#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
AAMP	14	genome.wustl.edu	37	2	219129888	219129888	+	Missense_Mutation	SNP	C	C	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr2:219129888C>T	ENST00000248450.4	-	10	1254	c.1084G>A	c.(1084-1086)Gtg>Atg	p.V362M	AAMP_ENST00000420660.1_Missense_Mutation_p.V343M|AAMP_ENST00000444053.1_Missense_Mutation_p.V363M			Q13685	AAMP_HUMAN	angio-associated, migratory cell protein	362					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|positive regulation of endothelial cell migration (GO:0010595)|smooth muscle cell migration (GO:0014909)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)			haematopoietic_and_lymphoid_tissue(2)|kidney(2)|lung(4)|ovary(2)|skin(1)	11		Renal(207;0.0474)		Epithelial(149;7.19e-07)|all cancers(144;0.000131)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AGCAGCTGCACGATGCCCGAC	0.637																																																	0													28.0	31.0	30.0					2																	219129888		2203	4300	6503	SO:0001583	missense	0			AB209790	CCDS33378.1	2q	2013-01-10			ENSG00000127837	ENSG00000127837		"""WD repeat domain containing"""	18	protein-coding gene	gene with protein product		603488				7743515	Standard	XM_005246325		Approved		uc002vhk.3	Q13685	OTTHUMG00000155202	ENST00000248450.4:c.1084G>A	2.37:g.219129888C>T	ENSP00000248450:p.Val362Met		Q8WUJ9|Q96H92	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.V362M	ENST00000248450.4	37	c.1084	CCDS33378.1	2	.	.	.	.	.	.	.	.	.	.	C	33	5.243167	0.95272	.	.	ENSG00000127837	ENST00000248450;ENST00000444053;ENST00000420660	T;T;T	0.18338	2.22;2.22;2.22	5.84	5.84	0.93424	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.34542	0.0901	L	0.37750	1.13	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.77557	0.99;0.984;0.98	T	0.00638	-1.1632	10	0.34782	T	0.22	-14.7313	20.1379	0.98040	0.0:1.0:0.0:0.0	.	363;362;343	C9JEH3;Q13685;C9JG97	.;AAMP_HUMAN;.	M	362;363;343	ENSP00000248450:V362M;ENSP00000403343:V363M;ENSP00000416394:V343M	ENSP00000248450:V362M	V	-	1	0	AAMP	218838132	1.000000	0.71417	0.993000	0.49108	0.992000	0.81027	7.637000	0.83313	2.779000	0.95612	0.655000	0.94253	GTG	AAMP	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000127837		0.637	AAMP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	AAMP	HGNC	protein_coding	OTTHUMT00000338756.1		0.00	96	0	C	NM_001087		219129888	-1			no_errors	ENST00000248450	ensembl	human	known	74_37	missense	9.80	45	5	SNP	1.000	T
ABCF2	10061	genome.wustl.edu	37	7	150915205	150915205	+	Missense_Mutation	SNP	C	C	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr7:150915205C>A	ENST00000287844.2	-	11	1409	c.1300G>T	c.(1300-1302)Gca>Tca	p.A434S	ABCF2_ENST00000473874.1_5'Flank|ABCF2_ENST00000222388.2_Missense_Mutation_p.A434S	NM_007189.1	NP_009120.1	Q9UG63	ABCF2_HUMAN	ATP-binding cassette, sub-family F (GCN20), member 2	434	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|membrane (GO:0016020)|mitochondrial envelope (GO:0005740)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(1)|large_intestine(4)|lung(15)|ovary(1)|skin(2)	24			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GACTTCCCTGCTCCATTGGGC	0.507																																																	0													144.0	121.0	129.0					7																	150915205		2203	4300	6503	SO:0001583	missense	0			AJ005016	CCDS5922.1, CCDS5923.1	7q36.1	2012-03-14			ENSG00000033050	ENSG00000033050		"""ATP binding cassette transporters / subfamily F"""	71	protein-coding gene	gene with protein product		612510				8894702	Standard	NM_007189		Approved	EST133090, ABC28, M-ABC1, HUSSY-18	uc003wjo.1	Q9UG63	OTTHUMG00000154570	ENST00000287844.2:c.1300G>T	7.37:g.150915205C>A	ENSP00000287844:p.Ala434Ser		O60864|Q75MJ0|Q75MJ1|Q96TE8	Missense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.A434S	ENST00000287844.2	37	c.1300	CCDS5923.1	7	.	.	.	.	.	.	.	.	.	.	C	36	5.641403	0.96704	.	.	ENSG00000033050	ENST00000222388;ENST00000287844	D;D	0.93189	-3.18;-3.18	5.49	5.49	0.81192	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.000000	0.85682	D	0.000000	D	0.93966	0.8068	N	0.20304	0.555	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.75484	0.986;0.986	D	0.95182	0.8300	10	0.87932	D	0	-5.9012	18.3531	0.90345	0.0:1.0:0.0:0.0	.	434;434	Q9UG63;Q75MJ1	ABCF2_HUMAN;.	S	434	ENSP00000222388:A434S;ENSP00000287844:A434S	ENSP00000222388:A434S	A	-	1	0	ABCF2	150546138	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.225000	0.78051	2.571000	0.86741	0.591000	0.81541	GCA	ABCF2	-	superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000033050		0.507	ABCF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCF2	HGNC	protein_coding	OTTHUMT00000336086.1	-	0.00	40	0	C	NM_005692		150915205	-1	tier1	-	no_errors	ENST00000222388	ensembl	human	known	74_37	missense	9.09	40	4	SNP	1.000	A
ABHD14B	84836	genome.wustl.edu	37	3	52003518	52003518	+	Frame_Shift_Del	DEL	G	G	-	rs201010064		TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr3:52003518delG	ENST00000483233.1	-	5	1063	c.557delC	c.(556-558)gcgfs	p.A186fs	ABHD14B_ENST00000487005.1_5'UTR|PCBP4_ENST00000395013.3_5'Flank|RP11-155D18.14_ENST00000489595.2_Intron|PCBP4_ENST00000428823.2_5'Flank|PCBP4_ENST00000355852.2_5'Flank|RP11-155D18.12_ENST00000488257.1_RNA|ABHD14B_ENST00000461108.1_3'UTR|ABHD14B_ENST00000525795.1_Frame_Shift_Del_p.A186fs|ABHD14B_ENST00000315877.10_Frame_Shift_Del_p.A184fs|ABHD14B_ENST00000361143.5_Frame_Shift_Del_p.A186fs|PCBP4_ENST00000461554.1_5'Flank|ABHD14B_ENST00000395008.2_Frame_Shift_Del_p.A186fs|PCBP4_ENST00000484633.1_5'Flank			Q96IU4	ABHEB_HUMAN	abhydrolase domain containing 14B	186					metabolic process (GO:0008152)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleus (GO:0005634)	hydrolase activity (GO:0016787)	p.A186V(1)		large_intestine(2)|lung(1)	3				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000548)|KIRC - Kidney renal clear cell carcinoma(197;0.00072)		GGGGTGCCCCGCCCCCTTCAT	0.612																																																	1	Substitution - Missense(1)	large_intestine(1)											83.0	88.0	86.0					3																	52003518		2203	4300	6503	SO:0001589	frameshift_variant	0			AK075112	CCDS2842.1	3p21.2	2009-01-12			ENSG00000114779	ENSG00000114779		"""Abhydrolase domain containing"""	28235	protein-coding gene	gene with protein product							Standard	NM_032750		Approved	MGC15429, CIB	uc011bdy.2	Q96IU4	OTTHUMG00000157816	ENST00000483233.1:c.557delC	3.37:g.52003518delG	ENSP00000420065:p.Ala186fs		Q86VK8|Q8N8W5	Frame_Shift_Del	DEL	NULL	p.A186fs	ENST00000483233.1	37	c.557	CCDS2842.1	3																																																																																			ABHD14B	-	NULL	ENSG00000114779		0.612	ABHD14B-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ABHD14B	HGNC	protein_coding	OTTHUMT00000349673.1		0.00	18	0	G	NM_032750		52003518	-1	tier1		no_errors	ENST00000361143	ensembl	human	known	74_37	frame_shift_del	9.09	20	2	DEL	1.000	-
ACBD4	79777	genome.wustl.edu	37	17	43213937	43213937	+	Silent	SNP	C	C	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr17:43213937C>T	ENST00000376955.4	+	3	456	c.159C>T	c.(157-159)ccC>ccT	p.P53P	ACBD4_ENST00000591136.1_3'UTR|ACBD4_ENST00000586346.1_Silent_p.P53P|ACBD4_ENST00000592162.1_Silent_p.P53P|ACBD4_ENST00000591859.1_Silent_p.P53P|ACBD4_ENST00000321854.8_Silent_p.P53P|ACBD4_ENST00000398322.3_Silent_p.P53P|ACBD4_ENST00000431281.1_Silent_p.P53P	NM_001135707.1	NP_001129179.1	Q8NC06	ACBD4_HUMAN	acyl-CoA binding domain containing 4	53	ACB. {ECO:0000255|PROSITE- ProRule:PRU00573}.						fatty-acyl-CoA binding (GO:0000062)|lipid binding (GO:0008289)			kidney(1)|lung(3)|ovary(1)	5						CCATGGGGCCCTGCCTGGTCC	0.602																																																	0													58.0	65.0	63.0					17																	43213937		1883	4096	5979	SO:0001819	synonymous_variant	0			BC029164	CCDS42348.1, CCDS45710.1, CCDS45711.1	17q21.31	2012-10-02	2010-04-30		ENSG00000181513	ENSG00000181513			23337	protein-coding gene	gene with protein product			"""acyl-Coenzyme A binding domain containing 4"""				Standard	NM_001135704		Approved	FLJ13322	uc002iie.3	Q8NC06	OTTHUMG00000180111	ENST00000376955.4:c.159C>T	17.37:g.43213937C>T			D3DX64|Q8IUT1|Q9H8Q4	Silent	SNP	pfam_Acyl-CoA-binding_protein,superfamily_Acyl-CoA-binding_protein,prints_Acyl-CoA-binding_protein	p.P53	ENST00000376955.4	37	c.159	CCDS45711.1	17																																																																																			ACBD4	-	pfam_Acyl-CoA-binding_protein,superfamily_Acyl-CoA-binding_protein	ENSG00000181513		0.602	ACBD4-006	KNOWN	basic|CCDS	protein_coding	ACBD4	HGNC	protein_coding	OTTHUMT00000449816.1	-	0.00	103	0	C	NM_024722		43213937	+1	tier1	-	no_errors	ENST00000431281	ensembl	human	known	74_37	silent	5.48	69	4	SNP	1.000	T
AEBP1	165	genome.wustl.edu	37	7	44152463	44152463	+	Missense_Mutation	SNP	G	G	C			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr7:44152463G>C	ENST00000223357.3	+	18	2829	c.2524G>C	c.(2524-2526)Ggc>Cgc	p.G842R	MIR4649_ENST00000582839.1_RNA|AEBP1_ENST00000450684.2_Missense_Mutation_p.G417R	NM_001129.3	NP_001120.3	Q8IUX7	AEBP1_HUMAN	AE binding protein 1	842	Interaction with PTEN. {ECO:0000250}.				cell adhesion (GO:0007155)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(13)|upper_aerodigestive_tract(2)	33						CTACACCGGCGGCATGGGCAT	0.692																																																	0													50.0	58.0	55.0					7																	44152463		2203	4300	6503	SO:0001583	missense	0			D86479	CCDS5476.1	7p	2008-07-18	2001-11-28		ENSG00000106624	ENSG00000106624			303	protein-coding gene	gene with protein product	"""aortic carboxypeptidase-like protein"", ""adipocyte enhancer binding protein 1"""	602981	"""AE-binding protein 1"""			8920928	Standard	NM_001129		Approved	ACLP	uc003tkb.4	Q8IUX7	OTTHUMG00000023362	ENST00000223357.3:c.2524G>C	7.37:g.44152463G>C	ENSP00000223357:p.Gly842Arg		Q14113|Q59ER7|Q6ZSC7|Q7KZ79	Missense_Mutation	SNP	pfam_Peptidase_M14,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_CarboxyPept-like_regulatory,smart_Coagulation_fac_5/8-C_type_dom,smart_Peptidase_M14,pfscan_Coagulation_fac_5/8-C_type_dom,prints_Peptidase_M14	p.G842R	ENST00000223357.3	37	c.2524	CCDS5476.1	7	.	.	.	.	.	.	.	.	.	.	G	24.1	4.491542	0.84962	.	.	ENSG00000106624	ENST00000223357;ENST00000450684	T;T	0.09911	2.93;2.93	5.41	4.53	0.55603	Peptidase M14, carboxypeptidase A (2);	0.110135	0.64402	D	0.000009	T	0.17704	0.0425	N	0.16307	0.4	0.48901	D	0.999728	D;D	0.89917	1.0;0.999	D;D	0.77557	0.99;0.975	T	0.07328	-1.0778	10	0.39692	T	0.17	-35.1535	13.8614	0.63561	0.0747:0.0:0.9253:0.0	.	417;842	Q8IUX7-2;Q8IUX7	.;AEBP1_HUMAN	R	842;417	ENSP00000223357:G842R;ENSP00000398878:G417R	ENSP00000223357:G842R	G	+	1	0	AEBP1	44118988	1.000000	0.71417	0.884000	0.34674	0.998000	0.95712	5.549000	0.67261	1.420000	0.47138	0.591000	0.81541	GGC	AEBP1	-	pfam_Peptidase_M14,smart_Peptidase_M14	ENSG00000106624		0.692	AEBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AEBP1	HGNC	protein_coding	OTTHUMT00000250993.2	-	0.00	130	0	G	NM_001129		44152463	+1	tier1	-	no_errors	ENST00000223357	ensembl	human	known	74_37	missense	9.57	85	9	SNP	0.996	C
ADCK2	90956	genome.wustl.edu	37	7	140380866	140380866	+	Nonsense_Mutation	SNP	C	C	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr7:140380866C>T	ENST00000072869.4	+	4	1412	c.1234C>T	c.(1234-1236)Cag>Tag	p.Q412*	ADCK2_ENST00000476491.1_Nonsense_Mutation_p.Q412*	NM_052853.3	NP_443085.2	Q7Z695	ADCK2_HUMAN	aarF domain containing kinase 2	412	Protein kinase.					integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			cervix(1)|kidney(2)|large_intestine(2)|lung(5)|prostate(1)|skin(4)	15	Melanoma(164;0.00956)					GTCCAGTTACCAGCAGGCAGG	0.572																																																	0													140.0	112.0	121.0					7																	140380866		2203	4300	6503	SO:0001587	stop_gained	0			AF131745	CCDS5861.1	7q34	2003-07-21			ENSG00000133597	ENSG00000133597			19039	protein-coding gene	gene with protein product							Standard	NM_052853		Approved	MGC20727	uc003vvy.1	Q7Z695	OTTHUMG00000157409	ENST00000072869.4:c.1234C>T	7.37:g.140380866C>T	ENSP00000072869:p.Gln412*		Q96CN6|Q9Y6T5	Nonsense_Mutation	SNP	pfam_UbiB_dom,superfamily_Kinase-like_dom	p.Q412*	ENST00000072869.4	37	c.1234	CCDS5861.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	34|34	5.402311|5.402311	0.96030|0.96030	.|.	.|.	ENSG00000133597|ENSG00000133597	ENST00000483369|ENST00000072869;ENST00000476491;ENST00000473512	.|.	.|.	.|.	4.38|4.38	4.38|4.38	0.52667|0.52667	.|.	.|0.102019	.|0.42964	.|D	.|0.000638	T|.	0.27663|.	0.0680|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.29027|.	-1.0025|.	3|.	.|0.06494	.|T	.|0.89	-29.0145|-29.0145	9.9853|9.9853	0.41839|0.41839	0.0:0.9061:0.0:0.0939|0.0:0.9061:0.0:0.0939	.|.	.|.	.|.	.|.	L|X	249|412;412;52	.|.	.|ENSP00000072869:Q412X	P|Q	+|+	2|1	0|0	ADCK2|ADCK2	140027335|140027335	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	3.003000|3.003000	0.49505|0.49505	2.262000|2.262000	0.75019|0.75019	0.561000|0.561000	0.74099|0.74099	CCA|CAG	ADCK2	-	superfamily_Kinase-like_dom	ENSG00000133597		0.572	ADCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCK2	HGNC	protein_coding	OTTHUMT00000348734.1	-	0.00	79	0	C	NM_052853		140380866	+1	tier1	-	no_errors	ENST00000072869	ensembl	human	known	74_37	nonsense	51.52	32	34	SNP	1.000	T
AEBP2	121536	genome.wustl.edu	37	12	19626251	19626251	+	Missense_Mutation	SNP	A	A	G			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr12:19626251A>G	ENST00000398864.3	+	3	975	c.949A>G	c.(949-951)Agg>Ggg	p.R317G	AEBP2_ENST00000266508.9_Missense_Mutation_p.R317G|AEBP2_ENST00000360995.4_Missense_Mutation_p.R101G|AEBP2_ENST00000541908.1_Missense_Mutation_p.R88G	NM_001114176.1	NP_001107648.1	Q6ZN18	AEBP2_HUMAN	AE binding protein 2	317					chromatin modification (GO:0016568)	ESC/E(Z) complex (GO:0035098)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription corepressor activity (GO:0003714)			ovary(1)	1	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)|Esophageal squamous(101;0.143)					TTGGTTACAAAGGCATATGCT	0.269																																																	0													69.0	65.0	66.0					12																	19626251		1861	4118	5979	SO:0001583	missense	0				CCDS44841.1, CCDS44842.1, CCDS58215.1	12p12.3	2012-10-02			ENSG00000139154	ENSG00000139154			24051	protein-coding gene	gene with protein product						10329662	Standard	NM_153207		Approved	MGC17922	uc001ref.2	Q6ZN18	OTTHUMG00000168906	ENST00000398864.3:c.949A>G	12.37:g.19626251A>G	ENSP00000381840:p.Arg317Gly		Q59FS5|Q6ZN62|Q96BG3	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R317G	ENST00000398864.3	37	c.949	CCDS44841.1	12	.	.	.	.	.	.	.	.	.	.	A	18.61	3.661347	0.67700	.	.	ENSG00000139154	ENST00000538425;ENST00000541908;ENST00000398864;ENST00000435841;ENST00000266508;ENST00000360995	D;D;D;D;D	0.96265	-3.96;-3.96;-3.96;-3.96;-3.96	5.18	4.02	0.46733	Zinc finger, C2H2-like (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.96024	0.8705	L	0.31120	0.905	0.50171	D	0.999857	D	0.69078	0.997	D	0.80764	0.994	D	0.95588	0.8652	9	0.62326	D	0.03	-10.0927	11.27	0.49133	0.6991:0.3009:0.0:0.0	.	317	Q6ZN18	AEBP2_HUMAN	G	88;88;317;251;317;101	ENSP00000444255:R88G;ENSP00000437983:R88G;ENSP00000381840:R317G;ENSP00000266508:R317G;ENSP00000354267:R101G	ENSP00000266508:R317G	R	+	1	2	AEBP2	19517518	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.217000	0.58547	0.975000	0.38392	0.454000	0.30748	AGG	AEBP2	-	smart_Znf_C2H2-like	ENSG00000139154		0.269	AEBP2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AEBP2	HGNC	protein_coding	OTTHUMT00000401575.1	-	0.00	81	0	A	NM_153207		19626251	+1	tier1	-	no_errors	ENST00000398864	ensembl	human	known	74_37	missense	45.31	35	29	SNP	1.000	G
AGPAT6	137964	genome.wustl.edu	37	8	41469726	41469726	+	Silent	SNP	C	C	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr8:41469726C>A	ENST00000396987.3	+	7	1656	c.729C>A	c.(727-729)atC>atA	p.I243I	RP11-360L9.8_ENST00000581909.1_RNA	NM_178819.3	NP_848934.1	Q86UL3	GPAT4_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 6	243					acyl-CoA metabolic process (GO:0006637)|CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|diacylglycerol metabolic process (GO:0046339)|fatty acid metabolic process (GO:0006631)|glandular epithelial cell maturation (GO:0002071)|glycerophospholipid biosynthetic process (GO:0046474)|lactation (GO:0007595)|lipid biosynthetic process (GO:0008610)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			endometrium(3)|kidney(2)|large_intestine(3)|lung(6)	14	Ovarian(28;0.00769)|Colorectal(14;0.0202)|Lung SC(25;0.211)	all_lung(54;0.0131)|Lung NSC(58;0.0363)|Hepatocellular(245;0.0462)|Esophageal squamous(32;0.0844)	OV - Ovarian serous cystadenocarcinoma(14;0.00126)|Colorectal(10;0.0014)|Lung(22;0.00177)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0147)			ATGGTGGCATCTGTGTGGCCA	0.458																																																	0													177.0	146.0	157.0					8																	41469726		2203	4300	6503	SO:0001819	synonymous_variant	0			AF406612	CCDS6117.1	8p11.21	2013-02-05	2013-02-05			ENSG00000158669	2.3.1.15	"""1-acylglycerol-3-phosphate O-acyltransferases"""	20880	protein-coding gene	gene with protein product	"""lysophosphatidic acid acyltransferase, zeta"""	608143	"""1-acylglycerol-3-phosphate O-acyltransferase 6 (lysophosphatidic acid acyltransferase, zeta)"""			12938015	Standard	NM_178819		Approved	DKFZp586M1819, LPAAT-zeta	uc003xnz.2	Q86UL3		ENST00000396987.3:c.729C>A	8.37:g.41469726C>A			Q86V89	Silent	SNP	pfam_Plipid/glycerol_acylTrfase,smart_Plipid/glycerol_acylTrfase	p.I243	ENST00000396987.3	37	c.729	CCDS6117.1	8																																																																																			AGPAT6	-	pfam_Plipid/glycerol_acylTrfase,smart_Plipid/glycerol_acylTrfase	ENSG00000158669		0.458	AGPAT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGPAT6	HGNC	protein_coding	OTTHUMT00000377158.1		0.00	75	0	C	NM_178819		41469726	+1			no_errors	ENST00000396987	ensembl	human	known	74_37	silent	5.77	49	3	SNP	1.000	A
AKAP1	8165	genome.wustl.edu	37	17	55183839	55183839	+	Missense_Mutation	SNP	G	G	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr17:55183839G>T	ENST00000337714.3	+	2	1247	c.1014G>T	c.(1012-1014)ttG>ttT	p.L338F	AKAP1_ENST00000571629.1_Missense_Mutation_p.L338F|AKAP1_ENST00000539273.1_Missense_Mutation_p.L338F|AKAP1_ENST00000314126.3_Missense_Mutation_p.L338F|AKAP1_ENST00000572557.1_Missense_Mutation_p.L338F	NM_003488.3	NP_003479.1	Q92667	AKAP1_HUMAN	A kinase (PRKA) anchor protein 1	338					blood coagulation (GO:0007596)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(2)|liver(1)|lung(7)|ovary(2)|pancreas(1)|skin(1)	14	Breast(9;5.46e-08)					AGGAGGGCTTGGATAGAAATG	0.498																																																	0													99.0	105.0	103.0					17																	55183839		2203	4300	6503	SO:0001583	missense	0			X97335	CCDS11594.1	17q22	2013-01-23			ENSG00000121057	ENSG00000121057		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Tudor domain containing"""	367	protein-coding gene	gene with protein product	"""protein kinase anchoring protein 1"", ""dual specificity A-kinase-anchoring protein 1"", ""protein phosphatase 1, regulatory subunit 43"", ""tudor domain containing 17"""	602449		PRKA1		8769136, 7499250	Standard	NM_003488		Approved	AKAP121, AKAP149, SAKAP84, S-AKAP84, AKAP84, D-AKAP1, PPP1R43, TDRD17	uc002iux.3	Q92667	OTTHUMG00000140369	ENST00000337714.3:c.1014G>T	17.37:g.55183839G>T	ENSP00000337736:p.Leu338Phe		A8K8Q1|D3DTZ0|Q13320|Q9BW14	Missense_Mutation	SNP	pfam_Tudor,pfam_KH_dom_type_1,smart_KH_dom,smart_Tudor,pfscan_Tudor,pfscan_KH_dom_type_1	p.L338F	ENST00000337714.3	37	c.1014	CCDS11594.1	17	.	.	.	.	.	.	.	.	.	.	G	21.3	4.131066	0.77549	.	.	ENSG00000121057	ENST00000337714;ENST00000314126;ENST00000427138;ENST00000539273	T;T;T	0.26957	2.11;1.7;2.11	5.72	3.56	0.40772	.	0.991061	0.08201	N	0.982336	T	0.13500	0.0327	N	0.14661	0.345	0.09310	N	1	P	0.41265	0.744	B	0.34038	0.174	T	0.08330	-1.0727	10	0.26408	T	0.33	2.5741	8.3882	0.32512	0.2284:0.0:0.7716:0.0	.	338	Q92667	AKAP1_HUMAN	F	338;338;380;338	ENSP00000337736:L338F;ENSP00000314075:L338F;ENSP00000443139:L338F	ENSP00000314075:L338F	L	+	3	2	AKAP1	52538838	0.086000	0.21541	0.018000	0.16275	0.957000	0.61999	0.526000	0.22971	1.413000	0.46997	0.561000	0.74099	TTG	AKAP1	-	NULL	ENSG00000121057		0.498	AKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP1	HGNC	protein_coding	OTTHUMT00000277069.1	-	0.00	76	0	G			55183839	+1	tier1	-	no_errors	ENST00000337714	ensembl	human	known	74_37	missense	28.57	30	12	SNP	0.017	T
ALG9	79796	genome.wustl.edu	37	11	111708222	111708222	+	Silent	SNP	G	G	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr11:111708222G>T	ENST00000531154.1	-	12	1400	c.928C>A	c.(928-930)Cga>Aga	p.R310R	ALG9_ENST00000398006.2_Silent_p.R303R|ALG9_ENST00000527228.1_5'UTR|ALG9_ENST00000524880.1_3'UTR	NM_024740.2	NP_079016.2	Q9H6U8	ALG9_HUMAN	ALG9, alpha-1,2-mannosyltransferase	474					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	dol-P-Man:Man(6)GlcNAc(2)-PP-Dol alpha-1,2-mannosyltransferase activity (GO:0052926)|dol-P-Man:Man(8)GlcNAc(2)-PP-Dol alpha-1,2-mannosyltransferase activity (GO:0052918)	p.R310R(1)|p.R706R(1)|p.R707R(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16		all_cancers(61;2.34e-15)|all_epithelial(67;1.72e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;6.81e-07)|BRCA - Breast invasive adenocarcinoma(274;1.15e-06)|all cancers(92;1.3e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0587)		CTGGGAAATCGATACCACTCT	0.418																																																	3	Substitution - coding silent(3)	endometrium(3)											110.0	110.0	110.0					11																	111708222		1876	4108	5984	SO:0001819	synonymous_variant	0				CCDS41714.1, CCDS53709.1, CCDS73379.1, CCDS73380.1	11q23	2013-02-26	2013-02-26	2004-08-26	ENSG00000086848	ENSG00000086848	2.4.1.259, 2.4.1.261	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	15672	protein-coding gene	gene with protein product	"""dolichyl-P-Man:Man(6)GlcNAc(2)-PP-dolichol alpha-1,2-mannosyltransferase"", ""dolichyl-P-Man:Man(8)GlcNAc(2)-PP-dolichol alpha-1,2-mannosyltransferase"", ""dol-P-Man dependent alpha-1,2-mannosyltransferase"""	606941	"""disrupted in bipolar affective disorder 1"", ""asparagine-linked glycosylation 9 homolog (yeast, alpha 1,2 mannosyltransferase)"", ""asparagine-linked glycosylation 9, alpha- 1,2-mannosyltransferase homolog (S. cerevisiae, alpha- 1,2-mannosyltransferase)"", ""asparagine-linked glycosylation 9, alpha-1,2-mannosyltransferase homolog (S. cerevisiae)"""	DIBD1		12030331, 15148656	Standard	NM_024740		Approved		uc021qql.1	Q9H6U8	OTTHUMG00000166819	ENST00000531154.1:c.928C>A	11.37:g.111708222G>T			Q6ZMD5|Q7Z4R4|Q96GS7|Q96PB9|Q9H068	Silent	SNP	pfam_GPI_mannosylTrfase	p.R310	ENST00000531154.1	37	c.928	CCDS41714.1	11																																																																																			ALG9	-	pfam_GPI_mannosylTrfase	ENSG00000086848		0.418	ALG9-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ALG9	HGNC	protein_coding	OTTHUMT00000391485.1		0.00	66	0	G	NM_024740		111708222	-1			no_errors	ENST00000531154	ensembl	human	known	74_37	silent	5.45	52	3	SNP	1.000	T
ALPK3	57538	genome.wustl.edu	37	15	85411669	85411669	+	Missense_Mutation	SNP	G	G	C			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr15:85411669G>C	ENST00000258888.5	+	14	5873	c.5706G>C	c.(5704-5706)aaG>aaC	p.K1902N		NM_020778.4	NP_065829.3	Q96L96	ALPK3_HUMAN	alpha-kinase 3	1902					heart development (GO:0007507)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(3)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(4)|large_intestine(9)|lung(27)|ovary(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	81			BRCA - Breast invasive adenocarcinoma(143;0.0587)			AGGGCTCCAAGGCCCAGGGCA	0.617																																																	0													29.0	29.0	29.0					15																	85411669		2203	4299	6502	SO:0001583	missense	0			AY044449	CCDS10333.1	15q25.2	2013-01-29			ENSG00000136383	ENSG00000136383		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17574	protein-coding gene	gene with protein product	"""myocyte induction differentiation originator"", ""muscle alpha-kinase"""					10021370	Standard	NM_020778		Approved	MAK, KIAA1330, Midori	uc002ble.3	Q96L96	OTTHUMG00000148667	ENST00000258888.5:c.5706G>C	15.37:g.85411669G>C	ENSP00000258888:p.Lys1902Asn		Q9P2L6	Missense_Mutation	SNP	pfam_MHCK_EF2_kinase,pfam_Ig_I-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase,pfscan_Ig-like_dom	p.K1902N	ENST00000258888.5	37	c.5706	CCDS10333.1	15	.	.	.	.	.	.	.	.	.	.	G	17.64	3.438990	0.63067	.	.	ENSG00000136383	ENST00000258888	T	0.64438	-0.1	4.47	3.56	0.40772	.	0.000000	0.42420	D	0.000702	T	0.73628	0.3611	M	0.65975	2.015	0.33443	D	0.582624	D;D	0.71674	0.99;0.998	P;D	0.76071	0.815;0.987	T	0.79988	-0.1571	10	0.87932	D	0	-27.0655	8.7212	0.34441	0.1068:0.0:0.8932:0.0	.	203;1902	B4DU37;Q96L96	.;ALPK3_HUMAN	N	1902	ENSP00000258888:K1902N	ENSP00000258888:K1902N	K	+	3	2	ALPK3	83212673	1.000000	0.71417	1.000000	0.80357	0.858000	0.48976	2.504000	0.45416	0.894000	0.36317	-0.368000	0.07277	AAG	ALPK3	-	NULL	ENSG00000136383		0.617	ALPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALPK3	HGNC	protein_coding	OTTHUMT00000308997.1	-	0.00	118	0	G	NM_020778		85411669	+1	tier1	-	no_errors	ENST00000258888	ensembl	human	known	74_37	missense	41.67	28	20	SNP	1.000	C
AMER3	205147	genome.wustl.edu	37	2	131522133	131522133	+	Missense_Mutation	SNP	C	C	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr2:131522133C>T	ENST00000423981.1	+	2	2598	c.2488C>T	c.(2488-2490)Cca>Tca	p.P830S	AMER3_ENST00000321420.4_Missense_Mutation_p.P830S	NM_001105193.1|NM_001105194.1|NM_001105195.1|NM_152698.2	NP_001098663.1|NP_001098664.1|NP_001098665.1|NP_689911.2	Q8N944	AMER3_HUMAN	APC membrane recruitment protein 3	830					Wnt signaling pathway (GO:0016055)	plasma membrane (GO:0005886)	lipid binding (GO:0008289)										TGCAAGTGCCCCAGAATGCCG	0.667																																																	0													8.0	10.0	9.0					2																	131522133		2171	4278	6449	SO:0001583	missense	0			AK095696	CCDS2164.1	2q21.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000178171	ENSG00000178171		"""-"""	26771	protein-coding gene	gene with protein product			"""family with sequence similarity 123C"""	FAM123C		20843316	Standard	NM_001105195		Approved	FLJ38377	uc002trw.2	Q8N944	OTTHUMG00000131637	ENST00000423981.1:c.2488C>T	2.37:g.131522133C>T	ENSP00000392700:p.Pro830Ser		B7ZLH6	Missense_Mutation	SNP	pfam_Uncharacterised_FAM123	p.P830S	ENST00000423981.1	37	c.2488	CCDS2164.1	2	.	.	.	.	.	.	.	.	.	.	C	14.94	2.685101	0.47991	.	.	ENSG00000178171	ENST00000321420;ENST00000423981	T;T	0.43294	0.95;0.95	4.34	0.266	0.15617	.	.	.	.	.	T	0.22282	0.0537	N	0.24115	0.695	0.09310	N	1	B	0.21821	0.061	B	0.19391	0.025	T	0.26087	-1.0113	9	0.15066	T	0.55	.	3.9142	0.09216	0.4073:0.4117:0.0:0.181	.	830	Q8N944	F123C_HUMAN	S	830	ENSP00000314914:P830S;ENSP00000392700:P830S	ENSP00000314914:P830S	P	+	1	0	FAM123C	131238603	0.001000	0.12720	0.000000	0.03702	0.889000	0.51656	0.428000	0.21395	-0.086000	0.12550	0.561000	0.74099	CCA	AMER3	-	NULL	ENSG00000178171		0.667	AMER3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	AMER3	HGNC	protein_coding	OTTHUMT00000254531.3	-	0.00	24	0	C	NM_152698		131522133	+1	tier1	-	no_errors	ENST00000321420	ensembl	human	known	74_37	missense	58.33	15	21	SNP	0.001	T
ANKRD52	283373	genome.wustl.edu	37	12	56646326	56646326	+	Missense_Mutation	SNP	T	T	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr12:56646326T>A	ENST00000267116.7	-	13	1451	c.1330A>T	c.(1330-1332)Agc>Tgc	p.S444C		NM_173595.3	NP_775866.2	Q8NB46	ANR52_HUMAN	ankyrin repeat domain 52	444										endometrium(9)|kidney(2)|large_intestine(8)|lung(6)|ovary(2)|prostate(1)|skin(1)	29						GCTCCACTGCTCAACAGCAAA	0.443																																																	0													156.0	150.0	152.0					12																	56646326		1925	4134	6059	SO:0001583	missense	0			AK091555	CCDS44920.1	12q13.3	2013-01-10			ENSG00000139645	ENSG00000139645		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"", ""Ankyrin repeat domain containing"""	26614	protein-coding gene	gene with protein product	"""protein phosphatase 6 ankyrin repeat subunit C"""						Standard	NM_173595		Approved	FLJ34236, PP6-ARS-C	uc001skm.4	Q8NB46	OTTHUMG00000170329	ENST00000267116.7:c.1330A>T	12.37:g.56646326T>A	ENSP00000267116:p.Ser444Cys		A6NE79|B1Q2K2	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.S444C	ENST00000267116.7	37	c.1330	CCDS44920.1	12	.	.	.	.	.	.	.	.	.	.	T	21.9	4.221998	0.79464	.	.	ENSG00000139645	ENST00000267116;ENST00000417002	T	0.65364	-0.15	4.67	4.67	0.58626	Ankyrin repeat-containing domain (3);	0.045898	0.85682	D	0.000000	T	0.77605	0.4155	M	0.75884	2.315	0.58432	D	0.999998	D	0.89917	1.0	D	0.79108	0.992	T	0.80865	-0.1191	10	0.87932	D	0	.	13.4294	0.61046	0.0:0.0:0.0:1.0	.	444	Q8NB46	ANR52_HUMAN	C	444	ENSP00000267116:S444C	ENSP00000267116:S444C	S	-	1	0	ANKRD52	54932593	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.939000	0.70179	1.881000	0.54492	0.460000	0.39030	AGC	ANKRD52	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000139645		0.443	ANKRD52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD52	HGNC	protein_coding	OTTHUMT00000408539.1		0.00	83	0	T	NM_173595		56646326	-1			no_errors	ENST00000267116	ensembl	human	known	74_37	missense	10.81	33	4	SNP	1.000	A
ARHGAP29	9411	genome.wustl.edu	37	1	94643144	94643144	+	Intron	DEL	T	T	-	rs563927860	byFrequency	TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr1:94643144delT	ENST00000260526.6	-	22	3088				ARHGAP29_ENST00000482481.1_5'UTR	NM_004815.3	NP_004806.3	Q52LW3	RHG29_HUMAN	Rho GTPase activating protein 29						positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|Rho GTPase activator activity (GO:0005100)			NS(1)|breast(5)|endometrium(6)|kidney(2)|large_intestine(9)|lung(19)|ovary(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	54		all_lung(203;0.000732)|Lung NSC(277;0.00328)		all cancers(265;0.0187)|Epithelial(280;0.159)		AGCAAACATATTTTTTTTTTA	0.378													|||unknown(HR)	41	0.0081869	0.0166	0.0014	5008	,	,		16588	0.0069		0.0	False		,,,				2504	0.0112																0										80,4186		3,74,2056	74.0	70.0	71.0			-1.3	0.0	1		73	148,8102		6,136,3983	no	intron	ARHGAP29	NM_004815.3		9,210,6039	A1A1,A1R,RR		1.7939,1.8753,1.8217			94643144	228,12288	2203	4298	6501	SO:0001627	intron_variant	0				CCDS748.1	1p22.1	2011-06-29			ENSG00000137962	ENSG00000137962		"""Rho GTPase activating proteins"""	30207	protein-coding gene	gene with protein product		610496				9305890	Standard	NM_004815		Approved	PARG1	uc001dqj.4	Q52LW3	OTTHUMG00000010643	ENST00000260526.6:c.2905+23A>-	1.37:g.94643144delT			O15463|Q59H86|Q5VYZ0|Q6NVX2|Q8TBI6	RNA	DEL	-	NULL	ENST00000260526.6	37	NULL	CCDS748.1	1																																																																																			ARHGAP29	-	-	ENSG00000137962		0.378	ARHGAP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP29	HGNC	protein_coding	OTTHUMT00000029376.2		0.00	50	0	T	NM_004815		94643144	-1	tier1		no_errors	ENST00000482481	ensembl	human	known	74_37	rna	12.90	27	4	DEL	0.000	-
ARMC9	80210	genome.wustl.edu	37	2	232146814	232146814	+	Missense_Mutation	SNP	G	G	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr2:232146814G>T	ENST00000349938.4	+	17	1788	c.1594G>T	c.(1594-1596)Gtt>Ttt	p.V532F	ARMC9_ENST00000483477.1_3'UTR	NM_001271466.1|NM_025139.4	NP_001258395.1|NP_079415	Q7Z3E5	ARMC9_HUMAN	armadillo repeat containing 9	532						extracellular vesicular exosome (GO:0070062)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(5)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22		Renal(207;0.0112)|all_lung(227;0.0744)|all_hematologic(139;0.0749)|Acute lymphoblastic leukemia(138;0.167)|Medulloblastoma(418;0.184)|Lung NSC(271;0.205)		Epithelial(121;1.43e-10)|LUSC - Lung squamous cell carcinoma(224;0.017)|Lung(119;0.0189)		CATCCTTTCTGTTCCATCCAT	0.428																																																	0													158.0	153.0	155.0					2																	232146814		2203	4300	6503	SO:0001583	missense	0			BC004514	CCDS2484.1, CCDS74666.1	2q37.1	2013-02-14			ENSG00000135931	ENSG00000135931		"""Armadillo repeat containing"""	20730	protein-coding gene	gene with protein product						11347906	Standard	NM_025139		Approved	FLJ12584, KIAA1868, ARM, KU-MEL-1	uc031rrs.1	Q7Z3E5	OTTHUMG00000133229	ENST00000349938.4:c.1594G>T	2.37:g.232146814G>T	ENSP00000258417:p.Val532Phe		Q53TI3|Q6P162|Q7L594|Q86WG2|Q96JF9|Q9H9R8	Missense_Mutation	SNP	superfamily_ARM-type_fold,smart_LisH_dimerisation,pfscan_LisH_dimerisation	p.V532F	ENST00000349938.4	37	c.1594	CCDS2484.1	2	.	.	.	.	.	.	.	.	.	.	G	9.793	1.178452	0.21787	.	.	ENSG00000135931	ENST00000349938;ENST00000359743	T	0.51325	0.71	5.45	-1.02	0.10135	Armadillo-like helical (1);Armadillo-type fold (1);	0.440517	0.26272	N	0.025327	T	0.32102	0.0818	N	0.25647	0.755	0.09310	N	0.999999	P	0.35077	0.483	B	0.36244	0.22	T	0.22800	-1.0206	10	0.54805	T	0.06	-4.275	10.8513	0.46771	0.4872:0.0:0.5128:0.0	.	532	Q7Z3E5	ARMC9_HUMAN	F	532	ENSP00000258417:V532F	ENSP00000258417:V532F	V	+	1	0	ARMC9	231855058	0.011000	0.17503	0.001000	0.08648	0.579000	0.36224	0.304000	0.19228	-0.335000	0.08451	-0.302000	0.09304	GTT	ARMC9	-	superfamily_ARM-type_fold	ENSG00000135931		0.428	ARMC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARMC9	HGNC	protein_coding	OTTHUMT00000256966.3	-	0.00	112	0	G	NM_025139		232146814	+1	tier1	-	no_errors	ENST00000349938	ensembl	human	known	74_37	missense	5.19	73	4	SNP	0.003	T
ATF4	468	genome.wustl.edu	37	22	39917510	39917510	+	Silent	SNP	C	C	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr22:39917510C>T	ENST00000337304.2	+	1	942	c.60C>T	c.(58-60)ttC>ttT	p.F20F	ATF4_ENST00000404241.2_Silent_p.F20F|ATF4_ENST00000396680.1_Silent_p.F20F	NM_001675.2	NP_001666.2	P18848	ATF4_HUMAN	activating transcription factor 4	20					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular amino acid metabolic process (GO:0006520)|cellular protein metabolic process (GO:0044267)|circadian regulation of gene expression (GO:0032922)|endoplasmic reticulum unfolded protein response (GO:0030968)|gamma-aminobutyric acid signaling pathway (GO:0007214)|gluconeogenesis (GO:0006094)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of oxidative stress-induced neuron death (GO:1903204)|negative regulation of potassium ion transport (GO:0043267)|positive regulation of apoptotic process (GO:0043065)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to endoplasmic reticulum stress (GO:1990440)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to endoplasmic reticulum stress (GO:0034976)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite membrane (GO:0032590)|Lewy body core (GO:1990037)|neuron projection (GO:0043005)|nuclear periphery (GO:0034399)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(2)|large_intestine(2)|lung(5)|skin(1)	11	Melanoma(58;0.04)				Pseudoephedrine(DB00852)	TGTCCCCCTTCGACCAGTCGG	0.537																																																	0													64.0	64.0	64.0					22																	39917510		2203	4300	6503	SO:0001819	synonymous_variant	0			D90209	CCDS13996.1	22q13.1	2013-05-23	2013-05-23		ENSG00000128272	ENSG00000128272		"""basic leucine zipper proteins"""	786	protein-coding gene	gene with protein product	"""tax-responsive enhancer element B67"""	604064	"""activating transcription factor 4 (tax-responsive enhancer element B67)"""	TXREB		1847461, 1534408	Standard	NM_182810		Approved	TAXREB67, CREB-2	uc003axz.3	P18848	OTTHUMG00000151099	ENST00000337304.2:c.60C>T	22.37:g.39917510C>T			Q9UH31	Silent	SNP	pfam_bZIP,smart_bZIP,pfscan_bZIP	p.F20	ENST00000337304.2	37	c.60	CCDS13996.1	22																																																																																			ATF4	-	NULL	ENSG00000128272		0.537	ATF4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ATF4	HGNC	protein_coding	OTTHUMT00000321305.1	-	0.00	71	0	C	NM_001675		39917510	+1	tier1	-	no_errors	ENST00000337304	ensembl	human	known	74_37	silent	11.94	59	8	SNP	1.000	T
ATF6B	1388	genome.wustl.edu	37	6	32093828	32093829	+	Intron	DEL	AC	AC	-			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	AC	AC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr6:32093828_32093829delAC	ENST00000375203.3	-	5	511				ATF6B_ENST00000375201.4_Intron|ATF6B_ENST00000468502.1_5'UTR	NM_001136153.1|NM_004381.4	NP_001129625.1|NP_004372.3	Q99941	ATF6B_HUMAN	activating transcription factor 6 beta						response to unfolded protein (GO:0006986)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(11)|prostate(2)|skin(1)|urinary_tract(1)	22						CTACACACATACACACACACAC	0.515																																																	0																																										SO:0001627	intron_variant	0				CCDS47408.1, CCDS4737.1	6p21.3	2013-01-10	2008-10-21	2008-10-21	ENSG00000213676	ENSG00000213676		"""basic leucine zipper proteins"""	2349	protein-coding gene	gene with protein product		600984	"""cAMP responsive element binding protein-like 1"""	CREBL1		11256944, 14973138	Standard	NM_004381		Approved	G13	uc003nzn.3	Q99941	OTTHUMG00000031296	ENST00000375203.3:c.478+64GT>-	6.37:g.32093838_32093839delAC			B0UYX6|Q13269|Q14343|Q14345|Q5SSW7|Q99635|Q99637|Q9H3V9|Q9H3W1|Q9NPL0	RNA	DEL	-	NULL	ENST00000375203.3	37	NULL	CCDS4737.1	6																																																																																			ATF6B	-	-	ENSG00000213676		0.515	ATF6B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATF6B	HGNC	protein_coding	OTTHUMT00000076638.2		0.00	42	0	AC			32093829	-1	tier1		no_errors	ENST00000468502	ensembl	human	known	74_37	rna	8.33	33	3	DEL	0.000:0.000	-
ATP2A2	488	genome.wustl.edu	37	12	110778492	110778492	+	Missense_Mutation	SNP	G	G	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr12:110778492G>A	ENST00000539276.2	+	14	1899	c.1790G>A	c.(1789-1791)gGc>gAc	p.G597D	ATP2A2_ENST00000395494.2_Missense_Mutation_p.G570D|ATP2A2_ENST00000308664.6_Missense_Mutation_p.G597D			P16615	AT2A2_HUMAN	ATPase, Ca++ transporting, cardiac muscle, slow twitch 2	597					blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cellular calcium ion homeostasis (GO:0006874)|epidermis development (GO:0008544)|ER-nucleus signaling pathway (GO:0006984)|ion transmembrane transport (GO:0034220)|negative regulation of heart contraction (GO:0045822)|positive regulation of heart rate (GO:0010460)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|calcium-transporting ATPase activity involved in regulation of cardiac muscle cell membrane potential (GO:0086039)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|S100 protein binding (GO:0044548)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(10)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(1)	38						GGCTGCGTGGGCATGCTGGAT	0.502																																																	0													110.0	114.0	113.0					12																	110778492		2203	4300	6503	SO:0001583	missense	0				CCDS9143.1, CCDS9144.1	12q24.11	2012-10-22			ENSG00000174437	ENSG00000174437	3.6.3.8	"""ATPases / P-type"""	812	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 2"", ""calcium pump 2"""	108740		ATP2B, DAR		10080178	Standard	NM_170665		Approved	SERCA2	uc001tqk.4	P16615	OTTHUMG00000169327	ENST00000539276.2:c.1790G>A	12.37:g.110778492G>A	ENSP00000440045:p.Gly597Asp		A6NDN7|B4DF05|P16614|Q86VJ2	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Ca-transp_IIA,tigrfam_Cation_transp_P_typ_ATPase	p.G597D	ENST00000539276.2	37	c.1790	CCDS9144.1	12	.	.	.	.	.	.	.	.	.	.	G	33	5.224851	0.95173	.	.	ENSG00000174437	ENST00000308664;ENST00000395494;ENST00000539276	D;D;D	0.91407	-2.84;-2.84;-2.84	6.07	6.07	0.98685	ATPase, cation-transporting, domain N (1);Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.000000	0.85682	D	0.000000	D	0.97929	0.9319	H	0.99573	4.635	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.87578	0.995;0.997;0.998	D	0.98650	1.0679	10	0.87932	D	0	.	20.6593	0.99626	0.0:0.0:1.0:0.0	.	570;597;597	P16615-4;P16615-2;P16615	.;.;AT2A2_HUMAN	D	597;570;597	ENSP00000311186:G597D;ENSP00000378872:G570D;ENSP00000440045:G597D	ENSP00000311186:G597D	G	+	2	0	ATP2A2	109262875	1.000000	0.71417	1.000000	0.80357	0.810000	0.45777	9.869000	0.99810	2.885000	0.99019	0.655000	0.94253	GGC	ATP2A2	-	pfam_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Ca-transp_IIA	ENSG00000174437		0.502	ATP2A2-003	KNOWN	basic|CCDS	protein_coding	ATP2A2	HGNC	protein_coding	OTTHUMT00000403539.1		0.00	48	0	G	NM_001681		110778492	+1			no_errors	ENST00000539276	ensembl	human	known	74_37	missense	9.76	37	4	SNP	1.000	A
ATP6V1C2	245973	genome.wustl.edu	37	2	10917819	10917820	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	AG	AG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr2:10917819_10917820delAG	ENST00000272238.4	+	11	1043_1044	c.934_935delAG	c.(934-936)agafs	p.R312fs	ATP6V1C2_ENST00000381661.3_Intron	NM_001039362.1	NP_001034451.1	Q8NEY4	VATC2_HUMAN	ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C2	312					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|positive regulation of Wnt signaling pathway (GO:0030177)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|proton-transporting V-type ATPase, V1 domain (GO:0033180)	hydrogen-exporting ATPase activity, phosphorylative mechanism (GO:0008553)|protein dimerization activity (GO:0046983)			endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.15)|OV - Ovarian serous cystadenocarcinoma(76;0.152)		GCAGACCGACAGAGAGAGAGAG	0.604																																					NSCLC(188;1042 2136 10807 16813 47705)												0																																										SO:0001589	frameshift_variant	0			AY039759	CCDS1674.1, CCDS42653.1	2p25.1	2010-04-21	2006-01-13		ENSG00000143882	ENSG00000143882		"""ATPases / V-type"""	18264	protein-coding gene	gene with protein product			"""ATPase, H+ transporting, lysosomal 42kD, V1 subunit C isoform 2"", ""ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C isoform 2"""			12384298	Standard	XR_426949		Approved	VMA5, ATP6C2	uc002ras.3	Q8NEY4	OTTHUMG00000090459	ENST00000272238.4:c.934_935delAG	2.37:g.10917829_10917830delAG	ENSP00000272238:p.Arg312fs		Q96EL8	Frame_Shift_Del	DEL	pfam_ATPase_V1-cplx_csu	p.E315fs	ENST00000272238.4	37	c.934_935	CCDS42653.1	2																																																																																			ATP6V1C2	-	pfam_ATPase_V1-cplx_csu	ENSG00000143882		0.604	ATP6V1C2-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	ATP6V1C2	HGNC	protein_coding	OTTHUMT00000323555.1		0.00	21	0	AG	NM_144583		10917820	+1	tier1		no_errors	ENST00000272238	ensembl	human	known	74_37	frame_shift_del	13.64	19	3	DEL	1.000:1.000	-
BAIAP2L2	80115	genome.wustl.edu	37	22	38481371	38481371	+	Missense_Mutation	SNP	G	G	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr22:38481371G>T	ENST00000381669.3	-	14	1670	c.1526C>A	c.(1525-1527)cCt>cAt	p.P509H	SLC16A8_ENST00000320521.5_5'Flank|SLC16A8_ENST00000469516.1_5'Flank	NM_025045.4	NP_079321.3	Q6UXY1	BI2L2_HUMAN	BAI1-associated protein 2-like 2	509					filopodium assembly (GO:0046847)|membrane organization (GO:0061024)|regulation of actin cytoskeleton organization (GO:0032956)|signal transduction (GO:0007165)	cell-cell contact zone (GO:0044291)|cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	phospholipid binding (GO:0005543)			large_intestine(2)|lung(1)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)	8	Melanoma(58;0.045)					AGTGGCAAAAGGATTTGTGCC	0.612																																																	0													71.0	79.0	76.0					22																	38481371		2123	4221	6344	SO:0001583	missense	0			BC015619	CCDS43018.1	22q13.1	2005-02-09			ENSG00000128298	ENSG00000128298			26203	protein-coding gene	gene with protein product							Standard	NM_025045		Approved	FLJ22582	uc003auw.3	Q6UXY1	OTTHUMG00000151197	ENST00000381669.3:c.1526C>A	22.37:g.38481371G>T	ENSP00000371085:p.Pro509His		B0QYE2|Q96BG7	Missense_Mutation	SNP	pfam_IRSp53/MIM_homology_IMD,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	p.P509H	ENST00000381669.3	37	c.1526	CCDS43018.1	22	.	.	.	.	.	.	.	.	.	.	G	17.84	3.488777	0.64074	.	.	ENSG00000128298	ENST00000381669;ENST00000402500	T	0.80393	-1.37	4.14	4.14	0.48551	.	0.000000	0.85682	U	0.000000	D	0.89128	0.6627	M	0.78049	2.395	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.90863	0.4740	10	0.87932	D	0	-25.8341	14.9499	0.71064	0.0:0.0:1.0:0.0	.	509	Q6UXY1	BI2L2_HUMAN	H	509;495	ENSP00000371085:P509H	ENSP00000371085:P509H	P	-	2	0	BAIAP2L2	36811317	1.000000	0.71417	1.000000	0.80357	0.485000	0.33311	5.428000	0.66489	2.011000	0.59026	0.491000	0.48974	CCT	BAIAP2L2	-	NULL	ENSG00000128298		0.612	BAIAP2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAIAP2L2	HGNC	protein_coding	OTTHUMT00000321727.1	-	0.00	91	0	G	NM_025045		38481371	-1	tier1	-	no_errors	ENST00000381669	ensembl	human	known	74_37	missense	5.13	72	4	SNP	1.000	T
BAZ2B	29994	genome.wustl.edu	37	2	160242920	160242920	+	Missense_Mutation	SNP	G	G	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr2:160242920G>A	ENST00000392783.2	-	22	3910	c.3415C>T	c.(3415-3417)Ctt>Ttt	p.L1139F	BAZ2B_ENST00000355831.2_Missense_Mutation_p.L1105F|AC008277.1_ENST00000420020.1_RNA|BAZ2B_ENST00000343439.5_Missense_Mutation_p.L1039F|BAZ2B_ENST00000392782.1_Missense_Mutation_p.L1103F	NM_013450.2	NP_038478.2	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	1139	DDT. {ECO:0000255|PROSITE- ProRule:PRU00063}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(7)|liver(2)|lung(41)|ovary(3)|prostate(1)|skin(2)|soft_tissue(1)|urinary_tract(1)	82						AGCCTCACAAGCAAGTCTTGT	0.373																																																	0													83.0	76.0	78.0					2																	160242920		1887	4133	6020	SO:0001583	missense	0			AB032255	CCDS2209.2, CCDS74594.1	2q24.2	2013-01-28			ENSG00000123636	ENSG00000123636		"""Zinc fingers, PHD-type"""	963	protein-coding gene	gene with protein product		605683				10662543	Standard	XM_005246488		Approved	WALp4	uc002uao.3	Q9UIF8	OTTHUMG00000132027	ENST00000392783.2:c.3415C>T	2.37:g.160242920G>A	ENSP00000376534:p.Leu1139Phe		D3DPA8|Q96EA1|Q96SQ8|Q9P252|Q9Y4N8	Missense_Mutation	SNP	pfam_Bromodomain,pfam_Methyl_CpG_DNA-bd,pfam_DDT_dom,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_DNA-bd_dom,superfamily_Znf_FYVE_PHD,superfamily_ARM-type_fold,smart_Methyl_CpG_DNA-bd,smart_DDT_dom_subgr,smart_Znf_PHD,smart_Bromodomain,pfscan_Methyl_CpG_DNA-bd,pfscan_Znf_PHD-finger,pfscan_DDT_dom_superfamily,pfscan_Bromodomain,prints_Bromodomain	p.L1139F	ENST00000392783.2	37	c.3415	CCDS2209.2	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.1|25.1	4.605061|4.605061	0.87157|0.87157	.|.	.|.	ENSG00000123636|ENSG00000123636	ENST00000294905|ENST00000392782;ENST00000392783;ENST00000355831;ENST00000343439	.|T;T;T;T	.|0.64803	.|-0.11;-0.08;-0.11;-0.12	6.08|6.08	6.08|6.08	0.98989|0.98989	.|DDT domain superfamily (1);DDT domain, subgroup (1);DDT domain (1);	.|0.000000	.|0.33534	.|U	.|0.004815	T|T	0.79143|0.79143	0.4396|0.4396	M|M	0.64997|0.64997	1.995|1.995	0.53688|0.53688	D|D	0.999977|0.999977	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.97110	.|0.995;1.0	T|T	0.77970|0.77970	-0.2387|-0.2387	5|10	.|0.62326	.|D	.|0.03	-10.6455|-10.6455	20.6721|20.6721	0.99693|0.99693	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1103;1139	.|Q9UIF8-5;Q9UIF8	.|.;BAZ2B_HUMAN	V|F	199|1103;1139;1105;1039	.|ENSP00000376533:L1103F;ENSP00000376534:L1139F;ENSP00000348087:L1105F;ENSP00000339670:L1039F	.|ENSP00000339670:L1039F	A|L	-|-	2|1	0|0	BAZ2B|BAZ2B	159951166|159951166	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	4.004000|4.004000	0.57068|0.57068	2.894000|2.894000	0.99253|0.99253	0.591000|0.591000	0.81541|0.81541	GCT|CTT	BAZ2B	-	pfam_DDT_dom,smart_DDT_dom_subgr,pfscan_DDT_dom_superfamily	ENSG00000123636		0.373	BAZ2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAZ2B	HGNC	protein_coding	OTTHUMT00000255037.2	-	0.00	88	0	G			160242920	-1	tier1	-	no_errors	ENST00000392783	ensembl	human	known	74_37	missense	6.06	62	4	SNP	1.000	A
BET1	10282	genome.wustl.edu	37	7	93628493	93628493	+	Missense_Mutation	SNP	C	C	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr7:93628493C>T	ENST00000222547.3	-	2	291	c.133G>A	c.(133-135)Gct>Act	p.A45T	BET1_ENST00000433727.1_Missense_Mutation_p.A45T|BET1_ENST00000471446.1_5'Flank|AC006378.2_ENST00000426634.1_RNA|BET1_ENST00000425626.1_Missense_Mutation_p.A45T|AC006378.2_ENST00000426193.2_RNA	NM_005868.4	NP_005859.1	O15155	BET1_HUMAN	Bet1 golgi vesicular membrane trafficking protein	45	t-SNARE coiled-coil homology. {ECO:0000255|PROSITE-ProRule:PRU00202}.				ER to Golgi vesicle-mediated transport (GO:0006888)|protein transport (GO:0015031)|vesicle fusion with Golgi apparatus (GO:0048280)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|Golgi cisterna (GO:0031985)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				large_intestine(2)|lung(1)|prostate(1)|skin(1)	5	all_cancers(62;2.22e-10)|all_epithelial(64;1.38e-09)|Lung NSC(181;0.218)	Breast(660;0.000162)|Ovarian(593;0.000626)	STAD - Stomach adenocarcinoma(171;0.000967)			GATTTTATAGCAGTTACTTTG	0.308																																																	0													49.0	47.0	48.0					7																	93628493		2203	4300	6503	SO:0001583	missense	0			AF007551	CCDS5635.1	7q21.1-q22	2013-03-08	2013-03-08		ENSG00000105829	ENSG00000105829			14562	protein-coding gene	gene with protein product	"""Golgi vesicular membrane trafficking protein p18"", ""Bet1p homolog"""	605456	"""Bet1 (S. cerevisiae) homolog"", ""BET1 homolog (S. cerevisiae)"", ""blocked early in transport 1 homolog (S. cerevisiae)"""			9382863, 10449330	Standard	XM_005250109		Approved	hbet1	uc003unf.1	O15155	OTTHUMG00000023487	ENST00000222547.3:c.133G>A	7.37:g.93628493C>T	ENSP00000222547:p.Ala45Thr		Q96EA0	Missense_Mutation	SNP	pfam_T_SNARE_dom,pfscan_T_SNARE_dom	p.A45T	ENST00000222547.3	37	c.133	CCDS5635.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.71|19.71	3.878124|3.878124	0.72294|0.72294	.|.	.|.	ENSG00000105829|ENSG00000105829	ENST00000222547;ENST00000433727;ENST00000425626|ENST00000457139	.|.	.|.	.|.	5.45|5.45	5.45|5.45	0.79879|0.79879	Target SNARE coiled-coil domain (3);|.	0.048240|.	0.85682|.	D|.	0.000000|.	T|T	0.74199|0.74199	0.3685|0.3685	M|M	0.64260|0.64260	1.97|1.97	0.80722|0.80722	D|D	1|1	B|.	0.29212|.	0.237|.	B|.	0.35278|.	0.199|.	T|T	0.71494|0.71494	-0.4576|-0.4576	9|5	0.15499|.	T|.	0.54|.	.|.	19.2608|19.2608	0.93967|0.93967	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	45|.	O15155|.	BET1_HUMAN|.	T|Y	45|59	.|.	ENSP00000222547:A45T|.	A|C	-|-	1|2	0|0	BET1|BET1	93466429|93466429	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.529000|0.529000	0.34654|0.34654	5.114000|5.114000	0.64648|0.64648	2.729000|2.729000	0.93468|0.93468	0.655000|0.655000	0.94253|0.94253	GCT|TGC	BET1	-	pfam_T_SNARE_dom,pfscan_T_SNARE_dom	ENSG00000105829		0.308	BET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BET1	HGNC	protein_coding	OTTHUMT00000255181.2	-	0.00	95	0	C	NM_005868		93628493	-1	tier1	-	no_errors	ENST00000357520	ensembl	human	known	74_37	missense	5.88	64	4	SNP	1.000	T
BRINP3	339479	genome.wustl.edu	37	1	190129936	190129936	+	Missense_Mutation	SNP	G	G	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr1:190129936G>A	ENST00000367462.3	-	7	1277	c.1046C>T	c.(1045-1047)tCt>tTt	p.S349F	BRINP3_ENST00000534846.1_Missense_Mutation_p.S247F	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	349					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)											CTGAAAATTAGAATCCATTGT	0.348																																																	0													120.0	129.0	126.0					1																	190129936		2203	4300	6503	SO:0001583	missense	0			AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.1046C>T	1.37:g.190129936G>A	ENSP00000356432:p.Ser349Phe		B3KVP1|B7Z260|O95726|Q2M330	Missense_Mutation	SNP	pfam_MACPF,smart_MACPF	p.S349F	ENST00000367462.3	37	c.1046	CCDS1373.1	1	.	.	.	.	.	.	.	.	.	.	G	15.41	2.824919	0.50739	.	.	ENSG00000162670	ENST00000367462;ENST00000534846	T;T	0.18174	2.49;2.23	5.75	5.75	0.90469	.	0.329748	0.33180	N	0.005200	T	0.15782	0.0380	L	0.38175	1.15	0.35636	D	0.810588	B;P	0.36438	0.32;0.553	B;B	0.31812	0.136;0.102	T	0.10497	-1.0627	10	0.44086	T	0.13	.	17.4294	0.87535	0.0:0.0:1.0:0.0	.	247;349	B7Z260;Q76B58	.;FAM5C_HUMAN	F	349;247	ENSP00000356432:S349F;ENSP00000438022:S247F	ENSP00000356432:S349F	S	-	2	0	FAM5C	188396559	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.872000	0.56085	2.718000	0.92993	0.573000	0.79308	TCT	BRINP3	-	NULL	ENSG00000162670		0.348	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRINP3	HGNC	protein_coding	OTTHUMT00000086278.1	-	0.00	81	0	G	NM_199051		190129936	-1	tier1	-	no_errors	ENST00000367462	ensembl	human	known	74_37	missense	55.32	21	26	SNP	1.000	A
C14orf23	387978	genome.wustl.edu	37	14	29261391	29261391	+	Missense_Mutation	SNP	G	G	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr14:29261391G>A	ENST00000399387.4	+	3	532	c.428G>A	c.(427-429)aGt>aAt	p.S143N	C14orf23_ENST00000548213.1_Intron|C14orf23_ENST00000550266.1_Intron					chromosome 14 open reading frame 23											central_nervous_system(1)	1						AGGTTCCTAAGTTTATCCAGA	0.343																																																	0																																										SO:0001583	missense	0					14q11.2	2013-01-15			ENSG00000186960	ENSG00000186960			19828	other	unknown							Standard	NR_026731		Approved		uc001wqf.3	Q86U37	OTTHUMG00000029410	ENST00000399387.4:c.428G>A	14.37:g.29261391G>A	ENSP00000382318:p.Ser143Asn			Missense_Mutation	SNP	NULL	p.S143N	ENST00000399387.4	37	c.428		14	.	.	.	.	.	.	.	.	.	.	G	1.673	-0.508586	0.04231	.	.	ENSG00000186960	ENST00000399387	.	.	.	3.72	-0.714	0.11219	.	2.050840	0.02471	N	0.087554	T	0.32224	0.0822	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.32508	-0.9904	8	0.87932	D	0	.	5.7771	0.18285	0.2016:0.3005:0.4979:0.0	.	143	Q86U37	CN023_HUMAN	N	143	.	ENSP00000382318:S143N	S	+	2	0	C14orf23	28331142	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.504000	0.06375	-0.179000	0.10654	-2.782000	0.00117	AGT	C14orf23	-	NULL	ENSG00000186960		0.343	C14orf23-003	KNOWN	basic|appris_candidate_longest	protein_coding	C14orf23	HGNC	protein_coding	OTTHUMT00000134019.2	-	0.00	83	0	G	NR_026731		29261391	+1	tier1	-	no_errors	ENST00000399387	ensembl	human	known	74_37	missense	34.55	36	19	SNP	0.000	A
C16orf82	162083	genome.wustl.edu	37	16	27080037	27080038	+	lincRNA	INS	-	-	T	rs545877844|rs369091781		TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr16:27080037_27080038insT	ENST00000505035.1	+	0	2010_2011				RP11-673P17.2_ENST00000565783.1_RNA			Q7Z2V1	TNT_HUMAN	chromosome 16 open reading frame 82																		TCCAAGCGTCCTTTTTTTTTTT	0.48																																																	0																																												0			BC031257		16p12.1	2013-01-24			ENSG00000234186	ENSG00000234186			30755	other	unknown						12477932	Standard	NM_001145545		Approved	TNT	uc010vcm.2	Q7Z2V1	OTTHUMG00000161986		16.37:g.27080048_27080048dupT			B9EGC2|Q8NEF0	RNA	INS	-	NULL	ENST00000505035.1	37	NULL		16																																																																																			C16orf82	-	-	ENSG00000234186		0.480	C16orf82-001	KNOWN	basic	lincRNA	C16orf82	HGNC	lincRNA	OTTHUMT00000366634.1		0.00	26	0	-	NM_001145545		27080038	+1	tier1		no_errors	ENST00000418886	ensembl	human	known	74_37	rna	10.00	18	2	INS	0.001:0.000	T
HSPB6	126393	genome.wustl.edu	37	19	36249114	36249114	+	5'Flank	SNP	G	G	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr19:36249114G>T	ENST00000592984.1	-	0	0				C19orf55_ENST00000536950.1_5'UTR|HSPB6_ENST00000004982.3_5'Flank|C19orf55_ENST00000544099.1_5'UTR|HSPB6_ENST00000587965.1_5'Flank|C19orf55_ENST00000537459.1_5'UTR|C19orf55_ENST00000396908.4_5'UTR|AC002398.12_ENST00000587767.1_RNA|C19orf55_ENST00000421853.2_5'UTR			O14558	HSPB6_HUMAN	heat shock protein, alpha-crystallin-related, B6						regulation of muscle contraction (GO:0006937)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)|structural constituent of eye lens (GO:0005212)			lung(1)	1	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			AGGGAGCCGCGGGATGGACCG	0.687																																																	0													11.0	16.0	15.0					19																	36249114		1984	4126	6110	SO:0001631	upstream_gene_variant	0			AJ278121	CCDS12475.1	19q13.13	2014-06-12			ENSG00000004776	ENSG00000004776		"""Heat shock proteins / HSPB"""	26511	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 91"""	610695				12820654, 14717697	Standard	NM_144617		Approved	FLJ32389, Hsp20, PPP1R91	uc002obn.2	O14558	OTTHUMG00000048122		19.37:g.36249114G>T	Exception_encountered		O14551|Q6NVI3|Q96MG9	RNA	SNP	-	NULL	ENST00000592984.1	37	NULL	CCDS12475.1	19																																																																																			C19orf55	-	-	ENSG00000167595		0.687	HSPB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C19orf55	HGNC	protein_coding	OTTHUMT00000109498.3	-	0.00	85	0	G	NM_144617		36249114	+1	tier1	-	no_errors	ENST00000544876	ensembl	human	putative	74_37	rna	11.11	31	4	SNP	0.002	T
C1R	715	genome.wustl.edu	37	12	7242681	7242681	+	Missense_Mutation	SNP	T	T	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr12:7242681T>A	ENST00000542285.1	-	3	541	c.392A>T	c.(391-393)aAg>aTg	p.K131M	C1R_ENST00000602298.1_5'Flank			P00736	C1R_HUMAN	complement component 1, r subcomponent	132	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.		Y -> H. {ECO:0000269|PubMed:12914573}.		complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|immune response (GO:0006955)|innate immune response (GO:0045087)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			endometrium(4)|kidney(1)|large_intestine(4)|lung(6)|pancreas(1)	16					Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	CAGGAAGCCCTTGTAGAACAT	0.532																																																	0													55.0	55.0	55.0					12																	7242681		1936	4138	6074	SO:0001583	missense	0			M14058		12p13.31	2014-05-14			ENSG00000159403	ENSG00000159403	3.4.21.41	"""Complement system"""	1246	protein-coding gene	gene with protein product		613785					Standard	NM_001733		Approved		uc010sfy.2	P00736	OTTHUMG00000168149	ENST00000542285.1:c.392A>T	12.37:g.7242681T>A	ENSP00000438615:p.Lys131Met		A6NJQ8|Q68D77|Q8J012	Missense_Mutation	SNP	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom	p.K132M	ENST00000542285.1	37	c.395		12	.	.	.	.	.	.	.	.	.	.	T	19.93	3.917552	0.73098	.	.	ENSG00000159403	ENST00000542220;ENST00000536053;ENST00000535233;ENST00000290575;ENST00000542285;ENST00000540610;ENST00000543835;ENST00000541042;ENST00000540242;ENST00000538050	T;T;T;T;T;T	0.36699	1.51;1.24;1.24;1.24;1.51;1.24	5.43	5.43	0.79202	CUB (4);	0.076107	0.53938	D	0.000051	T	0.56992	0.2023	.	.	.	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.996	D;D;P	0.71656	0.974;0.968;0.827	T	0.61377	-0.7075	9	0.72032	D	0.01	.	10.2365	0.43286	0.0:0.0835:0.0:0.9165	.	98;146;132	F5H2D0;B4DPQ0;P00736	.;.;C1R_HUMAN	M	132;146;98;146;131;27;107;27;132;27	ENSP00000438615:K131M;ENSP00000439223:K27M;ENSP00000445285:K107M;ENSP00000441601:K27M;ENSP00000442946:K132M;ENSP00000444009:K27M	ENSP00000290575:K146M	K	-	2	0	C1R	7133822	0.803000	0.28956	1.000000	0.80357	0.991000	0.79684	0.548000	0.23314	2.059000	0.61396	0.379000	0.24179	AAG	C1R	-	superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom	ENSG00000159403		0.532	C1R-201	KNOWN	basic|appris_candidate_longest	protein_coding	C1R	HGNC	protein_coding		-	0.00	91	0	T	NM_001733		7242681	-1	tier1	-	no_errors	ENST00000543362	ensembl	human	known	74_37	missense	5.26	72	4	SNP	1.000	A
C9orf131	138724	genome.wustl.edu	37	9	35042298	35042298	+	Missense_Mutation	SNP	G	G	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr9:35042298G>A	ENST00000312292.5	+	1	94	c.47G>A	c.(46-48)gGg>gAg	p.G16E	C9orf131_ENST00000354479.5_Intron|C9orf131_ENST00000421362.2_Intron	NM_001040410.1|NM_203299.2	NP_001035500.1|NP_976044.2	Q5VYM1	CI131_HUMAN	chromosome 9 open reading frame 131	16										cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(23)|prostate(2)|skin(2)|stomach(1)	39	all_epithelial(49;0.22)		LUSC - Lung squamous cell carcinoma(32;0.00117)|Lung(28;0.00309)			GGGGATATGGGGCTTCTCTGG	0.542																																																	0													54.0	52.0	52.0					9																	35042298		2203	4300	6503	SO:0001583	missense	0			BC045643	CCDS6572.2, CCDS47961.1, CCDS47962.1	9p13.3	2008-02-05			ENSG00000174038	ENSG00000174038			31418	protein-coding gene	gene with protein product							Standard	NM_001287391		Approved	MGC41945	uc003zvw.3	Q5VYM1	OTTHUMG00000019853	ENST00000312292.5:c.47G>A	9.37:g.35042298G>A	ENSP00000308279:p.Gly16Glu		A6NLE6|E9PB26|Q86XC6|Q9UF74	Missense_Mutation	SNP	NULL	p.G16E	ENST00000312292.5	37	c.47	CCDS6572.2	9	.	.	.	.	.	.	.	.	.	.	G	8.153	0.787764	0.16258	.	.	ENSG00000174038	ENST00000312292;ENST00000378745	T;T	0.59364	1.1;0.27	4.63	-0.507	0.11985	.	0.607939	0.14829	N	0.295969	T	0.36054	0.0953	N	0.19112	0.55	0.09310	N	1	B	0.19935	0.04	B	0.26693	0.072	T	0.26430	-1.0103	10	0.15066	T	0.55	-0.378	7.7386	0.28829	0.4662:0.0:0.5338:0.0	.	16	Q5VYM1	CI131_HUMAN	E	16	ENSP00000308279:G16E;ENSP00000368019:G16E	ENSP00000308279:G16E	G	+	2	0	C9orf131	35032298	0.027000	0.19231	0.012000	0.15200	0.006000	0.05464	0.322000	0.19576	-0.179000	0.10654	-0.136000	0.14681	GGG	C9orf131	-	NULL	ENSG00000174038		0.542	C9orf131-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C9orf131	HGNC	protein_coding	OTTHUMT00000052283.5	-	0.00	55	0	G	NM_203299		35042298	+1	tier1	-	no_errors	ENST00000312292	ensembl	human	known	74_37	missense	36.54	33	19	SNP	0.004	A
CACNA1E	777	genome.wustl.edu	37	1	181724429	181724429	+	Silent	SNP	G	G	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr1:181724429G>A	ENST00000367573.2	+	28	3885	c.3885G>A	c.(3883-3885)gtG>gtA	p.V1295V	CACNA1E_ENST00000526775.1_Silent_p.V1276V|CACNA1E_ENST00000357570.5_Silent_p.V1246V|CACNA1E_ENST00000367570.1_Silent_p.V1295V|CACNA1E_ENST00000358338.5_Silent_p.V1227V|CACNA1E_ENST00000360108.3_Silent_p.V1276V|CACNA1E_ENST00000367567.4_Silent_p.V902V	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	1295					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						TACTCATTGTGTACAAGCTCT	0.478																																																	0													220.0	208.0	212.0					1																	181724429		2027	4210	6237	SO:0001819	synonymous_variant	0			AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.3885G>A	1.37:g.181724429G>A			B1AM12|B1AM13|B1AM14|Q14580|Q14581	Silent	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,pfscan_EF_hand_dom,prints_VDCCAlpha1,prints_VDCC_R_a1su	p.V1295	ENST00000367573.2	37	c.3885	CCDS55664.1	1																																																																																			CACNA1E	-	pfam_Ion_trans_dom	ENSG00000198216		0.478	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	CACNA1E	HGNC	protein_coding	OTTHUMT00000090793.2	-	0.00	50	0	G	NM_000721		181724429	+1	tier1	-	no_errors	ENST00000367573	ensembl	human	known	74_37	silent	21.21	26	7	SNP	1.000	A
CACNA1I	8911	genome.wustl.edu	37	22	40060862	40060862	+	Missense_Mutation	SNP	C	C	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr22:40060862C>A	ENST00000402142.3	+	21	3785	c.3785C>A	c.(3784-3786)gCc>gAc	p.A1262D	CACNA1I_ENST00000401624.1_Missense_Mutation_p.A1262D|CACNA1I_ENST00000407673.1_Missense_Mutation_p.A1227D|CACNA1I_ENST00000400164.3_Missense_Mutation_p.A1227D|CACNA1I_ENST00000404898.1_Missense_Mutation_p.A1227D|CACNA1I_ENST00000336649.4_Missense_Mutation_p.A1268D	NM_021096.3	NP_066919.2	Q9P0X4	CAC1I_HUMAN	calcium channel, voltage-dependent, T type, alpha 1I subunit	1262					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|signal transduction (GO:0007165)|sleep (GO:0030431)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(2)|lung(27)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Melanoma(58;0.0749)				Cinnarizine(DB00568)|Flunarizine(DB04841)|Paramethadione(DB00617)|Spironolactone(DB00421)|Verapamil(DB00661)|Zonisamide(DB00909)	CTGGCCTCAGCCGGGGGAGCC	0.642																																																	0													54.0	62.0	59.0					22																	40060862		2084	4197	6281	SO:0001583	missense	0			AF129133	CCDS46710.1, CCDS46711.1	22q13.1	2012-03-07	2007-02-16		ENSG00000100346	ENSG00000100346		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1396	protein-coding gene	gene with protein product		608230				10454147, 16382099	Standard	NM_021096		Approved	Cav3.3	uc003ayd.3	Q9P0X4	OTTHUMG00000151096	ENST00000402142.3:c.3785C>A	22.37:g.40060862C>A	ENSP00000385019:p.Ala1262Asp		B0QY12|B0QY13|B0QY14|O95504|Q5JZ88|Q7Z6S9|Q8NFX6|Q9NZC8|Q9UH15|Q9UH30|Q9ULU9|Q9UNE6	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_PKD1_2_channel,prints_VDCC_T_a1su,prints_VDCCAlpha1	p.A1268D	ENST00000402142.3	37	c.3803	CCDS46710.1	22	.	.	.	.	.	.	.	.	.	.	C	9.958	1.222026	0.22457	.	.	ENSG00000100346	ENST00000402142;ENST00000404898;ENST00000401624;ENST00000407673;ENST00000336649;ENST00000400164	D;D;D;D;D;D	0.98419	-4.92;-4.92;-4.92;-4.92;-4.92;-4.92	4.3	4.3	0.51218	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.96975	0.9012	N	0.05031	-0.125	0.49483	D	0.99979	B;D;P;D	0.89917	0.27;1.0;0.859;0.999	B;D;B;D	0.91635	0.086;0.999;0.41;0.978	D	0.97920	1.0314	10	0.41790	T	0.15	.	16.7671	0.85527	0.0:1.0:0.0:0.0	.	1227;1262;1227;1262	Q9P0X4-3;Q9P0X4-2;Q9P0X4-4;Q9P0X4	.;.;.;CAC1I_HUMAN	D	1262;1227;1262;1227;1268;1227	ENSP00000385019:A1262D;ENSP00000384093:A1227D;ENSP00000383887:A1262D;ENSP00000385680:A1227D;ENSP00000337829:A1268D;ENSP00000383028:A1227D	ENSP00000337829:A1268D	A	+	2	0	CACNA1I	38390808	0.998000	0.40836	0.816000	0.32577	0.093000	0.18481	4.504000	0.60414	1.950000	0.56595	0.462000	0.41574	GCC	CACNA1I	-	pfam_Ion_trans_dom	ENSG00000100346		0.642	CACNA1I-001	KNOWN	basic|CCDS	protein_coding	CACNA1I	HGNC	protein_coding	OTTHUMT00000321290.1	-	0.00	46	0	C	NM_001003406		40060862	+1	tier1	-	no_errors	ENST00000336649	ensembl	human	known	74_37	missense	12.12	29	4	SNP	0.996	A
CACNG8	59283	genome.wustl.edu	37	19	54485599	54485599	+	Silent	SNP	G	G	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr19:54485599G>A	ENST00000270458.2	+	4	877	c.774G>A	c.(772-774)tcG>tcA	p.S258S	MIR935_ENST00000401179.1_RNA	NM_031895.5	NP_114101	Q8WXS5	CCG8_HUMAN	calcium channel, voltage-dependent, gamma subunit 8	258	Gly-rich.				calcium ion transport (GO:0006816)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			kidney(1)|large_intestine(3)|lung(8)|urinary_tract(1)	13	all_cancers(19;0.0385)|all_epithelial(19;0.0207)|all_lung(19;0.145)|Lung NSC(19;0.168)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.162)		GCGGCCCCTCGGCCATCCTCC	0.746																																																	0													4.0	5.0	5.0					19																	54485599		2012	3812	5824	SO:0001819	synonymous_variant	0			AF288388	CCDS33104.1	19q13.4	2008-05-02			ENSG00000142408	ENSG00000142408		"""Calcium channel subunits"""	13628	protein-coding gene	gene with protein product		606900				11170751	Standard	NM_031895		Approved		uc002qcs.2	Q8WXS5	OTTHUMG00000064908	ENST00000270458.2:c.774G>A	19.37:g.54485599G>A			Q9BXT0|Q9BY23	Silent	SNP	pfam_PMP22/EMP/MP20/Claudin,prints_VDCC_gsu,prints_VDCC_g8su,prints_Claudin	p.S258	ENST00000270458.2	37	c.774	CCDS33104.1	19																																																																																			CACNG8	-	NULL	ENSG00000142408		0.746	CACNG8-001	KNOWN	non_ATG_start|basic|appris_principal|CCDS	protein_coding	CACNG8	HGNC	protein_coding	OTTHUMT00000139361.3		0.00	20	0	G			54485599	+1			no_errors	ENST00000270458	ensembl	human	known	74_37	silent	33.33	8	4	SNP	1.000	A
CALHM1	255022	genome.wustl.edu	37	10	105215358	105215358	+	Silent	SNP	C	C	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr10:105215358C>T	ENST00000329905.5	-	2	838	c.702G>A	c.(700-702)acG>acA	p.T234T	RP11-225H22.4_ENST00000411906.1_RNA|CALHM2_ENST00000393235.1_5'Flank	NM_001001412.3	NP_001001412.3	Q8IU99	CAHM1_HUMAN	calcium homeostasis modulator 1	234					ATP transport (GO:0015867)|cation transport (GO:0006812)|protein homooligomerization (GO:0051260)|regulation of ion transmembrane transport (GO:0034765)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|identical protein binding (GO:0042802)|voltage-gated ion channel activity (GO:0005244)			large_intestine(2)|liver(1)|lung(5)|ovary(1)	9						GCTCCGTGCACGTCTCGTCGA	0.602																																																	0													90.0	71.0	77.0					10																	105215358		2203	4300	6503	SO:0001819	synonymous_variant	0			BC036208	CCDS7550.1	10q24.33	2008-07-02	2008-07-02	2008-07-02	ENSG00000185933	ENSG00000185933			23494	protein-coding gene	gene with protein product		612234	"""family with sequence similarity 26, member C"""	FAM26C		18585350	Standard	NM_001001412		Approved		uc001kxe.2	Q8IU99	OTTHUMG00000018991	ENST00000329905.5:c.702G>A	10.37:g.105215358C>T			Q5W091	Silent	SNP	NULL	p.T234	ENST00000329905.5	37	c.702	CCDS7550.1	10																																																																																			CALHM1	-	NULL	ENSG00000185933		0.602	CALHM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CALHM1	HGNC	protein_coding	OTTHUMT00000050165.1		0.00	41	0	C	NM_001001412		105215358	-1			no_errors	ENST00000329905	ensembl	human	known	74_37	silent	5.88	32	2	SNP	0.681	T
CASP1	834	genome.wustl.edu	37	11	104897032	104897032	+	Nonsense_Mutation	SNP	C	C	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr11:104897032C>A	ENST00000533400.1	-	9	1203	c.1168G>T	c.(1168-1170)Gaa>Taa	p.E390*	CASP1_ENST00000393136.4_Nonsense_Mutation_p.E369*|CASP1_ENST00000594519.1_Nonsense_Mutation_p.E249*|CASP1_ENST00000353247.5_Nonsense_Mutation_p.E74*|CASP1_ENST00000534497.1_Nonsense_Mutation_p.E249*|CASP1_ENST00000526568.1_Nonsense_Mutation_p.E297*|CASP1_ENST00000525825.1_Nonsense_Mutation_p.E369*|CASP1_ENST00000531166.1_Nonsense_Mutation_p.E74*|CASP1_ENST00000446369.1_Nonsense_Mutation_p.E249*|CASP1_ENST00000598974.1_Nonsense_Mutation_p.E390*|CASP1_ENST00000593315.1_Nonsense_Mutation_p.E369*|CASP1_ENST00000415981.2_Nonsense_Mutation_p.E74*|CASP1_ENST00000436863.3_Nonsense_Mutation_p.E390*|CASP1_ENST00000527979.1_Nonsense_Mutation_p.E353*	NM_001257118.1	NP_001244047.1	P29466	CASP1_HUMAN	caspase 1, apoptosis-related cysteine peptidase	390					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|cellular response to organic substance (GO:0071310)|execution phase of apoptosis (GO:0097194)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|membrane hyperpolarization (GO:0060081)|mitochondrial depolarization (GO:0051882)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-1 alpha secretion (GO:0050717)|positive regulation of interleukin-1 beta secretion (GO:0050718)|programmed necrotic cell death (GO:0097300)|proteolysis (GO:0006508)|pyroptosis (GO:0070269)|regulation of inflammatory response (GO:0050727)|response to ATP (GO:0033198)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	AIM2 inflammasome complex (GO:0097169)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|IPAF inflammasome complex (GO:0072557)|NLRP1 inflammasome complex (GO:0072558)|NLRP3 inflammasome complex (GO:0072559)	cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|cysteine-type endopeptidase activity (GO:0004197)|endopeptidase activity (GO:0004175)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(2)	5		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000525)|Epithelial(105;0.0128)|all cancers(92;0.0482)	Minocycline(DB01017)	GTCACTCTTTCAGTGGTGGGC	0.423																																					NSCLC(41;1246 1743 4934)												0													93.0	91.0	92.0					11																	104897032		2202	4299	6501	SO:0001587	stop_gained	0			U13697	CCDS8329.1, CCDS8330.1, CCDS8331.1, CCDS8332.1, CCDS53704.1	11q23	2012-02-29	2012-02-29		ENSG00000137752	ENSG00000137752		"""Caspases"""	1499	protein-coding gene	gene with protein product	"""caspase-1"", ""interleukin 1, beta, convertase"""	147678	"""caspase 1, apoptosis-related cysteine protease (interleukin 1, beta, convertase)"", ""caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase)"""	IL1BC		1373520, 9250871	Standard	NM_033292		Approved	ICE	uc001pim.5	P29466	OTTHUMG00000048072	ENST00000533400.1:c.1168G>T	11.37:g.104897032C>A	ENSP00000433138:p.Glu390*		B5MDZ1|Q53EY6|Q6DMQ1|Q6GSS3|Q6PI75|Q9UCN3	Nonsense_Mutation	SNP	pfam_Pept_C14_caspase,pfam_CARD,superfamily_DEATH-like_dom,smart_CARD,smart_Pept_C14A_p45_core,pirsf_Caspase_IL-1_beta,pfscan_CARD,pfscan_Pept_C14_p10,pfscan_Pept_C14_ICE_p20,prints_Pept_C14A_p45_core	p.E390*	ENST00000533400.1	37	c.1168	CCDS8330.1	11	.	.	.	.	.	.	.	.	.	.	.	12.13	1.845000	0.32606	.	.	ENSG00000137752	ENST00000526568;ENST00000527979;ENST00000533400;ENST00000436863;ENST00000415981;ENST00000446369;ENST00000353247;ENST00000393136;ENST00000525825;ENST00000531166;ENST00000534497	.	.	.	4.2	4.2	0.49525	.	0.161086	0.53938	D	0.000051	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	14.4387	0.67301	0.0:1.0:0.0:0.0	.	.	.	.	X	297;353;390;390;74;249;74;369;369;74;249	.	ENSP00000344132:E74X	E	-	1	0	CASP1	104402242	1.000000	0.71417	0.864000	0.33941	0.111000	0.19643	5.967000	0.70403	2.322000	0.78497	0.460000	0.39030	GAA	CASP1	-	pfam_Pept_C14_caspase,smart_Pept_C14A_p45_core,pirsf_Caspase_IL-1_beta,pfscan_Pept_C14_p10	ENSG00000137752		0.423	CASP1-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	CASP1	HGNC	protein_coding	OTTHUMT00000388116.1		0.00	71	0	C	NM_033292		104897032	-1			no_errors	ENST00000436863	ensembl	human	known	74_37	nonsense	5.13	37	2	SNP	0.995	A
CCDC129	223075	genome.wustl.edu	37	7	31682502	31682502	+	Missense_Mutation	SNP	T	T	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr7:31682502T>A	ENST00000407970.3	+	11	1556	c.1518T>A	c.(1516-1518)ttT>ttA	p.F506L	CCDC129_ENST00000409210.1_Missense_Mutation_p.F414L|CCDC129_ENST00000451887.2_Missense_Mutation_p.F532L|CCDC129_ENST00000319386.3_Missense_Mutation_p.F358L	NM_001257967.1|NM_194300.3	NP_001244896.1|NP_919276.2	Q6ZRS4	CC129_HUMAN	coiled-coil domain containing 129	506										cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(31)	44						AGGAAGAGTTTCTGCTTGAGG	0.532																																																	0													109.0	109.0	109.0					7																	31682502		2203	4300	6503	SO:0001583	missense	0			AK128026	CCDS5435.2, CCDS59050.1, CCDS75577.1	7p14.3	2006-08-21			ENSG00000180347	ENSG00000180347			27363	protein-coding gene	gene with protein product						14702039	Standard	NM_001257967		Approved	FLJ38344	uc011kad.1	Q6ZRS4	OTTHUMG00000128611	ENST00000407970.3:c.1518T>A	7.37:g.31682502T>A	ENSP00000384416:p.Phe506Leu		A2RU17|B3KTI9|B4DHB0|B4E2R1|F5H3V5	Missense_Mutation	SNP	NULL	p.F532L	ENST00000407970.3	37	c.1596	CCDS5435.2	7	.	.	.	.	.	.	.	.	.	.	T	1.480	-0.557366	0.03967	.	.	ENSG00000180347	ENST00000319386;ENST00000407970;ENST00000451887;ENST00000538406;ENST00000409210	T;T;T;T	0.15487	2.42;2.68;2.68;2.42	5.85	4.71	0.59529	.	1.004860	0.08008	N	0.989955	T	0.09905	0.0243	N	0.11427	0.14	0.22127	N	0.999347	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.0;0.001;0.001;0.0	T	0.38866	-0.9641	10	0.17369	T	0.5	0.6017	8.554	0.33469	0.0:0.0869:0.0:0.9131	.	532;516;506;358	F5H3V5;F5H2J8;Q6ZRS4;Q6ZRS4-2	.;.;CC129_HUMAN;.	L	358;506;532;516;414	ENSP00000313062:F358L;ENSP00000384416:F506L;ENSP00000395835:F532L;ENSP00000387214:F414L	ENSP00000313062:F358L	F	+	3	2	CCDC129	31649027	0.738000	0.28186	0.634000	0.29324	0.008000	0.06430	3.611000	0.54132	1.053000	0.40415	0.477000	0.44152	TTT	CCDC129	-	NULL	ENSG00000180347		0.532	CCDC129-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	CCDC129	HGNC	protein_coding	OTTHUMT00000318975.1	-	0.00	26	0	T	NM_194300		31682502	+1	tier1	-	no_errors	ENST00000451887	ensembl	human	known	74_37	missense	16.22	31	6	SNP	0.645	A
CCDC132	55610	genome.wustl.edu	37	7	92932771	92932771	+	Splice_Site	SNP	G	G	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr7:92932771G>T	ENST00000305866.5	+	17	1489		c.e17-1		CCDC132_ENST00000535481.1_Splice_Site|CCDC132_ENST00000317751.6_Splice_Site|CCDC132_ENST00000544910.1_Splice_Site|CCDC132_ENST00000541136.1_Splice_Site	NM_017667.3	NP_060137.2	Q96JG6	CC132_HUMAN	coiled-coil domain containing 132							extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				endometrium(1)|large_intestine(2)|lung(5)	8	all_cancers(62;2.64e-11)|all_epithelial(64;1.4e-10)|Breast(17;0.000675)|Lung NSC(181;0.0618)|all_lung(186;0.0837)		STAD - Stomach adenocarcinoma(171;0.000302)			CTTTTTTTAAGAACACGGCTC	0.333																																																	0													87.0	83.0	84.0					7																	92932771		1816	4074	5890	SO:0001630	splice_region_variant	0			AL833112, AK055965, AL832393	CCDS5630.1, CCDS43617.1, CCDS59065.1	7q21.3	2007-07-23			ENSG00000004766	ENSG00000004766			25956	protein-coding gene	gene with protein product						11347906	Standard	NM_024553		Approved	KIAA1861, FLJ20097, DKFZp313I2429	uc003umo.4	Q96JG6	OTTHUMG00000131733	ENST00000305866.5:c.1362-1G>T	7.37:g.92932771G>T			B3KX22|D1MQ00|F5H5U7|Q75N07|Q8WVK3|Q9H5C6	Splice_Site	SNP	-	e17-1	ENST00000305866.5	37	c.1362-1	CCDS43617.1	7	.	.	.	.	.	.	.	.	.	.	G	23.0	4.363588	0.82353	.	.	ENSG00000004766	ENST00000305866;ENST00000544910;ENST00000541136;ENST00000535481;ENST00000317751;ENST00000458707	.	.	.	4.92	4.92	0.64577	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.7132	0.91666	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CCDC132	92770707	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	9.563000	0.98148	2.724000	0.93272	0.563000	0.77884	.	CCDC132	-	-	ENSG00000004766		0.333	CCDC132-019	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC132	HGNC	protein_coding	OTTHUMT00000341687.1		0.00	34	0	G	NM_017667	Intron	92932771	+1			no_errors	ENST00000305866	ensembl	human	known	74_37	splice_site	9.09	20	2	SNP	1.000	T
CCDC150	284992	genome.wustl.edu	37	2	197584490	197584490	+	Intron	DEL	A	A	-	rs368182383	byFrequency	TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr2:197584490delA	ENST00000389175.4	+	19	2300				CCDC150_ENST00000487663.1_Intron|CCDC150_ENST00000409270.1_Intron|CCDC150_ENST00000272831.7_Intron	NM_001080539.1	NP_001074008.1	Q8NCX0	CC150_HUMAN	coiled-coil domain containing 150											breast(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(14)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	33						CTTCCTTTACAAAAAAAAAAA	0.299														21	0.00419329	0.0121	0.0014	5008	,	,		19925	0.0		0.0	False		,,,				2504	0.0041																0																																										SO:0001627	intron_variant	0				CCDS46478.1	2q33.1	2008-04-10			ENSG00000144395	ENSG00000144395			26834	protein-coding gene	gene with protein product							Standard	NM_001080539		Approved	FLJ39660	uc002utp.1	Q8NCX0	OTTHUMG00000154475	ENST00000389175.4:c.2165+100A>-	2.37:g.197584490delA			Q6P5U6|Q6P663|Q8N8V5	RNA	DEL	-	NULL	ENST00000389175.4	37	NULL	CCDS46478.1	2																																																																																			CCDC150	-	-	ENSG00000144395		0.299	CCDC150-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	CCDC150	HGNC	protein_coding	OTTHUMT00000335377.2		0.00	38	0	A	NM_001080539		197584490	+1	tier1		no_errors	ENST00000461825	ensembl	human	putative	74_37	rna	12.00	22	3	DEL	0.000	-
CCDC27	148870	genome.wustl.edu	37	1	3673316	3673316	+	Frame_Shift_Del	DEL	T	T	-			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr1:3673316delT	ENST00000294600.2	+	4	657	c.573delT	c.(571-573)agtfs	p.S191fs		NM_152492.2	NP_689705.2	Q2M243	CCD27_HUMAN	coiled-coil domain containing 27	191										breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(2)|lung(17)|prostate(1)|skin(2)|urinary_tract(2)	36	all_cancers(77;0.0385)|Ovarian(185;0.0634)|Lung NSC(156;0.21)|all_lung(157;0.218)	all_epithelial(116;5.52e-17)|all_lung(118;1.04e-06)|Lung NSC(185;0.000214)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Lung SC(97;0.0367)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.127)		Epithelial(90;1.11e-38)|OV - Ovarian serous cystadenocarcinoma(86;1.35e-22)|GBM - Glioblastoma multiforme(42;3.46e-16)|Colorectal(212;1.17e-05)|COAD - Colon adenocarcinoma(227;5.76e-05)|Kidney(185;0.00036)|BRCA - Breast invasive adenocarcinoma(365;0.000696)|KIRC - Kidney renal clear cell carcinoma(229;0.00558)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.203)		TTCCCTTCAGTAAGAGCATCT	0.557																																																	0													91.0	89.0	90.0					1																	3673316		2203	4300	6503	SO:0001589	frameshift_variant	0				CCDS50.1	1p36.32	2008-02-05			ENSG00000162592	ENSG00000162592			26546	protein-coding gene	gene with protein product							Standard	NM_152492		Approved	FLJ32825	uc001akv.2	Q2M243	OTTHUMG00000003504	ENST00000294600.2:c.573delT	1.37:g.3673316delT	ENSP00000294600:p.Ser191fs		Q5TBV3|Q96M50	Frame_Shift_Del	DEL	superfamily_Prefoldin	p.S191fs	ENST00000294600.2	37	c.573	CCDS50.1	1																																																																																			CCDC27	-	NULL	ENSG00000162592		0.557	CCDC27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC27	HGNC	protein_coding	OTTHUMT00000009740.1		0.00	56	0	T	NM_152492		3673316	+1	tier1		no_errors	ENST00000294600	ensembl	human	known	74_37	frame_shift_del	10.00	18	2	DEL	0.211	-
CCDC69	26112	genome.wustl.edu	37	5	150563967	150563967	+	Silent	SNP	C	C	T	rs369963539		TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr5:150563967C>T	ENST00000355417.2	-	8	825	c.651G>A	c.(649-651)acG>acA	p.T217T	CCDC69_ENST00000521308.1_5'UTR	NM_015621.2	NP_056436.2	A6NI79	CCD69_HUMAN	coiled-coil domain containing 69	217										haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|ovary(2)|stomach(1)	9		Medulloblastoma(196;0.091)|all_hematologic(541;0.207)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GTTGCAGGGTCGTAATTTTTT	0.488																																																	0								C		2,4404	4.2+/-10.8	0,2,2201	136.0	126.0	130.0		651	-6.5	0.4	5		130	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	CCDC69	NM_015621.2		0,3,6500	TT,TC,CC		0.0116,0.0454,0.0231		217/297	150563967	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS4312.1	5q33.1	2008-02-05			ENSG00000198624	ENSG00000198624			24487	protein-coding gene	gene with protein product						12477932	Standard	NM_015621		Approved	FLJ13705, DKFZP434C171	uc011dcq.3	A6NI79	OTTHUMG00000130127	ENST00000355417.2:c.651G>A	5.37:g.150563967C>T			A8K9X6	Silent	SNP	superfamily_ER_p29_C	p.T217	ENST00000355417.2	37	c.651	CCDS4312.1	5																																																																																			CCDC69	-	NULL	ENSG00000198624		0.488	CCDC69-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC69	HGNC	protein_coding	OTTHUMT00000252435.1	-	0.00	61	0	C	NM_015621		150563967	-1	tier1	-	no_errors	ENST00000355417	ensembl	human	known	74_37	silent	14.75	52	9	SNP	0.420	T
CCNJ	54619	genome.wustl.edu	37	10	97817694	97817694	+	Missense_Mutation	SNP	T	T	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr10:97817694T>A	ENST00000265992.5	+	6	1182	c.815T>A	c.(814-816)gTt>gAt	p.V272D	ENTPD1-AS1_ENST00000416301.1_RNA|ENTPD1-AS1_ENST00000454638.1_RNA|CCNJ_ENST00000403870.3_Missense_Mutation_p.V271D|ENTPD1-AS1_ENST00000458228.1_RNA|ENTPD1-AS1_ENST00000451364.1_RNA|ENTPD1-AS1_ENST00000427846.1_RNA|ENTPD1-AS1_ENST00000452728.1_RNA|CCNJ_ENST00000465148.2_Missense_Mutation_p.V283D|CCNJ_ENST00000534974.1_Missense_Mutation_p.V272D	NM_001134375.1|NM_001134376.1|NM_019084.4	NP_001127847.1|NP_001127848.1|NP_061957.2	Q5T5M9	CCNJ_HUMAN	cyclin J	272						nucleus (GO:0005634)				breast(2)|endometrium(2)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	11				Epithelial(162;6.1e-08)|all cancers(201;2.32e-06)		TCACGGCCAGTTCACTTTCAG	0.493																																																	0													237.0	199.0	212.0					10																	97817694		2203	4300	6503	SO:0001583	missense	0			AK001757	CCDS7445.1, CCDS44462.1, CCDS44463.1	10q23.33	2008-05-14			ENSG00000107443	ENSG00000107443			23434	protein-coding gene	gene with protein product						12477932	Standard	NM_019084		Approved	FLJ10895, bA690P14.1	uc010qoq.2	Q5T5M9	OTTHUMG00000018823	ENST00000265992.5:c.815T>A	10.37:g.97817694T>A	ENSP00000265992:p.Val272Asp		B7Z4E7|Q86XL1|Q9NV69	Missense_Mutation	SNP	pfam_Cyclin_C-dom,pfam_Cyclin_N,superfamily_Cyclin-like,smart_Cyclin-like	p.V283D	ENST00000265992.5	37	c.848	CCDS7445.1	10	.	.	.	.	.	.	.	.	.	.	T	12.84	2.059847	0.36373	.	.	ENSG00000107443	ENST00000265992;ENST00000419934;ENST00000403870;ENST00000534974	T;T;T	0.51071	0.72;1.33;0.72	5.5	3.17	0.36434	.	0.840404	0.10723	N	0.641487	T	0.29190	0.0726	N	0.08118	0	0.45733	D	0.998633	B;B;B	0.32781	0.384;0.004;0.003	B;B;B	0.37304	0.246;0.012;0.005	T	0.08827	-1.0703	10	0.72032	D	0.01	-4.2533	4.6747	0.12706	0.0:0.1709:0.1824:0.6467	.	283;271;272	Q5T5M9-3;Q5T5M9-2;Q5T5M9	.;.;CCNJ_HUMAN	D	272;283;271;272	ENSP00000265992:V272D;ENSP00000384498:V271D;ENSP00000441415:V272D	ENSP00000265992:V272D	V	+	2	0	CCNJ	97807684	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.068000	0.30629	0.465000	0.27167	-0.250000	0.11733	GTT	CCNJ	-	NULL	ENSG00000107443		0.493	CCNJ-003	KNOWN	basic|CCDS	protein_coding	CCNJ	HGNC	protein_coding	OTTHUMT00000090166.3		0.00	58	0	T	NM_019084		97817694	+1			no_errors	ENST00000465148	ensembl	human	known	74_37	missense	6.90	27	2	SNP	0.996	A
CCT6P3	643180	genome.wustl.edu	37	7	64530054	64530054	+	RNA	SNP	T	T	C			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr7:64530054T>C	ENST00000426828.1	+	0	874				SNORA15_ENST00000384334.1_RNA	NR_033416.1				chaperonin containing TCP1, subunit 6 (zeta) pseudogene 3																		CTCTTGCTTGTGGTGGGGTGG	0.403																																																	0																																												0					7q11.21	2010-06-29			ENSG00000234585	ENSG00000234585			35137	pseudogene	pseudogene							Standard	NR_033416		Approved		uc010kzt.1		OTTHUMG00000156630		7.37:g.64530054T>C				RNA	SNP	-	NULL	ENST00000426828.1	37	NULL		7																																																																																			CCT6P3	-	-	ENSG00000234585		0.403	CCT6P3-004	KNOWN	basic	processed_transcript	CCT6P3	HGNC	pseudogene	OTTHUMT00000344862.1	-	0.00	120	0	T			64530054	+1	tier1	-	no_errors	ENST00000426828	ensembl	human	known	74_37	rna	18.33	49	11	SNP	0.996	C
CDC27	996	genome.wustl.edu	37	17	45247389	45247389	+	Missense_Mutation	SNP	T	T	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr17:45247389T>A	ENST00000066544.3	-	4	364	c.271A>T	c.(271-273)Atc>Ttc	p.I91F	CDC27_ENST00000527547.1_Missense_Mutation_p.I91F|RP5-867C24.5_ENST00000572193.1_RNA|CDC27_ENST00000446365.2_Missense_Mutation_p.I30F|CDC27_ENST00000531206.1_Missense_Mutation_p.I91F|CDC27_ENST00000528748.1_5'UTR	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	91					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)	p.I91fs*54(1)		NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						CCAGATAAGATTTGTTCCCCT	0.323																																																	1	Deletion - Frameshift(1)	ovary(1)											84.0	94.0	91.0					17																	45247389		2203	4299	6502	SO:0001583	missense	0			U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.271A>T	17.37:g.45247389T>A	ENSP00000066544:p.Ile91Phe		G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.I91F	ENST00000066544.3	37	c.271	CCDS11509.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	21.7|21.7	4.182940|4.182940	0.78677|0.78677	.|.	.|.	ENSG00000004897|ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547;ENST00000526866|ENST00000533415	T;T;T;T;T|.	0.73897|.	-0.79;-0.79;-0.11;-0.79;-0.79|.	5.35|5.35	5.35|5.35	0.76521|0.76521	Tetratricopeptide-like helical (1);|.	0.059487|.	0.64402|.	D|.	0.000002|.	T|T	0.54095|0.54095	0.1837|0.1837	N|N	0.20986|0.20986	0.625|0.625	0.58432|0.58432	D|D	0.999998|0.999998	P;P;P;P|.	0.50272|.	0.855;0.865;0.933;0.889|.	B;P;P;P|.	0.48982|.	0.212;0.485;0.571;0.597|.	T|T	0.59156|0.59156	-0.7507|-0.7507	10|6	0.46703|0.62326	T|D	0.11|0.03	-26.5081|-26.5081	13.5832|13.5832	0.61915|0.61915	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	30;91;91;91|.	B4DL80;G5EA36;G3V1C4;P30260|.	.;.;.;CDC27_HUMAN|.	F|N	91;91;30;91;91|41	ENSP00000066544:I91F;ENSP00000434614:I91F;ENSP00000392802:I30F;ENSP00000437339:I91F;ENSP00000432105:I91F|.	ENSP00000066544:I91F|ENSP00000432211:K41N	I|K	-|-	1|3	0|2	CDC27|CDC27	42602388|42602388	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	5.952000|5.952000	0.70282|0.70282	2.152000|2.152000	0.67230|0.67230	0.533000|0.533000	0.62120|0.62120	ATC|AAA	CDC27	-	NULL	ENSG00000004897		0.323	CDC27-001	KNOWN	basic|CCDS	protein_coding	CDC27	HGNC	protein_coding	OTTHUMT00000389742.2		0.00	94	0	T			45247389	-1			no_errors	ENST00000531206	ensembl	human	known	74_37	missense	5.13	37	2	SNP	1.000	A
CDH20	28316	genome.wustl.edu	37	18	59195231	59195231	+	Missense_Mutation	SNP	C	C	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr18:59195231C>A	ENST00000262717.4	+	7	1447	c.1049C>A	c.(1048-1050)aCc>aAc	p.T350N	CDH20_ENST00000538374.1_Missense_Mutation_p.T350N|CDH20_ENST00000536675.2_Missense_Mutation_p.T350N			Q9HBT6	CAD20_HUMAN	cadherin 20, type 2	350	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(33)|ovary(1)|pancreas(1)|skin(3)	61		Colorectal(73;0.186)				AAAAGCTACACCTTAAAGGTG	0.443																																																	0													81.0	75.0	77.0					18																	59195231		2203	4300	6503	SO:0001583	missense	0			AF217289	CCDS11977.1	18q21.33	2010-01-26			ENSG00000101542	ENSG00000101542		"""Cadherins / Major cadherins"""	1760	protein-coding gene	gene with protein product		605807				10995570	Standard	NM_031891		Approved	CDH7L3, Cdh7	uc010dps.1	Q9HBT6	OTTHUMG00000132768	ENST00000262717.4:c.1049C>A	18.37:g.59195231C>A	ENSP00000262717:p.Thr350Asn		Q495S3	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.T350N	ENST00000262717.4	37	c.1049	CCDS11977.1	18	.	.	.	.	.	.	.	.	.	.	C	24.5	4.542854	0.86022	.	.	ENSG00000101542	ENST00000536675;ENST00000538374;ENST00000262717	T;T;T	0.50813	0.73;0.73;0.73	5.88	5.88	0.94601	Cadherin (5);Cadherin-like (1);	0.096640	0.64402	D	0.000001	T	0.60573	0.2279	L	0.59436	1.845	0.80722	D	1	P	0.35011	0.48	P	0.46510	0.519	T	0.59888	-0.7369	10	0.72032	D	0.01	.	20.2884	0.98536	0.0:1.0:0.0:0.0	.	350	Q9HBT6	CAD20_HUMAN	N	350	ENSP00000444767:T350N;ENSP00000442226:T350N;ENSP00000262717:T350N	ENSP00000262717:T350N	T	+	2	0	CDH20	57346211	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	5.727000	0.68523	2.791000	0.96007	0.650000	0.86243	ACC	CDH20	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000101542		0.443	CDH20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH20	HGNC	protein_coding	OTTHUMT00000256141.2	-	0.00	54	0	C	NM_031891		59195231	+1	tier1	-	no_errors	ENST00000262717	ensembl	human	known	74_37	missense	57.14	9	12	SNP	1.000	A
CEACAM20	125931	genome.wustl.edu	37	19	45015182	45015182	+	RNA	SNP	T	T	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr19:45015182T>A	ENST00000454753.1	-	0	1922							Q6UY09	CEA20_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 20							integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|prostate(1)	15		Prostate(69;0.0352)				GCTGAAAGAATTGCCTCTACG	0.502																																																	0													85.0	89.0	88.0					19																	45015182		1923	4116	6039			0			AY358129	CCDS74390.1, CCDS74391.1, CCDS74392.1, CCDS74393.1	19q13.31	2013-01-30			ENSG00000176395	ENSG00000273777		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	24879	protein-coding gene	gene with protein product						12975309	Standard	NM_001102600		Approved	UNQ9366	uc010ejo.1	Q6UY09	OTTHUMG00000151532		19.37:g.45015182T>A				RNA	SNP	-	NULL	ENST00000454753.1	37	NULL		19																																																																																			CEACAM20	-	-	ENSG00000176395		0.502	CEACAM20-001	KNOWN	basic	processed_transcript	CEACAM20	HGNC	processed_transcript	OTTHUMT00000323032.1	-	0.00	96	0	T	NM_198444		45015182	-1	tier1	-	no_errors	ENST00000316962	ensembl	human	known	74_37	rna	5.56	68	4	SNP	0.000	A
CELA3A	10136	genome.wustl.edu	37	1	22332269	22332269	+	Silent	SNP	C	C	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr1:22332269C>T	ENST00000290122.3	+	4	361	c.342C>T	c.(340-342)aaC>aaT	p.N114N	RN7SL768P_ENST00000584415.1_RNA|CELA3A_ENST00000374663.1_Silent_p.N114N	NM_005747.4	NP_005738.4	P09093	CEL3A_HUMAN	chymotrypsin-like elastase family, member 3A	114	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cholesterol metabolic process (GO:0008203)|digestion (GO:0007586)|proteolysis (GO:0006508)		serine-type endopeptidase activity (GO:0004252)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						CACTCTGGAACCGCTCGTGTG	0.587																																																	0													130.0	116.0	121.0					1																	22332269		2199	4300	6499	SO:0001819	synonymous_variant	0			D00306	CCDS220.1	1p36.12	2009-05-05	2009-05-05	2009-05-05	ENSG00000142789	ENSG00000142789			15944	protein-coding gene	gene with protein product	"""protease E"""		"""elastase 3A, pancreatic (protease E)"", ""elastase 3A, pancreatic"""	ELA3A		2826474, 2460440	Standard	NM_005747		Approved	ELA3		P09093	OTTHUMG00000002755	ENST00000290122.3:c.342C>T	1.37:g.22332269C>T			B1AQ53|Q9BRW4	Silent	SNP	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.N114	ENST00000290122.3	37	c.342	CCDS220.1	1																																																																																			CELA3A	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1	ENSG00000142789		0.587	CELA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELA3A	HGNC	protein_coding	OTTHUMT00000007791.1	-	0.00	84	0	C	NM_005747		22332269	+1	tier1	-	no_errors	ENST00000290122	ensembl	human	known	74_37	silent	5.71	66	4	SNP	0.368	T
CELF6	60677	genome.wustl.edu	37	15	72582500	72582500	+	Missense_Mutation	SNP	G	G	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr15:72582500G>A	ENST00000569547.1	-	4	562	c.491C>T	c.(490-492)aCg>aTg	p.T164M	CELF6_ENST00000543764.2_Missense_Mutation_p.T49M|CELF6_ENST00000539635.1_Missense_Mutation_p.T25M|CELF6_ENST00000569311.1_5'UTR|CELF6_ENST00000567083.1_Missense_Mutation_p.T164M|CELF6_ENST00000395258.2_Missense_Mutation_p.T51M|RP11-106M3.2_ENST00000379915.4_RNA|RP11-106M3.3_ENST00000570175.1_RNA|CELF6_ENST00000287202.5_Missense_Mutation_p.T164M			Q96J87	CELF6_HUMAN	CUGBP, Elav-like family member 6	164	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(2)	13						CCGCAGGACCGTGCACTCCTC	0.607																																																	0													81.0	68.0	73.0					15																	72582500		2199	4297	6496	SO:0001583	missense	0			AF425606	CCDS10242.1, CCDS53955.1, CCDS53956.1	15q24	2013-02-12	2010-02-19	2010-02-19	ENSG00000140488	ENSG00000140488		"""RNA binding motif (RRM) containing"""	14059	protein-coding gene	gene with protein product		612681	"""Bruno (Drosophila) -like 6, RNA binding protein"", ""bruno-like 6, RNA binding protein (Drosophila)"""	BRUNOL6		10893231	Standard	NM_052840		Approved		uc002auh.2	Q96J87	OTTHUMG00000133444	ENST00000569547.1:c.491C>T	15.37:g.72582500G>A	ENSP00000454749:p.Thr164Met		B4DG28|B4DJB6|Q6PII4|Q6ZNJ7|Q8N607	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.T164M	ENST00000569547.1	37	c.491	CCDS10242.1	15	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.0|21.0	4.081825|4.081825	0.76528|0.76528	.|.	.|.	ENSG00000140488|ENSG00000140488	ENST00000379915|ENST00000287202;ENST00000437872;ENST00000543764;ENST00000395258;ENST00000539635	.|T;T;T;T	.|0.16597	.|2.33;2.33;2.33;2.33	5.25|5.25	5.25|5.25	0.73442|0.73442	.|Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	.|0.000000	.|0.64402	.|U	.|0.000001	T|T	0.33411|0.33411	0.0862|0.0862	L|L	0.34521|0.34521	1.04|1.04	0.53005|0.53005	D|D	0.999968|0.999968	.|D;P;D;D;D	.|0.89917	.|1.0;0.916;1.0;1.0;1.0	.|D;P;D;D;D	.|0.91635	.|0.947;0.727;0.938;0.989;0.999	T|T	0.06607|0.06607	-1.0817|-1.0817	6|10	0.72032|0.87932	D|D	0.01|0	-14.6692|-14.6692	17.8368|17.8368	0.88700|0.88700	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|164;49;51;25;164	.|B4DJB6;B4DG28;Q96J87-2;B3KWE6;Q96J87	.|.;.;.;.;CELF6_HUMAN	W|M	42|164;164;49;51;25	.|ENSP00000287202:T164M;ENSP00000439956:T49M;ENSP00000378677:T51M;ENSP00000443162:T25M	ENSP00000369247:R42W|ENSP00000287202:T164M	R|T	-|-	1|2	2|0	CELF6|CELF6	70369554|70369554	1.000000|1.000000	0.71417|0.71417	0.982000|0.982000	0.44146|0.44146	0.993000|0.993000	0.82548|0.82548	9.476000|9.476000	0.97823|0.97823	2.469000|2.469000	0.83416|0.83416	0.561000|0.561000	0.74099|0.74099	CGG|ACG	CELF6	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000273025		0.607	CELF6-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	CELF6	Uniprot_gn	protein_coding	OTTHUMT00000420180.1		0.00	77	0	G	NM_052840		72582500	-1			no_errors	ENST00000569547	ensembl	human	known	74_37	missense	5.08	56	3	SNP	1.000	A
CELP	1057	genome.wustl.edu	37	9	135962555	135962556	+	RNA	INS	-	-	CTGC	rs370202675|rs58402826|rs112009079		TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr9:135962555_135962556insCTGC	ENST00000411440.2	+	0	1062_1063					NR_001275.2				carboxyl ester lipase pseudogene																		TGACTCTGAGGCCCGTGCCCAC	0.624																																																	0																																												0			L14813		9q34.2	2014-03-18	2003-02-28	2003-03-07	ENSG00000170827	ENSG00000170827			1849	pseudogene	pseudogene			"""carboxyl ester lipase-like (bile salt-stimulated lipase-like)"""	CELL		1639390	Standard	NR_001275		Approved		uc011mcu.1		OTTHUMG00000020857		9.37:g.135962555_135962556insCTGC				RNA	INS	-	NULL	ENST00000411440.2	37	NULL		9																																																																																			CELP	-	-	ENSG00000170827		0.624	CELP-002	KNOWN	basic	processed_transcript	CELP	HGNC	pseudogene	OTTHUMT00000339837.1		0.00	19	0	-	NM_001808		135962556	+1	tier1		no_errors	ENST00000411440	ensembl	human	known	74_37	rna	25.00	12	4	INS	0.038:0.013	CTGC
CHAF1B	8208	genome.wustl.edu	37	21	37781696	37781696	+	Silent	SNP	T	T	C			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr21:37781696T>C	ENST00000314103.5	+	10	1003	c.852T>C	c.(850-852)ccT>ccC	p.P284P		NM_005441.2	NP_005432.1	Q13112	CAF1B_HUMAN	chromatin assembly factor 1, subunit B (p60)	284					cell cycle (GO:0007049)|chromatin assembly (GO:0031497)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication-dependent nucleosome assembly (GO:0006335)|protein complex assembly (GO:0006461)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	CAF-1 complex (GO:0033186)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|liver(1)|lung(6)|ovary(2)|skin(2)	20						TTCCATGTCCTGGAAAAGCCA	0.458																																																	0													278.0	264.0	269.0					21																	37781696		2203	4300	6503	SO:0001819	synonymous_variant	0			U20980	CCDS13644.1	21q22.2	2013-01-10			ENSG00000159259	ENSG00000159259		"""WD repeat domain containing"""	1911	protein-coding gene	gene with protein product	"""M-phase phosphoprotein 7"", ""Chromatin assembly factor I, p60 subunit"", ""human chromatin assembly factor-I p60 subunit"""	601245				7600578, 8792829	Standard	NM_005441		Approved	CAF1P60, CAF-1, CAF1, CAF1A, MPP7, MPHOSPH7	uc002yvj.3	Q13112	OTTHUMG00000086606	ENST00000314103.5:c.852T>C	21.37:g.37781696T>C			Q99548	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Gprotein_B	p.P284	ENST00000314103.5	37	c.852	CCDS13644.1	21																																																																																			CHAF1B	-	superfamily_WD40_repeat_dom	ENSG00000159259		0.458	CHAF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHAF1B	HGNC	protein_coding	OTTHUMT00000194616.2		0.00	73	0	T	NM_005441		37781696	+1			no_errors	ENST00000314103	ensembl	human	known	74_37	silent	5.77	49	3	SNP	0.981	C
CHD8	57680	genome.wustl.edu	37	14	21896333	21896333	+	Silent	SNP	T	T	C			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr14:21896333T>C	ENST00000557364.1	-	4	1559	c.1296A>G	c.(1294-1296)tcA>tcG	p.S432S	CHD8_ENST00000399982.2_Silent_p.S432S|CHD8_ENST00000555962.1_Intron|CHD8_ENST00000430710.3_Silent_p.S153S|RN7SL650P_ENST00000583681.1_RNA			Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	432					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|canonical Wnt signaling pathway (GO:0060070)|DNA duplex unwinding (GO:0032508)|in utero embryonic development (GO:0001701)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	MLL1 complex (GO:0071339)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|beta-catenin binding (GO:0008013)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)			NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(33)|ovary(6)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	85	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		AGCTTGCTGGTGATGACAAAG	0.488																																																	0													130.0	125.0	126.0					14																	21896333		1921	4128	6049	SO:0001819	synonymous_variant	0			AB046784	CCDS45081.1, CCDS53885.1	14q11.2	2008-02-05	2004-06-22	2004-06-23		ENSG00000100888			20153	protein-coding gene	gene with protein product		610528	"""helicase with SNF2 domain 1"""	HELSNF1		10997877	Standard	NM_020920		Approved	KIAA1564, DUPLIN	uc001war.2	Q9HCK8		ENST00000557364.1:c.1296A>G	14.37:g.21896333T>C			Q4G0D8|Q68DQ0|Q6DKH9|Q6P440|Q6ZNL7|Q8N3Z9|Q8NCY4|Q8TBR9|Q96F26	Silent	SNP	pfam_SNF2_N,pfam_Chromo_domain,pfam_BRK_domain,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.S432	ENST00000557364.1	37	c.1296	CCDS53885.1	14																																																																																			CHD8	-	NULL	ENSG00000100888		0.488	CHD8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CHD8	HGNC	protein_coding	OTTHUMT00000410436.1		0.00	57	0	T	NM_020920		21896333	-1			no_errors	ENST00000399982	ensembl	human	known	74_37	silent	5.88	47	3	SNP	0.756	C
CHRM1	1128	genome.wustl.edu	37	11	62677638	62677638	+	Missense_Mutation	SNP	T	T	C			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr11:62677638T>C	ENST00000306960.3	-	2	1476	c.935A>G	c.(934-936)cAg>cGg	p.Q312R	AP000438.2_ENST00000543624.1_RNA	NM_000738.2	NP_000729.2	P11229	ACM1_HUMAN	cholinergic receptor, muscarinic 1	312					cell proliferation (GO:0008283)|cellular protein modification process (GO:0006464)|cognition (GO:0050890)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|nervous system development (GO:0007399)|neuromuscular synaptic transmission (GO:0007274)|phospholipase C-activating G-protein coupled acetylcholine receptor signaling pathway (GO:0007207)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of ion transport (GO:0043270)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of locomotion (GO:0040012)|saliva secretion (GO:0046541)|signal transduction (GO:0007165)	asymmetric synapse (GO:0032279)|axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	drug binding (GO:0008144)|G-protein coupled acetylcholine receptor activity (GO:0016907)|phosphatidylinositol phospholipase C activity (GO:0004435)			large_intestine(5)|lung(3)|stomach(1)	9					Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Benzatropine(DB00245)|Biperiden(DB00810)|Brompheniramine(DB00835)|Buclizine(DB00354)|Carbachol(DB00411)|Cevimeline(DB00185)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Citalopram(DB00215)|Clidinium(DB00771)|Clozapine(DB00363)|Cocaine(DB00907)|Cryptenamine(DB00785)|Cyclopentolate(DB00979)|Cycrimine(DB00942)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Dicyclomine(DB00804)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxepin(DB01142)|Doxylamine(DB00366)|Escitalopram(DB01175)|Ethopropazine(DB00392)|Fesoterodine(DB06702)|Flavoxate(DB01148)|Flupentixol(DB00875)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Mepenzolate(DB04843)|Methantheline(DB00940)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Metoclopramide(DB01233)|Minaprine(DB00805)|Molindone(DB01618)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Oxyphenonium(DB00219)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pirenzepine(DB00670)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propantheline(DB00782)|Propiomazine(DB00777)|Quetiapine(DB01224)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Triflupromazine(DB00508)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Trospium(DB00209)|Ziprasidone(DB00246)	GGTGGGGGCCTGTGCCTCGGG	0.617																																																	0													61.0	68.0	65.0					11																	62677638		2201	4298	6499	SO:0001583	missense	0			Y00508	CCDS8040.1	11q12-q13	2012-08-08				ENSG00000168539		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1950	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 1"""	118510					Standard	NM_000738		Approved		uc001nwi.3	P11229		ENST00000306960.3:c.935A>G	11.37:g.62677638T>C	ENSP00000306490:p.Gln312Arg		Q96RH1	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Musac_Ach_M1_rcpt,prints_Musac_Ach_rcpt,prints_GPCR_Rhodpsn	p.Q312R	ENST00000306960.3	37	c.935	CCDS8040.1	11	.	.	.	.	.	.	.	.	.	.	T	0.109	-1.141493	0.01728	.	.	ENSG00000168539	ENST00000306960;ENST00000543973	T;T	0.59083	0.33;0.29	4.79	2.28	0.28536	GPCR, rhodopsin-like superfamily (1);	1.294700	0.05594	N	0.575139	T	0.34454	0.0898	N	0.08118	0	0.24075	N	0.995967	B	0.14438	0.01	B	0.17433	0.018	T	0.26189	-1.0110	10	0.15066	T	0.55	-9.6435	5.3448	0.16004	0.0:0.0919:0.3509:0.5572	.	312	P11229	ACM1_HUMAN	R	312	ENSP00000306490:Q312R;ENSP00000441188:Q312R	ENSP00000306490:Q312R	Q	-	2	0	CHRM1	62434214	0.000000	0.05858	0.982000	0.44146	0.151000	0.21798	-1.012000	0.03649	0.833000	0.34828	0.460000	0.39030	CAG	CHRM1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Musac_Ach_M1_rcpt	ENSG00000168539		0.617	CHRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRM1	HGNC	protein_coding	OTTHUMT00000396178.1		0.00	22	0	T	NM_000738		62677638	-1			no_errors	ENST00000306960	ensembl	human	known	74_37	missense	12.50	28	4	SNP	0.575	C
CILP2	148113	genome.wustl.edu	37	19	19656122	19656122	+	Missense_Mutation	SNP	C	C	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr19:19656122C>T	ENST00000291495.5	+	8	2853	c.2768C>T	c.(2767-2769)aCt>aTt	p.T923I	CILP2_ENST00000586018.1_Missense_Mutation_p.T929I	NM_153221.2	NP_694953.2	Q8IUL8	CILP2_HUMAN	cartilage intermediate layer protein 2	923						extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(17)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	32						GCCTCCTGGACTGGCGATCTC	0.652																																																	0													34.0	25.0	28.0					19																	19656122		2202	4298	6500	SO:0001583	missense	0			AF542080	CCDS12405.1	19p13.11	2013-01-14				ENSG00000160161		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	24213	protein-coding gene	gene with protein product		612419				12477932	Standard	NM_153221		Approved	MGC45771	uc002nmv.4	Q8IUL8		ENST00000291495.5:c.2768C>T	19.37:g.19656122C>T	ENSP00000291495:p.Thr923Ile		Q6NV88|Q8N4A6|Q8WV21	Missense_Mutation	SNP	pfam_Thrombospondin_1_rpt,pfam_Ig_I-set,superfamily_Thrombospondin_1_rpt,superfamily_CarboxyPept-like_regulatory,superfamily_Carb-bd-like_fold,smart_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom	p.T923I	ENST00000291495.5	37	c.2768	CCDS12405.1	19	.	.	.	.	.	.	.	.	.	.	C	8.546	0.874511	0.17395	.	.	ENSG00000160161	ENST00000291495	T	0.09630	2.96	5.79	3.52	0.40303	.	0.278041	0.39615	N	0.001319	T	0.09818	0.0241	L	0.46157	1.445	0.41211	D	0.986448	P;P	0.48294	0.908;0.908	B;B	0.42851	0.4;0.391	T	0.06427	-1.0827	10	0.59425	D	0.04	-14.0412	4.2441	0.10663	0.1657:0.5914:0.1596:0.0832	.	923;923	B2RAJ0;Q8IUL8	.;CILP2_HUMAN	I	923	ENSP00000291495:T923I	ENSP00000291495:T923I	T	+	2	0	CILP2	19517122	0.998000	0.40836	0.816000	0.32577	0.069000	0.16628	3.866000	0.56040	1.447000	0.47661	-0.324000	0.08512	ACT	CILP2	-	NULL	ENSG00000160161		0.652	CILP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	CILP2	HGNC	protein_coding	OTTHUMT00000459738.3	-	0.00	74	0	C	NM_153221		19656122	+1	tier1	-	no_errors	ENST00000291495	ensembl	human	known	74_37	missense	8.51	43	4	SNP	0.974	T
CLEC7A	64581	genome.wustl.edu	37	12	10271066	10271066	+	Missense_Mutation	SNP	A	A	C			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr12:10271066A>C	ENST00000304084.8	-	6	889	c.735T>G	c.(733-735)ttT>ttG	p.F245L	CLEC7A_ENST00000298523.5_3'UTR|CLEC7A_ENST00000533022.1_3'UTR|CLEC7A_ENST00000353231.5_Missense_Mutation_p.F199L|CLEC7A_ENST00000396484.2_Missense_Mutation_p.F166L	NM_197947.2	NP_922938.1	Q9BXN2	CLC7A_HUMAN	C-type lectin domain family 7, member A	245					carbohydrate mediated signaling (GO:0009756)|cell recognition (GO:0008037)|defense response to protozoan (GO:0042832)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)|phagocytosis, recognition (GO:0006910)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|MHC protein binding (GO:0042287)|signaling pattern recognition receptor activity (GO:0008329)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(1)|upper_aerodigestive_tract(1)	7						CTTACATTGAAAACTTCTTCT	0.403																																																	0													133.0	126.0	128.0					12																	10271066		2203	4300	6503	SO:0001583	missense	0			AY009090	CCDS8613.1, CCDS8614.1, CCDS8617.1, CCDS41753.1, CCDS41754.1, CCDS53744.1	12p13.2-p12.3	2014-09-17		2005-02-09	ENSG00000172243	ENSG00000172243		"""C-type lectin domain containing"""	14558	protein-coding gene	gene with protein product		606264	"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 12"""	CLECSF12			Standard	XM_005253468		Approved	dectin-1, hDectin-1	uc001qxg.2	Q9BXN2	OTTHUMG00000133597	ENST00000304084.8:c.735T>G	12.37:g.10271066A>C	ENSP00000302569:p.Phe245Leu		B2R861|B7Z494|B7Z5A9|B7Z5B9|Q6IPS7|Q96D32|Q96DR9|Q96LD3|Q96PA4|Q96PA5|Q96PA6|Q96PA7|Q96PA8|Q9H1K3	Missense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin,prints_AntifreezeII	p.F245L	ENST00000304084.8	37	c.735	CCDS41753.1	12	.	.	.	.	.	.	.	.	.	.	A	3.567	-0.088415	0.07097	.	.	ENSG00000172243	ENST00000353231;ENST00000396484;ENST00000304084	T;T;T	0.15372	2.43;2.43;2.43	3.84	0.745	0.18359	C-type lectin fold (1);	0.861579	0.09499	N	0.793927	T	0.05318	0.0141	N	0.02916	-0.46	0.09310	N	1	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.001	T	0.40664	-0.9551	10	0.02654	T	1	.	6.0158	0.19603	0.4679:0.3783:0.1537:0.0	.	166;245;199	Q9BXN2-5;Q9BXN2;Q9BXN2-2	.;CLC7A_HUMAN;.	L	199;166;245	ENSP00000266456:F199L;ENSP00000379743:F166L;ENSP00000302569:F245L	ENSP00000302569:F245L	F	-	3	2	CLEC7A	10162333	0.000000	0.05858	0.004000	0.12327	0.552000	0.35366	-0.977000	0.03782	0.145000	0.18977	0.528000	0.53228	TTT	CLEC7A	-	superfamily_C-type_lectin_fold	ENSG00000172243		0.403	CLEC7A-013	KNOWN	basic|appris_principal|CCDS	protein_coding	CLEC7A	HGNC	protein_coding	OTTHUMT00000390772.1	-	0.00	84	0	A	NM_197954		10271066	-1	tier1	-	no_errors	ENST00000304084	ensembl	human	known	74_37	missense	20.00	40	10	SNP	0.005	C
CMKLR1	1240	genome.wustl.edu	37	12	108686241	108686241	+	Missense_Mutation	SNP	C	C	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr12:108686241C>A	ENST00000312143.7	-	3	862	c.499G>T	c.(499-501)Gct>Tct	p.A167S	CMKLR1_ENST00000397688.2_Missense_Mutation_p.A165S|CMKLR1_ENST00000412676.1_Missense_Mutation_p.A167S|CMKLR1_ENST00000550402.1_Missense_Mutation_p.A167S|CMKLR1_ENST00000552995.1_Missense_Mutation_p.A165S	NM_001142344.1|NM_004072.2	NP_001135816.1|NP_004063.1	Q99788	CML1_HUMAN	chemokine-like receptor 1	167					chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of macrophage chemotaxis (GO:0010759)|regulation of calcium-mediated signaling (GO:0050848)|skeletal system development (GO:0001501)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	chemokine receptor activity (GO:0004950)|G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)			endometrium(5)|large_intestine(3)|lung(20)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	37						AAGAAGAAAGCCAGGACCCAG	0.572																																																	0													85.0	86.0	86.0					12																	108686241		2095	4228	6323	SO:0001583	missense	0			U79526	CCDS41829.1, CCDS44965.1	12q23.3	2013-07-29			ENSG00000174600	ENSG00000174600		"""GPCR / Class A : Resolvin receptors"""	2121	protein-coding gene	gene with protein product	"""resolvin E1 receptor"", ""chemerin receptor"""	602351					Standard	NM_004072		Approved	RVER1	uc009zuw.3	Q99788	OTTHUMG00000169576	ENST00000312143.7:c.499G>T	12.37:g.108686241C>A	ENSP00000311733:p.Ala167Ser		A8K6Y5|O75748|Q3KP37|Q5U0H0|Q99789	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_DEZorph_rcpt,prints_GPCR_Rhodpsn,prints_Formyl_pep_rcpt,prints_Anphylx_rcpt,prints_ATII_rcpt	p.A167S	ENST00000312143.7	37	c.499	CCDS44965.1	12	.	.	.	.	.	.	.	.	.	.	c	14.40	2.522915	0.44866	.	.	ENSG00000174600	ENST00000312143;ENST00000412676;ENST00000397688;ENST00000552995;ENST00000550402	T;T;T;T;T	0.34667	1.35;1.35;1.35;1.35;1.35	5.32	4.42	0.53409	GPCR, rhodopsin-like superfamily (1);	0.115711	0.56097	N	0.000021	T	0.33962	0.0881	L	0.27053	0.805	0.41980	D	0.990795	P	0.45474	0.859	P	0.47376	0.545	T	0.08994	-1.0695	10	0.40728	T	0.16	.	14.4205	0.67180	0.1486:0.8514:0.0:0.0	.	167	Q99788	CML1_HUMAN	S	167;167;165;165;167	ENSP00000311733:A167S;ENSP00000401293:A167S;ENSP00000380803:A165S;ENSP00000447579:A165S;ENSP00000449716:A167S	ENSP00000311733:A167S	A	-	1	0	CMKLR1	107210371	0.965000	0.33210	1.000000	0.80357	0.826000	0.46750	2.031000	0.41117	1.227000	0.43598	-0.322000	0.08575	GCT	CMKLR1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000174600		0.572	CMKLR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CMKLR1	HGNC	protein_coding	OTTHUMT00000404867.1		0.00	43	0	C			108686241	-1			no_errors	ENST00000312143	ensembl	human	known	74_37	missense	8.11	34	3	SNP	1.000	A
CNGB3	54714	genome.wustl.edu	37	8	87751931	87751931	+	Missense_Mutation	SNP	T	T	C			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr8:87751931T>C	ENST00000320005.5	-	2	210	c.163A>G	c.(163-165)Acc>Gcc	p.T55A	CNGB3_ENST00000519777.1_5'UTR|RP11-386D6.1_ENST00000519041.1_RNA	NM_019098.4	NP_061971.3	Q9NQW8	CNGB3_HUMAN	cyclic nucleotide gated channel beta 3	55					cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)	p.T55S(1)|p.T55P(1)		NS(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(15)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	80						GTTGACTTGGTTTTGAGAGAT	0.313																																																	2	Substitution - Missense(2)	lung(1)|pancreas(1)											182.0	157.0	165.0					8																	87751931		2203	4300	6503	SO:0001583	missense	0			AF228520	CCDS6244.1	8q21.3	2013-01-23	2003-06-25		ENSG00000170289	ENSG00000170289		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2153	protein-coding gene	gene with protein product		605080	"""achromatopsia (rod monochromacy) 3"", ""achromatopsia (rod monochromacy) 1"""	ACHM3, ACHM1, RMCH		10888875, 10958649, 16382102	Standard	NM_019098		Approved		uc003ydx.3	Q9NQW8	OTTHUMG00000163738	ENST00000320005.5:c.163A>G	8.37:g.87751931T>C	ENSP00000316605:p.Thr55Ala		C9JA51|Q9NRE9	Missense_Mutation	SNP	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	p.T55A	ENST00000320005.5	37	c.163	CCDS6244.1	8	.	.	.	.	.	.	.	.	.	.	T	12.19	1.862442	0.32884	.	.	ENSG00000170289	ENST00000320005	T	0.27890	1.64	4.36	1.79	0.24919	.	.	.	.	.	T	0.17704	0.0425	L	0.36672	1.1	0.24957	N	0.991753	B	0.11235	0.004	B	0.04013	0.001	T	0.34129	-0.9841	9	0.06891	T	0.86	.	4.8737	0.13646	0.0:0.3228:0.0:0.6772	.	55	Q9NQW8	CNGB3_HUMAN	A	55	ENSP00000316605:T55A	ENSP00000316605:T55A	T	-	1	0	CNGB3	87821047	0.519000	0.26242	0.879000	0.34478	0.828000	0.46876	0.374000	0.20501	0.651000	0.30788	0.533000	0.62120	ACC	CNGB3	-	NULL	ENSG00000170289		0.313	CNGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNGB3	HGNC	protein_coding	OTTHUMT00000375107.1	-	0.00	45	0	T	NM_019098		87751931	-1	tier1	-	no_errors	ENST00000320005	ensembl	human	known	74_37	missense	15.56	38	7	SNP	0.970	C
CNOT6L	246175	genome.wustl.edu	37	4	78678024	78678024	+	Missense_Mutation	SNP	T	T	C			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr4:78678024T>C	ENST00000504123.1	-	5	612	c.482A>G	c.(481-483)aAt>aGt	p.N161S	CNOT6L_ENST00000264903.4_Missense_Mutation_p.N161S|CNOT6L_ENST00000506166.1_5'UTR			Q96LI5	CNO6L_HUMAN	CCR4-NOT transcription complex, subunit 6-like	161	Nuclease domain.				gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA destabilization (GO:0061157)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|transcription, DNA-templated (GO:0006351)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A)-specific ribonuclease activity (GO:0004535)			kidney(1)|large_intestine(1)|lung(6)|urinary_tract(1)	9						ACCTGCGAGATTGTCAAGCAT	0.363																																																	0													79.0	73.0	75.0					4																	78678024		1853	4088	5941	SO:0001583	missense	0			AL133112	CCDS68731.1	4q13.3	2014-06-17				ENSG00000138767			18042	protein-coding gene	gene with protein product							Standard	NM_144571		Approved	DKFZp434K098, Ccr4b	uc003hks.3	Q96LI5		ENST00000504123.1:c.482A>G	4.37:g.78678024T>C	ENSP00000424896:p.Asn161Ser		Q9UF92	Missense_Mutation	SNP	pfam_Endo/exonuclease/phosphatase,pfam_Leu-rich_rpt,superfamily_Endo/exonuclease/phosphatase,smart_Leu-rich_rpt_typical-subtyp	p.N161S	ENST00000504123.1	37	c.482		4	.	.	.	.	.	.	.	.	.	.	T	15.80	2.941414	0.53079	.	.	ENSG00000138767	ENST00000504123;ENST00000264903;ENST00000512485;ENST00000515441	T;T;T;T	0.32753	1.44;1.44;1.59;2.1	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	T	0.33585	0.0868	M	0.63208	1.945	0.80722	D	1	P;B;B	0.35507	0.506;0.199;0.365	B;B;B	0.35114	0.196;0.177;0.115	T	0.18999	-1.0319	10	0.54805	T	0.06	-12.6237	14.014	0.64513	0.0:0.0:0.0:1.0	.	161;134;161	B4E2S0;Q96LI5-2;Q96LI5	.;.;CNO6L_HUMAN	S	161;161;168;161	ENSP00000424896:N161S;ENSP00000264903:N161S;ENSP00000425571:N168S;ENSP00000426269:N161S	ENSP00000264903:N161S	N	-	2	0	CNOT6L	78897048	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.129000	0.77225	1.968000	0.57251	0.377000	0.23210	AAT	CNOT6L	-	NULL	ENSG00000138767		0.363	CNOT6L-001	KNOWN	basic|appris_principal	protein_coding	CNOT6L	HGNC	protein_coding	OTTHUMT00000362515.1	-	0.00	75	0	T			78678024	-1	tier1	-	no_errors	ENST00000264903	ensembl	human	known	74_37	missense	54.17	33	39	SNP	1.000	C
CNP	1267	genome.wustl.edu	37	17	40120030	40120030	+	Intron	SNP	G	G	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr17:40120030G>T	ENST00000393892.3	+	2	147				CNP_ENST00000472031.1_Intron|TTC25_ENST00000591658.1_RNA|CNP_ENST00000591072.1_Intron|CNP_ENST00000393888.1_Intron|CNP_ENST00000592446.1_Intron	NM_033133.4	NP_149124.3	P09543	CN37_HUMAN	2',3'-cyclic nucleotide 3' phosphodiesterase						adult locomotory behavior (GO:0008344)|aging (GO:0007568)|axonogenesis (GO:0007409)|cyclic nucleotide catabolic process (GO:0009214)|microtubule cytoskeleton organization (GO:0000226)|oligodendrocyte differentiation (GO:0048709)|regulation of mitochondrial membrane permeability (GO:0046902)|response to lipopolysaccharide (GO:0032496)|response to toxic substance (GO:0009636)|substantia nigra development (GO:0021762)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule (GO:0005874)|microvillus (GO:0005902)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|myelin sheath abaxonal region (GO:0035748)|myelin sheath adaxonal region (GO:0035749)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|pseudopodium (GO:0031143)	2',3'-cyclic-nucleotide 3'-phosphodiesterase activity (GO:0004113)|cyclic nucleotide binding (GO:0030551)|RNA binding (GO:0003723)			breast(1)|kidney(2)|large_intestine(1)|lung(4)|upper_aerodigestive_tract(1)	9		all_cancers(22;2.38e-06)|all_epithelial(22;6.79e-05)|Breast(137;0.000143)		UCEC - Uterine corpus endometrioid carcinoma (308;0.171)		TAGGGGTAAGGCCGGCGGGGA	0.597																																																	0																																										SO:0001627	intron_variant	0				CCDS11414.2	17q21	2008-02-05			ENSG00000173786	ENSG00000173786	3.1.4.37		2158	protein-coding gene	gene with protein product		123830				1322358	Standard	XM_006721701		Approved		uc002hyl.1	P09543	OTTHUMG00000133502	ENST00000393892.3:c.4-56G>T	17.37:g.40120030G>T				RNA	SNP	-	NULL	ENST00000393892.3	37	NULL	CCDS11414.2	17																																																																																			CNP	-	-	ENSG00000173786		0.597	CNP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNP	HGNC	protein_coding	OTTHUMT00000257443.2	-	0.00	51	0	G			40120030	+1	tier1	-	no_errors	ENST00000591945	ensembl	human	known	74_37	rna	9.52	38	4	SNP	0.022	T
COL12A1	1303	genome.wustl.edu	37	6	75840585	75840585	+	Missense_Mutation	SNP	G	G	C			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr6:75840585G>C	ENST00000322507.8	-	36	6359	c.6050C>G	c.(6049-6051)cCt>cGt	p.P2017R	COL12A1_ENST00000416123.2_Missense_Mutation_p.P2017R|COL12A1_ENST00000345356.6_Missense_Mutation_p.P853R|COL12A1_ENST00000483888.2_Missense_Mutation_p.P2017R	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	2017	Fibronectin type-III 15. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						GCCCTGGGCAGGGCTGGGATT	0.562																																																	0													77.0	79.0	78.0					6																	75840585		2021	4182	6203	SO:0001583	missense	0			U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.6050C>G	6.37:g.75840585G>C	ENSP00000325146:p.Pro2017Arg		O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_VWF_A,pfam_Collagen,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_VWF_A,smart_Laminin_G,pfscan_Fibronectin_type3,pfscan_VWF_A	p.P2017R	ENST00000322507.8	37	c.6050	CCDS43482.1	6	.	.	.	.	.	.	.	.	.	.	G	11.18	1.563117	0.27915	.	.	ENSG00000111799	ENST00000322507;ENST00000432784;ENST00000345356;ENST00000416123;ENST00000483888	T;T;T;T	0.54675	0.56;0.56;0.56;0.56	5.6	4.74	0.60224	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.306737	0.31834	N	0.007000	T	0.23330	0.0564	L	0.47716	1.5	0.32623	N	0.523018	B;B	0.09022	0.002;0.001	B;B	0.09377	0.004;0.003	T	0.09930	-1.0652	10	0.16420	T	0.52	.	10.3471	0.43911	0.0718:0.0:0.7863:0.1419	.	853;2017	Q99715-2;Q99715	.;COCA1_HUMAN	R	2017;2017;853;2017;2017	ENSP00000325146:P2017R;ENSP00000305147:P853R;ENSP00000412864:P2017R;ENSP00000421216:P2017R	ENSP00000325146:P2017R	P	-	2	0	COL12A1	75897305	0.999000	0.42202	0.873000	0.34254	0.906000	0.53458	3.261000	0.51530	1.368000	0.46115	0.655000	0.94253	CCT	COL12A1	-	superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000111799		0.562	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL12A1	HGNC	protein_coding	OTTHUMT00000041249.3	-	0.00	93	0	G	NM_004370		75840585	-1	tier1	-	no_errors	ENST00000322507	ensembl	human	known	74_37	missense	39.47	23	15	SNP	0.886	C
COL16A1	1307	genome.wustl.edu	37	1	32133200	32133200	+	Silent	SNP	C	C	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr1:32133200C>T	ENST00000373672.3	-	52	3849	c.3333G>A	c.(3331-3333)ggG>ggA	p.G1111G	COL16A1_ENST00000271069.6_Silent_p.G1111G	NM_001856.3	NP_001847.3	Q07092	COGA1_HUMAN	collagen, type XVI, alpha 1	1111	Triple-helical region 2 (COL2) with 2 imperfections.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female pregnancy (GO:0007565)|integrin-mediated signaling pathway (GO:0007229)	collagen type XVI trimer (GO:0005597)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(15)|ovary(8)|prostate(4)	48		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		CTCCCGCTGACCCGGTGTAGC	0.622																																					Colon(143;498 1786 21362 25193 36625)												0													21.0	26.0	25.0					1																	32133200		2132	4252	6384	SO:0001819	synonymous_variant	0			M92642	CCDS41297.1	1p35-p34	2013-01-16			ENSG00000084636	ENSG00000084636		"""Collagens"""	2193	protein-coding gene	gene with protein product		120326				1631157	Standard	NM_001856		Approved		uc001btk.1	Q07092	OTTHUMG00000003883	ENST00000373672.3:c.3333G>A	1.37:g.32133200C>T			Q16593|Q59F89|Q71RG9	Silent	SNP	pfam_Collagen,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G	p.G1111	ENST00000373672.3	37	c.3333	CCDS41297.1	1																																																																																			COL16A1	-	pfam_Collagen	ENSG00000084636		0.622	COL16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL16A1	HGNC	protein_coding	OTTHUMT00000011057.2		0.00	69	0	C	NM_001856		32133200	-1			no_errors	ENST00000271069	ensembl	human	known	74_37	silent	5.06	75	4	SNP	0.006	T
COL21A1	81578	genome.wustl.edu	37	6	55942867	55942867	+	Intron	SNP	C	C	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr6:55942867C>T	ENST00000244728.5	-	18	2210				COL21A1_ENST00000535941.1_Intron|COL21A1_ENST00000467045.1_Intron|COL21A1_ENST00000370819.1_Intron|COL21A1_ENST00000370808.2_Intron	NM_030820.3	NP_110447.2	Q96P44	COLA1_HUMAN	collagen, type XXI, alpha 1						extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(1)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|prostate(2)	41	Lung NSC(77;0.0483)		LUSC - Lung squamous cell carcinoma(124;0.181)			AAATGGCAATCTTTTCTCTTA	0.348																																																	0																																										SO:0001627	intron_variant	0			AF330693	CCDS55025.1	6p12.3-p11.2	2013-01-16			ENSG00000124749	ENSG00000124749		"""Collagens"""	17025	protein-coding gene	gene with protein product		610002				11566190	Standard	XR_241922		Approved		uc003pcs.3	Q96P44	OTTHUMG00000014907	ENST00000244728.5:c.1813-496G>A	6.37:g.55942867C>T			A6NIX5|B2R8J9|Q49A51|Q71RF4|Q8WXV8|Q9H0V3	RNA	SNP	-	NULL	ENST00000244728.5	37	NULL	CCDS55025.1	6																																																																																			COL21A1	-	-	ENSG00000124749		0.348	COL21A1-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	COL21A1	HGNC	protein_coding	OTTHUMT00000041004.2	-	0.00	92	0	C			55942867	-1	tier1	-	no_errors	ENST00000484987	ensembl	human	putative	74_37	rna	40.98	36	25	SNP	0.001	T
COX18	285521	genome.wustl.edu	37	4	73930518	73930518	+	Missense_Mutation	SNP	C	C	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr4:73930518C>T	ENST00000295890.4	-	4	788	c.697G>A	c.(697-699)Gtc>Atc	p.V233I	COX18_ENST00000507544.2_Missense_Mutation_p.V234I	NM_173827.2	NP_776188.1	Q8N8Q8	COX18_HUMAN	COX18 cytochrome C oxidase assembly factor	233					protein insertion into mitochondrial membrane (GO:0051204)|protein transport (GO:0015031)|respiratory chain complex IV assembly (GO:0008535)	integral component of mitochondrial inner membrane (GO:0031305)	protein transporter activity (GO:0008565)			large_intestine(4)|lung(2)	6	Breast(15;0.00096)		Epithelial(6;1.26e-06)|OV - Ovarian serous cystadenocarcinoma(6;9.45e-06)|all cancers(17;2.05e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			AAATTGATGACGCCAACAGAG	0.403																																																	0													72.0	70.0	71.0					4																	73930518		2203	4300	6503	SO:0001583	missense	0			AY957564	CCDS3554.1, CCDS75139.1	4q13.3	2013-06-12	2013-06-12		ENSG00000163626	ENSG00000163626		"""Mitochondrial respiratory chain complex assembly factors"""	26801	protein-coding gene	gene with protein product		610428	"""COX18 cytochrome c oxidase assembly homolog (S. cerevisiae)"", ""cytochrome c oxidase assembly homolog 18 (yeast)"""			16212937, 16911509	Standard	XM_005265679		Approved	FLJ38991	uc003hgm.1	Q8N8Q8	OTTHUMG00000129917	ENST00000295890.4:c.697G>A	4.37:g.73930518C>T	ENSP00000295890:p.Val233Ile		Q2PB66|Q2PB67|Q2PB68|Q49B97|Q6IPP9	Missense_Mutation	SNP	pfam_Membrane_insert_OXA1/ALB3/YidC	p.V233I	ENST00000295890.4	37	c.697	CCDS3554.1	4	.	.	.	.	.	.	.	.	.	.	C	8.681	0.905131	0.17760	.	.	ENSG00000163626	ENST00000295890;ENST00000507544	.	.	.	5.45	3.33	0.38152	.	0.252757	0.39985	N	0.001219	T	0.17450	0.0419	N	0.02916	-0.46	0.38557	D	0.949616	B;B	0.10296	0.001;0.003	B;B	0.11329	0.006;0.006	T	0.12142	-1.0559	9	0.07030	T	0.85	-17.4614	6.1089	0.20090	0.0:0.5374:0.2604:0.2022	.	234;233	B7ZL88;Q8N8Q8	.;COX18_HUMAN	I	233;234	.	ENSP00000295890:V233I	V	-	1	0	COX18	74149382	0.995000	0.38212	0.989000	0.46669	0.714000	0.41099	0.844000	0.27654	1.414000	0.47017	0.650000	0.86243	GTC	COX18	-	pfam_Membrane_insert_OXA1/ALB3/YidC	ENSG00000163626		0.403	COX18-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	COX18	HGNC	protein_coding	OTTHUMT00000252169.2	-	0.00	79	0	C	NM_173827		73930518	-1	tier1	-	no_errors	ENST00000295890	ensembl	human	known	74_37	missense	48.84	22	21	SNP	0.991	T
CSMD1	64478	genome.wustl.edu	37	8	3076825	3076825	+	Missense_Mutation	SNP	G	G	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr8:3076825G>A	ENST00000520002.1	-	30	5182	c.4627C>T	c.(4627-4629)Cgg>Tgg	p.R1543W	CSMD1_ENST00000602723.1_Missense_Mutation_p.R1543W|CSMD1_ENST00000400186.3_Missense_Mutation_p.R1543W|CSMD1_ENST00000542608.1_Missense_Mutation_p.R1542W|CSMD1_ENST00000539096.1_Missense_Mutation_p.R1542W|CSMD1_ENST00000602557.1_Missense_Mutation_p.R1543W|CSMD1_ENST00000523387.1_5'UTR|CSMD1_ENST00000537824.1_Missense_Mutation_p.R1542W			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	1543	CUB 9. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		GCATCACTCCGAAATGCCAGA	0.483																																																	0													49.0	53.0	52.0					8																	3076825		1840	4094	5934	SO:0001583	missense	0					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.4627C>T	8.37:g.3076825G>A	ENSP00000430733:p.Arg1543Trp		Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.R1543W	ENST00000520002.1	37	c.4627		8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.09|14.09	2.431947|2.431947	0.43122|0.43122	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096|ENST00000335551	T;T;T;T;T|.	0.30182|.	1.54;1.54;1.54;1.54;1.54|.	5.48|5.48	3.59|3.59	0.41128|0.41128	CUB (5);|.	0.000000|.	0.64402|.	D|.	0.000001|.	T|T	0.76147|0.76147	0.3947|0.3947	M|M	0.82193|0.82193	2.58|2.58	0.58432|0.58432	D|D	0.999998|0.999998	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	0.995;1.0;1.0|.	T|T	0.77469|0.77469	-0.2576|-0.2576	10|5	0.66056|.	D|.	0.02|.	.|.	14.4445|14.4445	0.67340|0.67340	0.0:0.0:0.7235:0.2765|0.0:0.0:0.7235:0.2765	.|.	1543;1543;1543|.	E5RIG2;Q96PZ7;Q96PZ7-4|.	.;CSMD1_HUMAN;.|.	W|L	1543;1543;1405;1542;1542;1542|1022	ENSP00000383047:R1543W;ENSP00000430733:R1543W;ENSP00000441462:R1542W;ENSP00000446243:R1542W;ENSP00000441675:R1542W|.	ENSP00000320445:R1405W|.	R|S	-|-	1|2	2|0	CSMD1|CSMD1	3064232|3064232	1.000000|1.000000	0.71417|0.71417	0.354000|0.354000	0.25760|0.25760	0.080000|0.080000	0.17528|0.17528	3.404000|3.404000	0.52623|0.52623	0.695000|0.695000	0.31675|0.31675	0.555000|0.555000	0.69702|0.69702	CGG|TCG	CSMD1	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom	ENSG00000183117		0.483	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	CSMD1	HGNC	protein_coding	OTTHUMT00000374500.2		0.00	59	0	G	NM_033225		3076825	-1			no_errors	ENST00000520002	ensembl	human	known	74_37	missense	5.41	35	2	SNP	1.000	A
CSPG4P13	100302666	genome.wustl.edu	37	15	78194048	78194048	+	RNA	SNP	C	C	G	rs538072076		TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr15:78194048C>G	ENST00000565545.1	+	0	46									chondroitin sulfate proteoglycan 4 pseudogene 13																		GCCCCTACTTCCCCACTCTCC	0.642													C|||	1	0.000199681	0.0	0.0	5008	,	,		17104	0.0		0.001	False		,,,				2504	0.0																0																																												0					15q24.3	2013-09-26			ENSG00000260139	ENSG00000260139			49195	pseudogene	pseudogene							Standard	NG_012725		Approved				OTTHUMG00000172978		15.37:g.78194048C>G				RNA	SNP	-	NULL	ENST00000565545.1	37	NULL		15																																																																																			CSPG4P13	-	-	ENSG00000260139		0.642	CSPG4P13-002	KNOWN	basic	processed_transcript	CSPG4P13	HGNC	pseudogene	OTTHUMT00000421581.1	-	0.00	98	0	C			78194048	+1	tier1	-	no_errors	ENST00000565545	ensembl	human	known	74_37	rna	77.42	6	24	SNP	0.994	G
CWH43	80157	genome.wustl.edu	37	4	49005812	49005812	+	Missense_Mutation	SNP	G	G	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr4:49005812G>T	ENST00000226432.4	+	7	1046	c.863G>T	c.(862-864)tGt>tTt	p.C288F	CWH43_ENST00000513409.1_Missense_Mutation_p.C261F	NM_025087.2	NP_079363.2	Q9H720	PG2IP_HUMAN	cell wall biogenesis 43 C-terminal homolog (S. cerevisiae)	288					GPI anchor biosynthetic process (GO:0006506)	integral component of membrane (GO:0016021)		p.C288Y(1)		cervix(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(26)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	43						GTGTCTGGCTGTGTCTTCGCC	0.502																																																	1	Substitution - Missense(1)	lung(1)											100.0	87.0	91.0					4																	49005812		2203	4300	6503	SO:0001583	missense	0				CCDS3486.1, CCDS68697.1	4p12-p11	2010-09-21			ENSG00000109182	ENSG00000109182			26133	protein-coding gene	gene with protein product						17714445, 17761529	Standard	NM_025087		Approved	FLJ21511, CWH43-C	uc003gyv.3	Q9H720	OTTHUMG00000128627	ENST00000226432.4:c.863G>T	4.37:g.49005812G>T	ENSP00000226432:p.Cys288Phe		B2RPD7	Missense_Mutation	SNP	superfamily_Endo/exonuclease/phosphatase	p.C288F	ENST00000226432.4	37	c.863	CCDS3486.1	4	.	.	.	.	.	.	.	.	.	.	G	2.481	-0.319685	0.05386	.	.	ENSG00000109182	ENST00000226432;ENST00000513409	T;T	0.41065	1.59;1.01	3.91	2.07	0.26955	.	0.883778	0.09820	N	0.751636	T	0.33644	0.0870	L	0.57536	1.79	0.09310	N	1	P	0.41265	0.744	B	0.38378	0.272	T	0.31392	-0.9945	9	.	.	.	.	1.4026	0.02274	0.139:0.2223:0.4111:0.2276	.	288	Q9H720	PG2IP_HUMAN	F	288;261	ENSP00000226432:C288F;ENSP00000422802:C261F	.	C	+	2	0	CWH43	48700569	0.819000	0.29175	0.034000	0.17996	0.002000	0.02628	1.213000	0.32407	0.553000	0.29044	-0.293000	0.09583	TGT	CWH43	-	NULL	ENSG00000109182		0.502	CWH43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CWH43	HGNC	protein_coding	OTTHUMT00000250496.2		0.00	49	0	G	NM_025087		49005812	+1			no_errors	ENST00000226432	ensembl	human	known	74_37	missense	9.38	29	3	SNP	0.029	T
CWH43	80157	genome.wustl.edu	37	4	49030703	49030703	+	Nonsense_Mutation	SNP	G	G	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr4:49030703G>T	ENST00000226432.4	+	10	1507	c.1324G>T	c.(1324-1326)Gaa>Taa	p.E442*	CWH43_ENST00000513409.1_Nonsense_Mutation_p.E415*	NM_025087.2	NP_079363.2	Q9H720	PG2IP_HUMAN	cell wall biogenesis 43 C-terminal homolog (S. cerevisiae)	442					GPI anchor biosynthetic process (GO:0006506)	integral component of membrane (GO:0016021)				cervix(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(26)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	43						ATATGACAATGAAGGGTGGTC	0.413																																																	0													99.0	93.0	95.0					4																	49030703		2203	4300	6503	SO:0001587	stop_gained	0				CCDS3486.1, CCDS68697.1	4p12-p11	2010-09-21			ENSG00000109182	ENSG00000109182			26133	protein-coding gene	gene with protein product						17714445, 17761529	Standard	NM_025087		Approved	FLJ21511, CWH43-C	uc003gyv.3	Q9H720	OTTHUMG00000128627	ENST00000226432.4:c.1324G>T	4.37:g.49030703G>T	ENSP00000226432:p.Glu442*		B2RPD7	Nonsense_Mutation	SNP	superfamily_Endo/exonuclease/phosphatase	p.E442*	ENST00000226432.4	37	c.1324	CCDS3486.1	4	.	.	.	.	.	.	.	.	.	.	G	40	8.031312	0.98619	.	.	ENSG00000109182	ENST00000226432;ENST00000513409	.	.	.	4.72	4.72	0.59763	.	0.094992	0.45361	D	0.000363	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.4187	0.83751	0.0:0.0:1.0:0.0	.	.	.	.	X	442;415	.	.	E	+	1	0	CWH43	48725460	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	5.980000	0.70516	2.634000	0.89283	0.462000	0.41574	GAA	CWH43	-	NULL	ENSG00000109182		0.413	CWH43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CWH43	HGNC	protein_coding	OTTHUMT00000250496.2		0.00	73	0	G	NM_025087		49030703	+1			no_errors	ENST00000226432	ensembl	human	known	74_37	nonsense	5.71	33	2	SNP	1.000	T
CYFIP2	26999	genome.wustl.edu	37	5	156714067	156714067	+	Missense_Mutation	SNP	G	G	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr5:156714067G>A	ENST00000521420.1	+	3	248	c.157G>A	c.(157-159)Gtc>Atc	p.V53I	CYFIP2_ENST00000377576.3_Missense_Mutation_p.V53I|CYFIP2_ENST00000442283.2_5'UTR|CYFIP2_ENST00000522463.1_Missense_Mutation_p.V53I|CYFIP2_ENST00000347377.6_Missense_Mutation_p.V53I|CYFIP2_ENST00000318218.6_Missense_Mutation_p.V53I|CYFIP2_ENST00000541131.1_Intron					cytoplasmic FMR1 interacting protein 2											breast(1)|endometrium(12)|kidney(2)|lung(23)	38	Renal(175;0.00212)	Medulloblastoma(196;0.0306)|all_neural(177;0.0897)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GAATGCATTTGTCACGGGCAT	0.493																																																	0													87.0	86.0	87.0					5																	156714067		2058	4214	6272	SO:0001583	missense	0			AF160973	CCDS75364.1	5q34	2008-07-18				ENSG00000055163			13760	protein-coding gene	gene with protein product	"""p53 inducible protein"""	606323				11438699	Standard	NM_001037333		Approved	PIR121	uc021ygm.1	Q96F07		ENST00000521420.1:c.157G>A	5.37:g.156714067G>A	ENSP00000430904:p.Val53Ile			Missense_Mutation	SNP	pfam_Cytoplasmic_FMR1-int,pirsf_Cytoplasmic_FMR1-int_sub,prints_Cytoplasmic_FMR1-int	p.V53I	ENST00000521420.1	37	c.157		5	.	.	.	.	.	.	.	.	.	.	G	27.8	4.866408	0.91511	.	.	ENSG00000055163	ENST00000318218;ENST00000522463;ENST00000521420;ENST00000347377;ENST00000377576	T;T;T;T;T	0.42131	0.98;2.09;2.12;0.98;0.98	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.46580	0.1400	L	0.51914	1.62	0.80722	D	1	B;B;B;B;P	0.35745	0.267;0.166;0.172;0.296;0.518	B;B;B;B;B	0.41374	0.355;0.017;0.015;0.101;0.355	T	0.31806	-0.9930	10	0.34782	T	0.22	-39.7201	19.4094	0.94662	0.0:0.0:1.0:0.0	.	53;53;53;53;53	E7EW33;E7EVJ5;E7EVF4;Q96F07-2;Q96F07	.;.;.;.;CYFP2_HUMAN	I	53	ENSP00000325817:V53I;ENSP00000428009:V53I;ENSP00000430904:V53I;ENSP00000313567:V53I;ENSP00000366799:V53I	ENSP00000325817:V53I	V	+	1	0	CYFIP2	156646645	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	9.382000	0.97209	2.583000	0.87209	0.561000	0.74099	GTC	CYFIP2	-	pirsf_Cytoplasmic_FMR1-int_sub,prints_Cytoplasmic_FMR1-int	ENSG00000055163		0.493	CYFIP2-001	NOVEL	basic	protein_coding	CYFIP2	HGNC	protein_coding	OTTHUMT00000373710.1		0.00	50	0	G	NM_001037332		156714067	+1			no_errors	ENST00000318218	ensembl	human	known	74_37	missense	7.27	51	4	SNP	1.000	A
DBN1	1627	genome.wustl.edu	37	5	176887455	176887455	+	Silent	SNP	G	G	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr5:176887455G>T	ENST00000309007.5	-	10	1152	c.933C>A	c.(931-933)ccC>ccA	p.P311P	DBN1_ENST00000393565.1_Silent_p.P311P|DBN1_ENST00000292385.5_Silent_p.P313P|DBN1_ENST00000393563.4_Silent_p.P43P|DBN1_ENST00000512501.1_Silent_p.P43P	NM_004395.3	NP_004386	Q16643	DREB_HUMAN	drebrin 1	311					actin filament organization (GO:0007015)|cell communication by chemical coupling (GO:0010643)|cell communication by electrical coupling (GO:0010644)|maintenance of protein location in cell (GO:0032507)|neural precursor cell proliferation (GO:0061351)|regulation of dendrite development (GO:0050773)|regulation of neuronal synaptic plasticity (GO:0048168)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|gap junction (GO:0005921)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|profilin binding (GO:0005522)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(12)|ovary(1)|skin(2)	25	all_cancers(89;2.17e-05)|Renal(175;0.000269)|Lung NSC(126;0.0014)|all_lung(126;0.0025)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TGAAGGGCGAGGGTACATCAC	0.622																																																	0													140.0	135.0	136.0					5																	176887455		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS4420.1, CCDS4421.1	5q35.3	2008-02-05			ENSG00000113758	ENSG00000113758			2695	protein-coding gene	gene with protein product		126660		D0S117E		8216329	Standard	NM_004395		Approved		uc003mgy.2	Q16643	OTTHUMG00000130856	ENST00000309007.5:c.933C>A	5.37:g.176887455G>T			A8MV58|B2RBG0|Q9UFZ5	Silent	SNP	pfam_Actin-bd_cofilin/tropomyosin,smart_Actin-bd_cofilin/tropomyosin	p.P313	ENST00000309007.5	37	c.939	CCDS4420.1	5																																																																																			DBN1	-	NULL	ENSG00000113758		0.622	DBN1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DBN1	HGNC	protein_coding	OTTHUMT00000253429.2	-	0.00	66	0	G	NM_080881		176887455	-1	tier1	-	no_errors	ENST00000292385	ensembl	human	known	74_37	silent	8.70	42	4	SNP	0.994	T
DDX41	51428	genome.wustl.edu	37	5	176943362	176943362	+	Silent	SNP	G	G	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr5:176943362G>A	ENST00000507955.1	-	3	748	c.225C>T	c.(223-225)gaC>gaT	p.D75D	DDX41_ENST00000506965.1_5'UTR	NM_016222.2	NP_057306.2	Q9UJV9	DDX41_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 41	75					apoptotic process (GO:0006915)|cellular response to interferon-beta (GO:0035458)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|multicellular organismal development (GO:0007275)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)|RNA processing (GO:0006396)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)					all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.191)			GCGGGATGTCGTCCTCATCTC	0.627																																																	0													126.0	118.0	121.0					5																	176943362		2203	4300	6503	SO:0001819	synonymous_variant	0			AF195417	CCDS4427.1	5q35.3	2008-02-05			ENSG00000183258	ENSG00000183258		"""DEAD-boxes"""	18674	protein-coding gene	gene with protein product		608170				10607561	Standard	NM_016222		Approved	ABS, MGC8828	uc003mho.3	Q9UJV9	OTTHUMG00000130858	ENST00000507955.1:c.225C>T	5.37:g.176943362G>A			B2RDC8|Q96BK6|Q96K05|Q9NT96|Q9NW04	Silent	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Znf_CCHC,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.D75	ENST00000507955.1	37	c.225	CCDS4427.1	5																																																																																			DDX41	-	NULL	ENSG00000183258		0.627	DDX41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX41	HGNC	protein_coding	OTTHUMT00000253432.2		0.00	42	0	G	NM_016222		176943362	-1			no_errors	ENST00000507955	ensembl	human	known	74_37	silent	8.11	34	3	SNP	1.000	A
DDX47	51202	genome.wustl.edu	37	12	12974243	12974243	+	Missense_Mutation	SNP	G	G	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr12:12974243G>T	ENST00000358007.3	+	3	305	c.283G>T	c.(283-285)Gcc>Tcc	p.A95S	DDX47_ENST00000352940.4_Missense_Mutation_p.A95S|DDX47_ENST00000392155.2_3'UTR	NM_016355.3	NP_057439.2	Q9H0S4	DDX47_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 47	95	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|rRNA processing (GO:0006364)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16		Prostate(47;0.0526)		BRCA - Breast invasive adenocarcinoma(232;0.0354)		GCGTTTGTTTGCCCTAGTTCT	0.537																																																	0													143.0	141.0	142.0					12																	12974243		2203	4300	6503	SO:0001583	missense	0			AK127712	CCDS8655.1, CCDS8656.1	12p13.2	2010-07-06			ENSG00000213782	ENSG00000213782		"""DEAD-boxes"""	18682	protein-coding gene	gene with protein product		615428					Standard	NM_016355		Approved	DKFZp564O176, FLJ30012, HQ0256, RRP3	uc001rax.3	Q9H0S4	OTTHUMG00000168709	ENST00000358007.3:c.283G>T	12.37:g.12974243G>T	ENSP00000350698:p.Ala95Ser		B3KXP4|G5E955|Q96GM0|Q96NV8|Q9UI98	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.A95S	ENST00000358007.3	37	c.283	CCDS8655.1	12	.	.	.	.	.	.	.	.	.	.	G	19.48	3.835294	0.71373	.	.	ENSG00000213782	ENST00000352940;ENST00000358007	T;T	0.19669	2.13;2.13	5.6	5.6	0.85130	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.175925	0.49305	D	0.000141	T	0.42743	0.1216	M	0.78637	2.42	0.58432	D	0.999999	B;B;B;B	0.30634	0.023;0.162;0.063;0.288	B;B;B;B	0.44278	0.445;0.38;0.243;0.38	T	0.35301	-0.9794	10	0.62326	D	0.03	-7.1476	19.616	0.95634	0.0:0.0:1.0:0.0	.	95;95;95;95	B4DYP6;Q9H4E3;G5E955;Q9H0S4	.;.;.;DDX47_HUMAN	S	95	ENSP00000319578:A95S;ENSP00000350698:A95S	ENSP00000319578:A95S	A	+	1	0	DDX47	12865510	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	6.978000	0.76147	2.642000	0.89623	0.555000	0.69702	GCC	DDX47	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000213782		0.537	DDX47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX47	HGNC	protein_coding	OTTHUMT00000400674.1	-	0.00	86	0	G	NM_016355		12974243	+1	tier1	-	no_errors	ENST00000358007	ensembl	human	known	74_37	missense	5.56	68	4	SNP	1.000	T
DDX50	79009	genome.wustl.edu	37	10	70696734	70696734	+	Silent	SNP	A	A	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr10:70696734A>T	ENST00000373585.3	+	12	1745	c.1638A>T	c.(1636-1638)cgA>cgT	p.R546R	DDX50_ENST00000466265.1_3'UTR	NM_024045.1	NP_076950.1	Q9BQ39	DDX50_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 50	546						membrane (GO:0016020)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(5)|liver(2)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	29						ATTTTTTCCGACCATCAGCTC	0.413																																																	0													119.0	116.0	117.0					10																	70696734		2203	4300	6503	SO:0001819	synonymous_variant	0			AF334103	CCDS7283.1	10q22.2	2010-09-30			ENSG00000107625	ENSG00000107625		"""DEAD-boxes"""	17906	protein-coding gene	gene with protein product		610373				11891046	Standard	NM_024045		Approved	GU2, MGC3199, GUB, RH-II/GuB	uc001jou.3	Q9BQ39	OTTHUMG00000018362	ENST00000373585.3:c.1638A>T	10.37:g.70696734A>T			Q5VX37|Q8WV76|Q9BWI8	Silent	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_GUCT,pfam_Helicase_C,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.R546	ENST00000373585.3	37	c.1638	CCDS7283.1	10																																																																																			DDX50	-	NULL	ENSG00000107625		0.413	DDX50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX50	HGNC	protein_coding	OTTHUMT00000048363.1	-	0.00	53	0	A	NM_024045		70696734	+1	tier1	-	no_errors	ENST00000373585	ensembl	human	known	74_37	silent	13.33	26	4	SNP	1.000	T
DHX15	1665	genome.wustl.edu	37	4	24578049	24578049	+	Missense_Mutation	SNP	G	G	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr4:24578049G>T	ENST00000336812.4	-	2	480	c.324C>A	c.(322-324)caC>caA	p.H108Q		NM_001358.2	NP_001349.2	O43143	DHX15_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 15	108					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|U12-type spliceosomal complex (GO:0005689)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)	p.H108H(1)		breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(5)|liver(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	30		Breast(46;0.0503)				GAAGTGACGTGTGACCTGCAT	0.463																																																	1	Substitution - coding silent(1)	upper_aerodigestive_tract(1)											299.0	279.0	286.0					4																	24578049		2203	4300	6503	SO:0001583	missense	0			AB001636	CCDS33966.1	4p15.3	2013-05-13	2013-05-13	2003-06-20	ENSG00000109606	ENSG00000109606		"""DEAH-boxes"""	2738	protein-coding gene	gene with protein product		603403	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 15"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 15"""	DDX15		9388478	Standard	NM_001358		Approved	HRH2, DBP1, PRP43, PrPp43p, PRPF43	uc003gqx.3	O43143	OTTHUMG00000160304	ENST00000336812.4:c.324C>A	4.37:g.24578049G>T	ENSP00000336741:p.His108Gln		Q9NQT7	Missense_Mutation	SNP	pfam_DUF1605,pfam_Helicase-assoc_dom,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.H108Q	ENST00000336812.4	37	c.324	CCDS33966.1	4	.	.	.	.	.	.	.	.	.	.	G	7.103	0.574387	0.13623	.	.	ENSG00000109606	ENST00000336812;ENST00000535946	T	0.09350	2.99	5.43	5.43	0.79202	.	0.000000	0.64402	D	0.000006	T	0.04815	0.0130	N	0.08118	0	0.29307	N	0.868297	B	0.02656	0.0	B	0.01281	0.0	T	0.34453	-0.9828	10	0.13470	T	0.59	-24.1698	7.5013	0.27520	0.0826:0.0:0.7059:0.2114	.	108	O43143	DHX15_HUMAN	Q	108;97	ENSP00000336741:H108Q	ENSP00000336741:H108Q	H	-	3	2	DHX15	24187147	1.000000	0.71417	1.000000	0.80357	0.890000	0.51754	3.705000	0.54823	2.546000	0.85860	0.655000	0.94253	CAC	DHX15	-	NULL	ENSG00000109606		0.463	DHX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX15	HGNC	protein_coding	OTTHUMT00000360143.1	-	0.00	109	0	G	NM_001358		24578049	-1	tier1	-	no_errors	ENST00000336812	ensembl	human	known	74_37	missense	6.90	54	4	SNP	1.000	T
DHX35	60625	genome.wustl.edu	37	20	37591011	37591012	+	Start_Codon_Ins	INS	-	-	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr20:37591011_37591012insT	ENST00000252011.3	+	0	34_35				DHX35_ENST00000373325.2_Start_Codon_Ins|RP4-616B8.4_ENST00000570096.1_RNA|DHX35_ENST00000373323.4_Start_Codon_Ins	NM_021931.3	NP_068750.2	Q9H5Z1	DHX35_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 35						mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(13)|ovary(1)|skin(2)|stomach(1)|urinary_tract(2)	40		Myeloproliferative disorder(115;0.00878)				TTACCCCAACATGGCTGCGCCC	0.713																																																	0																																										SO:0001582	initiator_codon_variant	0			AK026412	CCDS13310.1, CCDS54463.1	20q11.22-q12	2003-06-13	2003-06-13	2003-06-13	ENSG00000101452	ENSG00000101452		"""DEAH-boxes"""	15861	protein-coding gene	gene with protein product			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 35"""	C20orf15, DDX35			Standard	NM_001190809		Approved	FLJ22759, KAIA0875	uc002xjh.3	Q9H5Z1	OTTHUMG00000032463	ENST00000252011.3:c.2dupT	20.37:g.37591012_37591012dupT			A2RTX3|B4E0J0|F5GXM6|Q5THR0|Q9H4H7|Q9H6T6	Frame_Shift_Ins	INS	pfam_DUF1605,pfam_Helicase-assoc_dom,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.M1fs	ENST00000252011.3	37	c.1_2	CCDS13310.1	20																																																																																			DHX35	-	NULL	ENSG00000101452		0.713	DHX35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX35	HGNC	protein_coding	OTTHUMT00000079212.2		0.00	161	0	-	NM_021931		37591012	+1	tier1		no_errors	ENST00000252011	ensembl	human	known	74_37	frame_shift_ins	44.65	88	71	INS	1.000:1.000	T
DMD	1756	genome.wustl.edu	37	X	32613897	32613897	+	Missense_Mutation	SNP	C	C	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chrX:32613897C>T	ENST00000357033.4	-	13	1785	c.1579G>A	c.(1579-1581)Gct>Act	p.A527T	DMD_ENST00000288447.4_Missense_Mutation_p.A519T|DMD_ENST00000378677.2_Missense_Mutation_p.A523T	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	527			Missing (in BMD).		cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TCCAAAGCAGCAGTTGCGTGA	0.348																																																	0													146.0	117.0	127.0					X																	32613897		2202	4300	6502	SO:0001583	missense	0			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.1579G>A	X.37:g.32613897C>T	ENSP00000354923:p.Ala527Thr		E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_WW_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_dom,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_dom,pfscan_Znf_ZZ	p.A527T	ENST00000357033.4	37	c.1579	CCDS14233.1	X	.	.	.	.	.	.	.	.	.	.	C	25.1	4.603603	0.87157	.	.	ENSG00000198947	ENST00000534884;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280;ENST00000288447	T;T;T	0.50548	0.74;0.74;0.74	5.74	4.88	0.63580	.	0.201387	0.23263	N	0.050109	T	0.61615	0.2361	M	0.67953	2.075	0.80722	D	1	B;B;P;B	0.42908	0.013;0.003;0.793;0.003	B;B;P;B	0.54856	0.028;0.007;0.762;0.013	T	0.63629	-0.6594	10	0.72032	D	0.01	.	12.7514	0.57310	0.0:0.9178:0.0:0.0822	.	519;519;527;523	Q4G0X0;P11532-4;P11532;E9PDN5	.;.;DMD_HUMAN;.	T	519;523;527;527;404;519	ENSP00000367948:A523T;ENSP00000354923:A527T;ENSP00000288447:A519T	ENSP00000288447:A519T	A	-	1	0	DMD	32523818	1.000000	0.71417	0.997000	0.53966	0.980000	0.70556	5.447000	0.66606	1.177000	0.42855	0.538000	0.68166	GCT	DMD	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin,pirsf_Dystrophin/utrophin	ENSG00000198947		0.348	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMD	HGNC	protein_coding	OTTHUMT00000056182.2	-	0.00	61	0	C	NM_004006		32613897	-1	tier1	-	no_errors	ENST00000357033	ensembl	human	known	74_37	missense	8.70	42	4	SNP	1.000	T
DMXL1	1657	genome.wustl.edu	37	5	118485616	118485616	+	Missense_Mutation	SNP	C	C	G			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr5:118485616C>G	ENST00000311085.8	+	18	4174	c.4094C>G	c.(4093-4095)tCt>tGt	p.S1365C	DMXL1_ENST00000539542.1_Missense_Mutation_p.S1365C	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	1365										breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		GAAGCTGAATCTAATCATGAA	0.473																																																	0													82.0	81.0	82.0					5																	118485616		2202	4299	6501	SO:0001583	missense	0			AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.4094C>G	5.37:g.118485616C>G	ENSP00000309690:p.Ser1365Cys			Missense_Mutation	SNP	pfam_Rav1p_C,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S1365C	ENST00000311085.8	37	c.4094	CCDS4125.1	5	.	.	.	.	.	.	.	.	.	.	C	15.42	2.827054	0.50739	.	.	ENSG00000172869	ENST00000311085;ENST00000539542	T;T	0.44881	0.91;0.91	5.56	4.69	0.59074	.	0.269872	0.44285	D	0.000465	T	0.54078	0.1836	L	0.47716	1.5	0.36582	D	0.87359	D;D	0.69078	0.997;0.996	P;P	0.62649	0.846;0.905	T	0.63673	-0.6584	10	0.54805	T	0.06	-2.0893	13.7366	0.62821	0.0:0.926:0.0:0.074	.	1365;1365	F5H269;Q9Y485	.;DMXL1_HUMAN	C	1365	ENSP00000309690:S1365C;ENSP00000439479:S1365C	ENSP00000309690:S1365C	S	+	2	0	DMXL1	118513515	1.000000	0.71417	0.988000	0.46212	0.935000	0.57460	2.766000	0.47629	1.493000	0.48517	0.655000	0.94253	TCT	DMXL1	-	pfam_Rav1p_C	ENSG00000172869		0.473	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMXL1	HGNC	protein_coding	OTTHUMT00000250862.1	-	0.00	66	0	C	NM_005509		118485616	+1	tier1	-	no_errors	ENST00000539542	ensembl	human	known	74_37	missense	34.62	34	18	SNP	0.996	G
DNM1L	10059	genome.wustl.edu	37	12	32884819	32884819	+	Missense_Mutation	SNP	C	C	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr12:32884819C>T	ENST00000549701.1	+	12	1462	c.1388C>T	c.(1387-1389)gCc>gTc	p.A463V	DNM1L_ENST00000547312.1_Missense_Mutation_p.A463V|DNM1L_ENST00000553257.1_Missense_Mutation_p.A476V|DNM1L_ENST00000452533.2_Missense_Mutation_p.A463V|DNM1L_ENST00000381000.4_Missense_Mutation_p.A476V|DNM1L_ENST00000358214.5_Missense_Mutation_p.A476V|DNM1L_ENST00000266481.6_Missense_Mutation_p.A463V|DNM1L_ENST00000414834.2_Missense_Mutation_p.A260V|YARS2_ENST00000551673.1_Intron			O00429	DNM1L_HUMAN	dynamin 1-like	463	Interaction with GSK3B.|Middle domain.				apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|dynamin polymerization involved in mitochondrial fission (GO:0003374)|endocytosis (GO:0006897)|GTP catabolic process (GO:0006184)|membrane fission involved in mitochondrial fission (GO:0090149)|membrane fusion (GO:0061025)|mitochondrial fission (GO:0000266)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mitochondrion morphogenesis (GO:0070584)|necroptotic process (GO:0070266)|peroxisome fission (GO:0016559)|positive regulation of apoptotic process (GO:0043065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial fission (GO:0090141)|positive regulation of protein secretion (GO:0050714)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|protein homotetramerization (GO:0051289)|protein localization to mitochondrion (GO:0070585)|regulation of mitochondrion organization (GO:0010821)|regulation of peroxisome organization (GO:1900063)|regulation of protein oligomerization (GO:0032459)|release of cytochrome c from mitochondria (GO:0001836)	cell junction (GO:0030054)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|microtubule (GO:0005874)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)|protein complex (GO:0043234)|synapse (GO:0045202)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|lipid binding (GO:0008289)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)			cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|pancreas(1)|prostate(1)	23	Lung NSC(5;2.15e-06)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)					CTTCATGATGCCATAGTTGAA	0.318																																																	0													176.0	156.0	163.0					12																	32884819		2203	4300	6503	SO:0001583	missense	0			AF000430	CCDS8728.1, CCDS8729.1, CCDS8730.1, CCDS61095.1, CCDS61096.1, CCDS61098.1, CCDS61099.1	12p11.21	2012-10-02			ENSG00000087470	ENSG00000087470			2973	protein-coding gene	gene with protein product		603850				9348079, 9731200	Standard	NM_012062		Approved	DRP1, DVLP, HDYNIV, DYMPLE, VPS1	uc001rld.2	O00429	OTTHUMG00000169451	ENST00000549701.1:c.1388C>T	12.37:g.32884819C>T	ENSP00000450399:p.Ala463Val		A8K4X9|B4DGC9|B4DSU8|J3KPI2|O14541|O60709|Q59GN9|Q7L6B3|Q8TBT7|Q9BWM1|Q9Y5J2	Missense_Mutation	SNP	pfam_Dynamin_central,pfam_Dynamin_GTPase,pfam_GED,superfamily_P-loop_NTPase,smart_Dynamin_GTPase,smart_GED,prints_Dynamin_SF	p.A476V	ENST00000549701.1	37	c.1427	CCDS8729.1	12	.	.	.	.	.	.	.	.	.	.	C	23.8	4.453437	0.84209	.	.	ENSG00000087470	ENST00000452533;ENST00000411996;ENST00000266479;ENST00000553257;ENST00000549701;ENST00000358214;ENST00000266481;ENST00000547312;ENST00000414834;ENST00000381000	T;T;T;T;T;T;T;T	0.74421	-0.84;-0.84;-0.84;-0.84;-0.84;-0.84;-0.84;-0.84	5.07	5.07	0.68467	Dynamin central domain (1);	0.000000	0.85682	D	0.000000	D	0.82655	0.5084	M	0.71871	2.18	0.80722	D	1	P;B;B;B;B;B	0.42584	0.784;0.302;0.302;0.382;0.152;0.146	P;B;B;B;B;B	0.51657	0.676;0.315;0.41;0.149;0.158;0.297	D	0.84597	0.0670	10	0.72032	D	0.01	.	18.8176	0.92084	0.0:1.0:0.0:0.0	.	260;516;516;529;516;463	B4DGC9;D3DUW6;D3DUW5;F8W8D1;D3DUW7;O00429	.;.;.;.;.;DNM1L_HUMAN	V	463;529;463;476;463;476;463;463;260;476	ENSP00000415131:A463V;ENSP00000449089:A476V;ENSP00000450399:A463V;ENSP00000350948:A476V;ENSP00000266481:A463V;ENSP00000448610:A463V;ENSP00000404160:A260V;ENSP00000370388:A476V	ENSP00000266479:A463V	A	+	2	0	DNM1L	32776086	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.336000	0.79245	2.516000	0.84829	0.655000	0.94253	GCC	DNM1L	-	pfam_Dynamin_central	ENSG00000087470		0.318	DNM1L-003	KNOWN	basic|CCDS	protein_coding	DNM1L	HGNC	protein_coding	OTTHUMT00000404124.1	-	0.00	46	0	C	NM_012062		32884819	+1	tier1	-	no_errors	ENST00000553257	ensembl	human	known	74_37	missense	8.00	46	4	SNP	1.000	T
DSG1	1828	genome.wustl.edu	37	18	28914092	28914092	+	Missense_Mutation	SNP	C	C	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr18:28914092C>A	ENST00000257192.4	+	8	1144	c.932C>A	c.(931-933)tCt>tAt	p.S311Y		NM_001942.2	NP_001933.2	Q02413	DSG1_HUMAN	desmoglein 1	311	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell-cell junction assembly (GO:0007043)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)|maternal process involved in female pregnancy (GO:0060135)|protein stabilization (GO:0050821)|response to progesterone (GO:0032570)|single organismal cell-cell adhesion (GO:0016337)	apical plasma membrane (GO:0016324)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)|toxic substance binding (GO:0015643)			NS(2)|central_nervous_system(2)|endometrium(5)|kidney(7)|large_intestine(11)|lung(36)|ovary(3)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)	76			OV - Ovarian serous cystadenocarcinoma(10;0.00559)			TTCTTTATCTCTGGAAATGAA	0.294																																																	0													66.0	75.0	72.0					18																	28914092		2202	4293	6495	SO:0001583	missense	0			X56654	CCDS11896.1	18q12.1	2014-05-13			ENSG00000134760	ENSG00000134760		"""Cadherins / Major cadherins"""	3048	protein-coding gene	gene with protein product		125670		DSG		1889810	Standard	NM_001942		Approved	CDHF4	uc002kwp.3	Q02413	OTTHUMG00000131983	ENST00000257192.4:c.932C>A	18.37:g.28914092C>A	ENSP00000257192:p.Ser311Tyr		B7Z845	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Desmoglein,prints_Cadherin,prints_Desmosomal_cadherin	p.S311Y	ENST00000257192.4	37	c.932	CCDS11896.1	18	.	.	.	.	.	.	.	.	.	.	C	24.4	4.531250	0.85706	.	.	ENSG00000134760	ENST00000257192	T	0.43294	0.95	5.79	5.79	0.91817	Cadherin (4);Cadherin-like (1);	0.093242	0.47852	D	0.000206	T	0.75302	0.3831	M	0.94101	3.495	0.80722	D	1	D	0.76494	0.999	D	0.76071	0.987	T	0.81364	-0.0966	10	0.87932	D	0	.	20.0417	0.97594	0.0:1.0:0.0:0.0	.	311	Q02413	DSG1_HUMAN	Y	311	ENSP00000257192:S311Y	ENSP00000257192:S311Y	S	+	2	0	DSG1	27168090	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.459000	0.73513	2.736000	0.93811	0.655000	0.94253	TCT	DSG1	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000134760		0.294	DSG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSG1	HGNC	protein_coding	OTTHUMT00000254947.1	-	0.00	120	0	C	NM_001942		28914092	+1	tier1	-	no_errors	ENST00000257192	ensembl	human	known	74_37	missense	5.88	80	5	SNP	1.000	A
DUSP10	11221	genome.wustl.edu	37	1	221875662	221875662	+	3'UTR	DEL	A	A	-	rs3215279		TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr1:221875662delA	ENST00000366899.3	-	0	1779				DUSP10_ENST00000468085.1_5'UTR|DUSP10_ENST00000544095.1_3'UTR|DUSP10_ENST00000323825.3_3'UTR	NM_007207.4	NP_009138.1	Q9Y6W6	DUS10_HUMAN	dual specificity phosphatase 10						inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of respiratory burst involved in inflammatory response (GO:0060266)|oligodendrocyte differentiation (GO:0048709)|protein dephosphorylation (GO:0006470)|regulation of adaptive immune response (GO:0002819)|response to lipopolysaccharide (GO:0032496)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	MAP kinase phosphatase activity (GO:0033549)|MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|phosphatase activity (GO:0016791)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				GBM - Glioblastoma multiforme(131;0.0103)		TCCCAACTACAAAAAAAAAAA	0.348																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AB026436	CCDS1528.1	1q41	2011-06-09			ENSG00000143507	ENSG00000143507		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3065	protein-coding gene	gene with protein product		608867				10391943, 10597297	Standard	NM_007207		Approved	MKP-5, MKP5	uc001hmy.2	Q9Y6W6	OTTHUMG00000037269	ENST00000366899.3:c.*92T>-	1.37:g.221875662delA			D3DTB4|Q6GSI4|Q9H9Z5	RNA	DEL	-	NULL	ENST00000366899.3	37	NULL	CCDS1528.1	1																																																																																			DUSP10	-	-	ENSG00000143507		0.348	DUSP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP10	HGNC	protein_coding	OTTHUMT00000090716.1		0.00	29	0	A	NM_007207		221875662	-1	tier1		no_errors	ENST00000468085	ensembl	human	known	74_37	rna	18.18	18	4	DEL	0.040	-
EED	8726	genome.wustl.edu	37	11	85966330	85966330	+	Splice_Site	SNP	G	G	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr11:85966330G>T	ENST00000263360.6	+	4	1112		c.e4+1		EED_ENST00000351625.6_Splice_Site|EED_ENST00000327320.4_Splice_Site|EED_ENST00000528180.1_Splice_Site	NM_003797.3	NP_003788.2	O75530	EED_HUMAN	embryonic ectoderm development						negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K27 methylation (GO:0061087)|regulation of gene expression by genetic imprinting (GO:0006349)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|ESC/E(Z) complex (GO:0035098)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)|sex chromatin (GO:0001739)	chromatin binding (GO:0003682)|histone methyltransferase activity (GO:0042054)|identical protein binding (GO:0042802)			haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	21		Acute lymphoblastic leukemia(157;7.24e-07)|all_hematologic(158;0.00092)				GGATGCTGATGTATCCTTTCC	0.299																																																	0													99.0	90.0	93.0					11																	85966330		2202	4297	6499	SO:0001630	splice_region_variant	0			AF078933	CCDS8273.1, CCDS8274.1	11q14.2-q22.3	2013-01-10			ENSG00000074266	ENSG00000074266		"""WD repeat domain containing"""	3188	protein-coding gene	gene with protein product	"""WD protein associating with integrin cytoplasmic tails 1"""	605984				9765275, 9806832	Standard	NM_003797		Approved	WAIT-1, HEED	uc001pbp.3	O75530	OTTHUMG00000167209	ENST00000263360.6:c.426+1G>T	11.37:g.85966330G>T			A8K7V5|O00149|Q6NTH2|Q7LDA5|Q7LDG8|Q86VV2|Q9UNY7	Splice_Site	SNP	-	e4+1	ENST00000263360.6	37	c.426+1	CCDS8273.1	11	.	.	.	.	.	.	.	.	.	.	G	24.4	4.531260	0.85706	.	.	ENSG00000074266	ENST00000263360;ENST00000528180;ENST00000351625;ENST00000327320;ENST00000537092	.	.	.	5.44	5.44	0.79542	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.2736	0.94021	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	EED	85643978	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.298000	0.96132	2.563000	0.86464	0.467000	0.42956	.	EED	-	-	ENSG00000074266		0.299	EED-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EED	HGNC	protein_coding	OTTHUMT00000393733.1	-	0.00	85	0	G	NM_003797	Intron	85966330	+1	tier1	-	no_errors	ENST00000263360	ensembl	human	known	74_37	splice_site	7.02	53	4	SNP	1.000	T
EFCAB14	9813	genome.wustl.edu	37	1	47183662	47183662	+	Missense_Mutation	SNP	C	C	T	rs200133048		TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr1:47183662C>T	ENST00000371933.3	-	1	1074	c.98G>A	c.(97-99)cGc>cAc	p.R33H	EFCAB14_ENST00000544071.1_Missense_Mutation_p.R33H	NM_014774.2	NP_055589.1	O75071	EFC14_HUMAN	EF-hand calcium binding domain 14	33							calcium ion binding (GO:0005509)										AGGCTCAGTGCGAAGCAGGCG	0.537																																																	0													81.0	78.0	79.0					1																	47183662		2203	4300	6503	SO:0001583	missense	0			AB007963	CCDS30706.1	1p33	2013-01-10	2012-11-29	2012-11-29	ENSG00000159658	ENSG00000159658		"""EF-hand domain containing"""	29051	protein-coding gene	gene with protein product			"""KIAA0494"""	KIAA0494		9455484	Standard	NM_014774		Approved		uc001cqk.4	O75071	OTTHUMG00000007992	ENST00000371933.3:c.98G>A	1.37:g.47183662C>T	ENSP00000361001:p.Arg33His		D3DQ23|Q5SXB8	Missense_Mutation	SNP	pfscan_EF_hand_dom	p.R33H	ENST00000371933.3	37	c.98	CCDS30706.1	1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.127894	0.77549	.	.	ENSG00000159658	ENST00000544071;ENST00000371933	T;T	0.52057	0.68;1.57	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	T	0.63674	0.2531	L	0.42245	1.32	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.997;0.997;0.997	T	0.64668	-0.6353	10	0.72032	D	0.01	-2.8666	19.1736	0.93590	0.0:1.0:0.0:0.0	.	33;33;33	F5H7K3;B7Z444;O75071	.;.;K0494_HUMAN	H	33	ENSP00000442465:R33H;ENSP00000361001:R33H	ENSP00000361001:R33H	R	-	2	0	KIAA0494	46956249	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	6.304000	0.72800	2.836000	0.97738	0.655000	0.94253	CGC	EFCAB14	-	NULL	ENSG00000159658		0.537	EFCAB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFCAB14	HGNC	protein_coding	OTTHUMT00000021931.1		0.00	47	0	C	NM_014774		47183662	-1			no_errors	ENST00000371933	ensembl	human	known	74_37	missense	6.45	29	2	SNP	1.000	T
EFTUD2	9343	genome.wustl.edu	37	17	42953336	42953336	+	Missense_Mutation	SNP	G	G	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr17:42953336G>A	ENST00000426333.2	-	10	1132	c.835C>T	c.(835-837)Cgc>Tgc	p.R279C	EFTUD2_ENST00000592576.1_Missense_Mutation_p.R269C|EFTUD2_ENST00000591382.1_Missense_Mutation_p.R279C|EFTUD2_ENST00000402521.3_Missense_Mutation_p.R244C	NM_001142605.1|NM_001258354.1|NM_004247.3	NP_001136077.1|NP_001245283.1|NP_004238.3	Q15029	U5S1_HUMAN	elongation factor Tu GTP binding domain containing 2	279	tr-type G. {ECO:0000255|PROSITE- ProRule:PRU01059}.				gene expression (GO:0010467)|GTP catabolic process (GO:0006184)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(9)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	32		Prostate(33;0.109)				ACAATGTGGCGCAGCTTGTAA	0.512																																					Ovarian(10;65 485 10258 29980 30707)												0													197.0	183.0	188.0					17																	42953336		2203	4300	6503	SO:0001583	missense	0			D21163	CCDS11489.1, CCDS45707.1, CCDS59295.1	17q21.31	2014-08-12			ENSG00000108883	ENSG00000108883			30858	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 116 kD"""	603892				9233818	Standard	NM_004247		Approved	U5-116KD, Snrp116, Snu114, SNRNP116	uc002ihn.2	Q15029	OTTHUMG00000179865	ENST00000426333.2:c.835C>T	17.37:g.42953336G>A	ENSP00000392094:p.Arg279Cys		B4DK30|B4DMC0|D3DX58|K7EJ81|Q9BUR0	Missense_Mutation	SNP	pfam_EF_GTP-bd_dom,pfam_Transl_elong_EFG/EF2_IV,pfam_EFG_V,pfam_Transl_elong_EFTu/EF1A_2,pfam_MIRO-like,superfamily_P-loop_NTPase,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_Transl_B-barrel,superfamily_EFG_III-V,smart_Transl_elong_EFG/EF2_IV,smart_EFG_V,prints_EF_GTP-bd_dom,tigrfam_Small_GTP-bd_dom	p.R279C	ENST00000426333.2	37	c.835	CCDS11489.1	17	.	.	.	.	.	.	.	.	.	.	G	18.04	3.534242	0.64972	.	.	ENSG00000108883	ENST00000426333;ENST00000262414;ENST00000402521	T;T	0.77750	-1.12;-1.12	4.96	4.96	0.65561	Protein synthesis factor, GTP-binding (1);	0.000000	0.85682	D	0.000000	D	0.84460	0.5477	L	0.60845	1.875	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.65140	0.932;0.932	D	0.85331	0.1090	10	0.59425	D	0.04	-10.7074	14.8502	0.70292	0.0:0.0:0.8561:0.1438	.	269;279	B4DMC0;Q15029	.;U5S1_HUMAN	C	279;269;244	ENSP00000392094:R279C;ENSP00000385873:R244C	ENSP00000262414:R269C	R	-	1	0	EFTUD2	40308862	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	4.300000	0.59079	2.589000	0.87451	0.591000	0.81541	CGC	EFTUD2	-	pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase	ENSG00000108883		0.512	EFTUD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	EFTUD2	HGNC	protein_coding	OTTHUMT00000448672.1		0.00	89	0	G	NM_004247		42953336	-1			no_errors	ENST00000426333	ensembl	human	known	74_37	missense	6.25	44	3	SNP	1.000	A
EIF4G2	1982	genome.wustl.edu	37	11	10828881	10828881	+	De_novo_Start_OutOfFrame	SNP	T	T	C			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr11:10828881T>C	ENST00000526148.1	-	0	472				EIF4G2_ENST00000525681.1_De_novo_Start_OutOfFrame|RP11-685M7.3_ENST00000499765.1_RNA|EIF4G2_ENST00000339995.5_De_novo_Start_OutOfFrame|EIF4G2_ENST00000525995.1_Intron|EIF4G2_ENST00000396525.2_De_novo_Start_OutOfFrame	NM_001172705.1	NP_001166176			eukaryotic translation initiation factor 4 gamma, 2											NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	43				all cancers(16;2.8e-07)|Epithelial(150;4.18e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)		AAAAGAATAATATTAATAGAT	0.428																																																	0													54.0	64.0	60.0					11																	10828881		2201	4294	6495			0			U73824	CCDS31428.1, CCDS41618.1	11p15	2005-09-29			ENSG00000110321	ENSG00000110321			3297	protein-coding gene	gene with protein product		602325				9030685, 9032289	Standard	NM_001042559		Approved	DAP5, NAT1, p97	uc001mjc.3	P78344	OTTHUMG00000165823	ENST00000526148.1:c.-39A>G	11.37:g.10828881T>C				RNA	SNP	-	NULL	ENST00000526148.1	37	NULL	CCDS31428.1	11	.	.	.	.	.	.	.	.	.	.	T	29.5	5.009505	0.93346	.	.	ENSG00000110321	ENST00000429377	.	.	.	5.17	5.17	0.71159	.	.	.	.	.	T	0.27629	0.0679	.	.	.	.	.	.	.	.	.	.	.	.	T	0.29549	-1.0008	4	0.06625	T	0.88	.	9.13	0.36839	0.277:0.0:0.0:0.723	.	.	.	.	V	61	.	ENSP00000399908:I61V	I	-	1	0	EIF4G2	10785457	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.243000	0.32767	2.078000	0.62432	0.528000	0.53228	ATT	EIF4G2	-	-	ENSG00000110321		0.428	EIF4G2-006	KNOWN	alternative_5_UTR|non_ATG_start|basic|CCDS	protein_coding	EIF4G2	HGNC	protein_coding	OTTHUMT00000386603.1	-	0.00	72	0	T	NM_001418		10828881	-1	tier1	-	no_errors	ENST00000531507	ensembl	human	known	74_37	rna	31.71	28	13	SNP	1.000	C
EI24	9538	genome.wustl.edu	37	11	125448944	125448944	+	Nonsense_Mutation	SNP	C	C	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr11:125448944C>T	ENST00000278903.6	+	7	783	c.541C>T	c.(541-543)Cag>Tag	p.Q181*	STT3A-AS1_ENST00000530526.1_RNA|STT3A-AS1_ENST00000532714.1_RNA|EI24_ENST00000530985.1_3'UTR|EI24_ENST00000343678.4_Nonsense_Mutation_p.Q181*	NM_004879.3	NP_004870.3	O14681	EI24_HUMAN	etoposide induced 2.4	181					apoptotic process (GO:0006915)|autophagy (GO:0006914)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of cell growth (GO:0030308)|neuromuscular process controlling balance (GO:0050885)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|response to drug (GO:0042493)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				large_intestine(1)|lung(9)|ovary(1)	11	all_hematologic(175;0.228)	Breast(109;0.0021)|Lung NSC(97;0.0126)|all_lung(97;0.0132)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.64e-07)|OV - Ovarian serous cystadenocarcinoma(99;0.0975)		CCTTTTGCTGCAGGCTCTTTT	0.443																																																	0													69.0	58.0	61.0					11																	125448944		1863	4104	5967	SO:0001587	stop_gained	0			AF010313	CCDS73410.1	11q24.2	2012-11-19	2012-11-16		ENSG00000149547	ENSG00000149547			13276	protein-coding gene	gene with protein product	"""ectopic P-granules autophagy protein 4 homolog (C. elegans)"""	605170	"""etoposide induced 2.4 mRNA"""			10594026, 9305847	Standard	NM_001290135		Approved	PIG8, TP53I8, EPG4	uc001qcb.3	O14681	OTTHUMG00000165851	ENST00000278903.6:c.541C>T	11.37:g.125448944C>T	ENSP00000278903:p.Gln181*		A8K7D6|B4DKL6|Q9BUQ1	Nonsense_Mutation	SNP	NULL	p.Q181*	ENST00000278903.6	37	c.541		11	.	.	.	.	.	.	.	.	.	.	C	36	5.851730	0.97023	.	.	ENSG00000149547	ENST00000278903;ENST00000343678;ENST00000527842	.	.	.	5.25	5.25	0.73442	.	0.051386	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	-25.7297	17.009	0.86400	0.0:1.0:0.0:0.0	.	.	.	.	X	181	.	ENSP00000278903:Q181X	Q	+	1	0	EI24	124954154	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	7.210000	0.77924	2.615000	0.88500	0.650000	0.86243	CAG	EI24	-	NULL	ENSG00000149547		0.443	EI24-201	KNOWN	basic|appris_principal	protein_coding	EI24	HGNC	protein_coding		-	0.00	61	0	C	NM_004879		125448944	+1	tier1	-	no_errors	ENST00000278903	ensembl	human	known	74_37	nonsense	8.89	41	4	SNP	1.000	T
LINC01597	400841	genome.wustl.edu	37	20	29516551	29516551	+	lincRNA	SNP	C	C	G			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr20:29516551C>G	ENST00000380888.3	-	0	358																											gacctctccacggggtcgacg	0.617																																																	0																																												0																															20.37:g.29516551C>G				RNA	SNP	-	NULL	ENST00000380888.3	37	NULL		20																																																																																			RP4-610C12.4	-	-	ENSG00000205611		0.617	RP4-610C12.4-001	KNOWN	basic	lincRNA	ENSG00000205611	Clone_based_vega_gene	lincRNA	OTTHUMT00000256907.1	-	0.00	130	0	C			29516551	-1	tier1	-	no_errors	ENST00000380888	ensembl	human	known	74_37	rna	45.45	42	35	SNP	0.038	G
RP11-764K9.1	0	genome.wustl.edu	37	9	68400604	68400604	+	lincRNA	DEL	G	G	-			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr9:68400604delG	ENST00000417843.2	-	0	1215																											ggaaggggctggttttgtttt	0.433																																																	0																																												0																															9.37:g.68400604delG				RNA	DEL	-	NULL	ENST00000417843.2	37	NULL		9																																																																																			RP11-764K9.1	-	-	ENSG00000225411		0.433	RP11-764K9.1-001	KNOWN	basic	lincRNA	ENSG00000225411	Clone_based_vega_gene	lincRNA	OTTHUMT00000129817.2		0.00	8	0	G			68400604	-1	tier1		no_errors	ENST00000417843	ensembl	human	known	74_37	rna	33.33	6	3	DEL	0.021	-
LINC01347	731275	genome.wustl.edu	37	1	243211070	243211070	+	lincRNA	SNP	C	C	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr1:243211070C>T	ENST00000450226.1	-	0	187																											AGGCAGCTTTCATTTTATAAA	0.373																																																	0																																												0																															1.37:g.243211070C>T				RNA	SNP	-	NULL	ENST00000450226.1	37	NULL		1																																																																																			RP11-261C10.2	-	-	ENSG00000231512		0.373	RP11-261C10.2-003	KNOWN	basic	lincRNA	ENSG00000231512	Clone_based_vega_gene	lincRNA	OTTHUMT00000096161.1	-	0.00	201	0	C			243211070	-1	tier1	-	no_errors	ENST00000420830	ensembl	human	known	74_37	rna	24.00	95	30	SNP	1.000	T
RP11-480A16.1	0	genome.wustl.edu	37	3	195677979	195677979	+	lincRNA	SNP	T	T	C			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr3:195677979T>C	ENST00000570130.1	-	0	1587																											agcgactccattgggaccacg	0.547																																																	0																																												0																															3.37:g.195677979T>C				RNA	SNP	-	NULL	ENST00000570130.1	37	NULL		3																																																																																			RP11-480A16.1	-	-	ENSG00000260261		0.547	RP11-480A16.1-001	KNOWN	basic	lincRNA	ENSG00000260261	Clone_based_vega_gene	lincRNA	OTTHUMT00000431190.1	-	0.00	8	0	T			195677979	-1	tier1	-	no_errors	ENST00000570130	ensembl	human	known	74_37	rna	44.44	5	4	SNP	0.001	C
C16orf46	123775	genome.wustl.edu	37	16	81087509	81087509	+	3'UTR	SNP	G	G	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr16:81087509G>T	ENST00000378611.4	-	0	1449				RP11-303E16.8_ENST00000564536.1_RNA|RP11-303E16.5_ENST00000562450.1_RNA	NM_001100873.1	NP_001094343.1	Q6P387	CP046_HUMAN	chromosome 16 open reading frame 46							cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|endometrium(2)|large_intestine(3)|lung(9)|prostate(1)|stomach(1)|urinary_tract(1)	18						GTGTAAATAAGACCTTGCTCC	0.478																																																	0																																										SO:0001624	3_prime_UTR_variant	0			BC064143	CCDS10932.1, CCDS42201.1	16q23.2	2012-10-09			ENSG00000166455	ENSG00000166455			26525	protein-coding gene	gene with protein product							Standard	NM_152337		Approved	FLJ32702	uc002fgc.4	Q6P387	OTTHUMG00000137629	ENST00000378611.4:c.*167C>A	16.37:g.81087509G>T			Q96MA7	RNA	SNP	-	NULL	ENST00000378611.4	37	NULL	CCDS42201.1	16																																																																																			RP11-303E16.8	-	-	ENSG00000260643		0.478	C16orf46-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ENSG00000260643	Clone_based_vega_gene	protein_coding	OTTHUMT00000269055.1	-	0.00	19	0	G	NM_152337		81087509	-1	tier1	-	no_errors	ENST00000564536	ensembl	human	known	74_37	rna	36.36	7	4	SNP	0.027	T
FADS2	9415	genome.wustl.edu	37	11	61605250	61605250	+	Splice_Site	SNP	G	G	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr11:61605250G>T	ENST00000278840.4	+	2	838	c.208G>T	c.(208-210)Gat>Tat	p.D70Y	FADS2_ENST00000257261.6_Splice_Site_p.D48Y|FADS2_ENST00000521849.1_Splice_Site_p.D70Y|FADS2_ENST00000522056.1_Splice_Site_p.D39Y	NM_004265.2	NP_004256.1	O95864	FADS2_HUMAN	fatty acid desaturase 2	70	Cytochrome b5 heme-binding. {ECO:0000255|PROSITE-ProRule:PRU00279}.				alpha-linolenic acid metabolic process (GO:0036109)|linoleic acid metabolic process (GO:0043651)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid biosynthetic process (GO:0006636)|unsaturated fatty acid metabolic process (GO:0033559)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|stearoyl-CoA 9-desaturase activity (GO:0004768)			breast(2)|kidney(2)|large_intestine(4)|liver(1)|lung(2)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	20					Alpha-Linolenic Acid(DB00132)	TGCTCTCCAGGATGCCTTCCG	0.597																																																	0													63.0	44.0	51.0					11																	61605250		2202	4299	6501	SO:0001630	splice_region_variant	0			AF084559	CCDS8012.1, CCDS60807.1, CCDS60808.1	11q12.2	2013-01-25			ENSG00000134824	ENSG00000134824	1.14.19.3	"""Fatty acid desaturases"""	3575	protein-coding gene	gene with protein product	"""delta-6-desaturase"""	606149		LLCDL2			Standard	NM_004265		Approved	FADSD6, D6D, TU13, DES6, SLL0262	uc001nsl.1	O95864	OTTHUMG00000163794	ENST00000278840.4:c.208-1G>T	11.37:g.61605250G>T			A8K2M6|B7Z634|Q6MZQ7|Q96H07|Q96SV8|Q9H3G3|Q9Y3X4	Missense_Mutation	SNP	pfam_Fatty_acid_desaturase-1,pfam_Cyt_B5-like_heme/steroid-bd,superfamily_Cyt_B5-like_heme/steroid-bd,pirsf_Fatty_acid/sphinglp_desaturase,pfscan_Cyt_B5-like_heme/steroid-bd	p.D70Y	ENST00000278840.4	37	c.208	CCDS8012.1	11	.	.	.	.	.	.	.	.	.	.	G	19.41	3.822201	0.71028	.	.	ENSG00000134824	ENST00000257261;ENST00000522056;ENST00000278840;ENST00000521849	T;T;T;T	0.80909	1.29;1.55;-1.43;-1.43	4.89	4.89	0.63831	Cytochrome b5 (4);	0.246855	0.34223	N	0.004145	D	0.91774	0.7398	M	0.91872	3.25	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.999;1.0	D;D;D;D	0.79108	0.987;0.992;0.981;0.992	D	0.93352	0.6719	9	.	.	.	-18.5909	17.8614	0.88783	0.0:0.0:1.0:0.0	.	39;70;70;48	B7Z634;O95864;O95864-3;O95864-2	.;FADS2_HUMAN;.;.	Y	48;39;70;70	ENSP00000257261:D48Y;ENSP00000429500:D39Y;ENSP00000278840:D70Y;ENSP00000431091:D70Y	.	D	+	1	0	FADS2	61361826	1.000000	0.71417	1.000000	0.80357	0.416000	0.31233	8.803000	0.91915	2.534000	0.85438	0.655000	0.94253	GAT	FADS2	-	pfam_Cyt_B5-like_heme/steroid-bd,superfamily_Cyt_B5-like_heme/steroid-bd,pirsf_Fatty_acid/sphinglp_desaturase,pfscan_Cyt_B5-like_heme/steroid-bd	ENSG00000134824		0.597	FADS2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FADS2	HGNC	protein_coding	OTTHUMT00000375586.2		0.00	87	0	G	NM_004265	Missense_Mutation	61605250	+1			no_errors	ENST00000278840	ensembl	human	known	74_37	missense	5.00	76	4	SNP	1.000	T
FAM126B	285172	genome.wustl.edu	37	2	201887609	201887609	+	Missense_Mutation	SNP	C	C	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr2:201887609C>A	ENST00000418596.3	-	4	285	c.98G>T	c.(97-99)cGg>cTg	p.R33L	FAM126B_ENST00000485144.1_5'Flank	NM_173822.3	NP_776183.1	Q8IXS8	F126B_HUMAN	family with sequence similarity 126, member B	33						intracellular (GO:0005622)				endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	16						TGTTTTTTTCCGGTGTAAAGT	0.353																																																	0													118.0	116.0	117.0					2																	201887609		2203	4300	6503	SO:0001583	missense	0			BC039295	CCDS2335.1	2q33.1	2008-10-02			ENSG00000155744	ENSG00000155744			28593	protein-coding gene	gene with protein product						12477932	Standard	NM_173822		Approved	MGC39518, HYCC2	uc002uws.4	Q8IXS8	OTTHUMG00000132823	ENST00000418596.3:c.98G>T	2.37:g.201887609C>A	ENSP00000393667:p.Arg33Leu		B2RCG7|Q4ZG87|Q53TX6	Missense_Mutation	SNP	pfam_Hyccin	p.R33L	ENST00000418596.3	37	c.98	CCDS2335.1	2	.	.	.	.	.	.	.	.	.	.	C	13.02	2.110910	0.37242	.	.	ENSG00000155744	ENST00000418596;ENST00000452799;ENST00000453765;ENST00000446678	T;T;T;T	0.78003	-1.09;-1.09;-1.09;-1.14	5.39	5.39	0.77823	.	0.078821	0.53938	D	0.000049	T	0.61311	0.2337	N	0.03608	-0.345	0.46061	D	0.998842	B	0.06786	0.001	B	0.09377	0.004	T	0.57820	-0.7745	10	0.51188	T	0.08	-9.9922	19.5147	0.95159	0.0:1.0:0.0:0.0	.	33	Q8IXS8	F126B_HUMAN	L	33	ENSP00000393667:R33L;ENSP00000401905:R33L;ENSP00000408374:R33L;ENSP00000412139:R33L	ENSP00000286181:R33L	R	-	2	0	FAM126B	201595854	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.183000	0.42565	2.660000	0.90430	0.655000	0.94253	CGG	FAM126B	-	pfam_Hyccin	ENSG00000155744		0.353	FAM126B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM126B	HGNC	protein_coding	OTTHUMT00000256285.3		0.00	93	0	C	NM_173822		201887609	-1			no_errors	ENST00000418596	ensembl	human	known	74_37	missense	5.56	68	4	SNP	1.000	A
FAM127A	8933	genome.wustl.edu	37	X	134167513	134167513	+	3'UTR	SNP	A	A	G			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chrX:134167513A>G	ENST00000257013.7	+	0	1181				FAM127A_ENST00000464369.1_3'UTR	NM_001078171.1	NP_001071639.1	O15255	CXX1_HUMAN	family with sequence similarity 127, member A							plasma membrane (GO:0005886)				endometrium(3)|urinary_tract(1)	4	Acute lymphoblastic leukemia(192;0.000127)					CTCTGCTCTAATACACTACCT	0.393																																																	0																																										SO:0001624	3_prime_UTR_variant	0			Y13374	CCDS43997.1	Xq26	2014-05-16	2006-11-16	2006-11-16	ENSG00000134590	ENSG00000134590			2569	protein-coding gene	gene with protein product		300213	"""CAAX box 1"""	CXX1		9403077, 15716091, 16093683	Standard	NM_001078171		Approved	Mart8, Mar8, MAR8C	uc004eyd.3	A6ZKI3	OTTHUMG00000022465	ENST00000257013.7:c.*758A>G	X.37:g.134167513A>G			Q6IBF1	RNA	SNP	-	NULL	ENST00000257013.7	37	NULL	CCDS43997.1	X																																																																																			FAM127A	-	-	ENSG00000134590		0.393	FAM127A-002	NOVEL	basic|appris_principal|CCDS	protein_coding	FAM127A	HGNC	protein_coding	OTTHUMT00000058391.2	-	0.00	63	0	A	NM_001078171		134167513	+1	tier1	-	no_errors	ENST00000464369	ensembl	human	known	74_37	rna	24.14	22	7	SNP	0.795	G
FAM153B	202134	genome.wustl.edu	37	5	175530248	175530248	+	Frame_Shift_Del	DEL	T	T	-			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr5:175530248delT	ENST00000253490.4	+	13	740	c.683delT	c.(682-684)cttfs	p.L228fs	FAM153B_ENST00000515817.1_Frame_Shift_Del_p.L151fs|FAM153B_ENST00000510151.1_Frame_Shift_Del_p.L151fs|FAM153B_ENST00000512862.1_Intron			P0C7A2	F153B_HUMAN	family with sequence similarity 153, member B	228										endometrium(3)|kidney(2)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)	16	all_cancers(89;0.00406)|Renal(175;0.000269)|Lung NSC(126;0.0103)|all_lung(126;0.0164)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)	Kidney(146;0.0965)		AGGGATGTACTTCAGGAGCTG	0.493																																																	0													221.0	231.0	227.0					5																	175530248		2203	4300	6503	SO:0001589	frameshift_variant	0			AK055006	CCDS43401.1, CCDS43401.2	5q35.2	2010-05-12			ENSG00000182230	ENSG00000182230			27323	protein-coding gene	gene with protein product							Standard	NM_001265615		Approved		uc031smb.1	P0C7A2	OTTHUMG00000163181	ENST00000253490.4:c.683delT	5.37:g.175530248delT	ENSP00000253490:p.Leu228fs		A8MTI1	Frame_Shift_Del	DEL	prints_FAM153	p.Q229fs	ENST00000253490.4	37	c.683		5																																																																																			FAM153B	-	NULL	ENSG00000182230		0.493	FAM153B-201	KNOWN	basic|appris_candidate_longest	protein_coding	FAM153B	HGNC	protein_coding			0.00	427	0	T	NM_001079529		175530248	+1	tier1		no_errors	ENST00000253490	ensembl	human	known	74_37	frame_shift_del	27.56	226	86	DEL	0.000	-
FAM189B	10712	genome.wustl.edu	37	1	155221327	155221328	+	Missense_Mutation	DNP	TA	TA	AT			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	T|A	T|A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr1:155221327_155221328TA>AT	ENST00000361361.2	-	7	1368_1369	c.859_860TA>AT	c.(859-861)TAt>ATt	p.Y287I	FAM189B_ENST00000368368.3_Missense_Mutation_p.Y269I|FAM189B_ENST00000472550.1_5'UTR|FAM189B_ENST00000350210.2_Missense_Mutation_p.Y191I	NM_006589.2	NP_006580.2	P81408	F189B_HUMAN	family with sequence similarity 189, member B	287						integral component of membrane (GO:0016021)	WW domain binding (GO:0050699)			breast(4)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	23						GACTGCCTCATAAGAAGGGGGG	0.584																																																	0																																										SO:0001583	missense	0			AF070550	CCDS1103.1, CCDS1104.1, CCDS58035.1	1q21	2009-07-09	2009-07-09	2009-07-09	ENSG00000160767	ENSG00000160767			1233	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 2"""	C1orf2		9331372	Standard	NM_006589		Approved	cote1	uc001fjm.3	P81408	OTTHUMG00000035844	ENST00000361361.2:c.859_860delinsAT	1.37:g.155221327_155221328delinsAT	ENSP00000354958:p.Tyr287Ile		B1AVS5|Q8IXL3|Q9BR66	Missense_Mutation	SNP	pfam_CD20-like	p.Y287F|p.Y287N	ENST00000361361.2	37	c.860|c.859	CCDS1103.1	1																																																																																			FAM189B	-	NULL	ENSG00000160767		0.584	FAM189B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM189B	HGNC	protein_coding	OTTHUMT00000087224.1	-	0.00	74|75	0	T|A	NM_006589		155221327|155221328	-1	tier1	-	no_errors	ENST00000361361	ensembl	human	known	74_37	missense	19.44|19.18	58|59	14	SNP	1.000|0.993	A|T
FAM208B	54906	genome.wustl.edu	37	10	5754877	5754877	+	5'UTR	SNP	A	A	G			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr10:5754877A>G	ENST00000328090.5	+	0	430				FAM208B_ENST00000463468.1_3'UTR|RP11-336A10.2_ENST00000596567.1_RNA|RP11-336A10.2_ENST00000411512.2_RNA	NM_017782.4	NP_060252	Q5VWN6	F208B_HUMAN	family with sequence similarity 208, member B																		GATACTGAAAAGCAGGTAAGG	0.318																																																	0																																										SO:0001623	5_prime_UTR_variant	0			BX649177	CCDS41485.1	10p15.1	2011-09-14	2011-09-14	2011-09-14	ENSG00000108021	ENSG00000108021			23484	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 18"""	C10orf18		12477932	Standard	NM_017782		Approved	FLJ20360, bA318E3.2, KIAA2006	uc001iij.3	Q5VWN6	OTTHUMG00000017605	ENST00000328090.5:c.-196A>G	10.37:g.5754877A>G			Q2YD91|Q5VWN5|Q6ZRQ8|Q8IVG4|Q9BUZ7|Q9H5J9|Q9H7A4|Q9H996|Q9NXA1	RNA	SNP	-	NULL	ENST00000328090.5	37	NULL	CCDS41485.1	10																																																																																			FAM208B	-	-	ENSG00000108021		0.318	FAM208B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM208B	HGNC	protein_coding	OTTHUMT00000046571.2	-	0.00	119	0	A	NM_017782		5754877	+1	tier1	-	no_errors	ENST00000463468	ensembl	human	known	74_37	rna	27.59	42	16	SNP	0.944	G
FANCG	2189	genome.wustl.edu	37	9	35077348	35077348	+	Missense_Mutation	SNP	G	G	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr9:35077348G>T	ENST00000378643.3	-	5	1050	c.559C>A	c.(559-561)Cca>Aca	p.P187T	FANCG_ENST00000476212.1_5'Flank	NM_004629.1	NP_004620.1	O15287	FANCG_HUMAN	Fanconi anemia, complementation group G	187					cell cycle checkpoint (GO:0000075)|DNA repair (GO:0006281)|mitochondrion organization (GO:0007005)|ovarian follicle development (GO:0001541)|response to radiation (GO:0009314)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	damaged DNA binding (GO:0003684)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(7)|ovary(2)|prostate(3)|stomach(1)	28			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			TCCTCAGCTGGGGGACTCCAA	0.527			"""Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks																															yes	Rec		Fanconi anaemia G	9	9p13	2189	"""Fanconi anemia, complementation group G"""		L	0													132.0	134.0	134.0					9																	35077348		2203	4300	6503	SO:0001583	missense	0			AJ007669	CCDS6574.1	9p13	2014-09-17			ENSG00000221829	ENSG00000221829		"""Fanconi anemia, complementation groups"""	3588	protein-coding gene	gene with protein product	"""DNA repair protein XRCC9"", ""X-ray repair, complementing defective, in Chinese hamster, 9"", ""X-ray repair complementing defective repair in Chinese hamster cells 9"""	602956		XRCC9		9256465, 9382107	Standard	NM_004629		Approved	FAG	uc003zwb.1	O15287	OTTHUMG00000019850	ENST00000378643.3:c.559C>A	9.37:g.35077348G>T	ENSP00000367910:p.Pro187Thr			Missense_Mutation	SNP	superfamily_Sig_transdc_His_kin_Hpt_dom,smart_TPR_repeat	p.P187T	ENST00000378643.3	37	c.559	CCDS6574.1	9	.	.	.	.	.	.	.	.	.	.	G	13.61	2.289216	0.40494	.	.	ENSG00000221829	ENST00000378643;ENST00000543657;ENST00000448890	T;D	0.91464	0.38;-2.85	5.88	5.88	0.94601	.	.	.	.	.	D	0.94951	0.8367	M	0.74881	2.28	0.48975	D	0.999737	D	0.89917	1.0	D	0.83275	0.996	D	0.94877	0.8035	9	0.66056	D	0.02	-12.7918	15.7423	0.77910	0.0:0.0:1.0:0.0	.	187	O15287	FANCG_HUMAN	T	187	ENSP00000367910:P187T;ENSP00000409607:P187T	ENSP00000367910:P187T	P	-	1	0	FANCG	35067348	0.999000	0.42202	0.744000	0.31058	0.104000	0.19210	4.839000	0.62810	2.782000	0.95742	0.655000	0.94253	CCA	FANCG	-	superfamily_Sig_transdc_His_kin_Hpt_dom	ENSG00000221829		0.527	FANCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCG	HGNC	protein_coding	OTTHUMT00000052269.1	-	0.00	99	0	G	NM_004629		35077348	-1	tier1	-	no_errors	ENST00000378643	ensembl	human	known	74_37	missense	5.56	68	4	SNP	0.952	T
FAT2	2196	genome.wustl.edu	37	5	150923012	150923012	+	Missense_Mutation	SNP	G	G	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr5:150923012G>A	ENST00000261800.5	-	9	7688	c.7676C>T	c.(7675-7677)gCt>gTt	p.A2559V		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	2559	Cadherin 22. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TCCATCCCGAGCCATGACCTT	0.473																																																	0													145.0	149.0	148.0					5																	150923012		2203	4300	6503	SO:0001583	missense	0			AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.7676C>T	5.37:g.150923012G>A	ENSP00000261800:p.Ala2559Val		O75091|Q9NSR7	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl_sf,smart_Cadherin,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.A2559V	ENST00000261800.5	37	c.7676	CCDS4317.1	5	.	.	.	.	.	.	.	.	.	.	G	19.91	3.915229	0.73098	.	.	ENSG00000086570	ENST00000261800	T	0.66099	-0.19	5.15	5.15	0.70609	Cadherin (4);Cadherin-like (1);	0.000000	0.64402	D	0.000007	T	0.82162	0.4977	M	0.86420	2.815	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.83473	0.0060	10	0.42905	T	0.14	.	18.6386	0.91386	0.0:0.0:1.0:0.0	.	2559	Q9NYQ8	FAT2_HUMAN	V	2559	ENSP00000261800:A2559V	ENSP00000261800:A2559V	A	-	2	0	FAT2	150903205	1.000000	0.71417	0.995000	0.50966	0.819000	0.46315	9.787000	0.99055	2.395000	0.81488	0.462000	0.41574	GCT	FAT2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000086570		0.473	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT2	HGNC	protein_coding	OTTHUMT00000252434.1	-	0.00	66	0	G	NM_001447		150923012	-1	tier1	-	no_errors	ENST00000261800	ensembl	human	known	74_37	missense	20.00	32	8	SNP	1.000	A
FBXO15	201456	genome.wustl.edu	37	18	71814970	71814970	+	Missense_Mutation	SNP	C	C	G			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr18:71814970C>G	ENST00000419743.2	-	1	130	c.51G>C	c.(49-51)caG>caC	p.Q17H	FBXO15_ENST00000269500.5_5'UTR|TIMM21_ENST00000169551.6_5'Flank|TIMM21_ENST00000580087.1_5'Flank	NM_001142958.1	NP_001136430.1	Q8NCQ5	FBX15_HUMAN	F-box protein 15	17						SCF ubiquitin ligase complex (GO:0019005)				autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)	27		Esophageal squamous(42;0.103)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.143)		CGCGCAGCGTCTGGAGGCCGA	0.711																																																	0													6.0	8.0	7.0					18																	71814970		674	1563	2237	SO:0001583	missense	0			AK094215	CCDS45884.1	18q22.3	2006-03-09	2004-06-15		ENSG00000141665	ENSG00000141665		"""F-boxes /  ""other"""""	13617	protein-coding gene	gene with protein product		609093	"""F-box only protein 15"""			12665572	Standard	NM_152676		Approved	MGC39671, FBX15	uc002llf.2	Q8NCQ5	OTTHUMG00000132842	ENST00000419743.2:c.51G>C	18.37:g.71814970C>G	ENSP00000393154:p.Gln17His		B3KST3	Missense_Mutation	SNP	pfam_F-box_dom,superfamily_F-box_dom,smart_F-box_dom,pfscan_F-box_dom	p.Q17H	ENST00000419743.2	37	c.51	CCDS45884.1	18	.	.	.	.	.	.	.	.	.	.	C	10.79	1.449451	0.26074	.	.	ENSG00000141665	ENST00000419743	T	0.45668	0.89	3.84	3.84	0.44239	.	.	.	.	.	T	0.29389	0.0732	N	0.08118	0	0.80722	D	1	D	0.58620	0.983	P	0.47075	0.536	T	0.24333	-1.0163	9	0.56958	D	0.05	.	13.1477	0.59472	0.0:1.0:0.0:0.0	.	17	B3KST3	.	H	17	ENSP00000393154:Q17H	ENSP00000393154:Q17H	Q	-	3	2	FBXO15	69965950	0.060000	0.20803	0.019000	0.16419	0.019000	0.09904	1.193000	0.32162	2.163000	0.67991	0.557000	0.71058	CAG	FBXO15	-	NULL	ENSG00000141665		0.711	FBXO15-002	KNOWN	basic|CCDS	protein_coding	FBXO15	HGNC	protein_coding	OTTHUMT00000444223.1	-	0.00	54	0	C	NM_152676		71814970	-1	tier1	-	no_errors	ENST00000419743	ensembl	human	known	74_37	missense	40.91	12	9	SNP	0.009	G
FCGBP	8857	genome.wustl.edu	37	19	40376662	40376662	+	Missense_Mutation	SNP	G	G	C	rs79630345	byFrequency	TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr19:40376662G>C	ENST00000221347.6	-	24	11767	c.11760C>G	c.(11758-11760)caC>caG	p.H3920Q	FCGBP_ENST00000595713.1_5'Flank	NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	3920			H -> Q (in dbSNP:rs2542318).			extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			AGGGCTCCACGTGGCCTCCAG	0.592													g|||	625	0.1248	0.0983	0.0447	5008	,	,		27897	0.3026		0.0577	False		,,,				2504	0.1033																0													96.0	122.0	113.0					19																	40376662		2113	4189	6302	SO:0001583	missense	0			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.11760C>G	19.37:g.40376662G>C	ENSP00000221347:p.His3920Gln		O95784	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_Fol_N,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EG-like_dom,smart_VWF_C,smart_VWC_out	p.H3920Q	ENST00000221347.6	37	c.11760	CCDS12546.1	19	.	.	.	.	.	.	.	.	.	.	g	7.411	0.634815	0.14322	.	.	ENSG00000090920	ENST00000221347	T	0.75704	-0.96	3.67	-6.46	0.01908	Uncharacterised domain, cysteine-rich (2);	.	.	.	.	T	0.42653	0.1212	N	0.11255	0.115	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.33343	-0.9872	9	0.12766	T	0.61	.	1.7186	0.02907	0.3358:0.1251:0.4119:0.1272	.	3920	Q9Y6R7	FCGBP_HUMAN	Q	3920	ENSP00000221347:H3920Q	ENSP00000221347:H3920Q	H	-	3	2	FCGBP	45068502	0.000000	0.05858	0.000000	0.03702	0.483000	0.33249	-2.166000	0.01273	-1.510000	0.01796	0.313000	0.20887	CAC	FCGBP	-	pfam_Unchr_dom_Cys-rich,smart_Unchr_dom_Cys-rich	ENSG00000090920		0.592	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCGBP	HGNC	protein_coding	OTTHUMT00000462507.1	-	0.00	76	0	G	NM_003890		40376662	-1	tier1	rs79630345	no_errors	ENST00000221347	ensembl	human	known	74_37	missense	21.05	15	4	SNP	0.001	C
FLG	2312	genome.wustl.edu	37	1	152277313	152277313	+	Nonsense_Mutation	SNP	G	G	C			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr1:152277313G>C	ENST00000368799.1	-	3	10084	c.10049C>G	c.(10048-10050)tCa>tGa	p.S3350*	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	3350	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTGTGTGTCTGACTCTTCTGA	0.582									Ichthyosis																																								0													369.0	367.0	368.0					1																	152277313		2203	4300	6503	SO:0001587	stop_gained	0	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.10049C>G	1.37:g.152277313G>C	ENSP00000357789:p.Ser3350*		Q01720|Q5T583|Q9UC71	Nonsense_Mutation	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom,prints_Filaggrin	p.S3350*	ENST00000368799.1	37	c.10049	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	G	49	15.441228	0.99834	.	.	ENSG00000143631	ENST00000368799;ENST00000368796	.	.	.	3.85	1.7	0.24286	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-0.7637	5.9983	0.19507	0.0:0.2134:0.5669:0.2197	.	.	.	.	X	3350;288	.	ENSP00000357786:S288X	S	-	2	0	FLG	150543937	0.000000	0.05858	0.009000	0.14445	0.012000	0.07955	-0.171000	0.09883	0.920000	0.36970	0.454000	0.30748	TCA	FLG	-	NULL	ENSG00000143631		0.582	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	-	0.00	127	0	G	NM_002016		152277313	-1	tier1	-	no_errors	ENST00000368799	ensembl	human	known	74_37	nonsense	17.65	83	18	SNP	0.002	C
FDPS	2224	genome.wustl.edu	37	1	155290347	155290347	+	Missense_Mutation	SNP	C	C	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr1:155290347C>A	ENST00000356657.6	+	11	1369	c.1207C>A	c.(1207-1209)Ccc>Acc	p.P403T	RUSC1_ENST00000368352.5_5'Flank|RUSC1-AS1_ENST00000543656.1_RNA|FDPS_ENST00000368356.4_Missense_Mutation_p.P403T|RUSC1-AS1_ENST00000446880.1_RNA|RUSC1-AS1_ENST00000443642.1_RNA|RUSC1-AS1_ENST00000450199.1_RNA|RUSC1_ENST00000368354.3_5'Flank|FDPS_ENST00000447866.1_Missense_Mutation_p.P337T	NM_001135821.1	NP_001129293.1	P14324	FPPS_HUMAN	farnesyl diphosphate synthase	403					cholesterol biosynthetic process (GO:0006695)|farnesyl diphosphate biosynthetic process (GO:0045337)|geranyl diphosphate biosynthetic process (GO:0033384)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	dimethylallyltranstransferase activity (GO:0004161)|geranyltranstransferase activity (GO:0004337)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)	10	Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;2.03e-10)|all cancers(21;5.23e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000549)|LUSC - Lung squamous cell carcinoma(543;0.127)		Alendronate(DB00630)|Ibandronate(DB00710)|Pamidronate(DB00282)|Risedronate(DB00884)|Zoledronate(DB00399)	AGCACCCCTGCCCCCAGCCGT	0.517																																																	0													48.0	47.0	47.0					1																	155290347		2203	4300	6503	SO:0001583	missense	0			J05262	CCDS1110.1, CCDS44241.1, CCDS72940.1	1q22	2012-07-13	2010-06-24		ENSG00000160752	ENSG00000160752	2.5.1.1, 2.5.1.10		3631	protein-coding gene	gene with protein product	"""farnesyl pyrophosphate synthetase, dimethylallyltranstransferase, geranyltranstransferase"""	134629				1968462	Standard	NM_002004		Approved		uc001fkc.2	P14324	OTTHUMG00000013909	ENST00000356657.6:c.1207C>A	1.37:g.155290347C>A	ENSP00000349078:p.Pro403Thr		D3DV91|E9PCI9|Q96G29	Missense_Mutation	SNP	pfam_Polyprenyl_synt,superfamily_Terpenoid_synth	p.P403T	ENST00000356657.6	37	c.1207	CCDS1110.1	1	.	.	.	.	.	.	.	.	.	.	C	11.52	1.664073	0.29604	.	.	ENSG00000160752	ENST00000447866;ENST00000368356;ENST00000356657	T;T;T	0.62788	0.0;0.0;0.0	3.24	3.24	0.37175	Terpenoid synthase (2);	0.000000	0.36740	N	0.002438	T	0.48786	0.1519	M	0.79614	2.46	0.58432	D	0.999996	B	0.26318	0.146	B	0.24974	0.057	T	0.57929	-0.7726	10	0.40728	T	0.16	-7.9892	12.356	0.55176	0.0:1.0:0.0:0.0	.	403	P14324	FPPS_HUMAN	T	337;403;403	ENSP00000391755:P337T;ENSP00000357340:P403T;ENSP00000349078:P403T	ENSP00000349078:P403T	P	+	1	0	FDPS	153556971	1.000000	0.71417	0.990000	0.47175	0.021000	0.10359	3.977000	0.56874	2.111000	0.64477	0.462000	0.41574	CCC	FDPS	-	superfamily_Terpenoid_synth	ENSG00000160752		0.517	FDPS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FDPS	HGNC	protein_coding	OTTHUMT00000039053.1		0.00	53	0	C	NM_002004		155290347	+1			no_errors	ENST00000356657	ensembl	human	known	74_37	missense	17.95	32	7	SNP	1.000	A
FMO2	2327	genome.wustl.edu	37	1	171154891	171154891	+	Silent	SNP	T	T	C			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr1:171154891T>C	ENST00000209929.7	+	2	197	c.39T>C	c.(37-39)agT>agC	p.S13S	FMO2_ENST00000529935.1_Intron|FMO2_ENST00000441535.1_Silent_p.S13S			P31512	FMO4_HUMAN	flavin containing monooxygenase 2 (non-functional)	13					drug catabolic process (GO:0042737)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)			endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|prostate(1)|skin(2)|stomach(3)|urinary_tract(1)	22	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					CTGGGGTCAGTGGCCTAATTT	0.468																																																	0													261.0	249.0	253.0					1																	171154891		2203	4300	6503	SO:0001819	synonymous_variant	0			BC005894	CCDS1293.1	1q24.3	2011-08-04	2006-07-17		ENSG00000094963	ENSG00000094963			3770	protein-coding gene	gene with protein product		603955	"""flavin containing monooxygenase 2"""			1417778, 9804831	Standard	XR_426768		Approved		uc001ghk.1	Q99518	OTTHUMG00000035504	ENST00000209929.7:c.39T>C	1.37:g.171154891T>C			Q53XR0	Silent	SNP	pfam_Flavin_mOase-like,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,prints_Flavin_mOase,prints_Flavin_mOase_2,prints_Flavin_mOase_1,prints_Flavin_mOase_5	p.S13	ENST00000209929.7	37	c.39	CCDS1293.1	1																																																																																			FMO2	-	pfam_Flavin_mOase-like,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,prints_Flavin_mOase	ENSG00000094963		0.468	FMO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMO2	HGNC	protein_coding	OTTHUMT00000086216.2	-	0.00	156	0	T	NM_001460		171154891	+1	tier1	-	no_errors	ENST00000209929	ensembl	human	known	74_37	silent	14.63	70	12	SNP	0.721	C
FRY	10129	genome.wustl.edu	37	13	32676113	32676113	+	Missense_Mutation	SNP	C	C	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr13:32676113C>T	ENST00000380250.3	+	3	780	c.284C>T	c.(283-285)aCa>aTa	p.T95I		NM_023037.2	NP_075463.2	Q5TBA9	FRY_HUMAN	furry homolog (Drosophila)	95						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.T95I(1)		NS(3)|breast(4)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(31)|lung(50)|ovary(5)|pancreas(1)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	132		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		AAGCCATTGACAAAATCTCTG	0.313																																																	1	Substitution - Missense(1)	large_intestine(1)											100.0	99.0	99.0					13																	32676113		1826	4073	5899	SO:0001583	missense	0			AL049784	CCDS41875.1	13q13.1	2008-02-05	2005-11-24	2005-11-24	ENSG00000073910	ENSG00000073910			20367	protein-coding gene	gene with protein product		614818	"""chromosome 13 open reading frame 14"""	C13orf14		14702039, 8812419	Standard	NM_023037		Approved	bA37E23.1, 13CDNA73, CG003	uc001utx.3	Q5TBA9	OTTHUMG00000016696	ENST00000380250.3:c.284C>T	13.37:g.32676113C>T	ENSP00000369600:p.Thr95Ile		Q9Y3N6	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.T95I	ENST00000380250.3	37	c.284	CCDS41875.1	13	.	.	.	.	.	.	.	.	.	.	C	14.54	2.566278	0.45694	.	.	ENSG00000073910	ENST00000380250;ENST00000436046;ENST00000267067	T	0.21932	1.98	5.15	5.15	0.70609	.	0.054125	0.64402	D	0.000001	T	0.25195	0.0612	L	0.56769	1.78	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.03695	-1.1012	10	0.87932	D	0	.	15.6974	0.77512	0.0:1.0:0.0:0.0	.	95	Q5TBA9	FRY_HUMAN	I	95;92;61	ENSP00000369600:T95I	ENSP00000267067:T61I	T	+	2	0	FRY	31574113	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	5.249000	0.65427	2.547000	0.85894	0.655000	0.94253	ACA	FRY	-	NULL	ENSG00000073910		0.313	FRY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRY	HGNC	protein_coding	OTTHUMT00000044405.1		0.00	77	0	C	NM_023037		32676113	+1			no_errors	ENST00000380250	ensembl	human	known	74_37	missense	6.06	31	2	SNP	1.000	T
ARF5	381	genome.wustl.edu	37	7	127231635	127231636	+	3'UTR	INS	-	-	T	rs543667839|rs377612947		TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr7:127231635_127231636insT	ENST00000000233.5	+	0	979_980				FSCN3_ENST00000265825.5_5'Flank|FSCN3_ENST00000420086.2_5'Flank|GCC1_ENST00000497650.1_Intron|FSCN3_ENST00000478328.1_3'UTR	NM_001662.3	NP_001653.1	P84085	ARF5_HUMAN	ADP-ribosylation factor 5						GTP catabolic process (GO:0006184)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			cervix(2)|kidney(1)|lung(10)|ovary(1)	14						TCTGGGTTTCCTTTTTTTTTTC	0.564																																																	0																																										SO:0001624	3_prime_UTR_variant	0				CCDS34745.1	7q31.3	2008-07-18			ENSG00000004059	ENSG00000004059		"""ADP-ribosylation factors"""	658	protein-coding gene	gene with protein product		103188				1993656	Standard	NM_001662		Approved		uc003vmb.2	P84085	OTTHUMG00000023246	ENST00000000233.5:c.*283->T	7.37:g.127231645_127231645dupT			P26437	RNA	INS	-	NULL	ENST00000000233.5	37	NULL	CCDS34745.1	7																																																																																			GCC1	-	-	ENSG00000179562		0.564	ARF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCC1	HGNC	protein_coding	OTTHUMT00000059567.2		0.00	25	0	-	NM_001662		127231636	-1	tier1		no_errors	ENST00000473728	ensembl	human	known	74_37	rna	12.12	29	4	INS	0.929:0.928	T
GCN1L1	10985	genome.wustl.edu	37	12	120612974	120612974	+	Missense_Mutation	SNP	C	C	T	rs374519500		TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr12:120612974C>T	ENST00000300648.6	-	12	1096	c.1084G>A	c.(1084-1086)Gtc>Atc	p.V362I		NM_006836.1	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis 1-like 1 (yeast)	362					regulation of translation (GO:0006417)|translation (GO:0006412)	cytoplasm (GO:0005737)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)			NS(2)|breast(2)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(13)|liver(1)|lung(36)|ovary(4)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	94	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CCTGAGAGGACGCTCATCTTC	0.413																																																	0								C	ILE/VAL	1,3761		0,1,1880	98.0	88.0	91.0		1084	5.2	1.0	12		91	0,8222		0,0,4111	no	missense	GCN1L1	NM_006836.1	29	0,1,5991	TT,TC,CC		0.0,0.0266,0.0083	benign	362/2672	120612974	1,11983	1881	4111	5992	SO:0001583	missense	0			U77700	CCDS41847.1	12q24.2	2008-07-03	2001-11-28						4199	protein-coding gene	gene with protein product		605614	"""GCN1 (general control of amino-acid synthesis 1, yeast)-like 1"""			9234705	Standard	NM_006836		Approved	KIAA0219, GCN1, GCN1L	uc001txo.3	Q92616	OTTHUMG00000169338	ENST00000300648.6:c.1084G>A	12.37:g.120612974C>T	ENSP00000300648:p.Val362Ile		A8KAY1|O95001|O95651|Q6P2S3|Q86X65|Q8N5I5|Q8WU80|Q99736|Q9UE60	Missense_Mutation	SNP	pfam_DUF3554,pfam_HEAT,superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.V362I	ENST00000300648.6	37	c.1084	CCDS41847.1	12	.	.	.	.	.	.	.	.	.	.	C	15.84	2.952399	0.53293	2.66E-4	0.0	ENSG00000089154	ENST00000300648	T	0.04917	3.53	5.17	5.17	0.71159	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.08179	0.0204	L	0.48877	1.53	0.80722	D	1	B	0.20164	0.042	B	0.10450	0.005	T	0.27365	-1.0076	10	0.13470	T	0.59	-3.5148	18.6639	0.91481	0.0:1.0:0.0:0.0	.	362	Q92616	GCN1L_HUMAN	I	362	ENSP00000300648:V362I	ENSP00000300648:V362I	V	-	1	0	GCN1L1	119097357	1.000000	0.71417	0.985000	0.45067	0.840000	0.47671	7.225000	0.78051	2.403000	0.81681	0.563000	0.77884	GTC	GCN1L1	-	superfamily_ARM-type_fold	ENSG00000089154		0.413	GCN1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCN1L1	HGNC	protein_coding	OTTHUMT00000403592.1		0.00	66	0	C			120612974	-1			no_errors	ENST00000300648	ensembl	human	known	74_37	missense	5.26	36	2	SNP	1.000	T
GCNT4	51301	genome.wustl.edu	37	5	74325366	74325366	+	Missense_Mutation	SNP	C	C	T	rs556467713		TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr5:74325366C>T	ENST00000322348.4	-	1	1358	c.497G>A	c.(496-498)cGt>cAt	p.R166H		NM_016591.2	NP_057675.1	Q9P109	GCNT4_HUMAN	glucosaminyl (N-acetyl) transferase 4, core 2	166					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|homeostasis of number of cells (GO:0048872)|inter-male aggressive behavior (GO:0002121)|kidney morphogenesis (GO:0060993)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)|thyroid hormone metabolic process (GO:0042403)|tissue morphogenesis (GO:0048729)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity (GO:0003829)|N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity (GO:0008109)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|ovary(2)|skin(1)|stomach(2)	19		all_lung(232;0.0131)|Lung NSC(167;0.0282)|Ovarian(174;0.0798)		OV - Ovarian serous cystadenocarcinoma(47;8.44e-57)		AGGTGCCTTACGATCATAATG	0.383													c|||	1	0.000199681	0.0008	0.0	5008	,	,		22239	0.0		0.0	False		,,,				2504	0.0																0													152.0	148.0	149.0					5																	74325366		2203	4300	6503	SO:0001583	missense	0			AF132035	CCDS4026.1	5q12	2013-02-25	2010-03-16		ENSG00000176928	ENSG00000176928	2.4.1.102	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	17973	protein-coding gene	gene with protein product	"""core 2 beta-1,6-N-acetylglucosaminyltransferase 3"", ""beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase 4"""		"""glucosaminyl (N-acetyl) transferase 4, core 2 (beta-1,6-N-acetylglucosaminyltransferase)"""			10753916	Standard	NM_016591		Approved	C2GNT3	uc003kdn.3	Q9P109	OTTHUMG00000131272	ENST00000322348.4:c.497G>A	5.37:g.74325366C>T	ENSP00000317027:p.Arg166His			Missense_Mutation	SNP	pfam_Glyco_trans_14	p.R166H	ENST00000322348.4	37	c.497	CCDS4026.1	5	.	.	.	.	.	.	.	.	.	.	.	11.34	1.609358	0.28623	.	.	ENSG00000176928	ENST00000322348	T	0.11821	2.74	6.17	-4.36	0.03645	.	0.565448	0.20533	N	0.090470	T	0.09379	0.0231	L	0.43923	1.385	0.09310	N	0.999997	B	0.10296	0.003	B	0.09377	0.004	T	0.22452	-1.0216	10	0.51188	T	0.08	-16.1396	8.0673	0.30667	0.2533:0.1132:0.0:0.6335	.	166	Q9P109	GCNT4_HUMAN	H	166	ENSP00000317027:R166H	ENSP00000317027:R166H	R	-	2	0	GCNT4	74361122	0.122000	0.22280	0.017000	0.16124	0.918000	0.54935	0.486000	0.22340	-0.416000	0.07473	0.655000	0.94253	CGT	GCNT4	-	pfam_Glyco_trans_14	ENSG00000176928		0.383	GCNT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCNT4	HGNC	protein_coding	OTTHUMT00000254040.1		0.00	38	0	C	NM_016591		74325366	-1			no_errors	ENST00000322348	ensembl	human	known	74_37	missense	6.06	31	2	SNP	0.023	T
GLIS1	148979	genome.wustl.edu	37	1	54060185	54060185	+	Missense_Mutation	SNP	C	C	G			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr1:54060185C>G	ENST00000312233.2	-	3	957	c.391G>C	c.(391-393)Gag>Cag	p.E131Q		NM_147193.2	NP_671726.2			GLIS family zinc finger 1											endometrium(3)|kidney(2)|large_intestine(3)|liver(1)|lung(7)|ovary(1)|skin(3)|urinary_tract(4)	24						AAGCTGCCCTCATGGCTGTCC	0.642																																																	0													24.0	28.0	27.0					1																	54060185		2201	4299	6500	SO:0001583	missense	0			AK093474	CCDS582.1	1p32.3	2008-02-05			ENSG00000174332	ENSG00000174332		"""Zinc fingers, C2H2-type"""	29525	protein-coding gene	gene with protein product		610378				12042312, 14500813	Standard	NM_147193		Approved	FLJ36155	uc001cvr.1	Q8NBF1	OTTHUMG00000008079	ENST00000312233.2:c.391G>C	1.37:g.54060185C>G	ENSP00000309653:p.Glu131Gln			Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E131Q	ENST00000312233.2	37	c.391	CCDS582.1	1	.	.	.	.	.	.	.	.	.	.	C	8.798	0.932213	0.18131	.	.	ENSG00000174332	ENST00000312233	T	0.10668	2.85	4.14	4.14	0.48551	.	0.546132	0.17001	N	0.190920	T	0.06325	0.0163	N	0.24115	0.695	0.09310	N	1	B	0.31730	0.337	B	0.26770	0.073	T	0.32666	-0.9898	10	0.14252	T	0.57	.	9.7333	0.40374	0.0:0.8934:0.0:0.1066	.	131	Q8NBF1	GLIS1_HUMAN	Q	131	ENSP00000309653:E131Q	ENSP00000309653:E131Q	E	-	1	0	GLIS1	53832773	0.482000	0.25948	0.613000	0.29037	0.266000	0.26442	1.644000	0.37228	2.606000	0.88127	0.563000	0.77884	GAG	GLIS1	-	NULL	ENSG00000174332		0.642	GLIS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLIS1	HGNC	protein_coding	OTTHUMT00000022109.1	-	0.00	35	0	C	NM_147193		54060185	-1	tier1	-	no_errors	ENST00000312233	ensembl	human	known	74_37	missense	35.71	9	5	SNP	0.026	G
GNAS	2778	genome.wustl.edu	37	20	57415789	57415789	+	Missense_Mutation	SNP	C	C	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr20:57415789C>T	ENST00000313949.7	+	1	1017	c.628C>T	c.(628-630)Ccc>Tcc	p.P210S	GNAS-AS1_ENST00000443966.1_RNA|GNAS_ENST00000371098.2_Missense_Mutation_p.P210S|GNAS_ENST00000371075.3_Missense_Mutation_p.P210S|GNAS-AS1_ENST00000424094.2_RNA|GNAS-AS1_ENST00000598163.1_RNA			P63092	GNAS2_HUMAN	GNAS complex locus	0					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|bone development (GO:0060348)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|cognition (GO:0050890)|developmental growth (GO:0048589)|energy reserve metabolic process (GO:0006112)|hair follicle placode formation (GO:0060789)|intracellular transport (GO:0046907)|platelet aggregation (GO:0070527)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of insulin secretion (GO:0050796)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intrinsic component of membrane (GO:0031224)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	adenylate cyclase activity (GO:0004016)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			adrenal_gland(12)|autonomic_ganglia(1)|biliary_tract(5)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(37)|liver(9)|lung(9)|ovary(16)|pancreas(56)|parathyroid(5)|pituitary(228)|prostate(2)|small_intestine(1)|stomach(1)|testis(2)|thyroid(35)|upper_aerodigestive_tract(3)|urinary_tract(1)	441	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			GTCGAAGGAGCCCAAGGAGGA	0.667			Mis		pituitary adenoma		"""McCune-Albright syndrome; pseudohypoparathyroidism, type IA"""			TSP Lung(22;0.16)																											Colon(117;935 1597 6045 8307 46442)			Dom	yes		20	20q13.2	2778	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	yes	E	0													19.0	18.0	18.0					20																	57415789		2200	4295	6495	SO:0001583	missense	0			M21142	CCDS13471.1, CCDS13472.1, CCDS42892.1, CCDS46622.1, CCDS46623.1, CCDS46624.1	20q13.2-q13.3	2010-03-01	2001-12-19	2001-12-20	ENSG00000087460	ENSG00000087460			4392	protein-coding gene	gene with protein product	"""secretogranin VI"""	139320	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	GNAS1			Standard	NM_000516		Approved	NESP55, NESP, GNASXL, GPSA, SCG6	uc002xzw.3	O95467	OTTHUMG00000033069	ENST00000313949.7:c.628C>T	20.37:g.57415789C>T	ENSP00000323571:p.Pro210Ser		A6NI00|E1P5G5|P04895|Q12927|Q14433|Q32P26|Q5JWD2|Q5JWD4|Q5JWD5|Q6NR75|Q6NXS0|Q8TBC0|Q96H70	Missense_Mutation	SNP	pfam_NESP55	p.P210S	ENST00000313949.7	37	c.628	CCDS13471.1	20	.	.	.	.	.	.	.	.	.	.	C	9.207	1.029962	0.19512	.	.	ENSG00000087460	ENST00000313949;ENST00000371098;ENST00000371075;ENST00000453292	.	.	.	4.43	1.41	0.22369	.	.	.	.	.	T	0.25269	0.0614	N	0.19112	0.55	0.09310	N	0.999992	B	0.06786	0.001	B	0.06405	0.002	T	0.18903	-1.0322	8	0.34782	T	0.22	.	7.0871	0.25264	0.0:0.7043:0.0:0.2957	.	210	O95467	GNAS3_HUMAN	S	210;210;210;131	.	ENSP00000323571:P210S	P	+	1	0	GNAS	56849184	0.254000	0.23992	0.105000	0.21289	0.423000	0.31445	1.604000	0.36804	0.205000	0.20568	-0.482000	0.04802	CCC	GNAS	-	pfam_NESP55	ENSG00000087460		0.667	GNAS-002	KNOWN	NMD_exception|basic|CCDS	protein_coding	GNAS	HGNC	protein_coding	OTTHUMT00000080418.7		0.00	69	0	C	NM_000516		57415789	+1			no_errors	ENST00000313949	ensembl	human	known	74_37	missense	6.90	54	4	SNP	0.135	T
GRHL1	29841	genome.wustl.edu	37	2	10098951	10098951	+	Frame_Shift_Del	DEL	G	G	-			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr2:10098951delG	ENST00000324907.9	+	3	380	c.244delG	c.(244-246)gagfs	p.E82fs	GRHL1_ENST00000324883.5_5'UTR|GRHL1_ENST00000405379.2_Frame_Shift_Del_p.E82fs	NM_198182.2	NP_937825.2	Q9NZI5	GRHL1_HUMAN	grainyhead-like 1 (Drosophila)	82	Transcription activation.				cellular lipid metabolic process (GO:0044255)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(1)|large_intestine(2)|lung(8)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	17	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.172)|OV - Ovarian serous cystadenocarcinoma(76;0.246)		AGCAAAGCCAGAGGTGGAGCA	0.443																																																	0													114.0	117.0	116.0					2																	10098951		1981	4166	6147	SO:0001589	frameshift_variant	0			AF198489	CCDS33144.1, CCDS33144.2	2p25.2	2008-02-05	2005-07-11	2005-07-11	ENSG00000134317	ENSG00000134317			17923	protein-coding gene	gene with protein product		609786	"""transcription factor CP2-like 2"""	TFCP2L2		10644752, 12393799	Standard	NM_198182		Approved	LBP-32, MGR	uc002raa.3	Q9NZI5	OTTHUMG00000151704	ENST00000324907.9:c.244delG	2.37:g.10098951delG	ENSP00000324693:p.Glu82fs		A6NLA4|B2R7E4|B5MEC2|Q53T93|Q6NWN7|Q6NWN8|Q6NWN9|Q8NI33	Frame_Shift_Del	DEL	pfam_CP2	p.E82fs	ENST00000324907.9	37	c.244	CCDS33144.2	2																																																																																			GRHL1	-	NULL	ENSG00000134317		0.443	GRHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRHL1	HGNC	protein_coding	OTTHUMT00000323543.2		0.00	88	0	G	NM_014552		10098951	+1	tier1		no_errors	ENST00000324907	ensembl	human	known	74_37	frame_shift_del	67.90	26	55	DEL	0.948	-
HDDC2	51020	genome.wustl.edu	37	6	125614053	125614053	+	Missense_Mutation	SNP	T	T	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr6:125614053T>A	ENST00000398153.2	-	4	354	c.312A>T	c.(310-312)gaA>gaT	p.E104D	HDDC2_ENST00000608295.1_Intron|HDDC2_ENST00000368377.4_Missense_Mutation_p.E70D	NM_016063.2	NP_057147.2	Q7Z4H3	HDDC2_HUMAN	HD domain containing 2	104	HD.					extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)				endometrium(1)|large_intestine(1)|lung(4)	6			LUSC - Lung squamous cell carcinoma(4;0.0263)|Lung(4;0.0828)	GBM - Glioblastoma multiforme(226;0.0186)		GCTTCATAGCTTCCTGAAATA	0.348																																																	0													119.0	116.0	117.0					6																	125614053		1823	4084	5907	SO:0001583	missense	0			AF151888	CCDS43503.1	6q13-q24.3	2008-02-05	2005-08-22	2005-08-22	ENSG00000111906	ENSG00000111906			21078	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 74"""	C6orf74		10810093	Standard	NM_016063		Approved	CGI-130, dJ167O5.2	uc003qaa.1	Q7Z4H3	OTTHUMG00000015506	ENST00000398153.2:c.312A>T	6.37:g.125614053T>A	ENSP00000381220:p.Glu104Asp		Q5TDQ4|Q6NZ49|Q9BTT2|Q9BV31|Q9Y3D1	Missense_Mutation	SNP	pfam_HD_domain,smart_HD/PDEase_dom	p.E104D	ENST00000398153.2	37	c.312	CCDS43503.1	6	.	.	.	.	.	.	.	.	.	.	T	14.05	2.420070	0.42918	.	.	ENSG00000111906	ENST00000318787;ENST00000398153;ENST00000368377	T;T;T	0.48201	0.82;0.82;0.82	5.52	1.87	0.25490	Metal-dependent phosphohydrolase, HD domain (1);Metal-dependent phosphohydrolase, HD subdomain (1);HD domain (1);	0.197760	0.52532	D	0.000064	T	0.09949	0.0244	N	0.17723	0.515	0.41214	D	0.98646	B	0.14012	0.009	B	0.17979	0.02	T	0.14504	-1.0470	10	0.12430	T	0.62	.	4.0728	0.09891	0.1427:0.2433:0.0:0.614	.	104	Q7Z4H3	HDDC2_HUMAN	D	70;104;70	ENSP00000316242:E70D;ENSP00000381220:E104D;ENSP00000357361:E70D	ENSP00000316242:E70D	E	-	3	2	HDDC2	125655752	1.000000	0.71417	0.999000	0.59377	0.981000	0.71138	0.574000	0.23714	0.149000	0.19098	0.533000	0.62120	GAA	HDDC2	-	pfam_HD_domain,smart_HD/PDEase_dom	ENSG00000111906		0.348	HDDC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HDDC2	HGNC	protein_coding	OTTHUMT00000472493.1	-	0.00	73	0	T	NM_016063		125614053	-1	tier1	-	no_errors	ENST00000398153	ensembl	human	known	74_37	missense	56.82	19	25	SNP	1.000	A
HEATR5A	25938	genome.wustl.edu	37	14	31819037	31819037	+	Missense_Mutation	SNP	T	T	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr14:31819037T>A	ENST00000389961.3	-	17	2647	c.2648A>T	c.(2647-2649)gAt>gTt	p.D883V	HEATR5A_ENST00000543095.2_Missense_Mutation_p.D889V|HEATR5A_ENST00000439727.1_Missense_Mutation_p.D596V|HEATR5A_ENST00000439348.1_Missense_Mutation_p.D883V|HEATR5A_ENST00000404677.3_Missense_Mutation_p.D889V			Q86XA9	HTR5A_HUMAN	HEAT repeat containing 5A	883										breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(13)|ovary(1)	26	Hepatocellular(127;0.0877)|Breast(36;0.137)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.0797)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.0059)		AAAAGCTCCATCATCTACCAC	0.418																																																	0													60.0	57.0	58.0					14																	31819037		1877	4108	5985	SO:0001583	missense	0			AB037737		14q12	2012-04-19	2007-01-02	2007-01-02	ENSG00000129493	ENSG00000129493			20276	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 125"""	C14orf125			Standard	NM_015473		Approved	DKFZP434I1735	uc001wrf.4	Q86XA9	OTTHUMG00000169043	ENST00000389961.3:c.2648A>T	14.37:g.31819037T>A	ENSP00000374611:p.Asp883Val		Q68DD8|Q6P3S5|Q6P5R9|Q9H8D7|Q9NXB7|Q9P2N0|Q9UFQ3	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.D883V	ENST00000389961.3	37	c.2648		14	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	T|T|T	24.0|24.0|24.0	4.478309|4.478309|4.478309	0.84747|0.84747|0.84747	.|.|.	.|.|.	ENSG00000129493|ENSG00000129493|ENSG00000129493	ENST00000389961;ENST00000439348;ENST00000439727;ENST00000543095;ENST00000404677|ENST00000538864|ENST00000550366	T;T;T;T;T|.|.	0.68331|.|.	-0.32;-0.32;-0.32;-0.32;-0.32|.|.	5.48|5.48|5.48	5.48|5.48|5.48	0.80851|0.80851|0.80851	Armadillo-like helical (1);Armadillo-type fold (1);|.|.	0.000000|.|.	0.85682|.|.	D|.|.	0.000000|.|.	T|T|.	0.78091|0.78091|.	0.4229|0.4229|.	M|M|M	0.83223|0.83223|0.83223	2.63|2.63|2.63	0.80722|0.80722|0.80722	D|D|D	1|1|1	D;D;D|.|.	0.89917|.|.	1.0;0.995;1.0|.|.	D;D;D|.|.	0.91635|.|.	0.999;0.965;0.991|.|.	T|T|.	0.80279|0.80279|.	-0.1449|-0.1449|.	10|5|.	0.87932|.|.	D|.|.	0|.|.	.|.|.	15.5769|15.5769|15.5769	0.76397|0.76397|0.76397	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.|.	889;883;883|.|.	B5MC49;Q86XA9-2;Q86XA9|.|.	.;.;HTR5A_HUMAN|.|.	V|L|C	883;883;596;889;889|517|531	ENSP00000374611:D883V;ENSP00000405407:D883V;ENSP00000408681:D596V;ENSP00000437968:D889V;ENSP00000384646:D889V|.|.	ENSP00000374611:D883V|.|.	D|M|X	-|-|-	2|1|3	0|0|0	HEATR5A|HEATR5A|HEATR5A	30888788|30888788|30888788	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.989000|0.989000|0.989000	0.77384|0.77384|0.77384	5.884000|5.884000|5.884000	0.69729|0.69729|0.69729	2.091000|2.091000|2.091000	0.63221|0.63221|0.63221	0.533000|0.533000|0.533000	0.62120|0.62120|0.62120	GAT|ATG|TGA	HEATR5A	-	superfamily_ARM-type_fold	ENSG00000129493		0.418	HEATR5A-201	KNOWN	basic|appris_candidate	protein_coding	HEATR5A	HGNC	protein_coding		-	0.00	50	0	T	NM_015473		31819037	-1	tier1	-	no_errors	ENST00000389961	ensembl	human	known	74_37	missense	10.26	35	4	SNP	1.000	A
HEMK1	51409	genome.wustl.edu	37	3	50616342	50616342	+	Frame_Shift_Del	DEL	C	C	-			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr3:50616342delC	ENST00000232854.4	+	8	1307	c.755delC	c.(754-756)gccfs	p.A252fs	HEMK1_ENST00000434410.1_Frame_Shift_Del_p.A252fs|HEMK1_ENST00000455834.1_Frame_Shift_Del_p.A252fs	NM_016173.3	NP_057257.1	Q9Y5R4	HEMK1_HUMAN	HemK methyltransferase family member 1	252					DNA methylation (GO:0006306)	mitochondrion (GO:0005739)	DNA binding (GO:0003677)|N-methyltransferase activity (GO:0008170)|protein methyltransferase activity (GO:0008276)			lung(3)	3				BRCA - Breast invasive adenocarcinoma(193;0.000283)|KIRC - Kidney renal clear cell carcinoma(197;0.0179)|Kidney(197;0.0212)		GAGCAGCTGGCCCCTGAGATC	0.617																																																	0													44.0	38.0	40.0					3																	50616342		2203	4300	6503	SO:0001589	frameshift_variant	0			AF172244	CCDS2830.1	3p21	2008-02-05			ENSG00000114735	ENSG00000114735			24923	protein-coding gene	gene with protein product						10690633	Standard	XM_005265218		Approved	MTQ1	uc003dav.3	Q9Y5R4	OTTHUMG00000156849	ENST00000232854.4:c.755delC	3.37:g.50616342delC	ENSP00000232854:p.Ala252fs			Frame_Shift_Del	DEL	pfam_Small_mtfrase_dom,pfam_RNA_methylase_dom,pfam_Ribosomal-L11_MeTrfase_PrmA,pfam_RNA_MeTrfase_RsmD,pfam_Methyltransf_11,prints_D21N6_MeTrfase,tigrfam_Release_fac_Glu-N5_MeTfrase,tigrfam_Modification_methylase_HemK	p.P253fs	ENST00000232854.4	37	c.755	CCDS2830.1	3																																																																																			HEMK1	-	pfam_Small_mtfrase_dom,pfam_Methyltransf_11,tigrfam_Release_fac_Glu-N5_MeTfrase,tigrfam_Modification_methylase_HemK	ENSG00000114735		0.617	HEMK1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HEMK1	HGNC	protein_coding	OTTHUMT00000346231.1		0.00	45	0	C	NM_016173		50616342	+1	tier1		no_errors	ENST00000232854	ensembl	human	known	74_37	frame_shift_del	6.90	27	2	DEL	0.998	-
HERC2	8924	genome.wustl.edu	37	15	28451412	28451412	+	Missense_Mutation	SNP	C	C	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr15:28451412C>T	ENST00000261609.7	-	45	7294	c.7186G>A	c.(7186-7188)Gcc>Acc	p.A2396T		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		TCAAATATGGCCTTCACAGGA	0.493																																																	0													2.0	2.0	2.0					15																	28451412		975	2237	3212	SO:0001583	missense	0			AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.7186G>A	15.37:g.28451412C>T	ENSP00000261609:p.Ala2396Thr			Missense_Mutation	SNP	pfam_Reg_chr_condens,pfam_HECT,pfam_CPH_domain,pfam_Mib_Herc2,pfam_Cyt_B5-like_heme/steroid-bd,pfam_Znf_ZZ,pfam_APC_su10/DOC_dom,superfamily_RCC1/BLIP-II,superfamily_HECT,superfamily_Galactose-bd-like,superfamily_Cyt_B5-like_heme/steroid-bd,superfamily_UBA-like,superfamily_CUB_dom,smart_Beta-propeller_rpt_TECPR,smart_Znf_ZZ,smart_HECT,pfscan_HECT,pfscan_Znf_ZZ,pfscan_Reg_chr_condens,pfscan_Cyt_B5-like_heme/steroid-bd,prints_Reg_chr_condens	p.A2396T	ENST00000261609.7	37	c.7186	CCDS10021.1	15	.	.	.	.	.	.	.	.	.	.	C	29.9	5.045144	0.93685	.	.	ENSG00000128731	ENST00000261609	T	0.59772	0.24	4.32	4.32	0.51571	.	0.063670	0.64402	D	0.000010	T	0.69387	0.3105	M	0.72894	2.215	0.80722	D	1	D	0.61697	0.99	P	0.54238	0.746	T	0.75625	-0.3253	10	0.72032	D	0.01	.	17.0659	0.86559	0.0:1.0:0.0:0.0	.	2396	O95714	HERC2_HUMAN	T	2396	ENSP00000261609:A2396T	ENSP00000261609:A2396T	A	-	1	0	HERC2	26125007	1.000000	0.71417	0.999000	0.59377	0.912000	0.54170	7.409000	0.80053	2.239000	0.73571	0.449000	0.29647	GCC	HERC2	-	NULL	ENSG00000128731		0.493	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC2	HGNC	protein_coding	OTTHUMT00000251358.2	-	0.00	215	0	C	NM_004667		28451412	-1	tier1	-	no_errors	ENST00000261609	ensembl	human	known	74_37	missense	61.54	40	64	SNP	1.000	T
HIVEP2	3097	genome.wustl.edu	37	6	143074876	143074876	+	Missense_Mutation	SNP	C	C	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr6:143074876C>T	ENST00000367604.1	-	9	7348	c.6709G>A	c.(6709-6711)Gtt>Att	p.V2237I	HIVEP2_ENST00000012134.2_Missense_Mutation_p.V2237I|RP1-67K17.3_ENST00000437067.1_RNA|HIVEP2_ENST00000367603.2_Missense_Mutation_p.V2237I			P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer binding protein 2	2237					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(19)|lung(35)|ovary(4)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	100				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		ATGGAGTGAACCATCTGGATC	0.557																																					Esophageal Squamous(107;843 1510 13293 16805 42198)												0													100.0	107.0	105.0					6																	143074876		1981	4144	6125	SO:0001583	missense	0			M60119	CCDS43510.1	6q23-q24	2013-01-08	2001-11-28		ENSG00000010818	ENSG00000010818		"""Zinc fingers, C2H2-type"""	4921	protein-coding gene	gene with protein product	"""c-myc intron binding protein 1"""	143054	"""human immunodeficiency virus type I enhancer-binding protein 2"""			1733857, 2022670	Standard	NM_006734		Approved	MBP-2, HIV-EP2, MIBP1, ZAS2, Schnurri-2, ZNF40B	uc003qjd.3	P31629	OTTHUMG00000015713	ENST00000367604.1:c.6709G>A	6.37:g.143074876C>T	ENSP00000356576:p.Val2237Ile		Q02646|Q5THT5|Q9NS05	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Znf_C2H2_jaz,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.V2237I	ENST00000367604.1	37	c.6709	CCDS43510.1	6	.	.	.	.	.	.	.	.	.	.	C	15.75	2.926209	0.52759	.	.	ENSG00000010818	ENST00000367604;ENST00000367603;ENST00000012134	T;T;T	0.04970	3.52;3.52;3.52	5.63	5.63	0.86233	.	0.104145	0.64402	D	0.000003	T	0.02807	0.0084	L	0.45228	1.405	0.49213	D	0.999768	P	0.38535	0.635	B	0.29862	0.108	T	0.44390	-0.9331	10	0.49607	T	0.09	-9.877	12.9656	0.58481	0.0:0.9261:0.0:0.0739	.	2237	P31629	ZEP2_HUMAN	I	2237	ENSP00000356576:V2237I;ENSP00000356575:V2237I;ENSP00000012134:V2237I	ENSP00000012134:V2237I	V	-	1	0	HIVEP2	143116569	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.320000	0.59203	2.668000	0.90789	0.655000	0.94253	GTT	HIVEP2	-	NULL	ENSG00000010818		0.557	HIVEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIVEP2	HGNC	protein_coding	OTTHUMT00000042495.1	-	0.00	117	0	C			143074876	-1	tier1	-	no_errors	ENST00000012134	ensembl	human	known	74_37	missense	7.04	66	5	SNP	1.000	T
HMG20B	10362	genome.wustl.edu	37	19	3576972	3576972	+	Missense_Mutation	SNP	G	G	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr19:3576972G>T	ENST00000333651.6	+	8	750	c.675G>T	c.(673-675)caG>caT	p.Q225H		NM_006339.2	NP_006330.2	Q9P0W2	HM20B_HUMAN	high mobility group 20B	225					blood coagulation (GO:0007596)|cell cycle (GO:0007049)|chromatin modification (GO:0016568)|negative regulation of protein sumoylation (GO:0033234)|positive regulation of neuron differentiation (GO:0045666)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)	1		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0025)|STAD - Stomach adenocarcinoma(1328;0.18)		GGCACACGCAGAGCATGAGCA	0.711																																																	0													10.0	12.0	11.0					19																	3576972		2127	4226	6353	SO:0001583	missense	0			BC003505	CCDS45919.1	19p13.3	2011-07-01	2011-04-05		ENSG00000064961	ENSG00000064961		"""High mobility group / Non-canonical"""	5002	protein-coding gene	gene with protein product	"""HMG box domain containing 2"""	605535	"""high-mobility group 20B"""			10773667	Standard	NM_006339		Approved	SOXL, HMGX2, BRAF35, SMARCE1r, BRAF25, HMGXB2	uc002lya.3	Q9P0W2	OTTHUMG00000150437	ENST00000333651.6:c.675G>T	19.37:g.3576972G>T	ENSP00000328269:p.Gln225His		A6NMS5|D6W616|Q6IBP8|Q8NBD5|Q9HD21|Q9Y491|Q9Y4A2	Missense_Mutation	SNP	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.Q225H	ENST00000333651.6	37	c.675	CCDS45919.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	25.0|25.0	4.588158|4.588158	0.86851|0.86851	.|.	.|.	ENSG00000064961|ENSG00000064961	ENST00000402569|ENST00000333651;ENST00000262949	.|T	.|0.68181	.|-0.31	4.21|4.21	4.21|4.21	0.49690|0.49690	.|.	.|0.465133	.|0.19445	.|U	.|0.114098	.|T	.|0.62672	.|0.2447	L|L	0.44542|0.44542	1.39|1.39	0.33309|0.33309	D|D	0.565824|0.565824	.|P;P	.|0.44986	.|0.847;0.847	.|B;B	.|0.42738	.|0.396;0.396	.|T	.|0.76242	.|-0.3031	.|10	0.87932|0.72032	D|D	0|0.01	-19.224|-19.224	15.1338|15.1338	0.72545|0.72545	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|225;225	.|A8K0D5;Q9P0W2	.|.;HM20B_HUMAN	X|H	55|225;242	.|ENSP00000328269:Q225H	ENSP00000385987:E55X|ENSP00000262949:Q242H	E|Q	+|+	1|3	0|2	HMG20B|HMG20B	3527972|3527972	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	3.983000|3.983000	0.56916|0.56916	1.899000|1.899000	0.54978|0.54978	0.472000|0.472000	0.43445|0.43445	GAG|CAG	HMG20B	-	NULL	ENSG00000064961		0.711	HMG20B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMG20B	HGNC	protein_coding	OTTHUMT00000318088.1	-	0.00	85	0	G	NM_006339		3576972	+1	tier1	-	no_errors	ENST00000333651	ensembl	human	known	74_37	missense	7.84	47	4	SNP	1.000	T
HNRNPCL1	343069	genome.wustl.edu	37	1	12908030	12908030	+	Missense_Mutation	SNP	G	G	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr1:12908030G>A	ENST00000317869.6	-	2	338	c.113C>T	c.(112-114)tCc>tTc	p.S38F		NM_001013631.1|NM_001136561.2|NM_001146181.1	NP_001013653.1|NP_001130033.2|NP_001139653.1	O60812	HNRC1_HUMAN	heterogeneous nuclear ribonucleoprotein C-like 1	38	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.					nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|stomach(2)	29						GCCATACTTGGAAAAGATCGC	0.468																																																	0													152.0	142.0	145.0					1																	12908030		2203	4300	6503	SO:0001583	missense	0			BC002696	CCDS30591.1	1p36.21	2013-02-12		2008-04-18	ENSG00000179172	ENSG00000179172		"""RNA binding motif (RRM) containing"""	29295	protein-coding gene	gene with protein product				HNRPCL1			Standard	NM_001013631		Approved			O60812	OTTHUMG00000001931	ENST00000317869.6:c.113C>T	1.37:g.12908030G>A	ENSP00000365370:p.Ser38Phe		B2RP44	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pirsf_hnRNP_C_Raly,pfscan_RRM_dom	p.S38F	ENST00000317869.6	37	c.113	CCDS30591.1	1	.	.	.	.	.	.	.	.	.	.	G	12.10	1.837741	0.32513	.	.	ENSG00000179172	ENST00000317869	T	0.20069	2.1	1.09	-1.16	0.09678	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.283854	0.28171	U	0.016324	T	0.49660	0.1570	H	0.96720	3.87	0.40789	D	0.98324	D	0.62365	0.991	D	0.65684	0.937	T	0.49597	-0.8923	10	0.87932	D	0	.	5.2202	0.15364	0.4047:0.0:0.5953:0.0	.	38	O60812	HNRCL_HUMAN	F	38	ENSP00000365370:S38F	ENSP00000365370:S38F	S	-	2	0	HNRNPCL1	12830617	1.000000	0.71417	0.006000	0.13384	0.014000	0.08584	3.302000	0.51849	-0.408000	0.07565	0.416000	0.27883	TCC	HNRNPCL1	-	pfam_RRM_dom,smart_RRM_dom,pirsf_hnRNP_C_Raly,pfscan_RRM_dom	ENSG00000179172		0.468	HNRNPCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HNRNPCL1	HGNC	protein_coding	OTTHUMT00000005462.1	-	0.00	375	0	G	NM_001013631		12908030	-1	tier1	-	no_errors	ENST00000317869	ensembl	human	known	74_37	missense	9.58	217	23	SNP	0.998	A
HYDIN	54768	genome.wustl.edu	37	16	70995941	70995941	+	Nonsense_Mutation	SNP	C	C	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr16:70995941C>T	ENST00000393567.2	-	38	6039	c.5889G>A	c.(5887-5889)tgG>tgA	p.W1963*		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	1963					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				ACAGGGCGTGCCATTCTTCCA	0.468																																																	0													14.0	22.0	20.0					16																	70995941		1773	4018	5791	SO:0001587	stop_gained	0			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.5889G>A	16.37:g.70995941C>T	ENSP00000377197:p.Trp1963*		A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Nonsense_Mutation	SNP	superfamily_P-loop_NTPase,superfamily_PapD-like	p.W1963*	ENST00000393567.2	37	c.5889	CCDS59269.1	16	.	.	.	.	.	.	.	.	.	.	C	45	11.370455	0.99552	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	.	.	.	4.32	-3.34	0.04943	.	0.618847	0.11646	U	0.543333	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	.	5.347	0.16014	0.0:0.2546:0.4521:0.2933	.	.	.	.	X	1963;1962	.	ENSP00000310485:W254X	W	-	3	0	HYDIN	69553442	0.000000	0.05858	0.003000	0.11579	0.001000	0.01503	-0.817000	0.04472	-0.187000	0.10516	-0.430000	0.05897	TGG	HYDIN	-	NULL	ENSG00000157423		0.468	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	HYDIN	HGNC	protein_coding	OTTHUMT00000398624.3		0.00	22	0	C			70995941	-1			no_errors	ENST00000393567	ensembl	human	putative	74_37	nonsense	12.00	22	3	SNP	0.000	T
IDH2	3418	genome.wustl.edu	37	15	90631610	90631610	+	Missense_Mutation	SNP	C	C	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr15:90631610C>T	ENST00000330062.3	-	5	772	c.659G>A	c.(658-660)gGc>gAc	p.G220D	IDH2_ENST00000540499.2_Missense_Mutation_p.G168D|IDH2_ENST00000559482.1_Missense_Mutation_p.G111D|IDH2_ENST00000539790.1_Missense_Mutation_p.G90D	NM_002168.2	NP_002159.2	P48735	IDHP_HUMAN	isocitrate dehydrogenase 2 (NADP+), mitochondrial	220					2-oxoglutarate metabolic process (GO:0006103)|carbohydrate metabolic process (GO:0005975)|cellular metabolic process (GO:0044237)|glyoxylate cycle (GO:0006097)|isocitrate metabolic process (GO:0006102)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	isocitrate dehydrogenase (NADP+) activity (GO:0004450)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)			biliary_tract(11)|bone(19)|central_nervous_system(107)|endometrium(1)|haematopoietic_and_lymphoid_tissue(953)|large_intestine(8)|lung(5)|skin(5)	1109	Melanoma(11;0.00551)|Lung NSC(78;0.0196)|all_lung(78;0.04)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.106)			GTTGTACATGCCCATGCCCAC	0.582			M		GBM																																			Dom	yes		15	15q26.1	3418	"""socitrate dehydrogenase 2 (NADP+), mitochondrial """		M	0													101.0	97.0	99.0					15																	90631610		2200	4298	6498	SO:0001583	missense	0				CCDS10359.1	15q26.1	2014-09-17			ENSG00000182054	ENSG00000182054	1.1.1.42		5383	protein-coding gene	gene with protein product		147650					Standard	NM_001289910		Approved		uc002box.3	P48735	OTTHUMG00000149815	ENST00000330062.3:c.659G>A	15.37:g.90631610C>T	ENSP00000331897:p.Gly220Asp		B2R6L6|B4DFL2|Q96GT3	Missense_Mutation	SNP	pfam_IsoPropMal-DH-like_dom,pirsf_Isocitrate_DH_NADP,tigrfam_Isocitrate_DH_NADP	p.G220D	ENST00000330062.3	37	c.659	CCDS10359.1	15	.	.	.	.	.	.	.	.	.	.	C	25.2	4.612917	0.87258	.	.	ENSG00000182054	ENST00000330062;ENST00000539790;ENST00000540499	T;T;T	0.68025	-0.3;-0.3;-0.3	5.8	5.8	0.92144	Isopropylmalate dehydrogenase-like domain (2);	0.000000	0.85682	D	0.000000	D	0.86657	0.5985	H	0.95402	3.665	0.80722	D	1	D;D	0.62365	0.991;0.99	P;D	0.64042	0.891;0.921	D	0.90124	0.4201	10	0.87932	D	0	.	17.553	0.87881	0.0:1.0:0.0:0.0	.	220;220	Q53GL5;P48735	.;IDHP_HUMAN	D	220;90;168	ENSP00000331897:G220D;ENSP00000438457:G90D;ENSP00000446147:G168D	ENSP00000331897:G220D	G	-	2	0	IDH2	88432614	1.000000	0.71417	1.000000	0.80357	0.769000	0.43574	7.461000	0.80834	2.747000	0.94245	0.462000	0.41574	GGC	IDH2	-	pfam_IsoPropMal-DH-like_dom,pirsf_Isocitrate_DH_NADP,tigrfam_Isocitrate_DH_NADP	ENSG00000182054		0.582	IDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IDH2	HGNC	protein_coding	OTTHUMT00000313426.1	-	0.00	80	0	C			90631610	-1	tier1	-	no_errors	ENST00000330062	ensembl	human	known	74_37	missense	6.90	54	4	SNP	1.000	T
IGF2R	3482	genome.wustl.edu	37	6	160430068	160430068	+	Nonsense_Mutation	SNP	A	A	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr6:160430068A>T	ENST00000356956.1	+	3	464	c.316A>T	c.(316-318)Aga>Tga	p.R106*	AIRN_ENST00000601203.1_RNA|AIRN_ENST00000609176.1_RNA	NM_000876.2	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor	106					insulin-like growth factor receptor signaling pathway (GO:0048009)|liver development (GO:0001889)|organ regeneration (GO:0031100)|positive regulation of apoptotic process (GO:0043065)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	cell surface (GO:0009986)|clathrin coat (GO:0030118)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network transport vesicle (GO:0030140)	G-protein coupled receptor activity (GO:0004930)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|insulin-like growth factor-activated receptor activity (GO:0005010)|mannose binding (GO:0005537)|phosphoprotein binding (GO:0051219)|receptor activity (GO:0004872)|retinoic acid binding (GO:0001972)|transporter activity (GO:0005215)			breast(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(27)|lung(31)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)	Mecasermin(DB01277)	AAGTGCAACCAGATCTCTCCT	0.443																																																	0													119.0	114.0	116.0					6																	160430068		2203	4300	6503	SO:0001587	stop_gained	0			J03528	CCDS5273.1	6q25.3	2014-09-16			ENSG00000197081	ENSG00000197081		"""CD molecules"""	5467	protein-coding gene	gene with protein product	"""cation-independent mannose-6 phosphate receptor"""	147280					Standard	NM_000876		Approved	CD222, MPRI, MPR1, CIMPR, M6P-R	uc003qta.3	P11717	OTTHUMG00000015945	ENST00000356956.1:c.316A>T	6.37:g.160430068A>T	ENSP00000349437:p.Arg106*		Q7Z7G9|Q96PT5	Nonsense_Mutation	SNP	pfam_CIMR,pfam_FN_type2_col-bd,superfamily_Man6P_isomerase_rcpt-bd_dom,superfamily_Kringle-like,smart_FN_type2_col-bd,pfscan_FN_type2_col-bd	p.R106*	ENST00000356956.1	37	c.316	CCDS5273.1	6	.	.	.	.	.	.	.	.	.	.	A	21.3	4.132056	0.77662	.	.	ENSG00000197081	ENST00000356956	.	.	.	5.49	4.31	0.51392	.	0.477242	0.27027	N	0.021289	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10111	T	0.7	-16.8478	11.9194	0.52783	0.8539:0.1461:0.0:0.0	.	.	.	.	X	106	.	ENSP00000349437:R106X	R	+	1	2	IGF2R	160350058	0.981000	0.34729	0.088000	0.20740	0.100000	0.18952	2.205000	0.42770	0.982000	0.38575	0.533000	0.62120	AGA	IGF2R	-	superfamily_Man6P_isomerase_rcpt-bd_dom	ENSG00000197081		0.443	IGF2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGF2R	HGNC	protein_coding	OTTHUMT00000042931.1	-	0.00	56	0	A	NM_000876		160430068	+1	tier1	-	no_errors	ENST00000356956	ensembl	human	known	74_37	nonsense	13.33	26	4	SNP	0.000	T
IL17RD	54756	genome.wustl.edu	37	3	57136596	57136596	+	Missense_Mutation	SNP	G	G	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr3:57136596G>T	ENST00000296318.7	-	10	978	c.890C>A	c.(889-891)cCc>cAc	p.P297H	IL17RD_ENST00000320057.5_Missense_Mutation_p.P153H|IL17RD_ENST00000463523.1_Missense_Mutation_p.P153H|IL17RD_ENST00000427856.2_Missense_Mutation_p.P273H	NM_017563.3	NP_060033.3	Q8NFM7	I17RD_HUMAN	interleukin 17 receptor D	297					signal transduction (GO:0007165)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(1)|ovary(1)|pancreas(1)	16				KIRC - Kidney renal clear cell carcinoma(284;0.0173)|Kidney(284;0.0204)		GGCTCTGATGGGCCCGGCCCA	0.463																																																	0													51.0	54.0	53.0					3																	57136596		2203	4300	6503	SO:0001583	missense	0			AF494208	CCDS2880.2	3p21.1	2008-02-05			ENSG00000144730	ENSG00000144730		"""Interleukins and interleukin receptors"""	17616	protein-coding gene	gene with protein product		606807				11802164, 12604616	Standard	NM_017563		Approved	SEF, IL17RLM, FLJ35755, IL-17RD	uc003dil.3	Q8NFM7	OTTHUMG00000150171	ENST00000296318.7:c.890C>A	3.37:g.57136596G>T	ENSP00000296318:p.Pro297His		Q2NKP7|Q58EZ7|Q6RVF4|Q6UWI5|Q8N113|Q8NFS0|Q9UFA0	Missense_Mutation	SNP	pfam_SEFIR,superfamily_TIR_dom	p.P297H	ENST00000296318.7	37	c.890	CCDS2880.2	3	.	.	.	.	.	.	.	.	.	.	G	31	5.062726	0.93898	.	.	ENSG00000144730	ENST00000296318;ENST00000320057;ENST00000427856;ENST00000463523	T;T;T;T	0.16324	2.35;2.36;2.36;2.36	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.34483	0.0899	L	0.34521	1.04	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.998;1.0	T	0.03364	-1.1044	10	0.87932	D	0	-6.9731	19.5489	0.95310	0.0:0.0:1.0:0.0	.	153;297;273	B4DXM5;Q8NFM7;Q8NFM7-3	.;I17RD_HUMAN;.	H	297;153;273;153	ENSP00000296318:P297H;ENSP00000322250:P153H;ENSP00000399209:P273H;ENSP00000417516:P153H	ENSP00000296318:P297H	P	-	2	0	IL17RD	57111636	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	9.202000	0.95026	2.850000	0.98022	0.655000	0.94253	CCC	IL17RD	-	NULL	ENSG00000144730		0.463	IL17RD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	IL17RD	HGNC	protein_coding	OTTHUMT00000316680.1	-	0.00	99	0	G	NM_017563		57136596	-1	tier1	-	no_errors	ENST00000296318	ensembl	human	known	74_37	missense	5.41	70	4	SNP	1.000	T
IL1RL2	8808	genome.wustl.edu	37	2	102808451	102808451	+	Silent	SNP	T	T	C			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr2:102808451T>C	ENST00000264257.2	+	4	486	c.360T>C	c.(358-360)acT>acC	p.T120T	IL1RL2_ENST00000441515.2_Intron|IL1RL2_ENST00000481806.1_Intron|IL1RL2_ENST00000539491.1_Silent_p.T120T	NM_003854.2	NP_003845.2	Q9HB29	ILRL2_HUMAN	interleukin 1 receptor-like 2	120					cellular defense response (GO:0006968)|cytokine-mediated signaling pathway (GO:0019221)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of T cell differentiation (GO:0045582)|regulation of inflammatory response (GO:0050727)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type I, activating receptor activity (GO:0004909)			breast(1)|cervix(1)|endometrium(5)|large_intestine(6)|liver(2)|lung(8)|ovary(2)|prostate(1)	26						GGTGTGACACTTCCATAGGTG	0.368																																																	0													104.0	102.0	102.0					2																	102808451		2203	4300	6503	SO:0001819	synonymous_variant	0			U49065	CCDS2056.1	2q12	2013-01-14			ENSG00000115598	ENSG00000115598		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5999	protein-coding gene	gene with protein product		604512				8898719, 10191101, 11466363	Standard	NM_003854		Approved	IL1R-rp2, IL1RRP2	uc002tbs.3	Q9HB29	OTTHUMG00000130776	ENST00000264257.2:c.360T>C	2.37:g.102808451T>C			A4FU63|Q13525|Q45H74|Q53TU8|Q587I8	Silent	SNP	pfam_TIR_dom,superfamily_TIR_dom,smart_Ig_sub,smart_TIR_dom,pfscan_TIR_dom,pfscan_Ig-like_dom,prints_IL-1_rcpt_I/II-typ,prints_IL-1_rcpt_I-typ	p.T120	ENST00000264257.2	37	c.360	CCDS2056.1	2																																																																																			IL1RL2	-	NULL	ENSG00000115598		0.368	IL1RL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL1RL2	HGNC	protein_coding	OTTHUMT00000253290.1	-	0.00	78	0	T	NM_003854		102808451	+1	tier1	-	no_errors	ENST00000264257	ensembl	human	known	74_37	silent	15.38	55	10	SNP	0.007	C
ILF2	3608	genome.wustl.edu	37	1	153641012	153641012	+	Missense_Mutation	SNP	C	C	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr1:153641012C>T	ENST00000361891.4	-	4	255	c.130G>A	c.(130-132)Gtc>Atc	p.V44I	ILF2_ENST00000368681.1_Missense_Mutation_p.V44I	NM_001267809.1|NM_004515.3	NP_001254738.1|NP_004506.2	Q12905	ILF2_HUMAN	interleukin enhancer binding factor 2	44	DZF. {ECO:0000255|PROSITE- ProRule:PRU01040}.				immune response (GO:0006955)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|transferase activity (GO:0016740)			cervix(1)|kidney(1)|lung(4)|skin(1)	7	all_lung(78;1.84e-32)|Lung NSC(65;6.67e-31)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)			GCTGGCTTGACCCGGGGAAAG	0.438																																																	0													62.0	57.0	58.0					1																	153641012		2203	4300	6503	SO:0001583	missense	0			U10323	CCDS1050.1, CCDS72919.1	1q21.3	2012-12-04	2012-12-04		ENSG00000143621	ENSG00000143621			6037	protein-coding gene	gene with protein product		603181	"""interleukin enhancer binding factor 2, 45kD"", ""interleukin enhancer binding factor 2, 45kDa"""			7519613	Standard	NM_004515		Approved	NF45	uc001fcr.4	Q12905	OTTHUMG00000037087	ENST00000361891.4:c.130G>A	1.37:g.153641012C>T	ENSP00000355011:p.Val44Ile		A6NDB0|B2R8G7|Q5SR10|Q5SR11|Q7L7R3|Q9BWD4|Q9P1N0	Missense_Mutation	SNP	pfam_DZF,smart_DZF,pfscan_2-5-oligoadenylate_synth_N	p.V44I	ENST00000361891.4	37	c.130	CCDS1050.1	1	.	.	.	.	.	.	.	.	.	.	C	17.91	3.503813	0.64410	.	.	ENSG00000143621	ENST00000361891;ENST00000368684;ENST00000368681	T	0.48836	0.8	5.22	3.29	0.37713	.	0.063958	0.64402	D	0.000008	T	0.24774	0.0601	L	0.46819	1.47	0.58432	D	0.999996	B;P;P	0.40834	0.36;0.73;0.61	B;B;B	0.39339	0.062;0.297;0.156	T	0.03344	-1.1046	10	0.45353	T	0.12	-13.6793	10.0397	0.42151	0.1559:0.694:0.1501:0.0	.	6;44;44	B4DY09;F4ZW62;Q12905	.;.;ILF2_HUMAN	I	44;6;44	ENSP00000355011:V44I	ENSP00000355011:V44I	V	-	1	0	ILF2	151907636	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	6.910000	0.75741	0.563000	0.29222	-0.176000	0.13171	GTC	ILF2	-	NULL	ENSG00000143621		0.438	ILF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ILF2	HGNC	protein_coding	OTTHUMT00000090040.1	-	0.00	75	0	C	NM_004515		153641012	-1	tier1	-	no_errors	ENST00000361891	ensembl	human	known	74_37	missense	9.76	36	4	SNP	1.000	T
IQGAP1	8826	genome.wustl.edu	37	15	91025491	91025491	+	Missense_Mutation	SNP	C	C	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr15:91025491C>T	ENST00000268182.5	+	28	3657	c.3533C>T	c.(3532-3534)gCt>gTt	p.A1178V	IQGAP1_ENST00000560738.1_Missense_Mutation_p.A606V	NM_003870.3	NP_003861.1	P46940	IQGA1_HUMAN	IQ motif containing GTPase activating protein 1	1178	C1.|Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.				cellular response to calcium ion (GO:0071277)|cellular response to epidermal growth factor stimulus (GO:0071364)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerular visceral epithelial cell development (GO:0072015)|negative regulation of catalytic activity (GO:0043086)|negative regulation of dephosphorylation (GO:0035305)|neuron projection extension (GO:1990138)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|regulation of cytokine production (GO:0001817)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	actin filament (GO:0005884)|axon (GO:0030424)|cell junction (GO:0030054)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|lateral plasma membrane (GO:0016328)|microtubule (GO:0005874)|midbody (GO:0030496)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activator activity (GO:0043539)|Ras GTPase activator activity (GO:0005099)			breast(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|liver(1)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59	Melanoma(11;0.00551)|Lung NSC(78;0.0237)|all_lung(78;0.0488)		BRCA - Breast invasive adenocarcinoma(143;0.0745)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)			TTCCCTGATGCTGGTGAGGAT	0.493											OREG0023473	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													114.0	99.0	104.0					15																	91025491		2198	4298	6496	SO:0001583	missense	0			D29640	CCDS10362.1	15q26.1	2008-07-18			ENSG00000140575	ENSG00000140575			6110	protein-coding gene	gene with protein product	"""RasGAP-like with IQ motifs"""	603379				8051149, 8670801	Standard	XM_005254984		Approved	p195, KIAA0051, SAR1, HUMORFA01	uc002bpl.1	P46940	OTTHUMG00000149832	ENST00000268182.5:c.3533C>T	15.37:g.91025491C>T	ENSP00000268182:p.Ala1178Val	1279	A7MBM3	Missense_Mutation	SNP	pfam_RasGAP,pfam_RasGAP_C,pfam_IQ_motif_EF-hand-BS,pfam_CH-domain,pfam_WW_dom,superfamily_Rho_GTPase_activation_prot,superfamily_CH-domain,superfamily_P-loop_NTPase,smart_CH-domain,smart_WW_dom,smart_IQ_motif_EF-hand-BS,smart_RasGAP,pfscan_CH-domain,pfscan_IQ_motif_EF-hand-BS,pfscan_WW_dom,pfscan_RasGAP	p.A1178V	ENST00000268182.5	37	c.3533	CCDS10362.1	15	.	.	.	.	.	.	.	.	.	.	C	23.9	4.474170	0.84640	.	.	ENSG00000140575	ENST00000268182	T	0.80909	-1.43	6.17	6.17	0.99709	Rho GTPase activation protein (1);Ras GTPase-activating protein (4);	0.000000	0.85682	D	0.000000	D	0.83229	0.5209	M	0.86573	2.825	0.80722	D	1	P	0.37441	0.595	B	0.33392	0.163	D	0.84336	0.0524	10	0.52906	T	0.07	-16.3266	18.0354	0.89301	0.0:1.0:0.0:0.0	.	1178	P46940	IQGA1_HUMAN	V	1178	ENSP00000268182:A1178V	ENSP00000268182:A1178V	A	+	2	0	IQGAP1	88826495	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.671000	0.83941	2.941000	0.99782	0.655000	0.94253	GCT	IQGAP1	-	pfam_RasGAP,superfamily_Rho_GTPase_activation_prot,smart_RasGAP,pfscan_RasGAP	ENSG00000140575		0.493	IQGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQGAP1	HGNC	protein_coding	OTTHUMT00000313493.1		0.00	103	0	C	NM_003870		91025491	+1			no_errors	ENST00000268182	ensembl	human	known	74_37	missense	5.71	66	4	SNP	1.000	T
ITPR2	3709	genome.wustl.edu	37	12	26639167	26639167	+	Missense_Mutation	SNP	G	G	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr12:26639167G>T	ENST00000381340.3	-	41	6097	c.5681C>A	c.(5680-5682)aCa>aAa	p.T1894K		NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	1894					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)		ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	TTCTGGTCCTGTGCACATAAT	0.423																																																	0													243.0	230.0	234.0					12																	26639167		1910	4124	6034	SO:0001583	missense	0			D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.5681C>A	12.37:g.26639167G>T	ENSP00000370744:p.Thr1894Lys		O94773	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ARM-type_fold,smart_MIR_motif,prints_InsP3_rcpt-bd,pfscan_MIR_motif	p.T1894K	ENST00000381340.3	37	c.5681	CCDS41764.1	12	.	.	.	.	.	.	.	.	.	.	G	6.606	0.480138	0.12581	.	.	ENSG00000123104	ENST00000381340	D	0.91237	-2.81	5.07	4.14	0.48551	.	0.839775	0.11044	N	0.605760	T	0.82006	0.4943	N	0.19112	0.55	0.23903	N	0.996512	B	0.13594	0.008	B	0.09377	0.004	T	0.60281	-0.7294	10	0.06099	T	0.92	.	14.2754	0.66177	0.0:0.2753:0.7247:0.0	.	1894	Q14571	ITPR2_HUMAN	K	1894	ENSP00000370744:T1894K	ENSP00000370744:T1894K	T	-	2	0	ITPR2	26530434	0.111000	0.22076	0.029000	0.17559	0.885000	0.51271	2.641000	0.46587	2.627000	0.88993	0.655000	0.94253	ACA	ITPR2	-	superfamily_ARM-type_fold	ENSG00000123104		0.423	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPR2	HGNC	protein_coding	OTTHUMT00000402732.1		0.00	74	0	G	NM_002223		26639167	-1			no_errors	ENST00000381340	ensembl	human	known	74_37	missense	6.45	58	4	SNP	0.155	T
JARID2	3720	genome.wustl.edu	37	6	15497080	15497080	+	Missense_Mutation	SNP	G	G	T	rs143082189	byFrequency	TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr6:15497080G>T	ENST00000341776.2	+	7	1868	c.1624G>T	c.(1624-1626)Gcc>Tcc	p.A542S	JARID2_ENST00000397311.3_Missense_Mutation_p.A370S|JARID2_ENST00000541660.1_Missense_Mutation_p.A504S	NM_004973.3	NP_004964.2	Q92833	JARD2_HUMAN	jumonji, AT rich interactive domain 2	542					central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|liver development (GO:0001889)|negative regulation of cell proliferation (GO:0008285)|negative regulation of histone methylation (GO:0031061)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K9 methylation (GO:0051574)|spleen development (GO:0048536)|stem cell differentiation (GO:0048863)|thymus development (GO:0048538)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(5)|stomach(1)	59	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)				CTCGGGCAAGGCCGAGAAGGG	0.652																																																	0													24.0	27.0	26.0					6																	15497080		2202	4298	6500	SO:0001583	missense	0			U57592	CCDS4533.1, CCDS58996.1	6p24-p23	2008-02-05	2006-10-06	2004-01-30	ENSG00000008083	ENSG00000008083			6196	protein-coding gene	gene with protein product		601594	"""jumonji (mouse) homolog"", ""Jumonji, AT rich interactive domain 2"""	JMJ		8894700	Standard	NM_001267040		Approved		uc003nbj.4	Q92833	OTTHUMG00000014293	ENST00000341776.2:c.1624G>T	6.37:g.15497080G>T	ENSP00000341280:p.Ala542Ser		A8K9Z6|B7Z5S5|B7Z8L0|Q5U5L5|Q86X63	Missense_Mutation	SNP	pfam_JmjC_dom,pfam_ARID/BRIGHT_DNA-bd,pfam_TF_JmjN,pfam_Znf_C5HC2,superfamily_ARID/BRIGHT_DNA-bd,smart_TF_JmjN,smart_ARID/BRIGHT_DNA-bd,smart_JmjC_dom,pfscan_TF_JmjN,pfscan_JmjC_dom,pfscan_ARID/BRIGHT_DNA-bd	p.A542S	ENST00000341776.2	37	c.1624	CCDS4533.1	6	.	.	.	.	.	.	.	.	.	.	G	7.749	0.702985	0.15172	.	.	ENSG00000008083	ENST00000538175;ENST00000341776;ENST00000397311;ENST00000541660	D;D;D	0.88431	-1.75;-1.75;-2.38	5.29	2.36	0.29203	.	1.029180	0.07636	N	0.929459	T	0.60495	0.2273	N	0.12182	0.205	0.26219	N	0.979185	B;B;B	0.23249	0.082;0.005;0.02	B;B;B	0.21708	0.036;0.006;0.01	T	0.50600	-0.8809	10	0.09084	T	0.74	-1.3096	11.1643	0.48533	0.1227:0.4192:0.4581:0.0	.	504;406;542	F5H590;B7Z7X9;Q92833	.;.;JARD2_HUMAN	S	406;542;370;504	ENSP00000341280:A542S;ENSP00000380478:A370S;ENSP00000444623:A504S	ENSP00000341280:A542S	A	+	1	0	JARID2	15605059	0.982000	0.34865	0.998000	0.56505	0.725000	0.41563	1.853000	0.39358	0.605000	0.29947	0.561000	0.74099	GCC	JARID2	-	NULL	ENSG00000008083		0.652	JARID2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	JARID2	HGNC	protein_coding	OTTHUMT00000039926.1	-	0.00	78	0	G	NM_004973		15497080	+1	tier1	-	no_errors	ENST00000341776	ensembl	human	known	74_37	missense	11.11	32	4	SNP	0.993	T
KCNG1	3755	genome.wustl.edu	37	20	49626754	49626754	+	Missense_Mutation	SNP	C	C	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr20:49626754C>T	ENST00000371571.4	-	2	407	c.122G>A	c.(121-123)cGc>cAc	p.R41H	KCNG1_ENST00000396017.3_Missense_Mutation_p.R41H|RP5-955M13.4_ENST00000424566.1_RNA|KCNG1_ENST00000506387.1_5'Flank	NM_002237.3	NP_002228.2	Q9UIX4	KCNG1_HUMAN	potassium voltage-gated channel, subfamily G, member 1	41					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)	p.R41H(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(11)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	35						CTGCGCCCGGCGGTAGAACGC	0.682																																																	1	Substitution - Missense(1)	large_intestine(1)											17.0	20.0	19.0					20																	49626754		2185	4244	6429	SO:0001583	missense	0			AF033383	CCDS13436.1	20q13	2011-07-05			ENSG00000026559	ENSG00000026559		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6248	protein-coding gene	gene with protein product		603788		KCNG		9434767, 16382104	Standard	NM_002237		Approved	Kv6.1, kH2, K13	uc002xwa.4	Q9UIX4	OTTHUMG00000032745	ENST00000371571.4:c.122G>A	20.37:g.49626754C>T	ENSP00000360626:p.Arg41His		A8K3S4|O43528|Q5JXL5|Q9BRC1	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv6,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv3	p.R41H	ENST00000371571.4	37	c.122	CCDS13436.1	20	.	.	.	.	.	.	.	.	.	.	C	14.75	2.629925	0.46944	.	.	ENSG00000026559	ENST00000371571;ENST00000396017;ENST00000439216;ENST00000424171;ENST00000433903;ENST00000447736	D;D;D;D	0.98028	-4.67;-2.74;-3.32;-3.6	5.87	4.93	0.64822	.	1.096560	0.06710	N	0.773060	D	0.96953	0.9005	L	0.53249	1.67	0.34128	D	0.664881	D;B	0.63046	0.992;0.015	P;B	0.51582	0.674;0.016	D	0.94084	0.7347	9	.	.	.	.	5.6701	0.17717	0.0:0.7438:0.0:0.2562	.	41;41	Q9UIX4-2;Q9UIX4	.;KCNG1_HUMAN	H	41	ENSP00000360626:R41H;ENSP00000379338:R41H;ENSP00000394075:R41H;ENSP00000394093:R41H	.	R	-	2	0	KCNG1	49060161	1.000000	0.71417	0.992000	0.48379	0.383000	0.30230	3.979000	0.56888	2.800000	0.96347	0.456000	0.33151	CGC	KCNG1	-	NULL	ENSG00000026559		0.682	KCNG1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KCNG1	HGNC	protein_coding	OTTHUMT00000079726.4		0.00	32	0	C	NM_002237		49626754	-1			no_errors	ENST00000371571	ensembl	human	known	74_37	missense	8.00	23	2	SNP	0.999	T
KCNMA1	3778	genome.wustl.edu	37	10	78944583	78944583	+	Missense_Mutation	SNP	G	G	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr10:78944583G>A	ENST00000286628.8	-	4	693	c.694C>T	c.(694-696)Cgg>Tgg	p.R232W	KCNMA1_ENST00000404771.3_Missense_Mutation_p.R232W|KCNMA1_ENST00000354353.5_Missense_Mutation_p.R232W|KCNMA1_ENST00000406533.3_Missense_Mutation_p.R232W|KCNMA1_ENST00000372443.1_Missense_Mutation_p.R232W|KCNMA1_ENST00000286627.5_Missense_Mutation_p.R232W|KCNMA1_ENST00000372440.1_Missense_Mutation_p.R232W|KCNMA1_ENST00000404857.1_Missense_Mutation_p.R232W	NM_001161352.1	NP_001154824.1	Q12791	KCMA1_HUMAN	potassium large conductance calcium-activated channel, subfamily M, alpha member 1	232					blood coagulation (GO:0007596)|cellular potassium ion homeostasis (GO:0030007)|micturition (GO:0060073)|negative regulation of cell volume (GO:0045794)|positive regulation of apoptotic process (GO:0043065)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|response to calcium ion (GO:0051592)|response to carbon monoxide (GO:0034465)|response to hypoxia (GO:0001666)|response to osmotic stress (GO:0006970)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	actin binding (GO:0003779)|calcium-activated potassium channel activity (GO:0015269)|large conductance calcium-activated potassium channel activity (GO:0060072)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(17)|lung(23)|ovary(2)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	68	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Chlorzoxazone(DB00356)|Cromoglicic acid(DB01003)|Diazoxide(DB01119)|Halothane(DB01159)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Miconazole(DB01110)|Procaine(DB00721)	AAACTTACCCGCAAGCCGAAG	0.458																																																	0													144.0	130.0	135.0					10																	78944583		2203	4300	6503	SO:0001583	missense	0			U11717	CCDS7352.1, CCDS60569.1, CCDS60571.1, CCDS60572.1, CCDS73156.1	10q22	2012-07-05			ENSG00000156113	ENSG00000156113		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6284	protein-coding gene	gene with protein product	"""BK channel alpha subunit"""	600150		SLO		7987297, 16382103	Standard	NM_002247		Approved	KCa1.1, mSLO1	uc001jxn.3	Q12791	OTTHUMG00000018543	ENST00000286628.8:c.694C>T	10.37:g.78944583G>A	ENSP00000286628:p.Arg232Trp		F8WA96|Q12886|Q12917|Q12921|Q12960|Q13150|Q5JQ23|Q5SQR9|Q96LG8|Q9UBB0|Q9UCX0|Q9UQK6	Missense_Mutation	SNP	pfam_K_chnl_Ca-activ_BK_asu,pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,pfam_RCK_N,prints_K_chnl_Ca-activ_BK_asu,prints_K_chnl	p.R232W	ENST00000286628.8	37	c.694		10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.63|18.63	3.666126|3.666126	0.67700|0.67700	.|.	.|.	ENSG00000156113|ENSG00000156113	ENST00000372421|ENST00000372440;ENST00000372408;ENST00000372437;ENST00000457953;ENST00000404771;ENST00000372443;ENST00000286627;ENST00000286628;ENST00000406533;ENST00000354353;ENST00000404857;ENST00000412708	.|D;D;D;D;D;D;D;D;D	.|0.98732	.|-5.1;-5.1;-5.1;-5.1;-5.1;-5.1;-5.1;-5.1;-5.1	5.31|5.31	3.45|3.45	0.39498|0.39498	.|Ion transport (1);	.|0.061993	.|0.64402	.|D	.|0.000003	D|D	0.99058|0.99058	0.9677|0.9677	M|M	0.82517|0.82517	2.595|2.595	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D;D	.|0.89917	.|0.996;0.999;1.0;0.999;1.0;1.0	.|P;D;D;D;D;D	.|0.85130	.|0.88;0.993;0.991;0.988;0.997;0.993	D|D	0.99572|0.99572	1.0971|1.0971	5|10	.|0.87932	.|D	.|0	-12.1408|-12.1408	15.3168|15.3168	0.74085|0.74085	0.0:0.0:0.7441:0.2559|0.0:0.0:0.7441:0.2559	.|.	.|232;232;232;232;232;232	.|Q12791-4;B7ZMF5;Q12791-2;Q12791;Q12791-5;Q5SVJ7	.|.;.;.;KCMA1_HUMAN;.;.	V|W	220|232;169;167;206;169;232;232;206;232;232;232;14	.|ENSP00000361517:R232W;ENSP00000361485:R169W;ENSP00000361514:R167W;ENSP00000396608:R206W;ENSP00000361520:R232W;ENSP00000286627:R232W;ENSP00000385552:R232W;ENSP00000346321:R232W;ENSP00000385806:R232W	.|ENSP00000286627:R232W	A|R	-|-	2|1	0|2	KCNMA1|KCNMA1	78614589|78614589	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.914000|0.914000	0.54420|0.54420	6.665000|6.665000	0.74442|0.74442	0.877000|0.877000	0.35895|0.35895	-0.127000|-0.127000	0.14921|0.14921	GCG|CGG	KCNMA1	-	pfam_Ion_trans_dom,prints_K_chnl	ENSG00000156113		0.458	KCNMA1-009	KNOWN	basic|appris_candidate_longest	protein_coding	KCNMA1	HGNC	protein_coding	OTTHUMT00000048885.3	-	0.00	51	0	G	NM_002247		78944583	-1	tier1	-	no_errors	ENST00000406533	ensembl	human	known	74_37	missense	13.79	25	4	SNP	1.000	A
KDM5A	5927	genome.wustl.edu	37	12	438067	438067	+	Missense_Mutation	SNP	C	C	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr12:438067C>T	ENST00000399788.2	-	14	2264	c.1902G>A	c.(1900-1902)atG>atA	p.M634I	KDM5A_ENST00000382815.4_Missense_Mutation_p.M634I	NM_001042603.1	NP_001036068.1	P29375	KDM5A_HUMAN	lysine (K)-specific demethylase 5A	634					chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|multicellular organismal development (GO:0007275)|negative regulation of histone deacetylase activity (GO:1901726)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			NS(2)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(29)|ovary(1)|prostate(5)|skin(6)|stomach(1)|urinary_tract(2)	77						CTTTGCAGACCATGGCAGCCA	0.443			T	NUP98	AML																																			Dom	yes		12	12p11	5927	"""lysine (K)-specific demethylase 5A, JARID1A"""		L	0													103.0	97.0	99.0					12																	438067		1945	4152	6097	SO:0001583	missense	0				CCDS41736.1	12p13.33	2013-01-28	2009-04-06	2009-04-06	ENSG00000073614	ENSG00000073614		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	9886	protein-coding gene	gene with protein product		180202	"""retinoblastoma-binding protein 2"", ""Jumonji, AT rich interactive domain 1A (RBBP2-like)"", ""jumonji, AT rich interactive domain 1A"""	RBBP2, JARID1A		1857421	Standard	NM_001042603		Approved		uc001qif.1	P29375	OTTHUMG00000168055	ENST00000399788.2:c.1902G>A	12.37:g.438067C>T	ENSP00000382688:p.Met634Ile		A8MV76|Q4LE72|Q86XZ1	Missense_Mutation	SNP	pfam_Lys_sp_deMease_like_dom,pfam_JmjC_dom,pfam_Znf_PHD-finger,pfam_ARID/BRIGHT_DNA-bd,pfam_Znf_C5HC2,pfam_TF_JmjN,superfamily_ARID/BRIGHT_DNA-bd,superfamily_Znf_FYVE_PHD,smart_TF_JmjN,smart_ARID/BRIGHT_DNA-bd,smart_Znf_PHD,smart_JmjC_dom,pfscan_TF_JmjN,pfscan_JmjC_dom,pfscan_Znf_PHD-finger,pfscan_ARID/BRIGHT_DNA-bd	p.M634I	ENST00000399788.2	37	c.1902	CCDS41736.1	12	.	.	.	.	.	.	.	.	.	.	C	13.81	2.347926	0.41599	.	.	ENSG00000073614	ENST00000261253;ENST00000399787;ENST00000399788;ENST00000382815;ENST00000544760	T;T;T	0.70164	-0.46;-0.46;-0.46	5.27	4.37	0.52481	.	0.164014	0.64402	D	0.000017	T	0.42944	0.1225	N	0.03608	-0.345	0.36347	D	0.859843	B;B;B;B	0.25105	0.118;0.005;0.006;0.108	B;B;B;B	0.28385	0.016;0.017;0.017;0.089	T	0.51348	-0.8717	10	0.66056	D	0.02	-18.2113	9.0003	0.36077	0.1489:0.7772:0.0:0.0739	.	253;634;634;634	B4DVX3;F5H1F7;P29375;P29375-2	.;.;KDM5A_HUMAN;.	I	253;593;634;634;253	ENSP00000382688:M634I;ENSP00000372265:M634I;ENSP00000440622:M253I	ENSP00000261253:M253I	M	-	3	0	KDM5A	308328	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.732000	0.38146	1.338000	0.45544	0.462000	0.41574	ATG	KDM5A	-	NULL	ENSG00000073614		0.443	KDM5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM5A	HGNC	protein_coding	OTTHUMT00000397812.1		0.00	61	0	C	NM_005056		438067	-1			no_errors	ENST00000399788	ensembl	human	known	74_37	missense	5.45	52	3	SNP	1.000	T
KIF16B	55614	genome.wustl.edu	37	20	16488679	16488679	+	Missense_Mutation	SNP	T	T	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr20:16488679T>A	ENST00000354981.2	-	7	780	c.623A>T	c.(622-624)aAc>aTc	p.N208I	KIF16B_ENST00000378003.2_5'UTR|KIF16B_ENST00000355755.3_Missense_Mutation_p.N208I|KIF16B_ENST00000408042.1_Missense_Mutation_p.N208I	NM_001199865.1|NM_024704.4	NP_001186794.1|NP_078980.3	Q96L93	KI16B_HUMAN	kinesin family member 16B	208	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|early endosome to late endosome transport (GO:0045022)|endoderm development (GO:0007492)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|formation of primary germ layer (GO:0001704)|Golgi to endosome transport (GO:0006895)|microtubule-based movement (GO:0007018)|receptor catabolic process (GO:0032801)|regulation of receptor recycling (GO:0001919)	early endosome (GO:0005769)|endosome (GO:0005768)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|plus-end-directed microtubule motor activity (GO:0008574)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(24)|ovary(1)|prostate(15)|skin(3)|upper_aerodigestive_tract(2)	74						GGTGGTCCGGTTGATATTGCC	0.478																																																	0													263.0	227.0	239.0					20																	16488679		2203	4300	6503	SO:0001583	missense	0			AK000142	CCDS13122.1, CCDS56178.1	20p11.23	2008-03-03	2008-03-03	2008-03-03	ENSG00000089177	ENSG00000089177		"""Kinesins"""	15869	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 23"""	C20orf23		16084724, 16782399	Standard	NM_024704		Approved	FLJ20135, dJ971B4.1, SNX23	uc010gci.2	Q96L93	OTTHUMG00000031927	ENST00000354981.2:c.623A>T	20.37:g.16488679T>A	ENSP00000347076:p.Asn208Ile		A6NKJ9|A7E2A8|B1AKG3|B1AKT7|C9JDN5|C9JI52|C9JSM8|C9JWJ7|Q2TBF5|Q5HYC0|Q5HYK1|Q5JWW3|Q5TFK5|Q86VL9|Q86YS5|Q8IYU0|Q9BQJ8|Q9BQM0|Q9BQM1|Q9BQM5|Q9H5U0|Q9HCI2|Q9NXN9	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_FHA_dom,superfamily_P-loop_NTPase,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,prints_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	p.N208I	ENST00000354981.2	37	c.623	CCDS13122.1	20	.	.	.	.	.	.	.	.	.	.	T	22.8	4.339981	0.81911	.	.	ENSG00000089177	ENST00000354981;ENST00000355755;ENST00000377997;ENST00000408042	T;T;T	0.76839	-1.05;-1.05;-1.05	5.84	5.84	0.93424	Kinesin, motor domain (4);	0.000000	0.85682	D	0.000000	D	0.88625	0.6487	M	0.82923	2.615	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.999;0.999	D;D;D;D	0.77004	0.984;0.984;0.981;0.989	D	0.88879	0.3338	10	0.45353	T	0.12	.	16.2109	0.82158	0.0:0.0:0.0:1.0	.	208;208;208;208	Q96L93-4;Q96L93-2;Q96L93-6;Q96L93	.;.;.;KI16B_HUMAN	I	208	ENSP00000347076:N208I;ENSP00000347995:N208I;ENSP00000384164:N208I	ENSP00000347076:N208I	N	-	2	0	KIF16B	16436679	1.000000	0.71417	0.981000	0.43875	0.805000	0.45488	8.040000	0.89188	2.230000	0.72887	0.455000	0.32223	AAC	KIF16B	-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	ENSG00000089177		0.478	KIF16B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF16B	HGNC	protein_coding	OTTHUMT00000078104.2	-	0.00	61	0	T	NM_017683		16488679	-1	tier1	-	no_errors	ENST00000408042	ensembl	human	known	74_37	missense	9.30	39	4	SNP	1.000	A
KIF22	3835	genome.wustl.edu	37	16	29814198	29814198	+	Silent	SNP	C	C	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr16:29814198C>T	ENST00000160827.4	+	9	1429	c.1389C>T	c.(1387-1389)acC>acT	p.T463T	KIF22_ENST00000400751.5_Silent_p.T395T|KIF22_ENST00000569382.2_Silent_p.T395T|KIF22_ENST00000400750.2_5'UTR|KIF22_ENST00000561482.1_Silent_p.T395T	NM_001256269.1|NM_007317.2	NP_001243198.1|NP_015556.1	Q14807	KIF22_HUMAN	kinesin family member 22	463					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|DNA repair (GO:0006281)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)			endometrium(1)|large_intestine(1)|lung(11)|skin(1)	14						TGTTGAGTACCCCAAAGCGAG	0.577																																																	0													122.0	121.0	121.0					16																	29814198		2197	4300	6497	SO:0001819	synonymous_variant	0			D38751	CCDS10653.1, CCDS58444.1	16p11.2	2008-03-03	2003-01-09	2003-01-10	ENSG00000079616	ENSG00000079616		"""Kinesins"""	6391	protein-coding gene	gene with protein product		603213	"""kinesin-like 4"""	KNSL4		8599929, 11416179	Standard	NM_007317		Approved	Kid, OBP-1, OBP-2	uc002dts.4	Q14807	OTTHUMG00000097771	ENST00000160827.4:c.1389C>T	16.37:g.29814198C>T			B2R5M0|B7Z265|O60845|O94814|Q53F58|Q9BT46	Silent	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,superfamily_RuvA_2-like,smart_Kinesin_motor_dom,smart_Hlx-hairpin-Hlx_DNA-bd_motif,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.T463	ENST00000160827.4	37	c.1389	CCDS10653.1	16																																																																																			KIF22	-	NULL	ENSG00000079616		0.577	KIF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF22	HGNC	protein_coding	OTTHUMT00000215012.2		0.00	96	0	C			29814198	+1			no_errors	ENST00000160827	ensembl	human	known	74_37	silent	5.15	92	5	SNP	0.998	T
KMT2A	4297	genome.wustl.edu	37	11	118353187	118353187	+	Missense_Mutation	SNP	G	G	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr11:118353187G>T	ENST00000389506.5	+	8	4063	c.4063G>T	c.(4063-4065)Gta>Tta	p.V1355L	KMT2A_ENST00000420751.2_Intron|KMT2A_ENST00000534358.1_Missense_Mutation_p.V1355L|KMT2A_ENST00000354520.4_Missense_Mutation_p.V1355L			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	1355					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										AAGTATCCCTGTAAAACAAAA	0.403																																																	0													47.0	47.0	47.0					11																	118353187		2200	4296	6496	SO:0001583	missense	0			L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.4063G>T	11.37:g.118353187G>T	ENSP00000374157:p.Val1355Leu		E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Missense_Mutation	SNP	pfam_SET_dom,pfam_FYrich_C,pfam_Znf_PHD-finger,pfam_FYrich_N,pfam_Znf_CXXC,superfamily_Znf_FYVE_PHD,superfamily_Bromodomain,smart_Znf_PHD,smart_Bromodomain,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pirsf_MeTrfase_trithorax,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC,pfscan_Bromodomain	p.V1355L	ENST00000389506.5	37	c.4063	CCDS31686.1	11	.	.	.	.	.	.	.	.	.	.	G	13.91	2.379449	0.42207	.	.	ENSG00000118058	ENST00000534358;ENST00000531904;ENST00000389506;ENST00000354520;ENST00000359313;ENST00000392873	T;T;T;T;D	0.90324	-1.43;2.38;-1.43;-1.4;-2.65	5.56	5.56	0.83823	.	0.213040	0.41938	D	0.000795	D	0.83110	0.5183	L	0.31207	0.915	0.33261	D	0.559687	B;B	0.10296	0.003;0.003	B;B	0.04013	0.001;0.001	T	0.76410	-0.2969	10	0.06236	T	0.91	.	14.709	0.69215	0.0:0.1448:0.8552:0.0	.	1355;1355	E9PQG7;Q03164	.;MLL1_HUMAN	L	1355;1388;1355;1355;265;105	ENSP00000436786:V1355L;ENSP00000432391:V1388L;ENSP00000374157:V1355L;ENSP00000346516:V1355L;ENSP00000376612:V105L	ENSP00000346516:V1355L	V	+	1	0	MLL	117858397	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.432000	0.44784	2.620000	0.88729	0.563000	0.77884	GTA	KMT2A	-	pirsf_MeTrfase_trithorax	ENSG00000118058		0.403	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	KMT2A	HGNC	protein_coding	OTTHUMT00000399085.2	-	0.00	76	0	G	NM_005933		118353187	+1	tier1	-	no_errors	ENST00000389506	ensembl	human	known	74_37	missense	8.89	41	4	SNP	1.000	T
KRT10	3858	genome.wustl.edu	37	17	38975181	38975181	+	Missense_Mutation	SNP	C	C	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr17:38975181C>T	ENST00000269576.5	-	7	1615	c.1606G>A	c.(1606-1608)Ggc>Agc	p.G536S	TMEM99_ENST00000301665.3_5'Flank	NM_000421.3	NP_000412	P13645	K1C10_HUMAN	keratin 10	536	Gly-rich.|Ser-rich.|Tail.				cellular response to calcium ion (GO:0071277)|keratinocyte differentiation (GO:0030216)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of epidermis (GO:0030280)			NS(2)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)	11		Breast(137;0.000301)				ccgccgccgccggaactgcca	0.786																																																	0													1.0	1.0	1.0					17																	38975181		161	485	646	SO:0001583	missense	0			J04029	CCDS11377.1	17q21.2	2013-06-20	2008-08-01		ENSG00000186395	ENSG00000186395		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6413	protein-coding gene	gene with protein product	"""cytokeratin 10"", ""epidermolytic hyperkeratosis"""	148080	"""keratosis palmaris et plantaris"""	KPP		2461420, 16831889	Standard	NM_000421		Approved	K10, CK10	uc002hvi.3	P13645	OTTHUMG00000133368	ENST00000269576.5:c.1606G>A	17.37:g.38975181C>T	ENSP00000269576:p.Gly536Ser		Q14664|Q8N175	Missense_Mutation	SNP	pfam_IF,superfamily_Prefoldin,prints_Keratin_I	p.G536S	ENST00000269576.5	37	c.1606	CCDS11377.1	17	.	.	.	.	.	.	.	.	.	.	C	15.99	2.996632	0.54147	.	.	ENSG00000186395	ENST00000269576	D	0.94966	-3.57	5.35	-7.25	0.01470	.	1.185270	0.06423	N	0.722740	D	0.85062	0.5611	N	0.08118	0	0.09310	N	1	B	0.19200	0.034	B	0.10450	0.005	T	0.73820	-0.3862	10	0.87932	D	0	.	9.4203	0.38548	0.0:0.2367:0.1134:0.6499	.	536	P13645	K1C10_HUMAN	S	536	ENSP00000269576:G536S	ENSP00000269576:G536S	G	-	1	0	KRT10	36228707	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.568000	0.05909	-1.474000	0.01879	-0.310000	0.09108	GGC	KRT10	-	NULL	ENSG00000186395		0.786	KRT10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT10	HGNC	protein_coding	OTTHUMT00000257875.1	-	0.00	14	0	C	NM_000421		38975181	-1	tier1	-	no_errors	ENST00000269576	ensembl	human	known	74_37	missense	23.81	16	5	SNP	0.000	T
KRT10	3858	genome.wustl.edu	37	17	38975189	38975191	+	In_Frame_Del	DEL	CCA	CCA	-	rs184159044	byFrequency	TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	CCA	CCA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr17:38975189_38975191delCCA	ENST00000269576.5	-	7	1605_1607	c.1596_1598delTGG	c.(1594-1599)ggtggc>ggc	p.532_533GG>G	TMEM99_ENST00000301665.3_5'Flank	NM_000421.3	NP_000412	P13645	K1C10_HUMAN	keratin 10	532	Gly-rich.|Ser-rich.|Tail.				cellular response to calcium ion (GO:0071277)|keratinocyte differentiation (GO:0030216)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of epidermis (GO:0030280)			NS(2)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)	11		Breast(137;0.000301)				gccggaactgccaccaccgtagc	0.798																																																	0																																										SO:0001651	inframe_deletion	0			J04029	CCDS11377.1	17q21.2	2013-06-20	2008-08-01		ENSG00000186395	ENSG00000186395		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6413	protein-coding gene	gene with protein product	"""cytokeratin 10"", ""epidermolytic hyperkeratosis"""	148080	"""keratosis palmaris et plantaris"""	KPP		2461420, 16831889	Standard	NM_000421		Approved	K10, CK10	uc002hvi.3	P13645	OTTHUMG00000133368	ENST00000269576.5:c.1596_1598delTGG	17.37:g.38975192_38975194delCCA	ENSP00000269576:p.Gly533del		Q14664|Q8N175	In_Frame_Del	DEL	pfam_IF,superfamily_Prefoldin,prints_Keratin_I	p.G533in_frame_del	ENST00000269576.5	37	c.1598_1596	CCDS11377.1	17																																																																																			KRT10	-	NULL	ENSG00000186395		0.798	KRT10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT10	HGNC	protein_coding	OTTHUMT00000257875.1		0.00	13	0	CCA	NM_000421		38975191	-1	tier1		no_errors	ENST00000269576	ensembl	human	known	74_37	in_frame_del	29.17	17	7	DEL	0.021:0.020:0.013	-
KYNU	8942	genome.wustl.edu	37	2	143685256	143685256	+	Missense_Mutation	SNP	C	C	T	rs373416306		TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr2:143685256C>T	ENST00000410015.2	+	4	409	c.319C>T	c.(319-321)Cgt>Tgt	p.R107C	KYNU_ENST00000264170.4_Missense_Mutation_p.R107C|KYNU_ENST00000409512.1_Missense_Mutation_p.R107C|KYNU_ENST00000375773.2_Missense_Mutation_p.R107C					kynureninase											large_intestine(10)|liver(1)|lung(18)|prostate(3)|skin(4)	36				BRCA - Breast invasive adenocarcinoma(221;0.072)		AGTGGGGAAGCGTCCTTGGAT	0.368																																																	0								C	CYS/ARG,CYS/ARG,CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	208.0	194.0	199.0		319,319,319	5.9	1.0	2		199	0,8600		0,0,4300	no	missense,missense,missense	KYNU	NM_001032998.1,NM_001199241.1,NM_003937.2	180,180,180	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging,probably-damaging	107/308,107/466,107/466	143685256	1,13005	2203	4300	6503	SO:0001583	missense	0			U57721	CCDS2183.1, CCDS33299.1	2q22.2	2010-11-23	2010-11-23		ENSG00000115919	ENSG00000115919	3.7.1.3		6469	protein-coding gene	gene with protein product	"""L-kynurenine hydrolase"""	605197	"""kynureninase (L-kynurenine hydrolase)"""			8706755, 9180257	Standard	NM_001199241		Approved		uc002tvl.3	Q16719	OTTHUMG00000131829	ENST00000410015.2:c.319C>T	2.37:g.143685256C>T	ENSP00000387296:p.Arg107Cys			Missense_Mutation	SNP	pfam_Aminotrans_V/Cys_dSase,superfamily_PyrdxlP-dep_Trfase,tigrfam_Kynureninase	p.R107C	ENST00000410015.2	37	c.319		2	.	.	.	.	.	.	.	.	.	.	C	20.2	3.944870	0.73672	2.27E-4	0.0	ENSG00000115919	ENST00000264170;ENST00000375773;ENST00000409512;ENST00000410015	T;T;T	0.57107	0.42;0.42;0.42	5.88	5.88	0.94601	Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	T	0.70552	0.3237	M	0.64997	1.995	0.58432	D	0.999999	D;D	0.89917	0.994;1.0	P;D	0.91635	0.861;0.999	T	0.69187	-0.5211	10	0.49607	T	0.09	.	16.9558	0.86259	0.0:1.0:0.0:0.0	.	107;107	Q16719;Q9BVW3	KYNU_HUMAN;.	C	107	ENSP00000264170:R107C;ENSP00000364928:R107C;ENSP00000386731:R107C	ENSP00000264170:R107C	R	+	1	0	KYNU	143401726	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	3.130000	0.50508	2.792000	0.96026	0.557000	0.71058	CGT	KYNU	-	superfamily_PyrdxlP-dep_Trfase,tigrfam_Kynureninase	ENSG00000115919		0.368	KYNU-004	PUTATIVE	basic|exp_conf	protein_coding	KYNU	HGNC	protein_coding	OTTHUMT00000332172.2	-	0.00	115	0	C	NM_001032998		143685256	+1	tier1	-	no_errors	ENST00000264170	ensembl	human	known	74_37	missense	5.63	67	4	SNP	1.000	T
LARP7	51574	genome.wustl.edu	37	4	113574320	113574320	+	Missense_Mutation	SNP	G	G	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr4:113574320G>T	ENST00000344442.5	+	11	1782	c.1504G>T	c.(1504-1506)Gat>Tat	p.D502Y	LARP7_ENST00000324052.6_Missense_Mutation_p.D502Y|LARP7_ENST00000509061.1_Missense_Mutation_p.D509Y	NM_016648.3	NP_057732.2	Q4G0J3	LARP7_HUMAN	La ribonucleoprotein domain family, member 7	502					RNA processing (GO:0006396)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(2)|lung(8)|ovary(4)|skin(1)	17		Ovarian(17;0.0443)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000603)		AACTCCTGAGGATGCTCAAGC	0.373																																																	0													79.0	85.0	83.0					4																	113574320		2203	4300	6503	SO:0001583	missense	0			AF068284	CCDS3701.2, CCDS58924.1	4q25	2013-02-12			ENSG00000174720	ENSG00000174720		"""La ribonucleoprotein domain containing"", ""RNA binding motif (RRM) containing"""	24912	protein-coding gene	gene with protein product	"""P-TEFb-interaction protein for 7SK stability"""	612026				18191186, 18249148, 18281698, 22865833, 22488152	Standard	NM_016648		Approved	HDCMA18P, PIP7S, DKFZP564K112	uc003ibb.4	Q4G0J3	OTTHUMG00000132909	ENST00000344442.5:c.1504G>T	4.37:g.113574320G>T	ENSP00000344950:p.Asp502Tyr		B2ZHN6|Q3B7A9|Q9P1S7|Q9Y3Z8	Missense_Mutation	SNP	pfam_RRM_3,pfam_Lupus_La_RNA-bd,pfam_RRM_dom,smart_Lupus_La_RNA-bd,smart_RRM_dom,pfscan_Lupus_La_RNA-bd,pfscan_RRM_dom,prints_Lupus_La	p.D502Y	ENST00000344442.5	37	c.1504	CCDS3701.2	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.1|21.1	4.105108|4.105108	0.77096|0.77096	.|.	.|.	ENSG00000174720|ENSG00000174720	ENST00000344442;ENST00000509061;ENST00000324052|ENST00000511529	T;T;T|.	0.51574|.	0.7;0.7;0.7|.	5.35|5.35	4.51|4.51	0.55191|0.55191	Nucleotide-binding, alpha-beta plait (1);RNA-binding motif (1);|.	0.104995|.	0.64402|.	D|.	0.000006|.	T|T	0.73345|0.73345	0.3575|0.3575	M|M	0.76574|0.76574	2.34|2.34	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.72625|.	0.978|.	T|T	0.74044|0.74044	-0.3791|-0.3791	10|5	0.66056|.	D|.	0.02|.	-26.85|-26.85	13.7953|13.7953	0.63166|0.63166	0.075:0.0:0.925:0.0|0.075:0.0:0.925:0.0	.|.	502|.	Q4G0J3|.	LARP7_HUMAN|.	Y|S	502;509;502|295	ENSP00000344950:D502Y;ENSP00000422626:D509Y;ENSP00000314311:D502Y|.	ENSP00000314311:D502Y|.	D|R	+|+	1|3	0|2	LARP7|LARP7	113793769|113793769	1.000000|1.000000	0.71417|0.71417	0.947000|0.947000	0.38551|0.38551	0.998000|0.998000	0.95712|0.95712	8.850000|8.850000	0.92190|0.92190	1.257000|1.257000	0.44085|0.44085	0.591000|0.591000	0.81541|0.81541	GAT|AGG	LARP7	-	pfam_RRM_3	ENSG00000174720		0.373	LARP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LARP7	HGNC	protein_coding	OTTHUMT00000256417.2		0.00	85	0	G	NM_016648		113574320	+1			no_errors	ENST00000324052	ensembl	human	known	74_37	missense	10.81	33	4	SNP	1.000	T
LHX1	3975	genome.wustl.edu	37	17	35299500	35299500	+	Missense_Mutation	SNP	T	T	G			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr17:35299500T>G	ENST00000254457.5	+	4	2090	c.679T>G	c.(679-681)Tgg>Ggg	p.W227G	RP11-445F12.2_ENST00000607336.1_RNA	NM_005568.3	NP_005559.2	P48742	LHX1_HUMAN	LIM homeobox 1	227					anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|anterior/posterior axis specification (GO:0009948)|anterior/posterior pattern specification (GO:0009952)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell-cell signaling (GO:0007267)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellar Purkinje cell-granule cell precursor cell signaling involved in regulation of granule cell precursor cell proliferation (GO:0021937)|cerebellum development (GO:0021549)|cervix development (GO:0060067)|comma-shaped body morphogenesis (GO:0072049)|dorsal/ventral pattern formation (GO:0009953)|ectoderm formation (GO:0001705)|embryonic pattern specification (GO:0009880)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|embryonic viscerocranium morphogenesis (GO:0048703)|endoderm formation (GO:0001706)|epithelium development (GO:0060429)|forebrain regionalization (GO:0021871)|gastrulation with mouth forming second (GO:0001702)|head development (GO:0060322)|horizontal cell localization (GO:0035852)|kidney development (GO:0001822)|lateral motor column neuron migration (GO:0097477)|mesonephric duct development (GO:0072177)|metanephric comma-shaped body morphogenesis (GO:0072278)|metanephric glomerulus development (GO:0072224)|metanephric part of ureteric bud development (GO:0035502)|metanephric renal vesicle morphogenesis (GO:0072283)|metanephric S-shaped body morphogenesis (GO:0072284)|motor neuron axon guidance (GO:0008045)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct elongation (GO:0035849)|nephric duct morphogenesis (GO:0072178)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|oviduct development (GO:0060066)|oviduct epithelium development (GO:0035846)|paramesonephric duct development (GO:0061205)|pattern specification process (GO:0007389)|positive regulation of anterior head development (GO:2000744)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of embryonic development (GO:0040019)|positive regulation of gastrulation (GO:2000543)|positive regulation of nephron tubule epithelial cell differentiation (GO:2000768)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|primitive streak formation (GO:0090009)|pronephros development (GO:0048793)|regulation of gene expression (GO:0010468)|renal vesicle morphogenesis (GO:0072077)|retina layer formation (GO:0010842)|S-shaped body morphogenesis (GO:0072050)|somite rostral/caudal axis specification (GO:0032525)|spinal cord association neuron differentiation (GO:0021527)|telencephalon development (GO:0021537)|transcription from RNA polymerase II promoter (GO:0006366)|ureteric bud development (GO:0001657)|urogenital system development (GO:0001655)|uterine epithelium development (GO:0035847)|uterus development (GO:0060065)|vagina development (GO:0060068)|ventral spinal cord development (GO:0021517)	nucleus (GO:0005634)|protein complex (GO:0043234)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(1)	16		Breast(25;0.00607)				GCTGCAGGTCTGGTTCCAGAA	0.731																																																	0													7.0	10.0	9.0					17																	35299500		2152	4229	6381	SO:0001583	missense	0			U14755	CCDS11316.1	17q12	2014-04-11			ENSG00000132130	ENSG00000273706		"""Homeoboxes / LIM class"""	6593	protein-coding gene	gene with protein product		601999				9212161	Standard	NM_005568		Approved	LIM-1, LIM1	uc002hnh.2	P48742	OTTHUMG00000188456	ENST00000254457.5:c.679T>G	17.37:g.35299500T>G	ENSP00000254457:p.Trp227Gly		Q3MIW0	Missense_Mutation	SNP	pfam_Znf_LIM,pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Znf_LIM,smart_Homeobox_dom,pfscan_Znf_LIM,pfscan_Homeobox_dom	p.W227G	ENST00000254457.5	37	c.679	CCDS11316.1	17	.	.	.	.	.	.	.	.	.	.	T	26.1	4.700325	0.88924	.	.	ENSG00000132130	ENST00000254457	D	0.99822	-6.94	4.07	4.07	0.47477	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.000000	0.64402	D	0.000001	D	0.99871	0.9939	H	0.99565	4.63	0.80722	D	1	P	0.38020	0.615	P	0.50617	0.646	D	0.95680	0.8731	10	0.87932	D	0	.	12.2689	0.54695	0.0:0.0:0.0:1.0	.	227	P48742	LHX1_HUMAN	G	227	ENSP00000254457:W227G	ENSP00000254457:W227G	W	+	1	0	LHX1	32373613	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	7.839000	0.86812	2.070000	0.61991	0.402000	0.26972	TGG	LHX1	-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	ENSG00000132130		0.731	LHX1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	LHX1	HGNC	protein_coding	OTTHUMT00000256704.3		0.00	10	0	T	NM_005568		35299500	+1			no_errors	ENST00000254457	ensembl	human	known	74_37	missense	50.00	3	3	SNP	1.000	G
LINC00205	257103	genome.wustl.edu	37	21	46713421	46713421	+	lincRNA	SNP	G	G	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr21:46713421G>T	ENST00000433465.1	+	0	222				BX322557.10_ENST00000454115.2_RNA			P59089	CU086_HUMAN	long intergenic non-protein coding RNA 205																		GTGCAGGCCTGCTCCTCCGTT	0.582																																																	0																																												0			AF426264		21q22.3	2012-10-12	2011-08-11	2011-08-11	ENSG00000223768	ENSG00000223768		"""Long non-coding RNAs"""	16420	non-coding RNA	RNA, long non-coding			"""chromosome 21 open reading frame 86"", ""non-protein coding RNA 205"""	C21orf86, NCRNA00205		12036297	Standard			Approved			P59089	OTTHUMG00000090403		21.37:g.46713421G>T				RNA	SNP	-	NULL	ENST00000433465.1	37	NULL		21																																																																																			LINC00205	-	-	ENSG00000223768		0.582	LINC00205-001	KNOWN	basic|exp_conf	lincRNA	LINC00205	HGNC	lincRNA	OTTHUMT00000206823.2	-	0.00	93	0	G			46713421	+1	tier1	-	no_errors	ENST00000433465	ensembl	human	known	74_37	rna	7.14	52	4	SNP	0.008	T
LINGO4	339398	genome.wustl.edu	37	1	151773858	151773858	+	Silent	SNP	T	T	C			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr1:151773858T>C	ENST00000368820.3	-	2	2260	c.1323A>G	c.(1321-1323)ccA>ccG	p.P441P	RP11-98D18.17_ENST00000601909.1_lincRNA	NM_001004432.2	NP_001004432.1	Q6UY18	LIGO4_HUMAN	leucine rich repeat and Ig domain containing 4	441	Ig-like C2-type.					integral component of membrane (GO:0016021)				breast(2)|cervix(1)|endometrium(4)|large_intestine(5)|lung(4)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	21	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			CAGTGGGGGCTGGGTCTCCAT	0.622																																																	0													84.0	84.0	84.0					1																	151773858		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS30855.1	1q21.3	2013-01-11	2007-02-01	2007-02-01	ENSG00000213171	ENSG00000213171		"""Immunoglobulin superfamily / I-set domain containing"""	31814	protein-coding gene	gene with protein product		609794	"""leucine rich repeat neuronal 6D"""	LRRN6D			Standard	NM_001004432		Approved		uc001ezf.1	Q6UY18	OTTHUMG00000013059	ENST00000368820.3:c.1323A>G	1.37:g.151773858T>C				Silent	SNP	pfam_Leu-rich_rpt,pfam_Ig_I-set,pfam_Ig_V-set,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.P441	ENST00000368820.3	37	c.1323	CCDS30855.1	1																																																																																			LINGO4	-	pfam_Ig_I-set,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000213171		0.622	LINGO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LINGO4	HGNC	protein_coding	OTTHUMT00000036639.1	-	0.00	42	0	T	XM_291387		151773858	-1	tier1	-	no_errors	ENST00000368820	ensembl	human	known	74_37	silent	8.51	43	4	SNP	0.896	C
SLC24A3	57419	genome.wustl.edu	37	20	19263805	19263805	+	Intron	SNP	T	T	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr20:19263805T>A	ENST00000328041.6	+	2	468				RP5-1027G4.3_ENST00000319682.2_RNA	NM_020689.3	NP_065740.2	Q9HC58	NCKX3_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 3						ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium, potassium:sodium antiporter activity (GO:0008273)|symporter activity (GO:0015293)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|liver(1)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						AGAACCGGGCTTGGTTTCTGA	0.463																																																	0																																										SO:0001627	intron_variant	0			AF169257	CCDS13140.1	20p13	2013-05-22			ENSG00000185052	ENSG00000185052		"""Solute carriers"""	10977	protein-coding gene	gene with protein product		609839					Standard	NM_020689		Approved		uc002wrl.3	Q9HC58	OTTHUMG00000031993	ENST00000328041.6:c.271+2074T>A	20.37:g.19263805T>A			B1AKV7|Q9BQJ9|Q9BQL7|Q9BQY3|Q9H519	RNA	SNP	-	NULL	ENST00000328041.6	37	NULL	CCDS13140.1	20																																																																																			RP5-1027G4.3	-	-	ENSG00000179447		0.463	SLC24A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100130264	Clone_based_vega_gene	protein_coding	OTTHUMT00000078207.4	-	0.00	88	0	T	NM_020689		19263805	-1	tier1	-	no_errors	ENST00000319682	ensembl	human	known	74_37	rna	11.11	32	4	SNP	0.000	A
ZNF100	163227	genome.wustl.edu	37	19	21934236	21934236	+	Intron	DEL	T	T	-			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr19:21934236delT	ENST00000358296.6	-	3	295				ZNF100_ENST00000596452.1_5'Flank|ZNF100_ENST00000305570.6_5'Flank|RP11-420K14.6_ENST00000596710.1_RNA|AC092364.2_ENST00000579465.1_RNA	NM_173531.3	NP_775802.2	Q8IYN0	ZN100_HUMAN	zinc finger protein 100						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(11)|skin(1)|upper_aerodigestive_tract(1)	21						GTTCATACTCTTTTTAGTGCT	0.383																																																	0																																										SO:0001627	intron_variant	0			BC035579	CCDS42538.1	19p13.1	2013-01-08	2003-12-19		ENSG00000197020	ENSG00000197020		"""Zinc fingers, C2H2-type"", ""-"""	12880	protein-coding gene	gene with protein product		603982	"""zinc finger protein 100 (Y1)"""			12477932	Standard	NM_173531		Approved		uc002nqi.3	Q8IYN0		ENST00000358296.6:c.97-6367A>-	19.37:g.21934236delT			Q7M4M0	RNA	DEL	-	NULL	ENST00000358296.6	37	NULL	CCDS42538.1	19																																																																																			RP11-420K14.6	-	-	ENSG00000269845		0.383	ZNF100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC641367	Clone_based_vega_gene	protein_coding	OTTHUMT00000464087.1		0.00	69	0	T	NM_173531		21934236	+1	tier1		no_errors	ENST00000596710	ensembl	human	known	74_37	rna	10.53	17	2	DEL	0.998	-
LINC01529	644050	genome.wustl.edu	37	19	36283304	36283304	+	lincRNA	SNP	G	G	A	rs556740058	byFrequency	TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr19:36283304G>A	ENST00000433059.1	-	0	126					NR_104176.1																						ATGCACGAACGCTGATATGTG	0.632													G|||	4	0.000798722	0.003	0.0	5008	,	,		17733	0.0		0.0	False		,,,				2504	0.0																0																																												0																															19.37:g.36283304G>A				RNA	SNP	-	NULL	ENST00000433059.1	37	NULL		19																																																																																			AC002398.5	-	-	ENSG00000225872		0.632	AC002398.5-001	KNOWN	basic	lincRNA	LOC644050	Clone_based_vega_gene	lincRNA	OTTHUMT00000109494.1	-	0.00	49	0	G			36283304	-1	tier1	-	no_errors	ENST00000433059	ensembl	human	known	74_37	rna	33.33	16	8	SNP	0.066	A
LOC645752	645752	genome.wustl.edu	37	15	78207007	78207007	+	lincRNA	SNP	G	G	T	rs149319674	byFrequency	TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr15:78207007G>T	ENST00000565869.1	+	0	0				RN7SL214P_ENST00000487317.2_RNA																							CTAATGAAGAGCTCACTGTGG	0.353																																																	0																																												0																															15.37:g.78207007G>T				RNA	SNP	-	NULL	ENST00000565869.1	37	NULL		15																																																																																			RP11-114H24.2	-	-	ENSG00000260776		0.353	RP11-114H24.7-001	KNOWN	basic	lincRNA	LOC645752	Clone_based_vega_gene	lincRNA	OTTHUMT00000421587.1	-	0.00	134	0	G			78207007	-1	tier1	-	no_errors	ENST00000563349	ensembl	human	known	74_37	rna	8.57	64	6	SNP	0.230	T
LRCH3	84859	genome.wustl.edu	37	3	197607434	197607434	+	Intron	SNP	A	A	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr3:197607434A>T	ENST00000425562.2	+	21	2208				LRCH3_ENST00000414675.2_Intron|LRCH3_ENST00000536618.1_Intron|LRCH3_ENST00000441090.2_Intron|LRCH3_ENST00000438796.2_Nonsense_Mutation_p.R754*			Q96II8	LRCH3_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 3							cytoplasm (GO:0005737)|extracellular region (GO:0005576)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;4.82e-24)|all cancers(36;3.61e-22)|OV - Ovarian serous cystadenocarcinoma(49;7.08e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.119)		CAGCGTTAAAAGAACTGTTGA	0.443																																																	0																																										SO:0001627	intron_variant	0			AL137527	CCDS3330.1	3q29	2006-04-12			ENSG00000186001	ENSG00000186001			28637	protein-coding gene	gene with protein product						12477932	Standard	NM_032773		Approved	MGC4126	uc003fyj.1	Q96II8	OTTHUMG00000155378	ENST00000425562.2:c.2209-2978A>T	3.37:g.197607434A>T			B4E0T7|Q96FP9|Q9NT52	Nonsense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_CH-domain,superfamily_CH-domain,smart_Leu-rich_rpt_typical-subtyp,smart_CH-domain,pfscan_CH-domain	p.R754*	ENST00000425562.2	37	c.2260		3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	19.19|19.19	3.780507|3.780507	0.70222|0.70222	.|.	.|.	ENSG00000186001|ENSG00000186001	ENST00000428136|ENST00000438796	D|.	0.95918|.	-3.85|.	5.53|5.53	4.38|4.38	0.52667|0.52667	.|.	.|.	.|.	.|.	.|.	T|.	0.51193|.	0.1660|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.38972|.	-0.9636|.	6|.	0.34782|0.19590	T|T	0.22|0.45	.|.	8.4757|8.4757	0.33012|0.33012	0.8512:0.0:0.1488:0.0|0.8512:0.0:0.1488:0.0	.|.	.|.	.|.	.|.	M|X	131|754	ENSP00000394763:K131M|.	ENSP00000394763:K131M|ENSP00000399751:R754X	K|R	+|+	2|1	0|2	LRCH3|LRCH3	199091831|199091831	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	2.778000|2.778000	0.47726|0.47726	0.962000|0.962000	0.38057|0.38057	0.454000|0.454000	0.30748|0.30748	AAG|AGA	LRCH3	-	pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	ENSG00000186001		0.443	LRCH3-006	KNOWN	basic	protein_coding	LRCH3	HGNC	protein_coding	OTTHUMT00000339965.1	-	0.00	62	0	A	NM_032773		197607434	+1	tier1	-	no_errors	ENST00000438796	ensembl	human	known	74_37	nonsense	8.45	65	6	SNP	1.000	T
LSM11	134353	genome.wustl.edu	37	5	157178533	157178533	+	Missense_Mutation	SNP	A	A	G			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr5:157178533A>G	ENST00000286307.5	+	2	640	c.584A>G	c.(583-585)aAt>aGt	p.N195S		NM_173491.2	NP_775762.1	P83369	LSM11_HUMAN	LSM11, U7 small nuclear RNA associated	195	SM 1.				gene expression (GO:0010467)|histone mRNA 3'-end processing (GO:0006398)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	histone pre-mRNA 3'end processing complex (GO:0071204)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U7 snRNP (GO:0005683)	U7 snRNA binding (GO:0071209)			breast(1)|kidney(1)|large_intestine(2)|lung(2)|prostate(1)	7	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			AAGTTCTGGAATATGGTAATT	0.438																																																	0													120.0	123.0	122.0					5																	157178533		2203	4300	6503	SO:0001583	missense	0			AK095592	CCDS4342.1	5q33.3	2008-02-05	2004-04-28		ENSG00000155858	ENSG00000155858			30860	protein-coding gene	gene with protein product			"""LSM11 homolog, U7 small nuclear RNA associated (S. cerevisiae)"""			12975319	Standard	NM_173491		Approved	FLJ38273	uc003lxe.1	P83369	OTTHUMG00000130255	ENST00000286307.5:c.584A>G	5.37:g.157178533A>G	ENSP00000286307:p.Asn195Ser		A0AVQ1|Q7Z7P0|Q8N975	Missense_Mutation	SNP	pfam_Ribonucl_LSM,superfamily_LSM_dom,smart_Ribonucl_LSM_euk/arc	p.N195S	ENST00000286307.5	37	c.584	CCDS4342.1	5	.	.	.	.	.	.	.	.	.	.	A	29.7	5.031106	0.93575	.	.	ENSG00000155858	ENST00000286307	T	0.77750	-1.12	6.17	6.17	0.99709	Like-Sm ribonucleoprotein (LSM) domain (1);Like-Sm ribonucleoprotein (LSM)-related domain (2);	0.000000	0.85682	D	0.000000	D	0.89818	0.6825	M	0.87328	2.875	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.91268	0.5042	10	0.87932	D	0	-16.5897	16.8222	0.85835	1.0:0.0:0.0:0.0	.	195	P83369	LSM11_HUMAN	S	195	ENSP00000286307:N195S	ENSP00000286307:N195S	N	+	2	0	LSM11	157111111	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.300000	0.96151	2.371000	0.80710	0.533000	0.62120	AAT	LSM11	-	pfam_Ribonucl_LSM,superfamily_LSM_dom,smart_Ribonucl_LSM_euk/arc	ENSG00000155858		0.438	LSM11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LSM11	HGNC	protein_coding	OTTHUMT00000252580.2	-	0.00	76	0	A	NM_173491		157178533	+1	tier1	-	no_errors	ENST00000286307	ensembl	human	known	74_37	missense	21.21	52	14	SNP	1.000	G
MACF1	23499	genome.wustl.edu	37	1	39853455	39853455	+	Missense_Mutation	SNP	C	C	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr1:39853455C>T	ENST00000372915.3	+	57	15043	c.14956C>T	c.(14956-14958)Cgg>Tgg	p.R4986W	MACF1_ENST00000539005.1_Missense_Mutation_p.R2898W|MACF1_ENST00000289893.4_Missense_Mutation_p.R3421W|MACF1_ENST00000567887.1_Missense_Mutation_p.R5018W|MACF1_ENST00000317713.7_Missense_Mutation_p.R2919W|MACF1_ENST00000564288.1_Missense_Mutation_p.R4981W|MACF1_ENST00000361689.2_Missense_Mutation_p.R2919W|MACF1_ENST00000545844.1_Missense_Mutation_p.R2919W			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	4986					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)	p.R2919W(1)|p.R3421W(1)		breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GGATGGAATCCGGGATGAGAA	0.493																																																	2	Substitution - Missense(2)	large_intestine(2)											62.0	64.0	63.0					1																	39853455		2203	4300	6503	SO:0001583	missense	0			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.14956C>T	1.37:g.39853455C>T	ENSP00000362006:p.Arg4986Trp		B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_EF_hand_dom,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.R2919W	ENST00000372915.3	37	c.8755		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.69|15.69	2.908862|2.908862	0.52439|0.52439	.|.	.|.	ENSG00000127603|ENSG00000127603	ENST00000372925|ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000289893	.|T;T;T;T;T;T	.|0.52295	.|0.67;0.67;0.67;0.67;0.67;0.67	6.17|6.17	5.26|5.26	0.73747|0.73747	.|.	.|0.000000	.|0.56097	.|D	.|0.000027	T|T	0.62588|0.62588	0.2440|0.2440	L|L	0.59436|0.59436	1.845|1.845	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.79784	.|0.993;0.982;0.982	T|T	0.65541|0.65541	-0.6143|-0.6143	5|10	.|0.87932	.|D	.|0	.|.	10.3681|10.3681	0.44038|0.44038	0.1358:0.7979:0.0:0.0663|0.1358:0.7979:0.0:0.0663	.|.	.|4986;2919;2863	.|Q9UPN3;F8W8Q1;Q9UPN3-3	.|MACF1_HUMAN;.;.	L|W	2031|2919;4986;2919;2919;2898;3421	.|ENSP00000439537:R2919W;ENSP00000362006:R4986W;ENSP00000354573:R2919W;ENSP00000313438:R2919W;ENSP00000444364:R2898W;ENSP00000289893:R3421W	.|ENSP00000289893:R3421W	P|R	+|+	2|1	0|2	MACF1|MACF1	39626042|39626042	0.995000|0.995000	0.38212|0.38212	1.000000|1.000000	0.80357|0.80357	0.933000|0.933000	0.57130|0.57130	2.490000|2.490000	0.45294|0.45294	1.615000|1.615000	0.50252|0.50252	0.655000|0.655000	0.94253|0.94253	CCG|CGG	MACF1	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000127603		0.493	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	MACF1	HGNC	protein_coding	OTTHUMT00000392096.1	-	0.00	53	0	C	NM_033044		39853455	+1	tier1	-	no_errors	ENST00000317713	ensembl	human	known	74_37	missense	51.85	13	14	SNP	0.896	T
MCHR2	84539	genome.wustl.edu	37	6	100391010	100391010	+	Silent	SNP	G	G	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr6:100391010G>A	ENST00000281806.2	-	4	716	c.402C>T	c.(400-402)gcC>gcT	p.A134A	MCHR2_ENST00000369212.2_Silent_p.A134A	NM_001040179.1	NP_001035269.1	Q969V1	MCHR2_HUMAN	melanin-concentrating hormone receptor 2	134						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(19)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	39		all_cancers(76;4.87e-05)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0309)|Colorectal(196;0.069)		BRCA - Breast invasive adenocarcinoma(108;0.0429)		GTTGGACGAGGGCAAAGTACC	0.463																																																	0													95.0	88.0	91.0					6																	100391010		2203	4300	6503	SO:0001819	synonymous_variant	0			AF347063	CCDS5044.1	6q16	2012-08-08	2006-02-15	2006-02-15	ENSG00000152034	ENSG00000152034		"""GPCR / Class A : MCH receptors"""	20867	protein-coding gene	gene with protein product		606111	"""G protein-coupled receptor 145"""	GPR145		11355873, 11274220	Standard	NM_032503		Approved	SLT, MCH2, MCH2R	uc003pqi.1	Q969V1	OTTHUMG00000015270	ENST00000281806.2:c.402C>T	6.37:g.100391010G>A			B3KVW4|E1P5D7|Q5VTV7|Q6Q377|Q9BXA8	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_MCH2_receptor,prints_GPCR_Rhodpsn,prints_MCH_rcpt	p.A134	ENST00000281806.2	37	c.402	CCDS5044.1	6																																																																																			MCHR2	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000152034		0.463	MCHR2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	MCHR2	HGNC	protein_coding	OTTHUMT00000041620.2	-	0.00	57	0	G	NM_032503		100391010	-1	tier1	-	no_errors	ENST00000281806	ensembl	human	known	74_37	silent	23.81	32	10	SNP	1.000	A
MGA	23269	genome.wustl.edu	37	15	42058517	42058517	+	Missense_Mutation	SNP	A	A	G			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr15:42058517A>G	ENST00000570161.1	+	23	8237	c.8237A>G	c.(8236-8238)aAg>aGg	p.K2746R	MGA_ENST00000389936.4_Missense_Mutation_p.K2707R|MGA_ENST00000545763.1_Missense_Mutation_p.K2537R|MGA_ENST00000219905.7_Missense_Mutation_p.K2746R|MGA_ENST00000566586.1_Missense_Mutation_p.K2537R			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	TTACCTAAAAAGATTTCTGGT	0.373																																																	0													43.0	40.0	41.0					15																	42058517		1827	4090	5917	SO:0001583	missense	0			AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.8237A>G	15.37:g.42058517A>G	ENSP00000457035:p.Lys2746Arg		Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	pfam_TF_T-box,pfam_bHLH_dom,superfamily_p53-like_TF_DNA-bd,superfamily_bHLH_dom,smart_TF_T-box,smart_bHLH_dom,pfscan_bHLH_dom,pfscan_TF_T-box,prints_TF_T-box	p.K2746R	ENST00000570161.1	37	c.8237	CCDS55959.1	15	.	.	.	.	.	.	.	.	.	.	A	14.26	2.483286	0.44147	.	.	ENSG00000174197	ENST00000219905;ENST00000389936;ENST00000545763	D;D;D	0.86769	-2.13;-2.15;-2.17	5.37	4.25	0.50352	.	0.555826	0.15843	N	0.241955	T	0.76941	0.4058	N	0.14661	0.345	0.21897	N	0.999487	B;B	0.15141	0.012;0.007	B;B	0.14578	0.011;0.005	T	0.68311	-0.5442	10	0.87932	D	0	.	9.9135	0.41419	0.9236:0.0:0.0764:0.0	.	2537;2746	F5H7K2;E7ENI0	.;.	R	2746;2707;2537	ENSP00000219905:K2746R;ENSP00000374586:K2707R;ENSP00000442467:K2537R	ENSP00000219905:K2746R	K	+	2	0	MGA	39845809	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	4.241000	0.58707	1.056000	0.40484	0.528000	0.53228	AAG	MGA	-	NULL	ENSG00000174197		0.373	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MGA	HGNC	protein_coding	OTTHUMT00000420229.1		0.00	80	0	A	NM_001164273.1		42058517	+1			no_errors	ENST00000219905	ensembl	human	known	74_37	missense	6.06	31	2	SNP	0.986	G
MISP	126353	genome.wustl.edu	37	19	757175	757175	+	Missense_Mutation	SNP	C	C	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr19:757175C>T	ENST00000215582.6	+	2	332	c.229C>T	c.(229-231)Ccg>Tcg	p.P77S		NM_173481.2	NP_775752.1	Q8IVT2	MISP_HUMAN	mitotic spindle positioning	77					mitotic nuclear division (GO:0007067)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)											CACTGGCCAGCCGTCCCCACG	0.682																																																	0													50.0	48.0	49.0					19																	757175		2203	4297	6500	SO:0001583	missense	0			BC052236	CCDS12042.1	19p13.3	2014-06-25	2013-05-03	2013-05-03	ENSG00000099812	ENSG00000099812			27000	protein-coding gene	gene with protein product	"""mitotic interactor and substrate of Plk1"""	615289	"""chromosome 19 open reading frame 21"""	C19orf21		23574715, 23509069, 24475924	Standard	NM_173481		Approved	DKFZp686H18209, Caprice		Q8IVT2	OTTHUMG00000181786	ENST00000215582.6:c.229C>T	19.37:g.757175C>T	ENSP00000215582:p.Pro77Ser			Missense_Mutation	SNP	NULL	p.P77S	ENST00000215582.6	37	c.229	CCDS12042.1	19	.	.	.	.	.	.	.	.	.	.	C	2.257	-0.370095	0.05069	.	.	ENSG00000099812	ENST00000215582	T	0.74842	-0.88	4.1	0.592	0.17471	.	2.471570	0.02043	N	0.049418	T	0.58192	0.2105	L	0.29908	0.895	0.09310	N	1	B	0.29037	0.231	B	0.22152	0.038	T	0.40403	-0.9565	10	0.09338	T	0.73	-3.8356	4.9619	0.14070	0.169:0.6361:0.0:0.1949	.	77	Q8IVT2	CS021_HUMAN	S	77	ENSP00000215582:P77S	ENSP00000215582:P77S	P	+	1	0	C19orf21	708175	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	-0.549000	0.06041	0.307000	0.22880	0.313000	0.20887	CCG	MISP	-	NULL	ENSG00000099812		0.682	MISP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MISP	HGNC	protein_coding	OTTHUMT00000457600.2		0.00	127	0	C	NM_173481		757175	+1			no_errors	ENST00000215582	ensembl	human	known	74_37	missense	5.00	76	4	SNP	0.000	T
MOV10L1	54456	genome.wustl.edu	37	22	50599160	50599160	+	Missense_Mutation	SNP	T	T	G			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr22:50599160T>G	ENST00000262794.5	+	25	3451	c.3368T>G	c.(3367-3369)tTg>tGg	p.L1123W	MOV10L1_ENST00000395858.3_Intron|MOV10L1_ENST00000540615.1_Missense_Mutation_p.L1103W|MOV10L1_ENST00000395852.1_Missense_Mutation_p.L250W|MOV10L1_ENST00000545383.1_Missense_Mutation_p.L1123W	NM_018995.2	NP_061868.1	Q9BXT6	M10L1_HUMAN	Mov10 RISC complex RNA helicase like 1	1123					ATP catabolic process (GO:0006200)|germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	intracellular (GO:0005622)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|magnesium ion binding (GO:0000287)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|prostate(1)|skin(9)|stomach(4)|urinary_tract(3)	67		all_cancers(38;3.31e-11)|all_epithelial(38;5.69e-10)|all_lung(38;3.73e-05)|Breast(42;0.000525)|Lung NSC(38;0.000954)|Ovarian(80;0.0367)|Lung SC(80;0.114)		LUAD - Lung adenocarcinoma(64;0.0215)|BRCA - Breast invasive adenocarcinoma(115;0.24)		CGATATTTTTTGGGTTTCTTG	0.403																																																	0													134.0	134.0	134.0					22																	50599160		2203	4300	6503	SO:0001583	missense	0			AF285604	CCDS14084.1, CCDS54541.1, CCDS54542.1, CCDS54543.1	22q13.33	2014-07-02	2014-07-02		ENSG00000073146	ENSG00000073146			7201	protein-coding gene	gene with protein product	"""cardiac helicase activated by MEF2C protein"""	605794	"""Mov10 (mouse)-like 1"", ""Mov10l1, Moloney leukemia virus 10-like 1, homolog (mouse)"""			11279525	Standard	NM_018995		Approved	DJ402G11.8, DKFZp434B0717, CHAMP	uc003bjj.3	Q9BXT6	OTTHUMG00000044648	ENST00000262794.5:c.3368T>G	22.37:g.50599160T>G	ENSP00000262794:p.Leu1123Trp		A7E211|A8MXC6|B7WPP1|B7Z7R1|F5H403|Q5TGD5|Q8NBD4|Q9NXW3|Q9UFB3|Q9UGX9	Missense_Mutation	SNP	superfamily_P-loop_NTPase,superfamily_NA-bd_OB-fold	p.L1123W	ENST00000262794.5	37	c.3368	CCDS14084.1	22	.	.	.	.	.	.	.	.	.	.	.	16.19	3.054181	0.55218	.	.	ENSG00000073146	ENST00000545383;ENST00000262794;ENST00000540615;ENST00000395852	D;D;D;D	0.93426	-3.22;-3.22;-3.22;-3.22	5.68	4.64	0.57946	.	0.000000	0.85682	D	0.000000	D	0.97077	0.9045	M	0.91663	3.23	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	D	0.97093	0.9792	10	0.87932	D	0	-20.9142	12.1374	0.53979	0.0:0.0:0.1435:0.8565	.	1103;250;1123	F5H403;Q9BXT6-2;Q9BXT6	.;.;M10L1_HUMAN	W	1123;1123;1103;250	ENSP00000438978:L1123W;ENSP00000262794:L1123W;ENSP00000438542:L1103W;ENSP00000379193:L250W	ENSP00000262794:L1123W	L	+	2	0	MOV10L1	48941287	1.000000	0.71417	0.899000	0.35326	0.298000	0.27526	3.436000	0.52856	0.963000	0.38082	0.523000	0.50628	TTG	MOV10L1	-	superfamily_P-loop_NTPase	ENSG00000073146		0.403	MOV10L1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MOV10L1	HGNC	protein_coding	OTTHUMT00000075009.2	-	0.00	84	0	T	NM_018995		50599160	+1	tier1	-	no_errors	ENST00000262794	ensembl	human	known	74_37	missense	10.64	42	5	SNP	1.000	G
MROH7	374977	genome.wustl.edu	37	1	55175632	55175632	+	Missense_Mutation	SNP	G	G	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr1:55175632G>T	ENST00000421030.2	+	24	4029	c.3744G>T	c.(3742-3744)ttG>ttT	p.L1248F	MROH7_ENST00000454855.2_Missense_Mutation_p.L766F|MROH7_ENST00000409996.1_Missense_Mutation_p.L816F|MROH7-TTC4_ENST00000414150.2_Intron	NM_001039464.2	NP_001034553	Q68CQ1	MROH7_HUMAN	maestro heat-like repeat family member 7	1248						extracellular space (GO:0005615)|integral component of membrane (GO:0016021)		p.L1245F(1)|p.L1248F(1)									TGGATAACTTGAGACATGACC	0.567																																																	2	Substitution - Missense(2)	lung(2)											83.0	85.0	84.0					1																	55175632		2029	4189	6218	SO:0001583	missense	0			AL832492	CCDS41342.2	1p32.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000184313	ENSG00000184313		"""maestro heat-like repeat containing"""	24802	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 175"", ""HEAT repeat containing 8"""	C1orf175, HEATR8		12477932	Standard	NM_001039464		Approved	FLJ46354	uc010ooe.1	Q68CQ1	OTTHUMG00000009890	ENST00000421030.2:c.3744G>T	1.37:g.55175632G>T	ENSP00000396622:p.Leu1248Phe		A0AUX8|Q5TA99|Q6ZP40|Q6ZRH6|Q8N311|Q8NA14	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.L1248F	ENST00000421030.2	37	c.3744	CCDS41342.2	1	.	.	.	.	.	.	.	.	.	.	g	19.74	3.883135	0.72410	.	.	ENSG00000184313	ENST00000421030;ENST00000409996;ENST00000454855;ENST00000371287	T;T;T;T	0.38887	1.11;1.11;1.11;1.11	5.06	5.06	0.68205	Armadillo-like helical (1);Armadillo-type fold (1);	.	.	.	.	T	0.62332	0.2419	M	0.75777	2.31	0.32480	N	0.54161	D;P	0.69078	0.997;0.948	D;P	0.64410	0.925;0.7	T	0.72154	-0.4376	9	0.62326	D	0.03	.	13.9175	0.63908	0.0:0.0:1.0:0.0	.	1248;1247	Q68CQ1;Q68CQ1-9	HEAT8_HUMAN;.	F	1248;816;766;317	ENSP00000396622:L1248F;ENSP00000387048:L816F;ENSP00000401130:L766F;ENSP00000360336:L317F	ENSP00000360336:L317F	L	+	3	2	HEATR8	54948220	1.000000	0.71417	0.995000	0.50966	0.988000	0.76386	1.647000	0.37260	2.335000	0.79485	0.586000	0.80456	TTG	MROH7	-	superfamily_ARM-type_fold	ENSG00000184313		0.567	MROH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MROH7	HGNC	protein_coding	OTTHUMT00000346978.1		0.00	41	0	G	NM_198547		55175632	+1			no_errors	ENST00000421030	ensembl	human	known	74_37	missense	9.68	28	3	SNP	0.999	T
MRPL11	65003	genome.wustl.edu	37	11	66204663	66204663	+	Missense_Mutation	SNP	C	C	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr11:66204663C>T	ENST00000310999.7	-	4	478	c.385G>A	c.(385-387)Gca>Aca	p.A129T	MRPL11_ENST00000524576.1_5'UTR|MRPL11_ENST00000430466.2_Missense_Mutation_p.A103T|MRPL11_ENST00000329819.4_Missense_Mutation_p.A129T	NM_016050.3	NP_057134.1	Q9Y3B7	RM11_HUMAN	mitochondrial ribosomal protein L11	129					translation (GO:0006412)	mitochondrial ribosome (GO:0005761)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			endometrium(3)|lung(2)|ovary(1)|prostate(1)	7						AGGGCAAATGCCTCATCCTGA	0.557																																																	0													112.0	103.0	106.0					11																	66204663		2200	4295	6495	SO:0001583	missense	0			AB051338	CCDS8139.1, CCDS8140.1, CCDS44655.1	11q13.2	2012-11-14			ENSG00000174547	ENSG00000174547		"""Mitochondrial ribosomal proteins / large subunits"""	14042	protein-coding gene	gene with protein product		611826					Standard	XR_247672		Approved		uc001ohz.4	Q9Y3B7	OTTHUMG00000167097	ENST00000310999.7:c.385G>A	11.37:g.66204663C>T	ENSP00000308897:p.Ala129Thr		A6NLT0|A8K219|Q32P46|Q96Q73	Missense_Mutation	SNP	pfam_Ribosomal_L11_N,pfam_Ribosomal_L11_C,superfamily_Ribosomal_L11_N,superfamily_Ribosomal_L11_C,smart_Ribosomal_L11,tigrfam_Ribosomal_L11_bac-typ	p.A129T	ENST00000310999.7	37	c.385	CCDS8139.1	11	.	.	.	.	.	.	.	.	.	.	C	12.24	1.877503	0.33162	.	.	ENSG00000174547	ENST00000310999;ENST00000430466;ENST00000528272;ENST00000329819	.	.	.	5.79	5.79	0.91817	Ribosomal protein L11, C-terminal (3);	0.225081	0.46145	D	0.000307	T	0.60547	0.2277	L	0.31752	0.955	0.40171	D	0.977179	B;B;B	0.26363	0.147;0.097;0.097	B;B;B	0.39217	0.137;0.216;0.294	T	0.59989	-0.7350	9	0.49607	T	0.09	-15.5521	17.5412	0.87848	0.0:1.0:0.0:0.0	.	103;129;129	Q9Y3B7-2;Q9Y3B7;A6NLT0	.;RM11_HUMAN;.	T	129;103;11;129	.	ENSP00000308897:A129T	A	-	1	0	MRPL11	65961239	0.984000	0.35163	0.883000	0.34634	0.172000	0.22775	2.603000	0.46266	2.722000	0.93159	0.655000	0.94253	GCA	MRPL11	-	pfam_Ribosomal_L11_C,superfamily_Ribosomal_L11_C,smart_Ribosomal_L11,tigrfam_Ribosomal_L11_bac-typ	ENSG00000174547		0.557	MRPL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL11	HGNC	protein_coding	OTTHUMT00000393098.2		0.00	79	0	C	NM_016050		66204663	-1			no_errors	ENST00000310999	ensembl	human	known	74_37	missense	5.26	72	4	SNP	0.993	T
MT1M	4499	genome.wustl.edu	37	16	56667702	56667702	+	Missense_Mutation	SNP	C	C	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr16:56667702C>T	ENST00000379818.3	+	3	633	c.134C>T	c.(133-135)gCc>gTc	p.A45V	AC026461.1_ENST00000600389.1_5'Flank|MT1JP_ENST00000564564.1_RNA	NM_176870.2	NP_789846.1	Q8N339	MT1M_HUMAN	metallothionein 1M	45	Alpha.				cellular response to zinc ion (GO:0071294)|negative regulation of growth (GO:0045926)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(1)|lung(1)|ovary(1)	5						GCCAAGTGTGCCCACGGCTGT	0.592																																																	0													126.0	129.0	128.0					16																	56667702		2198	4300	6498	SO:0001583	missense	0			AF136177	CCDS42166.1	16q13	2008-02-05				ENSG00000205364		"""Metallothioneins"""	14296	protein-coding gene	gene with protein product		156357	"""metallothionein 1K"""	MT1, MT1K		2286373, 8049263	Standard	NM_176870		Approved		uc002ejn.3	Q8N339		ENST00000379818.3:c.134C>T	16.37:g.56667702C>T	ENSP00000369146:p.Ala45Val		Q8TDN3	Missense_Mutation	SNP	pfam_Metalthion_sfam_euk,superfamily_Metalthion_dom,prints_Metalthion_vert	p.A45V	ENST00000379818.3	37	c.134	CCDS42166.1	16	.	.	.	.	.	.	.	.	.	.	C	17.02	3.281111	0.59758	.	.	ENSG00000205364	ENST00000379818	T	0.12147	2.71	2.41	1.37	0.22104	Metallothionein domain, vertebrate (1);Metallothionein domain (1);	0.000000	0.64402	U	0.000019	T	0.15696	0.0378	.	.	.	0.37862	D	0.929762	B	0.31209	0.313	B	0.40565	0.333	T	0.08249	-1.0731	9	0.87932	D	0	.	6.9645	0.24615	0.0:0.8502:0.0:0.1498	.	45	Q8N339	MT1M_HUMAN	V	45	ENSP00000369146:A45V	ENSP00000369146:A45V	A	+	2	0	MT1M	55225203	1.000000	0.71417	0.993000	0.49108	0.781000	0.44180	3.275000	0.51639	0.297000	0.22615	0.461000	0.40582	GCC	MT1M	-	pfam_Metalthion_sfam_euk,superfamily_Metalthion_dom,prints_Metalthion_vert	ENSG00000205364		0.592	MT1M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MT1M	HGNC	protein_coding	OTTHUMT00000434359.1	-	0.00	99	0	C	NM_176870		56667702	+1	tier1	-	no_errors	ENST00000379818	ensembl	human	known	74_37	missense	43.14	58	44	SNP	1.000	T
MTMR3	8897	genome.wustl.edu	37	22	30387632	30387632	+	Nonsense_Mutation	SNP	G	G	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr22:30387632G>T	ENST00000401950.2	+	7	775	c.433G>T	c.(433-435)Gag>Tag	p.E145*	MTMR3_ENST00000323630.5_Nonsense_Mutation_p.E9*|MTMR3_ENST00000415511.1_3'UTR|MTMR3_ENST00000406629.1_Nonsense_Mutation_p.E145*|MTMR3_ENST00000351488.3_Nonsense_Mutation_p.E145*|MTMR3_ENST00000333027.3_Nonsense_Mutation_p.E145*	NM_021090.3	NP_066576.1	Q13615	MTMR3_HUMAN	myotubularin related protein 3	145					peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity (GO:0052629)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|large_intestine(3)|ovary(2)|skin(8)|upper_aerodigestive_tract(1)	17			OV - Ovarian serous cystadenocarcinoma(5;0.00204)|Epithelial(10;0.06)|all cancers(5;0.107)			CAGTGAAAAAGAGCAACATGG	0.453																																																	0													101.0	94.0	96.0					22																	30387632		2203	4300	6503	SO:0001587	stop_gained	0			U58034	CCDS13870.1, CCDS13871.1, CCDS46682.1	22q12.2	2011-06-09			ENSG00000100330	ENSG00000100330		"""Zinc fingers, FYVE domain containing"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7451	protein-coding gene	gene with protein product		603558				8640223, 9736772	Standard	NM_153050		Approved	KIAA0371, ZFYVE10, FYVE-DSP1	uc003agv.4	Q13615	OTTHUMG00000151278	ENST00000401950.2:c.433G>T	22.37:g.30387632G>T	ENSP00000384651:p.Glu145*		A5PL26|A7MD32|Q9NYN5|Q9NYN6|Q9UDX6|Q9UEG3	Nonsense_Mutation	SNP	pfam_Myotubularin-like_Pase_dom,pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Tyr_Pase_cat,smart_Znf_FYVE,pfscan_Znf_FYVE-rel	p.E145*	ENST00000401950.2	37	c.433	CCDS13870.1	22	.	.	.	.	.	.	.	.	.	.	G	21.3	4.127705	0.77549	.	.	ENSG00000100330	ENST00000401950;ENST00000333027;ENST00000323630;ENST00000351488;ENST00000406629	.	.	.	5.79	5.79	0.91817	.	0.093574	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	.	19.0848	0.93200	0.0:0.0:1.0:0.0	.	.	.	.	X	145;145;9;145;145	.	ENSP00000318070:E9X	E	+	1	0	MTMR3	28717632	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.472000	0.97709	2.752000	0.94435	0.650000	0.86243	GAG	MTMR3	-	NULL	ENSG00000100330		0.453	MTMR3-001	KNOWN	basic|CCDS	protein_coding	MTMR3	HGNC	protein_coding	OTTHUMT00000322066.1	-	0.00	72	0	G	NM_021090		30387632	+1	tier1	-	no_errors	ENST00000401950	ensembl	human	known	74_37	nonsense	8.33	44	4	SNP	1.000	T
MUC16	94025	genome.wustl.edu	37	19	9071105	9071105	+	Silent	SNP	C	C	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr19:9071105C>T	ENST00000397910.4	-	3	16544	c.16341G>A	c.(16339-16341)tcG>tcA	p.S5447S		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	5449	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GTGTGGCTTTCGATGTCTCTG	0.493																																																	0													216.0	208.0	211.0					19																	9071105		2086	4209	6295	SO:0001819	synonymous_variant	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.16341G>A	19.37:g.9071105C>T			Q6ZQW5|Q96RK2	Silent	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.S5447	ENST00000397910.4	37	c.16341	CCDS54212.1	19																																																																																			MUC16	-	NULL	ENSG00000181143		0.493	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	-	0.00	52	0	C	NM_024690		9071105	-1	tier1	-	no_errors	ENST00000397910	ensembl	human	known	74_37	silent	15.56	38	7	SNP	0.000	T
MUC4	4585	genome.wustl.edu	37	3	195509267	195509267	+	Missense_Mutation	SNP	G	G	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr3:195509267G>T	ENST00000463781.3	-	2	9643	c.9184C>A	c.(9184-9186)Cct>Act	p.P3062T	MUC4_ENST00000475231.1_Missense_Mutation_p.P3062T|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GCTGAGGAAGGGCTGGTGACA	0.622																																																	0													20.0	11.0	14.0					3																	195509267		633	1552	2185	SO:0001583	missense	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.9184C>A	3.37:g.195509267G>T	ENSP00000417498:p.Pro3062Thr		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.P3062T	ENST00000463781.3	37	c.9184	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	g	6.818	0.520066	0.13005	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.27557	1.66;1.66	.	.	.	.	.	.	.	.	T	0.14743	0.0356	N	0.14661	0.345	0.09310	N	1	B	0.15141	0.012	B	0.04013	0.001	T	0.28870	-1.0030	7	.	.	.	.	5.4195	0.16392	0.0:0.0:1.0:0.0	.	2934	E7ESK3	.	T	3062	ENSP00000417498:P3062T;ENSP00000420243:P3062T	.	P	-	1	0	MUC4	196994046	0.002000	0.14202	0.016000	0.15963	0.000000	0.00434	-0.266000	0.08631	0.497000	0.27926	0.000000	0.15137	CCT	MUC4	-	NULL	ENSG00000145113		0.622	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	-	0.00	12	0	G	NM_018406		195509267	-1	tier1	-	no_errors	ENST00000463781	ensembl	human	known	74_37	missense	50.00	6	6	SNP	0.127	T
MUC4	4585	genome.wustl.edu	37	3	195509950	195509950	+	Missense_Mutation	SNP	G	G	A	rs200731994	byFrequency	TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr3:195509950G>A	ENST00000463781.3	-	2	8960	c.8501C>T	c.(8500-8502)cCt>cTt	p.P2834L	MUC4_ENST00000475231.1_Missense_Mutation_p.P2834L|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GATGGTGACAGGAAGAGAGGT	0.587																																																	0													100.0	63.0	74.0					3																	195509950		687	1550	2237	SO:0001583	missense	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8501C>T	3.37:g.195509950G>A	ENSP00000417498:p.Pro2834Leu		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.P2834L	ENST00000463781.3	37	c.8501	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	g	7.918	0.738037	0.15574	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.37411	1.36;1.2	.	.	.	.	.	.	.	.	T	0.14614	0.0353	N	0.08118	0	0.28383	N	0.919452	P	0.42584	0.784	B	0.36885	0.235	T	0.15578	-1.0432	7	.	.	.	.	5.8178	0.18506	0.001:0.0:0.999:0.0	.	2706	E7ESK3	.	L	2834	ENSP00000417498:P2834L;ENSP00000420243:P2834L	.	P	-	2	0	MUC4	196994729	0.013000	0.17824	0.000000	0.03702	0.000000	0.00434	0.236000	0.17967	-0.000000	0.14550	0.000000	0.15137	CCT	MUC4	-	NULL	ENSG00000145113		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	-	0.00	219	0	G	NM_018406		195509950	-1	tier1	-	no_errors	ENST00000463781	ensembl	human	known	74_37	missense	12.54	277	40	SNP	0.911	A
MUC5B	727897	genome.wustl.edu	37	11	1269981	1269981	+	Silent	SNP	C	C	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr11:1269981C>T	ENST00000529681.1	+	31	11929	c.11871C>T	c.(11869-11871)acC>acT	p.T3957T	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Silent_p.T3960T	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	3957	11 X approximate tandem repeats, Ser/Thr- rich.|7 X Cys-rich subdomain repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		tcacggccaccggctccacca	0.612																																																	0													69.0	98.0	88.0					11																	1269981		1888	3837	5725	SO:0001819	synonymous_variant	0			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.11871C>T	11.37:g.1269981C>T			O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.T3960	ENST00000529681.1	37	c.11880	CCDS44515.2	11																																																																																			MUC5B	-	NULL	ENSG00000117983		0.612	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	HGNC	protein_coding	OTTHUMT00000390041.2	-	0.00	174	0	C	XM_001126093		1269981	+1	tier1	-	no_errors	ENST00000447027	ensembl	human	known	74_37	silent	28.43	73	29	SNP	0.000	T
NALCN	259232	genome.wustl.edu	37	13	101717816	101717816	+	Missense_Mutation	SNP	A	A	G			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr13:101717816A>G	ENST00000251127.6	-	40	4625	c.4544T>C	c.(4543-4545)aTg>aCg	p.M1515T		NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	1515					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					TTCGTAGCACATGTGCTTAAA	0.592																																																	0													175.0	135.0	149.0					13																	101717816		2203	4300	6503	SO:0001583	missense	0			AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.4544T>C	13.37:g.101717816A>G	ENSP00000251127:p.Met1515Thr		Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Missense_Mutation	SNP	pfam_Ion_trans_dom	p.M1515T	ENST00000251127.6	37	c.4544	CCDS9498.1	13	.	.	.	.	.	.	.	.	.	.	A	22.1	4.244701	0.79912	.	.	ENSG00000102452	ENST00000251127	D	0.97850	-4.57	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	D	0.98102	0.9374	L	0.55213	1.73	0.80722	D	1	D	0.76494	0.999	D	0.69142	0.962	D	0.99445	1.0939	10	0.87932	D	0	.	15.9883	0.80179	1.0:0.0:0.0:0.0	.	1515	Q8IZF0	NALCN_HUMAN	T	1515	ENSP00000251127:M1515T	ENSP00000251127:M1515T	M	-	2	0	NALCN	100515817	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.962000	0.93254	2.172000	0.68678	0.533000	0.62120	ATG	NALCN	-	NULL	ENSG00000102452		0.592	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NALCN	HGNC	protein_coding	OTTHUMT00000045663.2	-	0.00	56	0	A	NM_052867		101717816	-1	tier1	-	no_errors	ENST00000251127	ensembl	human	known	74_37	missense	11.43	31	4	SNP	1.000	G
NCOA6	23054	genome.wustl.edu	37	20	33330968	33330970	+	In_Frame_Del	DEL	TGC	TGC	-	rs140426729	byFrequency	TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	TGC	TGC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr20:33330968_33330970delTGC	ENST00000374796.2	-	12	5660_5662	c.3090_3092delGCA	c.(3088-3093)cagcaa>caa	p.1030_1031QQ>Q	NCOA6_ENST00000359003.2_In_Frame_Del_p.1030_1031QQ>Q			Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	1030	CREBBP-binding region.|Gln-rich.|NCOA1-binding region.				brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-templated transcription, initiation (GO:0006352)|glucocorticoid receptor signaling pathway (GO:0042921)|heart development (GO:0007507)|intracellular estrogen receptor signaling pathway (GO:0030520)|labyrinthine layer blood vessel development (GO:0060716)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)	histone methyltransferase complex (GO:0035097)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(8)|large_intestine(16)|lung(37)|ovary(4)|prostate(5)|skin(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	107						CATCATTtgttgctgctgctgct	0.576																																																	0																																										SO:0001651	inframe_deletion	0			AF128458	CCDS13241.1, CCDS74720.1	20q11	2008-08-01			ENSG00000198646	ENSG00000198646			15936	protein-coding gene	gene with protein product	"""nuclear receptor coactivator RAP250"", ""activating signal cointegrator-2"", ""peroxisome proliferator-activated receptor interacting protein"""	605299				8724849, 8263591	Standard	NM_014071		Approved	KIAA0181, RAP250, ASC2, AIB3, PRIP, TRBP, NRC	uc002xaw.3	Q14686	OTTHUMG00000032311	ENST00000374796.2:c.3090_3092delGCA	20.37:g.33330977_33330979delTGC	ENSP00000363929:p.Gln1032del		A6NLF1|B2RMN5|E1P5P7|Q9NTZ9|Q9UH74|Q9UK86	In_Frame_Del	DEL	NULL	p.Q1032in_frame_del	ENST00000374796.2	37	c.3092_3090	CCDS13241.1	20																																																																																			NCOA6	-	NULL	ENSG00000198646		0.576	NCOA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOA6	HGNC	protein_coding	OTTHUMT00000078811.2		0.00	60	0	TGC	NM_014071		33330970	-1	tier1		no_errors	ENST00000359003	ensembl	human	known	74_37	in_frame_del	9.30	39	4	DEL	1.000:1.000:1.000	-
NLRC4	58484	genome.wustl.edu	37	2	32460524	32460524	+	Missense_Mutation	SNP	C	C	G	rs144418059		TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr2:32460524C>G	ENST00000404025.2	-	9	3216	c.2728G>C	c.(2728-2730)Gtc>Ctc	p.V910L	NLRC4_ENST00000402280.1_Missense_Mutation_p.V910L|NLRC4_ENST00000360906.5_Missense_Mutation_p.V910L|NLRC4_ENST00000342905.6_Missense_Mutation_p.V245L			Q9NPP4	NLRC4_HUMAN	NLR family, CARD domain containing 4	910					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of innate immune response (GO:0002218)|defense response to bacterium (GO:0042742)|detection of bacterium (GO:0016045)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta secretion (GO:0050702)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of apoptotic process (GO:0043065)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein homooligomerization (GO:0051260)|pyroptosis (GO:0070269)	cytosol (GO:0005829)|intracellular (GO:0005622)|IPAF inflammasome complex (GO:0072557)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(1)|ovary(3)|skin(2)|stomach(2)	16	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					CCAAGCTTGACGAGTTGTGGG	0.498																																																	0													174.0	166.0	169.0					2																	32460524		2203	4300	6503	SO:0001583	missense	0			AF376061	CCDS33174.1	2p22-p21	2008-08-27	2006-12-08	2006-12-08	ENSG00000091106	ENSG00000091106		"""Nucleotide-binding domain and leucine rich repeat containing"""	16412	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 4"", ""NOD-like receptor C4"""	606831	"""caspase recruitment domain family, member 12"""	CARD12		11374873	Standard	NM_021209		Approved	CLAN1, ipaf, CLANA, CLANB, CLANC, CLAND, CLR2.1, CLAN	uc021vfq.1	Q9NPP4	OTTHUMG00000152107	ENST00000404025.2:c.2728G>C	2.37:g.32460524C>G	ENSP00000385090:p.Val910Leu		A8K9F8|B2RBQ3|B3KTF0|D6W580|Q96J81|Q96J82|Q96J83	Missense_Mutation	SNP	pfam_CARD,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,pfscan_NACHT_NTPase,pfscan_CARD	p.V910L	ENST00000404025.2	37	c.2728	CCDS33174.1	2	.	.	.	.	.	.	.	.	.	.	C	8.336	0.827687	0.16749	.	.	ENSG00000091106	ENST00000360906;ENST00000402280;ENST00000342905;ENST00000404025	T;T;T;T	0.52057	0.68;0.68;0.68;0.68	4.66	-8.86	0.00795	.	1.796490	0.03567	N	0.227975	T	0.32763	0.0840	L	0.36672	1.1	0.22240	N	0.999265	B;B	0.06786	0.001;0.001	B;B	0.10450	0.005;0.002	T	0.15065	-1.0450	9	0.35671	T	0.21	0.5709	7.8025	0.29183	0.0:0.2405:0.2042:0.5553	.	245;910	Q9NPP4-2;Q9NPP4	.;NLRC4_HUMAN	L	910;910;245;910	ENSP00000354159:V910L;ENSP00000385428:V910L;ENSP00000339666:V245L;ENSP00000385090:V910L	ENSP00000339666:V245L	V	-	1	0	NLRC4	32314028	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-6.173000	0.00077	-1.927000	0.01060	-0.290000	0.09829	GTC	NLRC4	-	NULL	ENSG00000091106		0.498	NLRC4-001	KNOWN	non_canonical_other|basic|appris_principal|CCDS	protein_coding	NLRC4	HGNC	protein_coding	OTTHUMT00000325222.2	-	0.00	52	0	C	NM_021209		32460524	-1	tier1	-	no_errors	ENST00000360906	ensembl	human	known	74_37	missense	22.58	24	7	SNP	0.000	G
NOBOX	135935	genome.wustl.edu	37	7	144098371	144098371	+	Frame_Shift_Del	DEL	C	C	-			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr7:144098371delC	ENST00000467773.1	-	4	611	c.612delG	c.(610-612)gggfs	p.G204fs	NOBOX_ENST00000223140.5_Frame_Shift_Del_p.G119fs|NOBOX_ENST00000483238.1_Frame_Shift_Del_p.G204fs	NM_001080413.3	NP_001073882.3	O60393	NOBOX_HUMAN	NOBOX oogenesis homeobox	204					oogenesis (GO:0048477)|ovarian follicle development (GO:0001541)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)	26	Melanoma(164;0.14)					TTTTCTGCTTCCCGGGGGCTG	0.597																																																	0													33.0	35.0	34.0					7																	144098371		1929	4128	6057	SO:0001589	frameshift_variant	0					7q35	2011-06-20			ENSG00000106410	ENSG00000106410		"""Homeoboxes / PRD class"""	22448	protein-coding gene	gene with protein product	"""newborn ovary homeobox-encoding gene"""	610934				11804785, 16597639	Standard	NM_001080413		Approved	OG2, Og2x	uc022aoj.1	O60393	OTTHUMG00000158051	ENST00000467773.1:c.612delG	7.37:g.144098371delC	ENSP00000419457:p.Gly204fs		A6NCD3|A8MZN5	Frame_Shift_Del	DEL	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.K205fs	ENST00000467773.1	37	c.612		7																																																																																			NOBOX	-	NULL	ENSG00000106410		0.597	NOBOX-002	KNOWN	basic	protein_coding	NOBOX	HGNC	protein_coding	OTTHUMT00000350095.1		0.00	62	0	C	XM_001134420		144098371	-1	tier1		no_errors	ENST00000467773	ensembl	human	known	74_37	frame_shift_del	21.57	40	11	DEL	0.000	-
NPHS2	7827	genome.wustl.edu	37	1	179533884	179533884	+	Missense_Mutation	SNP	G	G	C			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr1:179533884G>C	ENST00000367615.4	-	2	387	c.319C>G	c.(319-321)Ctc>Gtc	p.L107V	NPHS2_ENST00000367616.4_Missense_Mutation_p.L107V	NM_014625.2	NP_055440.1	Q9NP85	PODO_HUMAN	nephrosis 2, idiopathic, steroid-resistant (podocin)	107			L -> P (in NPHS2). {ECO:0000269|PubMed:24227627}.		actin cytoskeleton reorganization (GO:0031532)|excretion (GO:0007588)|metanephric glomerular visceral epithelial cell development (GO:0072249)	cell-cell junction (GO:0005911)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)				NS(1)|endometrium(1)|large_intestine(3)|lung(10)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	20						AGGGAAATGAGGACAAGAAGC	0.413																																																	0													72.0	76.0	74.0					1																	179533884		2203	4300	6503	SO:0001583	missense	0			AJ279254	CCDS1331.1, CCDS72988.1	1q25-q31	2014-06-27			ENSG00000116218	ENSG00000116218			13394	protein-coding gene	gene with protein product		604766				8589695, 10742096	Standard	XM_005245483		Approved	SRN1, PDCN	uc001gmq.4	Q9NP85	OTTHUMG00000035252	ENST00000367615.4:c.319C>G	1.37:g.179533884G>C	ENSP00000356587:p.Leu107Val		B1AM32|B1AM33|Q8N6Q5	Missense_Mutation	SNP	pfam_Band_7,smart_Band_7,prints_Stomatin	p.L107V	ENST00000367615.4	37	c.319	CCDS1331.1	1	.	.	.	.	.	.	.	.	.	.	G	0.016	-1.511857	0.00984	.	.	ENSG00000116218	ENST00000367615;ENST00000367616	D;D	0.99727	-6.55;-6.55	5.46	-0.267	0.12938	.	0.189598	0.45867	D	0.000328	D	0.97247	0.9100	N	0.20685	0.6	0.22330	N	0.9992	B;B	0.28291	0.206;0.002	B;B	0.27170	0.077;0.009	D	0.96940	0.9687	10	0.31617	T	0.26	-10.2445	3.9057	0.09182	0.3379:0.0:0.3025:0.3596	.	107;107	Q9NP85-2;Q9NP85	.;PODO_HUMAN	V	107	ENSP00000356587:L107V;ENSP00000356588:L107V	ENSP00000356587:L107V	L	-	1	0	NPHS2	177800507	0.954000	0.32549	0.249000	0.24280	0.006000	0.05464	0.014000	0.13333	0.032000	0.15435	-1.069000	0.02264	CTC	NPHS2	-	NULL	ENSG00000116218		0.413	NPHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPHS2	HGNC	protein_coding	OTTHUMT00000085283.1	-	0.00	106	0	G			179533884	-1	tier1	-	no_errors	ENST00000367615	ensembl	human	known	74_37	missense	8.86	72	7	SNP	0.298	C
OFD1	8481	genome.wustl.edu	37	X	13787349	13787350	+	3'UTR	INS	-	-	T	rs201476486|rs182746098		TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chrX:13787349_13787350insT	ENST00000340096.6	+	0	3488_3489				OFD1_ENST00000490265.1_3'UTR|OFD1_ENST00000380567.1_3'UTR|OFD1_ENST00000380550.3_3'UTR	NM_003611.2	NP_003602.1	O75665	OFD1_HUMAN	oral-facial-digital syndrome 1						axoneme assembly (GO:0035082)|cilium morphogenesis (GO:0060271)|embryonic body morphogenesis (GO:0010172)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of fibroblast growth factor receptor signaling pathway involved in neural plate anterior/posterior pattern formation (GO:2000314)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	alpha-tubulin binding (GO:0043014)|gamma-tubulin binding (GO:0043015)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	25						TCCAATGTGGGTTTTTTTTTCC	0.317																																																	0																																										SO:0001624	3_prime_UTR_variant	0			Y15164	CCDS14157.1	Xp22	2014-06-18			ENSG00000046651	ENSG00000046651			2567	protein-coding gene	gene with protein product		300170	"""retinitis pigmentosa 23 (X-linked recessive)"""	CXorf5, RP23		9722947, 9215688, 22619378	Standard	NM_003611		Approved	71-7A, JBTS10	uc004cvp.4	O75665	OTTHUMG00000021159	ENST00000340096.6:c.*123->T	X.37:g.13787358_13787358dupT			B9ZVU5|O75666|Q4VAK4	RNA	INS	-	NULL	ENST00000340096.6	37	NULL	CCDS14157.1	X																																																																																			OFD1	-	-	ENSG00000046651		0.317	OFD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OFD1	HGNC	protein_coding	OTTHUMT00000055808.1		0.00	34	0	-	NM_003611		13787350	+1	tier1		no_errors	ENST00000490265	ensembl	human	known	74_37	rna	15.00	17	3	INS	0.001:0.002	T
OR4S2	219431	genome.wustl.edu	37	11	55418475	55418475	+	Missense_Mutation	SNP	C	C	G			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr11:55418475C>G	ENST00000312422.2	+	1	96	c.96C>G	c.(94-96)ttC>ttG	p.F32L		NM_001004059.2	NP_001004059.2	Q8NH73	OR4S2_HUMAN	olfactory receptor, family 4, subfamily S, member 2	32						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(4)|lung(28)|ovary(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_epithelial(135;0.0748)				TTTCTTTCTTCTACATAATCA	0.378																																																	0													132.0	111.0	118.0					11																	55418475		2181	4029	6210	SO:0001583	missense	0			BK004390	CCDS31505.1	11q11	2012-08-09	2002-11-13	2002-11-15	ENSG00000174982	ENSG00000174982		"""GPCR / Class A : Olfactory receptors"""	15183	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily S, member 2 pseudogene"""	OR4S2P			Standard	NM_001004059		Approved	OST725	uc001nhs.1	Q8NH73	OTTHUMG00000166799	ENST00000312422.2:c.96C>G	11.37:g.55418475C>G	ENSP00000310337:p.Phe32Leu		Q6IF72	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F32L	ENST00000312422.2	37	c.96	CCDS31505.1	11	.	.	.	.	.	.	.	.	.	.	C	1.364	-0.587902	0.03799	.	.	ENSG00000174982	ENST00000312422	T	0.00625	6.14	5.36	4.44	0.53790	.	0.000000	0.56097	D	0.000031	T	0.00468	0.0015	N	0.10664	0.02	0.34383	D	0.693343	B	0.21606	0.058	B	0.21917	0.037	T	0.52208	-0.8606	10	0.16896	T	0.51	.	9.5792	0.39477	0.0:0.8348:0.0:0.1652	.	32	Q8NH73	OR4S2_HUMAN	L	32	ENSP00000310337:F32L	ENSP00000310337:F32L	F	+	3	2	OR4S2	55175051	0.000000	0.05858	0.759000	0.31340	0.151000	0.21798	-0.963000	0.03837	1.233000	0.43693	0.549000	0.68633	TTC	OR4S2	-	prints_GPCR_Rhodpsn	ENSG00000174982		0.378	OR4S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4S2	HGNC	protein_coding	OTTHUMT00000391503.1	-	0.00	116	0	C	NM_001004059		55418475	+1	tier1	-	no_errors	ENST00000312422	ensembl	human	known	74_37	missense	22.86	81	24	SNP	0.992	G
OR5V1	81696	genome.wustl.edu	37	6	29323224	29323224	+	Missense_Mutation	SNP	A	A	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr6:29323224A>T	ENST00000377154.1	-	4	1048	c.749T>A	c.(748-750)cTc>cAc	p.L250H	OR5V1_ENST00000543825.1_Missense_Mutation_p.L250H			Q9UGF6	OR5V1_HUMAN	olfactory receptor, family 5, subfamily V, member 1	250						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|kidney(3)|large_intestine(3)|liver(1)|lung(8)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						GCCATAAAAGAGAAAGACAAT	0.453																																					Ovarian(32;43 883 21137 32120 42650)												0													87.0	81.0	83.0					6																	29323224		2203	4300	6503	SO:0001583	missense	0				CCDS4657.1	6p22.1	2013-09-23				ENSG00000243729		"""GPCR / Class A : Olfactory receptors"""	13972	protein-coding gene	gene with protein product							Standard	NM_030876		Approved	hs6M1-21	uc011dlo.2	Q9UGF6		ENST00000377154.1:c.749T>A	6.37:g.29323224A>T	ENSP00000366359:p.Leu250His		A2BDZ0|B0S860|Q5SQI9|Q6NTB5|Q8IVL3	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L250H	ENST00000377154.1	37	c.749	CCDS4657.1	6	.	.	.	.	.	.	.	.	.	.	A	14.52	2.559647	0.45590	.	.	ENSG00000243729	ENST00000377154;ENST00000377151;ENST00000543825	T;T	0.00302	8.2;8.2	5.01	5.01	0.66863	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00695	0.0023	H	0.98048	4.135	0.09310	N	0.999996	D	0.89917	1.0	D	0.97110	1.0	T	0.27365	-1.0076	9	0.87932	D	0	-25.3512	14.5239	0.67873	1.0:0.0:0.0:0.0	.	250	Q9UGF6	OR5V1_HUMAN	H	250	ENSP00000366359:L250H;ENSP00000443309:L250H	ENSP00000366356:L250H	L	-	2	0	OR5V1	29431203	0.675000	0.27558	0.019000	0.16419	0.322000	0.28314	6.272000	0.72575	2.101000	0.63845	0.443000	0.29094	CTC	OR5V1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000243729		0.453	OR5V1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5V1	HGNC	protein_coding	OTTHUMT00000076398.3		0.00	40	0	A			29323224	-1			no_errors	ENST00000377154	ensembl	human	known	74_37	missense	13.64	19	3	SNP	0.132	T
PACS2	23241	genome.wustl.edu	37	14	105847331	105847331	+	Missense_Mutation	SNP	A	A	G			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr14:105847331A>G	ENST00000325438.8	+	12	1667	c.1163A>G	c.(1162-1164)gAg>gGg	p.E388G	PACS2_ENST00000547217.1_Missense_Mutation_p.E358G|PACS2_ENST00000551743.1_5'Flank|PACS2_ENST00000458164.2_Missense_Mutation_p.E388G|PACS2_ENST00000447393.1_Missense_Mutation_p.E388G|PACS2_ENST00000430725.2_Missense_Mutation_p.E313G			Q86VP3	PACS2_HUMAN	phosphofurin acidic cluster sorting protein 2	388					apoptotic process (GO:0006915)|autophagic vacuole assembly (GO:0000045)|protein localization to pre-autophagosomal structure (GO:0034497)|protein targeting to plasma membrane (GO:0072661)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)				endometrium(2)|kidney(2)|lung(7)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	21		all_cancers(154;0.0351)|all_epithelial(191;0.153)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.0145)|Epithelial(46;0.036)	Epithelial(152;0.138)		GGACAGCCTGAGGACAGCCCC	0.677																																																	0													37.0	35.0	36.0					14																	105847331		2202	4299	6501	SO:0001583	missense	0			AB011174	CCDS32168.1, CCDS45178.1, CCDS45178.2, CCDS58339.1	14q32	2005-02-15	2005-02-15	2005-02-15		ENSG00000179364			23794	protein-coding gene	gene with protein product		610423	"""phosphofurin acidic cluster sorting protein 1-like"""	PACS1L		15692567	Standard	NM_001100913		Approved	KIAA0602	uc001yqu.3	Q86VP3	OTTHUMG00000170450	ENST00000325438.8:c.1163A>G	14.37:g.105847331A>G	ENSP00000321834:p.Glu388Gly		A2VDJ9|G8JLK3|O60342|Q6P191|Q96FL7	Missense_Mutation	SNP	pfam_Phosphofurin_acidic_CS-1	p.E388G	ENST00000325438.8	37	c.1163	CCDS32168.1	14	.	.	.	.	.	.	.	.	.	.	A	10.69	1.422570	0.25639	.	.	ENSG00000179364	ENST00000430725;ENST00000325438;ENST00000458164;ENST00000447393;ENST00000547217	T;T;T;T;T	0.24350	1.86;1.86;1.86;1.86;1.86	4.97	3.8	0.43715	.	0.332161	0.32147	N	0.006520	T	0.15262	0.0368	N	0.22421	0.69	0.30804	N	0.739527	B;B;B;B	0.27140	0.0;0.002;0.001;0.169	B;B;B;B	0.27380	0.002;0.005;0.002;0.079	T	0.12734	-1.0536	10	0.30078	T	0.28	-18.0032	6.8856	0.24197	0.6955:0.1553:0.0:0.1492	.	388;388;388;389	E9PB38;Q86VP3-2;Q86VP3;Q86VP3-3	.;.;PACS2_HUMAN;.	G	313;388;388;388;358	ENSP00000393524:E313G;ENSP00000321834:E388G;ENSP00000399732:E388G;ENSP00000393559:E388G;ENSP00000449525:E358G	ENSP00000321834:E388G	E	+	2	0	PACS2	104918376	0.673000	0.27539	0.901000	0.35422	0.830000	0.47004	2.056000	0.41355	0.731000	0.32448	0.482000	0.46254	GAG	PACS2	-	NULL	ENSG00000179364		0.677	PACS2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	PACS2	HGNC	protein_coding	OTTHUMT00000409209.1	-	0.00	122	0	A	XM_377355		105847331	+1	tier1	-	no_errors	ENST00000458164	ensembl	human	known	74_37	missense	5.00	76	4	SNP	0.773	G
PCCB	5096	genome.wustl.edu	37	3	136012597	136012597	+	Splice_Site	SNP	G	G	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr3:136012597G>T	ENST00000251654.4	+	7	724		c.e7-1		PCCB_ENST00000469217.1_Splice_Site|PCCB_ENST00000471595.1_Splice_Site|PCCB_ENST00000482086.1_Splice_Site|PCCB_ENST00000474833.1_Splice_Site|PCCB_ENST00000466072.1_Splice_Site|PCCB_ENST00000478469.1_Splice_Site|PCCB_ENST00000490504.1_Splice_Site|PCCB_ENST00000483687.1_Splice_Site|PCCB_ENST00000468777.1_Splice_Site|PCCB_ENST00000462637.1_Splice_Site	NM_000532.4	NP_000523.2	P05166	PCCB_HUMAN	propionyl CoA carboxylase, beta polypeptide						biotin metabolic process (GO:0006768)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|propionyl-CoA carboxylase activity (GO:0004658)	p.?(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|urinary_tract(1)	25					Biotin(DB00121)|L-Valine(DB00161)	TTTTATTTCAGGACACCTCCT	0.493																																																	1	Unknown(1)	lung(1)											194.0	188.0	190.0					3																	136012597		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS3089.1, CCDS54643.1	3q21-q22	2010-07-01	2010-04-30		ENSG00000114054	ENSG00000114054	6.4.1.3		8654	protein-coding gene	gene with protein product		232050	"""propionyl Coenzyme A carboxylase, beta polypeptide"""			2895916	Standard	NM_000532		Approved		uc003eqy.2	P05166	OTTHUMG00000159792	ENST00000251654.4:c.655-1G>T	3.37:g.136012597G>T			B7Z2Z4|Q16813|Q96CX0	Splice_Site	SNP	-	e7-1	ENST00000251654.4	37	c.655-1	CCDS3089.1	3	.	.	.	.	.	.	.	.	.	.	G	21.4	4.137824	0.77775	.	.	ENSG00000114054	ENST00000251654;ENST00000490504;ENST00000483687;ENST00000468777;ENST00000462637;ENST00000466072;ENST00000482086;ENST00000471595;ENST00000469217;ENST00000478469	.	.	.	5.02	5.02	0.67125	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.3137	0.90210	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PCCB	137495287	1.000000	0.71417	1.000000	0.80357	0.789000	0.44602	9.004000	0.93583	2.482000	0.83794	0.650000	0.86243	.	PCCB	-	-	ENSG00000114054		0.493	PCCB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PCCB	HGNC	protein_coding	OTTHUMT00000357335.1		0.00	59	0	G		Intron	136012597	+1			no_errors	ENST00000251654	ensembl	human	known	74_37	splice_site	5.71	32	2	SNP	1.000	T
PCDH15	65217	genome.wustl.edu	37	10	55955638	55955638	+	Missense_Mutation	SNP	G	G	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr10:55955638G>T	ENST00000320301.6	-	11	1504	c.1110C>A	c.(1108-1110)gaC>gaA	p.D370E	PCDH15_ENST00000395446.1_Missense_Mutation_p.D370E|PCDH15_ENST00000395445.1_Missense_Mutation_p.D370E|PCDH15_ENST00000437009.1_Missense_Mutation_p.D370E|PCDH15_ENST00000373965.2_Missense_Mutation_p.D370E|PCDH15_ENST00000414778.1_Missense_Mutation_p.D375E|PCDH15_ENST00000395432.2_Missense_Mutation_p.D333E|PCDH15_ENST00000395438.1_Missense_Mutation_p.D370E|PCDH15_ENST00000395430.1_Missense_Mutation_p.D370E|PCDH15_ENST00000373957.3_Missense_Mutation_p.D348E|PCDH15_ENST00000361849.3_Missense_Mutation_p.D370E|PCDH15_ENST00000409834.1_5'UTR|PCDH15_ENST00000395440.1_Missense_Mutation_p.D370E|PCDH15_ENST00000395433.1_Missense_Mutation_p.D348E|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000373955.1_Missense_Mutation_p.D370E	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	370	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				GATGACCATTGTCTTGTTCAG	0.343										HNSCC(58;0.16)																																							0													98.0	96.0	96.0					10																	55955638		2203	4300	6503	SO:0001583	missense	0			AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.1110C>A	10.37:g.55955638G>T	ENSP00000322604:p.Asp370Glu		A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.D370E	ENST00000320301.6	37	c.1110	CCDS7248.1	10	.	.	.	.	.	.	.	.	.	.	G	16.63	3.176678	0.57692	.	.	ENSG00000150275	ENST00000373965;ENST00000414778;ENST00000455746;ENST00000395438;ENST00000395445;ENST00000395446;ENST00000395440;ENST00000395432;ENST00000361849;ENST00000395433;ENST00000373957;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000437009;ENST00000373955	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.37411	1.2;1.2;1.2;1.2;1.2;1.2;2.47;1.2;1.2;1.2;1.2;1.2;1.2;1.2	5.17	1.86	0.25419	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.53948	0.1828	M	0.76328	2.33	0.29338	N	0.8662	D;P;P;P;D;P;D;D;D;P;D;D;D;D;P	0.89917	0.996;0.942;0.855;0.768;0.999;0.942;0.996;0.999;0.999;0.719;0.999;0.999;1.0;1.0;0.942	D;P;P;P;D;P;D;D;D;P;D;D;D;D;P	0.91635	0.992;0.684;0.573;0.517;0.997;0.684;0.992;0.986;0.97;0.573;0.986;0.978;0.999;0.997;0.816	T	0.47837	-0.9086	9	0.24483	T	0.36	.	8.9144	0.35572	0.3776:0.0:0.6223:0.0	.	348;370;370;375;370;333;370;370;370;370;370;375;370;348;370	A2A3E8;E7EMG4;A2A3E7;C9JIG1;E7EM53;E7EMG0;A2A3E6;A2A3E3;C6ZEF5;A2A3E2;C6ZEF7;C9J4F3;Q96QU1-3;A2A3D8;Q96QU1	.;.;.;.;.;.;.;.;.;.;.;.;.;.;PCD15_HUMAN	E	370;375;370;370;370;370;370;333;370;348;348;370;370;375;370;370	ENSP00000363076:D370E;ENSP00000410304:D375E;ENSP00000378826:D370E;ENSP00000378832:D370E;ENSP00000378833:D370E;ENSP00000378827:D370E;ENSP00000378820:D333E;ENSP00000354950:D370E;ENSP00000378821:D348E;ENSP00000363068:D348E;ENSP00000322604:D370E;ENSP00000378818:D370E;ENSP00000412628:D370E;ENSP00000363066:D370E	ENSP00000322604:D370E	D	-	3	2	PCDH15	55625644	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	1.652000	0.37313	0.582000	0.29556	0.591000	0.81541	GAC	PCDH15	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000150275		0.343	PCDH15-001	KNOWN	basic|CCDS	protein_coding	PCDH15	HGNC	protein_coding	OTTHUMT00000048121.2		0.00	55	0	G	NM_033056		55955638	-1			no_errors	ENST00000320301	ensembl	human	known	74_37	missense	7.41	25	2	SNP	1.000	T
PCDHA8	56140	genome.wustl.edu	37	5	140221052	140221052	+	Missense_Mutation	SNP	C	C	T	rs562900530		TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr5:140221052C>T	ENST00000531613.1	+	1	146	c.146C>T	c.(145-147)gCg>gTg	p.A49V	PCDHA6_ENST00000527624.1_Intron|PCDHA8_ENST00000378123.3_Missense_Mutation_p.A49V|PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529619.1_Intron	NM_018911.2	NP_061734.1	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8	49	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(31)|ovary(2)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(6)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGCCGGATCGCGCAGGACCTG	0.667													.|||	1	0.000199681	0.0	0.0	5008	,	,		15147	0.0		0.0	False		,,,				2504	0.001																0													39.0	48.0	45.0					5																	140221052		2202	4298	6500	SO:0001583	missense	0			AF152486	CCDS54919.1	5q31	2010-11-26				ENSG00000204962		"""Cadherins / Protocadherins : Clustered"""	8674	other	complex locus constituent	"""KIAA0345-like 6"""	606314				10380929	Standard	NM_018911		Approved			Q9Y5H6		ENST00000531613.1:c.146C>T	5.37:g.140221052C>T	ENSP00000434655:p.Ala49Val		B9EGT7|O75281	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.A49V	ENST00000531613.1	37	c.146	CCDS54919.1	5	.	.	.	.	.	.	.	.	.	.	C	32	5.164728	0.94727	.	.	ENSG00000204962	ENST00000531613;ENST00000378123	T;T	0.53423	0.62;0.62	3.95	3.95	0.45737	Cadherin, N-terminal (1);Cadherin (3);Cadherin-like (1);	0.000000	0.36444	U	0.002584	T	0.70894	0.3276	M	0.86805	2.84	0.80722	D	1	D;D	0.89917	1.0;1.0	D;P	0.65140	0.932;0.819	T	0.79317	-0.1853	10	0.87932	D	0	.	16.3451	0.83120	0.0:1.0:0.0:0.0	.	49;49	Q9Y5H6;Q9Y5H6-2	PCDA8_HUMAN;.	V	49	ENSP00000434655:A49V;ENSP00000367363:A49V	ENSP00000367363:A49V	A	+	2	0	PCDHA8	140201236	1.000000	0.71417	0.991000	0.47740	0.938000	0.57974	4.864000	0.62990	1.905000	0.55150	0.557000	0.71058	GCG	PCDHA8	-	pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000204962		0.667	PCDHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA8	HGNC	protein_coding	OTTHUMT00000372830.2	-	0.00	143	0	C	NM_018911		140221052	+1	tier1	-	no_errors	ENST00000531613	ensembl	human	known	74_37	missense	5.62	84	5	SNP	0.997	T
PCDHB18	54660	genome.wustl.edu	37	5	140615725	140615725	+	RNA	SNP	C	C	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr5:140615725C>T	ENST00000526308.1	+	0	1788					NR_001281.1		Q96TA0	PCDBI_HUMAN	protocadherin beta 18 pseudogene						homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(9)|lung(7)|ovary(1)|urinary_tract(1)	18						GCGTGGGCGCCGCAGACCACG	0.662																																																	0																																												0			AF152528		5q31.3	2014-03-20			ENSG00000146001	ENSG00000146001		"""Cadherins / Protocadherins : Clustered"""	14548	pseudogene	pseudogene						10380929	Standard	NR_001281		Approved	PCDH-psi2	uc003ljc.1	Q96TA0	OTTHUMG00000167484		5.37:g.140615725C>T			B3KTF8	RNA	SNP	-	NULL	ENST00000526308.1	37	NULL		5																																																																																			PCDHB18	-	-	ENSG00000146001		0.662	PCDHB18-002	KNOWN	basic	processed_transcript	PCDHB18	HGNC	pseudogene	OTTHUMT00000394776.1	-	0.00	225	0	C			140615725	+1	tier1	-	no_errors	ENST00000526308	ensembl	human	known	74_37	rna	23.53	117	36	SNP	0.001	T
PCDHGB2	56103	genome.wustl.edu	37	5	140741229	140741229	+	Silent	SNP	G	G	A	rs377204571		TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr5:140741229G>A	ENST00000522605.1	+	1	1527	c.1527G>A	c.(1525-1527)gcG>gcA	p.A509A	PCDHGA5_ENST00000518069.1_5'Flank|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron	NM_018923.2|NM_032096.1	NP_061746.1|NP_115267.1	Q9Y5G2	PCDGE_HUMAN	protocadherin gamma subfamily B, 2	509	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCGTGAGCGCGCAGAGCGGGG	0.657																																																	0								G	,,,,,,	0,3974		0,0,1987	34.0	37.0	36.0		,,,,,1527,1527	-4.1	0.0	5		36	1,8309		0,1,4154	no	intron,intron,intron,intron,intron,coding-synonymous,coding-synonymous	PCDHGB2,PCDHGB1,PCDHGA4,PCDHGA3,PCDHGA2,PCDHGA1	NM_018912.2,NM_018915.2,NM_018916.3,NM_018917.2,NM_018922.2,NM_018923.2,NM_032096.1	,,,,,,	0,1,6141	AA,AG,GG		0.012,0.0,0.0081	,,,,,,	,,,,,509/932,509/812	140741229	1,12283	1987	4155	6142	SO:0001819	synonymous_variant	0			AF152331	CCDS54924.1, CCDS75332.1	5q31	2010-01-26				ENSG00000253910		"""Cadherins / Protocadherins : Clustered"""	8709	other	protocadherin		606300				10380929	Standard	NM_018923		Approved	PCDH-GAMMA-B2		Q9Y5G2		ENST00000522605.1:c.1527G>A	5.37:g.140741229G>A			Q3MIJ3|Q9UN65	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A509	ENST00000522605.1	37	c.1527	CCDS54924.1	5																																																																																			PCDHGB2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000253910		0.657	PCDHGB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB2	HGNC	protein_coding	OTTHUMT00000374741.1		0.00	66	0	G	NM_018923		140741229	+1			no_errors	ENST00000522605	ensembl	human	known	74_37	silent	6.45	29	2	SNP	0.002	A
PCDHGB3	56102	genome.wustl.edu	37	5	140752321	140752321	+	Missense_Mutation	SNP	G	G	T	rs201408759		TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr5:140752321G>T	ENST00000576222.1	+	1	2491	c.2360G>T	c.(2359-2361)tGg>tTg	p.W787L	PCDHGA5_ENST00000518069.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA6_ENST00000517434.1_5'Flank	NM_018924.2|NM_032097.1	NP_061747.1|NP_115268.1	Q9Y5G1	PCDGF_HUMAN	protocadherin gamma subfamily B, 3	787					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAAGCCTCTTGGTTTGAAAGT	0.383																																																	0													53.0	49.0	51.0					5																	140752321		1851	4100	5951	SO:0001583	missense	0			AF152519	CCDS58980.1, CCDS75334.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8710	other	protocadherin		606301				10380929	Standard	NM_018924		Approved	PCDH-GAMMA-B3		Q9Y5G1		ENST00000576222.1:c.2360G>T	5.37:g.140752321G>T	ENSP00000461862:p.Trp787Leu		A7E229|Q9Y5C7	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.W787L	ENST00000576222.1	37	c.2360	CCDS58980.1	5																																																																																			PCDHGB3	-	NULL	ENSG00000262209		0.383	PCDHGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB3	HGNC	protein_coding	OTTHUMT00000437094.1	-	0.00	43	0	G	NM_018924		140752321	+1	tier1	-	no_errors	ENST00000576222	ensembl	human	known	74_37	missense	41.67	14	10	SNP	0.072	T
PCDHGB7	56099	genome.wustl.edu	37	5	140797618	140797618	+	Silent	SNP	C	C	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr5:140797618C>T	ENST00000398594.2	+	1	192	c.192C>T	c.(190-192)cgC>cgT	p.R64R	PCDHGB2_ENST00000522605.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_018927.3	NP_061750.1	Q9Y5F8	PCDGJ_HUMAN	protocadherin gamma subfamily B, 7	64	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(13)|lung(15)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(3)	56			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGTCGGCTCGCGAGCTGCGAG	0.592											OREG0016863	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													52.0	60.0	57.0					5																	140797618		1947	4145	6092	SO:0001819	synonymous_variant	0			AF152523	CCDS47293.1, CCDS75344.1	5q31	2010-01-26			ENSG00000254122	ENSG00000254122		"""Cadherins / Protocadherins : Clustered"""	8714	other	protocadherin	"""cadherin ME6"""	606304				10380929	Standard	NM_032101		Approved	ME6, PCDH-GAMMA-B7		Q9Y5F8	OTTHUMG00000164054	ENST00000398594.2:c.192C>T	5.37:g.140797618C>T		1659	Q9UN63	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R64	ENST00000398594.2	37	c.192	CCDS47293.1	5																																																																																			PCDHGB7	-	pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin	ENSG00000254122		0.592	PCDHGB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB7	HGNC	protein_coding	OTTHUMT00000376973.1	-	0.00	67	0	C	NM_018927		140797618	+1	tier1	-	no_errors	ENST00000398594	ensembl	human	known	74_37	silent	28.12	46	18	SNP	0.871	T
PCNX	22990	genome.wustl.edu	37	14	71445317	71445317	+	Missense_Mutation	SNP	A	A	C			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr14:71445317A>C	ENST00000304743.2	+	6	2709	c.2263A>C	c.(2263-2265)Aac>Cac	p.N755H	PCNX_ENST00000439984.3_Missense_Mutation_p.N755H|PCNX_ENST00000238570.5_Missense_Mutation_p.N755H	NM_014982.2	NP_055797.2	Q96RV3	PCX1_HUMAN	pecanex homolog (Drosophila)	755						integral component of membrane (GO:0016021)				NS(2)|biliary_tract(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(14)|liver(2)|lung(40)|ovary(1)|prostate(7)|skin(2)|urinary_tract(1)	87			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		TAGCTTGCCAAACCAGGTTGC	0.448																																																	0													82.0	80.0	81.0					14																	71445317		2203	4300	6503	SO:0001583	missense	0			AF233450, AB018348	CCDS9806.1	14q24.2	2014-07-03							19740	protein-coding gene	gene with protein product			"""pecanex-like 1 (Drosophila)"""	PCNXL1		9244429, 15777640	Standard	NM_014982		Approved	KIAA0995, KIAA0805, pecanex	uc001xmo.2	Q96RV3		ENST00000304743.2:c.2263A>C	14.37:g.71445317A>C	ENSP00000304192:p.Asn755His		B2RTR6|O94897|Q96AI7|Q9Y2J9	Missense_Mutation	SNP	pfam_Pecanex	p.N755H	ENST00000304743.2	37	c.2263	CCDS9806.1	14	.	.	.	.	.	.	.	.	.	.	A	13.69	2.311200	0.40895	.	.	ENSG00000100731	ENST00000304743;ENST00000238570;ENST00000439984	T;T;T	0.10668	5.32;5.32;2.85	5.56	5.56	0.83823	.	0.238485	0.48767	D	0.000162	T	0.15349	0.0370	L	0.38175	1.15	0.24216	N	0.995456	B;B;P	0.36315	0.162;0.162;0.547	B;B;B	0.44224	0.121;0.066;0.444	T	0.09618	-1.0666	10	0.49607	T	0.09	.	15.7166	0.77672	1.0:0.0:0.0:0.0	.	755;755;755	B2RTR6;Q96RV3;Q96RV3-2	.;PCX1_HUMAN;.	H	755	ENSP00000304192:N755H;ENSP00000238570:N755H;ENSP00000396617:N755H	ENSP00000238570:N755H	N	+	1	0	PCNX	70515070	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	5.446000	0.66600	2.111000	0.64477	0.533000	0.62120	AAC	PCNX	-	NULL	ENSG00000100731		0.448	PCNX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNX	HGNC	protein_coding	OTTHUMT00000412479.1	-	0.00	80	0	A	NM_014982		71445317	+1	tier1	-	no_errors	ENST00000304743	ensembl	human	known	74_37	missense	37.25	32	19	SNP	1.000	C
PCSK1	5122	genome.wustl.edu	37	5	95728920	95728920	+	Nonsense_Mutation	SNP	G	G	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr5:95728920G>A	ENST00000311106.3	-	14	2284	c.2047C>T	c.(2047-2049)Caa>Taa	p.Q683*	PCSK1_ENST00000508626.1_Nonsense_Mutation_p.Q636*|PCSK1_ENST00000513085.1_5'UTR|CTD-2337A12.1_ENST00000502645.2_RNA	NM_000439.4|NM_001177876.1	NP_000430.3|NP_001171347.1	P29120	NEC1_HUMAN	proprotein convertase subtilisin/kexin type 1	683					cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|metabolic process (GO:0008152)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)|regulation of insulin secretion (GO:0050796)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|secretory granule lumen (GO:0034774)	serine-type endopeptidase activity (GO:0004252)			NS(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(14)|ovary(2)|prostate(3)|skin(3)|urinary_tract(2)	36		all_cancers(142;2.67e-06)|all_epithelial(76;6.92e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.0112)|Colorectal(57;0.0341)|Breast(839;0.244)		all cancers(79;3.44e-16)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	TTTGGTGATTGCTTTGGCGGT	0.522																																																	0													112.0	116.0	115.0					5																	95728920		2203	4300	6503	SO:0001587	stop_gained	0				CCDS4081.1, CCDS54881.1	5q15-q21	2008-07-18			ENSG00000175426	ENSG00000175426			8743	protein-coding gene	gene with protein product	"""prohormone convertase 3"", ""prohormone convertase 1"", ""neuroendocrine convertase 1"", ""proprotein convertase 1"""	162150		NEC1		1765368	Standard	NM_000439		Approved	PC1, PC3, SPC3	uc003kls.2	P29120	OTTHUMG00000122089	ENST00000311106.3:c.2047C>T	5.37:g.95728920G>A	ENSP00000308024:p.Gln683*		B7Z8T7|E9PHA1|P78478|Q92532	Nonsense_Mutation	SNP	pfam_Peptidase_S8/S53_dom,pfam_PrprotnconvertsP,pfam_Proho_convert,superfamily_Peptidase_S8/S53_dom,superfamily_Galactose-bd-like,superfamily_Prot_inh_propept,prints_Peptidase_S8_subtilisin-rel	p.Q683*	ENST00000311106.3	37	c.2047	CCDS4081.1	5	.	.	.	.	.	.	.	.	.	.	G	26.1	4.700882	0.88924	.	.	ENSG00000175426	ENST00000311106;ENST00000508626	.	.	.	5.62	5.62	0.85841	.	0.675310	0.15902	N	0.239019	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.20519	T	0.43	-0.754	19.2582	0.93955	0.0:0.0:1.0:0.0	.	.	.	.	X	683;636	.	ENSP00000308024:Q683X	Q	-	1	0	PCSK1	95754676	0.996000	0.38824	0.399000	0.26333	0.009000	0.06853	6.611000	0.74183	2.625000	0.88918	0.655000	0.94253	CAA	PCSK1	-	NULL	ENSG00000175426		0.522	PCSK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCSK1	HGNC	protein_coding	OTTHUMT00000242851.1		0.00	92	0	G	NM_000439		95728920	-1			no_errors	ENST00000311106	ensembl	human	known	74_37	nonsense	7.14	52	4	SNP	0.143	A
PDE6B	5158	genome.wustl.edu	37	4	657651	657651	+	Silent	SNP	G	G	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr4:657651G>A	ENST00000496514.1	+	16	2034	c.2013G>A	c.(2011-2013)ctG>ctA	p.L671L	RP11-1191J2.5_ENST00000609172.1_RNA|PDE6B_ENST00000255622.6_Silent_p.L671L|PDE6B_ENST00000429163.2_Silent_p.L392L			P35913	PDE6B_HUMAN	phosphodiesterase 6B, cGMP-specific, rod, beta	671					cytosolic calcium ion homeostasis (GO:0051480)|GMP metabolic process (GO:0046037)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|metal ion binding (GO:0046872)			NS(1)|breast(3)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(2)|prostate(2)|urinary_tract(1)	30					Caffeine(DB00201)	ACCTGGCCCTGTACTTCAAGT	0.706																																					GBM(71;463 1194 9848 25922 46834)												0													39.0	39.0	39.0					4																	657651		2202	4300	6502	SO:0001819	synonymous_variant	0			BC000249	CCDS33932.1, CCDS46993.1, CCDS54703.1	4p16.3	2014-01-28	2008-07-31		ENSG00000133256	ENSG00000133256	3.1.4.17	"""Phosphodiesterases"""	8786	protein-coding gene	gene with protein product	"""congenital stationary night blindness 3, autosomal dominant"""	180072		PDEB		1313787	Standard	NM_001145292		Approved	CSNB3, rd1, RP40, CSNBAD2	uc003gap.3	P35913	OTTHUMG00000159909	ENST00000496514.1:c.2013G>A	4.37:g.657651G>A			B7Z9T9|E7ETT3|Q53XN5|Q9BWH5|Q9UD49	Silent	SNP	pfam_PDEase_catalytic_dom,pfam_GAF,smart_GAF,smart_HD/PDEase_dom,prints_PDEase	p.L671	ENST00000496514.1	37	c.2013	CCDS33932.1	4																																																																																			PDE6B	-	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom	ENSG00000133256		0.706	PDE6B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PDE6B	HGNC	protein_coding	OTTHUMT00000358109.1	-	0.00	53	0	G	NM_000283		657651	+1	tier1	-	no_errors	ENST00000496514	ensembl	human	known	74_37	silent	9.76	37	4	SNP	1.000	A
PDS5B	23047	genome.wustl.edu	37	13	33226107	33226107	+	Missense_Mutation	SNP	C	C	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr13:33226107C>T	ENST00000315596.10	+	3	461	c.275C>T	c.(274-276)gCt>gTt	p.A92V		NM_015032.3	NP_055847.1	Q9NTI5	PDS5B_HUMAN	PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae)	92					cell proliferation (GO:0008283)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of cell proliferation (GO:0008285)|regulation of cell proliferation (GO:0042127)	chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(14)|lung(14)|ovary(5)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	62		Lung SC(185;0.0367)		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)		AGGATTTATGCTCCTGAAGCT	0.368																																																	0													182.0	172.0	175.0					13																	33226107		1869	4116	5985	SO:0001583	missense	0			AB023196	CCDS41878.1	13q12.3	2008-02-05	2007-07-18	2007-07-18	ENSG00000083642	ENSG00000083642			20418	protein-coding gene	gene with protein product		605333	"""androgen-induced proliferation inhibitor"""	APRIN		8812419, 10215036	Standard	NM_015032		Approved	AS3, KIAA0979, FLJ23236, CG008	uc010abf.3	Q9NTI5	OTTHUMG00000016704	ENST00000315596.10:c.275C>T	13.37:g.33226107C>T	ENSP00000313851:p.Ala92Val		Q5R3S3|Q5W0K8|Q6NSC3|Q8IXT6|Q9H5N8|Q9Y2I5|Q9Y451	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.A92V	ENST00000315596.10	37	c.275	CCDS41878.1	13	.	.	.	.	.	.	.	.	.	.	C	36	5.723275	0.96847	.	.	ENSG00000083642	ENST00000315596;ENST00000421084	T	0.68479	-0.33	5.59	5.59	0.84812	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.83599	0.5289	M	0.79693	2.465	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.91635	0.999;0.999;0.998	D	0.83872	0.0274	10	0.54805	T	0.06	-18.5746	19.961	0.97250	0.0:1.0:0.0:0.0	.	92;92;92	Q9NTI5;Q9NTI5-3;Q9NTI5-4	PDS5B_HUMAN;.;.	V	92	ENSP00000313851:A92V	ENSP00000313851:A92V	A	+	2	0	PDS5B	32124107	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.654000	0.83653	2.783000	0.95769	0.655000	0.94253	GCT	PDS5B	-	superfamily_ARM-type_fold	ENSG00000083642		0.368	PDS5B-006	KNOWN	basic|appris_principal|CCDS	protein_coding	PDS5B	HGNC	protein_coding	OTTHUMT00000044428.3		0.00	110	0	C	NM_015032		33226107	+1			no_errors	ENST00000315596	ensembl	human	known	74_37	missense	7.84	47	4	SNP	1.000	T
PELI3	246330	genome.wustl.edu	37	11	66239874	66239874	+	Missense_Mutation	SNP	A	A	C			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr11:66239874A>C	ENST00000320740.7	+	5	549	c.389A>C	c.(388-390)tAt>tCt	p.Y130S	PELI3_ENST00000524466.1_Missense_Mutation_p.Y130S|PELI3_ENST00000349459.6_Missense_Mutation_p.Y106S|CTD-3074O7.5_ENST00000527092.1_RNA|CTD-3074O7.5_ENST00000602951.1_RNA|PELI3_ENST00000531856.1_Intron|CTD-3074O7.5_ENST00000533502.1_RNA	NM_001243136.1|NM_145065.2	NP_001230065.1|NP_659502.2	Q8N2H9	PELI3_HUMAN	pellino E3 ubiquitin protein ligase family member 3	130					defense response to Gram-negative bacterium (GO:0050829)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of Toll signaling pathway (GO:0045751)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|negative regulation of type I interferon production (GO:0032480)|positive regulation of nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070434)|protein K63-linked ubiquitination (GO:0070534)|regulation of nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070428)|Toll signaling pathway (GO:0008063)	cytosol (GO:0005829)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(2)|large_intestine(4)|lung(4)|ovary(2)|prostate(1)|skin(1)	15						AGCATCTCGTATACACTGTCC	0.537																																																	0													207.0	156.0	173.0					11																	66239874		2200	4295	6495	SO:0001583	missense	0			AL834395	CCDS31615.1, CCDS41675.1, CCDS73328.1	11q13.2	2012-02-23	2012-02-23		ENSG00000174516	ENSG00000174516		"""Pellino homologs"""	30010	protein-coding gene	gene with protein product		609827	"""pellino homolog 3 (Drosophila)"""			12874243, 15917247	Standard	NM_145065		Approved	MGC35521	uc001oic.4	Q8N2H9	OTTHUMG00000167109	ENST00000320740.7:c.389A>C	11.37:g.66239874A>C	ENSP00000322532:p.Tyr130Ser		Q8N3E1|Q8N9Q6|Q8TAW7|Q8TED5	Missense_Mutation	SNP	pfam_Pellino_fam	p.Y130S	ENST00000320740.7	37	c.389	CCDS31615.1	11	.	.	.	.	.	.	.	.	.	.	A	21.4	4.145919	0.77888	.	.	ENSG00000174516	ENST00000349459;ENST00000320740;ENST00000524466;ENST00000526296	T;T;T;T	0.57595	0.39;0.39;0.39;0.39	5.42	3.0	0.34707	.	0.072085	0.56097	D	0.000021	T	0.69637	0.3133	M	0.82323	2.585	0.51012	D	0.999908	D;D;D	0.69078	0.99;0.997;0.995	P;D;D	0.69479	0.897;0.964;0.925	T	0.69143	-0.5223	10	0.54805	T	0.06	-22.7232	9.2816	0.37731	0.7144:0.0:0.0:0.2856	.	106;130;130	Q8N2H9-2;Q8N2H9;Q8N2H9-4	.;PELI3_HUMAN;.	S	106;130;130;23	ENSP00000309848:Y106S;ENSP00000322532:Y130S;ENSP00000434677:Y130S;ENSP00000436722:Y23S	ENSP00000322532:Y130S	Y	+	2	0	PELI3	65996450	1.000000	0.71417	0.873000	0.34254	0.863000	0.49368	5.096000	0.64535	0.437000	0.26423	0.460000	0.39030	TAT	PELI3	-	pfam_Pellino_fam	ENSG00000174516		0.537	PELI3-001	KNOWN	basic|CCDS	protein_coding	PELI3	HGNC	protein_coding	OTTHUMT00000393226.1	-	0.00	56	0	A	NM_145065		66239874	+1	tier1	-	no_errors	ENST00000320740	ensembl	human	known	74_37	missense	28.99	49	20	SNP	1.000	C
PEX2	5828	genome.wustl.edu	37	8	77895540	77895540	+	Missense_Mutation	SNP	G	G	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr8:77895540G>T	ENST00000419564.2	-	4	1339	c.875C>A	c.(874-876)cCa>cAa	p.P292Q	PEX2_ENST00000520103.1_Missense_Mutation_p.P292Q|PEX2_ENST00000357039.4_Missense_Mutation_p.P292Q|PEX2_ENST00000522527.1_Missense_Mutation_p.P292Q	NM_001172087.1	NP_001165558.1	P28328	PEX2_HUMAN	peroxisomal biogenesis factor 2	292					bile acid biosynthetic process (GO:0006699)|cholesterol homeostasis (GO:0042632)|fatty acid beta-oxidation (GO:0006635)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|peroxisome organization (GO:0007031)|protein destabilization (GO:0031648)|protein import into peroxisome matrix (GO:0016558)|regulation of cholesterol biosynthetic process (GO:0045540)|very long-chain fatty acid metabolic process (GO:0000038)	Cdc73/Paf1 complex (GO:0016593)|integral component of peroxisomal membrane (GO:0005779)|membrane (GO:0016020)|peroxisomal membrane (GO:0005778)	zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)	14						TGATTTCAGTGGCTGCAGACT	0.353																																																	0													97.0	100.0	99.0					8																	77895540		2203	4300	6503	SO:0001583	missense	0			M86852	CCDS6221.1	8q21.11	2010-02-09	2010-01-25	2010-01-25		ENSG00000164751		"""RING-type (C3HC4) zinc fingers"""	9717	protein-coding gene	gene with protein product	"""Zellweger syndrome"", ""peroxin 2"""	170993	"""peroxisomal membrane protein 3 (35kD, Zellweger syndrome)"", ""peroxisomal membrane protein 3, 35kDa"""	PXMP3		1546315, 8858157	Standard	NM_000318		Approved	PMP35, PAF-1, RNF72, ZWS3	uc022awf.1	P28328		ENST00000419564.2:c.875C>A	8.37:g.77895540G>T	ENSP00000400984:p.Pro292Gln		Q567S6|Q9BW41	Missense_Mutation	SNP	pfam_Pex_N,smart_Znf_RING,pfscan_Znf_RING	p.P292Q	ENST00000419564.2	37	c.875	CCDS6221.1	8	.	.	.	.	.	.	.	.	.	.	G	23.7	4.447033	0.84101	.	.	ENSG00000164751	ENST00000357039;ENST00000419564;ENST00000520103;ENST00000522527	T;T;T;T	0.42513	0.97;0.97;0.97;0.97	5.35	5.35	0.76521	Zinc finger, RING/FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	T	0.60051	0.2239	L	0.54323	1.7	0.80722	D	1	D	0.89917	1.0	D	0.69307	0.963	T	0.52586	-0.8556	10	0.33141	T	0.24	-9.104	19.2714	0.94011	0.0:0.0:1.0:0.0	.	292	P28328	PEX2_HUMAN	Q	292	ENSP00000349543:P292Q;ENSP00000400984:P292Q;ENSP00000428590:P292Q;ENSP00000428638:P292Q	ENSP00000349543:P292Q	P	-	2	0	PEX2	78058095	1.000000	0.71417	0.993000	0.49108	0.993000	0.82548	7.258000	0.78371	2.792000	0.96026	0.557000	0.71058	CCA	PEX2	-	NULL	ENSG00000164751		0.353	PEX2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PEX2	HGNC	protein_coding	OTTHUMT00000379122.1	-	0.00	115	0	G	NM_000318		77895540	-1	tier1	-	no_errors	ENST00000357039	ensembl	human	known	74_37	missense	5.80	65	4	SNP	1.000	T
PGAM5	192111	genome.wustl.edu	37	12	133291604	133291604	+	Missense_Mutation	SNP	C	C	T	rs376090046		TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr12:133291604C>T	ENST00000498926.2	+	2	410	c.352C>T	c.(352-354)Cgc>Tgc	p.R118C	PGAM5_ENST00000317555.2_Missense_Mutation_p.R118C|PGAM5_ENST00000454808.2_5'UTR|PXMP2_ENST00000545677.1_Missense_Mutation_p.P157L|PGAM5_ENST00000543955.1_5'UTR	NM_001170543.1|NM_001170544.1	NP_001164014.1|NP_001164015.1	Q96HS1	PGAM5_HUMAN	phosphoglycerate mutase family member 5	118					dephosphorylation (GO:0016311)|necroptotic process (GO:0070266)|positive regulation of GTPase activity (GO:0043547)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	GTPase activator activity (GO:0005096)|phosphatase activity (GO:0016791)|phosphoprotein phosphatase activity (GO:0004721)|protein complex binding (GO:0032403)			endometrium(1)|kidney(1)|large_intestine(1)|lung(2)	5	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.89e-08)|Epithelial(86;1.14e-07)|all cancers(50;3.57e-06)		GGAGAAGGACCGCACTCTGAC	0.592																																																	0								C	CYS/ARG,CYS/ARG,CYS/ARG	0,4404		0,0,2202	80.0	54.0	63.0		352,352,352	2.7	1.0	12		63	1,8595		0,1,4297	no	missense,missense,missense	PGAM5	NM_138575.3,NM_001170544.1,NM_001170543.1	180,180,180	0,1,6499	TT,TC,CC		0.0116,0.0,0.0077	benign,benign,benign	118/256,118/289,118/290	133291604	1,12999	2202	4298	6500	SO:0001583	missense	0			BC008196	CCDS9280.1, CCDS53845.1	12q24.33	2011-07-28			ENSG00000247077	ENSG00000247077			28763	protein-coding gene	gene with protein product		614939				11283018	Standard	NM_001170543		Approved	MGC5352, BXLBv68	uc009zyv.3	Q96HS1	OTTHUMG00000168021	ENST00000498926.2:c.352C>T	12.37:g.133291604C>T	ENSP00000438465:p.Arg118Cys		A9LN06|C9IZY7|Q96JB0	Missense_Mutation	SNP	pfam_His_Pase_superF_clade-1,smart_His_Pase_superF_clade-1	p.R118C	ENST00000498926.2	37	c.352	CCDS53845.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.96|11.96	1.795261|1.795261	0.31777|0.31777	0.0|0.0	1.16E-4|1.16E-4	ENSG00000176894|ENSG00000247077	ENST00000545677|ENST00000317555;ENST00000498926	.|T;T	.|0.72167	.|1.43;-0.63	4.64|4.64	2.67|2.67	0.31697|0.31697	.|Histidine phosphatase superfamily, clade-1 (2);	.|0.047537	.|0.85682	.|N	.|0.000000	T|T	0.62368|0.62368	0.2422|0.2422	M|M	0.64170|0.64170	1.965|1.965	0.80722|0.80722	D|D	1|1	.|B;B	.|0.27823	.|0.105;0.19	.|B;B	.|0.20577	.|0.03;0.022	T|T	0.62699|0.62699	-0.6799|-0.6799	6|10	0.87932|0.66056	D|D	0|0.02	-9.9653|-9.9653	7.3169|7.3169	0.26505|0.26505	0.2997:0.6094:0.0:0.0909|0.2997:0.6094:0.0:0.0909	.|.	.|118;118	.|Q96HS1;Q96HS1-2	.|PGAM5_HUMAN;.	L|C	157|118	.|ENSP00000321503:R118C;ENSP00000438465:R118C	ENSP00000444697:P157L|ENSP00000321503:R118C	P|R	+|+	2|1	0|0	PXMP2|PGAM5	131801677|131801677	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.843000|0.843000	0.47879|0.47879	2.068000|2.068000	0.41471|0.41471	0.953000|0.953000	0.37825|0.37825	0.462000|0.462000	0.41574|0.41574	CCG|CGC	PGAM5	-	pfam_His_Pase_superF_clade-1,smart_His_Pase_superF_clade-1	ENSG00000247077		0.592	PGAM5-005	KNOWN	basic|appris_principal|CCDS	protein_coding	PGAM5	HGNC	protein_coding	OTTHUMT00000397562.1	-	0.00	33	0	C	NM_138575		133291604	+1	tier1	-	no_errors	ENST00000498926	ensembl	human	known	74_37	missense	26.92	19	7	SNP	0.993	T
PHTF1	10745	genome.wustl.edu	37	1	114253027	114253027	+	Missense_Mutation	SNP	C	C	A	rs148397701		TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr1:114253027C>A	ENST00000369604.1	-	11	1601	c.1118G>T	c.(1117-1119)cGc>cTc	p.R373L	PHTF1_ENST00000393357.2_Missense_Mutation_p.R373L|PHTF1_ENST00000369600.1_Missense_Mutation_p.R320L|PHTF1_ENST00000474926.1_5'UTR|PHTF1_ENST00000447664.2_3'UTR|PHTF1_ENST00000357783.2_Missense_Mutation_p.R373L|PHTF1_ENST00000369598.1_Missense_Mutation_p.R328L|PHTF1_ENST00000369596.2_Missense_Mutation_p.R320L			Q9UMS5	PHTF1_HUMAN	putative homeodomain transcription factor 1	373					transcription, DNA-templated (GO:0006351)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	27	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CGAGTCATGGCGGGTGCTTTC	0.512																																																	0													80.0	76.0	78.0					1																	114253027		2203	4300	6503	SO:0001583	missense	0			AJ011863	CCDS861.1	1p13-p11	2008-07-18			ENSG00000116793	ENSG00000116793			8939	protein-coding gene	gene with protein product		604950		PHTF		10395808	Standard	NM_006608		Approved		uc009wgp.1	Q9UMS5	OTTHUMG00000011800	ENST00000369604.1:c.1118G>T	1.37:g.114253027C>A	ENSP00000358617:p.Arg373Leu		Q5VWP7|Q5VWP8|Q9BUP2|Q9H1X8	Missense_Mutation	SNP	pfam_TF_homeodomain_male	p.R373L	ENST00000369604.1	37	c.1118	CCDS861.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	35|35	5.586402|5.586402	0.96578|0.96578	.|.	.|.	ENSG00000116793|ENSG00000116793	ENST00000412670|ENST00000369597;ENST00000393357;ENST00000369596;ENST00000369598;ENST00000369600;ENST00000369604;ENST00000357783	.|.	.|.	.|.	5.73|5.73	5.73|5.73	0.89815|0.89815	.|.	.|0.110120	.|0.64402	.|D	.|0.000005	T|T	0.72755|0.72755	0.3500|0.3500	M|M	0.63843|0.63843	1.955|1.955	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.67145	.|0.988;0.98;0.996	.|P;P;D	.|0.63957	.|0.728;0.671;0.92	T|T	0.73830|0.73830	-0.3859|-0.3859	5|9	.|0.66056	.|D	.|0.02	-9.8589|-9.8589	19.9025|19.9025	0.96993|0.96993	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|373;128;373	.|Q9UMS5;Q5TCR1;Q9UMS5-2	.|PHTF1_HUMAN;.;.	S|L	129|328;373;320;328;320;373;373	.|.	.|ENSP00000350428:R373L	A|R	-|-	1|2	0|0	PHTF1|PHTF1	114054550|114054550	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.233000|7.233000	0.78125|0.78125	2.722000|2.722000	0.93159|0.93159	0.655000|0.655000	0.94253|0.94253	GCC|CGC	PHTF1	-	NULL	ENSG00000116793		0.512	PHTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHTF1	HGNC	protein_coding	OTTHUMT00000032666.1	-	0.00	66	0	C	NM_006608		114253027	-1	tier1	-	no_errors	ENST00000369604	ensembl	human	known	74_37	missense	58.82	14	20	SNP	1.000	A
PIGF	5281	genome.wustl.edu	37	2	46842241	46842241	+	Silent	SNP	G	G	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr2:46842241G>T	ENST00000281382.6	-	2	233	c.63C>A	c.(61-63)atC>atA	p.I21I	PIGF_ENST00000306465.4_Silent_p.I21I|PIGF_ENST00000495933.1_5'UTR|CRIPT_ENST00000238892.3_5'Flank	NM_002643.3	NP_002634.1	Q07326	PIGF_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class F	21					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	ethanolaminephosphotransferase activity (GO:0004307)			breast(1)|endometrium(1)|lung(1)|stomach(1)	4		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	LUSC - Lung squamous cell carcinoma(58;0.114)			AGACACTTAGGATAATTGAAA	0.358																																																	0													155.0	158.0	157.0					2																	46842241		2203	4299	6502	SO:0001819	synonymous_variant	0				CCDS1827.1, CCDS1828.1	2p21-p16	2013-02-26	2006-06-28		ENSG00000151665	ENSG00000151665		"""Phosphatidylinositol glycan anchor biosynthesis"""	8962	protein-coding gene	gene with protein product		600153	"""phosphatidylinositol glycan, class F"""			8575782, 8463218	Standard	NM_173074		Approved		uc002rvd.3	Q07326	OTTHUMG00000128816	ENST00000281382.6:c.63C>A	2.37:g.46842241G>T			Q8WW20	Silent	SNP	pfam_GPI_biosynthesis_protein_Pig-F	p.I21	ENST00000281382.6	37	c.63	CCDS1827.1	2																																																																																			PIGF	-	pfam_GPI_biosynthesis_protein_Pig-F	ENSG00000151665		0.358	PIGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIGF	HGNC	protein_coding	OTTHUMT00000250749.2	-	0.00	89	0	G	NM_173074		46842241	-1	tier1	-	no_errors	ENST00000281382	ensembl	human	known	74_37	silent	5.06	75	4	SNP	0.989	T
PITX3	5309	genome.wustl.edu	37	10	103990440	103990442	+	In_Frame_Del	DEL	GCG	GCG	-			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	GCG	GCG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr10:103990440_103990442delGCG	ENST00000370002.3	-	4	891_893	c.738_740delCGC	c.(736-741)gccgcg>gcg	p.246_247AA>A	PITX3_ENST00000539804.1_In_Frame_Del_p.246_247AA>A	NM_005029.3	NP_005020.1	O75364	PITX3_HUMAN	paired-like homeodomain 3	246	Poly-Ala.				dopaminergic neuron differentiation (GO:0071542)|lens development in camera-type eye (GO:0002088)|lens fiber cell differentiation (GO:0070306)|lens morphogenesis in camera-type eye (GO:0002089)|locomotory behavior (GO:0007626)|midbrain development (GO:0030901)|neuron development (GO:0048666)|organ morphogenesis (GO:0009887)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			endometrium(1)|large_intestine(2)|lung(2)	5		Colorectal(252;0.00957)		Epithelial(162;4.97e-08)|all cancers(201;8.99e-07)		ggcggcagccgcggcggcggcgg	0.749																																																	0										4,28,3746		1,0,2,1,26,1859						-8.1	0.4			10	5,79,7526		1,0,3,5,69,3727	no	codingComplex	PITX3	NM_005029.3		2,0,5,6,95,5586	A1A1,A1A2,A1R,A2A2,A2R,RR		1.1038,0.847,1.0186				9,107,11272				SO:0001651	inframe_deletion	0				CCDS7532.1	10q24.32	2013-11-14	2007-07-12		ENSG00000107859	ENSG00000107859		"""Homeoboxes / PRD class"""	9006	protein-coding gene	gene with protein product		602669	"""paired-like homeodomain transcription factor 3"", ""anterior segment mesenchymal dysgenesis"""	ASMD		9620774	Standard	NM_005029		Approved		uc001kuu.1	O75364	OTTHUMG00000018952	ENST00000370002.3:c.738_740delCGC	10.37:g.103990449_103990451delGCG	ENSP00000359019:p.Ala250del		Q5VZL2	In_Frame_Del	DEL	pfam_Homeobox_dom,pfam_OAR_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pirsf_Homeobox_Pitx/unc30,pfscan_OAR_dom,pfscan_Homeobox_dom	p.A250in_frame_del	ENST00000370002.3	37	c.740_738	CCDS7532.1	10																																																																																			PITX3	-	pirsf_Homeobox_Pitx/unc30	ENSG00000107859		0.749	PITX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PITX3	HGNC	protein_coding	OTTHUMT00000050031.1		0.00	53	0	GCG			103990442	-1	tier1		no_errors	ENST00000370002	ensembl	human	known	74_37	in_frame_del	16.67	15	3	DEL	0.722:0.728:0.588	-
PLEC	5339	genome.wustl.edu	37	8	144995674	144995674	+	Missense_Mutation	SNP	C	C	T	rs201916690		TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr8:144995674C>T	ENST00000322810.4	-	32	8895	c.8726G>A	c.(8725-8727)cGc>cAc	p.R2909H	PLEC_ENST00000354589.3_Missense_Mutation_p.R2772H|PLEC_ENST00000436759.2_Missense_Mutation_p.R2799H|PLEC_ENST00000527096.1_Missense_Mutation_p.R2795H|PLEC_ENST00000357649.2_Missense_Mutation_p.R2776H|PLEC_ENST00000398774.2_Missense_Mutation_p.R2740H|PLEC_ENST00000345136.3_Missense_Mutation_p.R2772H|PLEC_ENST00000356346.3_Missense_Mutation_p.R2758H|PLEC_ENST00000354958.2_Missense_Mutation_p.R2750H	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	2909	Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						AGTGACGGCGCGCTCGGCCGA	0.662																																																	0								C	HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG	7,4107		0,7,2050	34.0	43.0	40.0		8396,8273,8249,8726,8219,8315,8327,8315	4.0	0.8	8		40	0,8330		0,0,4165	no	missense,missense,missense,missense,missense,missense,missense,missense	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	29,29,29,29,29,29,29,29	0,7,6215	TT,TC,CC		0.0,0.1702,0.0563	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	2799/4575,2758/4534,2750/4526,2909/4685,2740/4516,2772/4548,2776/4552,2772/4548	144995674	7,12437	2057	4165	6222	SO:0001583	missense	0			U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.8726G>A	8.37:g.144995674C>T	ENSP00000323856:p.Arg2909His		Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	pfam_Plectin_repeat,pfam_CH-domain,pfam_S10_plectin_N,superfamily_CH-domain,superfamily_Chorismate_mutase_type_II,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,pfscan_CH-domain	p.R2909H	ENST00000322810.4	37	c.8726	CCDS43772.1	8	.	.	.	.	.	.	.	.	.	.	C	9.166	1.019919	0.19355	0.001702	0.0	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	T;T;T;T;T;T;T;T;T	0.69435	-0.4;-0.4;-0.4;-0.4;-0.4;-0.4;-0.4;-0.4;-0.4	4.94	4.04	0.47022	.	0.090297	0.41097	U	0.000955	T	0.78220	0.4249	M	0.79258	2.445	0.40909	D	0.984219	D;D;D;D;D;D;D;D	0.76494	0.999;0.999;0.999;0.998;0.999;0.999;0.999;0.999	P;P;P;P;P;P;P;P	0.59115	0.852;0.852;0.852;0.716;0.852;0.852;0.852;0.852	T	0.80598	-0.1311	10	0.45353	T	0.12	.	14.454	0.67404	0.1486:0.8514:0.0:0.0	.	2799;2758;2750;2909;2740;2772;2776;2772	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4	.;.;.;PLEC_HUMAN;.;.;.;.	H	2772;2776;2772;2740;2909;2750;2758;2799;2795	ENSP00000344848:R2772H;ENSP00000350277:R2776H;ENSP00000346602:R2772H;ENSP00000381756:R2740H;ENSP00000323856:R2909H;ENSP00000347044:R2750H;ENSP00000348702:R2758H;ENSP00000388180:R2799H;ENSP00000434583:R2795H	ENSP00000323856:R2909H	R	-	2	0	PLEC	145067662	0.966000	0.33281	0.824000	0.32777	0.265000	0.26407	2.551000	0.45820	1.178000	0.42870	0.449000	0.29647	CGC	PLEC	-	smart_Plectin_repeat	ENSG00000178209		0.662	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEC	HGNC	protein_coding	OTTHUMT00000383281.1	-	0.00	61	0	C	NM_000445		144995674	-1	tier1	rs201916690	no_errors	ENST00000322810	ensembl	human	known	74_37	missense	10.81	33	4	SNP	0.996	T
PML	5371	genome.wustl.edu	37	15	74290730	74290730	+	Missense_Mutation	SNP	A	A	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr15:74290730A>T	ENST00000268058.3	+	2	611	c.515A>T	c.(514-516)cAg>cTg	p.Q172L	PML_ENST00000435786.2_Missense_Mutation_p.Q172L|PML_ENST00000567543.1_Missense_Mutation_p.Q172L|PML_ENST00000359928.4_Missense_Mutation_p.Q172L|PML_ENST00000395135.3_Missense_Mutation_p.Q172L|PML_ENST00000395132.2_Missense_Mutation_p.Q172L|PML_ENST00000436891.3_Missense_Mutation_p.Q172L|PML_ENST00000354026.6_Missense_Mutation_p.Q172L|PML_ENST00000569965.1_Missense_Mutation_p.Q172L|PML_ENST00000563500.1_Missense_Mutation_p.Q172L|PML_ENST00000564428.1_Missense_Mutation_p.Q172L|PML_ENST00000569477.1_Missense_Mutation_p.Q172L|PML_ENST00000268059.6_Missense_Mutation_p.Q172L|PML_ENST00000565898.1_Missense_Mutation_p.Q172L	NM_033238.2	NP_150241.2	P29590	PML_HUMAN	promyelocytic leukemia	172					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell cycle arrest (GO:0007050)|cell fate commitment (GO:0045165)|cellular response to interleukin-4 (GO:0071353)|cellular senescence (GO:0090398)|circadian regulation of gene expression (GO:0032922)|common-partner SMAD protein phosphorylation (GO:0007182)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|entrainment of circadian clock by photoperiod (GO:0043153)|extrinsic apoptotic signaling pathway (GO:0097191)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|maintenance of protein location in nucleus (GO:0051457)|myeloid cell differentiation (GO:0030099)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|negative regulation of telomerase activity (GO:0051974)|negative regulation of telomere maintenance via telomerase (GO:0032211)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation in response to oxidative stress (GO:0032938)|negative regulation of viral release from host cell (GO:1902187)|PML body organization (GO:0030578)|positive regulation of apoptotic process involved in mammary gland involution (GO:0060058)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of histone deacetylation (GO:0031065)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein complex assembly (GO:0006461)|protein stabilization (GO:0050821)|protein targeting (GO:0006605)|regulation of calcium ion transport into cytosol (GO:0010522)|regulation of circadian rhythm (GO:0042752)|regulation of double-strand break repair (GO:2000779)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of protein phosphorylation (GO:0001932)|regulation of transcription, DNA-templated (GO:0006355)|response to cytokine (GO:0034097)|response to gamma radiation (GO:0010332)|response to hypoxia (GO:0001666)|response to UV (GO:0009411)|retinoic acid receptor signaling pathway (GO:0048384)|SMAD protein import into nucleus (GO:0007184)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extrinsic component of endoplasmic reticulum membrane (GO:0042406)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	cobalt ion binding (GO:0050897)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|SUMO binding (GO:0032183)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	31						CTGCGCAACCAGTCGGTGCGT	0.632			T	"""RARA, PAX5"""	"""APL, ALL"""																																			Dom	yes		15	15q22	5371	promyelocytic leukemia		L	0													55.0	51.0	53.0					15																	74290730		2198	4297	6495	SO:0001583	missense	0			AB208950	CCDS10255.1, CCDS10256.1, CCDS10257.1, CCDS10258.1, CCDS45297.1, CCDS45298.1, CCDS45299.1, CCDS45300.1, CCDS58386.1	15q24.1	2011-04-21			ENSG00000140464	ENSG00000140464		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	9113	protein-coding gene	gene with protein product		102578					Standard	NM_033244		Approved	MYL, TRIM19, RNF71	uc002awv.3	P29590	OTTHUMG00000137607	ENST00000268058.3:c.515A>T	15.37:g.74290730A>T	ENSP00000268058:p.Gln172Leu		E9PBR7|P29591|P29592|P29593|Q00755|Q15959|Q59FP9|Q8WUA0|Q96S41|Q9BPW2|Q9BWP7|Q9BZX6|Q9BZX7|Q9BZX8|Q9BZX9|Q9BZY0|Q9BZY2|Q9BZY3	Missense_Mutation	SNP	pfam_DUF3583,pfam_Znf_B-box,smart_Znf_RING,smart_Znf_B-box,pfscan_Znf_B-box,pfscan_Znf_RING	p.Q172L	ENST00000268058.3	37	c.515	CCDS10255.1	15	.	.	.	.	.	.	.	.	.	.	A	12.92	2.081317	0.36758	.	.	ENSG00000140464	ENST00000395135;ENST00000435786;ENST00000359928;ENST00000436891;ENST00000268058;ENST00000395132;ENST00000268059;ENST00000354026;ENST00000418568	T;T;T;T;T;T;T;T	0.56275	0.47;0.47;0.47;0.47;0.47;0.47;0.47;0.47	4.61	4.61	0.57282	.	0.629214	0.14408	N	0.321475	T	0.44393	0.1291	N	0.19112	0.55	0.09310	N	1	B;B;B;B;B;P;P;B;P;B;D;B	0.57257	0.002;0.088;0.143;0.226;0.011;0.514;0.625;0.115;0.799;0.016;0.979;0.013	B;B;B;B;B;B;B;B;B;B;P;B	0.53313	0.005;0.017;0.059;0.137;0.016;0.043;0.117;0.018;0.275;0.006;0.723;0.013	T	0.16305	-1.0407	10	0.06891	T	0.86	-7.4996	11.371	0.49699	1.0:0.0:0.0:0.0	.	122;172;172;172;172;172;172;172;172;172;172;175	Q59GQ8;P29590;P29590-11;P29590-12;P29590-5;E9PBR7;P29590-13;P29590-4;P29590-2;P29590-14;P29590-8;Q59H09	.;PML_HUMAN;.;.;.;.;.;.;.;.;.;.	L	172	ENSP00000378567:Q172L;ENSP00000395576:Q172L;ENSP00000353004:Q172L;ENSP00000394642:Q172L;ENSP00000268058:Q172L;ENSP00000378564:Q172L;ENSP00000268059:Q172L;ENSP00000315434:Q172L	ENSP00000268058:Q172L	Q	+	2	0	PML	72077783	0.007000	0.16637	0.027000	0.17364	0.818000	0.46254	1.506000	0.35747	1.726000	0.51525	0.459000	0.35465	CAG	PML	-	NULL	ENSG00000140464		0.632	PML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PML	HGNC	protein_coding	OTTHUMT00000269021.3	-	0.00	14	0	A	NM_002675		74290730	+1	tier1	-	no_errors	ENST00000268058	ensembl	human	known	74_37	missense	60.00	4	6	SNP	0.053	T
POLR1A	25885	genome.wustl.edu	37	2	86327110	86327110	+	Missense_Mutation	SNP	T	T	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr2:86327110T>A	ENST00000263857.6	-	2	641	c.263A>T	c.(262-264)tAt>tTt	p.Y88F	POLR1A_ENST00000409681.1_Missense_Mutation_p.Y88F			O95602	RPA1_HUMAN	polymerase (RNA) I polypeptide A, 194kDa	88					gene expression (GO:0010467)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase I complex (GO:0005736)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	63						GAGAGGGTTATACACTGTGAG	0.562																																																	0													86.0	91.0	89.0					2																	86327110		2061	4191	6252	SO:0001583	missense	0			AK025568	CCDS42706.1	2p11.2	2013-01-21			ENSG00000068654	ENSG00000068654		"""RNA polymerase subunits"""	17264	protein-coding gene	gene with protein product						9236775	Standard	NM_015425		Approved	DKFZP586M0122, FLJ21915, RPO1-4, RPA1	uc002sqs.3	O95602	OTTHUMG00000153165	ENST00000263857.6:c.263A>T	2.37:g.86327110T>A	ENSP00000263857:p.Tyr88Phe		B7Z7T0|D6W5M0|Q0VG05|Q9UEH0|Q9UFT9	Missense_Mutation	SNP	pfam_RNA_pol_Rpb1_5,pfam_RNA_pol_asu,pfam_RNA_pol_Rpb1_3,pfam_RNA_pol_Rpb1_4,pfam_RNA_pol_Rpb1_1,smart_RNA_pol_N	p.Y88F	ENST00000263857.6	37	c.263	CCDS42706.1	2	.	.	.	.	.	.	.	.	.	.	T	17.38	3.375839	0.61735	.	.	ENSG00000068654	ENST00000263857;ENST00000409681	T;T	0.17370	2.28;2.28	5.78	5.78	0.91487	RNA polymerase Rpb1, domain 1 (1);	0.000000	0.85682	D	0.000000	T	0.23926	0.0579	L	0.39085	1.19	0.80722	D	1	B;P	0.44521	0.309;0.837	B;P	0.51055	0.267;0.657	T	0.01305	-1.1390	10	0.25106	T	0.35	-23.8796	16.098	0.81144	0.0:0.0:0.0:1.0	.	88;88	B9ZVN9;O95602	.;RPA1_HUMAN	F	88	ENSP00000263857:Y88F;ENSP00000386300:Y88F	ENSP00000263857:Y88F	Y	-	2	0	POLR1A	86180621	1.000000	0.71417	1.000000	0.80357	0.743000	0.42351	5.746000	0.68681	2.210000	0.71456	0.460000	0.39030	TAT	POLR1A	-	pfam_RNA_pol_Rpb1_1	ENSG00000068654		0.562	POLR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR1A	HGNC	protein_coding	OTTHUMT00000329830.2	-	0.00	102	0	T	NM_015425		86327110	-1	tier1	-	no_errors	ENST00000263857	ensembl	human	known	74_37	missense	52.08	46	50	SNP	1.000	A
POMP	51371	genome.wustl.edu	37	13	29242633	29242633	+	Missense_Mutation	SNP	G	G	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr13:29242633G>T	ENST00000380842.4	+	4	267	c.186G>T	c.(184-186)atG>atT	p.M62I	POMP_ENST00000460403.1_3'UTR	NM_015932.5	NP_057016.1	Q9Y244	POMP_HUMAN	proteasome maturation protein	62					proteasome assembly (GO:0043248)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)|proteasome complex (GO:0000502)				endometrium(2)|kidney(1)|large_intestine(1)	4		Lung SC(185;0.0367)		all cancers(112;0.141)|OV - Ovarian serous cystadenocarcinoma(117;0.216)		AAGATAAAATGAATTTTTCCA	0.363																																																	0													107.0	103.0	104.0					13																	29242633		2203	4300	6503	SO:0001583	missense	0			AF077200	CCDS9331.1	13q12.13	2013-11-11	2006-07-04	2006-07-04	ENSG00000132963	ENSG00000132963			20330	protein-coding gene	gene with protein product	"""proteassemblin"""	613386	"""chromosome 13 open reading frame 12"""	C13orf12		11042152	Standard	NM_015932		Approved	HSPC014, UMP1	uc001usf.3	Q9Y244	OTTHUMG00000016652	ENST00000380842.4:c.186G>T	13.37:g.29242633G>T	ENSP00000370222:p.Met62Ile		A5HKJ2|D6MXU3|Q9HB69	Missense_Mutation	SNP	pfam_UMP1	p.M62I	ENST00000380842.4	37	c.186	CCDS9331.1	13	.	.	.	.	.	.	.	.	.	.	G	16.28	3.078135	0.55753	.	.	ENSG00000132963	ENST00000380842	.	.	.	6.14	6.14	0.99180	.	0.105732	0.85682	D	0.000000	T	0.68559	0.3014	M	0.71871	2.18	0.80722	D	1	B	0.06786	0.001	B	0.08055	0.003	T	0.61466	-0.7057	9	0.33940	T	0.23	-11.9195	19.5905	0.95508	0.0:0.0:1.0:0.0	.	62	Q9Y244	POMP_HUMAN	I	62	.	ENSP00000370222:M62I	M	+	3	0	POMP	28140633	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.787000	0.69013	2.927000	0.99377	0.637000	0.83480	ATG	POMP	-	pfam_UMP1	ENSG00000132963		0.363	POMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POMP	HGNC	protein_coding	OTTHUMT00000044327.1		0.00	63	0	G	NM_015932		29242633	+1			no_errors	ENST00000380842	ensembl	human	known	74_37	missense	8.57	32	3	SNP	1.000	T
PPA1	5464	genome.wustl.edu	37	10	71978538	71978538	+	Missense_Mutation	SNP	C	C	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr10:71978538C>A	ENST00000373232.3	-	3	258	c.159G>T	c.(157-159)tgG>tgT	p.W53C	PPA1_ENST00000495346.1_5'UTR|PPA1_ENST00000608321.1_Missense_Mutation_p.W53C	NM_021129.3	NP_066952.1	Q15181	IPYR_HUMAN	pyrophosphatase (inorganic) 1	53					diphosphate metabolic process (GO:0071344)|gene expression (GO:0010467)|phosphate-containing compound metabolic process (GO:0006796)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	inorganic diphosphatase activity (GO:0004427)|magnesium ion binding (GO:0000287)			breast(2)|endometrium(1)|large_intestine(2)|lung(3)|skin(2)	10						TTGCATTAGACCAGCGTGGTA	0.403																																																	0													103.0	87.0	92.0					10																	71978538		2203	4300	6503	SO:0001583	missense	0			AF154065	CCDS7299.1	10q11.1-q24	2012-10-02	2005-10-07	2005-10-07	ENSG00000180817	ENSG00000180817	3.6.1.1		9226	protein-coding gene	gene with protein product	"""cytosolic inorganic pyrophosphatase"", ""inorganic pyrophosphatase 1"", ""pyrophosphate phospho-hydrolase"""	179030	"""pyrophosphatase (inorganic)"""	PP		10542310, 975879	Standard	NM_021129		Approved	SID6-8061, Ppase, IOPPP, PP1	uc001jqv.1	Q15181	OTTHUMG00000018399	ENST00000373232.3:c.159G>T	10.37:g.71978538C>A	ENSP00000362329:p.Trp53Cys		Q2M348|Q5SQT7|Q6P7P4|Q9UQJ5|Q9Y5B1	Missense_Mutation	SNP	pfam_Pyrophosphatase,superfamily_Pyrophosphatase	p.W53C	ENST00000373232.3	37	c.159	CCDS7299.1	10	.	.	.	.	.	.	.	.	.	.	C	26.1	4.707987	0.89018	.	.	ENSG00000180817	ENST00000373232;ENST00000373230	T;T	0.46451	0.87;0.87	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	T	0.74366	0.3707	M	0.92077	3.27	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.78826	-0.2051	10	0.62326	D	0.03	-3.8237	19.1847	0.93639	0.0:1.0:0.0:0.0	.	53	Q15181	IPYR_HUMAN	C	53	ENSP00000362329:W53C;ENSP00000362327:W53C	ENSP00000362327:W53C	W	-	3	0	PPA1	71648544	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.540000	0.82074	2.882000	0.98803	0.655000	0.94253	TGG	PPA1	-	pfam_Pyrophosphatase,superfamily_Pyrophosphatase	ENSG00000180817		0.403	PPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPA1	HGNC	protein_coding	OTTHUMT00000048490.2		0.00	79	0	C	NM_021129		71978538	-1			no_errors	ENST00000373232	ensembl	human	known	74_37	missense	9.09	30	3	SNP	1.000	A
PPFIBP2	8495	genome.wustl.edu	37	11	7627226	7627226	+	Intron	SNP	A	A	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr11:7627226A>T	ENST00000299492.4	+	6	874				PPFIBP2_ENST00000528883.1_Intron|PPFIBP2_ENST00000533792.1_Intron|PPFIBP2_ENST00000530181.1_Missense_Mutation_p.R13W	NM_003621.3	NP_003612	Q8ND30	LIPB2_HUMAN	PTPRF interacting protein, binding protein 2 (liprin beta 2)						cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|intracellular (GO:0005622)|presynaptic active zone (GO:0048786)	DNA binding (GO:0003677)|integrase activity (GO:0008907)			breast(8)|cervix(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32				Epithelial(150;2.01e-07)|BRCA - Breast invasive adenocarcinoma(625;0.236)		GAAGCTATTGAGGAGACGGAG	0.448																																																	0																																										SO:0001627	intron_variant	0			AF034803	CCDS31419.1, CCDS58116.1, CCDS58117.1	11p15.4	2013-01-10			ENSG00000166387	ENSG00000166387		"""Sterile alpha motif (SAM) domain containing"""	9250	protein-coding gene	gene with protein product		603142				9624153	Standard	NM_003621		Approved	Cclp1	uc001mfj.5	Q8ND30	OTTHUMG00000165617	ENST00000299492.4:c.487-4296A>T	11.37:g.7627226A>T			B7Z433|E9PK77|O75337|Q8WW26	Missense_Mutation	SNP	pfam_SAM_2,pfam_SAM_type1,pfam_Integrase_Tn916-type_DNA-bd_N,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.R13W	ENST00000299492.4	37	c.37	CCDS31419.1	11	.	.	.	.	.	.	.	.	.	.	A	16.09	3.024514	0.54683	.	.	ENSG00000166387	ENST00000530181	T	0.32988	1.43	3.39	3.39	0.38822	.	.	.	.	.	T	0.50548	0.1622	.	.	.	0.25148	N	0.990443	D	0.76494	0.999	D	0.74674	0.984	T	0.30357	-0.9981	8	0.72032	D	0.01	.	10.103	0.42517	1.0:0.0:0.0:0.0	.	13	E9PMU1	.	W	13	ENSP00000437321:R13W	ENSP00000437321:R13W	R	+	1	2	PPFIBP2	7583802	1.000000	0.71417	0.997000	0.53966	0.332000	0.28634	1.442000	0.35046	1.546000	0.49388	0.454000	0.30748	AGG	PPFIBP2	-	NULL	ENSG00000166387		0.448	PPFIBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPFIBP2	HGNC	protein_coding	OTTHUMT00000385345.2	-	0.00	118	0	A	NM_003621		7627226	+1	tier1	-	no_errors	ENST00000530181	ensembl	human	putative	74_37	missense	7.41	50	4	SNP	1.000	T
PPIP5K1	9677	genome.wustl.edu	37	15	43827200	43827200	+	Missense_Mutation	SNP	C	C	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr15:43827200C>A	ENST00000396923.3	-	30	4095	c.3974G>T	c.(3973-3975)tGc>tTc	p.C1325F	PPIP5K1_ENST00000348806.6_Missense_Mutation_p.C1298F|PPIP5K1_ENST00000360301.4_Missense_Mutation_p.C1300F|PPIP5K1_ENST00000420765.1_Missense_Mutation_p.C1325F|PPIP5K1_ENST00000360135.4_Missense_Mutation_p.C1298F|PPIP5K1_ENST00000381879.4_Missense_Mutation_p.C1301F|PPIP5K1_ENST00000381885.1_Missense_Mutation_p.C1321F|PPIP5K1_ENST00000334933.4_Missense_Mutation_p.C1300F			Q6PFW1	VIP1_HUMAN	diphosphoinositol pentakisphosphate kinase 1	1325					inositol metabolic process (GO:0006020)|inositol phosphate metabolic process (GO:0043647)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	acid phosphatase activity (GO:0003993)|ATP binding (GO:0005524)|diphosphoinositol-pentakisphosphate kinase activity (GO:0033857)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol-1,3,4,5,6-pentakisphosphate kinase activity (GO:0000827)			large_intestine(1)	1						ACATAGCTGGCAAACTTCCTC	0.552																																																	0													105.0	103.0	104.0					15																	43827200		2201	4298	6499	SO:0001583	missense	0			AF502586	CCDS32215.1, CCDS45252.1, CCDS53937.1	15q15.3	2010-01-27	2010-01-26	2010-01-26	ENSG00000168781	ENSG00000168781	2.7.4.24		29023	protein-coding gene	gene with protein product		610979	"""histidine acid phosphatase domain containing 2A"""	HISPPD2A		17412958, 17690096, 18981179	Standard	NM_001190214		Approved	KIAA0377, IPS1, VIP1	uc001zrw.3	Q6PFW1	OTTHUMG00000059758	ENST00000396923.3:c.3974G>T	15.37:g.43827200C>A	ENSP00000380129:p.Cys1325Phe		O15082|Q5HYF8|Q7Z3A7|Q86TE7|Q86UV3|Q86UV4|Q86XW8|Q8IZN0	Missense_Mutation	SNP	pfam_His_Pase_superF_clade-2,superfamily_Cys_alpha_HP_mot_SF	p.C1325F	ENST00000396923.3	37	c.3974	CCDS45252.1	15	.	.	.	.	.	.	.	.	.	.	C	0.758	-0.770485	0.02974	.	.	ENSG00000168781	ENST00000381885;ENST00000360301;ENST00000360135;ENST00000334933;ENST00000396923;ENST00000304953;ENST00000381878;ENST00000420765;ENST00000381879;ENST00000348806;ENST00000335092	T;T;T;T;T;T;T;T	0.21191	2.02;2.02;2.55;2.02;2.03;2.03;2.02;2.55	5.73	-1.04	0.10068	.	0.272986	0.26658	N	0.023179	T	0.12092	0.0294	L	0.40543	1.245	0.09310	N	1	B;B;B;B	0.06786	0.001;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.0;0.0;0.0	T	0.13176	-1.0519	10	0.40728	T	0.16	0.3163	2.3529	0.04288	0.1218:0.4679:0.1189:0.2914	.	1298;1325;1322;1300	Q6PFW1-7;Q6PFW1;Q6PFW1-2;Q6PFW1-3	.;VIP1_HUMAN;.;.	F	1321;1300;1298;1300;1325;1325;1300;1325;1301;1298;1087	ENSP00000371309:C1321F;ENSP00000353446:C1300F;ENSP00000353253:C1298F;ENSP00000334779:C1300F;ENSP00000380129:C1325F;ENSP00000400887:C1325F;ENSP00000371303:C1301F;ENSP00000308773:C1298F	ENSP00000304750:C1325F	C	-	2	0	PPIP5K1	41614492	0.000000	0.05858	0.003000	0.11579	0.299000	0.27559	-1.612000	0.02061	0.087000	0.17167	0.514000	0.50259	TGC	PPIP5K1	-	NULL	ENSG00000168781		0.552	PPIP5K1-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	PPIP5K1	HGNC	protein_coding	OTTHUMT00000132907.1	-	0.00	77	0	C	NM_014659		43827200	-1	tier1	-	no_errors	ENST00000420765	ensembl	human	known	74_37	missense	27.03	27	10	SNP	0.000	A
PPP3CC	5533	genome.wustl.edu	37	8	22368688	22368688	+	Missense_Mutation	SNP	C	C	G			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr8:22368688C>G	ENST00000240139.5	+	5	901	c.574C>G	c.(574-576)Ctc>Gtc	p.L192V	PPP3CC_ENST00000518852.1_Missense_Mutation_p.L192V|PPP3CC_ENST00000289963.8_Missense_Mutation_p.L192V|PPP3CC_ENST00000397775.3_Missense_Mutation_p.L192V	NM_005605.4	NP_005596.2	P48454	PP2BC_HUMAN	protein phosphatase 3, catalytic subunit, gamma isozyme	192					apoptotic process (GO:0006915)|intrinsic apoptotic signaling pathway (GO:0097193)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17		Prostate(55;0.104)		BRCA - Breast invasive adenocarcinoma(99;0.00756)|Colorectal(74;0.0238)|COAD - Colon adenocarcinoma(73;0.0835)		CCAGCAGTTTCTCTGTGTACA	0.358																																																	0													179.0	149.0	159.0					8																	22368688		2203	4300	6503	SO:0001583	missense	0				CCDS34859.1, CCDS59094.1, CCDS59093.1	8p21.3	2010-03-17	2010-03-05		ENSG00000120910	ENSG00000120910	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9316	protein-coding gene	gene with protein product	"""calcineurin A gamma"", ""protein phosphatase 2B, catalytic subunit, gamma isoform"""	114107	"""protein phosphatase 3 (formerly 2B), catalytic subunit, gamma isoform (calcineurin A gamma)"", ""protein phosphatase 3 (formerly 2B), catalytic subunit, gamma isoform"""			1339277	Standard	NM_005605		Approved	CALNA3, PP2Bgamma	uc011kzi.2	P48454	OTTHUMG00000163802	ENST00000240139.5:c.574C>G	8.37:g.22368688C>G	ENSP00000240139:p.Leu192Val		B4DRT5|Q9BSS6|Q9H4M5	Missense_Mutation	SNP	pfam_PEstase_dom,smart_Ser/Thr-sp_prot-phosphatase,prints_Ser/Thr-sp_prot-phosphatase	p.L192V	ENST00000240139.5	37	c.574	CCDS34859.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.56|19.56	3.851413|3.851413	0.71719|0.71719	.|.	.|.	ENSG00000120910|ENSG00000120910	ENST00000522034;ENST00000521651|ENST00000518852;ENST00000240139;ENST00000289963;ENST00000397775;ENST00000523620	D;D|D;D;D;D;D	0.84370|0.86694	-1.84;-1.84|-2.16;-2.16;-2.16;-2.16;-2.16	6.03|6.03	4.01|4.01	0.46588|0.46588	.|Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase (2);Metallophosphoesterase domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.94305|0.94305	0.8170|0.8170	H|H	0.97707|0.97707	4.06|4.06	0.53688|0.53688	D|D	0.999978|0.999978	.|D;P;P;P	.|0.53745	.|0.962;0.512;0.784;0.911	.|P;P;P;P	.|0.58780	.|0.845;0.543;0.768;0.651	D|D	0.93558|0.93558	0.6892|0.6892	7|10	0.87932|0.87932	D|D	0|0	-13.6089|-13.6089	8.6147|8.6147	0.33824|0.33824	0.0:0.7245:0.0:0.2755|0.0:0.7245:0.0:0.2755	.|.	.|192;192;192;192	.|B4DRT5;P48454-2;P48454;G3V111	.|.;.;PP2BC_HUMAN;.	L|V	41;68|192;192;192;192;18	ENSP00000430783:F41L;ENSP00000428390:F68L|ENSP00000429379:L192V;ENSP00000240139:L192V;ENSP00000289963:L192V;ENSP00000380878:L192V;ENSP00000430555:L18V	ENSP00000428390:F68L|ENSP00000240139:L192V	F|L	+|+	3|1	2|0	PPP3CC|PPP3CC	22424633|22424633	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	1.776000|1.776000	0.38594|0.38594	0.692000|0.692000	0.31613|0.31613	0.655000|0.655000	0.94253|0.94253	TTC|CTC	PPP3CC	-	pfam_PEstase_dom,smart_Ser/Thr-sp_prot-phosphatase,prints_Ser/Thr-sp_prot-phosphatase	ENSG00000120910		0.358	PPP3CC-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPP3CC	HGNC	protein_coding	OTTHUMT00000375652.1	-	0.00	85	0	C	NM_005605		22368688	+1	tier1	-	no_errors	ENST00000240139	ensembl	human	known	74_37	missense	23.53	65	20	SNP	1.000	G
PRDM9	56979	genome.wustl.edu	37	5	23522934	23522934	+	Silent	SNP	C	C	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr5:23522934C>T	ENST00000296682.3	+	8	1004	c.822C>T	c.(820-822)ggC>ggT	p.G274G		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	274	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						TGCACTTTGGCCCTTATGAGG	0.562										HNSCC(3;0.000094)																																							0													74.0	74.0	74.0					5																	23522934		2203	4300	6503	SO:0001819	synonymous_variant	0			AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.822C>T	5.37:g.23522934C>T			B4DX22|Q27Q50	Silent	SNP	pfam_Znf_C2H2,pfam_SSXRD_motif,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Krueppel-associated_box-rel	p.G274	ENST00000296682.3	37	c.822	CCDS43307.1	5																																																																																			PRDM9	-	pfscan_SET_dom	ENSG00000164256		0.562	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDM9	HGNC	protein_coding	OTTHUMT00000366375.1	-	0.00	78	0	C	NM_020227		23522934	+1	tier1	-	no_errors	ENST00000296682	ensembl	human	known	74_37	silent	15.32	94	17	SNP	0.990	T
PRDM9	56979	genome.wustl.edu	37	5	23527045	23527045	+	Silent	SNP	C	C	A	rs545024531		TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr5:23527045C>A	ENST00000296682.3	+	11	2030	c.1848C>A	c.(1846-1848)ggC>ggA	p.G616G		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	616					meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						GTGGGCGGGGCTTTAGCCGGC	0.627										HNSCC(3;0.000094)																																							0													26.0	27.0	27.0					5																	23527045		1664	3571	5235	SO:0001819	synonymous_variant	0			AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.1848C>A	5.37:g.23527045C>A			B4DX22|Q27Q50	Silent	SNP	pfam_Znf_C2H2,pfam_SSXRD_motif,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Krueppel-associated_box-rel	p.G616	ENST00000296682.3	37	c.1848	CCDS43307.1	5																																																																																			PRDM9	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000164256		0.627	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDM9	HGNC	protein_coding	OTTHUMT00000366375.1	-	0.00	144	0	C	NM_020227		23527045	+1	tier1	-	no_errors	ENST00000296682	ensembl	human	known	74_37	silent	10.11	167	19	SNP	0.948	A
PRPF39	55015	genome.wustl.edu	37	14	45564749	45564749	+	Missense_Mutation	SNP	C	C	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr14:45564749C>A	ENST00000355765.6	+	2	477	c.307C>A	c.(307-309)Caa>Aaa	p.Q103K		NM_017922.3	NP_060392.3	Q86UA1	PRP39_HUMAN	pre-mRNA processing factor 39	103					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)		p.Q103*(1)		breast(2)|endometrium(2)|kidney(4)|lung(3)|ovary(1)	12						ATATTTGCTTCAATATGTAGA	0.313																																																	1	Substitution - Nonsense(1)	cervix(1)											15.0	15.0	15.0					14																	45564749		1814	4066	5880	SO:0001583	missense	0			AK000673	CCDS9682.2	14q21.1	2013-10-03	2013-10-03		ENSG00000185246	ENSG00000185246			20314	protein-coding gene	gene with protein product		614907	"""PRP39 pre-mRNA processing factor 39 homolog (yeast)"", ""PRP39 pre-mRNA processing factor 39 homolog (S. cerevisiae)"""				Standard	NM_017922		Approved	FLJ20666, FLJ11128	uc001wvz.4	Q86UA1	OTTHUMG00000140265	ENST00000355765.6:c.307C>A	14.37:g.45564749C>A	ENSP00000348010:p.Gln103Lys		Q08AL1|Q08AL2|Q9NUU5	Missense_Mutation	SNP	smart_HAT	p.Q103K	ENST00000355765.6	37	c.307	CCDS9682.2	14	.	.	.	.	.	.	.	.	.	.	C	18.69	3.678435	0.68042	.	.	ENSG00000185246	ENST00000355765	T	0.32515	1.45	5.87	5.87	0.94306	Tetratricopeptide-like helical (1);	.	.	.	.	T	0.32436	0.0829	L	0.39085	1.19	0.80722	D	1	P	0.36438	0.553	B	0.42112	0.376	T	0.02009	-1.1230	9	0.14656	T	0.56	-18.0729	19.7885	0.96447	0.0:1.0:0.0:0.0	.	103	Q86UA1	PRP39_HUMAN	K	103	ENSP00000348010:Q103K	ENSP00000348010:Q103K	Q	+	1	0	PRPF39	44634499	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.130000	0.77235	2.779000	0.95612	0.591000	0.81541	CAA	PRPF39	-	NULL	ENSG00000185246		0.313	PRPF39-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF39	HGNC	protein_coding	OTTHUMT00000319683.2		0.00	34	0	C			45564749	+1			no_errors	ENST00000355765	ensembl	human	known	74_37	missense	11.11	16	2	SNP	1.000	A
PRUNE2	158471	genome.wustl.edu	37	9	79321817	79321817	+	Missense_Mutation	SNP	T	T	G			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr9:79321817T>G	ENST00000376718.3	-	8	5496	c.5373A>C	c.(5371-5373)gaA>gaC	p.E1791D	PRUNE2_ENST00000428286.1_Missense_Mutation_p.E1432D	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	1791					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						TTGTCCCTGTTTCTGGAGAAG	0.458																																																	0													96.0	76.0	82.0					9																	79321817		1568	3582	5150	SO:0001583	missense	0			BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.5373A>C	9.37:g.79321817T>G	ENSP00000365908:p.Glu1791Asp		B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Missense_Mutation	SNP	pfam_Bcl2-/adenovirus-E1B,pfam_CRAL-TRIO_dom,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom	p.E1432D	ENST00000376718.3	37	c.4296	CCDS47982.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	6.239|6.239	0.412146|0.412146	0.11812|0.11812	.|.	.|.	ENSG00000106772|ENSG00000106772	ENST00000376718;ENST00000428286;ENST00000422033|ENST00000426088	T;T|.	0.52526|.	0.66;0.66|.	5.53|5.53	-1.42|-1.42	0.08913|0.08913	.|.	0.239792|.	0.29266|.	N|.	0.012643|.	T|T	0.34687|0.34687	0.0906|0.0906	L|L	0.54323|0.54323	1.7|1.7	0.25608|0.25608	N|N	0.986527|0.986527	B|.	0.20887|.	0.049|.	B|.	0.19666|.	0.026|.	T|T	0.36890|0.36890	-0.9729|-0.9729	10|5	0.37606|.	T|.	0.19|.	-7.1944|-7.1944	1.1927|1.1927	0.01868|0.01868	0.2389:0.1404:0.1235:0.4971|0.2389:0.1404:0.1235:0.4971	.|.	1791|.	Q8WUY3|.	PRUN2_HUMAN|.	D|H	1791;1432;1790|1113	ENSP00000365908:E1791D;ENSP00000397425:E1432D|.	ENSP00000365908:E1791D|.	E|N	-|-	3|1	2|0	PRUNE2|PRUNE2	78511637|78511637	0.121000|0.121000	0.22262|0.22262	0.270000|0.270000	0.24601|0.24601	0.073000|0.073000	0.16967|0.16967	0.205000|0.205000	0.17356|0.17356	0.087000|0.087000	0.17167|0.17167	0.533000|0.533000	0.62120|0.62120	GAA|AAC	PRUNE2	-	NULL	ENSG00000106772		0.458	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	PRUNE2	HGNC	protein_coding	OTTHUMT00000052730.2	-	0.00	32	0	T	NM_138818		79321817	-1	tier1	-	no_errors	ENST00000428286	ensembl	human	known	74_37	missense	30.00	21	9	SNP	0.086	G
PSG1	5669	genome.wustl.edu	37	19	43373155	43373155	+	Silent	SNP	G	G	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr19:43373155G>A	ENST00000436291.2	-	4	857	c.741C>T	c.(739-741)aaC>aaT	p.N247N	PSG1_ENST00000403380.3_Silent_p.N154N|PSG1_ENST00000595124.1_Silent_p.N154N|PSG1_ENST00000595356.1_Silent_p.N247N|PSG1_ENST00000244296.2_Silent_p.N247N|PSG1_ENST00000312439.6_Silent_p.N247N	NM_001184825.1|NM_001184826.1	NP_001171754.1|NP_001171755.1	P11464	PSG1_HUMAN	pregnancy specific beta-1-glycoprotein 1	247	Ig-like C2-type 2.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)				breast(2)|endometrium(4)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	30		Prostate(69;0.00682)				GGTTTAAGTTGTTGATGGTGA	0.468																																																	0													223.0	241.0	235.0					19																	43373155		1510	2709	4219	SO:0001819	synonymous_variant	0				CCDS12612.1, CCDS54275.1, CCDS59392.1, CCDS74380.1	19q13.2	2013-01-29			ENSG00000231924	ENSG00000231924		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9514	protein-coding gene	gene with protein product		176390		PSBG1			Standard	NM_006905		Approved	PSGGA, CD66f, PBG1		P11464	OTTHUMG00000151123	ENST00000436291.2:c.741C>T	19.37:g.43373155G>A			O75236|P11462|P11463|Q15231|Q15241|Q15243|Q16660|Q6ICR4|Q9P1W5|Q9UQ79	Silent	SNP	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.N247	ENST00000436291.2	37	c.741	CCDS54275.1	19																																																																																			PSG1	-	smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000231924		0.468	PSG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PSG1	HGNC	protein_coding	OTTHUMT00000321426.1	-	0.00	244	0	G			43373155	-1	tier1	-	no_errors	ENST00000312439	ensembl	human	known	74_37	silent	22.38	111	32	SNP	0.004	A
PTCH1	5727	genome.wustl.edu	37	9	98242361	98242362	+	Frame_Shift_Ins	INS	-	-	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr9:98242361_98242362insA	ENST00000331920.6	-	7	1255_1256	c.956_957insT	c.(955-957)atgfs	p.M319fs	PTCH1_ENST00000437951.1_Frame_Shift_Ins_p.M253fs|PTCH1_ENST00000430669.2_Frame_Shift_Ins_p.M253fs|PTCH1_ENST00000418258.1_Frame_Shift_Ins_p.M168fs|PTCH1_ENST00000421141.1_Frame_Shift_Ins_p.M168fs|PTCH1_ENST00000429896.2_Frame_Shift_Ins_p.M168fs|PTCH1_ENST00000375274.2_Frame_Shift_Ins_p.M318fs|PTCH1_ENST00000548379.1_5'Flank	NM_000264.3	NP_000255.2	Q13635	PTC1_HUMAN	patched 1	319					brain development (GO:0007420)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation involved in kidney development (GO:0061005)|cell proliferation involved in metanephros development (GO:0072203)|cellular response to cholesterol (GO:0071397)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|embryonic organ development (GO:0048568)|epidermis development (GO:0008544)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|hindlimb morphogenesis (GO:0035137)|in utero embryonic development (GO:0001701)|keratinocyte proliferation (GO:0043616)|limb morphogenesis (GO:0035108)|mammary gland duct morphogenesis (GO:0060603)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell division (GO:0051782)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural plate axis specification (GO:0021997)|neural tube closure (GO:0001843)|neural tube patterning (GO:0021532)|organ morphogenesis (GO:0009887)|pharyngeal system development (GO:0060037)|positive regulation of cholesterol efflux (GO:0010875)|protein processing (GO:0016485)|protein targeting to plasma membrane (GO:0072661)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein localization (GO:0032880)|regulation of smoothened signaling pathway (GO:0008589)|renal system development (GO:0072001)|response to chlorate (GO:0010157)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to mechanical stimulus (GO:0009612)|response to retinoic acid (GO:0032526)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|somite development (GO:0061053)|spinal cord motor neuron differentiation (GO:0021522)	axonal growth cone (GO:0044295)|caveola (GO:0005901)|dendritic growth cone (GO:0044294)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|primary cilium (GO:0072372)	cholesterol binding (GO:0015485)|cyclin binding (GO:0030332)|hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|heparin binding (GO:0008201)|smoothened binding (GO:0005119)			NS(8)|bone(33)|breast(10)|central_nervous_system(95)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(8)|kidney(2)|large_intestine(18)|lung(22)|meninges(1)|oesophagus(3)|ovary(6)|prostate(2)|skin(262)|upper_aerodigestive_tract(11)|urinary_tract(2)|vulva(1)	490		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)				AAACAAGGGCCATATCAAGAGG	0.431																																																	0			GRCh37	CI055020	PTCH1	I																																				SO:0001589	frameshift_variant	0			AI494442	CCDS6714.1, CCDS43851.1, CCDS47995.1, CCDS47996.1	9q22.1-q31	2014-09-17	2010-06-24	2006-09-26	ENSG00000185920	ENSG00000185920			9585	protein-coding gene	gene with protein product		601309	"""patched (Drosophila) homolog"", ""patched homolog (Drosophila)"", ""patched homolog 1 (Drosophila)"""	NBCCS, PTCH		8658145	Standard	NM_001083603		Approved	BCNS	uc004avk.4	Q13635	OTTHUMG00000020280	ENST00000331920.6:c.957dupT	9.37:g.98242362_98242362dupA	ENSP00000332353:p.Met319fs		A3KBI9|E9PEJ8|Q13463|Q5R1U7|Q5R1U9|Q5R1V0|Q5VZC0|Q5VZC2|Q86XG7	Frame_Shift_Ins	INS	pfam_Patched,pfscan_SSD,tigrfam_TM_rcpt_patched	p.M319fs	ENST00000331920.6	37	c.957_956	CCDS6714.1	9																																																																																			PTCH1	-	tigrfam_TM_rcpt_patched	ENSG00000185920		0.431	PTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTCH1	HGNC	protein_coding	OTTHUMT00000053229.2		0.00	88	0	-	NM_000264		98242362	-1	tier1		no_errors	ENST00000331920	ensembl	human	known	74_37	frame_shift_ins	70.21	14	33	INS	1.000:1.000	A
PTGFRN	5738	genome.wustl.edu	37	1	117504077	117504077	+	Missense_Mutation	SNP	G	G	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr1:117504077G>A	ENST00000393203.2	+	5	1573	c.1426G>A	c.(1426-1428)Gga>Aga	p.G476R	RNA5SP55_ENST00000516701.1_RNA	NM_020440.2	NP_065173.2	Q9P2B2	FPRP_HUMAN	prostaglandin F2 receptor inhibitor	476	Ig-like C2-type 4.				lipid particle organization (GO:0034389)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|endometrium(4)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)	46	Lung SC(450;0.225)	all_cancers(81;0.00104)|all_lung(203;8.97e-05)|all_epithelial(167;0.000139)|Lung NSC(69;0.000446)		Lung(183;0.0704)|LUSC - Lung squamous cell carcinoma(189;0.227)|Colorectal(144;0.248)		GCTAAAATATGGAGAGAGGAG	0.507																																																	0													84.0	77.0	79.0					1																	117504077		2203	4300	6503	SO:0001583	missense	0			AB014734	CCDS890.1	1p13.1	2013-01-29	2013-01-25		ENSG00000134247	ENSG00000134247		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9601	protein-coding gene	gene with protein product		601204	"""prostaglandin F2 receptor negative regulator"""			8655148	Standard	NM_020440		Approved	FPRP, EWI-F, CD9P-1, FLJ11001, KIAA1436, SMAP-6, CD315	uc001egv.1	Q9P2B2	OTTHUMG00000012028	ENST00000393203.2:c.1426G>A	1.37:g.117504077G>A	ENSP00000376899:p.Gly476Arg		Q5VVU9|Q8N2K6	Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.G476R	ENST00000393203.2	37	c.1426	CCDS890.1	1	.	.	.	.	.	.	.	.	.	.	G	17.53	3.412577	0.62511	.	.	ENSG00000134247	ENST00000393203;ENST00000544471	T	0.30714	1.52	5.35	5.35	0.76521	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.055813	0.64402	D	0.000001	T	0.47619	0.1455	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.49031	-0.8981	10	0.72032	D	0.01	-16.511	16.5508	0.84472	0.0:0.0:1.0:0.0	.	476	Q9P2B2	FPRP_HUMAN	R	476;335	ENSP00000376899:G476R	ENSP00000376899:G476R	G	+	1	0	PTGFRN	117305600	1.000000	0.71417	0.946000	0.38457	0.146000	0.21551	5.972000	0.70448	2.514000	0.84764	0.305000	0.20034	GGA	PTGFRN	-	smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	ENSG00000134247		0.507	PTGFRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTGFRN	HGNC	protein_coding	OTTHUMT00000033271.1	-	0.00	96	0	G	NM_020440		117504077	+1	tier1	-	no_errors	ENST00000393203	ensembl	human	known	74_37	missense	5.97	63	4	SNP	0.994	A
KBTBD4	55709	genome.wustl.edu	37	11	47593922	47593922	+	3'UTR	SNP	A	A	C			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr11:47593922A>C	ENST00000526005.1	-	0	2270				KBTBD4_ENST00000533290.1_3'UTR|PTPMT1_ENST00000527079.2_3'UTR|KBTBD4_ENST00000430070.2_3'UTR|NDUFS3_ENST00000533507.1_Intron|KBTBD4_ENST00000395288.2_3'UTR			Q9NVX7	KBTB4_HUMAN	kelch repeat and BTB (POZ) domain containing 4											NS(1)|breast(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	24						AATAAAACCAAAGTTACATTT	0.338																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF151086	CCDS7940.1, CCDS44594.1	11p11.2	2013-01-08	2003-12-12	2003-12-17	ENSG00000123444	ENSG00000123444		"""BTB/POZ domain containing"""	23761	protein-coding gene	gene with protein product			"""BTB and kelch domain containing 4"""	BKLHD4		11042152	Standard	NM_018095		Approved	FLJ10450, HSPC252	uc001nfz.3	Q9NVX7	OTTHUMG00000166894	ENST00000526005.1:c.*560T>G	11.37:g.47593922A>C			D3DQS1|D3DQS2|Q6IA85|Q9BUC3|Q9NV76	RNA	SNP	-	NULL	ENST00000526005.1	37	NULL	CCDS7940.1	11																																																																																			PTPMT1	-	-	ENSG00000110536		0.338	KBTBD4-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	PTPMT1	HGNC	protein_coding	OTTHUMT00000391763.1	-	0.00	70	0	A	NM_016506		47593922	+1	tier1	-	no_errors	ENST00000527079	ensembl	human	known	74_37	rna	11.29	55	7	SNP	0.004	C
PTPN14	5784	genome.wustl.edu	37	1	214560236	214560236	+	Silent	SNP	G	G	A	rs138976528		TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr1:214560236G>A	ENST00000366956.5	-	12	1211	c.1017C>T	c.(1015-1017)ccC>ccT	p.P339P	PTPN14_ENST00000543945.1_3'UTR	NM_005401.4	NP_005392.2	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type 14	339					lymphangiogenesis (GO:0001946)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of protein export from nucleus (GO:0046825)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)			NS(2)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(9)|liver(3)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	58				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		GGACGTGAACGGGAGGCAGGA	0.577																																					Colon(92;557 1424 24372 34121 40073)												0								G		2,4404	4.2+/-10.8	0,2,2201	93.0	69.0	77.0		1017	1.5	1.0	1	dbSNP_134	77	0,8600		0,0,4300	no	coding-synonymous	PTPN14	NM_005401.4		0,2,6501	AA,AG,GG		0.0,0.0454,0.0154		339/1188	214560236	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	0			X82676	CCDS1514.1	1q32.2	2011-06-09			ENSG00000152104	ENSG00000152104		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9647	protein-coding gene	gene with protein product		603155				7733990	Standard	NM_005401		Approved	PEZ	uc001hkk.2	Q15678	OTTHUMG00000037039	ENST00000366956.5:c.1017C>T	1.37:g.214560236G>A			Q5VSI0	Silent	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_FERM_central,pfam_FERM_N,pfam_FERM_PH-like_C,pfam_Dual-sp_phosphatase_cat-dom,superfamily_FERM_central,smart_Band_41_domain,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Tyr_Pase_non-rcpt_typ-14/21,pfscan_FERM_domain,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt,prints_Band_41_fam	p.P339	ENST00000366956.5	37	c.1017	CCDS1514.1	1																																																																																			PTPN14	-	pirsf_Tyr_Pase_non-rcpt_typ-14/21	ENSG00000152104		0.577	PTPN14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN14	HGNC	protein_coding	OTTHUMT00000089918.2	-	0.00	62	0	G	NM_005401		214560236	-1	tier1	rs138976528	no_errors	ENST00000366956	ensembl	human	known	74_37	silent	25.00	45	15	SNP	0.997	A
RALGAPB	57148	genome.wustl.edu	37	20	37198618	37198618	+	Missense_Mutation	SNP	G	G	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr20:37198618G>A	ENST00000262879.6	+	27	4326	c.4042G>A	c.(4042-4044)Gtg>Atg	p.V1348M	RALGAPB_ENST00000397042.3_Missense_Mutation_p.V1345M|RALGAPB_ENST00000397038.1_Missense_Mutation_p.V1127M|RALGAPB_ENST00000397040.1_Missense_Mutation_p.V1348M			Q86X10	RLGPB_HUMAN	Ral GTPase activating protein, beta subunit (non-catalytic)	1348	Rap-GAP. {ECO:0000255|PROSITE- ProRule:PRU00165}.				activation of Ral GTPase activity (GO:0032859)|membrane organization (GO:0061024)|Ral protein signal transduction (GO:0032484)|regulation of exocyst localization (GO:0060178)		protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(29)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	65						TGTAGTCTGGGTGGAACGCTA	0.468																																																	0													110.0	93.0	99.0					20																	37198618		2203	4300	6503	SO:0001583	missense	0			AB033045	CCDS13305.1, CCDS63272.1	20q11.23	2009-09-09	2009-09-09	2009-09-09	ENSG00000170471	ENSG00000170471			29221	protein-coding gene	gene with protein product			"""KIAA1219"""	KIAA1219		19520869	Standard	XM_005260462		Approved	DKFZp781M2411, RalGAPbeta	uc002xiw.3	Q86X10	OTTHUMG00000140270	ENST00000262879.6:c.4042G>A	20.37:g.37198618G>A	ENSP00000262879:p.Val1348Met		A2A2E8|A2A2E9|Q5TG31|Q8N3D1|Q8WWC0|Q9H3X8|Q9UJR1|Q9ULK1|Q9Y3G9	Missense_Mutation	SNP	superfamily_ARM-type_fold,pfscan_Rap_GAP_dom	p.V1348M	ENST00000262879.6	37	c.4042	CCDS13305.1	20	.	.	.	.	.	.	.	.	.	.	G	24.7	4.555021	0.86231	.	.	ENSG00000170471	ENST00000262879;ENST00000397042;ENST00000397038;ENST00000397040;ENST00000438490	D;D;D;D;D	0.94000	-3.33;-3.33;-3.33;-3.33;-3.33	5.64	5.64	0.86602	Rap/ran-GAP (1);	0.060423	0.64402	D	0.000003	D	0.91399	0.7286	L	0.44542	1.39	0.80722	D	1	P;P	0.41131	0.739;0.739	B;B	0.43225	0.412;0.412	D	0.90653	0.4584	10	0.39692	T	0.17	.	15.2249	0.73342	0.0:0.14:0.86:0.0	.	1345;1348	A2A2E9;Q86X10	.;RLGPB_HUMAN	M	1348;1345;1127;1348;1177	ENSP00000262879:V1348M;ENSP00000380235:V1345M;ENSP00000380231:V1127M;ENSP00000380233:V1348M;ENSP00000416646:V1177M	ENSP00000262879:V1348M	V	+	1	0	RALGAPB	36632032	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.620000	0.83070	2.664000	0.90586	0.655000	0.94253	GTG	RALGAPB	-	pfscan_Rap_GAP_dom	ENSG00000170471		0.468	RALGAPB-001	KNOWN	basic|CCDS	protein_coding	RALGAPB	HGNC	protein_coding	OTTHUMT00000079191.1		0.00	20	0	G	NM_020336		37198618	+1			no_errors	ENST00000262879	ensembl	human	known	74_37	missense	7.41	25	2	SNP	1.000	A
RGR	5995	genome.wustl.edu	37	10	86018276	86018276	+	Missense_Mutation	SNP	A	A	G			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr10:86018276A>G	ENST00000359452.4	+	7	807	c.769A>G	c.(769-771)Att>Gtt	p.I257V	RGR_ENST00000358110.5_Missense_Mutation_p.I215V|RGR_ENST00000479725.1_3'UTR	NM_001012720.1|NM_002921.3	NP_001012738.1|NP_002912.2	P47804	RGR_HUMAN	retinal G protein coupled receptor	253					chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|phototransduction (GO:0007602)|protein-chromophore linkage (GO:0018298)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)	chemokine receptor activity (GO:0004950)|G-protein coupled receptor activity (GO:0004930)|photoreceptor activity (GO:0009881)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|stomach(1)	17						GCCCGCCCTCATTGCCAAAAT	0.562																																					NSCLC(15;204 545 5889 6385 32445)												0													81.0	76.0	78.0					10																	86018276		2203	4300	6503	SO:0001583	missense	0			BC011349	CCDS7374.1, CCDS41543.1	10q23	2013-02-14			ENSG00000148604	ENSG00000148604		"""GPCR / Class A : Opsin receptors"""	9990	protein-coding gene	gene with protein product	"""RGR-opsin"""	600342				8641686	Standard	NM_002921		Approved	RP44	uc001kdd.1	P47804	OTTHUMG00000018636	ENST00000359452.4:c.769A>G	10.37:g.86018276A>G	ENSP00000352427:p.Ile257Val		A6NKK7|Q96FC5	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_RPE_GPCR,prints_GPCR_Rhodpsn	p.I257V	ENST00000359452.4	37	c.769	CCDS7374.1	10	.	.	.	.	.	.	.	.	.	.	A	10.25	1.297283	0.23650	.	.	ENSG00000148604	ENST00000359452;ENST00000358110	T;T	0.37235	1.21;1.21	4.85	1.22	0.21188	GPCR, rhodopsin-like superfamily (1);	0.162323	0.46758	N	0.000266	T	0.29976	0.0750	L	0.53617	1.68	0.29590	N	0.848502	B;B;B	0.13594	0.003;0.008;0.001	B;B;B	0.17722	0.012;0.019;0.013	T	0.19549	-1.0302	10	0.44086	T	0.13	.	8.0532	0.30589	0.7768:0.0:0.2232:0.0	.	215;257;253	P47804-3;P47804-2;P47804	.;.;RGR_HUMAN	V	257;215	ENSP00000352427:I257V;ENSP00000350823:I215V	ENSP00000350823:I215V	I	+	1	0	RGR	86008256	0.012000	0.17670	0.955000	0.39395	0.934000	0.57294	-0.200000	0.09478	0.092000	0.17331	0.533000	0.62120	ATT	RGR	-	pfscan_GPCR_Rhodpsn_7TM	ENSG00000148604		0.562	RGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGR	HGNC	protein_coding	OTTHUMT00000049116.1	-	0.00	79	0	A	NM_002921		86018276	+1	tier1	-	no_errors	ENST00000359452	ensembl	human	known	74_37	missense	17.31	43	9	SNP	0.968	G
RMND5A	64795	genome.wustl.edu	37	2	87000518	87000518	+	Missense_Mutation	SNP	A	A	G	rs202224251		TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr2:87000518A>G	ENST00000283632.4	+	9	1655	c.1160A>G	c.(1159-1161)aAa>aGa	p.K387R	RMND5A_ENST00000472843.1_3'UTR	NM_022780.3	NP_073617.1	Q9H871	RMD5A_HUMAN	required for meiotic nuclear division 5 homolog A (S. cerevisiae)	387										kidney(1)|liver(2)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	17						GGAGATGCCAAACAGATATTT	0.378																																																	0													107.0	107.0	107.0					2																	87000518		2203	4300	6503	SO:0001583	missense	0			BC012165	CCDS1991.1	2p11.2	2012-07-20			ENSG00000153561	ENSG00000153561			25850	protein-coding gene	gene with protein product	"""GID complex subunit 2 homolog A"""					12477932	Standard	NM_022780		Approved	FLJ13910, RMD5, GID2, GID2A	uc002srs.4	Q9H871	OTTHUMG00000130262	ENST00000283632.4:c.1160A>G	2.37:g.87000518A>G	ENSP00000283632:p.Lys387Arg		D6W5M6|Q6NTF0|Q9H6W5|Q9H9H2	Missense_Mutation	SNP	smart_LisH_dimerisation,smart_CTLH_C,smart_CRA_dom,pfscan_LisH_dimerisation,pfscan_CTLH_C	p.K387R	ENST00000283632.4	37	c.1160	CCDS1991.1	2	.	.	.	.	.	.	.	.	.	.	A	12.14	1.847935	0.32699	.	.	ENSG00000153561	ENST00000283632	.	.	.	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	T	0.34716	0.0907	N	0.04373	-0.215	0.58432	D	0.999999	B	0.17667	0.023	B	0.23574	0.047	T	0.32455	-0.9906	9	0.05959	T	0.93	-13.2265	16.3951	0.83601	1.0:0.0:0.0:0.0	.	387	Q9H871	RMD5A_HUMAN	R	387	.	ENSP00000283632:K387R	K	+	2	0	RMND5A	86854029	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.954000	0.93051	2.272000	0.75746	0.460000	0.39030	AAA	RMND5A	-	NULL	ENSG00000153561		0.378	RMND5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RMND5A	HGNC	protein_coding	OTTHUMT00000252591.2	-	0.00	100	0	A	NM_022780		87000518	+1	tier1	rs202224251	no_errors	ENST00000283632	ensembl	human	known	74_37	missense	51.56	31	33	SNP	1.000	G
RIF1	55183	genome.wustl.edu	37	2	152325154	152325154	+	Splice_Site	SNP	G	G	C			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr2:152325154G>C	ENST00000243326.5	+	32	7308		c.e32-1		RIF1_ENST00000430328.2_Splice_Site|RIF1_ENST00000444746.2_Splice_Site|RIF1_ENST00000453091.2_Splice_Site|RIF1_ENST00000428287.2_Splice_Site			Q9Y581	INSL6_HUMAN	replication timing regulatory factor 1						fertilization (GO:0009566)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|sperm motility (GO:0030317)|spermatid development (GO:0007286)	extracellular region (GO:0005576)	hormone activity (GO:0005179)			NS(2)|breast(8)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(19)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	97				BRCA - Breast invasive adenocarcinoma(221;0.0429)		TTTATTCTAAGATTTCAGAAA	0.373																																																	0													129.0	130.0	130.0					2																	152325154		2203	4300	6503	SO:0001630	splice_region_variant	0			AK022932	CCDS2194.1, CCDS54406.1	2q23.3	2014-06-02	2014-06-02		ENSG00000080345	ENSG00000080345			23207	protein-coding gene	gene with protein product		608952	"""RAP1 interacting factor homolog (yeast)"""			15342490, 15042697, 22850674	Standard	NM_018151		Approved	FLJ12870, FLJ10599	uc002txm.3	Q5UIP0	OTTHUMG00000131886	ENST00000243326.5:c.6826-1G>C	2.37:g.152325154G>C			A0AVS0|Q9NS16	Splice_Site	SNP	-	e32-1	ENST00000243326.5	37	c.6826-1	CCDS2194.1	2	.	.	.	.	.	.	.	.	.	.	G	22.0	4.231589	0.79688	.	.	ENSG00000080345	ENST00000444746;ENST00000453091;ENST00000428287;ENST00000243326;ENST00000430328	.	.	.	5.46	5.46	0.80206	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.892	0.92408	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RIF1	152033400	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	8.976000	0.93442	2.543000	0.85770	0.591000	0.81541	.	RIF1	-	-	ENSG00000080345		0.373	RIF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RIF1	HGNC	protein_coding	OTTHUMT00000254836.3	-	0.00	79	0	G		Intron	152325154	+1	tier1	-	no_errors	ENST00000243326	ensembl	human	known	74_37	splice_site	29.41	48	20	SNP	1.000	C
RN7SKP231	106479198	genome.wustl.edu	37	8	92607282	92607283	+	lincRNA	INS	-	-	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr8:92607282_92607283insT	ENST00000518416.1	-	0	415				RN7SKP231_ENST00000363281.1_RNA																							cgagtgtccccttcctacctca	0.569																																																	0																																												0																															8.37:g.92607284_92607284dupT				RNA	INS	-	NULL	ENST00000518416.1	37	NULL		8																																																																																			RN7SKP231	-	-	ENSG00000200151		0.569	RP11-122C21.1-002	KNOWN	basic	lincRNA	RN7SKP231	HGNC	lincRNA	OTTHUMT00000377026.1		0.00	9	0	0			92607283	+1			no_errors	ENST00000363281	ensembl	human	known	74_37	rna	33.33	4	2	INS	0.027:0.030	T
RNF213	57674	genome.wustl.edu	37	17	78353431	78353431	+	Silent	SNP	G	G	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr17:78353431G>T	ENST00000582970.1	+	55	13700	c.13557G>T	c.(13555-13557)ccG>ccT	p.P4519P	RNF213_ENST00000336301.6_Silent_p.P2592P|CTD-2047H16.4_ENST00000572151.1_RNA|RNF213_ENST00000508628.2_Silent_p.P4568P|CTD-2047H16.4_ENST00000573394.1_RNA|CTD-2047H16.4_ENST00000575034.1_RNA	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	4519					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.P2592P(1)|p.P4568P(1)		NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			GTGGCAGGCCGATGGAACAGA	0.502																																																	2	Substitution - coding silent(2)	urinary_tract(2)											118.0	109.0	112.0					17																	78353431		2203	4300	6503	SO:0001819	synonymous_variant	0			AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.13557G>T	17.37:g.78353431G>T			C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Silent	SNP	superfamily_P-loop_NTPase,smart_AAA+_ATPase,smart_Znf_RING,pfscan_Znf_RING	p.P4519	ENST00000582970.1	37	c.13557	CCDS58606.1	17																																																																																			RNF213	-	NULL	ENSG00000173821		0.502	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	RNF213	HGNC	protein_coding	OTTHUMT00000443298.1		0.00	53	0	G	NM_020914		78353431	+1			no_errors	ENST00000582970	ensembl	human	known	74_37	silent	5.66	50	3	SNP	0.145	T
RNF32	140545	genome.wustl.edu	37	7	156450240	156450240	+	Silent	SNP	G	G	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr7:156450240G>T	ENST00000405335.1	+	6	832	c.423G>T	c.(421-423)ctG>ctT	p.L141L	RNF32_ENST00000311822.8_Silent_p.L141L|RNF32_ENST00000392741.2_Silent_p.L141L|RNF32_ENST00000432459.2_Silent_p.L141L|RNF32_ENST00000317955.5_Silent_p.L141L|AC005534.8_ENST00000455709.1_RNA|RNF32_ENST00000343665.4_Intron|RNF32_ENST00000392743.2_Silent_p.L141L|RNF32_ENST00000480011.1_3'UTR			Q9H0A6	RNF32_HUMAN	ring finger protein 32	141						aggresome (GO:0016235)|endosome (GO:0005768)	zinc ion binding (GO:0008270)			cervix(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(2)	15	Ovarian(565;0.218)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.00291)	UCEC - Uterine corpus endometrioid carcinoma (81;0.169)		AACAGGTGCTGCTTTCATGCT	0.463																																																	0													218.0	190.0	200.0					7																	156450240		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS5944.1	7q36	2013-08-05			ENSG00000105982	ENSG00000105982		"""RING-type (C3HC4) zinc fingers"""	17118	protein-coding gene	gene with protein product		610241				11890671	Standard	NM_001184996		Approved	FKSG33, HSD15, LMBR2	uc003wmr.3	Q9H0A6	OTTHUMG00000151440	ENST00000405335.1:c.423G>T	7.37:g.156450240G>T			Q6FIB3|Q6X7T4|Q8N6V8|Q8TDG0|Q96BM5|Q9Y6U1	Silent	SNP	pfam_Znf_C3HC4_RING-type,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_Znf_RING,pfscan_IQ_motif_EF-hand-BS,pfscan_Znf_RING	p.L141	ENST00000405335.1	37	c.423	CCDS5944.1	7																																																																																			RNF32	-	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	ENSG00000105982		0.463	RNF32-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RNF32	HGNC	protein_coding	OTTHUMT00000322660.2	-	0.00	53	0	G	NM_030936		156450240	+1	tier1	-	no_errors	ENST00000317955	ensembl	human	known	74_37	silent	8.51	43	4	SNP	1.000	T
RNFT1	51136	genome.wustl.edu	37	17	58040592	58040592	+	Missense_Mutation	SNP	G	G	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr17:58040592G>A	ENST00000305783.8	-	2	165	c.110C>T	c.(109-111)gCc>gTc	p.A37V	RP11-178C3.1_ENST00000591035.1_Intron|RP11-178C3.2_ENST00000586209.1_lincRNA|RNFT1_ENST00000442346.2_5'UTR	NM_016125.3	NP_057209.3	Q5M7Z0	RNFT1_HUMAN	ring finger protein, transmembrane 1	37						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			large_intestine(2)|lung(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	9	all_cancers(5;1.58e-13)|Breast(5;2.91e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;7.95e-12)|all cancers(12;1.34e-10)			GGCTTGCATGGCCCTTAAATA	0.443																																																	0													83.0	77.0	79.0					17																	58040592		2203	4300	6503	SO:0001583	missense	0			BC006971	CCDS11622.2	17q23.2	2013-01-09			ENSG00000189050	ENSG00000189050		"""RING-type (C3HC4) zinc fingers"""	30206	protein-coding gene	gene with protein product		615172				12477932	Standard	NM_016125		Approved	PTD016	uc002iya.3	Q5M7Z0	OTTHUMG00000148658	ENST00000305783.8:c.110C>T	17.37:g.58040592G>A	ENSP00000304670:p.Ala37Val		Q8N7D0|Q96IZ9|Q9Y686	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.A37V	ENST00000305783.8	37	c.110	CCDS11622.2	17	.	.	.	.	.	.	.	.	.	.	G	2.192	-0.385112	0.04966	.	.	ENSG00000189050	ENST00000305783	T	0.38887	1.11	5.23	0.86	0.19042	.	2.016500	0.05390	N	0.538880	T	0.16085	0.0387	N	0.00926	-1.1	0.80722	D	1	B;B;B	0.11235	0.003;0.004;0.0	B;B;B	0.11329	0.006;0.006;0.001	T	0.26224	-1.0109	10	0.12766	T	0.61	5.5431	8.8775	0.35354	0.374:0.0:0.626:0.0	.	37;37;37	B4DHL4;Q5M7Z0-2;Q5M7Z0	.;.;RNFT1_HUMAN	V	37	ENSP00000304670:A37V	ENSP00000304670:A37V	A	-	2	0	RNFT1	55395374	0.979000	0.34478	0.682000	0.30024	0.094000	0.18550	1.188000	0.32102	-0.093000	0.12396	0.585000	0.79938	GCC	RNFT1	-	NULL	ENSG00000189050		0.443	RNFT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNFT1	HGNC	protein_coding	OTTHUMT00000308958.1		0.00	65	0	G	NM_016125		58040592	-1			no_errors	ENST00000305783	ensembl	human	known	74_37	missense	5.71	66	4	SNP	0.799	A
RPTOR	57521	genome.wustl.edu	37	17	78765283	78765283	+	Silent	SNP	T	T	C			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr17:78765283T>C	ENST00000306801.3	+	7	1226	c.864T>C	c.(862-864)ccT>ccC	p.P288P	RPTOR_ENST00000570891.1_Silent_p.P288P|RPTOR_ENST00000537330.1_Silent_p.P103P|RPTOR_ENST00000544334.2_Silent_p.P288P|RPTOR_ENST00000575542.1_3'UTR	NM_020761.2	NP_065812.1	Q8N122	RPTOR_HUMAN	regulatory associated protein of MTOR, complex 1	288					cell cycle arrest (GO:0007050)|cell growth (GO:0016049)|cellular response to amino acid stimulus (GO:0071230)|cellular response to nutrient levels (GO:0031669)|insulin receptor signaling pathway (GO:0008286)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of TOR signaling (GO:0032008)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|regulation of cell size (GO:0008361)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|TORC1 complex (GO:0031931)	14-3-3 protein binding (GO:0071889)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(17)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(3)	44						GTCTGGTGCCTGGCGTCACAC	0.433																																																	0													197.0	182.0	187.0					17																	78765283		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS11773.1, CCDS54175.1	17q25.3	2013-01-10				ENSG00000141564		"""WD repeat domain containing"""	30287	protein-coding gene	gene with protein product	"""regulatory associated protein of mTOR"""	607130				10718198, 12150926	Standard	NM_001163034		Approved	KOG1, Mip1, KIAA1303, raptor	uc002jyt.1	Q8N122		ENST00000306801.3:c.864T>C	17.37:g.78765283T>C			B2RN36|C6KEF2|F5H7J5|Q8N4V9|Q8TB32|Q9P2P3	Silent	SNP	pfam_HEAT,pfam_WD40_repeat,superfamily_ARM-type_fold,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom,prints_Raptor	p.P288	ENST00000306801.3	37	c.864	CCDS11773.1	17																																																																																			RPTOR	-	NULL	ENSG00000141564		0.433	RPTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPTOR	HGNC	protein_coding	OTTHUMT00000438125.1	-	0.00	80	0	T	NM_020761		78765283	+1	tier1	-	no_errors	ENST00000306801	ensembl	human	known	74_37	silent	5.26	72	4	SNP	0.861	C
RTEL1	51750	genome.wustl.edu	37	20	62319727	62319727	+	Silent	SNP	G	G	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr20:62319727G>A	ENST00000360203.5	+	20	2035	c.1710G>A	c.(1708-1710)ctG>ctA	p.L570L	RTEL1_ENST00000370003.1_5'Flank|RTEL1-TNFRSF6B_ENST00000482936.1_Silent_p.L570L|RTEL1_ENST00000318100.4_Silent_p.L570L|RTEL1_ENST00000508582.2_Silent_p.L594L|RTEL1_ENST00000370018.3_Silent_p.L570L					regulator of telomere elongation helicase 1											NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_cancers(38;6.47e-12)|all_epithelial(29;3.75e-13)		Epithelial(9;1.25e-09)|all cancers(9;5.13e-09)|BRCA - Breast invasive adenocarcinoma(10;7.26e-05)|OV - Ovarian serous cystadenocarcinoma(5;0.00223)|Colorectal(105;0.107)			AGAAGAGCCTGGAGTTCTGGC	0.637																																																	0													62.0	48.0	52.0					20																	62319727		2203	4291	6494	SO:0001819	synonymous_variant	0			AB029011	CCDS13530.2, CCDS13531.1, CCDS13530.3, CCDS63331.1, CCDS74751.1	20q13.3	2012-06-27	2004-10-29	2004-10-29	ENSG00000258366	ENSG00000258366			15888	protein-coding gene	gene with protein product		608833	"""chromosome 20 open reading frame 41"""	C20orf41		10655513, 15210109	Standard	NM_016434		Approved	bK3184A7.3, NHL, DKFZP434C013, KIAA1088, RTEL	uc011abd.2	Q9NZ71	OTTHUMG00000032992	ENST00000360203.5:c.1710G>A	20.37:g.62319727G>A				Silent	SNP	pfam_DEAD_2,superfamily_P-loop_NTPase,smart_Helicase-like_DEXD_c2,smart_ATP-dep_Helicase_C,pfscan_Helic_SF1/SF2_ATP-bd_DinG/Rad3,tigrfam_DNA_helicase_DNA-repair_Rad3	p.L570	ENST00000360203.5	37	c.1710		20																																																																																			RTEL1	-	superfamily_P-loop_NTPase,smart_ATP-dep_Helicase_C,tigrfam_DNA_helicase_DNA-repair_Rad3	ENSG00000258366		0.637	RTEL1-011	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	RTEL1	HGNC	protein_coding	OTTHUMT00000289781.1	-	0.00	30	0	G	NM_032957		62319727	+1	tier1	-	no_errors	ENST00000318100	ensembl	human	known	74_37	silent	13.33	26	4	SNP	1.000	A
RUNX2	860	genome.wustl.edu	37	6	45390503	45390505	+	In_Frame_Del	DEL	GCG	GCG	-			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	GCG	GCG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr6:45390503_45390505delGCG	ENST00000371438.1	+	2	590_592	c.232_234delGCG	c.(232-234)gcgdel	p.A89del	RUNX2_ENST00000359524.5_In_Frame_Del_p.A75del|RP1-244F24.1_ENST00000606796.1_RNA|RUNX2_ENST00000371436.6_In_Frame_Del_p.A89del|RUNX2_ENST00000541979.1_In_Frame_Del_p.A157del|RUNX2_ENST00000576263.1_In_Frame_Del_p.A89del|RUNX2_ENST00000352853.5_In_Frame_Del_p.A157del|RUNX2_ENST00000371432.3_In_Frame_Del_p.A75del|RUNX2_ENST00000465038.2_In_Frame_Del_p.A89del	NM_001024630.3	NP_001019801.3	Q13950	RUNX2_HUMAN	runt-related transcription factor 2	89	Poly-Ala.				BMP signaling pathway (GO:0030509)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|chondrocyte development (GO:0002063)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic forelimb morphogenesis (GO:0035115)|endochondral ossification (GO:0001958)|gene expression (GO:0010467)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|osteoblast development (GO:0002076)|osteoblast differentiation (GO:0001649)|osteoblast fate commitment (GO:0002051)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|stem cell differentiation (GO:0048863)|T cell differentiation (GO:0030217)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(18)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						ggcggcggctgcggcggcggcgg	0.734																																																	0																																										SO:0001651	inframe_deletion	0			AF001450	CCDS43467.1, CCDS43468.1, CCDS43467.2, CCDS43468.2	6p21	2010-08-20			ENSG00000124813	ENSG00000124813			10472	protein-coding gene	gene with protein product		600211		CCD, CBFA1, CCD1		7835892	Standard	NM_001024630		Approved	AML3, PEBP2A1, PEBP2aA1	uc011dvx.2	Q13950	OTTHUMG00000014774	ENST00000371438.1:c.232_234delGCG	6.37:g.45390512_45390514delGCG	ENSP00000360493:p.Ala89del		O14614|O14615|O95181	In_Frame_Del	DEL	pfam_Runt_dom,pfam_RunxI_C_dom,superfamily_p53-like_TF_DNA-bd,pfscan_Runt_dom,prints_AML1_Runt	p.A149in_frame_del	ENST00000371438.1	37	c.436_438	CCDS43467.2	6																																																																																			RUNX2	-	NULL	ENSG00000124813		0.734	RUNX2-003	KNOWN	not_organism_supported|upstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	RUNX2	HGNC	protein_coding	OTTHUMT00000040755.2		0.00	42	0	GCG	NM_004348		45390505	+1	tier1		no_errors	ENST00000352853	ensembl	human	known	74_37	in_frame_del	10.00	27	3	DEL	0.990:1.000:1.000	-
SDK2	54549	genome.wustl.edu	37	17	71429905	71429905	+	Silent	SNP	C	C	A	rs142980422		TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr17:71429905C>A	ENST00000392650.3	-	10	1278	c.1278G>T	c.(1276-1278)tcG>tcT	p.S426S	SDK2_ENST00000388726.3_Silent_p.S426S	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	426	Ig-like C2-type 5.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)		p.S426S(1)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						GGGGCGCCCCCGAGGTCTCAC	0.567																																																	1	Substitution - coding silent(1)	kidney(1)											48.0	37.0	41.0					17																	71429905		2203	4300	6503	SO:0001819	synonymous_variant	0			AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.1278G>T	17.37:g.71429905C>A			A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Silent	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.S426	ENST00000392650.3	37	c.1278	CCDS45769.1	17	.	.	.	.	.	.	.	.	.	.	C	9.963	1.223358	0.22457	.	.	ENSG00000069188	ENST00000416616	.	.	.	4.8	0.197	0.15164	.	.	.	.	.	T	0.42200	0.1192	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.24693	-1.0153	4	.	.	.	.	1.916	0.03297	0.1267:0.4259:0.1243:0.3231	.	.	.	.	W	331	.	.	G	-	1	0	SDK2	68941500	0.001000	0.12720	0.999000	0.59377	0.931000	0.56810	-1.934000	0.01552	0.181000	0.19994	-0.379000	0.06801	GGG	SDK2	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000069188		0.567	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SDK2	HGNC	protein_coding	OTTHUMT00000327598.2		0.00	46	0	C	NM_019064		71429905	-1			no_errors	ENST00000392650	ensembl	human	known	74_37	silent	8.33	32	3	SNP	0.982	A
SECISBP2	79048	genome.wustl.edu	37	9	91940488	91940488	+	Missense_Mutation	SNP	A	A	G			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr9:91940488A>G	ENST00000375807.3	+	3	400	c.329A>G	c.(328-330)cAg>cGg	p.Q110R	SECISBP2_ENST00000339901.4_Missense_Mutation_p.Q37R|SECISBP2_ENST00000470305.1_3'UTR|SECISBP2_ENST00000534113.2_Missense_Mutation_p.Q42R	NM_001282688.1|NM_001282690.1|NM_024077.3	NP_001269617.1|NP_001269619.1|NP_076982.3	Q96T21	SEBP2_HUMAN	SECIS binding protein 2	110					translation (GO:0006412)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|ribonucleoprotein complex binding (GO:0043021)|selenocysteine insertion sequence binding (GO:0035368)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(3)|skin(2)	32						CCTGGCTCCCAGTATCTTTAT	0.423																																																	0													214.0	204.0	207.0					9																	91940488		2203	4300	6503	SO:0001583	missense	0			AF380995	CCDS6683.1, CCDS65076.1, CCDS65077.1	9q22	2008-02-05			ENSG00000187742	ENSG00000187742			30972	protein-coding gene	gene with protein product		607693				11230166	Standard	XM_005252193		Approved		uc004aqj.1	Q96T21	OTTHUMG00000020182	ENST00000375807.3:c.329A>G	9.37:g.91940488A>G	ENSP00000364965:p.Gln110Arg		F8W892|Q5HYY1|Q8IYC0|Q9H0A1	Missense_Mutation	SNP	pfam_Ribosomal_L7Ae/L30e/S12e/Gad45	p.Q110R	ENST00000375807.3	37	c.329	CCDS6683.1	9	.	.	.	.	.	.	.	.	.	.	A	4.240	0.043535	0.08196	.	.	ENSG00000187742	ENST00000375807;ENST00000395669;ENST00000339901;ENST00000534113	T;T;T	0.75938	-0.93;-0.98;-0.92	4.17	-1.18	0.09617	.	1.082170	0.07022	N	0.827008	T	0.58452	0.2123	L	0.29908	0.895	0.09310	N	1	B;B;B;B;B	0.10296	0.003;0.0;0.001;0.001;0.0	B;B;B;B;B	0.09377	0.004;0.001;0.003;0.002;0.002	T	0.39440	-0.9614	10	0.36615	T	0.2	-0.2068	4.6155	0.12424	0.4512:0.2997:0.2491:0.0	.	130;110;37;110;42	Q59H19;B4DZC7;Q96T21-2;Q96T21;F8W892	.;.;.;SEBP2_HUMAN;.	R	110;130;37;42	ENSP00000364965:Q110R;ENSP00000364959:Q37R;ENSP00000436650:Q42R	ENSP00000364959:Q37R	Q	+	2	0	SECISBP2	91130308	0.001000	0.12720	0.007000	0.13788	0.083000	0.17756	0.415000	0.21181	-0.300000	0.08895	0.379000	0.24179	CAG	SECISBP2	-	NULL	ENSG00000187742		0.423	SECISBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SECISBP2	HGNC	protein_coding	OTTHUMT00000052990.3		0.00	57	0	A	NM_024077		91940488	+1			no_errors	ENST00000375807	ensembl	human	known	74_37	missense	5.13	37	2	SNP	0.123	G
SEL1L3	23231	genome.wustl.edu	37	4	25759360	25759360	+	Missense_Mutation	SNP	G	G	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr4:25759360G>T	ENST00000399878.3	-	22	3258	c.3136C>A	c.(3136-3138)Ctt>Att	p.L1046I	SEL1L3_ENST00000502949.1_Missense_Mutation_p.L893I|SEL1L3_ENST00000264868.5_Missense_Mutation_p.L1011I	NM_015187.3	NP_056002.2	Q68CR1	SE1L3_HUMAN	sel-1 suppressor of lin-12-like 3 (C. elegans)	1046						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)|urinary_tract(2)	14						TGCAGGTAAAGCCAGGCCAAG	0.607																																																	0													52.0	66.0	61.0					4																	25759360		2090	4210	6300	SO:0001583	missense	0			BC009945	CCDS47037.1, CCDS75113.1	4p15.2	2009-09-24			ENSG00000091490	ENSG00000091490			29108	protein-coding gene	gene with protein product	"""KIAA0746 protein"""					9872452	Standard	XM_005248143		Approved	KIAA0746	uc003gru.4	Q68CR1	OTTHUMG00000160331	ENST00000399878.3:c.3136C>A	4.37:g.25759360G>T	ENSP00000382767:p.Leu1046Ile		A0PJH6|A8K0X2|O94847|Q6P999|Q96G59	Missense_Mutation	SNP	pfam_Sel1-like,superfamily_ConA-like_lec_gl_sf,smart_Sel1-like	p.L1046I	ENST00000399878.3	37	c.3136	CCDS47037.1	4	.	.	.	.	.	.	.	.	.	.	G	13.56	2.273704	0.40194	.	.	ENSG00000091490	ENST00000399878;ENST00000264868;ENST00000502949	T;T;T	0.16324	2.56;2.57;2.35	5.61	3.49	0.39957	.	0.353722	0.30611	N	0.009257	T	0.10208	0.0250	L	0.28274	0.84	0.30965	N	0.723244	B;B	0.25772	0.018;0.134	B;B	0.17433	0.008;0.018	T	0.09840	-1.0656	10	0.26408	T	0.33	-13.9398	7.9677	0.30109	0.1096:0.0:0.7392:0.1513	.	453;1046	B4DTH5;Q68CR1	.;SE1L3_HUMAN	I	1046;1011;893	ENSP00000382767:L1046I;ENSP00000264868:L1011I;ENSP00000425438:L893I	ENSP00000264868:L1011I	L	-	1	0	SEL1L3	25368458	1.000000	0.71417	0.993000	0.49108	0.941000	0.58515	1.106000	0.31098	1.482000	0.48325	0.655000	0.94253	CTT	SEL1L3	-	NULL	ENSG00000091490		0.607	SEL1L3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SEL1L3	HGNC	protein_coding	OTTHUMT00000360261.1	-	0.00	61	0	G	NM_015187		25759360	-1	tier1	-	no_errors	ENST00000399878	ensembl	human	known	74_37	missense	14.29	24	4	SNP	0.998	T
SEMA5A	9037	genome.wustl.edu	37	5	9063121	9063121	+	Missense_Mutation	SNP	T	T	G			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr5:9063121T>G	ENST00000382496.5	-	18	3061	c.2396A>C	c.(2395-2397)gAc>gCc	p.D799A		NM_003966.2	NP_003957.2	Q13591	SEM5A_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A	799	TSP type-1 5. {ECO:0000255|PROSITE- ProRule:PRU00210}.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|diencephalon development (GO:0021536)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|nervous system development (GO:0007399)|patterning of blood vessels (GO:0001569)|positive chemotaxis (GO:0050918)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of angiogenesis (GO:0045766)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein kinase B signaling (GO:0051897)|signal clustering (GO:1990256)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|chondroitin sulfate proteoglycan binding (GO:0035373)|heparan sulfate proteoglycan binding (GO:0043395)|semaphorin receptor binding (GO:0030215)|syndecan binding (GO:0045545)			biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(13)|lung(40)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	81						CCTGCTGCAGTCACGGCTGCA	0.597																																																	0													85.0	68.0	74.0					5																	9063121		2203	4300	6503	SO:0001583	missense	0			U52840	CCDS3875.1	5p15.2	2008-05-15			ENSG00000112902	ENSG00000112902		"""Semaphorins"""	10736	protein-coding gene	gene with protein product		609297		SEMAF		8817451, 9464278	Standard	NM_003966		Approved	semF	uc003jek.2	Q13591	OTTHUMG00000090501	ENST00000382496.5:c.2396A>C	5.37:g.9063121T>G	ENSP00000371936:p.Asp799Ala		D3DTC6|O60408|Q1RLL9	Missense_Mutation	SNP	pfam_Semap_dom,pfam_Thrombospondin_1_rpt,superfamily_Semap_dom,superfamily_Thrombospondin_1_rpt,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_Thrombospondin_1_rpt,pfscan_Semap_dom,pfscan_Thrombospondin_1_rpt	p.D799A	ENST00000382496.5	37	c.2396	CCDS3875.1	5	.	.	.	.	.	.	.	.	.	.	T	19.36	3.811799	0.70797	.	.	ENSG00000112902	ENST00000382496	T	0.51574	0.7	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.39682	0.1087	N	0.25201	0.72	0.58432	D	0.999995	P	0.40282	0.711	B	0.42214	0.38	T	0.39333	-0.9619	10	0.62326	D	0.03	.	13.8294	0.63370	0.0:0.0:0.0:1.0	.	799	Q13591	SEM5A_HUMAN	A	799	ENSP00000371936:D799A	ENSP00000371936:D799A	D	-	2	0	SEMA5A	9116121	1.000000	0.71417	0.997000	0.53966	0.994000	0.84299	6.051000	0.71072	2.149000	0.67028	0.533000	0.62120	GAC	SEMA5A	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000112902		0.597	SEMA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA5A	HGNC	protein_coding	OTTHUMT00000206989.2	-	0.00	70	0	T			9063121	-1	tier1	-	no_errors	ENST00000382496	ensembl	human	known	74_37	missense	15.79	48	9	SNP	1.000	G
SEMA5B	54437	genome.wustl.edu	37	3	122646663	122646663	+	Missense_Mutation	SNP	G	G	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr3:122646663G>T	ENST00000357599.3	-	8	1210	c.824C>A	c.(823-825)gCc>gAc	p.A275D	SEMA5B_ENST00000195173.4_Missense_Mutation_p.A275D|SEMA5B_ENST00000451055.2_Missense_Mutation_p.A329D|AC078794.1_ENST00000408284.1_RNA	NM_001031702.3|NM_001256348.1	NP_001026872.2|NP_001243277.1	Q9P283	SEM5B_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B	275	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(13)|lung(26)|ovary(2)|pancreas(3)|skin(2)|upper_aerodigestive_tract(3)	55				GBM - Glioblastoma multiforme(114;0.0367)		GTTATATTGGGCAGTGCGAAG	0.632																																																	0													51.0	53.0	53.0					3																	122646663		2203	4300	6503	SO:0001583	missense	0			AB040878	CCDS35491.1, CCDS58848.1, CCDS74995.1	3q21.1	2008-07-18			ENSG00000082684	ENSG00000082684		"""Semaphorins"""	10737	protein-coding gene	gene with protein product		609298		SEMAG		8817451	Standard	NM_001256346		Approved	SemG, KIAA1445, FLJ10372	uc031sbm.1	Q9P283	OTTHUMG00000140392	ENST00000357599.3:c.824C>A	3.37:g.122646663G>T	ENSP00000350215:p.Ala275Asp		A8K5U2|B7Z393|F8W9U8|Q6DD89|Q6UY12|Q9NW17	Missense_Mutation	SNP	pfam_Semap_dom,pfam_Thrombospondin_1_rpt,superfamily_Semap_dom,superfamily_Thrombospondin_1_rpt,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_Thrombospondin_1_rpt,pfscan_Semap_dom,pfscan_Thrombospondin_1_rpt	p.A329D	ENST00000357599.3	37	c.986	CCDS35491.1	3	.	.	.	.	.	.	.	.	.	.	G	28.4	4.918361	0.92249	.	.	ENSG00000082684	ENST00000357599;ENST00000195173;ENST00000418793;ENST00000451055;ENST00000393583	T;T;T;T	0.10192	2.9;2.9;2.9;2.9	5.53	5.53	0.82687	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	T	0.17023	0.0409	N	0.17674	0.51	0.80722	D	1	P;P;P	0.51240	0.929;0.943;0.943	P;P;P	0.57548	0.729;0.823;0.823	T	0.03296	-1.1051	10	0.30078	T	0.28	.	18.6325	0.91364	0.0:0.0:1.0:0.0	.	217;275;275	D3YTI7;B5ME80;Q9P283	.;.;SEM5B_HUMAN	D	275;275;217;329;275	ENSP00000350215:A275D;ENSP00000195173:A275D;ENSP00000389588:A329D;ENSP00000377208:A275D	ENSP00000195173:A275D	A	-	2	0	SEMA5B	124129353	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.859000	0.86982	2.882000	0.98803	0.655000	0.94253	GCC	SEMA5B	-	pfam_Semap_dom,superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom	ENSG00000082684		0.632	SEMA5B-001	KNOWN	basic|CCDS	protein_coding	SEMA5B	HGNC	protein_coding	OTTHUMT00000277165.1	-	0.00	68	0	G	NM_001031702		122646663	-1	tier1	-	no_errors	ENST00000451055	ensembl	human	known	74_37	missense	5.33	71	4	SNP	1.000	T
SETD1B	23067	genome.wustl.edu	37	12	122248293	122248294	+	Frame_Shift_Ins	INS	-	-	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr12:122248293_122248294insT	ENST00000604567.1	+	6	1510_1511	c.1442_1443insT	c.(1441-1446)ggcacgfs	p.T482fs	SETD1B_ENST00000267197.5_Frame_Shift_Ins_p.T482fs|SETD1B_ENST00000542440.1_Frame_Shift_Ins_p.T482fs			Q9UPS6	SET1B_HUMAN	SET domain containing 1B	482	Pro-rich.				histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone-lysine N-methyltransferase activity (GO:0018024)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|endometrium(6)|kidney(2)|prostate(2)	11						GACAGCCCTGGCACGCCCACGC	0.708																																																	0																																										SO:0001589	frameshift_variant	0			AB028999	CCDS53838.1	12q24.31	2013-02-12			ENSG00000139718	ENSG00000139718		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29187	protein-coding gene	gene with protein product		611055				10470851, 17355966	Standard	NM_015048		Approved	KIAA1076, Set1B, KMT2G	uc001ubi.3	Q9UPS6	OTTHUMG00000169080	Exception_encountered	12.37:g.122248293_122248294insT	ENSP00000474253:p.Thr482fs		F6MFW1	Frame_Shift_Ins	INS	pfam_COMPASS_Set1_N-SET,pfam_SET_dom,pfam_RRM_dom,smart_RRM_dom,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_RRM_dom	p.T482fs	ENST00000604567.1	37	c.1442_1443		12																																																																																			SETD1B	-	NULL	ENSG00000139718		0.708	SETD1B-002	PUTATIVE	non_canonical_U12|basic|appris_candidate_longest	protein_coding	SETD1B	HGNC	protein_coding	OTTHUMT00000468264.1		0.00	46	0	-	XM_037523		122248294	+1	tier1		no_errors	ENST00000267197	ensembl	human	known	74_37	frame_shift_ins	12.50	14	2	INS	1.000:0.999	T
SGK1	6446	genome.wustl.edu	37	6	134491990	134491990	+	Missense_Mutation	SNP	T	T	C			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr6:134491990T>C	ENST00000237305.7	-	11	1190	c.1102A>G	c.(1102-1104)Att>Gtt	p.I368V	SGK1_ENST00000528577.1_Missense_Mutation_p.I396V|SGK1_ENST00000489458.2_5'Flank|SGK1_ENST00000367858.5_Missense_Mutation_p.I463V|SGK1_ENST00000367857.5_Missense_Mutation_p.I358V|SGK1_ENST00000413996.3_Missense_Mutation_p.I382V|SGK1_ENST00000475719.2_Missense_Mutation_p.I324V	NM_005627.3	NP_005618.2	O00141	SGK1_HUMAN	serum/glucocorticoid regulated kinase 1	368	AGC-kinase C-terminal.				apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|ion transmembrane transport (GO:0034220)|long-term memory (GO:0007616)|positive regulation of transporter activity (GO:0032411)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of catalytic activity (GO:0050790)|regulation of cell growth (GO:0001558)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of gastric acid secretion (GO:0060453)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|renal sodium ion absorption (GO:0070294)|response to stress (GO:0006950)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chloride channel regulator activity (GO:0017081)|potassium channel regulator activity (GO:0015459)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|sodium channel regulator activity (GO:0017080)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(21)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|skin(4)|stomach(1)	46	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00317)|GBM - Glioblastoma multiforme(68;0.00847)		GGGGGAGTAATCTTCTTATTA	0.368																																																	0													115.0	127.0	123.0					6																	134491990		2203	4300	6503	SO:0001583	missense	0			AJ000512	CCDS5170.1, CCDS47476.1, CCDS47477.1, CCDS47478.1	6q23	2008-02-05	2007-12-05	2007-12-05	ENSG00000118515	ENSG00000118515			10810	protein-coding gene	gene with protein product		602958	"""serum/glucocorticoid regulated kinase"""	SGK		9114008, 9722955	Standard	NM_005627		Approved		uc003qeo.4	O00141	OTTHUMG00000015613	ENST00000237305.7:c.1102A>G	6.37:g.134491990T>C	ENSP00000237305:p.Ile368Val		B7UUP7|B7UUP8|B7UUP9|B7Z5B2|E1P583|Q5TCN2|Q5TCN3|Q5TCN4|Q5VY65|Q9UN56	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_Phox,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Prot_kinase_dom	p.I463V	ENST00000237305.7	37	c.1387	CCDS5170.1	6	.	.	.	.	.	.	.	.	.	.	T	15.18	2.758287	0.49468	.	.	ENSG00000118515	ENST00000367858;ENST00000413996;ENST00000237305;ENST00000367857;ENST00000528577;ENST00000475719	T;T;T;T;T;T	0.45276	0.9;0.9;0.9;0.9;0.9;0.9	6.02	6.02	0.97574	AGC-kinase, C-terminal (2);Protein kinase-like domain (1);	0.044896	0.85682	D	0.000000	T	0.29126	0.0724	L	0.41027	1.25	0.80722	D	1	B;B;B;B;B;B	0.29646	0.07;0.005;0.253;0.02;0.036;0.024	B;B;B;B;B;B	0.36092	0.089;0.031;0.217;0.056;0.071;0.025	T	0.15780	-1.0425	10	0.52906	T	0.07	.	16.5446	0.84426	0.0:0.0:0.0:1.0	.	396;382;324;358;463;368	O00141-5;O00141-3;E9PR89;O00141-4;O00141-2;O00141	.;.;.;.;.;SGK1_HUMAN	V	463;382;368;358;396;324	ENSP00000356832:I463V;ENSP00000396242:I382V;ENSP00000237305:I368V;ENSP00000356831:I358V;ENSP00000434450:I396V;ENSP00000434302:I324V	ENSP00000237305:I368V	I	-	1	0	SGK1	134533683	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.305000	0.51873	2.311000	0.77944	0.533000	0.62120	ATT	SGK1	-	superfamily_Kinase-like_dom,smart_AGC-kinase_C	ENSG00000118515		0.368	SGK1-009	KNOWN	basic|appris_principal|CCDS	protein_coding	SGK1	HGNC	protein_coding	OTTHUMT00000042312.2	-	0.00	53	0	T			134491990	-1	tier1	-	no_errors	ENST00000367858	ensembl	human	known	74_37	missense	31.67	41	19	SNP	1.000	C
SH2D5	400745	genome.wustl.edu	37	1	21050738	21050738	+	Missense_Mutation	SNP	G	G	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr1:21050738G>T	ENST00000444387.2	-	7	1034	c.637C>A	c.(637-639)Ctg>Atg	p.L213M	SH2D5_ENST00000375031.1_Missense_Mutation_p.L129M|SH2D5_ENST00000460804.1_5'UTR	NM_001103161.1	NP_001096631.1	Q6ZV89	SH2D5_HUMAN	SH2 domain containing 5	213										lung(4)|prostate(1)|upper_aerodigestive_tract(1)	6		Colorectal(325;3.46e-05)|all_lung(284;5.32e-05)|Lung NSC(340;5.51e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|COAD - Colon adenocarcinoma(152;1.17e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000142)|GBM - Glioblastoma multiforme(114;0.000465)|Kidney(64;0.000476)|STAD - Stomach adenocarcinoma(196;0.00303)|KIRC - Kidney renal clear cell carcinoma(64;0.00634)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		GACTCTGGCAGCTCCTTCTAG	0.652																																																	0													41.0	48.0	46.0					1																	21050738		2030	4187	6217	SO:0001583	missense	0			AK124869, AK123236	CCDS41280.1, CCDS44080.1	1p36.12	2008-02-05			ENSG00000189410	ENSG00000189410			28819	protein-coding gene	gene with protein product							Standard	NM_001103161		Approved		uc009vpy.1	Q6ZV89	OTTHUMG00000002620	ENST00000444387.2:c.637C>A	1.37:g.21050738G>T	ENSP00000406026:p.Leu213Met		B7Z3W3|Q5SSJ2	Missense_Mutation	SNP	pfam_PTB/PI_dom,smart_PTB/PI_dom,pfscan_PTB/PI_dom,pfscan_SH2	p.L213M	ENST00000444387.2	37	c.637	CCDS44080.1	1	.	.	.	.	.	.	.	.	.	.	G	9.281	1.048029	0.19827	.	.	ENSG00000189410	ENST00000375031;ENST00000444387	.	.	.	4.82	3.83	0.44106	SH2 motif (3);	0.657660	0.14099	N	0.341531	T	0.29190	0.0726	N	0.22421	0.69	0.24853	N	0.992398	B	0.19073	0.033	B	0.15870	0.014	T	0.07927	-1.0747	9	0.33940	T	0.23	.	12.0065	0.53261	0.0:0.0:0.8163:0.1837	.	213	Q6ZV89	SH2D5_HUMAN	M	129;213	.	ENSP00000364171:L129M	L	-	1	2	SH2D5	20923325	0.695000	0.27747	0.989000	0.46669	0.371000	0.29859	1.367000	0.34204	2.522000	0.85027	0.655000	0.94253	CTG	SH2D5	-	NULL	ENSG00000189410		0.652	SH2D5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SH2D5	HGNC	protein_coding	OTTHUMT00000007455.2	-	0.00	19	0	G	XM_375698		21050738	-1	tier1	-	no_errors	ENST00000444387	ensembl	human	known	74_37	missense	42.86	4	3	SNP	0.899	T
SH3RF2	153769	genome.wustl.edu	37	5	145442255	145442255	+	Silent	SNP	C	C	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr5:145442255C>A	ENST00000511217.1	+	9	2233	c.2181C>A	c.(2179-2181)ccC>ccA	p.P727P	SH3RF2_ENST00000511705.1_3'UTR|SH3RF2_ENST00000359120.4_Silent_p.P727P			Q8TEC5	SH3R2_HUMAN	SH3 domain containing ring finger 2	727					negative regulation of phosphatase activity (GO:0010923)|protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|phosphatase binding (GO:0019902)|protein phosphatase 1 binding (GO:0008157)|protein phosphatase inhibitor activity (GO:0004864)|zinc ion binding (GO:0008270)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(9)|ovary(1)|prostate(1)|skin(2)|stomach(1)	22			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CCGTGTTTCCCAGCAAATGAA	0.557																																																	0													48.0	47.0	47.0					5																	145442255		2203	4300	6503	SO:0001819	synonymous_variant	0			AL833297	CCDS4280.1	5q32	2013-01-09	2011-11-04	2011-11-04	ENSG00000156463	ENSG00000156463		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	26299	protein-coding gene	gene with protein product	"""heart protein phosphatase 1-binding protein"", ""POSH-eliminating RING protein"""	613377	"""protein phosphatase 1, regulatory subunit 39"""	PPP1R39		22128169	Standard	NM_152550		Approved	FLJ23654, RNF158, Hepp1, POSHER	uc003lnt.3	Q8TEC5	OTTHUMG00000129685	ENST00000511217.1:c.2181C>A	5.37:g.145442255C>A			A8K961|Q08AM9|Q6GMR9|Q8N5S8|Q96LP8	Silent	SNP	pfam_SH3_2,pfam_SH3_domain,pfam_Znf_C3HC4_RING-type,superfamily_SH3_domain,smart_Znf_RING,smart_SH3_domain,pfscan_SH3_domain,pfscan_Znf_RING,prints_SH3_domain	p.P727	ENST00000511217.1	37	c.2181	CCDS4280.1	5																																																																																			SH3RF2	-	NULL	ENSG00000156463		0.557	SH3RF2-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	SH3RF2	HGNC	protein_coding	OTTHUMT00000372804.1	-	0.00	59	0	C	NM_152550		145442255	+1	tier1	-	no_errors	ENST00000359120	ensembl	human	known	74_37	silent	6.90	54	4	SNP	1.000	A
SIN3B	23309	genome.wustl.edu	37	19	16973357	16973357	+	Missense_Mutation	SNP	C	C	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr19:16973357C>T	ENST00000248054.5	+	9	1274	c.1253C>T	c.(1252-1254)gCc>gTc	p.A418V	SIN3B_ENST00000379803.1_Missense_Mutation_p.A418V|SIN3B_ENST00000595541.1_5'Flank					SIN3 transcription regulator family member B											endometrium(4)|kidney(2)|large_intestine(8)|lung(8)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	26						GGGAGGACAGCCATCTGCAAG	0.567																																																	0													45.0	36.0	39.0					19																	16973357		2203	4300	6503	SO:0001583	missense	0			AB014600	CCDS32946.1, CCDS74308.1	19p13.12	2013-08-21	2013-08-21						19354	protein-coding gene	gene with protein product		607777	"""SIN3 homolog B, transcription regulator (yeast)"", ""SIN3 transcription regulator homolog B (yeast)"""			9734811	Standard	XM_005259832		Approved	KIAA0700	uc002ney.2	O75182		ENST00000248054.5:c.1253C>T	19.37:g.16973357C>T	ENSP00000248054:p.Ala418Val			Missense_Mutation	SNP	pfam_PAH,pfam_HDAC_interact,superfamily_PAH,smart_HDAC_interact	p.A418V	ENST00000248054.5	37	c.1253		19	.	.	.	.	.	.	.	.	.	.	C	26.1	4.703443	0.88924	.	.	ENSG00000127511	ENST00000379803;ENST00000248054	T;T	0.47869	0.83;0.85	4.73	4.73	0.59995	Histone deacetylase interacting (2);	0.000000	0.85682	D	0.000000	T	0.58293	0.2112	L	0.39898	1.24	0.80722	D	1	D;P	0.54047	0.964;0.885	P;P	0.60789	0.879;0.688	T	0.60255	-0.7299	10	0.51188	T	0.08	-28.9674	17.6866	0.88257	0.0:1.0:0.0:0.0	.	418;418	O75182-2;O75182	.;SIN3B_HUMAN	V	418	ENSP00000369131:A418V;ENSP00000248054:A418V	ENSP00000248054:A418V	A	+	2	0	SIN3B	16834357	1.000000	0.71417	0.983000	0.44433	0.947000	0.59692	7.621000	0.83083	2.179000	0.69175	0.561000	0.74099	GCC	SIN3B	-	pfam_HDAC_interact,smart_HDAC_interact	ENSG00000127511		0.567	SIN3B-001	KNOWN	basic|appris_principal	protein_coding	SIN3B	HGNC	protein_coding	OTTHUMT00000462846.1	-	0.00	49	0	C	NM_015260		16973357	+1	tier1	-	no_errors	ENST00000379803	ensembl	human	known	74_37	missense	11.76	30	4	SNP	1.000	T
SLC25A2	83884	genome.wustl.edu	37	5	140683267	140683267	+	Missense_Mutation	SNP	C	C	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr5:140683267C>A	ENST00000239451.4	-	1	345	c.166G>T	c.(166-168)Gcc>Tcc	p.A56S		NM_031947.2	NP_114153.1	Q9BXI2	ORNT2_HUMAN	solute carrier family 25 (mitochondrial carrier; ornithine transporter) member 2	56					cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)|urea cycle (GO:0000050)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				breast(3)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	19		all_lung(500;0.000249)|Lung NSC(810;0.0011)|Ovarian(839;0.00556)|Breast(839;0.0173)|all_hematologic(541;0.152)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;0.00204)	L-Ornithine(DB00129)	CCCACTTGGGCGTATGTCTTC	0.572																																																	0													80.0	78.0	79.0					5																	140683267		2203	4300	6503	SO:0001583	missense	0			AF332005	CCDS4258.1	5q31.3	2013-05-22			ENSG00000120329	ENSG00000120329		"""Solute carriers"""	22921	protein-coding gene	gene with protein product		608157				11004451	Standard	NM_031947		Approved	ORNT2	uc003ljf.3	Q9BXI2	OTTHUMG00000129604	ENST00000239451.4:c.166G>T	5.37:g.140683267C>A	ENSP00000239451:p.Ala56Ser		Q496C1|Q6XUI0|Q8NFZ2	Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	p.A56S	ENST00000239451.4	37	c.166	CCDS4258.1	5	.	.	.	.	.	.	.	.	.	.	C	0.169	-1.073304	0.01918	.	.	ENSG00000120329	ENST00000239451	T	0.79141	-1.24	3.7	-7.4	0.01397	Mitochondrial carrier domain (2);	0.952792	0.08612	N	0.919890	T	0.53546	0.1803	N	0.25426	0.745	0.09310	N	1	B	0.09022	0.002	B	0.12156	0.007	T	0.38802	-0.9644	10	0.21540	T	0.41	-3.7959	1.6257	0.02722	0.181:0.2147:0.0893:0.515	.	56	Q9BXI2	ORNT2_HUMAN	S	56	ENSP00000239451:A56S	ENSP00000239451:A56S	A	-	1	0	SLC25A2	140663451	0.990000	0.36364	0.005000	0.12908	0.023000	0.10783	0.991000	0.29654	-1.248000	0.02503	-0.475000	0.04921	GCC	SLC25A2	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	ENSG00000120329		0.572	SLC25A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A2	HGNC	protein_coding	OTTHUMT00000251799.2	-	0.00	61	0	C	NM_031947		140683267	-1	tier1	-	no_errors	ENST00000239451	ensembl	human	known	74_37	missense	24.39	31	10	SNP	0.007	A
SLC25A5	292	genome.wustl.edu	37	X	118604452	118604452	+	Missense_Mutation	SNP	A	A	G			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chrX:118604452A>G	ENST00000317881.8	+	3	831	c.715A>G	c.(715-717)Atg>Gtg	p.M239V	SLC25A5_ENST00000460013.1_3'UTR|SLC25A5-AS1_ENST00000446986.1_RNA	NM_001152.4	NP_001143.2	P05141	ADT2_HUMAN	solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 5	239					adenine transport (GO:0015853)|chromosome segregation (GO:0007059)|energy reserve metabolic process (GO:0006112)|negative regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901029)|positive regulation of cell proliferation (GO:0008284)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|MMXD complex (GO:0071817)|nucleus (GO:0005634)	adenine transmembrane transporter activity (GO:0015207)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|stomach(2)	12					Clodronate(DB00720)	CCGCCGCATGATGATGCAGTC	0.498																																																	0													65.0	58.0	60.0					X																	118604452		2203	4300	6503	SO:0001583	missense	0			BC068199	CCDS14578.1	Xq24	2013-08-09			ENSG00000005022	ENSG00000005022		"""Solute carriers"""	10991	protein-coding gene	gene with protein product		300150		ANT2		2168878, 2829183	Standard	NM_001152		Approved	T2, 2F1, T3	uc004erh.4	P05141	OTTHUMG00000022715	ENST00000317881.8:c.715A>G	X.37:g.118604452A>G	ENSP00000360671:p.Met239Val		B2RCV1|O43350	Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier,prints_Aden_trnslctor	p.M239V	ENST00000317881.8	37	c.715	CCDS14578.1	X	.	.	.	.	.	.	.	.	.	.	a	16.02	3.003228	0.54254	.	.	ENSG00000005022	ENST00000317881	T	0.79033	-1.23	4.33	4.33	0.51752	Mitochondrial carrier domain (2);	0.039268	0.85682	D	0.000000	D	0.86900	0.6044	H	0.94808	3.585	0.80722	D	1	P	0.50819	0.939	P	0.50537	0.643	D	0.90237	0.4283	10	0.87932	D	0	.	12.4708	0.55785	1.0:0.0:0.0:0.0	.	239	P05141	ADT2_HUMAN	V	239	ENSP00000360671:M239V	ENSP00000360671:M239V	M	+	1	0	SLC25A5	118488480	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	7.133000	0.77259	1.692000	0.51112	0.427000	0.28365	ATG	SLC25A5	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier	ENSG00000005022		0.498	SLC25A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A5	HGNC	protein_coding	OTTHUMT00000058952.2	-	0.00	32	0	A	NM_001152		118604452	+1	tier1	-	no_errors	ENST00000317881	ensembl	human	known	74_37	missense	62.50	6	10	SNP	1.000	G
SLC2A9	56606	genome.wustl.edu	37	4	9982321	9982321	+	Silent	SNP	G	G	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr4:9982321G>T	ENST00000264784.3	-	5	629	c.576C>A	c.(574-576)atC>atA	p.I192I	SLC2A9_ENST00000506583.1_Silent_p.I163I|SLC2A9_ENST00000309065.3_Silent_p.I163I	NM_020041.2	NP_064425.2	Q9NRM0	GTR9_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 9	192					glucose transport (GO:0015758)|proton transport (GO:0015992)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	glucose transmembrane transporter activity (GO:0005355)|sugar:proton symporter activity (GO:0005351)	p.I163I(1)|p.I192I(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(12)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|stomach(1)	35					Losartan(DB00678)|Probenecid(DB01032)	CCTTGGGTGAGATCTCACTAA	0.587																																																	2	Substitution - coding silent(2)	large_intestine(2)											70.0	64.0	66.0					4																	9982321		2203	4300	6503	SO:0001819	synonymous_variant	0			AF210317	CCDS3406.1, CCDS3407.1	4p16.1	2013-05-22			ENSG00000109667	ENSG00000109667		"""Solute carriers"""	13446	protein-coding gene	gene with protein product	"""urate voltage-driven efflux transporter 1"""	606142				10860667, 17710649	Standard	NM_020041		Approved	Glut9, GLUTX, URATv1	uc003gmc.3	Q9NRM0	OTTHUMG00000044263	ENST00000264784.3:c.576C>A	4.37:g.9982321G>T			Q0VGC4|Q4W5D1|Q8WV30|Q96P00	Silent	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,prints_Sugar/inositol_transpt,tigrfam_Sugar/inositol_transpt	p.I192	ENST00000264784.3	37	c.576	CCDS3407.1	4																																																																																			SLC2A9	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Sugar/inositol_transpt	ENSG00000109667		0.587	SLC2A9-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC2A9	HGNC	protein_coding	OTTHUMT00000207055.1	-	0.00	19	0	G			9982321	-1	tier1	-	no_errors	ENST00000264784	ensembl	human	known	74_37	silent	33.33	12	6	SNP	1.000	T
SLC45A1	50651	genome.wustl.edu	37	1	8386005	8386005	+	Silent	SNP	C	C	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr1:8386005C>T	ENST00000471889.1	+	4	1003	c.618C>T	c.(616-618)agC>agT	p.S206S	SLC45A1_ENST00000377479.2_Silent_p.S240S|SLC45A1_ENST00000289877.8_Silent_p.S206S|Y_RNA_ENST00000516445.1_RNA			Q9Y2W3	S45A1_HUMAN	solute carrier family 45, member 1	206					carbohydrate transport (GO:0008643)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|liver(1)|lung(12)|ovary(2)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(2)	33	Ovarian(185;0.0661)|all_lung(157;0.127)	all_epithelial(116;1.22e-15)|all_lung(118;0.000147)|Lung NSC(185;0.000251)|Renal(390;0.000469)|Colorectal(325;0.00578)|Breast(348;0.00686)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.11)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;3.95e-66)|GBM - Glioblastoma multiforme(8;5.93e-33)|Colorectal(212;2.86e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|Kidney(185;5.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|KIRC - Kidney renal clear cell carcinoma(229;0.000979)|STAD - Stomach adenocarcinoma(132;0.00199)|READ - Rectum adenocarcinoma(331;0.0649)		TGGACTTTAGCGCCGACTCGG	0.652																																																	0													106.0	96.0	99.0					1																	8386005		2203	4300	6503	SO:0001819	synonymous_variant	0			AF118274	CCDS30577.1	1p36.23	2014-01-28	2005-10-04	2005-10-04	ENSG00000162426	ENSG00000162426		"""Solute carriers"""	17939	protein-coding gene	gene with protein product	"""H+/sugar symporter"""	605763	"""deleted in neuroblastoma 5"""	DNB5		10729226	Standard	XM_005263467		Approved		uc001apb.3	Q9Y2W3	OTTHUMG00000000503	ENST00000471889.1:c.618C>T	1.37:g.8386005C>T			Q5VY46|Q5VY49	Silent	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.S240	ENST00000471889.1	37	c.720	CCDS30577.1	1																																																																																			SLC45A1	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	ENSG00000162426		0.652	SLC45A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC45A1	HGNC	protein_coding	OTTHUMT00000001245.5	-	0.00	83	0	C			8386005	+1	tier1	-	no_errors	ENST00000377479	ensembl	human	known	74_37	silent	7.14	52	4	SNP	0.953	T
SLC5A4	6527	genome.wustl.edu	37	22	32621800	32621800	+	Missense_Mutation	SNP	G	G	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr22:32621800G>T	ENST00000266086.4	-	12	1302	c.1291C>A	c.(1291-1293)Ctt>Att	p.L431I	RP1-90G24.10_ENST00000434942.1_RNA	NM_014227.2	NP_055042.1	Q9NY91	SC5A4_HUMAN	solute carrier family 5 (glucose activated ion channel), member 4	431					carbohydrate transport (GO:0008643)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(15)|pancreas(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						GTTAATAGAAGAACAAATATC	0.348																																																	0													61.0	58.0	59.0					22																	32621800		2202	4300	6502	SO:0001583	missense	0			U41897	CCDS13903.1	22q12.3	2013-07-19	2013-07-19		ENSG00000100191	ENSG00000100191		"""Solute carriers"""	11039	protein-coding gene	gene with protein product			"""solute carrier family 5 (low affinity glucose cotransporter), member 4"""			9501190, 12354616	Standard	NM_014227		Approved	SAAT1, SGLT3, DJ90G24.4	uc003ami.3	Q9NY91	OTTHUMG00000150007	ENST00000266086.4:c.1291C>A	22.37:g.32621800G>T	ENSP00000266086:p.Leu431Ile		O15279	Missense_Mutation	SNP	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	p.L431I	ENST00000266086.4	37	c.1291	CCDS13903.1	22	.	.	.	.	.	.	.	.	.	.	G	3.641	-0.073606	0.07184	.	.	ENSG00000100191	ENST00000266086	D	0.86956	-2.19	5.05	-4.02	0.04034	.	0.593276	0.18141	N	0.150420	T	0.67163	0.2864	N	0.12961	0.28	0.09310	N	0.999995	B	0.06786	0.001	B	0.17979	0.02	T	0.53634	-0.8411	10	0.30854	T	0.27	.	1.2573	0.01994	0.2152:0.2352:0.3536:0.196	.	431	Q9NY91	SC5A4_HUMAN	I	431	ENSP00000266086:L431I	ENSP00000266086:L431I	L	-	1	0	SLC5A4	30951800	0.009000	0.17119	0.000000	0.03702	0.001000	0.01503	-0.649000	0.05384	-0.763000	0.04658	-0.225000	0.12378	CTT	SLC5A4	-	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	ENSG00000100191		0.348	SLC5A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A4	HGNC	protein_coding	OTTHUMT00000315724.1	-	0.00	126	0	G	NM_014227		32621800	-1	tier1	-	no_errors	ENST00000266086	ensembl	human	known	74_37	missense	5.97	63	4	SNP	0.004	T
SLC9A5	6553	genome.wustl.edu	37	16	67298363	67298363	+	Missense_Mutation	SNP	A	A	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr16:67298363A>T	ENST00000299798.11	+	13	2016	c.1951A>T	c.(1951-1953)Acc>Tcc	p.T651S	CTC-277H1.7_ENST00000573063.1_RNA	NM_004594.2	NP_004585.1	Q14940	SL9A5_HUMAN	solute carrier family 9, subfamily A (NHE5, cation proton antiporter 5), member 5	651					ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:proton antiporter activity (GO:0015385)			breast(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(3)|lung(9)|ovary(2)|pancreas(1)|prostate(1)	27		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00376)|Epithelial(162;0.0173)|all cancers(182;0.116)		CTTTAAGTCCACCAAGCACAA	0.592																																																	0													43.0	49.0	47.0					16																	67298363		2149	4259	6408	SO:0001583	missense	0				CCDS42178.1	16q22.1	2013-05-22	2012-03-22		ENSG00000135740	ENSG00000135740		"""Solute carriers"""	11078	protein-coding gene	gene with protein product		600477	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 5"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 5"""			7759094, 9933642	Standard	NM_004594		Approved	NHE5	uc002esm.3	Q14940	OTTHUMG00000172935	ENST00000299798.11:c.1951A>T	16.37:g.67298363A>T	ENSP00000299798:p.Thr651Ser		A5PKY7|Q9Y626	Missense_Mutation	SNP	pfam_Cation/H_exchanger,prints_Na/H_exchanger_3/5,prints_NaH_exchanger,tigrfam_NaH_exchanger	p.T651S	ENST00000299798.11	37	c.1951	CCDS42178.1	16	.	.	.	.	.	.	.	.	.	.	A	16.12	3.033863	0.54896	.	.	ENSG00000135740	ENST00000299798;ENST00000360183	T	0.56776	0.44	5.06	5.06	0.68205	.	0.069335	0.56097	D	0.000023	T	0.61527	0.2354	L	0.39898	1.24	0.48341	D	0.999632	D;B	0.71674	0.998;0.259	D;B	0.80764	0.994;0.039	T	0.56117	-0.8032	10	0.19590	T	0.45	.	14.2915	0.66281	1.0:0.0:0.0:0.0	.	164;651	F8WDV9;Q14940	.;SL9A5_HUMAN	S	651;164	ENSP00000299798:T651S	ENSP00000299798:T651S	T	+	1	0	SLC9A5	65855864	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	6.742000	0.74843	2.030000	0.59900	0.459000	0.35465	ACC	SLC9A5	-	NULL	ENSG00000135740		0.592	SLC9A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A5	HGNC	protein_coding	OTTHUMT00000421386.1	-	0.00	108	0	A			67298363	+1	tier1	-	no_errors	ENST00000299798	ensembl	human	known	74_37	missense	10.99	79	10	SNP	1.000	T
SMARCA2	6595	genome.wustl.edu	37	9	2084191	2084191	+	Frame_Shift_Del	DEL	G	G	-			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr9:2084191delG	ENST00000382203.1	+	17	2730	c.2521delG	c.(2521-2523)gcafs	p.A841fs	SMARCA2_ENST00000382194.1_Frame_Shift_Del_p.A841fs|SMARCA2_ENST00000357248.2_Frame_Shift_Del_p.A841fs|SMARCA2_ENST00000349721.2_Frame_Shift_Del_p.A841fs			P51531	SMCA2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2	841	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|chromatin remodeling (GO:0006338)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		GCACATTCTTGCAAAGGTATG	0.393																																																	0													46.0	46.0	46.0					9																	2084191		2203	4300	6503	SO:0001589	frameshift_variant	0			D26155	CCDS34977.1, CCDS34978.1, CCDS75807.1, CCDS75808.1	9p24.3	2008-11-11	2006-11-09		ENSG00000080503	ENSG00000080503			11098	protein-coding gene	gene with protein product		600014		SNF2L2		8012116	Standard	NM_003070		Approved	BAF190, hSNF2a, hBRM, Sth1p, SNF2LA, BRM, SNF2, SWI2	uc003zhc.3	P51531	OTTHUMG00000019445	ENST00000382203.1:c.2521delG	9.37:g.2084191delG	ENSP00000371638:p.Ala841fs		B1ALG3|B1ALG4|D3DRH4|D3DRH5	Frame_Shift_Del	DEL	pfam_SNF2_N,pfam_Bromodomain,pfam_BRK_domain,pfam_Helicase/SANT-assoc_DNA-bd,pfam_Helicase_C,pfam_Gln-Leu-Gln_QLQ,superfamily_P-loop_NTPase,superfamily_Bromodomain,superfamily_RNaseH-like_dom,smart_Gln-Leu-Gln_QLQ,smart_HAS_subgr,smart_BRK_domain,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Bromodomain,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Bromodomain,prints_Bromodomain	p.A841fs	ENST00000382203.1	37	c.2521	CCDS34977.1	9																																																																																			SMARCA2	-	pfam_SNF2_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000080503		0.393	SMARCA2-003	KNOWN	basic|CCDS	protein_coding	SMARCA2	HGNC	protein_coding	OTTHUMT00000051505.1		0.00	31	0	G	NM_003070		2084191	+1	tier1		no_errors	ENST00000349721	ensembl	human	known	74_37	frame_shift_del	28.57	5	2	DEL	1.000	-
SMEK2	57223	genome.wustl.edu	37	2	55826102	55826102	+	Missense_Mutation	SNP	T	T	C			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr2:55826102T>C	ENST00000345102.5	-	4	672	c.371A>G	c.(370-372)gAa>gGa	p.E124G	SMEK2_ENST00000407823.3_Missense_Mutation_p.E124G|SMEK2_ENST00000272313.5_Missense_Mutation_p.E124G	NM_001122964.1	NP_001116436	Q5MIZ7	P4R3B_HUMAN	SMEK homolog 2, suppressor of mek1 (Dictyostelium)	124					positive regulation of gluconeogenesis (GO:0045722)|protein dephosphorylation (GO:0006470)|regulation of lipid metabolic process (GO:0019216)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|protein phosphatase 4 complex (GO:0030289)				kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(1)	16			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			TTCAGGCATTTCTTCAAATCG	0.403																																																	0													158.0	167.0	164.0					2																	55826102		2203	4300	6503	SO:0001583	missense	0			AB037808	CCDS1855.1, CCDS46289.1, CCDS62913.1	2p16.1	2008-09-15			ENSG00000138041				29267	protein-coding gene	gene with protein product		610352				16085932, 18614045	Standard	NM_001122964		Approved	PSY2, FLFL2, KIAA1387, FLJ31474	uc002rzc.3	Q5MIZ7	OTTHUMG00000129336	ENST00000345102.5:c.371A>G	2.37:g.55826102T>C	ENSP00000339769:p.Glu124Gly		Q6P9B0|Q86XB8|Q9BQJ0|Q9BRK2|Q9H913|Q9P2G0	Missense_Mutation	SNP	pfam_DUF625,superfamily_ARM-type_fold	p.E124G	ENST00000345102.5	37	c.371	CCDS46289.1	2	.	.	.	.	.	.	.	.	.	.	T	17.39	3.376808	0.61735	.	.	ENSG00000138041	ENST00000272313;ENST00000407823;ENST00000345102	T;T;T	0.50277	0.75;0.75;0.75	5.85	5.85	0.93711	.	0.044471	0.85682	D	0.000000	T	0.35335	0.0928	N	0.17800	0.525	0.80722	D	1	P;P;B	0.37548	0.534;0.599;0.03	B;B;B	0.35607	0.205;0.206;0.036	T	0.18085	-1.0348	10	0.38643	T	0.18	-14.6038	16.2421	0.82418	0.0:0.0:0.0:1.0	.	124;124;124	Q5MIZ7-2;Q5MIZ7;Q5MIZ7-3	.;P4R3B_HUMAN;.	G	124	ENSP00000272313:E124G;ENSP00000385912:E124G;ENSP00000339769:E124G	ENSP00000272313:E124G	E	-	2	0	SMEK2	55679606	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.040000	0.89188	2.234000	0.73211	0.533000	0.62120	GAA	SMEK2	-	NULL	ENSG00000138041		0.403	SMEK2-002	NOVEL	basic|CCDS	protein_coding	SMEK2	HGNC	protein_coding	OTTHUMT00000251483.1	-	0.00	31	0	T	NM_020463		55826102	-1	tier1	-	no_errors	ENST00000272313	ensembl	human	known	74_37	missense	16.67	20	4	SNP	1.000	C
SNRNP70	6625	genome.wustl.edu	37	19	49593575	49593575	+	Missense_Mutation	SNP	C	C	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr19:49593575C>A	ENST00000598441.1	+	3	399	c.175C>A	c.(175-177)Cgt>Agt	p.R59S	SNRNP70_ENST00000221448.5_Missense_Mutation_p.R59S			P08621	RU17_HUMAN	small nuclear ribonucleoprotein 70kDa (U1)	59					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U1 snRNP (GO:0005685)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(3)|skin(2)	12						TCCTCCAACTCGTGCTGAAAC	0.532																																																	0													92.0	80.0	84.0					19																	49593575		2203	4300	6503	SO:0001583	missense	0				CCDS12756.1, CCDS74417.1	19q13.3	2013-02-12	2008-10-29	2008-10-29		ENSG00000104852		"""RNA binding motif (RRM) containing"""	11150	protein-coding gene	gene with protein product		180740	"""small nuclear ribonucleoprotein 70kDa (RNP antigen)"""	RNPU1Z, RPU1, SNRP70			Standard	XM_005259177		Approved	U1-70K, Snp1	uc021uxh.1	P08621		ENST00000598441.1:c.175C>A	19.37:g.49593575C>A	ENSP00000472998:p.Arg59Ser		B3KUA3|P78493|P78494|Q15364|Q15686|Q15687|Q15689|Q99377|Q9UE45|Q9UE46|Q9UE47|Q9UE48|Q9UFQ6	Missense_Mutation	SNP	pfam_U1snRNP70_N,pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.R59S	ENST00000598441.1	37	c.175	CCDS12756.1	19	.	.	.	.	.	.	.	.	.	.	C	19.49	3.838085	0.71373	.	.	ENSG00000104852	ENST00000221448;ENST00000401730	T	0.14640	2.49	5.49	4.44	0.53790	.	0.000000	0.85682	D	0.000000	T	0.28433	0.0703	M	0.79805	2.47	0.80722	D	1	P;D	0.54207	0.935;0.965	P;P	0.51550	0.673;0.618	T	0.06534	-1.0821	10	0.46703	T	0.11	-6.5725	12.4309	0.55573	0.3149:0.6851:0.0:0.0	.	59;59	P08621;P08621-2	RU17_HUMAN;.	S	59	ENSP00000221448:R59S	ENSP00000221448:R59S	R	+	1	0	SNRNP70	54285387	0.997000	0.39634	0.987000	0.45799	0.987000	0.75469	3.314000	0.51943	1.405000	0.46838	0.561000	0.74099	CGT	SNRNP70	-	pfam_U1snRNP70_N	ENSG00000104852		0.532	SNRNP70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNRNP70	HGNC	protein_coding	OTTHUMT00000466266.1	-	0.00	86	0	C	NM_003089		49593575	+1	tier1	-	no_errors	ENST00000598441	ensembl	human	known	74_37	missense	11.43	31	4	SNP	0.992	A
SNX5	27131	genome.wustl.edu	37	20	17922937	17922937	+	3'UTR	SNP	T	T	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr20:17922937T>A	ENST00000377768.3	-	0	1591				SNX5_ENST00000377759.4_3'UTR|SNX5_ENST00000483485.1_5'UTR	NM_152227.1	NP_689413.1	Q9Y5X3	SNX5_HUMAN	sorting nexin 5						intracellular protein transport (GO:0006886)|pinocytosis (GO:0006907)	cytoplasmic vesicle (GO:0031410)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|extrinsic component of endosome membrane (GO:0031313)|macropinocytic cup (GO:0070685)	phosphatidylinositol binding (GO:0035091)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)	11						GTGGTAATGATTTAAGTGCAA	0.299																																																	0													118.0	80.0	92.0					20																	17922937		692	1591	2283	SO:0001624	3_prime_UTR_variant	0			AF121855	CCDS13130.1	20p11	2008-05-22			ENSG00000089006	ENSG00000089006		"""Sorting nexins"""	14969	protein-coding gene	gene with protein product		605937				10600472, 17148574	Standard	NM_152227		Approved		uc002wqc.3	Q9Y5X3	OTTHUMG00000031953	ENST00000377768.3:c.*64A>T	20.37:g.17922937T>A			B7ZKN3|D3DW26|Q52LC4|Q7KZN0|Q9BWP0	RNA	SNP	-	NULL	ENST00000377768.3	37	NULL	CCDS13130.1	20																																																																																			SNX5	-	-	ENSG00000089006		0.299	SNX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX5	HGNC	protein_coding	OTTHUMT00000078137.4	-	0.00	65	0	T			17922937	-1	tier1	-	no_errors	ENST00000476648	ensembl	human	known	74_37	rna	32.00	17	8	SNP	0.992	A
SOX11	6664	genome.wustl.edu	37	2	5833282	5833284	+	In_Frame_Del	DEL	CGG	CGG	-			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	CGG	CGG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr2:5833282_5833284delCGG	ENST00000322002.3	+	1	484_486	c.429_431delCGG	c.(427-432)gccggc>gcc	p.G148del	AC108025.2_ENST00000453678.1_RNA|AC107057.2_ENST00000458264.1_RNA|AC108025.2_ENST00000420221.1_RNA	NM_003108.3	NP_003099.1	P35716	SOX11_HUMAN	SRY (sex determining region Y)-box 11	148	Poly-Gly.				cardiac ventricle formation (GO:0003211)|closure of optic fissure (GO:0061386)|cornea development in camera-type eye (GO:0061303)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic skeletal system morphogenesis (GO:0048704)|eyelid development in camera-type eye (GO:0061029)|glial cell development (GO:0021782)|glial cell proliferation (GO:0014009)|hard palate development (GO:0060022)|kidney development (GO:0001822)|lens morphogenesis in camera-type eye (GO:0002089)|limb bud formation (GO:0060174)|lung morphogenesis (GO:0060425)|negative regulation of cell death (GO:0060548)|negative regulation of gene expression (GO:0010629)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of lymphocyte proliferation (GO:0050672)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|neural crest cell development (GO:0014032)|neural tube formation (GO:0001841)|neuroepithelial cell differentiation (GO:0060563)|neuron differentiation (GO:0030182)|noradrenergic neuron differentiation (GO:0003357)|oligodendrocyte development (GO:0014003)|outflow tract morphogenesis (GO:0003151)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of hippo signaling (GO:0035332)|positive regulation of hormone secretion (GO:0046887)|positive regulation of lens epithelial cell proliferation (GO:2001111)|positive regulation of neurogenesis (GO:0050769)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of ossification (GO:0045778)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|signal transduction involved in cell cycle checkpoint (GO:0072395)|skeletal muscle cell differentiation (GO:0035914)|skeletal system development (GO:0001501)|soft palate development (GO:0060023)|somite development (GO:0061053)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|translation (GO:0006412)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enhancer sequence-specific DNA binding (GO:0001158)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|translation factor activity, nucleic acid binding (GO:0008135)			central_nervous_system(5)|cervix(1)|endometrium(1)|liver(1)|lung(4)|stomach(1)	13	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			OV - Ovarian serous cystadenocarcinoma(76;0.132)		Agagcgcggccggcggcggcggc	0.724																																																	0																																										SO:0001651	inframe_deletion	0				CCDS1654.1	2p25	2008-05-21			ENSG00000176887	ENSG00000176887		"""SRY (sex determining region Y)-boxes"""	11191	protein-coding gene	gene with protein product	"""SRY-related HMG-box gene 11"""	600898				8666406, 12637543	Standard	NM_003108		Approved		uc002qyj.3	P35716	OTTHUMG00000090333	ENST00000322002.3:c.429_431delCGG	2.37:g.5833291_5833293delCGG	ENSP00000322568:p.Gly148del		Q4ZFV8	In_Frame_Del	DEL	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pirsf_SOX-12/11/4a,pfscan_HMG_box_dom	p.G147in_frame_del	ENST00000322002.3	37	c.429_431	CCDS1654.1	2																																																																																			SOX11	-	pirsf_SOX-12/11/4a	ENSG00000176887		0.724	SOX11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOX11	HGNC	protein_coding	OTTHUMT00000206698.1		0.00	32	0	CGG	NM_003108		5833284	+1	tier1		no_errors	ENST00000322002	ensembl	human	known	74_37	in_frame_del	16.00	21	4	DEL	0.780:0.872:0.954	-
SPAG17	200162	genome.wustl.edu	37	1	118533511	118533511	+	Missense_Mutation	SNP	C	C	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr1:118533511C>T	ENST00000336338.5	-	38	5559	c.5494G>A	c.(5494-5496)Gaa>Aaa	p.E1832K		NM_206996.2	NP_996879.1	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	1832						cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)				NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(30)|liver(2)|lung(56)|ovary(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	123	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		TTTGTAGTTTCCTCCATTTTA	0.299																																																	0													92.0	94.0	93.0					1																	118533511		2201	4298	6499	SO:0001583	missense	0				CCDS899.1	1p12	2014-01-21			ENSG00000155761	ENSG00000155761			26620	protein-coding gene	gene with protein product							Standard	NM_206996		Approved	FLJ34497, PF6, RP4-776P7.2, CT143	uc001ehk.2	Q6Q759	OTTHUMG00000012198	ENST00000336338.5:c.5494G>A	1.37:g.118533511C>T	ENSP00000337804:p.Glu1832Lys		Q8NAZ1|Q9NT21	Missense_Mutation	SNP	NULL	p.E1832K	ENST00000336338.5	37	c.5494	CCDS899.1	1	.	.	.	.	.	.	.	.	.	.	C	13.62	2.292504	0.40594	.	.	ENSG00000155761	ENST00000336338;ENST00000437255	T	0.18338	2.22	5.14	3.13	0.36017	.	0.216295	0.38605	N	0.001622	T	0.04907	0.0132	L	0.41415	1.275	0.26627	N	0.972534	B	0.15930	0.015	B	0.20184	0.028	T	0.32534	-0.9903	10	0.25751	T	0.34	.	9.0253	0.36224	0.0:0.8053:0.0:0.1947	.	1832	Q6Q759	SPG17_HUMAN	K	1832;312	ENSP00000337804:E1832K	ENSP00000337804:E1832K	E	-	1	0	SPAG17	118335034	0.479000	0.25925	1.000000	0.80357	0.963000	0.63663	-0.024000	0.12435	1.404000	0.46819	0.655000	0.94253	GAA	SPAG17	-	NULL	ENSG00000155761		0.299	SPAG17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPAG17	HGNC	protein_coding	OTTHUMT00000033723.1		0.00	53	0	C	NM_206996		118533511	-1			no_errors	ENST00000336338	ensembl	human	known	74_37	missense	5.88	32	2	SNP	0.999	T
NPR2	4882	genome.wustl.edu	37	9	35811389	35811390	+	IGR	DNP	TC	TC	AG			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	T|C	T|C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr9:35811389_35811390TC>AG	ENST00000342694.2	+	0	3686				SPAG8_ENST00000340291.2_Missense_Mutation_p.R218T|SPAG8_ENST00000484764.1_Missense_Mutation_p.R216T|SPAG8_ENST00000479751.1_5'UTR|SPAG8_ENST00000396638.2_Missense_Mutation_p.R218T|HINT2_ENST00000474908.1_5'Flank|AL133410.1_ENST00000582432.1_RNA	NM_003995.3	NP_003986.2	P20594	ANPRB_HUMAN	natriuretic peptide receptor 2						bone development (GO:0060348)|cell surface receptor signaling pathway (GO:0007166)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cGMP biosynthetic process (GO:0006182)|intracellular signal transduction (GO:0035556)|negative regulation of meiotic cell cycle (GO:0051447)|negative regulation of oocyte maturation (GO:1900194)|ossification (GO:0001503)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|signal transduction (GO:0007165)|single organism reproductive process (GO:0044702)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(2)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)		Erythrityl Tetranitrate(DB01613)|Nesiritide(DB04899)	CCACCAGGTTTCTGAACCCTGG	0.579																																																	0																																										SO:0001628	intergenic_variant	0			AJ005282	CCDS6590.1	9p21-p12	2014-03-03	2014-03-03		ENSG00000159899	ENSG00000159899			7944	protein-coding gene	gene with protein product	"""guanylate cyclase B"""	108961	"""acromesomelic dysplasia, Maroteaux type"", ""atrionatriuretic peptide receptor B"", ""natriuretic peptide receptor B"""	ANPRB, NPRB, AMDM		9634515, 15146390	Standard	XM_005251478		Approved	GUCY2B, ANPb	uc003zyd.3	P20594	OTTHUMG00000019871	Exception_encountered	9.37:g.35811389_35811390delinsAG			B0ZBF2|B0ZBF3|D3DRP3|D3DRP4|O60871|Q4VAK7|Q5TCV2|Q8TA93|Q9UQ50	Missense_Mutation	SNP	prints_Antifreeze_1	p.R218S|p.R218T	ENST00000342694.2	37	c.654|c.653	CCDS6590.1	9																																																																																			SPAG8	-	NULL	ENSG00000137098		0.579	NPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPAG8	HGNC	protein_coding	OTTHUMT00000052345.1	-	0.00	105	0	T|C			35811389|35811390	-1	tier1	-	no_errors	ENST00000340291	ensembl	human	known	74_37	missense	23.81	32	10	SNP	0.000	A|G
SSTR4	6754	genome.wustl.edu	37	20	23016315	23016315	+	Missense_Mutation	SNP	C	C	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr20:23016315C>A	ENST00000255008.3	+	1	259	c.195C>A	c.(193-195)aaC>aaA	p.N65K	RP4-753D10.3_ENST00000440921.1_RNA	NM_001052.2	NP_001043.2	P31391	SSR4_HUMAN	somatostatin receptor 4	65					arachidonic acid metabolic process (GO:0019369)|cell migration (GO:0016477)|cellular response to glucocorticoid stimulus (GO:0071385)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cAMP metabolic process (GO:0030815)|negative regulation of cell proliferation (GO:0008285)|positive regulation of MAPK cascade (GO:0043410)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|upper_aerodigestive_tract(1)	32	Colorectal(13;0.0518)|Lung NSC(19;0.0542)|all_lung(19;0.118)					TGGTGGGCAACGCCCTGGTCA	0.657																																					Esophageal Squamous(15;850 1104 16640)												0													97.0	109.0	105.0					20																	23016315		2203	4300	6503	SO:0001583	missense	0				CCDS42856.1	20p11.21	2014-07-11			ENSG00000132671	ENSG00000132671		"""GPCR / Class A : Somatostatin receptors"""	11333	protein-coding gene	gene with protein product		182454				8483934	Standard	NM_001052		Approved		uc002wsr.2	P31391	OTTHUMG00000032054	ENST00000255008.3:c.195C>A	20.37:g.23016315C>A	ENSP00000255008:p.Asn65Lys		Q17RM1|Q17RM3|Q9UIY1	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfam_7TM_GPCR_serpentine_rcpt_Srw,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_Somatstn_rcpt_4,prints_GPCR_Rhodpsn,prints_Somatstn_rcpt,prints_Opioid_rcpt,prints_Neuropept_B/W_rcpt,prints_NPY_rcpt,prints_Somatstn_rcpt_1	p.N65K	ENST00000255008.3	37	c.195	CCDS42856.1	20	.	.	.	.	.	.	.	.	.	.	C	17.46	3.395025	0.62066	.	.	ENSG00000132671	ENST00000255008	D	0.96619	-4.07	3.73	0.301	0.15781	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	U	0.000002	D	0.98369	0.9458	H	0.98027	4.13	0.45342	D	0.998337	D	0.89917	1.0	D	0.81914	0.995	D	0.96487	0.9361	10	0.87932	D	0	.	6.5379	0.22365	0.0:0.6389:0.157:0.2041	.	65	P31391	SSR4_HUMAN	K	65	ENSP00000255008:N65K	ENSP00000255008:N65K	N	+	3	2	SSTR4	22964315	0.998000	0.40836	0.994000	0.49952	0.978000	0.69477	0.578000	0.23773	0.235000	0.21160	0.561000	0.74099	AAC	SSTR4	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000132671		0.657	SSTR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSTR4	HGNC	protein_coding	OTTHUMT00000078308.1		0.00	28	0	C			23016315	+1			no_errors	ENST00000255008	ensembl	human	known	74_37	missense	7.14	26	2	SNP	1.000	A
SS18L1	26039	genome.wustl.edu	37	20	60736518	60736518	+	Silent	SNP	C	C	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr20:60736518C>T	ENST00000331758.3	+	4	284	c.258C>T	c.(256-258)ggC>ggT	p.G86G	SS18L1_ENST00000421564.1_Silent_p.G86G|SS18L1_ENST00000370848.4_Silent_p.G89G	NM_198935.1	NP_945173.1	O75177	CREST_HUMAN	synovial sarcoma translocation gene on chromosome 18-like 1	86	N-terminal auto-inhibitory domain; necessary for interaction with SMARCA4/BRG1. {ECO:0000250}.				chromatin modification (GO:0016568)|dendrite development (GO:0016358)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of dendrite development (GO:0050773)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome, centromeric region (GO:0000780)|kinetochore (GO:0000776)|nuclear body (GO:0016604)|nucleus (GO:0005634)			SS18L1/SSX1(2)	ovary(2)|skin(1)	3	Breast(26;3.97e-09)		BRCA - Breast invasive adenocarcinoma(19;1.92e-08)			TGAACCTGGGCCCTGGAGCCC	0.632			T	SSX1	synovial sarcoma																																			Dom	yes		20	20q13.3	26039	synovial sarcoma translocation gene on chromosome 18-like 1		M	0													29.0	34.0	33.0					20																	60736518		2202	4300	6502	SO:0001819	synonymous_variant	0			AB014593	CCDS13491.1	20q13.3	2008-07-28			ENSG00000184402	ENSG00000184402			15592	protein-coding gene	gene with protein product		606472					Standard	XM_005260389		Approved	KIAA0693	uc002ycb.3	O75177	OTTHUMG00000032902	ENST00000331758.3:c.258C>T	20.37:g.60736518C>T			A6NNE3|A8K620|B3KWR8|E1P5H7|Q5JXJ3|Q6MZV9|Q6NTH3|Q6XYD9|Q8NE69|Q9BR55|Q9H4K6	Silent	SNP	pfam_SS18_fam	p.G89	ENST00000331758.3	37	c.267	CCDS13491.1	20																																																																																			SS18L1	-	NULL	ENSG00000184402		0.632	SS18L1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SS18L1	HGNC	protein_coding	OTTHUMT00000080004.2	-	0.00	38	0	C			60736518	+1	tier1	-	no_errors	ENST00000370848	ensembl	human	known	74_37	silent	36.00	16	9	SNP	0.998	T
STK16	8576	genome.wustl.edu	37	2	220113230	220113230	+	Missense_Mutation	SNP	G	G	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr2:220113230G>T	ENST00000409638.3	+	8	1039	c.867G>T	c.(865-867)caG>caT	p.Q289H	STK16_ENST00000409260.1_Missense_Mutation_p.Q334H|STK16_ENST00000409743.1_Missense_Mutation_p.Q257H|STK16_ENST00000409516.3_Missense_Mutation_p.Q171H|STK16_ENST00000396738.2_Missense_Mutation_p.Q289H|TUBA4A_ENST00000498660.1_5'Flank	NM_001008910.2	NP_001008910.1	O75716	STK16_HUMAN	serine/threonine kinase 16	289	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to transforming growth factor beta stimulus (GO:0071560)|protein autophosphorylation (GO:0046777)	Golgi-associated vesicle (GO:0005798)|membrane (GO:0016020)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			skin(1)	1		Renal(207;0.0474)		Epithelial(149;1.2e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TCCTCAGTCAGCTGGAGGCGC	0.562																																					Pancreas(34;887 922 17165 36961 39622)												0													79.0	84.0	82.0					2																	220113230		2032	4179	6211	SO:0001583	missense	0			AF060798	CCDS42822.1	2q35	2010-04-16			ENSG00000115661	ENSG00000115661			11394	protein-coding gene	gene with protein product		604719				9712705	Standard	NM_001008910		Approved	PKL12, MPSK	uc002vko.2	O75716	OTTHUMG00000154520	ENST00000409638.3:c.867G>T	2.37:g.220113230G>T	ENSP00000386928:p.Gln289His		A8K9H9|Q5U0F8|Q96KI2|Q9BUH4|Q9UEN3|Q9UP78	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.Q289H	ENST00000409638.3	37	c.867	CCDS42822.1	2	.	.	.	.	.	.	.	.	.	.	G	0.926	-0.714286	0.03206	.	.	ENSG00000115661	ENST00000409638;ENST00000396738;ENST00000409516;ENST00000409260;ENST00000409743	T;T;T;T;T	0.74106	-0.61;-0.61;0.11;-0.81;-0.49	5.15	-0.0799	0.13708	Protein kinase, catalytic domain (1);	0.111534	0.64402	N	0.000006	T	0.49133	0.1539	N	0.13235	0.315	0.45390	D	0.998377	B;B;B	0.26635	0.155;0.011;0.043	B;B;B	0.21151	0.033;0.011;0.014	T	0.12066	-1.0562	10	0.27785	T	0.31	-16.2958	6.0696	0.19881	0.3661:0.1192:0.5147:0.0	.	171;334;289	B4DPS1;B8ZZN3;O75716	.;.;STK16_HUMAN	H	289;289;171;334;257	ENSP00000386928:Q289H;ENSP00000379964:Q289H;ENSP00000386309:Q171H;ENSP00000387156:Q334H;ENSP00000386553:Q257H	ENSP00000379964:Q289H	Q	+	3	2	STK16	219821474	0.996000	0.38824	0.957000	0.39632	0.020000	0.10135	0.920000	0.28705	0.028000	0.15324	-0.367000	0.07326	CAG	STK16	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000115661		0.562	STK16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK16	HGNC	protein_coding	OTTHUMT00000335679.1	-	0.00	41	0	G			220113230	+1	tier1	-	no_errors	ENST00000396738	ensembl	human	known	74_37	missense	13.79	25	4	SNP	0.912	T
STK11IP	114790	genome.wustl.edu	37	2	220479262	220479262	+	Missense_Mutation	SNP	G	G	C			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr2:220479262G>C	ENST00000456909.1	+	23	2953	c.2863G>C	c.(2863-2865)Gtt>Ctt	p.V955L	STK11IP_ENST00000295641.10_Missense_Mutation_p.V966L			Q8N1F8	S11IP_HUMAN	serine/threonine kinase 11 interacting protein	966					protein localization (GO:0008104)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)	protein kinase binding (GO:0019901)			breast(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|urinary_tract(1)	23		Renal(207;0.0183)		Epithelial(149;2.69e-07)|all cancers(144;5.91e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GGCGTTCCTGGTTGAAGGTGA	0.562																																																	0													84.0	86.0	85.0					2																	220479262		2028	4195	6223	SO:0001583	missense	0			AF450267	CCDS46521.1	2q35	2008-06-03			ENSG00000144589	ENSG00000144589			19184	protein-coding gene	gene with protein product	"""LKB1 interacting protein"""	607172				11741830	Standard	NM_052902		Approved	LIP1, KIAA1898, LKB1IP, STK11IP1	uc002vml.3	Q8N1F8	OTTHUMG00000059239	ENST00000456909.1:c.2863G>C	2.37:g.220479262G>C	ENSP00000389383:p.Val955Leu		Q8NAW9|Q8WXE4|Q96CN3|Q96PY9	Missense_Mutation	SNP	NULL	p.V955L	ENST00000456909.1	37	c.2863		2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.64|12.64	1.999530|1.999530	0.35320|0.35320	.|.	.|.	ENSG00000144589|ENSG00000144589	ENST00000456909;ENST00000295641|ENST00000447191	T;T|.	0.05513|.	3.44;3.43|.	4.72|4.72	3.82|3.82	0.43975|0.43975	.|.	0.444644|.	0.21785|.	N|.	0.069142|.	T|T	0.40171|0.40171	0.1106|0.1106	L|L	0.44542|0.44542	1.39|1.39	0.22479|0.22479	N|N	0.999063|0.999063	B|.	0.32101|.	0.356|.	B|.	0.29598|.	0.104|.	T|T	0.18903|0.18903	-1.0322|-1.0322	10|5	0.20519|.	T|.	0.43|.	-3.7487|-3.7487	8.9271|8.9271	0.35648|0.35648	0.1031:0.0:0.8969:0.0|0.1031:0.0:0.8969:0.0	.|.	966|.	Q8N1F8|.	S11IP_HUMAN|.	L|C	955;966|54	ENSP00000389383:V955L;ENSP00000295641:V966L|.	ENSP00000295641:V966L|.	V|W	+|+	1|3	0|0	STK11IP|STK11IP	220187506|220187506	0.988000|0.988000	0.35896|0.35896	1.000000|1.000000	0.80357|0.80357	0.937000|0.937000	0.57800|0.57800	0.788000|0.788000	0.26872|0.26872	2.435000|2.435000	0.82474|0.82474	0.655000|0.655000	0.94253|0.94253	GTT|TGG	STK11IP	-	NULL	ENSG00000144589		0.562	STK11IP-001	NOVEL	basic|appris_principal	protein_coding	STK11IP	HGNC	protein_coding	OTTHUMT00000131432.1		0.00	65	0	G	NM_052902		220479262	+1			no_errors	ENST00000456909	ensembl	human	novel	74_37	missense	8.33	33	3	SNP	1.000	C
STK4	6789	genome.wustl.edu	37	20	43629138	43629138	+	Missense_Mutation	SNP	G	G	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr20:43629138G>T	ENST00000372806.3	+	8	1032	c.937G>T	c.(937-939)Gac>Tac	p.D313Y	STK4_ENST00000396731.4_Missense_Mutation_p.D313Y|STK4_ENST00000372801.1_Missense_Mutation_p.D313Y|STK4_ENST00000499879.2_Missense_Mutation_p.D258Y	NM_006282.2	NP_006273.1	Q13043	STK4_HUMAN	serine/threonine kinase 4	313					apoptotic process (GO:0006915)|cell differentiation involved in embryonic placenta development (GO:0060706)|cell morphogenesis (GO:0000902)|central nervous system development (GO:0007417)|endocardium development (GO:0003157)|hepatocyte apoptotic process (GO:0097284)|hippo signaling (GO:0035329)|intracellular signal transduction (GO:0035556)|keratinocyte differentiation (GO:0030216)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of organ growth (GO:0046621)|neural tube formation (GO:0001841)|patterning of blood vessels (GO:0001569)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|primitive hemopoiesis (GO:0060215)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|protein dimerization activity (GO:0046983)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activator activity (GO:0043539)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(2)|lung(5)|ovary(1)|prostate(1)|skin(2)	20		Myeloproliferative disorder(115;0.0122)				GCGGGAAGTGGACCAGGACGA	0.468																																					GBM(187;1039 2137 11798 21916 33213)												0													66.0	54.0	58.0					20																	43629138		2203	4300	6503	SO:0001583	missense	0				CCDS13341.1	20q11.2-q13.2	2014-09-17			ENSG00000101109	ENSG00000101109			11408	protein-coding gene	gene with protein product	"""mammalian sterile 20-like 1"", ""yeast Ste20-like"", ""kinase responsive to stress 2"""	604965				8816758, 9545236, 11517310	Standard	NM_006282		Approved	MST1, KRS2, YSK3	uc002xnb.3	Q13043	OTTHUMG00000033059	ENST00000372806.3:c.937G>T	20.37:g.43629138G>T	ENSP00000361892:p.Asp313Tyr		B2RCR8|Q15802|Q4G156|Q5H982|Q6PD60|Q9BR32|Q9NTZ4	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Mst1_SARAH_domain,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_SARAH_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.D313Y	ENST00000372806.3	37	c.937	CCDS13341.1	20	.	.	.	.	.	.	.	.	.	.	G	16.13	3.035681	0.54896	.	.	ENSG00000101109	ENST00000372806;ENST00000396731;ENST00000372801;ENST00000499879	T;T;T;T	0.73258	-0.71;-0.73;-0.73;0.26	5.88	5.88	0.94601	Protein kinase-like domain (1);	0.266184	0.42964	D	0.000640	T	0.68742	0.3034	L	0.60455	1.87	0.51482	D	0.999926	B;B;B;B	0.13145	0.001;0.005;0.003;0.007	B;B;B;B	0.15052	0.007;0.012;0.005;0.005	T	0.64829	-0.6315	10	0.56958	D	0.05	.	15.8044	0.78481	0.0:0.0:0.8635:0.1365	.	258;313;313;313	F5H5B4;Q13043-2;A0PJ51;Q13043	.;.;.;STK4_HUMAN	Y	313;313;313;258	ENSP00000361892:D313Y;ENSP00000379957:D313Y;ENSP00000361887:D313Y;ENSP00000443514:D258Y	ENSP00000361887:D313Y	D	+	1	0	STK4	43062552	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.282000	0.78630	2.782000	0.95742	0.655000	0.94253	GAC	STK4	-	superfamily_Kinase-like_dom	ENSG00000101109		0.468	STK4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	STK4	HGNC	protein_coding	OTTHUMT00000080401.4	-	0.00	116	0	G	NM_006282		43629138	+1	tier1	-	no_errors	ENST00000372806	ensembl	human	known	74_37	missense	48.18	57	53	SNP	1.000	T
STXBP5L	9515	genome.wustl.edu	37	3	121100286	121100286	+	Missense_Mutation	SNP	G	G	C			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr3:121100286G>C	ENST00000273666.6	+	23	2837	c.2566G>C	c.(2566-2568)Gga>Cga	p.G856R	STXBP5L_ENST00000472879.1_Missense_Mutation_p.G832R|STXBP5L_ENST00000497029.1_Missense_Mutation_p.G830R|STXBP5L_ENST00000492541.1_Missense_Mutation_p.G856R|STXBP5L_ENST00000471454.1_Missense_Mutation_p.G832R	NM_014980.2	NP_055795.1	Q9Y2K9	STB5L_HUMAN	syntaxin binding protein 5-like	856					exocytosis (GO:0006887)|glucose homeostasis (GO:0042593)|negative regulation of insulin secretion (GO:0046676)|positive regulation of protein secretion (GO:0050714)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(12)|lung(28)|ovary(7)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				GBM - Glioblastoma multiforme(114;0.0694)		TCTGTTCGTTGGAACCAGTCT	0.413																																																	0													187.0	175.0	179.0					3																	121100286		1895	4124	6019	SO:0001583	missense	0			AB023223	CCDS43137.1	3q13.33-q21.1	2013-01-10			ENSG00000145087	ENSG00000145087		"""WD repeat domain containing"""	30757	protein-coding gene	gene with protein product		609381				10231032, 14767561	Standard	NM_014980		Approved	KIAA1006, LLGL4	uc003eec.4	Q9Y2K9	OTTHUMG00000159426	ENST00000273666.6:c.2566G>C	3.37:g.121100286G>C	ENSP00000273666:p.Gly856Arg		Q4G1B4|Q6PIC3	Missense_Mutation	SNP	pfam_LLGL2,pfam_WD40_repeat,pfam_Lgl_C_dom,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,pfscan_Synaptobrevin,prints_Lethal2_giant	p.G856R	ENST00000273666.6	37	c.2566	CCDS43137.1	3	.	.	.	.	.	.	.	.	.	.	G	27.6	4.843815	0.91197	.	.	ENSG00000145087	ENST00000273666;ENST00000471454;ENST00000472879;ENST00000497029;ENST00000492541;ENST00000471262	T;T;T;T;T;T	0.51817	0.69;0.69;0.69;0.69;0.69;0.69	5.1	5.1	0.69264	Lethal giant larvae (Lgl)-like, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.75627	0.3875	M	0.90252	3.1	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.81136	-0.1070	10	0.87932	D	0	-17.3543	18.7084	0.91646	0.0:0.0:1.0:0.0	.	832;856	E9PFI2;Q9Y2K9	.;STB5L_HUMAN	R	856;832;832;830;856;799	ENSP00000273666:G856R;ENSP00000420019:G832R;ENSP00000419627:G832R;ENSP00000420287:G830R;ENSP00000420666:G856R;ENSP00000420167:G799R	ENSP00000273666:G856R	G	+	1	0	STXBP5L	122582976	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.369000	0.97156	2.660000	0.90430	0.650000	0.86243	GGA	STXBP5L	-	pfam_Lgl_C_dom	ENSG00000145087		0.413	STXBP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STXBP5L	HGNC	protein_coding	OTTHUMT00000355256.3	-	0.00	118	0	G			121100286	+1	tier1	-	no_errors	ENST00000273666	ensembl	human	known	74_37	missense	12.60	111	16	SNP	1.000	C
SUPT20H	55578	genome.wustl.edu	37	13	37619410	37619410	+	Missense_Mutation	SNP	A	A	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr13:37619410A>T	ENST00000350612.6	-	6	486	c.266T>A	c.(265-267)cTg>cAg	p.L89Q	SUPT20H_ENST00000360252.4_Missense_Mutation_p.L90Q|SUPT20H_ENST00000470359.2_5'UTR|SUPT20H_ENST00000475892.1_Missense_Mutation_p.L89Q|SUPT20H_ENST00000464744.1_Missense_Mutation_p.L90Q|SUPT20H_ENST00000542180.1_Missense_Mutation_p.L77Q|SUPT20H_ENST00000356185.3_Missense_Mutation_p.L90Q	NM_001014286.2	NP_001014308.2	Q8NEM7	SP20H_HUMAN	suppressor of Ty 20 homolog (S. cerevisiae)	89					autophagy (GO:0006914)|chromatin organization (GO:0006325)|gastrulation (GO:0007369)	SAGA complex (GO:0000124)|SAGA-type complex (GO:0070461)	transcription cofactor activity (GO:0003712)										CCTGAGCATCAGAGAATATCC	0.393																																																	0													120.0	111.0	114.0					13																	37619410		2203	4300	6503	SO:0001583	missense	0			AF093250	CCDS9362.1, CCDS31959.1, CCDS61311.1	13q13	2012-11-29	2012-11-29	2012-11-29	ENSG00000102710	ENSG00000102710			20596	protein-coding gene	gene with protein product	"""p38 interacting protein"", ""transcription factor (p38 interacting protein)"""	613417	"""chromosome 13 open reading frame 19"", ""family with sequence similarity 48, member A"""	C13orf19, FAM48A		12070015 , 16685401	Standard	NM_001278480		Approved	SPT20, bA421P11.4, P38IP	uc001uwg.3	Q8NEM7	OTTHUMG00000016747	ENST00000350612.6:c.266T>A	13.37:g.37619410A>T	ENSP00000218894:p.Leu89Gln		E7ER46|Q71RF3|Q9Y6A6	Missense_Mutation	SNP	pfam_Spt20	p.L89Q	ENST00000350612.6	37	c.266	CCDS31959.1	13	.	.	.	.	.	.	.	.	.	.	A	27.5	4.836535	0.91117	.	.	ENSG00000102710	ENST00000360252;ENST00000475892;ENST00000350612;ENST00000356185;ENST00000536874;ENST00000464744;ENST00000542180;ENST00000497318	T;T;T;T;T;T;T	0.50813	0.73;0.73;0.73;0.73;0.73;0.73;0.73	5.76	5.76	0.90799	.	0.000000	0.64402	D	0.000001	T	0.72661	0.3488	M	0.85041	2.73	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.998;0.998;0.997;0.999;0.998;0.999	T	0.77811	-0.2449	10	0.87932	D	0	-7.7057	16.0796	0.80995	1.0:0.0:0.0:0.0	.	77;89;89;90;90;89	B4E2D5;B3KNI1;E7ER46;A8K8L1;Q8NEM7-2;Q8NEM7	.;.;.;.;.;FA48A_HUMAN	Q	90;89;89;90;89;90;77;90	ENSP00000353388:L90Q;ENSP00000417510:L89Q;ENSP00000218894:L89Q;ENSP00000348512:L90Q;ENSP00000419754:L90Q;ENSP00000439000:L77Q;ENSP00000420170:L90Q	ENSP00000218894:L89Q	L	-	2	0	FAM48A	36517410	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.273000	0.95719	2.195000	0.70347	0.528000	0.53228	CTG	SUPT20H	-	pfam_Spt20	ENSG00000102710		0.393	SUPT20H-016	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SUPT20H	HGNC	protein_coding	OTTHUMT00000354766.1	-	0.00	112	0	A	NM_017569		37619410	-1	tier1	-	no_errors	ENST00000350612	ensembl	human	known	74_37	missense	7.14	52	4	SNP	1.000	T
SUSD2	56241	genome.wustl.edu	37	22	24577511	24577511	+	Missense_Mutation	SNP	G	G	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr22:24577511G>T	ENST00000358321.3	+	1	285	c.24G>T	c.(22-24)tgG>tgT	p.W8C		NM_019601.3	NP_062547.1	Q9UGT4	SUSD2_HUMAN	sushi domain containing 2	8					immune response (GO:0006955)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	26						TCCTGCCCTGGGCCCTGCTGC	0.687																																																	0													13.0	15.0	14.0					22																	24577511		2186	4285	6471	SO:0001583	missense	0			AK026431	CCDS13824.1	22q11-q12	2005-08-16			ENSG00000099994	ENSG00000099994			30667	protein-coding gene	gene with protein product		615825				12477932	Standard	NM_019601		Approved	BK65A6.2, FLJ22778	uc002zzn.1	Q9UGT4	OTTHUMG00000150792	ENST00000358321.3:c.24G>T	22.37:g.24577511G>T	ENSP00000351075:p.Trp8Cys		Q9H5Y6	Missense_Mutation	SNP	pfam_AMOP,pfam_VWF_type-D,pfam_Sushi_SCR_CCP,pfam_Somatomedin_B_dom,superfamily_Sushi_SCR_CCP,superfamily_Ig_E-set,smart_AMOP,smart_VWF_type-D,smart_Sushi_SCR_CCP,pfscan_AMOP,pfscan_Somatomedin_B_dom,pfscan_Sushi_SCR_CCP	p.W8C	ENST00000358321.3	37	c.24	CCDS13824.1	22	.	.	.	.	.	.	.	.	.	.	G	12.83	2.055095	0.36277	.	.	ENSG00000099994	ENST00000358321	T	0.20332	2.08	3.81	2.78	0.32641	.	0.520885	0.15392	N	0.264754	T	0.21427	0.0516	L	0.57536	1.79	0.40224	D	0.977771	B	0.12013	0.005	B	0.12156	0.007	T	0.07558	-1.0766	10	0.56958	D	0.05	-9.6359	9.4506	0.38723	0.0:0.2167:0.7833:0.0	.	8	Q9UGT4	SUSD2_HUMAN	C	8	ENSP00000351075:W8C	ENSP00000351075:W8C	W	+	3	0	SUSD2	22907511	0.546000	0.26457	0.542000	0.28115	0.898000	0.52572	0.337000	0.19841	1.157000	0.42530	0.550000	0.68814	TGG	SUSD2	-	NULL	ENSG00000099994		0.687	SUSD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUSD2	HGNC	protein_coding	OTTHUMT00000320088.1	-	0.00	42	0	G	NM_019601		24577511	+1	tier1	-	no_errors	ENST00000358321	ensembl	human	known	74_37	missense	15.38	22	4	SNP	0.883	T
SYNRG	11276	genome.wustl.edu	37	17	35913272	35913273	+	Frame_Shift_Ins	INS	-	-	A	rs370574307		TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr17:35913272_35913273insA	ENST00000339208.6	-	14	2692_2693	c.2552_2553insT	c.(2551-2553)atgfs	p.M851fs	SYNRG_ENST00000345615.4_Frame_Shift_Ins_p.M773fs|SYNRG_ENST00000585472.1_Frame_Shift_Ins_p.M772fs|SYNRG_ENST00000588194.1_5'Flank|SYNRG_ENST00000502449.2_Frame_Shift_Ins_p.M773fs|SYNRG_ENST00000394378.2_Frame_Shift_Ins_p.M773fs|SYNRG_ENST00000346661.4_Frame_Shift_Ins_p.M851fs|SYNRG_ENST00000591288.1_Frame_Shift_Ins_p.M690fs	NM_001163544.1|NM_001163545.1|NM_007247.4	NP_001157016.1|NP_001157017.1|NP_009178.3	Q9UMZ2	SYNRG_HUMAN	synergin, gamma	851					endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)	AP-1 adaptor complex (GO:0030121)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)			breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	36						AGCTATCAGACATGACATGCTT	0.47																																																	0																																										SO:0001589	frameshift_variant	0			AF169548	CCDS11321.1, CCDS11322.1, CCDS11322.2, CCDS54113.1, CCDS54114.1, CCDS59284.1, CCDS59285.1	17q12	2014-04-16	2009-07-20	2009-07-20	ENSG00000006114	ENSG00000275066			557	protein-coding gene	gene with protein product	"""gamma-synergin"", ""adaptor-related protein complex 1 gamma subunit-binding protein 1"""	607291	"""AP1 gamma subunit binding protein 1"""	AP1GBP1		10477754	Standard	XM_005256980		Approved	SYNG, MGC104959	uc010wdf.2	Q9UMZ2	OTTHUMG00000188473	ENST00000339208.6:c.2553dupT	17.37:g.35913273_35913273dupA	ENSP00000343610:p.Met851fs		A8MWU4|B7ZKZ2|B7ZKZ3|Q17RI2|Q5BKU5|Q6ZT17	Frame_Shift_Ins	INS	smart_EPS15_homology,pfscan_EPS15_homology	p.M851fs	ENST00000339208.6	37	c.2553_2552	CCDS11321.1	17																																																																																			SYNRG	-	NULL	ENSG00000006114		0.470	SYNRG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNRG	HGNC	protein_coding	OTTHUMT00000256811.2		0.00	57	0	-	NM_007247		35913273	-1	tier1		no_errors	ENST00000339208	ensembl	human	known	74_37	frame_shift_ins	18.18	36	8	INS	1.000:1.000	A
TAF3	83860	genome.wustl.edu	37	10	8019276	8019276	+	Missense_Mutation	SNP	C	C	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr10:8019276C>A	ENST00000344293.5	+	4	2511	c.2305C>A	c.(2305-2307)Caa>Aaa	p.Q769K		NM_031923.3	NP_114129.1	Q5VWG9	TAF3_HUMAN	TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140kDa	769					maintenance of protein location in nucleus (GO:0051457)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	zinc ion binding (GO:0008270)			NS(2)|breast(4)|endometrium(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(3)|prostate(4)|skin(2)	40						CGGTGCTGGCCAAGACAAGAT	0.423																																																	0													77.0	78.0	78.0					10																	8019276		1857	4095	5952	SO:0001583	missense	0			AJ292190	CCDS41487.1	10p15.1	2013-01-28	2002-08-29		ENSG00000165632	ENSG00000165632		"""Zinc fingers, PHD-type"""	17303	protein-coding gene	gene with protein product		606576	"""TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140 kD"""			11438666, 18549481	Standard	NM_031923		Approved	TAF140, TAFII140	uc010qbd.3	Q5VWG9	OTTHUMG00000017643	ENST00000344293.5:c.2305C>A	10.37:g.8019276C>A	ENSP00000340271:p.Gln769Lys		Q05DA0|Q6GMS5|Q6P6B5|Q86VY6|Q9BQS9|Q9UFI8	Missense_Mutation	SNP	pfam_BTP,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,superfamily_Histone-fold,smart_BTP,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.Q769K	ENST00000344293.5	37	c.2305	CCDS41487.1	10	.	.	.	.	.	.	.	.	.	.	C	19.23	3.787349	0.70337	.	.	ENSG00000165632	ENST00000344293	T	0.18016	2.24	6.05	6.05	0.98169	.	0.000000	0.64402	D	0.000008	T	0.20901	0.0503	M	0.77616	2.38	0.80722	D	1	P	0.36282	0.546	B	0.26416	0.069	T	0.21211	-1.0252	10	0.07644	T	0.81	-31.7616	20.6087	0.99469	0.0:1.0:0.0:0.0	.	769	Q5VWG9	TAF3_HUMAN	K	769	ENSP00000340271:Q769K	ENSP00000340271:Q769K	Q	+	1	0	TAF3	8059282	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	6.533000	0.73829	2.866000	0.98385	0.650000	0.86243	CAA	TAF3	-	NULL	ENSG00000165632		0.423	TAF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF3	HGNC	protein_coding	OTTHUMT00000046725.1	-	0.00	85	0	C	NM_031923		8019276	+1	tier1	-	no_errors	ENST00000344293	ensembl	human	known	74_37	missense	31.25	44	20	SNP	1.000	A
TARS	6897	genome.wustl.edu	37	5	33441104	33441104	+	5'UTR	SNP	C	C	G			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr5:33441104C>G	ENST00000265112.3	+	0	223				CTD-2203K17.1_ENST00000507251.1_RNA|TARS_ENST00000414361.2_5'UTR|TARS_ENST00000541634.1_5'UTR|TARS_ENST00000455217.2_5'UTR|TARS_ENST00000502553.1_Intron	NM_152295.4	NP_689508.3	P26639	SYTC_HUMAN	threonyl-tRNA synthetase						gene expression (GO:0010467)|threonyl-tRNA aminoacylation (GO:0006435)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|protein homodimerization activity (GO:0042803)|threonine-tRNA ligase activity (GO:0004829)			NS(1)|biliary_tract(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(7)|lung(11)|ovary(2)|prostate(1)	29					L-Threonine(DB00156)	AGGCCAAGTCCCGGGCGCTAG	0.637																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AK095852	CCDS3899.1, CCDS58943.1	5p13.2	2012-10-02			ENSG00000113407	ENSG00000113407	6.1.1.3	"""Aminoacyl tRNA synthetases / Class II"""	11572	protein-coding gene	gene with protein product	"""threonine tRNA ligase 1, cytoplasmic"""	187790					Standard	NM_152295		Approved		uc011coc.3	P26639	OTTHUMG00000090683	ENST00000265112.3:c.-89C>G	5.37:g.33441104C>G			A8K8I1|B4DEG8|Q96FP5|Q9BWA6	RNA	SNP	-	NULL	ENST00000265112.3	37	NULL	CCDS3899.1	5																																																																																			TARS	-	-	ENSG00000113407		0.637	TARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TARS	HGNC	protein_coding	OTTHUMT00000207367.1	-	0.00	44	0	C	NM_152295		33441104	+1	tier1	-	no_errors	ENST00000502508	ensembl	human	known	74_37	rna	34.29	23	12	SNP	0.004	G
TBC1D3P2	440452	genome.wustl.edu	37	17	60342940	60342940	+	RNA	SNP	C	C	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr17:60342940C>A	ENST00000581291.1	-	0	1213									TBC1 domain family, member 3 pseudogene 2											breast(2)|kidney(1)|lung(2)	5						TCTTCCCGCCCCGTGAAGCCG	0.672																																																	0																																												0					17q23.2	2009-05-14				ENSG00000188755			27783	pseudogene	pseudogene							Standard	NR_027486		Approved		uc002izq.2				17.37:g.60342940C>A				RNA	SNP	-	NULL	ENST00000581291.1	37	NULL		17																																																																																			TBC1D3P2	-	-	ENSG00000188755		0.672	TBC1D3P2-002	KNOWN	basic	processed_transcript	TBC1D3P2	HGNC	pseudogene	OTTHUMT00000445021.1	-	0.00	13	0	C	NR_027486		60342940	-1	tier1	-	no_errors	ENST00000339120	ensembl	human	known	74_37	rna	66.67	1	2	SNP	0.002	A
TBC1D9	23158	genome.wustl.edu	37	4	141590791	141590791	+	Silent	SNP	T	T	C			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr4:141590791T>C	ENST00000442267.2	-	8	1508	c.1434A>G	c.(1432-1434)aaA>aaG	p.K478K		NM_015130.2	NP_055945.2	Q6ZT07	TBCD9_HUMAN	TBC1 domain family, member 9 (with GRAM domain)	478							calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	31	all_hematologic(180;0.162)	Medulloblastoma(177;0.00498)				CACCCACCAATTTCGGGTTGA	0.458																																																	0													40.0	44.0	42.0					4																	141590791		1983	4143	6126	SO:0001819	synonymous_variant	0			AB020689	CCDS47136.1	4q31.1	2013-01-10	2006-07-12		ENSG00000109436	ENSG00000109436		"""EF-hand domain containing"""	21710	protein-coding gene	gene with protein product			"""TBC1 domain family, member 9"""			12970790	Standard	NM_015130		Approved	KIAA0882, MDR1	uc010ioj.3	Q6ZT07	OTTHUMG00000161405	ENST00000442267.2:c.1434A>G	4.37:g.141590791T>C			A6H8U8|D3DNZ1|O94958	Silent	SNP	pfam_Rab-GTPase-TBC_dom,pfam_GRAM,superfamily_Rab-GTPase-TBC_dom,smart_GRAM,smart_Rab-GTPase-TBC_dom,pfscan_EF_hand_dom,pfscan_Rab-GTPase-TBC_dom	p.K478	ENST00000442267.2	37	c.1434	CCDS47136.1	4																																																																																			TBC1D9	-	NULL	ENSG00000109436		0.458	TBC1D9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D9	HGNC	protein_coding	OTTHUMT00000364806.1	-	0.00	65	0	T	NM_015130		141590791	-1	tier1	-	no_errors	ENST00000442267	ensembl	human	known	74_37	silent	37.93	36	22	SNP	0.994	C
TFIP11	24144	genome.wustl.edu	37	22	26906094	26906094	+	Missense_Mutation	SNP	C	C	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr22:26906094C>A	ENST00000407690.1	-	4	428	c.145G>T	c.(145-147)Gcc>Tcc	p.A49S	CTA-445C9.14_ENST00000566814.1_RNA|CTA-445C9.14_ENST00000565764.1_RNA|TFIP11_ENST00000405938.1_Missense_Mutation_p.A49S|TFIP11_ENST00000407431.1_Missense_Mutation_p.A49S|TFIP11_ENST00000407148.1_Missense_Mutation_p.A49S	NM_012143.2	NP_036275.1	Q9UBB9	TFP11_HUMAN	tuftelin interacting protein 11	49	Required for interaction with DHX15.				biomineral tissue development (GO:0031214)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|spliceosomal complex disassembly (GO:0000390)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|proteinaceous extracellular matrix (GO:0005578)|spliceosomal complex (GO:0005681)|U2-type post-mRNA release spliceosomal complex (GO:0071008)	DNA binding (GO:0003677)			breast(1)|endometrium(5)|kidney(2)|large_intestine(5)|liver(1)|lung(7)|prostate(2)|skin(1)|urinary_tract(1)	25						CCGTAGGTGGCTTCTTCCTTG	0.562																																																	0													168.0	144.0	152.0					22																	26906094		2203	4300	6503	SO:0001583	missense	0			AL050258	CCDS13838.1	22q12.1	2013-01-28			ENSG00000100109	ENSG00000100109		"""G patch domain containing"""	17165	protein-coding gene	gene with protein product		612747				10806191, 11230166	Standard	NM_012143		Approved	TIP39, DKFZP434B194, Spp382	uc003acs.2	Q9UBB9	OTTHUMG00000150883	ENST00000407690.1:c.145G>T	22.37:g.26906094C>A	ENSP00000384421:p.Ala49Ser		O95908|Q20WL0|Q5H8V8|Q9UGV7|Q9Y2Q8	Missense_Mutation	SNP	pfam_GCFC_dom,pfam_TIP_N,pfam_G_patch_dom,smart_G_patch_dom,pfscan_G_patch_dom	p.A49S	ENST00000407690.1	37	c.145	CCDS13838.1	22	.	.	.	.	.	.	.	.	.	.	C	22.9	4.349301	0.82132	.	.	ENSG00000100109	ENST00000407690;ENST00000407431;ENST00000407148;ENST00000405938;ENST00000455080;ENST00000418876;ENST00000420242	T;T;T;T	0.50001	0.76;0.76;0.76;0.76	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.54319	0.1851	M	0.63428	1.95	0.80722	D	1	P	0.43938	0.822	P	0.46975	0.533	T	0.52403	-0.8580	10	0.37606	T	0.19	-33.3336	16.626	0.84970	0.0:1.0:0.0:0.0	.	49	Q9UBB9	TFP11_HUMAN	S	49	ENSP00000384421:A49S;ENSP00000383892:A49S;ENSP00000385861:A49S;ENSP00000384297:A49S	ENSP00000384297:A49S	A	-	1	0	TFIP11	25236094	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.127000	0.77210	2.592000	0.87571	0.650000	0.86243	GCC	TFIP11	-	pfam_TIP_N	ENSG00000100109		0.562	TFIP11-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TFIP11	HGNC	protein_coding	OTTHUMT00000320750.1	-	0.00	77	0	C	NM_001008697		26906094	-1	tier1	-	no_errors	ENST00000405938	ensembl	human	known	74_37	missense	19.30	46	11	SNP	1.000	A
TLR8	51311	genome.wustl.edu	37	X	12938288	12938288	+	Missense_Mutation	SNP	T	T	C			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chrX:12938288T>C	ENST00000218032.6	+	2	1216	c.1129T>C	c.(1129-1131)Tat>Cat	p.Y377H	TLR8_ENST00000311912.5_Missense_Mutation_p.Y395H	NM_138636.4	NP_619542.1	Q9NR97	TLR8_HUMAN	toll-like receptor 8	377					cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|immunoglobulin mediated immune response (GO:0016064)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|regulation of cytokine secretion (GO:0050707)|response to virus (GO:0009615)|toll-like receptor 8 signaling pathway (GO:0034158)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	endolysosome membrane (GO:0036020)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|drug binding (GO:0008144)|receptor activity (GO:0004872)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)			breast(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	50					Imiquimod(DB00724)	TTTAAGAGGTTATGTGTTCCA	0.363																																																	0													84.0	86.0	85.0					X																	12938288		2201	4300	6501	SO:0001583	missense	0			AF246971	CCDS14152.1, CCDS14153.1	Xp22	2009-11-23			ENSG00000101916	ENSG00000101916		"""CD molecules"""	15632	protein-coding gene	gene with protein product		300366				11022119	Standard	NM_138636		Approved	CD288	uc004cve.3	Q9NR97	OTTHUMG00000021145	ENST00000218032.6:c.1129T>C	X.37:g.12938288T>C	ENSP00000218032:p.Tyr377His		B3Y654|D1CS70|D1CS76|Q495P4|Q6UXL6|Q9NYG9	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_TIR_dom,superfamily_TIR_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_TIR_dom,pfscan_TIR_dom	p.Y377H	ENST00000218032.6	37	c.1129	CCDS14152.1	X	.	.	.	.	.	.	.	.	.	.	T	15.02	2.709737	0.48517	.	.	ENSG00000101916	ENST00000218032;ENST00000311912	T;T	0.30714	1.52;1.7	5.4	5.4	0.78164	.	0.000000	0.36200	N	0.002737	T	0.58864	0.2152	M	0.87827	2.91	0.36428	D	0.864758	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.72211	-0.4359	10	0.87932	D	0	.	10.7815	0.46379	0.0:0.0779:0.0:0.9221	.	377;395	Q9NR97;D1CS70	TLR8_HUMAN;.	H	377;395	ENSP00000218032:Y377H;ENSP00000312082:Y395H	ENSP00000218032:Y377H	Y	+	1	0	TLR8	12848209	1.000000	0.71417	1.000000	0.80357	0.656000	0.38851	6.170000	0.71920	1.922000	0.55676	0.486000	0.48141	TAT	TLR8	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000101916		0.363	TLR8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR8	HGNC	protein_coding	OTTHUMT00000055784.2	-	0.00	103	0	T	NM_016610		12938288	+1	tier1	-	no_errors	ENST00000218032	ensembl	human	known	74_37	missense	65.45	19	36	SNP	1.000	C
TM7SF3	51768	genome.wustl.edu	37	12	27133537	27133537	+	Missense_Mutation	SNP	T	T	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr12:27133537T>A	ENST00000343028.4	-	8	1223	c.998A>T	c.(997-999)tAt>tTt	p.Y333F	RP11-421F16.3_ENST00000500632.1_RNA|TM7SF3_ENST00000542667.1_Intron	NM_016551.2	NP_057635.1	Q9NS93	TM7S3_HUMAN	transmembrane 7 superfamily member 3	333						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	18	Colorectal(261;0.0847)					AATCAGTATATAAAAGAAGAA	0.343																																																	0													81.0	82.0	81.0					12																	27133537		2202	4299	6501	SO:0001583	missense	0			AB032470	CCDS8710.1	12q11-q12	2012-08-10			ENSG00000064115	ENSG00000064115			23049	protein-coding gene	gene with protein product		605181				10828615	Standard	NM_016551		Approved		uc010sjl.2	Q9NS93	OTTHUMG00000169243	ENST00000343028.4:c.998A>T	12.37:g.27133537T>A	ENSP00000342322:p.Tyr333Phe		B3KMZ3|Q9NUS4	Missense_Mutation	SNP	NULL	p.Y333F	ENST00000343028.4	37	c.998	CCDS8710.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	8.880|8.880	0.951290|0.951290	0.18431|0.18431	.|.	.|.	ENSG00000064115|ENSG00000064115	ENST00000545303|ENST00000343028;ENST00000545344;ENST00000537406;ENST00000543655;ENST00000535819	.|T;T;T	.|0.43688	.|1.51;0.94;0.94	5.09|5.09	3.86|3.86	0.44501|0.44501	.|.	.|0.051586	.|0.85682	.|D	.|0.000000	T|T	0.20981|0.20981	0.0505|0.0505	N|N	0.17082|0.17082	0.46|0.46	0.31869|0.31869	N|N	0.619949|0.619949	.|B	.|0.12013	.|0.005	.|B	.|0.15484	.|0.013	T|T	0.19549|0.19549	-1.0302|-1.0302	5|10	.|0.06236	.|T	.|0.91	-17.5044|-17.5044	8.4685|8.4685	0.32971|0.32971	0.3514:0.0:0.0:0.6486|0.3514:0.0:0.0:0.6486	.|.	.|333	.|Q9NS93	.|TM7S3_HUMAN	L|F	114|333;47;2;124;124	.|ENSP00000342322:Y333F;ENSP00000441924:Y124F;ENSP00000445156:Y124F	.|ENSP00000342322:Y333F	I|Y	-|-	1|2	0|0	TM7SF3|TM7SF3	27024804|27024804	0.998000|0.998000	0.40836|0.40836	0.900000|0.900000	0.35374|0.35374	0.866000|0.866000	0.49608|0.49608	2.590000|2.590000	0.46154|0.46154	2.048000|2.048000	0.60808|0.60808	0.482000|0.482000	0.46254|0.46254	ATA|TAT	TM7SF3	-	NULL	ENSG00000064115		0.343	TM7SF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TM7SF3	HGNC	protein_coding	OTTHUMT00000403033.1	-	0.00	65	0	T	NM_016551		27133537	-1	tier1	-	no_errors	ENST00000343028	ensembl	human	known	74_37	missense	41.67	21	15	SNP	0.970	A
TMED1	11018	genome.wustl.edu	37	19	10945729	10945729	+	Nonsense_Mutation	SNP	C	C	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr19:10945729C>A	ENST00000214869.2	-	3	444	c.346G>T	c.(346-348)Gag>Tag	p.E116*	C19orf38_ENST00000592854.1_5'Flank|TMED1_ENST00000591695.1_Intron|TMED1_ENST00000588289.1_5'UTR	NM_006858.2	NP_006849.1	Q13445	TMED1_HUMAN	transmembrane emp24 protein transport domain containing 1	116	GOLD. {ECO:0000255|PROSITE- ProRule:PRU00096}.				cell-cell signaling (GO:0007267)|protein transport (GO:0015031)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)	p.E116K(1)		breast(1)|central_nervous_system(2)|lung(2)|ovary(3)|prostate(1)|skin(1)	10						ACCAGCTTCTCGGAGATGGTG	0.577																																																	1	Substitution - Missense(1)	skin(1)											110.0	108.0	109.0					19																	10945729		2203	4300	6503	SO:0001587	stop_gained	0			U41804	CCDS12249.1	19p13.2	2008-02-05	2005-08-26			ENSG00000099203			17291	protein-coding gene	gene with protein product		605395	"""transmembrane emp24 domain containing 1"""			11466339, 8621446	Standard	NM_006858		Approved	ST2L, MGC1270, IL1RL1LG, Il1rl1l	uc002mpy.3	Q13445		ENST00000214869.2:c.346G>T	19.37:g.10945729C>A	ENSP00000214869:p.Glu116*			Nonsense_Mutation	SNP	pfam_GOLD,superfamily_GOLD,pfscan_GOLD	p.E116*	ENST00000214869.2	37	c.346	CCDS12249.1	19	.	.	.	.	.	.	.	.	.	.	C	38	6.719944	0.97788	.	.	ENSG00000099203	ENST00000214869	.	.	.	5.15	5.15	0.70609	.	0.048839	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	-35.2188	17.4077	0.87477	0.0:1.0:0.0:0.0	.	.	.	.	X	116	.	ENSP00000214869:E116X	E	-	1	0	TMED1	10806729	1.000000	0.71417	0.881000	0.34555	0.977000	0.68977	7.551000	0.82182	2.407000	0.81776	0.561000	0.74099	GAG	TMED1	-	pfam_GOLD,superfamily_GOLD,pfscan_GOLD	ENSG00000099203		0.577	TMED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMED1	HGNC	protein_coding	OTTHUMT00000452614.1		0.00	67	0	C	NM_006858		10945729	-1			no_errors	ENST00000214869	ensembl	human	known	74_37	nonsense	5.26	35	2	SNP	1.000	A
TMEM257	9142	genome.wustl.edu	37	X	144909318	144909318	+	Missense_Mutation	SNP	C	C	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chrX:144909318C>A	ENST00000408967.2	+	1	391	c.123C>A	c.(121-123)ttC>ttA	p.F41L		NM_004709.2	NP_004700.1	O96002	TM257_HUMAN	transmembrane protein 257	41						integral component of membrane (GO:0016021)											TGACTATATTCTGTTTTGCTT	0.279																																																	0													82.0	80.0	81.0					X																	144909318		2203	4300	6503	SO:0001583	missense	0			Y08902	CCDS14681.1	Xq27.3	2012-12-03	2012-12-03	2012-12-03	ENSG00000221870	ENSG00000221870			2562	protein-coding gene	gene with protein product		300565	"""chromosome X open reading frame 1"""	CXorf1		9881668	Standard	NM_004709		Approved		uc004fch.3	O96002	OTTHUMG00000159605	ENST00000408967.2:c.123C>A	X.37:g.144909318C>A	ENSP00000386149:p.Phe41Leu		Q14CW0	Missense_Mutation	SNP	NULL	p.F41L	ENST00000408967.2	37	c.123	CCDS14681.1	X	.	.	.	.	.	.	.	.	.	.	C	0.421	-0.908203	0.02434	.	.	ENSG00000221870	ENST00000408967	T	0.52057	0.68	3.92	-2.15	0.07102	.	.	.	.	.	T	0.21062	0.0507	N	0.08118	0	0.09310	N	1	B	0.13594	0.008	B	0.15484	0.013	T	0.18085	-1.0348	9	0.87932	D	0	.	0.4347	0.00477	0.1932:0.2072:0.1898:0.4097	.	41	O96002	CX001_HUMAN	L	41	ENSP00000386149:F41L	ENSP00000386149:F41L	F	+	3	2	CXorf1	144717010	0.208000	0.23494	0.000000	0.03702	0.112000	0.19704	1.392000	0.34486	-0.459000	0.07013	0.506000	0.49869	TTC	TMEM257	-	NULL	ENSG00000221870		0.279	TMEM257-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM257	HGNC	protein_coding	OTTHUMT00000356465.1	-	0.00	74	0	C	NM_004709		144909318	+1	tier1	-	no_errors	ENST00000408967	ensembl	human	known	74_37	missense	81.58	7	31	SNP	0.000	A
TNFRSF11B	4982	genome.wustl.edu	37	8	119941094	119941094	+	Missense_Mutation	SNP	G	G	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr8:119941094G>T	ENST00000297350.4	-	3	853	c.475C>A	c.(475-477)Ccc>Acc	p.P159T		NM_002546.3	NP_002537.3	O00300	TR11B_HUMAN	tumor necrosis factor receptor superfamily, member 11b	159					apoptotic process (GO:0006915)|extracellular matrix organization (GO:0030198)|negative regulation of bone resorption (GO:0045779)|negative regulation of odontogenesis of dentin-containing tooth (GO:0042489)|response to arsenic-containing substance (GO:0046685)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to magnesium ion (GO:0032026)|response to nutrient (GO:0007584)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	cytokine activity (GO:0005125)|receptor activity (GO:0004872)			breast(1)|central_nervous_system(3)|endometrium(4)|large_intestine(6)|lung(7)|prostate(3)|skin(1)	25	all_cancers(13;3.71e-26)|Lung NSC(37;1.69e-07)|Ovarian(258;0.018)|all_neural(195;0.0592)|Hepatocellular(40;0.234)		STAD - Stomach adenocarcinoma(47;0.00193)			TTTCTACAGGGTGCTTTAGAT	0.413																																																	0													210.0	190.0	197.0					8																	119941094		2203	4300	6503	SO:0001583	missense	0			U94332	CCDS6326.1	8q24	2008-07-31	2008-07-31		ENSG00000164761	ENSG00000164761		"""Tumor necrosis factor receptor superfamily"""	11909	protein-coding gene	gene with protein product		602643	"""osteoprotegerin"""	OPG		9108485	Standard	NM_002546		Approved	OCIF, TR1	uc003yon.4	O00300	OTTHUMG00000164969	ENST00000297350.4:c.475C>A	8.37:g.119941094G>T	ENSP00000297350:p.Pro159Thr		B2R9A8|O60236|Q53FX6|Q9UHP4	Missense_Mutation	SNP	pirsf_TNFR_11B,pfam_TNFR/NGFR_Cys_rich_reg,pfam_Death_domain,superfamily_DEATH-like_dom,smart_TNFR/NGFR_Cys_rich_reg,smart_Death_domain,prints_TNFR_11B,prints_TNFR_11,pfscan_TNFR/NGFR_Cys_rich_reg	p.P159T	ENST00000297350.4	37	c.475	CCDS6326.1	8	.	.	.	.	.	.	.	.	.	.	G	8.439	0.850456	0.17034	.	.	ENSG00000164761	ENST00000297350	T	0.60548	0.18	5.73	4.84	0.62591	TNFR/CD27/30/40/95 cysteine-rich region (1);	0.406640	0.27600	N	0.018658	T	0.44726	0.1307	L	0.36672	1.1	0.29230	N	0.873317	B	0.20164	0.042	B	0.15870	0.014	T	0.36114	-0.9761	9	.	.	.	-19.1274	10.4033	0.44241	0.0:0.3351:0.5397:0.1252	.	159	O00300	TR11B_HUMAN	T	159	ENSP00000297350:P159T	.	P	-	1	0	TNFRSF11B	120010275	0.276000	0.24211	0.999000	0.59377	0.998000	0.95712	0.316000	0.19469	1.388000	0.46506	0.650000	0.86243	CCC	TNFRSF11B	-	pirsf_TNFR_11B,smart_TNFR/NGFR_Cys_rich_reg	ENSG00000164761		0.413	TNFRSF11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFRSF11B	HGNC	protein_coding	OTTHUMT00000381220.1		0.00	135	0	G			119941094	-1			no_errors	ENST00000297350	ensembl	human	known	74_37	missense	6.15	61	4	SNP	0.869	T
TOP2B	7155	genome.wustl.edu	37	3	25674279	25674279	+	Missense_Mutation	SNP	G	G	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr3:25674279G>A	ENST00000264331.4	-	9	1032	c.1033C>T	c.(1033-1035)Cgg>Tgg	p.R345W	TOP2B_ENST00000435706.2_Missense_Mutation_p.R340W	NM_001068.2	NP_001059.2	Q02880	TOP2B_HUMAN	topoisomerase (DNA) II beta 180kDa	345					ATP catabolic process (GO:0006200)|axonogenesis (GO:0007409)|DNA topological change (GO:0006265)|DNA unwinding involved in DNA replication (GO:0006268)|forebrain development (GO:0030900)|mitotic DNA integrity checkpoint (GO:0044774)|mitotic recombination (GO:0006312)|neuron migration (GO:0001764)|resolution of meiotic recombination intermediates (GO:0000712)|sister chromatid segregation (GO:0000819)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|DNA topoisomerase complex (ATP-hydrolyzing) (GO:0009330)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein kinase C binding (GO:0005080)			breast(2)|endometrium(5)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|skin(2)|stomach(1)	36					Dactinomycin(DB00970)|Daunorubicin(DB00694)|Dexrazoxane(DB00380)|Etoposide(DB00773)	TCCACGTGCCGTCCACCCTAA	0.313																																																	0													128.0	122.0	124.0					3																	25674279		1840	4078	5918	SO:0001583	missense	0			X68060	CCDS46776.1	3p24.2	2012-08-30	2002-08-29		ENSG00000077097	ENSG00000077097	5.99.1.3		11990	protein-coding gene	gene with protein product		126431	"""topoisomerase (DNA) II beta (180kD)"""			1309226, 1333583	Standard	NM_001068		Approved		uc003cdj.3	Q02880	OTTHUMG00000155596	ENST00000264331.4:c.1033C>T	3.37:g.25674279G>A	ENSP00000264331:p.Arg345Trp		Q13600|Q9UMG8|Q9UQP8	Missense_Mutation	SNP	pfam_Topo_IIA_A/C,pfam_Topo_IIA_bsu_dom2,pfam_DTHCT,pfam_HATPase_ATP-bd,superfamily_Topo_IIA_like_dom,superfamily_HATPase_ATP-bd,superfamily_Ribosomal_S5_D2-typ_fold,smart_Topo_IIA,smart_Topo_IIA_A/C,prints_TopoII_euk,prints_Topo_IIA,prints_Transcrpt_fac_NFYB/HAP3	p.R345W	ENST00000264331.4	37	c.1033		3	.	.	.	.	.	.	.	.	.	.	G	19.54	3.846254	0.71603	.	.	ENSG00000077097	ENST00000435706;ENST00000264331;ENST00000424225	T;T	0.46063	0.88;0.88	5.4	4.44	0.53790	.	0.000000	0.85682	D	0.000000	T	0.69557	0.3124	M	0.91300	3.195	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.76645	-0.2883	10	0.87932	D	0	-15.6821	12.8782	0.58001	0.0:0.0:0.7159:0.2841	.	340	Q02880-2	.	W	340;345;340	ENSP00000396704:R340W;ENSP00000264331:R345W	ENSP00000264331:R345W	R	-	1	2	TOP2B	25649283	1.000000	0.71417	0.996000	0.52242	0.994000	0.84299	3.724000	0.54962	2.513000	0.84729	0.650000	0.86243	CGG	TOP2B	-	pfam_Topo_IIA_bsu_dom2,superfamily_Ribosomal_S5_D2-typ_fold,smart_Topo_IIA,prints_Topo_IIA	ENSG00000077097		0.313	TOP2B-201	KNOWN	basic|appris_candidate_longest	protein_coding	TOP2B	HGNC	protein_coding		-	0.00	105	0	G			25674279	-1	tier1	-	no_errors	ENST00000264331	ensembl	human	known	74_37	missense	6.67	56	4	SNP	1.000	A
TP53	7157	genome.wustl.edu	37	17	7579369	7579369	+	Missense_Mutation	SNP	G	G	C			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr17:7579369G>C	ENST00000269305.4	-	4	507	c.318C>G	c.(316-318)agC>agG	p.S106R	TP53_ENST00000455263.2_Missense_Mutation_p.S106R|TP53_ENST00000359597.4_Missense_Mutation_p.S106R|TP53_ENST00000445888.2_Missense_Mutation_p.S106R|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Missense_Mutation_p.S106R|TP53_ENST00000413465.2_Missense_Mutation_p.S106R	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	106	Interaction with HIPK1. {ECO:0000250}.|Interaction with WWOX.|Required for interaction with ZNF385A.		S -> G (in a sporadic cancer; somatic mutation).|S -> R (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.Q100fs*37(3)|p.G59fs*23(3)|p.S106R(3)|p.V73fs*9(1)|p.S106_Y107delSY(1)|p.G105_T125del21(1)|p.Y107fs*44(1)|p.W91fs*13(1)|p.Y103_G112>C(1)|p.P13fs*18(1)|p.S33fs*23(1)|p.Y103_L111>L(1)|p.Y103fs*15(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGAAACCGTAGCTGCCCTGGT	0.617		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	27	Deletion - Frameshift(12)|Whole gene deletion(8)|Substitution - Missense(3)|Complex - deletion inframe(2)|Deletion - In frame(2)	upper_aerodigestive_tract(5)|bone(4)|large_intestine(3)|ovary(3)|breast(3)|central_nervous_system(2)|lung(2)|liver(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|oesophagus(1)	GRCh37	CM013441	TP53	M							58.0	57.0	57.0					17																	7579369		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.318C>G	17.37:g.7579369G>C	ENSP00000269305:p.Ser106Arg		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.S106R	ENST00000269305.4	37	c.318	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	9.949	1.219579	0.22373	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000508793;ENST00000503591	D;D;D;D;D;D;D;D	0.99760	-6.66;-6.66;-6.66;-6.66;-6.66;-6.66;-6.66;-6.66	4.75	2.77	0.32553	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	1.175280	0.05775	N	0.607434	D	0.99133	0.9701	L	0.38175	1.15	0.28839	N	0.896688	B;P;B;B;B;B;B	0.34615	0.305;0.459;0.042;0.005;0.086;0.029;0.313	B;B;B;B;B;B;B	0.43103	0.107;0.408;0.117;0.007;0.186;0.186;0.061	D	0.99992	1.4503	10	0.40728	T	0.16	-0.4975	9.0942	0.36629	0.1857:0.0:0.8143:0.0	.	67;106;106;106;106;106;106	B4E095;E7EMR6;P04637-2;P04637-3;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	R	106	ENSP00000410739:S106R;ENSP00000352610:S106R;ENSP00000269305:S106R;ENSP00000398846:S106R;ENSP00000391127:S106R;ENSP00000391478:S106R;ENSP00000424104:S106R;ENSP00000426252:S106R	ENSP00000269305:S106R	S	-	3	2	TP53	7520094	0.247000	0.23920	0.636000	0.29352	0.532000	0.34746	0.437000	0.21543	1.364000	0.46038	0.655000	0.94253	AGC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000141510		0.617	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	116	0	G	NM_000546		7579369	-1	tier1	-	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	68.54	28	61	SNP	0.564	C
TRIAP1	51499	genome.wustl.edu	37	12	120882537	120882537	+	3'UTR	SNP	A	A	C			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr12:120882537A>C	ENST00000546954.1	-	0	408				AL021546.6_ENST00000551806.1_Intron|GATC_ENST00000551765.1_5'Flank|TRIAP1_ENST00000302432.3_5'UTR	NM_016399.2	NP_057483.1	O43715	TRIA1_HUMAN	TP53 regulated inhibitor of apoptosis 1						cellular response to UV (GO:0034644)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|phospholipid transport (GO:0015914)|positive regulation of phospholipid transport (GO:2001140)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of membrane lipid distribution (GO:0097035)	mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|protein complex (GO:0043234)	p53 binding (GO:0002039)					all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CTGAGAGGAAAACATCGAAGG	0.373																																																	0																																										SO:0001624	3_prime_UTR_variant	0				CCDS9198.1	12q24.31	2012-10-15			ENSG00000170855	ENSG00000170855			26937	protein-coding gene	gene with protein product	"""p53-inducible cell-survival factor"", ""mitochondrial distribution and morphology 35 homolog (S. cerevisiae)"""	614943				11042152, 15735003	Standard	NM_016399		Approved	P53CSV, WF-1, HSPC132, p53CSV, MDM35	uc001tyg.3	O43715	OTTHUMG00000047787	ENST00000546954.1:c.*138T>G	12.37:g.120882537A>C			B2R4Z7|Q5RKS5|Q6LCA7	RNA	SNP	-	NULL	ENST00000546954.1	37	NULL	CCDS9198.1	12																																																																																			TRIAP1	-	-	ENSG00000170855		0.373	TRIAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIAP1	HGNC	protein_coding	OTTHUMT00000108980.3	-	0.00	43	0	A	NM_016399		120882537	-1	tier1	-	no_errors	ENST00000302432	ensembl	human	putative	74_37	rna	66.67	5	10	SNP	0.001	C
TRIAP1	51499	genome.wustl.edu	37	12	120882648	120882648	+	3'UTR	SNP	C	C	T	rs564425873		TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr12:120882648C>T	ENST00000546954.1	-	0	297				AL021546.6_ENST00000551806.1_Intron|GATC_ENST00000551765.1_5'Flank|TRIAP1_ENST00000302432.3_5'UTR	NM_016399.2	NP_057483.1	O43715	TRIA1_HUMAN	TP53 regulated inhibitor of apoptosis 1						cellular response to UV (GO:0034644)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|phospholipid transport (GO:0015914)|positive regulation of phospholipid transport (GO:2001140)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of membrane lipid distribution (GO:0097035)	mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|protein complex (GO:0043234)	p53 binding (GO:0002039)					all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TCTGGACTTGCGAAATCCTTC	0.413													C|||	1	0.000199681	0.0	0.0	5008	,	,		19625	0.001		0.0	False		,,,				2504	0.0																0													154.0	159.0	157.0					12																	120882648		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0				CCDS9198.1	12q24.31	2012-10-15			ENSG00000170855	ENSG00000170855			26937	protein-coding gene	gene with protein product	"""p53-inducible cell-survival factor"", ""mitochondrial distribution and morphology 35 homolog (S. cerevisiae)"""	614943				11042152, 15735003	Standard	NM_016399		Approved	P53CSV, WF-1, HSPC132, p53CSV, MDM35	uc001tyg.3	O43715	OTTHUMG00000047787	ENST00000546954.1:c.*27G>A	12.37:g.120882648C>T			B2R4Z7|Q5RKS5|Q6LCA7	RNA	SNP	-	NULL	ENST00000546954.1	37	NULL	CCDS9198.1	12																																																																																			TRIAP1	-	-	ENSG00000170855		0.413	TRIAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIAP1	HGNC	protein_coding	OTTHUMT00000108980.3	-	0.00	72	0	C	NM_016399		120882648	-1	tier1	-	no_errors	ENST00000302432	ensembl	human	putative	74_37	rna	10.53	34	4	SNP	0.006	T
TRIP10	9322	genome.wustl.edu	37	19	6750388	6750388	+	Missense_Mutation	SNP	C	C	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr19:6750388C>T	ENST00000313244.9	+	13	1516	c.1481C>T	c.(1480-1482)gCt>gTt	p.A494V	TRIP10_ENST00000600428.1_Missense_Mutation_p.A330V|TRIP10_ENST00000596758.1_Missense_Mutation_p.A438V|TRIP10_ENST00000313285.8_Missense_Mutation_p.A438V|CTD-3128G10.6_ENST00000594056.1_RNA			Q15642	CIP4_HUMAN	thyroid hormone receptor interactor 10	494	Interaction with CDC42.|Interaction with DNM2 and WASL. {ECO:0000250}.|Interaction with PDE6G. {ECO:0000250}.|Required for interaction with FASLG and localization to lysosomes.			ARPPDPPASAPPD -> KHPIICRLIHFSN (in Ref. 10; AAC41729). {ECO:0000305}.	actin cytoskeleton organization (GO:0030036)|cell communication (GO:0007154)|endocytosis (GO:0006897)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)			NS(1)|breast(1)|endometrium(1)|large_intestine(1)|liver(2)|lung(7)|ovary(1)|prostate(1)|urinary_tract(1)	16						GACCCCCCCGCTAGCGCCCCG	0.677																																																	0													41.0	51.0	48.0					19																	6750388		2203	4300	6503	SO:0001583	missense	0			AB072596	CCDS12172.1, CCDS74271.1, CCDS74272.1	19p13.3	2008-02-05			ENSG00000125733	ENSG00000125733			12304	protein-coding gene	gene with protein product	"""Cdc42-interacting protein"""	604504	"""salt tolerator"""	STOT		7776974, 9210375, 11294612	Standard	XM_005259683		Approved	STP, HSTP, CIP4	uc002mfr.3	Q15642	OTTHUMG00000150255	ENST00000313244.9:c.1481C>T	19.37:g.6750388C>T	ENSP00000320117:p.Ala494Val		B2R8A6|B7WP22|D6W645|O15184|Q53G22|Q5TZN1|Q6FI24|Q8NFL1|Q8TCY1|Q8TDX3|Q96RJ1	Missense_Mutation	SNP	pfam_FCH_dom,pfam_SH3_domain,superfamily_SH3_domain,smart_FCH_dom,smart_SH3_domain,pfscan_FCH_dom,pfscan_SH3_domain	p.A494V	ENST00000313244.9	37	c.1481		19	.	.	.	.	.	.	.	.	.	.	C	0.197	-1.047914	0.01981	.	.	ENSG00000125733	ENST00000313285;ENST00000313244;ENST00000420690	T;T	0.74209	-0.82;-0.82	4.42	2.26	0.28386	.	1.169250	0.06354	N	0.710462	T	0.55273	0.1910	N	0.12182	0.205	0.09310	N	1	B;B;B	0.27971	0.02;0.191;0.196	B;B;B	0.29785	0.036;0.049;0.107	T	0.45131	-0.9282	10	0.19147	T	0.46	-7.4158	5.6649	0.17690	0.0:0.6909:0.2007:0.1084	.	438;494;438	G5E9U1;Q15642;Q15642-2	.;CIP4_HUMAN;.	V	438;494;438	ENSP00000320493:A438V;ENSP00000320117:A494V	ENSP00000320117:A494V	A	+	2	0	TRIP10	6701388	0.008000	0.16893	0.164000	0.22755	0.017000	0.09413	0.935000	0.28924	0.479000	0.27511	0.313000	0.20887	GCT	TRIP10	-	NULL	ENSG00000125733		0.677	TRIP10-003	KNOWN	basic	protein_coding	TRIP10	HGNC	protein_coding	OTTHUMT00000317129.2	-	0.00	95	0	C			6750388	+1	tier1	-	no_errors	ENST00000313244	ensembl	human	known	74_37	missense	23.44	49	15	SNP	0.002	T
TRPC4AP	26133	genome.wustl.edu	37	20	33632411	33632411	+	Silent	SNP	T	T	C			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr20:33632411T>C	ENST00000252015.2	-	7	851	c.762A>G	c.(760-762)tcA>tcG	p.S254S	TRPC4AP_ENST00000432634.2_Silent_p.S215S|TRPC4AP_ENST00000451813.2_Silent_p.S254S			Q8TEL6	TP4AP_HUMAN	transient receptor potential cation channel, subfamily C, member 4 associated protein	254	Interaction with TNFRSF1A. {ECO:0000250}.				calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|protein ubiquitination (GO:0016567)|transmembrane transport (GO:0055085)|ubiquitin-dependent protein catabolic process (GO:0006511)	Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|plasma membrane (GO:0005886)	phosphatase binding (GO:0019902)			breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|skin(1)|stomach(1)|urinary_tract(1)	32			BRCA - Breast invasive adenocarcinoma(18;0.00936)			TATCCATCTCTGAAATGGTGA	0.463																																																	0													135.0	131.0	132.0					20																	33632411		2203	4300	6503	SO:0001819	synonymous_variant	0			AF055022	CCDS13246.1, CCDS46591.1	20q11.23	2014-06-13	2003-10-06	2003-10-08	ENSG00000100991	ENSG00000100991			16181	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 158"""	608430	"""chromosome 20 open reading frame 188"""	C20orf188			Standard	NM_015638		Approved	DKFZP727M231, DKFZp586C1223, dJ756N5.2, TRRP4AP, PPP1R158	uc002xbk.3	Q8TEL6	OTTHUMG00000032319	ENST00000252015.2:c.762A>G	20.37:g.33632411T>C			E1P5Q0|E1P5Q1|Q96H82|Q9BVB8|Q9H429|Q9UFS6	Silent	SNP	pfam_DUF3689	p.S254	ENST00000252015.2	37	c.762	CCDS13246.1	20																																																																																			TRPC4AP	-	NULL	ENSG00000100991		0.463	TRPC4AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPC4AP	HGNC	protein_coding	OTTHUMT00000078832.2	-	0.00	53	0	T	NM_015638		33632411	-1	tier1	-	no_errors	ENST00000252015	ensembl	human	known	74_37	silent	10.26	35	4	SNP	0.587	C
TTC13	79573	genome.wustl.edu	37	1	231061301	231061301	+	Missense_Mutation	SNP	T	T	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr1:231061301T>A	ENST00000366661.4	-	13	1557	c.1550A>T	c.(1549-1551)gAa>gTa	p.E517V	TTC13_ENST00000366662.4_Missense_Mutation_p.E464V|TTC13_ENST00000414259.1_Missense_Mutation_p.E464V	NM_024525.4	NP_078801.3	Q8NBP0	TTC13_HUMAN	tetratricopeptide repeat domain 13	517										central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(9)|lung(16)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	39	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.167)		COAD - Colon adenocarcinoma(196;0.243)		ACCAGGTGTTTCATATTGCAT	0.418																																																	0													128.0	123.0	125.0					1																	231061301		2203	4300	6503	SO:0001583	missense	0				CCDS1588.1, CCDS44332.1, CCDS44332.2	1q42.2	2013-01-10			ENSG00000143643	ENSG00000143643		"""Tetratricopeptide (TTC) repeat domain containing"""	26204	protein-coding gene	gene with protein product							Standard	NM_024525		Approved	FLJ22584	uc001huf.4	Q8NBP0	OTTHUMG00000037788	ENST00000366661.4:c.1550A>T	1.37:g.231061301T>A	ENSP00000355621:p.Glu517Val		B1AQI1|B1AQI2|Q8IVP8|Q8NBI0|Q8ND20	Missense_Mutation	SNP	pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.E517V	ENST00000366661.4	37	c.1550	CCDS1588.1	1	.	.	.	.	.	.	.	.	.	.	T	27.1	4.799429	0.90538	.	.	ENSG00000143643	ENST00000366661;ENST00000366662;ENST00000414259	T;T;T	0.32272	1.46;1.46;1.46	5.85	5.85	0.93711	.	0.044558	0.85682	D	0.000000	T	0.30479	0.0766	N	0.22421	0.69	0.80722	D	1	P;D;P;P	0.60575	0.818;0.988;0.763;0.947	B;P;P;P	0.48114	0.319;0.543;0.463;0.567	T	0.07539	-1.0767	10	0.72032	D	0.01	-28.309	16.2355	0.82371	0.0:0.0:0.0:1.0	.	442;464;464;517	Q69YR0;E9PGV4;Q8NBP0-2;Q8NBP0	.;.;.;TTC13_HUMAN	V	517;464;464	ENSP00000355621:E517V;ENSP00000355622:E464V;ENSP00000416631:E464V	ENSP00000355621:E517V	E	-	2	0	TTC13	229127924	1.000000	0.71417	0.992000	0.48379	0.996000	0.88848	8.040000	0.89188	2.238000	0.73509	0.533000	0.62120	GAA	TTC13	-	NULL	ENSG00000143643		0.418	TTC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC13	HGNC	protein_coding	OTTHUMT00000092229.2	-	0.00	82	0	T	NM_024525		231061301	-1	tier1	-	no_errors	ENST00000366661	ensembl	human	known	74_37	missense	6.35	59	4	SNP	1.000	A
TTC29	83894	genome.wustl.edu	37	4	147795959	147795959	+	Silent	SNP	A	A	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr4:147795959A>T	ENST00000325106.4	-	7	934	c.708T>A	c.(706-708)acT>acA	p.T236T	TTC29_ENST00000513335.1_Silent_p.T262T|TTC29_ENST00000398886.4_Silent_p.T262T	NM_031956.2	NP_114162.2	Q8NA56	TTC29_HUMAN	tetratricopeptide repeat domain 29	236										breast(2)|cervix(2)|endometrium(3)|kidney(4)|large_intestine(6)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	26	all_hematologic(180;0.151)					GTAATCTGTAAGTCCTCAGGA	0.423																																																	0													72.0	67.0	68.0					4																	147795959		1823	4088	5911	SO:0001819	synonymous_variant	0			AF345910	CCDS47141.1, CCDS75200.1	4q31.23	2013-01-11				ENSG00000137473		"""Tetratricopeptide (TTC) repeat domain containing"""	29936	protein-coding gene	gene with protein product						12477932	Standard	NM_031956		Approved	NYD-SP14	uc003ikw.4	Q8NA56		ENST00000325106.4:c.708T>A	4.37:g.147795959A>T			A4GU95|Q9BXB6	Silent	SNP	smart_TPR_repeat,pfscan_TPR-contain_dom	p.T262	ENST00000325106.4	37	c.786	CCDS47141.1	4																																																																																			TTC29	-	pfscan_TPR-contain_dom	ENSG00000137473		0.423	TTC29-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TTC29	HGNC	protein_coding		-	0.00	48	0	A	NM_031956		147795959	-1	tier1	-	no_errors	ENST00000398886	ensembl	human	known	74_37	silent	10.81	33	4	SNP	0.870	T
TTN	7273	genome.wustl.edu	37	2	179456146	179456146	+	Missense_Mutation	SNP	T	T	C			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr2:179456146T>C	ENST00000591111.1	-	254	55607	c.55383A>G	c.(55381-55383)atA>atG	p.I18461M	TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.I17534M|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.I20102M|TTN_ENST00000359218.5_Missense_Mutation_p.I11162M|TTN_ENST00000460472.2_Missense_Mutation_p.I11037M|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.I11229M|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000590743.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000591332.1_RNA			Q8WZ42	TITIN_HUMAN	titin	18461	Ig-like 106.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCACACCTCTTATAATAGCAG	0.438																																																	0													238.0	235.0	236.0					2																	179456146		1917	4129	6046	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.55383A>G	2.37:g.179456146T>C	ENSP00000465570:p.Ile18461Met		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.I17534M	ENST00000591111.1	37	c.52602		2	.	.	.	.	.	.	.	.	.	.	T	14.58	2.579190	0.46006	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.70749	-0.51;-0.51;-0.51;-0.51	6.1	-3.29	0.05017	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.52869	0.1761	L	0.41906	1.305	0.30503	N	0.770184	B;B;B;B	0.10296	0.003;0.003;0.003;0.001	B;B;B;B	0.14023	0.01;0.01;0.01;0.01	T	0.49380	-0.8946	9	0.87932	D	0	.	1.1331	0.01749	0.4594:0.1888:0.1174:0.2343	.	11037;11162;11229;18461	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	M	17534;11037;11229;11162;11035	ENSP00000343764:I17534M;ENSP00000434586:I11037M;ENSP00000340554:I11229M;ENSP00000352154:I11162M	ENSP00000340554:I11229M	I	-	3	3	TTN	179164392	1.000000	0.71417	0.975000	0.42487	0.986000	0.74619	1.256000	0.32921	-0.371000	0.08004	0.528000	0.53228	ATA	TTN	-	pfam_Ig_I-set,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000155657		0.438	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	48	0	T	NM_133378		179456146	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	11.11	40	5	SNP	1.000	C
TWF1	5756	genome.wustl.edu	37	12	44191174	44191174	+	Nonsense_Mutation	SNP	T	T	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr12:44191174T>A	ENST00000395510.2	-	7	820	c.691A>T	c.(691-693)Aag>Tag	p.K231*	TWF1_ENST00000548315.1_Nonsense_Mutation_p.K238*|TWF1_ENST00000552521.1_Nonsense_Mutation_p.K133*|TWF1_ENST00000325127.4_Nonsense_Mutation_p.K265*	NM_001242397.1|NM_002822.4	NP_001229326.1|NP_002813.3	Q12792	TWF1_HUMAN	twinfilin actin-binding protein 1	231	ADF-H 2. {ECO:0000255|PROSITE- ProRule:PRU00599}.				barbed-end actin filament capping (GO:0051016)|negative regulation of actin filament polymerization (GO:0030837)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of actin phosphorylation (GO:0043538)|sequestering of actin monomers (GO:0042989)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|myofibril (GO:0030016)|perinuclear region of cytoplasm (GO:0048471)|ruffle membrane (GO:0032587)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			endometrium(2)|large_intestine(6)|lung(4)|prostate(1)|stomach(1)	14	all_cancers(12;0.00125)	Lung NSC(34;0.0804)|all_lung(34;0.181)		GBM - Glioblastoma multiforme(48;0.0474)		GCTGAATCCTTGGGAATCCTC	0.313																																																	0													78.0	82.0	81.0					12																	44191174		2203	4296	6499	SO:0001587	stop_gained	0			U02680	CCDS31780.1, CCDS31780.2, CCDS55818.1	12q12	2013-04-25	2013-04-25	2006-11-13					9620	protein-coding gene	gene with protein product		610932	"""protein tyrosine kinase 9"", ""PTK9 protein tyrosine kinase 9"", ""twinfilin, actin-binding protein, homolog 1 (Drosophila)"""	PTK9		7507208	Standard	NM_002822		Approved	A6	uc001rob.3	Q12792		ENST00000395510.2:c.691A>T	12.37:g.44191174T>A	ENSP00000378886:p.Lys231*		A8K5A8|B3KXS6|B4DLX9|Q59G07|Q5U0B1|Q6FHJ1|Q6FHL6|Q6NUK9|Q86XL6|Q8TCD3	Nonsense_Mutation	SNP	pfam_Actin-bd_cofilin/tropomyosin,smart_Actin-bd_cofilin/tropomyosin	p.K265*	ENST00000395510.2	37	c.793	CCDS31780.2	12	.	.	.	.	.	.	.	.	.	.	T	28.1	4.891488	0.91889	.	.	ENSG00000151239	ENST00000552521;ENST00000395510;ENST00000325127;ENST00000548315;ENST00000546662	.	.	.	5.42	5.42	0.78866	.	0.043752	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.0783	15.4549	0.75305	0.0:0.0:0.0:1.0	.	.	.	.	X	133;231;265;238;269	.	ENSP00000321058:K265X	K	-	1	0	TWF1	42477441	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.698000	0.84413	2.064000	0.61679	0.482000	0.46254	AAG	TWF1	-	pfam_Actin-bd_cofilin/tropomyosin,smart_Actin-bd_cofilin/tropomyosin	ENSG00000151239		0.313	TWF1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	TWF1	HGNC	protein_coding	OTTHUMT00000403956.1	-	0.00	63	0	T	NM_002822		44191174	-1	tier1	-	no_errors	ENST00000325127	ensembl	human	known	74_37	nonsense	10.26	35	4	SNP	1.000	A
UNC5C	8633	genome.wustl.edu	37	4	96127865	96127865	+	Missense_Mutation	SNP	C	C	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr4:96127865C>T	ENST00000453304.1	-	11	2164	c.1816G>A	c.(1816-1818)Gtc>Atc	p.V606I		NM_003728.3	NP_003719.3	O95185	UNC5C_HUMAN	unc-5 homolog C (C. elegans)	606	ZU5. {ECO:0000255|PROSITE- ProRule:PRU00485}.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|brain development (GO:0007420)|positive regulation of apoptotic process (GO:0043065)|regulation of cell migration (GO:0030334)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(14)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	55		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)		ATAGTGAGGACGACTGGGCGG	0.592																																																	0													80.0	73.0	75.0					4																	96127865		2203	4300	6503	SO:0001583	missense	0			AF055634	CCDS3643.1	4q21-q23	2013-01-11	2001-11-28		ENSG00000182168	ENSG00000182168		"""Immunoglobulin superfamily / I-set domain containing"""	12569	protein-coding gene	gene with protein product		603610	"""unc5 (C.elegans homolog) c"""			9126742, 9782087	Standard	NM_003728		Approved		uc003hto.3	O95185	OTTHUMG00000130989	ENST00000453304.1:c.1816G>A	4.37:g.96127865C>T	ENSP00000406022:p.Val606Ile		Q8IUT0	Missense_Mutation	SNP	pfam_ZU5,pfam_Death_domain,pfam_Ig_I-set,pfam_Thrombospondin_1_rpt,superfamily_DEATH-like_dom,superfamily_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,smart_Thrombospondin_1_rpt,smart_ZU5,smart_Death_domain,pfscan_Thrombospondin_1_rpt,pfscan_ZU5,pfscan_Ig-like_dom	p.V606I	ENST00000453304.1	37	c.1816	CCDS3643.1	4	.	.	.	.	.	.	.	.	.	.	C	0.016	-1.539182	0.00942	.	.	ENSG00000182168	ENST00000453304;ENST00000331502;ENST00000513796	T;T	0.39056	1.1;1.1	5.28	1.27	0.21489	ZU5 (3);	0.225652	0.43919	N	0.000508	T	0.10723	0.0262	N	0.00642	-1.3	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.0	T	0.38499	-0.9658	10	0.02654	T	1	.	9.6193	0.39712	0.0:0.2748:0.0:0.7252	.	606;606	A8K385;O95185	.;UNC5C_HUMAN	I	606;565;625	ENSP00000406022:V606I;ENSP00000426924:V625I	ENSP00000328673:V565I	V	-	1	0	UNC5C	96346888	1.000000	0.71417	0.977000	0.42913	0.131000	0.20780	1.411000	0.34702	0.085000	0.17107	-0.440000	0.05779	GTC	UNC5C	-	pfam_ZU5,smart_ZU5,pfscan_ZU5	ENSG00000182168		0.592	UNC5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC5C	HGNC	protein_coding	OTTHUMT00000253607.1	-	0.00	82	0	C	NM_003728		96127865	-1	tier1	-	no_errors	ENST00000453304	ensembl	human	known	74_37	missense	32.14	19	9	SNP	0.988	T
USH2A	7399	genome.wustl.edu	37	1	216061896	216061896	+	Missense_Mutation	SNP	G	G	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr1:216061896G>A	ENST00000307340.3	-	41	8481	c.8095C>T	c.(8095-8097)Cgg>Tgg	p.R2699W	RP5-1111A8.3_ENST00000414995.1_RNA|USH2A_ENST00000366943.2_Missense_Mutation_p.R2699W	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	2699	Fibronectin type-III 13. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.R2699W(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		ATCAGTACCCGATATTCATAT	0.493										HNSCC(13;0.011)																																							1	Substitution - Missense(1)	lung(1)											90.0	89.0	89.0					1																	216061896		2203	4300	6503	SO:0001583	missense	0			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.8095C>T	1.37:g.216061896G>A	ENSP00000305941:p.Arg2699Trp		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.R2699W	ENST00000307340.3	37	c.8095	CCDS31025.1	1	.	.	.	.	.	.	.	.	.	.	G	14.77	2.633193	0.47049	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.60920	0.15;0.15	5.73	3.85	0.44370	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.38272	N	0.001747	T	0.68403	0.2997	L	0.60455	1.87	0.47308	D	0.999382	D	0.89917	1.0	D	0.97110	1.0	T	0.66988	-0.5784	10	0.54805	T	0.06	.	8.0986	0.30844	0.0754:0.0:0.5011:0.4234	.	2699	O75445	USH2A_HUMAN	W	2699	ENSP00000305941:R2699W;ENSP00000355910:R2699W	ENSP00000305941:R2699W	R	-	1	2	USH2A	214128519	1.000000	0.71417	0.077000	0.20336	0.266000	0.26442	1.366000	0.34193	0.754000	0.32968	0.655000	0.94253	CGG	USH2A	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000042781		0.493	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	HGNC	protein_coding	OTTHUMT00000128138.1		0.00	29	0	G	NM_007123		216061896	-1			no_errors	ENST00000366943	ensembl	human	known	74_37	missense	7.14	26	2	SNP	1.000	A
USP31	57478	genome.wustl.edu	37	16	23093847	23093847	+	Missense_Mutation	SNP	T	T	C			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr16:23093847T>C	ENST00000219689.7	-	12	1861	c.1862A>G	c.(1861-1863)cAc>cGc	p.H621R		NM_020718.3	NP_065769.3	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 31	272	DUSP 2. {ECO:0000255|PROSITE- ProRule:PRU00613}.				ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(17)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	57				GBM - Glioblastoma multiforme(48;0.0187)		CTGCTTACAGTGTGGGCAACG	0.488																																																	0													89.0	77.0	81.0					16																	23093847		2197	4300	6497	SO:0001583	missense	0			AB033029	CCDS10607.1	16p12.3	2008-02-05	2005-08-08		ENSG00000103404	ENSG00000103404		"""Ubiquitin-specific peptidases"""	20060	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"""			12838346	Standard	NM_020718		Approved	KIAA1203	uc002dll.3	Q70CQ4	OTTHUMG00000094793	ENST00000219689.7:c.1862A>G	16.37:g.23093847T>C	ENSP00000219689:p.His621Arg		B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	p.H621R	ENST00000219689.7	37	c.1862	CCDS10607.1	16	.	.	.	.	.	.	.	.	.	.	T	23.7	4.448942	0.84101	.	.	ENSG00000103404	ENST00000219689	T	0.02606	4.23	4.9	4.9	0.64082	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	T	0.06508	0.0167	N	0.13140	0.3	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.56366	-0.7991	10	0.39692	T	0.17	-13.6731	14.0254	0.64582	0.0:0.0:0.0:1.0	.	621	Q70CQ4	UBP31_HUMAN	R	621	ENSP00000219689:H621R	ENSP00000219689:H621R	H	-	2	0	USP31	23001348	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.616000	0.83018	1.953000	0.56701	0.528000	0.53228	CAC	USP31	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	ENSG00000103404		0.488	USP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP31	HGNC	protein_coding	OTTHUMT00000211607.1	-	0.00	70	0	T	NM_020718		23093847	-1	tier1	-	no_errors	ENST00000219689	ensembl	human	known	74_37	missense	46.03	34	29	SNP	1.000	C
UTRN	7402	genome.wustl.edu	37	6	144800995	144800995	+	Silent	SNP	G	G	T	rs112708396		TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr6:144800995G>T	ENST00000367545.3	+	25	3384	c.3384G>T	c.(3382-3384)gcG>gcT	p.A1128A		NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	1128					aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		AAAAAGCTGCGAACCTGAAGA	0.423																																																	0													96.0	98.0	97.0					6																	144800995		2203	4300	6503	SO:0001819	synonymous_variant	0			AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.3384G>T	6.37:g.144800995G>T			Q5SYY1|Q5SZ57|Q9UJ40	Silent	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_dom,superfamily_CH-domain,superfamily_WW_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_dom,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_dom,pfscan_Znf_ZZ	p.A1128	ENST00000367545.3	37	c.3384	CCDS34547.1	6																																																																																			UTRN	-	smart_Spectrin/alpha-actinin,pirsf_Dystrophin/utrophin	ENSG00000152818		0.423	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTRN	HGNC	protein_coding	OTTHUMT00000042551.1	-	0.00	90	0	G			144800995	+1	tier1	-	no_errors	ENST00000367545	ensembl	human	known	74_37	silent	32.26	42	20	SNP	0.591	T
VAV1	7409	genome.wustl.edu	37	19	6848009	6848009	+	Splice_Site	SNP	G	G	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr19:6848009G>A	ENST00000602142.1	+	23	2095	c.2013G>A	c.(2011-2013)tgG>tgA	p.W671*	VAV1_ENST00000596764.1_Splice_Site_p.W639*|VAV1_ENST00000304076.2_Splice_Site_p.W649*|VAV1_ENST00000599806.1_Splice_Site_p.W616*|VAV1_ENST00000539284.1_Splice_Site_p.W574*	NM_005428.3	NP_005419.2	P15498	VAV_HUMAN	vav 1 guanine nucleotide exchange factor	671	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|reactive oxygen species metabolic process (GO:0072593)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription, DNA-templated (GO:0006355)|small GTPase mediated signal transduction (GO:0007264)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(16)|lung(18)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	62						CTCTTTGCAGGTACGCAGGCC	0.602																																																	0													75.0	79.0	77.0					19																	6848009		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS12174.1, CCDS59341.1, CCDS59342.1	19p13.2	2013-02-14	2007-07-25			ENSG00000141968		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12657	protein-coding gene	gene with protein product		164875	"""vav 1 oncogene"""	VAV		9438848	Standard	NM_005428		Approved		uc010xjh.2	P15498		ENST00000602142.1:c.2013-1G>A	19.37:g.6848009G>A			B4DVK9|M0QXX6|Q15860	Nonsense_Mutation	SNP	pfam_DH-domain,pfam_SH3_domain,pfam_SH3_2,pfam_CAMSAP_CH,pfam_SH2,pfam_CH-domain,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_CH-domain,superfamily_SH3_domain,smart_CH-domain,smart_DH-domain,smart_Pleckstrin_homology,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_SH3_domain,smart_SH2,pfscan_CH-domain,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_DH-domain,prints_SH3_domain,prints_SH2,prints_SM22_calponin	p.W671*	ENST00000602142.1	37	c.2013	CCDS12174.1	19	.	.	.	.	.	.	.	.	.	.	G	32	5.186021	0.94885	.	.	ENSG00000141968	ENST00000304076;ENST00000539284	.	.	.	3.68	3.68	0.42216	.	0.069039	0.64402	D	0.000007	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.9492	0.58389	0.0:0.0:1.0:0.0	.	.	.	.	X	671;574	.	.	W	+	3	0	VAV1	6799009	1.000000	0.71417	1.000000	0.80357	0.416000	0.31233	8.064000	0.89483	1.890000	0.54733	0.313000	0.20887	TGG	VAV1	-	pfam_SH2,superfamily_SH3_domain,smart_SH2,pfscan_SH2,prints_SH2	ENSG00000141968		0.602	VAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VAV1	HGNC	protein_coding	OTTHUMT00000458475.1		0.00	39	0	G		Nonsense_Mutation	6848009	+1			no_errors	ENST00000602142	ensembl	human	known	74_37	nonsense	9.52	19	2	SNP	1.000	A
VPS54	51542	genome.wustl.edu	37	2	64141399	64141399	+	Missense_Mutation	SNP	T	T	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr2:64141399T>A	ENST00000272322.4	-	17	2405	c.2251A>T	c.(2251-2253)Att>Ttt	p.I751F	VPS54_ENST00000409558.4_Missense_Mutation_p.I739F|VPS54_ENST00000354504.3_Missense_Mutation_p.I598F			Q9P1Q0	VPS54_HUMAN	vacuolar protein sorting 54 homolog (S. cerevisiae)	751					growth (GO:0040007)|homeostasis of number of cells within a tissue (GO:0048873)|musculoskeletal movement (GO:0050881)|neurofilament cytoskeleton organization (GO:0060052)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	GARP complex (GO:0000938)				endometrium(3)|kidney(4)|large_intestine(8)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	27						TCAAGGATAATTCTTATTAAC	0.328																																																	0													111.0	112.0	111.0					2																	64141399		2203	4300	6503	SO:0001583	missense	0			AF102177	CCDS33208.1, CCDS46302.1	2p15-p14	2014-06-13	2006-12-19		ENSG00000143952	ENSG00000143952			18652	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 164"""	614633	"""vacuolar protein sorting 54 (yeast)"""			12039048	Standard	NM_016516		Approved	HCC8, PPP1R164	uc002scq.3	Q9P1Q0	OTTHUMG00000152627	ENST00000272322.4:c.2251A>T	2.37:g.64141399T>A	ENSP00000272322:p.Ile751Phe		Q5VIR5|Q86YF7|Q8N6G3|Q9NPV0|Q9NT07|Q9NUJ0	Missense_Mutation	SNP	pfam_Vps54,pfam_Vacuolar_sorting-assoc_54	p.I751F	ENST00000272322.4	37	c.2251	CCDS33208.1	2	.	.	.	.	.	.	.	.	.	.	T	14.82	2.649790	0.47362	.	.	ENSG00000143952	ENST00000354504;ENST00000272322;ENST00000409558;ENST00000483277;ENST00000394400	T;T;T	0.32753	1.44;1.45;1.45	6.02	4.86	0.63082	.	0.087235	0.85682	D	0.000000	T	0.35828	0.0945	N	0.25890	0.77	0.80722	D	1	P;P;P	0.49447	0.9;0.924;0.906	P;P;P	0.58266	0.471;0.836;0.747	T	0.04242	-1.0966	10	0.20046	T	0.44	.	13.5553	0.61756	0.0:0.0:0.1299:0.8701	.	598;751;739	Q9P1Q0-3;Q9P1Q0;Q9P1Q0-4	.;VPS54_HUMAN;.	F	598;751;739;739;751	ENSP00000346499:I598F;ENSP00000272322:I751F;ENSP00000386980:I739F	ENSP00000272322:I751F	I	-	1	0	VPS54	63994903	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	8.040000	0.89188	1.076000	0.40961	-0.321000	0.08615	ATT	VPS54	-	pfam_Vps54	ENSG00000143952		0.328	VPS54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS54	HGNC	protein_coding	OTTHUMT00000327062.2	-	0.00	94	0	T	NM_016516		64141399	-1	tier1	-	no_errors	ENST00000272322	ensembl	human	known	74_37	missense	65.38	18	34	SNP	1.000	A
WBP11P1	441818	genome.wustl.edu	37	18	30091939	30091939	+	RNA	SNP	G	G	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr18:30091939G>A	ENST00000567636.1	+	0	314					NR_003558.1				WW domain binding protein 11 pseudogene 1																		GGTTTGAGCTGAAGTTTTAAA	0.423																																																	0																																												0			BC059403		18q12.1	2007-05-15				ENSG00000260389			26250	pseudogene	pseudogene							Standard	NR_003558		Approved	HsT3017	uc010dmc.3				18.37:g.30091939G>A				RNA	SNP	-	NULL	ENST00000567636.1	37	NULL		18																																																																																			WBP11P1	-	-	ENSG00000260389		0.423	WBP11P1-002	KNOWN	basic	processed_transcript	WBP11P1	HGNC	pseudogene	OTTHUMT00000435119.1	-	0.00	111	0	G			30091939	+1	tier1	-	no_errors	ENST00000567636	ensembl	human	known	74_37	rna	33.33	26	13	SNP	1.000	A
WDR19	57728	genome.wustl.edu	37	4	39276490	39276490	+	Missense_Mutation	SNP	G	G	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr4:39276490G>A	ENST00000399820.3	+	33	3782	c.3628G>A	c.(3628-3630)Gct>Act	p.A1210T	WDR19_ENST00000288634.7_Missense_Mutation_p.A1050T	NM_025132.3	NP_079408.3	Q8NEZ3	WDR19_HUMAN	WD repeat domain 19	1210					ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|cilium assembly (GO:0042384)|digestive system development (GO:0055123)|ear morphogenesis (GO:0042471)|embryonic camera-type eye development (GO:0031076)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic limb morphogenesis (GO:0030326)|in utero embryonic development (GO:0001701)|intraciliary retrograde transport (GO:0035721)|myotome development (GO:0061055)|neurological system process (GO:0050877)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intraciliary transport particle A (GO:0030991)|motile cilium (GO:0031514)|nonmotile primary cilium (GO:0031513)|photoreceptor connecting cilium (GO:0032391)				large_intestine(1)	1						GAAGAACTCTGCTTTCAGCTT	0.483																																																	0													146.0	135.0	139.0					4																	39276490		1973	4176	6149	SO:0001583	missense	0			AB046858, AY029257	CCDS47042.1	4p14	2014-02-21			ENSG00000157796	ENSG00000157796		"""WD repeat domain containing"", ""Intraflagellar transport homologs"""	18340	protein-coding gene	gene with protein product	"""intraflagellar transport 144 homolog (Chlamydomonas)"""	608151				12906858, 22019273	Standard	XM_005262658		Approved	Pwdmp, KIAA1638, FLJ23127, ORF26, DYF-2, Oseg6, IFT144, NPHP13	uc003gtv.3	Q8NEZ3	OTTHUMG00000160466	ENST00000399820.3:c.3628G>A	4.37:g.39276490G>A	ENSP00000382717:p.Ala1210Thr		B5MEF2|Q8N5B4|Q9H5S0|Q9HCD4	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.A1210T	ENST00000399820.3	37	c.3628	CCDS47042.1	4	.	.	.	.	.	.	.	.	.	.	G	29.8	5.034352	0.93575	.	.	ENSG00000157796	ENST00000399820;ENST00000288634	T;T	0.80123	-1.32;-1.34	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	D	0.92011	0.7469	M	0.90759	3.145	0.80722	D	1	D	0.71674	0.998	D	0.76071	0.987	D	0.93025	0.6443	10	0.87932	D	0	-17.1672	19.7838	0.96428	0.0:0.0:1.0:0.0	.	1210	Q8NEZ3	WDR19_HUMAN	T	1210;1050	ENSP00000382717:A1210T;ENSP00000288634:A1050T	ENSP00000288634:A1050T	A	+	1	0	WDR19	38952885	1.000000	0.71417	0.358000	0.25811	0.989000	0.77384	5.344000	0.65981	2.664000	0.90586	0.591000	0.81541	GCT	WDR19	-	NULL	ENSG00000157796		0.483	WDR19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR19	HGNC	protein_coding	OTTHUMT00000360689.1	-	0.00	76	0	G			39276490	+1	tier1	-	no_errors	ENST00000399820	ensembl	human	known	74_37	missense	35.71	27	15	SNP	0.999	A
WDR60	55112	genome.wustl.edu	37	7	158664026	158664026	+	Missense_Mutation	SNP	G	G	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr7:158664026G>A	ENST00000407559.3	+	3	421	c.263G>A	c.(262-264)aGa>aAa	p.R88K		NM_018051.4	NP_060521.4	Q8WVS4	WDR60_HUMAN	WD repeat domain 60	88					cell projection organization (GO:0030030)	cilium (GO:0005929)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				NS(3)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(4)|lung(16)|ovary(2)	35	Ovarian(565;0.152)	all_cancers(7;1.25e-09)|all_epithelial(9;0.000894)|all_hematologic(28;0.00603)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)|STAD - Stomach adenocarcinoma(7;0.18)		gacagagacagacagagggag	0.572																																																	0													54.0	67.0	62.0					7																	158664026		1988	4112	6100	SO:0001583	missense	0				CCDS47757.1	7q36.3	2013-11-15			ENSG00000126870	ENSG00000126870		"""WD repeat domain containing"""	21862	protein-coding gene	gene with protein product		615462				23910462	Standard	NM_018051		Approved	FLJ10300, FAP163	uc003woe.4	Q8WVS4	OTTHUMG00000151443	ENST00000407559.3:c.263G>A	7.37:g.158664026G>A	ENSP00000384290:p.Arg88Lys		Q9NW58	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat	p.R88K	ENST00000407559.3	37	c.263	CCDS47757.1	7	.	.	.	.	.	.	.	.	.	.	G	2.155	-0.393616	0.04899	.	.	ENSG00000126870	ENST00000407559;ENST00000397143	T;T	0.47177	1.94;0.85	4.88	-4.38	0.03622	.	0.492611	0.23132	N	0.051563	T	0.20981	0.0505	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.36578	-0.9742	10	0.05721	T	0.95	-10.4656	8.4857	0.33069	0.2718:0.1514:0.5767:0.0	.	88	Q8WVS4	WDR60_HUMAN	K	88;98	ENSP00000384290:R88K;ENSP00000380330:R98K	ENSP00000380330:R98K	R	+	2	0	WDR60	158356787	0.001000	0.12720	0.000000	0.03702	0.008000	0.06430	-0.000000	0.12993	-0.800000	0.04433	-0.302000	0.09304	AGA	WDR60	-	NULL	ENSG00000126870		0.572	WDR60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR60	HGNC	protein_coding	OTTHUMT00000322668.1	-	0.00	114	0	G	NM_018051		158664026	+1	tier1	-	no_errors	ENST00000407559	ensembl	human	known	74_37	missense	40.00	30	20	SNP	0.000	A
WDR72	256764	genome.wustl.edu	37	15	53908157	53908157	+	Missense_Mutation	SNP	C	C	G			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr15:53908157C>G	ENST00000396328.1	-	15	2485	c.2246G>C	c.(2245-2247)aGc>aCc	p.S749T	WDR72_ENST00000360509.5_Missense_Mutation_p.S749T|WDR72_ENST00000559418.1_Missense_Mutation_p.S759T|WDR72_ENST00000557913.1_Missense_Mutation_p.S746T	NM_001277176.1|NM_182758.2	NP_001264105.1|NP_877435.3	Q3MJ13	WDR72_HUMAN	WD repeat domain 72	749										NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(18)|lung(29)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	71				all cancers(107;0.0511)		TTGGGCCAGGCTTTCAGTAAT	0.433																																																	0													86.0	83.0	84.0					15																	53908157		2194	4293	6487	SO:0001583	missense	0			BX537884	CCDS10151.1, CCDS73730.1	15q21.3	2013-01-09			ENSG00000166415	ENSG00000166415		"""WD repeat domain containing"""	26790	protein-coding gene	gene with protein product		613214					Standard	NM_182758		Approved	FLJ38736	uc002acj.2	Q3MJ13	OTTHUMG00000131939	ENST00000396328.1:c.2246G>C	15.37:g.53908157C>G	ENSP00000379619:p.Ser749Thr		Q7Z3I3|Q8N8X2	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S749T	ENST00000396328.1	37	c.2246	CCDS10151.1	15	.	.	.	.	.	.	.	.	.	.	C	0.016	-1.517108	0.00975	.	.	ENSG00000166415	ENST00000396328;ENST00000360509	T;T	0.35605	1.3;1.3	5.63	-1.38	0.09027	.	0.749654	0.13291	N	0.398943	T	0.15609	0.0376	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.30475	-0.9977	10	0.11794	T	0.64	.	5.9107	0.19027	0.0:0.2805:0.2429:0.4767	.	749	Q3MJ13	WDR72_HUMAN	T	749	ENSP00000379619:S749T;ENSP00000353699:S749T	ENSP00000353699:S749T	S	-	2	0	WDR72	51695449	0.000000	0.05858	0.000000	0.03702	0.637000	0.38172	-0.462000	0.06704	-0.121000	0.11787	0.563000	0.77884	AGC	WDR72	-	NULL	ENSG00000166415		0.433	WDR72-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WDR72	HGNC	protein_coding	OTTHUMT00000254893.2	-	0.00	68	0	C	NM_182758		53908157	-1	tier1	-	no_errors	ENST00000360509	ensembl	human	known	74_37	missense	57.14	15	20	SNP	0.000	G
WRAP73	49856	genome.wustl.edu	37	1	3553584	3553584	+	Missense_Mutation	SNP	A	A	G			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr1:3553584A>G	ENST00000270708.7	-	5	564	c.491T>C	c.(490-492)gTc>gCc	p.V164A	WRAP73_ENST00000378322.3_Missense_Mutation_p.V164A	NM_017818.3	NP_060288.3	Q9P2S5	WRP73_HUMAN	WD repeat containing, antisense to TP73	164						centrosome (GO:0005813)|cytoplasm (GO:0005737)				endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|pancreas(1)	12						ATCACTGCAGACGAAGATGCT	0.562																																																	0													78.0	64.0	68.0					1																	3553584		2203	4298	6501	SO:0001583	missense	0			AB034912, EF494669	CCDS48.1	1p36.3	2013-05-21	2011-04-13	2011-04-13	ENSG00000116213	ENSG00000116213		"""WD repeat domain containing"""	12759	protein-coding gene	gene with protein product		606040	"""WD repeat domain 8"""	WDR8			Standard	NM_017818		Approved		uc001ako.3	Q9P2S5	OTTHUMG00000000612	ENST00000270708.7:c.491T>C	1.37:g.3553584A>G	ENSP00000270708:p.Val164Ala		Q5T0D6|Q9BUH7|Q9NTK7|Q9NX56	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat	p.V164A	ENST00000270708.7	37	c.491	CCDS48.1	1	.	.	.	.	.	.	.	.	.	.	A	8.523	0.869210	0.17322	.	.	ENSG00000116213	ENST00000270708;ENST00000378322;ENST00000424367;ENST00000419924	T;T;T	0.79141	3.48;-1.24;3.48	4.47	4.47	0.54385	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	T	0.53206	0.1782	N	0.02539	-0.55	0.58432	D	0.999995	B;B;B	0.12630	0.006;0.002;0.001	B;B;B	0.10450	0.005;0.002;0.004	T	0.50783	-0.8787	10	0.21540	T	0.41	-42.6365	13.2339	0.59958	1.0:0.0:0.0:0.0	.	164;164;164	B4DYE9;Q9P2S5;Q5T0D5	.;WRP73_HUMAN;.	A	164	ENSP00000270708:V164A;ENSP00000367573:V164A;ENSP00000416192:V164A	ENSP00000270708:V164A	V	-	2	0	WRAP73	3543444	1.000000	0.71417	0.158000	0.22627	0.665000	0.39181	7.032000	0.76498	1.779000	0.52309	0.533000	0.62120	GTC	WRAP73	-	NULL	ENSG00000116213		0.562	WRAP73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WRAP73	HGNC	protein_coding	OTTHUMT00000001470.1		0.00	71	0	A			3553584	-1			no_errors	ENST00000270708	ensembl	human	known	74_37	missense	11.76	30	4	SNP	0.995	G
WRNIP1	56897	genome.wustl.edu	37	6	2783659	2783659	+	Silent	SNP	C	C	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr6:2783659C>T	ENST00000380773.4	+	5	1715	c.1506C>T	c.(1504-1506)tgC>tgT	p.C502C	WRNIP1_ENST00000380764.1_Silent_p.C118C|WRNIP1_ENST00000380771.4_Silent_p.C477C|WRNIP1_ENST00000380769.4_Silent_p.C282C	NM_020135.2	NP_064520.2			Werner helicase interacting protein 1											breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(2)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	14	Ovarian(93;0.0412)	all_hematologic(90;0.0895)				ATTACAACTGCATCTCCGCCC	0.607																																																	0													70.0	58.0	62.0					6																	2783659		2203	4300	6503	SO:0001819	synonymous_variant	0			AB056152	CCDS4475.1, CCDS4476.1	6p25.2	2010-04-21			ENSG00000124535	ENSG00000124535		"""ATPases / AAA-type"""	20876	protein-coding gene	gene with protein product		608196				11301316	Standard	NM_020135		Approved	WHIP, FLJ22526, bA420G6.2	uc003mtz.3	Q96S55	OTTHUMG00000014126	ENST00000380773.4:c.1506C>T	6.37:g.2783659C>T				Silent	SNP	pfam_MgsA_C,pfam_ATPase_AAA_core,pfam_DNA_helicase_Holl-junc_RuvB_N,pfam_ATPase_dyneun-rel_AAA,pfam_DUF815,pfam_IstB_ATP-bd,pfam_ATPase_AAA-2,superfamily_P-loop_NTPase,smart_Znf_Rad18_put,smart_AAA+_ATPase	p.C502	ENST00000380773.4	37	c.1506	CCDS4475.1	6																																																																																			WRNIP1	-	NULL	ENSG00000124535		0.607	WRNIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WRNIP1	HGNC	protein_coding	OTTHUMT00000039641.1	-	0.00	57	0	C	NM_130395		2783659	+1	tier1	-	no_errors	ENST00000380773	ensembl	human	known	74_37	silent	7.02	53	4	SNP	0.997	T
XIRP1	165904	genome.wustl.edu	37	3	39229916	39229916	+	Missense_Mutation	SNP	C	C	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr3:39229916C>A	ENST00000340369.3	-	2	1249	c.1021G>T	c.(1021-1023)Gat>Tat	p.D341Y	XIRP1_ENST00000421646.1_Intron|XIRP1_ENST00000396251.1_Missense_Mutation_p.D341Y	NM_194293.2	NP_919269.2	Q702N8	XIRP1_HUMAN	xin actin-binding repeat containing 1	341					cardiac muscle cell development (GO:0055013)|negative regulation of cell proliferation (GO:0008285)|regulation of membrane potential (GO:0042391)|sarcomere organization (GO:0045214)	fascia adherens (GO:0005916)	poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(14)|lung(22)|ovary(4)|pancreas(1)|prostate(2)|skin(6)	71				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		TGCTGAACATCTGGACCAGGT	0.582																																																	0													79.0	88.0	85.0					3																	39229916		2203	4300	6503	SO:0001583	missense	0			AW755250	CCDS2683.1, CCDS56245.1	3p21.33	2008-02-05	2007-06-27	2007-06-27	ENSG00000168334	ENSG00000168334			14301	protein-coding gene	gene with protein product		609777	"""cardiomyopathy associated 1"""	CMYA1		12203715, 15454575	Standard	NM_001198621		Approved	DKFZp451D042, Xin	uc003cjk.2	Q702N8	OTTHUMG00000131297	ENST00000340369.3:c.1021G>T	3.37:g.39229916C>A	ENSP00000343140:p.Asp341Tyr		A0JP25|A4QPE2|Q68DF2|Q6ZTR3|Q702N9|Q8IVN7|Q8N1N3|Q8N904|Q8TCG7	Missense_Mutation	SNP	pfam_Actin-binding_Xin_repeat	p.D341Y	ENST00000340369.3	37	c.1021	CCDS2683.1	3	.	.	.	.	.	.	.	.	.	.	C	19.34	3.809185	0.70797	.	.	ENSG00000168334	ENST00000396251;ENST00000340369	T;T	0.12361	2.69;2.97	4.89	4.89	0.63831	.	0.179859	0.47093	D	0.000242	T	0.25754	0.0627	L	0.29908	0.895	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.995;1.0	T	0.01432	-1.1356	10	0.87932	D	0	.	13.9624	0.64188	0.0:1.0:0.0:0.0	.	341;341	Q702N8;Q702N8-2	XIRP1_HUMAN;.	Y	341	ENSP00000379550:D341Y;ENSP00000343140:D341Y	ENSP00000343140:D341Y	D	-	1	0	XIRP1	39204920	1.000000	0.71417	0.727000	0.30756	0.982000	0.71751	5.177000	0.65032	2.442000	0.82660	0.655000	0.94253	GAT	XIRP1	-	NULL	ENSG00000168334		0.582	XIRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	XIRP1	HGNC	protein_coding	OTTHUMT00000254065.1	-	0.00	47	0	C	XM_093522		39229916	-1	tier1	-	no_errors	ENST00000340369	ensembl	human	known	74_37	missense	16.67	20	4	SNP	1.000	A
ZDHHC23	254887	genome.wustl.edu	37	3	113673114	113673114	+	Missense_Mutation	SNP	G	G	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr3:113673114G>T	ENST00000330212.3	+	3	1028	c.729G>T	c.(727-729)aaG>aaT	p.K243N	ZDHHC23_ENST00000498275.1_Missense_Mutation_p.K237N	NM_173570.3	NP_775841.2	Q8IYP9	ZDH23_HUMAN	zinc finger, DHHC-type containing 23	243					protein localization to plasma membrane (GO:0072659)|protein palmitoylation (GO:0018345)	integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)	p.K243N(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(2)|urinary_tract(2)	16						ATGACCCCAAGGGCTCTTCCA	0.602																																																	1	Substitution - Missense(1)	large_intestine(1)											68.0	67.0	67.0					3																	113673114		2203	4300	6503	SO:0001583	missense	0			AK127025	CCDS33827.1	3q13.31	2008-05-02			ENSG00000184307	ENSG00000184307		"""Zinc fingers, DHHC-type"""	28654	protein-coding gene	gene with protein product						12477932	Standard	NM_173570		Approved	MGC42530	uc003eau.3	Q8IYP9	OTTHUMG00000159335	ENST00000330212.3:c.729G>T	3.37:g.113673114G>T	ENSP00000330485:p.Lys243Asn		D3DN76	Missense_Mutation	SNP	pfam_Znf_DHHC_palmitoyltrfase,pfscan_Znf_DHHC_palmitoyltrfase	p.K243N	ENST00000330212.3	37	c.729	CCDS33827.1	3	.	.	.	.	.	.	.	.	.	.	G	3.846	-0.032730	0.07543	.	.	ENSG00000184307	ENST00000330212;ENST00000498275	T;T	0.25414	1.8;1.8	5.11	4.24	0.50183	.	0.676707	0.14914	N	0.291068	T	0.18215	0.0437	L	0.29908	0.895	0.09310	N	1	B	0.32010	0.351	B	0.31495	0.131	T	0.15037	-1.0451	10	0.22706	T	0.39	-12.9346	10.4658	0.44607	0.1696:0.0:0.8304:0.0	.	243	Q8IYP9	ZDH23_HUMAN	N	243;237	ENSP00000330485:K243N;ENSP00000417840:K237N	ENSP00000330485:K243N	K	+	3	2	ZDHHC23	115155804	1.000000	0.71417	0.059000	0.19551	0.055000	0.15305	3.622000	0.54217	1.375000	0.46248	0.561000	0.74099	AAG	ZDHHC23	-	NULL	ENSG00000184307		0.602	ZDHHC23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC23	HGNC	protein_coding	OTTHUMT00000354702.1		0.00	29	0	G	NM_173570		113673114	+1			no_errors	ENST00000478793	ensembl	human	known	74_37	missense	9.68	28	3	SNP	0.160	T
ZFAT	57623	genome.wustl.edu	37	8	135622881	135622881	+	Missense_Mutation	SNP	C	C	G			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr8:135622881C>G	ENST00000377838.3	-	4	640	c.466G>C	c.(466-468)Gaa>Caa	p.E156Q	ZFAT_ENST00000523399.1_Intron|ZFAT_ENST00000520214.1_Missense_Mutation_p.E144Q|ZFAT_ENST00000429442.2_Missense_Mutation_p.E144Q|ZFAT_ENST00000520727.1_Missense_Mutation_p.E144Q|ZFAT_ENST00000520356.1_Missense_Mutation_p.E144Q	NM_001174157.1|NM_020863.3	NP_001167628.1|NP_065914.2	Q9P243	ZFAT_HUMAN	zinc finger and AT hook domain containing	156					hematopoietic progenitor cell differentiation (GO:0002244)|spongiotrophoblast layer development (GO:0060712)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.E156Q(1)|p.E144Q(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(10)|kidney(9)|large_intestine(8)|lung(16)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0432)			TTTTCTAGTTCAAGGTCAGAC	0.438																																																	2	Substitution - Missense(2)	kidney(2)											150.0	139.0	142.0					8																	135622881		1917	4122	6039	SO:0001583	missense	0			BC025423	CCDS43768.1, CCDS47924.1, CCDS43768.2, CCDS55275.1, CCDS55276.1	8q24.23	2008-06-05	2008-01-25	2008-01-25	ENSG00000066827	ENSG00000066827		"""Zinc fingers, C2H2-type"""	19899	protein-coding gene	gene with protein product		610931	"""zinc finger protein 406"""	ZNF406, ZFAT1		10819331, 18329245	Standard	NM_020863		Approved	KIAA1485	uc003yup.3	Q9P243	OTTHUMG00000164321	ENST00000377838.3:c.466G>C	8.37:g.135622881C>G	ENSP00000367069:p.Glu156Gln		B7ZL15|E9PER3|Q3MIM5|Q6PJ01|Q75PJ6|Q75PJ7|Q75PJ9|Q86X64	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E156Q	ENST00000377838.3	37	c.466	CCDS47924.1	8	.	.	.	.	.	.	.	.	.	.	C	14.43	2.534336	0.45073	.	.	ENSG00000066827	ENST00000520356;ENST00000520727;ENST00000429442;ENST00000377838;ENST00000520214;ENST00000318135;ENST00000398946;ENST00000522257	T;T;T;T;T;T	0.46819	2.99;2.93;2.94;2.92;2.93;0.86	5.36	5.36	0.76844	.	0.456353	0.23549	N	0.046983	T	0.40423	0.1116	L	0.27053	0.805	0.80722	D	1	B;P;B	0.37330	0.201;0.59;0.319	B;B;B	0.43082	0.143;0.407;0.096	T	0.24261	-1.0165	10	0.37606	T	0.19	-15.7406	11.5429	0.50677	0.0:0.9183:0.0:0.0817	.	144;144;156	E9PBN4;Q9P243-3;Q9P243	.;.;ZFAT_HUMAN	Q	144;144;144;156;144;144;144;94	ENSP00000427879:E144Q;ENSP00000427831:E144Q;ENSP00000394501:E144Q;ENSP00000367069:E156Q;ENSP00000428483:E144Q;ENSP00000429983:E94Q	ENSP00000326997:E144Q	E	-	1	0	ZFAT	135692063	1.000000	0.71417	0.989000	0.46669	0.999000	0.98932	2.341000	0.43983	2.498000	0.84270	0.655000	0.94253	GAA	ZFAT	-	NULL	ENSG00000066827		0.438	ZFAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFAT	HGNC	protein_coding	OTTHUMT00000378272.1		0.00	56	0	C	NM_001029939		135622881	-1			no_errors	ENST00000377838	ensembl	human	known	74_37	missense	8.82	31	3	SNP	0.999	G
ZFYVE9	9372	genome.wustl.edu	37	1	52798549	52798549	+	Missense_Mutation	SNP	A	A	G			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr1:52798549A>G	ENST00000371591.1	+	13	3679	c.3548A>G	c.(3547-3549)tAt>tGt	p.Y1183C	ZFYVE9_ENST00000469134.1_3'UTR|ZFYVE9_ENST00000357206.2_Missense_Mutation_p.Y1124C|ZFYVE9_ENST00000287727.3_Missense_Mutation_p.Y1183C	NM_004799.2|NM_007324.2	NP_004790.2|NP_015563.2	O95405	ZFYV9_HUMAN	zinc finger, FYVE domain containing 9	1183					endocytosis (GO:0006897)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteolysis (GO:0006508)|SMAD protein complex assembly (GO:0007183)|SMAD protein import into nucleus (GO:0007184)|transforming growth factor beta receptor signaling pathway (GO:0007179)	early endosome (GO:0005769)|early endosome membrane (GO:0031901)	1-phosphatidylinositol binding (GO:0005545)|metal ion binding (GO:0046872)|serine-type peptidase activity (GO:0008236)			breast(1)|central_nervous_system(4)|endometrium(3)|kidney(1)|large_intestine(12)|lung(17)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	53						GATGGAAACTATCAGACCCAG	0.438																																																	0													117.0	104.0	108.0					1																	52798549		2203	4300	6503	SO:0001583	missense	0			AF104304	CCDS563.1, CCDS564.1	1p32.3	2014-06-13	2004-05-21	2004-05-26	ENSG00000157077	ENSG00000157077		"""Zinc fingers, FYVE domain containing"""	6775	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 173"""	603755	"""MAD, mothers against decapentaplegic homolog (Drosophila) interacting protein, receptor activation anchor"""	MADHIP		9865696	Standard	NM_007324		Approved	SMADIP, SARA, PPP1R173	uc001cto.4	O95405	OTTHUMG00000008061	ENST00000371591.1:c.3548A>G	1.37:g.52798549A>G	ENSP00000360647:p.Tyr1183Cys		Q5T0F6|Q5T0F7|Q9UNE1|Q9Y5R7	Missense_Mutation	SNP	pfam_DUF3480,pfam_SARA_Smad-bd,pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pirsf_Znf_FYVE_SARA/endofin,pfscan_Znf_FYVE-rel	p.Y1183C	ENST00000371591.1	37	c.3548	CCDS563.1	1	.	.	.	.	.	.	.	.	.	.	A	21.5	4.165476	0.78339	.	.	ENSG00000157077	ENST00000357206;ENST00000287727;ENST00000371591	T;T;T	0.56776	0.6;0.44;0.44	4.59	4.59	0.56863	Domain of unknown function DUF3480 (1);	0.000000	0.85682	D	0.000000	T	0.73753	0.3627	M	0.82716	2.605	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.78932	-0.2009	10	0.87932	D	0	.	14.1308	0.65253	1.0:0.0:0.0:0.0	.	1124;1183	O95405-2;O95405	.;ZFYV9_HUMAN	C	1124;1183;1183	ENSP00000349737:Y1124C;ENSP00000287727:Y1183C;ENSP00000360647:Y1183C	ENSP00000287727:Y1183C	Y	+	2	0	ZFYVE9	52571137	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.922000	0.92789	1.944000	0.56390	0.455000	0.32223	TAT	ZFYVE9	-	pfam_DUF3480,pirsf_Znf_FYVE_SARA/endofin	ENSG00000157077		0.438	ZFYVE9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFYVE9	HGNC	protein_coding	OTTHUMT00000022083.1	-	0.00	62	0	A	NM_007324		52798549	+1	tier1	-	no_errors	ENST00000287727	ensembl	human	known	74_37	missense	68.75	10	22	SNP	1.000	G
ZMIZ2	83637	genome.wustl.edu	37	7	44795881	44795881	+	Silent	SNP	G	G	C			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr7:44795881G>C	ENST00000309315.4	+	2	156	c.33G>C	c.(31-33)ctG>ctC	p.L11L	ZMIZ2_ENST00000433667.1_Silent_p.L11L|ZMIZ2_ENST00000441627.1_Silent_p.L11L|ZMIZ2_ENST00000413916.1_Silent_p.L11L|ZMIZ2_ENST00000265346.7_Silent_p.L11L	NM_031449.3	NP_113637.3	Q8NF64	ZMIZ2_HUMAN	zinc finger, MIZ-type containing 2	11					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|zinc ion binding (GO:0008270)			breast(3)|endometrium(2)|kidney(3)|large_intestine(6)|lung(10)|ovary(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35						AACCTGCCCTGCCCCCTGCGC	0.602																																					NSCLC(20;604 852 1948 16908 50522)												0													60.0	65.0	64.0					7																	44795881		1920	4120	6040	SO:0001819	synonymous_variant	0			AK090415	CCDS43576.1, CCDS43577.1, CCDS75591.1	7p13	2009-11-06			ENSG00000122515	ENSG00000122515		"""Zinc fingers, MIZ-type"""	22229	protein-coding gene	gene with protein product		611196					Standard	XM_005249866		Approved	KIAA1886, hZIMP7, ZIMP7, DKFZp761I2123, NET27	uc003tlr.3	Q8NF64	OTTHUMG00000155817	ENST00000309315.4:c.33G>C	7.37:g.44795881G>C			A4D2K7|D3DVL1|O94790|Q0VGB4|Q659A8|Q6JKL5|Q8WTX8|Q96Q01|Q9BQH7	Silent	SNP	pfam_Znf_MIZ,pfscan_Znf_MIZ	p.L11	ENST00000309315.4	37	c.33	CCDS43576.1	7																																																																																			ZMIZ2	-	NULL	ENSG00000122515		0.602	ZMIZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMIZ2	HGNC	protein_coding	OTTHUMT00000341790.1		0.00	49	0	G	NM_031449		44795881	+1			no_errors	ENST00000309315	ensembl	human	known	74_37	silent	8.89	40	4	SNP	1.000	C
ZNF142	7701	genome.wustl.edu	37	2	219509410	219509410	+	Missense_Mutation	SNP	G	G	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr2:219509410G>A	ENST00000449707.1	-	8	2250	c.1829C>T	c.(1828-1830)gCa>gTa	p.A610V	ZNF142_ENST00000411696.2_Missense_Mutation_p.A610V	NM_001105537.1	NP_001099007.1	P52746	ZN142_HUMAN	zinc finger protein 142	610					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(7)|endometrium(7)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38		Renal(207;0.0474)		Epithelial(149;5.21e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)		CTCCTGGCTTGCATAGCGGAG	0.602																																					Colon(170;867 1942 8995 15834 18053)												0													46.0	49.0	48.0					2																	219509410		2056	4205	6261	SO:0001583	missense	0			U09849	CCDS42817.1	2q35	2013-01-08	2006-06-13		ENSG00000115568	ENSG00000115568		"""Zinc fingers, C2H2-type"""	12927	protein-coding gene	gene with protein product		604083	"""zinc finger protein 142 (clone pHZ-49)"""				Standard	NM_001105537		Approved	KIAA0236, pHZ-49	uc002vin.4	P52746	OTTHUMG00000154736	ENST00000449707.1:c.1829C>T	2.37:g.219509410G>A	ENSP00000408643:p.Ala610Val		Q92510	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A610V	ENST00000449707.1	37	c.1829	CCDS42817.1	2	.	.	.	.	.	.	.	.	.	.	G	15.01	2.706267	0.48412	.	.	ENSG00000115568	ENST00000449707;ENST00000411696	T;T	0.13307	2.6;2.6	5.95	4.17	0.49024	.	0.107206	0.64402	D	0.000006	T	0.20700	0.0498	L	0.53249	1.67	0.31472	N	0.668314	P;P	0.51791	0.935;0.948	P;P	0.50860	0.575;0.652	T	0.08953	-1.0697	10	0.40728	T	0.16	-1.8544	11.1152	0.48256	0.142:0.0:0.858:0.0	.	610;447	P52746;A8MWU9	ZN142_HUMAN;.	V	610	ENSP00000408643:A610V;ENSP00000398798:A610V	ENSP00000398798:A610V	A	-	2	0	ZNF142	219217654	1.000000	0.71417	0.213000	0.23690	0.174000	0.22865	6.350000	0.73017	0.871000	0.35750	-0.136000	0.14681	GCA	ZNF142	-	NULL	ENSG00000115568		0.602	ZNF142-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF142	HGNC	protein_coding	OTTHUMT00000336833.1	-	0.00	39	0	G	NM_005081		219509410	-1	tier1	-	no_errors	ENST00000411696	ensembl	human	known	74_37	missense	10.00	45	5	SNP	0.787	A
ZNF260	339324	genome.wustl.edu	37	19	37005581	37005581	+	Missense_Mutation	SNP	G	G	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr19:37005581G>T	ENST00000523638.1	-	3	1681	c.560C>A	c.(559-561)aCt>aAt	p.T187N	ZNF260_ENST00000593142.1_Missense_Mutation_p.T187N|ZNF260_ENST00000588993.1_Missense_Mutation_p.T187N|ZNF260_ENST00000592282.1_Missense_Mutation_p.T187N	NM_001166036.1|NM_001166037.1|NM_001166038.1	NP_001159508.1|NP_001159509.1|NP_001159510.1	Q3ZCT1	ZN260_HUMAN	zinc finger protein 260	187					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)	15	Esophageal squamous(110;0.162)					CTTCTTTCCAGTATGGATGTT	0.378																																																	0													162.0	165.0	164.0					19																	37005581		2203	4300	6503	SO:0001583	missense	0			AK122854	CCDS33003.1	19q13.12	2013-01-08				ENSG00000254004		"""Zinc fingers, C2H2-type"""	13499	protein-coding gene	gene with protein product		613749					Standard	NM_001166036		Approved	ozrf1, Zfp260	uc002oed.2	Q3ZCT1		ENST00000523638.1:c.560C>A	19.37:g.37005581G>T	ENSP00000429803:p.Thr187Asn		Q0VF43	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.T187N	ENST00000523638.1	37	c.560	CCDS33003.1	19	.	.	.	.	.	.	.	.	.	.	G	11.86	1.764753	0.31228	.	.	ENSG00000254004	ENST00000523638	T	0.26067	1.76	4.58	-0.514	0.11958	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.22936	0.0554	L	0.33485	1.01	0.25645	N	0.986164	B	0.23249	0.082	B	0.33890	0.172	T	0.43442	-0.9391	9	0.62326	D	0.03	.	11.3855	0.49782	0.0:0.2633:0.6515:0.0853	.	187	Q3ZCT1	ZN260_HUMAN	N	187	ENSP00000429803:T187N	ENSP00000429803:T187N	T	-	2	0	ZNF260	41697421	0.010000	0.17322	0.735000	0.30896	0.926000	0.56050	0.092000	0.15066	0.236000	0.21180	-0.311000	0.09066	ACT	ZNF260	-	pfscan_Znf_C2H2	ENSG00000254004		0.378	ZNF260-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF260	HGNC	protein_coding	OTTHUMT00000109564.2	-	0.00	105	0	G	NM_001012756		37005581	-1	tier1	-	no_errors	ENST00000523638	ensembl	human	known	74_37	missense	15.87	53	10	SNP	0.997	T
ZNF461	92283	genome.wustl.edu	37	19	37130748	37130748	+	Frame_Shift_Del	DEL	T	T	-			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr19:37130748delT	ENST00000588268.1	-	6	726	c.499delA	c.(499-501)attfs	p.I167fs	ZNF461_ENST00000540605.2_5'UTR|ZNF461_ENST00000360357.4_Frame_Shift_Del_p.I144fs	NM_153257.2	NP_694989.2	Q8TAF7	ZN461_HUMAN	zinc finger protein 461	167					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(1)|large_intestine(4)|lung(17)|prostate(1)|urinary_tract(2)	29	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			TCATGGTTAATCATAAGTTGT	0.358																																																	0													242.0	233.0	236.0					19																	37130748		1844	4101	5945	SO:0001589	frameshift_variant	0			BX649031	CCDS54257.1, CCDS74348.1	19q13.13	2013-01-08				ENSG00000197808		"""Zinc fingers, C2H2-type"", ""-"""	21629	protein-coding gene	gene with protein product		608640				11579202, 15004467	Standard	XM_005259402		Approved	GIOT-1, MGC33911	uc002oem.3	Q8TAF7		ENST00000588268.1:c.499delA	19.37:g.37130748delT	ENSP00000467931:p.Ile167fs		A8K9W9|Q6VSF7|Q9ULZ8	Frame_Shift_Del	DEL	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.I167fs	ENST00000588268.1	37	c.499	CCDS54257.1	19																																																																																			ZNF461	-	NULL	ENSG00000197808		0.358	ZNF461-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF461	HGNC	protein_coding	OTTHUMT00000453202.1		0.00	118	0	T	NM_153257		37130748	-1	tier1		no_errors	ENST00000588268	ensembl	human	known	74_37	frame_shift_del	18.92	60	14	DEL	0.002	-
ZNF347	84671	genome.wustl.edu	37	19	53652593	53652593	+	Missense_Mutation	SNP	T	T	C			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr19:53652593T>C	ENST00000334197.7	-	3	111	c.43A>G	c.(43-45)Ata>Gta	p.I15V	ZNF347_ENST00000601804.1_Intron|ZNF347_ENST00000452676.2_Missense_Mutation_p.I15V|ZNF347_ENST00000601469.2_Missense_Mutation_p.I15V	NM_032584.2	NP_115973.2	Q96SE7	ZN347_HUMAN	zinc finger protein 347	15	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|prostate(3)|skin(1)	23				GBM - Glioblastoma multiforme(134;0.0179)		GAGAATTCTATAGCCACATCC	0.478																																					Melanoma(64;205 1597 17324 45721)												0													89.0	92.0	91.0					19																	53652593		2203	4300	6503	SO:0001583	missense	0			AY029765	CCDS33097.1, CCDS54314.1	19q13.3	2013-01-08				ENSG00000197937		"""Zinc fingers, C2H2-type"", ""-"""	16447	protein-coding gene	gene with protein product							Standard	NM_032584		Approved	ZNF1111	uc010eql.2	Q96SE7		ENST00000334197.7:c.43A>G	19.37:g.53652593T>C	ENSP00000334146:p.Ile15Val		B3KU77|B9EG59|G5E9N4|Q8TCN1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.I15V	ENST00000334197.7	37	c.43	CCDS33097.1	19	.	.	.	.	.	.	.	.	.	.	T	12.15	1.852404	0.32699	.	.	ENSG00000197937	ENST00000334197;ENST00000452676	T;T	0.00824	5.65;5.65	2.38	1.35	0.21983	Krueppel-associated box (4);	.	.	.	.	T	0.01092	0.0036	N	0.10685	0.025	0.19575	N	0.999966	P;D	0.58620	0.876;0.983	P;D	0.73708	0.894;0.981	T	0.51490	-0.8699	9	0.08179	T	0.78	.	3.5479	0.07835	0.0:0.3519:0.0:0.6481	.	15;15	G5E9N4;Q96SE7	.;ZN347_HUMAN	V	15	ENSP00000334146:I15V;ENSP00000405218:I15V	ENSP00000334146:I15V	I	-	1	0	ZNF347	58344405	0.000000	0.05858	0.987000	0.45799	0.955000	0.61496	-0.302000	0.08221	1.100000	0.41517	0.482000	0.46254	ATA	ZNF347	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000197937		0.478	ZNF347-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF347	HGNC	protein_coding	OTTHUMT00000464170.1	-	0.00	202	0	T	NM_032584		53652593	-1	tier1	-	no_errors	ENST00000452676	ensembl	human	known	74_37	missense	68.91	37	82	SNP	0.774	C
ZNF484	83744	genome.wustl.edu	37	9	95610494	95610494	+	Missense_Mutation	SNP	T	T	C			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr9:95610494T>C	ENST00000375495.3	-	5	723	c.575A>G	c.(574-576)tAt>tGt	p.Y192C	ZNF484_ENST00000332591.6_Missense_Mutation_p.Y156C|ANKRD19P_ENST00000473204.1_RNA|ZNF484_ENST00000395505.2_Missense_Mutation_p.Y156C|ZNF484_ENST00000395506.3_Missense_Mutation_p.Y194C	NM_031486.2	NP_113674.1	Q5JVG2	ZN484_HUMAN	zinc finger protein 484	192					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|cervix(1)|kidney(8)|large_intestine(10)|lung(10)|prostate(2)	33						GTTTCTATTATATAAGGTTAT	0.358																																																	0													96.0	101.0	100.0					9																	95610494		2203	4300	6503	SO:0001583	missense	0			AK091203	CCDS35066.1, CCDS35067.1, CCDS59136.1	9q22.32	2013-01-08			ENSG00000127081	ENSG00000127081		"""Zinc fingers, C2H2-type"", ""-"""	23385	protein-coding gene	gene with protein product							Standard	NM_001007101		Approved	BA526D8.4, FLJ33884	uc004asu.2	Q5JVG2	OTTHUMG00000020236	ENST00000375495.3:c.575A>G	9.37:g.95610494T>C	ENSP00000364645:p.Tyr192Cys		B1AL89|B4DRI2	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Y194C	ENST00000375495.3	37	c.581	CCDS35066.1	9	.	.	.	.	.	.	.	.	.	.	.	0.634	-0.816017	0.02776	.	.	ENSG00000127081	ENST00000395505;ENST00000395506;ENST00000375495;ENST00000332591	T;T;T;T	0.06371	3.31;3.43;3.46;3.31	2.94	-1.73	0.08081	.	.	.	.	.	T	0.03739	0.0106	N	0.12746	0.255	0.09310	N	1	B;B	0.10296	0.003;0.003	B;B	0.08055	0.003;0.003	T	0.40869	-0.9540	9	0.59425	D	0.04	.	8.4154	0.32668	0.0:0.588:0.0:0.412	.	194;192	B4DRI2;Q5JVG2	.;ZN484_HUMAN	C	156;194;192;156	ENSP00000378881:Y156C;ENSP00000378882:Y194C;ENSP00000364645:Y192C;ENSP00000364646:Y156C	ENSP00000364646:Y156C	Y	-	2	0	ZNF484	94650315	0.000000	0.05858	0.000000	0.03702	0.101000	0.19017	-2.311000	0.01128	-0.386000	0.07821	-0.278000	0.10074	TAT	ZNF484	-	NULL	ENSG00000127081		0.358	ZNF484-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF484	HGNC	protein_coding	OTTHUMT00000053111.2	-	0.00	31	0	T	XM_046861		95610494	-1	tier1	-	no_errors	ENST00000395506	ensembl	human	known	74_37	missense	81.82	6	27	SNP	0.005	C
ZNF518A	9849	genome.wustl.edu	37	10	97921704	97921704	+	RNA	SNP	A	A	G			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr10:97921704A>G	ENST00000534948.1	+	0	6480							Q6AHZ1	Z518A_HUMAN	zinc finger protein 518A						transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(2)|urinary_tract(2)	24		Colorectal(252;0.0815)		Epithelial(162;4.23e-08)|all cancers(201;1.85e-06)		GAGTTTTAAAATGGATGTTTT	0.373																																																	0																																												0			AB002333	CCDS73170.1	10q23.33	2012-08-08	2007-12-07	2007-12-07	ENSG00000177853	ENSG00000177853		"""Zinc fingers, C2H2-type"""	29009	protein-coding gene	gene with protein product			"""zinc finger protein 518"""	ZNF518		9205841	Standard	NM_014803		Approved	KIAA0335	uc001klp.3	Q6AHZ1	OTTHUMG00000018828		10.37:g.97921704A>G			A0PJI5|O15044|Q32MP4	RNA	SNP	-	NULL	ENST00000534948.1	37	NULL		10																																																																																			ZNF518A	-	-	ENSG00000177853		0.373	ZNF518A-202	KNOWN	basic	processed_transcript	ZNF518A	HGNC	processed_transcript		-	0.00	67	0	A	NM_014803		97921704	+1	tier1	-	no_errors	ENST00000534948	ensembl	human	known	74_37	rna	34.09	29	15	SNP	0.118	G
ZNF578	147660	genome.wustl.edu	37	19	52961273	52961273	+	Intron	SNP	G	G	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr19:52961273G>T	ENST00000421239.2	+	2	123				ZNF578_ENST00000596382.1_3'UTR	NM_001099694.1	NP_001093164.1	Q96N58	ZN578_HUMAN	zinc finger protein 578						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)								GBM - Glioblastoma multiforme(134;0.00819)|OV - Ovarian serous cystadenocarcinoma(262;0.01)		CACTGCTCTTGGGCAGCAGGA	0.532																																																	0																																										SO:0001627	intron_variant	0			AK095562	CCDS54310.1	19q13.41	2013-09-20			ENSG00000258405	ENSG00000258405		"""Zinc fingers, C2H2-type"", ""-"""	26449	protein-coding gene	gene with protein product							Standard	NM_001099694		Approved	FLJ31384	uc002pzp.4	Q96N58	OTTHUMG00000156468	ENST00000421239.2:c.-122+1062G>T	19.37:g.52961273G>T			B4DR51|I3L1Y6	RNA	SNP	-	NULL	ENST00000421239.2	37	NULL	CCDS54310.1	19																																																																																			ZNF578	-	-	ENSG00000258405		0.532	ZNF578-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	ZNF578	HGNC	protein_coding	OTTHUMT00000344298.3	-	0.00	76	0	G	NM_152472		52961273	+1	tier1	-	no_errors	ENST00000594118	ensembl	human	known	74_37	rna	10.87	41	5	SNP	0.002	T
ZNF667	63934	genome.wustl.edu	37	19	56953299	56953299	+	Missense_Mutation	SNP	C	C	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr19:56953299C>A	ENST00000504904.3	-	7	1784	c.1065G>T	c.(1063-1065)gaG>gaT	p.E355D	ZNF667_ENST00000342634.3_Missense_Mutation_p.E483D|ZNF667_ENST00000292069.6_Missense_Mutation_p.E355D|ZNF667_ENST00000591790.1_3'UTR			Q5HYK9	ZN667_HUMAN	zinc finger protein 667	355					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(18)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	38		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0615)		TGTACGGTTTCTCTGAAGTGT	0.363																																																	0													85.0	91.0	89.0					19																	56953299		2203	4300	6503	SO:0001583	missense	0				CCDS12944.1	19q13.43	2013-01-08				ENSG00000198046		"""Zinc fingers, C2H2-type"", ""-"""	28854	protein-coding gene	gene with protein product		611024					Standard	NM_022103		Approved	FLJ14011	uc002qnd.3	Q5HYK9		ENST00000504904.3:c.1065G>T	19.37:g.56953299C>A	ENSP00000439402:p.Glu355Asp		B2RMS6|B9EK36|Q6B093|Q9H807	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E483D	ENST00000504904.3	37	c.1449	CCDS12944.1	19	.	.	.	.	.	.	.	.	.	.	C	7.984	0.751865	0.15778	.	.	ENSG00000198046	ENST00000342634;ENST00000504904;ENST00000292069;ENST00000452518;ENST00000360227	T;T;T	0.26810	1.71;1.71;1.71	5.05	0.301	0.15781	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.804032	0.10576	N	0.658516	T	0.24084	0.0583	L	0.39692	1.235	0.22666	N	0.99888	P;P	0.47253	0.892;0.822	P;P	0.48488	0.579;0.455	T	0.16541	-1.0399	10	0.87932	D	0	-6.0E-4	3.4801	0.07599	0.1377:0.5703:0.1338:0.1582	.	483;355	E7EPS0;Q5HYK9	.;ZN667_HUMAN	D	483;355;355;137;127	ENSP00000344699:E483D;ENSP00000439402:E355D;ENSP00000292069:E355D	ENSP00000292069:E355D	E	-	3	2	ZNF667	61645111	0.089000	0.21612	0.001000	0.08648	0.003000	0.03518	0.175000	0.16762	0.289000	0.22422	-0.274000	0.10170	GAG	ZNF667	-	pfscan_Znf_C2H2	ENSG00000198046		0.363	ZNF667-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF667	HGNC	protein_coding	OTTHUMT00000458394.1		0.00	56	0	C	NM_022103		56953299	-1			no_errors	ENST00000342634	ensembl	human	known	74_37	missense	5.71	33	2	SNP	0.897	A
ZNF728	388523	genome.wustl.edu	37	19	23159695	23159695	+	Silent	SNP	G	G	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr19:23159695G>T	ENST00000594710.1	-	4	589	c.444C>A	c.(442-444)ggC>ggA	p.G148G		NM_001267716.1	NP_001254645.1	P0DKX0	ZN728_HUMAN	zinc finger protein 728	148					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)										TTGCATATTTGCCACATTGAA	0.313																																																	0																																										SO:0001819	synonymous_variant	0			BC128130	CCDS59370.1	19p12	2014-02-14			ENSG00000269067	ENSG00000269067		"""Zinc fingers, C2H2-type"", ""-"""	32463	protein-coding gene	gene with protein product							Standard	NM_001267716		Approved		uc002nqz.2	P0DKX0	OTTHUMG00000183124	ENST00000594710.1:c.444C>A	19.37:g.23159695G>T				Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G148	ENST00000594710.1	37	c.444	CCDS59370.1	19																																																																																			ZNF728	-	NULL	ENSG00000269067		0.313	ZNF728-001	NOVEL	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	ZNF728	HGNC	protein_coding	OTTHUMT00000465176.1	-	0.00	109	0	G	NM_001267716		23159695	-1	tier1	-	no_errors	ENST00000594710	ensembl	human	novel	74_37	silent	11.54	46	6	SNP	0.004	T
ZNF71	58491	genome.wustl.edu	37	19	57133981	57133981	+	Missense_Mutation	SNP	G	G	T			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr19:57133981G>T	ENST00000328070.6	+	3	1560	c.1326G>T	c.(1324-1326)caG>caT	p.Q442H		NM_021216.4	NP_067039.1	Q9NQZ8	ZNF71_HUMAN	zinc finger protein 71	442					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|large_intestine(5)|lung(13)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	26				GBM - Glioblastoma multiforme(193;0.062)|Lung(386;0.0681)|LUSC - Lung squamous cell carcinoma(496;0.18)		GGTGCGGCCAGTGCGGGAAGT	0.642																																																	0													70.0	59.0	63.0					19																	57133981		2203	4300	6503	SO:0001583	missense	0			X60074	CCDS12947.1	19q13.4	2013-01-08	2006-05-12			ENSG00000197951		"""Zinc fingers, C2H2-type"""	13141	protein-coding gene	gene with protein product		194545	"""zinc finger protein 71 (Cos26)"""			1639391	Standard	NM_021216		Approved	Cos26, EZFIT	uc002qnm.4	Q9NQZ8		ENST00000328070.6:c.1326G>T	19.37:g.57133981G>T	ENSP00000328245:p.Gln442His		Q15919|Q9UC09|Q9UQD3	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q442H	ENST00000328070.6	37	c.1326	CCDS12947.1	19	.	.	.	.	.	.	.	.	.	.	G	11.98	1.801690	0.31869	.	.	ENSG00000197951	ENST00000328070	T	0.07567	3.18	3.82	2.71	0.32032	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.08935	0.0221	N	0.11927	0.2	0.26136	N	0.980347	P	0.45396	0.857	P	0.51582	0.674	T	0.26467	-1.0102	9	0.54805	T	0.06	.	10.3735	0.44068	0.1191:0.0:0.8809:0.0	.	442	Q9NQZ8	ZNF71_HUMAN	H	442	ENSP00000328245:Q442H	ENSP00000328245:Q442H	Q	+	3	2	ZNF71	61825793	0.001000	0.12720	0.992000	0.48379	0.822000	0.46500	-0.401000	0.07232	1.958000	0.56883	0.561000	0.74099	CAG	ZNF71	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197951		0.642	ZNF71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF71	HGNC	protein_coding	OTTHUMT00000459798.2	-	0.00	114	0	G	NM_021216		57133981	+1	tier1	-	no_errors	ENST00000328070	ensembl	human	known	74_37	missense	33.33	44	22	SNP	0.958	T
ZNF732	654254	genome.wustl.edu	37	4	265711	265711	+	Missense_Mutation	SNP	C	C	A			TCGA-XP-A8T8-01A-11D-A36J-09	TCGA-XP-A8T8-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0e7fe429-8748-4ae8-885c-ca9bf2a2fe79	d3072f13-42cf-4c39-a438-5191061ead95	g.chr4:265711C>A	ENST00000419098.1	-	4	945	c.935G>T	c.(934-936)gGc>gTc	p.G312V		NM_001137608.1	NP_001131080.1	B4DXR9	ZN732_HUMAN	zinc finger protein 732	312					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|lung(2)	3						AAAGACTTTGCCACATTCCTG	0.383																																																	0													71.0	66.0	67.0					4																	265711		692	1591	2283	SO:0001583	missense	0			AK302099	CCDS46990.1	4p16.3	2014-02-12	2009-07-22		ENSG00000186777	ENSG00000186777		"""Zinc fingers, C2H2-type"", ""-"""	37138	protein-coding gene	gene with protein product							Standard	NM_001137608		Approved	FLJ59067	uc011buu.1	B4DXR9	OTTHUMG00000159883	ENST00000419098.1:c.935G>T	4.37:g.265711C>A	ENSP00000415774:p.Gly312Val			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G312V	ENST00000419098.1	37	c.935	CCDS46990.1	4	.	.	.	.	.	.	.	.	.	.	C	13.98	2.398411	0.42512	.	.	ENSG00000186777	ENST00000419098	T	0.01495	4.83	0.977	0.977	0.19733	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.12689	0.0308	H	0.95816	3.725	0.53005	D	0.999968	D	0.89917	1.0	D	0.91635	0.999	T	0.00569	-1.1666	9	0.87932	D	0	.	7.3306	0.26580	0.0:1.0:0.0:0.0	.	312	B4DXR9	ZN732_HUMAN	V	312	ENSP00000415774:G312V	ENSP00000415774:G312V	G	-	2	0	ZNF732	255711	0.990000	0.36364	0.095000	0.20976	0.088000	0.18126	0.877000	0.28106	0.399000	0.25367	0.400000	0.26472	GGC	ZNF732	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000186777		0.383	ZNF732-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF732	HGNC	protein_coding	OTTHUMT00000357937.2	-	0.00	56	0	C	NM_001137608		265711	-1	tier1	-	no_errors	ENST00000419098	ensembl	human	known	74_37	missense	38.10	25	16	SNP	1.000	A
