#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
AADACL4	343066	genome.wustl.edu	37	1	12711295	12711295	+	Missense_Mutation	SNP	T	T	A			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr1:12711295T>A	ENST00000376221.1	+	2	322	c.322T>A	c.(322-324)Tcc>Acc	p.S108T		NM_001013630.1	NP_001013652.1	Q5VUY2	ADCL4_HUMAN	arylacetamide deacetylase-like 4	108						integral component of membrane (GO:0016021)	carboxylic ester hydrolase activity (GO:0052689)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(6)|prostate(1)	17	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.000937)|all_lung(284;0.00122)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.81e-07)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.00217)|KIRC - Kidney renal clear cell carcinoma(229;0.00579)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0384)		GAAGGCAGCATCCTCCAGACC	0.557																																																	0													64.0	63.0	63.0					1																	12711295		2203	4300	6503	SO:0001583	missense	0				CCDS30590.1	1p36.21	2010-12-14			ENSG00000204518	ENSG00000204518			32038	protein-coding gene	gene with protein product							Standard	XM_006710608		Approved	OTTHUMG00000001889	uc001auf.3	Q5VUY2	OTTHUMG00000001889	ENST00000376221.1:c.322T>A	1.37:g.12711295T>A	ENSP00000365395:p.Ser108Thr			Missense_Mutation	SNP	pfam_AB_hydrolase_3,pirsf_Arylacetamide_deacetylase	p.S108T	ENST00000376221.1	37	c.322	CCDS30590.1	1	.	.	.	.	.	.	.	.	.	.	T	17.27	3.348199	0.61183	.	.	ENSG00000204518	ENST00000376221	T	0.59638	0.25	5.01	3.85	0.44370	.	0.307856	0.30920	N	0.008606	T	0.55273	0.1910	M	0.68952	2.095	0.19775	N	0.999955	P	0.50066	0.931	B	0.44163	0.443	T	0.48937	-0.8990	10	0.33141	T	0.24	-44.8979	10.0478	0.42197	0.0:0.0:0.1697:0.8303	.	108	Q5VUY2	ADCL4_HUMAN	T	108	ENSP00000365395:S108T	ENSP00000365395:S108T	S	+	1	0	AADACL4	12633882	0.257000	0.24022	0.011000	0.14972	0.906000	0.53458	1.263000	0.33004	0.706000	0.31912	0.379000	0.24179	TCC	AADACL4	-	pirsf_Arylacetamide_deacetylase	ENSG00000204518		0.557	AADACL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AADACL4	HGNC	protein_coding	OTTHUMT00000005328.1	-	0.00	62	0	T	NM_001013630		12711295	+1	tier1	-	no_errors	ENST00000376221	ensembl	human	known	74_37	missense	30.70	79	35	SNP	0.137	A
ACAA2	10449	genome.wustl.edu	37	18	47318527	47318527	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr18:47318527C>T	ENST00000285093.10	-	6	1223	c.748G>A	c.(748-750)Gca>Aca	p.A250T	ACAA2_ENST00000587994.1_Missense_Mutation_p.A247T|ACAA2_ENST00000589432.1_Missense_Mutation_p.A195T	NM_006111.2	NP_006102.2	P42765	THIM_HUMAN	acetyl-CoA acyltransferase 2	250					cellular response to hypoxia (GO:0071456)|cholesterol biosynthetic process (GO:0006695)|fatty acid metabolic process (GO:0006631)|negative regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902109)|negative regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901029)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	acetyl-CoA C-acyltransferase activity (GO:0003988)|poly(A) RNA binding (GO:0044822)			large_intestine(2)|lung(7)|ovary(1)	10						CCAACCGATGCATTCCCTGCA	0.423																																																	0													138.0	111.0	120.0					18																	47318527		2203	4300	6503	SO:0001583	missense	0			D16294	CCDS11939.1	18q21	2010-04-30	2010-04-30		ENSG00000167315	ENSG00000167315	2.3.1.16		83	protein-coding gene	gene with protein product	"""mitochondrial 3-oxoacyl-Coenzyme A thiolase"""	604770	"""acetyl-Coenzyme A acyltransferase 2"""			8241273	Standard	NM_006111		Approved	DSAEC	uc002ldw.4	P42765	OTTHUMG00000132667	ENST00000285093.10:c.748G>A	18.37:g.47318527C>T	ENSP00000285093:p.Ala250Thr		Q9BUT6	Missense_Mutation	SNP	pfam_Thiolase_N,pfam_Thiolase_C,superfamily_Thiolase-like,pirsf_Thiolase,tigrfam_Thiolase	p.A250T	ENST00000285093.10	37	c.748	CCDS11939.1	18	.	.	.	.	.	.	.	.	.	.	C	27.1	4.802188	0.90538	.	.	ENSG00000167315	ENST00000285093	D	0.94417	-3.42	5.79	5.79	0.91817	Thiolase-like, subgroup (1);Thiolase, N-terminal (1);Thiolase-like (1);	0.000000	0.85682	D	0.000000	D	0.97999	0.9341	M	0.91038	3.17	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.989;0.998	D	0.98404	1.0569	10	0.87932	D	0	-23.5987	20.0355	0.97556	0.0:1.0:0.0:0.0	.	250;250	B2RB23;P42765	.;THIM_HUMAN	T	250	ENSP00000285093:A250T	ENSP00000285093:A250T	A	-	1	0	ACAA2	45572525	1.000000	0.71417	0.733000	0.30861	0.468000	0.32798	7.699000	0.84547	2.747000	0.94245	0.643000	0.83706	GCA	ACAA2	-	pfam_Thiolase_N,superfamily_Thiolase-like,pirsf_Thiolase,tigrfam_Thiolase	ENSG00000167315		0.423	ACAA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ACAA2	HGNC	protein_coding	OTTHUMT00000255921.2	-	0.00	51	0	C	NM_006111		47318527	-1	tier1	-	no_errors	ENST00000285093	ensembl	human	known	74_37	missense	7.14	52	4	SNP	1.000	T
ACHE	43	genome.wustl.edu	37	7	100490031	100490032	+	Frame_Shift_Ins	INS	-	-	G			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr7:100490031_100490032insG	ENST00000412389.1	-	2	1631_1632	c.1476_1477insC	c.(1474-1479)ccctctfs	p.S493fs	ACHE_ENST00000419336.2_Frame_Shift_Ins_p.S405fs|ACHE_ENST00000302913.4_Frame_Shift_Ins_p.S493fs|ACHE_ENST00000428317.1_Frame_Shift_Ins_p.S493fs|ACHE_ENST00000241069.5_Frame_Shift_Ins_p.S493fs|ACHE_ENST00000411582.1_Frame_Shift_Ins_p.S493fs|UFSP1_ENST00000388761.2_5'Flank			P22303	ACES_HUMAN	acetylcholinesterase (Yt blood group)	493					acetylcholine catabolic process (GO:0006581)|acetylcholine catabolic process in synaptic cleft (GO:0001507)|amyloid precursor protein metabolic process (GO:0042982)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|choline metabolic process (GO:0019695)|DNA replication (GO:0006260)|glycerophospholipid biosynthetic process (GO:0046474)|muscle organ development (GO:0007517)|negative regulation of synaptic transmission, cholinergic (GO:0032223)|nervous system development (GO:0007399)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter receptor biosynthetic process (GO:0045212)|osteoblast development (GO:0002076)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|positive regulation of protein secretion (GO:0050714)|protein tetramerization (GO:0051262)|receptor internalization (GO:0031623)|regulation of axonogenesis (GO:0050770)|regulation of dendrite morphogenesis (GO:0048814)|regulation of receptor recycling (GO:0001919)|response to wounding (GO:0009611)|retina development in camera-type eye (GO:0060041)|small molecule metabolic process (GO:0044281)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|basal lamina (GO:0005605)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synapse (GO:0045202)	acetylcholine binding (GO:0042166)|acetylcholinesterase activity (GO:0003990)|beta-amyloid binding (GO:0001540)|cholinesterase activity (GO:0004104)|collagen binding (GO:0005518)|hydrolase activity (GO:0016787)|laminin binding (GO:0043236)|protein homodimerization activity (GO:0042803)|serine hydrolase activity (GO:0017171)			large_intestine(3)|lung(7)|skin(3)|urinary_tract(3)	16	Lung NSC(181;0.041)|all_lung(186;0.0581)				Ambenonium(DB01122)|Choline(DB00122)|Decamethonium(DB01245)|Demecarium(DB00944)|Dipivefrin(DB00449)|Donepezil(DB00843)|Edrophonium(DB01010)|Ephedrine(DB01364)|Galantamine(DB00674)|Gallamine Triethiodide(DB00483)|Isoflurophate(DB00677)|Mefloquine(DB00358)|Minaprine(DB00805)|Neostigmine(DB01400)|Physostigmine(DB00981)|Pralidoxime(DB00733)|Pyridostigmine(DB00545)|Rivastigmine(DB00989)|Tubocurarine(DB01199)	TAGTTTCGAGAGGGGTCCAGGG	0.594																																																	0																																										SO:0001589	frameshift_variant	0				CCDS5709.1, CCDS5710.1, CCDS64736.1	7q22	2014-07-19	2014-01-02		ENSG00000087085	ENSG00000087085	3.1.1.7	"""Blood group antigens"""	108	protein-coding gene	gene with protein product	"""Yt blood group"""	100740	"""acetylcholinesterase (YT blood group)"", ""acetylcholinesterase (Yt blood group)"", ""acetylcholinesterase"""	YT		1380483	Standard	XM_005250357		Approved		uc003uxe.3	P22303	OTTHUMG00000157033	ENST00000412389.1:c.1477dupC	7.37:g.100490035_100490035dupG	ENSP00000394976:p.Ser493fs		A4D2E2|B7ZKZ0|D6W5X7|Q16169|Q29S23|Q2M324|Q504V3|Q53F46|Q86TM9|Q86YX9|Q9BXP7	Frame_Shift_Ins	INS	pfam_CarbesteraseB,pfam_AB_hydrolase_3,prints_Cholinesterase	p.S492fs	ENST00000412389.1	37	c.1477_1476	CCDS5709.1	7																																																																																			ACHE	-	pfam_CarbesteraseB	ENSG00000087085		0.594	ACHE-013	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ACHE	HGNC	protein_coding	OTTHUMT00000347201.1		0.00	70	0	0	NM_015831		100490032	-1			no_errors	ENST00000302913	ensembl	human	known	74_37	frame_shift_ins	9.68	168	18	INS	0.000:0.000	G
ADTRP	84830	genome.wustl.edu	37	6	11768590	11768590	+	Silent	SNP	G	G	T			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr6:11768590G>T	ENST00000414691.3	-	2	590	c.180C>A	c.(178-180)gtC>gtA	p.V60V	ADTRP_ENST00000229583.5_Silent_p.V78V|ADTRP_ENST00000379413.2_Silent_p.V60V	NM_032744.3	NP_116133.1	Q96IZ2	ADTRP_HUMAN	androgen-dependent TFPI-regulating protein	60						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)											CCAGGCAGGTGACCCCGTAGA	0.418																																																	0													178.0	163.0	168.0					6																	11768590		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ420520	CCDS4521.1, CCDS47374.1	6p24.1	2012-01-30	2012-01-27	2012-01-27	ENSG00000111863	ENSG00000111863			21214	protein-coding gene	gene with protein product	"""androgen-induced 1-like"""	614348	"""chromosome 6 open reading frame 105"""	C6orf105		21868574	Standard	NM_032744		Approved	dJ413H6.1, AIG1L	uc011dip.2	Q96IZ2	OTTHUMG00000014260	ENST00000414691.3:c.180C>A	6.37:g.11768590G>T			B2R7T9|B4DV39|Q5THW1	Nonsense_Mutation	SNP	pfam_Far-17a_AIG1	p.S80*	ENST00000414691.3	37	c.239	CCDS4521.1	6																																																																																			ADTRP	-	NULL	ENSG00000111863		0.418	ADTRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADTRP	HGNC	protein_coding	OTTHUMT00000039864.3	-	0.00	69	0	G	NM_032744		11768590	-1	tier1	-	no_errors	ENST00000485323	ensembl	human	known	74_37	nonsense	30.61	68	30	SNP	0.996	T
AGAP4	119016	genome.wustl.edu	37	10	46321476	46321476	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr10:46321476C>A	ENST00000448048.2	-	7	2004	c.1879G>T	c.(1879-1881)Gtc>Ttc	p.V627F	AGAP4_ENST00000430779.2_5'Flank	NM_133446.2	NP_597703.2	Q96P64	AGAP4_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 4	627					regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)	p.V627I(1)		central_nervous_system(1)|lung(1)|ovary(1)	3						CGGGCCATGACGTCCACCCCG	0.672																																																	1	Substitution - Missense(1)	ovary(1)											1.0	1.0	1.0					10																	46321476		214	382	596	SO:0001583	missense	0			AF411132	CCDS7215.1	10q11.21	2014-06-19	2008-09-22	2008-09-22	ENSG00000188234	ENSG00000188234		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	23459	protein-coding gene	gene with protein product			"""centaurin, gamma-like family, member 1"", ""ArfGAP with GTPase domain, ankyrin repeat and PH domain 8"", ""centaurin, gamma-like family, member 5"""	CTGLF1, AGAP8, CTGLF5		12477932	Standard	XM_005271797		Approved	Em:AC012044.1, MRIP2	uc001jcx.4	Q96P64	OTTHUMG00000018088	ENST00000448048.2:c.1879G>T	10.37:g.46321476C>A	ENSP00000392513:p.Val627Phe			Missense_Mutation	SNP	pfam_ArfGAP,pfam_Pleckstrin_homology,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_ArfGAP,prints_ArfGAP	p.V627F	ENST00000448048.2	37	c.1879	CCDS7215.1	10	.	.	.	.	.	.	.	.	.	.	c	6.989	0.552493	0.13374	.	.	ENSG00000188234	ENST00000448048;ENST00000342551	T	0.68903	-0.36	.	.	.	Ankyrin repeat-containing domain (4);	0.223555	0.38436	N	0.001698	T	0.65312	0.2679	L	0.54323	1.7	0.30332	N	0.786604	P;P	0.45986	0.87;0.785	P;P	0.51701	0.677;0.578	T	0.64002	-0.6509	9	0.72032	D	0.01	.	5.89	0.18904	0.0:0.9992:0.0:8.0E-4	.	650;627	C9JRW4;Q96P64	.;AGAP4_HUMAN	F	627;403	ENSP00000392513:V627F	ENSP00000343438:V403F	V	-	1	0	AGAP4	45641482	0.956000	0.32656	0.271000	0.24616	0.274000	0.26718	0.179000	0.16840	0.107000	0.17824	0.109000	0.15622	GTC	AGAP4	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000188234		0.672	AGAP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGAP4	HGNC	protein_coding	OTTHUMT00000047799.1	-	0.00	47	0	C	NM_133446		46321476	-1	tier1	-	no_errors	ENST00000448048	ensembl	human	known	74_37	missense	32.79	41	20	SNP	1.000	A
AIM1	202	genome.wustl.edu	37	6	106960342	106960342	+	Silent	SNP	C	C	T			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr6:106960342C>T	ENST00000369066.3	+	1	613	c.126C>T	c.(124-126)gaC>gaT	p.D42D		NM_001624.2	NP_001615	Q9UMX9	S45A2_HUMAN	absent in melanoma 1	0			M -> I (in OCA4). {ECO:0000269|PubMed:17768386}.		developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				breast(8)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(7)|large_intestine(13)|lung(20)|ovary(5)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	69	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		TGTTCGACGACGAGGTGGCGC	0.706																																																	0													15.0	16.0	15.0					6																	106960342		2197	4286	6483	SO:0001819	synonymous_variant	0			U83115	CCDS34506.1	6q21	2014-01-29			ENSG00000112297	ENSG00000112297			356	protein-coding gene	gene with protein product	"""suppression of tumorigenicity 4"", ""beta-gamma crystallin domain containing 1"""	601797	"""suppression of tumorigenicity 4 (malignant melanoma)"""	ST4		1680551, 12693952	Standard	NM_001624		Approved	CRYBG1	uc003prh.3	Q9Y4K1	OTTHUMG00000015302	ENST00000369066.3:c.126C>T	6.37:g.106960342C>T			Q6P2P0|Q9BTM3	Silent	SNP	pfam_Beta/gamma_crystallin,pfam_Ricin_B_lectin,superfamily_G_crystallin-rel,superfamily_Ricin_B_lectin,smart_Beta/gamma_crystallin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin,pfscan_Beta/gamma_crystallin,prints_Beta/gamma_crystallin	p.D42	ENST00000369066.3	37	c.126	CCDS34506.1	6																																																																																			AIM1	-	NULL	ENSG00000112297		0.706	AIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AIM1	HGNC	protein_coding	OTTHUMT00000041669.1		0.00	55	0	C			106960342	+1			no_errors	ENST00000369066	ensembl	human	known	74_37	silent	5.41	69	4	SNP	0.987	T
AIG1	51390	genome.wustl.edu	37	6	143457998	143457998	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr6:143457998C>G	ENST00000275235.4	+	2	193	c.168C>G	c.(166-168)atC>atG	p.I56M	AIG1_ENST00000367598.5_Missense_Mutation_p.I56M|AIG1_ENST00000344492.5_Intron|AIG1_ENST00000494282.2_Missense_Mutation_p.I56M|AIG1_ENST00000357847.4_Missense_Mutation_p.I56M			Q9NVV5	AIG1_HUMAN	androgen-induced 1	56						integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(155;2.34e-05)|GBM - Glioblastoma multiforme(68;0.0246)		TTTTTGGCATCTGTGTGCTGA	0.512																																																	0													199.0	193.0	195.0					6																	143457998		2203	4300	6503	SO:0001583	missense	0			AF153605	CCDS5198.1, CCDS69216.1	6q24.1	2008-02-05			ENSG00000146416	ENSG00000146416			21607	protein-coding gene	gene with protein product		608514				11266118	Standard	NM_001286587		Approved	dJ95L4.1, AIG-1, FLJ10485	uc003qjh.3	Q9NVV5	OTTHUMG00000015721	ENST00000275235.4:c.168C>G	6.37:g.143457998C>G	ENSP00000275235:p.Ile56Met		B4DPX2|C9J569|Q5T2H2|Q6N047|Q7Z378|Q8TB14|Q9Y3A9|Q9Y5B4	Missense_Mutation	SNP	pfam_Far-17a_AIG1	p.I56M	ENST00000275235.4	37	c.168		6	.	.	.	.	.	.	.	.	.	.	C	18.02	3.529867	0.64860	.	.	ENSG00000146416	ENST00000367601;ENST00000419072;ENST00000367598;ENST00000357847;ENST00000275235	T;T;T;T	0.32023	1.47;1.47;1.47;1.47	5.91	2.65	0.31530	.	0.116385	0.64402	D	0.000006	T	0.33206	0.0855	M	0.75615	2.305	0.44234	D	0.997075	P;P;P;P	0.50369	0.748;0.919;0.815;0.934	B;P;P;P	0.53593	0.276;0.61;0.499;0.73	T	0.21075	-1.0256	10	0.52906	T	0.07	-35.8427	12.0934	0.53739	0.0:0.7154:0.0:0.2846	.	56;56;56;52	B4DPX2;Q9NVV5-2;Q9NVV5-5;E7ENG8	.;.;.;.	M	52;52;56;56;56	ENSP00000356573:I52M;ENSP00000356570:I56M;ENSP00000350509:I56M;ENSP00000275235:I56M	ENSP00000275235:I56M	I	+	3	3	AIG1	143499691	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.288000	0.33296	0.792000	0.33850	0.655000	0.94253	ATC	AIG1	-	pfam_Far-17a_AIG1	ENSG00000146416		0.512	AIG1-005	KNOWN	basic	protein_coding	AIG1	HGNC	protein_coding	OTTHUMT00000042510.1	-	0.00	42	0	C	NM_016108		143457998	+1	tier1	-	no_errors	ENST00000275235	ensembl	human	known	74_37	missense	48.15	28	26	SNP	1.000	G
ALDH18A1	5832	genome.wustl.edu	37	10	97366618	97366618	+	Silent	SNP	C	C	T			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr10:97366618C>T	ENST00000371224.2	-	18	2426	c.2289G>A	c.(2287-2289)ctG>ctA	p.L763L	ALDH18A1_ENST00000371221.3_Silent_p.L761L	NM_002860.3	NP_002851.2	P54886	P5CS_HUMAN	aldehyde dehydrogenase 18 family, member A1	763	Gamma-glutamyl phosphate reductase.				cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|citrulline biosynthetic process (GO:0019240)|glutamate metabolic process (GO:0006536)|L-proline biosynthetic process (GO:0055129)|ornithine biosynthetic process (GO:0006592)|proline biosynthetic process (GO:0006561)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|glutamate 5-kinase activity (GO:0004349)|glutamate-5-semialdehyde dehydrogenase activity (GO:0004350)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(9)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Colorectal(252;0.0402)		Epithelial(162;9.1e-07)|all cancers(201;2.55e-05)		TCCCTCGCAGCAGCCACTTAG	0.478																																																	0													162.0	163.0	163.0					10																	97366618		2203	4300	6503	SO:0001819	synonymous_variant	0			X94453	CCDS7443.1, CCDS31257.1	10q24.3-q24.6	2004-08-12	2004-08-12	2004-08-12	ENSG00000059573	ENSG00000059573		"""Aldehyde dehydrogenases"""	9722	protein-coding gene	gene with protein product		138250	"""pyrroline-5-carboxylate synthetase (glutamate gamma-semialdehyde synthetase)"""	GSAS, PYCS		8921385	Standard	XM_006717933		Approved	P5CS	uc001kkz.3	P54886	OTTHUMG00000018815	ENST00000371224.2:c.2289G>A	10.37:g.97366618C>T			B2R5Q4|B7Z350|B7Z5X8|B7ZLP1|D3DR44|O95952|Q3KQU2|Q5T566|Q5T567|Q9UM72	Silent	SNP	pfam_Asp/Glu/Uridylate_kinase,pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH,superfamily_Asp/Glu/Uridylate_kinase,pirsf_P5_carboxy_syn,prints_Glu/AcGlu_kinase,tigrfam_P5_carboxy_syn,tigrfam_G-glutamylP_reductase	p.L763	ENST00000371224.2	37	c.2289	CCDS7443.1	10																																																																																			ALDH18A1	-	superfamily_Ald_DH/histidinol_DH,pirsf_P5_carboxy_syn,tigrfam_P5_carboxy_syn	ENSG00000059573		0.478	ALDH18A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ALDH18A1	HGNC	protein_coding	OTTHUMT00000049552.1	-	0.00	65	0	C	NM_002860		97366618	-1	tier1	-	no_errors	ENST00000371224	ensembl	human	known	74_37	silent	7.02	53	4	SNP	0.989	T
AMBN	258	genome.wustl.edu	37	4	71467239	71467239	+	Silent	SNP	C	C	A			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr4:71467239C>A	ENST00000322937.6	+	6	502	c.399C>A	c.(397-399)acC>acA	p.T133T	AMBN_ENST00000449493.2_Silent_p.T118T	NM_016519.5	NP_057603.1	Q9NP70	AMBN_HUMAN	ameloblastin (enamel matrix protein)	133					biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|odontogenesis of dentin-containing tooth (GO:0042475)	proteinaceous extracellular matrix (GO:0005578)	growth factor activity (GO:0008083)|structural constituent of tooth enamel (GO:0030345)			NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(12)|ovary(3)|prostate(2)|skin(1)	29			Lung(101;0.235)			CTGCTGCAACCACCAACCAGG	0.542											OREG0016218	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													145.0	139.0	141.0					4																	71467239		2203	4300	6503	SO:0001819	synonymous_variant	0			AF209780	CCDS3543.1	4q21	2006-11-28	2006-04-27		ENSG00000178522	ENSG00000178522			452	protein-coding gene	gene with protein product		601259	"""ameloblastin, enamel matrix protein"""			9126491	Standard	NM_016519		Approved		uc003hfl.3	Q9NP70	OTTHUMG00000129913	ENST00000322937.6:c.399C>A	4.37:g.71467239C>A		1130	Q3B862|Q9H2X1|Q9H4L1	Silent	SNP	pfam_Amelin,smart_Amelin	p.T133	ENST00000322937.6	37	c.399	CCDS3543.1	4																																																																																			AMBN	-	pfam_Amelin,smart_Amelin	ENSG00000178522		0.542	AMBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMBN	HGNC	protein_coding	OTTHUMT00000252165.1		0.00	40	0	C	NM_016519		71467239	+1			no_errors	ENST00000322937	ensembl	human	known	74_37	silent	7.27	51	4	SNP	0.000	A
ANK3	288	genome.wustl.edu	37	10	61830487	61830487	+	Silent	SNP	C	C	T			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr10:61830487C>T	ENST00000280772.2	-	37	10343	c.10152G>A	c.(10150-10152)caG>caA	p.Q3384Q	ANK3_ENST00000373827.2_Intron|ANK3_ENST00000503366.1_Intron|ANK3_ENST00000355288.2_Intron	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	3384					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.Q3384H(1)		NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						TGTTCCCATTCTGGGCAATTT	0.463																																																	1	Substitution - Missense(1)	urinary_tract(1)											152.0	143.0	146.0					10																	61830487		2203	4300	6503	SO:0001819	synonymous_variant	0			U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.10152G>A	10.37:g.61830487C>T			B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Silent	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like_dom,smart_Ankyrin_rpt,smart_ZU5,smart_Death_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death_domain,pfscan_ZU5,prints_Ankyrin_rpt	p.Q3384	ENST00000280772.2	37	c.10152	CCDS7258.1	10																																																																																			ANK3	-	NULL	ENSG00000151150		0.463	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANK3	HGNC	protein_coding	OTTHUMT00000048201.4	-	0.00	37	0	C	NM_020987		61830487	-1	tier1	-	no_errors	ENST00000280772	ensembl	human	known	74_37	silent	6.78	55	4	SNP	1.000	T
APLP1	333	genome.wustl.edu	37	19	36362551	36362551	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr19:36362551G>A	ENST00000221891.4	+	5	767	c.575G>A	c.(574-576)gGc>gAc	p.G192D	APLP1_ENST00000537454.2_Missense_Mutation_p.G153D|NPHS1_ENST00000591817.1_5'Flank|APLP1_ENST00000586861.1_Missense_Mutation_p.G186D	NM_001024807.1|NM_005166.3	NP_001019978.1|NP_005157.1	P51693	APLP1_HUMAN	amyloid beta (A4) precursor-like protein 1	192					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular response to norepinephrine stimulus (GO:0071874)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|mRNA polyadenylation (GO:0006378)|negative regulation of cAMP biosynthetic process (GO:0030818)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|regulation of translation (GO:0006417)	basement membrane (GO:0005604)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	alpha-2A adrenergic receptor binding (GO:0031694)|alpha-2B adrenergic receptor binding (GO:0031695)|alpha-2C adrenergic receptor binding (GO:0031696)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|transition metal ion binding (GO:0046914)			breast(4)|endometrium(2)|kidney(2)|large_intestine(12)|liver(1)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)	33	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CACGGCTCGGGCATGCTCTTA	0.637																																																	0													107.0	102.0	103.0					19																	36362551		2203	4300	6503	SO:0001583	missense	0			U48437	CCDS32997.1	19q	2008-07-15							597	protein-coding gene	gene with protein product	"""amyloid-like protein 1"", ""amyloid precursor-like protein 1"""	104775				8432545	Standard	NM_001024807		Approved	APLP	uc002ocf.3	P51693		ENST00000221891.4:c.575G>A	19.37:g.36362551G>A	ENSP00000221891:p.Gly192Asp		O00113|Q96A92	Missense_Mutation	SNP	pfam_Amyloid_glyco_heparin-bd,pfam_APP_amyloid_C,superfamily_Amyloid_glyco_E2_domain,superfamily_Amyloid_glyco_heparin-bd,superfamily_Amyloid_glyco_Cu-bd,smart_Amyloid_glyco_extra,prints_Amyloid_glyco	p.G192D	ENST00000221891.4	37	c.575	CCDS32997.1	19	.	.	.	.	.	.	.	.	.	.	G	19.69	3.874653	0.72180	.	.	ENSG00000105290	ENST00000537454;ENST00000221891	D;D	0.95518	-3.59;-3.73	4.41	4.41	0.53225	Amyloidogenic glycoprotein, extracellular (1);Amyloidogenic glycoprotein, copper-binding (3);	0.000000	0.47093	D	0.000255	D	0.97377	0.9142	M	0.78637	2.42	0.58432	D	0.999997	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.98095	1.0411	10	0.87932	D	0	-18.2646	14.4685	0.67499	0.0:0.0:1.0:0.0	.	186;153;192;192	B7Z4G8;F5GZ08;P51693-2;P51693	.;.;.;APLP1_HUMAN	D	153;192	ENSP00000441501:G153D;ENSP00000221891:G192D	ENSP00000221891:G192D	G	+	2	0	APLP1	41054391	1.000000	0.71417	0.839000	0.33178	0.546000	0.35178	8.716000	0.91420	2.006000	0.58801	0.462000	0.41574	GGC	APLP1	-	pfam_Amyloid_glyco_heparin-bd,superfamily_Amyloid_glyco_Cu-bd,smart_Amyloid_glyco_extra	ENSG00000105290		0.637	APLP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	APLP1	HGNC	protein_coding	OTTHUMT00000452564.1		0.00	22	0	G	NM_001024807		36362551	+1			no_errors	ENST00000221891	ensembl	human	known	74_37	missense	9.68	28	3	SNP	1.000	A
ARID1B	57492	genome.wustl.edu	37	6	157099427	157099429	+	In_Frame_Del	DEL	CAG	CAG	-			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	CAG	CAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr6:157099427_157099429delCAG	ENST00000350026.5	+	1	365_367	c.364_366delCAG	c.(364-366)cagdel	p.Q131del	RP11-230C9.2_ENST00000603191.1_lincRNA|ARID1B_ENST00000275248.4_In_Frame_Del_p.Q73del|ARID1B_ENST00000367148.1_In_Frame_Del_p.Q131del|RP11-230C9.3_ENST00000604792.1_RNA|ARID1B_ENST00000346085.5_In_Frame_Del_p.Q131del|MIR4466_ENST00000606121.1_RNA	NM_017519.2	NP_059989.2	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	131	Gln-rich.|Poly-Gln.				chromatin-mediated maintenance of transcription (GO:0048096)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			NS(2)|breast(5)|central_nervous_system(4)|endometrium(12)|kidney(4)|large_intestine(11)|lung(30)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(3)	81		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		gcagcagcaacagcagcagcagc	0.65																																																	0									,	35,81,2332		8,2,17,12,55,1130					,	0.0	0.9			6	48,164,4794		13,0,22,25,114,2329	no	codingComplex,codingComplex	ARID1B	NM_020732.3,NM_017519.2	,	21,2,39,37,169,3459	A1A1,A1A2,A1R,A2A2,A2R,RR		4.2349,4.7386,4.4003	,	,		83,245,7126				SO:0001651	inframe_deletion	0			AF521671	CCDS5251.1, CCDS5251.2, CCDS55072.1	6q25.3	2014-09-17			ENSG00000049618	ENSG00000049618		"""-"""	18040	protein-coding gene	gene with protein product		614556					Standard	NM_017519		Approved	KIAA1235, ELD/OSA1, p250R, BAF250b, DAN15, 6A3-5	uc003qqo.3	Q8NFD5	OTTHUMG00000015890	ENST00000350026.5:c.364_366delCAG	6.37:g.157099436_157099438delCAG	ENSP00000055163:p.Gln131del		Q5JRD1|Q5VYC4|Q8IZY8|Q8TEV0|Q8TF02|Q99491|Q9ULI5	In_Frame_Del	DEL	pfam_DUF3518,pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,superfamily_ARM-type_fold,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.Q125in_frame_del	ENST00000350026.5	37	c.364_366	CCDS5251.2	6																																																																																			ARID1B	-	NULL	ENSG00000049618		0.650	ARID1B-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	ARID1B	HGNC	protein_coding	OTTHUMT00000372723.1		0.00	9	0	CAG	NM_020732		157099429	+1	tier1		no_errors	ENST00000367148	ensembl	human	known	74_37	in_frame_del	33.33	8	4	DEL	0.974:0.990:0.991	-
ASL	435	genome.wustl.edu	37	7	65546811	65546811	+	Missense_Mutation	SNP	C	C	T	rs564735357		TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr7:65546811C>T	ENST00000304874.9	+	3	136	c.34C>T	c.(34-36)Cgg>Tgg	p.R12W	ASL_ENST00000395332.3_Missense_Mutation_p.R12W|ASL_ENST00000395331.3_Missense_Mutation_p.R12W|ASL_ENST00000380839.4_Missense_Mutation_p.R12W	NM_000048.3	NP_000039.2	P04424	ARLY_HUMAN	argininosuccinate lyase	12					arginine biosynthetic process via ornithine (GO:0042450)|arginine catabolic process (GO:0006527)|cellular nitrogen compound metabolic process (GO:0034641)|internal protein amino acid acetylation (GO:0006475)|small molecule metabolic process (GO:0044281)|urea cycle (GO:0000050)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	argininosuccinate lyase activity (GO:0004056)			breast(3)|endometrium(3)|large_intestine(2)|lung(9)|upper_aerodigestive_tract(1)	18					L-Arginine(DB00125)	TTGGGGTGGCCGGTTTGTGGG	0.542																																																	0													67.0	51.0	56.0					7																	65546811		2203	4300	6503	SO:0001583	missense	0				CCDS5531.1, CCDS47597.1, CCDS47598.1	7q11.21	2012-10-02			ENSG00000126522	ENSG00000126522	4.3.2.1		746	protein-coding gene	gene with protein product		608310					Standard	NM_001024943		Approved		uc003tuo.3	P04424	OTTHUMG00000022876	ENST00000304874.9:c.34C>T	7.37:g.65546811C>T	ENSP00000307188:p.Arg12Trp		E7EMI0|E9PE48|Q6LDS5|Q96HS2	Missense_Mutation	SNP	pfam_Fumarate_lyase_N,superfamily_L-Aspartase-like,prints_Fumarate_lyase_fam,tigrfam_Argininosuccinate_lyase	p.R12W	ENST00000304874.9	37	c.34	CCDS5531.1	7	.	.	.	.	.	.	.	.	.	.	c	22.1	4.243621	0.79912	.	.	ENSG00000126522	ENST00000304874;ENST00000380839;ENST00000395332;ENST00000395331	D;D;D;D	0.99413	-5.86;-5.86;-5.86;-5.86	4.9	4.9	0.64082	Lyase 1, N-terminal (1);L-Aspartase-like (1);	0.000000	0.85682	D	0.000000	D	0.99697	0.9885	H	0.98407	4.225	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.97615	1.0132	10	0.87932	D	0	.	10.8417	0.46720	0.2939:0.7061:0.0:0.0	.	12;12;12;12	B4DU69;E9PE48;E7EMI0;P04424	.;.;.;ARLY_HUMAN	W	12	ENSP00000307188:R12W;ENSP00000370219:R12W;ENSP00000378741:R12W;ENSP00000378740:R12W	ENSP00000307188:R12W	R	+	1	2	ASL	65184246	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.011000	0.49567	2.551000	0.86045	0.561000	0.74099	CGG	ASL	-	pfam_Fumarate_lyase_N,superfamily_L-Aspartase-like,tigrfam_Argininosuccinate_lyase	ENSG00000126522		0.542	ASL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASL	HGNC	protein_coding	OTTHUMT00000251695.2	-	0.00	34	0	C	NM_000048		65546811	+1	tier1	-	no_errors	ENST00000304874	ensembl	human	known	74_37	missense	42.62	35	26	SNP	1.000	T
ATP13A1	57130	genome.wustl.edu	37	19	19760397	19760397	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr19:19760397C>A	ENST00000357324.6	-	19	2637	c.2611G>T	c.(2611-2613)Gcc>Tcc	p.A871S	ATP13A1_ENST00000291503.5_Missense_Mutation_p.A753S	NM_020410.2	NP_065143.2	Q9HD20	AT131_HUMAN	ATPase type 13A1	871						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|liver(2)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						TGCTTCAGGGCGCCCACGTCG	0.577																																					Esophageal Squamous(142;920 1789 9047 14684 24777)												0													112.0	75.0	87.0					19																	19760397		2203	4300	6503	SO:0001583	missense	0			AK056420	CCDS32970.2	19p13.11	2010-04-20	2005-01-12	2005-01-12	ENSG00000105726	ENSG00000105726		"""ATPases / P-type"""	24215	protein-coding gene	gene with protein product	"""cation transporting ATPase"""		"""ATPase type 13A"""	ATP13A		11347906	Standard	NM_020410		Approved	KIAA1825, FLJ31858, CGI-152	uc002nnh.4	Q9HD20	OTTHUMG00000153016	ENST00000357324.6:c.2611G>T	19.37:g.19760397C>A	ENSP00000349877:p.Ala871Ser		B3KPJ2|B3KTA7|Q6NT90|Q6ZMG7|Q9H6C6	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Cation_typ_V,tigrfam_Cation_transp_P_typ_ATPase	p.A871S	ENST00000357324.6	37	c.2611	CCDS32970.2	19	.	.	.	.	.	.	.	.	.	.	C	27.0	4.791182	0.90367	.	.	ENSG00000105726	ENST00000291503;ENST00000357324	T;T	0.62105	0.05;0.05	5.58	5.58	0.84498	HAD-like domain (2);	0.046841	0.85682	D	0.000000	D	0.82697	0.5093	M	0.89478	3.035	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.85748	0.1341	10	0.87932	D	0	-27.8469	17.061	0.86547	0.0:1.0:0.0:0.0	.	871;753	Q9HD20;Q9HD20-2	AT131_HUMAN;.	S	753;871	ENSP00000291503:A753S;ENSP00000349877:A871S	ENSP00000291503:A753S	A	-	1	0	ATP13A1	19621397	1.000000	0.71417	0.998000	0.56505	0.655000	0.38815	7.267000	0.78462	2.640000	0.89533	0.561000	0.74099	GCC	ATP13A1	-	pfam_HAD-like_dom,superfamily_HAD-like_dom,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Cation_typ_V,tigrfam_Cation_transp_P_typ_ATPase	ENSG00000105726		0.577	ATP13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP13A1	HGNC	protein_coding	OTTHUMT00000329005.1	-	0.00	31	0	C	NM_020410		19760397	-1	tier1	-	no_errors	ENST00000357324	ensembl	human	known	74_37	missense	30.23	30	13	SNP	1.000	A
ATP5C1	509	genome.wustl.edu	37	10	7844263	7844263	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr10:7844263C>T	ENST00000356708.7	+	7	747	c.668C>T	c.(667-669)gCt>gTt	p.A223V	ATP5C1_ENST00000541227.1_Missense_Mutation_p.A176V|ATP5C1_ENST00000335698.4_Missense_Mutation_p.A223V|ATP5C1_ENST00000493053.1_3'UTR	NM_001001973.1	NP_001001973.1	P36542	ATPG_HUMAN	ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1	223					ATP biosynthetic process (GO:0006754)|ATP catabolic process (GO:0006200)|cellular metabolic process (GO:0044237)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrial proton-transporting ATP synthase complex, catalytic core F(1) (GO:0000275)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|transmembrane transporter activity (GO:0022857)			breast(2)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|skin(1)|urinary_tract(1)	16						GATATTGATGCTGACGTGCTG	0.398																																					Melanoma(143;1012 1820 16249 30920 33158)												0													109.0	91.0	97.0					10																	7844263		2203	4300	6503	SO:0001583	missense	0			D16561	CCDS7081.1, CCDS31142.1	10p14	2012-10-12			ENSG00000165629	ENSG00000165629		"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	833	protein-coding gene	gene with protein product		108729		ATP5CL1, ATP5C		8168843, 8227057	Standard	NM_005174		Approved		uc001iju.3	P36542	OTTHUMG00000017639	ENST00000356708.7:c.668C>T	10.37:g.7844263C>T	ENSP00000349142:p.Ala223Val		A8KA31|Q5VYP3|Q6I9V2|Q96AS8	Missense_Mutation	SNP	pfam_ATPase_F1-cplx_gsu,superfamily_ATPase_F1_gsu_dom,prints_ATPase_F1-cplx_gsu,tigrfam_ATPase_F1-cplx_gsu	p.A223V	ENST00000356708.7	37	c.668	CCDS31142.1	10	.	.	.	.	.	.	.	.	.	.	C	23.7	4.443244	0.83993	.	.	ENSG00000165629	ENST00000356708;ENST00000335698;ENST00000541227	.	.	.	5.5	5.5	0.81552	ATPase, F1 complex, gamma subunit domain (1);	0.048785	0.85682	D	0.000000	T	0.54447	0.1859	L	0.35341	1.055	0.80722	D	1	P	0.44627	0.839	B	0.43783	0.431	T	0.57306	-0.7834	9	0.54805	T	0.06	-7.9113	19.3767	0.94512	0.0:1.0:0.0:0.0	.	223	P36542	ATPG_HUMAN	V	223;223;176	.	ENSP00000338568:A223V	A	+	2	0	ATP5C1	7884269	1.000000	0.71417	0.999000	0.59377	0.772000	0.43724	7.729000	0.84864	2.735000	0.93741	0.655000	0.94253	GCT	ATP5C1	-	pfam_ATPase_F1-cplx_gsu,superfamily_ATPase_F1_gsu_dom,tigrfam_ATPase_F1-cplx_gsu	ENSG00000165629		0.398	ATP5C1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATP5C1	HGNC	protein_coding	OTTHUMT00000046708.1	-	0.00	41	0	C	NM_005174		7844263	+1	tier1	-	no_errors	ENST00000356708	ensembl	human	known	74_37	missense	8.57	32	3	SNP	1.000	T
AURKA	6790	genome.wustl.edu	37	20	54959346	54959346	+	Silent	SNP	C	C	T			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr20:54959346C>T	ENST00000347343.2	-	4	621	c.354G>A	c.(352-354)caG>caA	p.Q118Q	AURKA_ENST00000395907.1_Silent_p.Q118Q|AURKA_ENST00000395909.4_Silent_p.Q118Q|AURKA_ENST00000395915.3_Silent_p.Q118Q|AURKA_ENST00000312783.6_Silent_p.Q118Q|AURKA_ENST00000395914.1_Silent_p.Q118Q|AURKA_ENST00000395911.1_Silent_p.Q118Q|AURKA_ENST00000371356.2_Silent_p.Q118Q|AURKA_ENST00000395913.3_Silent_p.Q118Q	NM_003600.2	NP_003591.2	O14965	AURKA_HUMAN	aurora kinase A	118					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|anterior/posterior axis specification (GO:0009948)|centrosome localization (GO:0051642)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic centrosome separation (GO:0007100)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein binding (GO:0032091)|negative regulation of spindle checkpoint (GO:0090233)|neuron projection extension (GO:1990138)|positive regulation of mitosis (GO:0045840)|positive regulation of oocyte maturation (GO:1900195)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein autophosphorylation (GO:0046777)|protein localization to centrosome (GO:0071539)|protein phosphorylation (GO:0006468)|regulation of centrosome cycle (GO:0046605)|regulation of protein stability (GO:0031647)|spindle assembly involved in female meiosis I (GO:0007057)|spindle stabilization (GO:0043146)	axon hillock (GO:0043203)|centrosome (GO:0005813)|cytosol (GO:0005829)|germinal vesicle (GO:0042585)|meiotic spindle (GO:0072687)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole centrosome (GO:0031616)	ATP binding (GO:0005524)|histone serine kinase activity (GO:0035174)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)			breast(2)|cervix(1)|endometrium(1)|large_intestine(4)|lung(9)|ovary(2)|prostate(1)|skin(2)	22			Colorectal(105;0.202)			CTTCATTTTTCTGTTTTGATG	0.299																																					Melanoma(34;439 1292 51416 52695)|GBM(144;1525 2517 48902 51835)|Esophageal Squamous(191;569 2880 14195 30540)												0													61.0	64.0	63.0					20																	54959346		2203	4292	6495	SO:0001819	synonymous_variant	0			BC001280	CCDS13451.1	20q13	2012-07-23	2003-07-21	2003-07-23	ENSG00000087586	ENSG00000087586		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	11393	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 47"", ""Aurora-A kinase"""	603072	"""serine/threonine kinase 15"", "" serine/threonine kinase 6"""	STK15, STK6		9174055, 9771714	Standard	NM_003600		Approved	BTAK, AurA, STK7, ARK1, PPP1R47, AIK	uc002xxi.1	O14965	OTTHUMG00000032796	ENST00000347343.2:c.354G>A	20.37:g.54959346C>T			E1P5F9|O60445|O75873|Q9BQD6|Q9UPG5	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.Q118	ENST00000347343.2	37	c.354	CCDS13451.1	20																																																																																			AURKA	-	NULL	ENSG00000087586		0.299	AURKA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AURKA	HGNC	protein_coding	OTTHUMT00000079804.3	-	0.00	67	0	C	NM_003600		54959346	-1	tier1	-	no_errors	ENST00000312783	ensembl	human	known	74_37	silent	19.42	83	20	SNP	0.997	T
AVIL	10677	genome.wustl.edu	37	12	58204330	58204330	+	Frame_Shift_Del	DEL	A	A	-			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr12:58204330delA	ENST00000257861.3	-	6	993	c.563delT	c.(562-564)atgfs	p.M188fs	AVIL_ENST00000537081.1_Frame_Shift_Del_p.M181fs	NM_006576.3	NP_006567.3	O75366	AVIL_HUMAN	advillin	188	Core. {ECO:0000250}.				actin filament capping (GO:0051693)|cilium morphogenesis (GO:0060271)|cytoskeleton organization (GO:0007010)|nervous system development (GO:0007399)|positive regulation of neuron projection development (GO:0010976)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)	actin binding (GO:0003779)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(9)|ovary(1)|prostate(6)	32	Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)					TGCCAGAAGCATAGCCTGTCA	0.557																																																	0													64.0	59.0	61.0					12																	58204330		2203	4300	6503	SO:0001589	frameshift_variant	0			AF041449	CCDS8959.1	12q13.11	2006-03-30				ENSG00000135407			14188	protein-coding gene	gene with protein product		613397				9664034, 12034507	Standard	NM_006576		Approved	p92, FLJ12386, ADVIL, DOC6	uc001sqj.2	O75366	OTTHUMG00000170461	ENST00000257861.3:c.563delT	12.37:g.58204330delA	ENSP00000257861:p.Met188fs		B2RAU7|Q2NKM9	Frame_Shift_Del	DEL	pfam_Gelsolin_dom,pfam_Villin_headpiece,superfamily_Villin_headpiece,smart_Villin/Gelsolin,smart_Villin_headpiece,pfscan_Villin_headpiece,prints_Villin/Gelsolin	p.M188fs	ENST00000257861.3	37	c.563	CCDS8959.1	12																																																																																			AVIL	-	pfam_Gelsolin_dom,smart_Villin/Gelsolin	ENSG00000135407		0.557	AVIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AVIL	HGNC	protein_coding	OTTHUMT00000409276.1		0.00	14	0	A	NM_006576		58204330	-1	tier1		no_errors	ENST00000257861	ensembl	human	known	74_37	frame_shift_del	37.50	15	9	DEL	1.000	-
BRINP2	57795	genome.wustl.edu	37	1	177247739	177247739	+	Silent	SNP	G	G	T			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr1:177247739G>T	ENST00000361539.4	+	7	1365	c.1053G>T	c.(1051-1053)cgG>cgT	p.R351R	BRINP2_ENST00000478325.1_3'UTR	NM_021165.2	NP_066988.1	Q9C0B6	BRNP2_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 2	351					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	extracellular region (GO:0005576)											CCGATGACCGGTTCCTGAACT	0.567																																																	0													161.0	171.0	168.0					1																	177247739		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS1320.1	1q24	2013-08-06	2013-08-06	2013-07-31	ENSG00000198797	ENSG00000198797			13746	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member B"""	FAM5B		15193423	Standard	NM_021165		Approved	DBCCR1L2	uc001glf.3	Q9C0B6	OTTHUMG00000034953	ENST00000361539.4:c.1053G>T	1.37:g.177247739G>T			O95560|Q6ZWC1|Q7LCZ9|Q8N360	Silent	SNP	pfam_MACPF,smart_MACPF	p.R351	ENST00000361539.4	37	c.1053	CCDS1320.1	1																																																																																			BRINP2	-	NULL	ENSG00000198797		0.567	BRINP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRINP2	HGNC	protein_coding	OTTHUMT00000084599.1	-	0.00	40	0	G	NM_021165		177247739	+1	tier1	-	no_errors	ENST00000361539	ensembl	human	known	74_37	silent	16.67	15	3	SNP	1.000	T
C5orf46	389336	genome.wustl.edu	37	5	147281335	147281335	+	Splice_Site	SNP	G	G	C			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr5:147281335G>C	ENST00000318315.4	-	2	72	c.72C>G	c.(70-72)gaC>gaG	p.D24E	C5orf46_ENST00000510432.1_5'UTR|C5orf46_ENST00000515291.1_Splice_Site_p.D24E	NM_206966.2	NP_996849.2	Q6UWT4	CE046_HUMAN	chromosome 5 open reading frame 46	24						extracellular vesicular exosome (GO:0070062)				NS(1)|lung(1)|prostate(1)	3						cTGGTTTGTCGTCTGAAAAAC	0.488																																																	0													160.0	143.0	149.0					5																	147281335		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS34267.1	5q33.1	2013-12-13			ENSG00000178776	ENSG00000178776			33768	protein-coding gene	gene with protein product	"""skin and saliva secreted protein 1"""						Standard	NM_206966		Approved	MGC23985, SSSP1	uc003lou.3	Q6UWT4	OTTHUMG00000163420	ENST00000318315.4:c.71-1C>G	5.37:g.147281335G>C			A8K038|Q8WU04	Missense_Mutation	SNP	NULL	p.D24E	ENST00000318315.4	37	c.72	CCDS34267.1	5	.	.	.	.	.	.	.	.	.	.	G	10.99	1.508307	0.27036	.	.	ENSG00000178776	ENST00000318315;ENST00000515291	T;T	0.52754	0.65;0.65	4.06	-1.81	0.07882	.	0.000000	0.50627	D	0.000117	T	0.27765	0.0683	.	.	.	0.27485	N	0.952468	B	0.21225	0.053	B	0.20577	0.03	T	0.13737	-1.0498	9	0.87932	D	0	.	0.5193	0.00609	0.4425:0.1791:0.2052:0.1732	.	24	Q6UWT4	CE046_HUMAN	E	24	ENSP00000315370:D24E;ENSP00000425984:D24E	ENSP00000315370:D24E	D	-	3	2	C5orf46	147261528	0.996000	0.38824	0.940000	0.37924	0.290000	0.27261	0.205000	0.17356	-0.226000	0.09899	-1.311000	0.01308	GAC	C5orf46	-	NULL	ENSG00000178776		0.488	C5orf46-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C5orf46	HGNC	protein_coding	OTTHUMT00000373314.1	-	0.00	47	0	G	NM_206966	Missense_Mutation	147281335	-1	tier1	-	no_errors	ENST00000318315	ensembl	human	known	74_37	missense	29.27	29	12	SNP	0.970	C
C9orf142	286257	genome.wustl.edu	37	9	139888246	139888246	+	Missense_Mutation	SNP	G	G	A	rs370085766		TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr9:139888246G>A	ENST00000371620.3	+	7	630	c.604G>A	c.(604-606)Gat>Aat	p.D202N	C9orf142_ENST00000493968.1_3'UTR|CLIC3_ENST00000480181.1_5'Flank	NM_183241.1	NP_899064.1	Q9BUH6	CI142_HUMAN	chromosome 9 open reading frame 142	202						extracellular vesicular exosome (GO:0070062)						all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0821)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		CGTGGACTTCGATGAGACCTG	0.622																																																	0								G	ASN/ASP	0,4404		0,0,2202	106.0	84.0	91.0		604	3.9	0.1	9		91	1,8599	1.2+/-3.3	0,1,4299	no	missense	C9orf142	NM_183241.1	23	0,1,6501	AA,AG,GG		0.0116,0.0,0.0077	benign	202/205	139888246	1,13003	2202	4300	6502	SO:0001583	missense	0			BC002613	CCDS7020.1	9q34.3	2008-02-05			ENSG00000148362	ENSG00000148362			27849	protein-coding gene	gene with protein product							Standard	NM_183241		Approved		uc004cki.3	Q9BUH6	OTTHUMG00000020971	ENST00000371620.3:c.604G>A	9.37:g.139888246G>A	ENSP00000360682:p.Asp202Asn		Q8IY19	Missense_Mutation	SNP	NULL	p.D202N	ENST00000371620.3	37	c.604	CCDS7020.1	9	.	.	.	.	.	.	.	.	.	.	G	14.90	2.672122	0.47781	0.0	1.16E-4	ENSG00000148362	ENST00000371620	.	.	.	3.88	3.88	0.44766	.	0.402704	0.20765	N	0.086094	T	0.60508	0.2274	L	0.48642	1.525	0.39414	D	0.966791	D	0.67145	0.996	P	0.51101	0.659	T	0.68469	-0.5400	9	0.72032	D	0.01	-1.6526	14.9934	0.71412	0.0:0.0:1.0:0.0	.	202	Q9BUH6	CI142_HUMAN	N	202	.	ENSP00000360682:D202N	D	+	1	0	C9orf142	139008067	0.998000	0.40836	0.109000	0.21407	0.060000	0.15804	5.096000	0.64535	1.997000	0.58415	0.491000	0.48974	GAT	C9orf142	-	NULL	ENSG00000148362		0.622	C9orf142-004	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf142	HGNC	protein_coding	OTTHUMT00000055255.1	-	0.00	60	0	G	NM_183241		139888246	+1	tier1	-	no_errors	ENST00000371620	ensembl	human	known	74_37	missense	32.47	104	50	SNP	0.819	A
CAMTA1	23261	genome.wustl.edu	37	1	7796554	7796554	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr1:7796554G>A	ENST00000303635.7	+	13	3424	c.3217G>A	c.(3217-3219)Gct>Act	p.A1073T	CAMTA1_ENST00000439411.2_Missense_Mutation_p.A1073T	NM_015215.2	NP_056030.1	Q9Y6Y1	CMTA1_HUMAN	calmodulin binding transcription activator 1	1073					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(11)|lung(29)|ovary(5)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	85	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		CCACCTGGCCGCTGCCCAGGG	0.592			T	WWTR1	epitheliod hemangioendothelioma																																			Dom	yes		1	1p36.31-p36.23	611501	calmodulin binding transcription activator 1		M	0													109.0	102.0	104.0					1																	7796554		2203	4300	6503	SO:0001583	missense	0			AB020640	CCDS30576.1, CCDS55574.1, CCDS55575.1	1p36.31-p36.23	2008-07-18			ENSG00000171735	ENSG00000171735			18806	protein-coding gene	gene with protein product		611501				11925432	Standard	NM_001195563		Approved	KIAA0833	uc001aoi.3	Q9Y6Y1	OTTHUMG00000001212	ENST00000303635.7:c.3217G>A	1.37:g.7796554G>A	ENSP00000306522:p.Ala1073Thr		A7MBM4|G3V3Z7|Q5VUE1|Q6V701|Q8WYI3|Q96S92	Missense_Mutation	SNP	pfam_CG-1_dom,pfam_IPT,pfam_IQ_motif_EF-hand-BS,superfamily_Ig_E-set,superfamily_Ankyrin_rpt-contain_dom,superfamily_P-loop_NTPase,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_IQ_motif_EF-hand-BS	p.A1073T	ENST00000303635.7	37	c.3217	CCDS30576.1	1	.	.	.	.	.	.	.	.	.	.	G	27.7	4.857972	0.91433	.	.	ENSG00000171735	ENST00000303635;ENST00000439411;ENST00000414738;ENST00000303646	T;T	0.39997	1.05;1.05	5.79	5.79	0.91817	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	T	0.69233	0.3088	M	0.81239	2.535	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.996;0.998;0.993	T	0.71297	-0.4635	10	0.66056	D	0.02	-9.2643	20.04	0.97581	0.0:0.0:1.0:0.0	.	1073;160;29;1073	Q9Y6Y1-2;B4DXR3;Q7Z7P1;Q9Y6Y1	.;.;.;CMTA1_HUMAN	T	1073;1073;160;29	ENSP00000306522:A1073T;ENSP00000402561:A1073T	ENSP00000306522:A1073T	A	+	1	0	CAMTA1	7719141	1.000000	0.71417	0.897000	0.35233	0.413000	0.31143	9.793000	0.99091	2.733000	0.93635	0.655000	0.94253	GCT	CAMTA1	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000171735		0.592	CAMTA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CAMTA1	HGNC	protein_coding	OTTHUMT00000003588.3	-	0.00	49	0	G	NM_015215		7796554	+1	tier1	-	no_errors	ENST00000303635	ensembl	human	known	74_37	missense	8.33	44	4	SNP	1.000	A
CCDC141	285025	genome.wustl.edu	37	2	179736884	179736884	+	Silent	SNP	C	C	T			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr2:179736884C>T	ENST00000420890.2	-	13	2172	c.2055G>A	c.(2053-2055)gcG>gcA	p.A685A	CCDC141_ENST00000295723.5_Silent_p.A110A	NM_173648.3	NP_775919.3	Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	685										NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(37)|ovary(8)|pancreas(2)|skin(4)|upper_aerodigestive_tract(1)	78			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			CTTTGAATGCCGCCCACTGCT	0.483																																																	0													143.0	116.0	125.0					2																	179736884		2203	4300	6503	SO:0001819	synonymous_variant	0			AK096821		2q31.2	2013-01-14			ENSG00000163492	ENSG00000163492		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26821	protein-coding gene	gene with protein product	"""coiled-coil protein associated with myosin II and DISC1"""					20956536	Standard	NM_173648		Approved	FLJ39502, CAMDI	uc002une.2	Q6ZP82	OTTHUMG00000132578	ENST00000420890.2:c.2055G>A	2.37:g.179736884C>T			H7C0P1|J3KNW6|Q8N8H3	Silent	SNP	pfam_Ig_I-set,pfam_Spectrin_repeat,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.A685	ENST00000420890.2	37	c.2055		2																																																																																			CCDC141	-	NULL	ENSG00000163492		0.483	CCDC141-202	KNOWN	basic|appris_principal	protein_coding	CCDC141	HGNC	protein_coding		-	0.00	45	0	C	NM_173648		179736884	-1	tier1	-	no_errors	ENST00000420890	ensembl	human	known	74_37	silent	45.61	31	26	SNP	0.010	T
CCDC39	339829	genome.wustl.edu	37	3	180397551	180397551	+	5'Flank	SNP	A	A	G			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr3:180397551A>G	ENST00000442201.2	-	0	0				CCDC39-AS1_ENST00000495357.1_RNA|CCDC39_ENST00000273654.4_Missense_Mutation_p.L32P	NM_181426.1	NP_852091.1	Q9UFE4	CCD39_HUMAN	coiled-coil domain containing 39						axonemal dynein complex assembly (GO:0070286)|cilium-dependent cell motility (GO:0060285)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)				NS(1)|breast(1)|endometrium(4)|large_intestine(9)|lung(22)|ovary(6)|prostate(2)	45	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			ACCACGGGGCAGCTGGCTGGA	0.577											OREG0015933	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0																																										SO:0001631	upstream_gene_variant	0			BC047103	CCDS46964.1	3q26.33	2012-07-27			ENSG00000145075	ENSG00000145075			25244	protein-coding gene	gene with protein product		613798				21131972	Standard	NM_181426		Approved	DKFZp434A128, CILD14, FAP59	uc010hxe.3	Q9UFE4	OTTHUMG00000157857		3.37:g.180397551A>G	Exception_encountered	1961	B4E2H1	Missense_Mutation	SNP	superfamily_tRNA-bd_arm	p.L32P	ENST00000442201.2	37	c.95	CCDS46964.1	3	.	.	.	.	.	.	.	.	.	.	A	4.782	0.145377	0.09134	.	.	ENSG00000145075	ENST00000273654	.	.	.	2.62	-5.05	0.02955	.	.	.	.	.	T	0.31702	0.0805	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.39418	-0.9615	5	0.49607	T	0.09	.	5.1208	0.14860	0.2268:0.4864:0.2868:0.0	.	.	.	.	P	32	.	ENSP00000273654:L32P	L	-	2	0	CCDC39	181880245	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.736000	0.00801	-1.114000	0.02977	-0.607000	0.04081	CTG	CCDC39	-	NULL	ENSG00000145075		0.577	CCDC39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC39	HGNC	protein_coding	OTTHUMT00000349783.3	-	0.00	93	0	A	XM_291028		180397551	-1	tier1	-	no_errors	ENST00000273654	ensembl	human	known	74_37	missense	56.22	81	104	SNP	0.000	G
CD244	51744	genome.wustl.edu	37	1	160808261	160808261	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr1:160808261G>T	ENST00000368033.3	-	5	911	c.829C>A	c.(829-831)Ctg>Atg	p.L277M	CD244_ENST00000368034.4_Missense_Mutation_p.L272M|CD244_ENST00000368032.2_Missense_Mutation_p.L272M|CD244_ENST00000322302.7_Missense_Mutation_p.L180M|CD244_ENST00000481677.1_5'UTR			Q9BZW8	CD244_HUMAN	CD244 molecule, natural killer cell receptor 2B4	277					blood coagulation (GO:0007596)|leukocyte migration (GO:0050900)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			central_nervous_system(1)|large_intestine(3)|lung(12)|ovary(1)|urinary_tract(1)	18	all_cancers(52;2.72e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			CTGGTTTTCAGATCCTTGACA	0.473																																																	0													158.0	158.0	158.0					1																	160808261		2203	4300	6503	SO:0001583	missense	0			AF105261	CCDS1210.1, CCDS53398.1, CCDS53399.1	1q23.1	2013-01-11	2006-03-29		ENSG00000122223	ENSG00000122223		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18171	protein-coding gene	gene with protein product		605554	"""natural killer cell receptor 2B4"", ""CD244 natural killer cell receptor 2B4"""			3772297, 10458320	Standard	NM_016382		Approved	2B4, NAIL, NKR2B4, Nmrk, SLAMF4	uc009wtq.3	Q9BZW8	OTTHUMG00000028606	ENST00000368033.3:c.829C>A	1.37:g.160808261G>T	ENSP00000357012:p.Leu277Met		Q5VYI2|Q5VYI6|Q5VYI7|Q96T47|Q9NQD2|Q9NQD3|Q9Y288	Missense_Mutation	SNP	pfam_NK_rcpt_2B4_Ig_dom,pfscan_Ig-like_dom	p.L277M	ENST00000368033.3	37	c.829	CCDS53399.1	1	.	.	.	.	.	.	.	.	.	.	G	12.57	1.977861	0.34942	.	.	ENSG00000122223	ENST00000368034;ENST00000368033;ENST00000322302;ENST00000368032	T;T;T;T	0.38401	1.14;1.14;1.51;1.14	4.38	-4.4	0.03600	.	4.400160	0.00397	N	0.000055	T	0.18425	0.0442	N	0.19112	0.55	0.09310	N	1	P;P;P	0.48503	0.899;0.855;0.911	P;B;P	0.53549	0.729;0.359;0.562	T	0.20472	-1.0274	10	0.54805	T	0.06	-12.2473	9.2914	0.37789	0.1665:0.5854:0.2482:0.0	.	180;277;272	Q9BZW8-4;Q9BZW8;Q9BZW8-2	.;CD244_HUMAN;.	M	272;277;180;272	ENSP00000357013:L272M;ENSP00000357012:L277M;ENSP00000313619:L180M;ENSP00000357011:L272M	ENSP00000313619:L180M	L	-	1	2	CD244	159074885	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	-3.335000	0.00508	-0.611000	0.05709	0.655000	0.94253	CTG	CD244	-	NULL	ENSG00000122223		0.473	CD244-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD244	HGNC	protein_coding	OTTHUMT00000071469.1		0.00	81	0	G	NM_016382		160808261	-1			no_errors	ENST00000368033	ensembl	human	known	74_37	missense	5.41	70	4	SNP	0.000	T
CDK5RAP2	55755	genome.wustl.edu	37	9	123165255	123165255	+	Silent	SNP	C	C	G			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr9:123165255C>G	ENST00000349780.4	-	34	5315	c.5136G>C	c.(5134-5136)ctG>ctC	p.L1712L	CDK5RAP2_ENST00000360822.3_Silent_p.L1680L|CDK5RAP2_ENST00000480467.1_5'UTR|CDK5RAP2_ENST00000360190.4_Silent_p.L1633L|CDK5RAP2_ENST00000359309.3_Silent_p.L1671L	NM_018249.4	NP_060719.4	Q96SN8	CK5P2_HUMAN	CDK5 regulatory subunit associated protein 2	1712					brain development (GO:0007420)|centrosome organization (GO:0051297)|chromosome segregation (GO:0007059)|establishment of mitotic spindle orientation (GO:0000132)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|negative regulation of centriole replication (GO:0046600)|negative regulation of neuron differentiation (GO:0045665)|neurogenesis (GO:0022008)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neuron differentiation (GO:0045664)|regulation of spindle checkpoint (GO:0090231)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|pericentriolar material (GO:0000242)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)	calmodulin binding (GO:0005516)|microtubule binding (GO:0008017)|protein kinase binding (GO:0019901)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)			breast(6)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(6)|urinary_tract(1)	58						GGCCAGTGACCAGGCGGGACA	0.587																																																	0													73.0	74.0	74.0					9																	123165255		2203	4300	6503	SO:0001819	synonymous_variant	0			BK005504	CCDS6823.1, CCDS43871.1, CCDS75888.1	9q33.3	2014-02-21			ENSG00000136861	ENSG00000136861			18672	protein-coding gene	gene with protein product	"""centrosomin"""	608201	"""microcephaly, primary autosomal recessive 3"""	MCPH3		10721722, 17764569, 24466316	Standard	NM_018249		Approved	C48, FLJ10867, CEP215	uc004bkf.4	Q96SN8	OTTHUMG00000021043	ENST00000349780.4:c.5136G>C	9.37:g.123165255C>G			Q5JV18|Q7Z3L4|Q7Z3U1|Q7Z7I6|Q9BSW0|Q9H6J6|Q9HCD9|Q9NV90|Q9UIW9	Silent	SNP	pfam_Spindle_assoc	p.L1712	ENST00000349780.4	37	c.5136	CCDS6823.1	9																																																																																			CDK5RAP2	-	NULL	ENSG00000136861		0.587	CDK5RAP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDK5RAP2	HGNC	protein_coding	OTTHUMT00000055535.1	-	0.00	36	0	C	NM_018249		123165255	-1	tier1	-	no_errors	ENST00000349780	ensembl	human	known	74_37	silent	37.84	46	28	SNP	0.697	G
CFLAR	8837	genome.wustl.edu	37	2	202005016	202005016	+	Intron	SNP	A	A	G			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr2:202005016A>G	ENST00000309955.3	+	5	1038				CFLAR_ENST00000457277.1_Intron|CFLAR_ENST00000342795.5_Intron|CFLAR_ENST00000341222.6_Intron|CFLAR_ENST00000355558.4_Intron|CFLAR-AS1_ENST00000474886.2_RNA|CFLAR_ENST00000340870.5_Intron|RNU7-45P_ENST00000459460.1_RNA|CFLAR_ENST00000440180.1_Intron|CFLAR_ENST00000494258.1_Intron|CFLAR_ENST00000341582.6_Intron|CFLAR_ENST00000479953.2_Intron|CFLAR_ENST00000423241.2_Intron|CFLAR-AS1_ENST00000415011.2_RNA|CFLAR_ENST00000443227.1_Intron	NM_001202515.1|NM_003879.5	NP_001189444.1|NP_003870.4	O15519	CFLAR_HUMAN	CASP8 and FADD-like apoptosis regulator						apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of myoblast fusion (GO:1901740)|positive regulation of catalytic activity (GO:0043085)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of necroptotic process (GO:0060544)|regulation of satellite cell proliferation (GO:0014842)|skeletal muscle atrophy (GO:0014732)|skeletal muscle tissue development (GO:0007519)|skeletal muscle tissue regeneration (GO:0043403)|skeletal myofibril assembly (GO:0014866)|viral process (GO:0016032)	CD95 death-inducing signaling complex (GO:0031265)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|death-inducing signaling complex (GO:0031264)|ripoptosome (GO:0097342)	cysteine-type peptidase activity (GO:0008234)|death effector domain binding (GO:0035877)|enzyme activator activity (GO:0008047)|protease binding (GO:0002020)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|stomach(1)	13						CTGAACCACTATTGAAGATTT	0.358																																					Pancreas(16;548 657 22190 32864 42338)												0																																										SO:0001627	intron_variant	0			AF005774	CCDS2337.1, CCDS46487.1, CCDS56157.1, CCDS56158.1, CCDS59436.1	2q33-q34	2014-01-30			ENSG00000003402	ENSG00000003402		"""Endogenous ligands"""	1876	protein-coding gene	gene with protein product		603599		CASP8AP1		9208847, 9217161	Standard	NM_003879		Approved	CASH, Casper, CLARP, FLAME, FLIP, I-FLICE, MRIT, c-FLIP	uc002uxb.4	O15519	OTTHUMG00000132819	ENST00000309955.3:c.524-64A>G	2.37:g.202005016A>G			B4DJE0|B7Z9F9|O14673|O14674|O14675|O15137|O15138|O15356|O15510|O43618|O43619|O43620|O60458|O60459|Q53TS6|Q54AF1|Q96TE4|Q9UEW1	RNA	SNP	-	NULL	ENST00000309955.3	37	NULL	CCDS2337.1	2																																																																																			CFLAR-AS1	-	-	ENSG00000226312		0.358	CFLAR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CFLAR-AS1	HGNC	protein_coding	OTTHUMT00000256276.3	-	0.00	108	0	A	NM_003879		202005016	-1	tier1	-	no_errors	ENST00000415011	ensembl	human	known	74_37	rna	36.81	91	53	SNP	0.914	G
CHD8	57680	genome.wustl.edu	37	14	21868426	21868426	+	Frame_Shift_Del	DEL	T	T	-			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr14:21868426delT	ENST00000557364.1	-	24	4874	c.4611delA	c.(4609-4611)aaafs	p.K1537fs	SNORD8_ENST00000363915.1_RNA|CHD8_ENST00000555962.1_5'UTR|CHD8_ENST00000399982.2_Frame_Shift_Del_p.K1537fs|CHD8_ENST00000430710.3_Frame_Shift_Del_p.K1258fs			Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	1537					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|canonical Wnt signaling pathway (GO:0060070)|DNA duplex unwinding (GO:0032508)|in utero embryonic development (GO:0001701)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	MLL1 complex (GO:0071339)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|beta-catenin binding (GO:0008013)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)			NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(33)|ovary(6)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	85	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		GTGACTTTACTTTTTTTCCTT	0.413																																																	0													107.0	97.0	100.0					14																	21868426		1839	4101	5940	SO:0001589	frameshift_variant	0			AB046784	CCDS45081.1, CCDS53885.1	14q11.2	2008-02-05	2004-06-22	2004-06-23		ENSG00000100888			20153	protein-coding gene	gene with protein product		610528	"""helicase with SNF2 domain 1"""	HELSNF1		10997877	Standard	NM_020920		Approved	KIAA1564, DUPLIN	uc001war.2	Q9HCK8		ENST00000557364.1:c.4611delA	14.37:g.21868426delT	ENSP00000451601:p.Lys1537fs		Q4G0D8|Q68DQ0|Q6DKH9|Q6P440|Q6ZNL7|Q8N3Z9|Q8NCY4|Q8TBR9|Q96F26	Frame_Shift_Del	DEL	pfam_SNF2_N,pfam_Chromo_domain,pfam_BRK_domain,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.V1538fs	ENST00000557364.1	37	c.4611	CCDS53885.1	14																																																																																			CHD8	-	NULL	ENSG00000100888		0.413	CHD8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CHD8	HGNC	protein_coding	OTTHUMT00000410436.1		0.00	41	0	T	NM_020920		21868426	-1	tier1		no_errors	ENST00000399982	ensembl	human	known	74_37	frame_shift_del	34.55	72	38	DEL	1.000	-
CLDN12	9069	genome.wustl.edu	37	7	90099208	90099208	+	3'UTR	SNP	C	C	T	rs542818468		TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr7:90099208C>T	ENST00000478752.1	+	0	240				CTB-13L3.1_ENST00000480135.1_RNA			P56749	CLD12_HUMAN	claudin 12						calcium-independent cell-cell adhesion (GO:0016338)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			breast(1)|kidney(1)|large_intestine(3)|lung(8)|prostate(2)	15						TCCACAGCCCCAGGAACAATC	0.502													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19578	0.0		0.0	False		,,,				2504	0.0																0																																										SO:0001624	3_prime_UTR_variant	0			AJ250713	CCDS5618.1	7q21	2008-07-18			ENSG00000157224	ENSG00000157224		"""Claudins"""	2034	protein-coding gene	gene with protein product		611232					Standard	NM_001185072		Approved		uc003ukr.3	P56749	OTTHUMG00000156612	ENST00000478752.1:c.*237C>T	7.37:g.90099208C>T			D6W5Q4|Q7LDZ0	RNA	SNP	-	NULL	ENST00000478752.1	37	NULL		7																																																																																			CLDN12	-	-	ENSG00000157224		0.502	CLDN12-009	PUTATIVE	basic	processed_transcript	CLDN12	HGNC	protein_coding	OTTHUMT00000140209.1	-	0.00	26	0	C	NM_012129		90099208	+1	tier1	-	no_errors	ENST00000498033	ensembl	human	known	74_37	rna	12.50	49	7	SNP	0.000	T
CNOT3	4849	genome.wustl.edu	37	19	54646887	54646887	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr19:54646887G>A	ENST00000406403.1	+	2	1661	c.58G>A	c.(58-60)Gag>Aag	p.E20K	CNOT3_ENST00000221232.5_Missense_Mutation_p.E20K|CNOT3_ENST00000358389.3_5'UTR			O75175	CNOT3_HUMAN	CCR4-NOT transcription complex, subunit 3	20					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|nucleus (GO:0005634)		p.E20K(6)		endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(3)|prostate(7)|urinary_tract(3)	28	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					GAAGGTGTCCGAGGGCGTGGA	0.557																																																	6	Substitution - Missense(6)	prostate(4)|urinary_tract(1)|haematopoietic_and_lymphoid_tissue(1)											171.0	172.0	171.0					19																	54646887		2203	4300	6503	SO:0001583	missense	0			AF180474	CCDS12880.1	19q13.4	2011-02-14			ENSG00000088038	ENSG00000088038			7879	protein-coding gene	gene with protein product	"""NOT3 (negative regulator of transcription 3, yeast) homolog"""	604910		NOT3		10637334, 9734811	Standard	NM_014516		Approved	NOT3H, KIAA0691, LENG2	uc002qdj.2	O75175	OTTHUMG00000066468	ENST00000406403.1:c.58G>A	19.37:g.54646887G>A	ENSP00000383954:p.Glu20Lys		Q9NZN7|Q9UF76	Missense_Mutation	SNP	pfam_Not_N,pfam_NOT,pirsf_CCR4-NOT_su3/5	p.E20K	ENST00000406403.1	37	c.58	CCDS12880.1	19	.	.	.	.	.	.	.	.	.	.	G	35	5.507003	0.96386	.	.	ENSG00000088038	ENST00000221232;ENST00000406403	T;T	0.72725	-0.68;-0.68	5.04	5.04	0.67666	Not CCR4-Not complex component, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.85788	0.5778	M	0.85299	2.745	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.81914	0.995;0.993	D	0.88178	0.2869	10	0.87932	D	0	-31.302	17.5375	0.87837	0.0:0.0:1.0:0.0	.	20;20	B7Z6J7;O75175	.;CNOT3_HUMAN	K	20	ENSP00000221232:E20K;ENSP00000383954:E20K	ENSP00000221232:E20K	E	+	1	0	CNOT3	59338699	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.832000	0.92079	2.512000	0.84698	0.655000	0.94253	GAG	CNOT3	-	pfam_Not_N,pirsf_CCR4-NOT_su3/5	ENSG00000088038		0.557	CNOT3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CNOT3	HGNC	protein_coding	OTTHUMT00000142130.3		0.00	15	0	G	NM_014516		54646887	+1			no_errors	ENST00000221232	ensembl	human	known	74_37	missense	21.05	15	4	SNP	1.000	A
CNST	163882	genome.wustl.edu	37	1	246784932	246784932	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr1:246784932A>G	ENST00000366513.4	+	3	850	c.581A>G	c.(580-582)cAt>cGt	p.H194R	CNST_ENST00000483271.1_3'UTR|CNST_ENST00000366512.3_Missense_Mutation_p.H194R	NM_152609.2	NP_689822.2	Q6PJW8	CNST_HUMAN	consortin, connexin sorting protein	194					negative regulation of phosphatase activity (GO:0010923)|positive regulation of Golgi to plasma membrane protein transport (GO:0042998)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|trans-Golgi network (GO:0005802)|transport vesicle (GO:0030133)	connexin binding (GO:0071253)|phosphatase binding (GO:0019902)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|prostate(1)|urinary_tract(2)	28						CTTTGCCTTCATCAGGTACTC	0.493																																																	0													132.0	125.0	128.0					1																	246784932		2203	4300	6503	SO:0001583	missense	0			AK056563	CCDS1628.1, CCDS44343.1	1q44	2012-04-17	2009-11-03	2009-11-03	ENSG00000162852	ENSG00000162852		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	26486	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 64"""	613439	"""chromosome 1 open reading frame 71"""	C1orf71		19864490	Standard	NM_152609		Approved	FLJ32001, PPP1R64	uc001ibp.3	Q6PJW8	OTTHUMG00000040090	ENST00000366513.4:c.581A>G	1.37:g.246784932A>G	ENSP00000355470:p.His194Arg		Q5VSY9|Q5VTM7|Q8IYA9|Q8N3L5|Q8NB09|Q8TEI2|Q96MR5	Missense_Mutation	SNP	NULL	p.H194R	ENST00000366513.4	37	c.581	CCDS1628.1	1	.	.	.	.	.	.	.	.	.	.	A	21.3	4.129034	0.77549	.	.	ENSG00000162852	ENST00000366513;ENST00000366512	T;T	0.24908	1.83;1.83	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.51669	0.1688	M	0.77103	2.36	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.56655	-0.7943	10	0.87932	D	0	0.0038	12.9166	0.58209	1.0:0.0:0.0:0.0	.	194;194	Q6PJW8;Q6PJW8-2	CNST_HUMAN;.	R	194	ENSP00000355470:H194R;ENSP00000355469:H194R	ENSP00000355469:H194R	H	+	2	0	CNST	244851555	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	4.969000	0.63735	2.064000	0.61679	0.533000	0.62120	CAT	CNST	-	NULL	ENSG00000162852		0.493	CNST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNST	HGNC	protein_coding	OTTHUMT00000096780.1	-	0.00	45	0	A	NM_152609		246784932	+1	tier1	-	no_errors	ENST00000366513	ensembl	human	known	74_37	missense	64.10	14	25	SNP	1.000	G
COG7	91949	genome.wustl.edu	37	16	23421669	23421669	+	Silent	SNP	G	G	T			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr16:23421669G>T	ENST00000307149.5	-	11	1607	c.1422C>A	c.(1420-1422)acC>acA	p.T474T		NM_153603.3	NP_705831.1	P83436	COG7_HUMAN	component of oligomeric golgi complex 7	474					intracellular protein transport (GO:0006886)|protein glycosylation (GO:0006486)|protein localization to Golgi apparatus (GO:0034067)|protein localization to organelle (GO:0033365)|protein stabilization (GO:0050821)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(7)|large_intestine(9)|liver(1)|lung(7)|urinary_tract(1)	27				GBM - Glioblastoma multiforme(48;0.0401)		GCTCTCCACAGGTGGCTATTA	0.448																																																	0													84.0	64.0	71.0					16																	23421669		2197	4300	6497	SO:0001819	synonymous_variant	0			AF070568	CCDS10610.1	16p12.2	2008-02-05			ENSG00000168434	ENSG00000168434		"""Components of oligomeric golgi complex"""	18622	protein-coding gene	gene with protein product		606978				11980916	Standard	NM_153603		Approved		uc002dlo.3	P83436	OTTHUMG00000094807	ENST00000307149.5:c.1422C>A	16.37:g.23421669G>T			Q6UWU7	Silent	SNP	pfam_COG7	p.T474	ENST00000307149.5	37	c.1422	CCDS10610.1	16																																																																																			COG7	-	pfam_COG7	ENSG00000168434		0.448	COG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COG7	HGNC	protein_coding	OTTHUMT00000211625.1	-	0.00	59	0	G			23421669	-1	tier1	-	no_errors	ENST00000307149	ensembl	human	known	74_37	silent	5.71	66	4	SNP	1.000	T
COL13A1	1305	genome.wustl.edu	37	10	71678829	71678829	+	Silent	SNP	G	G	A			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr10:71678829G>A	ENST00000398978.3	+	20	1533	c.1041G>A	c.(1039-1041)ggG>ggA	p.G347G	COL13A1_ENST00000520133.1_Silent_p.G296G|COL13A1_ENST00000398969.3_Silent_p.G290G|COL13A1_ENST00000354547.3_Silent_p.G325G|COL13A1_ENST00000398964.3_Silent_p.G318G|COL13A1_ENST00000398972.3_Silent_p.G347G|COL13A1_ENST00000520267.1_Silent_p.G290G|COL13A1_ENST00000398966.3_Silent_p.G325G|COL13A1_ENST00000517713.1_Silent_p.G325G|COL13A1_ENST00000398971.3_Silent_p.G347G|COL13A1_ENST00000522165.1_Silent_p.G328G|COL13A1_ENST00000398973.3_Silent_p.G347G|COL13A1_ENST00000398968.3_Silent_p.G328G|COL13A1_ENST00000398974.3_Silent_p.G335G|COL13A1_ENST00000356340.3_Silent_p.G347G|COL13A1_ENST00000357811.3_Silent_p.G325G	NM_001130103.1	NP_001123575.1			collagen, type XIII, alpha 1											endometrium(5)|large_intestine(3)|lung(15)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	28						GTGAGCCAGGGATCCCAGGAA	0.542																																																	0													202.0	204.0	204.0					10																	71678829		1967	4155	6122	SO:0001819	synonymous_variant	0			AJ293624	CCDS44419.1, CCDS44423.1, CCDS44424.1, CCDS44425.1, CCDS44427.1, CCDS44428.1, CCDS44423.2, CCDS44424.2, CCDS44425.2, CCDS44427.2, CCDS44428.2	10q22	2013-01-16			ENSG00000197467	ENSG00000197467		"""Collagens"""	2190	protein-coding gene	gene with protein product		120350					Standard	NM_001130103		Approved		uc001jql.3	Q5TAT6	OTTHUMG00000018394	ENST00000398978.3:c.1041G>A	10.37:g.71678829G>A				Silent	SNP	pfam_Collagen	p.G347	ENST00000398978.3	37	c.1041	CCDS44419.1	10																																																																																			COL13A1	-	pfam_Collagen	ENSG00000197467		0.542	COL13A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL13A1	HGNC	protein_coding	OTTHUMT00000048468.1	-	0.00	29	0	G	NM_005203		71678829	+1	tier1	-	no_errors	ENST00000356340	ensembl	human	known	74_37	silent	17.24	24	5	SNP	0.997	A
CREBBP	1387	genome.wustl.edu	37	16	3788617	3788617	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr16:3788617C>A	ENST00000262367.5	-	26	5146	c.4337G>T	c.(4336-4338)cGc>cTc	p.R1446L	CREBBP_ENST00000382070.3_Missense_Mutation_p.R1408L	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	1446	Acetyl-CoA binding. {ECO:0000250|UniProtKB:Q09472}.|CBP/p300-type HAT. {ECO:0000255|PROSITE- ProRule:PRU01065}.|Cys/His-rich.				cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.R1446H(4)|p.R1446L(3)		NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		AACGGCTGTGCGGAGGCAACG	0.408			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																																	Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	7	Substitution - Missense(7)	haematopoietic_and_lymphoid_tissue(5)|upper_aerodigestive_tract(1)|central_nervous_system(1)											75.0	68.0	70.0					16																	3788617		2197	4300	6497	SO:0001583	missense	0			U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.4337G>T	16.37:g.3788617C>A	ENSP00000262367:p.Arg1446Leu		D3DUC9|O00147|Q16376|Q4LE28	Missense_Mutation	SNP	pfam_Histone_H3-K56_AcTrfase_RTT109,pfam_Nuc_rcpt_coact_CREBbp,pfam_KIX_dom,pfam_DUF902_CREBbp,pfam_Znf_TAZ,pfam_Bromodomain,pfam_Znf_ZZ,superfamily_Bromodomain,superfamily_Znf_TAZ,superfamily_KIX_dom,superfamily_Nuc_rcpt_coact,superfamily_Znf_FYVE_PHD,smart_Znf_TAZ,smart_Bromodomain,smart_Znf_ZZ,pfscan_KIX_dom,pfscan_Znf_TAZ,pfscan_Znf_ZZ,pfscan_Bromodomain,prints_Bromodomain	p.R1446L	ENST00000262367.5	37	c.4337	CCDS10509.1	16	.	.	.	.	.	.	.	.	.	.	c	24.5	4.536520	0.85812	.	.	ENSG00000005339	ENST00000262367;ENST00000543883;ENST00000382070;ENST00000323508	D;D	0.94000	-3.33;-3.33	5.28	5.28	0.74379	.	0.000000	0.64402	D	0.000004	D	0.97974	0.9333	H	0.96080	3.765	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98994	1.0809	10	0.87932	D	0	-29.6499	19.2588	0.93959	0.0:1.0:0.0:0.0	.	1476;1446	Q4LE28;Q92793	.;CBP_HUMAN	L	1446;1476;1408;35	ENSP00000262367:R1446L;ENSP00000371502:R1408L	ENSP00000262367:R1446L	R	-	2	0	CREBBP	3728618	1.000000	0.71417	0.998000	0.56505	0.972000	0.66771	7.755000	0.85180	2.638000	0.89438	0.561000	0.74099	CGC	CREBBP	-	pfam_Histone_H3-K56_AcTrfase_RTT109	ENSG00000005339		0.408	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CREBBP	HGNC	protein_coding	OTTHUMT00000251591.2	-	0.00	84	0	C	NM_004380		3788617	-1	tier1	-	no_errors	ENST00000262367	ensembl	human	known	74_37	missense	34.59	87	46	SNP	1.000	A
CUEDC1	404093	genome.wustl.edu	37	17	55940323	55940324	+	3'UTR	INS	-	-	T	rs559186385|rs59475396|rs545426418	byFrequency	TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr17:55940323_55940324insT	ENST00000577830.1	-	0	1900_1901				CUEDC1_ENST00000407144.2_3'UTR|CUEDC1_ENST00000578357.1_Intron	NM_001271875.1	NP_001258804.1	Q9NWM3	CUED1_HUMAN	CUE domain containing 1											endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|skin(3)	12						TGCTTTCTGGATTTTTTTTTTT	0.48																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK000746	CCDS11599.1	17q23.2	2004-03-16				ENSG00000180891			31350	protein-coding gene	gene with protein product							Standard	NM_001271875		Approved		uc002ive.2	Q9NWM3		ENST00000577830.1:c.*327->A	17.37:g.55940334_55940334dupT			D3DTZ2|Q9NWD0	RNA	INS	-	NULL	ENST00000577830.1	37	NULL	CCDS11599.1	17																																																																																			CUEDC1	-	-	ENSG00000180891		0.480	CUEDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUEDC1	HGNC	protein_coding	OTTHUMT00000443305.1		0.00	13	0	-	NM_017949		55940324	-1	tier1		no_errors	ENST00000577422	ensembl	human	known	74_37	rna	25.00	12	4	INS	0.001:0.000	T
DCAF12L1	139170	genome.wustl.edu	37	X	125685998	125685998	+	Silent	SNP	G	G	A			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chrX:125685998G>A	ENST00000371126.1	-	1	836	c.594C>T	c.(592-594)ttC>ttT	p.F198F		NM_178470.4	NP_848565.2	Q5VU92	DC121_HUMAN	DDB1 and CUL4 associated factor 12-like 1	198										breast(1)|central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(39)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	68						AGGCGACGGCGAAGATCCAGT	0.667																																																	0													35.0	37.0	36.0					X																	125685998		2203	4298	6501	SO:0001819	synonymous_variant	0			BC035674	CCDS14610.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198889	ENSG00000198889		"""WD repeat domain containing"""	29395	protein-coding gene	gene with protein product			"""WD repeat domain 40B"""	WDR40B		12477932	Standard	NM_178470		Approved	KIAA1892L	uc004eul.3	Q5VU92	OTTHUMG00000022353	ENST00000371126.1:c.594C>T	X.37:g.125685998G>A			Q8IYK3	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.F198	ENST00000371126.1	37	c.594	CCDS14610.1	X																																																																																			DCAF12L1	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000198889		0.667	DCAF12L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF12L1	HGNC	protein_coding	OTTHUMT00000058186.1	-	0.00	46	0	G	NM_178470		125685998	-1	tier1	-	no_errors	ENST00000371126	ensembl	human	known	74_37	silent	66.00	17	33	SNP	0.004	A
DHX30	22907	genome.wustl.edu	37	3	47887139	47887140	+	Intron	INS	-	-	T	rs568710065		TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr3:47887139_47887140insT	ENST00000445061.1	+	10	1346				DHX30_ENST00000446256.2_Intron|DHX30_ENST00000348968.4_Intron|DHX30_ENST00000457607.1_Intron	NM_138615.2	NP_619520.1	Q7L2E3	DHX30_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 30							cytoplasm (GO:0005737)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(1)|large_intestine(11)|lung(13)|ovary(4)|pancreas(1)|prostate(1)|skin(3)	37				BRCA - Breast invasive adenocarcinoma(193;0.000696)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)		GTCTGGGCTGGTTTTTGGGGAG	0.51																																																	0																																										SO:0001627	intron_variant	0			AB020697	CCDS2759.1	3p24.3-p22.1	2013-07-16	2013-07-16	2003-06-13	ENSG00000132153	ENSG00000132153		"""DEAH-boxes"""	16716	protein-coding gene	gene with protein product			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 30"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 30"""	DDX30		10048485, 18022663	Standard	NM_138615		Approved	KIAA0890, FLJ11214	uc003cru.3	Q7L2E3	OTTHUMG00000133522	ENST00000445061.1:c.940-50->T	3.37:g.47887144_47887144dupT			A8K5F1|O94965|Q7Z753|Q96CH4|Q9NUQ0	RNA	INS	-	NULL	ENST00000445061.1	37	NULL	CCDS2759.1	3																																																																																			DHX30	-	-	ENSG00000132153		0.510	DHX30-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DHX30	HGNC	protein_coding	OTTHUMT00000257495.2		0.00	28	0	-	NM_138615		47887140	+1	tier1		no_errors	ENST00000461905	ensembl	human	known	74_37	rna	39.13	14	9	INS	0.001:0.000	T
DNALI1	7802	genome.wustl.edu	37	1	38023339	38023339	+	Nonsense_Mutation	SNP	C	C	A			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr1:38023339C>A	ENST00000541606.1	+	2	206	c.9C>A	c.(7-9)taC>taA	p.Y3*	DNALI1_ENST00000296218.7_Missense_Mutation_p.L95I			O14645	IDLC_HUMAN	dynein, axonemal, light intermediate chain 1	0					cellular component movement (GO:0006928)|metabolic process (GO:0008152)|single fertilization (GO:0007338)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|cytoplasm (GO:0005737)|filopodium (GO:0030175)	microtubule motor activity (GO:0003777)			breast(1)|kidney(1)|large_intestine(2)|ovary(1)	5		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				GAATGCCATACTACCCCCAAG	0.537																																																	0													151.0	147.0	149.0					1																	38023339		2203	4300	6503	SO:0001587	stop_gained	0			AF006386	CCDS420.1	1p35.1	2008-07-18	2006-09-04		ENSG00000163879	ENSG00000163879		"""Axonemal dyneins"""	14353	protein-coding gene	gene with protein product	"""inner dynein arm, homolog of clamydomonas"", ""dJ423B22.5 (axonemal dynein light chain (hp28))"""	602135	"""dynein, axonemal, light intermediate polypeptide 1"""			9284741	Standard	NM_003462		Approved	P28, hp28, dJ423B22.5	uc001cbj.3	O14645	OTTHUMG00000004222	ENST00000541606.1:c.9C>A	1.37:g.38023339C>A	ENSP00000438962:p.Tyr3*		A8K387|B4DHN6|Q05BL9|Q5HYE2|Q5TGH0|Q7L0I5	Nonsense_Mutation	SNP	pfam_Axonemal_dynein_light_chain	p.Y3*	ENST00000541606.1	37	c.9		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	32|32	5.134137|5.134137	0.94517|0.94517	.|.	.|.	ENSG00000163879|ENSG00000163879	ENST00000296218|ENST00000541606	T|.	0.60920|.	0.15|.	5.49|5.49	4.38|4.38	0.52667|0.52667	.|.	0.064910|.	0.56097|.	D|.	0.000022|.	T|.	0.67335|.	0.2882|.	M|M	0.71296|0.71296	2.17|2.17	0.80722|0.80722	A|A	1|1	D|.	0.69078|.	0.997|.	D|.	0.79108|.	0.992|.	T|.	0.74702|.	-0.3576|.	9|.	0.48119|.	T|.	0.1|.	-9.4866|-9.4866	12.4418|12.4418	0.55629|0.55629	0.0:0.9043:0.0:0.0957|0.0:0.9043:0.0:0.0957	.|.	73|.	O14645|.	IDLC_HUMAN|.	I|X	95|3	ENSP00000296218:L95I|.	ENSP00000296218:L95I|.	L|Y	+|+	1|3	2|2	DNALI1|DNALI1	37795926|37795926	0.998000|0.998000	0.40836|0.40836	1.000000|1.000000	0.80357|0.80357	0.795000|0.795000	0.44927|0.44927	1.870000|1.870000	0.39529|0.39529	2.576000|2.576000	0.86940|0.86940	0.591000|0.591000	0.81541|0.81541	CTA|TAC	DNALI1	-	NULL	ENSG00000163879		0.537	DNALI1-201	KNOWN	basic	protein_coding	DNALI1	HGNC	protein_coding			0.00	15	0	C	NM_003462		38023339	+1			no_errors	ENST00000541606	ensembl	human	known	74_37	nonsense	20.00	16	4	SNP	1.000	A
DOC2A	8448	genome.wustl.edu	37	16	30020351	30020351	+	Missense_Mutation	SNP	T	T	A			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr16:30020351T>A	ENST00000350119.4	-	5	683	c.493A>T	c.(493-495)Atc>Ttc	p.I165F	DOC2A_ENST00000564944.1_Missense_Mutation_p.I165F|DOC2A_ENST00000564979.1_Missense_Mutation_p.I165F	NM_001282062.1|NM_001282063.1|NM_001282068.1|NM_003586.2	NP_001268991.1|NP_001268992.1|NP_001268997.1|NP_003577.2	Q14183	DOC2A_HUMAN	double C2-like domains, alpha	165	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				nervous system development (GO:0007399)|regulation of calcium ion-dependent exocytosis (GO:0017158)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|lysosome (GO:0005764)|membrane (GO:0016020)|neuron projection (GO:0043005)|synaptic vesicle (GO:0008021)	calcium-dependent phospholipid binding (GO:0005544)|transporter activity (GO:0005215)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(2)|ovary(2)	9						TCATCTGTGATCCCGCTGTAA	0.557																																																	0													215.0	178.0	190.0					16																	30020351		2197	4300	6497	SO:0001583	missense	0			D31897	CCDS10666.1	16p11.2	2014-07-02			ENSG00000149927	ENSG00000149927		"""Synaptotagmins"""	2985	protein-coding gene	gene with protein product		604567				7826360, 9736751	Standard	NM_003586		Approved		uc002dvn.3	Q14183	OTTHUMG00000132109	ENST00000350119.4:c.493A>T	16.37:g.30020351T>A	ENSP00000340017:p.Ile165Phe		B4DEJ2|H3BNH6|Q6P4G4|Q7Z5G0|Q8IVX0	Missense_Mutation	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pirsf_Doc2,prints_Synaptotagmin,prints_C2_dom,pfscan_C2_dom	p.I165F	ENST00000350119.4	37	c.493	CCDS10666.1	16	.	.	.	.	.	.	.	.	.	.	T	14.14	2.447333	0.43429	.	.	ENSG00000149927	ENST00000350119	T	0.44482	0.92	5.58	4.47	0.54385	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.227351	0.30584	N	0.009302	T	0.47248	0.1435	N	0.25426	0.745	0.53688	D	0.999973	D	0.89917	1.0	D	0.81914	0.995	T	0.33059	-0.9883	10	0.31617	T	0.26	.	10.0955	0.42473	0.1504:0.0:0.0:0.8496	.	165	Q14183	DOC2A_HUMAN	F	165	ENSP00000340017:I165F	ENSP00000340017:I165F	I	-	1	0	DOC2A	29927852	1.000000	0.71417	0.640000	0.29408	0.126000	0.20510	7.557000	0.82243	0.917000	0.36895	0.402000	0.26972	ATC	DOC2A	-	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pirsf_Doc2,pfscan_C2_dom	ENSG00000149927		0.557	DOC2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOC2A	HGNC	protein_coding	OTTHUMT00000255148.2	-	0.00	46	0	T	NM_003586		30020351	-1	tier1	-	no_errors	ENST00000350119	ensembl	human	known	74_37	missense	32.00	34	16	SNP	0.943	A
DOCK2	1794	genome.wustl.edu	37	5	169412885	169412885	+	Silent	SNP	G	G	T			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr5:169412885G>T	ENST00000256935.8	+	29	3032	c.2952G>T	c.(2950-2952)gtG>gtT	p.V984V	DOCK2_ENST00000523351.1_3'UTR|DOCK2_ENST00000520908.1_Silent_p.V476V|DOCK2_ENST00000540750.1_Silent_p.V45V	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	984	Interaction with CRKL.				actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GAAAGAACGTGTACCCTGGAG	0.478																																																	0													260.0	244.0	250.0					5																	169412885		2203	4300	6503	SO:0001819	synonymous_variant	0			BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.2952G>T	5.37:g.169412885G>T			Q2M3I0|Q96AK7	Silent	SNP	pfam_DOCK_C,pfam_SH3_2,superfamily_SH3_domain,superfamily_Cyt_c-like_dom,superfamily_ARM-type_fold,superfamily_Ferritin-like_SF,smart_SH3_domain,pfscan_SH3_domain	p.V984	ENST00000256935.8	37	c.2952	CCDS4371.1	5																																																																																			DOCK2	-	superfamily_ARM-type_fold	ENSG00000134516		0.478	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK2	HGNC	protein_coding	OTTHUMT00000252828.2	-	0.00	44	0	G	NM_004946		169412885	+1	tier1	-	no_errors	ENST00000256935	ensembl	human	known	74_37	silent	6.78	55	4	SNP	1.000	T
DPH5	51611	genome.wustl.edu	37	1	101455897	101455897	+	3'UTR	DEL	A	A	-			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr1:101455897delA	ENST00000370109.3	-	0	1037				DPH5_ENST00000342173.7_3'UTR|AC093157.1_ENST00000593496.1_5'UTR|DPH5_ENST00000427040.2_3'UTR|DPH5_ENST00000370105.3_5'UTR	NM_001077394.1|NM_001077395.1|NM_015958.2	NP_001070862.1|NP_001070863.1|NP_057042.2	Q9H2P9	DPH5_HUMAN	diphthamide biosynthesis 5						peptidyl-diphthamide biosynthetic process from peptidyl-histidine (GO:0017183)		diphthine synthase activity (GO:0004164)			endometrium(2)|large_intestine(1)|lung(4)	7		all_epithelial(167;3.1e-06)|all_lung(203;0.000414)|Lung NSC(277;0.000946)		Epithelial(280;0.0385)|all cancers(265;0.043)|COAD - Colon adenocarcinoma(174;0.151)|Colorectal(144;0.173)|Lung(183;0.198)		ttgggtggggatacatccaaa	0.383																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF132964	CCDS41358.1, CCDS41359.1	1p21.2	2013-05-02	2013-05-02		ENSG00000117543	ENSG00000117543			24270	protein-coding gene	gene with protein product		611075	"""DPH5 homolog (S. cerevisiae)"""			15485916, 23486472	Standard	NM_015958		Approved	CGI-30	uc001dtt.2	Q9H2P9	OTTHUMG00000010829	ENST00000370109.3:c.*67T>-	1.37:g.101455897delA			A8JZY6|D3DT62|Q9P017|Q9P0I4|Q9Y319	RNA	DEL	-	NULL	ENST00000370109.3	37	NULL	CCDS41358.1	1																																																																																			DPH5	-	-	ENSG00000117543		0.383	DPH5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DPH5	HGNC	protein_coding	OTTHUMT00000029881.1		0.00	11	0	A	NM_015958		101455897	-1	tier1		no_errors	ENST00000370105	ensembl	human	known	74_37	rna	27.78	26	10	DEL	0.036	-
DSG1	1828	genome.wustl.edu	37	18	28913582	28913582	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr18:28913582G>T	ENST00000257192.4	+	7	927	c.715G>T	c.(715-717)Ggc>Tgc	p.G239C		NM_001942.2	NP_001933.2	Q02413	DSG1_HUMAN	desmoglein 1	239	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell-cell junction assembly (GO:0007043)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)|maternal process involved in female pregnancy (GO:0060135)|protein stabilization (GO:0050821)|response to progesterone (GO:0032570)|single organismal cell-cell adhesion (GO:0016337)	apical plasma membrane (GO:0016324)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)|toxic substance binding (GO:0015643)			NS(2)|central_nervous_system(2)|endometrium(5)|kidney(7)|large_intestine(11)|lung(36)|ovary(3)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)	76			OV - Ovarian serous cystadenocarcinoma(10;0.00559)			TGCTGTAAGAGGCTCTGACCG	0.428																																																	0													129.0	117.0	121.0					18																	28913582		2203	4300	6503	SO:0001583	missense	0			X56654	CCDS11896.1	18q12.1	2014-05-13			ENSG00000134760	ENSG00000134760		"""Cadherins / Major cadherins"""	3048	protein-coding gene	gene with protein product		125670		DSG		1889810	Standard	NM_001942		Approved	CDHF4	uc002kwp.3	Q02413	OTTHUMG00000131983	ENST00000257192.4:c.715G>T	18.37:g.28913582G>T	ENSP00000257192:p.Gly239Cys		B7Z845	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Desmoglein,prints_Cadherin,prints_Desmosomal_cadherin	p.G239C	ENST00000257192.4	37	c.715	CCDS11896.1	18	.	.	.	.	.	.	.	.	.	.	G	18.06	3.539774	0.65085	.	.	ENSG00000134760	ENST00000257192	T	0.60920	0.15	5.82	5.82	0.92795	Cadherin (5);Cadherin-like (1);	0.091551	0.47852	D	0.000214	T	0.79845	0.4516	M	0.82517	2.595	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.81369	-0.0964	10	0.72032	D	0.01	.	20.088	0.97803	0.0:0.0:1.0:0.0	.	239	Q02413	DSG1_HUMAN	C	239	ENSP00000257192:G239C	ENSP00000257192:G239C	G	+	1	0	DSG1	27167580	1.000000	0.71417	1.000000	0.80357	0.115000	0.19883	7.188000	0.77739	2.739000	0.93911	0.655000	0.94253	GGC	DSG1	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000134760		0.428	DSG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSG1	HGNC	protein_coding	OTTHUMT00000254947.1	-	0.00	39	0	G	NM_001942		28913582	+1	tier1	-	no_errors	ENST00000257192	ensembl	human	known	74_37	missense	8.33	44	4	SNP	1.000	T
DTYMK	1841	genome.wustl.edu	37	2	242615582	242615582	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr2:242615582C>T	ENST00000305784.2	-	5	806	c.599G>A	c.(598-600)cGc>cAc	p.R200H		NM_001165031.1|NM_012145.3	NP_001158503.1|NP_036277.2	P23919	KTHY_HUMAN	deoxythymidylate kinase (thymidylate kinase)	200					cell cycle (GO:0007049)|cell proliferation (GO:0008283)|cellular response to growth factor stimulus (GO:0071363)|dTDP biosynthetic process (GO:0006233)|dTTP biosynthetic process (GO:0006235)|myoblast differentiation (GO:0045445)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside monophosphate phosphorylation (GO:0046940)|nucleotide phosphorylation (GO:0046939)|response to cadmium ion (GO:0046686)|response to estrogen (GO:0043627)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrial intermembrane space (GO:0005758)|mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|nucleoside phosphate kinase activity (GO:0050145)|thymidylate kinase activity (GO:0004798)			NS(1)|large_intestine(1)|lung(4)|urinary_tract(1)	7		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.6e-33)|all cancers(36;3.57e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.23e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0825)		TGTGGCAGTGCGGATGGCGTC	0.607																																																	0													61.0	54.0	56.0					2																	242615582		2203	4296	6499	SO:0001583	missense	0			X54729	CCDS2552.1	2q37	2008-02-05			ENSG00000168393	ENSG00000168393	2.7.4.9		3061	protein-coding gene	gene with protein product	"""dTMP kinase"", ""thymidylate (dTMP) kinase"""	188345				2017365, 8024690	Standard	NM_001165031		Approved	CDC8, TYMK, TMPK	uc002wbz.2	P23919	OTTHUMG00000133409	ENST00000305784.2:c.599G>A	2.37:g.242615582C>T	ENSP00000304802:p.Arg200His		B7ZW70|Q6FGX1|Q9BUX4	Missense_Mutation	SNP	superfamily_P-loop_NTPase,tigrfam_Thymidylate_kinase	p.R200H	ENST00000305784.2	37	c.599	CCDS2552.1	2	.	.	.	.	.	.	.	.	.	.	C	12.07	1.826962	0.32329	.	.	ENSG00000168393	ENST00000305784	D	0.94457	-3.43	5.47	-10.9	0.00192	.	1.717780	0.02835	N	0.127205	D	0.87051	0.6081	L	0.33485	1.01	0.09310	N	1	P;B	0.46784	0.884;0.001	B;B	0.35607	0.206;0.001	D	0.84442	0.0583	10	0.46703	T	0.11	0.6327	8.676	0.34179	0.1994:0.0823:0.0682:0.6501	.	176;200	B7ZW70;P23919	.;KTHY_HUMAN	H	200	ENSP00000304802:R200H	ENSP00000304802:R200H	R	-	2	0	DTYMK	242264255	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.732000	0.01851	-3.922000	0.00091	-0.127000	0.14921	CGC	DTYMK	-	superfamily_P-loop_NTPase	ENSG00000168393		0.607	DTYMK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DTYMK	HGNC	protein_coding	OTTHUMT00000257266.2		0.00	30	0	C	NM_012145		242615582	-1			no_errors	ENST00000305784	ensembl	human	known	74_37	missense	6.82	41	3	SNP	0.000	T
EEF1E1	9521	genome.wustl.edu	37	6	8080173	8080173	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr6:8080173G>T	ENST00000379715.5	-	4	531	c.475C>A	c.(475-477)Ctg>Atg	p.L159M	EEF1E1-BLOC1S5_ENST00000397456.2_Intron|EEF1E1_ENST00000429723.2_Intron	NM_004280.4	NP_004271.1	O43324	MCA3_HUMAN	eukaryotic translation elongation factor 1 epsilon 1	159	GST C-terminal.				gene expression (GO:0010467)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)				endometrium(1)|prostate(1)	2	Ovarian(93;0.0398)					ACACTAGACAGATGTTGCCTG	0.373																																																	0													142.0	120.0	128.0					6																	8080173		2203	4300	6503	SO:0001583	missense	0			AF054186	CCDS4507.1, CCDS47370.1	6p24.3	2009-05-20			ENSG00000124802	ENSG00000124802			3212	protein-coding gene	gene with protein product	"""aminoacyl tRNA synthetase complex-interacting multifunctional protein 3"""	609206		P18		9653160	Standard	NM_004280		Approved	AIMP3	uc003mxz.3	O43324	OTTHUMG00000014221	ENST00000379715.5:c.475C>A	6.37:g.8080173G>T	ENSP00000369038:p.Leu159Met		C9JLK5|Q5THS2	Missense_Mutation	SNP	pfam_GST_C,superfamily_Glutathione-S-Trfase_C-like	p.L159M	ENST00000379715.5	37	c.475	CCDS4507.1	6	.	.	.	.	.	.	.	.	.	.	G	19.67	3.871152	0.72065	.	.	ENSG00000124802	ENST00000379715	.	.	.	5.32	5.32	0.75619	Glutathione S-transferase, C-terminal-like (2);Glutathione S-transferase/chloride channel, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.83096	0.5180	M	0.88704	2.975	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	D	0.84899	0.0841	8	.	.	.	-6.4644	19.3933	0.94594	0.0:0.0:1.0:0.0	.	159	O43324	MCA3_HUMAN	M	159	.	.	L	-	1	2	EEF1E1	8025172	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.140000	0.64807	2.648000	0.89879	0.650000	0.86243	CTG	EEF1E1	-	superfamily_Glutathione-S-Trfase_C-like	ENSG00000124802		0.373	EEF1E1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	EEF1E1	HGNC	protein_coding	OTTHUMT00000039799.2	-	0.00	67	0	G	NM_004280		8080173	-1	tier1	-	no_errors	ENST00000379715	ensembl	human	known	74_37	missense	5.56	68	4	SNP	1.000	T
EEF2	1938	genome.wustl.edu	37	19	3980008	3980008	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr19:3980008T>C	ENST00000309311.6	-	10	1491	c.1403A>G	c.(1402-1404)aAc>aGc	p.N468S	SNORD37_ENST00000384048.1_RNA	NM_001961.3	NP_001952.1	P13639	EF2_HUMAN	eukaryotic translation elongation factor 2	468					cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|hematopoietic progenitor cell differentiation (GO:0002244)|positive regulation of gene expression (GO:0010628)|positive regulation of translation (GO:0045727)|translation (GO:0006412)|translational elongation (GO:0006414)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|translation activator activity (GO:0008494)|translation elongation factor activity (GO:0003746)			endometrium(4)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	21		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|GBM - Glioblastoma multiforme(1328;0.0223)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCCACAATGTTCCCACAAGG	0.597																																					Colon(165;1804 1908 4071 6587 18799)												0													62.0	52.0	56.0					19																	3980008		2203	4300	6503	SO:0001583	missense	0			Z11692	CCDS12117.1	19p13.3	2012-09-20			ENSG00000167658	ENSG00000167658			3214	protein-coding gene	gene with protein product	"""polypeptidyl-tRNA translocase"""	130610		EF2		2610926, 6427766	Standard	NM_001961		Approved	EEF-2	uc002lze.3	P13639		ENST00000309311.6:c.1403A>G	19.37:g.3980008T>C	ENSP00000307940:p.Asn468Ser		B2RMP5|D6W618|Q58J86	Missense_Mutation	SNP	pfam_EF_GTP-bd_dom,pfam_Transl_elong_EFG/EF2_IV,pfam_EFG_V,pfam_Transl_elong_EFTu/EF1A_2,superfamily_P-loop_NTPase,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_Transl_B-barrel,superfamily_EFG_III-V,smart_Transl_elong_EFG/EF2_IV,smart_EFG_V,prints_EF_GTP-bd_dom,tigrfam_Small_GTP-bd_dom	p.N468S	ENST00000309311.6	37	c.1403	CCDS12117.1	19	.	.	.	.	.	.	.	.	.	.	T	26.1	4.704548	0.88924	.	.	ENSG00000167658	ENST00000543343;ENST00000309311	D	0.81821	-1.54	5.45	5.45	0.79879	Translation elongation factor EFTu/EF1A, domain 2 (1);Translation elongation/initiation factor/Ribosomal, beta-barrel (1);	0.000000	0.85682	D	0.000000	D	0.91707	0.7378	M	0.92784	3.345	0.80722	D	1	D	0.69078	0.997	D	0.77004	0.989	D	0.93604	0.6933	10	0.87932	D	0	-64.2174	14.6712	0.68945	0.0:0.0:0.0:1.0	.	468	P13639	EF2_HUMAN	S	468	ENSP00000307940:N468S	ENSP00000307940:N468S	N	-	2	0	EEF2	3931008	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.994000	0.88315	2.065000	0.61736	0.459000	0.35465	AAC	EEF2	-	pfam_Transl_elong_EFTu/EF1A_2,superfamily_Transl_B-barrel	ENSG00000167658		0.597	EEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EEF2	HGNC	protein_coding	OTTHUMT00000457615.2	-	0.00	12	0	T	NM_001961		3980008	-1	tier1	-	no_errors	ENST00000309311	ensembl	human	known	74_37	missense	23.08	30	9	SNP	1.000	C
XXyac-YM21GA2.7	0	genome.wustl.edu	37	9	90474265	90474265	+	RNA	SNP	G	G	A			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr9:90474265G>A	ENST00000399186.2	-	0	49																											GTAAGTCGCCGATGGCATAGC	0.572																																																	0																																												0																															9.37:g.90474265G>A				RNA	SNP	-	NULL	ENST00000399186.2	37	NULL		9																																																																																			XXyac-YM21GA2.7	-	-	ENSG00000214888		0.572	XXyac-YM21GA2.7-001	KNOWN	basic	antisense	ENSG00000214888	Clone_based_vega_gene	antisense	OTTHUMT00000397578.1	-	0.00	68	0	G			90474265	-1	tier1	-	no_errors	ENST00000399186	ensembl	human	known	74_37	rna	24.22	97	31	SNP	0.000	A
GJC3	349149	genome.wustl.edu	37	7	99527283	99527283	+	5'Flank	SNP	C	C	T			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr7:99527283C>T	ENST00000312891.2	-	0	0				RP4-604G5.1_ENST00000456499.1_RNA	NM_181538.2	NP_853516.1	Q8NFK1	CXG3_HUMAN	gap junction protein, gamma 3, 30.2kDa						cell communication (GO:0007154)|myelination (GO:0042552)|sensory perception of sound (GO:0007605)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)|myelin sheath (GO:0043209)				breast(1)|endometrium(1)|large_intestine(3)|lung(3)|ovary(1)	9	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)					GTGTTGTTCACTGTCCTTCAG	0.537																																																	0													7.0	6.0	7.0					7																	99527283		1874	3754	5628	SO:0001631	upstream_gene_variant	0			AF503615	CCDS34697.1	7q22.1	2008-09-04	2007-11-06	2007-11-06	ENSG00000176402	ENSG00000176402		"""Ion channels / Gap junction proteins (connexins)"""	17495	protein-coding gene	gene with protein product	"""connexin 30.2"""	611925	"""gap junction protein, epsilon 1, 29kDa"""	GJE1			Standard	NM_181538		Approved	CX30.2	uc011kjd.2	Q8NFK1	OTTHUMG00000156649		7.37:g.99527283C>T	Exception_encountered		A4D296|Q86XI9	RNA	SNP	-	NULL	ENST00000312891.2	37	NULL	CCDS34697.1	7																																																																																			RP4-604G5.1	-	-	ENSG00000237640		0.537	GJC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000237640	Clone_based_vega_gene	protein_coding	OTTHUMT00000345052.1	-	0.00	35	0	C	NM_181538		99527283	+1	tier1	-	no_errors	ENST00000456499	ensembl	human	known	74_37	rna	6.25	75	5	SNP	0.419	T
SORD2P	653381	genome.wustl.edu	37	15	45123755	45123756	+	RNA	INS	-	-	C	rs11429544	byFrequency	TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr15:45123755_45123756insC	ENST00000561384.2	-	0	871_872																											GGAGGCCTCTGCCCCGTGCACT	0.574													CCCCC|CCCC|CCCCC|deletion	185	0.0369409	0.0756	0.0303	5008	,	,		16468	0.0407		0.002	False		,,,				2504	0.0215																0																																												0																															15.37:g.45123759_45123759dupC				RNA	INS	-	NULL	ENST00000561384.2	37	NULL		15																																																																																			CTD-2008A1.2	-	-	ENSG00000259479		0.574	CTD-2008A1.2-002	PUTATIVE	basic	processed_transcript	ENSG00000259479	Clone_based_vega_gene	pseudogene	OTTHUMT00000416181.2		0.00	35	0	-			45123756	-1	tier1		no_errors	ENST00000561384	ensembl	human	putative	74_37	rna	22.50	31	9	INS	0.632:0.983	C
PCSK6	5046	genome.wustl.edu	37	15	101844107	101844107	+	5'Flank	SNP	G	G	C	rs570973763		TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr15:101844107G>C	ENST00000561177.1	-	0	4407				RP11-299G20.2_ENST00000558838.1_RNA			P29122	PCSK6_HUMAN	proprotein convertase subtilisin/kexin type 6						determination of left/right symmetry (GO:0007368)|glycoprotein metabolic process (GO:0009100)|nerve growth factor processing (GO:0032455)|nerve growth factor production (GO:0032902)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|regulation of BMP signaling pathway (GO:0030510)|secretion by cell (GO:0032940)|zygotic determination of anterior/posterior axis, embryo (GO:0007354)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|heparin binding (GO:0008201)|nerve growth factor binding (GO:0048406)|serine-type endopeptidase activity (GO:0004252)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(17)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Lung NSC(78;0.00102)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000803)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			CATTTTGTGTGCCGTGGAAAG	0.378																																																	0																																										SO:0001631	upstream_gene_variant	0				CCDS73789.1, CCDS73790.1, CCDS73791.1, CCDS73792.1, CCDS73793.1	15q26	2008-07-18	2004-06-14	2004-06-16		ENSG00000140479			8569	protein-coding gene	gene with protein product	"""subtilisin-like protease"", ""subtilisin-like proprotein convertase 4"", ""subtilisin/kexin-like protease PACE4"""	167405	"""paired basic amino acid cleaving system 4"""	PACE4		1741956	Standard	NM_002570		Approved	SPC4	uc002bwy.3	P29122			15.37:g.101844107G>C	Exception_encountered		Q15099|Q15100|Q9UEG7|Q9UEJ1|Q9UEJ2|Q9UEJ7|Q9UEJ8|Q9UEJ9|Q9Y4G9|Q9Y4H0|Q9Y4H1	RNA	SNP	-	NULL	ENST00000561177.1	37	NULL		15																																																																																			RP11-299G20.2	-	-	ENSG00000259172		0.378	PCSK6-001	KNOWN	basic	processed_transcript	ENSG00000259172	Clone_based_vega_gene	protein_coding	OTTHUMT00000416811.5	-	0.00	88	0	G	NM_002570		101844107	+1	tier1	-	no_errors	ENST00000558838	ensembl	human	known	74_37	rna	14.57	129	22	SNP	0.000	C
SSTR5-AS1	146336	genome.wustl.edu	37	16	1116262	1116262	+	RNA	SNP	G	G	A	rs537743255	byFrequency	TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr16:1116262G>A	ENST00000569832.1	-	0	694				RP11-161M6.5_ENST00000564390.1_lincRNA	NR_027242.1				SSTR5 antisense RNA 1																		GGGGCTGCACGGGTGGGTCGG	0.692													G|||	6	0.00119808	0.0	0.0	5008	,	,		9122	0.0		0.0	False		,,,				2504	0.0061																0																																												0			AK056814		16p13.3	2012-10-12	2012-08-15		ENSG00000261713	ENSG00000261713		"""Long non-coding RNAs"""	26502	non-coding RNA	RNA, long non-coding			"""SSTR5 antisense RNA 1 (non-protein coding)"""				Standard	NR_027242		Approved		uc002cko.3		OTTHUMG00000172831		16.37:g.1116262G>A				RNA	SNP	-	NULL	ENST00000569832.1	37	NULL		16																																																																																			RP11-161M6.5	-	-	ENSG00000261720		0.692	SSTR5-AS1-001	KNOWN	basic	lincRNA	ENSG00000261720	Clone_based_vega_gene	processed_transcript	OTTHUMT00000420783.1	-	0.00	32	0	G	NR_02724		1116262	+1	tier1	-	no_errors	ENST00000564390	ensembl	human	known	74_37	rna	44.74	21	17	SNP	0.049	A
EPN1	29924	genome.wustl.edu	37	19	56200328	56200328	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr19:56200328G>A	ENST00000270460.6	+	4	882	c.571G>A	c.(571-573)Gcc>Acc	p.A191T	EPN1_ENST00000085079.7_Missense_Mutation_p.A191T|EPN1_ENST00000591743.1_3'UTR|EPN1_ENST00000411543.2_Missense_Mutation_p.A302T	NM_001130072.1	NP_001123544.1	Q9Y6I3	EPN1_HUMAN	epsin 1	191					embryonic organ development (GO:0048568)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|female pregnancy (GO:0007565)|in utero embryonic development (GO:0001701)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|Notch signaling pathway (GO:0007219)	coated pit (GO:0005905)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)			endometrium(5)|kidney(1)|large_intestine(2)|lung(8)|skin(1)	17		Colorectal(82;0.00244)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.112)		GCTCCAGCTGGCCCTGGCCAT	0.716																																																	0													13.0	16.0	15.0					19																	56200328		2119	4242	6361	SO:0001583	missense	0			AF073727	CCDS46198.1, CCDS46199.1, CCDS46200.1	19q13.42	2014-08-12			ENSG00000063245	ENSG00000063245			21604	protein-coding gene	gene with protein product		607262				9723620, 10557078	Standard	NM_001130072		Approved		uc002qlx.3	Q9Y6I3	OTTHUMG00000180911	ENST00000270460.6:c.571G>A	19.37:g.56200328G>A	ENSP00000270460:p.Ala191Thr		Q86ST3|Q9HA18	Missense_Mutation	SNP	pfam_Epsin_dom_N,pfam_ANTH_dom,superfamily_ENTH_VHS,smart_Epsin-like_N,smart_Ubiquitin-int_motif,pfscan_Epsin-like_N,pfscan_Ubiquitin-int_motif	p.A302T	ENST00000270460.6	37	c.904	CCDS46199.1	19	.	.	.	.	.	.	.	.	.	.	G	18.91	3.722784	0.68959	.	.	ENSG00000063245	ENST00000270460;ENST00000085079;ENST00000544375;ENST00000411543	T;T;T	0.58506	2.04;0.81;0.33	4.0	4.0	0.46444	Ubiquitin interacting motif (3);	0.000000	0.85682	D	0.000000	T	0.75488	0.3856	M	0.78456	2.415	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.998;1.0;0.996	T	0.78785	-0.2068	10	0.54805	T	0.06	-19.0362	15.3854	0.74695	0.0:0.0:1.0:0.0	.	152;302;191;191	B4DU91;Q9Y6I3-1;Q9Y6I3;Q9Y6I3-3	.;.;EPN1_HUMAN;.	T	191;191;152;302	ENSP00000270460:A191T;ENSP00000085079:A191T;ENSP00000406209:A302T	ENSP00000085079:A191T	A	+	1	0	EPN1	60892140	1.000000	0.71417	0.998000	0.56505	0.579000	0.36224	7.340000	0.79292	2.244000	0.73946	0.462000	0.41574	GCC	EPN1	-	smart_Ubiquitin-int_motif,pfscan_Ubiquitin-int_motif	ENSG00000063245		0.716	EPN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	EPN1	HGNC	protein_coding	OTTHUMT00000453610.1	-	0.00	25	0	G	NM_013333		56200328	+1	tier1	-	no_errors	ENST00000411543	ensembl	human	known	74_37	missense	31.03	20	9	SNP	1.000	A
FAM122C	159091	genome.wustl.edu	37	X	133938243	133938243	+	5'Flank	SNP	G	G	T			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chrX:133938243G>T	ENST00000370784.4	+	0	0				FAM122C_ENST00000414371.2_Nonsense_Mutation_p.G6*|FAM122C_ENST00000370785.3_5'Flank	NM_001170779.1	NP_001164250.1	Q6P4D5	F222C_HUMAN	family with sequence similarity 122C											endometrium(2)|kidney(1)|lung(2)	5	Acute lymphoblastic leukemia(192;0.000127)					ATATTTCCCTGGAACTGGAAG	0.413																																																	0													269.0	210.0	228.0					X																	133938243		692	1591	2283	SO:0001631	upstream_gene_variant	0			BC017868	CCDS14644.1, CCDS55500.1, CCDS55501.1, CCDS76028.1	Xq26.3	2008-02-05	2006-07-11		ENSG00000156500	ENSG00000156500			25202	protein-coding gene	gene with protein product						12477932	Standard	NM_138819		Approved	RP3-473B4.1	uc004exz.2	Q6P4D5	OTTHUMG00000022716		X.37:g.133938243G>T	Exception_encountered		F5H036|Q8WVK9	Nonsense_Mutation	SNP	NULL	p.G6*	ENST00000370784.4	37	c.16	CCDS55501.1	X	.	.	.	.	.	.	.	.	.	.	G	17.41	3.381735	0.61845	.	.	ENSG00000156500	ENST00000414371	.	.	.	3.86	0.00172	0.14047	.	.	.	.	.	.	.	.	.	.	.	0.20074	N	0.999935	.	.	.	.	.	.	.	.	.	.	0.25106	T	0.35	.	2.8138	0.05450	0.3706:0.0:0.425:0.2044	.	.	.	.	X	6	.	ENSP00000402477:G6X	G	+	1	0	FAM122C	133765909	0.021000	0.18746	0.014000	0.15608	0.004000	0.04260	0.550000	0.23345	-0.141000	0.11374	-0.213000	0.12676	GGA	FAM122C	-	NULL	ENSG00000156500		0.413	FAM122C-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM122C	HGNC	protein_coding		-	0.00	44	0	G	NM_138819		133938243	+1	tier1	-	no_errors	ENST00000414371	ensembl	human	known	74_37	nonsense	5.56	68	4	SNP	0.013	T
FAM129A	116496	genome.wustl.edu	37	1	184853931	184853931	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr1:184853931G>T	ENST00000367511.3	-	5	630	c.437C>A	c.(436-438)tCc>tAc	p.S146Y		NM_052966.2	NP_443198.1	Q9BZQ8	NIBAN_HUMAN	family with sequence similarity 129, member A	146					negative regulation of protein phosphorylation (GO:0001933)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of translation (GO:0045727)|response to endoplasmic reticulum stress (GO:0034976)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(1)|cervix(2)|endometrium(4)|large_intestine(6)|liver(1)|lung(22)|ovary(3)|skin(3)|upper_aerodigestive_tract(2)	45						CTTCTCACTGGAGGCTAAAGA	0.463																																																	0													78.0	78.0	78.0					1																	184853931		2203	4300	6503	SO:0001583	missense	0			AF288391	CCDS1364.1	1q25	2008-10-08	2006-11-23	2006-11-23	ENSG00000135842	ENSG00000135842			16784	protein-coding gene	gene with protein product	"""cell growth inhibiting protein 39"""		"""chromosome 1 open reading frame 24"""	C1orf24		15085203, 16444351	Standard	NM_052966		Approved	NIBAN, GIG39	uc001gra.4	Q9BZQ8	OTTHUMG00000035388	ENST00000367511.3:c.437C>A	1.37:g.184853931G>T	ENSP00000356481:p.Ser146Tyr		Q2TTR2|Q5TEM8|Q8TEI5|Q9H593|Q9H9Y8|Q9HCB9	Missense_Mutation	SNP	NULL	p.S146Y	ENST00000367511.3	37	c.437	CCDS1364.1	1	.	.	.	.	.	.	.	.	.	.	G	18.50	3.638451	0.67130	.	.	ENSG00000135842	ENST00000367511	T	0.17854	2.25	5.63	5.63	0.86233	.	0.469877	0.24287	N	0.039849	T	0.26991	0.0661	L	0.54323	1.7	0.38011	D	0.934555	D	0.59767	0.986	P	0.57152	0.814	T	0.03695	-1.1012	10	0.05436	T	0.98	-12.0507	15.1818	0.72965	0.0:0.0:1.0:0.0	.	146	Q9BZQ8	NIBAN_HUMAN	Y	146	ENSP00000356481:S146Y	ENSP00000356481:S146Y	S	-	2	0	FAM129A	183120554	1.000000	0.71417	0.246000	0.24233	0.881000	0.50899	6.538000	0.73852	2.653000	0.90120	0.650000	0.86243	TCC	FAM129A	-	NULL	ENSG00000135842		0.463	FAM129A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM129A	HGNC	protein_coding	OTTHUMT00000085786.1	-	0.00	78	0	G			184853931	-1	tier1	-	no_errors	ENST00000367511	ensembl	human	known	74_37	missense	42.47	41	31	SNP	0.685	T
FAM3D	131177	genome.wustl.edu	37	3	58635041	58635041	+	Splice_Site	SNP	C	C	T			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr3:58635041C>T	ENST00000358781.2	-	4	456		c.e4+1			NM_138805.2	NP_620160.1	Q96BQ1	FAM3D_HUMAN	family with sequence similarity 3, member D						negative regulation of insulin secretion (GO:0046676)	extracellular region (GO:0005576)	cytokine activity (GO:0005125)			large_intestine(1)|lung(2)	3				BRCA - Breast invasive adenocarcinoma(55;0.000225)|Kidney(10;0.000667)|KIRC - Kidney renal clear cell carcinoma(10;0.000802)|OV - Ovarian serous cystadenocarcinoma(275;0.169)		CAGATACTCACGGATCTCCTT	0.627																																																	0													90.0	84.0	86.0					3																	58635041		2203	4300	6503	SO:0001630	splice_region_variant	0			AF494381	CCDS2893.1	3p21.1	2008-07-18			ENSG00000198643	ENSG00000198643			18665	protein-coding gene	gene with protein product		608619				12160727	Standard	NM_138805		Approved	EF7, OIT1	uc003dkq.3	Q96BQ1	OTTHUMG00000159148	ENST00000358781.2:c.145+1G>A	3.37:g.58635041C>T			Q547G2	Splice_Site	SNP	-	e3+1	ENST00000358781.2	37	c.145+1	CCDS2893.1	3	.	.	.	.	.	.	.	.	.	.	C	10.76	1.440609	0.25900	.	.	ENSG00000198643	ENST00000358781;ENST00000483787;ENST00000489857;ENST00000498347	.	.	.	3.66	2.78	0.32641	.	.	.	.	.	.	.	.	.	.	.	0.53688	D	0.999979	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.3021	0.37851	0.0:0.7807:0.2193:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	FAM3D	58610081	0.975000	0.34042	0.564000	0.28396	0.081000	0.17604	1.691000	0.37721	1.103000	0.41568	0.491000	0.48974	.	FAM3D	-	-	ENSG00000198643		0.627	FAM3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM3D	HGNC	protein_coding	OTTHUMT00000353494.1	-	0.00	44	0	C	NM_138805	Intron	58635041	-1	tier1	-	no_errors	ENST00000358781	ensembl	human	known	74_37	splice_site	44.44	20	16	SNP	0.627	T
FAM57A	79850	genome.wustl.edu	37	17	644588	644588	+	Silent	SNP	G	G	T			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr17:644588G>T	ENST00000308278.8	+	5	788	c.552G>T	c.(550-552)acG>acT	p.T184T	FAM57A_ENST00000572018.1_3'UTR|FAM57A_ENST00000301324.8_Silent_p.T152T	NM_024792.1	NP_079068.1	Q8TBR7	FA57A_HUMAN	family with sequence similarity 57, member A	184	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				cervix(1)|endometrium(2)|large_intestine(1)|lung(2)|prostate(2)|urinary_tract(2)	10				UCEC - Uterine corpus endometrioid carcinoma (25;0.0217)		GAATCCTCACGCTGGCCACCT	0.532																																																	0													152.0	131.0	138.0					17																	644588		2203	4300	6503	SO:0001819	synonymous_variant	0			AK025935	CCDS10996.1	17p13.3	2014-08-14				ENSG00000167695			29646	protein-coding gene	gene with protein product		611627				12270127	Standard	NM_024792		Approved	FLJ22282, CT120	uc002frp.3	Q8TBR7		ENST00000308278.8:c.552G>T	17.37:g.644588G>T			A8K7Q0|Q7Z464|Q96D97|Q9H6H3	Silent	SNP	pfam_TLC-dom,smart_TLC-dom,pfscan_TLC-dom	p.T184	ENST00000308278.8	37	c.552	CCDS10996.1	17																																																																																			FAM57A	-	pfam_TLC-dom,smart_TLC-dom,pfscan_TLC-dom	ENSG00000167695		0.532	FAM57A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM57A	HGNC	protein_coding	OTTHUMT00000437155.2	-	0.00	37	0	G	NM_024792		644588	+1	tier1	-	no_errors	ENST00000308278	ensembl	human	known	74_37	silent	6.67	56	4	SNP	0.793	T
FAT3	120114	genome.wustl.edu	37	11	92533683	92533683	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr11:92533683G>T	ENST00000298047.6	+	9	7521	c.7504G>T	c.(7504-7506)Gta>Tta	p.V2502L	FAT3_ENST00000525166.1_Missense_Mutation_p.V2352L|FAT3_ENST00000409404.2_Missense_Mutation_p.V2502L			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	2502	Cadherin 23. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V2502I(2)		NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				AAGCACATACGTAGCTGAGGT	0.498										TCGA Ovarian(4;0.039)																																							2	Substitution - Missense(2)	large_intestine(2)											84.0	81.0	82.0					11																	92533683		2056	4199	6255	SO:0001583	missense	0			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.7504G>T	11.37:g.92533683G>T	ENSP00000298047:p.Val2502Leu		B5MDB0|Q96AU6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.V2502L	ENST00000298047.6	37	c.7504		11	.	.	.	.	.	.	.	.	.	.	G	8.932	0.963699	0.18583	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.52526	0.66;0.66;0.66	5.95	5.95	0.96441	.	.	.	.	.	T	0.37128	0.0992	N	0.16656	0.425	0.80722	D	1	B	0.15473	0.013	B	0.15484	0.013	T	0.07731	-1.0757	9	0.32370	T	0.25	.	20.3931	0.98965	0.0:0.0:1.0:0.0	.	2502	Q8TDW7-3	.	L	2502;2502;2352	ENSP00000298047:V2502L;ENSP00000387040:V2502L;ENSP00000432586:V2352L	ENSP00000298047:V2502L	V	+	1	0	FAT3	92173331	1.000000	0.71417	0.948000	0.38648	0.891000	0.51852	6.668000	0.74457	2.824000	0.97209	0.655000	0.94253	GTA	FAT3	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000165323		0.498	FAT3-201	KNOWN	basic	protein_coding	FAT3	HGNC	protein_coding			0.00	19	0	G	NM_001008781		92533683	+1			no_errors	ENST00000298047	ensembl	human	known	74_37	missense	10.53	17	2	SNP	1.000	T
FCRL6	343413	genome.wustl.edu	37	1	159779317	159779317	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr1:159779317G>T	ENST00000368106.3	+	5	731	c.730G>T	c.(730-732)Gat>Tat	p.D244Y	FCRL6_ENST00000339348.5_Missense_Mutation_p.D244Y|FCRL6_ENST00000321935.6_Missense_Mutation_p.D251Y|FCRL6_ENST00000392235.3_Missense_Mutation_p.D149Y	NM_001004310.2	NP_001004310.2	Q6DN72	FCRL6_HUMAN	Fc receptor-like 6	244	Ig-like C2-type 3.					external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)		p.D244N(1)		NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	24	all_hematologic(112;0.0597)					CTTCTACCTTGATGAGAAGAT	0.587																																																	1	Substitution - Missense(1)	ovary(1)											75.0	71.0	72.0					1																	159779317		2203	4300	6503	SO:0001583	missense	0			AK131201	CCDS30912.1, CCDS60312.1	1q23.2	2013-01-11			ENSG00000181036	ENSG00000181036		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	31910	protein-coding gene	gene with protein product		613562					Standard	NM_001004310		Approved	IFGP6, FLJ16056, FcRH6	uc001fud.4	Q6DN72	OTTHUMG00000035351	ENST00000368106.3:c.730G>T	1.37:g.159779317G>T	ENSP00000357086:p.Asp244Tyr		A1KXW6|A2A4D6|Q6DN73|Q6XRC3|Q6ZNI1	Missense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.D244Y	ENST00000368106.3	37	c.730	CCDS30912.1	1	.	.	.	.	.	.	.	.	.	.	g	12.92	2.082392	0.36758	.	.	ENSG00000181036	ENST00000321935;ENST00000339348;ENST00000392235;ENST00000368106	T;T;T;T	0.19105	2.17;2.17;2.17;2.17	3.91	-6.2	0.02072	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.142910	0.06898	N	0.805548	T	0.26629	0.0651	M	0.86343	2.81	0.09310	N	1	P;D;D;D	0.69078	0.824;0.997;0.992;0.994	P;D;D;P	0.66847	0.789;0.947;0.924;0.875	T	0.30179	-0.9987	9	.	.	.	.	6.3187	0.21204	0.6714:0.0:0.1878:0.1408	.	244;149;244;251	Q6DN72-3;Q6DN72-4;Q6DN72;Q6DN72-2	.;.;FCRL6_HUMAN;.	Y	251;244;149;244	ENSP00000320625:D251Y;ENSP00000340949:D244Y;ENSP00000376068:D149Y;ENSP00000357086:D244Y	.	D	+	1	0	FCRL6	158045941	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.737000	0.04877	-1.251000	0.02494	-0.958000	0.02645	GAT	FCRL6	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000181036		0.587	FCRL6-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FCRL6	HGNC	protein_coding	OTTHUMT00000276853.1		0.00	34	0	G	NM_001004310		159779317	+1			no_errors	ENST00000368106	ensembl	human	known	74_37	missense	6.25	30	2	SNP	0.000	T
FGF5	2250	genome.wustl.edu	37	4	81188197	81188197	+	Silent	SNP	C	C	T			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr4:81188197C>T	ENST00000312465.7	+	1	445	c.219C>T	c.(217-219)ggC>ggT	p.G73G	FGF5_ENST00000456523.3_Silent_p.G73G	NM_004464.3	NP_004455.2	P12034	FGF5_HUMAN	fibroblast growth factor 5	73					cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell differentiation (GO:0010001)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|signal transduction involved in regulation of gene expression (GO:0023019)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	fibroblast growth factor receptor binding (GO:0005104)			breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	22						AAGGAAGTGGCTTGGAGCAGA	0.622																																																	0													61.0	67.0	65.0					4																	81188197		2203	4300	6503	SO:0001819	synonymous_variant	0			M23534	CCDS3586.1, CCDS34021.1	4q21	2014-01-30			ENSG00000138675	ENSG00000138675		"""Endogenous ligands"""	3683	protein-coding gene	gene with protein product		165190				3211147, 2577873	Standard	NM_001291812		Approved		uc003hmd.3	P12034	OTTHUMG00000130288	ENST00000312465.7:c.219C>T	4.37:g.81188197C>T			B2R554|O75846|Q3Y8M3|Q8NF90	Silent	SNP	pfam_Fibroblast_GF_fam,superfamily_Cytokine_IL1-like,smart_Fibroblast_GF_fam,prints_Fibroblast_GF_fam,prints_IL-1_fam/FGF_fam	p.G73	ENST00000312465.7	37	c.219	CCDS34021.1	4																																																																																			FGF5	-	NULL	ENSG00000138675		0.622	FGF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGF5	HGNC	protein_coding	OTTHUMT00000252627.2	-	0.00	78	0	C			81188197	+1	tier1	-	no_errors	ENST00000312465	ensembl	human	known	74_37	silent	28.05	59	23	SNP	1.000	T
FLYWCH2	114984	genome.wustl.edu	37	16	2949270	2949270	+	3'UTR	DEL	T	T	-	rs76446842		TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr16:2949270delT	ENST00000396958.3	+	0	923				FLYWCH2_ENST00000293981.6_3'UTR|FLYWCH2_ENST00000572786.1_3'UTR	NM_001142500.1|NM_138439.2	NP_001135972.1|NP_612448.1	Q96CP2	FWCH2_HUMAN	FLYWCH family member 2								poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|lung(3)|ovary(1)|skin(1)	6						Atttcttttcttttttttttt	0.393																																																	0																																										SO:0001624	3_prime_UTR_variant	0			BC014089	CCDS10482.1	16p13.3	2014-02-12	2007-06-21		ENSG00000162076	ENSG00000162076			25178	protein-coding gene	gene with protein product						12477932	Standard	NM_138439		Approved		uc010uwk.2	Q96CP2	OTTHUMG00000128962	ENST00000396958.3:c.*120T>-	16.37:g.2949270delT				RNA	DEL	-	NULL	ENST00000396958.3	37	NULL	CCDS10482.1	16																																																																																			FLYWCH2	-	-	ENSG00000162076		0.393	FLYWCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLYWCH2	HGNC	protein_coding	OTTHUMT00000250944.1		0.00	24	0	T	NM_138439		2949270	+1	tier1		no_errors	ENST00000572786	ensembl	human	putative	74_37	rna	14.29	30	5	DEL	0.000	-
FREM2	341640	genome.wustl.edu	37	13	39263873	39263873	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr13:39263873C>G	ENST00000280481.7	+	1	2608	c.2392C>G	c.(2392-2394)Cga>Gga	p.R798G		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	798					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		CGTGGCTACTCGAGTGGCCCA	0.547																																																	0													62.0	65.0	64.0					13																	39263873		2203	4300	6503	SO:0001583	missense	0			BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.2392C>G	13.37:g.39263873C>G	ENSP00000280481:p.Arg798Gly		Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	pfam_Calx_beta,superfamily_Cadherin-like,smart_Calx_beta	p.R798G	ENST00000280481.7	37	c.2392	CCDS31960.1	13	.	.	.	.	.	.	.	.	.	.	C	14.69	2.609570	0.46527	.	.	ENSG00000150893	ENST00000280481	T	0.36699	1.24	5.8	4.95	0.65309	.	0.139416	0.47455	D	0.000228	T	0.50939	0.1645	M	0.72353	2.195	0.35019	D	0.757605	D	0.58620	0.983	P	0.53760	0.734	T	0.66436	-0.5924	10	0.49607	T	0.09	.	14.528	0.67902	0.2665:0.7335:0.0:0.0	.	798	Q5SZK8	FREM2_HUMAN	G	798	ENSP00000280481:R798G	ENSP00000280481:R798G	R	+	1	2	FREM2	38161873	0.331000	0.24713	0.997000	0.53966	0.923000	0.55619	0.973000	0.29422	1.423000	0.47198	0.655000	0.94253	CGA	FREM2	-	NULL	ENSG00000150893		0.547	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FREM2	HGNC	protein_coding	OTTHUMT00000044599.2	-	0.00	55	0	C	NM_207361		39263873	+1	tier1	-	no_errors	ENST00000280481	ensembl	human	known	74_37	missense	30.91	38	17	SNP	0.945	G
GALP	85569	genome.wustl.edu	37	19	56694564	56694564	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr19:56694564C>T	ENST00000357330.2	+	5	360	c.278C>T	c.(277-279)gCc>gTc	p.A93V	GALP_ENST00000440823.1_3'UTR	NM_033106.3	NP_149097.1	Q9UBC7	GALP_HUMAN	galanin-like peptide	93					behavioral response to starvation (GO:0042595)|defense response to bacterium (GO:0042742)|neuropeptide signaling pathway (GO:0007218)|regulation of appetite (GO:0032098)|response to insulin (GO:0032868)	extracellular region (GO:0005576)				lung(4)	4		Colorectal(82;0.000147)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0507)		GAGACGTTTGCCAAACCAGAG	0.512																																																	0													102.0	95.0	97.0					19																	56694564		2203	4300	6503	SO:0001583	missense	0			AF188493	CCDS12940.1, CCDS46202.1	19q13.42	2013-02-26	2007-08-24			ENSG00000197487		"""Endogenous ligands"""	24840	protein-coding gene	gene with protein product		611178				10601261	Standard	NM_033106		Approved		uc002qmo.1	Q9UBC7		ENST00000357330.2:c.278C>T	19.37:g.56694564C>T	ENSP00000349884:p.Ala93Val		A1KXL3	Missense_Mutation	SNP	pfam_Galanin	p.A93V	ENST00000357330.2	37	c.278	CCDS12940.1	19	.	.	.	.	.	.	.	.	.	.	C	9.527	1.109776	0.20714	.	.	ENSG00000197487	ENST00000357330	T	0.42131	0.98	2.07	1.02	0.19986	.	.	.	.	.	T	0.16938	0.0407	N	0.12746	0.255	0.09310	N	0.999998	B	0.27997	0.197	B	0.15870	0.014	T	0.20974	-1.0259	9	0.09843	T	0.71	-1.7366	3.8119	0.08801	0.0:0.7662:0.0:0.2338	.	93	Q9UBC7	GALP_HUMAN	V	93	ENSP00000349884:A93V	ENSP00000349884:A93V	A	+	2	0	GALP	61386376	0.000000	0.05858	0.007000	0.13788	0.026000	0.11368	0.293000	0.19029	0.406000	0.25560	0.591000	0.81541	GCC	GALP	-	NULL	ENSG00000197487		0.512	GALP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GALP	HGNC	protein_coding	OTTHUMT00000457832.1	-	0.00	71	0	C	NM_033106		56694564	+1	tier1	-	no_errors	ENST00000357330	ensembl	human	known	74_37	missense	5.56	68	4	SNP	0.021	T
GNAS	2778	genome.wustl.edu	37	20	57484444	57484444	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr20:57484444G>C	ENST00000371085.3	+	8	1049	c.625G>C	c.(625-627)Gag>Cag	p.E209Q	GNAS_ENST00000306090.10_Missense_Mutation_p.E195Q|GNAS_ENST00000464624.2_3'UTR|GNAS_ENST00000371102.4_Missense_Mutation_p.E838Q|GNAS_ENST00000371075.3_3'UTR|GNAS_ENST00000371100.4_Missense_Mutation_p.E852Q|GNAS_ENST00000313949.7_3'UTR|GNAS_ENST00000265620.7_Missense_Mutation_p.E194Q|GNAS_ENST00000354359.7_Missense_Mutation_p.E210Q|GNAS_ENST00000371095.3_Missense_Mutation_p.E195Q	NM_000516.4	NP_000507.1	P63092	GNAS2_HUMAN	GNAS complex locus	209					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|bone development (GO:0060348)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|cognition (GO:0050890)|developmental growth (GO:0048589)|energy reserve metabolic process (GO:0006112)|hair follicle placode formation (GO:0060789)|intracellular transport (GO:0046907)|platelet aggregation (GO:0070527)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of insulin secretion (GO:0050796)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intrinsic component of membrane (GO:0031224)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	adenylate cyclase activity (GO:0004016)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			adrenal_gland(12)|autonomic_ganglia(1)|biliary_tract(5)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(37)|liver(9)|lung(9)|ovary(16)|pancreas(56)|parathyroid(5)|pituitary(228)|prostate(2)|small_intestine(1)|stomach(1)|testis(2)|thyroid(35)|upper_aerodigestive_tract(3)|urinary_tract(1)	441	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			TGGAATCTTTGAGACCAAGTT	0.443			Mis		pituitary adenoma		"""McCune-Albright syndrome; pseudohypoparathyroidism, type IA"""			TSP Lung(22;0.16)																											Colon(117;935 1597 6045 8307 46442)			Dom	yes		20	20q13.2	2778	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	yes	E	0													82.0	80.0	81.0					20																	57484444		2203	4300	6503	SO:0001583	missense	0			M21142	CCDS13471.1, CCDS13472.1, CCDS42892.1, CCDS46622.1, CCDS46623.1, CCDS46624.1	20q13.2-q13.3	2010-03-01	2001-12-19	2001-12-20	ENSG00000087460	ENSG00000087460			4392	protein-coding gene	gene with protein product	"""secretogranin VI"""	139320	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	GNAS1			Standard	NM_000516		Approved	NESP55, NESP, GNASXL, GPSA, SCG6	uc002xzw.3	O95467	OTTHUMG00000033069	ENST00000371085.3:c.625G>C	20.37:g.57484444G>C	ENSP00000360126:p.Glu209Gln		A6NI00|E1P5G5|P04895|Q12927|Q14433|Q32P26|Q5JWD2|Q5JWD4|Q5JWD5|Q6NR75|Q6NXS0|Q8TBC0|Q96H70	Missense_Mutation	SNP	pfam_Gprotein_alpha_su,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,superfamily_GproteinA_insert,smart_Gprotein_alpha_su,prints_Gprotein_alpha_S,prints_Gprotein_alpha_su	p.E210Q	ENST00000371085.3	37	c.628	CCDS13472.1	20	.	.	.	.	.	.	.	.	.	.	G	27.8	4.862944	0.91511	.	.	ENSG00000087460	ENST00000371100;ENST00000371102;ENST00000371095;ENST00000371085;ENST00000354359;ENST00000265620;ENST00000306090	D;D;D;D;D;D;D	0.91843	-2.92;-2.92;-2.92;-2.92;-2.92;-2.92;-2.92	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	D	0.96664	0.8911	M	0.87900	2.915	0.80722	D	1	P;D;D;D	0.89917	0.8;0.98;0.975;1.0	P;P;P;D	0.79784	0.646;0.826;0.599;0.993	D	0.97050	0.9763	10	0.72032	D	0.01	.	19.1809	0.93623	0.0:0.0:1.0:0.0	.	209;210;194;852	P63092;A6NI00;P63092-3;Q5JWF2	GNAS2_HUMAN;.;.;GNAS1_HUMAN	Q	852;838;195;209;210;194;195	ENSP00000360141:E852Q;ENSP00000360143:E838Q;ENSP00000360136:E195Q;ENSP00000360126:E209Q;ENSP00000346328:E210Q;ENSP00000265620:E194Q;ENSP00000304472:E195Q	ENSP00000265620:E194Q	E	+	1	0	GNAS	56917839	1.000000	0.71417	1.000000	0.80357	0.822000	0.46500	9.291000	0.96070	2.532000	0.85374	0.467000	0.42956	GAG	GNAS	-	pfam_Gprotein_alpha_su,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,smart_Gprotein_alpha_su,prints_Gprotein_alpha_su	ENSG00000087460		0.443	GNAS-015	KNOWN	basic|CCDS	protein_coding	GNAS	HGNC	protein_coding	OTTHUMT00000080431.2	-	0.00	88	0	G	NM_000516		57484444	+1	tier1	-	no_errors	ENST00000354359	ensembl	human	known	74_37	missense	26.32	84	30	SNP	1.000	C
GON4L	54856	genome.wustl.edu	37	1	155740961	155740961	+	Missense_Mutation	SNP	T	T	A			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr1:155740961T>A	ENST00000368331.1	-	19	2591	c.2543A>T	c.(2542-2544)aAt>aTt	p.N848I	GON4L_ENST00000271883.5_Missense_Mutation_p.N848I|GON4L_ENST00000471341.1_5'UTR|GON4L_ENST00000437809.1_Missense_Mutation_p.N848I|GON4L_ENST00000361040.5_Missense_Mutation_p.N848I	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)	848					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					GATTAGAGGATTAGGAAACTC	0.408																																																	0													208.0	176.0	187.0					1																	155740961		2203	4300	6503	SO:0001583	missense	0			AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106	ENST00000368331.1:c.2543A>T	1.37:g.155740961T>A	ENSP00000357315:p.Asn848Ile		B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	Missense_Mutation	SNP	pfam_PAH,superfamily_PAH,superfamily_Homeodomain-like,pfscan_Myb-like_dom	p.N848I	ENST00000368331.1	37	c.2543		1	.	.	.	.	.	.	.	.	.	.	T	19.88	3.908813	0.72868	.	.	ENSG00000116580	ENST00000437809;ENST00000368331;ENST00000271883;ENST00000539959;ENST00000361040	T;T;T;T	0.12672	2.85;2.85;2.85;2.66	4.18	4.18	0.49190	.	0.303410	0.28104	N	0.016594	T	0.03651	0.0104	N	0.12182	0.205	0.29153	N	0.878243	P;P;P;P	0.44309	0.709;0.832;0.586;0.709	B;B;B;B	0.43754	0.43;0.248;0.126;0.249	T	0.37220	-0.9715	10	0.24483	T	0.36	.	13.0419	0.58904	0.0:0.0:0.0:1.0	.	848;44;848;848	Q3T8J9-2;Q1ED43;Q3T8J9;Q3T8J9-3	.;.;GON4L_HUMAN;.	I	848	ENSP00000396117:N848I;ENSP00000357315:N848I;ENSP00000271883:N848I;ENSP00000354322:N848I	ENSP00000271883:N848I	N	-	2	0	GON4L	154007585	1.000000	0.71417	0.987000	0.45799	0.982000	0.71751	6.848000	0.75409	1.745000	0.51790	0.482000	0.46254	AAT	GON4L	-	NULL	ENSG00000116580		0.408	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	GON4L	HGNC	protein_coding		-	0.00	103	0	T	NM_032292		155740961	-1	tier1	-	no_errors	ENST00000368331	ensembl	human	known	74_37	missense	35.91	116	65	SNP	0.996	A
HERC1	8925	genome.wustl.edu	37	15	64026961	64026961	+	Nonsense_Mutation	SNP	G	G	A			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr15:64026961G>A	ENST00000443617.2	-	13	2695	c.2608C>T	c.(2608-2610)Caa>Taa	p.Q870*		NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	870					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						TCAGGTCCTTGAGGTAAAAGA	0.398																																																	0													90.0	82.0	84.0					15																	64026961		1879	4117	5996	SO:0001587	stop_gained	0			U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.2608C>T	15.37:g.64026961G>A	ENSP00000390158:p.Gln870*		Q8IW65	Nonsense_Mutation	SNP	pfam_Reg_chr_condens,pfam_HECT,pfam_WD40_repeat,pfam_SPRY_rcpt,superfamily_RCC1/BLIP-II,superfamily_HECT,superfamily_WD40_repeat_dom,superfamily_ConA-like_lec_gl_sf,superfamily_UBA-like,superfamily_ARM-type_fold,smart_SPla/RYanodine_receptor_subgr,smart_WD40_repeat,smart_HECT,pfscan_B30.2/SPRY,pfscan_HECT,pfscan_Reg_chr_condens,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Reg_chr_condens	p.Q870*	ENST00000443617.2	37	c.2608	CCDS45277.1	15	.	.	.	.	.	.	.	.	.	.	G	40	8.275466	0.98737	.	.	ENSG00000103657	ENST00000443617	.	.	.	5.73	5.73	0.89815	.	0.000000	0.64402	U	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.36615	T	0.2	.	19.8961	0.96958	0.0:0.0:1.0:0.0	.	.	.	.	X	870	.	ENSP00000390158:Q870X	Q	-	1	0	HERC1	61814014	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.869000	0.99810	2.699000	0.92147	0.655000	0.94253	CAA	HERC1	-	NULL	ENSG00000103657		0.398	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC1	HGNC	protein_coding	OTTHUMT00000418523.1	-	0.00	68	0	G	NM_003922		64026961	-1	tier1	-	no_errors	ENST00000443617	ensembl	human	known	74_37	nonsense	18.80	95	22	SNP	1.000	A
HERC3	8916	genome.wustl.edu	37	4	89571101	89571101	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr4:89571101G>A	ENST00000402738.1	+	4	576	c.337G>A	c.(337-339)Gat>Aat	p.D113N	HERC3_ENST00000264345.3_Missense_Mutation_p.D113N|HERC3_ENST00000407637.1_Missense_Mutation_p.D113N	NM_001271602.1|NM_014606.1	NP_001258531.1|NP_055421.1	Q15034	HERC3_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 3	113					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(14)|prostate(2)|skin(2)	45				OV - Ovarian serous cystadenocarcinoma(123;0.000319)		TGCAGGGAGTGATGGTCAGCT	0.507																																																	0													166.0	160.0	162.0					4																	89571101		2203	4300	6503	SO:0001583	missense	0			D25215	CCDS34028.1	4q21	2012-02-23	2012-02-23		ENSG00000138641	ENSG00000138641			4876	protein-coding gene	gene with protein product		605200	"""hect domain and RLD 3"""			10702688	Standard	NM_014606		Approved	KIAA0032	uc003hrw.2	Q15034	OTTHUMG00000150436	ENST00000402738.1:c.337G>A	4.37:g.89571101G>A	ENSP00000385684:p.Asp113Asn		A8K1S5|Q8IXX3	Missense_Mutation	SNP	pfam_Reg_chr_condens,pfam_HECT,superfamily_HECT,superfamily_RCC1/BLIP-II,smart_HECT,pfscan_HECT,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.D113N	ENST00000402738.1	37	c.337	CCDS34028.1	4	.	.	.	.	.	.	.	.	.	.	G	16.64	3.180421	0.57800	.	.	ENSG00000138641	ENST00000402738;ENST00000431413;ENST00000407637;ENST00000426683;ENST00000452979;ENST00000264345	D;D;D;D;D;D	0.84730	-1.89;-1.89;-1.89;-1.89;-1.89;-1.89	5.32	5.32	0.75619	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.154341	0.56097	D	0.000022	T	0.80243	0.4587	N	0.11651	0.15	0.80722	D	1	B;D	0.53312	0.203;0.959	B;P	0.50860	0.117;0.652	T	0.79337	-0.1845	9	.	.	.	.	19.1954	0.93686	0.0:0.0:1.0:0.0	.	113;113	Q15034;Q8IXX3	HERC3_HUMAN;.	N	113	ENSP00000385684:D113N;ENSP00000405863:D113N;ENSP00000384005:D113N;ENSP00000389991:D113N;ENSP00000406210:D113N;ENSP00000264345:D113N	.	D	+	1	0	HERC3	89790124	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.133000	0.71682	2.772000	0.95346	0.650000	0.86243	GAT	HERC3	-	pfam_Reg_chr_condens,superfamily_RCC1/BLIP-II,pfscan_Reg_chr_condens,prints_Reg_chr_condens	ENSG00000138641		0.507	HERC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC3	HGNC	protein_coding	OTTHUMT00000318081.2	-	0.00	52	0	G	NM_014606		89571101	+1	tier1	-	no_errors	ENST00000264345	ensembl	human	known	74_37	missense	37.18	49	29	SNP	1.000	A
HGS	9146	genome.wustl.edu	37	17	79660958	79660958	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr17:79660958C>T	ENST00000329138.4	+	11	1034	c.899C>T	c.(898-900)tCa>tTa	p.S300L		NM_004712.4	NP_004703.1	O14964	HGS_HUMAN	hepatocyte growth factor-regulated tyrosine kinase substrate	300	Interaction with SNX1. {ECO:0000250}.				endosomal transport (GO:0016197)|endosome to lysosome transport (GO:0008333)|epidermal growth factor receptor signaling pathway (GO:0007173)|membrane invagination (GO:0010324)|membrane organization (GO:0061024)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of JAK-STAT cascade (GO:0046426)|positive regulation of gene expression (GO:0010628)|protein localization to membrane (GO:0072657)|protein targeting to lysosome (GO:0006622)|regulation of protein catabolic process (GO:0042176)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|secretory granule (GO:0030141)	metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			endometrium(2)|kidney(3)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	12	all_neural(118;0.0878)|all_lung(278;0.23)		BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0955)			TCGGCCTCCTCAGCGCCCCCC	0.647																																																	0													32.0	36.0	35.0					17																	79660958		2203	4300	6503	SO:0001583	missense	0			D84064	CCDS11784.1	17q25	2009-04-29				ENSG00000185359		"""Zinc fingers, FYVE domain containing"""	4897	protein-coding gene	gene with protein product		604375				9407053, 9630564	Standard	NM_004712		Approved	Hrs, ZFYVE8, Vps27	uc002kbg.3	O14964		ENST00000329138.4:c.899C>T	17.37:g.79660958C>T	ENSP00000331201:p.Ser300Leu		Q9NR36	Missense_Mutation	SNP	pfam_VHS,pfam_HRS_helical,pfam_Znf_FYVE,superfamily_ENTH_VHS,superfamily_Znf_FYVE_PHD,smart_VHS_subgr,smart_Znf_FYVE,pirsf_Ubi-bd_Hrs_VPS27,pfscan_Ubiquitin-int_motif,pfscan_VHS,pfscan_Znf_FYVE-rel	p.S300L	ENST00000329138.4	37	c.899	CCDS11784.1	17	.	.	.	.	.	.	.	.	.	.	C	15.52	2.857061	0.51376	.	.	ENSG00000185359	ENST00000329138;ENST00000442335	T	0.45668	0.89	4.76	4.76	0.60689	.	0.000000	0.85682	D	0.000000	T	0.56046	0.1959	M	0.72118	2.19	0.80722	D	1	P	0.51933	0.949	P	0.53360	0.724	T	0.58278	-0.7664	10	0.40728	T	0.16	-14.8196	16.7706	0.85536	0.0:1.0:0.0:0.0	.	300	O14964	HGS_HUMAN	L	300	ENSP00000331201:S300L	ENSP00000331201:S300L	S	+	2	0	HGS	77271363	1.000000	0.71417	0.089000	0.20774	0.003000	0.03518	7.165000	0.77544	2.186000	0.69663	0.655000	0.94253	TCA	HGS	-	pirsf_Ubi-bd_Hrs_VPS27	ENSG00000185359		0.647	HGS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HGS	HGNC	protein_coding	OTTHUMT00000440541.1	-	0.00	31	0	C	NM_004712		79660958	+1	tier1	-	no_errors	ENST00000329138	ensembl	human	known	74_37	missense	24.39	31	10	SNP	0.992	T
HS6ST3	266722	genome.wustl.edu	37	13	97485218	97485218	+	Silent	SNP	C	C	T			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr13:97485218C>T	ENST00000376705.2	+	2	1206	c.1182C>T	c.(1180-1182)cgC>cgT	p.R394R		NM_153456.3	NP_703157.2	Q8IZP7	H6ST3_HUMAN	heparan sulfate 6-O-sulfotransferase 3	394					heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)	integral component of membrane (GO:0016021)	heparan sulfate 6-O-sulfotransferase activity (GO:0017095)			NS(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|pancreas(1)|skin(1)	20	all_neural(89;0.0878)|Medulloblastoma(90;0.163)					AGGGTGCCCGCCAACGCATTG	0.502																																																	0													94.0	87.0	89.0					13																	97485218		2203	4300	6503	SO:0001819	synonymous_variant	0			AF539426	CCDS9481.1	13q32.2	2007-12-04			ENSG00000185352	ENSG00000185352		"""Sulfotransferases, membrane-bound"""	19134	protein-coding gene	gene with protein product		609401					Standard	NM_153456		Approved		uc001vmw.4	Q8IZP7	OTTHUMG00000017232	ENST00000376705.2:c.1182C>T	13.37:g.97485218C>T			Q5W0L0|Q68CW6	Silent	SNP	pfam_Sulfotransferase,superfamily_P-loop_NTPase	p.R394	ENST00000376705.2	37	c.1182	CCDS9481.1	13																																																																																			HS6ST3	-	pfam_Sulfotransferase	ENSG00000185352		0.502	HS6ST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HS6ST3	HGNC	protein_coding	OTTHUMT00000045517.2	-	0.00	33	0	C	NM_153456		97485218	+1	tier1	-	no_errors	ENST00000376705	ensembl	human	known	74_37	silent	31.58	26	12	SNP	0.953	T
IER5	51278	genome.wustl.edu	37	1	181058181	181058181	+	Missense_Mutation	SNP	T	T	A			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr1:181058181T>A	ENST00000367577.4	+	1	544	c.143T>A	c.(142-144)cTg>cAg	p.L48Q	RP11-309G3.3_ENST00000606938.1_lincRNA	NM_016545.4	NP_057629.2	Q5VY09	IER5_HUMAN	immediate early response 5	48										lung(1)|ovary(1)|pancreas(1)|urinary_tract(1)	4						CAAGTCTACCTGAGCGACCCG	0.736																																																	0													13.0	13.0	13.0					1																	181058181		2188	4264	6452	SO:0001583	missense	0			BC000128	CCDS1343.1	1q25.3	2008-02-05			ENSG00000162783	ENSG00000162783			5393	protein-coding gene	gene with protein product		607177				10049588, 11102586	Standard	NM_016545		Approved		uc001got.4	Q5VY09	OTTHUMG00000035178	ENST00000367577.4:c.143T>A	1.37:g.181058181T>A	ENSP00000356549:p.Leu48Gln		B2RBV3|Q8WY68|Q9NY49|Q9NZP9	Missense_Mutation	SNP	pfam_IER	p.L48Q	ENST00000367577.4	37	c.143	CCDS1343.1	1	.	.	.	.	.	.	.	.	.	.	T	21.9	4.212466	0.79240	.	.	ENSG00000162783	ENST00000367577;ENST00000545568	T	0.22336	1.96	4.09	4.09	0.47781	.	0.000000	0.44483	U	0.000455	T	0.42539	0.1207	M	0.64404	1.975	0.53005	D	0.999968	D	0.89917	1.0	D	0.91635	0.999	T	0.40021	-0.9585	10	0.87932	D	0	-10.3957	13.0198	0.58779	0.0:0.0:0.0:1.0	.	48	Q5VY09	IER5_HUMAN	Q	48	ENSP00000356549:L48Q	ENSP00000356549:L48Q	L	+	2	0	IER5	179324804	1.000000	0.71417	1.000000	0.80357	0.885000	0.51271	5.079000	0.64431	1.612000	0.50221	0.260000	0.18958	CTG	IER5	-	pfam_IER	ENSG00000162783		0.736	IER5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IER5	HGNC	protein_coding	OTTHUMT00000085142.1	-	0.00	24	0	T	NM_016545		181058181	+1	tier1	-	no_errors	ENST00000367577	ensembl	human	known	74_37	missense	44.64	31	25	SNP	1.000	A
IFNGR2	3460	genome.wustl.edu	37	21	34787211	34787211	+	Silent	SNP	G	G	T	rs546201964	byFrequency	TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr21:34787211G>T	ENST00000290219.6	+	2	738	c.90G>T	c.(88-90)ctG>ctT	p.L30L	IFNGR2_ENST00000381995.1_Silent_p.L49L|IFNGR2_ENST00000405436.1_5'UTR	NM_005534.3	NP_005525.2	P38484	INGR2_HUMAN	interferon gamma receptor 2 (interferon gamma transducer 1)	30					cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|response to virus (GO:0009615)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	interferon-gamma receptor activity (GO:0004906)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|urinary_tract(1)	13					Interferon gamma-1b(DB00033)	TTTCCCAGCTGCCCGCTCCTC	0.527																																																	0													50.0	50.0	50.0					21																	34787211		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS33544.1	21q22.1	2014-09-17			ENSG00000159128	ENSG00000159128		"""Interferons"", ""Fibronectin type III domain containing"""	5440	protein-coding gene	gene with protein product		147569		IFNGT1		3136170	Standard	NM_005534		Approved	AF-1	uc002yrp.4	P38484	OTTHUMG00000065188	ENST00000290219.6:c.90G>T	21.37:g.34787211G>T			Q9BTL5	Silent	SNP	pfam_Interferon_alpha/beta_rcpt_bsu,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	p.L30	ENST00000290219.6	37	c.90	CCDS33544.1	21																																																																																			IFNGR2	-	superfamily_Fibronectin_type3	ENSG00000159128		0.527	IFNGR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFNGR2	HGNC	protein_coding	OTTHUMT00000139916.1	-	0.00	40	0	G			34787211	+1	tier1	-	no_errors	ENST00000290219	ensembl	human	known	74_37	silent	51.85	13	14	SNP	0.994	T
IKBKE	9641	genome.wustl.edu	37	1	206648350	206648350	+	Intron	SNP	C	C	T			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr1:206648350C>T	ENST00000367120.3	+	5	731				IKBKE_ENST00000537984.1_Intron|IKBKE_ENST00000463979.1_3'UTR	NM_001193322.1|NM_014002.3	NP_001180251.1|NP_054721.1	Q14164	IKKE_HUMAN	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase epsilon						immune response (GO:0006955)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of type I interferon production (GO:0032480)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein phosphorylation (GO:0006468)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|IkappaB kinase activity (GO:0008384)|NF-kappaB-inducing kinase activity (GO:0004704)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(13)|ovary(3)|skin(2)	32	Breast(84;0.137)					GAGCCCCTCCCTGTCCCTGCC	0.587																																																	0													141.0	101.0	114.0					1																	206648350		2203	4300	6503	SO:0001627	intron_variant	0			AB016590	CCDS30996.1, CCDS53464.1, CCDS73019.1	1q31	2014-05-06			ENSG00000143466				14552	protein-coding gene	gene with protein product		605048				10421793, 10882136	Standard	NM_001193321		Approved	IKKE, IKK-i, KIAA0151	uc001hdz.2	Q14164	OTTHUMG00000184613	ENST00000367120.3:c.358+13C>T	1.37:g.206648350C>T			D3DT78|Q3B754|Q3KR43|Q5JTS6	RNA	SNP	-	NULL	ENST00000367120.3	37	NULL	CCDS30996.1	1																																																																																			IKBKE	-	-	ENSG00000143466		0.587	IKBKE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IKBKE	HGNC	protein_coding	OTTHUMT00000088484.1	-	0.00	22	0	C			206648350	+1	tier1	-	no_errors	ENST00000463979	ensembl	human	known	74_37	rna	26.47	25	9	SNP	0.000	T
IL17RA	23765	genome.wustl.edu	37	22	17586491	17586491	+	Splice_Site	SNP	G	G	A	rs41321447	byFrequency	TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr22:17586491G>A	ENST00000319363.6	+	10	1075	c.942G>A	c.(940-942)ccG>ccA	p.P314P		NM_014339.5	NP_055154.3	Q96F46	I17RA_HUMAN	interleukin 17 receptor A	314					cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|fibroblast activation (GO:0072537)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)|positive regulation of interleukin-23 production (GO:0032747)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	interleukin-17 receptor activity (GO:0030368)			endometrium(2)|large_intestine(8)|lung(16)|ovary(1)|skin(2)|stomach(1)	30		all_epithelial(15;0.0181)|Lung NSC(13;0.109)|all_lung(157;0.132)		Colorectal(9;0.241)		AACCAATTCCGGGTAAGCTTG	0.522													G|||	10	0.00199681	0.0068	0.0014	5008	,	,		20025	0.0		0.0	False		,,,				2504	0.0																0								G		39,4367	45.3+/-79.5	0,39,2164	200.0	198.0	199.0		942	-0.9	0.1	22	dbSNP_127	199	0,8600		0,0,4300	yes	coding-synonymous-near-splice	IL17RA	NM_014339.5		0,39,6464	AA,AG,GG		0.0,0.8852,0.2999		314/867	17586491	39,12967	2203	4300	6503	SO:0001630	splice_region_variant	0			U58917	CCDS13739.1	22q11.1	2014-09-17	2006-04-26	2006-04-26	ENSG00000177663	ENSG00000177663		"""Interleukins and interleukin receptors"", ""CD molecules"""	5985	protein-coding gene	gene with protein product		605461	"""interleukin 17 receptor"""	IL17R		9367539, 10591208	Standard	NM_014339		Approved	hIL-17R, IL-17RA, CDw217, CD217	uc002zly.4	Q96F46	OTTHUMG00000150026	ENST00000319363.6:c.943+1G>A	22.37:g.17586491G>A			O43844|Q20WK1	Silent	SNP	pfam_SEFIR	p.P314	ENST00000319363.6	37	c.942	CCDS13739.1	22																																																																																			IL17RA	-	NULL	ENSG00000177663		0.522	IL17RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL17RA	HGNC	protein_coding	OTTHUMT00000315820.1		0.00	36	0	G	NM_014339	Silent	17586491	+1			no_errors	ENST00000319363	ensembl	human	known	74_37	silent	5.71	33	2	SNP	0.289	A
IRF9	10379	genome.wustl.edu	37	14	24633132	24633134	+	In_Frame_Del	DEL	AGC	AGC	-	rs199740615		TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	AGC	AGC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr14:24633132_24633134delAGC	ENST00000396864.3	+	5	828_830	c.541_543delAGC	c.(541-543)agcdel	p.S187del	RP11-468E2.4_ENST00000558468.1_3'UTR|IRF9_ENST00000557894.1_In_Frame_Del_p.S85del	NM_006084.4	NP_006075.3	Q00978	IRF9_HUMAN	interferon regulatory factor 9	187	Poly-Ser.				cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|transcription from RNA polymerase II promoter (GO:0006366)|type I interferon biosynthetic process (GO:0045351)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|kidney(3)|large_intestine(3)|lung(4)|ovary(1)|skin(2)	16				GBM - Glioblastoma multiforme(265;0.00853)		AGACATTGGGagcagcagcagca	0.567																																																	0										167,4097		0,167,1965						-2.5	0.0			53	342,7912		0,342,3785	no	coding	IRF9	NM_006084.4		0,509,5750	A1A1,A1R,RR		4.1434,3.9165,4.0661				509,12009				SO:0001651	inframe_deletion	0			M87503	CCDS9615.1	14q11.2	2007-07-06	2007-07-06	2007-07-06	ENSG00000213928	ENSG00000213928			6131	protein-coding gene	gene with protein product		147574	"""interferon-stimulated transcription factor 3, gamma (48kD)"", ""interferon-stimulated transcription factor 3, gamma 48kDa"""	ISGF3G		1630447, 10199920	Standard	NM_006084		Approved		uc001wmq.3	Q00978	OTTHUMG00000028799	ENST00000396864.3:c.541_543delAGC	14.37:g.24633141_24633143delAGC	ENSP00000380073:p.Ser187del		D3DS61	In_Frame_Del	DEL	pfam_Interferon_reg_fact_DNA-bd_dom,pfam_Interferon_reg_factor-3,superfamily_SMAD_FHA_domain,smart_Interferon_reg_fact_DNA-bd_dom,prints_Interferon_reg_fact_DNA-bd_dom	p.S184in_frame_del	ENST00000396864.3	37	c.541_543	CCDS9615.1	14																																																																																			IRF9	-	NULL	ENSG00000213928		0.567	IRF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRF9	HGNC	protein_coding	OTTHUMT00000071927.2		0.00	31	0	AGC			24633134	+1	tier1		no_errors	ENST00000396864	ensembl	human	known	74_37	in_frame_del	5.56	34	2	DEL	0.064:0.076:0.081	-
ISG20	3669	genome.wustl.edu	37	15	89195433	89195433	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr15:89195433C>G	ENST00000306072.5	+	3	679	c.321C>G	c.(319-321)atC>atG	p.I107M	ISG20_ENST00000560741.1_Missense_Mutation_p.I107M|ISG20_ENST00000560746.1_3'UTR	NM_002201.4	NP_002192.2	Q96AZ6	ISG20_HUMAN	interferon stimulated exonuclease gene 20kDa	107					cell proliferation (GO:0008283)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|DNA catabolic process, exonucleolytic (GO:0000738)|negative regulation of viral genome replication (GO:0045071)|response to virus (GO:0009615)|RNA catabolic process (GO:0006401)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA processing (GO:0006364)|type I interferon signaling pathway (GO:0060337)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	3'-5'-exoribonuclease activity (GO:0000175)|exonuclease activity (GO:0004527)|exoribonuclease II activity (GO:0008859)|metal ion binding (GO:0046872)|single-stranded DNA 3'-5' exodeoxyribonuclease activity (GO:0008310)|U1 snRNA binding (GO:0030619)|U2 snRNA binding (GO:0030620)|U3 snoRNA binding (GO:0034511)			large_intestine(1)|lung(3)|prostate(1)	5	Lung NSC(78;0.0554)|all_lung(78;0.103)		BRCA - Breast invasive adenocarcinoma(143;0.12)			GCTACACAATCTACGACACGT	0.592																																																	0													174.0	140.0	152.0					15																	89195433		2200	4299	6499	SO:0001583	missense	0			X89773	CCDS10345.1	15q26	2006-02-22	2002-08-29		ENSG00000172183	ENSG00000172183			6130	protein-coding gene	gene with protein product		604533	"""interferon stimulated gene (20kD)"""			9235947, 9605874	Standard	NM_002201		Approved	HEM45, CD25	uc002bmv.1	Q96AZ6	OTTHUMG00000148679	ENST00000306072.5:c.321C>G	15.37:g.89195433C>G	ENSP00000306565:p.Ile107Met		O00441|O00586	Missense_Mutation	SNP	pfam_Exonuclease_RNaseT/DNA_pol3,superfamily_RNaseH-like_dom,smart_Exonuclease	p.I107M	ENST00000306072.5	37	c.321	CCDS10345.1	15	.	.	.	.	.	.	.	.	.	.	C	12.40	1.927333	0.34002	.	.	ENSG00000172183	ENST00000306072;ENST00000546338	T	0.34275	1.37	4.58	3.66	0.41972	Exonuclease (1);Exonuclease, RNase T/DNA polymerase III (1);Ribonuclease H-like (1);	0.472506	0.21722	N	0.070111	T	0.43055	0.1230	M	0.87269	2.87	0.80722	D	1	B	0.33345	0.409	B	0.33960	0.173	T	0.45293	-0.9271	10	0.66056	D	0.02	-7.7348	8.7793	0.34781	0.0:0.8933:0.0:0.1067	.	107	Q96AZ6	ISG20_HUMAN	M	107;115	ENSP00000306565:I107M	ENSP00000306565:I107M	I	+	3	3	ISG20	86996437	0.687000	0.27671	0.727000	0.30756	0.113000	0.19764	0.877000	0.28106	0.922000	0.37019	0.491000	0.48974	ATC	ISG20	-	pfam_Exonuclease_RNaseT/DNA_pol3,superfamily_RNaseH-like_dom,smart_Exonuclease	ENSG00000172183		0.592	ISG20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ISG20	HGNC	protein_coding	OTTHUMT00000309069.2	-	0.00	40	0	C	NM_002201		89195433	+1	tier1	-	no_errors	ENST00000306072	ensembl	human	known	74_37	missense	15.38	66	12	SNP	0.943	G
KALRN	8997	genome.wustl.edu	37	3	124303670	124303670	+	Start_Codon_SNP	SNP	T	T	C			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr3:124303670T>C	ENST00000291478.5	+	1	165	c.2T>C	c.(1-3)aTg>aCg	p.M1T	KALRN_ENST00000428018.2_Start_Codon_SNP_p.M1T|KALRN_ENST00000360013.3_Intron|KALRN_ENST00000393496.1_Intron	NM_007064.3	NP_008995.2	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase	0					apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						CGGGGCAACATGAAGGGCGGC	0.697																																																	0													64.0	55.0	58.0					3																	124303670		2198	4295	6493	SO:0001582	initiator_codon_variant	0			U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000291478.5:c.2T>C	3.37:g.124303670T>C	ENSP00000291478:p.Met1Thr		A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_DH-domain,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,pfscan_DH-domain	p.M1T	ENST00000291478.5	37	c.2	CCDS3028.1	3	.	.	.	.	.	.	.	.	.	.	T	17.61	3.431789	0.62844	.	.	ENSG00000160145	ENST00000291478;ENST00000454902;ENST00000428018	T;T	0.64085	-0.08;-0.05	4.61	4.61	0.57282	.	.	.	.	.	T	0.60379	0.2264	.	.	.	0.80722	D	1	B	0.16603	0.018	B	0.34489	0.184	T	0.62666	-0.6806	8	0.87932	D	0	.	10.3011	0.43653	0.0:0.0:0.0:1.0	.	1	C9JQ37	.	T	1	ENSP00000291478:M1T;ENSP00000402419:M1T	ENSP00000291478:M1T	M	+	2	0	KALRN	125786360	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	3.572000	0.53849	1.948000	0.56530	0.459000	0.35465	ATG	KALRN	-	NULL	ENSG00000160145		0.697	KALRN-001	KNOWN	basic|CCDS	protein_coding	KALRN	HGNC	protein_coding	OTTHUMT00000246891.5	-	0.00	18	0	T	NM_003947	Missense_Mutation	124303670	+1	tier1	-	no_errors	ENST00000291478	ensembl	human	known	74_37	missense	24.24	25	8	SNP	1.000	C
KIAA1467	57613	genome.wustl.edu	37	12	13211414	13211414	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr12:13211414G>A	ENST00000197268.8	+	3	583	c.463G>A	c.(463-465)Gat>Aat	p.D155N		NM_020853.1	NP_065904.1	A2RU67	K1467_HUMAN	KIAA1467	155						integral component of membrane (GO:0016021)				NS(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|prostate(1)|skin(4)	36		Prostate(47;0.184)		BRCA - Breast invasive adenocarcinoma(232;0.157)		GGAATTGGCTGATGTGAATGG	0.468																																																	0													434.0	403.0	414.0					12																	13211414		2203	4300	6503	SO:0001583	missense	0			AB040900	CCDS31750.1	12p13.1	2006-01-23				ENSG00000084444			29288	protein-coding gene	gene with protein product						10819331	Standard	XM_005253450		Approved		uc001rbi.3	A2RU67		ENST00000197268.8:c.463G>A	12.37:g.13211414G>A	ENSP00000197268:p.Asp155Asn		Q49AF2|Q5CZ81|Q6ZUV7|Q9P261	Missense_Mutation	SNP	superfamily_Quinonprotein_ADH-like_supfam	p.D155N	ENST00000197268.8	37	c.463	CCDS31750.1	12	.	.	.	.	.	.	.	.	.	.	G	23.7	4.449633	0.84101	.	.	ENSG00000084444	ENST00000197268	.	.	.	4.91	4.91	0.64330	Quinonprotein alcohol dehydrogenase-like (1);	0.000000	0.85682	D	0.000000	T	0.79890	0.4524	M	0.78456	2.415	0.51767	D	0.999933	D	0.89917	1.0	D	0.97110	1.0	T	0.82466	-0.0443	9	0.72032	D	0.01	-14.1529	17.2748	0.87112	0.0:0.0:1.0:0.0	.	155	A2RU67	K1467_HUMAN	N	155	.	ENSP00000197268:D155N	D	+	1	0	KIAA1467	13102681	1.000000	0.71417	0.995000	0.50966	0.685000	0.39939	6.731000	0.74785	2.540000	0.85666	0.650000	0.86243	GAT	KIAA1467	-	superfamily_Quinonprotein_ADH-like_supfam	ENSG00000084444		0.468	KIAA1467-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1467	HGNC	protein_coding	OTTHUMT00000401007.1	-	0.00	99	0	G	NM_020853		13211414	+1	tier1	-	no_errors	ENST00000197268	ensembl	human	known	74_37	missense	27.08	70	26	SNP	1.000	A
KLHDC2	23588	genome.wustl.edu	37	14	50244592	50244592	+	Silent	SNP	G	G	A			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr14:50244592G>A	ENST00000298307.5	+	4	1248	c.387G>A	c.(385-387)gtG>gtA	p.V129V	KLHDC2_ENST00000557247.1_Silent_p.V129V|KLHDC2_ENST00000553538.1_3'UTR|KLHDC2_ENST00000554589.1_Silent_p.V129V	NM_014315.2	NP_055130.1	Q9Y2U9	KLDC2_HUMAN	kelch domain containing 2	129						nucleus (GO:0005634)				endometrium(3)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16	all_epithelial(31;0.000959)|Breast(41;0.0117)					CAGACAGAGTGTTACAGTGGG	0.373																																																	0													120.0	113.0	116.0					14																	50244592		2203	4300	6503	SO:0001819	synonymous_variant	0			AK001771	CCDS9693.1	14q21.3	2003-01-15			ENSG00000165516	ENSG00000165516			20231	protein-coding gene	gene with protein product		611280				11384994	Standard	NM_014315		Approved	HCLP-1, LCP	uc001wwx.3	Q9Y2U9	OTTHUMG00000140288	ENST00000298307.5:c.387G>A	14.37:g.50244592G>A			B3KPF9|Q6IAF0|Q86TY9	Silent	SNP	pfam_Kelch_2	p.V129	ENST00000298307.5	37	c.387	CCDS9693.1	14																																																																																			KLHDC2	-	NULL	ENSG00000165516		0.373	KLHDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHDC2	HGNC	protein_coding	OTTHUMT00000276869.1	-	0.00	46	0	G			50244592	+1	tier1	-	no_errors	ENST00000298307	ensembl	human	known	74_37	silent	36.54	33	19	SNP	0.959	A
KLK5	25818	genome.wustl.edu	37	19	51451943	51451943	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr19:51451943C>T	ENST00000336334.3	-	5	1031	c.679G>A	c.(679-681)Gac>Aac	p.D227N	CTB-147C22.8_ENST00000594939.1_RNA|CTB-147C22.8_ENST00000601506.1_RNA|KLK5_ENST00000593428.1_Missense_Mutation_p.D227N|KLK5_ENST00000391809.2_Missense_Mutation_p.D227N	NM_012427.4	NP_036559	Q9Y337	KLK5_HUMAN	kallikrein-related peptidase 5	227	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				epidermis development (GO:0008544)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)	epidermal lamellar body (GO:0097209)|extracellular space (GO:0005615)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			NS(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|urinary_tract(1)	15		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00379)|GBM - Glioblastoma multiforme(134;0.00888)		AACATGGTGTCATCTATCTGT	0.502																																																	0													168.0	132.0	144.0					19																	51451943		2203	4300	6503	SO:0001583	missense	0			AF135028	CCDS12810.1	19q13.33	2008-02-05	2006-10-27			ENSG00000167754		"""Kallikreins"""	6366	protein-coding gene	gene with protein product		605643	"""kallikrein 5"""			10514489, 10608802, 1680072, 4, 16800723, 17012259	Standard	NM_012427		Approved	SCTE, KLK-L2	uc002puf.3	Q9Y337		ENST00000336334.3:c.679G>A	19.37:g.51451943C>T	ENSP00000337733:p.Asp227Asn		Q53ZR3|Q9HBG8	Missense_Mutation	SNP	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.D227N	ENST00000336334.3	37	c.679	CCDS12810.1	19	.	.	.	.	.	.	.	.	.	.	c	3.583	-0.085189	0.07097	.	.	ENSG00000167754	ENST00000336334;ENST00000391809	D;D	0.93488	-3.23;-3.23	4.67	-9.34	0.00636	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	3.146950	0.01443	N	0.015199	D	0.84338	0.5450	L	0.35249	1.045	0.09310	N	1	B	0.02656	0.0	B	0.08055	0.003	T	0.72114	-0.4388	10	0.19147	T	0.46	.	0.4833	0.00552	0.2897:0.1566:0.2772:0.2765	.	227	Q9Y337	KLK5_HUMAN	N	227	ENSP00000337733:D227N;ENSP00000375685:D227N	ENSP00000337733:D227N	D	-	1	0	KLK5	56143755	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	-4.114000	0.00292	-4.354000	0.00054	-0.910000	0.02820	GAC	KLK5	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1	ENSG00000167754		0.502	KLK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLK5	HGNC	protein_coding	OTTHUMT00000465057.1	-	0.00	22	0	C	NM_012427		51451943	-1	tier1	-	no_errors	ENST00000336334	ensembl	human	known	74_37	missense	35.48	20	11	SNP	0.000	T
KMT2A	4297	genome.wustl.edu	37	11	118392772	118392772	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr11:118392772G>A	ENST00000389506.5	+	36	11795	c.11795G>A	c.(11794-11796)cGt>cAt	p.R3932H	KMT2A_ENST00000534358.1_Missense_Mutation_p.R3935H|RP11-770J1.3_ENST00000532597.1_RNA|KMT2A_ENST00000354520.4_Missense_Mutation_p.R3894H|RP11-770J1.3_ENST00000528578.1_RNA|RP11-770J1.3_ENST00000554407.1_RNA|RP11-770J1.3_ENST00000525992.2_RNA|RP11-770J1.3_ENST00000556583.1_RNA			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	3932	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										TTTGCCATGCGTAAGATCTAC	0.498																																																	0													201.0	159.0	173.0					11																	118392772		2200	4295	6495	SO:0001583	missense	0			L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.11795G>A	11.37:g.118392772G>A	ENSP00000374157:p.Arg3932His		E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Missense_Mutation	SNP	pfam_SET_dom,pfam_FYrich_C,pfam_Znf_PHD-finger,pfam_FYrich_N,pfam_Znf_CXXC,superfamily_Znf_FYVE_PHD,superfamily_Bromodomain,smart_Znf_PHD,smart_Bromodomain,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pirsf_MeTrfase_trithorax,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC,pfscan_Bromodomain	p.R3932H	ENST00000389506.5	37	c.11795	CCDS31686.1	11	.	.	.	.	.	.	.	.	.	.	G	22.0	4.224662	0.79576	.	.	ENSG00000118058	ENST00000534358;ENST00000389506;ENST00000354520;ENST00000359313	D;D;D	0.86497	-2.13;-2.13;-2.13	5.5	5.5	0.81552	SET domain (3);	0.000000	0.85682	D	0.000000	D	0.95847	0.8648	H	0.95114	3.625	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.96498	0.9369	10	0.87932	D	0	.	19.5916	0.95514	0.0:0.0:1.0:0.0	.	3935;3932	E9PQG7;Q03164	.;MLL1_HUMAN	H	3935;3932;3894;2842	ENSP00000436786:R3935H;ENSP00000374157:R3932H;ENSP00000346516:R3894H	ENSP00000346516:R3894H	R	+	2	0	MLL	117897982	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.860000	0.86993	2.861000	0.98227	0.655000	0.94253	CGT	KMT2A	-	pfam_SET_dom,smart_SET_dom,pirsf_MeTrfase_trithorax,pfscan_SET_dom	ENSG00000118058		0.498	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	KMT2A	HGNC	protein_coding	OTTHUMT00000399085.2	-	0.00	51	0	G	NM_005933		118392772	+1	tier1	-	no_errors	ENST00000389506	ensembl	human	known	74_37	missense	50.00	19	19	SNP	1.000	A
KMT2B	9757	genome.wustl.edu	37	19	36212415	36212415	+	Silent	SNP	C	C	T	rs368953229		TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr19:36212415C>T	ENST00000222270.7	+	3	2166	c.2166C>T	c.(2164-2166)caC>caT	p.H722H	KMT2B_ENST00000607650.1_RNA|KMT2B_ENST00000420124.1_Silent_p.H722H|KMT2B_ENST00000341701.1_Missense_Mutation_p.T578M	NM_014727.1	NP_055542.1	Q9UMN6	KMT2B_HUMAN	lysine (K)-specific methyltransferase 2B	722	Pro-rich.				chromatin-mediated maintenance of transcription (GO:0048096)|gene silencing (GO:0016458)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|oocyte differentiation (GO:0009994)|ovarian follicle development (GO:0001541)|ovulation (GO:0030728)|regulation of histone H3-K4 methylation (GO:0051569)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										TGTCCCCTCACGGGGCTCCAG	0.667																																																	0								C		0,4136		0,0,2068	40.0	49.0	46.0		2166	-6.7	0.0	19		46	1,8421		0,1,4210	no	coding-synonymous	MLL4	NM_014727.1		0,1,6278	TT,TC,CC		0.0119,0.0,0.0080		722/2716	36212415	1,12557	2068	4211	6279	SO:0001819	synonymous_variant	0			AJ007041	CCDS46055.1	19q13.1	2014-02-18			ENSG00000105663	ENSG00000272333		"""Chromatin-modifying enzymes / K-methyltransferases"""	15840	protein-coding gene	gene with protein product	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 4"""	606834				10409430, 10637508	Standard	XM_006723513		Approved	KIAA0304, MLL2, TRX2, HRX2, WBP7, MLL1B, MLL4		Q9UMN6	OTTHUMG00000048119	ENST00000222270.7:c.2166C>T	19.37:g.36212415C>T			O15022|O95836|Q96GP2|Q96IP3|Q9UK25|Q9Y668|Q9Y669	Missense_Mutation	SNP	NULL	p.T578M	ENST00000222270.7	37	c.1733	CCDS46055.1	19	.	.	.	.	.	.	.	.	.	.	C	7.551	0.662658	0.14645	0.0	1.19E-4	ENSG00000105663	ENST00000341701	T	0.48201	0.82	4.61	-6.66	0.01789	.	.	.	.	.	T	0.33089	0.0851	.	.	.	0.28487	N	0.914684	.	.	.	.	.	.	T	0.44190	-0.9344	6	0.87932	D	0	.	0.7964	0.01067	0.2136:0.3025:0.2171:0.2668	.	.	.	.	M	578	ENSP00000345761:T578M	ENSP00000345761:T578M	T	+	2	0	AD000671.1	40904255	0.000000	0.05858	0.001000	0.08648	0.834000	0.47266	-1.324000	0.02690	-1.282000	0.02396	-0.374000	0.07098	ACG	KMT2B	-	NULL	ENSG00000272333		0.667	KMT2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	KMT2B	Uniprot_gn	protein_coding		-	0.00	133	0	C	NM_014727		36212415	+1	tier1	-	no_errors	ENST00000341701	ensembl	human	known	74_37	missense	10.57	110	13	SNP	0.003	T
KMT2C	58508	genome.wustl.edu	37	7	151878602	151878602	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr7:151878602C>A	ENST00000262189.6	-	36	6561	c.6343G>T	c.(6343-6345)Gct>Tct	p.A2115S	KMT2C_ENST00000355193.2_Missense_Mutation_p.A2115S	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	2115	Pro-rich.				histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										TGGGAAAAAGCCCTTGAAGGA	0.453																																																	0													101.0	104.0	103.0					7																	151878602		2203	4300	6503	SO:0001583	missense	0			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.6343G>T	7.37:g.151878602C>A	ENSP00000262189:p.Ala2115Ser		Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_Znf_PHD,smart_Znf_RING,smart_HMG_box_dom,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_DHHC_palmitoyltrfase,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.A2115S	ENST00000262189.6	37	c.6343	CCDS5931.1	7	.	.	.	.	.	.	.	.	.	.	C	9.575	1.121958	0.20877	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	D;D	0.81579	-1.51;-1.5	5.38	2.48	0.30137	.	0.161338	0.28365	N	0.015617	T	0.54647	0.1871	N	0.11560	0.145	0.80722	D	1	B;B	0.20052	0.038;0.041	B;B	0.17433	0.018;0.016	T	0.50303	-0.8844	10	0.02654	T	1	.	6.5015	0.22172	0.138:0.6504:0.0:0.2115	.	2115;1176	Q8NEZ4;Q8NEZ4-2	MLL3_HUMAN;.	S	2115	ENSP00000262189:A2115S;ENSP00000347325:A2115S	ENSP00000262189:A2115S	A	-	1	0	MLL3	151509535	0.133000	0.22466	0.999000	0.59377	0.925000	0.55904	0.040000	0.13905	1.285000	0.44548	-0.244000	0.11960	GCT	KMT2C	-	NULL	ENSG00000055609		0.453	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KMT2C	HGNC	protein_coding	OTTHUMT00000318887.3	-	0.00	44	0	C			151878602	-1	tier1	-	no_errors	ENST00000355193	ensembl	human	known	74_37	missense	45.95	20	17	SNP	1.000	A
KRI1	65095	genome.wustl.edu	37	19	10673510	10673510	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr19:10673510G>A	ENST00000312962.6	-	4	315	c.296C>T	c.(295-297)tCg>tTg	p.S99L	KRI1_ENST00000537964.1_Intron|KRI1_ENST00000361821.5_Missense_Mutation_p.S95L	NM_023008.3	NP_075384.3	Q8N9T8	KRI1_HUMAN	KRI1 homolog (S. cerevisiae)	93	Glu-rich.					nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	26			Epithelial(33;9.2e-06)|all cancers(31;3.9e-05)			GTCTGATGACGATGCTGTTAA	0.542																																																	0													193.0	150.0	165.0					19																	10673510		2203	4300	6503	SO:0001583	missense	0				CCDS12242.1	19p13.2	2008-02-05			ENSG00000129347	ENSG00000129347			25769	protein-coding gene	gene with protein product						12878157	Standard	NM_023008		Approved	FLJ12949	uc002moy.1	Q8N9T8	OTTHUMG00000150343	ENST00000312962.6:c.296C>T	19.37:g.10673510G>A	ENSP00000320917:p.Ser99Leu		Q2M1R5|Q2M1R7|Q7L5J7|Q96G92|Q9BU50|Q9H6I1|Q9H978	Missense_Mutation	SNP	pfam_KRR1-interact_protein_1	p.S99L	ENST00000312962.6	37	c.296	CCDS12242.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.23|12.23	1.874223|1.874223	0.33069|0.33069	.|.	.|.	ENSG00000129347|ENSG00000129347	ENST00000543682|ENST00000312962;ENST00000361821;ENST00000541101;ENST00000539027	.|T;T;T	.|0.35421	.|1.31;1.31;1.31	4.14|4.14	4.14|4.14	0.48551|0.48551	.|.	.|0.443453	.|0.14838	.|N	.|0.295445	T|T	0.29716|0.29716	0.0742|0.0742	L|L	0.56340|0.56340	1.77|1.77	0.09310|0.09310	N|N	1|1	.|B;P	.|0.36535	.|0.414;0.557	.|B;B	.|0.22753	.|0.041;0.041	T|T	0.14699|0.14699	-1.0463|-1.0463	5|10	.|0.32370	.|T	.|0.25	0.5877|0.5877	13.7055|13.7055	0.62636|0.62636	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|99;95	.|Q8N9T8;D3YTE0	.|KRI1_HUMAN;.	C|L	37|99;95;99;90	.|ENSP00000320917:S99L;ENSP00000355366:S95L;ENSP00000445789:S90L	.|ENSP00000320917:S99L	R|S	-|-	1|2	0|0	KRI1|KRI1	10534510|10534510	0.915000|0.915000	0.31059|0.31059	0.005000|0.005000	0.12908|0.12908	0.011000|0.011000	0.07611|0.07611	3.441000|3.441000	0.52893|0.52893	2.032000|2.032000	0.59987|0.59987	0.393000|0.393000	0.25936|0.25936	CGT|TCG	KRI1	-	NULL	ENSG00000129347		0.542	KRI1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	KRI1	HGNC	protein_coding	OTTHUMT00000317705.1	-	0.00	47	0	G	NM_023008		10673510	-1	tier1	-	no_errors	ENST00000312962	ensembl	human	known	74_37	missense	23.73	45	14	SNP	0.031	A
KRT6A	3853	genome.wustl.edu	37	12	52881551	52881551	+	Missense_Mutation	SNP	T	T	G			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr12:52881551T>G	ENST00000330722.6	-	9	1716	c.1648A>C	c.(1648-1650)Aag>Cag	p.K550Q		NM_005554.3	NP_005545.1	P02538	K2C6A_HUMAN	keratin 6A	550	Tail.				cell differentiation (GO:0030154)|positive regulation of cell proliferation (GO:0008284)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|liver(1)|lung(14)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	39				BRCA - Breast invasive adenocarcinoma(357;0.189)		GTGGTGTACTTGATGGTGGAA	0.592																																																	0													86.0	93.0	90.0					12																	52881551		2203	4300	6503	SO:0001583	missense	0			BC014152, L42593, L42610	CCDS41786.1	12q13.13	2013-01-16			ENSG00000205420	ENSG00000205420		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6443	protein-coding gene	gene with protein product		148041	"""keratin 6C"", ""keratin 6D"""	KRT6C, KRT6D		1713141, 16831889	Standard	NM_005554		Approved	CK6C, K6C, CK6D, K6D	uc001sam.3	P02538	OTTHUMG00000169597	ENST00000330722.6:c.1648A>C	12.37:g.52881551T>G	ENSP00000369317:p.Lys550Gln		A4QPC1|P48667|Q08AR4|Q6NT67|Q96CL4	Missense_Mutation	SNP	pfam_IF,superfamily_Prefoldin,prints_Keratin_II	p.K550Q	ENST00000330722.6	37	c.1648	CCDS41786.1	12	.	.	.	.	.	.	.	.	.	.	t	13.32	2.203009	0.38905	.	.	ENSG00000205420	ENST00000330722;ENST00000452121	D	0.82167	-1.58	4.75	3.5	0.40072	.	0.000000	0.47852	D	0.000208	T	0.72471	0.3464	L	0.41824	1.3	0.24849	N	0.992415	P	0.44877	0.845	B	0.39379	0.298	T	0.67864	-0.5560	10	0.56958	D	0.05	.	6.406	0.21664	0.0:0.0847:0.1579:0.7574	.	550	P02538	K2C6A_HUMAN	Q	550;506	ENSP00000369317:K550Q	ENSP00000369317:K550Q	K	-	1	0	KRT6A	51167818	0.019000	0.18553	1.000000	0.80357	0.958000	0.62258	0.316000	0.19469	1.901000	0.55032	0.529000	0.55759	AAG	KRT6A	-	NULL	ENSG00000205420		0.592	KRT6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT6A	HGNC	protein_coding	OTTHUMT00000404978.2		0.00	48	0	T	NM_005554		52881551	-1			no_errors	ENST00000330722	ensembl	human	known	74_37	missense	6.25	60	4	SNP	0.810	G
LAMA5	3911	genome.wustl.edu	37	20	60912751	60912751	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr20:60912751C>T	ENST00000252999.3	-	16	2125	c.2059G>A	c.(2059-2061)Gca>Aca	p.A687T		NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	687	Laminin EGF-like 8. {ECO:0000255|PROSITE- ProRule:PRU00460}.				angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			TCACAGGCTGCGTGCAGGGAG	0.657																																																	0													31.0	31.0	31.0					20																	60912751		2201	4296	6497	SO:0001583	missense	0			AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.2059G>A	20.37:g.60912751C>T	ENSP00000252999:p.Ala687Thr		Q8TDF8|Q8WZA7|Q9H1P1	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_I,pfam_Laminin_G,pfam_Laminin_N,pfam_Laminin_II,pfam_Laminin_B_type_IV,superfamily_ConA-like_lec_gl_sf,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N,pfscan_TNFR/NGFR_Cys_rich_reg	p.A687T	ENST00000252999.3	37	c.2059	CCDS33502.1	20	.	.	.	.	.	.	.	.	.	.	C	0.101	-1.152404	0.01700	.	.	ENSG00000130702	ENST00000252999	T	0.61627	0.09	4.89	-6.4	0.01944	EGF-like, laminin (3);	0.733633	0.12708	N	0.445819	T	0.23210	0.0561	N	0.05330	-0.07	0.09310	N	0.999996	B	0.06786	0.001	B	0.06405	0.002	T	0.36456	-0.9747	10	0.02654	T	1	.	6.7021	0.23230	0.2046:0.2435:0.0:0.5519	.	687	O15230	LAMA5_HUMAN	T	687	ENSP00000252999:A687T	ENSP00000252999:A687T	A	-	1	0	LAMA5	60346146	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-2.856000	0.00729	-1.353000	0.02191	-0.188000	0.12872	GCA	LAMA5	-	pfam_EGF_laminin,smart_EGF_laminin,smart_EG-like_dom,pfscan_EGF_laminin	ENSG00000130702		0.657	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA5	HGNC	protein_coding	OTTHUMT00000080014.2	-	0.00	41	0	C	NM_005560		60912751	-1	tier1	-	no_errors	ENST00000252999	ensembl	human	known	74_37	missense	12.50	35	5	SNP	0.000	T
LCT	3938	genome.wustl.edu	37	2	136564749	136564749	+	Nonsense_Mutation	SNP	G	G	T	rs557321611		TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr2:136564749G>T	ENST00000264162.2	-	9	4132	c.4122C>A	c.(4120-4122)taC>taA	p.Y1374*	Y_RNA_ENST00000363794.1_RNA	NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	1374	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)			breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	GAAACCGTCCGTACAGAAACT	0.567																																																	0													193.0	149.0	164.0					2																	136564749		2203	4300	6503	SO:0001587	stop_gained	0			X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.4122C>A	2.37:g.136564749G>T	ENSP00000264162:p.Tyr1374*		Q4ZG58	Nonsense_Mutation	SNP	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF,prints_Glyco_hydro_1	p.Y1374*	ENST00000264162.2	37	c.4122	CCDS2178.1	2	.	.	.	.	.	.	.	.	.	.	G	27.8	4.860161	0.91433	.	.	ENSG00000115850	ENST00000264162;ENST00000455227	.	.	.	5.87	-8.41	0.00961	.	0.116121	0.64402	D	0.000010	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-20.629	17.2517	0.87044	0.4483:0.0:0.5517:0.0	.	.	.	.	X	1374;806	.	ENSP00000264162:Y1374X	Y	-	3	2	LCT	136281219	0.867000	0.29959	0.046000	0.18839	0.557000	0.35523	0.146000	0.16180	-1.957000	0.01021	-0.812000	0.03155	TAC	LCT	-	superfamily_Glycoside_hydrolase_SF	ENSG00000115850		0.567	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCT	HGNC	protein_coding	OTTHUMT00000254657.1	-	0.00	59	0	G	NM_002299		136564749	-1	tier1	-	no_errors	ENST00000264162	ensembl	human	known	74_37	nonsense	5.33	71	4	SNP	0.786	T
LGR6	59352	genome.wustl.edu	37	1	202287572	202287572	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr1:202287572C>T	ENST00000367278.3	+	18	2230	c.2141C>T	c.(2140-2142)tCc>tTc	p.S714F	LGR6_ENST00000439764.2_Missense_Mutation_p.S575F|LGR6_ENST00000255432.7_Missense_Mutation_p.S662F	NM_001017403.1	NP_001017403.1	Q9HBX8	LGR6_HUMAN	leucine-rich repeat containing G protein-coupled receptor 6	714					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of Wnt signaling pathway (GO:0030177)|Wnt signaling pathway (GO:0016055)	integral component of plasma membrane (GO:0005887)|trans-Golgi network membrane (GO:0032588)|vesicle (GO:0031982)	transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(16)|ovary(3)|pancreas(1)|prostate(3)|skin(3)	36						TACGGGGCCTCCCCACTCTGC	0.687																																																	0													35.0	34.0	34.0					1																	202287572		2203	4299	6502	SO:0001583	missense	0			AF190501	CCDS1424.1, CCDS30971.1, CCDS30972.1	1q32.1	2012-08-21	2011-01-25		ENSG00000133067	ENSG00000133067		"""GPCR / Class A : Orphans"""	19719	protein-coding gene	gene with protein product		606653	"""leucine-rich repeat-containing G protein-coupled receptor 6"""			10935549	Standard	XM_005245404		Approved	FLJ14471	uc001gxu.3	Q9HBX8	OTTHUMG00000041383	ENST00000367278.3:c.2141C>T	1.37:g.202287572C>T	ENSP00000356247:p.Ser714Phe		Q5T509|Q5T512|Q6UY15|Q86VU0|Q96K69|Q9BYD7	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_GPCR_Rhodpsn,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,prints_Gphrmn_rcpt_fam,prints_GPCR_Rhodpsn	p.S714F	ENST00000367278.3	37	c.2141	CCDS30971.1	1	.	.	.	.	.	.	.	.	.	.	C	17.53	3.411465	0.62399	.	.	ENSG00000133067	ENST00000367278;ENST00000255432;ENST00000439764	D;D;D	0.87887	-2.31;-2.31;-2.31	4.36	4.36	0.52297	.	0.064462	0.64402	D	0.000004	D	0.89451	0.6719	L	0.33485	1.01	0.58432	D	0.99999	D;D;D	0.71674	0.984;0.998;0.987	P;D;D	0.70935	0.879;0.964;0.971	D	0.88928	0.3371	10	0.38643	T	0.18	.	17.488	0.87693	0.0:1.0:0.0:0.0	.	575;662;714	Q9HBX8-1;Q9HBX8-2;Q9HBX8	.;.;LGR6_HUMAN	F	714;662;575	ENSP00000356247:S714F;ENSP00000255432:S662F;ENSP00000387869:S575F	ENSP00000255432:S662F	S	+	2	0	LGR6	200554195	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.492000	0.81482	2.442000	0.82660	0.485000	0.47835	TCC	LGR6	-	pfam_GPCR_Rhodpsn,prints_Gphrmn_rcpt_fam	ENSG00000133067		0.687	LGR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LGR6	HGNC	protein_coding	OTTHUMT00000099143.1	-	0.00	27	0	C	NM_021636		202287572	+1	tier1	-	no_errors	ENST00000367278	ensembl	human	known	74_37	missense	34.69	32	17	SNP	1.000	T
MIR570	693155	genome.wustl.edu	37	3	195428437	195428437	+	RNA	SNP	G	G	C			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr3:195428437G>C	ENST00000384917.1	+	0	97					NR_030296.1				microRNA 570																		GATATTTAAAGACCAGGCCTT	0.602																																																	0																																												0					3	2011-09-12		2008-12-18	ENSG00000207650	ENSG00000207650		"""ncRNAs / Micro RNAs"""	32826	non-coding RNA	RNA, micro		614538		MIRN570			Standard	NR_030296		Approved	hsa-mir-570	uc021xjf.1				3.37:g.195428437G>C				RNA	SNP	-	NULL	ENST00000384917.1	37	NULL		3																																																																																			LINC00969	-	-	ENSG00000242086		0.602	MIR570-201	KNOWN	basic	miRNA	LINC00969	HGNC	miRNA		-	0.00	39	0	G	NR_030296		195428437	+1	tier1	-	no_errors	ENST00000445707	ensembl	human	known	74_37	rna	5.62	84	5	SNP	0.001	C
LINC01020	340094	genome.wustl.edu	37	5	5057902	5057902	+	lincRNA	SNP	T	T	C			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr5:5057902T>C	ENST00000508201.1	+	0	585									long intergenic non-protein coding RNA 1020																		gaaaggaaagTGAACTTGAAA	0.398																																																	0																																												0					5p15.32	2013-07-26			ENSG00000215231	ENSG00000215231		"""Long non-coding RNAs"""	27968	non-coding RNA	RNA, long non-coding						12477932	Standard	NR_026994		Approved				OTTHUMG00000161653		5.37:g.5057902T>C				RNA	SNP	-	NULL	ENST00000508201.1	37	NULL		5																																																																																			LINC01020	-	-	ENSG00000215231		0.398	LINC01020-001	KNOWN	basic	lincRNA	LINC01020	HGNC	lincRNA	OTTHUMT00000365595.1	-	0.00	80	0	T			5057902	+1	tier1	-	no_errors	ENST00000507599	ensembl	human	known	74_37	rna	35.80	51	29	SNP	0.000	C
FAM91A3P	729182	genome.wustl.edu	37	1	149262062	149262062	+	lincRNA	SNP	A	A	G			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr1:149262062A>G	ENST00000325963.8	+	0	1609																											ACTCTACTCTATAAGATATTT	0.368																																																	0																																												0																															1.37:g.149262062A>G				RNA	SNP	-	NULL	ENST00000325963.8	37	NULL		1																																																																																			RP11-403I13.4	-	-	ENSG00000223779		0.368	RP11-403I13.4-002	KNOWN	not_best_in_genome_evidence|basic	lincRNA	LOC100293748	Clone_based_vega_gene	lincRNA	OTTHUMT00000099551.1	-	0.00	59	0	A			149262062	+1	tier1	-	no_errors	ENST00000325963	ensembl	human	known	74_37	rna	15.12	73	13	SNP	1.000	G
LINC01410	103352539	genome.wustl.edu	37	9	66466650	66466650	+	lincRNA	SNP	G	G	C	rs1133399	byFrequency	TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr9:66466650G>C	ENST00000424345.1	+	0	1283																											gctaataaaggactccttaat	0.478																																																	0																																												0																															9.37:g.66466650G>C				RNA	SNP	-	NULL	ENST00000424345.1	37	NULL		9																																																																																			RP11-262H14.1	-	-	ENSG00000238113		0.478	RP11-262H14.1-001	KNOWN	basic	lincRNA	LOC100996870	Clone_based_vega_gene	lincRNA	OTTHUMT00000128851.1	-	0.00	12	0	G			66466650	+1	tier1	rs1133399	no_errors	ENST00000424345	ensembl	human	known	74_37	rna	25.00	12	4	SNP	0.105	C
LOC101927209	101927209	genome.wustl.edu	37	1	142621403	142621403	+	lincRNA	SNP	G	G	T	rs2992190	byFrequency	TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr1:142621403G>T	ENST00000610091.1	-	0	6364				RP11-417J8.3_ENST00000426408.1_lincRNA																							TGGTGACATAGATTATGTGCT	0.488																																																	0																																												0																															1.37:g.142621403G>T				RNA	SNP	-	NULL	ENST00000610091.1	37	NULL		1																																																																																			RP11-417J8.3	-	-	ENSG00000230880		0.488	RP11-417J8.6-001	KNOWN	basic	lincRNA	LOC101927209	Clone_based_vega_gene	lincRNA	OTTHUMT00000037265.2	-	0.00	17	0	G			142621403	+1	tier1	rs2992190	no_errors	ENST00000412092	ensembl	human	known	74_37	rna	26.92	19	7	SNP	0.074	T
LOC101927209	101927209	genome.wustl.edu	37	1	142670579	142670579	+	lincRNA	SNP	T	T	C	rs200336596		TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr1:142670579T>C	ENST00000610091.1	-	0	3560																											TGAACACTTTTATCCAACTTT	0.393																																																	0																																												0																															1.37:g.142670579T>C				RNA	SNP	-	NULL	ENST00000610091.1	37	NULL		1																																																																																			RP11-417J8.3	-	-	ENSG00000230880		0.393	RP11-417J8.6-001	KNOWN	basic	lincRNA	LOC101927209	Clone_based_vega_gene	lincRNA	OTTHUMT00000037265.2	-	0.00	29	0	T			142670579	+1	tier1	rs200336596	no_errors	ENST00000400755	ensembl	human	known	74_37	rna	19.23	21	5	SNP	0.282	C
RP11-435B5.5	0	genome.wustl.edu	37	1	143394039	143394039	+	lincRNA	SNP	G	G	A			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr1:143394039G>A	ENST00000428624.1	+	0	2328				RP11-435B5.4_ENST00000423249.1_lincRNA																							TATGGAGAAAGAGCAGGTGAA	0.338																																																	0																																												0																															1.37:g.143394039G>A				RNA	SNP	-	NULL	ENST00000428624.1	37	NULL		1																																																																																			RP11-435B5.5	-	-	ENSG00000238261		0.338	RP11-435B5.5-002	KNOWN	not_best_in_genome_evidence|basic	lincRNA	LOC101927345	Clone_based_vega_gene	lincRNA	OTTHUMT00000037971.1	-	0.00	278	0	G			143394039	+1	tier1	-	no_errors	ENST00000415543	ensembl	human	known	74_37	rna	13.47	301	47	SNP	0.010	A
PLEKHM1P	440456	genome.wustl.edu	37	17	62777687	62777687	+	RNA	SNP	C	C	A			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr17:62777687C>A	ENST00000582986.1	-	0	5014				hsa-mir-6080_ENST00000400873.3_RNA	NR_024386.1		Q69YJ1	PKHMP_HUMAN	pleckstrin homology domain containing, family M (with RUN domain) member 1 pseudogene						intracellular signal transduction (GO:0035556)		metal ion binding (GO:0046872)										ACCAGTGAGGCACCGGCGGAG	0.711																																																	0																																												0					17q24.1	2012-10-03			ENSG00000214176	ENSG00000214176			35411	pseudogene	pseudogene							Standard	NR_024386		Approved	LOC440456	uc002jew.4	Q69YJ1	OTTHUMG00000179296		17.37:g.62777687C>A				RNA	SNP	-	NULL	ENST00000582986.1	37	NULL		17																																																																																			hsa-mir-6080	-	-	ENSG00000215769		0.711	PLEKHM1P-002	KNOWN	basic	processed_transcript	LOC146880	miRBase	pseudogene	OTTHUMT00000445598.1	-	0.00	13	0	C	NR_024386		62777687	-1	tier1	-	no_errors	ENST00000400873	ensembl	human	known	74_37	rna	58.06	13	18	SNP	0.999	A
LRIG1	26018	genome.wustl.edu	37	3	66436586	66436586	+	Silent	SNP	G	G	A			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr3:66436586G>A	ENST00000273261.3	-	13	2132	c.1608C>T	c.(1606-1608)gtC>gtT	p.V536V	LRIG1_ENST00000496559.2_5'UTR|SLC25A26_ENST00000536651.1_Intron|LRIG1_ENST00000383703.3_Silent_p.V560V	NM_015541.2	NP_056356.2	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like domains 1	536	Ig-like C2-type 1.				innervation (GO:0060384)|otolith morphogenesis (GO:0032474)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)				NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(4)|stomach(4)|urinary_tract(1)	42		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		CATTGGTCAGGACTTCATTGT	0.562																																																	0													260.0	245.0	250.0					3																	66436586		2203	4300	6503	SO:0001819	synonymous_variant	0			AB050468	CCDS33783.1	3p14	2013-01-14			ENSG00000144749	ENSG00000144749		"""Immunoglobulin superfamily / I-set domain containing"""	17360	protein-coding gene	gene with protein product	"""ortholog of mouse integral membrane glycoprotein LIG-1"", ""leucine-rich repeat protein LRIG1"""	608868				11414704, 12234026	Standard	NM_015541		Approved	LIG-1, DKFZP586O1624, LIG1	uc003dmx.3	Q96JA1	OTTHUMG00000158727	ENST00000273261.3:c.1608C>T	3.37:g.66436586G>A			Q6IQ51|Q96CF9|Q9BYB8|Q9UFI4	Silent	SNP	pfam_Ig_I-set,pfam_Leu-rich_rpt,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Cys-rich_flank_reg_C,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.V536	ENST00000273261.3	37	c.1608	CCDS33783.1	3																																																																																			LRIG1	-	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000144749		0.562	LRIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRIG1	HGNC	protein_coding	OTTHUMT00000351930.1	-	0.00	73	0	G	NM_015541		66436586	-1	tier1	-	no_errors	ENST00000273261	ensembl	human	known	74_37	silent	52.00	12	13	SNP	0.994	A
LRRC37A6P	387646	genome.wustl.edu	37	10	27538198	27538198	+	lincRNA	SNP	C	C	G			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr10:27538198C>G	ENST00000574842.1	+	0	255				LRRC37A6P_ENST00000284414.4_RNA																							GGTTTAACCTCTGTAGTAGGT	0.527																																																	0													120.0	98.0	105.0					10																	27538198		692	1591	2283			0																															10.37:g.27538198C>G				RNA	SNP	-	NULL	ENST00000574842.1	37	NULL		10																																																																																			LRRC37A6P	-	-	ENSG00000230445		0.527	RP11-85G18.6-001	KNOWN	basic	lincRNA	LRRC37A6P	HGNC	lincRNA	OTTHUMT00000436904.1	-	0.00	110	0	C			27538198	-1	tier1	-	no_errors	ENST00000284414	ensembl	human	known	74_37	rna	30.15	95	41	SNP	0.013	G
MARK1	4139	genome.wustl.edu	37	1	220835505	220835505	+	Silent	SNP	G	G	A			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr1:220835505G>A	ENST00000366917.4	+	18	2651	c.2385G>A	c.(2383-2385)ctG>ctA	p.L795L	MARK1_ENST00000402574.1_Silent_p.L645L|MARK1_ENST00000366918.4_Silent_p.L758L|RP11-322F10.2_ENST00000446040.1_RNA					MAP/microtubule affinity-regulating kinase 1											central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(12)|lung(22)|ovary(4)|pancreas(1)|skin(3)|stomach(3)|urinary_tract(1)	63				GBM - Glioblastoma multiforme(131;0.0407)		AGCTTAAGCTGTAAAGAAGTC	0.393																																																	0													43.0	44.0	43.0					1																	220835505		2203	4300	6503	SO:0001819	synonymous_variant	0			AF154845	CCDS31029.2, CCDS65789.1, CCDS73033.1, CCDS73034.1	1q41	2013-06-27			ENSG00000116141	ENSG00000116141			6896	protein-coding gene	gene with protein product		606511				9108484	Standard	NM_018650		Approved	MARK, PAR-1C	uc001hmn.4	Q9P0L2	OTTHUMG00000037351	ENST00000366917.4:c.2385G>A	1.37:g.220835505G>A				Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_KA1_dom,superfamily_Kinase-like_dom,superfamily_KA1/Ssp2_C,superfamily_UBA-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_UBA/transl_elong_EF1B_N_euk,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_dom	p.L795	ENST00000366917.4	37	c.2385	CCDS31029.2	1																																																																																			MARK1	-	pfam_KA1_dom,superfamily_KA1/Ssp2_C	ENSG00000116141		0.393	MARK1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MARK1	HGNC	protein_coding	OTTHUMT00000090899.1		0.00	21	0	G			220835505	+1			no_errors	ENST00000366917	ensembl	human	known	74_37	silent	6.67	28	2	SNP	1.000	A
ANKRD30BL	554226	genome.wustl.edu	37	2	133014554	133014554	+	Intron	SNP	G	G	T			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr2:133014554G>T	ENST00000470729.1	-	1	441				MIR663B_ENST00000408361.1_RNA	NR_027020.2		A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like											endometrium(1)|kidney(3)	4						CTCAGGCACGGCCGGGCCACC	0.726																																																	0													17.0	29.0	25.0					2																	133014554		1550	3564	5114	SO:0001627	intron_variant	0					2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000470729.1:c.984+547C>A	2.37:g.133014554G>T			B8ZZL7	RNA	SNP	-	NULL	ENST00000470729.1	37	NULL		2																																																																																			MIR663B	-	-	ENSG00000221288		0.726	ANKRD30BL-002	KNOWN	basic	processed_transcript	MIR663B	HGNC	protein_coding	OTTHUMT00000331354.1		0.00	29	0	G	NR_027019		133014554	-1			no_errors	ENST00000408361	ensembl	human	known	74_37	rna	13.46	45	7	SNP	0.025	T
MRGPRF	116535	genome.wustl.edu	37	11	68773294	68773294	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr11:68773294C>T	ENST00000309099.6	-	3	866	c.484G>A	c.(484-486)Gtg>Atg	p.V162M	MRGPRF_ENST00000441623.1_Missense_Mutation_p.V162M|RP11-554A11.5_ENST00000562506.1_RNA	NM_145015.4	NP_659452.3	Q96AM1	MRGRF_HUMAN	MAS-related GPR, member F	162						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(3)|lung(4)	7			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			GCGCACACCACGGCCGACAGG	0.736																																																	0													7.0	11.0	10.0					11																	68773294		2109	4108	6217	SO:0001583	missense	0			AK075492	CCDS8188.1	11q13.1	2014-03-13	2004-03-25		ENSG00000172935	ENSG00000172935		"""GPCR / Class A : Orphans"""	24828	protein-coding gene	gene with protein product		607233	"""G protein-coupled receptor 168"", ""G protein-coupled receptor 140"""	GPR168, GPR140		12477932	Standard	NM_001098515		Approved	MGC21621, mrgF	uc001oop.4	Q96AM1	OTTHUMG00000167897	ENST00000309099.6:c.484G>A	11.37:g.68773294C>T	ENSP00000309782:p.Val162Met		B3KV43|Q8NBK8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.V162M	ENST00000309099.6	37	c.484	CCDS8188.1	11	.	.	.	.	.	.	.	.	.	.	C	16.07	3.017702	0.54576	.	.	ENSG00000172935	ENST00000441623;ENST00000309099;ENST00000421543	T;T	0.74209	-0.82;-0.82	4.86	2.85	0.33270	GPCR, rhodopsin-like superfamily (1);	0.392353	0.18802	N	0.130777	T	0.71451	0.3341	M	0.62209	1.925	0.09310	N	0.999992	P	0.52316	0.952	P	0.49047	0.599	T	0.61564	-0.7037	10	0.34782	T	0.22	-20.4438	5.4234	0.16413	0.0:0.6607:0.2257:0.1136	.	162	Q96AM1	MRGRF_HUMAN	M	162;162;134	ENSP00000403660:V162M;ENSP00000309782:V162M	ENSP00000309782:V162M	V	-	1	0	MRGPRF	68529870	0.000000	0.05858	0.812000	0.32479	0.893000	0.52053	-0.415000	0.07106	2.248000	0.74166	0.561000	0.74099	GTG	MRGPRF	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000172935		0.736	MRGPRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRGPRF	HGNC	protein_coding	OTTHUMT00000396875.1	-	0.00	44	0	C	NM_145015		68773294	-1	tier1	-	no_errors	ENST00000309099	ensembl	human	known	74_37	missense	7.84	188	16	SNP	0.509	T
MRPL57	78988	genome.wustl.edu	37	13	21751269	21751269	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr13:21751269G>C	ENST00000309594.4	+	2	292	c.214G>C	c.(214-216)Gag>Cag	p.E72Q	SKA3_ENST00000314759.5_5'Flank|SKA3_ENST00000400018.3_5'Flank	NM_024026.4	NP_076931.1	Q9BQC6	RT63_HUMAN		72					translation (GO:0006412)	mitochondrial ribosome (GO:0005761)	structural constituent of ribosome (GO:0003735)	p.E72Q(1)		kidney(1)|lung(2)|skin(1)|urinary_tract(1)	5		all_cancers(29;2.76e-20)|all_epithelial(30;2.97e-18)|all_lung(29;4.58e-16)|Lung SC(185;0.0262)|Breast(139;0.147)		all cancers(112;9.43e-05)|Epithelial(112;0.000285)|OV - Ovarian serous cystadenocarcinoma(117;0.00272)|Lung(94;0.0932)		GGAGGCCTTCGAGGCCATAAA	0.612																																																	1	Substitution - Missense(1)	urinary_tract(1)											33.0	31.0	32.0					13																	21751269		2203	4300	6503	SO:0001583	missense	0																														ENST00000309594.4:c.214G>C	13.37:g.21751269G>C	ENSP00000310726:p.Glu72Gln		A2A332	Missense_Mutation	SNP	pirsf_Ribosomal_MRP63_mit	p.E72Q	ENST00000309594.4	37	c.214	CCDS9296.1	13	.	.	.	.	.	.	.	.	.	.	G	8.604	0.887625	0.17540	.	.	ENSG00000173141	ENST00000309594	.	.	.	5.86	-0.0991	0.13625	.	0.464050	0.21046	N	0.081096	T	0.28928	0.0718	L	0.43701	1.375	0.09310	N	0.999993	B	0.21452	0.056	B	0.15484	0.013	T	0.13656	-1.0501	9	0.34782	T	0.22	4.7145	7.0638	0.25141	0.2461:0.3335:0.4203:0.0	.	72	Q9BQC6	RT63_HUMAN	Q	72	.	ENSP00000310726:E72Q	E	+	1	0	MRP63	20649269	0.949000	0.32298	0.002000	0.10522	0.001000	0.01503	1.075000	0.30716	-0.389000	0.07786	-0.136000	0.14681	GAG	MRP63	-	pirsf_Ribosomal_MRP63_mit	ENSG00000173141		0.612	MRP63-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRP63	HGNC	protein_coding	OTTHUMT00000044105.2	-	0.00	43	0	G			21751269	+1	tier1	-	no_errors	ENST00000309594	ensembl	human	known	74_37	missense	31.48	37	17	SNP	0.339	C
MUC4	4585	genome.wustl.edu	37	3	195506118	195506118	+	Silent	SNP	C	C	G	rs375216275		TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr3:195506118C>G	ENST00000463781.3	-	2	12792	c.12333G>C	c.(12331-12333)acG>acC	p.T4111T	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Silent_p.T4111T|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CAGGAAGAGGCGTGGTGTCAC	0.592																																																	0													10.0	7.0	8.0					3																	195506118		557	1435	1992	SO:0001819	synonymous_variant	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12333G>C	3.37:g.195506118C>G			O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.T4111	ENST00000463781.3	37	c.12333	CCDS54700.1	3																																																																																			MUC4	-	NULL	ENSG00000145113		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	-	0.00	40	0	C	NM_018406		195506118	-1	tier1	-	no_errors	ENST00000463781	ensembl	human	known	74_37	silent	24.49	37	12	SNP	0.000	G
MYH7B	57644	genome.wustl.edu	37	20	33568835	33568835	+	Splice_Site	SNP	G	G	C			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr20:33568835G>C	ENST00000262873.7	+	7	717		c.e7-1		MYH7B_ENST00000481922.1_Splice_Site	NM_020884.3	NP_065935.2	A7E2Y1	MYH7B_HUMAN	myosin, heavy chain 7B, cardiac muscle, beta							membrane (GO:0016020)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(5)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(19)|ovary(5)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	54			BRCA - Breast invasive adenocarcinoma(18;0.00691)			CTTTCCTCCAGACCGAGACAA	0.602																																																	0													96.0	96.0	96.0					20																	33568835		2002	4197	6199	SO:0001630	splice_region_variant	0			AB040945	CCDS42869.1	20q11	2011-09-27	2006-09-29		ENSG00000078814	ENSG00000078814		"""Myosins / Myosin superfamily : Class II"""	15906	protein-coding gene	gene with protein product		609928	"""myosin, heavy polypeptide 7B, cardiac muscle, beta"""			11919279, 15014174	Standard	XM_006723839		Approved	KIAA1512, dJ756N5.1, MYH14, MHC14	uc002xbi.2	A7E2Y1	OTTHUMG00000032320	ENST00000262873.7:c.626-1G>C	20.37:g.33568835G>C			Q5JVW7|Q6NT44|Q6NT57|Q6WG75|Q96I57|Q9NWE2|Q9P216	Splice_Site	SNP	-	NULL	ENST00000262873.7	37	c.NULL	CCDS42869.1	20	.	.	.	.	.	.	.	.	.	.	G	21.1	4.094784	0.76870	.	.	ENSG00000078814	ENST00000262873	.	.	.	4.74	4.74	0.60224	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.6555	0.85227	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MYH7B	33032496	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	7.806000	0.86020	2.463000	0.83235	0.643000	0.83706	.	MYH7B	-	-	ENSG00000078814		0.602	MYH7B-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MYH7B	HGNC	protein_coding	OTTHUMT00000078833.2	-	0.00	50	0	G	NM_020884	Intron	33568835	+1	tier1	-	no_errors	ENST00000481922	ensembl	human	known	74_37	splice_site	20.29	55	14	SNP	1.000	C
NAGLU	4669	genome.wustl.edu	37	17	40695400	40695400	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr17:40695400C>T	ENST00000225927.2	+	6	1477	c.1376C>T	c.(1375-1377)gCt>gTt	p.A459V	RP11-400F19.8_ENST00000585572.1_RNA	NM_000263.3	NP_000254.2	P54802	ANAG_HUMAN	N-acetylglucosaminidase, alpha	459					carbohydrate metabolic process (GO:0005975)|cerebellar Purkinje cell layer development (GO:0021680)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|inner ear receptor cell development (GO:0060119)|locomotor rhythm (GO:0045475)|lysosome organization (GO:0007040)|middle ear morphogenesis (GO:0042474)|nervous system development (GO:0007399)|retinal rod cell development (GO:0046548)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)	alpha-N-acetylglucosaminidase activity (GO:0004561)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(1)|ovary(2)|skin(1)	12		all_cancers(22;1.58e-05)|Breast(137;0.000153)|all_epithelial(22;0.000344)		BRCA - Breast invasive adenocarcinoma(366;0.13)	N-Acetyl-D-glucosamine(DB00141)	TCCCTCATGGCTGAGCTGGGC	0.662																																																	0													29.0	25.0	27.0					17																	40695400		2203	4299	6502	SO:0001583	missense	0				CCDS11427.1	17q21.2	2010-07-27	2010-07-27		ENSG00000108784	ENSG00000108784	3.2.1.50		7632	protein-coding gene	gene with protein product	"""Sanfilippo disease IIIB"""	609701					Standard	XM_006721920		Approved	NAG	uc002hzv.3	P54802		ENST00000225927.2:c.1376C>T	17.37:g.40695400C>T	ENSP00000225927:p.Ala459Val			Missense_Mutation	SNP	pfam_NAGLU_tim-barrel,superfamily_Glycoside_hydrolase_SF	p.A459V	ENST00000225927.2	37	c.1376	CCDS11427.1	17	.	.	.	.	.	.	.	.	.	.	C	16.99	3.274618	0.59649	.	.	ENSG00000108784	ENST00000225927;ENST00000377405	D	0.98762	-5.12	4.27	3.21	0.36854	Alpha-N-acetylglucosaminidase, tim-barrel domain (1);	0.228461	0.45361	D	0.000377	D	0.97501	0.9182	M	0.72894	2.215	0.30208	N	0.798028	P	0.50528	0.936	P	0.48304	0.573	D	0.94889	0.8046	10	0.44086	T	0.13	-7.2859	6.748	0.23472	0.3041:0.5337:0.1622:0.0	.	459	P54802	ANAG_HUMAN	V	459;135	ENSP00000225927:A459V	ENSP00000225927:A459V	A	+	2	0	NAGLU	37948926	0.885000	0.30320	0.997000	0.53966	0.924000	0.55760	1.506000	0.35747	2.389000	0.81357	0.313000	0.20887	GCT	NAGLU	-	pfam_NAGLU_tim-barrel	ENSG00000108784		0.662	NAGLU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAGLU	HGNC	protein_coding	OTTHUMT00000450385.1		0.00	33	0	C	NM_000263		40695400	+1			no_errors	ENST00000225927	ensembl	human	known	74_37	missense	6.25	60	4	SNP	0.977	T
NARF	26502	genome.wustl.edu	37	17	80445912	80445912	+	Missense_Mutation	SNP	A	A	T			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr17:80445912A>T	ENST00000309794.11	+	11	1448	c.1250A>T	c.(1249-1251)cAc>cTc	p.H417L	NARF_ENST00000457415.3_Missense_Mutation_p.H463L|NARF_ENST00000345415.7_Missense_Mutation_p.H369L|NARF_ENST00000390006.4_Missense_Mutation_p.H358L	NM_012336.3|NM_031968.2	NP_036468.1|NP_114174.1	Q9UHQ1	NARF_HUMAN	nuclear prelamin A recognition factor	417						lamin filament (GO:0005638)|nuclear lamina (GO:0005652)|nuclear lumen (GO:0031981)|nucleus (GO:0005634)	lamin binding (GO:0005521)			endometrium(2)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.0143)|BRCA - Breast invasive adenocarcinoma(99;0.0369)			TCCAGTGCACACGTGCAGGAG	0.627																																																	0													88.0	76.0	80.0					17																	80445912		2203	4300	6503	SO:0001583	missense	0			BC000438	CCDS32777.1, CCDS42403.1, CCDS42404.1	17q25.3	2011-12-19			ENSG00000141562	ENSG00000141562			29916	protein-coding gene	gene with protein product	"""iron-only hydrogenase-like protein 2"""	605349				10514485, 15667261	Standard	NM_031968		Approved	FLJ10067, DKFZp434G0420, IOP2	uc002kfg.4	Q9UHQ1		ENST00000309794.11:c.1250A>T	17.37:g.80445912A>T	ENSP00000309899:p.His417Leu		A6NCJ3|B3KPX2|K4DI98|Q96AY9|Q9BWC6	Missense_Mutation	SNP	pfam_Fe_hydrogenase_lsu_C,pfam_Fe_hydrogenase_ssu-like,superfamily_Fe_hydrogenase,smart_Fe_hydrogenase_ssu-like	p.H417L	ENST00000309794.11	37	c.1250	CCDS32777.1	17	.	.	.	.	.	.	.	.	.	.	.	6.370	0.436365	0.12104	.	.	ENSG00000141562	ENST00000390006;ENST00000374611;ENST00000309794;ENST00000345415	T;T;T	0.40476	1.03;1.03;1.03	5.58	3.37	0.38596	Iron hydrogenase, small subunit-like (3);Iron hydrogenase (1);	0.514142	0.23395	N	0.048651	T	0.35828	0.0945	L	0.41236	1.265	0.21841	N	0.999516	P;B;B;B	0.36392	0.551;0.156;0.237;0.343	B;B;B;B	0.42030	0.373;0.234;0.217;0.345	T	0.14504	-1.0470	10	0.24483	T	0.36	-20.347	9.3894	0.38363	0.8571:0.0:0.1429:0.0	.	463;369;464;417	Q9UHQ1-2;Q9UHQ1-3;E9PH27;Q9UHQ1	.;.;.;NARF_HUMAN	L	358;464;417;369	ENSP00000374656:H358L;ENSP00000309899:H417L;ENSP00000283996:H369L	ENSP00000309899:H417L	H	+	2	0	NARF	78039201	0.003000	0.15002	0.001000	0.08648	0.114000	0.19823	1.982000	0.40638	0.405000	0.25532	0.528000	0.53228	CAC	NARF	-	pfam_Fe_hydrogenase_ssu-like,superfamily_Fe_hydrogenase,smart_Fe_hydrogenase_ssu-like	ENSG00000141562		0.627	NARF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NARF	HGNC	protein_coding	OTTHUMT00000443573.2	-	0.00	24	0	A	NM_031968		80445912	+1	tier1	-	no_errors	ENST00000309794	ensembl	human	known	74_37	missense	18.75	26	6	SNP	0.005	T
NEFH	4744	genome.wustl.edu	37	22	29879448	29879448	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr22:29879448G>A	ENST00000310624.6	+	2	1001	c.968G>A	c.(967-969)cGt>cAt	p.R323H		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	323	Coil 2B.|Rod.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						GAGTACCGGCGTCAGCTGCAG	0.617																																																	0													122.0	110.0	114.0					22																	29879448		2203	4300	6503	SO:0001583	missense	0				CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.968G>A	22.37:g.29879448G>A	ENSP00000311997:p.Arg323His		B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Missense_Mutation	SNP	pfam_IF,pfam_DUF1388	p.R323H	ENST00000310624.6	37	c.968	CCDS13858.1	22	.	.	.	.	.	.	.	.	.	.	G	19.93	3.918592	0.73098	.	.	ENSG00000100285	ENST00000328842;ENST00000310624	D	0.90504	-2.68	5.3	5.3	0.74995	Filament (1);	0.000000	0.49305	D	0.000153	D	0.92341	0.7570	M	0.79011	2.435	0.52099	D	0.999948	D	0.56746	0.977	P	0.51016	0.656	D	0.92289	0.5840	10	0.54805	T	0.06	.	12.4643	0.55749	0.0759:0.0:0.9241:0.0	.	323	P12036	NFH_HUMAN	H	323	ENSP00000311997:R323H	ENSP00000311997:R323H	R	+	2	0	NEFH	28209448	1.000000	0.71417	0.997000	0.53966	0.994000	0.84299	6.509000	0.73725	2.761000	0.94854	0.650000	0.86243	CGT	NEFH	-	pfam_IF	ENSG00000100285		0.617	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEFH	HGNC	protein_coding	OTTHUMT00000321553.2	-	0.00	21	0	G	NM_021076		29879448	+1	tier1	-	no_errors	ENST00000310624	ensembl	human	known	74_37	missense	31.25	22	10	SNP	1.000	A
NOTCH3	4854	genome.wustl.edu	37	19	15292532	15292532	+	Nonsense_Mutation	SNP	G	G	A			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr19:15292532G>A	ENST00000263388.2	-	17	2722	c.2647C>T	c.(2647-2649)Cga>Tga	p.R883*		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	883	EGF-like 22; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			CGGGCGCATCGTGGGCCGGCG	0.682																																																	0													31.0	27.0	28.0					19																	15292532		2184	4293	6477	SO:0001587	stop_gained	0			U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.2647C>T	19.37:g.15292532G>A	ENSP00000263388:p.Arg883*		Q9UEB3|Q9UPL3|Q9Y6L8	Nonsense_Mutation	SNP	pirsf_Notch,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,pfam_Ankyrin_rpt,pfam_Notch_dom,pfam_Notch_NODP_dom,pfam_Notch_NOD_dom,pfam_EGF_extracell,pfam_DUF3454_notch,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Notch_dom,smart_Ankyrin_rpt,prints_Notch_3,prints_Notch_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom	p.R883*	ENST00000263388.2	37	c.2647	CCDS12326.1	19	.	.	.	.	.	.	.	.	.	.	G	39	7.440773	0.98286	.	.	ENSG00000074181	ENST00000263388;ENST00000539383	.	.	.	5.45	4.42	0.53409	.	0.000000	0.32244	N	0.006364	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05833	T	0.94	.	12.6987	0.57018	0.0805:0.0:0.9195:0.0	.	.	.	.	X	883;833	.	ENSP00000263388:R883X	R	-	1	2	NOTCH3	15153532	0.007000	0.16637	0.095000	0.20976	0.102000	0.19082	1.584000	0.36589	1.309000	0.44985	0.561000	0.74099	CGA	NOTCH3	-	pirsf_Notch,pfam_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom	ENSG00000074181		0.682	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH3	HGNC	protein_coding	OTTHUMT00000465714.1	-	0.00	141	0	G	NM_000435		15292532	-1	tier1	-	no_errors	ENST00000263388	ensembl	human	known	74_37	nonsense	32.37	116	56	SNP	0.993	A
NPEPPS	9520	genome.wustl.edu	37	17	45668212	45668212	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr17:45668212G>A	ENST00000322157.4	+	10	1462	c.1225G>A	c.(1225-1227)Gag>Aag	p.E409K	NPEPPS_ENST00000530173.1_Missense_Mutation_p.E405K|NPEPPS_ENST00000544660.1_Missense_Mutation_p.E329K|NPEPPS_ENST00000525037.1_3'UTR	NM_006310.3	NP_006301.3	P55786	PSA_HUMAN	aminopeptidase puromycin sensitive	409					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular response to hypoxia (GO:0071456)|protein polyubiquitination (GO:0000209)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(6)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	27						CCGTGCCCAGGAGCTTGACGC	0.418																																																	0													53.0	44.0	47.0					17																	45668212		1800	4041	5841	SO:0001583	missense	0			Y07701	CCDS45721.1	17q12-q21	2008-07-18			ENSG00000141279	ENSG00000141279	3.4.11.2		7900	protein-coding gene	gene with protein product	"""puromycin-sensitive aminopeptidase"", ""metalloproteinase MP100"""	606793				9048733, 10329370	Standard	NM_006310		Approved	PSA, MP100	uc002ilr.4	P55786	OTTHUMG00000165471	ENST00000322157.4:c.1225G>A	17.37:g.45668212G>A	ENSP00000320324:p.Glu409Lys		B7Z463|Q6P145|Q9NP16|Q9UEM2	Missense_Mutation	SNP	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.E409K	ENST00000322157.4	37	c.1225	CCDS45721.1	17	.	.	.	.	.	.	.	.	.	.	G	16.91	3.253959	0.59212	.	.	ENSG00000141279	ENST00000530173;ENST00000322157;ENST00000539572;ENST00000544660;ENST00000527964;ENST00000527360	T;T;T;T;T	0.02579	4.24;4.24;4.24;4.24;4.24	5.75	5.75	0.90469	Peptidase M1, membrane alanine aminopeptidase, N-terminal (2);	0.043858	0.85682	D	0.000000	T	0.03827	0.0108	L	0.34521	1.04	0.80722	D	1	B;B;B	0.30763	0.294;0.057;0.122	B;B;B	0.31191	0.125;0.043;0.068	T	0.58255	-0.7668	10	0.18276	T	0.48	.	19.9233	0.97095	0.0:0.0:1.0:0.0	.	409;405;409	A6NEC2;E9PLK3;P55786	PSAL_HUMAN;.;PSA_HUMAN	K	405;409;396;329;92;106	ENSP00000433287:E405K;ENSP00000320324:E409K;ENSP00000442461:E329K;ENSP00000435639:E92K;ENSP00000435966:E106K	ENSP00000320324:E409K	E	+	1	0	NPEPPS	43023211	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.714000	0.98744	2.704000	0.92352	0.591000	0.81541	GAG	NPEPPS	-	pfam_Peptidase_M1_N	ENSG00000141279		0.418	NPEPPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPEPPS	HGNC	protein_coding	OTTHUMT00000384269.1	-	0.00	174	0	G	NM_006310		45668212	+1	tier1	-	no_errors	ENST00000322157	ensembl	human	known	74_37	missense	12.08	182	25	SNP	1.000	A
NPHP3	27031	genome.wustl.edu	37	3	132415603	132415604	+	Frame_Shift_Ins	INS	-	-	A			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr3:132415603_132415604insA	ENST00000337331.5	-	15	2228_2229	c.2142_2143insT	c.(2140-2145)tatgtcfs	p.V715fs	NPHP3_ENST00000326682.8_Intron	NM_153240.4	NP_694972.3	Q7Z494	NPHP3_HUMAN	nephronophthisis 3 (adolescent)	715					atrial septum development (GO:0003283)|cilium morphogenesis (GO:0060271)|convergent extension involved in gastrulation (GO:0060027)|determination of intestine left/right asymmetry (GO:0071908)|determination of left/right symmetry (GO:0007368)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|determination of stomach left/right asymmetry (GO:0071909)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|establishment or maintenance of cell polarity (GO:0007163)|extracellular matrix organization (GO:0030198)|heart looping (GO:0001947)|kidney development (GO:0001822)|kidney morphogenesis (GO:0060993)|lipid metabolic process (GO:0006629)|lung development (GO:0030324)|maintenance of organ identity (GO:0048496)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|photoreceptor cell maintenance (GO:0045494)|regulation of cAMP metabolic process (GO:0030814)|regulation of planar cell polarity pathway involved in neural tube closure (GO:2000167)|regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000095)|ureter development (GO:0072189)|Wnt signaling pathway (GO:0016055)	cilium (GO:0005929)|primary cilium (GO:0072372)				NS(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(15)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						AAAAGGGTGACATAAAGGGCAT	0.436																																																	0																																										SO:0001589	frameshift_variant	0			AB056657	CCDS3078.1	3q22	2014-07-18			ENSG00000113971	ENSG00000113971		"""Tetratricopeptide (TTC) repeat domain containing"""	7907	protein-coding gene	gene with protein product	"""nephrocystin-3"", ""Meckel syndrome, type 7"", ""cilia and flagella associated protein 31"""	608002				12872122, 15381417	Standard	NM_153240		Approved	NPH3, KIAA2000, FLJ30691, FLJ36696, MKS7, SLSN3, CFAP31	uc003epe.2	Q7Z494	OTTHUMG00000159713	ENST00000337331.5:c.2143dupT	3.37:g.132415604_132415604dupA	ENSP00000338766:p.Val715fs		Q5JPE3|Q5JPE6|Q68D99|Q6NVH3|Q7Z492|Q7Z493|Q8N9R2|Q8NCM5|Q96N70|Q96NK2	Frame_Shift_Ins	INS	pfam_TPR_1,pfam_TPR-3,superfamily_P-loop_NTPase,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.V714fs	ENST00000337331.5	37	c.2143_2142	CCDS3078.1	3																																																																																			NPHP3	-	superfamily_P-loop_NTPase	ENSG00000113971		0.436	NPHP3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	NPHP3	HGNC	protein_coding	OTTHUMT00000357020.2		0.00	48	0	-	NM_153240		132415604	-1	tier1		no_errors	ENST00000337331	ensembl	human	known	74_37	frame_shift_ins	24.64	52	17	INS	1.000:1.000	A
NR2E1	7101	genome.wustl.edu	37	6	108497939	108497939	+	Silent	SNP	C	C	A			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr6:108497939C>A	ENST00000368986.4	+	4	1200	c.492C>A	c.(490-492)ccC>ccA	p.P164P	NR2E1_ENST00000368983.3_Silent_p.P201P|NR2E1_ENST00000484978.1_3'UTR	NM_003269.3	NP_003260.1	Q9Y466	NR2E1_HUMAN	nuclear receptor subfamily 2, group E, member 1	164					aggressive behavior (GO:0002118)|amygdala development (GO:0021764)|anterior commissure morphogenesis (GO:0021960)|behavioral fear response (GO:0001662)|cell fate commitment (GO:0045165)|cerebral cortex neuron differentiation (GO:0021895)|dentate gyrus development (GO:0021542)|extracellular matrix organization (GO:0030198)|forebrain generation of neurons (GO:0021872)|gene expression (GO:0010467)|glial cell migration (GO:0008347)|layer formation in cerebral cortex (GO:0021819)|long-term synaptic potentiation (GO:0060291)|negative regulation of apoptotic process (GO:0043066)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron differentiation (GO:0045665)|nervous system development (GO:0007399)|olfactory bulb development (GO:0021772)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle (GO:0045787)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of stem cell proliferation (GO:2000648)|regulation of cell migration involved in sprouting angiogenesis (GO:0090049)|regulation of dendrite morphogenesis (GO:0048814)|regulation of timing of neuron differentiation (GO:0060164)|retina development in camera-type eye (GO:0060041)|social behavior (GO:0035176)|somatic stem cell maintenance (GO:0035019)|transcription initiation from RNA polymerase II promoter (GO:0006367)|visual perception (GO:0007601)	nucleoplasm (GO:0005654)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(4)|liver(1)|lung(16)|prostate(1)|skin(3)	30		all_cancers(87;8.13e-05)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00866)|Colorectal(196;0.0637)		BRCA - Breast invasive adenocarcinoma(108;0.013)|Epithelial(106;0.0521)|all cancers(137;0.068)|OV - Ovarian serous cystadenocarcinoma(136;0.0689)		AGCCCACGCCCAAGGTCAGCG	0.662																																																	0													5.0	7.0	7.0					6																	108497939		2123	4191	6314	SO:0001819	synonymous_variant	0			Y13276	CCDS5063.1, CCDS69165.1	6q21	2013-01-16			ENSG00000112333	ENSG00000112333		"""Nuclear hormone receptors"""	7973	protein-coding gene	gene with protein product		603849		TLX		9628820	Standard	NM_003269		Approved	TLL, XTLL	uc003psg.3	Q9Y466	OTTHUMG00000015319	ENST00000368986.4:c.492C>A	6.37:g.108497939C>A			Q6ZMP8	Silent	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,pfscan_Znf_hrmn_rcpt	p.P164	ENST00000368986.4	37	c.492	CCDS5063.1	6																																																																																			NR2E1	-	superfamily_Nucl_hormone_rcpt_ligand-bd	ENSG00000112333		0.662	NR2E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NR2E1	HGNC	protein_coding	OTTHUMT00000041712.2	-	0.00	12	0	C			108497939	+1	tier1	-	no_errors	ENST00000368986	ensembl	human	known	74_37	silent	25.00	18	6	SNP	1.000	A
NSMAF	8439	genome.wustl.edu	37	8	59506838	59506838	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr8:59506838C>A	ENST00000038176.3	-	23	2116	c.1904G>T	c.(1903-1905)gGa>gTa	p.G635V	NSMAF_ENST00000427130.2_Missense_Mutation_p.G666V	NM_003580.3	NP_003571.2	Q92636	FAN_HUMAN	neutral sphingomyelinase (N-SMase) activation associated factor	635					ceramide metabolic process (GO:0006672)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	receptor signaling protein activity (GO:0005057)|sphingomyelin phosphodiesterase activator activity (GO:0016230)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	38		all_lung(136;0.174)|Lung NSC(129;0.2)				GACCGTGATTCCAGTAACTGC	0.403																																																	0													122.0	117.0	118.0					8																	59506838		2203	4300	6503	SO:0001583	missense	0			X96586	CCDS6173.1, CCDS47864.1	8q12-q13	2013-01-10			ENSG00000035681	ENSG00000035681		"""WD repeat domain containing"""	8017	protein-coding gene	gene with protein product		603043				8808629, 10640829	Standard	NM_003580		Approved	FAN	uc011lee.2	Q92636	OTTHUMG00000164352	ENST00000038176.3:c.1904G>T	8.37:g.59506838C>A	ENSP00000038176:p.Gly635Val		B4DFB0|E9PCH0|Q8IW26	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,pfam_GRAM,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,smart_GRAM,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.G666V	ENST00000038176.3	37	c.1997	CCDS6173.1	8	.	.	.	.	.	.	.	.	.	.	C	17.47	3.398905	0.62177	.	.	ENSG00000035681	ENST00000038176;ENST00000427130	T;T	0.30182	1.54;1.54	6.03	6.03	0.97812	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.56659	0.2000	M	0.67953	2.075	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.97110	1.0;0.953	T	0.48854	-0.8998	9	.	.	.	.	19.5478	0.95307	0.0:1.0:0.0:0.0	.	666;635	Q92636-2;Q92636	.;FAN_HUMAN	V	635;666	ENSP00000038176:G635V;ENSP00000411012:G666V	.	G	-	2	0	NSMAF	59669392	1.000000	0.71417	0.610000	0.28997	0.153000	0.21895	6.663000	0.74431	2.868000	0.98415	0.555000	0.69702	GGA	NSMAF	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000035681		0.403	NSMAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSMAF	HGNC	protein_coding	OTTHUMT00000378384.1	-	0.00	78	0	C	NM_003580		59506838	-1	tier1	-	no_errors	ENST00000427130	ensembl	human	known	74_37	missense	17.97	105	23	SNP	1.000	A
NT5C1B	93034	genome.wustl.edu	37	2	18768420	18768420	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr2:18768420G>T	ENST00000359846.2	-	3	217	c.140C>A	c.(139-141)cCg>cAg	p.P47Q	NT5C1B_ENST00000600945.1_Missense_Mutation_p.P47Q|NT5C1B-RDH14_ENST00000532967.1_Missense_Mutation_p.P47Q|NT5C1B_ENST00000304081.4_Intron|NT5C1B_ENST00000460052.1_Intron	NM_001002006.2|NM_001199086.1|NM_001199087.1|NM_001199088.1	NP_001002006.1|NP_001186015.1|NP_001186016.1|NP_001186017.1	Q96P26	5NT1B_HUMAN	5'-nucleotidase, cytosolic IB	47					nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)	5'-nucleotidase activity (GO:0008253)|magnesium ion binding (GO:0000287)|nucleotide binding (GO:0000166)			endometrium(2)|kidney(2)|large_intestine(10)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	29	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.177)	Ovarian(717;0.208)				CGAGTGATTCGGATTGACTGC	0.562																																																	0													52.0	42.0	45.0					2																	18768420		2203	4300	6503	SO:0001583	missense	0			AF356185	CCDS33149.1, CCDS33150.1	2p24.2	2010-08-13			ENSG00000185013	ENSG00000185013	3.1.3.5		17818	protein-coding gene	gene with protein product		610526				11690631	Standard	NM_033253		Approved	AIRP, CN-IB		Q96P26	OTTHUMG00000151765	ENST00000359846.2:c.140C>A	2.37:g.18768420G>T	ENSP00000352904:p.Pro47Gln		B5MCR0|B7ZVX7|Q53RX2|Q8N9W3|Q8NA26|Q96DU5|Q96KE6|Q96M25|Q96SA3	Missense_Mutation	SNP	pfam_5-nucleotidase	p.P47Q	ENST00000359846.2	37	c.140	CCDS33150.1	2	.	.	.	.	.	.	.	.	.	.	G	20.6	4.009517	0.75046	.	.	ENSG00000250741;ENSG00000185013;ENSG00000185013	ENST00000532967;ENST00000359846;ENST00000416783	.	.	.	5.39	5.39	0.77823	.	0.141782	0.32785	N	0.005655	T	0.46580	0.1400	N	0.14661	0.345	0.28901	N	0.893298	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.69654	0.946;0.923;0.965	T	0.46707	-0.9172	9	0.87932	D	0	-16.4599	14.5287	0.67909	0.0:0.0:1.0:0.0	.	47;47;47	B4DZ86;Q96P26;Q96P26-4	.;5NT1B_HUMAN;.	Q	47	.	ENSP00000352904:P47Q	P	-	2	0	NT5C1B-RDH14;NT5C1B	18631901	1.000000	0.71417	0.999000	0.59377	0.985000	0.73830	4.235000	0.58666	2.809000	0.96659	0.467000	0.42956	CCG	NT5C1B	-	NULL	ENSG00000185013		0.562	NT5C1B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NT5C1B	HGNC	protein_coding	OTTHUMT00000323822.1	-	0.00	22	0	G			18768420	-1	tier1	-	no_errors	ENST00000359846	ensembl	human	known	74_37	missense	70.59	5	12	SNP	1.000	T
NXPE2	120406	genome.wustl.edu	37	11	114577254	114577254	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr11:114577254G>A	ENST00000389586.4	+	6	1472	c.1282G>A	c.(1282-1284)Gaa>Aaa	p.E428K	NXPE2_ENST00000375475.5_Intron	NM_182495.5	NP_872301.2	Q96DL1	NXPE2_HUMAN	neurexophilin and PC-esterase domain family, member 2	428						integral component of membrane (GO:0016021)											AGTGAAAGATGAAAACTATAT	0.383																																																	0													77.0	66.0	69.0					11																	114577254		692	1591	2283	SO:0001583	missense	0			AK057953	CCDS44738.1	11q23.2	2012-06-14	2012-06-11	2012-06-11	ENSG00000204361	ENSG00000204361			26331	protein-coding gene	gene with protein product			"""family with sequence similarity 55, member B"""	FAM55B			Standard	NM_182495		Approved	FLJ25224	uc009yyy.2	Q96DL1	OTTHUMG00000168293	ENST00000389586.4:c.1282G>A	11.37:g.114577254G>A	ENSP00000374237:p.Glu428Lys		Q2NKI8	Missense_Mutation	SNP	pfam_NXPH/NXPE,superfamily_Ig_E-set	p.E428K	ENST00000389586.4	37	c.1282	CCDS44738.1	11	.	.	.	.	.	.	.	.	.	.	G	12.86	2.065003	0.36470	.	.	ENSG00000204361	ENST00000389586	T	0.18338	2.22	5.13	4.21	0.49690	.	0.461211	0.19408	N	0.115013	T	0.13586	0.0329	L	0.29908	0.895	0.80722	D	1	B	0.29378	0.243	B	0.28465	0.09	T	0.07328	-1.0778	10	0.28530	T	0.3	.	13.4832	0.61348	0.0:0.1581:0.8418:0.0	.	428	Q96DL1	FA55B_HUMAN	K	428	ENSP00000374237:E428K	ENSP00000374237:E428K	E	+	1	0	FAM55B	114082464	0.296000	0.24398	1.000000	0.80357	0.954000	0.61252	0.654000	0.24918	1.157000	0.42530	-0.314000	0.08810	GAA	NXPE2	-	NULL	ENSG00000204361		0.383	NXPE2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	NXPE2	HGNC	protein_coding	OTTHUMT00000399181.1	-	0.00	88	0	G	NM_182495		114577254	+1	tier1	-	no_errors	ENST00000389586	ensembl	human	known	74_37	missense	45.00	33	27	SNP	1.000	A
OBSCN	84033	genome.wustl.edu	37	1	228560180	228560180	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr1:228560180C>T	ENST00000422127.1	+	94	21745	c.21701C>T	c.(21700-21702)tCg>tTg	p.S7234L	OBSCN_ENST00000570156.2_Missense_Mutation_p.S8191L|OBSCN_ENST00000366707.4_Missense_Mutation_p.S4868L	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	7234					apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GAGTCCCAGTCGGAGGAGCAG	0.692																																																	0													13.0	16.0	15.0					1																	228560180		2078	4201	6279	SO:0001583	missense	0			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.21701C>T	1.37:g.228560180C>T	ENSP00000409493:p.Ser7234Leu		Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_DH-domain,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,pfscan_DH-domain	p.S7234L	ENST00000422127.1	37	c.21701	CCDS58065.1	1	.	.	.	.	.	.	.	.	.	.	C	8.815	0.936135	0.18206	.	.	ENSG00000154358	ENST00000422127;ENST00000366707	T;T	0.66638	-0.22;-0.11	1.05	1.05	0.20165	.	0.809039	0.10715	N	0.642420	T	0.49423	0.1556	L	0.29908	0.895	0.09310	N	1	B	0.14438	0.01	B	0.04013	0.001	T	0.36311	-0.9753	10	0.44086	T	0.13	.	4.8189	0.13381	0.0:0.6012:0.3988:0.0	.	7234	Q5VST9	OBSCN_HUMAN	L	7234;4868	ENSP00000409493:S7234L;ENSP00000355668:S4868L	ENSP00000355668:S4868L	S	+	2	0	OBSCN	226626803	0.010000	0.17322	0.611000	0.29010	0.365000	0.29674	0.720000	0.25896	0.119000	0.18210	0.121000	0.15741	TCG	OBSCN	-	NULL	ENSG00000154358		0.692	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding		-	0.00	64	0	C	NM_052843		228560180	+1	tier1	-	no_errors	ENST00000422127	ensembl	human	known	74_37	missense	38.96	47	30	SNP	0.000	T
OLFM1	10439	genome.wustl.edu	37	9	137968928	137968928	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr9:137968928G>T	ENST00000371799.4	+	2	652	c.367G>T	c.(367-369)Ggc>Tgc	p.G123C	OLFM1_ENST00000252854.4_Intron|OLFM1_ENST00000277415.11_Intron			Q99784	NOE1_HUMAN	olfactomedin 1	0					negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of neuron migration (GO:2001223)|nervous system development (GO:0007399)|protein oligomerization (GO:0051259)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular space (GO:0005615)|synapse (GO:0045202)	beta-amyloid binding (GO:0001540)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(2)	21		Myeloproliferative disorder(178;0.0333)		Epithelial(140;5.49e-08)|OV - Ovarian serous cystadenocarcinoma(145;9.68e-08)|all cancers(34;1.88e-07)		AGGTTTTCTTGGCCCCAGGAA	0.582																																																	0																																										SO:0001583	missense	0			AF035301	CCDS6986.1, CCDS6987.1, CCDS65183.1, CCDS65184.1	9q34.3	2014-01-20			ENSG00000130558	ENSG00000130558			17187	protein-coding gene	gene with protein product	"""pancortin"""	605366				9039501	Standard	NM_006334		Approved	NOE1, OlfA, AMY, NOELIN	uc004cfl.4	Q99784	OTTHUMG00000020897	ENST00000371799.4:c.367G>T	9.37:g.137968928G>T	ENSP00000360864:p.Gly123Cys		Q53XZ8|Q6IMJ4|Q6IMJ5|Q8N8R0|Q969S7|Q99452	Missense_Mutation	SNP	NULL	p.G123C	ENST00000371799.4	37	c.367		9	.	.	.	.	.	.	.	.	.	.	G	8.449	0.852574	0.17106	.	.	ENSG00000130558	ENST00000371799	.	.	.	3.76	1.9	0.25705	.	.	.	.	.	T	0.56587	0.1995	.	.	.	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.39121	-0.9629	7	0.66056	D	0.02	.	5.2518	0.15527	0.1139:0.2093:0.6769:0.0	.	123	Q6IMJ6	.	C	123	.	ENSP00000360864:G123C	G	+	1	0	OLFM1	137108749	0.001000	0.12720	0.001000	0.08648	0.397000	0.30659	0.448000	0.21726	0.551000	0.29008	0.561000	0.74099	GGC	OLFM1	-	NULL	ENSG00000130558		0.582	OLFM1-006	PUTATIVE	basic|exp_conf	protein_coding	OLFM1	HGNC	protein_coding	OTTHUMT00000054976.1	-	0.00	68	0	G	NM_014279		137968928	+1	tier1	-	no_errors	ENST00000371799	ensembl	human	putative	74_37	missense	85.71	11	66	SNP	0.001	T
OR2F2	135948	genome.wustl.edu	37	7	143632543	143632543	+	Missense_Mutation	SNP	A	A	T			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr7:143632543A>T	ENST00000408955.2	+	1	285	c.218A>T	c.(217-219)tAt>tTt	p.Y73F		NM_001004685.1	NP_001004685.1	O95006	OR2F2_HUMAN	olfactory receptor, family 2, subfamily F, member 2	73						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(19)|ovary(3)|skin(2)|stomach(1)|urinary_tract(1)	32	Melanoma(164;0.0903)					GATGTCTCCTATGCCACAAGC	0.517																																																	0													235.0	229.0	231.0					7																	143632543		2203	4300	6503	SO:0001583	missense	0				CCDS43666.1	7q33-q35	2012-08-09			ENSG00000221910	ENSG00000221910		"""GPCR / Class A : Olfactory receptors"""	8247	protein-coding gene	gene with protein product							Standard	NM_001004685		Approved	OR7-1	uc011ktv.2	O95006	OTTHUMG00000157768	ENST00000408955.2:c.218A>T	7.37:g.143632543A>T	ENSP00000386222:p.Tyr73Phe		A4D2G0|Q6IFP8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.Y73F	ENST00000408955.2	37	c.218	CCDS43666.1	7	.	.	.	.	.	.	.	.	.	.	A	7.410	0.634600	0.14322	.	.	ENSG00000221910	ENST00000408955	T	0.00428	7.44	3.49	3.49	0.39957	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47093	D	0.000259	T	0.00496	0.0016	L	0.45744	1.44	0.20074	N	0.999934	D	0.65815	0.995	P	0.58721	0.844	T	0.54159	-0.8335	10	0.11485	T	0.65	-22.7025	6.9379	0.24476	0.7644:0.2356:0.0:0.0	.	73	O95006	OR2F2_HUMAN	F	73	ENSP00000386222:Y73F	ENSP00000386222:Y73F	Y	+	2	0	OR2F2	143263476	0.000000	0.05858	1.000000	0.80357	0.040000	0.13550	0.149000	0.16243	1.578000	0.49821	0.402000	0.26972	TAT	OR2F2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000221910		0.517	OR2F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2F2	HGNC	protein_coding	OTTHUMT00000349570.1	-	0.00	53	0	A			143632543	+1	tier1	-	no_errors	ENST00000408955	ensembl	human	known	74_37	missense	59.46	15	22	SNP	0.710	T
OR2J1	442185	genome.wustl.edu	37	6	29069380	29069380	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr6:29069380G>A	ENST00000377171.3	+	1	995	c.661G>A	c.(661-663)Gcc>Acc	p.A221T				Q9GZK6	OR2J1_HUMAN	olfactory receptor, family 2, subfamily J, member 1 (gene/pseudogene)	221						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|lung(6)	7						TTCCTATGGTGCCATTGCCCG	0.463																																																	0																																										SO:0001583	missense	0					6p22.2-p21.31	2012-08-09	2011-08-30	2004-05-28	ENSG00000204702	ENSG00000204702		"""GPCR / Class A : Olfactory receptors"""	8259	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily J, member 1 pseudogene"", ""olfactory receptor, family 2, subfamily J, member 1"""	OR2J1P			Standard	NG_004683		Approved	OR6-5, hs6M1-4, dJ80I19.2		Q9GZK6	OTTHUMG00000031280	ENST00000377171.3:c.661G>A	6.37:g.29069380G>A	ENSP00000366376:p.Ala221Thr		A2AAS1|B0V1T2|Q9GZK1	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.A221T	ENST00000377171.3	37	c.661		6	.	.	.	.	.	.	.	.	.	.	G	10.52	1.372703	0.24857	.	.	ENSG00000204702	ENST00000377171	T	0.00107	8.72	2.55	2.55	0.30701	.	.	.	.	.	T	0.00039	0.0001	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.00019	-1.2364	6	0.36615	T	0.2	.	5.1989	0.15252	0.0:0.1891:0.441:0.3699	.	.	.	.	T	221	ENSP00000366376:A221T	ENSP00000366376:A221T	A	+	1	0	OR2J1	29177359	0.000000	0.05858	0.445000	0.26908	0.541000	0.35023	-1.187000	0.03067	1.411000	0.46957	0.591000	0.81541	GCC	OR2J1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000204702		0.463	OR2J1-001	KNOWN	basic|appris_principal	protein_coding	OR2J1	HGNC	protein_coding	OTTHUMT00000076612.2	-	0.00	56	0	G	NG_004683		29069380	+1	tier1	-	no_errors	ENST00000377171	ensembl	human	known	74_37	missense	38.16	47	29	SNP	0.003	A
OR4N2	390429	genome.wustl.edu	37	14	20296519	20296519	+	Silent	SNP	G	G	A	rs201350516		TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr14:20296519G>A	ENST00000315947.1	+	1	912	c.912G>A	c.(910-912)aaG>aaA	p.K304K	OR4N2_ENST00000568211.1_3'UTR	NM_001004723.1	NP_001004723.1	Q8NGD1	OR4N2_HUMAN	olfactory receptor, family 4, subfamily N, member 2	304						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|liver(1)|lung(32)|ovary(2)|prostate(1)|skin(2)|stomach(2)	52	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TGTTTAATAAGCACATAGCCT	0.338																																																	0													24.0	26.0	25.0					14																	20296519		2188	4237	6425	SO:0001819	synonymous_variant	0				CCDS32022.1	14q11.2	2013-09-23				ENSG00000176294		"""GPCR / Class A : Olfactory receptors"""	14742	protein-coding gene	gene with protein product							Standard	NM_001004723		Approved		uc010tkv.2	Q8NGD1		ENST00000315947.1:c.912G>A	14.37:g.20296519G>A			Q6IEY9|Q6IFA2	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.K304	ENST00000315947.1	37	c.912	CCDS32022.1	14																																																																																			OR4N2	-	NULL	ENSG00000176294		0.338	OR4N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4N2	HGNC	protein_coding	OTTHUMT00000409821.2		0.00	43	0	G			20296519	+1			no_errors	ENST00000315947	ensembl	human	known	74_37	silent	5.97	63	4	SNP	0.000	A
OR4S2	219431	genome.wustl.edu	37	11	55418727	55418727	+	Frame_Shift_Del	DEL	G	G	-			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr11:55418727delG	ENST00000312422.2	+	1	348	c.348delG	c.(346-348)atgfs	p.M116fs		NM_001004059.2	NP_001004059.2	Q8NH73	OR4S2_HUMAN	olfactory receptor, family 4, subfamily S, member 2	116						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(4)|lung(28)|ovary(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_epithelial(135;0.0748)				TTACTGTAATGGCCTATGATC	0.423																																																	0													208.0	175.0	186.0					11																	55418727		2180	4036	6216	SO:0001589	frameshift_variant	0			BK004390	CCDS31505.1	11q11	2012-08-09	2002-11-13	2002-11-15	ENSG00000174982	ENSG00000174982		"""GPCR / Class A : Olfactory receptors"""	15183	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily S, member 2 pseudogene"""	OR4S2P			Standard	NM_001004059		Approved	OST725	uc001nhs.1	Q8NH73	OTTHUMG00000166799	ENST00000312422.2:c.348delG	11.37:g.55418727delG	ENSP00000310337:p.Met116fs		Q6IF72	Frame_Shift_Del	DEL	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A117fs	ENST00000312422.2	37	c.348	CCDS31505.1	11																																																																																			OR4S2	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000174982		0.423	OR4S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4S2	HGNC	protein_coding	OTTHUMT00000391503.1		0.00	33	0	G	NM_001004059		55418727	+1	tier1		no_errors	ENST00000312422	ensembl	human	known	74_37	frame_shift_del	70.97	9	22	DEL	1.000	-
OR5T1	390155	genome.wustl.edu	37	11	56043399	56043399	+	Silent	SNP	C	C	A			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr11:56043399C>A	ENST00000313033.2	+	1	371	c.285C>A	c.(283-285)gtC>gtA	p.V95V		NM_001004745.1	NP_001004745.1	Q8NG75	OR5T1_HUMAN	olfactory receptor, family 5, subfamily T, member 1	95						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V95V(1)		NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(27)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	43	Esophageal squamous(21;0.00448)					AAATGTTGGTCAATTTCCTGG	0.378																																																	1	Substitution - coding silent(1)	lung(1)											111.0	108.0	109.0					11																	56043399		2201	4296	6497	SO:0001819	synonymous_variant	0			AB065962	CCDS31525.1	11q11	2012-08-09		2004-03-10	ENSG00000181698	ENSG00000181698		"""GPCR / Class A : Olfactory receptors"""	14821	protein-coding gene	gene with protein product				OR5T1P			Standard	NM_001004745		Approved		uc001nio.1	Q8NG75	OTTHUMG00000166853	ENST00000313033.2:c.285C>A	11.37:g.56043399C>A			B2RNM9	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V95	ENST00000313033.2	37	c.285	CCDS31525.1	11																																																																																			OR5T1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000181698		0.378	OR5T1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5T1	HGNC	protein_coding	OTTHUMT00000391600.1	-	0.00	61	0	C	NM_001004745		56043399	+1	tier1	-	no_errors	ENST00000313033	ensembl	human	known	74_37	silent	34.67	49	26	SNP	0.021	A
OR6S1	341799	genome.wustl.edu	37	14	21109503	21109503	+	Silent	SNP	C	C	T			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr14:21109503C>T	ENST00000320704.3	-	1	347	c.348G>A	c.(346-348)ctG>ctA	p.L116L		NM_001001968.1	NP_001001968.1	Q8NH40	OR6S1_HUMAN	olfactory receptor, family 6, subfamily S, member 1	116						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(3)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	23	all_cancers(95;0.00304)		Epithelial(56;1.23e-06)|all cancers(55;1.01e-05)	GBM - Glioblastoma multiforme(265;0.0135)		TGACAGCCAACAGTAAGAACT	0.517																																																	0													86.0	80.0	82.0					14																	21109503		2203	4300	6503	SO:0001819	synonymous_variant	0			AL163636	CCDS32038.1	14q11.2	2013-09-24			ENSG00000181803	ENSG00000181803		"""GPCR / Class A : Olfactory receptors"""	15363	protein-coding gene	gene with protein product							Standard	NM_001001968		Approved	OR6S1Q	uc001vxv.1	Q8NH40	OTTHUMG00000171010	ENST00000320704.3:c.348G>A	14.37:g.21109503C>T			Q6IFJ9	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L116	ENST00000320704.3	37	c.348	CCDS32038.1	14																																																																																			OR6S1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000181803		0.517	OR6S1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	OR6S1	HGNC	protein_coding	OTTHUMT00000411227.1	-	0.00	43	0	C			21109503	-1	tier1	-	no_errors	ENST00000320704	ensembl	human	known	74_37	silent	13.64	38	6	SNP	0.428	T
OVCH1	341350	genome.wustl.edu	37	12	29626014	29626014	+	Silent	SNP	T	T	C			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr12:29626014T>C	ENST00000318184.5	-	15	1622	c.1623A>G	c.(1621-1623)ccA>ccG	p.P541P	OVCH1-AS1_ENST00000551108.1_Intron|OVCH1-AS1_ENST00000549411.1_Intron	NM_183378.2	NP_899234.2	Q7RTY7	OVCH1_HUMAN	ovochymase 1	541						extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(43)|ovary(5)|pancreas(3)|prostate(2)|skin(1)|soft_tissue(1)|stomach(3)	92	Lung NSC(12;1.84e-09)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)					GAGGTAACTTTGGTTCAAATT	0.338																																																	0													105.0	98.0	100.0					12																	29626014		1828	4081	5909	SO:0001819	synonymous_variant	0			BN000128		12p11.23	2012-11-08			ENSG00000187950	ENSG00000187950			23080	protein-coding gene	gene with protein product						12838346	Standard	NM_183378		Approved	OVCH	uc001rix.1	Q7RTY7	OTTHUMG00000167741	ENST00000318184.5:c.1623A>G	12.37:g.29626014T>C				Silent	SNP	pfam_Peptidase_S1,pfam_CUB_dom,pfam_Peptidase_S1A_nudel,superfamily_Trypsin-like_Pept_dom,superfamily_CUB_dom,smart_Peptidase_S1,smart_CUB_dom,pfscan_CUB_dom,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.P541	ENST00000318184.5	37	c.1623		12																																																																																			OVCH1	-	NULL	ENSG00000187950		0.338	OVCH1-001	KNOWN	non_canonical_TEC|basic|appris_principal	protein_coding	OVCH1	HGNC	protein_coding	OTTHUMT00000395997.2	-	0.00	43	0	T	NM_183378		29626014	-1	tier1	-	no_errors	ENST00000318184	ensembl	human	known	74_37	silent	32.00	34	16	SNP	0.000	C
PDE4DIP	9659	genome.wustl.edu	37	1	144916732	144916732	+	Silent	SNP	C	C	T			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr1:144916732C>T	ENST00000369354.3	-	13	1812	c.1623G>A	c.(1621-1623)ctG>ctA	p.L541L	PDE4DIP_ENST00000369349.3_Silent_p.L541L|PDE4DIP_ENST00000479408.2_Silent_p.L328L|PDE4DIP_ENST00000313431.9_Silent_p.L704L|PDE4DIP_ENST00000369356.4_Silent_p.L541L|PDE4DIP_ENST00000313382.9_Silent_p.L607L|PDE4DIP_ENST00000529945.1_Silent_p.L704L|PDE4DIP_ENST00000369359.4_Silent_p.L678L|PDE4DIP_ENST00000530740.1_Silent_p.L678L|PDE4DIP_ENST00000369351.3_Silent_p.L541L			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	541					cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		CTTTGGCCCTCAGGAGACTCT	0.423			T	PDGFRB	MPD																																			Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	0													185.0	208.0	200.0					1																	144916732		2203	4296	6499	SO:0001819	synonymous_variant	0			AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.1623G>A	1.37:g.144916732C>T			A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Silent	SNP	pfam_Spindle_assoc,superfamily_ARM-type_fold	p.L541	ENST00000369354.3	37	c.1623	CCDS30824.1	1																																																																																			PDE4DIP	-	NULL	ENSG00000178104		0.423	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	PDE4DIP	HGNC	protein_coding	OTTHUMT00000038858.2	-	0.00	74	0	C	NM_022359		144916732	-1	tier1	-	no_errors	ENST00000369356	ensembl	human	known	74_37	silent	22.32	87	25	SNP	1.000	T
PDS5B	23047	genome.wustl.edu	37	13	33309450	33309450	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr13:33309450C>T	ENST00000315596.10	+	21	2575	c.2389C>T	c.(2389-2391)Ctt>Ttt	p.L797F		NM_015032.3	NP_055847.1	Q9NTI5	PDS5B_HUMAN	PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae)	797					cell proliferation (GO:0008283)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of cell proliferation (GO:0008285)|regulation of cell proliferation (GO:0042127)	chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(14)|lung(14)|ovary(5)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	62		Lung SC(185;0.0367)		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)		TGTGAAAGATCTTCTCATGAA	0.323																																																	0													124.0	112.0	116.0					13																	33309450		1868	4110	5978	SO:0001583	missense	0			AB023196	CCDS41878.1	13q12.3	2008-02-05	2007-07-18	2007-07-18	ENSG00000083642	ENSG00000083642			20418	protein-coding gene	gene with protein product		605333	"""androgen-induced proliferation inhibitor"""	APRIN		8812419, 10215036	Standard	NM_015032		Approved	AS3, KIAA0979, FLJ23236, CG008	uc010abf.3	Q9NTI5	OTTHUMG00000016704	ENST00000315596.10:c.2389C>T	13.37:g.33309450C>T	ENSP00000313851:p.Leu797Phe		Q5R3S3|Q5W0K8|Q6NSC3|Q8IXT6|Q9H5N8|Q9Y2I5|Q9Y451	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.L797F	ENST00000315596.10	37	c.2389	CCDS41878.1	13	.	.	.	.	.	.	.	.	.	.	C	15.01	2.707676	0.48412	.	.	ENSG00000083642	ENST00000315596;ENST00000421084	.	.	.	5.38	5.38	0.77491	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.59155	0.2173	M	0.72118	2.19	0.58432	D	0.999996	B	0.19706	0.038	B	0.29598	0.104	T	0.60321	-0.7286	9	0.42905	T	0.14	-2.9362	5.6586	0.17656	0.0:0.6641:0.1755:0.1604	.	797	Q9NTI5	PDS5B_HUMAN	F	797	.	ENSP00000313851:L797F	L	+	1	0	PDS5B	32207450	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.911000	0.48774	2.534000	0.85438	0.650000	0.86243	CTT	PDS5B	-	superfamily_ARM-type_fold	ENSG00000083642		0.323	PDS5B-006	KNOWN	basic|appris_principal|CCDS	protein_coding	PDS5B	HGNC	protein_coding	OTTHUMT00000044428.3	-	0.00	63	0	C	NM_015032		33309450	+1	tier1	-	no_errors	ENST00000315596	ensembl	human	known	74_37	missense	41.18	30	21	SNP	1.000	T
PDS5B	23047	genome.wustl.edu	37	13	33309466	33309466	+	Splice_Site	SNP	G	G	T			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr13:33309466G>T	ENST00000315596.10	+	21	2591	c.2405G>T	c.(2404-2406)cGg>cTg	p.R802L		NM_015032.3	NP_055847.1	Q9NTI5	PDS5B_HUMAN	PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae)	802					cell proliferation (GO:0008283)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of cell proliferation (GO:0008285)|regulation of cell proliferation (GO:0042127)	chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(14)|lung(14)|ovary(5)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	62		Lung SC(185;0.0367)		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)		ATGAATGATCGGGTAATTTAT	0.313																																																	0													88.0	78.0	81.0					13																	33309466		1831	4094	5925	SO:0001630	splice_region_variant	0			AB023196	CCDS41878.1	13q12.3	2008-02-05	2007-07-18	2007-07-18	ENSG00000083642	ENSG00000083642			20418	protein-coding gene	gene with protein product		605333	"""androgen-induced proliferation inhibitor"""	APRIN		8812419, 10215036	Standard	NM_015032		Approved	AS3, KIAA0979, FLJ23236, CG008	uc010abf.3	Q9NTI5	OTTHUMG00000016704	ENST00000315596.10:c.2406+1G>T	13.37:g.33309466G>T			Q5R3S3|Q5W0K8|Q6NSC3|Q8IXT6|Q9H5N8|Q9Y2I5|Q9Y451	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.R802L	ENST00000315596.10	37	c.2405	CCDS41878.1	13	.	.	.	.	.	.	.	.	.	.	G	28.4	4.919572	0.92249	.	.	ENSG00000083642	ENST00000315596;ENST00000421084	.	.	.	5.38	5.38	0.77491	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.62551	0.2437	L	0.54323	1.7	0.80722	D	1	P	0.47253	0.892	P	0.47376	0.545	T	0.61623	-0.7025	9	0.38643	T	0.18	-1.8654	19.1293	0.93399	0.0:0.0:1.0:0.0	.	802	Q9NTI5	PDS5B_HUMAN	L	802	.	ENSP00000313851:R802L	R	+	2	0	PDS5B	32207466	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	9.694000	0.98686	2.534000	0.85438	0.650000	0.86243	CGG	PDS5B	-	superfamily_ARM-type_fold	ENSG00000083642		0.313	PDS5B-006	KNOWN	basic|appris_principal|CCDS	protein_coding	PDS5B	HGNC	protein_coding	OTTHUMT00000044428.3		0.00	51	0	G	NM_015032	Missense_Mutation	33309466	+1			no_errors	ENST00000315596	ensembl	human	known	74_37	missense	5.77	49	3	SNP	1.000	T
PIEZO2	63895	genome.wustl.edu	37	18	10794790	10794790	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr18:10794790G>T	ENST00000503781.3	-	13	1737	c.1738C>A	c.(1738-1740)Cca>Aca	p.P580T	PIEZO2_ENST00000302079.6_Missense_Mutation_p.P580T|PIEZO2_ENST00000580640.1_Missense_Mutation_p.P580T	NM_022068.2	NP_071351.2	Q9H5I5	PIEZ2_HUMAN	piezo-type mechanosensitive ion channel component 2	580					cation transport (GO:0006812)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|regulation of membrane potential (GO:0042391)|response to mechanical stimulus (GO:0009612)	integral component of membrane (GO:0016021)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)										AGTTCTCCTGGCTCTTTCTTT	0.318																																																	0													62.0	50.0	54.0					18																	10794790		692	1591	2283	SO:0001583	missense	0			AK027056		18p11.21	2012-11-19	2011-08-31	2011-08-31	ENSG00000154864	ENSG00000154864			26270	protein-coding gene	gene with protein product		613629	"""chromosome 18 open reading frame 30"", ""chromosome 18 open reading frame 58"", ""family with sequence similarity 38, member B"""	FAM38B2, C18orf30, C18orf58, FAM38B		20813920, 21056836, 21299953	Standard	NM_022068		Approved	FLJ23403, FLJ23144, HsT748, HsT771, FLJ34907	uc002kos.2	Q9H5I5	OTTHUMG00000178507	ENST00000503781.3:c.1738C>A	18.37:g.10794790G>T	ENSP00000421377:p.Pro580Thr		B7Z812|M4GPJ9|Q6ZS91|Q8N787|Q8NAR6|Q9H5R4	Missense_Mutation	SNP	NULL	p.P580T	ENST00000503781.3	37	c.1738		18	.	.	.	.	.	.	.	.	.	.	G	11.36	1.614468	0.28712	.	.	ENSG00000154864	ENST00000302079	T	0.74209	-0.82	4.97	4.97	0.65823	.	.	.	.	.	T	0.77280	0.4107	L	0.46157	1.445	0.80722	D	1	.	.	.	.	.	.	T	0.73078	-0.4096	7	0.22706	T	0.39	.	18.2293	0.89929	0.0:0.0:1.0:0.0	.	.	.	.	T	580	ENSP00000303316:P580T	ENSP00000303316:P580T	P	-	1	0	FAM38B	10784790	1.000000	0.71417	0.986000	0.45419	0.955000	0.61496	5.232000	0.65332	2.309000	0.77851	0.557000	0.71058	CCA	PIEZO2	-	NULL	ENSG00000154864		0.318	PIEZO2-003	NOVEL	basic|appris_principal	protein_coding	PIEZO2	HGNC	protein_coding	OTTHUMT00000442385.4	-	0.00	61	0	G	NM_022068		10794790	-1	tier1	-	no_errors	ENST00000582913	ensembl	human	known	74_37	missense	5.71	66	4	SNP	0.975	T
PIGB	9488	genome.wustl.edu	37	15	55621954	55621954	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr15:55621954G>T	ENST00000164305.5	+	5	846	c.555G>T	c.(553-555)tgG>tgT	p.W185C	PIGB_ENST00000539642.1_5'UTR	NM_004855.4	NP_004846.4	Q92521	PIGB_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class B	185					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	mannosyltransferase activity (GO:0000030)			endometrium(3)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)	11				all cancers(107;0.0255)		GGTTCACATGGTATTGCTGTA	0.358																																																	0													202.0	194.0	196.0					15																	55621954		1823	4074	5897	SO:0001583	missense	0			D42138	CCDS61641.1	15q21.3	2013-02-26	2006-06-28		ENSG00000069943	ENSG00000069943		"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"", ""Phosphatidylinositol glycan anchor biosynthesis"""	8959	protein-coding gene	gene with protein product	"""GPI mannosyltransferase 3"", ""dol-P-Man dependent GPI mannosyltransferase"""	604122	"""phosphatidylinositol glycan, class B"""			8861954	Standard	NM_004855		Approved		uc002act.3	Q92521	OTTHUMG00000172654	ENST00000164305.5:c.555G>T	15.37:g.55621954G>T	ENSP00000164305:p.Trp185Cys		Q53FF9|Q8WVN7	Missense_Mutation	SNP	pfam_GPI_mannosylTrfase	p.W185C	ENST00000164305.5	37	c.555		15	.	.	.	.	.	.	.	.	.	.	G	21.9	4.218624	0.79464	.	.	ENSG00000069943	ENST00000164305	T	0.62941	-0.01	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	T	0.68449	0.3002	M	0.71036	2.16	0.80722	D	1	B	0.25521	0.128	B	0.35859	0.212	T	0.66551	-0.5895	10	0.56958	D	0.05	-10.7339	17.1412	0.86754	0.0:0.0:1.0:0.0	.	185	Q92521	PIGB_HUMAN	C	185	ENSP00000164305:W185C	ENSP00000164305:W185C	W	+	3	0	PIGB	53409246	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.872000	0.92352	2.832000	0.97577	0.655000	0.94253	TGG	PIGB	-	pfam_GPI_mannosylTrfase	ENSG00000069943		0.358	PIGB-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	PIGB	HGNC	protein_coding	OTTHUMT00000419687.1	-	0.00	59	0	G	NM_004855		55621954	+1	tier1	-	no_errors	ENST00000164305	ensembl	human	known	74_37	missense	15.13	101	18	SNP	1.000	T
PKP2	5318	genome.wustl.edu	37	12	32977060	32977060	+	Silent	SNP	C	C	T			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr12:32977060C>T	ENST00000070846.6	-	8	1749	c.1725G>A	c.(1723-1725)gcG>gcA	p.A575A	PKP2_ENST00000340811.4_Silent_p.A531A	NM_004572.3	NP_004563.2	Q99959	PKP2_HUMAN	plakophilin 2	575					adherens junction maintenance (GO:0034334)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential (GO:0086001)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cell-cell signaling involved in cardiac conduction (GO:0086019)|desmosome assembly (GO:0002159)|gap junction assembly (GO:0016264)|heart development (GO:0007507)|intermediate filament bundle assembly (GO:0045110)|lipid homeostasis (GO:0055088)|maintenance of organ identity (GO:0048496)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|positive regulation of sodium ion transport (GO:0010765)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of tight junction assembly (GO:2000810)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	adherens junction (GO:0005912)|cell junction (GO:0030054)|cell-cell junction (GO:0005911)|desmosome (GO:0030057)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intermediate filament binding (GO:0019215)|ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|protein kinase C binding (GO:0005080)|sodium channel regulator activity (GO:0017080)			NS(1)|breast(2)|endometrium(1)|kidney(9)|large_intestine(8)|lung(21)|ovary(1)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	50	Lung NSC(5;9.35e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)					ATCTTCTCATCGCTTTTCTCC	0.398																																																	0													152.0	128.0	136.0					12																	32977060		2203	4300	6503	SO:0001819	synonymous_variant	0			X97675	CCDS8731.1, CCDS31771.1	12p11	2014-09-17				ENSG00000057294		"""Armadillo repeat containing"""	9024	protein-coding gene	gene with protein product		602861				8922383	Standard	NM_001005242		Approved		uc001rlj.4	Q99959	OTTHUMG00000169500	ENST00000070846.6:c.1725G>A	12.37:g.32977060C>T			A0AV37|B8QFA1|B8QGS6|B8QGS7|D3DUW9|Q4VC01|Q99960	Silent	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.A575	ENST00000070846.6	37	c.1725	CCDS8731.1	12																																																																																			PKP2	-	superfamily_ARM-type_fold,smart_Armadillo	ENSG00000057294		0.398	PKP2-002	KNOWN	basic|CCDS	protein_coding	PKP2	HGNC	protein_coding	OTTHUMT00000404449.1	-	0.00	54	0	C	NM_004572		32977060	-1	tier1	-	no_errors	ENST00000070846	ensembl	human	known	74_37	silent	13.70	63	10	SNP	0.980	T
PLEKHG3	26030	genome.wustl.edu	37	14	65197822	65197822	+	Missense_Mutation	SNP	A	A	C			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr14:65197822A>C	ENST00000394691.1	+	7	931	c.784A>C	c.(784-786)Atg>Ctg	p.M262L	PLEKHG3_ENST00000247226.7_Missense_Mutation_p.M206L			A1L390	PKHG3_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 3	262	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.						Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(5)|kidney(2)|large_intestine(1)|lung(14)|prostate(2)|skin(3)|urinary_tract(2)	29				all cancers(60;0.00802)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)|BRCA - Breast invasive adenocarcinoma(234;0.0485)		CATTGACACCATGACCTGTGT	0.582																																																	0													155.0	136.0	143.0					14																	65197822		2203	4300	6503	SO:0001583	missense	0			AB011171	CCDS32098.1	14q23.3	2013-01-10	2004-12-01	2004-12-01	ENSG00000126822	ENSG00000126822		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	20364	protein-coding gene	gene with protein product			"""KIAA0599"""	KIAA0599			Standard	XM_005267511		Approved	ARHGEF43	uc001xhp.2	A1L390	OTTHUMG00000029671	ENST00000394691.1:c.784A>C	14.37:g.65197822A>C	ENSP00000378183:p.Met262Leu		A1L389|B5MEC9|O60339|Q6GMS3|Q6P4B1|Q7L3S3|Q86SW7|Q8TEF5|Q96EW6|Q9BT82	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.M262L	ENST00000394691.1	37	c.784		14	.	.	.	.	.	.	.	.	.	.	A	25.6	4.656489	0.88154	.	.	ENSG00000126822	ENST00000247226;ENST00000394691	T;T	0.62498	0.02;0.02	4.39	4.39	0.52855	Dbl homology (DH) domain (5);	0.000000	0.85682	D	0.000000	T	0.79969	0.4538	M	0.84846	2.72	0.80722	D	1	D;D	0.67145	0.996;0.995	D;D	0.87578	0.998;0.995	T	0.83235	-0.0061	10	0.66056	D	0.02	.	12.9116	0.58182	1.0:0.0:0.0:0.0	.	262;206	A1L390;A1L390-3	PKHG3_HUMAN;.	L	206;262	ENSP00000247226:M206L;ENSP00000378183:M262L	ENSP00000247226:M206L	M	+	1	0	PLEKHG3	64267575	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.406000	0.80017	1.743000	0.51761	0.459000	0.35465	ATG	PLEKHG3	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain	ENSG00000126822		0.582	PLEKHG3-010	KNOWN	basic|appris_principal	protein_coding	PLEKHG3	HGNC	protein_coding	OTTHUMT00000412028.1	-	0.00	36	0	A	NM_015549		65197822	+1	tier1	-	no_errors	ENST00000394691	ensembl	human	known	74_37	missense	39.62	32	21	SNP	1.000	C
PLEKHG6	55200	genome.wustl.edu	37	12	6436429	6436429	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr12:6436429G>T	ENST00000396988.3	+	15	1910	c.1680G>T	c.(1678-1680)gaG>gaT	p.E560D	PLEKHG6_ENST00000449001.2_Missense_Mutation_p.E528D|PLEKHG6_ENST00000011684.7_Missense_Mutation_p.E560D|PLEKHG6_ENST00000304581.8_Missense_Mutation_p.E90D	NM_001144856.1	NP_001138328.1	Q3KR16	PKHG6_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 6	560						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|skin(4)	23						GGACTCCTGAGTTCTCGACCA	0.512											OREG0021622	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													108.0	103.0	105.0					12																	6436429		2203	4300	6503	SO:0001583	missense	0			AK001527	CCDS8541.1, CCDS44808.1	12p13.31	2013-01-11			ENSG00000008323	ENSG00000008323		"""Pleckstrin homology (PH) domain containing"""	25562	protein-coding gene	gene with protein product		611743					Standard	NM_018173		Approved	FLJ10665	uc001qnr.3	Q3KR16	OTTHUMG00000168266	ENST00000396988.3:c.1680G>T	12.37:g.6436429G>T	ENSP00000380185:p.Glu560Asp	634	Q3SWR1|Q8N1P1|Q8WYY1|Q9H8F4|Q9NVK9	Missense_Mutation	SNP	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.E560D	ENST00000396988.3	37	c.1680	CCDS8541.1	12	.	.	.	.	.	.	.	.	.	.	G	10.87	1.472140	0.26423	.	.	ENSG00000008323	ENST00000011684;ENST00000396988;ENST00000449001;ENST00000304581	T;T;T	0.65364	-0.04;-0.04;-0.15	5.45	3.63	0.41609	.	0.345323	0.24915	N	0.034586	T	0.46405	0.1391	L	0.34521	1.04	0.09310	N	1	P;P	0.37330	0.59;0.455	B;B	0.40285	0.325;0.113	T	0.36962	-0.9726	10	0.06236	T	0.91	-8.0454	8.4185	0.32685	0.1805:0.0:0.8195:0.0	.	528;560	Q3KR16-2;Q3KR16	.;PKHG6_HUMAN	D	560;560;528;90	ENSP00000011684:E560D;ENSP00000380185:E560D;ENSP00000393194:E528D	ENSP00000011684:E560D	E	+	3	2	PLEKHG6	6306690	0.352000	0.24895	0.009000	0.14445	0.001000	0.01503	1.494000	0.35616	0.670000	0.31165	-0.137000	0.14449	GAG	PLEKHG6	-	NULL	ENSG00000008323		0.512	PLEKHG6-003	NOVEL	basic|appris_principal|CCDS	protein_coding	PLEKHG6	HGNC	protein_coding	OTTHUMT00000399031.1	-	0.00	46	0	G	NM_018173		6436429	+1	tier1	-	no_errors	ENST00000011684	ensembl	human	known	74_37	missense	7.55	49	4	SNP	0.120	T
POLA2	23649	genome.wustl.edu	37	11	65063037	65063037	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr11:65063037G>T	ENST00000265465.3	+	16	2018	c.1487G>T	c.(1486-1488)aGc>aTc	p.S496I	POLA2_ENST00000534785.1_3'UTR|POLA2_ENST00000541089.1_Missense_Mutation_p.S288I	NM_002689.2	NP_002680.2	Q14181	DPOA2_HUMAN	polymerase (DNA directed), alpha 2, accessory subunit	496					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|protein import into nucleus, translocation (GO:0000060)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	alpha DNA polymerase:primase complex (GO:0005658)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|protein heterodimerization activity (GO:0046982)			endometrium(1)|large_intestine(2)|lung(7)|urinary_tract(1)	11					Dacarbazine(DB00851)	GACAGATTCAGCCGAATACTC	0.498																																																	0													86.0	82.0	83.0					11																	65063037		2201	4297	6498	SO:0001583	missense	0			BC002990	CCDS8098.1	11q13	2012-05-18	2012-05-18		ENSG00000014138	ENSG00000014138		"""DNA polymerases"""	30073	protein-coding gene	gene with protein product	"""DNA polymerase alpha subunit B"", ""DNA polymerase alpha 70 kDa subunit"""		"""polymerase (DNA directed), alpha 2 (70kD subunit)"""			8223465, 11433027	Standard	NM_002689		Approved	FLJ21662	uc001odj.3	Q14181	OTTHUMG00000165951	ENST00000265465.3:c.1487G>T	11.37:g.65063037G>T	ENSP00000265465:p.Ser496Ile		B4DNB4|Q9BPV3	Missense_Mutation	SNP	pfam_Pol_alpha_B_N,pfam_DNA_pol_alpha/epsilon_bsu,pirsf_DNA_pol_alpha_bsu	p.S496I	ENST00000265465.3	37	c.1487	CCDS8098.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.5|22.5	4.296205|4.296205	0.81025|0.81025	.|.	.|.	ENSG00000014138|ENSG00000014138	ENST00000525924|ENST00000265465;ENST00000541089	.|T;T	.|0.32023	.|1.47;1.47	5.06|5.06	5.06|5.06	0.68205|0.68205	.|DNA polymerase alpha/epsilon, subunit B (1);	.|0.141122	.|0.64402	.|D	.|0.000005	T|T	0.58221|0.58221	0.2107|0.2107	M|M	0.85777|0.85777	2.775|2.775	0.58432|0.58432	D|D	0.999992|0.999992	.|D;D	.|0.67145	.|0.991;0.996	.|P;D	.|0.67382	.|0.859;0.951	T|T	0.61936|0.61936	-0.6960|-0.6960	5|10	.|0.41790	.|T	.|0.15	-25.2523|-25.2523	15.9246|15.9246	0.79606|0.79606	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|288;496	.|B4DNB4;Q14181	.|.;DPOA2_HUMAN	S|I	166|496;288	.|ENSP00000265465:S496I;ENSP00000443222:S288I	.|ENSP00000265465:S496I	A|S	+|+	1|2	0|0	POLA2|POLA2	64819613|64819613	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	4.178000|4.178000	0.58284|0.58284	2.359000|2.359000	0.80004|0.80004	0.462000|0.462000	0.41574|0.41574	GCC|AGC	POLA2	-	pfam_DNA_pol_alpha/epsilon_bsu,pirsf_DNA_pol_alpha_bsu	ENSG00000014138		0.498	POLA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLA2	HGNC	protein_coding	OTTHUMT00000387223.1	-	0.00	27	0	G	NM_002689		65063037	+1	tier1	-	no_errors	ENST00000265465	ensembl	human	known	74_37	missense	11.43	31	4	SNP	1.000	T
PPHLN1	51535	genome.wustl.edu	37	12	42778782	42778782	+	Silent	SNP	A	A	G			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr12:42778782A>G	ENST00000395568.2	+	6	636	c.552A>G	c.(550-552)gaA>gaG	p.E184E	PPHLN1_ENST00000449194.2_Intron|PPHLN1_ENST00000395580.3_Silent_p.E191E|PPHLN1_ENST00000432191.2_Silent_p.E129E|PPHLN1_ENST00000358314.7_Silent_p.E184E|PPHLN1_ENST00000549190.1_Silent_p.E202E|PPHLN1_ENST00000552761.1_Silent_p.E136E|PPHLN1_ENST00000317560.9_Intron|PPHLN1_ENST00000256678.8_Intron|PPHLN1_ENST00000337898.6_Silent_p.E129E	NM_016488.6	NP_057572.5	Q8NEY8	PPHLN_HUMAN	periphilin 1	184	Ser-rich.				keratinization (GO:0031424)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(5)|kidney(1)|large_intestine(4)|lung(2)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	16	all_cancers(12;0.00049)|Breast(8;0.165)	Lung NSC(34;0.123)		GBM - Glioblastoma multiforme(48;0.0875)		GGCAGAATGAAGGAAATCCTG	0.502																																																	0													125.0	110.0	115.0					12																	42778782		2203	4300	6503	SO:0001819	synonymous_variant	0			AY157850	CCDS8741.1, CCDS31777.1, CCDS41773.1, CCDS44860.1, CCDS44861.1, CCDS55817.1	12q12	2006-10-24				ENSG00000134283			19369	protein-coding gene	gene with protein product		608150					Standard	NM_016488		Approved		uc001rng.1	Q8NEY8		ENST00000395568.2:c.552A>G	12.37:g.42778782A>G			E9PAX8|Q86YT2|Q8IXN3|Q8TB09|Q96NB9|Q9NXL4|Q9P0P6|Q9P0R9	Silent	SNP	NULL	p.E184	ENST00000395568.2	37	c.552	CCDS31777.1	12																																																																																			PPHLN1	-	NULL	ENSG00000134283		0.502	PPHLN1-010	KNOWN	basic|CCDS	protein_coding	PPHLN1	HGNC	protein_coding	OTTHUMT00000404047.1	-	0.00	83	0	A	NM_201515		42778782	+1	tier1	-	no_errors	ENST00000395568	ensembl	human	known	74_37	silent	24.00	76	24	SNP	1.000	G
PRTN3	5657	genome.wustl.edu	37	19	846367	846367	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr19:846367G>A	ENST00000234347.5	+	4	636	c.590G>A	c.(589-591)gGc>gAc	p.G197D	PRTN3_ENST00000544537.2_Missense_Mutation_p.G156D	NM_002777.3	NP_002768.3	P24158	PRTN3_HUMAN	proteinase 3	197	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				collagen catabolic process (GO:0030574)|mature dendritic cell differentiation (GO:0097029)|negative regulation of phagocytosis (GO:0050765)|positive regulation of cell proliferation (GO:0008284)	cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			lung(1)|ovary(2)|urinary_tract(1)	4		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGCAAGGCCGGCATCTGCTTC	0.652																																																	0													51.0	33.0	39.0					19																	846367		2177	4271	6448	SO:0001583	missense	0				CCDS32860.1	19p13.3	2008-07-31	2008-07-31			ENSG00000196415			9495	protein-coding gene	gene with protein product	"""myeloblastin"", ""serine proteinase, neutrophil"", ""Wegener granulomatosis autoantigen"""	177020				2258701	Standard	NM_002777		Approved	PR-3, ACPA, C-ANCA, AGP7, MBT, P29	uc002lqa.1	P24158		ENST00000234347.5:c.590G>A	19.37:g.846367G>A	ENSP00000234347:p.Gly197Asp		P15637|P18078|Q4VB08|Q4VB09|Q6LBM7|Q6LBN2|Q9UD25|Q9UQD8	Missense_Mutation	SNP	pfam_Peptidase_S1,pfam_Peptidase_S1A_nudel,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.G197D	ENST00000234347.5	37	c.590	CCDS32860.1	19	.	.	.	.	.	.	.	.	.	.	G	14.54	2.564643	0.45694	.	.	ENSG00000196415	ENST00000234347;ENST00000544537	T	0.52526	0.66	3.0	1.91	0.25777	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	T	0.37812	0.1017	N	0.03071	-0.42	0.27086	N	0.962964	D	0.89917	1.0	D	0.80764	0.994	T	0.27054	-1.0085	9	0.20046	T	0.44	.	7.888	0.29661	0.0:0.2572:0.7428:0.0	.	197	P24158	PRTN3_HUMAN	D	197;156	ENSP00000234347:G197D	ENSP00000234347:G197D	G	+	2	0	PRTN3	797367	1.000000	0.71417	0.452000	0.26994	0.008000	0.06430	4.007000	0.57093	0.568000	0.29311	0.195000	0.17529	GGC	PRTN3	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	ENSG00000196415		0.652	PRTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRTN3	HGNC	protein_coding	OTTHUMT00000457888.2	-	0.00	51	0	G	NM_002777		846367	+1	tier1	-	no_errors	ENST00000234347	ensembl	human	known	74_37	missense	46.67	24	21	SNP	0.580	A
PPP2R1A	5518	genome.wustl.edu	37	19	52724234	52724234	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr19:52724234T>C	ENST00000322088.6	+	12	1424	c.1366T>C	c.(1366-1368)Tat>Cat	p.Y456H	CTD-2525I3.3_ENST00000593857.1_RNA|PPP2R1A_ENST00000462990.1_Missense_Mutation_p.Y277H|PPP2R1A_ENST00000444322.2_Missense_Mutation_p.Y401H	NM_014225.5	NP_055040.2	P30153	2AAA_HUMAN	protein phosphatase 2, regulatory subunit A, alpha	456	PP2A subunit C binding.				apoptotic process (GO:0006915)|ceramide metabolic process (GO:0006672)|chromosome segregation (GO:0007059)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|inactivation of MAPK activity (GO:0000188)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope reassembly (GO:0007084)|mRNA metabolic process (GO:0016071)|negative regulation of cell growth (GO:0030308)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine dephosphorylation (GO:0070262)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|protein complex assembly (GO:0006461)|protein dephosphorylation (GO:0006470)|regulation of cell adhesion (GO:0030155)|regulation of cell differentiation (GO:0045595)|regulation of DNA replication (GO:0006275)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|response to organic substance (GO:0010033)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|second-messenger-mediated signaling (GO:0019932)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	antigen binding (GO:0003823)|protein heterodimerization activity (GO:0046982)|protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine phosphatase activity (GO:0004722)			NS(1)|breast(4)|cervix(2)|endometrium(62)|kidney(1)|large_intestine(7)|lung(21)|ovary(32)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	135				GBM - Glioblastoma multiforme(134;0.00456)|OV - Ovarian serous cystadenocarcinoma(262;0.015)		TTCTGCAGTATATGCCATCCG	0.532			Mis		clear cell ovarian carcinoma																																			Dom?	yes		19	19q13.41	5518	"""protein phosphatase 2, regulatory subunit A, alpha"""		E	0													88.0	83.0	85.0					19																	52724234		2203	4300	6503	SO:0001583	missense	0				CCDS12849.1	19q13	2010-06-18	2010-04-14		ENSG00000105568	ENSG00000105568	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9302	protein-coding gene	gene with protein product	"""protein phosphatase 2A, regulatory subunit A, alpha isoform"", ""protein phosphatase 2, 65kDa regulatory subunit A"""	605983	"""protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), alpha isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit A, alpha isoform"""				Standard	NR_033500		Approved	PR65A, PP2A-Aalpha	uc002pyp.3	P30153	OTTHUMG00000137367	ENST00000322088.6:c.1366T>C	19.37:g.52724234T>C	ENSP00000324804:p.Tyr456His		Q13773|Q6ICQ3|Q96DH3	Missense_Mutation	SNP	pfam_HEAT,superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.Y456H	ENST00000322088.6	37	c.1366	CCDS12849.1	19	.	.	.	.	.	.	.	.	.	.	T	21.2	4.106363	0.77096	.	.	ENSG00000105568	ENST00000423369;ENST00000391791;ENST00000322088;ENST00000444322	T;T	0.16597	2.33;2.33	4.5	4.5	0.54988	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.51477	D	0.000091	T	0.34978	0.0916	M	0.84219	2.685	0.58432	D	0.999999	P;B	0.42375	0.778;0.029	P;B	0.50659	0.647;0.091	T	0.17930	-1.0353	10	0.54805	T	0.06	-13.6035	12.1013	0.53785	0.0:0.0:0.0:1.0	.	401;456	F5H3X9;P30153	.;2AAA_HUMAN	H	446;376;456;401	ENSP00000324804:Y456H;ENSP00000415067:Y401H	ENSP00000324804:Y456H	Y	+	1	0	PPP2R1A	57416046	1.000000	0.71417	0.996000	0.52242	0.799000	0.45148	7.226000	0.78060	2.026000	0.59711	0.533000	0.62120	TAT	PPP2R1A	-	superfamily_ARM-type_fold	ENSG00000105568		0.532	PPP2R1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP2R1A	HGNC	protein_coding	OTTHUMT00000267967.2	-	0.00	34	0	T	NM_014225		52724234	+1	tier1	-	no_errors	ENST00000322088	ensembl	human	known	74_37	missense	40.54	22	15	SNP	1.000	C
PYGB	5834	genome.wustl.edu	37	20	25277028	25277028	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr20:25277028A>G	ENST00000216962.4	+	20	2512	c.2402A>G	c.(2401-2403)aAg>aGg	p.K801R	PYGB_ENST00000471359.1_3'UTR|ABHD12_ENST00000376542.3_Intron	NM_002862.3	NP_002853.2	P11216	PYGB_HUMAN	phosphorylase, glycogen; brain	801					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	glycogen phosphorylase activity (GO:0008184)|pyridoxal phosphate binding (GO:0030170)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	31						TGGACCAAGAAGGTCATCAGG	0.557																																																	0													95.0	78.0	83.0					20																	25277028		2203	4300	6503	SO:0001583	missense	0				CCDS13171.1	20p11.21	2013-03-01			ENSG00000100994	ENSG00000100994	2.4.1.1	"""Glycogen phosphorylases"""	9723	protein-coding gene	gene with protein product	"""glycogen phosphorylase, brain form"""	138550					Standard	NM_002862		Approved		uc002wup.3	P11216	OTTHUMG00000032117	ENST00000216962.4:c.2402A>G	20.37:g.25277028A>G	ENSP00000216962:p.Lys801Arg		Q96AK1|Q9NPX8	Missense_Mutation	SNP	pfam_Glyco_trans_35,pirsf_Glyco_trans_35,tigrfam_Glycg_phsphrylas	p.K801R	ENST00000216962.4	37	c.2402	CCDS13171.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	13.64|13.64	2.298336|2.298336	0.40694|0.40694	.|.	.|.	ENSG00000100994|ENSG00000100994	ENST00000216962|ENST00000428458	D|.	0.93307|.	-3.2|.	4.66|4.66	3.54|3.54	0.40534|0.40534	.|.	0.111267|.	0.64402|.	D|.	0.000012|.	T|T	0.58807|0.58807	0.2148|0.2148	L|L	0.52364|0.52364	1.645|1.645	0.80722|0.80722	D|D	1|1	B|.	0.12630|.	0.006|.	B|.	0.15052|.	0.012|.	T|T	0.54377|0.54377	-0.8303|-0.8303	10|5	0.29301|.	T|.	0.29|.	-45.2731|-45.2731	10.5922|10.5922	0.45316|0.45316	0.8555:0.0:0.0:0.1445|0.8555:0.0:0.0:0.1445	.|.	801|.	P11216|.	PYGB_HUMAN|.	R|G	801|220	ENSP00000216962:K801R|.	ENSP00000216962:K801R|.	K|R	+|+	2|1	0|2	PYGB|PYGB	25225028|25225028	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	4.477000|4.477000	0.60223|0.60223	0.892000|0.892000	0.36259|0.36259	0.459000|0.459000	0.35465|0.35465	AAG|AGG	PYGB	-	pfam_Glyco_trans_35,pirsf_Glyco_trans_35,tigrfam_Glycg_phsphrylas	ENSG00000100994		0.557	PYGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PYGB	HGNC	protein_coding	OTTHUMT00000078415.2	-	0.00	67	0	A	NM_002862		25277028	+1	tier1	-	no_errors	ENST00000216962	ensembl	human	known	74_37	missense	22.83	71	21	SNP	1.000	G
PYGO1	26108	genome.wustl.edu	37	15	55839259	55839259	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr15:55839259G>T	ENST00000302000.6	-	3	316	c.222C>A	c.(220-222)gaC>gaA	p.D74E	PYGO1_ENST00000563719.1_Missense_Mutation_p.D74E	NM_015617.1	NP_056432.1	Q9Y3Y4	PYGO1_HUMAN	pygopus family PHD finger 1	74	Pro-rich.				hematopoietic progenitor cell differentiation (GO:0002244)|kidney development (GO:0001822)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|protein localization to nucleus (GO:0034504)|spermatid nucleus differentiation (GO:0007289)|Wnt signaling pathway (GO:0016055)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			endometrium(4)|kidney(2)|large_intestine(6)|lung(6)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	27				all cancers(107;0.0131)|GBM - Glioblastoma multiforme(80;0.18)		TATTATAGTTGTCATCAAATG	0.433																																																	0													67.0	65.0	66.0					15																	55839259		2193	4292	6485	SO:0001583	missense	0			AF457207	CCDS10155.1	15q21.1	2013-10-09	2013-10-09		ENSG00000171016	ENSG00000171016		"""Zinc fingers, PHD-type"""	30256	protein-coding gene	gene with protein product		606902	"""pygopus homolog 1 (Drosophila)"""			11988739	Standard	NM_015617		Approved		uc002adf.1	Q9Y3Y4	OTTHUMG00000132009	ENST00000302000.6:c.222C>A	15.37:g.55839259G>T	ENSP00000302327:p.Asp74Glu		A7Y2D6	Missense_Mutation	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.D74E	ENST00000302000.6	37	c.222	CCDS10155.1	15	.	.	.	.	.	.	.	.	.	.	G	16.52	3.144954	0.57044	.	.	ENSG00000171016	ENST00000302000;ENST00000401688	T	0.68479	-0.33	5.23	4.3	0.51218	.	0.000000	0.85682	D	0.000000	T	0.71592	0.3358	L	0.36672	1.1	0.43122	D	0.994846	D;D	0.76494	0.999;0.999	D;D	0.76071	0.987;0.987	T	0.72994	-0.4122	10	0.59425	D	0.04	-16.2368	9.8252	0.40908	0.1583:0.0:0.8417:0.0	.	74;74	A7Y2D6;Q9Y3Y4	.;PYGO1_HUMAN	E	74	ENSP00000302327:D74E	ENSP00000302327:D74E	D	-	3	2	PYGO1	53626551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.084000	0.50143	1.313000	0.45069	0.585000	0.79938	GAC	PYGO1	-	NULL	ENSG00000171016		0.433	PYGO1-001	KNOWN	basic|CCDS	protein_coding	PYGO1	HGNC	protein_coding	OTTHUMT00000254977.2		0.00	49	0	G	NM_015617		55839259	-1			no_errors	ENST00000302000	ensembl	human	known	74_37	missense	5.97	63	4	SNP	1.000	T
RAP1GAP2	23108	genome.wustl.edu	37	17	2901588	2901588	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr17:2901588C>A	ENST00000254695.8	+	14	1208	c.1118C>A	c.(1117-1119)cCa>cAa	p.P373Q	RAP1GAP2_ENST00000540393.2_Missense_Mutation_p.P354Q|RAP1GAP2_ENST00000366401.4_Missense_Mutation_p.P358Q|RAP1GAP2_ENST00000542807.1_Missense_Mutation_p.P373Q	NM_015085.4	NP_055900.4	Q684P5	RPGP2_HUMAN	RAP1 GTPase activating protein 2	373	Rap-GAP. {ECO:0000255|PROSITE- ProRule:PRU00165}.				negative regulation of neuron projection development (GO:0010977)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|neuron projection (GO:0043005)|nuclear membrane (GO:0031965)	Rap GTPase activator activity (GO:0046582)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	11						CCGTTTGTCCCAGACATGATA	0.473																																																	0													135.0	134.0	134.0					17																	2901588		2014	4180	6194	SO:0001583	missense	0			AB028962	CCDS45573.1, CCDS45574.1	17p13.3	2009-09-14	2009-09-14	2009-09-14		ENSG00000132359			29176	protein-coding gene	gene with protein product			"""GTPase activating RANGAP domain-like 4"", ""GTPase activating Rap/RanGAP domain-like 4"""	GARNL4		15632203	Standard	NM_015085		Approved	KIAA1039	uc010ckd.3	Q684P5		ENST00000254695.8:c.1118C>A	17.37:g.2901588C>A	ENSP00000254695:p.Pro373Gln		B2RTY5|Q684P4|Q6AI00|Q6ZVF0|Q9UPW2	Missense_Mutation	SNP	pfam_Rap_GAP_dom,pfscan_Rap_GAP_dom	p.P373Q	ENST00000254695.8	37	c.1118	CCDS45573.1	17	.	.	.	.	.	.	.	.	.	.	C	29.1	4.981457	0.93044	.	.	ENSG00000132359	ENST00000254695;ENST00000366401;ENST00000540393;ENST00000542807	D;D;D;D	0.94650	-3.48;-3.48;-3.48;-3.48	5.65	5.65	0.86999	Rap/ran-GAP (2);	0.102198	0.64402	D	0.000002	D	0.98005	0.9343	M	0.92412	3.305	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98753	1.0721	10	0.87932	D	0	-9.0925	18.7095	0.91651	0.0:1.0:0.0:0.0	.	358;373	Q684P5-2;Q684P5	.;RPGP2_HUMAN	Q	373;358;354;373	ENSP00000254695:P373Q;ENSP00000389824:P358Q;ENSP00000439688:P354Q;ENSP00000444890:P373Q	ENSP00000254695:P373Q	P	+	2	0	RAP1GAP2	2848338	1.000000	0.71417	1.000000	0.80357	0.853000	0.48598	7.818000	0.86416	2.666000	0.90696	0.555000	0.69702	CCA	RAP1GAP2	-	pfam_Rap_GAP_dom,pfscan_Rap_GAP_dom	ENSG00000132359		0.473	RAP1GAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RAP1GAP2	HGNC	protein_coding	OTTHUMT00000438208.2	-	0.00	44	0	C			2901588	+1	tier1	-	no_errors	ENST00000254695	ensembl	human	known	74_37	missense	25.00	39	13	SNP	1.000	A
RAPSN	5913	genome.wustl.edu	37	11	47460440	47460440	+	Missense_Mutation	SNP	G	G	T	rs549232026		TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr11:47460440G>T	ENST00000298854.2	-	7	1222	c.1009C>A	c.(1009-1011)Cgc>Agc	p.R337S	RAPSN_ENST00000529341.1_Missense_Mutation_p.R278S|RAPSN_ENST00000528356.1_Intron|RAPSN_ENST00000352508.3_Missense_Mutation_p.R278S|RNU6-1302P_ENST00000516518.1_RNA|RAPSN_ENST00000524487.1_Missense_Mutation_p.P286Q	NM_005055.4	NP_005046.2	Q13702	RAPSN_HUMAN	receptor-associated protein of the synapse	337					positive regulation of neuron apoptotic process (GO:0043525)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|neuromuscular junction (GO:0031594)|postsynaptic membrane (GO:0045211)	acetylcholine receptor binding (GO:0033130)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(6)|ovary(2)	12						CCTTTGCTGCGGTAAATGCTC	0.632													G|||	1	0.000199681	0.0	0.0	5008	,	,		16324	0.0		0.0	False		,,,				2504	0.001																0													26.0	23.0	24.0					11																	47460440		2189	4280	6469	SO:0001583	missense	0				CCDS7936.1, CCDS7937.1	11p11.2	2009-04-28	2007-02-23		ENSG00000165917	ENSG00000165917		"""RING-type (C3HC4) zinc fingers"""	9863	protein-coding gene	gene with protein product	"""rapsyn"""	601592	"""receptor-associated protein of the synapse, 43kD"""			8812503	Standard	NM_005055		Approved	RNF205, CMS1D, CMS1E	uc001nfi.2	Q13702	OTTHUMG00000166891	ENST00000298854.2:c.1009C>A	11.37:g.47460440G>T	ENSP00000298854:p.Arg337Ser		Q8TDF3|Q9BTD9	Missense_Mutation	SNP	pfam_Rapsyn_myristoylation/link_N,smart_TPR_repeat,smart_Znf_RING,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Znf_RING,prints_Postsynaptic	p.R337S	ENST00000298854.2	37	c.1009	CCDS7936.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.6|22.6	4.312401|4.312401	0.81358|0.81358	.|.	.|.	ENSG00000165917|ENSG00000165917	ENST00000524487|ENST00000298854;ENST00000352508;ENST00000529341	D|D;D;D	0.92911|0.94000	-3.13|-3.29;-3.24;-3.33	5.88|5.88	5.88|5.88	0.94601|0.94601	.|Tetratricopeptide-like helical (1);	.|0.214240	.|0.50627	.|D	.|0.000102	D|D	0.95500|0.95500	0.8538|0.8538	M|M	0.72118|0.72118	2.19|2.19	0.45747|0.45747	D|D	0.99864|0.99864	.|D;P;B	.|0.71674	.|0.998;0.759;0.015	.|D;B;B	.|0.65573	.|0.936;0.271;0.01	D|D	0.91715|0.91715	0.5384|0.5384	7|10	0.27785|0.05351	T|T	0.31|0.99	-35.4887|-35.4887	20.2884|20.2884	0.98536|0.98536	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|278;278;337	.|E9PK11;Q13702-2;Q13702	.|.;.;RAPSN_HUMAN	Q|S	286|337;278;278	ENSP00000435551:P286Q|ENSP00000298854:R337S;ENSP00000298853:R278S;ENSP00000431732:R278S	ENSP00000435551:P286Q|ENSP00000298854:R337S	P|R	-|-	2|1	0|0	RAPSN|RAPSN	47417016|47417016	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	9.400000|9.400000	0.97290|0.97290	2.791000|2.791000	0.96007|0.96007	0.650000|0.650000	0.86243|0.86243	CCG|CGC	RAPSN	-	NULL	ENSG00000165917		0.632	RAPSN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAPSN	HGNC	protein_coding	OTTHUMT00000391726.1	-	0.00	43	0	G			47460440	-1	tier1	-	no_errors	ENST00000298854	ensembl	human	known	74_37	missense	47.17	28	25	SNP	1.000	T
RICTOR	253260	genome.wustl.edu	37	5	38945607	38945607	+	Missense_Mutation	SNP	A	A	T			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr5:38945607A>T	ENST00000357387.3	-	34	4649	c.4619T>A	c.(4618-4620)aTa>aAa	p.I1540K	RICTOR_ENST00000296782.5_Missense_Mutation_p.I1564K	NM_152756.3	NP_689969.2			RPTOR independent companion of MTOR, complex 2											NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|prostate(3)|skin(5)	75	all_lung(31;0.000396)					ATGACTACATATTGCACTCAG	0.393																																																	0													120.0	110.0	114.0					5																	38945607		2203	4300	6503	SO:0001583	missense	0				CCDS34148.1, CCDS68861.1	5p13.1	2009-07-09			ENSG00000164327	ENSG00000164327			28611	protein-coding gene	gene with protein product	"""rapamycin-insensitive companion of mTOR"", ""pianissimo"""	609022				12477932	Standard	XM_005248278		Approved	MGC39830, AVO3, PIA, KIAA1999	uc003jlp.2	Q6R327	OTTHUMG00000162037	ENST00000357387.3:c.4619T>A	5.37:g.38945607A>T	ENSP00000349959:p.Ile1540Lys			Missense_Mutation	SNP	superfamily_ARM-type_fold	p.I1564K	ENST00000357387.3	37	c.4691	CCDS34148.1	5	.	.	.	.	.	.	.	.	.	.	A	15.10	2.732249	0.48939	.	.	ENSG00000164327	ENST00000357387;ENST00000296782	T;T	0.44083	0.94;0.93	5.63	4.32	0.51571	.	0.359552	0.32028	N	0.006683	T	0.20129	0.0484	N	0.08118	0	0.42181	D	0.991684	B;B	0.16166	0.016;0.016	B;B	0.16289	0.015;0.015	T	0.11227	-1.0596	10	0.87932	D	0	-10.4413	3.9945	0.09551	0.7814:0.0:0.2186:0.0	.	1540;1564	Q6R327;Q6R327-3	RICTR_HUMAN;.	K	1540;1564	ENSP00000349959:I1540K;ENSP00000296782:I1564K	ENSP00000296782:I1564K	I	-	2	0	RICTOR	38981364	1.000000	0.71417	0.995000	0.50966	0.997000	0.91878	5.653000	0.67967	2.270000	0.75569	0.460000	0.39030	ATA	RICTOR	-	NULL	ENSG00000164327		0.393	RICTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RICTOR	HGNC	protein_coding	OTTHUMT00000366985.1	-	0.00	68	0	A	NM_152756		38945607	-1	tier1	-	no_errors	ENST00000296782	ensembl	human	known	74_37	missense	30.65	43	19	SNP	0.925	T
RNF39	80352	genome.wustl.edu	37	6	30041253	30041253	+	Silent	SNP	A	A	G			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr6:30041253A>G	ENST00000244360.6	-	2	667	c.570T>C	c.(568-570)gaT>gaC	p.D190D	RNF39_ENST00000376751.3_Silent_p.D190D	NM_025236.3	NP_079512.2	Q9H2S5	RNF39_HUMAN	ring finger protein 39	190						cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)										TCTTCCTCATATCCTAGGATG	0.522																																					NSCLC(8;188 360 1520 20207 31481)												0													227.0	185.0	199.0					6																	30041253		2203	4300	6503	SO:0001819	synonymous_variant	0			AF238315	CCDS4673.1, CCDS4674.1	6p21.3	2013-01-09			ENSG00000204618	ENSG00000204618		"""RING-type (C3HC4) zinc fingers"""	18064	protein-coding gene	gene with protein product		607524				11130983, 11716498	Standard	NM_170769		Approved	HZFw1, LIRF	uc003npe.3	Q9H2S5	OTTHUMG00000031288	ENST00000244360.6:c.570T>C	6.37:g.30041253A>G			A2BEK3|A6NCD6|B0S858|Q5SPM8|Q5SPM9|Q5SPN0|Q5SRJ9|Q5SRK1|Q5SS29|Q9H2S3|Q9H2S4	Silent	SNP	pfam_SPRY_rcpt,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_RING,prints_Butyrophylin	p.D190	ENST00000244360.6	37	c.570	CCDS4673.1	6																																																																																			RNF39	-	NULL	ENSG00000204618		0.522	RNF39-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RNF39	HGNC	protein_coding	OTTHUMT00000076625.3	-	0.00	86	0	A	NM_170769		30041253	-1	tier1	-	no_errors	ENST00000244360	ensembl	human	known	74_37	silent	26.73	74	27	SNP	0.507	G
RP1L1	94137	genome.wustl.edu	37	8	10468842	10468842	+	Silent	SNP	C	C	A			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr8:10468842C>A	ENST00000382483.3	-	4	2989	c.2766G>T	c.(2764-2766)ctG>ctT	p.L922L		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	922					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		TCTCCTCGGACAGCCCCCGAG	0.697																																																	0													20.0	26.0	24.0					8																	10468842		1962	4133	6095	SO:0001819	synonymous_variant	0			AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.2766G>T	8.37:g.10468842C>A			Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Silent	SNP	pfam_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom	p.L922	ENST00000382483.3	37	c.2766	CCDS43708.1	8																																																																																			RP1L1	-	NULL	ENSG00000183638		0.697	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP1L1	HGNC	protein_coding	OTTHUMT00000375673.1	-	0.00	57	0	C			10468842	-1	tier1	-	no_errors	ENST00000382483	ensembl	human	known	74_37	silent	60.00	28	42	SNP	0.000	A
RPGRIP1L	23322	genome.wustl.edu	37	16	53679899	53679899	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr16:53679899G>T	ENST00000379925.3	-	17	2371	c.2321C>A	c.(2320-2322)cCc>cAc	p.P774H	RPGRIP1L_ENST00000262135.4_Missense_Mutation_p.P774H|RPGRIP1L_ENST00000563746.1_Missense_Mutation_p.P774H|RPGRIP1L_ENST00000564374.1_Missense_Mutation_p.P774H	NM_015272.2	NP_056087.2	Q68CZ1	FTM_HUMAN	RPGRIP1-like	774					camera-type eye development (GO:0043010)|cerebellum development (GO:0021549)|cilium assembly (GO:0042384)|corpus callosum development (GO:0022038)|determination of left/right symmetry (GO:0007368)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|establishment or maintenance of cell polarity (GO:0007163)|head development (GO:0060322)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lateral ventricle development (GO:0021670)|liver development (GO:0001889)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|neural tube patterning (GO:0021532)|nose development (GO:0043584)|olfactory bulb development (GO:0021772)|pericardium development (GO:0060039)|regulation of smoothened signaling pathway (GO:0008589)	axoneme (GO:0005930)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	thromboxane A2 receptor binding (GO:0031870)	p.P774H(1)		endometrium(6)|kidney(3)|large_intestine(9)|lung(19)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(2)	46		all_cancers(37;0.0973)				AGCAGTTTTGGGTGCTTGCTG	0.383																																																	1	Substitution - Missense(1)	kidney(1)											74.0	70.0	71.0					16																	53679899		2198	4300	6498	SO:0001583	missense	0				CCDS32447.1, CCDS45486.1	16q12.2	2014-09-17				ENSG00000103494			29168	protein-coding gene	gene with protein product	"""fantom homolog"", ""Meckel syndrome, type 5"", ""protein phosphatase 1, regulatory subunit 134"""	610937				10231032	Standard	NM_015272		Approved	KIAA1005, CORS3, JBTS7, MKS5, NPHP8, FTM, PPP1R134	uc002ehp.3	Q68CZ1		ENST00000379925.3:c.2321C>A	16.37:g.53679899G>T	ENSP00000369257:p.Pro774His		A0PJ88|Q9Y2K8	Missense_Mutation	SNP	pfam_DUF3250,pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.P774H	ENST00000379925.3	37	c.2321	CCDS32447.1	16	.	.	.	.	.	.	.	.	.	.	G	8.612	0.889411	0.17540	.	.	ENSG00000103494	ENST00000379925;ENST00000262135	T;T	0.77620	-0.92;-1.11	5.53	4.52	0.55395	C2 calcium/lipid-binding domain, CaLB (1);	0.356358	0.30455	N	0.009593	T	0.48370	0.1496	N	0.03608	-0.345	0.80722	D	1	B;B;B;B	0.14805	0.001;0.001;0.011;0.003	B;B;B;B	0.13407	0.003;0.002;0.004;0.009	T	0.48080	-0.9066	10	0.15499	T	0.54	-3.3575	3.7564	0.08586	0.1899:0.0:0.6021:0.208	.	774;774;774;774	B4E3M8;B7ZKJ9;Q68CZ1;Q68CZ1-2	.;.;FTM_HUMAN;.	H	774	ENSP00000369257:P774H;ENSP00000262135:P774H	ENSP00000262135:P774H	P	-	2	0	RPGRIP1L	52237400	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	1.388000	0.34442	2.608000	0.88229	0.555000	0.69702	CCC	RPGRIP1L	-	superfamily_C2_dom	ENSG00000103494		0.383	RPGRIP1L-009	KNOWN	basic|CCDS	protein_coding	RPGRIP1L	HGNC	protein_coding	OTTHUMT00000422187.1		0.00	47	0	G	NM_015272		53679899	-1			no_errors	ENST00000379925	ensembl	human	known	74_37	missense	8.00	46	4	SNP	1.000	T
RPGRIP1L	23322	genome.wustl.edu	37	16	53720465	53720465	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr16:53720465C>G	ENST00000379925.3	-	6	706	c.656G>C	c.(655-657)aGa>aCa	p.R219T	RPGRIP1L_ENST00000262135.4_Missense_Mutation_p.R219T|RPGRIP1L_ENST00000563746.1_Missense_Mutation_p.R219T|RPGRIP1L_ENST00000564374.1_Missense_Mutation_p.R219T	NM_015272.2	NP_056087.2	Q68CZ1	FTM_HUMAN	RPGRIP1-like	219					camera-type eye development (GO:0043010)|cerebellum development (GO:0021549)|cilium assembly (GO:0042384)|corpus callosum development (GO:0022038)|determination of left/right symmetry (GO:0007368)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|establishment or maintenance of cell polarity (GO:0007163)|head development (GO:0060322)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lateral ventricle development (GO:0021670)|liver development (GO:0001889)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|neural tube patterning (GO:0021532)|nose development (GO:0043584)|olfactory bulb development (GO:0021772)|pericardium development (GO:0060039)|regulation of smoothened signaling pathway (GO:0008589)	axoneme (GO:0005930)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	thromboxane A2 receptor binding (GO:0031870)			endometrium(6)|kidney(3)|large_intestine(9)|lung(19)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(2)	46		all_cancers(37;0.0973)				TATCTGGCCTCTTTGTGACTG	0.363																																																	0													109.0	104.0	106.0					16																	53720465		2198	4300	6498	SO:0001583	missense	0				CCDS32447.1, CCDS45486.1	16q12.2	2014-09-17				ENSG00000103494			29168	protein-coding gene	gene with protein product	"""fantom homolog"", ""Meckel syndrome, type 5"", ""protein phosphatase 1, regulatory subunit 134"""	610937				10231032	Standard	NM_015272		Approved	KIAA1005, CORS3, JBTS7, MKS5, NPHP8, FTM, PPP1R134	uc002ehp.3	Q68CZ1		ENST00000379925.3:c.656G>C	16.37:g.53720465C>G	ENSP00000369257:p.Arg219Thr		A0PJ88|Q9Y2K8	Missense_Mutation	SNP	pfam_DUF3250,pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.R219T	ENST00000379925.3	37	c.656	CCDS32447.1	16	.	.	.	.	.	.	.	.	.	.	C	13.74	2.327487	0.41197	.	.	ENSG00000103494	ENST00000379925;ENST00000262135	T;T	0.76578	-0.11;-1.03	5.73	2.73	0.32206	.	0.207331	0.51477	D	0.000096	T	0.55273	0.1910	N	0.12182	0.205	0.32169	N	0.581872	P;B;B;B	0.37914	0.611;0.411;0.282;0.328	B;B;B;B	0.33042	0.138;0.103;0.076;0.157	T	0.60855	-0.7180	10	0.28530	T	0.3	-9.6624	9.6381	0.39822	0.0:0.7229:0.0:0.2771	.	219;219;219;219	B4E3M8;B7ZKJ9;Q68CZ1;Q68CZ1-2	.;.;FTM_HUMAN;.	T	219	ENSP00000369257:R219T;ENSP00000262135:R219T	ENSP00000262135:R219T	R	-	2	0	RPGRIP1L	52277966	0.271000	0.24162	0.998000	0.56505	0.990000	0.78478	0.364000	0.20325	0.883000	0.36040	0.655000	0.94253	AGA	RPGRIP1L	-	NULL	ENSG00000103494		0.363	RPGRIP1L-009	KNOWN	basic|CCDS	protein_coding	RPGRIP1L	HGNC	protein_coding	OTTHUMT00000422187.1	-	0.00	68	0	C	NM_015272		53720465	-1	tier1	-	no_errors	ENST00000379925	ensembl	human	known	74_37	missense	36.56	59	34	SNP	0.990	G
RTN4R	65078	genome.wustl.edu	37	22	20230142	20230142	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr22:20230142C>T	ENST00000043402.7	-	2	952	c.514G>A	c.(514-516)Gac>Aac	p.D172N	RTN4R_ENST00000469601.1_5'UTR	NM_023004.5	NP_075380.1	Q9BZR6	RTN4R_HUMAN	reticulon 4 receptor	172					axonogenesis (GO:0007409)|negative regulation of axonogenesis (GO:0050771)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of axonogenesis (GO:0050770)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			lung(1)|ovary(1)|prostate(1)	3	Colorectal(54;0.0993)					CGGAAGGTGTCATCAGGCAGT	0.692																																																	0													75.0	64.0	68.0					22																	20230142		2203	4300	6503	SO:0001583	missense	0			AF283463	CCDS13777.1	22q11	2008-05-02			ENSG00000040608	ENSG00000040608			18601	protein-coding gene	gene with protein product		605566				11201742	Standard	NM_023004		Approved	NOGOR	uc002zrv.3	Q9BZR6	OTTHUMG00000150572	ENST00000043402.7:c.514G>A	22.37:g.20230142C>T	ENSP00000043402:p.Asp172Asn		D3DX28	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.D172N	ENST00000043402.7	37	c.514	CCDS13777.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.31|15.31	2.795922|2.795922	0.50208|0.50208	.|.	.|.	ENSG00000040608|ENSG00000040608	ENST00000043402|ENST00000416372;ENST00000425986	T|.	0.58210|.	0.35|.	4.1|4.1	3.07|3.07	0.35406|0.35406	.|.	0.205125|.	0.24417|.	N|.	0.038718|.	T|T	0.36635|0.36635	0.0974|0.0974	N|N	0.16066|0.16066	0.365|0.365	0.44880|0.44880	D|D	0.997895|0.997895	B|.	0.09022|.	0.002|.	B|.	0.14578|.	0.011|.	T|T	0.08289|0.08289	-1.0729|-1.0729	10|5	0.51188|.	T|.	0.08|.	.|.	9.0181|9.0181	0.36182|0.36182	0.0:0.8858:0.0:0.1142|0.0:0.8858:0.0:0.1142	.|.	172|.	Q9BZR6|.	RTN4R_HUMAN|.	N|I	172|191;257	ENSP00000043402:D172N|.	ENSP00000043402:D172N|.	D|M	-|-	1|3	0|0	RTN4R|RTN4R	18610142|18610142	0.994000|0.994000	0.37717|0.37717	0.030000|0.030000	0.17652|0.17652	0.929000|0.929000	0.56500|0.56500	3.881000|3.881000	0.56152|0.56152	1.045000|1.045000	0.40225|0.40225	0.561000|0.561000	0.74099|0.74099	GAC|ATG	RTN4R	-	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	ENSG00000040608		0.692	RTN4R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTN4R	HGNC	protein_coding	OTTHUMT00000318950.2		0.00	30	0	C			20230142	-1			no_errors	ENST00000043402	ensembl	human	known	74_37	missense	8.00	23	2	SNP	0.952	T
SCAND2P	54581	genome.wustl.edu	37	15	85178634	85178635	+	RNA	INS	-	-	TT	rs34515964|rs140645141|rs55971472|rs59355710	byFrequency	TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr15:85178634_85178635insTT	ENST00000527801.1	-	0	0				SCAND2P_ENST00000348993.5_RNA																							GAAGAGTTTAAttttttttttt	0.376																																																	0																																												0																															15.37:g.85178643_85178644dupTT				RNA	INS	-	NULL	ENST00000527801.1	37	NULL		15																																																																																			SCAND2P	-	-	ENSG00000176700		0.376	RP11-182J1.1-001	KNOWN	basic|exp_conf	antisense	SCAND2P	HGNC	antisense	OTTHUMT00000390220.1		0.00	11	0	-			85178635	+1	tier1		no_errors	ENST00000427525	ensembl	human	known	74_37	rna	23.53	13	4	INS	0.053:0.188	TT
SDHAP1	255812	genome.wustl.edu	37	3	195717061	195717061	+	RNA	SNP	C	C	A	rs182566717		TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr3:195717061C>A	ENST00000427841.1	-	0	89					NR_003264.2				succinate dehydrogenase complex, subunit A, flavoprotein pseudogene 1																		AGGGACTCACCGCCTTGGCCA	0.791																																					Ovarian(67;1158 1227 12109 20189 43170)												0																																												0			BC071730		3q29	2009-12-02	2006-11-21	2009-12-02	ENSG00000185485	ENSG00000185485			32455	pseudogene	pseudogene			"""succinate dehydrogenase complex, subunit A, flavoprotein-like 1"""	SDHAL1, SDHALP1			Standard	NR_003264		Approved		uc003fvy.3		OTTHUMG00000155716		3.37:g.195717061C>A				RNA	SNP	-	NULL	ENST00000427841.1	37	NULL		3																																																																																			SDHAP1	-	-	ENSG00000185485		0.791	SDHAP1-002	KNOWN	basic	processed_transcript	SDHAP1	HGNC	pseudogene	OTTHUMT00000341367.1		0.00	9	0	C			195717061	-1			no_errors	ENST00000413474	ensembl	human	known	74_37	rna	26.67	11	4	SNP	0.825	A
SDHC	6391	genome.wustl.edu	37	1	161284244	161284244	+	Intron	SNP	C	C	T			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr1:161284244C>T	ENST00000367975.2	+	1	169				SDHC_ENST00000432287.2_Intron|SDHC_ENST00000342751.4_Intron|SDHC_ENST00000392169.2_Intron|SDHC_ENST00000513009.1_Intron	NM_003001.3	NP_002992.1	Q99643	C560_HUMAN	succinate dehydrogenase complex, subunit C, integral membrane protein, 15kDa						aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|oxidation-reduction process (GO:0055114)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex II (GO:0005749)|mitochondrion (GO:0005739)|respiratory chain complex II (GO:0045273)	electron carrier activity (GO:0009055)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|succinate dehydrogenase activity (GO:0000104)			urinary_tract(1)	1	all_cancers(52;6.96e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Succinic acid(DB00139)	GGAGTTGGTGCCTGCGGCCCT	0.627			"""Mis, N, F"""			"""paraganglioma, pheochromocytoma"""			Familial Paragangliomas;Carney-Stratakis syndrome																														yes	Rec		Familial paraganglioma	1	1q21	6391	"""succinate dehydrogenase complex, subunit C, integral membrane protein, 15kDa"""		O	0													55.0	50.0	52.0					1																	161284244		2203	4300	6503	SO:0001627	intron_variant	0	Familial Cancer Database	Hereditary Glomus Tumors, Familial Paragangliomas, Hereditary Paragangliomas, type 1-3: PGL1, PGL2, PGL3, incl. Familial Carotid Body Paraganglioma and Sensorineural Hearing Loss;Carney-Stratakis dyad, Paraganglioma-Gastric Stromal Sarcoma dyad	D49737	CCDS1230.1, CCDS41431.1, CCDS41432.1, CCDS44263.1, CCDS60330.1	1q23.3	2014-09-17	2002-08-29		ENSG00000143252	ENSG00000143252		"""Mitochondrial respiratory chain complex / Complex II"""	10682	protein-coding gene	gene with protein product		602413	"""succinate dehydrogenase complex, subunit C, integral membrane protein, 15kD"""	PGL3		9533030, 12658451	Standard	NM_001278172		Approved		uc001gag.3	Q99643	OTTHUMG00000034468	ENST00000367975.2:c.20+29C>T	1.37:g.161284244C>T			O75609|Q3C259|Q3C2D8|Q3C2H4|Q5VTH3	RNA	SNP	-	NULL	ENST00000367975.2	37	NULL	CCDS1230.1	1																																																																																			SDHC	-	-	ENSG00000143252		0.627	SDHC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDHC	HGNC	protein_coding	OTTHUMT00000083316.2	-	0.00	53	0	C	NM_003001		161284244	+1	tier1	-	no_errors	ENST00000515731	ensembl	human	known	74_37	rna	11.76	30	4	SNP	0.000	T
SEC31A	22872	genome.wustl.edu	37	4	83784392	83784392	+	Intron	SNP	G	G	C			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr4:83784392G>C	ENST00000395310.2	-	12	1692				SEC31A_ENST00000348405.4_Intron|SEC31A_ENST00000508479.1_Intron|SEC31A_ENST00000508502.1_Intron|SEC31A_ENST00000505984.1_Intron|SEC31A_ENST00000448323.1_Intron|SEC31A_ENST00000326950.5_Intron|SEC31A_ENST00000513858.1_Intron|SEC31A_ENST00000436790.2_5'UTR|SEC31A_ENST00000509142.1_Intron|SEC31A_ENST00000500777.2_Intron|SEC31A_ENST00000355196.2_Intron|SEC31A_ENST00000311785.7_Intron|SEC31A_ENST00000443462.2_Intron|SEC31A_ENST00000264405.5_Intron|SEC31A_ENST00000432794.1_Intron|SEC31A_ENST00000505472.1_Intron	NM_001077207.2|NM_001077208.2|NM_014933.3	NP_001070675.1|NP_001070676.1|NP_055748.2	O94979	SC31A_HUMAN	SEC31 homolog A (S. cerevisiae)						activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER to Golgi vesicle-mediated transport (GO:0006888)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|protein transport (GO:0015031)|response to calcium ion (GO:0051592)	COPII vesicle coat (GO:0030127)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum exit site (GO:0070971)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle (GO:0030134)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|vesicle coat (GO:0030120)	calcium-dependent protein binding (GO:0048306)		SEC31A/ALK(3)|SEC31A/JAK2(4)	breast(1)	1		Hepatocellular(203;0.114)				TGGGTGATTTGAGATAATCTG	0.318																																																	0																																										SO:0001627	intron_variant	0			AB018358	CCDS3596.1, CCDS3597.1, CCDS43244.1, CCDS47088.1, CCDS54773.1, CCDS75155.1, CCDS75156.1	4q21.3	2013-01-10	2006-10-05	2006-09-07	ENSG00000138674	ENSG00000138674		"""WD repeat domain containing"""	17052	protein-coding gene	gene with protein product		610257	"""SEC31-like 1 (S. cerevisiae)"", ""Sec31 homolog A (S. cerevisiae)"""	SEC31L1		10048485, 10788476	Standard	NM_001077206		Approved	KIAA0905, ABP125, ABP130	uc003hnh.3	O94979	OTTHUMG00000130297	ENST00000395310.2:c.1509+78C>G	4.37:g.83784392G>C			B4DIW6|B7ZKZ7|B7ZL00|H7C2W3|Q17RR5|Q5H9P6|Q5XG74|Q659G7|Q6ZU90|Q7LCX9|Q86TJ0|Q8IZH4|Q9P048|Q9P0A6|Q9UM05|Q9UM06	RNA	SNP	-	NULL	ENST00000395310.2	37	NULL	CCDS3596.1	4																																																																																			SEC31A	-	-	ENSG00000138674		0.318	SEC31A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SEC31A	HGNC	protein_coding	OTTHUMT00000252640.1	-	0.00	81	0	G	NM_016211		83784392	-1	tier1	-	no_errors	ENST00000436790	ensembl	human	known	74_37	rna	36.92	82	48	SNP	0.075	C
SEPT12	124404	genome.wustl.edu	37	16	4827874	4827874	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr16:4827874G>A	ENST00000268231.8	-	10	1264	c.1001C>T	c.(1000-1002)tCc>tTc	p.S334F	SEPT12_ENST00000396693.5_Missense_Mutation_p.S288F	NM_144605.4	NP_653206.2	Q8IYM1	SEP12_HUMAN	septin 12	334					cell cycle (GO:0007049)|cell division (GO:0051301)	cleavage furrow (GO:0032154)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)|septin complex (GO:0031105)|sperm annulus (GO:0097227)|spindle (GO:0005819)|stress fiber (GO:0001725)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|phosphatidylinositol binding (GO:0035091)|protein homodimerization activity (GO:0042803)			NS(1)|cervix(1)|endometrium(3)|large_intestine(5)|lung(8)|skin(2)|stomach(3)	23						CTGTCCTGGGGAGGCCGGGGC	0.632																																																	0													28.0	29.0	28.0					16																	4827874		2176	4274	6450	SO:0001583	missense	0			AK058139	CCDS10522.1, CCDS53987.1	16p13.3	2013-01-21			ENSG00000140623	ENSG00000140623		"""Septins"""	26348	protein-coding gene	gene with protein product		611562				14611653, 15915442	Standard	NM_001154458		Approved	FLJ25410	uc002cxq.3	Q8IYM1	OTTHUMG00000129481	ENST00000268231.8:c.1001C>T	16.37:g.4827874G>A	ENSP00000268231:p.Ser334Phe		Q0P6B0|Q1PBH0|Q96LL0	Missense_Mutation	SNP	pfam_Cell_div_GTP-bd,pfam_AIG1,superfamily_P-loop_NTPase,pirsf_Septin	p.S334F	ENST00000268231.8	37	c.1001	CCDS10522.1	16	.	.	.	.	.	.	.	.	.	.	G	16.57	3.159586	0.57368	.	.	ENSG00000140623	ENST00000396693;ENST00000268231	T;T	0.54071	0.59;0.6	4.59	4.59	0.56863	.	0.584725	0.15255	N	0.272092	T	0.44726	0.1307	N	0.08118	0	0.09310	N	1	P;P	0.47604	0.875;0.898	P;P	0.51355	0.667;0.553	T	0.39272	-0.9622	10	0.36615	T	0.2	.	15.2815	0.73787	0.0:0.0:1.0:0.0	.	288;334	Q8IYM1-2;Q8IYM1	.;SEP12_HUMAN	F	288;334	ENSP00000379922:S288F;ENSP00000268231:S334F	ENSP00000268231:S334F	S	-	2	0	SEPT12	4767875	0.063000	0.20901	0.088000	0.20740	0.372000	0.29890	2.221000	0.42917	2.538000	0.85594	0.462000	0.41574	TCC	SEPT12	-	pirsf_Septin	ENSG00000140623		0.632	SEPT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEPT12	HGNC	protein_coding	OTTHUMT00000251645.2	-	0.00	53	0	G	NM_144605		4827874	-1	tier1	-	no_errors	ENST00000268231	ensembl	human	known	74_37	missense	38.33	37	23	SNP	0.020	A
SETD2	29072	genome.wustl.edu	37	3	47098822	47098822	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr3:47098822G>A	ENST00000409792.3	-	15	6494	c.6452C>T	c.(6451-6453)cCc>cTc	p.P2151L		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	2151	Low charge region.|Pro-rich.				angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		AGAGTCATAGGGCAGTGGTGA	0.522			"""N, F, S, Mis"""		clear cell renal carcinoma																																			Rec	yes		3	3p21.31	29072	SET domain containing 2		E	0													200.0	184.0	190.0					3																	47098822		2203	4300	6503	SO:0001583	missense	0			AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.6452C>T	3.37:g.47098822G>A	ENSP00000386759:p.Pro2151Leu		O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Missense_Mutation	SNP	pfam_SRI,pfam_SET_dom,pfam_WW_dom,superfamily_WW_dom,superfamily_Ferritin-like_SF,smart_AWS,smart_SET_dom,smart_Post-SET_dom,smart_WW_dom,pfscan_AWS,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_WW_dom	p.P2151L	ENST00000409792.3	37	c.6452	CCDS2749.2	3	.	.	.	.	.	.	.	.	.	.	G	20.4	3.987118	0.74589	.	.	ENSG00000181555	ENST00000451092;ENST00000409792	T	0.44482	0.92	5.25	5.25	0.73442	.	0.000000	0.64402	D	0.000017	T	0.42063	0.1186	L	0.43152	1.355	0.48452	D	0.999659	P;P	0.49185	0.92;0.92	B;B	0.42386	0.386;0.386	T	0.42916	-0.9423	10	0.66056	D	0.02	.	19.3982	0.94617	0.0:0.0:1.0:0.0	.	2151;2151	F2Z317;Q9BYW2	.;SETD2_HUMAN	L	2151	ENSP00000386759:P2151L	ENSP00000386759:P2151L	P	-	2	0	SETD2	47073826	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.058000	0.57463	2.894000	0.99253	0.655000	0.94253	CCC	SETD2	-	NULL	ENSG00000181555		0.522	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETD2	HGNC	protein_coding	OTTHUMT00000257479.2	-	0.00	43	0	G	NM_014159		47098822	-1	tier1	-	no_errors	ENST00000409792	ensembl	human	known	74_37	missense	61.90	16	26	SNP	1.000	A
SFMBT2	57713	genome.wustl.edu	37	10	7214488	7214488	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr10:7214488G>A	ENST00000361972.4	-	18	2210	c.2120C>T	c.(2119-2121)tCt>tTt	p.S707F	SFMBT2_ENST00000397167.1_Missense_Mutation_p.S707F	NM_001018039.1	NP_001018049.1	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2	707					negative regulation of gene expression (GO:0010629)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	histone binding (GO:0042393)			NS(2)|breast(3)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(26)|lung(34)|ovary(5)|pancreas(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	99						GTCCACGGCAGAAGACCTCCG	0.647																																																	0													47.0	46.0	46.0					10																	7214488		2203	4300	6503	SO:0001583	missense	0			AB046837	CCDS31138.1	10p15.1	2013-01-10	2003-11-14		ENSG00000198879	ENSG00000198879		"""Sterile alpha motif (SAM) domain containing"""	20256	protein-coding gene	gene with protein product		615392	"""Scm-related gene containing four mbt domains 2"""			10997877	Standard	NM_001029880		Approved	KIAA1617	uc009xio.2	Q5VUG0	OTTHUMG00000017630	ENST00000361972.4:c.2120C>T	10.37:g.7214488G>A	ENSP00000355109:p.Ser707Phe		A7MD09|Q9HCF5	Missense_Mutation	SNP	pfam_Mbt,pfam_DUF3588,pfam_SAM_type1,pfam_Pointed_dom,superfamily_SAM/pointed,superfamily_ARM-type_fold,smart_Mbt,smart_SAM,pfscan_Mbt	p.S707F	ENST00000361972.4	37	c.2120	CCDS31138.1	10	.	.	.	.	.	.	.	.	.	.	G	18.99	3.739900	0.69304	.	.	ENSG00000198879	ENST00000361972;ENST00000397167	T;T	0.16597	2.33;2.33	5.28	5.28	0.74379	.	0.249644	0.43416	D	0.000571	T	0.37210	0.0995	M	0.65498	2.005	0.80722	D	1	D	0.67145	0.996	P	0.59171	0.853	T	0.03840	-1.0999	10	0.37606	T	0.19	.	18.5052	0.90894	0.0:0.0:1.0:0.0	.	707	Q5VUG0	SMBT2_HUMAN	F	707	ENSP00000355109:S707F;ENSP00000380353:S707F	ENSP00000355109:S707F	S	-	2	0	SFMBT2	7254494	1.000000	0.71417	0.228000	0.23943	0.143000	0.21401	8.856000	0.92245	2.458000	0.83093	0.484000	0.47621	TCT	SFMBT2	-	superfamily_ARM-type_fold	ENSG00000198879		0.647	SFMBT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFMBT2	HGNC	protein_coding	OTTHUMT00000046673.1		0.00	54	0	G	NM_001029880		7214488	-1			no_errors	ENST00000361972	ensembl	human	known	74_37	missense	5.56	68	4	SNP	0.925	A
SFT2D1	113402	genome.wustl.edu	37	6	166733495	166733495	+	3'UTR	SNP	A	A	G			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr6:166733495A>G	ENST00000361731.3	-	0	799				SFT2D1_ENST00000487841.1_5'UTR	NM_145169.1	NP_660152.1			SFT2 domain containing 1											NS(1)|central_nervous_system(1)|large_intestine(3)|upper_aerodigestive_tract(1)	6		Breast(66;0.000148)|Prostate(117;0.109)|Ovarian(120;0.199)		OV - Ovarian serous cystadenocarcinoma(33;2.63e-19)|BRCA - Breast invasive adenocarcinoma(81;4.92e-06)|GBM - Glioblastoma multiforme(31;4.58e-05)		TTGGAAAAGTATATTAATGAC	0.254																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF041429	CCDS5292.1	6q27	2008-02-05	2005-07-25	2005-07-25	ENSG00000198818	ENSG00000198818			21102	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 83"""	C6orf83			Standard	NM_145169		Approved	MGC19825, pRGR1	uc003qux.3	Q8WV19	OTTHUMG00000016001	ENST00000361731.3:c.*210T>C	6.37:g.166733495A>G				RNA	SNP	-	NULL	ENST00000361731.3	37	NULL	CCDS5292.1	6																																																																																			SFT2D1	-	-	ENSG00000198818		0.254	SFT2D1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SFT2D1	HGNC	protein_coding	OTTHUMT00000043061.2	-	0.00	12	0	A	NM_145169		166733495	-1	tier1	-	no_errors	ENST00000487841	ensembl	human	known	74_37	rna	57.14	9	12	SNP	0.000	G
SGTB	54557	genome.wustl.edu	37	5	65000152	65000152	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr5:65000152G>C	ENST00000381007.4	-	5	563	c.328C>G	c.(328-330)Cag>Gag	p.Q110E		NM_019072.2	NP_061945.1	Q96EQ0	SGTB_HUMAN	small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta	110										large_intestine(3)|lung(3)|skin(3)	9		Lung NSC(167;3.24e-06)|Prostate(74;0.0138)|Ovarian(174;0.0545)|Breast(144;0.174)|Colorectal(97;0.234)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0657)|Lung(70;0.00487)		TCTATTGCCTGTGTGTAACAA	0.323																																																	0													157.0	146.0	149.0					5																	65000152		2203	4300	6503	SO:0001583	missense	0			AK096321	CCDS3988.1	5q12.3	2013-01-10			ENSG00000197860	ENSG00000197860		"""Tetratricopeptide (TTC) repeat domain containing"""	23567	protein-coding gene	gene with protein product						12477932	Standard	XM_005248548		Approved	Sgt2, FLJ39002	uc003jud.3	Q96EQ0	OTTHUMG00000097801	ENST00000381007.4:c.328C>G	5.37:g.65000152G>C	ENSP00000370395:p.Gln110Glu			Missense_Mutation	SNP	pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.Q110E	ENST00000381007.4	37	c.328	CCDS3988.1	5	.	.	.	.	.	.	.	.	.	.	G	12.61	1.988659	0.35131	.	.	ENSG00000197860	ENST00000381007;ENST00000506816	T;T	0.59083	0.29;0.29	5.35	4.47	0.54385	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.291581	0.38778	N	0.001578	T	0.33789	0.0875	N	0.05467	-0.045	0.38261	D	0.941872	B	0.10296	0.003	B	0.12156	0.007	T	0.24870	-1.0148	10	0.06236	T	0.91	-11.6481	14.2384	0.65941	0.0:0.0:0.8493:0.1507	.	110	Q96EQ0	SGTB_HUMAN	E	110	ENSP00000370395:Q110E;ENSP00000421447:Q110E	ENSP00000370395:Q110E	Q	-	1	0	SGTB	65035908	1.000000	0.71417	0.999000	0.59377	0.999000	0.98932	4.901000	0.63259	1.227000	0.43598	0.655000	0.94253	CAG	SGTB	-	pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000197860		0.323	SGTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGTB	HGNC	protein_coding	OTTHUMT00000215057.2	-	0.00	89	0	G	NM_019072		65000152	-1	tier1	-	no_errors	ENST00000381007	ensembl	human	known	74_37	missense	33.33	104	52	SNP	0.997	C
SLC17A6	57084	genome.wustl.edu	37	11	22360130	22360130	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr11:22360130G>C	ENST00000263160.3	+	1	488	c.51G>C	c.(49-51)aaG>aaC	p.K17N	CTD-2140G10.2_ENST00000530569.1_RNA|CTD-2140G10.2_ENST00000528009.1_RNA|CTD-2140G10.2_ENST00000531304.1_RNA	NM_020346.2	NP_065079.1	Q9P2U8	VGLU2_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 6	17					ion transport (GO:0006811)|neurotransmitter uptake (GO:0001504)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|synaptic vesicle membrane (GO:0030672)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(3)	50						AGGGGCTAAAGAATTTTGCTG	0.443																																																	0													65.0	70.0	68.0					11																	22360130		2203	4300	6503	SO:0001583	missense	0			AB032435	CCDS7856.1	11p14.3	2013-07-18	2013-07-18		ENSG00000091664	ENSG00000091664		"""Solute carriers"""	16703	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 2"", ""differentiation-associated Na-dependent inorganic phosphate cotransporter"""	607563	"""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6"""			11306821	Standard	NM_020346		Approved	DNPI, VGLUT2	uc001mqk.3	Q9P2U8	OTTHUMG00000166063	ENST00000263160.3:c.51G>C	11.37:g.22360130G>C	ENSP00000263160:p.Lys17Asn		A6NKS2	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.K17N	ENST00000263160.3	37	c.51	CCDS7856.1	11	.	.	.	.	.	.	.	.	.	.	G	17.99	3.522485	0.64747	.	.	ENSG00000091664	ENST00000263160	T	0.65732	-0.17	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	T	0.64962	0.2646	M	0.68593	2.085	0.80722	D	1	B	0.18310	0.027	B	0.22601	0.04	T	0.64145	-0.6476	10	0.62326	D	0.03	.	18.9139	0.92496	0.0:0.0:1.0:0.0	.	17	Q9P2U8	VGLU2_HUMAN	N	17	ENSP00000263160:K17N	ENSP00000263160:K17N	K	+	3	2	SLC17A6	22316706	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.845000	0.55880	2.465000	0.83290	0.655000	0.94253	AAG	SLC17A6	-	NULL	ENSG00000091664		0.443	SLC17A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC17A6	HGNC	protein_coding	OTTHUMT00000387671.1	-	0.00	87	0	G	NM_020346		22360130	+1	tier1	-	no_errors	ENST00000263160	ensembl	human	known	74_37	missense	28.00	54	21	SNP	1.000	C
SLC35C2	51006	genome.wustl.edu	37	20	44978913	44978913	+	3'UTR	SNP	C	C	A			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr20:44978913C>A	ENST00000372227.1	-	0	1758				SLC35C2_ENST00000243896.2_3'UTR|SLC35C2_ENST00000372230.5_3'UTR|SLC35C2_ENST00000372229.1_3'UTR|SLC35C2_ENST00000317734.8_3'UTR|SLC35C2_ENST00000493599.1_5'UTR|SLC35C2_ENST00000543605.1_3'UTR	NM_001281458.1|NM_001281460.1	NP_001268387.1|NP_001268389.1	Q9NQQ7	S35C2_HUMAN	solute carrier family 35 (GDP-fucose transporter), member C2						negative regulation of gene expression (GO:0010629)|positive regulation of Notch signaling pathway (GO:0045747)|protein O-linked fucosylation (GO:0036066)|transport (GO:0006810)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)	16		Myeloproliferative disorder(115;0.0122)				TTGGCCCCACCACCTGGTGAC	0.647																																																	0																																										SO:0001624	3_prime_UTR_variant	0				CCDS13396.1, CCDS13397.1, CCDS63292.1	20q13.12	2013-07-17	2013-07-17	2003-10-10	ENSG00000080189	ENSG00000080189		"""Solute carriers"""	17117	protein-coding gene	gene with protein product			"""ovarian cancer overexpressed 1"", ""solute carrier family 35, member C2"""	C20orf5, OVCOV1		10810093, 11549316	Standard	NM_173179		Approved	CGI-15, bA394O2.1	uc002xrq.3	Q9NQQ7	OTTHUMG00000033050	ENST00000372227.1:c.*120G>T	20.37:g.44978913C>A			B7Z6V6|E1P5T0|Q53GK3|Q5JW05|Q96CJ8|Q9Y304	RNA	SNP	-	NULL	ENST00000372227.1	37	NULL	CCDS13396.1	20																																																																																			SLC35C2	-	-	ENSG00000080189		0.647	SLC35C2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC35C2	HGNC	protein_coding	OTTHUMT00000080363.1	-	0.00	34	0	C	NM_015945		44978913	-1	tier1	-	no_errors	ENST00000493599	ensembl	human	known	74_37	rna	9.76	37	4	SNP	0.000	A
SLC43A2	124935	genome.wustl.edu	37	17	1479963	1479963	+	Silent	SNP	G	G	A	rs142934102		TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr17:1479963G>A	ENST00000301335.5	-	13	1564	c.1476C>T	c.(1474-1476)agC>agT	p.S492S	SLC43A2_ENST00000382147.4_Silent_p.S496S|SLC43A2_ENST00000412517.3_Silent_p.S355S|SLC43A2_ENST00000571650.1_Silent_p.S496S	NM_001284498.1|NM_001284499.1	NP_001271427.1|NP_001271428.1	Q8N370	LAT4_HUMAN	solute carrier family 43 (amino acid system L transporter), member 2	492					amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	L-amino acid transmembrane transporter activity (GO:0015179)			endometrium(4)|large_intestine(4)|liver(1)|lung(2)|upper_aerodigestive_tract(1)	12				UCEC - Uterine corpus endometrioid carcinoma (25;0.0883)		CGAAGAGCGCGCTGATCAGAG	0.637													G|||	1	0.000199681	0.0	0.0	5008	,	,		14140	0.0		0.001	False		,,,				2504	0.0																0								G		0,4406		0,0,2203	46.0	44.0	45.0		1476	-10.0	0.1	17	dbSNP_134	45	6,8594	4.3+/-15.6	0,6,4294	no	coding-synonymous	SLC43A2	NM_152346.1		0,6,6497	AA,AG,GG		0.0698,0.0,0.0461		492/570	1479963	6,13000	2203	4300	6503	SO:0001819	synonymous_variant	0			BC027923	CCDS11006.1, CCDS67107.1, CCDS67108.1	17p13.3	2013-07-17	2013-07-17		ENSG00000167703	ENSG00000167703		"""Solute carriers"""	23087	protein-coding gene	gene with protein product		610791				23268354	Standard	NM_001284498		Approved	MGC34680	uc002fsv.3	Q8N370	OTTHUMG00000090345	ENST00000301335.5:c.1476C>T	17.37:g.1479963G>A			B7Z6X9|C9JNU8|D3DTH9|Q5CD75|Q6IPM1|Q8NBX1|Q8NC21|Q8WZ00	Silent	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.S496	ENST00000301335.5	37	c.1488	CCDS11006.1	17																																																																																			SLC43A2	-	superfamily_MFS_dom_general_subst_transpt	ENSG00000167703		0.637	SLC43A2-001	KNOWN	basic|CCDS	protein_coding	SLC43A2	HGNC	protein_coding	OTTHUMT00000206717.4	-	0.00	34	0	G	NM_152346		1479963	-1	tier1	rs142934102	no_errors	ENST00000382147	ensembl	human	known	74_37	silent	29.17	34	14	SNP	0.852	A
SLC4A10	57282	genome.wustl.edu	37	2	162757652	162757652	+	Intron	SNP	A	A	G			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr2:162757652A>G	ENST00000446997.1	+	12	1535				SLC4A10_ENST00000375514.5_Intron|SLC4A10_ENST00000421911.1_Intron|SLC4A10_ENST00000493021.1_3'UTR|SLC4A10_ENST00000535165.1_Intron|SLC4A10_ENST00000415876.2_Intron|SLC4A10_ENST00000272716.5_Intron	NM_001178015.1	NP_001171486.1	Q6U841	S4A10_HUMAN	solute carrier family 4, sodium bicarbonate transporter, member 10						bicarbonate transport (GO:0015701)|chloride transport (GO:0006821)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|symporter activity (GO:0015293)			endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(35)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60					Sodium bicarbonate(DB01390)	TGAAAATGCCAATTAGTTTGA	0.318																																																	0																																										SO:0001627	intron_variant	0				CCDS46438.1, CCDS54411.1, CCDS54412.1	2q24.2	2013-05-22	2008-09-15		ENSG00000144290	ENSG00000144290		"""Solute carriers"""	13811	protein-coding gene	gene with protein product		605556	"""solute carrier family 4, sodium bicarbonate transporter-like, member 10"""			10964153, 18319254	Standard	NM_022058		Approved	NBCn2, NCBE	uc002ubx.4	Q6U841	OTTHUMG00000153938	ENST00000446997.1:c.1442+131A>G	2.37:g.162757652A>G			B7Z1R0|B7Z2J0|B7ZLC5|B9EG69|F8W675|Q4ZFX6|Q8TCP2|Q9HCQ6	RNA	SNP	-	NULL	ENST00000446997.1	37	NULL	CCDS54411.1	2																																																																																			SLC4A10	-	-	ENSG00000144290		0.318	SLC4A10-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC4A10	HGNC	protein_coding	OTTHUMT00000333090.1	-	0.00	14	0	A	NM_022058		162757652	+1	tier1	-	no_errors	ENST00000493021	ensembl	human	known	74_37	rna	31.82	15	7	SNP	0.006	G
SLC50A1	55974	genome.wustl.edu	37	1	155110819	155110820	+	3'UTR	INS	-	-	CAG			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr1:155110819_155110820insCAG	ENST00000368404.4	+	0	790_791				SLC50A1_ENST00000484157.1_3'UTR|SLC50A1_ENST00000303343.8_3'UTR|SLC50A1_ENST00000368401.5_3'UTR|SLC50A1_ENST00000368405.3_3'UTR	NM_018845.3	NP_061333.2	Q9BRV3	SWET1_HUMAN	solute carrier family 50 (sugar efflux transporter), member 1						carbohydrate transport (GO:0008643)|DNA recombination (GO:0006310)|glucoside transport (GO:0042946)|positive regulation of gene expression, epigenetic (GO:0045815)	endomembrane system (GO:0012505)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	glucoside transmembrane transporter activity (GO:0042947)			endometrium(1)|lung(1)|ovary(1)|skin(1)	4						CCTCCTTGTTTCAGCTGGGCCT	0.505																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF126023, AF126024	CCDS1093.1, CCDS44238.1, CCDS44239.1, CCDS72929.1, CCDS72930.1	1q22	2013-07-17	2013-07-17	2010-11-30	ENSG00000169241	ENSG00000169241		"""Solute carriers"""	30657	protein-coding gene	gene with protein product	"""stromal cell protein"""	613683	"""recombination activating gene 1 activating protein 1"""	RAG1AP1		21107422	Standard	NM_018845		Approved	SCP, RP11-540D14.5, slv, RZPDo834D038D, HsSWEET1, SWEET1	uc001fhj.4	Q9BRV3	OTTHUMG00000035333	ENST00000368404.4:c.*63->CAG	1.37:g.155110820_155110822dupCAG			Q5SR64|Q6IAK6|Q96DC5|Q9UHQ2|Q9UHQ3	RNA	INS	-	NULL	ENST00000368404.4	37	NULL	CCDS1093.1	1																																																																																			SLC50A1	-	-	ENSG00000169241		0.505	SLC50A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC50A1	HGNC	protein_coding	OTTHUMT00000085505.1		0.00	51	0	-	NM_018845		155110820	+1	tier1		no_errors	ENST00000368405	ensembl	human	known	74_37	rna	35.59	38	21	INS	0.110:0.111	CAG
SMAD4	4089	genome.wustl.edu	37	18	48603032	48603032	+	Nonsense_Mutation	SNP	C	C	T	rs377767360		TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr18:48603032C>T	ENST00000342988.3	+	11	1871	c.1333C>T	c.(1333-1335)Cga>Tga	p.R445*	SMAD4_ENST00000588745.1_Nonsense_Mutation_p.R349*|SMAD4_ENST00000398417.2_Nonsense_Mutation_p.R445*	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	445	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.R445*(7)|p.?(2)|p.R441fs*16(1)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		TCAGTGTCATCGACAGATGCA	0.458																																																	46	Whole gene deletion(36)|Substitution - Nonsense(7)|Unknown(2)|Deletion - Frameshift(1)	pancreas(30)|large_intestine(5)|breast(3)|stomach(2)|lung(2)|upper_aerodigestive_tract(1)|small_intestine(1)|oesophagus(1)|NS(1)	GRCh37	CM000742	SMAD4	M							43.0	44.0	44.0					18																	48603032		2203	4300	6503	SO:0001587	stop_gained	0			U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.1333C>T	18.37:g.48603032C>T	ENSP00000341551:p.Arg445*		A8K405	Nonsense_Mutation	SNP	pfam_SMAD_dom_Dwarfin-type,pfam_MAD_homology1_Dwarfin-type,superfamily_SMAD_FHA_domain,superfamily_MAD_homology_MH1,smart_MAD_homology1_Dwarfin-type,smart_SMAD_dom_Dwarfin-type,pfscan_MAD_homology_MH1,pfscan_SMAD_dom_Dwarfin-type	p.R445*	ENST00000342988.3	37	c.1333	CCDS11950.1	18	.	.	.	.	.	.	.	.	.	.	C	42	9.519426	0.99193	.	.	ENSG00000141646	ENST00000342988;ENST00000398417	.	.	.	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.3283	0.94273	0.0:1.0:0.0:0.0	.	.	.	.	X	445	.	ENSP00000341551:R445X	R	+	1	2	SMAD4	46857030	1.000000	0.71417	0.643000	0.29450	0.984000	0.73092	4.861000	0.62969	2.861000	0.98227	0.655000	0.94253	CGA	SMAD4	-	pfam_SMAD_dom_Dwarfin-type,superfamily_SMAD_FHA_domain,smart_SMAD_dom_Dwarfin-type,pfscan_SMAD_dom_Dwarfin-type	ENSG00000141646		0.458	SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SMAD4	HGNC	protein_coding	OTTHUMT00000255993.3	-	0.00	71	0	C	NM_005359		48603032	+1	tier1	-	no_errors	ENST00000342988	ensembl	human	known	74_37	nonsense	53.12	30	34	SNP	1.000	T
SOAT2	8435	genome.wustl.edu	37	12	53497990	53497990	+	Splice_Site	SNP	G	G	A			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr12:53497990G>A	ENST00000301466.3	+	2	198	c.138G>A	c.(136-138)gaG>gaA	p.E46E		NM_003578.3	NP_003569.1	O75908	SOAT2_HUMAN	sterol O-acyltransferase 2	46					cholesterol efflux (GO:0033344)|cholesterol esterification (GO:0034435)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|intestinal cholesterol absorption (GO:0030299)|macrophage derived foam cell differentiation (GO:0010742)|very-low-density lipoprotein particle assembly (GO:0034379)	brush border (GO:0005903)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	cholesterol binding (GO:0015485)|cholesterol O-acyltransferase activity (GO:0034736)|fatty-acyl-CoA binding (GO:0000062)|transferase activity, transferring acyl groups (GO:0016746)			endometrium(5)|kidney(3)|large_intestine(2)|liver(1)|lung(5)|ovary(1)|skin(1)	18					Hesperetin(DB01094)	GACACATGGAGGTGAGGGATG	0.493																																																	0													93.0	85.0	88.0					12																	53497990		2203	4300	6503	SO:0001630	splice_region_variant	0			AF059203	CCDS8847.1	12q13.13	2012-09-20			ENSG00000167780	ENSG00000167780	2.3.1.26		11178	protein-coding gene	gene with protein product		601311				9756920	Standard	NM_003578		Approved	ACAT2	uc001sbv.3	O75908	OTTHUMG00000169774	ENST00000301466.3:c.138+1G>A	12.37:g.53497990G>A			F5H7W4|I6L9H9|Q4VB99|Q4VBA1|Q96TD4|Q9UNR2	Silent	SNP	pfam_MBOAT_fam	p.E46	ENST00000301466.3	37	c.138	CCDS8847.1	12																																																																																			SOAT2	-	NULL	ENSG00000167780		0.493	SOAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOAT2	HGNC	protein_coding	OTTHUMT00000405817.1	-	0.00	26	0	G		Silent	53497990	+1	tier1	-	no_errors	ENST00000301466	ensembl	human	known	74_37	silent	38.10	26	16	SNP	1.000	A
SON	6651	genome.wustl.edu	37	21	34927209	34927209	+	Missense_Mutation	SNP	G	G	T	rs140776794		TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr21:34927209G>T	ENST00000356577.4	+	3	6147	c.5672G>T	c.(5671-5673)cGc>cTc	p.R1891L	SON_ENST00000300278.4_Missense_Mutation_p.R1891L|SON_ENST00000381692.2_Intron|SON_ENST00000381679.4_Missense_Mutation_p.R1891L|SON_ENST00000290239.6_Missense_Mutation_p.R1891L	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein	1891					cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						AAAGAGAAGCGCAAAAGATCT	0.458																																																	0													50.0	48.0	49.0					21																	34927209		2203	4300	6503	SO:0001583	missense	0			AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.5672G>T	21.37:g.34927209G>T	ENSP00000348984:p.Arg1891Leu		D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	Missense_Mutation	SNP	pfam_G_patch_dom,superfamily_WD40_repeat_dom,smart_G_patch_dom,pfscan_G_patch_dom,pfscan_dsRNA-bd_dom	p.R1891L	ENST00000356577.4	37	c.5672	CCDS13629.1	21	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.60|14.60	2.582946|2.582946	0.46006|0.46006	.|.	.|.	ENSG00000159140|ENSG00000159140	ENST00000436227|ENST00000356577;ENST00000290239;ENST00000300278;ENST00000381679	.|T;T;T;T	.|0.29397	.|1.57;1.57;1.57;1.57	5.53|5.53	5.53|5.53	0.82687|0.82687	.|.	.|0.000000	.|0.50627	.|D	.|0.000102	T|T	0.33876|0.33876	0.0878|0.0878	N|N	0.08118|0.08118	0|0	0.42989|0.42989	D|D	0.994487|0.994487	.|D;D;D;D;D	.|0.69078	.|0.994;0.99;0.994;0.997;0.997	.|D;P;P;D;D	.|0.65443	.|0.914;0.863;0.834;0.935;0.935	T|T	0.40136|0.40136	-0.9579|-0.9579	5|10	.|0.72032	.|D	.|0.01	.|.	14.3213|14.3213	0.66489|0.66489	0.0:0.0:0.8517:0.1482|0.0:0.0:0.8517:0.1482	.|.	.|1891;1891;1572;1891;1891	.|P18583-10;P18583;P18583-2;P18583-3;P18583-6	.|.;SON_HUMAN;.;.;.	S|L	886|1891	.|ENSP00000348984:R1891L;ENSP00000290239:R1891L;ENSP00000300278:R1891L;ENSP00000371095:R1891L	.|ENSP00000290239:R1891L	A|R	+|+	1|2	0|0	SON|SON	33849079|33849079	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	3.802000|3.802000	0.55553|0.55553	2.607000|2.607000	0.88179|0.88179	0.655000|0.655000	0.94253|0.94253	GCA|CGC	SON	-	NULL	ENSG00000159140		0.458	SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SON	HGNC	protein_coding	OTTHUMT00000140978.2		0.00	63	0	G	NM_138927		34927209	+1			no_errors	ENST00000356577	ensembl	human	known	74_37	missense	5.13	37	2	SNP	0.998	T
SPATA31E1	286234	genome.wustl.edu	37	9	90503589	90503589	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr9:90503589G>C	ENST00000325643.5	+	4	4253	c.4187G>C	c.(4186-4188)aGa>aCa	p.R1396T		NM_178828.4	NP_849150.3	Q6ZUB1	S31E1_HUMAN	SPATA31 subfamily E, member 1	1396					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											AGGGGCATCAGAGACAGAGAC	0.632																																																	0													47.0	46.0	47.0					9																	90503589		2203	4300	6503	SO:0001583	missense	0			AK093185	CCDS6676.1	9q22.1-q22.2	2012-10-12	2012-10-12	2012-10-12	ENSG00000177992	ENSG00000177992			26672	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 79"", ""family with sequence similarity 75, member E1"""	C9orf79, FAM75E1			Standard	NM_178828		Approved	FLJ35866	uc004app.4	Q6ZUB1	OTTHUMG00000020157	ENST00000325643.5:c.4187G>C	9.37:g.90503589G>C	ENSP00000322640:p.Arg1396Thr		B2RPB1|Q5SQC9|Q8NA41|Q8ND27	Missense_Mutation	SNP	NULL	p.R1396T	ENST00000325643.5	37	c.4187	CCDS6676.1	9	.	.	.	.	.	.	.	.	.	.	g	6.699	0.497691	0.12762	.	.	ENSG00000177992	ENST00000325643	T	0.07216	3.21	1.5	-3.01	0.05463	.	1.694850	0.03882	N	0.277281	T	0.10165	0.0249	L	0.34521	1.04	0.09310	N	1	P	0.50528	0.936	P	0.48425	0.577	T	0.25433	-1.0132	10	0.54805	T	0.06	.	6.9779	0.24686	0.3379:0.0:0.6621:0.0	.	1396	Q6ZUB1	CI079_HUMAN	T	1396	ENSP00000322640:R1396T	ENSP00000322640:R1396T	R	+	2	0	C9orf79	89693409	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.240000	0.02914	-1.183000	0.02723	-0.492000	0.04666	AGA	SPATA31E1	-	NULL	ENSG00000177992		0.632	SPATA31E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA31E1	HGNC	protein_coding	OTTHUMT00000052954.2		0.00	49	0	G	NM_178828		90503589	+1			no_errors	ENST00000325643	ensembl	human	known	74_37	missense	5.13	74	4	SNP	0.000	C
SPTBN4	57731	genome.wustl.edu	37	19	41019376	41019376	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr19:41019376G>A	ENST00000352632.3	+	14	2766	c.2680G>A	c.(2680-2682)Gag>Aag	p.E894K	SPTBN4_ENST00000598249.1_Missense_Mutation_p.E894K|SPTBN4_ENST00000338932.3_Missense_Mutation_p.E894K|SPTBN4_ENST00000344104.3_Missense_Mutation_p.E894K|SPTBN4_ENST00000595535.1_Missense_Mutation_p.E894K			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4	894					actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GCACGCGTGTGAGCTGTGGAT	0.652																																																	0													35.0	25.0	29.0					19																	41019376		2203	4300	6503	SO:0001583	missense	0			AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.2680G>A	19.37:g.41019376G>A	ENSP00000263373:p.Glu894Lys		E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	Missense_Mutation	SNP	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,pfam_CH-domain,pfam_Pleckstrin_homology,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Pleckstrin_homology,prints_PH_dom-spectrin-type,pfscan_CH-domain,pfscan_Pleckstrin_homology	p.E894K	ENST00000352632.3	37	c.2680	CCDS12559.1	19	.	.	.	.	.	.	.	.	.	.	G	17.89	3.499686	0.64298	.	.	ENSG00000160460	ENST00000428507;ENST00000352632;ENST00000338932;ENST00000344104	T;T;T	0.54279	0.58;0.58;0.58	3.28	2.22	0.28083	.	0.257659	0.24710	U	0.036221	T	0.61261	0.2333	M	0.76727	2.345	0.80722	D	1	D;P	0.57257	0.979;0.866	P;B	0.54759	0.76;0.41	T	0.61148	-0.7121	10	0.42905	T	0.14	.	9.6966	0.40161	0.1107:0.0:0.8893:0.0	.	894;894	Q9H254;Q71S06	SPTN4_HUMAN;.	K	894	ENSP00000263373:E894K;ENSP00000340345:E894K;ENSP00000340741:E894K	ENSP00000340345:E894K	E	+	1	0	SPTBN4	45711216	1.000000	0.71417	0.999000	0.59377	0.873000	0.50193	3.677000	0.54619	0.716000	0.32124	0.313000	0.20887	GAG	SPTBN4	-	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000160460		0.652	SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTBN4	HGNC	protein_coding	OTTHUMT00000462559.2		0.00	11	0	G			41019376	+1			no_errors	ENST00000352632	ensembl	human	known	74_37	missense	29.41	12	5	SNP	1.000	A
PILRB	29990	genome.wustl.edu	37	7	99943553	99943553	+	5'UTR	DEL	T	T	-			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr7:99943553delT	ENST00000610247.1	+	0	493				STAG3L5P-PVRIG2P-PILRB_ENST00000310771.4_RNA|STAG3L5P_ENST00000493499.1_RNA			Q9UKJ0	PILRB_HUMAN	paired immunoglobin-like type 2 receptor beta						activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)				endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	13	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TGTGAAGGGATTTTTTTTTTT	0.413																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AF161081, AJ400845	CCDS43622.1	7q22.1	2014-05-16			ENSG00000121716	ENSG00000121716		"""Immunoglobulin superfamily / V-set domain containing"""	18297	protein-coding gene	gene with protein product		605342				10660620	Standard	NM_178238		Approved	FDFACT1, FDFACT2	uc022ail.1	Q9UKJ0	OTTHUMG00000155363	ENST00000610247.1:c.-2004T>-	7.37:g.99943553delT			Q69YF9|Q9HBS0	RNA	DEL	-	NULL	ENST00000610247.1	37	NULL	CCDS43622.1	7																																																																																			STAG3L5P-PVRIG2P-PILRB	-	-	ENSG00000272752		0.413	PILRB-202	KNOWN	basic|appris_principal|CCDS	protein_coding	STAG3L5P-PVRIG2P-PILRB	HGNC	protein_coding			0.00	31	0	T	NM_178238		99943553	+1	tier1		no_errors	ENST00000310771	ensembl	human	known	74_37	rna	9.26	49	5	DEL	0.002	-
SZT2	23334	genome.wustl.edu	37	1	43891189	43891189	+	Missense_Mutation	SNP	A	A	T			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr1:43891189A>T	ENST00000562955.1	+	19	2690	c.2690A>T	c.(2689-2691)gAg>gTg	p.E897V	SZT2_ENST00000372442.1_Missense_Mutation_p.E55V	NM_015284.3	NP_056099.3	Q5T011	SZT2_HUMAN	seizure threshold 2 homolog (mouse)	897					central nervous system development (GO:0007417)|corpus callosum morphogenesis (GO:0021540)|embryo development (GO:0009790)|pigmentation (GO:0043473)|post-embryonic development (GO:0009791)|regulation of superoxide dismutase activity (GO:1901668)	extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)				NS(2)|breast(9)|central_nervous_system(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(39)|ovary(4)|pancreas(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	113						GAGGCCCTGGAGGGAGACTCA	0.572																																																	0													123.0	127.0	126.0					1																	43891189		2203	4300	6503	SO:0001583	missense	0			AB007936	CCDS30694.1, CCDS30694.2	1p34.2	2012-11-19	2011-06-10	2011-06-10	ENSG00000198198	ENSG00000198198			29040	protein-coding gene	gene with protein product	"""seizure threshold 2 homolog A (mouse)"", ""seizure threshold 2 homolog B (mouse)"""	615463	"""chromosome 1 open reading frame 84"", ""KIAA0467"""	C1orf84, KIAA0467		9455484	Standard	NM_015284		Approved	FLJ10387, SZT2B, RP11-506B15.1, FLJ34502, SZT2A	uc001cjk.3	Q5T011	OTTHUMG00000007423	ENST00000562955.1:c.2690A>T	1.37:g.43891189A>T	ENSP00000457168:p.Glu897Val		A0PJK5|A7E2X4|O75055|Q5JUY7|Q5T012|Q5XKC7|Q6ZNI8|Q6ZT24|Q7Z636|Q8NAY9|Q9H5H7|Q9UFQ8	Missense_Mutation	SNP	NULL	p.E897V	ENST00000562955.1	37	c.2690	CCDS30694.2	1	.	.	.	.	.	.	.	.	.	.	A	29.7	5.032533	0.93575	.	.	ENSG00000198198	ENST00000372442	.	.	.	6.02	6.02	0.97574	.	0.169590	0.51477	D	0.000087	T	0.66636	0.2809	L	0.42245	1.32	0.39141	D	0.962032	D;D	0.67145	0.963;0.996	P;P	0.58266	0.776;0.836	T	0.71328	-0.4626	9	0.87932	D	0	.	16.5446	0.84426	1.0:0.0:0.0:0.0	.	897;897	Q5T011-4;Q5T011-5	.;.	V	55	.	ENSP00000361519:E55V	E	+	2	0	SZT2	43663776	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.859000	0.92264	2.311000	0.77944	0.533000	0.62120	GAG	SZT2	-	NULL	ENSG00000198198		0.572	SZT2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SZT2	HGNC	protein_coding	OTTHUMT00000019517.3	-	0.00	16	0	A	NM_015284		43891189	+1	tier1	-	no_errors	ENST00000562955	ensembl	human	known	74_37	missense	31.25	11	5	SNP	1.000	T
TAGAP	117289	genome.wustl.edu	37	6	159457656	159457656	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr6:159457656C>T	ENST00000367066.3	-	10	1730	c.1399G>A	c.(1399-1401)Gcg>Acg	p.A467T	RP1-111C20.4_ENST00000607391.1_RNA|RP1-111C20.4_ENST00000607796.1_RNA|RP1-111C20.4_ENST00000606470.1_RNA|RP1-111C20.4_ENST00000606466.1_RNA|TAGAP_ENST00000326965.6_Missense_Mutation_p.A289T	NM_001278733.1|NM_054114.3	NP_001265662.1|NP_473455.2	Q8N103	TAGAP_HUMAN	T-cell activation RhoGTPase activating protein	467					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)			NS(1)|autonomic_ganglia(1)|endometrium(3)|large_intestine(8)|lung(7)|ovary(2)|skin(1)	23		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.16e-16)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		TCAGAGGACGCGTCCAGCGAG	0.567																																																	0													90.0	104.0	99.0					6																	159457656		2203	4300	6503	SO:0001583	missense	0			AF385429	CCDS5261.1, CCDS5262.1, CCDS5263.1	6q25.3	2011-09-07	2008-03-25		ENSG00000164691	ENSG00000164691		"""Rho GTPase activating proteins"""	15669	protein-coding gene	gene with protein product		609667	"""T-cell activation GTPase activating protein"""			16375659, 18311140, 18356936	Standard	NM_152133		Approved	FLJ32631, IDDM21, ARHGAP47	uc003qrz.3	Q8N103	OTTHUMG00000015923	ENST00000367066.3:c.1399G>A	6.37:g.159457656C>T	ENSP00000356033:p.Ala467Thr		Q2NKM8|Q8NI40|Q96KZ2|Q96QA2	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.A467T	ENST00000367066.3	37	c.1399	CCDS5261.1	6	.	.	.	.	.	.	.	.	.	.	C	9.271	1.045566	0.19748	.	.	ENSG00000164691	ENST00000367066;ENST00000326965;ENST00000539071	T;T	0.17691	2.26;2.51	6.05	1.85	0.25348	.	0.464779	0.21918	N	0.067206	T	0.05547	0.0146	L	0.57536	1.79	0.36967	D	0.893641	B	0.26602	0.154	B	0.11329	0.006	T	0.14924	-1.0455	10	0.27082	T	0.32	-6.2722	6.5681	0.22523	0.0:0.4156:0.0:0.5844	.	467	Q8N103	TAGAP_HUMAN	T	467;289;132	ENSP00000356033:A467T;ENSP00000322650:A289T	ENSP00000322650:A289T	A	-	1	0	TAGAP	159377644	0.028000	0.19301	0.000000	0.03702	0.002000	0.02628	1.438000	0.35002	0.465000	0.27167	-0.157000	0.13467	GCG	TAGAP	-	NULL	ENSG00000164691		0.567	TAGAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TAGAP	HGNC	protein_coding	OTTHUMT00000042890.1	-	0.00	37	0	C	NM_054114		159457656	-1	tier1	-	no_errors	ENST00000367066	ensembl	human	known	74_37	missense	30.51	41	18	SNP	0.000	T
TAS2R39	259285	genome.wustl.edu	37	7	142880943	142880943	+	Frame_Shift_Del	DEL	C	C	-			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr7:142880943delC	ENST00000446620.1	+	1	432	c.432delC	c.(430-432)tacfs	p.Y144fs		NM_176881.2	NP_795362.2	P59534	T2R39_HUMAN	taste receptor, type 2, member 39	144					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	20	Melanoma(164;0.059)					ATTTCTCCTACCCCCTTTTCC	0.408																																																	0													92.0	85.0	87.0					7																	142880943		1883	4100	5983	SO:0001589	frameshift_variant	0			AF494230	CCDS47729.1	7q34	2012-08-22			ENSG00000236398	ENSG00000236398		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18886	protein-coding gene	gene with protein product						12379855	Standard	NM_176881		Approved		uc011ksw.2	P59534	OTTHUMG00000152636	ENST00000446620.1:c.432delC	7.37:g.142880943delC	ENSP00000405095:p.Tyr144fs		A4FUI7|Q3ZCN6|Q645W4	Frame_Shift_Del	DEL	pfam_TAS2_rcpt	p.L146fs	ENST00000446620.1	37	c.432	CCDS47729.1	7																																																																																			TAS2R39	-	pfam_TAS2_rcpt	ENSG00000236398		0.408	TAS2R39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R39	HGNC	protein_coding	OTTHUMT00000327090.2		0.00	34	0	C	NM_176881		142880943	+1	tier1		no_errors	ENST00000446620	ensembl	human	known	74_37	frame_shift_del	10.53	34	4	DEL	0.032	-
TCF7L1	83439	genome.wustl.edu	37	2	85361007	85361007	+	Nonsense_Mutation	SNP	C	C	A			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr2:85361007C>A	ENST00000282111.3	+	1	475	c.200C>A	c.(199-201)tCg>tAg	p.S67*		NM_031283.2	NP_112573.1	Q9HCS4	TF7L1_HUMAN	transcription factor 7-like 1 (T-cell specific, HMG-box)	67	CTNNB1-binding. {ECO:0000250}.				anterior/posterior axis specification, embryo (GO:0008595)|axial mesoderm morphogenesis (GO:0048319)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|chromatin organization (GO:0006325)|generation of neurons (GO:0048699)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|skin(4)|upper_aerodigestive_tract(1)	18						GAGGTCAAGTCGTCCCTGGTC	0.692																																																	0													22.0	22.0	22.0					2																	85361007		2181	4263	6444	SO:0001587	stop_gained	0			X62870	CCDS1971.1	2p11.2	2008-02-05			ENSG00000152284	ENSG00000152284			11640	protein-coding gene	gene with protein product		604652		TCF3		1741298, 11085512	Standard	NM_031283		Approved		uc002soy.3	Q9HCS4	OTTHUMG00000130026	ENST00000282111.3:c.200C>A	2.37:g.85361007C>A	ENSP00000282111:p.Ser67*		Q53R97|Q6PD70|Q9NP00	Nonsense_Mutation	SNP	pfam_CTNNB1-bd_N,pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.S67*	ENST00000282111.3	37	c.200	CCDS1971.1	2	.	.	.	.	.	.	.	.	.	.	C	40	8.152664	0.98680	.	.	ENSG00000152284	ENST00000282111	.	.	.	3.92	3.01	0.34805	.	0.000000	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.808	0.34950	0.0:0.8837:0.0:0.1163	.	.	.	.	X	67	.	ENSP00000282111:S67X	S	+	2	0	TCF7L1	85214518	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.699000	0.74613	1.881000	0.54492	0.563000	0.77884	TCG	TCF7L1	-	pfam_CTNNB1-bd_N	ENSG00000152284		0.692	TCF7L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCF7L1	HGNC	protein_coding	OTTHUMT00000252301.2	-	0.00	48	0	C	NM_031283		85361007	+1	tier1	-	no_errors	ENST00000282111	ensembl	human	known	74_37	nonsense	28.30	38	15	SNP	1.000	A
TEAD4	7004	genome.wustl.edu	37	12	3147205	3147205	+	Silent	SNP	C	C	A	rs376977078		TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr12:3147205C>A	ENST00000397122.2	+	9	867	c.582C>A	c.(580-582)ccC>ccA	p.P194P	TEAD4_ENST00000358409.2_Silent_p.P280P|TEAD4_ENST00000359864.2_Silent_p.P323P	NM_201443.2	NP_958851.1	Q15561	TEAD4_HUMAN	TEA domain family member 4	323					gene expression (GO:0010467)|hippo signaling (GO:0035329)|muscle organ development (GO:0007517)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P323P(1)		endometrium(2)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(1)	10	Ovarian(42;0.211)		OV - Ovarian serous cystadenocarcinoma(31;0.000563)|COAD - Colon adenocarcinoma(12;0.0831)			ATGAGAGCCCCGAGAACATGA	0.597																																																	1	Substitution - coding silent(1)	endometrium(1)											89.0	74.0	79.0					12																	3147205		2203	4300	6503	SO:0001819	synonymous_variant	0			X94438	CCDS31729.1, CCDS31730.1, CCDS41737.1	12p13.3-p13.2	2008-05-14				ENSG00000197905			11717	protein-coding gene	gene with protein product		601714		TCF13L1		9889009, 8921372	Standard	NM_003213		Approved	TEF-3, TEFR-1, EFTR-2, RTEF-1	uc010sej.2	Q15561		ENST00000397122.2:c.582C>A	12.37:g.3147205C>A			H0Y308|Q6MZR9|Q8NEV5|Q92883|Q96BK2	Silent	SNP	pfam_TEA/ATTS,smart_TEA/ATTS,pirsf_TEF,pfscan_TEA/ATTS,prints_TEA/ATTS	p.P323	ENST00000397122.2	37	c.969	CCDS41737.1	12																																																																																			TEAD4	-	pfam_TEA/ATTS,pirsf_TEF	ENSG00000197905		0.597	TEAD4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	TEAD4	HGNC	protein_coding	OTTHUMT00000398477.1		0.00	30	0	C	NM_003213		3147205	+1			no_errors	ENST00000359864	ensembl	human	known	74_37	silent	6.90	27	2	SNP	0.016	A
TMC5	79838	genome.wustl.edu	37	16	19475199	19475199	+	Silent	SNP	C	C	T			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr16:19475199C>T	ENST00000396229.2	+	8	2087	c.1338C>T	c.(1336-1338)gtC>gtT	p.V446V	TMC5_ENST00000219821.5_Silent_p.V200V|TMC5_ENST00000561503.1_Silent_p.V87V|TMC5_ENST00000542583.2_Silent_p.V446V|TMC5_ENST00000564959.1_Silent_p.V129V|TMC5_ENST00000381414.4_Silent_p.V446V|TMC5_ENST00000541464.1_Silent_p.V446V	NM_001105248.1	NP_001098718.1	Q6UXY8	TMC5_HUMAN	transmembrane channel-like 5	446					ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(3)|liver(2)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	31						GAACCAGCGTCCTCTCCTATT	0.448																																																	0													136.0	117.0	123.0					16																	19475199		2197	4300	6497	SO:0001819	synonymous_variant	0			AY263164	CCDS10577.1, CCDS42126.1, CCDS45431.1	16p13.11	2008-02-05			ENSG00000103534	ENSG00000103534			22999	protein-coding gene	gene with protein product						12812529, 12906855	Standard	NM_024780		Approved	FLJ13593	uc010var.2	Q6UXY8	OTTHUMG00000131458	ENST00000396229.2:c.1338C>T	16.37:g.19475199C>T			Q68DK8|Q8IY20|Q8NHV6|Q9H8I7	Silent	SNP	pfam_TMC	p.V446	ENST00000396229.2	37	c.1338	CCDS45431.1	16																																																																																			TMC5	-	NULL	ENSG00000103534		0.448	TMC5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TMC5	HGNC	protein_coding	OTTHUMT00000435888.1	-	0.00	51	0	C	NM_024780		19475199	+1	tier1	-	no_errors	ENST00000396229	ensembl	human	known	74_37	silent	38.46	24	15	SNP	0.999	T
TMEM249	340393	genome.wustl.edu	37	8	145577021	145577021	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr8:145577021C>A	ENST00000398633.3	-	5	841	c.695G>T	c.(694-696)aGc>aTc	p.S232I	TMEM249_ENST00000531225.1_3'UTR|FBXL6_ENST00000526524.1_5'Flank	NM_001252402.1	NP_001239331.1	Q2WGJ8	TM249_HUMAN	transmembrane protein 249	232						integral component of membrane (GO:0016021)											CACCTCCAGGCTGGACTGAGA	0.642																																																	0																																										SO:0001583	missense	0				CCDS59117.1	8q24.3	2012-07-02			ENSG00000214597	ENSG00000261587			44155	protein-coding gene	gene with protein product							Standard	NM_001252402		Approved	C8orfK29	uc011llb.2	Q2WGJ8	OTTHUMG00000165167	ENST00000398633.3:c.695G>T	8.37:g.145577021C>A	ENSP00000381630:p.Ser232Ile			Missense_Mutation	SNP	NULL	p.S232I	ENST00000398633.3	37	c.695	CCDS59117.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	5.623|5.623	0.299649|0.299649	0.10622|0.10622	.|.	.|.	ENSG00000214597|ENSG00000214597	ENST00000526263|ENST00000398633;ENST00000531225	.|.	.|.	.|.	2.71|2.71	-1.69|-1.69	0.08186|0.08186	.|.	.|.	.|.	.|.	.|.	T|T	0.24967|0.24967	0.0606|0.0606	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	P|B	0.40032|0.26483	0.699|0.15	B|B	0.34931|0.23716	0.192|0.048	T|T	0.21895|0.21895	-1.0232|-1.0232	7|7	0.87932|0.52906	D|T	0|0.07	-6.2403|-6.2403	3.0741|3.0741	0.06241|0.06241	0.0:0.2778:0.2276:0.4946|0.0:0.2778:0.2276:0.4946	.|.	200|232	E9PKR6|Q2WGJ8	.|CHK29_HUMAN	H|I	200|232	.|.	ENSP00000435362:Q200H|ENSP00000381630:S232I	Q|S	-|-	3|2	2|0	GS1-393G12.10|GS1-393G12.10	145547829|145547829	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.122000|0.122000	0.20287|0.20287	0.225000|0.225000	0.17757|0.17757	-0.255000|-0.255000	0.09486|0.09486	-0.459000|-0.459000	0.05422|0.05422	CAG|AGC	TMEM249	-	NULL	ENSG00000214597		0.642	TMEM249-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM249	HGNC	protein_coding	OTTHUMT00000382802.1		0.00	32	0	C	NM_001252402		145577021	-1			no_errors	ENST00000398633	ensembl	human	known	74_37	missense	10.28	96	11	SNP	0.001	A
TNS1	7145	genome.wustl.edu	37	2	218750792	218750792	+	Nonsense_Mutation	SNP	G	G	A			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr2:218750792G>A	ENST00000171887.4	-	12	1092	c.640C>T	c.(640-642)Caa>Taa	p.Q214*	TNS1_ENST00000419504.1_Nonsense_Mutation_p.Q214*|TNS1_ENST00000430930.1_Nonsense_Mutation_p.Q214*|TNS1_ENST00000310858.6_Nonsense_Mutation_p.Q245*	NM_022648.4	NP_072174.3	Q9HBL0	TENS1_HUMAN	tensin 1	214	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				cell-substrate junction assembly (GO:0007044)|fibroblast migration (GO:0010761)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(23)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	79		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		TACACAGGTTGCATGGCCTGG	0.552																																																	0													128.0	118.0	121.0					2																	218750792		2203	4300	6503	SO:0001587	stop_gained	0			AB209238	CCDS2407.1	2q35-q36	2014-06-13	2005-05-13	2005-05-13	ENSG00000079308	ENSG00000079308		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	11973	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 155"""	600076	"""tensin"", ""matrix-remodelling associated 6"""	TNS, MXRA6			Standard	NM_022648		Approved	DKFZp586K0617, PPP1R155	uc002vgt.2	Q9HBL0	OTTHUMG00000133056	ENST00000171887.4:c.640C>T	2.37:g.218750792G>A	ENSP00000171887:p.Gln214*		Q4ZG71|Q6IPI5	Nonsense_Mutation	SNP	pfam_PTB,pfam_Tensin_phosphatase_C2-dom,pfam_SH2,superfamily_C2_dom,smart_Tyr_Pase_cat,smart_SH2,smart_PTB/PI_dom,pfscan_SH2,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.Q214*	ENST00000171887.4	37	c.640	CCDS2407.1	2	.	.	.	.	.	.	.	.	.	.	G	38	6.997460	0.97990	.	.	ENSG00000079308	ENST00000171887;ENST00000419504;ENST00000430930;ENST00000446903;ENST00000413554;ENST00000310858	.	.	.	5.08	5.08	0.68730	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	17.4107	0.87485	0.0:0.0:1.0:0.0	.	.	.	.	X	214;214;214;339;282;245	.	ENSP00000171887:Q214X	Q	-	1	0	TNS1	218459037	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.356000	0.97091	2.646000	0.89796	0.561000	0.74099	CAA	TNS1	-	pfam_Tensin_phosphatase_C2-dom,superfamily_C2_dom,pfscan_Tensin_phosphatase_C2-dom	ENSG00000079308		0.552	TNS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TNS1	HGNC	protein_coding	OTTHUMT00000256672.2	-	0.00	33	0	G	NM_022648		218750792	-1	tier1	-	no_errors	ENST00000171887	ensembl	human	known	74_37	nonsense	8.70	42	4	SNP	1.000	A
TP53	7157	genome.wustl.edu	37	17	7578479	7578479	+	Missense_Mutation	SNP	G	G	A	rs28934874|rs137852790|rs137852791		TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr17:7578479G>A	ENST00000269305.4	-	5	640	c.451C>T	c.(451-453)Ccc>Tcc	p.P151S	TP53_ENST00000445888.2_Missense_Mutation_p.P151S|TP53_ENST00000420246.2_Missense_Mutation_p.P151S|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.P151S|TP53_ENST00000359597.4_Missense_Mutation_p.P151S|TP53_ENST00000413465.2_Missense_Mutation_p.P151S	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	151	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		P -> A (in sporadic cancers; somatic mutation).|P -> H (in sporadic cancers; somatic mutation).|P -> L (in sporadic cancers; somatic mutation).|P -> R (in sporadic cancers; somatic mutation).|P -> S (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs28934874). {ECO:0000269|PubMed:7682763}.|P -> T (in LFS; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.P151S(68)|p.P151T(16)|p.P151A(13)|p.P152fs*18(9)|p.0?(8)|p.T150fs*16(6)|p.P151fs*30(6)|p.?(5)|p.P58A(2)|p.P58S(2)|p.P19A(2)|p.P19S(2)|p.P151_V173del23(1)|p.P152_P153del(1)|p.P152fs*28(1)|p.T57fs*16(1)|p.P151del(1)|p.D148_T155delDSTPPPGT(1)|p.T150_P153delTPPP(1)|p.D148fs*23(1)|p.S149fs*72(1)|p.P58T(1)|p.S149fs*17(1)|p.Q144_G154del11(1)|p.Q144fs*16(1)|p.P19T(1)|p.P152fs*14(1)|p.T18fs*16(1)|p.T150_P151delTP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCGGGCGGGGGTGTGGAATCA	0.612		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	156	Substitution - Missense(107)|Deletion - Frameshift(23)|Whole gene deletion(8)|Deletion - In frame(7)|Insertion - Frameshift(6)|Unknown(5)	upper_aerodigestive_tract(20)|large_intestine(17)|ovary(16)|lung(15)|oesophagus(12)|endometrium(11)|stomach(9)|breast(9)|central_nervous_system(7)|liver(7)|skin(7)|haematopoietic_and_lymphoid_tissue(5)|soft_tissue(4)|urinary_tract(4)|prostate(4)|bone(4)|vulva(2)|pancreas(2)|biliary_tract(1)	GRCh37	CM012662|CM941326	TP53	M	rs28934874						55.0	55.0	55.0					17																	7578479		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.451C>T	17.37:g.7578479G>A	ENSP00000269305:p.Pro151Ser		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.P151S	ENST00000269305.4	37	c.451	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	17.73	3.460739	0.63513	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99881	-7.47;-7.47;-7.47;-7.47;-7.47;-7.47;-7.47;-7.47;-7.47	5.59	5.59	0.84812	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.110207	0.64402	D	0.000007	D	0.99894	0.9949	M	0.87038	2.855	0.54753	D	0.999985	D;P;P;P;D;P;D	0.89917	0.99;0.941;0.92;0.835;0.98;0.953;1.0	P;P;P;P;P;P;D	0.97110	0.793;0.749;0.814;0.652;0.837;0.837;1.0	D	0.96419	0.9310	10	0.87932	D	0	-14.1156	17.4784	0.87667	0.0:0.0:1.0:0.0	rs28934874	112;151;151;58;151;151;151	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	S	151;151;151;151;151;151;140;58;19;58;19;151	ENSP00000410739:P151S;ENSP00000352610:P151S;ENSP00000269305:P151S;ENSP00000398846:P151S;ENSP00000391127:P151S;ENSP00000391478:P151S;ENSP00000425104:P19S;ENSP00000423862:P58S;ENSP00000424104:P151S	ENSP00000269305:P151S	P	-	1	0	TP53	7519204	1.000000	0.71417	0.971000	0.41717	0.067000	0.16453	7.823000	0.86660	2.804000	0.96469	0.655000	0.94253	CCC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000141510		0.612	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	15	0	G	NM_000546		7578479	-1	tier1	rs28934874	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	86.11	5	31	SNP	0.999	A
TOP3A	7156	genome.wustl.edu	37	17	18217912	18217912	+	Splice_Site	SNP	C	C	T			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr17:18217912C>T	ENST00000321105.5	-	1	395		c.e1+1		TOP3A_ENST00000542570.1_Splice_Site|SMCR8_ENST00000406438.3_5'Flank|TOP3A_ENST00000582230.1_Splice_Site	NM_004618.3	NP_004609.1	Q13472	TOP3A_HUMAN	topoisomerase (DNA) III alpha						DNA topological change (GO:0006265)|meiotic nuclear division (GO:0007126)	chromosome (GO:0005694)|nucleus (GO:0005634)|PML body (GO:0016605)	DNA binding (GO:0003677)|DNA topoisomerase type I activity (GO:0003917)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(15)|ovary(1)|skin(6)|stomach(2)|urinary_tract(1)	36						CGCTTTCTTACCCGCCTCATG	0.622																																																	0													58.0	49.0	52.0					17																	18217912		2203	4300	6503	SO:0001630	splice_region_variant	0			U43431	CCDS11194.1	17p12-p11.2	2014-02-18			ENSG00000177302	ENSG00000177302			11992	protein-coding gene	gene with protein product	"""zinc finger, GRF-type containing 7"""	601243		TOP3		9450867	Standard	NM_004618		Approved	ZGRF7	uc002gsx.1	Q13472	OTTHUMG00000059391	ENST00000321105.5:c.180+1G>A	17.37:g.18217912C>T			A8KA61|B4DK80|D3DXC7|Q13473	Splice_Site	SNP	-	e1+1	ENST00000321105.5	37	c.180+1	CCDS11194.1	17	.	.	.	.	.	.	.	.	.	.	C	34	5.387161	0.95988	.	.	ENSG00000177302	ENST00000412083;ENST00000321105	.	.	.	5.44	5.44	0.79542	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.4628	0.94924	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TOP3A	18158637	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.928000	0.75846	2.837000	0.97791	0.655000	0.94253	.	TOP3A	-	-	ENSG00000177302		0.622	TOP3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOP3A	HGNC	protein_coding	OTTHUMT00000132052.2		0.00	20	0	C		Intron	18217912	-1			no_errors	ENST00000321105	ensembl	human	known	74_37	splice_site	7.50	37	3	SNP	1.000	T
TPO	7173	genome.wustl.edu	37	2	1500468	1500468	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr2:1500468G>T	ENST00000345913.4	+	13	2408	c.2317G>T	c.(2317-2319)Gag>Tag	p.E773*	TPO_ENST00000349624.3_Nonsense_Mutation_p.E600*|TPO_ENST00000337415.3_Nonsense_Mutation_p.E773*|TPO_ENST00000329066.4_Nonsense_Mutation_p.E773*|TPO_ENST00000382201.3_Nonsense_Mutation_p.E716*|TPO_ENST00000497517.2_Intron|TPO_ENST00000382198.1_Nonsense_Mutation_p.E600*|TPO_ENST00000346956.3_Nonsense_Mutation_p.E773*	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	773	Sushi. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	GCACGGGTATGAGCTCCAAGG	0.562																																																	0													148.0	146.0	147.0					2																	1500468		2203	4300	6503	SO:0001587	stop_gained	0				CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.2317G>T	2.37:g.1500468G>T	ENSP00000318820:p.Glu773*		P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Nonsense_Mutation	SNP	pfam_Haem_peroxidase_animal,pfam_EGF-like_Ca-bd_dom,superfamily_Haem_peroxidase,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Sushi_SCR_CCP,pfscan_Haem_peroxidase_animal,prints_Haem_peroxidase_animal_subgr	p.E773*	ENST00000345913.4	37	c.2317	CCDS1643.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.6|24.6	4.554390|4.554390	0.86231|0.86231	.|.	.|.	ENSG00000115705|ENSG00000115705	ENST00000337415;ENST00000345913;ENST00000346956;ENST00000349624;ENST00000329066;ENST00000382201;ENST00000382198;ENST00000422464;ENST00000469607|ENST00000446278	.|.	.|.	.|.	5.14|5.14	-3.52|-3.52	0.04682|0.04682	.|.	1.155990|.	0.06236|.	N|.	0.689607|.	.|T	.|0.35998	.|0.0951	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.40270	.|-0.9572	.|4	0.05351|.	T|.	0.99|.	-7.0889|-7.0889	13.3446|13.3446	0.60564|0.60564	0.1431:0.6253:0.2316:0.0|0.1431:0.6253:0.2316:0.0	.|.	.|.	.|.	.|.	X|I	773;773;773;600;773;716;600;702;247|247	.|.	ENSP00000329869:E773X|.	E|M	+|+	1|3	0|0	TPO|TPO	1479475|1479475	0.001000|0.001000	0.12720|0.12720	0.000000|0.000000	0.03702|0.03702	0.004000|0.004000	0.04260|0.04260	0.029000|0.029000	0.13666|0.13666	-0.541000|-0.541000	0.06257|0.06257	0.591000|0.591000	0.81541|0.81541	GAG|ATG	TPO	-	superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000115705		0.562	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TPO	HGNC	protein_coding	OTTHUMT00000206594.2	-	0.00	37	0	G	NM_000547		1500468	+1	tier1	-	no_errors	ENST00000329066	ensembl	human	known	74_37	nonsense	7.14	52	4	SNP	0.000	T
TRAF1	7185	genome.wustl.edu	37	9	123688278	123688278	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr9:123688278C>T	ENST00000373887.3	-	2	2521	c.76G>A	c.(76-78)Gtc>Atc	p.V26I	TRAF1_ENST00000540010.1_Missense_Mutation_p.V26I	NM_005658.4	NP_005649.1	Q13077	TRAF1_HUMAN	TNF receptor-associated factor 1	26					apoptotic process (GO:0006915)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein complex assembly (GO:0006461)|regulation of extrinsic apoptotic signaling pathway (GO:2001236)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	thioesterase binding (GO:0031996)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)|ovary(4)|pancreas(1)|skin(2)	22						TCCTGGCAGACGGTGGGAGGG	0.637																																																	0													46.0	45.0	45.0					9																	123688278		2203	4300	6503	SO:0001583	missense	0			AK090468	CCDS6825.1, CCDS55335.1	9q33-q34	2008-02-05			ENSG00000056558	ENSG00000056558			12031	protein-coding gene	gene with protein product		601711				8069916	Standard	NM_001190945		Approved	EBI6	uc010mvl.2	Q13077	OTTHUMG00000020578	ENST00000373887.3:c.76G>A	9.37:g.123688278C>T	ENSP00000362994:p.Val26Ile		B4DJ77|Q658U1|Q8NF13	Missense_Mutation	SNP	pfam_MATH,superfamily_TRAF-like,smart_MATH,pirsf_TNF_rcpt--assoc_TRAF,pfscan_MATH	p.V26I	ENST00000373887.3	37	c.76	CCDS6825.1	9	.	.	.	.	.	.	.	.	.	.	C	6.736	0.504549	0.12822	.	.	ENSG00000056558	ENST00000373887;ENST00000540010	T;T	0.22743	1.94;1.94	5.63	-1.74	0.08056	.	2.721080	0.00995	N	0.003589	T	0.08403	0.0209	N	0.11427	0.14	0.09310	N	0.999996	B	0.02656	0.0	B	0.01281	0.0	T	0.15122	-1.0448	10	0.05721	T	0.95	-1.8187	0.9901	0.01454	0.1612:0.2639:0.1584:0.4165	.	26	Q13077	TRAF1_HUMAN	I	26	ENSP00000362994:V26I;ENSP00000443183:V26I	ENSP00000362994:V26I	V	-	1	0	TRAF1	122728099	0.002000	0.14202	0.000000	0.03702	0.424000	0.31475	-0.150000	0.10189	-0.172000	0.10779	-0.309000	0.09137	GTC	TRAF1	-	pirsf_TNF_rcpt--assoc_TRAF	ENSG00000056558		0.637	TRAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAF1	HGNC	protein_coding	OTTHUMT00000053843.1	-	0.00	46	0	C	NM_005658		123688278	-1	tier1	-	no_errors	ENST00000373887	ensembl	human	known	74_37	missense	35.48	60	33	SNP	0.000	T
TRIM17	51127	genome.wustl.edu	37	1	228602544	228602544	+	Missense_Mutation	SNP	T	T	A			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr1:228602544T>A	ENST00000366697.2	-	1	1186	c.230A>T	c.(229-231)aAc>aTc	p.N77I	TRIM17_ENST00000366698.2_Missense_Mutation_p.N77I|TRIM17_ENST00000456946.2_Missense_Mutation_p.N77I|TRIM17_ENST00000295033.3_Missense_Mutation_p.N77I			Q9Y577	TRI17_HUMAN	tripartite motif containing 17	77					protein autoubiquitination (GO:0051865)	intracellular (GO:0005622)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)	10		Prostate(94;0.0724)				CAGCAGCCGGTTGGGCAGCAG	0.642																																																	0													50.0	50.0	50.0					1																	228602544		2203	4300	6503	SO:0001583	missense	0			AF156271	CCDS1571.1, CCDS44327.1	1q42	2013-01-09	2011-01-25	2001-11-30	ENSG00000162931	ENSG00000162931		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	13430	protein-coding gene	gene with protein product	"""ring finger protein 16"", ""RING finger protein terf"", ""testis RING finger protein"""	606123	"""tripartite motif-containing 17"""	RNF16		9792805, 10894938	Standard	NM_016102		Approved	terf, RBCC	uc001hsv.3	Q9Y577	OTTHUMG00000039974	ENST00000366697.2:c.230A>T	1.37:g.228602544T>A	ENSP00000355658:p.Asn77Ile		B4DVJ2|Q5VST8	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.N77I	ENST00000366697.2	37	c.230	CCDS1571.1	1	.	.	.	.	.	.	.	.	.	.	T	18.02	3.529875	0.64860	.	.	ENSG00000162931	ENST00000366697;ENST00000366698;ENST00000295033;ENST00000456946;ENST00000479800;ENST00000355586	T;T;T;T;T;T	0.21543	2.0;2.0;2.0;2.0;2.0;2.0	4.82	4.82	0.62117	Zinc finger, RING/FYVE/PHD-type (1);	0.000000	0.46145	D	0.000305	T	0.48978	0.1530	M	0.88241	2.94	0.36149	D	0.847307	D;D	0.89917	1.0;0.961	D;P	0.97110	1.0;0.708	T	0.63795	-0.6556	10	0.87932	D	0	.	8.4377	0.32797	0.1744:0.0:0.0:0.8256	.	77;77	Q9Y577-2;Q9Y577	.;TRI17_HUMAN	I	77;77;77;77;50;77	ENSP00000355658:N77I;ENSP00000355659:N77I;ENSP00000295033:N77I;ENSP00000403312:N77I;ENSP00000430468:N50I;ENSP00000347794:N77I	ENSP00000295033:N77I	N	-	2	0	TRIM17	226669167	1.000000	0.71417	1.000000	0.80357	0.466000	0.32739	1.561000	0.36342	2.107000	0.64212	0.533000	0.62120	AAC	TRIM17	-	NULL	ENSG00000162931		0.642	TRIM17-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TRIM17	HGNC	protein_coding	OTTHUMT00000096439.2	-	0.00	67	0	T	NM_016102		228602544	-1	tier1	-	no_errors	ENST00000295033	ensembl	human	known	74_37	missense	28.05	58	23	SNP	1.000	A
TRIP4	9325	genome.wustl.edu	37	15	64692982	64692982	+	Nonsense_Mutation	SNP	C	C	G			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr15:64692982C>G	ENST00000261884.3	+	5	719	c.659C>G	c.(658-660)tCa>tGa	p.S220*	RN7SL595P_ENST00000582065.1_RNA|TRIP4_ENST00000559565.1_3'UTR	NM_016213.4	NP_057297.2	Q15650	TRIP4_HUMAN	thyroid hormone receptor interactor 4	220					positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	21						CAGCGTGACTCAAACAAGAGC	0.393																																																	0													97.0	93.0	95.0					15																	64692982		2203	4300	6503	SO:0001587	stop_gained	0			L40371	CCDS10194.1	15q22.1	2014-02-17			ENSG00000103671	ENSG00000103671		"""-"""	12310	protein-coding gene	gene with protein product	"""zinc finger, C2HC5-type"""	604501				7776974	Standard	NM_016213		Approved	HsT17391, ZC2HC5	uc002anm.3	Q15650	OTTHUMG00000133033	ENST00000261884.3:c.659C>G	15.37:g.64692982C>G	ENSP00000261884:p.Ser220*		B2RAS0|Q96ED7|Q9UKH0	Nonsense_Mutation	SNP	pfam_ASCH_domain,pfam_Znf_C2HC5,superfamily_PUA-like_domain	p.S220*	ENST00000261884.3	37	c.659	CCDS10194.1	15	.	.	.	.	.	.	.	.	.	.	C	35	5.487445	0.96323	.	.	ENSG00000103671	ENST00000261884	.	.	.	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08837	T	0.75	-2.7262	17.9747	0.89123	0.0:1.0:0.0:0.0	.	.	.	.	X	220	.	ENSP00000261884:S220X	S	+	2	0	TRIP4	62480035	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.814000	0.75236	2.746000	0.94184	0.591000	0.81541	TCA	TRIP4	-	NULL	ENSG00000103671		0.393	TRIP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIP4	HGNC	protein_coding	OTTHUMT00000256635.2	-	0.00	66	0	C	NM_016213		64692982	+1	tier1	-	no_errors	ENST00000261884	ensembl	human	known	74_37	nonsense	37.93	108	66	SNP	1.000	G
TUBB6	84617	genome.wustl.edu	37	18	12325138	12325139	+	Missense_Mutation	DNP	TG	TG	GT			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	T|G	T|G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr18:12325138_12325139TG>GT	ENST00000317702.5	+	4	584_585	c.350_351TG>GT	c.(349-351)cTG>cGT	p.L117R	TUBB6_ENST00000590967.1_Intron|TUBB6_ENST00000586653.1_3'UTR|TUBB6_ENST00000591909.1_Intron|TUBB6_ENST00000591208.1_Intron			Q9BUF5	TBB6_HUMAN	tubulin, beta 6 class V	117					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|prostate(1)	14				READ - Rectum adenocarcinoma(1;0.0649)		GACGCAGTGCTGGACGTGGTGC	0.673																																																	0																																										SO:0001583	missense	0			AK001295	CCDS11858.1	18p11.21	2011-10-10	2011-10-10		ENSG00000176014	ENSG00000176014		"""Tubulins"""	20776	protein-coding gene	gene with protein product	"""tubulin beta MGC4083"", ""class V beta-tubulin"""	615103	"""tubulin, beta 6"""			12477932	Standard	NM_032525		Approved	MGC4083, HsT1601	uc002kqw.3	Q9BUF5	OTTHUMG00000131692	Exception_encountered	18.37:g.12325138_12325139delinsGT	ENSP00000318697:p.Leu117Arg		B3KM76|Q9HA42	Missense_Mutation|Silent	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,pfam_Misato_II_tubulin-like,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Beta_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Delta_tubulin,prints_Gamma_tubulin,prints_Alpha_tubulin	p.L117R|p.L117	ENST00000317702.5	37	c.350|c.351	CCDS11858.1	18																																																																																			TUBB6	-	pfam_Tubulin_FtsZ_GTPase,superfamily_Tubulin_FtsZ_GTPase,smart_Tubulin_FtsZ_GTPase,prints_Beta_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Gamma_tubulin	ENSG00000176014		0.673	TUBB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBB6	HGNC	protein_coding	OTTHUMT00000254600.2	-	0.00	39|38	0	T|G	NM_032525		12325138|12325139	+1	tier1	-	no_errors	ENST00000317702	ensembl	human	known	74_37	missense|silent	22.64|23.08	41|40	12	SNP	1.000|0.999	G|T
TUBE1	51175	genome.wustl.edu	37	6	112392560	112392560	+	3'UTR	SNP	G	G	A			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr6:112392560G>A	ENST00000368662.5	-	0	1561				TUBE1_ENST00000604814.1_5'UTR	NM_016262.4	NP_057346.1	Q9UJT0	TBE_HUMAN	tubulin, epsilon 1						centrosome cycle (GO:0007098)|protein polymerization (GO:0051258)	microtubule (GO:0005874)|pericentriolar material (GO:0000242)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			cervix(1)|endometrium(2)|large_intestine(5)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	12		all_cancers(87;0.0101)|all_hematologic(75;0.000258)|Colorectal(196;0.0466)|all_epithelial(87;0.1)		all cancers(137;0.0217)|OV - Ovarian serous cystadenocarcinoma(136;0.0613)|Epithelial(106;0.0636)|GBM - Glioblastoma multiforme(226;0.0972)|BRCA - Breast invasive adenocarcinoma(108;0.246)	Vinblastine(DB00570)	TGTTGAAACAGAAAGGTCAGA	0.313																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF201334	CCDS5100.1	6q21	2005-11-03			ENSG00000074935	ENSG00000074935		"""Tubulins"""	20775	protein-coding gene	gene with protein product		607345				10620804	Standard	NM_016262		Approved	dJ142L7.2, FLJ22589, TUBE	uc003pvq.3	Q9UJT0	OTTHUMG00000015382	ENST00000368662.5:c.*55C>T	6.37:g.112392560G>A			Q5H8W8|Q8NEG3	RNA	SNP	-	NULL	ENST00000368662.5	37	NULL	CCDS5100.1	6																																																																																			TUBE1	-	-	ENSG00000074935		0.313	TUBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBE1	HGNC	protein_coding	OTTHUMT00000041867.1	-	0.00	64	0	G	NM_016262		112392560	-1	tier1	-	no_errors	ENST00000604814	ensembl	human	known	74_37	rna	33.85	43	22	SNP	0.023	A
TUBGCP3	10426	genome.wustl.edu	37	13	113201973	113201973	+	Nonsense_Mutation	SNP	G	G	A			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr13:113201973G>A	ENST00000261965.3	-	10	1315	c.1129C>T	c.(1129-1131)Cga>Tga	p.R377*	TUBGCP3_ENST00000375669.3_Nonsense_Mutation_p.R377*|TUBGCP3_ENST00000462580.1_5'Flank	NM_006322.4	NP_006313.1	Q96CW5	GCP3_HUMAN	tubulin, gamma complex associated protein 3	377					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)|single fertilization (GO:0007338)	centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|polar microtubule (GO:0005827)|spindle (GO:0005819)	gamma-tubulin binding (GO:0043015)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(9)|prostate(3)|urinary_tract(1)	25	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)					GTCTTCAGTCGTATTTTGGGA	0.542																																																	0													100.0	88.0	92.0					13																	113201973		2203	4300	6503	SO:0001587	stop_gained	0			AF042378	CCDS9525.1, CCDS66584.1, CCDS73599.1	13q34	2008-07-18			ENSG00000126216	ENSG00000126216			18598	protein-coding gene	gene with protein product	"""spindle pole body protein"""					9566967, 9566969	Standard	XM_005268293		Approved	GCP3, Spc98p, SPBC98	uc001vse.1	Q96CW5	OTTHUMG00000017367	ENST00000261965.3:c.1129C>T	13.37:g.113201973G>A	ENSP00000261965:p.Arg377*		O43631|O60852|O60853|Q5T8L2|Q7Z4K1|Q96I79	Nonsense_Mutation	SNP	pfam_TUBGCP	p.R377*	ENST00000261965.3	37	c.1129	CCDS9525.1	13	.	.	.	.	.	.	.	.	.	.	G	37	6.520065	0.97633	.	.	ENSG00000126216	ENST00000261965;ENST00000375669	.	.	.	4.7	2.15	0.27550	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-23.6822	11.5542	0.50737	0.0:0.0:0.29:0.71	.	.	.	.	X	377	.	ENSP00000261965:R377X	R	-	1	2	TUBGCP3	112249974	1.000000	0.71417	1.000000	0.80357	0.835000	0.47333	2.187000	0.42602	0.179000	0.19938	-0.743000	0.03520	CGA	TUBGCP3	-	pfam_TUBGCP	ENSG00000126216		0.542	TUBGCP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBGCP3	HGNC	protein_coding	OTTHUMT00000045825.2		0.00	25	0	G	NM_006322		113201973	-1			no_errors	ENST00000261965	ensembl	human	known	74_37	nonsense	8.11	34	3	SNP	1.000	A
UTP20	27340	genome.wustl.edu	37	12	101728221	101728221	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr12:101728221G>C	ENST00000261637.4	+	29	3754	c.3580G>C	c.(3580-3582)Gag>Cag	p.E1194Q		NM_014503.2	NP_055318.2	O75691	UTP20_HUMAN	UTP20, small subunit (SSU) processome component, homolog (yeast)	1194					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|negative regulation of cell proliferation (GO:0008285)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|preribosome, small subunit precursor (GO:0030688)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)	p.E1194Q(1)		NS(3)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(26)|lung(30)|ovary(2)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	88						GCTTGGATCTGAGAGTCAATA	0.358																																																	1	Substitution - Missense(1)	lung(1)											88.0	78.0	81.0					12																	101728221		2203	4300	6503	SO:0001583	missense	0			AJ006778	CCDS9081.1	12q23	2006-02-11				ENSG00000120800			17897	protein-coding gene	gene with protein product	"""down regulated in metastasis"""	612822				9673349, 15590835, 12837249	Standard	NM_014503		Approved	DRIM	uc001tia.1	O75691	OTTHUMG00000170270	ENST00000261637.4:c.3580G>C	12.37:g.101728221G>C	ENSP00000261637:p.Glu1194Gln		Q9H3H4	Missense_Mutation	SNP	pfam_DRIM,superfamily_ARM-type_fold	p.E1194Q	ENST00000261637.4	37	c.3580	CCDS9081.1	12	.	.	.	.	.	.	.	.	.	.	G	23.4	4.410592	0.83340	.	.	ENSG00000120800	ENST00000261637	T	0.44482	0.92	5.62	5.62	0.85841	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.62732	0.2452	L	0.54323	1.7	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.61491	-0.7052	10	0.54805	T	0.06	-22.4177	19.69	0.95996	0.0:0.0:1.0:0.0	.	1194	O75691	UTP20_HUMAN	Q	1194	ENSP00000261637:E1194Q	ENSP00000261637:E1194Q	E	+	1	0	UTP20	100252352	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.743000	0.91592	2.648000	0.89879	0.650000	0.86243	GAG	UTP20	-	superfamily_ARM-type_fold	ENSG00000120800		0.358	UTP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTP20	HGNC	protein_coding	OTTHUMT00000408242.1	-	0.00	29	0	G	NM_014503		101728221	+1	tier1	-	no_errors	ENST00000261637	ensembl	human	known	74_37	missense	14.29	36	6	SNP	1.000	C
VPS13C	54832	genome.wustl.edu	37	15	62207860	62207860	+	Missense_Mutation	SNP	T	T	A			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr15:62207860T>A	ENST00000261517.5	-	61	8490	c.8417A>T	c.(8416-8418)aAg>aTg	p.K2806M	RN7SL613P_ENST00000584412.1_RNA|VPS13C_ENST00000395896.4_Missense_Mutation_p.K2806M|VPS13C_ENST00000249837.3_Missense_Mutation_p.K2763M|VPS13C_ENST00000395898.3_Missense_Mutation_p.K2763M	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)											NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						GTTCTTCTTCTTGAAAGAAAA	0.323																																																	0													28.0	30.0	29.0					15																	62207860		2202	4300	6502	SO:0001583	missense	0			AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.8417A>T	15.37:g.62207860T>A	ENSP00000261517:p.Lys2806Met			Missense_Mutation	SNP	pfam_VPSAP_dom,pfam_Autophagy-rel_C	p.K2806M	ENST00000261517.5	37	c.8417	CCDS32257.1	15	.	.	.	.	.	.	.	.	.	.	T	19.87	3.907324	0.72868	.	.	ENSG00000129003	ENST00000249837;ENST00000261517;ENST00000395896;ENST00000395898	T;T;T	0.32515	1.45;1.45;1.45	5.39	5.39	0.77823	Vacuolar protein sorting-associated protein (1);	0.045697	0.85682	D	0.000000	T	0.56031	0.1958	M	0.74258	2.255	0.58432	D	0.999998	D;D;D;D;D	0.89917	0.999;0.999;1.0;1.0;1.0	D;D;D;D;D	0.74674	0.973;0.973;0.982;0.982;0.984	T	0.60959	-0.7159	10	0.72032	D	0.01	.	15.4116	0.74929	0.0:0.0:0.0:1.0	.	2806;2763;2806;2763;2806	F5GZG8;Q709C8-4;Q709C8-2;Q709C8-3;Q709C8	.;.;.;.;VP13C_HUMAN	M	2763;2806;2806;2806	ENSP00000249837:K2763M;ENSP00000261517:K2806M;ENSP00000379233:K2806M	ENSP00000249837:K2763M	K	-	2	0	VPS13C	59995152	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.979000	0.49313	2.033000	0.60031	0.455000	0.32223	AAG	VPS13C	-	pfam_VPSAP_dom	ENSG00000129003		0.323	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13C	HGNC	protein_coding	OTTHUMT00000415997.1	-	0.00	64	0	T	NM_017684		62207860	-1	tier1	-	no_errors	ENST00000261517	ensembl	human	known	74_37	missense	33.03	73	36	SNP	1.000	A
WASH3P	374666	genome.wustl.edu	37	15	102506815	102506816	+	RNA	DEL	CC	CC	-	rs151176585		TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	CC	CC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr15:102506815_102506816delCC	ENST00000557932.1	+	0	172							C4AMC7	WASH3_HUMAN	WAS protein family homolog 3 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)			central_nervous_system(1)|endometrium(6)|kidney(11)|prostate(5)|stomach(1)|urinary_tract(1)	25						tacctctccacctggagcgcac	0.421																																																	0																																												0					15q26.3	2014-03-20	2008-01-16	2008-01-16	ENSG00000185596	ENSG00000185596		"""WAS protein homologs"""	24362	pseudogene	pseudogene			"""family with sequence similarity 39, member D pseudogene"""	FAM39DP		11701968, 18159949	Standard	NR_003659		Approved	FLJ25222	uc002cdi.3	C4AMC7	OTTHUMG00000172275		15.37:g.102506815_102506816delCC				RNA	DEL	-	NULL	ENST00000557932.1	37	NULL		15																																																																																			WASH3P	-	-	ENSG00000185596		0.421	WASH3P-001	KNOWN	basic	processed_transcript	WASH3P	HGNC	pseudogene	OTTHUMT00000417608.1		0.00	8	0	CC	NM_199163		102506816	+1	tier1		no_errors	ENST00000559884	ensembl	human	known	74_37	rna	30.77	9	4	DEL	0.000:0.000	-
WDR55	54853	genome.wustl.edu	37	5	140049102	140049102	+	Frame_Shift_Del	DEL	A	A	-			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr5:140049102delA	ENST00000358337.5	+	7	1252	c.1015delA	c.(1015-1017)aaafs	p.K341fs	WDR55_ENST00000520764.1_3'UTR	NM_017706.4	NP_060176	Q9H6Y2	WDR55_HUMAN	WD repeat domain 55	341					rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)		p.K341fs*8(1)		NS(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(2)|prostate(1)	9			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCGTCGGCGCAAAAAAAAGGG	0.592																																																	1	Deletion - Frameshift(1)	large_intestine(1)											43.0	45.0	45.0					5																	140049102		2203	4300	6503	SO:0001589	frameshift_variant	0			AK000202	CCDS4235.1	5q31.3	2013-01-09			ENSG00000120314	ENSG00000120314		"""WD repeat domain containing"""	25971	protein-coding gene	gene with protein product						12477932	Standard	NM_017706		Approved	FLJ20195, FLJ21702	uc003lgr.4	Q9H6Y2	OTTHUMG00000129506	ENST00000358337.5:c.1015delA	5.37:g.140049102delA	ENSP00000351100:p.Lys341fs		Q9NXK4	Frame_Shift_Del	DEL	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_WD_repeat_p55,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.K341fs	ENST00000358337.5	37	c.1015	CCDS4235.1	5																																																																																			WDR55	-	pirsf_WD_repeat_p55	ENSG00000120314		0.592	WDR55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR55	HGNC	protein_coding	OTTHUMT00000251680.3		0.00	19	0	A	NM_017706		140049102	+1	tier1		no_errors	ENST00000358337	ensembl	human	known	74_37	frame_shift_del	8.70	21	2	DEL	1.000	-
WIZ	58525	genome.wustl.edu	37	19	15538113	15538113	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr19:15538113G>A	ENST00000389282.4	-	6	3545	c.3332C>T	c.(3331-3333)gCc>gTc	p.A1111V	WIZ_ENST00000545156.1_Missense_Mutation_p.A425V|WIZ_ENST00000263381.7_Missense_Mutation_p.A254V|WIZ_ENST00000599910.2_Missense_Mutation_p.A428V|WIZ_ENST00000599686.3_Missense_Mutation_p.A295V			O95785	WIZ_HUMAN	widely interspaced zinc finger motifs	1111	Pro-rich.				positive regulation of nuclear cell cycle DNA replication (GO:0010571)|protein heterotrimerization (GO:0070208)|protein stabilization (GO:0050821)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)|stomach(1)|urinary_tract(1)	24						CATCATCTTGGCCAGGGCTTT	0.657																																																	0													26.0	30.0	29.0					19																	15538113		1991	4156	6147	SO:0001583	missense	0			AK091183	CCDS42516.1	19p13.12	2012-10-05	2007-01-18		ENSG00000011451	ENSG00000011451		"""Zinc fingers, C2H2-type"""	30917	protein-coding gene	gene with protein product			"""WIZ zinc finger"""			9795207, 12226707	Standard	NM_021241		Approved	ZNF803	uc002nbb.4	O95785		ENST00000389282.4:c.3332C>T	19.37:g.15538113G>A	ENSP00000373933:p.Ala1111Val		B3KVH1|B7ZM82|M0QY21|Q4G0E0|Q6P6B0|Q6ZN24|Q7LDY6|Q7LDZ1|Q96IG5|Q96SQ6|Q9BUR8|Q9NPT1	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A1111V	ENST00000389282.4	37	c.3332		19	.	.	.	.	.	.	.	.	.	.	G	15.69	2.908794	0.52439	.	.	ENSG00000011451	ENST00000389282;ENST00000263381;ENST00000416927;ENST00000545156	T	0.03152	4.03	5.67	4.62	0.57501	.	0.472153	0.22188	N	0.063414	T	0.06826	0.0174	L	0.29908	0.895	0.35897	D	0.830083	P;D;D	0.58620	0.791;0.983;0.968	B;P;P	0.56434	0.15;0.798;0.48	T	0.50457	-0.8826	10	0.28530	T	0.3	-14.0189	10.7071	0.45960	0.0:0.143:0.7086:0.1484	.	1111;254;295	O95785;O95785-2;B3KVH1	WIZ_HUMAN;.;.	V	1111;254;295;425	ENSP00000373933:A1111V	ENSP00000263381:A254V	A	-	2	0	WIZ	15399113	1.000000	0.71417	1.000000	0.80357	0.373000	0.29922	3.622000	0.54217	1.382000	0.46385	-0.304000	0.09214	GCC	WIZ	-	NULL	ENSG00000011451		0.657	WIZ-201	KNOWN	basic|appris_principal	protein_coding	WIZ	HGNC	protein_coding		-	0.00	79	0	G	NM_021241		15538113	-1	tier1	-	no_errors	ENST00000389282	ensembl	human	known	74_37	missense	6.56	57	4	SNP	1.000	A
ZCCHC24	219654	genome.wustl.edu	37	10	81192403	81192403	+	Missense_Mutation	SNP	C	C	T	rs141500674		TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr10:81192403C>T	ENST00000372336.3	-	2	544	c.358G>A	c.(358-360)Gag>Aag	p.E120K	ZCCHC24_ENST00000372333.3_Missense_Mutation_p.R60Q	NM_153367.3	NP_699198.2	Q8N2G6	ZCH24_HUMAN	zinc finger, CCHC domain containing 24	120							poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|large_intestine(3)|lung(1)|skin(1)	9						TTGCGAGCCTCGGAGGTGAGG	0.612																																																	0								C	LYS/GLU	1,4405	2.1+/-5.4	0,1,2202	84.0	73.0	77.0		358	5.8	1.0	10	dbSNP_134	77	0,8600		0,0,4300	no	missense	ZCCHC24	NM_153367.3	56	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	120/242	81192403	1,13005	2203	4300	6503	SO:0001583	missense	0			AK075279	CCDS7359.1	10q22.3	2014-02-20	2008-06-23	2008-06-23	ENSG00000165424	ENSG00000165424		"""Zinc fingers, CCHC domain containing"""	26911	protein-coding gene	gene with protein product	"""zinc finger, 3CxxC-type 8"""		"""chromosome 10 open reading frame 56"""	C10orf56		12477932	Standard	NM_153367		Approved	FLJ90798, Z3CXXC8	uc010qlr.2	Q8N2G6	OTTHUMG00000018561	ENST00000372336.3:c.358G>A	10.37:g.81192403C>T	ENSP00000361411:p.Glu120Lys		Q5U5T9|Q8TAG0	Missense_Mutation	SNP	superfamily_Znf_CCHC,pfscan_Znf_CCHC	p.E120K	ENST00000372336.3	37	c.358	CCDS7359.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.6|23.6	4.433298|4.433298	0.83776|0.83776	2.27E-4|2.27E-4	0.0|0.0	ENSG00000165424|ENSG00000165424	ENST00000372336|ENST00000372333	T|.	0.46063|.	0.88|.	5.84|5.84	5.84|5.84	0.93424|0.93424	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.62245|0.62245	0.2412|0.2412	L|L	0.27053|0.27053	0.805|0.805	0.38463|0.38463	D|D	0.947255|0.947255	D|D	0.76494|0.69078	0.999|0.997	D|P	0.71184|0.55785	0.972|0.784	T|T	0.67189|0.67189	-0.5733|-0.5733	10|8	0.26408|0.87932	T|D	0.33|0	-11.7214|-11.7214	20.1438|20.1438	0.98071|0.98071	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	120|60	Q8N2G6|Q5W133	ZCH24_HUMAN|.	K|Q	120|60	ENSP00000361411:E120K|.	ENSP00000361411:E120K|ENSP00000361408:R60Q	E|R	-|-	1|2	0|0	ZCCHC24|ZCCHC24	80862409|80862409	1.000000|1.000000	0.71417|0.71417	0.965000|0.965000	0.40720|0.40720	0.969000|0.969000	0.65631|0.65631	7.487000|7.487000	0.81328|0.81328	2.768000|2.768000	0.95171|0.95171	0.650000|0.650000	0.86243|0.86243	GAG|CGA	ZCCHC24	-	superfamily_Znf_CCHC	ENSG00000165424		0.612	ZCCHC24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZCCHC24	HGNC	protein_coding	OTTHUMT00000048947.1	-	0.00	28	0	C	NM_153367		81192403	-1	tier1	rs141500674	no_errors	ENST00000372336	ensembl	human	known	74_37	missense	36.00	32	18	SNP	1.000	T
ZIC5	85416	genome.wustl.edu	37	13	100622679	100622679	+	Silent	SNP	C	C	T			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr13:100622679C>T	ENST00000267294.4	-	1	1484	c.1251G>A	c.(1249-1251)ccG>ccA	p.P417P		NM_033132.3	NP_149123.2	Q96T25	ZIC5_HUMAN	Zic family member 5	417	Pro-rich.				cell differentiation (GO:0030154)|forebrain development (GO:0030900)|neural tube closure (GO:0001843)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(1)|lung(2)|prostate(1)|skin(2)	9	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					gcggcggcggcggcggcggcg	0.716																																																	0													2.0	3.0	3.0					13																	100622679		1539	3180	4719	SO:0001819	synonymous_variant	0			AF378304	CCDS9494.2	13q32.2	2013-01-08	2011-05-19		ENSG00000139800	ENSG00000139800		"""Zinc fingers, C2H2-type"""	20322	protein-coding gene	gene with protein product			"""Zic family member 5 (odd-paired homolog, Drosophila)"""				Standard	NM_033132		Approved		uc001vom.1	Q96T25	OTTHUMG00000017280	ENST00000267294.4:c.1251G>A	13.37:g.100622679C>T			Q5VYB0	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P417	ENST00000267294.4	37	c.1251	CCDS9494.2	13																																																																																			ZIC5	-	NULL	ENSG00000139800		0.716	ZIC5-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	ZIC5	HGNC	protein_coding	OTTHUMT00000045623.3		0.00	17	0	C	NM_033132		100622679	-1			no_errors	ENST00000267294	ensembl	human	known	74_37	silent	8.33	22	2	SNP	0.808	T
ZMYM6	9204	genome.wustl.edu	37	1	35455732	35455732	+	Intron	SNP	T	T	C			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr1:35455732T>C	ENST00000357182.4	-	16	2374				ZMYM6_ENST00000493328.1_5'UTR|ZMYM6_ENST00000373340.2_Intron|ZMYM6_ENST00000487874.1_Intron	NM_007167.3	NP_009098.3	O95789	ZMYM6_HUMAN	zinc finger, MYM-type 6						cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(10)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	44		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.13)				ggttggagcatacattgatgt	0.423																																																	0																																										SO:0001627	intron_variant	0			AF055470	CCDS387.2	1p34.2	2014-05-12	2005-09-12	2005-09-12	ENSG00000163867	ENSG00000163867		"""Zinc fingers, MYM type"", ""Zinc fingers, BED-type"""	13050	protein-coding gene	gene with protein product	"""zinc finger, BED-type containing 7"""	613567	"""zinc finger protein 258"", ""zinc finger, MYM-type containing 6"""	ZNF258		10486218, 23533661	Standard	NM_007167		Approved	ZNF198L4, MYM, Buster2, ZBED7	uc001byh.3	O95789	OTTHUMG00000004163	ENST00000357182.4:c.2147-1196A>G	1.37:g.35455732T>C			B4DRJ6|Q32Q23|Q4G108|Q5SVZ9|Q5SW00|Q69YL4|Q96IY0|Q9NWF1|Q9P2J4	RNA	SNP	-	NULL	ENST00000357182.4	37	NULL	CCDS387.2	1																																																																																			ZMYM6	-	-	ENSG00000163867		0.423	ZMYM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMYM6	HGNC	protein_coding	OTTHUMT00000011999.1	-	0.00	8	0	T	NM_007167		35455732	-1	tier1	-	no_errors	ENST00000493328	ensembl	human	known	74_37	rna	61.54	5	8	SNP	0.017	C
ZNF493	284443	genome.wustl.edu	37	19	21606488	21606488	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr19:21606488C>T	ENST00000355504.4	+	2	909	c.643C>T	c.(643-645)Cac>Tac	p.H215Y	CTD-2561J22.3_ENST00000600810.1_Intron|ZNF493_ENST00000392288.2_Missense_Mutation_p.H343Y	NM_175910.6	NP_787106.4	Q6ZR52	ZN493_HUMAN	zinc finger protein 493	215					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	30						TAAGATAATTCACACTGAAGA	0.348																																																	0													40.0	44.0	43.0					19																	21606488		2202	4293	6495	SO:0001583	missense	0			AK093823, BC006408, BC022394	CCDS12412.1, CCDS42536.1, CCDS12411.1	19p12	2013-01-08			ENSG00000196268	ENSG00000196268		"""Zinc fingers, C2H2-type"", ""-"""	23708	protein-coding gene	gene with protein product							Standard	NM_001076678		Approved	FLJ36504	uc002npw.3	Q6ZR52	OTTHUMG00000141297	ENST00000355504.4:c.643C>T	19.37:g.21606488C>T	ENSP00000347691:p.His215Tyr		G5E974|Q59GM3|Q6ZSF6|Q8N1Z6|Q8N965|Q9BR99	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.H215Y	ENST00000355504.4	37	c.643	CCDS12412.1	19	.	.	.	.	.	.	.	.	.	.	N	11.25	1.584106	0.28268	.	.	ENSG00000196268	ENST00000392288;ENST00000355504	T;T	0.26518	1.73;1.73	0.985	0.985	0.19779	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.53238	0.1784	M	0.92555	3.32	0.80722	D	1	D;D	0.63880	0.977;0.993	P;D	0.68039	0.53;0.955	T	0.58272	-0.7665	9	0.72032	D	0.01	.	8.7583	0.34658	0.0:1.0:0.0:0.0	.	215;343	Q6ZR52;Q6ZR52-2	ZN493_HUMAN;.	Y	343;215	ENSP00000376110:H343Y;ENSP00000347691:H215Y	ENSP00000347691:H215Y	H	+	1	0	ZNF493	21398328	0.571000	0.26659	0.003000	0.11579	0.003000	0.03518	1.268000	0.33062	0.399000	0.25367	0.404000	0.27445	CAC	ZNF493	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196268		0.348	ZNF493-003	KNOWN	basic|CCDS	protein_coding	ZNF493	HGNC	protein_coding	OTTHUMT00000280563.1	-	0.00	91	0	C	NM_175910		21606488	+1	tier1	-	no_errors	ENST00000355504	ensembl	human	known	74_37	missense	38.95	58	37	SNP	0.994	T
ZNF766	90321	genome.wustl.edu	37	19	52794236	52794236	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr19:52794236C>A	ENST00000439461.1	+	4	1235	c.1192C>A	c.(1192-1194)Ctt>Att	p.L398I	ZNF766_ENST00000593612.1_Missense_Mutation_p.L413I|ZNF766_ENST00000599581.1_3'UTR|ZNF766_ENST00000359102.4_Missense_Mutation_p.L413I|CTD-2525I3.5_ENST00000594865.1_RNA	NM_001010851.2	NP_001010851.1	Q5HY98	ZN766_HUMAN	zinc finger protein 766	398					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)	17				GBM - Glioblastoma multiforme(134;0.00236)|OV - Ovarian serous cystadenocarcinoma(262;0.00871)		AGTTTCACATCTTGCACGACA	0.393																																																	0													53.0	57.0	56.0					19																	52794236		2203	4300	6503	SO:0001583	missense	0			AK024074	CCDS46163.1	19q13.33	2013-01-08				ENSG00000196214		"""Zinc fingers, C2H2-type"", ""-"""	28063	protein-coding gene	gene with protein product							Standard	XM_006723458		Approved		uc002pyr.1	Q5HY98		ENST00000439461.1:c.1192C>A	19.37:g.52794236C>A	ENSP00000409652:p.Leu398Ile		B2RNE0|Q7Z326	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L413I	ENST00000439461.1	37	c.1237	CCDS46163.1	19	.	.	.	.	.	.	.	.	.	.	C	11.87	1.767880	0.31320	.	.	ENSG00000196214	ENST00000439461;ENST00000359102	T;T	0.53857	0.6;0.6	2.24	-0.249	0.13011	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.67316	0.2880	M	0.89414	3.03	0.09310	N	1	P;P	0.40931	0.688;0.733	P;P	0.55824	0.607;0.785	T	0.59752	-0.7395	9	0.72032	D	0.01	.	3.2744	0.06893	0.2067:0.529:0.0:0.2643	.	413;398	G3XAE0;Q5HY98	.;ZN766_HUMAN	I	398;413	ENSP00000409652:L398I;ENSP00000352005:L413I	ENSP00000352005:L413I	L	+	1	0	ZNF766	57486048	0.573000	0.26676	0.000000	0.03702	0.001000	0.01503	1.101000	0.31037	-0.129000	0.11620	-0.142000	0.14014	CTT	ZNF766	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196214		0.393	ZNF766-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF766	HGNC	protein_coding	OTTHUMT00000462764.1	-	0.00	64	0	C	NM_001010851		52794236	+1	tier1	-	no_errors	ENST00000359102	ensembl	human	known	74_37	missense	28.05	59	23	SNP	0.004	A
ZNF816	125893	genome.wustl.edu	37	19	53431622	53431622	+	3'UTR	DEL	G	G	-	rs370327139		TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr19:53431622delG	ENST00000549216.1	-	0	1099				ZNF816-ZNF321P_ENST00000313956.4_RNA	NM_001202473.1	NP_001189402.1	Q0VGE8	ZN816_HUMAN	zinc finger protein 816						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(10)|lung(9)|stomach(1)|urinary_tract(2)	27						AAAAAAAAAAGAAAgaacact	0.368																																																	0																																										SO:0001624	3_prime_UTR_variant	0			BC063805	CCDS33096.1	19q13.41	2013-01-08	2010-07-23	2010-07-23		ENSG00000180257		"""Zinc fingers, C2H2-type"", ""-"""	26995	protein-coding gene	gene with protein product			"""zinc finger protein 816A"""	ZNF816A			Standard	NM_001031665		Approved		uc002qam.2	Q0VGE8		ENST00000549216.1:c.*534C>-	19.37:g.53431622delG			A8K7H5|Q3KR39|Q659B3	RNA	DEL	-	NULL	ENST00000549216.1	37	NULL		19																																																																																			ZNF816-ZNF321P	-	-	ENSG00000213801		0.368	ZNF816-202	KNOWN	basic	protein_coding	ZNF816-ZNF321P	HGNC	protein_coding			0.00	21	0	G	NM_001031665		53431622	-1	tier1		no_errors	ENST00000313956	ensembl	human	known	74_37	rna	6.90	27	2	DEL	0.082	-
ZNFX1	57169	genome.wustl.edu	37	20	47866096	47866096	+	Silent	SNP	G	G	A			TCGA-VR-AA7D-01A-11D-A403-09	TCGA-VR-AA7D-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	26db3638-64d4-4301-b3e0-2b75879facdf	bf56eaf2-cc4f-44bf-aa68-18b6471a9581	g.chr20:47866096G>A	ENST00000396105.1	-	14	3711	c.3465C>T	c.(3463-3465)acC>acT	p.T1155T	ZNFX1_ENST00000371754.4_Intron|ZNFX1_ENST00000371752.1_Silent_p.T1155T	NM_021035.2	NP_066363.1	Q9P2E3	ZNFX1_HUMAN	zinc finger, NFX1-type containing 1	1155							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(8)|kidney(7)|large_intestine(15)|liver(1)|lung(17)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	60			BRCA - Breast invasive adenocarcinoma(12;0.00173)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			TAGTGAGGATGGTGATCTGGG	0.527																																																	0													134.0	127.0	130.0					20																	47866096		2203	4300	6503	SO:0001819	synonymous_variant	0			AK022641	CCDS13417.1	20q13.13	2014-02-12			ENSG00000124201	ENSG00000124201			29271	protein-coding gene	gene with protein product						10718198	Standard	NM_021035		Approved	KIAA1404, FLJ11277	uc002xui.3	Q9P2E3	OTTHUMG00000032696	ENST00000396105.1:c.3465C>T	20.37:g.47866096G>A			Q9BQM7|Q9BQM8|Q9H8C1|Q9H9S2|Q9NUM1|Q9NWW1	Silent	SNP	superfamily_P-loop_NTPase,superfamily_ARM-type_fold,smart_Znf_NFX1	p.T1155	ENST00000396105.1	37	c.3465	CCDS13417.1	20																																																																																			ZNFX1	-	superfamily_P-loop_NTPase	ENSG00000124201		0.527	ZNFX1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNFX1	HGNC	protein_coding	OTTHUMT00000079647.2	-	0.00	32	0	G	NM_021035		47866096	-1	tier1	-	no_errors	ENST00000371752	ensembl	human	known	74_37	silent	30.91	38	17	SNP	1.000	A
