#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
MRC1	4360	genome.wustl.edu	37	10	17865242	17865242	+	Silent	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr10:17865242G>T	ENST00000331429.2	+	2	334	c.231G>T	c.(229-231)gtG>gtT	p.V77V	MRC1L1_ENST00000457317.1_Silent_p.V77V																breast(1)|endometrium(1)|large_intestine(1)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						GCCTGGGAGTGCCATCAAAAA	0.443																																																	0													174.0	174.0	174.0					10																	17865242		2034	3972	6006	SO:0001819	synonymous_variant	0																														ENST00000331429.2:c.231G>T	10.37:g.17865242G>T				Silent	SNP	pfam_C-type_lectin,pfam_FN_type2_col-bd,pfam_Ricin_B_lectin,pfam_Herpes_UL45-like,superfamily_Ricin_B_lectin,superfamily_C-type_lectin_fold,superfamily_Kringle-like,smart_Ricin_B_lectin,smart_FN_type2_col-bd,smart_C-type_lectin,pfscan_FN_type2_col-bd,pfscan_C-type_lectin,pfscan_Ricin_B_lectin,prints_AntifreezeII	p.V77	ENST00000331429.2	37	c.231		10																																																																																			MRC1L1	-	pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	ENSG00000183748		0.443	MRC1L1-001	NOVEL	basic|appris_principal	protein_coding	101928757	Clone_based_vega_gene	protein_coding	OTTHUMT00000047054.1	-	0.00	183	0	G			17865242	+1	tier1	-	no_errors	ENST00000457317	ensembl	human	known	74_37	silent	17.97	105	23	SNP	0.637	T
ABCA2	20	genome.wustl.edu	37	9	139915182	139915182	+	Nonsense_Mutation	SNP	C	C	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr9:139915182C>T	ENST00000371605.3	-	8	1373	c.1226G>A	c.(1225-1227)tGg>tAg	p.W409*	ABCA2_ENST00000341511.6_Nonsense_Mutation_p.W410*|ABCA2_ENST00000492260.1_5'UTR|ABCA2_ENST00000265662.5_Nonsense_Mutation_p.W410*			Q9BZC7	ABCA2_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 2	409					ATP catabolic process (GO:0006200)|cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|regulation of intracellular cholesterol transport (GO:0032383)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)|response to steroid hormone (GO:0048545)|transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|nucleotide binding (GO:0000166)			central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|liver(1)|lung(25)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	41	all_cancers(76;0.16)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		CAGGCCGGCCCAGAGCTGTAC	0.687																																																	0													12.0	14.0	13.0					9																	139915182		1998	4117	6115	SO:0001587	stop_gained	0			U18235	CCDS43909.1	9q34	2012-03-14			ENSG00000107331	ENSG00000107331		"""ATP binding cassette transporters / subfamily A"""	32	protein-coding gene	gene with protein product		600047		ABC2		8088782	Standard	NM_212533		Approved		uc022bpy.1	Q9BZC7	OTTHUMG00000020958	ENST00000371605.3:c.1226G>A	9.37:g.139915182C>T	ENSP00000360666:p.Trp409*		A6NED5|Q5SPY5|Q5W9G5|Q76MW7|Q9HC28	Nonsense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.W410*	ENST00000371605.3	37	c.1229		9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	41|41	8.587415|8.587415	0.98875|0.98875	.|.	.|.	ENSG00000107331|ENSG00000107331	ENST00000470535|ENST00000265662;ENST00000371605;ENST00000355090;ENST00000341511	.|.	.|.	.|.	4.86|4.86	4.86|4.86	0.63082|0.63082	.|.	.|3.669520	.|0.01298	.|U	.|0.010223	T|.	0.34077|.	0.0885|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.22208|.	-1.0223|.	3|.	.|0.02654	.|T	.|1	.|.	17.9737|17.9737	0.89120|0.89120	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	R|X	26|410;409;440;410	.|.	.|ENSP00000265662:W410X	G|W	-|-	1|2	0|0	ABCA2|ABCA2	139035003|139035003	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.925000|0.925000	0.55904|0.55904	5.724000|5.724000	0.68500|0.68500	2.239000|2.239000	0.73571|0.73571	0.462000|0.462000	0.41574|0.41574	GGG|TGG	ABCA2	-	NULL	ENSG00000107331		0.687	ABCA2-202	KNOWN	basic	protein_coding	ABCA2	HGNC	protein_coding		-	0.00	57	0	C	NM_001606		139915182	-1	tier1	-	no_errors	ENST00000265662	ensembl	human	known	74_37	nonsense	15.91	74	14	SNP	1.000	T
ACACA	31	genome.wustl.edu	37	17	35487049	35487049	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr17:35487049G>T	ENST00000394406.2	-	46	5854	c.5664C>A	c.(5662-5664)gaC>gaA	p.D1888E	ACACA_ENST00000353139.5_Missense_Mutation_p.D1925E|ACACA_ENST00000360679.3_Missense_Mutation_p.D1830E|ACACA_ENST00000335166.5_Missense_Mutation_p.D1810E|ACACA_ENST00000361253.5_Missense_Mutation_p.D14E	NM_198836.1	NP_942133.1	Q13085	ACACA_HUMAN	acetyl-CoA carboxylase alpha	1888	Carboxyltransferase.			D -> G (in Ref. 1; AAC50139). {ECO:0000305}.	acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|lipid homeostasis (GO:0055088)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|malonyl-CoA biosynthetic process (GO:2001295)|multicellular organismal protein metabolic process (GO:0044268)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(2)|breast(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(24)|lung(23)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	83		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)	CCCCTTCAAAGTCATCACACA	0.547																																					Colon(23;82 258 739 2117 10493 24037 27661 34815 35438 36249)												0													194.0	165.0	175.0					17																	35487049		2203	4300	6503	SO:0001583	missense	0			U19822	CCDS11317.1, CCDS11318.1, CCDS42302.1, CCDS42303.1	17q21	2014-05-06	2010-04-30		ENSG00000132142	ENSG00000278540	6.4.1.2		84	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 1"""	200350	"""acetyl-Coenzyme A carboxylase alpha"""	ACAC, ACC			Standard	NM_198837		Approved	ACC1	uc002hno.3	Q13085	OTTHUMG00000188463	ENST00000394406.2:c.5664C>A	17.37:g.35487049G>T	ENSP00000377928:p.Asp1888Glu		B2RP68|Q6KEV6|Q6XDA8|Q7Z2G8|Q7Z561|Q7Z563|Q7Z564|Q86WB2|Q86WB3	Missense_Mutation	SNP	pfam_AcCoA_COase_cen,pfam_Carboxyl_trans,pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_lsu_N,pfam_Biotin_COase_C,pfam_Biotin_lipoyl,pfam_Dala_Dala_lig_C,pfam_ATP-grasp_carboxylate-amine,superfamily_PreATP-grasp_dom,superfamily_Rudment_hybrid_motif,superfamily_Single_hybrid_motif,smart_Biotin_COase_C,pfscan_ATP-grasp,pfscan_Biotin_carboxylation_dom,pfscan_COA_CT_N,pfscan_COA_CT_C,pfscan_Biotin_lipoyl	p.D1925E	ENST00000394406.2	37	c.5775	CCDS11317.1	17	.	.	.	.	.	.	.	.	.	.	G	22.5	4.293754	0.80914	.	.	ENSG00000132142	ENST00000353139;ENST00000360679;ENST00000394406;ENST00000452074;ENST00000335166;ENST00000427330;ENST00000361253	D;D;D;D;D	0.97888	-4.59;-4.59;-4.59;-4.59;-4.59	5.83	5.83	0.93111	Acetyl-coenzyme A carboxyltransferase, C-terminal (1);Carboxyl transferase (1);	0.000000	0.85682	D	0.000000	D	0.98242	0.9418	M	0.71920	2.185	0.80722	D	1	D;D;D;D	0.76494	0.991;0.999;0.968;0.96	P;D;P;P	0.83275	0.86;0.996;0.781;0.673	D	0.97878	1.0290	10	0.52906	T	0.07	-21.0497	11.4618	0.50215	0.139:0.0:0.861:0.0	.	587;1925;1888;1830	F8W6G0;Q13085-4;Q13085;Q13085-2	.;.;ACACA_HUMAN;.	E	1925;1830;1888;1912;1810;587;14	ENSP00000344789:D1925E;ENSP00000353898:D1830E;ENSP00000377928:D1888E;ENSP00000335323:D1810E;ENSP00000354565:D14E	ENSP00000335323:D1810E	D	-	3	2	ACACA	32561162	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.778000	0.47726	2.762000	0.94881	0.655000	0.94253	GAC	ACACA	-	pfam_Carboxyl_trans,pfscan_COA_CT_C	ENSG00000132142		0.547	ACACA-009	KNOWN	basic|appris_principal|CCDS	protein_coding	ACACA	HGNC	protein_coding	OTTHUMT00000256696.1		0.00	84	0	G	NM_198836		35487049	-1			no_errors	ENST00000353139	ensembl	human	known	74_37	missense	5.63	66	4	SNP	1.000	T
ACOT8	10005	genome.wustl.edu	37	20	44485829	44485829	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr20:44485829G>T	ENST00000217455.4	-	1	216	c.126C>A	c.(124-126)ttC>ttA	p.F42L	ZSWIM3_ENST00000255152.2_5'Flank|ZSWIM3_ENST00000454862.2_5'Flank	NM_005469.3	NP_005460.2	O14734	ACOT8_HUMAN	acyl-CoA thioesterase 8	42					acyl-CoA metabolic process (GO:0006637)|alpha-linolenic acid metabolic process (GO:0036109)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|dicarboxylic acid catabolic process (GO:0043649)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|peroxisome fission (GO:0016559)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid metabolic process (GO:0033559)|viral process (GO:0016032)	mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)	acyl-CoA hydrolase activity (GO:0047617)|carboxylic ester hydrolase activity (GO:0052689)|choloyl-CoA hydrolase activity (GO:0033882)|medium-chain acyl-CoA hydrolase activity (GO:0052815)|palmitoyl-CoA hydrolase activity (GO:0016290)|receptor binding (GO:0005102)			kidney(2)|large_intestine(3)|lung(4)|skin(1)	10		Myeloproliferative disorder(115;0.0122)				CCGGCTACCTGAAGAGATCCT	0.662																																																	0													32.0	36.0	35.0					20																	44485829		2202	4299	6501	SO:0001583	missense	0			AF014404	CCDS13378.1	20q13.12	2012-05-16	2005-09-19	2005-09-19	ENSG00000101473	ENSG00000101473	3.1.2.27	"""Acyl CoA thioesterases"""	15919	protein-coding gene	gene with protein product	"""choloyl-CoA hydrolase"""	608123	"""peroxisomal acyl-CoA thioesterase"", ""peroxisomal acyl-CoA thioesterase 1"""	PTE1		10092594, 9153233, 16103133, 16940157	Standard	NM_005469		Approved	hACTE-III, hTE, PTE-2	uc002xqa.2	O14734	OTTHUMG00000033045	ENST00000217455.4:c.126C>A	20.37:g.44485829G>T	ENSP00000217455:p.Phe42Leu		O15261|Q17RX4	Missense_Mutation	SNP	pfam_Acyl_CoA_thio_II_dom,tigrfam_Acyl_CoA_thio	p.F42L	ENST00000217455.4	37	c.126	CCDS13378.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	36|36	5.732005|5.732005	0.96856|0.96856	.|.	.|.	ENSG00000101473|ENSG00000101473	ENST00000217455;ENST00000426915;ENST00000372531|ENST00000457981	.|.	.|.	.|.	5.4|5.4	5.4|5.4	0.78164|0.78164	.|.	0.170754|.	0.53938|.	D|.	0.000060|.	T|T	0.52869|0.52869	0.1761|0.1761	N|N	0.19112|0.19112	0.55|0.55	0.54753|0.54753	D|D	0.99998|0.99998	B;P;B|.	0.40431|.	0.0;0.717;0.376|.	B;B;B|.	0.37480|.	0.0;0.251;0.141|.	T|T	0.45293|0.45293	-0.9271|-0.9271	9|5	0.87932|.	D|.	0|.	-19.4021|-19.4021	17.5244|17.5244	0.87795|0.87795	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	42;42;42|.	E9PRD4;B4DLF4;O14734|.	.;.;ACOT8_HUMAN|.	L|K	42;40;42|3	.|.	ENSP00000217455:F42L|.	F|Q	-|-	3|1	2|0	ACOT8|ACOT8	43919236|43919236	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.985000|0.985000	0.73830|0.73830	7.232000|7.232000	0.78116|0.78116	2.813000|2.813000	0.96785|0.96785	0.561000|0.561000	0.74099|0.74099	TTC|CAG	ACOT8	-	tigrfam_Acyl_CoA_thio	ENSG00000101473		0.662	ACOT8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACOT8	HGNC	protein_coding	OTTHUMT00000080338.2		0.00	97	0	G	NM_183386		44485829	-1			no_errors	ENST00000217455	ensembl	human	known	74_37	missense	5.71	66	4	SNP	1.000	T
ADAM19	8728	genome.wustl.edu	37	5	156908789	156908789	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr5:156908789G>C	ENST00000517905.1	-	22	2757	c.2713C>G	c.(2713-2715)Cgg>Ggg	p.R905G	ADAM19_ENST00000430702.2_Intron|ADAM19_ENST00000257527.4_Intron|ADAM19_ENST00000394020.1_Intron			Q9H013	ADA19_HUMAN	ADAM metallopeptidase domain 19	905					heart development (GO:0007507)|membrane protein ectodomain proteolysis (GO:0006509)	integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(33)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	53	Renal(175;0.00488)	Medulloblastoma(196;0.0359)|all_neural(177;0.14)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			AGGGCTTCCCGTGGACTCACC	0.617																																																	0													17.0	18.0	18.0					5																	156908789		2195	4292	6487	SO:0001583	missense	0			AF311317	CCDS4338.1	5q33.3	2010-06-24	2010-06-24		ENSG00000135074	ENSG00000135074		"""ADAM metallopeptidase domain containing"""	197	protein-coding gene	gene with protein product	"""meltrin beta"""	603640	"""a disintegrin and metalloproteinase domain 19 (meltrin beta)"""			9806848	Standard	NM_033274		Approved	MLTNB	uc003lwz.4	Q9H013	OTTHUMG00000130242	ENST00000517905.1:c.2713C>G	5.37:g.156908789G>C	ENSP00000428654:p.Arg905Gly		Q9BZL5|Q9UHP2	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_EG-like_dom,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.R905G	ENST00000517905.1	37	c.2713		5	.	.	.	.	.	.	.	.	.	.	G	8.256	0.810133	0.16537	.	.	ENSG00000135074	ENST00000517905	T	0.01516	4.81	4.81	-4.84	0.03151	.	.	.	.	.	T	0.01489	0.0048	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.42882	-0.9425	6	0.44086	T	0.13	.	2.2523	0.04046	0.3214:0.2938:0.284:0.1008	.	.	.	.	G	905	ENSP00000428654:R905G	ENSP00000428654:R905G	R	-	1	2	ADAM19	156841367	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-1.994000	0.01474	-1.110000	0.02992	-1.134000	0.01955	CGG	ADAM19	-	NULL	ENSG00000135074		0.617	ADAM19-003	PUTATIVE	basic	protein_coding	ADAM19	HGNC	protein_coding	OTTHUMT00000373918.1	-	0.00	40	0	G	NM_033274		156908789	-1	tier1	-	no_errors	ENST00000517905	ensembl	human	putative	74_37	missense	37.10	39	23	SNP	0.000	C
ADAMTS13	11093	genome.wustl.edu	37	9	136307651	136307651	+	Silent	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr9:136307651G>T	ENST00000371929.3	+	17	2544	c.2100G>T	c.(2098-2100)ggG>ggT	p.G700G	ADAMTS13_ENST00000536611.1_Intron|ADAMTS13_ENST00000485925.1_Intron|ADAMTS13_ENST00000371916.1_3'UTR|ADAMTS13_ENST00000356589.2_Silent_p.G669G|ADAMTS13_ENST00000355699.2_Silent_p.G700G	NM_139025.3|NM_139027.3	NP_620594.1|NP_620596.2	Q76LX8	ATS13_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 13	700	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cell-matrix adhesion (GO:0007160)|glycoprotein metabolic process (GO:0009100)|integrin-mediated signaling pathway (GO:0007229)|peptide catabolic process (GO:0043171)|platelet activation (GO:0030168)|protein processing (GO:0016485)|proteolysis (GO:0006508)|response to interferon-gamma (GO:0034341)|response to interleukin-4 (GO:0070670)|response to tumor necrosis factor (GO:0034612)	cell surface (GO:0009986)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(4)	36				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		TGAGCTGTGGGGCAGGTGAGA	0.677																																																	0													71.0	67.0	69.0					9																	136307651		2203	4299	6502	SO:0001819	synonymous_variant	0			AJ011374	CCDS6970.1, CCDS6971.1, CCDS6972.1	9q34	2008-07-21	2005-08-19	2001-09-21	ENSG00000160323	ENSG00000160323		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	1366	protein-coding gene	gene with protein product		604134	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 13"""	C9orf8		11557746, 11535495	Standard	NM_139025		Approved	VWFCP, TTP, vWF-CP, FLJ42993, MGC118899, MGC118900, DKFZp434C2322	uc004cdv.4	Q76LX8	OTTHUMG00000020876	ENST00000371929.3:c.2100G>T	9.37:g.136307651G>T			Q6UY16|Q710F6|Q711T8|Q96L37|Q9H0G3|Q9UGQ1	Silent	SNP	pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,superfamily_CUB_dom,smart_ADAM_Cys-rich,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.G700	ENST00000371929.3	37	c.2100	CCDS6970.1	9																																																																																			ADAMTS13	-	superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt	ENSG00000160323		0.677	ADAMTS13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ADAMTS13	HGNC	protein_coding	OTTHUMT00000054920.1	-	0.00	31	0	G	NM_139025		136307651	+1	tier1	-	no_errors	ENST00000371929	ensembl	human	known	74_37	silent	10.26	35	4	SNP	1.000	T
ADCY10P1	221442	genome.wustl.edu	37	6	41078986	41078986	+	RNA	SNP	G	G	T	rs146079468	byFrequency	TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr6:41078986G>T	ENST00000567255.1	+	0	1475					NR_026938.2				adenylate cyclase 10 (soluble) pseudogene 1																		CTGTGTTTTCGGCCTTCCTGG	0.493																																																	0																																												0					6p21.1	2012-07-04			ENSG00000161912	ENSG00000161912			44143	pseudogene	pseudogene							Standard	NR_026938		Approved		uc010jxi.1		OTTHUMG00000014668		6.37:g.41078986G>T				RNA	SNP	-	NULL	ENST00000567255.1	37	NULL		6																																																																																			ADCY10P1	-	-	ENSG00000161912		0.493	ADCY10P1-002	KNOWN	non_canonical_polymorphism|basic	processed_transcript	ADCY10P1	HGNC	pseudogene	OTTHUMT00000436223.1	-	0.00	41	0	G	NR_026938		41078986	+1	tier1	-	no_errors	ENST00000567255	ensembl	human	known	74_37	rna	26.79	41	15	SNP	0.999	T
ADCY7	113	genome.wustl.edu	37	16	50325780	50325780	+	Missense_Mutation	SNP	C	C	T	rs150887897	byFrequency	TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr16:50325780C>T	ENST00000394697.2	+	4	849	c.509C>T	c.(508-510)aCg>aTg	p.T170M	ADCY7_ENST00000537579.1_Missense_Mutation_p.T170M|ADCY7_ENST00000538642.1_Missense_Mutation_p.T170M|ADCY7_ENST00000254235.3_Missense_Mutation_p.T170M|ADCY7_ENST00000566433.2_Missense_Mutation_p.T170M|ADCY7_ENST00000564044.1_Intron			P51828	ADCY7_HUMAN	adenylate cyclase 7	170					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to ethanol (GO:0071361)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|maternal process involved in female pregnancy (GO:0060135)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cAMP biosynthetic process (GO:0030819)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(5)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(3)	35		all_cancers(37;0.0127)		GBM - Glioblastoma multiforme(240;0.195)		GGAGGCTTCACGACACCCAGT	0.652																																																	0								C	MET/THR	0,4396		0,0,2198	66.0	61.0	63.0		509	-2.2	0.0	16	dbSNP_134	63	1,8599	1.2+/-3.3	0,1,4299	no	missense	ADCY7	NM_001114.3	81	0,1,6497	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	170/1081	50325780	1,12995	2198	4300	6498	SO:0001583	missense	0			D25538	CCDS10741.1, CCDS73882.1	16q12.1	2013-02-04			ENSG00000121281	ENSG00000121281	4.6.1.1	"""Adenylate cyclases"""	238	protein-coding gene	gene with protein product		600385				7860067	Standard	NM_001286057		Approved	KIAA0037, AC7	uc002egd.1	P51828	OTTHUMG00000133172	ENST00000394697.2:c.509C>T	16.37:g.50325780C>T	ENSP00000378187:p.Thr170Met		A0AVA6	Missense_Mutation	SNP	pfam_A/G_cyclase,pfam_Adenylate_cyclase-like,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.T170M	ENST00000394697.2	37	c.509	CCDS10741.1	16	.	.	.	.	.	.	.	.	.	.	C	12.10	1.837988	0.32513	0.0	1.16E-4	ENSG00000121281	ENST00000538642;ENST00000394697;ENST00000537579;ENST00000254235	T;D;T;D	0.82255	-1.09;-1.59;-1.1;-1.59	3.92	-2.19	0.07015	.	2.122320	0.03053	U	0.154796	T	0.72598	0.3480	N	0.22421	0.69	0.09310	N	1	P;P	0.47034	0.823;0.889	B;P	0.44897	0.097;0.463	T	0.63305	-0.6667	10	0.48119	T	0.1	.	2.6283	0.04936	0.3658:0.3593:0.1797:0.0953	.	170;170	P51828;F5H4D1	ADCY7_HUMAN;.	M	170	ENSP00000445046:T170M;ENSP00000378187:T170M;ENSP00000437788:T170M;ENSP00000254235:T170M	ENSP00000254235:T170M	T	+	2	0	ADCY7	48883281	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.301000	0.08232	-0.278000	0.09180	-0.258000	0.10820	ACG	ADCY7	-	NULL	ENSG00000121281		0.652	ADCY7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY7	HGNC	protein_coding	OTTHUMT00000256877.3		0.00	48	0	C			50325780	+1			no_errors	ENST00000254235	ensembl	human	known	74_37	missense	7.55	49	4	SNP	0.000	T
ADIRF	10974	genome.wustl.edu	37	10	88728258	88728258	+	5'UTR	SNP	G	G	C			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr10:88728258G>C	ENST00000372013.3	+	0	310				ADIRF-AS1_ENST00000418273.2_RNA|ADIRF-AS1_ENST00000440490.1_RNA|RP11-96C23.15_ENST00000609363.1_RNA|RP11-96C23.5_ENST00000433214.2_RNA|ADIRF-AS1_ENST00000609111.1_RNA	NM_006829.2	NP_006820.1	Q15847	ADIRF_HUMAN	adipogenesis regulatory factor						cell differentiation (GO:0030154)|cellular response to cisplatin (GO:0072719)|cellular response to radiation (GO:0071478)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of response to drug (GO:2001023)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)											AGGATCCAACGTCGCTCCAGC	0.662																																																	0													33.0	29.0	30.0					10																	88728258		2199	4300	6499	SO:0001623	5_prime_UTR_variant	0			BC004471	CCDS7381.1	10q23.31	2013-02-20	2013-02-20	2013-02-20	ENSG00000148671	ENSG00000148671			24043	protein-coding gene	gene with protein product	"""adipose specific 2"", ""adipose most abundant gene transcript 2"", ""adipogenesis factor rich in obesity"""		"""chromosome 10 open reading frame 116"""	C10orf116		8619847, 23239344	Standard	NM_006829		Approved	APM2, AFRO	uc001ked.2	Q15847	OTTHUMG00000018668	ENST00000372013.3:c.-44G>C	10.37:g.88728258G>C				RNA	SNP	-	NULL	ENST00000372013.3	37	NULL	CCDS7381.1	10																																																																																			ADIRF-AS1	-	-	ENSG00000272734		0.662	ADIRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADIRF-AS1	HGNC	protein_coding	OTTHUMT00000049194.1	-	0.00	46	0	G	NM_006829		88728258	-1	tier1	-	no_errors	ENST00000609111	ensembl	human	known	74_37	rna	54.55	25	30	SNP	0.000	C
ADPGK	83440	genome.wustl.edu	37	15	73076342	73076342	+	5'Flank	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr15:73076342G>T	ENST00000311669.8	-	0	0				ADPGK_ENST00000567733.1_5'Flank|ADPGK-AS1_ENST00000566745.1_RNA|ADPGK-AS1_ENST00000563592.1_RNA	NM_031284.4	NP_112574.3	Q9BRR6	ADPGK_HUMAN	ADP-dependent glucokinase						glycolytic process (GO:0006096)	extracellular region (GO:0005576)|membrane (GO:0016020)	ADP-specific glucokinase activity (GO:0043843)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|skin(1)	7						GAACACATTTGCTTTCGCAGT	0.557											OREG0023259	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0																																										SO:0001631	upstream_gene_variant	0			AL136873	CCDS42057.1	15q24.1	2012-07-02			ENSG00000159322	ENSG00000159322			25250	protein-coding gene	gene with protein product		611861				11230166	Standard	NM_031284		Approved	DKFZp434B195, ADP-GK	uc002avf.4	Q9BRR6	OTTHUMG00000172777		15.37:g.73076342G>T	Exception_encountered	1142	Q49AU7|Q8NBI1|Q8WZ90|Q96NF8|Q9H0A7	RNA	SNP	-	NULL	ENST00000311669.8	37	NULL	CCDS42057.1	15																																																																																			ADPGK-AS1	-	-	ENSG00000260898		0.557	ADPGK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ADPGK-AS1	HGNC	protein_coding	OTTHUMT00000420434.1	-	0.00	141	0	G	NM_031284		73076342	+1	tier1	-	no_errors	ENST00000563592	ensembl	human	known	74_37	rna	5.56	68	4	SNP	0.006	T
AFF3	3899	genome.wustl.edu	37	2	100623662	100623662	+	Silent	SNP	A	A	G			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr2:100623662A>G	ENST00000409236.2	-	4	547	c.435T>C	c.(433-435)acT>acC	p.T145T	AFF3_ENST00000317233.4_Silent_p.T145T|AFF3_ENST00000409579.1_Silent_p.T170T|AFF3_ENST00000356421.2_Silent_p.T170T			P51826	AFF3_HUMAN	AF4/FMR2 family, member 3	145					embryonic hindlimb morphogenesis (GO:0035116)|regulation of transcription, DNA-templated (GO:0006355)|response to tumor necrosis factor (GO:0034612)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)			NS(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(9)|kidney(4)|large_intestine(20)|liver(1)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(3)	86						GCCAGCCCATAGTGCCTCTCT	0.542																																																	0													93.0	100.0	98.0					2																	100623662		2203	4300	6503	SO:0001819	synonymous_variant	0			U34360	CCDS33258.1, CCDS42723.1	2q11.2-q12	2008-02-05	2005-06-27	2005-06-27	ENSG00000144218	ENSG00000144218			6473	protein-coding gene	gene with protein product		601464	"""lymphoid nuclear protein related to AF4"""	LAF4		8662235, 8555498	Standard	XM_005263945		Approved	MLLT2-like	uc002taf.3	P51826	OTTHUMG00000153011	ENST00000409236.2:c.435T>C	2.37:g.100623662A>G			B7ZM46|B9EGL9|D3DVI6|Q53RD6|Q53S47|Q53SI6|Q53TB9|Q59F27|Q8IWJ5	Silent	SNP	pfam_TF_AF4/FMR2	p.T170	ENST00000409236.2	37	c.510	CCDS42723.1	2																																																																																			AFF3	-	pfam_TF_AF4/FMR2	ENSG00000144218		0.542	AFF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AFF3	HGNC	protein_coding	OTTHUMT00000328982.3	-	0.00	54	0	A	NM_002285		100623662	-1	tier1	-	no_errors	ENST00000356421	ensembl	human	known	74_37	silent	47.06	18	16	SNP	0.018	G
AIM1	202	genome.wustl.edu	37	6	106967402	106967402	+	Silent	SNP	G	G	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr6:106967402G>A	ENST00000369066.3	+	2	1582	c.1095G>A	c.(1093-1095)gaG>gaA	p.E365E		NM_001624.2	NP_001615	Q9UMX9	S45A2_HUMAN	absent in melanoma 1	0					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				breast(8)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(7)|large_intestine(13)|lung(20)|ovary(5)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	69	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		ACTCTTCTGAGAATCAAGCTC	0.463																																																	0													89.0	99.0	96.0					6																	106967402		2203	4300	6503	SO:0001819	synonymous_variant	0			U83115	CCDS34506.1	6q21	2014-01-29			ENSG00000112297	ENSG00000112297			356	protein-coding gene	gene with protein product	"""suppression of tumorigenicity 4"", ""beta-gamma crystallin domain containing 1"""	601797	"""suppression of tumorigenicity 4 (malignant melanoma)"""	ST4		1680551, 12693952	Standard	NM_001624		Approved	CRYBG1	uc003prh.3	Q9Y4K1	OTTHUMG00000015302	ENST00000369066.3:c.1095G>A	6.37:g.106967402G>A			Q6P2P0|Q9BTM3	Silent	SNP	pfam_Beta/gamma_crystallin,pfam_Ricin_B_lectin,superfamily_G_crystallin-rel,superfamily_Ricin_B_lectin,smart_Beta/gamma_crystallin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin,pfscan_Beta/gamma_crystallin,prints_Beta/gamma_crystallin	p.E365	ENST00000369066.3	37	c.1095	CCDS34506.1	6																																																																																			AIM1	-	NULL	ENSG00000112297		0.463	AIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AIM1	HGNC	protein_coding	OTTHUMT00000041669.1	-	0.00	31	0	G			106967402	+1	tier1	-	no_errors	ENST00000369066	ensembl	human	known	74_37	silent	37.04	17	10	SNP	0.001	A
AK9	221264	genome.wustl.edu	37	6	109980576	109980576	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr6:109980576C>G	ENST00000424296.2	-	7	561	c.485G>C	c.(484-486)aGa>aCa	p.R162T	AK9_ENST00000341338.6_5'UTR|AK9_ENST00000368948.2_Missense_Mutation_p.R162T|AK9_ENST00000285397.5_Missense_Mutation_p.R162T	NM_001145128.2	NP_001138600.2	Q5TCS8	KAD9_HUMAN	adenylate kinase 9	162	Adenylate kinase 1.|LID 1. {ECO:0000250}.				ADP phosphorylation (GO:0006757)|AMP phosphorylation (GO:0006756)|CDP phosphorylation (GO:0061508)|CMP phosphorylation (GO:0061566)|dADP phosphorylation (GO:0006174)|dAMP phosphorylation (GO:0061565)|dCDP phosphorylation (GO:0061570)|dCMP phosphorylation (GO:0061567)|dGDP phosphorylation (GO:0006186)|GDP phosphorylation (GO:0061568)|TDP phosphorylation (GO:0061571)|UDP phosphorylation (GO:0061569)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)|nucleoside phosphate kinase activity (GO:0050145)										ATTGTGCTGTCTTTGCCCAGA	0.368																																																	0													133.0	120.0	125.0					6																	109980576		2203	4300	6503	SO:0001583	missense	0			AK131244, BC146443, BC087860	CCDS5077.1, CCDS55048.1	6q21	2013-04-29	2013-04-29	2013-04-29			2.7.4.3		33814	protein-coding gene	gene with protein product		615358	"""chromosome 6 open reading frame 224"", ""adenylate kinase domain containing 2"", ""chromosome 6 open reading frame 199"", ""adenylate kinase domain containing 1"""	C6orf224, AKD2, C6orf199, AKD1		23416111	Standard	NM_145025		Approved	FLJ42177, FLJ25791, dJ70A9.1, MGC26954		Q5TCS8		ENST00000424296.2:c.485G>C	6.37:g.109980576C>G	ENSP00000410186:p.Arg162Thr		A6NL75|B2RDJ0|B6ZDM7|Q3MIS4|Q5I0W8|Q6ZNF1|Q6ZVR7|Q8N7C6|Q8WW00|Q96NF4	Missense_Mutation	SNP	pfam_Adenylate_kin,pfam_YHS_dom,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.R162T	ENST00000424296.2	37	c.485	CCDS55048.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.5|22.5	4.304340|4.304340	0.81136|0.81136	.|.	.|.	ENSG00000155085|ENSG00000155085	ENST00000524674|ENST00000424296;ENST00000368948;ENST00000285397;ENST00000448084;ENST00000532976	.|T;T;T;T;T	.|0.71934	.|-0.59;-0.61;-0.52;0.97;0.97	5.46|5.46	5.46|5.46	0.80206|0.80206	.|ATPase, AAA+ type, core (1);	.|0.099868	.|0.64402	.|D	.|0.000006	D|D	0.82797|0.82797	0.5115|0.5115	M|M	0.84683|0.84683	2.71|2.71	0.80722|0.80722	D|D	1|1	.|D;D	.|0.71674	.|0.962;0.998	.|P;D	.|0.72625	.|0.671;0.978	D|D	0.84241|0.84241	0.0472|0.0472	5|9	.|.	.|.	.|.	-16.8697|-16.8697	16.2363|16.2363	0.82377|0.82377	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|162;162	.|Q5TCS8-2;Q5TCS8	.|.;AKD1_HUMAN	H|T	50|162;162;162;85;162	.|ENSP00000410186:R162T;ENSP00000357944:R162T;ENSP00000285397:R162T;ENSP00000407510:R85T;ENSP00000436325:R162T	.|.	D|R	-|-	1|2	0|0	AKD1|AKD1	110087269|110087269	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.931000|0.931000	0.56810|0.56810	3.333000|3.333000	0.52090|0.52090	2.560000|2.560000	0.86352|0.86352	0.650000|0.650000	0.86243|0.86243	GAC|AGA	AK9	-	pfam_Adenylate_kin,superfamily_P-loop_NTPase,smart_AAA+_ATPase	ENSG00000155085		0.368	AK9-202	KNOWN	basic|appris_principal|CCDS	protein_coding	AK9	HGNC	protein_coding		-	0.00	35	0	C	NM_001145128		109980576	-1	tier1	-	no_errors	ENST00000424296	ensembl	human	known	74_37	missense	41.89	43	31	SNP	1.000	G
AKAP4	8852	genome.wustl.edu	37	X	49961618	49961618	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chrX:49961618C>T	ENST00000376056.2	-	4	323	c.173G>A	c.(172-174)gGc>gAc	p.G58D	AKAP4_ENST00000358526.2_Missense_Mutation_p.G67D|AKAP4_ENST00000376064.3_Missense_Mutation_p.G58D|AKAP4_ENST00000481402.1_5'UTR|AKAP4_ENST00000376058.2_Missense_Mutation_p.G58D					A kinase (PRKA) anchor protein 4											NS(2)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(6)|lung(14)|ovary(1)|skin(4)	41	Ovarian(276;0.236)					GTTTAAGTTGCCTTCTGAGCT	0.433																																																	0													175.0	145.0	155.0					X																	49961618		2203	4300	6503	SO:0001583	missense	0			AF072756	CCDS14329.1, CCDS14330.1	Xp11.2	2009-03-12			ENSG00000147081	ENSG00000147081		"""A-kinase anchor proteins"""	374	protein-coding gene	gene with protein product	"""A-kinase anchor protein 82 kDa"", ""testis-specific gene HI"", ""protein kinase A anchoring protein 4"", ""cancer/testis antigen 99"""	300185				9822690, 9514854	Standard	NM_003886		Approved	p82, hAKAP82, AKAP82, Fsc1, HI, CT99	uc004dow.1	Q5JQC9	OTTHUMG00000021517	ENST00000376056.2:c.173G>A	X.37:g.49961618C>T	ENSP00000365224:p.Gly58Asp			Missense_Mutation	SNP	pfam_AKAP_110_C,pfam_RII_binding_1,smart_AKAP_110	p.G67D	ENST00000376056.2	37	c.200	CCDS14330.1	X	.	.	.	.	.	.	.	.	.	.	C	0.348	-0.946781	0.02304	.	.	ENSG00000147081	ENST00000376056;ENST00000376058;ENST00000358526;ENST00000376064;ENST00000448865;ENST00000437370	T;T;T;T;T	0.33438	2.65;1.41;2.65;2.65;1.42	4.57	2.74	0.32292	.	0.504572	0.16825	N	0.198005	T	0.19927	0.0479	L	0.36672	1.1	0.09310	N	1	B;B	0.12013	0.005;0.003	B;B	0.09377	0.004;0.004	T	0.22765	-1.0207	9	.	.	.	-0.9557	5.3321	0.15938	0.1987:0.6907:0.0:0.1107	.	67;58	Q5JQC9;A6ND82	AKAP4_HUMAN;.	D	58;58;67;58;58;58	ENSP00000365224:G58D;ENSP00000365226:G58D;ENSP00000351327:G67D;ENSP00000365232:G58D;ENSP00000412279:G58D	.	G	-	2	0	AKAP4	49848358	0.001000	0.12720	0.001000	0.08648	0.011000	0.07611	0.311000	0.19380	0.306000	0.22856	-0.305000	0.09177	GGC	AKAP4	-	smart_AKAP_110	ENSG00000147081		0.433	AKAP4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP4	HGNC	protein_coding	OTTHUMT00000056552.1	-	0.00	36	0	C	NM_003886		49961618	-1	tier1	-	no_errors	ENST00000358526	ensembl	human	known	74_37	missense	12.12	29	4	SNP	0.020	T
AMBP	259	genome.wustl.edu	37	9	116823765	116823765	+	Silent	SNP	G	G	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr9:116823765G>A	ENST00000265132.3	-	8	1054	c.792C>T	c.(790-792)tgC>tgT	p.C264C		NM_001633.3	NP_001624.1	P02760	AMBP_HUMAN	alpha-1-microglobulin/bikunin precursor	264	BPTI/Kunitz inhibitor 1. {ECO:0000255|PROSITE-ProRule:PRU00031}.				cell adhesion (GO:0007155)|female pregnancy (GO:0007565)|heme catabolic process (GO:0042167)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of immune response (GO:0050777)|negative regulation of JNK cascade (GO:0046329)|protein catabolic process (GO:0030163)|protein-chromophore linkage (GO:0018298)|viral process (GO:0016032)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	calcium channel inhibitor activity (GO:0019855)|calcium oxalate binding (GO:0046904)|heme binding (GO:0020037)|IgA binding (GO:0019862)|protein homodimerization activity (GO:0042803)|serine-type endopeptidase inhibitor activity (GO:0004867)|small molecule binding (GO:0036094)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	11					Human Serum Albumin(DB00062)|Serum albumin iodonated(DB00064)	CGTTGCCCATGCAGCCGCCGT	0.587																																																	0													76.0	69.0	72.0					9																	116823765		2203	4300	6503	SO:0001819	synonymous_variant	0			X04494	CCDS6800.1	9q32-q33	2014-01-22			ENSG00000106927	ENSG00000106927		"""Lipocalins"""	453	protein-coding gene	gene with protein product	"""growth-inhibiting protein 19"", ""uristatin"", ""complex-forming glycoprotein heterogeneous in charge"", ""bikunin"", ""inter-alpha-trypsin inhibitor light chain"", ""protein HC"", ""uronic-acid-rich protein"", ""trypstatin"""	176870		ITI, ITIL		1708673, 1385302	Standard	NM_001633		Approved	UTI, HCP, EDC1, HI30, IATIL, ITILC	uc004bie.4	P02760	OTTHUMG00000020534	ENST00000265132.3:c.792C>T	9.37:g.116823765G>A			P00977|P02759|P78491|Q2TU33|Q5TBD7|Q9UC58|Q9UDI8	Silent	SNP	pfam_Prot_inh_Kunz-m,pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like,superfamily_Prot_inh_Kunz-m,smart_Prot_inh_Kunz-m,pfscan_Prot_inh_Kunz-m,prints_A1-microglobln,prints_PstgldnD_synth,prints_Prot_inh_Kunz-m,prints_Lipocalin	p.C264	ENST00000265132.3	37	c.792	CCDS6800.1	9																																																																																			AMBP	-	pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,smart_Prot_inh_Kunz-m,pfscan_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m	ENSG00000106927		0.587	AMBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMBP	HGNC	protein_coding	OTTHUMT00000053758.2		0.00	86	0	G	NM_001633		116823765	-1			no_errors	ENST00000265132	ensembl	human	known	74_37	silent	6.67	56	4	SNP	0.959	A
AMBRA1	55626	genome.wustl.edu	37	11	46568608	46568609	+	Intron	INS	-	-	A	rs545025314		TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr11:46568608_46568609insA	ENST00000458649.2	-	4	797				AMBRA1_ENST00000528950.1_Intron|AMBRA1_ENST00000298834.3_Intron|AMBRA1_ENST00000534300.1_Intron|AMBRA1_ENST00000533727.1_Intron|AMBRA1_ENST00000314845.3_Intron|AMBRA1_ENST00000426438.1_Intron			Q9C0C7	AMRA1_HUMAN	autophagy/beclin-1 regulator 1						autophagy (GO:0006914)|cell differentiation (GO:0030154)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neural tube development (GO:0021915)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|phagocytic vesicle (GO:0045335)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	39				GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)		gactccgtctcaaaaaaaaaaa	0.465																																																	0																																										SO:0001627	intron_variant	0			AB051523	CCDS31475.1, CCDS58132.1, CCDS73281.1	11p11.2	2013-01-09			ENSG00000110497	ENSG00000110497		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	25990	protein-coding gene	gene with protein product	"""WD repeat domain 94"", ""DDB1 and CUL4 associated factor 3"""	611359				17622796, 17603510, 17589504	Standard	NM_001267782		Approved	FLJ20294, KIAA1736, WDR94, DCAF3	uc001ncv.3	Q9C0C7	OTTHUMG00000166500	ENST00000458649.2:c.378+53->T	11.37:g.46568619_46568619dupA			A6XN33|D3DQP8|G3V193|Q86XD6|Q9H8Z0|Q9NXE7	RNA	INS	-	NULL	ENST00000458649.2	37	NULL		11																																																																																			AMBRA1	-	-	ENSG00000110497		0.465	AMBRA1-005	KNOWN	basic	protein_coding	AMBRA1	HGNC	protein_coding	OTTHUMT00000390103.1		0.00	23	0	-	NM_017749		46568609	-1	tier1		no_errors	ENST00000524783	ensembl	human	known	74_37	rna	16.67	15	3	INS	0.032:0.881	A
AMY2B	280	genome.wustl.edu	37	1	104114789	104114789	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr1:104114789A>G	ENST00000361355.4	+	4	842	c.226A>G	c.(226-228)Aga>Gga	p.R76G	AMY2B_ENST00000491397.1_3'UTR	NM_020978.3	NP_066188.1	P19961	AMY2B_HUMAN	amylase, alpha 2B (pancreatic)	76					carbohydrate metabolic process (GO:0005975)|digestion (GO:0007586)	extracellular vesicular exosome (GO:0070062)	alpha-amylase activity (GO:0004556)|metal ion binding (GO:0046872)			breast(1)|endometrium(7)|kidney(4)|large_intestine(1)|lung(30)|prostate(1)|skin(1)|urinary_tract(1)	46		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0669)|all cancers(265;0.083)|Epithelial(280;0.094)|Lung(183;0.112)		TTGGTGGGAAAGATACCAACC	0.353																																																	0													142.0	143.0	143.0					1																	104114789		2202	4282	6484	SO:0001583	missense	0			M24895	CCDS782.1	1p21	2010-08-02	2006-04-27		ENSG00000240038	ENSG00000240038	3.2.1.1		478	protein-coding gene	gene with protein product		104660	"""amylase, alpha 2B; pancreatic"""	AMY2		8268204	Standard	NM_020978		Approved		uc001duq.3	P19961	OTTHUMG00000011024	ENST00000361355.4:c.226A>G	1.37:g.104114789A>G	ENSP00000354610:p.Arg76Gly		B3KTI1|B3KXB7|D3DT76|Q9UBH3	Missense_Mutation	SNP	pfam_Glyco_hydro_13_cat_dom,pfam_A-amylase_b_C,superfamily_Glycoside_hydrolase_SF,smart_Glyco_hydro_13_sub_cat_dom,smart_A-amylase_b_C,prints_Alpha_amylase	p.R76G	ENST00000361355.4	37	c.226	CCDS782.1	1	.	.	.	.	.	.	.	.	.	.	A	18.06	3.540470	0.65085	.	.	ENSG00000240038	ENST00000361355;ENST00000435302;ENST00000453959	D	0.97505	-4.41	4.65	4.65	0.58169	Glycoside hydrolase, subgroup, catalytic domain (1);Glycosyl hydrolase, family 13, catalytic domain (1);Glycoside hydrolase, superfamily (1);Glycosyl hydrolase, family 13, subfamily, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.98516	0.9505	M	0.91872	3.25	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99797	1.1034	10	0.87932	D	0	.	14.0847	0.64949	1.0:0.0:0.0:0.0	.	76	P19961	AMY2B_HUMAN	G	76	ENSP00000354610:R76G	ENSP00000354610:R76G	R	+	1	2	AMY2B	103916312	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	5.961000	0.70356	1.711000	0.51337	0.377000	0.23210	AGA	AMY2B	-	pfam_Glyco_hydro_13_cat_dom,superfamily_Glycoside_hydrolase_SF,smart_Glyco_hydro_13_sub_cat_dom,prints_Alpha_amylase	ENSG00000240038		0.353	AMY2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMY2B	HGNC	protein_coding	OTTHUMT00000030318.1	-	0.00	428	0	A	NM_020978		104114789	+1	tier1	-	no_errors	ENST00000361355	ensembl	human	known	74_37	missense	51.82	132	142	SNP	1.000	G
ANKS6	203286	genome.wustl.edu	37	9	101542471	101542471	+	Splice_Site	SNP	C	C	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr9:101542471C>A	ENST00000353234.4	-	6	1415	c.1368G>T	c.(1366-1368)aaG>aaT	p.K456N	ANKS6_ENST00000375018.1_Splice_Site_p.K456N|ANKS6_ENST00000540940.1_Splice_Site_p.K261N|ANKS6_ENST00000375019.2_Splice_Site_p.K155N			Q68DC2	ANKS6_HUMAN	ankyrin repeat and sterile alpha motif domain containing 6	456						cilium (GO:0005929)|cytoplasm (GO:0005737)				endometrium(3)|large_intestine(6)|lung(6)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	21		Acute lymphoblastic leukemia(62;0.0527)				AAAGGCAAACCTTCAGTCCAC	0.632																																																	0													45.0	47.0	46.0					9																	101542471		1925	4116	6041	SO:0001630	splice_region_variant	0			AK094247	CCDS43856.1	9q31.1	2013-09-10	2006-02-17	2006-02-17	ENSG00000165138	ENSG00000165138		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	26724	protein-coding gene	gene with protein product		615370	"""sterile alpha motif domain containing 6"", ""ankyrin repeat domain 14"""	SAMD6, ANKRD14		23793029	Standard	XM_005251793		Approved	FLJ36928, NPHP16	uc004ayu.3	Q68DC2	OTTHUMG00000020347	ENST00000353234.4:c.1368+1G>T	9.37:g.101542471C>A			A0SE62|Q5VSL0|Q5VSL2|Q5VSL3|Q5VSL4|Q68DB8|Q6P2R2|Q8N9L6|Q96D62	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SAM_type1,pfam_SAM_2,superfamily_Ankyrin_rpt-contain_dom,superfamily_SAM/pointed,smart_Ankyrin_rpt,smart_SAM,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SAM,prints_Ankyrin_rpt	p.K456N	ENST00000353234.4	37	c.1368	CCDS43856.1	9	.	.	.	.	.	.	.	.	.	.	C	27.7	4.851183	0.91277	.	.	ENSG00000165138	ENST00000375019;ENST00000375018;ENST00000353234;ENST00000540940	T;T;T;T	0.73258	1.55;-0.73;-0.71;1.79	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	D	0.82476	0.5045	M	0.63843	1.955	0.58432	D	0.999997	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.994	T	0.80964	-0.1147	9	.	.	.	-32.5179	17.5828	0.87973	0.0:1.0:0.0:0.0	.	456;456	Q68DC2-4;Q68DC2	.;ANKS6_HUMAN	N	155;456;456;261	ENSP00000364159:K155N;ENSP00000364158:K456N;ENSP00000297837:K456N;ENSP00000442189:K261N	.	K	-	3	2	ANKS6	100582292	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	7.237000	0.78164	2.752000	0.94435	0.557000	0.71058	AAG	ANKS6	-	NULL	ENSG00000165138		0.632	ANKS6-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	ANKS6	HGNC	protein_coding	OTTHUMT00000277053.1	-	0.00	126	0	C	NM_173551	Missense_Mutation	101542471	-1	tier1	-	no_errors	ENST00000375018	ensembl	human	known	74_37	missense	5.00	76	4	SNP	1.000	A
APOB	338	genome.wustl.edu	37	2	21257724	21257724	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr2:21257724C>T	ENST00000233242.1	-	8	995	c.868G>A	c.(868-870)Gac>Aac	p.D290N	APOB_ENST00000399256.4_Missense_Mutation_p.D290N	NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	290	Heparin-binding.|Vitellogenin. {ECO:0000255|PROSITE- ProRule:PRU00557}.				artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTTGGTGTGTCTTCAAGTTTC	0.443																																																	0													273.0	233.0	246.0					2																	21257724		2203	4300	6503	SO:0001583	missense	0			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.868G>A	2.37:g.21257724C>T	ENSP00000233242:p.Asp290Asn		O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	pfam_Lipid_transpt_N,pfam_Vitellinogen_open_b-sht,pfam_ApoB100_C,pfam_Lipid_transpt_open_b-sht,superfamily_Lipid_transp_b-sht_shell,superfamily_Vitellinogen_superhlx,superfamily_ARM-type_fold,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	p.D290N	ENST00000233242.1	37	c.868	CCDS1703.1	2	.	.	.	.	.	.	.	.	.	.	C	17.24	3.340070	0.60963	.	.	ENSG00000084674	ENST00000233242;ENST00000535079;ENST00000399256	T;T	0.04809	3.55;3.55	5.08	2.31	0.28768	Lipid transport protein, beta-sheet shell (1);Lipid transport protein, N-terminal (3);Vitellinogen, beta-sheet N-terminal (1);	0.202224	0.34223	N	0.004154	T	0.06234	0.0161	L	0.45581	1.43	0.41859	D	0.990217	B	0.24258	0.1	B	0.28916	0.096	T	0.27365	-1.0076	10	0.46703	T	0.11	.	11.0774	0.48040	0.0:0.7929:0.0:0.2071	.	290	P04114	APOB_HUMAN	N	290	ENSP00000233242:D290N;ENSP00000382200:D290N	ENSP00000233242:D290N	D	-	1	0	APOB	21111229	1.000000	0.71417	0.707000	0.30419	0.296000	0.27459	3.577000	0.53885	0.390000	0.25115	0.655000	0.94253	GAC	APOB	-	pfam_Lipid_transpt_N,superfamily_Lipid_transp_b-sht_shell,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	ENSG00000084674		0.443	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOB	HGNC	protein_coding	OTTHUMT00000207571.1	-	0.00	77	0	C			21257724	-1	tier1	-	no_errors	ENST00000233242	ensembl	human	known	74_37	missense	22.73	85	25	SNP	1.000	T
APOBR	55911	genome.wustl.edu	37	16	28507452	28507452	+	Missense_Mutation	SNP	G	G	T	rs370148393		TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr16:28507452G>T	ENST00000431282.1	+	3	1073	c.1063G>T	c.(1063-1065)Ggg>Tgg	p.G355W	APOBR_ENST00000328423.5_Missense_Mutation_p.G355W|CLN3_ENST00000567160.1_5'Flank|APOBR_ENST00000564831.1_Missense_Mutation_p.G364W|CLN3_ENST00000569430.1_5'Flank			Q0VD83	APOBR_HUMAN	apolipoprotein B receptor	355	Glu-rich.				cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|triglyceride metabolic process (GO:0006641)	chylomicron (GO:0042627)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	very-low-density lipoprotein particle receptor activity (GO:0030229)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|skin(2)|stomach(1)	29						GGAGGAGGCCGGGACAGCCTC	0.672																																																	0													14.0	17.0	16.0					16																	28507452		1944	4097	6041	SO:0001583	missense	0			AK025123	CCDS58442.1	16p11.2	2011-02-14			ENSG00000184730	ENSG00000184730			24087	protein-coding gene	gene with protein product	"""apolipoprotein B48 receptor"", ""apolipoprotein B100 receptor"""	605220				10852956	Standard	NM_018690		Approved	APOB48R, APOB100R	uc002dqb.2	Q0VD83		ENST00000431282.1:c.1063G>T	16.37:g.28507452G>T	ENSP00000416094:p.Gly355Trp		H3BU97|Q0VD81|Q8NC15|Q9NPJ9	Missense_Mutation	SNP	NULL	p.G364W	ENST00000431282.1	37	c.1090		16	.	.	.	.	.	.	.	.	.	.	G	11.71	1.718826	0.30503	.	.	ENSG00000184730	ENST00000328423;ENST00000431282	T;T	0.60548	0.18;0.18	3.86	-2.49	0.06403	.	.	.	.	.	T	0.33059	0.0850	N	0.19112	0.55	0.09310	N	1	B	0.33777	0.425	B	0.27715	0.082	T	0.13980	-1.0489	9	0.72032	D	0.01	.	3.7884	0.08710	0.5999:0.0:0.2159:0.1841	.	355	Q9NS13	.	W	355	ENSP00000327669:G355W;ENSP00000416094:G355W	ENSP00000327669:G355W	G	+	1	0	APOBR	28414953	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.825000	0.04433	-0.783000	0.04534	-0.487000	0.04747	GGG	APOBR	-	NULL	ENSG00000184730		0.672	APOBR-202	KNOWN	basic|appris_candidate	protein_coding	APOBR	HGNC	protein_coding		-	0.00	25	0	G	NM_182804		28507452	+1	tier1	-	no_errors	ENST00000564831	ensembl	human	known	74_37	missense	18.18	27	6	SNP	0.000	T
ARHGEF12	23365	genome.wustl.edu	37	11	120317116	120317116	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr11:120317116G>T	ENST00000397843.2	+	17	1516	c.1350G>T	c.(1348-1350)aaG>aaT	p.K450N	ARHGEF12_ENST00000356641.3_Missense_Mutation_p.K431N|ARHGEF12_ENST00000532993.1_Missense_Mutation_p.K347N	NM_015313.2	NP_056128.1	Q9NZN5	ARHGC_HUMAN	Rho guanine nucleotide exchange factor (GEF) 12	450	RGSL.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(5)|endometrium(6)|kidney(5)|large_intestine(13)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(2)	61		Breast(109;0.000813)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_hematologic(192;0.107)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.231)		ATGAAGAAAAGAGAAGACCTG	0.373			T	MLL	AML																																			Dom	yes		11	11q23.3	23365	RHO guanine nucleotide exchange factor (GEF) 12 (LARG)		L	0													73.0	67.0	69.0					11																	120317116		1870	4122	5992	SO:0001583	missense	0			AF180681	CCDS41727.1, CCDS55794.1	11q23.3	2011-11-16			ENSG00000196914	ENSG00000196914		"""Rho guanine nucleotide exchange factors"""	14193	protein-coding gene	gene with protein product		604763				10681437, 9205841	Standard	NM_001198665		Approved	KIAA0382, LARG	uc001pxl.2	Q9NZN5	OTTHUMG00000166143	ENST00000397843.2:c.1350G>T	11.37:g.120317116G>T	ENSP00000380942:p.Lys450Asn		O15086|Q6P526	Missense_Mutation	SNP	pfam_RGS-like_dom,pfam_DH-domain,pfam_PDZ,superfamily_Regulat_G_prot_signal_superfam,superfamily_DH-domain,superfamily_PDZ,smart_PDZ,smart_DH-domain,smart_Pleckstrin_homology,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.K431N	ENST00000397843.2	37	c.1293	CCDS41727.1	11	.	.	.	.	.	.	.	.	.	.	G	17.07	3.294528	0.60086	.	.	ENSG00000196914	ENST00000397843;ENST00000356641;ENST00000532993	D;D;D	0.82711	-1.64;-1.64;-1.64	6.17	1.78	0.24846	Regulator of G protein signalling superfamily (1);Regulator of G protein signalling-like fold (1);	0.000000	0.51477	D	0.000087	D	0.83788	0.5330	L	0.41236	1.265	0.35244	D	0.778056	B;D;D	0.76494	0.273;0.999;0.999	P;D;D	0.74674	0.486;0.973;0.984	T	0.81699	-0.0814	10	0.17832	T	0.49	-9.0283	10.7593	0.46256	0.6224:0.0:0.3776:0.0	.	347;431;450	B4DGW2;Q9NZN5-2;Q9NZN5	.;.;ARHGC_HUMAN	N	450;431;347	ENSP00000380942:K450N;ENSP00000349056:K431N;ENSP00000432984:K347N	ENSP00000349056:K431N	K	+	3	2	ARHGEF12	119822326	0.999000	0.42202	1.000000	0.80357	0.866000	0.49608	0.551000	0.23361	0.313000	0.23062	-0.345000	0.07892	AAG	ARHGEF12	-	pfam_RGS-like_dom,superfamily_Regulat_G_prot_signal_superfam	ENSG00000196914		0.373	ARHGEF12-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	ARHGEF12	HGNC	protein_coding	OTTHUMT00000388052.1		0.00	23	0	G	NM_015313		120317116	+1			no_errors	ENST00000356641	ensembl	human	known	74_37	missense	11.54	23	3	SNP	0.994	T
ARRDC4	91947	genome.wustl.edu	37	15	98512358	98512358	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr15:98512358G>T	ENST00000268042.6	+	5	795	c.631G>T	c.(631-633)Gct>Tct	p.A211S	ARRDC4_ENST00000538249.1_Missense_Mutation_p.A124S	NM_183376.2	NP_899232.2	Q8NCT1	ARRD4_HUMAN	arrestin domain containing 4	211					positive regulation of ubiquitin-protein transferase activity (GO:0051443)	endosome (GO:0005768)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|skin(3)	16	Melanoma(26;0.00539)|Lung NSC(78;0.0125)|all_lung(78;0.0222)		OV - Ovarian serous cystadenocarcinoma(32;0.0417)			TTTAGGAGAAGCTATTCCAAT	0.393																																																	0													51.0	56.0	54.0					15																	98512358		2197	4297	6494	SO:0001583	missense	0			BC028704	CCDS10377.1	15q26.2	2005-08-16			ENSG00000140450	ENSG00000140450			28087	protein-coding gene	gene with protein product						12477932	Standard	NM_183376		Approved	FLJ36045	uc010bom.3	Q8NCT1	OTTHUMG00000149849	ENST00000268042.6:c.631G>T	15.37:g.98512358G>T	ENSP00000268042:p.Ala211Ser		Q6NSI9	Missense_Mutation	SNP	pfam_Arrestin-like_N,pfam_Arrestin_C-like,superfamily_Ig_E-set	p.A211S	ENST00000268042.6	37	c.631	CCDS10377.1	15	.	.	.	.	.	.	.	.	.	.	G	14.39	2.521458	0.44866	.	.	ENSG00000140450	ENST00000538249;ENST00000268042	T;T	0.16073	2.37;2.37	5.11	5.11	0.69529	Immunoglobulin E-set (1);Arrestin, C-terminal (1);Arrestin-like, C-terminal (1);	0.000000	0.64402	D	0.000001	T	0.09818	0.0241	N	0.04148	-0.265	0.58432	D	0.999995	P;P	0.48089	0.905;0.884	B;B	0.43331	0.416;0.292	T	0.22417	-1.0217	10	0.07990	T	0.79	-6.9062	18.889	0.92391	0.0:0.0:1.0:0.0	.	211;124	Q8NCT1;F5H824	ARRD4_HUMAN;.	S	124;211	ENSP00000443774:A124S;ENSP00000268042:A211S	ENSP00000268042:A211S	A	+	1	0	ARRDC4	96313362	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.117000	0.64667	2.539000	0.85634	0.591000	0.81541	GCT	ARRDC4	-	pfam_Arrestin_C-like,superfamily_Ig_E-set	ENSG00000140450		0.393	ARRDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARRDC4	HGNC	protein_coding	OTTHUMT00000313535.1	-	0.00	53	0	G	NM_183376		98512358	+1	tier1	-	no_errors	ENST00000268042	ensembl	human	known	74_37	missense	9.76	37	4	SNP	1.000	T
ATAD3C	219293	genome.wustl.edu	37	1	1396169	1396169	+	Silent	SNP	C	C	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr1:1396169C>T	ENST00000378785.2	+	10	1847	c.852C>T	c.(850-852)ttC>ttT	p.F284F		NM_001039211.2	NP_001034300.2	Q5T2N8	ATD3C_HUMAN	ATPase family, AAA domain containing 3C	284							ATP binding (GO:0005524)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|lung(4)	7	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;1.79e-36)|OV - Ovarian serous cystadenocarcinoma(86;3.94e-22)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		CCGAGCAGTTCGACTGGGCCA	0.637																																																	0													91.0	78.0	82.0					1																	1396169		692	1591	2283	SO:0001819	synonymous_variant	0			AK091918	CCDS44039.1	1p36.33	2010-04-21		2007-02-08	ENSG00000215915	ENSG00000215915		"""ATPases / AAA-type"""	32151	protein-coding gene	gene with protein product							Standard	NM_001039211		Approved	FLJ34599	uc001aft.2	Q5T2N8	OTTHUMG00000000531	ENST00000378785.2:c.852C>T	1.37:g.1396169C>T			Q8N1Z5	Silent	SNP	pfam_DUF3523,pfam_ATPase_AAA_core,pfam_DNA_helicase_Holl-junc_RuvB_N,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.F284	ENST00000378785.2	37	c.852	CCDS44039.1	1																																																																																			ATAD3C	-	pfam_ATPase_AAA_core,superfamily_P-loop_NTPase,smart_AAA+_ATPase	ENSG00000215915		0.637	ATAD3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATAD3C	HGNC	protein_coding	OTTHUMT00000001279.3	-	0.00	71	0	C	NM_001039211		1396169	+1	tier1	-	no_errors	ENST00000378785	ensembl	human	known	74_37	silent	34.52	55	29	SNP	0.960	T
ATP1A2	477	genome.wustl.edu	37	1	160093781	160093781	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr1:160093781T>C	ENST00000361216.3	+	5	519	c.430T>C	c.(430-432)Ttc>Ctc	p.F144L	ATP1A2_ENST00000392233.3_Missense_Mutation_p.F144L	NM_000702.3	NP_000693.1	P50993	AT1A2_HUMAN	ATPase, Na+/K+ transporting, alpha 2 polypeptide	144					adult locomotory behavior (GO:0008344)|ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|locomotion (GO:0040011)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of heart contraction (GO:0045822)|negative regulation of striated muscle contraction (GO:0045988)|neurotransmitter uptake (GO:0001504)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of smooth muscle contraction (GO:0006940)|regulation of striated muscle contraction (GO:0006942)|regulation of the force of heart contraction (GO:0002026)|regulation of vasoconstriction (GO:0019229)|relaxation of cardiac muscle (GO:0055119)|response to nicotine (GO:0035094)|sodium ion export from cell (GO:0036376)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|visual learning (GO:0008542)	caveola (GO:0005901)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|endosome (GO:0005768)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)|synapse (GO:0045202)|T-tubule (GO:0030315)|vesicle (GO:0031982)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(30)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	69	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			CACTGGCTGCTTCTCCTACTA	0.542																																																	0													99.0	91.0	93.0					1																	160093781		2203	4300	6503	SO:0001583	missense	0			AB018321	CCDS1196.1	1q23.2	2014-09-17	2010-04-20		ENSG00000018625	ENSG00000018625	3.6.3.9	"""ATPases / P-type"""	800	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-2"", ""sodium pump subunit alpha-2"", ""sodium-potassium ATPase catalytic subunit alpha-2"""	182340	"""migraine, hemiplegic 2"", ""ATPase, Na+/K+ transporting, alpha 2 (+) polypeptide"""	MHP2		9403481	Standard	NM_000702		Approved	FHM2	uc001fvc.3	P50993	OTTHUMG00000024080	ENST00000361216.3:c.430T>C	1.37:g.160093781T>C	ENSP00000354490:p.Phe144Leu		D3DVE4|Q07059|Q5JW74|Q86UZ5|Q9UQ25	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Na/K_IIC,tigrfam_Cation_transp_P_typ_ATPase	p.F144L	ENST00000361216.3	37	c.430	CCDS1196.1	1	.	.	.	.	.	.	.	.	.	.	T	29.5	5.013981	0.93404	.	.	ENSG00000018625	ENST00000361216;ENST00000392233	D;D	0.89123	-2.47;-2.47	4.56	4.56	0.56223	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.000000	0.85682	D	0.000000	D	0.88171	0.6365	L	0.49571	1.57	0.80722	D	1	P	0.51791	0.948	P	0.55391	0.775	D	0.89931	0.4066	10	0.87932	D	0	.	13.025	0.58810	0.0:0.0:0.0:1.0	.	144	P50993	AT1A2_HUMAN	L	144	ENSP00000354490:F144L;ENSP00000376066:F144L	ENSP00000354490:F144L	F	+	1	0	ATP1A2	158360405	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.868000	0.87116	1.926000	0.55796	0.459000	0.35465	TTC	ATP1A2	-	pfam_ATPase_P-typ_transduc_dom_A,tigrfam_ATPase_P-typ_Na/K_IIC,tigrfam_Cation_transp_P_typ_ATPase	ENSG00000018625		0.542	ATP1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP1A2	HGNC	protein_coding	OTTHUMT00000060642.2		0.00	89	0	T	NM_000702		160093781	+1			no_errors	ENST00000361216	ensembl	human	known	74_37	missense	5.33	71	4	SNP	1.000	C
BARD1	580	genome.wustl.edu	37	2	215646173	215646173	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr2:215646173G>T	ENST00000260947.4	-	4	559	c.425C>A	c.(424-426)tCa>tAa	p.S142*	BARD1_ENST00000471787.1_5'UTR|BARD1_ENST00000449967.2_5'UTR	NM_000465.2|NM_001282543.1|NM_001282545.1|NM_001282548.1	NP_000456.2|NP_001269472.1|NP_001269474.1|NP_001269477.1	Q99728	BARD1_HUMAN	BRCA1 associated RING domain 1	142					cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|negative regulation of apoptotic process (GO:0043066)|negative regulation of mRNA 3'-end processing (GO:0031441)|negative regulation of protein export from nucleus (GO:0046826)|positive regulation of apoptotic process (GO:0043065)|positive regulation of protein catabolic process (GO:0045732)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of phosphorylation (GO:0042325)|tissue homeostasis (GO:0001894)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	kinase binding (GO:0019900)|ligase activity (GO:0016874)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(14)|prostate(4)|upper_aerodigestive_tract(1)	35		Renal(323;0.0243)		Epithelial(149;3.2e-06)|all cancers(144;0.000461)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		CATTTTAATTGAATTCTTCTT	0.328									Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																																								0													85.0	88.0	87.0					2																	215646173		2203	4299	6502	SO:0001587	stop_gained	0	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease		CCDS2397.1, CCDS74645.1, CCDS74646.1, CCDS74647.1, CCDS74648.1	2q34-q35	2013-01-10			ENSG00000138376	ENSG00000138376		"""Ankyrin repeat domain containing"""	952	protein-coding gene	gene with protein product		601593				8944023, 9425226, 15159397	Standard	NM_001282548		Approved		uc002veu.2	Q99728	OTTHUMG00000133016	ENST00000260947.4:c.425C>A	2.37:g.215646173G>T	ENSP00000260947:p.Ser142*		F6MDH7|F6MDH8|F6MDH9|O43574|Q53SS5	Nonsense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_BRCT_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_BRCT_dom,smart_Ankyrin_rpt,smart_BRCT_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_BRCT_dom,pfscan_Znf_RING,prints_Ankyrin_rpt	p.S142*	ENST00000260947.4	37	c.425	CCDS2397.1	2	.	.	.	.	.	.	.	.	.	.	G	33	5.286246	0.95517	.	.	ENSG00000138376	ENST00000260947	.	.	.	6.05	5.0	0.66597	.	0.687301	0.14247	N	0.331676	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-16.602	8.2767	0.31877	0.0845:0.0:0.6597:0.2558	.	.	.	.	X	142	.	ENSP00000260947:S142X	S	-	2	0	BARD1	215354418	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.089000	0.50183	2.878000	0.98634	0.650000	0.86243	TCA	BARD1	-	NULL	ENSG00000138376		0.328	BARD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BARD1	HGNC	protein_coding	OTTHUMT00000256602.1	-	0.00	53	0	G	NM_000465		215646173	-1	tier1	-	no_errors	ENST00000260947	ensembl	human	known	74_37	nonsense	75.61	10	31	SNP	0.997	T
BBS10	79738	genome.wustl.edu	37	12	76740691	76740691	+	Silent	SNP	C	C	T	rs551803123	byFrequency	TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr12:76740691C>T	ENST00000393262.3	-	2	1157	c.1074G>A	c.(1072-1074)tcG>tcA	p.S358S		NM_024685.3	NP_078961.3	Q8TAM1	BBS10_HUMAN	Bardet-Biedl syndrome 10	358					cellular protein metabolic process (GO:0044267)|chaperone-mediated protein complex assembly (GO:0051131)|nonmotile primary cilium assembly (GO:0035058)|photoreceptor cell maintenance (GO:0045494)|regulation of protein complex assembly (GO:0043254)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|visual perception (GO:0007601)	cell projection (GO:0042995)	ATP binding (GO:0005524)|RNA polymerase II repressing transcription factor binding (GO:0001103)			endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(1)	19						TTTCACACTGCGAAAAGGCCT	0.393									Bardet-Biedl syndrome				C|||	2	0.000399361	0.0	0.0	5008	,	,		20222	0.002		0.0	False		,,,				2504	0.0																0													75.0	66.0	69.0					12																	76740691		2203	4300	6503	SO:0001819	synonymous_variant	0	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	BC026355	CCDS9014.2	12q21.2	2014-06-17	2006-04-28	2006-04-28	ENSG00000179941	ENSG00000179941		"""Heat Shock Proteins / Chaperonins"""	26291	protein-coding gene	gene with protein product		610148	"""chromosome 12 open reading frame 58"""	C12orf58		16582908	Standard	NM_024685		Approved	FLJ23560	uc001syd.1	Q8TAM1	OTTHUMG00000147352	ENST00000393262.3:c.1074G>A	12.37:g.76740691C>T			Q96CW2|Q9H5D2	Silent	SNP	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,superfamily_GroEL-like_apical_dom	p.S358	ENST00000393262.3	37	c.1074	CCDS9014.2	12																																																																																			BBS10	-	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,superfamily_GroEL-like_apical_dom	ENSG00000179941		0.393	BBS10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BBS10	HGNC	protein_coding	OTTHUMT00000303983.2		0.00	38	0	C	NM_024685		76740691	-1			no_errors	ENST00000393262	ensembl	human	known	74_37	silent	12.00	22	3	SNP	0.000	T
BEGAIN	57596	genome.wustl.edu	37	14	101012872	101012872	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr14:101012872C>T	ENST00000355173.2	-	3	213	c.142G>A	c.(142-144)Gag>Aag	p.E48K	BEGAIN_ENST00000554747.1_5'UTR|BEGAIN_ENST00000443071.2_Missense_Mutation_p.E48K|BEGAIN_ENST00000556751.1_5'UTR	NM_020836.3	NP_065887.1	Q9BUH8	BEGIN_HUMAN	brain-enriched guanylate kinase-associated	48						cytoplasm (GO:0005737)|dendrite (GO:0030425)|membrane (GO:0016020)|neuronal cell body (GO:0043025)				cervix(1)|endometrium(4)|large_intestine(2)|lung(3)|prostate(1)|skin(2)|stomach(1)	14		Melanoma(154;0.212)				TCCAGTTCCTCCTGCGCGCGC	0.731																																					NSCLC(159;1889 2010 9965 27479 40101)												0													51.0	50.0	50.0					14																	101012872		2203	4300	6503	SO:0001583	missense	0			BC002607	CCDS9962.1	14q32.2	2012-12-07	2012-12-07			ENSG00000183092			24163	protein-coding gene	gene with protein product			"""brain-enriched guanylate kinase-associated homolog (rat)"""			10819331	Standard	NM_020836		Approved	KIAA1446	uc010txa.2	Q9BUH8		ENST00000355173.2:c.142G>A	14.37:g.101012872C>T	ENSP00000347301:p.Glu48Lys		Q9NPU3|Q9P282	Missense_Mutation	SNP	superfamily_Prefoldin	p.E48K	ENST00000355173.2	37	c.142	CCDS9962.1	14	.	.	.	.	.	.	.	.	.	.	c	37	6.225159	0.97390	.	.	ENSG00000183092	ENST00000355173;ENST00000443071;ENST00000553553;ENST00000556188;ENST00000557378;ENST00000554140	T;T;T;T;T;T	0.81247	0.75;0.75;-1.47;-1.47;-1.47;-1.47	4.59	4.59	0.56863	.	0.000000	0.85682	U	0.000000	D	0.88735	0.6517	M	0.75777	2.31	0.58432	D	0.999999	D	0.67145	0.996	D	0.76071	0.987	D	0.89950	0.4079	10	0.62326	D	0.03	.	14.9651	0.71184	0.0:1.0:0.0:0.0	.	48	Q9BUH8	BEGIN_HUMAN	K	48;48;60;48;48;67	ENSP00000347301:E48K;ENSP00000411124:E48K;ENSP00000451397:E60K;ENSP00000452157:E48K;ENSP00000450722:E48K;ENSP00000451125:E67K	ENSP00000347301:E48K	E	-	1	0	BEGAIN	100082625	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.942000	0.75928	2.105000	0.64084	0.473000	0.43528	GAG	BEGAIN	-	superfamily_Prefoldin	ENSG00000183092		0.731	BEGAIN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BEGAIN	HGNC	protein_coding	OTTHUMT00000414329.1	-	0.00	53	0	C	NM_020836		101012872	-1	tier1	-	no_errors	ENST00000355173	ensembl	human	known	74_37	missense	26.00	37	13	SNP	1.000	T
BLM	641	genome.wustl.edu	37	15	91295023	91295023	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr15:91295023G>C	ENST00000355112.3	+	4	924	c.806G>C	c.(805-807)aGc>aCc	p.S269T	BLM_ENST00000560509.1_Missense_Mutation_p.S269T	NM_000057.2	NP_000048.1	P54132	BLM_HUMAN	Bloom syndrome, RecQ helicase-like	269					alpha-beta T cell differentiation (GO:0046632)|ATP catabolic process (GO:0006200)|cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydroxyurea (GO:0072711)|cellular response to ionizing radiation (GO:0071479)|DNA double-strand break processing (GO:0000729)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA strand renaturation (GO:0000733)|double-strand break repair via homologous recombination (GO:0000724)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of cell division (GO:0051782)|negative regulation of DNA recombination (GO:0045910)|negative regulation of mitotic recombination (GO:0045950)|negative regulation of thymocyte apoptotic process (GO:0070244)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of transcription, DNA-templated (GO:0045893)|protein oligomerization (GO:0051259)|regulation of binding (GO:0051098)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|replication fork processing (GO:0031297)|replication fork protection (GO:0048478)|response to X-ray (GO:0010165)|telomere maintenance (GO:0000723)	cytoplasm (GO:0005737)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|nuclear chromosome (GO:0000228)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleus (GO:0005634)|PML body (GO:0016605)|pronucleus (GO:0045120)|replication fork (GO:0005657)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent helicase activity (GO:0008026)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|p53 binding (GO:0002039)|single-stranded DNA binding (GO:0003697)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(11)|liver(4)|lung(9)|ovary(6)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	Lung NSC(78;0.0875)|all_lung(78;0.109)		Lung(145;0.189)			GTAGATAATAGCGAAAAGAAG	0.338			"""Mis, N, F"""			"""leukemia, lymphoma, skin squamous cell , other cancers"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Bloom syndrome																														yes	Rec		Bloom Syndrome	15	15q26.1	641	Bloom Syndrome		"""L, E"""	0													97.0	96.0	96.0					15																	91295023		2198	4297	6495	SO:0001583	missense	0	Familial Cancer Database		U39817	CCDS10363.1, CCDS73782.1	15q26.1	2014-09-17	2009-03-19		ENSG00000197299	ENSG00000197299			1058	protein-coding gene	gene with protein product		604610	"""Bloom syndrome"""			9388193	Standard	NM_000057		Approved	BS, RECQL3, RECQ2	uc002bpr.3	P54132	OTTHUMG00000149834	ENST00000355112.3:c.806G>C	15.37:g.91295023G>C	ENSP00000347232:p.Ser269Thr		Q52M96	Missense_Mutation	SNP	pfam_RQC_domain,pfam_BDHCT,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_HRDC_dom,superfamily_P-loop_NTPase,superfamily_HRDC-like,smart_Helicase_ATP-bd,smart_Helicase_C,smart_RQC_domain,smart_HRDC_dom,pfscan_HRDC_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,tigrfam_DNA_helicase_ATP-dep_RecQ	p.S269T	ENST00000355112.3	37	c.806	CCDS10363.1	15	.	.	.	.	.	.	.	.	.	.	G	5.973	0.363433	0.11296	.	.	ENSG00000197299	ENST00000355112	T	0.43688	0.94	5.81	-1.2	0.09554	.	1.207350	0.05679	N	0.590128	T	0.23846	0.0577	N	0.19112	0.55	0.09310	N	1	B;B	0.13594	0.008;0.002	B;B	0.12156	0.007;0.007	T	0.20240	-1.0281	10	0.11182	T	0.66	-16.9471	6.0732	0.19901	0.417:0.1311:0.4518:0.0	.	269;269	B2RAN0;P54132	.;BLM_HUMAN	T	269	ENSP00000347232:S269T	ENSP00000347232:S269T	S	+	2	0	BLM	89096027	0.000000	0.05858	0.002000	0.10522	0.545000	0.35147	-0.067000	0.11579	-0.104000	0.12154	-0.137000	0.14449	AGC	BLM	-	NULL	ENSG00000197299		0.338	BLM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BLM	HGNC	protein_coding	OTTHUMT00000313495.1	-	0.00	45	0	G			91295023	+1	tier1	-	no_errors	ENST00000355112	ensembl	human	known	74_37	missense	23.91	35	11	SNP	0.000	C
BMPR1B	658	genome.wustl.edu	37	4	96035919	96035919	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr4:96035919G>T	ENST00000515059.1	+	5	475	c.192G>T	c.(190-192)ttG>ttT	p.L64F	BMPR1B_ENST00000394931.1_Missense_Mutation_p.L64F|BMPR1B_ENST00000440890.2_Missense_Mutation_p.L94F|BMPR1B_ENST00000502683.1_Missense_Mutation_p.L64F|BMPR1B_ENST00000264568.4_Missense_Mutation_p.L64F	NM_001203.2	NP_001194.1	O00238	BMR1B_HUMAN	bone morphogenetic protein receptor, type IB	64					BMP signaling pathway (GO:0030509)|cartilage condensation (GO:0001502)|chondrocyte differentiation (GO:0002062)|dorsal/ventral pattern formation (GO:0009953)|eye development (GO:0001654)|inflammatory response (GO:0006954)|limb morphogenesis (GO:0035108)|ovarian cumulus expansion (GO:0001550)|ovulation cycle (GO:0042698)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cell differentiation (GO:0045597)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of osteoblast differentiation (GO:0045669)|protein phosphorylation (GO:0006468)|retina development in camera-type eye (GO:0060041)|retinal ganglion cell axon guidance (GO:0031290)|skeletal system development (GO:0001501)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta receptor activity, type I (GO:0005025)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)			breast(3)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(11)|lung(8)|ovary(1)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.51e-07)		ACTCTGGGTTGCCTGTGGTCA	0.433																																																	0													335.0	308.0	317.0					4																	96035919		2203	4300	6503	SO:0001583	missense	0			D89675	CCDS3642.1, CCDS58919.1	4q23-q24	2008-02-05			ENSG00000138696	ENSG00000138696		"""CD molecules"""	1077	protein-coding gene	gene with protein product		603248				8140412, 9730621	Standard	NM_001203		Approved	ALK6, CDw293	uc031sgn.1	O00238	OTTHUMG00000130991	ENST00000515059.1:c.192G>T	4.37:g.96035919G>T	ENSP00000426617:p.Leu64Phe		B2R953|B4DSV1|P78366	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_TGF_beta_rcpt_GS,pfam_Activin_rcpt,superfamily_Kinase-like_dom,smart_TGF_beta_rcpt_GS,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_TGFB_receptor	p.L94F	ENST00000515059.1	37	c.282	CCDS3642.1	4	.	.	.	.	.	.	.	.	.	.	G	0.017	-1.506308	0.00992	.	.	ENSG00000138696	ENST00000515059;ENST00000506363;ENST00000512312;ENST00000509540;ENST00000440890;ENST00000502683;ENST00000264568;ENST00000394931	D;D;D;D;D;D;D;D	0.97752	-4.52;-4.52;-4.52;-4.52;-4.52;-4.52;-4.52;-4.52	5.82	2.22	0.28083	TGF-beta receptor/activin receptor, type I/II (1);	0.620127	0.17857	N	0.159661	D	0.93575	0.7949	L	0.34521	1.04	0.09310	N	0.999996	B	0.20671	0.047	B	0.31337	0.128	D	0.83450	0.0048	10	0.11485	T	0.65	.	5.5273	0.16964	0.3526:0.0:0.5238:0.1236	.	64	O00238	BMR1B_HUMAN	F	64;64;64;64;94;64;64;64	ENSP00000426617:L64F;ENSP00000421144:L64F;ENSP00000425444:L64F;ENSP00000421671:L64F;ENSP00000401907:L94F;ENSP00000424693:L64F;ENSP00000264568:L64F;ENSP00000378389:L64F	ENSP00000264568:L64F	L	+	3	2	BMPR1B	96254942	1.000000	0.71417	0.779000	0.31741	0.001000	0.01503	0.668000	0.25127	0.183000	0.20059	-0.162000	0.13425	TTG	BMPR1B	-	pfam_Activin_rcpt	ENSG00000138696		0.433	BMPR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMPR1B	HGNC	protein_coding	OTTHUMT00000253609.3		0.00	56	0	G	NM_001203		96035919	+1			no_errors	ENST00000440890	ensembl	human	known	74_37	missense	5.45	52	3	SNP	0.187	T
BNIP3L	665	genome.wustl.edu	37	8	26265848	26265848	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr8:26265848C>A	ENST00000380629.2	+	5	800	c.567C>A	c.(565-567)ttC>ttA	p.F189L	BNIP3L_ENST00000518611.1_Missense_Mutation_p.F149L|BNIP3L_ENST00000521254.1_3'UTR|BNIP3L_ENST00000520409.1_Missense_Mutation_p.F149L|BNIP3L_ENST00000523515.1_Missense_Mutation_p.F149L	NM_004331.2	NP_004322.1	O60238	BNI3L_HUMAN	BCL2/adenovirus E1B 19kDa interacting protein 3-like	189					defense response to virus (GO:0051607)|mitochondrial outer membrane permeabilization (GO:0097345)|mitochondrial protein catabolic process (GO:0035694)|negative regulation of apoptotic process (GO:0043066)|positive regulation of apoptotic process (GO:0043065)|viral process (GO:0016032)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intrinsic component of membrane (GO:0031224)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)	identical protein binding (GO:0042802)|lamin binding (GO:0005521)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			large_intestine(3)|lung(1)	4		all_cancers(63;0.086)|Ovarian(32;2.61e-05)|all_epithelial(46;0.0514)|Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0019)|Epithelial(17;1.59e-12)|all cancers(2;3.75e-11)|OV - Ovarian serous cystadenocarcinoma(2;2.57e-08)|Colorectal(74;0.135)		TGAAGGTGTTCATTCCATCTC	0.418																																																	0													166.0	159.0	161.0					8																	26265848		2203	4300	6503	SO:0001583	missense	0			AB004788	CCDS6050.1	8p21	2014-05-13	2002-08-29		ENSG00000104765	ENSG00000104765			1085	protein-coding gene	gene with protein product		605368	"""BCL2/adenovirus E1B 19kD-interacting protein 3-like"""			9523198, 9973195	Standard	NM_004331		Approved	Nix, BNIP3a	uc003xex.1	O60238	OTTHUMG00000099433	ENST00000380629.2:c.567C>A	8.37:g.26265848C>A	ENSP00000370003:p.Phe189Leu		B0AZS9|Q5JW63|Q8NF87	Missense_Mutation	SNP	pfam_BNIP3	p.F189L	ENST00000380629.2	37	c.567	CCDS6050.1	8	.	.	.	.	.	.	.	.	.	.	C	12.17	1.856571	0.32791	.	.	ENSG00000104765	ENST00000380629;ENST00000221209;ENST00000523949;ENST00000523515;ENST00000520409;ENST00000518611	.	.	.	6.16	5.29	0.74685	.	0.171552	0.64402	D	0.000004	T	0.49830	0.1580	L	0.31752	0.955	0.58432	D	0.999993	B;B	0.09022	0.0;0.002	B;B	0.12156	0.002;0.007	T	0.43015	-0.9417	9	0.14252	T	0.57	.	15.746	0.77944	0.0:0.9349:0.0:0.0651	.	149;189	B0AZS9;O60238	.;BNI3L_HUMAN	L	189;189;167;149;149;149	.	ENSP00000221209:F189L	F	+	3	2	BNIP3L	26321765	1.000000	0.71417	1.000000	0.80357	0.776000	0.43924	1.996000	0.40776	1.625000	0.50366	-0.157000	0.13467	TTC	BNIP3L	-	pfam_BNIP3	ENSG00000104765		0.418	BNIP3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BNIP3L	HGNC	protein_coding	OTTHUMT00000216895.1	-	0.00	60	0	C	NM_004331		26265848	+1	tier1	-	no_errors	ENST00000380629	ensembl	human	known	74_37	missense	24.32	83	27	SNP	1.000	A
BOD1L1	259282	genome.wustl.edu	37	4	13604639	13604639	+	Silent	SNP	C	C	T	rs182239378	byFrequency	TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr4:13604639C>T	ENST00000040738.5	-	10	4020	c.3885G>A	c.(3883-3885)tcG>tcA	p.S1295S		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	1295						nucleus (GO:0005634)	DNA binding (GO:0003677)	p.S1295S(1)									CTGGATCATACGATTCCCTCA	0.458													C|||	2	0.000399361	0.0	0.0	5008	,	,		22339	0.002		0.0	False		,,,				2504	0.0																1	Substitution - coding silent(1)	prostate(1)						C		0,4406		0,0,2203	107.0	93.0	98.0		3885	0.5	0.0	4		98	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	BOD1L	NM_148894.2		0,2,6501	TT,TC,CC		0.0233,0.0,0.0154		1295/3052	13604639	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	0			AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.3885G>A	4.37:g.13604639C>T			Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Silent	SNP	NULL	p.S1295	ENST00000040738.5	37	c.3885	CCDS3411.2	4																																																																																			BOD1L1	-	NULL	ENSG00000038219		0.458	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BOD1L1	HGNC	protein_coding	OTTHUMT00000207321.1		0.00	45	0	C	NM_148894		13604639	-1			no_errors	ENST00000040738	ensembl	human	known	74_37	silent	9.38	29	3	SNP	0.000	T
BAIAP2L1	55971	genome.wustl.edu	37	7	97935907	97935907	+	Intron	SNP	C	C	G			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr7:97935907C>G	ENST00000005260.8	-	11	1379				BAIAP2L1_ENST00000462558.1_5'Flank|RP4-607J23.2_ENST00000609873.1_RNA	NM_018842.4	NP_061330.2	Q9UHR4	BI2L1_HUMAN	BAI1-associated protein 2-like 1						filopodium assembly (GO:0046847)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of actin filament polymerization (GO:0030838)|response to bacterium (GO:0009617)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	proline-rich region binding (GO:0070064)			NS(1)|breast(1)|cervix(1)|endometrium(3)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)	23	all_cancers(62;4.34e-10)|all_epithelial(64;5e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0113)|all_lung(186;0.0126)		STAD - Stomach adenocarcinoma(171;0.215)			CTGGTGAGAGCTCAGGGCAGA	0.502																																																	0																																										SO:0001627	intron_variant	0			AF119666	CCDS34687.1	7q22.1	2012-10-04			ENSG00000006453	ENSG00000006453			21649	protein-coding gene	gene with protein product		611877					Standard	NM_018842		Approved	IRTKS	uc003upj.3	Q9UHR4	OTTHUMG00000165117	ENST00000005260.8:c.1164-79G>C	7.37:g.97935907C>G			A4D268|Q75L21|Q75L22|Q96CV4|Q9H5F5|Q9Y2M8	RNA	SNP	-	NULL	ENST00000005260.8	37	NULL	CCDS34687.1	7																																																																																			BRI3	-	-	ENSG00000164713		0.502	BAIAP2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRI3	HGNC	protein_coding	OTTHUMT00000334681.1	-	0.00	33	0	C	NM_018842		97935907	+1	tier1	-	no_errors	ENST00000485422	ensembl	human	known	74_37	rna	20.00	24	6	SNP	0.000	G
BRIP1	83990	genome.wustl.edu	37	17	59878759	59878759	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr17:59878759C>G	ENST00000259008.2	-	8	1262	c.995G>C	c.(994-996)tGc>tCc	p.C332S	BRIP1_ENST00000577598.1_Missense_Mutation_p.C332S	NM_032043.2	NP_114432.2	Q9BX63	FANCJ_HUMAN	BRCA1 interacting protein C-terminal helicase 1	332	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				DNA damage checkpoint (GO:0000077)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(9)|kidney(5)|large_intestine(9)|liver(2)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	55						CCAGGCTTTGCACATCCCTTG	0.393			"""F, N, Mis"""			"""AML, leukemia, breast"""		Involved in tolerance or repair of DNA crosslinks																															yes	Rec		"""Fanconi anaemia J, breast cancer susceptiblity"""	17	17q22	83990	BRCA1 interacting protein C-terminal helicase 1		"""L, E"""	0													171.0	170.0	170.0					17																	59878759		2203	4300	6503	SO:0001583	missense	0			AF360549	CCDS11631.1	17q22.2	2014-09-17				ENSG00000136492		"""Fanconi anemia, complementation groups"""	20473	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-associated helicase 1"""	605882				11595410, 11301010	Standard	NM_032043		Approved	OF, BACH1, FANCJ	uc002izk.2	Q9BX63		ENST00000259008.2:c.995G>C	17.37:g.59878759C>G	ENSP00000259008:p.Cys332Ser		Q3MJE2|Q8NCI5	Missense_Mutation	SNP	pfam_DEAD_2,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,superfamily_TIL_dom,smart_Helicase-like_DEXD_c2,smart_Helicase_ATP-bd,smart_ATP-dep_Helicase_C,pfscan_Helic_SF1/SF2_ATP-bd_DinG/Rad3,tigrfam_DNA_helicase_DNA-repair_Rad3	p.C332S	ENST00000259008.2	37	c.995	CCDS11631.1	17	.	.	.	.	.	.	.	.	.	.	C	4.213	0.038345	0.08148	.	.	ENSG00000136492	ENST00000259008	T	0.68903	-0.36	5.08	-4.04	0.04010	DEAD-like helicase (1);DEAD2 (1);Helicase, superfamily 1/2, ATP-binding domain, DinG/Rad3-type (1);	1.031700	0.07561	N	0.917110	T	0.43678	0.1258	N	0.16708	0.43	0.09310	N	1	B	0.12013	0.005	B	0.12837	0.008	T	0.21724	-1.0237	9	.	.	.	14.2066	7.1559	0.25637	0.0:0.2592:0.2244:0.5164	.	332	Q9BX63	FANCJ_HUMAN	S	332	ENSP00000259008:C332S	.	C	-	2	0	BRIP1	57233541	0.000000	0.05858	0.103000	0.21229	0.965000	0.64279	-1.048000	0.03517	-0.960000	0.03613	0.462000	0.41574	TGC	BRIP1	-	pfam_DEAD_2,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_Helicase-like_DEXD_c2,smart_Helicase_ATP-bd,pfscan_Helic_SF1/SF2_ATP-bd_DinG/Rad3,tigrfam_DNA_helicase_DNA-repair_Rad3	ENSG00000136492		0.393	BRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRIP1	HGNC	protein_coding	OTTHUMT00000445362.1	-	0.00	70	0	C	NM_032043		59878759	-1	tier1	-	no_errors	ENST00000259008	ensembl	human	known	74_37	missense	17.33	62	13	SNP	0.000	G
BRWD1	54014	genome.wustl.edu	37	21	40571099	40571099	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr21:40571099G>T	ENST00000333229.2	-	40	5570	c.5243C>A	c.(5242-5244)aCa>aAa	p.T1748K	BRWD1_ENST00000380800.3_Missense_Mutation_p.T1748K|BRWD1_ENST00000342449.3_Missense_Mutation_p.T1748K	NM_018963.4	NP_061836.2	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1	1748					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(2)|endometrium(6)|kidney(8)|large_intestine(14)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(7)|urinary_tract(2)	58		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				AAGAAATTTTGTCTTTGAAGG	0.418																																					Melanoma(170;988 1986 4794 16843 39731)												0													75.0	76.0	76.0					21																	40571099		2203	4300	6503	SO:0001583	missense	0			AJ002572	CCDS13662.1, CCDS13663.1, CCDS33557.1	21q22.2	2013-05-21	2005-05-13	2005-05-13	ENSG00000185658	ENSG00000185658		"""WD repeat domain containing"""	12760	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 107"", ""WD repeat domain 9"""	C21orf107, WDR9			Standard	NM_033656		Approved	FLJ11315, N143	uc002yxk.2	Q9NSI6	OTTHUMG00000066030	ENST00000333229.2:c.5243C>A	21.37:g.40571099G>T	ENSP00000330753:p.Thr1748Lys		C9JK25|O43721|Q5R2V0|Q5R2V1|Q6P2D1|Q8TCV3|Q96QG9|Q96QH0|Q9NUK1	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_Bromodomain,superfamily_WD40_repeat_dom,superfamily_Bromodomain,smart_WD40_repeat,smart_Bromodomain,pfscan_Bromodomain,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Bromodomain	p.T1748K	ENST00000333229.2	37	c.5243	CCDS13662.1	21	.	.	.	.	.	.	.	.	.	.	G	14.98	2.696000	0.48202	.	.	ENSG00000185658	ENST00000333229;ENST00000342449;ENST00000380800	T;T;T	0.54071	0.59;0.6;0.67	5.48	5.48	0.80851	.	0.594351	0.17016	N	0.190289	T	0.48114	0.1482	M	0.66939	2.045	0.44261	D	0.997119	P;B	0.35272	0.493;0.361	B;B	0.34242	0.178;0.036	T	0.43360	-0.9396	10	0.28530	T	0.3	-2.8119	8.4487	0.32858	0.1305:0.0:0.8695:0.0	.	1748;1748	Q9NSI6-2;Q9NSI6	.;BRWD1_HUMAN	K	1748	ENSP00000330753:T1748K;ENSP00000344333:T1748K;ENSP00000370178:T1748K	ENSP00000330753:T1748K	T	-	2	0	BRWD1	39492969	0.819000	0.29175	0.993000	0.49108	0.884000	0.51177	2.543000	0.45752	2.576000	0.86940	0.655000	0.94253	ACA	BRWD1	-	NULL	ENSG00000185658		0.418	BRWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRWD1	HGNC	protein_coding	OTTHUMT00000141398.3		0.00	68	0	G	NM_033656		40571099	-1			no_errors	ENST00000333229	ensembl	human	known	74_37	missense	5.36	53	3	SNP	0.361	T
BTBD11	121551	genome.wustl.edu	37	12	108004132	108004132	+	Splice_Site	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr12:108004132G>T	ENST00000280758.5	+	5	2337	c.1809G>T	c.(1807-1809)caG>caT	p.Q603H	BTBD11_ENST00000490090.2_Splice_Site_p.Q603H|RP11-128P10.1_ENST00000548473.1_RNA|BTBD11_ENST00000357167.4_Splice_Site_p.Q140H|BTBD11_ENST00000420571.2_Splice_Site_p.Q603H	NM_001018072.1	NP_001018082.1	A6QL63	BTBDB_HUMAN	BTB (POZ) domain containing 11	603						integral component of membrane (GO:0016021)				NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(18)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	53						TGAGCGAACAGGTACAGGGTC	0.612											OREG0022090	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													105.0	97.0	100.0					12																	108004132		2203	4300	6503	SO:0001630	splice_region_variant	0			AK091276	CCDS31893.1, CCDS41827.1	12q24.11	2013-10-02			ENSG00000151136	ENSG00000151136		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	23844	protein-coding gene	gene with protein product							Standard	XM_005268645		Approved	FLJ33957, ABTB2B	uc001tmk.1	A6QL63	OTTHUMG00000150413	ENST00000280758.5:c.1809+1G>T	12.37:g.108004132G>T		21	A4FU41|B3KXG3|C9J019|C9JK80|E9PHS4|Q3ZTQ4|Q52M89|Q6ZV99|Q8N245	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_BTB_POZ,superfamily_BTB/POZ_fold,superfamily_Ankyrin_rpt-contain_dom,superfamily_Histone-fold,smart_Ankyrin_rpt,smart_BTB/POZ-like,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_BTB/POZ-like	p.Q603H	ENST00000280758.5	37	c.1809	CCDS31893.1	12	.	.	.	.	.	.	.	.	.	.	G	16.18	3.050682	0.55218	.	.	ENSG00000151136	ENST00000280758;ENST00000420571;ENST00000490090;ENST00000415943;ENST00000357167	T;T;T;T;T	0.62232	0.65;0.65;0.65;0.04;0.65	4.82	4.82	0.62117	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	T	0.65668	0.2713	N	0.25094	0.71	0.80722	D	1	D;D;D;D	0.89917	0.998;0.996;0.996;1.0	D;D;D;D	0.91635	0.994;0.995;0.995;0.999	T	0.67284	-0.5709	10	0.54805	T	0.06	.	11.5623	0.50785	0.0815:0.0:0.9185:0.0	.	603;140;603;603	A6QL63-2;E9PHS4;A6QL63;A6QL63-3	.;.;BTBDB_HUMAN;.	H	603;603;603;237;140	ENSP00000280758:Q603H;ENSP00000413889:Q603H;ENSP00000447319:Q603H;ENSP00000407416:Q237H;ENSP00000349690:Q140H	ENSP00000280758:Q603H	Q	+	3	2	BTBD11	106528262	1.000000	0.71417	1.000000	0.80357	0.181000	0.23173	8.003000	0.88520	2.509000	0.84616	0.462000	0.41574	CAG	BTBD11	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000151136		0.612	BTBD11-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BTBD11	HGNC	protein_coding	OTTHUMT00000318003.1		0.00	56	0	G	NM_152322	Missense_Mutation	108004132	+1			no_errors	ENST00000280758	ensembl	human	known	74_37	missense	7.94	58	5	SNP	1.000	T
C16orf87	388272	genome.wustl.edu	37	16	46858307	46858307	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr16:46858307G>T	ENST00000285697.4	-	2	415	c.154C>A	c.(154-156)Cct>Act	p.P52T	C16orf87_ENST00000394806.2_Missense_Mutation_p.P52T|C16orf87_ENST00000564250.1_5'UTR	NM_001001436.2	NP_001001436.1	Q6PH81	CP087_HUMAN	chromosome 16 open reading frame 87	52										large_intestine(4)|urinary_tract(1)	5						CCTGTAGAAGGTGGTGATTTC	0.294																																																	0													85.0	85.0	85.0					16																	46858307		2203	4293	6496	SO:0001583	missense	0				CCDS10724.1	16q11.2	2008-08-08			ENSG00000155330	ENSG00000155330			33754	protein-coding gene	gene with protein product							Standard	NM_001001436		Approved		uc002eek.1	Q6PH81	OTTHUMG00000132538	ENST00000285697.4:c.154C>A	16.37:g.46858307G>T	ENSP00000285697:p.Pro52Thr		Q63HN9	Missense_Mutation	SNP	pfam_UPF0547	p.P52T	ENST00000285697.4	37	c.154	CCDS10724.1	16	.	.	.	.	.	.	.	.	.	.	G	12.62	1.994082	0.35226	.	.	ENSG00000155330	ENST00000285697;ENST00000394806	.	.	.	5.69	-1.94	0.07571	.	0.224693	0.46758	D	0.000278	T	0.33876	0.0878	N	0.14661	0.345	0.80722	D	1	B	0.18741	0.03	B	0.23018	0.043	T	0.03717	-1.1010	9	0.72032	D	0.01	.	7.0862	0.25259	0.3832:0.0:0.5069:0.1099	.	52	Q6PH81	CP087_HUMAN	T	52	.	ENSP00000285697:P52T	P	-	1	0	C16orf87	45415808	1.000000	0.71417	0.984000	0.44739	0.943000	0.58893	0.959000	0.29240	-0.179000	0.10654	0.460000	0.39030	CCT	C16orf87	-	NULL	ENSG00000155330		0.294	C16orf87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C16orf87	HGNC	protein_coding	OTTHUMT00000255738.2		0.00	52	0	G	NM_001001436		46858307	-1			no_errors	ENST00000285697	ensembl	human	known	74_37	missense	9.09	40	4	SNP	0.971	T
GAS8	2622	genome.wustl.edu	37	16	90095558	90095558	+	Intron	SNP	C	C	T	rs76646627		TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr16:90095558C>T	ENST00000268699.4	+	2	212				GAS8_ENST00000540721.1_Intron|C16orf3_ENST00000408886.2_Missense_Mutation_p.G65S|GAS8_ENST00000536122.1_Intron	NM_001481.2	NP_001472.1	O95995	GAS8_HUMAN	growth arrest-specific 8						cellular protein localization (GO:0034613)|negative regulation of cell proliferation (GO:0008285)|sperm motility (GO:0030317)	Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile cilium (GO:0031514)		p.G65S(1)		endometrium(3)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	14		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.029)		acggggcagcctacggggcag	0.672																																																	1	Substitution - Missense(1)	lung(1)											25.0	20.0	21.0					16																	90095558		2191	4298	6489	SO:0001627	intron_variant	0			AF050079	CCDS10992.1, CCDS67101.1, CCDS73932.1	16q24.3	2014-07-18	2003-01-16	2003-01-17	ENSG00000141013	ENSG00000141013			4166	protein-coding gene	gene with protein product		605178	"""growth arrest-specific 11"""	GAS11		9790751	Standard	NM_001481		Approved		uc002fqi.1	O95995	OTTHUMG00000138988	ENST00000268699.4:c.90+1428C>T	16.37:g.90095558C>T			B2RCT1|B7Z4U1|G3V1L5|Q2M234	Missense_Mutation	SNP	NULL	p.G65S	ENST00000268699.4	37	c.193	CCDS10992.1	16	.	.	.	.	.	.	.	.	.	.	C	9.046	0.990885	0.18966	.	.	ENSG00000221819	ENST00000408886	T	0.57595	0.39	1.2	-1.14	0.09741	.	.	.	.	.	T	0.23492	0.0568	N	0.08118	0	0.09310	N	1	B	0.22604	0.072	B	0.14578	0.011	T	0.14755	-1.0461	8	.	.	.	.	2.4936	0.04616	0.0:0.4385:0.3231:0.2384	.	73	O95177	CP003_HUMAN	S	65	ENSP00000386218:G65S	.	G	-	1	0	C16orf3	88623059	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.145000	0.10265	-0.326000	0.08564	0.407000	0.27541	GGC	C16orf3	-	NULL	ENSG00000221819		0.672	GAS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C16orf3	HGNC	protein_coding	OTTHUMT00000272877.2	-	0.00	73	0	C			90095558	-1	tier1	rs76646627	no_errors	ENST00000408886	ensembl	human	known	74_37	missense	8.06	56	5	SNP	0.000	T
C1QTNF2	114898	genome.wustl.edu	37	5	159776483	159776483	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr5:159776483T>C	ENST00000393975.3	-	3	688	c.685A>G	c.(685-687)Agc>Ggc	p.S229G		NM_031908.4	NP_114114.2	Q9BXJ5	C1QT2_HUMAN	C1q and tumor necrosis factor related protein 2	184	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.				activation of MAPK activity (GO:0000187)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|protein heterotrimerization (GO:0070208)|protein homooligomerization (GO:0051260)	collagen trimer (GO:0005581)|extracellular space (GO:0005615)				breast(2)|endometrium(2)|large_intestine(1)|lung(4)|prostate(1)|skin(3)	13	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AACTTGCCGCTGGAAGCATTG	0.582																																																	0													89.0	99.0	96.0					5																	159776483		2203	4300	6503	SO:0001583	missense	0			AF329836	CCDS4351.2	5q33.3	2008-05-15			ENSG00000145861	ENSG00000145861			14325	protein-coding gene	gene with protein product							Standard	XM_005265815		Approved	CTRP2	uc003lyd.3	Q9BXJ5	OTTHUMG00000130323	ENST00000393975.3:c.685A>G	5.37:g.159776483T>C	ENSP00000377545:p.Ser229Gly			Missense_Mutation	SNP	pfam_C1q,pfam_Collagen,superfamily_Tumour_necrosis_fac-like_dom,smart_C1q,pfscan_C1q,prints_C1q	p.S229G	ENST00000393975.3	37	c.685	CCDS4351.2	5	.	.	.	.	.	.	.	.	.	.	T	19.64	3.865557	0.71949	.	.	ENSG00000145861	ENST00000393975	T	0.75938	-0.98	5.62	5.62	0.85841	Tumour necrosis factor-like (2);Complement C1q protein (4);	0.044606	0.85682	D	0.000000	D	0.84813	0.5555	M	0.82716	2.605	0.58432	D	0.999992	D	0.58268	0.982	P	0.57283	0.817	D	0.87418	0.2380	10	0.87932	D	0	.	15.4784	0.75504	0.0:0.0:0.0:1.0	.	184	Q9BXJ5	C1QT2_HUMAN	G	229	ENSP00000377545:S229G	ENSP00000377545:S229G	S	-	1	0	C1QTNF2	159709061	1.000000	0.71417	0.982000	0.44146	0.392000	0.30506	8.040000	0.89188	2.151000	0.67156	0.482000	0.46254	AGC	C1QTNF2	-	pfam_C1q,superfamily_Tumour_necrosis_fac-like_dom,smart_C1q,pfscan_C1q,prints_C1q	ENSG00000145861		0.582	C1QTNF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1QTNF2	HGNC	protein_coding	OTTHUMT00000252672.2		0.00	27	0	T			159776483	-1			no_errors	ENST00000393975	ensembl	human	known	74_37	missense	10.00	36	4	SNP	1.000	C
C1orf159	54991	genome.wustl.edu	37	1	1026335	1026335	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr1:1026335T>C	ENST00000379339.1	-	5	311	c.101A>G	c.(100-102)aAc>aGc	p.N34S	C1orf159_ENST00000379319.1_Intron|C1orf159_ENST00000437760.1_Intron|C1orf159_ENST00000482816.1_Intron|C1orf159_ENST00000379320.1_Intron|C1orf159_ENST00000294576.5_Intron|C1orf159_ENST00000448924.1_Missense_Mutation_p.N34S|C1orf159_ENST00000421241.2_Intron			Q96HA4	CA159_HUMAN	chromosome 1 open reading frame 159	34						integral component of membrane (GO:0016021)						all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;2.96e-36)|OV - Ovarian serous cystadenocarcinoma(86;1.77e-22)|Colorectal(212;6.51e-05)|COAD - Colon adenocarcinoma(227;0.000214)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|Kidney(185;0.00254)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.037)|Lung(427;0.205)		AGCTTGTGTGTTGATCACAGC	0.617																																																	0																																										SO:0001583	missense	0			AK128434	CCDS7.2	1p36.33	2008-02-05			ENSG00000131591	ENSG00000131591			26062	protein-coding gene	gene with protein product						12975309	Standard	NM_017891		Approved	FLJ20584	uc001acu.2	Q96HA4	OTTHUMG00000000745	ENST00000379339.1:c.101A>G	1.37:g.1026335T>C	ENSP00000368644:p.Asn34Ser		B3KQ46|Q5T2W6|Q6UX67|Q6ZR77|Q9NWV0	Missense_Mutation	SNP	NULL	p.N34S	ENST00000379339.1	37	c.101		1	.	.	.	.	.	.	.	.	.	.	T	4.943	0.175179	0.09391	.	.	ENSG00000131591	ENST00000379339;ENST00000448924	.	.	.	1.93	0.669	0.17918	.	.	.	.	.	T	0.19406	0.0466	.	.	.	0.09310	N	1	B	0.23540	0.087	B	0.14023	0.01	T	0.19647	-1.0299	7	0.30078	T	0.28	.	3.8601	0.08991	0.0:0.2475:0.0:0.7525	.	34	Q96HA4	CA159_HUMAN	S	34	.	ENSP00000368644:N34S	N	-	2	0	C1orf159	1016198	0.000000	0.05858	0.008000	0.14137	0.251000	0.25915	-0.266000	0.08631	0.011000	0.14865	0.363000	0.22086	AAC	C1orf159	-	NULL	ENSG00000131591		0.617	C1orf159-002	KNOWN	basic|appris_candidate_longest	protein_coding	C1orf159	HGNC	protein_coding	OTTHUMT00000001851.2	-	0.00	69	0	T	NM_017891		1026335	-1	tier1	-	no_errors	ENST00000379339	ensembl	human	known	74_37	missense	22.00	39	11	SNP	0.002	C
C6	729	genome.wustl.edu	37	5	41186174	41186174	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr5:41186174C>G	ENST00000263413.3	-	6	988	c.724G>C	c.(724-726)Gag>Cag	p.E242Q	C6_ENST00000337836.5_Missense_Mutation_p.E242Q|C6_ENST00000475349.1_Intron	NM_001115131.1	NP_001108603.2	P13671	CO6_HUMAN	complement component 6	242	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)		p.E242Q(1)		central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(7)|large_intestine(16)|liver(1)|lung(51)|ovary(3)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)	96		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				TGTCATACCTCAAAGCCGACA	0.408																																																	1	Substitution - Missense(1)	lung(1)											126.0	113.0	117.0					5																	41186174		2203	4300	6503	SO:0001583	missense	0			J05024	CCDS3936.1	5p13.1	2014-09-17			ENSG00000039537	ENSG00000039537		"""Complement system"""	1339	protein-coding gene	gene with protein product		217050					Standard	NM_001115131		Approved		uc003jmk.3	P13671	OTTHUMG00000094781	ENST00000263413.3:c.724G>C	5.37:g.41186174C>G	ENSP00000263413:p.Glu242Gln			Missense_Mutation	SNP	pfam_MACPF,pfam_Sushi_SCR_CCP,pfam_Thrombospondin_1_rpt,pfam_LDrepeatLR_classA_rpt,pfam_Kazal_dom,superfamily_Sushi_SCR_CCP,superfamily_Thrombospondin_1_rpt,superfamily_LDrepeatLR_classA_rpt,smart_Thrombospondin_1_rpt,smart_LDrepeatLR_classA_rpt,smart_MACPF,smart_Sushi_SCR_CCP,smart_FacI_MAC,prints_MAC_perforin,pfscan_LDrepeatLR_classA_rpt,pfscan_Sushi_SCR_CCP,pfscan_Thrombospondin_1_rpt	p.E242Q	ENST00000263413.3	37	c.724	CCDS3936.1	5	.	.	.	.	.	.	.	.	.	.	C	7.676	0.688053	0.14973	.	.	ENSG00000039537	ENST00000337836;ENST00000263413	T;T	0.60171	0.21;0.21	5.99	3.07	0.35406	Membrane attack complex component/perforin (MACPF) domain (1);	0.250304	0.47093	N	0.000250	T	0.34250	0.0891	N	0.20766	0.605	0.34647	D	0.721204	B	0.29481	0.245	B	0.20955	0.032	T	0.35895	-0.9770	10	0.19590	T	0.45	-18.7605	7.5386	0.27725	0.0:0.4447:0.4009:0.1544	.	242	P13671	CO6_HUMAN	Q	242	ENSP00000338861:E242Q;ENSP00000263413:E242Q	ENSP00000263413:E242Q	E	-	1	0	C6	41221931	1.000000	0.71417	0.999000	0.59377	0.534000	0.34807	1.344000	0.33941	0.837000	0.34925	0.655000	0.94253	GAG	C6	-	NULL	ENSG00000039537		0.408	C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C6	HGNC	protein_coding	OTTHUMT00000211592.1	-	0.00	55	0	C			41186174	-1	tier1	-	no_errors	ENST00000263413	ensembl	human	known	74_37	missense	17.07	34	7	SNP	1.000	G
SQSTM1	8878	genome.wustl.edu	37	5	179264379	179264379	+	3'UTR	SNP	G	G	T	rs73334055	byFrequency	TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr5:179264379G>T	ENST00000389805.4	+	0	2287				C5orf45_ENST00000292586.6_3'UTR|SQSTM1_ENST00000376929.3_3'UTR|C5orf45_ENST00000518219.1_3'UTR|C5orf45_ENST00000376931.2_3'UTR|C5orf45_ENST00000518235.1_Intron|C5orf45_ENST00000520698.1_Intron|C5orf45_ENST00000523084.1_3'UTR|C5orf45_ENST00000403396.2_Intron|C5orf45_ENST00000523267.1_5'UTR	NM_003900.4	NP_003891.1	Q13501	SQSTM_HUMAN	sequestosome 1						apoptotic signaling pathway (GO:0097190)|autophagy (GO:0006914)|cell differentiation (GO:0030154)|endosomal transport (GO:0016197)|immune system process (GO:0002376)|intracellular signal transduction (GO:0035556)|macroautophagy (GO:0016236)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of macroautophagy (GO:0016239)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein heterooligomerization (GO:0051291)|protein localization (GO:0008104)|protein phosphorylation (GO:0006468)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of Ras protein signal transduction (GO:0046578)|response to stress (GO:0006950)|ubiquitin-dependent protein catabolic process (GO:0006511)	aggresome (GO:0016235)|autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|inclusion body (GO:0016234)|lysosome (GO:0005764)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|pre-autophagosomal structure (GO:0000407)	identical protein binding (GO:0042802)|protein kinase binding (GO:0019901)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|receptor tyrosine kinase binding (GO:0030971)|SH2 domain binding (GO:0042169)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)		SQSTM1/ALK(2)	NS(1)|breast(1)|endometrium(1)|large_intestine(2)|liver(2)|lung(5)|ovary(1)	13	all_cancers(89;0.000205)|all_epithelial(37;7.15e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0395)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TTAATAACCTGCCAGTCCCAG	0.458																																																	0													160.0	162.0	161.0					5																	179264379		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0			U46751	CCDS34317.1, CCDS47355.1	5q35	2008-02-05	2004-04-15		ENSG00000161011	ENSG00000161011			11280	protein-coding gene	gene with protein product		601530	"""Paget disease of bone 3"", ""oxidative stress induced like"""	PDB3, OSIL		8650207, 8551575	Standard	NM_003900		Approved	p62, p60, p62B, A170	uc003mkw.4	Q13501	OTTHUMG00000150643	ENST00000389805.4:c.*786G>T	5.37:g.179264379G>T			A6NFN7|B2R661|B3KUW5|Q13446|Q9BUV7|Q9BVS6|Q9UEU1	RNA	SNP	-	NULL	ENST00000389805.4	37	NULL	CCDS34317.1	5																																																																																			C5orf45	-	-	ENSG00000161010		0.458	SQSTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C5orf45	HGNC	protein_coding	OTTHUMT00000319344.1	-	0.00	48	0	G			179264379	-1	tier1	-	no_errors	ENST00000523267	ensembl	human	putative	74_37	rna	5.13	74	4	SNP	0.000	T
CA10	56934	genome.wustl.edu	37	17	50235351	50235351	+	5'UTR	SNP	A	A	G			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr17:50235351A>G	ENST00000285273.4	-	0	907				CA10_ENST00000570565.1_Intron|CA10_ENST00000442502.2_5'UTR|CA10_ENST00000340813.6_5'UTR|CA10_ENST00000451037.2_5'UTR	NM_001082533.1	NP_001076002.1	Q9NS85	CAH10_HUMAN	carbonic anhydrase X						brain development (GO:0007420)					cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(21)|ovary(1)|skin(3)|stomach(2)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(22;4.74e-06)		Zonisamide(DB00909)	CTCGGGCTCGACGGATGTGCG	0.617																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AF288385	CCDS32684.1	17q21	2012-08-21			ENSG00000154975	ENSG00000154975		"""Carbonic anhydrases"""	1369	protein-coding gene	gene with protein product		604642				8673298, 9921901	Standard	NM_020178		Approved	CARPX, CA-RPX, HUCEP-15	uc002itx.4	Q9NS85	OTTHUMG00000177544	ENST00000285273.4:c.-205T>C	17.37:g.50235351A>G			B2R7J0|B4DGL6	RNA	SNP	-	NULL	ENST00000285273.4	37	NULL	CCDS32684.1	17																																																																																			CA10	-	-	ENSG00000154975		0.617	CA10-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	CA10	HGNC	protein_coding	OTTHUMT00000437480.1	-	0.00	31	0	A	NM_020178		50235351	-1	tier1	-	no_errors	ENST00000573294	ensembl	human	known	74_37	rna	13.51	32	5	SNP	1.000	G
CACNA1A	773	genome.wustl.edu	37	19	13470461	13470461	+	Nonsense_Mutation	SNP	G	G	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr19:13470461G>A	ENST00000360228.5	-	6	936	c.937C>T	c.(937-939)Cag>Tag	p.Q313*	CACNA1A_ENST00000573710.2_Nonsense_Mutation_p.Q313*	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	313					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	GTTATGCACTGGAAAACAGTC	0.532																																																	0													105.0	99.0	101.0					19																	13470461		2105	4239	6344	SO:0001587	stop_gained	0			U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.937C>T	19.37:g.13470461G>A	ENSP00000353362:p.Gln313*		J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Nonsense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_P/Q_a1su	p.Q313*	ENST00000360228.5	37	c.937	CCDS45998.1	19	.	.	.	.	.	.	.	.	.	.	G	41	9.095006	0.99064	.	.	ENSG00000141837	ENST00000360228;ENST00000418012;ENST00000357018;ENST00000325084	.	.	.	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	18.0236	0.89262	0.0:0.0:1.0:0.0	.	.	.	.	X	313	.	ENSP00000317661:Q313X	Q	-	1	0	CACNA1A	13331461	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.601000	0.98297	2.542000	0.85734	0.655000	0.94253	CAG	CACNA1A	-	pfam_Ion_trans_dom	ENSG00000141837		0.532	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1A	HGNC	protein_coding	OTTHUMT00000104062.2	-	0.00	73	0	G	NM_000068		13470461	-1	tier1	-	no_errors	ENST00000360228	ensembl	human	known	74_37	nonsense	7.69	96	8	SNP	1.000	A
CAMK1D	57118	genome.wustl.edu	37	10	12811688	12811688	+	Missense_Mutation	SNP	A	A	C			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr10:12811688A>C	ENST00000378847.3	+	5	792	c.455A>C	c.(454-456)tAc>tCc	p.Y152S	CAMK1D_ENST00000378845.1_Missense_Mutation_p.Y152S	NM_153498.2	NP_705718.1	Q8IU85	KCC1D_HUMAN	calcium/calmodulin-dependent protein kinase ID	152	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				inflammatory response (GO:0006954)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of neuron projection development (GO:0010976)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of phagocytosis (GO:0050766)|positive regulation of respiratory burst (GO:0060267)|regulation of dendrite development (GO:0050773)|regulation of granulocyte chemotaxis (GO:0071622)	calcium- and calmodulin-dependent protein kinase complex (GO:0005954)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|skin(1)|stomach(1)	16				GBM - Glioblastoma multiforme(1;3.16e-05)		AATCTCTTGTACTACAGTCAA	0.393																																																	0													107.0	95.0	99.0					10																	12811688		2203	4300	6503	SO:0001583	missense	0			AF286366	CCDS7091.1, CCDS7092.1	10p13	2003-11-05			ENSG00000183049	ENSG00000183049			19341	protein-coding gene	gene with protein product		607957				11050006	Standard	XM_006717481		Approved	CKLiK	uc001ilo.3	Q8IU85	OTTHUMG00000017683	ENST00000378847.3:c.455A>C	10.37:g.12811688A>C	ENSP00000368124:p.Tyr152Ser		B0YIY0|Q9HD31	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.Y152S	ENST00000378847.3	37	c.455	CCDS7091.1	10	.	.	.	.	.	.	.	.	.	.	A	19.82	3.898939	0.72754	.	.	ENSG00000183049	ENST00000378847;ENST00000378845	T;T	0.64991	-0.13;-0.13	5.2	5.2	0.72013	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.131690	0.52532	D	0.000064	T	0.73345	0.3575	L	0.47190	1.495	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.993	T	0.76302	-0.3009	10	0.87932	D	0	-17.8056	14.227	0.65866	1.0:0.0:0.0:0.0	.	152;152	Q8IU85;Q5SQQ7	KCC1D_HUMAN;.	S	152	ENSP00000368124:Y152S;ENSP00000368122:Y152S	ENSP00000368122:Y152S	Y	+	2	0	CAMK1D	12851694	1.000000	0.71417	0.999000	0.59377	0.813000	0.45954	9.335000	0.96500	1.945000	0.56424	0.459000	0.35465	TAC	CAMK1D	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000183049		0.393	CAMK1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAMK1D	HGNC	protein_coding	OTTHUMT00000046820.1	-	0.00	67	0	A	NM_020397		12811688	+1	tier1	-	no_errors	ENST00000378847	ensembl	human	known	74_37	missense	46.55	31	27	SNP	1.000	C
CARD6	84674	genome.wustl.edu	37	5	40853632	40853632	+	Missense_Mutation	SNP	T	T	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr5:40853632T>A	ENST00000254691.5	+	3	2397	c.2198T>A	c.(2197-2199)cTc>cAc	p.L733H	CARD6_ENST00000381677.3_Intron	NM_032587.3	NP_115976.2	Q9BX69	CARD6_HUMAN	caspase recruitment domain family, member 6	733					apoptotic process (GO:0006915)|regulation of apoptotic process (GO:0042981)					NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(2)|lung(29)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	62						AACTCCTGGCTCTTTCCAACC	0.498																																																	0													182.0	193.0	189.0					5																	40853632		2203	4300	6503	SO:0001583	missense	0			AF356193	CCDS3935.1	5p13.1	2008-05-23			ENSG00000132357	ENSG00000132357			16394	protein-coding gene	gene with protein product		609986				12775719	Standard	NM_032587		Approved	CINCIN1	uc003jmg.3	Q9BX69	OTTHUMG00000094775	ENST00000254691.5:c.2198T>A	5.37:g.40853632T>A	ENSP00000254691:p.Leu733His		Q52LR2	Missense_Mutation	SNP	pfam_CARD,superfamily_DEATH-like_dom,smart_CARD,pfscan_CARD	p.L733H	ENST00000254691.5	37	c.2198	CCDS3935.1	5	.	.	.	.	.	.	.	.	.	.	T	11.35	1.612547	0.28712	.	.	ENSG00000132357	ENST00000254691	T	0.12569	2.67	4.8	1.92	0.25849	.	0.399284	0.21647	N	0.071249	T	0.05868	0.0153	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.28681	-1.0036	10	0.72032	D	0.01	-2.9985	3.6529	0.08210	0.1731:0.5471:0.0:0.2797	.	733	Q9BX69	CARD6_HUMAN	H	733	ENSP00000254691:L733H	ENSP00000254691:L733H	L	+	2	0	CARD6	40889389	0.000000	0.05858	0.001000	0.08648	0.007000	0.05969	0.085000	0.14912	0.639000	0.30564	-0.232000	0.12228	CTC	CARD6	-	NULL	ENSG00000132357		0.498	CARD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CARD6	HGNC	protein_coding	OTTHUMT00000211584.3	-	0.00	47	0	T			40853632	+1	tier1	-	no_errors	ENST00000254691	ensembl	human	known	74_37	missense	18.75	26	6	SNP	0.001	A
CASP1	834	genome.wustl.edu	37	11	104897037	104897037	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr11:104897037G>T	ENST00000533400.1	-	9	1198	c.1163C>A	c.(1162-1164)aCc>aAc	p.T388N	CASP1_ENST00000446369.1_Missense_Mutation_p.T247N|CASP1_ENST00000531166.1_Missense_Mutation_p.T72N|CASP1_ENST00000527979.1_Missense_Mutation_p.T351N|CASP1_ENST00000598974.1_Missense_Mutation_p.T388N|CASP1_ENST00000393136.4_Missense_Mutation_p.T367N|CASP1_ENST00000415981.2_Missense_Mutation_p.T72N|CASP1_ENST00000534497.1_Missense_Mutation_p.T247N|CASP1_ENST00000594519.1_Missense_Mutation_p.T247N|CASP1_ENST00000526568.1_Missense_Mutation_p.T295N|CASP1_ENST00000436863.3_Missense_Mutation_p.T388N|CASP1_ENST00000593315.1_Missense_Mutation_p.T367N|CASP1_ENST00000525825.1_Missense_Mutation_p.T367N|CASP1_ENST00000353247.5_Missense_Mutation_p.T72N	NM_001257118.1	NP_001244047.1	P29466	CASP1_HUMAN	caspase 1, apoptosis-related cysteine peptidase	388					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|cellular response to organic substance (GO:0071310)|execution phase of apoptosis (GO:0097194)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|membrane hyperpolarization (GO:0060081)|mitochondrial depolarization (GO:0051882)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-1 alpha secretion (GO:0050717)|positive regulation of interleukin-1 beta secretion (GO:0050718)|programmed necrotic cell death (GO:0097300)|proteolysis (GO:0006508)|pyroptosis (GO:0070269)|regulation of inflammatory response (GO:0050727)|response to ATP (GO:0033198)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	AIM2 inflammasome complex (GO:0097169)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|IPAF inflammasome complex (GO:0072557)|NLRP1 inflammasome complex (GO:0072558)|NLRP3 inflammasome complex (GO:0072559)	cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|cysteine-type endopeptidase activity (GO:0004197)|endopeptidase activity (GO:0004175)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(2)	5		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000525)|Epithelial(105;0.0128)|all cancers(92;0.0482)	Minocycline(DB01017)	TCTTTCAGTGGTGGGCATCTG	0.408																																					NSCLC(41;1246 1743 4934)												0													92.0	91.0	91.0					11																	104897037		2202	4299	6501	SO:0001583	missense	0			U13697	CCDS8329.1, CCDS8330.1, CCDS8331.1, CCDS8332.1, CCDS53704.1	11q23	2012-02-29	2012-02-29		ENSG00000137752	ENSG00000137752		"""Caspases"""	1499	protein-coding gene	gene with protein product	"""caspase-1"", ""interleukin 1, beta, convertase"""	147678	"""caspase 1, apoptosis-related cysteine protease (interleukin 1, beta, convertase)"", ""caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase)"""	IL1BC		1373520, 9250871	Standard	NM_033292		Approved	ICE	uc001pim.5	P29466	OTTHUMG00000048072	ENST00000533400.1:c.1163C>A	11.37:g.104897037G>T	ENSP00000433138:p.Thr388Asn		B5MDZ1|Q53EY6|Q6DMQ1|Q6GSS3|Q6PI75|Q9UCN3	Missense_Mutation	SNP	pfam_Pept_C14_caspase,pfam_CARD,superfamily_DEATH-like_dom,smart_CARD,smart_Pept_C14A_p45_core,pirsf_Caspase_IL-1_beta,pfscan_CARD,pfscan_Pept_C14_p10,pfscan_Pept_C14_ICE_p20,prints_Pept_C14A_p45_core	p.T388N	ENST00000533400.1	37	c.1163	CCDS8330.1	11	.	.	.	.	.	.	.	.	.	.	.	13.63	2.295040	0.40594	.	.	ENSG00000137752	ENST00000526568;ENST00000527979;ENST00000533400;ENST00000436863;ENST00000415981;ENST00000446369;ENST00000353247;ENST00000393136;ENST00000525825;ENST00000531166;ENST00000534497	T;T;T;T;T;T;T;T;T;T;T	0.44881	2.11;2.11;2.11;2.11;2.11;0.91;2.11;2.11;2.11;2.11;0.91	4.2	4.2	0.49525	Peptidase C14, caspase catalytic (1);Peptidase C14, caspase non-catalytic subunit p10 (1);Peptidase C14, caspase precursor p45, core (1);	0.111571	0.64402	D	0.000013	T	0.67674	0.2918	M	0.87180	2.865	0.43977	D	0.996662	D;D;D;D;D;D	0.76494	0.992;0.997;0.999;0.999;0.999;0.999	P;P;D;D;D;D	0.79108	0.813;0.884;0.98;0.992;0.98;0.981	T	0.74191	-0.3745	10	0.62326	D	0.03	.	14.4387	0.67301	0.0:0.0:1.0:0.0	.	72;247;367;388;351;295	P29466-5;P29466-4;P29466-2;P29466;G3V169;P29466-3	.;.;.;CASP1_HUMAN;.;.	N	295;351;388;388;72;247;72;367;367;72;247	ENSP00000434250:T295N;ENSP00000432340:T351N;ENSP00000433138:T388N;ENSP00000410076:T388N;ENSP00000408446:T72N;ENSP00000403260:T247N;ENSP00000344132:T72N;ENSP00000376844:T367N;ENSP00000434779:T367N;ENSP00000434303:T72N;ENSP00000436875:T247N	ENSP00000344132:T72N	T	-	2	0	CASP1	104402247	1.000000	0.71417	0.869000	0.34112	0.099000	0.18886	4.375000	0.59549	2.322000	0.78497	0.460000	0.39030	ACC	CASP1	-	pfam_Pept_C14_caspase,smart_Pept_C14A_p45_core,pirsf_Caspase_IL-1_beta,pfscan_Pept_C14_p10	ENSG00000137752		0.408	CASP1-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	CASP1	HGNC	protein_coding	OTTHUMT00000388116.1		0.00	39	0	G	NM_033292		104897037	-1			no_errors	ENST00000436863	ensembl	human	known	74_37	missense	6.67	28	2	SNP	0.930	T
CASP8AP2	9994	genome.wustl.edu	37	6	90583853	90583853	+	RNA	SNP	A	A	G			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr6:90583853A>G	ENST00000551025.1	+	0	14688									caspase 8 associated protein 2											NS(1)|endometrium(7)|kidney(6)|large_intestine(12)|lung(21)|ovary(2)|urinary_tract(2)	51		all_cancers(76;3.64e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;4.69e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0953)		TTAAAAAAATAGTTTTGTAGC	0.234																																					Colon(187;1656 2025 17045 31481 39901)												0																																												0			AB037736		6q15	2012-04-19	2008-10-30		ENSG00000118412	ENSG00000118412			1510	protein-coding gene	gene with protein product	"""FLICE-associated huge protein"""	606880	"""CASP8 associated protein 2"""			10235259, 17245429, 17003126	Standard	NM_001137668		Approved	FLASH, CED-4, RIP25, FLJ11208, KIAA1315	uc011dzz.2	Q9UKL3	OTTHUMG00000015212		6.37:g.90583853A>G				RNA	SNP	-	NULL	ENST00000551025.1	37	NULL		6																																																																																			CASP8AP2	-	-	ENSG00000118412		0.234	CASP8AP2-202	KNOWN	basic	processed_transcript	CASP8AP2	HGNC	processed_transcript		-	0.00	65	0	A	NM_001137667		90583853	+1	tier1	-	no_errors	ENST00000237177	ensembl	human	known	74_37	rna	39.76	50	33	SNP	0.988	G
CBWD6	644019	genome.wustl.edu	37	9	69247529	69247529	+	Silent	SNP	G	G	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr9:69247529G>A	ENST00000377457.5	-	5	588	c.483C>T	c.(481-483)taC>taT	p.Y161Y	CBWD6_ENST00000382399.4_Intron|CBWD6_ENST00000377449.1_Silent_p.Y125Y	NM_001085457.1	NP_001078926.1	Q4V339	CBWD6_HUMAN	COBW domain containing 6	161							ATP binding (GO:0005524)	p.Y161Y(1)		lung(4)	4						TACCATCAAGGTAAATATCAC	0.299																																																	1	Substitution - coding silent(1)	lung(1)																																								SO:0001819	synonymous_variant	0				CCDS43827.1	9q13	2006-06-30			ENSG00000204790	ENSG00000204790			31978	protein-coding gene	gene with protein product							Standard	NM_001085457		Approved	OTTHUMG00000066820	uc004afj.4	Q4V339	OTTHUMG00000066820	ENST00000377457.5:c.483C>T	9.37:g.69247529G>A				Silent	SNP	pfam_CobW/HypB/UreG_dom,pfam_Cbl_biosynth_CobW-like_C,superfamily_P-loop_NTPase,superfamily_Cbl_biosynth_CobW-like_C,smart_Cbl_biosynth_CobW-like_C	p.Y161	ENST00000377457.5	37	c.483	CCDS43827.1	9																																																																																			CBWD6	-	pfam_CobW/HypB/UreG_dom,superfamily_P-loop_NTPase	ENSG00000204790		0.299	CBWD6-001	KNOWN	non_canonical_polymorphism|basic|appris_principal|CCDS	protein_coding	CBWD6	HGNC	protein_coding	OTTHUMT00000143172.2		0.00	42	0	G	XM_928822		69247529	-1			no_errors	ENST00000377457	ensembl	human	known	74_37	silent	10.26	35	4	SNP	1.000	A
CCDC150	284992	genome.wustl.edu	37	2	197531518	197531518	+	Missense_Mutation	SNP	C	C	A	rs376590781		TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr2:197531518C>A	ENST00000389175.4	+	7	973	c.838C>A	c.(838-840)Caa>Aaa	p.Q280K	CCDC150_ENST00000472405.2_Intron|CCDC150_ENST00000423093.2_Intron|CCDC150_ENST00000272831.7_Intron	NM_001080539.1	NP_001074008.1	Q8NCX0	CC150_HUMAN	coiled-coil domain containing 150	280										breast(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(14)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	33						GGCCCAGGAACAAAAAAAAAA	0.373																																																	0													34.0	33.0	34.0					2																	197531518		1747	3902	5649	SO:0001583	missense	0				CCDS46478.1	2q33.1	2008-04-10			ENSG00000144395	ENSG00000144395			26834	protein-coding gene	gene with protein product							Standard	NM_001080539		Approved	FLJ39660	uc002utp.1	Q8NCX0	OTTHUMG00000154475	ENST00000389175.4:c.838C>A	2.37:g.197531518C>A	ENSP00000373827:p.Gln280Lys		Q6P5U6|Q6P663|Q8N8V5	Missense_Mutation	SNP	NULL	p.Q280K	ENST00000389175.4	37	c.838	CCDS46478.1	2	.	.	.	.	.	.	.	.	.	.	C	11.41	1.631673	0.29068	.	.	ENSG00000144395	ENST00000389175;ENST00000536389	T	0.26373	1.74	5.53	4.64	0.57946	.	1.202860	0.06048	N	0.656046	T	0.26231	0.0640	L	0.57536	1.79	0.31316	N	0.686582	B;B	0.17667	0.013;0.023	B;B	0.14578	0.007;0.011	T	0.41805	-0.9488	10	0.09338	T	0.73	-2.5955	9.0618	0.36438	0.1674:0.6712:0.1614:0.0	.	280;280	Q8NCX0;F5H6M2	CC150_HUMAN;.	K	280	ENSP00000373827:Q280K	ENSP00000373827:Q280K	Q	+	1	0	CCDC150	197239763	0.809000	0.29036	0.741000	0.31004	0.824000	0.46624	1.130000	0.31393	1.533000	0.49186	0.655000	0.94253	CAA	CCDC150	-	NULL	ENSG00000144395		0.373	CCDC150-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	CCDC150	HGNC	protein_coding	OTTHUMT00000335377.2	-	0.00	60	0	C	NM_001080539		197531518	+1	tier1	-	no_errors	ENST00000389175	ensembl	human	known	74_37	missense	10.29	61	7	SNP	0.494	A
CCDC79	283847	genome.wustl.edu	37	16	66812784	66812784	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr16:66812784C>T	ENST00000558713.2	-	9	907	c.835G>A	c.(835-837)Gca>Aca	p.A279T	CCDC79_ENST00000433574.1_Missense_Mutation_p.A279T|CCDC79_ENST00000433154.1_Missense_Mutation_p.A279T|CCDC79_ENST00000432602.1_Missense_Mutation_p.A279T|CCDC79_ENST00000415744.1_Missense_Mutation_p.A279T|CCDC79_ENST00000561333.1_5'UTR			Q8NA31	TERB1_HUMAN	coiled-coil domain containing 79	279					meiotic telomere clustering (GO:0045141)|synapsis (GO:0007129)	chromosome, telomeric region (GO:0000781)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(1)|endometrium(2)|kidney(1)|large_intestine(1)|skin(2)	7						GCAATGCATGCATCCACAGTC	0.378																																																	0													170.0	130.0	142.0					16																	66812784		692	1591	2283	SO:0001583	missense	0			AK093213		16q22.1	2012-10-03			ENSG00000249961	ENSG00000249961			26675	protein-coding gene	gene with protein product							Standard	NM_001136505		Approved	FLJ35894	uc010viv.2	Q8NA31	OTTHUMG00000133562	ENST00000558713.2:c.835G>A	16.37:g.66812784C>T	ENSP00000462883:p.Ala279Thr		A0AUW1	Missense_Mutation	SNP	pfam_SANT/Myb,superfamily_ARM-type_fold,superfamily_Homeodomain-like,superfamily_Cytokine_IL1-like,smart_SANT/Myb	p.A279T	ENST00000558713.2	37	c.835		16	.	.	.	.	.	.	.	.	.	.	C	16.58	3.161641	0.57368	.	.	ENSG00000177461	ENST00000433154;ENST00000432602;ENST00000433574;ENST00000415744	T;T;T;T	0.26518	1.73;1.73;1.73;1.73	5.91	5.91	0.95273	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.64402	D	0.000002	T	0.52948	0.1766	M	0.66939	2.045	0.45648	D	0.998578	D;D	0.89917	1.0;1.0	D;D	0.76071	0.987;0.984	T	0.50127	-0.8864	10	0.72032	D	0.01	-12.6676	20.2983	0.98569	0.0:1.0:0.0:0.0	.	279;279	Q8NA31;Q8NA31-2	CCD79_HUMAN;.	T	279	ENSP00000463762:A279T;ENSP00000462977:A279T;ENSP00000462037:A279T;ENSP00000462236:A279T	ENSP00000440822:A279T	A	-	1	0	CCDC79	65370285	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	4.223000	0.58587	2.802000	0.96397	0.655000	0.94253	GCA	CCDC79	-	superfamily_ARM-type_fold	ENSG00000249961		0.378	CCDC79-003	KNOWN	basic|appris_principal	protein_coding	CCDC79	HGNC	protein_coding	OTTHUMT00000418864.2	-	0.00	41	0	C			66812784	-1	tier1	-	no_errors	ENST00000433154	ensembl	human	known	74_37	missense	7.69	48	4	SNP	1.000	T
CCDC88A	55704	genome.wustl.edu	37	2	55529026	55529026	+	Nonsense_Mutation	SNP	G	G	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr2:55529026G>A	ENST00000436346.1	-	27	5495	c.4654C>T	c.(4654-4656)Cag>Tag	p.Q1552*	CCDC88A_ENST00000413716.2_Nonsense_Mutation_p.Q1551*|CCDC88A_ENST00000336838.6_Nonsense_Mutation_p.Q1551*|CCDC88A_ENST00000422883.2_Intron|CCDC88A_ENST00000263630.8_Nonsense_Mutation_p.Q1524*	NM_001135597.1|NM_001254943.1	NP_001129069.1|NP_001241872.1	Q3V6T2	GRDN_HUMAN	coiled-coil domain containing 88A	1552					activation of protein kinase B activity (GO:0032148)|cell migration (GO:0016477)|DNA replication (GO:0006260)|lamellipodium assembly (GO:0030032)|membrane organization (GO:0061024)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell proliferation (GO:0042127)|regulation of DNA replication (GO:0006275)|regulation of neuron projection development (GO:0010975)|regulation of protein phosphorylation (GO:0001932)|TOR signaling (GO:0031929)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|membrane (GO:0016020)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|microtubule binding (GO:0008017)|phosphatidylinositol binding (GO:0035091)|protein homodimerization activity (GO:0042803)|protein kinase B binding (GO:0043422)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(22)|lung(23)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	69						TTAACCAACTGCTTGGATCTG	0.388																																																	0													94.0	97.0	96.0					2																	55529026		2203	4300	6503	SO:0001587	stop_gained	0			AB033038, AF112218	CCDS33203.1, CCDS46288.1, CCDS58710.1	2p16.3	2013-03-13	2007-05-31	2007-05-31	ENSG00000115355	ENSG00000115355			25523	protein-coding gene	gene with protein product	"""Galpha-interacting vesicle-associated protein"", ""Akt-phosphorylation enhancer"", ""girdin"", ""girders of actin filaments"""	609736	"""KIAA1212"""	KIAA1212		15749703, 15753085	Standard	NM_001135597		Approved	FLJ10392, APE, GIV, HkRP1, GRDN	uc002ryv.2	Q3V6T2	OTTHUMG00000151915	ENST00000436346.1:c.4654C>T	2.37:g.55529026G>A	ENSP00000410608:p.Gln1552*		A1IGE7|B7ZM78|C9JG83|Q53SF1|Q581G3|Q5HYD0|Q7Z339|Q7Z3C5	Nonsense_Mutation	SNP	pfam_Hook-related_fam,superfamily_Prefoldin,superfamily_t-SNARE	p.Q1552*	ENST00000436346.1	37	c.4654		2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	43|43	10.428804|10.428804	0.99403|0.99403	.|.	.|.	ENSG00000115355|ENSG00000115355	ENST00000456975|ENST00000336838;ENST00000263630;ENST00000436346;ENST00000412148;ENST00000413716;ENST00000426576	.|.	.|.	.|.	5.41|5.41	5.41|5.41	0.78517|0.78517	.|.	.|0.000000	.|0.45606	.|U	.|0.000342	T|.	0.52533|.	0.1740|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.39860|.	-0.9593|.	4|.	.|0.11182	.|T	.|0.66	-9.8311|-9.8311	15.0804|15.0804	0.72110|0.72110	0.0:0.1415:0.8585:0.0|0.0:0.1415:0.8585:0.0	.|.	.|.	.|.	.|.	V|X	504|1551;1524;1552;569;1551;727	.|.	.|ENSP00000263630:Q1524X	A|Q	-|-	2|1	0|0	CCDC88A|CCDC88A	55382530|55382530	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	4.439000|4.439000	0.59968|0.59968	2.700000|2.700000	0.92200|0.92200	0.460000|0.460000	0.39030|0.39030	GCA|CAG	CCDC88A	-	NULL	ENSG00000115355		0.388	CCDC88A-203	KNOWN	basic	protein_coding	CCDC88A	HGNC	protein_coding		-	0.00	45	0	G	NM_017571		55529026	-1	tier1	-	no_errors	ENST00000436346	ensembl	human	known	74_37	nonsense	15.56	38	7	SNP	1.000	A
CD248	57124	genome.wustl.edu	37	11	66082524	66082524	+	Silent	SNP	G	G	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr11:66082524G>A	ENST00000311330.3	-	1	1991	c.1975C>T	c.(1975-1977)Ctg>Ttg	p.L659L	RP11-867G23.13_ENST00000534065.1_RNA	NM_020404.2	NP_065137.1	Q9HCU0	CD248_HUMAN	CD248 molecule, endosialin	659	Pro-rich.				anatomical structure regression (GO:0060033)|cell migration (GO:0016477)|lymph node development (GO:0048535)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|extracellular matrix binding (GO:0050840)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	26						GGTGAGGGCAGCCACAGGGCC	0.642																																																	0													31.0	34.0	33.0					11																	66082524		2197	4289	6486	SO:0001819	synonymous_variant	0			AF279142	CCDS8134.1	11q13	2006-04-12	2006-03-28	2005-02-11	ENSG00000174807	ENSG00000174807		"""CD molecules"""	18219	protein-coding gene	gene with protein product	"""endosialin"", ""tumor endothelial marker 1"""	606064	"""CD164 sialomucin-like 1"", ""CD248 antigen, endosialin"""	CD164L1		10947988, 11084048	Standard	NM_020404		Approved	TEM1	uc001ohm.1	Q9HCU0	OTTHUMG00000167073	ENST00000311330.3:c.1975C>T	11.37:g.66082524G>A			Q2M2V5|Q3SX55|Q96KB6	Silent	SNP	pfam_C-type_lectin,pfam_EGF-like_Ca-bd_dom,superfamily_C-type_lectin_fold,smart_C-type_lectin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_C-type_lectin	p.L659	ENST00000311330.3	37	c.1975	CCDS8134.1	11																																																																																			CD248	-	NULL	ENSG00000174807		0.642	CD248-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD248	HGNC	protein_coding	OTTHUMT00000392922.2		0.00	49	0	G	NM_020404		66082524	-1			no_errors	ENST00000311330	ensembl	human	known	74_37	silent	6.35	58	4	SNP	0.001	A
CD47	961	genome.wustl.edu	37	3	107764071	107764071	+	IGR	SNP	G	G	C			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr3:107764071G>C	ENST00000361309.5	-	0	1285				CD47_ENST00000355354.7_3'UTR|CD47_ENST00000471694.1_5'UTR	NM_001777.3	NP_001768.1	Q08722	CD47_HUMAN	CD47 molecule						blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|opsonization (GO:0008228)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of inflammatory response (GO:0050729)|positive regulation of phagocytosis (GO:0050766)|positive regulation of T cell activation (GO:0050870)|response to bacterium (GO:0009617)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	thrombospondin receptor activity (GO:0070053)			endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|urinary_tract(1)	9			OV - Ovarian serous cystadenocarcinoma(3;0.0191)|Epithelial(53;0.118)			AAATAAATGAGAGTTTACTAC	0.353																																																	0																																										SO:0001628	intergenic_variant	0				CCDS43125.1, CCDS43126.1	3q13.1-q13.2	2013-01-11	2006-03-28		ENSG00000196776	ENSG00000196776		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1682	protein-coding gene	gene with protein product	"""antigen identified by monoclonal antibody 1D8"", ""antigenic surface determinant protein OA3"", ""integrin associated protein"", ""Rh-related antigen"", ""leukocyte surface antigen CD47"", ""CD47 glycoprotein"""	601028	"""CD47 antigen (Rh-related antigen, integrin-associated signal transducer)"""	MER6		8294396, 2277087	Standard	XM_005247908		Approved	IAP, OA3	uc003dwt.1	Q08722	OTTHUMG00000044216		3.37:g.107764071G>C			A8K198|D3DN59|Q53Y71|Q96A60	RNA	SNP	-	NULL	ENST00000361309.5	37	NULL	CCDS43126.1	3																																																																																			CD47	-	-	ENSG00000196776		0.353	CD47-004	KNOWN	basic|CCDS	protein_coding	CD47	HGNC	protein_coding	OTTHUMT00000102793.1	-	0.00	62	0	G	NM_001777		107764071	-1	tier1	-	no_errors	ENST00000471694	ensembl	human	known	74_37	rna	43.48	13	10	SNP	0.105	C
CD97	976	genome.wustl.edu	37	19	14515276	14515276	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr19:14515276G>A	ENST00000242786.5	+	13	1611	c.1531G>A	c.(1531-1533)Gag>Aag	p.E511K	CD97_ENST00000358600.3_Missense_Mutation_p.E418K|CTC-548K16.5_ENST00000590626.1_RNA|CD97_ENST00000357355.3_Missense_Mutation_p.E462K	NM_078481.3	NP_510966.1	P48960	CD97_HUMAN	CD97 molecule	511	GPS. {ECO:0000255|PROSITE- ProRule:PRU00098}.				cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular component movement (GO:0006928)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|neuropeptide signaling pathway (GO:0007218)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						CTGGGCCACCGAGGGCTGCCA	0.632																																																	0													67.0	66.0	66.0					19																	14515276		2203	4300	6503	SO:0001583	missense	0				CCDS32929.1, CCDS32930.1, CCDS32931.1	19p13	2014-08-08	2006-03-28			ENSG00000123146		"""CD molecules"", ""-"", ""GPCR / Class B : Orphans"""	1711	protein-coding gene	gene with protein product	"""leukocyte antigen CD97"", ""seven-span transmembrane protein"", ""seven-transmembrane, heterodimeric receptor associated with inflammation"", ""seven transmembrane helix receptor"""	601211	"""CD97 antigen"""			7636245, 8786105	Standard	NM_078481		Approved	TM7LN1	uc002myl.3	P48960		ENST00000242786.5:c.1531G>A	19.37:g.14515276G>A	ENSP00000242786:p.Glu511Lys		A8K7Z4|B2RBJ9|O00718|O76101|Q8NG72|Q8TBQ7	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_EGF-like_Ca-bd_dom,pfam_GPS_dom,pfam_EG-like_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_CD97,prints_GPCR_2_secretin-like,prints_GPCR_2_EMR1_rcpt	p.E511K	ENST00000242786.5	37	c.1531	CCDS32929.1	19	.	.	.	.	.	.	.	.	.	.	G	2.094	-0.407718	0.04832	.	.	ENSG00000123146	ENST00000242786;ENST00000357355;ENST00000358600;ENST00000393059	T;T;T	0.69561	-0.41;-0.41;-0.41	4.85	-4.41	0.03590	GPS domain (3);	.	.	.	.	T	0.37156	0.0993	N	0.17723	0.515	0.09310	N	1	P;P;B	0.44627	0.839;0.839;0.297	B;B;B	0.36567	0.228;0.228;0.078	T	0.41787	-0.9489	9	0.06625	T	0.88	.	6.8444	0.23980	0.1948:0.0:0.548:0.2571	.	418;462;511	P48960-2;P48960-3;P48960	.;.;CD97_HUMAN	K	511;462;418;461	ENSP00000242786:E511K;ENSP00000349918:E462K;ENSP00000351413:E418K	ENSP00000242786:E511K	E	+	1	0	CD97	14376276	0.000000	0.05858	0.001000	0.08648	0.011000	0.07611	-1.275000	0.02817	-1.160000	0.02804	-0.367000	0.07326	GAG	CD97	-	pfam_GPS_dom,smart_GPS_dom,pfscan_GPS_dom,prints_GPCR_2_EMR1_rcpt	ENSG00000123146		0.632	CD97-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CD97	HGNC	protein_coding	OTTHUMT00000459821.2	-	0.00	34	0	G	NM_078481		14515276	+1	tier1	-	no_errors	ENST00000242786	ensembl	human	known	74_37	missense	45.00	22	18	SNP	0.000	A
CDC27	996	genome.wustl.edu	37	17	45199823	45199823	+	Silent	SNP	T	T	C			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr17:45199823T>C	ENST00000066544.3	-	18	2472	c.2379A>G	c.(2377-2379)caA>caG	p.Q793Q	CDC27_ENST00000531206.1_Silent_p.Q799Q|CDC27_ENST00000527547.1_Silent_p.Q792Q|CDC27_ENST00000446365.2_Silent_p.Q732Q	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	793					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						TCTGTTCTTCTTGGGTTATTG	0.338																																																	0													162.0	149.0	154.0					17																	45199823		2203	4300	6503	SO:0001819	synonymous_variant	0			U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.2379A>G	17.37:g.45199823T>C			G3V1C4|Q16349|Q96F35	Silent	SNP	pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.Q799	ENST00000066544.3	37	c.2397	CCDS11509.1	17																																																																																			CDC27	-	NULL	ENSG00000004897		0.338	CDC27-001	KNOWN	basic|CCDS	protein_coding	CDC27	HGNC	protein_coding	OTTHUMT00000389742.2	-	0.00	38	0	T			45199823	-1	tier1	-	no_errors	ENST00000531206	ensembl	human	known	74_37	silent	20.75	42	11	SNP	1.000	C
CDH10	1008	genome.wustl.edu	37	5	24491686	24491686	+	Splice_Site	SNP	C	C	G	rs184571175	byFrequency	TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr5:24491686C>G	ENST00000264463.4	-	11	2382	c.1875G>C	c.(1873-1875)ctG>ctC	p.L625L	CDH10_ENST00000502921.1_5'UTR	NM_006727.3	NP_006718.2	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 (T2-cadherin)	625					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.L625L(1)		NS(1)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(29)|lung(111)|ovary(6)|pancreas(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)	185				STAD - Stomach adenocarcinoma(35;0.0556)		GTTTCTTACCCAGTAGAATGA	0.483										HNSCC(23;0.051)																																							1	Substitution - coding silent(1)	lung(1)											69.0	69.0	69.0					5																	24491686		2203	4300	6503	SO:0001630	splice_region_variant	0			AF039747	CCDS3892.1	5p14.2	2010-01-26			ENSG00000040731	ENSG00000040731		"""Cadherins / Major cadherins"""	1749	protein-coding gene	gene with protein product		604555				2059658	Standard	NM_006727		Approved		uc003jgr.2	Q9Y6N8	OTTHUMG00000090667	ENST00000264463.4:c.1876+1G>C	5.37:g.24491686C>G			Q9ULB3	Silent	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.L625	ENST00000264463.4	37	c.1875	CCDS3892.1	5																																																																																			CDH10	-	NULL	ENSG00000040731		0.483	CDH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH10	HGNC	protein_coding	OTTHUMT00000207345.2	-	0.00	46	0	C	NM_006727	Silent	24491686	-1	tier1	-	no_errors	ENST00000264463	ensembl	human	known	74_37	silent	22.58	24	7	SNP	0.948	G
CDH13	1012	genome.wustl.edu	37	16	83065787	83065787	+	Silent	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr16:83065787G>T	ENST00000566620.1	+	3	620	c.330G>T	c.(328-330)gtG>gtT	p.V110V	CDH13_ENST00000431540.3_Silent_p.V110V|CDH13_ENST00000446376.2_Silent_p.V110V|CDH13_ENST00000565636.1_Silent_p.V110V|CDH13_ENST00000428848.3_Silent_p.V110V|CDH13_ENST00000268613.10_Silent_p.V157V|CDH13_ENST00000569454.1_3'UTR	NM_001220488.1|NM_001220489.1|NM_001220490.1|NM_001257.4	NP_001207417.1|NP_001207418.1|NP_001207419.1|NP_001248.1	P55290	CAD13_HUMAN	cadherin 13	110					adherens junction organization (GO:0034332)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|endothelial cell migration (GO:0043542)|homophilic cell adhesion (GO:0007156)|keratinocyte proliferation (GO:0043616)|lamellipodium assembly (GO:0030032)|localization within membrane (GO:0051668)|low-density lipoprotein particle mediated signaling (GO:0055096)|mitotic cell cycle (GO:0000278)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell proliferation (GO:0008285)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|Rac protein signal transduction (GO:0016601)|regulation of cell growth (GO:0001558)|regulation of endocytosis (GO:0030100)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|Rho protein signal transduction (GO:0007266)|sprouting angiogenesis (GO:0002040)	anchored component of membrane (GO:0031225)|caveola (GO:0005901)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	adiponectin binding (GO:0055100)|cadherin binding (GO:0045296)|calcium ion binding (GO:0005509)|lipoprotein particle binding (GO:0071813)|low-density lipoprotein particle binding (GO:0030169)			large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)		CAGAACTCGTGATTGTCGGGG	0.507																																																	0													55.0	56.0	56.0					16																	83065787		1943	4122	6065	SO:0001819	synonymous_variant	0			U59288	CCDS56009.1, CCDS56010.1, CCDS58485.1, CCDS58486.1, CCDS58487.1	16q23.3	2013-08-27	2013-08-27			ENSG00000140945		"""Cadherins / Major cadherins"""	1753	protein-coding gene	gene with protein product	"""T-cadherin"", ""H-cadherin (heart)"""	601364				8673923, 9468307	Standard	NM_001257		Approved	CDHH	uc010vns.2	P55290		ENST00000566620.1:c.330G>T	16.37:g.83065787G>T			A8W476|A8W477|B7Z590|C9JRI6|J3KN62|Q6GTW4|Q8TBX3	Silent	SNP	pfam_Cadherin,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.V110	ENST00000566620.1	37	c.330	CCDS58486.1	16																																																																																			CDH13	-	superfamily_Cadherin-like	ENSG00000140945		0.507	CDH13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH13	HGNC	protein_coding	OTTHUMT00000432917.1	-	0.00	68	0	G	NM_001257		83065787	+1	tier1	-	no_errors	ENST00000566620	ensembl	human	known	74_37	silent	19.51	33	8	SNP	0.923	T
CDH19	28513	genome.wustl.edu	37	18	64176315	64176315	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr18:64176315C>A	ENST00000262150.2	-	11	2037	c.1745G>T	c.(1744-1746)tGc>tTc	p.C582F	CDH19_ENST00000540086.1_Intron	NM_021153.3	NP_066976.1	Q96JQ0	PCD16_HUMAN	cadherin 19, type 2	1652	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(22)|ovary(1)|prostate(3)|skin(7)	61		Esophageal squamous(42;0.0132)				CTGGTACTGGCAGGTCTGTGT	0.443																																																	0													150.0	131.0	137.0					18																	64176315		2203	4300	6503	SO:0001583	missense	0			AJ007607	CCDS11994.1, CCDS59325.1	18q22.1	2010-01-26			ENSG00000071991	ENSG00000071991		"""Cadherins / Major cadherins"""	1758	protein-coding gene	gene with protein product		603016				10995570	Standard	NM_021153		Approved	CDH7	uc002lkc.2	Q9H159	OTTHUMG00000132802	ENST00000262150.2:c.1745G>T	18.37:g.64176315C>A	ENSP00000262150:p.Cys582Phe		O15098	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.C582F	ENST00000262150.2	37	c.1745	CCDS11994.1	18	.	.	.	.	.	.	.	.	.	.	C	17.84	3.487381	0.63962	.	.	ENSG00000071991	ENST00000262150	T	0.61859	0.07	5.06	5.06	0.68205	.	0.171042	0.52532	D	0.000061	T	0.77054	0.4074	M	0.83223	2.63	0.80722	D	1	D	0.76494	0.999	D	0.79784	0.993	T	0.80668	-0.1280	10	0.87932	D	0	.	14.4094	0.67106	0.0:0.8523:0.1477:0.0	.	582	Q9H159	CAD19_HUMAN	F	582	ENSP00000262150:C582F	ENSP00000262150:C582F	C	-	2	0	CDH19	62327295	1.000000	0.71417	0.157000	0.22605	0.012000	0.07955	5.654000	0.67974	2.513000	0.84729	0.585000	0.79938	TGC	CDH19	-	NULL	ENSG00000071991		0.443	CDH19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH19	HGNC	protein_coding	OTTHUMT00000256219.1	-	0.00	85	0	C	NM_021153		64176315	-1	tier1	-	no_errors	ENST00000262150	ensembl	human	known	74_37	missense	16.28	36	7	SNP	0.973	A
CDHR2	54825	genome.wustl.edu	37	5	176011726	176011726	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr5:176011726G>T	ENST00000510636.1	+	19	2718	c.2444G>T	c.(2443-2445)gGc>gTc	p.G815V	CDHR2_ENST00000506348.1_Missense_Mutation_p.G815V|CDHR2_ENST00000261944.5_Missense_Mutation_p.G815V	NM_001171976.1	NP_001165447.1	Q9BYE9	CDHR2_HUMAN	cadherin-related family member 2	815	Cadherin 8. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(8)|liver(1)|lung(23)|ovary(3)|prostate(5)|skin(4)|urinary_tract(1)	56						TCACTCCGGGGCATCCGTGTG	0.597																																																	0													112.0	108.0	109.0					5																	176011726		2203	4300	6503	SO:0001583	missense	0			AB047004	CCDS34297.1	5q35.2	2011-07-01	2010-01-25	2010-01-25		ENSG00000074276		"""Cadherins / Cadherin-related"""	18231	protein-coding gene	gene with protein product	"""protocadherin LKC"""		"""protocadherin 24"""	PCDH24		11082270, 12117771	Standard	NM_001171976		Approved	PC-LKC, FLJ20124, FLJ20383, PCLKC	uc003mem.2	Q9BYE9		ENST00000510636.1:c.2444G>T	5.37:g.176011726G>T	ENSP00000424565:p.Gly815Val		A1L3U4|A6NC80|Q9NXP8	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.G815V	ENST00000510636.1	37	c.2444	CCDS34297.1	5	.	.	.	.	.	.	.	.	.	.	G	4.627	0.116606	0.08881	.	.	ENSG00000074276	ENST00000510636;ENST00000261944;ENST00000506348	T;T;T	0.59364	0.27;0.27;0.27	5.28	2.05	0.26809	Cadherin (1);Cadherin-like (1);	.	.	.	.	T	0.35008	0.0917	N	0.12961	0.28	0.19775	N	0.999956	B	0.18013	0.025	B	0.15870	0.014	T	0.18178	-1.0345	9	0.25106	T	0.35	-33.0059	6.2008	0.20575	0.3043:0.1427:0.553:0.0	.	815	Q9BYE9	CDHR2_HUMAN	V	815	ENSP00000424565:G815V;ENSP00000261944:G815V;ENSP00000421078:G815V	ENSP00000261944:G815V	G	+	2	0	CDHR2	175944332	0.185000	0.23213	0.019000	0.16419	0.082000	0.17680	0.844000	0.27654	0.593000	0.29745	-0.272000	0.10252	GGC	CDHR2	-	superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000074276		0.597	CDHR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDHR2	HGNC	protein_coding	OTTHUMT00000372201.1	-	0.00	74	0	G	NM_017675		176011726	+1	tier1	-	no_errors	ENST00000261944	ensembl	human	known	74_37	missense	18.87	43	10	SNP	0.000	T
CEP128	145508	genome.wustl.edu	37	14	81361010	81361010	+	Intron	SNP	C	C	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr14:81361010C>A	ENST00000555265.1	-	8	1021				CEP128_ENST00000281129.3_Intron|CEP128_ENST00000216517.6_Intron|CEP128_ENST00000327841.2_Missense_Mutation_p.K159N			Q6ZU80	CE128_HUMAN	centrosomal protein 128kDa							centriole (GO:0005814)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|spindle pole (GO:0000922)				NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(22)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	51						ttccaaggctcttcacaaaaa	0.318																																																	0													14.0	13.0	13.0					14																	81361010		869	1987	2856	SO:0001627	intron_variant	0			AK056756	CCDS32130.1	14q31.1	2014-02-20	2011-05-06	2011-05-06	ENSG00000100629	ENSG00000100629			20359	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 61"", ""chromosome 14 open reading frame 145"""	C14orf61, C14orf145		21399614	Standard	NM_152446		Approved		uc001xux.2	Q6ZU80		ENST00000555265.1:c.645+1051G>T	14.37:g.81361010C>A			B9EK52|Q86X97|Q96ML4	Missense_Mutation	SNP	NULL	p.K159N	ENST00000555265.1	37	c.477	CCDS32130.1	14	.	.	.	.	.	.	.	.	.	.	C	5.019	0.189284	0.09547	.	.	ENSG00000100629	ENST00000327841	.	.	.	1.19	0.225	0.15325	.	.	.	.	.	T	0.35248	0.0925	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.36359	-0.9751	5	0.72032	D	0.01	.	3.2779	0.06904	0.0:0.6999:0.0:0.3001	.	.	.	.	N	159	.	ENSP00000332095:K159N	K	-	3	2	CEP128	80430763	0.002000	0.14202	0.027000	0.17364	0.323000	0.28346	0.100000	0.15231	0.096000	0.17463	0.121000	0.15741	AAG	CEP128	-	NULL	ENSG00000100629		0.318	CEP128-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP128	HGNC	protein_coding	OTTHUMT00000413415.1	-	0.00	50	0	C	NM_152446		81361010	-1	tier1	-	no_errors	ENST00000327841	ensembl	human	known	74_37	missense	15.00	16	3	SNP	0.037	A
CEP152	22995	genome.wustl.edu	37	15	49031175	49031175	+	Frame_Shift_Del	DEL	T	T	-	rs370946718		TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr15:49031175delT	ENST00000380950.2	-	27	4591	c.4404delA	c.(4402-4404)gaafs	p.E1468fs	CEP152_ENST00000399334.3_Frame_Shift_Del_p.E1412fs	NM_001194998.1|NM_014985.3	NP_001181927.1|NP_055800.2	O94986	CE152_HUMAN	centrosomal protein 152kDa	1468					cell projection organization (GO:0030030)|centriole replication (GO:0007099)|centrosome duplication (GO:0051298)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)			breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(16)|lung(30)|ovary(1)|prostate(2)|skin(2)	63		all_lung(180;0.0428)		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)		CTCCTTCACCTTCACAAGGAA	0.443																																																	0													117.0	112.0	113.0					15																	49031175		1905	4127	6032	SO:0001589	frameshift_variant	0			AB020719	CCDS42033.1, CCDS58361.1	15q21.1	2014-02-20							29298	protein-coding gene	gene with protein product	"""asterless"""	613529	"""microcephaly, primary autosomal recessive 4"""	MCPH4		14654843, 21131973	Standard	NM_014985		Approved	KIAA0912, SCKL5	uc001zwz.3	O94986		ENST00000380950.2:c.4404delA	15.37:g.49031175delT	ENSP00000370337:p.Glu1468fs		E7ER66|Q17RV1|Q6NTA0	Frame_Shift_Del	DEL	NULL	p.G1469fs	ENST00000380950.2	37	c.4404	CCDS58361.1	15																																																																																			CEP152	-	NULL	ENSG00000103995		0.443	CEP152-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CEP152	HGNC	protein_coding	OTTHUMT00000417365.1		0.00	48	0	T	NM_014985		49031175	-1	tier1		no_errors	ENST00000380950	ensembl	human	known	74_37	frame_shift_del	13.33	13	2	DEL	0.779	-
CEP85	64793	genome.wustl.edu	37	1	26604553	26604553	+	3'UTR	SNP	C	C	A	rs550448673	byFrequency	TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr1:26604553C>A	ENST00000252992.4	+	0	3189				SH3BGRL3_ENST00000270792.5_5'Flank|CEP85_ENST00000469609.1_3'UTR|SH3BGRL3_ENST00000319041.6_5'Flank	NM_001281517.1|NM_022778.2	NP_001268446.1|NP_073615.2	Q6P2H3	CEP85_HUMAN	centrosomal protein 85kDa							centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|spindle pole (GO:0000922)				breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(11)|skin(2)	25						GCAAACTCTTCTCTGTGGTTC	0.532																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK024038	CCDS277.1, CCDS60038.1	1p36.11	2014-02-20	2011-05-06	2011-05-06	ENSG00000130695	ENSG00000130695			25309	protein-coding gene	gene with protein product			"""coiled-coil domain containing 21"""	CCDC21		12477932	Standard	NM_022778		Approved	DKFZP434L0117	uc001bls.1	Q6P2H3	OTTHUMG00000003380	ENST00000252992.4:c.*769C>A	1.37:g.26604553C>A			B4DRL1|D3DPK4|F8W7K4|Q5VY68|Q5VY70|Q9H6Q1|Q9H828|Q9UF52	RNA	SNP	-	NULL	ENST00000252992.4	37	NULL	CCDS277.1	1																																																																																			CEP85	-	-	ENSG00000130695		0.532	CEP85-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	CEP85	HGNC	protein_coding	OTTHUMT00000009492.2	-	0.00	13	0	C	NM_022778		26604553	+1	tier1	-	no_errors	ENST00000469609	ensembl	human	known	74_37	rna	64.29	5	9	SNP	0.000	A
CHIAP2	149620	genome.wustl.edu	37	1	111827665	111827665	+	RNA	SNP	T	T	C			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr1:111827665T>C	ENST00000369743.4	+	0	1764					NR_003928.1				chitinase, acidic pseudogene 2																		ACCTGGATGATTTCACAGGCA	0.478																																																	0																																												0					1p13.2	2012-10-11			ENSG00000203878	ENSG00000203878			44463	pseudogene	pseudogene							Standard	NR_003928		Approved		uc009wgb.3		OTTHUMG00000012173		1.37:g.111827665T>C				RNA	SNP	-	NULL	ENST00000369743.4	37	NULL		1																																																																																			CHIAP2	-	-	ENSG00000203878		0.478	CHIAP2-001	KNOWN	basic	processed_transcript	CHIAP2	HGNC	pseudogene	OTTHUMT00000033667.3	-	0.00	75	0	T			111827665	+1	tier1	-	no_errors	ENST00000369743	ensembl	human	known	74_37	rna	45.45	36	30	SNP	1.000	C
CHRM4	1132	genome.wustl.edu	37	11	46407570	46407570	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr11:46407570C>A	ENST00000433765.2	-	1	537	c.538G>T	c.(538-540)Gtg>Ttg	p.V180L		NM_000741.2	NP_000732.2	P08173	ACM4_HUMAN	cholinergic receptor, muscarinic 4	180					adenylate cyclase-inhibiting G-protein coupled acetylcholine receptor signaling pathway (GO:0007197)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|regulation of locomotion (GO:0040012)|signal transduction (GO:0007165)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled acetylcholine receptor activity (GO:0016907)			breast(1)|endometrium(7)|kidney(1)|large_intestine(1)|lung(6)|prostate(3)|skin(1)	20				GBM - Glioblastoma multiforme(35;0.0254)|Lung(87;0.14)	Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Aripiprazole(DB01238)|Atropine(DB00572)|Brompheniramine(DB00835)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cryptenamine(DB00785)|Darifenacin(DB00496)|Desipramine(DB01151)|Doxepin(DB01142)|Fesoterodine(DB06702)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Isopropamide(DB01625)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paroxetine(DB00715)|Pethidine(DB00454)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Scopolamine(DB00747)|Solifenacin(DB01591)|Tolterodine(DB01036)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	TTGTCGGGCACCGTCCGCTTA	0.577																																					Esophageal Squamous(171;1020 1936 4566 30205 42542)												0													38.0	43.0	41.0					11																	46407570		2164	4286	6450	SO:0001583	missense	0			M16405	CCDS44581.1	11p12-p11.2	2012-08-08			ENSG00000180720	ENSG00000180720		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1953	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 4"""	118495				1577490	Standard	NM_000741		Approved		uc001nct.1	P08173	OTTHUMG00000154371	ENST00000433765.2:c.538G>T	11.37:g.46407570C>A	ENSP00000409378:p.Val180Leu		B2RPP4|Q0VD60|Q4VBK7	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Musac_Ach_rcpt,prints_GPCR_Rhodpsn,prints_Musac_Ach_M4_rcpt	p.V180L	ENST00000433765.2	37	c.538	CCDS44581.1	11	.	.	.	.	.	.	.	.	.	.	C	19.15	3.771463	0.69992	.	.	ENSG00000180720	ENST00000433765	T	0.36878	1.23	5.04	4.1	0.47936	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.43166	0.1235	L	0.51914	1.62	0.51767	D	0.999934	P	0.37370	0.592	P	0.45276	0.475	T	0.47636	-0.9102	9	0.87932	D	0	-17.8262	15.3356	0.74250	0.0:0.8597:0.1403:0.0	.	180	P08173	ACM4_HUMAN	L	180	ENSP00000409378:V180L	ENSP00000409378:V180L	V	-	1	0	CHRM4	46364146	1.000000	0.71417	0.055000	0.19348	0.789000	0.44602	5.883000	0.69721	1.285000	0.44548	0.462000	0.41574	GTG	CHRM4	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000180720		0.577	CHRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRM4	HGNC	protein_coding	OTTHUMT00000334985.1	-	0.00	47	0	C	NM_000741		46407570	-1	tier1	-	no_errors	ENST00000433765	ensembl	human	known	74_37	missense	27.27	16	6	SNP	0.997	A
CHRNA1	1134	genome.wustl.edu	37	2	175614679	175614679	+	Missense_Mutation	SNP	G	G	A	rs374391312		TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr2:175614679G>A	ENST00000261007.5	-	8	1138	c.1072C>T	c.(1072-1074)Cgg>Tgg	p.R358W	CHRNA1_ENST00000348749.5_Missense_Mutation_p.R333W|AC018890.6_ENST00000442996.1_RNA|CHRNA1_ENST00000409542.1_Missense_Mutation_p.R251W|CHRNA1_ENST00000409219.1_Missense_Mutation_p.R333W	NM_001039523.2	NP_001034612.1	P02708	ACHA_HUMAN	cholinergic receptor, nicotinic, alpha 1 (muscle)	358					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|muscle cell cellular homeostasis (GO:0046716)|musculoskeletal movement (GO:0050881)|neuromuscular junction development (GO:0007528)|neuromuscular process (GO:0050905)|neuromuscular synaptic transmission (GO:0007274)|neuron cellular homeostasis (GO:0070050)|neuronal action potential (GO:0019228)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue growth (GO:0048630)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|cell surface (GO:0009986)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ion channel activity (GO:0005216)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(15)|ovary(3)|prostate(3)|skin(4)	37					Galantamine(DB00674)	CTCACCTTCCGCACCCAGTTG	0.567																																																	0			GRCh37	CM086805	CHRNA1	M		G	TRP/ARG,TRP/ARG	0,4406		0,0,2203	95.0	79.0	85.0		997,1072	3.6	1.0	2		85	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	CHRNA1	NM_000079.3,NM_001039523.2	101,101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	333/458,358/483	175614679	1,13005	2203	4300	6503	SO:0001583	missense	0			Y00762	CCDS2261.1, CCDS33331.1	2q31.1	2012-02-11	2006-02-01		ENSG00000138435	ENSG00000138435		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1955	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 1 (muscle)"""	100690	"""cholinergic receptor, nicotinic, alpha polypeptide 1 (muscle)"""	CHRNA			Standard	NM_001039523		Approved		uc002uje.2	P02708	OTTHUMG00000132357	ENST00000261007.5:c.1072C>T	2.37:g.175614679G>A	ENSP00000261007:p.Arg358Trp		B4DRV6|D3DPE8	Missense_Mutation	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel	p.R358W	ENST00000261007.5	37	c.1072	CCDS33331.1	2	.	.	.	.	.	.	.	.	.	.	G	17.14	3.312388	0.60414	0.0	1.16E-4	ENSG00000138435	ENST00000348749;ENST00000261007;ENST00000409542;ENST00000409219	D;D;D;D	0.88201	-2.35;-2.35;-2.35;-2.35	5.64	3.61	0.41365	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.95329	0.8484	M	0.93462	3.42	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	D	0.95783	0.8818	10	0.87932	D	0	.	11.9266	0.52823	0.0:0.0:0.4057:0.5943	.	333;358	Q53SH4;P02708	.;ACHA_HUMAN	W	333;358;251;333	ENSP00000261008:R333W;ENSP00000261007:R358W;ENSP00000387026:R251W;ENSP00000386611:R333W	ENSP00000261007:R358W	R	-	1	2	CHRNA1	175322925	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	5.055000	0.64282	1.315000	0.45114	0.655000	0.94253	CGG	CHRNA1	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM	ENSG00000138435		0.567	CHRNA1-002	KNOWN	basic|CCDS	protein_coding	CHRNA1	HGNC	protein_coding	OTTHUMT00000334116.1	-	0.00	28	0	G			175614679	-1	tier1	-	no_errors	ENST00000261007	ensembl	human	known	74_37	missense	21.74	18	5	SNP	1.000	A
CHRNA1	1134	genome.wustl.edu	37	2	175614871	175614871	+	Missense_Mutation	SNP	C	C	G	rs137852803		TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr2:175614871C>G	ENST00000261007.5	-	8	946	c.880G>C	c.(880-882)Gtc>Ctc	p.V294L	CHRNA1_ENST00000348749.5_Missense_Mutation_p.V269L|AC018890.6_ENST00000442996.1_RNA|CHRNA1_ENST00000409542.1_Missense_Mutation_p.V187L|CHRNA1_ENST00000409219.1_Missense_Mutation_p.V269L	NM_001039523.2	NP_001034612.1	P02708	ACHA_HUMAN	cholinergic receptor, nicotinic, alpha 1 (muscle)	294			V -> F (in SCCMS; causes increased channel opening in absence of ACh; prolonged opening in presence of ACh; increased affinity for ACh and enhanced desensitization). {ECO:0000269|PubMed:9221765}.		cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|muscle cell cellular homeostasis (GO:0046716)|musculoskeletal movement (GO:0050881)|neuromuscular junction development (GO:0007528)|neuromuscular process (GO:0050905)|neuromuscular synaptic transmission (GO:0007274)|neuron cellular homeostasis (GO:0070050)|neuronal action potential (GO:0019228)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue growth (GO:0048630)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|cell surface (GO:0009986)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ion channel activity (GO:0005216)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(15)|ovary(3)|prostate(3)|skin(4)	37					Galantamine(DB00674)	GACAGTAAGACAGAGATGCTC	0.478																																																	0			GRCh37	CM973279	CHRNA1	M	rs137852803						114.0	96.0	102.0					2																	175614871		2203	4300	6503	SO:0001583	missense	0			Y00762	CCDS2261.1, CCDS33331.1	2q31.1	2012-02-11	2006-02-01		ENSG00000138435	ENSG00000138435		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1955	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 1 (muscle)"""	100690	"""cholinergic receptor, nicotinic, alpha polypeptide 1 (muscle)"""	CHRNA			Standard	NM_001039523		Approved		uc002uje.2	P02708	OTTHUMG00000132357	ENST00000261007.5:c.880G>C	2.37:g.175614871C>G	ENSP00000261007:p.Val294Leu		B4DRV6|D3DPE8	Missense_Mutation	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel	p.V294L	ENST00000261007.5	37	c.880	CCDS33331.1	2	.	.	.	.	.	.	.	.	.	.	C	21.7	4.181761	0.78677	.	.	ENSG00000138435	ENST00000348749;ENST00000261007;ENST00000409542;ENST00000409219	D;D;D;D	0.87966	-2.32;-2.32;-2.32;-2.32	5.6	5.6	0.85130	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.91081	0.7193	L	0.43923	1.385	0.80722	D	1	P;D	0.56746	0.837;0.977	P;D	0.65323	0.583;0.934	D	0.91644	0.5329	10	0.87932	D	0	.	19.6278	0.95687	0.0:1.0:0.0:0.0	.	269;294	Q53SH4;P02708	.;ACHA_HUMAN	L	269;294;187;269	ENSP00000261008:V269L;ENSP00000261007:V294L;ENSP00000387026:V187L;ENSP00000386611:V269L	ENSP00000261007:V294L	V	-	1	0	CHRNA1	175323117	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	7.818000	0.86416	2.642000	0.89623	0.655000	0.94253	GTC	CHRNA1	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM	ENSG00000138435		0.478	CHRNA1-002	KNOWN	basic|CCDS	protein_coding	CHRNA1	HGNC	protein_coding	OTTHUMT00000334116.1	-	0.00	65	0	C			175614871	-1	tier1	-	no_errors	ENST00000261007	ensembl	human	known	74_37	missense	21.82	43	12	SNP	1.000	G
CNNM2	54805	genome.wustl.edu	37	10	104828355	104828355	+	Intron	SNP	G	G	C			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr10:104828355G>C	ENST00000369878.4	+	5	2261				CNNM2_ENST00000475511.1_3'UTR|CNNM2_ENST00000433628.2_Intron	NM_017649.4	NP_060119.3	Q9H8M5	CNNM2_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 2						magnesium ion homeostasis (GO:0010960)|magnesium ion transport (GO:0015693)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	adenyl nucleotide binding (GO:0030554)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|urinary_tract(1)	19		Colorectal(252;0.103)|all_hematologic(284;0.152)|Breast(234;0.198)		Epithelial(162;7.89e-09)|all cancers(201;1.82e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		TTTGCAACTGGACTGAAAATA	0.443																																																	0													53.0	52.0	52.0					10																	104828355		1867	4105	5972	SO:0001627	intron_variant	0			AF216962	CCDS7543.1, CCDS44474.1, CCDS44475.1	10q24.32	2014-08-08	2014-08-07		ENSG00000148842	ENSG00000148842			103	protein-coding gene	gene with protein product		607803	"""cyclin M2"""	ACDP2		21393841, 24699222	Standard	NM_017649		Approved		uc001kwm.3	Q9H8M5	OTTHUMG00000018976	ENST00000369878.4:c.2074-31G>C	10.37:g.104828355G>C			Q5T569|Q5T570|Q8WU59|Q9H952|Q9NRK5|Q9NXT4	RNA	SNP	-	NULL	ENST00000369878.4	37	NULL	CCDS44474.1	10																																																																																			CNNM2	-	-	ENSG00000148842		0.443	CNNM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNNM2	HGNC	protein_coding	OTTHUMT00000050113.3	-	0.00	51	0	G	NM_017649		104828355	+1	tier1	-	no_errors	ENST00000475511	ensembl	human	known	74_37	rna	20.00	28	7	SNP	0.000	C
COL18A1	80781	genome.wustl.edu	37	21	46914474	46914474	+	Nonsense_Mutation	SNP	C	C	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr21:46914474C>T	ENST00000359759.4	+	26	3634	c.3613C>T	c.(3613-3615)Cga>Tga	p.R1205*	COL18A1_ENST00000459895.1_3'UTR|COL18A1_ENST00000400337.2_Nonsense_Mutation_p.R790*|COL18A1_ENST00000355480.5_Nonsense_Mutation_p.R970*			P39060	COIA1_HUMAN	collagen, type XVIII, alpha 1	1205	Triple-helical region 6 (COL6).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endothelial cell morphogenesis (GO:0001886)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|response to drug (GO:0042493)|response to hydrostatic pressure (GO:0051599)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		GCCGGGCTTCCGAGGACCCCC	0.642																																																	0													67.0	77.0	73.0					21																	46914474		1934	4130	6064	SO:0001587	stop_gained	0				CCDS42971.1, CCDS42972.1	21q22.3	2013-01-16			ENSG00000182871	ENSG00000182871		"""Collagens"""	2195	protein-coding gene	gene with protein product	"""endostatin"""	120328	"""Knobloch syndrome, type 1"""	KNO		8188291, 8776601, 10942434, 17546652	Standard	NM_130445		Approved	KS, KNO1	uc002zhi.3	P39060	OTTHUMG00000090407	ENST00000359759.4:c.3613C>T	21.37:g.46914474C>T	ENSP00000352798:p.Arg1205*		A8MVI4|Q58EX6|Q6RZ39|Q6RZ40|Q6RZ41|Q8N4S4|Q8WXI5|Q96T70|Q9UK38|Q9Y6Q7|Q9Y6Q8	Nonsense_Mutation	SNP	pfam_Collagenase_NC10/endostatin,pfam_DUF959_COL18_N,pfam_Collagen,pfam_Frizzled_dom,superfamily_C-type_lectin_fold,superfamily_ConA-like_lec_gl_sf,superfamily_Frizzled_dom,smart_Frizzled_dom,smart_Laminin_G,pfscan_Frizzled_dom	p.R1205*	ENST00000359759.4	37	c.3613		21	.	.	.	.	.	.	.	.	.	.	C	41	9.103462	0.99066	.	.	ENSG00000182871	ENST00000400337;ENST00000400347;ENST00000355480;ENST00000359759;ENST00000539645;ENST00000342220	.	.	.	3.76	1.74	0.24563	.	0.375132	0.23169	N	0.051142	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.09590	T	0.72	.	3.9271	0.09269	0.2359:0.6372:0.0:0.127	.	.	.	.	X	790;790;970;1205;1205;137	.	ENSP00000339118:R137X	R	+	1	2	COL18A1	45738902	0.066000	0.20996	1.000000	0.80357	0.743000	0.42351	0.808000	0.27154	0.950000	0.37743	0.306000	0.20318	CGA	COL18A1	-	pfam_Collagen	ENSG00000182871		0.642	COL18A1-201	KNOWN	basic|appris_principal	protein_coding	COL18A1	HGNC	protein_coding	OTTHUMT00000206827.1	-	0.00	63	0	C			46914474	+1	tier1	-	no_errors	ENST00000359759	ensembl	human	known	74_37	nonsense	8.00	46	4	SNP	0.999	T
COL28A1	340267	genome.wustl.edu	37	7	7491958	7491958	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr7:7491958C>A	ENST00000399429.3	-	18	1641	c.1501G>T	c.(1501-1503)Ggt>Tgt	p.G501C		NM_001037763.2	NP_001032852.2	Q2UY09	COSA1_HUMAN	collagen, type XXVIII, alpha 1	501	Collagen-like 4.				cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(23)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	42		Ovarian(82;0.0789)		UCEC - Uterine corpus endometrioid carcinoma (126;0.228)		ACCTTTGGACCTTGTACTCCA	0.413																																																	0													85.0	84.0	84.0					7																	7491958		1885	4116	6001	SO:0001583	missense	0			AJ890451	CCDS43553.1	7p21.3	2013-01-16			ENSG00000215018	ENSG00000215018		"""Collagens"""	22442	protein-coding gene	gene with protein product		609996				16330543	Standard	NM_001037763		Approved		uc003src.1	Q2UY09	OTTHUMG00000150034	ENST00000399429.3:c.1501G>T	7.37:g.7491958C>A	ENSP00000382356:p.Gly501Cys		A4D101|A4D106|A4D107|A8MVR2|B9EGX9|Q2UY07|Q2UY08	Missense_Mutation	SNP	pfam_Collagen,pfam_VWF_A,pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,smart_VWF_A,smart_Prot_inh_Kunz-m,pfscan_VWF_A,pfscan_Prot_inh_Kunz-m	p.G501C	ENST00000399429.3	37	c.1501	CCDS43553.1	7	.	.	.	.	.	.	.	.	.	.	C	16.92	3.254725	0.59212	.	.	ENSG00000215018	ENST00000399429;ENST00000399419	D	0.99369	-5.78	3.85	3.85	0.44370	.	0.084638	0.46758	U	0.000261	D	0.99560	0.9842	H	0.96861	3.895	0.46203	D	0.998923	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;0.996;1.0	D	0.97796	1.0241	10	0.87932	D	0	-6.5983	11.5873	0.50925	0.0:1.0:0.0:0.0	.	501;501;501	Q2UY09-2;B5MDS6;Q2UY09	.;.;COSA1_HUMAN	C	501	ENSP00000382356:G501C	ENSP00000382347:G501C	G	-	1	0	COL28A1	7458483	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	3.170000	0.50816	2.454000	0.82982	0.655000	0.94253	GGT	COL28A1	-	pfam_Collagen	ENSG00000215018		0.413	COL28A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL28A1	HGNC	protein_coding	OTTHUMT00000315899.1	-	0.00	71	0	C	NM_001037763		7491958	-1	tier1	-	no_errors	ENST00000399429	ensembl	human	known	74_37	missense	28.85	37	15	SNP	1.000	A
COX7A2L	9167	genome.wustl.edu	37	2	42578274	42578275	+	3'UTR	INS	-	-	A	rs568475280		TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr2:42578274_42578275insA	ENST00000378669.1	-	0	1258_1259				COX7A2L_ENST00000234301.2_3'UTR|COX7A2L_ENST00000482463.1_5'UTR			O14548	COX7R_HUMAN	cytochrome c oxidase subunit VIIa polypeptide 2 like						cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain (GO:0005746)	cytochrome-c oxidase activity (GO:0004129)			lung(4)	4						GCCATCCAAGtaaaaaaaaaaa	0.327																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AB007618	CCDS1808.1	2p21	2010-06-14			ENSG00000115944	ENSG00000115944			2289	protein-coding gene	gene with protein product		605771				9418891	Standard	NM_004718		Approved	EB1, COX7RP, COX7AR, SIG81	uc002rsk.3	O14548	OTTHUMG00000128605	ENST00000378669.1:c.*85->T	2.37:g.42578285_42578285dupA			Q9P118	RNA	INS	-	NULL	ENST00000378669.1	37	NULL	CCDS1808.1	2																																																																																			COX7A2L	-	-	ENSG00000115944		0.327	COX7A2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COX7A2L	HGNC	protein_coding	OTTHUMT00000250466.3		0.00	22	0	-	NM_004718		42578275	-1	tier1		no_errors	ENST00000482463	ensembl	human	known	74_37	rna	15.38	22	4	INS	0.002:0.000	A
COL4A4	1286	genome.wustl.edu	37	2	227973326	227973326	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr2:227973326C>T	ENST00000396625.3	-	12	913	c.706G>A	c.(706-708)Gtg>Atg	p.V236M	COL4A4_ENST00000329662.7_Missense_Mutation_p.V236M	NM_000092.4	NP_000083.3	P53420	CO4A4_HUMAN	collagen, type IV, alpha 4	236	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(35)|ovary(5)|pancreas(3)|prostate(2)|skin(12)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	98		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		TTTACTCCCACACCGGGATTT	0.423																																																	0													94.0	97.0	96.0					2																	227973326		1869	4095	5964	SO:0001583	missense	0				CCDS42828.1	2q35-q37	2014-09-17			ENSG00000081052	ENSG00000081052		"""Collagens"""	2206	protein-coding gene	gene with protein product	"""collagen of basement membrane, alpha-4 chain"""	120131				1639407	Standard	NM_000092		Approved	CA44	uc021vxs.1	P53420	OTTHUMG00000149892	ENST00000396625.3:c.706G>A	2.37:g.227973326C>T	ENSP00000379866:p.Val236Met		A8MTZ1|Q53RW9|Q53S42|Q53WR1	Missense_Mutation	SNP	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.V236M	ENST00000396625.3	37	c.706	CCDS42828.1	2	.	.	.	.	.	.	.	.	.	.	C	13.19	2.163949	0.38217	.	.	ENSG00000081052	ENST00000396625;ENST00000329662	D;D	0.94330	-3.4;-3.4	5.01	2.19	0.27852	.	.	.	.	.	D	0.89206	0.6649	L	0.49455	1.56	0.21445	N	0.999682	B	0.33345	0.409	B	0.33620	0.167	T	0.78687	-0.2107	9	0.36615	T	0.2	.	6.5367	0.22357	0.0:0.6865:0.0:0.3135	.	236	P53420	CO4A4_HUMAN	M	236	ENSP00000379866:V236M;ENSP00000328553:V236M	ENSP00000328553:V236M	V	-	1	0	COL4A4	227681570	0.138000	0.22547	0.959000	0.39883	0.933000	0.57130	0.382000	0.20635	0.230000	0.21059	0.585000	0.79938	GTG	COL4A4	-	NULL	ENSG00000081052		0.423	COL4A4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL4A4	HGNC	protein_coding	OTTHUMT00000313770.1	-	0.00	95	0	C	NM_000092		227973326	-1	tier1	-	no_errors	ENST00000396625	ensembl	human	known	74_37	missense	72.73	15	40	SNP	0.919	T
CPM	1368	genome.wustl.edu	37	12	69250413	69250413	+	Missense_Mutation	SNP	G	G	T	rs139235186	byFrequency	TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr12:69250413G>T	ENST00000551568.1	-	9	1196	c.1136C>A	c.(1135-1137)cCg>cAg	p.P379Q	CPM_ENST00000338356.3_Missense_Mutation_p.P379Q|CPM_ENST00000546373.1_Missense_Mutation_p.P379Q	NM_001005502.2|NM_198320.3	NP_001005502.1|NP_938079.1	P14384	CBPM_HUMAN	carboxypeptidase M	379					anatomical structure morphogenesis (GO:0009653)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(6)|prostate(2)	9	all_epithelial(5;1.09e-35)|Lung NSC(4;1.47e-33)|all_lung(4;1.02e-31)|Breast(13;1.59e-06)		all cancers(2;2.69e-50)|GBM - Glioblastoma multiforme(2;7.34e-41)|BRCA - Breast invasive adenocarcinoma(5;5.38e-10)|Lung(24;4.61e-05)|LUAD - Lung adenocarcinoma(15;0.000376)|STAD - Stomach adenocarcinoma(21;0.00372)|Kidney(9;0.143)			GGATTTCTCCGGAATAATCAC	0.418																																																	0													97.0	95.0	96.0					12																	69250413		2203	4300	6503	SO:0001583	missense	0			AF368463	CCDS8987.1	12q15	2012-02-10			ENSG00000135678	ENSG00000135678	3.4.17.12		2311	protein-coding gene	gene with protein product	"""renal carboxypeptidase"", ""urinary carboxypeptidase B"""	114860				8586455	Standard	NM_001874		Approved		uc001suq.3	P14384	OTTHUMG00000169300	ENST00000551568.1:c.1136C>A	12.37:g.69250413G>T	ENSP00000448517:p.Pro379Gln		B2R800|Q9H2K9	Missense_Mutation	SNP	pfam_Peptidase_M14,pfam_Aste_AspA,superfamily_CarboxyPept-like_regulatory,smart_Peptidase_M14,prints_Peptidase_M14	p.P379Q	ENST00000551568.1	37	c.1136	CCDS8987.1	12	.	.	.	.	.	.	.	.	.	.	G	19.12	3.766132	0.69878	.	.	ENSG00000135678	ENST00000551568;ENST00000338356;ENST00000546373	T;T;T	0.41065	1.01;1.01;1.01	5.48	5.48	0.80851	Peptidase M14, carboxypeptidase A (1);Carboxypeptidase-like, regulatory domain (1);Carboxypeptidase, regulatory domain (1);	0.118364	0.64402	D	0.000018	T	0.62233	0.2411	M	0.75150	2.29	0.45194	D	0.998202	D	0.64830	0.994	D	0.63703	0.917	T	0.61806	-0.6987	9	.	.	.	-8.7213	15.2417	0.73476	0.0:0.0:1.0:0.0	.	379	P14384	CBPM_HUMAN	Q	379	ENSP00000448517:P379Q;ENSP00000339157:P379Q;ENSP00000447255:P379Q	.	P	-	2	0	CPM	67536680	0.995000	0.38212	0.962000	0.40283	0.778000	0.44026	2.736000	0.47385	2.756000	0.94617	0.655000	0.94253	CCG	CPM	-	superfamily_CarboxyPept-like_regulatory,smart_Peptidase_M14	ENSG00000135678		0.418	CPM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPM	HGNC	protein_coding	OTTHUMT00000403355.1	-	0.00	44	0	G	NM_198320		69250413	-1	tier1	-	no_errors	ENST00000338356	ensembl	human	known	74_37	missense	6.45	58	4	SNP	0.979	T
CPSF1	29894	genome.wustl.edu	37	8	145626338	145626338	+	Silent	SNP	G	G	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr8:145626338G>A	ENST00000349769.3	-	6	613	c.519C>T	c.(517-519)caC>caT	p.H173H	MIR1234_ENST00000408875.1_RNA	NM_013291.2	NP_037423.2	Q10570	CPSF1_HUMAN	cleavage and polyadenylation specific factor 1, 160kDa	173					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)	mRNA 3'-UTR binding (GO:0003730)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.88e-41)|Epithelial(56;1.67e-40)|all cancers(56;1.2e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			CGAGCCCCTCGTGCTCCTCAG	0.721																																					NSCLC(133;1088 1848 27708 34777 35269)												0													26.0	28.0	27.0					8																	145626338		2202	4300	6502	SO:0001819	synonymous_variant	0			U37012	CCDS34966.1	8q24	2014-05-06	2002-08-29		ENSG00000071894	ENSG00000071894			2324	protein-coding gene	gene with protein product		606027	"""cleavage and polyadenylation specific factor 1, 160kD subunit"""			7651824, 7590244	Standard	NM_013291		Approved		uc003zcj.3	Q10570	OTTHUMG00000174612	ENST00000349769.3:c.519C>T	8.37:g.145626338G>A			Q96AF0	Silent	SNP	pfam_Cleavage/polyA-sp_fac_asu_C	p.H173	ENST00000349769.3	37	c.519	CCDS34966.1	8																																																																																			CPSF1	-	NULL	ENSG00000071894		0.721	CPSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPSF1	HGNC	protein_coding	OTTHUMT00000382422.2	-	0.00	35	0	G	NM_013291		145626338	-1	tier1	-	no_errors	ENST00000349769	ensembl	human	known	74_37	silent	30.00	49	21	SNP	0.996	A
CRYAA	1409	genome.wustl.edu	37	21	44589920	44589921	+	Intron	INS	-	-	C	rs5844151|rs71699904		TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr21:44589920_44589921insC	ENST00000291554.2	+	1	281				CRYAA_ENST00000482775.1_Intron|CRYAA_ENST00000398132.1_5'Flank|CRYAA_ENST00000398133.1_Frame_Shift_Ins_p.RP29fs	NM_000394.2	NP_000385.1	P02489	CRYAA_HUMAN	crystallin, alpha A						negative regulation of apoptotic process (GO:0043066)|negative regulation of intracellular transport (GO:0032387)|protein homooligomerization (GO:0051260)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|structural constituent of eye lens (GO:0005212)|unfolded protein binding (GO:0051082)			NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)	11						GGCAATGGACGCCCCCCCCCCC	0.614																																																	0																																										SO:0001627	intron_variant	0				CCDS13695.1	21q22.3	2011-09-05			ENSG00000160202	ENSG00000160202		"""Heat shock proteins / HSPB"""	2388	protein-coding gene	gene with protein product		123580		CRYA1			Standard	XM_005261093		Approved	HSPB4	uc002zdd.1	P02489	OTTHUMG00000086842	ENST00000291554.2:c.189+522->C	21.37:g.44589931_44589931dupC			Q53X53	Frame_Shift_Ins	INS	pfam_a-crystallin/Hsp20_dom,superfamily_HSP20-like_chaperone,pfscan_a-crystallin/Hsp20_dom,prints_Alpha-crystallin/HSP	p.P33fs	ENST00000291554.2	37	c.86_87	CCDS13695.1	21																																																																																			CRYAA	-	superfamily_HSP20-like_chaperone	ENSG00000160202		0.614	CRYAA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRYAA	HGNC	protein_coding	OTTHUMT00000195562.1		0.00	78	0	-			44589921	+1	tier1		no_errors	ENST00000398133	ensembl	human	putative	74_37	frame_shift_ins	15.22	39	7	INS	0.000:0.026	C
CSMD3	114788	genome.wustl.edu	37	8	113392679	113392679	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr8:113392679G>A	ENST00000297405.5	-	38	6282	c.6038C>T	c.(6037-6039)aCa>aTa	p.T2013I	CSMD3_ENST00000455883.2_Missense_Mutation_p.T1909I|CSMD3_ENST00000343508.3_Missense_Mutation_p.T1973I|CSMD3_ENST00000352409.3_Missense_Mutation_p.T1943I	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	2013	CUB 11. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.T1973K(1)|p.T2013K(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						ATGGGGTATTGTTGTTCCTGA	0.318										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																																							2	Substitution - Missense(2)	lung(2)											100.0	105.0	103.0					8																	113392679		2203	4295	6498	SO:0001583	missense	0			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.6038C>T	8.37:g.113392679G>A	ENSP00000297405:p.Thr2013Ile		Q96PZ3	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.T2013I	ENST00000297405.5	37	c.6038	CCDS6315.1	8	.	.	.	.	.	.	.	.	.	.	G	26.3	4.720984	0.89205	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.18502	2.21;2.21;2.21;2.21;2.21	5.64	5.64	0.86602	CUB (5);	0.000000	0.64402	D	0.000001	T	0.33089	0.0851	L	0.35854	1.095	0.58432	D	0.999999	D;D;D	0.89917	1.0;0.98;1.0	D;D;D	0.97110	0.999;0.983;1.0	T	0.01330	-1.1383	10	0.21540	T	0.41	.	19.2842	0.94065	0.0:0.0:1.0:0.0	.	1909;2013;1973	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	I	1973;2013;1283;1909;1943	ENSP00000345799:T1973I;ENSP00000297405:T2013I;ENSP00000341558:T1283I;ENSP00000412263:T1909I;ENSP00000343124:T1943I	ENSP00000297405:T2013I	T	-	2	0	CSMD3	113461855	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	9.553000	0.98118	2.654000	0.90174	0.591000	0.81541	ACA	CSMD3	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom	ENSG00000164796		0.318	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	HGNC	protein_coding	OTTHUMT00000347141.1		0.00	56	0	G	NM_052900		113392679	-1			no_errors	ENST00000297405	ensembl	human	known	74_37	missense	6.90	27	2	SNP	1.000	A
CSNK1A1P1	161635	genome.wustl.edu	37	15	37110510	37110510	+	RNA	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr15:37110510G>T	ENST00000430593.3	-	0	150					NR_027320.1				casein kinase 1, alpha 1 pseudogene 1																		TTTGTGAAGGGCTTCTAGCGG	0.632																																																	0																																												0			BC028192		15q13.3	2010-09-21	2010-07-20	2010-07-20		ENSG00000223518			30446	pseudogene	pseudogene			"""casein kinase 1, alpha 1 pseudogene"""	CSNK1A1P			Standard	NR_027320		Approved		uc001zjg.4				15.37:g.37110510G>T				RNA	SNP	-	NULL	ENST00000430593.3	37	NULL		15																																																																																			CSNK1A1P1	-	-	ENSG00000223518		0.632	CSNK1A1P1-002	KNOWN	basic	processed_transcript	CSNK1A1P1	HGNC	pseudogene	OTTHUMT00000419759.1		0.00	33	0	G	NR_027320		37110510	-1			no_errors	ENST00000430593	ensembl	human	known	74_37	rna	6.56	57	4	SNP	0.001	T
CSPG4	1464	genome.wustl.edu	37	15	75985560	75985560	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr15:75985560C>T	ENST00000308508.5	-	2	195	c.103G>A	c.(103-105)Gag>Aag	p.E35K		NM_001897.4	NP_001888.2	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4	35	Globular or compact configuration stabilized by disulfide bonds.|Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.|Neurite growth inhibition. {ECO:0000250}.				activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|intracellular signal transduction (GO:0035556)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|small molecule metabolic process (GO:0044281)|tissue remodeling (GO:0048771)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell projection (GO:0042995)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(3)|liver(2)|lung(18)|ovary(2)|pancreas(2)|prostate(4)|skin(4)	48						AGGTGGTTCTCACCGAAGAAG	0.627																																																	0													36.0	26.0	29.0					15																	75985560		2197	4294	6491	SO:0001583	missense	0			X96753, AY359468	CCDS10284.1	15q24.2	2010-04-19	2007-02-16		ENSG00000173546	ENSG00000173546		"""Proteoglycans / Cell surface : Other"""	2466	protein-coding gene	gene with protein product	"""melanoma-associated chondroitin sulfate proteoglycan"""	601172	"""chondroitin sulfate proteoglycan 4 (melanoma-associated)"""			8790396, 16407841	Standard	NM_001897		Approved	MCSPG, MEL-CSPG, MSK16, NG2, MCSP, HMW-MAA	uc002baw.3	Q6UVK1	OTTHUMG00000142836	ENST00000308508.5:c.103G>A	15.37:g.75985560C>T	ENSP00000312506:p.Glu35Lys		D3DW77|Q92675	Missense_Mutation	SNP	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G	p.E35K	ENST00000308508.5	37	c.103	CCDS10284.1	15	.	.	.	.	.	.	.	.	.	.	.	20.6	4.014286	0.75161	.	.	ENSG00000173546	ENST00000308508	T	0.79352	-1.26	5.0	5.0	0.66597	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	0.204801	0.33457	N	0.004881	T	0.79118	0.4392	L	0.49126	1.545	0.44966	D	0.997983	D	0.57257	0.979	P	0.49999	0.628	T	0.81453	-0.0926	10	0.59425	D	0.04	.	15.4979	0.75669	0.0:1.0:0.0:0.0	.	35	Q6UVK1	CSPG4_HUMAN	K	35	ENSP00000312506:E35K	ENSP00000312506:E35K	E	-	1	0	CSPG4	73772615	1.000000	0.71417	0.986000	0.45419	0.790000	0.44656	7.589000	0.82641	2.346000	0.79739	0.555000	0.69702	GAG	CSPG4	-	superfamily_ConA-like_lec_gl_sf,pfscan_Laminin_G	ENSG00000173546		0.627	CSPG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSPG4	HGNC	protein_coding	OTTHUMT00000286472.1	-	0.00	293	0	C	NM_001897		75985560	-1	tier1	-	no_errors	ENST00000308508	ensembl	human	known	74_37	missense	49.61	128	126	SNP	1.000	T
CUL3	8452	genome.wustl.edu	37	2	225367752	225367752	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr2:225367752C>T	ENST00000264414.4	-	10	1753	c.1415G>A	c.(1414-1416)gGa>gAa	p.G472E	CUL3_ENST00000409096.1_Missense_Mutation_p.G448E|CUL3_ENST00000409777.1_Missense_Mutation_p.G448E|CUL3_ENST00000344951.4_Missense_Mutation_p.G406E	NM_003590.4	NP_003581.1	Q13618	CUL3_HUMAN	cullin 3	472					cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|COPII vesicle coating (GO:0048208)|cyclin catabolic process (GO:0008054)|embryonic cleavage (GO:0040016)|ER to Golgi vesicle-mediated transport (GO:0006888)|G1/S transition of mitotic cell cycle (GO:0000082)|gastrulation (GO:0007369)|integrin-mediated signaling pathway (GO:0007229)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic metaphase plate congression (GO:0007080)|negative regulation of Rho protein signal transduction (GO:0035024)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|stem cell division (GO:0017145)|stress fiber assembly (GO:0043149)|trophectodermal cellular morphogenesis (GO:0001831)|Wnt signaling pathway (GO:0016055)	Cul3-RING ubiquitin ligase complex (GO:0031463)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|nucleus (GO:0005634)|polar microtubule (GO:0005827)	POZ domain binding (GO:0031208)			endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(2)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	46		all_lung(227;0.00877)|Lung NSC(271;0.011)|Renal(207;0.0112)|all_hematologic(139;0.138)		Epithelial(121;1.58e-11)|all cancers(144;1.43e-08)|Lung(261;0.00863)|LUSC - Lung squamous cell carcinoma(224;0.00902)		CCTAAACATTCCTTCCAGTTT	0.373																																																	0													285.0	264.0	271.0					2																	225367752		2203	4300	6503	SO:0001583	missense	0			U58089	CCDS2462.1, CCDS58751.1	2q36.2	2011-05-24			ENSG00000036257	ENSG00000036257			2553	protein-coding gene	gene with protein product		603136				8681378, 17192413	Standard	NM_003590		Approved		uc002vny.3	Q13618	OTTHUMG00000133167	ENST00000264414.4:c.1415G>A	2.37:g.225367752C>T	ENSP00000264414:p.Gly472Glu		A8K536|B8ZZC3|O75415|Q569L3|Q9UBI8|Q9UET7	Missense_Mutation	SNP	pfam_Cullin_N,pfam_Cullin_neddylation_domain,superfamily_Cullin_repeat-like_dom,superfamily_Cullin_homology,smart_Cullin_homology,smart_Cullin_neddylation_domain,pfscan_Cullin_homology	p.G472E	ENST00000264414.4	37	c.1415	CCDS2462.1	2	.	.	.	.	.	.	.	.	.	.	C	36	5.615673	0.96649	.	.	ENSG00000036257	ENST00000264414;ENST00000344951;ENST00000409096;ENST00000409777	T;T;T;T	0.74737	-0.87;-0.87;-0.87;-0.87	6.03	6.03	0.97812	Cullin, N-terminal (1);Cullin homology (3);	0.000000	0.85682	D	0.000000	D	0.89976	0.6871	M	0.91663	3.23	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.993;0.996;0.996	D	0.90809	0.4700	10	0.72032	D	0.01	.	20.5568	0.99304	0.0:1.0:0.0:0.0	.	406;450;472	Q13618-3;Q53S54;Q13618	.;.;CUL3_HUMAN	E	472;406;448;448	ENSP00000264414:G472E;ENSP00000343601:G406E;ENSP00000387200:G448E;ENSP00000386525:G448E	ENSP00000264414:G472E	G	-	2	0	CUL3	225075996	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.487000	0.81328	2.861000	0.98227	0.655000	0.94253	GGA	CUL3	-	pfam_Cullin_N,superfamily_Cullin_homology,smart_Cullin_homology,pfscan_Cullin_homology	ENSG00000036257		0.373	CUL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUL3	HGNC	protein_coding	OTTHUMT00000256871.2	-	0.00	64	0	C			225367752	-1	tier1	-	no_errors	ENST00000264414	ensembl	human	known	74_37	missense	73.21	15	41	SNP	1.000	T
CUTC	51076	genome.wustl.edu	37	10	101515475	101515475	+	Missense_Mutation	SNP	C	C	G	rs370349081		TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr10:101515475C>G	ENST00000370476.5	+	9	930	c.801C>G	c.(799-801)atC>atG	p.I267M		NM_015960.2	NP_057044.2	Q9NTM9	CUTC_HUMAN	cutC copper transporter	267					copper ion homeostasis (GO:0055070)|copper ion transport (GO:0006825)|protein tetramerization (GO:0051262)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	copper ion binding (GO:0005507)	p.I267I(1)		breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14		Colorectal(252;0.234)		Epithelial(162;3e-10)|all cancers(201;2.37e-08)		TGAATGCTATCGCAAAGAACA	0.413																																																	1	Substitution - coding silent(1)	large_intestine(1)											84.0	80.0	82.0					10																	101515475		2203	4300	6503	SO:0001583	missense	0			AF132966	CCDS7483.1	10q24.31	2013-07-31	2013-07-31		ENSG00000119929	ENSG00000119929			24271	protein-coding gene	gene with protein product		610101	"""cutC copper transporter homolog (E. coli)"""			16182249	Standard	NM_015960		Approved	CGI-32	uc001kqd.4	Q9NTM9	OTTHUMG00000018889	ENST00000370476.5:c.801C>G	10.37:g.101515475C>G	ENSP00000359507:p.Ile267Met		Q5TCZ8|Q9Y321	Missense_Mutation	SNP	pfam_Cu_homeostasis_CutC,superfamily_Cu_homeostasis_CutC_dom	p.I267M	ENST00000370476.5	37	c.801	CCDS7483.1	10	.	.	.	.	.	.	.	.	.	.	c	12.99	2.104283	0.37145	.	.	ENSG00000119929	ENST00000370476	.	.	.	5.55	3.19	0.36642	Copper homeostasis CutC domain (2);	0.047733	0.85682	D	0.000000	T	0.35653	0.0939	L	0.41961	1.31	0.50632	D	0.999885	P	0.47350	0.894	B	0.40982	0.345	T	0.12477	-1.0546	9	0.49607	T	0.09	-16.3099	6.1705	0.20414	0.0:0.1439:0.1336:0.7225	.	267	Q9NTM9	CUTC_HUMAN	M	267	.	ENSP00000359507:I267M	I	+	3	3	CUTC	101505465	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	0.758000	0.26447	0.927000	0.37143	-0.385000	0.06624	ATC	CUTC	-	superfamily_Cu_homeostasis_CutC_dom	ENSG00000119929		0.413	CUTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUTC	HGNC	protein_coding	OTTHUMT00000049811.1		0.00	48	0	C	NM_015960		101515475	+1			no_errors	ENST00000370476	ensembl	human	known	74_37	missense	6.67	28	2	SNP	1.000	G
DALRD3	55152	genome.wustl.edu	37	3	49053422	49053422	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr3:49053422G>A	ENST00000341949.4	-	10	1433	c.1427C>T	c.(1426-1428)gCt>gTt	p.A476V	DALRD3_ENST00000395462.4_Missense_Mutation_p.A309V|DALRD3_ENST00000496568.1_5'Flank|DALRD3_ENST00000313778.5_Missense_Mutation_p.A309V|DALRD3_ENST00000441576.2_Silent_p.C467C|DALRD3_ENST00000440857.1_Missense_Mutation_p.A309V	NM_001009996.1	NP_001009996.1	Q5D0E6	DALD3_HUMAN	DALR anticodon binding domain containing 3	476					arginyl-tRNA aminoacylation (GO:0006420)		arginine-tRNA ligase activity (GO:0004814)|ATP binding (GO:0005524)			breast(2)|endometrium(2)|large_intestine(2)|lung(5)|skin(1)	12				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		TGTGCGTACAGCAATGTGGAG	0.552																																																	0													66.0	73.0	70.0					3																	49053422		2203	4300	6503	SO:0001583	missense	0			BC014099	CCDS2783.1, CCDS33754.1, CCDS63632.1	3p21.31	2005-01-10			ENSG00000178149	ENSG00000178149			25536	protein-coding gene	gene with protein product						12477932	Standard	NM_001009996		Approved	FLJ10496	uc003cvk.2	Q5D0E6	OTTHUMG00000156748	ENST00000341949.4:c.1427C>T	3.37:g.49053422G>A	ENSP00000344989:p.Ala476Val		Q7Z5S7|Q86WY1|Q8N105|Q8NA89|Q9NVU8	Missense_Mutation	SNP	pfam_DALR_anticod-bd,superfamily_tRNAsynth_1a_anticodon-bd,smart_DALR_anticod-bd	p.A476V	ENST00000341949.4	37	c.1427	CCDS33754.1	3	.	.	.	.	.	.	.	.	.	.	G	3.782	-0.045402	0.07452	.	.	ENSG00000178149	ENST00000341949;ENST00000395462;ENST00000440857;ENST00000313778	T;T;T;T	0.45276	0.91;0.9;0.91;0.9	4.96	3.08	0.35506	Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (1);DALR anticodon binding (2);	0.564340	0.19737	N	0.107215	T	0.27594	0.0678	N	0.22421	0.69	0.09310	N	1	B;B	0.19331	0.028;0.035	B;B	0.20955	0.031;0.032	T	0.15464	-1.0436	10	0.30078	T	0.28	-0.3166	10.5713	0.45202	0.0732:0.1326:0.7941:0.0	.	309;476	C9JJG6;Q5D0E6	.;DALD3_HUMAN	V	476;309;309;309	ENSP00000344989:A476V;ENSP00000378846:A309V;ENSP00000403770:A309V;ENSP00000323265:A309V	ENSP00000323265:A309V	A	-	2	0	DALRD3	49028426	0.035000	0.19736	0.004000	0.12327	0.103000	0.19146	1.936000	0.40183	1.275000	0.44379	0.556000	0.70494	GCT	DALRD3	-	pfam_DALR_anticod-bd,superfamily_tRNAsynth_1a_anticodon-bd,smart_DALR_anticod-bd	ENSG00000178149		0.552	DALRD3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DALRD3	HGNC	protein_coding	OTTHUMT00000345581.1	-	0.00	26	0	G	NM_018114		49053422	-1	tier1	-	no_errors	ENST00000341949	ensembl	human	known	74_37	missense	87.50	2	14	SNP	0.013	A
DCAF5	8816	genome.wustl.edu	37	14	69522207	69522207	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr14:69522207C>T	ENST00000341516.5	-	9	1343	c.1196G>A	c.(1195-1197)gGc>gAc	p.G399D	DCAF5_ENST00000554215.1_Missense_Mutation_p.G317D|DCAF5_ENST00000556847.1_Missense_Mutation_p.G317D|DCAF5_ENST00000557386.1_Missense_Mutation_p.G398D|DCAF5_ENST00000553293.1_5'UTR	NM_001284206.1|NM_001284207.1|NM_003861.2	NP_001271135.1|NP_001271136.1|NP_003852.1	Q96JK2	DCAF5_HUMAN	DDB1 and CUL4 associated factor 5	399					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|mitochondrion (GO:0005739)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|upper_aerodigestive_tract(2)	29						ATGCGACAGGCCACTCCCACT	0.577																																																	0													152.0	143.0	146.0					14																	69522207		2203	4300	6503	SO:0001583	missense	0			AB058727	CCDS32106.1, CCDS61480.1, CCDS61481.1, CCDS73646.1	14q23-q24.1	2013-01-09	2009-07-17	2009-07-17				"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	20224	protein-coding gene	gene with protein product		603812	"""WD repeat domain 22"""	WDR22		9740667, 9521877	Standard	NM_003861		Approved	BCRP2, D14S1461E, BCRG2, KIAA1824	uc001xkp.3	Q96JK2		ENST00000341516.5:c.1196G>A	14.37:g.69522207C>T	ENSP00000341351:p.Gly399Asp		B2RN31|G3V4J7|O60559|Q8N3V3|Q8N3V5	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.G399D	ENST00000341516.5	37	c.1196	CCDS32106.1	14	.	.	.	.	.	.	.	.	.	.	C	17.26	3.343306	0.61073	.	.	ENSG00000139990	ENST00000341516;ENST00000554215;ENST00000556847;ENST00000557386	T;T;T;T	0.69306	-0.39;-0.22;-0.22;0.24	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	T	0.69967	0.3170	N	0.24115	0.695	0.80722	D	1	D;B	0.57571	0.98;0.355	P;B	0.58577	0.841;0.142	T	0.71859	-0.4465	10	0.51188	T	0.08	-25.0252	19.5403	0.95271	0.0:1.0:0.0:0.0	.	398;399	G3V4J7;Q96JK2	.;DCAF5_HUMAN	D	399;317;317;398	ENSP00000341351:G399D;ENSP00000451551:G317D;ENSP00000452052:G317D;ENSP00000451845:G398D	ENSP00000341351:G399D	G	-	2	0	DCAF5	68591960	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.336000	0.79245	2.623000	0.88846	0.561000	0.74099	GGC	DCAF5	-	NULL	ENSG00000139990		0.577	DCAF5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DCAF5	HGNC	protein_coding	OTTHUMT00000414806.2	-	0.00	61	0	C	NM_003861		69522207	-1	tier1	-	no_errors	ENST00000341516	ensembl	human	known	74_37	missense	12.50	28	4	SNP	1.000	T
DDX24	57062	genome.wustl.edu	37	14	94517537	94517537	+	Nonstop_Mutation	SNP	T	T	G	rs367601031		TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr14:94517537T>G	ENST00000330836.5	-	9	2711	c.2580A>C	c.(2578-2580)taA>taC	p.*860Y	DDX24_ENST00000544005.1_Nonstop_Mutation_p.*610Y|DDX24_ENST00000555054.1_Nonstop_Mutation_p.*817Y|DDX24_ENST00000553400.1_5'UTR	NM_020414.3	NP_065147.1	Q9GZR7	DDX24_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 24	0					RNA metabolic process (GO:0016070)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)			cervix(3)|endometrium(4)|kidney(4)|large_intestine(5)|lung(3)|ovary(2)|skin(1)|urinary_tract(1)	23		all_cancers(154;0.12)		Epithelial(152;0.114)|all cancers(159;0.19)|COAD - Colon adenocarcinoma(157;0.207)		ACTTGACCAGTTAATTTGCAC	0.493											OREG0022891	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													88.0	92.0	91.0					14																	94517537		2203	4299	6502	SO:0001578	stop_lost	0			AF214731	CCDS9918.1	14q32	2013-07-16	2013-07-16			ENSG00000089737		"""DEAD-boxes"""	13266	protein-coding gene	gene with protein product		606181	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 24"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 24"""			10936056, 18289627	Standard	NM_020414		Approved		uc001ycj.3	Q9GZR7		ENST00000330836.5:c.2580A>C	14.37:g.94517537T>G		1306	E7EMJ4|Q4V9L5	Nonstop_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.*860Y	ENST00000330836.5	37	c.2580	CCDS9918.1	14	.	.	.	.	.	.	.	.	.	.	T	14.26	2.481999	0.44147	.	.	ENSG00000089737	ENST00000330836;ENST00000544005;ENST00000440370;ENST00000543787;ENST00000555054;ENST00000542247	.	.	.	4.61	0.881	0.19166	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	3.3209	0.07049	0.174:0.3167:0.0:0.5093	.	.	.	.	Y	860;610;805;486;817;764	.	.	X	-	3	2	DDX24	93587290	0.047000	0.20315	0.000000	0.03702	0.395000	0.30598	0.645000	0.24782	0.056000	0.16144	0.459000	0.35465	TAA	DDX24	-	NULL	ENSG00000089737		0.493	DDX24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX24	HGNC	protein_coding	OTTHUMT00000412861.1		0.00	97	0	T	NM_020414		94517537	-1			no_errors	ENST00000330836	ensembl	human	known	74_37	nonstop	7.69	60	5	SNP	0.002	G
DHX8	1659	genome.wustl.edu	37	17	41598221	41598221	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr17:41598221G>T	ENST00000262415.3	+	20	3112	c.3040G>T	c.(3040-3042)Gtg>Ttg	p.V1014L	DHX8_ENST00000540306.1_Missense_Mutation_p.V1014L	NM_004941.1	NP_004932.1	Q14562	DHX8_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 8	1014					ATP catabolic process (GO:0006200)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	42		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.08)		CATGCTGTCTGTGCAGAACGT	0.502											OREG0024435	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									NSCLC(56;1548 1661 49258 49987)												0													145.0	122.0	130.0					17																	41598221		2203	4300	6503	SO:0001583	missense	0			D50487	CCDS11464.1	17q21.31	2005-08-19	2003-06-13	2003-06-20		ENSG00000067596		"""DEAH-boxes"""	2749	protein-coding gene	gene with protein product		600396	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 8 (RNA helicase)"""	DDX8		7935475	Standard	NM_004941		Approved	HRH1, PRP22, PRPF22	uc002idu.1	Q14562		ENST00000262415.3:c.3040G>T	17.37:g.41598221G>T	ENSP00000262415:p.Val1014Leu	902		Missense_Mutation	SNP	pfam_Helicase-assoc_dom,pfam_DUF1605,pfam_Rbsml_prot_S1_RNA-bd_dom,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,superfamily_NA-bd_OB-fold,smart_RNA-binding_domain_S1,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Rbsml_prot_S1_RNA-bd_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.V1014L	ENST00000262415.3	37	c.3040	CCDS11464.1	17	.	.	.	.	.	.	.	.	.	.	G	22.7	4.326418	0.81690	.	.	ENSG00000067596	ENST00000540306;ENST00000262415	T;T	0.06933	3.24;3.24	5.78	5.78	0.91487	Helicase-associated domain (2);	0.000000	0.64402	D	0.000001	T	0.18215	0.0437	L	0.58101	1.795	0.80722	D	1	P;B	0.47350	0.894;0.431	P;B	0.48488	0.579;0.386	T	0.00043	-1.2225	10	0.54805	T	0.06	.	18.9999	0.92829	0.0:0.0:1.0:0.0	.	1014;1014	F5H658;Q14562	.;DHX8_HUMAN	L	1014	ENSP00000437886:V1014L;ENSP00000262415:V1014L	ENSP00000262415:V1014L	V	+	1	0	DHX8	38953747	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.662000	0.98603	2.742000	0.94016	0.650000	0.86243	GTG	DHX8	-	pfam_Helicase-assoc_dom,superfamily_P-loop_NTPase,smart_Helicase-assoc_dom	ENSG00000067596		0.502	DHX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX8	HGNC	protein_coding	OTTHUMT00000453485.1	-	0.00	65	0	G			41598221	+1	tier1	-	no_errors	ENST00000262415	ensembl	human	known	74_37	missense	9.09	50	5	SNP	1.000	T
DIAPH3	81624	genome.wustl.edu	37	13	60435631	60435631	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr13:60435631G>T	ENST00000400324.4	-	22	2867	c.2647C>A	c.(2647-2649)Ctt>Att	p.L883I	DIAPH3_ENST00000465066.1_5'UTR|DIAPH3_ENST00000400330.1_Missense_Mutation_p.L883I|DIAPH3_ENST00000400319.1_Missense_Mutation_p.L813I|DIAPH3_ENST00000400320.1_Missense_Mutation_p.L837I|DIAPH3_ENST00000377908.2_Missense_Mutation_p.L872I|DIAPH3_ENST00000267215.4_Missense_Mutation_p.L883I	NM_001042517.1|NM_001258366.1	NP_001035982.1|NP_001245295.1	Q9NSV4	DIAP3_HUMAN	diaphanous-related formin 3	883	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin cytoskeleton organization (GO:0030036)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|liver(1)|lung(20)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46		Breast(118;0.052)|Prostate(109;0.103)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;2.77e-05)		AGGAAATGAAGTAGCGTTGTT	0.363																																																	0													152.0	139.0	143.0					13																	60435631		1833	4079	5912	SO:0001583	missense	0			AL137718	CCDS41898.1, CCDS58294.1, CCDS58295.1, CCDS58296.1, CCDS58297.1, CCDS73579.1, CCDS73580.1	13q21.2	2013-05-24	2013-05-24		ENSG00000139734	ENSG00000139734			15480	protein-coding gene	gene with protein product		614567	"""diaphanous (Drosophila, homolog) 3"", ""auditory neuropathy, autosomal dominant 1"", ""diaphanous homolog 3 (Drosophila)"""	AUNA1		14767582, 20624953	Standard	NM_030932		Approved	DRF3, FLJ34705, AN, NSDAN	uc001vht.4	Q9NSV4	OTTHUMG00000017004	ENST00000400324.4:c.2647C>A	13.37:g.60435631G>T	ENSP00000383178:p.Leu883Ile		A2A3B8|A2A3B9|A2A3C0|Q18P99|Q18PA0|Q18PA1|Q2KPB6|Q3ZK23|Q5JTP8|Q5T2S7|Q5XKF6|Q6MZF0|Q6NUP0|Q86VS4|Q8NAV4	Missense_Mutation	SNP	pfam_FH2_Formin,pfam_FH3_dom,pfam_GTPase-bd,pfam_Drf_DAD,superfamily_ARM-type_fold,smart_FH2_Formin	p.L883I	ENST00000400324.4	37	c.2647	CCDS41898.1	13	.	.	.	.	.	.	.	.	.	.	G	29.2	4.983517	0.93044	.	.	ENSG00000139734	ENST00000400324;ENST00000400330;ENST00000400327;ENST00000413168;ENST00000400329;ENST00000377908;ENST00000400319;ENST00000400320;ENST00000267215;ENST00000267214;ENST00000453990	T;T;T;T;T;T	0.80123	-1.34;-1.34;-1.34;-1.34;-1.34;-0.18	5.62	5.62	0.85841	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.000000	0.85682	D	0.000000	D	0.92057	0.7483	M	0.89601	3.045	0.54753	D	0.999987	D;D;D	0.76494	0.957;0.997;0.999	D;D;D	0.91635	0.97;0.992;0.999	D	0.93106	0.6512	10	0.87932	D	0	.	19.6569	0.95845	0.0:0.0:1.0:0.0	.	620;620;883	Q9NSV4-2;Q9NSV4-1;Q9NSV4	.;.;DIAP3_HUMAN	I	883;883;872;837;813;872;813;837;883;620;883	ENSP00000383178:L883I;ENSP00000383184:L883I;ENSP00000367141:L872I;ENSP00000383173:L813I;ENSP00000383174:L837I;ENSP00000267215:L883I	ENSP00000267214:L620I	L	-	1	0	DIAPH3	59333632	1.000000	0.71417	0.969000	0.41365	0.900000	0.52787	9.476000	0.97823	2.652000	0.90054	0.561000	0.74099	CTT	DIAPH3	-	pfam_FH2_Formin,smart_FH2_Formin	ENSG00000139734		0.363	DIAPH3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DIAPH3	HGNC	protein_coding	OTTHUMT00000045166.3	-	0.00	87	0	G	NM_001042517		60435631	-1	tier1	-	no_errors	ENST00000400324	ensembl	human	known	74_37	missense	10.53	34	4	SNP	0.999	T
ACAA1	30	genome.wustl.edu	37	3	38164060	38164060	+	IGR	SNP	C	C	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr3:38164060C>T	ENST00000333167.8	-	0	1785				DLEC1_ENST00000346219.3_Silent_p.S1767S|DLEC1_ENST00000308059.6_3'UTR|DLEC1_ENST00000452631.2_3'UTR|Y_RNA_ENST00000365095.1_RNA|ACAA1_ENST00000480865.1_5'Flank	NM_001607.3	NP_001598.1	P09110	THIK_HUMAN	acetyl-CoA acyltransferase 1						alpha-linolenic acid metabolic process (GO:0036109)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid metabolic process (GO:0000038)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	acetyl-CoA C-acyltransferase activity (GO:0003988)|palmitoyl-CoA oxidase activity (GO:0016401)			endometrium(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)	9				KIRC - Kidney renal clear cell carcinoma(284;0.0523)|Kidney(284;0.0657)		ATGGTCTCAGCCTAGGCCCTC	0.532																																																	0													17.0	17.0	17.0					3																	38164060		1891	4040	5931	SO:0001628	intergenic_variant	0			X14813	CCDS2673.1, CCDS46794.1	3p22.2	2012-05-16	2010-04-30		ENSG00000060971	ENSG00000060971	2.3.1.16		82	protein-coding gene	gene with protein product	"""peroxisomal 3-oxoacyl-Coenzyme A thiolase"""	604054	"""acetyl-Coenzyme A acyltransferase 1"""				Standard	NM_001607		Approved		uc003cht.3	P09110	OTTHUMG00000131087		3.37:g.38164060C>T			G5E935|Q96CA6	Silent	SNP	superfamily_PapD-like	p.S1767	ENST00000333167.8	37	c.5301	CCDS2673.1	3																																																																																			DLEC1	-	NULL	ENSG00000008226		0.532	ACAA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLEC1	HGNC	protein_coding	OTTHUMT00000342980.1	-	0.00	44	0	C	NM_001607		38164060	+1	tier1	-	no_errors	ENST00000346219	ensembl	human	known	74_37	silent	16.67	15	3	SNP	0.000	T
DMBT1	1755	genome.wustl.edu	37	10	124352022	124352022	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr10:124352022G>C	ENST00000338354.3	+	20	2517	c.2411G>C	c.(2410-2412)gGa>gCa	p.G804A	DMBT1_ENST00000359586.6_Intron|DMBT1_ENST00000330163.4_Intron|DMBT1_ENST00000368955.3_Missense_Mutation_p.G794A|DMBT1_ENST00000344338.3_Missense_Mutation_p.G794A|DMBT1_ENST00000368956.2_Intron|DMBT1_ENST00000368909.3_Missense_Mutation_p.G804A			Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1	804	SRCR 6. {ECO:0000255|PROSITE- ProRule:PRU00196}.				defense response to virus (GO:0051607)|epithelial cell differentiation (GO:0030855)|induction of bacterial agglutination (GO:0043152)|innate immune response (GO:0045087)|inner cell mass cell proliferation (GO:0001833)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of epithelial cell differentiation (GO:0030858)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|phagocytic vesicle membrane (GO:0030670)|proteinaceous extracellular matrix (GO:0005578)|zymogen granule membrane (GO:0042589)	calcium-dependent protein binding (GO:0048306)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|zymogen binding (GO:0035375)			breast(2)|central_nervous_system(7)|cervix(3)|endometrium(8)|kidney(1)|large_intestine(1)|lung(46)|prostate(1)|urinary_tract(3)	72		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				CGCTGCTCAGGACACGAGTCC	0.622																																					Ovarian(182;93 2026 18125 22222 38972)												0													149.0	109.0	122.0					10																	124352022		2025	4116	6141	SO:0001583	missense	0				CCDS44490.1, CCDS44491.1, CCDS44492.1	10q25.3-q26.1	2008-08-01			ENSG00000187908	ENSG00000187908			2926	protein-coding gene	gene with protein product		601969				9288095, 17548659	Standard	NM_004406		Approved	GP340, muclin	uc001lgk.1	Q9UGM3	OTTHUMG00000019185	ENST00000338354.3:c.2411G>C	10.37:g.124352022G>C	ENSP00000342210:p.Gly804Ala		A6NDG4|A6NDJ5|A8E4R5|B1ARE7|B1ARE8|B1ARE9|B1ARF0|B7Z8Y2|F8WEF7|Q59EX0|Q5JR26|Q6MZN4|Q96DU4|Q9UGM2|Q9UJ57|Q9UKJ4|Q9Y211|Q9Y4V9	Missense_Mutation	SNP	pfam_SRCR,pfam_CUB_dom,pfam_ZP_dom,superfamily_Srcr_rcpt-rel,superfamily_CUB_dom,smart_Srcr_rcpt-rel,smart_CUB_dom,smart_ZP_dom,pfscan_CUB_dom,pfscan_SRCR,pfscan_ZP_dom,prints_SRCR	p.G804A	ENST00000338354.3	37	c.2411		10	.	.	.	.	.	.	.	.	.	.	G	10.67	1.414550	0.25465	.	.	ENSG00000187908	ENST00000338354;ENST00000368915;ENST00000341278;ENST00000368953;ENST00000339871;ENST00000368942;ENST00000344338;ENST00000368909;ENST00000368955	T;T;T;T	0.71698	-0.59;-0.59;-0.59;-0.59	3.9	2.97	0.34412	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	.	.	.	.	D	0.87414	0.6171	H	0.94886	3.595	0.80722	D	1	D;D;D;D	0.89917	1.0;0.996;0.996;0.997	D;P;P;D	0.91635	0.999;0.904;0.904;0.942	D	0.90011	0.4121	9	0.87932	D	0	.	13.5114	0.61515	0.0:0.1582:0.8418:0.0	.	565;804;794;804	Q9UGM3-4;Q9UGM3-6;Q9UGM3-3;Q9UGM3	.;.;.;DMBT1_HUMAN	A	804;804;804;804;804;804;794;804;794	ENSP00000342210:G804A;ENSP00000343175:G794A;ENSP00000357905:G804A;ENSP00000357951:G794A	ENSP00000342210:G804A	G	+	2	0	DMBT1	124342012	1.000000	0.71417	0.202000	0.23494	0.029000	0.11900	9.247000	0.95444	0.717000	0.32145	0.563000	0.77884	GGA	DMBT1	-	pfam_SRCR,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_SRCR	ENSG00000187908		0.622	DMBT1-001	KNOWN	basic|appris_principal	protein_coding	DMBT1	HGNC	protein_coding	OTTHUMT00000050792.2	-	0.00	169	0	G	NM_004406		124352022	+1	tier1	-	no_errors	ENST00000338354	ensembl	human	known	74_37	missense	12.63	165	24	SNP	0.988	C
DNAH14	127602	genome.wustl.edu	37	1	225268267	225268267	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr1:225268267G>A	ENST00000445597.2	+	15	2755	c.2755G>A	c.(2755-2757)Gtg>Atg	p.V919M	DNAH14_ENST00000439375.2_Missense_Mutation_p.V985M|DNAH14_ENST00000430092.1_Missense_Mutation_p.V985M			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14	919					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						TACACAGATTGTGCTTTCAGA	0.383																																																	0													157.0	134.0	141.0					1																	225268267		692	1591	2283	SO:0001583	missense	0			U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.2755G>A	1.37:g.225268267G>A	ENSP00000409472:p.Val919Met		A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,superfamily_P-loop_NTPase,superfamily_Tautomerase/MIF_sf,smart_AAA+_ATPase	p.V985M	ENST00000445597.2	37	c.2953		1	.	.	.	.	.	.	.	.	.	.	G	19.86	3.905398	0.72868	.	.	ENSG00000185842	ENST00000445597;ENST00000430092;ENST00000439375;ENST00000328556	T;T;T;T	0.32023	2.36;1.47;1.47;1.67	5.14	3.27	0.37495	.	.	.	.	.	T	0.18759	0.0450	N	0.22421	0.69	0.32713	N	0.51135	P	0.45957	0.869	B	0.37888	0.26	T	0.16217	-1.0410	9	0.41790	T	0.15	.	9.7238	0.40320	0.1713:0.0:0.8287:0.0	.	985	Q0VDD8-4	.	M	919;985;985;63	ENSP00000409472:V919M;ENSP00000414402:V985M;ENSP00000392061:V985M;ENSP00000332424:V63M	ENSP00000332424:V63M	V	+	1	0	DNAH14	223334890	0.852000	0.29690	0.005000	0.12908	0.955000	0.61496	1.762000	0.38451	0.672000	0.31204	0.508000	0.49915	GTG	DNAH14	-	NULL	ENSG00000185842		0.383	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	DNAH14	HGNC	protein_coding	OTTHUMT00000331217.3	-	0.00	29	0	G	XM_059166		225268267	+1	tier1	-	no_errors	ENST00000430092	ensembl	human	known	74_37	missense	51.02	24	25	SNP	0.099	A
DNAH2	146754	genome.wustl.edu	37	17	7708333	7708333	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr17:7708333G>A	ENST00000572933.1	+	60	10701	c.9241G>A	c.(9241-9243)Gct>Act	p.A3081T	DNAH2_ENST00000389173.2_Missense_Mutation_p.A3081T			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	3081	Stalk. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				TCAGGCACTGGCTGACAATGC	0.542																																																	0													76.0	81.0	79.0					17																	7708333		2203	4300	6503	SO:0001583	missense	0			U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.9241G>A	17.37:g.7708333G>A	ENSP00000458355:p.Ala3081Thr		A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA_core,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.A3081T	ENST00000572933.1	37	c.9241	CCDS32551.1	17	.	.	.	.	.	.	.	.	.	.	G	33	5.211795	0.95069	.	.	ENSG00000183914	ENST00000389173	T	0.75260	-0.92	4.88	4.88	0.63580	Dynein heavy chain, coiled coil stalk (1);	0.000000	0.85682	D	0.000000	D	0.89483	0.6728	M	0.93720	3.45	0.80722	D	1	D	0.76494	0.999	D	0.77557	0.99	D	0.91636	0.5323	10	0.56958	D	0.05	.	16.9512	0.86246	0.0:0.0:1.0:0.0	.	3081	Q9P225	DYH2_HUMAN	T	3081	ENSP00000373825:A3081T	ENSP00000373825:A3081T	A	+	1	0	DNAH2	7649058	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.730000	0.91510	2.541000	0.85698	0.591000	0.81541	GCT	DNAH2	-	NULL	ENSG00000183914		0.542	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH2	HGNC	protein_coding	OTTHUMT00000440241.1		0.00	50	0	G	NM_020877		7708333	+1			no_errors	ENST00000389173	ensembl	human	known	74_37	missense	5.13	37	2	SNP	1.000	A
DNAJC25	548645	genome.wustl.edu	37	9	114415453	114415453	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr9:114415453G>T	ENST00000313525.3	+	4	1090	c.1034G>T	c.(1033-1035)aGa>aTa	p.R345I	DNAJC25_ENST00000556107.1_Intron|DNAJC25-GNG10_ENST00000374294.3_Intron	NM_001015882.2	NP_001015882.2	Q9H1X3	DJC25_HUMAN	DnaJ (Hsp40) homolog, subfamily C , member 25	345						integral component of membrane (GO:0016021)				kidney(1)|large_intestine(2)|lung(1)|skin(4)	8						AGATACAGGAGATGGATGAAG	0.373																																																	0													147.0	143.0	144.0					9																	114415453		1855	4093	5948	SO:0001583	missense	0				CCDS43862.1	9q31.3	2011-09-02			ENSG00000059769	ENSG00000059769		"""Heat shock proteins / DNAJ (HSP40)"""	34187	protein-coding gene	gene with protein product							Standard	NM_001015882		Approved	bA16L21.2.1	uc004bfl.3	Q9H1X3	OTTHUMG00000020491	ENST00000313525.3:c.1034G>T	9.37:g.114415453G>T	ENSP00000320650:p.Arg345Ile		Q5QTD8|Q96BN9	Missense_Mutation	SNP	pfam_DnaJ_domain,superfamily_DnaJ_domain,smart_DnaJ_domain,prints_DnaJ_domain,pfscan_DnaJ_domain	p.R345I	ENST00000313525.3	37	c.1034	CCDS43862.1	9	.	.	.	.	.	.	.	.	.	.	G	34	5.323565	0.95708	.	.	ENSG00000059769	ENST00000313525	T	0.63255	-0.03	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.82559	0.5063	M	0.82716	2.605	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	T	0.83050	-0.0153	10	0.87932	D	0	-29.6863	20.8794	0.99867	0.0:0.0:1.0:0.0	.	345	Q9H1X3	DJC25_HUMAN	I	345	ENSP00000320650:R345I	ENSP00000320650:R345I	R	+	2	0	DNAJC25	113455274	1.000000	0.71417	0.963000	0.40424	0.987000	0.75469	9.336000	0.96533	2.941000	0.99782	0.655000	0.94253	AGA	DNAJC25	-	NULL	ENSG00000059769		0.373	DNAJC25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC25	HGNC	protein_coding	OTTHUMT00000156218.3	-	0.00	82	0	G	NM_001015882		114415453	+1	tier1	-	no_errors	ENST00000313525	ensembl	human	known	74_37	missense	6.67	56	4	SNP	1.000	T
DOCK2	1794	genome.wustl.edu	37	5	169141380	169141380	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr5:169141380G>C	ENST00000256935.8	+	19	1940	c.1860G>C	c.(1858-1860)ttG>ttC	p.L620F	DOCK2_ENST00000520908.1_Missense_Mutation_p.L112F|DOCK2_ENST00000540750.1_5'UTR	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	620					actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TGCTGGGTTTGCTGAAGTGGC	0.458																																																	0													218.0	224.0	222.0					5																	169141380		2203	4300	6503	SO:0001583	missense	0			BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.1860G>C	5.37:g.169141380G>C	ENSP00000256935:p.Leu620Phe		Q2M3I0|Q96AK7	Missense_Mutation	SNP	pfam_DOCK_C,pfam_SH3_2,superfamily_SH3_domain,superfamily_Cyt_c-like_dom,superfamily_ARM-type_fold,superfamily_Ferritin-like_SF,smart_SH3_domain,pfscan_SH3_domain	p.L620F	ENST00000256935.8	37	c.1860	CCDS4371.1	5	.	.	.	.	.	.	.	.	.	.	G	17.52	3.410293	0.62399	.	.	ENSG00000134516	ENST00000256935;ENST00000343291;ENST00000520908	T;T	0.28895	1.59;1.59	5.79	4.89	0.63831	.	0.000000	0.85682	D	0.000000	T	0.59018	0.2163	M	0.92784	3.345	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.97110	0.998;1.0;0.997	T	0.63756	-0.6565	10	0.66056	D	0.02	.	5.0569	0.14537	0.081:0.2461:0.5415:0.1314	.	112;620;620	E7ERW7;E5RFJ0;Q92608	.;.;DOCK2_HUMAN	F	620;138;112	ENSP00000256935:L620F;ENSP00000429283:L112F	ENSP00000256935:L620F	L	+	3	2	DOCK2	169073958	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	0.791000	0.26915	1.364000	0.46038	0.655000	0.94253	TTG	DOCK2	-	NULL	ENSG00000134516		0.458	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK2	HGNC	protein_coding	OTTHUMT00000252828.2		0.00	73	0	G	NM_004946		169141380	+1			no_errors	ENST00000256935	ensembl	human	known	74_37	missense	5.56	67	4	SNP	1.000	C
DOCK4	9732	genome.wustl.edu	37	7	111503550	111503550	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr7:111503550G>C	ENST00000437633.1	-	23	2607	c.2351C>G	c.(2350-2352)gCc>gGc	p.A784G	DOCK4_ENST00000476846.1_5'UTR|DOCK4_ENST00000428084.1_Missense_Mutation_p.A784G	NM_014705.3	NP_055520.3	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4	784					cell chemotaxis (GO:0060326)|positive regulation of Rac GTPase activity (GO:0032855)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|stereocilium (GO:0032420)|stereocilium bundle (GO:0032421)	guanyl-nucleotide exchange factor activity (GO:0005085)|PDZ domain binding (GO:0030165)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)|receptor tyrosine kinase binding (GO:0030971)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(13)|lung(31)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(4)	72		Acute lymphoblastic leukemia(1;0.0441)				GACCAAGTTGGCTACTTCCCG	0.493																																																	0													56.0	54.0	55.0					7																	111503550		1956	4137	6093	SO:0001583	missense	0				CCDS47688.1	7q31.1	2007-08-07			ENSG00000128512	ENSG00000128512			19192	protein-coding gene	gene with protein product		607679				12432077, 12628187	Standard	XM_006716188		Approved	FLJ34238, KIAA0716	uc003vfx.3	Q8N1I0	OTTHUMG00000155077	ENST00000437633.1:c.2351C>G	7.37:g.111503550G>C	ENSP00000404179:p.Ala784Gly		O14584|O94824|Q8NB45	Missense_Mutation	SNP	pfam_DOCK_C,pfam_SH3_2,superfamily_SH3_domain,superfamily_Rho_GTPase_activation_prot,superfamily_C2_dom,smart_SH3_domain,pfscan_SH3_domain	p.A784G	ENST00000437633.1	37	c.2351	CCDS47688.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.13|18.13	3.556137|3.556137	0.65425|0.65425	.|.	.|.	ENSG00000128512|ENSG00000128512	ENST00000352877;ENST00000428084;ENST00000437633;ENST00000342288;ENST00000544250|ENST00000423057;ENST00000445943	T;T|.	0.03272|.	3.99;4.0|.	5.23|5.23	5.23|5.23	0.72850|0.72850	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.75027|0.75027	0.3794|0.3794	M|M	0.69463|0.69463	2.115|2.115	0.80722|0.80722	D|D	1|1	P;P;P;P|.	0.49783|.	0.928;0.671;0.468;0.663|.	P;B;B;B|.	0.46975|.	0.533;0.302;0.225;0.346|.	T|T	0.73241|0.73241	-0.4045|-0.4045	10|5	0.36615|.	T|.	0.2|.	.|.	18.9943|18.9943	0.92806|0.92806	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	784;784;784;784|.	Q149N2;Q149N5;Q8N1I0;Q8N1I0-2|.	.;.;DOCK4_HUMAN;.|.	G|A	772;784;784;772;783|236;772	ENSP00000410746:A784G;ENSP00000404179:A784G|.	ENSP00000345432:A772G|.	A|P	-|-	2|1	0|0	DOCK4|DOCK4	111290786|111290786	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.878000|0.878000	0.50629|0.50629	9.657000|9.657000	0.98554|0.98554	2.706000|2.706000	0.92434|0.92434	0.563000|0.563000	0.77884|0.77884	GCC|CCA	DOCK4	-	NULL	ENSG00000128512		0.493	DOCK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK4	HGNC	protein_coding	OTTHUMT00000338369.4	-	0.00	45	0	G	NM_014705		111503550	-1	tier1	-	no_errors	ENST00000428084	ensembl	human	known	74_37	missense	52.27	21	23	SNP	1.000	C
DOCK7	85440	genome.wustl.edu	37	1	62941485	62941485	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr1:62941485G>A	ENST00000340370.5	-	45	5778	c.5761C>T	c.(5761-5763)Cgt>Tgt	p.R1921C	DOCK7_ENST00000251157.5_Missense_Mutation_p.R1941C|DOCK7_ENST00000489185.1_5'UTR	NM_033407.2	NP_212132.2	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7	1952	DHR-2.				activation of Rac GTPase activity (GO:0032863)|axonogenesis (GO:0007409)|establishment of neuroblast polarity (GO:0045200)|hematopoietic progenitor cell differentiation (GO:0002244)|interkinetic nuclear migration (GO:0022027)|microtubule cytoskeleton organization (GO:0000226)|neuron projection development (GO:0031175)|pigmentation (GO:0043473)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of neurogenesis (GO:0050767)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|basal part of cell (GO:0045178)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|neuron projection (GO:0043005)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac GTPase binding (GO:0048365)	p.R1921C(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(19)|lung(42)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	92						CCATGGGCACGGCCATCTAAA	0.383																																																	1	Substitution - Missense(1)	lung(1)											166.0	160.0	162.0					1																	62941485		2203	4300	6503	SO:0001583	missense	0				CCDS30734.1, CCDS60156.1, CCDS60157.1	1p32.1	2008-02-05			ENSG00000116641	ENSG00000116641			19190	protein-coding gene	gene with protein product		615730				12432077	Standard	NM_033407		Approved	KIAA1771, ZIR2	uc001daq.4	Q96N67	OTTHUMG00000013131	ENST00000340370.5:c.5761C>T	1.37:g.62941485G>A	ENSP00000340742:p.Arg1921Cys		Q00M63|Q2PPY7|Q45RE8|Q45RE9|Q5T1B9|Q5T1C0|Q6ZV32|Q8TB82|Q96NG6|Q96NI0|Q9C092	Missense_Mutation	SNP	pfam_DOCK_C,pfam_DOCK_C/D_N,superfamily_ARM-type_fold	p.R1941C	ENST00000340370.5	37	c.5821	CCDS30734.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.3|21.3	4.134579|4.134579	0.77662|0.77662	.|.	.|.	ENSG00000116641|ENSG00000116641	ENST00000454575|ENST00000371140;ENST00000251157;ENST00000340370;ENST00000395441	.|T;T	.|0.19394	.|2.15;2.15	5.72|5.72	5.72|5.72	0.89469|0.89469	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.52419|0.52419	0.1733|0.1733	M|M	0.88842|0.88842	2.985|2.985	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0;1.0;1.0	.|D;D;D;D;D;D	.|0.97110	.|0.999;0.998;0.999;0.999;1.0;0.997	T|T	0.59182|0.59182	-0.7502|-0.7502	5|10	.|0.87932	.|D	.|0	.|.	13.3684|13.3684	0.60698|0.60698	0.0:0.0:0.7248:0.2752|0.0:0.0:0.7248:0.2752	.|.	.|1952;1941;1921;1910;1912;1943	.|Q96N67;Q96N67-2;Q96N67-5;Q96N67-4;Q96N67-3;Q96N67-6	.|DOCK7_HUMAN;.;.;.;.;.	L|C	1114|1952;1941;1921;682	.|ENSP00000251157:R1941C;ENSP00000340742:R1921C	.|ENSP00000251157:R1941C	P|R	-|-	2|1	0|0	DOCK7|DOCK7	62714073|62714073	1.000000|1.000000	0.71417|0.71417	0.952000|0.952000	0.39060|0.39060	0.991000|0.991000	0.79684|0.79684	5.437000|5.437000	0.66544|0.66544	2.717000|2.717000	0.92951|0.92951	0.655000|0.655000	0.94253|0.94253	CCG|CGT	DOCK7	-	pfam_DOCK_C	ENSG00000116641		0.383	DOCK7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK7	HGNC	protein_coding	OTTHUMT00000036806.1		0.00	43	0	G	NM_033407		62941485	-1			no_errors	ENST00000251157	ensembl	human	known	74_37	missense	6.00	47	3	SNP	0.970	A
DOPEY2	9980	genome.wustl.edu	37	21	37605164	37605164	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr21:37605164A>G	ENST00000399151.3	+	15	2498	c.2413A>G	c.(2413-2415)Act>Gct	p.T805A		NM_005128.2	NP_005119.2	Q9Y3R5	DOP2_HUMAN	dopey family member 2	805					cognition (GO:0050890)|endoplasmic reticulum organization (GO:0007029)|Golgi to endosome transport (GO:0006895)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)				autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(6)|lung(25)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						CTGCTGTGTGACTGACTGCTA	0.507																																																	0													154.0	137.0	143.0					21																	37605164		2203	4300	6503	SO:0001583	missense	0			AJ237839	CCDS13643.1	21q22.2	2013-03-05	2006-02-02	2006-02-02	ENSG00000142197	ENSG00000142197			1291	protein-coding gene	gene with protein product		604803	"""chromosome 21 open reading frame 5"""	C21orf5		16301316, 16303751, 10931277	Standard	NM_005128		Approved	KIAA0933	uc002yvg.3	Q9Y3R5	OTTHUMG00000086619	ENST00000399151.3:c.2413A>G	21.37:g.37605164A>G	ENSP00000382104:p.Thr805Ala		D3DSG5|Q6PJQ7|Q9UEZ3	Missense_Mutation	SNP	pfam_Dopey_N	p.T805A	ENST00000399151.3	37	c.2413	CCDS13643.1	21	.	.	.	.	.	.	.	.	.	.	A	12.20	1.865373	0.32977	.	.	ENSG00000142197	ENST00000399151	T	0.66638	-0.22	5.84	1.97	0.26223	.	0.524939	0.23185	N	0.050971	T	0.52451	0.1735	L	0.40543	1.245	0.09310	N	1	B;B	0.20052	0.041;0.024	B;B	0.17433	0.018;0.008	T	0.38243	-0.9670	10	0.33940	T	0.23	.	7.9377	0.29939	0.6306:0.1208:0.0:0.2486	.	805;805	Q9Y3R5-2;Q9Y3R5	.;DOP2_HUMAN	A	805	ENSP00000382104:T805A	ENSP00000382104:T805A	T	+	1	0	DOPEY2	36527034	0.883000	0.30277	0.065000	0.19835	0.995000	0.86356	2.663000	0.46774	0.073000	0.16731	0.528000	0.53228	ACT	DOPEY2	-	NULL	ENSG00000142197		0.507	DOPEY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOPEY2	HGNC	protein_coding	OTTHUMT00000194636.1	-	0.00	49	0	A	NM_005128		37605164	+1	tier1	-	no_errors	ENST00000399151	ensembl	human	known	74_37	missense	65.79	13	25	SNP	0.213	G
DOT1L	84444	genome.wustl.edu	37	19	2213639	2213639	+	Splice_Site	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr19:2213639G>T	ENST00000398665.3	+	17	1695	c.1659G>T	c.(1657-1659)gaG>gaT	p.E553D	AC004490.1_ENST00000585593.1_RNA	NM_032482.2	NP_115871.1	Q8TEK3	DOT1L_HUMAN	DOT1-like histone H3K79 methyltransferase	553					histone lysine methylation (GO:0034968)|regulation of JAK-STAT cascade (GO:0046425)|regulation of transcription regulatory region DNA binding (GO:2000677)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription factor binding (GO:0008134)			NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(2)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(9)	42		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AATTGGATGAGGTAGTGGACC	0.622																																																	0													50.0	55.0	54.0					19																	2213639		2111	4217	6328	SO:0001630	splice_region_variant	0			AF509504	CCDS42460.1	19p13.3	2013-05-21	2013-05-21		ENSG00000104885	ENSG00000104885	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"""	24948	protein-coding gene	gene with protein product	"""histone methyltransferase DOT1L"""	607375	"""DOT1-like, histone H3 methyltransferase (S. cerevisiae)"""			11347906, 12123582	Standard	NM_032482		Approved	KIAA1814, DOT1, KMT4	uc002lvb.4	Q8TEK3	OTTHUMG00000150431	ENST00000398665.3:c.1659+1G>T	19.37:g.2213639G>T			O60379|Q96JL1	Missense_Mutation	SNP	pfam_DOT1,pirsf_Histone_H3-K79_MeTrfase_met	p.E553D	ENST00000398665.3	37	c.1659	CCDS42460.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.25|14.25	2.478686|2.478686	0.44044|0.44044	.|.	.|.	ENSG00000104885|ENSG00000104885	ENST00000398665;ENST00000221482|ENST00000440640	T|.	0.38240|.	1.15|.	4.75|4.75	4.75|4.75	0.60458|0.60458	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.73055|0.73055	0.3538|0.3538	M|M	0.68952|0.68952	2.095|2.095	0.51482|0.51482	D|D	0.999926|0.999926	B|.	0.15930|.	0.015|.	B|.	0.15052|.	0.012|.	T|T	0.73506|0.73506	-0.3961|-0.3961	10|5	0.87932|.	D|.	0|.	-28.8887|-28.8887	16.7514|16.7514	0.85487|0.85487	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	553|.	Q8TEK3-2|.	.|.	D|I	553|340	ENSP00000381657:E553D|.	ENSP00000221482:E553D|.	E|S	+|+	3|2	2|0	DOT1L|DOT1L	2164639|2164639	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.123000|0.123000	0.20343|0.20343	8.612000|8.612000	0.90909|0.90909	2.180000|2.180000	0.69256|0.69256	0.555000|0.555000	0.69702|0.69702	GAG|AGC	DOT1L	-	pirsf_Histone_H3-K79_MeTrfase_met	ENSG00000104885		0.622	DOT1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOT1L	HGNC	protein_coding	OTTHUMT00000318066.1	-	0.00	49	0	G	NM_032482	Missense_Mutation	2213639	+1	tier1	-	no_errors	ENST00000398665	ensembl	human	known	74_37	missense	5.97	63	4	SNP	1.000	T
DST	667	genome.wustl.edu	37	6	56468751	56468751	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr6:56468751C>T	ENST00000361203.3	-	36	10049	c.10042G>A	c.(10042-10044)Gca>Aca	p.A3348T	DST_ENST00000370769.4_Missense_Mutation_p.A3348T|DST_ENST00000244364.6_Intron|DST_ENST00000421834.2_Intron|DST_ENST00000446842.2_Missense_Mutation_p.A3022T|DST_ENST00000312431.6_Missense_Mutation_p.A3348T|DST_ENST00000370788.2_Intron|DST_ENST00000370754.5_Missense_Mutation_p.A3526T			Q03001	DYST_HUMAN	dystonin	3348					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			AATGTTGATGCCCACACAGTA	0.388																																																	0													78.0	72.0	74.0					6																	56468751		1860	4110	5970	SO:0001583	missense	0			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.10042G>A	6.37:g.56468751C>T	ENSP00000354508:p.Ala3348Thr		B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_Plectin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,smart_EF_hand_dom,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.A3526T	ENST00000361203.3	37	c.10576		6	.	.	.	.	.	.	.	.	.	.	C	13.13	2.146194	0.37923	.	.	ENSG00000151914	ENST00000370754;ENST00000370769;ENST00000446842;ENST00000312431;ENST00000361203;ENST00000439203	T;T;T;T;T;T	0.81247	0.02;0.01;0.97;-1.47;-0.01;-0.39	5.75	4.88	0.63580	.	0.886766	0.09407	N	0.806362	T	0.51210	0.1661	.	.	.	0.23510	N	0.997521	B	0.20052	0.041	B	0.17433	0.018	T	0.12528	-1.0544	8	0.16896	T	0.51	.	11.1286	0.48333	0.0:0.8458:0.0:0.1542	.	3022	Q03001-9	.	T	3526;3348;3022;3348;3348;3022	ENSP00000359790:A3526T;ENSP00000359805:A3348T;ENSP00000393645:A3022T;ENSP00000307959:A3348T;ENSP00000354508:A3348T;ENSP00000404924:A3022T	ENSP00000307959:A3348T	A	-	1	0	DST	56576710	0.000000	0.05858	0.004000	0.12327	0.094000	0.18550	-0.492000	0.06467	1.408000	0.46895	0.655000	0.94253	GCA	DST	-	superfamily_ABC1_TM_dom	ENSG00000151914		0.388	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	DST	HGNC	protein_coding	OTTHUMT00000041021.3	-	0.00	43	0	C	NM_001723		56468751	-1	tier1	-	no_errors	ENST00000370754	ensembl	human	known	74_37	missense	5.63	66	4	SNP	0.007	T
DST	667	genome.wustl.edu	37	6	56492824	56492824	+	Silent	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr6:56492824G>T	ENST00000361203.3	-	29	3985	c.3978C>A	c.(3976-3978)acC>acA	p.T1326T	DST_ENST00000370769.4_Silent_p.T1326T|DST_ENST00000244364.6_Silent_p.T1000T|DST_ENST00000370765.6_Silent_p.T1000T|DST_ENST00000421834.2_Silent_p.T1326T|DST_ENST00000446842.2_Silent_p.T1000T|DST_ENST00000312431.6_Silent_p.T1326T|DST_ENST00000370788.2_Silent_p.T1326T|DST_ENST00000518935.1_Silent_p.T1000T|DST_ENST00000370754.5_Silent_p.T1504T			Q03001	DYST_HUMAN	dystonin	1326					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			GTGTGGCTAGGGTTTTACTAT	0.398																																																	0													160.0	151.0	154.0					6																	56492824		2203	4300	6503	SO:0001819	synonymous_variant	0			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.3978C>A	6.37:g.56492824G>T			B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Silent	SNP	pfam_Spectrin_repeat,pfam_Plectin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,smart_EF_hand_dom,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.T1504	ENST00000361203.3	37	c.4512		6																																																																																			DST	-	superfamily_ABC1_TM_dom,smart_Spectrin/alpha-actinin	ENSG00000151914		0.398	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	DST	HGNC	protein_coding	OTTHUMT00000041021.3	-	0.00	77	0	G	NM_001723		56492824	-1	tier1	-	no_errors	ENST00000370754	ensembl	human	known	74_37	silent	6.06	62	4	SNP	0.232	T
DUSP10	11221	genome.wustl.edu	37	1	221875661	221875662	+	3'UTR	INS	-	-	A	rs3215279		TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr1:221875661_221875662insA	ENST00000366899.3	-	0	1779_1780				DUSP10_ENST00000323825.3_3'UTR|DUSP10_ENST00000544095.1_3'UTR|DUSP10_ENST00000468085.1_5'UTR	NM_007207.4	NP_009138.1	Q9Y6W6	DUS10_HUMAN	dual specificity phosphatase 10						inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of respiratory burst involved in inflammatory response (GO:0060266)|oligodendrocyte differentiation (GO:0048709)|protein dephosphorylation (GO:0006470)|regulation of adaptive immune response (GO:0002819)|response to lipopolysaccharide (GO:0032496)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	MAP kinase phosphatase activity (GO:0033549)|MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|phosphatase activity (GO:0016791)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				GBM - Glioblastoma multiforme(131;0.0103)		CTCCCAACTACAAAAAAAAAAA	0.351																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AB026436	CCDS1528.1	1q41	2011-06-09			ENSG00000143507	ENSG00000143507		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3065	protein-coding gene	gene with protein product		608867				10391943, 10597297	Standard	NM_007207		Approved	MKP-5, MKP5	uc001hmy.2	Q9Y6W6	OTTHUMG00000037269	ENST00000366899.3:c.*93->T	1.37:g.221875672_221875672dupA			D3DTB4|Q6GSI4|Q9H9Z5	RNA	INS	-	NULL	ENST00000366899.3	37	NULL	CCDS1528.1	1																																																																																			DUSP10	-	-	ENSG00000143507		0.351	DUSP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP10	HGNC	protein_coding	OTTHUMT00000090716.1		0.00	12	0	-	NM_007207		221875662	-1	tier1		no_errors	ENST00000468085	ensembl	human	known	74_37	rna	10.34	26	3	INS	0.001:0.040	A
DYNC2H1	79659	genome.wustl.edu	37	11	103027455	103027455	+	Silent	SNP	G	G	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr11:103027455G>A	ENST00000375735.2	+	26	4227	c.4083G>A	c.(4081-4083)ttG>ttA	p.L1361L	DYNC2H1_ENST00000334267.7_Intron|DYNC2H1_ENST00000398093.3_Silent_p.L1361L	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	1361	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		GTGGAGCATTGCCAAAAGAAC	0.358																																																	0													55.0	55.0	55.0					11																	103027455		1848	4089	5937	SO:0001819	synonymous_variant	0			AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.4083G>A	11.37:g.103027455G>A			O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Silent	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.L1361	ENST00000375735.2	37	c.4083	CCDS53701.1	11																																																																																			DYNC2H1	-	pfam_Dynein_heavy_dom-2	ENSG00000187240		0.358	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC2H1	HGNC	protein_coding	OTTHUMT00000387196.1	-	0.00	40	0	G	XM_370652		103027455	+1	tier1	-	no_errors	ENST00000398093	ensembl	human	known	74_37	silent	17.65	14	3	SNP	0.999	A
EDC4	23644	genome.wustl.edu	37	16	67910487	67910487	+	Silent	SNP	C	C	G			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr16:67910487C>G	ENST00000358933.5	+	3	575	c.336C>G	c.(334-336)gcC>gcG	p.A112A	EDC4_ENST00000574770.1_3'UTR|AC040162.1_ENST00000408599.1_RNA	NM_014329.4	NP_055144.3	Q6P2E9	EDC4_HUMAN	enhancer of mRNA decapping 4	112					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(4)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	41		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)		CAAGCAAGGCCCGGGGAAGCA	0.532																																																	0													73.0	63.0	66.0					16																	67910487		2198	4300	6498	SO:0001819	synonymous_variant	0			U17474	CCDS10849.1	16q22.1	2008-02-05			ENSG00000038358	ENSG00000038358			17157	protein-coding gene	gene with protein product		606030				9067524	Standard	NM_014329		Approved	RCD-8, Ge-1, HEDLS	uc002eur.3	Q6P2E9	OTTHUMG00000137543	ENST00000358933.5:c.336C>G	16.37:g.67910487C>G			A6NGM1|A8K4T4|Q13025|Q13826|Q6ZR12|Q7Z6H7	Silent	SNP	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.A112	ENST00000358933.5	37	c.336	CCDS10849.1	16																																																																																			EDC4	-	superfamily_WD40_repeat_dom	ENSG00000038358		0.532	EDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EDC4	HGNC	protein_coding	OTTHUMT00000268874.2		0.00	31	0	C	NM_014329		67910487	+1			no_errors	ENST00000358933	ensembl	human	known	74_37	silent	15.79	16	3	SNP	0.825	G
EFTUD1P1	648809	genome.wustl.edu	37	15	84759002	84759003	+	RNA	DNP	GA	GA	TG			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G|A	G|A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr15:84759002_84759003GA>TG	ENST00000558187.1	+	0	369_370									elongation factor Tu GTP binding domain containing 1 pseudogene 1																		AGATCCGAGGGATCACTATGAA	0.381																																																	0																																												0					15q25.2	2012-07-04	2012-07-04	2012-07-04	ENSG00000259404	ENSG00000259404			31739	pseudogene	pseudogene	"""similar to hypothetical protein FLJ13119"""		"""family with sequence similarity 42, member B"""	FAM42B			Standard	NR_036652		Approved	HsT19321	uc021stg.1		OTTHUMG00000172493	Exception_encountered	15.37:g.84759002_84759003delinsTG				RNA	SNP	-	NULL	ENST00000558187.1	37	NULL		15																																																																																			EFTUD1P1	-	-	ENSG00000259404		0.381	EFTUD1P1-001	KNOWN	basic	processed_transcript	EFTUD1P1	HGNC	pseudogene	OTTHUMT00000418794.1	-	0.00	65	0	G|A	NR_036652		84759002|84759003	+1	tier1	-	no_errors	ENST00000558187	ensembl	human	known	74_37	rna	28.79|32.35	46	19|22	SNP	0.987|1.000	T|G
EHMT1	79813	genome.wustl.edu	37	9	140638394	140638394	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr9:140638394G>T	ENST00000460843.1	+	6	1049	c.1022G>T	c.(1021-1023)gGg>gTg	p.G341V	EHMT1_ENST00000462484.1_Missense_Mutation_p.G341V|EHMT1_ENST00000334856.6_Missense_Mutation_p.G310V|EHMT1_ENST00000371394.2_3'UTR	NM_024757.4	NP_079033.4	Q9H9B1	EHMT1_HUMAN	euchromatic histone-lysine N-methyltransferase 1	341					chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|embryo development (GO:0009790)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine dimethylation (GO:0018027)|peptidyl-lysine monomethylation (GO:0018026)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	histone methyltransferase activity (H3-K27 specific) (GO:0046976)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|methyltransferase activity (GO:0008168)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	41	all_cancers(76;0.164)			OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)		CACGTGAATGGGGAGAGCCTG	0.622																																																	0													46.0	40.0	42.0					9																	140638394		2203	4300	6503	SO:0001583	missense	0			AY083210	CCDS7050.1, CCDS7050.2, CCDS56595.1	9q34.3	2013-09-20			ENSG00000181090	ENSG00000181090	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"", ""Ankyrin repeat domain containing"""	24650	protein-coding gene	gene with protein product		607001	"""euchromatic histone methyltransferase 1"""			11347906, 12004135	Standard	NM_024757		Approved	Eu-HMTase1, FLJ12879, KIAA1876, bA188C12.1, KMT1D	uc011mfc.2	Q9H9B1	OTTHUMG00000020995	ENST00000460843.1:c.1022G>T	9.37:g.140638394G>T	ENSP00000417980:p.Gly341Val		B1AQ58|B1AQ59|Q86X08|Q8TCN7|Q96F53|Q96JF1|Q96KH4	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SET_dom,pfam_Pre-SET_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Pre-SET_Zn-bd_sub,smart_SET_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SET_dom,pfscan_Pre-SET_dom,prints_Ankyrin_rpt	p.G341V	ENST00000460843.1	37	c.1022	CCDS7050.2	9	.	.	.	.	.	.	.	.	.	.	G	22.0	4.232725	0.79688	.	.	ENSG00000181090	ENST00000334856;ENST00000371400;ENST00000462484;ENST00000460843	T;T;T	0.45276	0.9;0.9;0.9	5.42	5.42	0.78866	.	0.051656	0.85682	D	0.000000	T	0.65417	0.2689	M	0.67953	2.075	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	T	0.67929	-0.5543	10	0.87932	D	0	.	19.214	0.93768	0.0:0.0:1.0:0.0	.	341;310;341	Q9H9B1;Q9H9B1-2;Q9H9B1-4	EHMT1_HUMAN;.;.	V	310;310;341;341	ENSP00000334476:G310V;ENSP00000417328:G341V;ENSP00000417980:G341V	ENSP00000334476:G310V	G	+	2	0	EHMT1	139758215	1.000000	0.71417	0.989000	0.46669	0.589000	0.36550	7.840000	0.86819	2.539000	0.85634	0.561000	0.74099	GGG	EHMT1	-	NULL	ENSG00000181090		0.622	EHMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHMT1	HGNC	protein_coding	OTTHUMT00000055371.2	-	0.00	62	0	G	NM_024757		140638394	+1	tier1	-	no_errors	ENST00000460843	ensembl	human	known	74_37	missense	12.20	36	5	SNP	1.000	T
EIF4G2	1982	genome.wustl.edu	37	11	10830442	10830442	+	5'UTR	SNP	C	C	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr11:10830442C>A	ENST00000339995.5	-	0	215				EIF4G2_ENST00000396525.2_5'Flank|EIF4G2_ENST00000525995.1_5'Flank|EIF4G2_ENST00000526148.1_5'Flank|RP11-685M7.3_ENST00000499765.1_RNA|EIF4G2_ENST00000525681.1_5'Flank	NM_001418.3	NP_001409			eukaryotic translation initiation factor 4 gamma, 2											NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	43				all cancers(16;2.8e-07)|Epithelial(150;4.18e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)		GTACCCGCTGCCACCTCCATA	0.607																																																	0																																										SO:0001623	5_prime_UTR_variant	0			U73824	CCDS31428.1, CCDS41618.1	11p15	2005-09-29			ENSG00000110321	ENSG00000110321			3297	protein-coding gene	gene with protein product		602325				9030685, 9032289	Standard	NM_001042559		Approved	DAP5, NAT1, p97	uc001mjc.3	P78344	OTTHUMG00000165823	ENST00000339995.5:c.-277G>T	11.37:g.10830442C>A				RNA	SNP	-	NULL	ENST00000339995.5	37	NULL	CCDS31428.1	11																																																																																			EIF4G2	-	-	ENSG00000110321		0.607	EIF4G2-001	KNOWN	non_ATG_start|basic|CCDS	protein_coding	EIF4G2	HGNC	protein_coding	OTTHUMT00000386384.3	-	0.00	185	0	C	NM_001418		10830442	-1	tier1	-	no_errors	ENST00000525972	ensembl	human	known	74_37	rna	28.70	82	33	SNP	1.000	A
ELF3	1999	genome.wustl.edu	37	1	201981984	201981984	+	Intron	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr1:201981984G>T	ENST00000359651.3	+	5	3790				ELF3_ENST00000367283.3_Intron|ELF3_ENST00000367284.5_Intron|RP11-510N19.5_ENST00000504773.1_RNA|RP11-465N4.4_ENST00000419190.1_RNA					E74-like factor 3 (ets domain transcription factor, epithelial-specific )											breast(2)|endometrium(2)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	20						GGCAGGAACAGGAACAGGCTG	0.637																																																	0																																										SO:0001627	intron_variant	0			AF016295	CCDS1419.1	1q32.2	2008-02-05			ENSG00000163435	ENSG00000163435			3318	protein-coding gene	gene with protein product		602191		ESX		9395241, 9129154	Standard	NM_001114309		Approved	EPR-1, ESE-1, ERT	uc001gxh.4	P78545	OTTHUMG00000035867	ENST00000359651.3:c.599-91G>T	1.37:g.201981984G>T				Splice_Site	SNP	-	NULL	ENST00000359651.3	37	c.NULL	CCDS1419.1	1																																																																																			ELF3	-	-	ENSG00000163435		0.637	ELF3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ELF3	HGNC	protein_coding	OTTHUMT00000087360.1	-	0.00	55	0	G	NM_004433		201981984	+1	tier1	-	no_errors	ENST00000479874	ensembl	human	known	74_37	splice_site	9.09	40	4	SNP	0.006	T
ELFN2	114794	genome.wustl.edu	37	22	37770857	37770857	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr22:37770857C>T	ENST00000402918.2	-	3	1503	c.718G>A	c.(718-720)Gta>Ata	p.V240I	ELFN2_ENST00000435824.1_5'Flank|RP1-63G5.5_ENST00000430883.1_RNA|RP1-63G5.8_ENST00000609322.1_RNA	NM_052906.3	NP_443138.2	Q5R3F8	PPR29_HUMAN	extracellular leucine-rich repeat and fibronectin type III domain containing 2	240	LRRCT.				negative regulation of phosphatase activity (GO:0010923)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(13)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	35	Melanoma(58;0.0574)					GCCTGGAGTACGGTGATGGCG	0.682																																																	0													35.0	45.0	41.0					22																	37770857		2203	4299	6502	SO:0001583	missense	0			BC041596	CCDS33642.1	22q13.1	2013-02-11	2011-10-27	2011-10-27	ENSG00000166897	ENSG00000166897		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"""	29396	protein-coding gene	gene with protein product			"""leucine rich repeat containing 62"", ""extracellular leucine-rich repeat and fibronectin type III containing 2"", ""extracellular leucine-rich repeat and fibronectin type III domain containing 2"", ""protein phosphatase 1, regulatory subunit 29"""	LRRC62, PPP1R29		17868438	Standard	XR_244427		Approved	dJ63G5.3, KIAA1904	uc003asq.4	Q5R3F8	OTTHUMG00000150558	ENST00000402918.2:c.718G>A	22.37:g.37770857C>T	ENSP00000385277:p.Val240Ile		Q96PY3	Missense_Mutation	SNP	superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,pfscan_LPXTG_anchor	p.V240I	ENST00000402918.2	37	c.718	CCDS33642.1	22	.	.	.	.	.	.	.	.	.	.	C	4.416	0.076909	0.08485	.	.	ENSG00000166897	ENST00000349653;ENST00000402918	T;T	0.48522	0.81;0.81	4.96	3.93	0.45458	.	0.209199	0.40302	N	0.001128	T	0.18800	0.0451	N	0.01705	-0.755	0.33961	D	0.64557	B	0.09022	0.002	B	0.04013	0.001	T	0.18085	-1.0348	10	0.23891	T	0.37	-25.424	7.9926	0.30250	0.0:0.8107:0.0:0.1893	.	240	Q5R3F8	PPR29_HUMAN	I	240	ENSP00000300147:V240I;ENSP00000385277:V240I	ENSP00000300147:V240I	V	-	1	0	ELFN2	36100803	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	3.868000	0.56055	2.468000	0.83385	0.609000	0.83330	GTA	ELFN2	-	NULL	ENSG00000166897		0.682	ELFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELFN2	HGNC	protein_coding	OTTHUMT00000318900.2	-	0.00	136	0	C	NM_052906		37770857	-1	tier1	-	no_errors	ENST00000402918	ensembl	human	known	74_37	missense	45.04	71	59	SNP	1.000	T
ELN	2006	genome.wustl.edu	37	7	73456951	73456951	+	Silent	SNP	C	C	G	rs138649857		TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr7:73456951C>G	ENST00000252034.7	+	6	639	c.240C>G	c.(238-240)ggC>ggG	p.G80G	ELN_ENST00000380576.5_Silent_p.G80G|ELN_ENST00000320399.6_Silent_p.G80G|ELN_ENST00000380562.4_Silent_p.G80G|ELN_ENST00000429192.1_Silent_p.G80G|ELN_ENST00000320492.7_Silent_p.G68G|ELN_ENST00000358929.4_Silent_p.G80G|ELN_ENST00000414324.1_Silent_p.G70G|ELN_ENST00000458204.1_Silent_p.G70G|ELN_ENST00000357036.5_Silent_p.G80G|ELN_ENST00000380553.4_Intron|ELN_ENST00000445912.1_Silent_p.G80G|ELN_ENST00000380584.4_Silent_p.G80G|ELN_ENST00000380575.4_Silent_p.G70G	NM_000501.2|NM_001278915.1	NP_000492.2|NP_001265844.1	P15502	ELN_HUMAN	elastin	80					blood circulation (GO:0008015)|blood vessel remodeling (GO:0001974)|cell proliferation (GO:0008283)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|organ morphogenesis (GO:0009887)|regulation of actin filament polymerization (GO:0030833)|respiratory gaseous exchange (GO:0007585)|skeletal muscle tissue development (GO:0007519)|stress fiber assembly (GO:0043149)	elastic fiber (GO:0071953)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(10)|ovary(4)|pancreas(2)|prostate(1)|skin(2)|stomach(1)	32		Lung NSC(55;0.159)				CAGGGCTCGGCGCCTTCCCCG	0.632			T	PAX5	B-ALL		"""Supravalvular Aortic Stenosis, Cutis laxa , Williams-Beuren Syndrome"""																																	Dom	yes		7	7q11.23	2006	elastin	yes	L	0													63.0	63.0	63.0					7																	73456951		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS5562.2, CCDS43598.1, CCDS43599.1, CCDS47611.1, CCDS47612.1, CCDS64673.1, CCDS64674.1, CCDS64675.1, CCDS64676.1, CCDS64677.1, CCDS64678.1, CCDS75616.1, CCDS75617.1	7q11.1-q21.1	2008-08-01	2008-08-01		ENSG00000049540	ENSG00000049540			3327	protein-coding gene	gene with protein product	"""tropoelastin"", ""supravalvular aortic stenosis"", ""Williams-Beuren syndrome"""	130160				8096434	Standard	NM_001278939		Approved	WBS, WS, SVAS	uc003tzn.3	P15502	OTTHUMG00000150229	ENST00000252034.7:c.240C>G	7.37:g.73456951C>G			B3KTS6|O15336|O15337|Q14233|Q14234|Q14235|Q14238|Q6P0L4|Q6ZWJ6|Q75MU5|Q7Z316|Q7Z3F5|Q9UMF5	Silent	SNP	prints_Tropoelastin	p.G80	ENST00000252034.7	37	c.240	CCDS5562.2	7																																																																																			ELN	-	NULL	ENSG00000049540		0.632	ELN-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ELN	HGNC	protein_coding	OTTHUMT00000316913.1	-	0.00	69	0	C	NM_000501		73456951	+1	tier1	-	no_errors	ENST00000358929	ensembl	human	known	74_37	silent	44.00	56	44	SNP	0.000	G
EMILIN2	84034	genome.wustl.edu	37	18	2891505	2891505	+	Silent	SNP	G	G	T	rs371719195		TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr18:2891505G>T	ENST00000254528.3	+	4	1539	c.1380G>T	c.(1378-1380)acG>acT	p.T460T		NM_032048.2	NP_114437.2	Q9BXX0	EMIL2_HUMAN	elastin microfibril interfacer 2	460					cell adhesion (GO:0007155)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix constituent conferring elasticity (GO:0030023)			breast(2)|endometrium(5)|kidney(3)|large_intestine(8)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(4)	48				READ - Rectum adenocarcinoma(2;0.1)		TCAATGTGACGGAGAAGAACG	0.448																																																	0													103.0	109.0	107.0					18																	2891505		2203	4300	6503	SO:0001819	synonymous_variant	0			AF270513	CCDS11828.1	18p11.3	2008-02-05			ENSG00000132205	ENSG00000132205		"""EMI domain containing"""	19881	protein-coding gene	gene with protein product		608928					Standard	NM_032048		Approved	FLJ33200, FOAP-10	uc002kln.3	Q9BXX0	OTTHUMG00000128525	ENST00000254528.3:c.1380G>T	18.37:g.2891505G>T			B2RMY3|Q8NBH3|Q96JQ4	Silent	SNP	pfam_EMI_domain,pfam_C1q,superfamily_Tumour_necrosis_fac-like_dom,smart_C1q,pfscan_C1q,pfscan_EMI_domain	p.T460	ENST00000254528.3	37	c.1380	CCDS11828.1	18																																																																																			EMILIN2	-	NULL	ENSG00000132205		0.448	EMILIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMILIN2	HGNC	protein_coding	OTTHUMT00000250337.2		0.00	30	0	G	NM_032048		2891505	+1			no_errors	ENST00000254528	ensembl	human	known	74_37	silent	5.26	36	2	SNP	0.555	T
ENOX1	55068	genome.wustl.edu	37	13	43986988	43986988	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr13:43986988C>G	ENST00000261488.6	-	4	640	c.63G>C	c.(61-63)atG>atC	p.M21I	ENOX1_ENST00000412891.1_Missense_Mutation_p.M21I	NM_001242863.1|NM_017993.3	NP_001229792.1|NP_060463.2	Q8TC92	ENOX1_HUMAN	ecto-NOX disulfide-thiol exchanger 1	21					rhythmic process (GO:0048511)	extracellular region (GO:0005576)|plasma membrane (GO:0005886)	nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|oxidoreductase activity (GO:0016491)			breast(1)|endometrium(3)|large_intestine(7)|lung(18)|pancreas(2)|prostate(1)|skin(1)|urinary_tract(1)	34		Lung NSC(96;0.000518)|Prostate(109;0.0233)|Hepatocellular(98;0.0268)|Lung SC(185;0.0367)|Breast(139;0.0406)		GBM - Glioblastoma multiforme(144;0.00333)|BRCA - Breast invasive adenocarcinoma(63;0.172)		TACCTGCAGCCATCATCTGAG	0.473																																																	0													118.0	107.0	111.0					13																	43986988		2203	4300	6503	SO:0001583	missense	0			EF432052	CCDS9389.1	13q14.11	2013-02-12			ENSG00000120658	ENSG00000120658		"""RNA binding motif (RRM) containing"""	25474	protein-coding gene	gene with protein product		610914				11360993	Standard	NM_001127615		Approved	FLJ10094, PIG38, CNOX, cCNOX	uc001uza.4	Q8TC92	OTTHUMG00000016818	ENST00000261488.6:c.63G>C	13.37:g.43986988C>G	ENSP00000261488:p.Met21Ile		A4GU15|A6NMH9|B7Z5K1|Q2TU81|Q5VT11|Q9NWE0	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.M21I	ENST00000261488.6	37	c.63	CCDS9389.1	13	.	.	.	.	.	.	.	.	.	.	C	15.42	2.828459	0.50845	.	.	ENSG00000120658	ENST00000261488;ENST00000412891	T;T	0.39997	1.05;1.05	5.91	5.91	0.95273	.	0.127165	0.53938	D	0.000043	T	0.31918	0.0812	N	0.08118	0	0.80722	D	1	P	0.35872	0.525	B	0.42214	0.38	T	0.15206	-1.0445	10	0.30854	T	0.27	.	17.4545	0.87603	0.0:1.0:0.0:0.0	.	21	Q8TC92	ENOX1_HUMAN	I	21	ENSP00000261488:M21I;ENSP00000415054:M21I	ENSP00000261488:M21I	M	-	3	0	ENOX1	42884988	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.523000	0.60545	2.793000	0.96121	0.655000	0.94253	ATG	ENOX1	-	NULL	ENSG00000120658		0.473	ENOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENOX1	HGNC	protein_coding	OTTHUMT00000044717.2	-	0.00	74	0	C	NM_017993		43986988	-1	tier1	-	no_errors	ENST00000261488	ensembl	human	known	74_37	missense	24.44	34	11	SNP	1.000	G
ENPP1	5167	genome.wustl.edu	37	6	132172330	132172330	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr6:132172330C>A	ENST00000360971.2	+	4	499	c.479C>A	c.(478-480)aCc>aAc	p.T160N		NM_006208.2	NP_006199.2	P22413	ENPP1_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 1	160	SMB 2. {ECO:0000255|PROSITE- ProRule:PRU00350}.				3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|ATP catabolic process (GO:0006200)|biomineral tissue development (GO:0031214)|bone remodeling (GO:0046849)|cellular phosphate ion homeostasis (GO:0030643)|cellular response to insulin stimulus (GO:0032869)|generation of precursor metabolites and energy (GO:0006091)|immune response (GO:0006955)|inorganic diphosphate transport (GO:0030505)|negative regulation of cell growth (GO:0030308)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of glucose import (GO:0046325)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of ossification (GO:0030279)|negative regulation of protein autophosphorylation (GO:0031953)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleoside triphosphate catabolic process (GO:0009143)|phosphate-containing compound metabolic process (GO:0006796)|regulation of bone mineralization (GO:0030500)|riboflavin metabolic process (GO:0006771)|sequestering of triglyceride (GO:0030730)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|insulin receptor binding (GO:0005158)|NADH pyrophosphatase activity (GO:0035529)|nucleic acid binding (GO:0003676)|nucleoside-triphosphate diphosphatase activity (GO:0047429)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|protein homodimerization activity (GO:0042803)|scavenger receptor activity (GO:0005044)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(22)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	46	Breast(56;0.0505)			GBM - Glioblastoma multiforme(226;0.0216)|OV - Ovarian serous cystadenocarcinoma(155;0.022)	Amifostine(DB01143)|Ribavirin(DB00811)	AAAAGGTTGACCAGAAGCCTC	0.453																																					Colon(104;336 1535 5856 11019 33782)												0													156.0	147.0	150.0					6																	132172330		2203	4300	6503	SO:0001583	missense	0			M57736	CCDS5150.2	6q22-q23	2008-02-07			ENSG00000197594	ENSG00000197594	3.1.4.1, 3.6.1.9		3356	protein-coding gene	gene with protein product		173335		NPPS, M6S1, PDNP1		1315502	Standard	NM_006208		Approved	PC-1, PCA1	uc011ecf.2	P22413	OTTHUMG00000015572	ENST00000360971.2:c.479C>A	6.37:g.132172330C>A	ENSP00000354238:p.Thr160Asn		Q5T9R6|Q9NPZ3|Q9P1P6|Q9UP61|Q9Y6K3	Missense_Mutation	SNP	pfam_Phosphodiest/P_Trfase,pfam_Somatomedin_B_dom,pfam_DNA/RNA_non-sp_Endonuclease,superfamily_Alkaline_phosphatase_core,smart_Somatomedin_B_dom,smart_DNA/RNA_non-sp_Endonuclease,smart_Extracellular_endonuc_su_A,pfscan_Somatomedin_B_dom,prints_Somatomedin_B_chordata	p.T160N	ENST00000360971.2	37	c.479	CCDS5150.2	6	.	.	.	.	.	.	.	.	.	.	C	6.584	0.476051	0.12521	.	.	ENSG00000197594	ENST00000360971	T	0.42513	0.97	5.55	2.82	0.32997	Somatomedin B domain (3);	0.857107	0.10062	N	0.720798	T	0.11153	0.0272	N	0.08118	0	0.09310	N	1	B	0.20671	0.047	B	0.33121	0.158	T	0.43491	-0.9388	10	0.45353	T	0.12	1.364	8.0261	0.30438	0.0:0.7233:0.1325:0.1442	.	160	P22413	ENPP1_HUMAN	N	160	ENSP00000354238:T160N	ENSP00000354238:T160N	T	+	2	0	ENPP1	132214023	0.016000	0.18221	0.001000	0.08648	0.531000	0.34715	1.535000	0.36061	0.307000	0.22880	-1.031000	0.02408	ACC	ENPP1	-	pfam_Somatomedin_B_dom,smart_Somatomedin_B_dom,pfscan_Somatomedin_B_dom	ENSG00000197594		0.453	ENPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENPP1	HGNC	protein_coding	OTTHUMT00000042238.2	-	0.00	62	0	C			132172330	+1	tier1	-	no_errors	ENST00000360971	ensembl	human	known	74_37	missense	28.77	52	21	SNP	0.001	A
CD37	951	genome.wustl.edu	37	19	49843497	49843497	+	Intron	SNP	T	T	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr19:49843497T>A	ENST00000323906.4	+	8	909				CD37_ENST00000426897.2_Intron|CTC-301O7.4_ENST00000358234.4_lincRNA	NM_001774.2	NP_001765.1	P11049	CD37_HUMAN	CD37 molecule						defense response to protozoan (GO:0042832)|negative regulation of cell proliferation (GO:0008285)|negative regulation of myeloid dendritic cell activation (GO:0030886)|positive regulation of immunoglobulin production (GO:0002639)|regulation of defense response to virus (GO:0050688)|regulation of humoral immune response (GO:0002920)	extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|endometrium(1)|large_intestine(3)|lung(5)|upper_aerodigestive_tract(1)	11		all_lung(116;2.81e-06)|Lung NSC(112;5.89e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00088)|GBM - Glioblastoma multiforme(486;0.0443)		CCTCATCTCCTTTCTCTATAG	0.612																																																	0													133.0	109.0	117.0					19																	49843497		2203	4300	6503	SO:0001627	intron_variant	0				CCDS12760.1, CCDS46139.1	19p13-q13.4	2013-02-14	2006-03-28			ENSG00000104894		"""CD molecules"", ""Tetraspanins"""	1666	protein-coding gene	gene with protein product		151523	"""CD37 antigen"""			8436422	Standard	XM_005259435		Approved	TSPAN26	uc002pnd.3	P11049		ENST00000323906.4:c.769-11T>A	19.37:g.49843497T>A			B4DVC1|Q3KPF9	RNA	SNP	-	NULL	ENST00000323906.4	37	NULL	CCDS12760.1	19																																																																																			CTC-301O7.4	-	-	ENSG00000197813		0.612	CD37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000197813	Clone_based_vega_gene	protein_coding	OTTHUMT00000465532.1	-	0.00	47	0	T			49843497	-1	tier1	-	no_errors	ENST00000358234	ensembl	human	known	74_37	rna	10.53	34	4	SNP	1.000	A
CBFA2T3	863	genome.wustl.edu	37	16	89017062	89017062	+	Intron	SNP	C	C	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr16:89017062C>T	ENST00000268679.4	-	1	548				RP11-830F9.6_ENST00000378347.2_Missense_Mutation_p.S179F|CBFA2T3_ENST00000360302.2_Intron|CBFA2T3_ENST00000436887.2_Intron|CBFA2T3_ENST00000448839.1_Intron	NM_005187.5	NP_005178.4	O75081	MTG16_HUMAN	core-binding factor, runt domain, alpha subunit 2; translocated to, 3						cell proliferation (GO:0008283)|granulocyte differentiation (GO:0030851)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	17				BRCA - Breast invasive adenocarcinoma(80;0.0275)		TGGCACCTGTCTTCCGGATCT	0.647			T	RUNX1	AML																																			Dom	yes		16	16q24	863	"""core-binding factor, runt domain, alpha subunit 2; translocated to, 3 (MTG-16)"""		L	0																																										SO:0001627	intron_variant	0			AF052213	CCDS10972.1, CCDS10973.1	16q24	2013-10-16			ENSG00000129993	ENSG00000129993		"""Zinc fingers, MYND-type"", ""A-kinase anchor proteins"""	1537	protein-coding gene	gene with protein product	"""myeloid translocation gene 8 and 16b"""	603870				9790752, 20150326	Standard	NM_005187		Approved	MTGR2, ZMYND4, MTG16	uc002fmm.2	O75081	OTTHUMG00000137864	ENST00000268679.4:c.151+26002G>A	16.37:g.89017062C>T			D3DX78|O60615|O60616|O60617|O75082|O75107|O75108|Q0P5Z6|Q6P5W6	Missense_Mutation	SNP	NULL	p.S179F	ENST00000268679.4	37	c.536	CCDS10972.1	16	.	.	.	.	.	.	.	.	.	.	-	0.746	-0.774629	0.02951	.	.	ENSG00000205018	ENST00000378347	.	.	.	.	.	.	.	.	.	.	.	T	0.30135	0.0755	.	.	.	0.18873	N	0.999986	.	.	.	.	.	.	T	0.32534	-0.9903	4	0.62326	D	0.03	.	2.6649	0.05041	0.0:0.5123:0.0:0.4877	.	.	.	.	F	179	.	ENSP00000367598:S179F	S	+	2	0	AC092384.1	87544563	0.070000	0.21116	0.025000	0.17156	0.025000	0.11179	0.130000	0.15850	0.119000	0.18210	0.121000	0.15741	TCT	RP11-830F9.6	-	NULL	ENSG00000205018		0.647	CBFA2T3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000205018	Clone_based_vega_gene	protein_coding	OTTHUMT00000269545.2	-	0.00	123	0	C	NM_005187		89017062	+1	tier1	-	no_errors	ENST00000378347	ensembl	human	putative	74_37	missense	11.40	101	13	SNP	0.234	T
KRT17P7	339258	genome.wustl.edu	37	17	20424189	20424189	+	RNA	SNP	T	T	C	rs536865756	byFrequency	TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr17:20424189T>C	ENST00000582261.1	-	0	1866																											GCACACTCACTGGGCGTCCTC	0.617													t|||	101	0.0201677	0.0363	0.0202	5008	,	,		12310	0.005		0.0249	False		,,,				2504	0.0092																0																																												0																															17.37:g.20424189T>C				RNA	SNP	-	NULL	ENST00000582261.1	37	NULL		17																																																																																			AC015818.3	-	-	ENSG00000205215		0.617	AC015818.3-002	KNOWN	basic	processed_transcript	ENSG00000205215	Clone_based_vega_gene	pseudogene	OTTHUMT00000443767.1	-	0.00	39	0	T			20424189	-1	tier1	-	no_errors	ENST00000582261	ensembl	human	known	74_37	rna	60.00	4	6	SNP	0.990	C
KCNE2	9992	genome.wustl.edu	37	21	35743430	35743430	+	3'UTR	SNP	C	C	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr21:35743430C>A	ENST00000290310.3	+	0	793				AP000320.6_ENST00000440403.1_RNA	NM_172201.1	NP_751951.1	Q9Y6J6	KCNE2_HUMAN	potassium voltage-gated channel, Isk-related family, member 2						aging (GO:0007568)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cellular protein localization (GO:0034613)|cellular response to drug (GO:0035690)|membrane repolarization (GO:0086009)|membrane repolarization during action potential (GO:0086011)|positive regulation of proteasomal protein catabolic process (GO:1901800)|potassium ion export (GO:0071435)|potassium ion import (GO:0010107)|potassium ion transmembrane transport (GO:0071805)|regulation of cyclic nucleotide-gated ion channel activity (GO:1902159)|regulation of delayed rectifier potassium channel activity (GO:1902259)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of inward rectifier potassium channel activity (GO:1901979)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|tongue development (GO:0043586)|ventricular cardiac muscle cell action potential (GO:0086005)	cell surface (GO:0009986)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|inward rectifier potassium channel activity (GO:0005242)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)			endometrium(1)|large_intestine(1)	2						AAAATAAAGCCAAATTTGAAG	0.358																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF071002	CCDS13635.1	21q22.1	2014-09-17			ENSG00000159197	ENSG00000159197		"""Potassium channels"""	6242	protein-coding gene	gene with protein product		603796				10219239	Standard	NM_172201		Approved	MiRP1, LQT6	uc002ytt.1	Q9Y6J6	OTTHUMG00000086189	ENST00000290310.3:c.*281C>A	21.37:g.35743430C>A			A5H1P3|D3DSF8|Q52LJ5	RNA	SNP	-	NULL	ENST00000290310.3	37	NULL	CCDS13635.1	21																																																																																			AP000320.6	-	-	ENSG00000225555		0.358	KCNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000225555	Clone_based_vega_gene	protein_coding	OTTHUMT00000194068.2	-	0.00	49	0	C			35743430	-1	tier1	-	no_errors	ENST00000440403	ensembl	human	known	74_37	rna	38.71	19	12	SNP	0.009	A
RP11-807H22.5	0	genome.wustl.edu	37	11	71870787	71870787	+	RNA	DEL	C	C	-			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr11:71870787delC	ENST00000542477.2	+	0	611																											CAGCTGACCTCCTTTTACCTT	0.557																																																	0																																												0																															11.37:g.71870787delC				RNA	DEL	-	NULL	ENST00000542477.2	37	NULL		11																																																																																			RP11-807H22.5	-	-	ENSG00000256518		0.557	RP11-807H22.5-002	KNOWN	basic	processed_transcript	ENSG00000256518	Clone_based_vega_gene	pseudogene	OTTHUMT00000396767.2		0.00	20	0	C			71870787	+1	tier1		no_errors	ENST00000542477	ensembl	human	known	74_37	rna	20.51	31	8	DEL	0.003	-
ERVMER61-1	339476	genome.wustl.edu	37	1	187611070	187611070	+	lincRNA	SNP	C	C	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr1:187611070C>A	ENST00000429725.1	+	0	471									endogenous retrovirus group MER61, member 1																		ataagaatccctgtgtatatt	0.358																																																	0																																												0			BC040856		1q31.1	2013-10-11	2011-05-05	2011-05-05	ENSG00000230426	ENSG00000230426			27919	other	endogenous retrovirus			"""chromosome 1 open reading frame 99"""	C1orf99		21542922	Standard			Approved				OTTHUMG00000035624		1.37:g.187611070C>A				RNA	SNP	-	NULL	ENST00000429725.1	37	NULL		1																																																																																			ERVMER61-1	-	-	ENSG00000230426		0.358	ERVMER61-1-001	KNOWN	basic	lincRNA	ERVMER61-1	HGNC	lincRNA	OTTHUMT00000086446.2	-	0.00	34	0	C	NM_001012274		187611070	+1	tier1	-	no_errors	ENST00000429725	ensembl	human	known	74_37	rna	20.69	23	6	SNP	0.038	A
ZNF678	339500	genome.wustl.edu	37	1	227833026	227833026	+	Intron	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr1:227833026G>T	ENST00000343776.5	+	2	182				ZNF678_ENST00000608949.1_Intron|ZNF678_ENST00000465266.1_Intron|AL592310.1_ENST00000580546.1_RNA|ZNF678_ENST00000397097.3_Intron	NM_178549.3	NP_848644.2	Q5SXM1	ZN678_HUMAN	zinc finger protein 678						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(7)|pancreas(1)|prostate(1)	24		Prostate(94;0.0885)				TCGGGTAAATGAGTACTAGGT	0.363																																																	0																																										SO:0001627	intron_variant	0			BC042500		1q42.13	2013-01-08			ENSG00000181450	ENSG00000181450		"""Zinc fingers, C2H2-type"", ""-"""	28652	protein-coding gene	gene with protein product	"""hypothetical protein MGC42493"""					12477932	Standard	NM_178549		Approved	MGC42493	uc021pjy.1	Q5SXM1	OTTHUMG00000037700	ENST00000343776.5:c.-163-1219G>T	1.37:g.227833026G>T			Q8IVQ9	RNA	SNP	-	NULL	ENST00000343776.5	37	NULL		1																																																																																			AL592310.1	-	-	ENSG00000265216		0.363	ZNF678-001	KNOWN	basic	protein_coding	ENSG00000265216	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000091976.2	-	0.00	77	0	G	NM_178549		227833026	+1	tier1	-	no_errors	ENST00000580546	ensembl	human	novel	74_37	rna	44.79	53	43	SNP	0.011	T
F2RL3	9002	genome.wustl.edu	37	19	17000455	17000455	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr19:17000455C>A	ENST00000248076.3	+	2	511	c.181C>A	c.(181-183)Ctg>Atg	p.L61M	F2RL3_ENST00000599210.1_Silent_p.P59P	NM_003950.2	NP_003941.2	Q96RI0	PAR4_HUMAN	coagulation factor II (thrombin) receptor-like 3	61					blood coagulation (GO:0007596)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|platelet activation (GO:0030168)|platelet dense granule organization (GO:0060155)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|response to wounding (GO:0009611)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	thrombin receptor activity (GO:0015057)			cervix(1)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	7						CAGTGACACCCTGGAGCTCCC	0.687																																																	0													44.0	45.0	45.0					19																	17000455		2202	4300	6502	SO:0001583	missense	0			AF055917	CCDS12350.1	19p12	2012-08-08						"""GPCR / Class A : Protease activated receptors"""	3540	protein-coding gene	gene with protein product	"""proteinase-activated receptor-4"""	602779				9618465	Standard	XM_005260139		Approved	PAR4	uc002nfa.3	Q96RI0		ENST00000248076.3:c.181C>A	19.37:g.17000455C>A	ENSP00000248076:p.Leu61Met		O76067|Q6DK42	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Prot_act_rcpt_4,prints_GPCR_Rhodpsn,prints_Protea_act_rcpt	p.L61M	ENST00000248076.3	37	c.181	CCDS12350.1	19	.	.	.	.	.	.	.	.	.	.	C	16.09	3.025090	0.54683	.	.	ENSG00000127533	ENST00000248076	T	0.58797	0.31	3.7	0.221	0.15283	.	0.254138	0.25068	U	0.033391	T	0.56790	0.2009	L	0.29908	0.895	0.09310	N	1	D	0.89917	1.0	D	0.83275	0.996	T	0.43734	-0.9373	10	0.49607	T	0.09	.	5.0446	0.14477	0.0:0.476:0.3308:0.1932	.	61	Q96RI0	PAR4_HUMAN	M	61	ENSP00000248076:L61M	ENSP00000248076:L61M	L	+	1	2	F2RL3	16861455	0.003000	0.15002	0.004000	0.12327	0.233000	0.25261	0.434000	0.21494	0.193000	0.20303	0.491000	0.48974	CTG	F2RL3	-	prints_Prot_act_rcpt_4	ENSG00000127533		0.687	F2RL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F2RL3	HGNC	protein_coding	OTTHUMT00000462875.1		0.00	14	0	C			17000455	+1			no_errors	ENST00000248076	ensembl	human	known	74_37	missense	10.00	36	4	SNP	0.009	A
FAM110B	90362	genome.wustl.edu	37	8	59059063	59059063	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr8:59059063G>A	ENST00000361488.3	+	5	1154	c.274G>A	c.(274-276)Gca>Aca	p.A92T	FAM110B_ENST00000520369.1_Intron	NM_147189.2	NP_671722.1	Q8TC76	F110B_HUMAN	family with sequence similarity 110, member B	92						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(9)|skin(2)	26		all_epithelial(80;0.025)|all_lung(136;0.0274)|Lung NSC(129;0.0355)				TGCCAAGCGCGCACTGGGCAG	0.642																																																	0													32.0	35.0	34.0					8																	59059063		2203	4300	6503	SO:0001583	missense	0			U79298	CCDS6170.1	8q12.1	2007-06-21	2007-03-21	2007-03-21		ENSG00000169122			28587	protein-coding gene	gene with protein product		611394	"""chromosome 8 open reading frame 72"""	C8orf72		8619474, 9110174, 17499476	Standard	XM_005251324		Approved	MGC39325	uc003xtj.1	Q8TC76		ENST00000361488.3:c.274G>A	8.37:g.59059063G>A	ENSP00000355204:p.Ala92Thr		Q5BM08|Q9Y4K2	Missense_Mutation	SNP	NULL	p.A92T	ENST00000361488.3	37	c.274	CCDS6170.1	8	.	.	.	.	.	.	.	.	.	.	G	10.23	1.292953	0.23564	.	.	ENSG00000169122	ENST00000361488	T	0.50001	0.76	5.4	5.4	0.78164	.	0.619004	0.17342	N	0.177735	T	0.36580	0.0972	L	0.29908	0.895	0.39610	D	0.969871	B	0.25486	0.127	B	0.22753	0.041	T	0.16928	-1.0386	9	.	.	.	-20.2756	14.8341	0.70169	0.0:0.0:0.8554:0.1446	.	92	Q8TC76	F110B_HUMAN	T	92	ENSP00000355204:A92T	.	A	+	1	0	FAM110B	59221617	0.585000	0.26774	0.995000	0.50966	0.987000	0.75469	1.791000	0.38744	2.527000	0.85204	0.462000	0.41574	GCA	FAM110B	-	NULL	ENSG00000169122		0.642	FAM110B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM110B	HGNC	protein_coding	OTTHUMT00000378095.2		0.00	77	0	G	NM_147189		59059063	+1			no_errors	ENST00000361488	ensembl	human	known	74_37	missense	5.71	33	2	SNP	0.991	A
FAM186A	121006	genome.wustl.edu	37	12	50749945	50749945	+	Missense_Mutation	SNP	T	T	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr12:50749945T>A	ENST00000327337.5	-	4	669	c.670A>T	c.(670-672)Att>Ttt	p.I224F	FAM186A_ENST00000543111.1_Missense_Mutation_p.I224F	NM_001145475.1	NP_001138947.1	A6NE01	F186A_HUMAN	family with sequence similarity 186, member A	224																	TGATCACTAATCATCTGATCT	0.383																																					NSCLC(138;1796 1887 12511 19463 37884)												0													175.0	142.0	152.0					12																	50749945		692	1591	2283	SO:0001583	missense	0				CCDS44878.1	12q13.13	2009-04-22			ENSG00000185958	ENSG00000185958			26980	protein-coding gene	gene with protein product							Standard	NM_001145475		Approved	LOC121006	uc001rwl.2	A6NE01	OTTHUMG00000167889	ENST00000327337.5:c.670A>T	12.37:g.50749945T>A	ENSP00000329995:p.Ile224Phe			Missense_Mutation	SNP	NULL	p.I224F	ENST00000327337.5	37	c.670	CCDS44878.1	12	.	.	.	.	.	.	.	.	.	.	T	16.15	3.041764	0.55003	.	.	ENSG00000185958	ENST00000543111;ENST00000327337	T;T	0.15603	2.41;2.41	4.47	2.0	0.26442	.	.	.	.	.	T	0.26011	0.0634	L	0.39898	1.24	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.72075	0.976;0.965	T	0.03077	-1.1075	9	0.87932	D	0	.	5.0417	0.14462	0.0:0.0982:0.3634:0.5385	.	224;224	F5GYN0;A6NE01	.;F186A_HUMAN	F	224	ENSP00000441337:I224F;ENSP00000329995:I224F	ENSP00000329995:I224F	I	-	1	0	FAM186A	49036212	1.000000	0.71417	0.994000	0.49952	0.854000	0.48673	1.546000	0.36179	0.319000	0.23209	0.482000	0.46254	ATT	FAM186A	-	NULL	ENSG00000185958		0.383	FAM186A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM186A	HGNC	protein_coding	OTTHUMT00000396838.1	-	0.00	64	0	T	XM_001718353		50749945	-1	tier1	-	no_errors	ENST00000327337	ensembl	human	known	74_37	missense	19.48	62	15	SNP	0.974	A
FAM20B	9917	genome.wustl.edu	37	1	179013235	179013235	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr1:179013235G>A	ENST00000263733.4	+	2	589	c.253G>A	c.(253-255)Ggg>Agg	p.G85R		NM_014864.3	NP_055679.1	O75063	XYLK_HUMAN	family with sequence similarity 20, member B	85						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphotransferase activity, alcohol group as acceptor (GO:0016773)			breast(1)|endometrium(2)|large_intestine(2)|lung(6)|ovary(3)	14						ACCAGAGCTGGGGGCAGTCAT	0.542																																																	0													64.0	65.0	65.0					1																	179013235		2203	4300	6503	SO:0001583	missense	0			AB007944	CCDS1328.1	1q25.2	2013-04-29			ENSG00000116199	ENSG00000116199			23017	protein-coding gene	gene with protein product	"""glycosaminoglycan xylosylkinase"""	611063				9455484, 19473117	Standard	NM_014864		Approved	KIAA0475, GXK1	uc001gmc.3	O75063	OTTHUMG00000035073	ENST00000263733.4:c.253G>A	1.37:g.179013235G>A	ENSP00000263733:p.Gly85Arg		Q5W0C3|Q5W0C4	Missense_Mutation	SNP	pfam_DUF1193	p.G85R	ENST00000263733.4	37	c.253	CCDS1328.1	1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.299482	0.81136	.	.	ENSG00000116199	ENST00000440702;ENST00000263733	D	0.87650	-2.28	6.03	6.03	0.97812	.	0.046329	0.85682	D	0.000000	D	0.89529	0.6741	L	0.53561	1.675	0.80722	D	1	D	0.58268	0.982	P	0.50314	0.637	D	0.89559	0.3805	10	0.66056	D	0.02	-43.7202	20.5752	0.99366	0.0:0.0:1.0:0.0	.	85	O75063	XYLK_HUMAN	R	85	ENSP00000263733:G85R	ENSP00000263733:G85R	G	+	1	0	FAM20B	177279858	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.476000	0.97823	2.868000	0.98415	0.557000	0.71058	GGG	FAM20B	-	NULL	ENSG00000116199		0.542	FAM20B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM20B	HGNC	protein_coding	OTTHUMT00000084922.1	-	0.00	44	0	G	NM_014864		179013235	+1	tier1	-	no_errors	ENST00000263733	ensembl	human	known	74_37	missense	35.14	24	13	SNP	1.000	A
FAM74A7	100996582	genome.wustl.edu	37	9	40715957	40715957	+	lincRNA	SNP	A	A	G			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr9:40715957A>G	ENST00000432614.1	-	0	0				FAM74A3_ENST00000604146.1_lincRNA																							GAAGACGTGGAGAGCTCAGAG	0.577																																																	0													11.0	11.0	11.0					9																	40715957		2132	4194	6326			0																															9.37:g.40715957A>G				RNA	SNP	-	NULL	ENST00000432614.1	37	NULL		9																																																																																			FAM74A3	-	-	ENSG00000204844		0.577	RP11-395E19.5-001	KNOWN	basic	lincRNA	FAM74A3	HGNC	lincRNA	OTTHUMT00000143688.1	-	0.00	590	0	A			40715957	+1	tier1	-	no_errors	ENST00000355345	ensembl	human	known	74_37	rna	15.70	306	57	SNP	0.998	G
FAM86DP	692099	genome.wustl.edu	37	3	75471863	75471863	+	RNA	SNP	A	A	G			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr3:75471863A>G	ENST00000459803.1	-	0	1278					NR_024241.1				family with sequence similarity 86, member D, pseudogene																		TTTTATCTGCACAAAGCCAGA	0.473																																																	0																																												0			BC016686		3p12.3	2010-06-04	2010-06-04	2010-06-04	ENSG00000244026	ENSG00000244026			32659	pseudogene	pseudogene			"""family with sequence similarity 86, member D"""	FAM86D			Standard	NR_024241		Approved		uc003dpp.4		OTTHUMG00000158855		3.37:g.75471863A>G				RNA	SNP	-	NULL	ENST00000459803.1	37	NULL		3																																																																																			FAM86DP	-	-	ENSG00000244026		0.473	FAM86DP-003	KNOWN	basic	processed_transcript	FAM86DP	HGNC	pseudogene	OTTHUMT00000352425.1	-	0.00	31	0	A	NR_024241		75471863	-1	tier1	-	no_errors	ENST00000459803	ensembl	human	known	74_37	rna	77.78	4	14	SNP	0.001	G
FBXW5	54461	genome.wustl.edu	37	9	139837095	139837095	+	Silent	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr9:139837095G>T	ENST00000325285.3	-	5	658	c.579C>A	c.(577-579)ggC>ggA	p.G193G	FBXW5_ENST00000483559.1_5'UTR|C8G_ENST00000224181.3_5'Flank	NM_018998.3	NP_061871.1	Q969U6	FBXW5_HUMAN	F-box and WD repeat domain containing 5	193					centrosome duplication (GO:0051298)|mitotic nuclear division (GO:0007067)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)	protein kinase binding (GO:0019901)			breast(1)|endometrium(2)|large_intestine(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	12	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.19)	OV - Ovarian serous cystadenocarcinoma(145;7.8e-06)|Epithelial(140;0.000106)		TGAGCCAACAGCCAAACACGT	0.652																																																	0													47.0	31.0	36.0					9																	139837095		2191	4295	6486	SO:0001819	synonymous_variant	0			BC014130	CCDS7014.1	9q34.3	2013-01-09	2007-02-08		ENSG00000159069	ENSG00000159069		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	13613	protein-coding gene	gene with protein product		609072	"""F-box and WD-40 domain protein 5"""				Standard	NM_018998		Approved	DKFZP434B205, MGC20962, Fbw5	uc004cjx.3	Q969U6	OTTHUMG00000020967	ENST00000325285.3:c.579C>A	9.37:g.139837095G>T			B2RDZ6|Q59ET5|Q5SPZ8|Q5SPZ9|Q5SQ00|Q5SQ02|Q5SQ03|Q5SQ04|Q8WY79|Q96GJ6|Q9BSU8|Q9H6A8|Q9HBQ6|Q9NSZ3	Silent	SNP	pfam_WD40_repeat,pfam_F-box_dom,superfamily_Quinoprot_gluc/sorb_DH,superfamily_F-box_dom,smart_F-box_dom,smart_WD40_repeat,pfscan_F-box_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.G193	ENST00000325285.3	37	c.579	CCDS7014.1	9																																																																																			FBXW5	-	superfamily_Quinoprot_gluc/sorb_DH	ENSG00000159069		0.652	FBXW5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXW5	HGNC	protein_coding	OTTHUMT00000055227.1	-	0.00	39	0	G	NM_018998		139837095	-1	tier1	-	no_errors	ENST00000325285	ensembl	human	known	74_37	silent	5.95	79	5	SNP	1.000	T
FCN3	8547	genome.wustl.edu	37	1	27697395	27697395	+	Frame_Shift_Del	DEL	A	A	-			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr1:27697395delA	ENST00000270879.4	-	6	467	c.462delT	c.(460-462)tttfs	p.F154fs	FCN3_ENST00000354982.2_Frame_Shift_Del_p.F143fs	NM_003665.2	NP_003656.2	O75636	FCN3_HUMAN	ficolin (collagen/fibrinogen domain containing) 3	154	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)	blood microparticle (GO:0072562)|collagen trimer (GO:0005581)|extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)			endometrium(2)|kidney(2)|large_intestine(1)|lung(1)|urinary_tract(1)	7		all_lung(284;1.6e-05)|Lung NSC(340;2.92e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.0175)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0415)|OV - Ovarian serous cystadenocarcinoma(117;1.42e-27)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00128)|KIRC - Kidney renal clear cell carcinoma(1967;0.00155)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)		CTTGGTTCCCAAAACCTGCTC	0.552																																																	0													55.0	61.0	59.0					1																	27697395		2203	4300	6503	SO:0001589	frameshift_variant	0			D88587	CCDS300.1, CCDS301.1	1p36.11	2014-09-17	2013-09-12		ENSG00000142748	ENSG00000142748		"""Fibrinogen C domain containing"""	3625	protein-coding gene	gene with protein product	"""Hakata antigen"""	604973	"""ficolin (collagen/fibrinogen domain-containing) 3 (Hakata antigen)"""			9694814, 10330454	Standard	NM_003665		Approved	FCNH, HAKA1	uc001boa.3	O75636	OTTHUMG00000005722	ENST00000270879.4:c.462delT	1.37:g.27697395delA	ENSP00000270879:p.Phe154fs		Q6IBJ5|Q8WW86	Frame_Shift_Del	DEL	pfam_Fibrinogen_a/b/g_C_dom,pfam_Collagen,superfamily_Fibrinogen_a/b/g_C_dom,smart_Fibrinogen_a/b/g_C_dom	p.F154fs	ENST00000270879.4	37	c.462	CCDS300.1	1																																																																																			FCN3	-	pfam_Fibrinogen_a/b/g_C_dom,superfamily_Fibrinogen_a/b/g_C_dom,smart_Fibrinogen_a/b/g_C_dom	ENSG00000142748		0.552	FCN3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FCN3	HGNC	protein_coding	OTTHUMT00000015667.1		0.00	35	0	A			27697395	-1	tier1		no_errors	ENST00000270879	ensembl	human	known	74_37	frame_shift_del	9.52	19	2	DEL	0.996	-
FCRL5	83416	genome.wustl.edu	37	1	157512730	157512730	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr1:157512730C>T	ENST00000361835.3	-	6	1199	c.1042G>A	c.(1042-1044)Gag>Aag	p.E348K	FCRL5_ENST00000356953.4_Missense_Mutation_p.E348K|FCRL5_ENST00000368189.3_Missense_Mutation_p.E348K|FCRL5_ENST00000368191.3_Missense_Mutation_p.E263K|FCRL5_ENST00000368190.3_Missense_Mutation_p.E348K	NM_001195388.1|NM_031281.2	NP_001182317.1|NP_112571.2	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5	348	Ig-like C2-type 3.				negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of release of sequestered calcium ion into cytosol (GO:0051280)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)				breast(5)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(45)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	85	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				CCTGAATTCTCTGTAGTCAGT	0.537																																																	0													127.0	124.0	125.0					1																	157512730		2203	4300	6503	SO:0001583	missense	0			AF369794	CCDS1165.1	1q21	2013-01-11			ENSG00000143297	ENSG00000143297		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18508	protein-coding gene	gene with protein product		605877				11027651, 11290337	Standard	NM_031281		Approved	FCRH5, IRTA2, BXMAS1, CD307e	uc009wsm.3	Q96RD9	OTTHUMG00000017481	ENST00000361835.3:c.1042G>A	1.37:g.157512730C>T	ENSP00000354691:p.Glu348Lys		A0N0M2|B7WNT9|B7WP94|Q495Q2|Q495Q4|Q5VYK9|Q6UY46	Missense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.E348K	ENST00000361835.3	37	c.1042	CCDS1165.1	1	.	.	.	.	.	.	.	.	.	.	C	10.44	1.350738	0.24512	.	.	ENSG00000143297	ENST00000361835;ENST00000356953;ENST00000368190;ENST00000368191;ENST00000368189	T;T;T;T;T	0.13420	2.59;2.59;2.59;2.59;2.59	3.05	0.147	0.14838	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.17365	0.0417	M	0.89353	3.025	0.09310	N	1	D;P;P;D;P;D	0.59767	0.964;0.792;0.458;0.979;0.767;0.986	P;B;B;P;P;P	0.59595	0.625;0.415;0.194;0.696;0.561;0.86	T	0.03453	-1.1035	9	0.44086	T	0.13	.	4.7798	0.13197	0.0:0.4528:0.0:0.5472	.	379;263;348;348;348;348	B4DW39;F5GXJ2;Q96RD9-3;A6NJE8;Q96RD9-4;Q96RD9	.;.;.;.;.;FCRL5_HUMAN	K	348;348;348;263;348	ENSP00000354691:E348K;ENSP00000349434:E348K;ENSP00000357173:E348K;ENSP00000357174:E263K;ENSP00000357172:E348K	ENSP00000349434:E348K	E	-	1	0	FCRL5	155779354	0.000000	0.05858	0.004000	0.12327	0.066000	0.16364	0.004000	0.13106	0.048000	0.15891	0.313000	0.20887	GAG	FCRL5	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000143297		0.537	FCRL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FCRL5	HGNC	protein_coding	OTTHUMT00000046263.1	-	0.00	42	0	C	NM_031281		157512730	-1	tier1	-	no_errors	ENST00000356953	ensembl	human	known	74_37	missense	19.51	33	8	SNP	0.000	T
FIG4	9896	genome.wustl.edu	37	6	110083318	110083318	+	Silent	SNP	A	A	C			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr6:110083318A>C	ENST00000230124.3	+	12	1420	c.1296A>C	c.(1294-1296)cgA>cgC	p.R432R	FIG4_ENST00000441478.2_Silent_p.R155R	NM_014845.5	NP_055660.1	Q92562	FIG4_HUMAN	FIG4 phosphoinositide 5-phosphatase	432	SAC. {ECO:0000255|PROSITE- ProRule:PRU00183}.				cell death (GO:0008219)|locomotory behavior (GO:0007626)|myelin assembly (GO:0032288)|negative regulation of myelination (GO:0031642)|neuron development (GO:0048666)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of neuron projection development (GO:0010976)|small molecule metabolic process (GO:0044281)|vacuole organization (GO:0007033)	early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)	phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphatidylinositol-4-phosphate phosphatase activity (GO:0043812)			central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)	32		all_cancers(87;8.63e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000124)|all_lung(197;0.0187)|Colorectal(196;0.0492)|Lung SC(18;0.0548)		OV - Ovarian serous cystadenocarcinoma(136;0.0355)|Epithelial(106;0.038)|all cancers(137;0.0425)|BRCA - Breast invasive adenocarcinoma(108;0.079)		TTCTTGATCGACTAAATGTGA	0.368																																																	0													102.0	103.0	102.0					6																	110083318		2203	4300	6503	SO:0001819	synonymous_variant	0			D87464	CCDS5078.1	6q21	2014-09-17	2014-08-04	2007-07-30	ENSG00000112367	ENSG00000112367			16873	protein-coding gene	gene with protein product		609390	"""KIAA0274"", ""FIG4 homolog (S. cerevisiae)"", ""FIG4 homolog, SAC1 lipid phosphatase domain containing (S. cerevisiae)"""	KIAA0274		9039502, 11274189, 17572665	Standard	NM_014845		Approved	SAC3, hSac3, dJ249I4.1, ALS11, CMT4J	uc003ptt.2	Q92562	OTTHUMG00000015352	ENST00000230124.3:c.1296A>C	6.37:g.110083318A>C			Q53H49|Q5TCS6	Silent	SNP	pfam_Syja_N,pfscan_Syja_N	p.R432	ENST00000230124.3	37	c.1296	CCDS5078.1	6																																																																																			FIG4	-	pfscan_Syja_N	ENSG00000112367		0.368	FIG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FIG4	HGNC	protein_coding	OTTHUMT00000041768.1	-	0.00	63	0	A	NM_014845		110083318	+1	tier1	-	no_errors	ENST00000230124	ensembl	human	known	74_37	silent	14.49	118	20	SNP	0.884	C
FLNC	2318	genome.wustl.edu	37	7	128491632	128491632	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr7:128491632G>A	ENST00000325888.8	+	35	6053	c.5792G>A	c.(5791-5793)cGc>cAc	p.R1931H	RP11-309L24.2_ENST00000469965.1_RNA|FLNC_ENST00000346177.6_Missense_Mutation_p.R1898H	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	1931					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						ATCATCGTGCGCTTCGATGAC	0.587																																																	0													88.0	98.0	95.0					7																	128491632		2203	4300	6503	SO:0001583	missense	0			AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.5792G>A	7.37:g.128491632G>A	ENSP00000327145:p.Arg1931His		B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Missense_Mutation	SNP	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.R1931H	ENST00000325888.8	37	c.5792	CCDS43644.1	7	.	.	.	.	.	.	.	.	.	.	G	25.7	4.668335	0.88348	.	.	ENSG00000128591	ENST00000325888;ENST00000346177	D;D	0.85013	-1.93;-1.93	5.7	5.7	0.88788	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.055371	0.64402	D	0.000003	D	0.91040	0.7181	M	0.80982	2.52	0.47374	D	0.999409	D;D	0.63880	0.984;0.993	P;P	0.60345	0.799;0.873	D	0.91843	0.5485	10	0.87932	D	0	.	13.5192	0.61557	0.0803:0.0:0.9197:0.0	.	1898;1931	Q14315-2;Q14315	.;FLNC_HUMAN	H	1931;1898	ENSP00000327145:R1931H;ENSP00000344002:R1898H	ENSP00000327145:R1931H	R	+	2	0	FLNC	128278868	0.953000	0.32496	1.000000	0.80357	0.777000	0.43975	3.037000	0.49775	2.688000	0.91661	0.655000	0.94253	CGC	FLNC	-	pfam_Filamin/ABP280_repeat-like,superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like	ENSG00000128591		0.587	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FLNC	HGNC	protein_coding	OTTHUMT00000059948.3		0.00	41	0	G			128491632	+1			no_errors	ENST00000325888	ensembl	human	known	74_37	missense	7.50	37	3	SNP	1.000	A
FOXA3	3171	genome.wustl.edu	37	19	46376187	46376187	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr19:46376187C>G	ENST00000302177.2	+	2	1121	c.924C>G	c.(922-924)aaC>aaG	p.N308K		NM_004497.2	NP_004488.2	P55318	FOXA3_HUMAN	forkhead box A3	308					cell differentiation (GO:0030154)|cellular glucose homeostasis (GO:0001678)|cellular response to starvation (GO:0009267)|chromatin modification (GO:0016568)|endocrine pancreas development (GO:0031018)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(2)|large_intestine(2)|lung(4)|ovary(2)|pancreas(1)|prostate(1)	13		Ovarian(192;0.0308)|all_neural(266;0.0476)		OV - Ovarian serous cystadenocarcinoma(262;0.00453)|GBM - Glioblastoma multiforme(486;0.0518)|Epithelial(262;0.236)		CCATCAACAACCTAATGTCAG	0.592																																																	0													66.0	57.0	60.0					19																	46376187		2203	4300	6503	SO:0001583	missense	0			L12141	CCDS12677.1	19q13.32	2014-09-11		2002-09-20	ENSG00000170608	ENSG00000170608		"""Forkhead boxes"""	5023	protein-coding gene	gene with protein product		602295	"""hepatocyte nuclear factor 3, gamma"""	HNF3G		9119385	Standard	NM_004497		Approved		uc002pdr.3	P55318	OTTHUMG00000182484	ENST00000302177.2:c.924C>G	19.37:g.46376187C>G	ENSP00000304004:p.Asn308Lys		A9LYI5|Q53F16|Q9UMW9	Missense_Mutation	SNP	pfam_TF_fork_head,pfam_Fork-head_N,pfam_Forkhead_box_C,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.N308K	ENST00000302177.2	37	c.924	CCDS12677.1	19	.	.	.	.	.	.	.	.	.	.	C	17.28	3.348779	0.61183	.	.	ENSG00000170608	ENST00000302177	T	0.51817	0.69	4.24	3.2	0.36748	Forkhead box protein, C-terminal (1);	0.061586	0.64402	D	0.000008	T	0.62490	0.2432	M	0.75615	2.305	0.42190	D	0.991728	D	0.65815	0.995	P	0.61874	0.895	T	0.66662	-0.5867	10	0.87932	D	0	.	10.2344	0.43275	0.0:0.8998:0.0:0.1002	.	308	P55318	FOXA3_HUMAN	K	308	ENSP00000304004:N308K	ENSP00000304004:N308K	N	+	3	2	FOXA3	51068027	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	1.183000	0.32041	1.107000	0.41642	0.579000	0.79373	AAC	FOXA3	-	pfam_Forkhead_box_C	ENSG00000170608		0.592	FOXA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXA3	HGNC	protein_coding	OTTHUMT00000461682.1	-	0.00	100	0	C			46376187	+1	tier1	-	no_errors	ENST00000302177	ensembl	human	known	74_37	missense	16.67	50	10	SNP	1.000	G
FOXP1	27086	genome.wustl.edu	37	3	71019898	71019898	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr3:71019898C>T	ENST00000318789.4	-	19	2236	c.1711G>A	c.(1711-1713)Gca>Aca	p.A571T	FOXP1_ENST00000468577.1_Intron|FOXP1_ENST00000475937.1_Missense_Mutation_p.A571T|FOXP1_ENST00000491238.1_Missense_Mutation_p.A573T|FOXP1_ENST00000493089.1_Missense_Mutation_p.A570T|FOXP1_ENST00000484350.1_Missense_Mutation_p.A495T|FOXP1_ENST00000498215.1_Missense_Mutation_p.A571T	NM_001244810.1|NM_001244813.1|NM_032682.5	NP_001231739.1|NP_001231742.1|NP_116071.2	Q9H334	FOXP1_HUMAN	forkhead box P1	571					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	31		Lung NSC(201;4.62e-05)|Prostate(10;0.0181)|Hepatocellular(537;0.186)|Myeloproliferative disorder(1037;0.209)		BRCA - Breast invasive adenocarcinoma(55;1.17e-05)|Epithelial(33;1.39e-05)|LUSC - Lung squamous cell carcinoma(21;2.35e-05)|Lung(16;4.26e-05)		TGTAAAGCTGCATTGAGAGGT	0.418			T	PAX5	ALL																																			Dom	yes		3	3p14.1	27086	forkhead box P1		L	0													154.0	156.0	155.0					3																	71019898		2203	4300	6503	SO:0001583	missense	0			AF146696	CCDS2914.1, CCDS33785.1, CCDS58837.1, CCDS58838.1, CCDS58839.1, CCDS74963.1, CCDS74964.1	3p14.1	2008-07-18			ENSG00000114861	ENSG00000114861		"""Forkhead boxes"""	3823	protein-coding gene	gene with protein product	"""fork head-related protein like B"", ""glutamine-rich factor 1"", ""PAX5/FOXP1 fusion protein"""	605515				8265594, 11751404	Standard	NM_032682		Approved	QRF1, 12CC4, HSPC215, hFKH1B	uc003doj.3	Q9H334	OTTHUMG00000158803	ENST00000318789.4:c.1711G>A	3.37:g.71019898C>T	ENSP00000318902:p.Ala571Thr		A3QVP8|B3KV70|G5E9V8|Q8NAN6|Q9BSG9|Q9H332|Q9H333|Q9P0R1	Missense_Mutation	SNP	pfam_TF_fork_head,smart_TF_fork_head,prints_TF_fork_head,pfscan_TF_fork_head	p.A571T	ENST00000318789.4	37	c.1711	CCDS2914.1	3	.	.	.	.	.	.	.	.	.	.	C	22.5	4.297906	0.81025	.	.	ENSG00000114861	ENST00000318789;ENST00000358280;ENST00000475937;ENST00000497355;ENST00000491238;ENST00000493089;ENST00000498215;ENST00000484350	D;D;D;D;D;D;D	0.91068	-2.67;-2.67;-2.78;-2.78;-2.67;-2.67;-2.68	6.13	6.13	0.99165	.	0.000000	0.85682	D	0.000000	D	0.94414	0.8203	M	0.65975	2.015	0.80722	D	1	D;B;B	0.61697	0.99;0.053;0.023	P;B;B	0.60682	0.878;0.109;0.074	D	0.93043	0.6459	10	0.46703	T	0.11	.	20.8599	0.99761	0.0:1.0:0.0:0.0	.	570;495;571	G5E9V8;Q8NAN6;Q9H334	.;.;FOXP1_HUMAN	T	571;383;571;467;573;570;571;495	ENSP00000318902:A571T;ENSP00000419393:A571T;ENSP00000418225:A467T;ENSP00000420736:A573T;ENSP00000418524:A570T;ENSP00000418102:A571T;ENSP00000417857:A495T	ENSP00000318902:A571T	A	-	1	0	FOXP1	71102588	1.000000	0.71417	0.992000	0.48379	0.983000	0.72400	7.608000	0.82898	2.937000	0.99478	0.650000	0.86243	GCA	FOXP1	-	NULL	ENSG00000114861		0.418	FOXP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FOXP1	HGNC	protein_coding	OTTHUMT00000352250.1		0.00	60	0	C	NM_032682		71019898	-1			no_errors	ENST00000318789	ensembl	human	known	74_37	missense	6.25	30	2	SNP	1.000	T
FTH1	2495	genome.wustl.edu	37	11	61732489	61732489	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr11:61732489G>T	ENST00000273550.7	-	3	591	c.357C>A	c.(355-357)caC>caA	p.H119Q	FTH1_ENST00000529191.1_Intron|FTH1_ENST00000526640.1_Missense_Mutation_p.H89Q|FTH1_ENST00000532601.1_Missense_Mutation_p.H49Q|AP003733.1_ENST00000601917.1_5'Flank|BEST1_ENST00000449131.2_3'UTR|FTH1_ENST00000529631.1_Intron	NM_002032.2	NP_002023.2	P02794	FRIH_HUMAN	ferritin, heavy polypeptide 1	119	Ferritin-like diiron. {ECO:0000255|PROSITE-ProRule:PRU00085}.				cellular iron ion homeostasis (GO:0006879)|immune response (GO:0006955)|intracellular sequestering of iron ion (GO:0006880)|iron ion transport (GO:0006826)|membrane organization (GO:0061024)|negative regulation of cell proliferation (GO:0008285)|negative regulation of fibroblast proliferation (GO:0048147)|post-Golgi vesicle-mediated transport (GO:0006892)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular ferritin complex (GO:0008043)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ferric iron binding (GO:0008199)|ferroxidase activity (GO:0004322)|iron ion binding (GO:0005506)			NS(2)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	8					Iron Dextran(DB00893)	TGGCCAGTTTGTGCAGTTCCA	0.453																																																	0													203.0	193.0	196.0					11																	61732489		1870	4096	5966	SO:0001583	missense	0				CCDS41655.1	11q13	2012-10-02			ENSG00000167996	ENSG00000167996			3976	protein-coding gene	gene with protein product	"""apoferritin"", ""placenta immunoregulatory factor"", ""proliferation-inducing protein 15"""	134770		FTHL6		3020541	Standard	NM_002032		Approved	FTH, PLIF, PIG15, FHC	uc001nsu.3	P02794		ENST00000273550.7:c.357C>A	11.37:g.61732489G>T	ENSP00000273550:p.His119Gln		B3KNR5|Q3KRA8|Q3SWW1	Missense_Mutation	SNP	pfam_Ferritin_DPS_dom,superfamily_Ferritin-like_SF,pfscan_Ferritin-like_diiron	p.H119Q	ENST00000273550.7	37	c.357	CCDS41655.1	11	.	.	.	.	.	.	.	.	.	.	.	21.6	4.179456	0.78564	.	.	ENSG00000167996	ENST00000273550;ENST00000406545;ENST00000526640;ENST00000532601;ENST00000529548	T;T;T;T	0.66280	-0.2;-0.2;-0.2;-0.2	5.17	5.17	0.71159	Ferritin/ribonucleotide reductase-like (1);Ferritin-related (1);Ferritin/DPS protein domain (1);Ferritin-like (1);	0.000000	0.85682	D	0.000000	T	0.82226	0.4991	H	0.97291	3.975	0.80722	D	1	P	0.43885	0.82	P	0.48454	0.578	D	0.88608	0.3154	10	0.87932	D	0	.	18.6542	0.91445	0.0:0.0:1.0:0.0	.	119	P02794	FRIH_HUMAN	Q	119;168;89;49;49	ENSP00000273550:H119Q;ENSP00000433321:H89Q;ENSP00000435111:H49Q;ENSP00000436947:H49Q	ENSP00000273550:H119Q	H	-	3	2	FTH1	61489065	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.226000	0.51254	2.567000	0.86603	0.563000	0.77884	CAC	FTH1	-	pfam_Ferritin_DPS_dom,superfamily_Ferritin-like_SF,pfscan_Ferritin-like_diiron	ENSG00000167996		0.453	FTH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FTH1	HGNC	protein_coding	OTTHUMT00000388444.1		0.00	53	0	G	NM_002032		61732489	-1			no_errors	ENST00000273550	ensembl	human	known	74_37	missense	5.00	76	4	SNP	1.000	T
FXR2	9513	genome.wustl.edu	37	17	7507177	7507177	+	Missense_Mutation	SNP	A	A	C			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr17:7507177A>C	ENST00000250113.7	-	5	681	c.347T>G	c.(346-348)aTt>aGt	p.I116S		NM_004860.3	NP_004851.2	P51116	FXR2_HUMAN	fragile X mental retardation, autosomal homolog 2	116	Agenet-like 2.					cytoplasm (GO:0005737)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.?(1)		NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(7)|lung(8)|prostate(1)	26				READ - Rectum adenocarcinoma(115;0.17)		CAGGGTAACAATTTCATTGTA	0.468																																																	1	Unknown(1)	haematopoietic_and_lymphoid_tissue(1)											84.0	81.0	82.0					17																	7507177		1960	4151	6111	SO:0001583	missense	0			U31501	CCDS45604.1	17p13.3	2014-09-17				ENSG00000129245			4024	protein-coding gene	gene with protein product		605339		FMR1L2		7489725, 9259278	Standard	NM_004860		Approved		uc002gia.2	P51116		ENST00000250113.7:c.347T>G	17.37:g.7507177A>C	ENSP00000250113:p.Ile116Ser		B2R9M2|D3DTQ1|Q86V09|Q8WUM2	Missense_Mutation	SNP	pfam_Frag_X_MRP_fam,pfam_KH_dom_type_1,pfam_Agenet-like_dom,smart_KH_dom,pfscan_KH_dom_type_1	p.I116S	ENST00000250113.7	37	c.347	CCDS45604.1	17	.	.	.	.	.	.	.	.	.	.	A	25.0	4.591561	0.86953	.	.	ENSG00000129245	ENST00000250113	T	0.52754	0.65	5.59	5.59	0.84812	Agenet (1);	0.000000	0.85682	D	0.000000	T	0.71392	0.3334	M	0.85197	2.74	0.80722	D	1	D;D	0.64830	0.994;0.994	D;D	0.79784	0.993;0.993	T	0.76561	-0.2914	10	0.87932	D	0	.	14.0127	0.64507	1.0:0.0:0.0:0.0	.	116;116	Q86V09;P51116	.;FXR2_HUMAN	S	116	ENSP00000250113:I116S	ENSP00000250113:I116S	I	-	2	0	FXR2	7447902	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.049000	0.93837	2.254000	0.74563	0.459000	0.35465	ATT	FXR2	-	pfam_Agenet-like_dom	ENSG00000129245		0.468	FXR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FXR2	HGNC	protein_coding	OTTHUMT00000441084.1		0.00	113	0	A			7507177	-1			no_errors	ENST00000250113	ensembl	human	known	74_37	missense	5.08	56	3	SNP	1.000	C
GABRG1	2565	genome.wustl.edu	37	4	46086016	46086016	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr4:46086016T>C	ENST00000295452.4	-	3	475	c.308A>G	c.(307-309)gAt>gGt	p.D103G		NM_173536.3	NP_775807.2	Q8N1C3	GBRG1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 1	103					gamma-aminobutyric acid signaling pathway (GO:0007214)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(2)|central_nervous_system(5)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(2)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	76				Lung(65;0.106)|LUSC - Lung squamous cell carcinoma(721;0.23)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	ATTAATTGGATCAACTGGTCC	0.318																																																	0													43.0	41.0	41.0					4																	46086016		2196	4288	6484	SO:0001583	missense	0			BC031087	CCDS3470.1	4p12	2012-06-22			ENSG00000163285	ENSG00000163285		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4086	protein-coding gene	gene with protein product	"""GABA(A) receptor, gamma"""	137166				1321425	Standard	NM_173536		Approved		uc003gxb.3	Q8N1C3	OTTHUMG00000128609	ENST00000295452.4:c.308A>G	4.37:g.46086016T>C	ENSP00000295452:p.Asp103Gly		Q5H9T8	Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABBAg_rcpt,prints_GABAA_rcpt,prints_GABBAg1_rcpt,prints_GABAAa_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.D103G	ENST00000295452.4	37	c.308	CCDS3470.1	4	.	.	.	.	.	.	.	.	.	.	T	15.78	2.935057	0.52866	.	.	ENSG00000163285	ENST00000295452;ENST00000540030	T	0.80393	-1.37	4.83	4.83	0.62350	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.82618	0.5076	M	0.75085	2.285	0.47407	D	0.999411	P	0.36837	0.571	B	0.42959	0.403	D	0.84888	0.0835	10	0.87932	D	0	.	12.3969	0.55391	0.0:0.0:0.0:1.0	.	103	Q8N1C3	GBRG1_HUMAN	G	103	ENSP00000295452:D103G	ENSP00000295452:D103G	D	-	2	0	GABRG1	45780773	1.000000	0.71417	0.999000	0.59377	0.855000	0.48748	5.983000	0.70540	2.029000	0.59856	0.460000	0.39030	GAT	GABRG1	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,tigrfam_Neur_channel	ENSG00000163285		0.318	GABRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRG1	HGNC	protein_coding	OTTHUMT00000250470.1	-	0.00	68	0	T	NM_173536		46086016	-1	tier1	-	no_errors	ENST00000295452	ensembl	human	known	74_37	missense	35.14	24	13	SNP	1.000	C
GADD45GIP1	90480	genome.wustl.edu	37	19	13065136	13065136	+	Silent	SNP	C	C	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr19:13065136C>T	ENST00000316939.1	-	2	578	c.555G>A	c.(553-555)aaG>aaA	p.K185K		NM_052850.3	NP_443082.2	Q8TAE8	G45IP_HUMAN	growth arrest and DNA-damage-inducible, gamma interacting protein 1	185					cell cycle (GO:0007049)|viral process (GO:0016032)	mitochondrion (GO:0005739)|nucleus (GO:0005634)				ovary(2)|prostate(1)|skin(1)	4						GCTTGCGCTCCTTCTTCTCTA	0.637																																																	0													77.0	81.0	79.0					19																	13065136		2203	4300	6503	SO:0001819	synonymous_variant	0			AF479749	CCDS12290.1	19p13.2	2014-02-12				ENSG00000179271			29996	protein-coding gene	gene with protein product	"""papillomavirus L2 interacting nuclear protein 1"", ""CKII beta binding protein 2"", ""CR6 interacting factor 1"", ""p53-responsive gene 6"""	605162				10441517, 12482659	Standard	NM_052850		Approved	PLINP-1, MGC4667, MGC4758, CKBBP2, PRG6, Plinp1, CRIF1, CKbetaBP2	uc002mwb.4	Q8TAE8		ENST00000316939.1:c.555G>A	19.37:g.13065136C>T			Q8IVM3|Q8TE51|Q969P9|Q9BSM6	Silent	SNP	pfam_Damage-induce-interacting_prot	p.K185	ENST00000316939.1	37	c.555	CCDS12290.1	19																																																																																			GADD45GIP1	-	pfam_Damage-induce-interacting_prot	ENSG00000179271		0.637	GADD45GIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GADD45GIP1	HGNC	protein_coding	OTTHUMT00000452759.2	-	0.00	23	0	C	NM_052850		13065136	-1	tier1	-	no_errors	ENST00000316939	ensembl	human	known	74_37	silent	36.51	40	23	SNP	1.000	T
GALNT3	2591	genome.wustl.edu	37	2	166615871	166615871	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr2:166615871T>C	ENST00000392701.3	-	5	1823	c.1048A>G	c.(1048-1050)Agg>Ggg	p.R350G	GALNT3_ENST00000409882.1_Missense_Mutation_p.R88G	NM_004482.3	NP_004473.2	Q14435	GALT3_HUMAN	polypeptide N-acetylgalactosaminyltransferase 3	350					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation via serine (GO:0018242)|protein O-linked glycosylation via threonine (GO:0018243)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|manganese ion binding (GO:0030145)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			NS(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(3)|skin(1)	20						TCATCTTTCCTTCTTTGCTTC	0.383																																																	0													93.0	84.0	87.0					2																	166615871		2203	4300	6503	SO:0001583	missense	0				CCDS2226.1	2q24-q31	2014-03-13	2014-03-13		ENSG00000115339	ENSG00000115339	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4125	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 3"""	601756	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 3 (GalNAc-T3)"""			9592121, 15133511	Standard	NM_004482		Approved	GalNAc-T3, HHS, HFTC	uc010fph.1	Q14435	OTTHUMG00000132157	ENST00000392701.3:c.1048A>G	2.37:g.166615871T>C	ENSP00000376465:p.Arg350Gly		Q53TG9|Q7Z476	Missense_Mutation	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.R350G	ENST00000392701.3	37	c.1048	CCDS2226.1	2	.	.	.	.	.	.	.	.	.	.	T	18.72	3.684498	0.68157	.	.	ENSG00000115339	ENST00000392701;ENST00000409882;ENST00000412248	T;T;T	0.60424	0.19;0.19;0.19	5.56	2.98	0.34508	Glycosyl transferase, family 2 (1);	0.048419	0.85682	D	0.000000	T	0.69369	0.3103	M	0.79805	2.47	0.53688	D	0.999971	P	0.48407	0.91	P	0.53912	0.737	T	0.74057	-0.3787	10	0.87932	D	0	.	11.9535	0.52968	0.0:0.0:0.2748:0.7252	.	350	Q14435	GALT3_HUMAN	G	350;88;350	ENSP00000376465:R350G;ENSP00000386955:R88G;ENSP00000412643:R350G	ENSP00000376465:R350G	R	-	1	2	GALNT3	166324117	1.000000	0.71417	0.993000	0.49108	0.884000	0.51177	2.621000	0.46418	0.903000	0.36546	0.460000	0.39030	AGG	GALNT3	-	pfam_Glyco_trans_2	ENSG00000115339		0.383	GALNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT3	HGNC	protein_coding	OTTHUMT00000255205.2	-	0.00	38	0	T	NM_004482		166615871	-1	tier1	-	no_errors	ENST00000392701	ensembl	human	known	74_37	missense	32.65	33	16	SNP	0.994	C
GBP7	388646	genome.wustl.edu	37	1	89617967	89617967	+	Silent	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr1:89617967G>T	ENST00000294671.2	-	5	747	c.609C>A	c.(607-609)gcC>gcA	p.A203A		NM_207398.2	NP_997281.2	Q8N8V2	GBP7_HUMAN	guanylate binding protein 7	203	GB1/RHD3-type G.|GTPase domain (Globular). {ECO:0000250}.					membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		Lung NSC(277;0.0908)		all cancers(265;0.00835)|Epithelial(280;0.0322)		TCAGCTTCAAGGCATTCTCCA	0.463																																																	0													128.0	126.0	127.0					1																	89617967		2203	4300	6503	SO:0001819	synonymous_variant	0			AK096141	CCDS720.1	1p22.2	2008-02-05			ENSG00000213512	ENSG00000213512			29606	protein-coding gene	gene with protein product		612468					Standard	NM_207398		Approved	FLJ38822, GBP4L	uc001dna.2	Q8N8V2	OTTHUMG00000010659	ENST00000294671.2:c.609C>A	1.37:g.89617967G>T				Silent	SNP	pfam_Guanylate-bd_N,pfam_Guanylate-bd_C,superfamily_Guanylate-bd_C,superfamily_P-loop_NTPase	p.A203	ENST00000294671.2	37	c.609	CCDS720.1	1																																																																																			GBP7	-	pfam_Guanylate-bd_N,superfamily_P-loop_NTPase	ENSG00000213512		0.463	GBP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBP7	HGNC	protein_coding	OTTHUMT00000029401.1	-	0.00	42	0	G	NM_207398		89617967	-1	tier1	-	no_errors	ENST00000294671	ensembl	human	known	74_37	silent	8.33	44	4	SNP	1.000	T
GC	2638	genome.wustl.edu	37	4	72669648	72669648	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr4:72669648T>C	ENST00000504199.1	-	1	110	c.16A>G	c.(16-18)Agt>Ggt	p.S6G		NM_001204307.1	NP_001191236.1	P02774	VTDB_HUMAN	group-specific component (vitamin D binding protein)	0					small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)|vitamin transport (GO:0051180)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	actin binding (GO:0003779)|calcidiol binding (GO:1902118)|vitamin D binding (GO:0005499)|vitamin transporter activity (GO:0051183)			endometrium(5)|kidney(1)|large_intestine(4)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	45		all_hematologic(202;0.107)	Lung(101;0.148)		Alfacalcidol(DB01436)|Cholecalciferol(DB00169)	AGTACCTCACTCCAAGACCAC	0.393																																																	0																																										SO:0001583	missense	0			L10641	CCDS3550.1, CCDS56332.1	4q12-q13	2008-08-29			ENSG00000145321	ENSG00000145321			4187	protein-coding gene	gene with protein product		139200				558959	Standard	NM_000583		Approved	DBP, VDBP, hDBP	uc010iif.3	P02774	OTTHUMG00000129915	ENST00000504199.1:c.16A>G	4.37:g.72669648T>C	ENSP00000421725:p.Ser6Gly		B4DPP2|D6RAK8|Q16309|Q16310|Q53F31|Q6GTG1	Missense_Mutation	SNP	pfam_Serum_albumin_N,pfam_VitD-bind_III,superfamily_Serum_albumin-like,smart_Serum_albumin_N,prints_VitD-bd,prints_ALB/AFP/VDB	p.S6G	ENST00000504199.1	37	c.16	CCDS56332.1	4	.	.	.	.	.	.	.	.	.	.	.	1.220	-0.627263	0.03610	.	.	ENSG00000145321	ENST00000504199	T	0.57595	0.39	1.33	1.33	0.21861	.	.	.	.	.	T	0.26810	0.0656	N	0.08118	0	0.09310	N	1	B	0.20887	0.049	B	0.14578	0.011	T	0.14868	-1.0457	9	0.28530	T	0.3	.	4.8295	0.13432	0.0:0.0:0.0:1.0	.	6	D6RAK8	.	G	6	ENSP00000421725:S6G	ENSP00000421725:S6G	S	-	1	0	GC	72888512	0.006000	0.16342	0.004000	0.12327	0.004000	0.04260	1.027000	0.30115	0.878000	0.35920	0.383000	0.25322	AGT	GC	-	NULL	ENSG00000145321		0.393	GC-006	PUTATIVE	basic|CCDS	protein_coding	GC	HGNC	protein_coding	OTTHUMT00000362266.1	-	0.00	60	0	T			72669648	-1	tier1	-	no_errors	ENST00000504199	ensembl	human	putative	74_37	missense	31.58	26	12	SNP	0.004	C
GDF3	9573	genome.wustl.edu	37	12	7842479	7842479	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr12:7842479C>A	ENST00000329913.3	-	2	1137	c.1090G>T	c.(1090-1092)Ggg>Tgg	p.G364W		NM_020634.1	NP_065685.1	Q9NR23	GDF3_HUMAN	growth differentiation factor 3	364					endoderm development (GO:0007492)|eye development (GO:0001654)|formation of anatomical boundary (GO:0048859)|growth (GO:0040007)|in utero embryonic development (GO:0001701)|mesoderm development (GO:0007498)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of epidermal cell differentiation (GO:0045605)|notochord development (GO:0030903)|primitive streak formation (GO:0090009)|regulation of cell fate commitment (GO:0010453)|response to dietary excess (GO:0002021)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|somite rostral/caudal axis specification (GO:0032525)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	protein kinase binding (GO:0019901)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	28						ACATCCTACCCACACCCACAT	0.403																																																	0													92.0	86.0	88.0					12																	7842479		2203	4300	6503	SO:0001583	missense	0			AF263538	CCDS8581.1	12p13.1	2014-01-30			ENSG00000184344	ENSG00000184344		"""Endogenous ligands"""	4218	protein-coding gene	gene with protein product		606522				9467948	Standard	NM_020634		Approved		uc001qte.3	Q9NR23	OTTHUMG00000168433	ENST00000329913.3:c.1090G>T	12.37:g.7842479C>A	ENSP00000331745:p.Gly364Trp		Q8NEJ4	Missense_Mutation	SNP	pfam_TGF-b_C,pfam_TGF-b_N,smart_TGF-b_C,prints_Inhibin_asu	p.G364W	ENST00000329913.3	37	c.1090	CCDS8581.1	12	.	.	.	.	.	.	.	.	.	.	C	15.38	2.815339	0.50527	.	.	ENSG00000184344	ENST00000329913	D	0.83591	-1.74	3.82	2.91	0.33838	Transforming growth factor-beta, C-terminal (2);	0.104980	0.64402	D	0.000006	D	0.83261	0.5216	L	0.40543	1.245	0.31310	N	0.687231	D	0.67145	0.996	D	0.69307	0.963	T	0.80623	-0.1300	10	0.87932	D	0	.	5.0279	0.14395	0.0:0.7574:0.0:0.2426	.	364	Q9NR23	GDF3_HUMAN	W	364	ENSP00000331745:G364W	ENSP00000331745:G364W	G	-	1	0	GDF3	7733746	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	1.080000	0.30779	2.070000	0.61991	0.561000	0.74099	GGG	GDF3	-	smart_TGF-b_C	ENSG00000184344		0.403	GDF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDF3	HGNC	protein_coding	OTTHUMT00000399717.1	-	0.00	48	0	C			7842479	-1	tier1	-	no_errors	ENST00000329913	ensembl	human	known	74_37	missense	84.85	5	28	SNP	1.000	A
GIMAP6	474344	genome.wustl.edu	37	7	150325470	150325470	+	Silent	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr7:150325470G>T	ENST00000328902.5	-	3	432	c.216C>A	c.(214-216)acC>acA	p.T72T	GIMAP6_ENST00000493969.1_Intron	NM_001244072.1|NM_024711.5	NP_001231001.1|NP_078987.3	Q6P9H5	GIMA6_HUMAN	GTPase, IMAP family member 6	72	AIG1-type G.					cytosol (GO:0005829)	GTP binding (GO:0005525)			endometrium(4)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	29			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TCACGGGTCTGGTGCTGAGTT	0.577																																																	0													181.0	185.0	183.0					7																	150325470		2203	4300	6503	SO:0001819	synonymous_variant	0			AK026343	CCDS34778.1, CCDS59087.1, CCDS75676.1	7q36.1	2014-04-04			ENSG00000133561	ENSG00000133561		"""GTPases, IMAP"""	21918	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 6"""					15474311	Standard	NM_001244072		Approved	FLJ22690, IAN6	uc022apv.1	Q6P9H5	OTTHUMG00000159137	ENST00000328902.5:c.216C>A	7.37:g.150325470G>T			C9J7B6|D3DWZ4|Q5ZPR6|Q9H612	Silent	SNP	pfam_AIG1,superfamily_P-loop_NTPase	p.T72	ENST00000328902.5	37	c.216	CCDS34778.1	7																																																																																			GIMAP6	-	pfam_AIG1,superfamily_P-loop_NTPase	ENSG00000133561		0.577	GIMAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GIMAP6	HGNC	protein_coding	OTTHUMT00000353457.1	-	0.00	56	0	G	NM_024711		150325470	-1	tier1	-	no_errors	ENST00000328902	ensembl	human	known	74_37	silent	9.09	40	4	SNP	0.000	T
GLYATL2	219970	genome.wustl.edu	37	11	58607019	58607019	+	Nonsense_Mutation	SNP	C	C	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr11:58607019C>A	ENST00000287275.1	-	2	457	c.67G>T	c.(67-69)Gaa>Taa	p.E23*	GLYATL2_ENST00000533636.1_Intron|GLYATL2_ENST00000532258.1_Nonsense_Mutation_p.E23*	NM_145016.3	NP_659453.3	Q8WU03	GLYL2_HUMAN	glycine-N-acyltransferase-like 2	23						endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)	glycine N-acyltransferase activity (GO:0047961)			breast(1)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	23		Breast(21;0.0044)|all_epithelial(135;0.0216)			Glycine(DB00145)	TTTATGGATTCAGGGATGCTC	0.433																																																	0													136.0	125.0	128.0					11																	58607019		1885	4108	5993	SO:0001587	stop_gained	0			AF426250	CCDS41649.1	11q12.1	2008-02-05				ENSG00000156689			24178	protein-coding gene	gene with protein product		614762				12477932	Standard	NM_145016		Approved	BXMAS2-10, MGC24009	uc001nnd.4	Q8WU03		ENST00000287275.1:c.67G>T	11.37:g.58607019C>A	ENSP00000287275:p.Glu23*		A5LGC7|Q86WC3|Q96AT2	Nonsense_Mutation	SNP	pfam_Glycine_N-acyltransferase_N,pfam_Glycine_N-acyltransferase_C,pfam_FR47,superfamily_Acyl_CoA_acyltransferase	p.E23*	ENST00000287275.1	37	c.67	CCDS41649.1	11	.	.	.	.	.	.	.	.	.	.	C	36	5.966309	0.97156	.	.	ENSG00000156689	ENST00000287275;ENST00000532258	.	.	.	4.31	3.38	0.38709	.	0.241770	0.27636	U	0.018486	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	.	10.2693	0.43473	0.0:0.798:0.202:0.0	.	.	.	.	X	23	.	ENSP00000287275:E23X	E	-	1	0	GLYATL2	58363595	0.010000	0.17322	0.195000	0.23364	0.513000	0.34164	0.658000	0.24979	0.808000	0.34231	0.644000	0.83932	GAA	GLYATL2	-	pfam_Glycine_N-acyltransferase_N	ENSG00000156689		0.433	GLYATL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLYATL2	HGNC	protein_coding	OTTHUMT00000394599.1	-	0.00	43	0	C	NM_145016		58607019	-1	tier1	-	no_errors	ENST00000287275	ensembl	human	known	74_37	nonsense	14.93	57	10	SNP	0.537	A
GNA13	10672	genome.wustl.edu	37	17	63010777	63010777	+	Silent	SNP	A	A	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr17:63010777A>T	ENST00000439174.2	-	4	977	c.732T>A	c.(730-732)ctT>ctA	p.L244L	GNA13_ENST00000541118.1_Silent_p.L149L	NM_006572.4	NP_006563.2	Q14344	GNA13_HUMAN	guanine nucleotide binding protein (G protein), alpha 13	244					activation of phospholipase D activity (GO:0031584)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cellular component movement (GO:0006928)|in utero embryonic development (GO:0001701)|patterning of blood vessels (GO:0001569)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of cell migration (GO:0030334)|regulation of cell shape (GO:0008360)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)	brush border membrane (GO:0031526)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|heterotrimeric G-protein complex (GO:0005834)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	D5 dopamine receptor binding (GO:0031752)|G-protein beta/gamma-subunit complex binding (GO:0031683)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)|type 1 angiotensin receptor binding (GO:0031702)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(14)|kidney(2)|large_intestine(4)|lung(6)|urinary_tract(1)	34						AAACAAGGAAAAGTATTGATG	0.373																																																	0													111.0	101.0	104.0					17																	63010777		2203	4300	6503	SO:0001819	synonymous_variant	0			L22075	CCDS11661.1, CCDS62302.1	17q24.1	2014-09-04			ENSG00000120063	ENSG00000120063			4381	protein-coding gene	gene with protein product		604406				7791744	Standard	NM_006572		Approved	G13, MGC46138	uc002jfc.3	Q14344	OTTHUMG00000179316	ENST00000439174.2:c.732T>A	17.37:g.63010777A>T			B2R977|B7Z7R0|F5H1G8|Q8TD70	Silent	SNP	pfam_Gprotein_alpha_su,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,superfamily_GproteinA_insert,smart_Gprotein_alpha_su,prints_Gprotein_alpha_su,prints_Gprotein_alpha_12	p.L244	ENST00000439174.2	37	c.732	CCDS11661.1	17																																																																																			GNA13	-	pfam_Gprotein_alpha_su,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,smart_Gprotein_alpha_su,prints_Gprotein_alpha_su	ENSG00000120063		0.373	GNA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNA13	HGNC	protein_coding	OTTHUMT00000445720.1	-	0.00	121	0	A	NM_006572		63010777	-1	tier1	-	no_errors	ENST00000439174	ensembl	human	known	74_37	silent	35.29	77	42	SNP	0.936	T
GNL2	29889	genome.wustl.edu	37	1	38040040	38040040	+	Silent	SNP	C	C	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr1:38040040C>T	ENST00000373062.3	-	12	1418	c.1320G>A	c.(1318-1320)ttG>ttA	p.L440L		NM_013285.2	NP_037417.1	Q13823	NOG2_HUMAN	guanine nucleotide binding protein-like 2 (nucleolar)	440					GTP catabolic process (GO:0006184)|ribosome biogenesis (GO:0042254)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(8)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	30		Myeloproliferative disorder(586;0.0393)				CCACAGTCTGCAAGTCGGGCT	0.517																																																	0													45.0	43.0	44.0					1																	38040040		2203	4300	6503	SO:0001819	synonymous_variant	0			L05425	CCDS421.1	1p34	2008-02-05			ENSG00000134697	ENSG00000134697			29925	protein-coding gene	gene with protein product		609365				8822211	Standard	NM_013285		Approved	Ngp-1, HUMAUANTIG	uc001cbk.3	Q13823	OTTHUMG00000004322	ENST00000373062.3:c.1320G>A	1.37:g.38040040C>T			Q9BWN7	Silent	SNP	pfam_NOG2_N_dom,pfam_GTP_binding_domain,superfamily_P-loop_NTPase,prints_GTP_binding_domain	p.L440	ENST00000373062.3	37	c.1320	CCDS421.1	1																																																																																			GNL2	-	superfamily_P-loop_NTPase	ENSG00000134697		0.517	GNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNL2	HGNC	protein_coding	OTTHUMT00000012478.1	-	0.00	98	0	C	NM_013285		38040040	-1	tier1	-	no_errors	ENST00000373062	ensembl	human	known	74_37	silent	7.69	60	5	SNP	0.985	T
GNAI3	2773	genome.wustl.edu	37	1	110134705	110134705	+	Silent	SNP	C	C	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr1:110134705C>T	ENST00000369851.4	+	8	1025	c.915C>T	c.(913-915)tgC>tgT	p.C305C	RNU6V_ENST00000384105.1_RNA	NM_006496.3	NP_006487.1	P08754	GNAI3_HUMAN	guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3	305					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|cell cycle (GO:0007049)|cell division (GO:0051301)|negative regulation of adenylate cyclase activity (GO:0007194)|platelet activation (GO:0030168)|synaptic transmission (GO:0007268)|transport (GO:0006810)|vesicle fusion (GO:0006906)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|heterotrimeric G-protein complex (GO:0005834)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane raft (GO:0045121)|midbody (GO:0030496)|plasma membrane (GO:0005886)|zymogen granule (GO:0042588)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled serotonin receptor binding (GO:0031821)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			NS(1)|endometrium(2)|kidney(1)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	12		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		Lung(183;0.046)|Colorectal(144;0.119)|Epithelial(280;0.139)|all cancers(265;0.147)|LUSC - Lung squamous cell carcinoma(189;0.237)		ATATTCAATGCCAGTTTGAAG	0.418																																																	0													99.0	92.0	94.0					1																	110134705		2203	4300	6503	SO:0001819	synonymous_variant	0			M27543	CCDS802.1	1p13	2012-10-02			ENSG00000065135	ENSG00000065135			4387	protein-coding gene	gene with protein product		139370				3109953	Standard	NM_006496		Approved	87U6	uc001dxz.3	P08754	OTTHUMG00000011648	ENST00000369851.4:c.915C>T	1.37:g.110134705C>T			P17539|Q5TZX1	Silent	SNP	pfam_Gprotein_alpha_su,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,superfamily_GproteinA_insert,smart_Gprotein_alpha_su,prints_Gprotein_alpha_su,prints_Gprotein_alpha_I,prints_Fungi_Gprotein_alpha	p.C305	ENST00000369851.4	37	c.915	CCDS802.1	1																																																																																			GNAI3	-	pfam_Gprotein_alpha_su,superfamily_P-loop_NTPase,smart_Gprotein_alpha_su,prints_Gprotein_alpha_I,prints_Fungi_Gprotein_alpha	ENSG00000065135		0.418	GNAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNAI3	HGNC	protein_coding	OTTHUMT00000032222.1		0.00	73	0	C	NM_006496		110134705	+1			no_errors	ENST00000369851	ensembl	human	known	74_37	silent	5.88	64	4	SNP	1.000	T
GPX8	493869	genome.wustl.edu	37	5	54460112	54460113	+	3'UTR	INS	-	-	TT	rs552883936		TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr5:54460112_54460113insTT	ENST00000503787.1	+	0	771_772				CDC20B_ENST00000381375.2_Intron|CDC20B_ENST00000296733.1_Intron|CDC20B_ENST00000322374.6_Intron|GPX8_ENST00000515370.1_3'UTR|CDC20B_ENST00000331730.3_Intron|GPX8_ENST00000506123.1_3'UTR|CDC20B_ENST00000334206.5_Intron|GPX8_ENST00000296734.6_3'UTR	NM_001008397.2	NP_001008398.2	Q8TED1	GPX8_HUMAN	glutathione peroxidase 8 (putative)						response to oxidative stress (GO:0006979)	endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)	glutathione peroxidase activity (GO:0004602)|peroxidase activity (GO:0004601)			breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)|prostate(1)	11					Glutathione(DB00143)	CATTTTAAACAttttttttttg	0.396																																																	0																																										SO:0001624	3_prime_UTR_variant	0			BC029424	CCDS34156.1	5q11.2	2008-09-29				ENSG00000164294			33100	protein-coding gene	gene with protein product							Standard	NM_001008397		Approved	UNQ847, EPLA847	uc003jpq.2	Q8TED1		ENST00000503787.1:c.*67->TT	5.37:g.54460121_54460122dupTT				RNA	INS	-	NULL	ENST00000503787.1	37	NULL	CCDS34156.1	5																																																																																			GPX8	-	-	ENSG00000164294		0.396	GPX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPX8	HGNC	protein_coding	OTTHUMT00000369717.1		0.00	28	0	-	NM_001008397		54460113	+1	tier1		no_errors	ENST00000506123	ensembl	human	known	74_37	rna	11.76	15	2	INS	0.000:0.000	TT
GRM4	2914	genome.wustl.edu	37	6	33990592	33990592	+	3'UTR	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr6:33990592G>T	ENST00000538487.2	-	0	3188				GRM4_ENST00000609222.1_3'UTR|GRM4_ENST00000545715.1_5'UTR|GRM4_ENST00000455714.2_3'UTR|GRM4_ENST00000374177.3_3'UTR|GRM4_ENST00000374181.4_3'UTR|GRM4_ENST00000535756.1_3'UTR|GRM4_ENST00000544773.2_3'UTR	NM_000841.2|NM_001256811.1	NP_000832.1|NP_001243740.1	Q14833	GRM4_HUMAN	glutamate receptor, metabotropic 4						activation of MAPK activity (GO:0000187)|adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|learning (GO:0007612)|neurotransmitter secretion (GO:0007269)|positive regulation of MAPK cascade (GO:0043410)|regulation of neuron apoptotic process (GO:0043523)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	cytoplasmic vesicle (GO:0031410)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|presynaptic active zone membrane (GO:0048787)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)			NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(9)|liver(1)|lung(19)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						CAGCTCCATGGACTCGCTAGA	0.627																																																	0													167.0	131.0	144.0					6																	33990592		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0			U92457	CCDS4787.1, CCDS59010.1, CCDS59011.1, CCDS59012.1, CCDS75432.1	6p21.3	2012-08-29			ENSG00000124493	ENSG00000124493		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4596	protein-coding gene	gene with protein product		604100				8738157, 9473604	Standard	NM_000841		Approved	GPRC1D, mGlu4, MGLUR4	uc010jvh.4	Q14833	OTTHUMG00000014538	ENST00000538487.2:c.*6C>A	6.37:g.33990592G>T			B3KVL9|B7Z1T9|B7Z1U6|F5GXM5|Q5SZ84|Q6ZMQ2	RNA	SNP	-	NULL	ENST00000538487.2	37	NULL	CCDS4787.1	6																																																																																			GRM4	-	-	ENSG00000124493		0.627	GRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRM4	HGNC	protein_coding	OTTHUMT00000040213.2	-	0.00	66	0	G			33990592	-1	tier1	-	no_errors	ENST00000545715	ensembl	human	known	74_37	rna	70.18	17	40	SNP	0.649	T
GRSF1	2926	genome.wustl.edu	37	4	71691058	71691058	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr4:71691058G>C	ENST00000254799.6	-	8	1465	c.1348C>G	c.(1348-1350)Cat>Gat	p.H450D	GRSF1_ENST00000502323.1_Missense_Mutation_p.H288D|GRSF1_ENST00000545193.1_Missense_Mutation_p.H332D|GRSF1_ENST00000439371.1_Missense_Mutation_p.H288D|GRSF1_ENST00000508091.1_Intron	NM_002092.3	NP_002083	Q12849	GRSF1_HUMAN	G-rich RNA sequence binding factor 1	450	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				anterior/posterior pattern specification (GO:0009952)|morphogenesis of embryonic epithelium (GO:0016331)|mRNA polyadenylation (GO:0006378)|tRNA processing (GO:0008033)	cytoplasm (GO:0005737)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|upper_aerodigestive_tract(2)	17		all_hematologic(202;0.21)	Lung(101;0.235)			GCATCCTCATGGGTCTCAAAG	0.473																																																	0													75.0	75.0	75.0					4																	71691058		2021	4194	6215	SO:0001583	missense	0			BC040485	CCDS47069.1, CCDS47070.1	4q13	2013-07-16				ENSG00000132463		"""RNA binding motif (RRM) containing"""	4610	protein-coding gene	gene with protein product		604851				8036161	Standard	NM_001098477		Approved		uc010iia.1	Q12849		ENST00000254799.6:c.1348C>G	4.37:g.71691058G>C	ENSP00000254799:p.His450Asp		B3KPW0|Q4W5S5|Q6ZST3|Q8IWD6|Q8NBD2	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.H450D	ENST00000254799.6	37	c.1348	CCDS47069.1	4	.	.	.	.	.	.	.	.	.	.	G	18.27	3.586492	0.66105	.	.	ENSG00000132463	ENST00000254799;ENST00000439371;ENST00000540657;ENST00000499044;ENST00000502323;ENST00000545193	T;T;T;T;T	0.07908	3.15;3.15;3.15;3.15;3.15	5.97	5.97	0.96955	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (2);	0.045581	0.85682	D	0.000000	T	0.23094	0.0558	L	0.49640	1.575	0.58432	D	0.999999	D;D	0.57571	0.98;0.98	D;P	0.66979	0.948;0.898	T	0.00012	-1.2430	10	0.52906	T	0.07	-4.4152	15.5488	0.76129	0.0676:0.0:0.9324:0.0	.	363;450	B7Z5F9;Q12849	.;GRSF1_HUMAN	D	450;288;382;423;288;332	ENSP00000254799:H450D;ENSP00000389219:H288D;ENSP00000427354:H423D;ENSP00000425430:H288D;ENSP00000443380:H332D	ENSP00000254799:H450D	H	-	1	0	GRSF1	71909922	1.000000	0.71417	1.000000	0.80357	0.777000	0.43975	7.721000	0.84768	2.828000	0.97474	0.655000	0.94253	CAT	GRSF1	-	smart_RRM_dom,pfscan_RRM_dom	ENSG00000132463		0.473	GRSF1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	GRSF1	HGNC	protein_coding	OTTHUMT00000362642.1		0.00	45	0	G	NM_002092		71691058	-1			no_errors	ENST00000254799	ensembl	human	known	74_37	missense	6.25	30	2	SNP	1.000	C
GSG2	83903	genome.wustl.edu	37	17	3629174	3629174	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr17:3629174G>C	ENST00000325418.4	+	1	1964	c.1945G>C	c.(1945-1947)Gac>Cac	p.D649H	ITGAE_ENST00000263087.4_Intron|ITGAE_ENST00000571185.1_Intron	NM_031965.2	NP_114171.2	Q8TF76	HASP_HUMAN	germ cell associated 2 (haspin)	649	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159, ECO:0000305}.				histone H3-T3 phosphorylation involved in chromosome passenger complex localization to kinetochore (GO:2000751)|intracellular signal transduction (GO:0035556)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|protein localization to chromosome, centromeric region (GO:0071459)|protein phosphorylation (GO:0006468)|regulation of spindle checkpoint (GO:0090231)	centrosome (GO:0005813)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|histone kinase activity (H3-T3 specific) (GO:0072354)|protein kinase activity (GO:0004672)										TGAGCACCGAGACTTACACTG	0.532																																																	0													95.0	83.0	87.0					17																	3629174		2203	4300	6503	SO:0001583	missense	0			AB039834	CCDS11036.1	17p13	2005-01-19			ENSG00000177602	ENSG00000177602			19682	protein-coding gene	gene with protein product		609240					Standard	NM_031965		Approved	haspin	uc002fwp.3	Q8TF76	OTTHUMG00000090703	ENST00000325418.4:c.1945G>C	17.37:g.3629174G>C	ENSP00000325290:p.Asp649His		Q5U5K3|Q96MN1|Q9BXS7	Missense_Mutation	SNP	pfam_DUF3635,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom	p.D649H	ENST00000325418.4	37	c.1945	CCDS11036.1	17	.	.	.	.	.	.	.	.	.	.	G	18.83	3.706564	0.68615	.	.	ENSG00000177602	ENST00000325418	D	0.93076	-3.16	4.7	4.7	0.59300	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000001	D	0.97920	0.9316	H	0.97659	4.05	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98985	1.0806	10	0.87932	D	0	-33.1784	15.6646	0.77217	0.0:0.0:1.0:0.0	.	649	Q8TF76	HASP_HUMAN	H	649	ENSP00000325290:D649H	ENSP00000325290:D649H	D	+	1	0	GSG2	3575923	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.511000	0.67024	2.565000	0.86533	0.655000	0.94253	GAC	GSG2	-	pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom	ENSG00000177602		0.532	GSG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSG2	HGNC	protein_coding	OTTHUMT00000207391.1	-	0.00	31	0	G	NM_031965		3629174	+1	tier1	-	no_errors	ENST00000325418	ensembl	human	known	74_37	missense	71.43	2	5	SNP	1.000	C
GUSB	2990	genome.wustl.edu	37	7	65444472	65444472	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr7:65444472C>G	ENST00000304895.4	-	4	768	c.638G>C	c.(637-639)gGa>gCa	p.G213A	GUSB_ENST00000345660.6_Missense_Mutation_p.G213A|GUSB_ENST00000476486.1_5'UTR|GUSB_ENST00000421103.1_Intron	NM_000181.3	NP_000172.2	P08236	BGLR_HUMAN	glucuronidase, beta	213					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)	beta-glucuronidase activity (GO:0004566)			breast(1)|cervix(2)|kidney(2)|large_intestine(4)|lung(10)|skin(1)	20						CCGCTGCAGTCCAGCGTAGTT	0.532																																																	0													122.0	110.0	114.0					7																	65444472		2203	4300	6503	SO:0001583	missense	0			M15182	CCDS5530.1, CCDS64665.1	7q11.21	2012-10-02			ENSG00000169919	ENSG00000169919	3.2.1.31		4696	protein-coding gene	gene with protein product		611499				3468507	Standard	NM_000181		Approved		uc003tun.3	P08236	OTTHUMG00000023735	ENST00000304895.4:c.638G>C	7.37:g.65444472C>G	ENSP00000302728:p.Gly213Ala		B4E1F6|E9PCV0|Q549U0|Q96CL9	Missense_Mutation	SNP	pfam_Glyco_hydro_2_TIM,pfam_Glyco_hydro_2_N,pfam_Glyco_hydro_2_Ig-like,superfamily_Glycoside_hydrolase_SF,superfamily_Galactose-bd-like,superfamily_Glyco_hydro_2_Ig-like,prints_Glyco_hydro_2	p.G213A	ENST00000304895.4	37	c.638	CCDS5530.1	7	.	.	.	.	.	.	.	.	.	.	C	24.1	4.494142	0.85069	.	.	ENSG00000169919	ENST00000304895;ENST00000345660	D;D	0.99887	-7.53;-7.53	5.27	5.27	0.74061	Galactose-binding domain-like (1);Glycoside hydrolase, family 2, N-terminal (1);	0.048894	0.85682	D	0.000000	D	0.99924	0.9965	H	0.96916	3.905	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.96053	0.9033	10	0.87932	D	0	.	17.9613	0.89086	0.0:1.0:0.0:0.0	.	213	P08236	BGLR_HUMAN	A	213	ENSP00000302728:G213A;ENSP00000340734:G213A	ENSP00000302728:G213A	G	-	2	0	GUSB	65081907	1.000000	0.71417	0.995000	0.50966	0.675000	0.39556	7.598000	0.82745	2.464000	0.83262	0.556000	0.70494	GGA	GUSB	-	pfam_Glyco_hydro_2_N,superfamily_Galactose-bd-like	ENSG00000169919		0.532	GUSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GUSB	HGNC	protein_coding	OTTHUMT00000251637.3	-	0.00	74	0	C	NM_000181		65444472	-1	tier1	-	no_errors	ENST00000304895	ensembl	human	known	74_37	missense	15.62	80	15	SNP	1.000	G
HEATR3	55027	genome.wustl.edu	37	16	50104153	50104153	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr16:50104153C>A	ENST00000299192.7	+	4	655	c.464C>A	c.(463-465)tCt>tAt	p.S155Y	HEATR3_ENST00000285767.4_Missense_Mutation_p.S69Y	NM_182922.2	NP_891552.1	Q7Z4Q2	HEAT3_HUMAN	HEAT repeat containing 3	155										cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	28						AACAGAAATTCTATTGAGAAC	0.428																																																	0													105.0	98.0	100.0					16																	50104153		2198	4300	6498	SO:0001583	missense	0			BC018730	CCDS10739.1	16q12.1	2008-02-05			ENSG00000155393	ENSG00000155393			26087	protein-coding gene	gene with protein product		614951				12477932	Standard	XM_005256013		Approved	FLJ20718	uc002efw.3	Q7Z4Q2	OTTHUMG00000133174	ENST00000299192.7:c.464C>A	16.37:g.50104153C>A	ENSP00000299192:p.Ser155Tyr		A8K1N4|Q8N525|Q8WV56|Q96CC9|Q9NWN7	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.S155Y	ENST00000299192.7	37	c.464	CCDS10739.1	16	.	.	.	.	.	.	.	.	.	.	C	5.496	0.276536	0.10403	.	.	ENSG00000155393	ENST00000285767;ENST00000299192	T;T	0.66815	-0.23;-0.23	5.73	2.2	0.27929	Armadillo-type fold (1);	0.352176	0.33327	N	0.005030	T	0.32102	0.0818	N	0.02736	-0.51	0.09310	N	0.999994	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.0	T	0.30327	-0.9982	10	0.02654	T	1	.	7.6336	0.28253	0.3269:0.4435:0.2296:0.0	.	69;155	B7WNW7;Q7Z4Q2	.;HEAT3_HUMAN	Y	69;155	ENSP00000285767:S69Y;ENSP00000299192:S155Y	ENSP00000285767:S69Y	S	+	2	0	HEATR3	48661654	0.631000	0.27164	0.002000	0.10522	0.095000	0.18619	1.174000	0.31932	0.852000	0.35287	-0.176000	0.13171	TCT	HEATR3	-	superfamily_ARM-type_fold	ENSG00000155393		0.428	HEATR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEATR3	HGNC	protein_coding	OTTHUMT00000256880.2		0.00	53	0	C	NM_182922		50104153	+1			no_errors	ENST00000299192	ensembl	human	known	74_37	missense	5.00	57	3	SNP	0.243	A
HECA	51696	genome.wustl.edu	37	6	139498225	139498225	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr6:139498225G>A	ENST00000367658.2	+	4	1900	c.1615G>A	c.(1615-1617)Gtt>Att	p.V539I	RP1-225E12.2_ENST00000587577.1_RNA|RP1-225E12.2_ENST00000590219.1_RNA|RP1-225E12.2_ENST00000585447.1_RNA|RP1-225E12.2_ENST00000588638.1_RNA|RP1-225E12.2_ENST00000586229.1_RNA|RP1-225E12.2_ENST00000588529.1_RNA|RP1-225E12.2_ENST00000589192.1_RNA|RP1-225E12.3_ENST00000585874.1_RNA|RP1-225E12.2_ENST00000591102.1_RNA|RP1-225E12.2_ENST00000586266.1_RNA|RP1-225E12.2_ENST00000415194.2_RNA|RP1-225E12.2_ENST00000590679.1_RNA	NM_016217.2	NP_057301.1	Q9UBI9	HDC_HUMAN	headcase homolog (Drosophila)	539					respiratory tube development (GO:0030323)	membrane (GO:0016020)				endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|skin(1)	15				GBM - Glioblastoma multiforme(68;0.000252)|OV - Ovarian serous cystadenocarcinoma(155;0.000387)		CTCCTTCAAAGTTCTCGAAGC	0.383																																																	0													83.0	74.0	77.0					6																	139498225		2203	4300	6503	SO:0001583	missense	0			AB033492	CCDS5194.1	6q23-q24	2010-11-25			ENSG00000112406	ENSG00000112406			21041	protein-coding gene	gene with protein product		607977				11696983, 19643820	Standard	NM_016217		Approved	HDCL, hHDC, HDC, dJ225E12.1	uc003qin.3	Q9UBI9	OTTHUMG00000015686	ENST00000367658.2:c.1615G>A	6.37:g.139498225G>A	ENSP00000356630:p.Val539Ile			Missense_Mutation	SNP	superfamily_Glycoside_hydrolase_SF	p.V539I	ENST00000367658.2	37	c.1615	CCDS5194.1	6	.	.	.	.	.	.	.	.	.	.	G	33	5.226983	0.95173	.	.	ENSG00000112406	ENST00000367658	.	.	.	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	T	0.57359	0.2048	N	0.14661	0.345	0.80722	D	1	D	0.67145	0.996	D	0.76071	0.987	T	0.62895	-0.6757	9	0.54805	T	0.06	.	20.6634	0.99662	0.0:0.0:1.0:0.0	.	539	Q9UBI9	HDC_HUMAN	I	539	.	ENSP00000356630:V539I	V	+	1	0	HECA	139539918	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.476000	0.97823	2.894000	0.99253	0.655000	0.94253	GTT	HECA	-	NULL	ENSG00000112406		0.383	HECA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HECA	HGNC	protein_coding	OTTHUMT00000042456.1	-	0.00	61	0	G	NM_016217		139498225	+1	tier1	-	no_errors	ENST00000367658	ensembl	human	known	74_37	missense	52.00	48	52	SNP	1.000	A
HECTD4	283450	genome.wustl.edu	37	12	112622969	112622969	+	Silent	SNP	C	C	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr12:112622969C>T	ENST00000430131.2	-	60	9680	c.8535G>A	c.(8533-8535)gtG>gtA	p.V2845V	HECTD4_ENST00000377560.5_Silent_p.V3095V|HECTD4_ENST00000550722.1_Silent_p.V3121V			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	2845					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										TAGGCAGGGTCACTTCGGCCA	0.647																																																	0													16.0	18.0	17.0					12																	112622969		2012	4112	6124	SO:0001819	synonymous_variant	0			AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.8535G>A	12.37:g.112622969C>T			L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Silent	SNP	pfam_HECT,superfamily_HECT,superfamily_ConA-like_lec_gl_sf,smart_HECT,pfscan_HECT	p.V3095	ENST00000430131.2	37	c.9285		12																																																																																			HECTD4	-	NULL	ENSG00000173064		0.647	HECTD4-202	KNOWN	basic	protein_coding	HECTD4	HGNC	protein_coding		-	0.00	48	0	C	NM_173813		112622969	-1	tier1	-	no_errors	ENST00000377560	ensembl	human	known	74_37	silent	21.21	51	14	SNP	0.994	T
HELZ2	85441	genome.wustl.edu	37	20	62194076	62194076	+	Silent	SNP	C	C	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr20:62194076C>T	ENST00000467148.1	-	8	6168	c.6099G>A	c.(6097-6099)ctG>ctA	p.L2033L	HELZ2_ENST00000427522.2_Silent_p.L1464L	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator	2033					cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										GGTCAACATTCAGGCCAGGGC	0.706																																																	0													13.0	15.0	14.0					20																	62194076		2180	4285	6465	SO:0001819	synonymous_variant	0			AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.6099G>A	20.37:g.62194076C>T			Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	Silent	SNP	superfamily_P-loop_NTPase	p.L2033	ENST00000467148.1	37	c.6099	CCDS33508.1	20																																																																																			HELZ2	-	NULL	ENSG00000130589		0.706	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	HELZ2	HGNC	protein_coding	OTTHUMT00000354127.1	-	0.00	74	0	C	NM_001037335		62194076	-1	tier1	-	no_errors	ENST00000467148	ensembl	human	known	74_37	silent	33.00	67	33	SNP	0.026	T
HIPK1	204851	genome.wustl.edu	37	1	114483016	114483016	+	Missense_Mutation	SNP	A	A	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr1:114483016A>T	ENST00000369558.1	+	2	243	c.11A>T	c.(10-12)cAg>cTg	p.Q4L	HIPK1_ENST00000426820.2_Missense_Mutation_p.Q4L|HIPK1_ENST00000369554.2_Missense_Mutation_p.Q4L|HIPK1_ENST00000369561.4_Missense_Mutation_p.Q4L|HIPK1_ENST00000369555.2_Missense_Mutation_p.Q4L|HIPK1_ENST00000369559.4_Missense_Mutation_p.Q4L			Q86Z02	HIPK1_HUMAN	homeodomain interacting protein kinase 1	4					anterior/posterior pattern specification (GO:0009952)|definitive hemopoiesis (GO:0060216)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endothelial cell apoptotic process (GO:0072577)|extrinsic apoptotic signaling pathway (GO:0097191)|eye development (GO:0001654)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|iris morphogenesis (GO:0061072)|lens induction in camera-type eye (GO:0060235)|neuron differentiation (GO:0030182)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tumor necrosis factor-mediated signaling pathway (GO:0010803)|retina layer formation (GO:0010842)|smoothened signaling pathway (GO:0007224)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(15)|ovary(4)|prostate(2)	39	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.09e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		ATGGCATCACAGCTGCAAGTG	0.438																																																	0													114.0	123.0	120.0					1																	114483016		2203	4300	6503	SO:0001583	missense	0			AB089957	CCDS867.1, CCDS868.1, CCDS869.1, CCDS41370.1	1p13.1	2008-02-05			ENSG00000163349	ENSG00000163349			19006	protein-coding gene	gene with protein product		608003					Standard	NM_198268		Approved	KIAA0630, Myak, MGC26642, Nbak2, MGC33446, MGC33548	uc001eem.3	Q86Z02	OTTHUMG00000011983	ENST00000369558.1:c.11A>T	1.37:g.114483016A>T	ENSP00000358571:p.Gln4Leu		A6NJ34|O75125|Q5SQL2|Q5SQL4|Q5SQL5|Q8IYD7|Q8NDN5|Q8NEB6|Q8TBZ1	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.Q4L	ENST00000369558.1	37	c.11	CCDS867.1	1	.	.	.	.	.	.	.	.	.	.	A	15.67	2.902228	0.52227	.	.	ENSG00000163349	ENST00000426820;ENST00000369559;ENST00000443627;ENST00000369554;ENST00000369555;ENST00000369558;ENST00000369561;ENST00000514621;ENST00000503968	T;T;T;T;T;T;T;T;T	0.57907	0.37;0.43;0.47;0.52;0.52;0.47;0.49;0.62;0.62	4.78	4.78	0.61160	.	0.000000	0.64402	D	0.000009	T	0.60894	0.2304	M	0.64170	1.965	0.80722	D	1	D;D	0.57899	0.967;0.981	P;D	0.67900	0.901;0.954	T	0.67146	-0.5744	10	0.87932	D	0	.	14.3323	0.66566	1.0:0.0:0.0:0.0	.	4;4	Q86Z02;Q86Z02-2	HIPK1_HUMAN;.	L	75;4;4;4;4;4;4;4;4	ENSP00000407442:Q75L;ENSP00000358572:Q4L;ENSP00000409673:Q4L;ENSP00000358567:Q4L;ENSP00000358568:Q4L;ENSP00000358571:Q4L;ENSP00000358574:Q4L;ENSP00000422322:Q4L;ENSP00000426695:Q4L	ENSP00000358567:Q4L	Q	+	2	0	HIPK1	114284539	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.339000	0.96797	1.772000	0.52199	0.528000	0.53228	CAG	HIPK1	-	NULL	ENSG00000163349		0.438	HIPK1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	HIPK1	HGNC	protein_coding	OTTHUMT00000033127.1	-	0.00	51	0	A	NM_198268		114483016	+1	tier1	-	no_errors	ENST00000369558	ensembl	human	known	74_37	missense	30.61	34	15	SNP	1.000	T
HIRIP3	8479	genome.wustl.edu	37	16	30006911	30006911	+	Nonsense_Mutation	SNP	C	C	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr16:30006911C>A	ENST00000279392.3	-	1	846	c.16G>T	c.(16-18)Gag>Tag	p.E6*	HIRIP3_ENST00000566471.1_5'UTR|HIRIP3_ENST00000564026.1_Nonsense_Mutation_p.E6*|INO80E_ENST00000567254.1_5'Flank|INO80E_ENST00000567705.1_5'Flank|INO80E_ENST00000563197.1_5'UTR|INO80E_ENST00000304516.7_5'Flank	NM_003609.4	NP_003600.2	Q9BW71	HIRP3_HUMAN	HIRA interacting protein 3	6					chromatin assembly or disassembly (GO:0006333)	nucleus (GO:0005634)				central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|liver(1)|lung(9)	17						TCCTGCATCTCCTTCTCCCGC	0.652																																																	0													76.0	72.0	73.0					16																	30006911		2197	4300	6497	SO:0001587	stop_gained	0			AJ223351	CCDS10664.1, CCDS58449.1	16p12.1	2008-02-05	2001-11-29		ENSG00000149929	ENSG00000149929			4917	protein-coding gene	gene with protein product		603365	"""HIRA-interacting protein 3"""			9710638	Standard	NM_003609		Approved		uc002dve.3	Q9BW71	OTTHUMG00000132118	ENST00000279392.3:c.16G>T	16.37:g.30006911C>A	ENSP00000279392:p.Glu6*		H3BSR3|O75707|O75708	Nonsense_Mutation	SNP	pfam_Histone_chaperone_domain_CHZ	p.E6*	ENST00000279392.3	37	c.16	CCDS10664.1	16	.	.	.	.	.	.	.	.	.	.	C	37	6.123278	0.97305	.	.	ENSG00000149929	ENST00000279392;ENST00000352552	.	.	.	5.45	5.45	0.79879	.	0.231425	0.35179	N	0.003387	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-30.2303	16.8413	0.85970	0.0:1.0:0.0:0.0	.	.	.	.	X	6	.	ENSP00000279392:E6X	E	-	1	0	HIRIP3	29914412	0.993000	0.37304	0.996000	0.52242	0.995000	0.86356	4.083000	0.57643	2.835000	0.97688	0.650000	0.86243	GAG	HIRIP3	-	NULL	ENSG00000149929		0.652	HIRIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIRIP3	HGNC	protein_coding	OTTHUMT00000255160.2		0.00	91	0	C	NM_003609		30006911	-1			no_errors	ENST00000279392	ensembl	human	known	74_37	nonsense	5.48	69	4	SNP	0.993	A
HIST1H3G	8355	genome.wustl.edu	37	6	26271605	26271605	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr6:26271605C>T	ENST00000305910.3	-	1	7	c.8G>A	c.(7-9)cGc>cAc	p.R3H	HIST1H2BI_ENST00000377733.2_5'Flank	NM_003534.2	NP_003525.1	P68431	H31_HUMAN	histone cluster 1, H3g	3					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	12						CTGCTTGGTGCGGGCCATCTC	0.562																																																	0													24.0	27.0	26.0					6																	26271605		2192	4283	6475	SO:0001583	missense	0			Z80785	CCDS4602.1	6p22.1	2011-07-22	2006-10-11	2003-03-14	ENSG00000256018			"""Histones / Replication-dependent"""	4772	protein-coding gene	gene with protein product		602815	"""H3 histone family, member H"", ""histone 1, H3g"""	H3FH		9119399, 12408966	Standard	NM_003534		Approved	H3/h	uc003nhi.3	P68431	OTTHUMG00000014436	ENST00000305910.3:c.8G>A	6.37:g.26271605C>T	ENSP00000439660:p.Arg3His		A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	p.R3H	ENST00000305910.3	37	c.8	CCDS4602.1	6	.	.	.	.	.	.	.	.	.	.	.	13.88	2.368416	0.42003	.	.	ENSG00000256018	ENST00000305910	T	0.46819	0.86	4.36	4.36	0.52297	.	.	.	.	.	T	0.53126	0.1777	.	.	.	0.35535	D	0.802545	.	.	.	.	.	.	T	0.60762	-0.7199	6	0.62326	D	0.03	.	16.2821	0.82697	0.0:1.0:0.0:0.0	.	.	.	.	H	3	ENSP00000439660:R3H	ENSP00000439660:R3H	R	-	2	0	HIST1H3G	26379584	0.989000	0.36119	0.647000	0.29507	0.008000	0.06430	5.890000	0.69774	2.157000	0.67596	0.563000	0.77884	CGC	HIST1H3G	-	superfamily_Histone-fold,prints_Histone_H3	ENSG00000256018		0.562	HIST1H3G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H3G	HGNC	protein_coding	OTTHUMT00000040099.2		0.00	55	0	C	NM_003534		26271605	-1			no_errors	ENST00000305910	ensembl	human	known	74_37	missense	6.45	58	4	SNP	0.923	T
HLA-F	3134	genome.wustl.edu	37	6	29693994	29693994	+	Intron	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr6:29693994G>T	ENST00000376861.1	+	7	1420				HLA-F_ENST00000434407.2_Intron|HLA-F_ENST00000259951.7_Intron|HLA-F_ENST00000475996.1_Intron|HLA-F_ENST00000334668.4_Intron|HLA-F_ENST00000440587.2_Intron			P30511	HLAF_HUMAN	major histocompatibility complex, class I, F						antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)	early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|membrane (GO:0016020)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)|TAP1 binding (GO:0046978)|TAP2 binding (GO:0046979)			cervix(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	8						GTCTCTCACAGCTAATAAAGG	0.562																																																	0													49.0	47.0	48.0					6																	29693994		876	1991	2867	SO:0001627	intron_variant	0			AY253269	CCDS43437.1, CCDS43438.1, CCDS43439.1	6p21.3	2013-01-11			ENSG00000204642	ENSG00000204642		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4963	protein-coding gene	gene with protein product		143110				1688605	Standard	NM_018950		Approved		uc003nno.4	P30511	OTTHUMG00000031156	ENST00000376861.1:c.1036+174G>T	6.37:g.29693994G>T			Q5JQI8|Q5JQJ1|Q5SPT5|Q860R0|Q8MGQ1|Q8WLP5|Q95HC0|Q9TP68	RNA	SNP	-	NULL	ENST00000376861.1	37	NULL	CCDS43438.1	6																																																																																			HLA-F	-	-	ENSG00000204642		0.562	HLA-F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-F	HGNC	protein_coding	OTTHUMT00000195083.1	-	0.00	61	0	G	NM_018950		29693994	+1	tier1	-	no_errors	ENST00000484704	ensembl	human	known	74_37	rna	10.81	33	4	SNP	0.002	T
HLA-DQA2	3118	genome.wustl.edu	37	6	32713585	32713585	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr6:32713585G>T	ENST00000374940.3	+	3	451	c.349G>T	c.(349-351)Gtg>Ttg	p.V117L		NM_020056.4	NP_064440.1	P01906	DQA2_HUMAN	major histocompatibility complex, class II, DQ alpha 2	117	Alpha-2.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	MHC class II receptor activity (GO:0032395)			endometrium(2)|large_intestine(3)|lung(7)|skin(1)	13					"""""""Insulin(DB00071)"""	TGAGGTCACAGTGTTTTCCAA	0.507																																																	0													174.0	134.0	148.0					6																	32713585		1511	2709	4220	SO:0001583	missense	0				CCDS4753.1	6p21.3	2013-01-11			ENSG00000237541	ENSG00000237541		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4943	protein-coding gene	gene with protein product		613503		HLA-DXA			Standard	NM_020056		Approved		uc003obx.3	P01906	OTTHUMG00000031108	ENST00000374940.3:c.349G>T	6.37:g.32713585G>T	ENSP00000364076:p.Val117Leu		A2BF37|B0V0E7|O19789|Q5SQ94|Q5SR04	Missense_Mutation	SNP	pfam_MHC_II_a_N,pfam_Ig_C1-set,pfam_CD80_C2-set,superfamily_MHC_I/II-like_Ag-recog,smart_MHC_II_a_N,smart_Ig_C1-set,pfscan_Ig-like_dom	p.V117L	ENST00000374940.3	37	c.349	CCDS4753.1	6	.	.	.	.	.	.	.	.	.	.	.	7.883	0.730714	0.15507	.	.	ENSG00000237541	ENST00000374940	T	0.00606	6.26	3.06	3.06	0.35304	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.243651	0.34362	U	0.004036	T	0.00356	0.0011	L	0.56769	1.78	0.29132	N	0.879602	P	0.35542	0.508	B	0.37692	0.256	T	0.44065	-0.9352	10	0.59425	D	0.04	.	8.2477	0.31698	0.0:0.2475:0.7525:0.0	.	117	P01906	DQA2_HUMAN	L	117	ENSP00000364076:V117L	ENSP00000364076:V117L	V	+	1	0	HLA-DQA2	32821563	0.994000	0.37717	0.994000	0.49952	0.216000	0.24613	2.456000	0.44997	1.700000	0.51204	0.174000	0.16983	GTG	HLA-DQA2	-	pfscan_Ig-like_dom	ENSG00000237541		0.507	HLA-DQA2-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	HLA-DQA2	HGNC	protein_coding	OTTHUMT00000076179.2	-	0.00	70	0	G	NM_020056		32713585	+1	tier1	-	no_errors	ENST00000374940	ensembl	human	known	74_37	missense	6.33	74	5	SNP	0.992	T
HMGN2	3151	genome.wustl.edu	37	1	26801464	26801464	+	Intron	SNP	G	G	C			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr1:26801464G>C	ENST00000361427.5	+	6	331				HMGN2_ENST00000493418.1_3'UTR	NM_005517.3	NP_005508.1	P05204	HMGN2_HUMAN	high mobility group nucleosomal binding domain 2							chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|lung(2)	3		all_cancers(24;1.9e-24)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00637)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;3.38e-49)|OV - Ovarian serous cystadenocarcinoma(117;5.38e-28)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|BRCA - Breast invasive adenocarcinoma(304;0.000946)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.026)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.153)|LUSC - Lung squamous cell carcinoma(448;0.227)		tacctagtaagtcattctcag	0.438																																																	0																																										SO:0001627	intron_variant	0			BC081567	CCDS283.1	1p36.1	2011-07-01	2011-04-05	2002-08-16	ENSG00000198830	ENSG00000198830		"""High-mobility group / Canonical"""	4986	protein-coding gene	gene with protein product		163910	"""high-mobility group (nonhistone chromosomal) protein 17"", ""high-mobility group nucleosomal binding domain 2"""	HMG17		2037294	Standard	NM_005517		Approved		uc001bmp.4	P05204	OTTHUMG00000003555	ENST00000361427.5:c.238-140G>C	1.37:g.26801464G>C			Q0VGD5|Q6FGI5|Q96C64	RNA	SNP	-	NULL	ENST00000361427.5	37	NULL	CCDS283.1	1																																																																																			HMGN2	-	-	ENSG00000198830		0.438	HMGN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMGN2	HGNC	protein_coding	OTTHUMT00000009901.1	-	0.00	11	0	G	NM_005517		26801464	+1	tier1	-	no_errors	ENST00000493418	ensembl	human	known	74_37	rna	44.44	10	8	SNP	0.001	C
HMGCS2	3158	genome.wustl.edu	37	1	120298175	120298175	+	Missense_Mutation	SNP	T	T	G			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr1:120298175T>G	ENST00000369406.3	-	6	1111	c.1062A>C	c.(1060-1062)aaA>aaC	p.K354N	HMGCS2_ENST00000544913.2_Missense_Mutation_p.K312N|HMGCS2_ENST00000476640.1_5'UTR	NM_005518.3	NP_005509.1	P54868	HMCS2_HUMAN	3-hydroxy-3-methylglutaryl-CoA synthase 2 (mitochondrial)	354					cellular ketone body metabolic process (GO:0046950)|cellular lipid metabolic process (GO:0044255)|cholesterol biosynthetic process (GO:0006695)|isoprenoid biosynthetic process (GO:0008299)|ketone body biosynthetic process (GO:0046951)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	hydroxymethylglutaryl-CoA synthase activity (GO:0004421)			NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(1)|lung(13)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	28	all_cancers(5;6.38e-10)|all_epithelial(5;1.1e-10)|Melanoma(3;1.93e-05)|Breast(55;0.218)|all_neural(166;0.219)	all_lung(203;1.29e-06)|Lung NSC(69;9.35e-06)|all_epithelial(167;0.00124)		Lung(183;0.0112)|LUSC - Lung squamous cell carcinoma(189;0.0595)		TTAGAAGTGCTTTATCCAGGT	0.537																																																	0													510.0	492.0	498.0					1																	120298175		2203	4300	6503	SO:0001583	missense	0			BC044217	CCDS905.1, CCDS53353.1	1p13-p12	2014-09-17	2010-04-30		ENSG00000134240	ENSG00000134240			5008	protein-coding gene	gene with protein product		600234	"""3-hydroxy-3-methylglutaryl-Coenzyme A synthase 2 (mitochondrial)"""			7851882, 7893153	Standard	NM_005518		Approved		uc001eid.3	P54868	OTTHUMG00000012101	ENST00000369406.3:c.1062A>C	1.37:g.120298175T>G	ENSP00000358414:p.Lys354Asn		B7Z8R3|D3Y5K6|Q5SZU2|Q6IBF4	Missense_Mutation	SNP	pfam_HMG_CoA_synt_C,pfam_HMG_CoA_synth_N,superfamily_Thiolase-like,tigrfam_HMG_CoA_synthase_euk	p.K354N	ENST00000369406.3	37	c.1062	CCDS905.1	1	.	.	.	.	.	.	.	.	.	.	T	15.07	2.723478	0.48728	.	.	ENSG00000134240	ENST00000369406;ENST00000544913	T;T	0.81330	-1.48;-1.48	5.4	-3.15	0.05233	Hydroxymethylglutaryl-coenzyme A synthase C-terminal (1);Thiolase-like (1);	0.605383	0.16478	N	0.212676	D	0.88388	0.6423	M	0.93594	3.435	0.49687	D	0.999812	D;D	0.76494	0.999;0.998	D;D	0.77004	0.989;0.975	D	0.90660	0.4589	10	0.87932	D	0	-4.9148	13.8646	0.63581	0.0:0.6793:0.0:0.3207	.	312;354	B7Z8R3;P54868	.;HMCS2_HUMAN	N	354;312	ENSP00000358414:K354N;ENSP00000439495:K312N	ENSP00000358414:K354N	K	-	3	2	HMGCS2	120099698	0.998000	0.40836	0.035000	0.18076	0.183000	0.23260	0.509000	0.22707	-0.498000	0.06632	0.533000	0.62120	AAA	HMGCS2	-	pfam_HMG_CoA_synt_C,superfamily_Thiolase-like,tigrfam_HMG_CoA_synthase_euk	ENSG00000134240		0.537	HMGCS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMGCS2	HGNC	protein_coding	OTTHUMT00000033469.2	-	0.00	75	0	T	NM_005518		120298175	-1	tier1	-	no_errors	ENST00000369406	ensembl	human	known	74_37	missense	19.44	58	14	SNP	0.994	G
HMCN1	83872	genome.wustl.edu	37	1	186151375	186151375	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr1:186151375G>T	ENST00000271588.4	+	105	16599	c.16370G>T	c.(16369-16371)tGc>tTc	p.C5457F	HMCN1_ENST00000367492.2_Missense_Mutation_p.C5340F	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	5457	EGF-like 7; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						CAGTGCATCTGCCCACCTGGC	0.408																																																	0													132.0	123.0	126.0					1																	186151375		2203	4300	6503	SO:0001583	missense	0			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.16370G>T	1.37:g.186151375G>T	ENSP00000271588:p.Cys5457Phe		A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_G2_nidogen/fibulin_G2F,pfam_EGF-like_Ca-bd_dom,pfam_Thrombospondin_1_rpt,superfamily_GFP,superfamily_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_Cadherin-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Thrombospondin_1_rpt,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom	p.C5457F	ENST00000271588.4	37	c.16370	CCDS30956.1	1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.552246	0.86127	.	.	ENSG00000143341	ENST00000271588;ENST00000367492;ENST00000414277	D;D;D	0.99999	-13.64;-13.64;-13.64	5.42	5.42	0.78866	Growth factor, receptor (1);EGF-like region, conserved site (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.99999	1.0000	H	0.99900	4.915	0.80722	D	1	D	0.67145	0.996	D	0.83275	0.996	D	0.99998	1.6972	10	0.87932	D	0	.	19.2127	0.93763	0.0:0.0:1.0:0.0	.	5457	Q96RW7	HMCN1_HUMAN	F	5457;5340;132	ENSP00000271588:C5457F;ENSP00000356462:C5340F;ENSP00000406205:C132F	ENSP00000271588:C5457F	C	+	2	0	HMCN1	184417998	1.000000	0.71417	0.992000	0.48379	0.990000	0.78478	9.562000	0.98145	2.528000	0.85240	0.563000	0.77884	TGC	HMCN1	-	pfam_EGF-like_Ca-bd_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom	ENSG00000143341		0.408	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	HGNC	protein_coding	OTTHUMT00000131848.1		0.00	29	0	G	NM_031935		186151375	+1			no_errors	ENST00000271588	ensembl	human	known	74_37	missense	5.26	36	2	SNP	1.000	T
HOXB3	3213	genome.wustl.edu	37	17	46627744	46627744	+	Silent	SNP	A	A	G			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr17:46627744A>G	ENST00000470495.1	-	2	2695	c.1248T>C	c.(1246-1248)ccT>ccC	p.P416P	HOXB3_ENST00000485909.2_Silent_p.P284P|HOXB3_ENST00000490677.1_Silent_p.P282P|HOXB3_ENST00000498678.1_Silent_p.P416P|HOXB3_ENST00000460160.1_Silent_p.P284P|HOXB3_ENST00000489475.1_Silent_p.P343P|HOXB-AS3_ENST00000465846.2_RNA|HOXB-AS1_ENST00000508688.1_RNA|HOXB-AS1_ENST00000435312.1_RNA|HOXB3_ENST00000472863.1_Silent_p.P343P|HOXB-AS1_ENST00000502764.2_RNA|HOXB3_ENST00000476342.1_Silent_p.P416P|HOXB3_ENST00000311626.4_Silent_p.P416P			P14651	HXB3_HUMAN	homeobox B3	416					angiogenesis (GO:0001525)|anterior/posterior pattern specification (GO:0009952)|cartilage development (GO:0051216)|definitive hemopoiesis (GO:0060216)|embryonic skeletal system morphogenesis (GO:0048704)|face development (GO:0060324)|glossopharyngeal nerve morphogenesis (GO:0021615)|hematopoietic progenitor cell differentiation (GO:0002244)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of neurogenesis (GO:0050767)|rhombomere development (GO:0021546)|thyroid gland development (GO:0030878)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|kidney(2)|large_intestine(2)|lung(16)|prostate(4)|upper_aerodigestive_tract(1)	30						CCTGAGGAGGAGGCGCGTGGT	0.612											OREG0024516	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													80.0	91.0	87.0					17																	46627744		2202	4300	6502	SO:0001819	synonymous_variant	0				CCDS11528.1	17q21.32	2011-06-20	2005-12-22		ENSG00000120093	ENSG00000120093		"""Homeoboxes / ANTP class : HOXL subclass"""	5114	protein-coding gene	gene with protein product		142966	"""homeo box B3"""	HOX2, HOX2G		1973146, 1358459	Standard	XM_006721854		Approved		uc002ino.3	P14651	OTTHUMG00000159922	ENST00000470495.1:c.1248T>C	17.37:g.46627744A>G		940	A8K567|B7Z5N8|B7Z5P8|B7ZAD0|D3DTV3|O95615|P17484	Silent	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa	p.P416	ENST00000470495.1	37	c.1248	CCDS11528.1	17																																																																																			HOXB3	-	NULL	ENSG00000120093		0.612	HOXB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXB3	HGNC	protein_coding	OTTHUMT00000358261.1	-	0.00	29	0	A			46627744	-1	tier1	-	no_errors	ENST00000311626	ensembl	human	known	74_37	silent	16.67	50	10	SNP	0.822	G
HSF5	124535	genome.wustl.edu	37	17	56544249	56544249	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr17:56544249G>T	ENST00000323777.3	-	3	1126	c.1017C>A	c.(1015-1017)ttC>ttA	p.F339L		NM_001080439.1	NP_001073908.1	Q4G112	HSF5_HUMAN	heat shock transcription factor family member 5	339					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|ovary(3)|skin(1)	16	Medulloblastoma(34;0.127)|all_neural(34;0.237)					ATCTTACCTGGAAGTAGTTGC	0.418																																																	0													171.0	139.0	150.0					17																	56544249		2203	4300	6503	SO:0001583	missense	0			BC033020	CCDS32690.1	17q23.2	2006-04-25				ENSG00000176160			26862	protein-coding gene	gene with protein product							Standard	NM_001080439		Approved	FLJ40311	uc002iwi.1	Q4G112		ENST00000323777.3:c.1017C>A	17.37:g.56544249G>T	ENSP00000313243:p.Phe339Leu		Q08EH7|Q8N7V2	Missense_Mutation	SNP	pfam_HSF_DNA-bd,smart_HSF_DNA-bd	p.F339L	ENST00000323777.3	37	c.1017	CCDS32690.1	17	.	.	.	.	.	.	.	.	.	.	G	25.9	4.686658	0.88639	.	.	ENSG00000176160	ENST00000412540;ENST00000323777	T	0.72167	-0.63	6.08	4.11	0.48088	.	0.000000	0.64402	D	0.000001	T	0.71676	0.3368	L	0.27053	0.805	0.37691	D	0.923852	D	0.58268	0.982	D	0.67548	0.952	T	0.75852	-0.3171	10	0.56958	D	0.05	.	9.7363	0.40390	0.1582:0.0:0.8418:0.0	.	339	Q4G112	HSF5_HUMAN	L	239;339	ENSP00000313243:F339L	ENSP00000313243:F339L	F	-	3	2	HSF5	53899248	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	2.585000	0.46111	1.594000	0.50039	0.591000	0.81541	TTC	HSF5	-	NULL	ENSG00000176160		0.418	HSF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSF5	HGNC	protein_coding	OTTHUMT00000444719.1	-	0.00	66	0	G	XM_064190		56544249	-1	tier1	-	no_errors	ENST00000323777	ensembl	human	known	74_37	missense	42.31	30	22	SNP	1.000	T
HYAL4	23553	genome.wustl.edu	37	7	123516966	123516966	+	Silent	SNP	C	C	T	rs138582057	byFrequency	TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr7:123516966C>T	ENST00000223026.4	+	5	1841	c.1203C>T	c.(1201-1203)aaC>aaT	p.N401N	HYAL4_ENST00000476325.1_Silent_p.N401N	NM_012269.2	NP_036401.2	Q2M3T9	HYAL4_HUMAN	hyaluronoglucosaminidase 4	401					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate catabolic process (GO:0030207)|glycosaminoglycan catabolic process (GO:0006027)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)	hyalurononglucosaminidase activity (GO:0004415)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	23						TTCACTTGAACCCTGCAAGTT	0.502																																																	0								C		0,4406		0,0,2203	138.0	129.0	132.0		1203	3.1	0.9	7	dbSNP_134	132	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	HYAL4	NM_012269.2		0,2,6501	TT,TC,CC		0.0233,0.0,0.0154		401/482	123516966	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	0			AF009010	CCDS5789.1	7q31.3	2010-01-14			ENSG00000106302	ENSG00000106302			5323	protein-coding gene	gene with protein product	"""hyaluronidase 4"""	604510				10493834	Standard	NM_012269		Approved		uc003vlc.3	Q2M3T9	OTTHUMG00000157349	ENST00000223026.4:c.1203C>T	7.37:g.123516966C>T			D0VXG1|Q9UL99|Q9Y6T9	Silent	SNP	pfam_Hyaluronidase,superfamily_Glycoside_hydrolase_SF,pirsf_Hyaluronidase,prints_Hyaluronidase	p.N401	ENST00000223026.4	37	c.1203	CCDS5789.1	7																																																																																			HYAL4	-	pirsf_Hyaluronidase	ENSG00000106302		0.502	HYAL4-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HYAL4	HGNC	protein_coding	OTTHUMT00000348545.1		0.00	117	0	C	NM_012269		123516966	+1			no_errors	ENST00000223026	ensembl	human	known	74_37	silent	6.17	76	5	SNP	0.911	T
IBSP	3381	genome.wustl.edu	37	4	88723869	88723869	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr4:88723869C>G	ENST00000226284.5	+	4	236	c.169C>G	c.(169-171)Cga>Gga	p.R57G		NM_004967.3	NP_004958.2	P21815	SIAL_HUMAN	integrin-binding sialoprotein	57					biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|cellular response to growth factor stimulus (GO:0071363)|extracellular matrix organization (GO:0030198)|osteoblast differentiation (GO:0001649)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|membrane-bounded vesicle (GO:0031988)				breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(10)	21		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000333)|COAD - Colon adenocarcinoma(81;0.154)		TCATTTAAAACGATTTCCAGT	0.254																																																	0													41.0	41.0	41.0					4																	88723869		2198	4285	6483	SO:0001583	missense	0				CCDS3624.1	4q21.1	2008-07-28	2008-07-28		ENSG00000029559	ENSG00000029559			5341	protein-coding gene	gene with protein product	"""bone sialoprotein"", ""bone sialoprotein II"""	147563				8406493	Standard	NM_004967		Approved	BSP, SP-II, BSP-II	uc003hqx.4	P21815	OTTHUMG00000130600	ENST00000226284.5:c.169C>G	4.37:g.88723869C>G	ENSP00000226284:p.Arg57Gly			Missense_Mutation	SNP	pfam_BSP_II	p.R57G	ENST00000226284.5	37	c.169	CCDS3624.1	4	.	.	.	.	.	.	.	.	.	.	C	17.81	3.480372	0.63849	.	.	ENSG00000029559	ENST00000226284	T	0.21361	2.01	5.58	5.58	0.84498	.	0.000000	0.56097	D	0.000035	T	0.48519	0.1504	M	0.79475	2.455	0.45554	D	0.998506	D	0.89917	1.0	D	0.91635	0.999	T	0.49781	-0.8903	10	0.87932	D	0	.	15.0748	0.72069	0.0:1.0:0.0:0.0	.	57	P21815	SIAL_HUMAN	G	57	ENSP00000226284:R57G	ENSP00000226284:R57G	R	+	1	2	IBSP	88942893	1.000000	0.71417	1.000000	0.80357	0.682000	0.39822	1.175000	0.31944	2.631000	0.89168	0.467000	0.42956	CGA	IBSP	-	pfam_BSP_II	ENSG00000029559		0.254	IBSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IBSP	HGNC	protein_coding	OTTHUMT00000253050.2	-	0.00	49	0	C			88723869	+1	tier1	-	no_errors	ENST00000226284	ensembl	human	known	74_37	missense	16.33	41	8	SNP	1.000	G
IDI1	3422	genome.wustl.edu	37	10	1088605	1088605	+	Silent	SNP	C	C	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr10:1088605C>T	ENST00000381344.3	-	4	670	c.504G>A	c.(502-504)cgG>cgA	p.R168R	RNU7-163P_ENST00000459467.1_RNA|IDI2-AS1_ENST00000536039.1_RNA|IDI2-AS1_ENST00000428780.2_RNA|IDI2-AS1_ENST00000420381.1_RNA|IDI2-AS1_ENST00000437374.1_RNA|IDI1_ENST00000491735.1_5'UTR	NM_004508.2	NP_004499.2	Q13907	IDI1_HUMAN	isopentenyl-diphosphate delta isomerase 1	111	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.				cholesterol biosynthetic process (GO:0006695)|dimethylallyl diphosphate biosynthetic process (GO:0050992)|isoprenoid biosynthetic process (GO:0008299)|response to stilbenoid (GO:0035634)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)	hydrolase activity (GO:0016787)|isopentenyl-diphosphate delta-isomerase activity (GO:0004452)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|metal ion binding (GO:0046872)			large_intestine(3)|lung(2)|prostate(1)	6		all_epithelial(10;0.107)|Colorectal(49;0.14)	OV - Ovarian serous cystadenocarcinoma(33;0.221)	Epithelial(11;0.0972)		CAGCTTTCAGCCGTCTCTGTG	0.448																																																	0													101.0	91.0	95.0					10																	1088605		2203	4300	6503	SO:0001819	synonymous_variant	0			BC006999	CCDS7056.1	10p15.3	2003-11-12	2005-07-25		ENSG00000067064	ENSG00000067064	5.3.3.2		5387	protein-coding gene	gene with protein product	"""IPP isomerase"""	604055	"""isopentenyl-diphosphate delta isomerase"""			8020941	Standard	NM_004508		Approved		uc001iga.3	Q13907	OTTHUMG00000017536	ENST00000381344.3:c.504G>A	10.37:g.1088605C>T			B4E155|Q32Q13|Q53GQ6|Q86U81|Q8WUX8|Q96IZ4|Q9BQ74	Silent	SNP	pfam_NUDIX_hydrolase_dom,superfamily_NUDIX_hydrolase_dom-like,pirsf_IsopentenylPP_isomerase_typ1,tigrfam_IsopentenylPP_isomerase_typ1	p.R168	ENST00000381344.3	37	c.504	CCDS7056.1	10																																																																																			IDI1	-	pfam_NUDIX_hydrolase_dom,superfamily_NUDIX_hydrolase_dom-like,pirsf_IsopentenylPP_isomerase_typ1,tigrfam_IsopentenylPP_isomerase_typ1	ENSG00000067064		0.448	IDI1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	IDI1	HGNC	protein_coding	OTTHUMT00000046409.2		0.00	68	0	C	NM_004508		1088605	-1			no_errors	ENST00000381344	ensembl	human	known	74_37	silent	5.06	75	4	SNP	0.635	T
IGDCC4	57722	genome.wustl.edu	37	15	65689261	65689261	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr15:65689261T>C	ENST00000352385.2	-	6	1117	c.908A>G	c.(907-909)cAg>cGg	p.Q303R		NM_020962.1	NP_066013.1	Q8TDY8	IGDC4_HUMAN	immunoglobulin superfamily, DCC subclass, member 4	303	Ig-like C2-type 3.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	44						GTGCCAGGGCTGCGCGTTGGC	0.672																																																	0													38.0	36.0	37.0					15																	65689261		2191	4290	6481	SO:0001583	missense	0				CCDS10206.1	15q22.31	2013-02-11			ENSG00000103742	ENSG00000103742		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13770	protein-coding gene	gene with protein product	"""likely ortholog of mouse neighbor of Punc E11"""						Standard	NM_020962		Approved	NOPE, LOC57722	uc002aou.1	Q8TDY8	OTTHUMG00000133136	ENST00000352385.2:c.908A>G	15.37:g.65689261T>C	ENSP00000319623:p.Gln303Arg		Q9HCE4	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.Q303R	ENST00000352385.2	37	c.908	CCDS10206.1	15	.	.	.	.	.	.	.	.	.	.	T	4.004	-0.001867	0.07819	.	.	ENSG00000103742	ENST00000352385	T	0.27402	1.67	4.15	3.0	0.34707	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.579949	0.17081	N	0.187778	T	0.20740	0.0499	L	0.33485	1.01	0.29571	N	0.849886	B	0.27416	0.178	B	0.27380	0.079	T	0.21552	-1.0242	10	0.11182	T	0.66	-7.8206	10.5973	0.45345	0.0:0.0:0.1622:0.8378	.	303	Q8TDY8	IGDC4_HUMAN	R	303	ENSP00000319623:Q303R	ENSP00000319623:Q303R	Q	-	2	0	IGDCC4	63476314	1.000000	0.71417	0.996000	0.52242	0.035000	0.12851	3.973000	0.56845	0.446000	0.26666	0.379000	0.24179	CAG	IGDCC4	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000103742		0.672	IGDCC4-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	IGDCC4	HGNC	protein_coding	OTTHUMT00000256825.2	-	0.00	63	0	T	NM_020962		65689261	-1	tier1	-	no_errors	ENST00000352385	ensembl	human	novel	74_37	missense	45.19	57	47	SNP	1.000	C
IGFL3	388555	genome.wustl.edu	37	19	46627546	46627546	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr19:46627546G>T	ENST00000341415.2	-	2	82	c.58C>A	c.(58-60)Cag>Aag	p.Q20K	AC007193.6_ENST00000597989.1_lincRNA	NM_207393.1	NP_997276.1	Q6UXB1	IGFL3_HUMAN	IGF-like family member 3	20						extracellular region (GO:0005576)				endometrium(1)|large_intestine(1)|lung(5)	7		Ovarian(192;0.0175)|all_neural(266;0.0476)		OV - Ovarian serous cystadenocarcinoma(262;0.00473)|GBM - Glioblastoma multiforme(486;0.0149)|Epithelial(262;0.239)		TTTGAACACTGGAGGAGGAAG	0.433																																																	0													102.0	76.0	85.0					19																	46627546		2187	4300	6487	SO:0001583	missense	0			AY358434	CCDS33058.1	19q13.32	2006-07-14				ENSG00000188624			32930	protein-coding gene	gene with protein product		610546				14702039	Standard	NM_207393		Approved	UNQ483	uc002pea.1	Q6UXB1		ENST00000341415.2:c.58C>A	19.37:g.46627546G>T	ENSP00000344860:p.Gln20Lys			Missense_Mutation	SNP	NULL	p.Q20K	ENST00000341415.2	37	c.58	CCDS33058.1	19	.	.	.	.	.	.	.	.	.	.	G	1.670	-0.509212	0.04231	.	.	ENSG00000188624	ENST00000341415	T	0.21932	1.98	1.26	-0.00757	0.14008	.	.	.	.	.	T	0.13286	0.0322	L	0.40543	1.245	0.09310	N	1	P	0.42248	0.774	B	0.39299	0.296	T	0.20240	-1.0281	9	0.16896	T	0.51	2.7057	4.2124	0.10517	0.0:0.0:0.602:0.398	.	20	Q6UXB1	IGFL3_HUMAN	K	20	ENSP00000344860:Q20K	ENSP00000344860:Q20K	Q	-	1	0	IGFL3	51319386	0.000000	0.05858	0.001000	0.08648	0.008000	0.06430	-0.567000	0.05916	0.036000	0.15547	0.411000	0.27672	CAG	IGFL3	-	NULL	ENSG00000188624		0.433	IGFL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGFL3	HGNC	protein_coding	OTTHUMT00000421323.1	-	0.00	67	0	G	NM_207393		46627546	-1	tier1	-	no_errors	ENST00000341415	ensembl	human	known	74_37	missense	5.97	63	4	SNP	0.001	T
IGFN1	91156	genome.wustl.edu	37	1	201163373	201163373	+	Silent	SNP	G	G	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr1:201163373G>A	ENST00000335211.4	+	3	229	c.99G>A	c.(97-99)caG>caA	p.Q33Q	IGFN1_ENST00000295591.8_5'UTR|IGFN1_ENST00000451870.2_Silent_p.Q33Q	NM_001164586.1	NP_001158058.1	Q86VF2	IGFN1_HUMAN	immunoglobulin-like and fibronectin type III domain containing 1	33	Ig-like 1.					nucleus (GO:0005634)|Z disc (GO:0030018)				autonomic_ganglia(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						ACTTTGAGCAGAAGCCCGTCA	0.632																																																	0													34.0	39.0	37.0					1																	201163373		692	1591	2283	SO:0001819	synonymous_variant	0			AY245430	CCDS53455.1	1q32.1	2013-02-11			ENSG00000163395	ENSG00000163395		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	24607	protein-coding gene	gene with protein product							Standard	NM_001164586		Approved	DKFZp434B1231, EEF1A2BP1	uc001gwc.3	Q86VF2	OTTHUMG00000035728	ENST00000335211.4:c.99G>A	1.37:g.201163373G>A			F8WAI1|Q9NT72	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.Q33	ENST00000335211.4	37	c.99	CCDS53455.1	1																																																																																			IGFN1	-	pfam_Ig_I-set,pfscan_Ig-like_dom	ENSG00000163395		0.632	IGFN1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	IGFN1	HGNC	protein_coding		-	0.00	56	0	G	NM_178275		201163373	+1	tier1	-	no_errors	ENST00000335211	ensembl	human	known	74_37	silent	10.53	34	4	SNP	1.000	A
APOBR	55911	genome.wustl.edu	37	16	28511194	28511194	+	IGR	SNP	C	C	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr16:28511194C>T	ENST00000431282.1	+	0	3414				IL27_ENST00000356897.1_Silent_p.E170E			Q0VD83	APOBR_HUMAN	apolipoprotein B receptor						cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|triglyceride metabolic process (GO:0006641)	chylomicron (GO:0042627)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	very-low-density lipoprotein particle receptor activity (GO:0030229)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|skin(2)|stomach(1)	29						cctcctcctcctcttcctcct	0.677																																																	0													9.0	10.0	9.0					16																	28511194		2158	4227	6385	SO:0001628	intergenic_variant	0			AK025123	CCDS58442.1	16p11.2	2011-02-14			ENSG00000184730	ENSG00000184730			24087	protein-coding gene	gene with protein product	"""apolipoprotein B48 receptor"", ""apolipoprotein B100 receptor"""	605220				10852956	Standard	NM_018690		Approved	APOB48R, APOB100R	uc002dqb.2	Q0VD83			16.37:g.28511194C>T			H3BU97|Q0VD81|Q8NC15|Q9NPJ9	Silent	SNP	superfamily_4_helix_cytokine-like_core	p.E170	ENST00000431282.1	37	c.510		16																																																																																			IL27	-	superfamily_4_helix_cytokine-like_core	ENSG00000197272		0.677	APOBR-202	KNOWN	basic|appris_candidate	protein_coding	IL27	HGNC	protein_coding			0.00	32	0	C	NM_182804		28511194	-1			no_errors	ENST00000356897	ensembl	human	known	74_37	silent	14.29	18	3	SNP	0.003	T
APOBR	55911	genome.wustl.edu	37	16	28511197	28511197	+	IGR	SNP	T	T	C			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr16:28511197T>C	ENST00000431282.1	+	0	3414				IL27_ENST00000356897.1_Silent_p.E169E			Q0VD83	APOBR_HUMAN	apolipoprotein B receptor						cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|triglyceride metabolic process (GO:0006641)	chylomicron (GO:0042627)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	very-low-density lipoprotein particle receptor activity (GO:0030229)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|skin(2)|stomach(1)	29						cctcctcctcttcctcctcct	0.672																																																	0													8.0	9.0	9.0					16																	28511197		2149	4215	6364	SO:0001628	intergenic_variant	0			AK025123	CCDS58442.1	16p11.2	2011-02-14			ENSG00000184730	ENSG00000184730			24087	protein-coding gene	gene with protein product	"""apolipoprotein B48 receptor"", ""apolipoprotein B100 receptor"""	605220				10852956	Standard	NM_018690		Approved	APOB48R, APOB100R	uc002dqb.2	Q0VD83			16.37:g.28511197T>C			H3BU97|Q0VD81|Q8NC15|Q9NPJ9	Silent	SNP	superfamily_4_helix_cytokine-like_core	p.E169	ENST00000431282.1	37	c.507		16																																																																																			IL27	-	superfamily_4_helix_cytokine-like_core	ENSG00000197272		0.672	APOBR-202	KNOWN	basic|appris_candidate	protein_coding	IL27	HGNC	protein_coding			0.00	31	0	T	NM_182804		28511197	-1			no_errors	ENST00000356897	ensembl	human	known	74_37	silent	15.79	16	3	SNP	0.052	C
INHBE	83729	genome.wustl.edu	37	12	57850342	57850342	+	Missense_Mutation	SNP	A	A	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr12:57850342A>T	ENST00000266646.2	+	2	980	c.764A>T	c.(763-765)gAc>gTc	p.D255V	INHBE_ENST00000551553.1_3'UTR	NM_031479.3	NP_113667.1	P58166	INHBE_HUMAN	inhibin, beta E	255					growth (GO:0040007)	extracellular region (GO:0005576)				breast(2)|central_nervous_system(1)|large_intestine(2)|lung(7)|prostate(1)|skin(2)	15						CATTACGTAGACTTCCAGGAA	0.632											OREG0021944	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									GBM(191;1808 2166 15720 36624 50371)												0													84.0	90.0	88.0					12																	57850342		2203	4300	6503	SO:0001583	missense	0				CCDS8939.1	12q13.2	2008-02-05				ENSG00000139269			24029	protein-coding gene	gene with protein product		612031				12242034	Standard	NM_031479		Approved	activin, MGC4638	uc001snw.3	P58166		ENST00000266646.2:c.764A>T	12.37:g.57850342A>T	ENSP00000266646:p.Asp255Val	1026		Missense_Mutation	SNP	pfam_TGF-b_C,pfam_TGF-b_N,smart_TGF-b_C,prints_Inhibin_betaC,prints_Inhibin_asu	p.D255V	ENST00000266646.2	37	c.764	CCDS8939.1	12	.	.	.	.	.	.	.	.	.	.	A	21.7	4.189788	0.78789	.	.	ENSG00000139269	ENST00000547970;ENST00000266646	T;T	0.68181	-0.31;-0.31	4.79	4.79	0.61399	Transforming growth factor-beta, C-terminal (3);	0.168622	0.52532	D	0.000075	T	0.81716	0.4881	M	0.80847	2.515	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.84586	0.0664	10	0.87932	D	0	-4.6861	13.7584	0.62950	1.0:0.0:0.0:0.0	.	255	P58166	INHBE_HUMAN	V	200;255	ENSP00000450212:D200V;ENSP00000266646:D255V	ENSP00000266646:D255V	D	+	2	0	INHBE	56136609	1.000000	0.71417	0.994000	0.49952	0.883000	0.51084	9.094000	0.94168	2.144000	0.66660	0.533000	0.62120	GAC	INHBE	-	pfam_TGF-b_C,smart_TGF-b_C,prints_Inhibin_asu	ENSG00000139269		0.632	INHBE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INHBE	HGNC	protein_coding	OTTHUMT00000406773.1	-	0.00	64	0	A	NM_031479		57850342	+1	tier1	-	no_errors	ENST00000266646	ensembl	human	known	74_37	missense	88.31	9	68	SNP	1.000	T
ITGA8	8516	genome.wustl.edu	37	10	15719594	15719594	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr10:15719594G>T	ENST00000378076.3	-	6	1026	c.673C>A	c.(673-675)Caa>Aaa	p.Q225K		NM_003638.1	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8	225					brain development (GO:0007420)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|metanephros development (GO:0001656)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|substrate adhesion-dependent cell spreading (GO:0034446)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|dendritic spine membrane (GO:0032591)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integrin alpha8-beta1 complex (GO:0034678)|integrin complex (GO:0008305)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	metal ion binding (GO:0046872)			NS(2)|breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(57)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	96						AACATACCTTGCCAGTAGAAA	0.368																																																	0													121.0	113.0	116.0					10																	15719594		2203	4300	6503	SO:0001583	missense	0			L36531	CCDS31155.1	10p13	2010-03-23			ENSG00000077943	ENSG00000077943		"""Integrins"""	6144	protein-coding gene	gene with protein product		604063				7768999	Standard	XM_005252633		Approved		uc001ioc.1	P53708	OTTHUMG00000017733	ENST00000378076.3:c.673C>A	10.37:g.15719594G>T	ENSP00000367316:p.Gln225Lys		B0YJ31|Q5VX94	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_FG-GAP,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.Q225K	ENST00000378076.3	37	c.673	CCDS31155.1	10	.	.	.	.	.	.	.	.	.	.	G	31	5.085426	0.94100	.	.	ENSG00000077943	ENST00000378076;ENST00000538044	T	0.53857	0.6	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.73560	0.3602	M	0.83118	2.625	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.83275	0.996;0.991	T	0.69206	-0.5206	10	0.10377	T	0.69	.	19.582	0.95471	0.0:0.0:1.0:0.0	.	225;225	F5H818;P53708	.;ITA8_HUMAN	K	225	ENSP00000367316:Q225K	ENSP00000367316:Q225K	Q	-	1	0	ITGA8	15759600	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	8.962000	0.93254	2.638000	0.89438	0.557000	0.71058	CAA	ITGA8	-	smart_Int_alpha_beta-p	ENSG00000077943		0.368	ITGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA8	HGNC	protein_coding	OTTHUMT00000046987.1	-	0.00	113	0	G	NM_003638		15719594	-1	tier1	-	no_errors	ENST00000378076	ensembl	human	known	74_37	missense	31.43	48	22	SNP	1.000	T
INPP5A	3632	genome.wustl.edu	37	10	134563044	134563044	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr10:134563044G>T	ENST00000368594.3	+	10	1033	c.756G>T	c.(754-756)atG>atT	p.M252I	INPP5A_ENST00000368593.3_Missense_Mutation_p.M252I	NM_005539.3	NP_005530.3	Q14642	I5P1_HUMAN	inositol polyphosphate-5-phosphatase, 40kDa	252					inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol dephosphorylation (GO:0046856)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	inositol-1,3,4,5-tetrakisphosphate 5-phosphatase activity (GO:0052659)|inositol-1,4,5-trisphosphate 5-phosphatase activity (GO:0052658)|inositol-polyphosphate 5-phosphatase activity (GO:0004445)|PH domain binding (GO:0042731)			cervix(1)|kidney(1)|large_intestine(2)|lung(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15		all_cancers(35;8.59e-13)|all_epithelial(44;5.49e-09)|Lung NSC(174;0.000854)|all_lung(145;0.00146)|all_neural(114;0.0299)|Colorectal(31;0.0599)|Breast(234;0.0849)|Melanoma(40;0.124)|all_hematologic(284;0.196)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;0.000102)|Epithelial(32;0.00023)|all cancers(32;0.000326)		AAGCCACCATGCAGACGGTCC	0.622																																					Pancreas(63;823 1267 11107 20380 51626)												0													60.0	57.0	58.0					10																	134563044		2201	4299	6500	SO:0001583	missense	0			X77567	CCDS7669.2	10q26.3	2008-08-07	2002-08-29		ENSG00000068383	ENSG00000068383	3.1.3.56		6076	protein-coding gene	gene with protein product	"""CTCL tumor antigen HD-CL-02"", ""43 kDa inositol polyphosphate 5-phophatase"", ""inositol polyphosphate 5-phophatase, 40kDa"", ""InsP3 5-phosphatase"", ""type I inositol-1,4,5-trisphosphate 5-phosphatase"""	600106	"""inositol polyphosphate-5-phosphatase, 40kD"""			8013665	Standard	NM_005539		Approved	5PTASE	uc001llp.3	Q14642	OTTHUMG00000019293	ENST00000368594.3:c.756G>T	10.37:g.134563044G>T	ENSP00000357583:p.Met252Ile		D3DXI3|Q14640|Q5JSF1	Missense_Mutation	SNP	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,smart_IPPc	p.M252I	ENST00000368594.3	37	c.756	CCDS7669.2	10	.	.	.	.	.	.	.	.	.	.	G	8.653	0.898753	0.17686	.	.	ENSG00000068383	ENST00000368594;ENST00000368593;ENST00000432898	T;T	0.39787	1.06;1.06	5.1	3.17	0.36434	Endonuclease/exonuclease/phosphatase (2);Inositol polyphosphate-related phosphatase (1);	0.038892	0.85682	D	0.000000	T	0.28732	0.0712	L	0.29908	0.895	0.47511	D	0.999446	B;B	0.09022	0.001;0.002	B;B	0.14578	0.002;0.011	T	0.06570	-1.0819	10	0.20519	T	0.43	-8.1144	11.3812	0.49759	0.072:0.1284:0.7997:0.0	.	252;252	Q14642;Q5T1B5	I5P1_HUMAN;.	I	252;252;169	ENSP00000357583:M252I;ENSP00000357582:M252I	ENSP00000357582:M252I	M	+	3	0	INPP5A	134413034	1.000000	0.71417	0.998000	0.56505	0.103000	0.19146	6.879000	0.75572	1.259000	0.44117	0.655000	0.94253	ATG	INPP5A	-	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,smart_IPPc	ENSG00000068383		0.622	INPP5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INPP5A	HGNC	protein_coding	OTTHUMT00000051085.1	-	0.00	53	0	G	NM_005539		134563044	+1	tier1	-	no_errors	ENST00000368594	ensembl	human	known	74_37	missense	8.51	43	4	SNP	1.000	T
ITGAD	3681	genome.wustl.edu	37	16	31424553	31424553	+	Nonsense_Mutation	SNP	C	C	G			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr16:31424553C>G	ENST00000389202.2	+	16	2031	c.1982C>G	c.(1981-1983)tCa>tGa	p.S661*		NM_005353.2	NP_005344.2	Q13349	ITAD_HUMAN	integrin, alpha D	661					activated T cell proliferation (GO:0050798)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|integrin-mediated signaling pathway (GO:0007229)	cell surface (GO:0009986)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(2)|lung(43)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						CAGAAAAGCTCACTGGACCAG	0.607																																																	0													88.0	82.0	84.0					16																	31424553		2197	4300	6497	SO:0001587	stop_gained	0			U40274	CCDS32438.1	16p13.1-p11	2010-03-23				ENSG00000156886		"""CD molecules"", ""Integrins"""	6146	protein-coding gene	gene with protein product		602453				8666289, 9598326	Standard	NM_005353		Approved	CD11d, ADB2	uc002ebv.1	Q13349		ENST00000389202.2:c.1982C>G	16.37:g.31424553C>G	ENSP00000373854:p.Ser661*		Q15575|Q15576	Nonsense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.S661*	ENST00000389202.2	37	c.1982	CCDS32438.1	16	.	.	.	.	.	.	.	.	.	.	C	23.6	4.429761	0.83776	.	.	ENSG00000156886	ENST00000444228;ENST00000389202	.	.	.	5.24	4.28	0.50868	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	9.8945	0.41309	0.0:0.9049:0.0:0.0951	.	.	.	.	X	677;661	.	ENSP00000373854:S661X	S	+	2	0	ITGAD	31332054	0.009000	0.17119	0.035000	0.18076	0.190000	0.23558	2.527000	0.45615	1.215000	0.43411	0.604000	0.83254	TCA	ITGAD	-	pfam_Integrin_alpha-2	ENSG00000156886		0.607	ITGAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGAD	HGNC	protein_coding	OTTHUMT00000432836.1	-	0.00	38	0	C	NM_005353		31424553	+1	tier1	-	no_errors	ENST00000389202	ensembl	human	known	74_37	nonsense	32.26	21	10	SNP	0.006	G
KANK1	23189	genome.wustl.edu	37	9	712040	712040	+	Missense_Mutation	SNP	C	C	T	rs141509675	byFrequency	TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr9:712040C>T	ENST00000382303.1	+	7	1926	c.1274C>T	c.(1273-1275)gCa>gTa	p.A425V	KANK1_ENST00000382297.2_Missense_Mutation_p.A425V|KANK1_ENST00000382293.3_Missense_Mutation_p.A267V|KANK1_ENST00000489369.1_3'UTR	NM_001256876.1	NP_001243805.1	Q14678	KANK1_HUMAN	KN motif and ankyrin repeat domains 1	425	Interaction with KIF21A.				negative regulation of actin filament polymerization (GO:0030837)|negative regulation of cell migration (GO:0030336)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of lamellipodium morphogenesis (GO:2000393)|negative regulation of neuron projection development (GO:0010977)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of ruffle assembly (GO:1900028)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation of wound healing (GO:0090303)|regulation of establishment of cell polarity (GO:2000114)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	beta-catenin binding (GO:0008013)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|stomach(4)|upper_aerodigestive_tract(1)	43		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)		TGTAAGGATGCAGCTGTAGGG	0.532																																																	0													114.0	96.0	102.0					9																	712040		2203	4300	6503	SO:0001583	missense	0			AL833161	CCDS6441.1, CCDS34976.1	9p24.3	2013-01-10	2008-01-29	2008-01-29	ENSG00000107104	ENSG00000107104		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	19309	protein-coding gene	gene with protein product		607704	"""ankyrin repeat domain 15"""	ANKRD15		12133830, 17996375, 19554261	Standard	NM_015158		Approved	KIAA0172, KANK	uc003zgn.2	Q14678	OTTHUMG00000019434	ENST00000382303.1:c.1274C>T	9.37:g.712040C>T	ENSP00000371740:p.Ala425Val		A2A2W8|D3DRH3|Q5W0W0|Q8IY65|Q8WX74	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_KN_motif,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.A425V	ENST00000382303.1	37	c.1274	CCDS34976.1	9	.	.	.	.	.	.	.	.	.	.	C	7.119	0.577588	0.13686	.	.	ENSG00000107104	ENST00000382303;ENST00000354485;ENST00000382297;ENST00000382293	T;T;T	0.37584	1.19;1.19;1.22	5.73	3.86	0.44501	.	0.220702	0.31847	N	0.006977	T	0.23532	0.0569	L	0.27053	0.805	0.43471	D	0.995682	B;B	0.14438	0.01;0.01	B;B	0.14023	0.01;0.005	T	0.04593	-1.0940	10	0.27785	T	0.31	-14.0188	8.8605	0.35253	0.0:0.7089:0.0:0.2911	.	425;425	Q5W0W1;Q14678	.;KANK1_HUMAN	V	425;425;425;267	ENSP00000371740:A425V;ENSP00000371734:A425V;ENSP00000371730:A267V	ENSP00000346479:A425V	A	+	2	0	KANK1	702040	0.467000	0.25831	0.518000	0.27811	0.498000	0.33706	1.026000	0.30103	0.746000	0.32786	0.655000	0.94253	GCA	KANK1	-	NULL	ENSG00000107104		0.532	KANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KANK1	HGNC	protein_coding	OTTHUMT00000051484.2	-	0.00	51	0	C	NM_015158		712040	+1	tier1	-	no_errors	ENST00000382297	ensembl	human	known	74_37	missense	11.11	32	4	SNP	0.436	T
KARS	3735	genome.wustl.edu	37	16	75669947	75669947	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr16:75669947G>A	ENST00000302445.3	-	5	571	c.532C>T	c.(532-534)Cgg>Tgg	p.R178W	KARS_ENST00000319410.5_Missense_Mutation_p.R206W|KARS_ENST00000568378.1_Intron	NM_005548.2	NP_005539.1	Q15046	SYK_HUMAN	lysyl-tRNA synthetase	178					cell death (GO:0008219)|diadenosine tetraphosphate biosynthetic process (GO:0015966)|gene expression (GO:0010467)|lysyl-tRNA aminoacylation (GO:0006430)|tRNA aminoacylation for protein translation (GO:0006418)|tRNA processing (GO:0008033)|viral process (GO:0016032)	aminoacyl-tRNA synthetase multienzyme complex (GO:0017101)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|microtubule cytoskeleton (GO:0015630)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	amino acid binding (GO:0016597)|ATP binding (GO:0005524)|lysine-tRNA ligase activity (GO:0004824)|metal ion binding (GO:0046872)|tRNA binding (GO:0000049)	p.R178W(1)		kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	18					L-Lysine(DB00123)	ATGTCTCCCCGACGCAGTTTG	0.373																																																	1	Substitution - Missense(1)	large_intestine(1)											68.0	57.0	61.0					16																	75669947		2198	4300	6498	SO:0001583	missense	0			AF285758	CCDS10923.1, CCDS45532.1	16q23.1	2014-09-17			ENSG00000065427	ENSG00000065427	6.1.1.6	"""Aminoacyl tRNA synthetases / Class II"""	6215	protein-coding gene	gene with protein product	"""lysine tRNA ligase"""	601421	"""deafness, autosomal recessive 89"""	DFNB89		8812440, 9278442, 23768514	Standard	NM_005548		Approved	KARS2, KARS1	uc002fer.3	Q15046	OTTHUMG00000137609	ENST00000302445.3:c.532C>T	16.37:g.75669947G>A	ENSP00000303043:p.Arg178Trp		A8MSK1|D3DUK4|O14946|Q96J25|Q9HB23	Missense_Mutation	SNP	pfam_aa-tRNA-synt_II,pfam_NA-bd_OB_tRNA,superfamily_NA-bd_OB-fold,pfscan_aa-tRNA-synth_II,prints_Lys-tRNA-synth_II_C,prints_Asp/Asn-tRNA-synth_IIb,tigrfam_Lys-tRNA-ligase_II	p.R206W	ENST00000302445.3	37	c.616	CCDS10923.1	16	.	.	.	.	.	.	.	.	.	.	G	17.73	3.460529	0.63513	.	.	ENSG00000065427	ENST00000319410;ENST00000302445	T;T	0.23754	1.89;1.89	6.17	2.97	0.34412	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);Nucleic acid binding, OB-fold, tRNA/helicase-type (1);	0.000000	0.85682	D	0.000000	T	0.46833	0.1413	H	0.98577	4.27	0.80722	D	1	D;P	0.53312	0.959;0.939	B;B	0.40009	0.262;0.316	T	0.72391	-0.4308	10	0.72032	D	0.01	-10.463	14.0804	0.64917	0.0:0.0:0.4956:0.5044	.	206;178	Q15046-2;Q15046	.;SYK_HUMAN	W	206;178	ENSP00000325448:R206W;ENSP00000303043:R178W	ENSP00000303043:R178W	R	-	1	2	KARS	74227448	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	4.466000	0.60148	0.910000	0.36722	0.655000	0.94253	CGG	KARS	-	pfam_NA-bd_OB_tRNA,superfamily_NA-bd_OB-fold,tigrfam_Lys-tRNA-ligase_II	ENSG00000065427		0.373	KARS-001	KNOWN	basic|CCDS	protein_coding	KARS	HGNC	protein_coding	OTTHUMT00000269023.1		0.00	49	0	G	NM_005548		75669947	-1			no_errors	ENST00000319410	ensembl	human	known	74_37	missense	5.56	51	3	SNP	0.987	A
KCNIP2	30819	genome.wustl.edu	37	10	103587412	103587412	+	Intron	SNP	A	A	G			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr10:103587412A>G	ENST00000356640.2	-	9	1041				KCNIP2_ENST00000358038.3_Intron|KCNIP2_ENST00000461105.1_Intron|KCNIP2_ENST00000353068.3_Intron|KCNIP2_ENST00000348850.5_Intron|KCNIP2-AS1_ENST00000412353.1_RNA|KCNIP2_ENST00000355657.2_Intron|KCNIP2_ENST00000343195.4_Intron|KCNIP2_ENST00000370046.1_Intron	NM_014591.4|NM_173191.2	NP_055406.2|NP_775283.1	Q9NS61	KCIP2_HUMAN	Kv channel interacting protein 2						clustering of voltage-gated potassium channels (GO:0045163)|detection of calcium ion (GO:0005513)|membrane repolarization (GO:0086009)|muscle contraction (GO:0006936)|potassium ion export (GO:0071435)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of cation channel activity (GO:2001257)|regulation of heart contraction (GO:0008016)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|calcium ion binding (GO:0005509)|ER retention sequence binding (GO:0046923)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein N-terminus binding (GO:0047485)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	11		Colorectal(252;0.122)		Epithelial(162;4.93e-09)|all cancers(201;2.63e-07)		GCCTGAGTCCAGGTCAGGGTA	0.473																																																	0													119.0	96.0	104.0					10																	103587412		2203	4300	6503	SO:0001627	intron_variant	0				CCDS7521.1, CCDS7522.1, CCDS7523.1, CCDS7524.1, CCDS7525.1, CCDS7526.1, CCDS41562.1	10q24.32	2013-09-20	2001-11-29		ENSG00000120049	ENSG00000120049		"""EF-hand domain containing"""	15522	protein-coding gene	gene with protein product		604661	"""Kv channel-interacting protein 2"""			10676964	Standard	NM_173192		Approved	KCHIP2	uc001kuc.3	Q9NS61	OTTHUMG00000018937	ENST00000356640.2:c.765+33T>C	10.37:g.103587412A>G			A6NJE5|A8MQ75|Q3YAC6|Q3YAC8|Q3YAC9|Q7Z6F1|Q96K86|Q96T41|Q96T42|Q96T43|Q96T44|Q9H0N4|Q9HD10|Q9HD11|Q9NS60|Q9NY10|Q9NZI1	Missense_Mutation	SNP	pfam_EF_hand_dom,smart_EF_hand_dom,pfscan_EF_hand_dom,prints_Recoverin	p.W181R	ENST00000356640.2	37	c.541	CCDS7522.1	10	.	.	.	.	.	.	.	.	.	.	A	0.112	-1.136870	0.01742	.	.	ENSG00000120049	ENST00000239117	T	0.66280	-0.2	4.4	3.25	0.37280	.	.	.	.	.	T	0.70395	0.3219	.	.	.	0.26690	N	0.971373	B;D	0.55605	0.0;0.972	B;P	0.59643	0.0;0.861	T	0.59643	-0.7416	8	0.54805	T	0.06	.	8.3597	0.32351	0.8248:0.0:0.0:0.1752	.	181;222	Q9NS61-9;B4DW99	.;.	R	181	ENSP00000239117:W181R	ENSP00000239117:W181R	W	-	1	0	KCNIP2	103577402	0.001000	0.12720	0.052000	0.19188	0.081000	0.17604	0.376000	0.20535	0.826000	0.34661	-0.728000	0.03583	TGG	KCNIP2	-	NULL	ENSG00000120049		0.473	KCNIP2-009	KNOWN	basic|CCDS	protein_coding	KCNIP2	HGNC	protein_coding	OTTHUMT00000049973.1	-	0.00	60	0	A			103587412	-1	tier1	-	no_errors	ENST00000239117	ensembl	human	known	74_37	missense	9.52	38	4	SNP	0.060	G
KCNK2	3776	genome.wustl.edu	37	1	215259722	215259722	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr1:215259722G>A	ENST00000444842.2	+	2	208	c.58G>A	c.(58-60)Gac>Aac	p.D20N	KCNK2_ENST00000391894.2_Missense_Mutation_p.D5N|KCNK2_ENST00000391895.2_Missense_Mutation_p.D16N	NM_001017425.2|NM_014217.3	NP_001017425.2|NP_055032.1	O95069	KCNK2_HUMAN	potassium channel, subfamily K, member 2	20					G-protein coupled receptor signaling pathway (GO:0007186)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|potassium ion leak channel activity (GO:0022841)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|upper_aerodigestive_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(81;0.0399)|all cancers(67;0.0556)|GBM - Glioblastoma multiforme(131;0.068)	Dofetilide(DB00204)|Dronedarone(DB04855)	GGCGGCACCTGACTTGCTGGA	0.527																																																	0													51.0	53.0	52.0					1																	215259722		2203	4300	6503	SO:0001583	missense	0			AF004711	CCDS31024.1, CCDS41466.1, CCDS41467.1	1q41	2012-03-07			ENSG00000082482	ENSG00000082482		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6277	protein-coding gene	gene with protein product		603219				9721223, 16382106	Standard	NM_001017424		Approved	K2p2.1, TREK-1	uc001hkr.4	O95069	OTTHUMG00000037017	ENST00000444842.2:c.58G>A	1.37:g.215259722G>A	ENSP00000394033:p.Asp20Asn		A1Z1V3|A8K618|B2RCS4|B7ZL56|D3DTA5|Q5DP47|Q5DP48|Q9NRT2|Q9UNE3	Missense_Mutation	SNP	pfam_2pore_dom_K_chnl_dom,prints_2pore_dom_K_chnl_TREK,prints_2pore_dom_K_chnl,prints_2pore_dom_K_chnl_TRAAK,prints_2pore_dom_K_chnl_TASK	p.D20N	ENST00000444842.2	37	c.58	CCDS41467.1	1	.	.	.	.	.	.	.	.	.	.	G	26.3	4.719995	0.89205	.	.	ENSG00000082482	ENST00000366948;ENST00000391895;ENST00000391894;ENST00000444842	T;T;T	0.21734	2.01;1.99;1.99	5.77	5.77	0.91146	.	0.390340	0.29314	N	0.012506	T	0.46190	0.1380	M	0.63428	1.95	0.58432	D	0.999998	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.69824	0.966;0.926;0.966	T	0.14227	-1.0480	10	0.45353	T	0.12	.	19.9941	0.97377	0.0:0.0:1.0:0.0	.	5;20;16	O95069-2;O95069;O95069-3	.;KCNK2_HUMAN;.	N	16;16;5;20	ENSP00000375765:D16N;ENSP00000375764:D5N;ENSP00000394033:D20N	ENSP00000355915:D16N	D	+	1	0	KCNK2	213326345	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.638000	0.83328	2.729000	0.93468	0.557000	0.71058	GAC	KCNK2	-	prints_2pore_dom_K_chnl_TREK	ENSG00000082482		0.527	KCNK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNK2	HGNC	protein_coding	OTTHUMT00000089856.2	-	0.00	71	0	G	NM_014217		215259722	+1	tier1	-	no_errors	ENST00000444842	ensembl	human	known	74_37	missense	17.14	87	18	SNP	1.000	A
KIAA0226L	80183	genome.wustl.edu	37	13	46924315	46924315	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr13:46924315G>T	ENST00000429979.1	-	11	2106	c.1502C>A	c.(1501-1503)cCc>cAc	p.P501H	KIAA0226L_ENST00000409879.2_Missense_Mutation_p.P344H|KIAA0226L_ENST00000378797.2_Missense_Mutation_p.P501H|KIAA0226L_ENST00000378781.3_3'UTR|KIAA0226L_ENST00000322896.6_Missense_Mutation_p.P344H|KIAA0226L_ENST00000389908.3_Missense_Mutation_p.P501H|KIAA0226L_ENST00000378787.3_Missense_Mutation_p.P501H|KIAA0226L_ENST00000534925.1_Missense_Mutation_p.P366H|KIAA0226L_ENST00000378784.4_Missense_Mutation_p.P434H	NM_025113.2	NP_079389.2	Q9H714	K226L_HUMAN	KIAA0226-like	501										NS(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(7)|pancreas(1)	26						ATTGAAAATGGGCTGGTGCCA	0.532																																																	0													67.0	55.0	59.0					13																	46924315		2203	4300	6503	SO:0001583	missense	0			AK025215	CCDS31970.2, CCDS66543.1, CCDS66544.1, CCDS66545.1, CCDS73569.1	13q14.11	2011-08-09	2011-08-09	2011-08-09	ENSG00000102445	ENSG00000102445			20420	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 18"""	C13orf18			Standard	NM_001286766		Approved	FLJ21562	uc010acl.3	Q9H714	OTTHUMG00000016868	ENST00000429979.1:c.1502C>A	13.37:g.46924315G>T	ENSP00000396935:p.Pro501His		A8KAG9|A8XR19|B3KS87|Q5W051|Q5W053|Q6PJ74|Q6PK94|Q86XH7|Q8N5J6	Missense_Mutation	SNP	NULL	p.P501H	ENST00000429979.1	37	c.1502	CCDS31970.2	13	.	.	.	.	.	.	.	.	.	.	G	21.4	4.144356	0.77888	.	.	ENSG00000102445	ENST00000429979;ENST00000378797;ENST00000378784;ENST00000389908;ENST00000378787;ENST00000409879;ENST00000322896;ENST00000534925	T;T;T;T;T;T	0.70986	-0.13;-0.53;-0.1;-0.13;-0.53;-0.03	5.23	5.23	0.72850	.	0.000000	0.64402	D	0.000006	D	0.88713	0.6511	H	0.94582	3.555	0.80722	D	1	D;D;D;D;D;D	0.89917	0.997;0.997;1.0;1.0;1.0;0.998	D;D;D;D;D;D	0.77557	0.99;0.99;0.99;0.986;0.983;0.909	D	0.91422	0.5159	10	0.66056	D	0.02	-13.7471	18.1529	0.89679	0.0:0.0:1.0:0.0	.	344;344;501;366;434;501	B7ZBN5;B7Z6E4;Q9H714;A8KAG9;Q9H714-3;Q9H714-4	.;.;K226L_HUMAN;.;.;.	H	501;501;434;501;501;344;344;366	ENSP00000396935:P501H;ENSP00000368074:P501H;ENSP00000368061:P434H;ENSP00000374558:P501H;ENSP00000368064:P501H;ENSP00000437501:P366H	ENSP00000315633:P344H	P	-	2	0	KIAA0226L	45822316	1.000000	0.71417	0.999000	0.59377	0.567000	0.35839	7.714000	0.84703	2.616000	0.88540	0.655000	0.94253	CCC	KIAA0226L	-	NULL	ENSG00000102445		0.532	KIAA0226L-204	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0226L	HGNC	protein_coding	OTTHUMT00000044809.2	-	0.00	61	0	G	NM_025113		46924315	-1	tier1	-	no_errors	ENST00000389908	ensembl	human	known	74_37	missense	13.16	33	5	SNP	1.000	T
KIAA0753	9851	genome.wustl.edu	37	17	6531694	6531694	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr17:6531694G>T	ENST00000361413.3	-	3	819	c.461C>A	c.(460-462)gCc>gAc	p.A154D	KIAA0753_ENST00000572370.1_5'UTR|KIAA0753_ENST00000542606.1_5'UTR	NM_014804.2	NP_055619.2	Q2KHM9	K0753_HUMAN	KIAA0753	154						centrosome (GO:0005813)|cytoplasm (GO:0005737)				endometrium(4)|large_intestine(11)|lung(5)|prostate(4)	24				COAD - Colon adenocarcinoma(228;0.157)		ACACTGACAGGCTGCTTGACT	0.468																																																	0													86.0	92.0	90.0					17																	6531694		2091	4210	6301	SO:0001583	missense	0				CCDS42247.1	17p13.1	2014-04-04			ENSG00000198920	ENSG00000198920			29110	protein-coding gene	gene with protein product						24613305	Standard	NM_014804		Approved		uc002gde.4	Q2KHM9	OTTHUMG00000177928	ENST00000361413.3:c.461C>A	17.37:g.6531694G>T	ENSP00000355250:p.Ala154Asp		A8KA11|B7Z479|O94853|Q05D97|Q2KHN0|Q9UG45	Missense_Mutation	SNP	NULL	p.A154D	ENST00000361413.3	37	c.461	CCDS42247.1	17	.	.	.	.	.	.	.	.	.	.	G	2.627	-0.287289	0.05605	.	.	ENSG00000198920	ENST00000361413	T	0.08458	3.09	5.35	-10.7	0.00240	.	1.606680	0.03278	N	0.185785	T	0.08313	0.0207	L	0.40543	1.245	0.09310	N	1	B	0.25105	0.118	B	0.28784	0.094	T	0.33214	-0.9877	10	0.12103	T	0.63	9.8704	18.1987	0.89831	0.0983:0.2401:0.6616:0.0	.	154	Q2KHM9	K0753_HUMAN	D	154	ENSP00000355250:A154D	ENSP00000355250:A154D	A	-	2	0	KIAA0753	6472418	0.000000	0.05858	0.000000	0.03702	0.552000	0.35366	-2.759000	0.00787	-3.570000	0.00139	-0.290000	0.09829	GCC	KIAA0753	-	NULL	ENSG00000198920		0.468	KIAA0753-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0753	HGNC	protein_coding	OTTHUMT00000439769.3	-	0.00	55	0	G	NM_014804		6531694	-1	tier1	-	no_errors	ENST00000361413	ensembl	human	known	74_37	missense	8.33	44	4	SNP	0.000	T
KIAA1211	57482	genome.wustl.edu	37	4	57138578	57138578	+	5'UTR	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr4:57138578G>T	ENST00000504228.1	+	0	9				KIAA1211_ENST00000264229.6_5'UTR|KIAA1211_ENST00000541073.1_5'UTR			Q6ZU35	K1211_HUMAN	KIAA1211											endometrium(7)|large_intestine(10)|lung(39)|ovary(2)|prostate(3)|skin(3)|stomach(1)	65	Glioma(25;0.08)|all_neural(26;0.101)					TGCCGTCGTTGGGGAAGAAGA	0.458																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AB033037	CCDS43230.1	4q12	2012-08-03			ENSG00000109265	ENSG00000109265			29219	protein-coding gene	gene with protein product						10574462, 11230166	Standard	NM_020722		Approved		uc003hbk.2	Q6ZU35	OTTHUMG00000160749	ENST00000504228.1:c.-97G>T	4.37:g.57138578G>T			Q9NTE2|Q9NTP8|Q9ULK9	RNA	SNP	-	NULL	ENST00000504228.1	37	NULL	CCDS43230.1	4																																																																																			KIAA1211	-	-	ENSG00000109265		0.458	KIAA1211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1211	HGNC	protein_coding	OTTHUMT00000362097.2	-	0.00	65	0	G	NM_020722		57138578	+1	tier1	-	no_errors	ENST00000503618	ensembl	human	known	74_37	rna	9.68	56	6	SNP	0.000	T
KIAA1467	57613	genome.wustl.edu	37	12	13211471	13211471	+	Missense_Mutation	SNP	G	G	C	rs117039796	byFrequency	TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr12:13211471G>C	ENST00000197268.8	+	3	640	c.520G>C	c.(520-522)Ggg>Cgg	p.G174R		NM_020853.1	NP_065904.1	A2RU67	K1467_HUMAN	KIAA1467	174						integral component of membrane (GO:0016021)		p.G174W(1)		NS(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|prostate(1)|skin(4)	36		Prostate(47;0.184)		BRCA - Breast invasive adenocarcinoma(232;0.157)		GTCAAGGAACGGGAGTGCAGT	0.493																																																	1	Substitution - Missense(1)	lung(1)											364.0	324.0	338.0					12																	13211471		2203	4300	6503	SO:0001583	missense	0			AB040900	CCDS31750.1	12p13.1	2006-01-23				ENSG00000084444			29288	protein-coding gene	gene with protein product						10819331	Standard	XM_005253450		Approved		uc001rbi.3	A2RU67		ENST00000197268.8:c.520G>C	12.37:g.13211471G>C	ENSP00000197268:p.Gly174Arg		Q49AF2|Q5CZ81|Q6ZUV7|Q9P261	Missense_Mutation	SNP	superfamily_Quinonprotein_ADH-like_supfam	p.G174R	ENST00000197268.8	37	c.520	CCDS31750.1	12	.	.	.	.	.	.	.	.	.	.	G	9.124	1.009832	0.19277	.	.	ENSG00000084444	ENST00000197268	T	0.57436	0.4	4.92	4.0	0.46444	Quinonprotein alcohol dehydrogenase-like (1);	0.577624	0.19150	N	0.121464	T	0.48077	0.1480	L	0.57536	1.79	0.30461	N	0.774337	P	0.44986	0.847	B	0.40741	0.339	T	0.50849	-0.8779	10	0.25106	T	0.35	-17.4886	12.578	0.56375	0.0:0.1669:0.8331:0.0	.	174	A2RU67	K1467_HUMAN	R	174	ENSP00000197268:G174R	ENSP00000197268:G174R	G	+	1	0	KIAA1467	13102738	0.902000	0.30710	0.320000	0.25306	0.020000	0.10135	1.356000	0.34079	1.249000	0.43950	0.655000	0.94253	GGG	KIAA1467	-	superfamily_Quinonprotein_ADH-like_supfam	ENSG00000084444		0.493	KIAA1467-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1467	HGNC	protein_coding	OTTHUMT00000401007.1	-	0.00	81	0	G	NM_020853		13211471	+1	tier1	-	no_errors	ENST00000197268	ensembl	human	known	74_37	missense	18.63	83	19	SNP	0.851	C
KIAA2022	340533	genome.wustl.edu	37	X	73962184	73962184	+	Silent	SNP	A	A	G			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chrX:73962184A>G	ENST00000055682.6	-	3	2819	c.2208T>C	c.(2206-2208)gcT>gcC	p.A736A		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	736					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						TTTCTTGCCCAGCAGCTTTGA	0.388																																																	0													73.0	72.0	73.0					X																	73962184		2203	4297	6500	SO:0001819	synonymous_variant	0				CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.2208T>C	X.37:g.73962184A>G			A7YY87|Q5JUX9|Q8IVE9	Silent	SNP	NULL	p.A736	ENST00000055682.6	37	c.2208	CCDS35337.1	X																																																																																			KIAA2022	-	NULL	ENSG00000050030		0.388	KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA2022	HGNC	protein_coding	OTTHUMT00000057270.2	-	0.00	61	0	A	NM_001008537		73962184	-1	tier1	-	no_errors	ENST00000055682	ensembl	human	known	74_37	silent	52.63	18	20	SNP	0.977	G
KIF7	374654	genome.wustl.edu	37	15	90195944	90195944	+	Missense_Mutation	SNP	G	G	T	rs552362795		TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr15:90195944G>T	ENST00000394412.3	-	2	294	c.218C>A	c.(217-219)gCc>gAc	p.A73D		NM_198525.2	NP_940927.2	Q2M1P5	KIF7_HUMAN	kinesin family member 7	73	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of smoothened signaling pathway (GO:0045879)|positive regulation of smoothened signaling pathway (GO:0045880)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|kinesin complex (GO:0005871)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(2)|stomach(1)|urinary_tract(1)	25	Lung NSC(78;0.0237)|all_lung(78;0.0478)		BRCA - Breast invasive adenocarcinoma(143;0.128)			CTGAACGCAGGCCTGGTACAC	0.637													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19543	0.0		0.0	False		,,,				2504	0.0																0													78.0	82.0	81.0					15																	90195944		689	1590	2279	SO:0001583	missense	0			AY358384	CCDS32325.2	15q26.1	2011-06-02			ENSG00000166813	ENSG00000166813		"""Kinesins"""	30497	protein-coding gene	gene with protein product		611254				11416179, 15547730	Standard	NM_198525		Approved	JBTS12	uc002bof.2	Q2M1P5	OTTHUMG00000157177	ENST00000394412.3:c.218C>A	15.37:g.90195944G>T	ENSP00000377934:p.Ala73Asp		Q3SXY0|Q6UXE9|Q8IW72	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.A73D	ENST00000394412.3	37	c.218	CCDS32325.2	15	.	.	.	.	.	.	.	.	.	.	G	13.10	2.137154	0.37728	.	.	ENSG00000166813	ENST00000394412	T	0.75050	-0.9	4.75	4.75	0.60458	Kinesin, motor domain (4);	.	.	.	.	T	0.56834	0.2012	N	0.04508	-0.205	0.47374	D	0.999408	P	0.51147	0.942	B	0.43413	0.419	T	0.62015	-0.6943	9	0.27785	T	0.31	.	17.3405	0.87294	0.0:0.0:1.0:0.0	.	73	Q2M1P5	KIF7_HUMAN	D	73	ENSP00000377934:A73D	ENSP00000377934:A73D	A	-	2	0	KIF7	87996948	0.001000	0.12720	0.994000	0.49952	0.344000	0.29017	0.926000	0.28804	2.183000	0.69458	0.655000	0.94253	GCC	KIF7	-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	ENSG00000166813		0.637	KIF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF7	HGNC	protein_coding	OTTHUMT00000347782.1		0.00	46	0	G	NM_198525		90195944	-1			no_errors	ENST00000394412	ensembl	human	known	74_37	missense	5.26	36	2	SNP	1.000	T
KIRREL3	84623	genome.wustl.edu	37	11	126294541	126294541	+	Silent	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr11:126294541G>T	ENST00000525144.2	-	17	2520	c.2271C>A	c.(2269-2271)tcC>tcA	p.S757S	KIRREL3_ENST00000416561.2_Silent_p.S224S|KIRREL3_ENST00000529097.2_Silent_p.S745S	NM_032531.3	NP_115920.1	Q8IZU9	KIRR3_HUMAN	kin of IRRE like 3 (Drosophila)	757	Ser-rich.				hemopoiesis (GO:0030097)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(5)|large_intestine(11)|lung(8)|ovary(3)|prostate(1)	29	all_hematologic(175;0.145)	Lung NSC(97;0.0484)|all_lung(97;0.0522)|Medulloblastoma(222;0.0523)|Breast(109;0.0949)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;6.03e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.12)		ACGAGGACTGGGAGTGGTGGG	0.632																																																	0													119.0	130.0	126.0					11																	126294541		2161	4270	6431	SO:0001819	synonymous_variant	0			AB058770	CCDS53723.1, CCDS55796.1, CCDS73413.1	11q24	2013-01-29			ENSG00000149571	ENSG00000149571		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	23204	protein-coding gene	gene with protein product		607761				12424224, 11347906	Standard	NM_032531		Approved	NEPH2, KIAA1867, KIRRE	uc001qea.3	Q8IZU9	OTTHUMG00000165831	ENST00000525144.2:c.2271C>A	11.37:g.126294541G>T			Q3MIJ7|Q6UWJ9|Q6UWL5|Q96JG0	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.S757	ENST00000525144.2	37	c.2271	CCDS53723.1	11																																																																																			KIRREL3	-	NULL	ENSG00000149571		0.632	KIRREL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIRREL3	HGNC	protein_coding	OTTHUMT00000386479.2	-	0.00	53	0	G	NM_032531		126294541	-1	tier1	-	no_errors	ENST00000525144	ensembl	human	known	74_37	silent	35.14	24	13	SNP	0.990	T
KMO	8564	genome.wustl.edu	37	1	241725447	241725447	+	Intron	SNP	T	T	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr1:241725447T>A	ENST00000366559.4	+	7	760				KMO_ENST00000366558.3_Intron|KMO_ENST00000484628.1_Intron|KMO_ENST00000366557.4_Intron	NM_003679.4	NP_003670.2			kynurenine 3-monooxygenase (kynurenine 3-hydroxylase)											NS(1)|breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)	33	Ovarian(103;0.103)|all_lung(81;0.23)		OV - Ovarian serous cystadenocarcinoma(106;0.0176)			TTCTTTTGGATGTTTTGTTCT	0.383																																																	0													79.0	72.0	75.0					1																	241725447		2203	4300	6503	SO:0001627	intron_variant	0			AF056032	CCDS1618.1	1q42-q44	2010-11-23			ENSG00000117009	ENSG00000117009	1.14.13.9		6381	protein-coding gene	gene with protein product		603538				9237672	Standard	NM_003679		Approved		uc009xgp.3	O15229	OTTHUMG00000039635	ENST00000366559.4:c.450-20T>A	1.37:g.241725447T>A				RNA	SNP	-	NULL	ENST00000366559.4	37	NULL	CCDS1618.1	1																																																																																			KMO	-	-	ENSG00000117009		0.383	KMO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KMO	HGNC	protein_coding	OTTHUMT00000095612.1	-	0.00	40	0	T	NM_003679		241725447	+1	tier1	-	no_errors	ENST00000431245	ensembl	human	known	74_37	rna	10.39	69	8	SNP	0.004	A
KRCC1	51315	genome.wustl.edu	37	2	88327433	88327433	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr2:88327433C>T	ENST00000347055.3	-	4	1043	c.650G>A	c.(649-651)cGa>cAa	p.R217Q		NM_016618.1	NP_057702.1	Q9NPI7	KRCC1_HUMAN	lysine-rich coiled-coil 1	217	Lys-rich.									cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)	7						TTTCTCCTTTCGATTCTTAAG	0.393																																																	0													152.0	162.0	159.0					2																	88327433		2203	4300	6503	SO:0001583	missense	0			AF208845	CCDS2000.1	2p11.2	2008-02-05			ENSG00000172086	ENSG00000172086			28039	protein-coding gene	gene with protein product						12477932	Standard	XM_005264360		Approved	FLJ22333	uc002sso.1	Q9NPI7	OTTHUMG00000130315	ENST00000347055.3:c.650G>A	2.37:g.88327433C>T	ENSP00000340083:p.Arg217Gln		Q3B7J7	Missense_Mutation	SNP	NULL	p.R217Q	ENST00000347055.3	37	c.650	CCDS2000.1	2	.	.	.	.	.	.	.	.	.	.	C	13.23	2.174117	0.38413	.	.	ENSG00000172086	ENST00000347055	T	0.33216	1.42	5.98	2.99	0.34606	.	0.193712	0.31461	N	0.007605	T	0.23410	0.0566	L	0.57536	1.79	0.26838	N	0.968444	P	0.36249	0.545	B	0.21151	0.033	T	0.12268	-1.0554	10	0.54805	T	0.06	-3.7915	8.9653	0.35872	0.0:0.7316:0.0:0.2684	.	217	Q9NPI7	KRCC1_HUMAN	Q	217	ENSP00000340083:R217Q	ENSP00000340083:R217Q	R	-	2	0	KRCC1	88108548	0.085000	0.21516	0.893000	0.35052	0.912000	0.54170	1.158000	0.31737	0.311000	0.23014	0.650000	0.86243	CGA	KRCC1	-	NULL	ENSG00000172086		0.393	KRCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRCC1	HGNC	protein_coding	OTTHUMT00000252664.1		0.00	25	0	C	NM_016618		88327433	-1			no_errors	ENST00000347055	ensembl	human	known	74_37	missense	6.25	30	2	SNP	0.837	T
KRT12	3859	genome.wustl.edu	37	17	39023236	39023236	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr17:39023236C>T	ENST00000251643.4	-	1	226	c.203G>A	c.(202-204)gGc>gAc	p.G68D		NM_000223.3	NP_000214.1	Q99456	K1C12_HUMAN	keratin 12	68	Gly-rich.|Head.				visual perception (GO:0007601)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(2)	15		Breast(137;0.000301)			Griseofulvin(DB00400)	ACCCCCAAAGCCGGAACTAGA	0.577																																																	0													83.0	94.0	90.0					17																	39023236		2203	4300	6503	SO:0001583	missense	0				CCDS11378.1	17q21.2	2013-06-20	2008-08-01		ENSG00000187242	ENSG00000187242		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6414	protein-coding gene	gene with protein product	"""Meesmann corneal dystrophy"""	601687				9171831, 16831889	Standard	NM_000223		Approved	K12	uc002hvk.2	Q99456	OTTHUMG00000133369	ENST00000251643.4:c.203G>A	17.37:g.39023236C>T	ENSP00000251643:p.Gly68Asp		B2R9E0	Missense_Mutation	SNP	pfam_IF,superfamily_Prefoldin,prints_Keratin_I	p.G68D	ENST00000251643.4	37	c.203	CCDS11378.1	17	.	.	.	.	.	.	.	.	.	.	C	16.04	3.009087	0.54361	.	.	ENSG00000187242	ENST00000251643	D	0.89123	-2.47	5.91	2.74	0.32292	.	0.259474	0.27613	N	0.018581	D	0.88551	0.6467	L	0.47190	1.495	0.35215	D	0.775488	D	0.56746	0.977	P	0.53450	0.726	D	0.88459	0.3054	10	0.36615	T	0.2	.	11.7458	0.51819	0.2499:0.6299:0.1202:0.0	.	68	Q99456	K1C12_HUMAN	D	68	ENSP00000251643:G68D	ENSP00000251643:G68D	G	-	2	0	KRT12	36276762	0.930000	0.31532	0.997000	0.53966	0.895000	0.52256	1.251000	0.32862	0.355000	0.24131	0.655000	0.94253	GGC	KRT12	-	NULL	ENSG00000187242		0.577	KRT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT12	HGNC	protein_coding	OTTHUMT00000257214.2	-	0.00	72	0	C	NM_000223		39023236	-1	tier1	-	no_errors	ENST00000251643	ensembl	human	known	74_37	missense	28.07	41	16	SNP	0.999	T
LAMB1	3912	genome.wustl.edu	37	7	107600921	107600921	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr7:107600921G>C	ENST00000222399.6	-	18	2513	c.2283C>G	c.(2281-2283)agC>agG	p.S761R	LAMB1_ENST00000393560.1_Missense_Mutation_p.S761R|LAMB1_ENST00000393561.1_Missense_Mutation_p.S785R	NM_002291.2	NP_002282.2	P07942	LAMB1_HUMAN	laminin, beta 1	761	Laminin IV type B. {ECO:0000255|PROSITE- ProRule:PRU00462}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|neuron projection development (GO:0031175)|neuronal-glial interaction involved in cerebral cortex radial glia guided migration (GO:0021812)|odontogenesis (GO:0042476)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell proliferation (GO:0050679)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-2 complex (GO:0005607)|laminin-8 complex (GO:0043257)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)|structural molecule activity (GO:0005198)			NS(3)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(37)|ovary(6)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)	82						GGGCAGAAATGCTAAAGATGA	0.483																																																	0													100.0	91.0	94.0					7																	107600921		2203	4300	6503	SO:0001583	missense	0			M61916	CCDS5750.1	7q22	2013-03-01			ENSG00000091136	ENSG00000091136		"""Laminins"""	6486	protein-coding gene	gene with protein product		150240	"""cutis laxa with marfanoid phenotype"""	CLM		2563160, 2704655, 1864606	Standard	NM_002291		Approved		uc003vew.2	P07942	OTTHUMG00000149966	ENST00000222399.6:c.2283C>G	7.37:g.107600921G>C	ENSP00000222399:p.Ser761Arg		Q14D91	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_N,superfamily_Prefoldin,superfamily_t-SNARE,superfamily_P-loop_NTPase,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,pfscan_Laminin_IV,pfscan_EGF_laminin,pfscan_Laminin_N	p.S761R	ENST00000222399.6	37	c.2283	CCDS5750.1	7	.	.	.	.	.	.	.	.	.	.	G	19.91	3.914342	0.72983	.	.	ENSG00000091136	ENST00000393561;ENST00000222399;ENST00000393560	T;T;T	0.43688	1.23;1.22;0.94	5.32	3.49	0.39957	Laminin IV (1);	.	.	.	.	T	0.64853	0.2636	M	0.86268	2.805	0.43868	D	0.996474	D;D;D	0.76494	0.994;0.996;0.999	P;D;D	0.69479	0.881;0.953;0.964	T	0.71206	-0.4661	9	0.87932	D	0	.	12.0762	0.53644	0.1425:0.0:0.8575:0.0	.	761;761;785	E7EPA6;P07942;G3XAI2	.;LAMB1_HUMAN;.	R	785;761;761	ENSP00000377191:S785R;ENSP00000222399:S761R;ENSP00000377190:S761R	ENSP00000222399:S761R	S	-	3	2	LAMB1	107388157	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	0.731000	0.26058	1.243000	0.43853	0.557000	0.71058	AGC	LAMB1	-	pfscan_Laminin_IV	ENSG00000091136		0.483	LAMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMB1	HGNC	protein_coding	OTTHUMT00000314584.1	-	0.00	44	0	G	NM_002291		107600921	-1	tier1	-	no_errors	ENST00000222399	ensembl	human	known	74_37	missense	8.62	53	5	SNP	1.000	C
LEKR1	389170	genome.wustl.edu	37	3	156746172	156746172	+	Missense_Mutation	SNP	T	T	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr3:156746172T>A	ENST00000470811.1	+	13	2072	c.737T>A	c.(736-738)tTt>tAt	p.F246Y	LEKR1_ENST00000356539.4_Missense_Mutation_p.F550Y			Q6ZMV7	LEKR1_HUMAN	leucine, glutamate and lysine rich 1	246										breast(1)|large_intestine(5)|lung(3)|ovary(1)|skin(1)	11			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			ATAGAGCAATTTAACCAGTCC	0.383																																																	0													54.0	52.0	53.0					3																	156746172		2203	4300	6503	SO:0001583	missense	0			AK131473	CCDS54660.1	3q25.31	2014-02-12	2008-02-21		ENSG00000197980	ENSG00000197980			33765	protein-coding gene	gene with protein product		613536					Standard	NM_001004316		Approved	FLJ16641	uc021xgh.1	Q6ZMV7	OTTHUMG00000160130	ENST00000470811.1:c.737T>A	3.37:g.156746172T>A	ENSP00000418214:p.Phe246Tyr			Missense_Mutation	SNP	superfamily_Ribosomal_L29	p.F550Y	ENST00000470811.1	37	c.1649		3	.	.	.	.	.	.	.	.	.	.	T	8.472	0.857876	0.17178	.	.	ENSG00000178110	ENST00000470811;ENST00000356539	T;T	0.47177	0.86;0.85	5.48	5.48	0.80851	.	0.564700	0.17256	N	0.180978	T	0.46308	0.1386	M	0.65975	2.015	0.09310	N	1	P	0.42409	0.779	B	0.41036	0.346	T	0.44544	-0.9321	10	0.09338	T	0.73	-0.0652	13.8358	0.63408	0.0:0.0:0.0:1.0	.	246	Q6ZMV7	LEKR1_HUMAN	Y	246;550	ENSP00000418214:F246Y;ENSP00000348936:F550Y	ENSP00000348936:F550Y	F	+	2	0	LEKR1	158228866	0.547000	0.26465	0.003000	0.11579	0.537000	0.34900	4.827000	0.62723	2.081000	0.62600	0.533000	0.62120	TTT	LEKR1	-	NULL	ENSG00000197980		0.383	LEKR1-010	KNOWN	upstream_ATG|basic	protein_coding	LEKR1	HGNC	protein_coding	OTTHUMT00000351625.3	-	0.00	44	0	T	NM_001004316		156746172	+1	tier1	-	no_errors	ENST00000356539	ensembl	human	known	74_37	missense	28.00	18	7	SNP	0.013	A
LIN7C	55327	genome.wustl.edu	37	11	27523450	27523450	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr11:27523450C>G	ENST00000278193.2	-	2	75	c.55G>C	c.(55-57)Gaa>Caa	p.E19Q	LIN7C_ENST00000524596.1_Missense_Mutation_p.E19Q	NM_018362.3	NP_060832.1	Q9NUP9	LIN7C_HUMAN	lin-7 homolog C (C. elegans)	19	L27. {ECO:0000255|PROSITE- ProRule:PRU00365}.				exocytosis (GO:0006887)|morphogenesis of an epithelial sheet (GO:0002011)|neurotransmitter secretion (GO:0007269)|protein transport (GO:0015031)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|MPP7-DLG1-LIN7 complex (GO:0097025)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|tight junction (GO:0005923)	cytoskeletal protein binding (GO:0008092)|L27 domain binding (GO:0097016)|protein domain specific binding (GO:0019904)			endometrium(2)|lung(2)|upper_aerodigestive_tract(1)	5						TCCAATAATTCAATTGCTCTA	0.388																																																	0													83.0	80.0	81.0					11																	27523450		2201	4298	6499	SO:0001583	missense	0			AK002077	CCDS7864.1	11p14	2008-07-18				ENSG00000148943			17789	protein-coding gene	gene with protein product	"""LIN-7 protein 3"""	612332				10341223	Standard	NM_018362		Approved	MALS-3, Lin7c, LIN-7C, LIN-7-C, VELI3, FLJ11215	uc001mrl.3	Q9NUP9		ENST00000278193.2:c.55G>C	11.37:g.27523450C>G	ENSP00000278193:p.Glu19Gln			Missense_Mutation	SNP	pfam_PDZ,pfam_L27_C,superfamily_PDZ,smart_L27,smart_PDZ,pirsf_Lin-7_homologue,pfscan_L27,pfscan_PDZ	p.E19Q	ENST00000278193.2	37	c.55	CCDS7864.1	11	.	.	.	.	.	.	.	.	.	.	C	19.15	3.770989	0.69992	.	.	ENSG00000148943	ENST00000278193;ENST00000524596	T;T	0.22336	2.2;1.96	5.6	5.6	0.85130	L27, C-terminal (1);L27 (2);	0.000000	0.85682	D	0.000000	T	0.31979	0.0814	M	0.70595	2.14	0.80722	D	1	B;B	0.20780	0.017;0.048	B;B	0.27380	0.026;0.079	T	0.06770	-1.0808	10	0.51188	T	0.08	.	19.9664	0.97271	0.0:1.0:0.0:0.0	.	19;19	G3V1D4;Q9NUP9	.;LIN7C_HUMAN	Q	19	ENSP00000278193:E19Q;ENSP00000435353:E19Q	ENSP00000278193:E19Q	E	-	1	0	LIN7C	27480026	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.776000	0.85560	2.788000	0.95919	0.655000	0.94253	GAA	LIN7C	-	pfam_L27_C,smart_L27,pirsf_Lin-7_homologue,pfscan_L27	ENSG00000148943		0.388	LIN7C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LIN7C	HGNC	protein_coding	OTTHUMT00000388311.2	-	0.00	76	0	C	NM_018362		27523450	-1	tier1	-	no_errors	ENST00000278193	ensembl	human	known	74_37	missense	7.32	114	9	SNP	1.000	G
LINC00221	338005	genome.wustl.edu	37	14	106950237	106950237	+	lincRNA	SNP	C	C	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr14:106950237C>T	ENST00000334298.3	+	0	432					NR_027457.2				long intergenic non-protein coding RNA 221																		TTGGATGAATCTCTGGAGAAG	0.468																																																	0																																												0			AK058096		14q32.33	2013-05-31	2011-08-11	2011-08-11	ENSG00000187156	ENSG00000270816		"""Long non-coding RNAs"""	20169	non-coding RNA	RNA, long non-coding			"""chromosome 14 open reading frame 98"", ""non-protein coding RNA 221"""	C14orf98, NCRNA00221			Standard	NR_027457		Approved		uc001ysy.2		OTTHUMG00000152084		14.37:g.106950237C>T				RNA	SNP	-	NULL	ENST00000334298.3	37	NULL		14																																																																																			LINC00221	-	-	ENSG00000187156		0.468	LINC00221-002	KNOWN	basic	lincRNA	LINC00221	HGNC	lincRNA	OTTHUMT00000325180.1	-	0.00	58	0	C	NR_027457		106950237	+1	tier1	-	no_errors	ENST00000334298	ensembl	human	known	74_37	rna	16.42	56	11	SNP	0.283	T
LIPM	340654	genome.wustl.edu	37	10	90574373	90574373	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr10:90574373G>T	ENST00000404743.4	+	4	718	c.551G>T	c.(550-552)gGc>gTc	p.G184V	LIPM_ENST00000539337.1_Missense_Mutation_p.G144V	NM_001128215.1	NP_001121687.1	Q5VYY2	LIPM_HUMAN	lipase, family member M	184					lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)	hydrolase activity, acting on ester bonds (GO:0016788)			breast(1)|central_nervous_system(1)|endometrium(1)|lung(2)|pancreas(1)|skin(1)	7						TATTATGTCGGCTATTCACAG	0.428																																																	0													132.0	108.0	115.0					10																	90574373		692	1591	2283	SO:0001583	missense	0				CCDS44457.1	10q23.31	2008-02-04	2007-02-27	2007-02-27	ENSG00000173239	ENSG00000173239			23455	protein-coding gene	gene with protein product		613923	"""lipase-like, ab-hydrolase domain containing 3"""	LIPL3			Standard	NM_001128215		Approved	bA304I5.1	uc009xtm.1	Q5VYY2	OTTHUMG00000018698	ENST00000404743.4:c.551G>T	10.37:g.90574373G>T	ENSP00000383901:p.Gly184Val		A6PVS3|B2RXK7|B5MCR3	Missense_Mutation	SNP	pfam_AB_hydrolase_lipase,pfam_AB_hydrolase_1	p.G184V	ENST00000404743.4	37	c.551	CCDS44457.1	10	.	.	.	.	.	.	.	.	.	.	G	27.6	4.847232	0.91277	.	.	ENSG00000173239	ENST00000404743;ENST00000539337	D;D	0.93659	-3.26;-3.26	6.03	6.03	0.97812	Alpha/beta hydrolase fold-1 (1);	0.000000	0.64402	D	0.000002	D	0.98137	0.9385	H	0.97077	3.935	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98611	1.0663	10	0.87932	D	0	-15.2046	20.1547	0.98103	0.0:0.0:1.0:0.0	.	144;184	B2RXK7;Q5VYY2	.;LIPM_HUMAN	V	184;144	ENSP00000383901:G184V;ENSP00000440375:G144V	ENSP00000383901:G184V	G	+	2	0	LIPM	90564353	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	7.868000	0.87116	2.868000	0.98415	0.555000	0.69702	GGC	LIPM	-	pfam_AB_hydrolase_1	ENSG00000173239		0.428	LIPM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIPM	HGNC	protein_coding	OTTHUMT00000049261.3	-	0.00	75	0	G	XM_291663		90574373	+1	tier1	-	no_errors	ENST00000404743	ensembl	human	known	74_37	missense	5.88	80	5	SNP	1.000	T
LMAN1L	79748	genome.wustl.edu	37	15	75116811	75116811	+	Silent	SNP	G	G	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr15:75116811G>A	ENST00000309664.5	+	13	1582	c.1443G>A	c.(1441-1443)gtG>gtA	p.V481V	LMAN1L_ENST00000379709.3_Silent_p.V469V|RP11-414J4.2_ENST00000564823.1_RNA|CPLX3_ENST00000395018.4_5'Flank	NM_021819.2	NP_068591.2	Q9HAT1	LMA1L_HUMAN	lectin, mannose-binding, 1 like	481						integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			NS(2)|breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						TCGGCTACGTGCACTTCAGGT	0.587																																																	0													107.0	104.0	105.0					15																	75116811		2197	4295	6492	SO:0001819	synonymous_variant	0			AF303398	CCDS10270.1	15q24.1	2005-08-05			ENSG00000140506	ENSG00000140506			6632	protein-coding gene	gene with protein product		609548				11255007	Standard	NM_021819		Approved	ERGL, ERGIC-53L	uc002ayt.1	Q9HAT1	OTTHUMG00000142813	ENST00000309664.5:c.1443G>A	15.37:g.75116811G>A			Q6UWN2	Silent	SNP	pfam_Lectin_leg,superfamily_ConA-like_lec_gl_sf	p.V481	ENST00000309664.5	37	c.1443	CCDS10270.1	15																																																																																			LMAN1L	-	NULL	ENSG00000140506		0.587	LMAN1L-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	LMAN1L	HGNC	protein_coding	OTTHUMT00000286397.4		0.00	50	0	G			75116811	+1			no_errors	ENST00000309664	ensembl	human	known	74_37	silent	10.20	44	5	SNP	0.076	A
KRT73	319101	genome.wustl.edu	37	12	53004924	53004925	+	Intron	INS	-	-	G			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr12:53004924_53004925insG	ENST00000305748.3	-	6	1145				RP11-641A6.2_ENST00000551089.1_RNA|RP11-641A6.2_ENST00000552364.1_RNA|RP11-641A6.2_ENST00000549180.1_RNA	NM_175068.2	NP_778238.1	Q86Y46	K2C73_HUMAN	keratin 73							extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44				BRCA - Breast invasive adenocarcinoma(357;0.189)		AGGAGGGGGCAGGGGGTGCTAA	0.53																																																	0																																										SO:0001627	intron_variant	0			AJ508776	CCDS8834.1	12q13.13	2013-06-25			ENSG00000186049	ENSG00000186049		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28928	protein-coding gene	gene with protein product		608247				12648212, 16831889	Standard	NM_175068		Approved	KRT6IRS3, K6IRS3	uc001sas.3	Q86Y46	OTTHUMG00000169746	ENST00000305748.3:c.1110+62->C	12.37:g.53004929_53004929dupG			Q32MB2	RNA	INS	-	NULL	ENST00000305748.3	37	NULL	CCDS8834.1	12																																																																																			RP11-641A6.2	-	-	ENSG00000257495		0.530	KRT73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100127967	Clone_based_vega_gene	protein_coding	OTTHUMT00000405700.1		0.00	35	0	-	NM_175068		53004925	+1	tier1		no_errors	ENST00000552364	ensembl	human	known	74_37	rna	8.00	23	2	INS	0.000:0.001	G
FAM231C	729587	genome.wustl.edu	37	1	16865771	16865771	+	Frame_Shift_Del	DEL	T	T	-	rs200788146|rs57681900		TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr1:16865771delT	ENST00000601199.1	+	1	211	c.211delT	c.(211-213)tttfs	p.F71fs																								GGAGGGCACCTTTTGGACAGA	0.572																																																	0																																										SO:0001589	frameshift_variant	0																														ENST00000601199.1:c.211delT	1.37:g.16865771delT	ENSP00000473163:p.Phe71fs			Frame_Shift_Del	DEL	NULL	p.W72fs	ENST00000601199.1	37	c.211		1																																																																																			AL355149.2	-	NULL	ENSG00000268674		0.572	AL355149.2-201	KNOWN	basic|appris_principal	protein_coding	LOC100133301	Clone_based_ensembl_gene	protein_coding			0.00	31	0	T			16865771	+1	tier1		no_errors	ENST00000601199	ensembl	human	known	74_37	frame_shift_del	8.00	23	2	DEL	0.035	-
LOC202181	202181	genome.wustl.edu	37	5	177099159	177099160	+	RNA	DNP	GC	GC	CA			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G|C	G|C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr5:177099159_177099160GC>CA	ENST00000515045.1	-	0	50_51					NR_026921.1																						ATGGCTGCGGGCCCCGACCGAA	0.752																																																	0																																												0																														Exception_encountered	5.37:g.177099159_177099160delinsCA				RNA	SNP	-	NULL	ENST00000515045.1	37	NULL		5																																																																																			RP11-1277A3.2	-	-	ENSG00000246596		0.752	RP11-1277A3.2-002	KNOWN	basic	processed_transcript	LOC202181	Clone_based_vega_gene	pseudogene	OTTHUMT00000373167.1		0.00	30	0	G|C			177099159|177099160	-1			no_errors	ENST00000515045	ensembl	human	known	74_37	rna	10.00	36	4	SNP	0.778|0.682	C|A
LONRF1	91694	genome.wustl.edu	37	8	12592793	12592793	+	Splice_Site	SNP	A	A	G			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr8:12592793A>G	ENST00000398246.3	-	7	1636		c.e7+1		LONRF1_ENST00000533751.1_Splice_Site|LONRF1_ENST00000530693.1_5'Flank	NM_152271.3	NP_689484.3	Q17RB8	LONF1_HUMAN	LON peptidase N-terminal domain and ring finger 1								ATP-dependent peptidase activity (GO:0004176)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(4)|ovary(1)|upper_aerodigestive_tract(2)	19				READ - Rectum adenocarcinoma(644;0.236)		ACAAATATTTACCTCTTTTAA	0.368																																																	0													88.0	80.0	82.0					8																	12592793		1845	4100	5945	SO:0001630	splice_region_variant	0			AK074329	CCDS5987.2	8p23.1	2013-01-09			ENSG00000154359	ENSG00000154359		"""RING-type (C3HC4) zinc fingers"""	26302	protein-coding gene	gene with protein product						18253036	Standard	XM_005273685		Approved	FLJ23749, RNF191	uc003wwd.1	Q17RB8	OTTHUMG00000165475	ENST00000398246.3:c.1566+1T>C	8.37:g.12592793A>G			B4DM29|B4DU84|Q8TEA0|Q9BSV1	Splice_Site	SNP	-	e7+2	ENST00000398246.3	37	c.1566+2	CCDS5987.2	8	.	.	.	.	.	.	.	.	.	.	A	16.55	3.155837	0.57259	.	.	ENSG00000154359	ENST00000398246;ENST00000533751;ENST00000524526	.	.	.	5.32	4.14	0.48551	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.9499	0.58394	0.8644:0.1356:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	LONRF1	12637164	1.000000	0.71417	1.000000	0.80357	0.851000	0.48451	8.910000	0.92685	1.085000	0.41206	0.460000	0.39030	.	LONRF1	-	-	ENSG00000154359		0.368	LONRF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LONRF1	HGNC	protein_coding	OTTHUMT00000251693.2	-	0.00	102	0	A	NM_152271	Intron	12592793	-1	tier1	-	no_errors	ENST00000398246	ensembl	human	known	74_37	splice_site	34.09	29	15	SNP	1.000	G
LPO	4025	genome.wustl.edu	37	17	56324982	56324982	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr17:56324982C>T	ENST00000262290.4	+	4	624	c.308C>T	c.(307-309)tCc>tTc	p.S103F	LPO_ENST00000582328.1_Intron|LPO_ENST00000543544.1_Missense_Mutation_p.S44F|LPO_ENST00000421678.2_Intron	NM_006151.2	NP_006142.1	P22079	PERL_HUMAN	lactoperoxidase	103					defense response to bacterium (GO:0042742)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|hydrogen peroxide catabolic process (GO:0042744)|response to oxidative stress (GO:0006979)|thiocyanate metabolic process (GO:0018969)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heme binding (GO:0020037)|metal ion binding (GO:0046872)|thiocyanate peroxidase activity (GO:0036393)	p.S103C(1)		breast(5)|cervix(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	30						CAGAAGGCATCCTTGACCAAT	0.557																																																	1	Substitution - Missense(1)	cervix(1)											90.0	84.0	86.0					17																	56324982		2203	4300	6503	SO:0001583	missense	0			M58151	CCDS32689.1, CCDS54149.1	17q23.1	2008-02-05				ENSG00000167419	1.11.1.7		6678	protein-coding gene	gene with protein product		150205				2222811, 8964511	Standard	NM_006151		Approved	SPO	uc002ivt.3	P22079		ENST00000262290.4:c.308C>T	17.37:g.56324982C>T	ENSP00000262290:p.Ser103Phe		A5JUY4|E7EMJ3|Q13408|Q3KNQ2	Missense_Mutation	SNP	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal,prints_Haem_peroxidase_animal_subgr	p.S103F	ENST00000262290.4	37	c.308	CCDS32689.1	17	.	.	.	.	.	.	.	.	.	.	C	8.410	0.843978	0.16963	.	.	ENSG00000167419	ENST00000262290;ENST00000543544	T;T	0.72051	-0.51;-0.62	5.56	3.15	0.36227	.	1.275740	0.04981	N	0.465592	T	0.51805	0.1696	N	0.08118	0	0.18873	N	0.999983	B;B	0.14805	0.011;0.002	B;B	0.22880	0.042;0.004	T	0.43718	-0.9374	10	0.46703	T	0.11	-1.3543	4.2944	0.10894	0.1679:0.6051:0.0:0.227	.	44;103	B4E1M1;P22079	.;PERL_HUMAN	F	103;44	ENSP00000262290:S103F;ENSP00000445344:S44F	ENSP00000262290:S103F	S	+	2	0	LPO	53679981	0.009000	0.17119	0.004000	0.12327	0.120000	0.20174	0.846000	0.27682	0.466000	0.27193	0.655000	0.94253	TCC	LPO	-	NULL	ENSG00000167419		0.557	LPO-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LPO	HGNC	protein_coding	OTTHUMT00000443961.1		0.00	60	0	C			56324982	+1			no_errors	ENST00000262290	ensembl	human	known	74_37	missense	7.69	36	3	SNP	0.006	T
LRBA	987	genome.wustl.edu	37	4	151682999	151682999	+	Splice_Site	SNP	C	C	G			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr4:151682999C>G	ENST00000357115.3	-	35	5824	c.5581G>C	c.(5581-5583)Gag>Cag	p.E1861Q	LRBA_ENST00000507224.1_Splice_Site_p.E1861Q|LRBA_ENST00000535741.1_Splice_Site_p.E1861Q|LRBA_ENST00000510413.1_Splice_Site_p.E1861Q	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing	1861						cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					TTTTGCCACTCCTATAAAAAA	0.274																																																	0													45.0	53.0	51.0					4																	151682999		2199	4274	6473	SO:0001630	splice_region_variant	0			AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.5581-1G>C	4.37:g.151682999C>G			Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_DUF1088,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_ConA-like_lec_gl_sf,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom	p.E1861Q	ENST00000357115.3	37	c.5581	CCDS3773.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.8|23.8	4.456858|4.456858	0.84317|0.84317	.|.	.|.	ENSG00000198589|ENSG00000198589	ENST00000535741;ENST00000510413;ENST00000357115;ENST00000507224|ENST00000509835	T;T;T;T|.	0.71817|.	-0.11;0.04;-0.09;-0.6|.	5.09|5.09	5.09|5.09	0.68999|0.68999	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.82056|0.82056	0.4954|0.4954	M|M	0.83953|0.83953	2.67|2.67	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	0.999;1.0|.	D;D|.	0.87578|.	0.994;0.998|.	D|D	0.83753|0.83753	0.0210|0.0210	10|5	0.72032|.	D|.	0.01|.	.|.	18.5067|18.5067	0.90900|0.90900	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1861;1861|.	P50851;P50851-2|.	LRBA_HUMAN;.|.	Q|S	1861|513	ENSP00000446299:E1861Q;ENSP00000421552:E1861Q;ENSP00000349629:E1861Q;ENSP00000422180:E1861Q|.	ENSP00000349629:E1861Q|.	E|R	-|-	1|3	0|2	LRBA|LRBA	151902449|151902449	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.925000|0.925000	0.55904|0.55904	7.128000|7.128000	0.77217|0.77217	2.352000|2.352000	0.79861|0.79861	0.655000|0.655000	0.94253|0.94253	GAG|AGG	LRBA	-	NULL	ENSG00000198589		0.274	LRBA-002	KNOWN	basic|CCDS	protein_coding	LRBA	HGNC	protein_coding	OTTHUMT00000364939.1	-	0.00	85	0	C		Missense_Mutation	151682999	-1	tier1	-	no_errors	ENST00000357115	ensembl	human	known	74_37	missense	72.37	20	55	SNP	1.000	G
LRFN5	145581	genome.wustl.edu	37	14	42360949	42360949	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr14:42360949G>T	ENST00000298119.4	+	4	3071	c.1882G>T	c.(1882-1884)Gct>Tct	p.A628S	LRFN5_ENST00000554171.1_Intron|LRFN5_ENST00000554120.1_Intron	NM_152447.3	NP_689660.2	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III domain containing 5	628						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(67)|ovary(5)|pancreas(3)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(2)	120			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		CACTACCTCTGCTTTGCCTCC	0.473										HNSCC(30;0.082)																																							0													130.0	106.0	114.0					14																	42360949		2203	4300	6503	SO:0001583	missense	0			AK055365	CCDS9678.1	14q21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000165379	ENSG00000165379		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	20360	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 8"""	612811	"""chromosome 14 open reading frame 146"""	C14orf146		16828986	Standard	NM_152447		Approved	FIGLER8, SALM5	uc001wvm.3	Q96NI6	OTTHUMG00000140261	ENST00000298119.4:c.1882G>T	14.37:g.42360949G>T	ENSP00000298119:p.Ala628Ser		B3KU78|Q86XL2	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Ig_sub,smart_Ig_sub2,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.A628S	ENST00000298119.4	37	c.1882	CCDS9678.1	14	.	.	.	.	.	.	.	.	.	.	G	12.63	1.995699	0.35226	.	.	ENSG00000165379	ENST00000298119	T	0.48522	0.81	5.9	4.99	0.66335	.	0.111905	0.39834	N	0.001253	T	0.27594	0.0678	N	0.08118	0	0.80722	D	1	B	0.16603	0.018	B	0.17098	0.017	T	0.08229	-1.0732	10	0.12103	T	0.63	.	14.7227	0.69320	0.0:0.1458:0.8542:0.0	.	628	Q96NI6	LRFN5_HUMAN	S	628	ENSP00000298119:A628S	ENSP00000298119:A628S	A	+	1	0	LRFN5	41430699	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.527000	0.53517	1.472000	0.48140	0.650000	0.86243	GCT	LRFN5	-	NULL	ENSG00000165379		0.473	LRFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRFN5	HGNC	protein_coding	OTTHUMT00000276786.1		0.00	61	0	G	NM_152447		42360949	+1			no_errors	ENST00000298119	ensembl	human	known	74_37	missense	5.17	55	3	SNP	1.000	T
LRP1B	53353	genome.wustl.edu	37	2	141232707	141232707	+	Splice_Site	SNP	C	C	T	rs77794732		TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr2:141232707C>T	ENST00000389484.3	-	60	10596	c.9625G>A	c.(9625-9627)Gtc>Atc	p.V3209I		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	3209					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.V3209F(2)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CTGGACCAACCTTTGTGTCTA	0.289										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)												2	Substitution - Missense(2)	lung(2)											77.0	73.0	74.0					2																	141232707		2203	4299	6502	SO:0001630	splice_region_variant	0			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.9625+1G>A	2.37:g.141232707C>T			Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EG-like_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.V3209I	ENST00000389484.3	37	c.9625	CCDS2182.1	2	.	.	.	.	.	.	.	.	.	.	C	19.10	3.762279	0.69763	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.91295	-2.82	5.72	5.72	0.89469	Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);	0.000000	0.64402	U	0.000003	D	0.93099	0.7803	L	0.39633	1.23	0.58432	D	0.999997	D	0.58970	0.984	D	0.68192	0.956	D	0.91614	0.5305	9	.	.	.	.	19.8807	0.96899	0.0:1.0:0.0:0.0	.	3209	Q9NZR2	LRP1B_HUMAN	I	3209;3147	ENSP00000374135:V3209I	.	V	-	1	0	LRP1B	140949177	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.771000	0.85420	2.704000	0.92352	0.650000	0.86243	GTC	LRP1B	-	superfamily_Growth_fac_rcpt_N_dom,smart_LDLR_classB_rpt	ENSG00000168702		0.289	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	HGNC	protein_coding	OTTHUMT00000254736.2		0.00	31	0	C	NM_018557	Missense_Mutation	141232707	-1			no_errors	ENST00000389484	ensembl	human	known	74_37	missense	10.53	17	2	SNP	1.000	T
LRP4	4038	genome.wustl.edu	37	11	46911003	46911003	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr11:46911003G>T	ENST00000378623.1	-	16	2416	c.2174C>A	c.(2173-2175)cCc>cAc	p.P725H		NM_002334.3	NP_002325.2	O75096	LRP4_HUMAN	low density lipoprotein receptor-related protein 4	725	EGF-like 3.				dendrite morphogenesis (GO:0048813)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|limb development (GO:0060173)|negative regulation of axonogenesis (GO:0050771)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of ossification (GO:0030279)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of presynaptic membrane organization (GO:1901631)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|proximal/distal pattern formation (GO:0009954)|regulation of protein phosphorylation (GO:0001932)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|synapse organization (GO:0050808)|synaptic growth at neuromuscular junction (GO:0051124)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|synaptic membrane (GO:0097060)	calcium ion binding (GO:0005509)|receptor tyrosine kinase binding (GO:0030971)|scaffold protein binding (GO:0097110)			breast(7)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(24)|ovary(3)|pancreas(2)|prostate(5)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	70				Lung(87;0.159)		GAAGCCAGTGGGGCAGGCACA	0.607											OREG0020948	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													87.0	85.0	86.0					11																	46911003		2201	4299	6500	SO:0001583	missense	0			AB011540	CCDS31478.1	11p11.2	2013-05-29			ENSG00000134569	ENSG00000134569		"""Low density lipoprotein receptors"""	6696	protein-coding gene	gene with protein product		604270				9693030	Standard	NM_002334		Approved	MEGF7, CLSS, LRP-4, SOST2	uc001ndn.4	O75096	OTTHUMG00000166700	ENST00000378623.1:c.2174C>A	11.37:g.46911003G>T	ENSP00000367888:p.Pro725His	942	B2RN39|Q4AC85|Q5KTZ5	Missense_Mutation	SNP	pfam_LDLR_classB_rpt,pfam_LDrepeatLR_classA_rpt,pfam_EGF-like_Ca-bd_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.P725H	ENST00000378623.1	37	c.2174	CCDS31478.1	11	.	.	.	.	.	.	.	.	.	.	G	32	5.170836	0.94807	.	.	ENSG00000134569	ENST00000378623	D	0.89617	-2.54	5.53	5.53	0.82687	Growth factor, receptor (1);Epidermal growth factor-like (1);EGF-like region, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.94102	0.8109	M	0.69463	2.115	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.94325	0.7557	10	0.87932	D	0	.	19.4728	0.94969	0.0:0.0:1.0:0.0	.	725	O75096	LRP4_HUMAN	H	725	ENSP00000367888:P725H	ENSP00000367888:P725H	P	-	2	0	LRP4	46867579	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.439000	0.97543	2.608000	0.88229	0.561000	0.74099	CCC	LRP4	-	superfamily_Growth_fac_rcpt_N_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom	ENSG00000134569		0.607	LRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP4	HGNC	protein_coding	OTTHUMT00000391133.1		0.00	43	0	G	NM_002334		46911003	-1			no_errors	ENST00000378623	ensembl	human	known	74_37	missense	5.88	64	4	SNP	1.000	T
LRRC1	55227	genome.wustl.edu	37	6	53761325	53761325	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr6:53761325G>T	ENST00000370888.1	+	5	753	c.476G>T	c.(475-477)aGa>aTa	p.R159I		NM_018214.4	NP_060684.4	Q9BTT6	LRRC1_HUMAN	leucine rich repeat containing 1	159						cytoplasm (GO:0005737)|membrane (GO:0016020)				cervix(1)|endometrium(3)|large_intestine(5)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20	Lung NSC(77;0.0147)			BRCA - Breast invasive adenocarcinoma(397;0.0745)		CTGGAACTGAGAGAGAATCTT	0.368																																																	0													158.0	168.0	165.0					6																	53761325		2202	4300	6502	SO:0001583	missense	0			AF332199	CCDS4953.2	6p12.2	2014-07-30	2003-11-19		ENSG00000137269	ENSG00000137269			14307	protein-coding gene	gene with protein product		608195	"""leucine-rich repeat-containing 1"""				Standard	NM_018214		Approved	dJ523E19.1, LANO, FLJ10775, FLJ11834	uc003pcd.1	Q9BTT6	OTTHUMG00000014885	ENST00000370888.1:c.476G>T	6.37:g.53761325G>T	ENSP00000359925:p.Arg159Ile		Q5TGN3|Q9HAC0|Q9NVF1	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.R159I	ENST00000370888.1	37	c.476	CCDS4953.2	6	.	.	.	.	.	.	.	.	.	.	G	31	5.080583	0.94050	.	.	ENSG00000137269	ENST00000370888	T	0.10477	2.87	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.31263	0.0791	M	0.82433	2.59	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	T	0.08743	-1.0707	10	0.72032	D	0.01	.	18.4928	0.90853	0.0:0.0:1.0:0.0	.	159	Q9BTT6	LRRC1_HUMAN	I	159	ENSP00000359925:R159I	ENSP00000359925:R159I	R	+	2	0	LRRC1	53869284	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.988000	0.93501	2.618000	0.88619	0.655000	0.94253	AGA	LRRC1	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000137269		0.368	LRRC1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC1	HGNC	protein_coding	OTTHUMT00000040970.2		0.00	65	0	G	NM_025168		53761325	+1			no_errors	ENST00000370888	ensembl	human	known	74_37	missense	8.16	45	4	SNP	1.000	T
LRRC7	57554	genome.wustl.edu	37	1	70397207	70397207	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr1:70397207C>G	ENST00000035383.5	+	6	581	c.551C>G	c.(550-552)gCc>gGc	p.A184G	LRRC7_ENST00000310961.5_Missense_Mutation_p.A189G|LRRC7_ENST00000415775.2_5'UTR	NM_020794.2	NP_065845.1	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	184						cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)				breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						CACAAACTGGCCCAGTTGGAA	0.403																																																	0													93.0	87.0	89.0					1																	70397207		2203	4300	6503	SO:0001583	missense	0				CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000035383.5:c.551C>G	1.37:g.70397207C>G	ENSP00000035383:p.Ala184Gly		Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_PDZ,superfamily_PDZ,smart_Leu-rich_rpt_typical-subtyp,smart_PDZ,pfscan_PDZ	p.A184G	ENST00000035383.5	37	c.551	CCDS645.1	1	.	.	.	.	.	.	.	.	.	.	C	14.53	2.563563	0.45694	.	.	ENSG00000033122	ENST00000310961;ENST00000035383;ENST00000370957	T;T	0.09817	2.94;2.94	5.92	4.03	0.46877	.	0.125660	0.56097	N	0.000028	T	0.03520	0.0101	N	0.17345	0.48	0.80722	D	1	B	0.29955	0.263	B	0.36766	0.232	T	0.43829	-0.9367	10	0.30854	T	0.27	.	13.2029	0.59778	0.0:0.6943:0.3057:0.0	.	184	Q96NW7	LRRC7_HUMAN	G	189;184;7	ENSP00000309245:A189G;ENSP00000035383:A184G	ENSP00000035383:A184G	A	+	2	0	LRRC7	70169795	0.998000	0.40836	1.000000	0.80357	0.994000	0.84299	0.911000	0.28584	0.812000	0.34326	-0.182000	0.12963	GCC	LRRC7	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000033122		0.403	LRRC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC7	HGNC	protein_coding	OTTHUMT00000131261.1	-	0.00	76	0	C	NM_020794		70397207	+1	tier1	-	no_errors	ENST00000035383	ensembl	human	known	74_37	missense	20.93	68	18	SNP	1.000	G
LRRTM3	347731	genome.wustl.edu	37	10	68687865	68687865	+	Silent	SNP	G	G	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr10:68687865G>A	ENST00000361320.4	+	2	1769	c.1191G>A	c.(1189-1191)ccG>ccA	p.P397P	CTNNA3_ENST00000373744.4_Intron|CTNNA3_ENST00000433211.2_Intron	NM_178011.3	NP_821079.3	Q86VH5	LRRT3_HUMAN	leucine rich repeat transmembrane neuronal 3	397					positive regulation of beta-amyloid formation (GO:1902004)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				breast(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(20)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	41						CTTTGCCCCCGACGGTGGGAG	0.607																																																	0													43.0	47.0	45.0					10																	68687865		2203	4300	6503	SO:0001819	synonymous_variant	0			BX640611	CCDS7270.1	10q22.1	2007-01-22				ENSG00000198739			19410	protein-coding gene	gene with protein product		610869				12676565	Standard	XR_247527		Approved		uc001jmz.1	Q86VH5		ENST00000361320.4:c.1191G>A	10.37:g.68687865G>A			A8K2A3|Q2NKX7|Q6N0A3	Silent	SNP	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp	p.P397	ENST00000361320.4	37	c.1191	CCDS7270.1	10																																																																																			LRRTM3	-	NULL	ENSG00000198739		0.607	LRRTM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRTM3	HGNC	protein_coding	OTTHUMT00000048277.2	-	0.00	38	0	G	NM_178011		68687865	+1	tier1	-	no_errors	ENST00000361320	ensembl	human	known	74_37	silent	18.75	26	6	SNP	0.997	A
LSM2	57819	genome.wustl.edu	37	6	31774389	31774389	+	Intron	SNP	A	A	G			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr6:31774389A>G	ENST00000375661.5	-	1	230				LSM2_ENST00000491421.1_5'UTR	NM_021177.4	NP_067000.1	Q9Y333	LSM2_HUMAN	LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae)						exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)	poly(A) RNA binding (GO:0044822)|U6 snRNA binding (GO:0017070)			large_intestine(1)|lung(1)	2						TGCCTCCTCAATGAACCTGAG	0.478																																																	0																																										SO:0001627	intron_variant	0			AF182288	CCDS4722.1	6p21.3	2010-02-17	2003-02-17	2003-02-21	ENSG00000204392	ENSG00000204392			13940	protein-coding gene	gene with protein product		607282	"""chromosome 6 open reading frame 28"""	C6orf28		10523320, 8428774	Standard	NM_021177		Approved	G7b, YBL026W	uc003nxg.3	Q9Y333	OTTHUMG00000031121	ENST00000375661.5:c.3+142T>C	6.37:g.31774389A>G			Q6FGG1	RNA	SNP	-	NULL	ENST00000375661.5	37	NULL	CCDS4722.1	6																																																																																			LSM2	-	-	ENSG00000204392		0.478	LSM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LSM2	HGNC	protein_coding	OTTHUMT00000076205.2	-	0.00	62	0	A	NM_021177		31774389	-1	tier1	-	no_errors	ENST00000491421	ensembl	human	known	74_37	rna	71.43	10	25	SNP	0.000	G
MACROD1	28992	genome.wustl.edu	37	11	63918714	63918714	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr11:63918714C>T	ENST00000255681.6	-	3	580	c.514G>A	c.(514-516)Gcc>Acc	p.A172T	MACROD1_ENST00000538595.1_5'UTR	NM_014067.3	NP_054786.2	Q9BQ69	MACD1_HUMAN	MACRO domain containing 1	172	Macro. {ECO:0000255|PROSITE- ProRule:PRU00490}.|Substrate binding. {ECO:0000250}.				cellular response to DNA damage stimulus (GO:0006974)|protein de-ADP-ribosylation (GO:0051725)|purine nucleoside metabolic process (GO:0042278)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	deacetylase activity (GO:0019213)|hydrolase activity, acting on glycosyl bonds (GO:0016798)			breast(1)|large_intestine(3)|lung(6)|skin(1)	11						CACTCACCGGCGTTGACGATG	0.612																																																	0													129.0	105.0	113.0					11																	63918714		2201	4297	6498	SO:0001583	missense	0			AF202922	CCDS8056.1	11q13.1	2007-07-24	2007-06-11		ENSG00000133315	ENSG00000133315			29598	protein-coding gene	gene with protein product		610400				15691879	Standard	NM_014067		Approved	LRP16	uc001nyh.3	Q9BQ69	OTTHUMG00000167843	ENST00000255681.6:c.514G>A	11.37:g.63918714C>T	ENSP00000255681:p.Ala172Thr		Q9UH96	Missense_Mutation	SNP	pfam_Macro_dom,smart_Macro_dom,pfscan_Macro_dom	p.A172T	ENST00000255681.6	37	c.514	CCDS8056.1	11	.	.	.	.	.	.	.	.	.	.	C	18.26	3.585274	0.66105	.	.	ENSG00000133315	ENST00000255681	T	0.41065	1.01	3.86	3.86	0.44501	Appr-1-p processing (3);	0.000000	0.85682	D	0.000000	T	0.66645	0.2810	M	0.84511	2.7	0.54753	D	0.999989	D	0.71674	0.998	D	0.70227	0.968	T	0.74636	-0.3599	10	0.72032	D	0.01	.	14.9765	0.71277	0.0:1.0:0.0:0.0	.	172	Q9BQ69	MACD1_HUMAN	T	172	ENSP00000255681:A172T	ENSP00000255681:A172T	A	-	1	0	MACROD1	63675290	0.999000	0.42202	0.600000	0.28864	0.313000	0.28021	5.516000	0.67055	1.891000	0.54761	0.462000	0.41574	GCC	MACROD1	-	pfam_Macro_dom,smart_Macro_dom,pfscan_Macro_dom	ENSG00000133315		0.612	MACROD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MACROD1	HGNC	protein_coding	OTTHUMT00000396570.1		0.00	27	0	C	NM_014067		63918714	-1			no_errors	ENST00000255681	ensembl	human	known	74_37	missense	12.50	28	4	SNP	0.997	T
MAGI2	9863	genome.wustl.edu	37	7	77649090	77649090	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr7:77649090C>G	ENST00000354212.4	-	22	4163	c.3910G>C	c.(3910-3912)Ggc>Cgc	p.G1304R	MAGI2_ENST00000522391.1_3'UTR|MAGI2_ENST00000419488.1_Missense_Mutation_p.G1290R	NM_012301.3	NP_036433.2	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 2	1304					cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|glomerular visceral epithelial cell development (GO:0072015)|mitotic cell cycle arrest (GO:0071850)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase B signaling (GO:0051898)|nerve growth factor signaling pathway (GO:0038180)|planar cell polarity pathway involved in axis elongation (GO:0003402)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of receptor internalization (GO:0002092)|protein heterooligomerization (GO:0051291)|receptor clustering (GO:0043113)|SMAD protein signal transduction (GO:0060395)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|late endosome (GO:0005770)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)|synapse (GO:0045202)|tight junction (GO:0005923)	beta-1 adrenergic receptor binding (GO:0031697)|phosphatase binding (GO:0019902)|receptor signaling complex scaffold activity (GO:0030159)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|type II activin receptor binding (GO:0070699)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(37)|ovary(5)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(3)	84		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				TTCTTCTGGCCGCAGGCTGAA	0.682																																																	0													49.0	57.0	55.0					7																	77649090		2203	4300	6503	SO:0001583	missense	0			AB014605	CCDS5594.1, CCDS75623.1	7q21	2005-08-09			ENSG00000187391	ENSG00000187391			18957	protein-coding gene	gene with protein product		606382				10681527, 9734811	Standard	XM_005250725		Approved	AIP1, ARIP1, KIAA0705, ACVRIP1, MAGI-2	uc003ugx.3	Q86UL8	OTTHUMG00000130697	ENST00000354212.4:c.3910G>C	7.37:g.77649090C>G	ENSP00000346151:p.Gly1304Arg		A4D1C1|A7E2C3|O60434|O60510|Q86UI7|Q9NP44|Q9UDQ5|Q9UDU1	Missense_Mutation	SNP	pfam_PDZ,pfam_WW_dom,pfam_GK/Ca_channel_bsu,superfamily_PDZ,superfamily_P-loop_NTPase,superfamily_WW_dom,smart_PDZ,smart_GK/Ca_channel_bsu,smart_WW_dom,pfscan_PDZ,pfscan_WW_dom,pfscan_Guanylate_kin-like	p.G1304R	ENST00000354212.4	37	c.3910	CCDS5594.1	7	.	.	.	.	.	.	.	.	.	.	c	25.4	4.631044	0.87660	.	.	ENSG00000187391	ENST00000419488;ENST00000354212	T;T	0.09350	2.99;3.0	4.44	3.53	0.40419	.	.	.	.	.	T	0.12433	0.0302	N	0.19112	0.55	0.80722	D	1	D;P	0.55800	0.973;0.954	P;P	0.55455	0.776;0.602	T	0.15867	-1.0422	9	0.20046	T	0.44	.	11.7328	0.51748	0.0:0.9099:0.0:0.0901	.	1290;1304	Q86UL8-2;Q86UL8	.;MAGI2_HUMAN	R	1290;1304	ENSP00000405766:G1290R;ENSP00000346151:G1304R	ENSP00000346151:G1304R	G	-	1	0	MAGI2	77487026	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.478000	0.45189	0.807000	0.34208	0.544000	0.68410	GGC	MAGI2	-	NULL	ENSG00000187391		0.682	MAGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGI2	HGNC	protein_coding	OTTHUMT00000253197.3		0.00	14	0	C	NM_012301		77649090	-1			no_errors	ENST00000354212	ensembl	human	known	74_37	missense	27.27	16	6	SNP	1.000	G
MAML3	55534	genome.wustl.edu	37	4	140651587	140651587	+	Missense_Mutation	SNP	G	G	T	rs201995024|rs397746874|rs5862430|rs397881377|rs3051167	byFrequency	TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr4:140651587G>T	ENST00000509479.2	-	3	3170	c.2314C>A	c.(2314-2316)Cag>Aag	p.Q772K	MGST2_ENST00000515137.1_Intron	NM_018717.4	NP_061187			mastermind-like 3 (Drosophila)									p.Q772delQ(2)		breast(1)|endometrium(7)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	25	all_hematologic(180;0.162)					GCCAAAATctgctgctgctgc	0.537																																																	2	Deletion - In frame(2)	breast(2)											3.0	3.0	3.0					4																	140651587		1812	3413	5225	SO:0001583	missense	0			AB058719	CCDS54805.1	4q31.1	2014-08-12	2003-09-24		ENSG00000196782	ENSG00000196782			16272	protein-coding gene	gene with protein product	"""mastermind (drosophila)-like 3"""	608991	"""trinucleotide repeat containing 3"""	TNRC3		12370315, 12386158	Standard	NM_018717		Approved	KIAA1816, MAM2, CAGH3, GDN	uc021xsg.1	Q96JK9	OTTHUMG00000161441	ENST00000509479.2:c.2314C>A	4.37:g.140651587G>T	ENSP00000421180:p.Gln772Lys			Missense_Mutation	SNP	pfam_Neuroggenic_mastermind-like_N	p.Q772K	ENST00000509479.2	37	c.2314	CCDS54805.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	1.683|1.683	-0.505885|-0.505885	0.04261|0.04261	.|.	.|.	ENSG00000196782|ENSG00000196782	ENST00000509479;ENST00000538400|ENST00000502696	T|.	0.21734|.	1.99|.	3.36|3.36	3.36|3.36	0.38483|0.38483	.|.	0.571166|.	0.13309|.	U|.	0.397666|.	T|T	0.39911|0.39911	0.1096|0.1096	N|N	0.16478|0.16478	0.41|0.41	0.80722|0.80722	D|D	1|1	B;B|.	0.15473|.	0.013;0.013|.	B;B|.	0.11329|.	0.006;0.006|.	T|T	0.16541|0.16541	-1.0399|-1.0399	10|5	0.07644|.	T|.	0.81|.	.|.	10.6608|10.6608	0.45702|0.45702	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	772;768|.	E7EVW8;Q96JK9|.	.;MAML3_HUMAN|.	K|R	772;79|115	ENSP00000421180:Q772K|.	ENSP00000421180:Q772K|.	Q|S	-|-	1|3	0|2	MAML3|MAML3	140871037|140871037	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.982000|0.982000	0.71751|0.71751	2.139000|2.139000	0.42149|0.42149	1.616000|1.616000	0.50265|0.50265	0.480000|0.480000	0.44947|0.44947	CAG|AGC	MAML3	-	NULL	ENSG00000196782		0.537	MAML3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAML3	HGNC	protein_coding	OTTHUMT00000364934.2		0.00	10	0	G			140651587	-1			no_errors	ENST00000509479	ensembl	human	known	74_37	missense	30.00	14	6	SNP	1.000	T
MAP3K1	4214	genome.wustl.edu	37	5	56161771	56161771	+	Nonsense_Mutation	SNP	C	C	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr5:56161771C>A	ENST00000399503.3	+	6	1268	c.1268C>A	c.(1267-1269)tCa>tAa	p.S423*		NM_005921.1	NP_005912.1	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase	423	Poly-Ser.				activation of MAPKK activity (GO:0000186)|apoptotic mitochondrial changes (GO:0008637)|cellular response to mechanical stimulus (GO:0071260)|epithelial cell morphogenesis (GO:0003382)|eyelid development in camera-type eye (GO:0061029)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of actin filament polymerization (GO:0030838)|protein phosphorylation (GO:0006468)|regulation of cell migration (GO:0030334)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	cytosol (GO:0005829)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)	p.S260*(1)		NS(1)|breast(19)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(11)|ovary(1)|skin(3)|urinary_tract(1)	57		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		ACATTGTCATCATCTAGTACT	0.348																																																	1	Substitution - Nonsense(1)	large_intestine(1)											97.0	93.0	94.0					5																	56161771		1880	4110	5990	SO:0001587	stop_gained	0			U29671, AF042838	CCDS43318.1	5q11.2	2012-02-23	2012-02-23		ENSG00000095015	ENSG00000095015		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6848	protein-coding gene	gene with protein product		600982	"""mitogen-activated protein kinase kinase kinase 1"""	MEKK1		8597633	Standard	NM_005921		Approved	MEKK, MAPKKK1	uc003jqw.4	Q13233	OTTHUMG00000059486	ENST00000399503.3:c.1268C>A	5.37:g.56161771C>A	ENSP00000382423:p.Ser423*			Nonsense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Znf_RING,pfscan_Znf_SWIM,pfscan_Prot_kinase_dom	p.S423*	ENST00000399503.3	37	c.1268	CCDS43318.1	5	.	.	.	.	.	.	.	.	.	.	C	37	6.418626	0.97550	.	.	ENSG00000095015	ENST00000399503	.	.	.	5.72	5.72	0.89469	.	0.083491	0.51477	D	0.000100	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.8765	0.96875	0.0:1.0:0.0:0.0	.	.	.	.	X	423	.	ENSP00000382423:S423X	S	+	2	0	MAP3K1	56197528	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.421000	0.73353	2.695000	0.91970	0.650000	0.86243	TCA	MAP3K1	-	NULL	ENSG00000095015		0.348	MAP3K1-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MAP3K1	HGNC	protein_coding	OTTHUMT00000132309.2		0.00	51	0	C	XM_042066		56161771	+1			no_errors	ENST00000399503	ensembl	human	novel	74_37	nonsense	5.00	38	2	SNP	1.000	A
MAP3K1	4214	genome.wustl.edu	37	5	56179413	56179413	+	Silent	SNP	A	A	G			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr5:56179413A>G	ENST00000399503.3	+	15	3726	c.3726A>G	c.(3724-3726)gaA>gaG	p.E1242E		NM_005921.1	NP_005912.1	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase	1242					activation of MAPKK activity (GO:0000186)|apoptotic mitochondrial changes (GO:0008637)|cellular response to mechanical stimulus (GO:0071260)|epithelial cell morphogenesis (GO:0003382)|eyelid development in camera-type eye (GO:0061029)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of actin filament polymerization (GO:0030838)|protein phosphorylation (GO:0006468)|regulation of cell migration (GO:0030334)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	cytosol (GO:0005829)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)			NS(1)|breast(19)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(11)|ovary(1)|skin(3)|urinary_tract(1)	57		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		AAGACACTGAATGGCTGAAAG	0.393																																																	0													165.0	159.0	161.0					5																	56179413		1877	4094	5971	SO:0001819	synonymous_variant	0			U29671, AF042838	CCDS43318.1	5q11.2	2012-02-23	2012-02-23		ENSG00000095015	ENSG00000095015		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6848	protein-coding gene	gene with protein product		600982	"""mitogen-activated protein kinase kinase kinase 1"""	MEKK1		8597633	Standard	NM_005921		Approved	MEKK, MAPKKK1	uc003jqw.4	Q13233	OTTHUMG00000059486	ENST00000399503.3:c.3726A>G	5.37:g.56179413A>G				Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Znf_RING,pfscan_Znf_SWIM,pfscan_Prot_kinase_dom	p.E1242	ENST00000399503.3	37	c.3726	CCDS43318.1	5																																																																																			MAP3K1	-	superfamily_Kinase-like_dom	ENSG00000095015		0.393	MAP3K1-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MAP3K1	HGNC	protein_coding	OTTHUMT00000132309.2	-	0.00	118	0	A	XM_042066		56179413	+1	tier1	-	no_errors	ENST00000399503	ensembl	human	novel	74_37	silent	48.39	32	30	SNP	0.952	G
MED24	9862	genome.wustl.edu	37	17	38178915	38178915	+	Silent	SNP	C	C	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr17:38178915C>T	ENST00000394128.2	-	21	2496	c.2415G>A	c.(2413-2415)ccG>ccA	p.P805P	MED24_ENST00000501516.3_Silent_p.P824P|MED24_ENST00000356271.3_Silent_p.P792P|MED24_ENST00000394127.2_Silent_p.P792P|MED24_ENST00000394126.1_Silent_p.P830P	NM_014815.3	NP_055630.2	O75448	MED24_HUMAN	mediator complex subunit 24	805					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterooligomerization (GO:0051291)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			autonomic_ganglia(1)|breast(2)|endometrium(9)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	41	Colorectal(19;0.000442)					GAGCAGTGCCCGGGGGGTCCA	0.637																																																	0													49.0	50.0	49.0					17																	38178915		2203	4300	6503	SO:0001819	synonymous_variant	0			AF055995	CCDS11359.1, CCDS42315.1	17q21.2	2007-07-30	2007-07-30	2007-07-30	ENSG00000008838	ENSG00000008838			22963	protein-coding gene	gene with protein product		607000	"""thyroid hormone receptor associated protein 4"", ""cofactor required for Sp1 transcriptional activation, subunit 4, 100kDa"""	THRAP4, CRSP4			Standard	NM_001079518		Approved	TRAP100, KIAA0130, DRIP100, CRSP100	uc002htt.3	O75448	OTTHUMG00000133329	ENST00000394128.2:c.2415G>A	17.37:g.38178915C>T			A8K4S5|B3KMR9|Q14143|Q9NNY5	Silent	SNP	pfam_Mediator_Med24_N	p.P805	ENST00000394128.2	37	c.2415	CCDS11359.1	17	.	.	.	.	.	.	.	.	.	.	C	0.223	-1.026802	0.02045	.	.	ENSG00000008838	ENST00000422942	.	.	.	5.39	-9.04	0.00734	.	.	.	.	.	T	0.31796	0.0808	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.42548	-0.9445	4	.	.	.	-13.326	0.6774	0.00869	0.2578:0.2986:0.1641:0.2794	.	.	.	.	R	60	.	.	G	-	1	0	MED24	35432441	0.000000	0.05858	0.858000	0.33744	0.132000	0.20833	-2.573000	0.00912	-1.312000	0.02306	-2.610000	0.00160	GGG	MED24	-	pfam_Mediator_Med24_N	ENSG00000008838		0.637	MED24-006	KNOWN	basic|appris_principal|CCDS	protein_coding	MED24	HGNC	protein_coding	OTTHUMT00000257147.2	-	0.00	23	0	C	NM_014815		38178915	-1	tier1	-	no_errors	ENST00000394128	ensembl	human	known	74_37	silent	28.12	23	9	SNP	0.012	T
MED13	9969	genome.wustl.edu	37	17	60059673	60059673	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr17:60059673C>T	ENST00000397786.2	-	16	3767	c.3691G>A	c.(3691-3693)Gac>Aac	p.D1231N		NM_005121.2	NP_005112.2	Q9UHV7	MED13_HUMAN	mediator complex subunit 13	1231					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(4)|central_nervous_system(1)|endometrium(10)|kidney(24)|large_intestine(15)|liver(1)|lung(20)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						AGGTAGCAGTCATTGCAACAG	0.423																																																	0													141.0	128.0	132.0					17																	60059673		1958	4152	6110	SO:0001583	missense	0			AB011165	CCDS42366.1	17q22-q23	2007-07-30	2007-07-30	2007-07-30		ENSG00000108510			22474	protein-coding gene	gene with protein product		603808	"""thyroid hormone receptor associated protein 1"""	THRAP1		1019863	Standard	NM_005121		Approved	KIAA0593, TRAP240	uc002izo.3	Q9UHV7		ENST00000397786.2:c.3691G>A	17.37:g.60059673C>T	ENSP00000380888:p.Asp1231Asn		B2RU05|O60334	Missense_Mutation	SNP	pfam_Mediator_Med13,pfam_Mediator_Med13_N_met/fun	p.D1231N	ENST00000397786.2	37	c.3691	CCDS42366.1	17	.	.	.	.	.	.	.	.	.	.	C	26.1	4.707027	0.89018	.	.	ENSG00000108510	ENST00000397786;ENST00000262436	T	0.74632	-0.86	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	D	0.84995	0.5596	L	0.60455	1.87	0.80722	D	1	D	0.69078	0.997	D	0.77004	0.989	D	0.84354	0.0534	10	0.54805	T	0.06	0.0017	20.1356	0.98028	0.0:1.0:0.0:0.0	.	1231	Q9UHV7	MED13_HUMAN	N	1231;1230	ENSP00000380888:D1231N	ENSP00000262436:D1230N	D	-	1	0	MED13	57414455	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.403000	0.79983	2.755000	0.94549	0.650000	0.86243	GAC	MED13	-	NULL	ENSG00000108510		0.423	MED13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED13	HGNC	protein_coding	OTTHUMT00000445461.1	-	0.00	59	0	C	NM_005121		60059673	-1	tier1	-	no_errors	ENST00000397786	ensembl	human	known	74_37	missense	17.07	68	14	SNP	1.000	T
MERTK	10461	genome.wustl.edu	37	2	112786035	112786035	+	Missense_Mutation	SNP	G	G	T	rs546088670		TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr2:112786035G>T	ENST00000295408.4	+	19	2851	c.2594G>T	c.(2593-2595)cGg>cTg	p.R865L	MERTK_ENST00000421804.2_Missense_Mutation_p.R865L|MERTK_ENST00000409780.1_Missense_Mutation_p.R689L			Q12866	MERTK_HUMAN	MER proto-oncogene, tyrosine kinase	865			R -> W (in dbSNP:rs2230516). {ECO:0000269|PubMed:17344846}.		apoptotic cell clearance (GO:0043277)|blood coagulation (GO:0007596)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|leukocyte migration (GO:0050900)|natural killer cell differentiation (GO:0001779)|negative regulation of lymphocyte activation (GO:0051250)|peptidyl-tyrosine phosphorylation (GO:0018108)|phagocytosis (GO:0006909)|platelet activation (GO:0030168)|positive regulation of phagocytosis (GO:0050766)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|retina development in camera-type eye (GO:0060041)|secretion by cell (GO:0032940)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|rhabdomere (GO:0016028)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.R865Q(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|liver(1)|lung(18)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(10)	46						CCTGACGTTCGGAACCAAGCA	0.507																																																	1	Substitution - Missense(1)	large_intestine(1)											110.0	115.0	113.0					2																	112786035		2203	4300	6503	SO:0001583	missense	0			U08023	CCDS2094.1	2q14.1	2014-06-26	2014-06-26		ENSG00000153208	ENSG00000153208		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7027	protein-coding gene	gene with protein product		604705	"""c-mer proto-oncogene tyrosine kinase"""			8086340, 10343112	Standard	XM_005263565		Approved	mer, RP38	uc002thk.1	Q12866	OTTHUMG00000131278	ENST00000295408.4:c.2594G>T	2.37:g.112786035G>T	ENSP00000295408:p.Arg865Leu		Q9HBB4	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_Ig_I-set,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Rhodanese-like_dom,smart_Ig_sub,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R865L	ENST00000295408.4	37	c.2594	CCDS2094.1	2	.	.	.	.	.	.	.	.	.	.	G	7.792	0.711815	0.15306	.	.	ENSG00000153208	ENST00000295408;ENST00000421804;ENST00000393237;ENST00000409780;ENST00000449344	T;T;T;T	0.60797	0.16;0.16;0.16;0.16	5.81	-2.99	0.05497	Protein kinase-like domain (1);	0.894198	0.09052	U	0.855697	T	0.41766	0.1173	L	0.44542	1.39	0.09310	N	1	B	0.23058	0.079	B	0.19666	0.026	T	0.37911	-0.9685	10	0.54805	T	0.06	-0.3308	2.7843	0.05369	0.2831:0.3072:0.3086:0.1011	.	865	Q12866	MERTK_HUMAN	L	865;865;524;689;189	ENSP00000295408:R865L;ENSP00000389152:R865L;ENSP00000387277:R689L;ENSP00000412660:R189L	ENSP00000295408:R865L	R	+	2	0	MERTK	112502506	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.090000	0.11163	-0.389000	0.07786	-0.302000	0.09304	CGG	MERTK	-	superfamily_Kinase-like_dom,superfamily_Rhodanese-like_dom	ENSG00000153208		0.507	MERTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MERTK	HGNC	protein_coding	OTTHUMT00000254046.2		0.00	69	0	G			112786035	+1			no_errors	ENST00000295408	ensembl	human	known	74_37	missense	7.50	37	3	SNP	0.000	T
MFSD7	84179	genome.wustl.edu	37	4	677526	677526	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr4:677526G>T	ENST00000404286.2	-	7	883	c.868C>A	c.(868-870)Ctc>Atc	p.L290I	MFSD7_ENST00000515118.1_Missense_Mutation_p.L193I|MFSD7_ENST00000503156.1_Missense_Mutation_p.L225I|MFSD7_ENST00000513740.1_5'Flank|MFSD7_ENST00000322224.4_Missense_Mutation_p.L289I|MFSD7_ENST00000347950.5_Missense_Mutation_p.L171I	NM_032219.2	NP_115595.2	Q6UXD7	MFSD7_HUMAN	major facilitator superfamily domain containing 7	290					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				cervix(1)|kidney(2)|lung(4)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	11						GTGATGAAGAGAGCGCCACAG	0.627											OREG0016025	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													35.0	33.0	34.0					4																	677526		2190	4284	6474	SO:0001583	missense	0			AK025922	CCDS3338.1, CCDS75086.1	4p16.3	2013-05-22			ENSG00000169026	ENSG00000169026		"""Solute carriers"""	26177	protein-coding gene	gene with protein product						12975309	Standard	XM_005272295		Approved	FLJ22269, LP2561	uc003gax.3	Q6UXD7	OTTHUMG00000119001	ENST00000404286.2:c.868C>A	4.37:g.677526G>T	ENSP00000384616:p.Leu290Ile	590	A8K7J5|Q6XYD4|Q8N6H1|Q9H6H6	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.L290I	ENST00000404286.2	37	c.868		4	.	.	.	.	.	.	.	.	.	.	G	16.54	3.150603	0.57151	.	.	ENSG00000169026	ENST00000347950;ENST00000322224;ENST00000404286;ENST00000515118;ENST00000503156;ENST00000512249	T;T;T;T;T;T	0.59638	0.25;0.35;0.35;0.25;0.35;0.25	4.71	4.71	0.59529	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.64402	D	0.000001	T	0.62756	0.2454	L	0.40543	1.245	0.38077	D	0.936569	P;D;D;P;D	0.58268	0.927;0.969;0.982;0.927;0.969	P;P;P;P;P	0.61940	0.781;0.822;0.896;0.842;0.845	T	0.60510	-0.7249	10	0.24483	T	0.36	-18.9903	13.0685	0.59046	0.0:0.0:1.0:0.0	.	225;193;171;290;289	D6RIZ6;D6R9R0;Q6UXD7-3;Q6UXD7;Q6UXD7-2	.;.;.;MFSD7_HUMAN;.	I	171;289;290;193;225;107	ENSP00000307545:L171I;ENSP00000320234:L289I;ENSP00000384616:L290I;ENSP00000423204:L193I;ENSP00000425753:L225I;ENSP00000425038:L107I	ENSP00000320234:L289I	L	-	1	0	MFSD7	667526	1.000000	0.71417	1.000000	0.80357	0.246000	0.25737	4.171000	0.58236	2.460000	0.83146	0.558000	0.71614	CTC	MFSD7	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	ENSG00000169026		0.627	MFSD7-004	KNOWN	basic|appris_candidate_longest	protein_coding	MFSD7	HGNC	protein_coding	OTTHUMT00000358585.1	-	0.00	114	0	G	NM_032219		677526	-1	tier1	-	no_errors	ENST00000404286	ensembl	human	known	74_37	missense	7.55	49	4	SNP	0.999	T
MIEF1	54471	genome.wustl.edu	37	22	39909952	39909952	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr22:39909952T>C	ENST00000325301.2	+	6	1440	c.1016T>C	c.(1015-1017)cTg>cCg	p.L339P	MIEF1_ENST00000404569.1_Missense_Mutation_p.L339P|MIEF1_ENST00000402881.1_Missense_Mutation_p.L339P	NM_019008.4	NP_061881.2	Q9NQG6	MID51_HUMAN	mitochondrial elongation factor 1	339					mitochondrial fission (GO:0000266)|positive regulation of mitochondrial fission (GO:0090141)|positive regulation of protein targeting to membrane (GO:0090314)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	ADP binding (GO:0043531)|GDP binding (GO:0019003)|identical protein binding (GO:0042802)										CTGTGGCGGCTGAGCCTGCGT	0.602											OREG0026577	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													60.0	59.0	59.0					22																	39909952		2203	4300	6503	SO:0001583	missense	0			AL365515	CCDS13995.1	22q13.1	2013-09-23	2013-09-23	2013-09-23	ENSG00000100335	ENSG00000100335			25979	protein-coding gene	gene with protein product		615497	"""Smith-Magenis syndrome chromosome region, candidate 7-like"""	SMCR7L		21508961, 21701560	Standard	NM_019008		Approved	FLJ20232, MiD51	uc003axx.3	Q9NQG6	OTTHUMG00000151105	ENST00000325301.2:c.1016T>C	22.37:g.39909952T>C	ENSP00000327124:p.Leu339Pro	889	Q7L890|Q9BUI3	Missense_Mutation	SNP	NULL	p.L339P	ENST00000325301.2	37	c.1016	CCDS13995.1	22	.	.	.	.	.	.	.	.	.	.	T	18.95	3.731475	0.69189	.	.	ENSG00000100335	ENST00000402881;ENST00000325301;ENST00000404569	T;T;T	0.12569	2.67;2.67;2.67	6.07	6.07	0.98685	.	0.120246	0.64402	D	0.000019	T	0.27798	0.0684	L	0.44542	1.39	0.80722	D	1	P;D	0.60575	0.918;0.988	P;P	0.59357	0.601;0.856	T	0.00342	-1.1803	10	0.56958	D	0.05	-14.5942	16.6288	0.85011	0.0:0.0:0.0:1.0	.	339;339	Q9NQG6;B0QY95	MID51_HUMAN;.	P	339	ENSP00000385110:L339P;ENSP00000327124:L339P;ENSP00000385191:L339P	ENSP00000327124:L339P	L	+	2	0	SMCR7L	38239898	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.013000	0.64023	2.326000	0.78906	0.533000	0.62120	CTG	MIEF1	-	NULL	ENSG00000100335		0.602	MIEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIEF1	HGNC	protein_coding	OTTHUMT00000321325.1	-	0.00	64	0	T	NM_019008		39909952	+1	tier1	-	no_errors	ENST00000325301	ensembl	human	known	74_37	missense	29.79	33	14	SNP	1.000	C
MIER2	54531	genome.wustl.edu	37	19	307381	307381	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr19:307381G>T	ENST00000264819.4	-	13	1364	c.1354C>A	c.(1354-1356)Cca>Aca	p.P452T	CTD-3113P16.5_ENST00000591533.1_RNA	NM_017550.1	NP_060020.1	Q8N344	MIER2_HUMAN	mesoderm induction early response 1, family member 2	452					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			endometrium(4)|kidney(1)|large_intestine(5)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	22		all_cancers(10;1.05e-30)|all_epithelial(18;3.04e-19)|Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;2.49e-05)|all_lung(49;4.36e-05)|Breast(49;0.000304)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TATGAGGCTGGGTCGGCCAGG	0.682																																																	0													14.0	16.0	15.0					19																	307381		2198	4299	6497	SO:0001583	missense	0			AB033019	CCDS32855.1	19p13.3	2008-02-05	2006-04-20	2006-04-20		ENSG00000105556			29210	protein-coding gene	gene with protein product			"""KIAA1193"""	KIAA1193		10574462	Standard	NM_017550		Approved		uc002lok.1	Q8N344		ENST00000264819.4:c.1354C>A	19.37:g.307381G>T	ENSP00000264819:p.Pro452Thr		Q9ULM7	Missense_Mutation	SNP	pfam_ELM2_dom,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_ELM2_dom	p.P452T	ENST00000264819.4	37	c.1354	CCDS32855.1	19	.	.	.	.	.	.	.	.	.	.	G	3.897	-0.022848	0.07634	.	.	ENSG00000105556	ENST00000264819	T	0.23552	1.9	3.54	1.13	0.20643	.	0.778015	0.10871	N	0.624937	T	0.10078	0.0247	N	0.11201	0.11	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.36311	-0.9753	10	0.02654	T	1	-2.8401	6.451	0.21903	0.1212:0.2724:0.6064:0.0	.	452	Q8N344	MIER2_HUMAN	T	452	ENSP00000264819:P452T	ENSP00000264819:P452T	P	-	1	0	MIER2	258381	0.000000	0.05858	0.003000	0.11579	0.014000	0.08584	-0.038000	0.12144	0.791000	0.33826	0.563000	0.77884	CCA	MIER2	-	NULL	ENSG00000105556		0.682	MIER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIER2	HGNC	protein_coding	OTTHUMT00000451784.1		0.00	60	0	G	XM_041843		307381	-1			no_errors	ENST00000264819	ensembl	human	known	74_37	missense	5.88	64	4	SNP	0.000	T
MIR222	407007	genome.wustl.edu	37	X	45605608	45605608	+	RNA	SNP	G	G	C			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chrX:45605608G>C	ENST00000384992.1	-	0	110				MIR221_ENST00000385135.1_RNA	NR_029636.1				microRNA 222																		CAGGTAGCCTGAAACCCAGCA	0.443																																																	0													87.0	69.0	75.0					X																	45605608		1568	3582	5150			0					Xp11.3	2011-09-12		2008-12-18	ENSG00000207725	ENSG00000207725		"""ncRNAs / Micro RNAs"""	31602	non-coding RNA	RNA, micro		300569		MIRN222			Standard	NR_029636		Approved	hsa-mir-222	uc011mlf.1				X.37:g.45605608G>C				RNA	SNP	-	NULL	ENST00000384992.1	37	NULL		X																																																																																			MIR221	-	-	ENSG00000207870		0.443	MIR222-201	KNOWN	basic	miRNA	MIR221	HGNC	miRNA		-	0.00	35	0	G	NR_029636		45605608	-1	tier1	-	no_errors	ENST00000385135	ensembl	human	known	74_37	rna	23.08	30	9	SNP	1.000	C
NHSL1	57224	genome.wustl.edu	37	6	138756407	138756407	+	Intron	SNP	G	G	C			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr6:138756407G>C	ENST00000427025.2	-	5	1305				MIR3145_ENST00000580727.1_RNA|NHSL1_ENST00000343505.5_Intron	NM_020464.1	NP_065197.1	Q5SYE7	NHSL1_HUMAN	NHS-like 1											breast(2)|endometrium(4)|kidney(1)	7						AATGAGTTTTGAGTGTTTGGA	0.313																																																	0																																										SO:0001627	intron_variant	0			AB037778	CCDS47487.1, CCDS55063.1	6q23.3	2009-02-18	2004-10-07	2004-10-07	ENSG00000135540	ENSG00000135540			21021	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 63"""	C6orf63			Standard	NM_001144060		Approved	bA43P8.1, KIAA1357	uc011edp.2	Q5SYE7	OTTHUMG00000016321	ENST00000427025.2:c.677-1590C>G	6.37:g.138756407G>C			Q3ZCS5|Q5SYE8|Q9P2J0	RNA	SNP	-	NULL	ENST00000427025.2	37	NULL	CCDS55063.1	6																																																																																			MIR3145	-	-	ENSG00000266555		0.313	NHSL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	MIR3145	HGNC	protein_coding	OTTHUMT00000043700.2	-	0.00	65	0	G	XM_050421		138756407	-1	tier1	-	no_errors	ENST00000580727	ensembl	human	known	74_37	rna	13.95	74	12	SNP	0.000	C
RILPL1	353116	genome.wustl.edu	37	12	124021053	124021053	+	5'Flank	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr12:124021053G>T	ENST00000376874.4	-	0	0				MIR3908_ENST00000579798.1_RNA	NM_178314.3	NP_847884.2	Q5EBL4	RIPL1_HUMAN	Rab interacting lysosomal protein-like 1						epithelial cell morphogenesis (GO:0003382)|intracellular protein transport (GO:0006886)|regulation of neuron death (GO:1901214)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)				endometrium(1)|kidney(2)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	7	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000224)|Epithelial(86;0.00067)|all cancers(50;0.00836)|BRCA - Breast invasive adenocarcinoma(302;0.197)		ttttttttttggagacagagt	0.408																																																	0																																										SO:0001631	upstream_gene_variant	0			AK097550	CCDS45006.1	12q24.31	2007-11-27			ENSG00000188026	ENSG00000188026			26814	protein-coding gene	gene with protein product		614092				14668488	Standard	NM_178314		Approved	FLJ39378	uc001ufe.2	Q5EBL4	OTTHUMG00000168686		12.37:g.124021053G>T	Exception_encountered		Q66K36|Q8N1M0	RNA	SNP	-	NULL	ENST00000376874.4	37	NULL	CCDS45006.1	12																																																																																			MIR3908	-	-	ENSG00000266655		0.408	RILPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR3908	HGNC	protein_coding	OTTHUMT00000400595.1	-	0.00	42	0	G	NM_178314		124021053	+1	tier1	-	no_errors	ENST00000579798	ensembl	human	known	74_37	rna	15.38	33	6	SNP	0.107	T
MIR412	574433	genome.wustl.edu	37	14	101532274	101532274	+	RNA	SNP	A	A	G			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr14:101532274A>G	ENST00000362142.2	+	0	91				MIR656_ENST00000385224.1_RNA|MIR410_ENST00000362222.2_RNA|MIR541_ENST00000401360.1_RNA|MIR369_ENST00000362155.3_RNA|MIR409_ENST00000362237.1_RNA	NR_030155.1				microRNA 412																		GTTGTCTGTGATGAGTTCGCT	0.592																																																	0													103.0	87.0	92.0					14																	101532274		1568	3582	5150			0					14q32.31	2011-09-12		2008-12-18	ENSG00000199012	ENSG00000199012		"""ncRNAs / Micro RNAs"""	32064	non-coding RNA	RNA, micro				MIRN412			Standard	NR_030155		Approved	hsa-mir-412	uc021sds.1				14.37:g.101532274A>G				RNA	SNP	-	NULL	ENST00000362142.2	37	NULL		14																																																																																			MIR410	-	-	ENSG00000199092		0.592	MIR412-201	KNOWN	basic	miRNA	MIR410	HGNC	miRNA		-	0.00	58	0	A	NR_030155		101532274	+1	tier1	-	no_errors	ENST00000362222	ensembl	human	known	74_37	rna	16.33	41	8	SNP	1.000	G
MLH1	4292	genome.wustl.edu	37	3	37042452	37042452	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr3:37042452G>T	ENST00000231790.2	+	3	430	c.214G>T	c.(214-216)Gat>Tat	p.D72Y	MLH1_ENST00000435176.1_5'UTR|MLH1_ENST00000492474.1_3'UTR|MLH1_ENST00000455445.2_5'UTR|MLH1_ENST00000539477.1_5'UTR|MLH1_ENST00000458205.2_5'UTR|MLH1_ENST00000536378.1_5'UTR	NM_000249.3|NM_001258273.1	NP_000240.1|NP_001245202.1	P40692	MLH1_HUMAN	mutL homolog 1	72					ATP catabolic process (GO:0006200)|double-strand break repair via nonhomologous end joining (GO:0006303)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|isotype switching (GO:0045190)|male meiosis chromosome segregation (GO:0007060)|meiotic metaphase I plate congression (GO:0043060)|mismatch repair (GO:0006298)|negative regulation of mitotic recombination (GO:0045950)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|oogenesis (GO:0048477)|resolution of meiotic recombination intermediates (GO:0000712)|somatic hypermutation of immunoglobulin genes (GO:0016446)|spermatogenesis (GO:0007283)|spindle midzone assembly involved in meiosis (GO:0051257)|synapsis (GO:0007129)	chiasma (GO:0005712)|male germ cell nucleus (GO:0001673)|membrane (GO:0016020)|MutLalpha complex (GO:0032389)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|guanine/thymine mispair binding (GO:0032137)	p.D72Y(1)		NS(1)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(12)|kidney(2)|large_intestine(54)|lung(13)|oesophagus(7)|ovary(6)|pancreas(5)|prostate(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	127						ACAGAAAGAAGATCTGGATAT	0.338		1	"""D, Mis, N, F, S"""		"""colorectal, endometrial, ovarian, CNS"""	"""colorectal, endometrial, ovarian, CNS"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																														yes	Rec	yes	"""Hereditary non-polyposis colorectal cancer, Turcot syndrome"""	3	3p21.3	4292	E.coli MutL homolog gene		"""E, O"""	1	Substitution - Missense(1)	lung(1)											119.0	118.0	118.0					3																	37042452		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	U07418	CCDS2663.1, CCDS54562.1, CCDS54563.1	3p22.3	2014-09-17	2013-09-12		ENSG00000076242	ENSG00000076242			7127	protein-coding gene	gene with protein product		120436	"""mutL (E. coli) homolog 1 (colon cancer, nonpolyposis type 2)"", ""mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli)"""	COCA2		7903889	Standard	NM_000249		Approved	HNPCC, FCC2, HNPCC2	uc003cgl.3	P40692	OTTHUMG00000130797	ENST00000231790.2:c.214G>T	3.37:g.37042452G>T	ENSP00000231790:p.Asp72Tyr		B4DI13|B4DQ11|E9PCU2	Missense_Mutation	SNP	pfam_DNA_mismatch_repair_C,pfam_HATPase_ATP-bd,superfamily_HATPase_ATP-bd,superfamily_Ribosomal_S5_D2-typ_fold,tigrfam_DNA_mismatch_repair_N	p.D72Y	ENST00000231790.2	37	c.214	CCDS2663.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.8|27.8	4.865004|4.865004	0.91511|0.91511	.|.	.|.	ENSG00000076242|ENSG00000076242	ENST00000231790;ENST00000436867;ENST00000537937|ENST00000456676	D|.	0.95622|.	-3.76|.	6.03|6.03	6.03|6.03	0.97812|0.97812	DNA mismatch repair protein, N-terminal (1);ATPase-like, ATP-binding domain (4);|.	0.047777|.	0.85682|.	D|.	0.000000|.	D|D	0.88793|0.88793	0.6533|0.6533	H|H	0.96720|0.96720	3.87|3.87	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;1.0|.	D|D	0.91604|0.91604	0.5297|0.5297	10|5	0.87932|.	D|.	0|.	-26.1888|-26.1888	19.3283|19.3283	0.94273|0.94273	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	72;72|.	Q53GX1;P40692|.	.;MLH1_HUMAN|.	Y|N	72;38;38|63	ENSP00000231790:D72Y|.	ENSP00000231790:D72Y|.	D|K	+|+	1|3	0|2	MLH1|MLH1	37017456|37017456	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	8.827000|8.827000	0.92041|0.92041	2.861000|2.861000	0.98227|0.98227	0.655000|0.655000	0.94253|0.94253	GAT|AAG	MLH1	-	pfam_HATPase_ATP-bd,superfamily_HATPase_ATP-bd,tigrfam_DNA_mismatch_repair_N	ENSG00000076242		0.338	MLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLH1	HGNC	protein_coding	OTTHUMT00000253337.2		0.00	86	0	G	NM_000249		37042452	+1			no_errors	ENST00000231790	ensembl	human	known	74_37	missense	5.26	36	2	SNP	1.000	T
MMRN2	79812	genome.wustl.edu	37	10	88703785	88703785	+	Silent	SNP	C	C	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr10:88703785C>T	ENST00000372027.5	-	6	1077	c.756G>A	c.(754-756)ctG>ctA	p.L252L	MMRN2_ENST00000488950.1_5'UTR	NM_024756.2	NP_079032.2	Q9H8L6	MMRN2_HUMAN	multimerin 2	252					angiogenesis (GO:0001525)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|kidney(1)|large_intestine(6)|lung(7)|prostate(2)|skin(1)|stomach(1)	19						TAAGGCTGTGCAGGCTTTGGT	0.572																																																	0													67.0	59.0	62.0					10																	88703785		2203	4300	6503	SO:0001819	synonymous_variant	0			AK023527	CCDS7379.1	10q23.31	2004-03-10	2004-03-02	2004-03-02	ENSG00000173269	ENSG00000173269		"""EMI domain containing"""	19888	protein-coding gene	gene with protein product		608925	"""elastin microfibril interfacer 3"""	EMILIN3		11559704	Standard	NM_024756		Approved	EndoGlyx-1, FLJ13465	uc001kea.3	Q9H8L6	OTTHUMG00000018663	ENST00000372027.5:c.756G>A	10.37:g.88703785C>T			Q504V7|Q6P2N2	Silent	SNP	pfam_C1q,pfam_EMI_domain,superfamily_Tumour_necrosis_fac-like_dom,superfamily_tRNA-bd_arm,smart_C1q,prints_C1q,pfscan_C1q,pfscan_EMI_domain	p.L252	ENST00000372027.5	37	c.756	CCDS7379.1	10																																																																																			MMRN2	-	NULL	ENSG00000173269		0.572	MMRN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMRN2	HGNC	protein_coding	OTTHUMT00000049179.2	-	0.00	52	0	C	NM_024756		88703785	-1	tier1	-	no_errors	ENST00000372027	ensembl	human	known	74_37	silent	9.68	28	3	SNP	0.999	T
MOSPD2	158747	genome.wustl.edu	37	X	14891657	14891657	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chrX:14891657G>T	ENST00000380492.3	+	1	95	c.7G>T	c.(7-9)Gag>Tag	p.E3*	MOSPD2_ENST00000482354.1_Nonsense_Mutation_p.E3*|MOSPD2_ENST00000497603.2_Nonsense_Mutation_p.E3*|FANCB_ENST00000398334.1_5'Flank|FANCB_ENST00000324138.3_5'Flank	NM_001177475.1|NM_152581.3	NP_001170946.1|NP_689794.1	Q8NHP6	MSPD2_HUMAN	motile sperm domain containing 2	3						integral component of membrane (GO:0016021)|membrane (GO:0016020)	structural molecule activity (GO:0005198)			breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20	Hepatocellular(33;0.183)					GATCATGGCAGAGGTGAGGAG	0.687																																																	0													41.0	38.0	39.0					X																	14891657		2203	4299	6502	SO:0001587	stop_gained	0			AL834345	CCDS14162.1	Xp22.31	2006-03-16			ENSG00000130150	ENSG00000130150			28381	protein-coding gene	gene with protein product						15533722	Standard	NM_152581		Approved	MGC26706	uc004cwi.3	Q8NHP6	OTTHUMG00000021170	ENST00000380492.3:c.7G>T	X.37:g.14891657G>T	ENSP00000369860:p.Glu3*		Q8N3H2|Q8NA83	Nonsense_Mutation	SNP	pfam_CRAL-TRIO_dom,pfam_MSP_dom,superfamily_CRAL-TRIO_dom,superfamily_PapD-like,superfamily_CRAL/TRIO_N_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_MSP_dom	p.E3*	ENST00000380492.3	37	c.7	CCDS14162.1	X	.	.	.	.	.	.	.	.	.	.	G	32	5.111461	0.94339	.	.	ENSG00000130150	ENST00000380492	.	.	.	5.24	3.35	0.38373	.	0.435365	0.23282	N	0.049892	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-9.9992	5.1777	0.15143	0.1143:0.2073:0.6784:0.0	.	.	.	.	X	3	.	ENSP00000369860:E3X	E	+	1	0	MOSPD2	14801578	1.000000	0.71417	1.000000	0.80357	0.340000	0.28889	2.182000	0.42556	2.321000	0.78463	0.544000	0.68410	GAG	MOSPD2	-	NULL	ENSG00000130150		0.687	MOSPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MOSPD2	HGNC	protein_coding	OTTHUMT00000055837.1	-	0.00	63	0	G	NM_152581		14891657	+1	tier1	-	no_errors	ENST00000380492	ensembl	human	known	74_37	nonsense	62.07	11	18	SNP	1.000	T
MPP5	64398	genome.wustl.edu	37	14	67787942	67787942	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr14:67787942C>G	ENST00000261681.4	+	13	2367	c.1706C>G	c.(1705-1707)tCt>tGt	p.S569C	ATP6V1D_ENST00000553974.1_Intron|MPP5_ENST00000555925.1_Missense_Mutation_p.S535C	NM_022474.3	NP_071919.2	Q8N3R9	MPP5_HUMAN	membrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5)	569	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.				cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|establishment of protein localization to plasma membrane (GO:0090002)|morphogenesis of an epithelial sheet (GO:0002011)|myelin assembly (GO:0032288)|peripheral nervous system myelin maintenance (GO:0032287)|protein localization to myelin sheath abaxonal region (GO:0035750)|tight junction assembly (GO:0070830)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|lateral loop (GO:0043219)|myelin sheath adaxonal region (GO:0035749)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	protein domain specific binding (GO:0019904)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(8)|ovary(1)|skin(1)	18				all cancers(60;0.000388)|OV - Ovarian serous cystadenocarcinoma(108;0.00762)|BRCA - Breast invasive adenocarcinoma(234;0.0106)		GTGATCAACTCTGGCAAAATA	0.378																																																	0													171.0	168.0	169.0					14																	67787942		2203	4300	6503	SO:0001583	missense	0			AK022677	CCDS9779.1, CCDS58325.1	14q23.3	2008-08-11				ENSG00000072415			18669	protein-coding gene	gene with protein product	"""stardust"""	606958				11927608	Standard	NM_022474		Approved	PALS1, FLJ12615	uc001xjc.4	Q8N3R9		ENST00000261681.4:c.1706C>G	14.37:g.67787942C>G	ENSP00000261681:p.Ser569Cys		A1L380|Q7Z631|Q86T98|Q8N7I5|Q9H9Q0	Missense_Mutation	SNP	pfam_GK/Ca_channel_bsu,pfam_L27_N,pfam_SH3_2,pfam_PDZ,pfam_SH3_domain,pfam_L27_C,superfamily_P-loop_NTPase,superfamily_SH3_domain,superfamily_PDZ,smart_L27,smart_PDZ,smart_SH3_domain,smart_GK/Ca_channel_bsu,pfscan_L27,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin-like	p.S569C	ENST00000261681.4	37	c.1706	CCDS9779.1	14	.	.	.	.	.	.	.	.	.	.	C	25.4	4.630474	0.87660	.	.	ENSG00000072415	ENST00000261681;ENST00000555925	T;T	0.18657	2.2;2.2	5.14	5.14	0.70334	Guanylate kinase/L-type calcium channel (1);Guanylate kinase (2);	0.053969	0.85682	D	0.000000	T	0.51483	0.1677	M	0.84082	2.675	0.80722	D	1	D	0.67145	0.996	D	0.70016	0.967	T	0.59172	-0.7504	10	0.87932	D	0	.	18.6175	0.91308	0.0:1.0:0.0:0.0	.	569	Q8N3R9	MPP5_HUMAN	C	569;535	ENSP00000261681:S569C;ENSP00000451488:S535C	ENSP00000261681:S569C	S	+	2	0	MPP5	66857695	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.880000	0.69698	2.364000	0.80123	0.563000	0.77884	TCT	MPP5	-	pfam_GK/Ca_channel_bsu,superfamily_P-loop_NTPase,smart_GK/Ca_channel_bsu,pfscan_Guanylate_kin-like	ENSG00000072415		0.378	MPP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPP5	HGNC	protein_coding	OTTHUMT00000412498.1	-	0.00	69	0	C	NM_022474		67787942	+1	tier1	-	no_errors	ENST00000261681	ensembl	human	known	74_37	missense	45.05	50	41	SNP	1.000	G
MROH2A	339766	genome.wustl.edu	37	2	234688046	234688046	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr2:234688046G>T	ENST00000389758.3	+	2	208	c.42G>T	c.(40-42)gaG>gaT	p.E14D				A6NES4	MRO2A_HUMAN	maestro heat-like repeat family member 2A	44																	CCTCAAGTGAGGAGGTGTCAG	0.463																																																	0																																										SO:0001583	missense	0				CCDS74674.1	2q37.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000185038	ENSG00000185038		"""maestro heat-like repeat containing"""	27936	protein-coding gene	gene with protein product			"""HEAT repeat containing 7B1"""	HEATR7B1		12477932	Standard	NM_001287395		Approved			A6NES4	OTTHUMG00000059037	ENST00000389758.3:c.42G>T	2.37:g.234688046G>T	ENSP00000374408:p.Glu14Asp			Missense_Mutation	SNP	superfamily_ARM-type_fold	p.E14D	ENST00000389758.3	37	c.42		2	.	.	.	.	.	.	.	.	.	.	G	9.103	1.004643	0.19199	.	.	ENSG00000185038	ENST00000430892;ENST00000428446;ENST00000389758	T;T;T	0.07114	3.22;3.22;3.22	4.51	0.968	0.19680	.	.	.	.	.	T	0.10380	0.0254	L	0.44542	1.39	0.09310	N	1	.	.	.	.	.	.	T	0.28004	-1.0057	7	0.87932	D	0	.	6.6388	0.22897	0.2755:0.0:0.7245:0.0	.	.	.	.	D	14	ENSP00000392128:E14D;ENSP00000404614:E14D;ENSP00000374408:E14D	ENSP00000374408:E14D	E	+	3	2	HEATR7B1	234352785	0.988000	0.35896	0.343000	0.25615	0.004000	0.04260	0.495000	0.22483	0.173000	0.19788	-0.781000	0.03364	GAG	MROH2A	-	NULL	ENSG00000185038		0.463	MROH2A-001	NOVEL	basic|appris_principal|exp_conf	protein_coding	MROH2A	HGNC	protein_coding	OTTHUMT00000130646.6	-	0.00	55	0	G	XM_291007		234688046	+1	tier1	-	no_errors	ENST00000389758	ensembl	human	novel	74_37	missense	8.89	41	4	SNP	0.407	T
MRPL15	29088	genome.wustl.edu	37	8	55059975	55059975	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr8:55059975G>T	ENST00000260102.4	+	5	661	c.587G>T	c.(586-588)cGt>cTt	p.R196L		NM_014175.3	NP_054894.1	Q9P015	RM15_HUMAN	mitochondrial ribosomal protein L15	196					translation (GO:0006412)	large ribosomal subunit (GO:0015934)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|prostate(1)|skin(3)	10		Lung NSC(129;0.109)|all_epithelial(80;0.134)|all_lung(136;0.181)	OV - Ovarian serous cystadenocarcinoma(7;4.3e-07)|Epithelial(17;5.79e-05)|all cancers(17;0.000458)			TTCTTTCTTCGTGGACAACCC	0.378																																																	0													57.0	59.0	58.0					8																	55059975		2203	4300	6503	SO:0001583	missense	0			AB051619	CCDS6158.1	8q11.2-q13	2012-09-13			ENSG00000137547	ENSG00000137547		"""Mitochondrial ribosomal proteins / large subunits"""	14054	protein-coding gene	gene with protein product		611828				11543634	Standard	NM_014175		Approved	RPML7, MRP-L7, HSPC145, L15mt, MRP-L15	uc003xsa.2	Q9P015	OTTHUMG00000164315	ENST00000260102.4:c.587G>T	8.37:g.55059975G>T	ENSP00000260102:p.Arg196Leu		Q96Q54|Q9H0Y1	Missense_Mutation	SNP	pfam_Ribosomal_L18e/L15P,superfamily_Ribosomal_L18e/L15P	p.R196L	ENST00000260102.4	37	c.587	CCDS6158.1	8	.	.	.	.	.	.	.	.	.	.	G	15.88	2.964217	0.53507	.	.	ENSG00000137547	ENST00000260102	.	.	.	5.33	5.33	0.75918	.	0.145914	0.64402	D	0.000005	T	0.64811	0.2632	L	0.49350	1.555	0.58432	D	0.999997	B	0.10296	0.003	B	0.12156	0.007	T	0.61525	-0.7045	9	0.54805	T	0.06	-18.556	19.0385	0.92989	0.0:0.0:1.0:0.0	.	196	Q9P015	RM15_HUMAN	L	196	.	ENSP00000260102:R196L	R	+	2	0	MRPL15	55222528	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.976000	0.63785	2.484000	0.83849	0.650000	0.86243	CGT	MRPL15	-	NULL	ENSG00000137547		0.378	MRPL15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL15	HGNC	protein_coding	OTTHUMT00000378254.1		0.00	38	0	G	NM_014175		55059975	+1			no_errors	ENST00000260102	ensembl	human	known	74_37	missense	5.71	32	2	SNP	1.000	T
MRPL19	9801	genome.wustl.edu	37	2	75882271	75882271	+	Missense_Mutation	SNP	C	C	G	rs34812558		TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr2:75882271C>G	ENST00000393909.2	+	6	764	c.739C>G	c.(739-741)Ctt>Gtt	p.L247V	MRPL19_ENST00000409374.1_Missense_Mutation_p.L247V|MRPL19_ENST00000358788.6_Intron	NM_014763.3	NP_055578.2	P49406	RM19_HUMAN	mitochondrial ribosomal protein L19	247					translation (GO:0006412)	mitochondrion (GO:0005739)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|ribosome (GO:0005840)	structural constituent of ribosome (GO:0003735)			kidney(1)|large_intestine(1)|lung(6)	8						CAGATTTGATCTTTGTTTAAC	0.343																																																	0													58.0	56.0	57.0					2																	75882271		1810	4079	5889	SO:0001583	missense	0			AB051621	CCDS1960.2	2p11.1-q11.2	2012-09-13			ENSG00000115364	ENSG00000115364		"""Mitochondrial ribosomal proteins / large subunits"""	14052	protein-coding gene	gene with protein product	"""39S ribosomal protein L19"""	611832				11543634, 17309879	Standard	XM_006712155		Approved	MRP-L15, RPML15, KIAA0104, RLX1	uc002snl.3	P49406	OTTHUMG00000129990	ENST00000393909.2:c.739C>G	2.37:g.75882271C>G	ENSP00000377486:p.Leu247Val		Q53TX9|Q96Q52	Missense_Mutation	SNP	pfam_Ribosomal_L19,superfamily_Translation_prot_SH3-like,prints_Ribosomal_L19	p.L247V	ENST00000393909.2	37	c.739	CCDS1960.2	2	.	.	.	.	.	.	.	.	.	.	C	21.4	4.137521	0.77775	.	.	ENSG00000115364	ENST00000393909;ENST00000409374;ENST00000453233	.	.	.	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	T	0.73265	0.3565	M	0.73598	2.24	0.80722	D	1	D	0.65815	0.995	P	0.55455	0.776	T	0.72050	-0.4407	9	0.30854	T	0.27	-25.9175	16.4344	0.83871	0.0:1.0:0.0:0.0	.	247	P49406	RM19_HUMAN	V	247;247;34	.	ENSP00000377486:L247V	L	+	1	0	MRPL19	75735779	1.000000	0.71417	0.980000	0.43619	0.917000	0.54804	3.745000	0.55119	2.549000	0.85964	0.655000	0.94253	CTT	MRPL19	-	NULL	ENSG00000115364		0.343	MRPL19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL19	HGNC	protein_coding	OTTHUMT00000252256.1	-	0.00	159	0	C	NM_014763		75882271	+1	tier1	-	no_errors	ENST00000393909	ensembl	human	known	74_37	missense	11.11	79	10	SNP	1.000	G
MSLNL	401827	genome.wustl.edu	37	16	830591	830591	+	Intron	SNP	G	G	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr16:830591G>A	ENST00000442466.1	-	2	37				MSLNL_ENST00000293892.3_Missense_Mutation_p.A137V			Q96KJ4	MSLNL_HUMAN	mesothelin-like						cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(15)|ovary(2)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	36						GACTGTGGATGCGTGCAGGCA	0.567																																																	0													304.0	261.0	276.0					16																	830591		2178	4266	6444	SO:0001627	intron_variant	0					16p13.3	2008-08-06	2008-07-04	2008-07-04	ENSG00000162006	ENSG00000162006			14170	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 37"""	C16orf37			Standard	NG_032123		Approved	MPFL		Q96KJ4		ENST00000442466.1:c.38-429C>T	16.37:g.830591G>A				Missense_Mutation	SNP	pfam_Mesothelin	p.A137V	ENST00000442466.1	37	c.410		16	.	.	.	.	.	.	.	.	.	.	-	7.004	0.555541	0.13436	.	.	ENSG00000162006	ENST00000293892	T	0.15603	2.41	1.33	-1.07	0.09968	.	.	.	.	.	T	0.10078	0.0247	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.36792	-0.9733	5	.	.	.	.	3.4232	0.07401	0.1743:0.0:0.58:0.2456	.	.	.	.	V	137	ENSP00000293892:A137V	.	A	-	2	0	MSLNL	770592	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.290000	0.18975	-0.255000	0.09486	-0.460000	0.05396	GCA	MSLNL	-	NULL	ENSG00000162006		0.567	MSLNL-202	KNOWN	basic|appris_candidate	protein_coding	MSLNL	HGNC	protein_coding		-	0.00	94	0	G	NM_001025190		830591	-1	tier1	-	no_errors	ENST00000293892	ensembl	human	known	74_37	missense	29.76	59	25	SNP	0.000	A
MUC12	10071	genome.wustl.edu	37	7	100652377	100652377	+	Splice_Site	SNP	T	T	C			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr7:100652377T>C	ENST00000379442.3	+	8	15617	c.15617T>C	c.(15616-15618)aTg>aCg	p.M5206T	MUC12_ENST00000536621.1_Splice_Site_p.M5063T			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	5206	SEA. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						TTCTTTCAGATGGATGTCGTT	0.498																																																	0													208.0	170.0	182.0					7																	100652377		692	1591	2283	SO:0001630	splice_region_variant	0			AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.15616-1T>C	7.37:g.100652377T>C			A6ND38|F5GWV9|Q9UKN0	Missense_Mutation	SNP	pfam_SEA_dom	p.M5063T	ENST00000379442.3	37	c.15188		7	.	.	.	.	.	.	.	.	.	.	T	7.540	0.660515	0.14645	.	.	ENSG00000205277	ENST00000379442;ENST00000536621	T;T	0.36699	1.24;1.24	2.78	2.78	0.32641	.	0.000000	0.50627	U	0.000112	T	0.45418	0.1341	M	0.78456	2.415	0.22888	N	0.998601	.	.	.	.	.	.	T	0.29731	-1.0002	8	0.44086	T	0.13	.	7.6882	0.28552	0.0:0.0:0.0:1.0	.	.	.	.	T	5206;5063	ENSP00000368755:M5206T;ENSP00000441929:M5063T	ENSP00000368755:M5206T	M	+	2	0	MUC12	100439097	1.000000	0.71417	0.928000	0.36995	0.224000	0.24922	2.765000	0.47621	1.237000	0.43756	0.379000	0.24179	ATG	MUC12	-	pfam_SEA_dom	ENSG00000205277		0.498	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	-	0.00	44	0	T	XM_379904	Missense_Mutation	100652377	+1	tier1	-	no_errors	ENST00000536621	ensembl	human	known	74_37	missense	9.76	37	4	SNP	0.989	C
MYH10	4628	genome.wustl.edu	37	17	8445454	8445454	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr17:8445454G>T	ENST00000269243.4	-	13	1684	c.1546C>A	c.(1546-1548)Cag>Aag	p.Q516K	MYH10_ENST00000379980.4_Missense_Mutation_p.Q532K|MYH10_ENST00000396239.1_Missense_Mutation_p.Q516K|MYH10_ENST00000360416.3_Missense_Mutation_p.Q526K	NM_005964.3	NP_005955.3	P35580	MYH10_HUMAN	myosin, heavy chain 10, non-muscle	516	Myosin motor.				actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cardiac myofibril assembly (GO:0055003)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cerebellar Purkinje cell layer development (GO:0021680)|exocytosis (GO:0006887)|fourth ventricle development (GO:0021592)|in utero embryonic development (GO:0001701)|lateral ventricle development (GO:0021670)|mitotic cytokinesis (GO:0000281)|neuromuscular process controlling balance (GO:0050885)|neuron migration (GO:0001764)|nuclear migration (GO:0007097)|plasma membrane repair (GO:0001778)|regulation of cell shape (GO:0008360)|retina development in camera-type eye (GO:0060041)|substrate-dependent cell migration, cell extension (GO:0006930)|third ventricle development (GO:0021678)|ventricular cardiac muscle cell development (GO:0055015)	actomyosin (GO:0042641)|axon (GO:0030424)|cell cortex (GO:0005938)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|midbody (GO:0030496)|myosin complex (GO:0016459)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle (GO:0005819)|stress fiber (GO:0001725)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(5)|endometrium(9)|kidney(2)|large_intestine(16)|lung(9)|ovary(3)|prostate(3)|skin(4)|stomach(1)	52						ATGCATGGCTGCAGATCCAGC	0.493																																																	0													153.0	132.0	139.0					17																	8445454		2203	4300	6503	SO:0001583	missense	0			M69181	CCDS11144.1, CCDS58515.1, CCDS73984.1	17p13	2011-09-27	2006-09-29		ENSG00000133026	ENSG00000133026		"""Myosins / Myosin superfamily : Class II"""	7568	protein-coding gene	gene with protein product		160776	"""myosin, heavy polypeptide 10, non-muscle"""			1860190	Standard	NM_001256012		Approved	NMMHCB	uc002glm.4	P35580	OTTHUMG00000108195	ENST00000269243.4:c.1546C>A	17.37:g.8445454G>T	ENSP00000269243:p.Gln516Lys		B2RWP9|D3DTS1|F8VTL3|Q12989|Q149N3|Q149N4|Q16087|Q4LE45|Q6PK16|Q9BWG0	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_HR1_rho-bd,superfamily_UBA-like,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.Q516K	ENST00000269243.4	37	c.1546	CCDS11144.1	17	.	.	.	.	.	.	.	.	.	.	G	20.4	3.975899	0.74360	.	.	ENSG00000133026	ENST00000269243;ENST00000360416;ENST00000396239;ENST00000379980	D;D;D;D	0.87412	-2.25;-2.25;-2.25;-2.25	4.96	4.96	0.65561	Myosin head, motor domain (3);	0.055383	0.85682	D	0.000000	D	0.90092	0.6905	M	0.75447	2.3	0.80722	D	1	P;P;P	0.38148	0.547;0.62;0.547	B;P;B	0.44772	0.274;0.46;0.274	D	0.90938	0.4795	10	0.66056	D	0.02	.	18.7716	0.91894	0.0:0.0:1.0:0.0	.	525;526;516	B2RWP9;F8VTL3;P35580	.;.;MYH10_HUMAN	K	516;526;516;532	ENSP00000269243:Q516K;ENSP00000353590:Q526K;ENSP00000379539:Q516K;ENSP00000369315:Q532K	ENSP00000269243:Q516K	Q	-	1	0	MYH10	8386179	1.000000	0.71417	1.000000	0.80357	0.225000	0.24961	9.657000	0.98554	2.735000	0.93741	0.563000	0.77884	CAG	MYH10	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom	ENSG00000133026		0.493	MYH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH10	HGNC	protein_coding	OTTHUMT00000227001.2	-	0.00	79	0	G			8445454	-1	tier1	-	no_errors	ENST00000396239	ensembl	human	known	74_37	missense	7.02	53	4	SNP	1.000	T
MYH7B	57644	genome.wustl.edu	37	20	33577641	33577641	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr20:33577641G>T	ENST00000262873.7	+	18	1904	c.1812G>T	c.(1810-1812)aaG>aaT	p.K604N	MIR499A_ENST00000384903.1_RNA	NM_020884.3	NP_065935.2	A7E2Y1	MYH7B_HUMAN	myosin, heavy chain 7B, cardiac muscle, beta	562	Myosin motor.					membrane (GO:0016020)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(5)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(19)|ovary(5)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	54			BRCA - Breast invasive adenocarcinoma(18;0.00691)			ACGCGGGGAAGTCACCCAATT	0.612																																																	0													55.0	61.0	59.0					20																	33577641		2199	4297	6496	SO:0001583	missense	0			AB040945	CCDS42869.1	20q11	2011-09-27	2006-09-29		ENSG00000078814	ENSG00000078814		"""Myosins / Myosin superfamily : Class II"""	15906	protein-coding gene	gene with protein product		609928	"""myosin, heavy polypeptide 7B, cardiac muscle, beta"""			11919279, 15014174	Standard	XM_006723839		Approved	KIAA1512, dJ756N5.1, MYH14, MHC14	uc002xbi.2	A7E2Y1	OTTHUMG00000032320	ENST00000262873.7:c.1812G>T	20.37:g.33577641G>T	ENSP00000262873:p.Lys604Asn		Q5JVW7|Q6NT44|Q6NT57|Q6WG75|Q96I57|Q9NWE2|Q9P216	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Myosin_S1_N,superfamily_Prefoldin,superfamily_tRNA-bd_arm,superfamily_t-SNARE,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.K604N	ENST00000262873.7	37	c.1812	CCDS42869.1	20	.	.	.	.	.	.	.	.	.	.	G	18.79	3.699363	0.68501	.	.	ENSG00000078814	ENST00000262873	T	0.71579	-0.58	4.5	-0.787	0.10943	Myosin head, motor domain (2);	0.000000	0.39615	N	0.001320	T	0.81098	0.4752	M	0.80508	2.5	0.46927	D	0.999256	D	0.76494	0.999	D	0.91635	0.999	T	0.80507	-0.1352	10	0.87932	D	0	.	10.2374	0.43290	0.4354:0.0:0.5646:0.0	.	562	A7E2Y1	MYH7B_HUMAN	N	604	ENSP00000262873:K604N	ENSP00000262873:K604N	K	+	3	2	MYH7B	33041302	0.999000	0.42202	0.995000	0.50966	0.989000	0.77384	0.462000	0.21956	0.010000	0.14839	0.561000	0.74099	AAG	MYH7B	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom	ENSG00000078814		0.612	MYH7B-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MYH7B	HGNC	protein_coding	OTTHUMT00000078833.2	-	0.00	87	0	G	NM_020884		33577641	+1	tier1	-	no_errors	ENST00000262873	ensembl	human	novel	74_37	missense	25.61	59	21	SNP	0.997	T
MYLK4	340156	genome.wustl.edu	37	6	2693022	2693022	+	Silent	SNP	G	G	T	rs147243450		TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr6:2693022G>T	ENST00000274643.7	-	3	573	c.231C>A	c.(229-231)ctC>ctA	p.L77L	MYLK4_ENST00000268446.5_Silent_p.L77L	NM_001012418.3	NP_001012418.2	Q86YV6	MYLK4_HUMAN	myosin light chain kinase family, member 4	77						extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.L77L(2)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(10)|ovary(2)|skin(1)	23	Ovarian(93;0.0412)	all_hematologic(90;0.0897)				TGTTACCTGCGAGGGCTGATG	0.443																																																	2	Substitution - coding silent(2)	lung(2)											115.0	93.0	100.0					6																	2693022		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS34330.1	6p25.2	2008-01-23			ENSG00000145949	ENSG00000145949			27972	protein-coding gene	gene with protein product	"""caMLCK like"""						Standard	NM_001012418		Approved	SgK085	uc003mty.4	Q86YV6	OTTHUMG00000014121	ENST00000274643.7:c.231C>A	6.37:g.2693022G>T			A2RUC0|Q5TAW2	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.L77	ENST00000274643.7	37	c.231	CCDS34330.1	6																																																																																			MYLK4	-	NULL	ENSG00000145949		0.443	MYLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYLK4	HGNC	protein_coding	OTTHUMT00000039632.2		0.00	59	0	G	NM_001012418		2693022	-1			no_errors	ENST00000268446	ensembl	human	known	74_37	silent	7.69	24	2	SNP	0.000	T
MYO18B	84700	genome.wustl.edu	37	22	26176061	26176061	+	Missense_Mutation	SNP	T	T	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr22:26176061T>A	ENST00000407587.2	+	9	2276	c.2107T>A	c.(2107-2109)Ttc>Atc	p.F703I	MYO18B_ENST00000536101.1_Missense_Mutation_p.F703I|MYO18B_ENST00000335473.7_Missense_Mutation_p.F703I			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	703	Myosin motor.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						CCTCCGGGCCTTCGGCTCTGT	0.627																																																	0													19.0	23.0	21.0					22																	26176061		2085	4196	6281	SO:0001583	missense	0			AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.2107T>A	22.37:g.26176061T>A	ENSP00000386096:p.Phe703Ile		B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,superfamily_tRNA-bd_arm,superfamily_Ribosomal_zn-bd,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.F703I	ENST00000407587.2	37	c.2107		22	.	.	.	.	.	.	.	.	.	.	T	18.79	3.699143	0.68501	.	.	ENSG00000133454	ENST00000536101;ENST00000335473;ENST00000407587	D;D;D	0.84442	-1.85;-1.85;-1.85	5.38	5.38	0.77491	Myosin head, motor domain (3);	0.000000	0.85682	D	0.000000	D	0.93628	0.7965	M	0.91196	3.185	0.48511	D	0.999668	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.79784	0.974;0.993;0.975;0.988	D	0.94923	0.8075	10	0.87932	D	0	.	14.5937	0.68389	0.0:0.0:0.0:1.0	.	216;703;703;703	Q8IUG5-2;Q8IUG5;F5GXR6;F5GYU7	.;MY18B_HUMAN;.;.	I	703	ENSP00000441229:F703I;ENSP00000334563:F703I;ENSP00000386096:F703I	ENSP00000334563:F703I	F	+	1	0	MYO18B	24506061	1.000000	0.71417	0.973000	0.42090	0.075000	0.17131	7.134000	0.77268	2.035000	0.60131	0.533000	0.62120	TTC	MYO18B	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom	ENSG00000133454		0.627	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	MYO18B	HGNC	protein_coding	OTTHUMT00000400691.1	-	0.00	91	0	T	NM_032608		26176061	+1	tier1	-	no_errors	ENST00000335473	ensembl	human	known	74_37	missense	6.90	54	4	SNP	1.000	A
MYOM1	8736	genome.wustl.edu	37	18	3084019	3084019	+	Missense_Mutation	SNP	T	T	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr18:3084019T>A	ENST00000356443.4	-	32	4679	c.4346A>T	c.(4345-4347)aAg>aTg	p.K1449M	MYOM1_ENST00000261606.7_Missense_Mutation_p.K1353M|MYOM1_ENST00000400569.3_Missense_Mutation_p.K1449M	NM_003803.3|NM_019856.1	NP_003794.3|NP_062830.1	P52179	MYOM1_HUMAN	myomesin 1	1449					muscle contraction (GO:0006936)	M band (GO:0031430)|striated muscle myosin thick filament (GO:0005863)	identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|structural constituent of muscle (GO:0008307)			NS(2)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(20)|ovary(4)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						CATCAGTTCCTTAAAGGCTGT	0.388																																																	0													111.0	99.0	103.0					18																	3084019		1841	4089	5930	SO:0001583	missense	0			AF185573	CCDS45823.1, CCDS45824.1	18p11.31	2014-09-17	2012-10-17		ENSG00000101605	ENSG00000101605		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7613	protein-coding gene	gene with protein product	"""skelemin"""	603508	"""myomesin 1 (skelemin) (185kD)"", ""myomesin 1 (skelemin) 185kDa"", ""myomesin 1, 185kDa"""			9806852	Standard	NM_019856		Approved		uc002klp.3	P52179	OTTHUMG00000178209	ENST00000356443.4:c.4346A>T	18.37:g.3084019T>A	ENSP00000348821:p.Lys1449Met		Q14BD6|Q6H969|Q6ZUU0	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.K1449M	ENST00000356443.4	37	c.4346	CCDS45824.1	18	.	.	.	.	.	.	.	.	.	.	T	10.76	1.442025	0.25900	.	.	ENSG00000101605	ENST00000356443;ENST00000400569;ENST00000261606	T;T;T	0.52057	0.81;0.8;0.68	6.17	5.0	0.66597	.	0.519895	0.24474	N	0.038210	T	0.49712	0.1573	L	0.46157	1.445	0.32276	N	0.568223	B;B	0.27140	0.169;0.105	B;B	0.43360	0.417;0.238	T	0.61603	-0.7029	10	0.62326	D	0.03	.	7.6561	0.28375	0.0:0.0756:0.1784:0.7459	.	1353;1449	P52179-2;P52179	.;MYOM1_HUMAN	M	1449;1449;1353	ENSP00000348821:K1449M;ENSP00000383413:K1449M;ENSP00000261606:K1353M	ENSP00000261606:K1353M	K	-	2	0	MYOM1	3074019	1.000000	0.71417	0.994000	0.49952	0.788000	0.44548	2.103000	0.41806	2.371000	0.80710	0.533000	0.62120	AAG	MYOM1	-	NULL	ENSG00000101605		0.388	MYOM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MYOM1	HGNC	protein_coding	OTTHUMT00000441037.2	-	0.00	48	0	T	NM_003803		3084019	-1	tier1	-	no_errors	ENST00000356443	ensembl	human	known	74_37	missense	36.11	46	26	SNP	0.999	A
MYZAP	100820829	genome.wustl.edu	37	15	57976616	57976616	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr15:57976616C>T	ENST00000267853.5	+	13	1415	c.1321C>T	c.(1321-1323)Cgt>Tgt	p.R441C	MYZAP_ENST00000380565.4_Missense_Mutation_p.R413C|GCOM1_ENST00000572390.1_Missense_Mutation_p.R413C|GCOM1_ENST00000396180.1_Missense_Mutation_p.R410C|GCOM1_ENST00000484300.1_3'UTR|GCOM1_ENST00000574161.1_Missense_Mutation_p.R441C|POLR2M_ENST00000380563.2_5'UTR|GCOM1_ENST00000380560.2_Missense_Mutation_p.R372C|GCOM1_ENST00000380561.2_Intron|GCOM1_ENST00000380569.2_Intron|GCOM1_ENST00000587652.1_Intron|GCOM1_ENST00000380568.3_Intron			P0CAP1	MYZAP_HUMAN	myocardial zonula adherens protein	441					intracellular signal transduction (GO:0035556)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|I band (GO:0031674)		p.R441C(1)									AGGCAGGACTCGTGAAATTGT	0.428																																																	1	Substitution - Missense(1)	lung(1)											107.0	108.0	108.0					15																	57976616		2192	4292	6484	SO:0001583	missense	0			FJ970029		15q21.3	2012-10-05			ENSG00000263155	ENSG00000263155			43444	protein-coding gene	gene with protein product	"""myocardium-enriched zonula adherens protein"""	614071				20093627, 21992629, 22160502	Standard	NM_001018100		Approved	MYOZAP, Gup, Gup1, GCOM1		P0CAP1	OTTHUMG00000132453	ENST00000267853.5:c.1321C>T	15.37:g.57976616C>T	ENSP00000267853:p.Arg441Cys		D2E9U7|Q6EER8|Q6EES2|Q6EEV3|Q6EF00|Q6EF01|Q6EF02|Q6EF46|Q6EFN8|Q6EM48|Q6K046|Q6K050|Q6K051|Q6ZQZ3|Q8NC58|Q8NCF3|Q96DI5|Q96JB7|Q96NF5	Missense_Mutation	SNP	NULL	p.R441C	ENST00000267853.5	37	c.1321	CCDS10162.1	15	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.2|23.2	4.382035|4.382035	0.82792|0.82792	.|.	.|.	ENSG00000137878|ENSG00000137878	ENST00000396180;ENST00000380560;ENST00000267853;ENST00000380565|ENST00000461709	T;T;T;T|T	0.26957|0.30981	1.81;1.82;1.79;1.7|1.51	5.76|5.76	5.76|5.76	0.90799|0.90799	.|.	.|.	.|.	.|.	.|.	T|T	0.34279|0.34279	0.0892|0.0892	N|N	0.24115|0.24115	0.695|0.695	0.80722|0.80722	D|D	1|1	D;D|.	0.71674|.	0.998;0.997|.	P;P|.	0.53861|.	0.736;0.736|.	T|T	0.10019|0.10019	-1.0648|-1.0648	9|7	0.66056|0.87932	D|D	0.02|0	.|.	15.4858|15.4858	0.75564|0.75564	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	413;441|.	P0CAP1-4;P0CAP1|.	.;GCOM1_HUMAN|.	C|L	410;372;441;413|122	ENSP00000379483:R410C;ENSP00000369933:R372C;ENSP00000267853:R441C;ENSP00000369939:R413C|ENSP00000431396:S122L	ENSP00000267853:R441C|ENSP00000431396:S122L	R|S	+|+	1|2	0|0	GCOM1|GCOM1	55763908|55763908	0.998000|0.998000	0.40836|0.40836	0.999000|0.999000	0.59377|0.59377	0.862000|0.862000	0.49288|0.49288	4.205000|4.205000	0.58466|0.58466	2.706000|2.706000	0.92434|0.92434	0.655000|0.655000	0.94253|0.94253	CGT|TCG	MYZAP	-	NULL	ENSG00000263155		0.428	MYZAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYZAP	HGNC	protein_coding	OTTHUMT00000255716.2		0.00	45	0	C	NM_001018100		57976616	+1			no_errors	ENST00000267853	ensembl	human	known	74_37	missense	10.53	17	2	SNP	1.000	T
N4BP2	55728	genome.wustl.edu	37	4	40098975	40098975	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr4:40098975G>T	ENST00000261435.6	+	3	431	c.15G>T	c.(13-15)agG>agT	p.R5S		NM_018177.4	NP_060647.2	Q86UW6	N4BP2_HUMAN	NEDD4 binding protein 2	5					nucleic acid phosphodiester bond hydrolysis (GO:0090305)|phosphorylation (GO:0016310)	cytosol (GO:0005829)	ATP binding (GO:0005524)|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity (GO:0046404)|endonuclease activity (GO:0004519)			breast(4)|endometrium(3)|kidney(12)|large_intestine(7)|liver(2)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	60						CAAGGAGAAGGAAAAATCTTG	0.383																																																	0													99.0	100.0	100.0					4																	40098975		2203	4300	6503	SO:0001583	missense	0			AB037834	CCDS3457.1	4p14	2008-01-18			ENSG00000078177	ENSG00000078177			29851	protein-coding gene	gene with protein product	"""BCL-3 binding protein"""					10718198, 11717310	Standard	NM_018177		Approved	B3BP	uc003guy.4	Q86UW6	OTTHUMG00000128599	ENST00000261435.6:c.15G>T	4.37:g.40098975G>T	ENSP00000261435:p.Arg5Ser		A0AVR3|Q9NVK2|Q9P2D4	Missense_Mutation	SNP	pfam_DUF1771,pfam_Smr/MutS2_C,superfamily_P-loop_NTPase,superfamily_UBA-like,smart_Smr/MutS2_C,pfscan_CUE,pfscan_Smr/MutS2_C	p.R5S	ENST00000261435.6	37	c.15	CCDS3457.1	4	.	.	.	.	.	.	.	.	.	.	G	15.81	2.944025	0.53079	.	.	ENSG00000078177	ENST00000261435	T	0.26518	1.73	5.09	4.24	0.50183	.	0.324112	0.22559	N	0.058499	T	0.15955	0.0384	N	0.14661	0.345	0.28465	N	0.915676	P	0.50443	0.935	B	0.42245	0.381	T	0.04373	-1.0956	10	0.87932	D	0	.	9.6283	0.39763	0.1597:0.0:0.8403:0.0	.	5	Q86UW6	N4BP2_HUMAN	S	5	ENSP00000261435:R5S	ENSP00000261435:R5S	R	+	3	2	N4BP2	39775370	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	3.357000	0.52277	1.128000	0.42052	0.655000	0.94253	AGG	N4BP2	-	NULL	ENSG00000078177		0.383	N4BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	N4BP2	HGNC	protein_coding	OTTHUMT00000250458.2	-	0.00	79	0	G	NM_018177		40098975	+1	tier1	-	no_errors	ENST00000261435	ensembl	human	known	74_37	missense	15.15	28	5	SNP	1.000	T
NAA10	8260	genome.wustl.edu	37	X	153197547	153197547	+	Silent	SNP	G	G	C			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chrX:153197547G>C	ENST00000464845.1	-	6	681	c.363C>G	c.(361-363)ctC>ctG	p.L121L	NAA10_ENST00000370009.1_Intron|NAA10_ENST00000393712.3_Silent_p.L121L|NAA10_ENST00000393710.3_5'UTR|NAA10_ENST00000370015.4_Silent_p.L121L	NM_001256120.1|NM_003491.3	NP_001243049.1|NP_003482.1	P41227	NAA10_HUMAN	N(alpha)-acetyltransferase 10, NatA catalytic subunit	121	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.				DNA packaging (GO:0006323)|internal protein amino acid acetylation (GO:0006475)|N-terminal protein amino acid acetylation (GO:0006474)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|membrane (GO:0016020)|NatA complex (GO:0031415)|nucleolus (GO:0005730)|nucleus (GO:0005634)	N-acetyltransferase activity (GO:0008080)|peptide alpha-N-acetyltransferase activity (GO:0004596)			breast(1)|endometrium(3)|kidney(1)|lung(3)|ovary(1)|prostate(1)	10						TGTTGGAATAGAGGTGCAGGG	0.587																																					Ovarian(94;1099 1433 38814 45882 51063)												0													138.0	123.0	128.0					X																	153197547		2203	4300	6503	SO:0001819	synonymous_variant	0			BC000308	CCDS14737.1, CCDS59179.1	Xq28	2010-05-07	2010-01-14	2010-01-14	ENSG00000102030	ENSG00000102030	2.3.1.88	"""N(alpha)-acetyltransferase subunits"""	18704	protein-coding gene	gene with protein product		300013	"""ARD1 homolog, N-acetyltransferase (S. cerevisiae)"", ""ARD1 homolog A, N-acetyltransferase (S. cerevisiae)"""	ARD1, ARD1A		7981673, 19660095	Standard	NM_003491		Approved	DXS707, TE2	uc004fjm.2	P41227	OTTHUMG00000024225	ENST00000464845.1:c.363C>G	X.37:g.153197547G>C			A6NM98	Silent	SNP	pfam_GNAT_dom,pfam_FR47,superfamily_Acyl_CoA_acyltransferase,pfscan_GNAT_dom	p.L121	ENST00000464845.1	37	c.363	CCDS14737.1	X																																																																																			NAA10	-	pfam_GNAT_dom,pfam_FR47,superfamily_Acyl_CoA_acyltransferase,pfscan_GNAT_dom	ENSG00000102030		0.587	NAA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAA10	HGNC	protein_coding	OTTHUMT00000061108.2	-	0.00	38	0	G	NM_003491		153197547	-1	tier1	-	no_errors	ENST00000464845	ensembl	human	known	74_37	silent	49.09	28	27	SNP	1.000	C
NCAPD2	9918	genome.wustl.edu	37	12	6623482	6623482	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr12:6623482C>A	ENST00000315579.5	+	7	1438	c.639C>A	c.(637-639)caC>caA	p.H213Q	NCAPD2_ENST00000545962.1_Missense_Mutation_p.H168Q	NM_014865.3	NP_055680.3	Q15021	CND1_HUMAN	non-SMC condensin I complex, subunit D2	213	Interactions with SMC2 and SMC4.				mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensed chromosome (GO:0000793)|condensin complex (GO:0000796)|condensin core heterodimer (GO:0000797)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|pronucleus (GO:0045120)	histone binding (GO:0042393)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	48						CCATTAATCACCAGAAGAACC	0.488																																																	0													102.0	111.0	108.0					12																	6623482		2203	4300	6503	SO:0001583	missense	0			D63880	CCDS8548.1	12p13.31	2008-02-04			ENSG00000010292	ENSG00000010292			24305	protein-coding gene	gene with protein product	"""chromosome condensation related SMC associated protein 1"""	615638				8590280, 10958694	Standard	NM_014865		Approved	CNAP1, hCAP-D2, CAP-D2, KIAA0159	uc001qoo.2	Q15021	OTTHUMG00000168513	ENST00000315579.5:c.639C>A	12.37:g.6623482C>A	ENSP00000325017:p.His213Gln		D3DUR4|Q8N6U3	Missense_Mutation	SNP	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_Condensin_cplx_su1	p.H213Q	ENST00000315579.5	37	c.639	CCDS8548.1	12	.	.	.	.	.	.	.	.	.	.	C	17.71	3.455882	0.63401	.	.	ENSG00000010292	ENST00000315579;ENST00000382457;ENST00000545962;ENST00000535602	T;T;T	0.29655	2.53;1.56;2.26	5.79	5.79	0.91817	Condensin complex, subunit 1, N-terminal (1);	0.162807	0.56097	D	0.000030	T	0.46658	0.1404	L	0.57536	1.79	0.44261	D	0.997119	D;P;D	0.67145	0.995;0.899;0.996	D;P;D	0.66847	0.911;0.817;0.947	T	0.21621	-1.0240	10	0.27082	T	0.32	-22.9744	11.0184	0.47703	0.0:0.8882:0.0:0.1118	.	168;174;213	F5GZJ1;B3KY03;Q15021	.;.;CND1_HUMAN	Q	213;85;168;85	ENSP00000325017:H213Q;ENSP00000371895:H85Q;ENSP00000444417:H168Q	ENSP00000325017:H213Q	H	+	3	2	NCAPD2	6493743	0.995000	0.38212	1.000000	0.80357	0.993000	0.82548	1.006000	0.29847	2.735000	0.93741	0.643000	0.83706	CAC	NCAPD2	-	pirsf_Condensin_cplx_su1	ENSG00000010292		0.488	NCAPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCAPD2	HGNC	protein_coding	OTTHUMT00000399964.1	-	0.00	43	0	C	NM_014865		6623482	+1	tier1	-	no_errors	ENST00000315579	ensembl	human	known	74_37	missense	21.95	64	18	SNP	1.000	A
NCBP1	4686	genome.wustl.edu	37	9	100418317	100418317	+	Silent	SNP	T	T	C			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr9:100418317T>C	ENST00000375147.3	+	14	1579	c.1323T>C	c.(1321-1323)ccT>ccC	p.P441P		NM_002486.4	NP_002477.1	Q09161	NCBP1_HUMAN	nuclear cap binding protein subunit 1, 80kDa	441					7-methylguanosine mRNA capping (GO:0006370)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|mRNA cis splicing, via spliceosome (GO:0045292)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of mRNA 3'-end processing (GO:0031442)|positive regulation of viral transcription (GO:0050434)|regulation of translational initiation (GO:0006446)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|spliceosomal snRNP assembly (GO:0000387)|termination of RNA polymerase II transcription (GO:0006369)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|mRNA cap binding complex (GO:0005845)|nuclear cap binding complex (GO:0005846)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA cap binding (GO:0000339)			NS(1)|central_nervous_system(3)|endometrium(2)|kidney(2)|large_intestine(7)|lung(4)	19		Acute lymphoblastic leukemia(62;0.158)				GTCAAGATCCTGAAAGTCCCA	0.333																																					Ovarian(36;879 898 2893 44212 50307)												0													111.0	112.0	111.0					9																	100418317		2203	4300	6503	SO:0001819	synonymous_variant	0			BC001450	CCDS6728.1	9q34.1	2010-01-26	2002-08-29		ENSG00000136937	ENSG00000136937			7658	protein-coding gene	gene with protein product		600469	"""nuclear cap binding protein subunit 1, 80kD"""	NCBP		7937105, 8812508	Standard	NM_002486		Approved	CBP80, Sto1	uc004axq.3	Q09161	OTTHUMG00000020332	ENST00000375147.3:c.1323T>C	9.37:g.100418317T>C			B2R718|Q59G76|Q5T1V0|Q5T7X2	Silent	SNP	pfam_MIF4G-like_typ-2,pfam_MIF4G-like_typ-1,pfam_MIF4G-like_typ-3,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3	p.P441	ENST00000375147.3	37	c.1323	CCDS6728.1	9																																																																																			NCBP1	-	pfam_MIF4G-like_typ-1,superfamily_ARM-type_fold	ENSG00000136937		0.333	NCBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCBP1	HGNC	protein_coding	OTTHUMT00000053337.1	-	0.00	98	0	T	NM_002486		100418317	+1	tier1	-	no_errors	ENST00000375147	ensembl	human	known	74_37	silent	5.71	66	4	SNP	0.939	C
NCK2	8440	genome.wustl.edu	37	2	106498469	106498469	+	Silent	SNP	G	G	A	rs375512251		TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr2:106498469G>A	ENST00000233154.4	+	4	1354	c.912G>A	c.(910-912)gtG>gtA	p.V304V	NCK2_ENST00000451463.2_Intron|NCK2_ENST00000393349.2_Silent_p.V304V|NCK2_ENST00000522586.1_Intron	NM_003581.4	NP_003572.2	O43639	NCK2_HUMAN	NCK adaptor protein 2	304	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				actin filament organization (GO:0007015)|axon guidance (GO:0007411)|cell migration (GO:0016477)|epidermal growth factor receptor signaling pathway (GO:0007173)|lamellipodium assembly (GO:0030032)|negative regulation of cell proliferation (GO:0008285)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of translation (GO:0006417)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|vesicle membrane (GO:0012506)	cytoskeletal adaptor activity (GO:0008093)|receptor signaling complex scaffold activity (GO:0030159)			endometrium(1)|lung(3)|ovary(1)	5						AGCGGGGCGTGGAGGGCGACT	0.682																																																	0								G	,,	1,4393		0,1,2196	20.0	22.0	21.0		912,,912	-10.7	0.6	2		21	0,8580		0,0,4290	no	coding-synonymous,intron,coding-synonymous	NCK2	NM_001004720.2,NM_001004722.3,NM_003581.4	,,	0,1,6486	AA,AG,GG		0.0,0.0228,0.0077	,,	304/381,,304/381	106498469	1,12973	2197	4290	6487	SO:0001819	synonymous_variant	0			AF043119	CCDS33266.1	2q12	2013-02-14			ENSG00000071051	ENSG00000071051		"""SH2 domain containing"""	7665	protein-coding gene	gene with protein product		604930				9737977, 16752908	Standard	NM_001004720		Approved	NCKbeta	uc002tdi.3	O43639	OTTHUMG00000153116	ENST00000233154.4:c.912G>A	2.37:g.106498469G>A			D3DVK1|Q9BWN9|Q9UIC3	Silent	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_SH2,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,pirsf_Cytoplasmic_NCK,pfscan_SH2,pfscan_SH3_domain,prints_SH2,prints_SH3_domain	p.V304	ENST00000233154.4	37	c.912	CCDS33266.1	2																																																																																			NCK2	-	pfam_SH2,smart_SH2,pirsf_Cytoplasmic_NCK,pfscan_SH2	ENSG00000071051		0.682	NCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCK2	HGNC	protein_coding	OTTHUMT00000329634.1	-	0.00	37	0	G	NM_003581		106498469	+1	tier1	-	no_errors	ENST00000233154	ensembl	human	known	74_37	silent	32.26	41	20	SNP	0.922	A
NFYB	4801	genome.wustl.edu	37	12	104522279	104522279	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr12:104522279G>T	ENST00000240055.3	-	3	250	c.23C>A	c.(22-24)tCt>tAt	p.S8Y	NFYB_ENST00000551727.1_Missense_Mutation_p.S8Y	NM_006166.3	NP_006157.1	P25208	NFYB_HUMAN	nuclear transcription factor Y, beta	8	A domain.				cellular lipid metabolic process (GO:0044255)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	CCAAT-binding factor complex (GO:0016602)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|repressing transcription factor binding (GO:0070491)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.S8F(1)		large_intestine(1)|lung(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	6						ATCTGTTGTAGAACTGTCACC	0.368																																																	1	Substitution - Missense(1)	skin(1)											148.0	150.0	150.0					12																	104522279		2203	4300	6503	SO:0001583	missense	0				CCDS9098.1	12q22-q23	2008-11-11				ENSG00000120837			7805	protein-coding gene	gene with protein product		189904				1774067, 9612081	Standard	NM_006166		Approved	CBF-A, HAP3, NF-YB	uc001tkl.1	P25208	OTTHUMG00000170176	ENST00000240055.3:c.23C>A	12.37:g.104522279G>T	ENSP00000240055:p.Ser8Tyr		A8K7B9|Q96IY8	Missense_Mutation	SNP	pfam_CBFA_NFYB_domain,pfam_Histone_core_D,superfamily_Histone-fold,prints_Transcrpt_fac_NFYB/HAP3	p.S8Y	ENST00000240055.3	37	c.23	CCDS9098.1	12	.	.	.	.	.	.	.	.	.	.	G	23.8	4.460750	0.84317	.	.	ENSG00000120837	ENST00000240055;ENST00000551727;ENST00000551446	T;T	0.53640	0.61;0.61	6.14	6.14	0.99180	.	0.162866	0.56097	D	0.000028	T	0.42314	0.1197	L	0.34521	1.04	0.58432	D	0.999998	P	0.44195	0.828	B	0.37833	0.259	T	0.42899	-0.9424	10	0.87932	D	0	-4.44	20.8449	0.99727	0.0:0.0:1.0:0.0	.	8	P25208	NFYB_HUMAN	Y	8;8;9	ENSP00000240055:S8Y;ENSP00000447486:S8Y	ENSP00000240055:S8Y	S	-	2	0	NFYB	103046409	1.000000	0.71417	0.991000	0.47740	0.992000	0.81027	7.762000	0.85270	2.933000	0.99390	0.645000	0.84053	TCT	NFYB	-	NULL	ENSG00000120837		0.368	NFYB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NFYB	HGNC	protein_coding	OTTHUMT00000407786.1		0.00	25	0	G			104522279	-1			no_errors	ENST00000240055	ensembl	human	known	74_37	missense	7.41	25	2	SNP	1.000	T
NLRP13	126204	genome.wustl.edu	37	19	56424444	56424444	+	Nonsense_Mutation	SNP	G	G	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr19:56424444G>A	ENST00000342929.3	-	5	738	c.739C>T	c.(739-741)Cag>Tag	p.Q247*	NLRP13_ENST00000588751.1_Nonsense_Mutation_p.Q247*	NM_176810.2	NP_789780.2	Q86W25	NAL13_HUMAN	NLR family, pyrin domain containing 13	247	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.		Q -> R (in dbSNP:rs303997). {ECO:0000269|PubMed:12563287}.				ATP binding (GO:0005524)	p.Q247*(1)		NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(58)|ovary(4)|pancreas(2)|prostate(2)|skin(13)|stomach(2)|urinary_tract(1)	109		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)		GBM - Glioblastoma multiforme(193;0.0642)		AGCATAGCCTGCATTGCCAAG	0.507																																																	1	Substitution - Nonsense(1)	lung(1)											106.0	106.0	106.0					19																	56424444		2203	4300	6503	SO:0001587	stop_gained	0			AY154468	CCDS33119.1	19q13.43	2008-02-05	2006-12-08	2006-12-08	ENSG00000173572	ENSG00000173572		"""Nucleotide-binding domain and leucine rich repeat containing"""	22937	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 13"""	609660	"""NACHT, leucine rich repeat and PYD containing 13"""	NALP13		12563287	Standard	NM_176810		Approved	NOD14, PAN13, CLR19.7	uc010ygg.2	Q86W25	OTTHUMG00000167839	ENST00000342929.3:c.739C>T	19.37:g.56424444G>A	ENSP00000343891:p.Gln247*		Q7RTR5	Nonsense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.Q247*	ENST00000342929.3	37	c.739	CCDS33119.1	19	.	.	.	.	.	.	.	.	.	.	G	15.91	2.973132	0.53614	.	.	ENSG00000173572	ENST00000342929	.	.	.	2.81	1.73	0.24493	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.2555	0.20872	0.0:0.0:0.2668:0.7332	.	.	.	.	X	247	.	ENSP00000343891:Q247X	Q	-	1	0	NLRP13	61116256	0.941000	0.31946	0.004000	0.12327	0.086000	0.17979	2.706000	0.47135	0.290000	0.22444	-0.362000	0.07510	CAG	NLRP13	-	superfamily_P-loop_NTPase,pfscan_NACHT_NTPase	ENSG00000173572		0.507	NLRP13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NLRP13	HGNC	protein_coding	OTTHUMT00000396560.1		0.00	54	0	G	NM_176810		56424444	-1			no_errors	ENST00000342929	ensembl	human	known	74_37	nonsense	9.09	29	3	SNP	0.031	A
NLRP9	338321	genome.wustl.edu	37	19	56243981	56243981	+	Missense_Mutation	SNP	A	A	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr19:56243981A>T	ENST00000332836.2	-	2	1243	c.1216T>A	c.(1216-1218)Tat>Aat	p.Y406N		NM_176820.2	NP_789790.2	Q7RTR0	NALP9_HUMAN	NLR family, pyrin domain containing 9	406	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.					cytoplasm (GO:0005737)	ATP binding (GO:0005524)			NS(2)|breast(5)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(15)|lung(21)|ovary(2)|prostate(3)|skin(7)|urinary_tract(3)	74		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)		ACAAATGTATATGTCCAAATT	0.483																																																	0													81.0	82.0	82.0					19																	56243981		2203	4300	6503	SO:0001583	missense	0			AY154464	CCDS12934.1	19q13.43	2006-12-08	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22941	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 9"""	609663	"""NACHT, leucine rich repeat and PYD containing 9"""	NALP9		12563287	Standard	NM_176820		Approved	NOD6, PAN12, CLR19.1	uc002qly.3	Q7RTR0		ENST00000332836.2:c.1216T>A	19.37:g.56243981A>T	ENSP00000331857:p.Tyr406Asn		B2RN12|Q86W27	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.Y406N	ENST00000332836.2	37	c.1216	CCDS12934.1	19	.	.	.	.	.	.	.	.	.	.	A	0.757	-0.770508	0.02974	.	.	ENSG00000185792	ENST00000332836;ENST00000333452	D	0.81499	-1.5	2.56	-3.59	0.04583	.	.	.	.	.	T	0.56077	0.1961	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.01281	0.0	T	0.38436	-0.9661	9	0.25751	T	0.34	.	5.9282	0.19124	0.2297:0.5336:0.2367:0.0	.	406	Q7RTR0	NALP9_HUMAN	N	406	ENSP00000331857:Y406N	ENSP00000331857:Y406N	Y	-	1	0	NLRP9	60935793	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.718000	0.04980	-0.478000	0.06823	-1.102000	0.02115	TAT	NLRP9	-	NULL	ENSG00000185792		0.483	NLRP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP9	HGNC	protein_coding	OTTHUMT00000453653.1	-	0.00	39	0	A	NM_176820		56243981	-1	tier1	-	no_errors	ENST00000332836	ensembl	human	known	74_37	missense	57.14	6	8	SNP	0.000	T
NLRP8	126205	genome.wustl.edu	37	19	56467027	56467027	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr19:56467027C>G	ENST00000291971.3	+	3	1674	c.1603C>G	c.(1603-1605)Cac>Gac	p.H535D	NLRP8_ENST00000590542.1_Missense_Mutation_p.H535D	NM_176811.2	NP_789781.2	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	535					neuron death (GO:0070997)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)			breast(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|ovary(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	35		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		TGTGTTGAGCCACGTGAATAT	0.448																																																	0													123.0	121.0	122.0					19																	56467027		2203	4300	6503	SO:0001583	missense	0			AY154463	CCDS12937.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179709		"""Nucleotide-binding domain and leucine rich repeat containing"""	22940	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 8"""	609659	"""NACHT, leucine rich repeat and PYD containing 8"""	NALP8		12563287	Standard	NM_176811		Approved	NOD16, PAN4, CLR19.2	uc002qmh.3	Q86W28		ENST00000291971.3:c.1603C>G	19.37:g.56467027C>G	ENSP00000291971:p.His535Asp		Q7RTR4	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.H535D	ENST00000291971.3	37	c.1603	CCDS12937.1	19	.	.	.	.	.	.	.	.	.	.	C	3.880	-0.026090	0.07589	.	.	ENSG00000179709	ENST00000291971	D	0.85955	-2.05	2.04	0.952	0.19584	.	.	.	.	.	T	0.73590	0.3606	L	0.29908	0.895	0.09310	N	1	B;B	0.16396	0.017;0.006	B;B	0.15484	0.013;0.001	T	0.59193	-0.7500	9	0.34782	T	0.22	.	5.7796	0.18299	0.3152:0.6848:0.0:0.0	.	535;535	Q86W28-2;Q86W28	.;NALP8_HUMAN	D	535	ENSP00000291971:H535D	ENSP00000291971:H535D	H	+	1	0	NLRP8	61158839	0.003000	0.15002	0.000000	0.03702	0.001000	0.01503	0.240000	0.18042	0.400000	0.25396	0.514000	0.50259	CAC	NLRP8	-	NULL	ENSG00000179709		0.448	NLRP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP8	HGNC	protein_coding	OTTHUMT00000457462.1	-	0.00	63	0	C	NM_176811		56467027	+1	tier1	-	no_errors	ENST00000291971	ensembl	human	known	74_37	missense	7.14	52	4	SNP	0.001	G
NOTCH1	4851	genome.wustl.edu	37	9	139409151	139409151	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr9:139409151C>G	ENST00000277541.6	-	13	2093	c.2018G>C	c.(2017-2019)aGc>aCc	p.S673T		NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1	673	EGF-like 17; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		GTTACACATGCTCCCTAAGGG	0.652			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)																														Dom	yes		9	9q34.3	4851	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""		L	0													25.0	33.0	31.0					9																	139409151		2129	4229	6358	SO:0001583	missense	0			AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.2018G>C	9.37:g.139409151C>G	ENSP00000277541:p.Ser673Thr		Q59ED8|Q5SXM3	Missense_Mutation	SNP	pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,pfam_Ankyrin_rpt,pfam_EGF_extracell,pfam_Notch_NOD_dom,pfam_DUF3454_notch,pfam_Notch_NODP_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Notch_dom,smart_Ankyrin_rpt,pirsf_Notch,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom,prints_Notch_1,prints_Notch_dom	p.S673T	ENST00000277541.6	37	c.2018	CCDS43905.1	9	.	.	.	.	.	.	.	.	.	.	C	0.066	-1.211871	0.01555	.	.	ENSG00000148400	ENST00000277541	D	0.91686	-2.89	5.45	3.56	0.40772	EGF-like region, conserved site (2);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.447187	0.25780	N	0.028350	T	0.78336	0.4267	N	0.03304	-0.355	0.09310	N	1	B	0.17038	0.02	B	0.18871	0.023	T	0.63143	-0.6703	10	0.13108	T	0.6	.	8.7681	0.34715	0.0:0.6334:0.2909:0.0757	.	673	P46531	NOTC1_HUMAN	T	673	ENSP00000277541:S673T	ENSP00000277541:S673T	S	-	2	0	NOTCH1	138528972	0.026000	0.19158	0.025000	0.17156	0.006000	0.05464	1.003000	0.29809	0.639000	0.30564	-0.175000	0.13238	AGC	NOTCH1	-	smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pirsf_Notch,pfscan_EG-like_dom	ENSG00000148400		0.652	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH1	HGNC	protein_coding	OTTHUMT00000055087.1	-	0.00	102	0	C	NM_017617		139409151	-1	tier1	-	no_errors	ENST00000277541	ensembl	human	known	74_37	missense	23.88	102	32	SNP	0.139	G
NOTCH2	4853	genome.wustl.edu	37	1	120539370	120539370	+	Intron	SNP	C	C	G			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr1:120539370C>G	ENST00000256646.2	-	4	971				NOTCH2_ENST00000602566.1_Splice_Site	NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2						apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)			breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		CTCACTGTTTCTACAAAAGGG	0.413			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																															Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	0													56.0	60.0	59.0					1																	120539370		876	1991	2867	SO:0001627	intron_variant	0	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.751+249G>C	1.37:g.120539370C>G			Q5T3X7|Q99734|Q9H240	Splice_Site	SNP	-	e4-1	ENST00000256646.2	37	c.635-1	CCDS908.1	1	.	.	.	.	.	.	.	.	.	.	C	5.339	0.247824	0.10130	.	.	ENSG00000134250	ENST00000369342	.	.	.	5.15	3.25	0.37280	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.4932	0.22127	0.1779:0.7305:0.0:0.0916	.	.	.	.	.	-1	.	.	.	-	.	.	NOTCH2	120340893	0.094000	0.21725	0.984000	0.44739	0.342000	0.28953	1.008000	0.29872	0.727000	0.32360	-0.291000	0.09656	.	NOTCH2	-	-	ENSG00000134250		0.413	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH2	HGNC	protein_coding	OTTHUMT00000033679.1	-	0.00	119	0	C	NM_024408		120539370	-1	tier1	-	no_errors	ENST00000602566	ensembl	human	putative	74_37	splice_site	17.22	125	26	SNP	0.917	G
NSUN4	387338	genome.wustl.edu	37	1	46812708	46812708	+	Missense_Mutation	SNP	G	G	T	rs372410507		TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr1:46812708G>T	ENST00000474844.1	+	3	1203	c.553G>T	c.(553-555)Ggg>Tgg	p.G185W	NSUN4_ENST00000537428.1_Missense_Mutation_p.G136W|NSUN4_ENST00000536062.1_Missense_Mutation_p.G136W|NSUN4_ENST00000498008.1_3'UTR	NM_199044.3	NP_950245.2	Q96CB9	NSUN4_HUMAN	NOP2/Sun domain family, member 4	185	S-adenosyl-L-methionine binding.				rRNA methylation (GO:0031167)	mitochondrial large ribosomal subunit (GO:0005762)	methyltransferase activity (GO:0008168)|rRNA binding (GO:0019843)			endometrium(2)|kidney(1)|large_intestine(2)|lung(2)|prostate(1)	8	Acute lymphoblastic leukemia(166;0.155)					TGCAGCTCCTGGGGGAAAGAC	0.587																																																	0													121.0	108.0	112.0					1																	46812708		2203	4300	6503	SO:0001583	missense	0			AK021577	CCDS534.1, CCDS57996.1	1p34	2012-02-24	2009-11-23		ENSG00000117481	ENSG00000117481		"""NOP2/Sun domain containing"""	31802	protein-coding gene	gene with protein product	"""sperm head and tail associated protein"""	615394	"""NOL1/NOP2/Sun domain family 4"", ""NOL1/NOP2/Sun domain family, member 4"""				Standard	NM_199044		Approved	MGC22960, SHTAP	uc001cpr.2	Q96CB9	OTTHUMG00000007808	ENST00000474844.1:c.553G>T	1.37:g.46812708G>T	ENSP00000419740:p.Gly185Trp		A8K6S6|B3KQ50|B4DHA4|Q5TDF7|Q96AN8|Q9HAJ8	Missense_Mutation	SNP	pfam_Fmu/NOL1/Nop2p,prints_RCMT	p.G185W	ENST00000474844.1	37	c.553	CCDS534.1	1	.	.	.	.	.	.	.	.	.	.	G	33	5.291187	0.95546	.	.	ENSG00000117481	ENST00000474844;ENST00000536062;ENST00000537428	T;T;T	0.80824	-1.42;-1.42;-1.42	6.17	6.17	0.99709	Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p (1);	0.000000	0.85682	D	0.000000	D	0.94742	0.8303	H	0.99058	4.415	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95945	0.8950	10	0.87932	D	0	-17.6415	20.4745	0.99168	0.0:0.0:1.0:0.0	.	185	Q96CB9	NSUN4_HUMAN	W	185;136;136	ENSP00000419740:G185W;ENSP00000438912:G136W;ENSP00000437758:G136W	ENSP00000419740:G185W	G	+	1	0	NSUN4	46585295	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.584000	0.98220	2.941000	0.99782	0.655000	0.94253	GGG	NSUN4	-	pfam_Fmu/NOL1/Nop2p,prints_RCMT	ENSG00000117481		0.587	NSUN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSUN4	HGNC	protein_coding	OTTHUMT00000021427.1		0.00	38	0	G	NM_199044		46812708	+1			no_errors	ENST00000474844	ensembl	human	known	74_37	missense	5.71	33	2	SNP	1.000	T
NR5A2	2494	genome.wustl.edu	37	1	200017837	200017837	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr1:200017837G>T	ENST00000367362.3	+	5	1247	c.1001G>T	c.(1000-1002)aGc>aTc	p.S334I	NR5A2_ENST00000544748.1_Missense_Mutation_p.S262I|NR5A2_ENST00000236914.3_Missense_Mutation_p.S288I	NM_001276464.1|NM_205860.1	NP_001263393.1|NP_995582.1	O00482	NR5A2_HUMAN	nuclear receptor subfamily 5, group A, member 2	334					bile acid metabolic process (GO:0008206)|cholesterol homeostasis (GO:0042632)|embryo development (GO:0009790)|endocrine pancreas development (GO:0031018)|gene expression (GO:0010467)|homeostatic process (GO:0042592)|intracellular receptor signaling pathway (GO:0030522)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral genome replication (GO:0045070)|regulation of cell proliferation (GO:0042127)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|phospholipid binding (GO:0005543)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(15)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	31	Prostate(682;0.19)					GCTAACCGAAGCAAGCACGAA	0.473																																					Melanoma(179;1138 2773 15678 26136)												0													139.0	134.0	136.0					1																	200017837		2203	4300	6503	SO:0001583	missense	0			U93553	CCDS1400.1, CCDS1401.1, CCDS60383.1	1q32.11	2013-01-16			ENSG00000116833	ENSG00000116833		"""Nuclear hormone receptors"""	7984	protein-coding gene	gene with protein product	"""liver receptor homolog-1"""	604453		FTF		9858833, 7680097	Standard	NM_205860		Approved	FTZ-F1beta, hB1F, LRH-1, FTZ-F1, hB1F-2, B1F2	uc001gvb.4	O00482	OTTHUMG00000035635	ENST00000367362.3:c.1001G>T	1.37:g.200017837G>T	ENSP00000356331:p.Ser334Ile		B4E2P3|O95642|Q147U3	Missense_Mutation	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pirsf_Steroidogenic_factor_1,pfscan_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.S334I	ENST00000367362.3	37	c.1001	CCDS1401.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.83|16.83	3.230649|3.230649	0.58777|0.58777	.|.	.|.	ENSG00000116833|ENSG00000116833	ENST00000367357|ENST00000367362;ENST00000236914;ENST00000544748;ENST00000235480	.|D;D;D	.|0.96856	.|-4.15;-4.15;-4.15	5.33|5.33	4.41|4.41	0.53225|0.53225	.|Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (1);	.|0.244324	.|0.56097	.|D	.|0.000032	D|D	0.93979|0.93979	0.8072|0.8072	L|L	0.50333|0.50333	1.59|1.59	0.47994|0.47994	D|D	0.999561|0.999561	.|B;B	.|0.31949	.|0.117;0.348	.|B;B	.|0.34242	.|0.068;0.178	D|D	0.92000|0.92000	0.5610|0.5610	5|9	.|.	.|.	.|.	.|.	13.3942|13.3942	0.60840|0.60840	0.0771:0.0:0.9229:0.0|0.0771:0.0:0.9229:0.0	.|.	.|288;334	.|F1D8R9;O00482	.|.;NR5A2_HUMAN	S|I	255|334;288;262;254	.|ENSP00000356331:S334I;ENSP00000236914:S288I;ENSP00000439116:S262I	.|.	A|S	+|+	1|2	0|0	NR5A2|NR5A2	198284460|198284460	1.000000|1.000000	0.71417|0.71417	0.865000|0.865000	0.33974|0.33974	0.968000|0.968000	0.65278|0.65278	7.473000|7.473000	0.81007|0.81007	1.361000|1.361000	0.45981|0.45981	0.655000|0.655000	0.94253|0.94253	GCA|AGC	NR5A2	-	superfamily_Nucl_hormone_rcpt_ligand-bd,pirsf_Steroidogenic_factor_1	ENSG00000116833		0.473	NR5A2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NR5A2	HGNC	protein_coding	OTTHUMT00000086497.2		0.00	58	0	G			200017837	+1			no_errors	ENST00000367362	ensembl	human	known	74_37	missense	8.16	42	4	SNP	1.000	T
NUPL1	9818	genome.wustl.edu	37	13	25912993	25912993	+	Intron	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr13:25912993G>T	ENST00000381736.3	+	15	1880				NUPL1_ENST00000381718.3_Intron|NUPL1_ENST00000466694.1_3'UTR	NM_001008564.1|NM_014089.3	NP_001008564.1|NP_054808.1	Q9BVL2	NUPL1_HUMAN	nucleoporin like 1						carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)	nucleocytoplasmic transporter activity (GO:0005487)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|stomach(1)|urinary_tract(1)	16		Lung SC(185;0.0225)|Breast(139;0.0351)		all cancers(112;0.0092)|Epithelial(112;0.0477)|OV - Ovarian serous cystadenocarcinoma(117;0.165)|GBM - Glioblastoma multiforme(144;0.244)		TTACTCCCTGGATGAAGTGTG	0.318																																					Pancreas(166;1040 2004 4560 4728 37041)|GBM(109;1045 1520 7614 9308 19618)												0																																										SO:0001627	intron_variant	0			AB007870	CCDS9314.1, CCDS31949.1	13q12.12	2011-04-12			ENSG00000139496	ENSG00000139496			20261	protein-coding gene	gene with protein product		607615				9455477	Standard	NM_014089		Approved	KIAA0410	uc001uqi.3	Q9BVL2	OTTHUMG00000016608	ENST00000381736.3:c.1630+124G>T	13.37:g.25912993G>T			A6NI12|B4DZJ1|O43160|Q5JRG2|Q5JRG5	RNA	SNP	-	NULL	ENST00000381736.3	37	NULL	CCDS9314.1	13																																																																																			NUPL1	-	-	ENSG00000139496		0.318	NUPL1-001	KNOWN	basic|CCDS	protein_coding	NUPL1	HGNC	protein_coding	OTTHUMT00000044228.2	-	0.00	41	0	G			25912993	+1	tier1	-	no_errors	ENST00000466694	ensembl	human	putative	74_37	rna	71.05	11	27	SNP	0.000	T
OGDHL	55753	genome.wustl.edu	37	10	50946061	50946061	+	Missense_Mutation	SNP	T	T	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr10:50946061T>A	ENST00000374103.4	-	19	2534	c.2449A>T	c.(2449-2451)Aac>Tac	p.N817Y	OGDHL_ENST00000432695.1_Missense_Mutation_p.N608Y|OGDHL_ENST00000419399.1_Missense_Mutation_p.N760Y|OGDHL_ENST00000490844.1_5'UTR	NM_018245.2	NP_060715.2	Q9ULD0	OGDHL_HUMAN	oxoglutarate dehydrogenase-like	817					glycolytic process (GO:0006096)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)			central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(1)	61						GTGGAGCAGTTGACCACGATC	0.622																																																	0													254.0	234.0	241.0					10																	50946061		2203	4300	6503	SO:0001583	missense	0			AK001713	CCDS7234.1, CCDS44390.1, CCDS44391.1	10q11.23	2013-09-20			ENSG00000197444	ENSG00000197444			25590	protein-coding gene	gene with protein product						10574462	Standard	NM_018245		Approved	FLJ10851	uc001jie.3	Q9ULD0	OTTHUMG00000018200	ENST00000374103.4:c.2449A>T	10.37:g.50946061T>A	ENSP00000363216:p.Asn817Tyr		A8K2G1|B4DKG2|B4E193|Q8TAN9|Q9NVA0	Missense_Mutation	SNP	pfam_DH_E1,pfam_Transketolase-like_Pyr-bd,smart_Transketolase-like_Pyr-bd,pirsf_2oxoglutarate_DH_E1,tigrfam_2oxoglutarate_DH_E1	p.N817Y	ENST00000374103.4	37	c.2449	CCDS7234.1	10	.	.	.	.	.	.	.	.	.	.	T	16.11	3.029746	0.54790	.	.	ENSG00000197444	ENST00000374103;ENST00000419399;ENST00000432695	D;D;D	0.91407	-2.84;-2.84;-2.84	4.84	4.84	0.62591	Transketolase-like, pyrimidine-binding domain (2);	0.000000	0.85682	D	0.000000	D	0.93298	0.7864	L	0.58925	1.835	0.80722	D	1	D;D;D	0.63046	0.99;0.99;0.992	D;D;D	0.70935	0.934;0.944;0.971	D	0.91866	0.5503	10	0.27082	T	0.32	.	14.424	0.67202	0.0:0.0:0.0:1.0	.	760;608;817	Q9ULD0-2;Q9ULD0-3;Q9ULD0	.;.;OGDHL_HUMAN	Y	817;760;608	ENSP00000363216:N817Y;ENSP00000401356:N760Y;ENSP00000390240:N608Y	ENSP00000363216:N817Y	N	-	1	0	OGDHL	50616067	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.000000	0.88501	1.804000	0.52760	0.528000	0.53228	AAC	OGDHL	-	pfam_Transketolase-like_Pyr-bd,smart_Transketolase-like_Pyr-bd,pirsf_2oxoglutarate_DH_E1,tigrfam_2oxoglutarate_DH_E1	ENSG00000197444		0.622	OGDHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OGDHL	HGNC	protein_coding	OTTHUMT00000048007.1	-	0.00	47	0	T	NM_018245		50946061	-1	tier1	-	no_errors	ENST00000374103	ensembl	human	known	74_37	missense	18.75	25	6	SNP	1.000	A
OPA1	4976	genome.wustl.edu	37	3	193409884	193409884	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr3:193409884G>A	ENST00000392438.3	+	28	3085	c.2851G>A	c.(2851-2853)Gct>Act	p.A951T	OPA1_ENST00000361715.2_Missense_Mutation_p.A970T|OPA1_ENST00000361828.2_Missense_Mutation_p.A969T|OPA1_ENST00000361150.2_Missense_Mutation_p.A952T|OPA1_ENST00000361908.3_Missense_Mutation_p.A988T|OPA1_ENST00000361510.2_Missense_Mutation_p.A1006T	NM_015560.2	NP_056375.2	O60313	OPA1_HUMAN	optic atrophy 1 (autosomal dominant)	951					apoptotic process (GO:0006915)|axon transport of mitochondrion (GO:0019896)|cellular senescence (GO:0090398)|GTP catabolic process (GO:0006184)|inner mitochondrial membrane organization (GO:0007007)|mitochondrial fission (GO:0000266)|mitochondrial fusion (GO:0008053)|mitochondrion organization (GO:0007005)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|neural tube closure (GO:0001843)|visual perception (GO:0007601)	dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial crista (GO:0030061)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|magnesium ion binding (GO:0000287)			breast(1)|cervix(2)|endometrium(3)|kidney(3)|large_intestine(4)|lung(15)|upper_aerodigestive_tract(1)|urinary_tract(2)	31	all_cancers(143;9.56e-09)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;9.19e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000162)		AAAACTTGATGCTTTCATTGA	0.269																																																	0													19.0	19.0	19.0					3																	193409884		2167	4258	6425	SO:0001583	missense	0			AB011139	CCDS33917.1, CCDS43186.1	3q29	2014-09-17			ENSG00000198836	ENSG00000198836			8140	protein-coding gene	gene with protein product	"""mitochondrial dynamin-like GTPase"", ""dynamin-like guanosine triphosphatase"", ""Dynamin-like 120 kDa protein, mitochondrial"""	605290				9490303	Standard	NM_015560		Approved	NTG, KIAA0567, FLJ12460, NPG, MGM1	uc003ftg.3	O60313	OTTHUMG00000149897	ENST00000392438.3:c.2851G>A	3.37:g.193409884G>A	ENSP00000376233:p.Ala951Thr		D3DNW4	Missense_Mutation	SNP	pfam_Dynamin_GTPase,superfamily_P-loop_NTPase,smart_Dynamin_GTPase,prints_Dynamin_SF	p.A1006T	ENST00000392438.3	37	c.3016	CCDS43186.1	3	.	.	.	.	.	.	.	.	.	.	G	17.39	3.377615	0.61735	.	.	ENSG00000198836	ENST00000361908;ENST00000392438;ENST00000361510;ENST00000361715;ENST00000361828;ENST00000361150	D;D;D;D;D;D	0.94897	-3.13;-3.14;-3.12;-3.13;-3.14;-3.55	5.13	4.2	0.49525	.	0.050505	0.85682	D	0.000000	D	0.88496	0.6452	N	0.22421	0.69	0.53005	D	0.999965	B;P;B;B;B;B;B;B	0.37466	0.146;0.596;0.006;0.146;0.026;0.146;0.09;0.02	B;B;B;B;B;B;B;B	0.32211	0.093;0.142;0.024;0.093;0.02;0.119;0.034;0.039	D	0.89934	0.4068	10	0.72032	D	0.01	-14.0853	13.4725	0.61288	0.0:0.0:0.8429:0.1571	.	915;951;933;952;969;988;970;1006	E5KLK2;O60313;E5KLK0;E5KLK1;E5KLJ6;E5KLJ7;E5KLJ9;E5KLJ5	.;OPA1_HUMAN;.;.;.;.;.;.	T	988;951;1006;970;969;952	ENSP00000354681:A988T;ENSP00000376233:A951T;ENSP00000355324:A1006T;ENSP00000355311:A970T;ENSP00000354429:A969T;ENSP00000354781:A952T	ENSP00000354781:A952T	A	+	1	0	OPA1	194892578	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.846000	0.69444	2.373000	0.80994	0.650000	0.86243	GCT	OPA1	-	NULL	ENSG00000198836		0.269	OPA1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	OPA1	HGNC	protein_coding	OTTHUMT00000313812.2	-	0.00	94	0	G	NM_130837		193409884	+1	tier1	-	no_errors	ENST00000361510	ensembl	human	known	74_37	missense	21.43	99	27	SNP	1.000	A
OR10R2	343406	genome.wustl.edu	37	1	158449905	158449905	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr1:158449905T>C	ENST00000368152.1	+	1	238	c.238T>C	c.(238-240)Tac>Cac	p.Y80H	RP11-144L1.4_ENST00000419738.1_RNA|RP11-144L1.4_ENST00000426251.1_RNA	NM_001004472.1	NP_001004472.1	Q8NGX6	O10R2_HUMAN	olfactory receptor, family 10, subfamily R, member 2	80						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(26)|pancreas(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	41	all_hematologic(112;0.0378)					CACACCAATGTACTTCTTCCT	0.418																																																	0													267.0	228.0	242.0					1																	158449905		2203	4300	6503	SO:0001583	missense	0			AB065640	CCDS30898.1	1q23.1	2012-08-09			ENSG00000198965	ENSG00000198965		"""GPCR / Class A : Olfactory receptors"""	14820	protein-coding gene	gene with protein product							Standard	NM_001004472		Approved	OR10R2Q	uc010pik.2	Q8NGX6	OTTHUMG00000019632	ENST00000368152.1:c.238T>C	1.37:g.158449905T>C	ENSP00000357134:p.Tyr80His		Q5VWM8|Q6IFS1|Q96R61	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.Y80H	ENST00000368152.1	37	c.238	CCDS30898.1	1	.	.	.	.	.	.	.	.	.	.	t	19.02	3.745415	0.69418	.	.	ENSG00000198965	ENST00000368152	T	0.15487	2.42	4.28	4.28	0.50868	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.45637	0.1352	H	0.96333	3.805	0.36809	D	0.885771	D	0.89917	1.0	D	0.91635	0.999	T	0.65080	-0.6255	9	0.87932	D	0	.	12.5259	0.56085	0.0:0.0:0.0:1.0	.	80	Q8NGX6	O10R2_HUMAN	H	80	ENSP00000357134:Y80H	ENSP00000357134:Y80H	Y	+	1	0	OR10R2	156716529	1.000000	0.71417	1.000000	0.80357	0.832000	0.47134	5.470000	0.66756	1.762000	0.52044	0.533000	0.62120	TAC	OR10R2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000198965		0.418	OR10R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10R2	HGNC	protein_coding	OTTHUMT00000051847.2	-	0.00	41	0	T	NM_001004472		158449905	+1	tier1	-	no_errors	ENST00000368152	ensembl	human	known	74_37	missense	23.08	30	9	SNP	1.000	C
OR12D2	26529	genome.wustl.edu	37	6	29364590	29364590	+	Silent	SNP	T	T	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr6:29364590T>A	ENST00000383555.2	+	1	175	c.114T>A	c.(112-114)acT>acA	p.T38T	OR5V1_ENST00000377154.1_Intron	NM_013936.3	NP_039224.2	P58182	O12D2_HUMAN	olfactory receptor, family 12, subfamily D, member 2 (gene/pseudogene)	38						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(20)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	31						TCAGTGTGACTGGGAATGGAG	0.463																																																	0													132.0	146.0	141.0					6																	29364590		1510	2709	4219	SO:0001819	synonymous_variant	0				CCDS4659.1	6p22.2-p21.31	2013-10-10	2013-10-10		ENSG00000168787	ENSG00000168787		"""GPCR / Class A : Olfactory receptors"""	8178	protein-coding gene	gene with protein product			"""olfactory receptor, family 12, subfamily D, member 2"""				Standard	NM_013936		Approved	hs6M1-20	uc003nmf.4	P58182	OTTHUMG00000031049	ENST00000383555.2:c.114T>A	6.37:g.29364590T>A			B0S862|Q5SUN9|Q6IET9	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.T38	ENST00000383555.2	37	c.114	CCDS4659.1	6																																																																																			OR12D2	-	prints_GPCR_Rhodpsn	ENSG00000168787		0.463	OR12D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR12D2	HGNC	protein_coding	OTTHUMT00000076054.2	-	0.00	70	0	T			29364590	+1	tier1	-	no_errors	ENST00000383555	ensembl	human	known	74_37	silent	72.58	17	45	SNP	0.000	A
OR4K1	79544	genome.wustl.edu	37	14	20403872	20403872	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr14:20403872G>T	ENST00000285600.4	+	1	106	c.47G>T	c.(46-48)gGa>gTa	p.G16V		NM_001004063.2	NP_001004063.2	Q8NGD4	OR4K1_HUMAN	olfactory receptor, family 4, subfamily K, member 1	16						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(24)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	43	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00124)		GTACTTTTGGGACTCTCTAAT	0.343																																																	0													354.0	399.0	384.0					14																	20403872		2203	4300	6503	SO:0001583	missense	0				CCDS32025.1	14q11.2	2013-09-23			ENSG00000155249	ENSG00000155249		"""GPCR / Class A : Olfactory receptors"""	14726	protein-coding gene	gene with protein product							Standard	NM_001004063		Approved		uc001vwj.2	Q8NGD4	OTTHUMG00000170633	ENST00000285600.4:c.47G>T	14.37:g.20403872G>T	ENSP00000285600:p.Gly16Val		B9EKV9|Q8NGD6|Q96R73	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.G16V	ENST00000285600.4	37	c.47	CCDS32025.1	14	.	.	.	.	.	.	.	.	.	.	.	13.84	2.356938	0.41801	.	.	ENSG00000155249	ENST00000285600	T	0.00659	5.94	4.77	3.88	0.44766	.	0.000000	0.49916	D	0.000138	T	0.05868	0.0153	H	0.94264	3.515	0.50813	D	0.999892	D	0.67145	0.996	D	0.65443	0.935	T	0.00880	-1.1529	10	0.87932	D	0	.	10.9681	0.47424	0.0925:0.0:0.9075:0.0	.	16	Q8NGD4	OR4K1_HUMAN	V	16	ENSP00000285600:G16V	ENSP00000285600:G16V	G	+	2	0	OR4K1	19473712	1.000000	0.71417	0.999000	0.59377	0.343000	0.28985	3.427000	0.52785	1.234000	0.43709	0.561000	0.74099	GGA	OR4K1	-	NULL	ENSG00000155249		0.343	OR4K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4K1	HGNC	protein_coding	OTTHUMT00000409881.1	-	0.00	105	0	G			20403872	+1	tier1	-	no_errors	ENST00000285600	ensembl	human	known	74_37	missense	5.47	190	11	SNP	0.700	T
OR51I2	390064	genome.wustl.edu	37	11	5475294	5475294	+	Silent	SNP	C	C	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr11:5475294C>T	ENST00000341449.2	+	1	657	c.576C>T	c.(574-576)atC>atT	p.I192I	HBG2_ENST00000380259.2_Intron|HBE1_ENST00000380237.1_Intron|HBG2_ENST00000380252.1_Intron|AC104389.28_ENST00000415970.1_RNA	NM_001004754.2	NP_001004754.1	Q9H344	O51I2_HUMAN	olfactory receptor, family 51, subfamily I, member 2	192					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	29		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.09e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GTGCTGATATCAGTATCAACA	0.448																																																	0													311.0	267.0	282.0					11																	5475294		2201	4297	6498	SO:0001819	synonymous_variant	0			BK004381	CCDS31383.1	11p15.4	2012-08-09			ENSG00000187918	ENSG00000187918		"""GPCR / Class A : Olfactory receptors"""	15201	protein-coding gene	gene with protein product							Standard	NM_001004754		Approved		uc010qzf.2	Q9H344	OTTHUMG00000066902	ENST00000341449.2:c.576C>T	11.37:g.5475294C>T			Q6IF81	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.I192	ENST00000341449.2	37	c.576	CCDS31383.1	11																																																																																			OR51I2	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000187918		0.448	OR51I2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51I2	HGNC	protein_coding	OTTHUMT00000143385.1	-	0.00	70	0	C	NM_001004754		5475294	+1	tier1	-	no_errors	ENST00000341449	ensembl	human	known	74_37	silent	10.00	36	4	SNP	0.189	T
OR5L2	26338	genome.wustl.edu	37	11	55594893	55594893	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr11:55594893T>C	ENST00000378397.1	+	1	199	c.199T>C	c.(199-201)Tcc>Ccc	p.S67P		NM_001004739.1	NP_001004739.1	Q8NGL0	OR5L2_HUMAN	olfactory receptor, family 5, subfamily L, member 2	67						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|kidney(1)|large_intestine(1)|lung(42)|ovary(1)|prostate(3)|skin(1)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	59		all_epithelial(135;0.208)				CAGCCACTTGTCCTTTGTAGA	0.473										HNSCC(27;0.073)																																							0													229.0	212.0	218.0					11																	55594893		2200	4296	6496	SO:0001583	missense	0			AB065782	CCDS31511.1	11q11	2012-08-09			ENSG00000205030	ENSG00000205030		"""GPCR / Class A : Olfactory receptors"""	8351	protein-coding gene	gene with protein product						1370859	Standard	NM_001004739		Approved	HTPCRX16, HSHTPCRX16	uc001nhy.1	Q8NGL0	OTTHUMG00000166812	ENST00000378397.1:c.199T>C	11.37:g.55594893T>C	ENSP00000367650:p.Ser67Pro		Q6IF66|Q96RB2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S67P	ENST00000378397.1	37	c.199	CCDS31511.1	11	.	.	.	.	.	.	.	.	.	.	.	17.78	3.474119	0.63737	.	.	ENSG00000205030	ENST00000378397	T	0.12255	2.7	5.21	4.01	0.46588	GPCR, rhodopsin-like superfamily (1);	0.000000	0.48767	D	0.000175	T	0.47021	0.1423	H	0.96175	3.78	0.33502	D	0.590103	D	0.67145	0.996	D	0.68039	0.955	T	0.71354	-0.4618	10	0.87932	D	0	-51.3289	11.8055	0.52152	0.0:0.0:0.1455:0.8545	.	67	Q8NGL0	OR5L2_HUMAN	P	67	ENSP00000367650:S67P	ENSP00000367650:S67P	S	+	1	0	OR5L2	55351469	0.000000	0.05858	1.000000	0.80357	0.956000	0.61745	-0.867000	0.04241	2.128000	0.65567	0.509000	0.49947	TCC	OR5L2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000205030		0.473	OR5L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5L2	HGNC	protein_coding	OTTHUMT00000391516.1	-	0.00	75	0	T	NM_001004739		55594893	+1	tier1	-	no_errors	ENST00000378397	ensembl	human	known	74_37	missense	29.33	53	22	SNP	1.000	C
OR5M3	219482	genome.wustl.edu	37	11	56237538	56237538	+	Missense_Mutation	SNP	G	G	T	rs537773767		TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr11:56237538G>T	ENST00000312240.2	-	1	476	c.436C>A	c.(436-438)Cct>Act	p.P146T		NM_001004742.2	NP_001004742.2	Q8NGP4	OR5M3_HUMAN	olfactory receptor, family 5, subfamily M, member 3	146						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(2)|endometrium(2)|large_intestine(7)|lung(15)|ovary(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	37	Esophageal squamous(21;0.00448)					TAAATGTAAGGGAAAGTAATC	0.413																																																	0													108.0	99.0	102.0					11																	56237538		2201	4295	6496	SO:0001583	missense	0			AB065746	CCDS31532.1	11q11	2012-08-09			ENSG00000174937	ENSG00000174937		"""GPCR / Class A : Olfactory receptors"""	14806	protein-coding gene	gene with protein product							Standard	NM_001004742		Approved		uc010rjk.2	Q8NGP4	OTTHUMG00000166875	ENST00000312240.2:c.436C>A	11.37:g.56237538G>T	ENSP00000312208:p.Pro146Thr		B2RNM7|Q6IEW4|Q96RC0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.P146T	ENST00000312240.2	37	c.436	CCDS31532.1	11	.	.	.	.	.	.	.	.	.	.	G	9.337	1.061912	0.19987	.	.	ENSG00000174937	ENST00000312240	T	0.35789	1.29	4.6	3.68	0.42216	GPCR, rhodopsin-like superfamily (1);	0.000000	0.46758	D	0.000264	T	0.20414	0.0491	N	0.03999	-0.3	0.09310	N	1	P	0.39551	0.678	B	0.41619	0.361	T	0.10870	-1.0611	10	0.32370	T	0.25	-13.5292	12.7672	0.57399	0.0:0.0:0.8345:0.1655	.	146	Q8NGP4	OR5M3_HUMAN	T	146	ENSP00000312208:P146T	ENSP00000312208:P146T	P	-	1	0	OR5M3	55994114	0.000000	0.05858	0.997000	0.53966	0.416000	0.31233	0.182000	0.16900	1.128000	0.42052	0.478000	0.44815	CCT	OR5M3	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000174937		0.413	OR5M3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5M3	HGNC	protein_coding	OTTHUMT00000391639.1	-	0.00	55	0	G	NM_001004742		56237538	-1	tier1	-	no_errors	ENST00000312240	ensembl	human	known	74_37	missense	20.75	42	11	SNP	0.136	T
OR7E24	26648	genome.wustl.edu	37	19	9361740	9361741	+	Frame_Shift_Ins	INS	-	-	T	rs374077378|rs201985790		TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr19:9361740_9361741insT	ENST00000456448.1	+	1	135_136	c.21_22insT	c.(22-24)tttfs	p.F8fs		NM_001079935.1	NP_001073404.1	Q6IFN5	O7E24_HUMAN	olfactory receptor, family 7, subfamily E, member 24	8						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(2)	16						TTCCAATTCTCTTTTTTTTTTT	0.386																																																	0																																										SO:0001589	frameshift_variant	0			Y10529	CCDS45955.1	19p13.2	2012-08-09	2004-03-04	2004-03-05		ENSG00000237521		"""GPCR / Class A : Olfactory receptors"""	8396	protein-coding gene	gene with protein product			"""olfactory receptor, family 7, subfamily E, member 24 pseudogene"""	OR7E24P		9268701	Standard	NM_001079935		Approved	OR19-8, HSHT2, OR7E24Q	uc002mlb.1	Q6IFN5		ENST00000456448.1:c.32dupT	19.37:g.9361751_9361751dupT	ENSP00000387523:p.Phe8fs		B9EJD9|Q9UPJ1	Frame_Shift_Ins	INS	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F11fs	ENST00000456448.1	37	c.21_22	CCDS45955.1	19																																																																																			OR7E24	-	NULL	ENSG00000237521		0.386	OR7E24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR7E24	HGNC	protein_coding	OTTHUMT00000449006.1		0.00	66	0	-			9361741	+1	tier1		no_errors	ENST00000456448	ensembl	human	known	74_37	frame_shift_ins	19.23	21	5	INS	0.000:0.000	T
OSBPL6	114880	genome.wustl.edu	37	2	179247885	179247885	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr2:179247885G>T	ENST00000190611.4	+	17	2132	c.1756G>T	c.(1756-1758)Gtc>Ttc	p.V586F	OSBPL6_ENST00000315022.2_Missense_Mutation_p.V590F|OSBPL6_ENST00000409631.1_Missense_Mutation_p.V550F|OSBPL6_ENST00000359685.3_Missense_Mutation_p.V550F|OSBPL6_ENST00000392505.2_Missense_Mutation_p.V611F|OSBPL6_ENST00000409045.3_Missense_Mutation_p.V555F	NM_032523.3	NP_115912.1	Q9BZF3	OSBL6_HUMAN	oxysterol binding protein-like 6	586					lipid transport (GO:0006869)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(13)|lung(18)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	46			OV - Ovarian serous cystadenocarcinoma(117;0.00578)|Epithelial(96;0.00847)|all cancers(119;0.0335)			CCTGTCTAAAGTCTCTATGCC	0.502																																																	0													79.0	81.0	80.0					2																	179247885		2203	4300	6503	SO:0001583	missense	0			AF392448	CCDS2277.1, CCDS2278.1, CCDS56150.1, CCDS56151.1, CCDS56152.1	2q32.1	2008-05-27			ENSG00000079156	ENSG00000079156		"""Oxysterol binding proteins"""	16388	protein-coding gene	gene with protein product	"""OSBP-related protein 6"""	606734				11483621	Standard	NM_001201480		Approved	ORP6	uc002uly.3	Q9BZF3	OTTHUMG00000132579	ENST00000190611.4:c.1756G>T	2.37:g.179247885G>T	ENSP00000190611:p.Val586Phe		B4DTW1|C4AMC0|C4AME4|D3DPF6|D3DPF7|Q4ZG68|Q53T68|Q59H61|Q7Z4Q1|Q86V84|Q8N9T0|Q96SR1	Missense_Mutation	SNP	pfam_Oxysterol-bd,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.V590F	ENST00000190611.4	37	c.1768	CCDS2277.1	2	.	.	.	.	.	.	.	.	.	.	G	31	5.081426	0.94050	.	.	ENSG00000079156	ENST00000392505;ENST00000359685;ENST00000409045;ENST00000190611;ENST00000409631;ENST00000315022	T;T;T;T;T;T	0.35421	1.31;1.31;1.31;1.31;1.31;1.31	6.04	6.04	0.98038	.	0.102852	0.64402	D	0.000003	T	0.65196	0.2668	M	0.79123	2.44	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.999;0.997;1.0;1.0	D;D;D;D;D	0.91635	0.997;0.977;0.963;0.999;0.993	T	0.65874	-0.6062	10	0.87932	D	0	-13.7997	20.5948	0.99439	0.0:0.0:1.0:0.0	.	555;590;550;611;586	Q9BZF3-4;Q9BZF3-3;Q9BZF3-2;Q9BZF3-5;Q9BZF3	.;.;.;.;OSBL6_HUMAN	F	611;550;555;586;550;590	ENSP00000376293:V611F;ENSP00000352713:V550F;ENSP00000387248:V555F;ENSP00000190611:V586F;ENSP00000386885:V550F;ENSP00000318723:V590F	ENSP00000190611:V586F	V	+	1	0	OSBPL6	178956131	1.000000	0.71417	1.000000	0.80357	0.810000	0.45777	9.869000	0.99810	2.873000	0.98535	0.563000	0.77884	GTC	OSBPL6	-	pfam_Oxysterol-bd	ENSG00000079156		0.502	OSBPL6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	OSBPL6	HGNC	protein_coding	OTTHUMT00000334393.2	-	0.00	27	0	G	NM_032523		179247885	+1	tier1	-	no_errors	ENST00000315022	ensembl	human	known	74_37	missense	42.42	19	14	SNP	1.000	T
PABPC3	5042	genome.wustl.edu	37	13	25671806	25671806	+	Silent	SNP	T	T	A	rs537105482|rs150143049|rs558565724	byFrequency	TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr13:25671806T>A	ENST00000281589.3	+	1	1507	c.1470T>A	c.(1468-1470)gcT>gcA	p.A490A		NM_030979.2	NP_112241.2	Q9H361	PABP3_HUMAN	poly(A) binding protein, cytoplasmic 3	490					mRNA metabolic process (GO:0016071)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|pancreas(1)|skin(3)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		GTCctgcagctgctgctgctg	0.537													t|||	1	0.000199681	0.0	0.0	5008	,	,		21148	0.0		0.001	False		,,,				2504	0.0																0													49.0	46.0	47.0					13																	25671806		2203	4300	6503	SO:0001819	synonymous_variant	0			AF132026	CCDS9311.1	13q12-q13	2013-02-12	2001-11-28		ENSG00000151846	ENSG00000151846		"""RNA binding motif (RRM) containing"""	8556	protein-coding gene	gene with protein product	"""testis PABP"""	604680	"""poly(A)-binding protein, cytoplasmic 3"""	PABPL3		8432538, 10543404	Standard	NM_030979		Approved	PABP3, tPABP	uc001upy.3	Q9H361	OTTHUMG00000016601	ENST00000281589.3:c.1470T>A	13.37:g.25671806T>A			Q8NHV0|Q9H086	Silent	SNP	pfam_RRM_dom,pfam_PABP_HYD,superfamily_PABP_HYD,smart_RRM_dom,smart_RRM_dom_euk,smart_PABP_HYD,pfscan_RRM_dom,tigrfam_PABP_1234	p.A490	ENST00000281589.3	37	c.1470	CCDS9311.1	13																																																																																			PABPC3	-	superfamily_PABP_HYD,tigrfam_PABP_1234	ENSG00000151846		0.537	PABPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PABPC3	HGNC	protein_coding	OTTHUMT00000044220.2		0.00	45	0	T	NM_030979		25671806	+1			no_errors	ENST00000281589	ensembl	human	known	74_37	silent	7.41	25	2	SNP	0.999	A
PADI6	353238	genome.wustl.edu	37	1	17715326	17715326	+	RNA	SNP	T	T	C			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr1:17715326T>C	ENST00000434762.2	+	0	963							Q6TGC4	PADI6_HUMAN	peptidyl arginine deiminase, type VI						cytoplasm organization (GO:0007028)|cytoskeleton organization (GO:0007010)|protein citrullination (GO:0018101)|regulation of translation by machinery localization (GO:0043143)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(2)	29		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;7.59e-06)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.0134)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)	GGTGGCTCCCTGTGTCTTCAT	0.537																																																	0													107.0	109.0	108.0					1																	17715326		1986	4167	6153			0			AY422079	CCDS72715.1	1p36.13	2014-07-10			ENSG00000256049	ENSG00000276747	3.5.3.15	"""Peptidyl arginine deiminases"""	20449	protein-coding gene	gene with protein product		610363				15087120	Standard	NM_207421		Approved		uc001bak.1	Q6TGC4	OTTHUMG00000002372		1.37:g.17715326T>C			Q330K5|Q70SX3	RNA	SNP	-	NULL	ENST00000434762.2	37	NULL		1																																																																																			PADI6	-	-	ENSG00000256049		0.537	PADI6-001	KNOWN	basic	processed_transcript	PADI6	HGNC	processed_transcript	OTTHUMT00000006804.4	-	0.00	54	0	T	NM_207421		17715326	+1	tier1	-	no_errors	ENST00000358481	ensembl	human	known	74_37	rna	8.51	43	4	SNP	0.997	C
PAMR1	25891	genome.wustl.edu	37	11	35489551	35489551	+	Frame_Shift_Del	DEL	T	T	-			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr11:35489551delT	ENST00000378880.2	-	6	1263	c.818delA	c.(817-819)aatfs	p.N273fs	PAMR1_ENST00000378878.3_Frame_Shift_Del_p.N162fs|PAMR1_ENST00000278360.3_Frame_Shift_Del_p.N273fs|PAMR1_ENST00000532848.1_Frame_Shift_Del_p.N233fs|PAMR1_ENST00000534803.1_5'UTR	NM_001001991.1	NP_001001991.1	Q6UXH9	PAMR1_HUMAN	peptidase domain containing associated with muscle regeneration 1	273						extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	26						ATACTCACGATTTTCACAGCG	0.507																																																	0													76.0	44.0	55.0					11																	35489551		2197	4284	6481	SO:0001589	frameshift_variant	0				CCDS7898.1, CCDS31460.1, CCDS60759.1, CCDS60760.1	11p13	2009-09-30			ENSG00000149090	ENSG00000149090			24554	protein-coding gene	gene with protein product	"""regeneration-associated muscle protease"""					15111323	Standard	NM_001282675		Approved	RAMP, DKFZP586H2123	uc001mwf.3	Q6UXH9	OTTHUMG00000166328	ENST00000378880.2:c.818delA	11.37:g.35489551delT	ENSP00000368158:p.Asn273fs		A8MQ58|B7ZA73|Q5EBL7|Q5JPI4|Q6N062|Q71RE9|Q96JW2|Q9Y432	Frame_Shift_Del	DEL	pfam_Peptidase_S1,pfam_CUB_dom,pfam_Sushi_SCR_CCP,pfam_EG-like_dom,superfamily_Trypsin-like_Pept_dom,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_EG-like_dom,smart_CUB_dom,smart_EGF-like_Ca-bd_dom,smart_Sushi_SCR_CCP,smart_Peptidase_S1,prints_Peptidase_S1A,pfscan_CUB_dom,pfscan_EG-like_dom,pfscan_Sushi_SCR_CCP,pfscan_Peptidase_S1	p.N273fs	ENST00000378880.2	37	c.818	CCDS31460.1	11																																																																																			PAMR1	-	NULL	ENSG00000149090		0.507	PAMR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAMR1	HGNC	protein_coding	OTTHUMT00000389177.1		0.00	22	0	T	NM_015430		35489551	-1	tier1		no_errors	ENST00000278360	ensembl	human	known	74_37	frame_shift_del	8.00	23	2	DEL	0.733	-
PAPPA	5069	genome.wustl.edu	37	9	118949454	118949455	+	Frame_Shift_Ins	INS	-	-	T	rs541801151		TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr9:118949454_118949455insT	ENST00000328252.3	+	2	806_807	c.437_438insT	c.(436-441)tatatcfs	p.I147fs	PAPPA_ENST00000534838.1_5'Flank	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	147					cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						AAATGTTCTTATATCTCACGTG	0.441																																																	0																																										SO:0001589	frameshift_variant	0				CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.438dupT	9.37:g.118949455_118949455dupT	ENSP00000330658:p.Ile147fs		B1AMF9|Q08371|Q68G52|Q9UDK7	Frame_Shift_Ins	INS	pfam_Sushi_SCR_CCP,pfam_Notch_dom,pfam_Peptidase_M43,superfamily_ConA-like_lec_gl_sf,superfamily_Sushi_SCR_CCP,superfamily_Fibronectin_type3,superfamily_Notch_dom,smart_LamG-like,smart_Notch_dom,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP,tigrfam_Myxo_disulph_rpt	p.I147fs	ENST00000328252.3	37	c.437_438	CCDS6813.1	9																																																																																			PAPPA	-	superfamily_ConA-like_lec_gl_sf,smart_LamG-like	ENSG00000182752		0.441	PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPPA	HGNC	protein_coding	OTTHUMT00000055546.1		0.00	36	0	-	NM_002581		118949455	+1	tier1		no_errors	ENST00000328252	ensembl	human	known	74_37	frame_shift_ins	65.52	10	19	INS	1.000:1.000	T
PATZ1	23598	genome.wustl.edu	37	22	31740542	31740542	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr22:31740542G>T	ENST00000266269.5	-	1	1676	c.1047C>A	c.(1045-1047)agC>agA	p.S349R	AC005003.1_ENST00000504184.2_5'Flank|PATZ1_ENST00000405309.3_Missense_Mutation_p.S349R|PATZ1_ENST00000215919.3_Missense_Mutation_p.S349R|PATZ1_ENST00000351933.4_Missense_Mutation_p.S349R	NM_014323.2	NP_055138.2	Q9HBE1	PATZ1_HUMAN	POZ (BTB) and AT hook containing zinc finger 1	349					male gonad development (GO:0008584)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)		EWSR1/PATZ1(2)	NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|skin(2)	12						TCCTGGTCCGGCTCCTCTTTC	0.597																																																	0													58.0	60.0	59.0					22																	31740542		2203	4300	6503	SO:0001583	missense	0			AL096880	CCDS13894.1, CCDS13895.1, CCDS13896.1, CCDS46691.1	22q12.2	2013-01-09	2006-09-19	2006-09-19	ENSG00000100105	ENSG00000100105		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	13071	protein-coding gene	gene with protein product		605165	"""zinc finger protein 278"""	ZNF278		10591208, 18241078, 18401526	Standard	NM_014323		Approved	MAZR, dJ400N23, ZBTB19, ZSG, RIAZ, PATZ	uc003akq.3	Q9HBE1	OTTHUMG00000151254	ENST00000266269.5:c.1047C>A	22.37:g.31740542G>T	ENSP00000266269:p.Ser349Arg		Q9HBE2|Q9HBE3|Q9P1A9|Q9UDU0|Q9Y529	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.S349R	ENST00000266269.5	37	c.1047	CCDS13894.1	22	.	.	.	.	.	.	.	.	.	.	G	13.45	2.241925	0.39598	.	.	ENSG00000100105	ENST00000266269;ENST00000405309;ENST00000351933;ENST00000215919	T;T;T;T	0.10668	2.87;2.85;2.91;3.04	4.78	4.78	0.61160	AT hook, DNA-binding motif (1);	0.144236	0.64402	D	0.000003	T	0.06462	0.0166	N	0.08118	0	0.42061	D	0.991161	B;P;P;P	0.44627	0.058;0.557;0.839;0.557	B;B;B;B	0.36134	0.015;0.167;0.218;0.215	T	0.38672	-0.9650	10	0.59425	D	0.04	-22.3116	16.8089	0.85713	0.0:0.0:1.0:0.0	.	349;349;349;349	Q9HBE1-4;Q9HBE1-3;Q9HBE1;Q9HBE1-2	.;.;PATZ1_HUMAN;.	R	349	ENSP00000266269:S349R;ENSP00000384173:S349R;ENSP00000337520:S349R;ENSP00000215919:S349R	ENSP00000215919:S349R	S	-	3	2	PATZ1	30070542	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.029000	0.57253	2.211000	0.71520	0.561000	0.74099	AGC	PATZ1	-	NULL	ENSG00000100105		0.597	PATZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PATZ1	HGNC	protein_coding	OTTHUMT00000321932.1	-	0.00	69	0	G	NM_032052		31740542	-1	tier1	-	no_errors	ENST00000266269	ensembl	human	known	74_37	missense	6.85	68	5	SNP	1.000	T
PCDH9	5101	genome.wustl.edu	37	13	67801527	67801527	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr13:67801527G>T	ENST00000377865.2	-	1	1180	c.1046C>A	c.(1045-1047)aCc>aAc	p.T349N	PCDH9_ENST00000377861.3_Missense_Mutation_p.T349N|PCDH9_ENST00000544246.1_Missense_Mutation_p.T349N|PCDH9_ENST00000456367.1_Missense_Mutation_p.T349N|PCDH9_ENST00000328454.5_Missense_Mutation_p.T349N			Q9HC56	PCDH9_HUMAN	protocadherin 9	349	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				forebrain development (GO:0030900)|homophilic cell adhesion (GO:0007156)	cell-cell contact zone (GO:0044291)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(33)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	103		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)		ATTTACATCGGTGACATTGAT	0.453																																																	0													143.0	138.0	140.0					13																	67801527		2203	4300	6503	SO:0001583	missense	0			AF169692	CCDS9443.1, CCDS9444.1	13q21.32	2010-02-22			ENSG00000184226	ENSG00000184226		"""Cadherins / Protocadherins : Non-clustered"""	8661	protein-coding gene	gene with protein product		603581				9787079	Standard	NM_020403		Approved		uc001vik.3	Q9HC56	OTTHUMG00000017040	ENST00000377865.2:c.1046C>A	13.37:g.67801527G>T	ENSP00000367096:p.Thr349Asn		A2A6U1|Q5VT83|Q7Z3U0|Q8N3K7	Missense_Mutation	SNP	pfam_Cadherin,pfam_Protocadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.T349N	ENST00000377865.2	37	c.1046	CCDS9444.1	13	.	.	.	.	.	.	.	.	.	.	G	16.45	3.125676	0.56721	.	.	ENSG00000184226	ENST00000544246;ENST00000377865;ENST00000456367;ENST00000328454;ENST00000377861	T;T;T;T;T	0.52057	0.68;0.68;0.68;0.68;0.68	6.17	6.17	0.99709	Cadherin (4);Cadherin conserved site (1);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.66197	0.2765	L	0.50919	1.6	0.80722	D	1	B;D;D;D	0.71674	0.208;0.998;0.998;0.998	B;D;D;D	0.80764	0.389;0.99;0.989;0.994	T	0.60439	-0.7263	10	0.45353	T	0.12	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	349;349;349;349	B7ZM79;Q5VT82;Q9HC56-2;Q9HC56	.;.;.;PCDH9_HUMAN	N	349	ENSP00000442186:T349N;ENSP00000367096:T349N;ENSP00000401699:T349N;ENSP00000332060:T349N;ENSP00000367092:T349N	ENSP00000332060:T349N	T	-	2	0	PCDH9	66699528	1.000000	0.71417	0.995000	0.50966	0.998000	0.95712	9.869000	0.99810	2.941000	0.99782	0.655000	0.94253	ACC	PCDH9	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000184226		0.453	PCDH9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDH9	HGNC	protein_coding	OTTHUMT00000276387.1	-	0.00	60	0	G	NM_203487		67801527	-1	tier1	-	no_errors	ENST00000377865	ensembl	human	known	74_37	missense	6.78	55	4	SNP	1.000	T
PDE3A	5139	genome.wustl.edu	37	12	20807137	20807137	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr12:20807137C>T	ENST00000359062.3	+	15	3222	c.3182C>T	c.(3181-3183)cCa>cTa	p.P1061L	PDE3A_ENST00000544307.1_3'UTR	NM_000921.4|NM_001244683.1	NP_000912.3|NP_001231612.1	Q14432	PDE3A_HUMAN	phosphodiesterase 3A, cGMP-inhibited	1061	Catalytic. {ECO:0000250}.				blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cGMP (GO:0071321)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cGMP-mediated signaling (GO:0019934)|diterpenoid metabolic process (GO:0016101)|lipid metabolic process (GO:0006629)|negative regulation of apoptotic process (GO:0043066)|negative regulation of vascular permeability (GO:0043116)|oocyte maturation (GO:0001556)|positive regulation of oocyte development (GO:0060282)|positive regulation of vascular permeability (GO:0043117)|regulation of meiosis (GO:0040020)|response to cAMP (GO:0051591)|response to drug (GO:0042493)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity (GO:0004119)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(7)|lung(29)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	58	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Caffeine(DB00201)|Cilostazol(DB01166)|Enoximone(DB04880)|Ibudilast(DB05266)|Levosimendan(DB00922)|Milrinone(DB00235)|Oxtriphylline(DB01303)|Theophylline(DB00277)|Tofisopam(DB08811)	AATGAATCTCCAAGTAAGTTC	0.378																																																	0													86.0	89.0	88.0					12																	20807137		2203	4300	6503	SO:0001583	missense	0				CCDS31754.1	12p12.2	2011-04-15			ENSG00000172572	ENSG00000172572	3.1.4.17	"""Phosphodiesterases"""	8778	protein-coding gene	gene with protein product		123805				1315035, 10679291	Standard	NM_000921		Approved	CGI-PDE	uc001reh.2	Q14432	OTTHUMG00000168962	ENST00000359062.3:c.3182C>T	12.37:g.20807137C>T	ENSP00000351957:p.Pro1061Leu		O60865|Q13348|Q17RD1	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom	p.P1061L	ENST00000359062.3	37	c.3182	CCDS31754.1	12	.	.	.	.	.	.	.	.	.	.	C	10.04	1.241523	0.22711	.	.	ENSG00000172572	ENST00000359062	T	0.77229	-1.08	5.04	4.15	0.48705	.	1.016300	0.07845	N	0.963629	T	0.71728	0.3374	L	0.45137	1.4	0.50813	D	0.999896	B	0.21225	0.053	B	0.15870	0.014	T	0.57236	-0.7846	10	0.30078	T	0.28	.	11.5356	0.50634	0.0:0.9121:0.0:0.0879	.	1061	Q14432	PDE3A_HUMAN	L	1061	ENSP00000351957:P1061L	ENSP00000351957:P1061L	P	+	2	0	PDE3A	20698404	1.000000	0.71417	0.996000	0.52242	0.172000	0.22775	6.922000	0.75811	1.267000	0.44247	-0.136000	0.14681	CCA	PDE3A	-	NULL	ENSG00000172572		0.378	PDE3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE3A	HGNC	protein_coding	OTTHUMT00000401756.2	-	0.00	59	0	C			20807137	+1	tier1	-	no_errors	ENST00000359062	ensembl	human	known	74_37	missense	47.37	20	18	SNP	0.996	T
PDS5B	23047	genome.wustl.edu	37	13	33309466	33309466	+	Splice_Site	SNP	G	G	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr13:33309466G>A	ENST00000315596.10	+	21	2591	c.2405G>A	c.(2404-2406)cGg>cAg	p.R802Q		NM_015032.3	NP_055847.1	Q9NTI5	PDS5B_HUMAN	PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae)	802					cell proliferation (GO:0008283)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of cell proliferation (GO:0008285)|regulation of cell proliferation (GO:0042127)	chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(14)|lung(14)|ovary(5)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	62		Lung SC(185;0.0367)		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)		ATGAATGATCGGGTAATTTAT	0.313																																																	0													88.0	78.0	81.0					13																	33309466		1831	4094	5925	SO:0001630	splice_region_variant	0			AB023196	CCDS41878.1	13q12.3	2008-02-05	2007-07-18	2007-07-18	ENSG00000083642	ENSG00000083642			20418	protein-coding gene	gene with protein product		605333	"""androgen-induced proliferation inhibitor"""	APRIN		8812419, 10215036	Standard	NM_015032		Approved	AS3, KIAA0979, FLJ23236, CG008	uc010abf.3	Q9NTI5	OTTHUMG00000016704	ENST00000315596.10:c.2406+1G>A	13.37:g.33309466G>A			Q5R3S3|Q5W0K8|Q6NSC3|Q8IXT6|Q9H5N8|Q9Y2I5|Q9Y451	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.R802Q	ENST00000315596.10	37	c.2405	CCDS41878.1	13	.	.	.	.	.	.	.	.	.	.	G	21.7	4.183906	0.78677	.	.	ENSG00000083642	ENST00000315596;ENST00000421084	.	.	.	5.38	5.38	0.77491	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.58666	0.2138	L	0.54323	1.7	0.80722	D	1	B	0.27997	0.197	B	0.21360	0.034	T	0.55244	-0.8171	9	0.29301	T	0.29	-1.8654	19.1293	0.93399	0.0:0.0:1.0:0.0	.	802	Q9NTI5	PDS5B_HUMAN	Q	802	.	ENSP00000313851:R802Q	R	+	2	0	PDS5B	32207466	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	9.694000	0.98686	2.534000	0.85438	0.650000	0.86243	CGG	PDS5B	-	superfamily_ARM-type_fold	ENSG00000083642		0.313	PDS5B-006	KNOWN	basic|appris_principal|CCDS	protein_coding	PDS5B	HGNC	protein_coding	OTTHUMT00000044428.3		0.00	27	0	G	NM_015032	Missense_Mutation	33309466	+1			no_errors	ENST00000315596	ensembl	human	known	74_37	missense	7.14	26	2	SNP	1.000	A
PDZRN4	29951	genome.wustl.edu	37	12	41903641	41903641	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr12:41903641G>T	ENST00000402685.2	+	5	1137	c.1129G>T	c.(1129-1131)Gaa>Taa	p.E377*	PDZRN4_ENST00000298919.7_Nonsense_Mutation_p.E117*|PDZRN4_ENST00000539469.2_Nonsense_Mutation_p.E119*	NM_001164595.1	NP_001158067.1	Q6ZMN7	PZRN4_HUMAN	PDZ domain containing ring finger 4	377							ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	77	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)				AATGGAGCATGAATTTTATGA	0.368																																																	0													154.0	148.0	150.0					12																	41903641		2203	4300	6503	SO:0001587	stop_gained	0			AK094690	CCDS8739.1, CCDS53777.1	12q12	2008-08-14	2008-08-14			ENSG00000165966		"""RING-type (C3HC4) zinc fingers"""	30552	protein-coding gene	gene with protein product	"""similar to semaF cytoplasmic domain associated protein 3"""	609730				11230166, 15010864	Standard	NM_013377		Approved	DKFZp434B0417, LNX4, FLJ33777, IMAGE5767589	uc010skn.2	Q6ZMN7		ENST00000402685.2:c.1129G>T	12.37:g.41903641G>T	ENSP00000384197:p.Glu377*		Q52LY3|Q52LY4|Q6N052|Q8IUU1|Q9NTP7	Nonsense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,superfamily_TRAF-like,smart_Znf_RING,smart_PDZ,pfscan_PDZ,pfscan_Znf_RING	p.E377*	ENST00000402685.2	37	c.1129	CCDS53777.1	12	.	.	.	.	.	.	.	.	.	.	G	42	9.631618	0.99224	.	.	ENSG00000165966	ENST00000402685;ENST00000539469;ENST00000298919	.	.	.	4.86	4.86	0.63082	.	0.241943	0.34879	N	0.003611	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-8.4207	18.9006	0.92440	0.0:0.0:1.0:0.0	.	.	.	.	X	377;119;117	.	ENSP00000298919:E117X	E	+	1	0	PDZRN4	40189908	1.000000	0.71417	0.997000	0.53966	0.987000	0.75469	9.336000	0.96533	2.631000	0.89168	0.650000	0.86243	GAA	PDZRN4	-	superfamily_PDZ	ENSG00000165966		0.368	PDZRN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZRN4	HGNC	protein_coding	OTTHUMT00000403701.1	-	0.00	46	0	G	NM_013377		41903641	+1	tier1	-	no_errors	ENST00000402685	ensembl	human	known	74_37	nonsense	8.16	45	4	SNP	1.000	T
PIGN	23556	genome.wustl.edu	37	18	59780447	59780447	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr18:59780447C>A	ENST00000357637.5	-	16	1769	c.1354G>T	c.(1354-1356)Gtg>Ttg	p.V452L	PIGN_ENST00000400334.3_Missense_Mutation_p.V452L	NM_176787.4	NP_789744.1	O95427	PIGN_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class N	452					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity (GO:0016740)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22		Colorectal(73;0.187)				ATCCATCCCACAAAACCAATA	0.368																																																	0													114.0	104.0	107.0					18																	59780447		1861	4101	5962	SO:0001583	missense	0			AF109219	CCDS45879.1	18q21.33	2013-02-26	2006-06-28		ENSG00000197563	ENSG00000197563		"""Phosphatidylinositol glycan anchor biosynthesis"""	8967	protein-coding gene	gene with protein product		606097	"""phosphatidylinositol glycan, class N"""			10069808, 10574991	Standard	NM_012327		Approved	MDC4, PIG-N	uc021ulb.1	O95427	OTTHUMG00000180098	ENST00000357637.5:c.1354G>T	18.37:g.59780447C>A	ENSP00000350263:p.Val452Leu		Q7L8F8|Q8TC01|Q9NT05	Missense_Mutation	SNP	pfam_GPI_EtnP_transferase_1_C,pfam_Phosphodiest/P_Trfase,pfam_Sulfatase,superfamily_Alkaline_phosphatase_core	p.V452L	ENST00000357637.5	37	c.1354	CCDS45879.1	18	.	.	.	.	.	.	.	.	.	.	C	4.159	0.027976	0.08054	.	.	ENSG00000197563	ENST00000357637;ENST00000400334	T;T	0.49720	0.77;0.77	5.29	4.41	0.53225	GPI ethanolamine phosphate transferase 1, C-terminal (1);	0.142736	0.46442	D	0.000296	T	0.31827	0.0809	L	0.38175	1.15	0.45946	D	0.998771	B;B	0.23735	0.019;0.09	B;B	0.30943	0.091;0.122	T	0.11616	-1.0580	10	0.02654	T	1	-9.9384	7.3945	0.26929	0.1459:0.7184:0.0:0.1358	.	452;452	B2RCI8;O95427	.;PIGN_HUMAN	L	452	ENSP00000350263:V452L;ENSP00000383188:V452L	ENSP00000350263:V452L	V	-	1	0	PIGN	57931427	1.000000	0.71417	1.000000	0.80357	0.854000	0.48673	1.021000	0.30040	2.633000	0.89246	0.448000	0.29417	GTG	PIGN	-	pfam_GPI_EtnP_transferase_1_C	ENSG00000197563		0.368	PIGN-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	PIGN	HGNC	protein_coding	OTTHUMT00000449757.2	-	0.00	70	0	C	NM_176787		59780447	-1	tier1	-	no_errors	ENST00000357637	ensembl	human	known	74_37	missense	23.68	29	9	SNP	1.000	A
PIK3CD	5293	genome.wustl.edu	37	1	9784049	9784049	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr1:9784049G>T	ENST00000377346.4	+	21	2812	c.2617G>T	c.(2617-2619)Gag>Tag	p.E873*	PIK3CD_ENST00000536656.1_Nonsense_Mutation_p.E897*|PIK3CD_ENST00000361110.2_Nonsense_Mutation_p.E897*	NM_005026.3	NP_005017.3	O00329	PK3CD_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit delta	873	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				adaptive immune response (GO:0002250)|B cell activation (GO:0042113)|B cell chemotaxis (GO:0035754)|B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|cytokine production (GO:0001816)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|mast cell chemotaxis (GO:0002551)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|natural killer cell activation (GO:0030101)|natural killer cell chemotaxis (GO:0035747)|natural killer cell differentiation (GO:0001779)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|neutrophil extravasation (GO:0072672)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein phosphorylation (GO:0006468)|respiratory burst involved in defense response (GO:0002679)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell activation (GO:0042110)|T cell chemotaxis (GO:0010818)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|mast cell granule (GO:0042629)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)			central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(12)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	31	all_lung(157;0.222)	all_lung(118;2.44e-05)|Lung NSC(185;4.08e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0231)|Colorectal(212;7.52e-08)|COAD - Colon adenocarcinoma(227;1.78e-05)|Kidney(185;0.000322)|KIRC - Kidney renal clear cell carcinoma(229;0.00114)|BRCA - Breast invasive adenocarcinoma(304;0.0021)|STAD - Stomach adenocarcinoma(132;0.00395)|READ - Rectum adenocarcinoma(331;0.0419)	Caffeine(DB00201)	TCGAGCCATTGAGGAGTTCAC	0.542																																																	0													149.0	137.0	141.0					1																	9784049		2203	4300	6503	SO:0001587	stop_gained	0				CCDS104.1	1p36.2	2014-09-17	2012-07-13		ENSG00000171608	ENSG00000171608	2.7.1.153		8977	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase, catalytic, delta polypeptide"", ""phosphoinositide-3-kinase C"""	602839	"""phosphoinositide-3-kinase, catalytic, delta polypeptide"""			9113989, 9455486	Standard	NM_005026		Approved	p110D	uc001aqb.4	O00329	OTTHUMG00000001450	ENST00000377346.4:c.2617G>T	1.37:g.9784049G>T	ENSP00000366563:p.Glu873*		A6NCG0|G1FFP1|O15445|Q5SR49	Nonsense_Mutation	SNP	pfam_PI3/4_kinase_cat_dom,pfam_PInositide-3_kin_accessory_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,pfam_PI3K_Ras-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_dom,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E897*	ENST00000377346.4	37	c.2689	CCDS104.1	1	.	.	.	.	.	.	.	.	.	.	G	43	9.866120	0.99283	.	.	ENSG00000171608	ENST00000536656;ENST00000377346;ENST00000361110;ENST00000360563	.	.	.	5.01	5.01	0.66863	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-36.1738	18.2987	0.90155	0.0:0.0:1.0:0.0	.	.	.	.	X	897;873;897;897	.	ENSP00000353766:E897X	E	+	1	0	PIK3CD	9706636	1.000000	0.71417	0.977000	0.42913	0.947000	0.59692	9.864000	0.99589	2.327000	0.79052	0.561000	0.74099	GAG	PIK3CD	-	pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000171608		0.542	PIK3CD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3CD	HGNC	protein_coding	OTTHUMT00000004235.1		0.00	24	0	G	NM_005026		9784049	+1			no_errors	ENST00000536656	ensembl	human	known	74_37	nonsense	7.32	38	3	SNP	1.000	T
PKD2L2	27039	genome.wustl.edu	37	5	137260764	137260764	+	Silent	SNP	G	G	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr5:137260764G>A	ENST00000508883.1	+	11	1613	c.1587G>A	c.(1585-1587)aaG>aaA	p.K529K	PKD2L2_ENST00000350250.4_Silent_p.K495K|PKD2L2_ENST00000508638.1_Silent_p.K428K|PKD2L2_ENST00000290431.5_Silent_p.K529K|PKD2L2_ENST00000502810.1_Silent_p.K507K			Q9NZM6	PK2L2_HUMAN	polycystic kidney disease 2-like 2	529					calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)	integral component of membrane (GO:0016021)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)			breast(1)|endometrium(7)|kidney(4)|large_intestine(6)|lung(7)|skin(1)|upper_aerodigestive_tract(2)	28			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			TCAGACTGAAGAAAGCTCAAA	0.279																																																	0													63.0	62.0	62.0					5																	137260764		1801	4075	5876	SO:0001819	synonymous_variant	0			AF118125	CCDS43367.1, CCDS58971.1, CCDS58972.1	5q31	2011-12-16			ENSG00000078795	ENSG00000078795		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9012	protein-coding gene	gene with protein product		604669				10602361	Standard	NM_014386		Approved	TRPP5	uc003lbw.1	Q9NZM6	OTTHUMG00000163306	ENST00000508883.1:c.1587G>A	5.37:g.137260764G>A			A6NK98|B4DXD2|E9PC91|E9PDG4|Q86YB4|Q9UNJ0	Silent	SNP	pfam_PKD1_2_channel,pfam_Ion_trans_dom,prints_PKD_2	p.K529	ENST00000508883.1	37	c.1587		5																																																																																			PKD2L2	-	prints_PKD_2	ENSG00000078795		0.279	PKD2L2-001	KNOWN	basic|appris_principal	protein_coding	PKD2L2	HGNC	protein_coding	OTTHUMT00000372521.1	-	0.00	96	0	G	NM_014386		137260764	+1	tier1	-	no_errors	ENST00000508883	ensembl	human	known	74_37	silent	12.07	51	7	SNP	1.000	A
PKN2	5586	genome.wustl.edu	37	1	89289999	89289999	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr1:89289999G>C	ENST00000370521.3	+	18	2708	c.2349G>C	c.(2347-2349)ttG>ttC	p.L783F	PKN2_ENST00000544045.1_Missense_Mutation_p.L457F|PKN2_ENST00000370513.5_Missense_Mutation_p.L735F|PKN2_ENST00000370505.3_Missense_Mutation_p.L626F	NM_006256.2	NP_006247.1	Q16513	PKN2_HUMAN	protein kinase N2	783	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apical junction assembly (GO:0043297)|apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell division (GO:0051301)|epithelial cell migration (GO:0010631)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic cell cycle (GO:0045931)|protein phosphorylation (GO:0006468)|regulation of cell motility (GO:2000145)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	apical junction complex (GO:0043296)|centrosome (GO:0005813)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium (GO:0030027)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)	ATP binding (GO:0005524)|histone deacetylase binding (GO:0042826)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|endometrium(3)|kidney(3)|large_intestine(8)|lung(15)|prostate(1)|skin(1)	33		Lung NSC(277;0.123)		all cancers(265;0.0136)|Epithelial(280;0.0301)		ACAGAGATTTGAAATTGGATA	0.294																																																	0													123.0	114.0	117.0					1																	89289999		1806	4068	5874	SO:0001583	missense	0			U33052	CCDS714.1	1p22	2014-04-23	2004-07-01	2004-07-01	ENSG00000065243	ENSG00000065243			9406	protein-coding gene	gene with protein product	"""cardiolipin-activated protein kinase Pak2"""	602549	"""protein kinase C-like 2"""	PRKCL2		7988719, 7851406	Standard	NM_006256		Approved	PRK2, Pak-2, STK7	uc001dmn.3	Q16513	OTTHUMG00000010074	ENST00000370521.3:c.2349G>C	1.37:g.89289999G>C	ENSP00000359552:p.Leu783Phe		B4DQ21|B4DTP5|B4DVG1|D3DT24|Q08AF4|Q9H1W4	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_HR1_rho-bd,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_HR1_rho-bd,superfamily_C2_dom,smart_HR1_rho-bd,smart_C2_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Prot_kinase_dom	p.L783F	ENST00000370521.3	37	c.2349	CCDS714.1	1	.	.	.	.	.	.	.	.	.	.	G	18.39	3.614409	0.66672	.	.	ENSG00000065243	ENST00000370521;ENST00000370505;ENST00000370513;ENST00000544045;ENST00000544215	T;T;T;T	0.41758	0.99;0.99;0.99;0.99	5.82	4.91	0.64330	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.36893	U	0.002356	T	0.67692	0.2920	H	0.96015	3.755	0.54753	D	0.99998	D;D;D	0.71674	0.998;0.995;0.996	D;D;D	0.76575	0.988;0.953;0.939	T	0.78700	-0.2102	10	0.87932	D	0	.	11.8573	0.52446	0.1404:0.0:0.8596:0.0	.	767;735;783	B4DTP5;E7ESL7;Q16513	.;.;PKN2_HUMAN	F	783;626;735;457;37	ENSP00000359552:L783F;ENSP00000359536:L626F;ENSP00000359544:L735F;ENSP00000439643:L457F	ENSP00000359536:L626F	L	+	3	2	PKN2	89062587	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.200000	0.51051	1.461000	0.47929	0.591000	0.81541	TTG	PKN2	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000065243		0.294	PKN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKN2	HGNC	protein_coding	OTTHUMT00000027828.3	-	0.00	99	0	G	NM_006256		89289999	+1	tier1	-	no_errors	ENST00000370521	ensembl	human	known	74_37	missense	37.14	44	26	SNP	1.000	C
PLA2G6	8398	genome.wustl.edu	37	22	38559533	38559533	+	Intron	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr22:38559533G>T	ENST00000332509.3	-	2	393				PLA2G6_ENST00000335539.3_Intron|PLA2G6_ENST00000417303.2_Intron|PLA2G6_ENST00000447598.2_Intron|PLA2G6_ENST00000402064.1_Intron|PLA2G6_ENST00000436218.1_Intron|PLA2G6_ENST00000435484.1_Intron	NM_003560.2	NP_003551.2	O60733	PLPL9_HUMAN	phospholipase A2, group VI (cytosolic, calcium-independent)						cardiolipin acyl-chain remodeling (GO:0035965)|cardiolipin biosynthetic process (GO:0032049)|cell death (GO:0008219)|chemotaxis (GO:0006935)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|glycerophospholipid biosynthetic process (GO:0046474)|innate immune response (GO:0045087)|lipid catabolic process (GO:0016042)|maternal process involved in female pregnancy (GO:0060135)|memory (GO:0007613)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phospholipid metabolic process (GO:0006644)|positive regulation of arachidonic acid secretion (GO:0090238)|positive regulation of ceramide biosynthetic process (GO:2000304)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of exocytosis (GO:0045921)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of vasodilation (GO:0045909)|regulation of store-operated calcium channel activity (GO:1901339)|response to endoplasmic reticulum stress (GO:0034976)|small molecule metabolic process (GO:0044281)|urinary bladder smooth muscle contraction (GO:0014832)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)	calcium-independent phospholipase A2 activity (GO:0047499)|phospholipase A2 activity (GO:0004623)			breast(2)|endometrium(6)|kidney(1)|large_intestine(4)|liver(1)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	24	Melanoma(58;0.045)				Quinacrine(DB01103)	aacagatgtggaaacagaccc	0.627																																																	0																																										SO:0001627	intron_variant	0			AF064594	CCDS13967.1, CCDS33645.1	22q13.1	2013-01-10			ENSG00000184381	ENSG00000184381	3.1.1.4	"""Patatin-like phospholipase domain containing"", ""Parkinson disease"", ""Ankyrin repeat domain containing"""	9039	protein-coding gene	gene with protein product	"""neurodegeneration with brain iron accumulation 2"""	603604				9417066, 16799181, 19029121	Standard	NM_001199562		Approved	iPLA2, PNPLA9, PARK14, iPLA2beta, NBIA2	uc003aux.1	O60733	OTTHUMG00000151246	ENST00000332509.3:c.209+5691C>A	22.37:g.38559533G>T			A8K597|B0QYE8|O75645|Q8N452|Q9UG29|Q9UIT0|Q9Y671	RNA	SNP	-	NULL	ENST00000332509.3	37	NULL	CCDS13967.1	22																																																																																			PLA2G6	-	-	ENSG00000184381		0.627	PLA2G6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLA2G6	HGNC	protein_coding	OTTHUMT00000321860.1	-	0.00	54	0	G	NM_001004426		38559533	-1	tier1	-	no_errors	ENST00000445591	ensembl	human	known	74_37	rna	18.60	35	8	SNP	0.000	T
PLAA	9373	genome.wustl.edu	37	9	26947000	26947000	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr9:26947000C>T	ENST00000397292.3	-	1	461	c.44G>A	c.(43-45)cGg>cAg	p.R15Q	IFT74_ENST00000443698.1_5'Flank|PLAA_ENST00000520884.1_Missense_Mutation_p.R15Q|IFT74_ENST00000433700.1_5'Flank	NM_001031689.2	NP_001026859.1	Q9Y263	PLAP_HUMAN	phospholipase A2-activating protein	15					inflammatory response (GO:0006954)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)	phospholipase A2 activator activity (GO:0016005)			breast(1)|endometrium(7)|kidney(2)|large_intestine(3)|lung(3)|prostate(1)	17		all_neural(3;3.53e-10)|Glioma(3;2.71e-09)		Lung(218;1.32e-05)|LUSC - Lung squamous cell carcinoma(38;0.00011)		CTCGTGGCCCCGGAGCGAGCA	0.711																																					Melanoma(175;2670 2735 14091 35526)												0													17.0	18.0	17.0					9																	26947000		2189	4282	6471	SO:0001583	missense	0			AF083395	CCDS35000.1	9p21	2013-01-10			ENSG00000137055	ENSG00000137055		"""WD repeat domain containing"""	9043	protein-coding gene	gene with protein product	"""DOA1 homolog (S. cerevisiae)"""	603873				9931468, 10644453	Standard	NM_001031689		Approved	PLAP, PLA2P, FLJ11281, FLJ12699, DOA1	uc003zqd.3	Q9Y263	OTTHUMG00000019708	ENST00000397292.3:c.44G>A	9.37:g.26947000C>T	ENSP00000380460:p.Arg15Gln		Q53EU5|Q5VY33|Q9NUL8|Q9NVE9|Q9UF53|Q9Y5L1	Missense_Mutation	SNP	pfam_PUL,pfam_WD40_repeat,pfam_PLAA_fam_Ub-bd_PFU,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R15Q	ENST00000397292.3	37	c.44	CCDS35000.1	9	.	.	.	.	.	.	.	.	.	.	C	15.34	2.803252	0.50315	.	.	ENSG00000137055	ENST00000397292;ENST00000520884	T;T	0.60672	0.17;0.17	5.33	0.607	0.17564	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.492361	0.24447	N	0.038455	T	0.29914	0.0748	N	0.17594	0.5	0.21499	N	0.999661	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.002	T	0.07597	-1.0764	10	0.14252	T	0.57	0.0578	2.6139	0.04899	0.148:0.1391:0.4527:0.2602	.	15;15	E5RIM3;Q9Y263	.;PLAP_HUMAN	Q	15	ENSP00000380460:R15Q;ENSP00000429372:R15Q	ENSP00000380460:R15Q	R	-	2	0	PLAA	26937000	0.893000	0.30496	0.999000	0.59377	0.988000	0.76386	0.715000	0.25822	0.196000	0.20367	-0.479000	0.04858	CGG	PLAA	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000137055		0.711	PLAA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLAA	HGNC	protein_coding	OTTHUMT00000051958.2		0.00	59	0	C	NM_001031689		26947000	-1			no_errors	ENST00000397292	ensembl	human	known	74_37	missense	6.67	56	4	SNP	0.981	T
POMGNT2	84892	genome.wustl.edu	37	3	43122845	43122845	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr3:43122845C>T	ENST00000344697.2	-	2	424	c.79G>A	c.(79-81)Gag>Aag	p.E27K	POMGNT2_ENST00000441964.1_Missense_Mutation_p.E27K	NM_032806.5	NP_116195.2	Q8NAT1	PMGT2_HUMAN	protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-)	27					protein O-linked glycosylation (GO:0006493)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein O-GlcNAc transferase activity (GO:0097363)										GCTGCATGCTCACGCAGCCGC	0.647																																																	0													30.0	25.0	26.0					3																	43122845		2203	4299	6502	SO:0001583	missense	0			AK092147	CCDS2709.1	3p22.1	2014-07-15	2013-08-22	2013-08-22	ENSG00000144647	ENSG00000144647			25902	protein-coding gene	gene with protein product		614828	"""chromosome 3 open reading frame 39"", ""glycosyltransferase-like domain containing 2"""	C3orf39, GTDC2		12477932	Standard	NM_032806		Approved	FLJ14566, AGO61	uc003cmr.2	Q8NAT1	OTTHUMG00000133038	ENST00000344697.2:c.79G>A	3.37:g.43122845C>T	ENSP00000344125:p.Glu27Lys		B3KWC3|Q96SY3	Missense_Mutation	SNP	pfam_Glycosyltransferase_AER61,superfamily_Fibronectin_type3	p.E27K	ENST00000344697.2	37	c.79	CCDS2709.1	3	.	.	.	.	.	.	.	.	.	.	C	15.56	2.870734	0.51695	.	.	ENSG00000144647	ENST00000441964;ENST00000344697	T;T	0.80393	-1.37;-1.37	5.75	4.88	0.63580	.	0.000000	0.85682	D	0.000000	T	0.77532	0.4144	L	0.57536	1.79	0.80722	D	1	B	0.24092	0.097	B	0.21917	0.037	T	0.74456	-0.3659	10	0.45353	T	0.12	-12.1921	14.0591	0.64788	0.0:0.9277:0.0:0.0723	.	27	Q8NAT1	AGO61_HUMAN	K	27	ENSP00000408992:E27K;ENSP00000344125:E27K	ENSP00000344125:E27K	E	-	1	0	C3orf39	43097849	1.000000	0.71417	0.886000	0.34754	0.596000	0.36781	7.813000	0.86123	1.432000	0.47375	0.561000	0.74099	GAG	POMGNT2	-	NULL	ENSG00000144647		0.647	POMGNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POMGNT2	HGNC	protein_coding	OTTHUMT00000256643.1	-	0.00	40	0	C	NM_032806		43122845	-1	tier1	-	no_errors	ENST00000344697	ensembl	human	known	74_37	missense	25.00	15	5	SNP	0.999	T
PPP1CC	5501	genome.wustl.edu	37	12	111180517	111180517	+	5'UTR	SNP	T	T	C			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr12:111180517T>C	ENST00000335007.5	-	0	186				PPP1CC_ENST00000550991.1_5'UTR|PPP1CC_ENST00000551690.1_5'UTR|PPP1CC_ENST00000551676.1_5'UTR|PPP1CC_ENST00000340766.5_5'UTR	NM_002710.3	NP_002701.1	P36873	PP1G_HUMAN	protein phosphatase 1, catalytic subunit, gamma isozyme						cell division (GO:0051301)|circadian regulation of gene expression (GO:0032922)|entrainment of circadian clock by photoperiod (GO:0043153)|glycogen metabolic process (GO:0005977)|mitotic cell cycle (GO:0000278)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron differentiation (GO:0030182)|protein dephosphorylation (GO:0006470)|regulation of circadian rhythm (GO:0042752)|small molecule metabolic process (GO:0044281)|transforming growth factor beta receptor signaling pathway (GO:0007179)|triglyceride catabolic process (GO:0019433)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|focal adhesion (GO:0005925)|kinetochore (GO:0000776)|mitochondrion (GO:0005739)|MLL5-L complex (GO:0070688)|nucleolus (GO:0005730)|nucleus (GO:0005634)|protein complex (GO:0043234)|PTW/PP1 phosphatase complex (GO:0072357)	metal ion binding (GO:0046872)|phosphatase activity (GO:0016791)|phosphoprotein phosphatase activity (GO:0004721)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein serine/threonine phosphatase activity (GO:0004722)			central_nervous_system(1)|large_intestine(2)|lung(3)	6						CGCCATCGCCTTCCCACCGCC	0.697																																																	0													22.0	18.0	19.0					12																	111180517		2196	4291	6487	SO:0001623	5_prime_UTR_variant	0				CCDS9150.1, CCDS58279.1	12q24.1-q24.2	2013-01-17	2010-03-05		ENSG00000186298	ENSG00000186298	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9283	protein-coding gene	gene with protein product		176914	"""protein phosphatase 1, catalytic subunit, gamma isoform"""				Standard	NM_002710		Approved	PP1C, PP1gamma	uc021rdx.1	P36873	OTTHUMG00000169531	ENST00000335007.5:c.-5A>G	12.37:g.111180517T>C				RNA	SNP	-	NULL	ENST00000335007.5	37	NULL	CCDS9150.1	12																																																																																			PPP1CC	-	-	ENSG00000186298		0.697	PPP1CC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1CC	HGNC	protein_coding	OTTHUMT00000404659.1	-	0.00	23	0	T			111180517	-1	tier1	-	no_errors	ENST00000551690	ensembl	human	known	74_37	rna	46.43	15	13	SNP	0.987	C
PPP1R27	116729	genome.wustl.edu	37	17	79792473	79792473	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr17:79792473G>T	ENST00000330261.4	-	2	326	c.247C>A	c.(247-249)Ctg>Atg	p.L83M	PPP1R27_ENST00000573182.1_5'Flank|FAM195B_ENST00000538396.1_5'Flank|FAM195B_ENST00000455127.2_5'Flank|FAM195B_ENST00000576431.1_5'Flank|FAM195B_ENST00000575061.1_5'Flank|PPP1R27_ENST00000570394.1_Missense_Mutation_p.L83M|FAM195B_ENST00000573478.1_5'Flank|FAM195B_ENST00000572645.1_5'Flank	NM_001007533.3	NP_001007534.1	Q86WC6	PPR27_HUMAN	protein phosphatase 1, regulatory subunit 27	83					negative regulation of phosphatase activity (GO:0010923)		phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)										TATTTGACCAGCAGCTTCACG	0.622																																																	0													166.0	131.0	143.0					17																	79792473		2203	4300	6503	SO:0001583	missense	0			AF434846	CCDS32767.1	17q25.3	2013-01-10	2011-10-11	2011-10-11	ENSG00000182676	ENSG00000182676		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	16813	protein-coding gene	gene with protein product			"""dysferlin-interacting protein 1 (toonin)"", ""dysferlin interacting protein 1 (toonin)"", ""dysferlin interacting protein 1"""	DYSFIP1			Standard	NM_001007533		Approved	toonin	uc002kbj.1	Q86WC6		ENST00000330261.4:c.247C>A	17.37:g.79792473G>T	ENSP00000331065:p.Leu83Met			Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.L83M	ENST00000330261.4	37	c.247	CCDS32767.1	17	.	.	.	.	.	.	.	.	.	.	G	18.37	3.609076	0.66558	.	.	ENSG00000182676	ENST00000330261	T	0.68624	-0.34	4.86	3.89	0.44902	.	0.000000	0.64402	D	0.000002	T	0.82098	0.4963	M	0.88979	2.995	0.40343	D	0.97905	D	0.76494	0.999	D	0.91635	0.999	D	0.83881	0.0279	10	0.87932	D	0	.	9.0293	0.36249	0.1706:0.0:0.8294:0.0	.	83	Q86WC6	PPR27_HUMAN	M	83	ENSP00000331065:L83M	ENSP00000331065:L83M	L	-	1	2	DYSFIP1	77385762	1.000000	0.71417	1.000000	0.80357	0.754000	0.42855	5.175000	0.65021	1.049000	0.40321	0.561000	0.74099	CTG	PPP1R27	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000182676		0.622	PPP1R27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R27	HGNC	protein_coding	OTTHUMT00000439692.1	-	0.00	57	0	G	NM_001007533		79792473	-1	tier1	-	no_errors	ENST00000330261	ensembl	human	known	74_37	missense	5.71	66	4	SNP	1.000	T
PPP3CA	5530	genome.wustl.edu	37	4	101947132	101947132	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr4:101947132G>T	ENST00000394854.3	-	14	2139	c.1456C>A	c.(1456-1458)Cgc>Agc	p.R486S	PPP3CA_ENST00000512215.1_Missense_Mutation_p.R254S|PPP3CA_ENST00000323055.6_Missense_Mutation_p.R434S|PPP3CA_ENST00000523694.2_Missense_Mutation_p.R419S|PPP3CA_ENST00000394853.4_Missense_Mutation_p.R476S|PPP3CA_ENST00000507176.1_Missense_Mutation_p.R388S	NM_000944.4	NP_000935.1	Q08209	PP2BA_HUMAN	protein phosphatase 3, catalytic subunit, alpha isozyme	486	Inhibitory domain.				calcineurin-NFAT signaling cascade (GO:0033173)|calcium ion transport (GO:0006816)|cellular response to drug (GO:0035690)|cellular response to glucose stimulus (GO:0071333)|dephosphorylation (GO:0016311)|Fc-epsilon receptor signaling pathway (GO:0038095)|G1/S transition of mitotic cell cycle (GO:0000082)|innate immune response (GO:0045087)|multicellular organismal response to stress (GO:0033555)|negative regulation of insulin secretion (GO:0046676)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein dephosphorylation (GO:0006470)|protein import into nucleus (GO:0006606)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic transmission (GO:0050804)|response to amphetamine (GO:0001975)|response to calcium ion (GO:0051592)|skeletal muscle fiber development (GO:0048741)|T cell activation (GO:0042110)|transition between fast and slow fiber (GO:0014883)	calcineurin complex (GO:0005955)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|calmodulin-dependent protein phosphatase activity (GO:0033192)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|protein dimerization activity (GO:0046983)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|cervix(1)|endometrium(3)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	20				OV - Ovarian serous cystadenocarcinoma(123;6.79e-08)		GCATCTCTGCGAGGCGGCATC	0.483																																																	0													213.0	202.0	206.0					4																	101947132		2203	4300	6503	SO:0001583	missense	0				CCDS34037.1, CCDS47113.1, CCDS47114.1	4q24	2010-03-17	2010-03-05		ENSG00000138814	ENSG00000138814	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9314	protein-coding gene	gene with protein product	"""calcineurin A alpha"", ""protein phosphatase 2B, catalytic subunit, alpha isoform"""	114105	"""protein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoform (calcineurin A alpha)"", ""protein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoform"""	CALN, CALNA		2848250, 1659808	Standard	NM_000944		Approved	CNA1, PPP2B	uc011cen.1	Q08209	OTTHUMG00000133839	ENST00000394854.3:c.1456C>A	4.37:g.101947132G>T	ENSP00000378323:p.Arg486Ser		A1A441|A8K3B7|A8W6Z7|A8W6Z8|B5BUA2|Q8TAW9	Missense_Mutation	SNP	pfam_PEstase_dom,smart_Ser/Thr-sp_prot-phosphatase,prints_Ser/Thr-sp_prot-phosphatase	p.R486S	ENST00000394854.3	37	c.1456	CCDS34037.1	4	.	.	.	.	.	.	.	.	.	.	G	14.06	2.423828	0.43020	.	.	ENSG00000138814	ENST00000512215;ENST00000394854;ENST00000323055;ENST00000394853;ENST00000507176;ENST00000523694	T;T;T;T;T;T	0.48522	0.81;2.44;2.55;2.55;2.18;2.45	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.49609	0.1567	N	0.19112	0.55	0.80722	D	1	D;P;P;B;P;P	0.69078	0.997;0.766;0.666;0.078;0.645;0.645	P;P;B;B;B;B	0.59703	0.862;0.689;0.298;0.15;0.326;0.326	T	0.29971	-0.9994	10	0.10377	T	0.69	-8.6928	20.0473	0.97613	0.0:0.0:1.0:0.0	.	486;254;434;476;388;419	Q08209;A8W6Z8;A8W6Z7;Q08209-2;E7ETC2;A1A441	PP2BA_HUMAN;.;.;.;.;.	S	254;486;434;476;388;419	ENSP00000422781:R254S;ENSP00000378323:R486S;ENSP00000320580:R434S;ENSP00000378322:R476S;ENSP00000422990:R388S;ENSP00000429350:R419S	ENSP00000320580:R434S	R	-	1	0	PPP3CA	102166155	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.502000	0.97981	2.722000	0.93159	0.655000	0.94253	CGC	PPP3CA	-	NULL	ENSG00000138814		0.483	PPP3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PPP3CA	HGNC	protein_coding	OTTHUMT00000258379.2		0.00	74	0	G	NM_000944		101947132	-1			no_errors	ENST00000394854	ensembl	human	known	74_37	missense	6.12	46	3	SNP	1.000	T
PRIM2	5558	genome.wustl.edu	37	6	57512796	57512797	+	3'UTR	INS	-	-	CA	rs368894562		TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr6:57512796_57512797insCA	ENST00000389488.2	+	0	1711_1712				PRIM2_ENST00000607273.1_3'UTR			P49643	PRI2_HUMAN	primase, DNA, polypeptide 2 (58kDa)						DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	nucleoplasm (GO:0005654)|primosome complex (GO:1990077)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA primase activity (GO:0003896)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(34)|prostate(6)|stomach(4)|upper_aerodigestive_tract(1)	59				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		gttgtgtaattgtgacacaatt	0.441																																																	0																																										SO:0001624	3_prime_UTR_variant	0				CCDS75476.1, CCDS75477.1	6p12-p11.1	2013-01-31	2007-06-19	2007-06-19	ENSG00000146143	ENSG00000146143			9370	protein-coding gene	gene with protein product		176636	"""primase, polypeptide 2A (58kD)"", ""primase, polypeptide 2A, 58kDa"""	PRIM2A		8530050, 20675616	Standard	NM_001282487		Approved		uc003pdx.3	P49643	OTTHUMG00000016190	ENST00000389488.2:c.*1709->CA	6.37:g.57512796_57512797insCA			Q53FJ8|Q6P1Q7|Q8WVL2|Q9H413	RNA	INS	-	NULL	ENST00000389488.2	37	NULL		6																																																																																			PRIM2	-	-	ENSG00000146143		0.441	PRIM2-001	KNOWN	sequence_error|basic	processed_transcript	PRIM2	HGNC	protein_coding	OTTHUMT00000043468.3		0.00	11	0	-	NM_000947		57512797	+1	tier1		no_errors	ENST00000389488	ensembl	human	known	74_37	rna	35.71	9	5	INS	0.104:0.113	CA
PRDM1	639	genome.wustl.edu	37	6	106536292	106536292	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr6:106536292C>A	ENST00000369096.4	+	2	493	c.259C>A	c.(259-261)Ctg>Atg	p.L87M	PRDM1_ENST00000369091.2_Missense_Mutation_p.L51M	NM_001198.3	NP_001189.2	O75626	PRDM1_HUMAN	PR domain containing 1, with ZNF domain	87	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				cell fate commitment (GO:0045165)|eye photoreceptor cell development (GO:0042462)|germ cell development (GO:0007281)|intestinal epithelial cell development (GO:0060576)|maternal placenta development (GO:0001893)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of gene expression (GO:0010628)|post-embryonic development (GO:0009791)|transcription, DNA-templated (GO:0006351)|trophoblast giant cell differentiation (GO:0060707)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.?(1)		NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(59)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(5)|urinary_tract(2)	94	Breast(9;0.022)	all_cancers(87;2.2e-31)|all_epithelial(87;2.03e-21)|Acute lymphoblastic leukemia(125;4.99e-11)|all_lung(197;7.55e-09)|all_hematologic(75;5.82e-08)|Lung NSC(302;1.28e-06)|Colorectal(196;0.0112)|Ovarian(999;0.0365)		all cancers(137;1.83e-46)|Epithelial(106;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(136;1.99e-20)|GBM - Glioblastoma multiforme(226;3.72e-11)|BRCA - Breast invasive adenocarcinoma(108;1.38e-05)		ACCAAGGAATCTGCTTTTCAA	0.498			"""D, N, Mis, F, S"""		DLBCL																																			Rec	yes		6	6q21	639	"""PR domain containing 1, with ZNF domain"""		L	1	Unknown(1)	haematopoietic_and_lymphoid_tissue(1)											158.0	140.0	146.0					6																	106536292		2203	4300	6503	SO:0001583	missense	0				CCDS5054.2, CCDS34505.1	6q21	2013-01-08			ENSG00000057657	ENSG00000057657		"""Zinc fingers, C2H2-type"""	9346	protein-coding gene	gene with protein product		603423		BLIMP1		1851123	Standard	NM_001198		Approved	PRDI-BF1	uc003prd.2	O75626	OTTHUMG00000015299	ENST00000369096.4:c.259C>A	6.37:g.106536292C>A	ENSP00000358092:p.Leu87Met		B2REA6|E1P5E0|Q86WM7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_SET_dom,smart_SET_dom,smart_Znf_C2H2-like,pirsf_Znf_PRDM1,pfscan_SET_dom,pfscan_Znf_C2H2	p.L87M	ENST00000369096.4	37	c.259	CCDS5054.2	6	.	.	.	.	.	.	.	.	.	.	C	17.52	3.409588	0.62399	.	.	ENSG00000057657	ENST00000369091;ENST00000369096;ENST00000456278;ENST00000424894	T;T;T	0.71222	2.14;2.14;-0.55	5.91	5.91	0.95273	SET domain (2);	0.000000	0.64402	D	0.000001	D	0.82958	0.5150	M	0.88105	2.93	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.85573	0.1235	10	0.87932	D	0	-18.1049	11.2326	0.48920	0.0:0.8906:0.0:0.1094	.	87	O75626	PRDM1_HUMAN	M	51;87;51;51	ENSP00000358087:L51M;ENSP00000358092:L87M;ENSP00000395566:L51M	ENSP00000358087:L51M	L	+	1	2	PRDM1	106642985	1.000000	0.71417	1.000000	0.80357	0.888000	0.51559	2.806000	0.47947	2.804000	0.96469	0.462000	0.41574	CTG	PRDM1	-	smart_SET_dom,pirsf_Znf_PRDM1,pfscan_SET_dom	ENSG00000057657		0.498	PRDM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDM1	HGNC	protein_coding	OTTHUMT00000041661.3	-	0.00	111	0	C			106536292	+1	tier1	-	no_errors	ENST00000369096	ensembl	human	known	74_37	missense	25.58	64	22	SNP	1.000	A
PRKCE	5581	genome.wustl.edu	37	2	46372357	46372357	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr2:46372357A>G	ENST00000306156.3	+	12	2045	c.1718A>G	c.(1717-1719)tAc>tGc	p.Y573C		NM_005400.2	NP_005391.1	Q02156	KPCE_HUMAN	protein kinase C, epsilon	573	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell division (GO:0051301)|cellular response to ethanol (GO:0071361)|cellular response to hypoxia (GO:0071456)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|locomotory exploration behavior (GO:0035641)|macrophage activation involved in immune response (GO:0002281)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of cellular glucuronidation (GO:2001031)|positive regulation of cytokinesis (GO:0032467)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of insulin secretion (GO:0032024)|positive regulation of lipid catabolic process (GO:0050996)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mucus secretion (GO:0070257)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|release of sequestered calcium ion into cytosol (GO:0051209)|response to morphine (GO:0043278)|signal transduction (GO:0007165)|TRAM-dependent toll-like receptor 4 signaling pathway (GO:0035669)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|calcium-independent protein kinase C activity (GO:0004699)|enzyme activator activity (GO:0008047)|enzyme binding (GO:0019899)|ethanol binding (GO:0035276)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|receptor activator activity (GO:0030546)|signal transducer activity (GO:0004871)		MBOAT2/PRKCE(2)	breast(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(13)|ovary(3)|upper_aerodigestive_tract(2)	34		all_hematologic(82;0.155)|Acute lymphoblastic leukemia(82;0.209)	LUSC - Lung squamous cell carcinoma(58;0.171)		Tamoxifen(DB00675)	ACTCCTGACTACATAGCTCCT	0.562																																																	0													150.0	150.0	150.0					2																	46372357		2095	4091	6186	SO:0001583	missense	0				CCDS1824.1	2p21	2009-07-10			ENSG00000171132	ENSG00000171132	2.7.11.1		9401	protein-coding gene	gene with protein product		176975				1382605, 7877991	Standard	NM_005400		Approved		uc002rut.3	Q02156	OTTHUMG00000128817	ENST00000306156.3:c.1718A>G	2.37:g.46372357A>G	ENSP00000306124:p.Tyr573Cys		B0LPH7|Q32MQ3|Q53SL4|Q53SM5|Q9UE81	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pkinase_C,pfam_C2_dom,superfamily_Kinase-like_dom,superfamily_C2_dom,smart_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Prot_kin_PKC_delta,pfscan_C2_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom,prints_DAG/PE-bd	p.Y573C	ENST00000306156.3	37	c.1718	CCDS1824.1	2	.	.	.	.	.	.	.	.	.	.	A	22.5	4.301633	0.81136	.	.	ENSG00000171132	ENST00000306156	T	0.57907	0.37	4.98	4.98	0.66077	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.79805	0.4509	H	0.94925	3.6	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.85925	0.1448	10	0.87932	D	0	.	14.8489	0.70281	1.0:0.0:0.0:0.0	.	573	Q02156	KPCE_HUMAN	C	573	ENSP00000306124:Y573C	ENSP00000306124:Y573C	Y	+	2	0	PRKCE	46225861	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.139000	0.94554	2.094000	0.63399	0.533000	0.62120	TAC	PRKCE	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Prot_kin_PKC_delta,pfscan_Prot_kinase_dom	ENSG00000171132		0.562	PRKCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCE	HGNC	protein_coding	OTTHUMT00000250751.2	-	0.00	80	0	A			46372357	+1	tier1	-	no_errors	ENST00000306156	ensembl	human	known	74_37	missense	22.92	37	11	SNP	1.000	G
PRMT7	54496	genome.wustl.edu	37	16	68371380	68371380	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr16:68371380G>T	ENST00000339507.5	+	7	1240	c.410G>T	c.(409-411)cGt>cTt	p.R137L	PRMT7_ENST00000449359.3_Missense_Mutation_p.R87L|PRMT7_ENST00000348497.4_Intron|PRMT7_ENST00000441236.1_Missense_Mutation_p.R87L|PRMT7_ENST00000564441.1_3'UTR			Q9NVM4	ANM7_HUMAN	protein arginine methyltransferase 7	137	SAM-dependent MTase PRMT-type 1. {ECO:0000255|PROSITE-ProRule:PRU01015}.				cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|histone arginine methylation (GO:0034969)|histone methylation (GO:0016571)|peptidyl-arginine methylation (GO:0018216)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|peptidyl-arginine methylation, to symmetrical-dimethyl arginine (GO:0019918)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of protein binding (GO:0043393)|regulation of transcription, DNA-templated (GO:0006355)|spliceosomal snRNP assembly (GO:0000387)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	[myelin basic protein]-arginine N-methyltransferase activity (GO:0016277)|histone binding (GO:0042393)|histone methyltransferase activity (H4-R3 specific) (GO:0044020)|histone-arginine N-methyltransferase activity (GO:0008469)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|protein-arginine omega-N monomethyltransferase activity (GO:0035241)|protein-arginine omega-N symmetric methyltransferase activity (GO:0035243)|ribonucleoprotein complex binding (GO:0043021)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)			endometrium(3)|kidney(2)|large_intestine(3)|lung(10)|pancreas(1)|urinary_tract(1)	20		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0155)|Epithelial(162;0.0629)		ATGCCATGCCGTGCCAACATC	0.488																																																	0													88.0	83.0	85.0					16																	68371380		2198	4300	6498	SO:0001583	missense	0			AK001502	CCDS10866.1, CCDS54033.1	16q22.1	2008-02-05			ENSG00000132600	ENSG00000132600		"""Protein arginine methyltransferases"""	25557	protein-coding gene	gene with protein product		610087				15044439	Standard	NM_001184824		Approved	FLJ10640, KIAA1933	uc002evy.2	Q9NVM4	OTTHUMG00000137556	ENST00000339507.5:c.410G>T	16.37:g.68371380G>T	ENSP00000343103:p.Arg137Leu		B3KPR0|B3KUG9|B4E379|Q96PV5|Q9H9L0	Missense_Mutation	SNP	pfam_Ribosomal-L11_MeTrfase_PrmA,pirsf_Arg_MeTrfase_PRMT7	p.R137L	ENST00000339507.5	37	c.410	CCDS10866.1	16	.	.	.	.	.	.	.	.	.	.	G	22.3	4.270148	0.80469	.	.	ENSG00000132600	ENST00000449359;ENST00000441236;ENST00000339507	T;T;T	0.23147	1.92;1.92;1.92	5.34	4.18	0.49190	.	0.264750	0.39909	N	0.001229	T	0.43255	0.1239	M	0.69463	2.115	0.80722	D	1	D;D;P	0.62365	0.988;0.991;0.865	P;D;P	0.66716	0.884;0.946;0.561	T	0.33343	-0.9872	10	0.72032	D	0.01	-17.1564	8.1911	0.31368	0.1889:0.0:0.8111:0.0	.	87;137;137	Q9NVM4-3;Q9NVM4;Q9NVM4-4	.;ANM7_HUMAN;.	L	87;87;137	ENSP00000414716:R87L;ENSP00000409324:R87L;ENSP00000343103:R137L	ENSP00000343103:R137L	R	+	2	0	PRMT7	66928881	1.000000	0.71417	1.000000	0.80357	0.899000	0.52679	4.390000	0.59646	2.509000	0.84616	0.484000	0.47621	CGT	PRMT7	-	pirsf_Arg_MeTrfase_PRMT7	ENSG00000132600		0.488	PRMT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRMT7	HGNC	protein_coding	OTTHUMT00000268892.3		0.00	37	0	G	NM_019023		68371380	+1			no_errors	ENST00000339507	ensembl	human	known	74_37	missense	5.08	56	3	SNP	0.956	T
SUPT6H	6830	genome.wustl.edu	37	17	27031456	27031456	+	IGR	SNP	G	G	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr17:27031456G>A	ENST00000314616.6	+	0	6518				PROCA1_ENST00000301039.2_Intron|PROCA1_ENST00000579650.1_5'UTR|PROCA1_ENST00000581289.1_Intron|PROCA1_ENST00000439862.3_Intron	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)						chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					CCTTCAGCCTGCCACACATGG	0.652																																																	0													61.0	66.0	64.0					17																	27031456		2203	4300	6503	SO:0001628	intergenic_variant	0			U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85			17.37:g.27031456G>A			A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	RNA	SNP	-	NULL	ENST00000314616.6	37	NULL	CCDS32596.1	17																																																																																			PROCA1	-	-	ENSG00000167525		0.652	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PROCA1	HGNC	protein_coding	OTTHUMT00000446422.2	-	0.00	29	0	G	NM_003170		27031456	-1	tier1	-	no_errors	ENST00000579650	ensembl	human	known	74_37	rna	41.94	18	13	SNP	1.000	A
PRPS2	5634	genome.wustl.edu	37	X	12828231	12828231	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chrX:12828231A>G	ENST00000380668.5	+	4	624	c.496A>G	c.(496-498)Atc>Gtc	p.I166V	PRPS2_ENST00000398491.2_Missense_Mutation_p.I169V|PRPS2_ENST00000489404.1_Missense_Mutation_p.I166V	NM_001039091.2|NM_002765.4	NP_001034180.1|NP_002756.1	P11908	PRPS2_HUMAN	phosphoribosyl pyrophosphate synthetase 2	166					5-phosphoribose 1-diphosphate biosynthetic process (GO:0006015)|AMP biosynthetic process (GO:0006167)|nucleobase-containing compound metabolic process (GO:0006139)|organ regeneration (GO:0031100)	extracellular vesicular exosome (GO:0070062)|ribose phosphate diphosphokinase complex (GO:0002189)	ADP binding (GO:0043531)|AMP binding (GO:0016208)|ATP binding (GO:0005524)|carbohydrate binding (GO:0030246)|GDP binding (GO:0019003)|kinase activity (GO:0016301)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)|ribose phosphate diphosphokinase activity (GO:0004749)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(5)|urinary_tract(1)	16						GAAGAACTGTATCATTGTTTC	0.468																																																	0													114.0	97.0	103.0					X																	12828231		2203	4300	6503	SO:0001583	missense	0			Y00971	CCDS14150.1, CCDS43918.1	Xp22.2	2012-10-02			ENSG00000101911	ENSG00000101911	2.7.6.1		9465	protein-coding gene	gene with protein product	"""PRS II"", ""ribose-phosphate diphosphokinase 2"""	311860				1962753	Standard	NM_002765		Approved		uc004cva.3	P11908	OTTHUMG00000021139	ENST00000380668.5:c.496A>G	X.37:g.12828231A>G	ENSP00000370043:p.Ile166Val		Q0VDH9|Q0VDI0|Q15245|Q2TAK7	Missense_Mutation	SNP	pfam_PRibTrfase_dom,tigrfam_Rib-P_diPkinase	p.I169V	ENST00000380668.5	37	c.505	CCDS14150.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	3.977|3.977	-0.007146|-0.007146	0.07773|0.07773	.|.	.|.	ENSG00000101911|ENSG00000101911	ENST00000380668;ENST00000398491;ENST00000489404;ENST00000461630;ENST00000460220|ENST00000380663	D;D;D;T|D	0.92647|0.94092	-2.62;-2.62;-3.08;-0.38|-3.35	4.91|4.91	4.91|4.91	0.64330|0.64330	Phosphoribosyltransferase (1);|.	0.100652|.	0.64402|.	D|.	0.000003|.	T|T	0.76579|0.76579	0.4007|0.4007	N|N	0.00205|0.00205	-1.85|-1.85	0.36239|0.36239	D|D	0.853145|0.853145	B;B|.	0.02656|.	0.0;0.0|.	B;B|.	0.08055|.	0.003;0.001|.	T|T	0.81046|0.81046	-0.1110|-0.1110	10|7	0.02654|0.87932	T|D	1|0	-15.706|-15.706	9.3567|9.3567	0.38171|0.38171	0.9146:0.0:0.0854:0.0|0.9146:0.0:0.0854:0.0	.|.	166;169|.	P11908;P11908-2|.	PRPS2_HUMAN;.|.	V|C	166;169;166;79;56|145	ENSP00000370043:I166V;ENSP00000381504:I169V;ENSP00000419380:I166V;ENSP00000418911:I79V|ENSP00000370038:Y145C	ENSP00000370043:I166V|ENSP00000370038:Y145C	I|Y	+|+	1|2	0|0	PRPS2|PRPS2	12738152|12738152	1.000000|1.000000	0.71417|0.71417	0.889000|0.889000	0.34880|0.34880	0.575000|0.575000	0.36095|0.36095	7.002000|7.002000	0.76304|0.76304	1.754000|1.754000	0.51921|0.51921	0.483000|0.483000	0.47432|0.47432	ATC|TAT	PRPS2	-	pfam_PRibTrfase_dom,tigrfam_Rib-P_diPkinase	ENSG00000101911		0.468	PRPS2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PRPS2	HGNC	protein_coding	OTTHUMT00000055772.2	-	0.00	22	0	A	NM_002765		12828231	+1	tier1	-	no_errors	ENST00000398491	ensembl	human	known	74_37	missense	50.00	7	7	SNP	1.000	G
PRRC2A	7916	genome.wustl.edu	37	6	31592989	31592989	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr6:31592989G>A	ENST00000376033.2	+	6	739	c.505G>A	c.(505-507)Gaa>Aaa	p.E169K	PRRC2A_ENST00000469577.1_3'UTR|PRRC2A_ENST00000376007.4_Missense_Mutation_p.E169K|SNORA38_ENST00000363946.1_RNA	NM_004638.3	NP_004629.3	P48634	PRC2A_HUMAN	proline-rich coiled-coil 2A	169	4 X 57 AA type A repeats.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(6)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|lung(19)|ovary(3)|pancreas(2)|prostate(4)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	70						CTCTCGAGAGGAATTTCCGAC	0.572																																																	0													86.0	93.0	90.0					6																	31592989		1511	2709	4220	SO:0001583	missense	0			M31293	CCDS4708.1	6p21.3	2010-12-09	2010-12-09	2010-12-09	ENSG00000204469	ENSG00000204469			13918	protein-coding gene	gene with protein product		142580	"""HLA-B associated transcript 2"""	BAT2		2156268, 8499947	Standard	NM_080686		Approved	G2, D6S51E	uc003nvc.4	P48634	OTTHUMG00000031168	ENST00000376033.2:c.505G>A	6.37:g.31592989G>A	ENSP00000365201:p.Glu169Lys		B0UX77|B0UZE9|B0UZL3|O95875|Q05BK4|Q4LE37|Q5SQ29|Q5SQ30|Q5ST84|Q5STX6|Q5STX7|Q68DW9|Q6P9P7|Q6PIN1|Q8MGQ9|Q96QC6	Missense_Mutation	SNP	pfam_BAT2_N	p.E169K	ENST00000376033.2	37	c.505	CCDS4708.1	6	.	.	.	.	.	.	.	.	.	.	G	16.45	3.126820	0.56721	.	.	ENSG00000204469	ENST00000424184;ENST00000435052;ENST00000376007;ENST00000376033	T;T	0.32272	1.46;1.46	4.56	4.56	0.56223	BAT2, N-terminal (1);	0.000000	0.51477	D	0.000081	T	0.47395	0.1443	M	0.69358	2.11	0.80722	D	1	D;D	0.89917	1.0;0.997	D;D	0.91635	0.999;0.994	T	0.50474	-0.8824	10	0.87932	D	0	-12.3809	16.6015	0.84817	0.0:0.0:1.0:0.0	.	169;169	B4DZ56;P48634	.;PRC2A_HUMAN	K	169	ENSP00000365175:E169K;ENSP00000365201:E169K	ENSP00000365175:E169K	E	+	1	0	PRRC2A	31700968	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.191000	0.94940	2.527000	0.85204	0.655000	0.94253	GAA	PRRC2A	-	pfam_BAT2_N	ENSG00000204469		0.572	PRRC2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRC2A	HGNC	protein_coding	OTTHUMT00000259319.1	-	0.00	30	0	G	NM_080686		31592989	+1	tier1	-	no_errors	ENST00000376007	ensembl	human	known	74_37	missense	36.36	20	12	SNP	1.000	A
PRRC2C	23215	genome.wustl.edu	37	1	171535752	171535752	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr1:171535752G>C	ENST00000338920.4	+	22	6559	c.6322G>C	c.(6322-6324)Gaa>Caa	p.E2108Q	PRRC2C_ENST00000367742.3_Missense_Mutation_p.E2110Q|PRRC2C_ENST00000392078.3_Missense_Mutation_p.E2110Q|PRRC2C_ENST00000426496.2_Missense_Mutation_p.E2108Q	NM_015172.3	NP_055987.2	Q9Y520	PRC2C_HUMAN	proline-rich coiled-coil 2C	2108					hematopoietic progenitor cell differentiation (GO:0002244)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)										GAGTCCAGTAGAAAACAAAGA	0.348																																																	0													38.0	38.0	38.0					1																	171535752		2202	4298	6500	SO:0001583	missense	0			AL096857	CCDS1296.2	1q24.3	2012-07-18	2010-12-09	2010-12-09	ENSG00000117523	ENSG00000117523			24903	protein-coding gene	gene with protein product			"""BAT2 domain containing 1"", ""HLA-B associated transcript 2-like 2"""	BAT2D1, BAT2L2		10470851, 12443540	Standard	NM_015172		Approved	KIAA1096, XTP2	uc010pmg.2	Q9Y520	OTTHUMG00000034665	ENST00000338920.4:c.6322G>C	1.37:g.171535752G>C	ENSP00000343629:p.Glu2108Gln		Q05DM8|Q49A39|Q6PD54|Q9H2N2|Q9HA05|Q9NSM8|Q9NXL3|Q9UF29|Q9UPQ6	Missense_Mutation	SNP	pfam_BAT2_N	p.E2110Q	ENST00000338920.4	37	c.6328	CCDS1296.2	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.97|15.97	2.989231|2.989231	0.53934|0.53934	.|.	.|.	ENSG00000117523|ENSG00000117523	ENST00000392078;ENST00000451306;ENST00000426496;ENST00000367742;ENST00000338920;ENST00000392080|ENST00000495585	T;T;T;T|.	0.01963|.	4.53;4.53;4.55;4.55|.	5.31|5.31	5.31|5.31	0.75309|0.75309	.|.	0.000000|.	0.47852|.	D|.	0.000211|.	T|.	0.42630|.	0.1211|.	L|L	0.28694|0.28694	0.88|0.88	0.42367|0.42367	D|D	0.992432|0.992432	D|.	0.76494|.	0.999|.	D|.	0.68943|.	0.961|.	T|.	0.35375|.	-0.9791|.	10|.	0.02654|.	T|.	1|.	.|.	14.5833|14.5833	0.68308|0.68308	0.0:0.1458:0.8542:0.0|0.0:0.1458:0.8542:0.0	.|.	2108|.	Q9Y520-4|.	.|.	Q|Y	2110;2062;2108;2110;2108;1865|655	ENSP00000375928:E2110Q;ENSP00000410219:E2108Q;ENSP00000356716:E2110Q;ENSP00000343629:E2108Q|.	ENSP00000343629:E2108Q|.	E|X	+|+	1|3	0|2	PRRC2C|PRRC2C	169802376|169802376	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	7.284000|7.284000	0.78650|0.78650	2.468000|2.468000	0.83385|0.83385	0.655000|0.655000	0.94253|0.94253	GAA|TAG	PRRC2C	-	NULL	ENSG00000117523		0.348	PRRC2C-010	KNOWN	basic|appris_candidate|CCDS	protein_coding	PRRC2C	HGNC	protein_coding	OTTHUMT00000314826.4	-	0.00	49	0	G	NM_015172		171535752	+1	tier1	-	no_errors	ENST00000392078	ensembl	human	known	74_37	missense	25.93	20	7	SNP	1.000	C
PTK7	5754	genome.wustl.edu	37	6	43111336	43111336	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr6:43111336G>T	ENST00000230419.4	+	14	2450	c.2229G>T	c.(2227-2229)gaG>gaT	p.E743D	PTK7_ENST00000349241.2_Missense_Mutation_p.E613D|PTK7_ENST00000352931.2_Missense_Mutation_p.E687D|PTK7_ENST00000481273.1_Missense_Mutation_p.E751D|PTK7_ENST00000345201.2_Missense_Mutation_p.E703D	NM_002821.4	NP_002812.2	Q13308	PTK7_HUMAN	protein tyrosine kinase 7	743					actin cytoskeleton reorganization (GO:0031532)|axis elongation (GO:0003401)|canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|cochlea morphogenesis (GO:0090103)|convergent extension (GO:0060026)|establishment of epithelial cell apical/basal polarity (GO:0045198)|establishment of planar polarity (GO:0001736)|lung-associated mesenchyme development (GO:0060484)|neural tube closure (GO:0001843)|peptidyl-tyrosine phosphorylation (GO:0018108)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of neuron projection development (GO:0010976)|signal transduction (GO:0007165)|wound healing (GO:0042060)	cell-cell junction (GO:0005911)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.E743D(3)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(12)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00784)|OV - Ovarian serous cystadenocarcinoma(102;0.0423)			AGGGCGAGGAGCCAGAGATGG	0.677											OREG0017450	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					3	Substitution - Missense(3)	prostate(2)|breast(1)																																								SO:0001583	missense	0			AF447176	CCDS4884.1, CCDS4885.1, CCDS4886.1, CCDS4887.1, CCDS59021.1	6p21.1-p12.2	2013-02-18	2013-02-18		ENSG00000112655	ENSG00000112655	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9618	protein-coding gene	gene with protein product		601890	"""PTK7 protein tyrosine kinase 7"""			7478540	Standard	NM_002821		Approved	CCK4	uc011dve.2	Q13308	OTTHUMG00000014721	ENST00000230419.4:c.2229G>T	6.37:g.43111336G>T	ENSP00000230419:p.Glu743Asp	913	A8K974|B7Z477|E9PFZ5|Q13417|Q5T650|Q6IQ54|Q8NFA5|Q8NFA6|Q8NFA7|Q8NFA8	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Immunoglobulin,pfam_Prot_kinase_dom,pfam_Ig_V-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.E743D	ENST00000230419.4	37	c.2229	CCDS4884.1	6	.	.	.	.	.	.	.	.	.	.	G	32	5.105237	0.94245	.	.	ENSG00000112655	ENST00000230419;ENST00000349241;ENST00000352931;ENST00000345201;ENST00000481273	T;T;T;T;T	0.74209	-0.73;-0.82;-0.65;-0.73;-0.75	5.79	3.98	0.46160	.	0.000000	0.85682	D	0.000000	T	0.81044	0.4741	M	0.73598	2.24	0.80722	D	1	D;D;D;D;D	0.76494	0.983;0.976;0.999;0.976;0.992	P;P;D;P;P	0.68483	0.771;0.885;0.958;0.885;0.872	T	0.81028	-0.1118	10	0.52906	T	0.07	.	13.047	0.58933	0.1161:0.0:0.8839:0.0	.	751;613;703;687;743	E9PFZ5;Q13308-3;Q13308-2;Q13308-4;Q13308	.;.;.;.;PTK7_HUMAN	D	743;613;687;703;751	ENSP00000230419:E743D;ENSP00000325462:E613D;ENSP00000326029:E687D;ENSP00000325992:E703D;ENSP00000418754:E751D	ENSP00000230418:E743D	E	+	3	2	PTK7	43219314	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.802000	0.55553	2.733000	0.93635	0.655000	0.94253	GAG	PTK7	-	NULL	ENSG00000112655		0.677	PTK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTK7	HGNC	protein_coding	OTTHUMT00000040580.2		0.00	57	0	G			43111336	+1			no_errors	ENST00000230419	ensembl	human	known	74_37	missense	8.93	51	5	SNP	1.000	T
PTPN23	25930	genome.wustl.edu	37	3	47448624	47448624	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr3:47448624C>T	ENST00000265562.4	+	10	889	c.812C>T	c.(811-813)gCa>gTa	p.A271V	PTPN23_ENST00000431726.1_Missense_Mutation_p.A145V	NM_015466.2	NP_056281.1	Q9H3S7	PTN23_HUMAN	protein tyrosine phosphatase, non-receptor type 23	271	BRO1. {ECO:0000255|PROSITE- ProRule:PRU00526}.				cilium morphogenesis (GO:0060271)|negative regulation of epithelial cell migration (GO:0010633)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of adherens junction organization (GO:1903393)|positive regulation of early endosome to late endosome transport (GO:2000643)|positive regulation of homophilic cell adhesion (GO:1903387)|protein transport (GO:0015031)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|central_nervous_system(1)|large_intestine(5)|lung(7)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	23				BRCA - Breast invasive adenocarcinoma(193;0.000271)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		CCACAGGTTGCATACTTCCAG	0.592																																																	0													72.0	64.0	67.0					3																	47448624		2203	4300	6503	SO:0001583	missense	0			AB025194	CCDS2754.1	3p21.3	2011-06-09			ENSG00000076201	ENSG00000076201		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	14406	protein-coding gene	gene with protein product		606584				11095967	Standard	NM_015466		Approved	DKFZP564F0923, KIAA1471, HD-PTP	uc003crf.1	Q9H3S7	OTTHUMG00000133520	ENST00000265562.4:c.812C>T	3.37:g.47448624C>T	ENSP00000265562:p.Ala271Val		A8K0D7|Q7KZF8|Q8N6Z5|Q9BSR5|Q9P257|Q9UG03|Q9UMZ4	Missense_Mutation	SNP	pfam_BRO1_dom,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_BRO1_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.A271V	ENST00000265562.4	37	c.812	CCDS2754.1	3	.	.	.	.	.	.	.	.	.	.	C	24.3	4.517751	0.85495	.	.	ENSG00000076201	ENST00000456408;ENST00000265562	T	0.26518	1.73	5.37	4.3	0.51218	BRO1 domain (3);	0.121926	0.53938	D	0.000051	T	0.33527	0.0866	M	0.63169	1.94	0.80722	D	1	D;P	0.58620	0.983;0.874	P;B	0.49637	0.617;0.121	T	0.07102	-1.0790	10	0.54805	T	0.06	-21.6736	10.7757	0.46348	0.0:0.8539:0.0:0.1461	.	145;271	B4DST5;Q9H3S7	.;PTN23_HUMAN	V	236;271	ENSP00000265562:A271V	ENSP00000265562:A271V	A	+	2	0	PTPN23	47423628	1.000000	0.71417	0.985000	0.45067	0.739000	0.42172	4.494000	0.60347	2.504000	0.84457	0.561000	0.74099	GCA	PTPN23	-	pfam_BRO1_dom,pfscan_BRO1_dom	ENSG00000076201		0.592	PTPN23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN23	HGNC	protein_coding	OTTHUMT00000257492.2	-	0.00	42	0	C	NM_015466		47448624	+1	tier1	-	no_errors	ENST00000265562	ensembl	human	known	74_37	missense	7.84	47	4	SNP	0.961	T
PTPRH	5794	genome.wustl.edu	37	19	55716838	55716838	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr19:55716838C>A	ENST00000376350.3	-	4	497	c.475G>T	c.(475-477)Gat>Tat	p.D159Y	PTPRH_ENST00000263434.5_Intron|PTPRH_ENST00000588559.1_5'UTR	NM_002842.3	NP_002833.3	Q9HD43	PTPRH_HUMAN	protein tyrosine phosphatase, receptor type, H	159	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				apoptotic process (GO:0006915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(8)|lung(27)|ovary(2)|prostate(5)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	67		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0479)		CTGCCACCATCTCCAGTGTAC	0.582																																																	0													141.0	123.0	129.0					19																	55716838		2203	4298	6501	SO:0001583	missense	0				CCDS33110.1, CCDS54321.1	19q13.4	2013-02-11				ENSG00000080031		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9672	protein-coding gene	gene with protein product		602510				8294459	Standard	XM_006723312		Approved	SAP-1	uc002qjq.3	Q9HD43		ENST00000376350.3:c.475G>T	19.37:g.55716838C>A	ENSP00000365528:p.Asp159Tyr		C9JCH2|Q15426|Q2NKN9|Q2NKP0	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.D159Y	ENST00000376350.3	37	c.475	CCDS33110.1	19	.	.	.	.	.	.	.	.	.	.	C	13.93	2.385150	0.42308	.	.	ENSG00000080031	ENST00000376350	T	0.58210	0.35	3.93	-2.98	0.05513	Fibronectin, type III (4);Immunoglobulin-like fold (1);	2.656150	0.02025	N	0.048131	T	0.63474	0.2514	M	0.68317	2.08	0.09310	N	1	D	0.61080	0.989	P	0.60789	0.879	T	0.55464	-0.8137	10	0.59425	D	0.04	.	3.9467	0.09352	0.1554:0.2884:0.4573:0.0989	.	159	Q9HD43	PTPRH_HUMAN	Y	159	ENSP00000365528:D159Y	ENSP00000365528:D159Y	D	-	1	0	PTPRH	60408650	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-1.279000	0.02807	-0.527000	0.06374	0.430000	0.28490	GAT	PTPRH	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000080031		0.582	PTPRH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRH	HGNC	protein_coding	OTTHUMT00000452649.1	-	0.00	164	0	C			55716838	-1	tier1	-	no_errors	ENST00000376350	ensembl	human	known	74_37	missense	17.39	95	20	SNP	0.000	A
PTRF	284119	genome.wustl.edu	37	17	40557038	40557038	+	Silent	SNP	G	G	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr17:40557038G>A	ENST00000357037.5	-	2	1259	c.840C>T	c.(838-840)cgC>cgT	p.R280R		NM_012232.5	NP_036364.2			polymerase I and transcript release factor											breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|urinary_tract(1)	17		all_cancers(22;0.00146)|Breast(137;0.00116)|all_epithelial(22;0.0134)		BRCA - Breast invasive adenocarcinoma(366;0.193)		CGGGCACCAGGCGCGTGCCCA	0.637																																																	0													97.0	86.0	89.0					17																	40557038		2203	4300	6503	SO:0001819	synonymous_variant	0			AF000421	CCDS11425.1	17q21.31	2011-04-20				ENSG00000177469			9688	protein-coding gene	gene with protein product		603198				9582279	Standard	NM_012232		Approved	cavin-1, CAVIN1	uc002hzo.3	Q6NZI2		ENST00000357037.5:c.840C>T	17.37:g.40557038G>A				Silent	SNP	NULL	p.R280	ENST00000357037.5	37	c.840	CCDS11425.1	17																																																																																			PTRF	-	NULL	ENSG00000177469		0.637	PTRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTRF	HGNC	protein_coding	OTTHUMT00000449938.1	-	0.00	45	0	G	NM_012232		40557038	-1	tier1	-	no_errors	ENST00000357037	ensembl	human	known	74_37	silent	22.22	42	12	SNP	1.000	A
RAB3C	115827	genome.wustl.edu	37	5	58147162	58147162	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr5:58147162C>A	ENST00000282878.4	+	5	837	c.668C>A	c.(667-669)cCc>cAc	p.P223H	CTD-2176I21.2_ENST00000510198.1_RNA	NM_138453.2	NP_612462.1	Q96E17	RAB3C_HUMAN	RAB3C, member RAS oncogene family	223					antigen processing and presentation (GO:0019882)|GTP catabolic process (GO:0006184)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|vesicle (GO:0031982)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(6)|ovary(1)	21		all_cancers(5;9.93e-10)|all_epithelial(5;1.49e-10)|all_lung(5;8.97e-05)|Lung NSC(5;0.000139)|Prostate(74;0.0664)		OV - Ovarian serous cystadenocarcinoma(10;1.8e-34)		CCACCGCAGCCCAACTGTGCC	0.507																																																	0													89.0	77.0	81.0					5																	58147162		2203	4300	6503	SO:0001583	missense	0			AY026936	CCDS3976.1	5q13	2008-02-05			ENSG00000152932	ENSG00000152932		"""RAB, member RAS oncogene"""	30269	protein-coding gene	gene with protein product		612829				12296628	Standard	NM_138453		Approved		uc003jrp.3	Q96E17	OTTHUMG00000097053	ENST00000282878.4:c.668C>A	5.37:g.58147162C>A	ENSP00000282878:p.Pro223His			Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_SRP_receptor_beta_su,pfam_Gtr1_RagA,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.P223H	ENST00000282878.4	37	c.668	CCDS3976.1	5	.	.	.	.	.	.	.	.	.	.	C	17.23	3.336551	0.60963	.	.	ENSG00000152932	ENST00000282878	T	0.63913	-0.07	5.75	5.75	0.90469	.	0.246616	0.21356	N	0.075896	T	0.54013	0.1832	N	0.22421	0.69	0.51482	D	0.999923	B	0.29162	0.235	B	0.29598	0.104	T	0.54337	-0.8309	10	0.66056	D	0.02	-9.784	19.9522	0.97203	0.0:1.0:0.0:0.0	.	223	Q96E17	RAB3C_HUMAN	H	223	ENSP00000282878:P223H	ENSP00000282878:P223H	P	+	2	0	RAB3C	58182919	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	4.582000	0.60957	2.725000	0.93324	0.655000	0.94253	CCC	RAB3C	-	superfamily_P-loop_NTPase,smart_Ran_GTPase	ENSG00000152932		0.507	RAB3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB3C	HGNC	protein_coding	OTTHUMT00000214156.2	-	0.00	67	0	C	NM_138453		58147162	+1	tier1	-	no_errors	ENST00000282878	ensembl	human	known	74_37	missense	30.19	37	16	SNP	1.000	A
RAP2B	5912	genome.wustl.edu	37	3	152881013	152881013	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr3:152881013C>G	ENST00000323534.2	+	1	985	c.531C>G	c.(529-531)tgC>tgG	p.C177W	RP11-529G21.2_ENST00000487827.1_RNA	NM_002886.2	NP_002877.2	P61225	RAP2B_HUMAN	RAP2B, member of RAS oncogene family	177					GTP catabolic process (GO:0006184)|negative regulation of cell migration (GO:0030336)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|positive regulation of protein autophosphorylation (GO:0031954)|Rap protein signal transduction (GO:0032486)|regulation of protein tyrosine kinase activity (GO:0061097)|signal transduction (GO:0007165)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)	GDP binding (GO:0019003)|GTP binding (GO:0005525)			NS(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)	7			LUSC - Lung squamous cell carcinoma(72;0.0628)|Lung(72;0.11)			AGGGCTGCTGCTCGGCCTGCG	0.602																																																	0													10.0	8.0	9.0					3																	152881013		2167	4252	6419	SO:0001583	missense	0				CCDS3170.1	3q25.2	2014-05-09			ENSG00000181467	ENSG00000181467			9862	protein-coding gene	gene with protein product	"""Ras-related protein RAP-2B"", ""small GTP binding protein"", ""Ras family small GTP binding protein RAP2B"""	179541				2118648	Standard	NM_002886		Approved		uc003ezr.3	P61225	OTTHUMG00000159655	ENST00000323534.2:c.531C>G	3.37:g.152881013C>G	ENSP00000319096:p.Cys177Trp		P17964|Q96EG5|Q9CXG0	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.C177W	ENST00000323534.2	37	c.531	CCDS3170.1	3	.	.	.	.	.	.	.	.	.	.	C	18.47	3.631470	0.67015	.	.	ENSG00000181467	ENST00000323534	T	0.65364	-0.15	4.78	4.78	0.61160	.	0.175497	0.40554	U	0.001076	T	0.69628	0.3132	L	0.29908	0.895	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.71364	-0.4615	10	0.46703	T	0.11	.	16.4283	0.83832	0.0:1.0:0.0:0.0	.	177	P61225	RAP2B_HUMAN	W	177	ENSP00000319096:C177W	ENSP00000319096:C177W	C	+	3	2	RAP2B	154363703	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	0.882000	0.28186	2.209000	0.71365	0.563000	0.77884	TGC	RAP2B	-	superfamily_P-loop_NTPase	ENSG00000181467		0.602	RAP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAP2B	HGNC	protein_coding	OTTHUMT00000356707.1		0.00	23	0	C	NM_002886		152881013	+1			no_errors	ENST00000323534	ensembl	human	known	74_37	missense	9.09	19	2	SNP	1.000	G
RERGL	79785	genome.wustl.edu	37	12	18238585	18238585	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr12:18238585A>G	ENST00000229002.2	-	4	361	c.155T>C	c.(154-156)cTa>cCa	p.L52P	RERGL_ENST00000536890.1_Missense_Mutation_p.L51P|RERGL_ENST00000541632.1_5'UTR|RERGL_ENST00000538724.1_Missense_Mutation_p.L51P	NM_024730.2	NP_079006.1	Q9H628	RERGL_HUMAN	RERG/RAS-like	52	Small GTPase-like.				GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)	GTP binding (GO:0005525)	p.L52R(2)		endometrium(1)|large_intestine(5)|lung(8)|prostate(1)|skin(1)|urinary_tract(1)	17						TTCTAGATTTAGTTGTTTCCT	0.279																																																	2	Substitution - Missense(2)	large_intestine(2)											109.0	111.0	110.0					12																	18238585		2202	4297	6499	SO:0001583	missense	0			AK026308	CCDS8679.1, CCDS66332.1	12p12.3	2014-08-12			ENSG00000111404	ENSG00000111404			26213	protein-coding gene	gene with protein product						24127187	Standard	NM_001286201		Approved	FLJ22655	uc001rdq.3	Q9H628	OTTHUMG00000168820	ENST00000229002.2:c.155T>C	12.37:g.18238585A>G	ENSP00000229002:p.Leu52Pro			Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type	p.L52P	ENST00000229002.2	37	c.155	CCDS8679.1	12	.	.	.	.	.	.	.	.	.	.	A	15.06	2.720183	0.48728	.	.	ENSG00000111404	ENST00000229002;ENST00000538724;ENST00000536890	T;T;T	0.78246	-1.16;-1.16;-1.16	3.9	3.9	0.45041	.	0.181088	0.37483	N	0.002076	D	0.87688	0.6240	M	0.85777	2.775	0.80722	D	1	D;D	0.76494	0.96;0.999	P;D	0.72338	0.891;0.977	D	0.89269	0.3603	10	0.66056	D	0.02	.	12.3173	0.54964	1.0:0.0:0.0:0.0	.	51;52	F5H686;Q9H628	.;RERGL_HUMAN	P	52;51;51	ENSP00000229002:L52P;ENSP00000437814:L51P;ENSP00000437490:L51P	ENSP00000229002:L52P	L	-	2	0	RERGL	18129852	1.000000	0.71417	0.679000	0.29978	0.513000	0.34164	5.320000	0.65841	1.986000	0.57962	0.455000	0.32223	CTA	RERGL	-	pfam_Small_GTPase,pfam_MIRO-like,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type	ENSG00000111404		0.279	RERGL-001	KNOWN	basic|CCDS	protein_coding	RERGL	HGNC	protein_coding	OTTHUMT00000401198.1		0.00	22	0	A	NM_024730		18238585	-1			no_errors	ENST00000229002	ensembl	human	known	74_37	missense	5.13	37	2	SNP	0.977	G
RBM19	9904	genome.wustl.edu	37	12	114362504	114362504	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr12:114362504G>T	ENST00000545145.2	-	18	2381	c.2303C>A	c.(2302-2304)gCa>gAa	p.A768E	RBM19_ENST00000392561.3_Missense_Mutation_p.A768E|RBM19_ENST00000261741.5_Missense_Mutation_p.A768E	NM_001146699.1	NP_001140171.1	Q9Y4C8	RBM19_HUMAN	RNA binding motif protein 19	768	RRM 5. {ECO:0000255|PROSITE- ProRule:PRU00176}.				multicellular organismal development (GO:0007275)|positive regulation of embryonic development (GO:0040019)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(4)	55	Medulloblastoma(191;0.163)|all_neural(191;0.178)					CGGAATACCTGCTTTGTTCTT	0.448																																																	0													196.0	190.0	192.0					12																	114362504		2203	4300	6503	SO:0001583	missense	0			AL117547	CCDS9172.1	12q24.21	2013-02-12				ENSG00000122965		"""RNA binding motif (RRM) containing"""	29098	protein-coding gene	gene with protein product						9734811, 11230166	Standard	NM_016196		Approved	DKFZp586F1023, KIAA0682	uc009zwi.2	Q9Y4C8	OTTHUMG00000169646	ENST00000545145.2:c.2303C>A	12.37:g.114362504G>T	ENSP00000442053:p.Ala768Glu		A8K5X9|Q9BPY6|Q9UFN5	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,smart_RRM_dom_euk,pfscan_RRM_dom	p.A768E	ENST00000545145.2	37	c.2303	CCDS9172.1	12	.	.	.	.	.	.	.	.	.	.	G	10.06	1.245892	0.22796	.	.	ENSG00000122965	ENST00000545145;ENST00000392561;ENST00000261741	T;T;T	0.73789	-0.78;-0.78;-0.78	5.74	5.74	0.90152	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.433327	0.25205	N	0.032351	T	0.61874	0.2382	N	0.17631	0.505	0.58432	D	0.999996	B	0.10296	0.003	B	0.21151	0.033	T	0.55761	-0.8090	10	0.17832	T	0.49	-17.5064	16.6331	0.85039	0.0:0.0:1.0:0.0	.	768	Q9Y4C8	RBM19_HUMAN	E	768	ENSP00000442053:A768E;ENSP00000376344:A768E;ENSP00000261741:A768E	ENSP00000261741:A768E	A	-	2	0	RBM19	112846887	1.000000	0.71417	1.000000	0.80357	0.144000	0.21451	5.788000	0.69020	2.713000	0.92767	0.655000	0.94253	GCA	RBM19	-	pfam_RRM_dom,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom	ENSG00000122965		0.448	RBM19-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	RBM19	HGNC	protein_coding	OTTHUMT00000405251.1	-	0.00	47	0	G	NM_016196		114362504	-1	tier1	-	no_errors	ENST00000261741	ensembl	human	known	74_37	missense	5.41	70	4	SNP	1.000	T
RFC4	5984	genome.wustl.edu	37	3	186507806	186507806	+	Silent	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr3:186507806G>T	ENST00000392481.2	-	11	1325	c.1044C>A	c.(1042-1044)ctC>ctA	p.L348L	RFC4_ENST00000433496.1_Silent_p.L321L|RFC4_ENST00000296273.2_Silent_p.L348L|SNORA4_ENST00000584302.1_RNA|SNORA63_ENST00000363450.1_RNA	NM_181573.2	NP_853551.1	P35249	RFC4_HUMAN	replication factor C (activator 1) 4, 37kDa	348					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	DNA replication factor C complex (GO:0005663)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			breast(3)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	26	all_cancers(143;2.92e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)	GBM - Glioblastoma multiforme(93;0.0739)		AAAGGCTGATGAGTTGCAAAT	0.358																																																	0													88.0	84.0	85.0					3																	186507806		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS3283.1	3q27	2010-04-21	2002-08-29		ENSG00000163918	ENSG00000163918		"""ATPases / AAA-type"""	9972	protein-coding gene	gene with protein product	"""A1 37 kDa subunit"", ""activator 1 37 kDa subunit"", ""RFC 37 kDa subunit"""	102577	"""replication factor C (activator 1) 4 (37kD)"""			7774928	Standard	NM_181573		Approved	A1, RFC37	uc003fqz.3	P35249	OTTHUMG00000156515	ENST00000392481.2:c.1044C>A	3.37:g.186507806G>T			B4DM41|D3DNV2|Q6FHX7	Silent	SNP	pfam_Rep_factorC_C_dom,pfam_ATPase_AAA_core,superfamily_P-loop_NTPase,superfamily_DNA_pol3_clamp-load_cplx_C,smart_AAA+_ATPase	p.L348	ENST00000392481.2	37	c.1044	CCDS3283.1	3																																																																																			RFC4	-	pfam_Rep_factorC_C_dom,superfamily_DNA_pol3_clamp-load_cplx_C	ENSG00000163918		0.358	RFC4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	RFC4	HGNC	protein_coding	OTTHUMT00000344471.1		0.00	15	0	G	NM_002916		186507806	-1			no_errors	ENST00000296273	ensembl	human	known	74_37	silent	5.00	38	2	SNP	0.455	T
ACSBG2	81616	genome.wustl.edu	37	19	6190785	6190785	+	Intron	SNP	G	G	C			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr19:6190785G>C	ENST00000586696.1	+	14	2312				ACSBG2_ENST00000591403.1_Intron|ACSBG2_ENST00000252669.5_Intron|ACSBG2_ENST00000588304.1_Intron|RFX2_ENST00000587700.1_5'UTR|ACSBG2_ENST00000588485.1_Intron|ACSBG2_ENST00000591741.1_Intron			Q5FVE4	ACBG2_HUMAN	acyl-CoA synthetase bubblegum family member 2						cell differentiation (GO:0030154)|fatty acid metabolic process (GO:0006631)|long-chain fatty acid metabolic process (GO:0001676)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)	acyl-CoA hydrolase activity (GO:0047617)|ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(12)|lung(3)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						GCAGATCTGTGACTGGAACTG	0.488																																																	0																																										SO:0001627	intron_variant	0				CCDS12159.1, CCDS74269.1	19p13.3	2012-10-02			ENSG00000130377	ENSG00000130377		"""Acyl-CoA synthetase family"""	24174	protein-coding gene	gene with protein product	"""bubblegum related protein"""	614363				11230166	Standard	XM_005259653		Approved	BGR, PRTD-NY3, DKFZp434K1635	uc002meh.1	Q5FVE4	OTTHUMG00000180754	ENST00000586696.1:c.1998+82G>C	19.37:g.6190785G>C			B3KSF2|Q6UWJ3|Q7Z5A0|Q8WW03|Q96M36|Q9BYZ3|Q9H0C4	RNA	SNP	-	NULL	ENST00000586696.1	37	NULL	CCDS12159.1	19																																																																																			RFX2	-	-	ENSG00000087903		0.488	ACSBG2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RFX2	HGNC	protein_coding	OTTHUMT00000452898.1	-	0.00	11	0	G	NM_030924		6190785	-1	tier1	-	no_errors	ENST00000587700	ensembl	human	known	74_37	rna	41.67	7	5	SNP	0.000	C
RGAG4	340526	genome.wustl.edu	37	X	71350086	71350086	+	Silent	SNP	T	T	C			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chrX:71350086T>C	ENST00000545866.1	-	1	1672	c.1305A>G	c.(1303-1305)gaA>gaG	p.E435E	RGAG4_ENST00000609883.1_Silent_p.E435E|NHSL2_ENST00000540800.1_Intron	NM_001024455.3	NP_001019626.1	Q5HYW3	RGAG4_HUMAN	retrotransposon gag domain containing 4	435										cervix(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(8)|ovary(3)|skin(1)	24	Renal(35;0.156)					GTGGCTCTCCTTCTGGTTTCT	0.522																																																	0													214.0	215.0	215.0					X																	71350086		2141	4230	6371	SO:0001819	synonymous_variant	0			AB082532	CCDS55446.1	Xq13.1	2008-02-05			ENSG00000242732	ENSG00000242732			29430	protein-coding gene	gene with protein product						12056414, 15716091, 16093683	Standard	NM_001024455		Approved	KIAA2001, Mar5, Mart5	uc004eaj.2	Q5HYW3	OTTHUMG00000021808	ENST00000545866.1:c.1305A>G	X.37:g.71350086T>C			A7E2W7|Q8NCM4|Q9NPX1	Silent	SNP	pfam_Retrotrans_gag_dom	p.E435	ENST00000545866.1	37	c.1305	CCDS55446.1	X																																																																																			RGAG4	-	NULL	ENSG00000242732		0.522	RGAG4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	RGAG4	HGNC	protein_coding	OTTHUMT00000057171.1	-	0.00	26	0	T	NM_001024455		71350086	-1	tier1	-	no_errors	ENST00000479991	ensembl	human	known	74_37	silent	90.20	5	46	SNP	0.000	C
RICTOR	253260	genome.wustl.edu	37	5	38991089	38991089	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr5:38991089C>A	ENST00000357387.3	-	7	575	c.545G>T	c.(544-546)aGa>aTa	p.R182I	RICTOR_ENST00000296782.5_Missense_Mutation_p.R182I	NM_152756.3	NP_689969.2			RPTOR independent companion of MTOR, complex 2											NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|prostate(3)|skin(5)	75	all_lung(31;0.000396)					TCGGACCATTCTGTCTCTTTC	0.348																																																	0													105.0	93.0	97.0					5																	38991089		2203	4299	6502	SO:0001583	missense	0				CCDS34148.1, CCDS68861.1	5p13.1	2009-07-09			ENSG00000164327	ENSG00000164327			28611	protein-coding gene	gene with protein product	"""rapamycin-insensitive companion of mTOR"", ""pianissimo"""	609022				12477932	Standard	XM_005248278		Approved	MGC39830, AVO3, PIA, KIAA1999	uc003jlp.2	Q6R327	OTTHUMG00000162037	ENST00000357387.3:c.545G>T	5.37:g.38991089C>A	ENSP00000349959:p.Arg182Ile			Missense_Mutation	SNP	superfamily_ARM-type_fold	p.R182I	ENST00000357387.3	37	c.545	CCDS34148.1	5	.	.	.	.	.	.	.	.	.	.	C	32	5.123160	0.94429	.	.	ENSG00000164327	ENST00000357387;ENST00000296782;ENST00000514735	T;T;T	0.63744	-0.06;-0.06;-0.06	5.17	5.17	0.71159	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.80571	0.4648	M	0.78456	2.415	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;0.998;0.997	D;D;D;D	0.91635	0.996;0.999;0.979;0.994	T	0.83273	-0.0042	10	0.87932	D	0	-17.057	18.6644	0.91483	0.0:1.0:0.0:0.0	.	182;182;182;182	Q8N6M7;E7ETT0;Q6R327;Q6R327-3	.;.;RICTR_HUMAN;.	I	182;182;166	ENSP00000349959:R182I;ENSP00000296782:R182I;ENSP00000423162:R166I	ENSP00000296782:R182I	R	-	2	0	RICTOR	39026846	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.731000	0.68554	2.394000	0.81467	0.591000	0.81541	AGA	RICTOR	-	superfamily_ARM-type_fold	ENSG00000164327		0.348	RICTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RICTOR	HGNC	protein_coding	OTTHUMT00000366985.1	-	0.00	88	0	C	NM_152756		38991089	-1	tier1	-	no_errors	ENST00000296782	ensembl	human	known	74_37	missense	49.30	36	35	SNP	1.000	A
RIMS4	140730	genome.wustl.edu	37	20	43386383	43386383	+	Missense_Mutation	SNP	T	T	G			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr20:43386383T>G	ENST00000372851.3	-	4	445	c.379A>C	c.(379-381)Aac>Cac	p.N127H	RIMS4_ENST00000541604.2_Missense_Mutation_p.N128H	NM_001205317.1|NM_182970.3	NP_001192246.1|NP_892015.1	Q9H426	RIMS4_HUMAN	regulating synaptic membrane exocytosis 4	127	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				exocytosis (GO:0006887)|neurotransmitter transport (GO:0006836)|regulation of membrane potential (GO:0042391)	cell junction (GO:0030054)|presynaptic active zone (GO:0048786)|synaptic membrane (GO:0097060)				central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(11)|ovary(5)|urinary_tract(1)	29		Myeloproliferative disorder(115;0.0122)				AACTGACCGTTCCGCTCCTGC	0.577																																																	0													124.0	99.0	107.0					20																	43386383		2203	4300	6503	SO:0001583	missense	0				CCDS13338.1, CCDS56191.1	20q13.12	2005-02-03	2003-06-18	2003-06-20	ENSG00000101098	ENSG00000101098			16183	protein-coding gene	gene with protein product		611601	"""chromosome 20 open reading frame 190"""	C20orf190		12620390	Standard	NM_182970		Approved	dJ781B1.3	uc010ggu.3	Q9H426	OTTHUMG00000032546	ENST00000372851.3:c.379A>C	20.37:g.43386383T>G	ENSP00000361942:p.Asn127His		A4FU94|E1P613|Q3MI44|Q5JWT7	Missense_Mutation	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.N128H	ENST00000372851.3	37	c.382	CCDS13338.1	20	.	.	.	.	.	.	.	.	.	.	T	21.0	4.088333	0.76756	.	.	ENSG00000101098	ENST00000372851;ENST00000541604	T;T	0.79033	-1.23;-1.23	5.91	5.91	0.95273	C2 calcium/lipid-binding domain, CaLB (1);	0.042950	0.85682	D	0.000000	T	0.78916	0.4359	L	0.55990	1.75	0.58432	D	0.999998	P;P	0.38167	0.621;0.621	B;B	0.42882	0.401;0.308	T	0.80856	-0.1195	10	0.87932	D	0	.	16.3453	0.83126	0.0:0.0:0.0:1.0	.	128;127	E1P613;Q9H426	.;RIMS4_HUMAN	H	127;128	ENSP00000361942:N127H;ENSP00000439287:N128H	ENSP00000361942:N127H	N	-	1	0	RIMS4	42819797	1.000000	0.71417	0.996000	0.52242	0.640000	0.38277	8.040000	0.89188	2.261000	0.74972	0.533000	0.62120	AAC	RIMS4	-	superfamily_C2_dom	ENSG00000101098		0.577	RIMS4-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	RIMS4	HGNC	protein_coding	OTTHUMT00000101027.2	-	0.00	36	0	T	NM_182970		43386383	-1	tier1	-	no_errors	ENST00000541604	ensembl	human	known	74_37	missense	38.46	24	15	SNP	1.000	G
RPL30	6156	genome.wustl.edu	37	8	99054886	99054886	+	Frame_Shift_Del	DEL	A	A	-			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr8:99054886delA	ENST00000521291.1	-	3	431	c.285delT	c.(283-285)gctfs	p.A95fs	KB-1208A12.3_ENST00000501016.2_RNA|RPL30_ENST00000523172.1_Frame_Shift_Del_p.A31fs|SNORA72_ENST00000384339.1_RNA|RPL30_ENST00000518164.1_Intron|RPL30_ENST00000287038.3_Frame_Shift_Del_p.A95fs|RPL30_ENST00000396070.2_Frame_Shift_Del_p.A76fs			P62888	RL30_HUMAN	ribosomal protein L30	95					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			kidney(2)|lung(4)|skin(1)	7	Breast(36;1.43e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.192)			GATCAATGATAGCCAGTGTGC	0.368																																																	0													93.0	84.0	87.0					8																	99054886		2203	4300	6503	SO:0001589	frameshift_variant	0				CCDS34928.1	8q22	2013-05-09			ENSG00000156482	ENSG00000156482		"""L ribosomal proteins"""	10333	protein-coding gene	gene with protein product		180467				1577483	Standard	NM_000989		Approved	L30	uc003yif.3	P62888	OTTHUMG00000164796	ENST00000521291.1:c.285delT	8.37:g.99054886delA	ENSP00000428085:p.Ala95fs		B2R591|P04645|Q502Z6	Frame_Shift_Del	DEL	pfam_Ribosomal_L7Ae/L30e/S12e/Gad45	p.I96fs	ENST00000521291.1	37	c.285	CCDS34928.1	8																																																																																			RPL30	-	pfam_Ribosomal_L7Ae/L30e/S12e/Gad45	ENSG00000156482		0.368	RPL30-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RPL30	HGNC	protein_coding	OTTHUMT00000380450.1		0.00	55	0	A			99054886	-1	tier1		no_errors	ENST00000287038	ensembl	human	known	74_37	frame_shift_del	24.39	31	10	DEL	0.998	-
RPN1	6184	genome.wustl.edu	37	3	128341048	128341048	+	Nonsense_Mutation	SNP	G	G	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr3:128341048G>A	ENST00000296255.3	-	9	1648	c.1600C>T	c.(1600-1602)Cag>Tag	p.Q534*	RPN1_ENST00000497289.1_Nonsense_Mutation_p.Q362*	NM_002950.3	NP_002941.1	P04843	RPN1_HUMAN	ribophorin I	534					cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|gene expression (GO:0010467)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|oligosaccharyltransferase complex (GO:0008250)|rough endoplasmic reticulum (GO:0005791)	dolichyl-diphosphooligosaccharide-protein glycotransferase activity (GO:0004579)|poly(A) RNA binding (GO:0044822)			NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(2)|ovary(2)|stomach(2)	13				GBM - Glioblastoma multiforme(114;0.189)		AGCCTGGACTGCAGCAGTGCA	0.557			T	EVI1	AML																																			Dom	yes		3	3q21.3-q25.2	6184	ribophorin I		L	0													147.0	115.0	126.0					3																	128341048		2203	4300	6503	SO:0001587	stop_gained	0				CCDS3051.1	3q21.3	2013-03-06			ENSG00000163902	ENSG00000163902			10381	protein-coding gene	gene with protein product	"""oligosaccharyltransferase 1 homolog (S. cerevisiae)"", ""oligosaccharyltransferase complex subunit (non-catalytic)"""	180470					Standard	NM_002950		Approved	OST1	uc003ekr.1	P04843	OTTHUMG00000159691	ENST00000296255.3:c.1600C>T	3.37:g.128341048G>A	ENSP00000296255:p.Gln534*		B2R5Z0|D3DNB6|Q68DT1	Nonsense_Mutation	SNP	pfam_Ribophorin_I	p.Q534*	ENST00000296255.3	37	c.1600	CCDS3051.1	3	.	.	.	.	.	.	.	.	.	.	G	38	6.870622	0.97901	.	.	ENSG00000163902	ENST00000296255;ENST00000497289;ENST00000537139;ENST00000545956	.	.	.	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05959	T	0.93	-9.839	19.2668	0.93990	0.0:0.0:1.0:0.0	.	.	.	.	X	534;362;305;508	.	ENSP00000296255:Q534X	Q	-	1	0	RPN1	129823738	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.338000	0.96553	2.547000	0.85894	0.591000	0.81541	CAG	RPN1	-	NULL	ENSG00000163902		0.557	RPN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPN1	HGNC	protein_coding	OTTHUMT00000356934.2	-	0.00	45	0	G	NM_002950		128341048	-1	tier1	-	no_errors	ENST00000296255	ensembl	human	known	74_37	nonsense	9.76	37	4	SNP	1.000	A
RTEL1	51750	genome.wustl.edu	37	20	62292822	62292824	+	In_Frame_Del	DEL	GCT	GCT	-			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	GCT	GCT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr20:62292822_62292824delGCT	ENST00000360203.5	+	3	599_601	c.274_276delGCT	c.(274-276)gctdel	p.A96del	RTEL1-TNFRSF6B_ENST00000482936.1_In_Frame_Del_p.A96del|RTEL1_ENST00000508582.2_In_Frame_Del_p.A96del|RTEL1_ENST00000318100.4_In_Frame_Del_p.A96del|RTEL1_ENST00000370018.3_In_Frame_Del_p.A96del|RTEL1_ENST00000488316.1_3'UTR					regulator of telomere elongation helicase 1											NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_cancers(38;6.47e-12)|all_epithelial(29;3.75e-13)		Epithelial(9;1.25e-09)|all cancers(9;5.13e-09)|BRCA - Breast invasive adenocarcinoma(10;7.26e-05)|OV - Ovarian serous cystadenocarcinoma(5;0.00223)|Colorectal(105;0.107)			CTGGGGCAACGCTGCTGCTGCTG	0.645																																																	0																																										SO:0001651	inframe_deletion	0			AB029011	CCDS13530.2, CCDS13531.1, CCDS13530.3, CCDS63331.1, CCDS74751.1	20q13.3	2012-06-27	2004-10-29	2004-10-29	ENSG00000258366	ENSG00000258366			15888	protein-coding gene	gene with protein product		608833	"""chromosome 20 open reading frame 41"""	C20orf41		10655513, 15210109	Standard	NM_016434		Approved	bK3184A7.3, NHL, DKFZP434C013, KIAA1088, RTEL	uc011abd.2	Q9NZ71	OTTHUMG00000032992	ENST00000360203.5:c.274_276delGCT	20.37:g.62292831_62292833delGCT	ENSP00000353332:p.Ala96del			In_Frame_Del	DEL	pfam_DEAD_2,superfamily_P-loop_NTPase,smart_Helicase-like_DEXD_c2,smart_ATP-dep_Helicase_C,pfscan_Helic_SF1/SF2_ATP-bd_DinG/Rad3,tigrfam_DNA_helicase_DNA-repair_Rad3	p.A95in_frame_del	ENST00000360203.5	37	c.274_276		20																																																																																			RTEL1	-	superfamily_P-loop_NTPase,smart_Helicase-like_DEXD_c2,pfscan_Helic_SF1/SF2_ATP-bd_DinG/Rad3	ENSG00000258366		0.645	RTEL1-011	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	RTEL1	HGNC	protein_coding	OTTHUMT00000289781.1		0.00	20	0	GCT	NM_032957		62292824	+1	tier1		no_errors	ENST00000318100	ensembl	human	known	74_37	in_frame_del	10.71	25	3	DEL	0.006:0.021:0.035	-
SCEL	8796	genome.wustl.edu	37	13	78211301	78211301	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr13:78211301A>G	ENST00000349847.3	+	30	1894	c.1810A>G	c.(1810-1812)Ata>Gta	p.I604V	SCEL_ENST00000377246.3_Missense_Mutation_p.I584V|SCEL_ENST00000535157.1_Missense_Mutation_p.I562V	NM_144777.2	NP_659001.2	O95171	SCEL_HUMAN	sciellin	604					embryo development (GO:0009790)|epidermis development (GO:0008544)|keratinocyte differentiation (GO:0030216)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(18)|ovary(5)|prostate(1)|stomach(1)|urinary_tract(1)	40		Acute lymphoblastic leukemia(28;0.0282)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0233)		TGGAAAATACATACAAACTGT	0.313																																																	0													104.0	97.0	99.0					13																	78211301		2203	4297	6500	SO:0001583	missense	0			AF045941	CCDS9458.1, CCDS9459.1, CCDS53877.1	13q22	2008-07-18			ENSG00000136155	ENSG00000136155			10573	protein-coding gene	gene with protein product		604112				9813070	Standard	NM_003843		Approved	FLJ21667, MGC22531	uc001vki.3	O95171	OTTHUMG00000017107	ENST00000349847.3:c.1810A>G	13.37:g.78211301A>G	ENSP00000302579:p.Ile604Val		B7Z797|F5H651|Q53H61|Q5W0S8|Q5W0S9|Q86X00	Missense_Mutation	SNP	smart_Znf_LIM,pfscan_Znf_LIM	p.I604V	ENST00000349847.3	37	c.1810	CCDS9459.1	13	.	.	.	.	.	.	.	.	.	.	A	18.69	3.678018	0.68042	.	.	ENSG00000136155	ENST00000535157;ENST00000377246;ENST00000349847	T;T;T	0.81163	-1.46;-1.46;-1.46	5.93	5.93	0.95920	.	0.000000	0.64402	D	0.000005	D	0.88366	0.6417	M	0.72118	2.19	0.29876	N	0.826404	D;D;D	0.69078	0.994;0.997;0.996	D;D;D	0.79784	0.954;0.993;0.969	D	0.85714	0.1321	10	0.45353	T	0.12	-19.8417	14.3286	0.66537	1.0:0.0:0.0:0.0	.	562;584;604	F5H651;O95171-2;O95171	.;.;SCEL_HUMAN	V	562;584;604	ENSP00000437895:I562V;ENSP00000366454:I584V;ENSP00000302579:I604V	ENSP00000302579:I604V	I	+	1	0	SCEL	77109302	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.955000	0.56715	2.263000	0.75096	0.533000	0.62120	ATA	SCEL	-	NULL	ENSG00000136155		0.313	SCEL-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCEL	HGNC	protein_coding	OTTHUMT00000045339.2	-	0.00	58	0	A	NM_144777		78211301	+1	tier1	-	no_errors	ENST00000349847	ensembl	human	known	74_37	missense	60.00	12	18	SNP	1.000	G
SCN1A	6323	genome.wustl.edu	37	2	166900494	166900494	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr2:166900494G>T	ENST00000303395.4	-	11	1727	c.1728C>A	c.(1726-1728)agC>agA	p.S576R	AC010127.3_ENST00000599041.1_RNA|AC010127.3_ENST00000595268.1_RNA|AC010127.3_ENST00000595647.1_RNA|SCN1A_ENST00000423058.2_Missense_Mutation_p.S576R|SCN1A_ENST00000409050.1_Missense_Mutation_p.S576R|SCN1A_ENST00000375405.3_Missense_Mutation_p.S576R			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	576					adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)			NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GCCCTCTAAAGCTGAAAAGGC	0.448																																																	0													94.0	92.0	92.0					2																	166900494		2203	4300	6503	SO:0001583	missense	0			AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.1728C>A	2.37:g.166900494G>T	ENSP00000303540:p.Ser576Arg		E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_a1su,prints_Na_channel_asu,prints_PKD_2	p.S576R	ENST00000303395.4	37	c.1728	CCDS54413.1	2	.	.	.	.	.	.	.	.	.	.	G	15.16	2.750124	0.49257	.	.	ENSG00000144285	ENST00000423058;ENST00000303395;ENST00000375405;ENST00000409050	D;D;D;D	0.93604	-3.25;-3.25;-3.25;-3.25	5.59	3.55	0.40652	Domain of unknown function DUF3451 (1);	0.000000	0.85682	D	0.000000	D	0.96178	0.8754	M	0.85099	2.735	0.48901	D	0.999725	D;D;B	0.76494	0.999;0.999;0.256	D;D;B	0.87578	0.996;0.998;0.212	D	0.94995	0.8138	10	0.87932	D	0	.	8.2755	0.31871	0.2683:0.0:0.7317:0.0	.	576;576;576	P35498-2;E9PG49;P35498	.;.;SCN1A_HUMAN	R	576	ENSP00000407030:S576R;ENSP00000303540:S576R;ENSP00000364554:S576R;ENSP00000386312:S576R	ENSP00000303540:S576R	S	-	3	2	SCN1A	166608740	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.742000	0.47434	0.534000	0.28695	0.561000	0.74099	AGC	SCN1A	-	pfam_DUF3451	ENSG00000144285		0.448	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	SCN1A	HGNC	protein_coding	OTTHUMT00000102661.1	-	0.00	71	0	G	NM_006920		166900494	-1	tier1	-	no_errors	ENST00000303395	ensembl	human	known	74_37	missense	6.35	59	4	SNP	1.000	T
SEC22B	9554	genome.wustl.edu	37	1	145116546	145116546	+	RNA	SNP	T	T	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr1:145116546T>A	ENST00000453618.1	+	0	1632							O75396	SC22B_HUMAN	SEC22 vesicle trafficking protein homolog B (S. cerevisiae) (gene/pseudogene)						ER to Golgi vesicle-mediated transport (GO:0006888)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)											TGAATTATATTAAGATGCCTT	0.308																																																	0																																												0			AF047442		1q21.1	2012-04-20	2010-03-12	2006-04-25	ENSG00000223380				10700	protein-coding gene	gene with protein product		604029	"""SEC22, vesicle trafficking protein (S. cerevisiae)-like 1"", ""SEC22 vesicle trafficking protein-like 1 (S. cerevisiae)"", ""SEC22 vesicle trafficking protein homolog B (S. cerevisiae)"""	SEC22L1		9094723, 16354670	Standard	NM_004892		Approved	sec22b, ERS-24	uc031poa.1	O75396	OTTHUMG00000013745		1.37:g.145116546T>A			A8K1G0	RNA	SNP	-	NULL	ENST00000453618.1	37	NULL		1																																																																																			SEC22B	-	-	ENSG00000223380		0.308	SEC22B-001	KNOWN	basic	processed_transcript	SEC22B	HGNC	processed_transcript	OTTHUMT00000038523.5	-	0.00	137	0	T	NM_004892		145116546	+1	tier1	-	no_errors	ENST00000453618	ensembl	human	known	74_37	rna	8.44	141	13	SNP	0.996	A
SEMA3D	223117	genome.wustl.edu	37	7	84685162	84685162	+	Silent	SNP	A	A	T	rs556375076		TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr7:84685162A>T	ENST00000284136.6	-	7	775	c.732T>A	c.(730-732)atT>atA	p.I244I	SEMA3D_ENST00000444867.1_Silent_p.I244I	NM_152754.2	NP_689967.2	O95025	SEM3D_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D	244	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|membrane (GO:0016020)	receptor activity (GO:0004872)			NS(1)|breast(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(19)|lung(29)|ovary(3)|pancreas(1)|prostate(4)|skin(2)	73						AGAAAGTTCCAATAAATTTTG	0.323																																					Ovarian(63;442 1191 17318 29975 31528)												0													65.0	66.0	66.0					7																	84685162		2203	4300	6503	SO:0001819	synonymous_variant	0			BC029590	CCDS34676.1	7q21.11	2013-01-11			ENSG00000153993	ENSG00000153993		"""Semaphorins"", ""Immunoglobulin superfamily / V-set domain containing"""	10726	protein-coding gene	gene with protein product		609907					Standard	NM_152754		Approved	coll-2, Sema-Z2	uc003uic.3	O95025	OTTHUMG00000154569	ENST00000284136.6:c.732T>A	7.37:g.84685162A>T			A6NK46|Q6UW77|Q8NCQ1	Silent	SNP	pfam_Semap_dom,pfam_Ig_V-set,superfamily_Semap_dom,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_Ig_sub,pfscan_Semap_dom,pfscan_Ig-like_dom	p.I244	ENST00000284136.6	37	c.732	CCDS34676.1	7																																																																																			SEMA3D	-	pfam_Semap_dom,superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom	ENSG00000153993		0.323	SEMA3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA3D	HGNC	protein_coding	OTTHUMT00000336084.2	-	0.00	117	0	A	NM_152754		84685162	-1	tier1	-	no_errors	ENST00000284136	ensembl	human	known	74_37	silent	20.69	69	18	SNP	1.000	T
SEMA5A	9037	genome.wustl.edu	37	5	9066719	9066719	+	Nonsense_Mutation	SNP	T	T	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr5:9066719T>A	ENST00000382496.5	-	17	2778	c.2113A>T	c.(2113-2115)Aag>Tag	p.K705*		NM_003966.2	NP_003957.2	Q13591	SEM5A_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A	705					axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|diencephalon development (GO:0021536)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|nervous system development (GO:0007399)|patterning of blood vessels (GO:0001569)|positive chemotaxis (GO:0050918)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of angiogenesis (GO:0045766)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein kinase B signaling (GO:0051897)|signal clustering (GO:1990256)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|chondroitin sulfate proteoglycan binding (GO:0035373)|heparan sulfate proteoglycan binding (GO:0043395)|semaphorin receptor binding (GO:0030215)|syndecan binding (GO:0045545)			biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(13)|lung(40)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	81						GTGGTCTTCTTCAGCTCAGGA	0.562																																																	0													157.0	145.0	149.0					5																	9066719		2203	4300	6503	SO:0001587	stop_gained	0			U52840	CCDS3875.1	5p15.2	2008-05-15			ENSG00000112902	ENSG00000112902		"""Semaphorins"""	10736	protein-coding gene	gene with protein product		609297		SEMAF		8817451, 9464278	Standard	NM_003966		Approved	semF	uc003jek.2	Q13591	OTTHUMG00000090501	ENST00000382496.5:c.2113A>T	5.37:g.9066719T>A	ENSP00000371936:p.Lys705*		D3DTC6|O60408|Q1RLL9	Nonsense_Mutation	SNP	pfam_Semap_dom,pfam_Thrombospondin_1_rpt,superfamily_Semap_dom,superfamily_Thrombospondin_1_rpt,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_Thrombospondin_1_rpt,pfscan_Semap_dom,pfscan_Thrombospondin_1_rpt	p.K705*	ENST00000382496.5	37	c.2113	CCDS3875.1	5	.	.	.	.	.	.	.	.	.	.	T	46	12.379717	0.99662	.	.	ENSG00000112902	ENST00000382496	.	.	.	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.0141	0.42003	0.0:0.0:0.1696:0.8304	.	.	.	.	X	705	.	ENSP00000371936:K705X	K	-	1	0	SEMA5A	9119719	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	4.691000	0.61738	2.228000	0.72767	0.482000	0.46254	AAG	SEMA5A	-	NULL	ENSG00000112902		0.562	SEMA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA5A	HGNC	protein_coding	OTTHUMT00000206989.2	-	0.00	40	0	T			9066719	-1	tier1	-	no_errors	ENST00000382496	ensembl	human	known	74_37	nonsense	58.62	23	34	SNP	1.000	A
SEPT4	5414	genome.wustl.edu	37	17	56604047	56604047	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr17:56604047G>C	ENST00000317268.3	-	2	529	c.353C>G	c.(352-354)tCt>tGt	p.S118C	RP11-112H10.4_ENST00000580769.1_RNA|SEPT4_ENST00000393086.1_Missense_Mutation_p.S99C|SEPT4_ENST00000580809.1_Intron|SEPT4_ENST00000583114.1_5'UTR|SEPT4_ENST00000580791.1_5'UTR|RP11-112H10.4_ENST00000578022.1_RNA|SEPT4_ENST00000426861.1_Missense_Mutation_p.S99C|SEPT4_ENST00000579371.1_Intron|SEPT4_ENST00000317256.6_Missense_Mutation_p.S99C|SEPT4_ENST00000412945.3_Missense_Mutation_p.S110C|SEPT4_ENST00000457347.2_Missense_Mutation_p.S133C|SEPT4_ENST00000580844.1_Intron|RP11-112H10.4_ENST00000580589.1_RNA	NM_004574.3	NP_004565.1	O43236	SEPT4_HUMAN	septin 4	118					apoptotic process (GO:0006915)|brain development (GO:0007420)|cell cycle (GO:0007049)|cell division (GO:0051301)|GTP catabolic process (GO:0006184)|positive regulation of apoptotic process (GO:0043065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of protein ubiquitination (GO:0031398)|regulation of apoptotic process (GO:0042981)|sperm capacitation (GO:0048240)|sperm mitochondrion organization (GO:0030382)	cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|sperm annulus (GO:0097227)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural molecule activity (GO:0005198)			NS(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	18	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CTCTACCTCAGAGGAATCATA	0.607																																																	0													25.0	29.0	28.0					17																	56604047		2202	4300	6502	SO:0001583	missense	0			AF073312	CCDS11609.1, CCDS11610.1, CCDS45743.1, CCDS56041.1, CCDS58581.1, CCDS58582.1	17q22	2013-01-21	2005-01-11	2005-01-12	ENSG00000108387	ENSG00000108387		"""Septins"""	9165	protein-coding gene	gene with protein product	"""bradeoin"", ""septin-M"""	603696	"""peanut-like 2 (Drosophila)"""	PNUTL2		9889007	Standard	NM_001198713		Approved	H5, CE5B3, hucep-7, ARTS, hCDCREL-2, MART	uc002iwm.2	O43236		ENST00000317268.3:c.353C>G	17.37:g.56604047G>C	ENSP00000321674:p.Ser118Cys		B2RD42|B3KSX9|B4DXC6|B4DXV5|Q6IAP3|Q9H315|Q9UM58	Missense_Mutation	SNP	pfam_Cell_div_GTP-bd,superfamily_P-loop_NTPase	p.S133C	ENST00000317268.3	37	c.398	CCDS11610.1	17	.	.	.	.	.	.	.	.	.	.	G	17.14	3.313116	0.60414	.	.	ENSG00000108387	ENST00000412945;ENST00000457347;ENST00000317256;ENST00000317268;ENST00000393086;ENST00000426861	T;T;T;T;T;T	0.66099	0.59;0.55;0.6;0.59;0.6;-0.19	5.14	5.14	0.70334	.	0.989056	0.08196	N	0.982989	T	0.61565	0.2357	L	0.27053	0.805	0.33215	D	0.553943	B;P;P;B;B	0.46220	0.377;0.874;0.837;0.143;0.088	B;P;P;B;B	0.51550	0.428;0.518;0.673;0.428;0.246	T	0.62728	-0.6793	10	0.62326	D	0.03	.	9.6893	0.40118	0.0946:0.0:0.9054:0.0	.	110;133;99;99;118	O43236-3;O43236-4;O43236-6;O43236-2;O43236	.;.;.;.;SEPT4_HUMAN	C	110;132;99;118;99;99	ENSP00000414779:S110C;ENSP00000402000:S132C;ENSP00000321071:S99C;ENSP00000321674:S118C;ENSP00000376801:S99C;ENSP00000402348:S99C	ENSP00000321071:S99C	S	-	2	0	SEPT4	53959046	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.187000	0.50950	2.409000	0.81822	0.655000	0.94253	TCT	SEPT4	-	NULL	ENSG00000108387		0.607	SEPT4-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SEPT4	HGNC	protein_coding	OTTHUMT00000445420.1	-	0.00	64	0	G	NM_080417		56604047	-1	tier1	-	no_errors	ENST00000457347	ensembl	human	known	74_37	missense	12.12	29	4	SNP	1.000	C
SERPINB12	89777	genome.wustl.edu	37	18	61231270	61231270	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr18:61231270G>T	ENST00000269491.1	+	5	562	c.562G>T	c.(562-564)Gtg>Ttg	p.V188L	SERPINB12_ENST00000382768.1_Missense_Mutation_p.V208L	NM_080474.1	NP_536722.1	Q96P63	SPB12_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 12	188					hematopoietic progenitor cell differentiation (GO:0002244)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of protein catabolic process (GO:0042177)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	enzyme binding (GO:0019899)|serine-type endopeptidase inhibitor activity (GO:0004867)			kidney(1)|large_intestine(5)|lung(19)|skin(1)	26						GCTGGTACTGGTGAATGCTGT	0.408																																																	0													226.0	193.0	204.0					18																	61231270		2203	4300	6503	SO:0001583	missense	0			AF411191	CCDS11984.1	18q21.33	2014-02-18	2005-08-18		ENSG00000166634	ENSG00000166634		"""Serine (or cysteine) peptidase inhibitors"""	14220	protein-coding gene	gene with protein product		615662	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 12"""			24172014	Standard	NM_080474		Approved	YUKOPIN	uc010xen.2	Q96P63	OTTHUMG00000132789	ENST00000269491.1:c.562G>T	18.37:g.61231270G>T	ENSP00000269491:p.Val188Leu		Q3SYB4	Missense_Mutation	SNP	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.V188L	ENST00000269491.1	37	c.562	CCDS11984.1	18	.	.	.	.	.	.	.	.	.	.	G	22.7	4.327423	0.81690	.	.	ENSG00000166634	ENST00000269491;ENST00000382768	D;D	0.86956	-2.19;-2.19	5.57	5.57	0.84162	Serpin domain (3);	0.000000	0.64402	D	0.000015	D	0.93009	0.7775	M	0.67953	2.075	0.50632	D	0.999886	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	D	0.93188	0.6580	10	0.87932	D	0	.	18.8998	0.92437	0.0:0.0:1.0:0.0	.	208;188	Q3SYB4;Q96P63	.;SPB12_HUMAN	L	188;208	ENSP00000269491:V188L;ENSP00000372218:V208L	ENSP00000269491:V188L	V	+	1	0	SERPINB12	59382250	1.000000	0.71417	1.000000	0.80357	0.350000	0.29205	7.902000	0.87389	2.791000	0.96007	0.655000	0.94253	GTG	SERPINB12	-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	ENSG00000166634		0.408	SERPINB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINB12	HGNC	protein_coding	OTTHUMT00000256197.1	-	0.00	71	0	G	NM_080474		61231270	+1	tier1	-	no_errors	ENST00000269491	ensembl	human	known	74_37	missense	5.71	66	4	SNP	1.000	T
SETD5	55209	genome.wustl.edu	37	3	9506277	9506277	+	Missense_Mutation	SNP	G	G	T	rs200142019		TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr3:9506277G>T	ENST00000406341.1	+	17	2835	c.2645G>T	c.(2644-2646)cGa>cTa	p.R882L	SETD5_ENST00000402198.1_Missense_Mutation_p.R882L|SETD5_ENST00000407969.1_Missense_Mutation_p.R901L|SETD5_ENST00000302463.6_Missense_Mutation_p.R784L|SETD5_ENST00000488236.1_3'UTR|SETD5_ENST00000402466.1_Missense_Mutation_p.R784L			Q9C0A6	SETD5_HUMAN	SET domain containing 5	882										NS(2)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(11)|ovary(3)|prostate(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.112)		GAGGAGTGTCGAAATGGATAC	0.532																																																	0													143.0	141.0	141.0					3																	9506277		2004	4182	6186	SO:0001583	missense	0			BC020956	CCDS46741.1, CCDS74892.1	3p25.3	2011-12-13			ENSG00000168137	ENSG00000168137			25566	protein-coding gene	gene with protein product		615743				11214970	Standard	XM_005265299		Approved	FLJ10707	uc003brt.3	Q9C0A6	OTTHUMG00000150491	ENST00000406341.1:c.2645G>T	3.37:g.9506277G>T	ENSP00000383939:p.Arg882Leu		Q6AI17|Q8WUB6|Q9H3X4|Q9H6V7|Q9H7S3|Q9NVI9	Missense_Mutation	SNP	pfam_SET_dom,smart_SET_dom,pfscan_SET_dom	p.R882L	ENST00000406341.1	37	c.2645	CCDS46741.1	3	.	.	.	.	.	.	.	.	.	.	G	31	5.076516	0.94000	.	.	ENSG00000168137	ENST00000402198;ENST00000402466;ENST00000406341;ENST00000407969;ENST00000302463	D;D;D;D;D	0.94576	-3.09;-3.46;-3.09;-3.07;-3.46	5.78	5.78	0.91487	.	0.113942	0.45361	D	0.000372	D	0.95825	0.8641	L	0.32530	0.975	0.53688	D	0.999978	D;D;D;D	0.89917	1.0;0.998;0.993;0.993	D;D;D;D	0.91635	0.999;0.994;0.982;0.953	D	0.96286	0.9210	10	0.87932	D	0	-9.2635	19.9991	0.97403	0.0:0.0:1.0:0.0	.	551;784;882;901	B3KXG4;Q9C0A6-3;Q9C0A6;E7EWN3	.;.;SETD5_HUMAN;.	L	882;784;882;901;784	ENSP00000385852:R882L;ENSP00000384429:R784L;ENSP00000383939:R882L;ENSP00000384114:R901L;ENSP00000302028:R784L	ENSP00000302028:R784L	R	+	2	0	SETD5	9481277	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.754000	0.68743	2.724000	0.93272	0.655000	0.94253	CGA	SETD5	-	NULL	ENSG00000168137		0.532	SETD5-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	SETD5	HGNC	protein_coding	OTTHUMT00000318425.1		0.00	85	0	G	XM_371614		9506277	+1			no_errors	ENST00000402198	ensembl	human	known	74_37	missense	5.66	50	3	SNP	1.000	T
SF3A1	10291	genome.wustl.edu	37	22	30741014	30741014	+	Nonsense_Mutation	SNP	G	G	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr22:30741014G>A	ENST00000215793.8	-	4	713	c.559C>T	c.(559-561)Cag>Tag	p.Q187*	SF3A1_ENST00000439242.1_Nonsense_Mutation_p.Q122*	NM_005877.4	NP_005868.1	Q15459	SF3A1_HUMAN	splicing factor 3a, subunit 1, 120kDa	187					gene expression (GO:0010467)|mRNA 3'-splice site recognition (GO:0000389)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U2-type spliceosomal complex (GO:0005684)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(9)|ovary(4)|pancreas(1)|prostate(1)|urinary_tract(1)	29						TGCTCTTTCTGCATCAGCTGG	0.542																																																	0													150.0	133.0	139.0					22																	30741014		2203	4300	6503	SO:0001587	stop_gained	0			X85237	CCDS13875.1	22q12.2	2014-09-17	2002-08-29		ENSG00000099995	ENSG00000099995			10765	protein-coding gene	gene with protein product		605595	"""splicing factor 3a, subunit 1, 120kD"""			7489498	Standard	NM_005877		Approved	SF3a120, SAP114, PRPF21, Prp21	uc003ahl.3	Q15459	OTTHUMG00000151005	ENST00000215793.8:c.559C>T	22.37:g.30741014G>A	ENSP00000215793:p.Gln187*		E9PAW1	Nonsense_Mutation	SNP	pfam_PRP21-like,pfam_Surp,pfam_Ubiquitin_dom,superfamily_Surp,smart_Surp,smart_Ubiquitin_dom,pfscan_Surp,pfscan_Ubiquitin_supergroup	p.Q187*	ENST00000215793.8	37	c.559	CCDS13875.1	22	.	.	.	.	.	.	.	.	.	.	G	37	6.216220	0.97385	.	.	ENSG00000099995	ENST00000439242;ENST00000215793;ENST00000536049	.	.	.	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27082	T	0.32	-19.7329	19.0969	0.93255	0.0:0.0:1.0:0.0	.	.	.	.	X	122;187;84	.	ENSP00000215793:Q187X	Q	-	1	0	SF3A1	29071014	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.578000	0.82498	2.750000	0.94351	0.655000	0.94253	CAG	SF3A1	-	pfam_Surp,superfamily_Surp,smart_Surp,pfscan_Surp	ENSG00000099995		0.542	SF3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SF3A1	HGNC	protein_coding	OTTHUMT00000320916.2		0.00	88	0	G	NM_005877		30741014	-1			no_errors	ENST00000215793	ensembl	human	known	74_37	nonsense	5.26	72	4	SNP	1.000	A
SIDT2	51092	genome.wustl.edu	37	11	117062717	117062717	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr11:117062717C>T	ENST00000324225.4	+	19	2390	c.1859C>T	c.(1858-1860)tCt>tTt	p.S620F	SIDT2_ENST00000431081.2_Missense_Mutation_p.S617F|SIDT2_ENST00000532062.1_5'Flank	NM_001040455.1	NP_001035545.1	Q8NBJ9	SIDT2_HUMAN	SID1 transmembrane family, member 2	620					cell morphogenesis (GO:0000902)|dsRNA transport (GO:0033227)|glucose homeostasis (GO:0042593)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|response to glucose (GO:0009749)|type B pancreatic cell development (GO:0003323)|type B pancreatic cell proliferation (GO:0044342)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	RNA transmembrane transporter activity (GO:0051033)			NS(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(9)|lung(11)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	36	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.69e-05)|Epithelial(105;0.000219)|all cancers(92;0.00144)		ATCTTCTTCTCTGTGCTGGGC	0.607																																																	0													153.0	142.0	146.0					11																	117062717		2201	4296	6497	SO:0001583	missense	0			AF151799	CCDS31682.1	11q23.3	2008-02-05			ENSG00000149577	ENSG00000149577			24272	protein-coding gene	gene with protein product						10810093, 12975309	Standard	NM_001040455		Approved	CGI-40	uc001pqh.1	Q8NBJ9	OTTHUMG00000167065	ENST00000324225.4:c.1859C>T	11.37:g.117062717C>T	ENSP00000314023:p.Ser620Phe		Q8NBY7|Q9Y357	Missense_Mutation	SNP	NULL	p.S641F	ENST00000324225.4	37	c.1922	CCDS31682.1	11	.	.	.	.	.	.	.	.	.	.	C	31	5.094742	0.94149	.	.	ENSG00000149577	ENST00000324225;ENST00000278951;ENST00000431081	T;T;T	0.21031	2.03;2.03;2.03	4.91	4.91	0.64330	.	0.113064	0.64402	D	0.000007	T	0.35740	0.0942	L	0.38838	1.175	0.80722	D	1	P;P;P;P	0.50272	0.917;0.731;0.708;0.933	P;B;P;P	0.62885	0.694;0.444;0.722;0.908	T	0.01925	-1.1246	10	0.36615	T	0.2	-21.0197	18.2914	0.90131	0.0:1.0:0.0:0.0	.	641;617;620;641	Q8NBJ9-2;F5H8L4;Q8NBJ9;C9JBG5	.;.;SIDT2_HUMAN;.	F	620;641;617	ENSP00000314023:S620F;ENSP00000278951:S641F;ENSP00000399635:S617F	ENSP00000278951:S641F	S	+	2	0	SIDT2	116567927	1.000000	0.71417	0.989000	0.46669	0.996000	0.88848	7.524000	0.81866	2.573000	0.86826	0.655000	0.94253	TCT	SIDT2	-	NULL	ENSG00000149577		0.607	SIDT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIDT2	HGNC	protein_coding	OTTHUMT00000392836.1		0.00	16	0	C	NM_015996		117062717	+1			no_errors	ENST00000278951	ensembl	human	known	74_37	missense	8.00	23	2	SNP	1.000	T
SLC10A7	84068	genome.wustl.edu	37	4	147363928	147363928	+	Intron	SNP	T	T	C			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr4:147363928T>C	ENST00000507030.1	-	5	435				SLC10A7_ENST00000511374.1_3'UTR|SLC10A7_ENST00000394059.4_Missense_Mutation_p.K148E|SLC10A7_ENST00000264986.3_Intron|SLC10A7_ENST00000394062.3_Intron|SLC10A7_ENST00000335472.7_Intron|SLC10A7_ENST00000511315.1_5'UTR|SLC10A7_ENST00000432059.2_Intron			Q0GE19	NTCP7_HUMAN	solute carrier family 10, member 7						sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			endometrium(1)|kidney(3)|large_intestine(3)|lung(8)|skin(1)	16	all_hematologic(180;0.151)					AAACTATGTTTACTTACCAAA	0.274																																																	0													47.0	46.0	47.0					4																	147363928		2197	4288	6485	SO:0001627	intron_variant	0			AY346324	CCDS3768.1, CCDS34073.1, CCDS75198.1	4q31.2	2013-07-18	2013-07-18	2006-12-19	ENSG00000120519	ENSG00000120519		"""Solute carriers"""	23088	protein-coding gene	gene with protein product		611459	"""chromosome 4 open reading frame 13"""	C4orf13		15932064	Standard	NM_032128		Approved	MGC25043, DKFZp566M114, DKFZp313H0531, DKFZp779O2438	uc003ikr.2	Q0GE19	OTTHUMG00000161437	ENST00000507030.1:c.435+6A>G	4.37:g.147363928T>C			A7E2E6|A7MAX9|Q0VAP9|Q45NG1|Q45NG2|Q5H9S6|Q6P4E6|Q8IZ62|Q8NBP8|Q9H0M9	Missense_Mutation	SNP	NULL	p.K148E	ENST00000507030.1	37	c.442	CCDS34073.1	4	.	.	.	.	.	.	.	.	.	.	T	9.221	1.033359	0.19590	.	.	ENSG00000120519	ENST00000394059	.	.	.	5.96	5.96	0.96718	.	.	.	.	.	T	0.53997	0.1831	.	.	.	0.80722	D	1	B	0.13145	0.007	B	0.16289	0.015	T	0.54207	-0.8328	7	0.87932	D	0	.	10.2178	0.43179	0.2553:0.0:0.0:0.7447	.	148	Q0GE19-5	.	E	148	.	ENSP00000377623:K148E	K	-	1	0	SLC10A7	147583378	1.000000	0.71417	0.971000	0.41717	0.972000	0.66771	2.875000	0.48491	2.283000	0.76528	0.477000	0.44152	AAA	SLC10A7	-	NULL	ENSG00000120519		0.274	SLC10A7-009	KNOWN	basic|CCDS	protein_coding	SLC10A7	HGNC	protein_coding	OTTHUMT00000366932.1	-	0.00	95	0	T	NM_032128		147363928	-1	tier1	-	no_errors	ENST00000394059	ensembl	human	known	74_37	missense	11.86	52	7	SNP	0.918	C
SLC35A5	55032	genome.wustl.edu	37	3	112282359	112282359	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr3:112282359G>C	ENST00000492406.1	+	2	392	c.109G>C	c.(109-111)Gtg>Ctg	p.V37L	SLC35A5_ENST00000460713.1_3'UTR|ATG3_ENST00000402314.2_5'Flank|ATG3_ENST00000495756.1_5'Flank|ATG3_ENST00000283290.5_5'Flank	NM_017945.2	NP_060415.1	Q9BS91	S35A5_HUMAN	solute carrier family 35, member A5	37					nucleotide-sugar transport (GO:0015780)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	nucleotide-sugar transmembrane transporter activity (GO:0005338)|sugar:proton symporter activity (GO:0005351)			endometrium(1)|kidney(1)|large_intestine(1)|liver(2)|lung(4)|ovary(1)|skin(1)	11						CATCTTACTAGTGAAGTATTC	0.393																																																	0													162.0	140.0	148.0					3																	112282359		2203	4300	6503	SO:0001583	missense	0			AK000737	CCDS2967.1	3q13.13	2013-05-22			ENSG00000138459	ENSG00000138459		"""Solute carriers"""	20792	protein-coding gene	gene with protein product							Standard	NM_017945		Approved	FLJ20730	uc003dze.4	Q9BS91	OTTHUMG00000159263	ENST00000492406.1:c.109G>C	3.37:g.112282359G>C	ENSP00000417654:p.Val37Leu		D3DN66|Q69YY6|Q6ZMD6|Q9NWM9	Missense_Mutation	SNP	pfam_Nuc_sug_transpt,pfam_UAA,pfam_DMT,pfam_Tpt_PEP_trans_dom,pirsf_UDP/CMP-sugar_transptr,tigrfam_UDPgal_transpt	p.V37L	ENST00000492406.1	37	c.109	CCDS2967.1	3	.	.	.	.	.	.	.	.	.	.	G	12.54	1.968082	0.34754	.	.	ENSG00000138459	ENST00000484995;ENST00000492406;ENST00000468642	T	0.40225	1.04	5.96	4.98	0.66077	.	0.234366	0.43747	D	0.000525	T	0.27697	0.0681	L	0.35723	1.085	0.38105	D	0.937389	B	0.10296	0.003	B	0.09377	0.004	T	0.12293	-1.0553	10	0.09590	T	0.72	-13.365	8.3609	0.32359	0.162:0.0:0.838:0.0	.	37	Q9BS91	S35A5_HUMAN	L	37	ENSP00000417654:V37L	ENSP00000261034:V37L	V	+	1	0	SLC35A5	113765049	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	2.971000	0.49248	2.826000	0.97356	0.655000	0.94253	GTG	SLC35A5	-	pfam_Tpt_PEP_trans_dom,pirsf_UDP/CMP-sugar_transptr	ENSG00000138459		0.393	SLC35A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC35A5	HGNC	protein_coding	OTTHUMT00000354184.1	-	0.00	56	0	G	NM_017945		112282359	+1	tier1	-	no_errors	ENST00000492406	ensembl	human	known	74_37	missense	45.00	11	9	SNP	0.999	C
SLIT2	9353	genome.wustl.edu	37	4	20493433	20493433	+	Silent	SNP	C	C	T	rs557268494		TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr4:20493433C>T	ENST00000504154.1	+	9	1077	c.825C>T	c.(823-825)gcC>gcT	p.A275A	SLIT2_ENST00000503823.1_Silent_p.A275A|SLIT2_ENST00000273739.5_Silent_p.A279A|SLIT2_ENST00000503837.1_Silent_p.A279A	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	275	LRRNT 2.				apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)			NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						ACTGCCCTGCCGCCTGTACCT	0.418																																																	0													142.0	140.0	141.0					4																	20493433		2203	4300	6503	SO:0001819	synonymous_variant	0			AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	ENST00000504154.1:c.825C>T	4.37:g.20493433C>T			B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Silent	SNP	pfam_EG-like_dom,pfam_Laminin_G,pfam_Leu-rich_rpt,pfam_LRR-contain_N,pfam_Cys-rich_flank_reg_C,superfamily_ConA-like_lec_gl_sf,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_Fol_N,smart_Laminin_G,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_EG-like_dom,pfscan_Laminin_G	p.A275	ENST00000504154.1	37	c.825	CCDS3426.1	4																																																																																			SLIT2	-	pfam_LRR-contain_N,smart_LRR-contain_N	ENSG00000145147		0.418	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLIT2	HGNC	protein_coding	OTTHUMT00000250396.2	-	0.00	53	0	C			20493433	+1	tier1	-	no_errors	ENST00000504154	ensembl	human	known	74_37	silent	28.95	54	22	SNP	0.608	T
SMYD4	114826	genome.wustl.edu	37	17	1703457	1703457	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr17:1703457C>T	ENST00000305513.7	-	5	1398	c.1231G>A	c.(1231-1233)Gga>Aga	p.G411R		NM_052928.2	NP_443160.2	Q8IYR2	SMYD4_HUMAN	SET and MYND domain containing 4	411	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.						metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(5)|stomach(1)	21						ATATCGCATCCAGGAATTGGG	0.423																																																	0													143.0	140.0	141.0					17																	1703457		2203	4300	6503	SO:0001583	missense	0			AB067523	CCDS11013.1	17p13.3	2004-04-21			ENSG00000186532	ENSG00000186532		"""Zinc fingers, MYND-type"""	21067	protein-coding gene	gene with protein product						11572484	Standard	NM_052928		Approved	KIAA1936, ZMYND21	uc002ftm.4	Q8IYR2	OTTHUMG00000090570	ENST00000305513.7:c.1231G>A	17.37:g.1703457C>T	ENSP00000304360:p.Gly411Arg		Q8N1P2|Q8NAT0|Q96LV4|Q96PV2	Missense_Mutation	SNP	pfam_SET_dom,pfam_Znf_MYND,pfscan_SET_dom,pfscan_Znf_MYND	p.G411R	ENST00000305513.7	37	c.1231	CCDS11013.1	17	.	.	.	.	.	.	.	.	.	.	C	16.65	3.182886	0.57800	.	.	ENSG00000186532	ENST00000305513	T	0.79940	-1.32	6.03	6.03	0.97812	SET domain (2);	0.389073	0.30695	N	0.009072	D	0.90823	0.7118	M	0.83012	2.62	0.37182	D	0.903536	D	0.89917	1.0	D	0.85130	0.997	D	0.92544	0.6044	10	0.72032	D	0.01	-21.6614	18.7374	0.91761	0.0:1.0:0.0:0.0	.	411	Q8IYR2	SMYD4_HUMAN	R	411	ENSP00000304360:G411R	ENSP00000304360:G411R	G	-	1	0	SMYD4	1650207	0.893000	0.30496	0.993000	0.49108	0.492000	0.33523	5.071000	0.64382	2.861000	0.98227	0.655000	0.94253	GGA	SMYD4	-	pfam_SET_dom	ENSG00000186532		0.423	SMYD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMYD4	HGNC	protein_coding	OTTHUMT00000207108.4	-	0.00	55	0	C	XM_056082		1703457	-1	tier1	-	no_errors	ENST00000305513	ensembl	human	known	74_37	missense	9.30	39	4	SNP	0.986	T
SPEN	23013	genome.wustl.edu	37	1	16261094	16261094	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr1:16261094C>A	ENST00000375759.3	+	11	8563	c.8359C>A	c.(8359-8361)Cca>Aca	p.P2787T		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	2787	Interaction with RBPSUH. {ECO:0000250}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		TCGGTTCCACCCAGGGTCCAT	0.587																																																	0													61.0	58.0	59.0					1																	16261094		2203	4300	6503	SO:0001583	missense	0				CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.8359C>A	1.37:g.16261094C>A	ENSP00000364912:p.Pro2787Thr		Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Missense_Mutation	SNP	pfam_RRM_dom,pfam_SPOC_C,superfamily_SPOC_like_C_dom,smart_RRM_dom,pfscan_SPOC_met,pfscan_RRM_dom	p.P2787T	ENST00000375759.3	37	c.8359	CCDS164.1	1	.	.	.	.	.	.	.	.	.	.	C	10.14	1.269394	0.23221	.	.	ENSG00000065526	ENST00000375759	T	0.08458	3.09	5.08	5.08	0.68730	.	.	.	.	.	T	0.05640	0.0148	N	0.08118	0	0.48632	D	0.999688	B	0.31680	0.335	B	0.34346	0.18	T	0.51553	-0.8691	9	0.15499	T	0.54	-14.2405	16.6435	0.85138	0.0:1.0:0.0:0.0	.	2787	Q96T58	MINT_HUMAN	T	2787	ENSP00000364912:P2787T	ENSP00000364912:P2787T	P	+	1	0	SPEN	16133681	1.000000	0.71417	0.999000	0.59377	0.070000	0.16714	3.327000	0.52045	2.362000	0.80069	0.561000	0.74099	CCA	SPEN	-	NULL	ENSG00000065526		0.587	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPEN	HGNC	protein_coding	OTTHUMT00000025993.1		0.00	58	0	C	NM_015001		16261094	+1			no_errors	ENST00000375759	ensembl	human	known	74_37	missense	9.30	39	4	SNP	1.000	A
SNX7	51375	genome.wustl.edu	37	1	99150484	99150484	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr1:99150484C>A	ENST00000306121.3	+	2	233	c.224C>A	c.(223-225)cCa>cAa	p.P75Q	SNX7_ENST00000529992.1_Missense_Mutation_p.P75Q|SNX7_ENST00000370189.5_Missense_Mutation_p.P11Q	NM_015976.4	NP_057060.2	Q9UNH6	SNX7_HUMAN	sorting nexin 7	11	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				apoptotic process (GO:0006915)|intracellular protein transport (GO:0006886)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)	13		all_epithelial(167;7.64e-07)|all_lung(203;0.0006)|Lung NSC(277;0.00137)		Epithelial(280;0.0521)|all cancers(265;0.0687)|COAD - Colon adenocarcinoma(174;0.15)|Lung(183;0.207)|Colorectal(170;0.234)		CCTATGATGCCAACATCCCCT	0.333																																																	0													125.0	113.0	117.0					1																	99150484		2203	4300	6503	SO:0001583	missense	0			AF121857	CCDS755.2, CCDS756.1, CCDS756.2	1p21	2008-05-22			ENSG00000162627	ENSG00000162627		"""Sorting nexins"""	14971	protein-coding gene	gene with protein product		614904					Standard	NM_015976		Approved		uc010ouc.2	Q9UNH6	OTTHUMG00000010723	ENST00000306121.3:c.224C>A	1.37:g.99150484C>A	ENSP00000304429:p.Pro75Gln		A8KAF3|D3DT50|Q53FQ3|Q5VT09|Q5VT10|Q86U82|Q8WVD4|Q96FW9|Q9Y3Z7	Missense_Mutation	SNP	pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox	p.P75Q	ENST00000306121.3	37	c.224	CCDS755.2	1	.	.	.	.	.	.	.	.	.	.	C	13.06	2.123926	0.37533	.	.	ENSG00000162627	ENST00000370189;ENST00000529992;ENST00000306121;ENST00000454199	T;T;T;T	0.58358	1.34;2.06;1.39;0.34	5.39	5.39	0.77823	.	0.079472	0.53938	D	0.000047	T	0.40423	0.1116	N	0.25647	0.755	0.44711	D	0.997702	P;D;P	0.54964	0.7;0.969;0.899	B;P;B	0.53518	0.186;0.728;0.419	T	0.35101	-0.9802	10	0.45353	T	0.12	-16.8727	12.5036	0.55970	0.0:0.9239:0.0:0.0761	.	75;75;11	E9PNL2;Q9UNH6-3;Q9UNH6-2	.;.;.	Q	11;75;75;11	ENSP00000359208:P11Q;ENSP00000434731:P75Q;ENSP00000304429:P75Q;ENSP00000388266:P11Q	ENSP00000304429:P75Q	P	+	2	0	SNX7	98923072	1.000000	0.71417	0.998000	0.56505	0.614000	0.37383	3.996000	0.57009	2.533000	0.85409	0.650000	0.86243	CCA	SNX7	-	NULL	ENSG00000162627		0.333	SNX7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX7	HGNC	protein_coding	OTTHUMT00000029609.2	-	0.00	61	0	C			99150484	+1	tier1	-	no_errors	ENST00000306121	ensembl	human	known	74_37	missense	34.62	34	18	SNP	1.000	A
SPIRE1	56907	genome.wustl.edu	37	18	12479718	12479718	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr18:12479718G>T	ENST00000409402.4	-	10	1651	c.1384C>A	c.(1384-1386)Ctg>Atg	p.L462M	SPIRE1_ENST00000383356.2_Missense_Mutation_p.L289M|SPIRE1_ENST00000309836.5_Missense_Mutation_p.L251M|SPIRE1_ENST00000453447.2_Missense_Mutation_p.L328M|SPIRE1_ENST00000464481.1_5'UTR|SPIRE1_ENST00000410092.3_Missense_Mutation_p.L448M	NM_001128626.1	NP_001122098.1			spire-type actin nucleation factor 1											breast(3)|endometrium(3)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)	28						GAGCTGTCCAGTTCGGCCAGA	0.517																																																	0													89.0	75.0	80.0					18																	12479718		2203	4300	6503	SO:0001583	missense	0			AL833817	CCDS32790.2, CCDS45829.1, CCDS45830.1	18p11.21	2013-08-27	2013-08-27		ENSG00000134278	ENSG00000134278			30622	protein-coding gene	gene with protein product		609216	"""spire homolog 1 (Drosophila)"", ""spire family actin nucleation factor 1"""			10574461, 11747823	Standard	NM_001128626		Approved	spir-1, KIAA1135	uc002kre.3	Q08AE8	OTTHUMG00000153940	ENST00000409402.4:c.1384C>A	18.37:g.12479718G>T	ENSP00000387266:p.Leu462Met			Missense_Mutation	SNP	superfamily_Znf_FYVE_PHD,smart_KIND	p.L462M	ENST00000409402.4	37	c.1384	CCDS45829.1	18	.	.	.	.	.	.	.	.	.	.	G	13.66	2.302486	0.40795	.	.	ENSG00000134278	ENST00000453447;ENST00000409402;ENST00000410092;ENST00000309836;ENST00000383356	T;T;T;T;T	0.53206	0.65;1.41;1.21;0.64;0.63	5.45	4.57	0.56435	.	0.065370	0.64402	D	0.000006	T	0.31918	0.0812	N	0.25201	0.72	0.43787	D	0.996329	P;B;P	0.40376	0.51;0.343;0.715	B;B;B	0.42343	0.384;0.245;0.322	T	0.05084	-1.0907	10	0.09338	T	0.73	-12.097	9.9318	0.41528	0.1513:0.0:0.8487:0.0	.	448;251;462	Q08AE8-2;B4DWX0;Q08AE8	.;.;SPIR1_HUMAN	M	328;462;448;251;289	ENSP00000407050:L328M;ENSP00000387266:L462M;ENSP00000387226:L448M;ENSP00000309661:L251M;ENSP00000372847:L289M	ENSP00000309661:L251M	L	-	1	2	SPIRE1	12469718	1.000000	0.71417	0.998000	0.56505	0.879000	0.50718	3.312000	0.51927	2.577000	0.86979	0.650000	0.86243	CTG	SPIRE1	-	NULL	ENSG00000134278		0.517	SPIRE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPIRE1	HGNC	protein_coding	OTTHUMT00000333109.2	-	0.00	49	0	G	XM_290818		12479718	-1	tier1	-	no_errors	ENST00000409402	ensembl	human	known	74_37	missense	6.78	55	4	SNP	1.000	T
SPTA1	6708	genome.wustl.edu	37	1	158623119	158623119	+	Silent	SNP	G	G	T	rs373548086		TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr1:158623119G>T	ENST00000368147.4	-	22	3313	c.3133C>A	c.(3133-3135)Cgg>Agg	p.R1045R		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1045					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					TCTCGTCGCCGCTGTGGGAGC	0.542																																																	0													107.0	109.0	109.0					1																	158623119		2002	4189	6191	SO:0001819	synonymous_variant	0			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.3133C>A	1.37:g.158623119G>T			Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Silent	SNP	pfam_Spectrin_repeat,pfam_EF-hand_Ca_insen,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Spectrin/alpha-actinin,smart_SH3_domain,pfscan_EF_hand_dom,pfscan_SH3_domain,prints_Spectrin_alpha_SH3	p.R1045	ENST00000368147.4	37	c.3133	CCDS41423.1	1																																																																																			SPTA1	-	superfamily_SH3_domain,smart_Spectrin/alpha-actinin	ENSG00000163554		0.542	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTA1	HGNC	protein_coding	OTTHUMT00000051851.3		0.00	43	0	G	NM_003126		158623119	-1			no_errors	ENST00000368147	ensembl	human	known	74_37	silent	6.90	27	2	SNP	0.004	T
SPTLC1	10558	genome.wustl.edu	37	9	94809961	94809961	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr9:94809961G>T	ENST00000262554.2	-	10	923	c.918C>A	c.(916-918)aaC>aaA	p.N306K		NM_006415.2	NP_006406.1	O15269	SPTC1_HUMAN	serine palmitoyltransferase, long chain base subunit 1	306					ceramide biosynthetic process (GO:0046513)|small molecule metabolic process (GO:0044281)|sphinganine biosynthetic process (GO:0046511)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingomyelin biosynthetic process (GO:0006686)|sphingosine biosynthetic process (GO:0046512)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|serine C-palmitoyltransferase complex (GO:0017059)|SPOTS complex (GO:0035339)	pyridoxal phosphate binding (GO:0030170)|serine C-palmitoyltransferase activity (GO:0004758)			breast(2)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	14					L-Serine(DB00133)	CATTCTCCATGTTGGCACTGA	0.403																																																	0													74.0	67.0	70.0					9																	94809961		2203	4300	6503	SO:0001583	missense	0			Y08685	CCDS6692.1, CCDS6693.1	9q22.31	2014-09-17	2003-12-02		ENSG00000090054	ENSG00000090054	2.3.1.50		11277	protein-coding gene	gene with protein product		605712	"""hereditary sensory neuropathy, type 1"""	HSN1		9363775	Standard	NM_006415		Approved	LCB1, SPTI, HSAN1, hLCB1	uc004arl.1	O15269	OTTHUMG00000021047	ENST00000262554.2:c.918C>A	9.37:g.94809961G>T	ENSP00000262554:p.Asn306Lys		A8K681|Q5VWB4|Q96IX6	Missense_Mutation	SNP	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase	p.N306K	ENST00000262554.2	37	c.918	CCDS6692.1	9	.	.	.	.	.	.	.	.	.	.	G	16.03	3.007227	0.54361	.	.	ENSG00000090054	ENST00000262554	D	0.90444	-2.67	5.09	4.15	0.48705	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	D	0.87951	0.6307	L	0.55481	1.735	0.80722	D	1	B;B	0.24651	0.03;0.108	B;B	0.33121	0.158;0.102	D	0.85189	0.1008	10	0.66056	D	0.02	-24.6971	7.5652	0.27874	0.2655:0.0:0.7345:0.0	.	306;306	Q6NUL7;O15269	.;SPTC1_HUMAN	K	306	ENSP00000262554:N306K	ENSP00000262554:N306K	N	-	3	2	SPTLC1	93849782	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.758000	0.47565	1.288000	0.44600	0.650000	0.86243	AAC	SPTLC1	-	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase	ENSG00000090054		0.403	SPTLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTLC1	HGNC	protein_coding	OTTHUMT00000055553.1	-	0.00	71	0	G	NM_006415		94809961	-1	tier1	-	no_errors	ENST00000262554	ensembl	human	known	74_37	missense	6.15	61	4	SNP	1.000	T
SRPR	6734	genome.wustl.edu	37	11	126137598	126137598	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr11:126137598G>C	ENST00000332118.6	-	3	365	c.211C>G	c.(211-213)Cag>Gag	p.Q71E	FOXRED1_ENST00000263578.5_5'Flank|SRPR_ENST00000530680.1_5'UTR|FOXRED1_ENST00000532125.1_5'Flank|FOXRED1_ENST00000442061.2_5'Flank|SRPR_ENST00000532259.1_Missense_Mutation_p.Q43E	NM_003139.3	NP_003130.2	P08240	SRPR_HUMAN	signal recognition particle receptor (docking protein)	71					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cotranslational protein targeting to membrane (GO:0006613)|endoplasmic reticulum unfolded protein response (GO:0030968)|gene expression (GO:0010467)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|signal recognition particle receptor complex (GO:0005785)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|signal recognition particle binding (GO:0005047)			endometrium(7)|large_intestine(2)|lung(9)|ovary(2)|prostate(1)	21	all_hematologic(175;0.145)			BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0736)		AGGATCTTCTGAAAACCAACC	0.463																																																	0													71.0	73.0	72.0					11																	126137598		2201	4298	6499	SO:0001583	missense	0			BC001162	CCDS31717.1, CCDS53722.1	11q24-q25	2012-10-02	2008-10-29		ENSG00000182934	ENSG00000182934			11307	protein-coding gene	gene with protein product		182180	"""signal recognition particle receptor ('docking protein')"""			3340536, 1312991	Standard	NM_001177842		Approved	SRP-alpha, Sralpha	uc001qdh.3	P08240	OTTHUMG00000165826	ENST00000332118.6:c.211C>G	11.37:g.126137598G>C	ENSP00000328023:p.Gln71Glu		A6NIB3|B2R5Z8|B4E0H3|E9PJS4|Q9BVJ4	Missense_Mutation	SNP	pfam_Sig_recog_particle_rcpt_asu_N,pfam_SRP54_GTPase_dom,pfam_ArgK,pfam_CobQ/CobB/MinD/ParA_Nub-bd_dom,pfam_Signal_recog_particl_SRP54_hlx,superfamily_Longin-like_dom,superfamily_P-loop_NTPase,superfamily_Signal_recog_particl_SRP54_hlx,smart_Signal_recog_particl_SRP54_hlx,smart_AAA+_ATPase,smart_SRP54_GTPase_dom	p.Q71E	ENST00000332118.6	37	c.211	CCDS31717.1	11	.	.	.	.	.	.	.	.	.	.	G	13.29	2.193120	0.38707	.	.	ENSG00000182934	ENST00000332118;ENST00000532259	.	.	.	4.24	3.3	0.37823	Longin-like (1);Signal recognition particle receptor, alpha subunit, N-terminal (1);	0.113557	0.64402	D	0.000009	T	0.80476	0.4630	M	0.86651	2.83	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.76575	0.988;0.986	D	0.84038	0.0363	9	0.72032	D	0.01	-10.1617	13.9656	0.64207	0.0:0.1531:0.8469:0.0	.	43;71	E9PJS4;P08240	.;SRPR_HUMAN	E	71;43	.	ENSP00000328023:Q71E	Q	-	1	0	SRPR	125642808	1.000000	0.71417	1.000000	0.80357	0.015000	0.08874	9.548000	0.98103	0.962000	0.38057	-0.494000	0.04653	CAG	SRPR	-	pfam_Sig_recog_particle_rcpt_asu_N,superfamily_Longin-like_dom	ENSG00000182934		0.463	SRPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRPR	HGNC	protein_coding	OTTHUMT00000386425.2	-	0.00	35	0	G	NM_003139		126137598	-1	tier1	-	no_errors	ENST00000332118	ensembl	human	known	74_37	missense	21.05	15	4	SNP	1.000	C
SSBP4	170463	genome.wustl.edu	37	19	18541720	18541720	+	Missense_Mutation	SNP	A	A	G	rs151097251	byFrequency	TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr19:18541720A>G	ENST00000270061.7	+	5	643	c.349A>G	c.(349-351)Atg>Gtg	p.M117V	SSBP4_ENST00000598159.2_3'UTR|SSBP4_ENST00000348495.6_Missense_Mutation_p.M117V|SSBP4_ENST00000599699.2_5'Flank	NM_032627.4	NP_116016.1	Q9BWG4	SSBP4_HUMAN	single stranded DNA binding protein 4	117						nucleus (GO:0005634)	single-stranded DNA binding (GO:0003697)			endometrium(2)|kidney(1)|skin(1)	4						CGCAGGCTCCATGGCGGCTGG	0.667																																																	0								A	VAL/MET,VAL/MET	0,4404		0,0,2202	30.0	32.0	31.0		349,349	1.7	1.0	19	dbSNP_134	31	3,8597	2.2+/-6.3	0,3,4297	no	missense,missense	SSBP4	NM_001009998.3,NM_032627.4	21,21	0,3,6499	GG,GA,AA		0.0349,0.0,0.0231	benign,benign	117/364,117/386	18541720	3,13001	2202	4300	6502	SO:0001583	missense	0				CCDS12378.1, CCDS32960.1	19p13.1	2008-02-05				ENSG00000130511			15676	protein-coding gene	gene with protein product		607391				12079286	Standard	NM_032627		Approved		uc002niy.3	Q9BWG4		ENST00000270061.7:c.349A>G	19.37:g.18541720A>G	ENSP00000270061:p.Met117Val		Q9BWW5	Missense_Mutation	SNP	smart_LisH_dimerisation,pfscan_LisH_dimerisation,prints_SSDP_DNA-bd	p.M117V	ENST00000270061.7	37	c.349	CCDS12378.1	19	.	.	.	.	.	.	.	.	.	.	A	0.486	-0.877463	0.02550	0.0	3.49E-4	ENSG00000130511	ENST00000270061;ENST00000348495	.	.	.	2.8	1.74	0.24563	.	0.057889	0.64402	N	0.000004	T	0.28632	0.0709	N	0.19112	0.55	0.50467	D	0.999876	B;B	0.02656	0.0;0.0	B;B	0.11329	0.004;0.006	T	0.04522	-1.0945	9	0.13108	T	0.6	.	4.4854	0.11787	0.8164:0.0:0.1836:0.0	.	117;117	Q9BWW5;Q9BWG4	.;SSBP4_HUMAN	V	117	.	ENSP00000270061:M117V	M	+	1	0	SSBP4	18402720	1.000000	0.71417	0.996000	0.52242	0.386000	0.30323	3.592000	0.53993	0.291000	0.22468	0.459000	0.35465	ATG	SSBP4	-	NULL	ENSG00000130511		0.667	SSBP4-002	KNOWN	basic|CCDS	protein_coding	SSBP4	HGNC	protein_coding	OTTHUMT00000466348.3	-	0.00	155	0	A	NM_032627		18541720	+1	tier1	rs151097251	no_errors	ENST00000270061	ensembl	human	known	74_37	missense	50.87	85	88	SNP	1.000	G
ST6GALNAC1	55808	genome.wustl.edu	37	17	74621943	74621943	+	Silent	SNP	A	A	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr17:74621943A>T	ENST00000156626.7	-	8	1762	c.1563T>A	c.(1561-1563)acT>acA	p.T521T	ST6GALNAC1_ENST00000590878.1_5'Flank	NM_018414.3	NP_060884.1	Q9NSC7	SIA7A_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 1	521					oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity (GO:0001665)|sialyltransferase activity (GO:0008373)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(11)|prostate(1)|upper_aerodigestive_tract(1)	22						GGAGGGCCCCAGTGGTGGGGC	0.582																																																	0													46.0	49.0	48.0					17																	74621943		2203	4300	6503	SO:0001819	synonymous_variant	0			Y11339	CCDS11748.1	17q25.3	2013-03-01	2005-02-07	2005-02-07	ENSG00000070526	ENSG00000070526		"""Sialyltransferases"""	23614	protein-coding gene	gene with protein product		610138	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) A"""	SIAT7A			Standard	NM_001289107		Approved	ST6GalNAcI	uc002jsh.3	Q9NSC7	OTTHUMG00000180369	ENST00000156626.7:c.1563T>A	17.37:g.74621943A>T			Q6UW90|Q9NSC6	Silent	SNP	pfam_Glyco_trans_29	p.T521	ENST00000156626.7	37	c.1563	CCDS11748.1	17																																																																																			ST6GALNAC1	-	pfam_Glyco_trans_29	ENSG00000070526		0.582	ST6GALNAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ST6GALNAC1	HGNC	protein_coding	OTTHUMT00000450974.1	-	0.00	44	0	A	NM_018414		74621943	-1	tier1	-	no_errors	ENST00000156626	ensembl	human	known	74_37	silent	7.94	58	5	SNP	0.013	T
STAT1	6772	genome.wustl.edu	37	2	191873731	191873731	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr2:191873731G>T	ENST00000361099.3	-	4	618	c.231C>A	c.(229-231)ttC>ttA	p.F77L	STAT1_ENST00000409465.1_Missense_Mutation_p.F77L|STAT1_ENST00000540176.1_Missense_Mutation_p.F77L|STAT1_ENST00000392323.2_Missense_Mutation_p.F79L|STAT1_ENST00000392322.3_Missense_Mutation_p.F77L	NM_007315.3	NP_009330.1	P42224	STAT1_HUMAN	signal transducer and activator of transcription 1, 91kDa	77					apoptotic process (GO:0006915)|blood circulation (GO:0008015)|cellular response to insulin stimulus (GO:0032869)|cellular response to interferon-beta (GO:0035458)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|metanephric mesenchymal cell differentiation (GO:0072162)|metanephric mesenchymal cell proliferation involved in metanephros development (GO:0072136)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of macrophage fusion (GO:0034240)|negative regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003340)|negative regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072308)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|renal tubule development (GO:0061326)|response to cAMP (GO:0051591)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to exogenous dsRNA (GO:0043330)|response to hydrogen peroxide (GO:0042542)|response to mechanical stimulus (GO:0009612)|response to nutrient (GO:0007584)|response to peptide hormone (GO:0043434)|transcription from RNA polymerase II promoter (GO:0006366)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|tumor necrosis factor receptor binding (GO:0005164)			autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(6)|lung(13)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39			OV - Ovarian serous cystadenocarcinoma(117;0.00434)|Epithelial(96;0.0555)|all cancers(119;0.141)			GCTGTAGCAAGAAGTTATTCT	0.393																																																	0													104.0	96.0	99.0					2																	191873731		2203	4300	6503	SO:0001583	missense	0				CCDS2309.1, CCDS42793.1	2q32.2-q32.3	2014-09-17	2002-08-29		ENSG00000115415	ENSG00000115415		"""SH2 domain containing"""	11362	protein-coding gene	gene with protein product	"""transcription factor ISGF-3 components p91/p84"""	600555	"""signal transducer and activator of transcription 1, 91kD"""			7885841	Standard	NM_139266		Approved	STAT91, ISGF-3	uc002usj.2	P42224	OTTHUMG00000132699	ENST00000361099.3:c.231C>A	2.37:g.191873731G>T	ENSP00000354394:p.Phe77Leu		A8K989|B2RCA0|D2KFR8|D3DPI7|Q53S88|Q53XW4|Q68D00|Q9UDL5	Missense_Mutation	SNP	pfam_STAT_TF_DNA-bd,pfam_STAT_TF_alpha,pfam_STAT_TF_prot_interaction,pfam_STAT1_TAZ2-bd_C,pfam_SH2,superfamily_p53-like_TF_DNA-bd,superfamily_STAT_TF_coiled-coil,superfamily_STAT_TF_prot_interaction,smart_STAT_TF_prot_interaction,pfscan_SH2	p.F77L	ENST00000361099.3	37	c.231	CCDS2309.1	2	.	.	.	.	.	.	.	.	.	.	G	12.58	1.980891	0.34942	.	.	ENSG00000115415	ENST00000361099;ENST00000409465;ENST00000540176;ENST00000392322;ENST00000392323;ENST00000424722;ENST00000454414	T;T;T;T;T;T;T	0.44881	0.91;0.91;0.91;0.91;0.91;0.91;0.91	5.67	-2.31	0.06765	STAT transcription factor, protein interaction (4);	0.000000	0.85682	D	0.000000	T	0.49915	0.1585	L	0.50333	1.59	0.51233	D	0.99991	D;B	0.76494	0.999;0.093	D;B	0.85130	0.997;0.313	T	0.42085	-0.9472	10	0.28530	T	0.3	-25.2836	10.8649	0.46849	0.5643:0.0:0.4357:0.0	.	77;77	P42224-2;P42224	.;STAT1_HUMAN	L	77;77;77;77;79;77;77	ENSP00000354394:F77L;ENSP00000386244:F77L;ENSP00000438703:F77L;ENSP00000376136:F77L;ENSP00000376137:F79L;ENSP00000402548:F77L;ENSP00000411398:F77L	ENSP00000354394:F77L	F	-	3	2	STAT1	191581976	1.000000	0.71417	0.065000	0.19835	0.596000	0.36781	1.741000	0.38238	-0.363000	0.08101	-1.031000	0.02408	TTC	STAT1	-	pfam_STAT_TF_prot_interaction,superfamily_STAT_TF_prot_interaction,smart_STAT_TF_prot_interaction	ENSG00000115415		0.393	STAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAT1	HGNC	protein_coding	OTTHUMT00000255997.3	-	0.00	46	0	G	NM_007315		191873731	-1	tier1	-	no_errors	ENST00000361099	ensembl	human	known	74_37	missense	65.96	16	31	SNP	0.990	T
STRBP	55342	genome.wustl.edu	37	9	125898383	125898383	+	Silent	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr9:125898383G>T	ENST00000348403.5	-	16	2139	c.1710C>A	c.(1708-1710)gcC>gcA	p.A570A	STRBP_ENST00000447404.2_Silent_p.A570A|STRBP_ENST00000360998.3_Silent_p.A556A	NM_018387.4	NP_060857.2	Q96SI9	STRBP_HUMAN	spermatid perinuclear RNA binding protein	570	DRBM 2. {ECO:0000255|PROSITE- ProRule:PRU00266}.				cellular component movement (GO:0006928)|mechanosensory behavior (GO:0007638)|multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|single-stranded RNA binding (GO:0003727)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(6)|prostate(1)|skin(2)	26						GTTTCTCCAAGGCAGCTAAAG	0.413																																																	0													128.0	126.0	126.0					9																	125898383		2203	4300	6503	SO:0001819	synonymous_variant	0			AK002169	CCDS6851.1, CCDS55337.1	9q33.1-q33.3	2008-08-29	2001-11-28		ENSG00000165209	ENSG00000165209			16462	protein-coding gene	gene with protein product		611138	"""spermatid perinuclear RNA-binding protein"", ""interleukin enhancer binding factor 3-like"""	ILF3L			Standard	NM_018387		Approved	FLJ11307, SPNR	uc004bns.3	Q96SI9	OTTHUMG00000020636	ENST00000348403.5:c.1710C>A	9.37:g.125898383G>T			Q32NB9|Q9BUE1|Q9BXG4|Q9H0B4|Q9H7V1|Q9NUK4	Silent	SNP	pfam_DZF,pfam_dsRNA-bd_dom,smart_DZF,smart_dsRNA-bd_dom,pfscan_dsRNA-bd_dom	p.A570	ENST00000348403.5	37	c.1710	CCDS6851.1	9																																																																																			STRBP	-	pfam_dsRNA-bd_dom,smart_dsRNA-bd_dom,pfscan_dsRNA-bd_dom	ENSG00000165209		0.413	STRBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STRBP	HGNC	protein_coding	OTTHUMT00000053982.1	-	0.00	45	0	G			125898383	-1	tier1	-	no_errors	ENST00000348403	ensembl	human	known	74_37	silent	7.02	53	4	SNP	1.000	T
SYNE1	23345	genome.wustl.edu	37	6	152702455	152702455	+	Nonsense_Mutation	SNP	T	T	A	rs119103243		TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr6:152702455T>A	ENST00000367255.5	-	56	9296	c.8695A>T	c.(8695-8697)Aga>Tga	p.R2899*	SYNE1_ENST00000341594.5_Nonsense_Mutation_p.R2938*|SYNE1_ENST00000448038.1_Nonsense_Mutation_p.R2906*|SYNE1_ENST00000265368.4_Nonsense_Mutation_p.R2899*|SYNE1_ENST00000423061.1_Nonsense_Mutation_p.R2906*|SYNE1-AS1_ENST00000412161.1_RNA	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	2899					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GACTCCACTCTGCTGAGACGG	0.537										HNSCC(10;0.0054)																																							0			GRCh37	CM070290	SYNE1	M	rs119103243						125.0	125.0	125.0					6																	152702455		2203	4300	6503	SO:0001587	stop_gained	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.8695A>T	6.37:g.152702455T>A	ENSP00000356224:p.Arg2899*		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Nonsense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.R2899*	ENST00000367255.5	37	c.8695	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	T	28.6	4.937051	0.92458	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	.	.	.	6.01	-1.4	0.08968	.	0.000000	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10636	T	0.68	.	18.7116	0.91659	0.0:0.0:0.6552:0.3448	.	.	.	.	X	2899;2906;2899;2906;2938	.	ENSP00000265368:R2899X	R	-	1	2	SYNE1	152744148	1.000000	0.71417	0.937000	0.37676	0.986000	0.74619	0.934000	0.28910	-0.425000	0.07371	0.528000	0.53228	AGA	SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_Spectrin/alpha-actinin	ENSG00000131018		0.537	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	-	0.00	26	0	T	NM_182961		152702455	-1	tier1	rs119103243	no_errors	ENST00000265368	ensembl	human	known	74_37	nonsense	37.93	18	11	SNP	0.994	A
SYNJ2BP	55333	genome.wustl.edu	37	14	70839645	70839645	+	3'UTR	SNP	T	T	C			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr14:70839645T>C	ENST00000256366.4	-	0	582				SYNJ2BP_ENST00000554216.1_5'UTR|SYNJ2BP-COX16_ENST00000555276.1_RNA	NM_018373.2	NP_060843.2	P57105	SYJ2B_HUMAN	synaptojanin 2 binding protein						intracellular distribution of mitochondria (GO:0048312)|negative regulation of activin receptor signaling pathway (GO:0032926)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of protein localization to cell surface (GO:2000010)|positive regulation of receptor internalization (GO:0002092)	cell surface (GO:0009986)|integral component of mitochondrial outer membrane (GO:0031307)|mitochondrion (GO:0005739)				central_nervous_system(1)|kidney(2)|large_intestine(1)|upper_aerodigestive_tract(1)	5				all cancers(60;0.00367)|BRCA - Breast invasive adenocarcinoma(234;0.00716)|OV - Ovarian serous cystadenocarcinoma(108;0.0377)		CATGGCAGAATAGCAGGGGTG	0.448																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK002133	CCDS9803.1	14q24.2	2013-05-10			ENSG00000213463	ENSG00000213463			18955	protein-coding gene	gene with protein product	"""activin receptor interacting protein 5"""	609411				11882656	Standard	NM_018373		Approved	Arip2		P57105	OTTHUMG00000171240	ENST00000256366.4:c.*63A>G	14.37:g.70839645T>C			Q49SH3|Q96IA4	RNA	SNP	-	NULL	ENST00000256366.4	37	NULL	CCDS9803.1	14																																																																																			SYNJ2BP	-	-	ENSG00000213463		0.448	SYNJ2BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNJ2BP	HGNC	protein_coding	OTTHUMT00000412472.1	-	0.00	53	0	T	NM_018373		70839645	-1	tier1	-	no_errors	ENST00000554216	ensembl	human	putative	74_37	rna	34.38	21	11	SNP	0.739	C
TAF1C	9013	genome.wustl.edu	37	16	84215619	84215619	+	Missense_Mutation	SNP	A	A	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr16:84215619A>T	ENST00000567759.1	-	8	949	c.767T>A	c.(766-768)cTt>cAt	p.L256H	TAF1C_ENST00000341690.6_Missense_Mutation_p.L189H|TAF1C_ENST00000378541.4_Missense_Mutation_p.L256H|TAF1C_ENST00000570117.1_De_novo_Start_OutOfFrame|TAF1C_ENST00000541676.1_Missense_Mutation_p.L189H|TAF1C_ENST00000566732.1_Missense_Mutation_p.L256H	NM_005679.3	NP_005670	Q15572	TAF1C_HUMAN	TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kDa	256					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)			endometrium(1)|kidney(3)|large_intestine(3)|lung(11)|ovary(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	26						AGGTTTCCCAAGGAATTGGGG	0.547																																																	0													80.0	78.0	79.0					16																	84215619		2200	4300	6500	SO:0001583	missense	0			L39059	CCDS32496.1, CCDS45535.1, CCDS58488.1, CCDS58489.1	16q24	2008-02-05	2002-08-29			ENSG00000103168			11534	protein-coding gene	gene with protein product		604905	"""TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kD"""			7801123	Standard	NM_005679		Approved	TAFI110, TAFI95, SL1, MGC:39976	uc010vnx.2	Q15572		ENST00000567759.1:c.767T>A	16.37:g.84215619A>T	ENSP00000455265:p.Leu256His		B7Z5K5|B7Z5S4|B7Z908|B7Z9L7|Q59F67|Q8N6V3	Missense_Mutation	SNP	superfamily_WD40_repeat_dom	p.L256H	ENST00000567759.1	37	c.767	CCDS32496.1	16	.	.	.	.	.	.	.	.	.	.	A	14.67	2.603996	0.46423	.	.	ENSG00000103168	ENST00000378541;ENST00000541676;ENST00000341690;ENST00000537450	T;T;T	0.65178	3.96;-0.14;-0.14	4.42	2.02	0.26589	.	0.693493	0.12910	N	0.428988	T	0.72447	0.3461	M	0.70595	2.14	0.09310	N	1	B;D;D;D	0.89917	0.206;1.0;1.0;1.0	B;D;D;D	0.91635	0.054;0.999;0.999;0.999	T	0.58814	-0.7570	10	0.72032	D	0.01	-7.4672	3.2362	0.06765	0.6807:0.0:0.1204:0.1988	.	256;256;256;189	F5H7W6;Q15572-6;Q15572;Q15572-2	.;.;TAF1C_HUMAN;.	H	256;189;189;256	ENSP00000367802:L256H;ENSP00000437900:L189H;ENSP00000345305:L189H	ENSP00000345305:L189H	L	-	2	0	TAF1C	82773120	0.000000	0.05858	0.001000	0.08648	0.009000	0.06853	0.075000	0.14686	0.283000	0.22279	-0.408000	0.06270	CTT	TAF1C	-	NULL	ENSG00000103168		0.547	TAF1C-001	KNOWN	basic|CCDS	protein_coding	TAF1C	HGNC	protein_coding	OTTHUMT00000433045.2	-	0.00	37	0	A	NM_139353		84215619	-1	tier1	-	no_errors	ENST00000378541	ensembl	human	known	74_37	missense	11.11	32	4	SNP	0.000	T
TBC1D20	128637	genome.wustl.edu	37	20	421022	421022	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr20:421022C>A	ENST00000354200.4	-	6	785	c.638G>T	c.(637-639)gGg>gTg	p.G213V	TBC1D20_ENST00000461188.1_5'UTR	NM_144628.2	NP_653229.1	Q96BZ9	TBC20_HUMAN	TBC1 domain family, member 20	213	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				acrosome assembly (GO:0001675)|cargo loading into COPII-coated vesicle (GO:0090110)|ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi organization (GO:0007030)|lens fiber cell morphogenesis (GO:0070309)|lipid particle organization (GO:0034389)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|seminiferous tubule development (GO:0072520)|virion assembly (GO:0019068)	endoplasmic reticulum membrane (GO:0005789)|integral component of Golgi membrane (GO:0030173)|nuclear membrane (GO:0031965)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	12		all_epithelial(17;0.228)|Breast(17;0.231)				AAAGATGGTCCCTACCTCAGC	0.552																																																	0													99.0	85.0	90.0					20																	421022		2203	4300	6503	SO:0001583	missense	0			AK055573	CCDS13002.1	20p13	2013-07-10	2005-01-05	2005-01-05	ENSG00000125875	ENSG00000125875			16133	protein-coding gene	gene with protein product		611663	"""chromosome 20 open reading frame 140"""	C20orf140		17901050	Standard	XM_005260661		Approved	dJ852M4.2	uc002wds.3	Q96BZ9	OTTHUMG00000031637	ENST00000354200.4:c.638G>T	20.37:g.421022C>A	ENSP00000346139:p.Gly213Val		A8K6I3|B9A6M1|Q5JWQ7|Q6ZSY8|Q96NE1|Q9BYM7|Q9H140	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.G213V	ENST00000354200.4	37	c.638	CCDS13002.1	20	.	.	.	.	.	.	.	.	.	.	C	28.0	4.883776	0.91814	.	.	ENSG00000125875	ENST00000354200;ENST00000246077	T	0.22539	1.95	5.95	5.95	0.96441	Rab-GAP/TBC domain (4);	0.047933	0.85682	D	0.000000	T	0.51686	0.1689	M	0.83953	2.67	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.41016	-0.9532	10	0.30854	T	0.27	-28.6619	19.3813	0.94536	0.0:1.0:0.0:0.0	.	213	Q96BZ9	TBC20_HUMAN	V	213;238	ENSP00000346139:G213V	ENSP00000246077:G238V	G	-	2	0	TBC1D20	369022	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.486000	0.81215	2.824000	0.97209	0.655000	0.94253	GGG	TBC1D20	-	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	ENSG00000125875		0.552	TBC1D20-004	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D20	HGNC	protein_coding	OTTHUMT00000251397.2		0.00	63	0	C	NM_144628		421022	-1			no_errors	ENST00000354200	ensembl	human	known	74_37	missense	8.82	62	6	SNP	1.000	A
TAF4	6874	genome.wustl.edu	37	20	60581599	60581599	+	Silent	SNP	G	G	A	rs145691580		TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr20:60581599G>A	ENST00000252996.4	-	7	2189	c.2190C>T	c.(2188-2190)gtC>gtT	p.V730V		NM_003185.3	NP_003176.2	O00268	TAF4_HUMAN	TAF4 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 135kDa	730					DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|ovarian follicle development (GO:0001541)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	37	Breast(26;1e-08)		BRCA - Breast invasive adenocarcinoma(19;3.1e-07)			TGCCGACGCCGACCTGCGTGG	0.692																																																	0								G		0,4368		0,0,2184	16.0	16.0	16.0		2190	-10.9	0.4	20	dbSNP_134	16	1,8549		0,1,4274	no	coding-synonymous	TAF4	NM_003185.3		0,1,6458	AA,AG,GG		0.0117,0.0,0.0077		730/1086	60581599	1,12917	2184	4275	6459	SO:0001819	synonymous_variant	0			Y11354	CCDS33500.1	20q13.33	2010-02-26	2002-08-29	2002-01-18	ENSG00000130699	ENSG00000130699			11537	protein-coding gene	gene with protein product		601796	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, C1, 130kD"""	TAF4A, TAF2C1, TAF2C		8942982, 9192867	Standard	NM_003185		Approved	TAFII130, TAFII135	uc002ybs.3	O00268	OTTHUMG00000032893	ENST00000252996.4:c.2190C>T	20.37:g.60581599G>A			A6NGD9|Q5TBP6|Q99721|Q9BR40|Q9BX42	Silent	SNP	pfam_TAF4,pfam_TAFH_NHR1,superfamily_Histone-fold,smart_TAFH_NHR1,pfscan_TAFH_NHR1	p.V730	ENST00000252996.4	37	c.2190	CCDS33500.1	20																																																																																			TAF4	-	NULL	ENSG00000130699		0.692	TAF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF4	HGNC	protein_coding	OTTHUMT00000079968.2	-	0.00	61	0	G	NM_003185		60581599	-1	tier1	rs145691580	no_errors	ENST00000252996	ensembl	human	known	74_37	silent	17.59	89	19	SNP	0.049	A
TBC1D9B	23061	genome.wustl.edu	37	5	179289817	179289817	+	3'UTR	SNP	T	T	C			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr5:179289817T>C	ENST00000356834.3	-	0	4421				TBC1D9B_ENST00000518085.1_5'UTR|TBC1D9B_ENST00000355235.3_3'UTR|TBC1D9B_ENST00000444477.2_3'UTR|TBC1D9B_ENST00000519746.1_3'UTR	NM_198868.2	NP_942568.2	Q66K14	TBC9B_HUMAN	TBC1 domain family, member 9B (with GRAM domain)							integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	28	all_cancers(89;0.000197)|all_epithelial(37;6.84e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0236)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CAAGGAAATATATCAGGACCT	0.438																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AB014576	CCDS4450.1, CCDS43408.1	5q35.3	2013-01-10			ENSG00000197226	ENSG00000197226		"""EF-hand domain containing"""	29097	protein-coding gene	gene with protein product						9734811	Standard	NM_198868		Approved	KIAA0676	uc003mlh.3	Q66K14	OTTHUMG00000130911	ENST00000356834.3:c.*631A>G	5.37:g.179289817T>C			D3DWQ5|D3DWQ6|O75163|Q53EY0|Q6MZI2|Q96H49	RNA	SNP	-	NULL	ENST00000356834.3	37	NULL	CCDS43408.1	5																																																																																			TBC1D9B	-	-	ENSG00000197226		0.438	TBC1D9B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBC1D9B	HGNC	protein_coding	OTTHUMT00000253501.3	-	0.00	44	0	T	NM_015043		179289817	-1	tier1	-	no_errors	ENST00000518085	ensembl	human	putative	74_37	rna	46.15	28	24	SNP	0.000	C
TEX15	56154	genome.wustl.edu	37	8	30701460	30701460	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr8:30701460C>G	ENST00000256246.2	-	1	5148	c.5074G>C	c.(5074-5076)Gaa>Caa	p.E1692Q		NM_031271.3	NP_112561.2	Q9BXT5	TEX15_HUMAN	testis expressed 15	1692					fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia development (GO:0030539)|male meiosis (GO:0007140)|protein localization to chromosome (GO:0034502)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of protein localization (GO:0032880)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)					NS(2)|breast(3)|cervix(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|lung(56)|ovary(5)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	138				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		ATTTGAAGTTCTACCAAAGTG	0.358																																																	0													138.0	134.0	135.0					8																	30701460		2203	4300	6503	SO:0001583	missense	0			AF285605	CCDS6080.1	8p22	2009-03-25	2007-03-13			ENSG00000133863			11738	protein-coding gene	gene with protein product	"""cancer/testis antigen 42"""	605795	"""testis expressed sequence 15"""			11279525	Standard	NM_031271		Approved	CT42	uc003xil.3	Q9BXT5		ENST00000256246.2:c.5074G>C	8.37:g.30701460C>G	ENSP00000256246:p.Glu1692Gln			Missense_Mutation	SNP	NULL	p.E1692Q	ENST00000256246.2	37	c.5074	CCDS6080.1	8	.	.	.	.	.	.	.	.	.	.	C	18.86	3.712515	0.68730	.	.	ENSG00000133863	ENST00000256246	T	0.27104	1.69	5.6	5.6	0.85130	.	0.000000	0.56097	D	0.000021	T	0.50956	0.1646	M	0.63843	1.955	0.47094	D	0.999315	D	0.89917	1.0	D	0.97110	1.0	T	0.50250	-0.8850	10	0.87932	D	0	.	18.3732	0.90420	0.0:1.0:0.0:0.0	.	1692	Q9BXT5	TEX15_HUMAN	Q	1692	ENSP00000256246:E1692Q	ENSP00000256246:E1692Q	E	-	1	0	TEX15	30821002	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	5.290000	0.65661	2.622000	0.88805	0.655000	0.94253	GAA	TEX15	-	NULL	ENSG00000133863		0.358	TEX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEX15	HGNC	protein_coding	OTTHUMT00000376193.1	-	0.00	48	0	C			30701460	-1	tier1	-	no_errors	ENST00000256246	ensembl	human	known	74_37	missense	24.29	53	17	SNP	1.000	G
TLN2	83660	genome.wustl.edu	37	15	63131166	63131166	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr15:63131166G>T	ENST00000561311.1	+	57	7716	c.7486G>T	c.(7486-7488)Ggg>Tgg	p.G2496W	RP11-1069G10.1_ENST00000558404.1_RNA|TLN2_ENST00000306829.6_Missense_Mutation_p.G2496W			Q9Y4G6	TLN2_HUMAN	talin 2	2496	I/LWEQ. {ECO:0000255|PROSITE- ProRule:PRU00292}.				cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						CAAGTTTGTGGGGGGCATTGC	0.433																																																	0													109.0	107.0	108.0					15																	63131166		2203	4300	6503	SO:0001583	missense	0			AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.7486G>T	15.37:g.63131166G>T	ENSP00000453508:p.Gly2496Trp		A6NLB8	Missense_Mutation	SNP	pfam_Talin_cent,pfam_ILWEQ_dom,pfam_Vinculin-bd_dom,pfam_FERM_N,pfam_FERM_central,pfam_Insln_rcpt_S1,superfamily_Talin_cent,superfamily_Vinculin/catenin,superfamily_FERM_central,smart_Band_41_domain,smart_ILWEQ_dom,pfscan_FERM_domain,pfscan_ILWEQ_dom	p.G2496W	ENST00000561311.1	37	c.7486	CCDS32261.1	15	.	.	.	.	.	.	.	.	.	.	G	20.7	4.038281	0.75617	.	.	ENSG00000171914	ENST00000306829	T	0.44881	0.91	5.67	4.75	0.60458	I/LWEQ (4);	0.000000	0.85682	D	0.000000	T	0.67221	0.2870	M	0.83483	2.645	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.73445	-0.3980	10	0.87932	D	0	-22.9381	14.7185	0.69289	0.0697:0.0:0.9303:0.0	.	112;2496	B4DGF3;Q9Y4G6	.;TLN2_HUMAN	W	2496	ENSP00000303476:G2496W	ENSP00000303476:G2496W	G	+	1	0	TLN2	60918219	1.000000	0.71417	1.000000	0.80357	0.888000	0.51559	9.809000	0.99208	1.394000	0.46624	0.557000	0.71058	GGG	TLN2	-	pfam_ILWEQ_dom,smart_ILWEQ_dom,pfscan_ILWEQ_dom	ENSG00000171914		0.433	TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLN2	HGNC	protein_coding	OTTHUMT00000257878.2		0.00	68	0	G			63131166	+1			no_errors	ENST00000306829	ensembl	human	known	74_37	missense	7.32	38	3	SNP	1.000	T
TMEM243	79161	genome.wustl.edu	37	7	86827048	86827048	+	Intron	SNP	T	T	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr7:86827048T>A	ENST00000433078.1	-	4	676				TMEM243_ENST00000423734.1_3'UTR|TMEM243_ENST00000481425.1_Intron|TMEM243_ENST00000257637.3_Intron			Q9BU79	TM243_HUMAN	transmembrane protein 243, mitochondrial							integral component of membrane (GO:0016021)											ATCAAGGGAGTGGAATTTCTC	0.318																																																	0																																										SO:0001627	intron_variant	0				CCDS5602.1	7q21.12	2012-12-03	2012-12-03	2012-12-03	ENSG00000135185	ENSG00000135185			21707	protein-coding gene	gene with protein product	"""MDR1 and mitochondrial taxol resistance associated gene"""		"""chromosome 7 open reading frame 23"""	C7orf23			Standard	NM_024315		Approved	MGC4175, MM-TRAG	uc003uio.3	Q9BU79	OTTHUMG00000130823	ENST00000433078.1:c.234+208A>T	7.37:g.86827048T>A			A4D1C6|B2R9I4|D6W5P1	RNA	SNP	-	NULL	ENST00000433078.1	37	NULL	CCDS5602.1	7																																																																																			TMEM243	-	-	ENSG00000135185		0.318	TMEM243-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TMEM243	HGNC	protein_coding	OTTHUMT00000334412.1	-	0.00	70	0	T	NM_024315		86827048	-1	tier1	-	no_errors	ENST00000465976	ensembl	human	known	74_37	rna	26.67	54	20	SNP	0.000	A
TMEM63A	9725	genome.wustl.edu	37	1	226055696	226055696	+	Missense_Mutation	SNP	C	C	T	rs80287818	byFrequency	TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr1:226055696C>T	ENST00000366835.3	-	7	676	c.406G>A	c.(406-408)Gcc>Acc	p.A136T	TMEM63A_ENST00000474478.1_5'Flank|TMEM63A_ENST00000537914.1_5'Flank	NM_014698.2	NP_055513.2	O94886	CSCL1_HUMAN	transmembrane protein 63A	136					ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	nucleotide binding (GO:0000166)			breast(2)|endometrium(3)|large_intestine(5)|lung(6)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	24	Breast(184;0.197)					TAGTGGATGGCGTCCTCCCCA	0.547													C|||	3	0.000599042	0.0015	0.0014	5008	,	,		18203	0.0		0.0	False		,,,				2504	0.0																0								C	THR/ALA	7,4399	12.9+/-30.5	0,7,2196	174.0	127.0	143.0		406	5.9	1.0	1	dbSNP_131	143	0,8600		0,0,4300	yes	missense	TMEM63A	NM_014698.2	58	0,7,6496	TT,TC,CC		0.0,0.1589,0.0538	probably-damaging	136/808	226055696	7,12999	2203	4300	6503	SO:0001583	missense	0				CCDS31042.1	1q42.12	2008-02-05	2005-07-25	2005-07-25	ENSG00000196187	ENSG00000196187			29118	protein-coding gene	gene with protein product			"""KIAA0792"""	KIAA0792		9872452, 9455484	Standard	NM_014698		Approved		uc001hpm.2	O94886	OTTHUMG00000037442	ENST00000366835.3:c.406G>A	1.37:g.226055696C>T	ENSP00000355800:p.Ala136Thr		Q53GI7|Q5TE96|Q8N2U2	Missense_Mutation	SNP	pfam_DUF221	p.A136T	ENST00000366835.3	37	c.406	CCDS31042.1	1	.	.	.	.	.	.	.	.	.	.	C	36	5.643635	0.96704	0.001589	0.0	ENSG00000196187	ENST00000366835	T	0.61859	0.07	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.79981	0.4540	M	0.84511	2.7	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.81185	-0.1048	10	0.59425	D	0.04	-42.9941	19.0725	0.93145	0.0:1.0:0.0:0.0	.	136;136	B3KMR6;O94886	.;TM63A_HUMAN	T	136	ENSP00000355800:A136T	ENSP00000355800:A136T	A	-	1	0	TMEM63A	224122319	1.000000	0.71417	0.994000	0.49952	0.964000	0.63967	7.642000	0.83385	2.804000	0.96469	0.650000	0.86243	GCC	TMEM63A	-	NULL	ENSG00000196187		0.547	TMEM63A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM63A	HGNC	protein_coding	OTTHUMT00000091154.2		0.00	53	0	C	NM_014698		226055696	-1			no_errors	ENST00000366835	ensembl	human	known	74_37	missense	6.45	58	4	SNP	1.000	T
TNFRSF21	27242	genome.wustl.edu	37	6	47251781	47251781	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr6:47251781T>C	ENST00000296861.2	-	3	1529	c.1136A>G	c.(1135-1137)aAg>aGg	p.K379R		NM_014452.3	NP_055267.1	O75509	TNR21_HUMAN	tumor necrosis factor receptor superfamily, member 21	379					adaptive immune response (GO:0002250)|apoptotic process (GO:0006915)|B cell apoptotic process (GO:0001783)|cellular lipid metabolic process (GO:0044255)|cellular response to tumor necrosis factor (GO:0071356)|humoral immune response (GO:0006959)|myelination (GO:0042552)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-13 secretion (GO:2000666)|negative regulation of interleukin-5 secretion (GO:2000663)|negative regulation of myelination (GO:0031642)|negative regulation of T cell proliferation (GO:0042130)|neuron apoptotic process (GO:0051402)|oligodendrocyte apoptotic process (GO:0097252)|regulation of oligodendrocyte differentiation (GO:0048713)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|lung(7)|pancreas(1)|skin(2)	21			Lung(136;0.189)			CCGGGGCCCCTTTTTCAGAGT	0.512																																																	0													98.0	104.0	102.0					6																	47251781		2203	4300	6503	SO:0001583	missense	0			AF068868	CCDS4921.1	6p21.1	2011-08-11			ENSG00000146072	ENSG00000146072		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	13469	protein-coding gene	gene with protein product	"""death receptor 6"""	605732				9714541	Standard	NM_014452		Approved	DR6, CD358	uc003oyv.3	O75509	OTTHUMG00000014796	ENST00000296861.2:c.1136A>G	6.37:g.47251781T>C	ENSP00000296861:p.Lys379Arg		B2RDI9|Q0D2P5|Q96D86	Missense_Mutation	SNP	pfam_Death_domain,superfamily_DEATH-like_dom,smart_TNFR/NGFR_Cys_rich_reg,smart_Death_domain,pfscan_Death_domain,pfscan_TNFR/NGFR_Cys_rich_reg,prints_TNFR_21	p.K379R	ENST00000296861.2	37	c.1136	CCDS4921.1	6	.	.	.	.	.	.	.	.	.	.	T	28.9	4.960173	0.92791	.	.	ENSG00000146072	ENST00000296861;ENST00000419206	T	0.70631	-0.5	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.79753	0.4500	M	0.63843	1.955	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.82068	-0.0640	10	0.87932	D	0	.	16.8222	0.85835	0.0:0.0:0.0:1.0	.	379	O75509	TNR21_HUMAN	R	379;68	ENSP00000296861:K379R	ENSP00000296861:K379R	K	-	2	0	TNFRSF21	47359740	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.708000	0.68377	2.371000	0.80710	0.533000	0.62120	AAG	TNFRSF21	-	NULL	ENSG00000146072		0.512	TNFRSF21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFRSF21	HGNC	protein_coding	OTTHUMT00000040814.1		0.00	78	0	T	NM_014452		47251781	-1			no_errors	ENST00000296861	ensembl	human	known	74_37	missense	5.17	55	3	SNP	1.000	C
TNKS1BP1	85456	genome.wustl.edu	37	11	57087724	57087724	+	Missense_Mutation	SNP	C	C	T	rs371562715		TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr11:57087724C>T	ENST00000532437.1	-	2	868	c.557G>A	c.(556-558)cGc>cAc	p.R186H	TNKS1BP1_ENST00000358252.3_Missense_Mutation_p.R186H			Q9C0C2	TB182_HUMAN	tankyrase 1 binding protein 1, 182kDa	186	Pro-rich.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|RNA metabolic process (GO:0016070)|telomere maintenance via telomerase (GO:0007004)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nuclear telomeric heterochromatin (GO:0005724)|nucleus (GO:0005634)	ankyrin binding (GO:0030506)|enzyme binding (GO:0019899)	p.R186H(1)		breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	64		all_epithelial(135;0.21)				AAAGGTGAGGCGGGAACCCCA	0.642													C|||	1	0.000199681	0.0	0.0	5008	,	,		15542	0.0		0.001	False		,,,				2504	0.0																1	Substitution - Missense(1)	large_intestine(1)						C	HIS/ARG	0,4402		0,0,2201	60.0	64.0	62.0		557	4.5	1.0	11		62	1,8591	1.2+/-3.3	0,1,4295	no	missense	TNKS1BP1	NM_033396.2	29	0,1,6496	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	186/1730	57087724	1,12993	2201	4296	6497	SO:0001583	missense	0			AB051528	CCDS7951.1	11q12.2	2008-07-21			ENSG00000149115	ENSG00000149115			19081	protein-coding gene	gene with protein product		607104				11854288	Standard	NM_033396		Approved	TAB182, KIAA1741, FLJ45975	uc001njs.3	Q9C0C2	OTTHUMG00000167022	ENST00000532437.1:c.557G>A	11.37:g.57087724C>T	ENSP00000437271:p.Arg186His		A7E2F8|Q6PJ35|Q6ZV74	Missense_Mutation	SNP	NULL	p.R186H	ENST00000532437.1	37	c.557	CCDS7951.1	11	.	.	.	.	.	.	.	.	.	.	C	22.2	4.258282	0.80246	0.0	1.16E-4	ENSG00000149115	ENST00000358252;ENST00000532437	T;T	0.57107	0.42;0.42	4.47	4.47	0.54385	.	0.000000	0.33938	N	0.004413	T	0.57814	0.2079	N	0.24115	0.695	0.29641	N	0.844744	D	0.89917	1.0	D	0.85130	0.997	T	0.57579	-0.7787	10	0.72032	D	0.01	-14.7469	12.5151	0.56028	0.0:1.0:0.0:0.0	.	186	Q9C0C2	TB182_HUMAN	H	186	ENSP00000350990:R186H;ENSP00000437271:R186H	ENSP00000350990:R186H	R	-	2	0	TNKS1BP1	56844300	1.000000	0.71417	1.000000	0.80357	0.880000	0.50808	3.568000	0.53820	2.284000	0.76573	0.462000	0.41574	CGC	TNKS1BP1	-	NULL	ENSG00000149115		0.642	TNKS1BP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TNKS1BP1	HGNC	protein_coding	OTTHUMT00000392455.1		0.00	43	0	C	NM_033396		57087724	-1			no_errors	ENST00000358252	ensembl	human	known	74_37	missense	5.71	33	2	SNP	1.000	T
TNRC18	84629	genome.wustl.edu	37	7	5348561	5348561	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr7:5348561C>A	ENST00000430969.1	-	29	8993	c.8645G>T	c.(8644-8646)aGc>aTc	p.S2882I	TNRC18_ENST00000399537.4_Missense_Mutation_p.S2882I	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	2882	BAH. {ECO:0000255|PROSITE- ProRule:PRU00370}.						chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		GAGGCTGCGGCTGGACTTCTG	0.706																																																	0													7.0	10.0	9.0					7																	5348561		1833	4027	5860	SO:0001583	missense	0			U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.8645G>T	7.37:g.5348561C>A	ENSP00000395538:p.Ser2882Ile		A8MX41|Q96JH1|Q96K91	Missense_Mutation	SNP	pfam_BAH_dom,smart_BAH_dom,pfscan_BAH_dom	p.S2882I	ENST00000430969.1	37	c.8645	CCDS47534.1	7	.	.	.	.	.	.	.	.	.	.	c	18.17	3.563666	0.65651	.	.	ENSG00000182095	ENST00000399537;ENST00000430969	T;T	0.12879	2.64;2.64	5.16	5.16	0.70880	Bromo adjacent homology (BAH) domain (3);	.	.	.	.	T	0.10078	0.0247	N	0.02539	-0.55	0.34272	D	0.681132	P	0.42941	0.794	P	0.45377	0.478	T	0.39440	-0.9614	9	0.87932	D	0	.	18.2301	0.89933	0.0:1.0:0.0:0.0	.	2882	O15417	TNC18_HUMAN	I	2882	ENSP00000382452:S2882I;ENSP00000395538:S2882I	ENSP00000382452:S2882I	S	-	2	0	TNRC18	5315087	0.997000	0.39634	0.848000	0.33437	0.969000	0.65631	4.494000	0.60347	2.396000	0.81511	0.561000	0.74099	AGC	TNRC18	-	pfam_BAH_dom,smart_BAH_dom,pfscan_BAH_dom	ENSG00000182095		0.706	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TNRC18	HGNC	protein_coding		-	0.00	32	0	C			5348561	-1	tier1	-	no_errors	ENST00000399537	ensembl	human	known	74_37	missense	18.29	67	15	SNP	0.987	A
TNPO3	23534	genome.wustl.edu	37	7	128694795	128694795	+	Silent	SNP	G	G	T	rs138263703	byFrequency	TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr7:128694795G>T	ENST00000265388.5	-	1	173	c.30C>A	c.(28-30)ctC>ctA	p.L10L	TNPO3_ENST00000471234.1_Silent_p.L10L|TNPO3_ENST00000471166.1_Silent_p.L10L|TNPO3_ENST00000482320.1_5'UTR|TNPO3_ENST00000393245.1_Silent_p.L10L			Q9Y5L0	TNPO3_HUMAN	transportin 3	10					splicing factor protein import into nucleus (GO:0035048)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	receptor activity (GO:0004872)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(7)|ovary(2)|prostate(2)|skin(3)	22						CCTGGTACACGAGCTGCAATG	0.622																																					Pancreas(147;583 2585 39696 52331)												0													112.0	90.0	97.0					7																	128694795		2203	4300	6503	SO:0001819	synonymous_variant	0			AF145029	CCDS5809.1, CCDS55162.1	7q32.2	2014-02-03			ENSG00000064419	ENSG00000064419		"""Importins"""	17103	protein-coding gene	gene with protein product	"""importin 12"""	610032	"""limb girdle muscular dystrophy 1F (autosomal dominant)"""	LGMD1F		10366588, 10713112, 23543484, 23667635	Standard	NM_012470		Approved	TRN-SR, MTR10A, TRN-SR2, IPO12	uc003vol.2	Q9Y5L0	OTTHUMG00000158409	ENST00000265388.5:c.30C>A	7.37:g.128694795G>T			A4D1K9|C9IZM0|Q6NUM1|Q96G71|Q96GU9|Q9Y3R2	Silent	SNP	pfam_Exportin-1/Importin-b-like,superfamily_ARM-type_fold	p.L10	ENST00000265388.5	37	c.30	CCDS5809.1	7																																																																																			TNPO3	-	superfamily_ARM-type_fold	ENSG00000064419		0.622	TNPO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNPO3	HGNC	protein_coding	OTTHUMT00000350929.1	-	0.00	82	0	G	NM_012470		128694795	-1	tier1	-	no_errors	ENST00000393245	ensembl	human	known	74_37	silent	6.25	60	4	SNP	1.000	T
TP53	7157	genome.wustl.edu	37	17	7578542	7578542	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr17:7578542G>C	ENST00000269305.4	-	5	577	c.388C>G	c.(388-390)Ctc>Gtc	p.L130V	TP53_ENST00000359597.4_Missense_Mutation_p.L130V|TP53_ENST00000445888.2_Missense_Mutation_p.L130V|TP53_ENST00000420246.2_Missense_Mutation_p.L130V|TP53_ENST00000413465.2_Missense_Mutation_p.L130V|TP53_ENST00000455263.2_Missense_Mutation_p.L130V|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	130	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		L -> F (in sporadic cancers; somatic mutation).|L -> H (in sporadic cancers; somatic mutation).|L -> I (in a sporadic cancer; somatic mutation).|L -> P (in sporadic cancers; somatic mutation).|L -> R (in sporadic cancers; somatic mutation).|L -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.L130F(16)|p.L130V(11)|p.0?(8)|p.Y126_K132delYSPALNK(6)|p.L37F(3)|p.Y126_N131delYSPALN(3)|p.L130fs*19(2)|p.Y126fs*11(1)|p.S127_Q136del10(1)|p.A129_L130insXX(1)|p.A129_N131delALN(1)|p.V73fs*9(1)|p.Y126fs*18(1)|p.L130fs*39(1)|p.L130fs*16(1)|p.A129_K132delALNK(1)|p.L130_M133delLNKM(1)|p.N131fs*27(1)|p.P13fs*18(1)|p.S127fs*36(1)|p.L130del(1)|p.L130fs*40(1)|p.L130fs*41(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATCTTGTTGAGGGCAGGGGAG	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	65	Substitution - Missense(30)|Deletion - In frame(14)|Deletion - Frameshift(9)|Whole gene deletion(8)|Insertion - Frameshift(3)|Insertion - In frame(1)	large_intestine(11)|breast(9)|ovary(6)|upper_aerodigestive_tract(5)|lung(5)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(4)|prostate(4)|bone(4)|urinary_tract(3)|oesophagus(3)|adrenal_gland(2)|stomach(2)|biliary_tract(1)|skin(1)|liver(1)											45.0	46.0	45.0					17																	7578542		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.388C>G	17.37:g.7578542G>C	ENSP00000269305:p.Leu130Val		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.L130V	ENST00000269305.4	37	c.388	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	18.51	3.640631	0.67244	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000514944;ENST00000508793	D;D;D;D;D;D;D;D	0.99867	-7.31;-7.31;-7.31;-7.31;-7.31;-7.31;-7.31;-7.31	5.48	5.48	0.80851	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99869	0.9938	M	0.86953	2.85	0.58432	D	0.999992	D;D;D;P;D;D;D	0.76494	0.996;0.998;0.995;0.924;0.998;0.997;0.999	P;D;D;B;D;D;D	0.91635	0.899;0.999;0.98;0.388;0.999;0.999;0.989	D	0.96621	0.9459	10	0.87932	D	0	-29.0594	17.2272	0.86973	0.0:0.0:1.0:0.0	.	91;130;130;37;130;130;130	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	V	130;130;130;130;130;130;119;37;37;130	ENSP00000410739:L130V;ENSP00000352610:L130V;ENSP00000269305:L130V;ENSP00000398846:L130V;ENSP00000391127:L130V;ENSP00000391478:L130V;ENSP00000423862:L37V;ENSP00000424104:L130V	ENSP00000269305:L130V	L	-	1	0	TP53	7519267	1.000000	0.71417	0.930000	0.37139	0.764000	0.43329	5.638000	0.67861	2.733000	0.93635	0.655000	0.94253	CTC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	38	0	G	NM_000546		7578542	-1	tier1	-	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	57.69	11	15	SNP	0.985	C
TRIM10	10107	genome.wustl.edu	37	6	30128472	30128472	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr6:30128472G>A	ENST00000449742.2	-	1	239	c.164C>T	c.(163-165)cCt>cTt	p.P55L	TRIM15_ENST00000376694.4_5'Flank|TRIM15_ENST00000376688.1_5'Flank|TRIM10_ENST00000376704.3_Missense_Mutation_p.P55L	NM_006778.3	NP_006769.2	Q9UDY6	TRI10_HUMAN	tripartite motif containing 10	55					erythrocyte differentiation (GO:0030218)|innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)			ovary(1)	1						TGGGCAAGTAGGGGACTCCTC	0.622																																																	0													151.0	159.0	156.0					6																	30128472		2203	4300	6503	SO:0001583	missense	0			Y07829	CCDS4676.1, CCDS34375.1	6p21.3	2013-01-09	2011-01-25	2001-11-23	ENSG00000204613	ENSG00000204613		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10072	protein-coding gene	gene with protein product		605701	"""tripartite motif-containing 10"""	RNF9		9271628, 10207104	Standard	NM_052828		Approved	RFB30, HERF1	uc003npo.3	Q9UDY6	OTTHUMG00000031295	ENST00000449742.2:c.164C>T	6.37:g.30128472G>A	ENSP00000397073:p.Pro55Leu		A6NF84|Q5SRJ5|Q5SRK8|Q86Z08|Q96QB6|Q9C023|Q9C024	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.P55L	ENST00000449742.2	37	c.164	CCDS34375.1	6	.	.	.	.	.	.	.	.	.	.	G	0.012	-1.684064	0.00745	.	.	ENSG00000204613	ENST00000449742;ENST00000376704;ENST00000376706	T;T	0.05319	3.46;3.46	5.37	2.09	0.27110	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	0.288557	0.24907	N	0.034642	T	0.00815	0.0027	N	0.10809	0.05	0.09310	N	1	B;B	0.12630	0.006;0.002	B;B	0.14578	0.011;0.009	T	0.47368	-0.9123	10	0.11182	T	0.66	.	7.0539	0.25089	0.3447:0.0:0.6553:0.0	.	55;55	Q9UDY6;Q9UDY6-2	TRI10_HUMAN;.	L	55	ENSP00000397073:P55L;ENSP00000365894:P55L	ENSP00000365894:P55L	P	-	2	0	TRIM10	30236451	0.001000	0.12720	0.001000	0.08648	0.071000	0.16799	0.862000	0.27899	0.127000	0.18452	0.549000	0.68633	CCT	TRIM10	-	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	ENSG00000204613		0.622	TRIM10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM10	HGNC	protein_coding	OTTHUMT00000076634.1	-	0.00	82	0	G			30128472	-1	tier1	-	no_errors	ENST00000449742	ensembl	human	known	74_37	missense	31.58	26	12	SNP	0.014	A
TRIM36	55521	genome.wustl.edu	37	5	114462496	114462496	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr5:114462496G>T	ENST00000282369.3	-	10	2012	c.1891C>A	c.(1891-1893)Caa>Aaa	p.Q631K	TRIM36_ENST00000513154.1_Missense_Mutation_p.Q619K|TRIM36_ENST00000514154.1_Missense_Mutation_p.Q476K	NM_018700.3	NP_061170.2	Q9NQ86	TRI36_HUMAN	tripartite motif containing 36	631	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				acrosome reaction (GO:0007340)|regulation of cell cycle (GO:0051726)	acrosomal vesicle (GO:0001669)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(1)|kidney(2)|large_intestine(4)|lung(15)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	37		all_cancers(142;0.00133)|all_epithelial(76;2.41e-05)|Prostate(80;0.00955)|Ovarian(225;0.0443)|Breast(839;0.195)		OV - Ovarian serous cystadenocarcinoma(64;3.62e-08)|Epithelial(69;7.69e-08)|all cancers(49;9.33e-06)		GTAAATGGTTGTGAAGAATCA	0.378																																																	0													91.0	91.0	91.0					5																	114462496		2202	4300	6502	SO:0001583	missense	0			AJ272269	CCDS4115.1, CCDS34211.1, CCDS34212.1, CCDS75287.1	5q22	2013-02-11	2011-01-25		ENSG00000152503	ENSG00000152503		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Fibronectin type III domain containing"""	16280	protein-coding gene	gene with protein product	"""zinc-binding protein Rbcc728"", ""tripartite motif protein 36"", ""RING finger protein 98"""	609317	"""tripartite motif-containing 36"""			11331580	Standard	XM_005272031		Approved	RBCC728, RNF98, HAPRIN	uc003kqs.3	Q9NQ86	OTTHUMG00000128892	ENST00000282369.3:c.1891C>A	5.37:g.114462496G>T	ENSP00000282369:p.Gln631Lys		A1L3Z1|A6NDD0|B7Z3V4|B7ZAV7|E9PFI8|Q0P5Z9	Missense_Mutation	SNP	pfam_Znf_B-box,pfam_Fibronectin_type3,pfam_SPRY_rcpt,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Znf_RING,smart_Znf_B-box,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.Q631K	ENST00000282369.3	37	c.1891	CCDS4115.1	5	.	.	.	.	.	.	.	.	.	.	G	23.4	4.408575	0.83340	.	.	ENSG00000152503	ENST00000282369;ENST00000513154;ENST00000514154	T;T;T	0.59083	0.29;0.29;0.29	5.37	5.37	0.77165	Concanavalin A-like lectin/glucanase (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.061993	0.64402	D	0.000003	T	0.66426	0.2788	L	0.53249	1.67	0.80722	D	1	D;P	0.63880	0.993;0.881	P;P	0.60609	0.877;0.855	T	0.59910	-0.7365	10	0.05620	T	0.96	.	19.4818	0.95013	0.0:0.0:1.0:0.0	.	619;631	E9PFI8;Q9NQ86	.;TRI36_HUMAN	K	631;619;476	ENSP00000282369:Q631K;ENSP00000423934:Q619K;ENSP00000424259:Q476K	ENSP00000282369:Q631K	Q	-	1	0	TRIM36	114490395	1.000000	0.71417	0.966000	0.40874	0.941000	0.58515	7.379000	0.79691	2.658000	0.90341	0.591000	0.81541	CAA	TRIM36	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,pfscan_B30.2/SPRY	ENSG00000152503		0.378	TRIM36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM36	HGNC	protein_coding	OTTHUMT00000250854.2	-	0.00	33	0	G	NM_018700		114462496	-1	tier1	-	no_errors	ENST00000282369	ensembl	human	known	74_37	missense	35.71	9	5	SNP	1.000	T
SLC38A6	145389	genome.wustl.edu	37	14	61446377	61446377	+	5'Flank	SNP	C	C	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr14:61446377C>A	ENST00000267488.4	+	0	0				SLC38A6_ENST00000354886.2_5'Flank|TRMT5_ENST00000261249.6_Missense_Mutation_p.R80L|SLC38A6_ENST00000456840.2_5'Flank|RP11-193F5.1_ENST00000553946.1_RNA	NM_153811.2	NP_722518.2	Q8IZM9	S38A6_HUMAN	solute carrier family 38, member 6						amino acid transport (GO:0006865)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(2)|lung(5)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	21				OV - Ovarian serous cystadenocarcinoma(108;0.0981)		TGTCATGCCTCGGACATCAGA	0.378																																																	0													190.0	186.0	187.0					14																	61446377		2203	4300	6503	SO:0001631	upstream_gene_variant	0			AF070578	CCDS9751.1, CCDS53900.1	14q23.1	2013-05-22			ENSG00000139974	ENSG00000139974		"""Solute carriers"""	19863	protein-coding gene	gene with protein product							Standard	NM_153811		Approved	NAT-1	uc001xfh.2	Q8IZM9	OTTHUMG00000140335		14.37:g.61446377C>A	Exception_encountered		C9JWA6|Q86SY5	Missense_Mutation	SNP	pfam_tRNA_Trfase_Trm5/Tyw2	p.R80L	ENST00000267488.4	37	c.239	CCDS9751.1	14	.	.	.	.	.	.	.	.	.	.	C	29.7	5.028970	0.93518	.	.	ENSG00000126814	ENST00000261249;ENST00000553903;ENST00000555420	T	0.33216	1.42	4.59	4.59	0.56863	.	0.000000	0.85682	D	0.000000	T	0.52256	0.1723	M	0.81497	2.545	0.80722	D	1	P	0.48589	0.912	P	0.53722	0.733	T	0.60806	-0.7190	10	0.87932	D	0	-14.2982	17.938	0.89018	0.0:1.0:0.0:0.0	.	80	Q32P41	TRM5_HUMAN	L	80;108;107	ENSP00000261249:R80L	ENSP00000261249:R80L	R	-	2	0	TRMT5	60516130	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.246000	0.78247	2.533000	0.85409	0.655000	0.94253	CGA	TRMT5	-	NULL	ENSG00000126814		0.378	SLC38A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRMT5	HGNC	protein_coding	OTTHUMT00000276957.1	-	0.00	24	0	C			61446377	-1	tier1	-	no_errors	ENST00000261249	ensembl	human	known	74_37	missense	20.00	28	7	SNP	1.000	A
TTN	7273	genome.wustl.edu	37	2	179593288	179593288	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr2:179593288G>T	ENST00000591111.1	-	64	18638	c.18414C>A	c.(18412-18414)taC>taA	p.Y6138*	TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000589042.1_Nonsense_Mutation_p.Y6455*|TTN_ENST00000359218.5_Intron|TTN_ENST00000342175.6_Intron|TTN_ENST00000460472.2_Intron|RP11-171I2.1_ENST00000590024.1_RNA|TTN_ENST00000342992.6_Nonsense_Mutation_p.Y5211*			Q8WZ42	TITIN_HUMAN	titin	12924	Ig-like 42.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCTTGAAAGTGTACTGACCGC	0.408																																																	0													68.0	60.0	63.0					2																	179593288		1902	4130	6032	SO:0001587	stop_gained	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.18414C>A	2.37:g.179593288G>T	ENSP00000465570:p.Tyr6138*		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Nonsense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.Y5211*	ENST00000591111.1	37	c.15633		2	.	.	.	.	.	.	.	.	.	.	G	55	24.953827	0.99963	.	.	ENSG00000155657	ENST00000342992	.	.	.	5.63	-4.09	0.03951	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	17.0743	0.86582	0.309:0.0:0.691:0.0	.	.	.	.	X	5211	.	ENSP00000343764:Y5211X	Y	-	3	2	TTN	179301533	0.963000	0.33076	0.811000	0.32455	0.489000	0.33432	0.171000	0.16685	-0.906000	0.03866	-0.937000	0.02696	TAC	TTN	-	pfam_Ig_I-set,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000155657		0.408	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	61	0	G	NM_133378		179593288	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	nonsense	6.25	60	4	SNP	0.962	T
TTN	7273	genome.wustl.edu	37	2	179638020	179638020	+	Silent	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr2:179638020G>T	ENST00000591111.1	-	33	7895	c.7671C>A	c.(7669-7671)tcC>tcA	p.S2557S	TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000584485.1_RNA|TTN_ENST00000589042.1_Silent_p.S2557S|TTN_ENST00000360870.5_Silent_p.S2557S|TTN_ENST00000359218.5_Silent_p.S2511S|TTN-AS1_ENST00000610005.1_RNA|TTN_ENST00000342175.6_Silent_p.S2511S|TTN_ENST00000460472.2_Silent_p.S2511S|TTN_ENST00000342992.6_Silent_p.S2557S			Q8WZ42	TITIN_HUMAN	titin	12880					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTCCAGAGTGGGACAGCTCAA	0.348																																																	0													42.0	44.0	43.0					2																	179638020		2201	4300	6501	SO:0001819	synonymous_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.7671C>A	2.37:g.179638020G>T			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.S2557	ENST00000591111.1	37	c.7671		2																																																																																			TTN	-	pfam_Ig_I-set,superfamily_RNaseH-like_dom,smart_Ig_sub	ENSG00000155657		0.348	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	81	0	G	NM_133378		179638020	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	silent	6.25	60	4	SNP	0.999	T
UBQLN2	29978	genome.wustl.edu	37	X	56591114	56591114	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chrX:56591114C>T	ENST00000338222.5	+	1	1089	c.808C>T	c.(808-810)Cgc>Tgc	p.R270C		NM_013444.3	NP_038472.2	Q9UHD9	UBQL2_HUMAN	ubiquilin 2	270					cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|endometrium(3)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(1)	21						TGCTTTACGGCGCATGTACAC	0.498																																					Esophageal Squamous(104;218 1492 6022 10838 28884)												0													62.0	60.0	60.0					X																	56591114		2203	4300	6503	SO:0001583	missense	0			AF189009	CCDS14374.1	Xp11.21	2014-09-17			ENSG00000188021	ENSG00000188021		"""Ubiquilin family"""	12509	protein-coding gene	gene with protein product	"""NEDD4 binding protein 4"""	300264				10675567	Standard	NM_013444		Approved	Chap1, Dsk2, RIHFB2157, LIC-2, CHAP1/DSK2, PLIC-2, N4BP4, PLIC2	uc004dus.3	Q9UHD9	OTTHUMG00000021669	ENST00000338222.5:c.808C>T	X.37:g.56591114C>T	ENSP00000345195:p.Arg270Cys		O94798|Q5D027|Q9H3W6|Q9HAZ4	Missense_Mutation	SNP	pfam_Ubiquitin_dom,pfam_Rad60/SUMO_like,pfam_UBA/Ts_N,superfamily_UBA-like,superfamily_ARM-type_fold,superfamily_XPC-bd,smart_Ubiquitin_dom,smart_STI1_HS-bd,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Ubiquitin_supergroup	p.R270C	ENST00000338222.5	37	c.808	CCDS14374.1	X	.	.	.	.	.	.	.	.	.	.	C	13.86	2.361714	0.41801	.	.	ENSG00000188021	ENST00000338222;ENST00000535171	T	0.80994	-1.44	5.05	4.18	0.49190	.	0.000000	0.64402	D	0.000006	D	0.90195	0.6935	M	0.93462	3.42	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.77557	0.943;0.99	D	0.89685	0.3893	10	0.87932	D	0	-7.1392	5.8298	0.18574	0.1891:0.7114:0.0:0.0995	.	270;270	B4DZF1;Q9UHD9	.;UBQL2_HUMAN	C	270	ENSP00000345195:R270C	ENSP00000345195:R270C	R	+	1	0	UBQLN2	56607839	1.000000	0.71417	0.997000	0.53966	0.818000	0.46254	3.423000	0.52756	1.254000	0.44035	-0.208000	0.12717	CGC	UBQLN2	-	NULL	ENSG00000188021		0.498	UBQLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBQLN2	HGNC	protein_coding	OTTHUMT00000056891.1	-	0.00	28	0	C	NM_013444		56591114	+1	tier1	-	no_errors	ENST00000338222	ensembl	human	known	74_37	missense	80.95	4	17	SNP	1.000	T
UEVLD	55293	genome.wustl.edu	37	11	18566293	18566293	+	Nonsense_Mutation	SNP	G	G	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr11:18566293G>A	ENST00000541984.1	-	6	528	c.466C>T	c.(466-468)Cga>Tga	p.R156*	UEVLD_ENST00000535484.1_Nonsense_Mutation_p.R275*|UEVLD_ENST00000543987.1_Nonsense_Mutation_p.R313*|UEVLD_ENST00000540666.1_5'UTR|UEVLD_ENST00000320750.6_Nonsense_Mutation_p.R291*|UEVLD_ENST00000379387.4_Nonsense_Mutation_p.R291*|UEVLD_ENST00000396197.3_Nonsense_Mutation_p.R313*	NM_001261386.1	NP_001248315.1			UEV and lactate/malate dehyrogenase domains											endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	8						CCGATCACTCGATTTGCAGGA	0.323																																																	0													120.0	112.0	114.0					11																	18566293		2199	4293	6492	SO:0001587	stop_gained	0			AF503350	CCDS7843.1, CCDS41624.1, CCDS58122.1, CCDS58123.1, CCDS58124.1, CCDS58125.1, CCDS73266.1	11p15.1	2006-07-14			ENSG00000151116	ENSG00000151116			30866	protein-coding gene	gene with protein product		610985				12427560	Standard	NM_001040697		Approved	Attp, UEV3	uc001mot.4	Q8IX04	OTTHUMG00000167729	ENST00000541984.1:c.466C>T	11.37:g.18566293G>A	ENSP00000437538:p.Arg156*			Nonsense_Mutation	SNP	pfam_UEV_N,pfam_Lactate/malate_DH_N,pfam_Lactate/malate_DH_C,superfamily_UBQ-conjugating_enzyme/RWD,superfamily_Lactate_DH/Glyco_Ohase_4_C,prints_L-lactate/malate_DH	p.R313*	ENST00000541984.1	37	c.937	CCDS58125.1	11	.	.	.	.	.	.	.	.	.	.	G	36	5.897307	0.97081	.	.	ENSG00000151116	ENST00000543987;ENST00000535484;ENST00000396197;ENST00000320750;ENST00000379387;ENST00000540110;ENST00000541984	.	.	.	5.53	4.59	0.56863	.	0.442567	0.24823	N	0.035315	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-1.7315	13.4433	0.61125	0.0:0.0:0.645:0.355	.	.	.	.	X	313;275;313;291;291;90;156	.	ENSP00000323353:R291X	R	-	1	2	UEVLD	18522869	0.995000	0.38212	0.970000	0.41538	0.983000	0.72400	4.882000	0.63121	1.278000	0.44430	0.650000	0.86243	CGA	UEVLD	-	pfam_Lactate/malate_DH_N	ENSG00000151116		0.323	UEVLD-015	NOVEL	basic|exp_conf|CCDS	protein_coding	UEVLD	HGNC	protein_coding	OTTHUMT00000395928.1		0.00	29	0	G	NM_018314		18566293	-1			no_errors	ENST00000396197	ensembl	human	known	74_37	nonsense	5.71	33	2	SNP	0.991	A
UMOD	7369	genome.wustl.edu	37	16	20355434	20355434	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr16:20355434G>A	ENST00000570689.1	-	6	1389	c.1243C>T	c.(1243-1245)Cgt>Tgt	p.R415C	UMOD_ENST00000570331.1_5'Flank|UMOD_ENST00000302509.4_Missense_Mutation_p.R415C|UMOD_ENST00000424589.1_Missense_Mutation_p.R448C|UMOD_ENST00000396142.2_Missense_Mutation_p.R415C|UMOD_ENST00000396134.2_Missense_Mutation_p.R448C|UMOD_ENST00000396138.4_Missense_Mutation_p.R464C			P07911	UROM_HUMAN	uromodulin	415	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				cellular defense response (GO:0006968)|chemical homeostasis (GO:0048878)|excretion (GO:0007588)|heterophilic cell-cell adhesion (GO:0007157)|leukocyte cell-cell adhesion (GO:0007159)|metanephric ascending thin limb development (GO:0072218)|metanephric distal convoluted tubule development (GO:0072221)|metanephric thick ascending limb development (GO:0072233)|negative regulation of cell proliferation (GO:0008285)|neutrophil migration (GO:1990266)|regulation of ion homeostasis (GO:2000021)|response to organic substance (GO:0010033)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|primary cilium (GO:0072372)|spindle pole (GO:0000922)	calcium ion binding (GO:0005509)|IgG binding (GO:0019864)			endometrium(5)|kidney(1)|large_intestine(7)|lung(20)|ovary(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	41						TTGAGGTCACGGATGATGATC	0.547																																																	0													173.0	144.0	154.0					16																	20355434		2203	4300	6503	SO:0001583	missense	0			M17778	CCDS10583.1, CCDS61876.1	16p12.3	2008-06-23	2008-06-23		ENSG00000169344	ENSG00000169344			12559	protein-coding gene	gene with protein product	"""Tamm-Horsfall glycoprotein"", ""uromucoid"""	191845	"""uromodulin (uromucoid, Tamm-Horsfall glycoprotein)"""			8382593	Standard	NM_003361		Approved		uc002dha.3	P07911	OTTHUMG00000131488	ENST00000570689.1:c.1243C>T	16.37:g.20355434G>A	ENSP00000460548:p.Arg415Cys		B3KP48|B3KRN9|E9PEA4|Q540J6|Q6ZS84|Q8IYG0	Missense_Mutation	SNP	pfam_ZP_dom,pfam_EGF-like_Ca-bd_dom,pfam_EG-like_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_ZP_dom,pfscan_EG-like_dom,pfscan_ZP_dom,prints_ZP_dom	p.R448C	ENST00000570689.1	37	c.1342	CCDS10583.1	16	.	.	.	.	.	.	.	.	.	.	G	18.22	3.575449	0.65878	.	.	ENSG00000169344	ENST00000396138;ENST00000396134;ENST00000424589;ENST00000302509;ENST00000429954;ENST00000396142	D;D;D;D	0.85629	-2.01;-2.01;-2.01;-2.01	5.56	2.29	0.28610	Zona pellucida sperm-binding protein (3);	0.130764	0.35151	N	0.003408	D	0.93019	0.7778	M	0.92555	3.32	0.47037	D	0.99929	D;D	0.89917	1.0;1.0	D;D	0.74023	0.966;0.982	D	0.93514	0.6855	10	0.87932	D	0	-13.7945	12.2051	0.54348	0.0:0.0:0.4274:0.5726	.	448;415	E9PEA4;P07911	.;UROM_HUMAN	C	415;448;448;415;393;415	ENSP00000379438:R448C;ENSP00000416346:R448C;ENSP00000306279:R415C;ENSP00000379446:R415C	ENSP00000306279:R415C	R	-	1	0	UMOD	20262935	0.981000	0.34729	0.991000	0.47740	0.992000	0.81027	0.843000	0.27640	0.672000	0.31204	0.655000	0.94253	CGT	UMOD	-	pfam_ZP_dom,smart_ZP_dom,pfscan_ZP_dom	ENSG00000169344		0.547	UMOD-008	KNOWN	basic|appris_principal|CCDS	protein_coding	UMOD	HGNC	protein_coding	OTTHUMT00000436862.1		0.00	25	0	G			20355434	-1			no_errors	ENST00000424589	ensembl	human	known	74_37	missense	5.66	50	3	SNP	0.996	A
UNC5D	137970	genome.wustl.edu	37	8	35583947	35583947	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr8:35583947G>T	ENST00000404895.2	+	10	1909	c.1581G>T	c.(1579-1581)atG>atT	p.M527I	UNC5D_ENST00000416672.1_Missense_Mutation_p.M532I|UNC5D_ENST00000453357.2_Missense_Mutation_p.M522I|UNC5D_ENST00000420357.1_Missense_Mutation_p.M460I|UNC5D_ENST00000287272.2_Missense_Mutation_p.M458I|UNC5D_ENST00000449677.1_Missense_Mutation_p.M103I	NM_080872.2	NP_543148.2	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D (C. elegans)	527					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|pyramidal neuron differentiation (GO:0021859)|regulation of neuron migration (GO:2001222)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(2)|breast(7)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(56)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(6)|urinary_tract(2)	112				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		GAAATAAAATGCCCTACATCC	0.468																																																	0													119.0	121.0	121.0					8																	35583947		2203	4300	6503	SO:0001583	missense	0			AB055056	CCDS6093.2	8p12	2013-01-11			ENSG00000156687	ENSG00000156687		"""Immunoglobulin superfamily / I-set domain containing"""	18634	protein-coding gene	gene with protein product						18402767	Standard	NM_080872		Approved	KIAA1777, Unc5h4	uc003xjr.2	Q6UXZ4	OTTHUMG00000157145	ENST00000404895.2:c.1581G>T	8.37:g.35583947G>T	ENSP00000385143:p.Met527Ile		Q8WYP7	Missense_Mutation	SNP	pfam_ZU5,pfam_Ig_I-set,pfam_Thrombospondin_1_rpt,pfam_Death_domain,pfam_Immunoglobulin,superfamily_DEATH-like_dom,superfamily_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,smart_Thrombospondin_1_rpt,smart_ZU5,smart_Death_domain,pfscan_Thrombospondin_1_rpt,pfscan_ZU5,pfscan_Ig-like_dom	p.M527I	ENST00000404895.2	37	c.1581	CCDS6093.2	8	.	.	.	.	.	.	.	.	.	.	G	0.556	-0.847468	0.02651	.	.	ENSG00000156687	ENST00000404895;ENST00000420357;ENST00000287272;ENST00000416672;ENST00000453357;ENST00000449677	T;T;T;T;T;T	0.52983	0.67;1.12;1.12;0.67;0.64;2.58	5.8	-11.6	0.00059	.	1.028080	0.07622	N	0.927141	T	0.21801	0.0525	N	0.08118	0	0.09310	N	1	B;B;B;B	0.09022	0.0;0.0;0.002;0.001	B;B;B;B	0.06405	0.0;0.0;0.002;0.001	T	0.50101	-0.8867	10	0.24483	T	0.36	-1.1465	12.1925	0.54278	0.1333:0.1308:0.5793:0.1565	.	103;532;522;527	E9PDS8;C9J2B6;Q6UXZ4-2;Q6UXZ4	.;.;.;UNC5D_HUMAN	I	527;460;458;532;522;103	ENSP00000385143:M527I;ENSP00000392739:M460I;ENSP00000287272:M458I;ENSP00000412652:M532I;ENSP00000394303:M522I;ENSP00000397211:M103I	ENSP00000287272:M458I	M	+	3	0	UNC5D	35703489	0.000000	0.05858	0.000000	0.03702	0.276000	0.26787	-3.606000	0.00416	-5.341000	0.00016	-2.010000	0.00438	ATG	UNC5D	-	NULL	ENSG00000156687		0.468	UNC5D-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	UNC5D	HGNC	protein_coding	OTTHUMT00000347586.2	-	0.00	110	0	G			35583947	+1	tier1	-	no_errors	ENST00000404895	ensembl	human	known	74_37	missense	32.79	41	20	SNP	0.000	T
UNC93A	54346	genome.wustl.edu	37	6	167704959	167704959	+	5'UTR	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr6:167704959G>T	ENST00000230256.3	+	0	157				UNC93A_ENST00000366829.2_5'UTR|UNC93A_ENST00000366830.2_3'UTR	NM_018974.3	NP_061847.2	Q86WB7	UN93A_HUMAN	unc-93 homolog A (C. elegans)							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	40		Breast(66;7.62e-05)|Ovarian(120;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.22e-20)|BRCA - Breast invasive adenocarcinoma(81;6.17e-07)|GBM - Glioblastoma multiforme(31;0.00492)		ACTGGTGATTGATCTTTTCAT	0.443																																																	0													161.0	144.0	149.0					6																	167704959		2203	4300	6503	SO:0001623	5_prime_UTR_variant	0			AJ508812	CCDS5300.1, CCDS47515.1	6q27	2014-05-16	2001-11-28		ENSG00000112494	ENSG00000112494			12570	protein-coding gene	gene with protein product		607995	"""unc93 (C.elegans) homolog A"""			12381271	Standard	NM_001143947		Approved	dJ366N23.2, dJ366N23.1	uc003qvq.3	Q86WB7	OTTHUMG00000016021	ENST00000230256.3:c.-19G>T	6.37:g.167704959G>T			B3KRP5|Q4QQJ4|Q5JZD6	RNA	SNP	-	NULL	ENST00000230256.3	37	NULL	CCDS5300.1	6																																																																																			UNC93A	-	-	ENSG00000112494		0.443	UNC93A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC93A	HGNC	protein_coding	OTTHUMT00000043125.2	-	0.00	62	0	G	NM_018974		167704959	+1	tier1	-	no_errors	ENST00000366830	ensembl	human	known	74_37	rna	5.71	66	4	SNP	0.001	T
UPK1A	11045	genome.wustl.edu	37	19	36159309	36159309	+	Intron	SNP	G	G	C			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr19:36159309G>C	ENST00000222275.2	+	2	84				UPK1A_ENST00000379013.2_Intron|UPK1A-AS1_ENST00000443196.1_RNA	NM_007000.2	NP_008931.1	O00322	UPK1A_HUMAN	uroplakin 1A						epithelial cell differentiation (GO:0030855)|protein oligomerization (GO:0051259)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	monosaccharide binding (GO:0048029)|protein homodimerization activity (GO:0042803)			breast(1)|large_intestine(4)|lung(2)|stomach(2)	9	all_lung(56;2.22e-07)|Lung NSC(56;3.47e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CCTGGTGCCAGGGCTGCTGGC	0.602																																																	0													46.0	34.0	38.0					19																	36159309		2203	4300	6503	SO:0001627	intron_variant	0			AF085807	CCDS12470.1, CCDS62640.1	19q13.1	2013-02-14			ENSG00000105668	ENSG00000105668		"""Tetraspanins"""	12577	protein-coding gene	gene with protein product		611557				9846985, 10404304	Standard	NM_007000		Approved	TSPAN21	uc002oaw.3	O00322	OTTHUMG00000048115	ENST00000222275.2:c.85-47G>C	19.37:g.36159309G>C			Q3KNU5|Q3KNU6	RNA	SNP	-	NULL	ENST00000222275.2	37	NULL	CCDS12470.1	19																																																																																			UPK1A-AS1	-	-	ENSG00000226510		0.602	UPK1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UPK1A-AS1	HGNC	protein_coding	OTTHUMT00000109486.3	-	0.00	36	0	G			36159309	-1	tier1	-	no_errors	ENST00000443196	ensembl	human	known	74_37	rna	20.83	19	5	SNP	0.000	C
URGCP	55665	genome.wustl.edu	37	7	43918839	43918839	+	Nonsense_Mutation	SNP	C	C	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr7:43918839C>A	ENST00000453200.1	-	6	716	c.223G>T	c.(223-225)Gaa>Taa	p.E75*	URGCP_ENST00000223341.7_Nonsense_Mutation_p.E32*|URGCP_ENST00000402306.3_Nonsense_Mutation_p.E66*|URGCP_ENST00000497914.1_5'UTR|URGCP_ENST00000443736.1_Nonsense_Mutation_p.E32*|URGCP-MRPS24_ENST00000603700.1_Intron|URGCP_ENST00000336086.6_Nonsense_Mutation_p.E32*|URGCP_ENST00000447717.3_Nonsense_Mutation_p.E32*			Q8TCY9	URGCP_HUMAN	upregulator of cell proliferation	75					cell cycle (GO:0007049)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)	p.E32*(1)		breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|liver(1)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						GACAGCATTTCTTGAAGCCTG	0.517																																																	1	Substitution - Nonsense(1)	endometrium(1)											53.0	55.0	55.0					7																	43918839		1930	4136	6066	SO:0001587	stop_gained	0				CCDS43572.1, CCDS47577.1, CCDS47578.1	7p13	2010-02-17			ENSG00000106608	ENSG00000106608			30890	protein-coding gene	gene with protein product	"""up-regulated gene 4"""	610337				10819331, 12082552	Standard	NM_017920		Approved	URG4, KIAA1507, FLJ20654, DKFZp666G166, DKFZp686O0457	uc003tiw.3	Q8TCY9	OTTHUMG00000155245	ENST00000453200.1:c.223G>T	7.37:g.43918839C>A	ENSP00000396918:p.Glu75*		E9PFF6|Q658M4|Q68DH6|Q6MZZ5|Q8WV98|Q9NWR7|Q9P221	Nonsense_Mutation	SNP	superfamily_P-loop_NTPase,prints_GTP_binding_domain	p.E75*	ENST00000453200.1	37	c.223	CCDS47578.1	7	.	.	.	.	.	.	.	.	.	.	C	40	7.976111	0.98591	.	.	ENSG00000106608	ENST00000223341;ENST00000336086;ENST00000402306;ENST00000443736;ENST00000453200;ENST00000447717;ENST00000426198;ENST00000455877	.	.	.	5.82	4.93	0.64822	.	0.598429	0.17090	N	0.187406	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	-20.7352	7.9284	0.29889	0.0:0.8311:0.0:0.1689	.	.	.	.	X	32;32;66;32;75;32;32;32	.	ENSP00000223341:E32X	E	-	1	0	URGCP	43885364	0.006000	0.16342	1.000000	0.80357	0.999000	0.98932	0.601000	0.24119	2.761000	0.94854	0.655000	0.94253	GAA	URGCP	-	NULL	ENSG00000106608		0.517	URGCP-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	URGCP	HGNC	protein_coding	OTTHUMT00000338995.1	-	0.00	60	0	C	NM_001077664		43918839	-1	tier1	-	no_errors	ENST00000453200	ensembl	human	known	74_37	nonsense	16.47	71	14	SNP	0.989	A
USP24	23358	genome.wustl.edu	37	1	55620084	55620084	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr1:55620084C>T	ENST00000294383.6	-	14	1609	c.1610G>A	c.(1609-1611)cGa>cAa	p.R537Q	USP24_ENST00000407756.1_Intron	NM_015306.2	NP_056121.2	Q9UPU5	UBP24_HUMAN	ubiquitin specific peptidase 24	537					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(4)|cervix(1)|endometrium(8)|kidney(13)|large_intestine(7)|lung(16)|ovary(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	60						CCGGCCTATTCGTCCAATCAG	0.448																																																	0													95.0	85.0	88.0					1																	55620084		692	1591	2283	SO:0001583	missense	0			AB028980	CCDS44154.1, CCDS44154.2	1p32.3	2008-04-11	2005-08-08		ENSG00000162402	ENSG00000162402		"""Ubiquitin-specific peptidases"""	12623	protein-coding gene	gene with protein product		610569	"""ubiquitin specific protease 24"""			12838346	Standard	NM_015306		Approved	KIAA1057	uc021onw.1	Q9UPU5	OTTHUMG00000008135	ENST00000294383.6:c.1610G>A	1.37:g.55620084C>T	ENSP00000294383:p.Arg537Gln		Q6ZSY2|Q8N2Y4|Q9NXD1	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,superfamily_UBA-like,superfamily_ARM-type_fold,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Peptidase_C19/C67	p.R537Q	ENST00000294383.6	37	c.1610	CCDS44154.2	1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.175730	0.78564	.	.	ENSG00000162402	ENST00000294383	T	0.66280	-0.2	6.03	6.03	0.97812	.	0.000000	0.64402	D	0.000001	T	0.61615	0.2361	N	0.20685	0.6	0.80722	D	1	.	.	.	.	.	.	T	0.56661	-0.7942	8	0.32370	T	0.25	.	20.5568	0.99304	0.0:1.0:0.0:0.0	.	.	.	.	Q	537	ENSP00000294383:R537Q	ENSP00000294383:R537Q	R	-	2	0	USP24	55392672	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	7.818000	0.86416	2.861000	0.98227	0.655000	0.94253	CGA	USP24	-	superfamily_ARM-type_fold	ENSG00000162402		0.448	USP24-001	NOVEL	basic|appris_principal|CCDS	protein_coding	USP24	HGNC	protein_coding	OTTHUMT00000022275.2	-	0.00	47	0	C			55620084	-1	tier1	-	no_errors	ENST00000294383	ensembl	human	novel	74_37	missense	19.35	50	12	SNP	1.000	T
VARS	7407	genome.wustl.edu	37	6	31759425	31759425	+	Silent	SNP	A	A	G			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr6:31759425A>G	ENST00000375663.3	-	8	1502	c.1062T>C	c.(1060-1062)caT>caC	p.H354H	VARS_ENST00000444930.2_Silent_p.H59H	NM_006295.2	NP_006286.1	P26640	SYVC_HUMAN	valyl-tRNA synthetase	354					gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)|valyl-tRNA aminoacylation (GO:0006438)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|valine-tRNA ligase activity (GO:0004832)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(18)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	30					L-Valine(DB00161)	TGGTGAGTGCATGGCCCAGGT	0.572																																																	0													152.0	111.0	126.0					6																	31759425		1511	2708	4219	SO:0001819	synonymous_variant	0			BC012808	CCDS34412.1	6p21.3	2011-07-01		2005-07-05	ENSG00000204394	ENSG00000204394	6.1.1.9	"""Aminoacyl tRNA synthetases / Class I"""	12651	protein-coding gene	gene with protein product	"""valine tRNA ligase 1, cytoplasmic"""	192150	"""valyl-tRNA synthetase 2"""	VARS2		15779907	Standard	XM_005249362		Approved		uc003nxe.3	P26640	OTTHUMG00000031286	ENST00000375663.3:c.1062T>C	6.37:g.31759425A>G			B0V1N1|B4DZ61|Q5JQ90|Q96E77|Q9UQM2	Silent	SNP	pfam_aa-tRNA-synth_Ia,pfam_V/L/I-tRNA-synth_anticodon-bd,pfam_Glutathione_S-Trfase_N,pfam_Methionyl/Leucyl_tRNA_Synth,pfam_GST_C,superfamily_Val/Leu/Ile-tRNA-synth_edit,superfamily_tRNAsynth_1a_anticodon-bd,superfamily_Glutathione-S-Trfase_C-like,superfamily_tRNA-bd_arm,prints_Valyl-tRNA_ligase,tigrfam_Valyl-tRNA_ligase	p.H354	ENST00000375663.3	37	c.1062	CCDS34412.1	6																																																																																			VARS	-	pfam_aa-tRNA-synth_Ia,pfam_Methionyl/Leucyl_tRNA_Synth,tigrfam_Valyl-tRNA_ligase	ENSG00000204394		0.572	VARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VARS	HGNC	protein_coding	OTTHUMT00000076619.2	-	0.00	44	0	A	NM_006295		31759425	-1	tier1	-	no_errors	ENST00000375663	ensembl	human	known	74_37	silent	10.00	36	4	SNP	0.309	G
VIT	5212	genome.wustl.edu	37	2	36970377	36970377	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr2:36970377G>T	ENST00000389975.3	+	4	555	c.253G>T	c.(253-255)Gtg>Ttg	p.V85L	VIT_ENST00000404084.1_Missense_Mutation_p.V63L|VIT_ENST00000379241.3_Missense_Mutation_p.V85L|VIT_ENST00000457137.2_Missense_Mutation_p.V85L|VIT_ENST00000497382.1_5'UTR|VIT_ENST00000379242.3_Missense_Mutation_p.V85L|VIT_ENST00000401530.1_Missense_Mutation_p.V85L	NM_001177969.1|NM_001177970.1	NP_001171440.1|NP_001171441.1	Q6UXI7	VITRN_HUMAN	vitrin	85	LCCL. {ECO:0000255|PROSITE- ProRule:PRU00123}.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	interstitial matrix (GO:0005614)	glycosaminoglycan binding (GO:0005539)			autonomic_ganglia(1)|breast(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	57		all_hematologic(82;0.248)				CTACTCCAGTGTGTGTGGCGC	0.483																																																	0													120.0	101.0	107.0					2																	36970377		2203	4300	6503	SO:0001583	missense	0			AF063833	CCDS33180.1, CCDS54347.1, CCDS54348.1, CCDS54349.1, CCDS54350.1	2p22.2	2008-05-15			ENSG00000205221	ENSG00000205221			12697	protein-coding gene	gene with protein product							Standard	NM_001177969		Approved		uc002rpl.3	Q6UXI7	OTTHUMG00000152149	ENST00000389975.3:c.253G>T	2.37:g.36970377G>T	ENSP00000374625:p.Val85Leu		A1A526|A6NKI9|A8K7Y4|E9PF47|Q6P7T3|Q96DM8|Q96DT1|Q9UDN0	Missense_Mutation	SNP	pfam_VWF_A,pfam_LCCL,superfamily_LCCL,smart_LCCL,smart_VWF_A,pfscan_LCCL,pfscan_VWF_A	p.V85L	ENST00000389975.3	37	c.253	CCDS54347.1	2	.	.	.	.	.	.	.	.	.	.	G	10.37	1.331982	0.24167	.	.	ENSG00000205221	ENST00000379242;ENST00000389975;ENST00000402257;ENST00000457137;ENST00000404084;ENST00000379241;ENST00000401530	D;D;D;D;D;D	0.89485	-2.52;-2.52;-2.52;-2.52;-2.52;-2.52	4.78	3.83	0.44106	LCCL (5);	0.144426	0.47852	D	0.000204	T	0.77046	0.4073	N	0.11927	0.2	0.36724	D	0.881324	B;B;B;B;B;B	0.16802	0.015;0.008;0.006;0.017;0.007;0.019	B;B;B;B;B;B	0.21360	0.034;0.01;0.006;0.032;0.009;0.006	T	0.75619	-0.3255	10	0.52906	T	0.07	-13.2109	7.1719	0.25722	0.0875:0.0:0.742:0.1705	.	85;85;85;85;85;85	B4DRU4;E9PF47;Q6UXI7-2;Q6UXI7;Q6UXI7-4;Q6UXI7-3	.;.;.;VITRN_HUMAN;.;.	L	85;85;85;85;63;85;85	ENSP00000368544:V85L;ENSP00000374625:V85L;ENSP00000393561:V85L;ENSP00000384154:V63L;ENSP00000368543:V85L;ENSP00000385658:V85L	ENSP00000368543:V85L	V	+	1	0	VIT	36823881	0.998000	0.40836	1.000000	0.80357	0.322000	0.28314	1.806000	0.38892	2.363000	0.80096	0.655000	0.94253	GTG	VIT	-	pfam_LCCL,superfamily_LCCL,smart_LCCL,pfscan_LCCL	ENSG00000205221		0.483	VIT-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	VIT	HGNC	protein_coding		-	0.00	48	0	G			36970377	+1	tier1	-	no_errors	ENST00000379242	ensembl	human	known	74_37	missense	6.90	54	4	SNP	1.000	T
VKORC1	79001	genome.wustl.edu	37	16	31105918	31105918	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr16:31105918C>G	ENST00000394975.2	-	1	360	c.133G>C	c.(133-135)Gtg>Ctg	p.V45L	VKORC1_ENST00000498155.1_Intron|VKORC1_ENST00000319788.7_Missense_Mutation_p.V45L|RP11-196G11.1_ENST00000529564.1_Missense_Mutation_p.V45L|VKORC1_ENST00000394971.3_5'Flank|VKORC1_ENST00000300851.6_Missense_Mutation_p.V45L|VKORC1_ENST00000354895.4_Missense_Mutation_p.V45L	NM_024006.4	NP_076869.1	Q9BQB6	VKOR1_HUMAN	vitamin K epoxide reductase complex, subunit 1	45			V -> A (in CMRES; dbSNP:rs104894540). {ECO:0000269|PubMed:14765194}.		blood coagulation (GO:0007596)|bone development (GO:0060348)|cellular protein metabolic process (GO:0044267)|drug metabolic process (GO:0017144)|peptidyl-glutamic acid carboxylation (GO:0017187)|post-translational protein modification (GO:0043687)|vitamin K metabolic process (GO:0042373)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	quinone binding (GO:0048038)|vitamin-K-epoxide reductase (warfarin-sensitive) activity (GO:0047057)			lung(3)|urinary_tract(1)	4					Acenocoumarol(DB01418)|Dicoumarol(DB00266)|Menadione(DB00170)|Phenindione(DB00498)|Phenprocoumon(DB00946)|Warfarin(DB00682)	GCGGTGCCCACGTCGCAGAGC	0.697																																																	0													13.0	14.0	14.0					16																	31105918		2193	4276	6469	SO:0001583	missense	0				CCDS10703.1, CCDS10704.1	16p11.2	2008-02-05	2004-07-23		ENSG00000167397	ENSG00000167397			23663	protein-coding gene	gene with protein product		608547	"""vitamin K dependent clotting factors deficiency 2"""	VKCFD2			Standard	NM_024006		Approved		uc002eas.3	Q9BQB6	OTTHUMG00000047408	ENST00000394975.2:c.133G>C	16.37:g.31105918C>G	ENSP00000378426:p.Val45Leu		A6NIQ6|B2R4Z6|Q6UX90|Q7Z2R4	Missense_Mutation	SNP	pfam_VKOR,smart_VKOR	p.V45L	ENST00000394975.2	37	c.133	CCDS10703.1	16	.	.	.	.	.	.	.	.	.	.	C	15.96	2.985463	0.53934	.	.	ENSG00000167397;ENSG00000167397;ENSG00000167397;ENSG00000167397;ENSG00000255439	ENST00000300851;ENST00000319788;ENST00000354895;ENST00000394975;ENST00000529564	D;D;D;D;D	0.98012	-4.66;-4.66;-4.66;-4.66;-4.66	4.63	4.63	0.57726	Vitamin K epoxide reductase (2);	0.000000	0.43579	D	0.000555	D	0.95332	0.8485	N	0.05306	-0.075	0.80722	D	1	B;D;B	0.76494	0.363;0.999;0.431	B;D;B	0.83275	0.101;0.996;0.148	D	0.91496	0.5215	10	0.08837	T	0.75	6.8411	11.1283	0.48333	0.0:0.8132:0.1868:0.0	.	45;45;45	Q9BQB6-2;A6NIQ6;Q9BQB6	.;.;VKOR1_HUMAN	L	45	ENSP00000300851:V45L;ENSP00000326135:V45L;ENSP00000346969:V45L;ENSP00000378426:V45L;ENSP00000431371:V45L	ENSP00000431371:V45L	V	-	1	0	RP11-196G11.1;VKORC1	31013419	1.000000	0.71417	1.000000	0.80357	0.743000	0.42351	1.151000	0.31651	2.579000	0.87056	0.313000	0.20887	GTG	VKORC1	-	pfam_VKOR,smart_VKOR	ENSG00000167397		0.697	VKORC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VKORC1	HGNC	protein_coding	OTTHUMT00000108582.1	-	0.00	25	0	C	NM_024006		31105918	-1	tier1	-	no_errors	ENST00000394975	ensembl	human	known	74_37	missense	11.43	31	4	SNP	1.000	G
VWCE	220001	genome.wustl.edu	37	11	61048112	61048112	+	Silent	SNP	G	G	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr11:61048112G>A	ENST00000335613.5	-	9	1694	c.1308C>T	c.(1306-1308)tgC>tgT	p.C436C		NM_152718.2	NP_689931.2	Q96DN2	VWCE_HUMAN	von Willebrand factor C and EGF domains	436	VWFC 1. {ECO:0000255|PROSITE- ProRule:PRU00220}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			biliary_tract(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(17)|ovary(3)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37						ACGATGGGCAGCACCCACCAT	0.547																																																	0													109.0	89.0	96.0					11																	61048112		2203	4299	6502	SO:0001819	synonymous_variant	0			AK056571	CCDS8002.1	11q12.2	2006-08-04			ENSG00000167992	ENSG00000167992			26487	protein-coding gene	gene with protein product		611115				12869306	Standard	NM_152718		Approved	URG11, FLJ32009, VWC1	uc001nra.3	Q96DN2	OTTHUMG00000168208	ENST00000335613.5:c.1308C>T	11.37:g.61048112G>A			A5PKV0|Q7Z7L6|Q86WK8	Silent	SNP	pfam_VWF_C,pfam_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_VWF_C,smart_VWC_out,pfscan_EG-like_dom,pfscan_VWF_C	p.C436	ENST00000335613.5	37	c.1308	CCDS8002.1	11																																																																																			VWCE	-	pfam_VWF_C,smart_VWF_C,pfscan_VWF_C	ENSG00000167992		0.547	VWCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VWCE	HGNC	protein_coding	OTTHUMT00000398811.1	-	0.00	64	0	G	NM_152718		61048112	-1	tier1	-	no_errors	ENST00000335613	ensembl	human	known	74_37	silent	7.55	49	4	SNP	1.000	A
WDR60	55112	genome.wustl.edu	37	7	158727131	158727131	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr7:158727131G>T	ENST00000407559.3	+	23	2827	c.2669G>T	c.(2668-2670)aGa>aTa	p.R890I		NM_018051.4	NP_060521.4	Q8WVS4	WDR60_HUMAN	WD repeat domain 60	890					cell projection organization (GO:0030030)	cilium (GO:0005929)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				NS(3)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(4)|lung(16)|ovary(2)	35	Ovarian(565;0.152)	all_cancers(7;1.25e-09)|all_epithelial(9;0.000894)|all_hematologic(28;0.00603)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)|STAD - Stomach adenocarcinoma(7;0.18)		CATGGCACAAGACAAGATTTG	0.423																																																	0													51.0	50.0	50.0					7																	158727131		1909	4102	6011	SO:0001583	missense	0				CCDS47757.1	7q36.3	2013-11-15			ENSG00000126870	ENSG00000126870		"""WD repeat domain containing"""	21862	protein-coding gene	gene with protein product		615462				23910462	Standard	NM_018051		Approved	FLJ10300, FAP163	uc003woe.4	Q8WVS4	OTTHUMG00000151443	ENST00000407559.3:c.2669G>T	7.37:g.158727131G>T	ENSP00000384290:p.Arg890Ile		Q9NW58	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat	p.R890I	ENST00000407559.3	37	c.2669	CCDS47757.1	7	.	.	.	.	.	.	.	.	.	.	G	16.80	3.222540	0.58668	.	.	ENSG00000126870	ENST00000407559	T	0.62639	0.01	5.45	5.45	0.79879	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.099468	0.64402	D	0.000001	T	0.80476	0.4630	M	0.81497	2.545	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.994;0.999	T	0.82277	-0.0537	10	0.66056	D	0.02	-28.5559	16.8145	0.85730	0.0:0.0:1.0:0.0	.	373;890	A4D230;Q8WVS4	.;WDR60_HUMAN	I	890	ENSP00000384290:R890I	ENSP00000384290:R890I	R	+	2	0	WDR60	158419892	1.000000	0.71417	0.058000	0.19502	0.011000	0.07611	7.234000	0.78134	2.708000	0.92522	0.650000	0.86243	AGA	WDR60	-	superfamily_WD40_repeat_dom	ENSG00000126870		0.423	WDR60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR60	HGNC	protein_coding	OTTHUMT00000322668.1	-	0.00	70	0	G	NM_018051		158727131	+1	tier1	-	no_errors	ENST00000407559	ensembl	human	known	74_37	missense	50.00	31	31	SNP	0.992	T
YARS2	51067	genome.wustl.edu	37	12	32908804	32908804	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr12:32908804G>T	ENST00000324868.8	-	1	32	c.5C>A	c.(4-6)gCg>gAg	p.A2E		NM_001040436.2	NP_001035526.1	Q9Y2Z4	SYYM_HUMAN	tyrosyl-tRNA synthetase 2, mitochondrial	2				MAAP -> MGA (in Ref. 1; AAD27714). {ECO:0000305}.	gene expression (GO:0010467)|mitochondrial tyrosyl-tRNA aminoacylation (GO:0070184)|translation (GO:0006412)|tRNA aminoacylation (GO:0043039)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|tRNA binding (GO:0000049)|tyrosine binding (GO:0072545)|tyrosine-tRNA ligase activity (GO:0004831)			endometrium(1)|large_intestine(4)|lung(9)|prostate(1)|upper_aerodigestive_tract(1)	16	Lung NSC(5;2.43e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)				L-Tyrosine(DB00135)	GATGGGCGCCGCCATCTTGGT	0.587											OREG0021729	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													17.0	20.0	19.0					12																	32908804		2185	4291	6476	SO:0001583	missense	0			AF132939	CCDS31770.1	12p11.21	2014-03-19	2007-02-23		ENSG00000139131	ENSG00000139131	6.1.1.1	"""Aminoacyl tRNA synthetases / Class I"""	24249	protein-coding gene	gene with protein product	"""tyrosine tRNA ligase 2, mitochondrial"""	610957				15779907, 15840810	Standard	NM_001040436		Approved	FLJ13995, CGI-04, mt-TyrRS	uc001rli.3	Q9Y2Z4	OTTHUMG00000169454	ENST00000324868.8:c.5C>A	12.37:g.32908804G>T	ENSP00000320658:p.Ala2Glu	836	D3DUW8|Q9H817	Missense_Mutation	SNP	pfam_aa-tRNA-synth_Ic,prints_Tyr-tRNA-ligase,tigrfam_Tyr-tRNA-ligase	p.A2E	ENST00000324868.8	37	c.5	CCDS31770.1	12	.	.	.	.	.	.	.	.	.	.	g	18.16	3.561090	0.65538	.	.	ENSG00000139131	ENST00000324868	T	0.73469	-0.75	5.1	4.22	0.49857	.	0.158773	0.56097	D	0.000031	T	0.79353	0.4431	L	0.34521	1.04	0.42771	D	0.993834	D	0.89917	1.0	D	0.91635	0.999	T	0.82020	-0.0664	10	0.87932	D	0	-16.8825	13.6559	0.62338	0.0745:0.0:0.9255:0.0	.	2	Q9Y2Z4	SYYM_HUMAN	E	2	ENSP00000320658:A2E	ENSP00000320658:A2E	A	-	2	0	YARS2	32800071	1.000000	0.71417	1.000000	0.80357	0.243000	0.25628	6.309000	0.72825	1.416000	0.47057	-0.124000	0.14976	GCG	YARS2	-	NULL	ENSG00000139131		0.587	YARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YARS2	HGNC	protein_coding	OTTHUMT00000404153.1	-	0.00	49	0	G	NM_015936		32908804	-1	tier1	-	no_errors	ENST00000324868	ensembl	human	known	74_37	missense	66.67	4	8	SNP	1.000	T
ZBTB40	9923	genome.wustl.edu	37	1	22848056	22848056	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr1:22848056G>C	ENST00000375647.4	+	15	3323	c.3116G>C	c.(3115-3117)cGa>cCa	p.R1039P	ZBTB40_ENST00000404138.1_Missense_Mutation_p.R1039P|ZBTB40_ENST00000374651.4_Missense_Mutation_p.R927P|ZBTB40-IT1_ENST00000438551.1_RNA	NM_014870.3	NP_055685.3	Q9NUA8	ZBT40_HUMAN	zinc finger and BTB domain containing 40	1039					bone mineralization (GO:0030282)|cellular response to DNA damage stimulus (GO:0006974)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|kidney(4)|large_intestine(6)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	26		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;2.86e-26)|Colorectal(126;8.55e-08)|COAD - Colon adenocarcinoma(152;4.1e-06)|GBM - Glioblastoma multiforme(114;1.39e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000712)|KIRC - Kidney renal clear cell carcinoma(1967;0.00374)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0693)|Lung(427;0.216)		CAGAACCACCGATCTTCCAAG	0.483																																																	0													186.0	150.0	162.0					1																	22848056		2203	4300	6503	SO:0001583	missense	0			AB007947	CCDS224.1	1p36	2013-01-08			ENSG00000184677	ENSG00000184677		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	29045	protein-coding gene	gene with protein product		612106					Standard	NM_014870		Approved	KIAA0478, ZNF923	uc001bfu.2	Q9NUA8	OTTHUMG00000002897	ENST00000375647.4:c.3116G>C	1.37:g.22848056G>C	ENSP00000364798:p.Arg1039Pro		O75066|Q5TFU5|Q8N1R1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.R1039P	ENST00000375647.4	37	c.3116	CCDS224.1	1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.007248	0.75046	.	.	ENSG00000184677	ENST00000404138;ENST00000375647;ENST00000374651	T;T;T	0.10573	2.86;2.86;2.86	5.69	5.69	0.88448	.	0.000000	0.49305	D	0.000150	T	0.22282	0.0537	N	0.24115	0.695	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.01424	-1.1358	10	0.45353	T	0.12	-10.8734	18.4221	0.90594	0.0:0.0:1.0:0.0	.	927;1039	F8WAI8;Q9NUA8	.;ZBT40_HUMAN	P	1039;1039;927	ENSP00000384527:R1039P;ENSP00000364798:R1039P;ENSP00000363782:R927P	ENSP00000363782:R927P	R	+	2	0	ZBTB40	22720643	1.000000	0.71417	0.977000	0.42913	0.881000	0.50899	5.772000	0.68889	2.705000	0.92388	0.485000	0.47835	CGA	ZBTB40	-	NULL	ENSG00000184677		0.483	ZBTB40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB40	HGNC	protein_coding	OTTHUMT00000008094.1		0.00	73	0	G	NM_014870		22848056	+1			no_errors	ENST00000375647	ensembl	human	known	74_37	missense	6.25	45	3	SNP	1.000	C
ZKSCAN7	55888	genome.wustl.edu	37	3	44598659	44598659	+	Silent	SNP	C	C	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr3:44598659C>T	ENST00000273320.3	+	2	549	c.120C>T	c.(118-120)agC>agT	p.S40S	ZKSCAN7_ENST00000341840.3_Silent_p.S40S|ZKSCAN7_ENST00000426540.1_Silent_p.S40S|ZKSCAN7_ENST00000431636.1_Silent_p.S40S|RP11-944L7.4_ENST00000457331.1_RNA	NM_018651.2	NP_061121.2	Q9P0L1	ZKSC7_HUMAN	zinc finger with KRAB and SCAN domains 7	40					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)										GGCAGGGCAGCAGTCTCCAGA	0.562																																																	0													59.0	60.0	60.0					3																	44598659		2203	4300	6503	SO:0001819	synonymous_variant	0			L32164, AY280798	CCDS2714.1, CCDS2715.1, CCDS74924.1	3p21.32	2013-01-09	2013-01-09	2013-01-09	ENSG00000196345	ENSG00000196345		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12955	protein-coding gene	gene with protein product			"""zinc finger protein 64"", ""zinc finger protein 448"", ""zinc finger protein 167"""	ZNF64, ZNF448, ZNF167		7814019, 1505991	Standard	XM_005265323		Approved	FLJ12738, ZSCAN39	uc003cnj.3	Q9P0L1	OTTHUMG00000133094	ENST00000273320.3:c.120C>T	3.37:g.44598659C>T			A0PJV3|A8K5H0|Q6WL09|Q96FQ2	Silent	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.S40	ENST00000273320.3	37	c.120	CCDS2715.1	3																																																																																			ZKSCAN7	-	NULL	ENSG00000196345		0.562	ZKSCAN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZKSCAN7	HGNC	protein_coding	OTTHUMT00000256752.4	-	0.00	59	0	C	NM_018651		44598659	+1	tier1	-	no_errors	ENST00000273320	ensembl	human	known	74_37	silent	12.90	27	4	SNP	0.998	T
ZDHHC19	131540	genome.wustl.edu	37	3	195937566	195937566	+	Silent	SNP	A	A	G			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr3:195937566A>G	ENST00000296326.3	-	2	268	c.189T>C	c.(187-189)gtT>gtC	p.V63V	ZDHHC19_ENST00000488508.1_5'UTR	NM_001039617.1	NP_001034706.1	Q8WVZ1	ZDH19_HUMAN	zinc finger, DHHC-type containing 19	63						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|large_intestine(1)|liver(1)|lung(7)|ovary(3)	14	all_cancers(143;1.68e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;1.89e-25)|all cancers(36;1.46e-23)|OV - Ovarian serous cystadenocarcinoma(49;2.1e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.0022)		AGCCTGTGATAACAGGAAAGG	0.587																																																	0													62.0	70.0	67.0					3																	195937566		1987	4158	6145	SO:0001819	synonymous_variant	0			BC022078	CCDS43190.1	3q29	2008-05-02			ENSG00000163958	ENSG00000163958		"""Zinc fingers, DHHC-type"""	20713	protein-coding gene	gene with protein product							Standard	XR_246038		Approved	MGC33345	uc003fwc.3	Q8WVZ1	OTTHUMG00000133642	ENST00000296326.3:c.189T>C	3.37:g.195937566A>G			A8MSY6|B3KVI1	Silent	SNP	pfam_Znf_DHHC_palmitoyltrfase,pfscan_Znf_DHHC_palmitoyltrfase	p.V63	ENST00000296326.3	37	c.189	CCDS43190.1	3																																																																																			ZDHHC19	-	NULL	ENSG00000163958		0.587	ZDHHC19-007	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	ZDHHC19	HGNC	protein_coding	OTTHUMT00000341533.1	-	0.00	51	0	A	NM_144637		195937566	-1	tier1	-	no_errors	ENST00000296326	ensembl	human	known	74_37	silent	11.36	39	5	SNP	0.000	G
ZNF185	7739	genome.wustl.edu	37	X	152087570	152087572	+	In_Frame_Del	DEL	GAG	GAG	-			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	GAG	GAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chrX:152087570_152087572delGAG	ENST00000370268.4	+	7	512_514	c.475_477delGAG	c.(475-477)gagdel	p.E165del	ZNF185_ENST00000318504.7_In_Frame_Del_p.E165del|ZNF185_ENST00000370270.2_In_Frame_Del_p.E165del|ZNF185_ENST00000449285.2_In_Frame_Del_p.E165del|ZNF185_ENST00000318529.8_In_Frame_Del_p.E30del|ZNF185_ENST00000535861.1_In_Frame_Del_p.E165del|ZNF185_ENST00000324823.6_In_Frame_Del_p.E30del|ZNF185_ENST00000539731.1_In_Frame_Del_p.E165del			O15231	ZN185_HUMAN	zinc finger protein 185 (LIM domain)	165	Poly-Glu.					actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(3)	12	Acute lymphoblastic leukemia(192;6.56e-05)					AGGGGACACCgaggaggaggagg	0.596																																																	0									,,,,,,	160,3115		6,91,57,1273,478					,,,,,,	-7.0	0.0			54	367,5848		0,178,189,2088,1494	no	coding,coding,coding,coding,coding,coding,coding	ZNF185	NM_007150.3,NM_001178113.1,NM_001178110.1,NM_001178109.1,NM_001178108.1,NM_001178107.1,NM_001178106.1	,,,,,,	6,269,246,3361,1972	A1A1,A1R,A1,RR,R		5.9051,4.8855,5.5532	,,,,,,	,,,,,,		527,8963				SO:0001651	inframe_deletion	0			AK056517	CCDS48184.1, CCDS55528.1, CCDS55529.1, CCDS55530.1, CCDS55531.1, CCDS55532.1, CCDS69832.1	Xq28	2012-08-08			ENSG00000147394	ENSG00000147394		"""Zinc fingers, C2H2-type"""	12976	protein-coding gene	gene with protein product		300381				9268636	Standard	NM_001178106		Approved		uc011myg.2	O15231	OTTHUMG00000024187	ENST00000370268.4:c.475_477delGAG	X.37:g.152087579_152087581delGAG	ENSP00000359291:p.Glu165del		A4FTV3|A6NME5|B4DLE9|B7Z771|B8K2L9|B8K2M0|B8K2M1|B8K2M2|E9PFR6|F5GXF7|F5GZL4|F8W8V7|H0Y4M8|O00345|Q8N1R8|Q9NSD2	In_Frame_Del	DEL	smart_Znf_LIM,pfscan_Znf_LIM	p.E162in_frame_del	ENST00000370268.4	37	c.475_477	CCDS48184.1	X																																																																																			ZNF185	-	NULL	ENSG00000147394		0.596	ZNF185-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF185	HGNC	protein_coding	OTTHUMT00000377480.1		0.00	37	0	GAG	NM_007150		152087572	+1	tier1		no_errors	ENST00000370270	ensembl	human	known	74_37	in_frame_del	14.29	18	3	DEL	0.026:0.052:0.078	-
ZNF234	10780	genome.wustl.edu	37	19	44661674	44661674	+	Missense_Mutation	SNP	A	A	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr19:44661674A>T	ENST00000426739.2	+	6	1763	c.1505A>T	c.(1504-1506)cAt>cTt	p.H502L	ZNF234_ENST00000592437.1_Missense_Mutation_p.H502L	NM_006630.2	NP_006621.1	Q14588	ZN234_HUMAN	zinc finger protein 234	502					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(11)|ovary(1)|prostate(1)	23		Prostate(69;0.0435)				CTTAAAATTCATTGTAGGATC	0.453																																																	0													71.0	76.0	75.0					19																	44661674		2121	4262	6383	SO:0001583	missense	0			X78927	CCDS46101.1	19q13	2013-01-08				ENSG00000263002		"""Zinc fingers, C2H2-type"", ""-"""	13027	protein-coding gene	gene with protein product		604750		ZNF269		7865130	Standard	NM_006630		Approved	HZF4	uc002oyl.4	Q14588		ENST00000426739.2:c.1505A>T	19.37:g.44661674A>T	ENSP00000400878:p.His502Leu		A8K1C8|Q96IR4|Q9NS45|Q9NYT7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H502L	ENST00000426739.2	37	c.1505	CCDS46101.1	19	.	.	.	.	.	.	.	.	.	.	A	20.8	4.056970	0.76074	.	.	ENSG00000167380	ENST00000426739	D	0.86865	-2.18	4.12	4.12	0.48240	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.96134	0.8740	H	0.99156	4.45	0.40900	D	0.984149	D	0.89917	1.0	D	0.91635	0.999	D	0.97440	1.0021	9	0.87932	D	0	.	12.5333	0.56128	1.0:0.0:0.0:0.0	.	502	Q14588	ZN234_HUMAN	L	502	ENSP00000400878:H502L	ENSP00000400878:H502L	H	+	2	0	ZNF226	49353514	0.038000	0.19896	0.053000	0.19242	0.935000	0.57460	2.654000	0.46699	1.850000	0.53721	0.482000	0.46254	CAT	ZNF234	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000263002		0.453	ZNF234-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF234	HGNC	protein_coding	OTTHUMT00000460586.2	-	0.00	67	0	A			44661674	+1	tier1	-	no_errors	ENST00000426739	ensembl	human	known	74_37	missense	16.67	40	8	SNP	0.983	T
ZNF285	26974	genome.wustl.edu	37	19	44890737	44890737	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr19:44890737G>A	ENST00000330997.4	-	4	1734	c.1670C>T	c.(1669-1671)gCc>gTc	p.A557V	CTC-512J12.6_ENST00000588212.1_Intron|ZNF285_ENST00000591679.1_Missense_Mutation_p.A564V|ZNF285_ENST00000544719.2_Missense_Mutation_p.A557V	NM_152354.3	NP_689567.3	Q96NJ3	ZN285_HUMAN	zinc finger protein 285	557					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|prostate(5)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	44						TCTCTGATGGGCAAGGAGGTA	0.438																																																	0													141.0	116.0	124.0					19																	44890737		2203	4299	6502	SO:0001583	missense	0			AK055309	CCDS12638.1, CCDS74389.1	19q13.32	2013-01-08	2010-04-14	2010-04-14		ENSG00000267508		"""Zinc fingers, C2H2-type"", ""-"""	13079	protein-coding gene	gene with protein product			"""zinc finger protein 285A"""	ZNF285A			Standard	XM_005258734		Approved			Q96NJ3	OTTHUMG00000178848	ENST00000330997.4:c.1670C>T	19.37:g.44890737G>A	ENSP00000333595:p.Ala557Val		Q17RJ3|Q6B0A8|Q6ISR5	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.A557V	ENST00000330997.4	37	c.1670	CCDS12638.1	19	.	.	.	.	.	.	.	.	.	.	G	11.16	1.555794	0.27827	.	.	ENSG00000062370	ENST00000544719;ENST00000330997	T	0.06687	3.27	3.74	-1.49	0.08718	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03915	0.0110	N	0.13299	0.325	0.09310	N	1	B;B	0.13145	0.007;0.007	B;B	0.12156	0.007;0.007	T	0.45702	-0.9243	9	0.22706	T	0.39	.	4.0593	0.09831	0.2155:0.0:0.2587:0.5259	.	581;557	B7ZLR9;Q96NJ3	.;ZN285_HUMAN	V	580;557	ENSP00000333595:A557V	ENSP00000333595:A557V	A	-	2	0	ZNF285	49582577	0.000000	0.05858	0.002000	0.10522	0.357000	0.29423	-2.384000	0.01063	0.184000	0.20083	0.454000	0.30748	GCC	ZNF285	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000267508		0.438	ZNF285-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF285	HGNC	protein_coding	OTTHUMT00000443600.1		0.00	72	0	G	NM_152354		44890737	-1			no_errors	ENST00000330997	ensembl	human	known	74_37	missense	10.20	44	5	SNP	0.000	A
ZNF438	220929	genome.wustl.edu	37	10	31138755	31138755	+	Silent	SNP	C	C	T	rs568845590		TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr10:31138755C>T	ENST00000361310.3	-	6	908	c.579G>A	c.(577-579)gcG>gcA	p.A193A	ZNF438_ENST00000442986.1_Silent_p.A193A|ZNF438_ENST00000413025.1_Silent_p.A193A|ZNF438_ENST00000331737.6_Silent_p.A183A|ZNF438_ENST00000444692.2_Silent_p.A183A|ZNF438_ENST00000375311.1_Intron|ZNF438_ENST00000538351.2_Silent_p.A144A|ZNF438_ENST00000436087.2_Silent_p.A193A|ZNF438_ENST00000452305.1_Silent_p.A183A			Q7Z4V0	ZN438_HUMAN	zinc finger protein 438	193					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(15)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		Prostate(175;0.0587)				CATTGGTCAGCGCAGCTGTGC	0.567																																																	0													146.0	132.0	137.0					10																	31138755		2203	4300	6503	SO:0001819	synonymous_variant	0			AK057323	CCDS7168.1, CCDS44369.1, CCDS53504.1	10p11.23	2006-02-15			ENSG00000183621	ENSG00000183621		"""Zinc fingers, C2H2-type"""	21029	protein-coding gene	gene with protein product							Standard	NM_182755		Approved	bA330O11.1	uc010qeb.2	Q7Z4V0	OTTHUMG00000017904	ENST00000361310.3:c.579G>A	10.37:g.31138755C>T			A2A3J4|A8K9L5|Q5T426|Q658Q4|Q6ZN65	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A193	ENST00000361310.3	37	c.579	CCDS7168.1	10																																																																																			ZNF438	-	NULL	ENSG00000183621		0.567	ZNF438-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF438	HGNC	protein_coding	OTTHUMT00000277006.1	-	0.00	39	0	C	NM_182755		31138755	-1	tier1	-	no_errors	ENST00000361310	ensembl	human	known	74_37	silent	29.27	29	12	SNP	0.000	T
ZNF449	203523	genome.wustl.edu	37	X	134481196	134481196	+	Silent	SNP	C	C	G			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chrX:134481196C>G	ENST00000339249.4	+	2	293	c.153C>G	c.(151-153)ctC>ctG	p.L51L	ZNF449_ENST00000370760.3_Silent_p.L51L|ZNF449_ENST00000370761.3_Silent_p.L51L	NM_152695.5	NP_689908.3	Q6P9G9	ZN449_HUMAN	zinc finger protein 449	51	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(1)|skin(1)	23	Acute lymphoblastic leukemia(192;6.56e-05)					TTAACAAACTCTGGGAGCTTT	0.473																																																	0													89.0	82.0	84.0					X																	134481196		2203	4300	6503	SO:0001819	synonymous_variant	0			AY280801	CCDS14649.1	Xq26.3	2013-01-09			ENSG00000173275	ENSG00000173275		"""-"", ""Zinc fingers, C2H2-type"""	21039	protein-coding gene	gene with protein product		300627					Standard	NM_152695		Approved	ZSCAN19, FLJ23614	uc004eys.3	Q6P9G9	OTTHUMG00000022478	ENST00000339249.4:c.153C>G	X.37:g.134481196C>G			Q5JRZ7|Q5JRZ8|Q6NZX2|Q8N3Q1|Q8TED7	Silent	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.L51	ENST00000339249.4	37	c.153	CCDS14649.1	X																																																																																			ZNF449	-	pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,pfscan_Tscrpt_reg_SCAN	ENSG00000173275		0.473	ZNF449-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF449	HGNC	protein_coding	OTTHUMT00000058411.1	-	0.00	19	0	C	NM_152695		134481196	+1	tier1	-	no_errors	ENST00000339249	ensembl	human	known	74_37	silent	36.84	12	7	SNP	1.000	G
ZNF521	25925	genome.wustl.edu	37	18	22807224	22807224	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr18:22807224G>T	ENST00000361524.3	-	4	806	c.658C>A	c.(658-660)Cac>Aac	p.H220N	ZNF521_ENST00000538137.2_Missense_Mutation_p.H220N|ZNF521_ENST00000584787.1_5'UTR|ZNF521_ENST00000579111.1_5'Flank	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	220					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					ACCTGCATGTGTCCGTGTAAG	0.493			T	PAX5	ALL																																			Dom	yes		18	18q11.2	25925	zinc finger protein 521		L	0													100.0	88.0	92.0					18																	22807224		2203	4300	6503	SO:0001583	missense	0			AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.658C>A	18.37:g.22807224G>T	ENSP00000354794:p.His220Asn		A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.H220N	ENST00000361524.3	37	c.658	CCDS32806.1	18	.	.	.	.	.	.	.	.	.	.	G	12.44	1.939814	0.34189	.	.	ENSG00000198795	ENST00000361524;ENST00000538137;ENST00000399425	T;T	0.10005	2.92;2.92	6.08	6.08	0.98989	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.19127	0.0459	N	0.08118	0	0.45690	D	0.998606	D	0.71674	0.998	D	0.79784	0.993	T	0.26395	-1.0104	10	0.87932	D	0	-29.5623	20.6634	0.99662	0.0:0.0:1.0:0.0	.	220	Q96K83	ZN521_HUMAN	N	220;254;220	ENSP00000354794:H220N;ENSP00000382352:H220N	ENSP00000354794:H220N	H	-	1	0	ZNF521	21061222	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.476000	0.97823	2.894000	0.99253	0.655000	0.94253	CAC	ZNF521	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198795		0.493	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	ZNF521	HGNC	protein_coding	OTTHUMT00000446781.2	-	0.00	64	0	G	NM_015461		22807224	-1	tier1	-	no_errors	ENST00000361524	ensembl	human	known	74_37	missense	11.43	31	4	SNP	1.000	T
ZNF556	80032	genome.wustl.edu	37	19	2877636	2877636	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr19:2877636G>C	ENST00000307635.2	+	4	767	c.680G>C	c.(679-681)gGa>gCa	p.G227A	ZNF556_ENST00000586426.1_Missense_Mutation_p.G226A	NM_024967.1	NP_079243.1	Q9HAH1	ZN556_HUMAN	zinc finger protein 556	227					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|large_intestine(7)|lung(10)|pancreas(1)|prostate(3)|skin(7)	31				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACTCACACTGGAGAGAAACCC	0.507																																																	0													72.0	71.0	71.0					19																	2877636		2203	4300	6503	SO:0001583	missense	0			BC009374	CCDS12097.1, CCDS74254.1	19p13.3	2013-09-20			ENSG00000172000	ENSG00000172000		"""Zinc fingers, C2H2-type"", ""-"""	25669	protein-coding gene	gene with protein product						12477932	Standard	XM_005259647		Approved	FLJ11637	uc002lwp.1	Q9HAH1	OTTHUMG00000180501	ENST00000307635.2:c.680G>C	19.37:g.2877636G>C	ENSP00000302603:p.Gly227Ala		Q96GM3	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G227A	ENST00000307635.2	37	c.680	CCDS12097.1	19	.	.	.	.	.	.	.	.	.	.	G	11.79	1.742647	0.30865	.	.	ENSG00000172000	ENST00000307635	T	0.26373	1.74	2.44	1.38	0.22167	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.39358	0.1075	L	0.50847	1.595	0.26931	N	0.966459	D	0.89917	1.0	D	0.79108	0.992	T	0.13710	-1.0499	9	0.59425	D	0.04	.	6.6	0.22695	0.1575:0.0:0.8425:0.0	.	227	Q9HAH1	ZN556_HUMAN	A	227	ENSP00000302603:G227A	ENSP00000302603:G227A	G	+	2	0	ZNF556	2828636	1.000000	0.71417	0.760000	0.31359	0.218000	0.24690	4.019000	0.57181	0.235000	0.21160	0.407000	0.27541	GGA	ZNF556	-	pfscan_Znf_C2H2	ENSG00000172000		0.507	ZNF556-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF556	HGNC	protein_coding	OTTHUMT00000451638.2	-	0.00	46	0	G	NM_024967		2877636	+1	tier1	-	no_errors	ENST00000307635	ensembl	human	known	74_37	missense	68.09	15	32	SNP	1.000	C
ZNF570	148268	genome.wustl.edu	37	19	37974781	37974781	+	Splice_Site	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr19:37974781G>T	ENST00000330173.1	+	5	786	c.257G>T	c.(256-258)gGc>gTc	p.G86V	ZNF570_ENST00000388801.3_5'UTR|ZNF570_ENST00000586475.1_Splice_Site_p.G142V	NM_144694.1	NP_653295.1	Q96NI8	ZN570_HUMAN	zinc finger protein 570	86					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(3)|large_intestine(6)|lung(12)|ovary(1)|prostate(1)|skin(1)	27			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TACTTTTCAGGCTGGGAGCCT	0.308																																																	0													64.0	70.0	68.0					19																	37974781		2168	4288	6456	SO:0001630	splice_region_variant	0			AK055353	CCDS12504.1, CCDS74355.1	19q13.12	2013-09-20			ENSG00000171827	ENSG00000171827		"""Zinc fingers, C2H2-type"", ""-"""	26416	protein-coding gene	gene with protein product							Standard	XM_005258567		Approved	FLJ30791	uc002ogk.1	Q96NI8	OTTHUMG00000048176	ENST00000330173.1:c.257-1G>T	19.37:g.37974781G>T			A1L472|B4DMP1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G86V	ENST00000330173.1	37	c.257	CCDS12504.1	19	.	.	.	.	.	.	.	.	.	.	G	10.42	1.346194	0.24426	.	.	ENSG00000171827	ENST00000330173	T	0.04862	3.54	5.14	0.506	0.16961	.	2.800790	0.01969	N	0.043899	T	0.06645	0.0170	N	0.11023	0.085	0.80722	D	1	P	0.45396	0.857	P	0.48524	0.58	T	0.43163	-0.9408	9	.	.	.	.	7.8955	0.29704	0.4126:0.0:0.5874:0.0	.	86	Q96NI8	ZN570_HUMAN	V	86	ENSP00000331540:G86V	.	G	+	2	0	ZNF570	42666621	0.473000	0.25878	0.997000	0.53966	0.374000	0.29953	0.487000	0.22356	0.320000	0.23234	-0.262000	0.10625	GGC	ZNF570	-	NULL	ENSG00000171827		0.308	ZNF570-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF570	HGNC	protein_coding	OTTHUMT00000109600.1	-	0.00	49	0	G	NM_144694	Missense_Mutation	37974781	+1	tier1	-	no_errors	ENST00000330173	ensembl	human	known	74_37	missense	8.00	46	4	SNP	0.910	T
ZNF688	146542	genome.wustl.edu	37	16	30581255	30581255	+	Silent	SNP	G	G	T			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr16:30581255G>T	ENST00000223459.6	-	3	1917	c.813C>A	c.(811-813)atC>atA	p.I271I	AC002310.7_ENST00000492040.1_RNA|ZNF688_ENST00000395219.1_Silent_p.I257I|AC002310.7_ENST00000486926.1_RNA	NM_145271.3	NP_660314.1	P0C7X2	ZN688_HUMAN	zinc finger protein 688	271					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(2)|lung(2)|ovary(1)	8						ACTCCTCGAAGATGTCTGGGT	0.706																																																	0													33.0	35.0	34.0					16																	30581255		2063	4109	6172	SO:0001819	synonymous_variant	0			AK122680	CCDS10684.1	16p11.2	2013-01-08			ENSG00000229809	ENSG00000229809		"""Zinc fingers, C2H2-type"", ""-"""	30489	protein-coding gene	gene with protein product						10493829	Standard	XM_005255139		Approved		uc002dys.2	P0C7X2	OTTHUMG00000132408	ENST00000223459.6:c.813C>A	16.37:g.30581255G>T			A8MV39|B3KV51|O75701|Q8IW91|Q8WV14|Q96MN0	Silent	SNP	pfam_Krueppel-associated_box,pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.I271	ENST00000223459.6	37	c.813	CCDS10684.1	16																																																																																			ZNF688	-	NULL	ENSG00000229809		0.706	ZNF688-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF688	HGNC	protein_coding	OTTHUMT00000255544.2		0.00	47	0	G	NM_145271		30581255	-1			no_errors	ENST00000223459	ensembl	human	known	74_37	silent	8.00	46	4	SNP	1.000	T
ZNF890P	645700	genome.wustl.edu	37	7	5161474	5161474	+	RNA	SNP	T	T	G			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr7:5161474T>G	ENST00000422060.2	-	0	1080					NR_034163.1				zinc finger protein 890, pseudogene																		ACTGGCTCCCTGAGCTGCAGG	0.572																																																	0																																												0					7p22.1	2011-05-24			ENSG00000159904	ENSG00000159904			38691	pseudogene	pseudogene							Standard	NR_034163		Approved		uc003snu.1		OTTHUMG00000166790		7.37:g.5161474T>G				RNA	SNP	-	NULL	ENST00000422060.2	37	NULL		7																																																																																			ZNF890P	-	-	ENSG00000159904		0.572	ZNF890P-002	KNOWN	basic	processed_transcript	ZNF890P	HGNC	pseudogene	OTTHUMT00000391474.1	-	0.00	45	0	T	NR_034163		5161474	-1	tier1	-	no_errors	ENST00000422060	ensembl	human	known	74_37	rna	21.21	26	7	SNP	0.003	G
ZPBP2	124626	genome.wustl.edu	37	17	38027810	38027810	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-A8EZ-01A-11D-A36J-09	TCGA-VR-A8EZ-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9372ab61-4d63-4c11-96c2-9cdb19a67071	6a7d6675-a723-4ad5-88cb-11ede9c3b998	g.chr17:38027810A>G	ENST00000348931.4	+	4	529	c.338A>G	c.(337-339)tAt>tGt	p.Y113C	ZPBP2_ENST00000584588.1_Missense_Mutation_p.Y113C|ZPBP2_ENST00000377940.3_Missense_Mutation_p.Y91C	NM_199321.2	NP_955353.1	Q6X784	ZPBP2_HUMAN	zona pellucida binding protein 2	113					acrosome assembly (GO:0001675)|binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|cell body (GO:0044297)|extracellular region (GO:0005576)|nucleus (GO:0005634)|zona pellucida receptor complex (GO:0002199)				kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	15	Colorectal(19;0.000442)		Lung(15;0.00849)|LUSC - Lung squamous cell carcinoma(15;0.171)			ACTCTTTCTTATAAGACTGTT	0.308																																																	0													78.0	82.0	81.0					17																	38027810		2203	4296	6499	SO:0001583	missense	0			BC043152	CCDS11352.1, CCDS11353.2	17q21.1	2013-01-11			ENSG00000186075	ENSG00000186075		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	20678	protein-coding gene	gene with protein product		608499					Standard	XM_005257031		Approved	ZPBPL, MGC41930	uc002hte.3	Q6X784	OTTHUMG00000133022	ENST00000348931.4:c.338A>G	17.37:g.38027810A>G	ENSP00000335384:p.Tyr113Cys		A8K8L8|Q6X783|Q86XL5	Missense_Mutation	SNP	pfam_Sp38-bd,pfscan_Ig-like_dom	p.Y113C	ENST00000348931.4	37	c.338	CCDS11352.1	17	.	.	.	.	.	.	.	.	.	.	A	15.66	2.900513	0.52227	.	.	ENSG00000186075	ENST00000348931;ENST00000377940	T;T	0.60171	0.21;0.21	5.36	5.36	0.76844	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.106305	0.42294	D	0.000736	T	0.75759	0.3893	M	0.77313	2.365	0.36899	D	0.890293	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.82692	-0.0331	10	0.87932	D	0	-24.5167	13.5982	0.62002	1.0:0.0:0.0:0.0	.	91;113	Q6X784-2;Q6X784	.;ZPBP2_HUMAN	C	113;91	ENSP00000335384:Y113C;ENSP00000367174:Y91C	ENSP00000335384:Y113C	Y	+	2	0	ZPBP2	35281336	1.000000	0.71417	1.000000	0.80357	0.474000	0.32979	2.861000	0.48380	2.027000	0.59764	0.377000	0.23210	TAT	ZPBP2	-	pfam_Sp38-bd,pfscan_Ig-like_dom	ENSG00000186075		0.308	ZPBP2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZPBP2	HGNC	protein_coding	OTTHUMT00000256609.2	-	0.00	70	0	A	NM_198844		38027810	+1	tier1	-	no_errors	ENST00000348931	ensembl	human	known	74_37	missense	18.87	43	10	SNP	1.000	G
