#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ABHD16A	7920	genome.wustl.edu	37	6	31664812	31664812	+	Splice_Site	SNP	T	T	G			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr6:31664812T>G	ENST00000395952.3	-	5	506		c.e5-2		ABHD16A_ENST00000440843.2_Splice_Site|ABHD16A_ENST00000538874.1_Splice_Site|ABHD16A_ENST00000375842.4_Splice_Site|XXbac-BPG32J3.20_ENST00000461287.1_Splice_Site	NM_021160.2	NP_066983.1	O95870	ABHGA_HUMAN	abhydrolase domain containing 16A							integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)			endometrium(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)	10						GGCCAATGCCTGGTAGAAAAA	0.498																																																	0													102.0	99.0	100.0					6																	31664812		1509	2709	4218	SO:0001630	splice_region_variant	0			AF129756	CCDS4713.1, CCDS54988.1	6p21.3	2013-01-17	2010-12-09	2010-12-09	ENSG00000204427	ENSG00000204427		"""Abhydrolase domain containing"""	13921	protein-coding gene	gene with protein product		142620	"""HLA-B associated transcript 5"""	BAT5		2911734, 2813433	Standard	NM_021160		Approved	NG26, D6S82E	uc003nvy.2	O95870	OTTHUMG00000031177	ENST00000395952.3:c.344-2A>C	6.37:g.31664812T>G			A2BEY3|B7Z4R6|Q5SRR1|Q5SRR2|Q8WYH0|Q9NW33	Splice_Site	SNP	-	e5-2	ENST00000395952.3	37	c.344-2	CCDS4713.1	6	.	.	.	.	.	.	.	.	.	.	T	13.05	2.122390	0.37436	.	.	ENSG00000204427	ENST00000395952;ENST00000440843;ENST00000538874	.	.	.	5.78	5.78	0.91487	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.5045	0.55973	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	ABHD16A	31772791	1.000000	0.71417	0.997000	0.53966	0.366000	0.29705	5.942000	0.70203	2.212000	0.71576	0.260000	0.18958	.	ABHD16A	-	-	ENSG00000204427		0.498	ABHD16A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABHD16A	HGNC	protein_coding	OTTHUMT00000076342.4	-	0.00	79	0	T		Intron	31664812	-1	tier1	-	no_errors	ENST00000395952	ensembl	human	known	74_37	splice_site	44.00	70	55	SNP	0.980	G
ABHD17A	81926	genome.wustl.edu	37	19	1881527	1881527	+	Frame_Shift_Del	DEL	G	G	-	rs377128884		TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr19:1881527delG	ENST00000292577.7	-	2	472	c.39delC	c.(37-39)ttcfs	p.F13fs	ABHD17A_ENST00000250974.9_Frame_Shift_Del_p.F13fs|ABHD17A_ENST00000590661.1_Frame_Shift_Del_p.F13fs	NM_001130111.1	NP_001123583.1	Q96GS6	AB17A_HUMAN	abhydrolase domain containing 17A	13						extracellular region (GO:0005576)|membrane (GO:0016020)	hydrolase activity (GO:0016787)	p.F13delF(1)									GCGGGCAGCAGAAGAGGCAGC	0.756																																																	1	Deletion - In frame(1)	upper_aerodigestive_tract(1)											9.0	13.0	11.0					19																	1881527		2041	4133	6174	SO:0001589	frameshift_variant	0			BC020512	CCDS32867.1, CCDS45902.1	19p13.3	2013-03-15	2013-03-15	2013-03-15	ENSG00000129968	ENSG00000129968		"""Abhydrolase domain containing"""	28756	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 27"", ""family with sequence similarity 108, member A1"""	C19orf27, FAM108A1		14702039	Standard	NM_031213		Approved	MGC5244	uc002lug.3	Q96GS6	OTTHUMG00000171872	ENST00000292577.7:c.39delC	19.37:g.1881527delG	ENSP00000292577:p.Phe13fs		A8K0G8|D6W5Z9|Q6PJU2|Q8WUH9|Q9BWL0|Q9H7Q9	Frame_Shift_Del	DEL	pfam_Dienelactn_hydro	p.C14fs	ENST00000292577.7	37	c.39	CCDS45902.1	19																																																																																			ABHD17A	-	NULL	ENSG00000129968		0.756	ABHD17A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABHD17A	HGNC	protein_coding	OTTHUMT00000415556.2		0.00	20	0	G	NM_031213		1881527	-1			no_errors	ENST00000250974	ensembl	human	known	74_37	frame_shift_del	13.24	59	9	DEL	1.000	0
ABHD17A	81926	genome.wustl.edu	37	19	1881529	1881530	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	AG	AG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr19:1881529_1881530delAG	ENST00000292577.7	-	2	469_470	c.36_37delCT	c.(34-39)ctcttcfs	p.F13fs	ABHD17A_ENST00000250974.9_Frame_Shift_Del_p.F13fs|ABHD17A_ENST00000590661.1_Frame_Shift_Del_p.F13fs	NM_001130111.1	NP_001123583.1	Q96GS6	AB17A_HUMAN	abhydrolase domain containing 17A	13						extracellular region (GO:0005576)|membrane (GO:0016020)	hydrolase activity (GO:0016787)										GGGCAGCAGAAGAGGCAGCAGA	0.762																																																	0																																										SO:0001589	frameshift_variant	0			BC020512	CCDS32867.1, CCDS45902.1	19p13.3	2013-03-15	2013-03-15	2013-03-15	ENSG00000129968	ENSG00000129968		"""Abhydrolase domain containing"""	28756	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 27"", ""family with sequence similarity 108, member A1"""	C19orf27, FAM108A1		14702039	Standard	NM_031213		Approved	MGC5244	uc002lug.3	Q96GS6	OTTHUMG00000171872	ENST00000292577.7:c.36_37delCT	19.37:g.1881531_1881532delAG	ENSP00000292577:p.Phe13fs		A8K0G8|D6W5Z9|Q6PJU2|Q8WUH9|Q9BWL0|Q9H7Q9	Frame_Shift_Del	DEL	pfam_Dienelactn_hydro	p.F13fs	ENST00000292577.7	37	c.37_36	CCDS45902.1	19																																																																																			ABHD17A	-	NULL	ENSG00000129968		0.762	ABHD17A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABHD17A	HGNC	protein_coding	OTTHUMT00000415556.2		0.00	20	0	AG	NM_031213		1881530	-1			no_errors	ENST00000250974	ensembl	human	known	74_37	frame_shift_del	13.43	58	9	DEL	1.000:0.997	0
ABHD2	11057	genome.wustl.edu	37	15	89695080	89695080	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr15:89695080G>T	ENST00000352732.5	+	4	887	c.367G>T	c.(367-369)Gga>Tga	p.G123*	ABHD2_ENST00000355100.3_Nonsense_Mutation_p.G123*|ABHD2_ENST00000565973.1_Nonsense_Mutation_p.G123*	NM_152924.4	NP_690888.1	P08910	ABHD2_HUMAN	abhydrolase domain containing 2	123					negative regulation of cell migration (GO:0030336)|response to wounding (GO:0009611)	integral component of membrane (GO:0016021)	carboxylic ester hydrolase activity (GO:0052689)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|soft_tissue(1)	23	Lung NSC(78;0.0472)|all_lung(78;0.089)					GCACTGTGTTGGAGGTGAGCT	0.512																																					Colon(11;252 417 24570 33239 41878)												0													185.0	158.0	167.0					15																	89695080		2200	4299	6499	SO:0001587	stop_gained	0			X12433	CCDS10348.1	15q26.1	2006-10-06			ENSG00000140526	ENSG00000140526		"""Abhydrolase domain containing"""	18717	protein-coding gene	gene with protein product		612196					Standard	NM_152924		Approved	LABH2	uc002bnk.2	P08910	OTTHUMG00000148684	ENST00000352732.5:c.367G>T	15.37:g.89695080G>T	ENSP00000268129:p.Gly123*		Q53G48|Q53GU0|Q5FVD9|Q8TC79	Nonsense_Mutation	SNP	pfam_AB_hydrolase_1,pirsf_AB-Hydro_YheT	p.G123*	ENST00000352732.5	37	c.367	CCDS10348.1	15	.	.	.	.	.	.	.	.	.	.	G	39	7.757421	0.98474	.	.	ENSG00000140526	ENST00000352732;ENST00000355100	.	.	.	5.65	5.65	0.86999	.	0.055643	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15499	T	0.54	-1.1205	13.9406	0.64052	0.0723:0.0:0.9277:0.0	.	.	.	.	X	123	.	ENSP00000268129:G123X	G	+	1	0	ABHD2	87496084	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	5.061000	0.64319	2.648000	0.89879	0.655000	0.94253	GGA	ABHD2	-	pirsf_AB-Hydro_YheT	ENSG00000140526		0.512	ABHD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABHD2	HGNC	protein_coding	OTTHUMT00000309074.2		0.00	22	0	G			89695080	+1			no_errors	ENST00000352732	ensembl	human	known	74_37	nonsense	6.45	58	4	SNP	1.000	T
ADAM29	11086	genome.wustl.edu	37	4	175896998	175896998	+	Frame_Shift_Del	DEL	G	G	-			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr4:175896998delG	ENST00000359240.3	+	5	992	c.322delG	c.(322-324)gggfs	p.G108fs	ADAM29_ENST00000445694.1_Frame_Shift_Del_p.G108fs|ADAM29_ENST00000404450.4_Frame_Shift_Del_p.G108fs|ADAM29_ENST00000514159.1_Frame_Shift_Del_p.G108fs|RP13-577H12.2_ENST00000507525.1_RNA	NM_001278125.1|NM_014269.4	NP_001265054.1|NP_055084.3	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29	108					spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(25)|ovary(3)|pancreas(1)|prostate(7)|skin(24)|urinary_tract(2)	93		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		TTATGTGGAAGGGGACCCAGA	0.453																																					Ovarian(140;1727 1835 21805 25838 41440)												0													61.0	63.0	62.0					4																	175896998		2203	4300	6503	SO:0001589	frameshift_variant	0			AF171929	CCDS3823.1	4q34.1	2012-05-16	2005-08-18		ENSG00000168594	ENSG00000168594		"""ADAM metallopeptidase domain containing"""	207	protein-coding gene	gene with protein product	"""cancer/testis antigen 73"""	604778	"""a disintegrin and metalloproteinase domain 29"""			10644455	Standard	NM_014269		Approved	svph1, CT73	uc031shw.1	Q9UKF5	OTTHUMG00000160764	ENST00000359240.3:c.322delG	4.37:g.175896998delG	ENSP00000352177:p.Gly108fs		Q4W5F3|Q9UHP1|Q9UKF3|Q9UKF4	Frame_Shift_Del	DEL	pfam_Peptidase_M12B,pfam_ADAM_Cys-rich,pfam_Peptidase_M12B_N,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.D109fs	ENST00000359240.3	37	c.322	CCDS3823.1	4																																																																																			ADAM29	-	pfam_Peptidase_M12B_N	ENSG00000168594		0.453	ADAM29-201	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	ADAM29	HGNC	protein_coding			0.00	62	0	G			175896998	+1	tier1		no_errors	ENST00000359240	ensembl	human	known	74_37	frame_shift_del	35.71	45	25	DEL	1.000	-
ADAM29	11086	genome.wustl.edu	37	4	175897002	175897002	+	Missense_Mutation	SNP	A	A	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr4:175897002A>T	ENST00000359240.3	+	5	996	c.326A>T	c.(325-327)gAc>gTc	p.D109V	ADAM29_ENST00000445694.1_Missense_Mutation_p.D109V|ADAM29_ENST00000404450.4_Missense_Mutation_p.D109V|ADAM29_ENST00000514159.1_Missense_Mutation_p.D109V|RP13-577H12.2_ENST00000507525.1_RNA	NM_001278125.1|NM_014269.4	NP_001265054.1|NP_055084.3	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29	109					spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(25)|ovary(3)|pancreas(1)|prostate(7)|skin(24)|urinary_tract(2)	93		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		GTGGAAGGGGACCCAGAATCC	0.448																																					Ovarian(140;1727 1835 21805 25838 41440)												0													62.0	64.0	63.0					4																	175897002		2203	4300	6503	SO:0001583	missense	0			AF171929	CCDS3823.1	4q34.1	2012-05-16	2005-08-18		ENSG00000168594	ENSG00000168594		"""ADAM metallopeptidase domain containing"""	207	protein-coding gene	gene with protein product	"""cancer/testis antigen 73"""	604778	"""a disintegrin and metalloproteinase domain 29"""			10644455	Standard	NM_014269		Approved	svph1, CT73	uc031shw.1	Q9UKF5	OTTHUMG00000160764	ENST00000359240.3:c.326A>T	4.37:g.175897002A>T	ENSP00000352177:p.Asp109Val		Q4W5F3|Q9UHP1|Q9UKF3|Q9UKF4	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_ADAM_Cys-rich,pfam_Peptidase_M12B_N,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.D109V	ENST00000359240.3	37	c.326	CCDS3823.1	4	.	.	.	.	.	.	.	.	.	.	A	14.19	2.460599	0.43736	.	.	ENSG00000168594	ENST00000359240;ENST00000445694;ENST00000404450;ENST00000514159	T;T;T;T	0.06218	3.33;3.33;3.33;3.33	4.43	3.12	0.35913	Peptidase M12B, propeptide (1);	0.426339	0.16994	U	0.191167	T	0.07413	0.0187	N	0.04373	-0.215	0.41973	D	0.990762	D	0.89917	1.0	D	0.85130	0.997	T	0.49854	-0.8895	9	.	.	.	.	7.3834	0.26868	0.777:0.223:0.0:0.0	.	109	Q9UKF5	ADA29_HUMAN	V	109	ENSP00000352177:D109V;ENSP00000414544:D109V;ENSP00000384229:D109V;ENSP00000423517:D109V	.	D	+	2	0	ADAM29	176133577	0.000000	0.05858	0.973000	0.42090	0.927000	0.56198	0.095000	0.15127	1.936000	0.56123	0.519000	0.50382	GAC	ADAM29	-	pfam_Peptidase_M12B_N	ENSG00000168594		0.448	ADAM29-201	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	ADAM29	HGNC	protein_coding		-	0.00	61	0	A			175897002	+1	tier1	-	no_errors	ENST00000359240	ensembl	human	known	74_37	missense	36.76	43	25	SNP	0.981	T
ADAMTS12	81792	genome.wustl.edu	37	5	33561131	33561131	+	Splice_Site	SNP	C	C	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr5:33561131C>T	ENST00000504830.1	-	20	4461		c.e20+1		ADAMTS12_ENST00000352040.3_Splice_Site	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12						cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						TGATAAGTTACCTTGCTCCAG	0.483										HNSCC(64;0.19)																																							0													142.0	137.0	138.0					5																	33561131		2203	4300	6503	SO:0001630	splice_region_variant	0			AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.4125+1G>A	5.37:g.33561131C>T			A2RRN9|A5D6V6|Q6UWL3	Splice_Site	SNP	-	e20+1	ENST00000504830.1	37	c.4125+1	CCDS34140.1	5	.	.	.	.	.	.	.	.	.	.	C	28.5	4.923508	0.92319	.	.	ENSG00000151388	ENST00000504830;ENST00000352040	.	.	.	5.59	5.59	0.84812	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.1883	0.93653	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ADAMTS12	33596888	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	7.257000	0.78362	2.630000	0.89119	0.650000	0.86243	.	ADAMTS12	-	-	ENSG00000151388		0.483	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS12	HGNC	protein_coding	OTTHUMT00000367164.2	-	0.00	120	0	C	NM_030955	Intron	33561131	-1	tier1	-	no_errors	ENST00000504830	ensembl	human	known	74_37	splice_site	62.35	95	159	SNP	1.000	T
ADD2	119	genome.wustl.edu	37	2	70910897	70910897	+	Silent	SNP	C	C	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr2:70910897C>T	ENST00000264436.4	-	10	1395	c.951G>A	c.(949-951)gtG>gtA	p.V317V	ADD2_ENST00000407644.2_Silent_p.V317V|ADD2_ENST00000355733.3_Silent_p.V317V|ADD2_ENST00000413157.2_Silent_p.V317V|ADD2_ENST00000430656.1_Silent_p.V333V	NM_001617.3	NP_001608.1	P35612	ADDB_HUMAN	adducin 2 (beta)	317					actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|barbed-end actin filament capping (GO:0051016)|hemopoiesis (GO:0030097)|positive regulation of protein binding (GO:0032092)|protein complex assembly (GO:0006461)	cytoplasmic membrane-bounded vesicle (GO:0016023)|F-actin capping protein complex (GO:0008290)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|spectrin binding (GO:0030507)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(11)|lung(13)|ovary(3)|pancreas(1)|skin(2)	36						ACAGAGCCGACACCTGTAGCA	0.607																																																	0													28.0	29.0	29.0					2																	70910897		2203	4300	6503	SO:0001819	synonymous_variant	0			X58199	CCDS1906.1, CCDS1909.1, CCDS46318.1, CCDS54365.1	2p13.3	2008-02-05			ENSG00000075340	ENSG00000075340			244	protein-coding gene	gene with protein product		102681				1840603	Standard	NM_001617		Approved	ADDB	uc021vjc.1	P35612	OTTHUMG00000129710	ENST00000264436.4:c.951G>A	2.37:g.70910897C>T			A8K4P2|B4DM17|D6W5G7|D6W5G8|Q13482|Q16412|Q59G82|Q5U5P4|Q6P0P2|Q6PGQ4|Q7Z688|Q7Z689|Q7Z690|Q7Z691	Silent	SNP	pfam_Aldolase_II/adducin_N,superfamily_Aldolase_II/adducin_N	p.V317	ENST00000264436.4	37	c.951	CCDS1906.1	2																																																																																			ADD2	-	pfam_Aldolase_II/adducin_N,superfamily_Aldolase_II/adducin_N	ENSG00000075340		0.607	ADD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ADD2	HGNC	protein_coding	OTTHUMT00000251918.4	-	0.00	17	0	C	NM_001617		70910897	-1	tier1	-	no_errors	ENST00000264436	ensembl	human	known	74_37	silent	24.32	28	9	SNP	1.000	T
ADORA2A	135	genome.wustl.edu	37	22	24836725	24836725	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr22:24836725G>T	ENST00000337539.7	+	3	966	c.507G>T	c.(505-507)gaG>gaT	p.E169D	ADORA2A-AS1_ENST00000543438.1_RNA|ADORA2A-AS1_ENST00000427813.2_RNA|ADORA2A-AS1_ENST00000326341.4_RNA|SPECC1L-ADORA2A_ENST00000358654.2_3'UTR|ADORA2A_ENST00000496497.1_3'UTR	NM_000675.4|NM_001278497.1|NM_001278498.1|NM_001278499.1|NM_001278500.1	NP_000666.2|NP_001265426.1|NP_001265427.1|NP_001265428.1|NP_001265429.1	P29274	AA2AR_HUMAN	adenosine A2a receptor	169	Agonist binding.				activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|apoptotic process (GO:0006915)|blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cAMP biosynthetic process (GO:0006171)|cell-cell signaling (GO:0007267)|cellular defense response (GO:0006968)|central nervous system development (GO:0007417)|inflammatory response (GO:0006954)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phagocytosis (GO:0006909)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|sensory perception (GO:0007600)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|G-protein coupled adenosine receptor activity (GO:0001609)|identical protein binding (GO:0042802)			breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|liver(1)|lung(7)|skin(1)	21	Colorectal(2;0.196)				Adenosine(DB00640)|Caffeine(DB00201)|Defibrotide(DB04932)|Dyphylline(DB00651)|Enprofylline(DB00824)|Mefloquine(DB00358)|Oxtriphylline(DB01303)|Pentoxifylline(DB00806)|Regadenoson(DB06213)|Theobromine(DB01412)|Theophylline(DB00277)	GTCTCTTTGAGGATGTGGTCC	0.572																																																	0													208.0	193.0	198.0					22																	24836725		2203	4300	6503	SO:0001583	missense	0			X68486	CCDS13826.1	22q11.23	2012-08-08			ENSG00000128271	ENSG00000128271		"""GPCR / Class A : Adenosine receptors"""	263	protein-coding gene	gene with protein product		102776		ADORA2		1662665, 2541503	Standard	NM_001278497		Approved	RDC8	uc002zzy.4	P29274	OTTHUMG00000150761	ENST00000337539.7:c.507G>T	22.37:g.24836725G>T	ENSP00000336630:p.Glu169Asp		B2R7E0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Adeno_A2A_rcpt,prints_GPCR_Rhodpsn,prints_Adenosn_rcpt	p.E169D	ENST00000337539.7	37	c.507	CCDS13826.1	22	.	.	.	.	.	.	.	.	.	.	G	14.16	2.451977	0.43531	.	.	ENSG00000128271	ENST00000444262;ENST00000541988;ENST00000337539;ENST00000417596	T;T	0.37058	1.22;1.22	4.68	3.67	0.42095	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.47248	0.1435	L	0.53780	1.695	0.49483	D	0.999794	D	0.57571	0.98	P	0.57468	0.821	T	0.42310	-0.9459	10	0.46703	T	0.11	-31.1264	11.9795	0.53111	0.0848:0.0:0.9152:0.0	.	169	P29274	AA2AR_HUMAN	D	169	ENSP00000414802:E169D;ENSP00000336630:E169D	ENSP00000336630:E169D	E	+	3	2	ADORA2A	23166725	1.000000	0.71417	0.884000	0.34674	0.898000	0.52572	4.623000	0.61247	1.091000	0.41335	0.462000	0.41574	GAG	ADORA2A	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Adenosn_rcpt	ENSG00000128271		0.572	ADORA2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADORA2A	HGNC	protein_coding	OTTHUMT00000319971.2	-	0.00	35	0	G	NM_000675		24836725	+1	tier1	-	no_errors	ENST00000337539	ensembl	human	known	74_37	missense	5.26	72	4	SNP	1.000	T
AGPAT4	56895	genome.wustl.edu	37	6	161557631	161557631	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr6:161557631C>T	ENST00000320285.4	-	9	1290	c.1078G>A	c.(1078-1080)Gaa>Aaa	p.E360K	AGPAT4_ENST00000366911.5_3'UTR|AGPAT4_ENST00000457520.2_Missense_Mutation_p.E198K	NM_020133.2	NP_064518.1	Q9NRZ5	PLCD_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 4	360					CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)	p.E360K(1)		endometrium(1)|large_intestine(10)|lung(10)|ovary(2)|skin(2)	25		Breast(66;0.000289)|Ovarian(120;0.0266)|Prostate(117;0.0285)		OV - Ovarian serous cystadenocarcinoma(65;2.23e-17)|BRCA - Breast invasive adenocarcinoma(81;3.58e-05)		TTGTCAATTTCCGTCACACCA	0.537																																																	1	Substitution - Missense(1)	skin(1)											143.0	117.0	126.0					6																	161557631		2203	4300	6503	SO:0001583	missense	0			AF156776	CCDS5280.1	6q25.3	2013-02-05	2013-02-05		ENSG00000026652	ENSG00000026652	2.3.1.51	"""1-acylglycerol-3-phosphate O-acyltransferases"""	20885	protein-coding gene	gene with protein product	"""lysophosphatidic acid acyltransferase, delta"""	614795	"""1-acylglycerol-3-phosphate O-acyltransferase 4 (lysophosphatidic acid acyltransferase, delta)"""				Standard	XM_005267052		Approved	LPAAT-delta, dJ473J16.2	uc003qtr.1	Q9NRZ5	OTTHUMG00000015966	ENST00000320285.4:c.1078G>A	6.37:g.161557631C>T	ENSP00000314036:p.Glu360Lys		B4DSF9|Q5TEF0	Missense_Mutation	SNP	pfam_Plipid/glycerol_acylTrfase,smart_Plipid/glycerol_acylTrfase	p.E360K	ENST00000320285.4	37	c.1078	CCDS5280.1	6	.	.	.	.	.	.	.	.	.	.	C	26.8	4.776613	0.90195	.	.	ENSG00000026652	ENST00000320285;ENST00000457520	T	0.30182	1.54	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	T	0.37945	0.1022	L	0.38953	1.18	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.80764	0.994;0.994	T	0.02471	-1.1154	10	0.33141	T	0.24	-27.1734	18.9796	0.92751	0.0:1.0:0.0:0.0	rs34536691	198;360	B4DSF9;Q9NRZ5	.;PLCD_HUMAN	K	360;198	ENSP00000314036:E360K	ENSP00000314036:E360K	E	-	1	0	AGPAT4	161477621	1.000000	0.71417	0.733000	0.30861	0.888000	0.51559	6.489000	0.73641	2.723000	0.93209	0.655000	0.94253	GAA	AGPAT4	-	NULL	ENSG00000026652		0.537	AGPAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGPAT4	HGNC	protein_coding	OTTHUMT00000042983.1		0.00	30	0	C	NM_020133		161557631	-1			no_errors	ENST00000320285	ensembl	human	known	74_37	missense	7.14	26	2	SNP	0.181	T
AHCYL1	10768	genome.wustl.edu	37	1	110559031	110559031	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr1:110559031C>T	ENST00000369799.5	+	8	1215	c.848C>T	c.(847-849)aCc>aTc	p.T283I	AHCYL1_ENST00000393614.4_Missense_Mutation_p.T236I|AHCYL1_ENST00000359172.3_Missense_Mutation_p.T236I	NM_001242673.1|NM_001242674.1|NM_006621.5	NP_001229602.1|NP_001229603.1|NP_006612.2	O43865	SAHH2_HUMAN	adenosylhomocysteinase-like 1	283	NAD binding. {ECO:0000250}.				mRNA polyadenylation (GO:0006378)|one-carbon metabolic process (GO:0006730)|positive regulation of sodium ion transport (GO:0010765)|protein export from nucleus (GO:0006611)|regulation of anion transport (GO:0044070)|regulation of ion transmembrane transporter activity (GO:0032412)|regulation of mRNA 3'-end processing (GO:0031440)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)	adenosylhomocysteinase activity (GO:0004013)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)	18		all_epithelial(167;3.58e-05)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0259)|Colorectal(144;0.123)|all cancers(265;0.134)|Epithelial(280;0.141)|LUSC - Lung squamous cell carcinoma(189;0.143)		GATTCTGTTACCAAACAGAAG	0.418																																																	0													95.0	100.0	99.0					1																	110559031		2203	4300	6503	SO:0001583	missense	0			U82761	CCDS818.1, CCDS55620.1	1p13	2014-06-12	2009-06-12		ENSG00000168710	ENSG00000168710			344	protein-coding gene	gene with protein product	"""inositol 1,4,5-trisphosphate receptor-binding protein"", ""protein phosphatase 1, regulatory subunit 78"""	607826	"""S-adenosylhomocysteine hydrolase-like 1"""			11904675, 16754674, 12525476	Standard	NM_006621		Approved	XPVKONA, IRBIT, PPP1R78	uc001dyx.3	O43865	OTTHUMG00000011652	ENST00000369799.5:c.848C>T	1.37:g.110559031C>T	ENSP00000358814:p.Thr283Ile		B4E168|Q2TAJ6|Q502W8|Q5VSM0|Q6P171|Q96PK4|Q9UG84	Missense_Mutation	SNP	pfam_Adenosylhomocysteinase,pfam_Ado_hCys_hydrolase_NAD-bd,pfam_D-isomer_2_OHA_DH_NAD-bd,pfam_IlvN,pirsf_Adenosylhomocysteinase,tigrfam_Adenosylhomocysteinase	p.T283I	ENST00000369799.5	37	c.848	CCDS818.1	1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.564897	0.86439	.	.	ENSG00000168710	ENST00000369799;ENST00000359172;ENST00000393614	D;D;D	0.82255	-1.59;-1.59;-1.59	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	D	0.94466	0.8219	H	0.96996	3.92	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.95519	0.8593	10	0.87932	D	0	-21.8475	20.1649	0.98147	0.0:1.0:0.0:0.0	.	283	O43865	SAHH2_HUMAN	I	283;236;236	ENSP00000358814:T283I;ENSP00000352092:T236I;ENSP00000377238:T236I	ENSP00000352092:T236I	T	+	2	0	AHCYL1	110360554	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.753000	0.94483	0.655000	0.94253	ACC	AHCYL1	-	pfam_Adenosylhomocysteinase,pirsf_Adenosylhomocysteinase,tigrfam_Adenosylhomocysteinase	ENSG00000168710		0.418	AHCYL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AHCYL1	HGNC	protein_coding	OTTHUMT00000032243.1		0.00	35	0	C			110559031	+1			no_errors	ENST00000369799	ensembl	human	known	74_37	missense	8.00	46	4	SNP	1.000	T
ALMS1P	200420	genome.wustl.edu	37	2	73901066	73901066	+	RNA	SNP	G	G	A			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr2:73901066G>A	ENST00000450720.1	+	0	864					NR_003683.2		Q96L16	ALM1L_HUMAN	Alstrom syndrome 1 pseudogene						endosomal transport (GO:0016197)|regulation of stress fiber assembly (GO:0051492)												TGCGCTATTCGACATTGACAG	0.537																																																	0													78.0	69.0	72.0					2																	73901066		692	1591	2283			0			BC014492		2p13.2	2008-01-31	2008-01-31	2008-01-31	ENSG00000163016	ENSG00000163016			29586	pseudogene	pseudogene			"""Alstrom syndrome 1-like"""	ALMS1L		12477932	Standard	NR_003683		Approved		uc010yrl.2	Q96L16	OTTHUMG00000152773		2.37:g.73901066G>A				RNA	SNP	-	NULL	ENST00000450720.1	37	NULL		2																																																																																			ALMS1P	-	-	ENSG00000163016		0.537	ALMS1P-002	KNOWN	basic	processed_transcript	ALMS1P	HGNC	pseudogene	OTTHUMT00000339824.1	-	0.00	47	0	G	NR_003683		73901066	+1	tier1	-	no_errors	ENST00000450720	ensembl	human	known	74_37	rna	22.67	58	17	SNP	0.537	A
ALOX15B	247	genome.wustl.edu	37	17	7942529	7942529	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr17:7942529G>C	ENST00000380183.4	+	1	195	c.56G>C	c.(55-57)tGg>tCg	p.W19S	ALOX15B_ENST00000380173.2_Missense_Mutation_p.W19S|ALOX15B_ENST00000573359.1_Missense_Mutation_p.W19S|ALOX15B_ENST00000572022.1_Missense_Mutation_p.W19S	NM_001141.2	NP_001132.2	O15296	LX15B_HUMAN	arachidonate 15-lipoxygenase, type B	19	PLAT. {ECO:0000255|PROSITE- ProRule:PRU00152}.				apoptotic process (GO:0006915)|arachidonic acid metabolic process (GO:0019369)|hepoxilin biosynthetic process (GO:0051122)|linoleic acid metabolic process (GO:0043651)|lipid metabolic process (GO:0006629)|lipoxygenase pathway (GO:0019372)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of growth (GO:0045926)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|prostate gland development (GO:0030850)|regulation of epithelial cell differentiation (GO:0030856)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	arachidonate 15-lipoxygenase activity (GO:0050473)|arachidonate 8(S)-lipoxygenase activity (GO:0036403)|calcium ion binding (GO:0005509)|iron ion binding (GO:0005506)|linoleate 13S-lipoxygenase activity (GO:0016165)|lipid binding (GO:0008289)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	24						GCTGGCACATGGGACAAAGTG	0.647																																																	0													66.0	71.0	69.0					17																	7942529		2203	4300	6503	SO:0001583	missense	0			U78294	CCDS11128.1, CCDS32558.1, CCDS32559.1	17p13.1	2013-03-20	2006-01-16		ENSG00000179593	ENSG00000179593	1.13.11.33	"""Arachidonate lipoxygenases"""	434	protein-coding gene	gene with protein product		603697	"""arachidonate 15-lipoxygenase, second type"""			9177185	Standard	NM_001039130		Approved	15-LOX-2	uc002gju.3	O15296	OTTHUMG00000108181	ENST00000380183.4:c.56G>C	17.37:g.7942529G>C	ENSP00000369530:p.Trp19Ser		D3DTR2|Q8IYQ2|Q8TEV3|Q8TEV4|Q8TEV5|Q8TEV6|Q9UKM4	Missense_Mutation	SNP	pfam_LipOase_C,pfam_PLAT/LH2_dom,superfamily_LipOase_C,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,pfscan_PLAT/LH2_dom,prints_LipOase_mml,prints_LipOase_C	p.W19S	ENST00000380183.4	37	c.56	CCDS11128.1	17	.	.	.	.	.	.	.	.	.	.	G	6.174	0.400363	0.11696	.	.	ENSG00000179593	ENST00000380173;ENST00000339694;ENST00000380183	T;T	0.62232	0.04;0.04	4.09	3.03	0.35002	Lipoxygenase, LH2 (4);Lipase/lipooxygenase, PLAT/LH2 (1);	0.711084	0.13395	N	0.391066	T	0.53674	0.1811	L	0.45137	1.4	0.40724	D	0.982689	B;B;B;B	0.22414	0.069;0.056;0.056;0.069	B;B;B;B	0.30401	0.115;0.07;0.07;0.115	T	0.48502	-0.9030	10	0.22109	T	0.4	-15.1159	10.4172	0.44329	0.0:0.0:0.6608:0.3391	.	19;19;19;19	B4DNW8;O15296-2;O15296-4;O15296	.;.;.;LX15B_HUMAN	S	19	ENSP00000369520:W19S;ENSP00000369530:W19S	ENSP00000344337:W19S	W	+	2	0	ALOX15B	7883254	0.000000	0.05858	0.994000	0.49952	0.538000	0.34931	-0.611000	0.05622	1.963000	0.57068	0.585000	0.79938	TGG	ALOX15B	-	pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,pfscan_PLAT/LH2_dom,prints_LipOase_mml	ENSG00000179593		0.647	ALOX15B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALOX15B	HGNC	protein_coding	OTTHUMT00000226985.2	-	0.00	103	0	G			7942529	+1	tier1	-	no_errors	ENST00000380183	ensembl	human	known	74_37	missense	29.20	80	33	SNP	0.674	C
ANKRD24	170961	genome.wustl.edu	37	19	4217366	4217366	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr19:4217366C>T	ENST00000600132.1	+	18	2485	c.2209C>T	c.(2209-2211)Cgg>Tgg	p.R737W	ANKRD24_ENST00000262970.5_Missense_Mutation_p.R827W|ANKRD24_ENST00000318934.4_Missense_Mutation_p.R737W	NM_133475.1	NP_597732.1	Q8TF21	ANR24_HUMAN	ankyrin repeat domain 24	737										endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)	21				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0233)|STAD - Stomach adenocarcinoma(1328;0.181)		GGAGGCTCTCcggcagcggga	0.692																																																	0																																										SO:0001583	missense	0			AB075861	CCDS45925.1	19p13.3	2013-01-10				ENSG00000089847		"""Ankyrin repeat domain containing"""	29424	protein-coding gene	gene with protein product						11853319	Standard	NM_133475		Approved	KIAA1981	uc010dtt.1	Q8TF21		ENST00000600132.1:c.2209C>T	19.37:g.4217366C>T	ENSP00000471252:p.Arg737Trp		O75268|O95781	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.R737W	ENST00000600132.1	37	c.2209	CCDS45925.1	19	.	.	.	.	.	.	.	.	.	.	c	10.24	1.296239	0.23650	.	.	ENSG00000089847	ENST00000318934;ENST00000262970	T;T	0.52526	0.74;0.66	4.34	-2.95	0.05564	.	.	.	.	.	T	0.23965	0.0580	N	0.14661	0.345	0.09310	N	0.999997	B;B	0.28082	0.127;0.2	B;B	0.21917	0.014;0.037	T	0.16070	-1.0415	9	0.46703	T	0.11	-12.0171	5.1749	0.15129	0.3992:0.4406:0.0:0.1602	.	737;827	Q8TF21;Q8TF21-2	ANR24_HUMAN;.	W	737;827	ENSP00000321731:R737W;ENSP00000262970:R827W	ENSP00000262970:R827W	R	+	1	2	ANKRD24	4168366	0.000000	0.05858	0.009000	0.14445	0.514000	0.34195	-1.255000	0.02872	-0.202000	0.10268	0.462000	0.41574	CGG	ANKRD24	-	NULL	ENSG00000089847		0.692	ANKRD24-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	ANKRD24	HGNC	protein_coding	OTTHUMT00000458188.1	-	0.00	51	0	C	XM_114000		4217366	+1	tier1	-	no_errors	ENST00000318934	ensembl	human	known	74_37	missense	41.41	58	41	SNP	0.109	T
AOC3	8639	genome.wustl.edu	37	17	41003957	41003957	+	Silent	SNP	C	C	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr17:41003957C>T	ENST00000308423.2	+	1	757	c.597C>T	c.(595-597)tgC>tgT	p.C199C	AOC3_ENST00000591562.1_5'Flank	NM_003734.2	NP_003725.1	Q16853	AOC3_HUMAN	amine oxidase, copper containing 3	199					amine metabolic process (GO:0009308)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|cell adhesion (GO:0007155)|inflammatory response (GO:0006954)|response to antibiotic (GO:0046677)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	aliphatic-amine oxidase activity (GO:0052595)|aminoacetone:oxygen oxidoreductase(deaminating) activity (GO:0052594)|calcium ion binding (GO:0005509)|cation channel activity (GO:0005261)|copper ion binding (GO:0005507)|phenethylamine:oxygen oxidoreductase (deaminating) activity (GO:0052596)|primary amine oxidase activity (GO:0008131)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|quinone binding (GO:0048038)|tryptamine:oxygen oxidoreductase (deaminating) activity (GO:0052593)			breast(1)|central_nervous_system(4)|endometrium(4)|kidney(1)|large_intestine(8)|lung(14)|ovary(1)|skin(8)	41		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.156)	Hydralazine(DB01275)|Phenelzine(DB00780)	ACCACTGTTGCTTCTACAAGC	0.582																																					NSCLC(3;192 220 10664 11501 16477)												0													25.0	24.0	24.0					17																	41003957		2202	4298	6500	SO:0001819	synonymous_variant	0			AF067406	CCDS11444.1, CCDS62198.1, CCDS74071.1	17q21	2013-05-08	2013-05-08			ENSG00000131471	1.4.3.21		550	protein-coding gene	gene with protein product	"""vascular adhesion protein 1"""	603735				9653080, 8972912	Standard	NM_003734		Approved	VAP1, HPAO, VAP-1	uc002ibv.4	Q16853		ENST00000308423.2:c.597C>T	17.37:g.41003957C>T			B2RCI5|K7ESB3|L0L8N9|Q45F94	Silent	SNP	pfam_Cu_amine_oxidase_C,pfam_Cu_amine_oxidase_N2,pfam_Cu_amine_oxidase_N3,superfamily_Cu_amine_oxidase_C,superfamily_Cu_amine_oxidase_N-reg,prints_Cu_amine_oxidase	p.C199	ENST00000308423.2	37	c.597	CCDS11444.1	17																																																																																			AOC3	-	pfam_Cu_amine_oxidase_N3,superfamily_Cu_amine_oxidase_N-reg	ENSG00000131471		0.582	AOC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AOC3	HGNC	protein_coding	OTTHUMT00000452444.1	-	0.00	35	0	C	NM_003734		41003957	+1	tier1	-	no_errors	ENST00000308423	ensembl	human	known	74_37	silent	6.06	62	4	SNP	0.499	T
AOX1	316	genome.wustl.edu	37	2	201488706	201488706	+	Splice_Site	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr2:201488706G>T	ENST00000374700.2	+	19	2365	c.2124G>T	c.(2122-2124)gaG>gaT	p.E708D	AOX1_ENST00000485106.1_3'UTR	NM_001159.3	NP_001150.3	Q06278	AOXA_HUMAN	aldehyde oxidase 1	708					inflammatory response (GO:0006954)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|vitamin B6 metabolic process (GO:0042816)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	2 iron, 2 sulfur cluster binding (GO:0051537)|aldehyde oxidase activity (GO:0004031)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|NAD binding (GO:0051287)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)			breast(5)|endometrium(3)|kidney(4)|large_intestine(13)|lung(38)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	81					Allopurinol(DB00437)|Aminocaproic Acid(DB00513)|Brimonidine(DB00484)|Famciclovir(DB00426)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Pyrazinamide(DB00339)|Raloxifene(DB00481)|Zaleplon(DB00962)|Zonisamide(DB00909)	TAACAATTGAGGTAATGAGTT	0.458																																																	0													141.0	131.0	134.0					2																	201488706		2203	4300	6503	SO:0001630	splice_region_variant	0			AF017060	CCDS33360.1	2q33	2008-05-20			ENSG00000138356	ENSG00000138356			553	protein-coding gene	gene with protein product		602841				7570184	Standard	NM_001159		Approved	AO, AOH1	uc002uvx.3	Q06278	OTTHUMG00000154536	ENST00000374700.2:c.2124+1G>T	2.37:g.201488706G>T			O14765|Q53RR8|Q53TV3|Q9BYF0|Q9UPG6	Missense_Mutation	SNP	pfam_AldOxase/xan_DH_Mopterin-bd,pfam_Mopterin_DH_FAD-bd,pfam_Ald_Oxase/Xan_DH_a/b,pfam_2Fe-2S-bd,pfam_CO_DH_flav_C,pfam_2Fe-2S_ferredoxin-type,superfamily_AldOxase/xan_DH_Mopterin-bd,superfamily_FAD-bd_2,superfamily_Ald_Oxase/Xan_DH_a/b,superfamily_2Fe-2S-bd,superfamily_CO_DH_flav_C,superfamily_2Fe-2S_ferredoxin-type,pirsf_Ald_Oxase/xanthine_DH,pfscan_2Fe-2S_ferredoxin-type,tigrfam_Aldehyde_oxidase	p.E708D	ENST00000374700.2	37	c.2124	CCDS33360.1	2	.	.	.	.	.	.	.	.	.	.	G	18.36	3.605989	0.66445	.	.	ENSG00000138356	ENST00000374700	T	0.47869	0.83	5.21	5.21	0.72293	Aldehyde oxidase/xanthine dehydrogenase, molybdopterin binding (1);	0.148588	0.64402	D	0.000013	T	0.55721	0.1938	M	0.67517	2.055	0.58432	D	0.999999	B	0.32382	0.368	B	0.39119	0.291	T	0.59247	-0.7490	10	0.72032	D	0.01	-21.9059	19.314	0.94204	0.0:0.0:1.0:0.0	.	708	Q06278	ADO_HUMAN	D	708	ENSP00000363832:E708D	ENSP00000363832:E708D	E	+	3	2	AOX1	201196951	1.000000	0.71417	0.998000	0.56505	0.088000	0.18126	8.313000	0.89978	2.873000	0.98535	0.561000	0.74099	GAG	AOX1	-	superfamily_AldOxase/xan_DH_Mopterin-bd,pirsf_Ald_Oxase/xanthine_DH,tigrfam_Aldehyde_oxidase	ENSG00000138356		0.458	AOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AOX1	HGNC	protein_coding	OTTHUMT00000335844.1		0.00	26	0	G	NM_001159	Missense_Mutation	201488706	+1			no_errors	ENST00000374700	ensembl	human	known	74_37	missense	5.71	33	2	SNP	1.000	T
AP2A1	160	genome.wustl.edu	37	19	50302585	50302585	+	Splice_Site	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr19:50302585G>T	ENST00000359032.5	+	9	967	c.967G>T	c.(967-969)Gag>Tag	p.E323*	AP2A1_ENST00000354293.5_Splice_Site_p.E323*	NM_014203.2	NP_055018.2	O95782	AP2A1_HUMAN	adaptor-related protein complex 2, alpha 1 subunit	323					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Golgi to endosome transport (GO:0006895)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of hyaluronan biosynthetic process (GO:1900126)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	AP-2 adaptor complex (GO:0030122)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)	19		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.0023)|GBM - Glioblastoma multiforme(134;0.0157)		TGCTGGCAGTGAGCCCAACCT	0.637																																																	0													20.0	22.0	22.0					19																	50302585		2033	4170	6203	SO:0001630	splice_region_variant	0			AA993745	CCDS46148.1, CCDS46149.1	19q13.3	2008-05-23				ENSG00000196961			561	protein-coding gene	gene with protein product		601026		CLAPA1, ADTAA		2564002	Standard	NM_014203		Approved		uc002ppn.3	O95782		ENST00000359032.5:c.966-1G>T	19.37:g.50302585G>T			Q96CI7|Q96PP6|Q96PP7|Q9H070	Nonsense_Mutation	SNP	pfam_Clathrin/coatomer_adapt-like_N,pfam_Clathrin_a-adaptin_app_sub_C,pfam_Clathrin_a/b/g-adaptin_app_Ig,superfamily_ARM-type_fold,superfamily_Coatomer/calthrin_app_sub_C,superfamily_Coatomer/clathrin_app_Ig-like,smart_Clathrin_a/b/g-adaptin_app_Ig,pirsf_AP2_complex_asu	p.E323*	ENST00000359032.5	37	c.967	CCDS46148.1	19	.	.	.	.	.	.	.	.	.	.	G	38	7.205514	0.98136	.	.	ENSG00000196961	ENST00000354293;ENST00000359032	.	.	.	4.25	4.25	0.50352	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	15.5794	0.76422	0.0:0.0:1.0:0.0	.	.	.	.	X	323	.	ENSP00000346246:E323X	E	+	1	0	AP2A1	54994397	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	7.740000	0.84986	2.211000	0.71520	0.561000	0.74099	GAG	AP2A1	-	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_AP2_complex_asu	ENSG00000196961		0.637	AP2A1-008	NOVEL	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	AP2A1	HGNC	protein_coding	OTTHUMT00000465809.1		0.00	21	0	G		Nonsense_Mutation	50302585	+1			no_errors	ENST00000354293	ensembl	human	known	74_37	nonsense	6.25	30	2	SNP	1.000	T
APOB	338	genome.wustl.edu	37	2	21228972	21228972	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr2:21228972C>G	ENST00000233242.1	-	26	10895	c.10768G>C	c.(10768-10770)Gaa>Caa	p.E3590Q		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	3590					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGAGAGAGTTCCAGGGTGGCT	0.507																																																	0													86.0	78.0	81.0					2																	21228972		2203	4300	6503	SO:0001583	missense	0			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.10768G>C	2.37:g.21228972C>G	ENSP00000233242:p.Glu3590Gln		O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	pfam_Lipid_transpt_N,pfam_Vitellinogen_open_b-sht,pfam_ApoB100_C,pfam_Lipid_transpt_open_b-sht,superfamily_Lipid_transp_b-sht_shell,superfamily_Vitellinogen_superhlx,superfamily_ARM-type_fold,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	p.E3590Q	ENST00000233242.1	37	c.10768	CCDS1703.1	2	.	.	.	.	.	.	.	.	.	.	C	10.78	1.446882	0.25987	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.73469	-0.75	5.75	4.87	0.63330	.	0.097517	0.44097	D	0.000500	T	0.70996	0.3288	L	0.45581	1.43	0.45490	D	0.998456	B	0.21309	0.054	B	0.24269	0.052	T	0.68599	-0.5366	10	0.62326	D	0.03	.	16.9439	0.86225	0.0:0.8722:0.1278:0.0	.	3590	P04114	APOB_HUMAN	Q	3590	ENSP00000233242:E3590Q	ENSP00000233242:E3590Q	E	-	1	0	APOB	21082477	0.998000	0.40836	0.974000	0.42286	0.525000	0.34531	3.745000	0.55119	1.427000	0.47276	-0.150000	0.13652	GAA	APOB	-	NULL	ENSG00000084674		0.507	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOB	HGNC	protein_coding	OTTHUMT00000207571.1	-	0.00	46	0	C			21228972	-1	tier1	-	no_errors	ENST00000233242	ensembl	human	known	74_37	missense	27.66	68	26	SNP	0.263	G
ARID1B	57492	genome.wustl.edu	37	6	157517363	157517363	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr6:157517363G>T	ENST00000350026.5	+	15	3889	c.3888G>T	c.(3886-3888)atG>atT	p.M1296I	ARID1B_ENST00000275248.4_Missense_Mutation_p.M1291I|ARID1B_ENST00000367148.1_Missense_Mutation_p.M1349I|ARID1B_ENST00000346085.5_Missense_Mutation_p.M1309I	NM_017519.2	NP_059989.2	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	1296					chromatin-mediated maintenance of transcription (GO:0048096)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			NS(2)|breast(5)|central_nervous_system(4)|endometrium(12)|kidney(4)|large_intestine(11)|lung(30)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(3)	81		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		TGCAGGACATGTACAACCAAA	0.488																																																	0													158.0	152.0	154.0					6																	157517363		2203	4296	6499	SO:0001583	missense	0			AF521671	CCDS5251.1, CCDS5251.2, CCDS55072.1	6q25.3	2014-09-17			ENSG00000049618	ENSG00000049618		"""-"""	18040	protein-coding gene	gene with protein product		614556					Standard	NM_017519		Approved	KIAA1235, ELD/OSA1, p250R, BAF250b, DAN15, 6A3-5	uc003qqo.3	Q8NFD5	OTTHUMG00000015890	ENST00000350026.5:c.3888G>T	6.37:g.157517363G>T	ENSP00000055163:p.Met1296Ile		Q5JRD1|Q5VYC4|Q8IZY8|Q8TEV0|Q8TF02|Q99491|Q9ULI5	Missense_Mutation	SNP	pfam_DUF3518,pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,superfamily_ARM-type_fold,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.M1349I	ENST00000350026.5	37	c.4047	CCDS5251.2	6	.	.	.	.	.	.	.	.	.	.	G	11.48	1.651256	0.29336	.	.	ENSG00000049618	ENST00000346085;ENST00000350026;ENST00000367148;ENST00000275248;ENST00000414678	T;T;T;T;T	0.02140	4.77;4.75;4.76;4.76;4.43	5.54	4.67	0.58626	.	0.123784	0.64402	D	0.000001	T	0.00967	0.0032	L	0.43152	1.355	0.52501	D	0.999956	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.08055	0.001;0.003;0.003	T	0.49293	-0.8955	10	0.16896	T	0.51	.	11.5308	0.50610	0.1438:0.0:0.8562:0.0	.	1296;1309;1291	Q8NFD5;Q8NFD5-2;G3XAA0	ARI1B_HUMAN;.;.	I	1309;1296;1349;1291;818	ENSP00000344546:M1309I;ENSP00000055163:M1296I;ENSP00000356116:M1349I;ENSP00000275248:M1291I;ENSP00000412835:M818I	ENSP00000275248:M1291I	M	+	3	0	ARID1B	157559055	1.000000	0.71417	0.995000	0.50966	0.750000	0.42670	3.683000	0.54663	1.479000	0.48272	0.655000	0.94253	ATG	ARID1B	-	NULL	ENSG00000049618		0.488	ARID1B-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	ARID1B	HGNC	protein_coding	OTTHUMT00000372723.1		0.00	55	0	G	NM_020732		157517363	+1			no_errors	ENST00000367148	ensembl	human	known	74_37	missense	6.00	47	3	SNP	1.000	T
ARID1B	57492	genome.wustl.edu	37	6	157528625	157528625	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr6:157528625G>T	ENST00000350026.5	+	19	6312	c.6311G>T	c.(6310-6312)aGg>aTg	p.R2104M	ARID1B_ENST00000275248.4_Missense_Mutation_p.R2099M|ARID1B_ENST00000367148.1_Missense_Mutation_p.R2157M|ARID1B_ENST00000346085.5_Missense_Mutation_p.R2117M	NM_017519.2	NP_059989.2	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	2104					chromatin-mediated maintenance of transcription (GO:0048096)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			NS(2)|breast(5)|central_nervous_system(4)|endometrium(12)|kidney(4)|large_intestine(11)|lung(30)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(3)	81		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		ACATTAGTTAGGTACGTTGGG	0.488																																																	0													187.0	196.0	193.0					6																	157528625		2203	4296	6499	SO:0001583	missense	0			AF521671	CCDS5251.1, CCDS5251.2, CCDS55072.1	6q25.3	2014-09-17			ENSG00000049618	ENSG00000049618		"""-"""	18040	protein-coding gene	gene with protein product		614556					Standard	NM_017519		Approved	KIAA1235, ELD/OSA1, p250R, BAF250b, DAN15, 6A3-5	uc003qqo.3	Q8NFD5	OTTHUMG00000015890	ENST00000350026.5:c.6311G>T	6.37:g.157528625G>T	ENSP00000055163:p.Arg2104Met		Q5JRD1|Q5VYC4|Q8IZY8|Q8TEV0|Q8TF02|Q99491|Q9ULI5	Missense_Mutation	SNP	pfam_DUF3518,pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,superfamily_ARM-type_fold,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.R2157M	ENST00000350026.5	37	c.6470	CCDS5251.2	6	.	.	.	.	.	.	.	.	.	.	G	13.03	2.114255	0.37339	.	.	ENSG00000049618	ENST00000346085;ENST00000350026;ENST00000367148;ENST00000275248;ENST00000414678	T;T;T;T;T	0.38077	1.16;1.16;1.16;1.16;1.16	5.26	5.26	0.73747	Armadillo-like helical (1);	0.000000	0.85682	D	0.000000	T	0.59101	0.2169	M	0.81497	2.545	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.996;0.994;0.994	T	0.64441	-0.6407	10	0.87932	D	0	.	19.2386	0.93873	0.0:0.0:1.0:0.0	.	2104;2117;2099	Q8NFD5;Q8NFD5-2;G3XAA0	ARI1B_HUMAN;.;.	M	2117;2104;2157;2099;1626	ENSP00000344546:R2117M;ENSP00000055163:R2104M;ENSP00000356116:R2157M;ENSP00000275248:R2099M;ENSP00000412835:R1626M	ENSP00000275248:R2099M	R	+	2	0	ARID1B	157570317	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.812000	0.86109	2.607000	0.88179	0.655000	0.94253	AGG	ARID1B	-	pfam_DUF3518,superfamily_ARM-type_fold	ENSG00000049618		0.488	ARID1B-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	ARID1B	HGNC	protein_coding	OTTHUMT00000372723.1	-	0.00	53	0	G	NM_020732		157528625	+1	tier1	-	no_errors	ENST00000367148	ensembl	human	known	74_37	missense	7.46	62	5	SNP	1.000	T
ARID5A	10865	genome.wustl.edu	37	2	97217709	97217709	+	Missense_Mutation	SNP	G	G	A	rs150071690		TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr2:97217709G>A	ENST00000357485.3	+	7	1522	c.1444G>A	c.(1444-1446)Ggc>Agc	p.G482S	ARID5A_ENST00000454558.2_Missense_Mutation_p.G414S	NM_212481.1	NP_997646.1	Q03989	ARI5A_HUMAN	AT rich interactive domain 5A (MRF1-like)	482					chondrocyte differentiation (GO:0002062)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone acetylation (GO:0035066)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(2)|skin(1)|urinary_tract(2)	14						TGCAGGGTCCGGCCTGGTCTC	0.662																																																	0								G	SER/GLY	0,4400		0,0,2200	22.0	25.0	24.0		1444	1.2	0.0	2	dbSNP_134	24	1,8599	1.2+/-3.3	0,1,4299	no	missense	ARID5A	NM_212481.1	56	0,1,6499	AA,AG,GG		0.0116,0.0,0.0077	benign	482/595	97217709	1,12999	2200	4300	6500	SO:0001583	missense	0			M62324	CCDS33251.1	2p11.1	2013-02-07			ENSG00000196843	ENSG00000196843		"""-"""	17361	protein-coding gene	gene with protein product	"""modulator recognition factor 1"""	611583				8649988	Standard	NM_212481		Approved	MRF-1, RP11-363D14	uc002swe.3	Q03989	OTTHUMG00000155229	ENST00000357485.3:c.1444G>A	2.37:g.97217709G>A	ENSP00000350078:p.Gly482Ser		Q6NX37	Missense_Mutation	SNP	pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.G482S	ENST00000357485.3	37	c.1444	CCDS33251.1	2	.	.	.	.	.	.	.	.	.	.	G	13.86	2.361989	0.41902	0.0	1.16E-4	ENSG00000196843	ENST00000357485;ENST00000359765;ENST00000454558	T	0.69806	-0.43	5.31	1.25	0.21368	.	16.324600	0.00166	N	0.000000	T	0.60508	0.2274	M	0.62723	1.935	0.09310	N	1	B;B;B	0.30605	0.287;0.139;0.231	B;B;B	0.21151	0.033;0.015;0.015	T	0.42292	-0.9460	10	0.40728	T	0.16	-8.1764	3.9139	0.09214	0.2924:0.1798:0.5277:0.0	.	482;414;482	A6NM59;C9J1Q0;Q03989	.;.;ARI5A_HUMAN	S	482;482;414	ENSP00000350078:G482S	ENSP00000350078:G482S	G	+	1	0	ARID5A	96581436	0.018000	0.18449	0.001000	0.08648	0.185000	0.23345	0.831000	0.27476	0.726000	0.32339	0.650000	0.86243	GGC	ARID5A	-	NULL	ENSG00000196843		0.662	ARID5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARID5A	HGNC	protein_coding	OTTHUMT00000338888.2	-	0.00	35	0	G	NM_212481		97217709	+1	tier1	rs150071690	no_errors	ENST00000357485	ensembl	human	known	74_37	missense	8.93	101	10	SNP	0.001	A
ARNT2	9915	genome.wustl.edu	37	15	80767399	80767399	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr15:80767399G>T	ENST00000303329.4	+	5	622	c.457G>T	c.(457-459)Gtg>Ttg	p.V153L	ARNT2_ENST00000531595.3_3'UTR|ARNT2_ENST00000527771.1_Missense_Mutation_p.V142L|ARNT2_ENST00000533983.1_Missense_Mutation_p.V142L	NM_014862.3	NP_055677.3	Q9HBZ2	ARNT2_HUMAN	aryl-hydrocarbon receptor nuclear translocator 2	153	PAS 1. {ECO:0000255|PROSITE- ProRule:PRU00140}.				central nervous system development (GO:0007417)|in utero embryonic development (GO:0001701)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	aryl hydrocarbon receptor binding (GO:0017162)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			NS(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(16)|ovary(1)|pancreas(2)|prostate(2)|skin(1)	35			BRCA - Breast invasive adenocarcinoma(143;0.134)			TCTGTTTGTGGTGGCTGCTGA	0.473																																																	0													263.0	259.0	261.0					15																	80767399		2203	4300	6503	SO:0001583	missense	0			AB002305	CCDS32307.1	15q25.1	2013-05-21			ENSG00000172379	ENSG00000172379		"""Basic helix-loop-helix proteins"""	16876	protein-coding gene	gene with protein product		606036				11247670	Standard	NM_014862		Approved	KIAA0307, bHLHe1	uc002bfr.3	Q9HBZ2	OTTHUMG00000165478	ENST00000303329.4:c.457G>T	15.37:g.80767399G>T	ENSP00000307479:p.Val153Leu		B4DIS7|O15024|Q8IYC2	Missense_Mutation	SNP	pfam_PAS_fold_3,pfam_PAS_fold,pfam_bHLH_dom,superfamily_PAS,superfamily_bHLH_dom,smart_bHLH_dom,smart_PAS,smart_PAC,pfscan_PAS,pfscan_bHLH_dom,prints_Nuc_translocat,tigrfam_PAS	p.V153L	ENST00000303329.4	37	c.457	CCDS32307.1	15	.	.	.	.	.	.	.	.	.	.	G	26.6	4.751602	0.89753	.	.	ENSG00000172379	ENST00000360062;ENST00000303329;ENST00000540859	T	0.15603	2.41	4.65	4.65	0.58169	PAS (2);PAS fold (1);	0.000000	0.85682	D	0.000000	T	0.38427	0.1040	L	0.59967	1.855	0.80722	D	1	D;B	0.60575	0.988;0.256	D;B	0.72982	0.979;0.206	T	0.05989	-1.0852	10	0.38643	T	0.18	.	17.7295	0.88373	0.0:0.0:1.0:0.0	.	153;153	Q9HBZ2;Q86TN1	ARNT2_HUMAN;.	L	142;153;153	ENSP00000307479:V153L	ENSP00000307479:V153L	V	+	1	0	ARNT2	78554454	1.000000	0.71417	0.895000	0.35142	0.820000	0.46376	8.792000	0.91856	2.404000	0.81709	0.549000	0.68633	GTG	ARNT2	-	pfam_PAS_fold,superfamily_PAS,smart_PAS,pfscan_PAS,prints_Nuc_translocat	ENSG00000172379		0.473	ARNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARNT2	HGNC	protein_coding	OTTHUMT00000384389.2	-	0.00	45	0	G			80767399	+1	tier1	-	no_errors	ENST00000303329	ensembl	human	known	74_37	missense	5.71	66	4	SNP	1.000	T
ASAH2C	653365	genome.wustl.edu	37	10	48029278	48029278	+	Missense_Mutation	SNP	C	C	T	rs587604300		TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr10:48029278C>T	ENST00000426610.2	-	6	607	c.608G>A	c.(607-609)cGt>cAt	p.R203H				P0C7U2	ASA2C_HUMAN	N-acylsphingosine amidohydrolase (non-lysosomal ceramidase) 2C	203					sphingolipid metabolic process (GO:0006665)		ceramidase activity (GO:0017040)			lung(3)	3						GTTGATGCAACGTGGTCCAAG	0.448													C|||	1	0.000199681	0.0	0.0	5008	,	,		6131	0.0		0.001	False		,,,				2504	0.0																0																																										SO:0001583	missense	0					10q11.22	2013-01-14			ENSG00000072444				23457	other	unknown						17334805	Standard			Approved	bA98I6.3		P0C7U2	OTTHUMG00000018134	ENST00000426610.2:c.608G>A	10.37:g.48029278C>T	ENSP00000399947:p.Arg203His			Missense_Mutation	SNP	pfam_Ceramidase_alk	p.R203H	ENST00000426610.2	37	c.608		10	.	.	.	.	.	.	.	.	.	.	C	3.648	-0.072122	0.07228	.	.	ENSG00000072444	ENST00000420079;ENST00000426610	T	0.41758	0.99	2.57	1.41	0.22369	.	.	.	.	.	T	0.21347	0.0514	.	.	.	0.21256	N	0.999746	.	.	.	.	.	.	T	0.24012	-1.0172	6	0.14252	T	0.57	.	4.4067	0.11413	0.0:0.3206:0.0:0.6794	.	.	.	.	H	191;203	ENSP00000399947:R203H	ENSP00000392320:R191H	R	-	2	0	ASAH2C	47549284	0.000000	0.05858	0.965000	0.40720	0.912000	0.54170	-0.036000	0.12185	0.409000	0.25649	-0.497000	0.04613	CGT	ASAH2C	-	pfam_Ceramidase_alk	ENSG00000072444		0.448	ASAH2C-201	KNOWN	basic|appris_principal	protein_coding	ASAH2C	HGNC	protein_coding		-	0.00	42	0	C	NG_012763		48029278	-1	tier1	-	no_errors	ENST00000426610	ensembl	human	known	74_37	missense	38.89	44	28	SNP	0.795	T
ASAH2	56624	genome.wustl.edu	37	10	51974561	51974561	+	Missense_Mutation	SNP	C	C	T	rs549196716		TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr10:51974561C>T	ENST00000395526.4	-	8	1081	c.1082G>A	c.(1081-1083)cGt>cAt	p.R361H	ASAH2_ENST00000447815.1_Missense_Mutation_p.R361H|ASAH2_ENST00000443575.1_Missense_Mutation_p.R203H|ASAH2_ENST00000329428.6_Missense_Mutation_p.R342H	NM_019893.2	NP_063946.2	Q9NR71	ASAH2_HUMAN	N-acylsphingosine amidohydrolase (non-lysosomal ceramidase) 2	361					apoptotic process (GO:0006915)|ceramide metabolic process (GO:0006672)|glycosphingolipid metabolic process (GO:0006687)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	ceramidase activity (GO:0017040)	p.R342H(1)|p.R361H(1)		large_intestine(1)|lung(9)|urinary_tract(1)	11						GTTGATGCAACGTGGTCCAAG	0.448													C|||	1	0.000199681	0.0	0.0	5008	,	,		12025	0.0		0.001	False		,,,				2504	0.0																2	Substitution - Missense(2)	urinary_tract(2)											64.0	40.0	48.0					10																	51974561		2202	4293	6495	SO:0001583	missense	0			AF250847	CCDS7239.2, CCDS44398.1	10q11.23	2008-08-11			ENSG00000188611	ENSG00000188611			18860	protein-coding gene	gene with protein product		611202				10781606	Standard	NM_019893		Approved		uc001jjd.3	Q9NR71	OTTHUMG00000018223	ENST00000395526.4:c.1082G>A	10.37:g.51974561C>T	ENSP00000378897:p.Arg361His		Q3KNU1|Q5SNT7|Q5SZP6|Q5SZP7|Q5T1D5|Q71ME6	Missense_Mutation	SNP	pfam_Ceramidase_alk	p.R361H	ENST00000395526.4	37	c.1082	CCDS7239.2	10	.	.	.	.	.	.	.	.	.	.	C	6.257	0.415597	0.11870	.	.	ENSG00000188611	ENST00000395526;ENST00000447815;ENST00000443575;ENST00000329428	T;T;T;T	0.41758	0.99;0.99;0.99;0.99	5.26	-2.01	0.07410	.	0.739215	0.13790	N	0.362544	T	0.11922	0.0290	N	0.00879	-1.12	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.0	T	0.36261	-0.9755	10	0.14252	T	0.57	.	9.5371	0.39229	0.0:0.4674:0.0:0.5326	.	361;361	Q9NR71-2;Q9NR71	.;ASAH2_HUMAN	H	361;361;203;342	ENSP00000378897:R361H;ENSP00000388206:R361H;ENSP00000392766:R203H;ENSP00000329886:R342H	ENSP00000329886:R342H	R	-	2	0	ASAH2	51644567	0.000000	0.05858	0.051000	0.19133	0.884000	0.51177	-0.097000	0.11042	-0.315000	0.08703	-1.006000	0.02489	CGT	ASAH2	-	pfam_Ceramidase_alk	ENSG00000188611		0.448	ASAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASAH2	HGNC	protein_coding	OTTHUMT00000048061.3	-	0.00	106	0	C	NM_019893		51974561	-1	tier1	-	no_errors	ENST00000395526	ensembl	human	known	74_37	missense	34.11	85	44	SNP	0.058	T
BCL2A1	597	genome.wustl.edu	37	15	80263190	80263190	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr15:80263190G>C	ENST00000267953.3	-	1	598	c.272C>G	c.(271-273)aCc>aGc	p.T91S	BCL2A1_ENST00000335661.6_Missense_Mutation_p.T91S	NM_004049.3	NP_004040.1	Q16548	B2LA1_HUMAN	BCL2-related protein A1	91					extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of apoptotic process (GO:0043066)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)	mitochondrial outer membrane (GO:0005741)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			endometrium(1)|kidney(2)|large_intestine(4)|lung(3)|pancreas(1)|upper_aerodigestive_tract(1)	12						TGCAAATATGGTTACAATTCT	0.398																																																	0													204.0	195.0	198.0					15																	80263190		2203	4300	6503	SO:0001583	missense	0				CCDS10312.1, CCDS45322.1	15q24.3	2014-05-20			ENSG00000140379	ENSG00000140379			991	protein-coding gene	gene with protein product		601056		HBPA1		8589678, 12771180	Standard	NM_004049		Approved	GRS, BFL1, BCL2L5, ACC-1, ACC-2	uc002bfc.4	Q16548	OTTHUMG00000144173	ENST00000267953.3:c.272C>G	15.37:g.80263190G>C	ENSP00000267953:p.Thr91Ser		Q6FGZ4|Q6FH19|Q86W13|Q99524	Missense_Mutation	SNP	pfam_Blc2_fam,pfscan_Bcl2-like,prints_Bcl2A1,prints_Blc2_fam	p.T91S	ENST00000267953.3	37	c.272	CCDS10312.1	15	.	.	.	.	.	.	.	.	.	.	G	15.72	2.916475	0.52546	.	.	ENSG00000140379	ENST00000267953;ENST00000335661	T;T	0.16597	2.33;2.33	5.63	5.63	0.86233	Apoptosis regulator, Bcl2-like (1);Apoptosis regulator, Bcl-2, BH (3);Apoptosis regulator, Bcl-2, BH1 motif, conserved site (1);	0.000000	0.64402	D	0.000002	T	0.37237	0.0996	L	0.46614	1.455	0.50171	D	0.999852	D;D	0.76494	0.999;0.999	D;D	0.83275	0.994;0.996	T	0.01748	-1.1282	10	0.51188	T	0.08	-16.052	17.8901	0.88869	0.0:0.0:1.0:0.0	.	91;91	Q86W13;Q16548	.;B2LA1_HUMAN	S	91	ENSP00000267953:T91S;ENSP00000335250:T91S	ENSP00000267953:T91S	T	-	2	0	BCL2A1	78050245	1.000000	0.71417	0.940000	0.37924	0.060000	0.15804	5.228000	0.65310	2.652000	0.90054	0.655000	0.94253	ACC	BCL2A1	-	pfam_Blc2_fam,pfscan_Bcl2-like,prints_Bcl2A1,prints_Blc2_fam	ENSG00000140379		0.398	BCL2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCL2A1	HGNC	protein_coding	OTTHUMT00000291372.1	-	0.00	49	0	G	NM_004049		80263190	-1	tier1	-	no_errors	ENST00000267953	ensembl	human	known	74_37	missense	26.47	50	18	SNP	1.000	C
BEST3	144453	genome.wustl.edu	37	12	70049532	70049532	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr12:70049532G>A	ENST00000330891.5	-	10	1388	c.1162C>T	c.(1162-1164)Cgg>Tgg	p.R388W	BEST3_ENST00000488961.1_Missense_Mutation_p.R175W|BEST3_ENST00000331471.4_Intron|BEST3_ENST00000553096.1_Missense_Mutation_p.R282W	NM_001282613.1|NM_032735.2	NP_001269542.1|NP_116124.2	Q8N1M1	BEST3_HUMAN	bestrophin 3	388					negative regulation of ion transport (GO:0043271)	chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)			cervix(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|skin(2)	12	Breast(13;2.31e-06)|Esophageal squamous(21;0.187)		Lung(24;0.000278)|OV - Ovarian serous cystadenocarcinoma(12;0.0019)|STAD - Stomach adenocarcinoma(21;0.00694)			ATGGAATGCCGATGGCCATGC	0.537																																																	0													97.0	102.0	101.0					12																	70049532		2093	4226	6319	SO:0001583	missense	0			AF440758	CCDS8992.2, CCDS41810.1, CCDS61192.1, CCDS61193.1, CCDS73496.1	12q14.2-q15	2012-09-26	2006-10-18	2006-10-18	ENSG00000127325	ENSG00000127325		"""Ion channels / Chloride channels : Calcium activated : Bestrophins"""	17105	protein-coding gene	gene with protein product		607337	"""vitelliform macular dystrophy 2-like 3"""	VMD2L3		12032738	Standard	NM_032735		Approved	MGC40411, MGC13168	uc001svg.3	Q8N1M1	OTTHUMG00000149919	ENST00000330891.5:c.1162C>T	12.37:g.70049532G>A	ENSP00000332413:p.Arg388Trp		B5MDI8|F8VVZ2|Q53YQ7|Q8N356|Q8NFT9|Q9BR80	Missense_Mutation	SNP	pfam_Bestrophin/UPF0187	p.R388W	ENST00000330891.5	37	c.1162	CCDS8992.2	12	.	.	.	.	.	.	.	.	.	.	G	13.59	2.281498	0.40394	.	.	ENSG00000127325	ENST00000488961;ENST00000330891;ENST00000553096	D;D;D	0.98178	-4.41;-4.77;-4.73	5.63	4.7	0.59300	.	0.416527	0.24523	N	0.037786	D	0.98403	0.9469	M	0.68317	2.08	0.43930	D	0.996581	D;D	0.89917	1.0;1.0	D;D	0.64595	0.913;0.927	D	0.98310	1.0523	10	0.56958	D	0.05	-14.9986	13.9259	0.63961	0.0:0.0:0.8484:0.1516	.	388;175	Q8N1M1;B5MDI8	BEST3_HUMAN;.	W	175;388;282	ENSP00000433213:R175W;ENSP00000332413:R388W;ENSP00000449548:R282W	ENSP00000332413:R388W	R	-	1	2	BEST3	68335799	0.852000	0.29690	0.050000	0.19076	0.007000	0.05969	3.347000	0.52200	2.636000	0.89361	0.655000	0.94253	CGG	BEST3	-	NULL	ENSG00000127325		0.537	BEST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BEST3	HGNC	protein_coding	OTTHUMT00000313908.2		0.00	28	0	G	NM_152439		70049532	-1			no_errors	ENST00000330891	ensembl	human	known	74_37	missense	8.33	33	3	SNP	0.072	A
BHLHE22	27319	genome.wustl.edu	37	8	65494014	65494014	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr8:65494014A>G	ENST00000321870.1	+	1	1201	c.667A>G	c.(667-669)Agc>Ggc	p.S223G	RP11-21C4.1_ENST00000517909.1_RNA	NM_152414.4	NP_689627.1	Q8NFJ8	BHE22_HUMAN	basic helix-loop-helix family, member e22	223	Gly-rich.|Ser-rich.				anterior commissure morphogenesis (GO:0021960)|cerebral cortex regionalization (GO:0021796)|corpus callosum morphogenesis (GO:0021540)|corticospinal tract morphogenesis (GO:0021957)|negative regulation of transcription, DNA-templated (GO:0045892)|retinal bipolar neuron differentiation (GO:0060040)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.G225_S226insG(1)		NS(1)|central_nervous_system(1)|lung(1)|prostate(1)|skin(1)	5						cggtagcggcagcggcggcag	0.721																																					Colon(113;104 1586 2865 9855 18065)												1	Insertion - In frame(1)	prostate(1)											3.0	5.0	4.0					8																	65494014		1186	2585	3771	SO:0001583	missense	0			U80755	CCDS6179.1	8q12.1	2009-01-12	2009-01-12	2009-01-12		ENSG00000180828		"""Basic helix-loop-helix proteins"""	11963	protein-coding gene	gene with protein product		613483	"""trinucleotide repeat containing 20"", ""basic helix-loop-helix domain containing, class B, 5"""	TNRC20, BHLHB5		9225980, 12213201, 18557763	Standard	NM_152414		Approved	CAGL85, Beta3, bHLHe22	uc003xvi.3	Q8NFJ8		ENST00000321870.1:c.667A>G	8.37:g.65494014A>G	ENSP00000318799:p.Ser223Gly			Missense_Mutation	SNP	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.S223G	ENST00000321870.1	37	c.667	CCDS6179.1	8	.	.	.	.	.	.	.	.	.	.	A	0.001	-3.589800	0.00008	.	.	ENSG00000180828	ENST00000321870	T	0.76578	-1.03	1.69	-0.386	0.12466	.	.	.	.	.	T	0.50599	0.1625	N	0.08118	0	0.19300	N	0.999975	B	0.02656	0.0	B	0.01281	0.0	T	0.31916	-0.9926	9	0.11485	T	0.65	.	4.741	0.13012	0.2561:0.1785:0.5654:0.0	.	223	Q8NFJ8	BHE22_HUMAN	G	223	ENSP00000318799:S223G	ENSP00000318799:S223G	S	+	1	0	BHLHE22	65656568	0.000000	0.05858	0.503000	0.27626	0.026000	0.11368	-0.378000	0.07446	-0.113000	0.11958	-1.120000	0.02017	AGC	BHLHE22	-	NULL	ENSG00000180828		0.721	BHLHE22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BHLHE22	HGNC	protein_coding	OTTHUMT00000378549.1		0.00	10	0	A	NM_152414		65494014	+1			no_errors	ENST00000321870	ensembl	human	known	74_37	missense	11.76	30	4	SNP	0.985	G
BRINP3	339479	genome.wustl.edu	37	1	190423839	190423839	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr1:190423839G>A	ENST00000367462.3	-	2	413	c.182C>T	c.(181-183)aCa>aTa	p.T61I	BRINP3_ENST00000534846.1_Nonsense_Mutation_p.Q23*	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	61					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)											CACAAAATCTGTGTATTCCTG	0.473																																																	0													91.0	89.0	90.0					1																	190423839		2203	4300	6503	SO:0001583	missense	0			AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.182C>T	1.37:g.190423839G>A	ENSP00000356432:p.Thr61Ile		B3KVP1|B7Z260|O95726|Q2M330	Nonsense_Mutation	SNP	smart_MACPF	p.Q23*	ENST00000367462.3	37	c.67	CCDS1373.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	38|38	6.811843|6.811843	0.97857|0.97857	.|.	.|.	ENSG00000162670|ENSG00000162670	ENST00000534846|ENST00000367462;ENST00000445957	.|D;T	.|0.84660	.|-1.88;0.9	5.42|5.42	5.42|5.42	0.78866|0.78866	.|Membrane attack complex component/perforin (MACPF) domain (1);	.|0.062767	.|0.64402	.|D	.|0.000005	.|T	.|0.78898	.|0.4356	L|L	0.31926|0.31926	0.97|0.97	0.80722|0.80722	A|A	1|1	.|B	.|0.02656	.|0.0	.|B	.|0.06405	.|0.002	.|T	.|0.75673	.|-0.3236	.|9	0.51188|0.24483	T|T	0.08|0.36	.|.	16.7242|16.7242	0.85417|0.85417	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|61	.|Q76B58	.|FAM5C_HUMAN	X|I	23|61	.|ENSP00000356432:T61I;ENSP00000393441:T61I	ENSP00000438022:Q23X|ENSP00000356432:T61I	Q|T	-|-	1|2	0|0	FAM5C|FAM5C	188690462|188690462	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	6.052000|6.052000	0.71080|0.71080	2.540000|2.540000	0.85666|0.85666	0.655000|0.655000	0.94253|0.94253	CAG|ACA	BRINP3	-	smart_MACPF	ENSG00000162670		0.473	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRINP3	HGNC	protein_coding	OTTHUMT00000086278.1	-	0.00	42	0	G	NM_199051		190423839	-1	tier1	-	no_errors	ENST00000534846	ensembl	human	known	74_37	nonsense	6.90	54	4	SNP	1.000	A
BTN2A2	10385	genome.wustl.edu	37	6	26392963	26392963	+	Missense_Mutation	SNP	G	G	A	rs200888343		TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr6:26392963G>A	ENST00000356709.4	+	8	1451	c.1340G>A	c.(1339-1341)gGc>gAc	p.G447D	BTN2A2_ENST00000482536.1_Missense_Mutation_p.G237D|BTN2A2_ENST00000416795.2_Missense_Mutation_p.G447D|BTN2A2_ENST00000432533.2_3'UTR|BTN2A2_ENST00000352867.2_Missense_Mutation_p.G331D|BTN2A2_ENST00000469230.1_Intron	NM_001197240.1|NM_006995.4	NP_001184169.1|NP_008926.2	Q8WVV5	BT2A2_HUMAN	butyrophilin, subfamily 2, member A2	447	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of cellular metabolic process (GO:0031324)|negative regulation of cytokine secretion (GO:0050710)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(2)|endometrium(3)|large_intestine(5)|lung(13)	23						TGCCGGGTGGGCGTCTTCCTG	0.542																																																	0													104.0	97.0	99.0					6																	26392963		2203	4300	6503	SO:0001583	missense	0			U90550	CCDS4606.1, CCDS4607.1, CCDS56401.1, CCDS56402.1, CCDS56403.1	6p22.1	2014-01-14			ENSG00000124508	ENSG00000124508		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1137	protein-coding gene	gene with protein product		613591				10354554, 9149941	Standard	NM_006995		Approved	BTF2, BT2.2, BTN2.2	uc003nhq.3	Q8WVV5	OTTHUMG00000014452	ENST00000356709.4:c.1340G>A	6.37:g.26392963G>A	ENSP00000349143:p.Gly447Asp		A6NM84|B4DE97|B4DQ01|E9PH07|O00480	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Ig_V-set,pfam_CD80_C2-set,superfamily_ConA-like_lec_gl_sf,smart_Ig_sub,smart_Ig_V-set_subgr,smart_PRY,smart_SPla/RYanodine_receptor_subgr,prints_Butyrophylin,pfscan_B30.2/SPRY,pfscan_Ig-like_dom	p.G447D	ENST00000356709.4	37	c.1340	CCDS4606.1	6	.	.	.	.	.	.	.	.	.	.	.	13.36	2.213226	0.39102	.	.	ENSG00000124508	ENST00000356709;ENST00000352867;ENST00000482536;ENST00000416795	D;D;D;D	0.82893	-1.66;-1.66;-1.66;-1.66	3.78	1.36	0.22044	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.558553	0.16195	N	0.225198	D	0.91257	0.7244	H	0.97051	3.93	0.32856	D	0.507257	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.973;0.994;0.998	D	0.89600	0.3834	10	0.87932	D	0	.	11.3479	0.49571	0.0:0.6204:0.3796:0.0	.	237;331;447	E9PH07;A6NM84;Q8WVV5	.;.;BT2A2_HUMAN	D	447;331;237;447	ENSP00000349143:G447D;ENSP00000337117:G331D;ENSP00000419451:G237D;ENSP00000399308:G447D	ENSP00000337117:G331D	G	+	2	0	BTN2A2	26500942	0.661000	0.27430	0.012000	0.15200	0.140000	0.21249	3.336000	0.52113	-0.084000	0.12595	0.454000	0.30748	GGC	BTN2A2	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,prints_Butyrophylin,pfscan_B30.2/SPRY	ENSG00000124508		0.542	BTN2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTN2A2	HGNC	protein_coding	OTTHUMT00000040117.1		0.00	71	0	G			26392963	+1			no_errors	ENST00000356709	ensembl	human	known	74_37	missense	6.06	62	4	SNP	0.897	A
C10orf2	56652	genome.wustl.edu	37	10	102753223	102753224	+	Frame_Shift_Ins	INS	-	-	C			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr10:102753223_102753224insC	ENST00000311916.2	+	5	2196_2197	c.2011_2012insC	c.(2011-2013)gccfs	p.A671fs	C10orf2_ENST00000473656.1_3'UTR|C10orf2_ENST00000370228.1_3'UTR	NM_001163813.1|NM_021830.4	NP_001157285.1|NP_068602.2	Q96RR1	PEO1_HUMAN	chromosome 10 open reading frame 2	671					cell death (GO:0008219)|DNA unwinding involved in DNA replication (GO:0006268)|mitochondrial DNA replication (GO:0006264)|protein hexamerization (GO:0034214)|protein homooligomerization (GO:0051260)|transcription from mitochondrial promoter (GO:0006390)	mitochondrial nucleoid (GO:0042645)	5'-3' DNA helicase activity (GO:0043139)|ATP binding (GO:0005524)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|skin(1)|stomach(1)	24		Colorectal(252;0.122)|all_hematologic(284;0.152)		Epithelial(162;7.18e-11)|all cancers(201;8.75e-09)|BRCA - Breast invasive adenocarcinoma(275;0.224)		CTCAGGCCAGGCCCCCACTCCC	0.54																																																	0																																										SO:0001589	frameshift_variant	0			AF292004	CCDS7506.1, CCDS53570.1	10q24	2013-05-13			ENSG00000107815	ENSG00000107815			1160	protein-coding gene	gene with protein product	"""twinkle"", ""T7 helicase-related protein with intramitochondrial nucleoid localization"""	606075	"""infantile onset spinocerebellar ataxia (autosomal recessive)"""	IOSCA		11431692, 10645945, 16135556	Standard	NM_021830		Approved	PEO, PEO1, TWINKLE, FLJ21832, TWINL	uc001ksf.2	Q96RR1	OTTHUMG00000018917	ENST00000311916.2:c.2016dupC	10.37:g.102753228_102753228dupC	ENSP00000309595:p.Ala671fs		B2CQL2|Q6MZX2|Q6PJP5|Q96RR0	Frame_Shift_Ins	INS	pfam_Circ_KaiC/RadA,pfam_DNA_helicase_DnaB-like_C,superfamily_P-loop_NTPase,pfscan_DNA_helicase_DnaB-like_C	p.T673fs	ENST00000311916.2	37	c.2011_2012	CCDS7506.1	10																																																																																			C10orf2	-	NULL	ENSG00000107815		0.540	C10orf2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf2	HGNC	protein_coding	OTTHUMT00000049886.1		0.00	44	0	-	NM_021830		102753224	+1	tier1		no_errors	ENST00000311916	ensembl	human	known	74_37	frame_shift_ins	21.62	29	8	INS	0.001:0.000	C
C19orf44	84167	genome.wustl.edu	37	19	16613994	16613994	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr19:16613994G>A	ENST00000221671.3	+	3	1034	c.878G>A	c.(877-879)cGc>cAc	p.R293H	C19orf44_ENST00000594035.1_Missense_Mutation_p.R293H|CTD-3222D19.2_ENST00000409035.1_Intron	NM_032207.2	NP_115583.1	Q9H6X5	CS044_HUMAN	chromosome 19 open reading frame 44	293										endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|stomach(1)|urinary_tract(2)	16						CACAGCACTCGCTCAAGAGCA	0.547																																																	0													105.0	97.0	100.0					19																	16613994		2203	4300	6503	SO:0001583	missense	0			AK025395	CCDS12345.1, CCDS74306.1	19p13.11	2011-11-24			ENSG00000105072	ENSG00000105072			26141	protein-coding gene	gene with protein product						12477932	Standard	NM_032207		Approved	FLJ21742	uc002neh.1	Q9H6X5		ENST00000221671.3:c.878G>A	19.37:g.16613994G>A	ENSP00000221671:p.Arg293His		Q8N6Y7	Missense_Mutation	SNP	NULL	p.R293H	ENST00000221671.3	37	c.878	CCDS12345.1	19	.	.	.	.	.	.	.	.	.	.	G	5.205	0.223420	0.09863	.	.	ENSG00000105072	ENST00000221671	.	.	.	4.85	0.978	0.19740	.	1.164800	0.06119	N	0.668643	T	0.26085	0.0636	N	0.16478	0.41	0.09310	N	1	B;B	0.14438	0.01;0.01	B;B	0.09377	0.004;0.003	T	0.21930	-1.0231	9	0.28530	T	0.3	0.2368	6.4459	0.21875	0.0878:0.1371:0.6496:0.1255	.	293;293	Q9H6X5;Q9H6X5-2	CS044_HUMAN;.	H	293	.	ENSP00000221671:R293H	R	+	2	0	C19orf44	16474994	0.001000	0.12720	0.001000	0.08648	0.000000	0.00434	0.738000	0.26158	0.117000	0.18138	-2.067000	0.00394	CGC	C19orf44	-	NULL	ENSG00000105072		0.547	C19orf44-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C19orf44	HGNC	protein_coding	OTTHUMT00000461218.1		0.00	22	0	G	NM_032207		16613994	+1			no_errors	ENST00000221671	ensembl	human	known	74_37	missense	10.81	33	4	SNP	0.000	A
C20orf96	140680	genome.wustl.edu	37	20	257898	257898	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr20:257898C>T	ENST00000360321.2	-	7	830	c.692G>A	c.(691-693)cGc>cAc	p.R231H	C20orf96_ENST00000382369.5_Missense_Mutation_p.R196H|C20orf96_ENST00000400269.3_Missense_Mutation_p.R173H	NM_080571.1|NM_153269.2	NP_542138.1|NP_695001.2	Q9NUD7	CT096_HUMAN	chromosome 20 open reading frame 96	231										endometrium(3)|large_intestine(2)|lung(4)|prostate(1)|skin(1)|urinary_tract(1)	12		all_cancers(10;0.00959)|Lung NSC(37;0.227)	OV - Ovarian serous cystadenocarcinoma(29;0.149)			CTGCAGCTGGCGCATAAGAGT	0.552																																																	0													146.0	147.0	147.0					20																	257898		2203	4300	6503	SO:0001583	missense	0			AL034548	CCDS12994.1, CCDS74685.1	20p13	2012-10-30			ENSG00000196476	ENSG00000196476			16227	protein-coding gene	gene with protein product							Standard	NM_153269		Approved	dJ1103G7.2	uc002wde.2	Q9NUD7	OTTHUMG00000031626	ENST00000360321.2:c.692G>A	20.37:g.257898C>T	ENSP00000353470:p.Arg231His		A3KPE0|B2RPH9|Q8N840|Q8NAX5	Missense_Mutation	SNP	NULL	p.R231H	ENST00000360321.2	37	c.692	CCDS12994.1	20	.	.	.	.	.	.	.	.	.	.	C	6.965	0.547985	0.13312	.	.	ENSG00000196476	ENST00000382369;ENST00000360321;ENST00000400269	T;T;T	0.50813	0.73;0.73;0.73	4.95	3.02	0.34903	.	0.079971	0.46442	N	0.000283	T	0.32882	0.0844	L	0.38175	1.15	0.27082	N	0.963073	B;B;B;B	0.31640	0.333;0.333;0.333;0.333	B;B;B;B	0.25506	0.061;0.061;0.042;0.061	T	0.21690	-1.0238	10	0.56958	D	0.05	0.0323	7.8823	0.29629	0.0:0.8052:0.0:0.1948	.	173;196;231;196	F5GZA9;B7Z971;Q9NUD7;Q5JYC3	.;.;CT096_HUMAN;.	H	196;231;173	ENSP00000371806:R196H;ENSP00000353470:R231H;ENSP00000383128:R173H	ENSP00000353470:R231H	R	-	2	0	C20orf96	205898	0.966000	0.33281	0.948000	0.38648	0.021000	0.10359	0.510000	0.22723	0.510000	0.28216	-0.657000	0.03884	CGC	C20orf96	-	NULL	ENSG00000196476		0.552	C20orf96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C20orf96	HGNC	protein_coding	OTTHUMT00000077439.2		0.00	24	0	C	NM_153269		257898	-1			no_errors	ENST00000360321	ensembl	human	known	74_37	missense	5.26	72	4	SNP	0.958	T
C3	718	genome.wustl.edu	37	19	6719280	6719280	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr19:6719280G>A	ENST00000245907.6	-	2	301	c.209C>T	c.(208-210)tCc>tTc	p.S70F		NM_000064.2	NP_000055.2	P01024	CO3_HUMAN	complement component 3	70					complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|fatty acid metabolic process (GO:0006631)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of activation of membrane attack complex (GO:0001970)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic cell clearance (GO:2000427)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of glucose transport (GO:0010828)|positive regulation of lipid storage (GO:0010884)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of type IIa hypersensitivity (GO:0001798)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|regulation of immune response (GO:0050776)|regulation of triglyceride biosynthetic process (GO:0010866)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	C5L2 anaphylatoxin chemotactic receptor binding (GO:0031715)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(5)|endometrium(7)|kidney(6)|large_intestine(18)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)	72				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)	Intravenous Immunoglobulin(DB00028)	CTTCTCACTGGACAGCACTAG	0.602																																																	0													236.0	170.0	192.0					19																	6719280		2203	4300	6503	SO:0001583	missense	0			J04763	CCDS32883.1	19p13.3-p13.2	2014-09-17			ENSG00000125730	ENSG00000125730	3.4.21.43	"""Complement system"", ""Endogenous ligands"""	1318	protein-coding gene	gene with protein product	"""C3a anaphylatoxin"", ""complement component C3a"", ""complement component C3b"", ""prepro-C3"""	120700					Standard	NM_000064		Approved	CPAMD1, ARMD9, C3a, C3b	uc002mfm.3	P01024	OTTHUMG00000150335	ENST00000245907.6:c.209C>T	19.37:g.6719280G>A	ENSP00000245907:p.Ser70Phe		A7E236	Missense_Mutation	SNP	pfam_A2M_comp,pfam_A-macroglobulin_rcpt-bd,pfam_Macroglobln_a2,pfam_Netrin_module_non-TIMP,pfam_A2M_N_2,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,pfam_Anaphylatoxin/fibulin,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_TIMP-like_OB-fold,superfamily_A-macroglobulin_rcpt-bd,superfamily_Anaphylatoxin_comp_syst,smart_Anaphylatoxin/fibulin,smart_Netrin_module_non-TIMP,prints_Anaphylatoxn_comp_syst_dom,pfscan_Anaphylatoxin/fibulin,pfscan_Netrin_domain	p.S70F	ENST00000245907.6	37	c.209	CCDS32883.1	19	.	.	.	.	.	.	.	.	.	.	G	0.953	-0.705779	0.03255	.	.	ENSG00000125730	ENST00000245907	T	0.78246	-1.16	5.37	-6.7	0.01766	.	1.618470	0.03485	N	0.215729	T	0.53674	0.1811	N	0.16602	0.42	0.09310	N	1	B	0.06786	0.001	B	0.10450	0.005	T	0.46665	-0.9175	10	0.08837	T	0.75	.	4.2941	0.10892	0.4581:0.0:0.2199:0.3219	.	70	P01024	CO3_HUMAN	F	70	ENSP00000245907:S70F	ENSP00000245907:S70F	S	-	2	0	C3	6670280	0.009000	0.17119	0.296000	0.24974	0.023000	0.10783	0.152000	0.16302	-0.341000	0.08376	0.455000	0.32223	TCC	C3	-	NULL	ENSG00000125730		0.602	C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3	HGNC	protein_coding	OTTHUMT00000317636.2	-	0.00	71	0	G	NM_000064		6719280	-1	tier1	-	no_errors	ENST00000245907	ensembl	human	known	74_37	missense	11.54	115	15	SNP	0.000	A
C9orf24	84688	genome.wustl.edu	37	9	34381092	34381092	+	Silent	SNP	C	C	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr9:34381092C>T	ENST00000297623.2	-	5	708	c.510G>A	c.(508-510)tcG>tcA	p.S170S	C9orf24_ENST00000379126.3_Silent_p.S35S|C9orf24_ENST00000379127.1_Silent_p.S35S|C9orf24_ENST00000379124.1_Silent_p.S35S|C9orf24_ENST00000379133.3_Silent_p.S35S|C9orf24_ENST00000481295.1_5'Flank	NM_032596.3	NP_115985.2	Q8NCR6	SMRP1_HUMAN	chromosome 9 open reading frame 24	170					cell differentiation (GO:0030154)|cellular protein complex assembly (GO:0043623)|spermatogenesis (GO:0007283)	manchette (GO:0002177)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)	5			LUSC - Lung squamous cell carcinoma(29;0.0107)	GBM - Glioblastoma multiforme(74;0.123)		GCTGGTTCCGCGACAGTGAGT	0.662																																																	0													15.0	20.0	18.0					9																	34381092		2199	4298	6497	SO:0001819	synonymous_variant	0			BC029484	CCDS6553.1, CCDS6554.1, CCDS6555.1, CCDS59121.1	9p11.2	2013-01-11			ENSG00000164972	ENSG00000164972			19919	protein-coding gene	gene with protein product	"""ciliated bronchial epithelium 1"", ""spermatid-specific manchette-related protein 1"""					12029067	Standard	NM_147168		Approved	bA573M23.4, NYD-SP22, MGC32921, MGC33614, CBE1, SMRP1	uc003zuh.1	Q8NCR6	OTTHUMG00000000437	ENST00000297623.2:c.510G>A	9.37:g.34381092C>T			Q5T598|Q5T599|Q5T5A0|Q8N9G4|Q96KD1|Q96LN1	Silent	SNP	NULL	p.S170	ENST00000297623.2	37	c.510	CCDS6554.1	9																																																																																			C9orf24	-	NULL	ENSG00000164972		0.662	C9orf24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf24	HGNC	protein_coding	OTTHUMT00000001098.3	-	0.00	13	0	C	NM_147169		34381092	-1	tier1	-	no_errors	ENST00000297623	ensembl	human	known	74_37	silent	42.86	28	21	SNP	0.397	T
CA8	767	genome.wustl.edu	37	8	61135295	61135295	+	Silent	SNP	C	C	A			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr8:61135295C>A	ENST00000317995.4	-	7	915	c.651G>T	c.(649-651)gtG>gtT	p.V217V	CA8_ENST00000528666.1_5'UTR	NM_004056.4	NP_004047.3	P35219	CAH8_HUMAN	carbonic anhydrase VIII	217					one-carbon metabolic process (GO:0006730)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasm (GO:0005737)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(5)|lung(6)|prostate(2)|skin(1)	16		all_cancers(86;0.172)|all_epithelial(80;0.0383)|all_lung(136;0.0413)|Lung NSC(129;0.0474)			Zonisamide(DB00909)	AGCCTTCATACACCCAGTAAT	0.463																																																	0													108.0	98.0	101.0					8																	61135295		2203	4300	6503	SO:0001819	synonymous_variant	0			L04656	CCDS6174.1	8q12.1	2012-08-21			ENSG00000178538	ENSG00000178538		"""Carbonic anhydrases"""	1382	protein-coding gene	gene with protein product		114815		CALS		17219437	Standard	NM_004056		Approved	CARP	uc003xtz.1	P35219	OTTHUMG00000165325	ENST00000317995.4:c.651G>T	8.37:g.61135295C>A			A8K0A5|B3KQZ7|Q32MY2	Silent	SNP	pfam_Carbonic_anhydrase_a,superfamily_Carbonic_anhydrase_a,pfscan_Carbonic_anhydrase_a	p.V217	ENST00000317995.4	37	c.651	CCDS6174.1	8																																																																																			CA8	-	pfam_Carbonic_anhydrase_a,superfamily_Carbonic_anhydrase_a,pfscan_Carbonic_anhydrase_a	ENSG00000178538		0.463	CA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CA8	HGNC	protein_coding	OTTHUMT00000383445.1	-	0.00	38	0	C			61135295	-1	tier1	-	no_errors	ENST00000317995	ensembl	human	known	74_37	silent	18.57	57	13	SNP	0.940	A
CACNA1I	8911	genome.wustl.edu	37	22	40036971	40036971	+	Nonsense_Mutation	SNP	C	C	A			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr22:40036971C>A	ENST00000402142.3	+	6	840	c.840C>A	c.(838-840)tgC>tgA	p.C280*	CACNA1I_ENST00000336649.4_Nonsense_Mutation_p.C280*|CACNA1I_ENST00000401624.1_Nonsense_Mutation_p.C280*|CACNA1I_ENST00000400164.3_Nonsense_Mutation_p.C280*|CACNA1I_ENST00000407673.1_Nonsense_Mutation_p.C280*|CACNA1I_ENST00000404898.1_Nonsense_Mutation_p.C280*	NM_021096.3	NP_066919.2	Q9P0X4	CAC1I_HUMAN	calcium channel, voltage-dependent, T type, alpha 1I subunit	280					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|signal transduction (GO:0007165)|sleep (GO:0030431)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(2)|lung(27)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Melanoma(58;0.0749)				Cinnarizine(DB00568)|Flunarizine(DB04841)|Paramethadione(DB00617)|Spironolactone(DB00421)|Verapamil(DB00661)|Zonisamide(DB00909)	TAATGGGCTGCCATGAGATCC	0.627																																																	0													48.0	55.0	53.0					22																	40036971		2074	4213	6287	SO:0001587	stop_gained	0			AF129133	CCDS46710.1, CCDS46711.1	22q13.1	2012-03-07	2007-02-16		ENSG00000100346	ENSG00000100346		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1396	protein-coding gene	gene with protein product		608230				10454147, 16382099	Standard	NM_021096		Approved	Cav3.3	uc003ayd.3	Q9P0X4	OTTHUMG00000151096	ENST00000402142.3:c.840C>A	22.37:g.40036971C>A	ENSP00000385019:p.Cys280*		B0QY12|B0QY13|B0QY14|O95504|Q5JZ88|Q7Z6S9|Q8NFX6|Q9NZC8|Q9UH15|Q9UH30|Q9ULU9|Q9UNE6	Nonsense_Mutation	SNP	pfam_Ion_trans_dom,pfam_PKD1_2_channel,prints_VDCC_T_a1su,prints_VDCCAlpha1	p.C280*	ENST00000402142.3	37	c.840	CCDS46710.1	22	.	.	.	.	.	.	.	.	.	.	C	36	5.711324	0.96821	.	.	ENSG00000100346	ENST00000402142;ENST00000404898;ENST00000401624;ENST00000407673;ENST00000336649;ENST00000400164	.	.	.	4.99	2.84	0.33178	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	.	9.9887	0.41856	0.0:0.7645:0.0:0.2355	.	.	.	.	X	280	.	ENSP00000337829:C280X	C	+	3	2	CACNA1I	38366917	0.450000	0.25697	1.000000	0.80357	0.951000	0.60555	0.382000	0.20635	0.494000	0.27859	0.563000	0.77884	TGC	CACNA1I	-	pfam_Ion_trans_dom	ENSG00000100346		0.627	CACNA1I-001	KNOWN	basic|CCDS	protein_coding	CACNA1I	HGNC	protein_coding	OTTHUMT00000321290.1		0.00	42	0	C	NM_001003406		40036971	+1			no_errors	ENST00000336649	ensembl	human	known	74_37	nonsense	7.02	53	4	SNP	1.000	A
CAMK2N1	55450	genome.wustl.edu	37	1	20809950	20809950	+	3'UTR	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr1:20809950G>T	ENST00000375078.3	-	0	1269				CAMK2N1_ENST00000489020.1_5'UTR	NM_018584.5	NP_061054.2	Q7Z7J9	CK2N1_HUMAN	calcium/calmodulin-dependent protein kinase II inhibitor 1							cell junction (GO:0030054)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	calcium-dependent protein kinase inhibitor activity (GO:0008427)			lung(1)	1		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000247)|Lung NSC(340;0.000285)|Breast(348;0.0013)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|COAD - Colon adenocarcinoma(152;1.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000132)|Kidney(64;0.00016)|GBM - Glioblastoma multiforme(114;0.00116)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.195)		GAGGAGCCCAGAGccttctcc	0.358																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AY204901	CCDS207.1	1p36.12	2008-02-05			ENSG00000162545	ENSG00000162545			24190	protein-coding gene	gene with protein product		614986				12477932	Standard	NM_018584		Approved	CaMKIINalpha	uc001bdh.3	Q7Z7J9	OTTHUMG00000002837	ENST00000375078.3:c.*192C>A	1.37:g.20809950G>T				RNA	SNP	-	NULL	ENST00000375078.3	37	NULL	CCDS207.1	1																																																																																			CAMK2N1	-	-	ENSG00000162545		0.358	CAMK2N1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAMK2N1	HGNC	protein_coding	OTTHUMT00000007949.1	-	0.00	34	0	G	NM_018584		20809950	-1	tier1	-	no_errors	ENST00000489020	ensembl	human	known	74_37	rna	7.27	51	4	SNP	0.998	T
CAPNS1	826	genome.wustl.edu	37	19	36632054	36632054	+	Silent	SNP	C	C	T	rs17879825		TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr19:36632054C>T	ENST00000246533.3	+	2	739	c.141C>T	c.(139-141)ggC>ggT	p.G47G	CAPNS1_ENST00000588780.1_Silent_p.G47G|CAPNS1_ENST00000588815.1_Silent_p.G47G|CAPNS1_ENST00000589146.1_Intron|CAPNS1_ENST00000590874.1_Silent_p.G47G|CAPNS1_ENST00000587718.1_Silent_p.G47G|AD001527.7_ENST00000604228.1_RNA	NM_001003962.1|NM_001749.2	NP_001003962.1|NP_001740.1	P04632	CPNS1_HUMAN	calpain, small subunit 1	47	Gly-rich (hydrophobic).|Poly-Gly.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of cell proliferation (GO:0008284)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			cervix(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	5	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			gcggcggcggcggtggtggag	0.761																																					Esophageal Squamous(129;1541 1691 5780 18353 34150)												0																																										SO:0001819	synonymous_variant	0			X04106	CCDS12489.1	19q13.1	2013-01-10		2001-08-10	ENSG00000126247	ENSG00000126247	3.4.22.52	"""EF-hand domain containing"""	1481	protein-coding gene	gene with protein product		114170		CAPN4		3024120, 3016651	Standard	NM_001003962		Approved	CANP, CANPS, 30K, CDPS	uc002odj.3	P04632		ENST00000246533.3:c.141C>T	19.37:g.36632054C>T			A8K0P1|Q8WTX3|Q96EW0	Silent	SNP	pfscan_EF_hand_dom	p.G47	ENST00000246533.3	37	c.141	CCDS12489.1	19																																																																																			CAPNS1	-	NULL	ENSG00000126247		0.761	CAPNS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAPNS1	HGNC	protein_coding	OTTHUMT00000457411.2		0.00	40	0	C			36632054	+1			no_errors	ENST00000588780	ensembl	human	known	74_37	silent	11.84	65	9	SNP	0.020	T
CASC3	22794	genome.wustl.edu	37	17	38324562	38324562	+	Silent	SNP	T	T	C			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr17:38324562T>C	ENST00000264645.7	+	11	2083	c.1857T>C	c.(1855-1857)ccT>ccC	p.P619P		NM_007359.4	NP_031385.2	O15234	CASC3_HUMAN	cancer susceptibility candidate 3	619	Necessary for localization in cytoplasmic stress granules.				gene expression (GO:0010467)|intracellular mRNA localization (GO:0008298)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translation (GO:0006417)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)	cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|ribonucleoprotein complex (GO:0030529)	enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|ubiquitin protein ligase binding (GO:0031625)			endometrium(4)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)|urinary_tract(2)	16						TGCTTGCTCCTACTTACTTTT	0.567											OREG0024392	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													148.0	130.0	136.0					17																	38324562		2203	4300	6503	SO:0001819	synonymous_variant	0			X80199	CCDS11362.1	17q21.1	2012-09-20			ENSG00000108349	ENSG00000108349			17040	protein-coding gene	gene with protein product		606504				7490069, 18332872	Standard	NM_007359		Approved	MLN51, BTZ	uc002hue.3	O15234	OTTHUMG00000133323	ENST00000264645.7:c.1857T>C	17.37:g.38324562T>C		877	A8K8R0	Silent	SNP	pfam_Btz_dom	p.P619	ENST00000264645.7	37	c.1857	CCDS11362.1	17																																																																																			CASC3	-	NULL	ENSG00000108349		0.567	CASC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASC3	HGNC	protein_coding	OTTHUMT00000257127.3	-	0.00	52	0	T	NM_007359		38324562	+1	tier1	-	no_errors	ENST00000264645	ensembl	human	known	74_37	silent	66.30	31	61	SNP	0.926	C
CBLN2	147381	genome.wustl.edu	37	18	70209175	70209175	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr18:70209175G>A	ENST00000269503.4	-	3	994	c.221C>T	c.(220-222)gCg>gTg	p.A74V	CBLN2_ENST00000585159.1_Missense_Mutation_p.A74V|CBLN2_ENST00000581073.1_Intron|CBLN2_ENST00000584764.1_Intron|CBLN2_ENST00000583651.1_Intron	NM_182511.3	NP_872317.1	Q8IUK8	CBLN2_HUMAN	cerebellin 2 precursor	74					positive regulation of synapse assembly (GO:0051965)	extracellular space (GO:0005615)				endometrium(2)|lung(15)	17		Esophageal squamous(42;0.131)				GGCGCCGTCCGCCGACGGGCT	0.716																																																	0													29.0	27.0	28.0					18																	70209175		2201	4298	6499	SO:0001583	missense	0			BC035789	CCDS11999.1	18q22.3	2007-11-19			ENSG00000141668	ENSG00000141668			1544	protein-coding gene	gene with protein product		600433				7877445	Standard	NM_182511		Approved		uc002lkv.2	Q8IUK8	OTTHUMG00000132825	ENST00000269503.4:c.221C>T	18.37:g.70209175G>A	ENSP00000269503:p.Ala74Val		Q53Z56	Missense_Mutation	SNP	pfam_C1q,superfamily_Tumour_necrosis_fac-like_dom,smart_C1q,pfscan_C1q,prints_C1q	p.A74V	ENST00000269503.4	37	c.221	CCDS11999.1	18	.	.	.	.	.	.	.	.	.	.	G	18.99	3.740037	0.69304	.	.	ENSG00000141668	ENST00000269503	D	0.82081	-1.57	4.54	2.52	0.30459	.	0.216529	0.39687	N	0.001282	T	0.72120	0.3421	L	0.32530	0.975	0.80722	D	1	P	0.39282	0.666	B	0.32583	0.148	T	0.74318	-0.3704	10	0.56958	D	0.05	-9.6841	13.5798	0.61896	0.0:0.3088:0.6912:0.0	.	74	Q8IUK8	CBLN2_HUMAN	V	74	ENSP00000269503:A74V	ENSP00000269503:A74V	A	-	2	0	CBLN2	68360155	1.000000	0.71417	0.493000	0.27502	0.996000	0.88848	5.979000	0.70508	0.997000	0.38969	0.462000	0.41574	GCG	CBLN2	-	NULL	ENSG00000141668		0.716	CBLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBLN2	HGNC	protein_coding	OTTHUMT00000256288.1		0.00	44	0	G	NM_182511		70209175	-1			no_errors	ENST00000269503	ensembl	human	known	74_37	missense	5.00	38	2	SNP	0.997	A
CCDC173	129881	genome.wustl.edu	37	2	170510679	170510679	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr2:170510679G>T	ENST00000447353.1	-	6	970	c.865C>A	c.(865-867)Cag>Aag	p.Q289K		NM_001085447.1	NP_001078916.1	Q0VFZ6	CC173_HUMAN	coiled-coil domain containing 173	289																	TCCTCTTGCTGCTGCTGTTCT	0.343																																																	0													97.0	83.0	87.0					2																	170510679		1814	4087	5901	SO:0001583	missense	0			BC015980, BC117445	CCDS46445.1	2q31.1	2012-08-07	2012-08-07	2012-08-07	ENSG00000154479	ENSG00000154479			25064	protein-coding gene	gene with protein product	"""hypothetical LOC129881"""		"""chromosome 2 open reading frame 77"""	C2orf77		12477932	Standard	NM_001085447		Approved	LOC129881	uc002ufe.2	Q0VFZ6	OTTHUMG00000154116	ENST00000447353.1:c.865C>A	2.37:g.170510679G>T	ENSP00000391504:p.Gln289Lys		Q6PJF6	Missense_Mutation	SNP	NULL	p.Q289K	ENST00000447353.1	37	c.865	CCDS46445.1	2	.	.	.	.	.	.	.	.	.	.	G	8.172	0.791973	0.16258	.	.	ENSG00000154479	ENST00000447353	T	0.09723	2.95	5.04	3.13	0.36017	.	0.820583	0.11492	N	0.558583	T	0.07954	0.0199	L	0.41356	1.27	0.29046	N	0.884829	P	0.43024	0.798	B	0.42030	0.373	T	0.03945	-1.0990	10	0.06625	T	0.88	.	4.448	0.11607	0.0902:0.1506:0.6048:0.1544	.	289	Q0VFZ6	CB077_HUMAN	K	289	ENSP00000391504:Q289K	ENSP00000391504:Q289K	Q	-	1	0	C2orf77	170218925	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.573000	0.46007	1.256000	0.44068	0.585000	0.79938	CAG	CCDC173	-	NULL	ENSG00000154479		0.343	CCDC173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC173	HGNC	protein_coding	OTTHUMT00000333954.2		0.00	30	0	G	NM_001085447		170510679	-1			no_errors	ENST00000447353	ensembl	human	known	74_37	missense	7.27	51	4	SNP	1.000	T
CFAP45	25790	genome.wustl.edu	37	1	159869910	159869910	+	5'UTR	SNP	C	C	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr1:159869910C>T	ENST00000368099.4	-	0	43				hsa-mir-4259_ENST00000584466.1_RNA|CCDC19_ENST00000476696.1_5'UTR|CCDC19_ENST00000426543.2_5'Flank	NM_012337.2	NP_036469.2														endometrium(2)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	26	all_hematologic(112;0.0597)		BRCA - Breast invasive adenocarcinoma(70;0.151)			CACGCCCTGACTCCGGACTTC	0.657																																																	0													59.0	51.0	54.0					1																	159869910		2203	4300	6503	SO:0001623	5_prime_UTR_variant	0																														ENST00000368099.4:c.-22G>A	1.37:g.159869910C>T				RNA	SNP	-	NULL	ENST00000368099.4	37	NULL	CCDS30914.1	1																																																																																			CCDC19	-	-	ENSG00000213085		0.657	CCDC19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC19	HGNC	protein_coding	OTTHUMT00000085979.1	-	0.00	52	0	C			159869910	-1	tier1	-	no_errors	ENST00000476696	ensembl	human	known	74_37	rna	53.45	27	31	SNP	0.000	T
CDC25A	993	genome.wustl.edu	37	3	48209413	48209413	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr3:48209413G>T	ENST00000302506.3	-	10	1360	c.952C>A	c.(952-954)Ctg>Atg	p.L318M	CDC25A_ENST00000351231.3_Missense_Mutation_p.L278M|CDC25A_ENST00000459900.1_5'UTR	NM_001789.2	NP_001780.2	P30304	MPIP1_HUMAN	cell division cycle 25A	318					cell proliferation (GO:0008283)|cellular response to UV (GO:0034644)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|response to radiation (GO:0009314)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(9)|prostate(1)|skin(1)	20				BRCA - Breast invasive adenocarcinoma(193;0.000685)|KIRC - Kidney renal clear cell carcinoma(197;0.00596)|Kidney(197;0.00684)		GAAGATGCCAGGGATAAAGAC	0.443																																																	0													81.0	76.0	78.0					3																	48209413		2203	4300	6503	SO:0001583	missense	0			M81933	CCDS2760.1, CCDS2761.1	3p21	2013-01-17	2013-01-17		ENSG00000164045	ENSG00000164045		"""Protein tyrosine phosphatases / Class III Cys-based PTPs"""	1725	protein-coding gene	gene with protein product		116947	"""cell division cycle 25A"", ""cell division cycle 25 homolog A (S. cerevisiae)"", ""cell division cycle 25 homolog A (S. pombe)"""			1836978	Standard	NM_001789		Approved		uc003csh.1	P30304	OTTHUMG00000133535	ENST00000302506.3:c.952C>A	3.37:g.48209413G>T	ENSP00000303706:p.Leu318Met		Q8IZH5|Q96IL3|Q9H2F2	Missense_Mutation	SNP	pfam_MPI_Phosphatase,pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom,pfscan_Rhodanese-like_dom,prints_MPI_Phosphatase	p.L318M	ENST00000302506.3	37	c.952	CCDS2760.1	3	.	.	.	.	.	.	.	.	.	.	G	13.05	2.119954	0.37436	.	.	ENSG00000164045	ENST00000302506;ENST00000351231	T;T	0.24350	1.86;1.86	5.83	0.652	0.17823	.	0.508963	0.19965	N	0.102130	T	0.22360	0.0539	L	0.36672	1.1	0.09310	N	1	B;P	0.36647	0.321;0.563	B;P	0.45538	0.26;0.484	T	0.13683	-1.0500	10	0.41790	T	0.15	.	4.898	0.13760	0.4077:0.0:0.4565:0.1358	.	278;318	P30304-2;P30304	.;MPIP1_HUMAN	M	318;278	ENSP00000303706:L318M;ENSP00000343166:L278M	ENSP00000303706:L318M	L	-	1	2	CDC25A	48184417	0.026000	0.19158	0.002000	0.10522	0.424000	0.31475	-0.199000	0.09491	-0.149000	0.11215	0.555000	0.69702	CTG	CDC25A	-	pfam_MPI_Phosphatase	ENSG00000164045		0.443	CDC25A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC25A	HGNC	protein_coding	OTTHUMT00000257512.2	-	0.00	65	0	G	NM_001789		48209413	-1	tier1	-	no_errors	ENST00000302506	ensembl	human	known	74_37	missense	5.97	63	4	SNP	0.001	T
CDH6	1004	genome.wustl.edu	37	5	31305356	31305356	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr5:31305356C>G	ENST00000265071.2	+	7	1340	c.1075C>G	c.(1075-1077)Ctc>Gtc	p.L359V	CDH6_ENST00000514738.1_Missense_Mutation_p.L304V	NM_004932.3	NP_004923.1	P55285	CADH6_HUMAN	cadherin 6, type 2, K-cadherin (fetal kidney)	359	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(42)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						GCCACGATTTCTCTACTTGGG	0.458																																																	0													87.0	86.0	86.0					5																	31305356		2203	4300	6503	SO:0001583	missense	0			D31784	CCDS3894.1	5p13.3	2010-01-26			ENSG00000113361	ENSG00000113361		"""Cadherins / Major cadherins"""	1765	protein-coding gene	gene with protein product	"""K-Cadherin"""	603007				7743525, 10191097	Standard	NM_004932		Approved		uc003jhe.2	P55285	OTTHUMG00000090673	ENST00000265071.2:c.1075C>G	5.37:g.31305356C>G	ENSP00000265071:p.Leu359Val		A8K5H5|Q9BWS0	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L359V	ENST00000265071.2	37	c.1075	CCDS3894.1	5	.	.	.	.	.	.	.	.	.	.	C	14.70	2.613592	0.46631	.	.	ENSG00000113361	ENST00000514738;ENST00000265071	T;T	0.58060	0.49;0.36	5.88	5.88	0.94601	Cadherin (3);Cadherin-like (1);	0.271390	0.36482	N	0.002578	T	0.48995	0.1531	L	0.33668	1.02	0.40426	D	0.979892	B;P	0.36959	0.372;0.575	B;B	0.38921	0.285;0.187	T	0.46610	-0.9179	10	0.44086	T	0.13	.	20.2187	0.98312	0.0:1.0:0.0:0.0	.	359;359	P55285;P55285-2	CADH6_HUMAN;.	V	304;359	ENSP00000424843:L304V;ENSP00000265071:L359V	ENSP00000265071:L359V	L	+	1	0	CDH6	31341113	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	1.255000	0.32909	2.780000	0.95670	0.655000	0.94253	CTC	CDH6	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000113361		0.458	CDH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH6	HGNC	protein_coding	OTTHUMT00000207355.2	-	0.00	84	0	C	NM_004932		31305356	+1	tier1	-	no_errors	ENST00000265071	ensembl	human	known	74_37	missense	7.00	225	17	SNP	1.000	G
MMP23B	8510	genome.wustl.edu	37	1	1572523	1572523	+	IGR	SNP	T	T	C			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr1:1572523T>C	ENST00000356026.5	+	0	1326				CDK11B_ENST00000407249.3_Missense_Mutation_p.K541E|CDK11B_ENST00000341832.6_Missense_Mutation_p.K494E|CDK11B_ENST00000340677.5_Missense_Mutation_p.K528E|CDK11B_ENST00000317673.7_Missense_Mutation_p.K539E			O75900	MMP23_HUMAN	matrix metallopeptidase 23B						proteolysis (GO:0006508)|reproduction (GO:0000003)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			large_intestine(1)	1	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.61e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;5.26e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.54e-23)|GBM - Glioblastoma multiforme(42;9e-08)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|STAD - Stomach adenocarcinoma(132;0.00644)|BRCA - Breast invasive adenocarcinoma(365;0.00786)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)	Marimastat(DB00786)	TGCAGGTGTTTCACCCCACGC	0.652																																																	0													93.0	112.0	106.0					1																	1572523		2153	4276	6429	SO:0001628	intergenic_variant	0				CCDS30559.1	1p36.3	2013-01-11	2005-08-08		ENSG00000189409	ENSG00000189409		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7171	protein-coding gene	gene with protein product	"""matrix metalloproteinase 22"", ""femalysin"", ""matrix metalloproteinase in the female reproductive tract"""	603321	"""matrix metalloproteinase 23B"""	MMP22		9740677, 9750192	Standard	XM_005244810		Approved	MIFR, MIFR-1	uc001agp.3	O75900	OTTHUMG00000074713		1.37:g.1572523T>C			A2AGN0|A2AGN1|O75894|O75895|Q5QPQ8|Q76P96|Q7LDM6|Q7LDM7|Q9UBR9|Q9UJK8	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.K541E	ENST00000356026.5	37	c.1621	CCDS30559.1	1																																																																																			CDK11B	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000248333		0.652	MMP23B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK11B	HGNC	protein_coding	OTTHUMT00000158492.2		0.00	63	0	T	NM_006983		1572523	-1			no_errors	ENST00000407249	ensembl	human	known	74_37	missense	8.89	82	8	SNP	1.000	C
CDK11A	728642	genome.wustl.edu	37	1	1635742	1635742	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr1:1635742T>C	ENST00000378633.1	-	15	1694	c.1615A>G	c.(1615-1617)Aaa>Gaa	p.K539E	CDK11A_ENST00000356200.3_Missense_Mutation_p.K502E|CDK11A_ENST00000404249.3_Missense_Mutation_p.K536E|CDK11A_ENST00000358779.5_Missense_Mutation_p.K526E|CDK11A_ENST00000357760.2_Missense_Mutation_p.K535E|RP1-283E3.8_ENST00000598846.1_RNA|CDK11A_ENST00000378638.2_Missense_Mutation_p.K502E|CDK11A_ENST00000495016.1_5'UTR			Q9UQ88	CD11A_HUMAN	cyclin-dependent kinase 11A	539	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|mitotic nuclear division (GO:0007067)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of mRNA processing (GO:0050684)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(4)|stomach(1)|urinary_tract(1)	18						TGCAGGTGTTTCACCCCCCGC	0.667																																					Pancreas(186;965 2119 30274 40311 50569)												0													56.0	63.0	61.0					1																	1635742		2023	4169	6192	SO:0001583	missense	0			AF067522	CCDS44042.1, CCDS44043.1	1p36.33	2011-11-08	2009-12-16	2009-12-16	ENSG00000008128	ENSG00000008128		"""Cyclin-dependent kinases"""	1730	protein-coding gene	gene with protein product		116951	"""cell division cycle 2-like 2"", ""cell division cycle 2-like 2 (PITSLRE proteins)"""	CDC2L3, CDC2L2		7920654, 9750192, 19884882	Standard	NM_033529		Approved	PITSLRE, CDK11-p110, CDK11-p58, CDK11-p46, p58GTA		Q9UQ88	OTTHUMG00000000703	ENST00000378633.1:c.1615A>G	1.37:g.1635742T>C	ENSP00000367900:p.Lys539Glu		O95227|O95228|O96012|Q12821|Q12853|Q12854|Q2TAJ0|Q5QPR0|Q5QPR1|Q5QPR2|Q9UBC4|Q9UBI3|Q9UEI1|Q9UEI2|Q9UP53|Q9UP54|Q9UP55|Q9UP56|Q9UQ86|Q9UQ87|Q9UQ89	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.K536E	ENST00000378633.1	37	c.1606		1	.	.	.	.	.	.	.	.	.	.	-	10.78	1.447884	0.26074	.	.	ENSG00000008128	ENST00000356200;ENST00000404249;ENST00000357760;ENST00000358779;ENST00000378633;ENST00000378638;ENST00000378630	T;T;T;T;T;T	0.64438	-0.1;-0.1;-0.1;-0.1;-0.1;-0.1	1.93	1.93	0.25924	.	0.211286	0.49916	D	0.000132	T	0.38108	0.1028	N	0.11673	0.155	0.80722	D	1	B;B;B	0.30211	0.273;0.273;0.0	B;B;B	0.32980	0.156;0.156;0.002	T	0.08911	-1.0699	10	0.25751	T	0.34	.	7.3857	0.26880	0.0:0.0:0.0:1.0	.	536;526;153	Q9UQ88-2;Q9UQ88-4;Q9UQ88-5	.;.;.	E	502;536;535;526;539;502;502	ENSP00000348529:K502E;ENSP00000384442:K536E;ENSP00000350403:K535E;ENSP00000351629:K526E;ENSP00000367900:K539E;ENSP00000367905:K502E	ENSP00000348529:K502E	K	-	1	0	CDK11A	1625602	0.981000	0.34729	0.961000	0.40146	0.893000	0.52053	2.085000	0.41634	0.903000	0.36546	0.336000	0.21669	AAA	CDK11A	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000008128		0.667	CDK11A-005	NOVEL	basic	protein_coding	CDK11A	HGNC	protein_coding	OTTHUMT00000001735.1	-	0.00	48	0	T	NM_024011		1635742	-1	tier1	-	no_errors	ENST00000404249	ensembl	human	known	74_37	missense	33.96	33	18	SNP	1.000	C
CECR2	27443	genome.wustl.edu	37	22	17978486	17978486	+	Silent	SNP	C	C	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr22:17978486C>T	ENST00000400573.5	+	4	391	c.384C>T	c.(382-384)gaC>gaT	p.D128D	CECR2_ENST00000262608.8_Silent_p.D109D|CECR2_ENST00000497534.1_3'UTR|CECR2_ENST00000400585.2_5'UTR|CECR2_ENST00000342247.5_Silent_p.D108D			Q9BXF3	CECR2_HUMAN	cat eye syndrome chromosome region, candidate 2	150					apoptotic DNA fragmentation (GO:0006309)|ATP-dependent chromatin remodeling (GO:0043044)|cytokinesis (GO:0000910)|cytoskeleton organization (GO:0007010)|execution phase of apoptosis (GO:0097194)|neural tube development (GO:0021915)|vesicle-mediated transport (GO:0016192)	CERF complex (GO:0090537)|nucleus (GO:0005634)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	59		all_epithelial(15;0.139)		Lung(27;0.146)		TGGGTGAAGACAATTCTGGGG	0.493																																																	0													96.0	92.0	93.0					22																	17978486		1874	4111	5985	SO:0001819	synonymous_variant	0			AF336133		22q11.2	2012-04-19			ENSG00000099954	ENSG00000099954			1840	protein-coding gene	gene with protein product		607576				11381032	Standard	XM_006724077		Approved	KIAA1740	uc002zml.2	Q9BXF3	OTTHUMG00000150072	ENST00000400573.5:c.384C>T	22.37:g.17978486C>T			A8MS90|A8MX16|Q658Z4|Q96P58|Q9C0C3	Silent	SNP	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.D128	ENST00000400573.5	37	c.384		22																																																																																			CECR2	-	NULL	ENSG00000099954		0.493	CECR2-001	NOVEL	basic|appris_candidate_longest	protein_coding	CECR2	HGNC	protein_coding	OTTHUMT00000316104.5	-	0.00	40	0	C	NM_031413		17978486	+1	tier1	-	no_errors	ENST00000400573	ensembl	human	novel	74_37	silent	44.44	25	20	SNP	0.995	T
CEP152	22995	genome.wustl.edu	37	15	49031153	49031153	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr15:49031153G>T	ENST00000380950.2	-	27	4613	c.4426C>A	c.(4426-4428)Cac>Aac	p.H1476N	CEP152_ENST00000399334.3_Missense_Mutation_p.H1420N	NM_001194998.1|NM_014985.3	NP_001181927.1|NP_055800.2	O94986	CE152_HUMAN	centrosomal protein 152kDa	1476					cell projection organization (GO:0030030)|centriole replication (GO:0007099)|centrosome duplication (GO:0051298)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)			breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(16)|lung(30)|ovary(1)|prostate(2)|skin(2)	63		all_lung(180;0.0428)		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)		TTCTTCTTGTGCAAACCAAAG	0.443																																																	0													119.0	115.0	116.0					15																	49031153		1912	4130	6042	SO:0001583	missense	0			AB020719	CCDS42033.1, CCDS58361.1	15q21.1	2014-02-20							29298	protein-coding gene	gene with protein product	"""asterless"""	613529	"""microcephaly, primary autosomal recessive 4"""	MCPH4		14654843, 21131973	Standard	NM_014985		Approved	KIAA0912, SCKL5	uc001zwz.3	O94986		ENST00000380950.2:c.4426C>A	15.37:g.49031153G>T	ENSP00000370337:p.His1476Asn		E7ER66|Q17RV1|Q6NTA0	Missense_Mutation	SNP	NULL	p.H1476N	ENST00000380950.2	37	c.4426	CCDS58361.1	15	.	.	.	.	.	.	.	.	.	.	G	9.067	0.995930	0.19043	.	.	ENSG00000103995	ENST00000399334	T	0.54279	0.58	4.34	2.47	0.30058	.	0.842875	0.10169	N	0.707418	T	0.32882	0.0844	L	0.27053	0.805	0.09310	N	1	B	0.15141	0.012	B	0.13407	0.009	T	0.25572	-1.0128	10	0.12766	T	0.61	0.1091	3.9524	0.09375	0.1969:0.0:0.6005:0.2026	.	1420	O94986	CE152_HUMAN	N	1420	ENSP00000382271:H1420N	ENSP00000382271:H1420N	H	-	1	0	CEP152	46818445	0.028000	0.19301	0.028000	0.17463	0.242000	0.25591	1.358000	0.34102	0.777000	0.33496	0.557000	0.71058	CAC	CEP152	-	NULL	ENSG00000103995		0.443	CEP152-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CEP152	HGNC	protein_coding	OTTHUMT00000417365.1		0.00	36	0	G	NM_014985		49031153	-1			no_errors	ENST00000380950	ensembl	human	known	74_37	missense	5.56	34	2	SNP	0.006	T
CLDN9	9080	genome.wustl.edu	37	16	3063877	3063877	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr16:3063877G>T	ENST00000445369.2	+	1	1421	c.514G>T	c.(514-516)Gca>Tca	p.A172S		NM_020982.3	NP_066192.1	O95484	CLD9_HUMAN	claudin 9	172					calcium-independent cell-cell adhesion (GO:0016338)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)|viral process (GO:0016032)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			endometrium(2)|large_intestine(1)|lung(5)|prostate(2)	10						GGCGGCGGCTGCACTGCTTAT	0.726																																																	0													16.0	21.0	19.0					16																	3063877		2191	4285	6476	SO:0001583	missense	0			AJ130941	CCDS10487.1	16p13.3	2008-08-01			ENSG00000213937	ENSG00000213937		"""Claudins"""	2051	protein-coding gene	gene with protein product		615799				9441748, 18234789	Standard	NM_020982		Approved		uc010uwo.1	O95484	OTTHUMG00000129000	ENST00000445369.2:c.514G>T	16.37:g.3063877G>T	ENSP00000398017:p.Ala172Ser			Missense_Mutation	SNP	pfam_PMP22/EMP/MP20/Claudin,prints_Claudin,prints_Claudin9	p.A172S	ENST00000445369.2	37	c.514	CCDS10487.1	16	.	.	.	.	.	.	.	.	.	.	G	19.85	3.902939	0.72754	.	.	ENSG00000213937	ENST00000445369	D	0.88896	-2.44	4.56	4.56	0.56223	.	0.073494	0.53938	D	0.000044	D	0.89750	0.6805	M	0.67953	2.075	0.80722	D	1	P	0.40230	0.708	P	0.46339	0.513	D	0.88450	0.3048	10	0.31617	T	0.26	.	14.8665	0.70419	0.0:0.0:1.0:0.0	.	172	O95484	CLD9_HUMAN	S	172	ENSP00000398017:A172S	ENSP00000398017:A172S	A	+	1	0	CLDN9	3003878	1.000000	0.71417	0.581000	0.28614	0.590000	0.36582	9.601000	0.98297	2.349000	0.79799	0.563000	0.77884	GCA	CLDN9	-	pfam_PMP22/EMP/MP20/Claudin,prints_Claudin	ENSG00000213937		0.726	CLDN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLDN9	HGNC	protein_coding	OTTHUMT00000250989.1		0.00	11	0	G	NM_020982		3063877	+1			no_errors	ENST00000445369	ensembl	human	known	74_37	missense	15.00	17	3	SNP	0.998	T
CNTN3	5067	genome.wustl.edu	37	3	74313560	74313560	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr3:74313560G>T	ENST00000263665.6	-	22	3106	c.3079C>A	c.(3079-3081)Ctg>Atg	p.L1027M	CNTN3_ENST00000477856.1_5'UTR	NM_020872.1	NP_065923.1	Q9P232	CNTN3_HUMAN	contactin 3 (plasmacytoma associated)	1027					cell adhesion (GO:0007155)|nervous system development (GO:0007399)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(39)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	83		Lung NSC(201;0.138)|Lung SC(41;0.21)		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)		TATCACCACAGGACATATACA	0.338																																																	0													100.0	93.0	95.0					3																	74313560		2203	4299	6502	SO:0001583	missense	0			AB040929	CCDS33790.1	3p12.3	2013-02-11			ENSG00000113805	ENSG00000113805		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2173	protein-coding gene	gene with protein product		601325		PANG		8661054, 8586965	Standard	XM_005264757		Approved	BIG-1	uc003dpm.1	Q9P232	OTTHUMG00000158813	ENST00000263665.6:c.3079C>A	3.37:g.74313560G>T	ENSP00000263665:p.Leu1027Met		B9EK50|Q9H039	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.L1027M	ENST00000263665.6	37	c.3079	CCDS33790.1	3	.	.	.	.	.	.	.	.	.	.	G	13.01	2.110560	0.37242	.	.	ENSG00000113805	ENST00000263665	T	0.60548	0.18	4.99	0.455	0.16649	.	0.547984	0.17089	N	0.187475	T	0.45816	0.1361	N	0.14661	0.345	0.19945	N	0.999942	D	0.60575	0.988	P	0.54664	0.758	T	0.33292	-0.9874	10	0.56958	D	0.05	.	5.1253	0.14880	0.4425:0.199:0.3585:0.0	.	1027	Q9P232	CNTN3_HUMAN	M	1027	ENSP00000263665:L1027M	ENSP00000263665:L1027M	L	-	1	2	CNTN3	74396250	0.185000	0.23213	0.986000	0.45419	0.500000	0.33767	0.025000	0.13577	0.079000	0.16929	0.650000	0.86243	CTG	CNTN3	-	NULL	ENSG00000113805		0.338	CNTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN3	HGNC	protein_coding	OTTHUMT00000352306.1	-	0.00	73	0	G	NM_020872		74313560	-1	tier1	-	no_errors	ENST00000263665	ensembl	human	known	74_37	missense	54.05	17	20	SNP	0.344	T
CNTNAP5	129684	genome.wustl.edu	37	2	125262121	125262121	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr2:125262121G>A	ENST00000431078.1	+	8	1676	c.1312G>A	c.(1312-1314)Gaa>Aaa	p.E438K		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	438	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		ACGCGTAGCTGAAATCCTCAC	0.493																																																	0													51.0	54.0	53.0					2																	125262121		1953	4156	6109	SO:0001583	missense	0			AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.1312G>A	2.37:g.125262121G>A	ENSP00000399013:p.Glu438Lys		Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Missense_Mutation	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.E438K	ENST00000431078.1	37	c.1312	CCDS46401.1	2	.	.	.	.	.	.	.	.	.	.	G	16.71	3.198873	0.58126	.	.	ENSG00000155052	ENST00000431078	T	0.79352	-1.26	5.64	5.64	0.86602	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.49305	D	0.000144	T	0.75140	0.3809	L	0.53561	1.675	0.45005	D	0.998022	P	0.48834	0.916	P	0.49085	0.6	T	0.70938	-0.4736	10	0.07325	T	0.83	.	12.0628	0.53572	0.0784:0.0:0.9216:0.0	.	438	Q8WYK1	CNTP5_HUMAN	K	438	ENSP00000399013:E438K	ENSP00000399013:E438K	E	+	1	0	CNTNAP5	124978591	1.000000	0.71417	0.956000	0.39512	0.450000	0.32258	5.997000	0.70646	2.642000	0.89623	0.650000	0.86243	GAA	CNTNAP5	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G	ENSG00000155052		0.493	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP5	HGNC	protein_coding	OTTHUMT00000330864.3	-	0.00	55	0	G			125262121	+1	tier1	-	no_errors	ENST00000431078	ensembl	human	known	74_37	missense	5.38	263	15	SNP	0.978	A
COL5A1	1289	genome.wustl.edu	37	9	137658326	137658326	+	Silent	SNP	G	G	A			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr9:137658326G>A	ENST00000371817.3	+	22	2529	c.2115G>A	c.(2113-2115)ccG>ccA	p.P705P		NM_000093.3|NM_001278074.1	NP_000084.3|NP_001265003.1	P20908	CO5A1_HUMAN	collagen, type V, alpha 1	705	Triple-helical region.				axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|heart morphogenesis (GO:0003007)|integrin biosynthetic process (GO:0045112)|negative regulation of endodermal cell differentiation (GO:1903225)|regulation of cellular component organization (GO:0051128)|skin development (GO:0043588)|tendon development (GO:0035989)|wound healing, spreading of epidermal cells (GO:0035313)	basement membrane (GO:0005604)|collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|proteoglycan binding (GO:0043394)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(26)|liver(2)|lung(36)|ovary(4)|pancreas(4)|prostate(5)|skin(10)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	115		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		ACGGCCAGCCGGGGCCAAAAG	0.547																																																	0													81.0	75.0	77.0					9																	137658326		2203	4300	6503	SO:0001819	synonymous_variant	0			D90279	CCDS6982.1, CCDS75932.1	9q34.2-q34.3	2014-09-17			ENSG00000130635	ENSG00000130635		"""Collagens"""	2209	protein-coding gene	gene with protein product	"""alpha 1 type V collagen"""	120215				1572660	Standard	NM_001278074		Approved		uc031tfl.1	P20908	OTTHUMG00000020891	ENST00000371817.3:c.2115G>A	9.37:g.137658326G>A			Q15094|Q5SUX4	Silent	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Laminin_G,smart_Fib_collagen_C	p.P705	ENST00000371817.3	37	c.2115	CCDS6982.1	9																																																																																			COL5A1	-	NULL	ENSG00000130635		0.547	COL5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL5A1	HGNC	protein_coding	OTTHUMT00000054954.2	-	0.00	56	0	G	NM_000093		137658326	+1	tier1	-	no_errors	ENST00000371817	ensembl	human	known	74_37	silent	5.41	103	6	SNP	0.007	A
CSMD3	114788	genome.wustl.edu	37	8	113392631	113392631	+	Missense_Mutation	SNP	A	A	C			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr8:113392631A>C	ENST00000297405.5	-	38	6330	c.6086T>G	c.(6085-6087)tTt>tGt	p.F2029C	CSMD3_ENST00000455883.2_Missense_Mutation_p.F1925C|CSMD3_ENST00000352409.3_Missense_Mutation_p.F1959C|CSMD3_ENST00000343508.3_Missense_Mutation_p.F1989C	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	2029	CUB 11. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						GTCTGATTGAAAATTTAGATA	0.313										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																																							0													111.0	118.0	116.0					8																	113392631		2203	4293	6496	SO:0001583	missense	0			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.6086T>G	8.37:g.113392631A>C	ENSP00000297405:p.Phe2029Cys		Q96PZ3	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.F2029C	ENST00000297405.5	37	c.6086	CCDS6315.1	8	.	.	.	.	.	.	.	.	.	.	A	20.2	3.956872	0.73902	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.36340	1.26;1.26;1.26;1.26;1.26	5.64	5.64	0.86602	CUB (5);	0.000000	0.64402	D	0.000001	T	0.74997	0.3790	H	0.98612	4.28	0.50632	D	0.999884	D;D;D	0.89917	1.0;0.998;1.0	D;D;D	0.97110	0.999;0.998;1.0	D	0.84317	0.0514	10	0.49607	T	0.09	.	15.5045	0.75728	1.0:0.0:0.0:0.0	.	1925;2029;1989	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	C	1989;2029;1299;1925;1959	ENSP00000345799:F1989C;ENSP00000297405:F2029C;ENSP00000341558:F1299C;ENSP00000412263:F1925C;ENSP00000343124:F1959C	ENSP00000297405:F2029C	F	-	2	0	CSMD3	113461807	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.043000	0.76572	2.144000	0.66660	0.482000	0.46254	TTT	CSMD3	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom	ENSG00000164796		0.313	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	HGNC	protein_coding	OTTHUMT00000347141.1	-	0.00	61	0	A	NM_052900		113392631	-1	tier1	-	no_errors	ENST00000297405	ensembl	human	known	74_37	missense	25.69	81	28	SNP	1.000	C
CTBP2	1488	genome.wustl.edu	37	10	126678262	126678262	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr10:126678262G>T	ENST00000337195.5	-	11	1562	c.1163C>A	c.(1162-1164)cCg>cAg	p.P388Q	CTBP2_ENST00000309035.6_Missense_Mutation_p.P928Q|CTBP2_ENST00000494626.2_Missense_Mutation_p.P388Q|CTBP2_ENST00000334808.6_Missense_Mutation_p.P456Q|CTBP2_ENST00000531469.1_Missense_Mutation_p.P388Q|CTBP2_ENST00000411419.2_Missense_Mutation_p.P388Q	NM_001329.2	NP_001320.1	P56545	CTBP2_HUMAN	C-terminal binding protein 2	388					negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)|white fat cell differentiation (GO:0050872)	cell junction (GO:0030054)|nucleus (GO:0005634)|synapse (GO:0045202)|transcriptional repressor complex (GO:0017053)	NAD binding (GO:0051287)|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.173)		Colorectal(40;0.00572)|COAD - Colon adenocarcinoma(40;0.0127)|GBM - Glioblastoma multiforme(135;0.147)		GATGCCTGGCGGATATCTAAG	0.542																																																	0													44.0	46.0	45.0					10																	126678262		2203	4300	6503	SO:0001583	missense	0			AF016507	CCDS7643.1, CCDS7644.1	10q26.13	2008-08-01			ENSG00000175029	ENSG00000175029			2495	protein-coding gene	gene with protein product		602619				9479502, 11864595	Standard	NM_022802		Approved	ribeye	uc001lie.4	P56545	OTTHUMG00000019224	ENST00000337195.5:c.1163C>A	10.37:g.126678262G>T	ENSP00000338615:p.Pro388Gln		A8K2X5|D3DRF5|O43449|Q5SQP7|Q69YI3|Q86SV0|Q9H2T8	Missense_Mutation	SNP	pfam_D-isomer_2_OHA_DH_NAD-bd,pfam_D-isomer_2_OHA_DH_cat_dom	p.P928Q	ENST00000337195.5	37	c.2783	CCDS7643.1	10	.	.	.	.	.	.	.	.	.	.	G	14.41	2.526918	0.44969	.	.	ENSG00000175029	ENST00000337195;ENST00000309035;ENST00000334808;ENST00000531469;ENST00000494626;ENST00000411419	D;D;D;D;D;D	0.83506	-1.66;-1.66;-1.73;-1.66;-1.66;-1.66	5.09	5.09	0.68999	.	0.185952	0.47852	D	0.000215	D	0.85013	0.5600	L	0.43923	1.385	0.58432	D	0.999999	B;P;B	0.50943	0.012;0.94;0.191	B;P;B	0.52627	0.015;0.704;0.149	D	0.86276	0.1664	10	0.62326	D	0.03	.	18.6961	0.91601	0.0:0.0:1.0:0.0	.	388;928;456	P56545;P56545-2;Q5SQP8	CTBP2_HUMAN;.;.	Q	388;928;456;388;388;388	ENSP00000338615:P388Q;ENSP00000311825:P928Q;ENSP00000357816:P456Q;ENSP00000434630:P388Q;ENSP00000436285:P388Q;ENSP00000410474:P388Q	ENSP00000311825:P928Q	P	-	2	0	CTBP2	126668252	1.000000	0.71417	0.971000	0.41717	0.862000	0.49288	9.168000	0.94781	2.639000	0.89480	0.650000	0.86243	CCG	CTBP2	-	NULL	ENSG00000175029		0.542	CTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTBP2	HGNC	protein_coding	OTTHUMT00000050900.3		0.00	17	0	G	NM_001083914		126678262	-1			no_errors	ENST00000309035	ensembl	human	known	74_37	missense	6.67	28	2	SNP	1.000	T
CUX2	23316	genome.wustl.edu	37	12	111785396	111785396	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr12:111785396G>A	ENST00000261726.6	+	22	3882	c.3728G>A	c.(3727-3729)gGt>gAt	p.G1243D		NM_015267.3	NP_056082.2	O14529	CUX2_HUMAN	cut-like homeobox 2	1243					cellular response to organic substance (GO:0071310)|cognition (GO:0050890)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of synapse assembly (GO:0051965)|short-term memory (GO:0007614)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(24)|ovary(5)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	55						CCAAGCGGGGGTCCTGGAATC	0.662																																																	0													57.0	67.0	64.0					12																	111785396		1902	4110	6012	SO:0001583	missense	0			AB006631	CCDS41837.1	12q24.12	2011-06-20	2007-11-07	2007-11-07	ENSG00000111249	ENSG00000111249		"""Homeoboxes / CUT class"""	19347	protein-coding gene	gene with protein product		610648	"""cut-like 2 (Drosophila)"""	CUTL2			Standard	NM_015267		Approved	KIAA0293, CDP2	uc001tsa.2	O14529	OTTHUMG00000169546	ENST00000261726.6:c.3728G>A	12.37:g.111785396G>A	ENSP00000261726:p.Gly1243Asp		A7E2Y4	Missense_Mutation	SNP	pfam_Hmoeo_CUT,pfam_Homeobox_dom,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,superfamily_Prefoldin,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Hmoeo_CUT	p.G1243D	ENST00000261726.6	37	c.3728	CCDS41837.1	12	.	.	.	.	.	.	.	.	.	.	G	14.04	2.415687	0.42817	.	.	ENSG00000111249	ENST00000261726	T	0.44482	0.92	5.78	4.89	0.63831	.	0.173828	0.39544	N	0.001340	T	0.29524	0.0736	L	0.29908	0.895	0.34977	D	0.753675	B	0.20887	0.049	B	0.18263	0.021	T	0.31971	-0.9924	10	0.14656	T	0.56	-6.8542	12.4835	0.55859	0.0805:0.0:0.9195:0.0	.	1243	O14529	CUX2_HUMAN	D	1243	ENSP00000261726:G1243D	ENSP00000261726:G1243D	G	+	2	0	CUX2	110269779	0.558000	0.26554	0.977000	0.42913	0.923000	0.55619	1.245000	0.32790	1.445000	0.47624	0.650000	0.86243	GGT	CUX2	-	NULL	ENSG00000111249		0.662	CUX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUX2	HGNC	protein_coding	OTTHUMT00000404765.1	-	0.00	44	0	G	NM_015267		111785396	+1	tier1	-	no_errors	ENST00000261726	ensembl	human	known	74_37	missense	31.48	37	17	SNP	0.991	A
DDX39B	7919	genome.wustl.edu	37	6	31500611	31500611	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr6:31500611G>T	ENST00000396172.1	-	7	1443	c.813C>A	c.(811-813)gaC>gaA	p.D271E	ATP6V1G2-DDX39B_ENST00000376185.1_3'UTR|DDX39B_ENST00000415382.2_Missense_Mutation_p.D193E|DDX39B_ENST00000376177.2_Missense_Mutation_p.D271E|DDX39B_ENST00000458640.1_Missense_Mutation_p.D271E|DDX39B_ENST00000417556.2_Missense_Mutation_p.D286E|DDX39B_ENST00000462421.1_5'Flank	NM_004640.6	NP_004631.1	Q13838	DX39B_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 39B	271	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of DNA damage checkpoint (GO:2000002)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|RNA secondary structure unwinding (GO:0010501)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)|viral mRNA export from host cell nucleus (GO:0046784)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|transcription export complex (GO:0000346)	ATP binding (GO:0005524)|ATP-dependent protein binding (GO:0043008)|ATP-dependent RNA helicase activity (GO:0004004)|poly(A) RNA binding (GO:0044822)|RNA-dependent ATPase activity (GO:0008186)|U4 snRNA binding (GO:0030621)|U6 snRNA binding (GO:0017070)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	19						TCTTCTCGTTGTCCTTCAGTT	0.542																																																	0													135.0	107.0	117.0					6																	31500611		1511	2709	4220	SO:0001583	missense	0			Z37166	CCDS4697.1	6p21.33	2011-02-09	2011-02-08	2011-02-08	ENSG00000198563	ENSG00000198563		"""DEAD-boxes"""	13917	protein-coding gene	gene with protein product	"""U2AF65-associated protein 56"""	142560	"""HLA-B associated transcript 1"""	BAT1		7601445, 2813433	Standard	NM_004640		Approved	D6S81E, UAP56	uc003ntu.3	Q13838	OTTHUMG00000031165	ENST00000396172.1:c.813C>A	6.37:g.31500611G>T	ENSP00000379475:p.Asp271Glu		B0S8C0|O43496|Q0EFA1|Q2L6F9|Q53GL9|Q5RJ64|Q5RJ66|Q5ST94|Q5STB4|Q5STB5|Q5STB7|Q5STB8|Q5STU4|Q5STU5|Q5STU6|Q5STU8|Q71V76	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.D286E	ENST00000396172.1	37	c.858	CCDS4697.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.27|10.27	1.305002|1.305002	0.23736|0.23736	.|.	.|.	ENSG00000198563|ENSG00000198563	ENST00000376177;ENST00000458640;ENST00000396172;ENST00000417556;ENST00000415382;ENST00000431908;ENST00000427214|ENST00000417023	D;T;T;T;T;T;T|.	0.91996|.	-2.95;3.6;3.6;3.6;3.6;3.6;3.69|.	5.46|5.46	4.58|4.58	0.56647|0.56647	Helicase, C-terminal (1);|.	0.125934|.	0.50627|.	D|.	0.000118|.	T|T	0.12518|0.12518	0.0304|0.0304	N|N	0.01618|0.01618	-0.8|-0.8	0.80722|0.80722	D|D	1|1	B;B;B;B|.	0.14805|.	0.0;0.0;0.0;0.011|.	B;B;B;B|.	0.13407|.	0.0;0.002;0.0;0.009|.	T|T	0.14868|0.14868	-1.0457|-1.0457	10|5	0.02654|.	T|.	1|.	-22.1556|-22.1556	13.2483|13.2483	0.60036|0.60036	0.0:0.0:0.8398:0.1602|0.0:0.0:0.8398:0.1602	.|.	193;271;271;286|.	B4DP52;Q13838;Q5STU3;F8VQ10|.	.;DX39B_HUMAN;.;.|.	E|K	271;271;271;286;193;193;271|35	ENSP00000365347:D271E;ENSP00000416269:D271E;ENSP00000379475:D271E;ENSP00000412582:D286E;ENSP00000392669:D193E;ENSP00000408000:D193E;ENSP00000399371:D271E|.	ENSP00000365347:D271E|.	D|T	-|-	3|2	2|0	DDX39B|DDX39B	31608590|31608590	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	6.317000|6.317000	0.72862|0.72862	1.277000|1.277000	0.44412|0.44412	0.655000|0.655000	0.94253|0.94253	GAC|ACA	DDX39B	-	superfamily_P-loop_NTPase,pfscan_Helicase_C	ENSG00000198563		0.542	DDX39B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX39B	HGNC	protein_coding	OTTHUMT00000259083.1		0.00	46	0	G	NM_004640		31500611	-1			no_errors	ENST00000417556	ensembl	human	known	74_37	missense	5.71	66	4	SNP	1.000	T
DNAH9	1770	genome.wustl.edu	37	17	11648203	11648203	+	Silent	SNP	C	C	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr17:11648203C>T	ENST00000262442.4	+	31	6269	c.6201C>T	c.(6199-6201)gaC>gaT	p.D2067D	DNAH9_ENST00000454412.2_Silent_p.D2067D	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	2067					cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		GGCCTGAGGACCAGGTCCTGA	0.602																																																	0													63.0	56.0	58.0					17																	11648203		2203	4300	6503	SO:0001819	synonymous_variant	0			U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.6201C>T	17.37:g.11648203C>T			A2VCQ8|O15064|O95494|Q9NQ28	Silent	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.D2067	ENST00000262442.4	37	c.6201	CCDS11160.1	17																																																																																			DNAH9	-	superfamily_P-loop_NTPase	ENSG00000007174		0.602	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH9	HGNC	protein_coding	OTTHUMT00000252756.2	-	0.00	40	0	C	NM_001372		11648203	+1	tier1	-	no_errors	ENST00000262442	ensembl	human	known	74_37	silent	24.49	37	12	SNP	1.000	T
DNAJC5	80331	genome.wustl.edu	37	20	62562301	62562301	+	Missense_Mutation	SNP	C	C	A	rs144915847		TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr20:62562301C>A	ENST00000360864.4	+	4	572	c.419C>A	c.(418-420)gCg>gAg	p.A140E	DNAJC5_ENST00000369911.2_Missense_Mutation_p.A140E	NM_025219.2	NP_079495.1	Q9H3Z4	DNJC5_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 5	140					cell death (GO:0008219)|exocytosis (GO:0006887)|negative regulation of neuron apoptotic process (GO:0043524)|neurotransmitter secretion (GO:0007269)|regulated secretory pathway (GO:0045055)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)	clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)				cervix(1)|endometrium(1)|lung(1)|pancreas(1)|upper_aerodigestive_tract(1)	5	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					AAGCCCAAGGCGCCTGAAGGC	0.637																																																	0													101.0	83.0	89.0					20																	62562301		2203	4299	6502	SO:0001583	missense	0				CCDS13546.1	20q13.33	2014-09-17			ENSG00000101152	ENSG00000101152		"""Heat shock proteins / DNAJ (HSP40)"""	16235	protein-coding gene	gene with protein product		611203	"""ceroid-lipofuscinosis, neuronal 4 (Kufs disease)"""	CLN4			Standard	NM_025219		Approved	FLJ00118, FLJ13070, DNAJC5A	uc002yhf.3	Q9H3Z4	OTTHUMG00000033007	ENST00000360864.4:c.419C>A	20.37:g.62562301C>A	ENSP00000354111:p.Ala140Glu		A8K0M0|B3KY68|E1P5G8|Q9H3Z5|Q9H7H2	Missense_Mutation	SNP	pfam_DnaJ_domain,superfamily_DnaJ_domain,smart_DnaJ_domain,pfscan_DnaJ_domain,prints_DnaJ_domain	p.A140E	ENST00000360864.4	37	c.419	CCDS13546.1	20	.	.	.	.	.	.	.	.	.	.	C	16.48	3.136209	0.56936	.	.	ENSG00000101152	ENST00000369911;ENST00000360864	T;T	0.69561	-0.41;-0.4	5.91	5.91	0.95273	.	0.153219	0.64402	D	0.000014	T	0.65004	0.2650	L	0.42245	1.32	0.49483	D	0.999793	B;B	0.24368	0.102;0.101	B;B	0.29942	0.109;0.061	T	0.58250	-0.7669	10	0.37606	T	0.19	.	20.3053	0.98627	0.0:1.0:0.0:0.0	.	140;140	Q9H3Z4-2;Q9H3Z4	.;DNJC5_HUMAN	E	140	ENSP00000358927:A140E;ENSP00000354111:A140E	ENSP00000354111:A140E	A	+	2	0	DNAJC5	62032745	1.000000	0.71417	0.752000	0.31206	0.188000	0.23474	5.197000	0.65141	2.808000	0.96608	0.655000	0.94253	GCG	DNAJC5	-	NULL	ENSG00000101152		0.637	DNAJC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC5	HGNC	protein_coding	OTTHUMT00000080244.1		0.00	24	0	C	NM_025219		62562301	+1			no_errors	ENST00000360864	ensembl	human	known	74_37	missense	5.56	34	2	SNP	1.000	A
EDC4	23644	genome.wustl.edu	37	16	67913016	67913016	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr16:67913016G>T	ENST00000358933.5	+	12	1683	c.1444G>T	c.(1444-1446)Gag>Tag	p.E482*	AC040162.1_ENST00000408599.1_RNA|EDC4_ENST00000574770.1_3'UTR	NM_014329.4	NP_055144.3	Q6P2E9	EDC4_HUMAN	enhancer of mRNA decapping 4	482					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(4)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	41		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)		GCCTGCCGAAGAGGAAAATGA	0.592																																																	0													40.0	39.0	39.0					16																	67913016		2198	4300	6498	SO:0001587	stop_gained	0			U17474	CCDS10849.1	16q22.1	2008-02-05			ENSG00000038358	ENSG00000038358			17157	protein-coding gene	gene with protein product		606030				9067524	Standard	NM_014329		Approved	RCD-8, Ge-1, HEDLS	uc002eur.3	Q6P2E9	OTTHUMG00000137543	ENST00000358933.5:c.1444G>T	16.37:g.67913016G>T	ENSP00000351811:p.Glu482*		A6NGM1|A8K4T4|Q13025|Q13826|Q6ZR12|Q7Z6H7	Nonsense_Mutation	SNP	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E482*	ENST00000358933.5	37	c.1444	CCDS10849.1	16	.	.	.	.	.	.	.	.	.	.	G	39	7.597568	0.98381	.	.	ENSG00000038358	ENST00000358933;ENST00000536072	.	.	.	5.53	5.53	0.82687	.	0.143577	0.64402	D	0.000007	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15066	T	0.55	-25.1324	17.412	0.87488	0.0:0.0:1.0:0.0	.	.	.	.	X	482;414	.	ENSP00000351811:E482X	E	+	1	0	EDC4	66470517	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	9.541000	0.98083	2.882000	0.98803	0.655000	0.94253	GAG	EDC4	-	NULL	ENSG00000038358		0.592	EDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EDC4	HGNC	protein_coding	OTTHUMT00000268874.2		0.00	24	0	G	NM_014329		67913016	+1			no_errors	ENST00000358933	ensembl	human	known	74_37	nonsense	5.26	36	2	SNP	1.000	T
EFCAB1	79645	genome.wustl.edu	37	8	49647767	49647767	+	5'UTR	SNP	G	G	A			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr8:49647767G>A	ENST00000262103.3	-	0	24				EFCAB1_ENST00000523092.1_5'UTR|EFCAB1_ENST00000433756.1_5'UTR|EFCAB1_ENST00000521002.1_5'UTR	NM_024593.3	NP_078869.1	Q9HAE3	EFCB1_HUMAN	EF-hand calcium binding domain 1								calcium ion binding (GO:0005509)			endometrium(1)|large_intestine(3)|lung(6)|pancreas(1)|prostate(1)|urinary_tract(2)	14		all_epithelial(80;0.0134)|Lung NSC(129;0.0207)|all_lung(136;0.0464)				CGGCTACCGAGACCCTCGCGG	0.647																																																	0													55.0	47.0	49.0					8																	49647767		692	1591	2283	SO:0001623	5_prime_UTR_variant	0				CCDS6145.1, CCDS47853.1	8q11.21	2013-01-10			ENSG00000034239	ENSG00000034239		"""EF-hand domain containing"""	25678	protein-coding gene	gene with protein product						12477932	Standard	NM_024593		Approved	FLJ11767	uc003xqo.2	Q9HAE3	OTTHUMG00000164203	ENST00000262103.3:c.-57C>T	8.37:g.49647767G>A			B4DSB4|E7EVN7	RNA	SNP	-	NULL	ENST00000262103.3	37	NULL	CCDS6145.1	8																																																																																			EFCAB1	-	-	ENSG00000034239		0.647	EFCAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFCAB1	HGNC	protein_coding	OTTHUMT00000377778.1	-	0.00	15	0	G	NM_024593		49647767	-1	tier1	-	no_errors	ENST00000521002	ensembl	human	known	74_37	rna	37.18	49	29	SNP	0.003	A
ELMSAN1	91748	genome.wustl.edu	37	14	74205926	74205928	+	In_Frame_Del	DEL	CTG	CTG	-			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	CTG	CTG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr14:74205926_74205928delCTG	ENST00000286523.5	-	2	1566_1568	c.784_786delCAG	c.(784-786)cagdel	p.Q262del	ELMSAN1_ENST00000394071.2_In_Frame_Del_p.Q262del|ELMSAN1_ENST00000486739.1_5'Flank	NM_194278.3	NP_919254.2	Q6PJG2	EMSA1_HUMAN	ELM2 and Myb/SANT-like domain containing 1	262	Gln-rich.|Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)										GTAGGgctgcctgctgctgctgc	0.65																																																	0																																										SO:0001651	inframe_deletion	0			BF971739	CCDS9819.1	14q24.3	2012-09-25	2012-09-25	2012-09-25	ENSG00000156030	ENSG00000156030			19853	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 117"", ""chromosome 14 open reading frame 43"""	C14orf117, C14orf43			Standard	NM_194278		Approved	LSR68	uc001xou.3	Q6PJG2	OTTHUMG00000150359	ENST00000286523.5:c.784_786delCAG	14.37:g.74205935_74205937delCTG	ENSP00000286523:p.Gln262del		Q6PK13|Q6PK59|Q6ZS23	In_Frame_Del	DEL	pfam_ELM2_dom,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_ELM2_dom	p.Q262in_frame_del	ENST00000286523.5	37	c.786_784	CCDS9819.1	14																																																																																			ELMSAN1	-	NULL	ENSG00000156030		0.650	ELMSAN1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ELMSAN1	HGNC	protein_coding	OTTHUMT00000317793.1		0.00	56	0	CTG	NM_194278		74205928	-1			no_errors	ENST00000286523	ensembl	human	known	74_37	in_frame_del	6.32	89	6	DEL	1.000:1.000:1.000	0
EMD	2010	genome.wustl.edu	37	X	153609472	153609472	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chrX:153609472G>T	ENST00000369842.4	+	6	968	c.680G>T	c.(679-681)gGc>gTc	p.G227V	EMD_ENST00000369835.3_Missense_Mutation_p.G192V|EMD_ENST00000492448.1_3'UTR	NM_000117.2	NP_000108.1	P50402	EMD_HUMAN	emerin	227					cellular response to growth factor stimulus (GO:0071363)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic nuclear envelope reassembly (GO:0007084)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of fibroblast proliferation (GO:0048147)|positive regulation of protein export from nucleus (GO:0046827)|regulation of canonical Wnt signaling pathway (GO:0060828)|skeletal muscle cell differentiation (GO:0035914)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|microtubule (GO:0005874)|nuclear envelope (GO:0005635)|nuclear inner membrane (GO:0005637)|nuclear membrane (GO:0031965)|nuclear outer membrane (GO:0005640)	actin binding (GO:0003779)|beta-tubulin binding (GO:0048487)			lung(5)	5	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CCGCTCTGGGGCCAGCTGCTG	0.592																																																	0													67.0	61.0	63.0					X																	153609472		2203	4300	6503	SO:0001583	missense	0			X82434	CCDS14745.1	Xq27.3-q28	2014-09-17	2008-07-29		ENSG00000102119	ENSG00000102119			3331	protein-coding gene	gene with protein product	"""LEM domain containing 5"""	300384	"""Emery-Dreifuss muscular dystrophy"""				Standard	NM_000117		Approved	STA, LEMD5	uc004fkl.3	P50402	OTTHUMG00000033186	ENST00000369842.4:c.680G>T	X.37:g.153609472G>T	ENSP00000358857:p.Gly227Val		Q6FI02	Missense_Mutation	SNP	pfam_LEM_dom,superfamily_LEM/LEM-like_dom,smart_LEM_dom,pfscan_LEM_dom	p.G227V	ENST00000369842.4	37	c.680	CCDS14745.1	X	.	.	.	.	.	.	.	.	.	.	G	13.76	2.332342	0.41297	.	.	ENSG00000102119	ENST00000369842;ENST00000369835	T;D	0.84223	-1.34;-1.82	4.91	3.92	0.45320	.	0.219986	0.37348	N	0.002124	T	0.75162	0.3812	L	0.32530	0.975	0.48288	D	0.999629	P	0.43094	0.799	B	0.40825	0.341	T	0.71159	-0.4674	10	0.23302	T	0.38	-23.3071	8.1898	0.31361	0.0:0.0:0.6927:0.3073	.	227	P50402	EMD_HUMAN	V	227;192	ENSP00000358857:G227V;ENSP00000358850:G192V	ENSP00000358850:G192V	G	+	2	0	EMD	153262666	1.000000	0.71417	1.000000	0.80357	0.869000	0.49853	2.009000	0.40903	2.172000	0.68678	0.513000	0.50165	GGC	EMD	-	NULL	ENSG00000102119		0.592	EMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMD	HGNC	protein_coding	OTTHUMT00000080921.1		0.00	47	0	G			153609472	+1			no_errors	ENST00000369842	ensembl	human	known	74_37	missense	5.56	68	4	SNP	0.999	T
EME1	146956	genome.wustl.edu	37	17	48452977	48452977	+	Silent	SNP	A	A	G	rs76981894		TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr17:48452977A>G	ENST00000338165.4	+	2	490	c.408A>G	c.(406-408)aaA>aaG	p.K136K	MRPL27_ENST00000507088.1_5'Flank|EME1_ENST00000393271.2_Silent_p.K136K|MRPL27_ENST00000442592.3_5'Flank|EME1_ENST00000511648.2_Silent_p.K136K|MRPL27_ENST00000503633.1_5'Flank|MRPL27_ENST00000225969.4_5'Flank	NM_152463.2	NP_689676.2	Q96AY2	EME1_HUMAN	essential meiotic structure-specific endonuclease 1	136					DNA recombination (GO:0006310)|DNA repair (GO:0006281)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	cytoplasm (GO:0005737)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)			endometrium(4)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|stomach(2)|upper_aerodigestive_tract(1)	19	Breast(11;5.62e-19)		BRCA - Breast invasive adenocarcinoma(22;2.43e-08)			GTGACTGGAAAAAGCCCTTTC	0.468								Direct reversal of damage;Homologous recombination																																									0													77.0	81.0	80.0					17																	48452977		2203	4300	6503	SO:0001819	synonymous_variant	0			BC016470	CCDS11565.1, CCDS54141.1	17q21.33	2013-07-03	2013-07-03			ENSG00000154920			24965	protein-coding gene	gene with protein product	"""SLX2 structure-specific endonuclease subunit homolog A (S. cerevisiae)"""	610885	"""essential meiotic endonuclease 1 homolog 1 (S. pombe)"""			12721304	Standard	NM_001166131		Approved	FLJ31364, MMS4L, SLX2A	uc010dbp.2	Q96AY2		ENST00000338165.4:c.408A>G	17.37:g.48452977A>G			Q96N62	Silent	SNP	pfam_ERCC4_domain,smart_ERCC4_domain	p.K136	ENST00000338165.4	37	c.408	CCDS11565.1	17																																																																																			EME1	-	NULL	ENSG00000154920		0.468	EME1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EME1	HGNC	protein_coding	OTTHUMT00000367118.3		0.00	57	0	A	NM_152463		48452977	+1			no_errors	ENST00000393271	ensembl	human	known	74_37	silent	6.42	102	7	SNP	0.140	G
SNORA75	654321	genome.wustl.edu	37	12	9439294	9439294	+	RNA	SNP	T	T	C	rs200340789		TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr12:9439294T>C	ENST00000391138.1	-	0	124									small nucleolar RNA, H/ACA box 75																		CAGCCAAATATACCTCTGTAA	0.343																																																	0																																												0			AJ007015		2q37.1	2013-09-05			ENSG00000206885	ENSG00000206885		"""ncRNAs / Small nucleolar RNAs : H/ACA box containing"""	32661	non-coding RNA	RNA, small nucleolar						15199136, 16381836	Standard	NR_002921		Approved	U23	uc021quo.1				12.37:g.9439294T>C				RNA	SNP	-	NULL	ENST00000391138.1	37	NULL		12																																																																																			SNORA75	-	-	ENSG00000212440		0.343	SNORA75.3-201	NOVEL	basic	snoRNA	ENSG00000212440	RFAM	snoRNA		-	0.00	10	0	T	NR_002921		9439294	-1	tier1	rs200340789	no_errors	ENST00000391138	ensembl	human	novel	74_37	rna	46.67	8	7	SNP	0.012	C
MPP7	143098	genome.wustl.edu	37	10	28599880	28599880	+	RNA	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr10:28599880G>T	ENST00000410442.1	+	0	99																											TTTTCTCTTAGCTAAAATTAC	0.358																																																	0																																												0																															10.37:g.28599880G>T				RNA	SNP	-	NULL	ENST00000410442.1	37	NULL		10																																																																																			AC022021.1	-	-	ENSG00000222374		0.358	AC022021.1-201	NOVEL	basic	miRNA	ENSG00000222374	Clone_based_ensembl_gene	miRNA		-	0.00	47	0	G			28599880	+1	tier1	-	no_errors	ENST00000410442	ensembl	human	novel	74_37	rna	8.89	41	4	SNP	0.038	T
RP11-782C8.2	0	genome.wustl.edu	37	1	143119076	143119076	+	lincRNA	SNP	C	C	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr1:143119076C>T	ENST00000412204.2	-	0	5411				RP11-782C8.1_ENST00000438000.1_lincRNA																							TTTCCAGTGTCCTCTGGGTGT	0.418																																																	0																																												0																															1.37:g.143119076C>T				RNA	SNP	-	NULL	ENST00000412204.2	37	NULL		1																																																																																			RP11-782C8.2	-	-	ENSG00000232274		0.418	RP11-782C8.2-004	KNOWN	basic	lincRNA	ENSG00000232274	Clone_based_vega_gene	lincRNA	OTTHUMT00000037567.2	-	0.00	52	0	C			143119076	-1	tier1	-	no_errors	ENST00000412204	ensembl	human	known	74_37	rna	31.48	36	17	SNP	0.001	T
RP3-470B24.5	0	genome.wustl.edu	37	6	168377317	168377319	+	lincRNA	DEL	AGG	AGG	-			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	AGG	AGG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr6:168377317_168377319delAGG	ENST00000538528.1	-	0	300_302																											GAGGAGAAGAAGGCAGTGGGGGT	0.645																																																	0																																												0																															6.37:g.168377317_168377319delAGG				RNA	DEL	-	NULL	ENST00000538528.1	37	NULL		6																																																																																			RP3-470B24.5	-	-	ENSG00000235994		0.645	RP3-470B24.5-201	KNOWN	basic	lincRNA	ENSG00000235994	Clone_based_vega_gene	lincRNA			0.00	129	0	AGG			168377319	-1			no_errors	ENST00000441716	ensembl	human	known	74_37	rna	6.13	153	10	DEL	0.978:0.981:0.976	0
FAM27B	100133121	genome.wustl.edu	37	9	67793716	67793716	+	Intron	SNP	G	G	C	rs62543668		TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr9:67793716G>C	ENST00000377484.3	-	1	215				RP11-12A20.7_ENST00000315762.5_RNA			Q5VT28	FAM27_HUMAN	family with sequence similarity 27, member B																		cacacacacagagacacacac	0.542																																																	0																																										SO:0001627	intron_variant	0					9q13	2014-05-06			ENSG00000170215	ENSG00000278763			23667	other	unknown							Standard	NR_027422		Approved	bA12A20.3, FAM27A2	uc004aet.4	Q5VT28	OTTHUMG00000188586	ENST00000377484.3:c.78+180C>G	9.37:g.67793716G>C				RNA	SNP	-	NULL	ENST00000377484.3	37	NULL		9																																																																																			RP11-12A20.7	-	-	ENSG00000236233		0.542	FAM27B-001	KNOWN	basic|appris_principal	protein_coding	ENSG00000236233	Clone_based_vega_gene	protein_coding	OTTHUMT00000037106.1	-	0.00	12	0	G	NR_027422		67793716	+1	tier1	rs62543668	no_errors	ENST00000315762	ensembl	human	known	74_37	rna	50.00	5	5	SNP	0.019	C
NUP214	8021	genome.wustl.edu	37	9	134039651	134039652	+	Intron	DEL	GT	GT	-			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	GT	GT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr9:134039651_134039652delGT	ENST00000359428.5	+	21	3037				RP11-544A12.4_ENST00000589128.1_RNA|RP11-544A12.4_ENST00000589095.1_RNA|RP11-544A12.4_ENST00000590461.1_RNA|RP11-544A12.4_ENST00000589540.1_RNA|RP11-544A12.4_ENST00000417798.2_RNA|RP11-544A12.4_ENST00000586290.1_RNA|RP11-544A12.4_ENST00000589667.1_RNA|RP11-544A12.4_ENST00000588378.1_RNA|RP11-544A12.4_ENST00000587408.1_RNA|NUP214_ENST00000411637.2_Intron|RP11-544A12.4_ENST00000415391.2_RNA|RP11-544A12.4_ENST00000587264.1_RNA|RP11-544A12.4_ENST00000588325.1_RNA|NUP214_ENST00000451030.1_Intron|RP11-544A12.4_ENST00000592466.1_RNA|RP11-544A12.4_ENST00000586662.1_RNA			P35658	NU214_HUMAN	nucleoporin 214kDa						carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|regulation of cell cycle (GO:0051726)|regulation of glucose transport (GO:0010827)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleocytoplasmic transporter activity (GO:0005487)|transporter activity (GO:0005215)			NS(1)|breast(9)|central_nervous_system(3)|endometrium(13)|kidney(2)|large_intestine(9)|liver(2)|lung(29)|ovary(2)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	86	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;3.42e-05)|Epithelial(140;0.000256)		gtgtgtgtaagtgtgtgtgtgt	0.455			T	"""DEK, SET, ABL1"""	"""AML, T-ALL"""																																Pancreas(4;24 48 25510 30394 32571)			Dom	yes		9	9q34.1	8021	nucleoporin 214kDa (CAN)		L	0																																										SO:0001627	intron_variant	0			X64228	CCDS6940.1	9q34	2008-07-21	2002-08-29		ENSG00000126883	ENSG00000126883			8064	protein-coding gene	gene with protein product	"""nuclear pore complex protein Nup214"", ""CAN protein, putative oncogene"""	114350	"""nucleoporin 214kD (CAIN)"""			8108440, 2370860	Standard	NM_005085		Approved	CAIN, CAN, D9S46E, N214	uc004cag.3	P35658	OTTHUMG00000020816	ENST00000359428.5:c.2893+120GT>-	9.37:g.134039661_134039662delGT			A6NFQ0|Q15010|Q3KQZ0|Q5JUP7|Q75R47|Q86XD3	RNA	DEL	-	NULL	ENST00000359428.5	37	NULL	CCDS6940.1	9																																																																																			RP11-544A12.4	-	-	ENSG00000236986		0.455	NUP214-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ENSG00000236986	Clone_based_vega_gene	protein_coding	OTTHUMT00000054694.2		0.00	25	0	GT	NM_005085		134039652	-1	tier1		no_errors	ENST00000592466	ensembl	human	known	74_37	rna	7.14	26	2	DEL	0.000:0.004	-
PDE10A	10846	genome.wustl.edu	37	6	166355807	166355807	+	Intron	SNP	C	C	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr6:166355807C>T	ENST00000535229.1	-	1	389				AL590482.1_ENST00000516387.1_RNA			Q9Y233	PDE10_HUMAN	phosphodiesterase 10A						blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|metal ion binding (GO:0046872)			breast(4)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(39)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	71		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Caffeine(DB00201)|Dipyridamole(DB00975)|Papaverine(DB01113)|Tofisopam(DB08811)|Triflusal(DB08814)	cacatatatGCGCACACACAC	0.358																																					Esophageal Squamous(22;308 615 5753 12038 40624)												0																																										SO:0001627	intron_variant	0			AB020593	CCDS47513.1	6q26	2008-03-18			ENSG00000112541	ENSG00000112541	3.1.4.17	"""Phosphodiesterases"""	8772	protein-coding gene	gene with protein product		610652				10373451	Standard	NM_001130690		Approved		uc003quo.3	Q9Y233	OTTHUMG00000015986	ENST00000535229.1:c.1655+43788G>A	6.37:g.166355807C>T			Q6FHX1|Q9HCP9|Q9NTV4|Q9ULW9|Q9Y5T1	RNA	SNP	-	NULL	ENST00000535229.1	37	NULL		6																																																																																			AL590482.1	-	-	ENSG00000252196		0.358	PDE10A-004	KNOWN	mRNA_end_NF|basic	processed_transcript	ENSG00000252196	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000470299.1		0.00	53	0	C			166355807	-1			no_errors	ENST00000516387	ensembl	human	novel	74_37	rna	5.62	84	5	SNP	0.000	T
RIN1	9610	genome.wustl.edu	37	11	66103925	66103925	+	5'UTR	SNP	C	C	A	rs576729986		TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr11:66103925C>A	ENST00000311320.4	-	0	75				RIN1_ENST00000530056.1_Intron|RIN1_ENST00000424433.2_5'Flank|RP11-867G23.12_ENST00000526655.1_RNA|RIN1_ENST00000524804.1_5'Flank	NM_004292.2	NP_004283.2	Q13671	RIN1_HUMAN	Ras and Rab interactor 1						associative learning (GO:0008306)|endocytosis (GO:0006897)|memory (GO:0007613)|negative regulation of synaptic plasticity (GO:0031914)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(1)|lung(8)|ovary(1)	14						AGGCAAGGCACGCACATCCCC	0.637																																																	0													12.0	15.0	14.0					11																	66103925		1326	2308	3634	SO:0001623	5_prime_UTR_variant	0			L36463	CCDS31614.1	11q13.2	2005-09-18				ENSG00000174791			18749	protein-coding gene	gene with protein product		605965				9144171, 1849280	Standard	NM_004292		Approved		uc001ohn.1	Q13671		ENST00000311320.4:c.-52G>T	11.37:g.66103925C>A			O15010|Q00427|Q96CC8	RNA	SNP	-	NULL	ENST00000311320.4	37	NULL	CCDS31614.1	11																																																																																			RP11-867G23.12	-	-	ENSG00000254756		0.637	RIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000254756	Clone_based_vega_gene	protein_coding	OTTHUMT00000392980.2	-	0.00	35	0	C	NM_004292		66103925	+1	tier1	-	no_errors	ENST00000526655	ensembl	human	known	74_37	rna	30.34	62	27	SNP	0.738	A
RP11-51L5.5	0	genome.wustl.edu	37	17	60366660	60366660	+	RNA	SNP	T	T	C			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr17:60366660T>C	ENST00000602493.1	-	0	420																											CCCTTGTGTCTATCTATTTTA	0.294																																																	0																																												0																															17.37:g.60366660T>C				RNA	SNP	-	NULL	ENST00000602493.1	37	NULL		17																																																																																			RP11-51L5.5	-	-	ENSG00000263887		0.294	RP11-51L5.5-002	KNOWN	basic	processed_transcript	ENSG00000263887	Clone_based_vega_gene	pseudogene	OTTHUMT00000467668.1	-	0.00	42	0	T			60366660	-1	tier1	-	no_errors	ENST00000602493	ensembl	human	known	74_37	rna	13.16	99	15	SNP	1.000	C
ENTPD1	953	genome.wustl.edu	37	10	97604276	97604276	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr10:97604276G>T	ENST00000371205.4	+	5	740	c.457G>T	c.(457-459)Gag>Tag	p.E153*	ENTPD1_ENST00000453258.2_Nonsense_Mutation_p.E160*|ENTPD1_ENST00000371203.5_Nonsense_Mutation_p.E15*|ENTPD1_ENST00000539125.1_Nonsense_Mutation_p.E15*|ENTPD1_ENST00000490659.1_3'UTR|ENTPD1_ENST00000543964.1_Nonsense_Mutation_p.E45*|ENTPD1-AS1_ENST00000416301.1_RNA|RP11-429G19.3_ENST00000433113.1_RNA|ENTPD1_ENST00000371207.3_Nonsense_Mutation_p.E165*			P49961	ENTP1_HUMAN	ectonucleoside triphosphate diphosphohydrolase 1	153					ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|G-protein coupled receptor signaling pathway (GO:0007186)|platelet activation (GO:0030168)|purine ribonucleoside diphosphate catabolic process (GO:0009181)	basal lamina (GO:0005605)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|nucleoside-diphosphatase activity (GO:0017110)|nucleoside-triphosphatase activity (GO:0017111)			cervix(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(3)|prostate(1)|skin(1)	16		Colorectal(252;0.0821)		Epithelial(162;1.31e-07)|all cancers(201;5.33e-06)		GGATGTGGTGGAGAGGAGCCT	0.443																																																	0													167.0	161.0	163.0					10																	97604276		2203	4300	6503	SO:0001587	stop_gained	0			S73813	CCDS7444.1, CCDS53556.1, CCDS53557.1, CCDS53558.1, CCDS41554.1	10q24.1	2014-03-03			ENSG00000138185	ENSG00000138185		"""CD molecules"""	3363	protein-coding gene	gene with protein product		601752		CD39		9226376, 24482476	Standard	NM_001098175		Approved	NTPDase-1, ATPDase, SPG64	uc010qoj.2	P49961	OTTHUMG00000018818	ENST00000371205.4:c.457G>T	10.37:g.97604276G>T	ENSP00000360248:p.Glu153*		A9Z1X8|B4DWB9|B4E1X1|B7Z599|G3XAF6|Q5T561|Q5T562|Q86VV3|Q9UQQ9|Q9Y3Q9	Nonsense_Mutation	SNP	pfam_GDA1_CD39_NTPase	p.E165*	ENST00000371205.4	37	c.493	CCDS7444.1	10	.	.	.	.	.	.	.	.	.	.	G	16.24	3.066924	0.55539	.	.	ENSG00000138185	ENST00000453258;ENST00000371206;ENST00000371207;ENST00000543964;ENST00000539125;ENST00000371203;ENST00000371205	.	.	.	6.07	-10.9	0.00192	.	1.204120	0.05671	N	0.588648	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06891	T	0.86	0.1224	7.5347	0.27704	0.1634:0.0:0.344:0.4927	.	.	.	.	X	160;160;165;45;15;15;153	.	ENSP00000360246:E15X	E	+	1	0	ENTPD1	97594266	0.240000	0.23847	0.000000	0.03702	0.037000	0.13140	0.314000	0.19432	-2.012000	0.00950	-0.302000	0.09304	GAG	ENTPD1	-	pfam_GDA1_CD39_NTPase	ENSG00000138185		0.443	ENTPD1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	ENTPD1	HGNC	protein_coding	OTTHUMT00000049566.1	-	0.00	75	0	G	NM_001776		97604276	+1	tier1	-	no_errors	ENST00000371207	ensembl	human	known	74_37	nonsense	28.97	76	31	SNP	0.001	T
EPHA3	2042	genome.wustl.edu	37	3	89462365	89462365	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr3:89462365G>T	ENST00000336596.2	+	10	2062	c.1837G>T	c.(1837-1839)Gcc>Tcc	p.A613S	EPHA3_ENST00000494014.1_Missense_Mutation_p.A613S	NM_005233.5	NP_005224.2	P29320	EPHA3_HUMAN	EPH receptor A3	613					cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|ephrin receptor signaling pathway (GO:0048013)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rho GTPase activity (GO:0032319)	early endosome (GO:0005769)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(26)|liver(3)|lung(67)|ovary(7)|pancreas(1)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)	139	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		TCATGAGTTTGCCAAGGAATT	0.433										TSP Lung(6;0.00050)																																							0													176.0	156.0	163.0					3																	89462365		2203	4299	6502	SO:0001583	missense	0			M83941	CCDS2922.1, CCDS46875.1	3p11.2	2013-02-11	2004-10-28		ENSG00000044524	ENSG00000044524	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3387	protein-coding gene	gene with protein product		179611	"""EphA3"""	ETK, ETK1, TYRO4		1737782, 1311845	Standard	NM_005233		Approved	HEK, HEK4	uc003dqy.3	P29320	OTTHUMG00000159040	ENST00000336596.2:c.1837G>T	3.37:g.89462365G>T	ENSP00000337451:p.Ala613Ser		Q9H2V3|Q9H2V4	Missense_Mutation	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_2,pfam_SAM_type1,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom	p.A613S	ENST00000336596.2	37	c.1837	CCDS2922.1	3	.	.	.	.	.	.	.	.	.	.	G	34	5.370123	0.95900	.	.	ENSG00000044524	ENST00000336596;ENST00000494014	T;T	0.23552	1.9;1.9	5.95	5.95	0.96441	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.64549	0.2608	M	0.93638	3.44	0.80722	D	1	D	0.54964	0.969	D	0.71656	0.974	T	0.72124	-0.4385	9	.	.	.	.	20.3812	0.98933	0.0:0.0:1.0:0.0	.	613	P29320	EPHA3_HUMAN	S	613	ENSP00000337451:A613S;ENSP00000419190:A613S	.	A	+	1	0	EPHA3	89545055	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.914000	0.87478	2.821000	0.97095	0.650000	0.86243	GCC	EPHA3	-	pirsf_Tyr_kinase_ephrin_rcpt,superfamily_Kinase-like_dom	ENSG00000044524		0.433	EPHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA3	HGNC	protein_coding	OTTHUMT00000352995.1	-	0.00	88	0	G	NM_005233		89462365	+1	tier1	-	no_errors	ENST00000336596	ensembl	human	known	74_37	missense	5.71	66	4	SNP	1.000	T
EPHA7	2045	genome.wustl.edu	37	6	93956675	93956675	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr6:93956675C>T	ENST00000369303.4	-	15	2745	c.2561G>A	c.(2560-2562)cGt>cAt	p.R854H		NM_004440.3	NP_004431.1	Q15375	EPHA7_HUMAN	EPH receptor A7	854	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				brain development (GO:0007420)|branching morphogenesis of a nerve (GO:0048755)|ephrin receptor signaling pathway (GO:0048013)|negative chemotaxis (GO:0050919)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of cell-cell adhesion (GO:0022407)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of protein autophosphorylation (GO:0031952)|retinal ganglion cell axon guidance (GO:0031290)	dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|chemorepellent activity (GO:0045499)|GPI-linked ephrin receptor activity (GO:0005004)|protein tyrosine kinase activity (GO:0004713)			NS(1)|breast(1)|central_nervous_system(7)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|lung(43)|ovary(8)|pancreas(1)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(13)|urinary_tract(1)	112		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)		BRCA - Breast invasive adenocarcinoma(108;0.0847)		TGCTGGTAAACGATAACCTTC	0.388																																																	0													82.0	82.0	82.0					6																	93956675		2203	4300	6503	SO:0001583	missense	0			L36642	CCDS5031.1, CCDS75494.1	6q16.3	2013-02-11	2004-10-28		ENSG00000135333	ENSG00000135333		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3390	protein-coding gene	gene with protein product		602190	"""EphA7"""			9267020	Standard	NM_004440		Approved	Hek11	uc003poe.3	Q15375	OTTHUMG00000015228	ENST00000369303.4:c.2561G>A	6.37:g.93956675C>T	ENSP00000358309:p.Arg854His		A0AUX7|B2R8W1|B7ZLJ9|B7ZLK0|Q59G40|Q5VTU0|Q8N368|Q9H124	Missense_Mutation	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom	p.R854H	ENST00000369303.4	37	c.2561	CCDS5031.1	6	.	.	.	.	.	.	.	.	.	.	C	35	5.483443	0.96307	.	.	ENSG00000135333	ENST00000369303	D	0.85411	-1.98	5.98	5.98	0.97165	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.93874	0.8040	M	0.90082	3.085	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.986;1.0;1.0	D	0.93957	0.7237	10	0.87932	D	0	.	20.452	0.99131	0.0:1.0:0.0:0.0	.	850;849;854	Q15375-4;Q15375-2;Q15375	.;.;EPHA7_HUMAN	H	854	ENSP00000358309:R854H	ENSP00000358309:R854H	R	-	2	0	EPHA7	94013396	1.000000	0.71417	0.974000	0.42286	0.973000	0.67179	7.726000	0.84824	2.838000	0.97847	0.591000	0.81541	CGT	EPHA7	-	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000135333		0.388	EPHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA7	HGNC	protein_coding	OTTHUMT00000041545.1	-	0.00	60	0	C			93956675	-1	tier1	-	no_errors	ENST00000369303	ensembl	human	known	74_37	missense	28.26	33	13	SNP	1.000	T
EVPL	2125	genome.wustl.edu	37	17	74017554	74017554	+	Missense_Mutation	SNP	G	G	T	rs74955334	byFrequency	TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr17:74017554G>T	ENST00000301607.3	-	9	1259	c.1006C>A	c.(1006-1008)Cgc>Agc	p.R336S	EVPL_ENST00000586740.1_Missense_Mutation_p.R336S	NM_001988.2	NP_001979.2	Q92817	EVPL_HUMAN	envoplakin	336	Globular 1.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cell junction (GO:0030054)|cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)	p.R336S(1)		breast(4)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(14)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	54						CTCACCCGGCGGTAGTCCTCC	0.701																																																	1	Substitution - Missense(1)	prostate(1)											25.0	23.0	23.0					17																	74017554		2200	4298	6498	SO:0001583	missense	0			U53786	CCDS11737.1	17q25	2008-07-18				ENSG00000167880			3503	protein-coding gene	gene with protein product		601590				8938451, 10409435	Standard	NM_001988		Approved	EVPK	uc002jqi.2	Q92817		ENST00000301607.3:c.1006C>A	17.37:g.74017554G>T	ENSP00000301607:p.Arg336Ser		A0AUV5	Missense_Mutation	SNP	pfam_Plectin_repeat,superfamily_Ferritin-like_SF,smart_Spectrin/alpha-actinin,smart_Plectin_repeat	p.R336S	ENST00000301607.3	37	c.1006	CCDS11737.1	17	.	.	.	.	.	.	.	.	.	.	G	14.61	2.586746	0.46110	.	.	ENSG00000167880	ENST00000301607	T	0.29655	1.56	4.5	3.51	0.40186	.	0.459912	0.19820	N	0.105333	T	0.28433	0.0703	M	0.63428	1.95	0.32128	P	0.587128	B;B	0.17667	0.023;0.019	B;B	0.15484	0.013;0.006	T	0.28902	-1.0029	9	0.46703	T	0.11	-3.2116	6.9071	0.24315	0.0912:0.0:0.6215:0.2873	.	336;336	B7ZLH8;Q92817	.;EVPL_HUMAN	S	336	ENSP00000301607:R336S	ENSP00000301607:R336S	R	-	1	0	EVPL	71529149	0.006000	0.16342	0.881000	0.34555	0.961000	0.63080	1.629000	0.37071	1.018000	0.39521	0.563000	0.77884	CGC	EVPL	-	NULL	ENSG00000167880		0.701	EVPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EVPL	HGNC	protein_coding	OTTHUMT00000449483.1	-	0.00	24	0	G	NM_001988		74017554	-1	tier1	rs74955334	no_errors	ENST00000301607	ensembl	human	known	74_37	missense	27.14	51	19	SNP	0.970	T
EVPL	2125	genome.wustl.edu	37	17	74017573	74017573	+	Silent	SNP	C	C	G	rs78569674	byFrequency	TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr17:74017573C>G	ENST00000301607.3	-	9	1240	c.987G>C	c.(985-987)ctG>ctC	p.L329L	EVPL_ENST00000586740.1_Silent_p.L329L	NM_001988.2	NP_001979.2	Q92817	EVPL_HUMAN	envoplakin	329	Globular 1.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cell junction (GO:0030054)|cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)	p.L329L(1)		breast(4)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(14)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	54						CCACGTGCTGCAGCTGGGTCT	0.706																																																	1	Substitution - coding silent(1)	upper_aerodigestive_tract(1)											29.0	25.0	26.0					17																	74017573		2201	4297	6498	SO:0001819	synonymous_variant	0			U53786	CCDS11737.1	17q25	2008-07-18				ENSG00000167880			3503	protein-coding gene	gene with protein product		601590				8938451, 10409435	Standard	NM_001988		Approved	EVPK	uc002jqi.2	Q92817		ENST00000301607.3:c.987G>C	17.37:g.74017573C>G			A0AUV5	Silent	SNP	pfam_Plectin_repeat,superfamily_Ferritin-like_SF,smart_Spectrin/alpha-actinin,smart_Plectin_repeat	p.L329	ENST00000301607.3	37	c.987	CCDS11737.1	17																																																																																			EVPL	-	smart_Spectrin/alpha-actinin	ENSG00000167880		0.706	EVPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EVPL	HGNC	protein_coding	OTTHUMT00000449483.1	-	0.00	28	0	C	NM_001988		74017573	-1	tier1	rs78569674	no_errors	ENST00000301607	ensembl	human	known	74_37	silent	25.00	55	19	SNP	1.000	G
EVPL	2125	genome.wustl.edu	37	17	74017594	74017594	+	Silent	SNP	A	A	G	rs193119748	byFrequency	TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr17:74017594A>G	ENST00000301607.3	-	9	1219	c.966T>C	c.(964-966)tgT>tgC	p.C322C	EVPL_ENST00000586740.1_Silent_p.C322C	NM_001988.2	NP_001979.2	Q92817	EVPL_HUMAN	envoplakin	322	Globular 1.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cell junction (GO:0030054)|cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(4)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(14)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	54						CCTGGCAGATACACAGGTTCA	0.721																																																	0													29.0	26.0	27.0					17																	74017594		2202	4299	6501	SO:0001819	synonymous_variant	0			U53786	CCDS11737.1	17q25	2008-07-18				ENSG00000167880			3503	protein-coding gene	gene with protein product		601590				8938451, 10409435	Standard	NM_001988		Approved	EVPK	uc002jqi.2	Q92817		ENST00000301607.3:c.966T>C	17.37:g.74017594A>G			A0AUV5	Silent	SNP	pfam_Plectin_repeat,superfamily_Ferritin-like_SF,smart_Spectrin/alpha-actinin,smart_Plectin_repeat	p.C322	ENST00000301607.3	37	c.966	CCDS11737.1	17																																																																																			EVPL	-	smart_Spectrin/alpha-actinin	ENSG00000167880		0.721	EVPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EVPL	HGNC	protein_coding	OTTHUMT00000449483.1	-	0.00	28	0	A	NM_001988		74017594	-1	tier1	rs193119748	no_errors	ENST00000301607	ensembl	human	known	74_37	silent	22.78	61	18	SNP	1.000	G
FAM230A	653203	genome.wustl.edu	37	22	20710332	20710332	+	Silent	SNP	G	G	A	rs557875537		TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr22:20710332G>A	ENST00000434783.3	+	8	2248	c.2064G>A	c.(2062-2064)acG>acA	p.T688T	USP41_ENST00000486536.2_Intron|USP41_ENST00000454608.2_Intron					family with sequence similarity 230, member A																		TGCCGCCCACGGCATCGCTAA	0.667																																																	0																																										SO:0001819	synonymous_variant	0			JX456222		22q11.21	2014-08-13			ENSG00000188280	ENSG00000188280			45045	other	unknown							Standard	XM_006724099		Approved	DGCR15			OTTHUMG00000150686	ENST00000434783.3:c.2064G>A	22.37:g.20710332G>A				Silent	SNP	pfam_Ret-finger_pr-like_3_antisense,superfamily_Kinase-like_dom	p.T688	ENST00000434783.3	37	c.2064		22																																																																																			FAM230A	-	NULL	ENSG00000188280		0.667	FAM230A-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	FAM230A	HGNC	protein_coding	OTTHUMT00000319609.4	-	0.00	135	0	G			20710332	+1	tier1	-	no_errors	ENST00000434783	ensembl	human	known	74_37	silent	35.29	109	60	SNP	0.001	A
FAM87A	157693	genome.wustl.edu	37	8	327684	327684	+	lincRNA	SNP	A	A	G	rs372301088		TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr8:327684A>G	ENST00000330148.2	-	0	2777					NR_103537.1		P0C7U9	FA87A_HUMAN	family with sequence similarity 87, member A							integral component of membrane (GO:0016021)											cctggacacaactgcagagct	0.602																																																	0																																												0			BC037297		8p23.3	2013-02-15				ENSG00000182366		"""Long non-coding RNAs"""	27233	non-coding RNA	RNA, long non-coding						12477932	Standard	NR_103537		Approved			P0C7U9			8.37:g.327684A>G				RNA	SNP	-	NULL	ENST00000330148.2	37	NULL		8																																																																																			FAM87A	-	-	ENSG00000182366		0.602	FAM87A-001	KNOWN	basic	lincRNA	FAM87A	HGNC	lincRNA	OTTHUMT00000384563.2	-	0.00	38	0	A			327684	-1	tier1	-	no_errors	ENST00000330148	ensembl	human	known	74_37	rna	18.75	26	6	SNP	0.000	G
FBN2	2201	genome.wustl.edu	37	5	127611766	127611766	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr5:127611766C>T	ENST00000508053.1	-	65	8532	c.7558G>A	c.(7558-7560)Ggg>Agg	p.G2520R	FBN2_ENST00000262464.4_Missense_Mutation_p.G2520R			P35556	FBN2_HUMAN	fibrillin 2	2520	EGF-like 42; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		AGGACATACCCCCTCGGACAT	0.433																																																	0													204.0	179.0	188.0					5																	127611766		2203	4300	6503	SO:0001583	missense	0			U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.7558G>A	5.37:g.127611766C>T	ENSP00000424571:p.Gly2520Arg		B4DU01|Q59ES6	Missense_Mutation	SNP	pirsf_FBN,pfam_EGF-like_Ca-bd_dom,pfam_EG-like_dom,pfam_TB_dom,superfamily_TB_dom,superfamily_Cadherin-like,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	p.G2520R	ENST00000508053.1	37	c.7558	CCDS34222.1	5	.	.	.	.	.	.	.	.	.	.	C	26.3	4.727833	0.89390	.	.	ENSG00000138829	ENST00000262464;ENST00000508053	D;D	0.92752	-3.1;-3.1	5.16	5.16	0.70880	EGF-like region, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.64402	D	0.000016	D	0.97145	0.9067	M	0.92459	3.31	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.97628	1.0140	10	0.87932	D	0	.	19.2125	0.93763	0.0:1.0:0.0:0.0	.	2520	P35556	FBN2_HUMAN	R	2520	ENSP00000262464:G2520R;ENSP00000424571:G2520R	ENSP00000262464:G2520R	G	-	1	0	FBN2	127639665	1.000000	0.71417	0.962000	0.40283	0.529000	0.34654	7.609000	0.82925	2.840000	0.97914	0.655000	0.94253	GGG	FBN2	-	pirsf_FBN,pfam_EGF-like_Ca-bd_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom	ENSG00000138829		0.433	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN2	HGNC	protein_coding	OTTHUMT00000371618.2	-	0.00	60	0	C	NM_001999		127611766	-1	tier1	-	no_errors	ENST00000262464	ensembl	human	known	74_37	missense	34.67	49	26	SNP	1.000	T
FCRL2	79368	genome.wustl.edu	37	1	157746838	157746838	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr1:157746838A>G	ENST00000361516.3	-	1	74	c.26T>C	c.(25-27)aTc>aCc	p.I9T	FCRL2_ENST00000392274.3_Missense_Mutation_p.I9T|FCRL2_ENST00000368181.4_Missense_Mutation_p.I9T	NM_030764.3	NP_110391.2	Q96LA5	FCRL2_HUMAN	Fc receptor-like 2	9					cell-cell signaling (GO:0007267)|positive regulation of signal transduction (GO:0009967)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)			central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(29)|ovary(1)|pancreas(1)|prostate(3)|skin(2)	51	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			CTCACCAAAGATGACCAGCAA	0.473																																																	0													157.0	139.0	145.0					1																	157746838		2203	4300	6503	SO:0001583	missense	0			AF319438	CCDS1168.1	1q23.1	2013-01-14	2002-01-14	2005-03-23	ENSG00000132704	ENSG00000132704		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14875	protein-coding gene	gene with protein product		606509	"""SH2 domain-containing phosphatase anchor protein 1"""	SPAP1		11162587	Standard	NM_030764		Approved	FCRH2, IRTA4, CD307b	uc001fre.2	Q96LA5	OTTHUMG00000019399	ENST00000361516.3:c.26T>C	1.37:g.157746838A>G	ENSP00000355157:p.Ile9Thr		A0N0M5|A1L307|A6NMS0|Q6NTA1|Q9BZI4|Q9BZI5|Q9BZI6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.I9T	ENST00000361516.3	37	c.26	CCDS1168.1	1	.	.	.	.	.	.	.	.	.	.	A	13.00	2.107659	0.37242	.	.	ENSG00000132704	ENST00000292389;ENST00000361516;ENST00000368181;ENST00000392274	T;T;T	0.22539	2.03;3.42;1.95	4.16	1.6	0.23607	.	0.481892	0.15303	U	0.269529	T	0.13030	0.0316	L	0.44542	1.39	0.21553	N	0.999641	P;P;D;B	0.54047	0.94;0.664;0.964;0.168	P;B;P;B	0.54210	0.505;0.155;0.745;0.213	T	0.04855	-1.0922	10	0.72032	D	0.01	.	6.3708	0.21481	0.5969:0.0:0.0:0.4031	.	9;9;9;9	B4E0W2;B4DVJ9;Q96LA5-5;Q96LA5	.;.;.;FCRL2_HUMAN	T	9	ENSP00000355157:I9T;ENSP00000357163:I9T;ENSP00000376100:I9T	ENSP00000292389:I9T	I	-	2	0	FCRL2	156013462	0.021000	0.18746	0.943000	0.38184	0.973000	0.67179	0.245000	0.18142	0.719000	0.32188	0.523000	0.50628	ATC	FCRL2	-	NULL	ENSG00000132704		0.473	FCRL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCRL2	HGNC	protein_coding	OTTHUMT00000051408.2	-	0.00	52	0	A	NM_030764		157746838	-1	tier1	-	no_errors	ENST00000361516	ensembl	human	known	74_37	missense	36.25	51	29	SNP	0.838	G
FGD6	55785	genome.wustl.edu	37	12	95546719	95546719	+	Silent	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr12:95546719G>T	ENST00000343958.4	-	4	2860	c.2637C>A	c.(2635-2637)atC>atA	p.I879I	FGD6_ENST00000546711.1_Silent_p.I879I|FGD6_ENST00000549499.1_Silent_p.I879I	NM_018351.3	NP_060821.3	Q6ZV73	FGD6_HUMAN	FYVE, RhoGEF and PH domain containing 6	879	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin cytoskeleton organization (GO:0030036)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			breast(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(14)|liver(1)|lung(12)|ovary(3)|prostate(3)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	56						CTGAGCTCATGATCTCCTTGG	0.323																																																	0													172.0	169.0	170.0					12																	95546719		2203	4300	6503	SO:0001819	synonymous_variant	0			AB037783	CCDS31878.1	12q23.1	2013-01-10				ENSG00000180263		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	21740	protein-coding gene	gene with protein product		613520					Standard	NM_018351		Approved	ZFYVE24, FLJ11183	uc001tdp.4	Q6ZV73	OTTHUMG00000170133	ENST00000343958.4:c.2637C>A	12.37:g.95546719G>T			Q6ZR53|Q7Z2Z7|Q96D44|Q9NUR8|Q9P2I5	Silent	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Znf_FYVE,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,smart_Znf_FYVE,pfscan_Pleckstrin_homology,pfscan_Znf_FYVE-rel,pfscan_DH-domain	p.I879	ENST00000343958.4	37	c.2637	CCDS31878.1	12																																																																																			FGD6	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain	ENSG00000180263		0.323	FGD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGD6	HGNC	protein_coding	OTTHUMT00000407600.1	-	0.00	78	0	G	NM_018351		95546719	-1	tier1	-	no_errors	ENST00000343958	ensembl	human	known	74_37	silent	5.19	73	4	SNP	0.999	T
FIGF	2277	genome.wustl.edu	37	X	15364202	15364202	+	3'UTR	SNP	G	G	A			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chrX:15364202G>A	ENST00000297904.3	-	0	1547				FIGF_ENST00000488351.1_5'UTR	NM_004469.4	NP_004460.1	O43915	VEGFD_HUMAN	c-fos induced growth factor (vascular endothelial growth factor D)						angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|induction of positive chemotaxis (GO:0050930)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive chemotaxis (GO:0050918)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of mast cell chemotaxis (GO:0060754)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|platelet alpha granule lumen (GO:0031093)	chemoattractant activity (GO:0042056)|platelet-derived growth factor receptor binding (GO:0005161)|vascular endothelial growth factor receptor binding (GO:0005172)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	17	Hepatocellular(33;0.183)					CAGCAACTTGGCAAAGCAGCA	0.463																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AJ000185	CCDS14166.1	Xp22.31	2008-02-05			ENSG00000165197	ENSG00000165197			3708	protein-coding gene	gene with protein product		300091		VEGFD		9479493	Standard	NM_004469		Approved	VEGF-D	uc004cwt.2	O43915	OTTHUMG00000021175	ENST00000297904.3:c.*53C>T	X.37:g.15364202G>A			B2R7Z3	RNA	SNP	-	NULL	ENST00000297904.3	37	NULL	CCDS14166.1	X																																																																																			FIGF	-	-	ENSG00000165197		0.463	FIGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FIGF	HGNC	protein_coding	OTTHUMT00000055859.1	-	0.00	91	0	G	NM_004469		15364202	-1	tier1	-	no_errors	ENST00000488351	ensembl	human	known	74_37	rna	41.18	80	56	SNP	0.999	A
FIP1L1	81608	genome.wustl.edu	37	4	54319248	54319249	+	Frame_Shift_Del	DEL	AG	AG	-	rs143671659		TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	AG	AG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr4:54319248_54319249delAG	ENST00000337488.6	+	16	1641_1642	c.1447_1448delAG	c.(1447-1449)agafs	p.R483fs	FIP1L1_ENST00000358575.5_Frame_Shift_Del_p.R477fs|FIP1L1_ENST00000507166.1_Intron|FIP1L1_ENST00000306932.6_Frame_Shift_Del_p.R409fs	NM_030917.3	NP_112179.2	Q6UN15	FIP1_HUMAN	factor interacting with PAPOLA and CPSF1	483	Arg-rich.|Glu-rich.|Sufficient for interaction with CPSF1 and CSTF3.				mRNA processing (GO:0006397)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.R487fs*3(2)		large_intestine(3)|liver(1)|ovary(1)|skin(1)	6			GBM - Glioblastoma multiforme(3;3.31e-36)|LUSC - Lung squamous cell carcinoma(32;0.0134)			agaACGCACCAGAGAGAGAGAG	0.47			T	PDGFRA	idiopathic hypereosinophilic syndrome																																			Dom	yes		4	4q12	81608	FIP1 like 1 (S. cerevisiae)		L	2	Deletion - Frameshift(2)	large_intestine(1)|kidney(1)																																								SO:0001589	frameshift_variant	0			AF161429	CCDS3491.1, CCDS47055.1, CCDS47056.1	4q12	2013-06-18	2013-06-18		ENSG00000145216	ENSG00000145216			19124	protein-coding gene	gene with protein product		607686	"""FIP1 like 1 (S. cerevisiae)"", ""FIP1L1 cleavage and polyadenylation specific factor subunit"""			11230166, 14749727	Standard	NM_030917		Approved	DKFZp586K0717, FIP1	uc003hae.3	Q6UN15	OTTHUMG00000128701	ENST00000337488.6:c.1447_1448delAG	4.37:g.54319258_54319259delAG	ENSP00000336752:p.Arg483fs		B4DIR3|G3XAD6|Q0VGE0|Q499Y4|Q49AU3|Q7Z608|Q8WVN3|Q96F80|Q9H077	Frame_Shift_Del	DEL	pfam_Fip1	p.E486fs	ENST00000337488.6	37	c.1447_1448	CCDS3491.1	4																																																																																			FIP1L1	-	NULL	ENSG00000145216		0.470	FIP1L1-001	KNOWN	basic|CCDS	protein_coding	FIP1L1	HGNC	protein_coding	OTTHUMT00000250602.1		0.00	24	0	AG	NM_030917		54319249	+1	tier1		no_errors	ENST00000337488	ensembl	human	known	74_37	frame_shift_del	6.25	30	2	DEL	0.975:0.991	-
FLYWCH1	84256	genome.wustl.edu	37	16	2986279	2986279	+	Intron	SNP	C	C	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr16:2986279C>T	ENST00000253928.9	+	7	1918				FLYWCH1_ENST00000416288.2_Intron|FLYWCH1_ENST00000570752.1_3'UTR|FLYWCH1_ENST00000399667.2_Intron			Q4VC44	FWCH1_HUMAN	FLYWCH-type zinc finger 1							cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(1)|lung(3)	4						CACCCCCTCCCGTGGCCTGGC	0.642																																																	0																																										SO:0001627	intron_variant	0			AL136585	CCDS45390.1	16p13.3	2013-01-10	2007-06-21	2007-06-21	ENSG00000059122	ENSG00000059122		"""Zinc fingers"""	25404	protein-coding gene	gene with protein product						11230166, 10997877	Standard	XM_006720959		Approved	DKFZp761A132	uc002csc.3	Q4VC44		ENST00000253928.9:c.1514-843C>T	16.37:g.2986279C>T			D3DUA1|Q6ZSQ1|Q8WV62|Q9BQG6|Q9BUS5|Q9HCM0	RNA	SNP	-	NULL	ENST00000253928.9	37	NULL		16																																																																																			FLYWCH1	-	-	ENSG00000059122		0.642	FLYWCH1-001	KNOWN	basic|appris_candidate_longest	protein_coding	FLYWCH1	HGNC	protein_coding	OTTHUMT00000436479.1	-	0.00	59	0	C	NM_032296		2986279	+1	tier1	-	no_errors	ENST00000570752	ensembl	human	known	74_37	rna	30.38	55	24	SNP	0.000	T
FOLH1	2346	genome.wustl.edu	37	11	49175427	49175427	+	Silent	SNP	A	A	G	rs199517010		TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr11:49175427A>G	ENST00000256999.2	-	17	2201	c.1941T>C	c.(1939-1941)agT>agC	p.S647S	FOLH1_ENST00000340334.7_Silent_p.S632S|FOLH1_ENST00000356696.3_Silent_p.S647S|FOLH1_ENST00000533034.1_Silent_p.S632S|FOLH1_ENST00000343844.4_Silent_p.S339S	NM_004476.1	NP_004467.1	Q04609	FOLH1_HUMAN	folate hydrolase (prostate-specific membrane antigen) 1	647					folic acid-containing compound metabolic process (GO:0006760)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)	p.S647S(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(34)|ovary(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	60					Capromab(DB00089)	GGAGTCTCTCACTGAACTTGG	0.294																																																	1	Substitution - coding silent(1)	upper_aerodigestive_tract(1)											83.0	85.0	84.0					11																	49175427		2201	4296	6497	SO:0001819	synonymous_variant	0			M99487	CCDS7946.1, CCDS31493.1, CCDS53626.1, CCDS53627.1, CCDS53628.1	11p11.2	2011-07-22			ENSG00000086205	ENSG00000086205	3.4.17.21		3788	protein-coding gene	gene with protein product	"""glutamate carboxylase II"", ""glutamate carboxypeptidase II"""	600934		FOLH		9838072	Standard	NM_001193472		Approved	PSM, PSMA, NAALAD1, NAALAdase, GCP2, GCPII	uc001ngy.3	Q04609	OTTHUMG00000166625	ENST00000256999.2:c.1941T>C	11.37:g.49175427A>G			A4UU12|A9CB79|B7Z312|B7Z343|D3DQS5|E9PDX8|O43748|Q16305|Q541A4|Q8TAY3|Q9NP15|Q9NYE2|Q9P1P8	Silent	SNP	pfam_TFR-like_dimer_dom,pfam_Protease-assoc_domain,pfam_Peptidase_M28,superfamily_TFR-like_dimer_dom	p.S647	ENST00000256999.2	37	c.1941	CCDS7946.1	11																																																																																			FOLH1	-	pfam_TFR-like_dimer_dom,superfamily_TFR-like_dimer_dom	ENSG00000086205		0.294	FOLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOLH1	HGNC	protein_coding	OTTHUMT00000390896.1		0.00	39	0	A	NM_004476		49175427	-1			no_errors	ENST00000256999	ensembl	human	known	74_37	silent	5.71	32	2	SNP	0.000	G
FOLH1	2346	genome.wustl.edu	37	11	49204790	49204790	+	Silent	SNP	A	A	G	rs76509850	byFrequency	TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr11:49204790A>G	ENST00000256999.2	-	7	1091	c.831T>C	c.(829-831)taT>taC	p.Y277Y	FOLH1_ENST00000340334.7_Silent_p.Y262Y|FOLH1_ENST00000356696.3_Silent_p.Y277Y|FOLH1_ENST00000533034.1_Silent_p.Y262Y|FOLH1_ENST00000343844.4_5'UTR	NM_004476.1	NP_004467.1	Q04609	FOLH1_HUMAN	folate hydrolase (prostate-specific membrane antigen) 1	277	NAALADase.				folic acid-containing compound metabolic process (GO:0006760)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(34)|ovary(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	60					Capromab(DB00089)	GCCTATAAGCATATTCTGAAA	0.343																																																	0													61.0	61.0	61.0					11																	49204790		2201	4298	6499	SO:0001819	synonymous_variant	0			M99487	CCDS7946.1, CCDS31493.1, CCDS53626.1, CCDS53627.1, CCDS53628.1	11p11.2	2011-07-22			ENSG00000086205	ENSG00000086205	3.4.17.21		3788	protein-coding gene	gene with protein product	"""glutamate carboxylase II"", ""glutamate carboxypeptidase II"""	600934		FOLH		9838072	Standard	NM_001193472		Approved	PSM, PSMA, NAALAD1, NAALAdase, GCP2, GCPII	uc001ngy.3	Q04609	OTTHUMG00000166625	ENST00000256999.2:c.831T>C	11.37:g.49204790A>G			A4UU12|A9CB79|B7Z312|B7Z343|D3DQS5|E9PDX8|O43748|Q16305|Q541A4|Q8TAY3|Q9NP15|Q9NYE2|Q9P1P8	Silent	SNP	pfam_TFR-like_dimer_dom,pfam_Protease-assoc_domain,pfam_Peptidase_M28,superfamily_TFR-like_dimer_dom	p.Y277	ENST00000256999.2	37	c.831	CCDS7946.1	11																																																																																			FOLH1	-	NULL	ENSG00000086205		0.343	FOLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOLH1	HGNC	protein_coding	OTTHUMT00000390896.1	-	0.00	71	0	A	NM_004476		49204790	-1	tier1	rs76509850	no_errors	ENST00000256999	ensembl	human	known	74_37	silent	5.71	66	4	SNP	1.000	G
FOXP1	27086	genome.wustl.edu	37	3	71247378	71247378	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr3:71247378G>A	ENST00000318789.4	-	6	680	c.155C>T	c.(154-156)gCc>gTc	p.A52V	FOXP1_ENST00000468577.1_Missense_Mutation_p.A52V|FOXP1_ENST00000493089.1_Missense_Mutation_p.A52V|FOXP1_ENST00000475937.1_Missense_Mutation_p.A52V|FOXP1_ENST00000484350.1_Missense_Mutation_p.A52V|FOXP1_ENST00000498215.1_Missense_Mutation_p.A52V|FOXP1_ENST00000318779.3_Missense_Mutation_p.A52V	NM_001244810.1|NM_001244813.1|NM_032682.5	NP_001231739.1|NP_001231742.1|NP_116071.2	Q9H334	FOXP1_HUMAN	forkhead box P1	52					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	31		Lung NSC(201;4.62e-05)|Prostate(10;0.0181)|Hepatocellular(537;0.186)|Myeloproliferative disorder(1037;0.209)		BRCA - Breast invasive adenocarcinoma(55;1.17e-05)|Epithelial(33;1.39e-05)|LUSC - Lung squamous cell carcinoma(21;2.35e-05)|Lung(16;4.26e-05)		CTGGGCGTGGGCGAGGTCAGC	0.622			T	PAX5	ALL																																			Dom	yes		3	3p14.1	27086	forkhead box P1		L	0													50.0	55.0	53.0					3																	71247378		2203	4300	6503	SO:0001583	missense	0			AF146696	CCDS2914.1, CCDS33785.1, CCDS58837.1, CCDS58838.1, CCDS58839.1, CCDS74963.1, CCDS74964.1	3p14.1	2008-07-18			ENSG00000114861	ENSG00000114861		"""Forkhead boxes"""	3823	protein-coding gene	gene with protein product	"""fork head-related protein like B"", ""glutamine-rich factor 1"", ""PAX5/FOXP1 fusion protein"""	605515				8265594, 11751404	Standard	NM_032682		Approved	QRF1, 12CC4, HSPC215, hFKH1B	uc003doj.3	Q9H334	OTTHUMG00000158803	ENST00000318789.4:c.155C>T	3.37:g.71247378G>A	ENSP00000318902:p.Ala52Val		A3QVP8|B3KV70|G5E9V8|Q8NAN6|Q9BSG9|Q9H332|Q9H333|Q9P0R1	Missense_Mutation	SNP	pfam_TF_fork_head,smart_TF_fork_head,prints_TF_fork_head,pfscan_TF_fork_head	p.A52V	ENST00000318789.4	37	c.155	CCDS2914.1	3	.	.	.	.	.	.	.	.	.	.	G	33	5.262418	0.95368	.	.	ENSG00000114861	ENST00000318789;ENST00000475937;ENST00000339693;ENST00000493089;ENST00000498215;ENST00000484350;ENST00000468577;ENST00000318779	D;D;D;D;D;D;T	0.88975	-2.45;-2.45;-2.45;-2.45;-2.38;-2.25;0.78	5.65	5.65	0.86999	.	0.248242	0.40818	N	0.001003	D	0.85048	0.5608	N	0.25647	0.755	0.34865	D	0.742987	D;B;B;B;B	0.55605	0.972;0.013;0.001;0.002;0.001	P;B;B;B;B	0.48840	0.592;0.008;0.005;0.002;0.002	T	0.81936	-0.0705	10	0.02654	T	1	.	20.0781	0.97751	0.0:0.0:1.0:0.0	.	52;52;52;52;52	Q9BSG9;A3KMG1;G5E9V8;Q8NAN6;Q9H334	.;.;.;.;FOXP1_HUMAN	V	52	ENSP00000318902:A52V;ENSP00000419393:A52V;ENSP00000418524:A52V;ENSP00000418102:A52V;ENSP00000417857:A52V;ENSP00000418883:A52V;ENSP00000318721:A52V	ENSP00000318721:A52V	A	-	2	0	FOXP1	71330068	1.000000	0.71417	0.998000	0.56505	0.893000	0.52053	5.351000	0.66022	2.817000	0.96982	0.563000	0.77884	GCC	FOXP1	-	NULL	ENSG00000114861		0.622	FOXP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FOXP1	HGNC	protein_coding	OTTHUMT00000352250.1		0.00	88	0	G	NM_032682		71247378	-1			no_errors	ENST00000318789	ensembl	human	known	74_37	missense	5.88	64	4	SNP	1.000	A
FRMD8	83786	genome.wustl.edu	37	11	65172410	65172410	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr11:65172410A>G	ENST00000317568.5	+	10	1310	c.1147A>G	c.(1147-1149)Agt>Ggt	p.S383G	FRMD8_ENST00000355991.5_Missense_Mutation_p.S327G|FRMD8_ENST00000416776.2_Missense_Mutation_p.S349G	NM_031904.3	NP_114110.1	Q9BZ67	FRMD8_HUMAN	FERM domain containing 8	383						cytoskeleton (GO:0005856)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(9)|pancreas(1)|urinary_tract(1)	17						CCCCCAGGACAGTGCGACTGG	0.672																																																	0													34.0	36.0	35.0					11																	65172410		2201	4293	6494	SO:0001583	missense	0			AK074850	CCDS8102.1, CCDS73320.1	11q13.1	2007-08-14			ENSG00000126391	ENSG00000126391			25462	protein-coding gene	gene with protein product						12477932	Standard	NM_031904		Approved	FLJ90369, FKSG44	uc001odu.4	Q9BZ67	OTTHUMG00000166275	ENST00000317568.5:c.1147A>G	11.37:g.65172410A>G	ENSP00000319726:p.Ser383Gly		B4E2P1|Q86V56|Q8NCB5	Missense_Mutation	SNP	pfam_FERM_central,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain	p.S383G	ENST00000317568.5	37	c.1147	CCDS8102.1	11	.	.	.	.	.	.	.	.	.	.	A	9.435	1.086652	0.20390	.	.	ENSG00000126391	ENST00000317568;ENST00000355991;ENST00000416776	D;T;D	0.82893	-1.66;-1.08;-1.66	4.96	-3.9	0.04181	.	1.693770	0.03013	N	0.149703	T	0.68842	0.3045	L	0.27053	0.805	0.09310	N	1	B;B;B	0.13145	0.004;0.007;0.0	B;B;B	0.13407	0.006;0.009;0.0	T	0.49532	-0.8930	10	0.42905	T	0.14	1.9214	1.0744	0.01629	0.328:0.2833:0.2512:0.1375	.	349;327;383	B4E2P1;Q9BZ67-2;Q9BZ67	.;.;FRMD8_HUMAN	G	383;327;349	ENSP00000319726:S383G;ENSP00000348270:S327G;ENSP00000392111:S349G	ENSP00000319726:S383G	S	+	1	0	FRMD8	64928986	0.004000	0.15560	0.000000	0.03702	0.037000	0.13140	0.749000	0.26320	-0.973000	0.03555	0.533000	0.62120	AGT	FRMD8	-	NULL	ENSG00000126391		0.672	FRMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMD8	HGNC	protein_coding	OTTHUMT00000388833.1	-	0.00	62	0	A	NM_031904		65172410	+1	tier1	-	no_errors	ENST00000317568	ensembl	human	known	74_37	missense	25.38	147	50	SNP	0.000	G
FRMPD2	143162	genome.wustl.edu	37	10	49395321	49395321	+	Missense_Mutation	SNP	C	C	A	rs142488456		TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr10:49395321C>A	ENST00000374201.3	-	17	2482	c.2180G>T	c.(2179-2181)cGg>cTg	p.R727L	FRMPD2_ENST00000305531.3_Missense_Mutation_p.R702L|FRMPD2_ENST00000407470.4_Missense_Mutation_p.R695L	NM_001018071.3|NM_001042512.2	NP_001018081|NP_001035977.2	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2	727			R -> W (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		tight junction assembly (GO:0070830)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)	1-phosphatidylinositol binding (GO:0005545)			NS(2)|autonomic_ganglia(2)|breast(5)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(15)|lung(24)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	66				Kidney(211;0.201)		CAGCTGCTCCCGGCCAGTGCA	0.572																																																	0													59.0	54.0	56.0					10																	49395321		2203	4300	6503	SO:0001583	missense	0			AK123038	CCDS31195.1	10q11	2010-10-13			ENSG00000170324	ENSG00000170324			28572	protein-coding gene	gene with protein product		613323	"""PDZ domain containing 5C"""	PDZD5C, PDZK5C			Standard	NM_001018071		Approved	MGC35285	uc001jdv.3	Q68DX3	OTTHUMG00000018171	ENST00000374201.3:c.2180G>T	10.37:g.49395321C>A	ENSP00000363317:p.Arg727Leu		B7WNW0|B7ZML5|Q2VY07|Q6GMQ9|Q6ZN38|Q6ZWI2|Q8N5T9	Missense_Mutation	SNP	pfam_PDZ,pfam_FERM_central,pfam_FERM_PH-like_C,pfam_FERM_N,superfamily_PDZ,superfamily_FERM_central,superfamily_Kinase-like_dom,smart_KIND,smart_Band_41_domain,smart_PDZ,pfscan_FERM_domain,pfscan_PDZ,prints_Band_41_fam	p.R727L	ENST00000374201.3	37	c.2180	CCDS31195.1	10	.	.	.	.	.	.	.	.	.	.	C	8.958	0.969834	0.18659	.	.	ENSG00000170324	ENST00000374201;ENST00000305531;ENST00000407470	T;T;T	0.64438	-0.05;-0.09;-0.1	4.06	-8.12	0.01078	.	.	.	.	.	T	0.41236	0.1150	L	0.27053	0.805	0.09310	N	1	B;B;B	0.26318	0.146;0.007;0.146	B;B;B	0.22601	0.04;0.003;0.04	T	0.24584	-1.0156	9	0.30078	T	0.28	.	10.3274	0.43801	0.0:0.1389:0.186:0.6751	.	702;727;695	Q68DX3-2;Q68DX3;F8WCT2	.;FRPD2_HUMAN;.	L	727;702;695	ENSP00000363317:R727L;ENSP00000307079:R702L;ENSP00000384339:R695L	ENSP00000307079:R702L	R	-	2	0	FRMPD2	49065327	0.000000	0.05858	0.000000	0.03702	0.855000	0.48748	-4.405000	0.00239	-3.053000	0.00259	-0.123000	0.14984	CGG	FRMPD2	-	NULL	ENSG00000170324		0.572	FRMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMPD2	HGNC	protein_coding	OTTHUMT00000047923.3	-	0.00	33	0	C	NM_152428		49395321	-1	tier1	-	no_errors	ENST00000374201	ensembl	human	known	74_37	missense	39.22	31	20	SNP	0.000	A
G2E3	55632	genome.wustl.edu	37	14	31085591	31085591	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr14:31085591G>T	ENST00000206595.6	+	15	2126	c.1972G>T	c.(1972-1974)Gtg>Ttg	p.V658L	G2E3_ENST00000553504.1_Missense_Mutation_p.V688L|G2E3_ENST00000438909.2_Missense_Mutation_p.V612L	NM_017769.3	NP_060239.2	Q7L622	G2E3_HUMAN	G2/M-phase specific E3 ubiquitin protein ligase	658	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				apoptotic process (GO:0006915)|blastocyst development (GO:0001824)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	23						GTGTCTGCATGTGGATTTTCC	0.363																																																	0													62.0	58.0	59.0					14																	31085591		2203	4300	6503	SO:0001583	missense	0			AK000340	CCDS9638.1	14q12	2013-01-28	2010-09-17	2009-02-03	ENSG00000092140	ENSG00000092140		"""Zinc fingers, PHD-type"""	20338	protein-coding gene	gene with protein product	"""PHD finger protein 7B"""	611299	"""KIAA1333"""	KIAA1333		18511420, 17239372	Standard	NM_017769		Approved	FLJ20333, PHF7B	uc001wqk.2	Q7L622	OTTHUMG00000140204	ENST00000206595.6:c.1972G>T	14.37:g.31085591G>T	ENSP00000206595:p.Val658Leu		Q9BVR2|Q9H9E9|Q9NXC0|Q9P2L3	Missense_Mutation	SNP	pfam_HECT,superfamily_HECT,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_HECT,pfscan_HECT	p.V658L	ENST00000206595.6	37	c.1972	CCDS9638.1	14	.	.	.	.	.	.	.	.	.	.	G	6.865	0.528863	0.13127	.	.	ENSG00000092140	ENST00000206595;ENST00000438909;ENST00000553504	T;T;T	0.57273	0.41;0.41;0.41	5.8	-3.18	0.05186	HECT (3);	6.390080	0.00465	N	0.000105	T	0.41396	0.1157	L	0.29908	0.895	0.09310	N	1	B;B	0.13145	0.007;0.003	B;B	0.10450	0.005;0.005	T	0.33111	-0.9881	10	0.11182	T	0.66	0.6783	14.4375	0.67293	0.5584:0.0:0.4416:0.0	.	170;658	Q49AD9;Q7L622	.;G2E3_HUMAN	L	658;612;688	ENSP00000206595:V658L;ENSP00000391068:V612L;ENSP00000451653:V688L	ENSP00000206595:V658L	V	+	1	0	G2E3	30155342	0.082000	0.21442	0.189000	0.23252	0.215000	0.24574	0.279000	0.18771	-0.375000	0.07955	-0.948000	0.02665	GTG	G2E3	-	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT	ENSG00000092140		0.363	G2E3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	G2E3	HGNC	protein_coding	OTTHUMT00000276613.2	-	0.00	92	0	G	NM_017769		31085591	+1	tier1	-	no_errors	ENST00000206595	ensembl	human	known	74_37	missense	42.68	90	67	SNP	0.000	T
GDAP2	54834	genome.wustl.edu	37	1	118455260	118455260	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr1:118455260G>T	ENST00000369443.5	-	4	611	c.362C>A	c.(361-363)gCt>gAt	p.A121D	GDAP2_ENST00000369442.3_Missense_Mutation_p.A121D	NM_017686.3	NP_060156.1	Q9NXN4	GDAP2_HUMAN	ganglioside induced differentiation associated protein 2	121	Macro. {ECO:0000255|PROSITE- ProRule:PRU00490}.				response to retinoic acid (GO:0032526)	lysosomal membrane (GO:0005765)				kidney(2)|large_intestine(3)|lung(9)|ovary(2)	16		all_cancers(81;0.0156)|all_lung(203;5.81e-05)|Lung NSC(69;0.000446)|all_epithelial(167;0.00295)		Lung(183;0.0583)|LUSC - Lung squamous cell carcinoma(189;0.194)		GAACCGGGCAGCTAGATTGAA	0.418																																																	0													141.0	129.0	133.0					1																	118455260		2203	4300	6503	SO:0001583	missense	0			AK000149	CCDS897.1, CCDS44201.1	1q11	2011-10-20			ENSG00000196505	ENSG00000196505			18010	protein-coding gene	gene with protein product						1021725	Standard	NM_017686		Approved	FLJ20142, dJ776P7.1, MACROD3	uc001ehf.3	Q9NXN4	OTTHUMG00000012199	ENST00000369443.5:c.362C>A	1.37:g.118455260G>T	ENSP00000358451:p.Ala121Asp		Q96DZ0	Missense_Mutation	SNP	pfam_Macro_dom,superfamily_CRAL-TRIO_dom,smart_Macro_dom,smart_CRAL-TRIO_dom,pfscan_Macro_dom	p.A121D	ENST00000369443.5	37	c.362	CCDS897.1	1	.	.	.	.	.	.	.	.	.	.	G	35	5.444016	0.96187	.	.	ENSG00000196505	ENST00000369443;ENST00000369442	T;T	0.21031	2.03;2.03	5.9	5.9	0.94986	Appr-1-p processing (2);	0.000000	0.85682	D	0.000000	T	0.29423	0.0733	L	0.33137	0.985	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.66351	0.929;0.943	T	0.02574	-1.1139	10	0.72032	D	0.01	-20.4335	20.3298	0.98711	0.0:0.0:1.0:0.0	.	121;121	Q9NXN4-2;Q9NXN4	.;GDAP2_HUMAN	D	121	ENSP00000358451:A121D;ENSP00000358450:A121D	ENSP00000358450:A121D	A	-	2	0	GDAP2	118256783	1.000000	0.71417	0.999000	0.59377	0.947000	0.59692	9.850000	0.99511	2.810000	0.96702	0.585000	0.79938	GCT	GDAP2	-	pfam_Macro_dom,smart_Macro_dom,pfscan_Macro_dom	ENSG00000196505		0.418	GDAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDAP2	HGNC	protein_coding	OTTHUMT00000033732.2	-	0.00	35	0	G	NM_017686		118455260	-1	tier1	-	no_errors	ENST00000369443	ensembl	human	known	74_37	missense	8.16	45	4	SNP	1.000	T
GDPD4	220032	genome.wustl.edu	37	11	76979559	76979559	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr11:76979559G>T	ENST00000376217.2	-	9	900	c.650C>A	c.(649-651)tCc>tAc	p.S217Y	GDPD4_ENST00000527489.1_5'Flank|GDPD4_ENST00000315938.4_Missense_Mutation_p.S217Y			Q6W3E5	GDPD4_HUMAN	glycerophosphodiester phosphodiesterase domain containing 4	217	GP-PDE.				glycerol metabolic process (GO:0006071)|lipid metabolic process (GO:0006629)	integral component of membrane (GO:0016021)	glycerophosphodiester phosphodiesterase activity (GO:0008889)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(1)|skin(1)	20						TTTCTCAAAGGACATCATGGT	0.488																																																	0													183.0	180.0	181.0					11																	76979559		2200	4292	6492	SO:0001583	missense	0			AY326450	CCDS8249.1	11q13.5	2008-02-05			ENSG00000178795	ENSG00000178795			24849	protein-coding gene	gene with protein product							Standard	NM_182833		Approved	GDE6	uc001oyf.3	Q6W3E5	OTTHUMG00000165136	ENST00000376217.2:c.650C>A	11.37:g.76979559G>T	ENSP00000365390:p.Ser217Tyr		Q7Z5B0	Missense_Mutation	SNP	pfam_GlyceroP-diester-Pdiesterase,superfamily_PLC-like_Pdiesterase_TIM-brl	p.S217Y	ENST00000376217.2	37	c.650		11	.	.	.	.	.	.	.	.	.	.	G	19.95	3.921512	0.73213	.	.	ENSG00000178795	ENST00000376217;ENST00000315938	T;T	0.16073	2.37;2.37	4.68	4.68	0.58851	.	0.247574	0.42172	D	0.000743	T	0.51381	0.1671	H	0.94345	3.525	0.35546	D	0.803432	D	0.76494	0.999	D	0.65874	0.939	T	0.72717	-0.4209	10	0.87932	D	0	-5.8381	14.98	0.71303	0.0:0.0:1.0:0.0	.	217	Q6W3E5-2	.	Y	217	ENSP00000365390:S217Y;ENSP00000320815:S217Y	ENSP00000320815:S217Y	S	-	2	0	GDPD4	76657207	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	6.487000	0.73633	2.595000	0.87683	0.591000	0.81541	TCC	GDPD4	-	pfam_GlyceroP-diester-Pdiesterase,superfamily_PLC-like_Pdiesterase_TIM-brl	ENSG00000178795		0.488	GDPD4-002	KNOWN	basic|appris_candidate_longest	protein_coding	GDPD4	HGNC	protein_coding	OTTHUMT00000382075.1	-	0.00	48	0	G	NM_182833		76979559	-1	tier1	-	no_errors	ENST00000376217	ensembl	human	known	74_37	missense	60.59	67	103	SNP	0.997	T
GNAZ	2781	genome.wustl.edu	37	22	23437787	23437787	+	De_novo_Start_OutOfFrame	SNP	G	G	A			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr22:23437787G>A	ENST00000248996.4	+	0	571				RTDR1_ENST00000216036.4_Intron|GNAZ_ENST00000492538.1_3'UTR	NM_002073.2	NP_002064.1	P19086	GNAZ_HUMAN	guanine nucleotide binding protein (G protein), alpha z polypeptide						adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled serotonin receptor binding (GO:0031821)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|receptor signaling protein activity (GO:0005057)|signal transducer activity (GO:0004871)			endometrium(3)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|skin(5)|urinary_tract(1)	19	all_hematologic(9;0.0197)|Acute lymphoblastic leukemia(84;0.181)			READ - Rectum adenocarcinoma(21;0.166)		CTCCAGGGCAGCTGGGCTCTT	0.687																																																	0																																												0				CCDS13804.1	22q11.1-q11.2	2008-06-10			ENSG00000128266	ENSG00000128266			4395	protein-coding gene	gene with protein product		139160				2115889	Standard	NM_002073		Approved		uc002zwu.1	P19086	OTTHUMG00000150611	ENST00000248996.4:c.-96G>A	22.37:g.23437787G>A			B2R6C1|Q4QRJ6	RNA	SNP	-	NULL	ENST00000248996.4	37	NULL	CCDS13804.1	22																																																																																			GNAZ	-	-	ENSG00000128266		0.687	GNAZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNAZ	HGNC	protein_coding	OTTHUMT00000319073.1	-	0.00	20	0	G	NM_002073		23437787	+1	tier1	-	no_errors	ENST00000492538	ensembl	human	known	74_37	rna	26.32	28	10	SNP	0.001	A
GOLGA3	2802	genome.wustl.edu	37	12	133384931	133384931	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr12:133384931T>C	ENST00000450791.2	-	4	907	c.724A>G	c.(724-726)Aaa>Gaa	p.K242E	GOLGA3_ENST00000537452.1_Missense_Mutation_p.K242E|GOLGA3_ENST00000545875.1_Missense_Mutation_p.K242E|GOLGA3_ENST00000456883.2_Missense_Mutation_p.K242E|GOLGA3_ENST00000204726.3_Missense_Mutation_p.K242E			Q08378	GOGA3_HUMAN	golgin A3	242	Golgi-targeting domain.				intra-Golgi vesicle-mediated transport (GO:0006891)	cytosol (GO:0005829)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extrinsic component of Golgi membrane (GO:0090498)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)		GACCGGATTTTGCTTGATTTG	0.537																																																	0													138.0	156.0	150.0					12																	133384931		2203	4300	6503	SO:0001583	missense	0			AF485338	CCDS9281.1, CCDS53846.1	12q24.33	2010-02-12	2010-02-12		ENSG00000090615	ENSG00000090615			4426	protein-coding gene	gene with protein product	"""SY2/SY10 protein"", ""Golgi complex-associated protein of 170 kD"""	602581	"""golgi autoantigen, golgin subfamily a, 3"""			8315394, 15829563	Standard	NM_001172557		Approved	golgin-160, GCP170, MEA-2	uc001ukz.1	Q08378	OTTHUMG00000168023	ENST00000450791.2:c.724A>G	12.37:g.133384931T>C	ENSP00000410378:p.Lys242Glu		A5PKX6|O43241|Q6P9C7|Q86XW3|Q8TDA9|Q8WZA3	Missense_Mutation	SNP	superfamily_Prefoldin	p.K242E	ENST00000450791.2	37	c.724	CCDS9281.1	12	.	.	.	.	.	.	.	.	.	.	T	21.9	4.218307	0.79464	.	.	ENSG00000090615	ENST00000204726;ENST00000450791;ENST00000456883;ENST00000537452;ENST00000545875	T;T;T;T;T	0.29397	1.57;1.57;1.57;1.57;1.57	5.34	5.34	0.76211	.	0.179314	0.64402	D	0.000018	T	0.32675	0.0837	L	0.52364	1.645	0.80722	D	1	P;B;P	0.46142	0.873;0.4;0.673	B;B;B	0.41412	0.356;0.121;0.214	T	0.17745	-1.0359	10	0.72032	D	0.01	.	15.6173	0.76778	0.0:0.0:0.0:1.0	.	242;242;242	Q08378-4;Q08378-2;Q08378	.;.;GOGA3_HUMAN	E	242	ENSP00000204726:K242E;ENSP00000410378:K242E;ENSP00000409303:K242E;ENSP00000442143:K242E;ENSP00000442603:K242E	ENSP00000204726:K242E	K	-	1	0	GOLGA3	131895004	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.913000	0.87471	2.153000	0.67306	0.477000	0.44152	AAA	GOLGA3	-	NULL	ENSG00000090615		0.537	GOLGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GOLGA3	HGNC	protein_coding	OTTHUMT00000397569.2	-	0.00	44	0	T	NM_005895		133384931	-1	tier1	-	no_errors	ENST00000204726	ensembl	human	known	74_37	missense	34.85	43	23	SNP	1.000	C
GPR123	84435	genome.wustl.edu	37	10	134895346	134895346	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr10:134895346C>A	ENST00000607359.1	+	5	989	c.989C>A	c.(988-990)aCc>aAc	p.T330N				Q86SQ6	GP123_HUMAN	G protein-coupled receptor 123	0					G-protein coupled receptor signaling pathway (GO:0007186)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(3)	14		all_cancers(35;1.8e-10)|all_epithelial(44;8.95e-09)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Colorectal(31;0.0585)|Melanoma(40;0.123)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;9.16e-06)|Epithelial(32;1.21e-05)|all cancers(32;1.63e-05)		TCTGGCAGGACCCCCTGGAGC	0.662																																																	0													22.0	24.0	23.0					10																	134895346		1514	3507	5021	SO:0001583	missense	0			AB058731	CCDS41580.1	10q26	2014-08-08			ENSG00000197177	ENSG00000197177		"""-"", ""GPCR / Class B : Orphans"""	13838	protein-coding gene	gene with protein product		612302				12565841	Standard	XM_005252695		Approved	KIAA1828	uc001llw.3	Q86SQ6	OTTHUMG00000019304	ENST00000607359.1:c.989C>A	10.37:g.134895346C>A	ENSP00000475778:p.Thr330Asn		A5HL16|A6NG50|Q5T234|Q86SN7|Q96JJ9	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like	p.T330N	ENST00000607359.1	37	c.989		10	.	.	.	.	.	.	.	.	.	.	C	4.395	0.072920	0.08436	.	.	ENSG00000197177	ENST00000368577;ENST00000392609	.	.	.	1.37	1.37	0.22104	.	.	.	.	.	T	0.25082	0.0609	.	.	.	0.31745	N	0.635308	P	0.35821	0.523	B	0.23716	0.048	T	0.31752	-0.9932	6	0.87932	D	0	.	6.1998	0.20569	0.0:1.0:0.0:0.0	.	330	Q86SQ6-1	.	N	330	.	ENSP00000357566:T330N	T	+	2	0	GPR123	134745336	0.000000	0.05858	0.001000	0.08648	0.011000	0.07611	-0.017000	0.12590	1.090000	0.41315	0.537000	0.68136	ACC	GPR123	-	NULL	ENSG00000197177		0.662	GPR123-004	PUTATIVE	basic|appris_candidate_longest	protein_coding	GPR123	HGNC	protein_coding	OTTHUMT00000316904.2	-	0.00	50	0	C			134895346	+1	tier1	-	no_errors	ENST00000607359	ensembl	human	putative	74_37	missense	41.51	30	22	SNP	0.001	A
GPR123	84435	genome.wustl.edu	37	10	134942261	134942261	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr10:134942261G>A	ENST00000392607.3	+	7	1365	c.929G>A	c.(928-930)cGt>cAt	p.R310H	GPR123_ENST00000392606.2_Missense_Mutation_p.R213H|GPR123_ENST00000607359.1_Missense_Mutation_p.R1029H	NM_001083909.1	NP_001077378.1	Q86SQ6	GP123_HUMAN	G protein-coupled receptor 123	310					G-protein coupled receptor signaling pathway (GO:0007186)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(3)	14		all_cancers(35;1.8e-10)|all_epithelial(44;8.95e-09)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Colorectal(31;0.0585)|Melanoma(40;0.123)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;9.16e-06)|Epithelial(32;1.21e-05)|all cancers(32;1.63e-05)		TGCGCCAAGCGTGAGGACGTG	0.692																																																	0													40.0	32.0	35.0					10																	134942261		2192	4280	6472	SO:0001583	missense	0			AB058731	CCDS41580.1	10q26	2014-08-08			ENSG00000197177	ENSG00000197177		"""-"", ""GPCR / Class B : Orphans"""	13838	protein-coding gene	gene with protein product		612302				12565841	Standard	XM_005252695		Approved	KIAA1828	uc001llw.3	Q86SQ6	OTTHUMG00000019304	ENST00000392607.3:c.929G>A	10.37:g.134942261G>A	ENSP00000376384:p.Arg310His		A5HL16|A6NG50|Q5T234|Q86SN7|Q96JJ9	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like	p.R1029H	ENST00000392607.3	37	c.3086	CCDS41580.1	10	.	.	.	.	.	.	.	.	.	.	.	33	5.248781	0.95305	.	.	ENSG00000197177	ENST00000368577;ENST00000392607;ENST00000392606	T	0.58358	0.34	4.91	4.91	0.64330	GPCR, family 2-like (1);GPCR, family 2, secretin-like, conserved site (1);	0.000000	0.48767	D	0.000163	T	0.71550	0.3353	M	0.71581	2.175	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.74999	-0.3472	10	0.72032	D	0.01	-41.945	15.9562	0.79889	0.0:0.0:1.0:0.0	.	310;1029	Q86SQ6;Q86SQ6-1	GP123_HUMAN;.	H	1029;310;214	ENSP00000376384:R310H	ENSP00000357566:R1029H	R	+	2	0	GPR123	134792251	1.000000	0.71417	0.984000	0.44739	0.877000	0.50540	9.218000	0.95166	2.442000	0.82660	0.561000	0.74099	CGT	GPR123	-	pfscan_GPCR_2-like	ENSG00000197177		0.692	GPR123-003	NOVEL	basic|appris_candidate|exp_conf|CCDS	protein_coding	GPR123	HGNC	protein_coding	OTTHUMT00000051113.2	-	0.00	25	0	G			134942261	+1	tier1	-	no_errors	ENST00000607359	ensembl	human	putative	74_37	missense	46.67	8	7	SNP	1.000	A
GPR139	124274	genome.wustl.edu	37	16	20043281	20043281	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr16:20043281T>C	ENST00000570682.1	-	2	1138	c.838A>G	c.(838-840)Atc>Gtc	p.I280V		NM_001002911.2	NP_001002911.1	Q6DWJ6	GP139_HUMAN	G protein-coupled receptor 139	280					G-protein coupled receptor signaling pathway (GO:0007186)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)			autonomic_ganglia(1)|central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(17)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	30						AAGAAGTTGATGGCTGTGTTC	0.532																																																	0													98.0	98.0	98.0					16																	20043281		2203	4300	6503	SO:0001583	missense	0			AY255545	CCDS32398.1	16p13.11	2012-08-21						"""GPCR / Class A : Orphans"""	19995	protein-coding gene	gene with protein product						12679517	Standard	XM_005255114		Approved	PGR3	uc002dgu.1	Q6DWJ6		ENST00000570682.1:c.838A>G	16.37:g.20043281T>C	ENSP00000458791:p.Ile280Val		A8K5R9|Q86SP2|Q8TDU8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srw,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.I280V	ENST00000570682.1	37	c.838	CCDS32398.1	16	.	.	.	.	.	.	.	.	.	.	T	1.271	-0.612940	0.03690	.	.	ENSG00000180269	ENST00000326571	.	.	.	5.52	4.43	0.53597	GPCR, rhodopsin-like superfamily (1);	0.177376	0.50627	D	0.000115	T	0.21062	0.0507	N	0.02802	-0.49	0.34134	D	0.665619	B	0.06786	0.001	B	0.17098	0.017	T	0.21008	-1.0258	9	0.09084	T	0.74	-30.2765	10.5047	0.44826	0.0:0.0753:0.0:0.9247	.	280	Q6DWJ6	GP139_HUMAN	V	280	.	ENSP00000370779:I280V	I	-	1	0	GPR139	19950782	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.741000	0.55090	0.935000	0.37341	0.533000	0.62120	ATC	GPR139	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srw,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000180269		0.532	GPR139-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR139	HGNC	protein_coding	OTTHUMT00000438522.1	-	0.00	52	0	T	NM_001002911		20043281	-1	tier1	-	no_errors	ENST00000570682	ensembl	human	known	74_37	missense	41.33	43	31	SNP	1.000	C
GPR32	2854	genome.wustl.edu	37	19	51274851	51274851	+	Missense_Mutation	SNP	A	A	C	rs201404376		TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr19:51274851A>C	ENST00000270590.4	+	1	1131	c.994A>C	c.(994-996)Act>Cct	p.T332P		NM_001506.1	NP_001497.1	O75388	GPR32_HUMAN	G protein-coupled receptor 32	332					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			breast(4)|endometrium(4)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	29		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00641)|GBM - Glioblastoma multiforme(134;0.028)		CCAGTCTTTGACTTCTGCCCT	0.552																																					Esophageal Squamous(113;152 1581 5732 15840 44398)												0													66.0	71.0	69.0					19																	51274851		2203	4298	6501	SO:0001583	missense	0			AF045764	CCDS12801.1	19q13.33	2012-08-20			ENSG00000142511	ENSG00000142511		"""GPCR / Class A : Resolvin receptors"""	4487	protein-coding gene	gene with protein product	"""resolvin D1 receptor"""	603195				9653656	Standard	NM_001506		Approved	RVDR1	uc010ycf.3	O75388		ENST00000270590.4:c.994A>C	19.37:g.51274851A>C	ENSP00000270590:p.Thr332Pro		Q502U7|Q6NWS5	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_Formyl_pep_rcpt	p.T332P	ENST00000270590.4	37	c.994	CCDS12801.1	19	.	.	.	.	.	.	.	.	.	.	a	0.006	-2.066505	0.00382	.	.	ENSG00000142511	ENST00000270590	T	0.36699	1.24	2.71	-0.781	0.10965	.	.	.	.	.	T	0.12518	0.0304	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.31138	-0.9954	9	0.02654	T	1	.	3.6506	0.08202	0.205:0.5623:0.0:0.2327	.	332	O75388	GPR32_HUMAN	P	332	ENSP00000270590:T332P	ENSP00000270590:T332P	T	+	1	0	GPR32	55966663	0.000000	0.05858	0.025000	0.17156	0.653000	0.38743	0.089000	0.15002	-0.262000	0.09392	-0.755000	0.03482	ACT	GPR32	-	prints_Formyl_pep_rcpt	ENSG00000142511		0.552	GPR32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR32	HGNC	protein_coding	OTTHUMT00000465016.1	-	0.00	57	0	A			51274851	+1	tier1	rs201404376	no_errors	ENST00000270590	ensembl	human	known	74_37	missense	15.25	50	9	SNP	0.018	C
GZMH	2999	genome.wustl.edu	37	14	25076443	25076443	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr14:25076443C>T	ENST00000216338.4	-	4	553	c.509G>A	c.(508-510)tGc>tAc	p.C170Y	RP11-104E19.1_ENST00000557736.1_RNA|GZMH_ENST00000557220.2_Intron|RP11-104E19.1_ENST00000555300.1_RNA|GZMH_ENST00000382548.4_Intron	NM_033423.4	NP_219491.1	P20718	GRAH_HUMAN	granzyme H (cathepsin G-like 2, protein h-CCPX)	170	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				apoptotic process (GO:0006915)|cytolysis (GO:0019835)	membrane (GO:0016020)	serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)|skin(1)	12				GBM - Glioblastoma multiforme(265;0.0267)		TTCACACTGGCAGTCCTTCTG	0.522																																																	0													193.0	177.0	182.0					14																	25076443		2203	4300	6503	SO:0001583	missense	0			M72150	CCDS9632.1, CCDS59243.1	14q11.2	2003-10-20			ENSG00000100450	ENSG00000100450			4710	protein-coding gene	gene with protein product		116831		CTSGL2		2049336	Standard	NM_033423		Approved	CGL-2, CCP-X, CTLA1, CSP-C	uc001wpr.2	P20718	OTTHUMG00000140185	ENST00000216338.4:c.509G>A	14.37:g.25076443C>T	ENSP00000216338:p.Cys170Tyr		G3V2C5|Q6XGZ0|Q6XGZ1	Missense_Mutation	SNP	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.C170Y	ENST00000216338.4	37	c.509	CCDS9632.1	14	.	.	.	.	.	.	.	.	.	.	c	8.535	0.871889	0.17322	.	.	ENSG00000100450	ENST00000216338	D	0.88354	-2.37	4.83	-9.67	0.00531	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	T	0.68613	0.3020	N	0.01576	-0.805	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.59553	-0.7433	9	0.54805	T	0.06	.	12.6848	0.56942	0.0:0.6466:0.1249:0.2285	.	170	P20718	GRAH_HUMAN	Y	170	ENSP00000216338:C170Y	ENSP00000216338:C170Y	C	-	2	0	GZMH	24146283	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.768000	0.00371	-1.725000	0.01371	-1.202000	0.01658	TGC	GZMH	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1	ENSG00000100450		0.522	GZMH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GZMH	HGNC	protein_coding	OTTHUMT00000276538.2	-	0.00	16	0	C	NM_033423		25076443	-1	tier1	-	no_errors	ENST00000216338	ensembl	human	known	74_37	missense	20.00	16	4	SNP	0.000	T
HACE1	57531	genome.wustl.edu	37	6	105244829	105244829	+	Missense_Mutation	SNP	A	A	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr6:105244829A>T	ENST00000262903.4	-	8	965	c.689T>A	c.(688-690)gTa>gAa	p.V230E	HACE1_ENST00000369125.2_Missense_Mutation_p.V230E	NM_020771.3	NP_065822.2	Q8IYU2	HACE1_HUMAN	HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1	230					cell cycle (GO:0007049)|Golgi organization (GO:0007030)|membrane fusion (GO:0061025)|protein K48-linked ubiquitination (GO:0070936)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|Rac protein signal transduction (GO:0016601)|regulation of cell migration (GO:0030334)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	ligase activity (GO:0016874)|Rab GTPase binding (GO:0017137)|Rac GTPase binding (GO:0048365)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(17)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	44		all_cancers(87;6.89e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0216)|Colorectal(196;0.202)		BRCA - Breast invasive adenocarcinoma(108;0.122)|Epithelial(106;0.204)		CAGAGGAGTTACTCCATTTTT	0.333																																																	0													118.0	117.0	117.0					6																	105244829		2203	4300	6503	SO:0001583	missense	0			BC034982	CCDS5050.1	6q21	2013-01-10	2012-02-23		ENSG00000085382	ENSG00000085382		"""Ankyrin repeat domain containing"""	21033	protein-coding gene	gene with protein product		610876				10718198	Standard	NM_020771		Approved	KIAA1320	uc003pqu.1	Q8IYU2	OTTHUMG00000015287	ENST00000262903.4:c.689T>A	6.37:g.105244829A>T	ENSP00000262903:p.Val230Glu		A8K6U5|B3KY89|B4DFM6|B4DTQ4|B7Z9X6|E9PGP0|Q5VU99|Q5VUA0|Q8ND12|Q9P2M6	Missense_Mutation	SNP	pfam_HECT,pfam_Ankyrin_rpt,superfamily_HECT,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_HECT,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_HECT,prints_Ankyrin_rpt	p.V230E	ENST00000262903.4	37	c.689	CCDS5050.1	6	.	.	.	.	.	.	.	.	.	.	A	20.0	3.931294	0.73442	.	.	ENSG00000085382	ENST00000262903;ENST00000369125;ENST00000519645	T;T;T	0.62498	0.02;0.02;0.02	5.42	5.42	0.78866	Ankyrin repeat-containing domain (4);	0.180765	0.49305	D	0.000151	T	0.40522	0.1120	N	0.14661	0.345	0.54753	D	0.999988	P;P	0.48407	0.91;0.91	P;B	0.46049	0.502;0.216	T	0.52808	-0.8526	10	0.62326	D	0.03	.	15.4695	0.75429	1.0:0.0:0.0:0.0	.	230;230	E9PGP0;Q8IYU2	.;HACE1_HUMAN	E	230;230;186	ENSP00000262903:V230E;ENSP00000358121:V230E;ENSP00000429765:V186E	ENSP00000262903:V230E	V	-	2	0	HACE1	105351522	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	8.435000	0.90297	2.050000	0.60909	0.397000	0.26171	GTA	HACE1	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000085382		0.333	HACE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HACE1	HGNC	protein_coding	OTTHUMT00000041643.2		0.00	55	0	A	XM_045095		105244829	-1			no_errors	ENST00000262903	ensembl	human	known	74_37	missense	5.13	74	4	SNP	1.000	T
HARS	3035	genome.wustl.edu	37	5	140070830	140070830	+	Silent	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr5:140070830G>T	ENST00000504156.1	-	1	779	c.60C>A	c.(58-60)ggC>ggA	p.G20G	HARS_ENST00000448240.1_5'UTR|HARS2_ENST00000437649.2_5'Flank|HARS_ENST00000457527.2_Silent_p.G20G|HARS2_ENST00000230771.3_5'Flank|HARS_ENST00000431330.2_Silent_p.G20G|HARS_ENST00000415192.2_Silent_p.G20G|HARS_ENST00000307633.3_Silent_p.G20G|HARS2_ENST00000448069.2_5'Flank|HARS2_ENST00000508522.1_5'Flank|HARS2_ENST00000435019.2_5'Flank|HARS_ENST00000438307.2_Silent_p.G20G|HARS2_ENST00000432671.2_5'Flank	NM_002109.4	NP_002100.2	P12081	SYHC_HUMAN	histidyl-tRNA synthetase	20	WHEP-TRS.				gene expression (GO:0010467)|histidyl-tRNA aminoacylation (GO:0006427)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|histidine-tRNA ligase activity (GO:0004821)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	19			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		L-Histidine(DB00117)	GCTGCTTGAGGCCTCGCACGC	0.652																																																	0													42.0	35.0	37.0					5																	140070830		2203	4300	6503	SO:0001819	synonymous_variant	0			AK000498	CCDS4237.1, CCDS58976.1, CCDS58977.1, CCDS58978.1, CCDS75323.1, CCDS75324.1	5q31.3	2012-10-02			ENSG00000170445	ENSG00000170445	6.1.1.21	"""Aminoacyl tRNA synthetases / Class II"""	4816	protein-coding gene	gene with protein product	"""histidine tRNA ligase 1, cytoplasmic"""	142810					Standard	XM_005268428		Approved		uc003lgv.4	P12081	OTTHUMG00000129502	ENST00000504156.1:c.60C>A	5.37:g.140070830G>T			B4DHQ1|B4DY73|D6REN6|J3KNE5	Silent	SNP	pfam_aa-tRNA-synt_IIb_cons-dom,pfam_Anticodon-bd,pfam_WHEP-TRS,superfamily_Anticodon-bd,superfamily_S15_NS1_RNA-bd,pirsf_HisRS/HisZ,pfscan_aa-tRNA-synth_II,pfscan_WHEP-TRS,tigrfam_His-tRNA-ligase	p.G20	ENST00000504156.1	37	c.60	CCDS4237.1	5																																																																																			HARS	-	pfam_WHEP-TRS,superfamily_S15_NS1_RNA-bd,pfscan_WHEP-TRS	ENSG00000170445		0.652	HARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HARS	HGNC	protein_coding	OTTHUMT00000251673.2	-	0.00	34	0	G	NM_002109		140070830	-1	tier1	-	no_errors	ENST00000504156	ensembl	human	known	74_37	silent	6.45	58	4	SNP	0.015	T
HCN4	10021	genome.wustl.edu	37	15	73660109	73660111	+	In_Frame_Del	DEL	GGC	GGC	-			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	GGC	GGC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr15:73660109_73660111delGGC	ENST00000261917.3	-	1	1494_1496	c.501_503delGCC	c.(499-504)ccgccc>ccc	p.167_168PP>P		NM_005477.2	NP_005468.1	Q9Y3Q4	HCN4_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 4	167					blood circulation (GO:0008015)|cation transport (GO:0006812)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)|terminal bouton (GO:0043195)	cAMP binding (GO:0030552)|cation channel activity (GO:0005261)|identical protein binding (GO:0042802)|intracellular cAMP activated cation channel activity (GO:0005222)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(13)|liver(1)|lung(18)|ovary(6)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				COAD - Colon adenocarcinoma(1;0.142)		TGGCTGCTGGGGCGGCGGCGGCG	0.788																																																	0																																										SO:0001651	inframe_deletion	0			AJ132429	CCDS10248.1	15q24.1	2011-07-05			ENSG00000138622	ENSG00000138622		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	16882	protein-coding gene	gene with protein product		605206				10228147, 10430953, 16382102	Standard	NM_005477		Approved		uc002avp.3	Q9Y3Q4	OTTHUMG00000137563	ENST00000261917.3:c.501_503delGCC	15.37:g.73660118_73660120delGGC	ENSP00000261917:p.Pro168del		Q9UMQ7	In_Frame_Del	DEL	pfam_Ion_trans_N,pfam_cNMP-bd_dom,pfam_Ion_trans_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG,pfscan_cNMP-bd_dom	p.P168in_frame_del	ENST00000261917.3	37	c.503_501	CCDS10248.1	15																																																																																			HCN4	-	NULL	ENSG00000138622		0.788	HCN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCN4	HGNC	protein_coding	OTTHUMT00000268900.2		0.00	8	0	GGC	NM_005477		73660111	-1	tier1		no_errors	ENST00000261917	ensembl	human	known	74_37	in_frame_del	33.33	4	2	DEL	1.000:0.991:0.975	-
HCG17	414778	genome.wustl.edu	37	6	30231236	30231236	+	lincRNA	SNP	C	C	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr6:30231236C>T	ENST00000453558.1	-	0	126				HLA-L_ENST00000463348.1_RNA					HLA complex group 17 (non-protein coding)																		GCAGCTTTTACCCTATTTCCA	0.428																																																	0													56.0	59.0	58.0					6																	30231236		2203	4300	6503			0			AB023055		6p21	2012-11-02	2008-08-13		ENSG00000241701	ENSG00000270604		"""Long non-coding RNAs"""	31339	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 46"", ""long intergenic non-protein coding RNA 46"""						Standard	NR_052012		Approved	NCRNA00046, LINC00046	uc031snc.1		OTTHUMG00000031114		6.37:g.30231236C>T				RNA	SNP	-	NULL	ENST00000453558.1	37	NULL		6																																																																																			HLA-L	-	-	ENSG00000243753		0.428	HCG17-002	KNOWN	basic|exp_conf	lincRNA	HLA-L	HGNC	lincRNA	OTTHUMT00000256054.1	-	0.00	41	0	C	NR_052012		30231236	+1	tier1	-	no_errors	ENST00000463348	ensembl	human	known	74_37	rna	5.33	71	4	SNP	0.000	T
HMGB1P5	10354	genome.wustl.edu	37	3	22424159	22424159	+	RNA	SNP	T	T	C	rs11921417		TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr3:22424159T>C	ENST00000451497.1	+	0	724									high mobility group box 1 pseudogene 5																		AGCCACTAACTTTGCCTGGTA	0.378																																																	0																																												0			AF076677		3p24	2011-09-21	2011-04-05	2010-10-15	ENSG00000132967	ENSG00000132967		"""High mobility group / HMG-box pseudogenes"""	4997	pseudogene	pseudogene			"""high-mobility group (nonhistone chromosomal) protein 1-like 5"", ""high-mobility group (nonhistone chromosomal) protein 1-like 5 pseudogene"", ""high-mobility group box 1-like 5 pseudogene"", ""high-mobility group box 1-like 15"", ""high-mobility group box 1 pseudogene 2"", ""high-mobility group box 1-like 5"", ""high-mobility group box 1 pseudogene 5"""	HMG1L5, HMGB1L15, HMGB1P2, HMGB1L5		9925949	Standard	NG_000897		Approved				OTTHUMG00000155591		3.37:g.22424159T>C				RNA	SNP	-	NULL	ENST00000451497.1	37	NULL		3																																																																																			HMGB1P5	-	-	ENSG00000132967		0.378	HMGB1P5-002	KNOWN	basic	processed_transcript	HMGB1P5	HGNC	pseudogene	OTTHUMT00000340803.1		0.00	38	0	T	NG_000897		22424159	+1			no_errors	ENST00000451497	ensembl	human	known	74_37	rna	27.27	8	3	SNP	1.000	C
ID4	3400	genome.wustl.edu	37	6	19838106	19838108	+	In_Frame_Del	DEL	GCG	GCG	-			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	GCG	GCG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr6:19838106_19838108delGCG	ENST00000378700.3	+	1	490_492	c.121_123delGCG	c.(121-123)gcgdel	p.A48del	RP1-167F1.2_ENST00000432171.2_RNA	NM_001546.3	NP_001537.1	P47928	ID4_HUMAN	inhibitor of DNA binding 4, dominant negative helix-loop-helix protein	48	Poly-Ala.				cellular protein localization (GO:0034613)|central nervous system myelination (GO:0022010)|cerebral cortex neuron differentiation (GO:0021895)|fat cell differentiation (GO:0045444)|G1/S transition of mitotic cell cycle (GO:0000082)|hippocampus development (GO:0021766)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuroblast proliferation (GO:0007405)|positive regulation of cell proliferation (GO:0008284)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)			lung(1)	1	Ovarian(93;0.0355)|Breast(50;0.0654)|all_epithelial(95;0.12)		OV - Ovarian serous cystadenocarcinoma(7;0.00659)|all cancers(50;0.0327)|Epithelial(50;0.0621)			CTCCGCAGCCgcggcggcggcgg	0.788																																					Esophageal Squamous(13;105 518 19978 28644 46870)												0										0,152		0,0,76						-2.7	0.9			1	16,642		6,4,319	no	coding	ID4	NM_001546.2		6,4,395	A1A1,A1R,RR		2.4316,0.0,1.9753				16,794				SO:0001651	inframe_deletion	0			U16153	CCDS4544.1	6p22.3	2013-05-21			ENSG00000172201	ENSG00000172201		"""Basic helix-loop-helix proteins"""	5363	protein-coding gene	gene with protein product		600581				7665172	Standard	NM_001546		Approved	bHLHb27	uc003ncw.4	P47928	OTTHUMG00000014333	ENST00000378700.3:c.121_123delGCG	6.37:g.19838115_19838117delGCG	ENSP00000367972:p.Ala48del		Q13005	In_Frame_Del	DEL	pfam_bHLH_dom,superfamily_bHLH_dom,superfamily_Trp_syn_b_sub_like_PLP_eny_SF,smart_bHLH_dom,pfscan_bHLH_dom	p.A44in_frame_del	ENST00000378700.3	37	c.121_123	CCDS4544.1	6																																																																																			ID4	-	superfamily_Trp_syn_b_sub_like_PLP_eny_SF	ENSG00000172201		0.788	ID4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ID4	HGNC	protein_coding	OTTHUMT00000039979.1		0.00	26	0	GCG	NM_001546		19838108	+1	tier1		no_errors	ENST00000378700	ensembl	human	known	74_37	in_frame_del	10.00	18	2	DEL	0.988:0.989:0.984	-
INTS10	55174	genome.wustl.edu	37	8	19677964	19677964	+	Missense_Mutation	SNP	T	T	A			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr8:19677964T>A	ENST00000397977.3	+	4	774	c.376T>A	c.(376-378)Tta>Ata	p.L126I	INTS10_ENST00000521758.1_Intron	NM_018142.2	NP_060612.2	Q9NVR2	INT10_HUMAN	integrator complex subunit 10	126					snRNA processing (GO:0016180)	integrator complex (GO:0032039)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	20				Colorectal(111;0.057)|COAD - Colon adenocarcinoma(73;0.215)		CTTCAACACGTTAGAACGATC	0.403																																																	0													138.0	131.0	133.0					8																	19677964		1911	4130	6041	SO:0001583	missense	0			AK001431	CCDS6011.2	8p21.3	2006-04-26	2006-03-15	2006-03-15	ENSG00000104613	ENSG00000104613			25548	protein-coding gene	gene with protein product		611353	"""chromosome 8 open reading frame 35"""	C8orf35		16239144	Standard	XM_005273558		Approved	FLJ10569, INT10	uc003wzj.3	Q9NVR2	OTTHUMG00000131065	ENST00000397977.3:c.376T>A	8.37:g.19677964T>A	ENSP00000381064:p.Leu126Ile		Q6IA93|Q7L538|Q7L8C8|Q9H3W8	Missense_Mutation	SNP	NULL	p.L126I	ENST00000397977.3	37	c.376	CCDS6011.2	8	.	.	.	.	.	.	.	.	.	.	T	18.54	3.645369	0.67358	.	.	ENSG00000104613	ENST00000397977	.	.	.	5.86	-5.19	0.02832	.	0.000000	0.85682	D	0.000000	T	0.61009	0.2313	L	0.34521	1.04	0.35284	D	0.781572	D	0.67145	0.996	D	0.75484	0.986	T	0.65561	-0.6138	9	0.35671	T	0.21	-17.5803	18.1991	0.89832	0.0:0.7182:0.0:0.2818	.	126	Q9NVR2	INT10_HUMAN	I	126	.	ENSP00000381064:L126I	L	+	1	2	INTS10	19722244	0.000000	0.05858	0.008000	0.14137	0.986000	0.74619	-1.115000	0.03289	-0.760000	0.04677	0.533000	0.62120	TTA	INTS10	-	NULL	ENSG00000104613		0.403	INTS10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INTS10	HGNC	protein_coding	OTTHUMT00000253724.2	-	0.00	60	0	T	NM_018142		19677964	+1	tier1	-	no_errors	ENST00000397977	ensembl	human	known	74_37	missense	8.42	87	8	SNP	0.005	A
ISL2	64843	genome.wustl.edu	37	15	76630669	76630669	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr15:76630669G>A	ENST00000290759.4	+	3	485	c.325G>A	c.(325-327)Gtg>Atg	p.V109M	RP11-685G9.2_ENST00000559539.1_RNA	NM_145805.1	NP_665804.1	Q96A47	ISL2_HUMAN	ISL LIM homeobox 2	109	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				negative regulation of neuron differentiation (GO:0045665)|neuron development (GO:0048666)|peripheral nervous system neuron development (GO:0048935)|regulation of transcription, DNA-templated (GO:0006355)|retinal ganglion cell axon guidance (GO:0031290)|spinal cord motor neuron cell fate specification (GO:0021520)|visceral motor neuron differentiation (GO:0021524)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|lung(2)|ovary(1)|skin(1)	6						GCGGGACAGCGTGTACCACAT	0.687																																					GBM(97;953 1391 16164 31496 36951)												0													21.0	21.0	21.0					15																	76630669		2195	4290	6485	SO:0001583	missense	0			AK001022	CCDS10290.1	15q24.3	2012-03-09	2007-07-13		ENSG00000159556	ENSG00000159556		"""Homeoboxes / LIM class"""	18524	protein-coding gene	gene with protein product		609481	"""ISL2 transcription factor, LIM/homeodomain, (islet-2)"""				Standard	NM_145805		Approved	FLJ10160	uc002bbw.1	Q96A47	OTTHUMG00000143723	ENST00000290759.4:c.325G>A	15.37:g.76630669G>A	ENSP00000290759:p.Val109Met		B3KM37	Missense_Mutation	SNP	pfam_Znf_LIM,pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Znf_LIM,smart_Homeobox_dom,pfscan_Znf_LIM,pfscan_Homeobox_dom	p.V109M	ENST00000290759.4	37	c.325	CCDS10290.1	15	.	.	.	.	.	.	.	.	.	.	G	22.8	4.331392	0.81690	.	.	ENSG00000159556	ENST00000290759	D	0.88277	-2.36	4.3	4.3	0.51218	Zinc finger, LIM-type (5);	0.128400	0.51477	D	0.000088	D	0.94608	0.8262	M	0.86178	2.8	0.58432	D	0.999997	D	0.89917	1.0	D	0.77557	0.99	D	0.95501	0.8577	10	0.87932	D	0	.	15.5201	0.75859	0.0:0.0:1.0:0.0	.	109	Q96A47	ISL2_HUMAN	M	109	ENSP00000290759:V109M	ENSP00000290759:V109M	V	+	1	0	ISL2	74417724	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.422000	0.80217	2.219000	0.72066	0.555000	0.69702	GTG	ISL2	-	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	ENSG00000159556		0.687	ISL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ISL2	HGNC	protein_coding	OTTHUMT00000289779.1		0.00	58	0	G			76630669	+1			no_errors	ENST00000290759	ensembl	human	known	74_37	missense	5.19	73	4	SNP	1.000	A
ITGB1BP2	26548	genome.wustl.edu	37	X	70524467	70524467	+	Intron	SNP	C	C	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chrX:70524467C>T	ENST00000373829.3	+	10	889				ITGB1BP2_ENST00000465388.1_3'UTR|ITGB1BP2_ENST00000538820.1_Intron	NM_012278.1	NP_036410.1	Q9UKP3	ITBP2_HUMAN	integrin beta 1 binding protein (melusin) 2						muscle organ development (GO:0007517)|signal transduction (GO:0007165)	Z disc (GO:0030018)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			breast(1)|endometrium(5)|large_intestine(2)|lung(5)|ovary(1)	14	Renal(35;0.156)					AAGTGAAGACCAGGGGACACA	0.488																																																	0													74.0	59.0	64.0					X																	70524467		2203	4300	6503	SO:0001627	intron_variant	0			AF140690	CCDS14411.1	Xq12.1-q13	2008-02-05			ENSG00000147166	ENSG00000147166			6154	protein-coding gene	gene with protein product		300332				10506186	Standard	XM_005262255		Approved	CHORDC3	uc004dzr.1	Q9UKP3	OTTHUMG00000021793	ENST00000373829.3:c.816+13C>T	X.37:g.70524467C>T			Q32N04|Q549J7	RNA	SNP	-	NULL	ENST00000373829.3	37	NULL	CCDS14411.1	X																																																																																			ITGB1BP2	-	-	ENSG00000147166		0.488	ITGB1BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGB1BP2	HGNC	protein_coding	OTTHUMT00000057126.1		0.00	47	0	C	NM_012278		70524467	+1			no_errors	ENST00000465388	ensembl	human	known	74_37	rna	5.00	76	4	SNP	0.005	T
KCNJ12	3768	genome.wustl.edu	37	17	21319092	21319092	+	Silent	SNP	C	C	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr17:21319092C>T	ENST00000583088.1	+	3	1333	c.438C>T	c.(436-438)taC>taT	p.Y146Y	KCNJ12_ENST00000331718.5_Silent_p.Y146Y	NM_021012.4	NP_066292.2	Q14500	KCJ12_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 12	146					muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of heart contraction (GO:0008016)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|intrinsic component of membrane (GO:0031224)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)			NS(1)|breast(4)|endometrium(4)|kidney(1)|large_intestine(5)|lung(39)|ovary(5)|skin(8)|stomach(3)	70				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)|Yohimbine(DB01392)	CCATCGGCTACGGGCTGCGCT	0.647										Prostate(3;0.18)																																							0													50.0	48.0	49.0					17																	21319092		2203	4299	6502	SO:0001819	synonymous_variant	0			L36069	CCDS11219.1	17p11.1	2011-07-05	2004-01-13		ENSG00000184185	ENSG00000184185		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6258	protein-coding gene	gene with protein product		602323	"""potassium inwardly-rectifying channel, subfamily J, inhibitor 1"""	KCNJN1		7859381, 12417321, 16382105	Standard	NM_021012		Approved	Kir2.2, Kir2.2v, IRK2, hIRK1	uc021tss.1	Q14500	OTTHUMG00000132039	ENST00000583088.1:c.438C>T	17.37:g.21319092C>T			O43401|Q15756|Q8NG63	Silent	SNP	pfam_K_chnl_inward-rec_Kir,pfam_K_chnl_inward-rec_Kir_N,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir2.2	p.Y146	ENST00000583088.1	37	c.438	CCDS11219.1	17																																																																																			KCNJ12	-	pfam_K_chnl_inward-rec_Kir,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir	ENSG00000184185		0.647	KCNJ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNJ12	HGNC	protein_coding	OTTHUMT00000255060.2	-	0.00	69	0	C	NM_021012		21319092	+1	tier1	-	no_errors	ENST00000331718	ensembl	human	known	74_37	silent	6.98	80	6	SNP	1.000	T
KCNMA1	3778	genome.wustl.edu	37	10	79397159	79397159	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr10:79397159C>A	ENST00000286628.8	-	1	241	c.242G>T	c.(241-243)aGc>aTc	p.S81I	KCNMA1_ENST00000354353.5_Missense_Mutation_p.S81I|KCNMA1_ENST00000372440.1_Missense_Mutation_p.S81I|KCNMA1_ENST00000372443.1_Missense_Mutation_p.S81I|KCNMA1_ENST00000481070.1_Missense_Mutation_p.S81I|KCNMA1_ENST00000404771.3_Missense_Mutation_p.S81I|KCNMA1_ENST00000406533.3_Missense_Mutation_p.S81I|KCNMA1_ENST00000404857.1_Missense_Mutation_p.S81I|KCNMA1_ENST00000480683.1_Missense_Mutation_p.S81I|KCNMA1_ENST00000286627.5_Missense_Mutation_p.S81I	NM_001161352.1	NP_001154824.1	Q12791	KCMA1_HUMAN	potassium large conductance calcium-activated channel, subfamily M, alpha member 1	81					blood coagulation (GO:0007596)|cellular potassium ion homeostasis (GO:0030007)|micturition (GO:0060073)|negative regulation of cell volume (GO:0045794)|positive regulation of apoptotic process (GO:0043065)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|response to calcium ion (GO:0051592)|response to carbon monoxide (GO:0034465)|response to hypoxia (GO:0001666)|response to osmotic stress (GO:0006970)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	actin binding (GO:0003779)|calcium-activated potassium channel activity (GO:0015269)|large conductance calcium-activated potassium channel activity (GO:0060072)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(17)|lung(23)|ovary(2)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	68	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Chlorzoxazone(DB00356)|Cromoglicic acid(DB01003)|Diazoxide(DB01119)|Halothane(DB01159)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Miconazole(DB01110)|Procaine(DB00721)	TTGGCCCCGGCTGTCGCACGG	0.602																																																	0													67.0	59.0	62.0					10																	79397159		2203	4300	6503	SO:0001583	missense	0			U11717	CCDS7352.1, CCDS60569.1, CCDS60571.1, CCDS60572.1, CCDS73156.1	10q22	2012-07-05			ENSG00000156113	ENSG00000156113		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6284	protein-coding gene	gene with protein product	"""BK channel alpha subunit"""	600150		SLO		7987297, 16382103	Standard	NM_002247		Approved	KCa1.1, mSLO1	uc001jxn.3	Q12791	OTTHUMG00000018543	ENST00000286628.8:c.242G>T	10.37:g.79397159C>A	ENSP00000286628:p.Ser81Ile		F8WA96|Q12886|Q12917|Q12921|Q12960|Q13150|Q5JQ23|Q5SQR9|Q96LG8|Q9UBB0|Q9UCX0|Q9UQK6	Missense_Mutation	SNP	pfam_K_chnl_Ca-activ_BK_asu,pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,pfam_RCK_N,prints_K_chnl_Ca-activ_BK_asu,prints_K_chnl	p.S81I	ENST00000286628.8	37	c.242		10	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	18.73|18.73|18.73	3.687244|3.687244|3.687244	0.68157|0.68157|0.68157	.|.|.	.|.|.	ENSG00000156113|ENSG00000156113|ENSG00000156113	ENST00000372403|ENST00000372421|ENST00000372440;ENST00000372408;ENST00000372437;ENST00000457953;ENST00000404771;ENST00000372443;ENST00000286627;ENST00000286628;ENST00000406533;ENST00000354353;ENST00000404857	.|.|T;T;T;T;T;T;T;T;T;T	.|.|0.47177	.|.|0.85;0.85;0.85;0.85;0.85;0.85;0.96;0.85;0.85;0.85	3.68|3.68|3.68	2.65|2.65|2.65	0.31530|0.31530|0.31530	.|.|.	.|.|0.145767	.|.|0.47852	.|.|U	.|.|0.000204	T|T|T	0.44371|0.44371|0.44371	0.1290|0.1290|0.1290	N|N|N	0.14661|0.14661|0.14661	0.345|0.345|0.345	0.34664|0.34664|0.34664	D|D|D	0.72299|0.72299|0.72299	.|.|B;D;B;B;B;B;B	.|.|0.54207	.|.|0.037;0.965;0.286;0.409;0.286;0.404;0.286	.|.|B;D;B;B;B;B;B	.|.|0.66716	.|.|0.015;0.946;0.322;0.419;0.322;0.128;0.322	T|T|T	0.55780|0.55780|0.55780	-0.8087|-0.8087|-0.8087	5|5|10	.|.|0.66056	.|.|D	.|.|0.02	-5.7358|-5.7358|-5.7358	6.489|6.489|6.489	0.22105|0.22105|0.22105	0.1815:0.7215:0.0:0.097|0.1815:0.7215:0.0:0.097|0.1815:0.7215:0.0:0.097	.|.|.	.|.|81;81;81;81;81;81;81	.|.|D5MRH1;Q12791-6;B7ZMF5;Q12791-2;Q12791;Q12791-5;Q5SVJ7	.|.|.;.;.;.;KCMA1_HUMAN;.;.	S|H|I	32|69|81;18;16;55;18;81;81;55;81;81;81	.|.|ENSP00000361517:S81I;ENSP00000361485:S18I;ENSP00000361514:S16I;ENSP00000396608:S55I;ENSP00000361520:S81I;ENSP00000286627:S81I;ENSP00000286628:S55I;ENSP00000385552:S81I;ENSP00000346321:S81I;ENSP00000385806:S81I	.|.|ENSP00000286627:S81I	A|Q|S	-|-|-	1|3|2	0|2|0	KCNMA1|KCNMA1|KCNMA1	79067165|79067165|79067165	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.997000|0.997000|0.997000	0.91878|0.91878|0.91878	2.542000|2.542000|2.542000	0.45744|0.45744|0.45744	1.987000|1.987000|1.987000	0.57996|0.57996|0.57996	0.455000|0.455000|0.455000	0.32223|0.32223|0.32223	GCC|CAG|AGC	KCNMA1	-	NULL	ENSG00000156113		0.602	KCNMA1-009	KNOWN	basic|appris_candidate_longest	protein_coding	KCNMA1	HGNC	protein_coding	OTTHUMT00000048885.3	-	0.00	54	0	C	NM_002247		79397159	-1	tier1	-	no_errors	ENST00000406533	ensembl	human	known	74_37	missense	5.63	67	4	SNP	1.000	A
KDELR1	10945	genome.wustl.edu	37	19	48887553	48887553	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr19:48887553C>T	ENST00000330720.2	-	4	732	c.538G>A	c.(538-540)Gcc>Acc	p.A180T	KDELR1_ENST00000597017.1_Missense_Mutation_p.A118T	NM_006801.2	NP_006792.1	P24390	ERD21_HUMAN	KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1	180					intracellular protein transport (GO:0006886)|protein retention in ER lumen (GO:0006621)|vesicle-mediated transport (GO:0016192)	cis-Golgi network (GO:0005801)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	KDEL sequence binding (GO:0005046)	p.A180T(1)		NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(1)|pancreas(1)|urinary_tract(1)	11		all_epithelial(76;2.48e-06)|all_lung(116;5.76e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Prostate(7;0.122)|Breast(70;0.203)		all cancers(93;0.000114)|OV - Ovarian serous cystadenocarcinoma(262;0.000136)|Epithelial(262;0.01)|GBM - Glioblastoma multiforme(486;0.0145)		GCCACAATGGCGATGAGGTCG	0.532																																																	1	Substitution - Missense(1)	large_intestine(1)											73.0	63.0	66.0					19																	48887553		2203	4300	6503	SO:0001583	missense	0			X55885	CCDS12718.1	19q13.3	2008-05-02				ENSG00000105438			6304	protein-coding gene	gene with protein product		131235				2172835	Standard	NM_006801		Approved	ERD2.1, ERD2, HDEL	uc002pjb.1	P24390		ENST00000330720.2:c.538G>A	19.37:g.48887553C>T	ENSP00000329471:p.Ala180Thr		B2R6N4|Q54A39|Q8NBW7	Missense_Mutation	SNP	pfam_ER_ret_rcpt,prints_ER_ret_rcpt	p.A180T	ENST00000330720.2	37	c.538	CCDS12718.1	19	.	.	.	.	.	.	.	.	.	.	C	21.0	4.083507	0.76642	.	.	ENSG00000105438	ENST00000330720	T	0.77229	-1.08	4.68	4.68	0.58851	.	0.000000	0.64402	D	0.000014	T	0.76176	0.3951	M	0.78344	2.41	0.80722	D	1	P	0.42456	0.78	B	0.34536	0.185	T	0.80329	-0.1428	10	0.45353	T	0.12	.	16.8929	0.86092	0.0:1.0:0.0:0.0	.	180	P24390	ERD21_HUMAN	T	180	ENSP00000329471:A180T	ENSP00000329471:A180T	A	-	1	0	KDELR1	53579365	1.000000	0.71417	0.994000	0.49952	0.967000	0.64934	7.549000	0.82163	2.607000	0.88179	0.655000	0.94253	GCC	KDELR1	-	NULL	ENSG00000105438		0.532	KDELR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDELR1	HGNC	protein_coding	OTTHUMT00000465708.1		0.00	54	0	C			48887553	-1			no_errors	ENST00000330720	ensembl	human	known	74_37	missense	8.11	34	3	SNP	1.000	T
KDM6B	23135	genome.wustl.edu	37	17	7751886	7751887	+	Missense_Mutation	DNP	CA	CA	GG	rs150343260		TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C|A	C|A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr17:7751886_7751887CA>GG	ENST00000448097.2	+	11	2611_2612	c.2280_2281CA>GG	c.(2278-2283)acCAcc>acGGcc	p.T761A	KDM6B_ENST00000254846.5_Missense_Mutation_p.T761A			O15054	KDM6B_HUMAN	lysine (K)-specific demethylase 6B	761	Pro-rich.|Thr-rich.				cardiac muscle cell differentiation (GO:0055007)|cellular response to hydrogen peroxide (GO:0070301)|endothelial cell differentiation (GO:0045446)|inflammatory response (GO:0006954)|mesodermal cell differentiation (GO:0048333)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(3)|lung(18)|ovary(1)|pancreas(1)|skin(5)	37						ccaccaccaccaccacggccac	0.639																																																	0																																										SO:0001583	missense	0			AB002344	CCDS32552.1	17p13.1	2011-07-01	2009-04-17	2009-04-17		ENSG00000132510		"""Chromatin-modifying enzymes / K-demethylases"""	29012	protein-coding gene	gene with protein product		611577	"""jumonji domain containing 3"", ""jumonji domain containing 3, histone lysine demethylase"""	JMJD3		10662545, 9205841	Standard	NM_001080424		Approved	KIAA0346	uc002giw.1	O15054		Exception_encountered	17.37:g.7751886_7751887delinsGG	ENSP00000412513:p.Thr761Ala		C9IZ40|Q96G33	Silent|Missense_Mutation	SNP	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom	p.T760|p.T761A	ENST00000448097.2	37	c.2280|c.2281		17																																																																																			KDM6B	-	NULL	ENSG00000132510		0.639	KDM6B-002	KNOWN	basic	protein_coding	KDM6B	HGNC	protein_coding	OTTHUMT00000440248.1		0.00	10|9	0	C|A	XM_043272		7751886|7751887	+1			no_errors	ENST00000254846	ensembl	human	known	74_37	silent|missense	20.00|16.67	20	5|4	SNP	0.191|0.160	G
KEL	3792	genome.wustl.edu	37	7	142638460	142638460	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr7:142638460G>A	ENST00000355265.2	-	19	2552	c.2078C>T	c.(2077-2079)aCt>aTt	p.T693I		NM_000420.2	NP_000411.1	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase	693					vasoconstriction (GO:0042310)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(34)|ovary(3)|prostate(2)|skin(1)	60	Melanoma(164;0.059)					AGGGCTGTGAGTGTCGTGAGA	0.617																																																	0													105.0	109.0	108.0					7																	142638460		2203	4300	6503	SO:0001583	missense	0			BC003135	CCDS34766.1	7q33	2014-07-19	2006-10-10		ENSG00000197993	ENSG00000197993		"""CD molecules"", ""Blood group antigens"""	6308	protein-coding gene	gene with protein product		613883	"""Kell blood group"", ""Kell blood group, metalloendopeptidase"""			1712490, 7683930	Standard	NM_000420		Approved	ECE3, CD238	uc003wcb.3	P23276	OTTHUMG00000157159	ENST00000355265.2:c.2078C>T	7.37:g.142638460G>A	ENSP00000347409:p.Thr693Ile		B2RBV4|Q96RS8|Q99885	Missense_Mutation	SNP	pfam_Peptidase_M13_N,pfam_Peptidase_M13_C,prints_Peptidase_M13_C	p.T693I	ENST00000355265.2	37	c.2078	CCDS34766.1	7	.	.	.	.	.	.	.	.	.	.	g	4.092	0.015039	0.07959	.	.	ENSG00000197993	ENST00000355265	D	0.90563	-2.69	4.77	-2.6	0.06190	Peptidase M13, neprilysin, C-terminal (1);	1.427210	0.04682	N	0.412461	T	0.80618	0.4657	L	0.28192	0.835	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.62651	-0.6809	10	0.27082	T	0.32	0.1209	1.1559	0.01796	0.4483:0.1589:0.2316:0.1611	.	693	P23276	KELL_HUMAN	I	693	ENSP00000347409:T693I	ENSP00000347409:T693I	T	-	2	0	KEL	142348582	0.000000	0.05858	0.001000	0.08648	0.014000	0.08584	-1.139000	0.03213	-0.356000	0.08187	0.651000	0.88453	ACT	KEL	-	pfam_Peptidase_M13_C	ENSG00000197993		0.617	KEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KEL	HGNC	protein_coding	OTTHUMT00000347671.2		0.00	61	0	G	NM_000420		142638460	-1			no_errors	ENST00000355265	ensembl	human	known	74_37	missense	5.63	67	4	SNP	0.000	A
ICE1	23379	genome.wustl.edu	37	5	5447558	5447558	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr5:5447558C>T	ENST00000296564.7	+	8	665	c.443C>T	c.(442-444)aCt>aTt	p.T148I	KIAA0947_ENST00000512608.1_3'UTR	NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		148					positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						GTCAAGCAAACTCAGGACTTC	0.328																																																	0													30.0	27.0	28.0					5																	5447558		1794	4014	5808	SO:0001583	missense	0																														ENST00000296564.7:c.443C>T	5.37:g.5447558C>T	ENSP00000296564:p.Thr148Ile		Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Missense_Mutation	SNP	superfamily_Vitellinogen_superhlx	p.T148I	ENST00000296564.7	37	c.443	CCDS47187.1	5	.	.	.	.	.	.	.	.	.	.	C	18.04	3.535372	0.64972	.	.	ENSG00000164151	ENST00000296564	T	0.11277	2.79	5.87	3.75	0.43078	.	0.628969	0.14660	N	0.306015	T	0.08758	0.0217	L	0.29908	0.895	0.23816	N	0.996761	B	0.26483	0.15	B	0.26693	0.072	T	0.28073	-1.0055	10	0.56958	D	0.05	-11.094	7.8145	0.29252	0.0:0.7736:0.0:0.2264	.	148	Q9Y2F5	K0947_HUMAN	I	148	ENSP00000296564:T148I	ENSP00000296564:T148I	T	+	2	0	KIAA0947	5500558	0.271000	0.24162	0.995000	0.50966	0.998000	0.95712	0.031000	0.13710	0.722000	0.32252	0.655000	0.94253	ACT	KIAA0947	-	NULL	ENSG00000164151		0.328	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0947	HGNC	protein_coding	OTTHUMT00000365575.1	-	0.00	71	0	C			5447558	+1	tier1	-	no_errors	ENST00000296564	ensembl	human	known	74_37	missense	21.47	128	35	SNP	0.966	T
KIF3B	9371	genome.wustl.edu	37	20	30917958	30917958	+	Silent	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr20:30917958G>T	ENST00000375712.3	+	8	2150	c.1983G>T	c.(1981-1983)gtG>gtT	p.V661V	KIF3B_ENST00000418717.2_Silent_p.V287V	NM_004798.3	NP_004789.1	O15066	KIF3B_HUMAN	kinesin family member 3B	661	Globular.				anterograde axon cargo transport (GO:0008089)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cytoskeleton-dependent intracellular transport (GO:0030705)|determination of left/right symmetry (GO:0007368)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic centrosome separation (GO:0007100)|mitotic spindle organization (GO:0007052)|plus-end-directed vesicle transport along microtubule (GO:0072383)|spindle assembly involved in mitosis (GO:0090307)	centrosome (GO:0005813)|cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intraciliary transport particle (GO:0030990)|kinesin II complex (GO:0016939)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|plus-end kinesin complex (GO:0005873)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)|Rho GTPase binding (GO:0017048)			NS(2)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(5)|lung(9)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	36			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			AAAACATTGTGCTGTTAGAGC	0.567																																																	0													54.0	48.0	50.0					20																	30917958		2203	4300	6503	SO:0001819	synonymous_variant	0			AB002357	CCDS13200.1	20q11.21	2012-08-01			ENSG00000101350	ENSG00000101350		"""Kinesins"""	6320	protein-coding gene	gene with protein product		603754				9205841	Standard	NM_004798		Approved	KIAA0359, FLA8, KLP-11	uc002wxq.3	O15066	OTTHUMG00000032214	ENST00000375712.3:c.1983G>T	20.37:g.30917958G>T			B2RMP4|B4DSR5|E1P5M5	Silent	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.V661	ENST00000375712.3	37	c.1983	CCDS13200.1	20																																																																																			KIF3B	-	NULL	ENSG00000101350		0.567	KIF3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF3B	HGNC	protein_coding	OTTHUMT00000078619.1	-	0.00	41	0	G	NM_004798		30917958	+1	tier1	-	no_errors	ENST00000375712	ensembl	human	known	74_37	silent	6.15	61	4	SNP	0.729	T
KLHL30	377007	genome.wustl.edu	37	2	239054439	239054439	+	Silent	SNP	C	C	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr2:239054439C>T	ENST00000409223.1	+	5	1223	c.1116C>T	c.(1114-1116)agC>agT	p.S372S	KLHL30_ENST00000305959.4_Silent_p.S354S			Q0D2K2	KLH30_HUMAN	kelch-like family member 30	372										lung(4)	4		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;4.71e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.02e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.63e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000109)|Lung(119;0.0108)|LUSC - Lung squamous cell carcinoma(224;0.0253)		ACCACGCCAGCGCGGCCCTCA	0.652																																																	0													25.0	33.0	31.0					2																	239054439		2042	4179	6221	SO:0001819	synonymous_variant	0				CCDS46555.1, CCDS46555.2	2q37.3	2013-02-22	2013-02-22		ENSG00000168427	ENSG00000168427		"""Kelch-like"", ""BTB/POZ domain containing"""	24770	protein-coding gene	gene with protein product			"""kelch-like 30 (Drosophila)"""				Standard	NM_198582		Approved	FLJ43374	uc002vxr.2	Q0D2K2	OTTHUMG00000152905	ENST00000409223.1:c.1116C>T	2.37:g.239054439C>T			Q6ZUS1	Silent	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.S372	ENST00000409223.1	37	c.1116	CCDS46555.2	2																																																																																			KLHL30	-	pfam_Kelch_1,smart_Kelch_1,pirsf_Kelch-like_gigaxonin	ENSG00000168427		0.652	KLHL30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL30	HGNC	protein_coding	OTTHUMT00000328518.1		0.00	79	0	C	NM_198582		239054439	+1			no_errors	ENST00000409223	ensembl	human	known	74_37	silent	5.06	75	4	SNP	0.880	T
KLK7	5650	genome.wustl.edu	37	19	51483659	51483659	+	Silent	SNP	G	G	A			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr19:51483659G>A	ENST00000391807.1	-	4	407	c.306C>T	c.(304-306)ccC>ccT	p.P102P	KLK7_ENST00000597707.1_Silent_p.P30P|KLK7_ENST00000336317.4_5'UTR|KLK7_ENST00000595820.1_Silent_p.P102P|CTB-147C22.9_ENST00000594512.1_RNA|KLK7_ENST00000595638.1_5'Flank	NM_139277.2	NP_644806.1	P49862	KLK7_HUMAN	kallikrein-related peptidase 7	102	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	epidermal lamellar body (GO:0097209)|extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(11)|ovary(2)	19		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00382)|GBM - Glioblastoma multiforme(134;0.00895)		TGGAGTAGCCGGGGTGGCGGA	0.577																																																	0													130.0	102.0	112.0					19																	51483659		2203	4300	6503	SO:0001819	synonymous_variant	0			L33404	CCDS12812.1, CCDS59414.1	19q13.33	2011-09-07	2006-10-27			ENSG00000169035		"""Kallikreins"", ""Serine peptidases / Serine peptidases"""	6368	protein-coding gene	gene with protein product		604438	"""kallikrein 7 (chymotryptic, stratum corneum)"""	PRSS6		8034709, 16800724, 16800723	Standard	NM_005046		Approved	SCCE	uc021uyj.1	P49862		ENST00000391807.1:c.306C>T	19.37:g.51483659G>A			A8K0U5|Q8N5N9|Q8NFV7	Missense_Mutation	SNP	NULL	p.P53L	ENST00000391807.1	37	c.158	CCDS12812.1	19																																																																																			KLK7	-	NULL	ENSG00000169035		0.577	KLK7-202	KNOWN	basic|appris_principal|CCDS	protein_coding	KLK7	HGNC	protein_coding	OTTHUMT00000464344.1	-	0.00	55	0	G	NM_005046		51483659	-1	tier1	-	no_errors	ENST00000304045	ensembl	human	known	74_37	missense	6.25	60	4	SNP	0.000	A
KRTAP5-5	439915	genome.wustl.edu	37	11	1651393	1651393	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr11:1651393C>G	ENST00000399676.2	+	1	361	c.323C>G	c.(322-324)gCc>gGc	p.A108G		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	108	8 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)		p.A108G(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		TCCAAGGGGGCCTGTGGCTCC	0.687																																																	1	Substitution - Missense(1)	endometrium(1)											39.0	54.0	49.0					11																	1651393		2187	4284	6471	SO:0001583	missense	0			AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	ENST00000399676.2:c.323C>G	11.37:g.1651393C>G	ENSP00000382584:p.Ala108Gly		A8MWN2	Missense_Mutation	SNP	NULL	p.A108G	ENST00000399676.2	37	c.323	CCDS41592.1	11	.	.	.	.	.	.	.	.	.	.	G	0.036	-1.308300	0.01342	.	.	ENSG00000185940	ENST00000399676;ENST00000422553	T	0.00882	5.58	2.6	1.66	0.24008	.	.	.	.	.	T	0.00271	0.0008	N	0.00018	-2.82	0.18873	N	0.999987	B	0.02656	0.0	B	0.01281	0.0	T	0.44726	-0.9309	9	0.30078	T	0.28	.	9.6754	0.40037	0.0:0.2169:0.783:0.0	.	108	Q701N2	KRA55_HUMAN	G	108;79	ENSP00000382584:A108G	ENSP00000382584:A108G	A	+	2	0	KRTAP5-5	1607969	0.020000	0.18652	1.000000	0.80357	0.027000	0.11550	-1.742000	0.01835	0.397000	0.25310	-0.701000	0.03672	GCC	KRTAP5-5	-	NULL	ENSG00000185940		0.687	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP5-5	HGNC	protein_coding	OTTHUMT00000127919.1		0.00	43	0	C			1651393	+1			no_errors	ENST00000399676	ensembl	human	known	74_37	missense	6.45	58	4	SNP	0.949	G
LEFTY2	7044	genome.wustl.edu	37	1	226128687	226128687	+	Missense_Mutation	SNP	C	C	T	rs202147285		TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr1:226128687C>T	ENST00000366820.5	-	1	502	c.154G>A	c.(154-156)Gtc>Atc	p.V52I	LEFTY2_ENST00000474493.1_5'Flank|LEFTY2_ENST00000420304.2_Missense_Mutation_p.V52I	NM_003240.3	NP_003231.2	O00292	LFTY2_HUMAN	left-right determination factor 2	52					blood coagulation (GO:0007596)|cell growth (GO:0016049)|multicellular organismal development (GO:0007275)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|platelet alpha granule lumen (GO:0031093)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(8)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	16	Breast(184;0.197)					GCGGGGATGACCAGCTTCTCC	0.692																																					Colon(172;116 2643 9098 43333)												0													37.0	42.0	40.0					1																	226128687		2203	4299	6502	SO:0001583	missense	0			U81523	CCDS1549.1, CCDS53479.1	1q42.1	2008-07-18	2004-11-17	2004-11-17	ENSG00000143768	ENSG00000143768			3122	protein-coding gene	gene with protein product	"""transforming growth factor, beta-4 (endometrial bleeding-associated factor; LEFTY A)"""	601877	"""endometrial bleeding associated factor (left-right determination, factor A; transforming growth factor beta superfamily)"""	TGFB4, EBAF		9153275	Standard	NM_001172425		Approved	LEFTA, LEFTYA	uc001hpt.2	O00292	OTTHUMG00000037441	ENST00000366820.5:c.154G>A	1.37:g.226128687C>T	ENSP00000355785:p.Val52Ile		B3KNH4|B4E332|E9PDM4|O75611|Q5TE89|Q8NBQ9	Missense_Mutation	SNP	pfam_TGF-b_N,pfam_TGF-b_C,smart_TGF-b_C,pirsf_LRDF,prints_LRDF	p.V52I	ENST00000366820.5	37	c.154	CCDS1549.1	1	.	.	.	.	.	.	.	.	.	.	C	19.12	3.765072	0.69878	.	.	ENSG00000143768	ENST00000420304;ENST00000366820	T;T	0.71461	-0.57;-0.26	5.13	3.26	0.37387	Transforming growth factor-beta, N-terminal (1);	0.240387	0.41938	D	0.000788	T	0.69214	0.3086	M	0.75777	2.31	0.36726	D	0.881478	P;P;P	0.44380	0.457;0.457;0.834	B;B;B	0.41646	0.081;0.081;0.362	T	0.75068	-0.3448	10	0.66056	D	0.02	.	10.1024	0.42513	0.0:0.8407:0.0:0.1593	.	52;52;52	E9PDM4;B4E332;O00292	.;.;LFTY2_HUMAN	I	52	ENSP00000388009:V52I;ENSP00000355785:V52I	ENSP00000355785:V52I	V	-	1	0	LEFTY2	224195310	1.000000	0.71417	0.995000	0.50966	0.391000	0.30476	0.844000	0.27654	0.675000	0.31264	0.561000	0.74099	GTC	LEFTY2	-	pfam_TGF-b_N,pirsf_LRDF,prints_LRDF	ENSG00000143768		0.692	LEFTY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LEFTY2	HGNC	protein_coding	OTTHUMT00000091152.1	-	0.00	162	0	C	NM_003240		226128687	-1	tier1	rs202147285	no_errors	ENST00000366820	ensembl	human	known	74_37	missense	39.37	174	113	SNP	1.000	T
LILRA1	11024	genome.wustl.edu	37	19	55107747	55107747	+	Missense_Mutation	SNP	C	C	T	rs368541946		TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr19:55107747C>T	ENST00000251372.3	+	7	1234	c.1052C>T	c.(1051-1053)cCg>cTg	p.P351L	LILRB1_ENST00000418536.2_Intron|LILRB1_ENST00000396321.2_Intron|LILRA1_ENST00000453777.1_Intron|LILRA1_ENST00000473156.1_3'UTR|LILRB1_ENST00000448689.1_Intron	NM_006863.2	NP_006854.1	O75019	LIRA1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 1	351	Ig-like C2-type 4.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)|regulation of immune response (GO:0050776)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|liver(1)|lung(23)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	47				GBM - Glioblastoma multiforme(193;0.0348)		TCATGGGGGCCGTTCCACACT	0.582													g|||	1	0.000199681	0.0	0.0	5008	,	,		16247	0.0		0.0	False		,,,				2504	0.001																0													102.0	98.0	100.0					19																	55107747		2203	4300	6503	SO:0001583	missense	0			AF025530	CCDS12901.1, CCDS62802.1	19q13.4	2013-01-11			ENSG00000104974	ENSG00000104974		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6602	protein-coding gene	gene with protein product		604810				9548455	Standard	NM_006863		Approved	LIR-6, CD85i, LIR6	uc002qgh.2	O75019	OTTHUMG00000065701	ENST00000251372.3:c.1052C>T	19.37:g.55107747C>T	ENSP00000251372:p.Pro351Leu		O75018|Q3MJA6	Missense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2,pirsf_A1B_glyco/leuk_Ig-like_rcpt,pfscan_Ig-like_dom	p.P351L	ENST00000251372.3	37	c.1052	CCDS12901.1	19	.	.	.	.	.	.	.	.	.	.	G	3.762	-0.049466	0.07407	.	.	ENSG00000104974	ENST00000251372	T	0.03124	4.04	1.4	-2.8	0.05823	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	60.265400	0.00166	N	0.000001	T	0.04407	0.0121	M	0.61703	1.905	0.09310	N	1	B	0.15930	0.015	B	0.13407	0.009	T	0.52215	-0.8605	10	0.09590	T	0.72	.	0.9875	0.01449	0.1452:0.314:0.2086:0.3322	.	351	O75019	LIRA1_HUMAN	L	351	ENSP00000251372:P351L	ENSP00000251372:P351L	P	+	2	0	LILRA1	59799559	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-11.777000	0.00003	-3.822000	0.00102	-2.577000	0.00169	CCG	LILRA1	-	smart_Ig_sub,smart_Ig_sub2,pirsf_A1B_glyco/leuk_Ig-like_rcpt	ENSG00000104974		0.582	LILRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LILRA1	HGNC	protein_coding	OTTHUMT00000140807.2	-	0.00	91	0	C	NM_006863		55107747	+1	tier1	-	no_errors	ENST00000251372	ensembl	human	known	74_37	missense	64.06	23	41	SNP	0.000	T
LIMCH1	22998	genome.wustl.edu	37	4	41633188	41633188	+	Intron	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr4:41633188G>T	ENST00000313860.7	+	9	989				LIMCH1_ENST00000396595.3_Intron|LIMCH1_ENST00000381753.4_Intron|LIMCH1_ENST00000508501.1_Intron|LIMCH1_ENST00000514096.1_Intron|LIMCH1_ENST00000511496.1_Intron|LIMCH1_ENST00000509277.1_Intron|LIMCH1_ENST00000512820.1_Intron|LIMCH1_ENST00000512946.1_Intron|LIMCH1_ENST00000512632.1_Intron|LIMCH1_ENST00000513024.1_Intron|LIMCH1_ENST00000503057.1_Missense_Mutation_p.C432F	NM_014988.2	NP_055803.2	Q9UPQ0	LIMC1_HUMAN	LIM and calponin homology domains 1						actomyosin structure organization (GO:0031032)		zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(1)|large_intestine(9)|lung(17)|ovary(3)|pancreas(1)|prostate(3)|skin(5)	41						CAGCACATCTGTGCTTCTGAG	0.408																																																	0																																										SO:0001627	intron_variant	0			AB029025	CCDS33977.1, CCDS47047.1, CCDS54763.1, CCDS54764.1, CCDS54765.1, CCDS75119.1, CCDS75121.1	4p13	2007-06-14		2008-01-09	ENSG00000064042	ENSG00000064042			29191	protein-coding gene	gene with protein product						10470851	Standard	XM_005248057		Approved	DKFZP686A01247, LIMCH1A, LMO7B	uc003gvz.4	Q9UPQ0	OTTHUMG00000160575	ENST00000313860.7:c.936-7761G>T	4.37:g.41633188G>T			A8MXC3|E9PHM7|Q503B5|Q5CZB1|Q5CZB6|Q5H9S8|Q68E07|Q6PJ44|Q7Z3G5|Q8N3S9|Q8N6M2	Missense_Mutation	SNP	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.C432F	ENST00000313860.7	37	c.1295	CCDS33977.1	4	.	.	.	.	.	.	.	.	.	.	G	2.796	-0.250212	0.05867	.	.	ENSG00000064042	ENST00000503057;ENST00000313875	T	0.54675	0.56	5.4	2.65	0.31530	.	0.740818	0.12508	N	0.462744	T	0.50171	0.1600	.	.	.	0.09310	N	0.999998	P	0.44380	0.834	B	0.43445	0.42	T	0.38693	-0.9649	9	0.87932	D	0	-0.0292	10.7157	0.46011	0.0:0.2689:0.5914:0.1397	.	432	G5EA03	.	F	432;431	ENSP00000425631:C432F	ENSP00000316974:C431F	C	+	2	0	LIMCH1	41327945	0.006000	0.16342	0.176000	0.23000	0.005000	0.04900	0.977000	0.29475	0.368000	0.24481	-0.172000	0.13284	TGT	LIMCH1	-	NULL	ENSG00000064042		0.408	LIMCH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LIMCH1	HGNC	protein_coding	OTTHUMT00000361249.2	-	0.00	38	0	G	NM_014988		41633188	+1	tier1	-	no_errors	ENST00000503057	ensembl	human	known	74_37	missense	28.57	45	18	SNP	0.023	T
LINC00634	339674	genome.wustl.edu	37	22	42354488	42354489	+	RNA	DEL	GA	GA	-	rs376900632		TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	GA	GA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr22:42354488_42354489delGA	ENST00000381348.4	+	0	1061_1062					NR_024355.1				long intergenic non-protein coding RNA 634																		GGTTGGTGAGgagagagagaga	0.619																																																	0																																												0					22q13.2	2012-10-12			ENSG00000205704	ENSG00000205704		"""Long non-coding RNAs"""	27930	non-coding RNA	RNA, long non-coding						12477932	Standard	NR_024355		Approved				OTTHUMG00000151274		22.37:g.42354498_42354499delGA				RNA	DEL	-	NULL	ENST00000381348.4	37	NULL		22																																																																																			LINC00634	-	-	ENSG00000205704		0.619	LINC00634-002	KNOWN	basic|exp_conf	processed_transcript	LINC00634	HGNC	pseudogene	OTTHUMT00000322049.1		0.00	20	0	GA	NR_024355		42354489	+1	tier1		no_errors	ENST00000381348	ensembl	human	known	74_37	rna	20.83	19	5	DEL	0.088:0.090	-
LINC00668	400643	genome.wustl.edu	37	18	6927413	6927413	+	lincRNA	SNP	C	C	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr18:6927413C>T	ENST00000580197.1	-	0	406									long intergenic non-protein coding RNA 668																		TGATCTGCTCCGCAACTATTG	0.438																																																	0																																												0					18p11.31	2012-10-12			ENSG00000265933	ENSG00000265933		"""Long non-coding RNAs"""	44328	non-coding RNA	RNA, long non-coding							Standard	NR_034100		Approved		uc002kni.1		OTTHUMG00000178875		18.37:g.6927413C>T				RNA	SNP	-	NULL	ENST00000580197.1	37	NULL		18																																																																																			LINC00668	-	-	ENSG00000265933		0.438	LINC00668-003	KNOWN	basic	lincRNA	LINC00668	HGNC	lincRNA	OTTHUMT00000443724.1	-	0.00	18	0	C	NR_034100		6927413	-1	tier1	-	no_errors	ENST00000578497	ensembl	human	known	74_37	rna	18.52	22	5	SNP	0.003	T
LMF1	64788	genome.wustl.edu	37	16	920752	920752	+	Silent	SNP	G	G	A			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr16:920752G>A	ENST00000262301.11	-	8	1227	c.1209C>T	c.(1207-1209)gtC>gtT	p.V403V	LMF1_ENST00000543238.1_Silent_p.V166V|LMF1_ENST00000568897.1_Silent_p.V186V|LMF1_ENST00000568268.1_5'Flank|LMF1_ENST00000399843.2_Silent_p.V403V	NM_022773.2	NP_073610.2	Q96S06	LMF1_HUMAN	lipase maturation factor 1	403					chylomicron remnant clearance (GO:0034382)|ER to Golgi vesicle-mediated transport (GO:0006888)|positive regulation of lipoprotein lipase activity (GO:0051006)|protein glycosylation in Golgi (GO:0033578)|protein maturation (GO:0051604)|protein secretion (GO:0009306)|regulation of cholesterol metabolic process (GO:0090181)|regulation of triglyceride metabolic process (GO:0090207)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(1)	18		Hepatocellular(780;0.00308)				CGTAAGTGTTGACGATGTGAA	0.622																																																	0													105.0	119.0	115.0					16																	920752		2145	4252	6397	SO:0001819	synonymous_variant	0			AK022743	CCDS45373.1	16p13.3	2008-02-05	2007-11-29	2007-11-29	ENSG00000103227	ENSG00000103227			14154	protein-coding gene	gene with protein product		611761	"""chromosome 16 open reading frame 26"", ""transmembrane protein 112"""	C16orf26, TMEM112		11157797, 17994020	Standard	NM_022773		Approved	FLJ12681, JFP11, FLJ22302, TMEM112A	uc021tae.1	Q96S06	OTTHUMG00000047848	ENST00000262301.11:c.1209C>T	16.37:g.920752G>A			Q68CJ3|Q96FJ4|Q9H6G4|Q9H9K7	Silent	SNP	pfam_LMF	p.V403	ENST00000262301.11	37	c.1209	CCDS45373.1	16																																																																																			LMF1	-	pfam_LMF	ENSG00000103227		0.622	LMF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LMF1	HGNC	protein_coding	OTTHUMT00000109071.3	-	0.00	50	0	G	NM_022773		920752	-1	tier1	-	no_errors	ENST00000262301	ensembl	human	known	74_37	silent	44.23	29	23	SNP	1.000	A
DCST1	149095	genome.wustl.edu	37	1	155018529	155018529	+	Intron	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr1:155018529G>T	ENST00000295542.1	+	11	1368				DCST1_ENST00000392480.1_Intron|RP11-307C12.11_ENST00000452962.1_RNA|DCST1_ENST00000423025.2_Intron|DCST1_ENST00000368419.2_Intron	NM_152494.3	NP_689707.2	Q5T197	DCST1_HUMAN	DC-STAMP domain containing 1							integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			breast(2)|endometrium(4)|kidney(2)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	27	all_epithelial(22;1.43e-30)|all_lung(78;6.64e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.000434)			GTGGGTTCATGCTCCAGGAAG	0.587																																																	0																																										SO:0001627	intron_variant	0			AK057347	CCDS1083.1, CCDS44235.1	1q22	2008-02-05			ENSG00000163357	ENSG00000163357			26539	protein-coding gene	gene with protein product							Standard	NM_152494		Approved	FLJ32785	uc001fgn.2	Q5T197	OTTHUMG00000041314	ENST00000295542.1:c.1272+61G>T	1.37:g.155018529G>T			B4DXA0|E9PHV3|Q5T198|Q6P1W6|Q71S70|Q96M70	RNA	SNP	-	NULL	ENST00000295542.1	37	NULL	CCDS1083.1	1																																																																																			RP11-307C12.11	-	-	ENSG00000232093		0.587	DCST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100505666	Clone_based_vega_gene	protein_coding	OTTHUMT00000099006.1	-	0.00	43	0	G	NM_152494		155018529	-1	tier1	-	no_errors	ENST00000452962	ensembl	human	known	74_37	rna	5.26	90	5	SNP	0.000	T
AL589743.1	0	genome.wustl.edu	37	14	19686397	19686397	+	lincRNA	DEL	G	G	-			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr14:19686397delG	ENST00000418499.3	+	0	3508																											GGCCTAGTTCGCTTCAGAGGC	0.647																																																	0																																												0																															14.37:g.19686397delG				RNA	DEL	-	NULL	ENST00000418499.3	37	NULL		14																																																																																			AL589743.1	-	-	ENSG00000225210		0.647	AL589743.1-003	KNOWN	basic	lincRNA	LOC440157	Clone_based_vega_gene	lincRNA	OTTHUMT00000317887.3		0.00	18	0	G			19686397	+1	tier1		no_errors	ENST00000418499	ensembl	human	known	74_37	rna	33.33	8	4	DEL	0.065	-
SPANXA2-OT1	619455	genome.wustl.edu	37	X	140714645	140714645	+	RNA	SNP	A	A	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chrX:140714645A>T	ENST00000421554.1	+	0	572				RP1-171K16.5_ENST00000412163.1_lincRNA	NR_037183.1		Q8N9U9	SPOT1_HUMAN	SPANXA2 overlapping transcript 1																		AACTGTATTAATTTTTTATTA	0.378																																																	0																																												0			AK093505		Xq27.2	2014-06-02	2014-06-02	2011-08-31	ENSG00000226574	ENSG00000277215		"""Long non-coding RNAs"", ""-"""	31683	non-coding RNA	RNA, long non-coding			"""chromosome X open reading frame 18"", ""SPANXA2 overlapping transcript 1 (non-protein coding)"""	CXorf18			Standard	NR_037183		Approved	FLJ36186	uc004fbm.1	Q8N9U9	OTTHUMG00000022566		X.37:g.140714645A>T				RNA	SNP	-	NULL	ENST00000421554.1	37	NULL		X																																																																																			RP1-171K16.5	-	-	ENSG00000223438		0.378	SPANXA2-OT1-001	KNOWN	basic	processed_transcript	LOC645188	Clone_based_vega_gene	processed_transcript	OTTHUMT00000058601.2	-	0.00	76	0	A	NR_037183		140714645	+1	tier1	-	no_errors	ENST00000412163	ensembl	human	known	74_37	rna	30.67	52	23	SNP	0.000	T
CATSPERD	257062	genome.wustl.edu	37	19	5719848	5719848	+	5'Flank	DEL	C	C	-			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr19:5719848delC	ENST00000381624.3	+	0	0				LONP1_ENST00000593119.1_Intron|LONP1_ENST00000540670.2_Intron|LONP1_ENST00000590729.1_5'UTR|LONP1_ENST00000585374.1_Intron|LONP1_ENST00000590511.1_5'UTR|CATSPERD_ENST00000381614.2_5'Flank|LONP1_ENST00000360614.3_Frame_Shift_Del_p.G99fs	NM_152784.3	NP_689997.3	Q86XM0	CTSRD_HUMAN	catsper channel auxiliary subunit delta						multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm capacitation (GO:0048240)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|plasma membrane (GO:0005886)|sperm principal piece (GO:0097228)											gcccgcgctgccccccgcgcc	0.741																																																	0													10.0	14.0	12.0					19																	5719848		2179	4255	6434	SO:0001631	upstream_gene_variant	0			BC043005	CCDS12149.2	19p13.3	2013-10-11	2012-02-22	2012-02-22	ENSG00000174898	ENSG00000174898			28598	protein-coding gene	gene with protein product			"""transmembrane protein 146"""	TMEM146		21224844	Standard	NM_152784		Approved	MGC39581	uc002mda.3	Q86XM0	OTTHUMG00000143036		19.37:g.5719848delC	Exception_encountered		Q6ZRP1	Frame_Shift_Del	DEL	pfam_Pept_S16_C,pfam_Pept_S16_N,pfam_ATPase_AAA_core,pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-2,pfam_DNA_helicase_Holl-junc_RuvB_N,pfam_Prk_AAA_dom,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_P-loop_NTPase,superfamily_PUA-like_domain,smart_Pept_S16_N,smart_AAA+_ATPase,tigrfam_Lon_bac/euk-typ	p.G99fs	ENST00000381624.3	37	c.296	CCDS12149.2	19																																																																																			LONP1	-	NULL	ENSG00000196365		0.741	CATSPERD-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	LONP1	HGNC	protein_coding	OTTHUMT00000286953.2		0.00	15	0	C	NM_152784		5719848	-1	tier1		no_errors	ENST00000360614	ensembl	human	known	74_37	frame_shift_del	40.00	21	14	DEL	0.154	-
LRCH1	23143	genome.wustl.edu	37	13	47266728	47266728	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr13:47266728G>C	ENST00000389798.3	+	8	1269	c.1072G>C	c.(1072-1074)Gaa>Caa	p.E358Q	LRCH1_ENST00000389797.3_Missense_Mutation_p.E358Q|LRCH1_ENST00000311191.6_Missense_Mutation_p.E358Q	NM_015116.2	NP_055931	Q9Y2L9	LRCH1_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 1	358										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26		all_lung(13;5.61e-07)|Lung NSC(96;0.000117)|Breast(56;0.000141)|Prostate(109;0.0029)|Lung SC(185;0.0367)|Myeloproliferative disorder(33;0.0505)|Hepatocellular(98;0.0556)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000123)		CATGGAAGAAGAACAGATCAT	0.403																																																	0													179.0	146.0	157.0					13																	47266728		2203	4300	6503	SO:0001583	missense	0			AB023233	CCDS31972.1, CCDS53865.1, CCDS53866.1	13q14.11	2008-02-05	2004-05-27	2004-05-28	ENSG00000136141	ENSG00000136141			20309	protein-coding gene	gene with protein product		610368	"""calponin homology (CH) domain containing 1"""	CHDC1		10231032	Standard	NM_015116		Approved	KIAA1016	uc001vbk.3	Q9Y2L9	OTTHUMG00000016877	ENST00000389798.3:c.1072G>C	13.37:g.47266728G>C	ENSP00000374448:p.Glu358Gln		B7ZLL5|F8W6F0|Q17R43|Q2KHR1|Q5TBU9|Q7Z5F6|Q7Z5F7	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_Leu-rich_rpt_typical-subtyp,smart_CH-domain,pfscan_CH-domain	p.E358Q	ENST00000389798.3	37	c.1072	CCDS31972.1	13	.	.	.	.	.	.	.	.	.	.	G	16.95	3.264739	0.59431	.	.	ENSG00000136141	ENST00000311191;ENST00000389798;ENST00000389797	T;T;T	0.53857	0.62;0.67;0.6	5.83	5.83	0.93111	.	0.392250	0.27210	N	0.020419	T	0.45696	0.1355	N	0.11364	0.135	0.42695	D	0.993599	D;P;D;P	0.56287	0.957;0.604;0.975;0.745	P;B;P;B	0.53185	0.529;0.334;0.72;0.354	T	0.31558	-0.9939	10	0.09843	T	0.71	-6.3884	19.122	0.93367	0.0:0.0:1.0:0.0	.	358;358;358;358	Q17R43;Q9Y2L9-2;F8W6F0;Q9Y2L9	.;.;.;LRCH1_HUMAN	Q	358	ENSP00000308493:E358Q;ENSP00000374448:E358Q;ENSP00000374447:E358Q	ENSP00000308493:E358Q	E	+	1	0	LRCH1	46164729	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	7.672000	0.83956	2.770000	0.95276	0.655000	0.94253	GAA	LRCH1	-	NULL	ENSG00000136141		0.403	LRCH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LRCH1	HGNC	protein_coding	OTTHUMT00000044824.2	-	0.00	30	0	G	NM_015116		47266728	+1	tier1	-	no_errors	ENST00000389798	ensembl	human	known	74_37	missense	25.40	47	16	SNP	1.000	C
MAGEC1	9947	genome.wustl.edu	37	X	140993814	140993814	+	Silent	SNP	C	C	G			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chrX:140993814C>G	ENST00000285879.4	+	4	910	c.624C>G	c.(622-624)tcC>tcG	p.S208S	MAGEC1_ENST00000406005.2_Intron	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	208										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					CCTTCTCCTCCACTTTATTGA	0.493										HNSCC(15;0.026)																																							0																																										SO:0001819	synonymous_variant	0			AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.624C>G	X.37:g.140993814C>G			A0PK03|O75451|Q8TCV4	Silent	SNP	pfam_MAGE,pfscan_MAGE	p.S208	ENST00000285879.4	37	c.624	CCDS35417.1	X																																																																																			MAGEC1	-	NULL	ENSG00000155495		0.493	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAGEC1	HGNC	protein_coding	OTTHUMT00000058604.1	-	0.00	324	0	C	NM_005462		140993814	+1	tier1	-	no_errors	ENST00000285879	ensembl	human	known	74_37	silent	16.71	319	64	SNP	0.851	G
MAMLD1	10046	genome.wustl.edu	37	X	149639249	149639249	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chrX:149639249G>T	ENST00000370401.2	+	4	1714	c.1404G>T	c.(1402-1404)ttG>ttT	p.L468F	MAMLD1_ENST00000262858.5_Missense_Mutation_p.L468F|MAMLD1_ENST00000432680.2_Missense_Mutation_p.L443F|MAMLD1_ENST00000455522.2_5'Flank|MAMLD1_ENST00000426613.2_Missense_Mutation_p.L443F			Q13495	MAMD1_HUMAN	mastermind-like domain containing 1	468					male gonad development (GO:0008584)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(3)|large_intestine(12)|lung(14)|ovary(1)|prostate(2)	37	Acute lymphoblastic leukemia(192;6.56e-05)					GCCCAGGCTTGCCACAGCAGT	0.597																																																	0													71.0	70.0	71.0					X																	149639249		2203	4300	6503	SO:0001583	missense	0			U46023	CCDS14693.2, CCDS55525.1, CCDS55526.1	Xq28	2008-02-05	2008-01-03	2008-01-03	ENSG00000013619	ENSG00000013619			2568	protein-coding gene	gene with protein product		300120	"""chromosome X open reading frame 6"""	CXorf6		9169146, 17086185, 18162467	Standard	NM_001177465		Approved	CG1, F18	uc011mxu.2	Q13495	OTTHUMG00000024157	ENST00000370401.2:c.1404G>T	X.37:g.149639249G>T	ENSP00000359428:p.Leu468Phe		B2RCQ4|B4DG93|B9EGA5	Missense_Mutation	SNP	NULL	p.L443F	ENST00000370401.2	37	c.1329	CCDS14693.2	X	.	.	.	.	.	.	.	.	.	.	G	14.54	2.566687	0.45694	.	.	ENSG00000013619	ENST00000445612;ENST00000370401;ENST00000432680;ENST00000262858;ENST00000426613	T;T;T;T	0.76316	-1.01;-1.01;-1.01;-1.01	5.58	4.67	0.58626	.	0.000000	0.56097	D	0.000024	T	0.81559	0.4848	L	0.35593	1.075	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.85130	0.995;0.997;0.995;0.997	T	0.80254	-0.1459	9	.	.	.	-17.1374	15.0323	0.71717	0.0:0.1387:0.8613:0.0	.	430;443;443;468	F6WVG1;Q13495-4;Q13495-3;Q13495	.;.;.;MAMD1_HUMAN	F	430;468;443;468;443	ENSP00000359428:L468F;ENSP00000414517:L443F;ENSP00000262858:L468F;ENSP00000397438:L443F	.	L	+	3	2	MAMLD1	149389907	1.000000	0.71417	0.934000	0.37439	0.255000	0.26057	1.577000	0.36515	2.351000	0.79841	0.600000	0.82982	TTG	MAMLD1	-	NULL	ENSG00000013619		0.597	MAMLD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAMLD1	HGNC	protein_coding	OTTHUMT00000060844.2		0.00	17	0	G	NM_005491		149639249	+1			no_errors	ENST00000432680	ensembl	human	known	74_37	missense	9.38	29	3	SNP	1.000	T
FAM155A	728215	genome.wustl.edu	37	13	108183540	108183540	+	Intron	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr13:108183540G>T	ENST00000375915.2	-	2	1054				MIR1267_ENST00000408723.1_RNA	NM_001080396.2	NP_001073865.1	B1AL88	F155A_HUMAN	family with sequence similarity 155, member A							integral component of membrane (GO:0016021)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33						atctcatgttgaaatgtaatc	0.423																																																	0													50.0	48.0	49.0					13																	108183540		692	1591	2283	SO:0001627	intron_variant	0			L10374	CCDS32006.1	13q33.3	2008-04-15			ENSG00000204442	ENSG00000204442			33877	protein-coding gene	gene with protein product							Standard	NM_001080396		Approved		uc001vql.3	B1AL88	OTTHUMG00000017326	ENST00000375915.2:c.916-320437C>A	13.37:g.108183540G>T			B2RUV1|B7Z334	RNA	SNP	-	NULL	ENST00000375915.2	37	NULL	CCDS32006.1	13																																																																																			MIR1267	-	-	ENSG00000221650		0.423	FAM155A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR1267	HGNC	protein_coding	OTTHUMT00000045736.2	-	0.00	95	0	G	NM_001080396		108183540	-1	tier1	-	no_errors	ENST00000408723	ensembl	human	known	74_37	rna	26.58	163	59	SNP	0.008	T
MIR146A	406938	genome.wustl.edu	37	5	159912317	159912317	+	lincRNA	SNP	G	G	A			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr5:159912317G>A	ENST00000385201.1	+	0	0					NR_029701.1				microRNA 146a																		GCTGGGACAGGCCTGGACTGC	0.483																																																	0													48.0	45.0	46.0					5																	159912317		1568	3582	5150			0					5q34	2011-09-12	2005-06-30	2008-12-18	ENSG00000207936			"""ncRNAs / Micro RNAs"""	31533	non-coding RNA	RNA, micro		610566	"""microRNA 146"""	MIRN146, MIRN146A			Standard	NR_029701		Approved	hsa-mir-146, hsa-mir-146a					5.37:g.159912317G>A				RNA	SNP	-	NULL	ENST00000385201.1	37	NULL		5																																																																																			MIR146A	-	-	ENSG00000253522		0.483	MIR146A-201	KNOWN	basic	miRNA	MIR146A	HGNC	lincRNA		-	0.00	40	0	G	NR_029701		159912317	+1	tier1	-	no_errors	ENST00000517927	ensembl	human	known	74_37	rna	6.90	54	4	SNP	0.000	A
MLXIPL	51085	genome.wustl.edu	37	7	73008640	73008640	+	Silent	SNP	G	G	A			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr7:73008640G>A	ENST00000313375.3	-	16	2451	c.2404C>T	c.(2404-2406)Ctg>Ttg	p.L802L	MLXIPL_ENST00000395189.1_Silent_p.L709L|MLXIPL_ENST00000354613.1_Silent_p.L781L|MLXIPL_ENST00000429400.2_Silent_p.L783L|MLXIPL_ENST00000414749.2_Silent_p.L800L|MLXIPL_ENST00000434326.1_Silent_p.L708L	NM_032951.2|NM_032953.2	NP_116569.1|NP_116571.1	Q9NP71	MLXPL_HUMAN	MLX interacting protein-like	802					anatomical structure morphogenesis (GO:0009653)|energy reserve metabolic process (GO:0006112)|fatty acid homeostasis (GO:0055089)|glucose homeostasis (GO:0042593)|glucose mediated signaling pathway (GO:0010255)|intracellular signal transduction (GO:0035556)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of oxidative phosphorylation (GO:0090324)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular metabolic process (GO:0031325)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of glycolytic process (GO:0045821)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of energy homeostasis (GO:2000505)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride homeostasis (GO:0070328)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	carbohydrate response element binding (GO:0035538)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			cervix(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	13		Lung NSC(55;0.0659)|all_lung(88;0.152)				TACTGGTCCAGCCAGGCCAGT	0.637																																																	0													81.0	72.0	75.0					7																	73008640		2203	4300	6503	SO:0001819	synonymous_variant	0			AK055029	CCDS5553.1, CCDS5554.1, CCDS47605.1, CCDS47606.1	7q11.23	2013-05-21	2005-10-31	2005-10-31	ENSG00000009950	ENSG00000009950			12744	protein-coding gene	gene with protein product	"""carbohydrate response element binding protein"""	605678	"""Williams Beuren syndrome chromosome region 14"""	WBSCR14		9860302	Standard	XM_005250399		Approved	WS-bHLH, MIO, CHREBP, MONDOB, bHLHd14	uc003tyn.1	Q9NP71	OTTHUMG00000129995	ENST00000313375.3:c.2404C>T	7.37:g.73008640G>A			C5HU02|C5HU03|C5HU04|Q96E48|Q9BY03|Q9BY04|Q9BY05|Q9BY06|Q9Y2P3	Silent	SNP	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.L802	ENST00000313375.3	37	c.2404	CCDS5553.1	7																																																																																			MLXIPL	-	NULL	ENSG00000009950		0.637	MLXIPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MLXIPL	HGNC	protein_coding	OTTHUMT00000252262.1		0.00	38	0	G	NM_032951		73008640	-1			no_errors	ENST00000313375	ensembl	human	known	74_37	silent	5.00	76	4	SNP	1.000	A
MORC4	79710	genome.wustl.edu	37	X	106224144	106224144	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chrX:106224144C>G	ENST00000355610.4	-	7	1187	c.913G>C	c.(913-915)Gat>Cat	p.D305H	MORC4_ENST00000255495.7_Missense_Mutation_p.D305H|MORC4_ENST00000535534.1_Missense_Mutation_p.D53H	NM_001085354.2|NM_024657.4	NP_001078823.1|NP_078933.3	Q8TE76	MORC4_HUMAN	MORC family CW-type zinc finger 4	305						nucleus (GO:0005634)	zinc ion binding (GO:0008270)			endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	28						TTATATGTATCATATTCTACA	0.378																																																	0													217.0	181.0	193.0					X																	106224144		2203	4300	6503	SO:0001583	missense	0			AK021627	CCDS14525.2, CCDS48146.1	Xq22.3	2008-02-05	2005-06-15	2005-06-15	ENSG00000133131	ENSG00000133131			23485	protein-coding gene	gene with protein product			"""zinc finger, CW-type with coiled-coil domain 2"", ""zinc finger, CW type with coiled-coil domain 2"""	ZCWCC2		14607086	Standard	NM_024657		Approved	ZCW4, FLJ11565	uc004emp.4	Q8TE76	OTTHUMG00000022155	ENST00000355610.4:c.913G>C	X.37:g.106224144C>G	ENSP00000347821:p.Asp305His		A1YR23|A1YR24|H7BXF1|Q5JUK7|Q96MZ2|Q9HAI7	Missense_Mutation	SNP	pfam_Znf_CW,pfam_HATPase_ATP-bd,superfamily_HATPase_ATP-bd,superfamily_Prefoldin,pfscan_Znf_CW	p.D305H	ENST00000355610.4	37	c.913	CCDS14525.2	X	.	.	.	.	.	.	.	.	.	.	C	24.8	4.574764	0.86542	.	.	ENSG00000133131	ENST00000355610;ENST00000535534;ENST00000255495	T;T;T	0.33654	2.65;1.4;2.64	5.25	5.25	0.73442	ATPase-like, ATP-binding domain (1);	0.106709	0.64402	D	0.000010	T	0.49525	0.1562	M	0.66506	2.035	0.42482	D	0.992867	D;D;D	0.61080	0.986;0.975;0.989	P;P;P	0.53722	0.733;0.522;0.714	T	0.53634	-0.8411	10	0.66056	D	0.02	-6.4837	13.5938	0.61978	0.0:1.0:0.0:0.0	.	53;305;305	A1YR24;A1YR23;Q8TE76	.;.;MORC4_HUMAN	H	305;53;305	ENSP00000347821:D305H;ENSP00000440359:D53H;ENSP00000255495:D305H	ENSP00000255495:D305H	D	-	1	0	MORC4	106110800	1.000000	0.71417	0.996000	0.52242	0.991000	0.79684	5.306000	0.65756	2.519000	0.84933	0.538000	0.68166	GAT	MORC4	-	superfamily_HATPase_ATP-bd	ENSG00000133131		0.378	MORC4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MORC4	HGNC	protein_coding	OTTHUMT00000057816.3	-	0.00	87	0	C	NM_024657		106224144	-1	tier1	-	no_errors	ENST00000355610	ensembl	human	known	74_37	missense	44.32	49	39	SNP	1.000	G
MOV10L1	54456	genome.wustl.edu	37	22	50582669	50582669	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr22:50582669G>T	ENST00000262794.5	+	18	2585	c.2502G>T	c.(2500-2502)gaG>gaT	p.E834D	MOV10L1_ENST00000540615.1_Missense_Mutation_p.E814D|MOV10L1_ENST00000395858.3_Missense_Mutation_p.E834D|MOV10L1_ENST00000395852.1_5'Flank|MOV10L1_ENST00000395843.1_5'UTR|MOV10L1_ENST00000545383.1_Missense_Mutation_p.E834D	NM_018995.2	NP_061868.1	Q9BXT6	M10L1_HUMAN	Mov10 RISC complex RNA helicase like 1	834					ATP catabolic process (GO:0006200)|germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	intracellular (GO:0005622)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|magnesium ion binding (GO:0000287)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|prostate(1)|skin(9)|stomach(4)|urinary_tract(3)	67		all_cancers(38;3.31e-11)|all_epithelial(38;5.69e-10)|all_lung(38;3.73e-05)|Breast(42;0.000525)|Lung NSC(38;0.000954)|Ovarian(80;0.0367)|Lung SC(80;0.114)		LUAD - Lung adenocarcinoma(64;0.0215)|BRCA - Breast invasive adenocarcinoma(115;0.24)		GCAGGTTCGAGGAGGTGAGCC	0.642																																																	0													54.0	49.0	51.0					22																	50582669		2203	4300	6503	SO:0001583	missense	0			AF285604	CCDS14084.1, CCDS54541.1, CCDS54542.1, CCDS54543.1	22q13.33	2014-07-02	2014-07-02		ENSG00000073146	ENSG00000073146			7201	protein-coding gene	gene with protein product	"""cardiac helicase activated by MEF2C protein"""	605794	"""Mov10 (mouse)-like 1"", ""Mov10l1, Moloney leukemia virus 10-like 1, homolog (mouse)"""			11279525	Standard	NM_018995		Approved	DJ402G11.8, DKFZp434B0717, CHAMP	uc003bjj.3	Q9BXT6	OTTHUMG00000044648	ENST00000262794.5:c.2502G>T	22.37:g.50582669G>T	ENSP00000262794:p.Glu834Asp		A7E211|A8MXC6|B7WPP1|B7Z7R1|F5H403|Q5TGD5|Q8NBD4|Q9NXW3|Q9UFB3|Q9UGX9	Missense_Mutation	SNP	superfamily_P-loop_NTPase,superfamily_NA-bd_OB-fold	p.E834D	ENST00000262794.5	37	c.2502	CCDS14084.1	22	.	.	.	.	.	.	.	.	.	.	G	13.36	2.212842	0.39102	.	.	ENSG00000073146	ENST00000545383;ENST00000262794;ENST00000395858;ENST00000540615	D;D;D;D	0.81908	-1.55;-1.55;-1.55;-1.55	5.51	0.992	0.19819	.	0.368772	0.32416	N	0.006127	T	0.74733	0.3755	L	0.37630	1.12	0.80722	D	1	P;P;P	0.51653	0.565;0.947;0.619	B;P;B	0.51101	0.222;0.659;0.245	T	0.67616	-0.5625	10	0.16420	T	0.52	-34.7607	3.879	0.09069	0.4442:0.1821:0.3738:0.0	.	814;834;834	F5H403;A8MXC6;Q9BXT6	.;.;M10L1_HUMAN	D	834;834;834;814	ENSP00000438978:E834D;ENSP00000262794:E834D;ENSP00000379199:E834D;ENSP00000438542:E814D	ENSP00000262794:E834D	E	+	3	2	MOV10L1	48924796	1.000000	0.71417	0.966000	0.40874	0.553000	0.35397	1.276000	0.33156	0.338000	0.23692	0.650000	0.86243	GAG	MOV10L1	-	superfamily_P-loop_NTPase	ENSG00000073146		0.642	MOV10L1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MOV10L1	HGNC	protein_coding	OTTHUMT00000075009.2		0.00	20	0	G	NM_018995		50582669	+1			no_errors	ENST00000262794	ensembl	human	known	74_37	missense	14.29	24	4	SNP	0.995	T
MPP4	58538	genome.wustl.edu	37	2	202521061	202521061	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr2:202521061C>T	ENST00000409474.3	-	17	1367	c.1160G>A	c.(1159-1161)cGc>cAc	p.R387H	MPP4_ENST00000315506.7_Missense_Mutation_p.R343H|MPP4_ENST00000359962.5_Missense_Mutation_p.R387H|MPP4_ENST00000447335.2_Missense_Mutation_p.R380H|MPP4_ENST00000409143.1_Missense_Mutation_p.R329H|MPP4_ENST00000428900.2_Missense_Mutation_p.R363H|MPP4_ENST00000396886.3_Missense_Mutation_p.R312H	NM_033066.2	NP_149055	Q96JB8	MPP4_HUMAN	membrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4)	387					protein localization to synapse (GO:0035418)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|presynaptic membrane (GO:0042734)				kidney(1)|lung(11)	12						AGACTTCCTGCGACAAAGGCG	0.597																																																	0													20.0	22.0	21.0					2																	202521061		2104	4229	6333	SO:0001583	missense	0			AF316032	CCDS46491.1	2q33.2	2008-05-15			ENSG00000082126	ENSG00000082126			13680	protein-coding gene	gene with protein product		606575		DLG6		11414766	Standard	NM_033066		Approved		uc002uyk.4	Q96JB8	OTTHUMG00000154525	ENST00000409474.3:c.1160G>A	2.37:g.202521061C>T	ENSP00000387278:p.Arg387His		C9IZK4|Q53TT3|Q6ZNH6|Q96Q43|Q96Q44	Missense_Mutation	SNP	pfam_GK/Ca_channel_bsu,pfam_L27_C,pfam_PDZ,pfam_SH3_2,pfam_SH3_domain,superfamily_P-loop_NTPase,superfamily_SH3_domain,superfamily_PDZ,smart_L27,smart_PDZ,smart_SH3_domain,smart_GK/Ca_channel_bsu,pfscan_L27,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin-like	p.R387H	ENST00000409474.3	37	c.1160	CCDS46491.1	2	.	.	.	.	.	.	.	.	.	.	C	29.3	4.994626	0.93167	.	.	ENSG00000082126	ENST00000409474;ENST00000315506;ENST00000396886;ENST00000359962;ENST00000315549;ENST00000374605;ENST00000428900;ENST00000409143;ENST00000447335	T;T;T;T;T;T	0.07908	3.15;3.4;3.22;3.36;3.42;3.23	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.27866	0.0686	L	0.59436	1.845	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;0.98;1.0;1.0;1.0;1.0;1.0;1.0	D;P;D;D;D;D;D;D	0.83275	0.995;0.611;0.991;0.991;0.996;0.991;0.988;0.996	T	0.00211	-1.1915	10	0.59425	D	0.04	.	19.0738	0.93151	0.0:1.0:0.0:0.0	.	329;312;363;356;343;380;387;352	F6Q0Y6;B4DUF3;E7ET46;B7ZM19;Q96JB8-2;E7EUL8;Q96JB8;Q96JB8-4	.;.;.;.;.;.;MPP4_HUMAN;.	H	387;343;312;387;352;316;363;329;380	ENSP00000387278:R387H;ENSP00000319363:R343H;ENSP00000353047:R387H;ENSP00000416781:R363H;ENSP00000387293:R329H;ENSP00000406160:R380H	ENSP00000319363:R343H	R	-	2	0	MPP4	202229306	1.000000	0.71417	0.718000	0.30602	0.702000	0.40608	6.830000	0.75319	2.676000	0.91093	0.655000	0.94253	CGC	MPP4	-	NULL	ENSG00000082126		0.597	MPP4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MPP4	HGNC	protein_coding	OTTHUMT00000335748.2		0.00	18	0	C			202521061	-1			no_errors	ENST00000359962	ensembl	human	known	74_37	missense	10.53	17	2	SNP	1.000	T
MPZL1	9019	genome.wustl.edu	37	1	167757103	167757103	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr1:167757103G>T	ENST00000359523.2	+	6	957	c.755G>T	c.(754-756)aGt>aTt	p.S252I	MPZL1_ENST00000403379.3_3'UTR|MPZL1_ENST00000392121.3_Missense_Mutation_p.S102I	NM_003953.5|NM_024569.4	NP_003944.1|NP_078845.3	O95297	MPZL1_HUMAN	myelin protein zero-like 1	252					cell-cell signaling (GO:0007267)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)	structural molecule activity (GO:0005198)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(2)	15	all_hematologic(923;0.215)					GGACATCACAGTGACAAGATT	0.453																																																	0													111.0	102.0	105.0					1																	167757103		2203	4300	6503	SO:0001583	missense	0			AF087020	CCDS1264.1, CCDS44273.1, CCDS53425.1	1q24.2	2013-01-11			ENSG00000197965	ENSG00000197965		"""Immunoglobulin superfamily / V-set domain containing"""	7226	protein-coding gene	gene with protein product		604376				9792637	Standard	NM_003953		Approved	PZR, FLJ21047	uc001geo.3	O95297	OTTHUMG00000034571	ENST00000359523.2:c.755G>T	1.37:g.167757103G>T	ENSP00000352513:p.Ser252Ile		B2REB9|B2REC0|Q5R332|Q8IX11|Q9BWZ3|Q9NYK4|Q9UL20	Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like_dom,prints_Myelin_P0	p.S252I	ENST00000359523.2	37	c.755	CCDS1264.1	1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.542871	0.86022	.	.	ENSG00000197965	ENST00000359523;ENST00000392121	D;D	0.99598	-4.65;-6.26	4.58	4.58	0.56647	.	.	.	.	.	D	0.99208	0.9725	L	0.32530	0.975	0.44523	D	0.997474	D;D	0.76494	0.999;0.998	D;D	0.83275	0.996;0.991	D	0.99548	1.0965	8	0.87932	D	0	.	16.5301	0.84355	0.0:0.0:1.0:0.0	.	102;252	B2REC0;O95297	.;MPZL1_HUMAN	I	252;102	ENSP00000352513:S252I;ENSP00000375968:S102I	ENSP00000352513:S252I	S	+	2	0	MPZL1	166023727	0.997000	0.39634	0.988000	0.46212	0.997000	0.91878	2.811000	0.47986	2.505000	0.84491	0.650000	0.86243	AGT	MPZL1	-	NULL	ENSG00000197965		0.453	MPZL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPZL1	HGNC	protein_coding	OTTHUMT00000083655.2	-	0.00	35	0	G	NM_024569		167757103	+1	tier1	-	no_errors	ENST00000359523	ensembl	human	known	74_37	missense	9.30	39	4	SNP	0.998	T
MST1L	11223	genome.wustl.edu	37	1	17084569	17084569	+	RNA	SNP	G	G	A			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr1:17084569G>A	ENST00000455405.2	-	0	320							Q2TV78	MST1L_HUMAN	macrophage stimulating 1-like							extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)										CTCATAGCCCGTGAGAGGCAT	0.572																																																	0																																												0			U28055, AF083416		1p36.33	2013-03-27	2012-11-09	2012-11-09	ENSG00000186715	ENSG00000186715			7390	other	unknown			"""macrophage stimulating, pseudogene 7"", ""macrophage stimulating, pseudogene 9"", ""macrophage stimulating 1 (hepatocyte growth factor-like) pseudogene 9"""	MSTP7, MSTP9, MST1P9		10728827	Standard	NM_001271733		Approved	D1F15S1A, MSPL7, MSPL-7	uc010ock.3	Q2TV78	OTTHUMG00000002578		1.37:g.17084569G>A			B7WPB1|Q13209	RNA	SNP	-	NULL	ENST00000455405.2	37	NULL		1	.	.	.	.	.	.	.	.	.	.	.	5.254	0.232248	0.09969	.	.	ENSG00000186715	ENST00000389184;ENST00000334998;ENST00000442552	.	.	.	.	.	.	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	1.607170	0.04519	N	0.384290	T	0.20373	0.0490	.	.	.	.	.	.	P;B	0.34743	0.466;0.079	B;B	0.20184	0.02;0.028	T	0.18053	-1.0349	6	0.41790	T	0.15	.	5.8178	0.18506	0.001:0.0:0.999:0.0	.	510;536	Q2TV78-2;Q2TV78	.;MSTP9_HUMAN	M	505;510;536	.	ENSP00000439273:T510M	T	-	2	0	MST1P9	16957156	0.919000	0.31177	0.000000	0.03702	0.000000	0.00434	2.306000	0.43673	-0.000000	0.14550	0.000000	0.15137	ACG	MST1L	-	-	ENSG00000186715		0.572	MST1L-002	KNOWN	basic	processed_transcript	MST1L	HGNC	pseudogene	OTTHUMT00000400328.1		0.00	61	0	G	NM_001271733		17084569	-1			no_errors	ENST00000455405	ensembl	human	known	74_37	rna	9.68	84	9	SNP	1.000	A
MROH9	80133	genome.wustl.edu	37	1	170967362	170967362	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr1:170967362G>T	ENST00000367758.3	+	15	1642	c.1543G>T	c.(1543-1545)Gaa>Taa	p.E515*	MROH9_ENST00000367759.4_Nonsense_Mutation_p.E515*	NM_025063.2	NP_079339.2	Q5TGP6	MROH9_HUMAN	maestro heat-like repeat family member 9	515																	GCTCTCAGTAGAAGGTCCTAG	0.388																																																	0													136.0	123.0	127.0					1																	170967362		1828	4077	5905	SO:0001587	stop_gained	0			AK027203	CCDS41436.1, CCDS53429.1	1q24.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000117501	ENSG00000117501		"""maestro heat-like repeat containing"""	26287	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 129"""	C1orf129			Standard	NM_025063		Approved	FLJ23550, ARMC11	uc010plz.2	Q5TGP6	OTTHUMG00000041456	ENST00000367758.3:c.1543G>T	1.37:g.170967362G>T	ENSP00000356732:p.Glu515*		A0PJM0|A0PJM2|F5GWX6|Q9H5D7	Nonsense_Mutation	SNP	superfamily_ARM-type_fold	p.E515*	ENST00000367758.3	37	c.1543	CCDS41436.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	36|36	5.853077|5.853077	0.97030|0.97030	.|.	.|.	ENSG00000117501|ENSG00000117501	ENST00000367759;ENST00000367758|ENST00000426136	.|.	.|.	.|.	4.8|4.8	3.86|3.86	0.44501|0.44501	.|.	0.224039|.	0.30820|.	N|.	0.008801|.	.|T	.|0.40247	.|0.1109	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.32903	.|-0.9889	.|3	0.48119|.	T|.	0.1|.	-18.4043|-18.4043	11.2029|11.2029	0.48751|0.48751	0.0:0.1863:0.8137:0.0|0.0:0.1863:0.8137:0.0	.|.	.|.	.|.	.|.	X|I	515|121	.|.	ENSP00000356732:E515X|.	E|R	+|+	1|2	0|0	C1orf129|C1orf129	169233986|169233986	0.996000|0.996000	0.38824|0.38824	0.964000|0.964000	0.40570|0.40570	0.554000|0.554000	0.35429|0.35429	1.836000|1.836000	0.39191|0.39191	1.112000|1.112000	0.41740|0.41740	0.447000|0.447000	0.29281|0.29281	GAA|AGA	MROH9	-	superfamily_ARM-type_fold	ENSG00000117501		0.388	MROH9-001	KNOWN	basic|CCDS	protein_coding	MROH9	HGNC	protein_coding	OTTHUMT00000099327.1	-	0.00	71	0	G	NM_025063		170967362	+1	tier1	-	no_errors	ENST00000367759	ensembl	human	known	74_37	nonsense	24.69	61	20	SNP	0.999	T
MT-CO1	4512	genome.wustl.edu	37	M	2977	2977	+	5'Flank	SNP	G	G	A			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chrM:2977G>A	ENST00000361624.2	+	0	0				MT-TV_ENST00000387342.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-TF_ENST00000387314.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TC_ENST00000387405.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-ND1_ENST00000361390.2_5'Flank|MT-TM_ENST00000387377.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-TY_ENST00000387409.1_RNA|MT-ND2_ENST00000361453.3_5'Flank|MT-TL1_ENST00000386347.1_RNA|MT-TI_ENST00000387365.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I						aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						ATCAACAATAGGGTTTACGAC	0.433																																																	0																																										SO:0001631	upstream_gene_variant	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395			M.37:g.2977G>A	Exception_encountered		Q34770	RNA	SNP	-	NULL	ENST00000361624.2	37	NULL		MT																																																																																			MT-RNR2	-	-	ENSG00000210082		0.433	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	MT-RNR2	HGNC	protein_coding		-	0.00	132	0	G	YP_003024028		2977	+1	tier1	-	no_errors	ENST00000387347	ensembl	human	known	74_37	rna	41.13	82	58	SNP	NULL	A
MT-CO1	4512	genome.wustl.edu	37	M	2999	2999	+	5'Flank	SNP	C	C	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chrM:2999C>T	ENST00000361624.2	+	0	0				MT-TV_ENST00000387342.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-TF_ENST00000387314.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TC_ENST00000387405.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-ND1_ENST00000361390.2_5'Flank|MT-TM_ENST00000387377.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-TY_ENST00000387409.1_RNA|MT-ND2_ENST00000361453.3_5'Flank|MT-TL1_ENST00000386347.1_RNA|MT-TI_ENST00000387365.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I						aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						TCGATGTTGGATCAGGACATC	0.453																																																	0																																										SO:0001631	upstream_gene_variant	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395			M.37:g.2999C>T	Exception_encountered		Q34770	RNA	SNP	-	NULL	ENST00000361624.2	37	NULL		MT																																																																																			MT-RNR2	-	-	ENSG00000210082		0.453	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	MT-RNR2	HGNC	protein_coding		-	0.00	117	0	C	YP_003024028		2999	+1	tier1	-	no_errors	ENST00000387347	ensembl	human	known	74_37	rna	22.22	77	22	SNP	NULL	T
MTMR9	66036	genome.wustl.edu	37	8	11163709	11163709	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr8:11163709G>T	ENST00000221086.3	+	5	1075	c.602G>T	c.(601-603)cGa>cTa	p.R201L	MTMR9_ENST00000526292.1_Missense_Mutation_p.R116L	NM_015458.3	NP_056273.2	Q96QG7	MTMR9_HUMAN	myotubularin related protein 9	201	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.					cytoplasm (GO:0005737)	enzyme regulator activity (GO:0030234)|phosphatase activity (GO:0016791)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|urinary_tract(2)	16			STAD - Stomach adenocarcinoma(15;0.215)	COAD - Colon adenocarcinoma(149;0.0678)		GTAATTATGCGAAGTGGTCAG	0.418																																																	0													69.0	63.0	65.0					8																	11163709		2203	4300	6503	SO:0001583	missense	0			AJ297823	CCDS5979.1	8p23-p22	2011-06-09	2002-09-05	2002-09-06	ENSG00000104643	ENSG00000104643		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	14596	protein-coding gene	gene with protein product		606260	"""myotubularin related protein 8"""	C8orf9, MTMR8		11472061, 11896452, 12890864	Standard	NM_015458		Approved	DKFZp434K171, LIP-STYX	uc003wtm.3	Q96QG7	OTTHUMG00000090647	ENST00000221086.3:c.602G>T	8.37:g.11163709G>T	ENSP00000221086:p.Arg201Leu		B7Z291|Q52LU3|Q8WW11|Q96QG6|Q9NX50	Missense_Mutation	SNP	pfam_Myotubularin-like_Pase_dom	p.R201L	ENST00000221086.3	37	c.602	CCDS5979.1	8	.	.	.	.	.	.	.	.	.	.	G	32	5.188917	0.94923	.	.	ENSG00000104643	ENST00000221086;ENST00000526292	D;D	0.98164	-4.76;-4.76	5.54	5.54	0.83059	Myotubularin phosphatase domain (1);Myotubularin-related (1);	0.000000	0.85682	D	0.000000	D	0.99405	0.9790	H	0.97635	4.045	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98463	1.0597	10	0.87932	D	0	.	18.4741	0.90785	0.0:0.0:1.0:0.0	.	201	Q96QG7	MTMR9_HUMAN	L	201;116	ENSP00000221086:R201L;ENSP00000433239:R116L	ENSP00000221086:R201L	R	+	2	0	MTMR9	11201119	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	9.686000	0.98664	2.600000	0.87896	0.563000	0.77884	CGA	MTMR9	-	pfam_Myotubularin-like_Pase_dom	ENSG00000104643		0.418	MTMR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTMR9	HGNC	protein_coding	OTTHUMT00000207307.2	-	0.00	32	0	G	NM_015458		11163709	+1	tier1	-	no_errors	ENST00000221086	ensembl	human	known	74_37	missense	6.90	54	4	SNP	1.000	T
MYCBP2	23077	genome.wustl.edu	37	13	77835366	77835366	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr13:77835366C>T	ENST00000544440.2	-	12	1695	c.1678G>A	c.(1678-1680)Gca>Aca	p.A560T	MYCBP2_ENST00000360084.5_5'UTR|MYCBP2_ENST00000357337.6_Missense_Mutation_p.A560T|MYCBP2_ENST00000407578.2_Missense_Mutation_p.A598T					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		CCATCTTCTGCAACTAAAAGG	0.388																																																	0													124.0	113.0	117.0					13																	77835366		2203	4300	6503	SO:0001583	missense	0			AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.1678G>A	13.37:g.77835366C>T	ENSP00000444596:p.Ala560Thr			Missense_Mutation	SNP	pfam_PHR,pfam_Reg_chr_condens,pfam_Filamin/ABP280_repeat-like,superfamily_RCC1/BLIP-II,superfamily_Galactose-bd-like,superfamily_Ig_E-set,superfamily_ARM-type_fold,smart_Znf_RING,pfscan_Filamin/ABP280_repeat-like,pfscan_Znf_RING,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.A598T	ENST00000544440.2	37	c.1792		13	.	.	.	.	.	.	.	.	.	.	C	20.9	4.062139	0.76187	.	.	ENSG00000005810	ENST00000357337;ENST00000407578;ENST00000544440	T;T;T	0.75938	-0.98;-0.98;-0.98	5.62	5.62	0.85841	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.000000	0.85682	D	0.000000	T	0.75606	0.3872	N	0.24115	0.695	0.80722	D	1	D	0.63880	0.993	D	0.70935	0.971	T	0.67329	-0.5698	10	0.02654	T	1	.	19.6562	0.95842	0.0:1.0:0.0:0.0	.	560	O75592	MYCB2_HUMAN	T	560;598;560	ENSP00000349892:A560T;ENSP00000384288:A598T;ENSP00000444596:A560T	ENSP00000349892:A560T	A	-	1	0	MYCBP2	76733367	1.000000	0.71417	1.000000	0.80357	0.874000	0.50279	7.729000	0.84864	2.653000	0.90120	0.585000	0.79938	GCA	MYCBP2	-	superfamily_RCC1/BLIP-II,superfamily_ARM-type_fold	ENSG00000005810		0.388	MYCBP2-001	KNOWN	basic	protein_coding	MYCBP2	HGNC	protein_coding	OTTHUMT00000045326.1	-	0.00	48	0	C	NM_015057		77835366	-1	tier1	-	no_errors	ENST00000407578	ensembl	human	known	74_37	missense	7.81	59	5	SNP	1.000	T
MYH10	4628	genome.wustl.edu	37	17	8409714	8409714	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr17:8409714G>T	ENST00000269243.4	-	25	3353	c.3215C>A	c.(3214-3216)gCa>gAa	p.A1072E	MYH10_ENST00000360416.3_Missense_Mutation_p.A1103E|MYH10_ENST00000396239.1_Missense_Mutation_p.A1093E|MYH10_ENST00000379980.4_Missense_Mutation_p.A1088E	NM_005964.3	NP_005955.3	P35580	MYH10_HUMAN	myosin, heavy chain 10, non-muscle	1072					actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cardiac myofibril assembly (GO:0055003)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cerebellar Purkinje cell layer development (GO:0021680)|exocytosis (GO:0006887)|fourth ventricle development (GO:0021592)|in utero embryonic development (GO:0001701)|lateral ventricle development (GO:0021670)|mitotic cytokinesis (GO:0000281)|neuromuscular process controlling balance (GO:0050885)|neuron migration (GO:0001764)|nuclear migration (GO:0007097)|plasma membrane repair (GO:0001778)|regulation of cell shape (GO:0008360)|retina development in camera-type eye (GO:0060041)|substrate-dependent cell migration, cell extension (GO:0006930)|third ventricle development (GO:0021678)|ventricular cardiac muscle cell development (GO:0055015)	actomyosin (GO:0042641)|axon (GO:0030424)|cell cortex (GO:0005938)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|midbody (GO:0030496)|myosin complex (GO:0016459)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle (GO:0005819)|stress fiber (GO:0001725)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(5)|endometrium(9)|kidney(2)|large_intestine(16)|lung(9)|ovary(3)|prostate(3)|skin(4)|stomach(1)	52						CTGCAGCTCTGCGATCTGGTC	0.572																																																	0													106.0	90.0	96.0					17																	8409714		2203	4300	6503	SO:0001583	missense	0			M69181	CCDS11144.1, CCDS58515.1, CCDS73984.1	17p13	2011-09-27	2006-09-29		ENSG00000133026	ENSG00000133026		"""Myosins / Myosin superfamily : Class II"""	7568	protein-coding gene	gene with protein product		160776	"""myosin, heavy polypeptide 10, non-muscle"""			1860190	Standard	NM_001256012		Approved	NMMHCB	uc002glm.4	P35580	OTTHUMG00000108195	ENST00000269243.4:c.3215C>A	17.37:g.8409714G>T	ENSP00000269243:p.Ala1072Glu		B2RWP9|D3DTS1|F8VTL3|Q12989|Q149N3|Q149N4|Q16087|Q4LE45|Q6PK16|Q9BWG0	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_HR1_rho-bd,superfamily_UBA-like,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.A1093E	ENST00000269243.4	37	c.3278	CCDS11144.1	17	.	.	.	.	.	.	.	.	.	.	G	13.16	2.154827	0.38021	.	.	ENSG00000133026	ENST00000269243;ENST00000360416;ENST00000396239;ENST00000379980	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	4.87	4.87	0.63330	.	0.161807	0.53938	D	0.000041	T	0.74268	0.3694	L	0.32530	0.975	0.58432	D	0.999997	P;B;B	0.37612	0.602;0.311;0.431	B;B;B	0.41619	0.197;0.361;0.197	T	0.77991	-0.2379	10	0.87932	D	0	.	18.5613	0.91101	0.0:0.0:1.0:0.0	.	1081;1103;1072	B2RWP9;F8VTL3;P35580	.;.;MYH10_HUMAN	E	1072;1103;1093;1088	ENSP00000269243:A1072E;ENSP00000353590:A1103E;ENSP00000379539:A1093E;ENSP00000369315:A1088E	ENSP00000269243:A1072E	A	-	2	0	MYH10	8350439	1.000000	0.71417	0.953000	0.39169	0.292000	0.27327	5.420000	0.66441	2.672000	0.90937	0.563000	0.77884	GCA	MYH10	-	superfamily_HR1_rho-bd	ENSG00000133026		0.572	MYH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH10	HGNC	protein_coding	OTTHUMT00000227001.2	-	0.00	64	0	G			8409714	-1	tier1	-	no_errors	ENST00000396239	ensembl	human	known	74_37	missense	8.14	79	7	SNP	0.998	T
MYH1	4619	genome.wustl.edu	37	17	10401141	10401141	+	Silent	SNP	G	G	C			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr17:10401141G>C	ENST00000226207.5	-	31	4369	c.4275C>G	c.(4273-4275)ctC>ctG	p.L1425L	RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1425					muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						CTTCATTCTGGAGCCTCTGCT	0.478																																																	0													121.0	110.0	114.0					17																	10401141		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.4275C>G	17.37:g.10401141G>C			Q14CA4|Q9Y622	Silent	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.L1425	ENST00000226207.5	37	c.4275	CCDS11155.1	17																																																																																			MYH1	-	pfam_Myosin_tail	ENSG00000109061		0.478	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH1	HGNC	protein_coding	OTTHUMT00000252725.1	-	0.00	59	0	G	NM_005963		10401141	-1	tier1	-	no_errors	ENST00000226207	ensembl	human	known	74_37	silent	27.34	101	38	SNP	0.997	C
MYH2	4620	genome.wustl.edu	37	17	10428870	10428870	+	Nonsense_Mutation	SNP	C	C	A			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr17:10428870C>A	ENST00000245503.5	-	32	4819	c.4435G>T	c.(4435-4437)Gag>Tag	p.E1479*	MYH2_ENST00000532183.2_Intron|RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA|MYH2_ENST00000397183.2_Nonsense_Mutation_p.E1479*|CTC-297N7.11_ENST00000587182.2_RNA	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	1479					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						GAACGGGCCTCCTTCTGGGAG	0.468																																																	0													68.0	72.0	71.0					17																	10428870		2203	4300	6503	SO:0001587	stop_gained	0				CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.4435G>T	17.37:g.10428870C>A	ENSP00000245503:p.Glu1479*		A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Nonsense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_Ribosomal_L29,superfamily_t-SNARE,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.E1479*	ENST00000245503.5	37	c.4435	CCDS11156.1	17	.	.	.	.	.	.	.	.	.	.	C	46	12.659159	0.99686	.	.	ENSG00000125414	ENST00000245503;ENST00000397183	.	.	.	5.2	5.2	0.72013	.	0.000000	0.39615	U	0.001306	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	18.9276	0.92552	0.0:1.0:0.0:0.0	.	.	.	.	X	1479	.	ENSP00000245503:E1479X	E	-	1	0	MYH2	10369595	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.569000	0.82380	2.713000	0.92767	0.591000	0.81541	GAG	MYH2	-	pfam_Myosin_tail	ENSG00000125414		0.468	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH2	HGNC	protein_coding	OTTHUMT00000252726.3	-	0.00	49	0	C	NM_017534		10428870	-1	tier1	-	no_errors	ENST00000245503	ensembl	human	known	74_37	nonsense	28.04	76	30	SNP	1.000	A
MYO16	23026	genome.wustl.edu	37	13	109793189	109793189	+	Silent	SNP	C	C	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr13:109793189C>T	ENST00000357550.2	+	31	4604	c.4563C>T	c.(4561-4563)gtC>gtT	p.V1521V	MYO16_ENST00000356711.2_Silent_p.V1521V	NM_001198950.1	NP_001185879.1			myosin XVI											NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			AGCTGCCAGTCCTGGAGACCA	0.706																																																	0													19.0	23.0	22.0					13																	109793189		2194	4289	6483	SO:0001819	synonymous_variant	0				CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.4563C>T	13.37:g.109793189C>T				Silent	SNP	pfam_Myosin_head_motor_dom,pfam_Ankyrin_rpt,superfamily_P-loop_NTPase,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Myosin_head_motor_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.V1521	ENST00000357550.2	37	c.4563	CCDS32008.1	13																																																																																			MYO16	-	NULL	ENSG00000041515		0.706	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO16	HGNC	protein_coding	OTTHUMT00000045746.1	-	0.00	21	0	C	NM_015011		109793189	+1	tier1	-	no_errors	ENST00000356711	ensembl	human	known	74_37	silent	52.17	11	12	SNP	0.988	T
NCAPG2	54892	genome.wustl.edu	37	7	158448144	158448144	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr7:158448144C>A	ENST00000409423.1	-	21	2564	c.2392G>T	c.(2392-2394)Gat>Tat	p.D798Y	NCAPG2_ENST00000541468.1_Missense_Mutation_p.D299Y|NCAPG2_ENST00000356309.3_Missense_Mutation_p.D798Y|NCAPG2_ENST00000409339.3_Missense_Mutation_p.D798Y|NCAPG2_ENST00000449727.2_Missense_Mutation_p.D798Y|NCAPG2_ENST00000275830.10_Missense_Mutation_p.D590Y	NM_001281932.1	NP_001268861.1	Q86XI2	CNDG2_HUMAN	non-SMC condensin II complex, subunit G2	798					chromosome condensation (GO:0030261)|inner cell mass cell proliferation (GO:0001833)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	methylated histone binding (GO:0035064)			NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(7)|liver(1)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	39	Ovarian(565;0.152)	all_cancers(7;3.44e-11)|all_epithelial(9;3.05e-05)|all_hematologic(28;0.014)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.187)|STAD - Stomach adenocarcinoma(7;0.18)		GACTCCAGATCTGCCTGTAAT	0.572																																																	0													63.0	72.0	69.0					7																	158448144		2041	4191	6232	SO:0001583	missense	0			BC043404	CCDS43686.1, CCDS64816.1	7q36.3	2006-09-04	2006-09-04	2006-09-04	ENSG00000146918	ENSG00000146918			21904	protein-coding gene	gene with protein product		608532	"""leucine zipper protein 5"""	LUZP5		14532007	Standard	NM_001281933		Approved	FLJ20311, MTB, CAP-G2, hCAP-G2	uc003wnv.1	Q86XI2	OTTHUMG00000151438	ENST00000409423.1:c.2392G>T	7.37:g.158448144C>A	ENSP00000386569:p.Asp798Tyr		A4D228|Q7Z3J9|Q8WUG8|Q9BRX6|Q9H8S2|Q9H9K6	Missense_Mutation	SNP	pfam_Condensin2_G2,superfamily_ARM-type_fold	p.D798Y	ENST00000409423.1	37	c.2392	CCDS43686.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.02|11.02	1.514826|1.514826	0.27123|0.27123	.|.	.|.	ENSG00000146918|ENSG00000146918	ENST00000541468;ENST00000356309;ENST00000409423;ENST00000275830;ENST00000409339;ENST00000545393;ENST00000449727|ENST00000441982	T;T;T;T;T;T|.	0.42131|.	0.98;0.98;0.98;0.98;0.98;0.98|.	5.33|5.33	4.45|4.45	0.53987|0.53987	.|.	0.349218|.	0.31721|.	N|.	0.007166|.	T|T	0.41282|0.41282	0.1152|0.1152	L|L	0.43152|0.43152	1.355|1.355	0.09310|0.09310	N|N	1|1	D;D;P;D|.	0.63880|.	0.989;0.993;0.954;0.983|.	P;P;P;P|.	0.61477|.	0.532;0.889;0.69;0.663|.	T|T	0.24835|0.24835	-1.0149|-1.0149	10|5	0.52906|.	T|.	0.07|.	-15.4428|-15.4428	10.5835|10.5835	0.45269|0.45269	0.0:0.845:0.0:0.155|0.0:0.845:0.0:0.155	.|.	798;241;590;798|.	Q86XI2-2;B4DHE5;E7EUH9;Q86XI2|.	.;.;.;CNDG2_HUMAN|.	Y|H	299;798;798;590;798;241;798|599	ENSP00000442337:D299Y;ENSP00000348657:D798Y;ENSP00000386569:D798Y;ENSP00000275830:D590Y;ENSP00000387007:D798Y;ENSP00000388326:D798Y|.	ENSP00000275830:D590Y|.	D|Q	-|-	1|3	0|2	NCAPG2|NCAPG2	158140905|158140905	0.486000|0.486000	0.25980|0.25980	0.158000|0.158000	0.22627|0.22627	0.193000|0.193000	0.23685|0.23685	1.147000|1.147000	0.31602|0.31602	1.261000|1.261000	0.44149|0.44149	0.561000|0.561000	0.74099|0.74099	GAT|CAG	NCAPG2	-	pfam_Condensin2_G2	ENSG00000146918		0.572	NCAPG2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NCAPG2	HGNC	protein_coding	OTTHUMT00000327111.1	-	0.00	34	0	C	NM_017760		158448144	-1	tier1	-	no_errors	ENST00000409339	ensembl	human	known	74_37	missense	36.74	136	79	SNP	0.030	A
NCKAP1	10787	genome.wustl.edu	37	2	183847622	183847622	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr2:183847622G>T	ENST00000361354.4	-	12	1507	c.1135C>A	c.(1135-1137)Cgt>Agt	p.R379S	NCKAP1_ENST00000360982.2_Missense_Mutation_p.R385S	NM_013436.3	NP_038464.1	Q9Y2A7	NCKP1_HUMAN	NCK-associated protein 1	379					apical protein localization (GO:0045176)|apoptotic process (GO:0006915)|basal protein localization (GO:0045175)|central nervous system development (GO:0007417)|embryonic body morphogenesis (GO:0010172)|embryonic foregut morphogenesis (GO:0048617)|embryonic heart tube development (GO:0035050)|endoderm development (GO:0007492)|establishment or maintenance of actin cytoskeleton polarity (GO:0030950)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|lamellipodium assembly (GO:0030032)|mesodermal cell migration (GO:0008078)|neural tube closure (GO:0001843)|notochord morphogenesis (GO:0048570)|paraxial mesoderm morphogenesis (GO:0048340)|positive regulation of Arp2/3 complex-mediated actin nucleation (GO:2000601)|positive regulation of lamellipodium assembly (GO:0010592)|protein stabilization (GO:0050821)|Rac protein signal transduction (GO:0016601)|regulation of protein localization (GO:0032880)|somitogenesis (GO:0001756)|zygotic determination of anterior/posterior axis, embryo (GO:0007354)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|SCAR complex (GO:0031209)	protein complex binding (GO:0032403)			breast(3)|cervix(2)|endometrium(3)|kidney(4)|large_intestine(11)|lung(16)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	45			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			ATTTCATCACGGGCAAAGGAT	0.308																																																	0													43.0	44.0	44.0					2																	183847622		2203	4300	6503	SO:0001583	missense	0			AB014509	CCDS2287.1, CCDS2288.1	2q32	2009-08-14			ENSG00000061676	ENSG00000061676			7666	protein-coding gene	gene with protein product		604891				10673335, 12181570, 9344857	Standard	NM_013436		Approved	Nap1, HEM2, NAP125	uc002upb.4	Q9Y2A7	OTTHUMG00000132623	ENST00000361354.4:c.1135C>A	2.37:g.183847622G>T	ENSP00000355348:p.Arg379Ser		O60329|Q53QN5|Q53S94|Q53Y35	Missense_Mutation	SNP	pfam_Nck-associated_protein-1	p.R385S	ENST00000361354.4	37	c.1153	CCDS2287.1	2	.	.	.	.	.	.	.	.	.	.	G	21.6	4.176370	0.78564	.	.	ENSG00000061676	ENST00000361354;ENST00000360982	T;T	0.35789	1.29;1.29	5.45	4.58	0.56647	.	0.000000	0.85682	D	0.000000	T	0.61627	0.2362	M	0.80028	2.48	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.65957	-0.6042	10	0.52906	T	0.07	-10.1373	14.2997	0.66339	0.0716:0.0:0.9284:0.0	.	379;385	Q9Y2A7;Q9Y2A7-2	NCKP1_HUMAN;.	S	379;385	ENSP00000355348:R379S;ENSP00000354251:R385S	ENSP00000354251:R385S	R	-	1	0	NCKAP1	183555867	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.604000	0.74150	1.302000	0.44855	0.655000	0.94253	CGT	NCKAP1	-	pfam_Nck-associated_protein-1	ENSG00000061676		0.308	NCKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCKAP1	HGNC	protein_coding	OTTHUMT00000255867.2		0.00	94	0	G	NM_205842		183847622	-1			no_errors	ENST00000360982	ensembl	human	known	74_37	missense	5.33	71	4	SNP	1.000	T
NCOA6	23054	genome.wustl.edu	37	20	33328745	33328745	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr20:33328745C>T	ENST00000374796.2	-	12	7885	c.5315G>A	c.(5314-5316)aGc>aAc	p.S1772N	NCOA6_ENST00000359003.2_Missense_Mutation_p.S1772N			Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	1772	EP300/CRSP3-binding region.				brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-templated transcription, initiation (GO:0006352)|glucocorticoid receptor signaling pathway (GO:0042921)|heart development (GO:0007507)|intracellular estrogen receptor signaling pathway (GO:0030520)|labyrinthine layer blood vessel development (GO:0060716)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)	histone methyltransferase complex (GO:0035097)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(8)|large_intestine(16)|lung(37)|ovary(4)|prostate(5)|skin(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	107						CACCTGAGGGCTAGCCTCATC	0.517																																																	0													88.0	85.0	86.0					20																	33328745		2203	4300	6503	SO:0001583	missense	0			AF128458	CCDS13241.1, CCDS74720.1	20q11	2008-08-01			ENSG00000198646	ENSG00000198646			15936	protein-coding gene	gene with protein product	"""nuclear receptor coactivator RAP250"", ""activating signal cointegrator-2"", ""peroxisome proliferator-activated receptor interacting protein"""	605299				8724849, 8263591	Standard	NM_014071		Approved	KIAA0181, RAP250, ASC2, AIB3, PRIP, TRBP, NRC	uc002xaw.3	Q14686	OTTHUMG00000032311	ENST00000374796.2:c.5315G>A	20.37:g.33328745C>T	ENSP00000363929:p.Ser1772Asn		A6NLF1|B2RMN5|E1P5P7|Q9NTZ9|Q9UH74|Q9UK86	Missense_Mutation	SNP	NULL	p.S1772N	ENST00000374796.2	37	c.5315	CCDS13241.1	20	.	.	.	.	.	.	.	.	.	.	C	19.75	3.884999	0.72410	.	.	ENSG00000198646	ENST00000374796;ENST00000359003	T;T	0.25250	1.81;1.81	5.65	4.7	0.59300	.	0.189811	0.47093	D	0.000256	T	0.18841	0.0452	N	0.19112	0.55	0.33572	D	0.598711	P	0.34522	0.455	B	0.32465	0.146	T	0.26155	-1.0111	10	0.54805	T	0.06	-1.0122	15.8794	0.79193	0.0:0.745:0.255:0.0	.	1772	Q14686	NCOA6_HUMAN	N	1772	ENSP00000363929:S1772N;ENSP00000351894:S1772N	ENSP00000351894:S1772N	S	-	2	0	NCOA6	32792406	0.977000	0.34250	1.000000	0.80357	0.994000	0.84299	1.382000	0.34374	1.616000	0.50265	0.655000	0.94253	AGC	NCOA6	-	NULL	ENSG00000198646		0.517	NCOA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOA6	HGNC	protein_coding	OTTHUMT00000078811.2		0.00	68	0	C	NM_014071		33328745	-1			no_errors	ENST00000359003	ensembl	human	known	74_37	missense	6.56	57	4	SNP	1.000	T
NCOR2	9612	genome.wustl.edu	37	12	124914204	124914204	+	Missense_Mutation	SNP	G	G	T	rs369539019		TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr12:124914204G>T	ENST00000405201.1	-	10	1104	c.1104C>A	c.(1102-1104)agC>agA	p.S368R	NCOR2_ENST00000404621.1_Missense_Mutation_p.S367R|NCOR2_ENST00000397355.1_Missense_Mutation_p.S368R|NCOR2_ENST00000429285.2_Missense_Mutation_p.S367R|NCOR2_ENST00000356219.3_Missense_Mutation_p.S368R|NCOR2_ENST00000404121.2_5'UTR			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	368					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		CCTCGTGCTCGCTGCGGGCGG	0.662																																																	0													25.0	31.0	29.0					12																	124914204		2102	4221	6323	SO:0001583	missense	0			U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.1104C>A	12.37:g.124914204G>T	ENSP00000384018:p.Ser368Arg		O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Missense_Mutation	SNP	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.S368R	ENST00000405201.1	37	c.1104	CCDS41858.2	12	.	.	.	.	.	.	.	.	.	.	G	9.176	1.022266	0.19433	.	.	ENSG00000196498	ENST00000405201;ENST00000404621;ENST00000356219;ENST00000397355;ENST00000447011;ENST00000429285;ENST00000458234;ENST00000420698	T;T;T;T;T;T;T	0.48522	0.81;0.81;0.81;0.81;0.81;0.81;0.81	3.4	-1.91	0.07641	.	0.187928	0.45126	D	0.000396	T	0.58323	0.2114	L	0.58583	1.82	0.80722	D	1	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.87578	0.995;0.995;0.998	T	0.58399	-0.7643	10	0.87932	D	0	-20.2767	10.5393	0.45024	0.6903:0.0:0.3097:0.0	.	367;368;368	C9J0Q5;C9J239;C9JFD3	.;.;.	R	368;367;368;368;368;367;368;368	ENSP00000384018:S368R;ENSP00000384202:S367R;ENSP00000348551:S368R;ENSP00000380513:S368R;ENSP00000400281:S367R;ENSP00000402808:S368R;ENSP00000405367:S368R	ENSP00000348551:S368R	S	-	3	2	NCOR2	123480157	0.134000	0.22483	0.995000	0.50966	0.671000	0.39405	-0.365000	0.07573	-0.322000	0.08615	0.313000	0.20887	AGC	NCOR2	-	NULL	ENSG00000196498		0.662	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	NCOR2	HGNC	protein_coding	OTTHUMT00000318173.2		0.00	62	0	G	NM_006312		124914204	-1			no_errors	ENST00000356219	ensembl	human	known	74_37	missense	6.35	59	4	SNP	0.996	T
NDST2	8509	genome.wustl.edu	37	10	75566417	75566417	+	Missense_Mutation	SNP	G	G	C	rs534521520		TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr10:75566417G>C	ENST00000309979.6	-	5	1802	c.1246C>G	c.(1246-1248)Ctg>Gtg	p.L416V	RP11-574K11.31_ENST00000603027.1_Missense_Mutation_p.L416V|NDST2_ENST00000299641.4_Missense_Mutation_p.L293V			P52849	NDST2_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2	416	Heparan sulfate N-deacetylase 2.				carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|hydrolase activity (GO:0016787)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(11)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	30	Prostate(51;0.0112)					GGTCTCACCAGAGCAAACTGT	0.517													G|||	1	0.000199681	0.0	0.0	5008	,	,		20821	0.0		0.0	False		,,,				2504	0.001																0													104.0	100.0	101.0					10																	75566417		2203	4300	6503	SO:0001583	missense	0			U36601	CCDS7335.1	10q22	2007-03-14			ENSG00000166507	ENSG00000166507		"""Sulfotransferases, membrane-bound"""	7681	protein-coding gene	gene with protein product		603268				9601056	Standard	NM_003635		Approved	NST2, HSST2	uc001jvk.2	P52849	OTTHUMG00000018489	ENST00000309979.6:c.1246C>G	10.37:g.75566417G>C	ENSP00000310657:p.Leu416Val		Q2TB32|Q59H89	Missense_Mutation	SNP	pfam_Heparan_SO4_deacetylase,pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	p.L416V	ENST00000309979.6	37	c.1246	CCDS7335.1	10	.	.	.	.	.	.	.	.	.	.	G	0.020	-1.444258	0.01089	.	.	ENSG00000166507	ENST00000309979;ENST00000299641	T;T	0.43294	1.27;0.95	5.5	3.53	0.40419	.	0.415166	0.24147	N	0.041104	T	0.16769	0.0403	N	0.08118	0	0.30354	N	0.784467	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.15052	0.006;0.012;0.006	T	0.31280	-0.9949	10	0.02654	T	1	.	5.827	0.18558	0.1915:0.3256:0.4829:0.0	.	293;86;416	B4E139;B4DQU1;P52849	.;.;NDST2_HUMAN	V	416;293	ENSP00000310657:L416V;ENSP00000299641:L293V	ENSP00000299641:L293V	L	-	1	2	NDST2	75236423	0.898000	0.30612	1.000000	0.80357	0.942000	0.58702	0.780000	0.26760	0.574000	0.29417	0.491000	0.48974	CTG	NDST2	-	pfam_Heparan_SO4_deacetylase	ENSG00000166507		0.517	NDST2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	NDST2	HGNC	protein_coding	OTTHUMT00000048710.1	-	0.00	37	0	G	NM_003635		75566417	-1	tier1	-	no_errors	ENST00000309979	ensembl	human	known	74_37	missense	36.67	19	11	SNP	0.998	C
NF2	4771	genome.wustl.edu	37	22	30070824	30070824	+	Splice_Site	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr22:30070824G>T	ENST00000338641.4	+	13	1781		c.e13-1		NF2_ENST00000413209.2_Intron|NF2_ENST00000353887.4_Splice_Site|NF2_ENST00000361452.4_Splice_Site|NF2_ENST00000334961.7_Splice_Site|NF2_ENST00000347330.5_Splice_Site|NF2_ENST00000361676.4_Splice_Site|NF2_ENST00000361166.4_Splice_Site|NF2_ENST00000397789.3_Splice_Site|NF2_ENST00000403999.3_Splice_Site|NF2_ENST00000403435.1_Splice_Site	NM_000268.3|NM_016418.5|NM_181832.2	NP_000259.1|NP_057502.2|NP_861970.1	P35240	MERL_HUMAN	neurofibromin 2 (merlin)						actin cytoskeleton organization (GO:0030036)|cell-cell junction organization (GO:0045216)|ectoderm development (GO:0007398)|hippocampus development (GO:0021766)|lens fiber cell differentiation (GO:0070306)|mesoderm formation (GO:0001707)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of DNA replication (GO:0008156)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|negative regulation of tyrosine phosphorylation of Stat5 protein (GO:0042524)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of cell differentiation (GO:0045597)|positive regulation of stress fiber assembly (GO:0051496)|regulation of hippo signaling (GO:0035330)|regulation of neural precursor cell proliferation (GO:2000177)|regulation of protein localization to nucleus (GO:1900180)|regulation of protein stability (GO:0031647)|Schwann cell proliferation (GO:0014010)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|cleavage furrow (GO:0032154)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|early endosome (GO:0005769)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)		p.?(5)		NS(1)|bone(2)|breast(5)|central_nervous_system(21)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(17)|large_intestine(9)|liver(1)|lung(9)|meninges(372)|ovary(2)|pituitary(1)|pleura(9)|prostate(1)|skin(7)|soft_tissue(303)|stomach(2)|thyroid(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	776						TTTCCTTGCAGGGCCAAAGAG	0.597			"""D, Mis, N, F, S, O"""		"""meningioma, acoustic neuroma, renal """	"""meningioma, acoustic neuroma"""			Neurofibromatosis, type 2																														yes	Rec	yes	Neurofibromatosis type 2	22	22q12.2	4771	neurofibromatosis type 2 gene		O	5	Unknown(5)	meninges(2)|large_intestine(1)|stomach(1)|central_nervous_system(1)	GRCh37	CS961643	NF2	S							28.0	25.0	26.0					22																	30070824		2187	4248	6435	SO:0001630	splice_region_variant	0	Familial Cancer Database	NF2, Central Neurofibromatosis, Bilateral Acoustic Neurofibromatosis	L11353	CCDS13861.1, CCDS13862.1, CCDS13863.1, CCDS13864.1, CCDS13865.1, CCDS54516.1	22q12.2	2014-09-17	2007-12-17		ENSG00000186575	ENSG00000186575		"""A-kinase anchor proteins"""	7773	protein-coding gene	gene with protein product	"""moesin-ezrin-radixin like"", ""schwannomin"""	607379	"""neurofibromin 2 (bilateral acoustic neuroma)"""			10591208	Standard	NM_000268		Approved	merlin	uc003age.4	P35240	OTTHUMG00000030727	ENST00000338641.4:c.1341-1G>T	22.37:g.30070824G>T			O95683|Q8WUJ2|Q969N0|Q969Q3|Q96T30|Q96T31|Q96T32|Q96T33|Q9BTW3|Q9UNG9|Q9UNH3|Q9UNH4	Splice_Site	SNP	-	e13-1	ENST00000338641.4	37	c.1341-1	CCDS13861.1	22	.	.	.	.	.	.	.	.	.	.	G	31	5.073228	0.94000	.	.	ENSG00000186575	ENST00000347330;ENST00000338641;ENST00000403435;ENST00000361452;ENST00000397822;ENST00000403999;ENST00000334961;ENST00000353887;ENST00000397789;ENST00000361676;ENST00000361166	.	.	.	5.6	5.6	0.85130	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.605	0.95577	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NF2	28400824	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.860000	0.99555	2.635000	0.89317	0.655000	0.94253	.	NF2	-	-	ENSG00000186575		0.597	NF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NF2	HGNC	protein_coding	OTTHUMT00000075615.3	-	0.00	28	0	G	NM_000268	Intron	30070824	+1	tier1	-	no_errors	ENST00000338641	ensembl	human	known	74_37	splice_site	9.09	40	4	SNP	1.000	T
NIPBL	25836	genome.wustl.edu	37	5	37064103	37064103	+	Intron	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr5:37064103G>T	ENST00000282516.8	+	46	8548				NIPBL_ENST00000448238.2_Missense_Mutation_p.R2691L	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)						brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			AGGAGTCAACGTATTTCGCAG	0.388																																																	0													199.0	216.0	210.0					5																	37064103		2203	4300	6503	SO:0001627	intron_variant	0			AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.8049+23G>T	5.37:g.37064103G>T			Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.R2691L	ENST00000282516.8	37	c.8072	CCDS3920.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.32|11.32	1.603887|1.603887	0.28534|0.28534	.|.	.|.	ENSG00000164190|ENSG00000164190	ENST00000448238|ENST00000507919	D|.	0.94966|.	-3.57|.	5.5|5.5	5.5|5.5	0.81552|0.81552	.|.	.|.	.|.	.|.	.|.	T|T	0.30916|0.30916	0.0780|0.0780	N|N	0.08118|0.08118	0|0	0.29929|0.29929	N|N	0.822099|0.822099	P|.	0.38992|.	0.653|.	B|.	0.33620|.	0.167|.	T|T	0.19451|0.19451	-1.0305|-1.0305	8|5	.|.	.|.	.|.	.|.	17.5743|17.5743	0.87944|0.87944	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	2691|.	Q6KC79-2|.	.|.	L|L	2691|197	ENSP00000406266:R2691L|.	.|.	R|V	+|+	2|1	0|0	NIPBL|NIPBL	37099860|37099860	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	5.241000|5.241000	0.65384|0.65384	2.583000|2.583000	0.87209|0.87209	0.591000|0.591000	0.81541|0.81541	CGT|GTA	NIPBL	-	NULL	ENSG00000164190		0.388	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NIPBL	HGNC	protein_coding	OTTHUMT00000207582.1	-	0.00	54	0	G	NM_015384		37064103	+1	tier1	-	no_errors	ENST00000448238	ensembl	human	known	74_37	missense	5.71	66	4	SNP	1.000	T
NKAP	79576	genome.wustl.edu	37	X	119066177	119066177	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chrX:119066177T>C	ENST00000371410.3	-	6	906	c.740A>G	c.(739-741)aAg>aGg	p.K247R	NKAP_ENST00000477789.1_5'UTR	NM_024528.3	NP_078804.2	Q8N5F7	NKAP_HUMAN	NFKB activating protein	247	Lys-rich.|Necessary for interaction with CIR1.				granulocyte differentiation (GO:0030851)|hematopoietic stem cell proliferation (GO:0071425)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|stem cell maintenance (GO:0019827)|T cell differentiation in thymus (GO:0033077)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)|prostate(1)	20						CTTATATTTCTTCCTATAGGG	0.323																																																	0													87.0	86.0	86.0					X																	119066177		2203	4299	6502	SO:0001583	missense	0			BC012770	CCDS14592.1	Xq24	2010-07-20			ENSG00000101882	ENSG00000101882			29873	protein-coding gene	gene with protein product	"""NF kappaB activating protein"""	300766				14550261	Standard	NM_024528		Approved	FLJ22626	uc004esh.3	Q8N5F7	OTTHUMG00000022284	ENST00000371410.3:c.740A>G	X.37:g.119066177T>C	ENSP00000360464:p.Lys247Arg		Q6IPW6|Q96BQ2|Q9H638	Missense_Mutation	SNP	pfam_DUF926	p.K247R	ENST00000371410.3	37	c.740	CCDS14592.1	X	.	.	.	.	.	.	.	.	.	.	T	12.07	1.826814	0.32329	.	.	ENSG00000101882	ENST00000371410	T	0.16897	2.31	4.94	3.77	0.43336	.	0.092711	0.64402	N	0.000001	T	0.12220	0.0297	L	0.38531	1.155	0.80722	D	1	B;B	0.27997	0.06;0.197	B;B	0.25614	0.018;0.062	T	0.12708	-1.0537	10	0.20046	T	0.44	-13.8233	9.2539	0.37571	0.0:0.0868:0.0:0.9132	.	247;247	Q8N5F7;A0PJ73	NKAP_HUMAN;.	R	247	ENSP00000360464:K247R	ENSP00000360464:K247R	K	-	2	0	NKAP	118950205	1.000000	0.71417	1.000000	0.80357	0.690000	0.40134	6.713000	0.74686	0.666000	0.31087	0.345000	0.21793	AAG	NKAP	-	NULL	ENSG00000101882		0.323	NKAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NKAP	HGNC	protein_coding	OTTHUMT00000058072.1	-	0.00	22	0	T	NM_024528		119066177	-1	tier1	-	no_errors	ENST00000371410	ensembl	human	known	74_37	missense	32.05	53	25	SNP	1.000	C
NLRP12	91662	genome.wustl.edu	37	19	54312981	54312981	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr19:54312981C>A	ENST00000324134.6	-	3	2100	c.1932G>T	c.(1930-1932)aaG>aaT	p.K644N	NLRP12_ENST00000354278.3_Missense_Mutation_p.K644N|NLRP12_ENST00000391772.1_Missense_Mutation_p.K644N|NLRP12_ENST00000391775.3_Missense_Mutation_p.K644N|NLRP12_ENST00000535162.1_Missense_Mutation_p.K644N|NLRP12_ENST00000345770.5_Missense_Mutation_p.K644N|NLRP12_ENST00000351894.4_Missense_Mutation_p.K644N|NLRP12_ENST00000391773.1_Missense_Mutation_p.K644N	NM_001277126.1|NM_144687.2	NP_001264055.1|NP_653288.1	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12	644					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to cytokine stimulus (GO:0071345)|dendritic cell migration (GO:0036336)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of signal transduction (GO:0009968)|negative regulation of Toll signaling pathway (GO:0045751)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of MHC class I biosynthetic process (GO:0045345)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of interleukin-18 biosynthetic process (GO:0045381)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)			NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(36)|ovary(5)|pancreas(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	80	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		TGTGCTCCATCTTGGAGGCAA	0.592																																																	0													75.0	67.0	70.0					19																	54312981		2203	4300	6503	SO:0001583	missense	0			AY095146	CCDS12864.1, CCDS62784.1, CCDS62785.1	19q13.42	2014-09-17	2006-12-08	2006-12-08	ENSG00000142405	ENSG00000142405		"""Nucleotide-binding domain and leucine rich repeat containing"""	22938	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 12"""	609648	"""NACHT, leucine rich repeat and PYD containing 12"""	NALP12		12563287, 12019269	Standard	NM_001277129		Approved	RNO2, PYPAF7, Monarch1, PAN6, CLR19.3	uc002qcj.5	P59046	OTTHUMG00000060776	ENST00000324134.6:c.1932G>T	19.37:g.54312981C>A	ENSP00000319377:p.Lys644Asn		A8MTQ2|B3KTE7|Q8NEU4|Q9BY26	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.K644N	ENST00000324134.6	37	c.1932	CCDS12864.1	19	.	.	.	.	.	.	.	.	.	.	C	5.490	0.275450	0.10403	.	.	ENSG00000142405	ENST00000324134;ENST00000535162;ENST00000351894;ENST00000354278;ENST00000391775;ENST00000391773;ENST00000345770;ENST00000391772	D;D;D;D;D;D;D	0.91068	-2.78;-2.78;-2.78;-2.78;-2.78;-2.78;-2.78	4.05	0.401	0.16338	.	0.192717	0.25310	N	0.031586	D	0.83473	0.5262	L	0.53617	1.68	0.32180	N	0.580495	P;P;P;P	0.47191	0.747;0.747;0.891;0.679	B;B;B;B	0.37833	0.255;0.255;0.255;0.259	T	0.80044	-0.1547	10	0.36615	T	0.2	.	6.1624	0.20372	0.0:0.5282:0.3647:0.107	.	644;644;644;644	F2Z321;A8K407;A8MTQ2;P59046	.;.;.;NAL12_HUMAN	N	644	ENSP00000319377:K644N;ENSP00000438030:K644N;ENSP00000340473:K644N;ENSP00000346231:K644N;ENSP00000375655:K644N;ENSP00000375653:K644N;ENSP00000375652:K644N	ENSP00000319377:K644N	K	-	3	2	NLRP12	59004793	0.000000	0.05858	0.177000	0.23020	0.219000	0.24729	-0.491000	0.06474	-0.025000	0.13918	0.485000	0.47835	AAG	NLRP12	-	NULL	ENSG00000142405		0.592	NLRP12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NLRP12	HGNC	protein_coding	OTTHUMT00000134340.1	-	0.00	32	0	C	NM_144687		54312981	-1	tier1	-	no_errors	ENST00000324134	ensembl	human	known	74_37	missense	74.07	7	20	SNP	0.115	A
NOTCH1	4851	genome.wustl.edu	37	9	139413042	139413042	+	Splice_Site	SNP	C	C	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr9:139413042C>T	ENST00000277541.6	-	6	1175		c.e6+1		MIR4673_ENST00000584777.1_RNA	NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1						anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		AAGGCACTCACCTGTGCGGCC	0.657			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)																														Dom	yes		9	9q34.3	4851	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""		L	0													19.0	23.0	21.0					9																	139413042		2171	4280	6451	SO:0001630	splice_region_variant	0			AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.1099+1G>A	9.37:g.139413042C>T			Q59ED8|Q5SXM3	Splice_Site	SNP	-	e6+1	ENST00000277541.6	37	c.1099+1	CCDS43905.1	9	.	.	.	.	.	.	.	.	.	.	C	17.06	3.291297	0.59976	.	.	ENSG00000148400	ENST00000277541	.	.	.	4.88	4.88	0.63580	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.731	0.69383	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NOTCH1	138532863	1.000000	0.71417	0.944000	0.38274	0.567000	0.35839	7.013000	0.76373	2.257000	0.74773	0.561000	0.74099	.	NOTCH1	-	-	ENSG00000148400		0.657	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH1	HGNC	protein_coding	OTTHUMT00000055087.1	-	0.00	50	0	C	NM_017617	Intron	139413042	-1	tier1	-	no_errors	ENST00000277541	ensembl	human	known	74_37	splice_site	81.95	23	109	SNP	1.000	T
NPAS4	266743	genome.wustl.edu	37	11	66190167	66190167	+	Silent	SNP	C	C	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr11:66190167C>T	ENST00000311034.2	+	4	629	c.453C>T	c.(451-453)ttC>ttT	p.F151F		NM_178864.3	NP_849195.2	Q8IUM7	NPAS4_HUMAN	neuronal PAS domain protein 4	151					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(4)|endometrium(2)|kidney(3)|large_intestine(11)|liver(2)|lung(20)|ovary(1)|prostate(3)|skin(3)	49						GCTGCCGCTTCAACACCTCCA	0.557																																																	0													98.0	96.0	97.0					11																	66190167		2200	4295	6495	SO:0001819	synonymous_variant	0			AB049469	CCDS8138.1	11q13.2	2013-05-21			ENSG00000174576	ENSG00000174576		"""Basic helix-loop-helix proteins"""	18983	protein-coding gene	gene with protein product		608554				14701734	Standard	NM_178864		Approved	PASD10, NXF, Le-PAS, bHLHe79	uc001ohx.1	Q8IUM7	OTTHUMG00000167045	ENST00000311034.2:c.453C>T	11.37:g.66190167C>T			B7ZL81|Q8N8S5|Q8N9Q9	Silent	SNP	pfam_PAS_fold_3,superfamily_PAS,smart_PAS,pfscan_PAS	p.F151	ENST00000311034.2	37	c.453	CCDS8138.1	11																																																																																			NPAS4	-	superfamily_PAS	ENSG00000174576		0.557	NPAS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPAS4	HGNC	protein_coding	OTTHUMT00000392634.1	-	0.00	23	0	C	NM_178864		66190167	+1	tier1	-	no_errors	ENST00000311034	ensembl	human	known	74_37	silent	46.67	48	42	SNP	1.000	T
NPVF	64111	genome.wustl.edu	37	7	25266610	25266610	+	Missense_Mutation	SNP	A	A	C			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr7:25266610A>C	ENST00000222674.2	-	2	220	c.174T>G	c.(172-174)aaT>aaG	p.N58K		NM_022150.3	NP_071433	Q9HCQ7	NPVF_HUMAN	neuropeptide VF precursor	58					negative regulation of gonadotropin secretion (GO:0032277)|neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)				cervix(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|urinary_tract(1)	15						ATTCCTCAAAATTGAGGCTTC	0.368																																																	0													88.0	95.0	93.0					7																	25266610		2203	4300	6503	SO:0001583	missense	0			AB040290	CCDS5395.1	7p21-p15	2013-02-28	2006-10-06	2006-10-06	ENSG00000105954	ENSG00000105954		"""Endogenous ligands"""	13782	protein-coding gene	gene with protein product	"""RFamide-related peptide precursor"", ""FMRFamide-related peptide precursor"""		"""chromosome 7 open reading frame 9"""	C7orf9		11951088, 11173868	Standard	NM_022150		Approved	RFRP	uc003sxo.3	Q9HCQ7	OTTHUMG00000128509	ENST00000222674.2:c.174T>G	7.37:g.25266610A>C	ENSP00000222674:p.Asn58Lys		A4D164|Q7LE27|Q96PI9	Missense_Mutation	SNP	NULL	p.N58K	ENST00000222674.2	37	c.174	CCDS5395.1	7	.	.	.	.	.	.	.	.	.	.	A	9.881	1.201483	0.22121	.	.	ENSG00000105954	ENST00000222674	T	0.25912	1.77	5.67	3.29	0.37713	.	0.980375	0.08364	N	0.957198	T	0.30386	0.0763	M	0.65498	2.005	0.22701	N	0.998838	P	0.41848	0.763	B	0.39738	0.308	T	0.20306	-1.0279	10	0.59425	D	0.04	-11.0165	9.289	0.37775	0.8518:0.0:0.1482:0.0	.	58	Q9HCQ7	RFRP_HUMAN	K	58	ENSP00000222674:N58K	ENSP00000222674:N58K	N	-	3	2	NPVF	25233135	0.920000	0.31207	0.851000	0.33527	0.135000	0.20990	2.627000	0.46469	1.091000	0.41335	0.533000	0.62120	AAT	NPVF	-	NULL	ENSG00000105954		0.368	NPVF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPVF	HGNC	protein_coding	OTTHUMT00000250315.1	-	0.00	54	0	A	NM_022150		25266610	-1	tier1	-	no_errors	ENST00000222674	ensembl	human	known	74_37	missense	46.03	34	29	SNP	0.687	C
NTRK1	4914	genome.wustl.edu	37	1	156843511	156843511	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr1:156843511C>G	ENST00000524377.1	+	8	978	c.937C>G	c.(937-939)Ctg>Gtg	p.L313V	NTRK1_ENST00000368196.3_Missense_Mutation_p.L313V|NTRK1_ENST00000392302.2_Missense_Mutation_p.L283V|NTRK1_ENST00000358660.3_Missense_Mutation_p.L313V	NM_002529.3	NP_002520.2	P04629	NTRK1_HUMAN	neurotrophic tyrosine kinase, receptor, type 1	313	Ig-like C2-type 2.				activation of adenylate cyclase activity (GO:0007190)|activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|axon guidance (GO:0007411)|axonogenesis involved in innervation (GO:0060385)|B cell differentiation (GO:0030183)|cellular response to nerve growth factor stimulus (GO:1990090)|cellular response to nicotine (GO:0071316)|circadian rhythm (GO:0007623)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|developmental programmed cell death (GO:0010623)|learning or memory (GO:0007611)|mechanoreceptor differentiation (GO:0042490)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory nerve development (GO:0021553)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of angiogenesis (GO:0045766)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of programmed cell death (GO:0043068)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|response to activity (GO:0014823)|response to axon injury (GO:0048678)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|response to ethanol (GO:0045471)|response to hydrostatic pressure (GO:0051599)|response to nutrient levels (GO:0031667)|response to radiation (GO:0009314)|Sertoli cell development (GO:0060009)|small GTPase mediated signal transduction (GO:0007264)|sympathetic nervous system development (GO:0048485)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	axon (GO:0030424)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|early endosome (GO:0005769)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|nerve growth factor binding (GO:0048406)|nerve growth factor receptor activity (GO:0010465)|neurotrophin binding (GO:0043121)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(35)|ovary(8)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	74	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)				Amitriptyline(DB00321)|Imatinib(DB00619)|Regorafenib(DB08896)	GGCACCGTCTCTGCGCTGGCT	0.622			T	"""TPM3, TPR, TFG"""	papillary thyroid					TSP Lung(10;0.080)																														Dom	yes		1	1q21-q22	4914	"""neurotrophic tyrosine kinase, receptor, type 1"""		E	0													27.0	24.0	25.0					1																	156843511		2203	4300	6503	SO:0001583	missense	0			Y09028	CCDS1161.1, CCDS30890.1, CCDS30891.1	1q21-q22	2014-09-17			ENSG00000198400	ENSG00000198400	2.7.10.1	"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	8031	protein-coding gene	gene with protein product	"""high affinity nerve growth factor receptor"""	191315				2869410	Standard	NM_001007792		Approved	TRK, TRKA, MTC	uc001fqh.1	P04629	OTTHUMG00000041304	ENST00000524377.1:c.937C>G	1.37:g.156843511C>G	ENSP00000431418:p.Leu313Val		B2R6T5|B7ZM34|P08119|Q15655|Q15656|Q5D056|Q5VZS2|Q7Z5C3|Q9UIU7	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Cys-rich_flank_reg_C,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_Tyr_kinase_neurotrophic_rcpt_1,prints_Tyr_kinase_NGF_rcpt	p.L313V	ENST00000524377.1	37	c.937	CCDS1161.1	1	.	.	.	.	.	.	.	.	.	.	C	14.38	2.516938	0.44763	.	.	ENSG00000198400	ENST00000392302;ENST00000368196;ENST00000524377;ENST00000358660	T;T;T;T	0.25414	1.8;1.8;1.8;1.8	6.17	6.17	0.99709	Immunoglobulin-like fold (1);	0.142985	0.32343	N	0.006236	T	0.22627	0.0546	L	0.55103	1.725	0.36634	D	0.876446	P;B;P;B	0.47409	0.824;0.29;0.895;0.116	P;B;B;B	0.47162	0.54;0.082;0.358;0.062	T	0.02539	-1.1144	10	0.72032	D	0.01	.	13.0331	0.58854	0.2479:0.7521:0.0:0.0	.	313;313;313;283	A8K3Z4;P04629-2;P04629;A6NF12	.;.;NTRK1_HUMAN;.	V	283;313;313;313	ENSP00000376120:L283V;ENSP00000357179:L313V;ENSP00000431418:L313V;ENSP00000351486:L313V	ENSP00000351486:L313V	L	+	1	2	NTRK1	155110135	0.024000	0.19004	0.975000	0.42487	0.859000	0.49053	0.332000	0.19751	2.941000	0.99782	0.655000	0.94253	CTG	NTRK1	-	NULL	ENSG00000198400		0.622	NTRK1-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NTRK1	HGNC	protein_coding	OTTHUMT00000392279.1	-	0.00	28	0	C	NM_002529		156843511	+1	tier1	-	no_errors	ENST00000524377	ensembl	human	known	74_37	missense	38.78	30	19	SNP	0.725	G
NUDT12	83594	genome.wustl.edu	37	5	102895755	102895755	+	Frame_Shift_Del	DEL	C	C	-			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr5:102895755delC	ENST00000230792.2	-	2	291	c.195delG	c.(193-195)ctgfs	p.L66fs	NUDT12_ENST00000507423.1_Intron	NM_031438.2	NP_113626.1	Q9BQG2	NUD12_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 12	66					NAD catabolic process (GO:0019677)|NADP catabolic process (GO:0006742)	nucleus (GO:0005634)|peroxisome (GO:0005777)	metal ion binding (GO:0046872)|NAD+ diphosphatase activity (GO:0000210)|NADH pyrophosphatase activity (GO:0035529)			endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(6)|urinary_tract(1)	12		all_cancers(142;6.38e-08)|all_epithelial(76;1.99e-10)|Prostate(80;0.0138)|Lung NSC(167;0.0212)|Colorectal(57;0.0247)|all_lung(232;0.0283)|Ovarian(225;0.0423)		Epithelial(69;9.3e-13)|COAD - Colon adenocarcinoma(37;0.0221)		CTTTCTCAAGCAGAAATTGGA	0.373																																																	0													111.0	106.0	108.0					5																	102895755		2202	4300	6502	SO:0001589	frameshift_variant	0			AL136592	CCDS4096.1, CCDS75284.1	5q15	2013-01-10			ENSG00000112874	ENSG00000112874		"""Nudix motif containing"", ""Ankyrin repeat domain containing"""	18826	protein-coding gene	gene with protein product	"""nucleoside diphosphate linked moiety X-type motif 12"""	609232				11230166	Standard	XM_005272095		Approved	DKFZP761I172	uc003koi.3	Q9BQG2	OTTHUMG00000128739	ENST00000230792.2:c.195delG	5.37:g.102895755delC	ENSP00000230792:p.Leu66fs		B3KUW2|Q8TAL7	Frame_Shift_Del	DEL	pfam_NUDIX_hydrolase_dom,pfam_Ankyrin_rpt,pfam_Znr_NADH_PPase,pfam_NADH_PPase-like_N,superfamily_NUDIX_hydrolase_dom-like,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.E67fs	ENST00000230792.2	37	c.195	CCDS4096.1	5																																																																																			NUDT12	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000112874		0.373	NUDT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUDT12	HGNC	protein_coding	OTTHUMT00000250650.1		0.00	72	0	C	NM_031438		102895755	-1	tier1		no_errors	ENST00000230792	ensembl	human	known	74_37	frame_shift_del	41.23	67	47	DEL	0.997	-
NXF5	55998	genome.wustl.edu	37	X	101095814	101095814	+	Silent	SNP	A	A	G			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chrX:101095814A>G	ENST00000361708.2	-	9	893	c.534T>C	c.(532-534)tcT>tcC	p.S178S	NXF5_ENST00000473265.2_Silent_p.S178S|NXF5_ENST00000537026.1_Silent_p.S178S			Q9H1B4	NXF5_HUMAN	nuclear RNA export factor 5	178					mRNA export from nucleus (GO:0006406)|multicellular organismal development (GO:0007275)|RNA transport (GO:0050658)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(2)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(16)|skin(1)	30						CTGTAATGTCAGAAAGGCCAT	0.488																																																	0													82.0	71.0	75.0					X																	101095814		2202	4298	6500	SO:0001819	synonymous_variant	0			AJ277654	CCDS14491.1, CCDS14491.2	Xq22	2008-07-28			ENSG00000126952	ENSG00000126952			8075	protein-coding gene	gene with protein product		300319				11566096	Standard	NM_032946		Approved		uc011mrk.1	Q9H1B4	OTTHUMG00000022042	ENST00000361708.2:c.534T>C	X.37:g.101095814A>G			A2RRM0|B1AV82|B1AV83|B1AV84|B1AV85|Q9H1B0|Q9H1B1|Q9H1B2|Q9H1B3	Silent	SNP	pfam_Tap_RNA-bd	p.S178	ENST00000361708.2	37	c.534		X																																																																																			NXF5	-	NULL	ENSG00000126952		0.488	NXF5-201	KNOWN	basic	protein_coding	NXF5	HGNC	protein_coding		-	0.00	201	0	A			101095814	-1	tier1	-	no_errors	ENST00000263032	ensembl	human	known	74_37	silent	40.23	159	107	SNP	0.986	G
OR2M3	127062	genome.wustl.edu	37	1	248367307	248367307	+	Nonstop_Mutation	SNP	G	G	C			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr1:248367307G>C	ENST00000456743.1	+	1	976	c.938G>C	c.(937-939)tGa>tCa	p.*313S		NM_001004689.1	NP_001004689.1	Q8NG83	OR2M3_HUMAN	olfactory receptor, family 2, subfamily M, member 3	0						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(6)|large_intestine(4)|lung(33)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	50	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			TCTGGAGAGTGAGTTACCTAA	0.408																																																	0													98.0	94.0	96.0					1																	248367307		2203	4300	6503	SO:0001578	stop_lost	0				CCDS31107.1	1q44	2012-08-09		2004-03-10	ENSG00000228198	ENSG00000228198		"""GPCR / Class A : Olfactory receptors"""	8269	protein-coding gene	gene with protein product				OR2M6, OR2M3P			Standard	NM_001004689		Approved	OST003	uc010pzg.2	Q8NG83	OTTHUMG00000040459	ENST00000456743.1:c.938G>C	1.37:g.248367307G>C	ENSP00000389625:p.*313Serext*3		B9EH06|Q6IEY0	Nonstop_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.*313S	ENST00000456743.1	37	c.938	CCDS31107.1	1	.	.	.	.	.	.	.	.	.	.	g	0.016	-1.514881	0.00975	.	.	ENSG00000228198	ENST00000456743	.	.	.	2.2	-3.39	0.04868	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.9228	0.13878	0.3232:0.1716:0.5052:0.0	.	.	.	.	S	313	.	.	X	+	2	2	OR2M3	246433930	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.016000	0.12613	-0.589000	0.05874	-0.321000	0.08615	TGA	OR2M3	-	NULL	ENSG00000228198		0.408	OR2M3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2M3	HGNC	protein_coding	OTTHUMT00000097355.1	-	0.00	48	0	G	NM_001004689		248367307	+1	tier1	-	no_errors	ENST00000456743	ensembl	human	known	74_37	nonstop	49.58	60	59	SNP	0.000	C
OR51G1	79324	genome.wustl.edu	37	11	4944691	4944691	+	Silent	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr11:4944691G>T	ENST00000321961.2	-	1	946	c.879C>A	c.(877-879)atC>atA	p.I293I	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001005237.1	NP_001005237.1	Q8NGK1	O51G1_HUMAN	olfactory receptor, family 51, subfamily G, member 1	293						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(3)|skin(4)|soft_tissue(1)	25		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.58e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		TGATGCTGTAGATGATGGGGT	0.433																																																	0													169.0	155.0	160.0					11																	4944691		2201	4298	6499	SO:0001819	synonymous_variant	0			AB065793	CCDS31366.1	11p15.4	2012-08-09			ENSG00000176879	ENSG00000176879		"""GPCR / Class A : Olfactory receptors"""	14738	protein-coding gene	gene with protein product				OR51G3P			Standard	NM_001005237		Approved		uc010qyr.2	Q8NGK1	OTTHUMG00000066532	ENST00000321961.2:c.879C>A	11.37:g.4944691G>T			B9EGW8|Q6IFH6	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.I293	ENST00000321961.2	37	c.879	CCDS31366.1	11																																																																																			OR51G1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	ENSG00000176879		0.433	OR51G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51G1	HGNC	protein_coding	OTTHUMT00000142345.1		0.00	74	0	G	NM_001005237		4944691	-1			no_errors	ENST00000321961	ensembl	human	known	74_37	silent	5.00	76	4	SNP	0.994	T
OTOG	340990	genome.wustl.edu	37	11	17650754	17650754	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr11:17650754G>A	ENST00000399391.2	+	39	6639	c.6639G>A	c.(6637-6639)atG>atA	p.M2213I	OTOG_ENST00000342528.2_Missense_Mutation_p.M1219I|OTOG_ENST00000399397.1_Missense_Mutation_p.M2140I	NM_001277269.1	NP_001264198.1	Q6ZRI0	OTOG_HUMAN	otogelin	2213	VWFD 4. {ECO:0000255|PROSITE- ProRule:PRU00580}.				adult locomotory behavior (GO:0008344)|L-arabinose metabolic process (GO:0046373)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	alpha-L-arabinofuranosidase activity (GO:0046556)|structural molecule activity (GO:0005198)			breast(3)|central_nervous_system(1)|lung(1)|skin(1)	6						CAGGCCACATGTACATGATCC	0.562																																																	0																																										SO:0001583	missense	0			AK128214	CCDS59225.1	11p14.3	2014-07-17			ENSG00000188162	ENSG00000188162			8516	protein-coding gene	gene with protein product		604487				9405633	Standard	NM_001277269		Approved	mlemp, OTGN, FLJ46346	uc031pzc.1	Q6ZRI0	OTTHUMG00000149905	ENST00000399391.2:c.6639G>A	11.37:g.17650754G>A	ENSP00000382323:p.Met2213Ile		A8MTX6|A8MUJ0|B7WPC4	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_AbfB,pfam_TIL_dom,superfamily_AbfB,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_EG-like_dom	p.M2213I	ENST00000399391.2	37	c.6639	CCDS59225.1	11	.	.	.	.	.	.	.	.	.	.	G	19.92	3.915785	0.73098	.	.	ENSG00000188162	ENST00000399391;ENST00000399397;ENST00000342528	T;T;T	0.58940	0.3;0.3;0.3	5.58	5.58	0.84498	.	0.050713	0.85682	D	0.000000	T	0.61961	0.2389	M	0.80422	2.495	0.58432	D	0.999997	B	0.33694	0.421	B	0.33690	0.168	T	0.61013	-0.7148	10	0.23891	T	0.37	.	18.3457	0.90321	0.0:0.0:1.0:0.0	.	1219	Q6ZRI0-2	.	I	2213;2140;1219	ENSP00000382323:M2213I;ENSP00000382329:M2140I;ENSP00000341666:M1219I	ENSP00000341666:M1219I	M	+	3	0	OTOG	17607330	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	8.699000	0.91316	2.611000	0.88343	0.655000	0.94253	ATG	OTOG	-	pfam_VWF_type-D,smart_VWF_type-D	ENSG00000188162		0.562	OTOG-201	KNOWN	basic|appris_principal|CCDS	protein_coding	OTOG	HGNC	protein_coding		-	0.00	40	0	G			17650754	+1	tier1	-	no_errors	ENST00000399391	ensembl	human	known	74_37	missense	48.57	18	17	SNP	1.000	A
PACS1	55690	genome.wustl.edu	37	11	66010644	66010644	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr11:66010644G>A	ENST00000320580.4	+	24	2818	c.2785G>A	c.(2785-2787)Gat>Aat	p.D929N	PACS1_ENST00000524815.1_Missense_Mutation_p.D57N|PACS1_ENST00000529757.1_Missense_Mutation_p.D465N|RP11-755F10.1_ENST00000531086.1_RNA	NM_018026.3	NP_060496.2	Q6VY07	PACS1_HUMAN	phosphofurin acidic cluster sorting protein 1	929					protein targeting to Golgi (GO:0000042)|protein targeting to plasma membrane (GO:0072661)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	COPI-coated vesicle (GO:0030137)|cytosol (GO:0005829)	ion channel binding (GO:0044325)		RBM14/PACS1(2)	breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(8)|ovary(6)|skin(2)|urinary_tract(1)	37						AGTGTCCATCGATGGGGTCGA	0.612																																																	0													98.0	77.0	84.0					11																	66010644		2200	4294	6494	SO:0001583	missense	0			AB033001	CCDS8129.1	11q13.1-q13.2	2008-02-05			ENSG00000175115	ENSG00000175115			30032	protein-coding gene	gene with protein product		607492				12855553, 14608369	Standard	NM_018026		Approved	FLJ10209, KIAA1175	uc001oha.2	Q6VY07	OTTHUMG00000166889	ENST00000320580.4:c.2785G>A	11.37:g.66010644G>A	ENSP00000316454:p.Asp929Asn		Q6PJY6|Q6PKB6|Q7Z590|Q7Z5W4|Q8N8K6|Q96MW0|Q9NW92|Q9ULP5	Missense_Mutation	SNP	pfam_Phosphofurin_acidic_CS-1	p.D929N	ENST00000320580.4	37	c.2785	CCDS8129.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	35|35	5.479046|5.479046	0.96307|0.96307	.|.	.|.	ENSG00000175115|ENSG00000175115	ENST00000320580;ENST00000529757;ENST00000524815;ENST00000531597|ENST00000529677	T;T;T;T|.	0.63255|.	-0.03;-0.03;-0.03;-0.03|.	4.78|4.78	4.78|4.78	0.61160|0.61160	.|.	0.104254|.	0.64402|.	D|.	0.000005|.	T|T	0.78521|0.78521	0.4296|0.4296	M|M	0.84219|0.84219	2.685|2.685	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.91635|.	0.999|.	T|T	0.80899|0.80899	-0.1176|-0.1176	10|5	0.87932|.	D|.	0|.	-1.8911|-1.8911	16.7348|16.7348	0.85444|0.85444	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	929|.	Q6VY07|.	PACS1_HUMAN|.	N|Q	929;465;57;57|72	ENSP00000316454:D929N;ENSP00000432858:D465N;ENSP00000433991:D57N;ENSP00000434012:D57N|.	ENSP00000316454:D929N|.	D|R	+|+	1|2	0|0	PACS1|PACS1	65767220|65767220	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	9.651000|9.651000	0.98493|0.98493	2.480000|2.480000	0.83734|0.83734	0.561000|0.561000	0.74099|0.74099	GAT|CGA	PACS1	-	pfam_Phosphofurin_acidic_CS-1	ENSG00000175115		0.612	PACS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PACS1	HGNC	protein_coding	OTTHUMT00000391690.2	-	0.00	40	0	G	NM_018026		66010644	+1	tier1	-	no_errors	ENST00000320580	ensembl	human	known	74_37	missense	46.97	35	31	SNP	1.000	A
PAPOLB	56903	genome.wustl.edu	37	7	4899602	4899602	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr7:4899602C>G	ENST00000404991.1	-	1	2023	c.1837G>C	c.(1837-1839)Gtt>Ctt	p.V613L	RADIL_ENST00000536091.1_Intron|RADIL_ENST00000399583.3_Intron	NM_020144.4	NP_064529.4	Q9NRJ5	PAPOB_HUMAN	poly(A) polymerase beta (testis specific)	613					mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|polynucleotide adenylyltransferase activity (GO:0004652)|RNA binding (GO:0003723)			kidney(1)|large_intestine(6)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	14		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.089)|OV - Ovarian serous cystadenocarcinoma(56;2.06e-14)		GAAGAAACAACTCTGGCGACC	0.438																																																	0													81.0	85.0	84.0					7																	4899602		2141	4275	6416	SO:0001583	missense	0			AF218840		7p22.1	2008-02-08			ENSG00000218823	ENSG00000218823	2.7.7.19		15970	protein-coding gene	gene with protein product		607436				11150526	Standard	NM_020144		Approved	PAPT	uc003snk.3	Q9NRJ5	OTTHUMG00000151759	ENST00000404991.1:c.1837G>C	7.37:g.4899602C>G	ENSP00000384700:p.Val613Leu		Q75LH1|Q8NE14	Missense_Mutation	SNP	pfam_PolA_pol_cen_dom,pfam_PolA_pol_RNA-bd_dom,pfam_Nucleotidyltransferase,superfamily_NuclTrfase_I_C,pirsf_PolyA_polymerase	p.V613L	ENST00000404991.1	37	c.1837		7	.	.	.	.	.	.	.	.	.	.	C	9.082	0.999648	0.19121	.	.	ENSG00000218823	ENST00000404991	.	.	.	4.38	3.49	0.39957	.	.	.	.	.	T	0.36110	0.0955	L	0.32530	0.975	0.27827	N	0.941571	B	0.12630	0.006	B	0.14578	0.011	T	0.17930	-1.0353	8	0.19590	T	0.45	.	12.6468	0.56740	0.0:0.8318:0.1682:0.0	.	614	A4D1Z6	.	L	613	.	ENSP00000384700:V613L	V	-	1	0	PAPOLB	4866128	1.000000	0.71417	0.975000	0.42487	0.451000	0.32288	1.422000	0.34826	1.416000	0.47057	0.591000	0.81541	GTT	PAPOLB	-	pirsf_PolyA_polymerase	ENSG00000218823		0.438	PAPOLB-001	KNOWN	basic|appris_principal	protein_coding	PAPOLB	HGNC	protein_coding	OTTHUMT00000323797.1	-	0.00	78	0	C	NM_020144		4899602	-1	tier1	-	no_errors	ENST00000404991	ensembl	human	known	74_37	missense	8.04	103	9	SNP	0.998	G
PCLO	27445	genome.wustl.edu	37	7	82474678	82474678	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr7:82474678G>A	ENST00000333891.9	-	13	14292	c.13955C>T	c.(13954-13956)tCa>tTa	p.S4652L	PCLO_ENST00000423517.2_Missense_Mutation_p.S4652L|PCLO_ENST00000426442.2_5'UTR	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TGTAGGACCTGAATGAACATG	0.517																																																	0													89.0	88.0	89.0					7																	82474678		1997	4168	6165	SO:0001583	missense	0			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.13955C>T	7.37:g.82474678G>A	ENSP00000334319:p.Ser4652Leu			Missense_Mutation	SNP	pfam_Znf_piccolo,pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_PDZ,superfamily_Znf_FYVE_PHD,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ	p.S4652L	ENST00000333891.9	37	c.13955	CCDS47630.1	7	.	.	.	.	.	.	.	.	.	.	G	17.97	3.517355	0.64634	.	.	ENSG00000186472	ENST00000333891;ENST00000423517;ENST00000380195	T;T	0.17854	2.25;2.25	5.64	5.64	0.86602	.	.	.	.	.	T	0.40171	0.1106	L	0.51422	1.61	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.989;0.981	D;D;D;D	0.87578	0.998;0.998;0.985;0.966	T	0.06162	-1.0842	9	0.87932	D	0	.	20.0625	0.97681	0.0:0.0:1.0:0.0	.	4652;4652;82;149	Q9Y6V0-5;Q9Y6V0-6;Q9Y6V0-3;Q32P40	.;.;.;.	L	4652;4652;148	ENSP00000334319:S4652L;ENSP00000388393:S4652L	ENSP00000334319:S4652L	S	-	2	0	PCLO	82312614	1.000000	0.71417	0.965000	0.40720	0.995000	0.86356	5.464000	0.66719	2.816000	0.96949	0.561000	0.74099	TCA	PCLO	-	NULL	ENSG00000186472		0.517	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	HGNC	protein_coding	OTTHUMT00000337368.5	-	0.00	81	0	G	NM_014510		82474678	-1	tier1	-	no_errors	ENST00000333891	ensembl	human	known	74_37	missense	6.10	77	5	SNP	1.000	A
PCLO	27445	genome.wustl.edu	37	7	82544508	82544508	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr7:82544508C>G	ENST00000333891.9	-	7	13131	c.12794G>C	c.(12793-12795)gGc>gCc	p.G4265A	PCLO_ENST00000423517.2_Missense_Mutation_p.G4265A|PCLO_ENST00000437081.1_Missense_Mutation_p.G985A	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TCCTAATGTGCCCAGTCCTGT	0.478																																																	0													21.0	22.0	21.0					7																	82544508		1937	4148	6085	SO:0001583	missense	0			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.12794G>C	7.37:g.82544508C>G	ENSP00000334319:p.Gly4265Ala			Missense_Mutation	SNP	pfam_Znf_piccolo,pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_PDZ,superfamily_Znf_FYVE_PHD,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ	p.G4265A	ENST00000333891.9	37	c.12794	CCDS47630.1	7	.	.	.	.	.	.	.	.	.	.	C	6.515	0.463286	0.12402	.	.	ENSG00000186472	ENST00000333891;ENST00000423517;ENST00000437081	T;T	0.16897	2.31;2.31	6.03	6.03	0.97812	.	.	.	.	.	T	0.23766	0.0575	L	0.32530	0.975	0.32157	N	0.583435	P;P;P	0.51537	0.595;0.946;0.946	B;P;P	0.48840	0.192;0.592;0.592	T	0.02901	-1.1096	9	0.87932	D	0	.	18.7558	0.91832	0.0:1.0:0.0:0.0	.	4196;4265;4265	Q9Y6V0;Q9Y6V0-5;Q9Y6V0-6	PCLO_HUMAN;.;.	A	4265;4265;985	ENSP00000334319:G4265A;ENSP00000388393:G4265A	ENSP00000334319:G4265A	G	-	2	0	PCLO	82382444	1.000000	0.71417	0.997000	0.53966	0.908000	0.53690	4.751000	0.62169	2.868000	0.98415	0.557000	0.71058	GGC	PCLO	-	NULL	ENSG00000186472		0.478	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	HGNC	protein_coding	OTTHUMT00000337368.5	-	0.00	43	0	C	NM_014510		82544508	-1	tier1	-	no_errors	ENST00000333891	ensembl	human	known	74_37	missense	21.05	60	16	SNP	1.000	G
PCLO	27445	genome.wustl.edu	37	7	82585180	82585180	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr7:82585180G>C	ENST00000333891.9	-	5	5426	c.5089C>G	c.(5089-5091)Cca>Gca	p.P1697A	PCLO_ENST00000423517.2_Missense_Mutation_p.P1697A	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TCCAATTCTGGCTCTTCGTCA	0.428																																																	0													99.0	90.0	93.0					7																	82585180		1865	4099	5964	SO:0001583	missense	0			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.5089C>G	7.37:g.82585180G>C	ENSP00000334319:p.Pro1697Ala			Missense_Mutation	SNP	pfam_Znf_piccolo,pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_PDZ,superfamily_Znf_FYVE_PHD,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ	p.P1697A	ENST00000333891.9	37	c.5089	CCDS47630.1	7	.	.	.	.	.	.	.	.	.	.	G	12.06	1.824197	0.32237	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.26223	1.75;1.77	5.56	5.56	0.83823	.	.	.	.	.	T	0.54647	0.1871	M	0.73962	2.25	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.57069	-0.7874	9	0.87932	D	0	.	19.5248	0.95199	0.0:0.0:1.0:0.0	.	1697;1697	Q9Y6V0-5;Q9Y6V0-6	.;.	A	1628;1697;1697	ENSP00000334319:P1697A;ENSP00000388393:P1697A	ENSP00000334319:P1697A	P	-	1	0	PCLO	82423116	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.454000	0.90352	2.624000	0.88883	0.650000	0.86243	CCA	PCLO	-	NULL	ENSG00000186472		0.428	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	HGNC	protein_coding	OTTHUMT00000337368.5	-	0.00	38	0	G	NM_014510		82585180	-1	tier1	-	no_errors	ENST00000333891	ensembl	human	known	74_37	missense	28.81	42	17	SNP	1.000	C
PCSK6	5046	genome.wustl.edu	37	15	101910603	101910603	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr15:101910603C>T	ENST00000348070.1	-	13	1654	c.1655G>A	c.(1654-1656)cGa>cAa	p.R552Q	PCSK6_ENST00000561177.1_5'UTR|PCSK6_ENST00000331826.7_Missense_Mutation_p.R387Q|PCSK6_ENST00000358417.3_Missense_Mutation_p.R552Q|PCSK6_ENST00000398181.2_Missense_Mutation_p.R552Q|PCSK6_ENST00000344273.2_Missense_Mutation_p.R552Q	NM_002570.3|NM_138320.1	NP_002561.1|NP_612193.1	P29122	PCSK6_HUMAN	proprotein convertase subtilisin/kexin type 6	553					determination of left/right symmetry (GO:0007368)|glycoprotein metabolic process (GO:0009100)|nerve growth factor processing (GO:0032455)|nerve growth factor production (GO:0032902)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|regulation of BMP signaling pathway (GO:0030510)|secretion by cell (GO:0032940)|zygotic determination of anterior/posterior axis, embryo (GO:0007354)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|heparin binding (GO:0008201)|nerve growth factor binding (GO:0048406)|serine-type endopeptidase activity (GO:0004252)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(17)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Lung NSC(78;0.00102)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000803)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			GAGGTCTCCTCGGCGTGGGTG	0.637																																																	0													38.0	44.0	42.0					15																	101910603		1977	4093	6070	SO:0001583	missense	0				CCDS73789.1, CCDS73790.1, CCDS73791.1, CCDS73792.1, CCDS73793.1	15q26	2008-07-18	2004-06-14	2004-06-16		ENSG00000140479			8569	protein-coding gene	gene with protein product	"""subtilisin-like protease"", ""subtilisin-like proprotein convertase 4"", ""subtilisin/kexin-like protease PACE4"""	167405	"""paired basic amino acid cleaving system 4"""	PACE4		1741956	Standard	NM_002570		Approved	SPC4	uc002bwy.3	P29122		ENST00000348070.1:c.1655G>A	15.37:g.101910603C>T	ENSP00000305056:p.Arg552Gln		Q15099|Q15100|Q9UEG7|Q9UEJ1|Q9UEJ2|Q9UEJ7|Q9UEJ8|Q9UEJ9|Q9Y4G9|Q9Y4H0|Q9Y4H1	Missense_Mutation	SNP	pfam_Peptidase_S8/S53_dom,pfam_PrprotnconvertsP,pfam_PLAC,superfamily_Peptidase_S8/S53_dom,superfamily_Galactose-bd-like,superfamily_Growth_fac_rcpt_N_dom,superfamily_Prot_inh_propept,smart_Furin_repeat,smart_EG-like_dom,pfscan_PLAC,prints_Peptidase_S8_subtilisin-rel	p.R552Q	ENST00000348070.1	37	c.1655		15	.	.	.	.	.	.	.	.	.	.	C	34	5.404314	0.96051	.	.	ENSG00000140479	ENST00000348070;ENST00000358417;ENST00000398185;ENST00000344273;ENST00000398181;ENST00000331826	T;T;T;T;T	0.80653	-1.4;-1.4;-1.4;-1.4;-1.4	5.3	5.3	0.74995	Proprotein convertase, P (1);Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	D	0.92990	0.7769	H	0.95679	3.705	0.58432	D	0.999999	D;D;D;D;D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D	0.91635	0.956;0.994;0.997;0.999;0.999;0.999;0.998;0.997;0.999	D	0.94923	0.8075	10	0.87932	D	0	-24.3465	17.9357	0.89011	0.0:1.0:0.0:0.0	.	553;384;553;553;552;552;553;553;552	P29122;Q59H04;P29122-2;P29122-4;E7EWH5;E7EQ62;P29122-8;P29122-7;E7EM82	PCSK6_HUMAN;.;.;.;.;.;.;.;.	Q	552;552;383;552;552;387	ENSP00000305056:R552Q;ENSP00000351193:R552Q;ENSP00000344410:R552Q;ENSP00000381243:R552Q;ENSP00000332052:R387Q	ENSP00000332052:R387Q	R	-	2	0	PCSK6	99728126	1.000000	0.71417	0.705000	0.30386	0.856000	0.48823	7.208000	0.77907	2.475000	0.83589	0.561000	0.74099	CGA	PCSK6	-	pfam_PrprotnconvertsP,superfamily_Galactose-bd-like	ENSG00000140479		0.637	PCSK6-203	KNOWN	basic|appris_candidate_longest	protein_coding	PCSK6	HGNC	protein_coding		-	0.00	43	0	C	NM_002570		101910603	-1	tier1	-	no_errors	ENST00000348070	ensembl	human	known	74_37	missense	38.71	38	24	SNP	0.997	T
PDE3A	5139	genome.wustl.edu	37	12	20786713	20786713	+	Splice_Site	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr12:20786713G>T	ENST00000359062.3	+	7	1886		c.e7+1		PDE3A_ENST00000544307.1_Splice_Site	NM_000921.4|NM_001244683.1	NP_000912.3|NP_001231612.1	Q14432	PDE3A_HUMAN	phosphodiesterase 3A, cGMP-inhibited						blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cGMP (GO:0071321)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cGMP-mediated signaling (GO:0019934)|diterpenoid metabolic process (GO:0016101)|lipid metabolic process (GO:0006629)|negative regulation of apoptotic process (GO:0043066)|negative regulation of vascular permeability (GO:0043116)|oocyte maturation (GO:0001556)|positive regulation of oocyte development (GO:0060282)|positive regulation of vascular permeability (GO:0043117)|regulation of meiosis (GO:0040020)|response to cAMP (GO:0051591)|response to drug (GO:0042493)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity (GO:0004119)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(7)|lung(29)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	58	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Caffeine(DB00201)|Cilostazol(DB01166)|Enoximone(DB04880)|Ibudilast(DB05266)|Levosimendan(DB00922)|Milrinone(DB00235)|Oxtriphylline(DB01303)|Theophylline(DB00277)|Tofisopam(DB08811)	AGTAGAACAGGTAATTCATTG	0.428																																																	0													64.0	61.0	62.0					12																	20786713		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS31754.1	12p12.2	2011-04-15			ENSG00000172572	ENSG00000172572	3.1.4.17	"""Phosphodiesterases"""	8778	protein-coding gene	gene with protein product		123805				1315035, 10679291	Standard	NM_000921		Approved	CGI-PDE	uc001reh.2	Q14432	OTTHUMG00000168962	ENST00000359062.3:c.1846+1G>T	12.37:g.20786713G>T			O60865|Q13348|Q17RD1	Splice_Site	SNP	-	e7+1	ENST00000359062.3	37	c.1846+1	CCDS31754.1	12	.	.	.	.	.	.	.	.	.	.	G	20.6	4.014148	0.75161	.	.	ENSG00000172572	ENST00000359062	.	.	.	5.89	5.89	0.94794	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.0454	0.89330	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PDE3A	20677980	1.000000	0.71417	1.000000	0.80357	0.858000	0.48976	6.630000	0.74272	2.793000	0.96121	0.650000	0.86243	.	PDE3A	-	-	ENSG00000172572		0.428	PDE3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE3A	HGNC	protein_coding	OTTHUMT00000401756.2	-	0.00	92	0	G		Intron	20786713	+1	tier1	-	no_errors	ENST00000359062	ensembl	human	known	74_37	splice_site	6.49	72	5	SNP	1.000	T
PEX3	8504	genome.wustl.edu	37	6	143800253	143800253	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr6:143800253G>T	ENST00000367591.4	+	10	922	c.859G>T	c.(859-861)Ggt>Tgt	p.G287C		NM_003630.2	NP_003621.1	P56589	PEX3_HUMAN	peroxisomal biogenesis factor 3	287					peroxisome membrane biogenesis (GO:0016557)|peroxisome organization (GO:0007031)|protein import into peroxisome membrane (GO:0045046)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of peroxisomal membrane (GO:0005779)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)|protein complex (GO:0043234)|protein-lipid complex (GO:0032994)	lipid binding (GO:0008289)|protein dimerization activity (GO:0046983)			endometrium(1)|large_intestine(9)|lung(4)|ovary(2)|skin(2)	18				OV - Ovarian serous cystadenocarcinoma(155;5.73e-06)|GBM - Glioblastoma multiforme(68;0.0117)		TTTAAACCGAGGTTTTAGTAG	0.333																																																	0													95.0	93.0	94.0					6																	143800253		2203	4300	6503	SO:0001583	missense	0			AJ001625	CCDS5199.1	6q24.2	2008-05-15			ENSG00000034693	ENSG00000034693			8858	protein-coding gene	gene with protein product		603164				9657383	Standard	NM_003630		Approved		uc003qjl.3	P56589	OTTHUMG00000015730	ENST00000367591.4:c.859G>T	6.37:g.143800253G>T	ENSP00000356563:p.Gly287Cys		Q6FGP5	Missense_Mutation	SNP	pfam_Peroxin-3	p.G287C	ENST00000367591.4	37	c.859	CCDS5199.1	6	.	.	.	.	.	.	.	.	.	.	G	26.9	4.777511	0.90195	.	.	ENSG00000034693	ENST00000367591	T	0.47528	0.84	5.86	5.86	0.93980	.	0.047618	0.85682	D	0.000000	T	0.65616	0.2708	M	0.74258	2.255	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.59511	-0.7441	10	0.38643	T	0.18	-16.208	20.5632	0.99335	0.0:0.0:1.0:0.0	.	287	P56589	PEX3_HUMAN	C	287	ENSP00000356563:G287C	ENSP00000356563:G287C	G	+	1	0	PEX3	143841946	1.000000	0.71417	0.986000	0.45419	0.997000	0.91878	8.699000	0.91316	2.937000	0.99478	0.650000	0.86243	GGT	PEX3	-	pfam_Peroxin-3	ENSG00000034693		0.333	PEX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEX3	HGNC	protein_coding	OTTHUMT00000042525.1	-	0.00	67	0	G			143800253	+1	tier1	-	no_errors	ENST00000367591	ensembl	human	known	74_37	missense	5.71	66	4	SNP	1.000	T
PEX5	5830	genome.wustl.edu	37	12	7344176	7344176	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr12:7344176G>A	ENST00000455147.2	+	6	908	c.328G>A	c.(328-330)Gca>Aca	p.A110T	PEX5_ENST00000434354.2_Missense_Mutation_p.A125T|PEX5_ENST00000545220.1_3'UTR|PEX5_ENST00000266564.3_Missense_Mutation_p.A110T|PEX5_ENST00000266563.5_Missense_Mutation_p.A110T|RP11-273B20.3_ENST00000543061.1_RNA|PEX5_ENST00000420616.2_Missense_Mutation_p.A110T|PEX5_ENST00000412720.2_Missense_Mutation_p.A131T|RP11-273B20.3_ENST00000545794.1_RNA	NM_001131026.1	NP_001124498.1	P50542	PEX5_HUMAN	peroxisomal biogenesis factor 5	110					cell development (GO:0048468)|cerebral cortex cell migration (GO:0021795)|cerebral cortex neuron differentiation (GO:0021895)|endoplasmic reticulum organization (GO:0007029)|fatty acid beta-oxidation (GO:0006635)|mitochondrial membrane organization (GO:0007006)|negative regulation of protein homotetramerization (GO:1901094)|neuromuscular process (GO:0050905)|neuron migration (GO:0001764)|positive regulation of multicellular organism growth (GO:0040018)|protein import into peroxisome matrix (GO:0016558)|protein import into peroxisome matrix, docking (GO:0016560)|protein import into peroxisome matrix, translocation (GO:0016561)|protein import into peroxisome membrane (GO:0045046)|protein targeting to peroxisome (GO:0006625)|protein tetramerization (GO:0051262)|very long-chain fatty acid metabolic process (GO:0000038)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular (GO:0005622)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)|protein complex (GO:0043234)	enzyme binding (GO:0019899)|peroxisome matrix targeting signal-1 binding (GO:0005052)|peroxisome targeting sequence binding (GO:0000268)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|small GTPase binding (GO:0031267)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)	21						CCCTGGTGTGGCAGACTTGGC	0.458																																																	0													73.0	73.0	73.0					12																	7344176		2203	4300	6503	SO:0001583	missense	0			U19721	CCDS8576.1, CCDS44822.1, CCDS44823.1, CCDS44824.1, CCDS73433.1	12p	2013-01-10	2004-03-17	2004-03-19		ENSG00000139197		"""Tetratricopeptide (TTC) repeat domain containing"""	9719	protein-coding gene	gene with protein product		600414	"""peroxisome receptor 1"""	PXR1			Standard	NM_000319		Approved	PTS1R	uc010sgc.2	P50542		ENST00000455147.2:c.328G>A	12.37:g.7344176G>A	ENSP00000400647:p.Ala110Thr		A8K891|B4DZ45|B7ZAD5|D3DUT8|Q15115|Q15266|Q96FN7	Missense_Mutation	SNP	pfam_TPR_1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.A125T	ENST00000455147.2	37	c.373	CCDS44823.1	12	.	.	.	.	.	.	.	.	.	.	G	24.1	4.492586	0.84962	.	.	ENSG00000139197	ENST00000536883;ENST00000542539;ENST00000455147;ENST00000266563;ENST00000543974;ENST00000434354;ENST00000545574;ENST00000420616;ENST00000412720;ENST00000396637;ENST00000536841;ENST00000537873;ENST00000266564;ENST00000545845	D;D;D;D;D;D;D	0.88896	-2.39;-2.44;-2.4;-2.39;-2.37;-2.34;-2.41	4.04	4.04	0.47022	.	0.055818	0.64402	D	0.000001	D	0.92368	0.7578	L	0.52573	1.65	0.80722	D	1	D;P;P;P;D	0.89917	1.0;0.902;0.944;0.928;0.967	D;P;P;P;P	0.87578	0.998;0.546;0.66;0.671;0.744	D	0.92539	0.6040	10	0.48119	T	0.1	.	16.3705	0.83355	0.0:0.0:1.0:0.0	.	131;125;110;110;110	B4E0T2;B4DZ45;P50542;P50542-3;P50542-2	.;.;PEX5_HUMAN;.;.	T	27;110;110;110;27;125;98;110;131;125;110;110;110;27	ENSP00000400647:A110T;ENSP00000266563:A110T;ENSP00000407401:A125T;ENSP00000410159:A110T;ENSP00000391601:A131T;ENSP00000379877:A125T;ENSP00000266564:A110T	ENSP00000266563:A110T	A	+	1	0	PEX5	7235443	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.292000	0.89930	2.075000	0.62263	0.491000	0.48974	GCA	PEX5	-	NULL	ENSG00000139197		0.458	PEX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEX5	HGNC	protein_coding	OTTHUMT00000398611.1	-	0.00	49	0	G	NM_000319		7344176	+1	tier1	-	no_errors	ENST00000434354	ensembl	human	known	74_37	missense	6.35	59	4	SNP	1.000	A
PGS1	9489	genome.wustl.edu	37	17	76392413	76392413	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr17:76392413C>T	ENST00000262764.6	+	3	384	c.358C>T	c.(358-360)Cgg>Tgg	p.R120W	PGS1_ENST00000329897.7_Intron	NM_024419.3	NP_077733.3	Q32NB8	PGPS1_HUMAN	phosphatidylglycerophosphate synthase 1	120					cardiolipin biosynthetic process (GO:0032049)|diacylglycerol metabolic process (GO:0046339)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|CDP-diacylglycerol-glycerol-3-phosphate 3-phosphatidyltransferase activity (GO:0008444)			cervix(2)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|skin(1)|urinary_tract(1)	10			BRCA - Breast invasive adenocarcinoma(99;0.00144)|OV - Ovarian serous cystadenocarcinoma(97;0.031)			AGCCAAGAGGCGGGTCGTGAT	0.478																																					Esophageal Squamous(45;182 1126 10685 43198)												0													81.0	92.0	89.0					17																	76392413		1893	4102	5995	SO:0001583	missense	0				CCDS42391.1	17q25.3	2006-02-09							30029	protein-coding gene	gene with protein product		614942				9880566	Standard	XR_243691		Approved	DKFZP762M186	uc002jvm.3	Q32NB8		ENST00000262764.6:c.358C>T	17.37:g.76392413C>T	ENSP00000262764:p.Arg120Trp		B7ZA32|Q8IYK9|Q8TA85|Q96A75|Q9H7G9|Q9NPW7	Missense_Mutation	SNP	pirsf_PLipase-D_PtdSer-synthase-type,pfscan_PLipase_D/transphosphatidylase	p.R120W	ENST00000262764.6	37	c.358	CCDS42391.1	17	.	.	.	.	.	.	.	.	.	.	C	22.4	4.287733	0.80803	.	.	ENSG00000087157	ENST00000262764	T	0.24350	1.86	5.31	4.32	0.51571	.	0.138509	0.38778	U	0.001571	T	0.61489	0.2351	M	0.93898	3.47	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.73883	-0.3842	10	0.87932	D	0	-27.3081	15.1307	0.72520	0.1426:0.8574:0.0:0.0	.	120	Q32NB8	PGPS1_HUMAN	W	120	ENSP00000262764:R120W	ENSP00000262764:R120W	R	+	1	2	PGS1	73904008	1.000000	0.71417	0.999000	0.59377	0.819000	0.46315	5.387000	0.66243	1.182000	0.42928	0.655000	0.94253	CGG	PGS1	-	pirsf_PLipase-D_PtdSer-synthase-type	ENSG00000087157		0.478	PGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGS1	HGNC	protein_coding	OTTHUMT00000437301.1	-	0.00	62	0	C	NM_024419		76392413	+1	tier1	-	no_errors	ENST00000262764	ensembl	human	known	74_37	missense	32.97	60	30	SNP	1.000	T
PHEX	5251	genome.wustl.edu	37	X	22117197	22117197	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chrX:22117197C>T	ENST00000379374.4	+	9	1572	c.1007C>T	c.(1006-1008)tCc>tTc	p.S336F	PHEX_ENST00000535894.1_Missense_Mutation_p.S239F|PHEX_ENST00000475778.1_3'UTR|PHEX_ENST00000537599.1_Missense_Mutation_p.S336F|PHEX_ENST00000418858.3_Missense_Mutation_p.S39F	NM_000444.4	NP_000435.3	P78562	PHEX_HUMAN	phosphate regulating endopeptidase homolog, X-linked	336					bone mineralization (GO:0030282)|cell-cell signaling (GO:0007267)|cellular protein modification process (GO:0006464)|organophosphate metabolic process (GO:0019637)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|cervix(2)|endometrium(2)|large_intestine(12)|liver(1)|lung(19)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	42						ATCAGCCCCTCCGAGAATGTG	0.453																																																	0													131.0	117.0	122.0					X																	22117197		2203	4300	6503	SO:0001583	missense	0			U82970	CCDS14204.1	Xp22.2-p22.1	2008-07-31	2008-07-31		ENSG00000102174	ENSG00000102174			8918	protein-coding gene	gene with protein product		300550	"""phosphate regulating gene with homologies to endopeptidases on the X chromosome (hypophosphatemia, vitamin D resistant rickets)"""	HYP, HPDR		7550339, 9070861	Standard	NM_000444		Approved	PEX, HPDR1, HYP1, XLH	uc004dah.3	P78562	OTTHUMG00000021241	ENST00000379374.4:c.1007C>T	X.37:g.22117197C>T	ENSP00000368682:p.Ser336Phe		O00678|Q13646|Q2M325|Q93032|Q99827	Missense_Mutation	SNP	pfam_Peptidase_M13_N,pfam_Peptidase_M13_C,prints_Peptidase_M13_C	p.S336F	ENST00000379374.4	37	c.1007	CCDS14204.1	X	.	.	.	.	.	.	.	.	.	.	C	18.03	3.532636	0.64972	.	.	ENSG00000102174	ENST00000379374;ENST00000537599;ENST00000535894;ENST00000418858	T;T;T;T	0.74737	-0.87;-0.87;-0.87;-0.87	5.46	5.46	0.80206	Peptidase M13 (1);	0.000000	0.85682	D	0.000000	D	0.85084	0.5616	M	0.68593	2.085	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.71184	0.952;0.972	D	0.85809	0.1378	10	0.54805	T	0.06	.	18.3837	0.90459	0.0:1.0:0.0:0.0	.	336;336	F5GXU4;P78562	.;PHEX_HUMAN	F	336;336;239;39	ENSP00000368682:S336F;ENSP00000440362:S336F;ENSP00000439418:S239F;ENSP00000443531:S39F	ENSP00000368682:S336F	S	+	2	0	PHEX	22027118	1.000000	0.71417	0.976000	0.42696	0.831000	0.47069	6.013000	0.70776	2.282000	0.76494	0.529000	0.55759	TCC	PHEX	-	pfam_Peptidase_M13_N	ENSG00000102174		0.453	PHEX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHEX	HGNC	protein_coding	OTTHUMT00000056035.1	-	0.00	96	0	C	NM_000444		22117197	+1	tier1	-	no_errors	ENST00000379374	ensembl	human	known	74_37	missense	28.37	101	40	SNP	1.000	T
PLA2G2A	5320	genome.wustl.edu	37	1	20305467	20305468	+	Intron	DEL	CA	CA	-	rs71857665|rs376364585|rs531707871|rs3061293		TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	CA	CA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr1:20305467_20305468delCA	ENST00000375111.3	-	3	166				PLA2G2A_ENST00000496748.1_Intron|PLA2G2A_ENST00000400520.3_Intron	NM_000300.3|NM_001161727.1	NP_000291.1|NP_001155199.1	P14555	PA2GA_HUMAN	phospholipase A2, group IIA (platelets, synovial fluid)						defense response to Gram-positive bacterium (GO:0050830)|glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|low-density lipoprotein particle remodeling (GO:0034374)|negative regulation of epithelial cell proliferation (GO:0050680)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidic acid metabolic process (GO:0046473)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|positive regulation of inflammatory response (GO:0050729)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|small molecule metabolic process (GO:0044281)|somatic stem cell maintenance (GO:0035019)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|secretory granule (GO:0030141)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase A2 activity (GO:0047498)|phospholipase A2 activity (GO:0004623)|phospholipid binding (GO:0005543)			central_nervous_system(1)|lung(6)|prostate(1)|stomach(1)	9		Colorectal(325;0.000147)|Renal(390;0.000469)|all_lung(284;0.00459)|Lung NSC(340;0.00475)|Breast(348;0.00526)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.018)|COAD - Colon adenocarcinoma(152;1.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000138)|Kidney(64;0.000171)|GBM - Glioblastoma multiforme(114;0.00032)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Diclofenac(DB00586)|Ginkgo biloba(DB01381)|Indomethacin(DB00328)|Suramin(DB04786)	TCCAGCAATGcacacacacaca	0.554																																																	0																																										SO:0001627	intron_variant	0			BC005919	CCDS201.1	1p35	2008-09-19			ENSG00000188257	ENSG00000188257	3.1.1.4		9031	protein-coding gene	gene with protein product		172411		PLA2B, PLA2L		8838795	Standard	NM_000300		Approved		uc010odb.2	P14555	OTTHUMG00000002699	ENST00000375111.3:c.106-95TG>-	1.37:g.20305477_20305478delCA			A8K5I7|Q6DN24|Q6IBD9|Q9UCD2	RNA	DEL	-	NULL	ENST00000375111.3	37	NULL	CCDS201.1	1																																																																																			PLA2G2A	-	-	ENSG00000188257		0.554	PLA2G2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLA2G2A	HGNC	protein_coding	OTTHUMT00000007675.1		0.00	8	0	CA	NM_000300		20305468	-1	tier1		no_errors	ENST00000461140	ensembl	human	known	74_37	rna	33.33	6	3	DEL	0.006:0.005	-
PLCZ1	89869	genome.wustl.edu	37	12	18872455	18872455	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr12:18872455G>T	ENST00000266505.7	-	5	742	c.479C>A	c.(478-480)cCa>cAa	p.P160Q	PLCZ1_ENST00000435379.1_Intron|PLCZ1_ENST00000447925.2_Missense_Mutation_p.P158Q|PLCZ1_ENST00000539875.1_Intron|PLCZ1_ENST00000541695.1_Missense_Mutation_p.P23Q|RP11-361I14.2_ENST00000536931.1_RNA					phospholipase C, zeta 1											NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	31	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.0241)					ATCATTTAATGGATGAGTCAT	0.299																																																	0													59.0	59.0	59.0					12																	18872455		2203	4284	6487	SO:0001583	missense	0			AY035866	CCDS8680.1	12p13.31	2013-01-10			ENSG00000139151	ENSG00000139151	3.1.4.11	"""EF-hand domain containing"""	19218	protein-coding gene	gene with protein product		608075				12117804	Standard	NM_033123		Approved	NYD-SP27, PLCzeta	uc021qvx.2	Q86YW0	OTTHUMG00000168937	ENST00000266505.7:c.479C>A	12.37:g.18872455G>T	ENSP00000266505:p.Pro160Gln			Missense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_dom,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,pfscan_EF_hand_dom,pfscan_C2_dom,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.P160Q	ENST00000266505.7	37	c.479	CCDS8680.1	12	.	.	.	.	.	.	.	.	.	.	G	25.2	4.611032	0.87258	.	.	ENSG00000139151	ENST00000266505;ENST00000447925;ENST00000541695;ENST00000541966	T;T;T;T	0.80824	-1.42;-1.42;-1.42;-1.42	5.28	5.28	0.74379	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific , X domain (3);	0.000000	0.85682	D	0.000000	D	0.94105	0.8110	H	0.98646	4.29	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.96409	0.9303	10	0.87932	D	0	.	17.8805	0.88839	0.0:0.0:1.0:0.0	.	160	Q86YW0	PLCZ1_HUMAN	Q	160;158;23;56	ENSP00000266505:P160Q;ENSP00000402358:P158Q;ENSP00000443349:P23Q;ENSP00000444383:P56Q	ENSP00000266505:P160Q	P	-	2	0	PLCZ1	18763722	1.000000	0.71417	0.707000	0.30419	0.993000	0.82548	9.159000	0.94728	2.465000	0.83290	0.591000	0.81541	CCA	PLCZ1	-	pfam_PLipase_C_PInositol-sp_X_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,smart_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_PInositol-sp_X_dom,prints_Pinositol_PLipase_C	ENSG00000139151		0.299	PLCZ1-001	KNOWN	NAGNAG_splice_site|non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	PLCZ1	HGNC	protein_coding	OTTHUMT00000401667.3		0.00	31	0	G	NM_033123		18872455	-1			no_errors	ENST00000266505	ensembl	human	known	74_37	missense	5.00	38	2	SNP	1.000	T
PLD5	200150	genome.wustl.edu	37	1	242264075	242264075	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr1:242264075C>G	ENST00000536534.2	-	9	1490	c.1249G>C	c.(1249-1251)Gat>Cat	p.D417H	PLD5_ENST00000427495.1_Missense_Mutation_p.D355H|PLD5_ENST00000442594.2_Missense_Mutation_p.D325H			Q8N7P1	PLD5_HUMAN	phospholipase D family, member 5	417						integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(22)|ovary(6)|skin(3)|urinary_tract(1)	55	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)			CTTTCCAGATCAAAAAATTTC	0.373																																																	0													86.0	82.0	83.0					1																	242264075		2203	4300	6503	SO:0001583	missense	0			AK098092	CCDS1621.1, CCDS1621.2, CCDS55692.1	1q43	2008-02-05			ENSG00000180287	ENSG00000180287			26879	protein-coding gene	gene with protein product							Standard	NM_001195811		Approved	FLJ40773	uc001hzn.2	Q8N7P1	OTTHUMG00000039867	ENST00000536534.2:c.1249G>C	1.37:g.242264075C>G	ENSP00000440896:p.Asp417His		A1KXV0|B7Z324|Q494U9|Q8NB22	Missense_Mutation	SNP	smart_PLipase_D/transphosphatidylase	p.D417H	ENST00000536534.2	37	c.1249	CCDS1621.2	1	.	.	.	.	.	.	.	.	.	.	C	16.66	3.183976	0.57800	.	.	ENSG00000180287	ENST00000427495;ENST00000442594;ENST00000536534	T;T;T	0.21543	2.0;2.0;2.0	5.75	4.83	0.62350	.	0.148770	0.64402	D	0.000010	T	0.27933	0.0688	N	0.25647	0.755	0.40794	D	0.983282	P;D;D	0.55800	0.911;0.973;0.967	P;P;P	0.59288	0.66;0.855;0.773	T	0.01118	-1.1446	10	0.45353	T	0.12	-19.2855	13.1794	0.59645	0.0:0.9242:0.0:0.0758	.	325;417;355	Q8N7P1-2;Q8N7P1;Q8N7P1-4	.;PLD5_HUMAN;.	H	355;325;417	ENSP00000401285:D355H;ENSP00000414188:D325H;ENSP00000440896:D417H	ENSP00000401285:D355H	D	-	1	0	PLD5	240330698	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.109000	0.50345	2.723000	0.93209	0.650000	0.86243	GAT	PLD5	-	NULL	ENSG00000180287		0.373	PLD5-006	KNOWN	basic|appris_principal|CCDS	protein_coding	PLD5	HGNC	protein_coding	OTTHUMT00000397213.2	-	0.00	55	0	C	NM_152666		242264075	-1	tier1	-	no_errors	ENST00000536534	ensembl	human	known	74_37	missense	32.67	66	33	SNP	1.000	G
PLXNB2	23654	genome.wustl.edu	37	22	50728207	50728207	+	Silent	SNP	G	G	T	rs543105336	byFrequency	TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr22:50728207G>T	ENST00000449103.1	-	3	947	c.807C>A	c.(805-807)ccC>ccA	p.P269P	PLXNB2_ENST00000359337.4_Silent_p.P269P			O15031	PLXB2_HUMAN	plexin B2	269	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				brain development (GO:0007420)|neural tube closure (GO:0001843)|neuroblast proliferation (GO:0007405)|positive regulation of axonogenesis (GO:0050772)|regulation of cell shape (GO:0008360)|regulation of neuron migration (GO:2001222)|regulation of protein phosphorylation (GO:0001932)|regulation of Rho GTPase activity (GO:0032319)|semaphorin-plexin signaling pathway (GO:0071526)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	GTPase activator activity (GO:0005096)|semaphorin receptor activity (GO:0017154)			breast(2)|central_nervous_system(4)|cervix(2)|endometrium(11)|kidney(4)|large_intestine(3)|liver(1)|lung(20)|ovary(5)|prostate(6)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	66		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		CGTGGATGTCGGGGTCCCGGC	0.652																																																	0													38.0	42.0	40.0					22																	50728207		2060	4176	6236	SO:0001819	synonymous_variant	0				CCDS43035.1	22q13.33	2008-06-12			ENSG00000196576	ENSG00000196576		"""Plexins"""	9104	protein-coding gene	gene with protein product		604293				10520995, 12183458	Standard	NM_012401		Approved	MM1, KIAA0315, PLEXB2	uc003bkv.4	O15031	OTTHUMG00000150219	ENST00000449103.1:c.807C>A	22.37:g.50728207G>T			A6QRH0|Q7KZU3|Q9BSU7	Silent	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_IPT,pfam_Semap_dom,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.P269	ENST00000449103.1	37	c.807	CCDS43035.1	22																																																																																			PLXNB2	-	pfam_Semap_dom,superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom	ENSG00000196576		0.652	PLXNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNB2	HGNC	protein_coding	OTTHUMT00000316874.3		0.00	40	0	G	NM_012401		50728207	-1			no_errors	ENST00000359337	ensembl	human	known	74_37	silent	6.25	30	2	SNP	0.002	T
PPP4R1L	55370	genome.wustl.edu	37	20	56818597	56818597	+	3'UTR	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr20:56818597G>T	ENST00000334187.8	-	0	1601							Q9P1A2	PP4RL_HUMAN	protein phosphatase 4, regulatory subunit 1-like																		GCCACAAAGAGCTCATCCTGA	0.488																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF119843		20q13.32	2013-03-28			ENSG00000124224	ENSG00000124224			15755	other	unknown				C20orf192		14702039, 11780052	Standard	NR_003505		Approved	bA196N14.4, bA196N14.5	uc002xyy.1	Q9P1A2	OTTHUMG00000032838	ENST00000334187.8:c.*340C>A	20.37:g.56818597G>T			B4DRM4|Q96LY6|Q9BZ17|Q9BZ18	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.L63I	ENST00000334187.8	37	c.187		20																																																																																			PPP4R1L	-	NULL	ENSG00000124224		0.488	PPP4R1L-201	KNOWN	basic|appris_candidate_longest	protein_coding	PPP4R1L	HGNC	protein_coding		-	0.00	39	0	G	NR_003505		56818597	-1	tier1	-	no_errors	ENST00000497138	ensembl	human	known	74_37	missense	6.78	55	4	SNP	0.031	T
PRRT4	401399	genome.wustl.edu	37	7	127999980	127999980	+	Silent	SNP	G	G	A			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr7:127999980G>A	ENST00000446477.2	-	3	379	c.66C>T	c.(64-66)ggC>ggT	p.G22G	PRRT4_ENST00000535159.1_Silent_p.G22G|PRRT4_ENST00000489835.2_Silent_p.G22G|PRRT4_ENST00000435512.1_Silent_p.G22G	NM_001174164.1	NP_001167635.1	C9JH25	PRRT4_HUMAN	proline-rich transmembrane protein 4	22						integral component of membrane (GO:0016021)				endometrium(4)|prostate(1)	5						TGGGCTGGGGGCCCACAGTAG	0.632																																																	0													7.0	7.0	7.0					7																	127999980		692	1591	2283	SO:0001819	synonymous_variant	0			BC063892	CCDS47698.1, CCDS47698.2, CCDS55160.1	7q32.1	2011-10-10			ENSG00000224940	ENSG00000224940		"""Proline-rich transmembrane proteins"""	37280	protein-coding gene	gene with protein product							Standard	NM_001114726		Approved		uc022aky.1	C9JH25	OTTHUMG00000157714	ENST00000446477.2:c.66C>T	7.37:g.127999980G>A			A4D0Z9|C9JVW7	Silent	SNP	NULL	p.G22	ENST00000446477.2	37	c.66	CCDS55160.1	7																																																																																			PRRT4	-	NULL	ENSG00000224940		0.632	PRRT4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRT4	HGNC	protein_coding		-	0.00	97	0	G	NM_001114726		127999980	-1	tier1	-	no_errors	ENST00000446477	ensembl	human	known	74_37	silent	22.65	138	41	SNP	1.000	A
REV3L	5980	genome.wustl.edu	37	6	111693909	111693909	+	Silent	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr6:111693909G>T	ENST00000358835.3	-	14	6103	c.5649C>A	c.(5647-5649)tcC>tcA	p.S1883S	REV3L_ENST00000435970.1_Silent_p.S1805S|REV3L_ENST00000368805.1_Silent_p.S1883S|REV3L_ENST00000368802.3_Silent_p.S1883S			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	1883	Mediates interaction with MAD2L2.				DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		TACTTGGGGGGGACATAAGTG	0.433								DNA polymerases (catalytic subunits)																																									0													162.0	170.0	167.0					6																	111693909		2203	4300	6503	SO:0001819	synonymous_variant	0			AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.5649C>A	6.37:g.111693909G>T			O43214|Q5TC33	Silent	SNP	pfam_DNA-dir_DNA_pol_B_multi_dom,pfam_DNA-dir_DNA_pol_B_exonuc,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B,prints_DNA-dir_DNA_pol_B	p.S1883	ENST00000358835.3	37	c.5649	CCDS5091.2	6																																																																																			REV3L	-	superfamily_RNaseH-like_dom	ENSG00000009413		0.433	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	REV3L	HGNC	protein_coding	OTTHUMT00000043695.1	-	0.00	68	0	G	NM_002912		111693909	-1	tier1	-	no_errors	ENST00000358835	ensembl	human	known	74_37	silent	5.33	71	4	SNP	0.742	T
GBA2	57704	genome.wustl.edu	37	9	35751659	35751659	+	5'Flank	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr9:35751659G>T	ENST00000378103.3	-	0	0				GBA2_ENST00000545786.1_5'Flank|RGP1_ENST00000378078.4_Missense_Mutation_p.G224W|RGP1_ENST00000456972.2_Missense_Mutation_p.G264W|MSMP_ENST00000414286.1_5'Flank|GBA2_ENST00000378094.4_5'Flank	NM_020944.2	NP_065995.1	Q9HCG7	GBA2_HUMAN	glucosidase, beta (bile acid) 2						bile acid metabolic process (GO:0008206)|cell death (GO:0008219)|central nervous system neuron development (GO:0021954)|glucosylceramide catabolic process (GO:0006680)|glycoside catabolic process (GO:0016139)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum (GO:0005790)	beta-glucosidase activity (GO:0008422)|glucosylceramidase activity (GO:0004348)			NS(1)|kidney(3)|large_intestine(5)|lung(5)|ovary(4)|skin(3)	21	all_epithelial(49;0.167)		Lung(28;0.00416)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			AGGGAAAGTTGGGACGTTTGG	0.488																																																	0													114.0	113.0	113.0					9																	35751659		1963	4157	6120	SO:0001631	upstream_gene_variant	0			AJ309567	CCDS6589.1	9p13.2	2013-09-11			ENSG00000070610	ENSG00000070610			18986	protein-coding gene	gene with protein product	"""bile acid beta-glucosidase"", ""non-lysosomal glucosylceramidase"""	609471	"""spastic paraplegia 46 (autosomal recessive)"""	SPG46		11489889, 23332916, 23332917	Standard	NM_020944		Approved	KIAA1605, AD035, DKFZp762K054	uc003zxw.3	Q9HCG7	OTTHUMG00000021024		9.37:g.35751659G>T	Exception_encountered		D3DRP2|Q5TCV6|Q96A51|Q96LY1|Q96SJ2|Q9H2L8	Missense_Mutation	SNP	pfam_Rgp1	p.G264W	ENST00000378103.3	37	c.790	CCDS6589.1	9	.	.	.	.	.	.	.	.	.	.	G	20.1	3.932124	0.73442	.	.	ENSG00000107185	ENST00000456972;ENST00000378078	.	.	.	5.58	4.69	0.59074	.	0.049496	0.85682	D	0.000000	T	0.76709	0.4025	M	0.69358	2.11	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.79434	-0.1805	9	0.87932	D	0	-16.5415	13.7503	0.62904	0.0739:0.0:0.9261:0.0	.	224;224	Q92546;A8K0K1	RGP1_HUMAN;.	W	264;224	.	ENSP00000367318:G224W	G	+	1	0	RGP1	35741659	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	8.655000	0.91098	1.368000	0.46115	0.555000	0.69702	GGG	RGP1	-	pfam_Rgp1	ENSG00000107185		0.488	GBA2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	RGP1	HGNC	protein_coding	OTTHUMT00000055456.1	-	0.00	57	0	G	NM_020944		35751659	+1	tier1	-	no_errors	ENST00000456972	ensembl	human	known	74_37	missense	6.35	59	4	SNP	1.000	T
RIMS1	22999	genome.wustl.edu	37	6	73110497	73110497	+	IGR	SNP	A	A	G			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr6:73110497A>G	ENST00000521978.1	+	0	5079				RIMS1_ENST00000348717.5_3'UTR|RIMS1_ENST00000414192.2_3'UTR|RIMS1_ENST00000264839.7_3'UTR|RIMS1_ENST00000517827.1_3'UTR|RIMS1_ENST00000401910.3_3'UTR|RIMS1_ENST00000523963.1_3'UTR|RIMS1_ENST00000520567.1_3'UTR|RIMS1_ENST00000425662.2_3'UTR|RIMS1_ENST00000431478.2_3'UTR|RIMS1_ENST00000491071.2_3'UTR|RIMS1_ENST00000538414.1_3'UTR	NM_014989.5	NP_055804.2	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1						calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|glutamate secretion (GO:0014047)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|neurotransmitter secretion (GO:0007269)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|protein complex assembly (GO:0006461)|regulated secretory pathway (GO:0045055)|regulation of catalytic activity (GO:0050790)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neurotransmitter secretion (GO:0046928)|response to stimulus (GO:0050896)|secretion (GO:0046903)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|visual perception (GO:0007601)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)|small GTPase regulator activity (GO:0005083)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(25)|liver(4)|lung(35)|ovary(9)|pancreas(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	102		all_epithelial(107;0.179)|all_hematologic(105;0.212)				GATCGAAAGCATTGTTGGAGA	0.343																																																	0																																										SO:0001628	intergenic_variant	0			AB002338	CCDS47449.1, CCDS55029.1, CCDS55030.1, CCDS55031.1, CCDS55032.1, CCDS55033.1	6q12-q13	2008-10-16	2002-06-12	2002-06-14	ENSG00000079841	ENSG00000079841			17282	protein-coding gene	gene with protein product	"""Rab3-interacting molecule"""	606629	"""RAB3 interacting protein 2"""	RAB3IP2, CORD7		9205841, 11438518	Standard	NM_001168407		Approved	RIM, KIAA0340, RIM1	uc003pga.4	Q86UR5	OTTHUMG00000015009		6.37:g.73110497A>G			A7MBN6|B7Z2M0|B7Z2Q9|B7Z3S3|B7Z6S2|E7EX08|E9PCB7|E9PCZ1|E9PF48|E9PHF5|E9PHR1|O15048|Q5JY21|Q5JY25|Q5SZK1|Q8TDY9|Q8TDZ5|Q9HBA1|Q9HBA2|Q9HBA3|Q9HBA4|Q9HBA5|Q9HBA6	RNA	SNP	-	NULL	ENST00000521978.1	37	NULL	CCDS47449.1	6																																																																																			RIMS1	-	-	ENSG00000079841		0.343	RIMS1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	RIMS1	HGNC	protein_coding	OTTHUMT00000374968.1	-	0.00	31	0	A			73110497	+1	tier1	-	no_errors	ENST00000431478	ensembl	human	known	74_37	rna	41.94	18	13	SNP	1.000	G
RNF145	153830	genome.wustl.edu	37	5	158595982	158595982	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr5:158595982G>T	ENST00000424310.2	-	8	1379	c.1020C>A	c.(1018-1020)ttC>ttA	p.F340L	RNF145_ENST00000521606.2_Missense_Mutation_p.F357L|RNF145_ENST00000274542.2_Missense_Mutation_p.F368L|RNF145_ENST00000518802.1_Missense_Mutation_p.F370L|RNF145_ENST00000520638.1_Missense_Mutation_p.F354L|RNF145_ENST00000519865.1_Missense_Mutation_p.F340L	NM_001199383.1	NP_001186312.1	Q96MT1	RN145_HUMAN	ring finger protein 145	340						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			endometrium(7)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	30	Renal(175;0.00196)	Medulloblastoma(196;0.0523)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TACTGAGCAAGAATGCCCGAT	0.428																																																	0													131.0	131.0	131.0					5																	158595982		2203	4300	6503	SO:0001583	missense	0			BC042684	CCDS4344.1, CCDS56390.1, CCDS56391.1, CCDS56392.1, CCDS56393.1	5q33.3	2013-01-09			ENSG00000145860	ENSG00000145860		"""RING-type (C3HC4) zinc fingers"""	20853	protein-coding gene	gene with protein product							Standard	NM_001199380		Approved	FLJ31951	uc003lxo.2	Q96MT1	OTTHUMG00000130306	ENST00000424310.2:c.1020C>A	5.37:g.158595982G>T	ENSP00000409064:p.Phe340Leu		B7Z903|B7Z949|E7EVI7|Q8IVP7	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING-CH,smart_Znf_RING,pfscan_Znf_RING	p.F370L	ENST00000424310.2	37	c.1110	CCDS56390.1	5	.	.	.	.	.	.	.	.	.	.	G	18.96	3.734428	0.69189	.	.	ENSG00000145860	ENST00000274542;ENST00000519865;ENST00000424310;ENST00000521606;ENST00000413445;ENST00000518802;ENST00000535312;ENST00000520638	T;T;T;T;T;T;T	0.77229	-1.08;-1.06;-1.06;-1.07;-1.07;-1.08;-1.07	5.08	4.21	0.49690	.	0.000000	0.85682	D	0.000000	T	0.72439	0.3460	L	0.43152	1.355	0.58432	D	0.999999	P;P;P;P;P	0.42296	0.775;0.775;0.775;0.602;0.734	B;B;B;B;B	0.42916	0.306;0.306;0.306;0.402;0.203	T	0.70313	-0.4906	10	0.31617	T	0.26	-23.5982	13.6881	0.62529	0.0753:0.0:0.9247:0.0	.	357;354;370;340;368	B7Z949;B7Z903;E7EVI7;Q96MT1;Q96MT1-2	.;.;.;RN145_HUMAN;.	L	368;340;340;356;357;370;340;354	ENSP00000274542:F368L;ENSP00000430397:F340L;ENSP00000409064:F340L;ENSP00000430753:F356L;ENSP00000445115:F357L;ENSP00000430955:F370L;ENSP00000429071:F354L	ENSP00000274542:F368L	F	-	3	2	RNF145	158528560	1.000000	0.71417	0.999000	0.59377	0.975000	0.68041	5.539000	0.67199	1.254000	0.44035	0.585000	0.79938	TTC	RNF145	-	NULL	ENSG00000145860		0.428	RNF145-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RNF145	HGNC	protein_coding	OTTHUMT00000374048.1		0.00	97	0	G	NM_144726		158595982	-1			no_errors	ENST00000518802	ensembl	human	known	74_37	missense	6.33	74	5	SNP	1.000	T
RNF213	57674	genome.wustl.edu	37	17	78318718	78318718	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr17:78318718G>T	ENST00000582970.1	+	29	6726	c.6583G>T	c.(6583-6585)Gag>Tag	p.E2195*	RNF213_ENST00000508628.2_Nonsense_Mutation_p.E2244*|RNF213_ENST00000336301.6_Nonsense_Mutation_p.E268*	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	2195					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			AGGCACCCCGGAGGAATGCCT	0.468																																																	0													94.0	95.0	95.0					17																	78318718		2203	4300	6503	SO:0001587	stop_gained	0			AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.6583G>T	17.37:g.78318718G>T	ENSP00000464087:p.Glu2195*		C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Nonsense_Mutation	SNP	superfamily_P-loop_NTPase,smart_AAA+_ATPase,smart_Znf_RING,pfscan_Znf_RING	p.E2195*	ENST00000582970.1	37	c.6583	CCDS58606.1	17	.	.	.	.	.	.	.	.	.	.	G	46	12.247570	0.99650	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000336301	.	.	.	5.57	1.28	0.21552	.	0.770143	0.11896	N	0.519118	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.16896	T	0.51	.	8.2937	0.31973	0.1328:0.241:0.6262:0.0	.	.	.	.	X	2195;2244;268	.	ENSP00000338218:E268X	E	+	1	0	RNF213	75933313	0.054000	0.20591	0.000000	0.03702	0.136000	0.21042	2.389000	0.44407	0.282000	0.22254	-0.165000	0.13383	GAG	RNF213	-	NULL	ENSG00000173821		0.468	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	RNF213	HGNC	protein_coding	OTTHUMT00000443298.1		0.00	47	0	G	NM_020914		78318718	+1			no_errors	ENST00000582970	ensembl	human	known	74_37	nonsense	5.08	56	3	SNP	0.002	T
RPGR	6103	genome.wustl.edu	37	X	38146735	38146735	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chrX:38146735T>C	ENST00000339363.3	-	14	2299	c.2132A>G	c.(2131-2133)gAa>gGa	p.E711G	TM4SF2_ENST00000465127.1_Intron|RPGR_ENST00000309513.3_Intron|RPGR_ENST00000338898.3_Intron|RPGR_ENST00000342811.3_Intron|RPGR_ENST00000318842.7_Intron|RPGR_ENST00000378505.2_Intron			Q92834	RPGR_HUMAN	retinitis pigmentosa GTPase regulator	711	Glu-rich.				cilium assembly (GO:0042384)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|intraciliary transport (GO:0042073)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|Golgi apparatus (GO:0005794)|photoreceptor outer segment (GO:0001750)|sperm flagellum (GO:0036126)	guanyl-nucleotide exchange factor activity (GO:0005085)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	25						GTCTGGCTTTTCTACTGATTC	0.393																																																	0																																										SO:0001583	missense	0			U57629	CCDS14246.1, CCDS35229.1	Xp11.4	2013-06-06	2004-02-13		ENSG00000156313	ENSG00000156313			10295	protein-coding gene	gene with protein product		312610	"""retinitis pigmentosa 15"", ""cone dystrophy 1 (X-linked)"""	CRD, RP3, RP15, COD1		8673101, 8817343	Standard	XM_005272633		Approved	CORDX1	uc004ded.1	Q92834	OTTHUMG00000021361	ENST00000339363.3:c.2132A>G	X.37:g.38146735T>C	ENSP00000343671:p.Glu711Gly		B1ARN3|E9PE28|O00702|O00737|Q3KN84|Q8N5T6|Q93039|Q9HD29|Q9UMR1	Missense_Mutation	SNP	pfam_Reg_chr_condens,superfamily_RCC1/BLIP-II,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.E711G	ENST00000339363.3	37	c.2132		X	.	.	.	.	.	.	.	.	.	.	t	10.65	1.408827	0.25378	.	.	ENSG00000156313	ENST00000339363	T	0.18810	2.19	4.44	3.26	0.37387	.	.	.	.	.	T	0.15003	0.0362	.	.	.	0.09310	N	0.999997	.	.	.	.	.	.	T	0.27123	-1.0083	5	.	.	.	.	4.3345	0.11080	0.1762:0.0999:0.0:0.7239	.	.	.	.	G	711	ENSP00000343671:E711G	.	E	-	2	0	RPGR	38031679	0.001000	0.12720	0.010000	0.14722	0.122000	0.20287	0.296000	0.19083	0.437000	0.26423	0.435000	0.28638	GAA	RPGR	-	superfamily_RCC1/BLIP-II	ENSG00000156313		0.393	RPGR-203	KNOWN	basic|appris_candidate	protein_coding	RPGR	HGNC	protein_coding		-	0.00	42	0	T	NM_000328		38146735	-1	tier1	-	no_errors	ENST00000339363	ensembl	human	known	74_37	missense	38.13	86	53	SNP	0.070	C
RPL29P30	729611	genome.wustl.edu	37	15	71089126	71089126	+	RNA	SNP	C	C	A			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr15:71089126C>A	ENST00000470368.1	-	0	642									ribosomal protein L29 pseudogene 30																		GCATGCTTCCCAAGCTTGGGG	0.592																																																	0																																												0					15q23	2009-03-11				ENSG00000235420			36601	pseudogene	pseudogene						19123937	Standard	NG_010026		Approved						15.37:g.71089126C>A				RNA	SNP	-	NULL	ENST00000470368.1	37	NULL		15																																																																																			RPL29P30	-	-	ENSG00000235420		0.592	RPL29P30-002	KNOWN	basic	processed_transcript	RPL29P30	HGNC	pseudogene	OTTHUMT00000349960.1	-	0.00	66	0	C	NG_010026		71089126	-1	tier1	-	no_errors	ENST00000470368	ensembl	human	known	74_37	rna	45.07	39	32	SNP	0.131	A
RTL1	388015	genome.wustl.edu	37	14	101347177	101347177	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr14:101347177C>T	ENST00000534062.1	-	1	4007	c.3949G>A	c.(3949-3951)Gcc>Acc	p.A1317T	MIR431_ENST00000385266.1_RNA|MIR127_ENST00000384876.1_RNA|MIR433_ENST00000384837.1_RNA	NM_001134888.2	NP_001128360.1	A6NKG5	RTL1_HUMAN	retrotransposon-like 1	1317					multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)				breast(1)|endometrium(5)|kidney(4)|large_intestine(1)|lung(5)|pancreas(1)|prostate(2)|skin(2)	21						TGGCTCAGGGCCCTGGCTGCC	0.657																																																	0													19.0	21.0	20.0					14																	101347177		692	1589	2281	SO:0001583	missense	0				CCDS53910.1	14q32.2	2012-04-18			ENSG00000254656	ENSG00000254656			14665	protein-coding gene	gene with protein product		611896				16155747, 15854907, 12796779	Standard	NM_001134888		Approved	PEG11, MART1, Mar1	uc010txj.1	A6NKG5	OTTHUMG00000167573	ENST00000534062.1:c.3949G>A	14.37:g.101347177C>T	ENSP00000435342:p.Ala1317Thr		E9PKS8	Missense_Mutation	SNP	pfam_Retrotrans_gag_dom,superfamily_Peptidase_aspartic_dom	p.A1317T	ENST00000534062.1	37	c.3949	CCDS53910.1	14	.	.	.	.	.	.	.	.	.	.	C	10.78	1.446118	0.25987	.	.	ENSG00000254656	ENST00000534062	T	0.23950	1.88	3.53	-0.616	0.11583	.	.	.	.	.	T	0.12050	0.0293	N	0.24115	0.695	0.09310	N	1	B	0.17465	0.022	B	0.15052	0.012	T	0.32693	-0.9897	9	0.21014	T	0.42	.	0.9086	0.01290	0.1712:0.3933:0.2094:0.2262	.	1317	E9PKS8	.	T	1317	ENSP00000435342:A1317T	ENSP00000435342:A1317T	A	-	1	0	RTL1	100416930	0.016000	0.18221	0.004000	0.12327	0.150000	0.21749	-0.281000	0.08456	-0.126000	0.11682	0.609000	0.83330	GCC	RTL1	-	NULL	ENSG00000254656		0.657	RTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTL1	HGNC	protein_coding	OTTHUMT00000395127.1	-	0.00	82	0	C	NM_001134888		101347177	-1	tier1	-	no_errors	ENST00000534062	ensembl	human	known	74_37	missense	32.62	94	46	SNP	0.001	T
SALL4	57167	genome.wustl.edu	37	20	50405596	50405596	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr20:50405596G>A	ENST00000217086.4	-	3	2657	c.2546C>T	c.(2545-2547)tCg>tTg	p.S849L	SALL4_ENST00000483130.1_5'Flank|SALL4_ENST00000371539.3_Missense_Mutation_p.S72L|SALL4_ENST00000395997.3_Missense_Mutation_p.S412L	NM_020436.3	NP_065169.1	Q9UJQ4	SALL4_HUMAN	spalt-like transcription factor 4	849					embryonic limb morphogenesis (GO:0030326)|inner cell mass cell proliferation (GO:0001833)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|ventricular septum development (GO:0003281)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(27)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						GGACAATGTCGAGGGTCCCAC	0.582																																																	0													57.0	56.0	56.0					20																	50405596		2203	4300	6503	SO:0001583	missense	0			AK001666	CCDS13438.1	20q13.2	2014-09-17	2013-10-17		ENSG00000101115	ENSG00000101115		"""Zinc fingers, C2H2-type"""	15924	protein-coding gene	gene with protein product		607343	"""sal (Drosophila)-like 4"", ""sal-like 4 (Drosophila)"""				Standard	NM_020436		Approved	dJ1112F19.1, ZNF797	uc002xwh.4	Q9UJQ4	OTTHUMG00000032752	ENST00000217086.4:c.2546C>T	20.37:g.50405596G>A	ENSP00000217086:p.Ser849Leu		A2A2D8|Q540H3|Q6Y8G6	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S849L	ENST00000217086.4	37	c.2546	CCDS13438.1	20	.	.	.	.	.	.	.	.	.	.	G	11.01	1.512198	0.27036	.	.	ENSG00000101115	ENST00000217086;ENST00000395997;ENST00000371539	T;T;T	0.09817	2.94;3.17;3.19	5.73	4.76	0.60689	.	0.578709	0.14515	N	0.314814	T	0.04724	0.0128	N	0.01352	-0.895	0.27134	N	0.961818	B;B;B	0.24426	0.103;0.001;0.103	B;B;B	0.19666	0.011;0.0;0.026	T	0.35943	-0.9768	10	0.22109	T	0.4	-1.8184	16.5199	0.84311	0.0:0.131:0.869:0.0	.	412;72;849	A2A2D8;Q6Y8G5;Q9UJQ4	.;.;SALL4_HUMAN	L	849;412;72	ENSP00000217086:S849L;ENSP00000379319:S412L;ENSP00000360594:S72L	ENSP00000217086:S849L	S	-	2	0	SALL4	49839003	0.864000	0.29904	0.450000	0.26969	0.806000	0.45545	4.231000	0.58639	1.363000	0.46019	0.655000	0.94253	TCG	SALL4	-	NULL	ENSG00000101115		0.582	SALL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SALL4	HGNC	protein_coding	OTTHUMT00000079738.3	-	0.00	39	0	G			50405596	-1	tier1	-	no_errors	ENST00000217086	ensembl	human	known	74_37	missense	45.71	19	16	SNP	0.949	A
SCN5A	6331	genome.wustl.edu	37	3	38593046	38593046	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr3:38593046G>T	ENST00000333535.4	-	28	4966	c.4817C>A	c.(4816-4818)aCt>aAt	p.T1606N	SCN5A_ENST00000423572.2_Missense_Mutation_p.T1605N|SCN5A_ENST00000450102.2_Missense_Mutation_p.T1552N|SCN5A_ENST00000464652.1_5'Flank|SCN5A_ENST00000443581.1_Missense_Mutation_p.T1605N|SCN5A_ENST00000414099.2_Missense_Mutation_p.T1588N|SCN5A_ENST00000425664.1_Missense_Mutation_p.T1588N|SCN5A_ENST00000455624.2_Missense_Mutation_p.T1573N|SCN5A_ENST00000451551.2_Missense_Mutation_p.T1552N|SCN5A_ENST00000449557.2_Missense_Mutation_p.T1552N|SCN5A_ENST00000413689.1_Missense_Mutation_p.T1606N			Q14524	SCN5A_HUMAN	sodium channel, voltage-gated, type V, alpha subunit	1606					AV node cell to bundle of His cell communication (GO:0086067)|brainstem development (GO:0003360)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cardiac ventricle development (GO:0003231)|cellular response to calcium ion (GO:0071277)|cerebellum development (GO:0021549)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during SA node cell action potential (GO:0086046)|neuronal action potential (GO:0019228)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of action potential (GO:0045760)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|telencephalon development (GO:0021537)|ventricular cardiac muscle cell action potential (GO:0086005)	caveola (GO:0005901)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	ankyrin binding (GO:0030506)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			NS(3)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|lung(27)|ovary(6)|pancreas(3)|prostate(10)|skin(9)|upper_aerodigestive_tract(4)	107	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)	CGAGAGCACAGTGCCTGTGGG	0.597																																																	0													53.0	57.0	56.0					3																	38593046		2203	4300	6503	SO:0001583	missense	0			AJ310893	CCDS46796.1, CCDS46797.1, CCDS46798.1, CCDS46799.1, CCDS54569.1, CCDS54570.1	3p21	2014-09-17	2007-01-23		ENSG00000183873	ENSG00000183873		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10593	protein-coding gene	gene with protein product	"""long QT syndrome 3"""	600163	"""sodium channel, voltage-gated, type V, alpha (long QT syndrome 3)"""	CMD1E		7842012, 15466643, 16382098	Standard	NM_198056		Approved	Nav1.5, LQT3, HB1, HBBD, PFHB1, IVF, HB2, HH1, SSS1, CDCD2, CMPD2, ICCD	uc021wvl.1	Q14524	OTTHUMG00000156166	ENST00000333535.4:c.4817C>A	3.37:g.38593046G>T	ENSP00000328968:p.Thr1606Asn		A5H1P8|A6N922|A6N923|B2RTU0|E7ET19|E9PEF3|E9PEK2|E9PFW7|Q59H93|Q75RX9|Q75RY0|Q86UR3|Q8IZC9|Q96J69	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_DUF3451,pfam_PKD1_2_channel,prints_Na_channel_a5su,prints_Na_channel_asu	p.T1606N	ENST00000333535.4	37	c.4817	CCDS46796.1	3	.	.	.	.	.	.	.	.	.	.	G	12.85	2.062076	0.36373	.	.	ENSG00000183873	ENST00000414099;ENST00000423572;ENST00000413689;ENST00000451551;ENST00000443581;ENST00000425664;ENST00000333535;ENST00000455624;ENST00000450102;ENST00000449557	D;D;D;D;D;D;D;D;D;D	0.98419	-4.92;-4.92;-4.92;-4.92;-4.92;-4.92;-4.92;-4.46;-4.92;-4.92	4.54	4.54	0.55810	Ion transport (1);	0.051893	0.85682	D	0.000000	D	0.97334	0.9128	M	0.75777	2.31	0.46609	D	0.999126	B;B;B;B;B;B	0.28933	0.065;0.22;0.086;0.228;0.039;0.005	B;B;B;B;B;B	0.35770	0.164;0.21;0.191;0.16;0.171;0.012	D	0.97037	0.9754	10	0.87932	D	0	.	11.0403	0.47827	0.0851:0.0:0.9149:0.0	.	1552;1573;1588;1606;1605;1606	E9PEF3;E9PHB6;E9PG18;Q14524;Q14524-2;E9PEK2	.;.;.;SCN5A_HUMAN;.;.	N	1588;1605;1606;1552;1605;1588;1606;1573;1552;1552	ENSP00000398962:T1588N;ENSP00000398266:T1605N;ENSP00000410257:T1606N;ENSP00000388797:T1552N;ENSP00000397915:T1605N;ENSP00000416634:T1588N;ENSP00000328968:T1606N;ENSP00000399524:T1573N;ENSP00000403355:T1552N;ENSP00000413996:T1552N	ENSP00000328968:T1606N	T	-	2	0	SCN5A	38568050	1.000000	0.71417	0.982000	0.44146	0.997000	0.91878	5.024000	0.64090	2.353000	0.79882	0.561000	0.74099	ACT	SCN5A	-	pfam_Ion_trans_dom	ENSG00000183873		0.597	SCN5A-014	KNOWN	basic|CCDS	protein_coding	SCN5A	HGNC	protein_coding	OTTHUMT00000377958.1		0.00	41	0	G	NM_198056		38593046	-1			no_errors	ENST00000333535	ensembl	human	known	74_37	missense	8.00	46	4	SNP	0.994	T
SCN7A	6332	genome.wustl.edu	37	2	167333974	167333974	+	Splice_Site	DEL	T	T	-			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr2:167333974delT	ENST00000409855.1	-	2	359	c.233delA	c.(232-234)aat>at	p.N78fs		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	78					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.N78fs*4(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	AATACTCACATTTTTTTTCTT	0.299																																																	1	Deletion - Frameshift(1)	large_intestine(1)								30,3308		2,26,1641	19.0	16.0	17.0			-1.3	1.0	2		17	66,7408		7,52,3678	no	frameshift-near-splice	SCN7A	NM_002976.3		9,78,5319	A1A1,A1R,RR		0.8831,0.8987,0.8879			167333974	96,10716	1732	3921	5653	SO:0001630	splice_region_variant	0			M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.234+1A>-	2.37:g.167333974delT				Frame_Shift_Del	DEL	pfam_Ion_trans_dom,pfam_Na_trans_assoc,prints_Na_channel_asu	p.N78fs	ENST00000409855.1	37	c.233	CCDS46442.1	2																																																																																			SCN7A	-	NULL	ENSG00000136546		0.299	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN7A	HGNC	protein_coding	OTTHUMT00000333745.1		0.00	51	0	T		Frame_Shift_Del	167333974	-1	tier1		no_errors	ENST00000409855	ensembl	human	known	74_37	frame_shift_del	8.57	32	3	DEL	1.000	-
SEMA3F	6405	genome.wustl.edu	37	3	50225441	50225441	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr3:50225441C>T	ENST00000002829.3	+	19	2735	c.2251C>T	c.(2251-2253)Cgc>Tgc	p.R751C	SEMA3F_ENST00000413852.1_Missense_Mutation_p.R652C|SEMA3F_ENST00000434342.1_Missense_Mutation_p.R720C	NM_004186.3	NP_004177.3	Q13275	SEM3F_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F	751					axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branchiomotor neuron axon guidance (GO:0021785)|facial nerve structural organization (GO:0021612)|negative regulation of axon extension involved in axon guidance (GO:0048843)|nerve development (GO:0021675)|neural crest cell migration (GO:0001755)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sympathetic ganglion development (GO:0061549)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	extracellular space (GO:0005615)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|receptor activity (GO:0004872)			central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|skin(2)	17				BRCA - Breast invasive adenocarcinoma(193;0.00013)|KIRC - Kidney renal clear cell carcinoma(197;0.00599)|Kidney(197;0.00688)		GGGTTACTGGCGCCATGTGCC	0.697																																																	0													7.0	8.0	8.0					3																	50225441		2155	4238	6393	SO:0001583	missense	0			U33920	CCDS2811.1	3p21.3	2013-01-11			ENSG00000001617	ENSG00000001617		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10728	protein-coding gene	gene with protein product	"""sema IV"""	601124				8786119, 8649831	Standard	NM_004186		Approved	SEMAK, Sema4	uc003cyj.3	Q13275	OTTHUMG00000156806	ENST00000002829.3:c.2251C>T	3.37:g.50225441C>T	ENSP00000002829:p.Arg751Cys		C9JQ85|Q13274|Q13372|Q15704|Q6GTR4	Missense_Mutation	SNP	pfam_Semap_dom,superfamily_Semap_dom,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_Ig_sub,smart_Ig_sub2,pfscan_Semap_dom,pfscan_Ig-like_dom	p.R751C	ENST00000002829.3	37	c.2251	CCDS2811.1	3	.	.	.	.	.	.	.	.	.	.	C	22.8	4.343219	0.82022	.	.	ENSG00000001617	ENST00000413852;ENST00000002829;ENST00000434342	T;T;T	0.52295	0.73;0.67;0.73	5.57	5.57	0.84162	.	0.055009	0.85682	D	0.000000	T	0.56601	0.1996	L	0.44542	1.39	0.80722	D	1	D;D	0.76494	0.999;0.999	P;P	0.56216	0.719;0.794	T	0.53542	-0.8424	10	0.42905	T	0.14	.	18.3019	0.90167	0.0:1.0:0.0:0.0	.	720;751	C9JQ85;Q13275	.;SEM3F_HUMAN	C	652;751;720	ENSP00000388931:R652C;ENSP00000002829:R751C;ENSP00000409859:R720C	ENSP00000002829:R751C	R	+	1	0	SEMA3F	50200445	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	4.645000	0.61404	2.613000	0.88420	0.462000	0.41574	CGC	SEMA3F	-	NULL	ENSG00000001617		0.697	SEMA3F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA3F	HGNC	protein_coding	OTTHUMT00000345929.1	-	0.00	16	0	C	NM_004186		50225441	+1	tier1	-	no_errors	ENST00000002829	ensembl	human	known	74_37	missense	66.67	4	8	SNP	1.000	T
SERINC2	347735	genome.wustl.edu	37	1	31898638	31898638	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr1:31898638G>T	ENST00000373709.3	+	5	638	c.488G>T	c.(487-489)gGc>gTc	p.G163V	SERINC2_ENST00000536384.1_Missense_Mutation_p.G167V|SERINC2_ENST00000491976.1_3'UTR|SERINC2_ENST00000373710.1_Missense_Mutation_p.G172V|SERINC2_ENST00000536859.1_Missense_Mutation_p.G167V	NM_178865.4	NP_849196.2	Q96SA4	SERC2_HUMAN	serine incorporator 2	163					phosphatidylserine metabolic process (GO:0006658)|positive regulation of transferase activity (GO:0051347)|sphingolipid metabolic process (GO:0006665)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	L-serine transmembrane transporter activity (GO:0015194)			cervix(1)|endometrium(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(2)	12		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0629)|Breast(348;0.0707)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0541)|READ - Rectum adenocarcinoma(331;0.151)		TTCTACTTCGGCGTCGTGGGC	0.602																																																	0													213.0	178.0	190.0					1																	31898638		2203	4300	6503	SO:0001583	missense	0			AY094595	CCDS30662.1, CCDS55583.1, CCDS55584.1, CCDS55585.1	1p35.1	2008-02-05	2005-11-01	2005-11-01	ENSG00000168528	ENSG00000168528			23231	protein-coding gene	gene with protein product		614549	"""tumor differentially expressed 2-like"""	TDE2L		12949800	Standard	NM_178865		Approved	FKSG84, PRO0899, TDE2	uc010ogh.2	Q96SA4	OTTHUMG00000003796	ENST00000373709.3:c.488G>T	1.37:g.31898638G>T	ENSP00000362813:p.Gly163Val		A0AVB4|B4DJK5|B7Z567|B7ZAP2|E7EUZ9|Q86Y23	Missense_Mutation	SNP	pfam_TMS_TDE	p.G172V	ENST00000373709.3	37	c.515	CCDS30662.1	1	.	.	.	.	.	.	.	.	.	.	G	18.48	3.632828	0.67015	.	.	ENSG00000168528	ENST00000373710;ENST00000536859;ENST00000373709;ENST00000536384	T;T;T;T	0.18810	2.19;2.19;2.19;2.19	4.01	4.01	0.46588	.	0.000000	0.85682	D	0.000000	T	0.54078	0.1836	M	0.90309	3.105	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.67027	-0.5774	10	0.87932	D	0	-28.2786	16.2466	0.82448	0.0:0.0:1.0:0.0	.	167;172;163	B4DJK5;E7EUZ9;Q96SA4	.;.;SERC2_HUMAN	V	172;167;163;167	ENSP00000362814:G172V;ENSP00000444307:G167V;ENSP00000362813:G163V;ENSP00000439048:G167V	ENSP00000362813:G163V	G	+	2	0	SERINC2	31671225	1.000000	0.71417	0.991000	0.47740	0.369000	0.29798	9.547000	0.98100	2.233000	0.73108	0.491000	0.48974	GGC	SERINC2	-	pfam_TMS_TDE	ENSG00000168528		0.602	SERINC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERINC2	HGNC	protein_coding	OTTHUMT00000010680.1		0.00	23	0	G	NM_018565		31898638	+1			no_errors	ENST00000373710	ensembl	human	known	74_37	missense	7.69	24	2	SNP	1.000	T
RPS3A	6189	genome.wustl.edu	37	4	152024005	152024005	+	Intron	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr4:152024005G>T	ENST00000509736.1	+	2	91				RPS3A_ENST00000514682.1_Intron|SNORD73A_ENST00000386062.1_RNA|SNORD73_ENST00000364394.1_RNA|RPS3A_ENST00000274065.4_Intron|RPS3A_ENST00000512690.1_Intron|RPS3A_ENST00000322686.6_Intron|RPS3A_ENST00000506126.1_Intron					ribosomal protein S3A											endometrium(1)|lung(1)|ovary(1)|pancreas(1)	4	all_hematologic(180;0.093)					TAAATCTGACGGTATCTTTTT	0.338																																																	0													115.0	116.0	116.0					4																	152024005		2200	4298	6498	SO:0001627	intron_variant	0			X87373	CCDS3775.1	4q31.2-q31.3	2011-04-05			ENSG00000145425	ENSG00000145425		"""S ribosomal proteins"""	10421	protein-coding gene	gene with protein product		180478		MFTL		8647443, 1398113	Standard	NM_001006		Approved	S3A	uc003ilz.4	P61247	OTTHUMG00000161445	ENST00000509736.1:c.-3-18G>T	4.37:g.152024005G>T				RNA	SNP	-	NULL	ENST00000509736.1	37	NULL		4																																																																																			SH3D19	-	-	ENSG00000109686		0.338	RPS3A-006	PUTATIVE	basic|exp_conf	protein_coding	SH3D19	HGNC	protein_coding	OTTHUMT00000364962.2	-	0.00	37	0	G			152024005	-1	tier1	-	no_errors	ENST00000604922	ensembl	human	known	74_37	rna	9.76	37	4	SNP	0.000	T
SI	6476	genome.wustl.edu	37	3	164709256	164709256	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr3:164709256T>C	ENST00000264382.3	-	44	5055	c.4993A>G	c.(4993-4995)Att>Gtt	p.I1665V		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	1665	Sucrase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)			NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	CTGACGCCAATATCTTTGCCC	0.403										HNSCC(35;0.089)																																							0													97.0	88.0	91.0					3																	164709256		2203	4300	6503	SO:0001583	missense	0			X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.4993A>G	3.37:g.164709256T>C	ENSP00000264382:p.Ile1665Val		A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Gal_mutarotase_SF_dom,smart_P_trefoil	p.I1665V	ENST00000264382.3	37	c.4993	CCDS3196.1	3	.	.	.	.	.	.	.	.	.	.	T	4.750	0.139472	0.09083	.	.	ENSG00000090402	ENST00000264382	D	0.90563	-2.69	4.78	4.78	0.61160	.	0.066704	0.64402	D	0.000003	T	0.81772	0.4893	N	0.14661	0.345	0.35037	D	0.759364	B	0.11235	0.004	B	0.13407	0.009	T	0.79895	-0.1610	10	0.18710	T	0.47	.	14.1377	0.65297	0.0:0.0:0.0:1.0	.	1665	P14410	SUIS_HUMAN	V	1665	ENSP00000264382:I1665V	ENSP00000264382:I1665V	I	-	1	0	SI	166191950	0.971000	0.33674	0.344000	0.25628	0.018000	0.09664	0.793000	0.26944	2.003000	0.58678	0.383000	0.25322	ATT	SI	-	pfam_Glyco_hydro_31	ENSG00000090402		0.403	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SI	HGNC	protein_coding	OTTHUMT00000350116.1	-	0.00	63	0	T	NM_001041		164709256	-1	tier1	-	no_errors	ENST00000264382	ensembl	human	known	74_37	missense	31.73	71	33	SNP	0.915	C
SIX6	4990	genome.wustl.edu	37	14	60976547	60976547	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr14:60976547G>A	ENST00000327720.5	+	1	879	c.431G>A	c.(430-432)cGc>cAc	p.R144H		NM_007374.2	NP_031400.2	O95475	SIX6_HUMAN	SIX homeobox 6	144					organ morphogenesis (GO:0009887)|visual perception (GO:0007601)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)			NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(2)	11				OV - Ovarian serous cystadenocarcinoma(108;0.088)		CACCTGCTACGCGAGTGGTAC	0.587																																																	0													53.0	48.0	50.0					14																	60976547		2203	4300	6503	SO:0001583	missense	0			AF141651	CCDS9747.1	14q23.1	2011-06-20	2007-07-13		ENSG00000184302	ENSG00000184302		"""Homeoboxes / SINE class"""	10892	protein-coding gene	gene with protein product		606326	"""sine oculis homeobox (Drosophila) homolog 6"", ""sine oculis homeobox homolog 6 (Drosophila)"""	OPTX2		10512683	Standard	NM_007374		Approved	Six9	uc001xfa.4	O95475	OTTHUMG00000152339	ENST00000327720.5:c.431G>A	14.37:g.60976547G>A	ENSP00000328596:p.Arg144His		Q6NT42|Q9P1X8	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.R144H	ENST00000327720.5	37	c.431	CCDS9747.1	14	.	.	.	.	.	.	.	.	.	.	G	28.7	4.939670	0.92526	.	.	ENSG00000184302	ENST00000327720	D	0.96200	-3.94	5.38	5.38	0.77491	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.97368	0.9139	M	0.76838	2.35	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.97418	1.0007	10	0.87932	D	0	.	13.6226	0.62146	0.0762:0.0:0.9238:0.0	.	144	O95475	SIX6_HUMAN	H	144	ENSP00000328596:R144H	ENSP00000328596:R144H	R	+	2	0	SIX6	60046300	1.000000	0.71417	0.803000	0.32268	0.960000	0.62799	9.657000	0.98554	2.804000	0.96469	0.462000	0.41574	CGC	SIX6	-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	ENSG00000184302		0.587	SIX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIX6	HGNC	protein_coding	OTTHUMT00000276952.2	-	0.00	56	0	G			60976547	+1	tier1	-	no_errors	ENST00000327720	ensembl	human	known	74_37	missense	35.19	35	19	SNP	0.996	A
SLC17A6	57084	genome.wustl.edu	37	11	22363299	22363299	+	Silent	SNP	C	C	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr11:22363299C>T	ENST00000263160.3	+	2	749	c.312C>T	c.(310-312)atC>atT	p.I104I		NM_020346.2	NP_065079.1	Q9P2U8	VGLU2_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 6	104					ion transport (GO:0006811)|neurotransmitter uptake (GO:0001504)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|synaptic vesicle membrane (GO:0030672)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(3)	50						ACAGCACCATCCACCGCGGGG	0.607																																																	0													69.0	57.0	61.0					11																	22363299		2203	4300	6503	SO:0001819	synonymous_variant	0			AB032435	CCDS7856.1	11p14.3	2013-07-18	2013-07-18		ENSG00000091664	ENSG00000091664		"""Solute carriers"""	16703	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 2"", ""differentiation-associated Na-dependent inorganic phosphate cotransporter"""	607563	"""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6"""			11306821	Standard	NM_020346		Approved	DNPI, VGLUT2	uc001mqk.3	Q9P2U8	OTTHUMG00000166063	ENST00000263160.3:c.312C>T	11.37:g.22363299C>T			A6NKS2	Silent	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.I104	ENST00000263160.3	37	c.312	CCDS7856.1	11																																																																																			SLC17A6	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000091664		0.607	SLC17A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC17A6	HGNC	protein_coding	OTTHUMT00000387671.1	-	0.00	142	0	C	NM_020346		22363299	+1	tier1	-	no_errors	ENST00000263160	ensembl	human	known	74_37	silent	35.71	108	60	SNP	1.000	T
SLC22A10	387775	genome.wustl.edu	37	11	63078478	63078479	+	Splice_Site	INS	-	-	A	rs562147200	byFrequency	TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr11:63078478_63078479insA	ENST00000332793.6	+	10	1600_1601		c.e10-1		SLC22A10_ENST00000535888.1_Intron|SLC22A10_ENST00000544661.1_Splice_Site|SLC22A10_ENST00000525620.1_Intron|SLC22A10_ENST00000526800.1_Splice_Site	NM_001039752.3	NP_001034841.3	Q63ZE4	S22AA_HUMAN	solute carrier family 22, member 10							integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28					Conjugated Estrogens(DB00286)|Probenecid(DB01032)|Salicylic acid(DB00936)	tgttttTCCAGAAAAAAAAATC	0.302																																																	0																																										SO:0001630	splice_region_variant	0			AP003420	CCDS41661.1	11q12.3	2013-05-22	2008-01-11		ENSG00000184999	ENSG00000184999		"""Solute carriers"""	18057	protein-coding gene	gene with protein product		607580	"""solute carrier family 22 (organic anion/cation transporter), member 10"""			11327718	Standard	NM_001039752		Approved	OAT5, hOAT5	uc009yor.3	Q63ZE4	OTTHUMG00000165197	ENST00000332793.6:c.1599-1->A	11.37:g.63078487_63078487dupA			Q68CJ0	Frame_Shift_Ins	INS	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.N537fs	ENST00000332793.6	37	c.1600_1599	CCDS41661.1	11																																																																																			SLC22A10	-	NULL	ENSG00000184999		0.302	SLC22A10-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A10	HGNC	protein_coding	OTTHUMT00000382622.3		0.00	19	0	-	NM_001039752	Intron	63078479	+1	tier1		no_errors	ENST00000332793	ensembl	human	known	74_37	frame_shift_ins	28.57	10	4	INS	0.014:0.007	A
SLC2A6	11182	genome.wustl.edu	37	9	136340725	136340725	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr9:136340725G>T	ENST00000371899.4	-	5	648	c.571C>A	c.(571-573)Ctg>Atg	p.L191M	SLC2A6_ENST00000371897.4_Missense_Mutation_p.L191M|SLC2A6_ENST00000485978.1_5'UTR	NM_017585.3	NP_060055.2	Q9UGQ3	GTR6_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 6	191					glucose transport (GO:0015758)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glucose transmembrane transporter activity (GO:0005355)			cervix(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(3)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(145;8.47e-08)|Epithelial(140;9.37e-07)|all cancers(34;1.03e-05)		CGCCACGGCAGCAGGAGGCCT	0.667																																																	0													6.0	8.0	7.0					9																	136340725		2128	4200	6328	SO:0001583	missense	0			AJ011372	CCDS6975.1, CCDS48052.1	9q34	2013-05-22			ENSG00000160326	ENSG00000160326		"""Solute carriers"""	11011	protein-coding gene	gene with protein product		606813				10970791	Standard	NM_001145099		Approved	GLUT9, GLUT6, HSA011372	uc004cee.3	Q9UGQ3	OTTHUMG00000020874	ENST00000371899.4:c.571C>A	9.37:g.136340725G>T	ENSP00000360966:p.Leu191Met		A6NNU6|Q5SXD7|Q8NCC2	Missense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,prints_Sugar/inositol_transpt,tigrfam_Sugar/inositol_transpt	p.L191M	ENST00000371899.4	37	c.571	CCDS6975.1	9	.	.	.	.	.	.	.	.	.	.	G	17.96	3.515122	0.64634	.	.	ENSG00000160326	ENST00000371897;ENST00000371899	T;T	0.61040	0.14;0.14	5.13	1.03	0.20045	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.168870	0.40302	N	0.001127	T	0.63861	0.2547	M	0.71920	2.185	0.34668	D	0.723435	D;D	0.56287	0.971;0.975	P;P	0.60609	0.736;0.877	T	0.68622	-0.5360	10	0.46703	T	0.11	.	4.2805	0.10831	0.1551:0.1259:0.5899:0.1291	.	191;191	Q9UGQ3-2;Q9UGQ3	.;GTR6_HUMAN	M	191	ENSP00000360964:L191M;ENSP00000360966:L191M	ENSP00000360964:L191M	L	-	1	2	SLC2A6	135330546	0.702000	0.27816	0.998000	0.56505	0.968000	0.65278	0.856000	0.27818	1.156000	0.42514	0.491000	0.48974	CTG	SLC2A6	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Sugar/inositol_transpt	ENSG00000160326		0.667	SLC2A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC2A6	HGNC	protein_coding	OTTHUMT00000054909.1		0.00	24	0	G	NM_017585		136340725	-1			no_errors	ENST00000371899	ensembl	human	known	74_37	missense	5.97	63	4	SNP	0.525	T
SNTA1	6640	genome.wustl.edu	37	20	32026730	32026733	+	Frame_Shift_Del	DEL	ACAG	ACAG	-			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	ACAG	ACAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr20:32026730_32026733delACAG	ENST00000217381.2	-	2	681_684	c.410_413delCTGT	c.(409-414)tctgtgfs	p.SV137fs		NM_003098.2	NP_003089.1	Q13424	SNTA1_HUMAN	syntrophin, alpha 1	137	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.|PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				muscle contraction (GO:0006936)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|neuromuscular junction development (GO:0007528)|regulation of heart rate (GO:0002027)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of vasoconstriction by circulating norepinephrine (GO:0003117)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|ventricular cardiac muscle cell action potential (GO:0086005)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intracellular (GO:0005622)|neuromuscular junction (GO:0031594)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	ATPase binding (GO:0051117)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)			breast(1)|large_intestine(4)|liver(1)|lung(4)|skin(1)|stomach(1)|urinary_tract(1)	13						TTCCCCATTCACAGACAGGATGGC	0.554																																																	0																																										SO:0001589	frameshift_variant	0			U40571	CCDS13220.1	20q11.2	2014-09-17	2012-06-15		ENSG00000101400	ENSG00000101400			11167	protein-coding gene	gene with protein product	"""pro-TGF-alpha cytoplasmic domain-interacting protein 1"", ""dystrophin-associated protein A1, 59kDa, acidic component"""	601017	"""syntrophin, alpha 1 (dystrophin-associated protein A1, 59kD, acidic component)"""	SNT1		8576247, 8612778	Standard	NM_003098		Approved	TACIP1, LQT12	uc002wzd.1	Q13424	OTTHUMG00000032259	ENST00000217381.2:c.410_413delCTGT	20.37:g.32026734_32026737delACAG	ENSP00000217381:p.Ser137fs		A8K7H9|B4DX40|E1P5N1|Q16438	Frame_Shift_Del	DEL	pfam_PDZ,superfamily_PDZ,smart_Pleckstrin_homology,smart_PDZ,pfscan_PDZ,pfscan_Pleckstrin_homology	p.S137fs	ENST00000217381.2	37	c.413_410	CCDS13220.1	20																																																																																			SNTA1	-	pfam_PDZ,superfamily_PDZ,smart_Pleckstrin_homology,smart_PDZ,pfscan_PDZ,pfscan_Pleckstrin_homology	ENSG00000101400		0.554	SNTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNTA1	HGNC	protein_coding	OTTHUMT00000078704.2		0.00	67	0	ACAG	NM_003098		32026733	-1	tier1		no_errors	ENST00000217381	ensembl	human	known	74_37	frame_shift_del	72.60	20	53	DEL	1.000:1.000:0.001:1.000	-
SPACA1	81833	genome.wustl.edu	37	6	88775967	88775967	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr6:88775967G>T	ENST00000237201.1	+	7	916	c.799G>T	c.(799-801)Gtg>Ttg	p.V267L	SPACA1_ENST00000462690.1_3'UTR	NM_030960.2	NP_112222.1	Q9HBV2	SACA1_HUMAN	sperm acrosome associated 1	267					acrosome assembly (GO:0001675)	acrosomal membrane (GO:0002080)|integral component of membrane (GO:0016021)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(12)|skin(1)|upper_aerodigestive_tract(2)	20		all_cancers(76;8.24e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;4.11e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.00011)		BRCA - Breast invasive adenocarcinoma(108;0.11)		GCAGAGTTCTGTGAGATACAA	0.413																																																	0													107.0	116.0	113.0					6																	88775967		2203	4300	6503	SO:0001583	missense	0			AF203447	CCDS5014.1	6q15	2012-09-20			ENSG00000118434	ENSG00000118434			14967	protein-coding gene	gene with protein product		612739					Standard	NM_030960		Approved	SAMP32	uc003pmn.3	Q9HBV2	OTTHUMG00000015183	ENST00000237201.1:c.799G>T	6.37:g.88775967G>T	ENSP00000237201:p.Val267Leu			Missense_Mutation	SNP	NULL	p.V267L	ENST00000237201.1	37	c.799	CCDS5014.1	6	.	.	.	.	.	.	.	.	.	.	G	4.317	0.058097	0.08339	.	.	ENSG00000118434	ENST00000237201	T	0.27256	1.68	4.81	-3.45	0.04781	.	1.092750	0.06794	N	0.787500	T	0.07863	0.0197	L	0.40543	1.245	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.43782	-0.9370	10	0.38643	T	0.18	-3.7031	11.2739	0.49155	0.3678:0.0:0.6322:0.0	.	267	Q9HBV2	SACA1_HUMAN	L	267	ENSP00000237201:V267L	ENSP00000237201:V267L	V	+	1	0	SPACA1	88832686	0.102000	0.21896	0.393000	0.26258	0.002000	0.02628	-0.370000	0.07523	-0.484000	0.06763	-0.373000	0.07131	GTG	SPACA1	-	NULL	ENSG00000118434		0.413	SPACA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SPACA1	HGNC	protein_coding	OTTHUMT00000041459.1	-	0.00	52	0	G			88775967	+1	tier1	-	no_errors	ENST00000237201	ensembl	human	known	74_37	missense	5.41	69	4	SNP	0.022	T
SPEF2	79925	genome.wustl.edu	37	5	35705894	35705894	+	Frame_Shift_Del	DEL	A	A	-			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr5:35705894delA	ENST00000356031.3	+	18	2803	c.2649delA	c.(2647-2649)gcafs	p.A883fs	CTD-2113L7.1_ENST00000510433.1_RNA|SPEF2_ENST00000440995.2_Frame_Shift_Del_p.A878fs|SPEF2_ENST00000509059.1_Frame_Shift_Del_p.A878fs	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2	883					axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)		p.K886fs*8(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CTGAAATAGCAAAAAAAAAGA	0.269																																																	1	Deletion - Frameshift(1)	lung(1)								35,46,3367		0,0,35,0,46,1643	20.0	18.0	18.0			-2.4	0.0	5		19	95,88,7525		0,1,94,0,87,3672	no	codingComplex	SPEF2	NM_024867.3		0,1,129,0,133,5315	A1A1,A1A2,A1R,A2A2,A2R,RR		2.3742,2.3492,2.3664			35705894	130,134,10892	1785	4033	5818	SO:0001589	frameshift_variant	0			AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.2649delA	5.37:g.35705894delA	ENSP00000348314:p.Ala883fs		Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	Frame_Shift_Del	DEL	pfam_DUF1042,pfam_Adenylate_kin,pfam_HATC_dom_C,superfamily_P-loop_NTPase,superfamily_CH-domain,pfscan_CH-domain	p.K886fs	ENST00000356031.3	37	c.2649	CCDS43309.1	5																																																																																			SPEF2	-	NULL	ENSG00000152582		0.269	SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SPEF2	HGNC	protein_coding	OTTHUMT00000367199.1		0.00	43	0	A	NM_144722		35705894	+1			no_errors	ENST00000356031	ensembl	human	known	74_37	frame_shift_del	8.25	89	8	DEL	0.129	0
SPG11	80208	genome.wustl.edu	37	15	44862814	44862815	+	Frame_Shift_Del	DEL	GT	GT	-	rs375608115		TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	GT	GT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr15:44862814_44862815delGT	ENST00000261866.7	-	34	6401_6402	c.6385_6386delAC	c.(6385-6387)acgfs	p.T2129fs	SPG11_ENST00000427534.2_Frame_Shift_Del_p.T2129fs|SPG11_ENST00000535302.2_Frame_Shift_Del_p.T2016fs	NM_025137.3	NP_079413.3	Q96JI7	SPTCS_HUMAN	spastic paraplegia 11 (autosomal recessive)	2129					cell death (GO:0008219)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	72		all_cancers(109;1.29e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;1.34e-07)|all_lung(180;1.21e-06)|Melanoma(134;0.0122)		all cancers(107;2.93e-22)|GBM - Glioblastoma multiforme(94;1.55e-06)|COAD - Colon adenocarcinoma(120;0.0432)|Colorectal(105;0.0484)|Lung(196;0.104)|LUSC - Lung squamous cell carcinoma(244;0.214)		CATGTGGCACGTCAGGGTGAAG	0.579																																																	0																																										SO:0001589	frameshift_variant	0				CCDS10112.1, CCDS53939.1	15q13-q15	2007-11-13			ENSG00000104133	ENSG00000104133			11226	protein-coding gene	gene with protein product	"""spatacsin"""	610844	"""KIAA1840"""	KIAA1840		10408536, 17322883	Standard	NM_001160227		Approved	FLJ21439	uc001ztx.3	Q96JI7	OTTHUMG00000131199	ENST00000261866.7:c.6385_6386delAC	15.37:g.44862814_44862815delGT	ENSP00000261866:p.Thr2129fs		A8KAX9|B9EK60|F5H3N6|Q4VC11|Q58G86|Q69YG6|Q6NW01|Q8N270|Q8TBU9|Q9H734	Frame_Shift_Del	DEL	NULL	p.T2129fs	ENST00000261866.7	37	c.6386_6385	CCDS10112.1	15																																																																																			SPG11	-	NULL	ENSG00000104133		0.579	SPG11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPG11	HGNC	protein_coding	OTTHUMT00000253927.1		0.00	35	0	GT			44862815	-1	tier1		no_errors	ENST00000261866	ensembl	human	known	74_37	frame_shift_del	17.14	29	6	DEL	1.000:1.000	-
SPOCD1	90853	genome.wustl.edu	37	1	32280209	32280209	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr1:32280209G>T	ENST00000360482.2	-	2	855	c.726C>A	c.(724-726)gaC>gaA	p.D242E	SPOCD1_ENST00000373648.2_Missense_Mutation_p.D242E|SPOCD1_ENST00000533231.1_Missense_Mutation_p.D242E|SPOCD1_ENST00000257100.3_Intron	NM_144569.4	NP_653170.3	Q6ZMY3	SPOC1_HUMAN	SPOC domain containing 1	242					negative regulation of phosphatase activity (GO:0010923)|transcription, DNA-templated (GO:0006351)					NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|liver(1)|lung(7)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(2)	37		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)|Ovarian(437;0.199)		STAD - Stomach adenocarcinoma(196;0.18)		CTTGGGGAGGGTCTCCCACAG	0.617																																																	0													88.0	88.0	88.0					1																	32280209		2203	4300	6503	SO:0001583	missense	0			AK058077	CCDS347.1, CCDS60066.1, CCDS72748.1	1p35.1	2014-06-13			ENSG00000134668	ENSG00000134668			26338	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 146"""					12477932	Standard	NM_144569		Approved	FLJ25348, PPP1R146	uc001bts.1	Q6ZMY3	OTTHUMG00000003879	ENST00000360482.2:c.726C>A	1.37:g.32280209G>T	ENSP00000353670:p.Asp242Glu		Q24JU3|Q6PI90|Q8N869|Q8N8U0|Q8NBC6|Q96LN6	Missense_Mutation	SNP	pfam_TFIIS_cen_dom,pfam_SPOC_C,superfamily_TFIIS_cen_dom,smart_TFS2M	p.D242E	ENST00000360482.2	37	c.726	CCDS347.1	1	.	.	.	.	.	.	.	.	.	.	G	10.06	1.247788	0.22880	.	.	ENSG00000134668	ENST00000360482;ENST00000373648;ENST00000533231	T;T;T	0.31769	1.94;1.48;1.93	2.74	0.659	0.17861	.	.	.	.	.	T	0.16938	0.0407	N	0.14661	0.345	0.09310	N	1	B;B	0.10296	0.003;0.002	B;B	0.08055	0.003;0.001	T	0.21999	-1.0229	9	0.56958	D	0.05	2.527	7.1408	0.25554	0.0:0.0:0.5199:0.4801	.	242;242	Q6ZMY3-2;Q6ZMY3	.;SPOC1_HUMAN	E	242	ENSP00000353670:D242E;ENSP00000362752:D242E;ENSP00000435851:D242E	ENSP00000353670:D242E	D	-	3	2	SPOCD1	32052796	0.000000	0.05858	0.000000	0.03702	0.025000	0.11179	0.336000	0.19823	0.182000	0.20032	0.609000	0.83330	GAC	SPOCD1	-	NULL	ENSG00000134668		0.617	SPOCD1-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPOCD1	HGNC	protein_coding	OTTHUMT00000381912.1		0.00	61	0	G	NM_144569		32280209	-1			no_errors	ENST00000360482	ensembl	human	known	74_37	missense	7.27	51	4	SNP	0.000	T
SPTLC1	10558	genome.wustl.edu	37	9	94842356	94842356	+	Silent	SNP	T	T	C			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr9:94842356T>C	ENST00000262554.2	-	5	374	c.369A>G	c.(367-369)gcA>gcG	p.A123A	SPTLC1_ENST00000482632.1_5'UTR|SPTLC1_ENST00000337841.4_Silent_p.A123A	NM_006415.2	NP_006406.1	O15269	SPTC1_HUMAN	serine palmitoyltransferase, long chain base subunit 1	123					ceramide biosynthetic process (GO:0046513)|small molecule metabolic process (GO:0044281)|sphinganine biosynthetic process (GO:0046511)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingomyelin biosynthetic process (GO:0006686)|sphingosine biosynthetic process (GO:0046512)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|serine C-palmitoyltransferase complex (GO:0017059)|SPOTS complex (GO:0035339)	pyridoxal phosphate binding (GO:0030170)|serine C-palmitoyltransferase activity (GO:0004758)			breast(2)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	14					L-Serine(DB00133)	TCTTTAGAGATGCTAAAGCTG	0.353																																																	0													84.0	82.0	82.0					9																	94842356		2203	4300	6503	SO:0001819	synonymous_variant	0			Y08685	CCDS6692.1, CCDS6693.1	9q22.31	2014-09-17	2003-12-02		ENSG00000090054	ENSG00000090054	2.3.1.50		11277	protein-coding gene	gene with protein product		605712	"""hereditary sensory neuropathy, type 1"""	HSN1		9363775	Standard	NM_006415		Approved	LCB1, SPTI, HSAN1, hLCB1	uc004arl.1	O15269	OTTHUMG00000021047	ENST00000262554.2:c.369A>G	9.37:g.94842356T>C			A8K681|Q5VWB4|Q96IX6	Silent	SNP	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase	p.A123	ENST00000262554.2	37	c.369	CCDS6692.1	9																																																																																			SPTLC1	-	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase	ENSG00000090054		0.353	SPTLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTLC1	HGNC	protein_coding	OTTHUMT00000055553.1	-	0.00	30	0	T	NM_006415		94842356	-1	tier1	-	no_errors	ENST00000262554	ensembl	human	known	74_37	silent	44.74	21	17	SNP	0.921	C
SSPO	23145	genome.wustl.edu	37	7	149512264	149512264	+	RNA	SNP	C	C	A			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr7:149512264C>A	ENST00000378016.2	+	0	10584							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			CCTGCGTAGACTGCGGGGGTG	0.657																																																	0													37.0	44.0	42.0					7																	149512264		2070	4190	6260			0			AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149512264C>A			Q76B61	RNA	SNP	-	NULL	ENST00000378016.2	37	NULL		7																																																																																			SSPO	-	-	ENSG00000197558		0.657	SSPO-202	KNOWN	basic	processed_transcript	SSPO	HGNC	processed_transcript		-	0.00	28	0	C			149512264	+1	tier1	-	no_errors	ENST00000378016	ensembl	human	known	74_37	rna	6.58	71	5	SNP	1.000	A
SUN2	25777	genome.wustl.edu	37	22	39134598	39134598	+	Silent	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr22:39134598G>T	ENST00000405510.1	-	17	2299	c.1941C>A	c.(1939-1941)gcC>gcA	p.A647A	RP3-508I15.18_ENST00000420118.1_RNA|SUN2_ENST00000411587.2_Silent_p.A636A|RP3-508I15.14_ENST00000416406.1_RNA|SUN2_ENST00000216064.4_Silent_p.A647A|RP3-508I15.19_ENST00000418803.1_RNA|RP3-508I15.20_ENST00000609428.1_RNA|SUN2_ENST00000405018.1_Silent_p.A668A|SUN2_ENST00000406622.1_Silent_p.A647A	NM_001199580.1	NP_001186509.1	Q9UH99	SUN2_HUMAN	Sad1 and UNC84 domain containing 2	647	SUN. {ECO:0000255|PROSITE- ProRule:PRU00802}.				centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|mitotic spindle organization (GO:0007052)|nuclear envelope organization (GO:0006998)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)	condensed nuclear chromosome (GO:0000794)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|nuclear chromosome, telomeric region (GO:0000784)|nuclear envelope (GO:0005635)|nuclear inner membrane (GO:0005637)|nuclear membrane (GO:0031965)|SUN-KASH complex (GO:0034993)	identical protein binding (GO:0042802)|lamin binding (GO:0005521)|microtubule binding (GO:0008017)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|skin(2)|stomach(1)	15						TCACAAAGATGGCGAAGTCCT	0.607																																																	0													75.0	73.0	74.0					22																	39134598		2200	4296	6496	SO:0001819	synonymous_variant	0			AF202723	CCDS13978.1, CCDS56231.1	22q12-q13	2010-05-18	2010-05-18	2010-01-27	ENSG00000100242	ENSG00000100242			14210	protein-coding gene	gene with protein product		613569	"""unc-84 homolog B (C. elegans)"""	UNC84B		10508607, 10375507	Standard	NM_015374		Approved		uc010gxq.2	Q9UH99	OTTHUMG00000151031	ENST00000405510.1:c.1941C>A	22.37:g.39134598G>T			B0QY62|O75156|Q2NKN8|Q2T9F7|Q504T5|Q6B4H1|Q7Z3E3	Silent	SNP	pfam_Sad1_UNC_C,superfamily_Galactose-bd-like	p.A647	ENST00000405510.1	37	c.1941	CCDS13978.1	22																																																																																			SUN2	-	pfam_Sad1_UNC_C,superfamily_Galactose-bd-like	ENSG00000100242		0.607	SUN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUN2	HGNC	protein_coding	OTTHUMT00000321057.1	-	0.00	68	0	G	XM_039332		39134598	-1	tier1	-	no_errors	ENST00000216064	ensembl	human	known	74_37	silent	6.90	53	4	SNP	0.118	T
SYNE1	23345	genome.wustl.edu	37	6	152545638	152545638	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr6:152545638G>C	ENST00000367255.5	-	117	22114	c.21513C>G	c.(21511-21513)gaC>gaG	p.D7171E	SYNE1_ENST00000356820.4_Missense_Mutation_p.D1695E|SYNE1_ENST00000341594.5_Missense_Mutation_p.D6783E|SYNE1_ENST00000265368.4_Missense_Mutation_p.D7171E|SYNE1_ENST00000423061.1_Missense_Mutation_p.D7100E|SYNE1_ENST00000448038.1_Missense_Mutation_p.D7100E	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	7171					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CCTGAAGATTGTCCACCTGAA	0.388										HNSCC(10;0.0054)																																							0													95.0	89.0	91.0					6																	152545638		2203	4300	6503	SO:0001583	missense	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.21513C>G	6.37:g.152545638G>C	ENSP00000356224:p.Asp7171Glu		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.D7171E	ENST00000367255.5	37	c.21513	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	G	3.690	-0.063670	0.07273	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820;ENST00000367251	T;T;T;T;T;T;T	0.46451	0.87;0.87;0.87;0.87;0.87;0.87;0.87	5.73	2.85	0.33270	.	0.190829	0.36268	N	0.002690	T	0.04182	0.0116	N	0.03608	-0.345	0.32901	D	0.513153	B;B;B;B	0.06786	0.001;0.001;0.001;0.001	B;B;B;B	0.12156	0.007;0.007;0.004;0.007	T	0.33317	-0.9873	10	0.07482	T	0.82	.	0.7466	0.00983	0.2021:0.1516:0.3454:0.3009	.	7171;7171;7100;7100	Q8NF91;E7EQI5;Q8NF91-4;E9PEL9	SYNE1_HUMAN;.;.;.	E	7171;7100;7171;7100;6783;1695;93	ENSP00000356224:D7171E;ENSP00000396024:D7100E;ENSP00000265368:D7171E;ENSP00000390975:D7100E;ENSP00000341887:D6783E;ENSP00000349276:D1695E;ENSP00000356220:D93E	ENSP00000265368:D7171E	D	-	3	2	SYNE1	152587331	0.998000	0.40836	1.000000	0.80357	0.933000	0.57130	0.452000	0.21795	1.562000	0.49601	0.655000	0.94253	GAC	SYNE1	-	pfam_Spectrin_repeat,superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_Spectrin/alpha-actinin	ENSG00000131018		0.388	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	-	0.00	66	0	G	NM_182961		152545638	-1	tier1	-	no_errors	ENST00000265368	ensembl	human	known	74_37	missense	28.57	55	22	SNP	1.000	C
TCEAL2	140597	genome.wustl.edu	37	X	101381791	101381791	+	5'UTR	SNP	G	G	A			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chrX:101381791G>A	ENST00000372780.1	+	0	208				TCEAL2_ENST00000476749.1_3'UTR|TCEAL2_ENST00000329035.2_5'UTR	NM_080390.3	NP_525129.1	Q9H3H9	TCAL2_HUMAN	transcription elongation factor A (SII)-like 2						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				NS(1)|biliary_tract(1)|breast(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)	11						GAAAAGGAGGGGAAATCTCGA	0.498																																																	0													58.0	55.0	56.0					X																	101381791		2202	4299	6501	SO:0001623	5_prime_UTR_variant	0			AF325115	CCDS14496.1	Xq22.1-q22.3	2014-03-21			ENSG00000184905	ENSG00000184905			29818	protein-coding gene	gene with protein product						16221301	Standard	NM_080390		Approved	my048, MY0876G05, WEX1	uc004eip.3	Q9H3H9	OTTHUMG00000022048	ENST00000372780.1:c.-12G>A	X.37:g.101381791G>A			B2R5C7	RNA	SNP	-	NULL	ENST00000372780.1	37	NULL	CCDS14496.1	X																																																																																			TCEAL2	-	-	ENSG00000184905		0.498	TCEAL2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TCEAL2	HGNC	protein_coding	OTTHUMT00000057605.1	-	0.00	81	0	G	NM_080390		101381791	+1	tier1	-	no_errors	ENST00000476749	ensembl	human	known	74_37	rna	35.05	62	34	SNP	0.669	A
TCHHL1	126637	genome.wustl.edu	37	1	152059329	152059329	+	Nonsense_Mutation	SNP	C	C	A	rs114173361	byFrequency	TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr1:152059329C>A	ENST00000368806.1	-	3	893	c.829G>T	c.(829-831)Gaa>Taa	p.E277*		NM_001008536.1	NP_001008536.1	Q5QJ38	TCHL1_HUMAN	trichohyalin-like 1	277							calcium ion binding (GO:0005509)			breast(4)|endometrium(1)|kidney(2)|large_intestine(9)|lung(33)|ovary(2)|prostate(1)|skin(7)|stomach(1)	60	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.246)			GTTCTAACTTCCTGATCTTCA	0.433																																																	0													214.0	211.0	212.0					1																	152059329		2203	4300	6503	SO:0001587	stop_gained	0				CCDS30857.1	1q21.3	2011-10-11	2004-10-05	2006-01-27	ENSG00000182898	ENSG00000182898		"""S100 calcium binding proteins"""	31796	protein-coding gene	gene with protein product			"""S100 calcium binding protein A17"""	S100A17, THHL1			Standard	NM_001008536		Approved		uc001ezo.1	Q5QJ38	OTTHUMG00000013058	ENST00000368806.1:c.829G>T	1.37:g.152059329C>A	ENSP00000357796:p.Glu277*		B2RPK8|Q5VTJ9	Nonsense_Mutation	SNP	pfam_S100_Ca-bd_sub	p.E277*	ENST00000368806.1	37	c.829	CCDS30857.1	1	.	.	.	.	.	.	.	.	.	.	.	19.17	3.776385	0.70107	.	.	ENSG00000182898	ENST00000368806	.	.	.	5.49	2.51	0.30379	.	0.729658	0.11792	N	0.529038	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.32370	T	0.25	-0.5784	6.7395	0.23428	0.0:0.6793:0.0:0.3207	.	.	.	.	X	277	.	ENSP00000357796:E277X	E	-	1	0	TCHHL1	150325953	0.062000	0.20869	0.008000	0.14137	0.014000	0.08584	0.938000	0.28965	0.229000	0.21039	0.557000	0.71058	GAA	TCHHL1	-	NULL	ENSG00000182898		0.433	TCHHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCHHL1	HGNC	protein_coding	OTTHUMT00000036638.2		0.00	24	0	C	XM_060104		152059329	-1			no_errors	ENST00000368806	ensembl	human	known	74_37	nonsense	5.45	52	3	SNP	0.009	A
TJP2	9414	genome.wustl.edu	37	9	71869138	71869138	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr9:71869138G>T	ENST00000377245.4	+	23	3629	c.3421G>T	c.(3421-3423)Gag>Tag	p.E1141*	TJP2_ENST00000535702.1_Nonsense_Mutation_p.E1108*|TJP2_ENST00000348208.4_Nonsense_Mutation_p.E994*|TJP2_ENST00000453658.2_Nonsense_Mutation_p.E971*|TJP2_ENST00000539225.1_Nonsense_Mutation_p.E1172*	NM_004817.3	NP_004808.2	Q9UDY2	ZO2_HUMAN	tight junction protein 2	1141					apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|hippo signaling (GO:0035329)|nucleotide phosphorylation (GO:0046939)|response to organic substance (GO:0010033)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	guanylate kinase activity (GO:0004385)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(5)|lung(9)|prostate(3)|skin(3)|soft_tissue(1)|upper_aerodigestive_tract(1)	35						CAGACCCCCTGAGCCACAGAA	0.542																																																	0													122.0	119.0	120.0					9																	71869138		2203	4300	6503	SO:0001587	stop_gained	0			L27476	CCDS6627.1, CCDS6628.1, CCDS55314.1, CCDS55315.1, CCDS55316.1, CCDS55317.1	9q13-q21	2012-07-12	2012-07-12		ENSG00000119139	ENSG00000119139			11828	protein-coding gene	gene with protein product	"""Friedreich ataxia region gene X104 (tight junction protein ZO-2)"", ""zona occludens 2"""	607709	"""deafness, autosomal dominant 51"""	DFNA51		7951235, 20602916	Standard	NM_001170630		Approved	ZO-2, X104, ZO2	uc011lrv.2	Q9UDY2	OTTHUMG00000019978	ENST00000377245.4:c.3421G>T	9.37:g.71869138G>T	ENSP00000366453:p.Glu1141*		A2A3H9|B7Z2R8|B7Z7T6|F5H301|F5H886|Q15883|Q5VXL0|Q5VXL1|Q8N756|Q8NI14|Q99839|Q9UDY0|Q9UDY1	Nonsense_Mutation	SNP	pfam_PDZ,pfam_GK/Ca_channel_bsu,pfam_SH3_2,superfamily_PDZ,superfamily_P-loop_NTPase,superfamily_SH3_domain,smart_PDZ,smart_GK/Ca_channel_bsu,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin-like,prints_ZonOcculS2,prints_ZonOcculdens	p.E1172*	ENST00000377245.4	37	c.3514	CCDS6627.1	9	.	.	.	.	.	.	.	.	.	.	G	39	7.787973	0.98489	.	.	ENSG00000119139	ENST00000453658;ENST00000377245;ENST00000348208;ENST00000535702;ENST00000539225	.	.	.	5.79	5.79	0.91817	.	0.060203	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	.	20.0435	0.97601	0.0:0.0:1.0:0.0	.	.	.	.	X	971;1141;994;1108;1172	.	ENSP00000345893:E994X	E	+	1	0	TJP2	71058958	1.000000	0.71417	0.952000	0.39060	0.106000	0.19336	6.723000	0.74742	2.731000	0.93534	0.650000	0.86243	GAG	TJP2	-	NULL	ENSG00000119139		0.542	TJP2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	TJP2	HGNC	protein_coding	OTTHUMT00000052572.2	-	0.00	57	0	G	NM_201629		71869138	+1	tier1	-	no_errors	ENST00000539225	ensembl	human	known	74_37	nonsense	6.67	56	4	SNP	1.000	T
TLL1	7092	genome.wustl.edu	37	4	166915583	166915583	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr4:166915583G>T	ENST00000061240.2	+	4	1059	c.412G>T	c.(412-414)Ggg>Tgg	p.G138W	TLL1_ENST00000513213.1_Missense_Mutation_p.G138W|TLL1_ENST00000507499.1_Missense_Mutation_p.G138W	NM_012464.4	NP_036596.3	O43897	TLL1_HUMAN	tolloid-like 1	138					cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(21)|lung(26)|ovary(2)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		ACAATTCTCAGGGCAAAATGA	0.423																																																	0													76.0	73.0	74.0					4																	166915583		2203	4300	6503	SO:0001583	missense	0			AF282732	CCDS3811.1, CCDS56342.1	4q32-q33	2008-07-29			ENSG00000038295	ENSG00000038295			11843	protein-coding gene	gene with protein product		606742				10516436	Standard	NM_012464		Approved		uc003irh.2	O43897	OTTHUMG00000161112	ENST00000061240.2:c.412G>T	4.37:g.166915583G>T	ENSP00000061240:p.Gly138Trp		B2RMU2|Q96AN3|Q9NQS4	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Peptidase_M12A,pfam_EGF-like_Ca-bd_dom,superfamily_CUB_dom,smart_Peptidase_Metallo,smart_CUB_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pirsf_BMP_1/tolloid-like,pfscan_CUB_dom,pfscan_EG-like_dom,prints_Peptidase_M12A	p.G138W	ENST00000061240.2	37	c.412	CCDS3811.1	4	.	.	.	.	.	.	.	.	.	.	G	10.80	1.451763	0.26074	.	.	ENSG00000038295	ENST00000061240;ENST00000507499;ENST00000513213;ENST00000506144	T;T;T;T	0.78707	0.35;0.27;0.21;-1.2	5.4	4.5	0.54988	.	0.494420	0.21022	U	0.081485	T	0.63674	0.2531	N	0.14661	0.345	0.37912	D	0.931406	B;B	0.11235	0.004;0.001	B;B	0.08055	0.003;0.003	T	0.65278	-0.6207	10	0.62326	D	0.03	.	13.9478	0.64096	0.0:0.1516:0.8484:0.0	.	138;138	E9PD25;O43897	.;TLL1_HUMAN	W	138;138;138;38	ENSP00000061240:G138W;ENSP00000426082:G138W;ENSP00000422937:G138W;ENSP00000423748:G38W	ENSP00000061240:G138W	G	+	1	0	TLL1	167135033	1.000000	0.71417	1.000000	0.80357	0.030000	0.12068	6.149000	0.71795	2.522000	0.85027	0.655000	0.94253	GGG	TLL1	-	pirsf_BMP_1/tolloid-like	ENSG00000038295		0.423	TLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLL1	HGNC	protein_coding	OTTHUMT00000363821.1		0.00	61	0	G			166915583	+1			no_errors	ENST00000061240	ensembl	human	known	74_37	missense	5.97	63	4	SNP	1.000	T
TMEM106A	113277	genome.wustl.edu	37	17	41369714	41369714	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr17:41369714G>T	ENST00000331615.3	+	9	920	c.683G>T	c.(682-684)tGt>tTt	p.C228F	TMEM106A_ENST00000541594.1_Missense_Mutation_p.C180F|LINC00854_ENST00000427995.1_RNA|TMEM106A_ENST00000588659.1_Missense_Mutation_p.C228F|TMEM106A_ENST00000536052.1_Missense_Mutation_p.C181F|LINC00854_ENST00000593624.1_RNA|LINC00854_ENST00000595400.1_RNA	NM_145041.1	NP_659478.1	Q96A25	T106A_HUMAN	transmembrane protein 106A	228						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|endometrium(2)|large_intestine(1)|lung(6)|prostate(1)	11		Breast(137;0.0164)		BRCA - Breast invasive adenocarcinoma(366;0.0917)		ACCCTGACCTGTTCATACCTG	0.582																																																	0													199.0	189.0	193.0					17																	41369714		2203	4296	6499	SO:0001583	missense	0			AK056132	CCDS11462.1, CCDS74073.1	17q21.31	2012-01-23			ENSG00000184988	ENSG00000184988			28288	protein-coding gene	gene with protein product							Standard	XM_006721658		Approved	MGC20235	uc002idn.1	Q96A25		ENST00000331615.3:c.683G>T	17.37:g.41369714G>T	ENSP00000330774:p.Cys228Phe		A8K2X2|B7Z698	Missense_Mutation	SNP	pfam_DUF1356_TMEM106	p.C228F	ENST00000331615.3	37	c.683	CCDS11462.1	17	.	.	.	.	.	.	.	.	.	.	G	7.826	0.718875	0.15372	.	.	ENSG00000184988	ENST00000331615;ENST00000536052;ENST00000541594	T;T;T	0.20598	2.06;2.06;2.06	4.67	-2.77	0.05877	.	0.699137	0.14581	N	0.310849	T	0.13927	0.0337	L	0.46741	1.465	0.23445	N	0.997669	B;B;B	0.34181	0.44;0.192;0.297	B;B;B	0.30782	0.089;0.12;0.12	T	0.27839	-1.0062	10	0.19147	T	0.46	-21.3164	9.6208	0.39721	0.6581:0.0:0.3419:0.0	.	181;180;228	B7Z779;B7Z698;Q96A25	.;.;T106A_HUMAN	F	228;181;180	ENSP00000330774:C228F;ENSP00000439835:C181F;ENSP00000439844:C180F	ENSP00000330774:C228F	C	+	2	0	TMEM106A	38725240	0.010000	0.17322	0.095000	0.20976	0.877000	0.50540	-0.130000	0.10498	-0.370000	0.08016	0.591000	0.81541	TGT	TMEM106A	-	pfam_DUF1356_TMEM106	ENSG00000184988		0.582	TMEM106A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM106A	HGNC	protein_coding	OTTHUMT00000453470.2	-	0.00	34	0	G	NM_145041		41369714	+1	tier1	-	no_errors	ENST00000331615	ensembl	human	known	74_37	missense	7.55	49	4	SNP	0.042	T
TMEM59L	25789	genome.wustl.edu	37	19	18726873	18726873	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr19:18726873G>T	ENST00000600490.1	+	5	682	c.497G>T	c.(496-498)gGa>gTa	p.G166V	TMEM59L_ENST00000262817.3_Missense_Mutation_p.G166V			Q9UK28	TM59L_HUMAN	transmembrane protein 59-like	166						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)|skin(2)	13						TCAGCCCAGGGATTTGTCTCC	0.542																																																	0													137.0	129.0	132.0					19																	18726873		2203	4300	6503	SO:0001583	missense	0			AF186264	CCDS12383.1	19p12	2008-02-05	2007-03-14	2007-03-14		ENSG00000105696			13237	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 4"""	C19orf4		10527841	Standard	NM_012109		Approved	BSMAP	uc002njy.4	Q9UK28		ENST00000600490.1:c.497G>T	19.37:g.18726873G>T	ENSP00000470879:p.Gly166Val			Missense_Mutation	SNP	pfam_Uncharacterised_TMEM59	p.G166V	ENST00000600490.1	37	c.497	CCDS12383.1	19	.	.	.	.	.	.	.	.	.	.	G	20.9	4.070237	0.76301	.	.	ENSG00000105696	ENST00000262817	T	0.43688	0.94	5.11	4.05	0.47172	.	0.084716	0.85682	D	0.000000	T	0.41811	0.1175	N	0.22421	0.69	0.80722	D	1	D	0.54601	0.967	P	0.54174	0.744	T	0.39761	-0.9598	10	0.62326	D	0.03	-21.76	13.0124	0.58739	0.0797:0.0:0.9203:0.0	.	166	Q9UK28	TM59L_HUMAN	V	166	ENSP00000262817:G166V	ENSP00000262817:G166V	G	+	2	0	TMEM59L	18587873	1.000000	0.71417	0.967000	0.41034	0.941000	0.58515	6.947000	0.75959	1.136000	0.42199	0.491000	0.48974	GGA	TMEM59L	-	pfam_Uncharacterised_TMEM59	ENSG00000105696		0.542	TMEM59L-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	TMEM59L	HGNC	protein_coding	OTTHUMT00000465143.2		0.00	43	0	G			18726873	+1			no_errors	ENST00000262817	ensembl	human	known	74_37	missense	7.04	66	5	SNP	1.000	T
TNC	3371	genome.wustl.edu	37	9	117822230	117822230	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr9:117822230C>T	ENST00000350763.4	-	14	4496	c.4085G>A	c.(4084-4086)gGc>gAc	p.G1362D	TNC_ENST00000345230.3_Intron|TNC_ENST00000535648.1_Intron|TNC_ENST00000542877.1_Intron|TNC_ENST00000341037.4_Missense_Mutation_p.G1271D|TNC_ENST00000537320.1_Intron|TNC_ENST00000340094.3_Intron|TNC_ENST00000346706.3_Intron|TNC_ENST00000423613.2_Missense_Mutation_p.G1362D	NM_002160.3	NP_002151.2	P24821	TENA_HUMAN	tenascin C	1362	Fibronectin type-III 9. {ECO:0000255|PROSITE-ProRule:PRU00316}.				bud outgrowth involved in lung branching (GO:0060447)|cell adhesion (GO:0007155)|cellular response to prostaglandin D stimulus (GO:0071799)|cellular response to retinoic acid (GO:0071300)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|mesenchymal-epithelial cell signaling involved in prostate gland development (GO:0060739)|negative regulation of cell adhesion (GO:0007162)|neuromuscular junction development (GO:0007528)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|prostate gland epithelium morphogenesis (GO:0060740)|response to ethanol (GO:0045471)|response to fibroblast growth factor (GO:0071774)|response to mechanical stimulus (GO:0009612)|response to wounding (GO:0009611)|wound healing (GO:0042060)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	syndecan binding (GO:0045545)			NS(3)|breast(5)|central_nervous_system(4)|endometrium(8)|kidney(6)|large_intestine(32)|liver(1)|lung(39)|ovary(1)|pancreas(2)|prostate(5)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	120						GAGTCTGAGGCCATCCCAGCC	0.498																																																	0													61.0	48.0	52.0					9																	117822230		2203	4300	6503	SO:0001583	missense	0				CCDS6811.1	9q33.1	2014-01-28	2008-07-31	2002-06-07	ENSG00000041982	ENSG00000041982		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	5318	protein-coding gene	gene with protein product	"""hexabrachion (tenascin)"""	187380	"""hexabrachion (tenascin C, cytotactin)"", ""deafness, autosomal dominant 56"""	HXB, DFNA56		1704365, 1707164, 23936043	Standard	NM_002160		Approved	TN, MGC167029	uc004bjj.4	P24821	OTTHUMG00000021010	ENST00000350763.4:c.4085G>A	9.37:g.117822230C>T	ENSP00000265131:p.Gly1362Asp		C9IYT7|C9J575|C9J6D9|C9J848|Q14583|Q15567|Q5T7S3	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C_dom,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C_dom,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C_dom,pfscan_EG-like_dom,pfscan_Fibronectin_type3	p.G1362D	ENST00000350763.4	37	c.4085	CCDS6811.1	9	.	.	.	.	.	.	.	.	.	.	C	17.58	3.424147	0.62733	.	.	ENSG00000041982	ENST00000350763;ENST00000341037;ENST00000423613	T;T;T	0.56776	0.44;0.44;0.44	5.43	3.48	0.39840	Fibronectin, type III (4);	0.353895	0.26582	N	0.023574	T	0.64338	0.2589	L	0.52011	1.625	0.80722	D	1	D;B	0.76494	0.999;0.01	D;B	0.76575	0.988;0.016	T	0.66160	-0.5993	10	0.66056	D	0.02	.	11.4752	0.50293	0.1097:0.6589:0.2313:0.0	.	1362;1362	E9PC84;P24821	.;TENA_HUMAN	D	1362;1271;1362	ENSP00000265131:G1362D;ENSP00000339553:G1271D;ENSP00000411406:G1362D	ENSP00000339553:G1271D	G	-	2	0	TNC	116862051	0.998000	0.40836	0.999000	0.59377	0.996000	0.88848	1.055000	0.30467	1.224000	0.43551	0.563000	0.77884	GGC	TNC	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000041982		0.498	TNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNC	HGNC	protein_coding	OTTHUMT00000055418.2	-	0.00	56	0	C	NM_002160		117822230	-1	tier1	-	no_errors	ENST00000350763	ensembl	human	known	74_37	missense	6.15	61	4	SNP	0.999	T
TNPO1	3842	genome.wustl.edu	37	5	72201229	72201229	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr5:72201229G>T	ENST00000337273.5	+	24	3115	c.2689G>T	c.(2689-2691)Ggt>Tgt	p.G897C	TNPO1_ENST00000506351.2_Missense_Mutation_p.G889C|TNPO1_ENST00000454282.1_Missense_Mutation_p.G847C|TNPO1_ENST00000523768.1_Missense_Mutation_p.G847C	NM_002270.3	NP_002261.3	Q92973	TNPO1_HUMAN	transportin 1	897					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|protein import into nucleus, translocation (GO:0000060)|RNA metabolic process (GO:0016070)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	nuclear localization sequence binding (GO:0008139)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(10)|lung(6)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	36		Lung NSC(167;0.0053)|Ovarian(174;0.0175)		OV - Ovarian serous cystadenocarcinoma(47;6.14e-54)		AGCTTTTTATGGTGTTTAATC	0.373																																																	0													79.0	82.0	81.0					5																	72201229		2203	4300	6503	SO:0001583	missense	0			U70322	CCDS4016.1, CCDS43329.1	5q13.1	2009-01-12	2004-01-29	2004-01-30	ENSG00000083312	ENSG00000083312		"""Importins"""	6401	protein-coding gene	gene with protein product	"""importin 2"""	602901	"""karyopherin (importin) beta 2"""	KPNB2		8808633, 9144189	Standard	NM_153188		Approved	MIP, TRN, IPO2, MIP1	uc003kci.4	Q92973	OTTHUMG00000100967	ENST00000337273.5:c.2689G>T	5.37:g.72201229G>T	ENSP00000336712:p.Gly897Cys		B4DVC6|Q92957|Q92975	Missense_Mutation	SNP	pfam_HEAT,pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.G897C	ENST00000337273.5	37	c.2689	CCDS43329.1	5	.	.	.	.	.	.	.	.	.	.	G	27.4	4.831521	0.91036	.	.	ENSG00000083312	ENST00000337273;ENST00000454282;ENST00000523768;ENST00000506351	T;T;T;T	0.21543	2.02;2.0;2.0;2.01	5.52	5.52	0.82312	Armadillo-like helical (1);	0.098040	0.64402	D	0.000001	T	0.51924	0.1703	M	0.83012	2.62	0.80722	D	1	D;D	0.76494	0.999;0.996	D;P	0.68621	0.959;0.891	T	0.57021	-0.7882	10	0.87932	D	0	-20.1671	19.5112	0.95142	0.0:0.0:1.0:0.0	.	847;897	Q92973-3;Q92973	.;TNPO1_HUMAN	C	897;847;847;889	ENSP00000336712:G897C;ENSP00000398524:G847C;ENSP00000428899:G847C;ENSP00000425118:G889C	ENSP00000336712:G897C	G	+	1	0	TNPO1	72236985	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.471000	0.97696	2.632000	0.89209	0.644000	0.83932	GGT	TNPO1	-	NULL	ENSG00000083312		0.373	TNPO1-001	KNOWN	basic|CCDS	protein_coding	TNPO1	HGNC	protein_coding	OTTHUMT00000218577.3	-	0.00	102	0	G	NM_002270		72201229	+1	tier1	-	no_errors	ENST00000337273	ensembl	human	known	74_37	missense	38.14	60	37	SNP	1.000	T
TOMM40	10452	genome.wustl.edu	37	19	45406379	45406379	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr19:45406379C>T	ENST00000426677.2	+	9	1219	c.1039C>T	c.(1039-1041)Cac>Tac	p.H347Y	APOE_ENST00000252486.4_5'Flank|TOMM40_ENST00000405636.2_Missense_Mutation_p.H347Y|TOMM40_ENST00000252487.5_Missense_Mutation_p.H347Y|TOMM40_ENST00000592434.1_3'UTR	NM_001128917.1	NP_001122389.1	O96008	TOM40_HUMAN	translocase of outer mitochondrial membrane 40 homolog (yeast)	347					cellular protein metabolic process (GO:0044267)|ion transport (GO:0006811)|protein targeting to mitochondrion (GO:0006626)|protein transmembrane transport (GO:0071806)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of mitochondrial outer membrane (GO:0031307)|mitochondrial outer membrane translocase complex (GO:0005742)|pore complex (GO:0046930)	porin activity (GO:0015288)|protein transmembrane transporter activity (GO:0008320)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|ovary(1)	5	Lung NSC(12;0.0018)|all_lung(12;0.00481)			OV - Ovarian serous cystadenocarcinoma(262;0.0033)|Epithelial(262;0.176)		CTTCCTGAATCACCGCAAGAA	0.632																																																	0													76.0	68.0	71.0					19																	45406379		2203	4300	6503	SO:0001583	missense	0			AF043250	CCDS12646.1	19q13	2008-07-04				ENSG00000130204			18001	protein-coding gene	gene with protein product		608061				10980201, 15644312	Standard	NM_006114		Approved	PEREC1, D19S1177E, C19orf1, TOM40, PER-EC1	uc002paa.4	O96008		ENST00000426677.2:c.1039C>T	19.37:g.45406379C>T	ENSP00000410339:p.His347Tyr		Q86VW4|Q8WY09|Q8WY10|Q8WY11|Q9BR95	Missense_Mutation	SNP	pfam_Porin_Euk/Tom40	p.H347Y	ENST00000426677.2	37	c.1039	CCDS12646.1	19	.	.	.	.	.	.	.	.	.	.	C	22.9	4.354672	0.82243	.	.	ENSG00000130204	ENST00000426677;ENST00000405636;ENST00000252487	T;T;T	0.45668	0.89;0.89;0.89	4.46	4.46	0.54185	.	0.000000	0.85682	D	0.000000	T	0.67496	0.2899	M	0.88377	2.95	0.58432	D	0.999999	D	0.65815	0.995	D	0.64595	0.927	T	0.75402	-0.3330	10	0.66056	D	0.02	-16.6372	14.6135	0.68531	0.0:1.0:0.0:0.0	.	347	O96008	TOM40_HUMAN	Y	347	ENSP00000410339:H347Y;ENSP00000385184:H347Y;ENSP00000252487:H347Y	ENSP00000252487:H347Y	H	+	1	0	TOMM40	50098219	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.476000	0.81055	2.009000	0.58944	0.561000	0.74099	CAC	TOMM40	-	pfam_Porin_Euk/Tom40	ENSG00000130204		0.632	TOMM40-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TOMM40	HGNC	protein_coding	OTTHUMT00000453241.1	-	0.00	169	0	C			45406379	+1	tier1	-	no_errors	ENST00000252487	ensembl	human	known	74_37	missense	35.29	110	60	SNP	1.000	T
TP53	7157	genome.wustl.edu	37	17	7579563	7579563	+	Frame_Shift_Del	DEL	C	C	-			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr17:7579563delC	ENST00000269305.4	-	4	313	c.124delG	c.(124-126)gatfs	p.D42fs	TP53_ENST00000359597.4_Frame_Shift_Del_p.D42fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Frame_Shift_Del_p.D42fs|TP53_ENST00000420246.2_Frame_Shift_Del_p.D42fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.D42fs|TP53_ENST00000413465.2_Frame_Shift_Del_p.D42fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	42	Interaction with HRMT1L2.|Transcription activation (acidic).		D -> Y (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.S37fs*79(1)|p.D42Y(1)|p.P13fs*18(1)|p.S33fs*23(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGCATCAAATCATCCATTGCT	0.607		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	12	Whole gene deletion(8)|Deletion - Frameshift(3)|Substitution - Missense(1)	bone(4)|central_nervous_system(2)|upper_aerodigestive_tract(1)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)|ovary(1)|prostate(1)											168.0	165.0	166.0					17																	7579563		2203	4300	6503	SO:0001589	frameshift_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.124delG	17.37:g.7579563delC	ENSP00000269305:p.Asp42fs		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.D42fs	ENST00000269305.4	37	c.124	CCDS11118.1	17																																																																																			TP53	-	NULL	ENSG00000141510		0.607	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1		0.00	35	0	C	NM_000546		7579563	-1	tier1		no_errors	ENST00000269305	ensembl	human	known	74_37	frame_shift_del	83.10	12	59	DEL	0.000	-
TPTE	7179	genome.wustl.edu	37	21	10910363	10910363	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr21:10910363C>T	ENST00000361285.4	-	22	1722	c.1393G>A	c.(1393-1395)Gat>Aat	p.D465N	TPTE_ENST00000342420.5_Missense_Mutation_p.D427N|TPTE_ENST00000298232.7_Missense_Mutation_p.D447N|TPTE_ENST00000415664.2_5'UTR	NM_199261.2	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	465	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(19)|lung(76)|ovary(2)|prostate(2)|skin(8)|urinary_tract(1)	130			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TCGAATACATCAATTAATATT	0.348																																																	0													251.0	224.0	233.0					21																	10910363		2203	4300	6503	SO:0001583	missense	0			AF007118	CCDS74771.1, CCDS74772.1, CCDS74773.1	21p11	2011-06-09			ENSG00000166157	ENSG00000274391		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	12023	protein-coding gene	gene with protein product	"""PTEN-related tyrosine phosphatase"", ""cancer/testis antigen 44"""	604336				10830953, 14659893	Standard	NM_001290224		Approved	PTEN2, CT44	uc002yip.1	P56180	OTTHUMG00000074127	ENST00000361285.4:c.1393G>A	21.37:g.10910363C>T	ENSP00000355208:p.Asp465Asn		B2RAP7|C9J6D6|C9JKK8|Q6XPS4|Q6XPS5|Q71JA8|Q8NCS8	Missense_Mutation	SNP	pfam_Tensin_phosphatase_C2-dom,pfam_Dual-sp_phosphatase_cat-dom,pfam_Ion_trans_dom,superfamily_C2_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.D465N	ENST00000361285.4	37	c.1393	CCDS13560.2	21	.	.	.	.	.	.	.	.	.	.	.	0.005	-2.214496	0.00289	.	.	ENSG00000166157	ENST00000298232;ENST00000361285;ENST00000342420	D;D;D	0.84589	-1.87;-1.87;-1.87	2.25	-4.5	0.03493	Tensin phosphatase, C2 domain (2);C2 calcium/lipid-binding domain, CaLB (1);	0.831203	0.10819	N	0.630754	T	0.59851	0.2224	N	0.05259	-0.085	0.09310	N	1	B;B;B	0.09022	0.0;0.0;0.002	B;B;B	0.08055	0.002;0.002;0.003	T	0.33752	-0.9856	10	0.11485	T	0.65	0.3726	2.1387	0.03769	0.1089:0.167:0.3025:0.4216	.	427;447;465	P56180-3;P56180-2;P56180	.;.;TPTE_HUMAN	N	447;465;427	ENSP00000298232:D447N;ENSP00000355208:D465N;ENSP00000344441:D427N	ENSP00000298232:D447N	D	-	1	0	TPTE	9932234	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.293000	0.02770	-4.057000	0.00077	-1.140000	0.01884	GAT	TPTE	-	pfam_Tensin_phosphatase_C2-dom,superfamily_C2_dom,pfscan_Tensin_phosphatase_C2-dom	ENSG00000166157		0.348	TPTE-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TPTE	HGNC	protein_coding	OTTHUMT00000157413.1	-	0.00	127	0	C			10910363	-1	tier1	-	no_errors	ENST00000361285	ensembl	human	known	74_37	missense	9.09	230	23	SNP	0.000	T
TRDN	10345	genome.wustl.edu	37	6	123786032	123786033	+	Intron	INS	-	-	A	rs201431159		TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr6:123786032_123786033insA	ENST00000398178.3	-	10	953				TRDN_ENST00000546248.1_Frame_Shift_Ins_p.S297fs|TRDN_ENST00000334268.4_Intron|RP11-532N4.2_ENST00000589182.1_RNA|RP11-532N4.2_ENST00000587106.2_RNA|RP11-532N4.2_ENST00000434768.1_RNA|RP11-532N4.2_ENST00000587049.1_RNA|RP11-532N4.2_ENST00000418467.2_RNA|RP11-532N4.2_ENST00000427828.1_RNA	NM_006073.3	NP_006064.2	Q13061	TRDN_HUMAN	triadin						cellular calcium ion homeostasis (GO:0006874)|cytoplasmic microtubule organization (GO:0031122)|endoplasmic reticulum membrane organization (GO:0090158)|heart contraction (GO:0060047)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|myotube differentiation (GO:0014902)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|positive regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901846)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to organic cyclic compound (GO:0014070)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)	ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(1)|kidney(1)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	41				GBM - Glioblastoma multiforme(226;0.184)		AGATCTTTAAGAAAAAAAAAAG	0.386																																																	0																																										SO:0001627	intron_variant	0			U18985	CCDS59035.1, CCDS75511.1	6q22.31	2008-05-15			ENSG00000186439	ENSG00000186439			12261	protein-coding gene	gene with protein product		603283				7588753	Standard	NM_001251987		Approved		uc003pzj.2	Q13061	OTTHUMG00000015497	ENST00000398178.3:c.931+17->T	6.37:g.123786042_123786042dupA			A5D6W5|F5H2W7|Q6NSB8	Frame_Shift_Ins	INS	pfam_Asp-B-hydro/Triadin_dom	p.S297fs	ENST00000398178.3	37	c.890_889	CCDS55053.1	6																																																																																			TRDN	-	NULL	ENSG00000186439		0.386	TRDN-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRDN	HGNC	protein_coding			0.00	32	0	-			123786033	-1	tier1		no_errors	ENST00000546248	ensembl	human	known	74_37	frame_shift_ins	11.43	31	4	INS	0.000:0.000	A
TRIM27	5987	genome.wustl.edu	37	6	28876806	28876806	+	Missense_Mutation	SNP	A	A	C			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr6:28876806A>C	ENST00000377199.3	-	5	1186	c.830T>G	c.(829-831)aTc>aGc	p.I277S	TRIM27_ENST00000498117.1_5'Flank|TRIM27_ENST00000377194.3_Missense_Mutation_p.I277S	NM_006510.4	NP_006501.1	P14373	TRI27_HUMAN	tripartite motif containing 27	277					Arp2/3 complex-mediated actin nucleation (GO:0034314)|cell proliferation (GO:0008283)|innate immune response (GO:0045087)|interferon-gamma secretion (GO:0072643)|negative regulation of adaptive immune response (GO:0002820)|negative regulation of calcium ion import (GO:0090281)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of interleukin-2 secretion (GO:1900041)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein K63-linked ubiquitination (GO:0070534)|protein trimerization (GO:0070206)|retrograde transport, endosome to Golgi (GO:0042147)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(2)|lung(6)|ovary(1)	10						AAAAATGTGGATTTTCTCTTG	0.368			T	RET	papillary thyroid																																			Dom	yes		6	6p22	5987	tripartite motif-containing 27		E	0													84.0	86.0	85.0					6																	28876806		2203	4300	6503	SO:0001583	missense	0			Z58939	CCDS4654.1	6p22	2013-01-09	2011-01-25	2006-09-26	ENSG00000204713	ENSG00000204713		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	9975	protein-coding gene	gene with protein product		602165	"""ret finger protein"", ""tripartite motif-containing 27"""	RFP		8114113	Standard	NM_006510		Approved	RNF76	uc003nlr.3	P14373	OTTHUMG00000031215	ENST00000377199.3:c.830T>G	6.37:g.28876806A>C	ENSP00000366404:p.Ile277Ser		A2BE15|Q5RJA8|Q5ST26|Q6LA73|Q6NXR9|Q9BZY6|Q9UJL3	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin,prints_Znf_B-box_chordata	p.I277S	ENST00000377199.3	37	c.830	CCDS4654.1	6	.	.	.	.	.	.	.	.	.	.	A	13.97	2.397391	0.42512	.	.	ENSG00000204713	ENST00000377199;ENST00000377194	T;T	0.62364	0.55;0.03	4.29	4.29	0.51040	.	0.000000	0.53938	D	0.000054	T	0.35098	0.0920	L	0.38175	1.15	0.36806	D	0.885623	B;B;B	0.22983	0.078;0.001;0.002	B;B;B	0.19666	0.026;0.003;0.002	T	0.39603	-0.9606	10	0.48119	T	0.1	.	10.1172	0.42598	1.0:0.0:0.0:0.0	.	344;277;277	Q59EC6;P14373-2;P14373	.;.;TRI27_HUMAN	S	277	ENSP00000366404:I277S;ENSP00000366399:I277S	ENSP00000366399:I277S	I	-	2	0	TRIM27	28984785	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.422000	0.44696	2.161000	0.67846	0.533000	0.62120	ATC	TRIM27	-	NULL	ENSG00000204713		0.368	TRIM27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM27	HGNC	protein_coding	OTTHUMT00000076442.2	-	0.00	56	0	A	NM_030950		28876806	-1	tier1	-	no_errors	ENST00000377199	ensembl	human	known	74_37	missense	33.73	55	28	SNP	1.000	C
TRIM26	7726	genome.wustl.edu	37	6	30166680	30166680	+	Silent	SNP	G	G	T	rs367664883		TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr6:30166680G>T	ENST00000454678.2	-	4	637	c.201C>A	c.(199-201)ccC>ccA	p.P67P	TRIM26_ENST00000453195.1_Silent_p.P67P|TRIM26_ENST00000487829.1_5'UTR|TRIM26_ENST00000437089.1_Silent_p.P67P	NM_003449.4	NP_003440.1	Q12899	TRI26_HUMAN	tripartite motif containing 26	67					innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)	cytoplasm (GO:0005737)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|zinc ion binding (GO:0008270)	p.P67P(1)		lung(1)|ovary(2)	3						GTTGCCACACGGGTCGGATGT	0.622																																																	1	Substitution - coding silent(1)	large_intestine(1)											72.0	69.0	70.0					6																	30166680		1509	2708	4217	SO:0001819	synonymous_variant	0			AB088090	CCDS4678.1	6p21.3	2013-01-09	2011-01-25	2001-11-23	ENSG00000234127	ENSG00000234127		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	12962	protein-coding gene	gene with protein product		600830	"""tripartite motif-containing 26"""	ZNF173		8530076	Standard	NM_003449		Approved	RNF95	uc003npt.3	Q12899	OTTHUMG00000031041	ENST00000454678.2:c.201C>A	6.37:g.30166680G>T			A6NG96|Q5SRL2	Silent	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.P67	ENST00000454678.2	37	c.201	CCDS4678.1	6																																																																																			TRIM26	-	NULL	ENSG00000234127		0.622	TRIM26-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM26	HGNC	protein_coding	OTTHUMT00000253442.1		0.00	26	0	G	NM_003449		30166680	-1			no_errors	ENST00000437089	ensembl	human	known	74_37	silent	5.97	63	4	SNP	0.324	T
TRERF1	55809	genome.wustl.edu	37	6	42211080	42211080	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr6:42211080G>T	ENST00000372922.4	-	15	3327	c.2765C>A	c.(2764-2766)gCt>gAt	p.A922D	TRERF1_ENST00000541110.1_Missense_Mutation_p.A942D|TRERF1_ENST00000354325.2_Missense_Mutation_p.A839D|TRERF1_ENST00000340840.2_Missense_Mutation_p.A839D|TRERF1_ENST00000372917.4_Missense_Mutation_p.A839D	NM_033502.2	NP_277037.1	Q96PN7	TREF1_HUMAN	transcriptional regulating factor 1	922	Interacts with CREBBP.|SANT. {ECO:0000255|PROSITE- ProRule:PRU00624}.				cholesterol catabolic process (GO:0006707)|homeostatic process (GO:0042592)|multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hormone biosynthetic process (GO:0046885)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|steroid biosynthetic process (GO:0006694)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|RNA polymerase II transcription cofactor activity (GO:0001104)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(2)|endometrium(7)|kidney(1)|large_intestine(12)|lung(13)|ovary(3)|pancreas(1)|skin(3)|urinary_tract(2)	45	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			CACGCACTGAGCCACCGTCTT	0.502																																																	0													124.0	107.0	113.0					6																	42211080		2203	4300	6503	SO:0001583	missense	0			AF297872	CCDS4867.1, CCDS75455.1	6p21.1-p12.1	2012-09-25			ENSG00000124496	ENSG00000124496			18273	protein-coding gene	gene with protein product		610322	"""breast cancer anti-estrogen resistance 2"""	BCAR2		11349124	Standard	XM_005249223		Approved	TReP-132, HSA277276, RAPA, dJ139D8.5	uc003osd.2	Q96PN7	OTTHUMG00000014698	ENST00000372922.4:c.2765C>A	6.37:g.42211080G>T	ENSP00000362013:p.Ala922Asp		Q05GC6|Q7Z6T2|Q7Z6T3|Q9NQ72|Q9NQ73|Q9NUN9	Missense_Mutation	SNP	pfam_ELM2_dom,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_SANT/Myb,pfscan_ELM2_dom,pfscan_Znf_C2H2	p.A942D	ENST00000372922.4	37	c.2825	CCDS4867.1	6	.	.	.	.	.	.	.	.	.	.	g	33	5.242552	0.95272	.	.	ENSG00000124496	ENST00000541110;ENST00000372917;ENST00000372922;ENST00000340840;ENST00000354325	T;T;T;T;T	0.35789	1.29;1.29;1.29;1.29;1.29	6.16	6.16	0.99307	SANT domain, DNA binding (1);Homeodomain-like (1);SANT, eukarya (1);	0.000000	0.64402	D	0.000017	T	0.59810	0.2221	M	0.80616	2.505	0.51012	D	0.999906	D;D;D;D;P	0.76494	0.999;0.999;0.999;0.999;0.928	D;D;D;D;P	0.70016	0.967;0.927;0.927;0.967;0.828	T	0.61441	-0.7062	10	0.87932	D	0	-11.2222	20.4596	0.99160	0.0:0.0:1.0:0.0	.	839;942;922;678;678	Q96PN7-4;Q05GC8;Q96PN7;Q96PN7-2;Q96PN7-3	.;.;TREF1_HUMAN;.;.	D	942;839;922;839;839	ENSP00000439689:A942D;ENSP00000362008:A839D;ENSP00000362013:A922D;ENSP00000339438:A839D;ENSP00000346285:A839D	ENSP00000339438:A839D	A	-	2	0	TRERF1	42319058	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.989000	0.76219	2.937000	0.99478	0.651000	0.88453	GCT	TRERF1	-	superfamily_Homeodomain-like,smart_SANT/Myb	ENSG00000124496		0.502	TRERF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRERF1	HGNC	protein_coding	OTTHUMT00000040551.2		0.00	48	0	G	NM_033502		42211080	-1			no_errors	ENST00000541110	ensembl	human	known	74_37	missense	5.00	76	4	SNP	1.000	T
TRIM64C	646754	genome.wustl.edu	37	11	49080635	49080635	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr11:49080635C>A	ENST00000530230.1	-	1	29	c.30G>T	c.(28-30)caG>caT	p.Q10H		NM_001206631.1	NP_001193560.1	A6NLI5	TR64C_HUMAN	tripartite motif containing 64C	10						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|stomach(1)	2						TGAGCTCATTCTGGAAGACTC	0.428																																																	0																																										SO:0001583	missense	0				CCDS73287.1	11p11.12	2014-04-02	2011-01-25		ENSG00000214891	ENSG00000214891		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	37148	protein-coding gene	gene with protein product			"""tripartite motif-containing 64C"""				Standard	NM_001206631		Approved		uc021qiy.1	A6NLI5	OTTHUMG00000166752	ENST00000530230.1:c.30G>T	11.37:g.49080635C>A	ENSP00000431987:p.Gln10His			Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl_sf,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.Q10H	ENST00000530230.1	37	c.30		11	.	.	.	.	.	.	.	.	.	.	C	12.73	2.024593	0.35701	.	.	ENSG00000214891	ENST00000530230	T	0.17528	2.27	1.55	1.55	0.23275	.	.	.	.	.	T	0.23926	0.0579	M	0.64260	1.97	0.21290	N	0.99973	.	.	.	.	.	.	T	0.13791	-1.0496	7	0.66056	D	0.02	.	6.6145	0.22769	0.0:1.0:0.0:0.0	.	.	.	.	H	10	ENSP00000431987:Q10H	ENSP00000431987:Q10H	Q	-	3	2	TRIM64C	49037211	0.256000	0.24012	0.340000	0.25575	0.075000	0.17131	0.401000	0.20948	1.206000	0.43276	0.184000	0.17185	CAG	TRIM64C	-	NULL	ENSG00000214891		0.428	TRIM64C-001	KNOWN	basic|appris_principal	protein_coding	TRIM64C	HGNC	protein_coding	OTTHUMT00000391366.1	-	0.00	76	0	C			49080635	-1	tier1	-	no_errors	ENST00000530230	ensembl	human	known	74_37	missense	6.56	57	4	SNP	0.743	A
TRMT13	54482	genome.wustl.edu	37	1	100609798	100609798	+	Intron	SNP	G	G	A			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr1:100609798G>A	ENST00000370141.2	+	9	823				TRMT13_ENST00000493651.1_3'UTR	NM_019083.2	NP_061956.2	Q9NUP7	TRM13_HUMAN	tRNA methyltransferase 13 homolog (S. cerevisiae)						tRNA processing (GO:0008033)		metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)										GATATCTTATGTTTACAACTC	0.358																																																	0																																										SO:0001627	intron_variant	0			BC075811	CCDS765.1	1p21.2	2012-06-07	2012-06-07	2012-06-07	ENSG00000122435	ENSG00000122435			25502	protein-coding gene	gene with protein product			"""coiled-coil domain containing 76"""	CCDC76		11799066	Standard	NM_019083		Approved	FLJ10287, FLJ11219	uc001dsv.3	Q9NUP7	OTTHUMG00000010841	ENST00000370141.2:c.817+99G>A	1.37:g.100609798G>A			Q5VVL0|Q9NW65	RNA	SNP	-	NULL	ENST00000370141.2	37	NULL	CCDS765.1	1																																																																																			TRMT13	-	-	ENSG00000122435		0.358	TRMT13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRMT13	HGNC	protein_coding	OTTHUMT00000029919.1	-	0.00	22	0	G	NM_019083		100609798	+1	tier1	-	no_errors	ENST00000493651	ensembl	human	known	74_37	rna	33.33	16	8	SNP	0.000	A
UBN1	29855	genome.wustl.edu	37	16	4927081	4927081	+	Silent	SNP	C	C	G			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr16:4927081C>G	ENST00000396658.4	+	15	3937	c.3234C>G	c.(3232-3234)gcC>gcG	p.A1078A	UBN1_ENST00000590769.1_Silent_p.A1078A|UBN1_ENST00000262376.6_Silent_p.A1078A|UBN1_ENST00000545171.1_Silent_p.A1078A	NM_016936.3	NP_058632.2	Q9NPG3	UBN1_HUMAN	ubinuclein 1	1078					chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of phosphatase activity (GO:0010923)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|tight junction (GO:0005923)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(6)|kidney(4)|large_intestine(10)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38						CAGGCCCTGCCCCCGGGTCCT	0.577																																																	0													139.0	146.0	144.0					16																	4927081		2197	4300	6497	SO:0001819	synonymous_variant	0			AF108460	CCDS10525.1, CCDS73822.1	16p13.3	2010-11-09			ENSG00000118900	ENSG00000118900			12506	protein-coding gene	gene with protein product		609771				10725330	Standard	XM_005255277		Approved		uc002cyb.3	Q9NPG3	OTTHUMG00000129531	ENST00000396658.4:c.3234C>G	16.37:g.4927081C>G			B7Z6D3|D3DUE8|Q13079|Q9P1P7	Silent	SNP	NULL	p.A1078	ENST00000396658.4	37	c.3234	CCDS10525.1	16																																																																																			UBN1	-	NULL	ENSG00000118900		0.577	UBN1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	UBN1	HGNC	protein_coding	OTTHUMT00000251719.1	-	0.00	32	0	C	NM_016936		4927081	+1	tier1	-	no_errors	ENST00000262376	ensembl	human	known	74_37	silent	54.35	21	25	SNP	0.972	G
UFSP2	55325	genome.wustl.edu	37	4	186324742	186324742	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr4:186324742C>T	ENST00000264689.6	-	11	1345	c.1229G>A	c.(1228-1230)gGa>gAa	p.G410E		NM_018359.3	NP_060829.2	Q9NUQ7	UFSP2_HUMAN	UFM1-specific peptidase 2	410						cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	small conjugating protein-specific protease activity (GO:0019783)|thiolester hydrolase activity (GO:0016790)			endometrium(3)|kidney(1)|large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	12		all_lung(41;1.3e-11)|Lung NSC(41;2.25e-11)|Melanoma(20;0.00109)|Colorectal(36;0.0215)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;3.4e-25)|Epithelial(43;2.23e-22)|OV - Ovarian serous cystadenocarcinoma(60;1.54e-11)|BRCA - Breast invasive adenocarcinoma(30;8.1e-05)|GBM - Glioblastoma multiforme(59;0.000148)|STAD - Stomach adenocarcinoma(60;0.000782)|LUSC - Lung squamous cell carcinoma(40;0.00939)|COAD - Colon adenocarcinoma(29;0.0108)|READ - Rectum adenocarcinoma(43;0.166)		CCATGCAACTCCTAGTATTGT	0.368																																																	0													102.0	96.0	98.0					4																	186324742		2203	4300	6503	SO:0001583	missense	0			AK002062	CCDS3842.1	4q35.1	2008-03-25	2008-03-25	2008-03-25	ENSG00000109775	ENSG00000109775			25640	protein-coding gene	gene with protein product		611482	"""chromosome 4 open reading frame 20"""	C4orf20		17182609	Standard	NM_018359		Approved	FLJ11200	uc003ixo.2	Q9NUQ7	OTTHUMG00000160441	ENST00000264689.6:c.1229G>A	4.37:g.186324742C>T	ENSP00000264689:p.Gly410Glu		Q6IA77|Q96FS3	Missense_Mutation	SNP	pfam_Peptidase_C78_UfSP1/2	p.G410E	ENST00000264689.6	37	c.1229	CCDS3842.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	29.0|29.0	4.970047|4.970047	0.92855|0.92855	.|.	.|.	ENSG00000109775|ENSG00000109775	ENST00000509180|ENST00000264689	.|T	.|0.63096	.|-0.02	5.92|5.92	5.92|5.92	0.95590|0.95590	.|.	.|0.096709	.|0.64402	.|D	.|0.000001	D|D	0.87489|0.87489	0.6190|0.6190	H|H	0.97390|0.97390	3.995|3.995	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|0.993;1.0	.|D;D	.|0.75020	.|0.96;0.985	D|D	0.91055|0.91055	0.4881|0.4881	5|10	.|0.87932	.|D	.|0	-9.5406|-9.5406	20.3285|20.3285	0.98709|0.98709	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|410;310	.|Q9NUQ7;B3KRI4	.|UFSP2_HUMAN;.	K|E	139|410	.|ENSP00000264689:G410E	.|ENSP00000264689:G410E	E|G	-|-	1|2	0|0	UFSP2|UFSP2	186561736|186561736	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.934000|0.934000	0.57294|0.57294	7.478000|7.478000	0.81082|0.81082	2.800000|2.800000	0.96347|0.96347	0.655000|0.655000	0.94253|0.94253	GAG|GGA	UFSP2	-	pfam_Peptidase_C78_UfSP1/2	ENSG00000109775		0.368	UFSP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UFSP2	HGNC	protein_coding	OTTHUMT00000360589.2	-	0.00	55	0	C	NM_018359		186324742	-1	tier1	-	no_errors	ENST00000264689	ensembl	human	known	74_37	missense	40.32	37	25	SNP	1.000	T
USP25	29761	genome.wustl.edu	37	21	17191133	17191133	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr21:17191133C>G	ENST00000285679.6	+	10	1417	c.1048C>G	c.(1048-1050)Cat>Gat	p.H350D	USP25_ENST00000351097.5_Intron|USP25_ENST00000400183.2_Missense_Mutation_p.H350D|USP25_ENST00000285681.2_Missense_Mutation_p.H350D	NM_013396.3	NP_037528.3	Q9UHP3	UBP25_HUMAN	ubiquitin specific peptidase 25	350	USP.				cellular protein modification process (GO:0006464)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|proteolysis (GO:0006508)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	peptidase activity (GO:0008233)|SUMO binding (GO:0032183)|ubiquitin-specific protease activity (GO:0004843)			breast(4)|endometrium(6)|kidney(2)|large_intestine(13)|liver(5)|lung(14)|ovary(4)|prostate(1)|skin(1)|urinary_tract(2)	52				Epithelial(23;7.55e-05)|all cancers(11;0.000429)|COAD - Colon adenocarcinoma(22;0.00543)|OV - Ovarian serous cystadenocarcinoma(11;0.00743)|Colorectal(24;0.0116)|Lung(58;0.0853)|LUSC - Lung squamous cell carcinoma(23;0.0889)		TGAGTCTTTACATTCAGAGAA	0.403																																																	0													157.0	154.0	155.0					21																	17191133		2203	4300	6503	SO:0001583	missense	0			AF170562	CCDS33515.1, CCDS63336.1, CCDS63337.1	21q11.2	2011-02-24	2005-08-08		ENSG00000155313	ENSG00000155313		"""Ubiquitin-specific peptidases"""	12624	protein-coding gene	gene with protein product		604736	"""ubiquitin specific protease 25"""			12838346, 10612803	Standard	NM_013396		Approved	USP21	uc002yjy.1	Q9UHP3	OTTHUMG00000074343	ENST00000285679.6:c.1048C>G	21.37:g.17191133C>G	ENSP00000285679:p.His350Asp		C0LSZ0|Q6DHZ9|Q9H9W1	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfam_Ubiquitin-int_motif,superfamily_UBA-like,smart_Ubiquitin-int_motif,pfscan_Ubiquitin-int_motif,pfscan_Peptidase_C19/C67	p.H350D	ENST00000285679.6	37	c.1048	CCDS33515.1	21	.	.	.	.	.	.	.	.	.	.	C	14.68	2.607281	0.46527	.	.	ENSG00000155313	ENST00000285681;ENST00000285679;ENST00000400183	T;T;T	0.74209	-0.82;-0.82;-0.82	4.93	4.93	0.64822	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.212421	0.47455	D	0.000230	T	0.63838	0.2545	N	0.20610	0.595	0.80722	D	1	B;B;B	0.31383	0.321;0.125;0.042	B;B;B	0.32624	0.098;0.149;0.067	T	0.62067	-0.6932	10	0.34782	T	0.22	.	18.7306	0.91734	0.0:1.0:0.0:0.0	.	350;350;350	Q9UHP3-3;Q9UHP3-1;Q9UHP3	.;.;UBP25_HUMAN	D	350	ENSP00000285681:H350D;ENSP00000285679:H350D;ENSP00000383044:H350D	ENSP00000285679:H350D	H	+	1	0	USP25	16113004	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.973000	0.76116	2.746000	0.94184	0.655000	0.94253	CAT	USP25	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	ENSG00000155313		0.403	USP25-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USP25	HGNC	protein_coding	OTTHUMT00000157964.1	-	0.00	65	0	C			17191133	+1	tier1	-	no_errors	ENST00000400183	ensembl	human	known	74_37	missense	37.65	53	32	SNP	1.000	G
USP32	84669	genome.wustl.edu	37	17	58275786	58275786	+	Missense_Mutation	SNP	A	A	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr17:58275786A>T	ENST00000300896.4	-	27	3463	c.3269T>A	c.(3268-3270)tTc>tAc	p.F1090Y	USP32_ENST00000592339.1_Missense_Mutation_p.F760Y	NM_032582.3	NP_115971.2	Q8NFA0	UBP32_HUMAN	ubiquitin specific peptidase 32	1090	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			NS(3)|breast(5)|endometrium(5)|kidney(4)|large_intestine(12)|liver(1)|lung(24)|pancreas(1)|prostate(3)|skin(3)|urinary_tract(1)	62	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;2.02e-11)|all cancers(12;5.23e-10)|Colorectal(3;0.198)			AGATGACAGGAAATACAGTTC	0.443																																																	0													135.0	124.0	128.0					17																	58275786		2203	4300	6503	SO:0001583	missense	0			AF533230	CCDS32697.1	17q23.3	2013-01-10	2005-08-08		ENSG00000170832	ENSG00000170832		"""Ubiquitin-specific peptidases"", ""EF-hand domain containing"""	19143	protein-coding gene	gene with protein product		607740	"""ubiquitin specific protease 32"""			12838346	Standard	NM_032582		Approved	NY-REN-60, USP10	uc002iyo.1	Q8NFA0		ENST00000300896.4:c.3269T>A	17.37:g.58275786A>T	ENSP00000300896:p.Phe1090Tyr		Q7Z5T3|Q9BX85|Q9Y591	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfam_Pept_C19_DUSP,smart_EF_hand_dom,smart_Pept_C19_DUSP,pfscan_EF_hand_dom,pfscan_Peptidase_C19/C67,prints_Recoverin	p.F1090Y	ENST00000300896.4	37	c.3269	CCDS32697.1	17	.	.	.	.	.	.	.	.	.	.	A	19.29	3.798864	0.70567	.	.	ENSG00000170832	ENST00000300896	T	0.55234	0.53	5.01	5.01	0.66863	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	T	0.42899	0.1223	L	0.37561	1.115	0.80722	D	1	P	0.42296	0.775	B	0.39660	0.306	T	0.26849	-1.0091	10	0.19590	T	0.45	.	14.7078	0.69203	1.0:0.0:0.0:0.0	.	1090	Q8NFA0	UBP32_HUMAN	Y	1090	ENSP00000300896:F1090Y	ENSP00000300896:F1090Y	F	-	2	0	USP32	55630568	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.238000	0.95380	1.855000	0.53841	0.459000	0.35465	TTC	USP32	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	ENSG00000170832		0.443	USP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP32	HGNC	protein_coding	OTTHUMT00000449235.2	-	0.00	58	0	A	NM_032582		58275786	-1	tier1	-	no_errors	ENST00000300896	ensembl	human	known	74_37	missense	29.82	80	34	SNP	1.000	T
USP37	57695	genome.wustl.edu	37	2	219346828	219346828	+	Silent	SNP	T	T	C			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr2:219346828T>C	ENST00000258399.3	-	17	2212	c.1800A>G	c.(1798-1800)ccA>ccG	p.P600P	USP37_ENST00000418019.1_Silent_p.P600P|USP37_ENST00000454775.1_Silent_p.P600P|USP37_ENST00000475553.1_5'UTR|USP37_ENST00000415516.1_Silent_p.P528P	NM_020935.2	NP_065986	Q86T82	UBP37_HUMAN	ubiquitin specific peptidase 37	600	USP.				G1/S transition of mitotic cell cycle (GO:0000082)|mitotic nuclear division (GO:0007067)|protein deubiquitination (GO:0016579)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|protein kinase binding (GO:0019901)|ubiquitin-specific protease activity (GO:0004843)			NS(2)|breast(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(1)|lung(7)|ovary(2)|prostate(3)|skin(5)|stomach(1)	35		Renal(207;0.0915)		Epithelial(149;1.08e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.00375)|Lung(261;0.00487)		GGGTAAAAGGTGGTTTTGTAT	0.398																																																	0													169.0	159.0	163.0					2																	219346828		2203	4300	6503	SO:0001819	synonymous_variant	0			AB046814	CCDS2418.1	2q35	2008-02-05	2005-08-08		ENSG00000135913	ENSG00000135913		"""Ubiquitin-specific peptidases"""	20063	protein-coding gene	gene with protein product			"""ubiquitin specific protease 37"""			12838346	Standard	NM_020935		Approved	KIAA1594	uc010fvs.1	Q86T82	OTTHUMG00000133113	ENST00000258399.3:c.1800A>G	2.37:g.219346828T>C			A2RUQ8|B7ZM38|B7ZM41|E9PHL3|Q2KHT2|Q53S10|Q7Z3A5|Q9HCH8	Silent	SNP	pfam_Peptidase_C19/C67,pfam_Ubiquitin-int_motif,smart_Ubiquitin-int_motif,pfscan_Ubiquitin-int_motif,pfscan_Peptidase_C19/C67	p.P600	ENST00000258399.3	37	c.1800	CCDS2418.1	2																																																																																			USP37	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	ENSG00000135913		0.398	USP37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP37	HGNC	protein_coding	OTTHUMT00000256779.3	-	0.00	46	0	T	NM_020935		219346828	-1	tier1	-	no_errors	ENST00000258399	ensembl	human	known	74_37	silent	60.87	18	28	SNP	0.376	C
UVRAG	7405	genome.wustl.edu	37	11	75694430	75694431	+	Splice_Site	INS	-	-	A	rs369320979		TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr11:75694430_75694431insA	ENST00000356136.3	+	8	940_941		c.e8-1		UVRAG_ENST00000528420.1_Splice_Site|UVRAG_ENST00000531818.1_Splice_Site|UVRAG_ENST00000532130.1_Splice_Site|UVRAG_ENST00000533454.1_Splice_Site|UVRAG_ENST00000539288.1_5'Flank	NM_003369.3	NP_003360.2	Q9P2Y5	UVRAG_HUMAN	UV radiation resistance associated						DNA repair (GO:0006281)|positive regulation of autophagy (GO:0010508)|SNARE complex assembly (GO:0035493)|viral entry into host cell (GO:0046718)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|late endosome (GO:0005770)|lysosome (GO:0005764)|phagocytic vesicle (GO:0045335)|protein complex (GO:0043234)				central_nervous_system(1)|cervix(3)|endometrium(3)|kidney(1)|large_intestine(2)|lung(15)|skin(5)|urinary_tract(2)	32						TATTTATTTAGAAAAAAAAAAG	0.302																																																	0																																										SO:0001630	splice_region_variant	0			X99050, AB012958	CCDS8241.1	11q13	2012-11-15	2012-11-15		ENSG00000198382	ENSG00000198382			12640	protein-coding gene	gene with protein product	"""beclin 1 binding protein"""	602493	"""UV radiation resistance associated gene"""			9169138, 16799551, 18843052	Standard	NM_003369		Approved	VPS38	uc001oxc.3	Q9P2Y5	OTTHUMG00000165319	ENST00000356136.3:c.700-1->A	11.37:g.75694440_75694440dupA			B3KTC1|O00392	Frame_Shift_Ins	INS	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom	p.S237fs	ENST00000356136.3	37	c.701_700	CCDS8241.1	11																																																																																			UVRAG	-	NULL	ENSG00000198382		0.302	UVRAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UVRAG	HGNC	protein_coding	OTTHUMT00000383430.1		0.00	47	0	0	NM_003369	Intron	75694431	+1			no_errors	ENST00000356136	ensembl	human	known	74_37	frame_shift_ins	6.78	110	8	INS	1.000:1.000	A
WDR35	57539	genome.wustl.edu	37	2	20130204	20130204	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr2:20130204G>T	ENST00000345530.3	-	26	3222	c.3107C>A	c.(3106-3108)gCa>gAa	p.A1036E	WDR35_ENST00000281405.4_Missense_Mutation_p.A1025E|WDR35_ENST00000416055.2_Missense_Mutation_p.A509E	NM_001006657.1	NP_001006658.1	Q9P2L0	WDR35_HUMAN	WD repeat domain 35	1036					cilium assembly (GO:0042384)|intraciliary retrograde transport (GO:0035721)	axoneme (GO:0005930)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|intraciliary transport particle A (GO:0030991)				breast(1)|endometrium(5)|kidney(8)|large_intestine(8)|lung(16)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTGCCTCTGTGCAAGTATAAA	0.443																																																	0													181.0	185.0	184.0					2																	20130204		2203	4300	6503	SO:0001583	missense	0			AB037757	CCDS1695.1, CCDS33152.1	2p24.3	2014-02-21			ENSG00000118965	ENSG00000118965		"""WD repeat domain containing"", ""Intraflagellar transport homologs"""	29250	protein-coding gene	gene with protein product		613602				10718198	Standard	NM_001006657		Approved	MGC33196, KIAA1336, IFT121, IFTA1	uc002rdi.3	Q9P2L0	OTTHUMG00000090737	ENST00000345530.3:c.3107C>A	2.37:g.20130204G>T	ENSP00000314444:p.Ala1036Glu		B3KVI5|Q4ZG01|Q8NE11	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pirsf_WD_repeat_p35,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.A1036E	ENST00000345530.3	37	c.3107	CCDS33152.1	2	.	.	.	.	.	.	.	.	.	.	G	20.8	4.053155	0.75960	.	.	ENSG00000118965	ENST00000345530;ENST00000281405;ENST00000416055	T;T;D	0.84873	-1.02;-1.02;-1.91	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	D	0.93959	0.8066	M	0.90198	3.095	0.39035	D	0.960024	D;D;D	0.89917	1.0;0.998;0.992	D;D;P	0.91635	0.999;0.973;0.856	D	0.95318	0.8418	10	0.72032	D	0.01	-9.6715	18.4109	0.90550	0.0:0.0:1.0:0.0	.	1025;1036;509	Q9P2L0-2;Q9P2L0;B3KR94	.;WDR35_HUMAN;.	E	1036;1025;509	ENSP00000314444:A1036E;ENSP00000281405:A1025E;ENSP00000399159:A509E	ENSP00000281405:A1025E	A	-	2	0	WDR35	19993685	1.000000	0.71417	0.252000	0.24328	0.989000	0.77384	9.784000	0.99039	2.596000	0.87737	0.563000	0.77884	GCA	WDR35	-	pirsf_WD_repeat_p35	ENSG00000118965		0.443	WDR35-001	KNOWN	basic|CCDS	protein_coding	WDR35	HGNC	protein_coding	OTTHUMT00000207472.2	-	0.00	40	0	G	NM_020779		20130204	-1	tier1	-	no_errors	ENST00000345530	ensembl	human	known	74_37	missense	5.80	65	4	SNP	0.998	T
WWC1	23286	genome.wustl.edu	37	5	167841561	167841561	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr5:167841561G>T	ENST00000265293.4	+	9	1652	c.1150G>T	c.(1150-1152)Gcc>Tcc	p.A384S	WWC1_ENST00000521089.1_Missense_Mutation_p.A384S	NM_001161661.1|NM_001161662.1|NM_015238.2	NP_001155133.1|NP_001155134.1|NP_056053.1	Q8IX03	KIBRA_HUMAN	WW and C2 domain containing 1	384					cell migration (GO:0016477)|establishment of cell polarity (GO:0030010)|hippo signaling (GO:0035329)|negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of MAPK cascade (GO:0043410)|regulation of hippo signaling (GO:0035330)|regulation of intracellular transport (GO:0032386)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)|transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(2)|prostate(1)|skin(4)	43	Renal(175;0.000212)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0399)|all_neural(177;0.0577)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0364)|Epithelial(171;0.0765)|OV - Ovarian serous cystadenocarcinoma(192;0.0918)		CCTGCAGGCAGCCCGGGACAC	0.667																																																	0													8.0	9.0	9.0					5																	167841561		2152	4203	6355	SO:0001583	missense	0			AF506799	CCDS4366.1, CCDS54945.1	5q34	2014-06-13	2006-11-09		ENSG00000113645	ENSG00000113645		"""WW, C2 and coiled-coil domain containing"""	29435	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 168"""	610533	"""WW, C2 and coiled-coil domain containing 1"""			10048485, 12559952	Standard	NM_001161661		Approved	KIBRA, KIAA0869, PPP1R168	uc011den.2	Q8IX03	OTTHUMG00000130408	ENST00000265293.4:c.1150G>T	5.37:g.167841561G>T	ENSP00000265293:p.Ala384Ser		B4DK05|O94946|Q6MZX4|Q6Y2F8|Q7Z4G8|Q8WVM4|Q9BT29	Missense_Mutation	SNP	pfam_WW_dom,superfamily_C2_dom,superfamily_WW_dom,smart_WW_dom,pfscan_WW_dom	p.A384S	ENST00000265293.4	37	c.1150	CCDS4366.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	34|34	5.344106|5.344106	0.95807|0.95807	.|.	.|.	ENSG00000113645|ENSG00000113645	ENST00000265293;ENST00000521089|ENST00000393895;ENST00000524228	T;T|.	0.11385|.	2.8;2.78|.	5.68|5.68	5.68|5.68	0.88126|0.88126	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.82697|0.82697	0.5093|0.5093	M|M	0.82517|0.82517	2.595|2.595	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	1.0;0.999;0.999;1.0|.	D;D;D;D|.	0.91635|.	0.999;0.96;0.981;0.996|.	T|T	0.83080|0.83080	-0.0138|-0.0138	10|5	0.87932|.	D|.	0|.	.|.	19.7903|19.7903	0.96454|0.96454	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	384;290;290;384|.	Q8IX03-2;F5H498;B3KX05;Q8IX03|.	.;.;.;KIBRA_HUMAN|.	S|I	384|345;160	ENSP00000265293:A384S;ENSP00000427772:A384S|.	ENSP00000265293:A384S|.	A|S	+|+	1|2	0|0	WWC1|WWC1	167774139|167774139	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.828000|0.828000	0.46876|0.46876	9.832000|9.832000	0.99423|0.99423	2.674000|2.674000	0.91012|0.91012	0.655000|0.655000	0.94253|0.94253	GCC|AGC	WWC1	-	NULL	ENSG00000113645		0.667	WWC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	WWC1	HGNC	protein_coding	OTTHUMT00000252791.2	-	0.00	60	0	G	NM_015238		167841561	+1	tier1	-	no_errors	ENST00000265293	ensembl	human	known	74_37	missense	10.26	35	4	SNP	1.000	T
ZC2HC1C	79696	genome.wustl.edu	37	14	75537509	75537509	+	Missense_Mutation	SNP	C	C	A	rs200028022		TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr14:75537509C>A	ENST00000524913.1	+	2	722	c.233C>A	c.(232-234)aCa>aAa	p.T78K	ZC2HC1C_ENST00000526748.1_Intron|ZC2HC1C_ENST00000439583.2_Missense_Mutation_p.T78K|ZC2HC1C_ENST00000238686.8_Missense_Mutation_p.T78K|ACYP1_ENST00000555463.1_5'Flank	NM_024643.2	NP_078919.2	Q53FD0	ZC21C_HUMAN	zinc finger, C2HC-type containing 1C	78							metal ion binding (GO:0046872)										AACACCCAAACAAAAGCCCGG	0.463																																																	0													163.0	166.0	165.0					14																	75537509		1837	4089	5926	SO:0001583	missense	0			AK026746	CCDS41972.1, CCDS45138.1	14q24.3	2013-01-10	2012-02-03	2012-02-03	ENSG00000119703	ENSG00000119703		"""Zinc fingers, C2HC-type containing"""	20354	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 140"", ""family with sequence similarity 164, member C"""	C14orf140, FAM164C			Standard	XM_005268062		Approved		uc001xrh.3	Q53FD0	OTTHUMG00000167439	ENST00000524913.1:c.233C>A	14.37:g.75537509C>A	ENSP00000435550:p.Thr78Lys		E9PJQ0|Q9BTA8|Q9H5S9	Missense_Mutation	SNP	NULL	p.T78K	ENST00000524913.1	37	c.233	CCDS41972.1	14	.	.	.	.	.	.	.	.	.	.	C	2.054	-0.417009	0.04766	.	.	ENSG00000119703	ENST00000534151;ENST00000524913;ENST00000238686;ENST00000554763;ENST00000439583;ENST00000526130;ENST00000525046	T;T;T;T;T;T;T	0.19806	2.12;2.12;2.12;2.12;2.12;2.12;2.12	4.49	0.546	0.17196	.	0.354098	0.20700	N	0.087281	T	0.17577	0.0422	L	0.60455	1.87	0.09310	N	1	B;B	0.33612	0.419;0.19	B;B	0.36244	0.22;0.11	T	0.22800	-1.0206	10	0.87932	D	0	1.0863	1.5888	0.02650	0.1695:0.4785:0.1643:0.1878	.	78;78	Q53FD0;E9PJQ0	F164C_HUMAN;.	K	78	ENSP00000434997:T78K;ENSP00000435550:T78K;ENSP00000238686:T78K;ENSP00000451195:T78K;ENSP00000390606:T78K;ENSP00000437160:T78K;ENSP00000435684:T78K	ENSP00000238686:T78K	T	+	2	0	FAM164C	74607262	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.697000	0.05098	-0.069000	0.12931	-0.262000	0.10625	ACA	ZC2HC1C	-	NULL	ENSG00000119703		0.463	ZC2HC1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC2HC1C	HGNC	protein_coding	OTTHUMT00000394616.4	-	0.00	47	0	C	NM_001042430		75537509	+1	tier1	-	no_errors	ENST00000524913	ensembl	human	known	74_37	missense	6.74	82	6	SNP	0.000	A
ZC3H12B	340554	genome.wustl.edu	37	X	64721861	64721861	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chrX:64721861A>G	ENST00000338957.4	+	5	1350	c.1283A>G	c.(1282-1284)aAa>aGa	p.K428R	ZC3H12B_ENST00000423889.3_Missense_Mutation_p.K417R	NM_001010888.3	NP_001010888.3	Q5HYM0	ZC12B_HUMAN	zinc finger CCCH-type containing 12B	428							endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)			breast(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(13)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						TCAGAGGTCAAACGTGTGGCC	0.547																																																	0													71.0	75.0	73.0					X																	64721861		2030	4163	6193	SO:0001583	missense	0			BX647241	CCDS48131.1, CCDS48131.2	Xq12	2012-07-05	2005-06-14	2005-06-14	ENSG00000102053	ENSG00000102053		"""Zinc fingers, CCCH-type domain containing"""	17407	protein-coding gene	gene with protein product	"""MCP induced protein 2"""	300889	"""chromosome X open reading frame 32"""	CXorf32		18178554	Standard	NM_001010888		Approved	MCPIP2	uc010nko.3	Q5HYM0	OTTHUMG00000021719	ENST00000338957.4:c.1283A>G	X.37:g.64721861A>G	ENSP00000340839:p.Lys428Arg		B2RTQ3|E9PAJ6|Q5H9C0	Missense_Mutation	SNP	pfam_RNase_Zc3h12	p.K428R	ENST00000338957.4	37	c.1283	CCDS48131.2	X	.	.	.	.	.	.	.	.	.	.	A	12.31	1.899805	0.33535	.	.	ENSG00000102053	ENST00000338957;ENST00000423889;ENST00000218172	T;T	0.27256	1.68;1.69	5.22	5.22	0.72569	.	0.186507	0.56097	D	0.000032	T	0.28797	0.0714	M	0.70275	2.135	0.45295	D	0.998293	B	0.30664	0.289	B	0.23716	0.048	T	0.07751	-1.0756	10	0.54805	T	0.06	-31.5616	12.9323	0.58294	1.0:0.0:0.0:0.0	.	417	Q5HYM0	ZC12B_HUMAN	R	428;417;364	ENSP00000340839:K428R;ENSP00000408077:K417R	ENSP00000218172:K364R	K	+	2	0	ZC3H12B	64638586	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.058000	0.71126	1.734000	0.51633	0.417000	0.27973	AAA	ZC3H12B	-	NULL	ENSG00000102053		0.547	ZC3H12B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3H12B	HGNC	protein_coding	OTTHUMT00000378734.2	-	0.00	51	0	A	XM_293334		64721861	+1	tier1	-	no_errors	ENST00000338957	ensembl	human	known	74_37	missense	29.79	33	14	SNP	1.000	G
ZDHHC6	64429	genome.wustl.edu	37	10	114205005	114205005	+	Missense_Mutation	SNP	A	A	C			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr10:114205005A>C	ENST00000369405.3	-	2	613	c.190T>G	c.(190-192)Tgg>Ggg	p.W64G	VTI1A_ENST00000393077.2_5'Flank|ZDHHC6_ENST00000369404.3_Missense_Mutation_p.W64G|VTI1A_ENST00000432306.1_5'Flank	NM_022494.1	NP_071939.1	Q9H6R6	ZDHC6_HUMAN	zinc finger, DHHC-type containing 6	64					protein palmitoylation (GO:0018345)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(1)|large_intestine(2)|lung(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	14		Colorectal(252;0.198)		Epithelial(162;0.0291)|all cancers(201;0.117)		ATGACAGTCCAATTTATCAAC	0.408																																																	0													108.0	95.0	100.0					10																	114205005		2203	4300	6503	SO:0001583	missense	0			AK025605	CCDS7574.1	10q26.11	2008-05-02			ENSG00000023041	ENSG00000023041		"""Zinc fingers, DHHC-type"""	19160	protein-coding gene	gene with protein product							Standard	NM_022494		Approved	ZNF376, FLJ21952	uc001kzv.3	Q9H6R6	OTTHUMG00000019062	ENST00000369405.3:c.190T>G	10.37:g.114205005A>C	ENSP00000358413:p.Trp64Gly		D3DRB6|Q53G45|Q96IV7|Q9H605	Missense_Mutation	SNP	pfam_Znf_DHHC_palmitoyltrfase,pfam_SH3_2,superfamily_SH3_domain,pfscan_Znf_DHHC_palmitoyltrfase	p.W64G	ENST00000369405.3	37	c.190	CCDS7574.1	10	.	.	.	.	.	.	.	.	.	.	A	14.10	2.433362	0.43224	.	.	ENSG00000023041	ENST00000369405;ENST00000369404	T;T	0.64991	0.6;-0.13	6.08	4.94	0.65067	.	0.125317	0.64402	D	0.000019	T	0.73946	0.3652	M	0.61703	1.905	0.80722	D	1	D;D	0.67145	0.996;0.993	D;P	0.63877	0.919;0.782	T	0.75116	-0.3431	10	0.54805	T	0.06	-45.8442	13.3535	0.60615	0.8683:0.1317:0.0:0.0	.	64;64	Q9H6R6-2;Q9H6R6	.;ZDHC6_HUMAN	G	64	ENSP00000358413:W64G;ENSP00000358412:W64G	ENSP00000358412:W64G	W	-	1	0	ZDHHC6	114194995	1.000000	0.71417	0.973000	0.42090	0.281000	0.26958	9.040000	0.93783	1.101000	0.41535	-0.313000	0.08912	TGG	ZDHHC6	-	NULL	ENSG00000023041		0.408	ZDHHC6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZDHHC6	HGNC	protein_coding	OTTHUMT00000050393.1		0.00	52	0	A	NM_022494		114205005	-1			no_errors	ENST00000369405	ensembl	human	known	74_37	missense	5.56	34	2	SNP	1.000	C
ZEB2	9839	genome.wustl.edu	37	2	145157783	145157783	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr2:145157783G>A	ENST00000558170.2	-	8	2155	c.971C>T	c.(970-972)tCc>tTc	p.S324F	ZEB2_ENST00000409487.3_Missense_Mutation_p.S324F|ZEB2_ENST00000303660.4_Missense_Mutation_p.S324F|ZEB2_ENST00000539609.3_Missense_Mutation_p.S300F	NM_014795.3	NP_055610.1	O60315	ZEB2_HUMAN	zinc finger E-box binding homeobox 2	324					cell proliferation in forebrain (GO:0021846)|developmental pigmentation (GO:0048066)|hippocampus development (GO:0021766)|melanocyte migration (GO:0097324)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of melanin biosynthetic process (GO:0048023)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of melanosome organization (GO:1903056)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|phosphatase regulator activity (GO:0019208)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(7)|kidney(6)|large_intestine(23)|lung(45)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	107				BRCA - Breast invasive adenocarcinoma(221;0.112)		CGAACTGTAGGAACCAGAATG	0.373																																					Melanoma(33;1235 1264 5755 16332)												0													49.0	52.0	51.0					2																	145157783		2202	4300	6502	SO:0001583	missense	0			AB011141	CCDS2186.1, CCDS54403.1	2q22.3	2013-01-08	2007-02-15	2007-02-15	ENSG00000169554	ENSG00000169554		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	14881	protein-coding gene	gene with protein product	"""SMAD interacting protein 1"""	605802	"""zinc finger homeobox 1b"""	ZFHX1B			Standard	NM_014795		Approved	KIAA0569, SIP-1, SIP1	uc002tvu.3	O60315	OTTHUMG00000131834	ENST00000558170.2:c.971C>T	2.37:g.145157783G>A	ENSP00000454157:p.Ser324Phe		A0JP09|B7Z2P2|F5H814|Q9UED1	Missense_Mutation	SNP	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeobox_dom,pfscan_Znf_C2H2	p.S324F	ENST00000558170.2	37	c.971	CCDS2186.1	2	.	.	.	.	.	.	.	.	.	.	G	17.34	3.365871	0.61513	.	.	ENSG00000169554	ENST00000392860;ENST00000539609;ENST00000303660;ENST00000409487;ENST00000427902;ENST00000392861	T;T;T;T;T	0.16073	2.37;2.37;2.37;2.37;2.37	5.64	5.64	0.86602	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.36853	0.0982	L	0.40543	1.245	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.995;0.995	D;D;D;D	0.91635	0.999;0.998;0.986;0.986	T	0.05022	-1.0911	10	0.87932	D	0	-7.7698	19.7156	0.96119	0.0:0.0:1.0:0.0	.	300;189;323;324	F5H814;Q53TD9;A0JP08;O60315	.;.;.;ZEB2_HUMAN	F	319;300;324;324;324;324	ENSP00000443792:S300F;ENSP00000302501:S324F;ENSP00000386854:S324F;ENSP00000395496:S324F;ENSP00000376601:S324F	ENSP00000302501:S324F	S	-	2	0	ZEB2	144874253	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.658000	0.90341	0.655000	0.94253	TCC	ZEB2	-	smart_Znf_C2H2-like	ENSG00000169554		0.373	ZEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZEB2	HGNC	protein_coding	OTTHUMT00000254778.5	-	0.00	61	0	G	NM_014795		145157783	-1	tier1	-	no_errors	ENST00000303660	ensembl	human	known	74_37	missense	65.62	11	21	SNP	1.000	A
ZFP37	7539	genome.wustl.edu	37	9	115806537	115806537	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr9:115806537C>A	ENST00000374227.3	-	4	388	c.361G>T	c.(361-363)Gat>Tat	p.D121Y	ZFP37_ENST00000555206.1_Missense_Mutation_p.D122Y|ZFP37_ENST00000553380.1_Missense_Mutation_p.D136Y	NM_001282515.1|NM_001282518.1	NP_001269444.1|NP_001269447.1	Q9Y6Q3	ZFP37_HUMAN	ZFP37 zinc finger protein	121					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	38						TGGTCATCATCTTTCTGGACT	0.363																																																	0													63.0	71.0	68.0					9																	115806537		2102	3938	6040	SO:0001583	missense	0			AF022158	CCDS6787.1, CCDS65109.1, CCDS65110.1	9q32	2013-01-08	2012-11-27		ENSG00000136866	ENSG00000136866		"""Zinc fingers, C2H2-type"", ""-"""	12863	protein-coding gene	gene with protein product		602951	"""zinc finger protein homologous to Zfp37 in mouse"", ""zinc finger protein 37 homolog (mouse)"""				Standard	NM_001282515		Approved	ZNF906	uc004bgm.1	Q9Y6Q3	OTTHUMG00000021019	ENST00000374227.3:c.361G>T	9.37:g.115806537C>A	ENSP00000363344:p.Asp121Tyr		A0AVJ9|B4DVX4|G3V3L7|Q5T7Q4	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.D136Y	ENST00000374227.3	37	c.406	CCDS6787.1	9	.	.	.	.	.	.	.	.	.	.	C	0.218	-1.030859	0.02045	.	.	ENSG00000136866	ENST00000374227;ENST00000555206;ENST00000553380	T;T;T	0.06371	3.32;3.31;3.35	4.31	3.41	0.39046	.	0.155671	0.30356	N	0.009805	T	0.07503	0.0189	L	0.39898	1.24	0.30785	N	0.741549	D;D;D	0.59767	0.986;0.986;0.976	P;P;P	0.54100	0.742;0.742;0.556	T	0.01791	-1.1273	10	0.02654	T	1	-10.7831	6.7663	0.23568	0.0:0.7961:0.0:0.2039	.	122;136;121	G3V3L7;Q9Y6Q3-2;Q9Y6Q3	.;.;ZFP37_HUMAN	Y	121;122;136	ENSP00000363344:D121Y;ENSP00000451310:D122Y;ENSP00000452552:D136Y	ENSP00000363344:D121Y	D	-	1	0	ZFP37	114846358	0.000000	0.05858	0.825000	0.32803	0.630000	0.37929	-0.286000	0.08399	1.425000	0.47237	0.655000	0.94253	GAT	ZFP37	-	NULL	ENSG00000136866		0.363	ZFP37-001	KNOWN	basic|CCDS	protein_coding	ZFP37	HGNC	protein_coding	OTTHUMT00000055439.1	-	0.00	26	0	C	NM_003408		115806537	-1	tier1	-	no_errors	ENST00000553380	ensembl	human	known	74_37	missense	34.62	34	18	SNP	0.836	A
ZMYM3	9203	genome.wustl.edu	37	X	70460112	70460112	+	3'UTR	SNP	A	A	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chrX:70460112A>T	ENST00000353904.2	-	0	4954				ZMYM3_ENST00000373988.1_3'UTR|ZMYM3_ENST00000373998.1_3'UTR|ZMYM3_ENST00000489332.1_5'UTR|ZMYM3_ENST00000373984.3_3'UTR|ZMYM3_ENST00000314425.5_3'UTR	NM_005096.3	NP_005087.1	Q14202	ZMYM3_HUMAN	zinc finger, MYM-type 3						cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(7)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(12)|lung(17)|ovary(1)|prostate(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(35;0.156)					AAAAAAAGGCATTTGGAAGAT	0.488																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AB002383	CCDS14409.1, CCDS55443.1, CCDS55444.1	Xq13.1	2013-01-08	2005-12-19	2005-12-19	ENSG00000147130	ENSG00000147130		"""Zinc fingers, MYM type"""	13054	protein-coding gene	gene with protein product		300061	"""zinc finger protein 261"""	ZNF261		10486218	Standard	NM_201599		Approved	ZNF198L2, DXS6673E, KIAA0385, MYM	uc004dzh.2	Q14202	OTTHUMG00000021799	ENST00000353904.2:c.*654T>A	X.37:g.70460112A>T			D3DVV3|O15089|Q96E26	RNA	SNP	-	NULL	ENST00000353904.2	37	NULL	CCDS14409.1	X																																																																																			ZMYM3	-	-	ENSG00000147130		0.488	ZMYM3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZMYM3	HGNC	protein_coding	OTTHUMT00000057154.1	-	0.00	11	0	A	NM_201599		70460112	-1	tier1	-	no_errors	ENST00000489332	ensembl	human	known	74_37	rna	47.06	9	8	SNP	0.026	T
ZNF430	80264	genome.wustl.edu	37	19	21240141	21240141	+	Nonsense_Mutation	SNP	A	A	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr19:21240141A>T	ENST00000261560.5	+	5	1208	c.1027A>T	c.(1027-1029)Aaa>Taa	p.K343*	AC012627.1_ENST00000578233.1_RNA	NM_001172671.1|NM_025189.3	NP_001166142.1|NP_079465.3	Q9H8G1	ZN430_HUMAN	zinc finger protein 430	343					regulation of transcription, DNA-templated (GO:0006355)|substantia nigra development (GO:0021762)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(8)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	23						TACTGGAGAGAAACCCTACAA	0.388																																																	0													59.0	64.0	62.0					19																	21240141		2203	4291	6494	SO:0001587	stop_gained	0			AK023721	CCDS32978.1	19p12	2013-01-08				ENSG00000118620		"""Zinc fingers, C2H2-type"", ""-"""	20808	protein-coding gene	gene with protein product							Standard	NM_025189		Approved	FLJ13659	uc002npj.3	Q9H8G1		ENST00000261560.5:c.1027A>T	19.37:g.21240141A>T	ENSP00000261560:p.Lys343*		Q86V70	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K343*	ENST00000261560.5	37	c.1027	CCDS32978.1	19	.	.	.	.	.	.	.	.	.	.	.	22.1	4.246057	0.80024	.	.	ENSG00000118620	ENST00000261560	.	.	.	1.04	1.04	0.20106	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.9941	0.24772	1.0:0.0:0.0:0.0	.	.	.	.	X	343	.	ENSP00000261560:K343X	K	+	1	0	ZNF430	21031981	0.544000	0.26441	0.042000	0.18584	0.038000	0.13279	2.796000	0.47869	0.383000	0.24910	0.374000	0.22700	AAA	ZNF430	-	pfscan_Znf_C2H2	ENSG00000118620		0.388	ZNF430-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF430	HGNC	protein_coding	OTTHUMT00000463539.1	-	0.00	53	0	A	NM_025189		21240141	+1	tier1	-	no_errors	ENST00000261560	ensembl	human	known	74_37	nonsense	27.45	36	14	SNP	1.000	T
ZNF527	84503	genome.wustl.edu	37	19	37879281	37879281	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr19:37879281G>T	ENST00000436120.2	+	5	437	c.330G>T	c.(328-330)gaG>gaT	p.E110D	ZNF527_ENST00000587349.1_Intron	NM_032453.1	NP_115829.1	Q8NB42	ZN527_HUMAN	zinc finger protein 527	110	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	33			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TATCCCAGGAGATGGTAATGG	0.408																																																	0													69.0	65.0	66.0					19																	37879281		1858	4103	5961	SO:0001583	missense	0			AB058732, AK091585	CCDS42559.1	19q13.1	2013-01-08			ENSG00000189164	ENSG00000189164		"""Zinc fingers, C2H2-type"", ""-"""	29385	protein-coding gene	gene with protein product						11347906	Standard	NM_032453		Approved	KIAA1829	uc010efk.1	Q8NB42	OTTHUMG00000048173	ENST00000436120.2:c.330G>T	19.37:g.37879281G>T	ENSP00000390179:p.Glu110Asp		B4DVL5	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E110D	ENST00000436120.2	37	c.330	CCDS42559.1	19	.	.	.	.	.	.	.	.	.	.	G	2.193	-0.384767	0.04966	.	.	ENSG00000189164	ENST00000356178;ENST00000317566;ENST00000436120	.	.	.	4.48	-6.75	0.01738	.	.	.	.	.	T	0.14227	0.0344	N	0.12746	0.255	0.09310	N	1	B;B	0.18310	0.016;0.027	B;B	0.14023	0.007;0.01	T	0.32241	-0.9914	8	0.13108	T	0.6	.	6.5587	0.22474	0.555:0.2613:0.1836:0.0	.	110;78	Q8NB42;Q8NB42-2	ZN527_HUMAN;.	D	110;78;58	.	ENSP00000325231:E78D	E	+	3	2	ZNF527	42571121	0.000000	0.05858	0.000000	0.03702	0.024000	0.10985	-2.133000	0.01308	-1.112000	0.02984	-0.251000	0.11542	GAG	ZNF527	-	NULL	ENSG00000189164		0.408	ZNF527-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF527	HGNC	protein_coding	OTTHUMT00000458434.1	-	0.00	70	0	G	NM_032453		37879281	+1	tier1	-	no_errors	ENST00000436120	ensembl	human	known	74_37	missense	5.80	65	4	SNP	0.000	T
ZNF608	57507	genome.wustl.edu	37	5	123972613	123972614	+	3'UTR	INS	-	-	A	rs70991633	byFrequency	TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr5:123972613_123972614insA	ENST00000306315.5	-	0	5953_5954				ZNF608_ENST00000504926.1_3'UTR|ZNF608_ENST00000513985.1_5'UTR	NM_020747.2	NP_065798.2	Q9ULD9	ZN608_HUMAN	zinc finger protein 608								metal ion binding (GO:0046872)			breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(12)|ovary(3)|skin(6)|urinary_tract(1)	46		all_cancers(142;0.186)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.00126)|Epithelial(69;0.00238)|all cancers(49;0.00783)		AGCCattatttaaaaaaaaaaa	0.248													|||unknown(HR)	2155	0.430312	0.267	0.5375	5008	,	,		16774	0.5982		0.3569	False		,,,				2504	0.4775																0																																										SO:0001624	3_prime_UTR_variant	0			AB033107	CCDS34219.1	5q23.2	2008-05-02			ENSG00000168916	ENSG00000168916		"""Zinc fingers, C2H2-type"""	29238	protein-coding gene	gene with protein product						10574462, 10508479	Standard	NM_020747		Approved	KIAA1281, DKFZp434M098, NY-REN-36	uc003ktq.1	Q9ULD9	OTTHUMG00000162999	ENST00000306315.5:c.*980->T	5.37:g.123972624_123972624dupA			A7E2W9|Q3SYM6|Q68D12|Q8IY05|Q9Y5A1	RNA	INS	-	NULL	ENST00000306315.5	37	NULL	CCDS34219.1	5																																																																																			ZNF608	-	-	ENSG00000168916		0.248	ZNF608-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF608	HGNC	protein_coding	OTTHUMT00000371300.1		0.00	27	0	-	XM_114432		123972614	-1	tier1		no_errors	ENST00000513985	ensembl	human	known	74_37	rna	21.43	22	6	INS	0.291:0.200	A
ZNF707	286075	genome.wustl.edu	37	8	144776548	144776548	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr8:144776548G>A	ENST00000532205.1	+	8	1863	c.964G>A	c.(964-966)Ggc>Agc	p.G322S	RP11-429J17.2_ENST00000531565.1_RNA|ZNF707_ENST00000532158.1_Missense_Mutation_p.G322S|ZNF707_ENST00000454097.1_Missense_Mutation_p.G322S|ZNF707_ENST00000418203.2_Missense_Mutation_p.G322S|ZNF707_ENST00000358656.4_Missense_Mutation_p.G322S			Q96C28	ZN707_HUMAN	zinc finger protein 707	322					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)	1	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;5.6e-41)|Epithelial(56;1.02e-39)|all cancers(56;9.65e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			TGCCGAGTGCGGCAAGTCCTT	0.637																																																	0													31.0	38.0	36.0					8																	144776548		2161	4275	6436	SO:0001583	missense	0			AK001126	CCDS47932.1	8q24.3	2013-01-08				ENSG00000181135		"""Zinc fingers, C2H2-type"", ""-"""	27815	protein-coding gene	gene with protein product						12477932	Standard	NM_173831		Approved		uc010mfi.3	Q96C28		ENST00000532205.1:c.964G>A	8.37:g.144776548G>A	ENSP00000436212:p.Gly322Ser		A8K317|B3KNY1|D3DWK7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G322S	ENST00000532205.1	37	c.964	CCDS47932.1	8	.	.	.	.	.	.	.	.	.	.	G	20.5	4.000358	0.74818	.	.	ENSG00000181135	ENST00000454097;ENST00000358656;ENST00000532158;ENST00000532205;ENST00000418203	T;T;T;T;T	0.21734	1.99;1.99;1.99;1.99;1.99	2.99	2.99	0.34606	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.35364	0.0929	L	0.46670	1.46	0.40905	D	0.984185	D;D	0.89917	1.0;1.0	D;D	0.79784	0.99;0.993	T	0.07366	-1.0776	8	.	.	.	-11.6822	11.432	0.50047	0.0:0.0:1.0:0.0	.	247;322	B4DV46;Q96C28	.;ZN707_HUMAN	S	322	ENSP00000409029:G322S;ENSP00000351482:G322S;ENSP00000436250:G322S;ENSP00000436212:G322S;ENSP00000413215:G322S	.	G	+	1	0	ZNF707	144848536	1.000000	0.71417	0.698000	0.30274	0.530000	0.34684	5.147000	0.64851	1.478000	0.48253	0.563000	0.77884	GGC	ZNF707	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000181135		0.637	ZNF707-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF707	HGNC	protein_coding	OTTHUMT00000382197.1	-	0.00	97	0	G	NM_173831		144776548	+1	tier1	-	no_errors	ENST00000358656	ensembl	human	known	74_37	missense	13.51	192	30	SNP	0.997	A
ZNF749	388567	genome.wustl.edu	37	19	57956324	57956324	+	Missense_Mutation	SNP	A	A	T			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr19:57956324A>T	ENST00000334181.4	+	3	2058	c.1808A>T	c.(1807-1809)cAg>cTg	p.Q603L	AC004076.9_ENST00000596831.1_Intron	NM_001023561.2	NP_001018855.2	O43361	ZN749_HUMAN	zinc finger protein 749	603					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(2)|lung(3)|prostate(1)	13		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0264)|Lung(386;0.177)		GTTATTCATCAGAGAATTCAC	0.393																																																	0													64.0	69.0	67.0					19																	57956324		2203	4300	6503	SO:0001583	missense	0			AK122740	CCDS33132.2	19q13.43	2013-01-08			ENSG00000186230	ENSG00000186230		"""Zinc fingers, C2H2-type"", ""-"""	32783	protein-coding gene	gene with protein product							Standard	NM_001023561		Approved	FLJ16360	uc002qoq.2	O43361	OTTHUMG00000150372	ENST00000334181.4:c.1808A>T	19.37:g.57956324A>T	ENSP00000333980:p.Gln603Leu			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q603L	ENST00000334181.4	37	c.1808	CCDS33132.2	19	.	.	.	.	.	.	.	.	.	.	A	17.31	3.356287	0.61293	.	.	ENSG00000186230	ENST00000334181	T	0.42131	0.98	2.3	-2.66	0.06077	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.17238	0.0414	N	0.04335	-0.225	0.09310	N	1	B	0.22003	0.063	B	0.10450	0.005	T	0.16571	-1.0398	9	0.66056	D	0.02	.	4.3679	0.11233	0.6559:0.0:0.1763:0.1678	.	603	O43361	ZN749_HUMAN	L	603	ENSP00000333980:Q603L	ENSP00000333980:Q603L	Q	+	2	0	ZNF749	62648136	0.000000	0.05858	0.000000	0.03702	0.734000	0.41952	-0.836000	0.04382	-0.433000	0.07286	0.260000	0.18958	CAG	ZNF749	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000186230		0.393	ZNF749-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF749	HGNC	protein_coding	OTTHUMT00000317879.1		0.00	69	0	A	NM_001023561		57956324	+1			no_errors	ENST00000334181	ensembl	human	known	74_37	missense	7.55	49	4	SNP	0.000	T
ZNF789	285989	genome.wustl.edu	37	7	99074101	99074101	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr7:99074101A>G	ENST00000331410.5	+	2	292	c.22A>G	c.(22-24)Aag>Gag	p.K8E	ZNF789_ENST00000493485.1_5'UTR|ZNF789_ENST00000483089.1_5'UTR|ZNF789_ENST00000379724.3_Missense_Mutation_p.K8E|ZNF789_ENST00000448667.1_5'UTR	NM_213603.2	NP_998768.2	Q5FWF6	ZN789_HUMAN	zinc finger protein 789	8					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(2)|large_intestine(4)|lung(2)|ovary(1)	11	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)					AGCCAGGGGGAAGGTGAGCTG	0.562																																																	0													68.0	58.0	61.0					7																	99074101		2203	4300	6503	SO:0001583	missense	0			AK093141	CCDS34693.1, CCDS34694.1	7q22.1	2013-01-08			ENSG00000198556	ENSG00000198556		"""Zinc fingers, C2H2-type"", ""-"""	27801	protein-coding gene	gene with protein product						12477932	Standard	XM_005250281		Approved		uc003uqq.1	Q5FWF6	OTTHUMG00000154601	ENST00000331410.5:c.22A>G	7.37:g.99074101A>G	ENSP00000331927:p.Lys8Glu		A4D282|A6NH61|Q6ZMZ9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K8E	ENST00000331410.5	37	c.22	CCDS34693.1	7	.	.	.	.	.	.	.	.	.	.	A	12.88	2.071777	0.36566	.	.	ENSG00000198556	ENST00000331410;ENST00000379724	T;T	0.00801	5.68;5.68	3.89	-2.35	0.06684	Krueppel-associated box (1);	.	.	.	.	T	0.00608	0.0020	N	0.13140	0.3	0.49915	D	0.999838	B;P	0.39809	0.131;0.689	B;B	0.29077	0.039;0.098	T	0.68671	-0.5347	9	0.51188	T	0.08	.	11.3936	0.49827	0.3053:0.6946:0.0:0.0	.	8;8	Q5FWF6;A6NH61	ZN789_HUMAN;.	E	8	ENSP00000331927:K8E;ENSP00000369047:K8E	ENSP00000331927:K8E	K	+	1	0	ZNF789	98912037	0.050000	0.20438	0.266000	0.24541	0.057000	0.15508	-0.179000	0.09768	-0.137000	0.11455	0.459000	0.35465	AAG	ZNF789	-	superfamily_Krueppel-associated_box	ENSG00000198556		0.562	ZNF789-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF789	HGNC	protein_coding	OTTHUMT00000336266.1	-	0.00	28	0	A	NM_213603		99074101	+1	tier1	-	no_errors	ENST00000331410	ensembl	human	known	74_37	missense	7.02	53	4	SNP	0.063	G
ZSWIM7	125150	genome.wustl.edu	37	17	15897110	15897110	+	Intron	DEL	A	A	-			TCGA-VR-A8EY-01A-11D-A36J-09	TCGA-VR-A8EY-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5a787e4c-1d09-4304-88a5-b8de5394c710	d601820b-9c2c-4e15-80f2-d6ce2c280ada	g.chr17:15897110delA	ENST00000399277.1	-	2	174				ZSWIM7_ENST00000399280.2_Intron|ZSWIM7_ENST00000472495.1_Intron|ZSWIM7_ENST00000486655.1_Intron	NM_001042697.1|NM_001042698.1	NP_001036162.1|NP_001036163.1	Q19AV6	ZSWM7_HUMAN	zinc finger, SWIM-type containing 7						double-strand break repair via homologous recombination (GO:0000724)|protein stabilization (GO:0050821)	nucleus (GO:0005634)|Shu complex (GO:0097196)	zinc ion binding (GO:0008270)			upper_aerodigestive_tract(1)	1				UCEC - Uterine corpus endometrioid carcinoma (92;0.0827)		ATGAGAATGGAAAAAAAAAGT	0.279																																																	0													47.0	48.0	48.0					17																	15897110		1815	4070	5885	SO:0001627	intron_variant	0			AK093384	CCDS42266.1	17p11.2	2014-02-12			ENSG00000214941	ENSG00000214941		"""Zinc fingers, SWIM-type"""	26993	protein-coding gene	gene with protein product	"""SWIM domain containing Srs2 interacting protein 1"""	614535				16710300	Standard	NM_001042698		Approved	SWS1	uc002gpf.3	Q19AV6	OTTHUMG00000059308	ENST00000399277.1:c.77-18T>-	17.37:g.15897110delA				RNA	DEL	-	NULL	ENST00000399277.1	37	NULL	CCDS42266.1	17																																																																																			ZSWIM7	-	-	ENSG00000214941		0.279	ZSWIM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSWIM7	HGNC	protein_coding	OTTHUMT00000131736.1		0.00	14	0	A	NM_001042697		15897110	-1	tier1		no_errors	ENST00000475498	ensembl	human	known	74_37	rna	11.76	15	2	DEL	0.002	-
