#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
A4GNT	51146	genome.wustl.edu	37	3	137850070	137850070	+	Nonsense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr3:137850070G>C	ENST00000236709.3	-	2	230	c.29C>G	c.(28-30)tCa>tGa	p.S10*		NM_016161.2	NP_057245.1	Q9UNA3	A4GCT_HUMAN	alpha-1,4-N-acetylglucosaminyltransferase	10					carbohydrate metabolic process (GO:0005975)|glycoprotein biosynthetic process (GO:0009101)|negative regulation of epithelial cell proliferation (GO:0050680)|protein O-linked glycosylation (GO:0006493)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	acetylglucosaminyltransferase activity (GO:0008375)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(7)	16						CAAGGTGACTGACAGGGAGAG	0.502																																																	0													78.0	76.0	77.0					3																	137850070		2203	4300	6503	SO:0001587	stop_gained	0			AF141315	CCDS3097.1	3p14.3	2010-12-14			ENSG00000118017	ENSG00000118017			17968	protein-coding gene	gene with protein product						10430883	Standard	NM_016161		Approved	alpha4GnT	uc003ers.2	Q9UNA3	OTTHUMG00000159820	ENST00000236709.3:c.29C>G	3.37:g.137850070G>C	ENSP00000236709:p.Ser10*		Q0VDK1|Q0VDK2	Nonsense_Mutation	SNP	pfam_A1-4-GlycosylTfrase_dom,pfam_GlycoTrfase_DXD_sugar-bd_CS	p.S10*	ENST00000236709.3	37	c.29	CCDS3097.1	3	.	.	.	.	.	.	.	.	.	.	G	17.02	3.280793	0.59758	.	.	ENSG00000118017	ENST00000236709	.	.	.	5.32	-0.884	0.10597	.	1.215830	0.06104	N	0.665942	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11485	T	0.65	.	6.9436	0.24506	0.3723:0.4249:0.2028:0.0	.	.	.	.	X	10	.	ENSP00000236709:S10X	S	-	2	0	A4GNT	139332760	0.001000	0.12720	0.122000	0.21767	0.327000	0.28475	-0.071000	0.11505	-0.257000	0.09459	0.561000	0.74099	TCA	A4GNT	-	NULL	ENSG00000118017		0.502	A4GNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	A4GNT	HGNC	protein_coding	OTTHUMT00000357557.1	-	0.00	32	0	G	NM_016161		137850070	-1	tier1	-	no_errors	ENST00000236709	ensembl	human	known	74_37	nonsense	13.95	37	6	SNP	0.012	C
AARD	441376	genome.wustl.edu	37	8	117950617	117950617	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr8:117950617C>G	ENST00000378279.3	+	1	180	c.135C>G	c.(133-135)atC>atG	p.I45M		NM_001025357.2	NP_001020528.1	Q4LEZ3	AARD_HUMAN	alanine and arginine rich domain containing protein	45					lung development (GO:0030324)												GCACGGACATCCAGGAGGAGG	0.697																																																	0													18.0	19.0	19.0					8																	117950617		2203	4297	6500	SO:0001583	missense	0			AB181519, BC140924	CCDS34935.1	8q24.11	2012-04-19	2012-04-19	2012-04-19	ENSG00000205002	ENSG00000205002			33842	protein-coding gene	gene with protein product	"""Alanine and arginine-rich domain-containing protein"""		"""chromosome 8 open reading frame 85"""	C8orf85			Standard	NM_001025357		Approved	LOC441376	uc003yof.3	Q4LEZ3	OTTHUMG00000164961	ENST00000378279.3:c.135C>G	8.37:g.117950617C>G	ENSP00000367528:p.Ile45Met		A5PKU8	Missense_Mutation	SNP	NULL	p.I45M	ENST00000378279.3	37	c.135	CCDS34935.1	8	.	.	.	.	.	.	.	.	.	.	C	10.25	1.297264	0.23650	.	.	ENSG00000205002	ENST00000378279	T	0.33216	1.42	3.62	-4.18	0.03846	.	2.067280	0.02987	N	0.146399	T	0.13415	0.0325	N	0.08118	0	0.09310	N	1	B	0.19583	0.037	B	0.22753	0.041	T	0.10132	-1.0643	10	0.41790	T	0.15	2.368	0.0778	0.00029	0.2625:0.1869:0.2389:0.3117	.	45	Q4LEZ3	AARD_HUMAN	M	45	ENSP00000367528:I45M	ENSP00000367528:I45M	I	+	3	3	C8orf85	118019798	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.579000	0.05834	-0.864000	0.04078	-0.262000	0.10625	ATC	AARD	-	NULL	ENSG00000205002		0.697	AARD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AARD	HGNC	protein_coding	OTTHUMT00000381195.1	-	0.00	54	0	C	NM_001025357		117950617	+1	tier1	-	no_errors	ENST00000378279	ensembl	human	known	74_37	missense	9.38	58	6	SNP	0.000	G
ABCA1	19	genome.wustl.edu	37	9	107579672	107579672	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr9:107579672G>C	ENST00000374736.3	-	24	3870	c.3476C>G	c.(3475-3477)tCt>tGt	p.S1159C		NM_005502.3	NP_005493.2	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 1	1159					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|endosomal transport (GO:0016197)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle assembly (GO:0034380)|interleukin-1 beta secretion (GO:0050702)|intracellular cholesterol transport (GO:0032367)|lipoprotein metabolic process (GO:0042157)|lysosome organization (GO:0007040)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|peptide secretion (GO:0002790)|phagocytosis, engulfment (GO:0006911)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|phospholipid translocation (GO:0045332)|platelet dense granule organization (GO:0060155)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cholesterol efflux (GO:0010875)|protein lipidation (GO:0006497)|regulation of Cdc42 protein signal transduction (GO:0032489)|response to drug (GO:0042493)|response to laminar fluid shear stress (GO:0034616)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)	endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|apolipoprotein A-I binding (GO:0034186)|apolipoprotein A-I receptor activity (GO:0034188)|apolipoprotein binding (GO:0034185)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase binding (GO:0051117)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)|receptor binding (GO:0005102)|small GTPase binding (GO:0031267)|syntaxin binding (GO:0019905)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(31)|liver(1)|lung(40)|ovary(5)|pancreas(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	115				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glyburide(DB01016)|Probucol(DB01599)	ACTGCTCTGAGAAACACTGTC	0.582																																																	0													122.0	90.0	101.0					9																	107579672		2203	4300	6503	SO:0001583	missense	0			AJ012376	CCDS6762.1	9q31	2014-03-14			ENSG00000165029	ENSG00000165029		"""ATP binding cassette transporters / subfamily A"""	29	protein-coding gene	gene with protein product	"""Tangier disease"""	600046		ABC1, HDLDT1		8088782, 10431236, 10431237, 10431238	Standard	NM_005502		Approved	TGD	uc004bcl.3	O95477	OTTHUMG00000020417	ENST00000374736.3:c.3476C>G	9.37:g.107579672G>C	ENSP00000363868:p.Ser1159Cys		Q5VX33|Q96S56|Q96T85|Q9NQV4|Q9UN06|Q9UN07|Q9UN08|Q9UN09	Missense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.S1159C	ENST00000374736.3	37	c.3476	CCDS6762.1	9	.	.	.	.	.	.	.	.	.	.	G	16.49	3.138117	0.56936	.	.	ENSG00000165029	ENST00000374736	D	0.89415	-2.51	5.88	5.88	0.94601	.	0.051493	0.85682	D	0.000000	D	0.89336	0.6686	M	0.70275	2.135	0.80722	D	1	B	0.17465	0.022	B	0.17979	0.02	D	0.84349	0.0531	10	0.37606	T	0.19	.	20.2422	0.98381	0.0:0.0:1.0:0.0	.	1159	O95477	ABCA1_HUMAN	C	1159	ENSP00000363868:S1159C	ENSP00000363868:S1159C	S	-	2	0	ABCA1	106619493	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.476000	0.97823	2.782000	0.95742	0.655000	0.94253	TCT	ABCA1	-	NULL	ENSG00000165029		0.582	ABCA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA1	HGNC	protein_coding	OTTHUMT00000053491.1	-	0.00	17	0	G	NM_005502		107579672	-1	tier1	-	no_errors	ENST00000374736	ensembl	human	known	74_37	missense	26.32	14	5	SNP	1.000	C
ABCC4	10257	genome.wustl.edu	37	13	95858835	95858835	+	Nonsense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr13:95858835G>C	ENST00000376887.4	-	8	1226	c.1112C>G	c.(1111-1113)tCa>tGa	p.S371*	ABCC4_ENST00000431522.1_Nonsense_Mutation_p.S371*|ABCC4_ENST00000412704.1_Nonsense_Mutation_p.S371*|ABCC4_ENST00000536256.1_Nonsense_Mutation_p.S296*|ABCC4_ENST00000538287.1_3'UTR	NM_005845.3	NP_005836.2	O15439	MRP4_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 4	371	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				blood coagulation (GO:0007596)|oxidation-reduction process (GO:0055114)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of smooth muscle cell proliferation (GO:0048661)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|response to organonitrogen compound (GO:0010243)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense granule membrane (GO:0031088)	15-hydroxyprostaglandin dehydrogenase (NAD+) activity (GO:0016404)|ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			breast(1)|central_nervous_system(4)|endometrium(5)|kidney(4)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	43	all_neural(89;0.0878)|Medulloblastoma(90;0.163)				Adefovir Dipivoxil(DB00718)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Cefazolin(DB01327)|Celecoxib(DB00482)|Conjugated Estrogens(DB00286)|Diclofenac(DB00586)|Dinoprostone(DB00917)|Dipyridamole(DB00975)|Fluorouracil(DB00544)|Flurbiprofen(DB00712)|Folic Acid(DB00158)|Gadoxetate(DB08884)|Glutathione(DB00143)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Lamivudine(DB00709)|Leucovorin(DB00650)|Meloxicam(DB00814)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Nateglinide(DB00731)|Oseltamivir(DB00198)|Probenecid(DB01032)|Rosuvastatin(DB01098)|Sildenafil(DB00203)|Sorafenib(DB00398)|Sulfinpyrazone(DB01138)|Sunitinib(DB01268)|Tenofovir(DB00300)|Tioguanine(DB00352)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)|Zidovudine(DB00495)	CTCAATGGCTGAGGGGAAGAA	0.537																																																	0													91.0	82.0	85.0					13																	95858835		2203	4300	6503	SO:0001587	stop_gained	0			U66682	CCDS9474.1	13q31	2012-03-14			ENSG00000125257	ENSG00000125257		"""ATP binding cassette transporters / subfamily C"""	55	protein-coding gene	gene with protein product	"""canalicular multispecific organic anion transporter (ABC superfamily)"", ""bA464I2.1 (ATP-binding cassette, sub-family C (CFTR/MRP), member 4)"", ""multidrug resistance-associated protein 4"", ""multispecific organic anion transporter B"""	605250				8894702, 9661885	Standard	NM_005845		Approved	MRP4, EST170205, MOAT-B, MOATB	uc001vmd.4	O15439	OTTHUMG00000017216	ENST00000376887.4:c.1112C>G	13.37:g.95858835G>C	ENSP00000366084:p.Ser371*		A9Z1Z7|Q8IVZ4|Q8IZN6|Q8NEW8|Q9Y6J2	Nonsense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC1_TM_dom,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom,prints_CysFib_conduc_TM	p.S371*	ENST00000376887.4	37	c.1112	CCDS9474.1	13	.	.	.	.	.	.	.	.	.	.	G	31	5.065740	0.93898	.	.	ENSG00000125257	ENST00000412704;ENST00000376887;ENST00000536256;ENST00000431522	.	.	.	5.34	5.34	0.76211	.	1.471380	0.03819	N	0.267215	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10636	T	0.68	.	18.6246	0.91333	0.0:0.0:1.0:0.0	.	.	.	.	X	371;371;296;371	.	ENSP00000366084:S371X	S	-	2	0	ABCC4	94656836	0.019000	0.18553	0.128000	0.21923	0.345000	0.29048	2.007000	0.40883	2.471000	0.83476	0.655000	0.94253	TCA	ABCC4	-	superfamily_ABC1_TM_dom,pfscan_ABC1_TM_dom,prints_CysFib_conduc_TM	ENSG00000125257		0.537	ABCC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC4	HGNC	protein_coding	OTTHUMT00000045478.2	-	0.00	28	0	G	NM_005845		95858835	-1	tier1	-	no_errors	ENST00000376887	ensembl	human	known	74_37	nonsense	17.86	23	5	SNP	0.058	C
ACAD10	80724	genome.wustl.edu	37	12	112143731	112143731	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr12:112143731G>C	ENST00000313698.4	+	4	681	c.526G>C	c.(526-528)Gat>Cat	p.D176H	ACAD10_ENST00000392636.2_5'UTR|ACAD10_ENST00000549590.1_Missense_Mutation_p.D176H|ACAD10_ENST00000455480.2_Missense_Mutation_p.D176H|ACAD10_ENST00000413681.3_3'UTR	NM_025247.5	NP_079523.3	Q6JQN1	ACD10_HUMAN	acyl-CoA dehydrogenase family, member 10	176						mitochondrion (GO:0005739)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|hydrolase activity (GO:0016787)|transferase activity, transferring phosphorus-containing groups (GO:0016772)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(17)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(5)	47						GAAACAGTTTGATGTGGTAAG	0.433																																																	0													84.0	83.0	83.0					12																	112143731		2203	4300	6503	SO:0001583	missense	0			AY323912	CCDS31903.1, CCDS44973.1	12q24.12	2012-10-02	2010-04-30		ENSG00000111271	ENSG00000111271			21597	protein-coding gene	gene with protein product		611181	"""acyl-Coenzyme A dehydrogenase family, member 10"""			15560374	Standard	NM_025247		Approved	MGC5601	uc009zvx.3	Q6JQN1	OTTHUMG00000169602	ENST00000313698.4:c.526G>C	12.37:g.112143731G>C	ENSP00000325137:p.Asp176His		G3XAJ0|Q8N828|Q8NAP2|Q96BX5	Missense_Mutation	SNP	pfam_Aminoglycoside_PTrfase,pfam_AcylCo_DH/oxidase_C,pfam_Acyl-CoA_DH_2_C,pfam_AcylCoA_DH/ox_N,pfam_Acyl-CoA_Oxase/DH_cen-dom,pfam_HAD-like_dom,superfamily_AcylCoA_DH/oxidase_NM_dom,superfamily_Kinase-like_dom,superfamily_AcylCo_DH/oxidase_C,superfamily_HAD-like_dom,prints_HAD-SF_hydro_IA,tigrfam_HAD-SF_ppase_IA/epoxid_hydro_N,tigrfam_HAD-SF_hydro_IA	p.D176H	ENST00000313698.4	37	c.526	CCDS31903.1	12	.	.	.	.	.	.	.	.	.	.	G	25.9	4.681100	0.88542	.	.	ENSG00000111271	ENST00000509936;ENST00000413681;ENST00000549590;ENST00000455480;ENST00000507135;ENST00000313698	T;T;T	0.09538	2.97;2.97;2.97	5.98	5.98	0.97165	Predicted HAD-superfamily phosphatase, subfamily IA/Epoxide hydrolase, N-terminal (1);Haloacid dehalogenase-like hydrolase (1);HAD-like domain (2);	0.000000	0.64402	D	0.000008	T	0.49389	0.1554	H	0.95294	3.65	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.992;1.0;1.0;0.999;1.0	T	0.62826	-0.6772	10	0.87932	D	0	.	20.0243	0.97517	0.0:0.0:1.0:0.0	.	176;176;176;176;176	G3XAJ0;F8VZG7;Q6JQN1;Q6JQN1-2;Q6JQN1-4	.;.;ACD10_HUMAN;.;.	H	176	ENSP00000446959:D176H;ENSP00000389813:D176H;ENSP00000325137:D176H	ENSP00000325137:D176H	D	+	1	0	ACAD10	110628114	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.204000	0.65180	2.833000	0.97629	0.655000	0.94253	GAT	ACAD10	-	pfam_HAD-like_dom,superfamily_HAD-like_dom,prints_HAD-SF_hydro_IA,tigrfam_HAD-SF_ppase_IA/epoxid_hydro_N,tigrfam_HAD-SF_hydro_IA	ENSG00000111271		0.433	ACAD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACAD10	HGNC	protein_coding	OTTHUMT00000368307.1	-	0.00	50	0	G	NM_025247		112143731	+1	tier1	-	no_errors	ENST00000455480	ensembl	human	known	74_37	missense	52.31	31	34	SNP	1.000	C
ACSL4	2182	genome.wustl.edu	37	X	108911423	108911423	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chrX:108911423G>C	ENST00000469796.2	-	11	1741	c.1345C>G	c.(1345-1347)Cag>Gag	p.Q449E	ACSL4_ENST00000340800.2_Missense_Mutation_p.Q449E|ACSL4_ENST00000348502.6_Missense_Mutation_p.Q408E			O60488	ACSL4_HUMAN	acyl-CoA synthetase long-chain family member 4	449					cellular lipid metabolic process (GO:0044255)|dendritic spine development (GO:0060996)|embryonic process involved in female pregnancy (GO:0060136)|fatty acid transport (GO:0015908)|lipid biosynthetic process (GO:0008610)|lipid metabolic process (GO:0006629)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|negative regulation of prostaglandin secretion (GO:0032307)|positive regulation of cell growth (GO:0030307)|response to interleukin-15 (GO:0070672)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|ER-mitochondrion membrane contact site (GO:0044233)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|neuronal cell body (GO:0043025)|peroxisome (GO:0005777)	arachidonate-CoA ligase activity (GO:0047676)|ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(6)|ovary(2)	22					Icosapent(DB00159)|Rosiglitazone(DB00412)	CGGTGTGTCTGAGGAGATAGC	0.498																																					Pancreas(188;358 2127 38547 41466 45492)												0													136.0	115.0	122.0					X																	108911423		2203	4300	6503	SO:0001583	missense	0			BC034959	CCDS14548.1, CCDS14549.1	Xq22.3-q23	2008-02-05	2004-02-19	2004-02-20	ENSG00000068366	ENSG00000068366		"""Acyl-CoA synthetase family"""	3571	protein-coding gene	gene with protein product	"""lignoceroyl-CoA synthase"", "" long-chain fatty-acid-Coenzyme A ligase 4"""	300157	"""fatty-acid-Coenzyme A ligase, long-chain 4"", ""mental retardation, X-linked 63"", ""mental retardation, X-linked 68"""	FACL4, MRX63, MRX68		9480748, 12949969	Standard	NM_022977		Approved	ACS4, LACS4	uc004eoi.2	O60488	OTTHUMG00000022190	ENST00000469796.2:c.1345C>G	X.37:g.108911423G>C	ENSP00000419171:p.Gln449Glu		D3DUY2|O60848|O60849|Q5JWV8	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.Q449E	ENST00000469796.2	37	c.1345	CCDS14548.1	X	.	.	.	.	.	.	.	.	.	.	G	11.56	1.676220	0.29783	.	.	ENSG00000068366	ENST00000348502;ENST00000469796;ENST00000340800	T;T;T	0.08008	3.14;3.14;3.14	5.65	4.78	0.61160	AMP-dependent synthetase/ligase (1);	0.171941	0.52532	D	0.000079	T	0.03739	0.0106	N	0.02286	-0.61	0.37662	D	0.922822	B	0.09022	0.002	B	0.17098	0.017	T	0.34079	-0.9843	10	0.08837	T	0.75	-10.1619	15.1018	0.72284	0.0:0.0:0.8574:0.1426	.	449	O60488	ACSL4_HUMAN	E	408;449;449	ENSP00000262835:Q408E;ENSP00000419171:Q449E;ENSP00000339787:Q449E	ENSP00000339787:Q449E	Q	-	1	0	ACSL4	108798079	1.000000	0.71417	0.790000	0.31976	0.959000	0.62525	7.018000	0.76406	1.130000	0.42092	0.600000	0.82982	CAG	ACSL4	-	pfam_AMP-dep_Synth/Lig	ENSG00000068366		0.498	ACSL4-003	KNOWN	basic|CCDS	protein_coding	ACSL4	HGNC	protein_coding	OTTHUMT00000358155.2	-	0.00	26	0	G	NM_004458		108911423	-1	tier1	-	no_errors	ENST00000340800	ensembl	human	known	74_37	missense	46.51	23	20	SNP	0.988	C
ACVR1B	91	genome.wustl.edu	37	12	52380666	52380666	+	Missense_Mutation	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr12:52380666G>A	ENST00000257963.4	+	7	1278	c.1201G>A	c.(1201-1203)Gct>Act	p.A401T	ACVR1B_ENST00000542485.1_Missense_Mutation_p.A349T|ACVR1B_ENST00000426655.2_Missense_Mutation_p.A401T|RNU6-574P_ENST00000384265.1_RNA|ACVR1B_ENST00000415850.2_Missense_Mutation_p.A401T|ACVR1B_ENST00000563121.1_Intron|ACVR1B_ENST00000541224.1_Missense_Mutation_p.A442T	NM_004302.4|NM_020328.3	NP_004293.1|NP_064733.3	P36896	ACV1B_HUMAN	activin A receptor, type IB	401	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activin receptor signaling pathway (GO:0032924)|central nervous system development (GO:0007417)|development of primary female sexual characteristics (GO:0046545)|extrinsic apoptotic signaling pathway (GO:0097191)|G1/S transition of mitotic cell cycle (GO:0000082)|hair follicle development (GO:0001942)|in utero embryonic development (GO:0001701)|negative regulation of cell growth (GO:0030308)|nodal signaling pathway (GO:0038092)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of trophoblast cell migration (GO:1901165)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	activin receptor activity, type I (GO:0016361)|ATP binding (GO:0005524)|inhibin binding (GO:0034711)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)|ubiquitin protein ligase binding (GO:0031625)			breast(5)|endometrium(4)|kidney(5)|large_intestine(12)|lung(10)|ovary(1)|pancreas(6)|prostate(1)	44				BRCA - Breast invasive adenocarcinoma(357;0.104)	Adenosine triphosphate(DB00171)	CTTTAAATGTGCTGATATTTA	0.413																																																	0													129.0	125.0	127.0					12																	52380666		2203	4300	6503	SO:0001583	missense	0				CCDS8816.1, CCDS44893.1, CCDS44894.1, CCDS44893.2, CCDS44894.2	12q13	2006-11-09			ENSG00000135503	ENSG00000135503			172	protein-coding gene	gene with protein product		601300		ACVRLK4		8397373	Standard	NM_020327		Approved	ALK4, SKR2, ActRIB	uc010snn.2	P36896	OTTHUMG00000167920	ENST00000257963.4:c.1201G>A	12.37:g.52380666G>A	ENSP00000257963:p.Ala401Thr		B7Z5L8|B7Z5W5|Q15479|Q15480|Q15481|Q15482	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_TGF_beta_rcpt_GS,pfam_Activin_rcpt,superfamily_Kinase-like_dom,smart_TGF_beta_rcpt_GS,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.A401T	ENST00000257963.4	37	c.1201	CCDS8816.1	12	.	.	.	.	.	.	.	.	.	.	G	29.9	5.044077	0.93685	.	.	ENSG00000135503	ENST00000257963;ENST00000541224;ENST00000426655;ENST00000415850;ENST00000542485	D;D;D;D;D	0.93659	-3.26;-3.26;-3.26;-3.26;-3.26	4.77	4.77	0.60923	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.95564	0.8558	L	0.55834	1.745	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;1.0;0.996	D;D;D;D	0.78314	0.982;0.982;0.991;0.914	D	0.94589	0.7786	10	0.38643	T	0.18	.	18.3723	0.90411	0.0:0.0:1.0:0.0	.	442;401;401;401	P36896-4;P36896;P36896-2;P36896-3	.;ACV1B_HUMAN;.;.	T	401;442;401;401;349	ENSP00000257963:A401T;ENSP00000442656:A442T;ENSP00000390477:A401T;ENSP00000397550:A401T;ENSP00000442885:A349T	ENSP00000257963:A401T	A	+	1	0	ACVR1B	50666933	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.657000	0.98554	2.668000	0.90789	0.563000	0.77884	GCT	ACVR1B	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000135503		0.413	ACVR1B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ACVR1B	HGNC	protein_coding	OTTHUMT00000397000.1	-	0.00	38	0	G	NM_020328		52380666	+1	tier1	-	no_errors	ENST00000257963	ensembl	human	known	74_37	missense	14.58	41	7	SNP	1.000	A
ADAM23	8745	genome.wustl.edu	37	2	207346014	207346014	+	Missense_Mutation	SNP	T	T	C	rs111649087		TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr2:207346014T>C	ENST00000264377.3	+	3	819	c.491T>C	c.(490-492)cTt>cCt	p.L164P	ADAM23_ENST00000374415.3_Missense_Mutation_p.L164P|ADAM23_ENST00000374416.1_Missense_Mutation_p.L164P	NM_003812.2	NP_003803.1	O75077	ADA23_HUMAN	ADAM metallopeptidase domain 23	164					cell adhesion (GO:0007155)|central nervous system development (GO:0007417)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|endometrium(6)|kidney(3)|large_intestine(5)|liver(2)|lung(22)|ovary(2)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	51				LUSC - Lung squamous cell carcinoma(261;0.0961)|Lung(261;0.182)|Epithelial(149;0.205)		AAATTCATTCTTGACCTCATA	0.373																																					Melanoma(194;1127 2130 19620 24042 27855)												0													57.0	58.0	57.0					2																	207346014		2203	4300	6503	SO:0001583	missense	0			AB009672	CCDS2369.1	2q33	2008-06-12	2005-08-18		ENSG00000114948	ENSG00000114948		"""ADAM metallopeptidase domain containing"""	202	protein-coding gene	gene with protein product		603710	"""a disintegrin and metalloproteinase domain 23"""			9693107	Standard	NM_003812		Approved	MDC3	uc002vbq.4	O75077	OTTHUMG00000132919	ENST00000264377.3:c.491T>C	2.37:g.207346014T>C	ENSP00000264377:p.Leu164Pro		A2RU59	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_EG-like_dom,pfscan_Peptidase_M12B	p.L164P	ENST00000264377.3	37	c.491	CCDS2369.1	2	.	.	.	.	.	.	.	.	.	.	T	16.49	3.138897	0.56936	.	.	ENSG00000114948	ENST00000264377;ENST00000374416;ENST00000431817;ENST00000374415	T;T;T	0.22336	1.96;1.96;1.96	5.04	5.04	0.67666	Peptidase M12B, propeptide (1);	0.000000	0.48767	D	0.000178	T	0.42944	0.1225	M	0.90705	3.14	0.80722	D	1	B	0.26635	0.155	B	0.40038	0.317	T	0.50432	-0.8829	10	0.87932	D	0	.	14.0463	0.64706	0.0:0.0:0.0:1.0	.	164	O75077	ADA23_HUMAN	P	164;164;58;164	ENSP00000264377:L164P;ENSP00000363537:L164P;ENSP00000363536:L164P	ENSP00000264377:L164P	L	+	2	0	ADAM23	207054259	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.454000	0.73493	2.016000	0.59253	0.528000	0.53228	CTT	ADAM23	-	pfam_Peptidase_M12B_N	ENSG00000114948		0.373	ADAM23-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ADAM23	HGNC	protein_coding	OTTHUMT00000256431.2	-	0.00	44	0	T	NM_003812		207346014	+1	tier1	rs111649087	no_errors	ENST00000264377	ensembl	human	known	74_37	missense	33.33	34	17	SNP	1.000	C
ADAMTSL4	54507	genome.wustl.edu	37	1	150528034	150528034	+	Missense_Mutation	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:150528034G>A	ENST00000369038.2	+	6	1565	c.1364G>A	c.(1363-1365)cGc>cAc	p.R455H	ADAMTSL4_ENST00000271643.4_Missense_Mutation_p.R455H|RP11-54A4.2_ENST00000442435.2_RNA|ADAMTSL4_ENST00000369041.5_Missense_Mutation_p.R455H|ADAMTSL4_ENST00000369039.5_Missense_Mutation_p.R478H			Q6UY14	ATL4_HUMAN	ADAMTS-like 4	455					apoptotic process (GO:0006915)|extracellular matrix organization (GO:0030198)|positive regulation of apoptotic process (GO:0043065)	interstitial matrix (GO:0005614)	metalloendopeptidase activity (GO:0004222)|protease binding (GO:0002020)	p.R455H(1)		breast(1)|cervix(1)|endometrium(6)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(3)	32	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			GTGGCTGGACGCTGTCTGGTG	0.547																																																	1	Substitution - Missense(1)	ovary(1)											82.0	73.0	76.0					1																	150528034		2203	4300	6503	SO:0001583	missense	0			BC027478	CCDS955.1, CCDS30852.1, CCDS72908.1	1q21.2	2008-02-05	2005-12-01	2005-12-01	ENSG00000143382	ENSG00000143382			19706	protein-coding gene	gene with protein product		610113	"""thrombospondin repeat containing 1"""	TSRC1		12706885	Standard	NM_019032		Approved	DKFZP434K1772	uc001eux.3	Q6UY14	OTTHUMG00000034863	ENST00000369038.2:c.1364G>A	1.37:g.150528034G>A	ENSP00000358034:p.Arg455His		B2RTT0|F8WAD0|Q5T5F7|Q6IPM6|Q8N643|Q9HBS6	Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt	p.R478H	ENST00000369038.2	37	c.1433	CCDS955.1	1	.	.	.	.	.	.	.	.	.	.	G	14.40	2.525224	0.44969	.	.	ENSG00000143382	ENST00000369041;ENST00000271643;ENST00000369039;ENST00000369038	T;T;T;T	0.70164	0.04;0.04;-0.46;0.04	4.69	1.78	0.24846	.	.	.	.	.	T	0.36468	0.0968	L	0.48642	1.525	0.49798	D	0.999823	B;B;B;B	0.28667	0.171;0.069;0.14;0.219	B;B;B;B	0.21360	0.021;0.022;0.015;0.034	T	0.22730	-1.0208	9	0.51188	T	0.08	.	6.8714	0.24123	0.3773:0.0:0.6227:0.0	.	478;478;455;455	B7ZMJ3;F8WAD0;Q6UY14;Q6UY14-2	.;.;ATL4_HUMAN;.	H	455;455;478;455	ENSP00000358037:R455H;ENSP00000271643:R455H;ENSP00000358035:R478H;ENSP00000358034:R455H	ENSP00000271643:R455H	R	+	2	0	ADAMTSL4	148794658	0.961000	0.32948	0.998000	0.56505	0.969000	0.65631	0.685000	0.25378	0.203000	0.20529	-0.258000	0.10820	CGC	ADAMTSL4	-	NULL	ENSG00000143382		0.547	ADAMTSL4-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	ADAMTSL4	HGNC	protein_coding	OTTHUMT00000084395.4		0.00	14	0	G	NM_019032		150528034	+1			no_errors	ENST00000369039	ensembl	human	known	74_37	missense	12.50	14	2	SNP	0.993	A
ADCK4	79934	genome.wustl.edu	37	19	41206253	41206253	+	Missense_Mutation	SNP	C	C	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr19:41206253C>A	ENST00000324464.3	-	11	1298	c.997G>T	c.(997-999)Gac>Tac	p.D333Y	ADCK4_ENST00000243583.6_Missense_Mutation_p.D292Y|ADCK4_ENST00000450541.1_Missense_Mutation_p.D292Y	NM_024876.3	NP_079152.3	Q96D53	ADCK4_HUMAN	aarF domain containing kinase 4	333	Protein kinase.					integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|endometrium(3)|large_intestine(3)|lung(6)|stomach(2)|urinary_tract(1)	17			Lung(22;9.49e-05)|LUSC - Lung squamous cell carcinoma(20;0.000219)			TGGCACTGGTCCAGGGGGACC	0.667																																																	0													38.0	41.0	40.0					19																	41206253		2203	4300	6503	SO:0001583	missense	0			AK022291	CCDS12562.1, CCDS46081.1	19q13.2	2008-02-05				ENSG00000123815			19041	protein-coding gene	gene with protein product		615567					Standard	NM_024876		Approved	FLJ12229, COQ8	uc002oor.2	Q96D53		ENST00000324464.3:c.997G>T	19.37:g.41206253C>A	ENSP00000315118:p.Asp333Tyr		Q8TAJ1|Q9HA52	Missense_Mutation	SNP	pfam_UbiB_dom,superfamily_Kinase-like_dom	p.D333Y	ENST00000324464.3	37	c.997	CCDS12562.1	19	.	.	.	.	.	.	.	.	.	.	C	27.1	4.799317	0.90538	.	.	ENSG00000123815	ENST00000324464;ENST00000450541;ENST00000243583	T;T;T	0.56611	0.45;0.45;0.45	5.75	5.75	0.90469	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.79040	0.4379	M	0.90369	3.11	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.996;0.999	T	0.82788	-0.0284	10	0.87932	D	0	-24.4413	18.7097	0.91652	0.0:1.0:0.0:0.0	.	333;292	Q96D53;Q96D53-2	ADCK4_HUMAN;.	Y	333;292;292	ENSP00000315118:D333Y;ENSP00000412839:D292Y;ENSP00000243583:D292Y	ENSP00000243583:D292Y	D	-	1	0	ADCK4	45898093	1.000000	0.71417	1.000000	0.80357	0.823000	0.46562	7.677000	0.84024	2.720000	0.93068	0.563000	0.77884	GAC	ADCK4	-	superfamily_Kinase-like_dom	ENSG00000123815		0.667	ADCK4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ADCK4	HGNC	protein_coding	OTTHUMT00000462731.1		0.00	27	0	C	NM_024876		41206253	-1			no_errors	ENST00000324464	ensembl	human	known	74_37	missense	12.00	22	3	SNP	1.000	A
AGR3	155465	genome.wustl.edu	37	7	16901016	16901016	+	Missense_Mutation	SNP	A	A	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr7:16901016A>C	ENST00000310398.2	-	6	429	c.359T>G	c.(358-360)aTg>aGg	p.M120R	AGR3_ENST00000402239.3_Missense_Mutation_p.M120R	NM_176813.3	NP_789783.1	Q8TD06	AGR3_HUMAN	anterior gradient 3	120						extracellular region (GO:0005576)	dystroglycan binding (GO:0002162)			central_nervous_system(1)|kidney(8)|lung(2)|skin(1)|stomach(1)	13	Lung NSC(10;0.0376)|all_lung(11;0.0721)|all_epithelial(12;0.202)			UCEC - Uterine corpus endometrioid carcinoma (126;0.184)		ACCTACAAACATGATTCTAGG	0.313																																																	0													124.0	122.0	123.0					7																	16901016		2203	4298	6501	SO:0001583	missense	0			AY069977	CCDS5365.1	7p21.1	2013-07-31	2013-07-31		ENSG00000173467	ENSG00000173467		"""Protein disulfide isomerases"""	24167	protein-coding gene	gene with protein product	"""breast cancer membrane protein 11"", ""protein disulfide isomerase family A, member 18"""	609482	"""anterior gradient 3 homolog (Xenopus laevis)"""			12592373, 12477722	Standard	NM_176813		Approved	HAG3, hAG-3, BCMP11, PDIA18	uc003sts.3	Q8TD06	OTTHUMG00000128411	ENST00000310398.2:c.359T>G	7.37:g.16901016A>C	ENSP00000308606:p.Met120Arg		A4D120	Missense_Mutation	SNP	superfamily_Thioredoxin-like_fold	p.M120R	ENST00000310398.2	37	c.359	CCDS5365.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.22|18.22	3.574925|3.574925	0.65878|0.65878	.|.	.|.	ENSG00000173467|ENSG00000173467	ENST00000414935|ENST00000310398;ENST00000402239	.|T;T	.|0.41400	.|1.0;1.0	4.81|4.81	4.81|4.81	0.61882|0.61882	.|Thioredoxin-like fold (2);	.|0.000000	.|0.64402	.|D	.|0.000001	T|T	0.60143|0.60143	0.2246|0.2246	M|M	0.63843|0.63843	1.955|1.955	0.80722|0.80722	D|D	1|1	.|D	.|0.76494	.|0.999	.|D	.|0.68943	.|0.961	T|T	0.64317|0.64317	-0.6436|-0.6436	5|10	.|0.72032	.|D	.|0.01	-4.183|-4.183	14.0507|14.0507	0.64734|0.64734	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|120	.|Q8TD06	.|AGR3_HUMAN	Q|R	98|120	.|ENSP00000308606:M120R;ENSP00000386016:M120R	.|ENSP00000308606:M120R	H|M	-|-	3|2	2|0	AGR3|AGR3	16867541|16867541	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	5.287000|5.287000	0.65645|0.65645	1.806000|1.806000	0.52798|0.52798	0.533000|0.533000	0.62120|0.62120	CAT|ATG	AGR3	-	superfamily_Thioredoxin-like_fold	ENSG00000173467		0.313	AGR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGR3	HGNC	protein_coding	OTTHUMT00000250191.2	-	0.00	69	0	A	NM_176813		16901016	-1	tier1	-	no_errors	ENST00000310398	ensembl	human	known	74_37	missense	22.97	57	17	SNP	1.000	C
AHCTF1	25909	genome.wustl.edu	37	1	247076622	247076622	+	Silent	SNP	T	T	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:247076622T>C	ENST00000391829.2	-	4	591	c.468A>G	c.(466-468)gcA>gcG	p.A156A	AHCTF1_ENST00000366508.1_Silent_p.A191A|AHCTF1_ENST00000326225.3_Silent_p.A165A			Q8WYP5	ELYS_HUMAN	AT hook containing transcription factor 1	156	Necessary for cytoplasmic localization. {ECO:0000250}.|Seven-bladed beta propeller repeats. {ECO:0000250}.				cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(6)|cervix(3)|endometrium(8)|kidney(6)|large_intestine(12)|liver(2)|lung(21)|ovary(5)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	74	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			TGACCACAGCTGCCACTCCAA	0.418																																					Colon(145;197 1800 4745 15099 26333)												0													68.0	70.0	70.0					1																	247076622		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS1629.1, CCDS1629.2	1q44	2008-09-09			ENSG00000153207	ENSG00000153207			24618	protein-coding gene	gene with protein product	"""ELYS transcription factor like protein TMBS62"""	610853				11952839	Standard	NM_015446		Approved	ELYS	uc001ibv.2	Q8WYP5	OTTHUMG00000040706	ENST00000391829.2:c.468A>G	1.37:g.247076622T>C			A6NGM0|A8MSG9|A8MZ86|Q7Z4E3|Q8IZA4|Q96EH9|Q9Y4Q6	Silent	SNP	superfamily_Quinonprotein_ADH-like_supfam	p.A165	ENST00000391829.2	37	c.495		1																																																																																			AHCTF1	-	superfamily_Quinonprotein_ADH-like_supfam	ENSG00000153207		0.418	AHCTF1-201	KNOWN	basic|appris_candidate	protein_coding	AHCTF1	HGNC	protein_coding		-	0.00	61	0	T	NM_015446		247076622	-1	tier1	-	no_errors	ENST00000326225	ensembl	human	known	74_37	silent	34.88	56	30	SNP	0.997	C
AHNAK	79026	genome.wustl.edu	37	11	62297376	62297376	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr11:62297376C>G	ENST00000378024.4	-	5	4787	c.4513G>C	c.(4513-4515)Gac>Cac	p.D1505H	AHNAK_ENST00000530124.1_Intron|AHNAK_ENST00000257247.7_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	1505					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				AGGTGCCAGTCTGGGCCATGA	0.483																																																	0													193.0	204.0	201.0					11																	62297376		2202	4299	6501	SO:0001583	missense	0			M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.4513G>C	11.37:g.62297376C>G	ENSP00000367263:p.Asp1505His		A1A586	Missense_Mutation	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.D1505H	ENST00000378024.4	37	c.4513	CCDS31584.1	11	.	.	.	.	.	.	.	.	.	.	c	16.45	3.126141	0.56721	.	.	ENSG00000124942	ENST00000378024	T	0.05513	3.43	4.34	4.34	0.51931	.	0.289604	0.33916	N	0.004426	T	0.30355	0.0762	M	0.88181	2.935	0.26941	N	0.966256	D	0.76494	0.999	D	0.75484	0.986	T	0.18777	-1.0326	10	0.48119	T	0.1	.	16.5107	0.84284	0.0:1.0:0.0:0.0	.	1505	Q09666	AHNK_HUMAN	H	1505	ENSP00000367263:D1505H	ENSP00000367263:D1505H	D	-	1	0	AHNAK	62053952	0.993000	0.37304	1.000000	0.80357	0.961000	0.63080	5.626000	0.67777	1.973000	0.57446	0.450000	0.29827	GAC	AHNAK	-	NULL	ENSG00000124942		0.483	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK	HGNC	protein_coding	OTTHUMT00000395572.1	-	0.00	70	0	C	NM_024060		62297376	-1	tier1	-	no_errors	ENST00000378024	ensembl	human	known	74_37	missense	11.65	91	12	SNP	1.000	G
AHNAK	79026	genome.wustl.edu	37	11	62298039	62298039	+	Missense_Mutation	SNP	C	C	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr11:62298039C>A	ENST00000378024.4	-	5	4124	c.3850G>T	c.(3850-3852)Gat>Tat	p.D1284Y	AHNAK_ENST00000530124.1_Intron|AHNAK_ENST00000257247.7_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	1284					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				CCTGAGACATCAATGTCAGCC	0.532																																																	0													192.0	198.0	196.0					11																	62298039		2202	4299	6501	SO:0001583	missense	0			M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.3850G>T	11.37:g.62298039C>A	ENSP00000367263:p.Asp1284Tyr		A1A586	Missense_Mutation	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.D1284Y	ENST00000378024.4	37	c.3850	CCDS31584.1	11	.	.	.	.	.	.	.	.	.	.	c	7.898	0.733715	0.15574	.	.	ENSG00000124942	ENST00000378024	T	0.03441	3.93	4.89	3.98	0.46160	.	0.000000	0.32655	U	0.005813	T	0.23451	0.0567	H	0.96518	3.835	0.23876	N	0.996599	D	0.58620	0.983	P	0.58873	0.847	T	0.33904	-0.9850	10	0.72032	D	0.01	.	13.1085	0.59261	0.0:0.921:0.0:0.079	.	1284	Q09666	AHNK_HUMAN	Y	1284	ENSP00000367263:D1284Y	ENSP00000367263:D1284Y	D	-	1	0	AHNAK	62054615	0.060000	0.20803	0.032000	0.17829	0.004000	0.04260	2.306000	0.43673	1.197000	0.43143	-0.142000	0.14014	GAT	AHNAK	-	NULL	ENSG00000124942		0.532	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK	HGNC	protein_coding	OTTHUMT00000395572.1	-	0.00	89	0	C	NM_024060		62298039	-1	tier1	-	no_errors	ENST00000378024	ensembl	human	known	74_37	missense	15.93	95	18	SNP	0.599	A
AHNAK	79026	genome.wustl.edu	37	11	62298750	62298750	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr11:62298750C>G	ENST00000378024.4	-	5	3413	c.3139G>C	c.(3139-3141)Gaa>Caa	p.E1047Q	AHNAK_ENST00000530124.1_Intron|AHNAK_ENST00000257247.7_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	1047					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				AACTTCCCTTCAGGTCCTTCA	0.463																																																	0													88.0	88.0	88.0					11																	62298750		2202	4299	6501	SO:0001583	missense	0			M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.3139G>C	11.37:g.62298750C>G	ENSP00000367263:p.Glu1047Gln		A1A586	Missense_Mutation	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.E1047Q	ENST00000378024.4	37	c.3139	CCDS31584.1	11	.	.	.	.	.	.	.	.	.	.	N	15.71	2.912991	0.52439	.	.	ENSG00000124942	ENST00000378024	T	0.01119	5.31	4.76	4.76	0.60689	.	0.418455	0.25450	N	0.030592	T	0.10121	0.0248	M	0.93854	3.465	0.33812	D	0.627962	D	0.71674	0.998	D	0.79784	0.993	T	0.41448	-0.9508	10	0.23891	T	0.37	-29.8647	17.4048	0.87470	0.0:1.0:0.0:0.0	.	1047	Q09666	AHNK_HUMAN	Q	1047	ENSP00000367263:E1047Q	ENSP00000367263:E1047Q	E	-	1	0	AHNAK	62055326	0.927000	0.31430	1.000000	0.80357	0.956000	0.61745	3.192000	0.50989	2.201000	0.70794	0.555000	0.69702	GAA	AHNAK	-	NULL	ENSG00000124942		0.463	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK	HGNC	protein_coding	OTTHUMT00000395572.1	-	0.00	65	0	C	NM_024060		62298750	-1	tier1	-	no_errors	ENST00000378024	ensembl	human	known	74_37	missense	13.70	63	10	SNP	1.000	G
AKAP9	10142	genome.wustl.edu	37	7	91630582	91630582	+	Nonsense_Mutation	SNP	G	G	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr7:91630582G>T	ENST00000359028.2	+	9	1612	c.1387G>T	c.(1387-1389)Gaa>Taa	p.E463*	AKAP9_ENST00000358100.2_Nonsense_Mutation_p.E463*|AKAP9_ENST00000356239.3_Nonsense_Mutation_p.E451*			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9	463	Glu-rich.				G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)			NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			AATGAAACAAGAATTAATAAG	0.378			T	BRAF	papillary thyroid																																			Dom	yes		7	7q21-q22	10142	A kinase (PRKA) anchor protein (yotiao) 9		E	0													104.0	111.0	109.0					7																	91630582		2203	4300	6503	SO:0001587	stop_gained	0			AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.1387G>T	7.37:g.91630582G>T	ENSP00000351922:p.Glu463*		A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	Nonsense_Mutation	SNP	pfam_PACT_domain,superfamily_Prefoldin,superfamily_YbaB	p.E463*	ENST00000359028.2	37	c.1387		7	.	.	.	.	.	.	.	.	.	.	G	38	6.909997	0.97928	.	.	ENSG00000127914	ENST00000356239;ENST00000359028;ENST00000358100;ENST00000413120;ENST00000394565	.	.	.	5.56	5.56	0.83823	.	0.000000	0.42548	D	0.000682	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.8856	0.96911	0.0:0.0:1.0:0.0	.	.	.	.	X	451;463;463;463;463	.	ENSP00000348573:E451X	E	+	1	0	AKAP9	91468518	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.790000	0.85794	2.771000	0.95319	0.650000	0.86243	GAA	AKAP9	-	NULL	ENSG00000127914		0.378	AKAP9-202	KNOWN	basic	protein_coding	AKAP9	HGNC	protein_coding		-	0.00	64	0	G	NM_005751		91630582	+1	tier1	-	no_errors	ENST00000359028	ensembl	human	known	74_37	nonsense	26.09	34	12	SNP	1.000	T
AKAP9	10142	genome.wustl.edu	37	7	91631497	91631497	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr7:91631497G>C	ENST00000359028.2	+	9	2527	c.2302G>C	c.(2302-2304)Gaa>Caa	p.E768Q	AKAP9_ENST00000358100.2_Missense_Mutation_p.E768Q|AKAP9_ENST00000356239.3_Missense_Mutation_p.E756Q			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9	768	Glu-rich.				G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)			NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			AGAATTGTTAGAAAAACAGAT	0.299			T	BRAF	papillary thyroid																																			Dom	yes		7	7q21-q22	10142	A kinase (PRKA) anchor protein (yotiao) 9		E	0													43.0	49.0	47.0					7																	91631497		2190	4290	6480	SO:0001583	missense	0			AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.2302G>C	7.37:g.91631497G>C	ENSP00000351922:p.Glu768Gln		A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	Missense_Mutation	SNP	pfam_PACT_domain,superfamily_Prefoldin,superfamily_YbaB	p.E768Q	ENST00000359028.2	37	c.2302		7	.	.	.	.	.	.	.	.	.	.	G	9.220	1.033167	0.19590	.	.	ENSG00000127914	ENST00000356239;ENST00000359028;ENST00000358100;ENST00000413120;ENST00000394565	T;T;T	0.48522	0.81;0.81;0.81	5.73	4.85	0.62838	.	0.000000	0.42172	D	0.000755	T	0.53867	0.1823	L	0.55103	1.725	0.36903	D	0.89052	P;P;B;P	0.45715	0.787;0.865;0.361;0.545	B;P;B;B	0.49665	0.413;0.618;0.104;0.209	T	0.59762	-0.7393	10	0.32370	T	0.25	.	16.2214	0.82262	0.0:0.2952:0.7048:0.0	.	768;756;756;768	Q99996;Q99996-2;Q99996-3;A4D1E4	AKAP9_HUMAN;.;.;.	Q	756;768;768;768;768	ENSP00000348573:E756Q;ENSP00000351922:E768Q;ENSP00000350813:E768Q	ENSP00000348573:E756Q	E	+	1	0	AKAP9	91469433	1.000000	0.71417	1.000000	0.80357	0.616000	0.37450	4.813000	0.62620	1.565000	0.49641	0.650000	0.86243	GAA	AKAP9	-	NULL	ENSG00000127914		0.299	AKAP9-202	KNOWN	basic	protein_coding	AKAP9	HGNC	protein_coding		-	0.00	185	0	G	NM_005751		91631497	+1	tier1	-	no_errors	ENST00000359028	ensembl	human	known	74_37	missense	27.08	174	65	SNP	1.000	C
AMZ2	51321	genome.wustl.edu	37	17	66250605	66250605	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr17:66250605G>T	ENST00000359904.3	+	5	1779	c.647G>T	c.(646-648)gGc>gTc	p.G216V	AMZ2_ENST00000577273.1_Intron|AMZ2_ENST00000580753.1_Missense_Mutation_p.G216V|AMZ2_ENST00000392720.2_Missense_Mutation_p.G216V|AMZ2_ENST00000577985.1_Missense_Mutation_p.G216V|AMZ2_ENST00000585050.1_Intron|AMZ2_ENST00000577866.1_Missense_Mutation_p.G216V|AMZ2_ENST00000359783.4_Missense_Mutation_p.G158V	NM_016627.4	NP_057711.3	Q86W34	AMZ2_HUMAN	archaelysin family metallopeptidase 2	216							metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)	9	all_cancers(12;1.12e-09)		BRCA - Breast invasive adenocarcinoma(8;3.17e-08)|LUSC - Lung squamous cell carcinoma(166;0.24)			CACTATAAAGGCAAAGTGAAG	0.363																																																	0													102.0	95.0	98.0					17																	66250605		2203	4300	6503	SO:0001583	missense	0			CR609550	CCDS11674.1, CCDS32714.1	17q24.2	2010-04-08			ENSG00000196704	ENSG00000196704			28041	protein-coding gene	gene with protein product	"""archaemetzincin-2"""	615169				15972818	Standard	XM_005257436		Approved		uc002jgr.1	Q86W34		ENST00000359904.3:c.647G>T	17.37:g.66250605G>T	ENSP00000352976:p.Gly216Val		A6NLD9|B3KR44|Q5XKF1|Q9NZE2	Missense_Mutation	SNP	pfam_Pept_M54_archaemetzincn	p.G216V	ENST00000359904.3	37	c.647	CCDS11674.1	17	.	.	.	.	.	.	.	.	.	.	G	9.915	1.210496	0.22289	.	.	ENSG00000196704	ENST00000359904;ENST00000359783;ENST00000392720	T;T;T	0.21543	2.0;2.0;2.0	5.12	5.12	0.69794	.	0.083576	0.46145	D	0.000305	T	0.47911	0.1471	M	0.73598	2.24	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.77004	0.973;0.989	T	0.46762	-0.9168	10	0.72032	D	0.01	-3.6771	16.9302	0.86188	0.0:0.0:1.0:0.0	.	158;216	A6NLD9;Q86W34	.;AMZ2_HUMAN	V	216;158;216	ENSP00000352976:G216V;ENSP00000352831:G158V;ENSP00000376481:G216V	ENSP00000352831:G158V	G	+	2	0	AMZ2	63762200	1.000000	0.71417	0.992000	0.48379	0.252000	0.25951	7.720000	0.84759	2.775000	0.95449	0.632000	0.83419	GGC	AMZ2	-	NULL	ENSG00000196704		0.363	AMZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMZ2	HGNC	protein_coding	OTTHUMT00000448261.1	-	0.00	66	0	G	NM_016627		66250605	+1	tier1	-	no_errors	ENST00000359904	ensembl	human	known	74_37	missense	11.11	32	4	SNP	1.000	T
ANAPC13	25847	genome.wustl.edu	37	3	134201686	134201686	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr3:134201686C>G	ENST00000510994.1	-	2	791	c.61G>C	c.(61-63)Gaa>Caa	p.E21Q	CEP63_ENST00000354446.3_5'Flank|ANAPC13_ENST00000514612.1_Missense_Mutation_p.E21Q|CEP63_ENST00000332047.5_5'Flank|ANAPC13_ENST00000354910.5_Missense_Mutation_p.E21Q|ANAPC13_ENST00000511751.1_Missense_Mutation_p.E21Q	NM_001242374.1	NP_001229303.1	Q9BS18	APC13_HUMAN	anaphase promoting complex subunit 13	21					mitotic nuclear division (GO:0007067)|protein K11-linked ubiquitination (GO:0070979)	anaphase-promoting complex (GO:0005680)				lung(1)|skin(1)	2						AGCTTGTCTTCTCGCCAAGCA	0.443																																																	0													326.0	295.0	305.0					3																	134201686		2203	4300	6503	SO:0001583	missense	0			AF086169	CCDS3085.1	3q22.1	2011-06-15				ENSG00000129055		"""Anaphase promoting complex subunits"""	24540	protein-coding gene	gene with protein product		614484				15060174	Standard	NM_015391		Approved	SWM1, APC13, DKFZP566D193	uc003eqi.3	Q9BS18		ENST00000510994.1:c.61G>C	3.37:g.134201686C>G	ENSP00000421842:p.Glu21Gln		Q9Y3V0	Missense_Mutation	SNP	pfam_Apc13p	p.E21Q	ENST00000510994.1	37	c.61	CCDS3085.1	3	.	.	.	.	.	.	.	.	.	.	C	26.6	4.749853	0.89753	.	.	ENSG00000129055	ENST00000510994;ENST00000354910;ENST00000514612;ENST00000511751	.	.	.	5.29	5.29	0.74685	.	0.000000	0.64402	U	0.000003	T	0.61862	0.2381	.	.	.	0.80722	D	1	P	0.47841	0.901	P	0.47102	0.537	T	0.60811	-0.7189	8	0.37606	T	0.19	-16.5026	18.9067	0.92466	0.0:1.0:0.0:0.0	.	21	Q9BS18	APC13_HUMAN	Q	21	.	ENSP00000346987:E21Q	E	-	1	0	ANAPC13	135684376	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.663000	0.83820	2.629000	0.89072	0.561000	0.74099	GAA	ANAPC13	-	pfam_Apc13p	ENSG00000129055		0.443	ANAPC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANAPC13	HGNC	protein_coding	OTTHUMT00000357412.1	-	0.00	56	0	C	NM_015391		134201686	-1	tier1	-	no_errors	ENST00000354910	ensembl	human	known	74_37	missense	19.57	37	9	SNP	1.000	G
ANAPC2	29882	genome.wustl.edu	37	9	140082363	140082363	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr9:140082363C>G	ENST00000323927.2	-	2	314	c.310G>C	c.(310-312)Gag>Cag	p.E104Q	SSNA1_ENST00000322310.5_5'Flank	NM_013366.3	NP_037498.1	Q9UJX6	ANC2_HUMAN	anaphase promoting complex subunit 2	104					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of axon extension (GO:0045773)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic plasticity (GO:0031915)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)				breast(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	15	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.000858)		CACTGGGGCTCATCCGCAGAG	0.582																																																	0													86.0	90.0	88.0					9																	140082363		2203	4300	6503	SO:0001583	missense	0			AB037827	CCDS7033.1	9q34.3	2011-06-15			ENSG00000176248	ENSG00000176248		"""Anaphase promoting complex subunits"""	19989	protein-coding gene	gene with protein product		606946				11739784	Standard	NM_013366		Approved	APC2, KIAA1406	uc004clr.1	Q9UJX6	OTTHUMG00000020983	ENST00000323927.2:c.310G>C	9.37:g.140082363C>G	ENSP00000314004:p.Glu104Gln		Q5VSG1|Q96DG5|Q96GG4|Q9P2E1	Missense_Mutation	SNP	pfam_Cullin_N,pfam_APC_su2_C,superfamily_Cullin_homology,smart_Cullin_homology,pfscan_Cullin_homology	p.E104Q	ENST00000323927.2	37	c.310	CCDS7033.1	9	.	.	.	.	.	.	.	.	.	.	C	11.77	1.736326	0.30774	.	.	ENSG00000176248	ENST00000323927	T	0.76316	-1.01	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	T	0.71316	0.3325	L	0.46157	1.445	0.80722	D	1	P	0.44090	0.826	B	0.39152	0.292	T	0.71331	-0.4625	10	0.29301	T	0.29	-22.8123	15.9702	0.80008	0.0:1.0:0.0:0.0	.	104	Q9UJX6	ANC2_HUMAN	Q	104	ENSP00000314004:E104Q	ENSP00000314004:E104Q	E	-	1	0	ANAPC2	139202184	1.000000	0.71417	0.795000	0.32087	0.524000	0.34500	6.484000	0.73621	2.365000	0.80145	0.561000	0.74099	GAG	ANAPC2	-	NULL	ENSG00000176248		0.582	ANAPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANAPC2	HGNC	protein_coding	OTTHUMT00000055315.1	-	0.00	17	0	C	NM_013366		140082363	-1	tier1	-	no_errors	ENST00000323927	ensembl	human	known	74_37	missense	23.81	16	5	SNP	0.998	G
ANGPTL3	27329	genome.wustl.edu	37	1	63068045	63068045	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:63068045C>G	ENST00000371129.3	+	5	1005	c.925C>G	c.(925-927)Ctt>Gtt	p.L309V	DOCK7_ENST00000404627.2_Intron|DOCK7_ENST00000251157.5_Intron|DOCK7_ENST00000340370.5_Intron|ANGPTL3_ENST00000493994.1_3'UTR	NM_014495.2	NP_055310.1	Q9Y5C1	ANGL3_HUMAN	angiopoietin-like 3	309	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				acylglycerol homeostasis (GO:0055090)|artery morphogenesis (GO:0048844)|cell-matrix adhesion (GO:0007160)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|fatty acid metabolic process (GO:0006631)|glycerol metabolic process (GO:0006071)|integrin-mediated signaling pathway (GO:0007229)|lipid homeostasis (GO:0055088)|lipid storage (GO:0019915)|negative regulation of lipoprotein lipase activity (GO:0051005)|negative regulation of phospholipase activity (GO:0010519)|phospholipid catabolic process (GO:0009395)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of lipid catabolic process (GO:0050996)|response to hormone (GO:0009725)|signal transduction (GO:0007165)|triglyceride homeostasis (GO:0070328)	cell surface (GO:0009986)|extracellular space (GO:0005615)	enzyme inhibitor activity (GO:0004857)|growth factor activity (GO:0008083)|integrin binding (GO:0005178)|phospholipase inhibitor activity (GO:0004859)	p.L309F(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(3)|urinary_tract(1)	13						TTTTGGGAGGCTTGATGGTAA	0.358																																																	1	Substitution - Missense(1)	endometrium(1)											154.0	151.0	152.0					1																	63068045		2203	4300	6503	SO:0001583	missense	0			AF152562	CCDS622.1	1p31.3	2013-02-06			ENSG00000132855	ENSG00000132855		"""Fibrinogen C domain containing"""	491	protein-coding gene	gene with protein product	"""angiopoietin 5"""	604774		ANGPT5		10644446	Standard	NM_014495		Approved		uc001das.2	Q9Y5C1	OTTHUMG00000009146	ENST00000371129.3:c.925C>G	1.37:g.63068045C>G	ENSP00000360170:p.Leu309Val		A0JLS0|B1ALJ0|B2RCW1	Missense_Mutation	SNP	pfam_Fibrinogen_a/b/g_C_dom,superfamily_Fibrinogen_a/b/g_C_dom,smart_Fibrinogen_a/b/g_C_dom	p.L309V	ENST00000371129.3	37	c.925	CCDS622.1	1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.948602	0.73787	.	.	ENSG00000132855	ENST00000371129	T	0.77229	-1.08	5.84	5.84	0.93424	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);	0.056772	0.64402	D	0.000003	T	0.78233	0.4251	L	0.61218	1.895	0.58432	D	0.999999	D	0.58268	0.982	P	0.54431	0.752	T	0.72795	-0.4185	10	0.15066	T	0.55	.	20.1438	0.98071	0.0:1.0:0.0:0.0	.	309	Q9Y5C1	ANGL3_HUMAN	V	309	ENSP00000360170:L309V	ENSP00000360170:L309V	L	+	1	0	ANGPTL3	62840633	0.975000	0.34042	0.966000	0.40874	0.837000	0.47467	2.399000	0.44495	2.768000	0.95171	0.650000	0.86243	CTT	ANGPTL3	-	pfam_Fibrinogen_a/b/g_C_dom,superfamily_Fibrinogen_a/b/g_C_dom,smart_Fibrinogen_a/b/g_C_dom	ENSG00000132855		0.358	ANGPTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANGPTL3	HGNC	protein_coding	OTTHUMT00000025344.1	-	0.00	67	0	C	NM_014495		63068045	+1	tier1	-	no_errors	ENST00000371129	ensembl	human	known	74_37	missense	18.42	62	14	SNP	0.997	G
ANKRD29	147463	genome.wustl.edu	37	18	21218851	21218851	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr18:21218851G>C	ENST00000592179.1	-	4	446	c.292C>G	c.(292-294)Ctc>Gtc	p.L98V	ANKRD29_ENST00000322980.9_Missense_Mutation_p.L98V|ANKRD29_ENST00000284207.7_Missense_Mutation_p.L98V	NM_173505.2	NP_775776.2	Q8N6D5	ANR29_HUMAN	ankyrin repeat domain 29	98										breast(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(3)|prostate(1)|skin(1)	13	all_cancers(21;5.07e-05)|all_epithelial(16;2.49e-07)|Lung NSC(20;0.00211)|all_lung(20;0.00676)|Colorectal(14;0.0202)|Ovarian(20;0.127)					AATCCAAAGAGAAATCTCACG	0.423																																																	0													111.0	104.0	106.0					18																	21218851		2203	4300	6503	SO:0001583	missense	0			AK057782	CCDS11879.1	18q11.2	2013-01-10			ENSG00000154065	ENSG00000154065		"""Ankyrin repeat domain containing"""	27110	protein-coding gene	gene with protein product							Standard	NM_173505		Approved	FLJ25053	uc002kun.3	Q8N6D5	OTTHUMG00000131875	ENST00000592179.1:c.292C>G	18.37:g.21218851G>C	ENSP00000468354:p.Leu98Val		B2R972|Q6ZWE8|Q96LU9	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.L98V	ENST00000592179.1	37	c.292	CCDS11879.1	18	.	.	.	.	.	.	.	.	.	.	G	24.5	4.540144	0.85917	.	.	ENSG00000154065	ENST00000322980;ENST00000284207	T;T	0.80480	-1.38;-1.38	5.69	5.69	0.88448	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	D	0.92453	0.7604	M	0.92459	3.31	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.83275	0.996;0.994	D	0.93524	0.6864	10	0.87932	D	0	.	18.9514	0.92642	0.0:0.0:1.0:0.0	.	98;98	Q8N6D5-3;Q8N6D5	.;ANR29_HUMAN	V	98	ENSP00000323387:L98V;ENSP00000284207:L98V	ENSP00000284207:L98V	L	-	1	0	ANKRD29	19472849	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	8.648000	0.91062	2.840000	0.97914	0.655000	0.94253	CTC	ANKRD29	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000154065		0.423	ANKRD29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD29	HGNC	protein_coding	OTTHUMT00000254825.1	-	0.00	64	0	G	NM_173505		21218851	-1	tier1	-	no_errors	ENST00000592179	ensembl	human	known	74_37	missense	15.38	65	12	SNP	1.000	C
ANO2	57101	genome.wustl.edu	37	12	5672624	5672624	+	Silent	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr12:5672624C>G	ENST00000356134.5	-	27	2912	c.2841G>C	c.(2839-2841)ctG>ctC	p.L947L	ANO2_ENST00000327087.8_Silent_p.L946L|ANO2_ENST00000546188.1_Silent_p.L947L	NM_001278596.1	NP_001265525.1	Q9NQ90	ANO2_HUMAN	anoctamin 2, calcium activated chloride channel	951					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(3)|upper_aerodigestive_tract(1)	58						GCTCCTCTTTCAGGAAGAAAT	0.552																																																	0													56.0	55.0	55.0					12																	5672624		1947	4152	6099	SO:0001819	synonymous_variant	0			AJ272204	CCDS44807.1, CCDS44807.2	12p13.3	2014-04-09	2014-04-09	2008-08-28		ENSG00000047617		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	1183	protein-coding gene	gene with protein product	"""transmembrane protein 16B (eight membrane-spanning domains)"""	610109	"""chromosome 12 open reading frame 3"", ""transmembrane protein 16B"", ""anoctamin 2"""	C12orf3, TMEM16B		12739008, 15067359, 24692353	Standard	NM_001278596		Approved		uc001qnm.2	Q9NQ90		ENST00000356134.5:c.2841G>C	12.37:g.5672624C>G			C4N787|Q9H847	Silent	SNP	pfam_Anoctamin	p.L947	ENST00000356134.5	37	c.2841		12																																																																																			ANO2	-	NULL	ENSG00000047617		0.552	ANO2-001	KNOWN	basic	protein_coding	ANO2	HGNC	protein_coding	OTTHUMT00000399019.4	-	0.00	14	0	C	NM_020373		5672624	-1	tier1	-	no_errors	ENST00000356134	ensembl	human	known	74_37	silent	54.84	14	17	SNP	1.000	G
ANKS1B	56899	genome.wustl.edu	37	12	99447069	99447069	+	Missense_Mutation	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr12:99447069C>T	ENST00000547776.2	-	17	2643	c.2644G>A	c.(2644-2646)Gat>Aat	p.D882N	ANKS1B_ENST00000546568.1_Missense_Mutation_p.D108N|ANKS1B_ENST00000549025.2_Missense_Mutation_p.D51N|ANKS1B_ENST00000547446.1_Missense_Mutation_p.D77N|ANKS1B_ENST00000549493.2_Missense_Mutation_p.D108N|ANKS1B_ENST00000549558.2_Missense_Mutation_p.D108N|ANKS1B_ENST00000546960.1_Missense_Mutation_p.D108N|ANKS1B_ENST00000329257.7_Missense_Mutation_p.D882N|ANKS1B_ENST00000332712.7_Missense_Mutation_p.D108N|ANKS1B_ENST00000550693.2_Missense_Mutation_p.D108N|ANKS1B_ENST00000547010.1_Missense_Mutation_p.D458N	NM_152788.4	NP_690001.3	Q7Z6G8	ANS1B_HUMAN	ankyrin repeat and sterile alpha motif domain containing 1B	882						cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	ephrin receptor binding (GO:0046875)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(15)|lung(38)|pancreas(1)|prostate(2)|skin(1)	70		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)		TGGTAGCCATCATGCCCAATG	0.418																																																	0													47.0	45.0	46.0					12																	99447069		1907	4141	6048	SO:0001583	missense	0			AF145204	CCDS55864.1, CCDS55865.1, CCDS55866.1, CCDS55867.1, CCDS55868.1, CCDS55869.1, CCDS55870.1, CCDS55871.1, CCDS55872.1	12q23.1	2013-01-10						"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	24600	protein-coding gene	gene with protein product		607815				10490826, 12415113	Standard	NM_020140		Approved	EB-1, AIDA-1, cajalin-2, ANKS2	uc001tge.2	Q7Z6G8		ENST00000547776.2:c.2644G>A	12.37:g.99447069C>T	ENSP00000449629:p.Asp882Asn		A5PKY5|A7E259|A8K153|A8MSN4|B4DFP6|B4DH98|F8VPM3|F8VZR9|F8WC27|Q5XLJ0|Q6IVB5|Q6NUS4|Q7Z6G6|Q7Z6G7|Q8TAP3|Q9NRX7|Q9Y5K9	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SAM_type1,pfam_PTB/PI_dom,pfam_SAM_2,pfam_PTB,superfamily_Ankyrin_rpt-contain_dom,superfamily_SAM/pointed,smart_Ankyrin_rpt,smart_SAM,smart_PTB/PI_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_PTB/PI_dom,pfscan_SAM,prints_Ankyrin_rpt	p.D882N	ENST00000547776.2	37	c.2644	CCDS55872.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.58|18.58	3.654481|3.654481	0.67472|0.67472	.|.	.|.	ENSG00000185046|ENSG00000185046	ENST00000549558;ENST00000547776;ENST00000547010;ENST00000329257;ENST00000538702;ENST00000550693;ENST00000549025;ENST00000549493;ENST00000547446;ENST00000546568;ENST00000332712;ENST00000407362;ENST00000546960;ENST00000552245|ENST00000550778	D;D;D;D;D;D;D;D;D;D;D|.	0.82433|.	-1.61;-1.61;-1.61;-1.61;-1.61;-1.61;-1.61;-1.61;-1.61;-1.61;-1.61|.	6.07|6.07	6.07|6.07	0.98685|0.98685	Sterile alpha motif domain (1);Sterile alpha motif/pointed domain (2);|.	0.056966|.	0.64402|.	D|.	0.000002|.	T|T	0.77532|0.77532	0.4144|0.4144	M|M	0.76328|0.76328	2.33|2.33	0.52501|0.52501	D|D	0.999959|0.999959	P;P;P;B;B;B;P;D;B;D;B|.	0.76494|.	0.945;0.606;0.884;0.283;0.218;0.038;0.884;0.999;0.298;0.982;0.146|.	D;P;P;P;P;B;P;D;B;D;B|.	0.81914|.	0.975;0.597;0.701;0.52;0.448;0.378;0.629;0.99;0.378;0.995;0.337|.	T|T	0.75557|0.75557	-0.3276|-0.3276	10|5	0.51188|.	T|.	0.08|.	-15.3904|-15.3904	18.8244|18.8244	0.92111|0.92111	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	77;108;108;108;96;108;108;51;458;882;108|.	F8VPM3;Q7Z6G8-4;Q7Z6G8-5;F8VZ47;F8VQW6;Q7Z6G8-2;Q7Z6G8-3;F8VZR9;Q7Z6G8-6;Q7Z6G8;Q7Z6G8-7|.	.;.;.;.;.;.;.;.;.;ANS1B_HUMAN;.|.	N|I	108;882;458;882;457;108;51;108;77;108;108;44;108;108|153	ENSP00000448993:D108N;ENSP00000449629:D882N;ENSP00000448512:D458N;ENSP00000331381:D882N;ENSP00000447999:D108N;ENSP00000447312:D51N;ENSP00000448203:D108N;ENSP00000450015:D77N;ENSP00000448205:D108N;ENSP00000332683:D108N;ENSP00000447839:D108N|.	ENSP00000331381:D882N|.	D|M	-|-	1|3	0|0	ANKS1B|ANKS1B	97971200|97971200	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.987000|0.987000	0.75469|0.75469	7.085000|7.085000	0.76875|0.76875	2.890000|2.890000	0.99128|0.99128	0.650000|0.650000	0.86243|0.86243	GAT|ATG	ANKS1B	-	superfamily_SAM/pointed,smart_SAM	ENSG00000185046		0.418	ANKS1B-003	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	ANKS1B	HGNC	protein_coding	OTTHUMT00000408421.3	-	0.00	59	0	C	NM_020140		99447069	-1	tier1	-	no_errors	ENST00000329257	ensembl	human	known	74_37	missense	16.42	56	11	SNP	1.000	T
AOX2P	344454	genome.wustl.edu	37	2	201619757	201619758	+	IGR	INS	-	-	TG	rs71022335|rs35856862|rs563268698	byFrequency	TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr2:201619757_201619758insTG								AC007163.3 (19857 upstream) : AOX2P (7272 downstream)																							TCCTTTCAAATtgtgtgtgtgt	0.401																																																	0																																										SO:0001628	intergenic_variant	0																															2.37:g.201619766_201619767dupTG				RNA	INS	-	NULL		37	NULL		2																																																																																			AOX2P	-	-	ENSG00000243478	0	0.401					AOX2P	HGNC				0.00	19	0	-			201619758	+1	tier1		no_errors	ENST00000472376	ensembl	human	known	74_37	rna	18.75	26	6	INS	0.000:0.000	TG
APPBP2	10513	genome.wustl.edu	37	17	58571889	58571889	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr17:58571889G>C	ENST00000083182.3	-	3	604	c.317C>G	c.(316-318)tCt>tGt	p.S106C		NM_001282476.1|NM_006380.2	NP_001269405.1|NP_006371.2	Q92624	APBP2_HUMAN	amyloid beta precursor protein (cytoplasmic tail) binding protein 2	106					intracellular protein transport (GO:0006886)|intracellular transport (GO:0046907)|metabolic process (GO:0008152)	cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	microtubule motor activity (GO:0003777)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(17)|pancreas(1)|urinary_tract(1)	25	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;3.67e-13)|all cancers(12;1.44e-11)|Colorectal(3;0.01)			TGCTATATAAGAGCACCGCCT	0.393																																																	0													97.0	94.0	95.0					17																	58571889		2203	4300	6503	SO:0001583	missense	0			AF017782	CCDS32699.1	17q23.2	2012-09-20	2001-11-28		ENSG00000062725	ENSG00000062725			622	protein-coding gene	gene with protein product	"""protein interacting with APP tail 1"""	605324	"""amyloid beta precursor protein (cytoplasmic tail)-binding protein 2"""			9843960	Standard	NM_006380		Approved	KIAA0228, Hs.84084, PAT1	uc002iys.1	Q92624		ENST00000083182.3:c.317C>G	17.37:g.58571889G>C	ENSP00000083182:p.Ser106Cys		A8K862|O95095|Q8WVC9	Missense_Mutation	SNP	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.S106C	ENST00000083182.3	37	c.317	CCDS32699.1	17	.	.	.	.	.	.	.	.	.	.	G	24.5	4.536676	0.85812	.	.	ENSG00000062725	ENST00000083182	D	0.83673	-1.75	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	D	0.84465	0.5478	N	0.13098	0.295	0.80722	D	1	P	0.52842	0.956	D	0.64237	0.923	D	0.86101	0.1556	10	0.56958	D	0.05	0.0598	20.2165	0.98299	0.0:0.0:1.0:0.0	.	106	Q92624	APBP2_HUMAN	C	106	ENSP00000083182:S106C	ENSP00000083182:S106C	S	-	2	0	APPBP2	55926671	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.434000	0.97515	2.781000	0.95711	0.591000	0.81541	TCT	APPBP2	-	NULL	ENSG00000062725		0.393	APPBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APPBP2	HGNC	protein_coding	OTTHUMT00000449465.1	-	0.00	51	0	G	NM_006380		58571889	-1	tier1	-	no_errors	ENST00000083182	ensembl	human	known	74_37	missense	15.91	37	7	SNP	1.000	C
AR	367	genome.wustl.edu	37	X	66766356	66766356	+	Silent	SNP	T	T	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chrX:66766356T>C	ENST00000374690.3	+	1	1892	c.1368T>C	c.(1366-1368)ggT>ggC	p.G456G	AR_ENST00000513847.1_3'UTR|AR_ENST00000396044.3_Silent_p.G456G|AR_ENST00000504326.1_Silent_p.G456G	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	454	Modulating.|Poly-Gly.				androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	gtgggggtggtggcggcggcg	0.741									Androgen Insensitivity Syndrome																																								0													1.0	2.0	2.0					X																	66766356		861	1905	2766	SO:0001819	synonymous_variant	0	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	ENST00000374690.3:c.1368T>C	X.37:g.66766356T>C			A2RUN2|B1AKD7|Q9UD95	Silent	SNP	pfam_Andrgn_rcpt,pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Andrgn_rcpt,prints_Znf_hrmn_rcpt	p.G456	ENST00000374690.3	37	c.1368	CCDS14387.1	X																																																																																			AR	-	NULL	ENSG00000169083		0.741	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AR	HGNC	protein_coding	OTTHUMT00000057007.1		0.00	12	0	T	NM_000044		66766356	+1			no_errors	ENST00000374690	ensembl	human	known	74_37	silent	40.00	3	2	SNP	0.027	C
ARHGEF17	9828	genome.wustl.edu	37	11	73076558	73076558	+	Missense_Mutation	SNP	G	G	C	rs372726461		TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr11:73076558G>C	ENST00000263674.3	+	19	6024	c.5674G>C	c.(5674-5676)Gag>Cag	p.E1892Q		NM_014786.3	NP_055601.2	Q96PE2	ARHGH_HUMAN	Rho guanine nucleotide exchange factor (GEF) 17	1892					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|skin(2)	32						AGACACCTTTGAGCAGCTGGC	0.577																																																	0								G	GLN/GLU	1,4399	2.1+/-5.4	0,1,2199	156.0	115.0	129.0		5674	4.9	1.0	11		129	0,8586		0,0,4293	no	missense	ARHGEF17	NM_014786.3	29	0,1,6492	CC,CG,GG		0.0,0.0227,0.0077	probably-damaging	1892/2064	73076558	1,12985	2200	4293	6493	SO:0001583	missense	0			AF378754	CCDS8221.1	11q13.3	2011-11-16			ENSG00000110237	ENSG00000110237		"""Rho guanine nucleotide exchange factors"""	21726	protein-coding gene	gene with protein product	"""Rho-specific guanine-nucleotide exchange factor 164 kDa"", ""tumor endothelial marker 4"""					11559528, 12071859	Standard	NM_014786		Approved	TEM4, KIAA0337, p164-RhoGEF	uc001otu.3	Q96PE2	OTTHUMG00000167971	ENST00000263674.3:c.5674G>C	11.37:g.73076558G>C	ENSP00000263674:p.Glu1892Gln		B2RP20|Q86XU2|Q8N2S0|Q9Y4G3	Missense_Mutation	SNP	pfam_DH-domain,superfamily_DH-domain,superfamily_WD40_repeat_dom,superfamily_Vinculin/catenin,smart_DH-domain,pfscan_DH-domain	p.E1892Q	ENST00000263674.3	37	c.5674	CCDS8221.1	11	.	.	.	.	.	.	.	.	.	.	G	17.60	3.430035	0.62844	2.27E-4	0.0	ENSG00000110237	ENST00000263674	T	0.36520	1.25	5.8	4.87	0.63330	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.116790	0.64402	D	0.000004	T	0.54515	0.1863	L	0.56396	1.775	0.58432	D	0.999992	D	0.89917	1.0	D	0.71184	0.972	T	0.52117	-0.8618	10	0.34782	T	0.22	-24.3275	15.0997	0.72266	0.0:0.0:0.8575:0.1425	.	1892	Q96PE2	ARHGH_HUMAN	Q	1892	ENSP00000263674:E1892Q	ENSP00000263674:E1892Q	E	+	1	0	ARHGEF17	72754206	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.896000	0.87350	1.402000	0.46780	0.655000	0.94253	GAG	ARHGEF17	-	superfamily_WD40_repeat_dom	ENSG00000110237		0.577	ARHGEF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF17	HGNC	protein_coding	OTTHUMT00000397365.1	-	0.00	19	0	G	NM_014786		73076558	+1	tier1	-	no_errors	ENST00000263674	ensembl	human	known	74_37	missense	50.00	10	10	SNP	1.000	C
ARID5B	84159	genome.wustl.edu	37	10	63852198	63852198	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr10:63852198G>C	ENST00000279873.7	+	10	3386	c.2976G>C	c.(2974-2976)atG>atC	p.M992I	ARID5B_ENST00000309334.5_Missense_Mutation_p.M749I	NM_032199.2	NP_115575.1	Q14865	ARI5B_HUMAN	AT rich interactive domain 5B (MRF1-like)	992					adipose tissue development (GO:0060612)|adrenal gland development (GO:0030325)|cell development (GO:0048468)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|fat pad development (GO:0060613)|female gonad development (GO:0008585)|fibroblast migration (GO:0010761)|kidney development (GO:0001822)|liver development (GO:0001889)|male gonad development (GO:0008584)|multicellular organism growth (GO:0035264)|muscle organ morphogenesis (GO:0048644)|negative regulation of transcription, DNA-templated (GO:0045892)|palate development (GO:0060021)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|post-embryonic development (GO:0009791)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(2)|endometrium(13)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	44	Prostate(12;0.016)|all_hematologic(501;0.215)					TGGAAGGCATGGTCCACCCAA	0.532																																																	0													71.0	78.0	76.0					10																	63852198		2203	4300	6503	SO:0001583	missense	0			M73837	CCDS31208.1, CCDS58082.1	10q11.22	2013-02-07			ENSG00000150347	ENSG00000150347		"""-"""	17362	protein-coding gene	gene with protein product		608538				11483573, 11478881	Standard	NM_032199		Approved	FLJ21150, MRF2	uc001jlt.2	Q14865	OTTHUMG00000018298	ENST00000279873.7:c.2976G>C	10.37:g.63852198G>C	ENSP00000279873:p.Met992Ile		B4DLB3|Q05DG6|Q32Q59|Q5VST4|Q6NZ42|Q7Z3M4|Q8N421|Q9H786	Missense_Mutation	SNP	pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.M992I	ENST00000279873.7	37	c.2976	CCDS31208.1	10	.	.	.	.	.	.	.	.	.	.	G	13.70	2.315653	0.40996	.	.	ENSG00000150347	ENST00000279873;ENST00000309334	T;T	0.46451	0.88;0.87	5.72	5.72	0.89469	.	0.467546	0.27631	N	0.018508	T	0.40473	0.1118	L	0.54323	1.7	0.45806	D	0.99868	B	0.26318	0.146	B	0.24974	0.057	T	0.29701	-1.0003	10	0.62326	D	0.03	-21.9554	13.1125	0.59281	0.0731:0.0:0.9269:0.0	.	992	Q14865	ARI5B_HUMAN	I	992;749	ENSP00000279873:M992I;ENSP00000308862:M749I	ENSP00000279873:M992I	M	+	3	0	ARID5B	63522204	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.161000	0.71868	2.702000	0.92279	0.655000	0.94253	ATG	ARID5B	-	NULL	ENSG00000150347		0.532	ARID5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARID5B	HGNC	protein_coding	OTTHUMT00000048233.1	-	0.00	31	0	G	XM_084482		63852198	+1	tier1	-	no_errors	ENST00000279873	ensembl	human	known	74_37	missense	16.67	25	5	SNP	1.000	C
ARSEP1	10033	genome.wustl.edu	37	Y	14468196	14468196	+	RNA	SNP	A	A	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chrY:14468196A>G	ENST00000430152.1	+	0	469									arylsulfatase E pseudogene 1																		CCCCTCTGCTAGTGCCTTAGG	0.537																																																	0																																												0					Yq11.21	2010-07-27	2010-01-12	2010-01-12	ENSG00000224060	ENSG00000224060			720	pseudogene	pseudogene			"""arylsulfatase E pseudogene"""	ARSEP		8845834	Standard	NG_000880		Approved				OTTHUMG00000036379		Y.37:g.14468196A>G				RNA	SNP	-	NULL	ENST00000430152.1	37	NULL		Y																																																																																			ARSEP1	-	-	ENSG00000224060		0.537	ARSEP1-002	KNOWN	basic|exp_conf	processed_transcript	ARSEP1	HGNC	pseudogene	OTTHUMT00000471811.1	-	0.00	17	0	A	NG_000880		14468196	+1	tier1	-	no_errors	ENST00000430152	ensembl	human	known	74_37	rna	46.15	7	6	SNP	0.663	G
ASPA	443	genome.wustl.edu	37	17	3385000	3385000	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr17:3385000G>C	ENST00000263080.2	+	2	498	c.340G>C	c.(340-342)Gac>Cac	p.D114H	ASPA_ENST00000456349.2_Missense_Mutation_p.D114H|SPATA22_ENST00000541913.1_Intron	NM_000049.2	NP_000040.1	P45381	ACY2_HUMAN	aspartoacylase	114			D -> E (in CAND; <0.5% residual enzyme activity). {ECO:0000269|PubMed:8659549}.|D -> Y (in CAND). {ECO:0000269|PubMed:12205125}.		aspartate catabolic process (GO:0006533)|central nervous system myelination (GO:0022010)|positive regulation of oligodendrocyte differentiation (GO:0048714)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	aminoacylase activity (GO:0004046)|aspartoacylase activity (GO:0019807)|hydrolase activity, acting on ester bonds (GO:0016788)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|large_intestine(6)|lung(5)|stomach(1)|urinary_tract(1)	17					L-Aspartic Acid(DB00128)	CATTATTTTTGACCTTCACAA	0.338																																																	0			GRCh37	CM023014	ASPA	M							81.0	76.0	77.0					17																	3385000		2203	4300	6503	SO:0001583	missense	0			S67156	CCDS11028.1	17p13.3	2010-06-24	2010-06-24		ENSG00000108381	ENSG00000108381	3.5.1.15		756	protein-coding gene	gene with protein product	"""aminoacylase 2"", ""Canavan disease"""	608034	"""aspartoacylase (aminoacylase 2, Canavan disease)"""			8252036	Standard	NM_001128085		Approved	ASP, ACY2	uc002fvq.3	P45381	OTTHUMG00000090655	ENST00000263080.2:c.340G>C	17.37:g.3385000G>C	ENSP00000263080:p.Asp114His			Missense_Mutation	SNP	pfam_Aste_AspA,pirsf_Aspartoacylase	p.D114H	ENST00000263080.2	37	c.340	CCDS11028.1	17	.	.	.	.	.	.	.	.	.	.	g	25.3	4.623082	0.87460	.	.	ENSG00000108381	ENST00000456349;ENST00000263080	D;D	0.99948	-8.67;-8.67	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	D	0.99953	0.9980	M	0.92604	3.325	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96134	0.9095	10	0.87932	D	0	-15.6626	19.0107	0.92871	0.0:0.0:1.0:0.0	.	114	P45381	ACY2_HUMAN	H	114	ENSP00000409976:D114H;ENSP00000263080:D114H	ENSP00000263080:D114H	D	+	1	0	ASPA	3331750	1.000000	0.71417	1.000000	0.80357	0.885000	0.51271	9.631000	0.98424	2.812000	0.96745	0.557000	0.71058	GAC	ASPA	-	pfam_Aste_AspA,pirsf_Aspartoacylase	ENSG00000108381		0.338	ASPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASPA	HGNC	protein_coding	OTTHUMT00000207315.1	-	0.00	79	0	G	NM_000049		3385000	+1	tier1	-	no_errors	ENST00000263080	ensembl	human	known	74_37	missense	20.93	68	18	SNP	1.000	C
ASPH	444	genome.wustl.edu	37	8	62559369	62559369	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr8:62559369G>C	ENST00000379454.4	-	6	746	c.559C>G	c.(559-561)Ctt>Gtt	p.L187V	ASPH_ENST00000517847.2_Missense_Mutation_p.L173V|ASPH_ENST00000445642.3_Missense_Mutation_p.L173V|ASPH_ENST00000356457.5_Missense_Mutation_p.L187V|ASPH_ENST00000541428.1_Missense_Mutation_p.L158V|ASPH_ENST00000517903.1_Missense_Mutation_p.L173V|ASPH_ENST00000518068.1_Intron|ASPH_ENST00000522835.1_Intron|ASPH_ENST00000522919.1_5'Flank	NM_004318.3	NP_004309.2	Q12797	ASPH_HUMAN	aspartate beta-hydroxylase	187	Glu-rich.				activation of cysteine-type endopeptidase activity (GO:0097202)|activation of store-operated calcium channel activity (GO:0032237)|calcium ion transmembrane transport (GO:0070588)|cellular response to calcium ion (GO:0071277)|detection of calcium ion (GO:0005513)|face morphogenesis (GO:0060325)|limb morphogenesis (GO:0035108)|muscle contraction (GO:0006936)|negative regulation of cell proliferation (GO:0008285)|palate development (GO:0060021)|pattern specification process (GO:0007389)|peptidyl-aspartic acid hydroxylation (GO:0042264)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of proteolysis (GO:0045862)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031585)|regulation of protein depolymerization (GO:1901879)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|response to ATP (GO:0033198)	calcium channel complex (GO:0034704)|cortical endoplasmic reticulum (GO:0032541)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|electron carrier activity (GO:0009055)|ion channel binding (GO:0044325)|peptide-aspartate beta-dioxygenase activity (GO:0004597)|structural constituent of muscle (GO:0008307)|structural molecule activity (GO:0005198)			breast(1)|cervix(1)|endometrium(5)|large_intestine(5)|lung(16)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35	Lung SC(2;0.153)	Lung NSC(129;0.0358)|all_lung(136;0.0654)|all_epithelial(80;0.101)			L-Aspartic Acid(DB00128)|Succinic acid(DB00139)	GTCGCCATAAGAAACTCATCA	0.388																																																	0													387.0	389.0	388.0					8																	62559369		2203	4300	6503	SO:0001583	missense	0			AF224468	CCDS34898.1, CCDS34899.1, CCDS34900.1, CCDS43742.1, CCDS47866.1, CCDS55234.1, CCDS55235.1, CCDS55236.1, CCDS55237.1, CCDS55238.1, CCDS75746.1	8q12.1	2008-02-05			ENSG00000198363	ENSG00000198363	1.14.11.16		757	protein-coding gene	gene with protein product	"""junctin"", ""humbug"", ""junctate"""	600582				7821814, 10974562	Standard	NM_004318		Approved	CASQ2BP1, BAH, JCTN, HAAH	uc003xuj.3	Q12797	OTTHUMG00000164375	ENST00000379454.4:c.559C>G	8.37:g.62559369G>C	ENSP00000368767:p.Leu187Val		A6NDF4|A6NHI2|B4DIC9|B4E2K4|B7ZM95|E5RGP5|F5H667|Q6NXR7|Q8TB28|Q9H291|Q9H2C4|Q9NRI0|Q9NRI1|Q9Y4J0	Missense_Mutation	SNP	pfam_Asp-B-hydro/Triadin_dom,pfam_Asp_Arg_b-Hydrxlase,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.L187V	ENST00000379454.4	37	c.559	CCDS34898.1	8	.	.	.	.	.	.	.	.	.	.	G	12.57	1.977104	0.34848	.	.	ENSG00000198363	ENST00000389213;ENST00000541428;ENST00000379454;ENST00000356457;ENST00000519234;ENST00000517903;ENST00000445642;ENST00000517847	T;T;T;T;T;T;T	0.54675	0.56;0.56;0.56;0.56;0.56;0.56;0.56	5.48	1.48	0.22813	Aspartyl beta-hydroxylase/Triadin domain (1);	0.945325	0.08945	N	0.870918	T	0.46756	0.1409	N	0.22421	0.69	0.09310	N	1	P;P;P;P;B;P;P;B	0.48350	0.704;0.909;0.883;0.51;0.052;0.617;0.883;0.367	B;P;P;B;B;B;P;B	0.55577	0.192;0.779;0.625;0.106;0.012;0.11;0.625;0.232	T	0.30679	-0.9970	10	0.23891	T	0.37	-1.3775	4.0294	0.09701	0.1819:0.0:0.4938:0.3242	.	187;173;173;158;187;187;173;187	B8Y0L3;B7ZM95;B7ZM96;F5H667;F8W7A9;Q12797-2;Q9H291;Q12797	.;.;.;.;.;.;.;ASPH_HUMAN	V	187;158;187;187;202;173;173;173	ENSP00000437864:L158V;ENSP00000368767:L187V;ENSP00000348841:L187V;ENSP00000427823:L202V;ENSP00000430245:L173V;ENSP00000394013:L173V;ENSP00000429954:L173V	ENSP00000348841:L187V	L	-	1	0	ASPH	62721923	0.374000	0.25081	0.003000	0.11579	0.000000	0.00434	0.974000	0.29436	0.054000	0.16065	-0.181000	0.13052	CTT	ASPH	-	pfam_Asp-B-hydro/Triadin_dom	ENSG00000198363		0.388	ASPH-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASPH	HGNC	protein_coding	OTTHUMT00000378510.3	-	0.00	60	0	G	NM_004318		62559369	-1	tier1	-	no_errors	ENST00000379454	ensembl	human	known	74_37	missense	19.44	58	14	SNP	0.002	C
ASTN1	460	genome.wustl.edu	37	1	177000021	177000021	+	Silent	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:177000021C>T	ENST00000367654.3	-	4	1144	c.933G>A	c.(931-933)gtG>gtA	p.V311V	ASTN1_ENST00000361833.2_Silent_p.V311V|ASTN1_ENST00000281881.3_5'UTR|MIR488_ENST00000365739.2_RNA|ASTN1_ENST00000367657.3_Silent_p.V311V|ASTN1_ENST00000424564.2_Silent_p.V311V	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	311					locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)				NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						GGTTGGAGTCCACAGGGCTAG	0.448																																																	0													173.0	166.0	169.0					1																	177000021		2203	4300	6503	SO:0001819	synonymous_variant	0			AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.933G>A	1.37:g.177000021C>T			A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Silent	SNP	superfamily_Fibronectin_type3,smart_EG-like_dom,smart_MACPF,pfscan_Fibronectin_type3	p.V311	ENST00000367654.3	37	c.933		1																																																																																			ASTN1	-	NULL	ENSG00000152092		0.448	ASTN1-201	KNOWN	basic	protein_coding	ASTN1	HGNC	protein_coding		-	0.00	52	0	C	NM_004319		177000021	-1	tier1	-	no_errors	ENST00000367654	ensembl	human	known	74_37	silent	23.21	43	13	SNP	1.000	T
ATM	472	genome.wustl.edu	37	11	108186589	108186589	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr11:108186589G>C	ENST00000452508.2	+	42	6235	c.6046G>C	c.(6046-6048)Gat>Cat	p.D2016H	C11orf65_ENST00000525729.1_Intron|ATM_ENST00000278616.4_Missense_Mutation_p.D2016H			Q13315	ATM_HUMAN	ATM serine/threonine kinase	2016	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.		D -> G (in AT). {ECO:0000269|PubMed:9887333}.		brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)	p.D2016Y(1)		NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	AGGGGAGCCAGATAGTTTGTA	0.348			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																													yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	1	Substitution - Missense(1)	breast(1)											89.0	89.0	89.0					11																	108186589		2201	4298	6499	SO:0001583	missense	0	Familial Cancer Database	AT, Louis-Bar syndrome	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.6046G>C	11.37:g.108186589G>C	ENSP00000388058:p.Asp2016His		B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_TAN,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.D2016H	ENST00000452508.2	37	c.6046	CCDS31669.1	11	.	.	.	.	.	.	.	.	.	.	G	26.6	4.756218	0.89843	.	.	ENSG00000149311	ENST00000278616;ENST00000452508	T;T	0.48201	0.82;0.82	5.33	5.33	0.75918	PIK-related kinase (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.72187	0.3429	M	0.80746	2.51	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.76258	-0.3025	10	0.87932	D	0	.	19.0155	0.92892	0.0:0.0:1.0:0.0	.	668;2016	E9PFP9;Q13315	.;ATM_HUMAN	H	2016	ENSP00000278616:D2016H;ENSP00000388058:D2016H	ENSP00000278616:D2016H	D	+	1	0	ATM	107691799	1.000000	0.71417	0.995000	0.50966	0.959000	0.62525	9.348000	0.97062	2.502000	0.84385	0.305000	0.20034	GAT	ATM	-	superfamily_ARM-type_fold,pfscan_PIK_FAT	ENSG00000149311		0.348	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATM	HGNC	protein_coding	OTTHUMT00000389938.1	-	0.00	51	0	G	NM_000051		108186589	+1	tier1	-	no_errors	ENST00000278616	ensembl	human	known	74_37	missense	32.47	52	25	SNP	1.000	C
ATP2B1	490	genome.wustl.edu	37	12	90003718	90003718	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr12:90003718G>C	ENST00000428670.3	-	15	2894	c.2438C>G	c.(2437-2439)gCa>gGa	p.A813G	ATP2B1_ENST00000393164.2_Missense_Mutation_p.A556G|ATP2B1_ENST00000359142.3_Missense_Mutation_p.A813G|ATP2B1_ENST00000261173.2_Missense_Mutation_p.A813G|ATP2B1_ENST00000348959.3_Missense_Mutation_p.A813G			P20020	AT2B1_HUMAN	ATPase, Ca++ transporting, plasma membrane 1	813					blood coagulation (GO:0007596)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(13)|lung(15)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	45						TCTTACCATTGCAAATCCAAC	0.358																																																	0													115.0	103.0	107.0					12																	90003718		2203	4300	6503	SO:0001583	missense	0			J04027	CCDS9035.1, CCDS41817.1	12q21.33	2010-04-20			ENSG00000070961	ENSG00000070961	3.6.3.8	"""ATPases / P-type"""	814	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 1"""	108731				1674727	Standard	NM_001682		Approved	PMCA1	uc001tbh.3	P20020		ENST00000428670.3:c.2438C>G	12.37:g.90003718G>C	ENSP00000392043:p.Ala813Gly		Q12992|Q12993|Q13819|Q13820|Q13821|Q16504|Q93082	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_ATP_Ca_trans_C,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Ca-transp_plasma,tigrfam_Cation_transp_P_typ_ATPase	p.A813G	ENST00000428670.3	37	c.2438	CCDS9035.1	12	.	.	.	.	.	.	.	.	.	.	G	33	5.212677	0.95069	.	.	ENSG00000070961	ENST00000261173;ENST00000348959;ENST00000359142;ENST00000428670;ENST00000393164	D;D;D;D;D	0.98585	-5.01;-5.01;-5.01;-5.01;-5.01	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	D	0.99052	0.9675	H	0.95645	3.7	0.80722	D	1	P;P;P	0.51537	0.882;0.899;0.946	P;P;P	0.52066	0.477;0.689;0.689	D	0.99663	1.0994	10	0.87932	D	0	-25.2593	20.3431	0.98773	0.0:0.0:1.0:0.0	.	813;813;813	P20020-3;P20020-2;P20020-6	.;.;.	G	813;813;813;813;556	ENSP00000261173:A813G;ENSP00000343599:A813G;ENSP00000352054:A813G;ENSP00000392043:A813G;ENSP00000376869:A556G	ENSP00000261173:A813G	A	-	2	0	ATP2B1	88527849	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.869000	0.99810	2.880000	0.98712	0.650000	0.86243	GCA	ATP2B1	-	pfam_HAD-like_dom,superfamily_HAD-like_dom,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Ca-transp_plasma,tigrfam_Cation_transp_P_typ_ATPase	ENSG00000070961		0.358	ATP2B1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	ATP2B1	HGNC	protein_coding	OTTHUMT00000406653.1	-	0.00	59	0	G	NM_001682		90003718	-1	tier1	-	no_errors	ENST00000261173	ensembl	human	known	74_37	missense	25.53	35	12	SNP	1.000	C
B3GAT1	27087	genome.wustl.edu	37	11	134252719	134252719	+	Missense_Mutation	SNP	C	C	T	rs368413334		TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr11:134252719C>T	ENST00000524765.1	-	4	5347	c.803G>A	c.(802-804)cGa>cAa	p.R268Q	B3GAT1_ENST00000312527.4_Missense_Mutation_p.R268Q|B3GAT1_ENST00000392580.1_Missense_Mutation_p.R268Q|B3GAT1_ENST00000531510.1_5'Flank|B3GAT1_ENST00000537389.1_Missense_Mutation_p.R281Q			Q9P2W7	B3GA1_HUMAN	beta-1,3-glucuronyltransferase 1	268					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity (GO:0015018)|metal ion binding (GO:0046872)|UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity (GO:0008499)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	19	all_hematologic(175;0.127)	all_cancers(12;1.39e-23)|all_epithelial(12;7.17e-17)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000162)|Medulloblastoma(222;0.0125)|all_neural(223;0.0137)|Esophageal squamous(93;0.0559)		Epithelial(10;2.58e-11)|all cancers(11;5.75e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.000879)|Lung(977;0.0864)		GGCCTGGCTTCGCTGCAGAAT	0.587																																																	0								C	GLN/ARG,GLN/ARG	0,4402		0,0,2201	121.0	94.0	103.0		803,803	5.2	1.0	11		103	2,8592	2.2+/-6.3	0,2,4295	no	missense,missense	B3GAT1	NM_018644.3,NM_054025.2	43,43	0,2,6496	TT,TC,CC		0.0233,0.0,0.0154	benign,benign	268/335,268/335	134252719	2,12994	2201	4297	6498	SO:0001583	missense	0			AB029396	CCDS8500.1	11q25	2014-07-08	2014-07-08		ENSG00000109956	ENSG00000109956	2.4.1.135	"""CD molecules"", ""Beta-1,3-glucuronyltransferases"""	921	protein-coding gene	gene with protein product	"""galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase 1"", ""glucuronosyltransferase P"""	151290	"""CD57 antigen"""	CD57, LEU7			Standard	XM_005271506		Approved	GlcAT-P, HNK-1, NK-1	uc001qhq.3	Q9P2W7	OTTHUMG00000167180	ENST00000524765.1:c.803G>A	11.37:g.134252719C>T	ENSP00000433847:p.Arg268Gln		Q96FS7	Missense_Mutation	SNP	pfam_Glyco_trans_43	p.R281Q	ENST00000524765.1	37	c.842	CCDS8500.1	11	.	.	.	.	.	.	.	.	.	.	C	24.0	4.479650	0.84747	0.0	2.33E-4	ENSG00000109956	ENST00000392580;ENST00000312527;ENST00000524765;ENST00000537389	T;T;T;T	0.65364	-0.15;-0.15;-0.15;-0.15	5.22	5.22	0.72569	.	0.175695	0.49916	D	0.000125	T	0.58538	0.2129	L	0.56396	1.775	0.53688	D	0.999978	B;B	0.25235	0.027;0.121	B;B	0.15484	0.008;0.013	T	0.54840	-0.8233	10	0.18276	T	0.48	-12.9879	18.9552	0.92655	0.0:1.0:0.0:0.0	.	281;268	F5H0S0;Q9P2W7	.;B3GA1_HUMAN	Q	268;268;268;281	ENSP00000376359:R268Q;ENSP00000307875:R268Q;ENSP00000433847:R268Q;ENSP00000445983:R281Q	ENSP00000307875:R268Q	R	-	2	0	B3GAT1	133757929	1.000000	0.71417	0.980000	0.43619	0.988000	0.76386	4.763000	0.62257	2.721000	0.93114	0.491000	0.48974	CGA	B3GAT1	-	pfam_Glyco_trans_43	ENSG00000109956		0.587	B3GAT1-002	KNOWN	alternative_3_UTR|alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	B3GAT1	HGNC	protein_coding	OTTHUMT00000393639.1	-	0.00	42	0	C	NM_018644		134252719	-1	tier1	-	no_errors	ENST00000537389	ensembl	human	known	74_37	missense	20.59	27	7	SNP	0.997	T
BAG6	7917	genome.wustl.edu	37	6	31615559	31615559	+	Silent	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr6:31615559C>T	ENST00000375964.6	-	7	928	c.615G>A	c.(613-615)caG>caA	p.Q205Q	BAG6_ENST00000362049.6_Silent_p.Q199Q|BAG6_ENST00000404765.2_Silent_p.Q199Q|BAG6_ENST00000211379.5_Silent_p.Q199Q|BAG6_ENST00000439687.2_Silent_p.Q199Q|BAG6_ENST00000375976.4_Silent_p.Q199Q	NM_004639.3|NM_080703.2	NP_004630.3|NP_542434.1	P46379	BAG6_HUMAN	BCL2-associated athanogene 6	205	Pro-rich.				brain development (GO:0007420)|cell differentiation (GO:0030154)|chromatin modification (GO:0016568)|embryo development (GO:0009790)|immune system process (GO:0002376)|internal peptidyl-lysine acetylation (GO:0018393)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|kidney development (GO:0001822)|lung development (GO:0030324)|negative regulation of apoptotic process (GO:0043066)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of proteolysis (GO:0045861)|protein stabilization (GO:0050821)|regulation of cell proliferation (GO:0042127)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)|tail-anchored membrane protein insertion into ER membrane (GO:0071816)|transport (GO:0006810)|ubiquitin-dependent protein catabolic process (GO:0006511)	BAT3 complex (GO:0071818)|cytosol (GO:0005829)|nucleus (GO:0005634)	polyubiquitin binding (GO:0031593)|proteasome binding (GO:0070628)|ribosome binding (GO:0043022)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(2)|pancreas(2)|skin(3)|urinary_tract(2)	36						CAGCCGGTGGCTGCGGGGGCG	0.607																																																	0													93.0	124.0	113.0					6																	31615559		1510	2707	4217	SO:0001819	synonymous_variant	0			M31294	CCDS4709.1, CCDS47403.1, CCDS56414.1, CCDS56415.1	6p21.3	2011-06-14	2010-12-09	2010-12-09	ENSG00000204463	ENSG00000204463			13919	protein-coding gene	gene with protein product		142590	"""HLA-B associated transcript 3"""	BAT3		2156268	Standard	NM_004639		Approved	G3, D6S52E	uc003nvf.4	P46379	OTTHUMG00000031171	ENST00000375964.6:c.615G>A	6.37:g.31615559C>T			A2ADJ7|A3KQ42|A3KQ44|A6NGY6|A6PWF7|B0UX84|B4DZ12|B4E3V4|E7EMZ4|F8VXY4|O95874|Q5HYL9|Q5SQ35|Q5SQ36|Q5SQ37|Q5SQ41|Q5SRP8|Q5SRP9|Q5STC1|Q5STX1|Q5STX3|Q96SA6|Q9BCN4	Silent	SNP	pfam_DUF3538,pfam_Ubiquitin_dom,smart_Ubiquitin_dom,pfscan_Ubiquitin_supergroup	p.Q199	ENST00000375964.6	37	c.597	CCDS47403.1	6																																																																																			BAG6	-	NULL	ENSG00000204463		0.607	BAG6-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BAG6	HGNC	protein_coding		-	0.00	128	0	C	NM_080703		31615559	-1	tier1	-	no_errors	ENST00000404765	ensembl	human	known	74_37	silent	34.38	63	33	SNP	0.204	T
BAI2	576	genome.wustl.edu	37	1	32222191	32222191	+	Missense_Mutation	SNP	A	A	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:32222191A>C	ENST00000373658.3	-	4	588	c.247T>G	c.(247-249)Ttc>Gtc	p.F83V	BAI2_ENST00000398542.1_Missense_Mutation_p.F71V|BAI2_ENST00000527361.1_Missense_Mutation_p.F83V|MIR4254_ENST00000581063.1_RNA|BAI2_ENST00000398538.1_Missense_Mutation_p.F71V|BAI2_ENST00000398547.1_Missense_Mutation_p.F71V|BAI2_ENST00000257070.4_Missense_Mutation_p.F83V|BAI2_ENST00000398556.3_Missense_Mutation_p.F86V|BAI2_ENST00000373655.2_Missense_Mutation_p.F83V	NM_001703.2	NP_001694.2	O60241	BAI2_HUMAN	brain-specific angiogenesis inhibitor 2	83					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(2)|endometrium(1)|large_intestine(7)|liver(2)|lung(24)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	55		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)		STAD - Stomach adenocarcinoma(196;0.0557)		TGGCGGTTGAAGCGCAGGTAG	0.652																																																	0													46.0	45.0	45.0					1																	32222191		2202	4300	6502	SO:0001583	missense	0			AB005298	CCDS72746.1, CCDS72747.1	1p35	2014-08-08			ENSG00000121753	ENSG00000121753		"""-"", ""GPCR / Class B : Orphans"""	944	protein-coding gene	gene with protein product		602683				9533023	Standard	XM_006710783		Approved		uc001btn.3	O60241	OTTHUMG00000003885	ENST00000373658.3:c.247T>G	1.37:g.32222191A>C	ENSP00000362762:p.Phe83Val		B9EGK9|Q5T6K0|Q8NGW8|Q96GZ9	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_DUF3497,pfam_Thrombospondin_1_rpt,pfam_GPS_dom,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_GPS_dom,pfscan_Thrombospondin_1_rpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_brain-spec_angio_inhib,prints_GPCR_2_secretin-like	p.F83V	ENST00000373658.3	37	c.247	CCDS346.2	1	.	.	.	.	.	.	.	.	.	.	A	11.52	1.663933	0.29604	.	.	ENSG00000121753	ENST00000398556;ENST00000398547;ENST00000373658;ENST00000373655;ENST00000398542;ENST00000257070;ENST00000527361;ENST00000398538;ENST00000420125;ENST00000533175	T;T;T;T;T;T;T;T;T;T	0.39592	1.7;1.88;1.11;1.11;2.05;1.07;1.07;1.12;1.69;1.57	5.04	5.04	0.67666	.	0.000000	0.45126	D	0.000394	T	0.42086	0.1187	N	0.26042	0.785	0.80722	D	1	B;D;P;P;D;B	0.65815	0.184;0.995;0.672;0.473;0.967;0.333	B;P;B;B;P;B	0.59171	0.019;0.853;0.387;0.107;0.692;0.075	T	0.16660	-1.0395	10	0.07030	T	0.85	.	14.0689	0.64849	1.0:0.0:0.0:0.0	.	71;83;71;71;83;83	A2A3C3;O60241-4;O60241-3;A2A3C1;O60241-2;O60241	.;.;.;.;.;BAI2_HUMAN	V	86;71;83;83;71;83;83;71;76;117	ENSP00000381564:F86V;ENSP00000381555:F71V;ENSP00000362762:F83V;ENSP00000362759:F83V;ENSP00000381550:F71V;ENSP00000257070:F83V;ENSP00000435397:F83V;ENSP00000381548:F71V;ENSP00000410921:F76V;ENSP00000437219:F117V	ENSP00000257070:F83V	F	-	1	0	BAI2	31994778	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.497000	0.90488	2.028000	0.59812	0.379000	0.24179	TTC	BAI2	-	NULL	ENSG00000121753		0.652	BAI2-015	KNOWN	basic|CCDS	protein_coding	BAI2	HGNC	protein_coding	OTTHUMT00000381838.1	-	0.00	62	0	A	NM_001703		32222191	-1	tier1	-	no_errors	ENST00000373658	ensembl	human	known	74_37	missense	23.68	58	18	SNP	1.000	C
BAI3	577	genome.wustl.edu	37	6	70082325	70082325	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr6:70082325G>C	ENST00000370598.1	+	30	5088	c.4267G>C	c.(4267-4269)Gac>Cac	p.D1423H	BAI3_ENST00000238918.8_Missense_Mutation_p.D629H|BAI3_ENST00000546190.1_Missense_Mutation_p.D387H	NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	1423					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				TTCAGACCTTGACTTTGAGGT	0.239																																																	0													19.0	21.0	20.0					6																	70082325		2111	4155	6266	SO:0001583	missense	0			AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.4267G>C	6.37:g.70082325G>C	ENSP00000359630:p.Asp1423His		B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_DUF3497,pfam_Thrombospondin_1_rpt,pfam_GPS_dom,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_CUB_dom,pfscan_GPS_dom,pfscan_Thrombospondin_1_rpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_brain-spec_angio_inhib,prints_GPCR_2_secretin-like	p.D1423H	ENST00000370598.1	37	c.4267	CCDS4968.1	6	.	.	.	.	.	.	.	.	.	.	G	15.55	2.865576	0.51588	.	.	ENSG00000135298	ENST00000370598;ENST00000238918;ENST00000546190	T;T;T	0.08102	3.13;3.13;3.13	5.97	5.97	0.96955	.	0.046113	0.85682	D	0.000000	T	0.06005	0.0156	L	0.49778	1.585	0.49051	D	0.999741	B;B	0.29508	0.006;0.246	B;B	0.26094	0.012;0.066	T	0.05784	-1.0864	10	0.87932	D	0	.	17.3555	0.87334	0.0:0.0:1.0:0.0	.	629;1423	B7Z356;O60242	.;BAI3_HUMAN	H	1423;629;387	ENSP00000359630:D1423H;ENSP00000238918:D629H;ENSP00000441821:D387H	ENSP00000238918:D629H	D	+	1	0	BAI3	70139046	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.873000	0.75541	2.836000	0.97738	0.655000	0.94253	GAC	BAI3	-	prints_GPCR_2_brain-spec_angio_inhib	ENSG00000135298		0.239	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAI3	HGNC	protein_coding	OTTHUMT00000041120.1	-	0.00	52	0	G			70082325	+1	tier1	-	no_errors	ENST00000370598	ensembl	human	known	74_37	missense	35.38	42	23	SNP	1.000	C
BCHE	590	genome.wustl.edu	37	3	165548470	165548470	+	Missense_Mutation	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr3:165548470C>T	ENST00000264381.3	-	2	518	c.352G>A	c.(352-354)Gaa>Aaa	p.E118K	BCHE_ENST00000540653.1_Intron	NM_000055.2	NP_000046.1	P06276	CHLE_HUMAN	butyrylcholinesterase	118					cellular protein metabolic process (GO:0044267)|choline metabolic process (GO:0019695)|cocaine metabolic process (GO:0050783)|learning (GO:0007612)|negative regulation of cell proliferation (GO:0008285)|negative regulation of synaptic transmission (GO:0050805)|neuroblast differentiation (GO:0014016)|response to alkaloid (GO:0043279)|response to drug (GO:0042493)|response to folic acid (GO:0051593)|response to glucocorticoid (GO:0051384)|synaptic transmission, cholinergic (GO:0007271)	blood microparticle (GO:0072562)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)	acetylcholinesterase activity (GO:0003990)|beta-amyloid binding (GO:0001540)|catalytic activity (GO:0003824)|choline binding (GO:0033265)|cholinesterase activity (GO:0004104)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)			breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(34)|ovary(4)|pancreas(2)|stomach(1)	55					Aclidinium(DB08897)|Ambenonium(DB01122)|Bambuterol(DB01408)|Chloroprocaine(DB01161)|Chlorphenesin(DB00856)|Chlorpromazine(DB00477)|Choline(DB00122)|Cinchocaine(DB00527)|Cisplatin(DB00515)|Clevidipine(DB04920)|Cyclopentolate(DB00979)|Decamethonium(DB01245)|Demecarium(DB00944)|Diethylcarbamazine(DB00711)|Dipivefrin(DB00449)|Doxacurium chloride(DB01135)|Drospirenone(DB01395)|Echothiophate(DB01057)|Edrophonium(DB01010)|Ephedrine(DB01364)|Ethopropazine(DB00392)|Galantamine(DB00674)|Hexafluronium(DB00941)|Irinotecan(DB00762)|Isoflurophate(DB00677)|Malathion(DB00772)|Mefloquine(DB00358)|Mirabegron(DB08893)|Mivacurium(DB01226)|Neostigmine(DB01400)|Nizatidine(DB00585)|Oxybuprocaine(DB00892)|Pancuronium(DB01337)|Pegvisomant(DB00082)|Pentagastrin(DB00183)|Perindopril(DB00790)|Pipecuronium(DB01338)|Pralidoxime(DB00733)|Procainamide(DB01035)|Procaine(DB00721)|Pyridostigmine(DB00545)|Ramipril(DB00178)|Rivastigmine(DB00989)|Succinylcholine(DB00202)|Sulpiride(DB00391)|Terbutaline(DB00871)|Triamcinolone(DB00620)|Triflupromazine(DB00508)|Trimethaphan(DB01116)	AAACAGTCTTCACTGAGGTCA	0.388																																																	0													77.0	82.0	80.0					3																	165548470		2203	4300	6503	SO:0001583	missense	0			M16541	CCDS3198.1	3q26.1-q26.2	2013-07-10			ENSG00000114200	ENSG00000114200	3.1.1.8		983	protein-coding gene	gene with protein product		177400	"""cholinesterase 1"", ""cholinesterase (serum) 2"""	CHE1, CHE2		1769657, 2318303	Standard	NM_000055		Approved	E1	uc003fem.4	P06276	OTTHUMG00000158131	ENST00000264381.3:c.352G>A	3.37:g.165548470C>T	ENSP00000264381:p.Glu118Lys		A8K7P8	Missense_Mutation	SNP	pfam_CarbesteraseB,pfam_AChE_tetra,pfam_AB_hydrolase_3,prints_Cholinesterase	p.E118K	ENST00000264381.3	37	c.352	CCDS3198.1	3	.	.	.	.	.	.	.	.	.	.	C	26.5	4.744362	0.89663	.	.	ENSG00000114200	ENST00000264381	D	0.86956	-2.19	5.69	5.69	0.88448	Carboxylesterase type B, conserved site (1);Carboxylesterase, type B (1);	0.000000	0.85682	D	0.000000	D	0.96895	0.8986	H	0.99573	4.635	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98541	1.0632	10	0.87932	D	0	.	18.7962	0.91995	0.0:1.0:0.0:0.0	.	118	P06276	CHLE_HUMAN	K	118	ENSP00000264381:E118K	ENSP00000264381:E118K	E	-	1	0	BCHE	167031164	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	7.687000	0.84139	2.671000	0.90904	0.655000	0.94253	GAA	BCHE	-	pfam_CarbesteraseB	ENSG00000114200		0.388	BCHE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCHE	HGNC	protein_coding	OTTHUMT00000350254.1	-	0.00	58	0	C			165548470	-1	tier1	-	no_errors	ENST00000264381	ensembl	human	known	74_37	missense	36.62	45	26	SNP	1.000	T
BCLAF1	9774	genome.wustl.edu	37	6	136599709	136599709	+	Missense_Mutation	SNP	T	T	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr6:136599709T>A	ENST00000531224.1	-	4	562	c.310A>T	c.(310-312)Agt>Tgt	p.S104C	BCLAF1_ENST00000530767.1_Missense_Mutation_p.S104C|BCLAF1_ENST00000527759.1_Missense_Mutation_p.S102C|BCLAF1_ENST00000392348.2_Missense_Mutation_p.S102C|BCLAF1_ENST00000527536.1_Missense_Mutation_p.S104C|BCLAF1_ENST00000353331.4_Missense_Mutation_p.S102C	NM_001077441.1|NM_014739.2	NP_001070909.1|NP_055554.1	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1	104					apoptotic process (GO:0006915)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA-templated transcription, initiation (GO:2000144)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of response to DNA damage stimulus (GO:2001022)|regulation of DNA-templated transcription in response to stress (GO:0043620)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|ovary(1)|skin(1)	9	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		CGTCTAGGACTCCTAGAGTGC	0.468																																					Colon(142;1534 1789 5427 7063 28491)												0													150.0	148.0	149.0					6																	136599709		2203	4300	6503	SO:0001583	missense	0			AF249273	CCDS5177.1, CCDS47485.1, CCDS47486.1, CCDS75525.1	6q22-q23	2007-03-02			ENSG00000029363	ENSG00000029363			16863	protein-coding gene	gene with protein product		612588				8724849, 10330179	Standard	NM_001077440		Approved	KIAA0164, BTF	uc003qgx.1	Q9NYF8	OTTHUMG00000033323	ENST00000531224.1:c.310A>T	6.37:g.136599709T>A	ENSP00000435210:p.Ser104Cys		A2RU75|B7ZM58|E1P586|Q14673|Q86WU6|Q86WY0	Missense_Mutation	SNP	NULL	p.S104C	ENST00000531224.1	37	c.310	CCDS5177.1	6	.	.	.	.	.	.	.	.	.	.	T	15.27	2.784255	0.49997	.	.	ENSG00000029363	ENST00000531224;ENST00000353331;ENST00000527536;ENST00000530767;ENST00000527759;ENST00000392348;ENST00000529826	T;T;T;T;T;T;T	0.19394	2.56;2.53;2.53;2.15;2.56;2.53;2.34	5.21	5.21	0.72293	.	0.000000	0.64402	D	0.000001	T	0.35098	0.0920	M	0.64170	1.965	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.76071	0.987;0.987;0.987;0.987	T	0.18461	-1.0336	10	0.87932	D	0	-10.6396	15.3832	0.74676	0.0:0.0:0.0:1.0	.	102;102;104;104	Q9NYF8-2;Q9NYF8-3;Q9NYF8;Q9NYF8-4	.;.;BCLF1_HUMAN;.	C	104;102;104;104;102;102;104	ENSP00000435210:S104C;ENSP00000229446:S102C;ENSP00000435441:S104C;ENSP00000436501:S104C;ENSP00000434826:S102C;ENSP00000376159:S102C;ENSP00000431734:S104C	ENSP00000229446:S102C	S	-	1	0	BCLAF1	136641402	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.811000	0.69187	2.102000	0.63906	0.455000	0.32223	AGT	BCLAF1	-	NULL	ENSG00000029363		0.468	BCLAF1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BCLAF1	HGNC	protein_coding	OTTHUMT00000042375.2	-	0.00	73	0	T	NM_014739		136599709	-1	tier1	-	no_errors	ENST00000531224	ensembl	human	known	74_37	missense	6.25	120	8	SNP	1.000	A
BDP1	55814	genome.wustl.edu	37	5	70840330	70840330	+	Missense_Mutation	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr5:70840330G>A	ENST00000358731.4	+	31	6822	c.6559G>A	c.(6559-6561)Gaa>Aaa	p.E2187K	BDP1_ENST00000380675.2_Missense_Mutation_p.E323K	NM_018429.2	NP_060899.2	A6H8Y1	BDP1_HUMAN	B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB	2187					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(34)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		AAACCTAACTGAAAGGTAAAA	0.398																																																	0													91.0	87.0	88.0					5																	70840330		1866	4093	5959	SO:0001583	missense	0			AF298151	CCDS43328.1	5q12-q13	2008-02-05	2001-11-29	2001-11-30	ENSG00000145734	ENSG00000145734			13652	protein-coding gene	gene with protein product		607012	"""TATA box binding protein (TBP)-associated factor, RNA polymerase III, GTF3B subunit 1"""	TFNR, TAF3B1		11214970, 11040218	Standard	NM_018429		Approved	TFIIIB150, TFC5, TFIIIB90, KIAA1689, HSA238520, KIAA1241	uc003kbp.1	A6H8Y1	OTTHUMG00000162506	ENST00000358731.4:c.6559G>A	5.37:g.70840330G>A	ENSP00000351575:p.Glu2187Lys		Q68DS6|Q68DY5|Q6MZL9|Q6PIM7|Q86W98|Q96LR8|Q9C0H4|Q9H197|Q9H1A1|Q9HAW1|Q9HAW2|Q9HCY0|Q9ULH9	Missense_Mutation	SNP	superfamily_Homeodomain-like,smart_SANT/Myb	p.E2187K	ENST00000358731.4	37	c.6559	CCDS43328.1	5	.	.	.	.	.	.	.	.	.	.	G	16.95	3.262122	0.59431	.	.	ENSG00000145734	ENST00000358731;ENST00000451951;ENST00000380675;ENST00000545546	T;T	0.47869	3.74;0.83	5.24	-1.51	0.08664	.	0.609436	0.15571	N	0.255421	T	0.36690	0.0976	L	0.56769	1.78	0.09310	N	1	B;B	0.25955	0.017;0.138	B;B	0.24701	0.011;0.055	T	0.23476	-1.0187	10	0.33141	T	0.24	.	6.2381	0.20774	0.2373:0.373:0.3896:0.0	.	2187;2187	A6H8Y1;A6H8Y1-2	BDP1_HUMAN;.	K	2187;1735;323;323	ENSP00000351575:E2187K;ENSP00000370050:E323K	ENSP00000351575:E2187K	E	+	1	0	BDP1	70876086	0.011000	0.17503	0.002000	0.10522	0.915000	0.54546	0.088000	0.14979	-0.194000	0.10399	-0.136000	0.14681	GAA	BDP1	-	NULL	ENSG00000145734		0.398	BDP1-016	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BDP1	HGNC	protein_coding	OTTHUMT00000374681.2	-	0.00	59	0	G	NM_018429		70840330	+1	tier1	-	no_errors	ENST00000358731	ensembl	human	known	74_37	missense	23.94	54	17	SNP	0.008	A
BEND5	79656	genome.wustl.edu	37	1	49227056	49227056	+	Nonsense_Mutation	SNP	C	C	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:49227056C>A	ENST00000371833.3	-	2	399	c.313G>T	c.(313-315)Gag>Tag	p.E105*	AGBL4_ENST00000371839.1_Intron|AGBL4_ENST00000371838.1_Intron|BEND5_ENST00000476096.1_5'Flank	NM_024603.2	NP_078879.2	Q7L4P6	BEND5_HUMAN	BEN domain containing 5	105						Golgi apparatus (GO:0005794)				large_intestine(5)|lung(2)|skin(1)	8						TCTTTAACCTCTCCATCTTCT	0.353																																																	0													244.0	200.0	213.0					1																	49227056		692	1591	2283	SO:0001587	stop_gained	0			BC007932	CCDS552.2	1p33	2012-11-22	2008-10-03	2008-10-03	ENSG00000162373	ENSG00000162373		"""BEN domain containing"""	25668	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 165"""	C1orf165		12477932	Standard	NM_024603		Approved	FLJ11588	uc001crx.4	Q7L4P6	OTTHUMG00000008153	ENST00000371833.3:c.313G>T	1.37:g.49227056C>A	ENSP00000360899:p.Glu105*		D3DQ27|Q96A62|Q9HAI3	Nonsense_Mutation	SNP	pfam_BEN_domain	p.E105*	ENST00000371833.3	37	c.313	CCDS552.2	1	.	.	.	.	.	.	.	.	.	.	C	32	5.172019	0.94807	.	.	ENSG00000162373	ENST00000371833	.	.	.	5.61	5.61	0.85477	.	0.108794	0.64402	D	0.000013	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-6.2836	19.0051	0.92848	0.0:1.0:0.0:0.0	.	.	.	.	X	105	.	.	E	-	1	0	BEND5	48999643	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.205000	0.65186	2.814000	0.96858	0.591000	0.81541	GAG	BEND5	-	NULL	ENSG00000162373		0.353	BEND5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BEND5	HGNC	protein_coding	OTTHUMT00000022323.1	-	0.00	110	0	C	NM_024603		49227056	-1	tier1	-	no_errors	ENST00000371833	ensembl	human	known	74_37	nonsense	15.49	60	11	SNP	1.000	A
BICD2	23299	genome.wustl.edu	37	9	95526873	95526873	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr9:95526873C>G	ENST00000375512.3	-	1	221	c.154G>C	c.(154-156)Gag>Cag	p.E52Q	BICD2_ENST00000356884.6_Missense_Mutation_p.E52Q	NM_015250.3	NP_056065.1	Q8TD16	BICD2_HUMAN	bicaudal D homolog 2 (Drosophila)	52					cell death (GO:0008219)|microtubule anchoring at microtubule organizing center (GO:0072393)|minus-end-directed organelle transport along microtubule (GO:0072385)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	Rab GTPase binding (GO:0017137)			cervix(3)|endometrium(4)|kidney(1)|large_intestine(6)|lung(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23						TGCTTCTCCTCGAGCACCGCC	0.667																																																	0													20.0	14.0	16.0					9																	95526873		2170	4258	6428	SO:0001583	missense	0			AB014599	CCDS6700.1, CCDS35064.1	9q22.32	2008-02-05			ENSG00000185963	ENSG00000185963			17208	protein-coding gene	gene with protein product		609797				9734811	Standard	NM_001003800		Approved	KIAA0699	uc004asp.1	Q8TD16	OTTHUMG00000021036	ENST00000375512.3:c.154G>C	9.37:g.95526873C>G	ENSP00000364662:p.Glu52Gln		O75181|Q5TBQ2|Q5TBQ3|Q96LH2|Q9BT84|Q9H561	Missense_Mutation	SNP	pfam_Bicaudal-D_microtubule-assoc	p.E52Q	ENST00000375512.3	37	c.154	CCDS6700.1	9	.	.	.	.	.	.	.	.	.	.	.	36	5.722030	0.96839	.	.	ENSG00000185963	ENST00000356884;ENST00000375512	T;T	0.59083	0.29;0.3	4.81	4.81	0.61882	.	0.000000	0.85682	D	0.000000	T	0.72835	0.3510	M	0.76727	2.345	0.58432	D	0.999999	D;D	0.76494	0.999;0.976	D;P	0.66979	0.948;0.749	T	0.70403	-0.4881	10	0.24483	T	0.36	-27.0688	15.7501	0.77976	0.0:1.0:0.0:0.0	.	52;52	Q8TD16-2;Q8TD16	.;BICD2_HUMAN	Q	52	ENSP00000349351:E52Q;ENSP00000364662:E52Q	ENSP00000349351:E52Q	E	-	1	0	BICD2	94566694	1.000000	0.71417	0.986000	0.45419	0.970000	0.65996	7.406000	0.80017	2.388000	0.81334	0.400000	0.26472	GAG	BICD2	-	NULL	ENSG00000185963		0.667	BICD2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	BICD2	HGNC	protein_coding	OTTHUMT00000055508.1	-	0.00	46	0	C	NM_015250		95526873	-1	tier1	-	no_errors	ENST00000356884	ensembl	human	known	74_37	missense	23.73	43	14	SNP	1.000	G
BRD4	23476	genome.wustl.edu	37	19	15366974	15366974	+	Missense_Mutation	SNP	T	T	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr19:15366974T>C	ENST00000263377.2	-	9	1873	c.1652A>G	c.(1651-1653)cAc>cGc	p.H551R	BRD4_ENST00000371835.4_Missense_Mutation_p.H551R|BRD4_ENST00000602230.1_5'UTR|BRD4_ENST00000360016.5_Missense_Mutation_p.H551R	NM_058243.2	NP_490597.1	O60885	BRD4_HUMAN	bromodomain containing 4	551	BID region.|Lys-rich.				cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|chromosome segregation (GO:0007059)|histone H3-K14 acetylation (GO:0044154)|histone H4-K12 acetylation (GO:0043983)|inner cell mass cell proliferation (GO:0001833)|negative regulation of DNA damage checkpoint (GO:2000002)|positive regulation of DNA binding (GO:0043388)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|regulation of phosphorylation of RNA polymerase II C-terminal domain (GO:1901407)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|positive transcription elongation factor complex b (GO:0008024)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|urinary_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(3;3.02e-24)|Epithelial(3;4.71e-20)|all cancers(3;2.26e-18)			tttccttttgtgcttttcttt	0.428			T	C15orf55	lethal midline carcinoma of young people																																			Dom	yes		19	19p13.1	23476	bromodomain containing 4		E	0													249.0	222.0	232.0					19																	15366974		2202	4300	6502	SO:0001583	missense	0			Y12059	CCDS12328.1, CCDS46004.1	19p13.12	2013-09-20	2002-01-14		ENSG00000141867	ENSG00000141867			13575	protein-coding gene	gene with protein product	"""chromosome-associated protein"""	608749	"""bromodomain-containing 4"""			10938129	Standard	NM_058243		Approved	HUNKI, MCAP, CAP, HUNK1	uc002nar.3	O60885	OTTHUMG00000183252	ENST00000263377.2:c.1652A>G	19.37:g.15366974T>C	ENSP00000263377:p.His551Arg		O60433|Q4G0X8|Q86YS8|Q96PD3	Missense_Mutation	SNP	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.H551R	ENST00000263377.2	37	c.1652	CCDS12328.1	19	.	.	.	.	.	.	.	.	.	.	T	13.87	2.366356	0.41902	.	.	ENSG00000141867	ENST00000263377;ENST00000371835;ENST00000360016	T;T;T	0.10960	2.82;2.82;2.82	5.55	5.55	0.83447	.	0.683333	0.14264	N	0.330582	T	0.14614	0.0353	L	0.57536	1.79	0.45621	D	0.998554	B;B;B	0.26081	0.126;0.089;0.141	B;B;B	0.25759	0.052;0.015;0.063	T	0.03630	-1.1018	10	0.30854	T	0.27	-10.4692	14.6817	0.69023	0.0:0.0:0.0:1.0	.	551;551;551	Q4G0X8;O60885-2;O60885	.;.;BRD4_HUMAN	R	551	ENSP00000263377:H551R;ENSP00000360901:H551R;ENSP00000353112:H551R	ENSP00000263377:H551R	H	-	2	0	BRD4	15227974	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.289000	0.72696	2.122000	0.65172	0.459000	0.35465	CAC	BRD4	-	NULL	ENSG00000141867		0.428	BRD4-001	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	BRD4	HGNC	protein_coding	OTTHUMT00000465800.3	-	0.00	53	0	T	NM_058243		15366974	-1	tier1	-	no_errors	ENST00000263377	ensembl	human	known	74_37	missense	25.00	30	10	SNP	1.000	C
BST1	683	genome.wustl.edu	37	4	15707200	15707200	+	Missense_Mutation	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr4:15707200C>T	ENST00000265016.4	+	2	446	c.251C>T	c.(250-252)tCc>tTc	p.S84F	BST1_ENST00000382346.3_Missense_Mutation_p.S99F	NM_004334.2	NP_004325.2	Q10588	BST1_HUMAN	bone marrow stromal cell antigen 1	84					humoral immune response (GO:0006959)|multicellular organismal development (GO:0007275)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	NAD(P)+ nucleosidase activity (GO:0050135)|NAD+ nucleosidase activity (GO:0003953)|transferase activity (GO:0016740)			central_nervous_system(1)|large_intestine(1)|lung(2)|stomach(3)|urinary_tract(1)	8						GATCCCTGCTCCGTGCTGCCC	0.473																																																	0													150.0	137.0	141.0					4																	15707200		2203	4300	6503	SO:0001583	missense	0			D21878	CCDS3416.1	4p15	2010-05-04			ENSG00000109743	ENSG00000109743	3.2.2.5	"""CD molecules"""	1118	protein-coding gene	gene with protein product	"""NAD(+) nucleosidase"", ""ADP-ribosyl cyclase 2"""	600387				8202488	Standard	NM_004334		Approved	CD157	uc003goh.4	Q10588	OTTHUMG00000097739	ENST00000265016.4:c.251C>T	4.37:g.15707200C>T	ENSP00000265016:p.Ser84Phe		B2R6A2|Q1XII0|Q5U0K0|Q96EN3	Missense_Mutation	SNP	pfam_ADP-ribosyl_cyclase	p.S84F	ENST00000265016.4	37	c.251	CCDS3416.1	4	.	.	.	.	.	.	.	.	.	.	C	11.20	1.568857	0.28003	.	.	ENSG00000109743	ENST00000265016;ENST00000382346	T;T	0.15139	2.45;2.45	5.72	3.93	0.45458	.	0.362486	0.28236	N	0.016082	T	0.25382	0.0617	M	0.63843	1.955	0.09310	N	1	D	0.56035	0.974	P	0.49421	0.61	T	0.06625	-1.0816	9	.	.	.	-2.0327	11.3176	0.49401	0.3312:0.6688:0.0:0.0	.	84	Q10588	BST1_HUMAN	F	84;99	ENSP00000265016:S84F;ENSP00000371783:S99F	.	S	+	2	0	BST1	15316298	0.030000	0.19436	0.002000	0.10522	0.024000	0.10985	1.688000	0.37690	0.714000	0.32081	-0.187000	0.12897	TCC	BST1	-	pfam_ADP-ribosyl_cyclase	ENSG00000109743		0.473	BST1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	BST1	HGNC	protein_coding	OTTHUMT00000214968.2	-	0.00	33	0	C	NM_004334		15707200	+1	tier1	-	no_errors	ENST00000265016	ensembl	human	known	74_37	missense	12.20	36	5	SNP	0.029	T
BSX	390259	genome.wustl.edu	37	11	122852178	122852178	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr11:122852178G>C	ENST00000343035.2	-	1	250	c.202C>G	c.(202-204)Cac>Gac	p.H68D		NM_001098169.1	NP_001091639.1	Q3C1V8	BSH_HUMAN	brain-specific homeobox	68	His-rich.				eating behavior (GO:0042755)|locomotory behavior (GO:0007626)|mammary gland involution (GO:0060056)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(2)	10		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0361)		TGATGGGCGTGAGGAGCCAAG	0.582																																																	0													29.0	31.0	31.0					11																	122852178		2035	4177	6212	SO:0001583	missense	0				CCDS41728.1	11q24.1	2011-07-19			ENSG00000188909	ENSG00000188909		"""Homeoboxes / ANTP class : NKL subclass"""	20450	protein-coding gene	gene with protein product		611074					Standard	NM_001098169		Approved	BSX1	uc010rzs.2	Q3C1V8	OTTHUMG00000150247	ENST00000343035.2:c.202C>G	11.37:g.122852178G>C	ENSP00000344285:p.His68Asp			Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa	p.H68D	ENST00000343035.2	37	c.202	CCDS41728.1	11	.	.	.	.	.	.	.	.	.	.	G	21.9	4.221710	0.79464	.	.	ENSG00000188909	ENST00000343035	D	0.93811	-3.29	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	D	0.94414	0.8203	L	0.34521	1.04	0.80722	D	1	D	0.71674	0.998	D	0.73708	0.981	D	0.93324	0.6695	10	0.30854	T	0.27	.	18.5986	0.91239	0.0:0.0:1.0:0.0	.	68	Q3C1V8	BSH_HUMAN	D	68	ENSP00000344285:H68D	ENSP00000344285:H68D	H	-	1	0	BSX	122357388	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.085000	0.94083	2.489000	0.83994	0.586000	0.80456	CAC	BSX	-	NULL	ENSG00000188909		0.582	BSX-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	BSX	HGNC	protein_coding	OTTHUMT00000317076.1	-	0.00	15	0	G	NM_001098169		122852178	-1	tier1	-	no_errors	ENST00000343035	ensembl	human	known	74_37	missense	20.00	20	5	SNP	1.000	C
BTAF1	9044	genome.wustl.edu	37	10	93768818	93768818	+	Nonsense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr10:93768818C>G	ENST00000265990.6	+	28	4264	c.3956C>G	c.(3955-3957)tCa>tGa	p.S1319*	BTAF1_ENST00000544642.1_Nonsense_Mutation_p.S147*	NM_003972.2	NP_003963.1	O14981	BTAF1_HUMAN	BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa	1319	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				negative regulation of chromatin binding (GO:0035562)|negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(2)|urinary_tract(6)	59		Colorectal(252;0.0846)				TATGCAAGATCAAAATTAGCA	0.368																																																	0													114.0	102.0	106.0					10																	93768818		2203	4300	6503	SO:0001587	stop_gained	0			AJ001017	CCDS7419.1	10q22-q23	2013-05-01	2013-05-01		ENSG00000095564	ENSG00000095564			17307	protein-coding gene	gene with protein product	"""Mot1 homolog (S. cerevisiae)"""	605191	"""BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170 kD (Mot1 homolog, S. cerevisiae)"""			9342322, 9488487	Standard	NM_003972		Approved	TAFII170, TAF172, MOT1, TAF-172, TAF(II)170	uc001khr.3	O14981	OTTHUMG00000018752	ENST00000265990.6:c.3956C>G	10.37:g.93768818C>G	ENSP00000265990:p.Ser1319*		B4E0W6|O43578	Nonsense_Mutation	SNP	pfam_DUF3535,pfam_SNF2_N,pfam_HEAT,pfam_Helicase_C,superfamily_ARM-type_fold,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.S1319*	ENST00000265990.6	37	c.3956	CCDS7419.1	10	.	.	.	.	.	.	.	.	.	.	C	38	6.839818	0.97877	.	.	ENSG00000095564	ENST00000265990;ENST00000544642;ENST00000538688	.	.	.	5.23	5.23	0.72850	.	0.189166	0.42682	D	0.000664	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	-13.569	17.3587	0.87344	0.0:1.0:0.0:0.0	.	.	.	.	X	1319;147;169	.	ENSP00000265990:S1319X	S	+	2	0	BTAF1	93758798	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.749000	0.62155	2.610000	0.88304	0.650000	0.86243	TCA	BTAF1	-	pfam_SNF2_N,superfamily_ARM-type_fold,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000095564		0.368	BTAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTAF1	HGNC	protein_coding	OTTHUMT00000049380.4	-	0.00	90	0	C	NM_003972		93768818	+1	tier1	-	no_errors	ENST00000265990	ensembl	human	known	74_37	nonsense	11.30	102	13	SNP	1.000	G
C10orf88	80007	genome.wustl.edu	37	10	124697221	124697221	+	Splice_Site	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr10:124697221C>G	ENST00000481909.1	-	5	1327	c.1103G>C	c.(1102-1104)gGa>gCa	p.G368A	C10orf88_ENST00000368891.5_5'UTR	NM_024942.3	NP_079218.2	Q9H8K7	CJ088_HUMAN	chromosome 10 open reading frame 88	368										breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)	18		all_neural(114;0.0765)|Lung NSC(174;0.163)|all_lung(145;0.205)		Colorectal(40;0.0686)|COAD - Colon adenocarcinoma(40;0.0735)		TAATACTTACCCAACACCAAG	0.378																																																	0													81.0	80.0	80.0					10																	124697221		2203	4299	6502	SO:0001630	splice_region_variant	0			AK023552	CCDS7632.1	10q26.13	2012-11-09			ENSG00000119965	ENSG00000119965			25822	protein-coding gene	gene with protein product						12477932	Standard	NM_024942		Approved	FLJ13490, Em:AC073585.5	uc001lgw.2	Q9H8K7	OTTHUMG00000019190	ENST00000481909.1:c.1103+1G>C	10.37:g.124697221C>G			Q0P6C6|Q8N597	Missense_Mutation	SNP	NULL	p.G368A	ENST00000481909.1	37	c.1103	CCDS7632.1	10	.	.	.	.	.	.	.	.	.	.	C	9.905	1.207910	0.22205	.	.	ENSG00000119965	ENST00000481909	.	.	.	3.79	-2.31	0.06765	.	0.895717	0.09100	N	0.848605	T	0.24353	0.0590	N	0.11427	0.14	0.22240	N	0.999263	B	0.09022	0.002	B	0.11329	0.006	T	0.21895	-1.0232	8	.	.	.	.	16.3542	0.83228	0.0:0.8036:0.1964:0.0	.	368	Q9H8K7	CJ088_HUMAN	A	368	.	.	G	-	2	0	C10orf88	124687211	0.008000	0.16893	0.244000	0.24202	0.714000	0.41099	-0.118000	0.10692	-0.134000	0.11516	0.467000	0.42956	GGA	C10orf88	-	NULL	ENSG00000119965		0.378	C10orf88-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf88	HGNC	protein_coding	OTTHUMT00000050807.1	-	0.00	35	0	C	NM_024942	Missense_Mutation	124697221	-1	tier1	-	no_errors	ENST00000481909	ensembl	human	known	74_37	missense	17.39	38	8	SNP	0.246	G
C11orf85	283129	genome.wustl.edu	37	11	64707168	64707168	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr11:64707168C>G	ENST00000301896.5	-	10	691	c.618G>C	c.(616-618)agG>agC	p.R206S	C11orf85_ENST00000530444.1_Missense_Mutation_p.E150Q|C11orf85_ENST00000536065.1_Missense_Mutation_p.E122Q|C11orf85_ENST00000432175.1_Missense_Mutation_p.R206S	NM_001037225.1	NP_001032302.1	Q3KP22	CK085_HUMAN	chromosome 11 open reading frame 85	206										breast(2)|large_intestine(1)|lung(1)|skin(1)|urinary_tract(2)	7						GCTGCTCGCTCCTTAGGTGGA	0.547																																																	0													91.0	90.0	90.0					11																	64707168		2201	4297	6498	SO:0001583	missense	0			AK093130, BC033501	CCDS31603.1, CCDS73316.1	11q13.1	2012-08-10			ENSG00000168070	ENSG00000168070			27441	protein-coding gene	gene with protein product						14702039	Standard	XM_005273918		Approved		uc001ocb.1	Q3KP22		ENST00000301896.5:c.618G>C	11.37:g.64707168C>G	ENSP00000301896:p.Arg206Ser		B3KS99	Missense_Mutation	SNP	NULL	p.R206S	ENST00000301896.5	37	c.618	CCDS31603.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.12|13.12	2.142163|2.142163	0.37825|0.37825	.|.	.|.	ENSG00000168070|ENSG00000168070	ENST00000532617;ENST00000530444;ENST00000536065|ENST00000301896;ENST00000432175	.|.	.|.	.|.	3.61|3.61	1.69|1.69	0.24217|0.24217	.|.	.|1.135100	.|0.06841	.|N	.|0.795723	T|T	0.20700|0.20700	0.0498|0.0498	N|N	0.22421|0.22421	0.69|0.69	0.09310|0.09310	N|N	1|1	P|B	0.42203|0.27732	0.773|0.187	B|B	0.35312|0.22386	0.2|0.039	T|T	0.25745|0.25745	-1.0123|-1.0123	8|9	0.87932|0.13470	D|T	0|0.59	-8.1164|-8.1164	4.9343|4.9343	0.13932|0.13932	0.0:0.662:0.2182:0.1197|0.0:0.662:0.2182:0.1197	.|.	150|206	E9PPE5|Q3KP22	.|CK085_HUMAN	Q|S	49;150;122|206	.|.	ENSP00000434568:E150Q|ENSP00000301896:R206S	E|R	-|-	1|3	0|2	C11orf85|C11orf85	64463744|64463744	0.011000|0.011000	0.17503|0.17503	0.011000|0.011000	0.14972|0.14972	0.013000|0.013000	0.08279|0.08279	1.172000|1.172000	0.31908|0.31908	0.493000|0.493000	0.27837|0.27837	0.563000|0.563000	0.77884|0.77884	GAG|AGG	C11orf85	-	NULL	ENSG00000168070		0.547	C11orf85-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C11orf85	HGNC	protein_coding	OTTHUMT00000385477.1	-	0.00	29	0	C	NM_001037225		64707168	-1	tier1	-	no_errors	ENST00000301896	ensembl	human	known	74_37	missense	27.27	23	9	SNP	0.013	G
C11orf80	79703	genome.wustl.edu	37	11	66555679	66555679	+	Nonsense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr11:66555679C>G	ENST00000360962.4	+	5	579	c.572C>G	c.(571-573)tCa>tGa	p.S191*	C11orf80_ENST00000540737.1_Nonsense_Mutation_p.S25*|C11orf80_ENST00000525449.2_Nonsense_Mutation_p.S36*|C11orf80_ENST00000527634.1_Intron|C11orf80_ENST00000346672.4_Nonsense_Mutation_p.S36*|C11orf80_ENST00000527368.1_3'UTR|C11orf80_ENST00000532565.2_5'UTR	NM_024650.3	NP_078926.3	Q8N6T0	CK080_HUMAN	chromosome 11 open reading frame 80	191										autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	14						ACTTGGACTTCAGAGGAAGGC	0.413																																																	0													98.0	93.0	94.0					11																	66555679		1885	4114	5999	SO:0001587	stop_gained	0					11q13.2	2012-05-30			ENSG00000173715	ENSG00000173715			26197	protein-coding gene	gene with protein product						18160775	Standard	NM_024650		Approved	FLJ22531	uc021qmd.1	Q8N6T0	OTTHUMG00000167164	ENST00000360962.4:c.572C>G	11.37:g.66555679C>G	ENSP00000354227:p.Ser191*		Q9H677	Nonsense_Mutation	SNP	NULL	p.S191*	ENST00000360962.4	37	c.572	CCDS53664.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.21|14.21	2.468911|2.468911	0.43839|0.43839	.|.	.|.	ENSG00000173715|ENSG00000173715	ENST00000532089|ENST00000525908;ENST00000360962;ENST00000346672;ENST00000528340;ENST00000540737;ENST00000525449	.|.	.|.	.|.	5.38|5.38	2.47|2.47	0.30058|0.30058	.|.	.|0.951167	.|0.08649	.|N	.|0.914330	T|.	0.50990|.	0.1648|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.55237|.	-0.8172|.	3|.	.|0.87932	.|D	.|0	.|.	7.8676|7.8676	0.29545|0.29545	0.0:0.7359:0.0:0.2641|0.0:0.7359:0.0:0.2641	.|.	.|.	.|.	.|.	E|X	17|142;191;36;25;25;36	.|.	.|ENSP00000317408:S36X	Q|S	+|+	1|2	0|0	C11orf80|C11orf80	66312255|66312255	0.997000|0.997000	0.39634|0.39634	0.041000|0.041000	0.18516|0.18516	0.110000|0.110000	0.19582|0.19582	0.415000|0.415000	0.21181|0.21181	0.255000|0.255000	0.21593|0.21593	-0.150000|-0.150000	0.13652|0.13652	CAG|TCA	C11orf80	-	NULL	ENSG00000173715		0.413	C11orf80-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C11orf80	HGNC	protein_coding		-	0.00	78	0	C	NM_024650		66555679	+1	tier1	-	no_errors	ENST00000360962	ensembl	human	known	74_37	nonsense	18.39	71	16	SNP	0.659	G
C12orf29	91298	genome.wustl.edu	37	12	88442121	88442124	+	Frame_Shift_Del	DEL	TAAG	TAAG	-			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	TAAG	TAAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr12:88442121_88442124delTAAG	ENST00000356891.3	+	7	1103_1106	c.900_903delTAAG	c.(898-903)attaagfs	p.IK300fs		NM_001009894.2	NP_001009894.2	Q8N999	CL029_HUMAN	chromosome 12 open reading frame 29	300					hematopoietic progenitor cell differentiation (GO:0002244)					large_intestine(3)|lung(1)|ovary(1)	5						CCTTTGATATTAAGTGTTTGTTTA	0.27																																																	0																																										SO:0001589	frameshift_variant	0			AL137488	CCDS31866.1	12q21.32	2012-05-30			ENSG00000133641	ENSG00000133641			25322	protein-coding gene	gene with protein product						14702039	Standard	NM_001009894		Approved	DKFZp434N2030	uc001tao.3	Q8N999	OTTHUMG00000169870	ENST00000356891.3:c.900_903delTAAG	12.37:g.88442121_88442124delTAAG	ENSP00000349358:p.Ile300fs		Q569K5|Q6AWA8|Q6PEK5|Q8IYQ5|Q9NT75	Frame_Shift_Del	DEL	NULL	p.K301fs	ENST00000356891.3	37	c.900_903	CCDS31866.1	12																																																																																			C12orf29	-	NULL	ENSG00000133641		0.270	C12orf29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf29	HGNC	protein_coding	OTTHUMT00000406335.1		0.00	75	0	TAAG	NM_001009894		88442124	+1	tier1		no_errors	ENST00000356891	ensembl	human	known	74_37	frame_shift_del	40.26	46	31	DEL	0.250:0.251:0.177:0.110	-
C16orf91	283951	genome.wustl.edu	37	16	1476218	1476218	+	Silent	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr16:1476218C>T	ENST00000310355.1	-	3	404	c.405G>A	c.(403-405)agG>agA	p.R135R				Q4G0I0	CSMT1_HUMAN	chromosome 16 open reading frame 91	0						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|kidney(1)|lung(4)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	11						GACTGGTCAGCCTCATCCTGG	0.612																																																	0													98.0	102.0	101.0					16																	1476218		2199	4300	6499	SO:0001819	synonymous_variant	0			BC023590	CCDS61789.1	16p13.3	2012-10-10			ENSG00000174109	ENSG00000174109			27558	protein-coding gene	gene with protein product	"""cattle cerebrum and skeletal muscle-specific protein 1 family member"""						Standard	NM_001272051		Approved	gs103, CCSMST1	uc002clr.4	Q4G0I0		ENST00000310355.1:c.405G>A	16.37:g.1476218C>T			Q96RZ0	Silent	SNP	prints_CCSMST1	p.R135	ENST00000310355.1	37	c.405	CCDS32360.1	16																																																																																			C16orf91	-	NULL	ENSG00000174109		0.612	C16orf91-201	KNOWN	basic|CCDS	protein_coding	C16orf91	HGNC	protein_coding		-	0.00	57	0	C	NM_001010878		1476218	-1	tier1	-	no_errors	ENST00000310355	ensembl	human	known	74_37	silent	5.49	86	5	SNP	0.000	T
C16orf62	57020	genome.wustl.edu	37	16	19628044	19628044	+	Nonsense_Mutation	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr16:19628044C>T	ENST00000251143.5	+	14	1150	c.1138C>T	c.(1138-1140)Caa>Taa	p.Q380*	C16orf62_ENST00000543152.1_Nonsense_Mutation_p.Q129*|C16orf62_ENST00000542263.1_Intron|C16orf62_ENST00000438132.3_Nonsense_Mutation_p.Q469*|C16orf62_ENST00000417362.2_Intron|C16orf62_ENST00000448695.1_Nonsense_Mutation_p.Q230*			Q7Z3J2	CP062_HUMAN	chromosome 16 open reading frame 62	380						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	36						GCTGGTGGTCCAAGGAGTGGA	0.522																																																	0													141.0	115.0	124.0					16																	19628044		2197	4300	6497	SO:0001587	stop_gained	0				CCDS32397.1, CCDS32397.2, CCDS73840.1	16p12.3	2012-05-30			ENSG00000103544	ENSG00000103544			24641	protein-coding gene	gene with protein product						10493829	Standard	NM_020314		Approved	MGC16824	uc002dgn.3	Q7Z3J2	OTTHUMG00000167925	ENST00000251143.5:c.1138C>T	16.37:g.19628044C>T	ENSP00000251143:p.Gln380*		A8K2M1|O43329|Q69YI1|Q6PDA0|Q7L371|Q86W66|Q8WXA5|Q9H0L7|Q9H7C8	Nonsense_Mutation	SNP	NULL	p.Q469*	ENST00000251143.5	37	c.1405		16	.	.	.	.	.	.	.	.	.	.	C	32	5.127548	0.94473	.	.	ENSG00000103544	ENST00000438132;ENST00000251143;ENST00000448695	.	.	.	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-22.5587	18.7567	0.91835	0.0:1.0:0.0:0.0	.	.	.	.	X	469;380;230	.	.	Q	+	1	0	C16orf62	19535545	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.313000	0.78978	2.524000	0.85096	0.557000	0.71058	CAA	C16orf62	-	NULL	ENSG00000103544		0.522	C16orf62-201	KNOWN	basic|appris_principal	protein_coding	C16orf62	HGNC	protein_coding		-	0.00	75	0	C	NM_020314		19628044	+1	tier1	-	no_errors	ENST00000438132	ensembl	human	known	74_37	nonsense	28.40	58	23	SNP	1.000	T
NOL4L	140688	genome.wustl.edu	37	20	31115602	31115602	+	Missense_Mutation	SNP	T	T	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr20:31115602T>C	ENST00000201961.2	-	2	373	c.154A>G	c.(154-156)Aaa>Gaa	p.K52E	C20orf112_ENST00000375678.3_Missense_Mutation_p.K11E			Q96MY1	NOL4L_HUMAN		210						cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(3)|kidney(2)|large_intestine(5)|lung(5)	15						TTGGGGGCTTTGCCTGGCTCC	0.592																																																	0																																										SO:0001583	missense	0																														ENST00000201961.2:c.154A>G	20.37:g.31115602T>C	ENSP00000201961:p.Lys52Glu		Q5JYB7|Q6P0Y4|Q9BR34|Q9NQF6	Missense_Mutation	SNP	NULL	p.K52E	ENST00000201961.2	37	c.154		20	.	.	.	.	.	.	.	.	.	.	T	19.40	3.819725	0.71028	.	.	ENSG00000197183	ENST00000375678;ENST00000201961	.	.	.	4.66	4.66	0.58398	.	.	.	.	.	T	0.43656	0.1257	N	0.14661	0.345	0.40637	D	0.981916	.	.	.	.	.	.	T	0.49457	-0.8938	6	0.51188	T	0.08	.	11.9794	0.53111	0.0:0.0:0.0:1.0	.	.	.	.	E	11;52	.	ENSP00000201961:K52E	K	-	1	0	C20orf112	30579263	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.730000	0.47335	1.968000	0.57251	0.374000	0.22700	AAA	C20orf112	-	NULL	ENSG00000197183		0.592	C20orf112-002	KNOWN	basic|appris_candidate_longest	protein_coding	C20orf112	HGNC	protein_coding	OTTHUMT00000078629.3	-	0.00	39	0	T			31115602	-1	tier1	-	no_errors	ENST00000201961	ensembl	human	known	74_37	missense	23.26	33	10	SNP	1.000	C
C2CD3	26005	genome.wustl.edu	37	11	73745207	73745207	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr11:73745207G>C	ENST00000334126.7	-	31	6224	c.5998C>G	c.(5998-6000)Cga>Gga	p.R2000G	C2CD3_ENST00000542452.1_5'Flank			Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3	2000					brain development (GO:0007420)|centriole elongation (GO:0061511)|embryonic digit morphogenesis (GO:0042733)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|neural plate axis specification (GO:0021997)|neural tube development (GO:0021915)|nonmotile primary cilium assembly (GO:0035058)|protein localization to centrosome (GO:0071539)|protein processing (GO:0016485)|regulation of proteolysis (GO:0030162)|regulation of smoothened signaling pathway (GO:0008589)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)				NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(26)|ovary(4)|pancreas(2)|prostate(1)|skin(3)	64	Breast(11;4.16e-06)					ATTGTGCATCGTTCTTGCAGT	0.522																																																	0																																										SO:0001583	missense	0			BC035599	CCDS31636.1, CCDS66167.1	11q13.4	2014-02-12	2007-10-17		ENSG00000168014	ENSG00000168014			24564	protein-coding gene	gene with protein product		615944					Standard	XM_005273897		Approved	DKFZP586P0123	uc001ouu.2	Q4AC94	OTTHUMG00000168110	ENST00000334126.7:c.5998C>G	11.37:g.73745207G>C	ENSP00000334379:p.Arg2000Gly		C9JR55|E2QRD1|Q2NLE1|Q3C1U9|Q6ZU92|Q8IYM4|Q8NB87|Q8NDH7|Q9Y4M2	Missense_Mutation	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom	p.R2000G	ENST00000334126.7	37	c.5998		11	.	.	.	.	.	.	.	.	.	.	G	0.685	-0.796837	0.02862	.	.	ENSG00000168014	ENST00000334126	T	0.10668	2.85	5.83	2.62	0.31277	.	1.232400	0.06274	N	0.696214	T	0.09468	0.0233	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.43360	-0.9396	7	0.20519	T	0.43	.	9.7745	0.40609	0.0:0.4867:0.3356:0.1776	.	.	.	.	G	2000	ENSP00000334379:R2000G	ENSP00000334379:R2000G	R	-	1	2	C2CD3	73422855	0.001000	0.12720	0.030000	0.17652	0.030000	0.12068	0.403000	0.20982	0.763000	0.33175	0.655000	0.94253	CGA	C2CD3	-	NULL	ENSG00000168014		0.522	C2CD3-201	KNOWN	basic|appris_candidate_longest	protein_coding	C2CD3	HGNC	protein_coding		-	0.00	15	0	G	NM_015531		73745207	-1	tier1	-	no_errors	ENST00000334126	ensembl	human	known	74_37	missense	26.32	28	10	SNP	0.009	C
C3orf27	23434	genome.wustl.edu	37	3	128292319	128292320	+	Frame_Shift_Del	DEL	TC	TC	-	rs147519916		TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	TC	TC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr3:128292319_128292320delTC	ENST00000356020.2	-	3	1219_1220	c.253_254delGA	c.(253-255)gatfs	p.D86fs		NM_007354.2	NP_031380.1	O15544	GR6_HUMAN	chromosome 3 open reading frame 27	86										large_intestine(2)|lung(5)|prostate(1)	8				GBM - Glioblastoma multiforme(114;0.176)		GAGCTCGTCATCTCTCTCTCTC	0.599																																																	0																																										SO:0001589	frameshift_variant	0			AF008192	CCDS3050.1	3q21	2005-12-19			ENSG00000198685	ENSG00000198685			17099	protein-coding gene	gene with protein product						9307271	Standard	NR_125802		Approved	GR6	uc003ekq.3	O15544	OTTHUMG00000159688	ENST00000356020.2:c.253_254delGA	3.37:g.128292329_128292330delTC	ENSP00000348302:p.Asp86fs			Frame_Shift_Del	DEL	NULL	p.D85fs	ENST00000356020.2	37	c.254_253	CCDS3050.1	3																																																																																			C3orf27	-	NULL	ENSG00000198685		0.599	C3orf27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3orf27	HGNC	protein_coding	OTTHUMT00000356924.1		0.00	31	0	TC	NM_007354		128292320	-1	tier1		no_errors	ENST00000356020	ensembl	human	known	74_37	frame_shift_del	11.76	30	4	DEL	0.075:0.076	-
C3orf30	152405	genome.wustl.edu	37	3	118865898	118865898	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr3:118865898G>C	ENST00000295622.1	+	1	902	c.862G>C	c.(862-864)Gag>Cag	p.E288Q	IGSF11_ENST00000441144.2_5'Flank|IGSF11_ENST00000425327.2_5'Flank|RP11-484M3.5_ENST00000490594.1_5'Flank|IGSF11_ENST00000354673.2_5'Flank	NM_152539.2	NP_689752.2	Q96M34	CC030_HUMAN	chromosome 3 open reading frame 30	288										NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(20)|ovary(2)|prostate(1)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(114;0.222)		AGGAACTTCTGAGCAGACTGA	0.493																																																	0													77.0	75.0	76.0					3																	118865898		2203	4300	6503	SO:0001583	missense	0			AK057421	CCDS2984.1	3q13.32	2011-08-09			ENSG00000163424	ENSG00000163424			26553	protein-coding gene	gene with protein product							Standard	NM_152539		Approved	FLJ32859	uc003ecb.1	Q96M34	OTTHUMG00000159349	ENST00000295622.1:c.862G>C	3.37:g.118865898G>C	ENSP00000295622:p.Glu288Gln		A1L4B7	Missense_Mutation	SNP	superfamily_cAMP_dep_PK_reg_su_I/II_a/b	p.E288Q	ENST00000295622.1	37	c.862	CCDS2984.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.08|14.08	2.428194|2.428194	0.43122|0.43122	.|.	.|.	ENSG00000163424|ENSG00000163424	ENST00000295622;ENST00000470341|ENST00000460150;ENST00000473121;ENST00000492792	T|.	0.12361|.	2.69|.	4.13|4.13	3.21|3.21	0.36854|0.36854	.|.	0.665339|.	0.13221|.	N|.	0.404360|.	T|.	0.50684|.	0.1630|.	L|L	0.55481|0.55481	1.735|1.735	0.09310|0.09310	N|N	1|1	P;P|.	0.51537|.	0.851;0.946|.	P;P|.	0.47402|.	0.546;0.521|.	T|.	0.40289|.	-0.9571|.	10|.	0.33940|.	T|.	0.23|.	-1.8723|-1.8723	11.8312|11.8312	0.52297|0.52297	0.0:0.1791:0.8209:0.0|0.0:0.1791:0.8209:0.0	.|.	288;288|.	E9PFE5;Q96M34|.	.;CC030_HUMAN|.	Q|S	288|251;80;22	ENSP00000295622:E288Q|.	ENSP00000295622:E288Q|.	E|X	+|+	1|2	0|2	C3orf30|C3orf30	120348588|120348588	0.001000|0.001000	0.12720|0.12720	0.002000|0.002000	0.10522|0.10522	0.003000|0.003000	0.03518|0.03518	0.647000|0.647000	0.24812|0.24812	1.256000|1.256000	0.44068|0.44068	0.591000|0.591000	0.81541|0.81541	GAG|TGA	C3orf30	-	NULL	ENSG00000163424		0.493	C3orf30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3orf30	HGNC	protein_coding	OTTHUMT00000354838.1	-	0.00	41	0	G	NM_152539		118865898	+1	tier1	-	no_errors	ENST00000295622	ensembl	human	known	74_37	missense	50.94	26	27	SNP	0.009	C
C5orf42	65250	genome.wustl.edu	37	5	37201793	37201793	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr5:37201793G>C	ENST00000508244.1	-	18	3500	c.3407C>G	c.(3406-3408)tCt>tGt	p.S1136C	C5orf42_ENST00000274258.7_Missense_Mutation_p.S17C|C5orf42_ENST00000425232.2_Missense_Mutation_p.S1136C			Q9H799	CE042_HUMAN	chromosome 5 open reading frame 42	1136						integral component of membrane (GO:0016021)				breast(5)|endometrium(3)|kidney(8)|large_intestine(24)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	79	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			GTCCTTGGCAGAGTCTATCAG	0.443																																																	0													119.0	118.0	118.0					5																	37201793		2203	4300	6503	SO:0001583	missense	0				CCDS34146.1, CCDS34146.2	5p13.2	2014-01-28			ENSG00000197603	ENSG00000197603			25801	protein-coding gene	gene with protein product		614571				22264561	Standard	NM_023073		Approved	FLJ13231, JBTS17	uc011cpa.1	Q9H799	OTTHUMG00000160492	ENST00000508244.1:c.3407C>G	5.37:g.37201793G>C	ENSP00000421690:p.Ser1136Cys		A8MUB7|B7ZLV7|Q4G174|Q6DK46|Q8N8L4|Q9H5T1|Q9H8T9	Missense_Mutation	SNP	superfamily_Quino_amine_DH_bsu	p.S1136C	ENST00000508244.1	37	c.3407	CCDS34146.2	5	.	.	.	.	.	.	.	.	.	.	G	27.0	4.791541	0.90367	.	.	ENSG00000197603	ENST00000508244;ENST00000425232;ENST00000274258;ENST00000514429;ENST00000388739	T;T;T;T	0.26067	1.78;1.78;1.76;1.77	5.48	5.48	0.80851	.	0.000000	0.43416	D	0.000568	T	0.35537	0.0935	N	0.19112	0.55	0.38454	D	0.947033	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.991	T	0.31998	-0.9923	10	0.87932	D	0	.	13.6182	0.62121	0.0743:0.0:0.9257:0.0	.	1136;17	E9PH94;Q9H799	.;CE042_HUMAN	C	1136;1136;17;184;17	ENSP00000421690:S1136C;ENSP00000389014:S1136C;ENSP00000274258:S17C;ENSP00000424223:S184C	ENSP00000274258:S17C	S	-	2	0	C5orf42	37237550	1.000000	0.71417	0.989000	0.46669	0.984000	0.73092	4.923000	0.63412	2.583000	0.87209	0.313000	0.20887	TCT	C5orf42	-	NULL	ENSG00000197603		0.443	C5orf42-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	C5orf42	HGNC	protein_coding	OTTHUMT00000360806.1	-	0.00	47	0	G	NM_023073		37201793	-1	tier1	-	no_errors	ENST00000425232	ensembl	human	known	74_37	missense	21.88	50	14	SNP	0.996	C
CACNA1C	775	genome.wustl.edu	37	12	2783715	2783715	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr12:2783715G>C	ENST00000347598.4	+	41	4879	c.4879G>C	c.(4879-4881)Gaa>Caa	p.E1627Q	CACNA1C_ENST00000399606.1_Missense_Mutation_p.E1599Q|CACNA1C_ENST00000399629.1_Missense_Mutation_p.E1596Q|CACNA1C-AS1_ENST00000501371.1_RNA|CACNA1C_ENST00000399617.1_Missense_Mutation_p.E1579Q|CACNA1C_ENST00000399655.1_Missense_Mutation_p.E1579Q|CACNA1C_ENST00000335762.5_Missense_Mutation_p.E1604Q|CACNA1C_ENST00000399601.1_Missense_Mutation_p.E1579Q|CACNA1C_ENST00000399638.1_Missense_Mutation_p.E1607Q|CACNA1C_ENST00000399595.1_Missense_Mutation_p.E1587Q|CACNA1C_ENST00000399634.1_Missense_Mutation_p.E1579Q|CACNA1C_ENST00000399597.1_Missense_Mutation_p.E1579Q|CACNA1C_ENST00000406454.3_Missense_Mutation_p.E1579Q|CACNA1C_ENST00000399649.1_Missense_Mutation_p.E1585Q|CACNA1C_ENST00000399621.1_Missense_Mutation_p.E1598Q|CACNA1C_ENST00000399641.1_Missense_Mutation_p.E1579Q|CACNA1C-AS2_ENST00000545526.1_RNA|CACNA1C_ENST00000399644.1_Missense_Mutation_p.E1579Q|CACNA1C_ENST00000402845.3_Missense_Mutation_p.E1598Q|CACNA1C_ENST00000327702.7_Missense_Mutation_p.E1579Q|CACNA1C_ENST00000399603.1_Missense_Mutation_p.E1579Q|CACNA1C_ENST00000344100.3_Missense_Mutation_p.E1620Q|CACNA1C_ENST00000399637.1_Missense_Mutation_p.E1598Q|CACNA1C_ENST00000399591.1_Missense_Mutation_p.E1587Q	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	1627					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	AGGGAACCTAGAACAAGCCAA	0.602																																																	0													23.0	29.0	27.0					12																	2783715		2183	4284	6467	SO:0001583	missense	0			AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.4879G>C	12.37:g.2783715G>C	ENSP00000266376:p.Glu1627Gln		B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCC_L_a1csu,prints_VDCCAlpha1,prints_VDCC_L_a1su	p.E1579Q	ENST00000347598.4	37	c.4735	CCDS44788.1	12	.	.	.	.	.	.	.	.	.	.	G	15.86	2.958699	0.53400	.	.	ENSG00000151067	ENST00000335762;ENST00000399655;ENST00000399644;ENST00000399638;ENST00000399597;ENST00000399621;ENST00000399637;ENST00000399591;ENST00000399641;ENST00000347598;ENST00000399606;ENST00000399601;ENST00000344100;ENST00000399629;ENST00000327702;ENST00000399649;ENST00000402845;ENST00000399603;ENST00000399634;ENST00000399617;ENST00000406454;ENST00000399595;ENST00000322367	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.96587	-4.01;-4.01;-4.0;-3.99;-4.0;-4.01;-3.92;-3.95;-4.01;-3.92;-3.94;-4.01;-4.03;-3.93;-3.86;-4.06;-4.01;-4.0;-4.02;-3.95;-4.01;-4.05	4.39	4.39	0.52855	.	0.000000	0.85682	D	0.000000	D	0.96658	0.8909	L	0.32530	0.975	0.80722	D	1	P;B;B;D;B;B;B;B;D;P;B;P;B;B;B;B;B;D;B;D;D;B;P;D;D	0.76494	0.822;0.035;0.034;0.992;0.02;0.042;0.034;0.023;0.976;0.631;0.042;0.825;0.068;0.023;0.008;0.001;0.001;0.991;0.02;0.997;0.999;0.042;0.912;0.998;0.997	P;B;B;P;B;B;B;B;P;P;B;P;B;B;B;B;B;P;B;D;D;B;P;D;D	0.81914	0.529;0.009;0.021;0.856;0.014;0.033;0.023;0.033;0.908;0.791;0.033;0.529;0.353;0.068;0.003;0.008;0.003;0.9;0.014;0.962;0.995;0.033;0.765;0.993;0.981	D	0.97752	1.0215	10	0.87932	D	0	.	17.144	0.86761	0.0:0.0:1.0:0.0	.	270;1620;1576;1627;1579;1598;1579;1596;1607;1579;1599;1579;1539;1627;1579;1579;1579;1587;1585;1587;1568;1598;1598;1579;1579	B7Z7Z5;Q13936-14;Q13936-35;Q13936;Q13936-33;Q13936-13;Q13936-22;Q13936-32;Q13936-31;Q13936-21;Q13936-30;Q13936-23;Q13936-28;Q13936-11;E9PDJ1;E9PDJ0;F5GY28;Q13936-25;Q13936-15;Q13936-29;Q13936-19;Q13936-24;Q13936-27;Q13936-20;Q13936-12	.;.;.;CAC1C_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	Q	1604;1579;1579;1607;1579;1598;1598;1587;1579;1627;1599;1579;1620;1596;1579;1585;1598;1579;1579;1579;1579;1587;1409	ENSP00000336982:E1604Q;ENSP00000382563:E1579Q;ENSP00000382552:E1579Q;ENSP00000382547:E1607Q;ENSP00000382506:E1579Q;ENSP00000382530:E1598Q;ENSP00000382546:E1598Q;ENSP00000382500:E1587Q;ENSP00000382549:E1579Q;ENSP00000266376:E1627Q;ENSP00000382515:E1599Q;ENSP00000382510:E1579Q;ENSP00000341092:E1620Q;ENSP00000382537:E1596Q;ENSP00000329877:E1579Q;ENSP00000382557:E1585Q;ENSP00000385724:E1598Q;ENSP00000382512:E1579Q;ENSP00000382542:E1579Q;ENSP00000382526:E1579Q;ENSP00000385896:E1579Q;ENSP00000382504:E1587Q	ENSP00000323129:E1409Q	E	+	1	0	CACNA1C	2653976	1.000000	0.71417	0.987000	0.45799	0.025000	0.11179	9.601000	0.98297	2.269000	0.75478	0.563000	0.77884	GAA	CACNA1C	-	NULL	ENSG00000151067		0.602	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1C	HGNC	protein_coding	OTTHUMT00000317035.1	-	0.00	53	0	G	NM_000719		2783715	+1	tier1	-	no_errors	ENST00000399634	ensembl	human	known	74_37	missense	14.55	47	8	SNP	1.000	C
CANX	821	genome.wustl.edu	37	5	179150701	179150701	+	Missense_Mutation	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr5:179150701G>A	ENST00000247461.4	+	12	1639	c.1439G>A	c.(1438-1440)cGc>cAc	p.R480H	CANX_ENST00000512607.2_Missense_Mutation_p.R372H|CANX_ENST00000504734.1_Missense_Mutation_p.R480H|CANX_ENST00000415618.2_Missense_Mutation_p.R515H|CANX_ENST00000452673.2_Missense_Mutation_p.R480H	NM_001746.3	NP_001737.1	P27824	CALX_HUMAN	calnexin	480				R -> L (in Ref. 10; AAA35696). {ECO:0000305}.	aging (GO:0007568)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|chaperone-mediated protein folding (GO:0061077)|clathrin-mediated endocytosis (GO:0072583)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|protein secretion (GO:0009306)|synaptic vesicle endocytosis (GO:0048488)	axon (GO:0030424)|dendrite cytoplasm (GO:0032839)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|ER-mitochondrion membrane contact site (GO:0044233)|extracellular vesicular exosome (GO:0070062)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)|ribosome (GO:0005840)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|kidney(4)|large_intestine(2)|lung(7)|prostate(2)|urinary_tract(3)	22	all_cancers(89;0.000129)|all_epithelial(37;5.59e-05)|Renal(175;0.000159)|Lung NSC(126;0.00121)|all_lung(126;0.00218)	all_cancers(40;0.0413)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Antihemophilic Factor(DB00025)|Tenecteplase(DB00031)	GCTGAAGAGCGCCCGTGGCTG	0.483																																																	0													143.0	142.0	142.0					5																	179150701		2203	4300	6503	SO:0001583	missense	0			L18887	CCDS4447.1	5q35	2008-07-18			ENSG00000127022	ENSG00000127022			1473	protein-coding gene	gene with protein product	"""major histocompatibility complex class I antigen-binding protein p88"""	114217				1326756, 8136357	Standard	NM_001746		Approved	CNX, IP90, P90	uc003mkl.3	P27824	OTTHUMG00000130910	ENST00000247461.4:c.1439G>A	5.37:g.179150701G>A	ENSP00000247461:p.Arg480His		B2R5V8|B4DGP8|B4E2T8|D3DWQ3|D6R9K3	Missense_Mutation	SNP	pfam_Calret/calnex,superfamily_ConA-like_lec_gl_sf,superfamily_Calreticulin/calnexin_P_dom,prints_Calret/calnex	p.R515H	ENST00000247461.4	37	c.1544	CCDS4447.1	5	.	.	.	.	.	.	.	.	.	.	G	12.92	2.081983	0.36758	.	.	ENSG00000127022	ENST00000504734;ENST00000415618;ENST00000452673;ENST00000247461;ENST00000512607	T;T;T;T;T	0.55052	0.56;0.54;0.56;0.56;0.6	5.91	5.03	0.67393	.	0.107588	0.64402	D	0.000007	T	0.49167	0.1541	L	0.58810	1.83	0.58432	D	0.999999	B;B	0.22003	0.063;0.063	B;B	0.15870	0.014;0.008	T	0.43196	-0.9406	10	0.20046	T	0.44	-9.2279	16.218	0.82241	0.0:0.0:0.8659:0.1341	.	515;480	B4DGP8;P27824	.;CALX_HUMAN	H	480;515;480;480;372	ENSP00000424063:R480H;ENSP00000394817:R515H;ENSP00000391646:R480H;ENSP00000247461:R480H;ENSP00000423588:R372H	ENSP00000247461:R480H	R	+	2	0	CANX	179083307	1.000000	0.71417	1.000000	0.80357	0.431000	0.31685	7.894000	0.87336	1.500000	0.48636	-0.320000	0.08662	CGC	CANX	-	NULL	ENSG00000127022		0.483	CANX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CANX	HGNC	protein_coding	OTTHUMT00000253500.2	-	0.00	50	0	G	NM_001024649		179150701	+1	tier1	-	no_errors	ENST00000415618	ensembl	human	known	74_37	missense	8.45	65	6	SNP	1.000	A
CAPN15	6650	genome.wustl.edu	37	16	603464	603465	+	Frame_Shift_Ins	INS	-	-	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr16:603464_603465insC	ENST00000219611.2	+	14	3572_3573	c.3209_3210insC	c.(3208-3213)agccccfs	p.SP1070fs	LA16c-366D1.3_ENST00000565879.1_RNA	NM_005632.2	NP_005623.1	O75808	CAN15_HUMAN	calpain 15	1070					proteolysis (GO:0006508)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|cysteine-type peptidase activity (GO:0008234)|peptidase activity (GO:0008233)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										GGGACCCACAGCCCCCCACTCA	0.688																																																	0																																										SO:0001589	frameshift_variant	0			U85647	CCDS10410.1	16p13.3	2013-06-27	2013-06-27	2013-06-27	ENSG00000103326	ENSG00000103326			11182	protein-coding gene	gene with protein product		603267	"""small optic lobes (Drosophila) homolog"", ""small optic lobes homolog (Drosophila)"""	SOLH		9722942	Standard	NM_005632		Approved		uc002chi.3	O75808	OTTHUMG00000119059	ENST00000219611.2:c.3215dupC	16.37:g.603470_603470dupC	ENSP00000219611:p.Ser1070fs		B1B1M4|Q2KHS2|Q8WTY9|Q9BUW0	Frame_Shift_Ins	INS	pfam_Peptidase_C2_calpain_cat,pfam_Znf_RanBP2,smart_Znf_RanBP2,smart_Peptidase_C2_calpain_cat,pfscan_Znf_RanBP2,pfscan_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease	p.L1073fs	ENST00000219611.2	37	c.3209_3210	CCDS10410.1	16																																																																																			CAPN15	-	NULL	ENSG00000103326		0.688	CAPN15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAPN15	HGNC	protein_coding	OTTHUMT00000239271.1		0.00	20	0	-	NM_005632		603465	+1	tier1		no_errors	ENST00000219611	ensembl	human	known	74_37	frame_shift_ins	7.14	26	2	INS	0.998:0.991	C
CAPZA1	829	genome.wustl.edu	37	1	113192078	113192078	+	Missense_Mutation	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:113192078G>A	ENST00000263168.3	+	3	814	c.142G>A	c.(142-144)Gaa>Aaa	p.E48K	CAPZA1_ENST00000476936.1_3'UTR	NM_006135.2	NP_006126.1	P52907	CAZA1_HUMAN	capping protein (actin filament) muscle Z-line, alpha 1	48					actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|blood coagulation (GO:0007596)|cellular component movement (GO:0006928)|innate immune response (GO:0045087)|protein complex assembly (GO:0006461)	actin cytoskeleton (GO:0015629)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|F-actin capping protein complex (GO:0008290)|WASH complex (GO:0071203)	actin binding (GO:0003779)			breast(1)|kidney(2)|large_intestine(2)|lung(3)|prostate(1)	9	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TCTCCTCAGGGAAGGGGCAGC	0.368																																																	0													109.0	104.0	106.0					1																	113192078		2203	4300	6503	SO:0001583	missense	0			U56637	CCDS30805.1	1p13.2	2014-05-09			ENSG00000116489	ENSG00000116489			1488	protein-coding gene	gene with protein product		601580				7665558, 9119363	Standard	NM_006135		Approved		uc001ecj.1	P52907	OTTHUMG00000011769	ENST00000263168.3:c.142G>A	1.37:g.113192078G>A	ENSP00000263168:p.Glu48Lys		Q53FQ6|Q6FHD5	Missense_Mutation	SNP	pfam_CapZ_alpha,prints_CapZ_alpha	p.E48K	ENST00000263168.3	37	c.142	CCDS30805.1	1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.601609	0.87055	.	.	ENSG00000116489	ENST00000263168	.	.	.	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	T	0.67458	0.2895	M	0.63428	1.95	0.58432	D	0.999997	P	0.39624	0.681	P	0.52957	0.714	T	0.66114	-0.6004	9	0.41790	T	0.15	-23.8126	18.7748	0.91907	0.0:0.0:1.0:0.0	.	48	P52907	CAZA1_HUMAN	K	48	.	ENSP00000263168:E48K	E	+	1	0	CAPZA1	112993601	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.975000	0.88055	2.524000	0.85096	0.591000	0.81541	GAA	CAPZA1	-	pfam_CapZ_alpha	ENSG00000116489		0.368	CAPZA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAPZA1	HGNC	protein_coding	OTTHUMT00000032567.2	-	0.00	44	0	G	NM_006135		113192078	+1	tier1	-	no_errors	ENST00000263168	ensembl	human	known	74_37	missense	6.35	59	4	SNP	1.000	A
CARD6	84674	genome.wustl.edu	37	5	40852462	40852462	+	Nonsense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr5:40852462C>G	ENST00000254691.5	+	3	1227	c.1028C>G	c.(1027-1029)tCa>tGa	p.S343*	CARD6_ENST00000381677.3_Intron	NM_032587.3	NP_115976.2	Q9BX69	CARD6_HUMAN	caspase recruitment domain family, member 6	343					apoptotic process (GO:0006915)|regulation of apoptotic process (GO:0042981)					NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(2)|lung(29)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	62						GCTAGGGATTCAATCCTCAGT	0.463																																																	0													60.0	59.0	59.0					5																	40852462		2203	4300	6503	SO:0001587	stop_gained	0			AF356193	CCDS3935.1	5p13.1	2008-05-23			ENSG00000132357	ENSG00000132357			16394	protein-coding gene	gene with protein product		609986				12775719	Standard	NM_032587		Approved	CINCIN1	uc003jmg.3	Q9BX69	OTTHUMG00000094775	ENST00000254691.5:c.1028C>G	5.37:g.40852462C>G	ENSP00000254691:p.Ser343*		Q52LR2	Nonsense_Mutation	SNP	pfam_CARD,superfamily_DEATH-like_dom,smart_CARD,pfscan_CARD	p.S343*	ENST00000254691.5	37	c.1028	CCDS3935.1	5	.	.	.	.	.	.	.	.	.	.	C	17.13	3.310255	0.60414	.	.	ENSG00000132357	ENST00000254691;ENST00000509771	.	.	.	5.4	3.6	0.41247	.	1.299340	0.05179	N	0.500926	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	0.06891	T	0.86	0.0214	10.2506	0.43367	0.0:0.837:0.0:0.163	.	.	.	.	X	343	.	ENSP00000254691:S343X	S	+	2	0	CARD6	40888219	0.000000	0.05858	0.001000	0.08648	0.036000	0.12997	0.442000	0.21628	0.825000	0.34637	0.655000	0.94253	TCA	CARD6	-	NULL	ENSG00000132357		0.463	CARD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CARD6	HGNC	protein_coding	OTTHUMT00000211584.3		0.00	48	0	C			40852462	+1			no_errors	ENST00000254691	ensembl	human	known	74_37	nonsense	6.38	44	3	SNP	0.003	G
CASR	846	genome.wustl.edu	37	3	122003196	122003196	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr3:122003196G>C	ENST00000490131.1	+	7	2767	c.2395G>C	c.(2395-2397)Gag>Cag	p.E799Q	AC068754.1_ENST00000408547.1_RNA|CASR_ENST00000296154.5_Missense_Mutation_p.E799Q|CASR_ENST00000498619.1_Missense_Mutation_p.E809Q	NM_000388.3	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor	799					anatomical structure morphogenesis (GO:0009653)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|chemosensory behavior (GO:0007635)|detection of calcium ion (GO:0005513)|G-protein coupled receptor signaling pathway (GO:0007186)|metabolic process (GO:0008152)|ossification (GO:0001503)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|phosphatidylinositol phospholipase C activity (GO:0004435)			NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(45)|ovary(4)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	84				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	GAAGCTGCCGGAGAACTTCAA	0.547																																																	0			GRCh37	CM013357	CASR	M							58.0	55.0	56.0					3																	122003196		2203	4300	6503	SO:0001583	missense	0			U20760	CCDS3010.1, CCDS54632.1	3q21.1	2012-08-29	2008-08-01		ENSG00000036828	ENSG00000036828		"""GPCR / Class C : Calcium-sensing receptors"""	1514	protein-coding gene	gene with protein product	"""severe neonatal hyperparathyroidism"""	601199	"""hypocalciuric hypercalcemia 1"""	HHC, HHC1		7677761	Standard	NM_000388		Approved	FHH, NSHPT, GPRC2A	uc003eew.4	P41180	OTTHUMG00000159491	ENST00000490131.1:c.2395G>C	3.37:g.122003196G>C	ENSP00000418685:p.Glu799Gln		Q13912|Q16108|Q16109|Q16110|Q16379|Q2M1T0|Q4PJ19	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,superfamily_Peripla_BP_I,superfamily_Growth_fac_rcpt_N_dom,pfscan_GPCR_3_C,prints_GPCR_3	p.E809Q	ENST00000490131.1	37	c.2425	CCDS3010.1	3	.	.	.	.	.	.	.	.	.	.	G	22.1	4.250061	0.80024	.	.	ENSG00000036828	ENST00000490131;ENST00000498619;ENST00000296154	D;D;D	0.88975	-2.45;-2.45;-2.45	6.04	6.04	0.98038	GPCR, family 3, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.94178	0.8132	M	0.66439	2.03	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.87578	0.997;0.998	D	0.93962	0.7241	10	0.87932	D	0	.	19.5674	0.95401	0.0:0.0:1.0:0.0	.	809;799	E7ENE0;P41180	.;CASR_HUMAN	Q	799;809;799	ENSP00000418685:E799Q;ENSP00000420194:E809Q;ENSP00000296154:E799Q	ENSP00000296154:E799Q	E	+	1	0	CASR	123485886	1.000000	0.71417	0.974000	0.42286	0.933000	0.57130	8.018000	0.88722	2.873000	0.98535	0.561000	0.74099	GAG	CASR	-	pfam_GPCR_3_C,pfscan_GPCR_3_C,prints_GPCR_3	ENSG00000036828		0.547	CASR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASR	HGNC	protein_coding	OTTHUMT00000355761.1	-	0.00	18	0	G	NM_000388		122003196	+1	tier1	-	no_errors	ENST00000498619	ensembl	human	known	74_37	missense	32.50	27	13	SNP	1.000	C
CCBL2	56267	genome.wustl.edu	37	1	89426940	89426940	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:89426940C>G	ENST00000260508.4	-	8	1034	c.697G>C	c.(697-699)Gct>Cct	p.A233P	CCBL2_ENST00000370491.3_Missense_Mutation_p.A199P|CCBL2_ENST00000370485.2_3'UTR|CCBL2_ENST00000446900.2_5'UTR	NM_001008661.2	NP_001008661.1	Q6YP21	KAT3_HUMAN	cysteine conjugate-beta lyase 2	233					2-oxoglutarate metabolic process (GO:0006103)|biosynthetic process (GO:0009058)|cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|kynurenine metabolic process (GO:0070189)|L-kynurenine metabolic process (GO:0097052)|small molecule metabolic process (GO:0044281)|tryptophan catabolic process (GO:0006569)	mitochondrion (GO:0005739)	cysteine-S-conjugate beta-lyase activity (GO:0047804)|kynurenine-glyoxylate transaminase activity (GO:0047315)|kynurenine-oxoglutarate transaminase activity (GO:0016212)|poly(A) RNA binding (GO:0044822)|pyridoxal phosphate binding (GO:0030170)			endometrium(3)|kidney(4)|large_intestine(2)|lung(4)|ovary(2)|skin(2)|soft_tissue(1)	18		Lung NSC(277;0.123)		all cancers(265;0.0117)|Epithelial(280;0.0341)		CAAAGGTCAGCAATTACTTGC	0.368																																																	0													176.0	168.0	170.0					1																	89426940		2203	4300	6503	SO:0001583	missense	0			AF091090	CCDS30766.1, CCDS30767.1	1p22.2	2009-06-23			ENSG00000137944	ENSG00000137944			33238	protein-coding gene	gene with protein product		610656				16376499	Standard	NM_001008662		Approved	RBM1, RP11-82K18.3, KAT3	uc001dmp.2	Q6YP21	OTTHUMG00000010617	ENST00000260508.4:c.697G>C	1.37:g.89426940C>G	ENSP00000260508:p.Ala233Pro		B3KQ13|O95335|Q5JS27|Q5T9T7|Q5T9T8|Q6AI27|Q6ICW1|Q9BVY5	Missense_Mutation	SNP	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase	p.A233P	ENST00000260508.4	37	c.697	CCDS30766.1	1	.	.	.	.	.	.	.	.	.	.	c	25.9	4.688859	0.88639	.	.	ENSG00000137944	ENST00000370491;ENST00000260508;ENST00000370486	D;D;D	0.91945	-2.94;-2.94;-2.94	5.93	5.02	0.67125	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.044558	0.85682	D	0.000000	D	0.97736	0.9257	H	0.98802	4.335	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99723	1.1010	10	0.87932	D	0	-11.4015	16.7293	0.85431	0.1306:0.8694:0.0:0.0	.	233	Q6YP21	KAT3_HUMAN	P	199;233;233	ENSP00000359522:A199P;ENSP00000260508:A233P;ENSP00000359517:A233P	ENSP00000260508:A233P	A	-	1	0	CCBL2	89199528	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	5.667000	0.68067	1.533000	0.49186	-0.121000	0.15023	GCT	CCBL2	-	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase	ENSG00000137944		0.368	CCBL2-004	KNOWN	basic|CCDS	protein_coding	CCBL2	HGNC	protein_coding	OTTHUMT00000029300.3	-	0.00	42	0	C	NM_001008661		89426940	-1	tier1	-	no_errors	ENST00000260508	ensembl	human	known	74_37	missense	13.21	46	7	SNP	1.000	G
CCDC108	255101	genome.wustl.edu	37	2	219870902	219870902	+	Missense_Mutation	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr2:219870902G>A	ENST00000341552.5	-	31	4846	c.4763C>T	c.(4762-4764)gCc>gTc	p.A1588V	AC097468.4_ENST00000441450.1_RNA|CCDC108_ENST00000453220.1_Missense_Mutation_p.A1588V|CCDC108_ENST00000441968.1_Missense_Mutation_p.A1588V	NM_194302.2	NP_919278.2	Q6ZU64	CC108_HUMAN	coiled-coil domain containing 108	1588						integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(1)|lung(34)|ovary(2)|pancreas(1)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Renal(207;0.0915)		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TTTCCAGCTGGCAGGCCGGCT	0.617																																																	0													59.0	67.0	64.0					2																	219870902		2203	4300	6503	SO:0001583	missense	0			NM_194302, AL833882, AK127189	CCDS2430.2, CCDS2431.2, CCDS63125.1, CCDS63126.1	2q35	2008-02-05			ENSG00000181378	ENSG00000181378			25325	protein-coding gene	gene with protein product		614270				12477932	Standard	NM_194302		Approved	DKFZp434O0527, MGC35338	uc002vjl.2	Q6ZU64	OTTHUMG00000133013	ENST00000341552.5:c.4763C>T	2.37:g.219870902G>A	ENSP00000340776:p.Ala1588Val		A2BDD8|E9PCR1|E9PG25|E9PG72|Q6ZSR8|Q8N0T4|Q8NDJ3	Missense_Mutation	SNP	superfamily_PapD-like,pfscan_MSP_dom	p.A1588V	ENST00000341552.5	37	c.4763	CCDS2430.2	2	.	.	.	.	.	.	.	.	.	.	G	8.270	0.813178	0.16537	.	.	ENSG00000181378	ENST00000341552;ENST00000441968;ENST00000453220	T;T;T	0.05717	3.4;3.4;3.4	5.56	3.43	0.39272	.	0.496676	0.16965	N	0.192346	T	0.06325	0.0163	L	0.43152	1.355	0.58432	D	0.999998	B	0.17667	0.023	B	0.16289	0.015	T	0.22138	-1.0225	10	0.34782	T	0.22	-10.5128	7.9139	0.29806	0.2574:0.0:0.7426:0.0	.	1588	Q6ZU64	CC108_HUMAN	V	1588	ENSP00000340776:A1588V;ENSP00000413377:A1588V;ENSP00000409117:A1588V	ENSP00000340776:A1588V	A	-	2	0	CCDC108	219579146	0.938000	0.31826	0.859000	0.33776	0.124000	0.20399	1.490000	0.35573	1.350000	0.45770	-0.150000	0.13652	GCC	CCDC108	-	NULL	ENSG00000181378		0.617	CCDC108-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC108	HGNC	protein_coding	OTTHUMT00000256598.4	-	0.00	44	0	G	NM_194302		219870902	-1	tier1	-	no_errors	ENST00000341552	ensembl	human	known	74_37	missense	40.00	21	14	SNP	0.814	A
CCDC13	152206	genome.wustl.edu	37	3	42799748	42799748	+	Missense_Mutation	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr3:42799748C>T	ENST00000310232.6	-	2	173	c.90G>A	c.(88-90)atG>atA	p.M30I	CCDC13_ENST00000435327.2_5'UTR	NM_144719.3	NP_653320.3	Q8IYE1	CCD13_HUMAN	coiled-coil domain containing 13	30										endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(11)|ovary(1)|prostate(3)|skin(1)|urinary_tract(1)	25						TCTTTTTCTCCATCTGCTTCT	0.532																																																	0													248.0	196.0	214.0					3																	42799748		2203	4300	6503	SO:0001583	missense	0			AK058196	CCDS2705.1	3p22.1	2005-01-25			ENSG00000244607	ENSG00000244607			26358	protein-coding gene	gene with protein product						12477932	Standard	NM_144719		Approved	FLJ25467	uc003cly.4	Q8IYE1	OTTHUMG00000133046	ENST00000310232.6:c.90G>A	3.37:g.42799748C>T	ENSP00000309836:p.Met30Ile			Missense_Mutation	SNP	superfamily_Prefoldin	p.M30I	ENST00000310232.6	37	c.90	CCDS2705.1	3	.	.	.	.	.	.	.	.	.	.	C	12.89	2.074635	0.36566	.	.	ENSG00000244607	ENST00000310232	T	0.25085	1.82	4.61	3.74	0.42951	.	0.206644	0.49916	D	0.000135	T	0.25494	0.0620	M	0.72479	2.2	0.80722	D	1	B;B;B	0.33807	0.426;0.206;0.206	B;B;B	0.28305	0.088;0.052;0.085	T	0.05178	-1.0901	10	0.40728	T	0.16	.	10.2703	0.43479	0.0:0.9034:0.0:0.0966	.	30;30;30	B4DZD2;Q96LI1;Q8IYE1	.;.;CCD13_HUMAN	I	30	ENSP00000309836:M30I	ENSP00000309836:M30I	M	-	3	0	CCDC13	42774752	1.000000	0.71417	1.000000	0.80357	0.314000	0.28054	3.350000	0.52224	1.152000	0.42452	0.563000	0.77884	ATG	CCDC13	-	NULL	ENSG00000244607		0.532	CCDC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC13	HGNC	protein_coding	OTTHUMT00000256652.1	-	0.00	55	0	C	NM_144719		42799748	-1	tier1	-	no_errors	ENST00000310232	ensembl	human	known	74_37	missense	34.55	36	19	SNP	1.000	T
CCDC40	55036	genome.wustl.edu	37	17	78013862	78013862	+	Silent	SNP	G	G	A	rs561961621		TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr17:78013862G>A	ENST00000397545.4	+	3	372	c.345G>A	c.(343-345)ccG>ccA	p.P115P	CCDC40_ENST00000374877.3_Silent_p.P115P|CCDC40_ENST00000269318.5_Silent_p.P115P|CCDC40_ENST00000374876.4_Silent_p.P115P	NM_017950.3	NP_060420.2	Q4G0X9	CCD40_HUMAN	coiled-coil domain containing 40	115					axonemal dynein complex assembly (GO:0070286)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement (GO:0003351)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)|regulation of cilium beat frequency (GO:0003356)	cilium (GO:0005929)|cytoplasm (GO:0005737)				NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(7)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	38	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.149)			CGACTTACCCGTATTTCAGTC	0.527																																																	0													77.0	80.0	80.0					17																	78013862		1930	4136	6066	SO:0001819	synonymous_variant	0			AB046860	CCDS42395.1, CCDS58604.1	17q25.3	2013-11-15			ENSG00000141519	ENSG00000141519			26090	protein-coding gene	gene with protein product		613799				21131974	Standard	NM_017950		Approved	FLJ20753, KIAA1640, FLJ32021, CILD15, FAP172	uc010dht.3	Q4G0X9	OTTHUMG00000132707	ENST00000397545.4:c.345G>A	17.37:g.78013862G>A			A8MTD2|C9JTI9|C9JTJ0|C9JXW1|Q6PE47|Q9HCD2|Q9NWL5	Silent	SNP	pfam_E3_ubiquit_lig_BRE1	p.P115	ENST00000397545.4	37	c.345	CCDS42395.1	17																																																																																			CCDC40	-	NULL	ENSG00000141519		0.527	CCDC40-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC40	HGNC	protein_coding	OTTHUMT00000256005.2	-	0.00	30	0	G	XM_371082		78013862	+1	tier1	-	no_errors	ENST00000397545	ensembl	human	known	74_37	silent	14.29	30	5	SNP	0.000	A
CCDC59	29080	genome.wustl.edu	37	12	82752046	82752046	+	Missense_Mutation	SNP	C	C	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr12:82752046C>A	ENST00000256151.7	-	1	521	c.110G>T	c.(109-111)tGg>tTg	p.W37L	METTL25_ENST00000248306.3_5'Flank|CCDC59_ENST00000548126.1_Intron	NM_014167.4	NP_054886.2	Q9P031	TAP26_HUMAN	coiled-coil domain containing 59	37					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)	5						GTTAGGCCGCCATGTCTTCTG	0.547											OREG0022008	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													70.0	65.0	67.0					12																	82752046		2203	4300	6503	SO:0001583	missense	0			AF213377	CCDS9023.1	12q21.31	2007-10-17				ENSG00000133773			25005	protein-coding gene	gene with protein product						16630564, 12882447	Standard	NM_014167		Approved	HSPC128, TAP26, BR22	uc001szp.4	Q9P031		ENST00000256151.7:c.110G>T	12.37:g.82752046C>A	ENSP00000256151:p.Trp37Leu	1216	Q9H2V5|Q9NW62	Missense_Mutation	SNP	pfam_rRNA_processing,prints_rRNA_processing	p.W37L	ENST00000256151.7	37	c.110	CCDS9023.1	12	.	.	.	.	.	.	.	.	.	.	C	23.5	4.420537	0.83559	.	.	ENSG00000133773	ENST00000552377;ENST00000256151	.	.	.	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	T	0.73521	0.3597	L	0.46819	1.47	0.54753	D	0.999981	D	0.89917	1.0	D	0.80764	0.994	T	0.75631	-0.3251	9	0.66056	D	0.02	-4.0827	15.5877	0.76499	0.0:1.0:0.0:0.0	.	37	Q9P031	TAP26_HUMAN	L	37	.	ENSP00000256151:W37L	W	-	2	0	CCDC59	81276177	0.997000	0.39634	0.502000	0.27614	0.016000	0.09150	4.152000	0.58111	2.420000	0.82092	0.585000	0.79938	TGG	CCDC59	-	prints_rRNA_processing	ENSG00000133773		0.547	CCDC59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC59	HGNC	protein_coding	OTTHUMT00000408186.1	-	0.00	39	0	C	NM_014167		82752046	-1	tier1	-	no_errors	ENST00000256151	ensembl	human	known	74_37	missense	22.97	57	17	SNP	0.984	A
CCDC66	285331	genome.wustl.edu	37	3	56594942	56594942	+	Intron	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr3:56594942C>T	ENST00000394672.3	+	3	172				CCDC66_ENST00000436465.2_Intron|CCDC66_ENST00000538560.1_Intron|CCDC66_ENST00000326595.7_Intron|CCDC66_ENST00000442522.2_Intron	NM_001012506.4|NM_001141947.1	NP_001012524.4|NP_001135419.1	A2RUB6	CCD66_HUMAN	coiled-coil domain containing 66						post-embryonic retina morphogenesis in camera-type eye (GO:0060060)|retinal rod cell development (GO:0046548)					breast(1)|kidney(1)|large_intestine(2)|liver(1)|lung(4)|skin(2)|urinary_tract(1)	12				KIRC - Kidney renal clear cell carcinoma(284;0.0478)|Kidney(284;0.0597)|OV - Ovarian serous cystadenocarcinoma(275;0.233)		GATGATGTACCACTTTATCCT	0.393																																																	0																																										SO:0001627	intron_variant	0			AL832692	CCDS33770.2, CCDS46852.1	3p14.3	2006-03-27			ENSG00000180376	ENSG00000180376			27709	protein-coding gene	gene with protein product						14702039	Standard	NR_024460		Approved	DKFZp686C0433	uc003dhz.3	A2RUB6	OTTHUMG00000155748	ENST00000394672.3:c.102+1320C>T	3.37:g.56594942C>T			B3KWL8|Q4VC34|Q8N949	Missense_Mutation	SNP	NULL	p.P52L	ENST00000394672.3	37	c.155	CCDS46852.1	3																																																																																			CCDC66	-	NULL	ENSG00000180376		0.393	CCDC66-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC66	HGNC	protein_coding	OTTHUMT00000341473.1	-	0.00	69	0	C	NM_001012506		56594942	+1	tier1	-	no_errors	ENST00000434467	ensembl	human	known	74_37	missense	27.12	43	16	SNP	0.000	T
CDC20	991	genome.wustl.edu	37	1	43826244	43826244	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:43826244G>C	ENST00000372462.1	+	6	1031	c.828G>C	c.(826-828)tgG>tgC	p.W276C	CDC20_ENST00000478882.1_3'UTR|RP1-92O14.3_ENST00000424948.1_RNA|CDC20_ENST00000310955.6_Missense_Mutation_p.W276C			Q12834	CDC20_HUMAN	cell division cycle 20	276					activation of anaphase-promoting complex activity (GO:0051488)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell cycle (GO:0007049)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of cell proliferation (GO:0008284)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic plasticity (GO:0031915)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein ubiquitination (GO:0016567)|regulation of dendrite development (GO:0050773)|regulation of meiosis (GO:0040020)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)|spindle (GO:0005819)	enzyme binding (GO:0019899)|protein C-terminus binding (GO:0008022)			endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)	15	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				CCCTAAGCTGGAACAGCTATA	0.517																																					Esophageal Squamous(137;1154 1759 10362 10401 46925)												0													169.0	156.0	161.0					1																	43826244		2203	4300	6503	SO:0001583	missense	0			U05340	CCDS484.1	1p34.1	2013-01-17	2013-01-17		ENSG00000117399	ENSG00000117399		"""WD repeat domain containing"""	1723	protein-coding gene	gene with protein product		603618	"""CDC20 (cell division cycle 20, S. cerevisiae, homolog)"", ""CDC20 cell division cycle 20 homolog (S. cerevisiae)"", ""cell division cycle 20 homolog (S. cerevisiae)"""			7513050, 9353311	Standard	NM_001255		Approved	p55CDC, CDC20A	uc001cix.3	Q12834	OTTHUMG00000007420	ENST00000372462.1:c.828G>C	1.37:g.43826244G>C	ENSP00000361540:p.Trp276Cys		B2R6Z6|D3DPJ1|Q5JUY4|Q9BW56|Q9UQI9	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.W276C	ENST00000372462.1	37	c.828	CCDS484.1	1	.	.	.	.	.	.	.	.	.	.	G	19.58	3.855011	0.71719	.	.	ENSG00000117399	ENST00000437896;ENST00000310955;ENST00000372462	T;T	0.34859	1.34;1.34	6.07	5.13	0.70059	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.72510	0.3469	H	0.96398	3.815	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.81269	-0.1009	10	0.87932	D	0	-10.6389	16.8452	0.85978	0.0:0.0:0.8711:0.1289	.	276	Q12834	CDC20_HUMAN	C	252;276;276	ENSP00000308450:W276C;ENSP00000361540:W276C	ENSP00000308450:W276C	W	+	3	0	CDC20	43598831	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.001000	0.88508	2.884000	0.98904	0.655000	0.94253	TGG	CDC20	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000117399		0.517	CDC20-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CDC20	HGNC	protein_coding	OTTHUMT00000019488.1	-	0.00	22	0	G	NM_001255		43826244	+1	tier1	-	no_errors	ENST00000310955	ensembl	human	known	74_37	missense	21.74	18	5	SNP	1.000	C
CD53	963	genome.wustl.edu	37	1	111440417	111440417	+	Intron	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:111440417G>C	ENST00000271324.5	+	7	616				CD53_ENST00000497404.1_Intron|CD53_ENST00000429072.2_Intron	NM_000560.3|NM_001040033.1	NP_000551.1|NP_001035122.1	P19397	CD53_HUMAN	CD53 molecule						positive regulation of myoblast fusion (GO:1901741)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(6)	17		all_cancers(81;1.06e-05)|all_epithelial(167;1.95e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)		Lung(183;0.0264)|Colorectal(144;0.0375)|all cancers(265;0.11)|Epithelial(280;0.114)|COAD - Colon adenocarcinoma(174;0.141)|LUSC - Lung squamous cell carcinoma(189;0.144)		ATTTGTAACTGAAATGTCTTC	0.363																																																	0													168.0	158.0	161.0					1																	111440417		2203	4300	6503	SO:0001627	intron_variant	0			BC040693	CCDS829.1	1p13	2013-02-14	2006-03-28		ENSG00000143119	ENSG00000143119		"""CD molecules"", ""Tetraspanins"""	1686	protein-coding gene	gene with protein product		151525	"""CD53 antigen"""	MOX44		8319976	Standard	XM_006711053		Approved	TSPAN25	uc001dzw.3	P19397	OTTHUMG00000048020	ENST00000271324.5:c.505-14G>C	1.37:g.111440417G>C			B2R905|Q5U0D6	RNA	SNP	-	NULL	ENST00000271324.5	37	NULL	CCDS829.1	1																																																																																			CD53	-	-	ENSG00000143119		0.363	CD53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD53	HGNC	protein_coding	OTTHUMT00000032931.1	-	0.00	35	0	G	NM_000560		111440417	+1	tier1	-	no_errors	ENST00000464329	ensembl	human	known	74_37	rna	10.53	51	6	SNP	0.026	C
CCSAP	126731	genome.wustl.edu	37	1	229459933	229459933	+	3'UTR	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:229459933G>A	ENST00000366687.1	-	0	1913				CCSAP_ENST00000483092.1_5'UTR|CCSAP_ENST00000284617.2_3'UTR|RP4-803J11.2_ENST00000418348.1_RNA|CCSAP_ENST00000366686.1_3'UTR			Q6IQ19	CCSAP_HUMAN	centriole, cilia and spindle-associated protein						multicellular organismal development (GO:0007275)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|regulation of embryonic development (GO:0045995)	axon (GO:0030424)|axoneme (GO:0005930)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|ciliary transition zone (GO:0035869)|cilium (GO:0005929)|spindle (GO:0005819)											ACATCATCAAGACTTTGTTAT	0.398																																																	0																																										SO:0001624	3_prime_UTR_variant	0			BC071609	CCDS1577.1	1q42.13	2012-06-19	2012-06-19	2012-06-19	ENSG00000154429	ENSG00000154429			29578	protein-coding gene	gene with protein product	"""centriole and spindle-associated protein"""		"""chromosome 1 open reading frame 96"""	C1orf96		22493317	Standard	NM_145257		Approved	FLJ41471, CSAP	uc001htl.4	Q6IQ19	OTTHUMG00000037663	ENST00000366687.1:c.*1049C>T	1.37:g.229459933G>A			A8K5X2|Q6P9G2|Q6ZW85|Q8IXU1|Q96BM2	RNA	SNP	-	NULL	ENST00000366687.1	37	NULL	CCDS1577.1	1																																																																																			CCSAP	-	-	ENSG00000154429		0.398	CCSAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCSAP	HGNC	protein_coding	OTTHUMT00000091839.1	-	0.00	62	0	G	NM_145257		229459933	-1	tier1	-	no_errors	ENST00000483092	ensembl	human	known	74_37	rna	23.61	55	17	SNP	0.000	A
CDC42EP4	23580	genome.wustl.edu	37	17	71282205	71282205	+	Silent	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr17:71282205C>T	ENST00000335793.3	-	2	829	c.435G>A	c.(433-435)aaG>aaA	p.K145K	CDC42EP4_ENST00000439510.2_Silent_p.K75K|CDC42EP4_ENST00000581014.1_Intron			Q9H3Q1	BORG4_HUMAN	CDC42 effector protein (Rho GTPase binding) 4	145					positive regulation of pseudopodium assembly (GO:0031274)|regulation of cell shape (GO:0008360)|Rho protein signal transduction (GO:0007266)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)	GTP-Rho binding (GO:0017049)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(3)|large_intestine(1)|lung(7)|urinary_tract(1)	14			LUSC - Lung squamous cell carcinoma(166;0.0352)|Lung(188;0.0711)			CATTGGCCTTCTTCACGGGGC	0.657																																																	0													48.0	48.0	48.0					17																	71282205		2203	4300	6503	SO:0001819	synonymous_variant	0			AB042237	CCDS11695.1	17q24-q25	2008-07-18				ENSG00000179604			17147	protein-coding gene	gene with protein product	"""Cdc42 effector protein 4"", ""binder of Rho GTPases 4"""	605468				11035016, 10490598	Standard	NM_012121		Approved	CEP4, KAIA1777, BORG4, MGC3740, MGC17125	uc002jjo.3	Q9H3Q1		ENST00000335793.3:c.435G>A	17.37:g.71282205C>T			B3KUS7|O95828|Q96FT3	Silent	SNP	pfam_CRIB_dom,smart_CRIB_dom,pfscan_CRIB_dom	p.K145	ENST00000335793.3	37	c.435	CCDS11695.1	17																																																																																			CDC42EP4	-	NULL	ENSG00000179604		0.657	CDC42EP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC42EP4	HGNC	protein_coding	OTTHUMT00000441898.1	-	0.00	19	0	C	NM_012121		71282205	-1	tier1	-	no_errors	ENST00000335793	ensembl	human	known	74_37	silent	56.10	18	23	SNP	1.000	T
CDH17	1015	genome.wustl.edu	37	8	95188895	95188895	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr8:95188895C>G	ENST00000027335.3	-	5	422	c.298G>C	c.(298-300)Gac>Cac	p.D100H	CDH17_ENST00000450165.2_Missense_Mutation_p.D100H|CDH17_ENST00000441892.2_Missense_Mutation_p.D100H	NM_004063.3	NP_004054.3	Q12864	CAD17_HUMAN	cadherin 17, LI cadherin (liver-intestine)	100	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|oligopeptide transmembrane transport (GO:0035672)|oligopeptide transport (GO:0006857)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|proton-dependent oligopeptide secondary active transmembrane transporter activity (GO:0005427)|transporter activity (GO:0005215)			NS(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(18)|ovary(6)|prostate(3)|skin(4)|stomach(2)	52	Breast(36;4.65e-06)		BRCA - Breast invasive adenocarcinoma(8;0.00691)			CCATTAGCGTCCAGGGCTGCA	0.443																																																	0													117.0	101.0	106.0					8																	95188895		2203	4300	6503	SO:0001583	missense	0			X83228	CCDS6260.1	8q22.1	2010-01-26			ENSG00000079112	ENSG00000079112		"""Cadherins / Major cadherins"""	1756	protein-coding gene	gene with protein product		603017				9615235, 10191097	Standard	NM_004063		Approved	HPT-1, cadherin	uc003ygh.2	Q12864	OTTHUMG00000164391	ENST00000027335.3:c.298G>C	8.37:g.95188895C>G	ENSP00000027335:p.Asp100His		Q15336|Q2M2E0	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.D100H	ENST00000027335.3	37	c.298	CCDS6260.1	8	.	.	.	.	.	.	.	.	.	.	C	12.72	2.023876	0.35701	.	.	ENSG00000079112	ENST00000027335;ENST00000441892;ENST00000450165;ENST00000521491	T;T;T;T	0.80824	-0.79;-0.79;-0.79;-1.42	5.93	4.15	0.48705	Cadherin (3);Cadherin-like (1);	0.228496	0.30830	N	0.008798	D	0.91047	0.7183	H	0.95187	3.635	0.33102	D	0.53941	D;D	0.89917	1.0;0.996	D;P	0.74674	0.984;0.819	D	0.92422	0.5946	10	0.66056	D	0.02	-18.1002	7.7078	0.28661	0.0:0.6909:0.0:0.3091	.	100;100	E7EN24;Q12864	.;CAD17_HUMAN	H	100	ENSP00000027335:D100H;ENSP00000392811:D100H;ENSP00000401468:D100H;ENSP00000428189:D100H	ENSP00000027335:D100H	D	-	1	0	CDH17	95258071	0.992000	0.36948	0.245000	0.24217	0.125000	0.20455	0.691000	0.25467	0.857000	0.35407	0.655000	0.94253	GAC	CDH17	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000079112		0.443	CDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH17	HGNC	protein_coding	OTTHUMT00000378560.1	-	0.00	78	0	C	NM_004063		95188895	-1	tier1	-	no_errors	ENST00000027335	ensembl	human	known	74_37	missense	17.89	78	17	SNP	0.995	G
CDH23	64072	genome.wustl.edu	37	10	73464809	73464809	+	Missense_Mutation	SNP	G	G	A	rs200196800		TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr10:73464809G>A	ENST00000224721.6	+	24	2895	c.2890G>A	c.(2890-2892)Gcg>Acg	p.A964T	CDH23_ENST00000299366.7_Missense_Mutation_p.A1004T	NM_022124.5	NP_071407.4	Q9H251	CAD23_HUMAN	cadherin-related 23	959	Cadherin 9. {ECO:0000255|PROSITE- ProRule:PRU00043}.		R -> Q. {ECO:0000269|PubMed:24767429}.		calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cytosolic calcium ion homeostasis (GO:0051480)|equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(6)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(27)|lung(49)|ovary(3)|pancreas(1)|prostate(7)|stomach(7)|upper_aerodigestive_tract(3)	133						CGAGCGCATCGCGGAGTACCA	0.672																																																	0								G	THR/ALA,THR/ALA,THR/ALA	1,4147		0,1,2073	37.0	41.0	40.0		2875,2875,2875	5.5	1.0	10		40	0,8364		0,0,4182	yes	missense,missense,missense	CDH23	NM_022124.5,NM_001171931.1,NM_001171930.1	58,58,58	0,1,6255	AA,AG,GG		0.0,0.0241,0.0080	benign,benign,benign	959/3355,959/1062,959/1382	73464809	1,12511	2074	4182	6256	SO:0001583	missense	0			AY010111	CCDS53540.1, CCDS73146.1	10q22.1	2014-08-08	2010-01-25		ENSG00000107736	ENSG00000107736		"""Cadherins / Cadherin-related"""	13733	protein-coding gene	gene with protein product	"""cadherin-related family member 23"""	605516	"""cadherin related 23"", ""cadherin-like 23"""	DFNB12, USH1D		11090341	Standard	NM_022124		Approved	CDHR23	uc001jrx.4	Q9H251	OTTHUMG00000019347	ENST00000224721.6:c.2890G>A	10.37:g.73464809G>A	ENSP00000224721:p.Ala964Thr		C4IXS9|F6U049|Q5QGS1|Q5QGS2|Q5QGS5|Q5QGS6|Q5XKN2|Q6UWW1|Q96JL3|Q9H4K9	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A964T	ENST00000224721.6	37	c.2890		10	.	.	.	.	.	.	.	.	.	.	G	13.60	2.284619	0.40394	2.41E-4	0.0	ENSG00000107736	ENST00000398860;ENST00000398855;ENST00000398828;ENST00000299366;ENST00000224721;ENST00000442677	.	.	.	5.5	5.5	0.81552	Cadherin (4);Cadherin-like (1);	0.398971	0.23918	N	0.043275	T	0.42562	0.1208	N	0.25890	0.77	0.80722	D	1	B;B;B	0.18741	0.006;0.03;0.001	B;B;B	0.13407	0.009;0.008;0.009	T	0.27640	-1.0068	9	0.27082	T	0.32	.	10.8917	0.47000	0.0723:0.1321:0.7956:0.0	.	959;962;959	Q6P152;G3XCN8;Q9H251	.;.;CAD23_HUMAN	T	964;959;959;962;962;476	.	ENSP00000224721:A964T	A	+	1	0	CDH23	73134815	0.267000	0.24122	1.000000	0.80357	0.985000	0.73830	1.412000	0.34714	2.575000	0.86900	0.561000	0.74099	GCG	CDH23	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000107736		0.672	CDH23-001	PUTATIVE	basic|appris_principal	protein_coding	CDH23	HGNC	protein_coding	OTTHUMT00000051227.4		0.00	20	0	G	NM_052836		73464809	+1			no_errors	ENST00000224721	ensembl	human	putative	74_37	missense	16.67	15	3	SNP	0.999	A
CDH7	1005	genome.wustl.edu	37	18	63430240	63430240	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr18:63430240C>G	ENST00000397968.2	+	2	588	c.162C>G	c.(160-162)ttC>ttG	p.F54L	CDH7_ENST00000323011.3_Missense_Mutation_p.F54L|CDH7_ENST00000536984.2_Missense_Mutation_p.F54L	NM_004361.2	NP_004352.2	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2	54	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(43)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	80		Esophageal squamous(42;0.129)				GGAATCAGTTCTTTGTGCTGG	0.468																																																	0													87.0	81.0	83.0					18																	63430240		2203	4300	6503	SO:0001583	missense	0			AB035301	CCDS11993.1	18q22.1	2010-01-26			ENSG00000081138	ENSG00000081138		"""Cadherins / Major cadherins"""	1766	protein-coding gene	gene with protein product		605806				9615235	Standard	NM_033646		Approved		uc002ljz.3	Q9ULB5	OTTHUMG00000132800	ENST00000397968.2:c.162C>G	18.37:g.63430240C>G	ENSP00000381058:p.Phe54Leu		Q9H157	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.F54L	ENST00000397968.2	37	c.162	CCDS11993.1	18	.	.	.	.	.	.	.	.	.	.	C	24.6	4.552029	0.86127	.	.	ENSG00000081138	ENST00000323011;ENST00000536984;ENST00000397966;ENST00000397968	T;T;T	0.00567	6.54;6.54;6.54	5.57	5.57	0.84162	Cadherin-like (1);	0.057016	0.64402	D	0.000001	T	0.02083	0.0065	M	0.66439	2.03	0.80722	D	1	B;D	0.58268	0.381;0.982	B;D	0.65140	0.148;0.932	T	0.64964	-0.6283	10	0.52906	T	0.07	.	19.5581	0.95361	0.0:1.0:0.0:0.0	.	54;54	F5H5X9;Q9ULB5	.;CADH7_HUMAN	L	54	ENSP00000319166:F54L;ENSP00000443030:F54L;ENSP00000381058:F54L	ENSP00000319166:F54L	F	+	3	2	CDH7	61581220	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.525000	0.53502	2.614000	0.88457	0.655000	0.94253	TTC	CDH7	-	superfamily_Cadherin-like	ENSG00000081138		0.468	CDH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH7	HGNC	protein_coding	OTTHUMT00000256217.2	-	0.00	78	0	C	NM_033646		63430240	+1	tier1	-	no_errors	ENST00000323011	ensembl	human	known	74_37	missense	34.38	42	22	SNP	1.000	G
CENPF	1063	genome.wustl.edu	37	1	214814749	214814749	+	Missense_Mutation	SNP	T	T	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:214814749T>G	ENST00000366955.3	+	12	3236	c.3068T>G	c.(3067-3069)cTt>cGt	p.L1023R		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	0					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)			NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		CAAGAAAAACTTATTTTACTA	0.323																																					Colon(80;575 1284 11000 14801 43496)												0													55.0	61.0	59.0					1																	214814749		2173	4289	6462	SO:0001583	missense	0			U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.3068T>G	1.37:g.214814749T>G	ENSP00000355922:p.Leu1023Arg		Q13171|Q13246|Q5VVM7	Missense_Mutation	SNP	pfam_Centromere_CenpF_N,pfam_Centromere_CenpF_leu-rich_rpt,pfam_CenpF/LEK1_Rb-prot-bd	p.L1023R	ENST00000366955.3	37	c.3068	CCDS31023.1	1	.	.	.	.	.	.	.	.	.	.	T	10.56	1.384260	0.25031	.	.	ENSG00000117724	ENST00000366955	T	0.03553	3.89	4.86	4.86	0.63082	.	0.000000	0.34386	N	0.004020	T	0.06325	0.0163	.	.	.	0.23107	N	0.998281	D	0.64830	0.994	P	0.57911	0.829	T	0.33292	-0.9874	9	0.11182	T	0.66	.	9.3853	0.38338	0.2668:0.0:0.0:0.7332	.	1023	P49454	CENPF_HUMAN	R	1023	ENSP00000355922:L1023R	ENSP00000355922:L1023R	L	+	2	0	CENPF	212881372	0.008000	0.16893	0.473000	0.27253	0.607000	0.37147	1.537000	0.36083	1.947000	0.56498	0.496000	0.49642	CTT	CENPF	-	NULL	ENSG00000117724		0.323	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPF	HGNC	protein_coding	OTTHUMT00000089749.1	-	0.00	47	0	T	NM_016343		214814749	+1	tier1	-	no_errors	ENST00000366955	ensembl	human	known	74_37	missense	13.43	58	9	SNP	0.429	G
CENPH	64946	genome.wustl.edu	37	5	68485511	68485511	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr5:68485511G>C	ENST00000283006.2	+	1	137	c.50G>C	c.(49-51)gGa>gCa	p.G17A	CENPH_ENST00000515001.1_Missense_Mutation_p.G17A	NM_022909.3	NP_075060.1			centromere protein H											kidney(15)|large_intestine(2)|lung(3)	20		Lung NSC(167;5.51e-05)|Prostate(74;0.00634)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;1.41e-56)|Epithelial(20;1.29e-52)|all cancers(19;3.15e-48)|Lung(70;0.0178)		GCGGACTCCGGAGGGGAAGGC	0.677																																																	0													10.0	12.0	11.0					5																	68485511		2178	4272	6450	SO:0001583	missense	0			AB035124	CCDS3998.1	5p15.2	2013-11-05			ENSG00000153044	ENSG00000153044			17268	protein-coding gene	gene with protein product		605607				11092768, 15502821	Standard	NM_022909		Approved		uc003jvp.3	Q9H3R5	OTTHUMG00000097816	ENST00000283006.2:c.50G>C	5.37:g.68485511G>C	ENSP00000283006:p.Gly17Ala			Missense_Mutation	SNP	pfam_CENP-H	p.G17A	ENST00000283006.2	37	c.50	CCDS3998.1	5	.	.	.	.	.	.	.	.	.	.	G	11.35	1.611812	0.28712	.	.	ENSG00000153044	ENST00000283006;ENST00000515001	T;T	0.56776	0.44;0.44	4.19	0.113	0.14631	.	1.087950	0.07277	N	0.870186	T	0.29458	0.0734	N	0.24115	0.695	0.09310	N	1	B;B	0.12013	0.005;0.005	B;B	0.11329	0.006;0.006	T	0.22347	-1.0219	10	0.02654	T	1	-0.7759	3.3992	0.07317	0.0955:0.3545:0.3927:0.1573	.	17;17	B3KVZ3;Q9H3R5	.;CENPH_HUMAN	A	17	ENSP00000283006:G17A;ENSP00000426014:G17A	ENSP00000283006:G17A	G	+	2	0	CENPH	68521267	0.002000	0.14202	0.000000	0.03702	0.017000	0.09413	-0.021000	0.12504	-0.006000	0.14370	-0.300000	0.09419	GGA	CENPH	-	NULL	ENSG00000153044		0.677	CENPH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPH	HGNC	protein_coding	OTTHUMT00000215083.1	-	0.00	54	0	G			68485511	+1	tier1	-	no_errors	ENST00000283006	ensembl	human	known	74_37	missense	25.29	65	22	SNP	0.000	C
CEP104	9731	genome.wustl.edu	37	1	3756340	3756340	+	Splice_Site	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:3756340C>T	ENST00000378230.3	-	7	891	c.567G>A	c.(565-567)agG>agA	p.R189R	CEP104_ENST00000460038.1_5'Flank	NM_014704.3	NP_055519.1	O60308	CE104_HUMAN	centrosomal protein 104kDa	189						centriole (GO:0005814)	glutamate binding (GO:0016595)|glycine binding (GO:0016594)|thienylcyclohexylpiperidine binding (GO:0016596)			breast(2)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(14)|lung(8)|prostate(1)|skin(3)	39						AGTCAGATTTCCTAAAGGGAA	0.428																																																	0													104.0	102.0	103.0					1																	3756340		2203	4300	6503	SO:0001630	splice_region_variant	0			AB011134	CCDS30571.1	1p36.32	2014-02-20	2011-05-06	2011-05-06	ENSG00000116198	ENSG00000116198			24866	protein-coding gene	gene with protein product	"""glycine, glutamate, thienylcyclohexylpiperidine binding protein"""		"""KIAA0562"""	KIAA0562		7488117, 21399614	Standard	NM_014704		Approved	GlyBP, RP1-286D6.4	uc001aky.2	O60308	OTTHUMG00000003507	ENST00000378230.3:c.567-1G>A	1.37:g.3756340C>T			Q5JSQ3|Q5SR24|Q5SR25|Q6PKF5|Q86W32|Q86X14	Silent	SNP	superfamily_Galactose-bd-like,superfamily_ARM-type_fold	p.R189	ENST00000378230.3	37	c.567	CCDS30571.1	1																																																																																			CEP104	-	NULL	ENSG00000116198		0.428	CEP104-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP104	HGNC	protein_coding	OTTHUMT00000009747.3	-	0.00	57	0	C	NM_014704	Silent	3756340	-1	tier1	-	no_errors	ENST00000378230	ensembl	human	known	74_37	silent	29.55	31	13	SNP	0.998	T
CEP164	22897	genome.wustl.edu	37	11	117257946	117257946	+	Silent	SNP	A	A	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr11:117257946A>G	ENST00000278935.3	+	15	1899	c.1752A>G	c.(1750-1752)ccA>ccG	p.P584P	CEP164_ENST00000533706.1_3'UTR	NM_001271933.1|NM_014956.4	NP_001258862.1|NP_055771.4	Q9UPV0	CE164_HUMAN	centrosomal protein 164kDa	584	Glu-rich.				cilium assembly (GO:0042384)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary transition fiber (GO:0097539)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|kidney(7)|large_intestine(12)|lung(18)|ovary(3)|prostate(3)	47	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;4e-05)|Epithelial(105;0.0008)		TGGCTCCCCCAGAGCAGCTCT	0.557																																																	0													81.0	82.0	81.0					11																	117257946		2201	4296	6497	SO:0001819	synonymous_variant	0			AB028975	CCDS31683.1	11q23.3	2014-02-20			ENSG00000110274	ENSG00000110274			29182	protein-coding gene	gene with protein product		614848				10470851, 14654843	Standard	NM_014956		Approved	KIAA1052, NPHP15	uc001prc.3	Q9UPV0	OTTHUMG00000167070	ENST00000278935.3:c.1752A>G	11.37:g.117257946A>G			Q6PKH9|Q7Z2X9|Q9NVS0|Q9UFJ6	Silent	SNP	superfamily_WW_dom,smart_WW_dom,pfscan_WW_dom	p.P584	ENST00000278935.3	37	c.1752	CCDS31683.1	11																																																																																			CEP164	-	NULL	ENSG00000110274		0.557	CEP164-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP164	HGNC	protein_coding	OTTHUMT00000392893.1		0.00	36	0	A	NM_014956		117257946	+1			no_errors	ENST00000278935	ensembl	human	known	74_37	silent	6.67	28	2	SNP	0.000	G
CEP89	84902	genome.wustl.edu	37	19	33462550	33462550	+	Intron	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr19:33462550G>C	ENST00000305768.5	-	1	128				C19orf40_ENST00000589646.1_5'Flank|CEP89_ENST00000590597.2_Intron|CEP89_ENST00000591863.1_5'UTR|C19orf40_ENST00000590281.1_5'Flank|C19orf40_ENST00000590179.1_5'Flank|C19orf40_ENST00000588258.1_5'Flank	NM_032816.3	NP_116205.3	Q96ST8	CEP89_HUMAN	centrosomal protein 89kDa						cilium assembly (GO:0042384)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary transition fiber (GO:0097539)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)				breast(2)|cervix(1)|endometrium(4)|large_intestine(4)|lung(15)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	35						gcgacagagcgagaccctgtt	0.507																																																	0																																										SO:0001627	intron_variant	0			AL832158	CCDS32987.1	19q13.11	2014-02-20	2011-05-06	2011-05-06		ENSG00000121289			25907	protein-coding gene	gene with protein product		615470	"""coiled-coil domain containing 123"""	CCDC123		16395595	Standard	NM_032816		Approved	FLJ14640	uc002nty.3	Q96ST8		ENST00000305768.5:c.39+191C>G	19.37:g.33462550G>C			B9EGA6|Q8N5J8	RNA	SNP	-	NULL	ENST00000305768.5	37	NULL	CCDS32987.1	19																																																																																			CEP89	-	-	ENSG00000121289		0.507	CEP89-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CEP89	HGNC	protein_coding	OTTHUMT00000451300.2	-	0.00	13	0	G	NM_032816		33462550	-1	tier1	-	no_errors	ENST00000591863	ensembl	human	putative	74_37	rna	23.53	13	4	SNP	0.244	C
CHD1L	9557	genome.wustl.edu	37	1	146727518	146727518	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:146727518G>C	ENST00000369258.4	+	4	418	c.398G>C	c.(397-399)aGa>aCa	p.R133T	CHD1L_ENST00000361293.5_Intron|CHD1L_ENST00000431239.1_Missense_Mutation_p.R133T|CHD1L_ENST00000467213.1_3'UTR|CHD1L_ENST00000369259.3_Intron	NM_001256336.1|NM_004284.4|NM_024568.2	NP_001243265.1|NP_004275.4|NP_078844.2	Q86WJ1	CHD1L_HUMAN	chromodomain helicase DNA binding protein 1-like	133	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|nucleotide binding (GO:0000166)			breast(2)|endometrium(4)|kidney(1)|large_intestine(4)|lung(15)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33	all_hematologic(923;0.0487)					AAGGAGGAAAGAGCCTGCCTT	0.423																																																	0													85.0	76.0	79.0					1																	146727518		2203	4300	6503	SO:0001583	missense	0			AF054177	CCDS927.1, CCDS58021.1, CCDS58022.1, CCDS72882.1	1q21.1	2008-02-05			ENSG00000131778	ENSG00000131778			1916	protein-coding gene	gene with protein product		613039				9653160	Standard	NM_004284		Approved	ALC1	uc001epm.5	Q86WJ1	OTTHUMG00000150271	ENST00000369258.4:c.398G>C	1.37:g.146727518G>C	ENSP00000358262:p.Arg133Thr		A5YM64|B4DDE1|B5MDZ7|Q53EZ3|Q5VXX7|Q6DD94|Q6PK83|Q86XH3|Q96HF7|Q96SP3|Q9BVJ1|Q9NVV8	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,pfam_HDA_complex_subunit-2/3,pfam_Helicase/UvrB_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Macro_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.R133T	ENST00000369258.4	37	c.398	CCDS927.1	1	.	.	.	.	.	.	.	.	.	.	G	18.59	3.657420	0.67586	.	.	ENSG00000131778	ENST00000431239;ENST00000369258;ENST00000436230;ENST00000254086	D;D	0.94613	-3.47;-3.47	5.57	5.57	0.84162	DEAD-like helicase (2);SNF2-related (1);	0.000000	0.85682	D	0.000000	D	0.97052	0.9037	M	0.84326	2.69	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.996;1.0	D	0.97297	0.9928	10	0.87932	D	0	.	15.4084	0.74900	0.0:0.0:1.0:0.0	.	133;133	Q86WJ1-2;Q86WJ1	.;CHD1L_HUMAN	T	133;133;33;94	ENSP00000389031:R133T;ENSP00000358262:R133T	ENSP00000254086:R94T	R	+	2	0	CHD1L	145194142	1.000000	0.71417	0.994000	0.49952	0.348000	0.29142	6.885000	0.75606	2.785000	0.95823	0.591000	0.81541	AGA	CHD1L	-	pfam_SNF2_N,pfam_Helicase/UvrB_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000131778		0.423	CHD1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD1L	HGNC	protein_coding	OTTHUMT00000040377.1	-	0.00	48	0	G	NM_004284		146727518	+1	tier1	-	no_errors	ENST00000369258	ensembl	human	known	74_37	missense	24.00	38	12	SNP	1.000	C
CHML	1122	genome.wustl.edu	37	1	241798135	241798135	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:241798135C>G	ENST00000366553.1	-	1	1097	c.934G>C	c.(934-936)Gat>Cat	p.D312H	OPN3_ENST00000469376.1_Intron|OPN3_ENST00000366554.2_Intron|OPN3_ENST00000331838.5_Intron	NM_001821.3	NP_001812.2	P26374	RAE2_HUMAN	choroideremia-like (Rab escort protein 2)	312					intracellular protein transport (GO:0006886)|protein geranylgeranylation (GO:0018344)	Rab-protein geranylgeranyltransferase complex (GO:0005968)	GTPase activator activity (GO:0005096)|Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)			breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|lung(7)|ovary(4)|skin(3)|stomach(1)	26	Ovarian(103;0.103)|all_lung(81;0.23)	all_cancers(173;0.0231)	OV - Ovarian serous cystadenocarcinoma(106;0.0125)			TGGTATTCATCAGGATGTTGT	0.348																																																	0													97.0	97.0	97.0					1																	241798135		2203	4299	6502	SO:0001583	missense	0			X64728	CCDS31073.1	1q43	2013-09-19			ENSG00000203668	ENSG00000203668			1941	protein-coding gene	gene with protein product		118825				7981670	Standard	NM_001821		Approved	REP-2	uc001hzd.3	P26374	OTTHUMG00000039690	ENST00000366553.1:c.934G>C	1.37:g.241798135C>G	ENSP00000355511:p.Asp312His		B2RAB9|Q17RE0|Q9H1Y4	Missense_Mutation	SNP	pfam_GDP_dissociation_inhibitor,pirsf_Rab_geranylTrfase_A_euk,prints_Rab_escort,prints_GDP_dissociation_inhibitor	p.D312H	ENST00000366553.1	37	c.934	CCDS31073.1	1	.	.	.	.	.	.	.	.	.	.	C	14.36	2.510779	0.44660	.	.	ENSG00000203668	ENST00000366553	D	0.86030	-2.06	4.96	4.05	0.47172	.	1.245710	0.05436	U	0.546919	D	0.89729	0.6799	.	.	.	0.41298	D	0.987024	P	0.39520	0.676	P	0.51079	0.658	T	0.80450	-0.1377	9	0.66056	D	0.02	-0.6382	11.5362	0.50639	0.0:0.9128:0.0:0.0872	.	312	P26374	RAE2_HUMAN	H	312	ENSP00000355511:D312H	ENSP00000355511:D312H	D	-	1	0	CHML	239864758	1.000000	0.71417	0.980000	0.43619	0.465000	0.32709	3.089000	0.50183	1.468000	0.48064	0.655000	0.94253	GAT	CHML	-	pfam_GDP_dissociation_inhibitor,pirsf_Rab_geranylTrfase_A_euk,prints_Rab_escort	ENSG00000203668		0.348	CHML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHML	HGNC	protein_coding	OTTHUMT00000095712.1	-	0.00	48	0	C	NM_001821		241798135	-1	tier1	-	no_errors	ENST00000366553	ensembl	human	known	74_37	missense	27.14	51	19	SNP	0.988	G
CHMP6	79643	genome.wustl.edu	37	17	78969547	78969547	+	Missense_Mutation	SNP	A	A	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr17:78969547A>G	ENST00000325167.5	+	4	415	c.337A>G	c.(337-339)Aag>Gag	p.K113E		NM_024591.4	NP_078867.2	Q96FZ7	CHMP6_HUMAN	charged multivesicular body protein 6	113					endosomal transport (GO:0016197)|membrane organization (GO:0061024)|protein transport (GO:0015031)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	protein N-terminus binding (GO:0047485)			lung(2)|ovary(1)	3	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0175)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			GTGTCTGAACAAGATGCACCA	0.567																																																	0													96.0	82.0	87.0					17																	78969547		2203	4300	6503	SO:0001583	missense	0			BC010108	CCDS11774.1	17q25.3	2014-08-13	2011-09-21		ENSG00000176108	ENSG00000176108		"""Charged multivesicular body proteins"""	25675	protein-coding gene	gene with protein product		610901	"""chromatin modifying protein 6"""			11559748, 15511219	Standard	NM_024591		Approved	FLJ11749, VPS20	uc002jyw.4	Q96FZ7	OTTHUMG00000177645	ENST00000325167.5:c.337A>G	17.37:g.78969547A>G	ENSP00000317468:p.Lys113Glu		A8K7U0|Q53FU4|Q9HAE8	Missense_Mutation	SNP	pfam_Snf7	p.K113E	ENST00000325167.5	37	c.337	CCDS11774.1	17	.	.	.	.	.	.	.	.	.	.	A	14.82	2.649024	0.47362	.	.	ENSG00000176108	ENST00000325167	T	0.72835	-0.69	4.29	4.29	0.51040	.	0.000000	0.85682	D	0.000000	T	0.59335	0.2186	L	0.35723	1.085	0.58432	D	0.999998	B	0.16166	0.016	B	0.15052	0.012	T	0.54456	-0.8291	10	0.21540	T	0.41	-6.6312	13.4405	0.61109	1.0:0.0:0.0:0.0	.	113	Q96FZ7	CHMP6_HUMAN	E	113	ENSP00000317468:K113E	ENSP00000317468:K113E	K	+	1	0	CHMP6	76584142	1.000000	0.71417	0.992000	0.48379	0.932000	0.56968	8.621000	0.90949	1.575000	0.49775	0.374000	0.22700	AAG	CHMP6	-	pfam_Snf7	ENSG00000176108		0.567	CHMP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHMP6	HGNC	protein_coding	OTTHUMT00000438215.1	-	0.00	34	0	A	NM_024591		78969547	+1	tier1	-	no_errors	ENST00000325167	ensembl	human	known	74_37	missense	44.44	10	8	SNP	0.998	G
CHRNA5	1138	genome.wustl.edu	37	15	78873159	78873159	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr15:78873159C>G	ENST00000299565.5	+	2	313	c.113C>G	c.(112-114)tCt>tGt	p.S38C	CHRNA5_ENST00000559554.1_Missense_Mutation_p.S38C	NM_000745.3	NP_000736.2	P30532	ACHA5_HUMAN	cholinergic receptor, nicotinic, alpha 5 (neuronal)	38					behavioral response to nicotine (GO:0035095)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(1)|ovary(1)|prostate(1)|skin(3)	15					Galantamine(DB00674)|Nicotine(DB00184)	ACAGGATTATCTGAACCTTCT	0.368																																																	0													66.0	66.0	66.0					15																	78873159		2195	4293	6488	SO:0001583	missense	0				CCDS10304.1	15q24	2012-02-11	2012-02-07		ENSG00000169684	ENSG00000169684		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1959	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 5 (neuronal)"""	118505	"""cholinergic receptor, nicotinic, alpha polypeptide 5"""			2004777	Standard	NM_000745		Approved		uc002bdy.3	P30532	OTTHUMG00000143858	ENST00000299565.5:c.113C>G	15.37:g.78873159C>G	ENSP00000299565:p.Ser38Cys		Q15824|Q99554	Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.S38C	ENST00000299565.5	37	c.113	CCDS10304.1	15	.	.	.	.	.	.	.	.	.	.	C	21.3	4.136154	0.77662	.	.	ENSG00000169684	ENST00000299565	T	0.78707	-1.2	5.52	5.52	0.82312	.	0.262349	0.39020	N	0.001500	T	0.65037	0.2653	N	0.08118	0	0.44042	D	0.996779	B	0.33448	0.412	B	0.36186	0.219	T	0.64618	-0.6365	10	0.32370	T	0.25	.	19.4388	0.94809	0.0:1.0:0.0:0.0	.	38	P30532	ACHA5_HUMAN	C	38	ENSP00000299565:S38C	ENSP00000299565:S38C	S	+	2	0	CHRNA5	76660214	1.000000	0.71417	0.822000	0.32727	0.950000	0.60333	5.297000	0.65704	2.590000	0.87494	0.655000	0.94253	TCT	CHRNA5	-	NULL	ENSG00000169684		0.368	CHRNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRNA5	HGNC	protein_coding	OTTHUMT00000290106.1	-	0.00	162	0	C			78873159	+1	tier1	-	no_errors	ENST00000299565	ensembl	human	known	74_37	missense	34.25	118	62	SNP	0.958	G
CHRNA9	55584	genome.wustl.edu	37	4	40356243	40356243	+	Silent	SNP	G	G	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr4:40356243G>T	ENST00000310169.2	+	5	1285	c.1146G>T	c.(1144-1146)ctG>ctT	p.L382L		NM_017581.3	NP_060051.2	Q9UGM1	ACHA9_HUMAN	cholinergic receptor, nicotinic, alpha 9 (neuronal)	382					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|inner ear morphogenesis (GO:0042472)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|synaptic transmission (GO:0007268)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine-activated cation-selective channel activity (GO:0004889)|calcium channel activity (GO:0005262)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(3)|skin(4)|stomach(1)	33					Galantamine(DB00674)|Nicotine(DB00184)	AGTCTAACCTGAAAGCAGCCA	0.512																																					Esophageal Squamous(115;1297 1602 22235 25158 43327)												0													88.0	84.0	85.0					4																	40356243		2203	4300	6503	SO:0001819	synonymous_variant	0			AF227732	CCDS3459.1	4p14	2012-02-11	2012-02-07		ENSG00000174343	ENSG00000174343		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	14079	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 9 (neuronal)"""	605116	"""cholinergic receptor, nicotinic, alpha polypeptide 9"""				Standard	NM_017581		Approved	NACHRA9	uc003gva.2	Q9UGM1	OTTHUMG00000099375	ENST00000310169.2:c.1146G>T	4.37:g.40356243G>T			Q14CY7|Q4W5A2|Q9NYV2	Silent	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.L382	ENST00000310169.2	37	c.1146	CCDS3459.1	4																																																																																			CHRNA9	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,tigrfam_Neur_channel	ENSG00000174343		0.512	CHRNA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRNA9	HGNC	protein_coding	OTTHUMT00000216822.1	-	0.00	43	0	G			40356243	+1	tier1	-	no_errors	ENST00000310169	ensembl	human	known	74_37	silent	6.58	71	5	SNP	0.004	T
CILP2	148113	genome.wustl.edu	37	19	19653312	19653312	+	Missense_Mutation	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr19:19653312G>A	ENST00000291495.5	+	5	806	c.721G>A	c.(721-723)Gat>Aat	p.D241N	CILP2_ENST00000588333.2_3'UTR|CILP2_ENST00000586018.1_Missense_Mutation_p.D247N	NM_153221.2	NP_694953.2	Q8IUL8	CILP2_HUMAN	cartilage intermediate layer protein 2	241						extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(17)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	32						GGCCACCAGCGATGCTCACGG	0.662																																																	0													43.0	39.0	40.0					19																	19653312		2203	4300	6503	SO:0001583	missense	0			AF542080	CCDS12405.1	19p13.11	2013-01-14				ENSG00000160161		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	24213	protein-coding gene	gene with protein product		612419				12477932	Standard	NM_153221		Approved	MGC45771	uc002nmv.4	Q8IUL8		ENST00000291495.5:c.721G>A	19.37:g.19653312G>A	ENSP00000291495:p.Asp241Asn		Q6NV88|Q8N4A6|Q8WV21	Missense_Mutation	SNP	pfam_Thrombospondin_1_rpt,pfam_Ig_I-set,superfamily_Thrombospondin_1_rpt,superfamily_CarboxyPept-like_regulatory,superfamily_Carb-bd-like_fold,smart_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom	p.D241N	ENST00000291495.5	37	c.721	CCDS12405.1	19	.	.	.	.	.	.	.	.	.	.	G	11.71	1.720261	0.30503	.	.	ENSG00000160161	ENST00000291495	T	0.49720	0.77	5.23	4.19	0.49359	Carboxypeptidase-like, regulatory domain (1);Carboxypeptidase, regulatory domain (1);	0.100895	0.64402	D	0.000003	T	0.43233	0.1238	L	0.46157	1.445	0.26284	N	0.97823	B;B	0.31125	0.309;0.309	B;B	0.34138	0.176;0.176	T	0.33394	-0.9870	10	0.33940	T	0.23	-22.8188	13.8408	0.63437	0.0:0.1542:0.8458:0.0	.	241;241	B2RAJ0;Q8IUL8	.;CILP2_HUMAN	N	241	ENSP00000291495:D241N	ENSP00000291495:D241N	D	+	1	0	CILP2	19514312	0.996000	0.38824	0.066000	0.19879	0.078000	0.17371	2.506000	0.45433	1.206000	0.43276	0.555000	0.69702	GAT	CILP2	-	superfamily_CarboxyPept-like_regulatory	ENSG00000160161		0.662	CILP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	CILP2	HGNC	protein_coding	OTTHUMT00000459738.3	-	0.00	28	0	G	NM_153221		19653312	+1	tier1	-	no_errors	ENST00000291495	ensembl	human	known	74_37	missense	26.67	11	4	SNP	0.583	A
CKB	1152	genome.wustl.edu	37	14	103986518	103986518	+	Missense_Mutation	SNP	C	C	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr14:103986518C>A	ENST00000348956.2	-	7	1265	c.908G>T	c.(907-909)gGc>gTc	p.G303V		NM_001823.4	NP_001814.2	P12277	KCRB_HUMAN	creatine kinase, brain	303	Phosphagen kinase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00843}.				cellular chloride ion homeostasis (GO:0030644)|cellular nitrogen compound metabolic process (GO:0034641)|creatine metabolic process (GO:0006600)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|creatine kinase activity (GO:0004111)			lung(2)|prostate(1)	3		Melanoma(154;0.155)	Epithelial(46;0.14)		Creatine(DB00148)	CTCATGCTTGCCCAGGTTGGG	0.622																																					Esophageal Squamous(186;2492 2823 49929 50127)												0													49.0	53.0	52.0					14																	103986518		2203	4299	6502	SO:0001583	missense	0				CCDS9981.1	14q32.32	2012-10-02			ENSG00000166165	ENSG00000166165	2.7.3.2		1991	protein-coding gene	gene with protein product		123280		CKBB			Standard	NM_001823		Approved		uc001ynf.2	P12277	OTTHUMG00000171786	ENST00000348956.2:c.908G>T	14.37:g.103986518C>A	ENSP00000299198:p.Gly303Val		A8K236|B2R5R4|Q2LE07|Q6FG40|Q9UC66	Missense_Mutation	SNP	pfam_ATP-guanido_PTrfase_cat,pfam_ATP-guanido_PTrfase_N,superfamily_ATP-guanido_PTrfase_N	p.G303V	ENST00000348956.2	37	c.908	CCDS9981.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.5|20.5	4.007470|4.007470	0.75046|0.75046	.|.	.|.	ENSG00000166165|ENSG00000166165	ENST00000555039|ENST00000348956;ENST00000428256;ENST00000553610	.|T;T	.|0.10192	.|2.9;2.9	4.63|4.63	4.63|4.63	0.57726|0.57726	.|ATP:guanido phosphotransferase, catalytic domain (2);Glutamine synthetase/guanido kinase, catalytic domain (1);	.|0.046925	.|0.85682	.|D	.|0.000000	T|T	0.20861|0.20861	0.0502|0.0502	L|L	0.52126|0.52126	1.63|1.63	0.80722|0.80722	D|D	1|1	.|P	.|0.40180	.|0.705	.|P	.|0.48488	.|0.579	T|T	0.01356|0.01356	-1.1376|-1.1376	5|10	.|0.87932	.|D	.|0	-14.6926|-14.6926	17.5047|17.5047	0.87741|0.87741	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|303	.|P12277	.|KCRB_HUMAN	S|V	54|303;268;101	.|ENSP00000299198:G303V;ENSP00000451426:G101V	.|ENSP00000299198:G303V	A|G	-|-	1|2	0|0	CKB|CKB	103056271|103056271	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.952000|0.952000	0.60782|0.60782	7.698000|7.698000	0.84413|0.84413	2.110000|2.110000	0.64415|0.64415	0.462000|0.462000	0.41574|0.41574	GCA|GGC	CKB	-	pfam_ATP-guanido_PTrfase_cat	ENSG00000166165		0.622	CKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CKB	HGNC	protein_coding	OTTHUMT00000415111.1		0.00	62	0	C			103986518	-1			no_errors	ENST00000348956	ensembl	human	known	74_37	missense	7.55	49	4	SNP	1.000	A
CLPTM1L	81037	genome.wustl.edu	37	5	1330463	1330463	+	Silent	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr5:1330463G>A	ENST00000320895.5	-	9	1269	c.1012C>T	c.(1012-1014)Ctg>Ttg	p.L338L	CLPTM1L_ENST00000507807.1_Intron|CLPTM1L_ENST00000320927.6_Intron	NM_030782.3	NP_110409.2	Q96KA5	CLP1L_HUMAN	CLPTM1-like	338					apoptotic process (GO:0006915)	integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(2)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24	Lung NSC(6;5.78e-14)|all_lung(6;4.47e-13)|all_epithelial(6;4.47e-09)		Epithelial(17;0.00931)|OV - Ovarian serous cystadenocarcinoma(19;0.0116)|all cancers(22;0.0181)	KIRC - Kidney renal clear cell carcinoma(5;0.177)|Kidney(13;0.208)		AGCAGGAACAGAAAGATGACC	0.637																																																	0													83.0	79.0	81.0					5																	1330463		2203	4299	6502	SO:0001819	synonymous_variant	0			AK027306	CCDS3862.1	5p15.33	2008-02-05			ENSG00000049656	ENSG00000049656			24308	protein-coding gene	gene with protein product	"""cisplatin resistance related protein"""	612585				11162647	Standard	NM_030782		Approved	FLJ14400, CRR9	uc003jch.3	Q96KA5	OTTHUMG00000131015	ENST00000320895.5:c.1012C>T	5.37:g.1330463G>A			D3DTC1|Q658W6|Q7LG29|Q96AZ0|Q9H3N4	Silent	SNP	pfam_CLPTM1	p.L338	ENST00000320895.5	37	c.1012	CCDS3862.1	5																																																																																			CLPTM1L	-	pfam_CLPTM1	ENSG00000049656		0.637	CLPTM1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLPTM1L	HGNC	protein_coding	OTTHUMT00000253649.2		0.00	22	0	G	NM_030782		1330463	-1			no_errors	ENST00000320895	ensembl	human	known	74_37	silent	7.00	93	7	SNP	1.000	A
CLSTN1	22883	genome.wustl.edu	37	1	9796040	9796040	+	Missense_Mutation	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:9796040G>A	ENST00000377298.4	-	12	2429	c.1637C>T	c.(1636-1638)tCc>tTc	p.S546F	CLSTN1_ENST00000361311.4_Missense_Mutation_p.S536F|CLSTN1_ENST00000377288.3_Missense_Mutation_p.S527F|CLSTN1_ENST00000477264.1_5'Flank	NM_001009566.1	NP_001009566.1	O94985	CSTN1_HUMAN	calsyntenin 1	546					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	cell junction (GO:0030054)|cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	beta-amyloid binding (GO:0001540)|calcium ion binding (GO:0005509)|kinesin binding (GO:0019894)|X11-like protein binding (GO:0042988)	p.S546C(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(7)|liver(1)|lung(9)|prostate(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	36	all_lung(157;0.222)	all_lung(284;4.03e-05)|Lung NSC(185;6.93e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|Colorectal(212;8.36e-08)|COAD - Colon adenocarcinoma(227;1.93e-05)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(304;0.000949)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|STAD - Stomach adenocarcinoma(132;0.00644)|READ - Rectum adenocarcinoma(331;0.0419)		GAGTTTCCCGGAACGGAGAGT	0.572																																																	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)											108.0	100.0	103.0					1																	9796040		2203	4300	6503	SO:0001583	missense	0			AB020718	CCDS105.1, CCDS30580.1	1p36.22	2011-07-01			ENSG00000171603	ENSG00000171603		"""Cadherins / Cadherin-related"""	17447	protein-coding gene	gene with protein product	"""cadherin-related family member 12"""	611321				10048485	Standard	XM_005263432		Approved	CSTN1, KIAA0911, CDHR12	uc001aqh.3	O94985	OTTHUMG00000001451	ENST00000377298.4:c.1637C>T	1.37:g.9796040G>A	ENSP00000366513:p.Ser546Phe		A8K183|Q5SR52|Q5UE58|Q71MN0|Q8N4K9	Missense_Mutation	SNP	pfam_Cadherin,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.S546F	ENST00000377298.4	37	c.1637	CCDS30580.1	1	.	.	.	.	.	.	.	.	.	.	G	28.5	4.921475	0.92249	.	.	ENSG00000171603	ENST00000377298;ENST00000361311;ENST00000435891;ENST00000377288;ENST00000539822	T;T;T;T	0.74947	-0.89;-0.89;-0.89;-0.89	5.77	5.77	0.91146	Concanavalin A-like lectin/glucanase (1);	0.000000	0.85682	D	0.000000	T	0.82121	0.4968	L	0.45581	1.43	0.80722	D	1	P;D;D	0.57899	0.953;0.976;0.981	P;P;P	0.61328	0.887;0.82;0.887	T	0.81590	-0.0863	10	0.52906	T	0.07	-24.2187	19.9983	0.97395	0.0:0.0:1.0:0.0	.	527;536;546	B4E3Q1;O94985-2;O94985	.;.;CSTN1_HUMAN	F	546;536;347;527;527	ENSP00000366513:S546F;ENSP00000354997:S536F;ENSP00000401934:S347F;ENSP00000366502:S527F	ENSP00000354997:S536F	S	-	2	0	CLSTN1	9718627	1.000000	0.71417	0.995000	0.50966	0.822000	0.46500	9.869000	0.99810	2.724000	0.93272	0.561000	0.74099	TCC	CLSTN1	-	superfamily_ConA-like_lec_gl_sf	ENSG00000171603		0.572	CLSTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CLSTN1	HGNC	protein_coding	OTTHUMT00000004239.1	-	0.00	48	0	G			9796040	-1	tier1	-	no_errors	ENST00000377298	ensembl	human	known	74_37	missense	13.79	25	4	SNP	1.000	A
CLSPN	63967	genome.wustl.edu	37	1	36211119	36211119	+	Missense_Mutation	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:36211119C>T	ENST00000318121.3	-	16	2956	c.2899G>A	c.(2899-2901)Gag>Aag	p.E967K	CLSPN_ENST00000520551.1_Missense_Mutation_p.E914K|RP11-435D7.3_ENST00000373226.2_RNA|CLSPN_ENST00000373220.3_Missense_Mutation_p.E903K|CLSPN_ENST00000251195.5_Missense_Mutation_p.E967K	NM_022111.3	NP_071394.2	Q9HAW4	CLSPN_HUMAN	claspin	967					activation of protein kinase activity (GO:0032147)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|G2 DNA damage checkpoint (GO:0031572)|mitotic DNA replication checkpoint (GO:0033314)|peptidyl-serine phosphorylation (GO:0018105)	nucleoplasm (GO:0005654)	anaphase-promoting complex binding (GO:0010997)|DNA binding (GO:0003677)			NS(2)|breast(3)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	56		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				ATGCTGCTCTCCTTCTCCTGT	0.448																																																	0													141.0	122.0	128.0					1																	36211119		2203	4300	6503	SO:0001583	missense	0			AF297866	CCDS396.1, CCDS53297.1	1p34.3	2010-06-24	2010-06-24		ENSG00000092853	ENSG00000092853			19715	protein-coding gene	gene with protein product		605434	"""claspin homolog (Xenopus laevis)"""			11090622, 12766152	Standard	NM_022111		Approved		uc001bzi.3	Q9HAW4	OTTHUMG00000004168	ENST00000318121.3:c.2899G>A	1.37:g.36211119C>T	ENSP00000312995:p.Glu967Lys		A6NFL4|Q1RMC6|Q2KHM3|Q5VYG0|Q6P6H5|Q8IWI1	Missense_Mutation	SNP	NULL	p.E967K	ENST00000318121.3	37	c.2899	CCDS396.1	1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.579480	0.86645	.	.	ENSG00000092853	ENST00000251195;ENST00000318121;ENST00000373220;ENST00000520551	T;T;T;T	0.22743	1.94;1.95;1.96;1.96	5.65	5.65	0.86999	.	0.295771	0.37955	N	0.001864	T	0.33059	0.0850	M	0.66939	2.045	0.53688	D	0.99997	P;P	0.52316	0.952;0.914	P;P	0.47430	0.547;0.501	T	0.01617	-1.1311	10	0.36615	T	0.2	-19.7703	18.2859	0.90114	0.0:1.0:0.0:0.0	.	903;967	Q9HAW4-2;Q9HAW4	.;CLSPN_HUMAN	K	967;967;903;914	ENSP00000251195:E967K;ENSP00000312995:E967K;ENSP00000362317:E903K;ENSP00000428848:E914K	ENSP00000251195:E967K	E	-	1	0	CLSPN	35983706	1.000000	0.71417	1.000000	0.80357	0.742000	0.42306	2.071000	0.41500	2.827000	0.97445	0.650000	0.86243	GAG	CLSPN	-	NULL	ENSG00000092853		0.448	CLSPN-005	KNOWN	basic|appris_principal|CCDS	protein_coding	CLSPN	HGNC	protein_coding	OTTHUMT00000377857.1	-	0.00	55	0	C	NM_022111		36211119	-1	tier1	-	no_errors	ENST00000318121	ensembl	human	known	74_37	missense	16.98	44	9	SNP	1.000	T
CNIH2	254263	genome.wustl.edu	37	11	66045989	66045991	+	In_Frame_Del	DEL	TCT	TCT	-	rs143558098		TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	TCT	TCT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr11:66045989_66045991delTCT	ENST00000311445.6	+	1	320_322	c.62_64delTCT	c.(61-66)atcttc>atc	p.F23del	RP11-867G23.4_ENST00000528650.1_RNA|CNIH2_ENST00000530519.1_3'UTR|RP11-867G23.3_ENST00000501708.1_lincRNA|RP11-867G23.4_ENST00000526951.1_RNA|CNIH2_ENST00000528852.1_In_Frame_Del_p.F23del	NM_182553.2	NP_872359.1	Q6PI25	CNIH2_HUMAN	cornichon family AMPA receptor auxiliary protein 2	23					intracellular signal transduction (GO:0035556)|localization within membrane (GO:0051668)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of membrane potential (GO:0042391)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)				endometrium(1)|large_intestine(1)|lung(2)|prostate(1)	5						GCCTCCCTCATCTTCTTTGTCAT	0.749																																																	0																																										SO:0001651	inframe_deletion	0			BC047953	CCDS8131.1	11q13.2	2013-08-28	2013-08-28		ENSG00000174871	ENSG00000174871			28744	protein-coding gene	gene with protein product		611288	"""cornichon homolog 2 (Drosophila)"""			12477932	Standard	NM_182553		Approved	MGC50896, Cnil, CNIH-2	uc001ohi.2	Q6PI25	OTTHUMG00000166919	ENST00000311445.6:c.62_64delTCT	11.37:g.66045992_66045994delTCT	ENSP00000310003:p.Phe23del			In_Frame_Del	DEL	pfam_Cornichon	p.F23in_frame_del	ENST00000311445.6	37	c.62_64	CCDS8131.1	11																																																																																			CNIH2	-	pfam_Cornichon	ENSG00000174871		0.749	CNIH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNIH2	HGNC	protein_coding	OTTHUMT00000391892.1		0.00	40	0	TCT	NM_182553		66045991	+1	tier1		no_errors	ENST00000311445	ensembl	human	known	74_37	in_frame_del	14.63	35	6	DEL	1.000:1.000:1.000	-
CNR1	1268	genome.wustl.edu	37	6	88854985	88854985	+	Silent	SNP	C	C	T	rs371432780		TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr6:88854985C>T	ENST00000537554.1	-	2	3571	c.9G>A	c.(7-9)tcG>tcA	p.S3S	CNR1_ENST00000549716.1_5'Flank|CNR1_ENST00000369499.2_Silent_p.S3S|CNR1_ENST00000549890.1_Silent_p.S3S|CNR1_ENST00000535130.1_Silent_p.S3S|CNR1_ENST00000362094.5_Silent_p.S3S|CNR1_ENST00000468898.1_Silent_p.S3S|CNR1_ENST00000369501.2_Silent_p.S3S|CNR1_ENST00000428600.2_Silent_p.S3S	NM_001160226.1|NM_001160258.1	NP_001153698.1|NP_001153730.1	P21554	CNR1_HUMAN	cannabinoid receptor 1 (brain)	3					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|aging (GO:0007568)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glucose homeostasis (GO:0042593)|maternal process involved in female pregnancy (GO:0060135)|memory (GO:0007613)|negative regulation of action potential (GO:0045759)|negative regulation of blood pressure (GO:0045776)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of fatty acid beta-oxidation (GO:0031999)|negative regulation of mast cell activation (GO:0033004)|negative regulation of nitric-oxide synthase activity (GO:0051001)|positive regulation of acute inflammatory response to antigenic stimulus (GO:0002866)|positive regulation of apoptotic process (GO:0043065)|positive regulation of blood pressure (GO:0045777)|positive regulation of fever generation (GO:0031622)|positive regulation of neuron projection development (GO:0010976)|regulation of feeding behavior (GO:0060259)|regulation of insulin secretion (GO:0050796)|regulation of penile erection (GO:0060405)|regulation of synaptic transmission, GABAergic (GO:0032228)|regulation of synaptic transmission, glutamatergic (GO:0051966)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to morphine (GO:0043278)|response to nicotine (GO:0035094)|response to nutrient (GO:0007584)|sensory perception of pain (GO:0019233)|spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cannabinoid receptor activity (GO:0004949)|drug binding (GO:0008144)			breast(2)|endometrium(3)|kidney(1)|large_intestine(7)|liver(1)|lung(11)|prostate(1)|skin(10)|urinary_tract(1)	37		all_cancers(76;8.24e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;4.11e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.00011)		BRCA - Breast invasive adenocarcinoma(108;0.15)	Dronabinol(DB00470)|Nabilone(DB00486)|Rimonabant(DB06155)	CATCTAGGATCGACTTCATAA	0.478																																																	0								C	,,,,	1,4405	2.1+/-5.4	0,1,2202	132.0	112.0	119.0		9,9,9,9,9	-3.5	1.0	6		119	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	CNR1	NM_001160226.1,NM_001160258.1,NM_001160259.1,NM_016083.4,NM_033181.3	,,,,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,,,,	3/473,3/473,3/473,3/473,3/440	88854985	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AF107262	CCDS5015.1, CCDS5016.1, CCDS5016.2	6q14-q15	2012-08-08			ENSG00000118432	ENSG00000118432		"""GPCR / Class A : Cannabinoid receptors"""	2159	protein-coding gene	gene with protein product		114610		CNR			Standard	NM_016083		Approved	CB1K5, CB-R, CB1, CANN6, CB1A	uc003pmq.4	P21554	OTTHUMG00000015184	ENST00000537554.1:c.9G>A	6.37:g.88854985C>T			B2R9T4|E1P512|Q13949|Q495Z0|Q4PLI4|Q4VBM6|Q5JVL5|Q5UB37|Q9UNN0	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pirsf_Canbinoid_rcpt_1,pfscan_GPCR_Rhodpsn_7TM,prints_Canbinoid_rcpt_1,prints_Cnbnoid_rcpt,prints_GPCR_Rhodpsn	p.S3	ENST00000537554.1	37	c.9	CCDS5015.1	6																																																																																			CNR1	-	pirsf_Canbinoid_rcpt_1	ENSG00000118432		0.478	CNR1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	CNR1	HGNC	protein_coding	OTTHUMT00000354204.2	-	0.00	38	0	C			88854985	-1	tier1	-	no_errors	ENST00000369499	ensembl	human	known	74_37	silent	12.00	44	6	SNP	0.656	T
COG8	84342	genome.wustl.edu	37	16	69354891	69354891	+	5'UTR	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr16:69354891C>T	ENST00000564419.1	-	0	87				VPS4A_ENST00000254950.11_Intron			Q96MW5	COG8_HUMAN	component of oligomeric golgi complex 8						protein transport (GO:0015031)	Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(3)|kidney(1)|large_intestine(2)|ovary(2)|skin(1)	9						CTTCGTGCCTCCCCTTCCGTG	0.537																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AK025968	CCDS10876.1	16q22.1	2011-05-31			ENSG00000213380	ENSG00000213380		"""Components of oligomeric golgi complex"""	18623	protein-coding gene	gene with protein product		606979				11980916	Standard	NM_032382		Approved	FLJ22315, DOR1	uc002ewy.2	Q96MW5	OTTHUMG00000154277	ENST00000564419.1:c.-849G>A	16.37:g.69354891C>T			Q0VAK2|Q8WVV6|Q9H6F8	RNA	SNP	-	NULL	ENST00000564419.1	37	NULL		16																																																																																			COG8	-	-	ENSG00000213380		0.537	COG8-005	PUTATIVE	basic	processed_transcript	COG8	HGNC	protein_coding	OTTHUMT00000430567.1	-	0.00	30	0	C	NM_032382		69354891	-1	tier1	-	no_errors	ENST00000564419	ensembl	human	putative	74_37	rna	53.85	12	14	SNP	0.000	T
COL12A1	1303	genome.wustl.edu	37	6	75893760	75893760	+	Silent	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr6:75893760G>A	ENST00000322507.8	-	9	1407	c.1098C>T	c.(1096-1098)gtC>gtT	p.V366V	COL12A1_ENST00000345356.6_Intron|COL12A1_ENST00000416123.2_Silent_p.V366V|COL12A1_ENST00000483888.2_Silent_p.V366V	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	366	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						GTGTGAGGATGACTTTGTAGC	0.483																																																	0													81.0	79.0	80.0					6																	75893760		1984	4178	6162	SO:0001819	synonymous_variant	0			U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.1098C>T	6.37:g.75893760G>A			O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Silent	SNP	pfam_Fibronectin_type3,pfam_VWF_A,pfam_Collagen,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_VWF_A,smart_Laminin_G,pfscan_Fibronectin_type3,pfscan_VWF_A	p.V366	ENST00000322507.8	37	c.1098	CCDS43482.1	6																																																																																			COL12A1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000111799		0.483	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL12A1	HGNC	protein_coding	OTTHUMT00000041249.3	-	0.00	53	0	G	NM_004370		75893760	-1	tier1	-	no_errors	ENST00000322507	ensembl	human	known	74_37	silent	17.54	47	10	SNP	0.000	A
COL14A1	7373	genome.wustl.edu	37	8	121292979	121292979	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr8:121292979G>C	ENST00000297848.3	+	30	3946	c.3676G>C	c.(3676-3678)Gat>Cat	p.D1226H	COL14A1_ENST00000247781.3_Missense_Mutation_p.D1131H|COL14A1_ENST00000309791.4_Missense_Mutation_p.D1226H	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1											NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			GGATGGCATTGATCTTGCAGG	0.363																																																	0													105.0	101.0	103.0					8																	121292979		2203	4300	6503	SO:0001583	missense	0				CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.3676G>C	8.37:g.121292979G>C	ENSP00000297848:p.Asp1226His			Missense_Mutation	SNP	pfam_VWF_A,pfam_Fibronectin_type3,pfam_Collagen,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_VWF_A,smart_Laminin_G,pfscan_Fibronectin_type3,pfscan_VWF_A	p.D1226H	ENST00000297848.3	37	c.3676	CCDS34938.1	8	.	.	.	.	.	.	.	.	.	.	G	10.98	1.505625	0.26949	.	.	ENSG00000187955	ENST00000309791;ENST00000297848;ENST00000247781	D;D;D	0.88431	-2.28;-2.31;-2.38	5.76	4.77	0.60923	Concanavalin A-like lectin/glucanase (1);	0.297267	0.40469	N	0.001086	T	0.75700	0.3885	N	0.22421	0.69	0.46749	D	0.99918	P	0.38642	0.641	B	0.32289	0.143	T	0.72880	-0.4158	10	0.33940	T	0.23	.	4.4697	0.11706	0.2325:0.0:0.7675:0.0	.	1226	Q05707	COEA1_HUMAN	H	1226;1226;1131	ENSP00000311809:D1226H;ENSP00000297848:D1226H;ENSP00000247781:D1131H	ENSP00000247781:D1131H	D	+	1	0	COL14A1	121362160	0.925000	0.31364	0.267000	0.24556	0.041000	0.13682	5.247000	0.65416	2.736000	0.93811	0.655000	0.94253	GAT	COL14A1	-	superfamily_ConA-like_lec_gl_sf	ENSG00000187955		0.363	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL14A1	HGNC	protein_coding	OTTHUMT00000313657.2	-	0.00	46	0	G	NM_021110		121292979	+1	tier1	-	no_errors	ENST00000297848	ensembl	human	known	74_37	missense	13.56	51	8	SNP	0.034	C
COL16A1	1307	genome.wustl.edu	37	1	32126208	32126208	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:32126208C>G	ENST00000373672.3	-	62	4373	c.3857G>C	c.(3856-3858)aGa>aCa	p.R1286T	RP11-73M7.6_ENST00000588288.1_RNA|RP11-73M7.6_ENST00000609033.1_RNA|RP11-73M7.6_ENST00000609373.1_RNA|RP11-73M7.6_ENST00000445166.1_RNA|RP11-73M7.6_ENST00000585660.1_RNA|RP11-73M7.6_ENST00000589462.1_RNA|RP11-73M7.6_ENST00000609625.1_RNA|RP11-73M7.6_ENST00000607926.1_RNA|RP11-73M7.6_ENST00000608332.1_RNA|RP11-73M7.6_ENST00000587445.1_RNA|RP11-73M7.6_ENST00000609549.1_RNA|RP11-73M7.6_ENST00000609338.1_RNA|RP11-73M7.6_ENST00000591592.1_RNA|RP11-73M7.6_ENST00000585413.1_RNA|RP11-73M7.6_ENST00000610216.1_RNA|RP11-73M7.6_ENST00000608888.1_RNA|COL16A1_ENST00000271069.6_Missense_Mutation_p.R1286T|RP11-73M7.6_ENST00000591929.1_RNA|RP11-73M7.6_ENST00000608246.1_RNA|RP11-73M7.6_ENST00000610043.1_RNA|RP11-73M7.6_ENST00000593188.1_RNA	NM_001856.3	NP_001847.3	Q07092	COGA1_HUMAN	collagen, type XVI, alpha 1	1286	Triple-helical region 2 (COL2) with 2 imperfections.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female pregnancy (GO:0007565)|integrin-mediated signaling pathway (GO:0007229)	collagen type XVI trimer (GO:0005597)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(15)|ovary(8)|prostate(4)	48		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		GGGACCGGGTCTTCCCTGGGG	0.537																																					Colon(143;498 1786 21362 25193 36625)												0													70.0	74.0	73.0					1																	32126208		1910	4122	6032	SO:0001583	missense	0			M92642	CCDS41297.1	1p35-p34	2013-01-16			ENSG00000084636	ENSG00000084636		"""Collagens"""	2193	protein-coding gene	gene with protein product		120326				1631157	Standard	NM_001856		Approved		uc001btk.1	Q07092	OTTHUMG00000003883	ENST00000373672.3:c.3857G>C	1.37:g.32126208C>G	ENSP00000362776:p.Arg1286Thr		Q16593|Q59F89|Q71RG9	Missense_Mutation	SNP	pfam_Collagen,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G	p.R1286T	ENST00000373672.3	37	c.3857	CCDS41297.1	1	.	.	.	.	.	.	.	.	.	.	C	13.79	2.341178	0.41498	.	.	ENSG00000084636	ENST00000373672;ENST00000271069;ENST00000440437	D;D;D	0.94092	-3.23;-3.23;-3.35	5.57	5.57	0.84162	.	0.064475	0.64402	D	0.000011	D	0.94364	0.8188	L	0.41356	1.27	0.36602	D	0.874702	D;D	0.76494	0.999;0.998	D;D	0.78314	0.991;0.99	D	0.91601	0.5295	10	0.09590	T	0.72	.	18.7086	0.91648	0.0:1.0:0.0:0.0	.	1286;1284	Q07092;Q07092-2	COGA1_HUMAN;.	T	1286;1286;143	ENSP00000362776:R1286T;ENSP00000271069:R1286T;ENSP00000390281:R143T	ENSP00000271069:R1286T	R	-	2	0	COL16A1	31898795	1.000000	0.71417	1.000000	0.80357	0.672000	0.39443	3.377000	0.52425	2.793000	0.96121	0.591000	0.81541	AGA	COL16A1	-	NULL	ENSG00000084636		0.537	COL16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL16A1	HGNC	protein_coding	OTTHUMT00000011057.2	-	0.00	30	0	C	NM_001856		32126208	-1	tier1	-	no_errors	ENST00000271069	ensembl	human	known	74_37	missense	23.64	42	13	SNP	1.000	G
COL4A2	1284	genome.wustl.edu	37	13	111117830	111117830	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr13:111117830G>C	ENST00000360467.5	+	25	2161	c.1855G>C	c.(1855-1857)Ggc>Cgc	p.G619R	COL4A2-AS2_ENST00000458403.2_RNA	NM_001846.2	NP_001837.2	P08572	CO4A2_HUMAN	collagen, type IV, alpha 2	619	Triple-helical region.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of angiogenesis (GO:0016525)|transcription, DNA-templated (GO:0006351)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	extracellular matrix structural constituent (GO:0005201)			NS(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|liver(2)|lung(48)|ovary(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	80	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)			AGGAGAAATGGGCCCCCCAGG	0.607																																																	0													36.0	40.0	39.0					13																	111117830		1820	4079	5899	SO:0001583	missense	0			AK025912	CCDS41907.1	13q34	2013-09-05			ENSG00000134871	ENSG00000134871		"""Collagens"""	2203	protein-coding gene	gene with protein product	"""canstatin"", ""collagen type IV alpha 2"""	120090				2439508, 3025878	Standard	NM_001846		Approved	FLJ22259, DKFZp686I14213	uc001vqx.3	P08572	OTTHUMG00000017344	ENST00000360467.5:c.1855G>C	13.37:g.111117830G>C	ENSP00000353654:p.Gly619Arg		Q14052|Q548C3|Q5VZA9|Q66K23	Missense_Mutation	SNP	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.G619R	ENST00000360467.5	37	c.1855	CCDS41907.1	13	.	.	.	.	.	.	.	.	.	.	G	11.88	1.769911	0.31320	.	.	ENSG00000134871	ENST00000360467;ENST00000257309	D	0.99537	-6.11	4.65	4.65	0.58169	.	0.000000	0.51477	D	0.000098	D	0.99687	0.9882	M	0.91249	3.19	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97383	0.9984	10	0.87932	D	0	.	17.1381	0.86745	0.0:0.0:1.0:0.0	.	619	P08572	CO4A2_HUMAN	R	619	ENSP00000353654:G619R	ENSP00000257309:G619R	G	+	1	0	COL4A2	109915831	1.000000	0.71417	0.157000	0.22605	0.011000	0.07611	4.603000	0.61105	2.136000	0.66102	0.462000	0.41574	GGC	COL4A2	-	NULL	ENSG00000134871		0.607	COL4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL4A2	HGNC	protein_coding	OTTHUMT00000045761.2	-	0.00	102	0	G	NM_001846		111117830	+1	tier1	-	no_errors	ENST00000360467	ensembl	human	known	74_37	missense	12.05	73	10	SNP	0.978	C
COL6A3	1293	genome.wustl.edu	37	2	238261195	238261195	+	Silent	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr2:238261195C>G	ENST00000295550.4	-	26	7175	c.6723G>C	c.(6721-6723)ctG>ctC	p.L2241L	COL6A3_ENST00000472056.1_Silent_p.L1634L|COL6A3_ENST00000347401.3_Silent_p.L2040L|COL6A3_ENST00000409809.1_Silent_p.L2035L|COL6A3_ENST00000346358.4_Silent_p.L2041L|COL6A3_ENST00000353578.4_Silent_p.L2035L	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	2241	Triple-helical region.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		GTTCTCCTATCAGCCCTGGAG	0.552																																																	0													81.0	67.0	71.0					2																	238261195		2203	4300	6503	SO:0001819	synonymous_variant	0			X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.6723G>C	2.37:g.238261195C>G			A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Silent	SNP	pfam_VWF_A,pfam_Collagen,pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,superfamily_Fibronectin_type3,smart_VWF_A,smart_Prot_inh_Kunz-m,pfscan_Fibronectin_type3,pfscan_VWF_A,pfscan_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m	p.L2241	ENST00000295550.4	37	c.6723	CCDS33412.1	2																																																																																			COL6A3	-	NULL	ENSG00000163359		0.552	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL6A3	HGNC	protein_coding	OTTHUMT00000315790.2	-	0.00	34	0	C	NM_004369		238261195	-1	tier1	-	no_errors	ENST00000295550	ensembl	human	known	74_37	silent	35.71	18	10	SNP	0.006	G
COLEC12	81035	genome.wustl.edu	37	18	346689	346689	+	Silent	SNP	C	C	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr18:346689C>A	ENST00000400256.3	-	5	1140	c.933G>T	c.(931-933)ctG>ctT	p.L311L		NM_130386.2	NP_569057	Q5KU26	COL12_HUMAN	collectin sub-family member 12	311					carbohydrate mediated signaling (GO:0009756)|defense response (GO:0006952)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)|phagocytosis, recognition (GO:0006910)|protein homooligomerization (GO:0051260)|receptor-mediated endocytosis (GO:0006898)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	galactose binding (GO:0005534)|low-density lipoprotein particle binding (GO:0030169)|metal ion binding (GO:0046872)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)			cervix(2)|endometrium(3)|kidney(2)|large_intestine(10)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	46		all_cancers(4;0.0442)|Myeloproliferative disorder(11;0.0426)				GCAGGTCTTTCAGGTTCTGCT	0.478																																																	0													169.0	142.0	151.0					18																	346689		2203	4300	6503	SO:0001819	synonymous_variant	0			AB038518	CCDS32782.1	18p11.32	2013-09-19			ENSG00000158270	ENSG00000158270		"""Collectins"""	16016	protein-coding gene	gene with protein product		607621				11162630	Standard	NM_130386		Approved	SRCL, CL-P1, SCARA4	uc002kkm.3	Q5KU26	OTTHUMG00000178145	ENST00000400256.3:c.933G>T	18.37:g.346689C>A			Q6P9F2|Q8TCR2|Q8WZA4|Q9BY85|Q9BYH7	Silent	SNP	pfam_C-type_lectin,pfam_Collagen,superfamily_C-type_lectin_fold,smart_C-type_lectin,prints_AntifreezeII,pfscan_C-type_lectin	p.L311	ENST00000400256.3	37	c.933	CCDS32782.1	18																																																																																			COLEC12	-	NULL	ENSG00000158270		0.478	COLEC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COLEC12	HGNC	protein_coding	OTTHUMT00000440746.1	-	0.00	54	0	C			346689	-1	tier1	-	no_errors	ENST00000400256	ensembl	human	known	74_37	silent	20.00	60	15	SNP	1.000	A
COPS5	10987	genome.wustl.edu	37	8	67976567	67976567	+	5'Flank	SNP	C	C	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr8:67976567C>A	ENST00000357849.4	-	0	0				CSPP1_ENST00000262210.5_5'Flank|CSPP1_ENST00000412460.1_5'Flank|COPS5_ENST00000519963.1_Intron|COPS5_ENST00000517736.1_Intron	NM_006837.2	NP_006828.2	Q92905	CSN5_HUMAN	COP9 signalosome subunit 5						cullin deneddylation (GO:0010388)|exosomal secretion (GO:1990182)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein deneddylation (GO:0000338)|protein deubiquitination (GO:0016579)|regulation of cell cycle (GO:0051726)|regulation of JNK cascade (GO:0046328)|transcription from RNA polymerase II promoter (GO:0006366)|translation (GO:0006412)|translational initiation (GO:0006413)	cell junction (GO:0030054)|COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|eukaryotic translation initiation factor 3 complex (GO:0005852)|nucleus (GO:0005634)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|transcription coactivator activity (GO:0003713)|translation initiation factor activity (GO:0003743)|ubiquitin-specific protease activity (GO:0004843)			endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|skin(3)	14	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00389)|OV - Ovarian serous cystadenocarcinoma(28;0.00691)|all cancers(69;0.0205)|BRCA - Breast invasive adenocarcinoma(89;0.153)			GGGCCGTACCCGGCGGTTGGC	0.731											OREG0018811	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0																																										SO:0001631	upstream_gene_variant	0			U65928	CCDS6198.1	8q13.1	2013-03-14	2013-03-14		ENSG00000121022	ENSG00000121022			2240	protein-coding gene	gene with protein product		604850	"""COP9 (constitutive photomorphogenic, Arabidopsis, homolog) subunit 5"", ""COP9 constitutive photomorphogenic homolog subunit 5 (Arabidopsis)"""			8837781, 9341143	Standard	NM_006837		Approved	JAB1, SGN5, MOV-34, CSN5	uc003xxe.3	Q92905	OTTHUMG00000164563		8.37:g.67976567C>A	Exception_encountered	1103	O15386|Q6AW95|Q86WQ4|Q9BQ17	RNA	SNP	-	NULL	ENST00000357849.4	37	NULL	CCDS6198.1	8																																																																																			COPS5	-	-	ENSG00000121022		0.731	COPS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COPS5	HGNC	protein_coding	OTTHUMT00000379245.2	-	0.00	31	0	C			67976567	-1	tier1	-	no_errors	ENST00000517793	ensembl	human	putative	74_37	rna	31.91	32	15	SNP	0.000	A
CRHR1	1394	genome.wustl.edu	37	17	43907863	43907863	+	Nonsense_Mutation	SNP	C	C	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr17:43907863C>A	ENST00000398285.3	+	8	723	c.723C>A	c.(721-723)taC>taA	p.Y241*	CRHR1_ENST00000352855.5_Nonsense_Mutation_p.Y172*|CRHR1_ENST00000577353.1_Nonsense_Mutation_p.Y212*|CRHR1_ENST00000339069.5_Nonsense_Mutation_p.Y111*|CRHR1_ENST00000293493.7_Nonsense_Mutation_p.Y37*|CRHR1_ENST00000314537.5_Nonsense_Mutation_p.Y212*	NM_001145146.1	NP_001138618.1	P34998	CRFR1_HUMAN	corticotropin releasing hormone receptor 1	241					activation of adenylate cyclase activity (GO:0007190)|adrenal gland development (GO:0030325)|behavioral response to cocaine (GO:0048148)|behavioral response to ethanol (GO:0048149)|behavioral response to pain (GO:0048266)|cellular response to corticotropin-releasing hormone stimulus (GO:0071376)|corticotropin secretion (GO:0051458)|epithelial cell differentiation (GO:0030855)|fear response (GO:0042596)|female pregnancy (GO:0007565)|general adaptation syndrome, behavioral process (GO:0051867)|hypothalamus development (GO:0021854)|immune response (GO:0006955)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of feeding behavior (GO:2000252)|negative regulation of neuron death (GO:1901215)|negative regulation of voltage-gated calcium channel activity (GO:1901386)|neuropeptide signaling pathway (GO:0007218)|parturition (GO:0007567)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of mast cell degranulation (GO:0043306)|regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010578)|regulation of corticosterone secretion (GO:2000852)|response to hypoxia (GO:0001666)|response to immobilization stress (GO:0035902)|visual learning (GO:0008542)	apical part of cell (GO:0045177)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)|vesicle (GO:0031982)	corticotrophin-releasing factor receptor activity (GO:0015056)|corticotropin-releasing hormone binding (GO:0051424)|corticotropin-releasing hormone receptor activity (GO:0043404)			NS(1)|breast(1)|endometrium(1)|large_intestine(4)|lung(15)|pancreas(1)|skin(1)	24	Colorectal(2;0.0416)			BRCA - Breast invasive adenocarcinoma(366;0.161)		AGGGCTGCTACCTGCACACAG	0.612																																					Ovarian(110;57 1568 10207 38216 49865)												0													95.0	98.0	97.0					17																	43907863		2202	4300	6502	SO:0001587	stop_gained	0			L23332	CCDS42350.1, CCDS45712.1, CCDS45713.1, CCDS45714.1	17q12-q22	2012-08-14			ENSG00000120088	ENSG00000120088		"""GPCR / Class B : Corticotropin-releasing factor receptors"""	2357	protein-coding gene	gene with protein product	"""corticotropin-releasing factor receptor"""	122561		CRHR		7590738	Standard	NM_004382		Approved	CRF-R, CRF1	uc010dap.3	P34998		ENST00000398285.3:c.723C>A	17.37:g.43907863C>A	ENSP00000381333:p.Tyr241*		B4DIE9|Q13008|Q4QRJ1|Q9UK64	Nonsense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_CRF_rcpt,prints_GPCR_2_secretin-like,prints_GPCR_2_CRF1_rcpt,prints_GPCR_2_diuretic_rcpt	p.Y241*	ENST00000398285.3	37	c.723	CCDS45712.1	17	.	.	.	.	.	.	.	.	.	.	C	36	5.635093	0.96682	.	.	ENSG00000120088	ENST00000293493;ENST00000339069;ENST00000398285;ENST00000314537;ENST00000347197;ENST00000352855	.	.	.	5.27	4.3	0.51218	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.5921	0.50951	0.0:0.9125:0.0:0.0875	.	.	.	.	X	37;111;241;212;212;172	.	ENSP00000293493:Y37X	Y	+	3	2	CRHR1	41263644	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.689000	0.46993	1.214000	0.43395	0.561000	0.74099	TAC	CRHR1	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	ENSG00000120088		0.612	CRHR1-001	KNOWN	basic|CCDS	protein_coding	CRHR1	HGNC	protein_coding	OTTHUMT00000441241.3	-	0.00	26	0	C			43907863	+1	tier1	-	no_errors	ENST00000398285	ensembl	human	known	74_37	nonsense	38.24	21	13	SNP	1.000	A
CRNKL1	51340	genome.wustl.edu	37	20	20024186	20024186	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr20:20024186C>G	ENST00000377340.2	-	8	1436	c.1405G>C	c.(1405-1407)Gaa>Caa	p.E469Q	CRNKL1_ENST00000536226.1_Missense_Mutation_p.E308Q|CRNKL1_ENST00000377327.4_Missense_Mutation_p.E457Q	NM_001278628.1|NM_016652.4	NP_001265557.1|NP_057736.4	Q9BZJ0	CRNL1_HUMAN	crooked neck pre-mRNA splicing factor 1	469	Mediates interaction with HSP90. {ECO:0000250|UniProtKB:P63154}.				mRNA splicing, via spliceosome (GO:0000398)|spliceosomal complex assembly (GO:0000245)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(2)|cervix(2)|endometrium(7)|large_intestine(11)|lung(12)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(6)	45						ATGATATCTTCAATACCCCGC	0.418																																																	0													178.0	161.0	167.0					20																	20024186		2203	4300	6503	SO:0001583	missense	0			AF255443	CCDS33446.1, CCDS63238.1, CCDS63239.1	20p11.2	2013-10-03	2013-10-03		ENSG00000101343	ENSG00000101343			15762	protein-coding gene	gene with protein product	"""SYF3 pre-mRNA-splicing factor"""	610952	"""crooked neck (Drosophila Crn homolog)-like 1"", ""Crn, crooked neck-like 1 (Drosophila)"", ""crooked neck pre-mRNA splicing factor-like 1 (Drosophila)"""				Standard	NM_016652		Approved	CRN, CLF, SYF3, Clf1	uc002wrs.3	Q9BZJ0	OTTHUMG00000032000	ENST00000377340.2:c.1405G>C	20.37:g.20024186C>G	ENSP00000366557:p.Glu469Gln		A8K9T4|Q5JY64|Q8WYI5|Q9BZI9|Q9BZJ1|Q9BZJ2|Q9GZW7|Q9H8F8|Q9NQH5|Q9NYD8	Missense_Mutation	SNP	pfam_HAT,pfam_Suf,smart_HAT,pfscan_TPR-contain_dom	p.E469Q	ENST00000377340.2	37	c.1405	CCDS33446.1	20	.	.	.	.	.	.	.	.	.	.	C	32	5.176502	0.94846	.	.	ENSG00000101343	ENST00000377327;ENST00000377340;ENST00000536226	T;T;T	0.37058	1.22;1.22;1.22	6.07	6.07	0.98685	.	0.042365	0.85682	D	0.000000	T	0.62245	0.2412	H	0.95917	3.74	0.80722	D	1	P	0.49783	0.928	P	0.44990	0.466	T	0.75906	-0.3152	10	0.87932	D	0	-13.0498	20.6439	0.99570	0.0:1.0:0.0:0.0	.	469	Q9BZJ0	CRNL1_HUMAN	Q	457;469;308	ENSP00000366544:E457Q;ENSP00000366557:E469Q;ENSP00000440733:E308Q	ENSP00000366544:E457Q	E	-	1	0	CRNKL1	19972186	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.770000	0.85390	2.884000	0.98904	0.655000	0.94253	GAA	CRNKL1	-	NULL	ENSG00000101343		0.418	CRNKL1-002	KNOWN	basic|CCDS	protein_coding	CRNKL1	HGNC	protein_coding	OTTHUMT00000127787.1	-	0.00	43	0	C			20024186	-1	tier1	-	no_errors	ENST00000377340	ensembl	human	known	74_37	missense	45.45	36	30	SNP	1.000	G
CSE1L	1434	genome.wustl.edu	37	20	47704604	47704604	+	Silent	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr20:47704604C>T	ENST00000262982.2	+	17	1905	c.1782C>T	c.(1780-1782)ctC>ctT	p.L594L	CSE1L_ENST00000396192.3_Silent_p.L538L|CSE1L_ENST00000542325.1_Silent_p.L377L	NM_001256135.1|NM_001316.3	NP_001243064.1|NP_001307.2	P55060	XPO2_HUMAN	CSE1 chromosome segregation 1-like (yeast)	594					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	importin-alpha export receptor activity (GO:0008262)			breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(11)|ovary(1)|prostate(3)|skin(2)|urinary_tract(2)	35			BRCA - Breast invasive adenocarcinoma(12;0.000491)|Colorectal(8;0.198)			TCCCTACTCTCATCACTCAGC	0.368																																																	0													95.0	92.0	93.0					20																	47704604		2203	4300	6503	SO:0001819	synonymous_variant	0			U33286	CCDS13412.1, CCDS58773.1	20q13	2013-05-01	2001-11-28		ENSG00000124207	ENSG00000124207		"""Exportins"""	2431	protein-coding gene	gene with protein product	"""cellular apoptosis susceptibility"""	601342	"""chromosome segregation 1 (yeast homolog)-like"""			8963895, 7479798	Standard	NM_001316		Approved	CAS, XPO2, CSE1	uc002xty.4	P55060	OTTHUMG00000033046	ENST00000262982.2:c.1782C>T	20.37:g.47704604C>T			A3RLL6|B2R5T4|E1P5Y0|F8W904|O75432|Q32M40|Q9H5B7|Q9NTS0|Q9UP98|Q9UP99|Q9UPA0	Silent	SNP	pfam_CAS_CSE1_C,pfam_Cse1,pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.L594	ENST00000262982.2	37	c.1782	CCDS13412.1	20																																																																																			CSE1L	-	pfam_CAS_CSE1_C,superfamily_ARM-type_fold	ENSG00000124207		0.368	CSE1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSE1L	HGNC	protein_coding	OTTHUMT00000080345.2	-	0.00	59	0	C	NM_001316		47704604	+1	tier1	-	no_errors	ENST00000262982	ensembl	human	known	74_37	silent	16.00	63	12	SNP	0.988	T
CSNK2A3	283106	genome.wustl.edu	37	11	11374595	11374595	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr11:11374595C>G	ENST00000528848.2	-	1	309	c.72G>C	c.(70-72)tgG>tgC	p.W24C	RP11-567I13.1_ENST00000526867.1_RNA|GALNT18_ENST00000227756.4_Intron	NM_001256686.1	NP_001243615.1	Q8NEV1	CSK23_HUMAN	casein kinase 2, alpha 3 polypeptide	24					positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein catabolic process (GO:0045732)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)		ATP binding (GO:0005524)|protein phosphatase regulator activity (GO:0019888)|protein serine/threonine kinase activity (GO:0004674)										ACTCGTAATCCCAGTATTCTC	0.483																																																	0																																										SO:0001583	missense	0			X64692	CCDS59224.1	11p15.3	2013-01-18	2013-01-17	2013-01-17	ENSG00000254598	ENSG00000254598			2458	protein-coding gene	gene with protein product			"""casein kinase 2, alpha 1 polypeptide pseudogene"""	CSNK2A1P		12102635, 1610905, 20625391	Standard	NM_001256686		Approved		uc001mjp.4	Q8NEV1	OTTHUMG00000165708	ENST00000528848.2:c.72G>C	11.37:g.11374595C>G	ENSP00000473553:p.Trp24Cys			Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Aminoglycoside_PTrfase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.W24C	ENST00000528848.2	37	c.72	CCDS59224.1	11																																																																																			CSNK2A3	-	superfamily_Kinase-like_dom	ENSG00000254598		0.483	CSNK2A3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	CSNK2A3	HGNC	protein_coding	OTTHUMT00000385850.3	-	0.00	93	0	C	NM_001256686		11374595	-1	tier1	-	no_errors	ENST00000528848	ensembl	human	novel	74_37	missense	13.73	88	14	SNP	1.000	G
CSPG4	1464	genome.wustl.edu	37	15	75969636	75969636	+	Missense_Mutation	SNP	G	G	T	rs182397893		TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr15:75969636G>T	ENST00000308508.5	-	10	5316	c.5224C>A	c.(5224-5226)Cgc>Agc	p.R1742S	CTD-2026K11.1_ENST00000569467.1_RNA|AC105020.1_ENST00000435356.1_5'Flank	NM_001897.4	NP_001888.2	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4	1742	Cysteine-containing.|Neurite growth inhibition. {ECO:0000250}.				activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|intracellular signal transduction (GO:0035556)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|small molecule metabolic process (GO:0044281)|tissue remodeling (GO:0048771)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell projection (GO:0042995)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(3)|liver(2)|lung(18)|ovary(2)|pancreas(2)|prostate(4)|skin(4)	48						TGCTCTGAGCGCTGGGGTGAT	0.662																																																	0													16.0	13.0	14.0					15																	75969636		2180	4281	6461	SO:0001583	missense	0			X96753, AY359468	CCDS10284.1	15q24.2	2010-04-19	2007-02-16		ENSG00000173546	ENSG00000173546		"""Proteoglycans / Cell surface : Other"""	2466	protein-coding gene	gene with protein product	"""melanoma-associated chondroitin sulfate proteoglycan"""	601172	"""chondroitin sulfate proteoglycan 4 (melanoma-associated)"""			8790396, 16407841	Standard	NM_001897		Approved	MCSPG, MEL-CSPG, MSK16, NG2, MCSP, HMW-MAA	uc002baw.3	Q6UVK1	OTTHUMG00000142836	ENST00000308508.5:c.5224C>A	15.37:g.75969636G>T	ENSP00000312506:p.Arg1742Ser		D3DW77|Q92675	Missense_Mutation	SNP	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G	p.R1742S	ENST00000308508.5	37	c.5224	CCDS10284.1	15	.	.	.	.	.	.	.	.	.	.	G	10.62	1.401628	0.25291	.	.	ENSG00000173546	ENST00000308508	T	0.20200	2.09	5.39	4.41	0.53225	.	0.000000	0.64402	D	0.000013	T	0.32793	0.0841	M	0.68952	2.095	0.54753	D	0.999989	D	0.58620	0.983	P	0.57679	0.825	T	0.07927	-1.0747	10	0.08381	T	0.77	.	12.1167	0.53870	0.0:0.0:0.73:0.27	.	1742	Q6UVK1	CSPG4_HUMAN	S	1742	ENSP00000312506:R1742S	ENSP00000312506:R1742S	R	-	1	0	CSPG4	73756691	0.737000	0.28175	0.739000	0.30968	0.054000	0.15201	1.070000	0.30653	2.517000	0.84864	0.561000	0.74099	CGC	CSPG4	-	NULL	ENSG00000173546		0.662	CSPG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSPG4	HGNC	protein_coding	OTTHUMT00000286472.1	-	0.00	71	0	G	NM_001897		75969636	-1	tier1	-	no_errors	ENST00000308508	ensembl	human	known	74_37	missense	8.51	43	4	SNP	0.980	T
CTAGE9	643854	genome.wustl.edu	37	6	132030636	132030636	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr6:132030636C>G	ENST00000314099.8	-	1	1570	c.1522G>C	c.(1522-1524)Gat>Cat	p.D508H	ENPP3_ENST00000414305.1_Intron|ENPP3_ENST00000358229.5_Intron|ENPP3_ENST00000357639.3_Intron	NM_001145659.1|NM_001278507.1	NP_001139131.1|NP_001265436.1	A4FU28	CTGE9_HUMAN	CTAGE family, member 9	508						integral component of membrane (GO:0016021)				endometrium(1)|lung(1)	2						TTTGAAACATCGAGTGCATTA	0.393																																																	0													17.0	18.0	18.0					6																	132030636		692	1591	2283	SO:0001583	missense	0				CCDS47475.1	6q23.2	2010-06-23			ENSG00000236761	ENSG00000236761			37275	protein-coding gene	gene with protein product							Standard	NM_001145659		Approved		uc011ece.2	A4FU28	OTTHUMG00000047966	ENST00000314099.8:c.1522G>C	6.37:g.132030636C>G	ENSP00000395587:p.Asp508His			Missense_Mutation	SNP	NULL	p.D508H	ENST00000314099.8	37	c.1522	CCDS47475.1	6	.	.	.	.	.	.	.	.	.	.	-	8.739	0.918622	0.17982	.	.	ENSG00000236761	ENST00000314099	T	0.38560	1.13	.	.	.	.	.	.	.	.	T	0.43255	0.1239	M	0.84773	2.715	0.09310	N	1	P	0.49185	0.92	P	0.54401	0.751	T	0.24048	-1.0171	6	0.72032	D	0.01	.	.	.	.	.	508	A4FU28	CTGE9_HUMAN	H	508	ENSP00000395587:D508H	ENSP00000395587:D508H	D	-	1	0	CTAGE9	132072329	1.000000	0.71417	.	.	.	.	2.108000	0.41854	.	.	.	.	GAT	CTAGE9	-	NULL	ENSG00000236761		0.393	CTAGE9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTAGE9	HGNC	protein_coding	OTTHUMT00000109220.1	-	0.00	113	0	C	NM_001145659		132030636	-1	tier1	-	no_errors	ENST00000314099	ensembl	human	known	74_37	missense	21.82	129	36	SNP	0.000	G
CWC22	57703	genome.wustl.edu	37	2	180846701	180846701	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr2:180846701C>G	ENST00000410053.3	-	5	529	c.230G>C	c.(229-231)aGa>aCa	p.R77T	CWC22_ENST00000295749.6_Missense_Mutation_p.R77T	NM_020943.2	NP_065994.1	Q9HCG8	CWC22_HUMAN	CWC22 spliceosome-associated protein	77	Arg-rich.				mRNA splicing, via spliceosome (GO:0000398)|regulation of mRNA splicing, via spliceosome (GO:0048024)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	RNA binding (GO:0003723)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(7)|kidney(2)|large_intestine(8)|liver(1)|lung(8)|stomach(1)	30						ttctctttctctgcgtttttc	0.408																																																	0													46.0	44.0	44.0					2																	180846701		1751	3943	5694	SO:0001583	missense	0				CCDS46465.1	2q31.3	2014-07-03	2014-07-03		ENSG00000163510	ENSG00000163510			29322	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein b"""	615186	"""CWC22 spliceosome-associated protein homolog (S. cerevisiae)"""			9136012, 23236153	Standard	NM_020943		Approved	KIAA1604, EIF4GL, fSAPb, NCM	uc010frh.1	Q9HCG8	OTTHUMG00000154244	ENST00000410053.3:c.230G>C	2.37:g.180846701C>G	ENSP00000387006:p.Arg77Thr		Q05DC2|Q4G135|Q52LF0|Q6PEX2|Q7Z6I0|Q9H5L3|Q9H6Q6	Missense_Mutation	SNP	pfam_MIF4G-like_typ-3,pfam_Initiation_fac_eIF4g_MI,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3,smart_Initiation_fac_eIF4g_MI	p.R77T	ENST00000410053.3	37	c.230	CCDS46465.1	2	.	.	.	.	.	.	.	.	.	.	C	13.24	2.178230	0.38511	.	.	ENSG00000163510	ENST00000410053;ENST00000295749;ENST00000404136	T;T;T	0.29655	1.56;1.56;1.56	5.45	4.58	0.56647	.	0.292761	0.35067	N	0.003464	T	0.30448	0.0765	M	0.66939	2.045	0.33880	D	0.636057	B	0.22276	0.067	B	0.12837	0.008	T	0.38286	-0.9668	10	0.39692	T	0.17	-13.5108	9.7082	0.40229	0.0:0.8355:0.0:0.1645	.	77	Q9HCG8	CWC22_HUMAN	T	77	ENSP00000387006:R77T;ENSP00000295749:R77T;ENSP00000384159:R77T	ENSP00000295749:R77T	R	-	2	0	CWC22	180554946	0.996000	0.38824	1.000000	0.80357	0.933000	0.57130	1.462000	0.35266	1.295000	0.44724	0.650000	0.86243	AGA	CWC22	-	NULL	ENSG00000163510		0.408	CWC22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CWC22	HGNC	protein_coding	OTTHUMT00000334537.1		0.00	21	0	C	NM_020943		180846701	-1			no_errors	ENST00000295749	ensembl	human	known	74_37	missense	16.00	21	4	SNP	1.000	G
CYB5A	1528	genome.wustl.edu	37	18	71920820	71920820	+	Nonstop_Mutation	SNP	C	C	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr18:71920820C>A	ENST00000340533.4	-	5	544	c.404G>T	c.(403-405)tGa>tTa	p.*135L	CYB5A_ENST00000299438.9_Nonstop_Mutation_p.*61L|CYB5A_ENST00000579064.1_5'UTR|CYB5A_ENST00000494131.2_3'UTR|CYB5A_ENST00000397914.4_Nonstop_Mutation_p.*125L	NM_148923.3	NP_683725.1	P00167	CYB5_HUMAN	cytochrome b5 type A (microsomal)	0					hydrogen ion transmembrane transport (GO:1902600)|L-ascorbic acid metabolic process (GO:0019852)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)	aldo-keto reductase (NADP) activity (GO:0004033)|cytochrome-c oxidase activity (GO:0004129)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(1)|lung(1)|skin(1)	4		Esophageal squamous(42;0.0749)|Prostate(75;0.157)|Melanoma(33;0.211)				AGGAGGTGTTCAGTCCTCTGC	0.498																																					NSCLC(176;1530 2076 2606 27426 50572)|Ovarian(151;328 1870 2837 37860 52175)												0													70.0	61.0	64.0					18																	71920820		2203	4300	6503	SO:0001578	stop_lost	0			M22865	CCDS12004.1, CCDS12005.1, CCDS54188.1	18q23	2006-01-30	2006-01-30	2006-01-30	ENSG00000166347	ENSG00000166347		"""Cytochrome b genes"""	2570	protein-coding gene	gene with protein product		613218	"""cytochrome b-5"", ""cytochrome b5 (microsomal)"""	CYB5		1840560	Standard	NM_148923		Approved		uc002lli.3	P00167	OTTHUMG00000132843	ENST00000340533.4:c.404G>T	18.37:g.71920820C>A			A8MV91|F8WEU4|Q6IB14	Nonstop_Mutation	SNP	pfam_Cyt_B5-like_heme/steroid-bd,superfamily_Cyt_B5-like_heme/steroid-bd,pfscan_Cyt_B5-like_heme/steroid-bd,prints_Cyt_B5-like_heme/steroid-bd	p.*135L	ENST00000340533.4	37	c.404	CCDS12004.1	18	.	.	.	.	.	.	.	.	.	.	C	3.108	-0.183323	0.06340	.	.	ENSG00000166347	ENST00000397914;ENST00000340533	.	.	.	5.62	0.931	0.19460	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.9356	0.19163	0.1521:0.1238:0.0:0.724	.	.	.	.	L	125;135	.	.	X	-	2	2	CYB5A	70071800	0.644000	0.27277	0.009000	0.14445	0.003000	0.03518	1.426000	0.34870	-0.062000	0.13088	-0.140000	0.14226	TGA	CYB5A	-	NULL	ENSG00000166347		0.498	CYB5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYB5A	HGNC	protein_coding	OTTHUMT00000256316.1	-	0.00	30	0	C	NM_001914, NM_148923		71920820	-1	tier1	-	no_errors	ENST00000340533	ensembl	human	known	74_37	nonstop	24.24	25	8	SNP	0.054	A
CYFIP2	26999	genome.wustl.edu	37	5	156752515	156752515	+	Silent	SNP	C	C	G	rs367974123		TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr5:156752515C>G	ENST00000521420.1	+	16	1864	c.1773C>G	c.(1771-1773)ctC>ctG	p.L591L	CYFIP2_ENST00000442283.2_5'UTR|CYFIP2_ENST00000522463.1_Silent_p.L421L|CYFIP2_ENST00000541131.1_Silent_p.L542L|CYFIP2_ENST00000435847.2_Silent_p.L316L|CYFIP2_ENST00000347377.6_Silent_p.L617L|CYFIP2_ENST00000318218.6_Silent_p.L642L|CYFIP2_ENST00000520960.1_3'UTR|CYFIP2_ENST00000377576.3_Silent_p.L617L					cytoplasmic FMR1 interacting protein 2											breast(1)|endometrium(12)|kidney(2)|lung(23)	38	Renal(175;0.00212)	Medulloblastoma(196;0.0306)|all_neural(177;0.0897)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GTTGTGACCTCTCCCAGCTCT	0.458																																																	0								C	,,	0,4112		0,0,2056	71.0	71.0	71.0		1851,1851,1851	-2.4	1.0	5		71	1,8463		0,1,4231	no	coding-synonymous,coding-synonymous,coding-synonymous	CYFIP2	NM_001037332.2,NM_001037333.1,NM_014376.2	,,	0,1,6287	GG,GC,CC		0.0118,0.0,0.0080	,,	617/1254,617/1254,617/1254	156752515	1,12575	2056	4232	6288	SO:0001819	synonymous_variant	0			AF160973	CCDS75364.1	5q34	2008-07-18				ENSG00000055163			13760	protein-coding gene	gene with protein product	"""p53 inducible protein"""	606323				11438699	Standard	NM_001037333		Approved	PIR121	uc021ygm.1	Q96F07		ENST00000521420.1:c.1773C>G	5.37:g.156752515C>G				Silent	SNP	pfam_Cytoplasmic_FMR1-int,pirsf_Cytoplasmic_FMR1-int_sub,prints_Cytoplasmic_FMR1-int	p.L642	ENST00000521420.1	37	c.1926		5																																																																																			CYFIP2	-	pfam_Cytoplasmic_FMR1-int,pirsf_Cytoplasmic_FMR1-int_sub,prints_Cytoplasmic_FMR1-int	ENSG00000055163		0.458	CYFIP2-001	NOVEL	basic	protein_coding	CYFIP2	HGNC	protein_coding	OTTHUMT00000373710.1	-	0.00	49	0	C	NM_001037332		156752515	+1	tier1	-	no_errors	ENST00000318218	ensembl	human	known	74_37	silent	20.51	62	16	SNP	0.963	G
CYLC1	1538	genome.wustl.edu	37	X	83128291	83128291	+	Nonsense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chrX:83128291C>G	ENST00000329312.4	+	4	612	c.575C>G	c.(574-576)tCa>tGa	p.S192*		NM_021118.1	NP_066941.1	P35663	CYLC1_HUMAN	cylicin, basic protein of sperm head cytoskeleton 1	192					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	acrosomal matrix (GO:0043159)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	58						AAGACAGTCTCAAAAAATTGT	0.308																																																	0													26.0	25.0	26.0					X																	83128291		2176	4261	6437	SO:0001587	stop_gained	0			Z22780	CCDS35341.1, CCDS75998.1	Xq21.1	2008-07-31			ENSG00000183035	ENSG00000183035			2582	protein-coding gene	gene with protein product	"""cylicin 1"""	300768				7737358, 8354692	Standard	NM_021118		Approved		uc004eei.2	P35663	OTTHUMG00000021922	ENST00000329312.4:c.575C>G	X.37:g.83128291C>G	ENSP00000331556:p.Ser192*		A0AVQ8|Q5JQQ9	Nonsense_Mutation	SNP	NULL	p.S192*	ENST00000329312.4	37	c.575	CCDS35341.1	X	.	.	.	.	.	.	.	.	.	.	c	14.87	2.664625	0.47572	.	.	ENSG00000183035	ENST00000329312;ENST00000544771	.	.	.	4.08	-0.246	0.13022	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.23302	T	0.38	0.1191	6.787	0.23679	0.0:0.3849:0.0:0.6151	.	.	.	.	X	192	.	ENSP00000331556:S192X	S	+	2	0	CYLC1	83014947	0.008000	0.16893	0.000000	0.03702	0.024000	0.10985	0.086000	0.14935	-0.193000	0.10415	0.513000	0.50165	TCA	CYLC1	-	NULL	ENSG00000183035		0.308	CYLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYLC1	HGNC	protein_coding	OTTHUMT00000057371.1	-	0.00	34	0	C	NM_021118		83128291	+1	tier1	-	no_errors	ENST00000329312	ensembl	human	known	74_37	nonsense	39.06	38	25	SNP	0.000	G
CYLC1	1538	genome.wustl.edu	37	X	83129461	83129461	+	Nonsense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chrX:83129461C>G	ENST00000329312.4	+	4	1782	c.1745C>G	c.(1744-1746)tCa>tGa	p.S582*		NM_021118.1	NP_066941.1	P35663	CYLC1_HUMAN	cylicin, basic protein of sperm head cytoskeleton 1	582					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	acrosomal matrix (GO:0043159)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	58						TTCAGAATGTCATCCAAAAAG	0.403																																																	0													62.0	55.0	57.0					X																	83129461		2201	4299	6500	SO:0001587	stop_gained	0			Z22780	CCDS35341.1, CCDS75998.1	Xq21.1	2008-07-31			ENSG00000183035	ENSG00000183035			2582	protein-coding gene	gene with protein product	"""cylicin 1"""	300768				7737358, 8354692	Standard	NM_021118		Approved		uc004eei.2	P35663	OTTHUMG00000021922	ENST00000329312.4:c.1745C>G	X.37:g.83129461C>G	ENSP00000331556:p.Ser582*		A0AVQ8|Q5JQQ9	Nonsense_Mutation	SNP	NULL	p.S582*	ENST00000329312.4	37	c.1745	CCDS35341.1	X	.	.	.	.	.	.	.	.	.	.	c	20.4	3.987247	0.74589	.	.	ENSG00000183035	ENST00000329312;ENST00000544771	.	.	.	3.75	0.377	0.16198	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	2.648	5.541	0.17038	0.0:0.4811:0.0:0.5189	.	.	.	.	X	582	.	ENSP00000331556:S582X	S	+	2	0	CYLC1	83016117	0.008000	0.16893	0.001000	0.08648	0.137000	0.21094	0.463000	0.21972	-0.041000	0.13558	-0.176000	0.13171	TCA	CYLC1	-	NULL	ENSG00000183035		0.403	CYLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYLC1	HGNC	protein_coding	OTTHUMT00000057371.1	-	0.00	18	0	C	NM_021118		83129461	+1	tier1	-	no_errors	ENST00000329312	ensembl	human	known	74_37	nonsense	35.00	26	14	SNP	0.001	G
CYP2C9	1559	genome.wustl.edu	37	10	96748714	96748714	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr10:96748714G>C	ENST00000260682.6	+	9	1414	c.1402G>C	c.(1402-1404)Gac>Cac	p.D468H		NM_000771.3	NP_000762.2	P11712	CP2C9_HUMAN	cytochrome P450, family 2, subfamily C, polypeptide 9	468					arachidonic acid metabolic process (GO:0019369)|cellular amide metabolic process (GO:0043603)|drug catabolic process (GO:0042737)|drug metabolic process (GO:0017144)|epoxygenase P450 pathway (GO:0019373)|exogenous drug catabolic process (GO:0042738)|monocarboxylic acid metabolic process (GO:0032787)|monoterpenoid metabolic process (GO:0016098)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|oxidative demethylation (GO:0070989)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|urea metabolic process (GO:0019627)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	(R)-limonene 6-monooxygenase activity (GO:0052741)|(S)-limonene 6-monooxygenase activity (GO:0018675)|(S)-limonene 7-monooxygenase activity (GO:0018676)|caffeine oxidase activity (GO:0034875)|drug binding (GO:0008144)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity (GO:0016491)|steroid hydroxylase activity (GO:0008395)			breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(9)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	34		Colorectal(252;0.0902)		all cancers(201;6.93e-05)	Acenocoumarol(DB01418)|Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Agomelatine(DB06594)|Alosetron(DB00969)|Alprazolam(DB00404)|Aminophenazone(DB01424)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amodiaquine(DB00613)|Amprenavir(DB00701)|Anastrozole(DB01217)|Antipyrine(DB01435)|Apixaban(DB06605)|Aprepitant(DB00673)|Arformoterol(DB01274)|Artemether(DB06697)|Atazanavir(DB01072)|Atorvastatin(DB01076)|Atovaquone(DB01117)|Azelastine(DB00972)|Bexarotene(DB00307)|Bicalutamide(DB01128)|Bortezomib(DB00188)|Bosentan(DB00559)|Brompheniramine(DB00835)|Buprenorphine(DB00921)|Bupropion(DB01156)|Cabozantinib(DB08875)|Caffeine(DB00201)|Candesartan(DB00796)|Capecitabine(DB01101)|Carbamazepine(DB00564)|Carbinoxamine(DB00748)|Carvedilol(DB01136)|Celecoxib(DB00482)|Chloramphenicol(DB00446)|Chlorpropamide(DB00672)|Cholecalciferol(DB00169)|Cimetidine(DB00501)|Cinnarizine(DB00568)|Cisapride(DB00604)|Cisplatin(DB00515)|Clevidipine(DB04920)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Cocaine(DB00907)|Colchicine(DB01394)|Cyclizine(DB01176)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dapagliflozin(DB06292)|Dapsone(DB00250)|Delavirdine(DB00705)|Desloratadine(DB00967)|Dexamethasone(DB01234)|Dexfenfluramine(DB01191)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diazepam(DB00829)|Diclofenac(DB00586)|Diclofenamide(DB01144)|Dicoumarol(DB00266)|Diethylstilbestrol(DB00255)|Diltiazem(DB00343)|Diphenhydramine(DB01075)|Disulfiram(DB00822)|Dolasetron(DB00757)|Donepezil(DB00843)|Dopamine(DB00988)|Dorzolamide(DB00869)|Doxepin(DB01142)|Dronabinol(DB00470)|Efavirenz(DB00625)|Eletriptan(DB00216)|Enzalutamide(DB08899)|Epinephrine(DB00668)|Epoprostenol(DB01240)|Eprosartan(DB00876)|Estradiol(DB00783)|Estrone(DB00655)|Estropipate(DB04574)|Eszopiclone(DB00402)|Ethanol(DB00898)|Etodolac(DB00749)|Etoricoxib(DB01628)|Etravirine(DB06414)|Felodipine(DB01023)|Fenofibrate(DB01039)|Flecainide(DB01195)|Fluconazole(DB00196)|Flunarizine(DB04841)|Flunitrazepam(DB01544)|Fluorouracil(DB00544)|Fluoxetine(DB00472)|Flurbiprofen(DB00712)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Formoterol(DB00983)|Fosphenytoin(DB01320)|Gefitinib(DB00317)|Gemfibrozil(DB01241)|Ginkgo biloba(DB01381)|Gliclazide(DB01120)|Glimepiride(DB00222)|Glipizide(DB01067)|Glyburide(DB01016)|Guanfacine(DB01018)|Haloperidol(DB00502)|Halothane(DB01159)|Hexobarbital(DB01355)|Histamine Phosphate(DB00667)|Human Serum Albumin(DB00062)|Hydromorphone(DB00327)|Ibuprofen(DB01050)|Idarubicin(DB01177)|Ifosfamide(DB01181)|Imatinib(DB00619)|Indinavir(DB00224)|Indomethacin(DB00328)|Irbesartan(DB01029)|Isoniazid(DB00951)|Ketamine(DB01221)|Ketobemidone(DB06738)|Ketoconazole(DB01026)|Ketoprofen(DB01009)|Lansoprazole(DB00448)|Leflunomide(DB01097)|Lidocaine(DB00281)|Lopinavir(DB01601)|Loratadine(DB00455)|Lornoxicam(DB06725)|Losartan(DB00678)|Lovastatin(DB00227)|Lumiracoxib(DB01283)|Medroxyprogesterone Acetate(DB00603)|Mefenamic acid(DB00784)|Melatonin(DB01065)|Meloxicam(DB00814)|Mestranol(DB01357)|Methadone(DB00333)|Methazolamide(DB00703)|Methimazole(DB00763)|Methoxyflurane(DB01028)|Metronidazole(DB00916)|Miconazole(DB01110)|Mirtazapine(DB00370)|Moclobemide(DB01171)|Modafinil(DB00745)|Montelukast(DB00471)|Naproxen(DB00788)|Nateglinide(DB00731)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Nicardipine(DB00622)|Niclosamide(DB06803)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nilutamide(DB00665)|Nilvadipine(DB06712)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Omeprazole(DB00338)|Ondansetron(DB00904)|Ospemifene(DB04938)|Oxaprozin(DB00991)|Paclitaxel(DB01229)|Pantoprazole(DB00213)|Paramethadione(DB00617)|Paroxetine(DB00715)|Perphenazine(DB00850)|Phenobarbital(DB01174)|Phenprocoumon(DB00946)|Phentermine(DB00191)|Phenylbutazone(DB00812)|Phenytoin(DB00252)|Pioglitazone(DB01132)|Piroxicam(DB00554)|Pitavastatin(DB08860)|Pranlukast(DB01411)|Prasugrel(DB06209)|Pravastatin(DB00175)|Primidone(DB00794)|Probenecid(DB01032)|Progesterone(DB00396)|Proguanil(DB01131)|Promazine(DB00420)|Promethazine(DB01069)|Propafenone(DB01182)|Propofol(DB00818)|Pyrimethamine(DB00205)|Quazepam(DB01589)|Quinidine(DB00908)|Quinine(DB00468)|Rabeprazole(DB01129)|Regorafenib(DB08896)|Rifampicin(DB01045)|Rifapentine(DB01201)|Ritonavir(DB00503)|Rosiglitazone(DB00412)|Rosuvastatin(DB01098)|Salicylic acid(DB00936)|Saquinavir(DB01232)|Secobarbital(DB00418)|Selegiline(DB01037)|Sertraline(DB01104)|Sildenafil(DB00203)|Simvastatin(DB00641)|Sitaxentan(DB06268)|Sorafenib(DB00398)|Sulfadiazine(DB00359)|Sulfadimethoxine(DB06150)|Sulfamethizole(DB00576)|Sulfamethoxazole(DB01015)|Sulfamoxole(DB08798)|Sulfanilamide(DB00259)|Sulfaphenazole(DB06729)|Sulfapyridine(DB00891)|Sulfinpyrazone(DB01138)|Sulfisoxazole(DB00263)|Suprofen(DB00870)|Tamoxifen(DB00675)|Tapentadol(DB06204)|Temazepam(DB00231)|Teniposide(DB00444)|Tenoxicam(DB00469)|Terbinafine(DB00857)|Testosterone(DB00624)|Thalidomide(DB01041)|Theophylline(DB00277)|Thiamylal(DB01154)|Thioridazine(DB00679)|Ticlopidine(DB00208)|Tioconazole(DB01007)|Tolbutamide(DB01124)|Tolcapone(DB00323)|Tolterodine(DB01036)|Torasemide(DB00214)|Trabectedin(DB05109)|Tranylcypromine(DB00752)|Treprostinil(DB00374)|Tretinoin(DB00755)|Triazolam(DB00897)|Trimethadione(DB00347)|Trimethoprim(DB00440)|Trimipramine(DB00726)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Valsartan(DB00177)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vismodegib(DB08828)|Voriconazole(DB00582)|Warfarin(DB00682)|Ximelagatran(DB04898)|Zafirlukast(DB00549)|Zalcitabine(DB00943)|Zidovudine(DB00495)|Zileuton(DB00744)|Zolpidem(DB00425)|Zopiclone(DB01198)	AAAGAACCTTGACACCACTCC	0.502																																					Ovarian(54;1266 1406 16072 35076)												0													165.0	154.0	158.0					10																	96748714		2203	4300	6503	SO:0001583	missense	0			M61855	CCDS7437.1	10q24.1	2007-12-14	2003-01-14		ENSG00000138109	ENSG00000138109		"""Cytochrome P450s"""	2623	protein-coding gene	gene with protein product		601130	"""cytochrome P450, subfamily IIC (mephenytoin 4-hydroxylase), polypeptide 9"""	CYP2C10		2009263, 7841444	Standard	NM_000771		Approved	P450IIC9	uc001kka.4	P11712	OTTHUMG00000018805	ENST00000260682.6:c.1402G>C	10.37:g.96748714G>C	ENSP00000260682:p.Asp468His		P11713|Q16756|Q16872|Q5VX92|Q6IRV8|Q8WW80	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_B	p.D468H	ENST00000260682.6	37	c.1402	CCDS7437.1	10	.	.	.	.	.	.	.	.	.	.	G	12.46	1.943844	0.34283	.	.	ENSG00000138109	ENST00000260682	T	0.70399	-0.48	3.42	1.49	0.22878	.	0.152498	0.42294	U	0.000737	T	0.78679	0.4321	M	0.85542	2.76	0.09310	N	0.999991	D;D	0.69078	0.997;0.997	P;P	0.58721	0.844;0.844	T	0.68918	-0.5282	10	0.87932	D	0	.	5.6452	0.17586	0.3726:0.0:0.6274:0.0	.	468;468	Q5VX92;P11712	.;CP2C9_HUMAN	H	468	ENSP00000260682:D468H	ENSP00000260682:D468H	D	+	1	0	CYP2C9	96738704	0.761000	0.28439	0.003000	0.11579	0.091000	0.18340	1.009000	0.29886	0.261000	0.21753	0.453000	0.30009	GAC	CYP2C9	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000138109		0.502	CYP2C9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2C9	HGNC	protein_coding	OTTHUMT00000049501.1	-	0.00	67	0	G	NM_000771		96748714	+1	tier1	-	no_errors	ENST00000260682	ensembl	human	known	74_37	missense	9.09	90	9	SNP	0.117	C
DCAF17	80067	genome.wustl.edu	37	2	172336638	172336638	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr2:172336638G>C	ENST00000375255.3	+	13	1684	c.1357G>C	c.(1357-1359)Gat>Cat	p.D453H	DCAF17_ENST00000539783.1_Missense_Mutation_p.D386H|DCAF17_ENST00000468592.1_3'UTR	NM_025000.3	NP_079276.2	Q5H9S7	DCA17_HUMAN	DDB1 and CUL4 associated factor 17	453					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|prostate(1)	17						AGCTCACCTGGATTTCCACTG	0.393																																																	0													132.0	130.0	131.0					2																	172336638		2203	4300	6503	SO:0001583	missense	0			AK023158	CCDS2243.2, CCDS54419.1	2q31.1	2014-01-28	2009-07-17	2009-07-17	ENSG00000115827	ENSG00000115827		"""DDB1 and CUL4 associated factors"""	25784	protein-coding gene	gene with protein product	"""Woodhouse-Sakati syndrome"""	612515	"""chromosome 2 open reading frame 37"""	C2orf37			Standard	NM_001164821		Approved	FLJ13096	uc002ugx.3	Q5H9S7	OTTHUMG00000132259	ENST00000375255.3:c.1357G>C	2.37:g.172336638G>C	ENSP00000364404:p.Asp453His		B2RTW5|Q53TN3|Q9H908	Missense_Mutation	SNP	NULL	p.D453H	ENST00000375255.3	37	c.1357	CCDS2243.2	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.7|20.7	4.034281|4.034281	0.75617|0.75617	.|.	.|.	ENSG00000115827|ENSG00000115827	ENST00000375255;ENST00000539783;ENST00000429466|ENST00000339506;ENST00000431110	T;T|.	0.46063|.	0.88;0.89|.	5.96|5.96	5.96|5.96	0.96718|0.96718	.|.	0.272882|.	0.42294|.	D|.	0.000735|.	T|T	0.71693|0.71693	0.3370|0.3370	L|L	0.51422|0.51422	1.61|1.61	0.43803|0.43803	D|D	0.996356|0.996356	D;D|.	0.71674|.	0.998;0.998|.	D;P|.	0.67382|.	0.951;0.904|.	T|T	0.65713|0.65713	-0.6101|-0.6101	10|5	0.59425|.	D|.	0.04|.	-19.0493|-19.0493	20.4192|20.4192	0.99033|0.99033	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	386;453|.	F5H7W1;Q5H9S7|.	.;DCA17_HUMAN|.	H|C	453;386;203|203;154	ENSP00000364404:D453H;ENSP00000442238:D386H|.	ENSP00000364404:D453H|.	D|W	+|+	1|3	0|0	DCAF17|DCAF17	172044884|172044884	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	5.564000|5.564000	0.67359|0.67359	2.831000|2.831000	0.97527|0.97527	0.650000|0.650000	0.86243|0.86243	GAT|TGG	DCAF17	-	NULL	ENSG00000115827		0.393	DCAF17-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DCAF17	HGNC	protein_coding	OTTHUMT00000255342.2	-	0.00	72	0	G	NM_025000		172336638	+1	tier1	-	no_errors	ENST00000375255	ensembl	human	known	74_37	missense	20.69	46	12	SNP	1.000	C
DCLK1	9201	genome.wustl.edu	37	13	36410271	36410271	+	Silent	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr13:36410271C>T	ENST00000360631.3	-	8	1339	c.1128G>A	c.(1126-1128)tcG>tcA	p.S376S	DCLK1_ENST00000255448.4_Silent_p.S376S|DCLK1_ENST00000379893.1_Silent_p.S69S			O15075	DCLK1_HUMAN	doublecortin-like kinase 1	376					axon extension (GO:0048675)|central nervous system development (GO:0007417)|central nervous system projection neuron axonogenesis (GO:0021952)|dendrite morphogenesis (GO:0048813)|endosomal transport (GO:0016197)|forebrain development (GO:0030900)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein activity (GO:0005057)			breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(18)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(6)|urinary_tract(1)	64		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)		AGCCTTCCTCCGACACTTCTG	0.353																																																	0													192.0	183.0	186.0					13																	36410271		2203	4300	6503	SO:0001819	synonymous_variant	0			AB002367	CCDS9354.1, CCDS55895.1, CCDS73561.1	13q13.3	2008-02-05	2007-04-02	2007-04-02	ENSG00000133083	ENSG00000133083			2700	protein-coding gene	gene with protein product		604742	"""doublecortin and CaM kinase-like 1"""	DCAMKL1		9747029, 10036192	Standard	NM_004734		Approved	KIAA0369, DCLK, DCDC3A	uc001uvf.3	O15075	OTTHUMG00000016729	ENST00000360631.3:c.1128G>A	13.37:g.36410271C>T			B7Z3E9|Q5VZY8|Q5VZZ0|Q5VZZ1	Silent	SNP	pfam_Prot_kinase_dom,pfam_Doublecortin_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Doublecortin_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Doublecortin_dom,pfscan_Prot_kinase_dom	p.S376	ENST00000360631.3	37	c.1128		13																																																																																			DCLK1	-	superfamily_Kinase-like_dom	ENSG00000133083		0.353	DCLK1-010	KNOWN	basic	protein_coding	DCLK1	HGNC	protein_coding	OTTHUMT00000044487.1	-	0.00	64	0	C	NM_004734		36410271	-1	tier1	-	no_errors	ENST00000360631	ensembl	human	known	74_37	silent	11.11	72	9	SNP	0.917	T
WASH3P	374666	genome.wustl.edu	37	15	102516922	102516922	+	RNA	SNP	A	A	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr15:102516922A>C	ENST00000557932.1	+	0	1679				DDX11L9_ENST00000562189.1_RNA			C4AMC7	WASH3_HUMAN	WAS protein family homolog 3 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)			central_nervous_system(1)|endometrium(6)|kidney(11)|prostate(5)|stomach(1)|urinary_tract(1)	25						AGAGAAGGGCAGTCAGCAGGG	0.562																																																	0																																												0					15q26.3	2014-03-20	2008-01-16	2008-01-16	ENSG00000185596	ENSG00000185596		"""WAS protein homologs"""	24362	pseudogene	pseudogene			"""family with sequence similarity 39, member D pseudogene"""	FAM39DP		11701968, 18159949	Standard	NR_003659		Approved	FLJ25222	uc002cdi.3	C4AMC7	OTTHUMG00000172275		15.37:g.102516922A>C				RNA	SNP	-	NULL	ENST00000557932.1	37	NULL		15																																																																																			DDX11L9	-	-	ENSG00000248472		0.562	WASH3P-001	KNOWN	basic	processed_transcript	DDX11L9	HGNC	pseudogene	OTTHUMT00000417608.1	-	0.00	10	0	A	NM_199163		102516922	-1	tier1	-	no_errors	ENST00000559159	ensembl	human	known	74_37	rna	57.14	3	4	SNP	0.002	C
DDX21	9188	genome.wustl.edu	37	10	70734442	70734442	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr10:70734442G>C	ENST00000354185.4	+	11	1783	c.1685G>C	c.(1684-1686)cGa>cCa	p.R562P		NM_001256910.1|NM_004728.3	NP_001243839.1|NP_004719.2	Q9NR30	DDX21_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 21	562	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|osteoblast differentiation (GO:0001649)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(6)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	20						AAGTTCAAACGAATAGGTGTT	0.373																																																	0													94.0	89.0	91.0					10																	70734442		2203	4300	6503	SO:0001583	missense	0			U41387	CCDS31211.1, CCDS73144.1	10q21	2013-05-13	2012-02-23		ENSG00000165732	ENSG00000165732		"""DEAD-boxes"""	2744	protein-coding gene	gene with protein product		606357	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 21"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 21"""			8614622, 18180292	Standard	NM_004728		Approved	RH-II/GU, GURDB	uc001jov.2	Q9NR30	OTTHUMG00000018366	ENST00000354185.4:c.1685G>C	10.37:g.70734442G>C	ENSP00000346120:p.Arg562Pro		B2RDL0|Q13436|Q5VX41|Q68D35	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_GUCT,pfam_Helicase_C,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.R562P	ENST00000354185.4	37	c.1685	CCDS31211.1	10	.	.	.	.	.	.	.	.	.	.	G	26.2	4.716729	0.89205	.	.	ENSG00000165732	ENST00000354185	T	0.19105	2.17	5.64	5.64	0.86602	Helicase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.40743	0.1129	L	0.42529	1.33	0.80722	D	1	D	0.76494	0.999	D	0.70935	0.971	T	0.03325	-1.1048	10	0.42905	T	0.14	-55.3078	19.7127	0.96102	0.0:0.0:1.0:0.0	.	562	Q9NR30	DDX21_HUMAN	P	562	ENSP00000346120:R562P	ENSP00000346120:R562P	R	+	2	0	DDX21	70404448	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.749000	0.91619	2.652000	0.90054	0.655000	0.94253	CGA	DDX21	-	pfscan_Helicase_C	ENSG00000165732		0.373	DDX21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX21	HGNC	protein_coding	OTTHUMT00000048374.1	-	0.00	65	0	G	NM_004728		70734442	+1	tier1	-	no_errors	ENST00000354185	ensembl	human	known	74_37	missense	8.96	61	6	SNP	1.000	C
DDX24	57062	genome.wustl.edu	37	14	94545833	94545833	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr14:94545833C>G	ENST00000330836.5	-	2	387	c.256G>C	c.(256-258)Gag>Cag	p.E86Q	DDX24_ENST00000555054.1_Missense_Mutation_p.E43Q|IFI27L1_ENST00000393115.3_5'Flank|IFI27L1_ENST00000556381.1_5'Flank|IFI27L1_ENST00000553664.1_5'Flank|DDX24_ENST00000544005.1_Intron|IFI27L1_ENST00000557218.1_5'Flank|IFI27L1_ENST00000557066.1_5'Flank|IFI27L1_ENST00000555523.1_5'Flank|IFI27L1_ENST00000554544.1_5'Flank	NM_020414.3	NP_065147.1	Q9GZR7	DDX24_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 24	86	Poly-Glu.				RNA metabolic process (GO:0016070)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)			cervix(3)|endometrium(4)|kidney(4)|large_intestine(5)|lung(3)|ovary(2)|skin(1)|urinary_tract(1)	23		all_cancers(154;0.12)		Epithelial(152;0.114)|all cancers(159;0.19)|COAD - Colon adenocarcinoma(157;0.207)		TCCTCCTCCTCCTCTTCTTCT	0.438																																																	0													165.0	162.0	163.0					14																	94545833		2203	4300	6503	SO:0001583	missense	0			AF214731	CCDS9918.1	14q32	2013-07-16	2013-07-16			ENSG00000089737		"""DEAD-boxes"""	13266	protein-coding gene	gene with protein product		606181	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 24"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 24"""			10936056, 18289627	Standard	NM_020414		Approved		uc001ycj.3	Q9GZR7		ENST00000330836.5:c.256G>C	14.37:g.94545833C>G	ENSP00000328690:p.Glu86Gln		E7EMJ4|Q4V9L5	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.E86Q	ENST00000330836.5	37	c.256	CCDS9918.1	14	.	.	.	.	.	.	.	.	.	.	C	18.52	3.642011	0.67244	.	.	ENSG00000089737	ENST00000330836;ENST00000440370;ENST00000555054;ENST00000542247	T;T	0.03663	3.85;3.89	5.9	5.9	0.94986	.	0.654674	0.17078	N	0.187885	T	0.08714	0.0216	L	0.52573	1.65	0.32645	N	0.5202	D	0.56035	0.974	P	0.49140	0.601	T	0.02037	-1.1225	10	0.51188	T	0.08	-0.6288	15.5011	0.75700	0.1391:0.8609:0.0:0.0	.	86	Q9GZR7	DDX24_HUMAN	Q	86;86;43;43	ENSP00000328690:E86Q;ENSP00000452145:E43Q	ENSP00000328690:E86Q	E	-	1	0	DDX24	93615586	0.026000	0.19158	0.979000	0.43373	0.980000	0.70556	0.714000	0.25808	2.801000	0.96364	0.650000	0.86243	GAG	DDX24	-	NULL	ENSG00000089737		0.438	DDX24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX24	HGNC	protein_coding	OTTHUMT00000412861.1	-	0.00	22	0	C	NM_020414		94545833	-1	tier1	-	no_errors	ENST00000330836	ensembl	human	known	74_37	missense	20.00	16	4	SNP	0.903	G
DDX5	1655	genome.wustl.edu	37	17	62496429	62496429	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr17:62496429C>G	ENST00000225792.5	-	13	1858	c.1457G>C	c.(1456-1458)aGa>aCa	p.R486T	DDX5_ENST00000578804.1_Missense_Mutation_p.R486T|MIR3064_ENST00000581130.1_RNA|DDX5_ENST00000450599.2_Missense_Mutation_p.R407T|MIR5047_ENST00000579212.1_RNA|DDX5_ENST00000580026.1_5'UTR	NM_004396.3	NP_004387.1	P17844	DDX5_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 5	486	Transactivation domain.				cell growth (GO:0016049)|circadian rhythm (GO:0007623)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of osteoblast differentiation (GO:0045667)|regulation of skeletal muscle cell differentiation (GO:2001014)|regulation of viral genome replication (GO:0045069)|transcription, DNA-templated (GO:0006351)	catalytic step 2 spliceosome (GO:0071013)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|pre-mRNA binding (GO:0036002)|RNA helicase activity (GO:0003724)|transcription coactivator activity (GO:0003713)			breast(3)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)	19	Breast(5;2.15e-14)		BRCA - Breast invasive adenocarcinoma(8;8.6e-12)			CATGCCTCCTCTACCCCTGGA	0.418			T	ETV4	prostate																																NSCLC(22;406 813 4871 19580 40307)			Dom	yes		17	17q21	1655	DEAD (Asp-Glu-Ala-Asp) box polypeptide 5		E	0													71.0	72.0	71.0					17																	62496429		2203	4300	6503	SO:0001583	missense	0			AF015812	CCDS11659.1	17q21	2012-07-27	2012-02-23		ENSG00000108654	ENSG00000108654		"""DEAD-boxes"""	2746	protein-coding gene	gene with protein product		180630	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 5 (RNA helicase, 68kD)"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 5"""	HLR1, G17P1		22156369, 18698352	Standard	NM_004396		Approved	p68	uc002jek.2	P17844	OTTHUMG00000178936	ENST00000225792.5:c.1457G>C	17.37:g.62496429C>G	ENSP00000225792:p.Arg486Thr		B4DLW8|B5BU21|D3DU32|E7ETL9|O75681|Q53Y61	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_P68HR,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.R486T	ENST00000225792.5	37	c.1457	CCDS11659.1	17	.	.	.	.	.	.	.	.	.	.	C	9.270	1.045376	0.19748	.	.	ENSG00000108654	ENST00000540698;ENST00000450599;ENST00000225792	.	.	.	5.45	5.45	0.79879	.	0.097592	0.64402	D	0.000001	T	0.67636	0.2914	M	0.76170	2.325	0.80722	D	1	B;B;B	0.26081	0.141;0.137;0.137	B;B;B	0.18263	0.021;0.021;0.021	T	0.66610	-0.5880	9	0.49607	T	0.09	-12.9913	17.1403	0.86752	0.0:1.0:0.0:0.0	.	407;486;486	B4DLW8;B5BUE6;P17844	.;.;DDX5_HUMAN	T	486;416;475	.	ENSP00000225792:R475T	R	-	2	0	DDX5	59926891	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.935000	0.70145	2.712000	0.92718	0.591000	0.81541	AGA	DDX5	-	NULL	ENSG00000108654		0.418	DDX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX5	HGNC	protein_coding	OTTHUMT00000444030.1	-	0.00	26	0	C	NM_004396		62496429	-1	tier1	-	no_errors	ENST00000225792	ensembl	human	known	74_37	missense	40.00	18	12	SNP	1.000	G
DDX60L	91351	genome.wustl.edu	37	4	169377211	169377211	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr4:169377211C>G	ENST00000511577.1	-	7	1063	c.816G>C	c.(814-816)ttG>ttC	p.L272F	DDX60L_ENST00000260184.7_Missense_Mutation_p.L272F|DDX60L_ENST00000505890.1_Missense_Mutation_p.L272F			Q5H9U9	DDX6L_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like	272							ATP binding (GO:0005524)|helicase activity (GO:0004386)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(23)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.175)		GGTACATTCTCAAGGATAGTG	0.448																																																	0													70.0	64.0	66.0					4																	169377211		1951	4150	6101	SO:0001583	missense	0			AK092461	CCDS47161.1	4q32.3	2008-01-08				ENSG00000181381			26429	protein-coding gene	gene with protein product							Standard	XM_005263341		Approved	FLJ31033	uc003irq.4	Q5H9U9		ENST00000511577.1:c.816G>C	4.37:g.169377211C>G	ENSP00000422423:p.Leu272Phe		Q96ND6	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.L272F	ENST00000511577.1	37	c.816		4	.	.	.	.	.	.	.	.	.	.	C	12.13	1.845569	0.32606	.	.	ENSG00000181381	ENST00000260184;ENST00000511577;ENST00000505890	T;T;T	0.36520	1.26;1.26;1.25	3.62	0.846	0.18955	.	0.000000	0.29892	U	0.010924	T	0.50497	0.1619	M	0.69358	2.11	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.37979	-0.9682	10	0.41790	T	0.15	.	7.2639	0.26219	0.0:0.587:0.0:0.413	.	272;272	D6R906;Q5H9U9	.;DDX6L_HUMAN	F	272	ENSP00000260184:L272F;ENSP00000422423:L272F;ENSP00000422202:L272F	ENSP00000260184:L272F	L	-	3	2	DDX60L	169613786	0.019000	0.18553	0.000000	0.03702	0.020000	0.10135	0.157000	0.16402	-0.232000	0.09811	-0.459000	0.05422	TTG	DDX60L	-	NULL	ENSG00000181381		0.448	DDX60L-001	KNOWN	basic|appris_principal	protein_coding	DDX60L	HGNC	protein_coding	OTTHUMT00000364839.1	-	0.00	27	0	C	NM_001012967		169377211	-1	tier1	-	no_errors	ENST00000260184	ensembl	human	known	74_37	missense	30.00	28	12	SNP	0.015	G
DEFB108B	245911	genome.wustl.edu	37	11	71548582	71548582	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr11:71548582G>C	ENST00000328698.1	+	2	196	c.196G>C	c.(196-198)Gag>Cag	p.E66Q	DEFB108B_ENST00000529157.1_3'UTR	NM_001002035.1	NP_001002035.1	Q8NET1	D108B_HUMAN	defensin, beta 108B	66					defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)				endometrium(1)|kidney(1)|lung(2)|skin(1)	5						ACCAAGAATTGAGAGCACTAC	0.478																																																	0													71.0	76.0	75.0					11																	71548582		2200	4289	6489	SO:0001583	missense	0			AF529416	CCDS31631.1	11q13.4	2011-03-29			ENSG00000184276	ENSG00000184276		"""Defensins, beta"""	29966	protein-coding gene	gene with protein product							Standard	NM_001002035		Approved		uc010rqr.2	Q8NET1	OTTHUMG00000167533	ENST00000328698.1:c.196G>C	11.37:g.71548582G>C	ENSP00000333234:p.Glu66Gln			Missense_Mutation	SNP	NULL	p.E66Q	ENST00000328698.1	37	c.196	CCDS31631.1	11	.	.	.	.	.	.	.	.	.	.	.	0.702	-0.790620	0.02884	.	.	ENSG00000184276	ENST00000328698	T	0.13778	2.56	1.46	0.45	0.16624	.	0.456125	0.16256	N	0.222476	T	0.07638	0.0192	.	.	.	0.09310	N	1	B	0.31893	0.345	B	0.18871	0.023	T	0.25293	-1.0136	9	0.66056	D	0.02	.	4.0891	0.09962	0.2385:0.0:0.7615:0.0	.	66	Q8NET1	D108B_HUMAN	Q	66	ENSP00000333234:E66Q	ENSP00000333234:E66Q	E	+	1	0	DEFB108B	71226230	0.009000	0.17119	0.002000	0.10522	0.017000	0.09413	0.777000	0.26718	0.159000	0.19401	0.505000	0.49811	GAG	DEFB108B	-	NULL	ENSG00000184276		0.478	DEFB108B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEFB108B	HGNC	protein_coding	OTTHUMT00000394945.1	-	0.00	356	0	G	NM_001002035		71548582	+1	tier1	-	no_errors	ENST00000328698	ensembl	human	known	74_37	missense	23.71	325	101	SNP	0.002	C
DFNB59	494513	genome.wustl.edu	37	2	179319173	179319173	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr2:179319173C>G	ENST00000409117.3	+	3	682	c.326C>G	c.(325-327)tCc>tGc	p.S109C	PRKRA_ENST00000470200.1_5'Flank|DFNB59_ENST00000375129.4_Missense_Mutation_p.S109C	NM_001042702.3	NP_001036167.1	Q0ZLH3	PJVK_HUMAN	deafness, autosomal recessive 59	109					sensory perception of sound (GO:0007605)	neuronal cell body (GO:0043025)				breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(1)	18			OV - Ovarian serous cystadenocarcinoma(117;0.00406)|Epithelial(96;0.0159)|all cancers(119;0.0564)			GGATCAGATTCCATTGCAGTG	0.353																																																	0													86.0	85.0	85.0					2																	179319173		1899	4116	6015	SO:0001583	missense	0			BC020859, BQ887979	CCDS42787.1	2q31.2	2011-07-01			ENSG00000204311	ENSG00000204311			29502	protein-coding gene	gene with protein product		610219				16804542	Standard	NM_001042702		Approved	pejvakin	uc002umi.4	Q0ZLH3	OTTHUMG00000154425	ENST00000409117.3:c.326C>G	2.37:g.179319173C>G	ENSP00000386647:p.Ser109Cys		A0PK14|B9EJE2	Missense_Mutation	SNP	pfam_Gasdermin	p.S109C	ENST00000409117.3	37	c.326	CCDS42787.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.33|19.33	3.807064|3.807064	0.70797|0.70797	.|.	.|.	ENSG00000204311|ENSG00000204311	ENST00000442710|ENST00000409117;ENST00000375129	.|T;T	.|0.22743	.|1.94;1.94	5.67|5.67	4.79|4.79	0.61399|0.61399	.|.	.|0.204781	.|0.17900	.|U	.|0.158223	T|T	0.16128|0.16128	0.0388|0.0388	N|N	0.17082|0.17082	0.46|0.46	0.58432|0.58432	D|D	0.999998|0.999998	.|B	.|0.12013	.|0.005	.|B	.|0.16289	.|0.015	T|T	0.03443|0.03443	-1.1036|-1.1036	5|10	.|0.36615	.|T	.|0.2	-2.0818|-2.0818	17.196|17.196	0.86892|0.86892	0.0:0.8741:0.1258:0.0|0.0:0.8741:0.1258:0.0	.|.	.|109	.|Q0ZLH3	.|PJVK_HUMAN	L|C	56|109	.|ENSP00000386647:S109C;ENSP00000364271:S109C	.|ENSP00000364271:S109C	F|S	+|+	3|2	2|0	DFNB59|DFNB59	179027419|179027419	1.000000|1.000000	0.71417|0.71417	0.993000|0.993000	0.49108|0.49108	0.996000|0.996000	0.88848|0.88848	5.730000|5.730000	0.68546|0.68546	1.511000|1.511000	0.48818|0.48818	0.655000|0.655000	0.94253|0.94253	TTC|TCC	DFNB59	-	pfam_Gasdermin	ENSG00000204311		0.353	DFNB59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DFNB59	HGNC	protein_coding	OTTHUMT00000335160.1	-	0.00	59	0	C			179319173	+1	tier1	-	no_errors	ENST00000375129	ensembl	human	known	74_37	missense	27.45	37	14	SNP	1.000	G
DHX9	1660	genome.wustl.edu	37	1	182829167	182829167	+	Missense_Mutation	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:182829167G>A	ENST00000367549.3	+	12	1290	c.1180G>A	c.(1180-1182)Gaa>Aaa	p.E394K		NM_001357.4	NP_001348.2	Q08211	DHX9_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 9	394					ATP catabolic process (GO:0006200)|cellular response to heat (GO:0034605)|circadian rhythm (GO:0007623)|CRD-mediated mRNA stabilization (GO:0070934)|DNA duplex unwinding (GO:0032508)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|positive regulation of type I interferon production (GO:0032481)|RNA splicing (GO:0008380)	centrosome (GO:0005813)|CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)|RNA polymerase II transcription factor binding (GO:0001085)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(10)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	49						GAAGAAATTTGAAAGTGAGAT	0.413																																					Colon(69;210 1162 3697 13559 39565)												0													136.0	129.0	131.0					1																	182829167		1853	4090	5943	SO:0001583	missense	0			L13848	CCDS41444.1	1q25	2013-05-13	2013-05-13	2003-06-20	ENSG00000135829	ENSG00000135829		"""DEAH-boxes"""	2750	protein-coding gene	gene with protein product	"""NDH II"", ""RNA helicase A"""	603115	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 9 (RNA helicase A, nuclear DNA helicase II; leukophysin)"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 9"""	LKP, DDX9		8344961, 9111062	Standard	NM_001357		Approved	RHA	uc001gpr.3	Q08211	OTTHUMG00000035337	ENST00000367549.3:c.1180G>A	1.37:g.182829167G>A	ENSP00000356520:p.Glu394Lys		B2RNV4|Q05CI5|Q12803|Q32Q22|Q5VY62|Q6PD69|Q99556	Missense_Mutation	SNP	pfam_dsRNA-bd_dom,pfam_Helicase-assoc_dom,pfam_Helicase_C,pfam_DUF1605,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_dsRNA-bd_dom,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_dsRNA-bd_dom	p.E394K	ENST00000367549.3	37	c.1180	CCDS41444.1	1	.	.	.	.	.	.	.	.	.	.	G	15.61	2.885563	0.51908	.	.	ENSG00000135829	ENST00000399175;ENST00000367549	T	0.15017	2.46	5.84	5.84	0.93424	DEAD-like helicase (1);	0.000000	0.85682	D	0.000000	T	0.05547	0.0146	N	0.00301	-1.68	0.53005	D	0.999961	B	0.12013	0.005	B	0.08055	0.003	T	0.47381	-0.9122	10	0.13853	T	0.58	.	19.7483	0.96259	0.0:0.0:1.0:0.0	.	394	Q08211	DHX9_HUMAN	K	394	ENSP00000356520:E394K	ENSP00000356520:E394K	E	+	1	0	DHX9	181095790	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.031000	0.76491	2.779000	0.95612	0.655000	0.94253	GAA	DHX9	-	superfamily_P-loop_NTPase,smart_Helicase_ATP-bd	ENSG00000135829		0.413	DHX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX9	HGNC	protein_coding	OTTHUMT00000085522.2	-	0.00	75	0	G	NM_030588		182829167	+1	tier1	-	no_errors	ENST00000367549	ensembl	human	known	74_37	missense	29.07	61	25	SNP	1.000	A
DIP2A	23181	genome.wustl.edu	37	21	47974553	47974553	+	Frame_Shift_Del	DEL	C	C	-	rs550948255		TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr21:47974553delC	ENST00000417564.2	+	27	3241	c.3220delC	c.(3220-3222)cccfs	p.P1075fs	DIP2A_ENST00000427143.2_Frame_Shift_Del_p.P1011fs|DIP2A_ENST00000400274.1_Frame_Shift_Del_p.P1071fs|DIP2A_ENST00000318711.7_Frame_Shift_Del_p.P1076fs			Q14689	DIP2A_HUMAN	DIP2 disco-interacting protein 2 homolog A (Drosophila)	1075					multicellular organismal development (GO:0007275)|negative regulation of gene expression (GO:0010629)|regulation of apoptotic process (GO:0042981)	cell surface (GO:0009986)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(22)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(49;0.0933)			Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)		CACCGTGCGGCCCCCGCACCC	0.657																																																	0													36.0	44.0	41.0					21																	47974553		2167	4260	6427	SO:0001589	frameshift_variant	0			AF490768	CCDS46655.1, CCDS46656.1, CCDS46657.1, CCDS54490.1, CCDS54491.1	21q22.3	2010-08-20	2006-01-13	2006-01-13	ENSG00000160305	ENSG00000160305			17217	protein-coding gene	gene with protein product		607711	"""chromosome 21 open reading frame 106"""	C21orf106			Standard	NM_015151		Approved	Dip2, KIAA0184	uc002zjo.2	Q14689	OTTHUMG00000090717	ENST00000417564.2:c.3220delC	21.37:g.47974553delC	ENSP00000392066:p.Pro1075fs		A6P4T3|B4E0F0|E7EMA5|Q8IVA3|Q8N4S2|Q8TD89|Q96ML9	Frame_Shift_Del	DEL	pfam_AMP-dep_Synth/Lig,pfam_DMAP1-bd	p.P1076fs	ENST00000417564.2	37	c.3223	CCDS46655.1	21																																																																																			DIP2A	-	pfam_AMP-dep_Synth/Lig	ENSG00000160305		0.657	DIP2A-012	KNOWN	basic|CCDS	protein_coding	DIP2A	HGNC	protein_coding	OTTHUMT00000376736.1		0.00	35	0	C	NM_015151		47974553	+1	tier1		no_errors	ENST00000318711	ensembl	human	known	74_37	frame_shift_del	5.41	35	2	DEL	1.000	-
DLG5	9231	genome.wustl.edu	37	10	79569442	79569442	+	Missense_Mutation	SNP	A	A	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr10:79569442A>T	ENST00000372391.2	-	24	4515	c.4510T>A	c.(4510-4512)Ttc>Atc	p.F1504I	DLG5_ENST00000459739.1_5'UTR|DLG5_ENST00000372388.2_Missense_Mutation_p.F1164I	NM_004747.3	NP_004738.3	Q8TDM6	DLG5_HUMAN	discs, large homolog 5 (Drosophila)	1504	PDZ 4. {ECO:0000255|PROSITE- ProRule:PRU00143}.				apical protein localization (GO:0045176)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|intracellular signal transduction (GO:0035556)|metanephric collecting duct development (GO:0072205)|midbrain development (GO:0030901)|negative regulation of cell proliferation (GO:0008285)|polarized epithelial cell differentiation (GO:0030859)|protein complex assembly (GO:0006461)|protein localization to adherens junction (GO:0071896)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|zonula adherens assembly (GO:0045186)	cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cytoskeletal protein binding (GO:0008092)|receptor signaling complex scaffold activity (GO:0030159)			breast(9)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(17)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	60	all_cancers(46;0.0316)|all_epithelial(25;0.00147)|Breast(12;0.0015)|Prostate(51;0.0146)		Epithelial(14;0.00105)|OV - Ovarian serous cystadenocarcinoma(4;0.00151)|all cancers(16;0.00446)			TTTTTGATGAAGACAACGCGT	0.527																																																	0													192.0	192.0	192.0					10																	79569442		2203	4300	6503	SO:0001583	missense	0			U61843	CCDS7353.2	10q23	2008-07-09	2001-11-28		ENSG00000151208	ENSG00000151208			2904	protein-coding gene	gene with protein product		604090	"""discs, large (Drosophila) homolog 5"""			9738934	Standard	XM_005270276		Approved	P-dlg, KIAA0583	uc001jzk.3	Q8TDM6	OTTHUMG00000018548	ENST00000372391.2:c.4510T>A	10.37:g.79569442A>T	ENSP00000361467:p.Phe1504Ile		A6H8Y3|Q149N1|Q5T1H7|Q5T1H8|Q6DKG3|Q86WC0|Q8TDM7|Q9UE73|Q9Y4E3	Missense_Mutation	SNP	pfam_PDZ,pfam_DUF622,pfam_GK/Ca_channel_bsu,superfamily_P-loop_NTPase,superfamily_PDZ,superfamily_SH3_domain,superfamily_DEATH-like_dom,smart_PDZ,smart_SH3_domain,smart_GK/Ca_channel_bsu,pfscan_CARD,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin-like	p.F1504I	ENST00000372391.2	37	c.4510	CCDS7353.2	10	.	.	.	.	.	.	.	.	.	.	A	10.47	1.360027	0.24598	.	.	ENSG00000151208	ENST00000372391;ENST00000424842;ENST00000372388	T;T;T	0.39406	1.08;1.08;1.08	5.85	0.695	0.18070	PDZ/DHR/GLGF (2);	0.000000	0.40728	N	0.001021	T	0.12987	0.0315	N	0.02315	-0.6	0.25190	N	0.990132	B;B	0.19073	0.004;0.033	B;B	0.19391	0.009;0.025	T	0.11446	-1.0587	10	0.22706	T	0.39	.	1.5954	0.02663	0.2955:0.2027:0.0792:0.4226	.	1504;1164	Q8TDM6;Q8TDM6-2	DLG5_HUMAN;.	I	1504;465;1164	ENSP00000361467:F1504I;ENSP00000394797:F465I;ENSP00000361464:F1164I	ENSP00000361464:F1164I	F	-	1	0	DLG5	79239448	0.999000	0.42202	0.604000	0.28916	0.596000	0.36781	1.461000	0.35255	0.468000	0.27243	0.533000	0.62120	TTC	DLG5	-	superfamily_PDZ,pfscan_PDZ	ENSG00000151208		0.527	DLG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLG5	HGNC	protein_coding	OTTHUMT00000048900.2	-	0.00	59	0	A			79569442	-1	tier1	-	no_errors	ENST00000372391	ensembl	human	known	74_37	missense	34.29	23	12	SNP	0.928	T
DNAJC28	54943	genome.wustl.edu	37	21	34860764	34860764	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr21:34860764C>G	ENST00000314399.3	-	2	1375	c.937G>C	c.(937-939)Gat>Cat	p.D313H	DNAJC28_ENST00000381947.3_Missense_Mutation_p.D313H|DNAJC28_ENST00000402202.1_Missense_Mutation_p.D313H	NM_017833.3	NP_060303.2	Q9NX36	DJC28_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 28	313										endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(5)|skin(1)|urinary_tract(1)	18						AAATTAAAATCATTAATTCGC	0.348																																																	0													86.0	84.0	85.0					21																	34860764		2203	4300	6503	SO:0001583	missense	0			AK000468	CCDS13626.1	21q22.11	2011-09-02	2008-06-17	2008-06-17	ENSG00000177692	ENSG00000177692		"""Heat shock proteins / DNAJ (HSP40)"""	1297	protein-coding gene	gene with protein product	"""Orf28"""		"""chromosome 21 open reading frame 55"""	C21orf55			Standard	NM_017833		Approved	C21orf78	uc002yrw.3	Q9NX36	OTTHUMG00000065531	ENST00000314399.3:c.937G>C	21.37:g.34860764C>G	ENSP00000320303:p.Asp313His		D3DSF2	Missense_Mutation	SNP	pfam_DnaJ_homolog_subfam-C_membr-28,pfam_DnaJ_domain,superfamily_DnaJ_domain,smart_DnaJ_domain,pfscan_DnaJ_domain	p.D313H	ENST00000314399.3	37	c.937	CCDS13626.1	21	.	.	.	.	.	.	.	.	.	.	C	15.84	2.951701	0.53186	.	.	ENSG00000177692	ENST00000381947;ENST00000314399;ENST00000402202	.	.	.	5.09	4.15	0.48705	.	0.165679	0.51477	D	0.000083	T	0.55194	0.1905	M	0.76574	2.34	0.31737	N	0.636322	P	0.50272	0.933	P	0.50231	0.635	T	0.66200	-0.5983	9	0.62326	D	0.03	-22.0815	10.0109	0.41986	0.1397:0.7828:0.0:0.0775	.	313	Q9NX36	DJC28_HUMAN	H	313	.	ENSP00000320303:D313H	D	-	1	0	DNAJC28	33782634	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.611000	0.46334	2.534000	0.85438	0.650000	0.86243	GAT	DNAJC28	-	NULL	ENSG00000177692		0.348	DNAJC28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC28	HGNC	protein_coding	OTTHUMT00000140454.3	-	0.00	87	0	C			34860764	-1	tier1	-	no_errors	ENST00000314399	ensembl	human	known	74_37	missense	22.54	55	16	SNP	1.000	G
DNMT3A	1788	genome.wustl.edu	37	2	25497920	25497920	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr2:25497920C>G	ENST00000264709.3	-	6	866	c.529G>C	c.(529-531)Gag>Cag	p.E177Q	DNMT3A_ENST00000321117.5_Missense_Mutation_p.E177Q	NM_175629.2	NP_783328.1	Q9Y6K1	DNM3A_HUMAN	DNA (cytosine-5-)-methyltransferase 3 alpha	177					C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation involved in gamete generation (GO:0043046)|DNA methylation on cytosine within a CG sequence (GO:0010424)|hypermethylation of CpG island (GO:0044027)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of gene expression by genetic imprinting (GO:0006349)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)|spermatogenesis (GO:0007283)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|euchromatin (GO:0000791)|nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|unmethylated CpG binding (GO:0045322)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(964)|kidney(3)|large_intestine(10)|lung(29)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	1021	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGGCTGGACTCCCAGCCCAAG	0.677			"""Mis, F, N, S"""		AML																																			Rec	yes		2	2p23	1788	DNA (cytosine-5-)-methyltransferase 3 alpha		L	0													18.0	18.0	18.0					2																	25497920		2201	4296	6497	SO:0001583	missense	0				CCDS1718.2, CCDS33157.1, CCDS46232.1	2p23	2014-09-17			ENSG00000119772	ENSG00000119772			2978	protein-coding gene	gene with protein product		602769				9662389, 10433969	Standard	NM_175630		Approved		uc002rgc.4	Q9Y6K1	OTTHUMG00000094777	ENST00000264709.3:c.529G>C	2.37:g.25497920C>G	ENSP00000264709:p.Glu177Gln		E9PEB8|Q86TE8|Q86XF5|Q8IZV0|Q8WXU9	Missense_Mutation	SNP	pfam_PWWP_dom,pfam_C5_MeTfrase,superfamily_Znf_FYVE_PHD,smart_PWWP_dom,pfscan_PWWP_dom	p.E177Q	ENST00000264709.3	37	c.529	CCDS33157.1	2	.	.	.	.	.	.	.	.	.	.	C	28.4	4.918689	0.92249	.	.	ENSG00000119772	ENST00000321117;ENST00000264709	D;D	0.94687	-3.49;-3.49	5.09	5.09	0.68999	.	0.165828	0.38778	N	0.001570	D	0.94295	0.8167	N	0.24115	0.695	0.80722	D	1	D	0.57899	0.981	D	0.65140	0.932	D	0.94542	0.7746	10	0.46703	T	0.11	-14.5205	16.0069	0.80370	0.0:1.0:0.0:0.0	.	177	Q9Y6K1	DNM3A_HUMAN	Q	177	ENSP00000324375:E177Q;ENSP00000264709:E177Q	ENSP00000264709:E177Q	E	-	1	0	DNMT3A	25351424	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.125000	0.77193	2.367000	0.80283	0.561000	0.74099	GAG	DNMT3A	-	NULL	ENSG00000119772		0.677	DNMT3A-001	KNOWN	basic|CCDS	protein_coding	DNMT3A	HGNC	protein_coding	OTTHUMT00000211587.1	-	0.00	81	0	C	NM_022552		25497920	-1	tier1	-	no_errors	ENST00000264709	ensembl	human	known	74_37	missense	10.71	75	9	SNP	1.000	G
DQX1	165545	genome.wustl.edu	37	2	74746774	74746774	+	Missense_Mutation	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr2:74746774C>T	ENST00000404568.3	-	10	1934	c.1715G>A	c.(1714-1716)cGa>cAa	p.R572Q	DQX1_ENST00000393951.2_Missense_Mutation_p.R572Q	NM_133637.2	NP_598376.2	Q8TE96	DQX1_HUMAN	DEAQ box RNA-dependent ATPase 1	572						nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(1)	18						AAGTTCAATTCGTTGCATGAG	0.517																																																	0													145.0	140.0	142.0					2																	74746774		2203	4300	6503	SO:0001583	missense	0			AK074337	CCDS1949.2	2p12	2010-04-20	2009-01-15		ENSG00000144045	ENSG00000144045			20410	protein-coding gene	gene with protein product			"""DEAQ box polypeptide 1 (RNA-dependent ATPase)"""				Standard	NM_133637		Approved	FLJ23757	uc010yrw.2	Q8TE96	OTTHUMG00000129965	ENST00000404568.3:c.1715G>A	2.37:g.74746774C>T	ENSP00000384621:p.Arg572Gln		Q6B017|Q8NAM8	Missense_Mutation	SNP	pfam_Helicase-assoc_dom,pfam_DUF1605,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase-assoc_dom,pfscan_Helicase_ATP-bd	p.R572Q	ENST00000404568.3	37	c.1715	CCDS1949.2	2	.	.	.	.	.	.	.	.	.	.	C	16.94	3.259774	0.59321	.	.	ENSG00000144045	ENST00000393951;ENST00000404568	T;T	0.03242	4.0;4.0	5.69	1.0	0.19881	Domain of unknown function DUF1605 (1);	0.344250	0.22606	N	0.057899	T	0.07683	0.0193	M	0.91406	3.205	0.32557	N	0.531624	B	0.34290	0.447	B	0.26969	0.075	T	0.03184	-1.1063	10	0.59425	D	0.04	-27.7225	9.5244	0.39156	0.0:0.6649:0.0:0.3351	.	572	Q8TE96	DQX1_HUMAN	Q	572	ENSP00000377523:R572Q;ENSP00000384621:R572Q	ENSP00000377523:R572Q	R	-	2	0	DQX1	74600282	0.768000	0.28519	0.901000	0.35422	0.991000	0.79684	0.754000	0.26390	-0.067000	0.12976	-0.137000	0.14449	CGA	DQX1	-	pfam_DUF1605	ENSG00000144045		0.517	DQX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DQX1	HGNC	protein_coding	OTTHUMT00000252230.3		0.00	38	0	C	NM_133637		74746774	-1			no_errors	ENST00000393951	ensembl	human	known	74_37	missense	9.52	19	2	SNP	0.928	T
DSCAML1	57453	genome.wustl.edu	37	11	117387201	117387201	+	Silent	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr11:117387201G>A	ENST00000321322.6	-	8	1945	c.1944C>T	c.(1942-1944)agC>agT	p.S648S	DSCAML1_ENST00000527706.1_Silent_p.S378S	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	588	Ig-like C2-type 7.				axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		CTACGTGAACGCTCTGGCTGA	0.632																																																	0													101.0	80.0	87.0					11																	117387201		2201	4296	6497	SO:0001819	synonymous_variant	0				CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.1944C>T	11.37:g.117387201G>A			Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.S648	ENST00000321322.6	37	c.1944	CCDS8384.1	11																																																																																			DSCAML1	-	smart_Ig_sub	ENSG00000177103		0.632	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSCAML1	HGNC	protein_coding	OTTHUMT00000392907.2		0.00	27	0	G	NM_020693		117387201	-1			no_errors	ENST00000321322	ensembl	human	known	74_37	silent	8.70	21	2	SNP	0.404	A
DSG4	147409	genome.wustl.edu	37	18	28993211	28993211	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr18:28993211G>C	ENST00000308128.4	+	16	2911	c.2776G>C	c.(2776-2778)Gat>Cat	p.D926H	RP11-534N16.1_ENST00000578477.1_RNA|DSG4_ENST00000359747.4_Missense_Mutation_p.D945H|RP11-534N16.1_ENST00000581856.1_RNA	NM_177986.3	NP_817123.1	Q86SJ6	DSG4_HUMAN	desmoglein 4	926					anagen (GO:0042640)|BMP signaling pathway (GO:0030509)|homophilic cell adhesion (GO:0007156)|keratinocyte differentiation (GO:0030216)|single organismal cell-cell adhesion (GO:0016337)	desmosome (GO:0030057)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(6)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(11)|liver(2)|lung(35)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			AATTATTTTTGATCCTCAGCT	0.428																																																	0													172.0	161.0	164.0					18																	28993211		2203	4300	6503	SO:0001583	missense	0			AY177664, AY168788	CCDS11897.1, CCDS45845.1	18q12.1	2010-01-26			ENSG00000175065	ENSG00000175065		"""Cadherins / Major cadherins"""	21307	protein-coding gene	gene with protein product		607892				12648213	Standard	NM_001134453		Approved	CDHF13, LAH	uc002kwq.2	Q86SJ6	OTTHUMG00000131979	ENST00000308128.4:c.2776G>C	18.37:g.28993211G>C	ENSP00000311859:p.Asp926His		A2RUI1|Q6Y9L9|Q8IXV4	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin,prints_Desmoglein,prints_Desmosomal_cadherin	p.D945H	ENST00000308128.4	37	c.2833	CCDS11897.1	18	.	.	.	.	.	.	.	.	.	.	G	14.76	2.631687	0.46944	.	.	ENSG00000175065	ENST00000308128;ENST00000359747	T;T	0.78481	-1.18;-1.18	5.51	5.51	0.81932	.	0.000000	0.36066	N	0.002813	D	0.87087	0.6090	M	0.64997	1.995	0.47276	D	0.999379	D;D	0.76494	0.999;0.997	D;D	0.78314	0.991;0.928	D	0.87634	0.2518	10	0.66056	D	0.02	.	19.0134	0.92884	0.0:0.0:1.0:0.0	.	945;926	Q86SJ6-2;Q86SJ6	.;DSG4_HUMAN	H	926;945	ENSP00000311859:D926H;ENSP00000352785:D945H	ENSP00000311859:D926H	D	+	1	0	DSG4	27247209	1.000000	0.71417	1.000000	0.80357	0.871000	0.50021	4.822000	0.62686	2.563000	0.86464	0.655000	0.94253	GAT	DSG4	-	NULL	ENSG00000175065		0.428	DSG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSG4	HGNC	protein_coding	OTTHUMT00000254941.1	-	0.00	37	0	G	NM_177986		28993211	+1	tier1	-	no_errors	ENST00000359747	ensembl	human	known	74_37	missense	41.86	25	18	SNP	1.000	C
DYNC1H1	1778	genome.wustl.edu	37	14	102483493	102483493	+	Silent	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr14:102483493C>T	ENST00000360184.4	+	39	8081	c.7917C>T	c.(7915-7917)tgC>tgT	p.C2639C		NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	2639	AAA 3. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)	p.C2639C(1)		NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						ATCACTACTGCGAGTACAGGC	0.473																																																	1	Substitution - coding silent(1)	large_intestine(1)											149.0	140.0	143.0					14																	102483493		2203	4300	6503	SO:0001819	synonymous_variant	0			AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.7917C>T	14.37:g.102483493C>T			B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Silent	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_Thioredoxin-like_fold,superfamily_Glutathione-S-Trfase_C-like,smart_AAA+_ATPase	p.C2639	ENST00000360184.4	37	c.7917	CCDS9966.1	14																																																																																			DYNC1H1	-	superfamily_P-loop_NTPase,smart_AAA+_ATPase	ENSG00000197102		0.473	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC1H1	HGNC	protein_coding	OTTHUMT00000414574.1		0.00	38	0	C	NM_001376		102483493	+1			no_errors	ENST00000360184	ensembl	human	known	74_37	silent	6.06	31	2	SNP	0.999	T
DYNC1I1	1780	genome.wustl.edu	37	7	95705494	95705494	+	Silent	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr7:95705494C>T	ENST00000324972.6	+	15	1879	c.1686C>T	c.(1684-1686)ctC>ctT	p.L562L	DYNC1I1_ENST00000437599.1_Silent_p.L542L|DYNC1I1_ENST00000447467.2_Silent_p.L545L|DYNC1I1_ENST00000359388.4_Silent_p.L525L|DYNC1I1_ENST00000457059.1_Silent_p.L545L|DYNC1I1_ENST00000537881.1_Silent_p.L525L	NM_004411.4	NP_004402.1	O14576	DC1I1_HUMAN	dynein, cytoplasmic 1, intermediate chain 1	562					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|metabolic process (GO:0008152)|vesicle transport along microtubule (GO:0047496)	cytoplasmic dynein complex (GO:0005868)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|kinetochore (GO:0000776)|microtubule (GO:0005874)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)|vesicle (GO:0031982)	microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)|spectrin binding (GO:0030507)			NS(2)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(27)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	54	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		STAD - Stomach adenocarcinoma(171;0.0957)			TCTGGAACCTCAACAATGACA	0.627											OREG0018174	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													62.0	58.0	59.0					7																	95705494		2203	4300	6503	SO:0001819	synonymous_variant	0			AF063228	CCDS5644.1, CCDS47645.1, CCDS47646.1, CCDS64718.1	7q21.3-q22.1	2013-01-18	2005-11-24	2005-11-24	ENSG00000158560	ENSG00000158560		"""Cytoplasmic dyneins"", ""WD repeat domain containing"""	2963	protein-coding gene	gene with protein product		603772	"""dynein, cytoplasmic, intermediate polypeptide 1"""	DNCI1		10049579, 16260502	Standard	NM_004411		Approved	DNCIC1	uc003uoc.4	O14576	OTTHUMG00000153983	ENST00000324972.6:c.1686C>T	7.37:g.95705494C>T		1315	B4DME3|F5H050|G5E9K1|Q8TBF7|Q9Y2X1	Silent	SNP	pfam_Dynein_IC_1/2,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.L562	ENST00000324972.6	37	c.1686	CCDS5644.1	7																																																																																			DYNC1I1	-	superfamily_WD40_repeat_dom,pfscan_WD40_repeat_dom	ENSG00000158560		0.627	DYNC1I1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DYNC1I1	HGNC	protein_coding	OTTHUMT00000333432.1	-	0.00	35	0	C	NM_004411		95705494	+1	tier1	-	no_errors	ENST00000324972	ensembl	human	known	74_37	silent	14.71	29	5	SNP	1.000	T
DYNC2H1	79659	genome.wustl.edu	37	11	103041718	103041718	+	Missense_Mutation	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr11:103041718C>T	ENST00000375735.2	+	34	5399	c.5255C>T	c.(5254-5256)tCa>tTa	p.S1752L	DYNC2H1_ENST00000334267.7_Intron|DYNC2H1_ENST00000398093.3_Missense_Mutation_p.S1752L	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	1752	AAA 1. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		TCTGTACTGTCAGCAGTTTCT	0.398																																																	0													166.0	154.0	157.0					11																	103041718		1840	4091	5931	SO:0001583	missense	0			AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.5255C>T	11.37:g.103041718C>T	ENSP00000364887:p.Ser1752Leu		O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.S1752L	ENST00000375735.2	37	c.5255	CCDS53701.1	11	.	.	.	.	.	.	.	.	.	.	C	25.9	4.683369	0.88542	.	.	ENSG00000187240	ENST00000375735;ENST00000398093	T;T	0.45668	0.89;0.89	4.92	4.92	0.64577	ATPase, AAA+ type, core (1);	.	.	.	.	T	0.79293	0.4421	H	0.98351	4.21	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.88171	0.2864	9	0.87932	D	0	.	18.4867	0.90831	0.0:1.0:0.0:0.0	.	1752;1752	Q8NCM8;Q8NCM8-2	DYHC2_HUMAN;.	L	1752	ENSP00000364887:S1752L;ENSP00000381167:S1752L	ENSP00000364887:S1752L	S	+	2	0	DYNC2H1	102546928	1.000000	0.71417	0.972000	0.41901	0.742000	0.42306	7.772000	0.85439	2.432000	0.82394	0.650000	0.86243	TCA	DYNC2H1	-	superfamily_P-loop_NTPase,smart_AAA+_ATPase	ENSG00000187240		0.398	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC2H1	HGNC	protein_coding	OTTHUMT00000387196.1	-	0.00	70	0	C	XM_370652		103041718	+1	tier1	-	no_errors	ENST00000398093	ensembl	human	known	74_37	missense	36.36	56	32	SNP	1.000	T
DYNLT1	6993	genome.wustl.edu	37	6	159058091	159058091	+	Intron	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr6:159058091C>G	ENST00000367089.3	-	4	302				DYNLT1_ENST00000367088.1_Missense_Mutation_p.E45Q	NM_006519.2	NP_006510.1	P63172	DYLT1_HUMAN	dynein, light chain, Tctex-type 1						establishment of mitotic spindle orientation (GO:0000132)|intracellular transport of viral protein in host cell (GO:0019060)|microtubule-dependent intracellular transport of viral material towards nucleus (GO:0075521)|mitotic nuclear division (GO:0007067)|negative regulation of neurogenesis (GO:0050768)|neuron projection morphogenesis (GO:0048812)|regulation of cytoskeleton organization (GO:0051493)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of Rac GTPase activity (GO:0032314)|viral entry into host cell (GO:0046718)	cytoplasmic dynein complex (GO:0005868)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)	identical protein binding (GO:0042802)|motor activity (GO:0003774)			lung(2)	2		Breast(66;0.00519)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;4.02e-18)|BRCA - Breast invasive adenocarcinoma(81;9.53e-06)		GCATTGCATTCAAAGATAGGA	0.358																																																	0																																										SO:0001627	intron_variant	0			D50663	CCDS5257.1	6q25.2-q25.3	2008-02-05	2005-11-24	2005-11-24	ENSG00000146425	ENSG00000146425		"""Cytoplasmic dyneins"""	11697	protein-coding gene	gene with protein product		601554	"""t-complex-associated-testis-expressed 1-like 1"""	TCTEL1		8646886, 16260502	Standard	XM_005267117		Approved		uc003qrn.2	P63172	OTTHUMG00000015918	ENST00000367089.3:c.271+68G>C	6.37:g.159058091C>G			Q15763|Q5VTU4	Missense_Mutation	SNP	pfam_Tctex	p.E45Q	ENST00000367089.3	37	c.133	CCDS5257.1	6	.	.	.	.	.	.	.	.	.	.	C	6.948	0.544722	0.13312	.	.	ENSG00000146425	ENST00000367088	.	.	.	3.43	-1.11	0.09840	.	.	.	.	.	T	0.07143	0.0181	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.36212	-0.9757	4	.	.	.	.	1.6412	0.02753	0.3642:0.3423:0.1786:0.1149	.	.	.	.	Q	45	.	.	E	-	1	0	DYNLT1	158978079	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-1.008000	0.03663	-0.390000	0.07774	0.655000	0.94253	GAA	DYNLT1	-	NULL	ENSG00000146425		0.358	DYNLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNLT1	HGNC	protein_coding	OTTHUMT00000042881.1	-	0.00	21	0	C	NM_006519		159058091	-1	tier1	-	no_errors	ENST00000367088	ensembl	human	known	74_37	missense	36.67	19	11	SNP	0.000	G
CRACR2B	283229	genome.wustl.edu	37	11	831001	831001	+	Missense_Mutation	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr11:831001G>A	ENST00000525077.1	+	7	1023	c.922G>A	c.(922-924)Gaa>Aaa	p.E308K	CD151_ENST00000397421.1_5'Flank|CD151_ENST00000322008.4_5'Flank|CD151_ENST00000397420.3_5'Flank|EFCAB4A_ENST00000450448.1_Intron|AP006621.8_ENST00000532946.1_RNA|EFCAB4A_ENST00000528542.2_Intron			Q8N4Y2	EFC4A_HUMAN		308					cellular protein localization (GO:0034613)|regulation of store-operated calcium entry (GO:2001256)|store-operated calcium entry (GO:0002115)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)			endometrium(1)|large_intestine(1)|lung(1)	3		all_cancers(49;2.31e-08)|all_epithelial(84;3.72e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.179)|all_lung(207;0.227)		all cancers(45;1.45e-25)|Epithelial(43;1.17e-24)|OV - Ovarian serous cystadenocarcinoma(40;6.76e-19)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GCTGGAGAGCGAAGCACGAGG	0.751																																																	0																																										SO:0001583	missense	0																														ENST00000525077.1:c.922G>A	11.37:g.831001G>A	ENSP00000435299:p.Glu308Lys		D5LPR2|Q8NBW8	Missense_Mutation	SNP	pfscan_EF_hand_dom	p.E308K	ENST00000525077.1	37	c.922		11	.	.	.	.	.	.	.	.	.	.	g	13.91	2.377598	0.42105	.	.	ENSG00000177685	ENST00000321883;ENST00000525077	T	0.07114	3.22	3.45	1.34	0.21922	.	.	.	.	.	T	0.04048	0.0113	.	.	.	0.19575	N	0.999961	P	0.42871	0.792	B	0.25759	0.063	T	0.40213	-0.9575	8	0.45353	T	0.12	.	5.4448	0.16529	0.0:0.2268:0.5401:0.2331	.	308	Q8N4Y2	EFC4A_HUMAN	K	308	ENSP00000435299:E308K	ENSP00000324024:E308K	E	+	1	0	EFCAB4A	821001	0.269000	0.24143	0.667000	0.29798	0.544000	0.35116	1.220000	0.32491	0.102000	0.17638	0.457000	0.33378	GAA	EFCAB4A	-	NULL	ENSG00000177685		0.751	EFCAB4A-007	NOVEL	basic|appris_principal	protein_coding	EFCAB4A	HGNC	protein_coding	OTTHUMT00000383097.1	-	0.00	18	0	G			831001	+1	tier1	-	no_errors	ENST00000525077	ensembl	human	novel	74_37	missense	42.86	4	3	SNP	0.174	A
ELF1	1997	genome.wustl.edu	37	13	41515340	41515340	+	Nonsense_Mutation	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr13:41515340G>A	ENST00000239882.3	-	8	1287	c.973C>T	c.(973-975)Caa>Taa	p.Q325*	ELF1_ENST00000442101.1_Nonsense_Mutation_p.Q301*|ELF1_ENST00000498824.1_5'UTR	NM_172373.3	NP_758961.1	P32519	ELF1_HUMAN	E74-like factor 1 (ets domain transcription factor)	325					cell differentiation (GO:0030154)|negative regulation of T cell receptor signaling pathway (GO:0050860)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokine production (GO:0001817)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	37		Lung NSC(96;8.3e-05)|Prostate(109;0.0233)|Breast(139;0.0296)|Lung SC(185;0.0367)		all cancers(112;1.87e-08)|Epithelial(112;8.45e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000202)|GBM - Glioblastoma multiforme(144;0.00266)|BRCA - Breast invasive adenocarcinoma(63;0.072)		CGGCTGGTTTGATTCCTATTT	0.418																																																	0													107.0	116.0	113.0					13																	41515340		2203	4300	6503	SO:0001587	stop_gained	0			M82882	CCDS9374.1	13q13	2008-07-18			ENSG00000120690	ENSG00000120690			3316	protein-coding gene	gene with protein product		189973				1545787	Standard	NM_001145353		Approved		uc001uxs.3	P32519	OTTHUMG00000016783	ENST00000239882.3:c.973C>T	13.37:g.41515340G>A	ENSP00000239882:p.Gln325*		B4E2I5|E9PDQ9|Q8N6F6|Q9UDE1	Nonsense_Mutation	SNP	pfam_TF_Elf_N,pfam_Ets_dom,smart_Ets_dom,pfscan_Ets_dom,prints_Ets_dom	p.Q325*	ENST00000239882.3	37	c.973	CCDS9374.1	13	.	.	.	.	.	.	.	.	.	.	G	32	5.182311	0.94885	.	.	ENSG00000120690	ENST00000442101;ENST00000379498;ENST00000239882	.	.	.	5.47	4.61	0.57282	.	0.188682	0.47093	D	0.000245	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	.	16.5513	0.84473	0.0:0.1309:0.8691:0.0	.	.	.	.	X	301;67;325	.	ENSP00000239882:Q325X	Q	-	1	0	ELF1	40413340	1.000000	0.71417	0.984000	0.44739	0.003000	0.03518	6.565000	0.73974	1.427000	0.47276	-0.175000	0.13238	CAA	ELF1	-	NULL	ENSG00000120690		0.418	ELF1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ELF1	HGNC	protein_coding	OTTHUMT00000044654.3	-	0.00	52	0	G	NM_172373		41515340	-1	tier1	-	no_errors	ENST00000239882	ensembl	human	known	74_37	nonsense	25.00	44	15	SNP	1.000	A
EFNB2	1948	genome.wustl.edu	37	13	107187251	107187251	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr13:107187251C>G	ENST00000245323.4	-	1	211	c.62G>C	c.(61-63)aGa>aCa	p.R21T		NM_004093.3	NP_004084.1	P52799	EFNB2_HUMAN	ephrin-B2	21					anatomical structure morphogenesis (GO:0009653)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|cell-cell signaling (GO:0007267)|ephrin receptor signaling pathway (GO:0048013)|lymph vessel development (GO:0001945)|negative regulation of keratinocyte proliferation (GO:0010839)|organ morphogenesis (GO:0009887)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|regulation of chemotaxis (GO:0050920)|viral process (GO:0016032)	focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ephrin receptor binding (GO:0046875)			haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(7)|ovary(1)|skin(1)	13	Lung NSC(43;0.015)|all_neural(89;0.0741)|Lung SC(71;0.14)|Medulloblastoma(90;0.169)					AATCGCAGTTCTGCATAAAAC	0.552																																																	0													90.0	96.0	94.0					13																	107187251		2202	4300	6502	SO:0001583	missense	0			L38734	CCDS9507.1	13q33	2011-03-09			ENSG00000125266	ENSG00000125266		"""Ephrins"""	3227	protein-coding gene	gene with protein product	"""HTK ligand"", ""ligand of eph-related kinase 5"", ""eph-related receptor tyrosine kinase ligand 5"""	600527		EPLG5		7833926	Standard	NM_004093		Approved	LERK5, Htk-L, HTKL, MGC126226, MGC126227, MGC126228	uc001vqi.3	P52799	OTTHUMG00000017324	ENST00000245323.4:c.62G>C	13.37:g.107187251C>G	ENSP00000245323:p.Arg21Thr		Q5JV56	Missense_Mutation	SNP	pfam_Ephrin,superfamily_Cupredoxin,prints_Ephrin	p.R21T	ENST00000245323.4	37	c.62	CCDS9507.1	13	.	.	.	.	.	.	.	.	.	.	C	13.53	2.265833	0.40095	.	.	ENSG00000125266	ENST00000245323	D	0.90504	-2.68	4.27	3.42	0.39159	.	0.598302	0.18765	N	0.131762	D	0.86493	0.5946	L	0.58101	1.795	0.34586	D	0.714966	B	0.26258	0.145	B	0.23716	0.048	T	0.82080	-0.0634	10	0.11182	T	0.66	.	12.0318	0.53401	0.0:0.9141:0.0:0.0859	.	21	P52799	EFNB2_HUMAN	T	21	ENSP00000245323:R21T	ENSP00000245323:R21T	R	-	2	0	EFNB2	105985252	1.000000	0.71417	0.994000	0.49952	0.989000	0.77384	3.675000	0.54605	0.795000	0.33922	0.456000	0.33151	AGA	EFNB2	-	NULL	ENSG00000125266		0.552	EFNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFNB2	HGNC	protein_coding	OTTHUMT00000045733.4	-	0.00	95	0	C	NM_004093		107187251	-1	tier1	-	no_errors	ENST00000245323	ensembl	human	known	74_37	missense	25.68	110	38	SNP	1.000	G
ELFN1	392617	genome.wustl.edu	37	7	1785016	1785016	+	Missense_Mutation	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr7:1785016C>T	ENST00000424383.2	+	3	1271	c.784C>T	c.(784-786)Ccc>Tcc	p.P262S	ELFN1_ENST00000561626.1_Missense_Mutation_p.P262S|ELFN1_ENST00000541472.1_Missense_Mutation_p.P262S			P0C7U0	ELFN1_HUMAN	extracellular leucine-rich repeat and fibronectin type III domain containing 1	262					negative regulation of phosphatase activity (GO:0010923)|synapse organization (GO:0050808)	dendrite (GO:0030425)|excitatory synapse (GO:0060076)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)			endometrium(1)	1						GGTGGTCGGGCCCCCACGTCC	0.711																																																	0													8.0	11.0	10.0					7																	1785016		685	1577	2262	SO:0001583	missense	0				CCDS59046.1	7p22.3	2013-02-11	2011-10-27	2011-10-27	ENSG00000225968	ENSG00000225968		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"""	33154	protein-coding gene	gene with protein product		614964	"""extracellular leucine-rich repeat and fibronectin type III containing 1"", ""extracellular leucine-rich repeat and fibronectin type III domain containing 1"", ""protein phosphatase 1, regulatory subunit 28"""	PPP1R28		17868438	Standard	NM_001128636		Approved		uc010ksg.2	P0C7U0	OTTHUMG00000151495	ENST00000424383.2:c.784C>T	7.37:g.1785016C>T	ENSP00000456548:p.Pro262Ser		H3BS57	Missense_Mutation	SNP	superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.P262S	ENST00000424383.2	37	c.784	CCDS59046.1	7																																																																																			ELFN1	-	NULL	ENSG00000225968		0.711	ELFN1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	ELFN1	HGNC	protein_coding	OTTHUMT00000322893.2	-	0.00	8	0	C	NM_001128636		1785016	+1	tier1	-	no_errors	ENST00000424383	ensembl	human	known	74_37	missense	41.18	10	7	SNP	0.237	T
EMC1	23065	genome.wustl.edu	37	1	19547522	19547522	+	Intron	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:19547522C>G	ENST00000477853.1	-	21	2630				RP1-43E13.2_ENST00000437898.1_RNA|EMC1_ENST00000375199.3_Intron|EMC1_ENST00000375208.3_Intron|EMC1_ENST00000480380.1_5'UTR	NM_001271427.1|NM_001271428.1|NM_015047.2	NP_001258356.1|NP_001258357.1|NP_055862.1	Q8N766	EMC1_HUMAN	ER membrane protein complex subunit 1							ER membrane protein complex (GO:0072546)|integral component of membrane (GO:0016021)											TGAAGGTTCTCACTTTTGAAG	0.328																																																	0																																										SO:0001627	intron_variant	0				CCDS190.1, CCDS59190.1, CCDS59191.1	1p36.13	2012-05-23	2012-05-23	2012-05-23	ENSG00000127463	ENSG00000127463			28957	protein-coding gene	gene with protein product			"""KIAA0090"""	KIAA0090		22119785	Standard	NM_015047		Approved		uc001bbo.4	Q8N766	OTTHUMG00000002497	ENST00000477853.1:c.2588-180G>C	1.37:g.19547522C>G			A8K6F3|Q14700|Q5TG62|Q63HL0|Q63HL3|Q8NBH8	RNA	SNP	-	NULL	ENST00000477853.1	37	NULL	CCDS190.1	1																																																																																			EMC1	-	-	ENSG00000127463		0.328	EMC1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EMC1	HGNC	protein_coding	OTTHUMT00000007076.2	-	0.00	19	0	C	NM_015047		19547522	-1	tier1	-	no_errors	ENST00000461353	ensembl	human	known	74_37	rna	25.00	12	4	SNP	0.000	G
ENO4	387712	genome.wustl.edu	37	10	118615248	118615248	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr10:118615248C>G	ENST00000341276.5	+	3	338	c.283C>G	c.(283-285)Caa>Gaa	p.Q95E	ENO4_ENST00000409522.1_Intron	NM_001242699.1	NP_001229628.1	A6NNW6	ENO4_HUMAN	enolase family member 4	95					glycolytic process (GO:0006096)	phosphopyruvate hydratase complex (GO:0000015)	magnesium ion binding (GO:0000287)|phosphopyruvate hydratase activity (GO:0004634)			lung(1)	1						CTGCACCATTCAAAACTTTCC	0.428																																																	0																																										SO:0001583	missense	0				CCDS73206.1	10q25.3	2012-04-19	2009-12-15	2009-12-15	ENSG00000188316	ENSG00000188316			31670	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 134"""	C10orf134			Standard	NM_001242699		Approved	AC023283.3	uc021pzj.1	A6NNW6	OTTHUMG00000019113	ENST00000341276.5:c.283C>G	10.37:g.118615248C>G	ENSP00000345555:p.Gln95Glu		B8ZZN9	Missense_Mutation	SNP	pfam_Enolase_C,pfam_Enolase_N	p.Q95E	ENST00000341276.5	37	c.283		10	.	.	.	.	.	.	.	.	.	.	C	14.90	2.672027	0.47781	.	.	ENSG00000188316	ENST00000341276	T	0.28069	1.63	5.87	5.87	0.94306	.	0.592069	0.16965	N	0.192332	T	0.46737	0.1408	M	0.72479	2.2	0.24885	N	0.992209	.	.	.	.	.	.	T	0.44513	-0.9323	8	0.59425	D	0.04	-18.0309	12.9893	0.58610	0.1611:0.8389:0.0:0.0	.	.	.	.	E	95	ENSP00000345555:Q95E	ENSP00000345555:Q95E	Q	+	1	0	ENO4	118605238	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	3.579000	0.53900	2.941000	0.99782	0.655000	0.94253	CAA	ENO4	-	pfam_Enolase_N	ENSG00000188316		0.428	ENO4-201	KNOWN	basic|appris_principal	protein_coding	ENO4	HGNC	protein_coding		-	0.00	82	0	C	NM_001242699		118615248	+1	tier1	-	no_errors	ENST00000341276	ensembl	human	known	74_37	missense	9.62	94	10	SNP	1.000	G
ENPP1	5167	genome.wustl.edu	37	6	132190551	132190551	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr6:132190551G>T	ENST00000360971.2	+	13	1347	c.1327G>T	c.(1327-1329)Gat>Tat	p.D443Y		NM_006208.2	NP_006199.2	P22413	ENPP1_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 1	443	Phosphodiesterase.				3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|ATP catabolic process (GO:0006200)|biomineral tissue development (GO:0031214)|bone remodeling (GO:0046849)|cellular phosphate ion homeostasis (GO:0030643)|cellular response to insulin stimulus (GO:0032869)|generation of precursor metabolites and energy (GO:0006091)|immune response (GO:0006955)|inorganic diphosphate transport (GO:0030505)|negative regulation of cell growth (GO:0030308)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of glucose import (GO:0046325)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of ossification (GO:0030279)|negative regulation of protein autophosphorylation (GO:0031953)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleoside triphosphate catabolic process (GO:0009143)|phosphate-containing compound metabolic process (GO:0006796)|regulation of bone mineralization (GO:0030500)|riboflavin metabolic process (GO:0006771)|sequestering of triglyceride (GO:0030730)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|insulin receptor binding (GO:0005158)|NADH pyrophosphatase activity (GO:0035529)|nucleic acid binding (GO:0003676)|nucleoside-triphosphate diphosphatase activity (GO:0047429)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|protein homodimerization activity (GO:0042803)|scavenger receptor activity (GO:0005044)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(22)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	46	Breast(56;0.0505)			GBM - Glioblastoma multiforme(226;0.0216)|OV - Ovarian serous cystadenocarcinoma(155;0.022)	Amifostine(DB01143)|Ribavirin(DB00811)	ATATTTGGGGGATGTTAAAAA	0.328																																					Colon(104;336 1535 5856 11019 33782)												0													52.0	56.0	55.0					6																	132190551		2203	4299	6502	SO:0001583	missense	0			M57736	CCDS5150.2	6q22-q23	2008-02-07			ENSG00000197594	ENSG00000197594	3.1.4.1, 3.6.1.9		3356	protein-coding gene	gene with protein product		173335		NPPS, M6S1, PDNP1		1315502	Standard	NM_006208		Approved	PC-1, PCA1	uc011ecf.2	P22413	OTTHUMG00000015572	ENST00000360971.2:c.1327G>T	6.37:g.132190551G>T	ENSP00000354238:p.Asp443Tyr		Q5T9R6|Q9NPZ3|Q9P1P6|Q9UP61|Q9Y6K3	Missense_Mutation	SNP	pfam_Phosphodiest/P_Trfase,pfam_Somatomedin_B_dom,pfam_DNA/RNA_non-sp_Endonuclease,superfamily_Alkaline_phosphatase_core,smart_Somatomedin_B_dom,smart_DNA/RNA_non-sp_Endonuclease,smart_Extracellular_endonuc_su_A,pfscan_Somatomedin_B_dom,prints_Somatomedin_B_chordata	p.D443Y	ENST00000360971.2	37	c.1327	CCDS5150.2	6	.	.	.	.	.	.	.	.	.	.	G	15.51	2.853887	0.51270	.	.	ENSG00000197594	ENST00000360971	T	0.73258	-0.73	5.14	3.33	0.38152	Alkaline-phosphatase-like, core domain (1);	0.152990	0.56097	D	0.000022	T	0.73900	0.3646	M	0.83223	2.63	0.27759	N	0.943903	D;D	0.76494	0.994;0.999	D;D	0.74023	0.942;0.982	T	0.66756	-0.5843	10	0.66056	D	0.02	-22.366	5.4276	0.16436	0.2378:0.1591:0.6031:0.0	.	443;73	P22413;Q7Z3P5	ENPP1_HUMAN;.	Y	443	ENSP00000354238:D443Y	ENSP00000354238:D443Y	D	+	1	0	ENPP1	132232244	0.381000	0.25140	0.949000	0.38748	0.995000	0.86356	0.798000	0.27014	1.295000	0.44724	0.655000	0.94253	GAT	ENPP1	-	pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	ENSG00000197594		0.328	ENPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENPP1	HGNC	protein_coding	OTTHUMT00000042238.2	-	0.00	67	0	G			132190551	+1	tier1	-	no_errors	ENST00000360971	ensembl	human	known	74_37	missense	10.53	51	6	SNP	0.334	T
LOC113230	113230	genome.wustl.edu	37	19	14183884	14183884	+	Silent	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr19:14183884C>G	ENST00000269720.2	+	2	189	c.189C>G	c.(187-189)ctC>ctG	p.L63L	hsa-mir-1199_ENST00000591982.1_3'UTR|hsa-mir-1199_ENST00000587086.1_5'UTR																							GCGAAGTCCTCGAGCCATCAG	0.652																																																	0																																										SO:0001819	synonymous_variant	0																														ENST00000269720.2:c.189C>G	19.37:g.14183884C>G				Silent	SNP	NULL	p.L63	ENST00000269720.2	37	c.189		19																																																																																			hsa-mir-1199	-	NULL	ENSG00000141854		0.652	hsa-mir-1199.1-201	KNOWN	basic	protein_coding	ENSG00000141854	miRBase	protein_coding		-	0.00	115	0	C			14183884	+1	tier1	-	no_errors	ENST00000269720	ensembl	human	known	74_37	silent	20.29	53	14	SNP	0.000	G
RP11-764K9.1	0	genome.wustl.edu	37	9	68400387	68400387	+	lincRNA	DEL	C	C	-	rs111626719		TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr9:68400387delC	ENST00000417843.2	-	0	1432																											GATCTGGGGTCCTCTGATGAG	0.542																																																	0																																												0																															9.37:g.68400387delC				RNA	DEL	-	NULL	ENST00000417843.2	37	NULL		9																																																																																			RP11-764K9.1	-	-	ENSG00000225411		0.542	RP11-764K9.1-001	KNOWN	basic	lincRNA	ENSG00000225411	Clone_based_vega_gene	lincRNA	OTTHUMT00000129817.2		0.00	11	0	C			68400387	-1	tier1		no_errors	ENST00000417843	ensembl	human	known	74_37	rna	33.33	8	4	DEL	0.103	-
MACF1	23499	genome.wustl.edu	37	1	39715548	39715548	+	Intron	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:39715548C>T	ENST00000372915.3	+	3	369				MACF1_ENST00000361689.2_Intron|MACF1_ENST00000545844.1_Intron|MACF1_ENST00000567887.1_Intron|MACF1_ENST00000536367.1_Intron|MACF1_ENST00000539005.1_Intron|RP11-420K8.1_ENST00000289890.7_RNA|MACF1_ENST00000317713.7_Intron|MACF1_ENST00000564288.1_Intron			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1						ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TCTGAAACTTCCTGAATTTTA	0.269																																																	0																																										SO:0001627	intron_variant	0			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.283-138C>T	1.37:g.39715548C>T			B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	RNA	SNP	-	NULL	ENST00000372915.3	37	NULL		1																																																																																			RP11-420K8.1	-	-	ENSG00000226438		0.269	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	ENSG00000226438	Clone_based_vega_gene	protein_coding	OTTHUMT00000392096.1	-	0.00	35	0	C	NM_033044		39715548	-1	tier1	-	no_errors	ENST00000289890	ensembl	human	known	74_37	rna	36.36	21	12	SNP	0.419	T
LOC102724392	102724392	genome.wustl.edu	37	5	70741606	70741606	+	lincRNA	DEL	C	C	-			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr5:70741606delC	ENST00000502659.2	-	0	563				RP11-136K7.1_ENST00000510180.1_lincRNA																							TTATGTTGAGCTCCTCACTGT	0.473																																																	0																																												0																															5.37:g.70741606delC				RNA	DEL	-	NULL	ENST00000502659.2	37	NULL		5																																																																																			RP11-136K7.2	-	-	ENSG00000250387		0.473	RP11-136K7.2-001	KNOWN	basic	lincRNA	ENSG00000250387	Clone_based_vega_gene	lincRNA	OTTHUMT00000374679.1		0.00	28	0	C			70741606	-1	tier1		no_errors	ENST00000502659	ensembl	human	known	74_37	rna	21.74	36	10	DEL	0.347	-
FEZ1	9638	genome.wustl.edu	37	11	125365498	125365498	+	Intron	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr11:125365498G>C	ENST00000278919.3	-	1	190				FEZ1_ENST00000524435.1_5'UTR|FEZ1_ENST00000366139.3_Intron|AP000708.1_ENST00000527818.1_Missense_Mutation_p.E92Q	NM_005103.4	NP_005094.1	Q99689	FEZ1_HUMAN	fasciculation and elongation protein zeta 1 (zygin I)						axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular response to growth factor stimulus (GO:0071363)|establishment of mitochondrion localization (GO:0051654)|nervous system development (GO:0007399)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|transport (GO:0006810)	axon (GO:0030424)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)	24	all_hematologic(175;0.228)	Breast(109;0.0021)|Lung NSC(97;0.0126)|all_lung(97;0.0132)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0934)		GGAGGGGCACGAGCGGGGTCG	0.622																																					Melanoma(180;509 2033 10762 15939 24711)												0																																										SO:0001627	intron_variant	0			U60060	CCDS31716.1, CCDS44758.1	11q24.2	2005-09-29			ENSG00000149557	ENSG00000149557			3659	protein-coding gene	gene with protein product		604825				9096408, 15843383	Standard	NM_005103		Approved		uc001qbx.3	Q99689	OTTHUMG00000165886	ENST00000278919.3:c.44+518C>G	11.37:g.125365498G>C			O00679|O00728|Q6IBI7	Missense_Mutation	SNP	NULL	p.E92Q	ENST00000278919.3	37	c.274	CCDS31716.1	11	.	.	.	.	.	.	.	.	.	.	G	12.11	1.840123	0.32513	.	.	ENSG00000255537	ENST00000527818	.	.	.	3.85	-0.675	0.11364	.	.	.	.	.	T	0.27241	0.0668	.	.	.	0.09310	N	0.999994	B	0.21147	0.052	B	0.17433	0.018	T	0.25950	-1.0117	7	0.87932	D	0	.	3.5399	0.07807	0.3972:0.1969:0.4059:0.0	.	92	Q8IYB0	YK038_HUMAN	Q	92	.	ENSP00000434154:E92Q	E	+	1	0	AP000708.1	124870708	0.000000	0.05858	0.001000	0.08648	0.015000	0.08874	-0.151000	0.10175	-0.337000	0.08426	-0.254000	0.11334	GAG	AP000708.1	-	NULL	ENSG00000255537		0.622	FEZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000255537	Clone_based_vega_gene	protein_coding	OTTHUMT00000386875.1	-	0.00	25	0	G	NM_005103		125365498	+1	tier1	-	no_errors	ENST00000527818	ensembl	human	putative	74_37	missense	28.57	20	8	SNP	0.000	C
SLC35F4	341880	genome.wustl.edu	37	14	58096827	58096827	+	Intron	SNP	A	A	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr14:58096827A>G	ENST00000556826.1	-	2	340				SLC35F4_ENST00000557430.1_Intron|CTD-2325K12.1_ENST00000600311.1_RNA	NM_001206920.1	NP_001193849.1	A4IF30	S35F4_HUMAN	solute carrier family 35, member F4						transport (GO:0006810)	integral component of membrane (GO:0016021)				breast(1)|endometrium(4)|large_intestine(3)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						TGCTTACATAATTTGGACAGA	0.388																																																	0																																										SO:0001627	intron_variant	0					14q22.3	2013-05-22		2003-11-28	ENSG00000151812	ENSG00000151812		"""Solute carriers"""	19845	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 36"""	C14orf36			Standard	NM_001206920		Approved	FLJ37712	uc021rtp.1	A4IF30	OTTHUMG00000171317	ENST00000556826.1:c.104-35985T>C	14.37:g.58096827A>G			A6NDQ3	RNA	SNP	-	NULL	ENST00000556826.1	37	NULL		14																																																																																			CTD-2325K12.1	-	-	ENSG00000258856		0.388	SLC35F4-004	NOVEL	not_organism_supported|upstream_uORF|basic|appris_principal	protein_coding	ENSG00000258856	Clone_based_vega_gene	protein_coding	OTTHUMT00000412973.1	-	0.00	100	0	A	XM_292260		58096827	+1	tier1	-	no_errors	ENST00000600311	ensembl	human	known	74_37	rna	28.09	64	25	SNP	1.000	G
PKD1	5310	genome.wustl.edu	37	16	2163121	2163121	+	Intron	DEL	C	C	-			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr16:2163121delC	ENST00000262304.4	-	12	3194				RP11-304L19.4_ENST00000568795.1_RNA|PKD1_ENST00000423118.1_Intron	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)						anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						ccccgccctgccccgccccat	0.657																																																	0													2.0	2.0	2.0					16																	2163121		957	1806	2763	SO:0001627	intron_variant	0			L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.2985+40G>-	16.37:g.2163121delC			Q15140|Q15141	RNA	DEL	-	NULL	ENST00000262304.4	37	NULL	CCDS32369.1	16																																																																																			RP11-304L19.4	-	-	ENSG00000261240		0.657	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000261240	Clone_based_vega_gene	protein_coding	OTTHUMT00000341688.1		0.00	40	0	C			2163121	+1	tier1		no_errors	ENST00000568795	ensembl	human	known	74_37	rna	18.37	40	9	DEL	0.000	-
RP11-923I11.6	0	genome.wustl.edu	37	12	52213863	52213863	+	lincRNA	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr12:52213863G>C	ENST00000562343.2	+	0	2023																											gaatgggatggagagagtgag	0.572																																																	0																																												0																															12.37:g.52213863G>C				RNA	SNP	-	NULL	ENST00000562343.2	37	NULL		12																																																																																			RP11-923I11.6	-	-	ENSG00000261586		0.572	RP11-923I11.6-001	KNOWN	basic	lincRNA	ENSG00000261586	Clone_based_vega_gene	lincRNA	OTTHUMT00000430848.2	-	0.00	20	0	G			52213863	+1	tier1	-	no_errors	ENST00000562343	ensembl	human	known	74_37	rna	23.33	23	7	SNP	0.006	C
CDON	50937	genome.wustl.edu	37	11	125828460	125828460	+	3'UTR	SNP	A	A	G	rs582224|rs371911236		TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr11:125828460A>G	ENST00000392693.3	-	0	6368				RP11-680F20.6_ENST00000531193.1_RNA|RP11-680F20.12_ENST00000582823.1_RNA|CDON_ENST00000531738.1_3'UTR|RP11-680F20.6_ENST00000524962.2_RNA	NM_001243597.1|NM_016952.4	NP_001230526.1|NP_058648.4	Q4KMG0	CDON_HUMAN	cell adhesion associated, oncogene regulated						anterior/posterior pattern specification (GO:0009952)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cerebral cortex development (GO:0021987)|embryonic body morphogenesis (GO:0010172)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|lens development in camera-type eye (GO:0002088)|muscle cell differentiation (GO:0042692)|myoblast fusion (GO:0007520)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of protein heterodimerization activity (GO:0043497)|skeletal muscle satellite cell differentiation (GO:0014816)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(9)|ovary(3)|prostate(2)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	61	all_hematologic(175;0.177)	Breast(109;0.00157)|Lung NSC(97;0.0127)|all_lung(97;0.0133)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.51e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0604)		atatatatatatgtgtgtgtg	0.308																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF004841	CCDS8468.1, CCDS58192.1	11q24.2	2013-02-11	2012-12-07		ENSG00000064309	ENSG00000064309		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17104	protein-coding gene	gene with protein product	"""cell adhesion molecule-related/down-regulated by oncogenes"""	608707	"""Cdon homolog (mouse)"""			9214393	Standard	NM_016952		Approved	ORCAM, CDO, CDON1	uc009zbw.3	Q4KMG0	OTTHUMG00000165862	ENST00000392693.3:c.*2377T>C	11.37:g.125828460A>G			O14631	RNA	SNP	-	NULL	ENST00000392693.3	37	NULL	CCDS58192.1	11																																																																																			RP11-680F20.12	-	-	ENSG00000264299		0.308	CDON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000264299	Clone_based_vega_gene	protein_coding	OTTHUMT00000386749.2	-	0.00	72	0	A	NM_016952		125828460	+1	tier1	rs582224	no_errors	ENST00000582823	ensembl	human	known	74_37	rna	7.53	86	7	SNP	0.301	G
SLFN14	342618	genome.wustl.edu	37	17	33881770	33881773	+	Intron	DEL	AAAA	AAAA	-	rs576224222|rs71366455|rs112616287|rs370866509|rs10578465		TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	AAAA	AAAA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr17:33881770_33881773delAAAA	ENST00000415846.3	-	2	1096				RP11-1094M14.12_ENST00000588445.1_RNA	NM_001129820.1	NP_001123292.1	P0C7P3	SLN14_HUMAN	schlafen family member 14								ATP binding (GO:0005524)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(3)	9						ataaaaagttaaaaaaaaaaaaaa	0.392																																																	0																																										SO:0001627	intron_variant	0				CCDS45650.1	17q12	2009-09-22				ENSG00000236320			32689	protein-coding gene	gene with protein product		614958				9846487	Standard	NM_001129820		Approved		uc010ctu.1	P0C7P3		ENST00000415846.3:c.1061-47TTTT>-	17.37:g.33881778_33881781delAAAA			B2RTW9	RNA	DEL	-	NULL	ENST00000415846.3	37	NULL	CCDS45650.1	17																																																																																			RP11-1094M14.12	-	-	ENSG00000267359		0.392	SLFN14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000267359	Clone_based_vega_gene	protein_coding	OTTHUMT00000448928.1		0.00	13	0	AAAA	NM_001129820		33881773	+1	tier1		no_errors	ENST00000588445	ensembl	human	known	74_37	rna	25.00	12	4	DEL	0.014:0.014:0.007:0.002	-
EP400	57634	genome.wustl.edu	37	12	132467003	132467003	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr12:132467003C>G	ENST00000333577.4	+	6	2126	c.2017C>G	c.(2017-2019)Cag>Gag	p.Q673E	EP400_ENST00000332482.4_Missense_Mutation_p.Q600E|EP400_ENST00000389561.2_Missense_Mutation_p.Q637E|EP400_ENST00000330386.6_Missense_Mutation_p.Q637E|EP400_ENST00000389562.2_Missense_Mutation_p.Q636E			Q96L91	EP400_HUMAN	E1A binding protein p400	673					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		GCAGGCCTCTCAGCTTTCCTC	0.562																																																	0													47.0	47.0	47.0					12																	132467003		2203	4300	6503	SO:0001583	missense	0			U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.2017C>G	12.37:g.132467003C>G	ENSP00000333602:p.Gln673Glu		O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase/SANT-assoc_DNA-bd,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Homeodomain-like,smart_HAS_subgr,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Myb-like_dom,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.Q673E	ENST00000333577.4	37	c.2017		12	.	.	.	.	.	.	.	.	.	.	C	12.57	1.978918	0.34942	.	.	ENSG00000183495	ENST00000537902;ENST00000333577;ENST00000389561;ENST00000389562;ENST00000332482;ENST00000330386;ENST00000423130;ENST00000541296;ENST00000542457	D;D;D;D;D	0.89875	-2.58;-2.57;-2.56;-2.58;-2.56	5.52	5.52	0.82312	.	0.527307	0.20589	N	0.089386	D	0.87720	0.6248	L	0.46157	1.445	0.25275	N	0.98948	B;B;B;P;P	0.37663	0.287;0.287;0.287;0.477;0.604	B;B;B;B;B	0.39258	0.215;0.215;0.215;0.295;0.275	T	0.81682	-0.0822	10	0.45353	T	0.12	.	19.4488	0.94859	0.0:1.0:0.0:0.0	.	637;637;636;673;600	Q96L91-2;Q96L91-4;Q96L91-5;F8WCN8;Q96L91-3	.;.;.;.;.	E	600;673;637;636;600;637;673;637;637	ENSP00000333602:Q673E;ENSP00000374212:Q637E;ENSP00000374213:Q636E;ENSP00000331737:Q600E;ENSP00000330620:Q637E	ENSP00000330620:Q637E	Q	+	1	0	EP400	131032956	0.926000	0.31397	0.189000	0.23252	0.807000	0.45602	5.695000	0.68279	2.586000	0.87340	0.655000	0.94253	CAG	EP400	-	NULL	ENSG00000183495		0.562	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	EP400	HGNC	protein_coding		-	0.00	26	0	C	NM_015409		132467003	+1	tier1	-	no_errors	ENST00000333577	ensembl	human	known	74_37	missense	37.50	15	9	SNP	0.658	G
EPOR	2057	genome.wustl.edu	37	19	11488935	11488935	+	Missense_Mutation	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr19:11488935C>T	ENST00000222139.6	-	8	1356	c.1252G>A	c.(1252-1254)Gga>Aga	p.G418R	EPOR_ENST00000592375.2_3'UTR	NM_000121.3	NP_000112.1	P19235	EPOR_HUMAN	erythropoietin receptor	418					brain development (GO:0007420)|decidualization (GO:0046697)|erythropoietin-mediated signaling pathway (GO:0038162)|heart development (GO:0007507)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	erythropoietin receptor activity (GO:0004900)|identical protein binding (GO:0042802)			endometrium(1)|lung(2)|ovary(1)|urinary_tract(1)	5					Darbepoetin alfa(DB00012)|Epoetin alfa(DB00016)|Epoetin Zeta(DB08923)|Peginesatide(DB08894)	GCAGAGGCTCCCTCTGGGCTG	0.622											OREG0025254	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													39.0	37.0	37.0					19																	11488935		2203	4300	6503	SO:0001583	missense	0			M34986	CCDS12260.1	19p13.3-p13.2	2013-02-11				ENSG00000187266		"""Fibronectin type III domain containing"""	3416	protein-coding gene	gene with protein product		133171					Standard	NM_000121		Approved		uc002mrj.2	P19235		ENST00000222139.6:c.1252G>A	19.37:g.11488935C>T	ENSP00000222139:p.Gly418Arg	672	B2RCG4|Q15443|Q2M205	Missense_Mutation	SNP	pirsf_Erythropoietin_rcpt,pfam_Growth/epo_recpt_lig-bind,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.G418R	ENST00000222139.6	37	c.1252	CCDS12260.1	19	.	.	.	.	.	.	.	.	.	.	C	4.699	0.129986	0.08981	.	.	ENSG00000187266	ENST00000222139	T	0.49720	0.77	4.69	4.69	0.59074	.	0.856352	0.10279	N	0.693802	T	0.35653	0.0939	L	0.57536	1.79	0.21822	N	0.999521	P	0.45902	0.868	B	0.31191	0.125	T	0.18524	-1.0334	10	0.16420	T	0.52	-22.5384	8.9306	0.35668	0.0:0.897:0.0:0.103	.	418	P19235	EPOR_HUMAN	R	418	ENSP00000222139:G418R	ENSP00000222139:G418R	G	-	1	0	EPOR	11349935	0.080000	0.21391	0.126000	0.21872	0.094000	0.18550	2.304000	0.43655	2.138000	0.66242	0.555000	0.69702	GGA	EPOR	-	pirsf_Erythropoietin_rcpt	ENSG00000187266		0.622	EPOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPOR	HGNC	protein_coding	OTTHUMT00000458791.1	-	0.00	25	0	C			11488935	-1	tier1	-	no_errors	ENST00000222139	ensembl	human	known	74_37	missense	36.00	16	9	SNP	0.512	T
ERC2	26059	genome.wustl.edu	37	3	55733455	55733455	+	Missense_Mutation	SNP	C	C	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr3:55733455C>A	ENST00000288221.6	-	16	3053	c.2798G>T	c.(2797-2799)cGa>cTa	p.R933L		NM_015576.1	NP_056391.1	O15083	ERC2_HUMAN	ELKS/RAB6-interacting/CAST family member 2	933						cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|growth cone (GO:0030426)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)		p.R933Q(2)		breast(2)|endometrium(5)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|urinary_tract(1)	31				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)		CCCAGGAGATCgatggtggtg	0.493																																																	2	Substitution - Missense(2)	endometrium(2)											237.0	245.0	242.0					3																	55733455		2070	4209	6279	SO:0001583	missense	0			AB002376	CCDS46851.1	3p14.3	2006-08-14			ENSG00000187672	ENSG00000187672			31922	protein-coding gene	gene with protein product							Standard	NM_015576		Approved	CAST, CAST1, KIAA0378, SPBC110, Spc110, ELKSL	uc003dhr.1	O15083	OTTHUMG00000158390	ENST00000288221.6:c.2798G>T	3.37:g.55733455C>A	ENSP00000288221:p.Arg933Leu		Q2T9F6|Q86TK4	Missense_Mutation	SNP	pfam_CAZ_cplx_RIM-bd_prot,superfamily_Prefoldin	p.R933L	ENST00000288221.6	37	c.2798	CCDS46851.1	3	.	.	.	.	.	.	.	.	.	.	C	17.17	3.322428	0.60634	.	.	ENSG00000187672	ENST00000288221	T	0.30714	1.52	5.66	5.66	0.87406	.	0.210236	0.41823	D	0.000813	T	0.17238	0.0414	N	0.08118	0	0.45607	D	0.998549	P	0.38827	0.649	B	0.29077	0.098	T	0.06127	-1.0844	10	0.35671	T	0.21	-7.634	20.1253	0.97977	0.0:1.0:0.0:0.0	.	933	O15083	ERC2_HUMAN	L	933	ENSP00000288221:R933L	ENSP00000288221:R933L	R	-	2	0	ERC2	55708495	0.876000	0.30132	0.998000	0.56505	0.980000	0.70556	2.720000	0.47252	2.832000	0.97577	0.655000	0.94253	CGA	ERC2	-	NULL	ENSG00000187672		0.493	ERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERC2	HGNC	protein_coding	OTTHUMT00000350884.2		0.00	43	0	C	NM_015576		55733455	-1			no_errors	ENST00000288221	ensembl	human	known	74_37	missense	6.12	46	3	SNP	1.000	A
F2	2147	genome.wustl.edu	37	11	46744983	46744983	+	Frame_Shift_Del	DEL	C	C	-			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr11:46744983delC	ENST00000311907.5	+	6	530	c.474delC	c.(472-474)cgcfs	p.R158fs	F2_ENST00000530231.1_Frame_Shift_Del_p.R158fs	NM_000506.3	NP_000497.1	P00734	THRB_HUMAN	coagulation factor II (thrombin)	158	Kringle 1. {ECO:0000255|PROSITE- ProRule:PRU00121}.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell surface receptor signaling pathway (GO:0007166)|cellular protein metabolic process (GO:0044267)|cytosolic calcium ion homeostasis (GO:0051480)|fibrinolysis (GO:0042730)|leukocyte migration (GO:0050900)|multicellular organismal development (GO:0007275)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of platelet activation (GO:0010544)|negative regulation of proteolysis (GO:0045861)|peptidyl-glutamic acid carboxylation (GO:0017187)|platelet activation (GO:0030168)|positive regulation of blood coagulation (GO:0030194)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C-activating G-protein coupled receptor signaling pathway (GO:1900738)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)|regulation of blood coagulation (GO:0030193)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)	blood microparticle (GO:0072562)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|growth factor activity (GO:0008083)|receptor binding (GO:0005102)|serine-type endopeptidase activity (GO:0004252)|thrombospondin receptor activity (GO:0070053)			endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(3)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)	27		all_lung(304;0.000414)|Lung NSC(402;0.0011)		BRCA - Breast invasive adenocarcinoma(625;0.146)	Antihemophilic Factor(DB00025)|Argatroban(DB00278)|ART-123(DB05777)|Bivalirudin(DB00006)|Coagulation Factor IX(DB00100)|Dabigatran etexilate(DB06695)|Drotrecogin alfa(DB00055)|Lepirudin(DB00001)|Menadione(DB00170)|Proflavine(DB01123)|Suramin(DB04786)|Ximelagatran(DB04898)	ATTTCTGCCGCAACCCCGACA	0.592																																					Esophageal Squamous(147;1147 1808 2148 38609 51144)												0													57.0	57.0	57.0					11																	46744983		2201	4299	6500	SO:0001589	frameshift_variant	0			M33031	CCDS31476.1	11p11.2	2013-02-28			ENSG00000180210	ENSG00000180210	3.4.21.5	"""Endogenous ligands"""	3535	protein-coding gene	gene with protein product	"""prepro-coagulation factor II"""	176930					Standard	NM_000506		Approved		uc001ndf.4	P00734	OTTHUMG00000150344	ENST00000311907.5:c.474delC	11.37:g.46744983delC	ENSP00000308541:p.Arg158fs		B2R7F7|B4E1A7|Q4QZ40|Q53H04|Q53H06|Q69EZ7|Q7Z7P3|Q9UCA1	Frame_Shift_Del	DEL	pfam_Peptidase_S1,pfam_Kringle,pfam_Thrombin_light_chain,pfam_GLA_domain,superfamily_Trypsin-like_Pept_dom,superfamily_Kringle-like,superfamily_GLA_domain,smart_GLA_domain,smart_Kringle,smart_Peptidase_S1,pirsf_Prothrombin/thrombin,pfscan_GLA_domain,pfscan_Kringle,pfscan_Peptidase_S1,prints_Prothrombin/thrombin,prints_Peptidase_S1A,prints_GLA_domain	p.N159fs	ENST00000311907.5	37	c.474	CCDS31476.1	11																																																																																			F2	-	pfam_Kringle,superfamily_Kringle-like,smart_Kringle,pirsf_Prothrombin/thrombin,pfscan_Kringle	ENSG00000180210		0.592	F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F2	HGNC	protein_coding	OTTHUMT00000317706.1		0.00	40	0	C			46744983	+1	tier1		no_errors	ENST00000311907	ensembl	human	known	74_37	frame_shift_del	5.71	33	2	DEL	0.865	-
FAM129B	64855	genome.wustl.edu	37	9	130269200	130269200	+	Missense_Mutation	SNP	T	T	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr9:130269200T>A	ENST00000373312.3	-	14	2378	c.2165A>T	c.(2164-2166)cAg>cTg	p.Q722L	FAM129B_ENST00000468379.1_5'Flank|FAM129B_ENST00000373314.3_Missense_Mutation_p.Q709L	NM_022833.2	NP_073744.2	Q96TA1	NIBL1_HUMAN	family with sequence similarity 129, member B	722					negative regulation of apoptotic process (GO:0043066)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|liver(1)|lung(7)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	25						GCTGGACACCTGCTCTCCAGT	0.677																																																	0													57.0	57.0	57.0					9																	130269200		2203	4300	6503	SO:0001583	missense	0			AF151783	CCDS35144.1, CCDS35145.1	9q34.13	2010-02-01	2006-11-23	2006-11-23	ENSG00000136830	ENSG00000136830			25282	protein-coding gene	gene with protein product		614045	"""chromosome 9 open reading frame 88"""	C9orf88		14702039, 19362540	Standard	XM_005252135		Approved	DKFZP434H0820, FLJ13518, FLJ22151, FLJ22298, bA356B19.6, MINERVA	uc004brh.3	Q96TA1	OTTHUMG00000020705	ENST00000373312.3:c.2165A>T	9.37:g.130269200T>A	ENSP00000362409:p.Gln722Leu		Q4LE55|Q5VVW6|Q5VVW7|Q9BUS2|Q9NT35	Missense_Mutation	SNP	pfscan_Pleckstrin_homology	p.Q722L	ENST00000373312.3	37	c.2165	CCDS35145.1	9	.	.	.	.	.	.	.	.	.	.	T	15.33	2.801906	0.50315	.	.	ENSG00000136830	ENST00000373314;ENST00000538931;ENST00000373312	T;T	0.24151	1.87;1.87	4.84	3.71	0.42584	.	0.768703	0.12287	N	0.482360	T	0.19725	0.0474	L	0.36672	1.1	0.34158	D	0.668386	B;B	0.18310	0.027;0.027	B;B	0.18561	0.022;0.015	T	0.18335	-1.0340	10	0.54805	T	0.06	-28.445	6.4166	0.21719	0.0:0.1084:0.0:0.8916	.	709;722	Q96TA1-2;Q96TA1	.;NIBL1_HUMAN	L	709;372;722	ENSP00000362411:Q709L;ENSP00000362409:Q722L	ENSP00000362409:Q722L	Q	-	2	0	FAM129B	129309021	0.000000	0.05858	1.000000	0.80357	0.882000	0.50991	0.111000	0.15458	1.813000	0.52934	0.459000	0.35465	CAG	FAM129B	-	NULL	ENSG00000136830		0.677	FAM129B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM129B	HGNC	protein_coding	OTTHUMT00000054196.1		0.00	12	0	T	NM_022833		130269200	-1			no_errors	ENST00000373312	ensembl	human	known	74_37	missense	40.00	3	2	SNP	1.000	A
FAM178A	55719	genome.wustl.edu	37	10	102703859	102703859	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr10:102703859G>C	ENST00000238961.4	+	12	3273	c.2731G>C	c.(2731-2733)Gaa>Caa	p.E911Q	FAM178A_ENST00000481654.1_3'UTR|FAM178A_ENST00000370269.3_Missense_Mutation_p.E911Q	NM_018121.3	NP_060591.3	Q8IX21	F178A_HUMAN	family with sequence similarity 178, member A	911						chromatin (GO:0000785)|extracellular space (GO:0005615)|nucleus (GO:0005634)											AACACTTCCTGAAACCAACAT	0.338																																																	0													68.0	68.0	68.0					10																	102703859		2203	4300	6503	SO:0001583	missense	0			AF460991	CCDS7500.1, CCDS44470.1, CCDS65918.1	10q24.31	2008-07-18	2008-07-18	2008-07-18	ENSG00000119906	ENSG00000119906			17814	protein-coding gene	gene with protein product		610348	"""chromosome 10 open reading frame 6"""	C10orf6		12459258	Standard	NM_018121		Approved	FLJ10512, FLJ25012	uc001krs.3	Q8IX21	OTTHUMG00000018919	ENST00000238961.4:c.2731G>C	10.37:g.102703859G>C	ENSP00000238961:p.Glu911Gln		A8K950|B1AL17|Q5W0L8|Q6GMU6|Q9NPE8	Missense_Mutation	SNP	NULL	p.E911Q	ENST00000238961.4	37	c.2731	CCDS7500.1	10	.	.	.	.	.	.	.	.	.	.	G	20.5	3.993686	0.74703	.	.	ENSG00000119906	ENST00000238961;ENST00000370269	T;T	0.36699	1.25;1.24	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.55226	0.1907	L	0.59436	1.845	0.42632	D	0.99338	D;D	0.89917	1.0;1.0	D;D	0.74348	0.983;0.983	T	0.54275	-0.8318	10	0.48119	T	0.1	-19.0298	14.6154	0.68544	0.0:0.0:1.0:0.0	.	911;911	Q8IX21;B1AL17	F178A_HUMAN;.	Q	911	ENSP00000238961:E911Q;ENSP00000359292:E911Q	ENSP00000238961:E911Q	E	+	1	0	FAM178A	102693849	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.239000	0.65371	2.515000	0.84797	0.585000	0.79938	GAA	FAM178A	-	NULL	ENSG00000119906		0.338	FAM178A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM178A	HGNC	protein_coding	OTTHUMT00000049897.3	-	0.00	84	0	G			102703859	+1	tier1	-	no_errors	ENST00000370269	ensembl	human	known	74_37	missense	13.54	83	13	SNP	1.000	C
FAM184B	27146	genome.wustl.edu	37	4	17661649	17661649	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr4:17661649C>G	ENST00000265018.3	-	9	1968	c.1756G>C	c.(1756-1758)Gag>Cag	p.E586Q		NM_015688.1	NP_056503.1	Q9ULE4	F184B_HUMAN	family with sequence similarity 184, member B	586										NS(1)|central_nervous_system(1)|endometrium(1)|prostate(1)	4						GATGTTTTCTCCTTCAACAAA	0.507																																																	0													119.0	104.0	108.0					4																	17661649		692	1591	2283	SO:0001583	missense	0				CCDS47033.1	4p16	2009-04-22			ENSG00000047662	ENSG00000047662			29235	protein-coding gene	gene with protein product						10574462	Standard	NM_015688		Approved	KIAA1276	uc003gpm.4	Q9ULE4	OTTHUMG00000160287	ENST00000265018.3:c.1756G>C	4.37:g.17661649C>G	ENSP00000265018:p.Glu586Gln			Missense_Mutation	SNP	NULL	p.E586Q	ENST00000265018.3	37	c.1756	CCDS47033.1	4	.	.	.	.	.	.	.	.	.	.	C	12.50	1.958127	0.34565	.	.	ENSG00000047662	ENST00000265018	T	0.32753	1.44	5.33	4.48	0.54585	.	0.749332	0.12883	N	0.431316	T	0.46658	0.1404	L	0.60455	1.87	0.35467	D	0.797011	D	0.67145	0.996	D	0.64144	0.922	T	0.47235	-0.9133	10	0.22706	T	0.39	-11.38	11.1499	0.48453	0.0:0.9127:0.0:0.0873	.	586	Q9ULE4	F184B_HUMAN	Q	586	ENSP00000265018:E586Q	ENSP00000265018:E586Q	E	-	1	0	FAM184B	17270747	0.988000	0.35896	0.973000	0.42090	0.181000	0.23173	1.047000	0.30367	1.228000	0.43614	0.563000	0.77884	GAG	FAM184B	-	NULL	ENSG00000047662		0.507	FAM184B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM184B	HGNC	protein_coding	OTTHUMT00000360137.1	-	0.00	77	0	C	NM_015688		17661649	-1	tier1	-	no_errors	ENST00000265018	ensembl	human	known	74_37	missense	25.00	39	13	SNP	1.000	G
FAM92B	339145	genome.wustl.edu	37	16	85141485	85141485	+	Silent	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr16:85141485C>G	ENST00000539556.1	-	4	548	c.393G>C	c.(391-393)ctG>ctC	p.L131L		NM_198491.1	NP_940893.1	Q6ZTR7	FA92B_HUMAN	family with sequence similarity 92, member B	131										breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)	16						ACTTCTGCCTCAGTTTCTCCA	0.502																																																	0													204.0	198.0	200.0					16																	85141485		2198	4300	6498	SO:0001819	synonymous_variant	0				CCDS32500.1	16q24.1	2005-09-22				ENSG00000153789			24781	protein-coding gene	gene with protein product						12477932	Standard	NM_198491		Approved	FLJ44299	uc021tlz.1	Q6ZTR7		ENST00000539556.1:c.393G>C	16.37:g.85141485C>G				Silent	SNP	pfam_FAM92	p.L131	ENST00000539556.1	37	c.393	CCDS32500.1	16																																																																																			FAM92B	-	pfam_FAM92	ENSG00000153789		0.502	FAM92B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM92B	HGNC	protein_coding		-	0.00	40	0	C	NM_198491		85141485	-1	tier1	-	no_errors	ENST00000539556	ensembl	human	known	74_37	silent	29.17	17	7	SNP	0.999	G
FAM92B	339145	genome.wustl.edu	37	16	85141517	85141517	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr16:85141517C>G	ENST00000539556.1	-	4	516	c.361G>C	c.(361-363)Gag>Cag	p.E121Q		NM_198491.1	NP_940893.1	Q6ZTR7	FA92B_HUMAN	family with sequence similarity 92, member B	121										breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)	16						TGTTTGATCTCATGATTTTGG	0.512																																																	0													210.0	201.0	204.0					16																	85141517		2198	4300	6498	SO:0001583	missense	0				CCDS32500.1	16q24.1	2005-09-22				ENSG00000153789			24781	protein-coding gene	gene with protein product						12477932	Standard	NM_198491		Approved	FLJ44299	uc021tlz.1	Q6ZTR7		ENST00000539556.1:c.361G>C	16.37:g.85141517C>G	ENSP00000443411:p.Glu121Gln			Missense_Mutation	SNP	pfam_FAM92	p.E121Q	ENST00000539556.1	37	c.361	CCDS32500.1	16	.	.	.	.	.	.	.	.	.	.	C	20.6	4.013838	0.75161	.	.	ENSG00000153789	ENST00000393246;ENST00000539556	T	0.58797	0.31	5.71	5.71	0.89125	.	0.000000	0.64402	D	0.000002	T	0.79975	0.4539	M	0.86420	2.815	0.48040	D	0.999573	D	0.89917	1.0	D	0.91635	0.999	T	0.82774	-0.0291	10	0.72032	D	0.01	-52.3307	17.345	0.87308	0.0:1.0:0.0:0.0	.	121	Q6ZTR7	FA92B_HUMAN	Q	121	ENSP00000443411:E121Q	ENSP00000376937:E121Q	E	-	1	0	FAM92B	83699018	1.000000	0.71417	0.956000	0.39512	0.418000	0.31294	5.047000	0.64232	2.702000	0.92279	0.498000	0.49722	GAG	FAM92B	-	pfam_FAM92	ENSG00000153789		0.512	FAM92B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM92B	HGNC	protein_coding		-	0.00	42	0	C	NM_198491		85141517	-1	tier1	-	no_errors	ENST00000539556	ensembl	human	known	74_37	missense	34.38	21	11	SNP	1.000	G
FANCD2	2177	genome.wustl.edu	37	3	10131997	10131997	+	Silent	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr3:10131997C>T	ENST00000419585.1	+	37	3866	c.3705C>T	c.(3703-3705)ttC>ttT	p.F1235F	FANCD2_ENST00000287647.3_Silent_p.F1235F|FANCD2_ENST00000383807.1_Silent_p.F1235F|FANCD2OS_ENST00000436517.1_Intron|FANCD2OS_ENST00000524279.1_Intron|FANCD2_ENST00000383806.1_Intron			Q9BXW9	FACD2_HUMAN	Fanconi anemia, complementation group D2	1235					DNA repair (GO:0006281)|gamete generation (GO:0007276)|response to gamma radiation (GO:0010332)|synapsis (GO:0007129)	condensed chromosome (GO:0000793)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA polymerase binding (GO:0070182)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	51				OV - Ovarian serous cystadenocarcinoma(96;0.148)		TTGTTTTCTTCCGTGTGATGA	0.463			"""D, Mis, N, F"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																														yes	Rec		Fanconi anaemia D2	3	3p26	2177	"""Fanconi anemia, complementation group D2"""		L	0													133.0	95.0	108.0					3																	10131997		2203	4300	6503	SO:0001819	synonymous_variant	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	AF340183	CCDS2595.1, CCDS33696.1	3p25.3	2014-09-17		2001-10-05	ENSG00000144554	ENSG00000144554		"""Fanconi anemia, complementation groups"""	3585	protein-coding gene	gene with protein product		613984		FACD, FANCD		7581463, 11239453, 18475298	Standard	XM_005264946		Approved	FAD, FA-D2	uc003buw.3	Q9BXW9	OTTHUMG00000128670	ENST00000419585.1:c.3705C>T	3.37:g.10131997C>T			Q2LA86|Q69YP9|Q6PJN7|Q9BQ06|Q9H9T9	Silent	SNP	superfamily_ARM-type_fold	p.F1235	ENST00000419585.1	37	c.3705	CCDS33696.1	3																																																																																			FANCD2	-	NULL	ENSG00000144554		0.463	FANCD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCD2	HGNC	protein_coding	OTTHUMT00000339873.1	-	0.00	61	0	C			10131997	+1	tier1	-	no_errors	ENST00000287647	ensembl	human	known	74_37	silent	17.86	46	10	SNP	1.000	T
FATE1	89885	genome.wustl.edu	37	X	150884668	150884668	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chrX:150884668G>C	ENST00000370350.3	+	1	162	c.77G>C	c.(76-78)gGg>gCg	p.G26A		NM_033085.2	NP_149076.1	Q969F0	FATE1_HUMAN	fetal and adult testis expressed 1	26						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|cervix(1)|endometrium(3)|large_intestine(2)|lung(6)|ovary(1)	15	Acute lymphoblastic leukemia(192;6.56e-05)					GGACGCCAAGGGGAAAACCAA	0.517																																																	0													85.0	64.0	71.0					X																	150884668		2017	3753	5770	SO:0001583	missense	0			AF249872	CCDS14700.1	Xq28	2009-03-25			ENSG00000147378	ENSG00000147378			24683	protein-coding gene	gene with protein product	"""cancer/testis antigen 43"""	300450				11694338	Standard	NM_033085		Approved	FATE, CT43	uc004fex.3	Q969F0	OTTHUMG00000024172	ENST00000370350.3:c.77G>C	X.37:g.150884668G>C	ENSP00000359375:p.Gly26Ala			Missense_Mutation	SNP	pfam_FATE/Miff/Tango-11	p.G26A	ENST00000370350.3	37	c.77	CCDS14700.1	X	.	.	.	.	.	.	.	.	.	.	G	12.34	1.907506	0.33721	.	.	ENSG00000147378	ENST00000370350;ENST00000417321	T;T	0.47528	0.92;0.84	4.18	-0.95	0.10372	.	1.579880	0.03649	N	0.240732	T	0.29556	0.0737	N	0.24115	0.695	0.09310	N	1	P	0.43826	0.818	B	0.39465	0.3	T	0.09907	-1.0653	10	0.23891	T	0.37	.	2.6387	0.04965	0.3381:0.0:0.3051:0.3568	.	26	Q969F0	FATE1_HUMAN	A	26;18	ENSP00000359375:G26A;ENSP00000400493:G18A	ENSP00000359375:G26A	G	+	2	0	FATE1	150635324	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-1.777000	0.01780	-0.361000	0.08125	0.600000	0.82982	GGG	FATE1	-	NULL	ENSG00000147378		0.517	FATE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FATE1	HGNC	protein_coding	OTTHUMT00000060885.1	-	0.00	32	0	G	NM_033085		150884668	+1	tier1	-	no_errors	ENST00000370350	ensembl	human	known	74_37	missense	50.00	13	13	SNP	0.000	C
FBP2	8789	genome.wustl.edu	37	9	97346898	97346898	+	Silent	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr9:97346898G>A	ENST00000375337.3	-	3	453	c.387C>T	c.(385-387)tgC>tgT	p.C129C		NM_003837.2	NP_003828.2	O00757	F16P2_HUMAN	fructose-1,6-bisphosphatase 2	129					carbohydrate metabolic process (GO:0005975)|fructose metabolic process (GO:0006000)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|small molecule metabolic process (GO:0044281)	cell junction (GO:0030054)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	fructose 1,6-bisphosphate 1-phosphatase activity (GO:0042132)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(3)|lung(5)	9		Acute lymphoblastic leukemia(62;0.136)				TGGAGGCCAGGCAGTCAATAT	0.483																																																	0													151.0	123.0	133.0					9																	97346898		2203	4300	6503	SO:0001819	synonymous_variant	0			Y10812	CCDS6711.1	9q22.3	2012-08-13			ENSG00000130957	ENSG00000130957	3.1.3.11		3607	protein-coding gene	gene with protein product		603027				9678974	Standard	NM_003837		Approved		uc004auv.3	O00757	OTTHUMG00000020269	ENST00000375337.3:c.387C>T	9.37:g.97346898G>A			Q17R39|Q6FI53	Silent	SNP	pfam_FBPase_class-1/SBPase,pfam_Inositol_monophosphatase,prints_FBPtase,prints_SBPase	p.C129	ENST00000375337.3	37	c.387	CCDS6711.1	9																																																																																			FBP2	-	pfam_FBPase_class-1/SBPase	ENSG00000130957		0.483	FBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBP2	HGNC	protein_coding	OTTHUMT00000053189.1		0.00	47	0	G	NM_003837		97346898	-1			no_errors	ENST00000375337	ensembl	human	known	74_37	silent	10.71	25	3	SNP	0.996	A
FEZ1	9638	genome.wustl.edu	37	11	125325912	125325912	+	Missense_Mutation	SNP	T	T	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr11:125325912T>C	ENST00000278919.3	-	6	992	c.758A>G	c.(757-759)cAg>cGg	p.Q253R	FEZ1_ENST00000527350.1_5'UTR	NM_005103.4	NP_005094.1	Q99689	FEZ1_HUMAN	fasciculation and elongation protein zeta 1 (zygin I)	253					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular response to growth factor stimulus (GO:0071363)|establishment of mitochondrion localization (GO:0051654)|nervous system development (GO:0007399)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|transport (GO:0006810)	axon (GO:0030424)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)	24	all_hematologic(175;0.228)	Breast(109;0.0021)|Lung NSC(97;0.0126)|all_lung(97;0.0132)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0934)		GCGGGCCAGCTGCTGCACCAG	0.587																																					Melanoma(180;509 2033 10762 15939 24711)												0													63.0	65.0	64.0					11																	125325912		2201	4299	6500	SO:0001583	missense	0			U60060	CCDS31716.1, CCDS44758.1	11q24.2	2005-09-29			ENSG00000149557	ENSG00000149557			3659	protein-coding gene	gene with protein product		604825				9096408, 15843383	Standard	NM_005103		Approved		uc001qbx.3	Q99689	OTTHUMG00000165886	ENST00000278919.3:c.758A>G	11.37:g.125325912T>C	ENSP00000278919:p.Gln253Arg		O00679|O00728|Q6IBI7	Missense_Mutation	SNP	pfam_FEZ	p.Q253R	ENST00000278919.3	37	c.758	CCDS31716.1	11	.	.	.	.	.	.	.	.	.	.	T	32	5.121688	0.94385	.	.	ENSG00000149557	ENST00000278919	T	0.33438	1.41	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.57946	0.2088	M	0.77820	2.39	0.80722	D	1	D;D	0.76494	0.999;0.991	D;D	0.83275	0.996;0.988	T	0.63116	-0.6709	10	0.87932	D	0	-14.7715	15.5626	0.76262	0.0:0.0:0.0:1.0	.	224;253	B4DKG5;Q99689	.;FEZ1_HUMAN	R	253	ENSP00000278919:Q253R	ENSP00000278919:Q253R	Q	-	2	0	FEZ1	124831122	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.967000	0.87967	2.149000	0.67028	0.533000	0.62120	CAG	FEZ1	-	pfam_FEZ	ENSG00000149557		0.587	FEZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FEZ1	HGNC	protein_coding	OTTHUMT00000386875.1	-	0.00	11	0	T	NM_005103		125325912	-1	tier1	-	no_errors	ENST00000278919	ensembl	human	known	74_37	missense	20.00	20	5	SNP	1.000	C
PLEKHA3	65977	genome.wustl.edu	37	2	179343292	179343292	+	5'Flank	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr2:179343292G>A	ENST00000234453.5	+	0	0				FKBP7_ENST00000464248.1_5'Flank|FKBP7_ENST00000434643.2_5'Flank|FKBP7_ENST00000424785.2_5'Flank	NM_019091.3	NP_061964.3	Q9HB20	PKHA3_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 3							Golgi apparatus (GO:0005794)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)|phospholipid binding (GO:0005543)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)	11			OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.0266)|all cancers(119;0.0865)			TCCCGCGGCCGAGTTCCGACG	0.652																																																	0													21.0	20.0	20.0					2																	179343292		692	1591	2283	SO:0001631	upstream_gene_variant	0			AF286162	CCDS33336.1	2q31.2	2013-01-10	2002-01-14		ENSG00000116095	ENSG00000116095		"""Pleckstrin homology (PH) domain containing"""	14338	protein-coding gene	gene with protein product	"""four-phosphate-adaptor protein 1"""	607774	"""pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 3"""			11001876, 15107860	Standard	NM_019091		Approved	FAPP1	uc002umn.3	Q9HB20	OTTHUMG00000154446		2.37:g.179343292G>A	Exception_encountered		Q4ZG69|Q86TQ1|Q9NXT3	RNA	SNP	-	NULL	ENST00000234453.5	37	NULL	CCDS33336.1	2																																																																																			FKBP7	-	-	ENSG00000079150		0.652	PLEKHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FKBP7	HGNC	protein_coding	OTTHUMT00000335241.2	-	0.00	26	0	G	NM_019091		179343292	-1	tier1	-	no_errors	ENST00000470945	ensembl	human	known	74_37	rna	16.13	26	5	SNP	0.000	A
FPGT	8790	genome.wustl.edu	37	1	74663999	74663999	+	Missense_Mutation	SNP	C	C	G	rs201738008		TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:74663999C>G	ENST00000609362.1	+	1	74	c.37C>G	c.(37-39)Cga>Gga	p.R13G	FPGT-TNNI3K_ENST00000370899.3_Missense_Mutation_p.R13G|LRRIQ3_ENST00000370911.3_5'Flank|LRRIQ3_ENST00000354431.4_5'Flank|FPGT_ENST00000482102.2_Missense_Mutation_p.R13G|FPGT_ENST00000524915.1_3'UTR|FPGT-TNNI3K_ENST00000370895.1_Missense_Mutation_p.R13G|FPGT_ENST00000534056.1_Missense_Mutation_p.R13G|FPGT_ENST00000370898.3_Missense_Mutation_p.R26G|TNNI3K_ENST00000370891.2_Missense_Mutation_p.R13G|FPGT_ENST00000370894.5_Missense_Mutation_p.R13G|LRRIQ3_ENST00000370909.2_5'Flank|FPGT-TNNI3K_ENST00000533006.1_3'UTR|FPGT_ENST00000467578.2_Missense_Mutation_p.R26G|FPGT-TNNI3K_ENST00000557284.2_Missense_Mutation_p.R26G|FPGT-TNNI3K_ENST00000370893.1_Missense_Mutation_p.R13G	NM_003838.4	NP_003829.3	O14772	FPGT_HUMAN	fucose-1-phosphate guanylyltransferase	13					fucose metabolic process (GO:0006004)	cytoplasm (GO:0005737)	catalytic activity (GO:0003824)|fucose-1-phosphate guanylyltransferase activity (GO:0047341)|GTP binding (GO:0005525)			breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(18)|ovary(1)|prostate(4)|skin(1)|urinary_tract(1)	39						AGTATCGCTGCGAGAAGCCAC	0.632																																																	0													52.0	50.0	51.0					1																	74663999		2203	4300	6503	SO:0001583	missense	0			AF017445	CCDS663.1, CCDS663.2	1p31.1	2013-09-24			ENSG00000254685	ENSG00000254685	2.7.7.30		3825	protein-coding gene	gene with protein product		603609				9804772	Standard	NM_003838		Approved	GFPP		O14772	OTTHUMG00000009571	ENST00000609362.1:c.37C>G	1.37:g.74663999C>G	ENSP00000476680:p.Arg13Gly		A6NMH3|B4DRX2|B4E2Y7|E9PNQ2|Q8N5J7	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Prot_kinase_dom,prints_Ankyrin_rpt,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R26G	ENST00000609362.1	37	c.76	CCDS663.1	1	.	.	.	.	.	.	.	.	.	.	C	14.15	2.450905	0.43531	.	.	ENSG00000254685;ENSG00000254685;ENSG00000254685;ENSG00000254685;ENSG00000254685;ENSG00000254685;ENSG00000259030;ENSG00000259030;ENSG00000259030;ENSG00000259030;ENSG00000116783;ENSG00000116783	ENST00000467578;ENST00000524915;ENST00000482102;ENST00000370898;ENST00000370894;ENST00000534056;ENST00000370899;ENST00000370895;ENST00000534632;ENST00000557284;ENST00000370891;ENST00000370893	T;T;T;T;T;T	0.75821	1.37;0.81;-0.97;-0.68;-0.96;-0.96	4.7	-2.63	0.06133	.	0.411997	0.22687	N	0.056867	T	0.44973	0.1319	L	0.59436	1.845	0.09310	N	1	P;B;B;B;B;P	0.46395	0.877;0.001;0.001;0.0;0.312;0.692	B;B;B;B;B;B	0.35240	0.198;0.002;0.001;0.001;0.09;0.131	T	0.53913	-0.8371	10	0.72032	D	0.01	.	9.8625	0.41123	0.5683:0.2083:0.2234:0.0	.	13;13;13;13;13;13	B4DH62;E9PNQ2;Q59H18-1;Q59H18-4;Q59H18-3;O14772	.;.;.;.;.;FPGT_HUMAN	G	13	ENSP00000359935:R13G;ENSP00000432819:R13G;ENSP00000359936:R13G;ENSP00000359932:R13G;ENSP00000450895:R13G;ENSP00000359928:R13G	ENSP00000359928:R13G	R	+	1	2	RP11-653A5.2;TNNI3K;AC093158.1	74436587	0.011000	0.17503	0.044000	0.18714	0.388000	0.30384	-0.411000	0.07142	-0.586000	0.05898	-1.383000	0.01170	CGA	FPGT-TNNI3K	-	NULL	ENSG00000259030		0.632	FPGT-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FPGT-TNNI3K	HGNC	protein_coding		-	0.00	54	0	C			74663999	+1	tier1	rs201738008	no_errors	ENST00000557284	ensembl	human	known	74_37	missense	9.76	37	4	SNP	0.011	G
FPGT-TNNI3K	100526835	genome.wustl.edu	37	1	74715181	74715181	+	Missense_Mutation	SNP	G	G	A	rs567503494		TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:74715181G>A	ENST00000370899.3	+	5	528	c.491G>A	c.(490-492)cGc>cAc	p.R164H	FPGT-TNNI3K_ENST00000370895.1_Missense_Mutation_p.R164H|TNNI3K_ENST00000370891.2_Missense_Mutation_p.R164H|FPGT-TNNI3K_ENST00000533006.1_3'UTR|TNNI3K_ENST00000326637.3_Missense_Mutation_p.R63H|FPGT-TNNI3K_ENST00000557284.2_Missense_Mutation_p.R177H	NM_001199327.1	NP_001186256			FPGT-TNNI3K readthrough																		TTAAATTACCGCACTGAAAAT	0.333													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18839	0.0		0.0	False		,,,				2504	0.0																0													153.0	156.0	155.0					1																	74715181		2202	4300	6502	SO:0001583	missense	0					1p31.3	2014-03-14			ENSG00000259030	ENSG00000259030			42952	other	readthrough							Standard	NM_001112808		Approved		uc001dge.2		OTTHUMG00000166281	ENST00000370899.3:c.491G>A	1.37:g.74715181G>A	ENSP00000359936:p.Arg164His			Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Prot_kinase_dom,prints_Ankyrin_rpt,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R177H	ENST00000370899.3	37	c.530		1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.392920	0.83011	.	.	ENSG00000259030;ENSG00000259030;ENSG00000259030;ENSG00000116783;ENSG00000116783	ENST00000370899;ENST00000370895;ENST00000557284;ENST00000370891;ENST00000326637	T;T;T;T;T	0.15952	2.38;2.38;2.38;2.38;2.38	5.83	3.95	0.45737	Ankyrin repeat-containing domain (3);	0.054702	0.64402	N	0.000001	T	0.16642	0.0400	L	0.34521	1.04	0.50039	D	0.999849	D;D;D;D	0.89917	1.0;1.0;0.999;1.0	D;D;D;D	0.69824	0.925;0.966;0.909;0.909	T	0.01604	-1.1314	10	0.51188	T	0.08	.	10.8712	0.46885	0.0677:0.0:0.8018:0.1305	.	63;164;164;164	Q59H18;Q59H18-1;Q59H18-4;Q59H18-3	TNI3K_HUMAN;.;.;.	H	164;164;164;164;63	ENSP00000359936:R164H;ENSP00000359932:R164H;ENSP00000450895:R164H;ENSP00000359928:R164H;ENSP00000322251:R63H	ENSP00000322251:R63H	R	+	2	0	RP11-653A5.2;AC093158.1	74487769	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.409000	0.59768	0.798000	0.33994	-0.126000	0.14955	CGC	FPGT-TNNI3K	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom	ENSG00000259030		0.333	FPGT-TNNI3K-003	NOVEL	basic|appris_candidate|readthrough_transcript|exp_conf	protein_coding	FPGT-TNNI3K	HGNC	protein_coding	OTTHUMT00000026438.3	-	0.00	44	0	G			74715181	+1	tier1	-	no_errors	ENST00000557284	ensembl	human	known	74_37	missense	21.51	73	20	SNP	1.000	A
FRY	10129	genome.wustl.edu	37	13	32753865	32753865	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr13:32753865G>T	ENST00000380250.3	+	23	3421	c.2925G>T	c.(2923-2925)atG>atT	p.M975I		NM_023037.2	NP_075463.2	Q5TBA9	FRY_HUMAN	furry homolog (Drosophila)	975						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(3)|breast(4)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(31)|lung(50)|ovary(5)|pancreas(1)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	132		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		TGCCTTTGATGAGACTAGAGA	0.398																																																	0													207.0	196.0	199.0					13																	32753865		1888	4114	6002	SO:0001583	missense	0			AL049784	CCDS41875.1	13q13.1	2008-02-05	2005-11-24	2005-11-24	ENSG00000073910	ENSG00000073910			20367	protein-coding gene	gene with protein product		614818	"""chromosome 13 open reading frame 14"""	C13orf14		14702039, 8812419	Standard	NM_023037		Approved	bA37E23.1, 13CDNA73, CG003	uc001utx.3	Q5TBA9	OTTHUMG00000016696	ENST00000380250.3:c.2925G>T	13.37:g.32753865G>T	ENSP00000369600:p.Met975Ile		Q9Y3N6	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.M975I	ENST00000380250.3	37	c.2925	CCDS41875.1	13	.	.	.	.	.	.	.	.	.	.	G	20.9	4.067670	0.76301	.	.	ENSG00000073910	ENST00000380250	T	0.58940	0.3	6.03	6.03	0.97812	.	0.080879	0.85682	D	0.000000	T	0.53142	0.1778	L	0.36672	1.1	0.80722	D	1	P	0.36909	0.573	B	0.36885	0.235	T	0.50882	-0.8775	10	0.44086	T	0.13	.	20.5568	0.99304	0.0:0.0:1.0:0.0	.	975	Q5TBA9	FRY_HUMAN	I	975	ENSP00000369600:M975I	ENSP00000369600:M975I	M	+	3	0	FRY	31651865	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.673000	0.98631	2.861000	0.98227	0.655000	0.94253	ATG	FRY	-	superfamily_ARM-type_fold	ENSG00000073910		0.398	FRY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRY	HGNC	protein_coding	OTTHUMT00000044405.1	-	0.00	37	0	G	NM_023037		32753865	+1	tier1	-	no_errors	ENST00000380250	ensembl	human	known	74_37	missense	6.78	55	4	SNP	1.000	T
FRYL	285527	genome.wustl.edu	37	4	48577189	48577189	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr4:48577189C>G	ENST00000503238.1	-	22	2790	c.2791G>C	c.(2791-2793)Gaa>Caa	p.E931Q	FRYL_ENST00000537810.1_Missense_Mutation_p.E931Q|FRYL_ENST00000264319.7_5'UTR|FRYL_ENST00000507711.1_Missense_Mutation_p.E931Q|FRYL_ENST00000358350.4_Missense_Mutation_p.E931Q|RNU5E-3P_ENST00000515913.1_RNA			O94915	FRYL_HUMAN	FRY-like	931					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(21)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	91						TCTGTGATTTCCATGCTCTCA	0.393																																																	0													119.0	112.0	114.0					4																	48577189		1881	4113	5994	SO:0001583	missense	0			AL833170	CCDS43227.1	4p12	2011-08-03	2006-11-17	2005-11-24	ENSG00000075539	ENSG00000075539			29127	protein-coding gene	gene with protein product			"""KIAA0826"", ""furry homolog-like (Drosophila)"""	KIAA0826		10048485	Standard	NM_015030		Approved	DKFZp686E205	uc003gyh.1	O94915	OTTHUMG00000160608	ENST00000503238.1:c.2791G>C	4.37:g.48577189C>G	ENSP00000426064:p.Glu931Gln		O95640|Q8WTZ5|Q9NT40	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.E931Q	ENST00000503238.1	37	c.2791	CCDS43227.1	4	.	.	.	.	.	.	.	.	.	.	C	23.4	4.415781	0.83449	.	.	ENSG00000075539	ENST00000503238;ENST00000358350;ENST00000537810;ENST00000507711	T;T;T;T	0.59502	0.26;0.26;0.26;0.26	5.71	5.71	0.89125	Armadillo-like helical (1);Armadillo-type fold (1);	0.065049	0.64402	U	0.000011	T	0.57213	0.2038	L	0.54323	1.7	0.80722	D	1	B;P	0.37176	0.322;0.586	B;B	0.38106	0.165;0.265	T	0.52689	-0.8542	10	0.24483	T	0.36	.	19.8773	0.96884	0.0:1.0:0.0:0.0	.	931;931	F2Z2S2;O94915	.;FRYL_HUMAN	Q	931	ENSP00000426064:E931Q;ENSP00000351113:E931Q;ENSP00000441114:E931Q;ENSP00000421584:E931Q	ENSP00000351113:E931Q	E	-	1	0	FRYL	48271946	1.000000	0.71417	1.000000	0.80357	0.815000	0.46073	7.461000	0.80834	2.686000	0.91538	0.650000	0.86243	GAA	FRYL	-	superfamily_ARM-type_fold	ENSG00000075539		0.393	FRYL-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FRYL	HGNC	protein_coding	OTTHUMT00000369265.2	-	0.00	119	0	C			48577189	-1	tier1	-	no_errors	ENST00000358350	ensembl	human	known	74_37	missense	20.96	132	35	SNP	1.000	G
GAB4	128954	genome.wustl.edu	37	22	17488987	17488987	+	Silent	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr22:17488987G>A	ENST00000400588.1	-	1	125	c.18C>T	c.(16-18)ccC>ccT	p.P6P	GAB4_ENST00000523144.1_5'Flank	NM_001037814.1	NP_001032903.1	Q2WGN9	GAB4_HUMAN	GRB2-associated binding protein family, member 4	6										breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(24)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	44		all_epithelial(15;0.112)|Lung NSC(13;0.248)				GGGAGGGTGAGGGGGACGGCA	0.687																																																	0													12.0	15.0	14.0					22																	17488987		2143	4244	6387	SO:0001819	synonymous_variant	0			AK057252	CCDS42976.1	22q11.2	2013-01-10			ENSG00000215568	ENSG00000215568		"""Pleckstrin homology (PH) domain containing"""	18325	protein-coding gene	gene with protein product							Standard	NM_001037814		Approved		uc002zlw.3	Q2WGN9	OTTHUMG00000149992	ENST00000400588.1:c.18C>T	22.37:g.17488987G>A				Silent	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.P6	ENST00000400588.1	37	c.18	CCDS42976.1	22																																																																																			GAB4	-	NULL	ENSG00000215568		0.687	GAB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAB4	HGNC	protein_coding	OTTHUMT00000315426.1	-	0.00	36	0	G	XM_372882		17488987	-1	tier1	-	no_errors	ENST00000400588	ensembl	human	known	74_37	silent	40.00	18	12	SNP	0.010	A
GABRB1	2560	genome.wustl.edu	37	4	47405694	47405694	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr4:47405694C>G	ENST00000295454.3	+	7	1093	c.801C>G	c.(799-801)atC>atG	p.I267M	GABRB1_ENST00000538619.1_Missense_Mutation_p.I197M	NM_000812.3	NP_000803.2	P18505	GBRB1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta 1	267					cellular response to histamine (GO:0071420)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|GABA-A receptor complex (GO:1902711)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|ligand-gated ion channel activity (GO:0015276)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44					Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Gamma Hydroxybutyric Acid(DB01440)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lindane(DB00431)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	CTTTTTGGATCAACTATGATG	0.388																																																	0													129.0	122.0	124.0					4																	47405694		2203	4300	6503	SO:0001583	missense	0				CCDS3474.1	4p12	2012-06-22			ENSG00000163288	ENSG00000163288		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4081	protein-coding gene	gene with protein product	"""GABA(A) receptor, beta 1"""	137190					Standard	NM_000812		Approved		uc003gxh.3	P18505	OTTHUMG00000044269	ENST00000295454.3:c.801C>G	4.37:g.47405694C>G	ENSP00000295454:p.Ile267Met		B2R6U7|D6REL3|Q16166|Q8TBK3	Missense_Mutation	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,prints_GABAAb_rcpt,prints_Neur_channel,prints_GABBAg_rcpt,tigrfam_Neur_channel	p.I267M	ENST00000295454.3	37	c.801	CCDS3474.1	4	.	.	.	.	.	.	.	.	.	.	C	18.22	3.574949	0.65878	.	.	ENSG00000163288	ENST00000295454;ENST00000538619	D;D	0.88124	-2.34;-2.34	5.43	4.59	0.56863	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.92146	0.7510	M	0.72624	2.21	0.58432	D	0.999999	D;D	0.76494	0.999;0.999	D;D	0.87578	0.95;0.998	D	0.92718	0.6189	10	0.87932	D	0	-28.1926	12.134	0.53959	0.0:0.8587:0.0:0.1413	.	197;267	F5GXV5;P18505	.;GBRB1_HUMAN	M	267;197	ENSP00000295454:I267M;ENSP00000440330:I197M	ENSP00000295454:I267M	I	+	3	3	GABRB1	47100451	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.101000	0.50283	1.531000	0.49152	0.655000	0.94253	ATC	GABRB1	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,tigrfam_Neur_channel	ENSG00000163288		0.388	GABRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRB1	HGNC	protein_coding	OTTHUMT00000216896.1	-	0.00	33	0	C			47405694	+1	tier1	-	no_errors	ENST00000295454	ensembl	human	known	74_37	missense	37.14	22	13	SNP	1.000	G
GADD45G	10912	genome.wustl.edu	37	9	92220309	92220309	+	Intron	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr9:92220309C>G	ENST00000252506.6	+	2	162				GADD45G_ENST00000494726.1_3'UTR|GADD45G_ENST00000375769.1_5'UTR	NM_006705.3	NP_006696.1	O95257	GA45G_HUMAN	growth arrest and DNA-damage-inducible, gamma						activation of MAPKK activity (GO:0000186)|activation of MAPKKK activity (GO:0000185)|apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|negative regulation of protein kinase activity (GO:0006469)|positive regulation of apoptotic process (GO:0043065)|positive regulation of JNK cascade (GO:0046330)|positive regulation of p38MAPK cascade (GO:1900745)|regulation of cell cycle (GO:0051726)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				lung(2)	2						GCCGCGCCCTCCGGCCGGCTC	0.721																																					Colon(131;320 2336 18973 23919)												0													3.0	4.0	4.0					9																	92220309		1919	3792	5711	SO:0001627	intron_variant	0			D83023	CCDS6686.1	9q22.1-q22.2	2008-07-21			ENSG00000130222	ENSG00000130222			4097	protein-coding gene	gene with protein product	"""gadd-related protein, 17 kD"", ""growth arrest and DNA-damage-inducible gamma"""	604949				9827804, 10496071	Standard	NM_006705		Approved	DDIT2, GADD45gamma, GRP17, CR6	uc004aqq.3	O95257	OTTHUMG00000020187	ENST00000252506.6:c.54-38C>G	9.37:g.92220309C>G			Q5VZ87|Q9C076	RNA	SNP	-	NULL	ENST00000252506.6	37	NULL	CCDS6686.1	9																																																																																			GADD45G	-	-	ENSG00000130222		0.721	GADD45G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GADD45G	HGNC	protein_coding	OTTHUMT00000053000.1	-	0.00	19	0	C	NM_006705		92220309	+1	tier1	-	no_errors	ENST00000494726	ensembl	human	known	74_37	rna	28.00	18	7	SNP	0.000	G
GAS2	2620	genome.wustl.edu	37	11	22747881	22747881	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr11:22747881C>G	ENST00000454584.2	+	4	616	c.311C>G	c.(310-312)tCg>tGg	p.S104W	GAS2_ENST00000433790.1_Missense_Mutation_p.S104W|GAS2_ENST00000278187.3_Missense_Mutation_p.S104W	NM_001143830.1	NP_001137302.1	O43903	GAS2_HUMAN	growth arrest-specific 2	104	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				apoptotic process (GO:0006915)|cell cycle arrest (GO:0007050)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|regulation of cell shape (GO:0008360)	actin filament (GO:0005884)|cytosol (GO:0005829)|membrane (GO:0016020)				breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(1)|skin(4)|stomach(1)	24						AGTGCACCCTCGGGCTCCTTT	0.418																																																	0													120.0	124.0	122.0					11																	22747881		2203	4300	6503	SO:0001583	missense	0			BC040470	CCDS7858.1	11p14.3	2005-10-11			ENSG00000148935	ENSG00000148935			4167	protein-coding gene	gene with protein product		602835				9521882	Standard	NM_005256		Approved		uc001mqo.3	O43903	OTTHUMG00000166071	ENST00000454584.2:c.311C>G	11.37:g.22747881C>G	ENSP00000401145:p.Ser104Trp		B2R9C8|D3DQZ0|Q6ICV8|Q7Z3X8	Missense_Mutation	SNP	pfam_GAS2_dom,pfam_CH-domain,superfamily_CH-domain,superfamily_GAS2_dom,smart_CH-domain,smart_GAS2_dom,pfscan_CH-domain	p.S104W	ENST00000454584.2	37	c.311	CCDS7858.1	11	.	.	.	.	.	.	.	.	.	.	C	22.4	4.290137	0.80914	.	.	ENSG00000148935	ENST00000528582;ENST00000454584;ENST00000533363;ENST00000278187;ENST00000534801;ENST00000532398;ENST00000433790	T;T;T;T;T;T;T	0.46819	0.86;0.86;0.86;0.86;0.86;0.86;0.86	5.74	5.74	0.90152	Calponin homology domain (5);	0.000000	0.85682	D	0.000000	T	0.76392	0.3981	M	0.90705	3.14	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.80027	-0.1554	10	0.62326	D	0.03	-10.604	19.9329	0.97127	0.0:1.0:0.0:0.0	.	104	O43903	GAS2_HUMAN	W	104	ENSP00000432584:S104W;ENSP00000401145:S104W;ENSP00000434478:S104W;ENSP00000278187:S104W;ENSP00000433182:S104W;ENSP00000435946:S104W;ENSP00000396708:S104W	ENSP00000278187:S104W	S	+	2	0	GAS2	22704457	1.000000	0.71417	1.000000	0.80357	0.678000	0.39670	7.818000	0.86416	2.714000	0.92807	0.650000	0.86243	TCG	GAS2	-	pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	ENSG00000148935		0.418	GAS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAS2	HGNC	protein_coding	OTTHUMT00000387717.1	-	0.00	60	0	C	NM_177553		22747881	+1	tier1	-	no_errors	ENST00000278187	ensembl	human	known	74_37	missense	12.68	62	9	SNP	1.000	G
GATAD1	57798	genome.wustl.edu	37	7	92080020	92080020	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr7:92080020C>G	ENST00000287957.3	+	3	658	c.381C>G	c.(379-381)atC>atG	p.I127M		NM_021167.4	NP_066990.3	Q8WUU5	GATD1_HUMAN	GATA zinc finger domain containing 1	127						nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.I127M(1)|p.?(1)		endometrium(1)|kidney(2)|lung(3)	6	all_cancers(62;1.63e-10)|all_epithelial(64;8.33e-10)|Breast(17;0.00311)|all_lung(186;0.0498)|Lung NSC(181;0.0676)		STAD - Stomach adenocarcinoma(171;4.51e-05)|GBM - Glioblastoma multiforme(5;8.83e-05)|all cancers(6;0.000136)|Lung(22;0.123)|Epithelial(20;0.179)|LUSC - Lung squamous cell carcinoma(200;0.225)			CATAGCCCATCAAAGCTCCTG	0.398																																																	2	Substitution - Missense(1)|Unknown(1)	lung(1)|kidney(1)											99.0	95.0	96.0					7																	92080020		2203	4300	6503	SO:0001583	missense	0				CCDS5625.1	7q21-q22	2014-09-17			ENSG00000157259	ENSG00000157259		"""GATA zinc finger domain containing"""	29941	protein-coding gene	gene with protein product	"""ocular development associated gene"""	614518				12062807	Standard	NM_021167		Approved	ODAG, RG083M05.2, FLJ22489	uc003ulx.2	Q8WUU5	OTTHUMG00000131201	ENST00000287957.3:c.381C>G	7.37:g.92080020C>G	ENSP00000287957:p.Ile127Met		B2RE37|D6W5Q5|Q8N5Y5|Q99995|Q9H689	Missense_Mutation	SNP	pfam_Znf_GATA,pfscan_Znf_GATA	p.I127M	ENST00000287957.3	37	c.381	CCDS5625.1	7	.	.	.	.	.	.	.	.	.	.	C	16.93	3.259235	0.59321	.	.	ENSG00000157259	ENST00000287957	D	0.88431	-2.38	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	D	0.90494	0.7022	L	0.41710	1.295	0.58432	D	0.999999	D	0.64830	0.994	P	0.56916	0.809	D	0.89300	0.3625	10	0.40728	T	0.16	-26.3204	18.4846	0.90824	0.0:1.0:0.0:0.0	.	127	Q8WUU5	GATD1_HUMAN	M	127	ENSP00000287957:I127M	ENSP00000287957:I127M	I	+	3	3	GATAD1	91917956	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.905000	0.48727	2.878000	0.98634	0.650000	0.86243	ATC	GATAD1	-	NULL	ENSG00000157259		0.398	GATAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GATAD1	HGNC	protein_coding	OTTHUMT00000253929.2	-	0.00	23	0	C	NM_021167		92080020	+1	tier1	-	no_errors	ENST00000287957	ensembl	human	known	74_37	missense	12.50	28	4	SNP	1.000	G
GCLM	2730	genome.wustl.edu	37	1	94370138	94370138	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:94370138C>G	ENST00000370238.3	-	2	379	c.133G>C	c.(133-135)Gat>Cat	p.D45H	GCLM_ENST00000467772.1_5'UTR	NM_002061.2	NP_002052.1	P48507	GSH0_HUMAN	glutamate-cysteine ligase, modifier subunit	45					apoptotic mitochondrial changes (GO:0008637)|cellular nitrogen compound metabolic process (GO:0034641)|cysteine metabolic process (GO:0006534)|glutamate metabolic process (GO:0006536)|glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of glutamate-cysteine ligase activity (GO:0035229)|regulation of blood vessel size (GO:0050880)|regulation of mitochondrial depolarization (GO:0051900)|response to drug (GO:0042493)|response to nitrosative stress (GO:0051409)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|glutamate-cysteine ligase complex (GO:0017109)	glutamate-cysteine ligase activity (GO:0004357)|glutamate-cysteine ligase catalytic subunit binding (GO:0035226)			endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10		all_lung(203;0.000815)|Lung NSC(277;0.00363)		all cancers(265;0.00566)|GBM - Glioblastoma multiforme(16;0.0203)|Epithelial(280;0.131)	L-Cysteine(DB00151)	TGGATACAATCATGAAGCTGC	0.323																																																	0													117.0	109.0	111.0					1																	94370138		2203	4300	6503	SO:0001583	missense	0			L35546	CCDS746.1	1p21	2008-02-05			ENSG00000023909	ENSG00000023909	6.3.2.2		4312	protein-coding gene	gene with protein product	"""gamma-glutamylcysteine synthetase"""	601176		GLCLR		7826375	Standard	NM_002061		Approved		uc001dqg.1	P48507	OTTHUMG00000010562	ENST00000370238.3:c.133G>C	1.37:g.94370138C>G	ENSP00000359258:p.Asp45His		A8K334|D3DT45|M5A959|Q6FHC1|Q9NPX9|Q9NU74	Missense_Mutation	SNP	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom	p.D45H	ENST00000370238.3	37	c.133	CCDS746.1	1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.391604	0.83011	.	.	ENSG00000023909	ENST00000370238	T	0.47869	0.83	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.49660	0.1570	L	0.58101	1.795	0.80722	D	1	D	0.57571	0.98	P	0.50231	0.635	T	0.53165	-0.8477	10	0.72032	D	0.01	.	19.6301	0.95699	0.0:1.0:0.0:0.0	.	45	P48507	GSH0_HUMAN	H	45	ENSP00000359258:D45H	ENSP00000359258:D45H	D	-	1	0	GCLM	94142726	1.000000	0.71417	1.000000	0.80357	0.803000	0.45373	6.054000	0.71096	2.742000	0.94016	0.655000	0.94253	GAT	GCLM	-	NULL	ENSG00000023909		0.323	GCLM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCLM	HGNC	protein_coding	OTTHUMT00000029169.1	-	0.00	62	0	C	NM_002061		94370138	-1	tier1	-	no_errors	ENST00000370238	ensembl	human	known	74_37	missense	21.05	45	12	SNP	1.000	G
GCNT6	644378	genome.wustl.edu	37	6	10634212	10634212	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr6:10634212G>C	ENST00000417671.1	+	1	220	c.220G>C	c.(220-222)Gat>Cat	p.D74H				Q5T4J0	GCNT6_HUMAN	glucosaminyl (N-acetyl) transferase 6	74					protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)			breast(1)	1						GTTTGGAATAGATTCTTGCCC	0.448																																																	0																																										SO:0001583	missense	0					6p24.2	2013-02-25			ENSG00000205318	ENSG00000205318		"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	21623	protein-coding gene	gene with protein product							Standard			Approved	bA421M1.3		Q5T4J0	OTTHUMG00000014243	ENST00000417671.1:c.220G>C	6.37:g.10634212G>C	ENSP00000398277:p.Asp74His			Missense_Mutation	SNP	pfam_Glyco_trans_14	p.D74H	ENST00000417671.1	37	c.220		6	.	.	.	.	.	.	.	.	.	.	G	12.26	1.883868	0.33255	.	.	ENSG00000205318	ENST00000417671;ENST00000379591	T;T	0.11712	2.88;2.75	3.88	2.96	0.34315	.	.	.	.	.	T	0.02929	0.0087	N	0.22421	0.69	0.09310	N	1	.	.	.	.	.	.	T	0.42865	-0.9426	7	0.44086	T	0.13	.	6.041	0.19734	0.0:0.2505:0.4442:0.3053	.	.	.	.	H	74;19	ENSP00000398277:D74H;ENSP00000368910:D19H	ENSP00000368910:D19H	D	+	1	0	GCNT6	10742198	0.000000	0.05858	0.001000	0.08648	0.014000	0.08584	0.678000	0.25277	0.846000	0.35142	0.655000	0.94253	GAT	GCNT6	-	NULL	ENSG00000205318		0.448	GCNT6-201	KNOWN	basic|appris_principal	protein_coding	GCNT6	HGNC	protein_coding		-	0.00	53	0	G			10634212	+1	tier1	-	no_errors	ENST00000417671	ensembl	human	known	74_37	missense	27.12	43	16	SNP	0.000	C
GFM1	85476	genome.wustl.edu	37	3	158363491	158363491	+	Nonsense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr3:158363491C>G	ENST00000486715.1	+	2	512	c.155C>G	c.(154-156)tCa>tGa	p.S52*	GFM1_ENST00000478576.1_Nonsense_Mutation_p.S52*|GFM1_ENST00000264263.5_Nonsense_Mutation_p.S52*	NM_024996.5	NP_079272.4			G elongation factor, mitochondrial 1											breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(3)|urinary_tract(2)	22			Lung(72;0.00309)|LUSC - Lung squamous cell carcinoma(72;0.0043)			ATTGGAATCTCAGCTCACATT	0.388																																																	0													120.0	119.0	119.0					3																	158363491		2203	4300	6503	SO:0001587	stop_gained	0			AF309777	CCDS33885.1	3q25	2008-02-05			ENSG00000168827	ENSG00000168827			13780	protein-coding gene	gene with protein product		606639	"""G translation elongation factor, mitochondrial"""			11374907, 11735030	Standard	NM_024996		Approved	EFGM, GFM, EGF1	uc003fce.3	Q96RP9	OTTHUMG00000158804	ENST00000486715.1:c.155C>G	3.37:g.158363491C>G	ENSP00000419038:p.Ser52*			Nonsense_Mutation	SNP	pfam_EF_GTP-bd_dom,pfam_Transl_elong_EFG/EF2_IV,pfam_EFG_V,pfam_Transl_elong_EFTu/EF1A_2,superfamily_P-loop_NTPase,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_Transl_B-barrel,superfamily_EFG_III-V,smart_Transl_elong_EFG/EF2_IV,smart_EFG_V,prints_EF_GTP-bd_dom,tigrfam_Transl_elong_EFG/EF2,tigrfam_Small_GTP-bd_dom	p.S52*	ENST00000486715.1	37	c.155	CCDS33885.1	3	.	.	.	.	.	.	.	.	.	.	C	33	5.288870	0.95517	.	.	ENSG00000168827	ENST00000486715;ENST00000478576;ENST00000264263	.	.	.	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	-6.5767	19.5841	0.95484	0.0:1.0:0.0:0.0	.	.	.	.	X	52	.	ENSP00000264263:S52X	S	+	2	0	GFM1	159846185	1.000000	0.71417	0.984000	0.44739	0.991000	0.79684	7.216000	0.77974	2.604000	0.88044	0.655000	0.94253	TCA	GFM1	-	pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,prints_EF_GTP-bd_dom,tigrfam_Transl_elong_EFG/EF2,tigrfam_Small_GTP-bd_dom	ENSG00000168827		0.388	GFM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GFM1	HGNC	protein_coding	OTTHUMT00000352271.1	-	0.00	101	0	C	NM_024996		158363491	+1	tier1	-	no_errors	ENST00000486715	ensembl	human	known	74_37	nonsense	11.21	103	13	SNP	1.000	G
GFRA1	2674	genome.wustl.edu	37	10	117825136	117825136	+	Splice_Site	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr10:117825136G>A	ENST00000355422.6	-	10	1749	c.1199C>T	c.(1198-1200)gCa>gTa	p.A400V	GFRA1_ENST00000544592.1_Splice_Site_p.A279V|GFRA1_ENST00000439649.3_Splice_Site_p.A395V|GFRA1_ENST00000369236.1_Splice_Site_p.A395V	NM_005264.4	NP_005255.1	P56159	GFRA1_HUMAN	GDNF family receptor alpha 1	400					axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	glial cell-derived neurotrophic factor receptor activity (GO:0016167)|receptor binding (GO:0005102)			endometrium(2)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)	26		Lung NSC(174;0.21)		all cancers(201;0.0337)		CAGCTTCTGTGCCTGGAGAGG	0.398																																					Ovarian(128;329 1725 45498 46808 50759)												0													89.0	80.0	83.0					10																	117825136		2203	4300	6503	SO:0001630	splice_region_variant	0			AF038421	CCDS7593.1, CCDS44481.1	10q25-q26	2011-01-25			ENSG00000151892	ENSG00000151892			4243	protein-coding gene	gene with protein product		601496		GDNFRA		9465905, 9545641	Standard	NM_005264		Approved	RETL1, GDNFR, GFR-ALPHA-1, RET1L, TRNR1	uc001lcj.3	P56159	OTTHUMG00000019097	ENST00000355422.6:c.1198-1C>T	10.37:g.117825136G>A			A8KA21|O15507|O43912	Missense_Mutation	SNP	pfam_GDNF/GAS1,smart_GDNF/GAS1,pirsf_Glial_neurotroph_fac_rcpt_a1/2,prints_GDNF_rcpt,prints_GDNF_rcpt_A1	p.A400V	ENST00000355422.6	37	c.1199	CCDS44481.1	10	.	.	.	.	.	.	.	.	.	.	G	16.06	3.016362	0.54468	.	.	ENSG00000151892	ENST00000439649;ENST00000369236;ENST00000355422;ENST00000544592;ENST00000369234	T;T	0.49432	1.4;0.78	6.16	6.16	0.99307	.	0.049349	0.85682	D	0.000000	T	0.50633	0.1627	M	0.65498	2.005	0.80722	D	1	B;B	0.24043	0.058;0.096	B;B	0.22152	0.017;0.038	T	0.42666	-0.9438	10	0.49607	T	0.09	-11.9121	18.0158	0.89239	0.0:0.0:1.0:0.0	.	400;395	P56159;P56159-2	GFRA1_HUMAN;.	V	400;395;395;279;395	ENSP00000358239:A395V;ENSP00000442179:A279V	ENSP00000347591:A395V	A	-	2	0	GFRA1	117815126	1.000000	0.71417	1.000000	0.80357	0.442000	0.32017	4.090000	0.57693	2.937000	0.99478	0.650000	0.86243	GCA	GFRA1	-	pirsf_Glial_neurotroph_fac_rcpt_a1/2	ENSG00000151892		0.398	GFRA1-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	GFRA1	HGNC	protein_coding	OTTHUMT00000050512.2	-	0.00	23	0	G	NM_145793	Missense_Mutation	117825136	-1	tier1	-	no_errors	ENST00000355422	ensembl	human	known	74_37	missense	17.24	24	5	SNP	1.000	A
GLTSCR1	29998	genome.wustl.edu	37	19	48176990	48176990	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr19:48176990C>G	ENST00000396720.3	+	4	249	c.55C>G	c.(55-57)Ctc>Gtc	p.L19V	CTD-2571L23.8_ENST00000599924.1_lincRNA	NM_015711.3	NP_056526.3	Q9NZM4	GSCR1_HUMAN	glioma tumor suppressor candidate region gene 1	19										breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|pancreas(3)|prostate(4)|skin(2)	20		all_cancers(25;1.8e-07)|all_lung(116;5.73e-06)|Lung NSC(112;9.69e-06)|all_epithelial(76;2.42e-05)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000358)|OV - Ovarian serous cystadenocarcinoma(262;0.000576)|Epithelial(262;0.0212)|GBM - Glioblastoma multiforme(486;0.0355)		CCCACAGGCCCTCAATGACTT	0.602																																																	0													100.0	94.0	96.0					19																	48176990		1568	3582	5150	SO:0001583	missense	0			AF182077	CCDS46134.1	19q13.3	2012-11-29			ENSG00000063169	ENSG00000063169			4332	protein-coding gene	gene with protein product		605690				10708517	Standard	NM_015711		Approved		uc002phh.4	Q9NZM4		ENST00000396720.3:c.55C>G	19.37:g.48176990C>G	ENSP00000379946:p.Leu19Val		A8MW01	Missense_Mutation	SNP	NULL	p.L19V	ENST00000396720.3	37	c.55	CCDS46134.1	19	.	.	.	.	.	.	.	.	.	.	c	10.31	1.314795	0.23908	.	.	ENSG00000063169	ENST00000396720	T	0.62941	-0.01	3.72	2.58	0.30949	.	.	.	.	.	T	0.54029	0.1833	L	0.57536	1.79	0.33901	D	0.638532	B	0.31705	0.336	B	0.30782	0.12	T	0.67597	-0.5630	9	0.87932	D	0	.	6.8465	0.23990	0.0:0.7104:0.1829:0.1067	.	19	Q9NZM4	GSCR1_HUMAN	V	19	ENSP00000379946:L19V	ENSP00000379946:L19V	L	+	1	0	GLTSCR1	52868802	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	2.512000	0.45485	2.051000	0.60960	0.556000	0.70494	CTC	GLTSCR1	-	NULL	ENSG00000063169		0.602	GLTSCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLTSCR1	HGNC	protein_coding	OTTHUMT00000465846.1	-	0.00	42	0	C	NM_015711		48176990	+1	tier1	-	no_errors	ENST00000396720	ensembl	human	known	74_37	missense	8.70	42	4	SNP	1.000	G
GLYR1	84656	genome.wustl.edu	37	16	4863802	4863802	+	Missense_Mutation	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr16:4863802C>T	ENST00000321919.9	-	12	1131	c.1055G>A	c.(1054-1056)cGc>cAc	p.R352H	GLYR1_ENST00000591451.1_Missense_Mutation_p.R346H|GLYR1_ENST00000381983.3_Missense_Mutation_p.R335H|GLYR1_ENST00000436648.5_Missense_Mutation_p.R271H	NM_032569.3	NP_115958	Q49A26	GLYR1_HUMAN	glyoxylate reductase 1 homolog (Arabidopsis)	352					pentose-phosphate shunt (GO:0006098)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|NAD binding (GO:0051287)|phosphogluconate dehydrogenase (decarboxylating) activity (GO:0004616)			endometrium(1)|kidney(1)|large_intestine(7)|lung(6)|prostate(2)|skin(1)|urinary_tract(1)	19						CTTCCCAGGGCGGATCCCTTG	0.622																																																	0													71.0	53.0	59.0					16																	4863802		2197	4300	6497	SO:0001583	missense	0			AF244907	CCDS10524.1	16p13.3	2010-02-17			ENSG00000140632	ENSG00000140632			24434	protein-coding gene	gene with protein product	"""nuclear protein 60kDa"""	610660				16352664	Standard	NM_032569		Approved	BM045, HIBDL, NP60, N-PAC	uc002cxx.4	Q49A26	OTTHUMG00000129530	ENST00000321919.9:c.1055G>A	16.37:g.4863802C>T	ENSP00000322716:p.Arg352His		B4DL47|C9JJ40|C9JJ60|Q5U632|Q6P1Q2|Q6V3W7|Q9BTI1|Q9BXK2	Missense_Mutation	SNP	pfam_6PGDH_NADP-bd,pfam_PWWP_dom,superfamily_6-PGluconate_DH_C-like,smart_PWWP_dom,pfscan_PWWP_dom	p.R352H	ENST00000321919.9	37	c.1055	CCDS10524.1	16	.	.	.	.	.	.	.	.	.	.	C	20.2	3.955423	0.73902	.	.	ENSG00000140632	ENST00000321919;ENST00000381983;ENST00000436648	T;T;T	0.70516	-0.18;-0.17;-0.49	5.37	5.37	0.77165	6-phosphogluconate dehydrogenase, NADP-binding (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.76723	0.4027	L	0.41710	1.295	0.80722	D	1	B;P;B;D	0.76494	0.169;0.709;0.169;0.999	B;B;B;P	0.60236	0.034;0.08;0.049;0.871	T	0.75958	-0.3134	10	0.44086	T	0.13	-9.9325	18.2373	0.89954	0.0:1.0:0.0:0.0	.	271;346;335;352	Q49A26-5;Q49A26-3;Q49A26-2;Q49A26	.;.;.;GLYR1_HUMAN	H	352;335;271	ENSP00000322716:R352H;ENSP00000371413:R335H;ENSP00000390276:R271H	ENSP00000322716:R352H	R	-	2	0	GLYR1	4803803	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.447000	0.80620	2.667000	0.90743	0.655000	0.94253	CGC	GLYR1	-	pfam_6PGDH_NADP-bd	ENSG00000140632		0.622	GLYR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GLYR1	HGNC	protein_coding	OTTHUMT00000251717.2		0.00	22	0	C	NM_032569		4863802	-1			no_errors	ENST00000321919	ensembl	human	known	74_37	missense	11.11	32	4	SNP	1.000	T
GNPTAB	79158	genome.wustl.edu	37	12	102158669	102158669	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr12:102158669G>T	ENST00000299314.7	-	13	2288	c.2026C>A	c.(2026-2028)Ccg>Acg	p.P676T	RNU6-101P_ENST00000410323.1_RNA	NM_024312.4	NP_077288.2	Q3T906	GNPTA_HUMAN	N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits	676					carbohydrate phosphorylation (GO:0046835)|cell differentiation (GO:0030154)|lysosome organization (GO:0007040)|protein secretion (GO:0009306)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|UDP-N-acetylglucosamine-lysosomal-enzyme N-acetylglucosaminephosphotransferase activity (GO:0003976)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(8)|lung(8)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	37						TTAAACTTCGGGAAGCGTTTT	0.423																																																	0													61.0	62.0	62.0					12																	102158669		2203	4300	6503	SO:0001583	missense	0			AY687932	CCDS9088.1	12q23.3	2013-01-10				ENSG00000111670		"""EF-hand domain containing"""	29670	protein-coding gene	gene with protein product		607840		GNPTA		10574462, 16116615	Standard	NM_024312		Approved	KIAA1208, MGC4170	uc001tit.3	Q3T906	OTTHUMG00000170444	ENST00000299314.7:c.2026C>A	12.37:g.102158669G>T	ENSP00000299314:p.Pro676Thr		A2RRQ9|Q3ZQK2|Q6IPW5|Q86TQ2|Q96N13|Q9ULL2	Missense_Mutation	SNP	pfam_DMAP1-bd,pfam_Notch_dom,pfam_DUF3184,superfamily_Notch_dom,smart_Notch_dom,pfscan_EF_hand_dom,pfscan_Notch_dom	p.P676T	ENST00000299314.7	37	c.2026	CCDS9088.1	12	.	.	.	.	.	.	.	.	.	.	G	19.56	3.849699	0.71603	.	.	ENSG00000111670	ENST00000299314	D	0.96619	-4.07	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	D	0.96962	0.9008	L	0.36672	1.1	0.80722	D	1	D	0.76494	0.999	D	0.66084	0.941	D	0.97391	0.9989	10	0.87932	D	0	-17.1193	20.422	0.99049	0.0:0.0:1.0:0.0	.	676	Q3T906	GNPTA_HUMAN	T	676	ENSP00000299314:P676T	ENSP00000299314:P676T	P	-	1	0	GNPTAB	100682800	1.000000	0.71417	0.995000	0.50966	0.211000	0.24417	9.117000	0.94347	2.832000	0.97577	0.655000	0.94253	CCG	GNPTAB	-	NULL	ENSG00000111670		0.423	GNPTAB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNPTAB	HGNC	protein_coding	OTTHUMT00000409182.1		0.00	53	0	G			102158669	-1			no_errors	ENST00000299314	ensembl	human	known	74_37	missense	5.19	73	4	SNP	1.000	T
GPC6	10082	genome.wustl.edu	37	13	93879852	93879852	+	Missense_Mutation	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr13:93879852C>T	ENST00000377047.4	+	1	758	c.143C>T	c.(142-144)cCc>cTc	p.P48L		NM_005708.3	NP_005699.1	Q9Y625	GPC6_HUMAN	glypican 6	48					carbohydrate metabolic process (GO:0005975)|cell migration (GO:0016477)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	38	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;5.48e-07)|all_epithelial(2;5.69e-08)|all_lung(2;2.19e-05)|Lung NSC(4;6.09e-05)|Breast(118;0.0395)|Renal(2;0.0568)|Hepatocellular(115;0.217)				GCGGACATCCCCTACCAGGAG	0.721											OREG0022460	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													29.0	29.0	29.0					13																	93879852		2201	4297	6498	SO:0001583	missense	0			AF111178	CCDS9469.1	13q32	2008-02-05			ENSG00000183098	ENSG00000183098		"""Proteoglycans / Cell Surface : Glypicans"""	4454	protein-coding gene	gene with protein product	"""glypican proteoglycan 6"""	604404				10329016	Standard	NM_005708		Approved		uc001vlt.3	Q9Y625	OTTHUMG00000017205	ENST00000377047.4:c.143C>T	13.37:g.93879852C>T	ENSP00000366246:p.Pro48Leu	1301	A8K279|Q96SG5|Q96SG8|Q9H1P4	Missense_Mutation	SNP	pfam_Glypican	p.P48L	ENST00000377047.4	37	c.143	CCDS9469.1	13	.	.	.	.	.	.	.	.	.	.	C	25.2	4.617262	0.87359	.	.	ENSG00000183098	ENST00000377047	T	0.57436	0.4	5.36	5.36	0.76844	.	0.219588	0.29152	N	0.012984	T	0.76898	0.4052	M	0.87180	2.865	0.58432	D	0.99999	D;D	0.62365	0.991;0.973	P;D	0.71414	0.828;0.973	T	0.80317	-0.1433	10	0.59425	D	0.04	.	18.7056	0.91637	0.0:1.0:0.0:0.0	.	48;48	B4E2M1;Q9Y625	.;GPC6_HUMAN	L	48	ENSP00000366246:P48L	ENSP00000366246:P48L	P	+	2	0	GPC6	92677853	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.679000	0.68160	2.527000	0.85204	0.655000	0.94253	CCC	GPC6	-	pfam_Glypican	ENSG00000183098		0.721	GPC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPC6	HGNC	protein_coding	OTTHUMT00000045460.4	-	0.00	20	0	C	NM_005708		93879852	+1	tier1	-	no_errors	ENST00000377047	ensembl	human	known	74_37	missense	46.67	8	7	SNP	1.000	T
GPR156	165829	genome.wustl.edu	37	3	119886160	119886160	+	Missense_Mutation	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr3:119886160C>T	ENST00000464295.1	-	10	2609	c.2164G>A	c.(2164-2166)Gaa>Aaa	p.E722K	GPR156_ENST00000315843.3_Missense_Mutation_p.E722K|GPR156_ENST00000461057.1_Missense_Mutation_p.E718K			Q8NFN8	GP156_HUMAN	G protein-coupled receptor 156	722						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled GABA receptor activity (GO:0004965)			breast(2)|endometrium(3)|kidney(1)|large_intestine(11)|lung(12)|ovary(1)|prostate(1)|skin(1)	32				GBM - Glioblastoma multiforme(114;0.19)		TGCCACTGTTCAGGCAAGTCA	0.577																																																	0													42.0	46.0	45.0					3																	119886160		2202	4300	6502	SO:0001583	missense	0			AF488739	CCDS2997.1, CCDS54629.1	3q13.33	2012-08-21			ENSG00000175697	ENSG00000175697		"""GPCR / Class C : Orphans"""	20844	protein-coding gene	gene with protein product		610464				12591167	Standard	NM_153002		Approved	PGR28, GABABL	uc011bjf.2	Q8NFN8	OTTHUMG00000159406	ENST00000464295.1:c.2164G>A	3.37:g.119886160C>T	ENSP00000417261:p.Glu722Lys		B7ZL66|E9PFZ4|Q14CM1|Q86SN6	Missense_Mutation	SNP	pfam_GPCR_3_C,pfscan_GPCR_3_C,prints_GPCR_3_GABA_rcpt_B	p.E722K	ENST00000464295.1	37	c.2164	CCDS2997.1	3	.	.	.	.	.	.	.	.	.	.	C	10.72	1.428929	0.25726	.	.	ENSG00000175697	ENST00000464295;ENST00000315843;ENST00000461057	T;T;T	0.22336	1.96;1.96;1.96	4.57	2.76	0.32466	.	0.913779	0.09415	N	0.805226	T	0.17365	0.0417	L	0.43152	1.355	0.09310	N	1	B;B	0.10296	0.003;0.003	B;B	0.04013	0.001;0.001	T	0.30238	-0.9985	9	.	.	.	-0.2943	6.8559	0.24040	0.0:0.6857:0.1448:0.1695	.	718;722	E9PFZ4;Q8NFN8	.;GP156_HUMAN	K	722;722;718	ENSP00000417261:E722K;ENSP00000324553:E722K;ENSP00000418758:E718K	.	E	-	1	0	GPR156	121368850	0.150000	0.22732	0.001000	0.08648	0.036000	0.12997	1.271000	0.33098	0.650000	0.30769	0.462000	0.41574	GAA	GPR156	-	NULL	ENSG00000175697		0.577	GPR156-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GPR156	HGNC	protein_coding	OTTHUMT00000355139.1	-	0.00	34	0	C	NM_153002		119886160	-1	tier1	-	no_errors	ENST00000315843	ensembl	human	known	74_37	missense	12.50	28	4	SNP	0.000	T
GPR180	160897	genome.wustl.edu	37	13	95271749	95271749	+	Silent	SNP	A	A	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr13:95271749A>C	ENST00000376958.4	+	5	739	c.714A>C	c.(712-714)ccA>ccC	p.P238P		NM_180989.5	NP_851320.1	Q86V85	GP180_HUMAN	G protein-coupled receptor 180	238					G-protein coupled receptor signaling pathway (GO:0007186)|response to pheromone (GO:0019236)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(3)|lung(4)|urinary_tract(1)	10	all_neural(89;0.0684)|Medulloblastoma(90;0.163)					TAGGGGTACCATTTATGGGAA	0.303																																																	0													118.0	118.0	118.0					13																	95271749		2203	4299	6502	SO:0001819	synonymous_variant	0			AF339823	CCDS9472.1	13q32.1	2006-04-05			ENSG00000152749	ENSG00000152749			28899	protein-coding gene	gene with protein product	"""intimal thickness related receptor"""	607787				12538434	Standard	NM_180989		Approved	ITR	uc001vly.3	Q86V85	OTTHUMG00000017207	ENST00000376958.4:c.714A>C	13.37:g.95271749A>C			A8K1D5	Silent	SNP	pfam_Intimal_thickness-rel_rcpt,pfam_TM_rcpt_euk	p.P238	ENST00000376958.4	37	c.714	CCDS9472.1	13																																																																																			GPR180	-	pfam_Intimal_thickness-rel_rcpt,pfam_TM_rcpt_euk	ENSG00000152749		0.303	GPR180-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR180	HGNC	protein_coding	OTTHUMT00000045465.3	-	0.00	55	0	A	NM_180989		95271749	+1	tier1	-	no_errors	ENST00000376958	ensembl	human	known	74_37	silent	17.57	61	13	SNP	1.000	C
GPR3	2827	genome.wustl.edu	37	1	27721276	27721276	+	Missense_Mutation	SNP	G	G	T	rs145491319	byFrequency	TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:27721276G>T	ENST00000374024.3	+	2	1073	c.974G>T	c.(973-975)cGc>cTc	p.R325L		NM_005281.3	NP_005272.1	P46089	GPR3_HUMAN	G protein-coupled receptor 3	325					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|regulation of meiosis (GO:0040020)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			endometrium(3)|lung(3)|ovary(1)|skin(1)	8		Breast(348;1.53e-05)|Ovarian(437;0.0606)|all_lung(284;0.157)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0415)|OV - Ovarian serous cystadenocarcinoma(117;2.81e-26)|Colorectal(126;1.24e-08)|KIRC - Kidney renal clear cell carcinoma(1967;3.23e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;4.45e-06)|Lung(427;0.00163)|STAD - Stomach adenocarcinoma(196;0.00303)|LUSC - Lung squamous cell carcinoma(448;0.008)|READ - Rectum adenocarcinoma(331;0.0419)		TTCCGATCCCGCTCCCCCAGT	0.527																																																	0													134.0	129.0	131.0					1																	27721276		2203	4300	6503	SO:0001583	missense	0			BC032702	CCDS303.1	1p36.1-p35	2012-08-21			ENSG00000181773	ENSG00000181773		"""GPCR / Class A : Orphans"""	4484	protein-coding gene	gene with protein product		600241				7851889	Standard	NM_005281		Approved	ACCA	uc001bod.4	P46089	OTTHUMG00000003397	ENST00000374024.3:c.974G>T	1.37:g.27721276G>T	ENSP00000363136:p.Arg325Leu		A8K570	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,prints_GPR_3/6/12_orphan,prints_GPR3,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.R325L	ENST00000374024.3	37	c.974	CCDS303.1	1	.	.	.	.	.	.	.	.	.	.	G	18.39	3.614195	0.66672	.	.	ENSG00000181773	ENST00000374024	T	0.36520	1.25	5.93	5.93	0.95920	.	2.887400	0.01180	N	0.007067	T	0.65595	0.2706	L	0.52905	1.665	0.45607	D	0.998545	D	0.71674	0.998	D	0.78314	0.991	T	0.44467	-0.9326	10	0.87932	D	0	.	19.1152	0.93336	0.0:0.0:1.0:0.0	.	325	P46089	GPR3_HUMAN	L	325	ENSP00000363136:R325L	ENSP00000363136:R325L	R	+	2	0	GPR3	27593863	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	7.843000	0.86859	2.815000	0.96918	0.561000	0.74099	CGC	GPR3	-	NULL	ENSG00000181773		0.527	GPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR3	HGNC	protein_coding	OTTHUMT00000009522.1		0.00	31	0	G	NM_005281		27721276	+1			no_errors	ENST00000374024	ensembl	human	known	74_37	missense	6.67	28	2	SNP	1.000	T
GPR98	84059	genome.wustl.edu	37	5	89949169	89949169	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr5:89949169G>C	ENST00000405460.2	+	20	3874	c.3778G>C	c.(3778-3780)Gaa>Caa	p.E1260Q		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	1260					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		TGTCCTGTCTGAAGATGATAT	0.438																																																	0													117.0	110.0	112.0					5																	89949169		1959	4155	6114	SO:0001583	missense	0			AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.3778G>C	5.37:g.89949169G>C	ENSP00000384582:p.Glu1260Gln		O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	pfam_Calx_beta,pfam_EPTP,pfam_GPCR_2_secretin-like,pfam_GPS_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Gal_Oxase/kelch_b-propeller,smart_Calx_beta,pfscan_EAR,pfscan_GPS_dom,pfscan_GPCR_2-like	p.E1260Q	ENST00000405460.2	37	c.3778	CCDS47246.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.7|21.7	4.187194|4.187194	0.78789|0.78789	.|.	.|.	ENSG00000164199|ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000399043|ENST00000504142	T|.	0.31769|.	1.48|.	5.84|5.84	5.84|5.84	0.93424|0.93424	.|.	0.144593|.	0.64402|.	D|.	0.000007|.	T|.	0.78400|.	0.4277|.	M|M	0.76002|0.76002	2.32|2.32	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.73708|.	0.981|.	T|.	0.75755|.	-0.3206|.	10|.	0.44086|.	T|.	0.13|.	.|.	20.5224|20.5224	0.99228|0.99228	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1260|.	Q8WXG9|.	GPR98_HUMAN|.	Q|S	1260|848	ENSP00000384582:E1260Q|.	ENSP00000296619:E1260Q|.	E|X	+|+	1|2	0|2	GPR98|GPR98	89984925|89984925	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.891000|0.891000	0.51852|0.51852	6.285000|6.285000	0.72658|0.72658	2.927000|2.927000	0.99377|0.99377	0.637000|0.637000	0.83480|0.83480	GAA|TGA	GPR98	-	NULL	ENSG00000164199		0.438	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR98	HGNC	protein_coding	OTTHUMT00000369993.2	-	0.00	42	0	G	NM_032119		89949169	+1	tier1	-	no_errors	ENST00000405460	ensembl	human	known	74_37	missense	15.87	53	10	SNP	1.000	C
GRIA3	2892	genome.wustl.edu	37	X	122613989	122613989	+	Intron	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chrX:122613989C>T	ENST00000371251.1	+	15	2491				GRIA3_ENST00000371256.5_Silent_p.Y800Y|GRIA3_ENST00000542149.1_3'UTR|GRIA3_ENST00000264357.5_Intron			P42263	GRIA3_HUMAN	glutamate receptor, ionotropic, AMPA 3						glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)			breast(2)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|pancreas(2)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	57					Lithium(DB01356)	AATGGTGGTACGATAAGGGGG	0.418																																																	0													130.0	105.0	113.0					X																	122613989		2203	4300	6503	SO:0001627	intron_variant	0			U10301	CCDS14604.1, CCDS14605.1, CCDS76017.1	Xq25	2012-08-29	2012-02-03		ENSG00000125675	ENSG00000125675		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4573	protein-coding gene	gene with protein product		305915	"""glutamate receptor, ionotrophic, AMPA 3"""	GLUR3		1319477, 10644433	Standard	NM_007325		Approved	GluA3, GLURC, MRX94	uc004etr.4	P42263	OTTHUMG00000022685	ENST00000371251.1:c.2440-2661C>T	X.37:g.122613989C>T			D3DTF1|Q4VXD5|Q4VXD6|Q9HDA0|Q9HDA1|Q9HDA2|Q9P0H1	Silent	SNP	pfam_Iontro_glu_rcpt,pfam_ANF_lig-bd_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.Y800	ENST00000371251.1	37	c.2400	CCDS14604.1	X																																																																																			GRIA3	-	pfam_Iontro_glu_rcpt,smart_Iontro_glu_rcpt	ENSG00000125675		0.418	GRIA3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRIA3	HGNC	protein_coding	OTTHUMT00000058854.1	-	0.00	72	0	C	NM_000828		122613989	+1	tier1	-	no_errors	ENST00000371256	ensembl	human	known	74_37	silent	53.25	36	41	SNP	1.000	T
GRID2IP	392862	genome.wustl.edu	37	7	6541650	6541650	+	Missense_Mutation	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr7:6541650C>T	ENST00000457091.2	-	19	3249	c.3250G>A	c.(3250-3252)Gac>Aac	p.D1084N	GRID2IP_ENST00000435185.1_Missense_Mutation_p.D900N|GRID2IP_ENST00000452113.1_Missense_Mutation_p.D893N	NM_001145118.1	NP_001138590.1	A4D2P6	GRD2I_HUMAN	glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein	1084	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				long term synaptic depression (GO:0060292)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				endometrium(4)	4						GTGGGCAGGTCCTGAGCAAAG	0.622																																																	0													81.0	81.0	81.0					7																	6541650		692	1591	2283	SO:0001583	missense	0				CCDS47537.1	7p22	2007-10-05	2006-03-01		ENSG00000215045	ENSG00000215045			18464	protein-coding gene	gene with protein product		610639	"""glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein 1"""			14612983	Standard	NM_001145118		Approved		uc011jwx.2	A4D2P6	OTTHUMG00000155531	ENST00000457091.2:c.3250G>A	7.37:g.6541650C>T	ENSP00000397351:p.Asp1084Asn			Missense_Mutation	SNP	pfam_FH2_Formin,pfam_PDZ,superfamily_PDZ,smart_PDZ,smart_FH2_Formin,pfscan_PDZ	p.D1084N	ENST00000457091.2	37	c.3250	CCDS47537.1	7	.	.	.	.	.	.	.	.	.	.	C	28.5	4.921707	0.92319	.	.	ENSG00000215045	ENST00000452113;ENST00000435185;ENST00000457091	T;T;T	0.68479	-0.33;-0.33;-0.33	4.86	4.86	0.63082	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.000000	0.85682	U	0.000000	T	0.78742	0.4331	M	0.70595	2.14	0.80722	D	1	D	0.60575	0.988	P	0.60473	0.875	T	0.81792	-0.0770	10	0.87932	D	0	.	15.8693	0.79098	0.0:1.0:0.0:0.0	.	1084	A4D2P6	GRD2I_HUMAN	N	893;900;1084	ENSP00000397887:D893N;ENSP00000408364:D900N;ENSP00000397351:D1084N	ENSP00000408364:D900N	D	-	1	0	GRID2IP	6508175	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.433000	0.80362	2.414000	0.81942	0.563000	0.77884	GAC	GRID2IP	-	pfam_FH2_Formin,smart_FH2_Formin	ENSG00000215045		0.622	GRID2IP-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	GRID2IP	HGNC	protein_coding	OTTHUMT00000340534.1	-	0.00	22	0	C	XM_294249		6541650	-1	tier1	-	no_errors	ENST00000457091	ensembl	human	putative	74_37	missense	32.08	36	17	SNP	1.000	T
GRIN3B	116444	genome.wustl.edu	37	19	1005401	1005401	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr19:1005401G>T	ENST00000234389.3	+	3	1920	c.1901G>T	c.(1900-1902)aGc>aTc	p.S634I	AC004528.4_ENST00000588380.1_RNA	NM_138690.1	NP_619635.1	O60391	NMD3B_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3B	634					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|protein insertion into membrane (GO:0051205)|regulation of calcium ion transport (GO:0051924)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|neurotransmitter receptor activity (GO:0030594)			breast(1)|kidney(1)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	11		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000226)|all_lung(49;0.000353)|Breast(49;0.00066)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Acamprosate(DB00659)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Secobarbital(DB00418)	ACCGTGTCCAGCAAGACGCCC	0.647																																																	0													117.0	110.0	112.0					19																	1005401		2203	4300	6503	SO:0001583	missense	0				CCDS32861.1	19p13.3	2014-05-06			ENSG00000116032	ENSG00000116032		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16768	protein-coding gene	gene with protein product		606651					Standard	XM_003403700		Approved	GluN3B	uc002lqo.1	O60391	OTTHUMG00000181904	ENST00000234389.3:c.1901G>T	19.37:g.1005401G>T	ENSP00000234389:p.Ser634Ile		Q5EAK7|Q7RTW9	Missense_Mutation	SNP	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.S634I	ENST00000234389.3	37	c.1901	CCDS32861.1	19	.	.	.	.	.	.	.	.	.	.	G	7.412	0.634889	0.14322	.	.	ENSG00000116032	ENST00000234389	T	0.24538	1.85	4.36	4.36	0.52297	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (2);	0.099962	0.64402	U	0.000004	T	0.29288	0.0729	N	0.14661	0.345	0.34100	D	0.661802	D	0.76494	0.999	D	0.70487	0.969	T	0.13953	-1.0490	10	0.09590	T	0.72	.	15.5149	0.75815	0.0:0.0:1.0:0.0	.	634	O60391	NMD3B_HUMAN	I	634	ENSP00000234389:S634I	ENSP00000234389:S634I	S	+	2	0	GRIN3B	956401	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	3.651000	0.54431	2.012000	0.59069	0.306000	0.20318	AGC	GRIN3B	-	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,smart_Iontro_glu_rcpt	ENSG00000116032		0.647	GRIN3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN3B	HGNC	protein_coding	OTTHUMT00000103923.2		0.00	24	0	G			1005401	+1			no_errors	ENST00000234389	ensembl	human	known	74_37	missense	23.81	16	5	SNP	1.000	T
GTF2IRD1	9569	genome.wustl.edu	37	7	73969808	73969808	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr7:73969808G>C	ENST00000265755.3	+	19	2445	c.2052G>C	c.(2050-2052)aaG>aaC	p.K684N	GTF2IRD1_ENST00000476977.1_Missense_Mutation_p.K669N|GTF2IRD1_ENST00000424337.2_Missense_Mutation_p.K669N|GTF2IRD1_ENST00000489094.1_Intron|GTF2IRD1_ENST00000455841.2_Missense_Mutation_p.K701N	NM_005685.3|NM_016328.2	NP_005676.3|NP_057412.1	Q9UHL9	GT2D1_HUMAN	GTF2I repeat domain containing 1	684					multicellular organismal development (GO:0007275)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transition between slow and fast fiber (GO:0014886)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(19)|ovary(6)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						AGAGCCTGAAGAGACAGGGCT	0.607																																																	0													72.0	64.0	67.0					7																	73969808		2203	4300	6503	SO:0001583	missense	0			AF151354	CCDS5571.1, CCDS47613.1, CCDS56492.1	7q11.23	2008-04-18	2002-01-14		ENSG00000006704	ENSG00000006704			4661	protein-coding gene	gene with protein product	"""binding factor for early enhancer"""	604318	"""GTF2I repeat domain-containing 1"""	WBSCR11		9774679, 10198167	Standard	NM_016328		Approved	MusTRD1, RBAP2, GTF3, WBSCR12, BEN, Cream1	uc010lbq.3	Q9UHL9	OTTHUMG00000023782	ENST00000265755.3:c.2052G>C	7.37:g.73969808G>C	ENSP00000265755:p.Lys684Asn		O95444|Q6DSU6|Q75MX7|Q86UM3|Q8WVC4|Q9UHK8|Q9UI91	Missense_Mutation	SNP	pfam_GTF2I,superfamily_GTF2I,pirsf_TF_II-I,pfscan_GTF2I	p.K684N	ENST00000265755.3	37	c.2052	CCDS5571.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.05|13.05	2.122543|2.122543	0.37436|0.37436	.|.	.|.	ENSG00000006704|ENSG00000006704	ENST00000470715|ENST00000265755;ENST00000455841;ENST00000424337;ENST00000476977	.|T;T;T;T	.|0.35048	.|1.33;1.35;1.35;1.34	4.0|4.0	2.11|2.11	0.27256|0.27256	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.29256|0.29256	0.0728|0.0728	L|L	0.50333|0.50333	1.59|1.59	0.46396|0.46396	D|D	0.999026|0.999026	.|B;B;B;B	.|0.32526	.|0.037;0.134;0.258;0.374	.|B;B;B;B	.|0.31946	.|0.017;0.138;0.101;0.134	T|T	0.08848|0.08848	-1.0702|-1.0702	5|10	.|0.46703	.|T	.|0.11	-5.748|-5.748	8.2945|8.2945	0.31978|0.31978	0.2047:0.0:0.7953:0.0|0.2047:0.0:0.7953:0.0	.|.	.|701;669;684;669	.|Q6DSU6;E9PFE2;Q9UHL9;Q9UHL9-2	.|.;.;GT2D1_HUMAN;.	Q|N	47|684;701;669;669	.|ENSP00000265755:K684N;ENSP00000397566:K701N;ENSP00000408477:K669N;ENSP00000418383:K669N	.|ENSP00000265755:K684N	E|K	+|+	1|3	0|2	GTF2IRD1|GTF2IRD1	73607744|73607744	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.920000|0.920000	0.55202|0.55202	3.728000|3.728000	0.54991|0.54991	0.809000|0.809000	0.34255|0.34255	-0.136000|-0.136000	0.14681|0.14681	GAG|AAG	GTF2IRD1	-	pirsf_TF_II-I	ENSG00000006704		0.607	GTF2IRD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GTF2IRD1	HGNC	protein_coding	OTTHUMT00000252654.2	-	0.00	40	0	G	NM_016328		73969808	+1	tier1	-	no_errors	ENST00000265755	ensembl	human	known	74_37	missense	33.33	28	14	SNP	1.000	C
HCAR1	27198	genome.wustl.edu	37	12	123214080	123214080	+	Missense_Mutation	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr12:123214080C>T	ENST00000436083.2	-	1	1310	c.807G>A	c.(805-807)atG>atA	p.M269I	HCAR1_ENST00000432564.1_Missense_Mutation_p.M269I|HCAR1_ENST00000356987.2_Missense_Mutation_p.M269I			Q9BXC0	HCAR1_HUMAN	hydroxycarboxylic acid receptor 1	269					response to estradiol (GO:0032355)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|endometrium(1)|kidney(1)|lung(1)|ovary(1)|pancreas(1)|skin(1)	10						GCATGCTGTTCATGTAGGTGA	0.522																																																	0													98.0	98.0	98.0					12																	123214080		2203	4300	6503	SO:0001583	missense	0			AF411110	CCDS9236.1	12q24.31	2012-08-08	2011-05-30	2011-05-30	ENSG00000196917	ENSG00000196917		"""GPCR / Class A : Hydroxy-carboxylic acid receptors"""	4532	protein-coding gene	gene with protein product	"""lactate receptor 1"""	606923	"""G protein-coupled receptor 104"", ""G protein-coupled receptor 81"""	GPR104, GPR81		11574155, 19047060, 18952058, 21454438	Standard	NM_032554		Approved	HCA1, FKSG80, TA-GPCR, LACR1	uc001ucz.3	Q9BXC0		ENST00000436083.2:c.807G>A	12.37:g.123214080C>T	ENSP00000409980:p.Met269Ile		B2R9X4|Q3Y5J3|Q4VBN1|Q6NXU5	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.M269I	ENST00000436083.2	37	c.807	CCDS9236.1	12	.	.	.	.	.	.	.	.	.	.	C	14.03	2.414821	0.42817	.	.	ENSG00000196917	ENST00000356987;ENST00000432564;ENST00000436083	T;T;T	0.34275	1.37;1.37;1.37	5.77	1.84	0.25277	GPCR, rhodopsin-like superfamily (1);	0.502751	0.21551	N	0.072731	T	0.23886	0.0578	L	0.31845	0.965	0.31819	N	0.626274	B	0.12013	0.005	B	0.17979	0.02	T	0.14671	-1.0464	10	0.34782	T	0.22	-14.7802	6.6454	0.22933	0.0:0.6478:0.1295:0.2227	.	269	Q9BXC0	HCAR1_HUMAN	I	269	ENSP00000349478:M269I;ENSP00000389255:M269I;ENSP00000409980:M269I	ENSP00000349478:M269I	M	-	3	0	HCAR1	121780033	0.949000	0.32298	0.954000	0.39281	0.990000	0.78478	-0.079000	0.11357	0.066000	0.16515	0.655000	0.94253	ATG	HCAR1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000196917		0.522	HCAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCAR1	HGNC	protein_coding	OTTHUMT00000401415.1	-	0.00	51	0	C			123214080	-1	tier1	-	no_errors	ENST00000356987	ensembl	human	known	74_37	missense	10.53	85	10	SNP	1.000	T
HCN4	10021	genome.wustl.edu	37	15	73614969	73614969	+	Missense_Mutation	SNP	C	C	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr15:73614969C>A	ENST00000261917.3	-	8	4458	c.3465G>T	c.(3463-3465)aaG>aaT	p.K1155N		NM_005477.2	NP_005468.1	Q9Y3Q4	HCN4_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 4	1155					blood circulation (GO:0008015)|cation transport (GO:0006812)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)|terminal bouton (GO:0043195)	cAMP binding (GO:0030552)|cation channel activity (GO:0005261)|identical protein binding (GO:0042802)|intracellular cAMP activated cation channel activity (GO:0005222)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(13)|liver(1)|lung(18)|ovary(6)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				COAD - Colon adenocarcinoma(1;0.142)		CTGAGGATGTCTTCCGAGGCA	0.677																																																	0													25.0	25.0	25.0					15																	73614969		2194	4297	6491	SO:0001583	missense	0			AJ132429	CCDS10248.1	15q24.1	2011-07-05			ENSG00000138622	ENSG00000138622		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	16882	protein-coding gene	gene with protein product		605206				10228147, 10430953, 16382102	Standard	NM_005477		Approved		uc002avp.3	Q9Y3Q4	OTTHUMG00000137563	ENST00000261917.3:c.3465G>T	15.37:g.73614969C>A	ENSP00000261917:p.Lys1155Asn		Q9UMQ7	Missense_Mutation	SNP	pfam_Ion_trans_N,pfam_cNMP-bd_dom,pfam_Ion_trans_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG,pfscan_cNMP-bd_dom	p.K1155N	ENST00000261917.3	37	c.3465	CCDS10248.1	15	.	.	.	.	.	.	.	.	.	.	C	7.817	0.716887	0.15306	.	.	ENSG00000138622	ENST00000261917	D	0.97665	-4.48	3.4	2.46	0.29980	.	.	.	.	.	D	0.92753	0.7696	N	0.22421	0.69	0.31920	N	0.613537	B	0.06786	0.001	B	0.04013	0.001	D	0.90345	0.4362	9	0.66056	D	0.02	.	9.9616	0.41699	0.3636:0.6364:0.0:0.0	.	1155	Q9Y3Q4	HCN4_HUMAN	N	1155	ENSP00000261917:K1155N	ENSP00000261917:K1155N	K	-	3	2	HCN4	71402022	1.000000	0.71417	1.000000	0.80357	0.069000	0.16628	6.747000	0.74872	0.600000	0.29862	-0.577000	0.04142	AAG	HCN4	-	NULL	ENSG00000138622		0.677	HCN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCN4	HGNC	protein_coding	OTTHUMT00000268900.2	-	0.00	9	0	C	NM_005477		73614969	-1	tier1	-	no_errors	ENST00000261917	ensembl	human	known	74_37	missense	64.29	5	9	SNP	1.000	A
HEATR5B	54497	genome.wustl.edu	37	2	37230747	37230747	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr2:37230747C>G	ENST00000233099.5	-	31	5083	c.4988G>C	c.(4987-4989)gGa>gCa	p.G1663A	HEATR5B_ENST00000354531.2_Missense_Mutation_p.G1663A	NM_019024.1	NP_061897.1	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B	1663						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|pancreas(1)|prostate(1)|skin(10)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	77		all_hematologic(82;0.21)				TTGTACAACTCCAGTAACCAA	0.378																																																	0													82.0	81.0	82.0					2																	37230747		2203	4300	6503	SO:0001583	missense	0			AB037835	CCDS33181.1	2p22.2	2007-01-02			ENSG00000008869	ENSG00000008869			29273	protein-coding gene	gene with protein product						10718198	Standard	XM_005264379		Approved	KIAA1414, DKFZp686P15184	uc002rpp.1	Q9P2D3	OTTHUMG00000152158	ENST00000233099.5:c.4988G>C	2.37:g.37230747C>G	ENSP00000233099:p.Gly1663Ala		B5MDU8|Q7Z3B2|Q9NVL7	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.G1663A	ENST00000233099.5	37	c.4988	CCDS33181.1	2	.	.	.	.	.	.	.	.	.	.	C	13.97	2.397171	0.42512	.	.	ENSG00000008869	ENST00000233099;ENST00000354531	T;T	0.65178	-0.14;-0.14	5.51	5.51	0.81932	Armadillo-type fold (1);	0.055536	0.64402	D	0.000001	T	0.34164	0.0888	N	0.01352	-0.895	0.39789	D	0.972405	B	0.02656	0.0	B	0.04013	0.001	T	0.30416	-0.9979	10	0.25106	T	0.35	-21.6927	15.2862	0.73831	0.0:0.8604:0.1396:0.0	.	1663	Q9P2D3	HTR5B_HUMAN	A	1663	ENSP00000233099:G1663A;ENSP00000346531:G1663A	ENSP00000233099:G1663A	G	-	2	0	HEATR5B	37084251	0.998000	0.40836	1.000000	0.80357	0.994000	0.84299	1.934000	0.40163	2.736000	0.93811	0.655000	0.94253	GGA	HEATR5B	-	superfamily_ARM-type_fold	ENSG00000008869		0.378	HEATR5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEATR5B	HGNC	protein_coding	OTTHUMT00000325492.1	-	0.00	59	0	C	NM_019024		37230747	-1	tier1	-	no_errors	ENST00000233099	ensembl	human	known	74_37	missense	26.53	72	26	SNP	1.000	G
HELB	92797	genome.wustl.edu	37	12	66700240	66700240	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr12:66700240G>C	ENST00000247815.4	+	3	782	c.723G>C	c.(721-723)ttG>ttC	p.L241F		NM_033647.3	NP_387467.2	Q8NG08	HELB_HUMAN	helicase (DNA) B	241					DNA duplex unwinding (GO:0032508)|DNA replication (GO:0006260)|DNA replication, synthesis of RNA primer (GO:0006269)		ATP binding (GO:0005524)|ATP-dependent 5'-3' DNA helicase activity (GO:0043141)|single-stranded DNA-dependent ATP-dependent DNA helicase activity (GO:0017116)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(15)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	40			GBM - Glioblastoma multiforme(2;0.000142)	GBM - Glioblastoma multiforme(28;0.0265)		AAGAGATGTTGAAAGAGATAG	0.368																																																	0													116.0	120.0	119.0					12																	66700240		2203	4300	6503	SO:0001583	missense	0			AF319995	CCDS8976.1	12q14.2	2009-01-15			ENSG00000127311	ENSG00000127311			17196	protein-coding gene	gene with protein product		614539				12181327	Standard	NM_033647		Approved		uc001sti.3	Q8NG08	OTTHUMG00000169006	ENST00000247815.4:c.723G>C	12.37:g.66700240G>C	ENSP00000247815:p.Leu241Phe		A8K4C9|Q4G0T2|Q9H7L5	Missense_Mutation	SNP	superfamily_P-loop_NTPase	p.L241F	ENST00000247815.4	37	c.723	CCDS8976.1	12	.	.	.	.	.	.	.	.	.	.	G	10.54	1.378387	0.24944	.	.	ENSG00000127311	ENST00000247815	T	0.18810	2.19	5.9	2.99	0.34606	.	0.246783	0.34291	N	0.004088	T	0.15912	0.0383	L	0.55834	1.745	0.09310	N	1	B	0.34372	0.451	B	0.31101	0.124	T	0.11641	-1.0579	9	.	.	.	-16.6027	5.3723	0.16146	0.1512:0.1234:0.6106:0.1148	.	241	Q8NG08	HELB_HUMAN	F	241	ENSP00000247815:L241F	.	L	+	3	2	HELB	64986507	0.609000	0.26975	0.123000	0.21794	0.015000	0.08874	0.734000	0.26101	1.497000	0.48584	0.561000	0.74099	TTG	HELB	-	NULL	ENSG00000127311		0.368	HELB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HELB	HGNC	protein_coding	OTTHUMT00000401919.1	-	0.00	96	0	G			66700240	+1	tier1	-	no_errors	ENST00000247815	ensembl	human	known	74_37	missense	9.52	95	10	SNP	0.002	C
HHIPL2	79802	genome.wustl.edu	37	1	222713363	222713363	+	Missense_Mutation	SNP	T	T	C	rs140791930		TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:222713363T>C	ENST00000343410.6	-	4	1497	c.1439A>G	c.(1438-1440)aAt>aGt	p.N480S		NM_024746.3	NP_079022.2	Q6UWX4	HIPL2_HUMAN	HHIP-like 2	480					carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)			NS(2)|endometrium(8)|kidney(4)|large_intestine(7)|lung(28)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	59				GBM - Glioblastoma multiforme(131;0.0185)		CAAAGAGGCATTGTGACAAAG	0.453																																																	0								T	SER/ASN	4,4402	8.1+/-20.4	0,4,2199	73.0	75.0	74.0		1439	4.4	0.6	1	dbSNP_134	74	0,8600		0,0,4300	no	missense	HHIPL2	NM_024746.3	46	0,4,6499	CC,CT,TT		0.0,0.0908,0.0308	possibly-damaging	480/725	222713363	4,13002	2203	4300	6503	SO:0001583	missense	0			BC007638	CCDS1530.2	1q41	2008-02-05	2008-01-16	2008-01-16	ENSG00000143512	ENSG00000143512			25842	protein-coding gene	gene with protein product			"""KIAA1822-like"""	KIAA1822L		12975309	Standard	NM_024746		Approved	FLJ13840	uc001hnh.1	Q6UWX4	OTTHUMG00000037545	ENST00000343410.6:c.1439A>G	1.37:g.222713363T>C	ENSP00000342118:p.Asn480Ser		Q6GU65|Q96BT4|Q96BU5|Q9H8A0	Missense_Mutation	SNP	pfam_Folate_rcpt-like,pfam_Glc/Sorbosone_DH,superfamily_Quinoprot_gluc/sorb_DH,superfamily_Saposin-like	p.N480S	ENST00000343410.6	37	c.1439	CCDS1530.2	1	.	.	.	.	.	.	.	.	.	.	T	14.75	2.627644	0.46944	9.08E-4	0.0	ENSG00000143512	ENST00000343410	T	0.12361	2.69	5.48	4.36	0.52297	Soluble quinoprotein glucose/sorbosone dehydrogenase (1);Glucose/Sorbosone dehydrogenase (1);Six-bladed beta-propeller, TolB-like (1);	0.141892	0.64402	N	0.000013	T	0.13457	0.0326	L	0.41415	1.275	0.41730	D	0.989556	B	0.15141	0.012	B	0.29524	0.103	T	0.06935	-1.0799	10	0.30078	T	0.28	-10.2545	10.9456	0.47299	0.0:0.0742:0.0:0.9258	.	480	Q6UWX4	HIPL2_HUMAN	S	480	ENSP00000342118:N480S	ENSP00000342118:N480S	N	-	2	0	HHIPL2	220779986	1.000000	0.71417	0.626000	0.29213	0.988000	0.76386	5.833000	0.69349	0.921000	0.36994	-0.333000	0.08304	AAT	HHIPL2	-	pfam_Glc/Sorbosone_DH,superfamily_Quinoprot_gluc/sorb_DH	ENSG00000143512		0.453	HHIPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HHIPL2	HGNC	protein_coding	OTTHUMT00000091499.2	-	0.00	28	0	T	NM_024746		222713363	-1	tier1	rs140791930	no_errors	ENST00000343410	ensembl	human	known	74_37	missense	25.58	32	11	SNP	1.000	C
HHIPL2	79802	genome.wustl.edu	37	1	222717196	222717196	+	Silent	SNP	G	G	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:222717196G>T	ENST00000343410.6	-	2	715	c.657C>A	c.(655-657)ccC>ccA	p.P219P		NM_024746.3	NP_079022.2	Q6UWX4	HIPL2_HUMAN	HHIP-like 2	219					carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)			NS(2)|endometrium(8)|kidney(4)|large_intestine(7)|lung(28)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	59				GBM - Glioblastoma multiforme(131;0.0185)		CCATGGAGACGGGGTTCCTCA	0.637																																																	0													62.0	57.0	59.0					1																	222717196		2203	4300	6503	SO:0001819	synonymous_variant	0			BC007638	CCDS1530.2	1q41	2008-02-05	2008-01-16	2008-01-16	ENSG00000143512	ENSG00000143512			25842	protein-coding gene	gene with protein product			"""KIAA1822-like"""	KIAA1822L		12975309	Standard	NM_024746		Approved	FLJ13840	uc001hnh.1	Q6UWX4	OTTHUMG00000037545	ENST00000343410.6:c.657C>A	1.37:g.222717196G>T			Q6GU65|Q96BT4|Q96BU5|Q9H8A0	Silent	SNP	pfam_Folate_rcpt-like,pfam_Glc/Sorbosone_DH,superfamily_Quinoprot_gluc/sorb_DH,superfamily_Saposin-like	p.P219	ENST00000343410.6	37	c.657	CCDS1530.2	1																																																																																			HHIPL2	-	superfamily_Quinoprot_gluc/sorb_DH	ENSG00000143512		0.637	HHIPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HHIPL2	HGNC	protein_coding	OTTHUMT00000091499.2		0.00	38	0	G	NM_024746		222717196	-1			no_errors	ENST00000343410	ensembl	human	known	74_37	silent	5.88	32	2	SNP	0.007	T
HK2	3099	genome.wustl.edu	37	2	75104436	75104436	+	Nonsense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr2:75104436C>G	ENST00000290573.2	+	8	1619	c.1019C>G	c.(1018-1020)tCa>tGa	p.S340*	HK2_ENST00000409174.1_Nonsense_Mutation_p.S312*	NM_000189.4	NP_000180.2	P52789	HXK2_HUMAN	hexokinase 2	340	Hexokinase type-2 1.|Regulatory.				apoptotic mitochondrial changes (GO:0008637)|carbohydrate metabolic process (GO:0005975)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose metabolic process (GO:0006006)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose transport (GO:0008645)|lactation (GO:0007595)|regulation of glucose import (GO:0046324)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|glucose binding (GO:0005536)|hexokinase activity (GO:0004396)|mannokinase activity (GO:0019158)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(22)|ovary(2)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	43						AAAGACATCTCAGACATTGAA	0.552																																																	0													122.0	130.0	127.0					2																	75104436		2203	4300	6503	SO:0001587	stop_gained	0				CCDS1956.1	2p13	2010-03-19			ENSG00000159399	ENSG00000159399	2.7.1.1		4923	protein-coding gene	gene with protein product		601125					Standard	NM_000189		Approved		uc002snd.3	P52789	OTTHUMG00000129972	ENST00000290573.2:c.1019C>G	2.37:g.75104436C>G	ENSP00000290573:p.Ser340*		D6W5J2|Q8WU87|Q9UN82	Nonsense_Mutation	SNP	pfam_Hexokinase_C,pfam_Hexokinase_N,prints_Hexokinase	p.S340*	ENST00000290573.2	37	c.1019	CCDS1956.1	2	.	.	.	.	.	.	.	.	.	.	C	40	7.958864	0.98583	.	.	ENSG00000159399	ENST00000290573;ENST00000535740;ENST00000409174	.	.	.	5.07	5.07	0.68467	.	0.301552	0.37715	N	0.001963	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-7.0088	16.3236	0.82964	0.0:1.0:0.0:0.0	.	.	.	.	X	340;340;312	.	ENSP00000290573:S340X	S	+	2	0	HK2	74957944	1.000000	0.71417	0.987000	0.45799	0.370000	0.29829	5.806000	0.69150	2.793000	0.96121	0.655000	0.94253	TCA	HK2	-	pfam_Hexokinase_C	ENSG00000159399		0.552	HK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HK2	HGNC	protein_coding	OTTHUMT00000252238.2		0.00	30	0	C	NM_000189		75104436	+1			no_errors	ENST00000290573	ensembl	human	known	74_37	nonsense	11.11	24	3	SNP	1.000	G
HLA-B	3106	genome.wustl.edu	37	6	31324463	31324464	+	Splice_Site	DNP	AC	AC	GA			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	A|C	A|C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr6:31324463_31324464AC>GA	ENST00000412585.2	-	2	372		c.e2+1			NM_005514.6	NP_005505.2	P30486	1B48_HUMAN	major histocompatibility complex, class I, B						antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|viral process (GO:0016032)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|MHC class I protein complex (GO:0042612)	peptide antigen binding (GO:0042605)	p.?(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(4)|lung(4)|prostate(1)|upper_aerodigestive_tract(2)	27						GGGGTCACTCACCGGCCTCGCT	0.683									Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of																																								1	Unknown(1)	upper_aerodigestive_tract(1)																																								SO:0001630	splice_region_variant	0	Familial Cancer Database	;Lichen Sclerosis, Familial	M15470	CCDS34394.1	6p21.3	2013-01-11			ENSG00000234745	ENSG00000234745		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4932	protein-coding gene	gene with protein product		142830	"""ankylosing spondylitis"""	AS		3459708	Standard	NM_005514		Approved		uc011imz.2	P01889	OTTHUMG00000031153	ENST00000412585.2:c.344_344delinsGA	6.37:g.31324463_31324464delinsGA			Q29764	Splice_Site	SNP	-	e2+2|e2+1	ENST00000412585.2	37	c.343+2|c.343+1	CCDS34394.1	6																																																																																			HLA-B	-	-	ENSG00000234745		0.683	HLA-B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-B	HGNC	protein_coding	OTTHUMT00000076280.4	-	0.00	45	0	A|C	NM_005514	Intron	31324463|31324464	-1	tier1	-	no_errors	ENST00000412585	ensembl	human	known	74_37	splice_site	19.30|18.64	46|48	11	SNP	1.000	G|A
HNRNPH1	3187	genome.wustl.edu	37	5	179047895	179047895	+	Nonsense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr5:179047895G>C	ENST00000356731.5	-	3	1930	c.395C>G	c.(394-396)tCa>tGa	p.S132*	HNRNPH1_ENST00000511300.2_5'Flank|HNRNPH1_ENST00000510411.1_Nonsense_Mutation_p.S132*|HNRNPH1_ENST00000393432.4_Nonsense_Mutation_p.S132*|HNRNPH1_ENST00000524180.1_5'UTR|HNRNPH1_ENST00000329433.6_Nonsense_Mutation_p.S132*|HNRNPH1_ENST00000442819.2_Nonsense_Mutation_p.S132*			P31943	HNRH1_HUMAN	heterogeneous nuclear ribonucleoprotein H1 (H)	132	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of RNA splicing (GO:0043484)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(4)|skin(1)	14						CTACATACCTGAGAAGAACTG	0.418																																																	0													114.0	102.0	106.0					5																	179047895		2203	4300	6503	SO:0001587	stop_gained	0			BC001348	CCDS4446.1	5q35.3	2013-02-12		2008-04-18	ENSG00000169045	ENSG00000169045		"""RNA binding motif (RRM) containing"""	5041	protein-coding gene	gene with protein product		601035		HNRPH1		7499401	Standard	NM_005520		Approved	hnRNPH	uc003mkf.5	P31943	OTTHUMG00000130908	ENST00000356731.5:c.395C>G	5.37:g.179047895G>C	ENSP00000349168:p.Ser132*		B3KW86|D3DWQ2|Q6IBM4	Nonsense_Mutation	SNP	pfam_RRM_dom,pfam_Znf_CHHC,smart_RRM_dom,pfscan_RRM_dom	p.S132*	ENST00000356731.5	37	c.395	CCDS4446.1	5	.	.	.	.	.	.	.	.	.	.	g	28.9	4.959971	0.92791	.	.	ENSG00000169045	ENST00000393432;ENST00000442819;ENST00000356731;ENST00000329433;ENST00000510411;ENST00000503105;ENST00000508103;ENST00000506721;ENST00000505811;ENST00000510431;ENST00000519056;ENST00000521790;ENST00000504348;ENST00000513225	.	.	.	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-3.6473	19.0418	0.93002	0.0:0.0:1.0:0.0	.	.	.	.	X	132;132;132;132;132;132;132;132;132;132;80;55;132;132	.	ENSP00000327539:S132X	S	-	2	0	HNRNPH1	178980501	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.869000	0.99810	2.510000	0.84645	0.467000	0.42956	TCA	HNRNPH1	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000169045		0.418	HNRNPH1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HNRNPH1	HGNC	protein_coding	OTTHUMT00000253497.3	-	0.00	51	0	G	NM_005520		179047895	-1	tier1	-	no_errors	ENST00000356731	ensembl	human	known	74_37	nonsense	15.56	38	7	SNP	1.000	C
HOOK2	29911	genome.wustl.edu	37	19	12882120	12882120	+	Nonsense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr19:12882120G>C	ENST00000397668.3	-	9	687	c.614C>G	c.(613-615)tCa>tGa	p.S205*	HOOK2_ENST00000589965.1_Intron|HOOK2_ENST00000264827.5_Nonsense_Mutation_p.S205*	NM_013312.2	NP_037444.2	Q96ED9	HOOK2_HUMAN	hook microtubule-tethering protein 2	205	Sufficient for interaction with microtubules.				early endosome to late endosome transport (GO:0045022)|endocytosis (GO:0006897)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|protein transport (GO:0015031)	centrosome (GO:0005813)|FHF complex (GO:0070695)|microtubule (GO:0005874)	identical protein binding (GO:0042802)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(5)|skin(1)	20						CTTCTCCTCTGACAGGAGCAT	0.647																																																	0													19.0	22.0	21.0					19																	12882120		2015	4181	6196	SO:0001587	stop_gained	0			AF044924	CCDS42507.1, CCDS42508.1	19p13.2	2013-08-21	2013-08-21						19885	protein-coding gene	gene with protein product		607824	"""hook homolog 2 (Drosophila)"""			9927460	Standard	NM_013312		Approved	HK2	uc002muy.2	Q96ED9		ENST00000397668.3:c.614C>G	19.37:g.12882120G>C	ENSP00000380785:p.Ser205*		O60562	Nonsense_Mutation	SNP	pfam_Hook-related_fam,superfamily_UBA-like	p.S205*	ENST00000397668.3	37	c.614	CCDS42508.1	19	.	.	.	.	.	.	.	.	.	.	g	24.4	4.530230	0.85706	.	.	ENSG00000095066	ENST00000397668;ENST00000264827	.	.	.	4.89	3.62	0.41486	.	0.777994	0.11631	N	0.544808	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.22109	T	0.4	-3.3483	6.6765	0.23098	0.2659:0.0:0.7341:0.0	.	.	.	.	X	205	.	ENSP00000264827:S205X	S	-	2	0	HOOK2	12743120	0.006000	0.16342	0.974000	0.42286	0.359000	0.29487	1.443000	0.35057	2.277000	0.76020	0.450000	0.29827	TCA	HOOK2	-	pfam_Hook-related_fam	ENSG00000095066		0.647	HOOK2-002	KNOWN	basic|CCDS	protein_coding	HOOK2	HGNC	protein_coding	OTTHUMT00000451008.1	-	0.00	78	0	G	NM_013312		12882120	-1	tier1	-	no_errors	ENST00000397668	ensembl	human	known	74_37	nonsense	31.67	41	19	SNP	0.073	C
HOXD12	3238	genome.wustl.edu	37	2	176965274	176965274	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr2:176965274G>C	ENST00000406506.2	+	2	671	c.599G>C	c.(598-600)gGg>gCg	p.G200A	HOXD12_ENST00000404162.2_Silent_p.G209G			P35452	HXD12_HUMAN	homeobox D12	200				LPWGAAPGR -> KRCPCSPGRPAVGGGPGE (in Ref. 1; AAF79044). {ECO:0000305}.	embryonic digit morphogenesis (GO:0042733)|pattern specification process (GO:0007389)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|large_intestine(1)|lung(7)|ovary(1)	10			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	Colorectal(32;0.0521)|READ - Rectum adenocarcinoma(9;0.0678)		GCGGCCCCGGGGAGGGCCCGC	0.627																																																	0																																										SO:0001583	missense	0				CCDS46456.1	2q31.1	2011-06-20	2005-12-22		ENSG00000170178	ENSG00000170178		"""Homeoboxes / ANTP class : HOXL subclass"""	5135	protein-coding gene	gene with protein product		142988	"""homeo box D12"""	HOX4H		1675198, 1973146	Standard	NM_021193		Approved		uc010zev.1	P35452	OTTHUMG00000150358	ENST00000406506.2:c.599G>C	2.37:g.176965274G>C	ENSP00000385586:p.Gly200Ala		B5MCP0|Q0VAD7|Q0VAD8|Q9NS03	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa	p.G200A	ENST00000406506.2	37	c.599	CCDS46456.1	2	.	.	.	.	.	.	.	.	.	.	G	7.225	0.598077	0.13939	.	.	ENSG00000170178	ENST00000406506	D	0.95690	-3.78	5.57	4.64	0.57946	Homeodomain-related (1);Homeobox (1);Homeodomain-like (1);	0.448815	0.27420	N	0.019444	D	0.88998	0.6590	N	0.16478	0.41	0.80722	D	1	B	0.21606	0.058	B	0.21917	0.037	D	0.84089	0.0389	10	0.06757	T	0.87	.	14.4953	0.67683	0.0:0.2691:0.7309:0.0	.	200	P35452	HXD12_HUMAN	A	200	ENSP00000385586:G200A	ENSP00000385586:G200A	G	+	2	0	HOXD12	176673520	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.198000	0.58419	2.630000	0.89119	0.655000	0.94253	GGG	HOXD12	-	superfamily_Homeodomain-like,pfscan_Homeobox_dom	ENSG00000170178		0.627	HOXD12-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	HOXD12	HGNC	protein_coding	OTTHUMT00000359253.2	-	0.00	65	0	G	NM_021193		176965274	+1	tier1	-	no_errors	ENST00000406506	ensembl	human	known	74_37	missense	29.21	63	26	SNP	1.000	C
HSD3B1	3283	genome.wustl.edu	37	1	120050130	120050130	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:120050130G>T	ENST00000369413.3	+	2	176	c.31G>T	c.(31-33)Gca>Tca	p.A11S	HSD3B1_ENST00000235547.6_Missense_Mutation_p.A13S|HSD3B1_ENST00000528909.1_Missense_Mutation_p.A11S			P14060	3BHS1_HUMAN	hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1	11					androgen biosynthetic process (GO:0006702)|estrogen biosynthetic process (GO:0006703)|glucocorticoid biosynthetic process (GO:0006704)|mineralocorticoid biosynthetic process (GO:0006705)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|smooth endoplasmic reticulum membrane (GO:0030868)	3-beta-hydroxy-delta5-steroid dehydrogenase activity (GO:0003854)|steroid delta-isomerase activity (GO:0004769)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(18)|ovary(2)|prostate(1)|skin(1)	32	all_neural(166;0.219)	all_lung(203;3.16e-06)|Lung NSC(69;2.19e-05)|all_epithelial(167;0.000624)		Lung(183;0.0106)|LUSC - Lung squamous cell carcinoma(189;0.0554)	Trilostane(DB01108)	TGTGACAGGAGCAGGAGGGTT	0.547																																																	0													93.0	85.0	88.0					1																	120050130		2203	4300	6503	SO:0001583	missense	0			S45679	CCDS903.1	1p12	2014-06-03			ENSG00000203857	ENSG00000203857	1.1.1.145, 5.3.3.1	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	5217	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 11E, member 1"""	109715		HSDB3, HSD3B		2779585, 19027726	Standard	NM_000862		Approved	SDR11E1	uc001ehv.1	P14060	OTTHUMG00000012525	ENST00000369413.3:c.31G>T	1.37:g.120050130G>T	ENSP00000358421:p.Ala11Ser		A8K691|Q14545|Q8IV65	Missense_Mutation	SNP	pfam_3Beta_OHSteriod_DH/Estase,pfam_Epimerase_deHydtase,pfam_Male_sterile_NAD-bd,pfam_Polysac_CapD-like,pfam_DH_sc/Rdtase_SDR,pfam_dTDP_dehydrorham_reduct,pfam_PKS_KR,pfam_NmrA	p.A13S	ENST00000369413.3	37	c.37	CCDS903.1	1	.	.	.	.	.	.	.	.	.	.	G	17.61	3.432375	0.62844	.	.	ENSG00000203857	ENST00000531340;ENST00000369413;ENST00000235547;ENST00000528909	D;D;D;D	0.91180	-2.04;-2.8;-2.8;-2.8	2.91	2.91	0.33838	3-beta hydroxysteroid dehydrogenase/isomerase (1);NAD(P)-binding domain (1);	0.063936	0.64402	D	0.000007	D	0.89051	0.6605	M	0.80616	2.505	0.45205	D	0.998217	P;P	0.44195	0.828;0.825	P;B	0.47941	0.562;0.372	D	0.89565	0.3809	10	0.66056	D	0.02	-16.1014	9.0706	0.36491	0.0:0.0:1.0:0.0	.	13;11	Q5TDG2;P14060	.;3BHS1_HUMAN	S	11;11;13;11	ENSP00000435999:A11S;ENSP00000358421:A11S;ENSP00000235547:A13S;ENSP00000432268:A11S	ENSP00000235547:A13S	A	+	1	0	HSD3B1	119851653	1.000000	0.71417	0.998000	0.56505	0.933000	0.57130	5.024000	0.64090	1.447000	0.47661	0.313000	0.20887	GCA	HSD3B1	-	pfam_3Beta_OHSteriod_DH/Estase,pfam_Epimerase_deHydtase,pfam_Male_sterile_NAD-bd,pfam_Polysac_CapD-like,pfam_DH_sc/Rdtase_SDR,pfam_dTDP_dehydrorham_reduct,pfam_PKS_KR,pfam_NmrA	ENSG00000203857		0.547	HSD3B1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	HSD3B1	HGNC	protein_coding	OTTHUMT00000034993.3		0.00	70	0	G	NM_000862		120050130	+1			no_errors	ENST00000235547	ensembl	human	known	74_37	missense	5.13	74	4	SNP	1.000	T
IFT172	26160	genome.wustl.edu	37	2	27679461	27679461	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr2:27679461C>G	ENST00000260570.3	-	30	3391	c.3288G>C	c.(3286-3288)aaG>aaC	p.K1096N		NM_015662.1	NP_056477.1	Q9UG01	IF172_HUMAN	intraflagellar transport 172	1096					bone development (GO:0060348)|brain development (GO:0007420)|cilium assembly (GO:0042384)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|epidermis development (GO:0008544)|heart looping (GO:0001947)|hindgut development (GO:0061525)|left/right axis specification (GO:0070986)|limb development (GO:0060173)|negative regulation of epithelial cell proliferation (GO:0050680)|neural tube closure (GO:0001843)|Notch signaling pathway (GO:0007219)|palate development (GO:0060021)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|smoothened signaling pathway (GO:0007224)|spinal cord motor neuron differentiation (GO:0021522)	axoneme (GO:0005930)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)|sperm midpiece (GO:0097225)|sperm principal piece (GO:0097228)|vesicle (GO:0031982)				central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(17)|lung(17)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	43	Acute lymphoblastic leukemia(172;0.155)					CTCCCAGGCTCTTTGCCCACA	0.522																																																	0													136.0	127.0	130.0					2																	27679461		2203	4300	6503	SO:0001583	missense	0			AB033005	CCDS1755.1	2p23.3	2014-07-03	2014-07-03		ENSG00000138002	ENSG00000138002		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	30391	protein-coding gene	gene with protein product	"""wimple homolog"""	607386	"""intraflagellar transport 172 homolog (Chlamydomonas)"""			10788441, 10574461, 24140113	Standard	XM_005264254		Approved	SLB, wim, osm-1, NPHP17	uc002rku.3	Q9UG01	OTTHUMG00000128425	ENST00000260570.3:c.3288G>C	2.37:g.27679461C>G	ENSP00000260570:p.Lys1096Asn		A5PKZ0|B2RNU5|Q86X44|Q96HW4|Q9UFJ9|Q9ULP1	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat	p.K1096N	ENST00000260570.3	37	c.3288	CCDS1755.1	2	.	.	.	.	.	.	.	.	.	.	C	15.37	2.812271	0.50527	.	.	ENSG00000138002	ENST00000260570	T	0.45668	0.89	5.99	1.72	0.24424	.	0.111471	0.64402	D	0.000004	T	0.39627	0.1085	M	0.67397	2.05	0.80722	D	1	B	0.33940	0.433	B	0.35312	0.2	T	0.26815	-1.0092	10	0.45353	T	0.12	-23.8502	9.9315	0.41525	0.0:0.6405:0.0:0.3595	.	1096	Q9UG01	IF172_HUMAN	N	1096	ENSP00000260570:K1096N	ENSP00000260570:K1096N	K	-	3	2	IFT172	27532965	1.000000	0.71417	0.995000	0.50966	0.995000	0.86356	1.022000	0.30052	0.439000	0.26476	0.655000	0.94253	AAG	IFT172	-	NULL	ENSG00000138002		0.522	IFT172-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFT172	HGNC	protein_coding	OTTHUMT00000250213.2	-	0.00	31	0	C	NM_015662		27679461	-1	tier1	-	no_errors	ENST00000260570	ensembl	human	known	74_37	missense	13.51	32	5	SNP	0.998	G
IFT172	26160	genome.wustl.edu	37	2	27683889	27683889	+	Silent	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr2:27683889G>A	ENST00000260570.3	-	23	2617	c.2514C>T	c.(2512-2514)ttC>ttT	p.F838F		NM_015662.1	NP_056477.1	Q9UG01	IF172_HUMAN	intraflagellar transport 172	838					bone development (GO:0060348)|brain development (GO:0007420)|cilium assembly (GO:0042384)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|epidermis development (GO:0008544)|heart looping (GO:0001947)|hindgut development (GO:0061525)|left/right axis specification (GO:0070986)|limb development (GO:0060173)|negative regulation of epithelial cell proliferation (GO:0050680)|neural tube closure (GO:0001843)|Notch signaling pathway (GO:0007219)|palate development (GO:0060021)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|smoothened signaling pathway (GO:0007224)|spinal cord motor neuron differentiation (GO:0021522)	axoneme (GO:0005930)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)|sperm midpiece (GO:0097225)|sperm principal piece (GO:0097228)|vesicle (GO:0031982)				central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(17)|lung(17)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	43	Acute lymphoblastic leukemia(172;0.155)					TACCTTTCATGAATGCGTTGC	0.483																																																	0													203.0	164.0	177.0					2																	27683889		2203	4300	6503	SO:0001819	synonymous_variant	0			AB033005	CCDS1755.1	2p23.3	2014-07-03	2014-07-03		ENSG00000138002	ENSG00000138002		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	30391	protein-coding gene	gene with protein product	"""wimple homolog"""	607386	"""intraflagellar transport 172 homolog (Chlamydomonas)"""			10788441, 10574461, 24140113	Standard	XM_005264254		Approved	SLB, wim, osm-1, NPHP17	uc002rku.3	Q9UG01	OTTHUMG00000128425	ENST00000260570.3:c.2514C>T	2.37:g.27683889G>A			A5PKZ0|B2RNU5|Q86X44|Q96HW4|Q9UFJ9|Q9ULP1	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat	p.F838	ENST00000260570.3	37	c.2514	CCDS1755.1	2																																																																																			IFT172	-	superfamily_ARM-type_fold	ENSG00000138002		0.483	IFT172-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFT172	HGNC	protein_coding	OTTHUMT00000250213.2	-	0.00	49	0	G	NM_015662		27683889	-1	tier1	-	no_errors	ENST00000260570	ensembl	human	known	74_37	silent	32.69	35	17	SNP	1.000	A
IGFALS	3483	genome.wustl.edu	37	16	1841183	1841183	+	Silent	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr16:1841183G>C	ENST00000215539.3	-	2	1346	c.1236C>G	c.(1234-1236)ctC>ctG	p.L412L	IGFALS_ENST00000415638.3_Silent_p.L450L			P35858	ALS_HUMAN	insulin-like growth factor binding protein, acid labile subunit	412					cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin-like growth factor binding (GO:0005520)			endometrium(2)|lung(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	8						AGAGTCGGCGGAGCCCCGAGA	0.687																																																	0													21.0	27.0	25.0					16																	1841183		2194	4293	6487	SO:0001819	synonymous_variant	0			M86826	CCDS10446.1, CCDS53982.1	16p13.3	2008-07-28			ENSG00000099769	ENSG00000099769			5468	protein-coding gene	gene with protein product		601489				1379671, 16114275	Standard	NM_004970		Approved	ALS	uc010uvn.2	P35858	OTTHUMG00000128638	ENST00000215539.3:c.1236C>G	16.37:g.1841183G>C			B4DZY8|E9PGU3	Silent	SNP	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.L450	ENST00000215539.3	37	c.1350	CCDS10446.1	16																																																																																			IGFALS	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000099769		0.687	IGFALS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGFALS	HGNC	protein_coding	OTTHUMT00000250509.2	-	0.00	33	0	G			1841183	-1	tier1	-	no_errors	ENST00000415638	ensembl	human	known	74_37	silent	9.76	36	4	SNP	0.996	C
IL17RB	55540	genome.wustl.edu	37	3	53886917	53886917	+	Missense_Mutation	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr3:53886917G>A	ENST00000288167.3	+	5	383	c.374G>A	c.(373-375)gGc>gAc	p.G125D		NM_018725.3	NP_061195.2	Q9NRM6	I17RB_HUMAN	interleukin 17 receptor B	125					cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|regulation of cell growth (GO:0001558)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	cytokine receptor activity (GO:0004896)			breast(1)|endometrium(1)|large_intestine(3)|lung(2)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)	13				BRCA - Breast invasive adenocarcinoma(193;0.000158)|KIRC - Kidney renal clear cell carcinoma(284;0.00588)|Kidney(284;0.00673)|OV - Ovarian serous cystadenocarcinoma(275;0.118)		TCCTACATCGGCTTCCCTGTA	0.423																																																	0													120.0	103.0	109.0					3																	53886917		2203	4300	6503	SO:0001583	missense	0			AF212365	CCDS2874.1	3p21.1	2008-02-05		2003-07-09	ENSG00000056736	ENSG00000056736		"""Interleukins and interleukin receptors"""	18015	protein-coding gene	gene with protein product		605458	"""interleukin 17B receptor"""	IL17BR		10749887, 10815801	Standard	NM_018725		Approved	IL17RH1, EVI27, CRL4	uc003dha.3	Q9NRM6	OTTHUMG00000158280	ENST00000288167.3:c.374G>A	3.37:g.53886917G>A	ENSP00000288167:p.Gly125Asp		Q9BPZ0|Q9NRL4|Q9NRM5	Missense_Mutation	SNP	pfam_SEFIR	p.G125D	ENST00000288167.3	37	c.374	CCDS2874.1	3	.	.	.	.	.	.	.	.	.	.	G	13.10	2.137590	0.37728	.	.	ENSG00000056736	ENST00000288167;ENST00000494338	T;T	0.25414	1.8;1.8	6.07	6.07	0.98685	.	0.073367	0.53938	D	0.000057	T	0.47414	0.1444	M	0.65975	2.015	0.43693	D	0.996142	D	0.89917	1.0	D	0.91635	0.999	T	0.17653	-1.0362	10	0.13470	T	0.59	-22.7532	16.144	0.81551	0.0:0.0:1.0:0.0	.	125	Q9NRM6	I17RB_HUMAN	D	125	ENSP00000288167:G125D;ENSP00000418638:G125D	ENSP00000288167:G125D	G	+	2	0	IL17RB	53861957	1.000000	0.71417	0.996000	0.52242	0.176000	0.22953	4.848000	0.62874	2.884000	0.98904	0.655000	0.94253	GGC	IL17RB	-	NULL	ENSG00000056736		0.423	IL17RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL17RB	HGNC	protein_coding	OTTHUMT00000350563.1	-	0.00	74	0	G	NM_172234		53886917	+1	tier1	-	no_errors	ENST00000288167	ensembl	human	known	74_37	missense	5.80	65	4	SNP	1.000	A
INADL	10207	genome.wustl.edu	37	1	62237287	62237287	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:62237287C>G	ENST00000371158.2	+	6	823	c.709C>G	c.(709-711)Ctg>Gtg	p.L237V	INADL_ENST00000316485.6_Missense_Mutation_p.L237V	NM_176877.2	NP_795352	Q8NI35	INADL_HUMAN	InaD-like (Drosophila)	237					cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|intracellular signal transduction (GO:0035556)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)				breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(8)|liver(1)|lung(51)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)	103						TGATACAACTCTGCCTGAAAC	0.368																																																	0													78.0	72.0	74.0					1																	62237287		2203	4300	6503	SO:0001583	missense	0			AB044807	CCDS617.2	1p31	2008-02-05			ENSG00000132849	ENSG00000132849			28881	protein-coding gene	gene with protein product		603199				9280290, 11374908	Standard	NM_176877		Approved	Cipp, PATJ	uc001dab.3	Q8NI35	OTTHUMG00000008560	ENST00000371158.2:c.709C>G	1.37:g.62237287C>G	ENSP00000360200:p.Leu237Val		O15249|O43742|O60833|Q5VUA5|Q5VUA6|Q5VUA7|Q5VUA8|Q5VUA9|Q5VUB0|Q8WU78|Q9H3N9	Missense_Mutation	SNP	pfam_PDZ,pfam_L27_2,superfamily_PDZ,smart_L27,smart_PDZ,pfscan_L27,pfscan_PDZ	p.L237V	ENST00000371158.2	37	c.709	CCDS617.2	1	.	.	.	.	.	.	.	.	.	.	C	0.672	-0.801645	0.02841	.	.	ENSG00000132849	ENST00000371158;ENST00000316485;ENST00000371156;ENST00000395513;ENST00000255202	T;T	0.16897	2.31;2.31	4.6	2.54	0.30619	PDZ/DHR/GLGF (1);	0.343723	0.22513	N	0.059062	T	0.11196	0.0273	L	0.41236	1.265	0.20307	N	0.999919	B;B;B	0.28055	0.199;0.044;0.045	B;B;B	0.29862	0.108;0.024;0.047	T	0.24440	-1.0160	10	0.17369	T	0.5	.	4.0079	0.09610	0.1673:0.5821:0.162:0.0886	.	237;237;237	F8W8T2;Q8NI35;Q8NI35-4	.;INADL_HUMAN;.	V	237	ENSP00000360200:L237V;ENSP00000326199:L237V	ENSP00000255202:L237V	L	+	1	2	INADL	62009875	0.001000	0.12720	0.777000	0.31699	0.546000	0.35178	0.452000	0.21795	0.903000	0.36546	0.460000	0.39030	CTG	INADL	-	superfamily_PDZ	ENSG00000132849		0.368	INADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INADL	HGNC	protein_coding	OTTHUMT00000023639.2	-	0.00	47	0	C	NM_170605		62237287	+1	tier1	-	no_errors	ENST00000371158	ensembl	human	known	74_37	missense	5.71	66	4	SNP	0.227	G
INF2	64423	genome.wustl.edu	37	14	105172433	105172433	+	Missense_Mutation	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr14:105172433G>A	ENST00000392634.4	+	6	875	c.763G>A	c.(763-765)Gac>Aac	p.D255N	INF2_ENST00000330634.7_Missense_Mutation_p.D255N	NM_022489.3	NP_071934.3	Q27J81	INF2_HUMAN	inverted formin, FH2 and WH2 domain containing	255	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin cytoskeleton organization (GO:0030036)|cell death (GO:0008219)|regulation of cellular component size (GO:0032535)|regulation of mitochondrial fission (GO:0090140)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	8		all_cancers(154;0.0896)|Melanoma(154;0.155)|all_epithelial(191;0.172)	all cancers(16;0.00188)|OV - Ovarian serous cystadenocarcinoma(23;0.0191)|Epithelial(46;0.047)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.176)		TAAGGCCGAGGACGAGGAGGA	0.657																																																	0													26.0	31.0	30.0					14																	105172433		2076	4210	6286	SO:0001583	missense	0			AK025709	CCDS9989.2, CCDS45173.1	14q32.33	2009-09-07	2007-11-29	2007-11-29	ENSG00000203485	ENSG00000203485			23791	protein-coding gene	gene with protein product	"""inverted formin 2"""	610982	"""chromosome 14 open reading frame 151"", ""chromosome 14 open reading frame 173"""	C14orf151, C14orf173		16818491	Standard	NM_001031714		Approved	MGC13251	uc001ypb.2	Q27J81	OTTHUMG00000029811	ENST00000392634.4:c.763G>A	14.37:g.105172433G>A	ENSP00000376410:p.Asp255Asn		Q27J83|Q69YL8|Q6P1X7|Q6PK22|Q86TR7|Q9BRM1|Q9H6N1	Missense_Mutation	SNP	pfam_FH2_Formin,pfam_FH3_dom,pfam_GTPase-bd,pfam_WH2_dom,superfamily_ARM-type_fold,smart_FH2_Formin,pfscan_WH2_dom	p.D255N	ENST00000392634.4	37	c.763	CCDS9989.2	14	.	.	.	.	.	.	.	.	.	.	G	28.7	4.938835	0.92526	.	.	ENSG00000203485	ENST00000330634;ENST00000392634	D;D	0.96427	-4.01;-4.01	4.28	4.28	0.50868	GTPase-binding/formin homology 3 (1);Diaphanous FH3 (1);Armadillo-type fold (1);	1.308490	0.05248	N	0.513404	D	0.98651	0.9548	M	0.89414	3.03	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.991;0.995	D	0.95062	0.8196	10	0.66056	D	0.02	.	17.073	0.86579	0.0:0.0:1.0:0.0	.	255;255	Q27J81-2;Q27J81	.;INF2_HUMAN	N	255	ENSP00000376406:D255N;ENSP00000376410:D255N	ENSP00000376406:D255N	D	+	1	0	INF2	104243478	1.000000	0.71417	0.998000	0.56505	0.612000	0.37316	9.641000	0.98458	2.088000	0.63022	0.462000	0.41574	GAC	INF2	-	pfam_FH3_dom,superfamily_ARM-type_fold	ENSG00000203485		0.657	INF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	INF2	HGNC	protein_coding	OTTHUMT00000074371.4	-	0.00	87	0	G	NM_022489		105172433	+1	tier1	-	no_errors	ENST00000392634	ensembl	human	known	74_37	missense	34.38	42	22	SNP	1.000	A
INHA	3623	genome.wustl.edu	37	2	220437184	220437184	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr2:220437184C>G	ENST00000243786.2	+	1	268	c.88C>G	c.(88-90)Ctg>Gtg	p.L30V	OBSL1_ENST00000373873.4_5'Flank|OBSL1_ENST00000289656.3_5'Flank|INHA_ENST00000489456.1_Intron|OBSL1_ENST00000265318.4_5'Flank|OBSL1_ENST00000373876.1_5'Flank|OBSL1_ENST00000603926.1_5'Flank|OBSL1_ENST00000404537.1_5'Flank|OBSL1_ENST00000491370.1_5'Flank	NM_002191.3	NP_002182.1	P05111	INHA_HUMAN	inhibin, alpha	30					cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|erythrocyte differentiation (GO:0030218)|hemoglobin biosynthetic process (GO:0042541)|male gonad development (GO:0008584)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell cycle (GO:0045786)|negative regulation of follicle-stimulating hormone secretion (GO:0046882)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of phosphorylation (GO:0042326)|nervous system development (GO:0007399)|ovarian follicle development (GO:0001541)|positive regulation of follicle-stimulating hormone secretion (GO:0046881)|regulation of cell cycle (GO:0051726)|regulation of cell proliferation (GO:0042127)|response to external stimulus (GO:0009605)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|inhibin A complex (GO:0043512)|inhibin-betaglycan-ActRII complex (GO:0034673)|neuronal cell body (GO:0043025)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|hormone activity (GO:0005179)|receptor binding (GO:0005102)			large_intestine(2)|lung(5)|ovary(1)|skin(1)|urinary_tract(1)	10		Renal(207;0.0183)		Epithelial(149;4.58e-07)|all cancers(144;4.31e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00802)		GGAACTTGTTCTGGCCAAGGT	0.667											OREG0003991	type=REGULATORY REGION|Gene=BC045558|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																					0													36.0	38.0	37.0					2																	220437184		2203	4300	6503	SO:0001583	missense	0				CCDS2444.1	2q35	2013-09-19			ENSG00000123999	ENSG00000123999			6065	protein-coding gene	gene with protein product		147380				3345731	Standard	NM_002191		Approved		uc002vmk.2	P05111	OTTHUMG00000059237	ENST00000243786.2:c.88C>G	2.37:g.220437184C>G	ENSP00000243786:p.Leu30Val	2266	A8K8H5	Missense_Mutation	SNP	pfam_TGF-b_C,smart_TGF-b_C,pirsf_Inhibin_asu_subgr,prints_Inhibin_asu	p.L30V	ENST00000243786.2	37	c.88	CCDS2444.1	2	.	.	.	.	.	.	.	.	.	.	C	18.28	3.589115	0.66105	.	.	ENSG00000123999	ENST00000243786	D	0.89746	-2.56	5.52	3.63	0.41609	.	0.076882	0.52532	D	0.000064	D	0.94132	0.8118	M	0.87180	2.865	0.48571	D	0.999673	D	0.76494	0.999	D	0.80764	0.994	D	0.93835	0.7131	10	0.51188	T	0.08	-11.8582	11.2194	0.48846	0.0:0.8427:0.0:0.1573	.	30	P05111	INHA_HUMAN	V	30	ENSP00000243786:L30V	ENSP00000243786:L30V	L	+	1	2	INHA	220145428	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	2.477000	0.45180	1.257000	0.44085	0.555000	0.69702	CTG	INHA	-	pirsf_Inhibin_asu_subgr	ENSG00000123999		0.667	INHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INHA	HGNC	protein_coding	OTTHUMT00000131425.1	-	0.00	84	0	C			220437184	+1	tier1	-	no_errors	ENST00000243786	ensembl	human	known	74_37	missense	50.68	36	37	SNP	1.000	G
JAG2	3714	genome.wustl.edu	37	14	105617715	105617715	+	Missense_Mutation	SNP	G	G	C	rs372331234		TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr14:105617715G>C	ENST00000331782.3	-	9	1575	c.1172C>G	c.(1171-1173)tCg>tGg	p.S391W	RP11-44N21.4_ENST00000548203.1_RNA|JAG2_ENST00000347004.2_Missense_Mutation_p.S391W	NM_002226.4	NP_002217.3	Q9Y219	JAG2_HUMAN	jagged 2	391	EGF-like 5; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				auditory receptor cell fate commitment (GO:0009912)|cell cycle (GO:0007049)|cell differentiation (GO:0030154)|epithelial cell apoptotic process involved in palatal shelf morphogenesis (GO:1990134)|gamma-delta T cell differentiation (GO:0042492)|in utero embryonic development (GO:0001701)|morphogenesis of embryonic epithelium (GO:0016331)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|respiratory system process (GO:0003016)|skeletal system development (GO:0001501)|spermatogenesis (GO:0007283)|T cell differentiation (GO:0030217)|thymic T cell selection (GO:0045061)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|growth factor activity (GO:0008083)|Notch binding (GO:0005112)			breast(2)|endometrium(2)|kidney(3)|large_intestine(1)|lung(7)|prostate(2)|skin(5)	22		all_cancers(154;0.0336)|all_epithelial(191;0.0729)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00989)|all cancers(16;0.0114)|Epithelial(46;0.0272)	Epithelial(152;0.047)|OV - Ovarian serous cystadenocarcinoma(161;0.148)|all cancers(159;0.208)		ACACGGGTTCGAAGCACACTC	0.652																																																	0													35.0	33.0	34.0					14																	105617715		2203	4300	6503	SO:0001583	missense	0			AF020201	CCDS9998.1, CCDS9999.1	14q32	2008-08-01			ENSG00000184916	ENSG00000184916			6189	protein-coding gene	gene with protein product		602570				9315665, 10662552	Standard	NM_002226		Approved		uc001yqg.4	Q9Y219	OTTHUMG00000140172	ENST00000331782.3:c.1172C>G	14.37:g.105617715G>C	ENSP00000328169:p.Ser391Trp		Q9UE17|Q9UE99|Q9UNK8|Q9Y6P9|Q9Y6Q0	Missense_Mutation	SNP	pfam_EG-like_dom,pfam_Notch_ligand_N,pfam_DSL,pfam_EGF_extracell,pfam_EGF-like_Ca-bd_dom,smart_DSL,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_VWC_out,smart_VWF_C,pfscan_DSL,pfscan_EG-like_dom,pfscan_VWF_C	p.S391W	ENST00000331782.3	37	c.1172	CCDS9998.1	14	.	.	.	.	.	.	.	.	.	.	G	15.75	2.926565	0.52759	.	.	ENSG00000184916	ENST00000331782;ENST00000347004	D;D	0.91945	-2.94;-2.3	3.76	3.76	0.43208	EGF-like calcium-binding, conserved site (1);EGF (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	U	0.000000	D	0.97508	0.9184	H	0.98646	4.29	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98268	1.0502	10	0.72032	D	0.01	.	13.0718	0.59066	0.0:0.0:1.0:0.0	.	391;391	Q9Y219-2;Q9Y219	.;JAG2_HUMAN	W	391	ENSP00000328169:S391W;ENSP00000328566:S391W	ENSP00000328169:S391W	S	-	2	0	JAG2	104688760	0.992000	0.36948	0.119000	0.21687	0.376000	0.30014	6.367000	0.73099	1.610000	0.50200	0.297000	0.19635	TCG	JAG2	-	pfam_EG-like_dom,pfam_EGF_extracell,pfam_EGF-like_Ca-bd_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom	ENSG00000184916		0.652	JAG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JAG2	HGNC	protein_coding	OTTHUMT00000276506.2	-	0.00	59	0	G			105617715	-1	tier1	-	no_errors	ENST00000331782	ensembl	human	known	74_37	missense	35.00	26	14	SNP	0.998	C
JMY	133746	genome.wustl.edu	37	5	78620720	78620720	+	3'UTR	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr5:78620720G>C	ENST00000396137.4	+	0	6724				JMY_ENST00000412001.1_3'UTR	NM_152405.4	NP_689618.4	Q8N9B5	JMY_HUMAN	junction mediating and regulatory protein, p53 cofactor						'de novo' actin filament nucleation (GO:0070060)|actin polymerization-dependent cell motility (GO:0070358)|Arp2/3 complex-mediated actin nucleation (GO:0034314)|cell cycle arrest (GO:0007050)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|positive regulation of apoptotic process (GO:0043065)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			endometrium(4)|kidney(2)|large_intestine(2)|lung(6)|skin(1)|urinary_tract(1)	16		all_lung(232;0.00051)|Lung NSC(167;0.00131)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;4.45e-45)|Epithelial(54;5.85e-40)|all cancers(79;2.89e-35)		CTTACTCTATGTAATAAGGAA	0.338																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK095189	CCDS4047.3	5q14.1	2010-03-23			ENSG00000152409	ENSG00000152409			28916	protein-coding gene	gene with protein product		604279				10518217	Standard	NM_152405		Approved	FLJ37870	uc003kfx.4	Q8N9B5	OTTHUMG00000131301	ENST00000396137.4:c.*3295G>C	5.37:g.78620720G>C			A1L4P5|B5MDS2|B5MDT0	RNA	SNP	-	NULL	ENST00000396137.4	37	NULL	CCDS4047.3	5																																																																																			JMY	-	-	ENSG00000152409		0.338	JMY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JMY	HGNC	protein_coding	OTTHUMT00000254070.4	-	0.00	137	0	G	NM_152405		78620720	+1	tier1	-	no_errors	ENST00000412001	ensembl	human	known	74_37	rna	18.45	84	19	SNP	0.000	C
KCNF1	3754	genome.wustl.edu	37	2	11053879	11053879	+	Frame_Shift_Del	DEL	G	G	-			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr2:11053879delG	ENST00000295082.1	+	1	1817	c.1327delG	c.(1327-1329)gggfs	p.G444fs		NM_002236.4	NP_002227.2	Q9H3M0	KCNF1_HUMAN	potassium voltage-gated channel, subfamily F, member 1	444					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)			NS(1)|endometrium(2)|large_intestine(2)|lung(10)|ovary(2)|skin(1)|urinary_tract(1)	19	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.128)		GGGCAAGACCGGGGGCTCCCG	0.662																																																	0													25.0	28.0	27.0					2																	11053879		2203	4299	6502	SO:0001589	frameshift_variant	0			AF033382	CCDS1676.1	2p25	2011-07-05			ENSG00000162975	ENSG00000162975		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6246	protein-coding gene	gene with protein product		603787		KCNF		9434767, 16382104	Standard	NM_002236		Approved	Kv5.1, kH1, IK8	uc002rax.3	Q9H3M0	OTTHUMG00000119054	ENST00000295082.1:c.1327delG	2.37:g.11053879delG	ENSP00000295082:p.Gly444fs		O43527|Q585L3	Frame_Shift_Del	DEL	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,pfam_PKD1_2_channel,superfamily_BTB/POZ_fold,prints_K_chnl,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv1,prints_K_chnl_volt-dep_Kv6	p.G444fs	ENST00000295082.1	37	c.1327	CCDS1676.1	2																																																																																			KCNF1	-	NULL	ENSG00000162975		0.662	KCNF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNF1	HGNC	protein_coding	OTTHUMT00000239265.1		0.00	30	0	G	NM_002236		11053879	+1	tier1		no_errors	ENST00000295082	ensembl	human	known	74_37	frame_shift_del	6.25	30	2	DEL	0.875	-
KCMF1	56888	genome.wustl.edu	37	2	85276546	85276546	+	Missense_Mutation	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr2:85276546C>T	ENST00000409785.4	+	6	1018	c.659C>T	c.(658-660)tCt>tTt	p.S220F		NM_020122.4	NP_064507.3	Q9P0J7	KCMF1_HUMAN	potassium channel modulatory factor 1	220							ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			ovary(3)	3						CTTAATTCCTCTGGCCCTTCC	0.498																																																	0													106.0	112.0	110.0					2																	85276546		2143	4247	6390	SO:0001583	missense	0			AF155652	CCDS46350.1	2p11.2	2010-11-23			ENSG00000176407	ENSG00000176407		"""Zinc fingers, ZZ-type"""	20589	protein-coding gene	gene with protein product		614719					Standard	NM_020122		Approved	DEBT91, PCMF, DKFZP434L1021, ZZZ1	uc002sox.4	Q9P0J7	OTTHUMG00000153004	ENST00000409785.4:c.659C>T	2.37:g.85276546C>T	ENSP00000386738:p.Ser220Phe		Q4ZG04|Q53SC7|Q9BWK2|Q9H8P5|Q9UFE8	Missense_Mutation	SNP	pfam_Znf_ZZ,pfam_Di19_Zn_binding,smart_Znf_ZZ,smart_Znf_C2H2-like,pfscan_Znf_ZZ,pfscan_Znf_C2H2	p.S220F	ENST00000409785.4	37	c.659	CCDS46350.1	2	.	.	.	.	.	.	.	.	.	.	C	32	5.116047	0.94339	.	.	ENSG00000176407	ENST00000409785	T	0.50548	0.74	5.96	5.96	0.96718	Drought induced 19/ RING finger protein 114 (1);	0.000000	0.85682	D	0.000000	T	0.59307	0.2184	L	0.38175	1.15	0.80722	D	1	D	0.65815	0.995	D	0.63597	0.916	T	0.58544	-0.7618	10	0.62326	D	0.03	-15.9669	17.9158	0.88950	0.0:1.0:0.0:0.0	.	220	Q9P0J7	KCMF1_HUMAN	F	220	ENSP00000386738:S220F	ENSP00000386738:S220F	S	+	2	0	KCMF1	85130057	1.000000	0.71417	0.998000	0.56505	0.981000	0.71138	7.534000	0.82004	2.832000	0.97577	0.655000	0.94253	TCT	KCMF1	-	pfam_Di19_Zn_binding	ENSG00000176407		0.498	KCMF1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	KCMF1	HGNC	protein_coding	OTTHUMT00000328942.4	-	0.00	28	0	C	NM_020122		85276546	+1	tier1	-	no_errors	ENST00000409785	ensembl	human	known	74_37	missense	53.85	18	21	SNP	1.000	T
KCNIP3	30818	genome.wustl.edu	37	2	96051150	96051150	+	3'UTR	SNP	G	G	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr2:96051150G>T	ENST00000295225.5	+	0	2259				KCNIP3_ENST00000360990.3_3'UTR|KCNIP3_ENST00000377181.2_3'UTR	NM_013434.4	NP_038462.1	Q9Y2W7	CSEN_HUMAN	Kv channel interacting protein 3, calsenilin						apoptotic process (GO:0006915)|behavioral response to pain (GO:0048266)|intracellular protein transport (GO:0006886)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of neuron apoptotic process (GO:0043523)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	axon terminus (GO:0043679)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|sequence-specific DNA binding (GO:0043565)|transcription corepressor activity (GO:0003714)|voltage-gated ion channel activity (GO:0005244)			NS(1)|breast(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(3)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	16				READ - Rectum adenocarcinoma(193;0.13)		TGAGGGCTGAGAGGGCTGTGG	0.617																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF199599	CCDS2013.1, CCDS33245.1	2q21.1	2013-01-10	2006-02-11	2006-02-11	ENSG00000115041	ENSG00000115041		"""EF-hand domain containing"""	15523	protein-coding gene	gene with protein product		604662	"""calsenilin, presenilin-binding protein, EF hand transcription factor"""	CSEN		9771752, 10078534	Standard	NM_013434		Approved	DREAM, KCHIP3, calsenilin	uc002sup.3	Q9Y2W7	OTTHUMG00000130392	ENST00000295225.5:c.*1353G>T	2.37:g.96051150G>T			H7BY46|Q3YAC3|Q3YAC4|Q53TJ5|Q96T40|Q9UJ84|Q9UJ85	RNA	SNP	-	NULL	ENST00000295225.5	37	NULL	CCDS2013.1	2																																																																																			KCNIP3	-	-	ENSG00000115041		0.617	KCNIP3-001	KNOWN	basic|CCDS	protein_coding	KCNIP3	HGNC	protein_coding	OTTHUMT00000252770.1	-	0.00	80	0	G	NM_013434		96051150	+1	tier1	-	no_errors	ENST00000377181	ensembl	human	known	74_37	rna	5.33	71	4	SNP	0.001	T
KCNK13	56659	genome.wustl.edu	37	14	90650533	90650533	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr14:90650533C>G	ENST00000282146.4	+	2	854	c.413C>G	c.(412-414)aCc>aGc	p.T138S		NM_022054.2	NP_071337.2	Q9HB14	KCNKD_HUMAN	potassium channel, subfamily K, member 13	138					synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(12)|prostate(1)|skin(4)	25		all_cancers(154;0.186)				TGTTCCAGCACCATCTTGTTC	0.537																																																	0													109.0	116.0	114.0					14																	90650533		2203	4300	6503	SO:0001583	missense	0			AF287303	CCDS9889.1	14q32.11	2012-03-07				ENSG00000152315		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6275	protein-coding gene	gene with protein product		607367				11060316, 16382106	Standard	NM_022054		Approved	K2p13.1, THIK-1, THIK1	uc001xye.1	Q9HB14		ENST00000282146.4:c.413C>G	14.37:g.90650533C>G	ENSP00000282146:p.Thr138Ser		B5TJL8|Q96E79	Missense_Mutation	SNP	pfam_2pore_dom_K_chnl_dom,prints_2pore_dom_K_chnl_THIK,prints_2pore_dom_K_chnl,prints_2pore_dom_K_chnl_TASK	p.T138S	ENST00000282146.4	37	c.413	CCDS9889.1	14	.	.	.	.	.	.	.	.	.	.	C	17.35	3.366429	0.61513	.	.	ENSG00000152315	ENST00000282146	T	0.31510	1.49	5.31	5.31	0.75309	Ion transport 2 (1);	0.000000	0.42548	D	0.000684	T	0.42245	0.1194	L	0.60845	1.875	0.80722	D	1	P	0.37370	0.592	P	0.48488	0.579	T	0.12578	-1.0542	10	0.08837	T	0.75	.	18.9479	0.92628	0.0:1.0:0.0:0.0	.	138	Q9HB14	KCNKD_HUMAN	S	138	ENSP00000282146:T138S	ENSP00000282146:T138S	T	+	2	0	KCNK13	89720286	1.000000	0.71417	1.000000	0.80357	0.784000	0.44337	5.988000	0.70579	2.476000	0.83614	0.655000	0.94253	ACC	KCNK13	-	pfam_2pore_dom_K_chnl_dom,prints_2pore_dom_K_chnl_THIK	ENSG00000152315		0.537	KCNK13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNK13	HGNC	protein_coding	OTTHUMT00000411251.1		0.00	15	0	C	NM_022054		90650533	+1			no_errors	ENST00000282146	ensembl	human	known	74_37	missense	26.67	11	4	SNP	1.000	G
KCNK13	56659	genome.wustl.edu	37	14	90650758	90650758	+	Nonsense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr14:90650758C>G	ENST00000282146.4	+	2	1079	c.638C>G	c.(637-639)tCa>tGa	p.S213*		NM_022054.2	NP_071337.2	Q9HB14	KCNKD_HUMAN	potassium channel, subfamily K, member 13	213					synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(12)|prostate(1)|skin(4)	25		all_cancers(154;0.186)				TGCTGCGCCTCAGCCATGTAC	0.567																																																	0													164.0	139.0	148.0					14																	90650758		2203	4300	6503	SO:0001587	stop_gained	0			AF287303	CCDS9889.1	14q32.11	2012-03-07				ENSG00000152315		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6275	protein-coding gene	gene with protein product		607367				11060316, 16382106	Standard	NM_022054		Approved	K2p13.1, THIK-1, THIK1	uc001xye.1	Q9HB14		ENST00000282146.4:c.638C>G	14.37:g.90650758C>G	ENSP00000282146:p.Ser213*		B5TJL8|Q96E79	Nonsense_Mutation	SNP	pfam_2pore_dom_K_chnl_dom,prints_2pore_dom_K_chnl_THIK,prints_2pore_dom_K_chnl,prints_2pore_dom_K_chnl_TASK	p.S213*	ENST00000282146.4	37	c.638	CCDS9889.1	14	.	.	.	.	.	.	.	.	.	.	C	36	5.963849	0.97151	.	.	ENSG00000152315	ENST00000282146	.	.	.	5.31	4.42	0.53409	.	0.218239	0.23498	N	0.047529	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	.	13.9782	0.64285	0.0:0.9262:0.0:0.0738	.	.	.	.	X	213	.	ENSP00000282146:S213X	S	+	2	0	KCNK13	89720511	1.000000	0.71417	0.008000	0.14137	0.295000	0.27426	6.072000	0.71238	1.234000	0.43709	0.655000	0.94253	TCA	KCNK13	-	pfam_2pore_dom_K_chnl_dom,prints_2pore_dom_K_chnl_THIK	ENSG00000152315		0.567	KCNK13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNK13	HGNC	protein_coding	OTTHUMT00000411251.1	-	0.00	28	0	C	NM_022054		90650758	+1	tier1	-	no_errors	ENST00000282146	ensembl	human	known	74_37	nonsense	36.84	12	7	SNP	0.997	G
KIAA1549L	25758	genome.wustl.edu	37	11	33667496	33667497	+	Missense_Mutation	DNP	CC	CC	TT			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr11:33667496_33667497CC>TT	ENST00000321505.4	+	16	4963_4964	c.4783_4784CC>TT	c.(4783-4785)CCg>TTg	p.P1595L	KIAA1549L_ENST00000389726.3_Missense_Mutation_p.P1601L			Q6ZVL6	K154L_HUMAN	KIAA1549-like	1595						integral component of membrane (GO:0016021)											GACCAGCGCTCCGGGGACCATG	0.668																																																	0																																										SO:0001583	missense	0			U10991	CCDS44565.1, CCDS44565.2	11p13	2012-08-09	2012-08-09	2012-08-09	ENSG00000110427	ENSG00000110427			24836	protein-coding gene	gene with protein product		612297	"""chromosome 11 open reading frame 69"", ""chromosome 11 open reading frame 41"""	C11orf69, C11orf41			Standard	NM_012194		Approved	G2, MGC34830	uc021qfs.1	Q6ZVL6	OTTHUMG00000150410	Exception_encountered	11.37:g.33667496_33667497delinsTT	ENSP00000315295:p.Pro1595Leu		B0QYU0	Missense_Mutation	SNP	NULL	p.P1601S|p.P1601L	ENST00000321505.4	37	c.4801|c.4802	CCDS44565.2	11																																																																																			KIAA1549L	-	NULL	ENSG00000110427		0.668	KIAA1549L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KIAA1549L	HGNC	protein_coding	OTTHUMT00000317998.1	-	0.00	42|41	0	C	NM_012194		33667496|33667497	+1	tier1	-	no_errors	ENST00000389726	ensembl	human	known	74_37	missense	29.79	33	14	SNP	0.999	T
C2orf74	339804	genome.wustl.edu	37	2	61389617	61389617	+	5'Flank	SNP	T	T	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr2:61389617T>C	ENST00000432605.1	+	0	0				C2orf74_ENST00000426997.1_Intron|RP11-493E12.1_ENST00000605902.1_lincRNA	NM_001143959.1	NP_001137431.1	A8MZ97	CB074_HUMAN	chromosome 2 open reading frame 74							integral component of membrane (GO:0016021)				endometrium(1)	1						CAGTCTGTGATTGTGAGAGTG	0.368																																																	0													283.0	222.0	240.0					2																	61389617		692	1591	2283	SO:0001631	upstream_gene_variant	0					2p15	2012-08-06			ENSG00000237651	ENSG00000237651			34439	protein-coding gene	gene with protein product							Standard	NM_001143959		Approved	LOC339804	uc010ypm.1	A8MZ97			2.37:g.61389617T>C	Exception_encountered		C9JP62	RNA	SNP	-	NULL	ENST00000432605.1	37	NULL		2																																																																																			KIAA1841	-	-	ENSG00000162929		0.368	C2orf74-202	KNOWN	basic|appris_principal	protein_coding	KIAA1841	HGNC	protein_coding		-	0.00	68	0	T	NM_001143959		61389617	+1	tier1	-	no_errors	ENST00000488469	ensembl	human	known	74_37	rna	11.27	63	8	SNP	0.006	C
KIAA1919	91749	genome.wustl.edu	37	6	111588180	111588180	+	Missense_Mutation	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr6:111588180G>A	ENST00000368847.4	+	4	1768	c.1415G>A	c.(1414-1416)aGa>aAa	p.R472K		NM_153369.2	NP_699200.2	Q5TF39	NAGT1_HUMAN	KIAA1919	472					carbohydrate transport (GO:0008643)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			large_intestine(3)|lung(2)|ovary(4)|skin(3)	12		all_cancers(87;2.35e-05)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.0209)		OV - Ovarian serous cystadenocarcinoma(136;0.055)|all cancers(137;0.0871)|Epithelial(106;0.0884)		GAGACATCTAGAAGTAGTCTG	0.393																																																	0													111.0	115.0	113.0					6																	111588180		2203	4300	6503	SO:0001583	missense	0			BC036115	CCDS5090.1	6q22	2013-10-02			ENSG00000173214	ENSG00000173214			21053	protein-coding gene	gene with protein product							Standard	NM_153369		Approved	MGC33953, MFSD4B	uc003puv.4	Q5TF39	OTTHUMG00000015372	ENST00000368847.4:c.1415G>A	6.37:g.111588180G>A	ENSP00000357840:p.Arg472Lys		A8K9M0|Q8IYB6|Q96PW9|Q9P0D6	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.R472K	ENST00000368847.4	37	c.1415	CCDS5090.1	6	.	.	.	.	.	.	.	.	.	.	G	9.911	1.209488	0.22289	.	.	ENSG00000173214	ENST00000368847	T	0.43294	0.95	6.05	6.05	0.98169	.	0.553877	0.20743	N	0.086496	T	0.12092	0.0294	L	0.28274	0.84	0.09310	N	1	B	0.32245	0.361	B	0.19148	0.024	T	0.04635	-1.0937	10	0.20519	T	0.43	-12.6431	11.8318	0.52299	0.0:0.1303:0.7347:0.135	.	472	Q5TF39	NAGT1_HUMAN	K	472	ENSP00000357840:R472K	ENSP00000357840:R472K	R	+	2	0	KIAA1919	111694873	0.009000	0.17119	0.131000	0.22000	0.009000	0.06853	0.225000	0.17757	2.875000	0.98604	0.643000	0.83706	AGA	KIAA1919	-	NULL	ENSG00000173214		0.393	KIAA1919-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1919	HGNC	protein_coding	OTTHUMT00000041827.1		0.00	48	0	G	NM_153369		111588180	+1			no_errors	ENST00000368847	ensembl	human	known	74_37	missense	6.12	46	3	SNP	0.097	A
KIF11	3832	genome.wustl.edu	37	10	94408026	94408026	+	Missense_Mutation	SNP	C	C	T	rs149407589		TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr10:94408026C>T	ENST00000260731.3	+	19	2695	c.2605C>T	c.(2605-2607)Cgt>Tgt	p.R869C		NM_004523.3	NP_004514.2	P52732	KIF11_HUMAN	kinesin family member 11	869					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|chromosome segregation (GO:0007059)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic centrosome separation (GO:0007100)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|spindle assembly involved in mitosis (GO:0090307)|spindle organization (GO:0007051)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)			breast(1)|endometrium(5)|kidney(2)|large_intestine(9)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						ATCAGATGGACGTAAGGCAGC	0.318																																					Colon(47;212 1003 2764 4062 8431)												0								C	CYS/ARG	0,4406		0,0,2203	78.0	72.0	74.0		2605	1.8	0.0	10	dbSNP_134	74	2,8598	2.2+/-6.3	0,2,4298	yes	missense	KIF11	NM_004523.3	180	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	benign	869/1057	94408026	2,13004	2203	4300	6503	SO:0001583	missense	0			X85137	CCDS7422.1	10q24.1	2008-03-03	2003-01-09	2003-01-10	ENSG00000138160	ENSG00000138160		"""Kinesins"""	6388	protein-coding gene	gene with protein product		148760	"""kinesin-like 1"""	KNSL1		1505978, 8548803	Standard	NM_004523		Approved	Eg5, HKSP, TRIP5	uc001kic.3	P52732	OTTHUMG00000018761	ENST00000260731.3:c.2605C>T	10.37:g.94408026C>T	ENSP00000260731:p.Arg869Cys		A0AV49|B2RMV3|Q15716|Q5VWX0	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.R869C	ENST00000260731.3	37	c.2605	CCDS7422.1	10	.	.	.	.	.	.	.	.	.	.	C	2.111	-0.403754	0.04832	0.0	2.33E-4	ENSG00000138160	ENST00000260731	T	0.73363	-0.74	5.67	1.84	0.25277	.	0.671285	0.15377	N	0.265549	T	0.48150	0.1484	N	0.03608	-0.345	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.35301	-0.9794	10	0.38643	T	0.18	.	7.6854	0.28538	0.0:0.67:0.0:0.33	.	869	P52732	KIF11_HUMAN	C	869	ENSP00000260731:R869C	ENSP00000260731:R869C	R	+	1	0	KIF11	94398006	0.089000	0.21612	0.015000	0.15790	0.000000	0.00434	0.476000	0.22180	0.086000	0.17137	-0.824000	0.03097	CGT	KIF11	-	NULL	ENSG00000138160		0.318	KIF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF11	HGNC	protein_coding	OTTHUMT00000049401.1	-	0.00	90	0	C	NM_004523		94408026	+1	tier1	rs149407589	no_errors	ENST00000260731	ensembl	human	known	74_37	missense	8.46	119	11	SNP	0.024	T
KIF1B	23095	genome.wustl.edu	37	1	10434400	10434400	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:10434400C>G	ENST00000377086.1	+	46	5175	c.4973C>G	c.(4972-4974)tCt>tGt	p.S1658C	KIF1B_ENST00000377081.1_Missense_Mutation_p.S1658C|KIF1B_ENST00000263934.6_Missense_Mutation_p.S1612C			O60333	KIF1B_HUMAN	kinesin family member 1B	1658					anterograde axon cargo transport (GO:0008089)|apoptotic process (GO:0006915)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|mitochondrion transport along microtubule (GO:0047497)|neuromuscular synaptic transmission (GO:0007274)|neuron-neuron synaptic transmission (GO:0007270)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|endometrium(7)|kidney(8)|large_intestine(9)|lung(29)|ovary(3)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(2)	71	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		TCCCGGGCCTCTAGTCCCTGC	0.428																																																	0													132.0	150.0	144.0					1																	10434400		2203	4300	6503	SO:0001583	missense	0			AF257176	CCDS111.1, CCDS112.1	1p36.22	2014-09-17			ENSG00000054523	ENSG00000054523		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	16636	protein-coding gene	gene with protein product		605995		CMT2A, CMT2		11389829, 10762626	Standard	NM_015074		Approved	KIAA0591, KLP, HMSNII	uc001aqw.4	O60333	OTTHUMG00000001817	ENST00000377086.1:c.4973C>G	1.37:g.10434400C>G	ENSP00000366290:p.Ser1658Cys		A6NFS8|A6NKQ4|Q4VXC3|Q4VXC4|Q4VXC5|Q4VXC6|Q96Q94|Q9BV80|Q9P280	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_Kinesin-like,pfam_Pleckstrin_homology,pfam_KIF1B,pfam_FHA_dom,superfamily_P-loop_NTPase,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,smart_FHA_dom,smart_Pleckstrin_homology,pfscan_FHA_dom,pfscan_Pleckstrin_homology,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.S1612C	ENST00000377086.1	37	c.4835		1	.	.	.	.	.	.	.	.	.	.	C	15.29	2.789569	0.50102	.	.	ENSG00000054523	ENST00000355249;ENST00000263934;ENST00000377086;ENST00000377081	T;T;T	0.16196	2.36;2.36;2.36	5.62	5.62	0.85841	.	0.058574	0.64402	D	0.000001	T	0.27169	0.0666	L	0.47716	1.5	0.58432	D	0.999999	P;B;P;B;P;P	0.51653	0.895;0.01;0.895;0.0;0.947;0.91	P;B;P;B;B;P	0.49683	0.524;0.002;0.619;0.0;0.443;0.505	T	0.00271	-1.1859	10	0.39692	T	0.17	.	19.6632	0.95882	0.0:1.0:0.0:0.0	.	1644;1618;1658;1632;1658;1612	Q4R9M9;Q4R9M7;Q4VXC4;Q4R9M8;O60333;O60333-2	.;.;.;.;KIF1B_HUMAN;.	C	1658;1612;1658;1658	ENSP00000263934:S1612C;ENSP00000366290:S1658C;ENSP00000366284:S1658C	ENSP00000263934:S1612C	S	+	2	0	KIF1B	10356987	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.291000	0.78721	2.625000	0.88918	0.655000	0.94253	TCT	KIF1B	-	NULL	ENSG00000054523		0.428	KIF1B-001	NOVEL	basic	protein_coding	KIF1B	HGNC	protein_coding	OTTHUMT00000005102.1	-	0.00	71	0	C			10434400	+1	tier1	-	no_errors	ENST00000263934	ensembl	human	known	74_37	missense	32.84	45	22	SNP	1.000	G
KLB	152831	genome.wustl.edu	37	4	39448748	39448748	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr4:39448748C>G	ENST00000257408.4	+	4	2499	c.2402C>G	c.(2401-2403)tCg>tGg	p.S801W		NM_175737.3	NP_783864.1	Q86Z14	KLOTB_HUMAN	klotho beta	801	Glycosyl hydrolase-1 2.				carbohydrate metabolic process (GO:0005975)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fibroblast growth factor binding (GO:0017134)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(11)|skin(6)	29						CTTTCCAGCTCGGCCCTGCCG	0.647																																																	0													27.0	29.0	28.0					4																	39448748		2201	4291	6492	SO:0001583	missense	0			AB079373	CCDS3451.1	4p14	2008-02-05			ENSG00000134962	ENSG00000134962			15527	protein-coding gene	gene with protein product		611135					Standard	NM_175737		Approved		uc003gua.3	Q86Z14	OTTHUMG00000128577	ENST00000257408.4:c.2402C>G	4.37:g.39448748C>G	ENSP00000257408:p.Ser801Trp		Q2M3K8	Missense_Mutation	SNP	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF,prints_Glyco_hydro_1	p.S801W	ENST00000257408.4	37	c.2402	CCDS3451.1	4	.	.	.	.	.	.	.	.	.	.	C	13.07	2.125936	0.37533	.	.	ENSG00000134962	ENST00000257408	T	0.35973	1.28	4.95	4.95	0.65309	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	1.199690	0.06332	U	0.706371	T	0.72875	0.3515	H	0.94698	3.57	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.65459	-0.6163	10	0.54805	T	0.06	-24.1287	13.2015	0.59772	0.1594:0.8406:0.0:0.0	.	792;801	B7ZL50;Q86Z14	.;KLOTB_HUMAN	W	801	ENSP00000257408:S801W	ENSP00000257408:S801W	S	+	2	0	KLB	39125143	1.000000	0.71417	0.376000	0.26042	0.011000	0.07611	5.829000	0.69316	2.293000	0.77203	0.313000	0.20887	TCG	KLB	-	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF	ENSG00000134962		0.647	KLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLB	HGNC	protein_coding	OTTHUMT00000250429.1	-	0.00	42	0	C	NM_175737		39448748	+1	tier1	-	no_errors	ENST00000257408	ensembl	human	known	74_37	missense	21.82	43	12	SNP	0.958	G
KLHL21	9903	genome.wustl.edu	37	1	6659289	6659289	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:6659289G>C	ENST00000377658.4	-	2	1296	c.1245C>G	c.(1243-1245)tgC>tgG	p.C415W	KLHL21_ENST00000463043.1_Missense_Mutation_p.C48W|KLHL21_ENST00000377663.3_Missense_Mutation_p.C415W|KLHL21_ENST00000467612.1_Missense_Mutation_p.C48W	NM_014851.2	NP_055666.2	Q9UJP4	KLH21_HUMAN	kelch-like family member 21	415					chromosome passenger complex localization to spindle midzone (GO:0035853)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)|regulation of cytokinesis (GO:0032465)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|polar microtubule (GO:0005827)				central_nervous_system(1)|endometrium(1)|kidney(1)|lung(3)|prostate(2)	8	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;7.39e-28)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;1.36e-07)|COAD - Colon adenocarcinoma(227;1.4e-05)|Kidney(185;4.95e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000528)|KIRC - Kidney renal clear cell carcinoma(229;0.000927)|STAD - Stomach adenocarcinoma(132;0.0172)|READ - Rectum adenocarcinoma(331;0.0644)		CAGTGGTGGAGCAGTTGTCCA	0.647																																																	0													119.0	110.0	113.0					1																	6659289		2203	4300	6503	SO:0001583	missense	0			AK090472	CCDS30575.1	1p36	2013-01-30	2013-01-30		ENSG00000162413	ENSG00000162413		"""Kelch-like"", ""BTB/POZ domain containing"""	29041	protein-coding gene	gene with protein product			"""kelch-like 21 (Drosophila)"""				Standard	XM_005263542		Approved	KIAA0469	uc001aoa.3	Q9UJP4	OTTHUMG00000001437	ENST00000377658.4:c.1245C>G	1.37:g.6659289G>C	ENSP00000366886:p.Cys415Trp		B3KQP2|O75057|Q5SY26|Q5SY28|Q8N4I6|Q8NF10	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.C415W	ENST00000377658.4	37	c.1245	CCDS30575.1	1	.	.	.	.	.	.	.	.	.	.	G	15.81	2.944657	0.53079	.	.	ENSG00000162413	ENST00000377658;ENST00000377663	T;T	0.67523	-0.27;-0.27	5.14	1.01	0.19927	Galactose oxidase, beta-propeller (1);	0.000000	0.85682	D	0.000000	T	0.76271	0.3964	M	0.72894	2.215	0.80722	D	1	D;D	0.76494	0.997;0.999	P;D	0.70487	0.788;0.969	T	0.74306	-0.3708	10	0.66056	D	0.02	.	9.4049	0.38455	0.3054:0.0:0.6946:0.0	.	415;415	Q9UJP4;Q9UJP4-2	KLH21_HUMAN;.	W	415	ENSP00000366886:C415W;ENSP00000366891:C415W	ENSP00000366886:C415W	C	-	3	2	KLHL21	6581876	1.000000	0.71417	0.998000	0.56505	0.986000	0.74619	1.296000	0.33389	0.001000	0.14605	-0.136000	0.14681	TGC	KLHL21	-	smart_Kelch_1,pirsf_Kelch-like_gigaxonin	ENSG00000162413		0.647	KLHL21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL21	HGNC	protein_coding	OTTHUMT00000004188.1		0.00	26	0	G	NM_014851		6659289	-1			no_errors	ENST00000377658	ensembl	human	known	74_37	missense	11.76	15	2	SNP	1.000	C
KLHDC9	126823	genome.wustl.edu	37	1	161068192	161068192	+	5'UTR	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:161068192G>C	ENST00000368011.4	+	0	9				KLHDC9_ENST00000490724.2_3'UTR|PFDN2_ENST00000468311.1_5'Flank|KLHDC9_ENST00000392192.2_5'UTR	NM_152366.4	NP_689579.3	Q8NEP7	KLDC9_HUMAN	kelch domain containing 9											lung(5)|upper_aerodigestive_tract(1)	6	all_cancers(52;1.28e-19)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00165)			GCCGGGACTTGAGGTGGGAAC	0.677																																																	0																																										SO:0001623	5_prime_UTR_variant	0			BC022077	CCDS30919.1, CCDS41425.1	1q23.3	2008-02-05			ENSG00000162755	ENSG00000162755			28489	protein-coding gene	gene with protein product	"""kelch/ankyrin repeat containing cyclin A1 interacting protein"""					15159402	Standard	NM_152366		Approved	KARCA1	uc001fxr.3	Q8NEP7	OTTHUMG00000031479	ENST00000368011.4:c.-134G>C	1.37:g.161068192G>C			Q5SY56|Q6NXT9|Q6PKN4|Q8N5E1|Q8NA16	RNA	SNP	-	NULL	ENST00000368011.4	37	NULL	CCDS30919.1	1																																																																																			KLHDC9	-	-	ENSG00000162755		0.677	KLHDC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHDC9	HGNC	protein_coding	OTTHUMT00000077092.1	-	0.00	10	0	G	NM_152366		161068192	+1	tier1	-	no_errors	ENST00000469647	ensembl	human	known	74_37	rna	35.29	11	6	SNP	0.000	C
KLHL4	56062	genome.wustl.edu	37	X	86880713	86880713	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chrX:86880713C>G	ENST00000373119.4	+	6	1386	c.1241C>G	c.(1240-1242)tCc>tGc	p.S414C	KLHL4_ENST00000373114.4_Missense_Mutation_p.S414C	NM_019117.4	NP_061990.2	Q9C0H6	KLHL4_HUMAN	kelch-like family member 4	414						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(29)|ovary(2)|prostate(1)|skin(1)	67						GAGAGAAGATCCATGATGCAA	0.438																																																	0													93.0	81.0	85.0					X																	86880713		2203	4300	6503	SO:0001583	missense	0			AF284765	CCDS14456.1, CCDS14457.1	Xq21.3	2013-01-30	2013-01-30		ENSG00000102271	ENSG00000102271		"""Kelch-like"", ""BTB/POZ domain containing"""	6355	protein-coding gene	gene with protein product		300348	"""kelch (Drosophila)-like 4"", ""kelch-like 4 (Drosophila)"""			11401425	Standard	NM_019117		Approved	KIAA1687, DKELCHL, KHL4	uc004efa.2	Q9C0H6	OTTHUMG00000021946	ENST00000373119.4:c.1241C>G	X.37:g.86880713C>G	ENSP00000362211:p.Ser414Cys		B2RTW2|Q9Y3J5	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pfscan_BTB/POZ-like	p.S414C	ENST00000373119.4	37	c.1241	CCDS14457.1	X	.	.	.	.	.	.	.	.	.	.	C	23.3	4.403099	0.83230	.	.	ENSG00000102271	ENST00000373119;ENST00000373114	T;T	0.75154	-0.91;-0.88	4.89	4.89	0.63831	Galactose oxidase, beta-propeller (1);	0.594107	0.18284	N	0.145928	T	0.82167	0.4978	M	0.73217	2.22	0.53688	D	0.999979	P;D	0.52996	0.63;0.957	B;P	0.54346	0.438;0.749	D	0.84445	0.0585	10	0.66056	D	0.02	.	16.3502	0.83202	0.0:1.0:0.0:0.0	.	414;414	Q9C0H6;Q9C0H6-2	KLHL4_HUMAN;.	C	414	ENSP00000362211:S414C;ENSP00000362206:S414C	ENSP00000362206:S414C	S	+	2	0	KLHL4	86767369	0.992000	0.36948	0.808000	0.32385	0.972000	0.66771	4.410000	0.59774	2.146000	0.66826	0.513000	0.50165	TCC	KLHL4	-	NULL	ENSG00000102271		0.438	KLHL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL4	HGNC	protein_coding	OTTHUMT00000057413.1	-	0.00	25	0	C			86880713	+1	tier1	-	no_errors	ENST00000373114	ensembl	human	known	74_37	missense	46.67	24	21	SNP	0.988	G
KMT2D	8085	genome.wustl.edu	37	12	49427918	49427918	+	Nonsense_Mutation	SNP	C	C	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr12:49427918C>A	ENST00000301067.7	-	38	10671	c.10672G>T	c.(10672-10674)Gaa>Taa	p.E3558*	KMT2D_ENST00000549743.1_5'Flank	NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	3558	Gln-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										GCATCAGCTTCTGGGAACTCA	0.547																																																	0													69.0	66.0	67.0					12																	49427918		2001	4188	6189	SO:0001587	stop_gained	0			AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.10672G>T	12.37:g.49427918C>A	ENSP00000301067:p.Glu3558*		O14687	Nonsense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_Znf_PHD,smart_Znf_RING,smart_HMG_box_dom,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.E3558*	ENST00000301067.7	37	c.10672	CCDS44873.1	12	.	.	.	.	.	.	.	.	.	.	C	52	18.693044	0.99909	.	.	ENSG00000167548	ENST00000301067	.	.	.	5.38	5.38	0.77491	.	0.000000	0.37715	N	0.001965	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	18.2915	0.90131	0.0:1.0:0.0:0.0	.	.	.	.	X	3558	.	ENSP00000301067:E3558X	E	-	1	0	MLL2	47714185	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	7.818000	0.86416	2.711000	0.92665	0.563000	0.77884	GAA	KMT2D	-	NULL	ENSG00000167548		0.547	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KMT2D	HGNC	protein_coding	OTTHUMT00000390183.2	-	0.00	26	0	C			49427918	-1	tier1	-	no_errors	ENST00000301067	ensembl	human	known	74_37	nonsense	21.62	29	8	SNP	1.000	A
KRT78	196374	genome.wustl.edu	37	12	53242563	53242563	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr12:53242563G>C	ENST00000304620.4	-	1	215	c.152C>G	c.(151-153)tCt>tGt	p.S51C	KRT78_ENST00000359499.4_5'Flank	NM_173352.2	NP_775487.2	Q8N1N4	K2C78_HUMAN	keratin 78	51	Gly-rich.|Head.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	18						ACTCCCACGAGAGCCTTCCAG	0.672																																																	0													20.0	22.0	21.0					12																	53242563		2203	4299	6502	SO:0001583	missense	0			AK096419	CCDS8840.1, CCDS73473.1	12q13.13	2013-06-25			ENSG00000170423	ENSG00000170423		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28926	protein-coding gene	gene with protein product		611159				16831889	Standard	XM_005268695		Approved	K5B	uc001sbc.1	Q8N1N4	OTTHUMG00000169880	ENST00000304620.4:c.152C>G	12.37:g.53242563G>C	ENSP00000306261:p.Ser51Cys		A8K4D6|Q5HYM7|Q7RTT2	Missense_Mutation	SNP	pfam_IF,superfamily_Prefoldin,prints_Keratin_II	p.S51C	ENST00000304620.4	37	c.152	CCDS8840.1	12	.	.	.	.	.	.	.	.	.	.	G	14.36	2.512114	0.44660	.	.	ENSG00000170423	ENST00000304620	T	0.75477	-0.94	5.18	2.28	0.28536	.	.	.	.	.	T	0.60983	0.2311	L	0.35723	1.085	0.09310	N	1	B	0.15719	0.014	B	0.14578	0.011	T	0.53913	-0.8371	9	0.72032	D	0.01	.	3.8081	0.08786	0.1512:0.1296:0.5858:0.1334	.	51	Q8N1N4	K2C78_HUMAN	C	51	ENSP00000306261:S51C	ENSP00000306261:S51C	S	-	2	0	KRT78	51528830	0.000000	0.05858	0.002000	0.10522	0.075000	0.17131	-0.247000	0.08866	0.265000	0.21872	0.491000	0.48974	TCT	KRT78	-	NULL	ENSG00000170423		0.672	KRT78-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT78	HGNC	protein_coding	OTTHUMT00000406380.1	-	0.00	35	0	G	NM_173352		53242563	-1	tier1	-	no_errors	ENST00000304620	ensembl	human	known	74_37	missense	25.64	29	10	SNP	0.004	C
KRTAP5-7	440050	genome.wustl.edu	37	11	71238747	71238747	+	Nonsense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr11:71238747C>G	ENST00000398536.4	+	1	435	c.401C>G	c.(400-402)tCa>tGa	p.S134*		NM_001012503.1	NP_001012521.1	Q6L8G8	KRA57_HUMAN	keratin associated protein 5-7	134	7 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				breast(1)|endometrium(1)|kidney(3)|lung(6)|ovary(1)	12						tgctgttcctcaggctgtggg	0.612																																																	0													128.0	136.0	133.0					11																	71238747		2200	4294	6494	SO:0001587	stop_gained	0			AB126076	CCDS41682.1	11q13.4	2008-02-05			ENSG00000244411	ENSG00000244411		"""Keratin associated proteins"""	23602	protein-coding gene	gene with protein product						15144888	Standard	NM_001012503		Approved	KRTAP5.7, KRTAP5-3	uc001oqq.1	Q6L8G8	OTTHUMG00000057570	ENST00000398536.4:c.401C>G	11.37:g.71238747C>G	ENSP00000417330:p.Ser134*		B2RNM3|Q701N5	Nonsense_Mutation	SNP	NULL	p.S134*	ENST00000398536.4	37	c.401	CCDS41682.1	11	.	.	.	.	.	.	.	.	.	.	N	8.851	0.944518	0.18356	.	.	ENSG00000244411	ENST00000398536	.	.	.	1.53	-3.06	0.05379	.	.	.	.	.	.	.	.	.	.	.	0.29947	N	0.820529	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	6.4565	0.21932	0.1897:0.2449:0.5655:0.0	.	.	.	.	X	134	.	ENSP00000417330:S134X	S	+	2	0	KRTAP5-7	70916395	0.113000	0.22115	0.000000	0.03702	0.001000	0.01503	0.563000	0.23547	-0.824000	0.04295	-0.712000	0.03635	TCA	KRTAP5-7	-	NULL	ENSG00000244411		0.612	KRTAP5-7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP5-7	HGNC	protein_coding	OTTHUMT00000127953.1	-	0.00	96	0	C			71238747	+1	tier1	-	no_errors	ENST00000398536	ensembl	human	known	74_37	nonsense	17.27	91	19	SNP	0.004	G
LAMA5	3911	genome.wustl.edu	37	20	60884275	60884275	+	3'UTR	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr20:60884275G>A	ENST00000252999.3	-	0	11271				RP11-157P1.4_ENST00000414042.1_RNA|LAMA5_ENST00000492698.1_5'UTR	NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5						angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			ACCATCTTCAGAAACAAGATC	0.438																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.*117C>T	20.37:g.60884275G>A			Q8TDF8|Q8WZA7|Q9H1P1	RNA	SNP	-	NULL	ENST00000252999.3	37	NULL	CCDS33502.1	20																																																																																			LAMA5	-	-	ENSG00000130702		0.438	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA5	HGNC	protein_coding	OTTHUMT00000080014.2	-	0.00	31	0	G	NM_005560		60884275	-1	tier1	-	no_errors	ENST00000492698	ensembl	human	known	74_37	rna	12.00	22	3	SNP	0.989	A
LAPTM5	7805	genome.wustl.edu	37	1	31211805	31211805	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:31211805G>C	ENST00000294507.3	-	5	566	c.492C>G	c.(490-492)ttC>ttG	p.F164L	MIR4420_ENST00000583944.1_RNA|LAPTM5_ENST00000476492.1_5'Flank	NM_006762.2	NP_006753.1	Q13571	LAPM5_HUMAN	lysosomal protein transmembrane 5	164					transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)				large_intestine(2)|lung(7)|skin(1)	10		Colorectal(325;0.0199)|Myeloproliferative disorder(586;0.0393)|all_neural(195;0.0966)|Medulloblastoma(700;0.151)|Ovarian(437;0.192)		STAD - Stomach adenocarcinoma(196;0.0196)|READ - Rectum adenocarcinoma(331;0.0649)		TCATGGACTTGAAGTTGAGAT	0.557																																																	0													69.0	54.0	60.0					1																	31211805		2203	4300	6503	SO:0001583	missense	0			U51240	CCDS337.1	1p34	2009-07-20	2009-07-20		ENSG00000162511	ENSG00000162511			29612	protein-coding gene	gene with protein product		601476	"""lysosomal multispanning membrane protein 5"""			8661146, 12527926	Standard	NM_006762		Approved		uc001bsc.2	Q13571	OTTHUMG00000003707	ENST00000294507.3:c.492C>G	1.37:g.31211805G>C	ENSP00000294507:p.Phe164Leu		Q13240|Q14698|Q3KP54	Missense_Mutation	SNP	pfam_LAPTM4/5,tigrfam_LAPTM_4A/5	p.F164L	ENST00000294507.3	37	c.492	CCDS337.1	1	.	.	.	.	.	.	.	.	.	.	G	11.16	1.557443	0.27827	.	.	ENSG00000162511	ENST00000294507;ENST00000424259	T	0.54279	0.58	5.73	3.84	0.44239	.	0.075891	0.64402	D	0.000016	T	0.40094	0.1103	L	0.50333	1.59	0.30929	N	0.727109	B	0.15930	0.015	B	0.22152	0.038	T	0.38972	-0.9636	10	0.02654	T	1	-58.4551	9.3353	0.38047	0.1711:0.0:0.8289:0.0	.	164	Q13571	LAPM5_HUMAN	L	164	ENSP00000294507:F164L	ENSP00000294507:F164L	F	-	3	2	LAPTM5	30984392	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.618000	0.46393	1.418000	0.47098	0.655000	0.94253	TTC	LAPTM5	-	pfam_LAPTM4/5,tigrfam_LAPTM_4A/5	ENSG00000162511		0.557	LAPTM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAPTM5	HGNC	protein_coding	OTTHUMT00000010463.1	-	0.00	24	0	G	NM_006762		31211805	-1	tier1	-	no_errors	ENST00000294507	ensembl	human	known	74_37	missense	22.22	42	12	SNP	1.000	C
LCE3C	353144	genome.wustl.edu	37	1	152573397	152573397	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:152573397C>G	ENST00000333881.3	+	1	260	c.190C>G	c.(190-192)Caa>Gaa	p.Q64E		NM_178434.2	NP_848521.1	Q5T5A8	LCE3C_HUMAN	late cornified envelope 3C	64					keratinization (GO:0031424)					lung(1)	1	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)	UCEC - Uterine corpus endometrioid carcinoma (5;0.153)|KIRC - Kidney renal clear cell carcinoma(4;0.0313)|Kidney(5;0.0367)		CAGGTCCCATCAATGCCGGCG	0.652																																																	0													50.0	47.0	48.0					1																	152573397		1811	2706	4517	SO:0001583	missense	0			BI670516	CCDS1015.1	1q21.3	2008-02-05		2004-10-15	ENSG00000244057	ENSG00000244057		"""Late cornified envelopes"""	16612	protein-coding gene	gene with protein product		612615	"""small proline rich-like (epidermal differentiation complex) 3A"""	SPRL3A		11698679	Standard	NM_178434		Approved	LEP15	uc001fac.2	Q5T5A8	OTTHUMG00000014403	ENST00000333881.3:c.190C>G	1.37:g.152573397C>G	ENSP00000334644:p.Gln64Glu		A1L420	Missense_Mutation	SNP	NULL	p.Q64E	ENST00000333881.3	37	c.190	CCDS1015.1	1	.	.	.	.	.	.	.	.	.	.	C	1.648	-0.514607	0.04200	.	.	ENSG00000244057	ENST00000333881	T	0.03441	3.93	4.01	-6.52	0.01872	.	.	.	.	.	T	0.00875	0.0029	.	.	.	0.09310	N	1	B	0.14012	0.009	B	0.09377	0.004	T	0.50448	-0.8827	8	0.56958	D	0.05	.	7.2431	0.26107	0.5678:0.1834:0.2487:0.0	.	64	Q5T5A8	LCE3C_HUMAN	E	64	ENSP00000334644:Q64E	ENSP00000334644:Q64E	Q	+	1	0	LCE3C	150840021	0.000000	0.05858	0.164000	0.22755	0.066000	0.16364	-0.530000	0.06179	-0.846000	0.04174	0.313000	0.20887	CAA	LCE3C	-	NULL	ENSG00000244057		0.652	LCE3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCE3C	HGNC	protein_coding	OTTHUMT00000040061.2	-	0.00	30	0	C	NM_178434		152573397	+1	tier1	-	no_errors	ENST00000333881	ensembl	human	known	74_37	missense	64.44	16	29	SNP	0.013	G
LAMC1	3915	genome.wustl.edu	37	1	183093999	183093999	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:183093999G>C	ENST00000258341.4	+	14	2892	c.2635G>C	c.(2635-2637)Gac>Cac	p.D879H		NM_002293.3	NP_002284.3	P11047	LAMC1_HUMAN	laminin, gamma 1 (formerly LAMB2)	879	Laminin EGF-like 8. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|endoderm development (GO:0007492)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|positive regulation of epithelial cell proliferation (GO:0050679)|protein complex assembly (GO:0006461)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(27)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	76						CAATCCAGCAGACAAATGCAA	0.428																																																	0													60.0	59.0	59.0					1																	183093999		2203	4300	6503	SO:0001583	missense	0			J03202	CCDS1351.1	1q31	2013-03-01			ENSG00000135862	ENSG00000135862		"""Laminins"""	6492	protein-coding gene	gene with protein product		150290		LAMB2		3234037	Standard	NM_002293		Approved		uc001gpy.4	P11047	OTTHUMG00000035418	ENST00000258341.4:c.2635G>C	1.37:g.183093999G>C	ENSP00000258341:p.Asp879His		Q5VYE7	Missense_Mutation	SNP	pfam_Laminin_N,pfam_EGF_laminin,pfam_Laminin_B_type_IV,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_N	p.D879H	ENST00000258341.4	37	c.2635	CCDS1351.1	1	.	.	.	.	.	.	.	.	.	.	G	18.60	3.658095	0.67586	.	.	ENSG00000135862	ENST00000258341	T	0.61742	0.08	5.51	4.59	0.56863	EGF-like, laminin (4);	0.296252	0.41097	D	0.000960	T	0.74512	0.3726	M	0.92317	3.295	0.53688	D	0.999971	D	0.63046	0.992	P	0.54815	0.761	T	0.78833	-0.2048	10	0.48119	T	0.1	.	11.0016	0.47609	0.0:0.1403:0.714:0.1457	.	879	P11047	LAMC1_HUMAN	H	879	ENSP00000258341:D879H	ENSP00000258341:D879H	D	+	1	0	LAMC1	181360622	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.479000	0.53165	1.293000	0.44690	0.650000	0.86243	GAC	LAMC1	-	pfam_EGF_laminin,smart_EGF_laminin,smart_EG-like_dom,pfscan_EGF_laminin	ENSG00000135862		0.428	LAMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMC1	HGNC	protein_coding	OTTHUMT00000085954.2	-	0.00	28	0	G	NM_002293		183093999	+1	tier1	-	no_errors	ENST00000258341	ensembl	human	known	74_37	missense	8.51	43	4	SNP	1.000	C
LCN15	389812	genome.wustl.edu	37	9	139658513	139658513	+	Intron	SNP	C	C	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr9:139658513C>A	ENST00000316144.5	-	2	121				LCN15_ENST00000482511.1_5'UTR	NM_203347.1	NP_976222.1	Q6UWW0	LCN15_HUMAN	lipocalin 15						lipid metabolic process (GO:0006629)	extracellular region (GO:0005576)	small molecule binding (GO:0036094)|transporter activity (GO:0005215)			endometrium(1)|lung(1)	2						GCAGGGCCCTCCTTGCCCAGG	0.632																																																	0													12.0	15.0	14.0					9																	139658513		1327	2307	3634	SO:0001627	intron_variant	0				CCDS7006.1	9q34.3	2011-10-24			ENSG00000177984	ENSG00000177984		"""Lipocalins"""	33777	protein-coding gene	gene with protein product							Standard	NM_203347		Approved	UNQ2541, PRO6093	uc004cjd.3	Q6UWW0	OTTHUMG00000020943	ENST00000316144.5:c.97-52G>T	9.37:g.139658513C>A				RNA	SNP	-	NULL	ENST00000316144.5	37	NULL	CCDS7006.1	9																																																																																			LCN15	-	-	ENSG00000177984		0.632	LCN15-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LCN15	HGNC	protein_coding	OTTHUMT00000055114.2	-	0.00	17	0	C	NM_203347		139658513	-1	tier1	-	no_errors	ENST00000482511	ensembl	human	known	74_37	rna	33.33	10	5	SNP	0.008	A
LDHAL6CP	121498	genome.wustl.edu	37	12	63398598	63398598	+	lincRNA	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr12:63398598C>T	ENST00000552996.1	-	0	211				LDHAL6CP_ENST00000550738.1_RNA																							GAGTGACTTTCCTTTTTATTT	0.308																																																	0																																												0																															12.37:g.63398598C>T				RNA	SNP	-	NULL	ENST00000552996.1	37	NULL		12																																																																																			LDHAL6CP	-	-	ENSG00000250517		0.308	RP11-848D3.5-001	KNOWN	basic	lincRNA	LDHAL6CP	HGNC	lincRNA	OTTHUMT00000406731.1	-	0.00	21	0	C			63398598	+1	tier1	-	no_errors	ENST00000550738	ensembl	human	known	74_37	rna	31.82	15	7	SNP	0.552	T
LDLRAD2	401944	genome.wustl.edu	37	1	22148534	22148534	+	Intron	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:22148534C>G	ENST00000344642.2	+	5	992				LDLRAD2_ENST00000484271.1_3'UTR|LDLRAD2_ENST00000543870.1_Intron|HSPG2_ENST00000486901.1_5'Flank	NM_001013693.2	NP_001013715.2	Q5SZI1	LRAD2_HUMAN	low density lipoprotein receptor class A domain containing 2							integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(1)|lung(3)	6		Colorectal(325;0.000147)|Renal(390;0.000734)|Lung NSC(340;0.00166)|all_lung(284;0.00172)|Breast(348;0.012)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;5.2e-26)|COAD - Colon adenocarcinoma(152;1.13e-05)|GBM - Glioblastoma multiforme(114;1.36e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000544)|KIRC - Kidney renal clear cell carcinoma(1967;0.00598)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.197)		ggctctctgtctgatgttgga	0.587																																																	0																																										SO:0001627	intron_variant	0			AL590103	CCDS30624.1	1p36.12	2008-02-05	2005-10-07		ENSG00000187942	ENSG00000187942			32071	protein-coding gene	gene with protein product			"""low density lipoprotein receptor A domain containing 2"""				Standard	NM_001013693		Approved		uc001bfg.1	Q5SZI1	OTTHUMG00000002675	ENST00000344642.2:c.806-161C>G	1.37:g.22148534C>G			B9EJB3|Q6ZSN5	RNA	SNP	-	NULL	ENST00000344642.2	37	NULL	CCDS30624.1	1																																																																																			LDLRAD2	-	-	ENSG00000187942		0.587	LDLRAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LDLRAD2	HGNC	protein_coding	OTTHUMT00000007601.1	-	0.00	30	0	C	NM_001013693		22148534	+1	tier1	-	no_errors	ENST00000484271	ensembl	human	known	74_37	rna	30.77	9	4	SNP	0.002	G
LETM2	137994	genome.wustl.edu	37	8	38251658	38251658	+	Missense_Mutation	SNP	A	A	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr8:38251658A>G	ENST00000379957.4	+	4	671	c.544A>G	c.(544-546)Atg>Gtg	p.M182V	LETM2_ENST00000297720.5_Intron|LETM2_ENST00000523983.2_Missense_Mutation_p.M135V|LETM2_ENST00000527710.1_5'Flank|LETM2_ENST00000524874.1_Intron|LETM2_ENST00000519476.2_3'UTR	NM_001199659.1	NP_001186588.1	Q2VYF4	LETM2_HUMAN	leucine zipper-EF-hand containing transmembrane protein 2	182	LETM1.					integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				NS(1)|large_intestine(1)|lung(3)|prostate(2)	7	all_cancers(2;6.77e-47)|all_epithelial(2;1.01e-50)|all_lung(3;1.25e-23)|Lung NSC(2;2.76e-23)|Colorectal(12;0.000442)|Esophageal squamous(3;0.00202)	all_lung(54;0.0657)|Hepatocellular(245;0.152)|Lung NSC(58;0.175)	Epithelial(3;1.17e-42)|all cancers(3;5.44e-38)|BRCA - Breast invasive adenocarcinoma(5;5.44e-27)|LUSC - Lung squamous cell carcinoma(2;7.12e-25)|Lung(2;4.49e-22)|COAD - Colon adenocarcinoma(9;0.114)			GGTTCCATTTATGGTGTTCTT	0.343																																																	0																																										SO:0001583	missense	0			AK058138	CCDS6106.1, CCDS56534.1, CCDS69466.1, CCDS75731.1	8p12	2013-01-11						"""EF-hand domain containing"""	14648	protein-coding gene	gene with protein product						11549311	Standard	NM_001286821		Approved	FLJ25409	uc003xlm.2	Q2VYF4		ENST00000379957.4:c.544A>G	8.37:g.38251658A>G	ENSP00000369291:p.Met182Val		A6NMG3|Q8NCR2|Q96LL1	Missense_Mutation	SNP	pfam_LETM1	p.M182V	ENST00000379957.4	37	c.544		8	.	.	.	.	.	.	.	.	.	.	A	7.525	0.657539	0.14645	.	.	ENSG00000165046	ENST00000379957;ENST00000523983	T;T	0.40476	1.03;1.03	6.02	0.612	0.17591	LETM1-like (1);	0.271361	0.31909	N	0.006871	T	0.20373	0.0490	N	0.20845	0.615	0.80722	D	1	B	0.06786	0.001	B	0.15870	0.014	T	0.05835	-1.0861	10	0.23302	T	0.38	.	2.9428	0.05836	0.4607:0.3039:0.1387:0.0968	.	182	Q2VYF4	LETM2_HUMAN	V	182;135	ENSP00000369291:M182V;ENSP00000428765:M135V	ENSP00000369291:M182V	M	+	1	0	LETM2	38370815	1.000000	0.71417	0.933000	0.37362	0.989000	0.77384	1.460000	0.35244	-0.094000	0.12374	0.533000	0.62120	ATG	LETM2	-	pfam_LETM1	ENSG00000165046		0.343	LETM2-013	KNOWN	basic|appris_candidate_longest	protein_coding	LETM2	HGNC	protein_coding	OTTHUMT00000381816.1	-	0.00	89	0	A	NM_144652		38251658	+1	tier1	-	no_errors	ENST00000379957	ensembl	human	known	74_37	missense	25.76	49	17	SNP	0.997	G
LILRB4	11006	genome.wustl.edu	37	19	55175698	55175698	+	Silent	SNP	C	C	T	rs541287083		TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr19:55175698C>T	ENST00000391736.1	+	6	732	c.417C>T	c.(415-417)agC>agT	p.S139S	LILRB4_ENST00000270452.2_Silent_p.S139S|LILRB4_ENST00000391734.3_Silent_p.S139S|LILRB4_ENST00000391733.3_Silent_p.S139S|LILRB4_ENST00000430952.2_Silent_p.S139S	NM_001278426.2|NM_001278428.2|NM_001278429.2|NM_001278430.2	NP_001265355.1|NP_001265357.1|NP_001265358.1|NP_001265359.1	Q8NHJ6	LIRB4_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4	139	Ig-like C2-type 2.				immune system process (GO:0002376)|negative regulation of osteoclast differentiation (GO:0045671)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|receptor activity (GO:0004872)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(20)|ovary(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)	39				GBM - Glioblastoma multiforme(193;0.035)		CAGGAAAGAGCGTGACCCTGC	0.572													C|||	1	0.000199681	0.0	0.0	5008	,	,		20867	0.001		0.0	False		,,,				2504	0.0																0													103.0	98.0	99.0					19																	55175698		2203	4300	6503	SO:0001819	synonymous_variant	0			U82979	CCDS12902.1, CCDS42618.1	19q13.4	2013-01-11				ENSG00000186818		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6608	protein-coding gene	gene with protein product		604821				9151699, 9079806	Standard	XM_005277050		Approved	LIR-5, ILT3, HM18, LIR5, CD85k	uc002qgp.3	Q8NHJ6		ENST00000391736.1:c.417C>T	19.37:g.55175698C>T			A8MVL8|O15468|O75021|Q6FGQ9|Q8N1C7|Q8NHL5	Silent	SNP	pfam_Immunoglobulin,pfscan_Ig-like_dom	p.S139	ENST00000391736.1	37	c.417	CCDS12902.1	19																																																																																			LILRB4	-	pfam_Immunoglobulin,pfscan_Ig-like_dom	ENSG00000186818		0.572	LILRB4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LILRB4	HGNC	protein_coding	OTTHUMT00000141127.3	-	0.00	126	0	C			55175698	+1	tier1	-	no_errors	ENST00000270452	ensembl	human	known	74_37	silent	12.40	106	15	SNP	0.005	T
LOC63930	63930	genome.wustl.edu	37	20	61665989	61665989	+	lincRNA	SNP	C	C	T	rs572219143		TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr20:61665989C>T	ENST00000607802.1	+	0	91				LINC00029_ENST00000370341.3_lincRNA	NR_033370.1																						AGCGTGATTCCGTGCCACGGC	0.522													C|||	1	0.000199681	0.0	0.0	5008	,	,		21600	0.001		0.0	False		,,,				2504	0.0																0																																												0																															20.37:g.61665989C>T				RNA	SNP	-	NULL	ENST00000607802.1	37	NULL		20																																																																																			LINC00029	-	-	ENSG00000125514		0.522	RP11-305P22.9-001	KNOWN	basic	lincRNA	LINC00029	HGNC	lincRNA	OTTHUMT00000470475.1	-	0.00	51	0	C			61665989	-1	tier1	-	no_errors	ENST00000370341	ensembl	human	known	74_37	rna	8.62	53	5	SNP	0.000	T
LINC00266-1	140849	genome.wustl.edu	37	20	62942674	62942674	+	IGR	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr20:62942674C>G								LINC00266-1 (7762 upstream) : None (None downstream)																							AAAGAAGAATCTGAAGTGAAA	0.363																																																	0																																										SO:0001628	intergenic_variant	0																															20.37:g.62942674C>G				RNA	SNP	-	NULL		37	NULL		20																																																																																			LINC00266-1	-	-	ENSG00000149656	0	0.363					LINC00266-1	HGNC			-	0.00	285	0	C			62942674	+1	tier1	-	no_errors	ENST00000425473	ensembl	human	known	74_37	rna	8.33	296	27	SNP	0.232	G
LNX1	84708	genome.wustl.edu	37	4	54373487	54373487	+	Missense_Mutation	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr4:54373487C>T	ENST00000263925.7	-	4	1086	c.772G>A	c.(772-774)Gaa>Aaa	p.E258K	LNX1-AS1_ENST00000510785.1_RNA|LNX1_ENST00000306888.2_Missense_Mutation_p.E162K|LNX1-AS1_ENST00000514364.1_RNA|FIP1L1_ENST00000507166.1_Intron|LNX1-AS1_ENST00000511989.1_RNA	NM_001126328.2	NP_001119800.1	Q8TBB1	LNX1_HUMAN	ligand of numb-protein X 1, E3 ubiquitin protein ligase	258					protein homooligomerization (GO:0051260)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|endometrium(3)|large_intestine(11)|lung(6)|ovary(3)|urinary_tract(4)	32	all_neural(26;0.153)		GBM - Glioblastoma multiforme(3;8.2e-46)|LUSC - Lung squamous cell carcinoma(32;0.0134)			CATTTACCTTCAGGGGCAGTG	0.532																																																	0													139.0	121.0	127.0					4																	54373487		2203	4300	6503	SO:0001583	missense	0			AF237782	CCDS3492.1, CCDS47057.1	4q12	2013-01-09	2012-02-23	2005-11-04	ENSG00000072201	ENSG00000072201		"""RING-type (C3HC4) zinc fingers"""	6657	protein-coding gene	gene with protein product		609732	"""ligand of numb-protein X"", ""ligand of numb-protein X 1"""	LNX		11521506, 11782429	Standard	NM_032622		Approved	MPDZ, PDZRN2	uc003hag.5	Q8TBB1	OTTHUMG00000102099	ENST00000263925.7:c.772G>A	4.37:g.54373487C>T	ENSP00000263925:p.Glu258Lys		Q4W5K7|Q8N4C2|Q96MJ7|Q9BY20	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_Znf_RING,smart_PDZ,pfscan_PDZ,pfscan_Znf_RING	p.E258K	ENST00000263925.7	37	c.772	CCDS47057.1	4	.	.	.	.	.	.	.	.	.	.	C	10.32	1.316650	0.23908	.	.	ENSG00000072201	ENST00000306888;ENST00000538207;ENST00000263925	T;T	0.08282	3.11;4.54	5.0	5.0	0.66597	PDZ/DHR/GLGF (1);	0.394002	0.28883	N	0.013839	T	0.08492	0.0211	L	0.43152	1.355	0.43583	D	0.995922	B;B	0.25235	0.121;0.006	B;B	0.21360	0.034;0.012	T	0.10894	-1.0610	10	0.06494	T	0.89	.	18.0937	0.89481	0.0:1.0:0.0:0.0	.	258;162	Q8TBB1;Q8TBB1-2	LNX1_HUMAN;.	K	162;96;258	ENSP00000302879:E162K;ENSP00000263925:E258K	ENSP00000263925:E258K	E	-	1	0	LNX1	54068244	1.000000	0.71417	0.964000	0.40570	0.071000	0.16799	5.732000	0.68563	2.602000	0.87976	0.455000	0.32223	GAA	LNX1	-	superfamily_PDZ	ENSG00000072201		0.532	LNX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LNX1	HGNC	protein_coding	OTTHUMT00000219934.2	-	0.00	40	0	C			54373487	-1	tier1	-	no_errors	ENST00000263925	ensembl	human	known	74_37	missense	25.45	41	14	SNP	0.989	T
TP53TG3HP	100130700	genome.wustl.edu	37	16	34739560	34739560	+	lincRNA	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr16:34739560G>A	ENST00000562591.1	-	0	362				RP11-80F22.2_ENST00000569755.2_RNA	NR_034019.1																						GTGAGGCACAGATGAGTTATT	0.299																																																	0																																												0																															16.37:g.34739560G>A				RNA	SNP	-	NULL	ENST00000562591.1	37	NULL		16																																																																																			RP11-80F22.15	-	-	ENSG00000260857		0.299	RP11-80F22.15-001	KNOWN	basic	lincRNA	LOC100130700	Clone_based_vega_gene	lincRNA	OTTHUMT00000465648.1	-	0.00	40	0	G			34739560	-1	tier1	-	no_errors	ENST00000562591	ensembl	human	known	74_37	rna	22.22	42	12	SNP	0.001	A
LOC101927648	101927648	genome.wustl.edu	37	1	143355600	143355600	+	lincRNA	SNP	G	G	A	rs369564219		TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:143355600G>A	ENST00000423249.1	-	0	1151				RP11-435B5.3_ENST00000430699.1_lincRNA																							AGATATCTGTGCAGCCCTTGG	0.383																																																	0																																												0																															1.37:g.143355600G>A				RNA	SNP	-	NULL	ENST00000423249.1	37	NULL		1																																																																																			RP11-435B5.4	-	-	ENSG00000185044		0.383	RP11-435B5.4-002	KNOWN	not_best_in_genome_evidence|basic	lincRNA	LOC101927648	Clone_based_vega_gene	lincRNA	OTTHUMT00000037552.1	-	0.00	47	0	G			143355600	-1	tier1	-	no_errors	ENST00000423249	ensembl	human	known	74_37	rna	18.60	35	8	SNP	0.005	A
LOC101927648	101927648	genome.wustl.edu	37	1	143355605	143355605	+	lincRNA	SNP	C	C	T	rs368439406		TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:143355605C>T	ENST00000423249.1	-	0	1146				RP11-435B5.3_ENST00000430699.1_lincRNA																							TCTGTGCAGCCCTTGGATCAA	0.373																																																	0																																												0																															1.37:g.143355605C>T				RNA	SNP	-	NULL	ENST00000423249.1	37	NULL		1																																																																																			RP11-435B5.4	-	-	ENSG00000185044		0.373	RP11-435B5.4-002	KNOWN	not_best_in_genome_evidence|basic	lincRNA	LOC101927648	Clone_based_vega_gene	lincRNA	OTTHUMT00000037552.1	-	0.00	47	0	C			143355605	-1	tier1	-	no_errors	ENST00000423249	ensembl	human	known	74_37	rna	18.60	35	8	SNP	0.001	T
FAM91A3P	729182	genome.wustl.edu	37	1	149262282	149262282	+	lincRNA	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:149262282G>A	ENST00000325963.8	+	0	1829																											CATAGAAGATGCTCTTGTCAT	0.408																																																	0																																												0																															1.37:g.149262282G>A				RNA	SNP	-	NULL	ENST00000325963.8	37	NULL		1																																																																																			RP11-403I13.4	-	-	ENSG00000223779		0.408	RP11-403I13.4-002	KNOWN	not_best_in_genome_evidence|basic	lincRNA	LOC100293748	Clone_based_vega_gene	lincRNA	OTTHUMT00000099551.1	-	0.00	220	0	G			149262282	+1	tier1	-	no_errors	ENST00000325963	ensembl	human	known	74_37	rna	9.62	235	25	SNP	1.000	A
CADM3	57863	genome.wustl.edu	37	1	159171026	159171026	+	3'UTR	SNP	T	T	A	rs371451747		TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:159171026T>A	ENST00000368125.4	+	0	1668				DARC_ENST00000537147.1_5'Flank|CADM3_ENST00000368124.4_3'UTR|CTA-134P22.2_ENST00000415675.2_RNA|CTA-134P22.2_ENST00000609696.1_RNA|CADM3_ENST00000497636.1_3'UTR	NM_001127173.1	NP_001120645.1	Q8N126	CADM3_HUMAN	cell adhesion molecule 3						adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|protein localization (GO:0008104)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(20)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55	all_hematologic(112;0.0429)					AGCCCTGGGGTGAGAAAAGCA	0.478																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AY046418	CCDS1182.1, CCDS44251.1	1q21.2-q22	2013-01-29	2007-02-07	2007-02-07	ENSG00000162706	ENSG00000162706		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17601	protein-coding gene	gene with protein product	"""nectin-like 1"""	609743	"""immunoglobulin superfamily, member 4B"""	IGSF4B		11536053	Standard	NM_021189		Approved	BIgR, FLJ10698, TSLL1, NECL1, SynCAM3, Necl-1	uc001ftk.2	Q8N126	OTTHUMG00000037177	ENST00000368125.4:c.*314T>A	1.37:g.159171026T>A			Q8IZQ9|Q9NVJ5|Q9UJP1	RNA	SNP	-	NULL	ENST00000368125.4	37	NULL	CCDS44251.1	1																																																																																			CTA-134P22.2	-	-	ENSG00000225670		0.478	CADM3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LOC100131825	Clone_based_vega_gene	protein_coding	OTTHUMT00000090330.1	-	0.00	26	0	T	NM_021189		159171026	-1	tier1	-	no_errors	ENST00000415675	ensembl	human	known	74_37	rna	19.51	32	8	SNP	0.949	A
CCDC192	728586	genome.wustl.edu	37	5	127039171	127039171	+	lincRNA	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr5:127039171C>T	ENST00000514853.2	+	0	90																											ATCTGTGGTCCCAGAGTCTGA	0.483																																																	0																																												0																															5.37:g.127039171C>T				RNA	SNP	-	NULL	ENST00000514853.2	37	NULL		5																																																																																			CTC-228N24.1	-	-	ENSG00000230561		0.483	CTC-228N24.1-001	KNOWN	not_organism_supported|basic	lincRNA	LOC728586	Clone_based_vega_gene	lincRNA	OTTHUMT00000372464.3	-	0.00	55	0	C			127039171	+1	tier1	-	no_errors	ENST00000514853	ensembl	human	known	74_37	rna	18.75	51	12	SNP	0.003	T
LPIN3	64900	genome.wustl.edu	37	20	39987112	39987112	+	Missense_Mutation	SNP	G	G	C	rs146490125	byFrequency	TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr20:39987112G>C	ENST00000373257.3	+	19	2432	c.2341G>C	c.(2341-2343)Gag>Cag	p.E781Q	LPIN3_ENST00000491528.1_3'UTR	NM_022896.1	NP_075047.1	Q9BQK8	LPIN3_HUMAN	lipin 3	781	C-LIP.				fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(7)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		Myeloproliferative disorder(115;0.000739)				GGGCCTGCCTGAGTCACGCAT	0.602																																																	0								G	GLN/GLU	1,4405	2.1+/-5.4	0,1,2202	66.0	71.0	69.0		2341	-0.8	0.0	20	dbSNP_134	69	5,8595	4.3+/-15.6	0,5,4295	yes	missense	LPIN3	NM_022896.1	29	0,6,6497	CC,CG,GG		0.0581,0.0227,0.0461	benign	781/852	39987112	6,13000	2203	4300	6503	SO:0001583	missense	0			AL132654	CCDS33469.1	20q11.2-q12	2006-04-04	2002-05-23		ENSG00000132793	ENSG00000132793			14451	protein-coding gene	gene with protein product		605520	"""lipin 3-like"""	LIPN3L		11138012	Standard	XM_005260515		Approved	SMP2	uc002xjx.3	Q9BQK8	OTTHUMG00000033056	ENST00000373257.3:c.2341G>C	20.37:g.39987112G>C	ENSP00000362354:p.Glu781Gln		B2RTT5|Q5TDB9|Q9NPY8|Q9UJE5	Missense_Mutation	SNP	pfam_LNS2,pfam_Lipin_N,superfamily_HAD-like_dom,smart_LNS2	p.E781Q	ENST00000373257.3	37	c.2341	CCDS33469.1	20	.	.	.	.	.	.	.	.	.	.	G	14.11	2.438110	0.43326	2.27E-4	5.81E-4	ENSG00000132793	ENST00000373257	T	0.76448	-1.02	5.38	-0.793	0.10922	HAD-like domain (2);LNS2, Lipin/Ned1/Smp2 (2);	0.581911	0.17228	N	0.182071	T	0.71888	0.3393	L	0.49640	1.575	0.09310	N	1	P;B	0.36249	0.545;0.063	B;B	0.43413	0.419;0.046	T	0.62177	-0.6909	9	.	.	.	-2.0501	8.1962	0.31398	0.2764:0.1076:0.616:0.0	.	782;781	Q9BQK8-2;Q9BQK8	.;LPIN3_HUMAN	Q	781	ENSP00000362354:E781Q	.	E	+	1	0	LPIN3	39420526	0.010000	0.17322	0.001000	0.08648	0.576000	0.36127	1.748000	0.38308	-0.002000	0.14469	0.650000	0.86243	GAG	LPIN3	-	pfam_LNS2,superfamily_HAD-like_dom,smart_LNS2	ENSG00000132793		0.602	LPIN3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	LPIN3	HGNC	protein_coding	OTTHUMT00000080393.1	-	0.00	11	0	G	NM_022896		39987112	+1	tier1	rs146490125	no_errors	ENST00000373257	ensembl	human	known	74_37	missense	26.67	11	4	SNP	0.001	C
LPL	4023	genome.wustl.edu	37	8	19813423	19813423	+	Nonsense_Mutation	SNP	G	G	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr8:19813423G>T	ENST00000311322.8	+	6	1317	c.847G>T	c.(847-849)Gaa>Taa	p.E283*		NM_000237.2	NP_000228.1	P06858	LIPL_HUMAN	lipoprotein lipase	283					chylomicron remodeling (GO:0034371)|fatty acid biosynthetic process (GO:0006633)|lipoprotein metabolic process (GO:0042157)|phospholipid metabolic process (GO:0006644)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of sequestering of triglyceride (GO:0010890)|response to cold (GO:0009409)|response to drug (GO:0042493)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|triglyceride catabolic process (GO:0019433)|triglyceride homeostasis (GO:0070328)|triglyceride metabolic process (GO:0006641)|very-low-density lipoprotein particle remodeling (GO:0034372)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|chylomicron (GO:0042627)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	apolipoprotein binding (GO:0034185)|heparin binding (GO:0008201)|lipoprotein lipase activity (GO:0004465)|phospholipase activity (GO:0004620)|receptor binding (GO:0005102)|triglyceride binding (GO:0017129)|triglyceride lipase activity (GO:0004806)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	36				Colorectal(111;0.0577)|COAD - Colon adenocarcinoma(73;0.216)	AST-120(DB05269)|Tyloxapol(DB06439)	GTTGAATGAAGAAAATCCAAG	0.468																																																	0													97.0	97.0	97.0					8																	19813423		2203	4300	6503	SO:0001587	stop_gained	0				CCDS6012.1	8p22	2012-10-02			ENSG00000175445	ENSG00000175445	3.1.1.34		6677	protein-coding gene	gene with protein product		609708		LIPD			Standard	NM_000237		Approved		uc003wzk.4	P06858	OTTHUMG00000036645	ENST00000311322.8:c.847G>T	8.37:g.19813423G>T	ENSP00000309757:p.Glu283*		B2R5T9|Q16282|Q16283|Q96FC4	Nonsense_Mutation	SNP	pirsf_Lipoprotein_lipase_LIPH,pfam_Lipase_N,pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,prints_Lipo_Lipase,prints_Lipase,pfscan_PLAT/LH2_dom,tigrfam_Lipo_Lipase	p.E283*	ENST00000311322.8	37	c.847	CCDS6012.1	8	.	.	.	.	.	.	.	.	.	.	G	42	9.723512	0.99248	.	.	ENSG00000175445	ENST00000311322;ENST00000538071;ENST00000535763	.	.	.	6.07	6.07	0.98685	.	0.137404	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	A	1.000000	.	.	.	.	.	.	.	.	.	.	.	.	.	-18.6753	18.2083	0.89861	0.0:0.0:1.0:0.0	.	.	.	.	X	283;207;269	.	.	E	+	1	0	LPL	19857703	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.326000	0.72905	2.902000	0.99343	0.650000	0.86243	GAA	LPL	-	pirsf_Lipoprotein_lipase_LIPH,pfam_Lipase_N,tigrfam_Lipo_Lipase	ENSG00000175445		0.468	LPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPL	HGNC	protein_coding	OTTHUMT00000089113.3		0.00	42	0	G			19813423	+1			no_errors	ENST00000311322	ensembl	human	known	74_37	nonsense	5.71	33	2	SNP	1.000	T
PLPPR4	9890	genome.wustl.edu	37	1	99771566	99771566	+	Missense_Mutation	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:99771566G>A	ENST00000370185.3	+	7	1789	c.1292G>A	c.(1291-1293)aGa>aAa	p.R431K	LPPR4_ENST00000457765.1_Missense_Mutation_p.R373K|LPPR4_ENST00000370184.1_Missense_Mutation_p.R273K	NM_014839.4	NP_055654.2	Q7Z2D5	LPPR4_HUMAN		431					axonogenesis (GO:0007409)|inner ear development (GO:0048839)|phospholipid dephosphorylation (GO:0046839)	integral component of plasma membrane (GO:0005887)	lipid phosphatase activity (GO:0042577)|phosphatidate phosphatase activity (GO:0008195)	p.R431T(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(39)|ovary(3)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	72		all_epithelial(167;3.54e-06)|all_lung(203;0.00139)|Lung NSC(277;0.00202)		Epithelial(280;0.0736)|all cancers(265;0.0975)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)|Colorectal(170;0.22)		CCTGTCAGAAGAAATGCGAGC	0.488																																																	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)											66.0	67.0	66.0					1																	99771566		2203	4300	6503	SO:0001583	missense	0																														ENST00000370185.3:c.1292G>A	1.37:g.99771566G>A	ENSP00000359204:p.Arg431Lys		E7EPS1|O75043|Q5T9R9|Q86XQ5|Q8N3F1|Q96MP0	Missense_Mutation	SNP	pfam_P_Acid_Pase_2/haloperoxidase,superfamily_P_Acid_Pase_2/haloperoxidase,smart_P_Acid_Pase_2/haloperoxidase	p.R431K	ENST00000370185.3	37	c.1292	CCDS757.1	1	.	.	.	.	.	.	.	.	.	.	G	15.42	2.827185	0.50739	.	.	ENSG00000117600	ENST00000370185;ENST00000457765;ENST00000263178;ENST00000370184	T;T;T	0.33654	1.96;1.7;1.4	5.5	5.5	0.81552	.	0.911782	0.09560	N	0.785679	T	0.54791	0.1880	M	0.67397	2.05	0.49299	D	0.999772	D;D	0.65815	0.99;0.995	D;D	0.72982	0.979;0.935	T	0.45498	-0.9257	9	.	.	.	-26.0602	19.3904	0.94578	0.0:0.0:1.0:0.0	.	373;431	E7EPS1;Q7Z2D5	.;LPPR4_HUMAN	K	431;373;431;273	ENSP00000359204:R431K;ENSP00000394913:R373K;ENSP00000359203:R273K	.	R	+	2	0	RP4-788L13.1	99544154	1.000000	0.71417	0.987000	0.45799	0.173000	0.22820	7.508000	0.81686	2.575000	0.86900	0.650000	0.86243	AGA	LPPR4	-	NULL	ENSG00000117600		0.488	LPPR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPPR4	Uniprot_gn	protein_coding	OTTHUMT00000029670.2	-	0.00	29	0	G			99771566	+1	tier1	-	no_errors	ENST00000370185	ensembl	human	known	74_37	missense	39.58	29	19	SNP	1.000	A
LRIF1	55791	genome.wustl.edu	37	1	111493959	111493959	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:111493959G>T	ENST00000369763.4	-	2	1937	c.1547C>A	c.(1546-1548)gCa>gAa	p.A516E	RP11-96K19.2_ENST00000440689.1_RNA|LRIF1_ENST00000494675.1_Intron|LRIF1_ENST00000485275.2_Intron	NM_018372.3	NP_060842.3	Q5T3J3	LRIF1_HUMAN	ligand dependent nuclear receptor interacting factor 1	516					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)				endometrium(2)|kidney(2)|large_intestine(7)|lung(12)|ovary(2)|skin(1)|urinary_tract(2)	28						AACAGTTGTTGCATCAACAGA	0.388																																																	0													142.0	138.0	140.0					1																	111493959		2203	4300	6503	SO:0001583	missense	0			AY190122	CCDS30800.1, CCDS41366.1	1p13.3	2011-04-15	2011-04-15	2011-04-15	ENSG00000121931	ENSG00000121931			30299	protein-coding gene	gene with protein product	"""receptor interacting factor 1"""	615354	"""chromosome 1 open reading frame 103"""	C1orf103		17455211	Standard	NM_018372		Approved	RIF1, FLJ11269	uc001eaa.3	Q5T3J3	OTTHUMG00000011913	ENST00000369763.4:c.1547C>A	1.37:g.111493959G>T	ENSP00000358778:p.Ala516Glu		Q86XS4|Q8N3B6|Q96HT4|Q9NUM5|Q9NV32	Missense_Mutation	SNP	NULL	p.A516E	ENST00000369763.4	37	c.1547	CCDS30800.1	1	.	.	.	.	.	.	.	.	.	.	G	14.23	2.474326	0.43942	.	.	ENSG00000121931	ENST00000369763	T	0.33654	1.4	5.82	3.87	0.44632	.	0.201560	0.35151	N	0.003409	T	0.28499	0.0705	L	0.54323	1.7	0.80722	D	1	P	0.46912	0.886	P	0.48425	0.577	T	0.01904	-1.1250	10	0.45353	T	0.12	-11.6657	10.1017	0.42509	0.0:0.1465:0.7029:0.1506	.	516	Q5T3J3	LRIF1_HUMAN	E	516	ENSP00000358778:A516E	ENSP00000358778:A516E	A	-	2	0	LRIF1	111295482	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.634000	0.67833	2.757000	0.94681	0.585000	0.79938	GCA	LRIF1	-	NULL	ENSG00000121931		0.388	LRIF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LRIF1	HGNC	protein_coding	OTTHUMT00000032932.2	-	0.00	42	0	G	NM_018372		111493959	-1	tier1	-	no_errors	ENST00000369763	ensembl	human	known	74_37	missense	5.80	65	4	SNP	1.000	T
LRP2BP	55805	genome.wustl.edu	37	4	186291869	186291869	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr4:186291869G>C	ENST00000328559.7	-	7	1714	c.903C>G	c.(901-903)ttC>ttG	p.F301L	LRP2BP_ENST00000505916.1_Missense_Mutation_p.F301L|RP11-714G18.1_ENST00000514884.1_RNA|LRP2BP_ENST00000510776.1_Missense_Mutation_p.F275L|LRP2BP_ENST00000362004.3_Missense_Mutation_p.F303L	NM_018409.3	NP_060879.2	Q9P2M1	LR2BP_HUMAN	LRP2 binding protein	301						cytoplasm (GO:0005737)				breast(1)|endometrium(2)|large_intestine(6)|lung(3)|prostate(1)|skin(2)	15		all_lung(41;1.3e-11)|Lung NSC(41;2.25e-11)|Melanoma(20;0.00109)|Colorectal(36;0.0215)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;2.14e-25)|Epithelial(43;1.55e-22)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-11)|BRCA - Breast invasive adenocarcinoma(30;8.01e-05)|GBM - Glioblastoma multiforme(59;0.000132)|STAD - Stomach adenocarcinoma(60;0.000766)|Colorectal(24;0.00116)|LUSC - Lung squamous cell carcinoma(40;0.00904)|COAD - Colon adenocarcinoma(29;0.0101)|READ - Rectum adenocarcinoma(43;0.161)		TTGCGTGGTAGAAGGATGCCA	0.478																																																	0													131.0	111.0	118.0					4																	186291869		2203	4300	6503	SO:0001583	missense	0			AB037746	CCDS3840.1	4q35.1	2011-05-03			ENSG00000109771	ENSG00000109771			25434	protein-coding gene	gene with protein product						10718198, 12508107	Standard	NM_018409		Approved	DKFZp761O0113	uc003ixj.2	Q9P2M1	OTTHUMG00000160460	ENST00000328559.7:c.903C>G	4.37:g.186291869G>C	ENSP00000332681:p.Phe301Leu		A6NJR7|A7E219|B3KX83|Q9NSN6	Missense_Mutation	SNP	pfam_Sel1-like,pfam_TPR_2,smart_Sel1-like,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.F303L	ENST00000328559.7	37	c.909	CCDS3840.1	4	.	.	.	.	.	.	.	.	.	.	G	19.10	3.761296	0.69763	.	.	ENSG00000109771	ENST00000362004;ENST00000328559;ENST00000510776;ENST00000505916	T;T;T;T	0.50277	0.75;0.75;0.75;0.75	5.65	4.8	0.61643	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.64034	0.2562	M	0.66939	2.045	0.54753	D	0.999985	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.996	T	0.63695	-0.6579	10	0.39692	T	0.17	-24.736	11.377	0.49735	0.1461:0.0:0.8539:0.0	.	275;301	G5E9Z9;Q9P2M1	.;LR2BP_HUMAN	L	303;301;275;301	ENSP00000354846:F303L;ENSP00000332681:F301L;ENSP00000424610:F275L;ENSP00000426203:F301L	ENSP00000332681:F301L	F	-	3	2	LRP2BP	186528863	1.000000	0.71417	1.000000	0.80357	0.330000	0.28571	3.990000	0.56965	1.616000	0.50265	0.655000	0.94253	TTC	LRP2BP	-	pfam_Sel1-like,smart_Sel1-like	ENSG00000109771		0.478	LRP2BP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LRP2BP	HGNC	protein_coding	OTTHUMT00000360679.2	-	0.00	39	0	G	NM_018409		186291869	-1	tier1	-	no_errors	ENST00000362004	ensembl	human	known	74_37	missense	24.29	53	17	SNP	1.000	C
LRPPRC	10128	genome.wustl.edu	37	2	44190798	44190798	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr2:44190798C>G	ENST00000260665.7	-	12	1474	c.1417G>C	c.(1417-1419)Gat>Cat	p.D473H	LRPPRC_ENST00000409659.1_Missense_Mutation_p.D473H|LRPPRC_ENST00000409946.1_Missense_Mutation_p.D473H	NM_133259.3	NP_573566.2	P42704	LPPRC_HUMAN	leucine-rich pentatricopeptide repeat containing	473					mitochondrion transport along microtubule (GO:0047497)|mRNA transport (GO:0051028)|negative regulation of mitochondrial RNA catabolic process (GO:0000961)|regulation of mitochondrial translation (GO:0070129)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|microtubule (GO:0005874)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribonucleoprotein complex (GO:0030529)	beta-tubulin binding (GO:0048487)|microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			breast(3)|endometrium(3)|kidney(5)|large_intestine(9)|lung(15)|ovary(2)|prostate(2)|skin(2)	41		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				GTTTCCTGATCAGGATGTACT	0.343																																																	0													146.0	141.0	143.0					2																	44190798		2203	4300	6503	SO:0001583	missense	0			M92439	CCDS33189.1	2p21	2012-02-24	2012-02-24		ENSG00000138095	ENSG00000138095			15714	protein-coding gene	gene with protein product		607544	"""Leigh syndrome, French-Canadian type (cytochrome oxidase deficiency)"""	LSFC		8012652, 8619474, 22045337	Standard	NM_133259		Approved	GP130, LRP130	uc002rtr.2	P42704	OTTHUMG00000152782	ENST00000260665.7:c.1417G>C	2.37:g.44190798C>G	ENSP00000260665:p.Asp473His		A0PJE3|A8K1V1|Q53PC0|Q53QN7|Q6ZUD8|Q7Z7A6|Q96D84	Missense_Mutation	SNP	pfam_Pentatricopeptide_repeat,tigrfam_Pentatricopeptide_repeat	p.D473H	ENST00000260665.7	37	c.1417	CCDS33189.1	2	.	.	.	.	.	.	.	.	.	.	C	11.65	1.701525	0.30142	.	.	ENSG00000138095	ENST00000465633;ENST00000260665;ENST00000409946;ENST00000409659	T;T;T	0.38240	1.15;1.15;1.15	5.47	1.63	0.23807	.	0.049904	0.85682	D	0.000000	T	0.52693	0.1750	M	0.76002	2.32	0.35381	D	0.789908	D;B	0.69078	0.997;0.034	D;B	0.68765	0.96;0.029	T	0.60260	-0.7298	10	0.87932	D	0	-16.7816	7.3175	0.26509	0.0:0.6332:0.1121:0.2547	.	373;473	F5H4J6;P42704	.;LPPRC_HUMAN	H	373;473;473;473	ENSP00000260665:D473H;ENSP00000386234:D473H;ENSP00000386562:D473H	ENSP00000260665:D473H	D	-	1	0	LRPPRC	44044302	0.995000	0.38212	0.422000	0.26621	0.002000	0.02628	0.998000	0.29744	0.017000	0.15025	-1.008000	0.02478	GAT	LRPPRC	-	NULL	ENSG00000138095		0.343	LRPPRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRPPRC	HGNC	protein_coding	OTTHUMT00000327823.1	-	0.00	51	0	C	NM_133259		44190798	-1	tier1	-	no_errors	ENST00000260665	ensembl	human	known	74_37	missense	12.50	42	6	SNP	0.551	G
LRRC32	2615	genome.wustl.edu	37	11	76370959	76370959	+	Missense_Mutation	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr11:76370959C>T	ENST00000407242.2	-	3	1920	c.1678G>A	c.(1678-1680)Gag>Aag	p.E560K	LRRC32_ENST00000464145.1_Intron|LRRC32_ENST00000404995.1_Missense_Mutation_p.E560K|LRRC32_ENST00000260061.5_Missense_Mutation_p.E560K|AP001189.4_ENST00000447519.1_RNA	NM_005512.2	NP_005503.1	Q14392	LRC32_HUMAN	leucine rich repeat containing 32	560					negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of cytokine secretion (GO:0050710)|positive regulation of gene expression (GO:0010628)	integral component of plasma membrane (GO:0005887)				endometrium(1)|large_intestine(3)|lung(26)|upper_aerodigestive_tract(1)	31						AGGCTGGTCTCCAGGCCACCC	0.662																																																	0													29.0	30.0	30.0					11																	76370959		2200	4292	6492	SO:0001583	missense	0			Z24680	CCDS8245.1	11q13.5-q14	2008-02-05	2005-02-25	2005-02-25	ENSG00000137507	ENSG00000137507			4161	protein-coding gene	gene with protein product		137207	"""glycoprotein A repetitions predominant"""	D11S833E, GARP		8180135, 1543912	Standard	NM_005512		Approved		uc001oxq.4	Q14392	OTTHUMG00000133687	ENST00000407242.2:c.1678G>A	11.37:g.76370959C>T	ENSP00000384126:p.Glu560Lys		Q86V06	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_RNase_inh_sub-typ,smart_Leu-rich_rpt_typical-subtyp	p.E560K	ENST00000407242.2	37	c.1678	CCDS8245.1	11	.	.	.	.	.	.	.	.	.	.	C	19.94	3.919613	0.73098	.	.	ENSG00000137507	ENST00000260061;ENST00000407242;ENST00000404995	T;T;T	0.56941	0.43;0.43;0.43	4.25	4.25	0.50352	.	0.056033	0.64402	D	0.000001	T	0.34250	0.0891	N	0.04880	-0.145	0.58432	D	0.999996	D	0.52996	0.957	P	0.46758	0.526	T	0.20306	-1.0279	10	0.06625	T	0.88	.	16.8423	0.85972	0.0:1.0:0.0:0.0	.	560	Q14392	LRC32_HUMAN	K	560	ENSP00000260061:E560K;ENSP00000384126:E560K;ENSP00000385766:E560K	ENSP00000260061:E560K	E	-	1	0	LRRC32	76048607	1.000000	0.71417	0.999000	0.59377	0.971000	0.66376	4.249000	0.58766	2.197000	0.70478	0.491000	0.48974	GAG	LRRC32	-	smart_Leu-rich_rpt_RNase_inh_sub-typ	ENSG00000137507		0.662	LRRC32-201	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC32	HGNC	protein_coding	OTTHUMT00000257926.2	-	0.00	38	0	C	NM_005512		76370959	-1	tier1	-	no_errors	ENST00000260061	ensembl	human	known	74_37	missense	17.50	33	7	SNP	1.000	T
LRSAM1	90678	genome.wustl.edu	37	9	130265075	130265075	+	Missense_Mutation	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr9:130265075G>A	ENST00000323301.4	+	25	2673	c.2069G>A	c.(2068-2070)tGt>tAt	p.C690Y	LRSAM1_ENST00000483302.1_3'UTR|LRSAM1_ENST00000373322.1_Missense_Mutation_p.C690Y|LRSAM1_ENST00000373324.4_Missense_Mutation_p.C663Y|LRSAM1_ENST00000300417.6_Missense_Mutation_p.C690Y	NM_138361.5	NP_612370.3	Q6UWE0	LRSM1_HUMAN	leucine rich repeat and sterile alpha motif containing 1	690					cell death (GO:0008219)|negative regulation of endocytosis (GO:0045806)|protein autoubiquitination (GO:0051865)|protein catabolic process (GO:0030163)|protein polyubiquitination (GO:0000209)|ubiquitin-dependent endocytosis (GO:0070086)|viral budding (GO:0046755)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(2)	16						TTCCTCAACTGTGGCCACGTC	0.632																																																	0													23.0	22.0	22.0					9																	130265075		2203	4299	6502	SO:0001583	missense	0			AK056203	CCDS6873.1, CCDS55347.1	9q34.13	2014-09-17			ENSG00000148356	ENSG00000148356		"""Sterile alpha motif (SAM) domain containing"""	25135	protein-coding gene	gene with protein product		610933				12975309	Standard	NM_001005373		Approved	FLJ31641	uc004brd.2	Q6UWE0	OTTHUMG00000020701	ENST00000323301.4:c.2069G>A	9.37:g.130265075G>A	ENSP00000322937:p.Cys690Tyr		Q5VVV0|Q8NB40|Q96GT5|Q96MX5|Q96MZ7	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,superfamily_PTS_PEP_utilis_N,smart_Leu-rich_rpt_typical-subtyp,smart_SAM,pfscan_SAM,pfscan_Znf_RING	p.C690Y	ENST00000323301.4	37	c.2069	CCDS6873.1	9	.	.	.	.	.	.	.	.	.	.	G	19.84	3.902767	0.72754	.	.	ENSG00000148356	ENST00000300417;ENST00000373324;ENST00000323301;ENST00000373322	D;D;D;D	0.99741	-6.6;-6.6;-6.6;-6.6	5.36	5.36	0.76844	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);	0.000000	0.85682	D	0.000000	D	0.99768	0.9905	H	0.97540	4.025	0.52501	D	0.999955	P;P	0.46512	0.853;0.879	P;P	0.54210	0.679;0.745	D	0.96970	0.9708	10	0.87932	D	0	-7.5849	16.5782	0.84706	0.0:0.0:1.0:0.0	.	663;690	Q6UWE0-2;Q6UWE0	.;LRSM1_HUMAN	Y	690;663;690;690	ENSP00000300417:C690Y;ENSP00000362421:C663Y;ENSP00000322937:C690Y;ENSP00000362419:C690Y	ENSP00000300417:C690Y	C	+	2	0	LRSAM1	129304896	1.000000	0.71417	0.998000	0.56505	0.988000	0.76386	4.758000	0.62220	2.512000	0.84698	0.505000	0.49811	TGT	LRSAM1	-	pfscan_Znf_RING	ENSG00000148356		0.632	LRSAM1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LRSAM1	HGNC	protein_coding	OTTHUMT00000054164.1	-	0.00	54	0	G	NM_138361		130265075	+1	tier1	-	no_errors	ENST00000300417	ensembl	human	known	74_37	missense	14.04	49	8	SNP	1.000	A
LRTM2	654429	genome.wustl.edu	37	12	1944589	1944590	+	3'UTR	DEL	AC	AC	-	rs372477361		TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	AC	AC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr12:1944589_1944590delAC	ENST00000543818.1	+	0	2657_2658				CACNA2D4_ENST00000585708.1_Intron|CACNA2D4_ENST00000588077.1_Intron|LRTM2_ENST00000543730.1_3'UTR|CACNA2D4_ENST00000585732.1_Intron|CACNA2D4_ENST00000382722.5_Intron|LRTM2_ENST00000299194.1_3'UTR|CACNA2D4_ENST00000586184.1_Intron|CACNA2D4_ENST00000587995.1_Intron|LRTM2_ENST00000535041.1_3'UTR	NM_001039029.2|NM_001163925.1|NM_001163926.1	NP_001034118.1|NP_001157397.1|NP_001157398.1	Q8N967	LRTM2_HUMAN	leucine-rich repeats and transmembrane domains 2							integral component of membrane (GO:0016021)				NS(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	20	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.000834)			AAGAATTAATacacacacacac	0.525																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK095610	CCDS31726.1	12p13.33	2008-02-05				ENSG00000166159			32443	protein-coding gene	gene with protein product							Standard	NM_001039029		Approved		uc010sdx.1	Q8N967		ENST00000543818.1:c.*703AC>-	12.37:g.1944599_1944600delAC			A7E2U6	RNA	DEL	-	NULL	ENST00000543818.1	37	NULL	CCDS31726.1	12																																																																																			LRTM2	-	-	ENSG00000166159		0.525	LRTM2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	LRTM2	HGNC	protein_coding	OTTHUMT00000398055.1		0.00	14	0	AC			1944590	+1	tier1		no_errors	ENST00000543730	ensembl	human	putative	74_37	rna	20.00	8	2	DEL	0.001:0.002	-
LYN	4067	genome.wustl.edu	37	8	56912040	56912040	+	Missense_Mutation	SNP	A	A	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr8:56912040A>C	ENST00000519728.1	+	12	1564	c.1268A>C	c.(1267-1269)aAg>aCg	p.K423T	LYN_ENST00000520220.2_Missense_Mutation_p.K402T	NM_002350.3	NP_002341.1	P07948	LYN_HUMAN	LYN proto-oncogene, Src family tyrosine kinase	423	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to extracellular stimulus (GO:0031668)|cellular response to heat (GO:0034605)|cellular response to retinoic acid (GO:0071300)|cytokine secretion (GO:0050663)|dendritic cell differentiation (GO:0097028)|erythrocyte differentiation (GO:0030218)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|Fc receptor mediated stimulatory signaling pathway (GO:0002431)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|histamine secretion by mast cell (GO:0002553)|immune response-regulating cell surface receptor signaling pathway (GO:0002768)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|leukocyte migration (GO:0050900)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of immune response (GO:0050777)|negative regulation of intracellular signal transduction (GO:1902532)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of mast cell proliferation (GO:0070667)|negative regulation of myeloid leukocyte differentiation (GO:0002762)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|neuron projection development (GO:0031175)|oligodendrocyte development (GO:0014003)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of Fc receptor mediated stimulatory signaling pathway (GO:0060369)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of mast cell proliferation (GO:0070668)|positive regulation of neuron projection development (GO:0010976)|positive regulation of oligodendrocyte progenitor proliferation (GO:0070447)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of stress-activated protein kinase signaling cascade (GO:0070304)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of B cell apoptotic process (GO:0002902)|regulation of B cell receptor signaling pathway (GO:0050855)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of cytokine production (GO:0001817)|regulation of cytokine secretion (GO:0050707)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of erythrocyte differentiation (GO:0045646)|regulation of inflammatory response (GO:0050727)|regulation of mast cell activation (GO:0033003)|regulation of mast cell degranulation (GO:0043304)|regulation of monocyte chemotaxis (GO:0090025)|regulation of platelet aggregation (GO:0090330)|regulation of protein phosphorylation (GO:0001932)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|response to amino acid (GO:0043200)|response to axon injury (GO:0048678)|response to carbohydrate (GO:0009743)|response to drug (GO:0042493)|response to hormone (GO:0009725)|response to insulin (GO:0032868)|response to organic cyclic compound (GO:0014070)|response to sterol depletion (GO:0006991)|response to toxic substance (GO:0009636)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|T cell costimulation (GO:0031295)|tolerance induction to self antigen (GO:0002513)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integrin alpha2-beta1 complex (GO:0034666)|mast cell granule (GO:0042629)|membrane raft (GO:0045121)|mitochondrial crista (GO:0030061)|mitochondrial intermembrane space (GO:0005758)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|glycosphingolipid binding (GO:0043208)|ion channel binding (GO:0044325)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	22		all_lung(136;0.0555)|Lung NSC(129;0.0726)|all_epithelial(80;0.0772)	Epithelial(17;0.000834)|all cancers(17;0.00598)		Bosutinib(DB06616)|Ponatinib(DB08901)	TTCACTATTAAGTCTGATGTG	0.398																																																	0													137.0	132.0	134.0					8																	56912040		2203	4300	6503	SO:0001583	missense	0			M16038	CCDS6162.1, CCDS47859.1	8q13	2014-06-25	2014-06-25		ENSG00000254087	ENSG00000254087		"""SH2 domain containing"""	6735	protein-coding gene	gene with protein product		165120	"""v-yes-1 Yamaguchi sarcoma viral related oncogene homolog"""			3561390	Standard	NM_002350		Approved	JTK8	uc003xsk.4	P07948	OTTHUMG00000044345	ENST00000519728.1:c.1268A>C	8.37:g.56912040A>C	ENSP00000428924:p.Lys423Thr		A0AVQ5	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,pfam_SH3_domain,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2,prints_SH3_domain	p.K423T	ENST00000519728.1	37	c.1268	CCDS6162.1	8	.	.	.	.	.	.	.	.	.	.	A	25.0	4.590636	0.86851	.	.	ENSG00000254087	ENST00000519728;ENST00000520220	T;T	0.14391	2.51;2.51	4.89	4.89	0.63831	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.41213	0.1149	M	0.84156	2.68	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.45585	-0.9251	10	0.87932	D	0	.	14.8317	0.70153	1.0:0.0:0.0:0.0	.	493;423	Q6NUK7;P07948	.;LYN_HUMAN	T	423;402	ENSP00000428924:K423T;ENSP00000428424:K402T	ENSP00000428924:K423T	K	+	2	0	LYN	57074594	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.287000	0.95975	1.970000	0.57323	0.482000	0.46254	AAG	LYN	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000254087		0.398	LYN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LYN	HGNC	protein_coding	OTTHUMT00000378155.1	-	0.00	100	0	A	NM_002350		56912040	+1	tier1	-	no_errors	ENST00000519728	ensembl	human	known	74_37	missense	11.50	100	13	SNP	1.000	C
LYPD4	147719	genome.wustl.edu	37	19	42343053	42343053	+	Missense_Mutation	SNP	C	C	T	rs368266342		TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr19:42343053C>T	ENST00000330743.3	-	3	1324	c.113G>A	c.(112-114)aGa>aAa	p.R38K	LYPD4_ENST00000343055.4_Intron|LYPD4_ENST00000601246.1_Intron	NM_173506.4	NP_775777.3	Q6UWN0	LYPD4_HUMAN	LY6/PLAUR domain containing 4	38						anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|skin(2)	12						AGCAACAGCTCTGAATCTTGA	0.498																																																	0								C	LYS/ARG	1,4405	2.1+/-5.4	0,1,2202	144.0	134.0	138.0		113	3.9	1.0	19		138	0,8600		0,0,4300	no	missense	LYPD4	NM_173506.4	26	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging	38/247	42343053	1,13005	2203	4300	6503	SO:0001583	missense	0			AY358726	CCDS12587.1	19q13.2	2008-02-05				ENSG00000273111			28659	protein-coding gene	gene with protein product						12975309	Standard	XM_005278383		Approved	MGC42718	uc002orp.1	Q6UWN0		ENST00000330743.3:c.113G>A	19.37:g.42343053C>T	ENSP00000328737:p.Arg38Lys		Q8IYW0	Missense_Mutation	SNP	pfam_LY6_UPAR	p.R38K	ENST00000330743.3	37	c.113	CCDS12587.1	19	.	.	.	.	.	.	.	.	.	.	C	12.06	1.824633	0.32237	2.27E-4	0.0	ENSG00000183103	ENST00000330743	T	0.05513	3.43	3.91	3.91	0.45181	.	0.000000	0.49305	D	0.000145	T	0.17577	0.0422	M	0.69823	2.125	0.80722	D	1	D	0.63880	0.993	D	0.67548	0.952	T	0.06679	-1.0813	10	0.11485	T	0.65	-15.2044	11.6865	0.51490	0.0:1.0:0.0:0.0	.	38	Q6UWN0	LYPD4_HUMAN	K	38	ENSP00000328737:R38K	ENSP00000328737:R38K	R	-	2	0	LYPD4	47034893	1.000000	0.71417	0.998000	0.56505	0.060000	0.15804	2.957000	0.49137	2.474000	0.83562	0.551000	0.68910	AGA	LYPD4	-	NULL	ENSG00000183103		0.498	LYPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LYPD4	HGNC	protein_coding	OTTHUMT00000463039.1	-	0.00	37	0	C	NM_173506		42343053	-1	tier1	-	no_errors	ENST00000330743	ensembl	human	known	74_37	missense	29.63	19	8	SNP	0.998	T
MACF1	23499	genome.wustl.edu	37	1	39800706	39800706	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:39800706C>G	ENST00000372915.3	+	36	8548	c.8461C>G	c.(8461-8463)Caa>Gaa	p.Q2821E	MACF1_ENST00000361689.2_Intron|MACF1_ENST00000289893.4_Missense_Mutation_p.Q1256E|MACF1_ENST00000545844.1_Intron|MACF1_ENST00000567887.1_Missense_Mutation_p.Q2853E|MACF1_ENST00000476350.1_Intron|MACF1_ENST00000539005.1_Intron|MACF1_ENST00000317713.7_Intron|MACF1_ENST00000564288.1_Missense_Mutation_p.Q2816E			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	2821					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GAGATTATTTCAAGTTGAAAA	0.353																																																	0													51.0	56.0	54.0					1																	39800706		2199	4300	6499	SO:0001583	missense	0			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.8461C>G	1.37:g.39800706C>G	ENSP00000362006:p.Gln2821Glu		B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_Plectin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,superfamily_RNaseH-like_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,smart_EF_hand_dom,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.Q2853E	ENST00000372915.3	37	c.8557		1	.	.	.	.	.	.	.	.	.	.	C	0.009	-1.801652	0.00611	.	.	ENSG00000127603	ENST00000372915;ENST00000289893	T;T	0.62941	-0.01;1.01	5.28	1.15	0.20763	.	0.517604	0.17480	N	0.172762	T	0.34513	0.0900	N	0.12182	0.205	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.08534	-1.0717	10	0.28530	T	0.3	.	2.419	0.04443	0.1694:0.5218:0.1652:0.1435	.	2821	Q9UPN3	MACF1_HUMAN	E	2821;1256	ENSP00000362006:Q2821E;ENSP00000289893:Q1256E	ENSP00000289893:Q1256E	Q	+	1	0	MACF1	39573293	0.000000	0.05858	0.010000	0.14722	0.048000	0.14542	0.227000	0.17795	0.581000	0.29539	0.491000	0.48974	CAA	MACF1	-	superfamily_RNaseH-like_dom	ENSG00000127603		0.353	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	MACF1	HGNC	protein_coding	OTTHUMT00000392096.1	-	0.00	76	0	C	NM_033044		39800706	+1	tier1	-	no_errors	ENST00000567887	ensembl	human	putative	74_37	missense	11.39	70	9	SNP	0.000	G
MACROD2	140733	genome.wustl.edu	37	20	14830786	14830786	+	Intron	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr20:14830786C>G	ENST00000310348.4	+	5	418				MACROD2_ENST00000217246.4_Intron|MACROD2_ENST00000464883.1_Intron			A1Z1Q3	MACD2_HUMAN	MACRO domain containing 2						brain development (GO:0007420)|cellular response to DNA damage stimulus (GO:0006974)|protein de-ADP-ribosylation (GO:0051725)|purine nucleoside metabolic process (GO:0042278)	nucleus (GO:0005634)	deacetylase activity (GO:0019213)|hydrolase activity, acting on glycosyl bonds (GO:0016798)			breast(2)|kidney(4)|large_intestine(5)|lung(8)|skin(1)	20		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)				TGGGGGTCATCTAGGACACTG	0.373																																																	0																																										SO:0001627	intron_variant	0			BC101218	CCDS13120.2, CCDS33443.1	20p12.1	2011-04-28	2007-07-24	2007-07-24	ENSG00000172264	ENSG00000172264			16126	protein-coding gene	gene with protein product		611567	"""chromosome 20 open reading frame 133"""	C20orf133			Standard	NM_080676		Approved	dJ631M13.5	uc002wot.3	A1Z1Q3	OTTHUMG00000031919	ENST00000310348.4:c.418+165181C>G	20.37:g.14830786C>G			A6NFF7|B0QZ39|B3KWV0|Q0P6D5|Q495E0|Q5W199|Q6ZN71	RNA	SNP	-	NULL	ENST00000310348.4	37	NULL	CCDS13120.2	20																																																																																			MACROD2	-	-	ENSG00000172264		0.373	MACROD2-201	KNOWN	basic|CCDS	protein_coding	MACROD2	HGNC	protein_coding		-	0.00	31	0	C	NM_080676		14830786	+1	tier1	-	no_errors	ENST00000497992	ensembl	human	known	74_37	rna	45.16	17	14	SNP	0.000	G
MAOB	4129	genome.wustl.edu	37	X	43661490	43661490	+	Nonsense_Mutation	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chrX:43661490C>T	ENST00000378069.4	-	5	552	c.405G>A	c.(403-405)tgG>tgA	p.W135*	MAOB_ENST00000487544.1_5'UTR|MAOB_ENST00000538942.1_Nonsense_Mutation_p.W119*|MAOB_ENST00000536181.1_Nonsense_Mutation_p.W119*	NM_000898.4	NP_000889.3	P27338	AOFB_HUMAN	monoamine oxidase B	135					negative regulation of serotonin secretion (GO:0014063)|positive regulation of dopamine metabolic process (GO:0045964)|response to aluminum ion (GO:0010044)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)|xenobiotic metabolic process (GO:0006805)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial envelope (GO:0005740)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|primary amine oxidase activity (GO:0008131)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|prostate(2)|skin(5)	21					Amantadine(DB00915)|Amphetamine(DB00182)|Dopamine(DB00988)|Ephedra(DB01363)|Flavin adenine dinucleotide(DB03147)|Furazolidone(DB00614)|Isocarboxazid(DB01247)|Linezolid(DB00601)|Methamphetamine(DB01577)|Moclobemide(DB01171)|Nandrolone decanoate(DB08804)|Nicotine(DB00184)|Pargyline(DB01626)|Phenelzine(DB00780)|Phentermine(DB00191)|Procaine(DB00721)|Rasagiline(DB01367)|Selegiline(DB01037)|Sertraline(DB01104)|Tranylcypromine(DB00752)|Zonisamide(DB00909)	GGGGAGCCTTCCATGGGGCAT	0.418																																																	0													104.0	77.0	86.0					X																	43661490		2203	4300	6503	SO:0001587	stop_gained	0				CCDS14261.1	Xp11.4-p11.3	2008-02-05			ENSG00000069535	ENSG00000069535	1.4.3.4		6834	protein-coding gene	gene with protein product		309860					Standard	NM_000898		Approved		uc004dfz.4	P27338	OTTHUMG00000021388	ENST00000378069.4:c.405G>A	X.37:g.43661490C>T	ENSP00000367309:p.Trp135*		B2R6R3|B7Z5H3|D3DWC3|Q7Z6S2	Nonsense_Mutation	SNP	pfam_Amino_oxidase,pfam_FAD-dep_OxRdtase,pfam_FAD_bind_dom,pfam_Pyr_OxRdtase_NAD-bd_dom,pfam_mOase_FAD-bd,prints_Flavin_amine_oxidase	p.W135*	ENST00000378069.4	37	c.405	CCDS14261.1	X	.	.	.	.	.	.	.	.	.	.	C	37	6.474656	0.97598	.	.	ENSG00000069535	ENST00000378069;ENST00000536181;ENST00000538942	.	.	.	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.4241	18.6305	0.91358	0.0:1.0:0.0:0.0	.	.	.	.	X	135;119;119	.	ENSP00000367309:W135X	W	-	3	0	MAOB	43546434	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.136000	0.77285	2.430000	0.82344	0.544000	0.68410	TGG	MAOB	-	pfam_Amino_oxidase	ENSG00000069535		0.418	MAOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAOB	HGNC	protein_coding	OTTHUMT00000056303.1	-	0.00	12	0	C	NM_000898		43661490	-1	tier1	-	no_errors	ENST00000378069	ensembl	human	known	74_37	nonsense	42.11	11	8	SNP	1.000	T
MC4R	4160	genome.wustl.edu	37	18	58038944	58038944	+	Silent	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr18:58038944G>C	ENST00000299766.3	-	1	1057	c.639C>G	c.(637-639)gtC>gtG	p.V213V		NM_005912.2	NP_005903.2	P32245	MC4R_HUMAN	melanocortin 4 receptor	213					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|diet induced thermogenesis (GO:0002024)|energy reserve metabolic process (GO:0006112)|feeding behavior (GO:0007631)|insulin secretion (GO:0030073)|negative regulation of feeding behavior (GO:2000252)|positive regulation of bone resorption (GO:0045780)|positive regulation of cAMP biosynthetic process (GO:0030819)|regulation of grooming behavior (GO:2000821)|response to insulin (GO:0032868)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	melanocortin receptor activity (GO:0004977)|melanocyte-stimulating hormone receptor activity (GO:0004980)|neuropeptide binding (GO:0042923)|peptide hormone binding (GO:0017046)|ubiquitin protein ligase binding (GO:0031625)			endometrium(2)|kidney(1)|large_intestine(5)|liver(2)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	17		Colorectal(73;0.0946)				GGAACATGTGGACATAGAGAG	0.498																																																	0													74.0	69.0	70.0					18																	58038944		2203	4300	6503	SO:0001819	synonymous_variant	0			AY236539	CCDS11976.1	18q22	2012-08-10			ENSG00000166603	ENSG00000166603		"""GPCR / Class A : Melanocortin receptors"""	6932	protein-coding gene	gene with protein product		155541				7949735, 9763669	Standard	NM_005912		Approved		uc002lie.1	P32245	OTTHUMG00000132766	ENST00000299766.3:c.639C>G	18.37:g.58038944G>C			B2RAC3|Q16317|Q3MIJ6	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Melcrt_ACTH_rcpt,prints_Mcort_rcpt_4,prints_GPCR_Rhodpsn,prints_Melancort_rcpt,prints_Cnbnoid_rcpt	p.V213	ENST00000299766.3	37	c.639	CCDS11976.1	18																																																																																			MC4R	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_Cnbnoid_rcpt	ENSG00000166603		0.498	MC4R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MC4R	HGNC	protein_coding	OTTHUMT00000256139.1	-	0.00	33	0	G	NM_005912		58038944	-1	tier1	-	no_errors	ENST00000299766	ensembl	human	known	74_37	silent	47.37	10	9	SNP	0.988	C
MECOM	2122	genome.wustl.edu	37	3	169099121	169099121	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr3:169099121G>C	ENST00000494292.1	-	2	326	c.229C>G	c.(229-231)Cct>Gct	p.P77A	MECOM_ENST00000485957.1_5'UTR	NM_004991.3	NP_004982.2	Q13465	MDS1_HUMAN	MDS1 and EVI1 complex locus	77					regulation of transcription, DNA-templated (GO:0006355)		sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(13)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(12)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	85						AACTCAGCAGGAATGGGGATA	0.478																																																	0													131.0	123.0	126.0					3																	169099121		1858	4103	5961	SO:0001583	missense	0			S82592, AF164154	CCDS3205.1, CCDS54669.1, CCDS54670.1	3q26.2	2013-01-08	2009-08-07	2009-08-07	ENSG00000085276	ENSG00000085276		"""Zinc fingers, C2H2-type"""	3498	protein-coding gene	gene with protein product		165215	"""myelodysplasia syndrome 1"", ""ecotropic viral integration site 1"""	MDS1, EVI1		2115646, 8171026, 8643684	Standard	NM_001105077		Approved	MDS1-EVI1, PRDM3	uc011bpj.1	Q03112	OTTHUMG00000158596	ENST00000494292.1:c.229C>G	3.37:g.169099121G>C	ENSP00000417899:p.Pro77Ala		Q13466|Q6FH90	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Znf_BED_prd,smart_SET_dom,smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2	p.P77A	ENST00000494292.1	37	c.229		3	.	.	.	.	.	.	.	.	.	.	G	23.9	4.475769	0.84640	.	.	ENSG00000085276	ENST00000494292;ENST00000486748	D;T	0.86694	-2.16;0.74	5.92	5.92	0.95590	.	0.000000	0.64402	D	0.000010	D	0.93903	0.8049	M	0.81942	2.565	0.80722	D	1	D;P	0.76494	0.999;0.61	D;B	0.68943	0.961;0.271	D	0.93834	0.7130	10	0.87932	D	0	.	20.3343	0.98733	0.0:0.0:1.0:0.0	.	77;77	Q13465;Q03112-3	MDS1_HUMAN;.	A	77;101	ENSP00000417899:P77A;ENSP00000419537:P101A	ENSP00000419537:P101A	P	-	1	0	MECOM	170581815	1.000000	0.71417	1.000000	0.80357	0.828000	0.46876	9.463000	0.97652	2.822000	0.97130	0.650000	0.86243	CCT	MECOM	-	NULL	ENSG00000085276		0.478	MECOM-004	KNOWN	basic|appris_principal	protein_coding	MECOM	HGNC	protein_coding	OTTHUMT00000351517.3	-	0.00	58	0	G	NM_005241, NM_004991		169099121	-1	tier1	-	no_errors	ENST00000494292	ensembl	human	known	74_37	missense	26.67	44	16	SNP	1.000	C
MECP2	4204	genome.wustl.edu	37	X	153295862	153295862	+	Missense_Mutation	SNP	C	C	G	rs267608634		TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chrX:153295862C>G	ENST00000303391.6	-	4	1666	c.1417G>C	c.(1417-1419)Gag>Cag	p.E473Q	MECP2_ENST00000460227.1_5'Flank|MECP2_ENST00000453960.2_Missense_Mutation_p.E485Q	NM_004992.3	NP_004983.1	P51608	MECP2_HUMAN	methyl CpG binding protein 2	473					adult locomotory behavior (GO:0008344)|behavioral fear response (GO:0001662)|cardiolipin metabolic process (GO:0032048)|catecholamine secretion (GO:0050432)|cerebellum development (GO:0021549)|chromatin silencing (GO:0006342)|dendrite development (GO:0016358)|glucocorticoid metabolic process (GO:0008211)|glutamine metabolic process (GO:0006541)|histone acetylation (GO:0016573)|histone methylation (GO:0016571)|inositol metabolic process (GO:0006020)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|negative regulation of histone acetylation (GO:0035067)|negative regulation of histone methylation (GO:0031061)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neurological system process involved in regulation of systemic arterial blood pressure (GO:0001976)|neuron maturation (GO:0042551)|pathogenesis (GO:0009405)|phosphatidylcholine metabolic process (GO:0046470)|positive regulation of cell proliferation (GO:0008284)|positive regulation of synapse assembly (GO:0051965)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|proprioception (GO:0019230)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|respiratory gaseous exchange (GO:0007585)|response to hypoxia (GO:0001666)|sensory perception of pain (GO:0019233)|social behavior (GO:0035176)|startle response (GO:0001964)|synapse assembly (GO:0007416)|transcription, DNA-templated (GO:0006351)|ventricular system development (GO:0021591)|visual learning (GO:0008542)	cytosol (GO:0005829)|extracellular space (GO:0005615)|heterochromatin (GO:0000792)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|double-stranded methylated DNA binding (GO:0010385)|methyl-CpG binding (GO:0008327)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|protein N-terminus binding (GO:0047485)|sequence-specific DNA binding transcription factor activity (GO:0003700)|siRNA binding (GO:0035197)|transcription corepressor activity (GO:0003714)			breast(2)|cervix(2)|endometrium(2)|kidney(3)|large_intestine(3)|lung(8)|prostate(2)|urinary_tract(1)	23	all_cancers(53;3.7e-16)|all_epithelial(53;3.44e-10)|all_lung(58;2.06e-07)|Lung NSC(58;2.72e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TCCACAGGCTCCTCTCTGTTT	0.557																																																	0													213.0	189.0	197.0					X																	153295862		2203	4300	6503	SO:0001583	missense	0			AF158180	CCDS14741.1, CCDS48193.1	Xq28	2014-09-17	2014-06-18		ENSG00000169057	ENSG00000169057			6990	protein-coding gene	gene with protein product		300005	"""mental retardation, X-linked 16"", ""mental retardation, X-linked 79"", ""Rett syndrome"", ""methyl CpG binding protein 2 (Rett syndrome)"""	RTT, MRX16, MRX79		1606614, 10508514	Standard	NM_004992		Approved		uc004fjw.2	P51608	OTTHUMG00000024229	ENST00000303391.6:c.1417G>C	X.37:g.153295862C>G	ENSP00000301948:p.Glu473Gln		O15233|Q6QHH9|Q7Z384	Missense_Mutation	SNP	pfam_Methyl_CpG_DNA-bd,superfamily_DNA-bd_dom,superfamily_Ig_E-set,smart_Methyl_CpG_DNA-bd,pirsf_Me_CpG-bd_MeCP2,pfscan_Methyl_CpG_DNA-bd	p.E473Q	ENST00000303391.6	37	c.1417	CCDS14741.1	X	.	.	.	.	.	.	.	.	.	.	C	16.92	3.256553	0.59321	.	.	ENSG00000169057	ENST00000303391;ENST00000453960	D;D	0.94280	-3.39;-3.39	5.8	5.8	0.92144	.	0.171928	0.53938	D	0.000053	D	0.91676	0.7369	N	0.24115	0.695	0.80722	D	1	D;P	0.54397	0.966;0.89	P;B	0.50570	0.644;0.324	D	0.92962	0.6390	10	0.72032	D	0.01	-25.2915	17.6415	0.88138	0.0:1.0:0.0:0.0	.	485;473	P51608-2;P51608	.;MECP2_HUMAN	Q	473;485	ENSP00000301948:E473Q;ENSP00000395535:E485Q	ENSP00000301948:E473Q	E	-	1	0	MECP2	152949056	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.090000	0.71397	2.438000	0.82558	0.600000	0.82982	GAG	MECP2	-	pirsf_Me_CpG-bd_MeCP2	ENSG00000169057		0.557	MECP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MECP2	HGNC	protein_coding	OTTHUMT00000061144.1	-	0.00	51	0	C	NM_004992		153295862	-1	tier1	-	no_errors	ENST00000303391	ensembl	human	known	74_37	missense	21.43	33	9	SNP	1.000	G
MED19	219541	genome.wustl.edu	37	11	57472496	57472496	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr11:57472496G>C	ENST00000431606.2	-	2	452	c.423C>G	c.(421-423)ttC>ttG	p.F141L	MED19_ENST00000337672.2_Missense_Mutation_p.F141L			A0JLT2	MED19_HUMAN	mediator complex subunit 19	141						mediator complex (GO:0016592)|nucleus (GO:0005634)	RNA polymerase II transcription cofactor activity (GO:0001104)			cervix(1)|large_intestine(1)|lung(1)|ovary(2)	5						TGATAGGATTGAAAGAGCTAC	0.562																																																	0													64.0	64.0	64.0					11																	57472496		2201	4296	6497	SO:0001583	missense	0			AY148462	CCDS7966.1	11q12.1	2008-02-05	2007-07-30		ENSG00000156603	ENSG00000156603			29600	protein-coding gene	gene with protein product		612385	"""mediator of RNA polymerase II transcription, subunit 19 homolog (S. cerevisiae)"""			9417904	Standard	NM_153450		Approved	LCMR1	uc001nlb.3	A0JLT2	OTTHUMG00000167199	ENST00000431606.2:c.423C>G	11.37:g.57472496G>C	ENSP00000416227:p.Phe141Leu		Q8IV02|Q8IZD1	Missense_Mutation	SNP	pfam_Mediator_Med19_met,pfam_DNA-dir_RNA_pol1_su_RPA34	p.F141L	ENST00000431606.2	37	c.423		11	.	.	.	.	.	.	.	.	.	.	A	6.084	0.383761	0.11524	.	.	ENSG00000156603	ENST00000337672;ENST00000431606	.	.	.	5.6	-2.7	0.06004	.	0.000000	0.85682	D	0.000000	T	0.42517	0.1206	L	0.33093	0.98	0.49582	D	0.999802	B;B	0.29301	0.043;0.241	B;B	0.34873	0.019;0.191	T	0.43750	-0.9372	9	0.02654	T	1	-12.0634	17.6554	0.88176	0.1818:0.0:0.8182:0.0	.	141;141	A0JLT2-2;A0JLT2	.;MED19_HUMAN	L	141	.	ENSP00000337340:F141L	F	-	3	2	MED19	57229072	1.000000	0.71417	0.968000	0.41197	0.911000	0.54048	0.596000	0.24044	-0.748000	0.04753	-1.322000	0.01289	TTC	MED19	-	pfam_Mediator_Med19_met	ENSG00000156603		0.562	MED19-002	KNOWN	basic|appris_principal	protein_coding	MED19	HGNC	protein_coding	OTTHUMT00000393702.1	-	0.00	49	0	G	NM_153450		57472496	-1	tier1	-	no_errors	ENST00000431606	ensembl	human	known	74_37	missense	25.00	42	14	SNP	0.999	C
MERTK	10461	genome.wustl.edu	37	2	112779081	112779081	+	Missense_Mutation	SNP	C	C	A	rs200576584		TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr2:112779081C>A	ENST00000295408.4	+	17	2529	c.2272C>A	c.(2272-2274)Cgc>Agc	p.R758S	MERTK_ENST00000409780.1_Missense_Mutation_p.R582S|MERTK_ENST00000421804.2_Missense_Mutation_p.R758S			Q12866	MERTK_HUMAN	MER proto-oncogene, tyrosine kinase	758	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic cell clearance (GO:0043277)|blood coagulation (GO:0007596)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|leukocyte migration (GO:0050900)|natural killer cell differentiation (GO:0001779)|negative regulation of lymphocyte activation (GO:0051250)|peptidyl-tyrosine phosphorylation (GO:0018108)|phagocytosis (GO:0006909)|platelet activation (GO:0030168)|positive regulation of phagocytosis (GO:0050766)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|retina development in camera-type eye (GO:0060041)|secretion by cell (GO:0032940)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|rhabdomere (GO:0016028)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|liver(1)|lung(18)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(10)	46						CCGCCAAGGCCGCATTGCTAA	0.463																																																	0													140.0	135.0	136.0					2																	112779081		2203	4300	6503	SO:0001583	missense	0			U08023	CCDS2094.1	2q14.1	2014-06-26	2014-06-26		ENSG00000153208	ENSG00000153208		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7027	protein-coding gene	gene with protein product		604705	"""c-mer proto-oncogene tyrosine kinase"""			8086340, 10343112	Standard	XM_005263565		Approved	mer, RP38	uc002thk.1	Q12866	OTTHUMG00000131278	ENST00000295408.4:c.2272C>A	2.37:g.112779081C>A	ENSP00000295408:p.Arg758Ser		Q9HBB4	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_Ig_I-set,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Rhodanese-like_dom,smart_Ig_sub,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R758S	ENST00000295408.4	37	c.2272	CCDS2094.1	2	.	.	.	.	.	.	.	.	.	.	C	13.92	2.379945	0.42207	.	.	ENSG00000153208	ENST00000295408;ENST00000421804;ENST00000393237;ENST00000409780;ENST00000449344	D;D;D;D	0.82081	-1.57;-1.57;-1.57;-1.57	5.24	5.24	0.73138	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.34088	U	0.004274	D	0.84732	0.5537	N	0.25957	0.775	0.80722	D	1	D	0.58970	0.984	D	0.68039	0.955	T	0.80082	-0.1531	10	0.15952	T	0.53	-24.4355	19.012	0.92877	0.0:1.0:0.0:0.0	.	758	Q12866	MERTK_HUMAN	S	758;758;394;582;82	ENSP00000295408:R758S;ENSP00000389152:R758S;ENSP00000387277:R582S;ENSP00000412660:R82S	ENSP00000295408:R758S	R	+	1	0	MERTK	112495552	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	3.682000	0.54656	2.724000	0.93272	0.563000	0.77884	CGC	MERTK	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000153208		0.463	MERTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MERTK	HGNC	protein_coding	OTTHUMT00000254046.2	-	0.00	31	0	C			112779081	+1	tier1	-	no_errors	ENST00000295408	ensembl	human	known	74_37	missense	11.11	32	4	SNP	1.000	A
HTR2C	3358	genome.wustl.edu	37	X	113886032	113886032	+	Intron	SNP	T	T	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chrX:113886032T>C	ENST00000276198.1	+	2	649				HTR2C_ENST00000371951.1_Intron|HTR2C_ENST00000371950.3_Intron|MIR1912_ENST00000410389.1_RNA	NM_000868.2	NP_000859.1	P28335	5HT2C_HUMAN	5-hydroxytryptamine (serotonin) receptor 2C, G protein-coupled						behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|cGMP biosynthetic process (GO:0006182)|feeding behavior (GO:0007631)|locomotory behavior (GO:0007626)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipase C-activating serotonin receptor signaling pathway (GO:0007208)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol biosynthetic process (GO:0010513)|regulation of appetite (GO:0032098)|regulation of corticotropin-releasing hormone secretion (GO:0043397)|regulation of neurological system process (GO:0031644)|release of sequestered calcium ion into cytosol (GO:0051209)|response to drug (GO:0042493)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding (GO:0071886)|drug binding (GO:0008144)|Gq/11-coupled serotonin receptor activity (GO:0001587)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(15)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	50					Agomelatine(DB06594)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Clomipramine(DB01242)|Clozapine(DB00363)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Dexfenfluramine(DB01191)|Doxepin(DB01142)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Lorcaserin(DB04871)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Pramipexole(DB00413)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	TAGGATGTGCTCATTGCATGG	0.353																																																	0													121.0	96.0	104.0					X																	113886032		692	1591	2283	SO:0001627	intron_variant	0				CCDS14564.1, CCDS59174.1	Xq23	2013-12-19	2012-02-03		ENSG00000147246	ENSG00000147246		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5295	protein-coding gene	gene with protein product		312861	"""5-hydroxytryptamine (serotonin) receptor 2C"""	HTR1C		7895773	Standard	NM_000868		Approved	5-HT2C, 5HTR2C	uc004epu.1	P28335	OTTHUMG00000022226	ENST00000276198.1:c.-80+37693T>C	X.37:g.113886032T>C			B1AMW4|Q5VUF8|Q9NP28	RNA	SNP	-	NULL	ENST00000276198.1	37	NULL	CCDS14564.1	X																																																																																			MIR1912	-	-	ENSG00000222321		0.353	HTR2C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR1912	HGNC	protein_coding	OTTHUMT00000057962.1	-	0.00	27	0	T	NM_000868		113886032	+1	tier1	-	no_errors	ENST00000410389	ensembl	human	known	74_37	rna	61.54	20	32	SNP	1.000	C
VMP1	81671	genome.wustl.edu	37	17	57918648	57918648	+	IGR	SNP	G	G	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr17:57918648G>T	ENST00000262291.4	+	0	2712				MIR21_ENST00000362134.1_RNA	NM_030938.3	NP_112200.2	Q96GC9	VMP1_HUMAN	vacuole membrane protein 1						autophagy (GO:0006914)|cell junction assembly (GO:0034329)|embryo implantation (GO:0007566)|regulation of autophagy (GO:0010506)|single organismal cell-cell adhesion (GO:0016337)	autophagic vacuole membrane (GO:0000421)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|pre-autophagosomal structure (GO:0000407)				breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(4)|skin(2)	16						TTATCAGACTGATGTTGACTG	0.423																																																	0													147.0	116.0	125.0					17																	57918648		1568	3582	5150	SO:0001628	intergenic_variant	0				CCDS11619.1	17q23.1	2014-05-20	2011-03-02	2011-03-02	ENSG00000062716	ENSG00000062716			29559	protein-coding gene	gene with protein product	"""ectopic P-granules autophagy protein 3 homolog (C. elegans)"", ""transport and golgi organization 5 homolog (Drosophila)"""	611753	"""transmembrane protein 49"""	TMEM49		11230166, 11785947	Standard	NM_030938		Approved	EPG3, TANGO5	uc002ixu.4	Q96GC9	OTTHUMG00000179882		17.37:g.57918648G>T			B4DVV9|Q9H0P4|Q9P089	RNA	SNP	-	NULL	ENST00000262291.4	37	NULL	CCDS11619.1	17																																																																																			MIR21	-	-	ENSG00000199004		0.423	VMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR21	HGNC	protein_coding	OTTHUMT00000448793.1	-	0.00	35	0	G	NM_030938		57918648	+1	tier1	-	no_errors	ENST00000362134	ensembl	human	known	74_37	rna	21.95	32	9	SNP	1.000	T
MMP2	4313	genome.wustl.edu	37	16	55527132	55527132	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr16:55527132G>C	ENST00000219070.4	+	9	1908	c.1399G>C	c.(1399-1401)Gag>Cag	p.E467Q	MMP2_ENST00000570308.1_Missense_Mutation_p.E391Q|MMP2_ENST00000437642.2_Missense_Mutation_p.E417Q|MMP2_ENST00000543485.1_Missense_Mutation_p.E391Q	NM_004530.4	NP_004521.1	P08253	MMP2_HUMAN	matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)	467	Required for inhibitor TIMP2 binding.				angiogenesis (GO:0001525)|blood vessel maturation (GO:0001955)|bone trabecula formation (GO:0060346)|cellular protein metabolic process (GO:0044267)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|intramembranous ossification (GO:0001957)|positive regulation of innate immune response (GO:0045089)|proteolysis (GO:0006508)|response to hypoxia (GO:0001666)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|sarcomere (GO:0030017)	metalloendopeptidase activity (GO:0004222)|serine-type endopeptidase activity (GO:0004252)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(12)|liver(2)|lung(23)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	58		Renal(780;0.00183)|Breast(268;0.00354)|Hepatocellular(780;0.00826)|all_neural(199;0.0189)		UCEC - Uterine corpus endometrioid carcinoma (183;0.0185)|all cancers(182;7.16e-45)|Epithelial(162;5.26e-37)|GBM - Glioblastoma multiforme(240;9e-08)|Kidney(780;0.00227)|BRCA - Breast invasive adenocarcinoma(181;0.00786)	Captopril(DB01197)|Marimastat(DB00786)	TGTCACTCCTGAGATCTGCAA	0.572																																																	0													147.0	132.0	137.0					16																	55527132		2198	4300	6498	SO:0001583	missense	0				CCDS10752.1, CCDS45487.1	16q13-q21	2008-02-05	2005-08-08		ENSG00000087245	ENSG00000087245	3.4.24.24		7166	protein-coding gene	gene with protein product		120360	"""matrix metalloproteinase 2 (gelatinase A, 72kD gelatinase, 72kD type IV collagenase)"", ""matrix metalloproteinase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)"""	CLG4, CLG4A			Standard	NM_004530		Approved	TBE-1	uc002ehz.4	P08253	OTTHUMG00000133202	ENST00000219070.4:c.1399G>C	16.37:g.55527132G>C	ENSP00000219070:p.Glu467Gln		B2R6U1|B4DWH3|E9PE45|Q9UCJ8	Missense_Mutation	SNP	pfam_Pept_M10_metallopeptidase,pfam_FN_type2_col-bd,pfam_Hemopexin-like_repeat,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin-like_dom,superfamily_Kringle-like,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_FN_type2_col-bd,smart_Hemopexin-like_repeat,pfscan_FN_type2_col-bd,prints_Pept_M10A	p.E467Q	ENST00000219070.4	37	c.1399	CCDS10752.1	16	.	.	.	.	.	.	.	.	.	.	G	16.17	3.046717	0.55110	.	.	ENSG00000087245	ENST00000219070;ENST00000543485;ENST00000437642	T;T;T	0.09255	3.0;3.0;3.0	5.4	5.4	0.78164	Hemopexin/matrixin (2);	0.049185	0.85682	D	0.000000	T	0.10852	0.0265	L	0.43923	1.385	0.45452	D	0.998429	B;P	0.38440	0.004;0.631	B;B	0.25506	0.002;0.061	T	0.04885	-1.0920	10	0.59425	D	0.04	.	19.1698	0.93572	0.0:0.0:1.0:0.0	.	417;467	E9PE45;P08253	.;MMP2_HUMAN	Q	467;391;417	ENSP00000219070:E467Q;ENSP00000444143:E391Q;ENSP00000394237:E417Q	ENSP00000219070:E467Q	E	+	1	0	MMP2	54084633	1.000000	0.71417	0.937000	0.37676	0.898000	0.52572	7.836000	0.86788	2.543000	0.85770	0.563000	0.77884	GAG	MMP2	-	superfamily_Hemopexin-like_dom	ENSG00000087245		0.572	MMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP2	HGNC	protein_coding	OTTHUMT00000256913.3	-	0.00	33	0	G			55527132	+1	tier1	-	no_errors	ENST00000219070	ensembl	human	known	74_37	missense	42.86	20	15	SNP	0.997	C
MN1	4330	genome.wustl.edu	37	22	28193043	28193043	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr22:28193043C>G	ENST00000302326.4	-	1	4443	c.3489G>C	c.(3487-3489)caG>caC	p.Q1163H		NM_002430.2	NP_002421.3	Q10571	MN1_HUMAN	meningioma (disrupted in balanced translocation) 1	1163					intramembranous ossification (GO:0001957)					NS(1)|breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	45						ACTGCTGCCTCTGTAGCTGGA	0.687			T	ETV6	"""AML, meningioma"""																																			Dom	yes		22	22q13	4330	meningioma (disrupted in balanced translocation) 1		"""L, O"""	0													12.0	13.0	13.0					22																	28193043		2057	4208	6265	SO:0001583	missense	0			X82209	CCDS42998.1	22q12.1	2010-09-29			ENSG00000169184	ENSG00000169184			7180	protein-coding gene	gene with protein product	"""probable tumor suppressor protein MN1"""	156100	"""meningioma chromosome region"""	MGCR		7731706, 12569362	Standard	NM_002430		Approved	MGCR1-PEN, MGCR1	uc003adj.3	Q10571	OTTHUMG00000150975	ENST00000302326.4:c.3489G>C	22.37:g.28193043C>G	ENSP00000304956:p.Gln1163His		A9Z1V9	Missense_Mutation	SNP	NULL	p.Q1163H	ENST00000302326.4	37	c.3489	CCDS42998.1	22	.	.	.	.	.	.	.	.	.	.	C	17.36	3.368797	0.61624	.	.	ENSG00000169184	ENST00000302326	T	0.50813	0.73	5.04	2.95	0.34219	.	0.000000	0.64402	D	0.000001	T	0.52917	0.1764	L	0.29908	0.895	0.41720	D	0.989506	D	0.76494	0.999	D	0.85130	0.997	T	0.54879	-0.8227	10	0.62326	D	0.03	-14.483	9.9882	0.41854	0.0:0.8332:0.0:0.1668	.	1163	Q10571	MN1_HUMAN	H	1163	ENSP00000304956:Q1163H	ENSP00000304956:Q1163H	Q	-	3	2	MN1	26523043	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.846000	0.39289	1.127000	0.42034	0.456000	0.33151	CAG	MN1	-	NULL	ENSG00000169184		0.687	MN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MN1	HGNC	protein_coding	OTTHUMT00000320737.1	-	0.00	19	0	C	NM_002430		28193043	-1	tier1	-	no_errors	ENST00000302326	ensembl	human	known	74_37	missense	23.53	13	4	SNP	1.000	G
MNT	4335	genome.wustl.edu	37	17	2290288	2290288	+	Silent	SNP	C	C	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr17:2290288C>A	ENST00000174618.4	-	6	2061	c.1656G>T	c.(1654-1656)gtG>gtT	p.V552V	RP1-59D14.1_ENST00000571775.1_RNA|MNT_ENST00000575374.1_5'Flank	NM_020310.2	NP_064706.1	Q99583	MNT_HUMAN	MAX network transcriptional repressor	552					cell aging (GO:0007569)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of cell cycle (GO:0051726)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			endometrium(4)|large_intestine(5)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	12				Colorectal(2;1.37e-05)|READ - Rectum adenocarcinoma(2;8.68e-05)		GGGGGTGGTGCACCACCTGAG	0.667																																																	0													26.0	24.0	25.0					17																	2290288		2185	4280	6465	SO:0001819	synonymous_variant	0			Y13444	CCDS11018.1	17p13.3	2013-11-15	2013-11-15		ENSG00000070444	ENSG00000070444		"""MAX dimerization proteins"", ""Basic helix-loop-helix proteins"""	7188	protein-coding gene	gene with protein product	"""myc antagonist"", ""Max-interacting protein"""	603039	"""MAX binding protein"", ""MNT, MAX dimerization protein"""			9598315	Standard	NM_020310		Approved	ROX, MXD6, MAD6, bHLHd3	uc002fur.3	Q99583	OTTHUMG00000090603	ENST00000174618.4:c.1656G>T	17.37:g.2290288C>A			A8K6D1|D3DTI7|Q1ED38	Silent	SNP	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.V552	ENST00000174618.4	37	c.1656	CCDS11018.1	17																																																																																			MNT	-	NULL	ENSG00000070444		0.667	MNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MNT	HGNC	protein_coding	OTTHUMT00000207158.1	-	0.00	51	0	C	NM_020310		2290288	-1	tier1	-	no_errors	ENST00000174618	ensembl	human	known	74_37	silent	36.00	32	18	SNP	1.000	A
MROH7	374977	genome.wustl.edu	37	1	55118525	55118525	+	Splice_Site	SNP	G	G	T	rs140180910		TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:55118525G>T	ENST00000421030.2	+	3	211		c.e3-1		MROH7-TTC4_ENST00000414150.2_Splice_Site|MROH7_ENST00000454855.2_Intron|MROH7_ENST00000472987.1_Splice_Site|MROH7_ENST00000409996.1_Intron|MROH7_ENST00000545244.1_Intron|MROH7_ENST00000339553.5_Splice_Site|MROH7_ENST00000395690.2_Splice_Site	NM_001039464.2	NP_001034553	Q68CQ1	MROH7_HUMAN	maestro heat-like repeat family member 7							extracellular space (GO:0005615)|integral component of membrane (GO:0016021)		p.?(1)									tctctctcaagactgctgctg	0.522																																																	1	Unknown(1)	skin(1)																																								SO:0001630	splice_region_variant	0			AL832492	CCDS41342.2	1p32.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000184313	ENSG00000184313		"""maestro heat-like repeat containing"""	24802	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 175"", ""HEAT repeat containing 8"""	C1orf175, HEATR8		12477932	Standard	NM_001039464		Approved	FLJ46354	uc010ooe.1	Q68CQ1	OTTHUMG00000009890	ENST00000421030.2:c.-74-1G>T	1.37:g.55118525G>T			A0AUX8|Q5TA99|Q6ZP40|Q6ZRH6|Q8N311|Q8NA14	Splice_Site	SNP	-	e1-1	ENST00000421030.2	37	c.1-1	CCDS41342.2	1																																																																																			MROH7-TTC4	-	-	ENSG00000271723		0.522	MROH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MROH7-TTC4	HGNC	protein_coding	OTTHUMT00000346978.1		0.00	25	0	G	NM_198547	Intron	55118525	+1			no_errors	ENST00000414150	ensembl	human	known	74_37	splice_site	9.38	29	3	SNP	0.651	T
MRPL13	28998	genome.wustl.edu	37	8	121455468	121455468	+	Silent	SNP	A	A	G	rs148855915		TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr8:121455468A>G	ENST00000306185.3	-	2	399	c.108T>C	c.(106-108)tcT>tcC	p.S36S	MTBP_ENST00000305949.1_5'Flank	NM_014078.5	NP_054797.2	Q9BYD1	RM13_HUMAN	mitochondrial ribosomal protein L13	36					translation (GO:0006412)	mitochondrial large ribosomal subunit (GO:0005762)|mitochondrial ribosome (GO:0005761)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(1)|ovary(1)	6	Lung NSC(37;1.69e-07)|Ovarian(258;0.00769)|all_neural(195;0.0804)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00503)			GAAGTCTTATAGATGCCATAG	0.398																																																	0													141.0	132.0	135.0					8																	121455468		2203	4300	6503	SO:0001819	synonymous_variant	0			AB049640	CCDS6332.1	8q22.1-q22.3	2012-09-13			ENSG00000172172	ENSG00000172172		"""Mitochondrial ribosomal proteins / large subunits"""	14278	protein-coding gene	gene with protein product		610200				11543634	Standard	NM_014078		Approved	L13, RPL13, L13mt, RPML13, L13A	uc003ypa.3	Q9BYD1	OTTHUMG00000165039	ENST00000306185.3:c.108T>C	8.37:g.121455468A>G			B2R4R8|Q9UI04	Silent	SNP	pfam_Ribosomal_L13,superfamily_Ribosomal_L13_dom,pirsf_Ribosomal_L13,tigrfam_Ribosomal_L13_bac-type	p.S36	ENST00000306185.3	37	c.108	CCDS6332.1	8																																																																																			MRPL13	-	pfam_Ribosomal_L13,superfamily_Ribosomal_L13_dom,pirsf_Ribosomal_L13,tigrfam_Ribosomal_L13_bac-type	ENSG00000172172		0.398	MRPL13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL13	HGNC	protein_coding	OTTHUMT00000381523.1	-	0.00	61	0	A	NM_014078		121455468	-1	tier1	-	no_errors	ENST00000306185	ensembl	human	known	74_37	silent	13.56	51	8	SNP	0.000	G
MRPS36	92259	genome.wustl.edu	37	5	68524143	68524143	+	Missense_Mutation	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr5:68524143G>A	ENST00000256441.4	+	3	293	c.223G>A	c.(223-225)Gaa>Aaa	p.E75K	MRPS36_ENST00000602380.1_Missense_Mutation_p.E10K|MRPS36_ENST00000512880.1_Missense_Mutation_p.E10K|MRPS36_ENST00000507022.1_3'UTR	NM_033281.5	NP_150597.1	P82909	RT36_HUMAN	mitochondrial ribosomal protein S36	75					translation (GO:0006412)	mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)	structural constituent of ribosome (GO:0003735)			NS(1)|endometrium(1)|large_intestine(2)|liver(1)|lung(1)|urinary_tract(1)	7		Lung NSC(167;5.51e-05)|Prostate(74;0.00634)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;1.04e-56)|Epithelial(20;8.79e-53)|all cancers(19;2.01e-48)|Lung(70;0.0176)		AGACACTGCAGAAATAATAAA	0.378																																																	0													113.0	121.0	118.0					5																	68524143		2203	4300	6503	SO:0001583	missense	0				CCDS34174.1	5q13.2	2013-09-20			ENSG00000134056	ENSG00000134056		"""Mitochondrial ribosomal proteins / small subunits"""	16631	protein-coding gene	gene with protein product		611996				11279123	Standard	NM_033281		Approved	DC47, MRP-S36	uc003jvq.3	P82909	OTTHUMG00000162443	ENST00000256441.4:c.223G>A	5.37:g.68524143G>A	ENSP00000256441:p.Glu75Lys		Q9H2H4	Missense_Mutation	SNP	NULL	p.E75K	ENST00000256441.4	37	c.223	CCDS34174.1	5	.	.	.	.	.	.	.	.	.	.	G	19.06	3.754606	0.69648	.	.	ENSG00000134056	ENST00000256441;ENST00000512880	.	.	.	5.76	5.76	0.90799	.	0.261969	0.37761	N	0.001958	T	0.50650	0.1628	L	0.29908	0.895	0.42726	D	0.993699	B	0.34290	0.447	B	0.35413	0.202	T	0.52139	-0.8615	9	0.51188	T	0.08	-20.2748	18.7445	0.91787	0.0:0.0:1.0:0.0	.	75	P82909	RT36_HUMAN	K	75;10	.	ENSP00000256441:E75K	E	+	1	0	MRPS36	68559899	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	6.198000	0.72106	2.725000	0.93324	0.460000	0.39030	GAA	MRPS36	-	NULL	ENSG00000134056		0.378	MRPS36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPS36	HGNC	protein_coding	OTTHUMT00000368940.1	-	0.00	74	0	G	NM_033281		68524143	+1	tier1	-	no_errors	ENST00000256441	ensembl	human	known	74_37	missense	29.63	57	24	SNP	1.000	A
MT-ND1	4535	genome.wustl.edu	37	M	1171	1171	+	5'Flank	SNP	A	A	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chrM:1171A>G	ENST00000361390.2	+	0	0				MT-RNR2_ENST00000387347.2_RNA|MT-TF_ENST00000387314.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-TL1_ENST00000386347.1_RNA			P03886	NU1M_HUMAN	mitochondrially encoded NADH dehydrogenase 1						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(13)|kidney(17)|lung(2)|prostate(1)	34					Desflurane(DB01189)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	AAAACTCAAAGGACCTGGCGG	0.478																																																	0																																										SO:0001631	upstream_gene_variant	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198888	ENSG00000198888	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7455	protein-coding gene	gene with protein product	"""complex I ND1 subunit"", ""NADH-ubiquinone oxidoreductase chain 1"""	516000	"""NADH dehydrogenase 1"""	MTND1			Standard			Approved	ND1, NAD1		P03886			M.37:g.1171A>G	Exception_encountered		C0JKH6|Q37523	RNA	SNP	-	NULL	ENST00000361390.2	37	NULL		MT																																																																																			MT-RNR1	-	-	ENSG00000211459		0.478	MT-ND1-201	KNOWN	basic|appris_principal	protein_coding	MT-RNR1	HGNC	protein_coding		-	0.00	15	0	A	YP_003024026		1171	+1	tier1	-	no_errors	ENST00000389680	ensembl	human	known	74_37	rna	55.56	8	10	SNP	NULL	G
MT-CO1	4512	genome.wustl.edu	37	M	7332	7332	+	Missense_Mutation	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chrM:7332G>A	ENST00000361624.2	+	1	1429	c.1429G>A	c.(1429-1431)Gct>Act	p.A477T	MT-CO3_ENST00000362079.2_5'Flank|MT-TM_ENST00000387377.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-ND3_ENST00000361227.2_5'Flank|MT-CO2_ENST00000361739.1_5'Flank|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-TS1_ENST00000387416.2_RNA|MT-TQ_ENST00000387372.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I	477					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						GAGAAGCCTTCGCTTCGAAGC	0.423																																																	0																																										SO:0001583	missense	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395		ENST00000361624.2:c.1429G>A	M.37:g.7332G>A	ENSP00000354499:p.Ala477Thr		Q34770	Missense_Mutation	SNP	pfam_Cyt_c_Oxase_su1,superfamily_Cyt_c_Oxase_su1_dom,pfscan_Cyt_c_Oxase_su1_dom,prints_Cyt_c_Oxase_su1	p.A477T	ENST00000361624.2	37	c.1429		MT																																																																																			MT-CO1	-	superfamily_Cyt_c_Oxase_su1_dom,pfscan_Cyt_c_Oxase_su1_dom	ENSG00000198804		0.423	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	MT-CO1	HGNC	protein_coding		-	0.00	197	0	G	YP_003024028		7332	+1	tier1	-	no_errors	ENST00000361624	ensembl	human	known	74_37	missense	76.96	44	147	SNP	NULL	A
MTG1	92170	genome.wustl.edu	37	10	135209721	135209721	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr10:135209721C>G	ENST00000317502.6	+	3	282	c.232C>G	c.(232-234)Cac>Gac	p.H78D	RP11-108K14.8_ENST00000468317.2_Missense_Mutation_p.H83D|MTG1_ENST00000477902.2_Missense_Mutation_p.H37D	NM_138384.2	NP_612393.2	Q9BT17	MTG1_HUMAN	mitochondrial ribosome-associated GTPase 1	78	CP-type G. {ECO:0000255|PROSITE- ProRule:PRU01058}.				GTP catabolic process (GO:0006184)|regulation of mitochondrial translation (GO:0070129)|regulation of respiratory system process (GO:0044065)|ribosome biogenesis (GO:0042254)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial ribosome (GO:0005761)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|large_intestine(5)|lung(5)|ovary(2)|skin(1)|urinary_tract(1)	15		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;1.21e-06)|all cancers(32;1.69e-06)|Epithelial(32;1.94e-06)		GCTTAAGCCTCACTTGCTGGT	0.502																																																	0													192.0	194.0	193.0					10																	135209721		2203	4300	6503	SO:0001583	missense	0				CCDS31320.1	10q26.3	2013-05-24	2013-05-24	2006-01-09	ENSG00000148824	ENSG00000148824			32159	protein-coding gene	gene with protein product			"""GTP-binding protein 7"", ""GTP-binding protein 7 (putative)"", ""mitochondrial GTPase 1 homolog (S. cerevisiae)"""	GTPBP7		12808030, 23396448	Standard	NM_138384		Approved		uc001lnd.3	Q9BT17	OTTHUMG00000166564	ENST00000317502.6:c.232C>G	10.37:g.135209721C>G	ENSP00000323047:p.His78Asp		Q5VWX8|Q6PIY9|Q8IYJ4|Q8NC48|Q9BVU8	Missense_Mutation	SNP	pfam_GTP_binding_domain,superfamily_P-loop_NTPase,pirsf_GTPase_MTG1,tigrfam_GTP-bd_ribosome_bgen_YlqF	p.H78D	ENST00000317502.6	37	c.232	CCDS31320.1	10	.	.	.	.	.	.	.	.	.	.	c	24.0	4.478384	0.84747	.	.	ENSG00000254536;ENSG00000148824;ENSG00000148824;ENSG00000148824	ENST00000468317;ENST00000317502;ENST00000432508;ENST00000537620	T;T;T	0.14022	2.54;2.54;2.54	5.4	5.4	0.78164	.	2.297760	0.02128	N	0.056208	T	0.52837	0.1759	M	0.90483	3.12	0.80722	D	1	D	0.67145	0.996	D	0.70487	0.969	T	0.15954	-1.0419	10	0.66056	D	0.02	-17.7878	16.6591	0.85236	0.0:1.0:0.0:0.0	.	78	Q9BT17	MTG1_HUMAN	D	83;78;78;37	ENSP00000436767:H83D;ENSP00000323047:H78D;ENSP00000393480:H78D	ENSP00000323047:H78D	H	+	1	0	AL360181.1;MTG1	135059711	1.000000	0.71417	0.818000	0.32626	0.993000	0.82548	6.217000	0.72218	2.535000	0.85469	0.478000	0.44815	CAC	MTG1	-	superfamily_P-loop_NTPase,pirsf_GTPase_MTG1,tigrfam_GTP-bd_ribosome_bgen_YlqF	ENSG00000148824		0.502	MTG1-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	MTG1	HGNC	protein_coding	OTTHUMT00000051166.1	-	0.00	59	0	C	NM_138384		135209721	+1	tier1	-	no_errors	ENST00000317502	ensembl	human	known	74_37	missense	17.33	61	13	SNP	1.000	G
MUC17	140453	genome.wustl.edu	37	7	100685190	100685190	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr7:100685190C>G	ENST00000306151.4	+	3	10557	c.10493C>G	c.(10492-10494)tCt>tGt	p.S3498C		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	3498	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					ACCAATTCATCTCCTACAACT	0.517																																																	0													218.0	231.0	227.0					7																	100685190		2203	4300	6503	SO:0001583	missense	0			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.10493C>G	7.37:g.100685190C>G	ENSP00000302716:p.Ser3498Cys		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_EG-like_dom,pfscan_SEA_dom	p.S3498C	ENST00000306151.4	37	c.10493	CCDS34711.1	7	.	.	.	.	.	.	.	.	.	.	C	6.795	0.515664	0.12944	.	.	ENSG00000169876	ENST00000306151	T	0.03124	4.04	1.41	1.41	0.22369	.	.	.	.	.	T	0.06872	0.0175	N	0.24115	0.695	0.09310	N	1	D	0.69078	0.997	D	0.80764	0.994	T	0.37079	-0.9721	9	0.66056	D	0.02	.	3.8154	0.08814	0.0:0.7492:0.0:0.2508	.	3498	Q685J3	MUC17_HUMAN	C	3498	ENSP00000302716:S3498C	ENSP00000302716:S3498C	S	+	2	0	MUC17	100471910	0.000000	0.05858	0.014000	0.15608	0.085000	0.17905	-0.518000	0.06267	0.750000	0.32877	0.186000	0.17326	TCT	MUC17	-	NULL	ENSG00000169876		0.517	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	HGNC	protein_coding	OTTHUMT00000347161.1	-	0.00	62	0	C	NM_001040105		100685190	+1	tier1	-	no_errors	ENST00000306151	ensembl	human	known	74_37	missense	32.61	31	15	SNP	0.013	G
MUC17	140453	genome.wustl.edu	37	7	100685292	100685292	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr7:100685292C>G	ENST00000306151.4	+	3	10659	c.10595C>G	c.(10594-10596)tCt>tGt	p.S3532C		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	3532	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					GTGGCCAGTTCTGAGGCTAGC	0.488																																																	0													247.0	261.0	256.0					7																	100685292		2203	4300	6503	SO:0001583	missense	0			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.10595C>G	7.37:g.100685292C>G	ENSP00000302716:p.Ser3532Cys		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_EG-like_dom,pfscan_SEA_dom	p.S3532C	ENST00000306151.4	37	c.10595	CCDS34711.1	7	.	.	.	.	.	.	.	.	.	.	C	5.467	0.271227	0.10349	.	.	ENSG00000169876	ENST00000306151	T	0.03124	4.04	1.13	1.13	0.20643	.	.	.	.	.	T	0.06645	0.0170	N	0.14661	0.345	0.09310	N	1	D	0.76494	0.999	D	0.81914	0.995	T	0.42015	-0.9476	9	0.59425	D	0.04	.	7.7466	0.28873	0.0:1.0:0.0:0.0	.	3532	Q685J3	MUC17_HUMAN	C	3532	ENSP00000302716:S3532C	ENSP00000302716:S3532C	S	+	2	0	MUC17	100472012	0.001000	0.12720	0.011000	0.14972	0.010000	0.07245	0.357000	0.20199	0.567000	0.29293	0.186000	0.17326	TCT	MUC17	-	NULL	ENSG00000169876		0.488	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	HGNC	protein_coding	OTTHUMT00000347161.1	-	0.00	64	0	C	NM_001040105		100685292	+1	tier1	-	no_errors	ENST00000306151	ensembl	human	known	74_37	missense	21.31	48	13	SNP	0.014	G
MXD3	83463	genome.wustl.edu	37	5	176734640	176734640	+	Silent	SNP	G	G	A	rs533160184		TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr5:176734640G>A	ENST00000439742.2	-	6	1048	c.570C>T	c.(568-570)ttC>ttT	p.F190F	MXD3_ENST00000427908.2_Intron|MXD3_ENST00000513063.1_Silent_p.F190F|MXD3_ENST00000423571.2_Missense_Mutation_p.S216L	NM_031300.3	NP_112590.1	Q9BW11	MAD3_HUMAN	MAX dimerization protein 3	190					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)					all_cancers(89;2.49e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGCCGGCGACGAAGCCCCGCA	0.697													G|||	1	0.000199681	0.0	0.0	5008	,	,		15356	0.0		0.001	False		,,,				2504	0.0																0													29.0	33.0	32.0					5																	176734640		2203	4299	6502	SO:0001819	synonymous_variant	0			BC000745	CCDS4416.1, CCDS47347.1	5q35.3	2013-03-20			ENSG00000213347	ENSG00000213347		"""MAX dimerization proteins"", ""Basic helix-loop-helix proteins"""	14008	protein-coding gene	gene with protein product		609450					Standard	NM_031300		Approved	MAD3, bHLHc13	uc003mgb.2	Q9BW11	OTTHUMG00000130854	ENST00000439742.2:c.570C>T	5.37:g.176734640G>A			B4E0J1|Q53HK1|Q7Z4Y0|Q8NDJ7|Q96ME3	Missense_Mutation	SNP	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.S216L	ENST00000439742.2	37	c.647	CCDS4416.1	5	.	.	.	.	.	.	.	.	.	.	G	15.46	2.838743	0.51057	.	.	ENSG00000213347	ENST00000423571	T	0.36340	1.26	5.11	4.24	0.50183	.	.	.	.	.	T	0.27559	0.0677	.	.	.	0.80722	D	1	P	0.35363	0.497	B	0.24155	0.051	T	0.10451	-1.0629	8	0.87932	D	0	.	11.5732	0.50845	0.15:0.0:0.85:0.0	.	216	B4E0J1	.	L	216	ENSP00000389716:S216L	ENSP00000389716:S216L	S	-	2	0	MXD3	176667246	1.000000	0.71417	0.859000	0.33776	0.004000	0.04260	1.269000	0.33074	1.141000	0.42275	0.561000	0.74099	TCG	MXD3	-	NULL	ENSG00000213347		0.697	MXD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MXD3	HGNC	protein_coding	OTTHUMT00000253427.1	-	0.00	69	0	G			176734640	-1	tier1	-	no_errors	ENST00000423571	ensembl	human	putative	74_37	missense	20.00	48	12	SNP	1.000	A
MYBPC1	4604	genome.wustl.edu	37	12	102061578	102061578	+	Missense_Mutation	SNP	A	A	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr12:102061578A>G	ENST00000550270.1	+	22	2404	c.2404A>G	c.(2404-2406)Aca>Gca	p.T802A	MYBPC1_ENST00000545503.2_Missense_Mutation_p.T784A|MYBPC1_ENST00000551300.1_Missense_Mutation_p.T685A|MYBPC1_ENST00000536007.1_Missense_Mutation_p.T765A|MYBPC1_ENST00000541119.1_Missense_Mutation_p.T772A|MYBPC1_ENST00000550501.1_Intron|MYBPC1_ENST00000549145.1_Missense_Mutation_p.T815A|MYBPC1_ENST00000361466.2_Missense_Mutation_p.T809A|MYBPC1_ENST00000547509.1_Missense_Mutation_p.T770A|MYBPC1_ENST00000547405.1_Missense_Mutation_p.T758A|MYBPC1_ENST00000392934.3_Missense_Mutation_p.T771A|MYBPC1_ENST00000441232.1_Missense_Mutation_p.T802A|MYBPC1_ENST00000553190.1_Missense_Mutation_p.T784A|MYBPC1_ENST00000452455.2_Missense_Mutation_p.T802A|MYBPC1_ENST00000361685.2_Missense_Mutation_p.T809A|MYBPC1_ENST00000360610.2_Missense_Mutation_p.T802A			Q00872	MYPC1_HUMAN	myosin binding protein C, slow type	802	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myofibril (GO:0030016)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	57						AGGTCTGCCAACAGATGCAAA	0.458																																																	0													106.0	92.0	97.0					12																	102061578		2203	4300	6503	SO:0001583	missense	0				CCDS9083.1, CCDS9084.1, CCDS9085.1, CCDS55877.1, CCDS58268.1, CCDS58269.1, CCDS58270.1, CCDS58271.1, CCDS58272.1, CCDS58273.1	12q23.2	2013-02-11	2001-11-28		ENSG00000196091	ENSG00000196091		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7549	protein-coding gene	gene with protein product		160794	"""myosin-binding protein C, slow-type"""			8375400, 16918501	Standard	NM_002465		Approved		uc010svs.2	Q00872	OTTHUMG00000170274	ENST00000550270.1:c.2404A>G	12.37:g.102061578A>G	ENSP00000449702:p.Thr802Ala		B4DKR5|B7Z8G8|B7ZL02|B7ZL09|B7ZL10|E7ESM5|E7EWS6|G3XAE8|Q15497|Q17RR7|Q569K7|Q86T48|Q86TC8|Q8N3L2	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.T809A	ENST00000550270.1	37	c.2425	CCDS9085.1	12	.	.	.	.	.	.	.	.	.	.	A	8.860	0.946805	0.18356	.	.	ENSG00000196091	ENST00000547405;ENST00000452455;ENST00000441232;ENST00000360610;ENST00000392934;ENST00000547509;ENST00000361685;ENST00000549145;ENST00000553190;ENST00000545503;ENST00000536007;ENST00000541119;ENST00000361466;ENST00000551300;ENST00000550270	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.54866	0.55;0.55;0.55;0.55;0.55;0.55;0.55;0.55;0.55;0.55;0.55;0.55;0.55;0.55;0.55	5.73	5.73	0.89815	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.116058	0.38381	N	0.001715	T	0.49184	0.1542	N	0.17872	0.535	0.18873	N	0.999988	B;P;B;B;B;B;P;B;P;P	0.45672	0.116;0.735;0.326;0.418;0.413;0.151;0.548;0.059;0.864;0.619	B;P;P;B;B;B;B;B;P;B	0.48815	0.16;0.519;0.577;0.141;0.265;0.263;0.384;0.214;0.591;0.281	T	0.51196	-0.8736	10	0.72032	D	0.01	.	16.0325	0.80588	1.0:0.0:0.0:0.0	.	765;772;802;784;771;758;784;802;809;809	B7ZL02;B7ZL10;E7EWS6;B7ZL09;E7ESM5;Q17RR7;Q00872-3;Q00872;G3XAE8;Q00872-2	.;.;.;.;.;.;.;MYPC1_HUMAN;.;.	A	758;802;802;802;771;770;809;815;784;784;765;772;809;685;802	ENSP00000448175:T758A;ENSP00000400908:T802A;ENSP00000388989:T802A;ENSP00000353822:T802A;ENSP00000376665:T771A;ENSP00000447362:T770A;ENSP00000354845:T809A;ENSP00000447660:T815A;ENSP00000447900:T784A;ENSP00000440034:T784A;ENSP00000446128:T765A;ENSP00000442847:T772A;ENSP00000354849:T809A;ENSP00000447116:T685A;ENSP00000449702:T802A	ENSP00000353822:T802A	T	+	1	0	MYBPC1	100585709	0.812000	0.29077	0.034000	0.17996	0.004000	0.04260	3.768000	0.55295	2.180000	0.69256	0.528000	0.53228	ACA	MYBPC1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000196091		0.458	MYBPC1-024	KNOWN	basic|appris_candidate|CCDS	protein_coding	MYBPC1	HGNC	protein_coding	OTTHUMT00000408806.1	-	0.00	49	0	A			102061578	+1	tier1	-	no_errors	ENST00000361466	ensembl	human	known	74_37	missense	20.75	42	11	SNP	0.211	G
MYCBP2	23077	genome.wustl.edu	37	13	77671764	77671764	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr13:77671764G>C	ENST00000544440.2	-	56	9428	c.9411C>G	c.(9409-9411)atC>atG	p.I3137M	MYCBP2-AS1_ENST00000593933.1_RNA|MYCBP2_ENST00000357337.6_Missense_Mutation_p.I3137M|MYCBP2_ENST00000407578.2_Missense_Mutation_p.I3175M|MYCBP2_ENST00000482517.1_5'Flank					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		AAGCAGCTTTGATAGTAGCCA	0.373																																																	0													67.0	64.0	65.0					13																	77671764		2203	4300	6503	SO:0001583	missense	0			AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.9411C>G	13.37:g.77671764G>C	ENSP00000444596:p.Ile3137Met			Missense_Mutation	SNP	pfam_PHR,pfam_Reg_chr_condens,pfam_Filamin/ABP280_repeat-like,superfamily_RCC1/BLIP-II,superfamily_Galactose-bd-like,superfamily_Ig_E-set,superfamily_ARM-type_fold,smart_Znf_RING,pfscan_Filamin/ABP280_repeat-like,pfscan_Znf_RING,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.I3175M	ENST00000544440.2	37	c.9525		13	.	.	.	.	.	.	.	.	.	.	G	11.93	1.785834	0.31593	.	.	ENSG00000005810	ENST00000357337;ENST00000407578;ENST00000544440	T;T;T	0.31510	1.49;1.49;1.49	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	T	0.42223	0.1193	L	0.36672	1.1	0.47276	D	0.999377	D;D;D	0.71674	0.998;0.997;0.989	D;D;P	0.77004	0.983;0.989;0.735	T	0.31641	-0.9936	10	0.72032	D	0.01	.	8.6147	0.33824	0.0812:0.0:0.7657:0.1531	.	523;3137;3137	Q9UG08;O75592-2;O75592	.;.;MYCB2_HUMAN	M	3137;3175;3137	ENSP00000349892:I3137M;ENSP00000384288:I3175M;ENSP00000444596:I3137M	ENSP00000349892:I3137M	I	-	3	3	MYCBP2	76569765	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.790000	0.38734	2.716000	0.92895	0.655000	0.94253	ATC	MYCBP2	-	superfamily_ARM-type_fold	ENSG00000005810		0.373	MYCBP2-001	KNOWN	basic	protein_coding	MYCBP2	HGNC	protein_coding	OTTHUMT00000045326.1	-	0.00	47	0	G	NM_015057		77671764	-1	tier1	-	no_errors	ENST00000407578	ensembl	human	known	74_37	missense	23.53	51	16	SNP	1.000	C
MYO1D	4642	genome.wustl.edu	37	17	30981621	30981621	+	Silent	SNP	G	G	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr17:30981621G>T	ENST00000318217.5	-	18	2668	c.2364C>A	c.(2362-2364)ctC>ctA	p.L788L	MYO1D_ENST00000579584.1_Silent_p.L788L|RP11-220C2.1_ENST00000582272.1_RNA|MYO1D_ENST00000394649.4_Silent_p.L700L	NM_015194.1	NP_056009.1	O94832	MYO1D_HUMAN	myosin ID	788					early endosome to recycling endosome transport (GO:0061502)|negative regulation of phosphatase activity (GO:0010923)	axolemma (GO:0030673)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|smooth endoplasmic reticulum (GO:0005790)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(14)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39			BRCA - Breast invasive adenocarcinoma(9;0.0362)			TGCTCTTGATGAGCTGGGATG	0.473																																																	0													51.0	49.0	50.0					17																	30981621		2203	4300	6503	SO:0001819	synonymous_variant	0			AB018270	CCDS32615.1	17q11-q12	2014-06-12				ENSG00000176658		"""Myosins / Myosin superfamily : Class I"""	7598	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 108"""	606539				8884266	Standard	NM_015194		Approved	KIAA0727, myr4, PPP1R108	uc002hho.1	O94832		ENST00000318217.5:c.2364C>A	17.37:g.30981621G>T			A6H8V3|Q8NHP9	Silent	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail_2,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.L788	ENST00000318217.5	37	c.2364	CCDS32615.1	17																																																																																			MYO1D	-	NULL	ENSG00000176658		0.473	MYO1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO1D	HGNC	protein_coding	OTTHUMT00000447457.1	-	0.00	22	0	G			30981621	-1	tier1	-	no_errors	ENST00000318217	ensembl	human	known	74_37	silent	33.33	20	10	SNP	0.996	T
MYO5C	55930	genome.wustl.edu	37	15	52527916	52527916	+	Silent	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr15:52527916C>T	ENST00000261839.7	-	23	3074	c.2913G>A	c.(2911-2913)caG>caA	p.Q971Q	MYO5C_ENST00000443683.2_3'UTR	NM_018728.3	NP_061198.2	Q9NQX4	MYO5C_HUMAN	myosin VC	971						extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(7)|large_intestine(15)|lung(12)|ovary(7)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66				all cancers(107;0.0137)		TTTGTTCTTTCTGTGTTTCCA	0.398																																																	0													162.0	147.0	151.0					15																	52527916		1825	4078	5903	SO:0001819	synonymous_variant	0			AF272390	CCDS42036.1	15q21	2011-09-27				ENSG00000128833		"""Myosins / Myosin superfamily : Class V"""	7604	protein-coding gene	gene with protein product	"""myosin 5C"""	610022				11870218	Standard	NM_018728		Approved	MGC74969	uc010bff.3	Q9NQX4		ENST00000261839.7:c.2913G>A	15.37:g.52527916C>T			Q6P1W8	Silent	SNP	pfam_Myosin_head_motor_dom,pfam_Dil_domain,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_Dilute,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.Q971	ENST00000261839.7	37	c.2913	CCDS42036.1	15																																																																																			MYO5C	-	NULL	ENSG00000128833		0.398	MYO5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO5C	HGNC	protein_coding	OTTHUMT00000419562.1	-	0.00	36	0	C	NM_018728		52527916	-1	tier1	-	no_errors	ENST00000261839	ensembl	human	known	74_37	silent	32.50	27	13	SNP	0.994	T
MYOM1	8736	genome.wustl.edu	37	18	3131469	3131469	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr18:3131469C>G	ENST00000356443.4	-	17	2743	c.2410G>C	c.(2410-2412)Ggt>Cgt	p.G804R	MYOM1_ENST00000400569.3_Missense_Mutation_p.G804R|MYOM1_ENST00000261606.7_Missense_Mutation_p.G804R|MYOM1_ENST00000582016.1_5'Flank	NM_003803.3|NM_019856.1	NP_003794.3|NP_062830.1	P52179	MYOM1_HUMAN	myomesin 1	804	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				muscle contraction (GO:0006936)	M band (GO:0031430)|striated muscle myosin thick filament (GO:0005863)	identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|structural constituent of muscle (GO:0008307)	p.G804S(1)		NS(2)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(20)|ovary(4)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						TAACTCTGACCAGTCACTAAT	0.373																																																	1	Substitution - Missense(1)	skin(1)											73.0	63.0	66.0					18																	3131469		1830	4092	5922	SO:0001583	missense	0			AF185573	CCDS45823.1, CCDS45824.1	18p11.31	2014-09-17	2012-10-17		ENSG00000101605	ENSG00000101605		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7613	protein-coding gene	gene with protein product	"""skelemin"""	603508	"""myomesin 1 (skelemin) (185kD)"", ""myomesin 1 (skelemin) 185kDa"", ""myomesin 1, 185kDa"""			9806852	Standard	NM_019856		Approved		uc002klp.3	P52179	OTTHUMG00000178209	ENST00000356443.4:c.2410G>C	18.37:g.3131469C>G	ENSP00000348821:p.Gly804Arg		Q14BD6|Q6H969|Q6ZUU0	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.G804R	ENST00000356443.4	37	c.2410	CCDS45824.1	18	.	.	.	.	.	.	.	.	.	.	C	17.98	3.520265	0.64747	.	.	ENSG00000101605	ENST00000356443;ENST00000400569;ENST00000261606	T;T;T	0.62639	0.01;0.01;0.01	5.79	5.79	0.91817	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.158879	0.56097	D	0.000030	D	0.83280	0.5220	M	0.90542	3.125	0.44562	D	0.997529	D;D	0.58620	0.983;0.975	D;D	0.68943	0.951;0.961	D	0.83857	0.0266	10	0.44086	T	0.13	.	20.024	0.97514	0.0:1.0:0.0:0.0	.	804;804	P52179-2;P52179	.;MYOM1_HUMAN	R	804	ENSP00000348821:G804R;ENSP00000383413:G804R;ENSP00000261606:G804R	ENSP00000261606:G804R	G	-	1	0	MYOM1	3121469	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	6.049000	0.71053	2.718000	0.92993	0.655000	0.94253	GGT	MYOM1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000101605		0.373	MYOM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MYOM1	HGNC	protein_coding	OTTHUMT00000441037.2		0.00	44	0	C	NM_003803		3131469	-1			no_errors	ENST00000356443	ensembl	human	known	74_37	missense	5.41	35	2	SNP	1.000	G
MYPN	84665	genome.wustl.edu	37	10	69866502	69866502	+	5'Flank	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr10:69866502G>C	ENST00000358913.5	+	0	0				MYPN_ENST00000540630.1_5'Flank|MYPN_ENST00000354393.2_Missense_Mutation_p.K7N|MYPN_ENST00000373675.3_5'Flank	NM_001256267.1|NM_032578.3	NP_001243196.1|NP_115967.2	Q86TC9	MYPN_HUMAN	myopalladin						sarcomere organization (GO:0045214)	I band (GO:0031674)|nucleus (GO:0005634)|Z disc (GO:0030018)	cytoskeletal protein binding (GO:0008092)|muscle alpha-actinin binding (GO:0051371)|SH3 domain binding (GO:0017124)			breast(2)|central_nervous_system(1)|endometrium(13)|kidney(6)|large_intestine(13)|liver(1)|lung(43)|ovary(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(5)	94						TCCAAGTGAAGACTTCCTCTG	0.393																																																	0																																										SO:0001631	upstream_gene_variant	0			AL834247	CCDS7275.1, CCDS73142.1	10q22.1	2014-09-17			ENSG00000138347	ENSG00000138347		"""Immunoglobulin superfamily / I-set domain containing"""	23246	protein-coding gene	gene with protein product	"""sarcomeric protein myopalladin, 145 kDa"""	608517				11309420, 12482578	Standard	NM_032578		Approved	MYOP	uc001jnm.5	Q86TC9	OTTHUMG00000018344		10.37:g.69866502G>C	Exception_encountered		Q5VV35|Q5VV36|Q86T37|Q8N3L4|Q96K90|Q96KF5	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.K7N	ENST00000358913.5	37	c.21	CCDS7275.1	10	.	.	.	.	.	.	.	.	.	.	G	14.67	2.606086	0.46527	.	.	ENSG00000138347	ENST00000354393;ENST00000542332	T	0.62364	0.03	5.83	1.86	0.25419	.	.	.	.	.	T	0.52709	0.1751	.	.	.	0.80722	D	1	P	0.38420	0.63	B	0.41646	0.362	T	0.39121	-0.9629	7	.	.	.	.	8.2604	0.31781	0.3282:0.0:0.6718:0.0	.	7	Q86TC9-2	.	N	7	ENSP00000346369:K7N	.	K	+	3	2	MYPN	69536508	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	1.457000	0.35212	0.371000	0.24564	0.655000	0.94253	AAG	MYPN	-	smart_Ig_sub	ENSG00000138347		0.393	MYPN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MYPN	HGNC	protein_coding	OTTHUMT00000048307.1	-	0.00	55	0	G	NM_032578		69866502	+1	tier1	-	no_errors	ENST00000354393	ensembl	human	known	74_37	missense	31.34	46	21	SNP	0.998	C
NANS	54187	genome.wustl.edu	37	9	100839226	100839226	+	Silent	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr9:100839226G>A	ENST00000210444.5	+	3	445	c.375G>A	c.(373-375)ctG>ctA	p.L125L	NANS_ENST00000461452.1_3'UTR|TRIM14_ENST00000375098.3_Intron	NM_018946.3	NP_061819.2	Q9NR45	SIAS_HUMAN	N-acetylneuraminic acid synthase	125					lipopolysaccharide biosynthetic process (GO:0009103)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	N-acetylneuraminate synthase activity (GO:0050462)|N-acylneuraminate cytidylyltransferase activity (GO:0008781)|N-acylneuraminate-9-phosphate synthase activity (GO:0047444)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|skin(1)	11		Acute lymphoblastic leukemia(62;0.0559)				TGCATGAACTGAATGTTCCAT	0.353																																																	0													124.0	116.0	119.0					9																	100839226		2203	4300	6503	SO:0001819	synonymous_variant	0			AF161387	CCDS6733.1	9p24.1-p23	2008-07-31	2008-07-31		ENSG00000095380	ENSG00000095380			19237	protein-coding gene	gene with protein product	"""sialic acid synthase"""	605202				10749855	Standard	NM_018946		Approved	SAS	uc004ayc.3	Q9NR45	OTTHUMG00000020341	ENST00000210444.5:c.375G>A	9.37:g.100839226G>A			B2RE98|Q8WUV9|Q9BWS6|Q9NVD4	Silent	SNP	pfam_Neu5Ac_N,pfam_SAF,superfamily_AFP_Neu5c_C,smart_SAF,pfscan_AFP_Neu5c_C,prints_Antifreeze_III	p.L125	ENST00000210444.5	37	c.375	CCDS6733.1	9																																																																																			NANS	-	pfam_Neu5Ac_N	ENSG00000095380		0.353	NANS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NANS	HGNC	protein_coding	OTTHUMT00000053359.1	-	0.00	87	0	G	NM_018946		100839226	+1	tier1	-	no_errors	ENST00000210444	ensembl	human	known	74_37	silent	30.70	79	35	SNP	1.000	A
NAP1L6	645996	genome.wustl.edu	37	X	72347515	72347515	+	Silent	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chrX:72347515C>T	ENST00000373518.1	-	1	404	c.207G>A	c.(205-207)ctG>ctA	p.L69L				A6NFF2	NP1L6_HUMAN	nucleosome assembly protein 1-like 6	69					nucleosome assembly (GO:0006334)	nucleus (GO:0005634)											GAAATTCCCTCAGGTACTTGG	0.483																																																	0																																										SO:0001819	synonymous_variant	0			AK090915		Xq13.2	2013-03-27			ENSG00000204118	ENSG00000204118			31706	other	unknown							Standard	NR_027291		Approved	FLJ33596	uc004ebh.1	A6NFF2	OTTHUMG00000021826	ENST00000373518.1:c.207G>A	X.37:g.72347515C>T				Silent	SNP	pfam_NAP_family	p.L69	ENST00000373518.1	37	c.207		X																																																																																			NAP1L6	-	pfam_NAP_family	ENSG00000204118		0.483	NAP1L6-001	KNOWN	basic|appris_principal	protein_coding	NAP1L6	HGNC	protein_coding	OTTHUMT00000057224.1	-	0.00	22	0	C	NR_027291		72347515	-1	tier1	-	no_errors	ENST00000373518	ensembl	human	known	74_37	silent	28.57	25	10	SNP	0.321	T
NCAM2	4685	genome.wustl.edu	37	21	22696804	22696804	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr21:22696804G>T	ENST00000400546.1	+	6	970	c.721G>T	c.(721-723)Gcc>Tcc	p.A241S	NCAM2_ENST00000284894.7_Missense_Mutation_p.A99S|NCAM2_ENST00000535285.1_Missense_Mutation_p.A266S	NM_004540.3	NP_004531.2	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2	241	Ig-like C2-type 3.				axonal fasciculation (GO:0007413)|neuron cell-cell adhesion (GO:0007158)|sensory perception of smell (GO:0007608)	axon (GO:0030424)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(4)|cervix(2)|endometrium(8)|kidney(6)|large_intestine(22)|liver(4)|lung(49)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	108		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		TCCAGAACCCGCCATCTCCTG	0.493																																																	0													87.0	88.0	88.0					21																	22696804		1917	4128	6045	SO:0001583	missense	0				CCDS42910.1	21q21	2013-02-11			ENSG00000154654	ENSG00000154654		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7657	protein-coding gene	gene with protein product		602040				9226371	Standard	NM_004540		Approved	NCAM21, MGC51008	uc002yld.2	O15394	OTTHUMG00000078121	ENST00000400546.1:c.721G>T	21.37:g.22696804G>T	ENSP00000383392:p.Ala241Ser		A8MQ06|B7Z841|Q7Z7F2	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom,prints_Neural_cell_adh	p.A241S	ENST00000400546.1	37	c.721	CCDS42910.1	21	.	.	.	.	.	.	.	.	.	.	G	9.297	1.052130	0.19827	.	.	ENSG00000154654	ENST00000400546;ENST00000284894;ENST00000535285	T;T;T	0.64260	-0.09;-0.09;-0.09	4.94	-4.73	0.03259	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.080040	0.06945	N	0.813567	T	0.31765	0.0807	N	0.03238	-0.38	0.09310	N	0.999999	B;B;B	0.06786	0.0;0.001;0.001	B;B;B	0.13407	0.006;0.009;0.005	T	0.13872	-1.0493	10	0.36615	T	0.2	-1.6742	4.7758	0.13178	0.2499:0.0:0.3752:0.3748	.	266;99;241	B7Z841;B7Z5K2;O15394	.;.;NCAM2_HUMAN	S	241;99;266	ENSP00000383392:A241S;ENSP00000284894:A99S;ENSP00000441887:A266S	ENSP00000284894:A99S	A	+	1	0	NCAM2	21618675	0.186000	0.23225	0.721000	0.30653	0.753000	0.42808	0.126000	0.15769	-0.670000	0.05282	-0.423000	0.05987	GCC	NCAM2	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	ENSG00000154654		0.493	NCAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCAM2	HGNC	protein_coding	OTTHUMT00000170915.1	-	0.00	140	0	G	NM_004540		22696804	+1	tier1	-	no_errors	ENST00000400546	ensembl	human	known	74_37	missense	8.44	141	13	SNP	0.080	T
NCF1B	654816	genome.wustl.edu	37	7	72639953	72639953	+	RNA	SNP	G	G	A	rs201604882		TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr7:72639953G>A	ENST00000423083.1	+	0	158					NR_003186.1		A6NI72	NCF1B_HUMAN	neutrophil cytosolic factor 1B pseudogene							cytoplasm (GO:0005737)	phosphatidylinositol binding (GO:0035091)|superoxide-generating NADPH oxidase activity (GO:0016175)										GCGGGCCGCCGAGAACCACCA	0.637																																																	0																																												0					7q11.23	2014-03-20	2006-09-19		ENSG00000182487	ENSG00000182487			32522	pseudogene	pseudogene			"""neutrophil cytosolic factor 1B"""				Standard	NR_003186		Approved	SH3PXD1B	uc011ker.1	A6NI72	OTTHUMG00000156804		7.37:g.72639953G>A				RNA	SNP	-	NULL	ENST00000423083.1	37	NULL		7																																																																																			NCF1B	-	-	ENSG00000182487		0.637	NCF1B-003	KNOWN	basic	processed_transcript	NCF1B	HGNC	pseudogene	OTTHUMT00000345924.1		0.00	95	0	G	NR_003186		72639953	+1			no_errors	ENST00000432102	ensembl	human	known	74_37	rna	7.69	72	6	SNP	0.995	A
NCKAP5L	57701	genome.wustl.edu	37	12	50186476	50186476	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr12:50186476C>G	ENST00000335999.6	-	11	3835	c.3634G>C	c.(3634-3636)Gag>Cag	p.E1212Q		NM_001037806.3	NP_001032895.2	Q9HCH0	NCK5L_HUMAN	NCK-associated protein 5-like	1208	Pro-rich.									central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(8)|prostate(2)	18						GGACAGGTCTCATGGCCCCGG	0.667																																																	0													13.0	16.0	15.0					12																	50186476		2166	4262	6428	SO:0001583	missense	0			AB046822	CCDS41781.2	12q13.12	2009-08-14	2009-08-14	2009-08-14	ENSG00000167566	ENSG00000167566			29321	protein-coding gene	gene with protein product		615104	"""KIAA1602"""	KIAA1602			Standard	NM_001037806		Approved		uc009zlk.2	Q9HCH0	OTTHUMG00000156969	ENST00000335999.6:c.3634G>C	12.37:g.50186476C>G	ENSP00000337998:p.Glu1212Gln		Q2TB26|Q71RH1|Q8N4W1|Q96HX2	Missense_Mutation	SNP	NULL	p.E1212Q	ENST00000335999.6	37	c.3634	CCDS41781.2	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	1.047|1.047	-0.676970|-0.676970	0.03378|0.03378	.|.	.|.	ENSG00000167566|ENSG00000167566	ENST00000335999;ENST00000354423|ENST00000433948	T|.	0.40756|.	1.02|.	4.3|4.3	2.32|2.32	0.28847|0.28847	.|.	0.569068|.	0.14856|.	N|.	0.294363|.	T|.	0.08670|.	0.0215|.	N|N	0.00926|0.00926	-1.1|-1.1	0.09310|0.09310	N|N	1|1	B;B;B|.	0.02656|.	0.0;0.0;0.0|.	B;B;B|.	0.01281|.	0.0;0.0;0.0|.	T|.	0.34104|.	-0.9842|.	10|.	0.02654|.	T|.	1|.	-1.8|-1.8	6.134|6.134	0.20221|0.20221	0.0:0.1495:0.4896:0.3609|0.0:0.1495:0.4896:0.3609	.|.	1186;1208;1208|.	E2QRB5;Q9HCH0;Q9HCH0-2|.	.;NCK5L_HUMAN;.|.	Q|S	1212;1186|926	ENSP00000337998:E1212Q|.	ENSP00000337998:E1212Q|.	E|X	-|-	1|2	0|2	NCKAP5L|NCKAP5L	48472743|48472743	0.866000|0.866000	0.29940|0.29940	0.542000|0.542000	0.28115|0.28115	0.929000|0.929000	0.56500|0.56500	0.756000|0.756000	0.26419|0.26419	0.513000|0.513000	0.28278|0.28278	-0.270000|-0.270000	0.10280|0.10280	GAG|TGA	NCKAP5L	-	NULL	ENSG00000167566		0.667	NCKAP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCKAP5L	HGNC	protein_coding	OTTHUMT00000346884.2	-	0.00	23	0	C	XM_035497		50186476	-1	tier1	-	no_errors	ENST00000335999	ensembl	human	known	74_37	missense	30.43	16	7	SNP	0.558	G
NCKAP1L	3071	genome.wustl.edu	37	12	54905766	54905766	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr12:54905766C>G	ENST00000293373.6	+	9	897	c.818C>G	c.(817-819)tCc>tGc	p.S273C	NCKAP1L_ENST00000545638.2_Missense_Mutation_p.S223C|NCKAP1L_ENST00000552211.1_3'UTR	NM_005337.4	NP_005328.2	P55160	NCKPL_HUMAN	NCK-associated protein 1-like	273					actin polymerization-dependent cell motility (GO:0070358)|B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|chemotaxis (GO:0006935)|cortical actin cytoskeleton organization (GO:0030866)|erythrocyte development (GO:0048821)|maintenance of cell polarity (GO:0030011)|myeloid cell homeostasis (GO:0002262)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of myosin-light-chain-phosphatase activity (GO:0035509)|neutrophil chemotaxis (GO:0030593)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043372)|positive regulation of CD8-positive, alpha-beta T cell differentiation (GO:0043378)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of lymphocyte differentiation (GO:0045621)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of T cell proliferation (GO:0042102)|protein complex assembly (GO:0006461)|response to drug (GO:0042493)|T cell homeostasis (GO:0043029)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|SCAR complex (GO:0031209)	protein complex binding (GO:0032403)|protein kinase activator activity (GO:0030295)|Rac GTPase activator activity (GO:0030675)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(37)|ovary(3)|prostate(3)|skin(3)|stomach(2)	80						TGCCTCAACTCCAATAGCCAG	0.488																																																	0													150.0	134.0	139.0					12																	54905766		2203	4300	6503	SO:0001583	missense	0			AI924363	CCDS31813.1, CCDS53799.1	12q13.1	2005-10-11	2005-10-11	2005-10-11		ENSG00000123338			4862	protein-coding gene	gene with protein product		141180	"""hematopoietic protein 1"""	HEM1		1932118	Standard	NM_005337		Approved		uc001sgc.4	P55160	OTTHUMG00000169843	ENST00000293373.6:c.818C>G	12.37:g.54905766C>G	ENSP00000293373:p.Ser273Cys		B4DUT5|Q52LW0	Missense_Mutation	SNP	pfam_Nck-associated_protein-1,superfamily_Nucl_hormone_rcpt_ligand-bd	p.S273C	ENST00000293373.6	37	c.818	CCDS31813.1	12	.	.	.	.	.	.	.	.	.	.	C	18.67	3.673194	0.67928	.	.	ENSG00000123338	ENST00000293373;ENST00000545638	T;T	0.32023	1.47;1.47	5.61	4.67	0.58626	.	0.190600	0.45867	D	0.000324	T	0.31949	0.0813	N	0.24115	0.695	0.31691	N	0.641893	P	0.40731	0.728	P	0.51582	0.674	T	0.25606	-1.0127	10	0.48119	T	0.1	-5.9615	11.7159	0.51653	0.0:0.8223:0.1777:0.0	.	273	P55160	NCKPL_HUMAN	C	273;223	ENSP00000293373:S273C;ENSP00000445596:S223C	ENSP00000293373:S273C	S	+	2	0	NCKAP1L	53192033	0.272000	0.24172	1.000000	0.80357	0.990000	0.78478	2.202000	0.42743	2.665000	0.90641	0.558000	0.71614	TCC	NCKAP1L	-	pfam_Nck-associated_protein-1	ENSG00000123338		0.488	NCKAP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCKAP1L	HGNC	protein_coding	OTTHUMT00000406195.1	-	0.00	51	0	C	NM_005337		54905766	+1	tier1	-	no_errors	ENST00000293373	ensembl	human	known	74_37	missense	19.40	54	13	SNP	1.000	G
NDUFB8	4714	genome.wustl.edu	37	10	102283650	102283650	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr10:102283650C>G	ENST00000299166.4	-	5	517	c.505G>C	c.(505-507)Gaa>Caa	p.E169Q	NDUFB8_ENST00000531258.1_Intron|NDUFB8_ENST00000557395.1_Intron|NDUFB8_ENST00000370322.1_Missense_Mutation_p.E138Q|SEC31B_ENST00000535773.1_Intron	NM_005004.2	NP_004995.1	O95169	NDUB8_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 8, 19kDa	169					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			endometrium(2)|lung(2)	4		Colorectal(252;0.234)		Epithelial(162;5.68e-10)|all cancers(201;4.05e-08)		CCGCCTCGTTCCAGGTACAGA	0.493																																																	0													89.0	82.0	84.0					10																	102283650		2203	4300	6503	SO:0001583	missense	0			AF044958	CCDS7497.1, CCDS65916.1, CCDS65917.1	10q24.31	2011-07-04	2002-08-29		ENSG00000166136	ENSG00000166136		"""Mitochondrial respiratory chain complex / Complex I"""	7703	protein-coding gene	gene with protein product	"""complex I ASHI subunit"""	602140	"""NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 8 (19kD, ASHI)"""			9763676	Standard	NM_001284368		Approved	ASHI, CI-ASHI	uc001kri.1	O95169	OTTHUMG00000019346	ENST00000299166.4:c.505G>C	10.37:g.102283650C>G	ENSP00000299166:p.Glu169Gln		A8K0L4|Q5W143|Q5W144|Q5W145|Q9UG53|Q9UJR4|Q9UQF3	Missense_Mutation	SNP	pfam_NDUFB8,pirsf_NADH_UbQ_OxRdtase_b-cplx_su8	p.E169Q	ENST00000299166.4	37	c.505	CCDS7497.1	10	.	.	.	.	.	.	.	.	.	.	C	22.9	4.347755	0.82022	.	.	ENSG00000166136	ENST00000299166;ENST00000370322	.	.	.	5.05	5.05	0.67936	.	0.000000	0.85682	D	0.000000	D	0.82986	0.5156	M	0.87328	2.875	0.80722	D	1	D	0.63046	0.992	P	0.62382	0.901	D	0.86026	0.1510	9	0.59425	D	0.04	-14.4502	18.007	0.89212	0.0:1.0:0.0:0.0	.	169	O95169	NDUB8_HUMAN	Q	169;138	.	ENSP00000299166:E169Q	E	-	1	0	NDUFB8	102273640	1.000000	0.71417	1.000000	0.80357	0.828000	0.46876	7.195000	0.77798	2.351000	0.79841	0.455000	0.32223	GAA	NDUFB8	-	pfam_NDUFB8,pirsf_NADH_UbQ_OxRdtase_b-cplx_su8	ENSG00000166136		0.493	NDUFB8-005	KNOWN	basic|appris_principal|CCDS	protein_coding	NDUFB8	HGNC	protein_coding	OTTHUMT00000051225.1	-	0.00	41	0	C	NM_005004		102283650	-1	tier1	-	no_errors	ENST00000299166	ensembl	human	known	74_37	missense	22.45	38	11	SNP	1.000	G
NEDD4	4734	genome.wustl.edu	37	15	56208246	56208246	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr15:56208246G>T	ENST00000508342.1	-	1	1083	c.784C>A	c.(784-786)Cgt>Agt	p.R262S	NEDD4_ENST00000506154.1_Missense_Mutation_p.R262S|NEDD4_ENST00000435532.3_Intron|NEDD4_ENST00000338963.2_Missense_Mutation_p.R262S	NM_001284338.1	NP_001271267.1	P46934	NEDD4_HUMAN	neural precursor cell expressed, developmentally down-regulated 4, E3 ubiquitin protein ligase	262					adaptive immune response (GO:0002250)|blood vessel morphogenesis (GO:0048514)|cellular response to UV (GO:0034644)|cytokine-mediated signaling pathway (GO:0019221)|development involved in symbiotic interaction (GO:0044111)|endocardial cushion development (GO:0003197)|glucocorticoid receptor signaling pathway (GO:0042921)|lysosomal transport (GO:0007041)|negative regulation of sodium ion transport (GO:0010766)|negative regulation of transcription from RNA polymerase II promoter in response to UV-induced DNA damage (GO:0010768)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|neuromuscular junction development (GO:0007528)|neuron projection development (GO:0031175)|outflow tract morphogenesis (GO:0003151)|positive regulation of nucleocytoplasmic transport (GO:0046824)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein catabolic process (GO:0045732)|progesterone receptor signaling pathway (GO:0050847)|protein K63-linked ubiquitination (GO:0070534)|protein monoubiquitination (GO:0006513)|protein targeting to lysosome (GO:0006622)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|receptor catabolic process (GO:0032801)|receptor internalization (GO:0031623)|regulation of dendrite morphogenesis (GO:0048814)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|regulation of synapse organization (GO:0050807)|response to calcium ion (GO:0051592)|T cell activation (GO:0042110)|transmission of virus (GO:0019089)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	apicolateral plasma membrane (GO:0016327)|cell cortex (GO:0005938)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	beta-2 adrenergic receptor binding (GO:0031698)|ligase activity (GO:0016874)|phosphoserine binding (GO:0050815)|phosphothreonine binding (GO:0050816)|proline-rich region binding (GO:0070064)|protein domain specific binding (GO:0019904)|RNA polymerase binding (GO:0070063)|sodium channel inhibitor activity (GO:0019871)|ubiquitin binding (GO:0043130)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(15)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	43				all cancers(107;0.0299)|GBM - Glioblastoma multiforme(80;0.113)		GAGGAGTAACGTTTTAGTGGA	0.413																																																	0													107.0	106.0	107.0					15																	56208246		2193	4291	6484	SO:0001583	missense	0			D42055	CCDS10156.1, CCDS45265.1, CCDS61643.1, CCDS61644.1	15q	2012-02-23	2012-02-23		ENSG00000069869	ENSG00000069869			7727	protein-coding gene	gene with protein product	"""receptor-potentiating factor 1"""	602278	"""neural precursor cell expressed, developmentally down-regulated 4"""			9073511, 8649367	Standard	XR_243101		Approved	KIAA0093, MGC176705, NEDD4-1, RPF1	uc002adi.3	P46934	OTTHUMG00000132015	ENST00000508342.1:c.784C>A	15.37:g.56208246G>T	ENSP00000424827:p.Arg262Ser		A1KY35|A6ND72|A7MD29|B4E2R7|B7ZM59|B7ZM60|B9EGN5|D6RF89	Missense_Mutation	SNP	pfam_HECT,pfam_WW_dom,superfamily_HECT,superfamily_WW_dom,superfamily_C2_dom,smart_WW_dom,smart_HECT,pfscan_HECT,pfscan_WW_dom	p.R262S	ENST00000508342.1	37	c.784		15	.	.	.	.	.	.	.	.	.	.	G	19.95	3.921427	0.73213	.	.	ENSG00000069869	ENST00000508342;ENST00000338963;ENST00000506154	T;T;T	0.40476	1.03;1.03;1.03	5.25	4.32	0.51571	.	1.220650	0.05028	N	0.474186	T	0.57961	0.2089	L	0.36672	1.1	0.32684	N	0.515105	D;D;D	0.76494	0.999;0.999;0.999	D;P;D	0.68353	0.957;0.907;0.957	T	0.53913	-0.8371	10	0.87932	D	0	.	13.3348	0.60512	0.0777:0.0:0.9223:0.0	.	262;262;262	P46934-2;P46934;P46934-3	.;NEDD4_HUMAN;.	S	262	ENSP00000424827:R262S;ENSP00000345530:R262S;ENSP00000422705:R262S	ENSP00000345530:R262S	R	-	1	0	NEDD4	53995538	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	6.804000	0.75186	2.466000	0.83321	0.467000	0.42956	CGT	NEDD4	-	NULL	ENSG00000069869		0.413	NEDD4-002	KNOWN	basic	protein_coding	NEDD4	HGNC	protein_coding	OTTHUMT00000359817.1		0.00	47	0	G	NM_198400		56208246	-1			no_errors	ENST00000508342	ensembl	human	known	74_37	missense	5.56	34	2	SNP	1.000	T
NHS	4810	genome.wustl.edu	37	X	17745851	17745851	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chrX:17745851G>C	ENST00000380060.3	+	6	3900	c.3562G>C	c.(3562-3564)Gag>Cag	p.E1188Q	NHS_ENST00000398097.3_Missense_Mutation_p.E1032Q	NM_198270.2	NP_938011.1	Q6T4R5	NHS_HUMAN	Nance-Horan syndrome (congenital cataracts and dental anomalies)	1209					cell differentiation (GO:0030154)|lens development in camera-type eye (GO:0002088)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(5)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(26)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	71	Hepatocellular(33;0.183)					TTCTGCAGTTGAGATGGGACC	0.403																																																	0													96.0	93.0	94.0					X																	17745851		2203	4300	6503	SO:0001583	missense	0				CCDS14181.1, CCDS48087.1	Xp22.3-p21.1	2014-06-18			ENSG00000188158	ENSG00000188158			7820	protein-coding gene	gene with protein product		300457					Standard	NM_001136024		Approved		uc004cxx.3	Q6T4R5	OTTHUMG00000022799	ENST00000380060.3:c.3562G>C	X.37:g.17745851G>C	ENSP00000369400:p.Glu1188Gln		B7ZVX8|E2DH69|Q5J7Q0|Q5J7Q1|Q68DR5	Missense_Mutation	SNP	NULL	p.E1188Q	ENST00000380060.3	37	c.3562	CCDS14181.1	X	.	.	.	.	.	.	.	.	.	.	G	5.192	0.220898	0.09863	.	.	ENSG00000188158	ENST00000380060;ENST00000398097;ENST00000380057	T;T	0.50277	0.77;0.75	5.79	5.79	0.91817	.	0.161489	0.56097	D	0.000033	T	0.44993	0.1320	L	0.54323	1.7	0.22719	N	0.998818	B;B;B;B	0.23806	0.091;0.091;0.091;0.084	B;B;B;B	0.26517	0.07;0.039;0.039;0.066	T	0.30822	-0.9965	10	0.21540	T	0.41	-17.257	15.2472	0.73513	0.0:0.1367:0.8633:0.0	.	1209;1030;1032;1188	B7ZVX8;C9IYM8;Q6T4R5-2;Q6T4R5	.;.;.;NHS_HUMAN	Q	1188;1032;1030	ENSP00000369400:E1188Q;ENSP00000381170:E1032Q	ENSP00000369397:E1030Q	E	+	1	0	NHS	17655772	1.000000	0.71417	0.340000	0.25575	0.044000	0.14063	4.907000	0.63300	2.444000	0.82710	0.544000	0.68410	GAG	NHS	-	NULL	ENSG00000188158		0.403	NHS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NHS	HGNC	protein_coding	OTTHUMT00000059120.1	-	0.00	14	0	G	NM_198270		17745851	+1	tier1	-	no_errors	ENST00000380060	ensembl	human	known	74_37	missense	59.09	9	13	SNP	0.312	C
NKD2	85409	genome.wustl.edu	37	5	1033539	1033539	+	Silent	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr5:1033539C>T	ENST00000296849.5	+	5	484	c.255C>T	c.(253-255)ctC>ctT	p.L85L	NKD2_ENST00000537972.1_Silent_p.L85L|NKD2_ENST00000274150.4_Silent_p.L85L	NM_033120.3	NP_149111.1	Q969F2	NKD2_HUMAN	naked cuticle homolog 2 (Drosophila)	85	Targeting to the basolateral cell membrane.				exocytosis (GO:0006887)|Golgi vesicle fusion to target membrane (GO:0048210)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein processing (GO:0010954)|protein targeting to plasma membrane (GO:0072661)|Wnt signaling pathway (GO:0016055)	basolateral plasma membrane (GO:0016323)|cell periphery (GO:0071944)|cytoplasmic vesicle (GO:0031410)	calcium ion binding (GO:0005509)|growth factor binding (GO:0019838)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(3)|large_intestine(1)|lung(8)|pancreas(1)	14	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;3.28e-09)		Epithelial(17;0.00093)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00417)|Lung(60;0.165)			GACAACTCCTCAGCGCAGATG	0.677																																																	0													22.0	28.0	26.0					5																	1033539		2182	4275	6457	SO:0001819	synonymous_variant	0			AF358137	CCDS3859.1, CCDS59486.1	5p15.3	2013-01-10			ENSG00000145506	ENSG00000145506		"""EF-hand domain containing"""	17046	protein-coding gene	gene with protein product	"""naked cuticle-2"", ""Dvl-binding protein NKD2"""	607852				11356022, 11604995	Standard	NM_033120		Approved	Naked2	uc003jbt.2	Q969F2	OTTHUMG00000090348	ENST00000296849.5:c.255C>T	5.37:g.1033539C>T			Q96EK8|Q9BSN0	Silent	SNP	pfscan_EF_hand_dom	p.L85	ENST00000296849.5	37	c.255	CCDS3859.1	5																																																																																			NKD2	-	NULL	ENSG00000145506		0.677	NKD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NKD2	HGNC	protein_coding	OTTHUMT00000206720.2	-	0.00	52	0	C	NM_033120		1033539	+1	tier1	-	no_errors	ENST00000296849	ensembl	human	known	74_37	silent	36.26	109	62	SNP	0.000	T
NOX4	50507	genome.wustl.edu	37	11	89135696	89135696	+	Missense_Mutation	SNP	T	T	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr11:89135696T>A	ENST00000263317.4	-	9	882	c.644A>T	c.(643-645)tAt>tTt	p.Y215F	NOX4_ENST00000528341.1_Missense_Mutation_p.Y190F|NOX4_ENST00000527626.1_Missense_Mutation_p.Y49F|NOX4_ENST00000532825.1_Missense_Mutation_p.Y191F|NOX4_ENST00000527956.1_Missense_Mutation_p.Y191F|NOX4_ENST00000413594.2_Missense_Mutation_p.Y236F|NOX4_ENST00000535633.1_Missense_Mutation_p.Y191F|NOX4_ENST00000531342.1_Intron|NOX4_ENST00000534731.1_Missense_Mutation_p.Y215F|NOX4_ENST00000343727.5_Missense_Mutation_p.Y191F|NOX4_ENST00000424319.1_Missense_Mutation_p.Y191F|NOX4_ENST00000542487.1_Missense_Mutation_p.Y191F|NOX4_ENST00000375979.3_Intron|NOX4_ENST00000525196.1_Intron			Q9NPH5	NOX4_HUMAN	NADPH oxidase 4	215	Ferric oxidoreductase.				bone resorption (GO:0045453)|cardiac muscle cell differentiation (GO:0055007)|cell aging (GO:0007569)|cell morphogenesis (GO:0000902)|cellular response to cAMP (GO:0071320)|cellular response to gamma radiation (GO:0071480)|cellular response to glucose stimulus (GO:0071333)|cellular response to transforming growth factor beta stimulus (GO:0071560)|homocysteine metabolic process (GO:0050667)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|oxidation-reduction process (GO:0055114)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of stress fiber assembly (GO:0051496)|reactive oxygen species metabolic process (GO:0072593)|response to hypoxia (GO:0001666)|superoxide anion generation (GO:0042554)	apical plasma membrane (GO:0016324)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|NADPH oxidase complex (GO:0043020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|heme binding (GO:0020037)|modified amino acid binding (GO:0072341)|NAD(P)H oxidase activity (GO:0016174)|nucleotide binding (GO:0000166)|oxygen sensor activity (GO:0019826)|superoxide-generating NADPH oxidase activity (GO:0016175)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(20)|ovary(2)|prostate(3)|skin(2)	44		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.011)				ATTAGTTTGATACTTCAGCAG	0.358																																																	0													60.0	67.0	65.0					11																	89135696		2200	4298	6498	SO:0001583	missense	0			AF254621	CCDS8285.1, CCDS44695.1, CCDS44696.1, CCDS73361.1, CCDS73362.1	11q14.2-q21	2008-02-05			ENSG00000086991	ENSG00000086991			7891	protein-coding gene	gene with protein product		605261					Standard	NM_001143837		Approved	KOX-1, KOX	uc001pct.3	Q9NPH5	OTTHUMG00000167298	ENST00000263317.4:c.644A>T	11.37:g.89135696T>A	ENSP00000263317:p.Tyr215Phe		A8K715|B7Z520|E7EMD7|Q5K3R4|Q5K3R5|Q5K3R6|Q5K3R8|Q7Z7G3|Q86V92	Missense_Mutation	SNP	pfam_Fe_red_NAD-bd_6,pfam_Fe3_Rdtase_TM_dom,pfam_FAD-bd_8,superfamily_Riboflavin_synthase-like_b-brl,prints_Cyt_b245_heavy_chain	p.Y236F	ENST00000263317.4	37	c.707	CCDS8285.1	11	.	.	.	.	.	.	.	.	.	.	T	18.79	3.699523	0.68501	.	.	ENSG00000086991	ENST00000424319;ENST00000535633;ENST00000343727;ENST00000534731;ENST00000263317;ENST00000532825;ENST00000527956;ENST00000542487;ENST00000527626;ENST00000528341;ENST00000413594	D;D;D;D;D;D;D;D;D;D;D	0.95272	-3.59;-3.59;-3.59;-3.57;-3.51;-3.66;-3.59;-3.59;-3.33;-3.56;-3.62	4.76	4.76	0.60689	.	0.385576	0.27031	N	0.021279	D	0.95345	0.8489	L	0.48935	1.535	0.46609	D	0.999126	P;D;D;P;B	0.71674	0.454;0.998;0.997;0.567;0.27	B;D;D;P;B	0.65323	0.205;0.925;0.934;0.458;0.184	D	0.94739	0.7917	9	.	.	.	-12.7587	14.5682	0.68194	0.0:0.0:0.0:1.0	.	191;49;190;215;215	E9PMY6;E9PR43;E9PPP2;Q9NPH5-6;Q9NPH5	.;.;.;.;NOX4_HUMAN	F	191;191;191;215;215;191;191;191;49;190;236	ENSP00000412446:Y191F;ENSP00000440172:Y191F;ENSP00000344747:Y191F;ENSP00000436892:Y215F;ENSP00000263317:Y215F;ENSP00000434924:Y191F;ENSP00000433797:Y191F;ENSP00000439373:Y191F;ENSP00000436093:Y49F;ENSP00000436970:Y190F;ENSP00000405705:Y236F	.	Y	-	2	0	NOX4	88775344	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	4.426000	0.59882	1.907000	0.55213	0.383000	0.25322	TAT	NOX4	-	NULL	ENSG00000086991		0.358	NOX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOX4	HGNC	protein_coding	OTTHUMT00000394054.1	-	0.00	41	0	T	NM_016931		89135696	-1	tier1	-	no_errors	ENST00000413594	ensembl	human	known	74_37	missense	23.08	50	15	SNP	1.000	A
NPAP1	23742	genome.wustl.edu	37	15	24921665	24921665	+	Silent	SNP	A	A	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr15:24921665A>T	ENST00000329468.2	+	1	1125	c.651A>T	c.(649-651)tcA>tcT	p.S217S		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	217					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)											ACAAGTTCTCAGAAAACAGCA	0.622																																																	0													37.0	37.0	37.0					15																	24921665		2203	4300	6503	SO:0001819	synonymous_variant	0			AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.651A>T	15.37:g.24921665A>T				Silent	SNP	NULL	p.S217	ENST00000329468.2	37	c.651	CCDS10015.1	15																																																																																			NPAP1	-	NULL	ENSG00000185823		0.622	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPAP1	HGNC	protein_coding	OTTHUMT00000251253.1	-	0.00	24	0	A	NM_018958		24921665	+1	tier1	-	no_errors	ENST00000329468	ensembl	human	known	74_37	silent	21.15	41	11	SNP	0.000	T
NSMF	26012	genome.wustl.edu	37	9	140344061	140344061	+	Silent	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr9:140344061G>C	ENST00000371475.3	-	15	1716	c.1485C>G	c.(1483-1485)ctC>ctG	p.L495L	NSMF_ENST00000371474.3_Silent_p.L470L|NSMF_ENST00000371472.2_Silent_p.L493L|NSMF_ENST00000392812.4_Silent_p.L472L|NSMF_ENST00000541195.1_Silent_p.L292L|NSMF_ENST00000265663.7_Silent_p.L493L|NSMF_ENST00000371473.3_Silent_p.L465L|NSMF_ENST00000437259.1_Silent_p.L472L|NSMF_ENST00000371482.1_Silent_p.L159L|NSMF_ENST00000484316.1_5'UTR|NSMF_ENST00000339554.3_Silent_p.L292L	NM_001130969.1	NP_001124441.1	Q6X4W1	NSMF_HUMAN	NMDA receptor synaptonuclear signaling and neuronal migration factor	495					cellular response to amino acid stimulus (GO:0071230)|cellular response to electrical stimulus (GO:0071257)|cellular response to gonadotropin stimulus (GO:0071371)|positive regulation of neuron migration (GO:2001224)|positive regulation of protein dephosphorylation (GO:0035307)|regulation of dendrite morphogenesis (GO:0048814)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuronal synaptic plasticity (GO:0048168)	apical dendrite (GO:0097440)|cell junction (GO:0030054)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|membrane (GO:0016020)|neuron projection (GO:0043005)|nuclear envelope (GO:0005635)|nuclear euchromatin (GO:0005719)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|perikaryon (GO:0043204)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	calcium-dependent protein binding (GO:0048306)										CTTGGGCTGAGAGCTCCAGGG	0.652																																																	0													32.0	32.0	32.0					9																	140344061		2194	4297	6491	SO:0001819	synonymous_variant	0				CCDS7044.1, CCDS48067.1, CCDS48068.1, CCDS48069.1, CCDS55357.1	9q34.3	2013-01-14	2013-01-14	2013-01-14	ENSG00000165802	ENSG00000165802			29843	protein-coding gene	gene with protein product		608137	"""nasal embryonic LHRH factor"""	NELF		11230166, 10898796	Standard	NM_015537		Approved		uc004cna.3	Q6X4W1	OTTHUMG00000020989	ENST00000371475.3:c.1485C>G	9.37:g.140344061G>C			Q2TB96|Q6X4V7|Q6X4V8|Q6X4V9|Q8N2M2|Q96SY1|Q9NPM4|Q9NPP3|Q9NPS3	Silent	SNP	superfamily_P-loop_NTPase	p.L495	ENST00000371475.3	37	c.1485	CCDS48069.1	9																																																																																			NSMF	-	NULL	ENSG00000165802		0.652	NSMF-204	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NSMF	HGNC	protein_coding		-	0.00	77	0	G	NM_015537		140344061	-1	tier1	-	no_errors	ENST00000371475	ensembl	human	known	74_37	silent	28.57	50	20	SNP	0.999	C
NUAK2	81788	genome.wustl.edu	37	1	205290713	205290713	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:205290713G>C	ENST00000367157.3	-	1	170	c.44C>G	c.(43-45)tCg>tGg	p.S15W		NM_030952.1	NP_112214.1			NUAK family, SNF1-like kinase, 2											breast(3)|kidney(3)|large_intestine(4)|lung(4)|ovary(3)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	23	Breast(84;0.186)		BRCA - Breast invasive adenocarcinoma(75;0.117)			CTCTGCGGCCGAGGGAGTGGG	0.677																																																	0													20.0	25.0	23.0					1																	205290713		2202	4299	6501	SO:0001583	missense	0			AK074830	CCDS1453.1	1q32.1	2008-02-05			ENSG00000163545	ENSG00000163545			29558	protein-coding gene	gene with protein product	"""SNF1/AMP activated protein kinase"""	608131				11230166	Standard	NM_030952		Approved	SNARK, FLJ90349	uc001hce.3	Q9H093	OTTHUMG00000037196	ENST00000367157.3:c.44C>G	1.37:g.205290713G>C	ENSP00000356125:p.Ser15Trp			Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.S15W	ENST00000367157.3	37	c.44	CCDS1453.1	1	.	.	.	.	.	.	.	.	.	.	G	17.67	3.446610	0.63178	.	.	ENSG00000163545	ENST00000367157	T	0.73152	-0.72	4.68	3.76	0.43208	.	0.730137	0.11212	N	0.587637	T	0.63604	0.2525	L	0.27053	0.805	0.09310	N	0.999991	D	0.57899	0.981	P	0.48627	0.584	T	0.54139	-0.8338	10	0.87932	D	0	.	8.4669	0.32962	0.1051:0.0:0.8949:0.0	.	15	Q9H093	NUAK2_HUMAN	W	15	ENSP00000356125:S15W	ENSP00000356125:S15W	S	-	2	0	NUAK2	203557336	0.255000	0.24002	0.617000	0.29091	0.224000	0.24922	1.438000	0.35002	1.197000	0.43143	0.561000	0.74099	TCG	NUAK2	-	NULL	ENSG00000163545		0.677	NUAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUAK2	HGNC	protein_coding	OTTHUMT00000090390.1		0.00	9	0	G	NM_030952		205290713	-1			no_errors	ENST00000367157	ensembl	human	known	74_37	missense	20.00	12	3	SNP	0.113	C
OGDH	4967	genome.wustl.edu	37	7	44664045	44664045	+	Nonsense_Mutation	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr7:44664045C>T	ENST00000222673.5	+	2	145	c.103C>T	c.(103-105)Caa>Taa	p.Q35*	OGDH_ENST00000447398.1_Nonsense_Mutation_p.Q35*|OGDH_ENST00000543843.1_5'Flank|OGDH_ENST00000439616.2_Nonsense_Mutation_p.Q35*|OGDH_ENST00000449767.1_Nonsense_Mutation_p.Q35*|OGDH_ENST00000443864.2_Nonsense_Mutation_p.Q35*|OGDH_ENST00000444676.1_Nonsense_Mutation_p.Q35*	NM_002541.3	NP_002532.2	Q02218	ODO1_HUMAN	oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)	35					2-oxoglutarate metabolic process (GO:0006103)|cellular metabolic process (GO:0044237)|cellular nitrogen compound metabolic process (GO:0034641)|cerebellar cortex development (GO:0021695)|generation of precursor metabolites and energy (GO:0006091)|glycolytic process (GO:0006096)|hippocampus development (GO:0021766)|lysine catabolic process (GO:0006554)|NADH metabolic process (GO:0006734)|olfactory bulb mitral cell layer development (GO:0061034)|pyramidal neuron development (GO:0021860)|small molecule metabolic process (GO:0044281)|striatum development (GO:0021756)|succinyl-CoA metabolic process (GO:0006104)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)|thalamus development (GO:0021794)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrion (GO:0005739)|oxoglutarate dehydrogenase complex (GO:0045252)	metal ion binding (GO:0046872)|oxoglutarate dehydrogenase (NAD+) activity (GO:0034602)|oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)	p.Q35K(1)		breast(2)|endometrium(5)|kidney(2)|large_intestine(6)|lung(13)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	36					Valproic Acid(DB00313)	TAGGACATTTCAACAGATTCG	0.468																																																	1	Substitution - Missense(1)	urinary_tract(1)											204.0	184.0	191.0					7																	44664045		2203	4300	6503	SO:0001587	stop_gained	0			D10523	CCDS34627.1, CCDS47580.1, CCDS55107.1	7p13-p11.2	2010-11-23			ENSG00000105953	ENSG00000105953	1.2.4.2		8124	protein-coding gene	gene with protein product		613022				8020988, 1542694	Standard	NM_002541		Approved	E1k	uc003tln.3	Q02218	OTTHUMG00000155304	ENST00000222673.5:c.103C>T	7.37:g.44664045C>T	ENSP00000222673:p.Gln35*		B4E2U9|D3DVL0|E9PBM1|Q96DD3|Q9UDX0	Nonsense_Mutation	SNP	pfam_DH_E1,pfam_Transketolase-like_Pyr-bd,smart_Transketolase-like_Pyr-bd,pirsf_2oxoglutarate_DH_E1,tigrfam_2oxoglutarate_DH_E1	p.Q35*	ENST00000222673.5	37	c.103	CCDS34627.1	7	.	.	.	.	.	.	.	.	.	.	C	37	6.569353	0.97671	.	.	ENSG00000105953	ENST00000439616;ENST00000443864;ENST00000449767;ENST00000447398;ENST00000419661;ENST00000444676;ENST00000222673	.	.	.	4.74	2.92	0.33932	.	0.345550	0.34460	N	0.003942	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06365	T	0.9	-7.9215	8.9464	0.35762	0.0:0.7426:0.1708:0.0866	.	.	.	.	X	35	.	ENSP00000222673:Q35X	Q	+	1	0	OGDH	44630570	1.000000	0.71417	0.852000	0.33557	0.998000	0.95712	3.737000	0.55060	0.596000	0.29794	0.655000	0.94253	CAA	OGDH	-	pirsf_2oxoglutarate_DH_E1	ENSG00000105953		0.468	OGDH-001	KNOWN	basic|CCDS	protein_coding	OGDH	HGNC	protein_coding	OTTHUMT00000339391.1	-	0.00	77	0	C			44664045	+1	tier1	-	no_errors	ENST00000222673	ensembl	human	known	74_37	nonsense	26.47	75	27	SNP	1.000	T
OPA1	4976	genome.wustl.edu	37	3	193409893	193409893	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr3:193409893G>C	ENST00000392438.3	+	28	3094	c.2860G>C	c.(2860-2862)Gaa>Caa	p.E954Q	OPA1_ENST00000361150.2_Missense_Mutation_p.E955Q|OPA1_ENST00000361715.2_Missense_Mutation_p.E973Q|OPA1_ENST00000361510.2_Missense_Mutation_p.E1009Q|OPA1_ENST00000361828.2_Missense_Mutation_p.E972Q|OPA1_ENST00000361908.3_Missense_Mutation_p.E991Q	NM_015560.2	NP_056375.2	O60313	OPA1_HUMAN	optic atrophy 1 (autosomal dominant)	954					apoptotic process (GO:0006915)|axon transport of mitochondrion (GO:0019896)|cellular senescence (GO:0090398)|GTP catabolic process (GO:0006184)|inner mitochondrial membrane organization (GO:0007007)|mitochondrial fission (GO:0000266)|mitochondrial fusion (GO:0008053)|mitochondrion organization (GO:0007005)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|neural tube closure (GO:0001843)|visual perception (GO:0007601)	dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial crista (GO:0030061)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|magnesium ion binding (GO:0000287)			breast(1)|cervix(2)|endometrium(3)|kidney(3)|large_intestine(4)|lung(15)|upper_aerodigestive_tract(1)|urinary_tract(2)	31	all_cancers(143;9.56e-09)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;9.19e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000162)		TGCTTTCATTGAAGCTCTTCA	0.279																																																	0													19.0	19.0	19.0					3																	193409893		2167	4258	6425	SO:0001583	missense	0			AB011139	CCDS33917.1, CCDS43186.1	3q29	2014-09-17			ENSG00000198836	ENSG00000198836			8140	protein-coding gene	gene with protein product	"""mitochondrial dynamin-like GTPase"", ""dynamin-like guanosine triphosphatase"", ""Dynamin-like 120 kDa protein, mitochondrial"""	605290				9490303	Standard	NM_015560		Approved	NTG, KIAA0567, FLJ12460, NPG, MGM1	uc003ftg.3	O60313	OTTHUMG00000149897	ENST00000392438.3:c.2860G>C	3.37:g.193409893G>C	ENSP00000376233:p.Glu954Gln		D3DNW4	Missense_Mutation	SNP	pfam_Dynamin_GTPase,superfamily_P-loop_NTPase,smart_Dynamin_GTPase,prints_Dynamin_SF	p.E1009Q	ENST00000392438.3	37	c.3025	CCDS43186.1	3	.	.	.	.	.	.	.	.	.	.	G	13.54	2.268749	0.40095	.	.	ENSG00000198836	ENST00000361908;ENST00000392438;ENST00000361510;ENST00000361715;ENST00000361828;ENST00000361150	D;D;D;D;D;D	0.94897	-3.13;-3.15;-3.13;-3.14;-3.14;-3.55	5.13	5.13	0.70059	.	0.103425	0.64402	D	0.000003	D	0.88440	0.6437	N	0.24115	0.695	0.58432	D	0.999998	B;P;B;B;B;B;B;B	0.37466	0.011;0.596;0.0;0.011;0.0;0.011;0.001;0.0	B;B;B;B;B;B;B;B	0.32211	0.012;0.142;0.001;0.012;0.001;0.01;0.003;0.002	D	0.87367	0.2348	10	0.13853	T	0.58	-19.8934	17.5551	0.87888	0.0:0.0:1.0:0.0	.	918;954;936;955;972;991;973;1009	E5KLK2;O60313;E5KLK0;E5KLK1;E5KLJ6;E5KLJ7;E5KLJ9;E5KLJ5	.;OPA1_HUMAN;.;.;.;.;.;.	Q	991;954;1009;973;972;955	ENSP00000354681:E991Q;ENSP00000376233:E954Q;ENSP00000355324:E1009Q;ENSP00000355311:E973Q;ENSP00000354429:E972Q;ENSP00000354781:E955Q	ENSP00000354781:E955Q	E	+	1	0	OPA1	194892587	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.678000	0.84035	2.373000	0.80994	0.650000	0.86243	GAA	OPA1	-	NULL	ENSG00000198836		0.279	OPA1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	OPA1	HGNC	protein_coding	OTTHUMT00000313812.2	-	0.00	153	0	G	NM_130837		193409893	+1	tier1	-	no_errors	ENST00000361510	ensembl	human	known	74_37	missense	15.54	125	23	SNP	1.000	C
OPLAH	26873	genome.wustl.edu	37	8	145113708	145113708	+	Silent	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr8:145113708G>A	ENST00000426825.1	-	5	636	c.555C>T	c.(553-555)cgC>cgT	p.R185R	OPLAH_ENST00000534424.1_5'UTR	NM_017570.3	NP_060040.1	O14841	OPLA_HUMAN	5-oxoprolinase (ATP-hydrolysing)	185					glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	5-oxoprolinase (ATP-hydrolyzing) activity (GO:0017168)|ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|endometrium(1)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	20	all_cancers(97;1.06e-10)|all_epithelial(106;1.5e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;2.24e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CAGCCAGGCTGCGGATGCCTC	0.682																																																	0													21.0	28.0	26.0					8																	145113708		2096	4195	6291	SO:0001819	synonymous_variant	0			AF024672, AB122018	CCDS75802.1	8q24.3	2010-11-23			ENSG00000178814	ENSG00000178814	3.5.2.9		8149	protein-coding gene	gene with protein product		614243				14993790	Standard	NM_017570		Approved	OPLA, 5-Opase	uc003zar.3	O14841		ENST00000426825.1:c.555C>T	8.37:g.145113708G>A			A5PKY8|Q75W65|Q9Y4Q0	Silent	SNP	pfam_Hydantoinase_B,pfam_Hydantoinase_A,pfam_Hydant_A_N	p.R185	ENST00000426825.1	37	c.555		8																																																																																			OPLAH	-	pfam_Hydant_A_N	ENSG00000178814		0.682	OPLAH-201	KNOWN	basic|appris_principal	protein_coding	OPLAH	HGNC	protein_coding		-	0.00	62	0	G	NM_017570		145113708	-1	tier1	-	no_errors	ENST00000426825	ensembl	human	known	74_37	silent	14.29	42	7	SNP	0.992	A
OR1C1	26188	genome.wustl.edu	37	1	247920874	247920874	+	Missense_Mutation	SNP	A	A	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:247920874A>T	ENST00000408896.2	-	1	1108	c.835T>A	c.(835-837)Tca>Aca	p.S279T		NM_012353.2	NP_036485.2	Q15619	OR1C1_HUMAN	olfactory receptor, family 1, subfamily C, member 1	279					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(32)|skin(2)|upper_aerodigestive_tract(1)	46	all_cancers(71;4.34e-05)|all_epithelial(71;1.13e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)	all_cancers(173;0.0247)	OV - Ovarian serous cystadenocarcinoma(106;0.0168)			GCCACCATTGAATACATGATG	0.483																																																	0													107.0	101.0	103.0					1																	247920874		1983	4181	6164	SO:0001583	missense	0			X89674	CCDS41481.1	1q44	2012-08-09			ENSG00000221888	ENSG00000221888		"""GPCR / Class A : Olfactory receptors"""	8182	protein-coding gene	gene with protein product						9119360	Standard	NM_012353		Approved	TPCR27, HSTPCR27	uc010pza.2	Q15619	OTTHUMG00000040198	ENST00000408896.2:c.835T>A	1.37:g.247920874A>T	ENSP00000386138:p.Ser279Thr		B9EIR9|Q5VVD2|Q6IF97|Q8NGZ1|Q96R83	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S279T	ENST00000408896.2	37	c.835	CCDS41481.1	1	.	.	.	.	.	.	.	.	.	.	A	0	-2.723466	0.00092	.	.	ENSG00000221888	ENST00000408896	T	0.00025	8.96	3.22	-0.764	0.11027	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00039	0.0001	N	0.00252	-1.77	0.09310	N	1	B	0.10296	0.003	B	0.13407	0.009	T	0.31251	-0.9950	9	0.02654	T	1	.	4.4572	0.11649	0.3394:0.0999:0.0:0.5607	.	279	Q15619	OR1C1_HUMAN	T	279	ENSP00000386138:S279T	ENSP00000386138:S279T	S	-	1	0	OR1C1	245987497	0.000000	0.05858	0.037000	0.18230	0.079000	0.17450	-0.141000	0.10327	-0.012000	0.14223	0.482000	0.46254	TCA	OR1C1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000221888		0.483	OR1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1C1	HGNC	protein_coding	OTTHUMT00000096855.1	-	0.00	30	0	A			247920874	-1	tier1	-	no_errors	ENST00000408896	ensembl	human	known	74_37	missense	17.86	23	5	SNP	0.002	T
OR11L1	391189	genome.wustl.edu	37	1	248004879	248004879	+	Missense_Mutation	SNP	A	A	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:248004879A>C	ENST00000355784.2	-	1	375	c.320T>G	c.(319-321)cTc>cGc	p.L107R		NM_001001959.1	NP_001001959.1	Q8NGX0	O11L1_HUMAN	olfactory receptor, family 11, subfamily L, member 1	107						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(4)|kidney(5)|large_intestine(5)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	57	all_cancers(71;8.78e-05)|all_epithelial(71;9.15e-06)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			GGTGGCGCCGAGGAATACGAA	0.602																																																	0													54.0	46.0	49.0					1																	248004879		2203	4300	6503	SO:0001583	missense	0			AB065646	CCDS31098.1	1q44	2013-09-24			ENSG00000197591	ENSG00000197591		"""GPCR / Class A : Olfactory receptors"""	14998	protein-coding gene	gene with protein product							Standard	NM_001001959		Approved		uc001idn.1	Q8NGX0	OTTHUMG00000040193	ENST00000355784.2:c.320T>G	1.37:g.248004879A>C	ENSP00000348033:p.Leu107Arg			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.L107R	ENST00000355784.2	37	c.320	CCDS31098.1	1	.	.	.	.	.	.	.	.	.	.	A	10.46	1.356789	0.24598	.	.	ENSG00000197591	ENST00000355784	T	0.01335	5.0	4.2	4.2	0.49525	GPCR, rhodopsin-like superfamily (1);	0.000000	0.37437	U	0.002099	T	0.09992	0.0245	H	0.94582	3.555	0.09310	N	1	D	0.71674	0.998	D	0.65233	0.933	T	0.09596	-1.0667	10	0.87932	D	0	.	8.2183	0.31526	0.9079:0.0:0.0921:0.0	.	107	Q8NGX0	O11L1_HUMAN	R	107	ENSP00000348033:L107R	ENSP00000348033:L107R	L	-	2	0	OR11L1	246071502	0.005000	0.15991	0.140000	0.22221	0.006000	0.05464	1.697000	0.37784	1.889000	0.54706	0.443000	0.29094	CTC	OR11L1	-	pfam_GPCR_Rhodpsn,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000197591		0.602	OR11L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR11L1	HGNC	protein_coding	OTTHUMT00000096850.1	-	0.00	29	0	A	NM_001001959		248004879	-1	tier1	-	no_errors	ENST00000355784	ensembl	human	known	74_37	missense	26.32	14	5	SNP	0.301	C
OR3A3	8392	genome.wustl.edu	37	17	3324821	3324821	+	Silent	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr17:3324821G>A	ENST00000291231.1	+	1	960	c.960G>A	c.(958-960)ctG>ctA	p.L320L		NM_012373.2	NP_036505.2	P47888	OR3A3_HUMAN	olfactory receptor, family 3, subfamily A, member 3	320					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(3)|prostate(1)	9						AGCGATCACTGACCTGAGAGA	0.453																																																	0													68.0	71.0	70.0					17																	3324821		2203	4300	6503	SO:0001819	synonymous_variant	0			U04688	CCDS11025.1	17p13.3	2012-08-09			ENSG00000159961	ENSG00000159961		"""GPCR / Class A : Olfactory receptors"""	8284	protein-coding gene	gene with protein product				OR3A6, OR3A7, OR3A8P		8004088, 9500546	Standard	NM_012373		Approved	OR17-201, OR17-137, OR17-16	uc010vrd.2	P47888	OTTHUMG00000090649	ENST00000291231.1:c.960G>A	17.37:g.3324821G>A			Q2VPE4|Q6IFM6|Q9P1Q4|Q9UBE7	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L320	ENST00000291231.1	37	c.960	CCDS11025.1	17																																																																																			OR3A3	-	NULL	ENSG00000159961		0.453	OR3A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR3A3	HGNC	protein_coding	OTTHUMT00000207309.1	-	0.00	42	0	G			3324821	+1	tier1	-	no_errors	ENST00000291231	ensembl	human	known	74_37	silent	45.24	23	19	SNP	0.001	A
OR51S1	119692	genome.wustl.edu	37	11	4870196	4870196	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr11:4870196C>G	ENST00000322101.2	-	1	318	c.243G>C	c.(241-243)ttG>ttC	p.L81F	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001004758.1	NP_001004758.1	Q8NGJ8	O51S1_HUMAN	olfactory receptor, family 51, subfamily S, member 1	81						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L81F(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(15)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	33		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)		GGGCAGTGACCAATCCAATAT	0.552																																																	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)											123.0	101.0	108.0					11																	4870196		2201	4298	6499	SO:0001583	missense	0			AB065796	CCDS31362.1	11p15.4	2012-08-09			ENSG00000176922	ENSG00000176922		"""GPCR / Class A : Olfactory receptors"""	15204	protein-coding gene	gene with protein product							Standard	NM_001004758		Approved		uc010qyo.2	Q8NGJ8	OTTHUMG00000066506	ENST00000322101.2:c.243G>C	11.37:g.4870196C>G	ENSP00000322754:p.Leu81Phe		B9EGZ1|Q6IFI2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L81F	ENST00000322101.2	37	c.243	CCDS31362.1	11	.	.	.	.	.	.	.	.	.	.	C	8.864	0.947630	0.18356	.	.	ENSG00000176922	ENST00000322101	T	0.02944	4.1	4.85	0.706	0.18133	GPCR, rhodopsin-like superfamily (1);	0.000000	0.33005	N	0.005390	T	0.04318	0.0119	L	0.45698	1.435	0.19300	N	0.99998	P	0.40931	0.733	P	0.46758	0.526	T	0.28427	-1.0044	10	0.87932	D	0	-7.04	5.3435	0.15996	0.0:0.4722:0.27:0.2578	.	81	Q8NGJ8	O51S1_HUMAN	F	81	ENSP00000322754:L81F	ENSP00000322754:L81F	L	-	3	2	OR51S1	4826772	0.000000	0.05858	0.121000	0.21740	0.027000	0.11550	0.161000	0.16481	-0.027000	0.13873	-0.253000	0.11424	TTG	OR51S1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000176922		0.552	OR51S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51S1	HGNC	protein_coding	OTTHUMT00000142179.1		0.00	15	0	C	NM_001004758		4870196	-1			no_errors	ENST00000322101	ensembl	human	known	74_37	missense	7.89	35	3	SNP	0.055	G
OR4C3	256144	genome.wustl.edu	37	11	48346987	48346987	+	Silent	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr11:48346987C>G	ENST00000319856.4	+	1	516	c.495C>G	c.(493-495)ctC>ctG	p.L165L		NM_001004702.1	NP_001004702.1	Q8NH37	OR4C3_HUMAN	olfactory receptor, family 4, subfamily C, member 3	138						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(18)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	32						CCAGGCATCTCTGTGCCATGC	0.537																																																	0													143.0	137.0	139.0					11																	48346987		2201	4298	6499	SO:0001819	synonymous_variant	0			AB065567	CCDS31489.1	11p11.2	2012-08-09				ENSG00000176547		"""GPCR / Class A : Olfactory receptors"""	14697	protein-coding gene	gene with protein product							Standard	NM_001004702		Approved		uc010rhv.2	Q8NH37	OTTHUMG00000166579	ENST00000319856.4:c.495C>G	11.37:g.48346987C>G			B2RNF2|Q6IFB3	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L165	ENST00000319856.4	37	c.495	CCDS31489.1	11																																																																																			OR4C3	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000176547		0.537	OR4C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C3	HGNC	protein_coding	OTTHUMT00000390557.1	-	0.00	42	0	C	NM_001004702		48346987	+1	tier1	-	no_errors	ENST00000319856	ensembl	human	known	74_37	silent	11.11	40	5	SNP	0.270	G
OR5D13	390142	genome.wustl.edu	37	11	55541134	55541134	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr11:55541134G>T	ENST00000361760.1	+	1	221	c.221G>T	c.(220-222)tGt>tTt	p.C74F		NM_001001967.1	NP_001001967.1	Q8NGL4	OR5DD_HUMAN	olfactory receptor, family 5, subfamily D, member 13	74						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(1)|lung(20)|ovary(1)|pancreas(2)|skin(2)|stomach(1)|urinary_tract(1)	40		all_epithelial(135;0.196)				ACAGACTTCTGTTTTTCCACT	0.393																																																	0													173.0	161.0	165.0					11																	55541134		2200	4296	6496	SO:0001583	missense	0			BK004394	CCDS31507.1	11q11	2012-08-09			ENSG00000198877	ENSG00000198877		"""GPCR / Class A : Olfactory receptors"""	15280	protein-coding gene	gene with protein product							Standard	NM_001001967		Approved		uc010ril.2	Q8NGL4	OTTHUMG00000166807	ENST00000361760.1:c.221G>T	11.37:g.55541134G>T	ENSP00000354800:p.Cys74Phe		Q6IF68|Q6IFC9	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.C74F	ENST00000361760.1	37	c.221	CCDS31507.1	11	.	.	.	.	.	.	.	.	.	.	G	3.745	-0.052840	0.07362	.	.	ENSG00000198877	ENST00000361760	T	0.16897	2.31	3.52	2.5	0.30297	GPCR, rhodopsin-like superfamily (1);	0.221905	0.23008	U	0.052994	T	0.36991	0.0987	M	0.77820	2.39	0.09310	N	0.999995	D	0.89917	1.0	D	0.76071	0.987	T	0.02837	-1.1104	10	0.87932	D	0	-11.7867	7.6387	0.28282	0.0:0.1751:0.6461:0.1788	.	74	Q8NGL4	OR5DD_HUMAN	F	74	ENSP00000354800:C74F	ENSP00000354800:C74F	C	+	2	0	OR5D13	55297710	0.002000	0.14202	0.900000	0.35374	0.010000	0.07245	1.269000	0.33074	2.001000	0.58596	0.486000	0.48141	TGT	OR5D13	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000198877		0.393	OR5D13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5D13	HGNC	protein_coding	OTTHUMT00000391511.1		0.00	36	0	G	NM_001001967		55541134	+1			no_errors	ENST00000361760	ensembl	human	known	74_37	missense	6.12	46	3	SNP	0.154	T
OR5I1	10798	genome.wustl.edu	37	11	55703532	55703532	+	Silent	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr11:55703532G>A	ENST00000301532.3	-	1	344	c.345C>T	c.(343-345)ttC>ttT	p.F115F		NM_006637.1	NP_006628.1	Q13606	OR5I1_HUMAN	olfactory receptor, family 5, subfamily I, member 1	115					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(34)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	52						CGGCCAGGATGAAGGATTCTG	0.433																																																	0													49.0	52.0	51.0					11																	55703532		2201	4292	6493	SO:0001819	synonymous_variant	0			BC069093	CCDS7949.1	11q11	2012-08-09			ENSG00000167825	ENSG00000167825		"""GPCR / Class A : Olfactory receptors"""	8347	protein-coding gene	gene with protein product		608496				9017400, 9787077	Standard	NM_006637		Approved	HSOlf1, OLF1	uc010ris.2	Q13606	OTTHUMG00000166821	ENST00000301532.3:c.345C>T	11.37:g.55703532G>A			Q6IEU4	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F115	ENST00000301532.3	37	c.345	CCDS7949.1	11																																																																																			OR5I1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000167825		0.433	OR5I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5I1	HGNC	protein_coding	OTTHUMT00000391528.1	-	0.00	44	0	G	NM_006637		55703532	-1	tier1	-	no_errors	ENST00000301532	ensembl	human	known	74_37	silent	29.41	36	15	SNP	0.031	A
OR7C2	26658	genome.wustl.edu	37	19	15052578	15052578	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr19:15052578C>G	ENST00000248072.3	+	1	278	c.278C>G	c.(277-279)aCt>aGt	p.T93S		NM_012377.1	NP_036509.1	O60412	OR7C2_HUMAN	olfactory receptor, family 7, subfamily C, member 2	93						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(3)|lung(8)|ovary(2)|skin(2)	15	Ovarian(108;0.203)					AAAATGATCACTTTTGCAGGC	0.458																																																	0													60.0	56.0	57.0					19																	15052578		2203	4300	6503	SO:0001583	missense	0			U86255	CCDS12320.1	19p13.1	2012-08-09				ENSG00000127529		"""GPCR / Class A : Olfactory receptors"""	8374	protein-coding gene	gene with protein product				OR7C3			Standard	NM_012377		Approved	OR19-18	uc010xoc.2	O60412		ENST00000248072.3:c.278C>G	19.37:g.15052578C>G	ENSP00000248072:p.Thr93Ser		O43881|Q6IFP9	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.T93S	ENST00000248072.3	37	c.278	CCDS12320.1	19	.	.	.	.	.	.	.	.	.	.	c	0.017	-1.490394	0.01018	.	.	ENSG00000127529	ENST00000248072	T	0.00011	9.37	4.19	1.93	0.25924	GPCR, rhodopsin-like superfamily (1);	0.366777	0.19461	N	0.113688	T	0.00039	0.0001	N	0.00538	-1.39	0.09310	N	1	B	0.23058	0.079	B	0.19946	0.027	T	0.01512	-1.1336	10	0.10111	T	0.7	.	12.036	0.53425	0.0:0.6652:0.3348:0.0	.	93	O60412	OR7C2_HUMAN	S	93	ENSP00000248072:T93S	ENSP00000248072:T93S	T	+	2	0	OR7C2	14913578	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	1.297000	0.33400	0.485000	0.27652	0.514000	0.50259	ACT	OR7C2	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000127529		0.458	OR7C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR7C2	HGNC	protein_coding	OTTHUMT00000466281.1	-	0.00	59	0	C			15052578	+1	tier1	-	no_errors	ENST00000248072	ensembl	human	known	74_37	missense	35.71	27	15	SNP	0.005	G
OR8K3	219473	genome.wustl.edu	37	11	56085848	56085848	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr11:56085848G>C	ENST00000312711.1	+	1	66	c.66G>C	c.(64-66)gaG>gaC	p.E22D		NM_001005202.1	NP_001005202.1	Q8NH51	OR8K3_HUMAN	olfactory receptor, family 8, subfamily K, member 3	22						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(2)|endometrium(3)|large_intestine(6)|liver(2)|lung(15)|ovary(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	40	Esophageal squamous(21;0.00448)					ATATCGCTGAGCTGCAGGCAC	0.433																																																	0													180.0	162.0	168.0					11																	56085848		2201	4296	6497	SO:0001583	missense	0			AB065541	CCDS31527.1	11q11	2012-08-09			ENSG00000181689	ENSG00000181689		"""GPCR / Class A : Olfactory receptors"""	15313	protein-coding gene	gene with protein product							Standard	NM_001005202		Approved		uc010rjf.2	Q8NH51	OTTHUMG00000166855	ENST00000312711.1:c.66G>C	11.37:g.56085848G>C	ENSP00000323555:p.Glu22Asp		Q6IFC4	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.E22D	ENST00000312711.1	37	c.66	CCDS31527.1	11	.	.	.	.	.	.	.	.	.	.	G	6.280	0.419770	0.11928	.	.	ENSG00000181689	ENST00000312711	T	0.00433	7.43	4.84	1.98	0.26296	.	0.203064	0.34338	N	0.004054	T	0.00300	0.0009	L	0.33245	0.995	0.09310	N	0.999999	B	0.22800	0.075	B	0.23852	0.049	T	0.41858	-0.9485	10	0.42905	T	0.14	.	9.6359	0.39806	0.248:0.0:0.752:0.0	.	22	Q8NH51	OR8K3_HUMAN	D	22	ENSP00000323555:E22D	ENSP00000323555:E22D	E	+	3	2	OR8K3	55842424	.	.	0.987000	0.45799	0.002000	0.02628	.	.	0.762000	0.33152	-0.154000	0.13518	GAG	OR8K3	-	NULL	ENSG00000181689		0.433	OR8K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8K3	HGNC	protein_coding	OTTHUMT00000391602.1	-	0.00	45	0	G	NM_001005202		56085848	+1	tier1	-	no_errors	ENST00000312711	ensembl	human	known	74_37	missense	29.82	40	17	SNP	0.380	C
OR8K3	219473	genome.wustl.edu	37	11	56086442	56086442	+	Silent	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr11:56086442C>T	ENST00000312711.1	+	1	660	c.660C>T	c.(658-660)ctC>ctT	p.L220L		NM_001005202.1	NP_001005202.1	Q8NH51	OR8K3_HUMAN	olfactory receptor, family 8, subfamily K, member 3	220						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(2)|endometrium(3)|large_intestine(6)|liver(2)|lung(15)|ovary(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	40	Esophageal squamous(21;0.00448)					CTTACCTGCTCATCCTTGTAG	0.388																																																	0													94.0	91.0	92.0					11																	56086442		2201	4295	6496	SO:0001819	synonymous_variant	0			AB065541	CCDS31527.1	11q11	2012-08-09			ENSG00000181689	ENSG00000181689		"""GPCR / Class A : Olfactory receptors"""	15313	protein-coding gene	gene with protein product							Standard	NM_001005202		Approved		uc010rjf.2	Q8NH51	OTTHUMG00000166855	ENST00000312711.1:c.660C>T	11.37:g.56086442C>T			Q6IFC4	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L220	ENST00000312711.1	37	c.660	CCDS31527.1	11																																																																																			OR8K3	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000181689		0.388	OR8K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8K3	HGNC	protein_coding	OTTHUMT00000391602.1		0.00	35	0	C	NM_001005202		56086442	+1			no_errors	ENST00000312711	ensembl	human	known	74_37	silent	9.09	40	4	SNP	0.001	T
OSR2	116039	genome.wustl.edu	37	8	99961177	99961177	+	5'UTR	SNP	G	G	C	rs376602714		TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr8:99961177G>C	ENST00000297565.4	+	0	493				OSR2_ENST00000457907.2_Silent_p.R120R|OSR2_ENST00000435298.2_5'UTR|OSR2_ENST00000522510.1_5'UTR|OSR2_ENST00000523368.1_5'UTR	NM_001142462.1	NP_001135934.1	Q8N2R0	OSR2_HUMAN	odd-skipped related transciption factor 2						bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|chondrocyte differentiation (GO:0002062)|embryo development (GO:0009790)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic skeletal joint development (GO:0072498)|embryonic skeletal joint morphogenesis (GO:0060272)|embryonic skeletal limb joint morphogenesis (GO:0036023)|embryonic skeletal system morphogenesis (GO:0048704)|eyelid development in camera-type eye (GO:0061029)|head development (GO:0060322)|mesonephros development (GO:0001823)|metanephros development (GO:0001656)|middle ear morphogenesis (GO:0042474)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis (GO:0042476)|osteoblast proliferation (GO:0033687)|palate development (GO:0060021)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gastrulation (GO:2000543)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephros development (GO:0048793)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(14)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	Breast(36;4.14e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.0136)			CAGCATCCCGGAAAATGGGGA	0.627																																																	0													38.0	42.0	41.0					8																	99961177		1976	4154	6130	SO:0001623	5_prime_UTR_variant	0			AY038072	CCDS47901.1, CCDS47902.1, CCDS69520.1	8q22.2	2013-10-17	2013-10-17			ENSG00000164920		"""Zinc fingers, C2H2-type"""	15830	protein-coding gene	gene with protein product		611297	"""odd-skipped related 2 (Drosophila)"""				Standard	XM_005250779		Approved	FLJ90037	uc003yir.3	Q8N2R0		ENST00000297565.4:c.-4G>C	8.37:g.99961177G>C			A8K626|B4E3B7|Q96AM6|Q96LB6|Q96LB7	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R120	ENST00000297565.4	37	c.360	CCDS47901.1	8																																																																																			OSR2	-	NULL	ENSG00000164920		0.627	OSR2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	OSR2	HGNC	protein_coding	OTTHUMT00000379505.1	-	0.00	35	0	G	NM_053001		99961177	+1	tier1	-	no_errors	ENST00000457907	ensembl	human	known	74_37	silent	18.75	25	6	SNP	0.835	C
OXCT2	64064	genome.wustl.edu	37	1	40236869	40236869	+	Nonsense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:40236869G>C	ENST00000327582.5	-	1	151	c.59C>G	c.(58-60)tCa>tGa	p.S20*	BMP8B_ENST00000397360.2_Intron|BMP8B_ENST00000372827.3_Intron	NM_022120.1	NP_071403.1	Q9BYC2	SCOT2_HUMAN	3-oxoacid CoA transferase 2	20					ketone body catabolic process (GO:0046952)	mitochondrion (GO:0005739)|motile cilium (GO:0031514)	3-oxoacid CoA-transferase activity (GO:0008260)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|pancreas(1)|upper_aerodigestive_tract(1)	6	all_cancers(7;5.56e-14)|all_lung(5;3.88e-17)|all_epithelial(6;3.78e-16)|Lung NSC(20;7.03e-07)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;1.87e-18)|Epithelial(16;1.92e-17)|all cancers(16;4.03e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)		Succinic acid(DB00139)	CGCGAGCCCTGAGCCGCCGGC	0.726																																																	0													2.0	2.0	2.0					1																	40236869		1192	2341	3533	SO:0001587	stop_gained	0			AB050193	CCDS445.1	1p34	2008-02-05			ENSG00000198754	ENSG00000198754			18606	protein-coding gene	gene with protein product		610289				11214971, 11756565	Standard	NM_022120		Approved	FKSG25, FLJ00030, SCOT-T	uc001ceb.1	Q9BYC2	OTTHUMG00000009249	ENST00000327582.5:c.59C>G	1.37:g.40236869G>C	ENSP00000361914:p.Ser20*		B2RBB4|Q5QPK4|Q8NHR1|Q9H1I4	Nonsense_Mutation	SNP	pfam_CoA_trans_fam_I,smart_CoA_trans_fam_I,pirsf_3-oxoacid_CoA-transferase,tigrfam_3-oxoacid_CoA-transf_B,tigrfam_3-oxoacid_CoA-transf_A	p.S20*	ENST00000327582.5	37	c.59	CCDS445.1	1	.	.	.	.	.	.	.	.	.	.	g	16.58	3.163102	0.57476	.	.	ENSG00000198754	ENST00000327582;ENST00000542949	.	.	.	2.1	1.17	0.20885	.	1.181910	0.06656	U	0.763717	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	.	4.6155	0.12424	0.1927:0.0:0.8073:0.0	.	.	.	.	X	20	.	ENSP00000361914:S20X	S	-	2	0	OXCT2	40009456	0.007000	0.16637	0.001000	0.08648	0.005000	0.04900	0.324000	0.19610	0.439000	0.26476	0.401000	0.26515	TCA	OXCT2	-	NULL	ENSG00000198754		0.726	OXCT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OXCT2	HGNC	protein_coding	OTTHUMT00000025656.1		0.00	9	0	G	NM_022120		40236869	-1			no_errors	ENST00000327582	ensembl	human	known	74_37	nonsense	37.50	5	3	SNP	0.001	C
OXSR1	9943	genome.wustl.edu	37	3	38240282	38240282	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr3:38240282C>G	ENST00000446845.1	+	4	734	c.362C>G	c.(361-363)tCt>tGt	p.S121C	OXSR1_ENST00000311806.3_Missense_Mutation_p.S121C					oxidative stress responsive 1											skin(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)		CTAGATGAATCTACCATTGCT	0.373																																																	0													155.0	146.0	149.0					3																	38240282		2203	4300	6503	SO:0001583	missense	0			AB017642	CCDS2675.1	3p22.2	2013-05-17	2013-05-17	2004-11-26	ENSG00000172939	ENSG00000172939			8508	protein-coding gene	gene with protein product		604046	"""oxidative-stress responsive 1"""	OSR1		10083736	Standard	XM_005265638		Approved	KIAA1101	uc003chy.3	O95747	OTTHUMG00000131084	ENST00000446845.1:c.362C>G	3.37:g.38240282C>G	ENSP00000415851:p.Ser121Cys			Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase_OSR1/WNK_CCT,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.S121C	ENST00000446845.1	37	c.362		3	.	.	.	.	.	.	.	.	.	.	C	22.4	4.282050	0.80692	.	.	ENSG00000172939	ENST00000446845;ENST00000311806	T;T	0.66460	-0.21;-0.21	4.43	4.43	0.53597	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.529047	0.21001	N	0.081867	T	0.74876	0.3774	M	0.70108	2.13	0.34348	D	0.689487	P;B	0.37207	0.587;0.282	P;B	0.47162	0.54;0.378	D	0.84171	0.0434	10	0.62326	D	0.03	0.2004	16.4269	0.83817	0.0:1.0:0.0:0.0	.	121;121	C9JIG9;O95747	.;OXSR1_HUMAN	C	121	ENSP00000415851:S121C;ENSP00000311713:S121C	ENSP00000311713:S121C	S	+	2	0	OXSR1	38215286	0.776000	0.28616	0.394000	0.26270	0.991000	0.79684	7.180000	0.77674	2.173000	0.68751	0.563000	0.77884	TCT	OXSR1	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000172939		0.373	OXSR1-004	NOVEL	basic|exp_conf	protein_coding	OXSR1	HGNC	protein_coding	OTTHUMT00000342708.1	-	0.00	94	0	C	NM_005109		38240282	+1	tier1	-	no_errors	ENST00000311806	ensembl	human	known	74_37	missense	29.69	45	19	SNP	0.956	G
PAPD4	167153	genome.wustl.edu	37	5	78940966	78940966	+	Missense_Mutation	SNP	C	C	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr5:78940966C>A	ENST00000296783.3	+	9	1071	c.772C>A	c.(772-774)Cag>Aag	p.Q258K	PAPD4_ENST00000423041.2_Missense_Mutation_p.Q254K|PAPD4_ENST00000453514.1_Missense_Mutation_p.Q258K|PAPD4_ENST00000504233.1_Missense_Mutation_p.Q258K|PAPD4_ENST00000428308.2_Missense_Mutation_p.Q258K			Q6PIY7	GLD2_HUMAN	PAP associated domain containing 4	258					hematopoietic progenitor cell differentiation (GO:0002244)|histone mRNA catabolic process (GO:0071044)|mRNA processing (GO:0006397)|RNA polyadenylation (GO:0043631)	cytoplasm (GO:0005737)|nuclear RNA-directed RNA polymerase complex (GO:0031380)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|polynucleotide adenylyltransferase activity (GO:0004652)			biliary_tract(1)|breast(2)|endometrium(4)|kidney(3)|large_intestine(9)|lung(4)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	29		Lung NSC(167;0.00293)|all_lung(232;0.00323)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;8.61e-47)|Epithelial(54;1.32e-41)|all cancers(79;2.45e-36)		TGAGAGACCTCAGCTGATTCG	0.338																																																	0													91.0	93.0	92.0					5																	78940966		2203	4300	6503	SO:0001583	missense	0			AL833136	CCDS4048.1, CCDS75265.1, CCDS75266.1	5q14.1	2014-03-21			ENSG00000164329	ENSG00000164329			26776	protein-coding gene	gene with protein product	"""TUTase2"""	614121				12477932	Standard	NM_173797		Approved	FLJ38499, GLD2, TUT2	uc003kgb.2	Q6PIY7	OTTHUMG00000108163	ENST00000296783.3:c.772C>A	5.37:g.78940966C>A	ENSP00000296783:p.Gln258Lys		Q86WZ2|Q8N927	Missense_Mutation	SNP	pfam_PAP_assoc	p.Q258K	ENST00000296783.3	37	c.772	CCDS4048.1	5	.	.	.	.	.	.	.	.	.	.	C	25.7	4.669501	0.88348	.	.	ENSG00000164329	ENST00000453514;ENST00000423041;ENST00000504233;ENST00000428308;ENST00000296783	T;T;T;T;T	0.43688	0.94;0.94;0.94;0.94;0.94	5.72	5.72	0.89469	.	0.114823	0.64402	D	0.000004	T	0.52306	0.1726	L	0.52759	1.655	0.54753	D	0.999988	B;P;D	0.62365	0.23;0.544;0.991	B;B;P	0.58820	0.122;0.241;0.846	T	0.39961	-0.9588	10	0.05959	T	0.93	-7.8654	19.8629	0.96790	0.0:1.0:0.0:0.0	.	258;254;258	Q6PIY7;Q6PIY7-2;D6RAF2	GLD2_HUMAN;.;.	K	258;254;258;258;258	ENSP00000397563:Q258K;ENSP00000393412:Q254K;ENSP00000421966:Q258K;ENSP00000396861:Q258K;ENSP00000296783:Q258K	ENSP00000296783:Q258K	Q	+	1	0	PAPD4	78976722	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.713000	0.68415	2.690000	0.91761	0.573000	0.79308	CAG	PAPD4	-	NULL	ENSG00000164329		0.338	PAPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPD4	HGNC	protein_coding	OTTHUMT00000226967.1	-	0.00	78	0	C	NM_173797		78940966	+1	tier1	-	no_errors	ENST00000296783	ensembl	human	known	74_37	missense	14.75	52	9	SNP	1.000	A
PCDHGA1	56114	genome.wustl.edu	37	5	140710522	140710522	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr5:140710522G>C	ENST00000517417.1	+	1	271	c.271G>C	c.(271-273)Gac>Cac	p.D91H	PCDHGA1_ENST00000378105.3_Missense_Mutation_p.D91H|AC005618.6_ENST00000606901.1_lincRNA	NM_018912.2	NP_061735.1	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1	91	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D91N(2)		breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|lung(32)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCGCAGGATAGACCGGGAGGA	0.512																																																	2	Substitution - Missense(2)	lung(2)											110.0	123.0	118.0					5																	140710522		2203	4300	6503	SO:0001583	missense	0			AF152318	CCDS54922.1	5q31	2010-01-26				ENSG00000204956		"""Cadherins / Protocadherins : Clustered"""	8696	other	protocadherin		606288				10380929	Standard	NM_018912		Approved	PCDH-GAMMA-A1		Q9Y5H4		ENST00000517417.1:c.271G>C	5.37:g.140710522G>C	ENSP00000431083:p.Asp91His		Q2M273|Q9Y5D6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.D91H	ENST00000517417.1	37	c.271	CCDS54922.1	5	.	.	.	.	.	.	.	.	.	.	G	21.5	4.164981	0.78339	.	.	ENSG00000204956	ENST00000517417;ENST00000378105	T;T	0.53640	0.61;0.61	4.37	4.37	0.52481	Cadherin, N-terminal (1);Cadherin (4);Cadherin-like (1);	0.000000	0.51477	D	0.000085	D	0.83552	0.5279	H	0.99874	4.875	0.43355	D	0.995425	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.91743	0.5406	10	0.87932	D	0	.	17.0903	0.86620	0.0:0.0:1.0:0.0	.	91;91	Q9Y5H4-2;Q9Y5H4	.;PCDG1_HUMAN	H	91	ENSP00000431083:D91H;ENSP00000367345:D91H	ENSP00000367345:D91H	D	+	1	0	PCDHGA1	140690706	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.601000	0.98297	2.432000	0.82394	0.655000	0.94253	GAC	PCDHGA1	-	pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000204956		0.512	PCDHGA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDHGA1	HGNC	protein_coding	OTTHUMT00000374737.1	-	0.00	29	0	G	NM_018912		140710522	+1	tier1	-	no_errors	ENST00000517417	ensembl	human	known	74_37	missense	15.62	27	5	SNP	1.000	C
PCDHGA3	56112	genome.wustl.edu	37	5	140723799	140723799	+	Missense_Mutation	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr5:140723799G>A	ENST00000253812.6	+	1	199	c.199G>A	c.(199-201)Gtc>Atc	p.V67I	PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_018916.3|NM_032011.1	NP_061739.2|NP_114400.1	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3	67	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGTCCGCATCGTCTCCAGAGG	0.617											OREG0016855	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													75.0	88.0	83.0					5																	140723799		2177	4291	6468	SO:0001583	missense	0			AF152510	CCDS47290.1, CCDS75329.1	5q31	2010-01-26			ENSG00000254245	ENSG00000254245		"""Cadherins / Protocadherins : Clustered"""	8701	other	protocadherin		606290				10380929	Standard	NM_032011		Approved	PCDH-GAMMA-A3		Q9Y5H0	OTTHUMG00000163680	ENST00000253812.6:c.199G>A	5.37:g.140723799G>A	ENSP00000253812:p.Val67Ile	1658	Q9Y5D4	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.V67I	ENST00000253812.6	37	c.199	CCDS47290.1	5	.	.	.	.	.	.	.	.	.	.	.	9.145	1.014702	0.19355	.	.	ENSG00000254245	ENST00000253812	T	0.30714	1.52	5.65	1.84	0.25277	Cadherin, N-terminal (1);Cadherin (3);Cadherin-like (1);	0.279637	0.18363	N	0.143518	T	0.23014	0.0556	L	0.54323	1.7	0.20074	N	0.999931	B;B	0.31680	0.335;0.019	B;B	0.27500	0.075;0.08	T	0.12091	-1.0561	10	0.30078	T	0.28	.	6.289	0.21049	0.29:0.1242:0.5858:0.0	.	67;67	Q9Y5H0-2;Q9Y5H0	.;PCDG3_HUMAN	I	67	ENSP00000253812:V67I	ENSP00000253812:V67I	V	+	1	0	PCDHGA3	140703983	0.000000	0.05858	1.000000	0.80357	0.398000	0.30690	-0.126000	0.10563	0.407000	0.25591	0.655000	0.94253	GTC	PCDHGA3	-	pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000254245		0.617	PCDHGA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA3	HGNC	protein_coding	OTTHUMT00000377017.1	-	0.00	51	0	G	NM_018916		140723799	+1	tier1	-	no_errors	ENST00000253812	ensembl	human	known	74_37	missense	15.00	34	6	SNP	0.964	A
PCDHGA9	56107	genome.wustl.edu	37	5	140783516	140783516	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr5:140783516G>C	ENST00000573521.1	+	1	997	c.997G>C	c.(997-999)Gtg>Ctg	p.V333L	PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB3_ENST00000576222.1_Intron	NM_018921.2|NM_032089.1	NP_061744.1|NP_114478.1	Q9Y5G4	PCDG9_HUMAN	protocadherin gamma subfamily A, 9	333	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGGACAAAAGTGCTCATTTC	0.398																																																	0													146.0	146.0	146.0					5																	140783516		1943	4139	6082	SO:0001583	missense	0			AF152516	CCDS58981.1, CCDS75341.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8707	other	protocadherin		606296				10380929	Standard	NM_018921		Approved	PCDH-GAMMA-A9		Q9Y5G4		ENST00000573521.1:c.997G>C	5.37:g.140783516G>C	ENSP00000460274:p.Val333Leu		A2RU65|Q9Y5C9	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.V333L	ENST00000573521.1	37	c.997	CCDS58981.1	5																																																																																			PCDHGA9	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000261934		0.398	PCDHGA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA9	HGNC	protein_coding	OTTHUMT00000437105.1	-	0.00	59	0	G	NM_018921		140783516	+1	tier1	-	no_errors	ENST00000573521	ensembl	human	known	74_37	missense	12.50	28	4	SNP	1.000	C
PCDHGB7	56099	genome.wustl.edu	37	5	140798107	140798107	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr5:140798107G>C	ENST00000398594.2	+	1	681	c.681G>C	c.(679-681)caG>caC	p.Q227H	PCDHGA11_ENST00000518882.1_5'Flank|PCDHGA10_ENST00000398610.2_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA11_ENST00000398587.2_5'Flank|PCDHGA9_ENST00000573521.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB3_ENST00000576222.1_Intron	NM_018927.3	NP_061750.1	Q9Y5F8	PCDGJ_HUMAN	protocadherin gamma subfamily B, 7	227	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(13)|lung(15)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(3)	56			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTACTGCTCAGATAAGAATCC	0.557																																																	0													84.0	85.0	84.0					5																	140798107		1969	4169	6138	SO:0001583	missense	0			AF152523	CCDS47293.1, CCDS75344.1	5q31	2010-01-26			ENSG00000254122	ENSG00000254122		"""Cadherins / Protocadherins : Clustered"""	8714	other	protocadherin	"""cadherin ME6"""	606304				10380929	Standard	NM_032101		Approved	ME6, PCDH-GAMMA-B7		Q9Y5F8	OTTHUMG00000164054	ENST00000398594.2:c.681G>C	5.37:g.140798107G>C	ENSP00000381594:p.Gln227His		Q9UN63	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.Q227H	ENST00000398594.2	37	c.681	CCDS47293.1	5	.	.	.	.	.	.	.	.	.	.	g	8.975	0.973886	0.18736	.	.	ENSG00000254122	ENST00000398594	T	0.54279	0.58	5.7	2.53	0.30540	Cadherin (4);Cadherin-like (1);	0.667503	0.11132	U	0.596254	T	0.51873	0.1700	M	0.70275	2.135	0.22066	N	0.999383	B;B	0.20459	0.045;0.036	B;B	0.26614	0.071;0.042	T	0.46624	-0.9178	10	0.35671	T	0.21	.	9.427	0.38586	0.3725:0.0:0.6275:0.0	.	227;227	Q9Y5F8;Q9Y5F8-2	PCDGJ_HUMAN;.	H	227	ENSP00000381594:Q227H	ENSP00000381594:Q227H	Q	+	3	2	PCDHGB7	140778291	0.000000	0.05858	0.953000	0.39169	0.805000	0.45488	-0.556000	0.05992	0.780000	0.33566	0.561000	0.74099	CAG	PCDHGB7	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000254122		0.557	PCDHGB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB7	HGNC	protein_coding	OTTHUMT00000376973.1	-	0.00	83	0	G	NM_018927		140798107	+1	tier1	-	no_errors	ENST00000398594	ensembl	human	known	74_37	missense	10.94	57	7	SNP	0.981	C
PCK1	5105	genome.wustl.edu	37	20	56138676	56138676	+	Missense_Mutation	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr20:56138676C>T	ENST00000319441.4	+	6	1018	c.854C>T	c.(853-855)cCc>cTc	p.P285L	PCK1_ENST00000535860.1_Missense_Mutation_p.P153L|PCK1_ENST00000543666.1_Intron	NM_002591.3	NP_002582.3	P35558	PCKGC_HUMAN	phosphoenolpyruvate carboxykinase 1 (soluble)	285					carbohydrate metabolic process (GO:0005975)|drug metabolic process (GO:0017144)|gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycerol biosynthetic process from pyruvate (GO:0046327)|internal protein amino acid acetylation (GO:0006475)|oxaloacetate metabolic process (GO:0006107)|response to activity (GO:0014823)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	carboxylic acid binding (GO:0031406)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|phosphoenolpyruvate carboxykinase (GTP) activity (GO:0004613)			endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(19)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	34	Lung NSC(12;0.000764)|all_lung(29;0.00264)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;9.88e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.13e-07)			GCCGCATTTCCCAGCGCCTGC	0.542																																																	0													75.0	76.0	76.0					20																	56138676		2203	4300	6503	SO:0001583	missense	0				CCDS13460.1	20q13.31	2007-11-06			ENSG00000124253	ENSG00000124253	4.1.1.32		8724	protein-coding gene	gene with protein product		614168				1492743	Standard	NM_002591		Approved	PEPCK-C	uc002xyn.4	P35558	OTTHUMG00000032825	ENST00000319441.4:c.854C>T	20.37:g.56138676C>T	ENSP00000319814:p.Pro285Leu		A8K437|B4DT64|Q8TCA3|Q9UJD2	Missense_Mutation	SNP	pfam_PEP_carboxykinase_GTP,superfamily_PEP_carboxykinase_N,pirsf_PEP_carboxykinase_GTP	p.P285L	ENST00000319441.4	37	c.854	CCDS13460.1	20	.	.	.	.	.	.	.	.	.	.	C	24.1	4.489498	0.84962	.	.	ENSG00000124253	ENST00000319441;ENST00000535860	T;T	0.25579	1.79;1.79	5.27	5.27	0.74061	Phosphoenolpyruvate carboxykinase, C-terminal (1);Phosphoenolpyruvate carboxykinase, GTP-utilising, conserved site (1);	0.000000	0.85682	D	0.000000	T	0.67363	0.2885	H	0.97131	3.945	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.80072	-0.1535	10	0.87932	D	0	-28.4106	18.8895	0.92392	0.0:1.0:0.0:0.0	.	285	P35558	PCKGC_HUMAN	L	285;153	ENSP00000319814:P285L;ENSP00000444342:P153L	ENSP00000319814:P285L	P	+	2	0	PCK1	55572082	1.000000	0.71417	1.000000	0.80357	0.514000	0.34195	7.380000	0.79704	2.478000	0.83669	0.561000	0.74099	CCC	PCK1	-	pfam_PEP_carboxykinase_GTP,pirsf_PEP_carboxykinase_GTP	ENSG00000124253		0.542	PCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCK1	HGNC	protein_coding	OTTHUMT00000079851.2	-	0.00	40	0	C			56138676	+1	tier1	-	no_errors	ENST00000319441	ensembl	human	known	74_37	missense	11.54	46	6	SNP	1.000	T
PCYT1A	5130	genome.wustl.edu	37	3	195984695	195984695	+	Missense_Mutation	SNP	T	T	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr3:195984695T>C	ENST00000292823.2	-	4	353	c.181A>G	c.(181-183)Agg>Ggg	p.R61G	PCYT1A_ENST00000491544.1_5'UTR|PCYT1A_ENST00000419333.1_Missense_Mutation_p.R61G|PCYT1A_ENST00000431016.1_Missense_Mutation_p.R61G|RP11-447L10.1_ENST00000431391.1_3'UTR	NM_005017.2	NP_005008.2	P49585	PCY1A_HUMAN	phosphate cytidylyltransferase 1, choline, alpha	61					CDP-choline pathway (GO:0006657)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|glycogen granule (GO:0042587)	choline-phosphate cytidylyltransferase activity (GO:0004105)|lipid binding (GO:0008289)			cervix(1)|endometrium(3)|large_intestine(8)|lung(5)|ovary(1)	18	all_cancers(143;1.19e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;1.28e-24)|all cancers(36;1.01e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00259)	Choline(DB00122)|Lamivudine(DB00709)	ATAGTTACCCTGACATAGGGC	0.368																																																	0													87.0	89.0	88.0					3																	195984695		2203	4300	6503	SO:0001583	missense	0			L28957	CCDS3315.1	3q29	2010-07-19	2005-09-05		ENSG00000161217	ENSG00000161217	2.7.7.15		8754	protein-coding gene	gene with protein product	"""phosphate cytidylyltransferase 1, choline, alpha isoform"""	123695	"""phosphate cytidylyltransferase 1, choline, alpha isoform"""	PCYT1		7918629	Standard	NM_005017		Approved	CT, CTPCT	uc003fwg.3	P49585	OTTHUMG00000155670	ENST00000292823.2:c.181A>G	3.37:g.195984695T>C	ENSP00000292823:p.Arg61Gly		A9LYK9|D3DXB1|Q86Y88	Missense_Mutation	SNP	pfam_Cyt_trans-like,superfamily_NA-bd_OB-fold,tigrfam_Cyt_trans-like	p.R61G	ENST00000292823.2	37	c.181	CCDS3315.1	3	.	.	.	.	.	.	.	.	.	.	T	23.1	4.377190	0.82682	.	.	ENSG00000161217	ENST00000441879;ENST00000419333;ENST00000292823;ENST00000431016;ENST00000411591;ENST00000412869;ENST00000443555	.	.	.	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.56761	0.2007	L	0.58101	1.795	0.80722	D	1	P	0.50443	0.935	B	0.41412	0.356	T	0.64106	-0.6485	9	0.87932	D	0	-20.1829	15.5881	0.76502	0.0:0.0:0.0:1.0	.	61	P49585	PCY1A_HUMAN	G	61	.	ENSP00000292823:R61G	R	-	1	2	PCYT1A	197469092	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.271000	0.43364	2.272000	0.75746	0.460000	0.39030	AGG	PCYT1A	-	NULL	ENSG00000161217		0.368	PCYT1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCYT1A	HGNC	protein_coding	OTTHUMT00000341147.1	-	0.00	89	0	T	NM_005017		195984695	-1	tier1	-	no_errors	ENST00000292823	ensembl	human	known	74_37	missense	25.29	65	22	SNP	1.000	C
PDGFA	5154	genome.wustl.edu	37	7	550466	550466	+	Missense_Mutation	SNP	C	C	T	rs201258799	byFrequency	TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr7:550466C>T	ENST00000354513.5	-	4	825	c.433G>A	c.(433-435)Gtc>Atc	p.V145I	PDGFA_ENST00000426681.2_5'Flank|PDGFA_ENST00000402802.3_Missense_Mutation_p.V145I	NM_002607.5	NP_002598.4	P04085	PDGFA_HUMAN	platelet-derived growth factor alpha polypeptide	145					actin cytoskeleton organization (GO:0030036)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cell activation (GO:0001775)|cell projection assembly (GO:0030031)|cell-cell signaling (GO:0007267)|embryo development (GO:0009790)|epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix organization (GO:0030198)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|lung alveolus development (GO:0048286)|negative chemotaxis (GO:0050919)|negative regulation of phosphatidylinositol biosynthetic process (GO:0010512)|negative regulation of platelet activation (GO:0010544)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway (GO:0035793)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of branching involved in salivary gland morphogenesis by epithelial-mesenchymal signaling (GO:0060683)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of smooth muscle cell migration (GO:0014910)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|response to inorganic substance (GO:0010035)|response to retinoic acid (GO:0032526)|response to wounding (GO:0009611)|skin development (GO:0043588)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	cell surface (GO:0009986)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi membrane (GO:0000139)|microvillus (GO:0005902)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|growth factor activity (GO:0008083)|platelet-derived growth factor binding (GO:0048407)|platelet-derived growth factor receptor binding (GO:0005161)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	16		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|Epithelial(4;1.1e-17)|OV - Ovarian serous cystadenocarcinoma(56;1.7e-17)|all cancers(6;4.89e-15)		CGGTGGTGGACGCGGGAGGGC	0.697													C|||	2	0.000399361	0.0008	0.0014	5008	,	,		5082	0.0		0.0	False		,,,				2504	0.0																0								C	ILE/VAL,ILE/VAL	0,4400		0,0,2200	38.0	31.0	33.0		433,433	-1.5	0.0	7		33	11,8579		0,11,4284	no	missense,missense	PDGFA	NM_002607.5,NM_033023.4	29,29	0,11,6484	TT,TC,CC		0.1281,0.0,0.0847	benign,benign	145/212,145/197	550466	11,12979	2200	4295	6495	SO:0001583	missense	0				CCDS34578.1, CCDS47524.1	7p22	2008-07-18			ENSG00000197461	ENSG00000197461			8799	protein-coding gene	gene with protein product	"""PDGF A-chain"", ""platelet-derived growth factor alpha chain"""	173430				1505216, 2536956	Standard	NM_002607		Approved	PDGF1, PDGF-A	uc003sir.3	P04085	OTTHUMG00000151412	ENST00000354513.5:c.433G>A	7.37:g.550466C>T	ENSP00000346508:p.Val145Ile		B5BU73	Missense_Mutation	SNP	pfam_PDGF/VEGF_dom,pfam_PDGF_N,smart_PDGF/VEGF_dom,pfscan_PDGF/VEGF_dom	p.V145I	ENST00000354513.5	37	c.433	CCDS34578.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	0.201|0.201	-1.044504|-1.044504	0.01997|0.01997	0.0|0.0	0.001281|0.001281	ENSG00000197461|ENSG00000197461	ENST00000400761|ENST00000402802;ENST00000354513	.|T;T	.|0.41758	.|0.99;0.99	4.59|4.59	-1.46|-1.46	0.08800|0.08800	.|Platelet-derived growth factor (PDGF) (3);	.|0.511465	.|0.19124	.|N	.|0.122091	T|T	0.21347|0.21347	0.0514|0.0514	N|N	0.16790|0.16790	0.44|0.44	0.20975|0.20975	N|N	0.999813|0.999813	.|B;B;B	.|0.13594	.|0.001;0.008;0.008	.|B;B;B	.|0.16722	.|0.001;0.004;0.016	T|T	0.20672|0.20672	-1.0268|-1.0268	6|10	0.54805|0.20519	T|T	0.06|0.43	-9.2627|-9.2627	8.5844|8.5844	0.33649|0.33649	0.0:0.3672:0.0:0.6328|0.0:0.3672:0.0:0.6328	.|.	.|159;145;145	.|Q32M96;P04085-2;P04085	.|.;.;PDGFA_HUMAN	H|I	151|145	.|ENSP00000383889:V145I;ENSP00000346508:V145I	ENSP00000383572:R151H|ENSP00000346508:V145I	R|V	-|-	2|1	0|0	PDGFA|PDGFA	516992|516992	0.989000|0.989000	0.36119|0.36119	0.002000|0.002000	0.10522|0.10522	0.001000|0.001000	0.01503|0.01503	1.507000|1.507000	0.35758|0.35758	-0.175000|-0.175000	0.10725|0.10725	-2.282000|-2.282000	0.00269|0.00269	CGT|GTC	PDGFA	-	pfam_PDGF/VEGF_dom,smart_PDGF/VEGF_dom,pfscan_PDGF/VEGF_dom	ENSG00000197461		0.697	PDGFA-002	KNOWN	basic|CCDS	protein_coding	PDGFA	HGNC	protein_coding	OTTHUMT00000322534.1		0.00	24	0	C			550466	-1			no_errors	ENST00000354513	ensembl	human	known	74_37	missense	26.83	30	11	SNP	0.704	T
PDLIM2	64236	genome.wustl.edu	37	8	22451274	22451274	+	Missense_Mutation	SNP	C	C	T	rs147368012		TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr8:22451274C>T	ENST00000397760.4	+	10	1310	c.910C>T	c.(910-912)Cgg>Tgg	p.R304W	PDLIM2_ENST00000265810.4_Missense_Mutation_p.R304W|PDLIM2_ENST00000409141.1_Silent_p.A264A|AC037459.4_ENST00000430850.2_Missense_Mutation_p.R98W|PDLIM2_ENST00000409417.1_Missense_Mutation_p.R304W|PDLIM2_ENST00000448520.1_3'UTR|PDLIM2_ENST00000397761.2_Missense_Mutation_p.R304W|PDLIM2_ENST00000339162.7_Silent_p.A264A|PDLIM2_ENST00000308354.7_Missense_Mutation_p.R554W			Q96JY6	PDLI2_HUMAN	PDZ and LIM domain 2 (mystique)	304	LIM zinc-binding. {ECO:0000255|PROSITE- ProRule:PRU00125}.					actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|urinary_tract(1)	9		Prostate(55;0.0421)|Breast(100;0.102)|all_epithelial(46;0.142)		BRCA - Breast invasive adenocarcinoma(99;0.00579)|Colorectal(74;0.0152)|COAD - Colon adenocarcinoma(73;0.0626)		CCAGGAGGGCCGGTACCGCCA	0.647																																																	0								C	TRP/ARG,TRP/ARG,	1,4403		0,1,2201	27.0	23.0	24.0		1660,910,792	2.8	1.0	8	dbSNP_134	24	1,8595		0,1,4297	no	missense,missense,coding-synonymous	PDLIM2	NM_021630.5,NM_176871.3,NM_198042.3	101,101,	0,2,6498	TT,TC,CC		0.0116,0.0227,0.0154	probably-damaging,probably-damaging,	554/603,304/367,264/279	22451274	2,12998	2202	4298	6500	SO:0001583	missense	0			AY007729	CCDS34860.1, CCDS6032.1, CCDS34861.1, CCDS6032.2	8p21.3	2012-06-27			ENSG00000120913	ENSG00000120913			13992	protein-coding gene	gene with protein product		609722					Standard	NM_021630		Approved		uc003xby.4	Q96JY6	OTTHUMG00000164270	ENST00000397760.4:c.910C>T	8.37:g.22451274C>T	ENSP00000380867:p.Arg304Trp		D3DSR5|J3KNH4|Q7Z584|Q86WM8|Q8WZ29|Q9H4L9|Q9H7I2	Missense_Mutation	SNP	pfam_PDZ,pfam_Znf_LIM,superfamily_PDZ,smart_PDZ,smart_Znf_LIM,pfscan_Znf_LIM,pfscan_PDZ	p.R554W	ENST00000397760.4	37	c.1660		8	.	.	.	.	.	.	.	.	.	.	C	19.91	3.914109	0.72983	2.27E-4	1.16E-4	ENSG00000120913;ENSG00000120913;ENSG00000120913;ENSG00000120913;ENSG00000120913;ENSG00000248235	ENST00000308354;ENST00000397760;ENST00000397761;ENST00000265810;ENST00000409417;ENST00000430850	D;D;D;D;D;D	0.88124	-2.34;-2.34;-2.34;-2.34;-2.34;-2.34	4.72	2.81	0.32909	Zinc finger, LIM-type (5);	0.154474	0.43579	D	0.000553	D	0.92909	0.7744	.	.	.	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.986	D	0.92361	0.5897	9	0.72032	D	0.01	-26.562	12.1967	0.54300	0.3143:0.6857:0.0:0.0	.	304;304	Q96JY6-3;Q96JY6	.;PDLI2_HUMAN	W	554;304;304;304;304;98	ENSP00000312634:R554W;ENSP00000380867:R304W;ENSP00000380868:R304W;ENSP00000265810:R304W;ENSP00000387084:R304W;ENSP00000428700:R98W	ENSP00000428700:R98W	R	+	1	2	AC037459.4;PDLIM2	22507219	0.606000	0.26949	0.984000	0.44739	0.987000	0.75469	1.055000	0.30467	0.348000	0.23949	0.491000	0.48974	CGG	PDLIM2	-	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	ENSG00000120913		0.647	PDLIM2-202	KNOWN	basic|appris_principal	protein_coding	PDLIM2	HGNC	protein_coding	OTTHUMT00000334167.1	-	0.00	52	0	C			22451274	+1	tier1	rs147368012	no_errors	ENST00000308354	ensembl	human	known	74_37	missense	18.60	35	8	SNP	0.928	T
PDPN	10630	genome.wustl.edu	37	1	13933769	13933769	+	Missense_Mutation	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:13933769G>A	ENST00000509009.1	+	2	198	c.154G>A	c.(154-156)Gaa>Aaa	p.E52K	PDPN_ENST00000487038.1_Missense_Mutation_p.E15K|PDPN_ENST00000513143.1_Missense_Mutation_p.E15K|PDPN_ENST00000294489.6_Missense_Mutation_p.E133K|PDPN_ENST00000376061.4_Missense_Mutation_p.E15K|PDPN_ENST00000475043.1_Missense_Mutation_p.E15K|PDPN_ENST00000376057.4_Missense_Mutation_p.E133K					podoplanin											endometrium(3)|kidney(2)|large_intestine(2)|liver(2)|lung(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	16	Ovarian(185;0.249)	all_lung(284;2.29e-05)|Lung NSC(185;4.37e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00969)|Colorectal(212;4.48e-06)|COAD - Colon adenocarcinoma(227;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000347)|Kidney(185;0.00087)|KIRC - Kidney renal clear cell carcinoma(229;0.0027)|STAD - Stomach adenocarcinoma(313;0.00802)|READ - Rectum adenocarcinoma(331;0.0678)		AGGAACCAGCGAAGACCGCTA	0.517																																																	0													82.0	76.0	78.0					1																	13933769		2203	4300	6503	SO:0001583	missense	0			AB127958, AY194238	CCDS30602.1, CCDS41266.1, CCDS44060.1, CCDS53270.1	1p36.21	2008-02-05			ENSG00000162493	ENSG00000162493			29602	protein-coding gene	gene with protein product	"""lung type I cell membrane associated glycoprotein"""	608863				10393083, 9651190	Standard	NM_006474		Approved	T1A-2, Gp38, aggrus, GP40, PA2.26	uc001avd.3	Q86YL7	OTTHUMG00000007912	ENST00000509009.1:c.154G>A	1.37:g.13933769G>A	ENSP00000422977:p.Glu52Lys			Missense_Mutation	SNP	pfam_Podoplanin	p.E133K	ENST00000509009.1	37	c.397		1	.	.	.	.	.	.	.	.	.	.	G	12.74	2.029363	0.35797	.	.	ENSG00000162493	ENST00000294489;ENST00000376057;ENST00000510906;ENST00000509009;ENST00000376061;ENST00000513143;ENST00000487038;ENST00000475043	T;T;T;T;T;T;T;T	0.30714	1.52;1.52;1.52;1.52;1.52;1.52;1.52;1.52	3.92	-1.11	0.09840	.	1.663320	0.02733	N	0.115339	T	0.24236	0.0587	L	0.45581	1.43	0.09310	N	1	B;B;B;B	0.20671	0.047;0.047;0.009;0.009	B;B;B;B	0.17979	0.02;0.02;0.007;0.007	T	0.17623	-1.0363	10	0.06891	T	0.86	4.1945	7.313	0.26485	0.5151:0.0:0.4849:0.0	.	57;15;133;133	Q86YL7;E9PB68;Q86YL7-3;Q86YL7-4	PDPN_HUMAN;.;.;.	K	133;133;124;52;15;15;15;15	ENSP00000294489:E133K;ENSP00000365225:E133K;ENSP00000426302:E124K;ENSP00000422977:E52K;ENSP00000365229:E15K;ENSP00000425304:E15K;ENSP00000427537:E15K;ENSP00000426063:E15K	ENSP00000294489:E133K	E	+	1	0	PDPN	13806356	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.078000	0.11375	-0.195000	0.10382	-0.123000	0.14984	GAA	PDPN	-	pfam_Podoplanin	ENSG00000162493		0.517	PDPN-009	PUTATIVE	basic|exp_conf	protein_coding	PDPN	HGNC	protein_coding	OTTHUMT00000367736.1	-	0.00	52	0	G	NM_006474		13933769	+1	tier1	-	no_errors	ENST00000294489	ensembl	human	known	74_37	missense	15.56	38	7	SNP	0.000	A
PDS5A	23244	genome.wustl.edu	37	4	39891930	39891930	+	Nonsense_Mutation	SNP	C	C	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr4:39891930C>A	ENST00000303538.8	-	17	2364	c.1825G>T	c.(1825-1827)Gag>Tag	p.E609*		NM_001100399.1	NP_001093869.1			PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae)											breast(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(9)|lung(14)|prostate(3)|skin(1)|urinary_tract(1)	39						TTGACCATCTCTAGAAAAGGA	0.353																																																	0													85.0	78.0	80.0					4																	39891930		1812	4076	5888	SO:0001587	stop_gained	0			AF294791	CCDS47045.1, CCDS54759.1	4p14	2007-06-20			ENSG00000121892	ENSG00000121892			29088	protein-coding gene	gene with protein product		613200				11076961, 15855230	Standard	NM_001100399		Approved	KIAA0648, PIG54, SCC-112	uc003guv.4	Q29RF7	OTTHUMG00000160582	ENST00000303538.8:c.1825G>T	4.37:g.39891930C>A	ENSP00000303427:p.Glu609*			Nonsense_Mutation	SNP	superfamily_ARM-type_fold	p.E609*	ENST00000303538.8	37	c.1825	CCDS47045.1	4	.	.	.	.	.	.	.	.	.	.	C	45	11.477114	0.99566	.	.	ENSG00000121892	ENST00000303538	.	.	.	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-14.9328	19.6604	0.95864	0.0:1.0:0.0:0.0	.	.	.	.	X	609	.	.	E	-	1	0	PDS5A	39568325	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.713000	0.84693	2.721000	0.93114	0.655000	0.94253	GAG	PDS5A	-	superfamily_ARM-type_fold	ENSG00000121892		0.353	PDS5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDS5A	HGNC	protein_coding	OTTHUMT00000361287.1	-	0.00	68	0	C	NM_015200		39891930	-1	tier1	-	no_errors	ENST00000303538	ensembl	human	known	74_37	nonsense	24.19	94	30	SNP	1.000	A
PFKM	5213	genome.wustl.edu	37	12	48531621	48531621	+	Missense_Mutation	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr12:48531621G>A	ENST00000312352.7	+	11	1093	c.1054G>A	c.(1054-1056)Gtc>Atc	p.V352I	PFKM_ENST00000340802.6_Missense_Mutation_p.V423I|PFKM_ENST00000547587.1_Missense_Mutation_p.V352I|PFKM_ENST00000551804.1_Missense_Mutation_p.V321I|PFKM_ENST00000359794.5_Missense_Mutation_p.V352I|PFKM_ENST00000395233.2_Missense_Mutation_p.V321I	NM_001166687.1	NP_001160159.1	P08237	PFKAM_HUMAN	phosphofructokinase, muscle	352	N-terminal catalytic PFK domain 1.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 6-phosphate metabolic process (GO:0006002)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|muscle cell cellular homeostasis (GO:0046716)|positive regulation of insulin secretion (GO:0032024)|protein oligomerization (GO:0051259)|small molecule metabolic process (GO:0044281)	6-phosphofructokinase complex (GO:0005945)|apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|sperm principal piece (GO:0097228)	6-phosphofructokinase activity (GO:0003872)|ATP binding (GO:0005524)|fructose binding (GO:0070061)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			NS(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(16)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	35						CATGGAATGTGTCCAGGTGGT	0.547																																																	0													134.0	124.0	127.0					12																	48531621		2203	4300	6503	SO:0001583	missense	0			M26066	CCDS8760.1, CCDS53786.1	12q13.11	2014-06-13					2.7.1.11		8877	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 122"""	610681	"""phosphofructokinase, polypeptide X"""	PFKX			Standard	NM_001166686		Approved	PFK-1, PPP1R122	uc001rrb.2	P08237		ENST00000312352.7:c.1054G>A	12.37:g.48531621G>A	ENSP00000309438:p.Val352Ile		J3KNX3|Q16814|Q16815|Q6ZTT1	Missense_Mutation	SNP	pfam_Phosphofructokinase_dom,superfamily_Phosphofructokinase_dom,pirsf_6-phosphofructokinase_euk,prints_Phosphofructokinase,tigrfam_6-phosphofructokinase_euk	p.V352I	ENST00000312352.7	37	c.1054	CCDS8760.1	12	.	.	.	.	.	.	.	.	.	.	G	29.6	5.015800	0.93404	.	.	ENSG00000152556	ENST00000340802;ENST00000359794;ENST00000395233;ENST00000551804;ENST00000547587;ENST00000312352	T;T;T;T;T;T	0.81163	-1.46;-1.46;-1.46;-1.46;-1.46;-1.46	4.44	4.44	0.53790	Phosphofructokinase domain (1);	0.068967	0.56097	D	0.000021	D	0.92195	0.7525	H	0.94222	3.51	0.80722	D	1	D;D;P	0.89917	1.0;0.997;0.793	D;D;P	0.91635	0.999;0.996;0.772	D	0.93425	0.6780	10	0.48119	T	0.1	-27.1023	16.4107	0.83712	0.0:0.0:1.0:0.0	.	321;352;423	P08237-2;P08237;Q6ZTT1	.;K6PF_HUMAN;.	I	423;352;321;321;352;352	ENSP00000345771:V423I;ENSP00000352842:V352I;ENSP00000378656:V321I;ENSP00000448177:V321I;ENSP00000449426:V352I;ENSP00000309438:V352I	ENSP00000309438:V352I	V	+	1	0	PFKM	46817888	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.582000	0.98214	2.475000	0.83589	0.643000	0.83706	GTC	PFKM	-	superfamily_Phosphofructokinase_dom,pirsf_6-phosphofructokinase_euk,tigrfam_6-phosphofructokinase_euk	ENSG00000152556		0.547	PFKM-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PFKM	HGNC	protein_coding	OTTHUMT00000406490.1	-	0.00	32	0	G	NM_000289		48531621	+1	tier1	-	no_errors	ENST00000312352	ensembl	human	known	74_37	missense	12.20	36	5	SNP	1.000	A
PGAP1	80055	genome.wustl.edu	37	2	197777708	197777708	+	Silent	SNP	A	A	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr2:197777708A>G	ENST00000354764.4	-	4	661	c.547T>C	c.(547-549)Ttg>Ctg	p.L183L	PGAP1_ENST00000409475.1_Silent_p.L183L|PGAP1_ENST00000409188.1_Silent_p.L141L|PGAP1_ENST00000485830.1_5'UTR	NM_024989.3	NP_079265.2	Q75T13	PGAP1_HUMAN	post-GPI attachment to proteins 1	183					anterior/posterior axis specification (GO:0009948)|attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|embryonic pattern specification (GO:0009880)|forebrain regionalization (GO:0021871)|head development (GO:0060322)|intracellular protein transport (GO:0006886)|myo-inositol transport (GO:0015798)|post-translational protein modification (GO:0043687)|sensory perception of sound (GO:0007605)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	nuclease activity (GO:0004518)|phosphoric ester hydrolase activity (GO:0042578)			breast(4)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(9)|lung(11)|ovary(6)|stomach(1)|urinary_tract(1)	40						AGTGTAAGCAATGCTCTTGCA	0.373																																																	0													109.0	107.0	107.0					2																	197777708		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS2318.1	2q33.1	2014-03-03			ENSG00000197121	ENSG00000197121			25712	protein-coding gene	gene with protein product	"""GPI inositol-deacylase"""	611655				14734546, 17711852, 24482476	Standard	XM_005246866		Approved	FLJ12377, Bst1, SPG67	uc002utw.3	Q75T13	OTTHUMG00000132743	ENST00000354764.4:c.547T>C	2.37:g.197777708A>G			Q4G0R8|Q4ZG47|Q53SM0|Q6AW92|Q6UWV4|Q9HA24	Silent	SNP	pfam_PGAP1-like	p.L183	ENST00000354764.4	37	c.547	CCDS2318.1	2																																																																																			PGAP1	-	pfam_PGAP1-like	ENSG00000197121		0.373	PGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGAP1	HGNC	protein_coding	OTTHUMT00000256103.5	-	0.00	44	0	A	NM_024989		197777708	-1	tier1	-	no_errors	ENST00000354764	ensembl	human	known	74_37	silent	33.33	36	18	SNP	0.981	G
PGBD2	267002	genome.wustl.edu	37	1	249211387	249211387	+	Missense_Mutation	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:249211387G>A	ENST00000329291.5	+	3	751	c.604G>A	c.(604-606)Gaa>Aaa	p.E202K	PGBD2_ENST00000355360.4_Intron|PGBD2_ENST00000462488.1_Intron|PGBD2_ENST00000539153.1_Missense_Mutation_p.E199K	NM_170725.2	NP_733843.1	Q6P3X8	PGBD2_HUMAN	piggyBac transposable element derived 2	202										NS(1)|endometrium(3)|lung(6)|ovary(1)|skin(3)	14	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.012)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			GATGTTCTGGGAAACCTCTCC	0.388																																																	0													139.0	141.0	141.0					1																	249211387		2203	4300	6503	SO:0001583	missense	0			AF229602	CCDS31128.1, CCDS31129.1	1q	2008-02-05			ENSG00000185220	ENSG00000185220			19399	protein-coding gene	gene with protein product							Standard	XM_005270333		Approved		uc001ifh.3	Q6P3X8	OTTHUMG00000040424	ENST00000329291.5:c.604G>A	1.37:g.249211387G>A	ENSP00000331643:p.Glu202Lys		B3KVR8|Q6MZF8	Missense_Mutation	SNP	NULL	p.E202K	ENST00000329291.5	37	c.604	CCDS31128.1	1	.	.	.	.	.	.	.	.	.	.	G	18.93	3.728540	0.69074	.	.	ENSG00000185220	ENST00000329291;ENST00000539153	T;T	0.16897	2.31;2.31	4.04	4.04	0.47022	.	0.000000	0.37715	N	0.001965	T	0.31765	0.0807	L	0.52364	1.645	0.30083	N	0.808973	D;D	0.76494	0.998;0.999	D;D	0.83275	0.944;0.996	T	0.04650	-1.0936	10	0.25106	T	0.35	-34.7443	11.9052	0.52708	0.0:0.0:1.0:0.0	.	199;202	F5H4U7;Q6P3X8	.;PGBD2_HUMAN	K	202;199	ENSP00000331643:E202K;ENSP00000439950:E199K	ENSP00000331643:E202K	E	+	1	0	PGBD2	247178010	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.644000	0.37228	2.243000	0.73865	0.655000	0.94253	GAA	PGBD2	-	NULL	ENSG00000185220		0.388	PGBD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PGBD2	HGNC	protein_coding	OTTHUMT00000097318.1	-	0.00	38	0	G			249211387	+1	tier1	-	no_errors	ENST00000329291	ensembl	human	known	74_37	missense	23.73	45	14	SNP	1.000	A
PGM2	55276	genome.wustl.edu	37	4	37836311	37836311	+	Silent	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr4:37836311C>T	ENST00000381967.4	+	3	421	c.321C>T	c.(319-321)gcC>gcT	p.A107A	PGM2_ENST00000544359.1_5'UTR|PGM2_ENST00000537241.1_Intron	NM_018290.3	NP_060760.2	Q96G03	PGM2_HUMAN	phosphoglucomutase 2	107					carbohydrate metabolic process (GO:0005975)|deoxyribose phosphate catabolic process (GO:0046386)|galactose catabolic process (GO:0019388)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	magnesium ion binding (GO:0000287)|phosphoglucomutase activity (GO:0004614)|phosphopentomutase activity (GO:0008973)			breast(1)|kidney(2)|large_intestine(3)|lung(10)|ovary(2)|urinary_tract(1)	19						GTTTTGACGCCCGAGCTCATC	0.343																																																	0													88.0	98.0	95.0					4																	37836311		2203	4300	6503	SO:0001819	synonymous_variant	0			BC010087	CCDS3443.1	4p14	2012-10-02			ENSG00000169299	ENSG00000169299	5.4.2.2		8906	protein-coding gene	gene with protein product	"""phosphopentomutase"""	172000				9549096	Standard	NM_018290		Approved	FLJ10983	uc011byb.1	Q96G03	OTTHUMG00000097813	ENST00000381967.4:c.321C>T	4.37:g.37836311C>T			B4E0G8|Q53FP5|Q5QTR0|Q9H0P9|Q9NV22	Silent	SNP	pfam_A-D-PHexomutase_a/b/a-I,pfam_A-D-PHexomutase_a/b/a-II,pfam_A-D-PHexomutase_a/b/a-III,pfam_A-D-PHexomutase_C,superfamily_A-D-PHexomutase_a/b/a-I/II/III,prints_Alpha-D-phosphohexomutase_SF	p.A107	ENST00000381967.4	37	c.321	CCDS3443.1	4																																																																																			PGM2	-	pfam_A-D-PHexomutase_a/b/a-I,superfamily_A-D-PHexomutase_a/b/a-I/II/III	ENSG00000169299		0.343	PGM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGM2	HGNC	protein_coding	OTTHUMT00000215079.2	-	0.00	175	0	C	NM_018290		37836311	+1	tier1	-	no_errors	ENST00000381967	ensembl	human	known	74_37	silent	24.26	178	57	SNP	0.069	T
PHKB	5257	genome.wustl.edu	37	16	47683022	47683022	+	Missense_Mutation	SNP	T	T	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr16:47683022T>G	ENST00000323584.5	+	18	1728	c.1704T>G	c.(1702-1704)atT>atG	p.I568M	PHKB_ENST00000566044.1_Missense_Mutation_p.I561M|PHKB_ENST00000299167.8_Missense_Mutation_p.I568M|PHKB_ENST00000455779.1_Missense_Mutation_p.I561M	NM_000293.2	NP_000284.1	Q93100	KPBB_HUMAN	phosphorylase kinase, beta	568					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|liver(1)|lung(18)|ovary(1)|skin(1)	41		all_cancers(37;0.00447)|all_lung(18;0.00616)|Lung NSC(13;0.0418)|Breast(268;0.203)				TTTATCGCATTCTAGGAAAGA	0.343																																																	0													148.0	137.0	141.0					16																	47683022		2201	4300	6501	SO:0001583	missense	0				CCDS10729.1, CCDS42161.1	16q12-q13	2009-07-10			ENSG00000102893	ENSG00000102893	2.7.11.19		8927	protein-coding gene	gene with protein product		172490					Standard	NM_000293		Approved		uc002eev.4	Q93100	OTTHUMG00000133102	ENST00000323584.5:c.1704T>G	16.37:g.47683022T>G	ENSP00000313504:p.Ile568Met		Q8N4T5	Missense_Mutation	SNP	pfam_Glyco_hydro_15,superfamily_6-hairpin_glycosidase-like	p.I568M	ENST00000323584.5	37	c.1704	CCDS10729.1	16	.	.	.	.	.	.	.	.	.	.	T	17.27	3.347951	0.61183	.	.	ENSG00000102893	ENST00000299167;ENST00000455779;ENST00000323584	D;D	0.92149	-2.98;-2.98	5.89	-0.71	0.11234	Glycoside hydrolase 15-related (1);	0.000000	0.85682	D	0.000000	D	0.94231	0.8148	M	0.81942	2.565	0.58432	D	0.999999	D;D	0.76494	0.997;0.999	D;D	0.78314	0.991;0.982	D	0.91388	0.5133	10	0.72032	D	0.01	-25.6867	6.3407	0.21321	0.1506:0.4165:0.0:0.4329	.	568;561	Q93100;Q93100-4	KPBB_HUMAN;.	M	561;561;568	ENSP00000414345:I561M;ENSP00000313504:I568M	ENSP00000299167:I561M	I	+	3	3	PHKB	46240523	0.997000	0.39634	0.911000	0.35937	0.751000	0.42716	0.362000	0.20284	-0.098000	0.12285	0.477000	0.44152	ATT	PHKB	-	pfam_Glyco_hydro_15	ENSG00000102893		0.343	PHKB-002	KNOWN	basic|CCDS	protein_coding	PHKB	HGNC	protein_coding	OTTHUMT00000430413.1	-	0.00	76	0	T			47683022	+1	tier1	-	no_errors	ENST00000299167	ensembl	human	known	74_37	missense	12.37	85	12	SNP	0.996	G
PIGK	10026	genome.wustl.edu	37	1	77676165	77676165	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:77676165C>G	ENST00000370812.3	-	2	126	c.103G>C	c.(103-105)Gaa>Caa	p.E35Q	PIGK_ENST00000370813.5_Missense_Mutation_p.E35Q|PIGK_ENST00000445065.1_Intron|PIGK_ENST00000359130.1_Missense_Mutation_p.E35Q|PIGK_ENST00000478391.1_5'UTR	NM_005482.2	NP_005473.1	Q92643	GPI8_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class K	35					attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)	endoplasmic reticulum membrane (GO:0005789)|GPI-anchor transamidase complex (GO:0042765)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)	cysteine-type endopeptidase activity (GO:0004197)|GPI-anchor transamidase activity (GO:0003923)|protein disulfide isomerase activity (GO:0003756)			endometrium(5)|kidney(1)|large_intestine(4)|lung(3)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)	19						AAGAATTGTTCTGCTTGATCC	0.343																																																	0													41.0	36.0	38.0					1																	77676165		2200	4292	6492	SO:0001583	missense	0			AF022913	CCDS674.1	1p31.1	2013-02-26	2006-06-28		ENSG00000142892	ENSG00000142892		"""Phosphatidylinositol glycan anchor biosynthesis"""	8965	protein-coding gene	gene with protein product	"""GPI transamidase subunit"""	605087	"""phosphatidylinositol glycan, class K"""			9356492	Standard	NM_005482		Approved	hGPI8, GPI8	uc001dhk.3	Q92643	OTTHUMG00000009686	ENST00000370812.3:c.103G>C	1.37:g.77676165C>G	ENSP00000359848:p.Glu35Gln		B2R7K3|B4E2M3|O14822|Q5TG77	Missense_Mutation	SNP	pfam_Peptidase_C13,prints_Peptidase_C13	p.E35Q	ENST00000370812.3	37	c.103	CCDS674.1	1	.	.	.	.	.	.	.	.	.	.	C	15.56	2.868855	0.51588	.	.	ENSG00000142892	ENST00000370812;ENST00000370813;ENST00000359130	T;T;T	0.49432	0.87;0.78;0.88	4.79	3.87	0.44632	.	0.117150	0.56097	D	0.000027	T	0.25717	0.0626	L	0.29908	0.895	0.21220	N	0.999757	P;B;B	0.42078	0.77;0.033;0.012	P;B;B	0.46144	0.505;0.014;0.005	T	0.09100	-1.0690	10	0.32370	T	0.25	.	13.6309	0.62193	0.1565:0.8435:0.0:0.0	.	35;35;35	B4E2M3;A6NEM5;Q92643	.;.;GPI8_HUMAN	Q	35	ENSP00000359848:E35Q;ENSP00000359849:E35Q;ENSP00000352041:E35Q	ENSP00000352041:E35Q	E	-	1	0	PIGK	77448753	0.988000	0.35896	1.000000	0.80357	0.992000	0.81027	1.482000	0.35486	1.130000	0.42092	0.655000	0.94253	GAA	PIGK	-	NULL	ENSG00000142892		0.343	PIGK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIGK	HGNC	protein_coding	OTTHUMT00000026687.1	-	0.00	143	0	C	NM_005482		77676165	-1	tier1	-	no_errors	ENST00000370812	ensembl	human	known	74_37	missense	17.98	144	32	SNP	1.000	G
PIK3CA	5290	genome.wustl.edu	37	3	178952074	178952074	+	Missense_Mutation	SNP	G	G	A	rs121913283		TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr3:178952074G>A	ENST00000263967.3	+	21	3286	c.3129G>A	c.(3127-3129)atG>atA	p.M1043I	RP11-245C23.3_ENST00000609807.1_RNA	NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	1043	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		M -> I (in MCAP and CRC; also found in an endometrial carcinoma sample; shows an increase in lipid kinase activity). {ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.M1043I(66)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TGAAACAAATGAATGATGCAC	0.368		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)			Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	66	Substitution - Missense(66)	large_intestine(36)|endometrium(11)|breast(6)|urinary_tract(4)|lung(4)|cervix(2)|thyroid(1)|central_nervous_system(1)|ovary(1)											98.0	88.0	91.0					3																	178952074		1907	4120	6027	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.3129G>A	3.37:g.178952074G>A	ENSP00000263967:p.Met1043Ile		Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_dom,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.M1043I	ENST00000263967.3	37	c.3129	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	15.94	2.979751	0.53827	.	.	ENSG00000121879	ENST00000263967	T	0.75260	-0.92	6.08	6.08	0.98989	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	T	0.42944	0.1225	N	0.00500	-1.43	0.80722	D	1	B	0.25955	0.138	B	0.19666	0.026	T	0.58662	-0.7597	10	0.02654	T	1	-20.5202	20.6721	0.99693	0.0:0.0:1.0:0.0	.	1043	P42336	PK3CA_HUMAN	I	1043	ENSP00000263967:M1043I	ENSP00000263967:M1043I	M	+	3	0	PIK3CA	180434768	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.367000	0.97148	2.894000	0.99253	0.591000	0.81541	ATG	PIK3CA	-	superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000121879		0.368	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	-	0.00	43	0	G			178952074	+1	tier1	-	no_errors	ENST00000263967	ensembl	human	known	74_37	missense	36.67	18	11	SNP	1.000	A
PISD	23761	genome.wustl.edu	37	22	32021682	32021682	+	Intron	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr22:32021682G>C	ENST00000439502.2	-	4	545				PISD_ENST00000478893.1_5'UTR|PISD_ENST00000397500.1_Intron|PISD_ENST00000336566.4_Intron|PISD_ENST00000266095.5_Intron|PISD_ENST00000382151.2_Intron			Q9UG56	PISD_HUMAN	phosphatidylserine decarboxylase						glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	phosphatidylserine decarboxylase activity (GO:0004609)			central_nervous_system(3)|endometrium(2)|large_intestine(4)|lung(1)|ovary(1)|prostate(1)	12					Phosphatidylserine(DB00144)	CGCTGGATGTGAACTCTGACC	0.697																																																	0													11.0	17.0	15.0					22																	32021682		690	1588	2278	SO:0001627	intron_variant	0				CCDS13899.1	22q12.2	2011-01-25			ENSG00000241878	ENSG00000241878	4.1.1.65		8999	protein-coding gene	gene with protein product		612770				10591208	Standard	NM_014338		Approved	dJ858B16.2, PSDC	uc003alk.2	Q9UG56	OTTHUMG00000030252	ENST00000439502.2:c.322-3811C>G	22.37:g.32021682G>C			B1AKM7|O43207|O95535|Q6IC28|Q96GQ2|Q9UGA9	RNA	SNP	-	NULL	ENST00000439502.2	37	NULL		22																																																																																			PISD	-	-	ENSG00000241878		0.697	PISD-001	KNOWN	basic	protein_coding	PISD	HGNC	protein_coding	OTTHUMT00000075106.4	-	0.00	100	0	G			32021682	-1	tier1	-	no_errors	ENST00000478893	ensembl	human	known	74_37	rna	22.47	68	20	SNP	0.998	C
PLEK	5341	genome.wustl.edu	37	2	68620294	68620294	+	Splice_Site	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr2:68620294G>A	ENST00000234313.7	+	7	942	c.763G>A	c.(763-765)Ggg>Agg	p.G255R		NM_002664.2	NP_002655.2	P08567	PLEK_HUMAN	pleckstrin	255	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton reorganization (GO:0031532)|blood coagulation (GO:0007596)|cell projection organization (GO:0030030)|cortical actin cytoskeleton organization (GO:0030866)|hematopoietic progenitor cell differentiation (GO:0002244)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of calcium-mediated signaling (GO:0050849)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|negative regulation of inositol phosphate biosynthetic process (GO:0010920)|phosphatidylinositol metabolic process (GO:0046488)|phospholipase C-inhibiting G-protein coupled receptor signaling pathway (GO:0030845)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of actin filament bundle assembly (GO:0032233)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of inositol-polyphosphate 5-phosphatase activity (GO:0010925)|positive regulation of integrin activation (GO:0033625)|positive regulation of platelet activation (GO:0010572)|protein kinase C signaling (GO:0070528)|protein secretion by platelet (GO:0070560)|regulation of cell diameter (GO:0060305)|ruffle organization (GO:0031529)|thrombin receptor signaling pathway (GO:0070493)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|membrane (GO:0016020)|ruffle membrane (GO:0032587)	phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)			autonomic_ganglia(1)|endometrium(3)|large_intestine(6)|lung(12)|ovary(1)|skin(1)	24		Ovarian(717;0.0129)		STAD - Stomach adenocarcinoma(1183;0.00159)|READ - Rectum adenocarcinoma(193;0.0419)		CTGGATACAGGGGCATAGAAG	0.433																																																	0													151.0	142.0	145.0					2																	68620294		2203	4300	6503	SO:0001630	splice_region_variant	0			X07743	CCDS1887.1	2p13.3	2013-01-10			ENSG00000115956	ENSG00000115956		"""Pleckstrin homology (PH) domain containing"""	9070	protein-coding gene	gene with protein product		173570				2897630, 12054651	Standard	NM_002664		Approved	P47	uc002sen.4	P08567	OTTHUMG00000129562	ENST00000234313.7:c.763-1G>A	2.37:g.68620294G>A			B2R9E8|Q53SU8|Q6FGM8|Q6FGQ1|Q8WV81	Missense_Mutation	SNP	pfam_Pleckstrin_homology,pfam_DEP_dom,smart_Pleckstrin_homology,smart_DEP_dom,pfscan_DEP_dom,pfscan_Pleckstrin_homology	p.G255R	ENST00000234313.7	37	c.763	CCDS1887.1	2	.	.	.	.	.	.	.	.	.	.	G	33	5.231046	0.95207	.	.	ENSG00000115956	ENST00000234313	T	0.36699	1.24	5.77	5.77	0.91146	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	T	0.62986	0.2473	M	0.76002	2.32	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.60910	-0.7169	9	.	.	.	.	19.6065	0.95583	0.0:0.0:1.0:0.0	.	273;255	Q59GZ2;P08567	.;PLEK_HUMAN	R	255	ENSP00000234313:G255R	.	G	+	1	0	PLEK	68473798	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.405000	0.97313	2.744000	0.94065	0.561000	0.74099	GGG	PLEK	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000115956		0.433	PLEK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEK	HGNC	protein_coding	OTTHUMT00000251755.1	-	0.00	79	0	G	NM_002664	Missense_Mutation	68620294	+1	tier1	-	no_errors	ENST00000234313	ensembl	human	known	74_37	missense	40.79	45	31	SNP	1.000	A
PLEKHA8P1	51054	genome.wustl.edu	37	12	45567423	45567423	+	RNA	SNP	C	C	T	rs368700010		TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr12:45567423C>T	ENST00000256692.5	-	0	1262					NR_037144.1		O95397	PKHA9_HUMAN	pleckstrin homology domain containing, family A member 8 pseudogene 1							cytoplasm (GO:0005737)	glycolipid binding (GO:0051861)|glycolipid transporter activity (GO:0017089)			breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(10)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						CAAGATCCATCTTAACAGGAG	0.413																																																	0													158.0	149.0	152.0					12																	45567423		2203	4300	6503			0			AF103731		12q12	2010-11-24	2010-11-24	2010-11-24	ENSG00000134297	ENSG00000134297			30222	pseudogene	pseudogene	"""putative glycolipid transfer protein"""		"""pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 9"""	PLEKHA9		12477932	Standard	NR_037144		Approved	FLJ14156	uc001rom.2	O95397			12.37:g.45567423C>T				RNA	SNP	-	NULL	ENST00000256692.5	37	NULL		12																																																																																			PLEKHA8P1	-	-	ENSG00000134297		0.413	PLEKHA8P1-002	KNOWN	basic	processed_transcript	PLEKHA8P1	HGNC	pseudogene	OTTHUMT00000404814.1	-	0.00	51	0	C	NR_037144		45567423	-1	tier1	-	no_errors	ENST00000256692	ensembl	human	known	74_37	rna	18.39	71	16	SNP	1.000	T
PLEKHH2	130271	genome.wustl.edu	37	2	43924327	43924327	+	Missense_Mutation	SNP	T	T	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr2:43924327T>G	ENST00000282406.4	+	7	630	c.520T>G	c.(520-522)Tca>Gca	p.S174A		NM_172069.3	NP_742066.2	Q8IVE3	PKHH2_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 2	174					negative regulation of actin filament depolymerization (GO:0030835)	cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	actin binding (GO:0003779)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(24)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	56		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				AGGAAAGAAGTCATCCACTGT	0.378																																																	0													124.0	126.0	126.0					2																	43924327		2203	4300	6503	SO:0001583	missense	0			AB095948	CCDS1812.1	2p22	2013-01-10			ENSG00000152527	ENSG00000152527		"""Pleckstrin homology (PH) domain containing"""	30506	protein-coding gene	gene with protein product		612723					Standard	NM_172069		Approved	KIAA2028, PLEKHH1L	uc010yny.2	Q8IVE3	OTTHUMG00000128657	ENST00000282406.4:c.520T>G	2.37:g.43924327T>G	ENSP00000282406:p.Ser174Ala		Q5JPJ6|Q6P4Q1|Q8N3Q3	Missense_Mutation	SNP	pfam_Pleckstrin_homology,pfam_MyTH4_dom,pfam_FERM_central,superfamily_FERM_central,smart_Pleckstrin_homology,smart_MyTH4_dom,smart_Band_41_domain,pfscan_FERM_domain,pfscan_MyTH4_dom,pfscan_Pleckstrin_homology	p.S174A	ENST00000282406.4	37	c.520	CCDS1812.1	2	.	.	.	.	.	.	.	.	.	.	T	1.338	-0.594781	0.03771	.	.	ENSG00000152527	ENST00000282406	T	0.44881	0.91	5.04	-0.432	0.12291	.	2.193340	0.01990	N	0.045430	T	0.24509	0.0594	L	0.27053	0.805	0.09310	N	1	B;B	0.14438	0.001;0.01	B;B	0.13407	0.003;0.009	T	0.05241	-1.0897	10	0.08179	T	0.78	0.6293	0.805	0.01082	0.3104:0.1124:0.1585:0.4187	.	174;174	Q8IVE3;Q8IVE3-3	PKHH2_HUMAN;.	A	174	ENSP00000282406:S174A	ENSP00000282406:S174A	S	+	1	0	PLEKHH2	43777831	0.014000	0.17966	0.102000	0.21198	0.714000	0.41099	-0.201000	0.09464	-0.043000	0.13513	-0.503000	0.04515	TCA	PLEKHH2	-	NULL	ENSG00000152527		0.378	PLEKHH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHH2	HGNC	protein_coding	OTTHUMT00000250537.1	-	0.00	72	0	T	NM_172069		43924327	+1	tier1	-	no_errors	ENST00000282406	ensembl	human	known	74_37	missense	12.15	94	13	SNP	0.017	G
PLOD1	5351	genome.wustl.edu	37	1	12012751	12012751	+	Nonsense_Mutation	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:12012751C>T	ENST00000196061.4	+	5	565	c.538C>T	c.(538-540)Cag>Tag	p.Q180*	PLOD1_ENST00000376369.3_Nonsense_Mutation_p.Q227*|PLOD1_ENST00000485046.1_3'UTR	NM_000302.3	NP_000293.2	Q02809	PLOD1_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1	180					cellular protein modification process (GO:0006464)|epidermis development (GO:0008544)|extracellular matrix organization (GO:0030198)|hydroxylysine biosynthetic process (GO:0046947)|oxidation-reduction process (GO:0055114)|response to hypoxia (GO:0001666)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-lysine 5-dioxygenase activity (GO:0008475)|protein homodimerization activity (GO:0042803)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	29	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.06e-06)|COAD - Colon adenocarcinoma(227;0.000273)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.000809)|KIRC - Kidney renal clear cell carcinoma(229;0.00267)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)	Succinic acid(DB00139)|Vitamin C(DB00126)	CGACAGCGATCAGCTGTTTTA	0.617																																																	0													95.0	88.0	90.0					1																	12012751		2203	4300	6503	SO:0001587	stop_gained	0			BC016657	CCDS142.1	1p36.22	2011-08-25	2011-08-24	2004-12-14	ENSG00000083444	ENSG00000083444	1.14.11.4		9081	protein-coding gene	gene with protein product	"""lysyl hydroxlase 1"""	153454	"""procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase (lysine hydroxylase, Ehlers-Danlos syndrome type VI)"""	LLH, PLOD		1577494	Standard	NM_000302		Approved	LH1	uc001atm.3	Q02809	OTTHUMG00000002393	ENST00000196061.4:c.538C>T	1.37:g.12012751C>T	ENSP00000196061:p.Gln180*		B4DR87|Q96AV9|Q9H132	Nonsense_Mutation	SNP	pfam_Oxoglu/Fe-dep_dioxygenase,smart_Pro_4_hyd_alph	p.Q227*	ENST00000196061.4	37	c.679	CCDS142.1	1	.	.	.	.	.	.	.	.	.	.	C	17.94	3.512114	0.64522	.	.	ENSG00000083444	ENST00000358133;ENST00000376369;ENST00000429000;ENST00000196061	.	.	.	4.61	4.61	0.57282	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	16.5981	0.84802	0.0:1.0:0.0:0.0	.	.	.	.	X	180;227;180;180	.	ENSP00000196061:Q180X	Q	+	1	0	PLOD1	11935338	1.000000	0.71417	0.998000	0.56505	0.783000	0.44284	7.596000	0.82721	2.380000	0.81148	0.555000	0.69702	CAG	PLOD1	-	NULL	ENSG00000083444		0.617	PLOD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLOD1	HGNC	protein_coding	OTTHUMT00000006865.1	-	0.00	45	0	C	NM_000302		12012751	+1	tier1	-	no_errors	ENST00000376369	ensembl	human	known	74_37	nonsense	37.74	33	20	SNP	1.000	T
PLOD1	5351	genome.wustl.edu	37	1	12012771	12012771	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:12012771C>G	ENST00000196061.4	+	5	585	c.558C>G	c.(556-558)atC>atG	p.I186M	PLOD1_ENST00000376369.3_Missense_Mutation_p.I233M|PLOD1_ENST00000485046.1_3'UTR	NM_000302.3	NP_000293.2	Q02809	PLOD1_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1	186					cellular protein modification process (GO:0006464)|epidermis development (GO:0008544)|extracellular matrix organization (GO:0030198)|hydroxylysine biosynthetic process (GO:0046947)|oxidation-reduction process (GO:0055114)|response to hypoxia (GO:0001666)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-lysine 5-dioxygenase activity (GO:0008475)|protein homodimerization activity (GO:0042803)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	29	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.06e-06)|COAD - Colon adenocarcinoma(227;0.000273)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.000809)|KIRC - Kidney renal clear cell carcinoma(229;0.00267)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)	Succinic acid(DB00139)|Vitamin C(DB00126)	ACACCAAGATCTTCTTGGACC	0.617																																																	0													76.0	72.0	74.0					1																	12012771		2203	4300	6503	SO:0001583	missense	0			BC016657	CCDS142.1	1p36.22	2011-08-25	2011-08-24	2004-12-14	ENSG00000083444	ENSG00000083444	1.14.11.4		9081	protein-coding gene	gene with protein product	"""lysyl hydroxlase 1"""	153454	"""procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase (lysine hydroxylase, Ehlers-Danlos syndrome type VI)"""	LLH, PLOD		1577494	Standard	NM_000302		Approved	LH1	uc001atm.3	Q02809	OTTHUMG00000002393	ENST00000196061.4:c.558C>G	1.37:g.12012771C>G	ENSP00000196061:p.Ile186Met		B4DR87|Q96AV9|Q9H132	Missense_Mutation	SNP	pfam_Oxoglu/Fe-dep_dioxygenase,smart_Pro_4_hyd_alph	p.I233M	ENST00000196061.4	37	c.699	CCDS142.1	1	.	.	.	.	.	.	.	.	.	.	C	17.57	3.423077	0.62733	.	.	ENSG00000083444	ENST00000358133;ENST00000376369;ENST00000429000;ENST00000196061	T;T;T	0.32988	1.43;1.43;1.43	4.61	4.61	0.57282	.	0.054803	0.64402	D	0.000001	T	0.51381	0.1671	M	0.83483	2.645	0.58432	D	0.999997	D;P	0.57899	0.981;0.948	P;P	0.53224	0.721;0.595	T	0.62039	-0.6938	10	0.87932	D	0	.	16.5981	0.84802	0.0:1.0:0.0:0.0	.	233;186	B4DR87;Q02809	.;PLOD1_HUMAN	M	186;233;186;186	ENSP00000365548:I233M;ENSP00000405372:I186M;ENSP00000196061:I186M	ENSP00000196061:I186M	I	+	3	3	PLOD1	11935358	1.000000	0.71417	1.000000	0.80357	0.751000	0.42716	1.356000	0.34079	2.380000	0.81148	0.555000	0.69702	ATC	PLOD1	-	NULL	ENSG00000083444		0.617	PLOD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLOD1	HGNC	protein_coding	OTTHUMT00000006865.1	-	0.00	39	0	C	NM_000302		12012771	+1	tier1	-	no_errors	ENST00000376369	ensembl	human	known	74_37	missense	44.74	21	17	SNP	1.000	G
PLXNA2	5362	genome.wustl.edu	37	1	208213028	208213028	+	Missense_Mutation	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:208213028C>T	ENST00000367033.3	-	24	5195	c.4438G>A	c.(4438-4440)Gag>Aag	p.E1480K		NM_025179.3	NP_079455.3	O75051	PLXA2_HUMAN	plexin A2	1480					axon guidance (GO:0007411)|centrosome localization (GO:0051642)|cerebellar granule cell precursor tangential migration (GO:0021935)|limb bud formation (GO:0060174)|neural tube development (GO:0021915)|pharyngeal system development (GO:0060037)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|somitogenesis (GO:0001756)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)	80				OV - Ovarian serous cystadenocarcinoma(81;0.199)		TAGCGGGCCTCGCCCGTGATG	0.612																																																	0													88.0	84.0	86.0					1																	208213028		2203	4300	6503	SO:0001583	missense	0			X87831	CCDS31013.1	1q32.2	2008-07-18			ENSG00000076356	ENSG00000076356		"""Plexins"""	9100	protein-coding gene	gene with protein product	"""plexin 2"", ""plexin-A2"", ""semaphorin receptor OCT"", ""transmembrane protein OCT"""	601054		PLXN2		8570614	Standard	NM_025179		Approved	OCT, FLJ11751, FLJ30634, KIAA0463	uc001hgz.3	O75051	OTTHUMG00000036564	ENST00000367033.3:c.4438G>A	1.37:g.208213028C>T	ENSP00000356000:p.Glu1480Lys		A2RTX9|B2RMX7|Q6UX61|Q96GN9|Q9BRL1|Q9UIW1	Missense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semap_dom,pfam_IPT,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.E1480K	ENST00000367033.3	37	c.4438	CCDS31013.1	1	.	.	.	.	.	.	.	.	.	.	C	33	5.278447	0.95459	.	.	ENSG00000076356	ENST00000367033	T	0.10668	2.85	5.51	5.51	0.81932	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.26195	0.0639	L	0.37507	1.11	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.00500	-1.1703	10	0.41790	T	0.15	.	19.4545	0.94882	0.0:1.0:0.0:0.0	.	1480	O75051	PLXA2_HUMAN	K	1480	ENSP00000356000:E1480K	ENSP00000356000:E1480K	E	-	1	0	PLXNA2	206279651	1.000000	0.71417	1.000000	0.80357	0.847000	0.48162	5.825000	0.69286	2.590000	0.87494	0.650000	0.86243	GAG	PLXNA2	-	pfam_Plexin_cytoplasmic_RasGAP_dom,superfamily_Rho_GTPase_activation_prot	ENSG00000076356		0.612	PLXNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA2	HGNC	protein_coding	OTTHUMT00000088932.6		0.00	43	0	C	NM_025179		208213028	-1			no_errors	ENST00000367033	ensembl	human	known	74_37	missense	13.51	32	5	SNP	1.000	T
PMPCA	23203	genome.wustl.edu	37	9	139310748	139310748	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr9:139310748G>C	ENST00000371717.3	+	6	547	c.538G>C	c.(538-540)Gaa>Caa	p.E180Q	PMPCA_ENST00000371720.1_3'UTR|PMPCA_ENST00000399219.3_Missense_Mutation_p.E49Q|PMPCA_ENST00000462616.1_3'UTR	NM_001282946.1|NM_015160.1	NP_001269875.1|NP_055975.1	Q10713	MPPA_HUMAN	peptidase (mitochondrial processing) alpha	180					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)|proteolysis (GO:0006508)	extracellular space (GO:0005615)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			endometrium(3)|kidney(1)|large_intestine(1)|lung(6)|ovary(2)|urinary_tract(1)	14		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;9.3e-06)|Epithelial(140;1.15e-05)		TGCAGATGAAGAAGTCGAGAT	0.562																																																	0													100.0	91.0	94.0					9																	139310748		2203	4300	6503	SO:0001583	missense	0			D21064	CCDS35180.1, CCDS65192.1	9q34.3	2008-02-05	2003-06-13	2003-06-20	ENSG00000165688	ENSG00000165688			18667	protein-coding gene	gene with protein product		613036	"""inositol polyphosphate-5-phosphatase, 72 kD"""	INPP5E		8590280, 7788527	Standard	NM_015160		Approved	KIAA0123, Alpha-MPP	uc004chl.3	Q10713	OTTHUMG00000020926	ENST00000371717.3:c.538G>C	9.37:g.139310748G>C	ENSP00000360782:p.Glu180Gln		B4DKL3|E7ET61|Q16639|Q5SXM9|Q8N513	Missense_Mutation	SNP	pfam_Pept_M16_N,pfam_Peptidase_M16_C,superfamily_Metalloenz_LuxS/M16	p.E180Q	ENST00000371717.3	37	c.538	CCDS35180.1	9	.	.	.	.	.	.	.	.	.	.	G	26.4	4.736154	0.89482	.	.	ENSG00000165688	ENST00000371717;ENST00000399219	T;T	0.45668	2.08;0.89	5.34	5.34	0.76211	Peptidase M16, core (1);Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);Peptidase M16, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.68760	0.3036	M	0.83953	2.67	0.80722	D	1	D;D;D;D	0.89917	0.997;0.999;1.0;1.0	D;D;D;D	0.81914	0.968;0.992;0.995;0.995	T	0.73069	-0.4099	10	0.72032	D	0.01	.	18.4007	0.90515	0.0:0.0:1.0:0.0	.	49;180;180;180	B4DKL3;B4DRK5;Q5SXM9;Q10713	.;.;.;MPPA_HUMAN	Q	180;49	ENSP00000360782:E180Q;ENSP00000416702:E49Q	ENSP00000360782:E180Q	E	+	1	0	PMPCA	138430569	1.000000	0.71417	0.067000	0.19924	0.012000	0.07955	9.563000	0.98148	2.647000	0.89833	0.655000	0.94253	GAA	PMPCA	-	pfam_Pept_M16_N,superfamily_Metalloenz_LuxS/M16	ENSG00000165688		0.562	PMPCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMPCA	HGNC	protein_coding	OTTHUMT00000055054.1	-	0.00	9	0	G	NM_015160		139310748	+1	tier1	-	no_errors	ENST00000371717	ensembl	human	known	74_37	missense	29.03	22	9	SNP	0.996	C
PMS2CL	441194	genome.wustl.edu	37	7	6750417	6750417	+	RNA	SNP	G	G	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr7:6750417G>T	ENST00000366167.2	+	0	1128				PMS2CL_ENST00000486256.1_RNA																							GCCACGAGGGGCCCCAACAGA	0.512																																																	0																																												0																															7.37:g.6750417G>T				RNA	SNP	-	NULL	ENST00000366167.2	37	NULL		7																																																																																			PMS2CL	-	-	ENSG00000187953		0.512	AC073343.13-001	KNOWN	basic	antisense	PMS2CL	HGNC	antisense	OTTHUMT00000326013.1	-	0.00	53	0	G			6750417	+1	tier1	-	no_errors	ENST00000486256	ensembl	human	known	74_37	rna	7.81	59	5	SNP	0.001	T
PNLIPRP2	5408	genome.wustl.edu	37	10	118383542	118383542	+	RNA	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr10:118383542C>T	ENST00000298771.7	+	0	161				PNLIPRP2_ENST00000433618.4_RNA|PNLIPRP2_ENST00000537242.1_RNA	NR_103727.1		P54317	LIPR2_HUMAN	pancreatic lipase-related protein 2						galactolipid catabolic process (GO:0019376)|lipid digestion (GO:0044241)|phospholipid catabolic process (GO:0009395)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	acylglycerol lipase activity (GO:0047372)|calcium ion binding (GO:0005509)|galactolipase activity (GO:0047714)|phospholipase activity (GO:0004620)|triglyceride lipase activity (GO:0004806)			endometrium(1)|large_intestine(1)|lung(11)|prostate(3)	16				all cancers(201;0.015)		AAAATTACTTCCCTGGTCCCC	0.488																																																	0													112.0	109.0	110.0					10																	118383542		1893	4127	6020			0			M93284		10q26.12	2014-03-14				ENSG00000266200	3.1.1.3		9157	protein-coding gene	gene with protein product		604423				1379598	Standard	NM_005396		Approved	PLRP2	uc001lcq.3	P54317			10.37:g.118383542C>T			A8K627|Q6IB55	Missense_Mutation	SNP	pirsf_Lipoprotein_lipase_LIPH,pfam_Lipase_N,pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,prints_Lipase_panc,prints_Lipase,pfscan_PLAT/LH2_dom	p.P46S	ENST00000298771.7	37	c.136		10	.	.	.	.	.	.	.	.	.	.	C	26.8	4.775923	0.90195	.	.	ENSG00000165862	ENST00000537242	D	0.90444	-2.67	5.65	5.65	0.86999	Lipase, N-terminal (1);	0.000000	0.56097	D	0.000021	D	0.95465	0.8527	.	.	.	0.34787	D	0.735286	D	0.60575	0.988	D	0.71184	0.972	D	0.98245	1.0490	9	0.87932	D	0	.	18.4917	0.90851	0.0:1.0:0.0:0.0	.	46	P54317	LIPR2_HUMAN	S	46	ENSP00000446346:P46S	ENSP00000446346:P46S	P	+	1	0	PNLIPRP2	118373532	1.000000	0.71417	0.685000	0.30070	0.276000	0.26787	5.875000	0.69660	2.660000	0.90430	0.555000	0.69702	CCC	PNLIPRP2	-	pirsf_Lipoprotein_lipase_LIPH,pfam_Lipase_N,prints_Lipase_panc	ENSG00000165862		0.488	PNLIPRP2-004	KNOWN	basic	processed_transcript	PNLIPRP2	HGNC	polymorphic_pseudogene	OTTHUMT00000050546.6	-	0.00	79	0	C	NM_005396		118383542	+1	tier1	-	no_errors	ENST00000537242	ensembl	human	known	74_37	missense	12.00	66	9	SNP	0.997	T
POGZ	23126	genome.wustl.edu	37	1	151377628	151377628	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:151377628C>G	ENST00000271715.2	-	19	4197	c.3883G>C	c.(3883-3885)Gat>Cat	p.D1295H	POGZ_ENST00000540984.1_Missense_Mutation_p.D657H|POGZ_ENST00000361398.3_Missense_Mutation_p.D1242H|POGZ_ENST00000531094.1_Missense_Mutation_p.D1233H|POGZ_ENST00000491586.1_Missense_Mutation_p.D1251H|POGZ_ENST00000368863.2_Missense_Mutation_p.D1200H|POGZ_ENST00000409503.1_Missense_Mutation_p.D1286H|POGZ_ENST00000392723.1_Missense_Mutation_p.D1242H	NM_001194937.1|NM_015100.3	NP_001181866.1|NP_055915.2	Q7Z3K3	POGZ_HUMAN	pogo transposable element with ZNF domain	1295	DDE.				kinetochore assembly (GO:0051382)|mitotic sister chromatid cohesion (GO:0007064)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(10)|kidney(3)|large_intestine(10)|liver(2)|lung(11)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	47	Lung SC(34;0.00471)|Ovarian(49;0.00672)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			AGCAGGACATCAGAATCACAT	0.488																																																	0													176.0	171.0	173.0					1																	151377628		2203	4300	6503	SO:0001583	missense	0			AB007930	CCDS997.1, CCDS998.1, CCDS44222.1, CCDS44222.2, CCDS53365.1, CCDS53366.1	1q21.1	2013-07-22			ENSG00000143442	ENSG00000143442			18801	protein-coding gene	gene with protein product	"""zinc finger protein 280E"", ""putative protein product of Nbla00003"""	614787				10976766	Standard	NM_015100		Approved	KIAA0461, ZNF635m, ZNF280E	uc001eyd.2	Q7Z3K3	OTTHUMG00000012499	ENST00000271715.2:c.3883G>C	1.37:g.151377628C>G	ENSP00000271715:p.Asp1295His		B4DTP8|B4DYL9|B7ZBY5|E9PM80|O75049|Q3LIC4|Q5SZS1|Q5SZS2|Q5SZS3|Q5SZS4|Q8TDZ7|Q9Y4X7	Missense_Mutation	SNP	pfam_DDE_SF_endonuclease_CENPB-like,pfam_HTH_CenpB_DNA-bd_dom,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_HTH_CenpB_DNA-bd_dom,pfscan_Znf_C2H2	p.D1295H	ENST00000271715.2	37	c.3883	CCDS997.1	1	.	.	.	.	.	.	.	.	.	.	C	14.74	2.624573	0.46840	.	.	ENSG00000143442	ENST00000392723;ENST00000271715;ENST00000361398;ENST00000368863;ENST00000409503;ENST00000531094;ENST00000540984;ENST00000491586	T;T;T;T;T;T;T;T	0.24908	5.79;5.82;5.79;5.76;5.8;5.8;1.83;5.28	6.17	4.27	0.50696	.	0.226102	0.37178	N	0.002214	T	0.24624	0.0597	L	0.29908	0.895	0.36414	D	0.863938	D;B;D;D;D;D	0.89917	1.0;0.0;1.0;1.0;1.0;1.0	D;B;D;D;D;D	0.87578	0.998;0.005;0.998;0.998;0.997;0.998	T	0.11641	-1.0579	10	0.87932	D	0	-2.4717	10.6768	0.45792	0.0:0.7957:0.1332:0.0711	.	1233;1286;1200;1251;1242;1295	E9PM80;B7ZBY5;Q7Z3K3-5;Q7Z3K3-3;Q7Z3K3-2;Q7Z3K3	.;.;.;.;.;POGZ_HUMAN	H	1242;1295;1242;1200;1286;1233;657;1251	ENSP00000376484:D1242H;ENSP00000271715:D1295H;ENSP00000354467:D1242H;ENSP00000357856:D1200H;ENSP00000386836:D1286H;ENSP00000431259:D1233H;ENSP00000443547:D657H;ENSP00000418408:D1251H	ENSP00000271715:D1295H	D	-	1	0	POGZ	149644252	0.785000	0.28726	0.956000	0.39512	0.979000	0.70002	2.943000	0.49026	0.897000	0.36392	0.655000	0.94253	GAT	POGZ	-	NULL	ENSG00000143442		0.488	POGZ-001	KNOWN	basic|CCDS	protein_coding	POGZ	HGNC	protein_coding	OTTHUMT00000034915.2	-	0.00	23	0	C	NM_207171		151377628	-1	tier1	-	no_errors	ENST00000271715	ensembl	human	known	74_37	missense	37.84	23	14	SNP	0.980	G
POLDIP3	84271	genome.wustl.edu	37	22	42992255	42992255	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr22:42992255C>G	ENST00000252115.5	-	5	854	c.750G>C	c.(748-750)ttG>ttC	p.L250F	POLDIP3_ENST00000451060.2_Missense_Mutation_p.L94F|POLDIP3_ENST00000491021.1_5'UTR|POLDIP3_ENST00000339677.6_Intron|POLDIP3_ENST00000348657.2_Missense_Mutation_p.L221F	NM_032311.3	NP_115687.2	Q9BY77	PDIP3_HUMAN	polymerase (DNA-directed), delta interacting protein 3	250					poly(A)+ mRNA export from nucleus (GO:0016973)|positive regulation of translation (GO:0045727)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			biliary_tract(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(3)|upper_aerodigestive_tract(1)	16						ACATGTTGGTCAAGGCTTTTG	0.542																																					Ovarian(52;967 1128 5875 19997 42537)												0													133.0	123.0	126.0					22																	42992255		2203	4300	6503	SO:0001583	missense	0				CCDS14038.1, CCDS14039.1, CCDS74873.1	22q13.31	2013-02-12			ENSG00000100227	ENSG00000100227		"""RNA binding motif (RRM) containing"""	23782	protein-coding gene	gene with protein product		611520				12522211	Standard	NM_032311		Approved	PDIP46, KIAA1649	uc003bcu.3	Q9BY77	OTTHUMG00000150887	ENST00000252115.5:c.750G>C	22.37:g.42992255C>G	ENSP00000252115:p.Leu250Phe		A8K6F8|A8K6V9|Q009A7|Q5H972|Q6PGN6|Q7Z6Z0|Q9NSP5|Q9NSP6	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.L250F	ENST00000252115.5	37	c.750	CCDS14038.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.24|19.24	3.789109|3.789109	0.70337|0.70337	.|.	.|.	ENSG00000100227|ENSG00000100227	ENST00000348657;ENST00000252115;ENST00000451060|ENST00000452567	.|.	.|.	.|.	5.95|5.95	4.94|4.94	0.65067|0.65067	.|.	0.581756|.	0.17796|.	N|.	0.161736|.	T|.	0.64472|.	0.2601|.	M|M	0.62723|0.62723	1.935|1.935	0.42479|0.42479	D|D	0.992856|0.992856	D;D;D;D|.	0.89917|.	1.0;0.999;0.999;0.999|.	D;D;D;D|.	0.91635|.	0.999;0.998;0.978;0.998|.	T|.	0.64271|.	-0.6447|.	9|.	0.32370|.	T|.	0.25|.	-3.1829|-3.1829	11.2095|11.2095	0.48790|0.48790	0.0:0.8036:0.1282:0.0682|0.0:0.8036:0.1282:0.0682	.|.	267;246;221;250|.	B4E0L0;Q96DI9;Q9BY77-2;Q9BY77|.	.;.;.;PDIP3_HUMAN|.	F|S	221;250;94|185	.|.	ENSP00000252115:L250F|.	L|X	-|-	3|2	2|2	POLDIP3|POLDIP3	41322199|41322199	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	2.319000|2.319000	0.43788|0.43788	1.530000|1.530000	0.49136|0.49136	0.655000|0.655000	0.94253|0.94253	TTG|TGA	POLDIP3	-	NULL	ENSG00000100227		0.542	POLDIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLDIP3	HGNC	protein_coding	OTTHUMT00000320433.1	-	0.00	46	0	C	NM_032311		42992255	-1	tier1	-	no_errors	ENST00000252115	ensembl	human	known	74_37	missense	43.48	26	20	SNP	1.000	G
POLE	5426	genome.wustl.edu	37	12	133226308	133226308	+	Silent	SNP	G	G	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr12:133226308G>T	ENST00000320574.5	-	30	3793	c.3750C>A	c.(3748-3750)ccC>ccA	p.P1250P	POLE_ENST00000535270.1_Silent_p.P1223P	NM_006231.2	NP_006222.2	Q07864	DPOE1_HUMAN	polymerase (DNA directed), epsilon, catalytic subunit	1250					base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA synthesis involved in DNA repair (GO:0000731)|G1/S transition of mitotic cell cycle (GO:0000082)|in utero embryonic development (GO:0001701)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	cytoplasm (GO:0005737)|epsilon DNA polymerase complex (GO:0008622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|nucleotide binding (GO:0000166)|zinc ion binding (GO:0008270)			NS(2)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(41)|ovary(3)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	89	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)	Cladribine(DB00242)	TTTCCTGCCAGGGCACAGTCG	0.617								DNA polymerases (catalytic subunits)																																									0													119.0	116.0	117.0					12																	133226308		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS9278.1	12q24.3	2014-09-17	2012-05-18		ENSG00000177084	ENSG00000177084		"""DNA polymerases"""	9177	protein-coding gene	gene with protein product	"""DNA polymerase epsilon catalytic subunit A"""	174762	"""polymerase (DNA directed), epsilon"""			8020968	Standard	NM_006231		Approved	POLE1	uc001uks.1	Q07864	OTTHUMG00000168045	ENST00000320574.5:c.3750C>A	12.37:g.133226308G>T			Q13533|Q86VH9	Silent	SNP	pfam_DNA_pol_e_suA_C,pfam_DNA-dir_DNA_pol_B_exonuc,pfam_DNA-dir_DNA_pol_B_multi_dom,pfam_3'-5'_exonuclease_PolB-like,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B	p.P1250	ENST00000320574.5	37	c.3750	CCDS9278.1	12																																																																																			POLE	-	NULL	ENSG00000177084		0.617	POLE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLE	HGNC	protein_coding	OTTHUMT00000397689.2		0.00	33	0	G	NM_006231		133226308	-1			no_errors	ENST00000320574	ensembl	human	known	74_37	silent	8.57	32	3	SNP	1.000	T
POLQ	10721	genome.wustl.edu	37	3	121207808	121207808	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr3:121207808G>C	ENST00000264233.5	-	16	4098	c.3970C>G	c.(3970-3972)Ctg>Gtg	p.L1324V		NM_199420.3	NP_955452.3	O75417	DPOLQ_HUMAN	polymerase (DNA directed), theta	1324					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(55)|ovary(5)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	120				GBM - Glioblastoma multiforme(114;0.0915)		TGAGTATCCAGATAGAAACTA	0.363								DNA polymerases (catalytic subunits)																													Pancreas(152;907 1925 26081 31236 36904)												0													138.0	127.0	131.0					3																	121207808		2203	4300	6503	SO:0001583	missense	0			AF052573	CCDS33833.1	3q13.3	2012-05-18			ENSG00000051341	ENSG00000051341	2.7.7.7	"""DNA polymerases"""	9186	protein-coding gene	gene with protein product		604419				10395804	Standard	NM_199420		Approved	POLH	uc003eee.4	O75417	OTTHUMG00000159396	ENST00000264233.5:c.3970C>G	3.37:g.121207808G>C	ENSP00000264233:p.Leu1324Val		O95160|Q6VMB5	Missense_Mutation	SNP	pfam_DNA-dir_DNA_pol_A_palm_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_RNaseH-like_dom,smart_Helicase_ATP-bd,smart_Helicase_C,smart_DNA-dir_DNA_pol_A_palm_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,prints_DNA_polymerase_A	p.L1324V	ENST00000264233.5	37	c.3970	CCDS33833.1	3	.	.	.	.	.	.	.	.	.	.	G	17.06	3.291825	0.59976	.	.	ENSG00000051341	ENST00000543272;ENST00000264233;ENST00000393672	T	0.69040	-0.37	6.11	3.36	0.38483	.	0.172077	0.38663	N	0.001620	T	0.71126	0.3303	L	0.36672	1.1	0.28381	N	0.919547	D;D	0.89917	0.999;1.0	D;D	0.85130	0.918;0.997	T	0.64411	-0.6414	10	0.72032	D	0.01	.	8.8848	0.35396	0.3497:0.0:0.6503:0.0	.	1324;496	O75417;O75417-2	DPOLQ_HUMAN;.	V	947;1324;1460	ENSP00000264233:L1324V	ENSP00000264233:L1324V	L	-	1	2	POLQ	122690498	0.999000	0.42202	0.087000	0.20705	0.971000	0.66376	2.421000	0.44688	0.455000	0.26910	0.655000	0.94253	CTG	POLQ	-	NULL	ENSG00000051341		0.363	POLQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLQ	HGNC	protein_coding	OTTHUMT00000355097.1	-	0.00	50	0	G	NM_199420		121207808	-1	tier1	-	no_errors	ENST00000264233	ensembl	human	known	74_37	missense	30.23	30	13	SNP	0.977	C
POLR1B	84172	genome.wustl.edu	37	2	113331138	113331138	+	Splice_Site	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr2:113331138G>A	ENST00000263331.5	+	14	2851		c.e14-1		POLR1B_ENST00000541869.1_Splice_Site|POLR1B_ENST00000537335.1_Splice_Site|POLR1B_ENST00000409894.3_Splice_Site|POLR1B_ENST00000417433.2_Splice_Site	NM_019014.4	NP_061887.2	Q9H9Y6	RPA2_HUMAN	polymerase (RNA) I polypeptide B, 128kDa						gene expression (GO:0010467)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|ribonucleoside binding (GO:0032549)			breast(3)|endometrium(9)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	42						TTACTTCACAGATTGTGAATA	0.388																																					Ovarian(16;256 576 9537 23969 41147)												0													60.0	61.0	61.0					2																	113331138		2203	4300	6503	SO:0001630	splice_region_variant	0			AK001678	CCDS2097.1, CCDS46395.1, CCDS62988.1, CCDS62989.1, CCDS62990.1	2q13	2013-01-21			ENSG00000125630	ENSG00000125630		"""RNA polymerase subunits"""	20454	protein-coding gene	gene with protein product		602000					Standard	NM_001137604		Approved	Rpo1-2, FLJ21921, FLJ10816, RPA2	uc002thw.2	Q9H9Y6	OTTHUMG00000131314	ENST00000263331.5:c.2272-1G>A	2.37:g.113331138G>A			B7Z6Y7|B7Z823|F5GZX4|F8W898|Q2TAM4|Q585T5|Q6ZRR2|Q9H9D3	Splice_Site	SNP	-	e15-1	ENST00000263331.5	37	c.2386-1	CCDS2097.1	2	.	.	.	.	.	.	.	.	.	.	G	23.8	4.457078	0.84317	.	.	ENSG00000125630	ENST00000263331;ENST00000541869;ENST00000409894;ENST00000537335;ENST00000417433;ENST00000458012;ENST00000536096	.	.	.	5.35	5.35	0.76521	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.8475	0.88734	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	POLR1B	113047609	1.000000	0.71417	0.996000	0.52242	0.932000	0.56968	9.365000	0.97139	2.490000	0.84030	0.650000	0.86243	.	POLR1B	-	-	ENSG00000125630		0.388	POLR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR1B	HGNC	protein_coding	OTTHUMT00000254083.1	-	0.00	40	0	G	NM_019014	Intron	113331138	+1	tier1	-	no_errors	ENST00000541869	ensembl	human	known	74_37	splice_site	21.43	44	12	SNP	1.000	A
POM121L2	94026	genome.wustl.edu	37	6	27278167	27278167	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr6:27278167G>C	ENST00000444565.1	-	1	1782	c.1783C>G	c.(1783-1785)Cct>Gct	p.P595A	POM121L2_ENST00000377451.2_Missense_Mutation_p.P531A	NM_033482.3	NP_258443.2	Q96KW2	P12L2_HUMAN	POM121 transmembrane nucleoporin-like 2	595										breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|skin(1)	7						GAGGAGAAAGGAGCTATCATG	0.488																																																	0													84.0	75.0	78.0					6																	27278167		692	1591	2283	SO:0001583	missense	0			AL021808	CCDS59497.1	6p21.3	2012-03-13	2012-03-13		ENSG00000158553	ENSG00000158553			13973	protein-coding gene	gene with protein product			"""POM121 membrane glycoprotein-like 2 (rat)"", ""POM121 membrane glycoprotein-like 2"""				Standard	NM_033482		Approved	POM121-L	uc011dku.1	Q96KW2	OTTHUMG00000014475	ENST00000444565.1:c.1783C>G	6.37:g.27278167G>C	ENSP00000392726:p.Pro595Ala		C9J1I7	Missense_Mutation	SNP	NULL	p.P595A	ENST00000444565.1	37	c.1783	CCDS59497.1	6	.	.	.	.	.	.	.	.	.	.	G	15.80	2.939501	0.52972	.	.	ENSG00000158553	ENST00000377451;ENST00000444565	T;T	0.30448	1.78;1.53	4.11	1.15	0.20763	.	0.508491	0.14783	N	0.298700	T	0.16085	0.0387	M	0.71206	2.165	0.09310	N	1	B	0.30146	0.27	B	0.28139	0.086	T	0.16424	-1.0403	10	0.56958	D	0.05	.	11.7856	0.52041	0.0:0.5357:0.4643:0.0	.	595	C9J1I7	.	A	531;595	ENSP00000366671:P531A;ENSP00000392726:P595A	ENSP00000366671:P531A	P	-	1	0	POM121L2	27386146	0.055000	0.20627	0.000000	0.03702	0.506000	0.33950	0.877000	0.28106	0.231000	0.21079	0.484000	0.47621	CCT	POM121L2	-	NULL	ENSG00000158553		0.488	POM121L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POM121L2	HGNC	protein_coding	OTTHUMT00000040143.2		0.00	15	0	G	NM_033482		27278167	-1			no_errors	ENST00000444565	ensembl	human	known	74_37	missense	12.50	21	3	SNP	0.000	C
PPARD	5467	genome.wustl.edu	37	6	35392450	35392450	+	Silent	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr6:35392450C>T	ENST00000311565.4	+	8	1321	c.972C>T	c.(970-972)ttC>ttT	p.F324F	PPARD_ENST00000360694.3_Silent_p.F324F|PPARD_ENST00000448077.2_Silent_p.F285F|PPARD_ENST00000418635.2_Silent_p.F226F|PPARD_ENST00000337400.2_Silent_p.F324F|PPARD_ENST00000540939.1_Silent_p.F221F|PPARD_ENST00000444397.1_Silent_p.F324F	NM_001171818.1	NP_001165289.1	Q03181	PPARD_HUMAN	peroxisome proliferator-activated receptor delta	324	Ligand-binding.				adipose tissue development (GO:0060612)|anagen (GO:0042640)|apoptotic signaling pathway (GO:0097190)|axon ensheathment (GO:0008366)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cell-substrate adhesion (GO:0031589)|cellular response to hypoxia (GO:0071456)|cholesterol metabolic process (GO:0008203)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|fatty acid beta-oxidation (GO:0006635)|fatty acid catabolic process (GO:0009062)|fatty acid transport (GO:0015908)|gene expression (GO:0010467)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glucose transport (GO:0015758)|heart development (GO:0007507)|intracellular receptor signaling pathway (GO:0030522)|keratinocyte migration (GO:0051546)|keratinocyte proliferation (GO:0043616)|lipid metabolic process (GO:0006629)|mRNA transcription (GO:0009299)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of collagen biosynthetic process (GO:0032966)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of inflammatory response (GO:0050728)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|phospholipid biosynthetic process (GO:0008654)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epidermis development (GO:0045684)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of insulin secretion (GO:0032024)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vasodilation (GO:0045909)|proteoglycan metabolic process (GO:0006029)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to activity (GO:0014823)|response to glucose (GO:0009749)|response to vitamin A (GO:0033189)|transcription initiation from RNA polymerase II promoter (GO:0006367)|vitamin A metabolic process (GO:0006776)|wound healing (GO:0042060)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|drug binding (GO:0008144)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|linoleic acid binding (GO:0070539)|lipid binding (GO:0008289)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(1)|endometrium(1)|large_intestine(4)|liver(2)|lung(9)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	23					Bezafibrate(DB01393)|Icosapent(DB00159)|Sulindac(DB00605)|Treprostinil(DB00374)	GCAAACCCTTCAGTGATATCA	0.532																																																	0													69.0	65.0	66.0					6																	35392450		2203	4300	6503	SO:0001819	synonymous_variant	0			L07592	CCDS4803.1, CCDS4804.1, CCDS54994.1, CCDS54995.1	6p21.2	2013-01-16	2006-10-17		ENSG00000112033	ENSG00000112033		"""Nuclear hormone receptors"""	9235	protein-coding gene	gene with protein product		600409	"""peroxisome proliferative activated receptor, delta"""			1333051	Standard	NM_177435		Approved	NUC1, NUCII, FAAR, NR1C2	uc003okm.3	Q03181	OTTHUMG00000014567	ENST00000311565.4:c.972C>T	6.37:g.35392450C>T			A8K6J6|B4E3V3|B6ZGS1|B7Z3W1|E9PE18|Q5D1P0|Q7Z5K0|Q9BUD4	Silent	SNP	pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_1Cnucl_rcpt,prints_Str_hrmn_rcpt,prints_1Cnucl_rcpt_B,prints_Znf_hrmn_rcpt,prints_1Cnucl_rcpt_A	p.F324	ENST00000311565.4	37	c.972	CCDS4803.1	6																																																																																			PPARD	-	pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Nucl_hrmn_rcpt_lig-bd_core	ENSG00000112033		0.532	PPARD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PPARD	HGNC	protein_coding	OTTHUMT00000040288.1	-	0.00	37	0	C	NM_006238		35392450	+1	tier1	-	no_errors	ENST00000311565	ensembl	human	known	74_37	silent	30.00	14	6	SNP	1.000	T
PPARG	5468	genome.wustl.edu	37	3	12447448	12447448	+	Silent	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr3:12447448C>T	ENST00000287820.6	+	5	808	c.687C>T	c.(685-687)atC>atT	p.I229I	PPARG_ENST00000397010.2_Silent_p.I201I|PPARG_ENST00000397000.1_Silent_p.I201I|PPARG_ENST00000539812.1_Silent_p.I199I|PPARG_ENST00000397012.2_Silent_p.I201I|PPARG_ENST00000397015.2_Silent_p.I201I|PPARG_ENST00000397026.2_Silent_p.I207I|PPARG_ENST00000309576.6_Silent_p.I201I	NM_015869.4	NP_056953.2	P37231	PPARG_HUMAN	peroxisome proliferator-activated receptor gamma	229	Interaction with FAM120B. {ECO:0000250}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|brown fat cell differentiation (GO:0050873)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|cellular response to insulin stimulus (GO:0032869)|cellular response to lithium ion (GO:0071285)|epithelial cell differentiation (GO:0030855)|fatty acid oxidation (GO:0019395)|G-protein coupled receptor signaling pathway (GO:0007186)|gene expression (GO:0010467)|glucose homeostasis (GO:0042593)|heart development (GO:0007507)|innate immune response (GO:0045087)|lipid homeostasis (GO:0055088)|lipid metabolic process (GO:0006629)|lipoprotein transport (GO:0042953)|long-chain fatty acid transport (GO:0015909)|low-density lipoprotein particle receptor biosynthetic process (GO:0045713)|monocyte differentiation (GO:0030224)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of cell growth (GO:0030308)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of receptor biosynthetic process (GO:0010871)|negative regulation of sequestering of triglyceride (GO:0010891)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of telomerase activity (GO:0051974)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|organ regeneration (GO:0031100)|peroxisome proliferator activated receptor signaling pathway (GO:0035357)|placenta development (GO:0001890)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of blood pressure (GO:0008217)|regulation of cholesterol transporter activity (GO:0060694)|regulation of transcription involved in cell fate commitment (GO:0060850)|response to caffeine (GO:0031000)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to lipid (GO:0033993)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|response to retinoic acid (GO:0032526)|response to vitamin A (GO:0033189)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|white fat cell differentiation (GO:0050872)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	activating transcription factor binding (GO:0033613)|arachidonic acid binding (GO:0050544)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|prostaglandin receptor activity (GO:0004955)|retinoid X receptor binding (GO:0046965)|RNA polymerase II regulatory region DNA binding (GO:0001012)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)		PAX8/PPARG(117)	breast(2)|endometrium(4)|kidney(3)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)	20					Balsalazide(DB01014)|Bezafibrate(DB01393)|Glipizide(DB01067)|Ibuprofen(DB01050)|Icosapent(DB00159)|Indomethacin(DB00328)|Mesalazine(DB00244)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Pioglitazone(DB01132)|Repaglinide(DB00912)|Rosiglitazone(DB00412)|Sulfasalazine(DB00795)|Telmisartan(DB00966)	CCAGTGATATCGACCAGCTGA	0.527			T	PAX8	follicular thyroid		"""Insulin resistance ; lipodystrophy, familial partial L;diabetes mellitus, insulin-resistantI, with acanthosis nigricans and hypertension"""																																	Dom	yes		3	3p25	5468	"""peroxisome proliferative activated receptor, gamma"""	yes	E	0													80.0	78.0	79.0					3																	12447448		2203	4300	6503	SO:0001819	synonymous_variant	0			X90563	CCDS2609.1, CCDS2610.2	3p25	2013-01-16	2006-10-17		ENSG00000132170	ENSG00000132170		"""Nuclear hormone receptors"""	9236	protein-coding gene	gene with protein product		601487	"""peroxisome proliferative activated receptor, gamma"""			7862171, 9750197	Standard	NM_005037		Approved	PPARG1, PPARG2, NR1C3, PPARgamma	uc003bwx.3	P37231	OTTHUMG00000129764	ENST00000287820.6:c.687C>T	3.37:g.12447448C>T			A8K3G6|B5BUA1|O00684|O00710|O14515|Q0QJH8|Q15178|Q15179|Q15180|Q15832|Q86U60|Q96J12	Silent	SNP	pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_PPARgamma_N,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_1Cnucl_rcpt,prints_1Cnucl_rcpt_G,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.I229	ENST00000287820.6	37	c.687	CCDS2609.1	3																																																																																			PPARG	-	prints_1Cnucl_rcpt,prints_1Cnucl_rcpt_G	ENSG00000132170		0.527	PPARG-002	KNOWN	basic|CCDS	protein_coding	PPARG	HGNC	protein_coding	OTTHUMT00000251979.2	-	0.00	28	0	C	NM_005037		12447448	+1	tier1	-	no_errors	ENST00000287820	ensembl	human	known	74_37	silent	30.23	30	13	SNP	1.000	T
PPL	5493	genome.wustl.edu	37	16	4949116	4949116	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr16:4949116G>C	ENST00000345988.2	-	8	863	c.774C>G	c.(772-774)ttC>ttG	p.F258L	PPL_ENST00000590782.2_Missense_Mutation_p.F256L	NM_002705.4	NP_002696	O60437	PEPL_HUMAN	periplakin	258					keratinization (GO:0031424)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			breast(6)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(12)|lung(12)|ovary(4)|prostate(5)|skin(3)|stomach(1)|urinary_tract(2)	62						TCCGGTTGATGAAATTCTGCA	0.657																																																	0													69.0	76.0	73.0					16																	4949116		2197	4300	6497	SO:0001583	missense	0			AF013717	CCDS10526.1	16p13.3	2008-02-05			ENSG00000118898	ENSG00000118898			9273	protein-coding gene	gene with protein product		602871				9570964, 9521878	Standard	NM_002705		Approved		uc002cyd.1	O60437	OTTHUMG00000129528	ENST00000345988.2:c.774C>G	16.37:g.4949116G>C	ENSP00000340510:p.Phe258Leu		O60314|O60454|Q14C98	Missense_Mutation	SNP	pfam_Plectin_repeat,smart_Spectrin/alpha-actinin,smart_Plectin_repeat	p.F258L	ENST00000345988.2	37	c.774	CCDS10526.1	16	.	.	.	.	.	.	.	.	.	.	G	26.5	4.743498	0.89663	.	.	ENSG00000118898	ENST00000345988	T	0.66995	-0.24	5.25	4.28	0.50868	.	0.000000	0.85682	D	0.000000	T	0.54967	0.1891	N	0.25245	0.725	0.53005	D	0.999967	P	0.50443	0.935	P	0.45753	0.492	T	0.51725	-0.8669	10	0.22109	T	0.4	.	14.217	0.65800	0.0732:0.0:0.9268:0.0	.	258	O60437	PEPL_HUMAN	L	258	ENSP00000340510:F258L	ENSP00000340510:F258L	F	-	3	2	PPL	4889117	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	1.488000	0.35551	2.459000	0.83118	0.561000	0.74099	TTC	PPL	-	smart_Spectrin/alpha-actinin	ENSG00000118898		0.657	PPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPL	HGNC	protein_coding	OTTHUMT00000251715.1	-	0.00	36	0	G	NM_002705		4949116	-1	tier1	-	no_errors	ENST00000345988	ensembl	human	known	74_37	missense	25.53	35	12	SNP	1.000	C
PPP2R2B	5521	genome.wustl.edu	37	5	145972589	145972589	+	Missense_Mutation	SNP	A	A	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr5:145972589A>G	ENST00000394413.3	-	8	1567	c.997T>C	c.(997-999)Tat>Cat	p.Y333H	PPP2R2B_ENST00000504198.1_Missense_Mutation_p.Y339H|PPP2R2B_ENST00000394409.3_Missense_Mutation_p.Y391H|PPP2R2B_ENST00000336640.6_Missense_Mutation_p.Y336H|PPP2R2B_ENST00000394414.1_Missense_Mutation_p.Y399H|PPP2R2B_ENST00000530902.1_5'UTR|CTB-99A3.1_ENST00000512730.1_RNA|PPP2R2B_ENST00000394411.4_Missense_Mutation_p.Y333H|PPP2R2B_ENST00000356826.3_Missense_Mutation_p.Y333H|PPP2R2B_ENST00000508545.2_Missense_Mutation_p.Y322H|PPP2R2B_ENST00000453001.1_Missense_Mutation_p.Y333H|PPP2R2B_ENST00000394410.2_Missense_Mutation_p.Y322H			Q00005	2ABB_HUMAN	protein phosphatase 2, regulatory subunit B, beta	333					apoptotic process (GO:0006915)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	cytoskeleton (GO:0005856)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(9)|ovary(1)|prostate(4)|skin(3)	32			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TCATTTTCATAGAGGGAACAC	0.403																																																	0													149.0	160.0	156.0					5																	145972589		2203	4300	6503	SO:0001583	missense	0			M64930	CCDS4283.1, CCDS4284.1, CCDS43380.1, CCDS4284.2, CCDS64282.1	5q32	2013-01-10	2010-04-14		ENSG00000156475	ENSG00000156475	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""WD repeat domain containing"""	9305	protein-coding gene	gene with protein product	"""PP2A subunit B isoform beta"""	604325	"""spinocerebellar ataxia 12"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), beta isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B, beta isoform"""	SCA12		1849734, 10581021	Standard	NM_181674		Approved	PR55-BETA, PR52B	uc003log.5	Q00005	OTTHUMG00000163381	ENST00000394413.3:c.997T>C	5.37:g.145972589A>G	ENSP00000377935:p.Tyr333His		A6NEJ2|A8K102|B3KPD0|B7Z2F2|B7Z304|D3DQF7|D3DQF8|G3V149	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_PP2A_PR55,prints_PP2A_PR55	p.Y399H	ENST00000394413.3	37	c.1195	CCDS4284.1	5	.	.	.	.	.	.	.	.	.	.	A	15.15	2.746765	0.49257	.	.	ENSG00000156475	ENST00000394413;ENST00000508545;ENST00000394414;ENST00000394411;ENST00000356826;ENST00000453001;ENST00000394410;ENST00000336640;ENST00000504198;ENST00000394409	T;T;T;T;T;T;T;T;T;T	0.77620	-1.11;-1.1;1.11;-1.11;-1.11;-1.11;-1.1;-1.11;-1.11;1.11	5.39	4.23	0.50019	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.82536	0.5058	M	0.89658	3.05	0.80722	D	1	P;B;B;P;P;B	0.37864	0.489;0.224;0.102;0.489;0.61;0.102	B;B;B;B;B;B	0.41374	0.152;0.184;0.119;0.355;0.351;0.184	D	0.84144	0.0419	10	0.87932	D	0	-16.6667	11.3715	0.49702	0.9293:0.0:0.0707:0.0	.	391;339;322;399;336;333	Q00005-4;Q00005-3;G3V149;Q00005-5;Q00005-2;Q00005	.;.;.;.;.;2ABB_HUMAN	H	333;322;399;333;333;333;322;336;339;391	ENSP00000377935:Y333H;ENSP00000431320:Y322H;ENSP00000377936:Y399H;ENSP00000377933:Y333H;ENSP00000349283:Y333H;ENSP00000398779:Y333H;ENSP00000377932:Y322H;ENSP00000336591:Y336H;ENSP00000421396:Y339H;ENSP00000377931:Y391H	ENSP00000336591:Y336H	Y	-	1	0	AC011357.1	145952782	1.000000	0.71417	0.997000	0.53966	0.193000	0.23685	9.073000	0.93992	1.060000	0.40578	-0.290000	0.09829	TAT	PPP2R2B	-	superfamily_WD40_repeat_dom,pirsf_PP2A_PR55,prints_PP2A_PR55	ENSG00000156475		0.403	PPP2R2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP2R2B	HGNC	protein_coding	OTTHUMT00000251893.2	-	0.00	40	0	A	NM_181678		145972589	-1	tier1	-	no_errors	ENST00000394414	ensembl	human	known	74_37	missense	18.37	40	9	SNP	1.000	G
PRDM1	639	genome.wustl.edu	37	6	106553015	106553015	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr6:106553015C>G	ENST00000369096.4	+	5	1214	c.980C>G	c.(979-981)tCc>tGc	p.S327C	PRDM1_ENST00000369089.3_Missense_Mutation_p.S193C|PRDM1_ENST00000369091.2_Missense_Mutation_p.S291C	NM_001198.3	NP_001189.2	O75626	PRDM1_HUMAN	PR domain containing 1, with ZNF domain	327					cell fate commitment (GO:0045165)|eye photoreceptor cell development (GO:0042462)|germ cell development (GO:0007281)|intestinal epithelial cell development (GO:0060576)|maternal placenta development (GO:0001893)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of gene expression (GO:0010628)|post-embryonic development (GO:0009791)|transcription, DNA-templated (GO:0006351)|trophoblast giant cell differentiation (GO:0060707)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(59)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(5)|urinary_tract(2)	94	Breast(9;0.022)	all_cancers(87;2.2e-31)|all_epithelial(87;2.03e-21)|Acute lymphoblastic leukemia(125;4.99e-11)|all_lung(197;7.55e-09)|all_hematologic(75;5.82e-08)|Lung NSC(302;1.28e-06)|Colorectal(196;0.0112)|Ovarian(999;0.0365)		all cancers(137;1.83e-46)|Epithelial(106;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(136;1.99e-20)|GBM - Glioblastoma multiforme(226;3.72e-11)|BRCA - Breast invasive adenocarcinoma(108;1.38e-05)		ATCACTCGCTCCCCCATTCCA	0.602			"""D, N, Mis, F, S"""		DLBCL																																			Rec	yes		6	6q21	639	"""PR domain containing 1, with ZNF domain"""		L	0													78.0	72.0	74.0					6																	106553015		2203	4300	6503	SO:0001583	missense	0				CCDS5054.2, CCDS34505.1	6q21	2013-01-08			ENSG00000057657	ENSG00000057657		"""Zinc fingers, C2H2-type"""	9346	protein-coding gene	gene with protein product		603423		BLIMP1		1851123	Standard	NM_001198		Approved	PRDI-BF1	uc003prd.2	O75626	OTTHUMG00000015299	ENST00000369096.4:c.980C>G	6.37:g.106553015C>G	ENSP00000358092:p.Ser327Cys		B2REA6|E1P5E0|Q86WM7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_SET_dom,smart_SET_dom,smart_Znf_C2H2-like,pirsf_Znf_PRDM1,pfscan_SET_dom,pfscan_Znf_C2H2	p.S327C	ENST00000369096.4	37	c.980	CCDS5054.2	6	.	.	.	.	.	.	.	.	.	.	C	16.24	3.068666	0.55539	.	.	ENSG00000057657	ENST00000369091;ENST00000369096;ENST00000456278;ENST00000369089	T;T;T	0.47869	0.83;0.83;0.83	5.51	4.63	0.57726	.	0.163737	0.56097	D	0.000028	T	0.60599	0.2281	M	0.73598	2.24	0.54753	D	0.999988	D;D	0.89917	1.0;0.999	D;D	0.70227	0.968;0.949	T	0.68292	-0.5447	10	0.72032	D	0.01	-17.9269	15.9729	0.80034	0.0:0.8604:0.1396:0.0	.	193;327	Q86WM7;O75626	.;PRDM1_HUMAN	C	291;327;291;193	ENSP00000358087:S291C;ENSP00000358092:S327C;ENSP00000358085:S193C	ENSP00000358085:S193C	S	+	2	0	PRDM1	106659708	1.000000	0.71417	0.461000	0.27105	0.402000	0.30811	5.641000	0.67881	1.298000	0.44778	0.655000	0.94253	TCC	PRDM1	-	pirsf_Znf_PRDM1	ENSG00000057657		0.602	PRDM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDM1	HGNC	protein_coding	OTTHUMT00000041661.3	-	0.00	19	0	C			106553015	+1	tier1	-	no_errors	ENST00000369096	ensembl	human	known	74_37	missense	30.00	14	6	SNP	0.998	G
PRDM10	56980	genome.wustl.edu	37	11	129794884	129794884	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr11:129794884C>G	ENST00000360871.3	-	12	2002	c.1771G>C	c.(1771-1773)Gaa>Caa	p.E591Q	PRDM10_ENST00000358825.5_Missense_Mutation_p.E595Q|PRDM10_ENST00000528746.1_Missense_Mutation_p.E565Q|PRDM10_ENST00000304538.6_Missense_Mutation_p.E505Q|PRDM10_ENST00000526082.1_Missense_Mutation_p.E509Q|PRDM10_ENST00000423662.2_Missense_Mutation_p.E509Q	NM_199437.1	NP_955469.1	Q9NQV6	PRD10_HUMAN	PR domain containing 10	595					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			breast(2)|endometrium(6)|kidney(3)|large_intestine(14)|lung(15)|pancreas(2)|skin(1)|stomach(3)|urinary_tract(2)	48	all_hematologic(175;0.0537)	Breast(109;0.000496)|Lung NSC(97;0.000693)|all_lung(97;0.00151)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0174)|Lung(977;0.176)|LUSC - Lung squamous cell carcinoma(976;0.185)		TCAAAGGATTCTGGGCAAAAA	0.453																																																	0													156.0	158.0	157.0					11																	129794884		2201	4297	6498	SO:0001583	missense	0			AF275817	CCDS8484.1, CCDS8485.1, CCDS44771.1, CCDS44772.1	11q24.3	2013-01-08			ENSG00000170325	ENSG00000170325		"""Zinc fingers, C2H2-type"""	13995	protein-coding gene	gene with protein product	"""PRDM zinc finger transcription factor"", ""PR-domain family member 7"", ""tristanin"""					12175877	Standard	NM_020228		Approved	KIAA1231, PFM7, MGC131802	uc001qfm.3	Q9NQV6	OTTHUMG00000165762	ENST00000360871.3:c.1771G>C	11.37:g.129794884C>G	ENSP00000354118:p.Glu591Gln		B7ZL71|G3XAE5|J3KP23|Q17R90|Q2KHR4|Q863Z2|Q9NXI4|Q9ULI9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Znf_C2H2_jaz,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E595Q	ENST00000360871.3	37	c.1783	CCDS8484.1	11	.	.	.	.	.	.	.	.	.	.	C	23.6	4.434642	0.83885	.	.	ENSG00000170325	ENST00000358825;ENST00000304538;ENST00000360871;ENST00000423662;ENST00000528746;ENST00000526082;ENST00000533431	T;T;T;T;T;T;T	0.28069	1.63;1.63;1.63;1.63;1.63;1.63;1.63	5.71	5.71	0.89125	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.049546	0.85682	D	0.000000	T	0.40546	0.1121	L	0.39326	1.205	0.80722	D	1	B;B;B;B;P;B	0.43542	0.189;0.286;0.189;0.286;0.81;0.286	B;B;P;B;P;B	0.49012	0.193;0.355;0.598;0.355;0.551;0.221	T	0.15178	-1.0446	10	0.72032	D	0.01	-19.7354	19.8579	0.96771	0.0:1.0:0.0:0.0	.	505;591;595;509;505;509	B7ZL72;G3XAE5;Q9NQV6;Q9NQV6-5;Q9NQV6-2;Q9NQV6-1	.;.;PRD10_HUMAN;.;.;.	Q	595;505;591;509;565;509;308	ENSP00000351686:E595Q;ENSP00000302669:E505Q;ENSP00000354118:E591Q;ENSP00000398431:E509Q;ENSP00000431262:E565Q;ENSP00000432237:E509Q;ENSP00000435940:E308Q	ENSP00000302669:E505Q	E	-	1	0	PRDM10	129300094	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.487000	0.81328	2.687000	0.91594	0.655000	0.94253	GAA	PRDM10	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000170325		0.453	PRDM10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDM10	HGNC	protein_coding	OTTHUMT00000386076.1	-	0.00	37	0	C	NM_199437		129794884	-1	tier1	-	no_errors	ENST00000358825	ensembl	human	known	74_37	missense	21.62	29	8	SNP	1.000	G
PRDM8	56978	genome.wustl.edu	37	4	81123144	81123144	+	Silent	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr4:81123144C>T	ENST00000504452.1	+	8	1367	c.528C>T	c.(526-528)ttC>ttT	p.F176F	PRDM8_ENST00000339711.4_Silent_p.F176F|PRDM8_ENST00000415738.2_Silent_p.F176F			Q9NQV8	PRDM8_HUMAN	PR domain containing 8	176					corpus callosum morphogenesis (GO:0021540)|corticospinal tract morphogenesis (GO:0021957)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(2)|skin(2)	10						ATCTGCGTTTCCGCTGCCCCA	0.607											OREG0016246	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													117.0	126.0	123.0					4																	81123144		2114	4228	6342	SO:0001819	synonymous_variant	0			AF275815	CCDS43243.1	4q21	2008-08-21				ENSG00000152784			13993	protein-coding gene	gene with protein product							Standard	NM_020226		Approved		uc003hmc.4	Q9NQV8		ENST00000504452.1:c.528C>T	4.37:g.81123144C>T		1203	A8K7X2|Q6IQ36	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.F176	ENST00000504452.1	37	c.528	CCDS43243.1	4																																																																																			PRDM8	-	smart_Znf_C2H2-like	ENSG00000152784		0.607	PRDM8-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PRDM8	HGNC	protein_coding	OTTHUMT00000362793.1	-	0.00	33	0	C			81123144	+1	tier1	-	no_errors	ENST00000339711	ensembl	human	known	74_37	silent	15.38	22	4	SNP	1.000	T
PRDM9	56979	genome.wustl.edu	37	5	23527657	23527657	+	Silent	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr5:23527657C>T	ENST00000296682.3	+	11	2642	c.2460C>T	c.(2458-2460)ctC>ctT	p.L820L		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	820					meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						CACACCTCCTCAGACACCAGA	0.562										HNSCC(3;0.000094)																																							0													32.0	45.0	41.0					5																	23527657		2112	4252	6364	SO:0001819	synonymous_variant	0			AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.2460C>T	5.37:g.23527657C>T			B4DX22|Q27Q50	Silent	SNP	pfam_Znf_C2H2,pfam_SSXRD_motif,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Krueppel-associated_box-rel	p.L820	ENST00000296682.3	37	c.2460	CCDS43307.1	5																																																																																			PRDM9	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000164256		0.562	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDM9	HGNC	protein_coding	OTTHUMT00000366375.1	-	0.00	63	0	C	NM_020227		23527657	+1	tier1	-	no_errors	ENST00000296682	ensembl	human	known	74_37	silent	11.54	92	12	SNP	0.000	T
PREPL	9581	genome.wustl.edu	37	2	44586684	44586684	+	Silent	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr2:44586684C>T	ENST00000409936.1	-	2	608	c.171G>A	c.(169-171)aaG>aaA	p.K57K	PREPL_ENST00000378520.3_Silent_p.K57K|PREPL_ENST00000409411.1_Intron|PREPL_ENST00000541738.1_Intron|PREPL_ENST00000540817.1_Intron|CAMKMT_ENST00000403853.3_5'Flank|CAMKMT_ENST00000378494.3_5'Flank|PREPL_ENST00000260648.6_Silent_p.K57K|CAMKMT_ENST00000402247.1_5'Flank|PREPL_ENST00000409957.1_Intron|PREPL_ENST00000409272.1_Silent_p.K57K|CAMKMT_ENST00000407131.1_5'Flank|PREPL_ENST00000410081.1_Silent_p.K57K|PREPL_ENST00000378511.3_Silent_p.K57K	NM_001171606.1	NP_001165077.1	Q4J6C6	PPCEL_HUMAN	prolyl endopeptidase-like	57						cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)			breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(19)|ovary(1)|prostate(1)|skin(2)	33		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				ACTCTGATATCTTGGGTTTAT	0.318																																																	0													153.0	154.0	154.0					2																	44586684		2203	4300	6503	SO:0001819	synonymous_variant	0			AB007896	CCDS33190.1, CCDS42675.1, CCDS42676.1, CCDS54353.1	2p22.1	2008-02-05			ENSG00000138078	ENSG00000138078			30228	protein-coding gene	gene with protein product		609557				11524703	Standard	NM_006036		Approved	KIAA0436	uc002ruk.2	Q4J6C6	OTTHUMG00000152791	ENST00000409936.1:c.171G>A	2.37:g.44586684C>T			A7E2X6|D6W5A3|O43163|Q4J6C3|Q4J6C4|Q4ZG39|Q6ZMW7|Q96DW7	Silent	SNP	pfam_Peptidase_S9,pfam_Pept_S9A_N,prints_Peptidase_S9A	p.K57	ENST00000409936.1	37	c.171	CCDS33190.1	2																																																																																			PREPL	-	NULL	ENSG00000138078		0.318	PREPL-008	KNOWN	basic|appris_principal|CCDS	protein_coding	PREPL	HGNC	protein_coding	OTTHUMT00000327900.1	-	0.00	92	0	C	NM_006036		44586684	-1	tier1	-	no_errors	ENST00000260648	ensembl	human	known	74_37	silent	16.88	64	13	SNP	1.000	T
PREX2	80243	genome.wustl.edu	37	8	69103972	69103972	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr8:69103972C>G	ENST00000288368.4	+	36	4639	c.4362C>G	c.(4360-4362)gaC>gaG	p.D1454E		NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	1454					adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						TCTACTTGGACAAGTCAAATT	0.313																																																	0													103.0	103.0	103.0					8																	69103972		2203	4299	6502	SO:0001583	missense	0			AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.4362C>G	8.37:g.69103972C>G	ENSP00000288368:p.Asp1454Glu		B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	pfam_DH-domain,pfam_DEP_dom,pfam_PDZ,superfamily_DH-domain,superfamily_PDZ,smart_DH-domain,smart_Pleckstrin_homology,smart_DEP_dom,smart_PDZ,pfscan_DEP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.D1454E	ENST00000288368.4	37	c.4362	CCDS6201.1	8	.	.	.	.	.	.	.	.	.	.	C	3.668	-0.068172	0.07228	.	.	ENSG00000046889	ENST00000288368	T	0.57752	0.38	5.48	5.48	0.80851	.	0.053230	0.64402	D	0.000001	T	0.31295	0.0792	N	0.20401	0.57	0.50467	D	0.999871	B	0.02656	0.0	B	0.04013	0.001	T	0.15636	-1.0430	10	0.02654	T	1	.	10.2986	0.43639	0.0:0.8492:0.0:0.1508	.	1454	Q70Z35	PREX2_HUMAN	E	1454	ENSP00000288368:D1454E	ENSP00000288368:D1454E	D	+	3	2	PREX2	69266526	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	0.710000	0.25748	2.729000	0.93468	0.650000	0.86243	GAC	PREX2	-	NULL	ENSG00000046889		0.313	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PREX2	HGNC	protein_coding	OTTHUMT00000378620.1	-	0.00	75	0	C	NM_025170		69103972	+1	tier1	-	no_errors	ENST00000288368	ensembl	human	known	74_37	missense	16.90	59	12	SNP	1.000	G
PRG4	10216	genome.wustl.edu	37	1	186275881	186275881	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:186275881C>G	ENST00000445192.2	+	7	1075	c.1030C>G	c.(1030-1032)Ctc>Gtc	p.L344V	PRG4_ENST00000367486.3_Missense_Mutation_p.L301V|PRG4_ENST00000367484.3_Missense_Mutation_p.L303V|PRG4_ENST00000367483.4_Missense_Mutation_p.L303V|PRG4_ENST00000367485.4_Missense_Mutation_p.L251V	NM_005807.3	NP_005798.2	Q92954	PRG4_HUMAN	proteoglycan 4	344					cell proliferation (GO:0008283)|hematopoietic stem cell proliferation (GO:0071425)|immune response (GO:0006955)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|regulation of cell proliferation (GO:0042127)	extracellular space (GO:0005615)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(33)|prostate(7)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	102						AGGCCCTGCTCTCACCACTCC	0.517																																																	0													143.0	151.0	148.0					1																	186275881		2203	4300	6503	SO:0001583	missense	0			U70136	CCDS1369.1, CCDS44287.1, CCDS44288.1	1q25-q31	2008-07-18	2004-11-15		ENSG00000116690	ENSG00000116690			9364	protein-coding gene	gene with protein product	"""lubricin"", ""megakaryocyte stimulating factor"", ""articular superficial zone protein"", ""Jacobs camptodactyly-arthropathy-pericarditis syndrome"", ""camptodactyly, arthropathy, coxa vara, pericarditis syndrome"", ""bG174L6.2 (MSF: megakaryocyte stimulating factor )"""	604283	"""proteoglycan 4, (megakaryocyte stimulating factor, articular superficial zone protein, camptodactyly, arthropathy, coxa vara, pericarditis syndrome)"""	CACP		10545950, 9920774	Standard	NM_005807		Approved	JCAP, SZP, MSF, HAPO, bG174L6.2, FLJ32635	uc001gru.4	Q92954	OTTHUMG00000035574	ENST00000445192.2:c.1030C>G	1.37:g.186275881C>G	ENSP00000399679:p.Leu344Val		Q6DNC4|Q6DNC5|Q6ZMZ5|Q9BX49	Missense_Mutation	SNP	pfam_Somatomedin_B_dom,pfam_Hemopexin-like_repeat,superfamily_Hemopexin-like_dom,smart_Somatomedin_B_dom,smart_Hemopexin-like_repeat,prints_Somatomedin_B_chordata,pfscan_Somatomedin_B_dom	p.L344V	ENST00000445192.2	37	c.1030	CCDS1369.1	1	.	.	.	.	.	.	.	.	.	.	-	6.851	0.526234	0.13066	.	.	ENSG00000116690	ENST00000367486;ENST00000367484;ENST00000367482;ENST00000367483;ENST00000367485;ENST00000445192	T;T;T;T;T	0.05717	3.4;3.68;3.51;3.4;3.51	3.27	2.23	0.28157	.	.	.	.	.	T	0.03136	0.0092	N	0.08118	0	0.09310	N	1	B;B;B;B	0.27732	0.187;0.187;0.118;0.187	B;B;B;B	0.26770	0.073;0.073;0.033;0.073	T	0.45411	-0.9263	8	.	.	.	1.846	7.2582	0.26189	0.1849:0.6336:0.1815:0.0	.	210;251;344;303	Q92954-4;Q92954-3;Q92954;Q92954-2	.;.;PRG4_HUMAN;.	V	301;303;210;303;251;344	ENSP00000356456:L301V;ENSP00000356454:L303V;ENSP00000356453:L303V;ENSP00000356455:L251V;ENSP00000399679:L344V	.	L	+	1	0	PRG4	184542504	0.002000	0.14202	0.004000	0.12327	0.081000	0.17604	1.398000	0.34554	1.582000	0.49881	0.434000	0.28630	CTC	PRG4	-	NULL	ENSG00000116690		0.517	PRG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRG4	HGNC	protein_coding	OTTHUMT00000086346.1	-	0.00	102	0	C	NM_005807		186275881	+1	tier1	-	no_errors	ENST00000445192	ensembl	human	known	74_37	missense	16.91	113	23	SNP	0.003	G
PRRC1	133619	genome.wustl.edu	37	5	126887539	126887539	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr5:126887539G>C	ENST00000296666.8	+	9	1457	c.1269G>C	c.(1267-1269)caG>caC	p.Q423H	PRRC1_ENST00000512635.2_Missense_Mutation_p.Q423H|PRRC1_ENST00000442138.2_3'UTR|PRRC1_ENST00000513427.1_3'UTR	NM_130809.3	NP_570721.1	Q96M27	PRRC1_HUMAN	proline-rich coiled-coil 1	423						Golgi apparatus (GO:0005794)				endometrium(1)|large_intestine(1)|lung(4)	6		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0851)|Epithelial(69;0.113)		CCCGTCGGCAGATGATCTACA	0.537																																																	0													102.0	101.0	101.0					5																	126887539		2203	4300	6503	SO:0001583	missense	0			AJ515429	CCDS4143.1, CCDS68943.1	5q23.2	2008-02-05			ENSG00000164244	ENSG00000164244			28164	protein-coding gene	gene with protein product						15541471	Standard	NM_130809		Approved	FLJ32875	uc003kuk.3	Q96M27	OTTHUMG00000128982	ENST00000296666.8:c.1269G>C	5.37:g.126887539G>C	ENSP00000296666:p.Gln423His		Q69YM8|Q7L2U7|Q86Y42|Q8IVJ4|Q8IVL4|Q8NEZ7|Q96AJ3	Missense_Mutation	SNP	pfam_NTPase/PRRC1	p.Q423H	ENST00000296666.8	37	c.1269	CCDS4143.1	5	.	.	.	.	.	.	.	.	.	.	G	17.74	3.464053	0.63513	.	.	ENSG00000164244	ENST00000296666;ENST00000330542;ENST00000512635;ENST00000512535	.	.	.	5.36	4.42	0.53409	.	0.118236	0.64402	D	0.000014	T	0.63698	0.2533	L	0.50333	1.59	0.44295	D	0.997164	D	0.63880	0.993	P	0.56042	0.79	T	0.63065	-0.6720	9	0.46703	T	0.11	-3.6518	13.5531	0.61745	0.0854:0.0:0.9146:0.0	.	423	Q96M27	PRRC1_HUMAN	H	423	.	ENSP00000296666:Q423H	Q	+	3	2	PRRC1	126915438	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	1.649000	0.37281	2.788000	0.95919	0.557000	0.71058	CAG	PRRC1	-	NULL	ENSG00000164244		0.537	PRRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRC1	HGNC	protein_coding	OTTHUMT00000250971.3	-	0.00	34	0	G	NM_130809		126887539	+1	tier1	-	no_errors	ENST00000512635	ensembl	human	known	74_37	missense	16.00	21	4	SNP	1.000	C
PPT2	9374	genome.wustl.edu	37	6	32119859	32119859	+	5'Flank	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr6:32119859C>G	ENST00000324816.6	+	0	0				PPT2_ENST00000445576.2_5'Flank|PRRT1_ENST00000467780.1_5'Flank|PRRT1_ENST00000375152.2_Intron|PPT2_ENST00000375143.2_5'Flank|PPT2_ENST00000437001.2_5'Flank|PPT2_ENST00000395523.1_5'Flank|PPT2_ENST00000375137.2_5'Flank|PPT2-EGFL8_ENST00000422437.1_5'Flank|PRRT1_ENST00000211413.5_5'Flank|PPT2_ENST00000361568.2_5'Flank|PRRT1_ENST00000375150.2_Intron			Q9UMR5	PPT2_HUMAN	palmitoyl-protein thioesterase 2						cellular protein modification process (GO:0006464)|macromolecule depalmitoylation (GO:0098734)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	palmitoyl hydrolase activity (GO:0098599)|palmitoyl-(protein) hydrolase activity (GO:0008474)|thiolester hydrolase activity (GO:0016790)			NS(1)|endometrium(2)|large_intestine(2)|lung(10)|prostate(1)|urinary_tract(1)	17						GACCACCTCTCTCCTCCTCTT	0.617																																																	0																																										SO:0001631	upstream_gene_variant	0			AF020543	CCDS4740.1, CCDS4742.1	6p21.3	2012-07-02			ENSG00000221988	ENSG00000221988	3.1.2.22		9326	protein-coding gene	gene with protein product		603298				9341199, 10051407	Standard	NM_138717		Approved		uc003nzw.3	Q9UMR5	OTTHUMG00000031257		6.37:g.32119859C>G	Exception_encountered		A2ABC9|A2ABD1|A2ARM7|A2BFH7|A2BFH9|A2BFI2|A8K9L4|B0S868|G8JLE1|O14799|Q0P6K0|Q5JP13|Q5JP14|Q5JQF0|Q5SSX4|Q5SSX5|Q5SSX6|Q5STJ4|Q5STJ5|Q5STJ6|Q6FI80|Q99945	RNA	SNP	-	NULL	ENST00000324816.6	37	NULL	CCDS4742.1	6																																																																																			PRRT1	-	-	ENSG00000204314		0.617	PPT2-207	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRT1	HGNC	protein_coding	OTTHUMT00000076552.4	-	0.00	34	0	C	NM_138717		32119859	-1	tier1	-	no_errors	ENST00000486917	ensembl	human	known	74_37	rna	40.62	19	13	SNP	0.998	G
PTCHD2	57540	genome.wustl.edu	37	1	11561424	11561424	+	Silent	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:11561424G>A	ENST00000294484.6	+	2	513	c.375G>A	c.(373-375)gcG>gcA	p.A125A	PTCHD2_ENST00000389575.3_Silent_p.A125A	NM_020780.1	NP_065831.1	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	125					cholesterol homeostasis (GO:0042632)|regulation of lipid transport (GO:0032368)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	hedgehog receptor activity (GO:0008158)			NS(3)|breast(2)|endometrium(9)|kidney(4)|large_intestine(5)|lung(34)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	76	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		TCACTCTGGCGCTTAAGTCCC	0.582																																																	0													48.0	49.0	49.0					1																	11561424		2058	4192	6250	SO:0001819	synonymous_variant	0			AB037758	CCDS41247.1	1p36.22	2010-02-17			ENSG00000204624	ENSG00000204624			29251	protein-coding gene	gene with protein product		611251				15738394	Standard	NM_020780		Approved	KIAA1337, DISP3	uc001ash.4	Q9P2K9	OTTHUMG00000002074	ENST00000294484.6:c.375G>A	1.37:g.11561424G>A			Q5VTU9|Q9UJD6	Silent	SNP	pfam_Patched,pfam_MMPL_dom,pfscan_SSD	p.A125	ENST00000294484.6	37	c.375	CCDS41247.1	1																																																																																			PTCHD2	-	NULL	ENSG00000204624		0.582	PTCHD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PTCHD2	HGNC	protein_coding	OTTHUMT00000005770.2	-	0.00	38	0	G	XM_052561		11561424	+1	tier1	-	no_errors	ENST00000294484	ensembl	human	known	74_37	silent	14.58	41	7	SNP	0.924	A
PSMA5	5686	genome.wustl.edu	37	1	109955703	109955703	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:109955703C>G	ENST00000271308.4	-	4	298	c.278G>C	c.(277-279)aGa>aCa	p.R93T	PSMA5_ENST00000538610.1_Missense_Mutation_p.R35T|PSMA5_ENST00000490870.1_5'UTR	NM_002790.3	NP_002781.2	P28066	PSA5_HUMAN	proteasome (prosome, macropain) subunit, alpha type, 5	93					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|proteasome core complex, alpha-subunit complex (GO:0019773)	threonine-type endopeptidase activity (GO:0004298)			kidney(1)|large_intestine(2)|lung(2)	5		all_epithelial(167;2.83e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Lung(183;0.045)|Colorectal(144;0.116)|Epithelial(280;0.187)|all cancers(265;0.196)|LUSC - Lung squamous cell carcinoma(189;0.235)		TGTCTCCACTCTGGCTTTATC	0.433																																																	0													132.0	125.0	128.0					1																	109955703		2203	4300	6503	SO:0001583	missense	0			X61970	CCDS799.1, CCDS55619.1	1p13	2008-02-05			ENSG00000143106	ENSG00000143106		"""Proteasome (prosome, macropain) subunits"""	9534	protein-coding gene	gene with protein product		176844				1888762	Standard	NM_002790		Approved	ZETA	uc001dxn.3	P28066	OTTHUMG00000012001	ENST00000271308.4:c.278G>C	1.37:g.109955703C>G	ENSP00000271308:p.Arg93Thr		B2R8F6|B4E2V4|Q3T1C1|Q6IBF7	Missense_Mutation	SNP	pfam_Proteasome_sua/b,pfam_Proteasome_asu_N,smart_Proteasome_asu_N	p.R93T	ENST00000271308.4	37	c.278	CCDS799.1	1	.	.	.	.	.	.	.	.	.	.	c	21.7	4.187339	0.78789	.	.	ENSG00000143106	ENST00000538610;ENST00000271308	T;T	0.27104	1.69;1.69	5.93	5.01	0.66863	.	0.000000	0.85682	D	0.000000	T	0.61375	0.2342	H	0.98295	4.195	0.53005	D	0.999961	D	0.76494	0.999	D	0.78314	0.991	T	0.79135	-0.1928	9	.	.	.	-4.1748	15.0109	0.71550	0.0:0.857:0.143:0.0	.	93	P28066	PSA5_HUMAN	T	35;93	ENSP00000440618:R35T;ENSP00000271308:R93T	.	R	-	2	0	PSMA5	109757226	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.455000	0.80726	1.499000	0.48617	0.586000	0.80456	AGA	PSMA5	-	pfam_Proteasome_sua/b	ENSG00000143106		0.433	PSMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMA5	HGNC	protein_coding	OTTHUMT00000033192.2	-	0.00	53	0	C	NM_002790		109955703	-1	tier1	-	no_errors	ENST00000271308	ensembl	human	known	74_37	missense	22.95	47	14	SNP	1.000	G
PRRX1	5396	genome.wustl.edu	37	1	170688965	170688965	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:170688965G>C	ENST00000239461.6	+	2	653	c.340G>C	c.(340-342)Gag>Cag	p.E114Q	PRRX1_ENST00000367760.3_Missense_Mutation_p.E114Q|PRRX1_ENST00000497230.2_Missense_Mutation_p.E114Q	NM_022716.2	NP_073207.1	P54821	PRRX1_HUMAN	paired related homeobox 1	114					artery morphogenesis (GO:0048844)|cartilage development (GO:0051216)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic limb morphogenesis (GO:0030326)|inner ear morphogenesis (GO:0042472)|middle ear morphogenesis (GO:0042474)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|palate development (GO:0060021)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of smoothened signaling pathway (GO:0045880)	nucleolus (GO:0005730)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)			large_intestine(2)|ovary(1)	3	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					GCGTGTCTTTGAGCGGACACA	0.522																																																	0													118.0	105.0	109.0					1																	170688965		2203	4300	6503	SO:0001583	missense	0			M95929	CCDS1290.1, CCDS1291.1	1q24.3	2011-06-20	2003-11-12	2003-11-14	ENSG00000116132	ENSG00000116132		"""Homeoboxes / PRD class"""	9142	protein-coding gene	gene with protein product		167420	"""paired mesoderm homeo box 1"""	PMX1		1509260	Standard	NM_006902		Approved	PHOX1	uc001ghf.3	P54821	OTTHUMG00000035231	ENST00000239461.6:c.340G>C	1.37:g.170688965G>C	ENSP00000239461:p.Glu114Gln		B5BUM7|O60807	Missense_Mutation	SNP	pfam_Homeobox_dom,pfam_OAR_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_OAR_dom,pfscan_Homeobox_dom	p.E114Q	ENST00000239461.6	37	c.340	CCDS1290.1	1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.129556	0.77549	.	.	ENSG00000116132	ENST00000553786;ENST00000367760;ENST00000239461;ENST00000497230	D;D;D;D	0.96136	-3.92;-3.92;-3.92;-3.92	5.32	5.32	0.75619	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.90758	0.7099	N	0.03294	-0.36	0.80722	D	1	D;B	0.58268	0.982;0.376	P;B	0.54629	0.757;0.058	D	0.94214	0.7461	10	0.87932	D	0	.	17.5667	0.87922	0.0:0.0:1.0:0.0	.	114;114	P54821;P54821-2	PRRX1_HUMAN;.	Q	67;114;114;114	ENSP00000451943:E67Q;ENSP00000356734:E114Q;ENSP00000239461:E114Q;ENSP00000450762:E114Q	ENSP00000239461:E114Q	E	+	1	0	PRRX1	168955589	1.000000	0.71417	0.994000	0.49952	0.938000	0.57974	4.679000	0.61649	2.463000	0.83235	0.655000	0.94253	GAG	PRRX1	-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	ENSG00000116132		0.522	PRRX1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRX1	HGNC	protein_coding	OTTHUMT00000085236.3	-	0.00	32	0	G	NM_006902		170688965	+1	tier1	-	no_errors	ENST00000239461	ensembl	human	known	74_37	missense	24.44	34	11	SNP	1.000	C
PTK2B	2185	genome.wustl.edu	37	8	27290985	27290985	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr8:27290985G>T	ENST00000397501.1	+	16	1829	c.1021G>T	c.(1021-1023)Gct>Tct	p.A341S	PTK2B_ENST00000420218.2_Missense_Mutation_p.A341S|PTK2B_ENST00000517339.1_Missense_Mutation_p.A341S|PTK2B_ENST00000338238.4_Missense_Mutation_p.A341S|PTK2B_ENST00000397497.4_Missense_Mutation_p.A87S|PTK2B_ENST00000544172.1_Missense_Mutation_p.A341S|PTK2B_ENST00000346049.5_Missense_Mutation_p.A341S	NM_173174.2	NP_775266.1	Q14289	FAK2_HUMAN	protein tyrosine kinase 2 beta	341	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				activation of Janus kinase activity (GO:0042976)|activation of Rac GTPase activity (GO:0032863)|apoptotic process (GO:0006915)|blood vessel endothelial cell migration (GO:0043534)|bone resorption (GO:0045453)|cell surface receptor signaling pathway (GO:0007166)|cellular defense response (GO:0006968)|cellular response to retinoic acid (GO:0071300)|chemokine-mediated signaling pathway (GO:0070098)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|glial cell proliferation (GO:0014009)|integrin-mediated signaling pathway (GO:0007229)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term synaptic potentiation (GO:0060291)|MAPK cascade (GO:0000165)|marginal zone B cell differentiation (GO:0002315)|negative regulation of apoptotic process (GO:0043066)|negative regulation of bone mineralization (GO:0030502)|negative regulation of cell proliferation (GO:0008285)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of potassium ion transport (GO:0043267)|neuron projection development (GO:0031175)|oocyte maturation (GO:0001556)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of B cell chemotaxis (GO:2000538)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein complex assembly (GO:0006461)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of cell adhesion (GO:0030155)|regulation of cell shape (GO:0008360)|regulation of establishment of cell polarity (GO:2000114)|regulation of inositol trisphosphate biosynthetic process (GO:0032960)|regulation of macrophage chemotaxis (GO:0010758)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000058)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|response to calcium ion (GO:0051592)|response to cAMP (GO:0051591)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to hormone (GO:0009725)|response to hydrogen peroxide (GO:0042542)|response to hypoxia (GO:0001666)|response to lithium ion (GO:0010226)|response to mechanical stimulus (GO:0009612)|response to osmotic stress (GO:0006970)|response to stress (GO:0006950)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|sprouting angiogenesis (GO:0002040)|stress fiber assembly (GO:0043149)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	apical dendrite (GO:0097440)|axon (GO:0030424)|cell body (GO:0044297)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|membrane raft (GO:0045121)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|signal transducer activity (GO:0004871)			breast(2)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(17)|ovary(4)|skin(12)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Ovarian(32;2.72e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|Epithelial(17;6.61e-10)|BRCA - Breast invasive adenocarcinoma(99;0.226)|Colorectal(74;0.229)	Leflunomide(DB01097)	CCTAGCAGAGGCTGAGAACAT	0.577																																																	0													88.0	82.0	84.0					8																	27290985		2203	4300	6503	SO:0001583	missense	0			U33284	CCDS6057.1, CCDS6058.1	8p21.1	2013-02-18	2013-02-18		ENSG00000120899	ENSG00000120899			9612	protein-coding gene	gene with protein product		601212	"""protein tyrosine kinase 2 beta"", ""PTK2B protein tyrosine kinase 2 beta"""	FAK2		7544443, 7499242	Standard	NM_173174		Approved	CAKB, PYK2, RAFTK, PTK, CADTK	uc003xfp.2	Q14289	OTTHUMG00000102082	ENST00000397501.1:c.1021G>T	8.37:g.27290985G>T	ENSP00000380638:p.Ala341Ser		D3DST0|Q13475|Q14290|Q16709|Q6PID4	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Focal_adhesion_kin_target_dom,pfam_Prot_kinase_dom,pfam_FERM_central,superfamily_Kinase-like_dom,superfamily_Focal_adhesion_kin_target_dom,superfamily_FERM_central,smart_Band_41_domain,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_FERM_domain,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.A341S	ENST00000397501.1	37	c.1021	CCDS6057.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.4|27.4	4.827804|4.827804	0.90955|0.90955	.|.	.|.	ENSG00000120899|ENSG00000120899	ENST00000397501;ENST00000539100;ENST00000338238;ENST00000544172;ENST00000346049;ENST00000420218;ENST00000517339;ENST00000397497|ENST00000519512	T;T;T;T;T;T;T|.	0.24350|.	1.86;1.86;1.86;1.86;1.86;1.86;1.86|.	5.52|5.52	5.52|5.52	0.82312|0.82312	FERM domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.73621|0.73621	0.3610|0.3610	M|M	0.66939|0.66939	2.045|2.045	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.61080|.	0.989;0.989;0.985;0.989|.	P;P;D;D|.	0.64410|.	0.893;0.893;0.918;0.925|.	T|T	0.72257|0.72257	-0.4346|-0.4346	10|5	0.59425|.	D|.	0.04|.	.|.	16.9375|16.9375	0.86207|0.86207	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	346;87;341;341|.	Q59GM4;E9PBI4;Q14289-2;Q14289|.	.;.;.;FAK2_HUMAN|.	S|V	341;346;341;341;341;341;341;87|114	ENSP00000380638:A341S;ENSP00000342242:A341S;ENSP00000440926:A341S;ENSP00000332816:A341S;ENSP00000391995:A341S;ENSP00000427931:A341S;ENSP00000380634:A87S|.	ENSP00000342242:A341S|.	A|G	+|+	1|2	0|0	PTK2B|PTK2B	27346902|27346902	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.756000|0.756000	0.42949|0.42949	9.318000|9.318000	0.96334|0.96334	2.600000|2.600000	0.87896|0.87896	0.561000|0.561000	0.74099|0.74099	GCT|GGC	PTK2B	-	pfscan_FERM_domain	ENSG00000120899		0.577	PTK2B-009	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PTK2B	HGNC	protein_coding	OTTHUMT00000219916.1	-	0.00	38	0	G	NM_004103		27290985	+1	tier1	-	no_errors	ENST00000346049	ensembl	human	known	74_37	missense	12.12	29	4	SNP	1.000	T
PTPDC1	138639	genome.wustl.edu	37	9	96870182	96870182	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr9:96870182G>C	ENST00000375360.3	+	10	2561	c.2221G>C	c.(2221-2223)Gaa>Caa	p.E741Q	PTPDC1_ENST00000467049.1_3'UTR|PTPDC1_ENST00000288976.3_Missense_Mutation_p.E793Q	NM_001253830.1|NM_177995.2	NP_001240759.1|NP_818931.1	A2A3K4	PTPC1_HUMAN	protein tyrosine phosphatase domain containing 1	741					cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)		protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			endometrium(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	32						CACGCTGGAAGAAAAAAGAAA	0.368																																																	0													31.0	33.0	32.0					9																	96870182		2202	4299	6501	SO:0001583	missense	0			BC051654	CCDS6707.1, CCDS6708.1, CCDS75860.1	9q22.32	2011-06-09			ENSG00000158079	ENSG00000158079		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : CDC14s"""	30184	protein-coding gene	gene with protein product	"""protein tyrosine phosphatase PTP9Q22"""					14702039	Standard	NM_152422		Approved	PTP9Q22, FLJ37312	uc010mrj.2	A2A3K4	OTTHUMG00000020258	ENST00000375360.3:c.2221G>C	9.37:g.96870182G>C	ENSP00000364509:p.Glu741Gln		Q5T3M4|Q6NXE8|Q8IWM1|Q8N1X4|Q8N9F5	Missense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Dual-sp_phosphatase_subgr_cat,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-sp_Pase	p.E741Q	ENST00000375360.3	37	c.2221	CCDS6707.1	9	.	.	.	.	.	.	.	.	.	.	G	23.4	4.405755	0.83230	.	.	ENSG00000158079	ENST00000375360;ENST00000288976	T;T	0.18502	2.21;2.21	5.71	5.71	0.89125	.	0.319307	0.37483	N	0.002069	T	0.42449	0.1203	M	0.73962	2.25	0.43065	D	0.994699	D;D;D;D	0.69078	0.995;0.997;0.995;0.99	P;D;P;P	0.66497	0.881;0.944;0.881;0.742	T	0.26849	-1.0091	10	0.66056	D	0.02	-26.0042	17.0329	0.86466	0.0:0.0:1.0:0.0	.	795;793;795;741	E7EN59;A2A3K4-2;A8K0X7;A2A3K4	.;.;.;PTPC1_HUMAN	Q	741;793	ENSP00000364509:E741Q;ENSP00000288976:E793Q	ENSP00000288976:E793Q	E	+	1	0	PTPDC1	95910003	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	3.734000	0.55037	2.712000	0.92718	0.650000	0.86243	GAA	PTPDC1	-	NULL	ENSG00000158079		0.368	PTPDC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPDC1	HGNC	protein_coding	OTTHUMT00000215007.1	-	0.00	96	0	G	NM_177995, NM_152422		96870182	+1	tier1	-	no_errors	ENST00000375360	ensembl	human	known	74_37	missense	19.79	77	19	SNP	1.000	C
PTPRK	5796	genome.wustl.edu	37	6	128388853	128388853	+	Silent	SNP	G	G	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr6:128388853G>T	ENST00000368215.3	-	12	1967	c.1968C>A	c.(1966-1968)gtC>gtA	p.V656V	RP11-103C16.2_ENST00000417390.1_RNA|PTPRK_ENST00000524481.1_5'UTR|PTPRK_ENST00000368207.3_Silent_p.V656V|PTPRK_ENST00000532331.1_Silent_p.V656V|PTPRK_ENST00000368226.4_Silent_p.V656V|PTPRK_ENST00000368213.5_Silent_p.V656V|PTPRK_ENST00000368227.3_Silent_p.V656V|PTPRK_ENST00000368210.3_Silent_p.V656V			Q15262	PTPRK_HUMAN	protein tyrosine phosphatase, receptor type, K	656	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to reactive oxygen species (GO:0034614)|cellular response to UV (GO:0034644)|focal adhesion assembly (GO:0048041)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	axon (GO:0030424)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|leading edge membrane (GO:0031256)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)		PTPRK/RSPO3(10)	autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(14)|lung(24)|ovary(3)|pancreas(1)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	72				all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)		TTTGGTATGTGACAGGAACCT	0.527																																																	0													99.0	101.0	101.0					6																	128388853		2203	4300	6503	SO:0001819	synonymous_variant	0			L77886	CCDS5137.1, CCDS47473.1, CCDS75517.1	6q22.2-q22.3	2013-02-11			ENSG00000152894	ENSG00000152894		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9674	protein-coding gene	gene with protein product		602545				9047348, 8663237	Standard	NM_002844		Approved	R-PTP-kappa	uc010kfc.3	Q15262	OTTHUMG00000015536	ENST00000368215.3:c.1968C>A	6.37:g.128388853G>T			B2RTQ8|B7ZMG0|Q14763|Q5TG10|Q5TG11	Silent	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_MAM_dom,pfam_Fibronectin_type3,pfam_Ig_I-set,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_MAM_dom,smart_Ig_sub,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_MAM_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like_dom,prints_Tyr_Pase_rcpt/non-rcpt,prints_MAM_dom	p.V656	ENST00000368215.3	37	c.1968		6																																																																																			PTPRK	-	NULL	ENSG00000152894		0.527	PTPRK-005	KNOWN	basic|appris_candidate	protein_coding	PTPRK	HGNC	protein_coding	OTTHUMT00000042163.1	-	0.00	34	0	G			128388853	-1	tier1	-	no_errors	ENST00000368227	ensembl	human	known	74_37	silent	18.75	39	9	SNP	0.960	T
STXBP1	6812	genome.wustl.edu	37	9	130457332	130457333	+	IGR	INS	-	-	TGA	rs55657635|rs569572633|rs138071672|rs67150798|rs57076743|rs58200979	byFrequency	TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr9:130457332_130457333insTGA	ENST00000373299.1	+	0	3759				STXBP1_ENST00000481942.1_3'UTR	NM_001032221.3	NP_001027392.1	P61764	STXB1_HUMAN	syntaxin binding protein 1						axon target recognition (GO:0007412)|energy reserve metabolic process (GO:0006112)|glutamate secretion (GO:0014047)|long term synaptic depression (GO:0060292)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter secretion (GO:0007269)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|protein stabilization (GO:0050821)|protein transport (GO:0015031)|regulation of insulin secretion (GO:0050796)|regulation of SNARE complex assembly (GO:0035542)|regulation of synaptic vesicle fusion to presynaptic membrane (GO:0031630)|regulation of synaptic vesicle priming (GO:0010807)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|synaptic vesicle maturation (GO:0016188)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|protein complex (GO:0043234)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|SNARE binding (GO:0000149)|syntaxin binding (GO:0019905)|syntaxin-1 binding (GO:0017075)			breast(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(7)|skin(2)	23						GGCTCAGCCATtgatgatgatg	0.525														1540	0.307508	0.3608	0.3199	5008	,	,		19290	0.1825		0.336	False		,,,				2504	0.3262																0																																										SO:0001628	intergenic_variant	0			AF004563	CCDS6874.1, CCDS35146.1	9q34.1	2008-07-21			ENSG00000136854	ENSG00000136854			11444	protein-coding gene	gene with protein product	"""syntaxin-binding protein 1"""	602926				9545644	Standard	NM_001032221		Approved	hUNC18, MUNC18-1, UNC18, rbSec1	uc004brk.2	P61764	OTTHUMG00000020713		9.37:g.130457339_130457341dupTGA			B1AM97|Q28208|Q62759|Q64320|Q96TG8	RNA	INS	-	NULL	ENST00000373299.1	37	NULL	CCDS35146.1	9																																																																																			PTRH1	-	-	ENSG00000187024		0.525	STXBP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PTRH1	HGNC	protein_coding	OTTHUMT00000054229.1		0.00	13	0	-	NM_003165		130457333	-1	tier1		no_errors	ENST00000335223	ensembl	human	known	74_37	rna	29.41	12	5	INS	0.000:0.000	TGA
RAB3IL1	5866	genome.wustl.edu	37	11	61674023	61674023	+	Missense_Mutation	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr11:61674023C>T	ENST00000394836.2	-	5	729	c.572G>A	c.(571-573)cGc>cAc	p.R191H	RAB3IL1_ENST00000301773.5_Intron	NM_013401.2	NP_037533.2	Q8TBN0	R3GEF_HUMAN	RAB3A interacting protein (rabin3)-like 1	191					positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|liver(1)|lung(4)|skin(3)|urinary_tract(1)	14						GCTCTTGTGGCGAGAGTGGCC	0.677																																																	0													36.0	32.0	34.0					11																	61674023		2199	4296	6495	SO:0001583	missense	0			AF084557	CCDS8014.1, CCDS60809.1	11q12.2	2008-02-01			ENSG00000167994	ENSG00000167994			9780	protein-coding gene	gene with protein product							Standard	NM_013401		Approved		uc001nso.4	Q8TBN0	OTTHUMG00000167524	ENST00000394836.2:c.572G>A	11.37:g.61674023C>T	ENSP00000378313:p.Arg191His		Q86V32|Q9P1Q8	Missense_Mutation	SNP	pfam_Sec2p	p.R191H	ENST00000394836.2	37	c.572	CCDS8014.1	11	.	.	.	.	.	.	.	.	.	.	C	21.9	4.216087	0.79352	.	.	ENSG00000167994	ENST00000394836;ENST00000531922	T;T	0.57107	1.29;0.42	4.73	2.76	0.32466	.	0.118877	0.64402	D	0.000016	T	0.65698	0.2716	M	0.68317	2.08	0.80722	D	1	D	0.89917	1.0	D	0.73380	0.98	T	0.66432	-0.5925	10	0.56958	D	0.05	-10.68	9.2949	0.37808	0.1431:0.7786:0.0:0.0782	.	191	Q8TBN0	R3GEF_HUMAN	H	191;238	ENSP00000378313:R191H;ENSP00000435444:R238H	ENSP00000378313:R191H	R	-	2	0	RAB3IL1	61430599	1.000000	0.71417	0.090000	0.20809	0.846000	0.48090	5.918000	0.69996	1.171000	0.42768	0.561000	0.74099	CGC	RAB3IL1	-	NULL	ENSG00000167994		0.677	RAB3IL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB3IL1	HGNC	protein_coding	OTTHUMT00000394917.1	-	0.00	57	0	C	NM_013401		61674023	-1	tier1	-	no_errors	ENST00000394836	ensembl	human	known	74_37	missense	25.64	58	20	SNP	0.996	T
RADIL	55698	genome.wustl.edu	37	7	4874538	4874538	+	Silent	SNP	G	G	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr7:4874538G>T	ENST00000399583.3	-	4	1303	c.1116C>A	c.(1114-1116)ctC>ctA	p.L372L	RADIL_ENST00000536091.1_Silent_p.L372L|RADIL_ENST00000538469.1_Silent_p.L132L	NM_018059.4	NP_060529.4	Q96JH8	RADIL_HUMAN	Ras association and DIL domains	372	FHA.				multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)|substrate adhesion-dependent cell spreading (GO:0034446)	microtubule (GO:0005874)				NS(1)|biliary_tract(2)|breast(1)|central_nervous_system(3)|endometrium(2)|large_intestine(2)|lung(22)|pancreas(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;7.41e-15)		GCACAGCCCGGAGGCGCGCCA	0.771																																																	0													5.0	6.0	6.0					7																	4874538		1692	3788	5480	SO:0001819	synonymous_variant	0			AB058752	CCDS43544.1	7p22.1	2010-08-27			ENSG00000157927	ENSG00000157927			22226	protein-coding gene	gene with protein product		611491				16051602, 17704304	Standard	NM_018059		Approved	FLJ10324, KIAA1849, RASIP2	uc003snj.1	Q96JH8	OTTHUMG00000151753	ENST00000399583.3:c.1116C>A	7.37:g.4874538G>T			A4D1Z5|A5YM49|B7ZL20|Q0VFZ9|Q75LH3|Q9BSP5|Q9H0M6|Q9NW43|Q9NWC4	Missense_Mutation	SNP	pfam_Ras-assoc,smart_Ras-assoc,pfscan_Ras-assoc	p.P371T	ENST00000399583.3	37	c.1111	CCDS43544.1	7																																																																																			RADIL	-	NULL	ENSG00000157927		0.771	RADIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RADIL	HGNC	protein_coding	OTTHUMT00000323769.2	-	0.00	40	0	G	NM_018059		4874538	-1	tier1	-	no_errors	ENST00000445392	ensembl	human	known	74_37	missense	14.08	61	10	SNP	0.001	T
RAI14	26064	genome.wustl.edu	37	5	34821951	34821951	+	Missense_Mutation	SNP	T	T	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr5:34821951T>C	ENST00000265109.3	+	14	1396	c.1109T>C	c.(1108-1110)tTa>tCa	p.L370S	RAI14_ENST00000397449.1_Missense_Mutation_p.L363S|RAI14_ENST00000506376.1_Missense_Mutation_p.L362S|RAI14_ENST00000503673.1_Missense_Mutation_p.L370S|RAI14_ENST00000515799.1_Missense_Mutation_p.L373S|RAI14_ENST00000512629.1_Missense_Mutation_p.L341S|RAI14_ENST00000428746.2_Missense_Mutation_p.L370S	NM_001145522.1|NM_015577.2	NP_001138994.1|NP_056392.2	Q9P0K7	RAI14_HUMAN	retinoic acid induced 14	370						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(19)|lung(22)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	56	all_lung(31;0.000191)					CAAGATAAATTACAGGTATAT	0.338																																																	0													71.0	71.0	71.0					5																	34821951		2203	4299	6502	SO:0001583	missense	0			AB037755	CCDS34142.1, CCDS54837.1, CCDS54838.1, CCDS54839.1	5p13.3-p13.2	2013-01-10			ENSG00000039560	ENSG00000039560		"""Ankyrin repeat domain containing"""	14873	protein-coding gene	gene with protein product	"""novel retinal pigment epithelial"""	606586				11042181	Standard	NM_015577		Approved	NORPEG, KIAA1334, RAI13, DKFZp564G013	uc011coj.2	Q9P0K7	OTTHUMG00000162019	ENST00000265109.3:c.1109T>C	5.37:g.34821951T>C	ENSP00000265109:p.Leu370Ser		E9PED3|Q6V1W9|Q7Z5I4|Q7Z733|Q9P2L2|Q9Y3T5	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_t-SNARE,superfamily_UBA-like,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.L373S	ENST00000265109.3	37	c.1118	CCDS34142.1	5	.	.	.	.	.	.	.	.	.	.	T	21.4	4.138754	0.77775	.	.	ENSG00000039560	ENST00000265109;ENST00000512629;ENST00000428746;ENST00000503673;ENST00000515799;ENST00000506376;ENST00000397449	T;T;T;T;T;T;T	0.46451	0.87;0.9;0.87;0.87;0.87;0.92;0.9	5.81	5.81	0.92471	.	.	.	.	.	T	0.55321	0.1913	L	0.32530	0.975	0.45822	D	0.998697	D;P;D;P	0.89917	1.0;0.911;0.957;0.911	D;B;P;B	0.91635	0.999;0.311;0.59;0.311	T	0.58679	-0.7594	9	0.87932	D	0	-3.2913	16.1678	0.81782	0.0:0.0:0.0:1.0	.	362;341;373;370	Q9P0K7-3;E9PED3;Q9P0K7-2;Q9P0K7	.;.;.;RAI14_HUMAN	S	370;341;370;370;373;362;363	ENSP00000265109:L370S;ENSP00000422377:L341S;ENSP00000388725:L370S;ENSP00000422942:L370S;ENSP00000427123:L373S;ENSP00000423854:L362S;ENSP00000380591:L363S	ENSP00000265109:L370S	L	+	2	0	RAI14	34857708	1.000000	0.71417	0.997000	0.53966	0.936000	0.57629	5.945000	0.70226	2.218000	0.71995	0.528000	0.53228	TTA	RAI14	-	NULL	ENSG00000039560		0.338	RAI14-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RAI14	HGNC	protein_coding	OTTHUMT00000366786.1	-	0.00	39	0	T	NM_015577		34821951	+1	tier1	-	no_errors	ENST00000515799	ensembl	human	known	74_37	missense	18.75	39	9	SNP	1.000	C
RAPGEF6	51735	genome.wustl.edu	37	5	130764605	130764605	+	Silent	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr5:130764605G>A	ENST00000509018.1	-	27	4975	c.4770C>T	c.(4768-4770)agC>agT	p.S1590S	CTC-432M15.3_ENST00000514667.1_Silent_p.S1640S|RAPGEF6_ENST00000296859.6_Silent_p.S1598S|RAPGEF6_ENST00000307984.5_Intron|RAPGEF6_ENST00000507093.1_Intron	NM_001164386.1|NM_016340.5	NP_001157858.1|NP_057424.3	Q8TEU7	RPGF6_HUMAN	Rap guanine nucleotide exchange factor (GEF) 6	1590					positive regulation of GTPase activity (GO:0043547)|Ras protein signal transduction (GO:0007265)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTP-dependent protein binding (GO:0030742)|guanyl-nucleotide exchange factor activity (GO:0005085)|Ras GTPase binding (GO:0017016)	p.S1590S(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|skin(1)|stomach(1)	31			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0721)		CATCTGCTTCGCTATCTGCAT	0.398																																					Melanoma(168;435 1955 13113 13877 23213)												1	Substitution - coding silent(1)	endometrium(1)											116.0	109.0	112.0					5																	130764605		2203	4300	6503	SO:0001819	synonymous_variant	0			AF117947	CCDS34225.1, CCDS54897.1, CCDS54898.1, CCDS54899.1, CCDS54900.1	5q31.1	2008-02-05	2004-03-01	2004-03-02	ENSG00000158987	ENSG00000158987			20655	protein-coding gene	gene with protein product		610499	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 2"""	PDZGEF2		11524421, 12095257	Standard	NM_016340		Approved	RA-GEF-2, PDZ-GEF2	uc010jdi.2	Q8TEU7	OTTHUMG00000162683	ENST00000509018.1:c.4770C>T	5.37:g.130764605G>A			A3KN82|A5PLL6|B7ZML2|E9PDV7|Q8NI21|Q8TEU6|Q96PC1	Silent	SNP	pfam_RasGRF_CDC25,pfam_PDZ,pfam_Ras-assoc,pfam_cNMP-bd_dom,pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,superfamily_PDZ,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,smart_Ras-like_Gua-exchang_fac_N,smart_PDZ,smart_Ras-assoc,smart_RasGRF_CDC25,pfscan_cNMP-bd_dom,pfscan_PDZ,pfscan_Ras-assoc,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.S1590	ENST00000509018.1	37	c.4770	CCDS34225.1	5																																																																																			RAPGEF6	-	NULL	ENSG00000158987		0.398	RAPGEF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RAPGEF6	HGNC	protein_coding	OTTHUMT00000370059.1		0.00	28	0	G	NM_016340		130764605	-1			no_errors	ENST00000509018	ensembl	human	known	74_37	silent	13.64	19	3	SNP	1.000	A
RASGRF1	5923	genome.wustl.edu	37	15	79292148	79292148	+	Missense_Mutation	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr15:79292148C>T	ENST00000419573.3	-	18	3005	c.2731G>A	c.(2731-2733)Gcc>Acc	p.A911T	RASGRF1_ENST00000560334.1_5'UTR|RASGRF1_ENST00000558480.2_Missense_Mutation_p.A895T|RASGRF1_ENST00000394745.3_Missense_Mutation_p.A127T	NM_002891.4	NP_002882.3	Q13972	RGRF1_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 1	911					activation of Rac GTPase activity (GO:0032863)|cell proliferation (GO:0008283)|long-term memory (GO:0007616)|neuron projection development (GO:0031175)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of Rac protein signal transduction (GO:0035020)|regulation of Ras protein signal transduction (GO:0046578)|regulation of synaptic plasticity (GO:0048167)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|growth cone (GO:0030426)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(18)|lung(23)|ovary(2)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						TTGGCCCCGGCGGTTGCTATG	0.567																																																	0													142.0	110.0	121.0					15																	79292148		2196	4293	6489	SO:0001583	missense	0			M91815	CCDS10309.1, CCDS42065.1, CCDS45320.1	15q24	2013-01-10			ENSG00000058335	ENSG00000058335		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9875	protein-coding gene	gene with protein product		606600		GRF1		7684828, 1379731	Standard	NM_153815		Approved	CDC25L, CDC25, GRF55, H-GRF55, GNRP, PP13187	uc002beq.3	Q13972	OTTHUMG00000144172	ENST00000419573.3:c.2731G>A	15.37:g.79292148C>T	ENSP00000405963:p.Ala911Thr		F8VPA5|H0YKF2|J3KQP9|Q16027	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_Ras_GEF_dom,superfamily_DH-domain,smart_Pleckstrin_homology,smart_DH-domain,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_DH-domain,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.A911T	ENST00000419573.3	37	c.2731	CCDS10309.1	15	.	.	.	.	.	.	.	.	.	.	C	25.3	4.619134	0.87460	.	.	ENSG00000058335	ENST00000419573;ENST00000394741;ENST00000394745	T;T	0.69040	-0.37;-0.01	4.34	4.34	0.51931	Ras guanine nucleotide exchange factor, domain (1);Ras-like guanine nucleotide exchange factor, N-terminal (1);	0.604609	0.15127	N	0.279063	T	0.80470	0.4629	M	0.77820	2.39	0.80722	D	1	B;D;P;D	0.89917	0.275;1.0;0.905;1.0	B;D;B;D	0.91635	0.039;0.998;0.191;0.999	T	0.76517	-0.2930	10	0.21540	T	0.41	.	14.3634	0.66789	0.0:1.0:0.0:0.0	.	307;895;913;895	B7Z6Z6;Q8IUU5;Q13972;F8VPA5	.;.;RGRF1_HUMAN;.	T	911;895;127	ENSP00000405963:A911T;ENSP00000378228:A127T	ENSP00000378224:A895T	A	-	1	0	RASGRF1	77079203	1.000000	0.71417	0.095000	0.20976	0.926000	0.56050	5.352000	0.66028	2.236000	0.73375	0.591000	0.81541	GCC	RASGRF1	-	pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,smart_Ras-like_Gua-exchang_fac_N	ENSG00000058335		0.567	RASGRF1-001	KNOWN	basic|CCDS	protein_coding	RASGRF1	HGNC	protein_coding	OTTHUMT00000291371.3		0.00	45	0	C	NM_002891		79292148	-1			no_errors	ENST00000419573	ensembl	human	known	74_37	missense	6.52	43	3	SNP	0.976	T
RBM6	10180	genome.wustl.edu	37	3	50085751	50085751	+	Splice_Site	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr3:50085751G>C	ENST00000266022.4	+	7	1890	c.1631G>C	c.(1630-1632)cGa>cCa	p.R544P	RBM6_ENST00000422955.1_Splice_Site_p.R22P|RBM6_ENST00000443081.1_Splice_Site_p.R412P|RBM6_ENST00000441115.1_3'UTR|RBM6_ENST00000539992.1_Intron|RBM6_ENST00000442092.1_Splice_Site_p.R22P	NM_005777.2	NP_005768.1	P78332	RBM6_HUMAN	RNA binding motif protein 6	544					RNA processing (GO:0006396)	nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(3)|prostate(1)|skin(4)|urinary_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;6.81e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0084)|Kidney(197;0.00977)		TACTGCAAACGAGTAAGTACC	0.428																																																	0													81.0	76.0	78.0					3																	50085751		2203	4300	6503	SO:0001630	splice_region_variant	0			AF069517	CCDS2809.1, CCDS54586.1	3p21.3	2013-01-28			ENSG00000004534	ENSG00000004534		"""RNA binding motif (RRM) containing"", ""G patch domain containing"""	9903	protein-coding gene	gene with protein product		606886				10352938	Standard	NM_001167582		Approved	DEF-3, 3G2, NY-LU-12, g16, DEF3	uc003cyc.3	P78332	OTTHUMG00000156736	ENST00000266022.4:c.1632+1G>C	3.37:g.50085751G>C			O60549|O75524|Q86SS3	Missense_Mutation	SNP	pfam_G_patch_dom,smart_RRM_dom,smart_G_patch_dom,pfscan_G_patch_dom,pfscan_RRM_dom	p.R544P	ENST00000266022.4	37	c.1631	CCDS2809.1	3	.	.	.	.	.	.	.	.	.	.	G	14.48	2.546548	0.45383	.	.	ENSG00000004534	ENST00000442092;ENST00000266022;ENST00000443081;ENST00000422955;ENST00000446471	T;T;T;T;D	0.83755	0.58;1.45;1.46;0.58;-1.76	5.62	4.75	0.60458	.	0.818803	0.11171	N	0.592060	T	0.72763	0.3501	L	0.29908	0.895	0.80722	D	1	B;P	0.35872	0.123;0.525	B;B	0.33042	0.094;0.157	T	0.64639	-0.6360	9	.	.	.	-1.499	9.8006	0.40761	0.1579:0.0:0.8421:0.0	.	412;544	E9PGM9;P78332	.;RBM6_HUMAN	P	22;544;412;22;22	ENSP00000393530:R22P;ENSP00000266022:R544P;ENSP00000396466:R412P;ENSP00000392939:R22P;ENSP00000394336:R22P	.	R	+	2	0	RBM6	50060755	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.235000	0.43044	1.388000	0.46506	0.650000	0.86243	CGA	RBM6	-	NULL	ENSG00000004534		0.428	RBM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM6	HGNC	protein_coding	OTTHUMT00000345528.4	-	0.00	55	0	G	NM_005777	Missense_Mutation	50085751	+1	tier1	-	no_errors	ENST00000266022	ensembl	human	known	74_37	missense	42.22	26	19	SNP	1.000	C
RBM6	10180	genome.wustl.edu	37	3	50106179	50106179	+	Silent	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr3:50106179G>C	ENST00000266022.4	+	18	3259	c.3000G>C	c.(2998-3000)ctG>ctC	p.L1000L	RBM6_ENST00000422955.1_Silent_p.L478L|RBM6_ENST00000443081.1_Silent_p.L868L|RBM6_ENST00000539992.1_Silent_p.L342L|RBM6_ENST00000442092.1_Silent_p.L478L|RBM6_ENST00000421682.1_5'UTR	NM_005777.2	NP_005768.1	P78332	RBM6_HUMAN	RNA binding motif protein 6	1000					RNA processing (GO:0006396)	nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(3)|prostate(1)|skin(4)|urinary_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;6.81e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0084)|Kidney(197;0.00977)		TAGCCTATCTGGAAAGGAGAG	0.433																																																	0													103.0	101.0	101.0					3																	50106179		2203	4300	6503	SO:0001819	synonymous_variant	0			AF069517	CCDS2809.1, CCDS54586.1	3p21.3	2013-01-28			ENSG00000004534	ENSG00000004534		"""RNA binding motif (RRM) containing"", ""G patch domain containing"""	9903	protein-coding gene	gene with protein product		606886				10352938	Standard	NM_001167582		Approved	DEF-3, 3G2, NY-LU-12, g16, DEF3	uc003cyc.3	P78332	OTTHUMG00000156736	ENST00000266022.4:c.3000G>C	3.37:g.50106179G>C			O60549|O75524|Q86SS3	Silent	SNP	pfam_G_patch_dom,smart_RRM_dom,smart_G_patch_dom,pfscan_G_patch_dom,pfscan_RRM_dom	p.L1000	ENST00000266022.4	37	c.3000	CCDS2809.1	3																																																																																			RBM6	-	NULL	ENSG00000004534		0.433	RBM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM6	HGNC	protein_coding	OTTHUMT00000345528.4	-	0.00	141	0	G	NM_005777		50106179	+1	tier1	-	no_errors	ENST00000266022	ensembl	human	known	74_37	silent	21.14	97	26	SNP	1.000	C
RBPJL	11317	genome.wustl.edu	37	20	43942696	43942696	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr20:43942696G>C	ENST00000343694.3	+	8	851	c.779G>C	c.(778-780)gGa>gCa	p.G260A	RBPJL_ENST00000464504.1_3'UTR|RBPJL_ENST00000372743.1_Missense_Mutation_p.G260A|RBPJL_ENST00000372741.3_Missense_Mutation_p.G260A	NM_001281448.1|NM_001281449.1|NM_014276.2	NP_001268377.1|NP_001268378.1|NP_055091.2	Q9UBG7	RBPJL_HUMAN	recombination signal binding protein for immunoglobulin kappa J region-like	260					positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|kidney(1)|large_intestine(5)|lung(3)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		Myeloproliferative disorder(115;0.0122)				TCTGCCCAAGGAGACTTCCCA	0.587																																																	0													128.0	126.0	127.0					20																	43942696		2203	4300	6503	SO:0001583	missense	0			AB024964	CCDS13349.1, CCDS63283.1, CCDS63284.1	20q13.12	2013-10-18	2007-02-26	2007-02-26	ENSG00000124232	ENSG00000124232			13761	protein-coding gene	gene with protein product			"""recombining binding protein suppressor of hairless (Drosophila)-like"""	RBPSUHL		9929984	Standard	NM_014276		Approved	RBP-L, SUH, SUHL	uc002xns.3	Q9UBG7	OTTHUMG00000033055	ENST00000343694.3:c.779G>C	20.37:g.43942696G>C	ENSP00000341243:p.Gly260Ala		O95723|Q5QPU9|Q5QPV0|Q9ULV9	Missense_Mutation	SNP	pfam_Beta-trefoil_DNA-bd_dom,pfam_LAG1_DNA-bd,superfamily_Beta-trefoil_DNA-bd_dom,superfamily_p53-like_TF_DNA-bd,superfamily_Ig_E-set	p.G260A	ENST00000343694.3	37	c.779	CCDS13349.1	20	.	.	.	.	.	.	.	.	.	.	G	10.34	1.323750	0.24080	.	.	ENSG00000124232	ENST00000372743;ENST00000372741;ENST00000343694	T;T;T	0.29142	1.58;1.58;1.58	5.25	4.31	0.51392	Beta-trefoil (2);	0.609926	0.16855	N	0.196761	T	0.19087	0.0458	N	0.13098	0.295	0.29863	N	0.82748	B;B	0.27559	0.181;0.047	B;B	0.25884	0.064;0.013	T	0.10847	-1.0612	10	0.42905	T	0.14	-23.0816	11.5722	0.50841	0.0816:0.0:0.9184:0.0	.	260;260	Q5QPV1;Q9UBG7	.;RBPJL_HUMAN	A	260	ENSP00000361828:G260A;ENSP00000361826:G260A;ENSP00000341243:G260A	ENSP00000341243:G260A	G	+	2	0	RBPJL	43376110	1.000000	0.71417	0.998000	0.56505	0.236000	0.25371	3.648000	0.54410	1.448000	0.47680	-0.244000	0.11960	GGA	RBPJL	-	pfam_Beta-trefoil_DNA-bd_dom,superfamily_Beta-trefoil_DNA-bd_dom	ENSG00000124232		0.587	RBPJL-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RBPJL	HGNC	protein_coding	OTTHUMT00000080391.1	-	0.00	61	0	G	NM_014276		43942696	+1	tier1	-	no_errors	ENST00000343694	ensembl	human	known	74_37	missense	8.57	64	6	SNP	0.901	C
RFX7	64864	genome.wustl.edu	37	15	56394372	56394372	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr15:56394372C>G	ENST00000559447.2	-	6	578	c.307G>C	c.(307-309)Gat>Cat	p.D103H	RFX7_ENST00000423270.1_Missense_Mutation_p.D200H|RFX7_ENST00000422057.1_Missense_Mutation_p.D103H|RFX7_ENST00000317318.6_Missense_Mutation_p.D200H			Q2KHR2	RFX7_HUMAN	regulatory factor X, 7	103					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(3)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19						CTTACCCCATCTCCAGTTTTG	0.343																																																	0													73.0	69.0	70.0					15																	56394372		1802	4064	5866	SO:0001583	missense	0					15q21.3	2008-08-04	2008-08-04	2008-08-04		ENSG00000181827			25777	protein-coding gene	gene with protein product		612660	"""regulatory factor X domain containing 2"""	RFXDC2			Standard	NM_022841		Approved	FLJ12994	uc010bfn.3	Q2KHR2		ENST00000559447.2:c.307G>C	15.37:g.56394372C>G	ENSP00000453281:p.Asp103His		Q6ZRR1|Q6ZTY6|Q8N3J0|Q9H7A9|Q9H956	Missense_Mutation	SNP	pfam_DNA-bd_RFX	p.D200H	ENST00000559447.2	37	c.598		15	.	.	.	.	.	.	.	.	.	.	C	25.4	4.633651	0.87660	.	.	ENSG00000181827	ENST00000422057;ENST00000317318;ENST00000423270	T;T;T	0.58210	0.37;0.35;0.35	5.89	5.89	0.94794	.	0.000000	0.85682	D	0.000000	T	0.69433	0.3110	L	0.50333	1.59	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.75484	0.986;0.978	T	0.69525	-0.5122	10	0.72032	D	0.01	-18.0133	19.239	0.93875	0.0:1.0:0.0:0.0	.	103;103	Q2KHR2;C9JU50	RFX7_HUMAN;.	H	103;200;200	ENSP00000387504:D103H;ENSP00000313299:D200H;ENSP00000397644:D200H	ENSP00000313299:D200H	D	-	1	0	RFX7	54181664	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.818000	0.86416	2.788000	0.95919	0.585000	0.79938	GAT	RFX7	-	NULL	ENSG00000181827		0.343	RFX7-001	KNOWN	non_canonical_U12|basic	protein_coding	RFX7	HGNC	protein_coding	OTTHUMT00000418841.3	-	0.00	65	0	C	NM_022841		56394372	-1	tier1	-	no_errors	ENST00000423270	ensembl	human	known	74_37	missense	16.95	49	10	SNP	1.000	G
RMND5B	64777	genome.wustl.edu	37	5	177573128	177573128	+	Missense_Mutation	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr5:177573128G>A	ENST00000515098.1	+	9	1059	c.708G>A	c.(706-708)atG>atA	p.M236I	RMND5B_ENST00000313386.4_Missense_Mutation_p.M236I|RMND5B_ENST00000542098.1_Missense_Mutation_p.M223I			Q96G75	RMD5B_HUMAN	required for meiotic nuclear division 5 homolog B (S. cerevisiae)	236										endometrium(3)|large_intestine(5)|lung(6)|ovary(1)|skin(2)	17	all_cancers(89;0.00294)|Renal(175;0.000269)|Lung NSC(126;0.00858)|all_lung(126;0.0139)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TCCAGGTGATGATGGGCAGCC	0.632											OREG0017097	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													45.0	43.0	44.0					5																	177573128		2203	4300	6503	SO:0001583	missense	0			BC009911	CCDS4431.1, CCDS75382.1	5q35.3	2012-07-20			ENSG00000145916	ENSG00000145916			26181	protein-coding gene	gene with protein product	"""GID complex subunit 2 homolog B"""					12975309	Standard	NM_022762		Approved	FLJ22318, GID2, GID2B	uc003mim.3	Q96G75	OTTHUMG00000130897	ENST00000515098.1:c.708G>A	5.37:g.177573128G>A	ENSP00000420875:p.Met236Ile	1939	Q1HE27|Q6UVY7|Q9H6F6	Missense_Mutation	SNP	smart_LisH_dimerisation,smart_CTLH_C,smart_CRA_dom,pfscan_LisH_dimerisation,pfscan_CTLH_C	p.M236I	ENST00000515098.1	37	c.708	CCDS4431.1	5	.	.	.	.	.	.	.	.	.	.	G	14.56	2.573260	0.45902	.	.	ENSG00000145916	ENST00000313386;ENST00000515098;ENST00000542098	.	.	.	5.65	5.65	0.86999	Ran binding protein-like, CRA domain (1);	0.054014	0.85682	D	0.000000	T	0.33059	0.0850	N	0.08118	0	0.37243	D	0.90621	B;B;B	0.12013	0.005;0.004;0.005	B;B;B	0.14023	0.007;0.004;0.01	T	0.27365	-1.0076	9	0.45353	T	0.12	-40.8591	12.2016	0.54328	0.0:0.0:0.8297:0.1703	.	223;223;236	B3KSG5;F5H6G4;Q96G75	.;.;RMD5B_HUMAN	I	236;236;223	.	ENSP00000320623:M236I	M	+	3	0	RMND5B	177505734	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.345000	0.52182	2.659000	0.90383	0.655000	0.94253	ATG	RMND5B	-	smart_CRA_dom	ENSG00000145916		0.632	RMND5B-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RMND5B	HGNC	protein_coding	OTTHUMT00000373542.1	-	0.00	60	0	G	NM_022762		177573128	+1	tier1	-	no_errors	ENST00000313386	ensembl	human	known	74_37	missense	18.60	35	8	SNP	1.000	A
RNF207	388591	genome.wustl.edu	37	1	6266692	6266692	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:6266692G>C	ENST00000377939.4	+	2	224	c.97G>C	c.(97-99)Gag>Cag	p.E33Q	RP1-120G22.11_ENST00000455744.1_RNA|RNF207_ENST00000377948.2_5'UTR	NM_207396.2	NP_997279.2	Q6ZRF8	RN207_HUMAN	ring finger protein 207	33						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(7)|ovary(2)	16	Ovarian(185;0.0634)	all_cancers(23;1.22e-38)|all_epithelial(116;4.25e-22)|all_lung(118;7.95e-08)|Lung NSC(185;1.6e-06)|all_neural(13;3.18e-06)|all_hematologic(16;8.99e-06)|Acute lymphoblastic leukemia(12;0.000365)|Breast(487;0.000496)|Renal(390;0.0007)|Colorectal(325;0.00104)|Glioma(11;0.00203)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0392)|Medulloblastoma(700;0.211)		Epithelial(90;4.84e-38)|GBM - Glioblastoma multiforme(13;5.77e-32)|OV - Ovarian serous cystadenocarcinoma(86;2.88e-19)|Colorectal(212;6.9e-08)|COAD - Colon adenocarcinoma(227;8.13e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|BRCA - Breast invasive adenocarcinoma(365;0.00108)|STAD - Stomach adenocarcinoma(132;0.00311)|READ - Rectum adenocarcinoma(331;0.0642)|Lung(427;0.182)		CGTGCAGTACGAGCGCCCGTG	0.687																																																	0													46.0	45.0	45.0					1																	6266692		2201	4300	6501	SO:0001583	missense	0			AK128246	CCDS59.2	1p36.31	2008-11-19			ENSG00000158286	ENSG00000158286		"""RING-type (C3HC4) zinc fingers"""	32947	protein-coding gene	gene with protein product	"""OTTHUMG00000001089"""		"""chromosome 1 open reading frame 188"""	C1orf188			Standard	NM_207396		Approved	FLJ46380, FLJ32096	uc001amg.3	Q6ZRF8	OTTHUMG00000001089	ENST00000377939.4:c.97G>C	1.37:g.6266692G>C	ENSP00000367173:p.Glu33Gln		A2VCM8|B4DFR6|Q5TGS6|Q6ZS63|Q96MP2	Missense_Mutation	SNP	pfam_Znf_B-box,smart_Znf_RING,pfscan_Znf_B-box,pfscan_Znf_RING	p.E33Q	ENST00000377939.4	37	c.97	CCDS59.2	1	.	.	.	.	.	.	.	.	.	.	G	17.00	3.275632	0.59649	.	.	ENSG00000158286	ENST00000377939	D	0.87103	-2.21	4.33	3.41	0.39046	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	0.229124	0.26582	U	0.023573	T	0.79311	0.4424	N	0.12853	0.265	0.80722	D	1	P;P	0.51147	0.905;0.942	P;P	0.51385	0.525;0.668	T	0.73382	-0.4000	10	0.22109	T	0.4	-19.9625	8.2802	0.31896	0.0926:0.1689:0.7385:0.0	.	33;33	Q6ZRF8;Q6ZRF8-2	RN207_HUMAN;.	Q	33	ENSP00000367173:E33Q	ENSP00000367173:E33Q	E	+	1	0	RNF207	6189279	0.986000	0.35501	0.765000	0.31456	0.885000	0.51271	1.248000	0.32827	0.819000	0.34492	-0.698000	0.03680	GAG	RNF207	-	smart_Znf_RING,pfscan_Znf_RING	ENSG00000158286		0.687	RNF207-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	RNF207	HGNC	protein_coding	OTTHUMT00000003669.2	-	0.00	46	0	G	NM_207396		6266692	+1	tier1	-	no_errors	ENST00000377939	ensembl	human	novel	74_37	missense	24.24	25	8	SNP	0.988	C
RPL10L	140801	genome.wustl.edu	37	14	47120658	47120658	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr14:47120658G>C	ENST00000298283.3	-	1	370	c.282C>G	c.(280-282)ttC>ttG	p.F94L		NM_080746.2	NP_542784.1	Q96L21	RL10L_HUMAN	ribosomal protein L10-like	94					spermatogenesis (GO:0007283)|translation (GO:0006412)	cytosolic large ribosomal subunit (GO:0022625)|membrane (GO:0016020)|nucleus (GO:0005634)|polysome (GO:0005844)	structural constituent of ribosome (GO:0003735)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(20)|ovary(1)	27						GGATGACATGGAAGGGATGGA	0.547																																																	0													69.0	67.0	68.0					14																	47120658		2203	4300	6503	SO:0001583	missense	0			AB063608	CCDS32071.1	14q21.2	2011-09-15			ENSG00000165496	ENSG00000165496		"""L ribosomal proteins"""	17976	protein-coding gene	gene with protein product						19123937	Standard	NM_080746		Approved		uc001wwg.3	Q96L21	OTTHUMG00000157869	ENST00000298283.3:c.282C>G	14.37:g.47120658G>C	ENSP00000298283:p.Phe94Leu		Q8IUD1	Missense_Mutation	SNP	pfam_Ribosomal_L10e/L16,superfamily_Ribosomal_L10e/L16,pirsf_Ribosomal_L10e,tigrfam_Ribosomal_L10e	p.F94L	ENST00000298283.3	37	c.282	CCDS32071.1	14	.	.	.	.	.	.	.	.	.	.	G	18.96	3.734289	0.69189	.	.	ENSG00000165496	ENST00000298283	T	0.76968	-1.06	4.17	4.17	0.49024	Ribosomal protein L10e/L16 (2);	0.000000	0.85682	D	0.000000	D	0.89726	0.6798	M	0.92169	3.28	0.80722	D	1	P	0.47604	0.898	D	0.63597	0.916	D	0.91604	0.5297	10	0.66056	D	0.02	-37.1443	14.7976	0.69889	0.0:0.0:1.0:0.0	.	94	Q96L21	RL10L_HUMAN	L	94	ENSP00000298283:F94L	ENSP00000298283:F94L	F	-	3	2	RPL10L	46190408	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.347000	0.52200	2.608000	0.88229	0.655000	0.94253	TTC	RPL10L	-	pfam_Ribosomal_L10e/L16,superfamily_Ribosomal_L10e/L16,pirsf_Ribosomal_L10e,tigrfam_Ribosomal_L10e	ENSG00000165496		0.547	RPL10L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL10L	HGNC	protein_coding	OTTHUMT00000349819.1	-	0.00	51	0	G			47120658	-1	tier1	-	no_errors	ENST00000298283	ensembl	human	known	74_37	missense	31.67	41	19	SNP	1.000	C
RPRD2	23248	genome.wustl.edu	37	1	150444823	150444823	+	Silent	SNP	A	A	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:150444823A>G	ENST00000369068.4	+	11	3403	c.3399A>G	c.(3397-3399)acA>acG	p.T1133T	RPRD2_ENST00000492220.1_3'UTR|RPRD2_ENST00000401000.4_Silent_p.T1107T	NM_015203.3	NP_056018.2	Q5VT52	RPRD2_HUMAN	regulation of nuclear pre-mRNA domain containing 2	1133						DNA-directed RNA polymerase II, holoenzyme (GO:0016591)				central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(20)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	37						ATCTGAGCACATCAGGTAGCT	0.562																																																	0													53.0	57.0	56.0					1																	150444823		2009	4159	6168	SO:0001819	synonymous_variant	0			BX641025	CCDS44216.1, CCDS72907.1	1q21.2	2012-02-09	2008-08-15	2008-07-28	ENSG00000163125	ENSG00000163125			29039	protein-coding gene	gene with protein product		614695	"""KIAA0460"""	KIAA0460		22231121	Standard	XM_005245033		Approved	FLJ32145, HSPC099	uc009wlr.3	Q5VT52	OTTHUMG00000012808	ENST00000369068.4:c.3399A>G	1.37:g.150444823A>G			A8K6N8|B3KPT1|B4E2Q6|O75048|Q5VT51|Q5VT53|Q6MZL4|Q86XD2|Q9P0D7	Silent	SNP	pfam_RNA_pol_II-bd,superfamily_ENTH_VHS,superfamily_Ricin_B_lectin,smart_CID_dom	p.T1133	ENST00000369068.4	37	c.3399	CCDS44216.1	1																																																																																			RPRD2	-	NULL	ENSG00000163125		0.562	RPRD2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RPRD2	HGNC	protein_coding	OTTHUMT00000035844.1	-	0.00	39	0	A	NM_015203		150444823	+1	tier1	-	no_errors	ENST00000369068	ensembl	human	known	74_37	silent	30.30	46	20	SNP	0.958	G
RPS13	6207	genome.wustl.edu	37	11	17098993	17098993	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr11:17098993G>C	ENST00000525634.1	-	2	200	c.55C>G	c.(55-57)Cga>Gga	p.R19G	RPS13_ENST00000526895.1_5'UTR|SNORD14A_ENST00000606526.1_RNA|SNORD14B_ENST00000364533.1_RNA|RPS13_ENST00000228140.2_Missense_Mutation_p.R19G|PIK3C2A_ENST00000531428.1_5'Flank			P62277	RS13_HUMAN	ribosomal protein S13	19					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|negative regulation of RNA splicing (GO:0033119)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribosome (GO:0005840)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(2)	5						ACGCTGCGTCGATAGGGTAAA	0.632																																																	0													47.0	52.0	50.0					11																	17098993		2200	4294	6494	SO:0001583	missense	0			X79239	CCDS7823.1	11p	2011-04-05			ENSG00000110700	ENSG00000110700		"""S ribosomal proteins"""	10386	protein-coding gene	gene with protein product	"""40S ribosomal protein S13"""	180476				8332508, 9582194	Standard	NM_001017		Approved	S13	uc001mmp.3	P62277	OTTHUMG00000165988	ENST00000525634.1:c.55C>G	11.37:g.17098993G>C	ENSP00000435777:p.Arg19Gly		B2R549|P19116|Q02546|Q29200|Q498Y0	Missense_Mutation	SNP	pfam_Ribosomal_S13/S15_N,pfam_Ribosomal_S15,superfamily_S15_NS1_RNA-bd	p.R19G	ENST00000525634.1	37	c.55	CCDS7823.1	11	.	.	.	.	.	.	.	.	.	.	G	23.7	4.447511	0.84101	.	.	ENSG00000110700	ENST00000228140;ENST00000525634;ENST00000533969	T	0.26660	1.72	6.07	6.07	0.98685	Ribosomal protein S13/S15, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.44074	0.1276	M	0.89534	3.04	0.80722	D	1	B	0.15719	0.014	B	0.32211	0.142	T	0.45381	-0.9265	10	0.72032	D	0.01	-36.9433	14.175	0.65534	0.0:0.0:0.8507:0.1493	.	19	P62277	RS13_HUMAN	G	19	ENSP00000432096:R19G	ENSP00000228140:R19G	R	-	1	2	RPS13	17055569	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	2.097000	0.41748	2.884000	0.98904	0.655000	0.94253	CGA	RPS13	-	pfam_Ribosomal_S13/S15_N	ENSG00000110700		0.632	RPS13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS13	HGNC	protein_coding	OTTHUMT00000387320.2	-	0.00	40	0	G	NM_001017		17098993	-1	tier1	-	no_errors	ENST00000525634	ensembl	human	known	74_37	missense	29.73	26	11	SNP	1.000	C
RPUSD2	27079	genome.wustl.edu	37	15	40864051	40864051	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr15:40864051G>C	ENST00000315616.7	+	2	893	c.855G>C	c.(853-855)aaG>aaC	p.K285N	RPUSD2_ENST00000559271.1_Missense_Mutation_p.K224N	NM_152260.1	NP_689473.1	Q8IZ73	RUSD2_HUMAN	RNA pseudouridylate synthase domain containing 2	285					pseudouridine synthesis (GO:0001522)		poly(A) RNA binding (GO:0044822)|pseudouridine synthase activity (GO:0009982)			kidney(4)|lung(4)|skin(3)	11		all_cancers(109;2.74e-14)|all_epithelial(112;1.64e-11)|Lung NSC(122;6.69e-09)|all_lung(180;1.22e-07)|Melanoma(134;0.091)|Colorectal(260;0.175)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;3.1e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0786)		TGTTTGCCAAGACAGCTGCAG	0.542																																																	0													110.0	106.0	107.0					15																	40864051		2203	4300	6503	SO:0001583	missense	0			AK055971	CCDS10061.1, CCDS66737.1	15q13.3	2013-02-11	2005-01-31	2005-02-07	ENSG00000166133	ENSG00000166133		"""RNA pseudouridylate synthase domain containing"""	24180	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 19"""	C15orf19		12477932	Standard	NM_001286407		Approved	C18B11, FLJ31409	uc001zmd.1	Q8IZ73	OTTHUMG00000130031	ENST00000315616.7:c.855G>C	15.37:g.40864051G>C	ENSP00000323288:p.Lys285Asn		B4DDD1|Q7L989|Q92939|Q96IA7|Q96N50	Missense_Mutation	SNP	pfam_PsdUridine_synth_RsuA/RluD,superfamily_PsdUridine_synth_cat_dom,tigrfam_PsdUridine_synth_RluC/D	p.K285N	ENST00000315616.7	37	c.855	CCDS10061.1	15	.	.	.	.	.	.	.	.	.	.	G	22.1	4.245269	0.80024	.	.	ENSG00000166133	ENST00000315616;ENST00000417769	T	0.15017	2.46	6.17	4.32	0.51571	Pseudouridine synthase, RsuA and RluB/C/D/E/F (1);Pseudouridine synthase, catalytic domain (1);	0.042053	0.85682	D	0.000000	T	0.59169	0.2174	H	0.98769	4.325	0.54753	D	0.999989	D	0.71674	0.998	D	0.79108	0.992	T	0.75224	-0.3393	10	0.87932	D	0	-25.777	13.0963	0.59195	0.1289:0.0:0.8711:0.0	.	285	Q8IZ73	RUSD2_HUMAN	N	285;264	ENSP00000323288:K285N	ENSP00000323288:K285N	K	+	3	2	RPUSD2	38651343	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.079000	0.30766	0.948000	0.37687	0.655000	0.94253	AAG	RPUSD2	-	pfam_PsdUridine_synth_RsuA/RluD,superfamily_PsdUridine_synth_cat_dom,tigrfam_PsdUridine_synth_RluC/D	ENSG00000166133		0.542	RPUSD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RPUSD2	HGNC	protein_coding	OTTHUMT00000252308.2	-	0.00	20	0	G	NM_152260		40864051	+1	tier1	-	no_errors	ENST00000315616	ensembl	human	known	74_37	missense	24.24	25	8	SNP	1.000	C
RTP4	64108	genome.wustl.edu	37	3	187089154	187089154	+	Missense_Mutation	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr3:187089154C>T	ENST00000259030.2	+	2	844	c.734C>T	c.(733-735)tCa>tTa	p.S245L		NM_022147.2	NP_071430.2	Q96DX8	RTP4_HUMAN	receptor (chemosensory) transporter protein 4	245					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|protein targeting to membrane (GO:0006612)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|large_intestine(2)|lung(5)|skin(1)	11	all_cancers(143;4.66e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;5.56e-18)	GBM - Glioblastoma multiforme(93;0.0269)		TGCTTTACATCAGAATGATGA	0.368																																																	0													44.0	39.0	41.0					3																	187089154		2203	4300	6503	SO:0001583	missense	0			BC013161	CCDS33910.1	3q27.3	2014-02-20	2006-11-21		ENSG00000136514	ENSG00000136514		"""Receptor transporter proteins"""	23992	protein-coding gene	gene with protein product	"""zinc finger, 3CxxC-type 4"""	609350	"""receptor transporter protein 4"""			16271481, 15550249, 16720576	Standard	NM_022147		Approved	IFRG28, Z3CXXC4	uc003frm.3	Q96DX8	OTTHUMG00000156459	ENST00000259030.2:c.734C>T	3.37:g.187089154C>T	ENSP00000259030:p.Ser245Leu		Q9H4F3	Missense_Mutation	SNP	NULL	p.S245L	ENST00000259030.2	37	c.734	CCDS33910.1	3	.	.	.	.	.	.	.	.	.	.	C	4.838	0.155817	0.09236	.	.	ENSG00000136514	ENST00000259030	T	0.20738	2.05	2.87	-5.73	0.02398	.	6.352380	0.00357	N	0.000027	T	0.10852	0.0265	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.16453	-1.0402	10	0.72032	D	0.01	.	1.3391	0.02150	0.3863:0.3141:0.1343:0.1654	.	245	Q96DX8	RTP4_HUMAN	L	245	ENSP00000259030:S245L	ENSP00000259030:S245L	S	+	2	0	RTP4	188571848	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-2.822000	0.00748	-2.723000	0.00388	-1.047000	0.02352	TCA	RTP4	-	NULL	ENSG00000136514		0.368	RTP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTP4	HGNC	protein_coding	OTTHUMT00000344260.1	-	0.00	41	0	C	NM_022147		187089154	+1	tier1	-	no_errors	ENST00000259030	ensembl	human	known	74_37	missense	25.93	20	7	SNP	0.000	T
SAT1	6303	genome.wustl.edu	37	X	23803555	23803555	+	Intron	SNP	G	G	C	rs11550720		TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chrX:23803555G>C	ENST00000379270.4	+	4	483				RP13-314C10.5_ENST00000366134.2_RNA|SAT1_ENST00000489394.1_Intron|SAT1_ENST00000379254.1_Intron	NM_002970.2	NP_002961.1	Q9H2B4	S26A1_HUMAN	spermidine/spermine N1-acetyltransferase 1						3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|carbohydrate metabolic process (GO:0005975)|chloride transport (GO:0006821)|glycosaminoglycan metabolic process (GO:0030203)|ion transport (GO:0006811)|oxalate transport (GO:0019532)|small molecule metabolic process (GO:0044281)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)|xenobiotic metabolic process (GO:0006805)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	anion:anion antiporter activity (GO:0015301)|chloride transmembrane transporter activity (GO:0015108)|oxalate transmembrane transporter activity (GO:0019531)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)			breast(1)|endometrium(3)|kidney(3)|lung(3)	10						AGGTACGATTGAGTTCGGAGC	0.383																																																	0													223.0	191.0	202.0					X																	23803555		2203	4300	6503	SO:0001627	intron_variant	0			M55580	CCDS14207.1	Xp22.1	2011-11-16	2006-08-24	2006-08-24	ENSG00000130066	ENSG00000130066	2.3.1.57		10540	protein-coding gene	gene with protein product	"""diamine N-acetyltransferase 1"""	313020	"""spermidine/spermine N1-acetyltransferase"""	SAT		1985966, 1417826	Standard	NM_002970		Approved	SSAT	uc004dau.3	P21673	OTTHUMG00000021256	ENST00000379270.4:c.304+9G>C	X.37:g.23803555G>C			A8K9N2|Q7Z5R3|Q96BK0	RNA	SNP	-	NULL	ENST00000379270.4	37	NULL	CCDS14207.1	X																																																																																			SAT1	-	-	ENSG00000130066		0.383	SAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAT1	HGNC	protein_coding	OTTHUMT00000056056.1	-	0.00	48	0	G	NM_002970		23803555	+1	tier1	-	no_errors	ENST00000462639	ensembl	human	known	74_37	rna	15.91	37	7	SNP	0.000	C
SCAMP3	10067	genome.wustl.edu	37	1	155228738	155228738	+	Missense_Mutation	SNP	C	C	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:155228738C>A	ENST00000302631.3	-	5	503	c.396G>T	c.(394-396)caG>caT	p.Q132H	SCAMP3_ENST00000472397.1_5'UTR|SCAMP3_ENST00000355379.3_Missense_Mutation_p.Q106H	NM_005698.3	NP_005689.2	O14828	SCAM3_HUMAN	secretory carrier membrane protein 3	132					post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)|response to retinoic acid (GO:0032526)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(3)|large_intestine(3)|lung(7)|ovary(4)|urinary_tract(1)	19	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			GCCAATTGTTCTGTCGAGCTG	0.483																																																	0													100.0	104.0	103.0					1																	155228738		2203	4300	6503	SO:0001583	missense	0			AF005039	CCDS1105.1, CCDS1106.1	1q21	2013-02-21			ENSG00000116521	ENSG00000116521		"""Secretory carrier membrane proteins"""	10565	protein-coding gene	gene with protein product	"""Propin 1"""	606913		C1orf3		9331372, 9658162	Standard	NM_005698		Approved		uc001fjs.3	O14828	OTTHUMG00000035874	ENST00000302631.3:c.396G>T	1.37:g.155228738C>A	ENSP00000307275:p.Gln132His		A9Z1W6|B1AVS6|O15128|Q96FR8|Q9BPY0	Missense_Mutation	SNP	pfam_SCAMP	p.Q132H	ENST00000302631.3	37	c.396	CCDS1105.1	1	.	.	.	.	.	.	.	.	.	.	.	21.7	4.184899	0.78677	.	.	ENSG00000116521	ENST00000302631;ENST00000355379	T;T	0.18338	2.22;2.22	4.83	2.92	0.33932	.	0.000000	0.85682	D	0.000000	T	0.20700	0.0498	M	0.63843	1.955	0.45118	D	0.998134	D;D	0.61080	0.975;0.989	P;D	0.63113	0.854;0.911	T	0.01149	-1.1436	9	.	.	.	-19.4769	9.5236	0.39152	0.0:0.8213:0.0:0.1787	.	106;132	O14828-2;O14828	.;SCAM3_HUMAN	H	132;106	ENSP00000307275:Q132H;ENSP00000347540:Q106H	.	Q	-	3	2	SCAMP3	153495362	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.886000	0.39688	1.265000	0.44215	0.655000	0.94253	CAG	SCAMP3	-	pfam_SCAMP	ENSG00000116521		0.483	SCAMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCAMP3	HGNC	protein_coding	OTTHUMT00000087399.1	-	0.00	131	0	C	NM_005698		155228738	-1	tier1	-	no_errors	ENST00000302631	ensembl	human	known	74_37	missense	14.78	98	17	SNP	1.000	A
SCN8A	6334	genome.wustl.edu	37	12	52056610	52056610	+	Silent	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr12:52056610G>A	ENST00000354534.6	+	2	187	c.9G>A	c.(7-9)gcG>gcA	p.A3A	SCN8A_ENST00000550891.1_Silent_p.A3A|SCN8A_ENST00000545061.1_Silent_p.A3A	NM_001177984.2|NM_014191.3	NP_001171455.1|NP_055006.1	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha subunit	3					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|membrane depolarization during action potential (GO:0086010)|muscle organ development (GO:0007517)|myelination (GO:0042552)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|neuronal action potential (GO:0019228)|peripheral nervous system development (GO:0007422)|response to toxic substance (GO:0009636)|sensory perception of sound (GO:0007605)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	ATP binding (GO:0005524)|voltage-gated sodium channel activity (GO:0005248)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55				BRCA - Breast invasive adenocarcinoma(357;0.181)	Valproic Acid(DB00313)	AGATGGCAGCGCGGCTGCTTG	0.517																																																	0													102.0	101.0	101.0					12																	52056610		2041	4214	6255	SO:0001819	synonymous_variant	0			AB027567	CCDS44891.1, CCDS53794.1	12q13.1	2012-02-26	2007-01-23			ENSG00000196876		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10596	protein-coding gene	gene with protein product		600702	"""sodium channel, voltage gated, type VIII, alpha polypeptide"""	MED		7670495, 9828131, 16382098	Standard	NM_014191		Approved	Nav1.6, NaCh6, PN4, CerIII	uc001ryw.4	Q9UQD0		ENST00000354534.6:c.9G>A	12.37:g.52056610G>A			B9VWG8|O95788|Q9NYX2|Q9UPB2	Silent	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,pfam_IQ_motif_EF-hand-BS,smart_IQ_motif_EF-hand-BS,prints_Na_channel_a8su,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.A3	ENST00000354534.6	37	c.9	CCDS44891.1	12																																																																																			SCN8A	-	NULL	ENSG00000196876		0.517	SCN8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN8A	HGNC	protein_coding	OTTHUMT00000404372.3		0.00	15	0	G	NM_014191		52056610	+1			no_errors	ENST00000354534	ensembl	human	known	74_37	silent	27.27	8	3	SNP	0.915	A
SEC24A	10802	genome.wustl.edu	37	5	134007552	134007552	+	Missense_Mutation	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr5:134007552G>A	ENST00000398844.2	+	4	1081	c.793G>A	c.(793-795)Gag>Aag	p.E265K	SEC24A_ENST00000322887.4_Missense_Mutation_p.E265K	NM_021982.2	NP_068817.1	O95486	SC24A_HUMAN	SEC24 family member A	265					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|positive regulation of cholesterol homeostasis (GO:2000189)|positive regulation of protein secretion (GO:0050714)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045714)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(13)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	36			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TAGTTACGACGAGATTGAAGG	0.308																																																	0													137.0	122.0	127.0					5																	134007552		1848	4094	5942	SO:0001583	missense	0			AJ131244	CCDS43363.1, CCDS58967.1	5q31.1	2013-10-21	2013-10-21		ENSG00000113615	ENSG00000113615			10703	protein-coding gene	gene with protein product		607183	"""SEC24 (S. cerevisiae) related gene family, member A"", ""SEC24 family, member A (S. cerevisiae)"""			10075675, 10329445	Standard	NM_021982		Approved		uc003kzs.3	O95486	OTTHUMG00000163064	ENST00000398844.2:c.793G>A	5.37:g.134007552G>A	ENSP00000381823:p.Glu265Lys		A8MVW3|Q8WUV2|Q96GP7	Missense_Mutation	SNP	pfam_Sec23/24_trunk_dom,pfam_Sec23/24_helical_dom,pfam_Sec23_24_beta_S,pfam_Znf_Sec23_Sec24,pfam_Gelsolin_dom,superfamily_Sec23/24_helical_dom	p.E265K	ENST00000398844.2	37	c.793	CCDS43363.1	5	.	.	.	.	.	.	.	.	.	.	G	13.14	2.149535	0.37923	.	.	ENSG00000113615	ENST00000398844;ENST00000322887	T;T	0.41758	1.22;0.99	5.28	4.21	0.49690	.	0.701868	0.14283	N	0.329413	T	0.23846	0.0577	L	0.36672	1.1	0.28102	N	0.931374	P	0.38370	0.628	B	0.24155	0.051	T	0.08743	-1.0707	10	0.07325	T	0.83	-12.8437	10.7932	0.46445	0.1539:0.0:0.8461:0.0	.	265	O95486	SC24A_HUMAN	K	265	ENSP00000381823:E265K;ENSP00000321749:E265K	ENSP00000321749:E265K	E	+	1	0	SEC24A	134035451	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	2.037000	0.41174	2.464000	0.83262	0.591000	0.81541	GAG	SEC24A	-	NULL	ENSG00000113615		0.308	SEC24A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC24A	HGNC	protein_coding	OTTHUMT00000371563.1	-	0.00	81	0	G			134007552	+1	tier1	-	no_errors	ENST00000398844	ensembl	human	known	74_37	missense	17.44	71	15	SNP	1.000	A
SEC61A1	29927	genome.wustl.edu	37	3	127774404	127774404	+	Missense_Mutation	SNP	A	A	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr3:127774404A>C	ENST00000243253.3	+	3	305	c.121A>C	c.(121-123)Atc>Ctc	p.I41L	SEC61A1_ENST00000464451.1_Missense_Mutation_p.I47L|SEC61A1_ENST00000424880.2_Intron	NM_013336.3	NP_037468.1	P61619	S61A1_HUMAN	Sec61 alpha 1 subunit (S. cerevisiae)	41					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell growth (GO:0016049)|endoplasmic reticulum organization (GO:0007029)|posttranslational protein targeting to membrane (GO:0006620)|protein targeting to ER (GO:0045047)|response to interferon-gamma (GO:0034341)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)	integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|rough endoplasmic reticulum (GO:0005791)	ribosome binding (GO:0043022)			central_nervous_system(1)|kidney(1)|large_intestine(5)|liver(1)|lung(8)|ovary(1)|prostate(4)	21						CACCCTCTTTATCTTCTTAGT	0.438																																																	0													186.0	177.0	180.0					3																	127774404		2203	4300	6503	SO:0001583	missense	0			AF077032	CCDS3046.1	3q21.3	2008-02-05			ENSG00000058262	ENSG00000058262			18276	protein-coding gene	gene with protein product		609213					Standard	NM_013336		Approved		uc003ekb.3	P61619	OTTHUMG00000159624	ENST00000243253.3:c.121A>C	3.37:g.127774404A>C	ENSP00000243253:p.Ile41Leu		P38378|P57726|Q5JPF8|Q8N0Z4|Q8N3U3|Q8NC71|Q9BU16|Q9Y2R3	Missense_Mutation	SNP	pfam_SecY/SEC61-alpha,pfam_Translocon_Sec61/SecY_plug_dom,superfamily_SecY_su_dom,pirsf_SecY/SEC61-alpha,tigrfam_SecY/SEC61-alpha	p.I41L	ENST00000243253.3	37	c.121	CCDS3046.1	3	.	.	.	.	.	.	.	.	.	.	A	20.3	3.968512	0.74131	.	.	ENSG00000058262	ENST00000464451;ENST00000243253	.	.	.	5.51	5.51	0.81932	Translocon Sec61/SecY, plug domain (1);SecY subunit domain (2);	0.000000	0.85682	D	0.000000	T	0.54983	0.1892	L	0.44542	1.39	0.80722	D	1	B	0.02656	0.0	B	0.11329	0.006	T	0.50004	-0.8878	9	0.24483	T	0.36	.	15.6324	0.76920	1.0:0.0:0.0:0.0	.	41	P61619	S61A1_HUMAN	L	47;41	.	ENSP00000243253:I41L	I	+	1	0	SEC61A1	129257094	1.000000	0.71417	0.982000	0.44146	0.891000	0.51852	9.334000	0.96470	2.088000	0.63022	0.528000	0.53228	ATC	SEC61A1	-	pfam_Translocon_Sec61/SecY_plug_dom,superfamily_SecY_su_dom,pirsf_SecY/SEC61-alpha,tigrfam_SecY/SEC61-alpha	ENSG00000058262		0.438	SEC61A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC61A1	HGNC	protein_coding	OTTHUMT00000356541.2	-	0.00	71	0	A	NM_013336		127774404	+1	tier1	-	no_errors	ENST00000243253	ensembl	human	known	74_37	missense	15.79	96	18	SNP	1.000	C
SEMA3A	10371	genome.wustl.edu	37	7	83634746	83634746	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr7:83634746G>C	ENST00000265362.4	-	11	1583	c.1269C>G	c.(1267-1269)atC>atG	p.I423M	SEMA3A_ENST00000436949.1_Missense_Mutation_p.I423M	NM_006080.2	NP_006071.1	Q14563	SEM3A_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A	423	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				apoptotic process (GO:0006915)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis involved in innervation (GO:0060385)|branchiomotor neuron axon guidance (GO:0021785)|dendrite morphogenesis (GO:0048813)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|facial nerve structural organization (GO:0021612)|gonadotrophin-releasing hormone neuronal migration to the hypothalamus (GO:0021828)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of epithelial cell migration (GO:0010633)|nerve development (GO:0021675)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neural crest cell migration involved in sympathetic nervous system development (GO:1903045)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of male gonad development (GO:2000020)|positive regulation of neuron migration (GO:2001224)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of heart rate (GO:0002027)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sensory system development (GO:0048880)|sympathetic ganglion development (GO:0061549)|sympathetic nervous system development (GO:0048485)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular region (GO:0005576)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|neuropilin binding (GO:0038191)|receptor activity (GO:0004872)			breast(3)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53						CATCCGTTTTGATCACTATTG	0.378																																																	0													188.0	169.0	176.0					7																	83634746		2203	4300	6503	SO:0001583	missense	0			L26081	CCDS5599.1	7p12.1	2013-01-11			ENSG00000075213	ENSG00000075213		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10723	protein-coding gene	gene with protein product	"""sema III"""	603961		SEMAD		8269517, 7748561	Standard	NM_006080		Approved	SEMA1, SemD, coll-1, Hsema-I	uc003uhz.3	Q14563	OTTHUMG00000023443	ENST00000265362.4:c.1269C>G	7.37:g.83634746G>C	ENSP00000265362:p.Ile423Met			Missense_Mutation	SNP	pfam_Semap_dom,superfamily_Semap_dom,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_Ig_sub,pfscan_Semap_dom,pfscan_Ig-like_dom	p.I423M	ENST00000265362.4	37	c.1269	CCDS5599.1	7	.	.	.	.	.	.	.	.	.	.	G	11.64	1.699582	0.30142	.	.	ENSG00000075213	ENST00000265362;ENST00000436949	T;T	0.11063	2.81;2.81	4.96	1.08	0.20341	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.151216	0.64402	D	0.000020	T	0.10380	0.0254	L	0.55743	1.74	0.48632	D	0.999687	B	0.16166	0.016	B	0.24848	0.056	T	0.09509	-1.0671	10	0.62326	D	0.03	.	5.2868	0.15706	0.3592:0.0:0.5124:0.1284	.	423	Q14563	SEM3A_HUMAN	M	423	ENSP00000265362:I423M;ENSP00000415260:I423M	ENSP00000265362:I423M	I	-	3	3	SEMA3A	83472682	1.000000	0.71417	0.999000	0.59377	0.837000	0.47467	0.566000	0.23593	0.229000	0.21039	-0.482000	0.04802	ATC	SEMA3A	-	pfam_Semap_dom,superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom	ENSG00000075213		0.378	SEMA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA3A	HGNC	protein_coding	OTTHUMT00000253355.2	-	0.00	64	0	G	NM_006080		83634746	-1	tier1	-	no_errors	ENST00000265362	ensembl	human	known	74_37	missense	15.56	76	14	SNP	1.000	C
SEPT1	1731	genome.wustl.edu	37	16	30392739	30392739	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr16:30392739C>G	ENST00000571393.1	-	6	547	c.361G>C	c.(361-363)Gag>Cag	p.E121Q	SEPT1_ENST00000605106.1_Missense_Mutation_p.E126Q|SEPT1_ENST00000570039.1_5'Flank|SEPT1_ENST00000321367.3_Missense_Mutation_p.E168Q			Q8WYJ6	SEPT1_HUMAN	septin 1	121	Septin-type G.				cell cycle (GO:0007049)|cell division (GO:0051301)	septin complex (GO:0031105)	GTP binding (GO:0005525)	p.E121K(1)		breast(2)|endometrium(1)|large_intestine(3)|lung(15)|ovary(1)|skin(1)|urinary_tract(1)	24			Colorectal(24;0.193)			AGGCCACTCTCATCCCTAAGG	0.582																																																	1	Substitution - Missense(1)	breast(1)											107.0	101.0	103.0					16																	30392739		2197	4300	6497	SO:0001583	missense	0			AF308288	CCDS10678.1, CCDS10678.2, CCDS10678.3	16p11.2	2013-01-21		2001-09-10	ENSG00000180096	ENSG00000180096	3.1.5.1	"""Septins"""	2879	protein-coding gene	gene with protein product		612897		DIFF6		8697812	Standard	NM_052838		Approved	PNUTL3	uc002dxy.4	Q8WYJ6	OTTHUMG00000176984	ENST00000571393.1:c.361G>C	16.37:g.30392739C>G	ENSP00000460441:p.Glu121Gln		B4DVE6|Q658T1|Q8NEZ1|Q96EL4|Q9H285	Missense_Mutation	SNP	pfam_Cell_div_GTP-bd,pfam_Ribosome_biogen_GTPase_RsgA,superfamily_P-loop_NTPase,pirsf_Septin	p.E168Q	ENST00000571393.1	37	c.502		16	.	.	.	.	.	.	.	.	.	.	C	15.38	2.816937	0.50633	.	.	ENSG00000180096	ENST00000321367	.	.	.	5.65	4.7	0.59300	.	0.092055	0.47455	D	0.000227	T	0.80924	0.4717	M	0.86953	2.85	0.58432	D	0.999994	D;D	0.89917	1.0;0.992	D;P	0.81914	0.995;0.882	D	0.84685	0.0719	9	0.87932	D	0	.	13.8397	0.63430	0.0:0.9251:0.0:0.0749	.	168;121	B4E0I4;Q8WYJ6	.;SEPT1_HUMAN	Q	121	.	ENSP00000324511:E121Q	E	-	1	0	SEPT1	30300240	1.000000	0.71417	0.997000	0.53966	0.048000	0.14542	7.818000	0.86416	1.546000	0.49388	-0.229000	0.12294	GAG	SEPT1	-	pfam_Cell_div_GTP-bd,superfamily_P-loop_NTPase,pirsf_Septin	ENSG00000180096		0.582	SEPT1-201	KNOWN	basic	protein_coding	SEPT1	HGNC	protein_coding		-	0.00	87	0	C	NM_052838		30392739	-1	tier1	-	no_errors	ENST00000321367	ensembl	human	known	74_37	missense	30.00	63	27	SNP	1.000	G
SEPT7P2	641977	genome.wustl.edu	37	7	45788242	45788243	+	RNA	INS	-	-	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr7:45788242_45788243insT	ENST00000429741.1	-	0	803_804									septin 7 pseudogene 2																		TTTTTAACAAGTTTTTTTTCTT	0.317																																																	0																																												0			AL133216		7p12.3	2010-03-24	2010-03-24	2010-03-24	ENSG00000214765	ENSG00000214765			32339	pseudogene	pseudogene		611563	"""septin 7B"", ""septin 13"""	SEPT7B, SEPT13		15915442	Standard	NR_024271		Approved	DKFZp313J1114	uc003tnf.4		OTTHUMG00000155423		7.37:g.45788250_45788250dupT				RNA	INS	-	NULL	ENST00000429741.1	37	NULL		7																																																																																			SEPT7P2	-	-	ENSG00000214765		0.317	SEPT7P2-001	KNOWN	basic	processed_transcript	SEPT7P2	HGNC	pseudogene	OTTHUMT00000340060.1		0.00	152	0	-	NR_024271		45788243	-1	tier1		no_errors	ENST00000338231	ensembl	human	known	74_37	rna	19.88	129	32	INS	1.000:1.000	T
SEPT14	346288	genome.wustl.edu	37	7	55886880	55886880	+	Missense_Mutation	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr7:55886880C>T	ENST00000388975.3	-	7	873	c.757G>A	c.(757-759)Gaa>Aaa	p.E253K		NM_207366.2	NP_997249.2	Q6ZU15	SEP14_HUMAN	septin 14	253	Septin-type G.				cell cycle (GO:0007049)|cell division (GO:0051301)	septin complex (GO:0031105)	GTP binding (GO:0005525)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(15)|skin(2)	23	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			ACTTTCACTTCATCTGTACTC	0.428																																																	0													62.0	51.0	55.0					7																	55886880		2203	4300	6503	SO:0001583	missense	0			AK126048	CCDS5519.2	7p11.2	2013-01-21			ENSG00000154997	ENSG00000154997		"""Septins"""	33280	protein-coding gene	gene with protein product		612140					Standard	NM_207366		Approved	FLJ44060	uc003tqz.2	Q6ZU15	OTTHUMG00000129341	ENST00000388975.3:c.757G>A	7.37:g.55886880C>T	ENSP00000373627:p.Glu253Lys		A6NCC2|B4DXD6	Missense_Mutation	SNP	pfam_Cell_div_GTP-bd,superfamily_P-loop_NTPase,pirsf_Septin	p.E253K	ENST00000388975.3	37	c.757	CCDS5519.2	7	.	.	.	.	.	.	.	.	.	.	C	14.05	2.418828	0.42918	.	.	ENSG00000154997	ENST00000388975	T	0.32272	1.46	3.85	3.85	0.44370	.	0.000000	0.56097	D	0.000027	T	0.43211	0.1237	L	0.43554	1.36	0.35444	D	0.79508	P	0.51147	0.942	P	0.60886	0.88	T	0.55698	-0.8100	10	0.56958	D	0.05	.	13.6577	0.62348	0.0:1.0:0.0:0.0	.	253	Q6ZU15	SEP14_HUMAN	K	253	ENSP00000373627:E253K	ENSP00000373627:E253K	E	-	1	0	SEPT14	55854374	1.000000	0.71417	0.258000	0.24420	0.057000	0.15508	3.401000	0.52601	2.130000	0.65690	0.563000	0.77884	GAA	SEPT14	-	pfam_Cell_div_GTP-bd,superfamily_P-loop_NTPase,pirsf_Septin	ENSG00000154997		0.428	SEPT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEPT14	HGNC	protein_coding	OTTHUMT00000251489.2	-	0.00	55	0	C	NM_207366		55886880	-1	tier1	-	no_errors	ENST00000388975	ensembl	human	known	74_37	missense	41.67	42	30	SNP	0.943	T
SF3A1	10291	genome.wustl.edu	37	22	30730595	30730595	+	Silent	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr22:30730595C>G	ENST00000215793.8	-	16	2524	c.2370G>C	c.(2368-2370)ggG>ggC	p.G790G	SF3A1_ENST00000439242.1_Silent_p.G725G	NM_005877.4	NP_005868.1	Q15459	SF3A1_HUMAN	splicing factor 3a, subunit 1, 120kDa	790	Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.				gene expression (GO:0010467)|mRNA 3'-splice site recognition (GO:0000389)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U2-type spliceosomal complex (GO:0005684)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.G790G(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(9)|ovary(4)|pancreas(1)|prostate(1)|urinary_tract(1)	29						ACTTCTTCCTCCCGCCTCTCT	0.562																																																	1	Substitution - coding silent(1)	lung(1)											146.0	129.0	135.0					22																	30730595		2203	4300	6503	SO:0001819	synonymous_variant	0			X85237	CCDS13875.1	22q12.2	2014-09-17	2002-08-29		ENSG00000099995	ENSG00000099995			10765	protein-coding gene	gene with protein product		605595	"""splicing factor 3a, subunit 1, 120kD"""			7489498	Standard	NM_005877		Approved	SF3a120, SAP114, PRPF21, Prp21	uc003ahl.3	Q15459	OTTHUMG00000151005	ENST00000215793.8:c.2370G>C	22.37:g.30730595C>G			E9PAW1	Silent	SNP	pfam_PRP21-like,pfam_Surp,pfam_Ubiquitin_dom,superfamily_Surp,smart_Surp,smart_Ubiquitin_dom,pfscan_Surp,pfscan_Ubiquitin_supergroup	p.G790	ENST00000215793.8	37	c.2370	CCDS13875.1	22																																																																																			SF3A1	-	pfscan_Ubiquitin_supergroup	ENSG00000099995		0.562	SF3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SF3A1	HGNC	protein_coding	OTTHUMT00000320916.2	-	0.00	48	0	C	NM_005877		30730595	-1	tier1	-	no_errors	ENST00000215793	ensembl	human	known	74_37	silent	25.71	26	9	SNP	1.000	G
SGSM2	9905	genome.wustl.edu	37	17	2278855	2278855	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr17:2278855G>C	ENST00000426855.2	+	17	2210	c.2035G>C	c.(2035-2037)Gag>Cag	p.E679Q	SGSM2_ENST00000574563.1_Missense_Mutation_p.E679Q|RP1-59D14.5_ENST00000574290.1_RNA|RP1-59D14.5_ENST00000573007.1_RNA|SGSM2_ENST00000268989.3_Missense_Mutation_p.E724Q	NM_001098509.1	NP_001091979.1	O43147	SGSM2_HUMAN	small G protein signaling modulator 2	679	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				late endosome to Golgi transport (GO:0034499)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)		Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				Colorectal(2;5.15e-05)|READ - Rectum adenocarcinoma(2;0.000115)		ACCAAAACCTGAGCAGGAAGC	0.622																																																	0													52.0	63.0	59.0					17																	2278855		2203	4300	6503	SO:0001583	missense	0			BC039204	CCDS32526.1, CCDS45570.1	17p13.3	2013-07-10	2007-08-14	2007-08-14		ENSG00000141258		"""Small G protein signaling modulators"""	29026	protein-coding gene	gene with protein product		611418	"""RUN and TBC1 domain containing 1"""	RUTBC1		9455477, 17509819, 21808068	Standard	NM_014853		Approved	KIAA0397	uc002fum.4	O43147		ENST00000426855.2:c.2035G>C	17.37:g.2278855G>C	ENSP00000415107:p.Glu679Gln		A5LGW2|B4DH69|Q49AC2|Q6ZUY2|Q8IXU4	Missense_Mutation	SNP	pfam_Run,pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Run,smart_Rab-GTPase-TBC_dom,pfscan_Run,pfscan_Rab-GTPase-TBC_dom	p.E724Q	ENST00000426855.2	37	c.2170	CCDS45570.1	17	.	.	.	.	.	.	.	.	.	.	g	6.332	0.429403	0.11987	.	.	ENSG00000141258	ENST00000268989;ENST00000426855	T;T	0.11604	2.76;2.79	5.55	4.58	0.56647	Rab-GAP/TBC domain (3);	0.312551	0.36268	N	0.002687	T	0.05731	0.0150	N	0.05050	-0.12	0.22280	N	0.999235	P;B;P	0.42409	0.496;0.309;0.779	B;B;B	0.41036	0.217;0.058;0.346	T	0.36817	-0.9732	10	0.15499	T	0.54	-1.2471	11.7459	0.51819	0.0814:0.0:0.9186:0.0	.	679;679;724	O43147-5;O43147;O43147-2	.;SGSM2_HUMAN;.	Q	724;679	ENSP00000268989:E724Q;ENSP00000415107:E679Q	ENSP00000268989:E724Q	E	+	1	0	SGSM2	2225605	0.058000	0.20735	0.123000	0.21794	0.114000	0.19823	2.009000	0.40903	1.353000	0.45828	0.651000	0.88453	GAG	SGSM2	-	superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	ENSG00000141258		0.622	SGSM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGSM2	HGNC	protein_coding	OTTHUMT00000438186.1	-	0.00	50	0	G	NM_014853		2278855	+1	tier1	-	no_errors	ENST00000268989	ensembl	human	known	74_37	missense	35.90	25	14	SNP	0.594	C
SHROOM2	357	genome.wustl.edu	37	X	9914723	9914723	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chrX:9914723G>C	ENST00000380913.3	+	10	4687	c.4597G>C	c.(4597-4599)Gag>Cag	p.E1533Q	SHROOM2_ENST00000418909.2_Missense_Mutation_p.E368Q	NM_001649.2	NP_001640.1	Q13796	SHRM2_HUMAN	shroom family member 2	1533	ASD2. {ECO:0000255|PROSITE- ProRule:PRU00638}.				apical protein localization (GO:0045176)|brain development (GO:0007420)|camera-type eye development (GO:0043010)|camera-type eye morphogenesis (GO:0048593)|cell migration (GO:0016477)|cell-cell junction maintenance (GO:0045217)|cellular pigment accumulation (GO:0043482)|ear development (GO:0043583)|establishment of melanosome localization (GO:0032401)|eye pigment granule organization (GO:0008057)|lens morphogenesis in camera-type eye (GO:0002089)|melanosome organization (GO:0032438)|negative regulation of actin filament depolymerization (GO:0030835)|sodium ion transmembrane transport (GO:0035725)	apical plasma membrane (GO:0016324)|cell cortex (GO:0005938)|cell-cell adherens junction (GO:0005913)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|beta-catenin binding (GO:0008013)|ligand-gated sodium channel activity (GO:0015280)			breast(4)|central_nervous_system(2)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(13)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	57		Hepatocellular(5;0.000888)				ATCACTGCTTGAGAAGCAGAG	0.552																																																	0													33.0	30.0	31.0					X																	9914723		2203	4300	6503	SO:0001583	missense	0			X83543	CCDS14135.1	Xp22.3	2008-02-05	2006-07-20	2006-07-20	ENSG00000146950	ENSG00000146950			630	protein-coding gene	gene with protein product		300103	"""apical protein, Xenopus laevis-like"", ""apical protein-like (Xenopus laevis)"""	APXL		7795590, 16615870	Standard	NM_001649		Approved		uc004csu.1	Q13796	OTTHUMG00000021121	ENST00000380913.3:c.4597G>C	X.37:g.9914723G>C	ENSP00000370299:p.Glu1533Gln		B9EIQ7	Missense_Mutation	SNP	pfam_ASD2,pfam_ASD1,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.E1533Q	ENST00000380913.3	37	c.4597	CCDS14135.1	X	.	.	.	.	.	.	.	.	.	.	G	18.56	3.649829	0.67358	.	.	ENSG00000146950	ENST00000380913;ENST00000418909;ENST00000452575;ENST00000540923	T;T;T	0.36340	1.26;1.26;1.26	4.58	4.58	0.56647	Apx/shroom, ASD2 (2);	0.062767	0.64402	D	0.000007	T	0.55657	0.1934	L	0.54965	1.715	0.48632	D	0.999687	B;D	0.89917	0.395;1.0	B;D	0.75484	0.209;0.986	T	0.57100	-0.7869	10	0.48119	T	0.1	-40.9158	17.0822	0.86602	0.0:0.0:1.0:0.0	.	367;1533	Q68DU3;Q13796	.;SHRM2_HUMAN	Q	1533;368;368;368	ENSP00000370299:E1533Q;ENSP00000415229:E368Q;ENSP00000406724:E368Q	ENSP00000370299:E1533Q	E	+	1	0	SHROOM2	9874723	1.000000	0.71417	0.919000	0.36401	0.840000	0.47671	6.800000	0.75165	2.042000	0.60477	0.594000	0.82650	GAG	SHROOM2	-	pfam_ASD2	ENSG00000146950		0.552	SHROOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHROOM2	HGNC	protein_coding	OTTHUMT00000055721.1	-	0.00	11	0	G	NM_001649		9914723	+1	tier1	-	no_errors	ENST00000380913	ensembl	human	known	74_37	missense	80.00	4	16	SNP	0.996	C
SI	6476	genome.wustl.edu	37	3	164700087	164700087	+	Silent	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr3:164700087G>A	ENST00000264382.3	-	47	5421	c.5359C>T	c.(5359-5361)Cta>Tta	p.L1787L		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	1787	Sucrase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)			NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	TTATACGTTAGAGTAACTGCA	0.343										HNSCC(35;0.089)																																							0													129.0	123.0	125.0					3																	164700087		2203	4299	6502	SO:0001819	synonymous_variant	0			X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.5359C>T	3.37:g.164700087G>A			A2RUC3|Q1JQ80|Q1RMC2	Silent	SNP	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Gal_mutarotase_SF_dom,smart_P_trefoil	p.L1787	ENST00000264382.3	37	c.5359	CCDS3196.1	3																																																																																			SI	-	NULL	ENSG00000090402		0.343	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SI	HGNC	protein_coding	OTTHUMT00000350116.1	-	0.00	68	0	G	NM_001041		164700087	-1	tier1	-	no_errors	ENST00000264382	ensembl	human	known	74_37	silent	34.69	64	34	SNP	0.000	A
SIM1	6492	genome.wustl.edu	37	6	100838633	100838633	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr6:100838633C>G	ENST00000369208.3	-	12	2687	c.1905G>C	c.(1903-1905)caG>caC	p.Q635H	SIM1_ENST00000262901.4_Missense_Mutation_p.Q635H			P81133	SIM1_HUMAN	single-minded family bHLH transcription factor 1	635	Single-minded C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00632}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(4)|endometrium(5)|kidney(1)|large_intestine(15)|lung(34)|ovary(4)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(5)	79		all_cancers(76;9.88e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0248)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0774)		TTCCCTCTCTCTGCTGGATAT	0.483																																																	0													165.0	163.0	164.0					6																	100838633		2203	4300	6503	SO:0001583	missense	0			U70212	CCDS5045.1	6q16.3	2013-10-17	2013-10-17		ENSG00000112246	ENSG00000112246		"""Basic helix-loop-helix proteins"""	10882	protein-coding gene	gene with protein product		603128	"""single-minded (Drosophila) homolog 1"", ""single-minded homolog 1 (Drosophila)"""			9199934, 11448938	Standard	NM_005068		Approved	bHLHe14	uc003pqj.4	P81133	OTTHUMG00000015275	ENST00000369208.3:c.1905G>C	6.37:g.100838633C>G	ENSP00000358210:p.Gln635His		Q5TDP7	Missense_Mutation	SNP	pfam_SIM_C,pfam_PAS_fold_3,pfam_PAS_fold,pfam_bHLH_dom,superfamily_PAS,superfamily_bHLH_dom,smart_bHLH_dom,smart_PAS,smart_PAC,pfscan_PAS,pfscan_bHLH_dom	p.Q635H	ENST00000369208.3	37	c.1905	CCDS5045.1	6	.	.	.	.	.	.	.	.	.	.	C	12.76	2.034526	0.35893	.	.	ENSG00000112246	ENST00000369208;ENST00000262901	T;T	0.03831	3.79;3.79	5.82	4.78	0.61160	Single-minded, C-terminal (2);	0.297199	0.39475	N	0.001345	T	0.01029	0.0034	N	0.04508	-0.205	0.41529	D	0.988446	B	0.06786	0.001	B	0.08055	0.003	T	0.52343	-0.8588	10	0.33141	T	0.24	.	9.5747	0.39450	0.0:0.7787:0.0:0.2213	.	635	P81133	SIM1_HUMAN	H	635	ENSP00000358210:Q635H;ENSP00000262901:Q635H	ENSP00000262901:Q635H	Q	-	3	2	SIM1	100945354	0.990000	0.36364	1.000000	0.80357	0.982000	0.71751	0.248000	0.18198	2.759000	0.94783	0.557000	0.71058	CAG	SIM1	-	pfam_SIM_C	ENSG00000112246		0.483	SIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIM1	HGNC	protein_coding	OTTHUMT00000041628.3	-	0.00	22	0	C	NM_005068		100838633	-1	tier1	-	no_errors	ENST00000262901	ensembl	human	known	74_37	missense	16.00	20	4	SNP	0.999	G
SIX4	51804	genome.wustl.edu	37	14	61190785	61190785	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr14:61190785G>C	ENST00000216513.4	-	1	67	c.8C>G	c.(7-9)tCt>tGt	p.S3C		NM_017420.4	NP_059116.3	Q9UIU6	SIX4_HUMAN	SIX homeobox 4	3					anatomical structure morphogenesis (GO:0009653)|embryonic cranial skeleton morphogenesis (GO:0048701)|generation of neurons (GO:0048699)|inner ear morphogenesis (GO:0042472)|metanephric mesenchyme development (GO:0072075)|myoblast migration (GO:0051451)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of ureteric bud formation (GO:0072107)|regulation of branch elongation involved in ureteric bud branching (GO:0072095)|regulation of protein localization (GO:0032880)|regulation of synaptic growth at neuromuscular junction (GO:0008582)|skeletal muscle tissue development (GO:0007519)|thymus development (GO:0048538)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|endometrium(1)|large_intestine(11)|liver(1)|lung(7)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28				OV - Ovarian serous cystadenocarcinoma(108;0.0275)		GGGGGAGGAAGAGGACATTTT	0.562																																																	0													69.0	76.0	74.0					14																	61190785		2172	4278	6450	SO:0001583	missense	0			AB024687	CCDS9749.2	14q23.1	2012-10-02	2007-07-13		ENSG00000100625	ENSG00000100625		"""Homeoboxes / SINE class"""	10890	protein-coding gene	gene with protein product		606342	"""sine oculis homeobox (Drosophila) homolog 4"", ""sine oculis homeobox homolog 4 (Drosophila)"""			10512683, 10640827	Standard	NM_017420		Approved	AREC3	uc001xfc.3	Q9UIU6	OTTHUMG00000028996	ENST00000216513.4:c.8C>G	14.37:g.61190785G>C	ENSP00000216513:p.Ser3Cys		Q4QQH5|Q4V764	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.S3C	ENST00000216513.4	37	c.8	CCDS9749.2	14	.	.	.	.	.	.	.	.	.	.	g	14.87	2.663410	0.47572	.	.	ENSG00000100625	ENST00000216513	D	0.91686	-2.89	3.52	2.61	0.31194	.	.	.	.	.	D	0.85500	0.5711	N	0.14661	0.345	0.80722	D	1	D	0.64830	0.994	P	0.48189	0.57	D	0.83595	0.0125	9	0.66056	D	0.02	.	7.2631	0.26214	0.092:0.0:0.7383:0.1698	.	3	Q9UIU6	SIX4_HUMAN	C	3	ENSP00000216513:S3C	ENSP00000216513:S3C	S	-	2	0	SIX4	60260538	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.770000	0.85390	0.805000	0.34159	0.290000	0.19541	TCT	SIX4	-	NULL	ENSG00000100625		0.562	SIX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIX4	HGNC	protein_coding	OTTHUMT00000072397.2		0.00	9	0	G			61190785	-1			no_errors	ENST00000216513	ensembl	human	known	74_37	missense	12.50	21	3	SNP	1.000	C
SLC11A2	4891	genome.wustl.edu	37	12	51393017	51393017	+	Silent	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr12:51393017C>T	ENST00000262051.7	-	8	702	c.615G>A	c.(613-615)cgG>cgA	p.R205R	SLC11A2_ENST00000545993.2_Silent_p.R201R|SLC11A2_ENST00000547198.1_Silent_p.R205R|SLC11A2_ENST00000546743.1_Silent_p.R126R|SLC11A2_ENST00000541174.2_Silent_p.R205R|SLC11A2_ENST00000262052.5_Silent_p.R205R|SLC11A2_ENST00000394904.3_Silent_p.R234R|SLC11A2_ENST00000547688.1_Silent_p.R234R	NM_001174126.1|NM_001174127.1	NP_001167597.1|NP_001167598.1	P49281	NRAM2_HUMAN	solute carrier family 11 (proton-coupled divalent metal ion transporter), member 2	205					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cadmium ion transmembrane transport (GO:0070574)|cation transmembrane transport (GO:0098655)|cellular iron ion homeostasis (GO:0006879)|cellular response to hypoxia (GO:0071456)|cellular response to iron ion (GO:0071281)|cellular response to oxidative stress (GO:0034599)|cellular response to tumor necrosis factor (GO:0071356)|cobalt ion transport (GO:0006824)|copper ion transport (GO:0006825)|dendrite morphogenesis (GO:0048813)|detection of oxygen (GO:0003032)|erythrocyte development (GO:0048821)|ferrous iron import (GO:0070627)|ferrous iron transport (GO:0015684)|heme biosynthetic process (GO:0006783)|lead ion transport (GO:0015692)|learning or memory (GO:0007611)|manganese ion transmembrane transport (GO:0071421)|manganese ion transport (GO:0006828)|multicellular organismal iron ion homeostasis (GO:0060586)|nickel cation transmembrane transport (GO:0035444)|nickel cation transport (GO:0015675)|response to cadmium ion (GO:0046686)|response to hypoxia (GO:0001666)|response to iron ion (GO:0010039)|response to lead ion (GO:0010288)|response to manganese ion (GO:0010042)|transmembrane transport (GO:0055085)|vanadium ion transport (GO:0015676)|zinc ion transmembrane transport (GO:0071577)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|basal part of cell (GO:0045178)|brush border (GO:0005903)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|nucleus (GO:0005634)|paraferritin complex (GO:0070826)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)|vacuole (GO:0005773)	cadmium ion binding (GO:0046870)|cadmium ion transmembrane transporter activity (GO:0015086)|cobalt ion binding (GO:0050897)|cobalt ion transmembrane transporter activity (GO:0015087)|copper ion binding (GO:0005507)|copper ion transmembrane transporter activity (GO:0005375)|ferrous iron transmembrane transporter activity (GO:0015093)|hydrogen ion transmembrane transporter activity (GO:0015078)|inorganic cation transmembrane transporter activity (GO:0022890)|iron ion binding (GO:0005506)|lead ion transmembrane transporter activity (GO:0015094)|manganese ion binding (GO:0030145)|manganese ion transmembrane transporter activity (GO:0005384)|nickel cation binding (GO:0016151)|nickel cation transmembrane transporter activity (GO:0015099)|solute:proton symporter activity (GO:0015295)|vanadium ion transmembrane transporter activity (GO:0015100)|zinc ion binding (GO:0008270)|zinc ion transmembrane transporter activity (GO:0005385)			breast(2)|cervix(1)|endometrium(3)|kidney(16)|large_intestine(4)|lung(9)|upper_aerodigestive_tract(1)	36						CTTCTAGCTTCCGCAAGCCTA	0.453																																																	0													80.0	78.0	79.0					12																	51393017		2203	4300	6503	SO:0001819	synonymous_variant	0			AB015355	CCDS8805.1, CCDS53791.1, CCDS53792.1, CCDS53793.1	12q13	2013-07-18	2013-07-18		ENSG00000110911	ENSG00000110911		"""Solute carriers"""	10908	protein-coding gene	gene with protein product		600523		NRAMP2		7613023	Standard	NM_000617		Approved	DCT1, DMT1	uc001rxk.2	P49281	OTTHUMG00000169493	ENST00000262051.7:c.615G>A	12.37:g.51393017C>T			B3KT08|B4DK84|F5H741|O43288|O60932|O94801|Q498Z5|Q8IUD7|Q96J35	Silent	SNP	pfam_NRAMP-like,prints_NRAMP-like,tigrfam_NRAMP-like	p.R234	ENST00000262051.7	37	c.702	CCDS53792.1	12																																																																																			SLC11A2	-	pfam_NRAMP-like,prints_NRAMP-like,tigrfam_NRAMP-like	ENSG00000110911		0.453	SLC11A2-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	SLC11A2	HGNC	protein_coding	OTTHUMT00000404383.1	-	0.00	63	0	C			51393017	-1	tier1	-	no_errors	ENST00000394904	ensembl	human	known	74_37	silent	7.53	86	7	SNP	1.000	T
SLC12A7	10723	genome.wustl.edu	37	5	1085364	1085364	+	Silent	SNP	G	G	A	rs140320673	byFrequency	TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr5:1085364G>A	ENST00000264930.5	-	7	943	c.900C>T	c.(898-900)ttC>ttT	p.F300F		NM_006598.2	NP_006589.2	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 7	300					cell volume homeostasis (GO:0006884)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion transport (GO:0006813)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	32	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)	CCGGGGGGTCGAAGGCAGACT	0.652																																																	0								G		2,4392	6.2+/-15.9	0,2,2195	60.0	49.0	53.0		900	-3.2	0.9	5	dbSNP_134	53	0,8596		0,0,4298	no	coding-synonymous	SLC12A7	NM_006598.2		0,2,6493	AA,AG,GG		0.0,0.0455,0.0154		300/1084	1085364	2,12988	2197	4298	6495	SO:0001819	synonymous_variant	0			AF105365	CCDS34129.1	5p15	2013-07-18	2013-07-18		ENSG00000113504	ENSG00000113504		"""Solute carriers"""	10915	protein-coding gene	gene with protein product		604879				10347194	Standard	NM_006598		Approved	KCC4, DKFZP434F076	uc003jbu.3	Q9Y666	OTTHUMG00000161931	ENST00000264930.5:c.900C>T	5.37:g.1085364G>A			A6NDS8|Q4G0F3|Q96I81|Q9H7I3|Q9H7I7|Q9UFW2	Silent	SNP	pfam_AA-permease/SLC12A_dom,prints_KCL_cotranspt,tigrfam_Na/K/Cl_cotransptS	p.F300	ENST00000264930.5	37	c.900	CCDS34129.1	5																																																																																			SLC12A7	-	prints_KCL_cotranspt,tigrfam_Na/K/Cl_cotransptS	ENSG00000113504		0.652	SLC12A7-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	SLC12A7	HGNC	protein_coding	OTTHUMT00000366446.2	-	0.00	45	0	G	NM_006598		1085364	-1	tier1	rs140320673	no_errors	ENST00000264930	ensembl	human	known	74_37	silent	6.35	116	8	SNP	0.936	A
SLC13A3	64849	genome.wustl.edu	37	20	45242144	45242144	+	Missense_Mutation	SNP	C	C	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr20:45242144C>A	ENST00000279027.4	-	2	350	c.332G>T	c.(331-333)cGa>cTa	p.R111L	SLC13A3_ENST00000472148.1_Missense_Mutation_p.R64L|SLC13A3_ENST00000372121.1_Missense_Mutation_p.R111L|SLC13A3_ENST00000495082.1_Missense_Mutation_p.R64L|SLC13A3_ENST00000435032.1_5'UTR|SLC13A3_ENST00000417157.2_Missense_Mutation_p.R64L|SLC13A3_ENST00000290317.5_Missense_Mutation_p.R64L|SLC13A3_ENST00000413164.2_Missense_Mutation_p.R111L|SLC13A3_ENST00000339636.3_Missense_Mutation_p.R111L|SLC13A3_ENST00000396360.1_Missense_Mutation_p.R64L	NM_001193342.1|NM_022829.5	NP_001180271.1|NP_073740.2	Q8WWT9	S13A3_HUMAN	solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3	111					transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	high-affinity sodium:dicarboxylate symporter activity (GO:0015362)			breast(2)|endometrium(2)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31		Myeloproliferative disorder(115;0.0122)			Succinic acid(DB00139)	GAGGGCGATTCGCCGGTGCAG	0.582																																																	0													69.0	61.0	64.0					20																	45242144		2203	4300	6503	SO:0001583	missense	0			AF154121	CCDS13400.1, CCDS42886.1, CCDS54469.1, CCDS54470.1	20q13.12	2013-05-22			ENSG00000158296	ENSG00000158296		"""Solute carriers"""	14430	protein-coding gene	gene with protein product		606411				10794676, 10992006	Standard	NM_001011554		Approved	NADC3, SDCT2	uc002xsf.2	Q8WWT9	OTTHUMG00000033042	ENST00000279027.4:c.332G>T	20.37:g.45242144C>A	ENSP00000279027:p.Arg111Leu		B4DIR8|E1P5U4|F6WI18|Q5JYC9|Q5JYD0|Q5JYD1|Q5TCQ2|Q8IVB1|Q8N8K4|Q96MM5|Q9BR25|Q9H1G1|Q9H3W4|Q9NQN5|Q9NS04	Missense_Mutation	SNP	pfam_Na/sul_symport,pfam_Cit_transptr-like_dom	p.R111L	ENST00000279027.4	37	c.332	CCDS13400.1	20	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808268	0.90707	.	.	ENSG00000158296	ENST00000290317;ENST00000396360;ENST00000279027;ENST00000472148;ENST00000413164;ENST00000495082;ENST00000468915;ENST00000420568;ENST00000372121;ENST00000417157;ENST00000339636	T;T;T;T;T;T;T;T;T;T;T	0.14391	2.51;2.51;2.51;2.51;2.51;2.51;2.51;2.51;2.51;2.51;2.51	6.17	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.43010	0.1228	M	0.85373	2.75	0.58432	D	0.999999	D;D;D;D;D	0.89917	1.0;0.996;0.996;1.0;0.999	D;D;D;D;D	0.97110	1.0;0.97;0.977;0.999;0.99	T	0.50642	-0.8804	10	0.87932	D	0	-13.2882	15.4435	0.75208	0.0:0.9342:0.0:0.0658	.	111;64;64;64;111	B4DIR8;Q8WWT9-3;F6WI18;C9J4A3;Q8WWT9	.;.;.;.;S13A3_HUMAN	L	64;64;111;64;111;64;64;74;111;64;111	ENSP00000290317:R64L;ENSP00000379648:R64L;ENSP00000279027:R111L;ENSP00000420177:R64L;ENSP00000415852:R111L;ENSP00000419621:R64L;ENSP00000417784:R64L;ENSP00000395095:R74L;ENSP00000361193:R111L;ENSP00000397955:R64L;ENSP00000344912:R111L	ENSP00000279027:R111L	R	-	2	0	SLC13A3	44675551	0.941000	0.31946	0.744000	0.31058	0.831000	0.47069	7.776000	0.85560	1.633000	0.50488	0.655000	0.94253	CGA	SLC13A3	-	pfam_Na/sul_symport,pfam_Cit_transptr-like_dom	ENSG00000158296		0.582	SLC13A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC13A3	HGNC	protein_coding	OTTHUMT00000080329.2		0.00	16	0	C			45242144	-1			no_errors	ENST00000279027	ensembl	human	known	74_37	missense	5.26	36	2	SNP	0.702	A
COL18A1	80781	genome.wustl.edu	37	21	46932395	46932395	+	3'UTR	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr21:46932395C>G	ENST00000359759.4	+	0	5369				SLC19A1_ENST00000468508.1_5'UTR|COL18A1_ENST00000355480.5_3'UTR|COL18A1_ENST00000400337.2_3'UTR|SLC19A1_ENST00000567670.1_Intron			P39060	COIA1_HUMAN	collagen, type XVIII, alpha 1						angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endothelial cell morphogenesis (GO:0001886)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|response to drug (GO:0042493)|response to hydrostatic pressure (GO:0051599)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		CCGGCCAGCCCCTGGCCCCAG	0.567																																																	0																																										SO:0001624	3_prime_UTR_variant	0				CCDS42971.1, CCDS42972.1	21q22.3	2013-01-16			ENSG00000182871	ENSG00000182871		"""Collagens"""	2195	protein-coding gene	gene with protein product	"""endostatin"""	120328	"""Knobloch syndrome, type 1"""	KNO		8188291, 8776601, 10942434, 17546652	Standard	NM_130445		Approved	KS, KNO1	uc002zhi.3	P39060	OTTHUMG00000090407	ENST00000359759.4:c.*83C>G	21.37:g.46932395C>G			A8MVI4|Q58EX6|Q6RZ39|Q6RZ40|Q6RZ41|Q8N4S4|Q8WXI5|Q96T70|Q9UK38|Q9Y6Q7|Q9Y6Q8	RNA	SNP	-	NULL	ENST00000359759.4	37	NULL		21																																																																																			SLC19A1	-	-	ENSG00000173638		0.567	COL18A1-201	KNOWN	basic|appris_principal	protein_coding	SLC19A1	HGNC	protein_coding	OTTHUMT00000206827.1	-	0.00	88	0	C			46932395	-1	tier1	-	no_errors	ENST00000468508	ensembl	human	known	74_37	rna	7.46	61	5	SNP	0.013	G
SLC25A34	284723	genome.wustl.edu	37	1	16064389	16064389	+	Intron	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:16064389C>G	ENST00000294454.5	+	2	459				RP11-288I21.1_ENST00000453804.1_RNA|RP11-169K16.4_ENST00000418525.1_RNA|SLC25A34_ENST00000489568.1_3'UTR	NM_207348.1	NP_997231.1	Q6PIV7	S2534_HUMAN	solute carrier family 25, member 34						transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				NS(1)|breast(1)|endometrium(3)|large_intestine(1)|lung(2)|skin(1)	9		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00566)|all_lung(284;0.00831)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.56e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|KIRC - Kidney renal clear cell carcinoma(229;0.00244)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CTCCCAGGCTCCATCCCCACA	0.627																																																	0													65.0	64.0	65.0					1																	16064389		2203	4300	6503	SO:0001627	intron_variant	0			BC027998	CCDS162.1	1p36.13	2013-05-22			ENSG00000162461	ENSG00000162461		"""Solute carriers"""	27653	protein-coding gene	gene with protein product		610817					Standard	NM_207348		Approved	DKFZp781A10161	uc001axb.1	Q6PIV7	OTTHUMG00000003063	ENST00000294454.5:c.379-35C>G	1.37:g.16064389C>G			Q68DV0	RNA	SNP	-	NULL	ENST00000294454.5	37	NULL	CCDS162.1	1																																																																																			SLC25A34	-	-	ENSG00000162461		0.627	SLC25A34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A34	HGNC	protein_coding	OTTHUMT00000008467.1	-	0.00	17	0	C	NM_207348		16064389	+1	tier1	-	no_errors	ENST00000489568	ensembl	human	known	74_37	rna	33.33	8	4	SNP	0.000	G
SLC25A39	51629	genome.wustl.edu	37	17	42397473	42397473	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr17:42397473G>C	ENST00000377095.5	-	12	1095	c.976C>G	c.(976-978)Cgg>Ggg	p.R326G	SLC25A39_ENST00000586016.1_Missense_Mutation_p.R194G|SLC25A39_ENST00000590194.1_Missense_Mutation_p.R318G|SLC25A39_ENST00000537904.2_Missense_Mutation_p.R303G|SLC25A39_ENST00000225308.8_Missense_Mutation_p.R318G	NM_001143780.1	NP_001137252.1	Q9BZJ4	S2539_HUMAN	solute carrier family 25, member 39	326					heme biosynthetic process (GO:0006783)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				endometrium(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	7		Prostate(33;0.0233)		BRCA - Breast invasive adenocarcinoma(366;0.189)		TTGATGATCCGAGGAAGGAAG	0.617																																																	0													77.0	78.0	78.0					17																	42397473		2203	4300	6503	SO:0001583	missense	0			BC096819	CCDS11482.1, CCDS45700.1	17q12	2013-05-22			ENSG00000013306	ENSG00000013306		"""Solute carriers"""	24279	protein-coding gene	gene with protein product		610820				16949250	Standard	NM_001143780		Approved	FLJ22407, CGI-69	uc002ign.2	Q9BZJ4	OTTHUMG00000132628	ENST00000377095.5:c.976C>G	17.37:g.42397473G>C	ENSP00000366299:p.Arg326Gly		A8JZZ2|D3DX51|D3DX54|Q4V9M1|Q9P182|Q9UF66|Q9Y379	Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	p.R326G	ENST00000377095.5	37	c.976	CCDS45700.1	17	.	.	.	.	.	.	.	.	.	.	G	13.18	2.160639	0.38119	.	.	ENSG00000013306	ENST00000225308;ENST00000377095;ENST00000537904	T;T;T	0.80824	-1.42;-1.42;-1.42	5.25	1.73	0.24493	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	D	0.89949	0.6863	M	0.87617	2.895	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.999	D	0.91274	0.5046	10	0.87932	D	0	-9.8903	14.6678	0.68921	0.0:0.0:0.7198:0.2802	.	303;326;318	B4DFG5;Q9BZJ4;Q9BZJ4-2	.;S2539_HUMAN;.	G	318;326;303	ENSP00000225308:R318G;ENSP00000366299:R326G;ENSP00000444540:R303G	ENSP00000225308:R318G	R	-	1	2	SLC25A39	39752999	0.998000	0.40836	0.697000	0.30258	0.152000	0.21847	2.828000	0.48120	0.484000	0.27630	-0.457000	0.05445	CGG	SLC25A39	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	ENSG00000013306		0.617	SLC25A39-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC25A39	HGNC	protein_coding	OTTHUMT00000457745.1	-	0.00	84	0	G	NM_016016		42397473	-1	tier1	-	no_errors	ENST00000377095	ensembl	human	known	74_37	missense	33.90	39	20	SNP	0.784	C
SLC25A45	283130	genome.wustl.edu	37	11	65144518	65144518	+	Silent	SNP	G	G	A	rs370182084		TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr11:65144518G>A	ENST00000527174.1	-	5	424	c.369C>T	c.(367-369)atC>atT	p.I123I	RP11-867O8.5_ENST00000533886.1_RNA|SLC25A45_ENST00000534028.1_Silent_p.I99I|SLC25A45_ENST00000360662.3_Silent_p.I99I|SLC25A45_ENST00000294187.6_Silent_p.I81I|SLC25A45_ENST00000526432.1_Silent_p.I61I|SLC25A45_ENST00000417511.2_Silent_p.I81I|SLC25A45_ENST00000398802.1_Silent_p.I123I|SLC25A45_ENST00000377152.2_Silent_p.I19I			Q8N413	S2545_HUMAN	solute carrier family 25, member 45	123					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	14						GCCGGACTTTGATGAGGTCAA	0.612																																																	0								G	,	0,3646		0,0,1823	28.0	31.0	30.0		243,369	5.2	1.0	11		30	2,8158		0,2,4078	no	coding-synonymous,coding-synonymous	SLC25A45	NM_001077241.1,NM_182556.2	,	0,2,5901	AA,AG,GG		0.0245,0.0,0.0169	,	81/247,123/289	65144518	2,11804	1823	4080	5903	SO:0001819	synonymous_variant	0			BC041100	CCDS41670.1, CCDS41671.1, CCDS60850.1	11q13.1	2013-05-22			ENSG00000162241	ENSG00000162241		"""Solute carriers"""	27442	protein-coding gene	gene with protein product		610825				16949250	Standard	XM_006718507		Approved		uc001odr.1	Q8N413	OTTHUMG00000166255	ENST00000527174.1:c.369C>T	11.37:g.65144518G>A			Q6PL49|Q8IW29	Silent	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier	p.I123	ENST00000527174.1	37	c.369	CCDS41670.1	11																																																																																			SLC25A45	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier	ENSG00000162241		0.612	SLC25A45-005	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A45	HGNC	protein_coding	OTTHUMT00000388744.3	-	0.00	103	0	G	NM_182556		65144518	-1	tier1	-	no_errors	ENST00000398802	ensembl	human	known	74_37	silent	25.93	80	28	SNP	1.000	A
SLC35G5	83650	genome.wustl.edu	37	8	11189620	11189620	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr8:11189620G>T	ENST00000382435.4	+	1	1224	c.1005G>T	c.(1003-1005)aaG>aaT	p.K335N		NM_001282300.1|NM_054028.1	NP_001269229.1|NP_473369.1	Q96KT7	S35G5_HUMAN	solute carrier family 35, member G5	335						integral component of membrane (GO:0016021)											GGACAGGGAAGGTGGAGGAGT	0.483																																																	0													52.0	55.0	54.0					8																	11189620		2203	4300	6503	SO:0001583	missense	0			AJ291677	CCDS5980.1	8p23.1	2013-05-22	2011-08-03	2011-08-03	ENSG00000177710	ENSG00000177710		"""Solute carriers"""	15546	protein-coding gene	gene with protein product		615199	"""acyl-malonyl condensing enzyme 1-like 2"""	AMAC, AMAC1L2			Standard	NM_054028		Approved		uc003wtp.1	Q96KT7	OTTHUMG00000090653	ENST00000382435.4:c.1005G>T	8.37:g.11189620G>T	ENSP00000371872:p.Lys335Asn		A2RRL6	Missense_Mutation	SNP	pfam_DMT	p.K335N	ENST00000382435.4	37	c.1005	CCDS5980.1	8	.	.	.	.	.	.	.	.	.	.	g	5.259	0.233309	0.09969	.	.	ENSG00000177710	ENST00000382435	T	0.27402	1.67	.	.	.	.	0.720518	0.11917	N	0.517063	T	0.17662	0.0424	N	0.22421	0.69	0.22424	N	0.999112	B	0.23735	0.09	B	0.18561	0.022	T	0.20174	-1.0283	8	0.62326	D	0.03	0.0	.	.	.	.	335	Q96KT7	S35G5_HUMAN	N	335	ENSP00000371872:K335N	ENSP00000371872:K335N	K	+	3	2	SLC35G5	11227030	0.477000	0.25909	0.268000	0.24571	0.269000	0.26545	0.550000	0.23345	0.064000	0.16427	0.064000	0.15345	AAG	SLC35G5	-	NULL	ENSG00000177710		0.483	SLC35G5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC35G5	HGNC	protein_coding	OTTHUMT00000207313.2	-	0.00	89	0	G	NM_054028		11189620	+1	tier1	-	no_errors	ENST00000382435	ensembl	human	known	74_37	missense	11.36	78	10	SNP	0.994	T
SLC3A1	6519	genome.wustl.edu	37	2	44547731	44547731	+	Nonsense_Mutation	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr2:44547731C>T	ENST00000260649.6	+	10	2087	c.2011C>T	c.(2011-2013)Cga>Tga	p.R671*	PREPL_ENST00000409411.1_3'UTR|PREPL_ENST00000541738.1_3'UTR|PREPL_ENST00000409936.1_3'UTR|PREPL_ENST00000409957.1_3'UTR|SLC3A1_ENST00000409740.3_Nonsense_Mutation_p.R302*|SLC3A1_ENST00000409380.1_Nonsense_Mutation_p.R393*	NM_000341.3	NP_000332.2	Q07837	SLC31_HUMAN	solute carrier family 3 (amino acid transporter heavy chain), member 1	671					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|basic amino acid transport (GO:0015802)|carbohydrate metabolic process (GO:0005975)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|L-cystine transport (GO:0015811)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)|vacuolar membrane (GO:0005774)	amino acid transmembrane transporter activity (GO:0015171)|basic amino acid transmembrane transporter activity (GO:0015174)|catalytic activity (GO:0003824)|cation binding (GO:0043169)|L-cystine transmembrane transporter activity (GO:0015184)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|prostate(1)|skin(3)	26		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)			L-Cystine(DB00138)	TGTTTCCAATCGAGCATGCTA	0.423																																																	0													89.0	74.0	79.0					2																	44547731		2203	4300	6503	SO:0001587	stop_gained	0				CCDS1819.1	2p16.3	2013-07-19	2013-07-19		ENSG00000138079	ENSG00000138079		"""Solute carriers"""	11025	protein-coding gene	gene with protein product		104614	"""solute carrier family 3 (cystine, dibasic and neutral amino acid transporters, activator of cystine, dibasic and neutral amino acid transport), member 1"""			8486766, 9186880	Standard	NM_000341		Approved	CSNU1, D2H, RBAT, ATR1, NBAT	uc002ruc.4	Q07837	OTTHUMG00000128759	ENST00000260649.6:c.2011C>T	2.37:g.44547731C>T	ENSP00000260649:p.Arg671*		A8K0S1|O00658|Q15295|Q4J6B4|Q4J6B5|Q4J6B6|Q4J6B7|Q4J6B8|Q4J6B9|Q52M92|Q52M94	Nonsense_Mutation	SNP	pfam_Glyco_hydro_13_cat_dom,superfamily_Glycoside_hydrolase_SF,smart_Glyco_hydro_13_sub_cat_dom	p.R671*	ENST00000260649.6	37	c.2011	CCDS1819.1	2	.	.	.	.	.	.	.	.	.	.	C	40	8.262325	0.98732	.	.	ENSG00000138079	ENST00000260649;ENST00000540334;ENST00000409380;ENST00000409740	.	.	.	5.99	5.04	0.67666	.	0.164236	0.52532	D	0.000062	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.08179	T	0.78	-4.4218	11.7671	0.51937	0.3744:0.6256:0.0:0.0	.	.	.	.	X	671;607;393;302	.	ENSP00000260649:R671X	R	+	1	2	SLC3A1	44401235	1.000000	0.71417	0.021000	0.16686	0.845000	0.48019	4.909000	0.63314	2.840000	0.97914	0.655000	0.94253	CGA	SLC3A1	-	NULL	ENSG00000138079		0.423	SLC3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC3A1	HGNC	protein_coding	OTTHUMT00000250676.1	-	0.00	21	0	C	NM_000341		44547731	+1	tier1	-	no_errors	ENST00000260649	ensembl	human	known	74_37	nonsense	31.03	20	9	SNP	0.637	T
SLC44A5	204962	genome.wustl.edu	37	1	75805272	75805272	+	Silent	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:75805272G>A	ENST00000370855.5	-	4	209	c.96C>T	c.(94-96)gcC>gcT	p.A32A	SLC44A5_ENST00000469525.1_5'UTR|SLC44A5_ENST00000535611.1_5'UTR|SLC44A5_ENST00000370859.3_Silent_p.A32A	NM_152697.4	NP_689910.2	Q8NCS7	CTL5_HUMAN	solute carrier family 44, member 5	32					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				kidney(1)|large_intestine(13)|lung(35)|ovary(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	61						CTTACCTGTTGGCAACAGGCC	0.373																																																	0													209.0	232.0	224.0					1																	75805272		2203	4300	6503	SO:0001819	synonymous_variant	0			BC034580	CCDS667.1, CCDS44164.1	1p31.1	2013-05-22			ENSG00000137968	ENSG00000137968		"""Solute carriers"""	28524	protein-coding gene	gene with protein product						15715662	Standard	NM_152697		Approved	MGC34032, CTL5	uc001dgu.3	Q8NCS7	OTTHUMG00000009721	ENST00000370855.5:c.96C>T	1.37:g.75805272G>A			B5MCU3|Q4G0K0|Q8NA44|Q8NB86	Silent	SNP	pfam_Choline_transptr-like	p.A32	ENST00000370855.5	37	c.96	CCDS667.1	1																																																																																			SLC44A5	-	NULL	ENSG00000137968		0.373	SLC44A5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC44A5	HGNC	protein_coding	OTTHUMT00000026921.1	-	0.00	102	0	G	NM_152697		75805272	-1	tier1	-	no_errors	ENST00000370855	ensembl	human	known	74_37	silent	14.29	84	14	SNP	0.001	A
SLC5A3	6526	genome.wustl.edu	37	21	35468289	35468289	+	Missense_Mutation	SNP	C	C	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr21:35468289C>A	ENST00000381151.3	+	2	1304	c.792C>A	c.(790-792)ttC>ttA	p.F264L	AP000320.7_ENST00000362077.4_RNA|MRPS6_ENST00000399312.2_Intron|SLC5A3_ENST00000608209.1_Missense_Mutation_p.F264L			P53794	SC5A3_HUMAN	solute carrier family 5 (sodium/myo-inositol cotransporter), member 3	264					inositol metabolic process (GO:0006020)|peripheral nervous system development (GO:0007422)|regulation of respiratory gaseous exchange (GO:0043576)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	myo-inositol:sodium symporter activity (GO:0005367)			breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	20						GGCCTGGATTCATTCTTGGGC	0.478																																																	0													109.0	103.0	105.0					21																	35468289		2203	4300	6503	SO:0001583	missense	0				CCDS33549.1	21q22.11	2013-05-22	2008-09-02		ENSG00000198743	ENSG00000198743		"""Solute carriers"""	11038	protein-coding gene	gene with protein product		600444	"""solute carrier family 5 (inositol transporter), member 3"""			7789985	Standard	NM_006933		Approved	SMIT, SMIT1	uc002yto.3	P53794	OTTHUMG00000065821	ENST00000381151.3:c.792C>A	21.37:g.35468289C>A	ENSP00000370543:p.Phe264Leu		O43489	Missense_Mutation	SNP	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	p.F264L	ENST00000381151.3	37	c.792	CCDS33549.1	21	.	.	.	.	.	.	.	.	.	.	C	5.603	0.295932	0.10622	.	.	ENSG00000198743	ENST00000381151	D	0.85861	-2.04	5.72	3.93	0.45458	.	0.000000	0.85682	D	0.000000	T	0.82038	0.4950	N	0.20304	0.555	0.42200	D	0.991762	D	0.89917	1.0	D	0.85130	0.997	T	0.77443	-0.2586	10	0.02654	T	1	.	8.9719	0.35912	0.0:0.7704:0.0:0.2296	.	264	P53794	SC5A3_HUMAN	L	264	ENSP00000370543:F264L	ENSP00000370543:F264L	F	+	3	2	SLC5A3	34390159	0.762000	0.28451	0.989000	0.46669	0.998000	0.95712	1.022000	0.30052	0.779000	0.33543	0.609000	0.83330	TTC	SLC5A3	-	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	ENSG00000198743		0.478	SLC5A3-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	SLC5A3	HGNC	protein_coding	OTTHUMT00000141037.1	-	0.00	54	0	C			35468289	+1	tier1	-	no_errors	ENST00000381151	ensembl	human	known	74_37	missense	20.37	43	11	SNP	1.000	A
SLC6A3	6531	genome.wustl.edu	37	5	1422047	1422047	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr5:1422047G>C	ENST00000270349.9	-	5	863	c.736C>G	c.(736-738)Ctg>Gtg	p.L246V	SLC6A3_ENST00000453492.2_Missense_Mutation_p.L246V	NM_001044.4	NP_001035.1	Q01959	SC6A3_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 3	246					adenohypophysis development (GO:0021984)|aging (GO:0007568)|cation transmembrane transport (GO:0098655)|cell death (GO:0008219)|dopamine biosynthetic process (GO:0042416)|dopamine catabolic process (GO:0042420)|dopamine transport (GO:0015872)|lactation (GO:0007595)|locomotory behavior (GO:0007626)|monoamine transport (GO:0015844)|neurotransmitter biosynthetic process (GO:0042136)|positive regulation of multicellular organism growth (GO:0040018)|prepulse inhibition (GO:0060134)|regulation of dopamine metabolic process (GO:0042053)|response to cAMP (GO:0051591)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to iron ion (GO:0010039)|response to nicotine (GO:0035094)|sensory perception of smell (GO:0007608)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	axon (GO:0030424)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine transmembrane transporter activity (GO:0005329)|dopamine:sodium symporter activity (GO:0005330)|drug binding (GO:0008144)|monoamine transmembrane transporter activity (GO:0008504)			breast(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(19)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	38			OV - Ovarian serous cystadenocarcinoma(19;0.00928)|all cancers(22;0.0262)		Amoxapine(DB00543)|Amphetamine(DB00182)|Atomoxetine(DB00289)|Benzatropine(DB00245)|Benzphetamine(DB00865)|Bupropion(DB01156)|Chloroprocaine(DB01161)|Chlorphenamine(DB01114)|Citalopram(DB00215)|Cocaine(DB00907)|Dexmethylphenidate(DB06701)|Dextroamphetamine(DB01576)|Diethylpropion(DB00937)|Diphenylpyraline(DB01146)|Dopamine(DB00988)|Duloxetine(DB00476)|Ephedra(DB01363)|Escitalopram(DB01175)|Fencamfamine(DB01463)|Imipramine(DB00458)|Ioflupane I 123(DB08824)|Lisdexamfetamine(DB01255)|Loxapine(DB00408)|Mazindol(DB00579)|Methamphetamine(DB01577)|Methylphenidate(DB00422)|Mianserin(DB06148)|Mirtazapine(DB00370)|Modafinil(DB00745)|Nefazodone(DB01149)|Pethidine(DB00454)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Procaine(DB00721)|Pseudoephedrine(DB00852)|Sertraline(DB01104)|Sibutramine(DB01105)|Trimipramine(DB00726)|Venlafaxine(DB00285)	ACGATGACCAGCACCAGGCAG	0.647																																																	0													94.0	83.0	86.0					5																	1422047		2203	4300	6503	SO:0001583	missense	0				CCDS3863.1	5p15.3	2013-07-19	2013-07-19		ENSG00000142319	ENSG00000142319		"""Solute carriers"""	11049	protein-coding gene	gene with protein product	"""dopamine transporter"""	126455	"""solute carrier family 6 (neurotransmitter transporter, dopamine), member 3"", ""dopamine transporter 1"""	DAT1		1406597	Standard	NM_001044		Approved	DAT	uc003jck.3	Q01959	OTTHUMG00000131016	ENST00000270349.9:c.736C>G	5.37:g.1422047G>C	ENSP00000270349:p.Leu246Val		A2RUN4|Q14996	Missense_Mutation	SNP	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport,prints_Na/ntran_symport_dopamine	p.L246V	ENST00000270349.9	37	c.736	CCDS3863.1	5	.	.	.	.	.	.	.	.	.	.	G	6.620	0.482872	0.12581	.	.	ENSG00000142319	ENST00000270349;ENST00000453492;ENST00000513308	T;T;T	0.72835	-0.69;-0.69;-0.69	4.4	3.45	0.39498	.	0.240834	0.32624	N	0.005856	T	0.45276	0.1334	N	0.10629	0.01	0.38386	D	0.945269	B	0.10296	0.003	B	0.11329	0.006	T	0.40421	-0.9564	10	0.11485	T	0.65	.	10.1313	0.42680	0.0:0.379:0.621:0.0	.	246	Q01959	SC6A3_HUMAN	V	246;246;172	ENSP00000270349:L246V;ENSP00000399806:L246V;ENSP00000429101:L172V	ENSP00000270349:L246V	L	-	1	2	SLC6A3	1475047	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	3.225000	0.51246	2.145000	0.66743	0.462000	0.41574	CTG	SLC6A3	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport	ENSG00000142319		0.647	SLC6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A3	HGNC	protein_coding	OTTHUMT00000253650.3		0.00	21	0	G	NM_001044		1422047	-1			no_errors	ENST00000270349	ensembl	human	known	74_37	missense	12.07	102	14	SNP	1.000	C
SLC6A3	6531	genome.wustl.edu	37	5	1432726	1432726	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr5:1432726G>T	ENST00000270349.9	-	4	633	c.506C>A	c.(505-507)tCc>tAc	p.S169Y	SLC6A3_ENST00000453492.2_Missense_Mutation_p.S169Y	NM_001044.4	NP_001035.1	Q01959	SC6A3_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 3	169					adenohypophysis development (GO:0021984)|aging (GO:0007568)|cation transmembrane transport (GO:0098655)|cell death (GO:0008219)|dopamine biosynthetic process (GO:0042416)|dopamine catabolic process (GO:0042420)|dopamine transport (GO:0015872)|lactation (GO:0007595)|locomotory behavior (GO:0007626)|monoamine transport (GO:0015844)|neurotransmitter biosynthetic process (GO:0042136)|positive regulation of multicellular organism growth (GO:0040018)|prepulse inhibition (GO:0060134)|regulation of dopamine metabolic process (GO:0042053)|response to cAMP (GO:0051591)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to iron ion (GO:0010039)|response to nicotine (GO:0035094)|sensory perception of smell (GO:0007608)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	axon (GO:0030424)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine transmembrane transporter activity (GO:0005329)|dopamine:sodium symporter activity (GO:0005330)|drug binding (GO:0008144)|monoamine transmembrane transporter activity (GO:0008504)			breast(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(19)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	38			OV - Ovarian serous cystadenocarcinoma(19;0.00928)|all cancers(22;0.0262)		Amoxapine(DB00543)|Amphetamine(DB00182)|Atomoxetine(DB00289)|Benzatropine(DB00245)|Benzphetamine(DB00865)|Bupropion(DB01156)|Chloroprocaine(DB01161)|Chlorphenamine(DB01114)|Citalopram(DB00215)|Cocaine(DB00907)|Dexmethylphenidate(DB06701)|Dextroamphetamine(DB01576)|Diethylpropion(DB00937)|Diphenylpyraline(DB01146)|Dopamine(DB00988)|Duloxetine(DB00476)|Ephedra(DB01363)|Escitalopram(DB01175)|Fencamfamine(DB01463)|Imipramine(DB00458)|Ioflupane I 123(DB08824)|Lisdexamfetamine(DB01255)|Loxapine(DB00408)|Mazindol(DB00579)|Methamphetamine(DB01577)|Methylphenidate(DB00422)|Mianserin(DB06148)|Mirtazapine(DB00370)|Modafinil(DB00745)|Nefazodone(DB01149)|Pethidine(DB00454)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Procaine(DB00721)|Pseudoephedrine(DB00852)|Sertraline(DB01104)|Sibutramine(DB01105)|Trimipramine(DB00726)|Venlafaxine(DB00285)	GGTGAAGGAGGAGAAGAGATA	0.582																																																	0													157.0	139.0	145.0					5																	1432726		2203	4300	6503	SO:0001583	missense	0				CCDS3863.1	5p15.3	2013-07-19	2013-07-19		ENSG00000142319	ENSG00000142319		"""Solute carriers"""	11049	protein-coding gene	gene with protein product	"""dopamine transporter"""	126455	"""solute carrier family 6 (neurotransmitter transporter, dopamine), member 3"", ""dopamine transporter 1"""	DAT1		1406597	Standard	NM_001044		Approved	DAT	uc003jck.3	Q01959	OTTHUMG00000131016	ENST00000270349.9:c.506C>A	5.37:g.1432726G>T	ENSP00000270349:p.Ser169Tyr		A2RUN4|Q14996	Missense_Mutation	SNP	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport,prints_Na/ntran_symport_dopamine	p.S169Y	ENST00000270349.9	37	c.506	CCDS3863.1	5	.	.	.	.	.	.	.	.	.	.	G	18.48	3.632981	0.67015	.	.	ENSG00000142319	ENST00000270349;ENST00000453492;ENST00000513308	T;T;T	0.75589	-0.95;-0.95;-0.95	4.34	4.34	0.51931	.	0.058731	0.64402	D	0.000001	D	0.83248	0.5213	M	0.62088	1.915	0.58432	D	0.999991	D	0.71674	0.998	D	0.73708	0.981	D	0.84923	0.0855	10	0.62326	D	0.03	.	14.4007	0.67044	0.0:0.0:1.0:0.0	.	169	Q01959	SC6A3_HUMAN	Y	169;169;95	ENSP00000270349:S169Y;ENSP00000399806:S169Y;ENSP00000429101:S95Y	ENSP00000270349:S169Y	S	-	2	0	SLC6A3	1485726	1.000000	0.71417	1.000000	0.80357	0.847000	0.48162	7.016000	0.76393	2.237000	0.73441	0.591000	0.81541	TCC	SLC6A3	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport	ENSG00000142319		0.582	SLC6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A3	HGNC	protein_coding	OTTHUMT00000253650.3	-	0.00	39	0	G	NM_001044		1432726	-1	tier1	-	no_errors	ENST00000270349	ensembl	human	known	74_37	missense	8.09	125	11	SNP	1.000	T
SLC6A9	6536	genome.wustl.edu	37	1	44474228	44474228	+	Silent	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:44474228G>A	ENST00000360584.2	-	5	797	c.606C>T	c.(604-606)atC>atT	p.I202I	SLC6A9_ENST00000372306.3_Silent_p.I129I|SLC6A9_ENST00000372310.3_Silent_p.I129I|SLC6A9_ENST00000357730.2_Silent_p.I148I|SLC6A9_ENST00000537678.1_Silent_p.I64I|SLC6A9_ENST00000492434.2_5'UTR|SLC6A9_ENST00000372307.3_Silent_p.I64I|SLC6A9_ENST00000475075.2_Silent_p.I18I	NM_201649.3	NP_964012.2	P48067	SC6A9_HUMAN	solute carrier family 6 (neurotransmitter transporter, glycine), member 9	202					transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycine:sodium symporter activity (GO:0015375)|neurotransmitter:sodium symporter activity (GO:0005328)			endometrium(3)|large_intestine(8)|lung(7)|ovary(1)|skin(1)|urinary_tract(2)	22	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0511)			Glycine(DB00145)	AGTAGAAGGCGATGCAGATGA	0.587																																																	0													110.0	83.0	92.0					1																	44474228		2203	4300	6503	SO:0001819	synonymous_variant	0			S70609	CCDS30695.1, CCDS41316.1, CCDS41317.1	1p33	2013-05-22			ENSG00000196517	ENSG00000196517		"""Solute carriers"""	11056	protein-coding gene	gene with protein product		601019				8183239, 7587377	Standard	NM_006934		Approved	GLYT1	uc001cll.4	P48067	OTTHUMG00000008294	ENST00000360584.2:c.606C>T	1.37:g.44474228G>A			A6NDH1|A6NII2|A6NNZ8|Q5TAB8|Q5TAB9|Q5TAC0	Silent	SNP	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport,prints_Na/ntran_symport_glycine_GLY1	p.I202	ENST00000360584.2	37	c.606	CCDS41317.1	1																																																																																			SLC6A9	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport	ENSG00000196517		0.587	SLC6A9-001	KNOWN	basic|CCDS	protein_coding	SLC6A9	HGNC	protein_coding	OTTHUMT00000022825.2	-	0.00	30	0	G	NM_201649		44474228	-1	tier1	-	no_errors	ENST00000360584	ensembl	human	known	74_37	silent	27.78	26	10	SNP	0.993	A
SLC7A9	11136	genome.wustl.edu	37	19	33359402	33359402	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr19:33359402C>G	ENST00000023064.4	-	2	230	c.39G>C	c.(37-39)gaG>gaC	p.E13D	SLC7A9_ENST00000587772.1_Missense_Mutation_p.E13D|SLC7A9_ENST00000590341.1_Missense_Mutation_p.E13D	NM_001126335.1|NM_001243036.1|NM_014270.4	NP_001119807.1|NP_001229965.1|NP_055085.1	P82251	BAT1_HUMAN	solute carrier family 7 (amino acid transporter light chain, bo,+ system), member 9	13					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|L-cystine transport (GO:0015811)|leukocyte migration (GO:0050900)|neutral amino acid transport (GO:0015804)|protein complex assembly (GO:0006461)|transmembrane transport (GO:0055085)|transport (GO:0006810)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|L-cystine transmembrane transporter activity (GO:0015184)|neutral amino acid transmembrane transporter activity (GO:0015175)|peptide antigen binding (GO:0042605)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	32	Esophageal squamous(110;0.137)				L-Cystine(DB00138)	GGATCGACTTCTCATCCTCTC	0.567																																					GBM(181;1335 2108 9644 44178 46689)												0													193.0	131.0	152.0					19																	33359402		2203	4300	6503	SO:0001583	missense	0			AF141289	CCDS12425.1	19q13.11	2013-07-19	2013-07-19		ENSG00000021488	ENSG00000021488		"""Solute carriers"""	11067	protein-coding gene	gene with protein product		604144		CSNU3		10471498	Standard	NM_014270		Approved		uc021usa.1	P82251	OTTHUMG00000180287	ENST00000023064.4:c.39G>C	19.37:g.33359402C>G	ENSP00000023064:p.Glu13Asp		B2R9A6	Missense_Mutation	SNP	pfam_AA-permease/SLC12A_dom,pirsf_AA/rel_permease1	p.E13D	ENST00000023064.4	37	c.39	CCDS12425.1	19	.	.	.	.	.	.	.	.	.	.	C	2.141	-0.396872	0.04899	.	.	ENSG00000021488	ENST00000023064	D	0.90004	-2.6	5.29	1.75	0.24633	.	3.880830	0.00166	N	0.000012	D	0.83303	0.5225	L	0.38175	1.15	0.24985	N	0.991572	B	0.02656	0.0	B	0.04013	0.001	T	0.65067	-0.6258	10	0.13108	T	0.6	.	7.516	0.27602	0.0:0.5887:0.2589:0.1524	.	13	P82251	BAT1_HUMAN	D	13	ENSP00000023064:E13D	ENSP00000023064:E13D	E	-	3	2	SLC7A9	38051242	0.277000	0.24220	0.141000	0.22245	0.076000	0.17211	0.583000	0.23849	0.724000	0.32296	-0.502000	0.04539	GAG	SLC7A9	-	NULL	ENSG00000021488		0.567	SLC7A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC7A9	HGNC	protein_coding	OTTHUMT00000450585.1	-	0.00	25	0	C			33359402	-1	tier1	-	no_errors	ENST00000023064	ensembl	human	known	74_37	missense	12.20	36	5	SNP	0.796	G
SLCO4A1	28231	genome.wustl.edu	37	20	61300307	61300307	+	Silent	SNP	C	C	T	rs201252224		TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr20:61300307C>T	ENST00000370507.1	+	10	1998	c.1902C>T	c.(1900-1902)ttC>ttT	p.F634F	SLCO4A1_ENST00000470412.1_3'UTR|RP11-93B14.5_ENST00000411824.1_RNA|RP11-93B14.5_ENST00000451648.1_RNA|RP11-93B14.5_ENST00000433126.1_RNA|SLCO4A1_ENST00000217159.1_Silent_p.F634F			Q96BD0	SO4A1_HUMAN	solute carrier organic anion transporter family, member 4A1	634					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			endometrium(6)|kidney(2)|large_intestine(1)|lung(7)|ovary(3)|prostate(2)	21	Breast(26;3.65e-08)		BRCA - Breast invasive adenocarcinoma(19;2.33e-06)		Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Dextrothyroxine(DB00509)|Digoxin(DB00390)|Dinoprostone(DB00917)|Estradiol(DB00783)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	CCATCGCCTTCGGCTGGGTGA	0.657											OREG0026115	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Pancreas(168;741 2006 10379 40139 45334)												0													35.0	37.0	36.0					20																	61300307		2203	4300	6503	SO:0001819	synonymous_variant	0			AB031051	CCDS13501.1	20q13.1	2013-05-22	2003-11-25	2003-11-26	ENSG00000101187	ENSG00000101187		"""Solute carriers"""	10953	protein-coding gene	gene with protein product		612436	"""solute carrier family 21 (organic anion transporter), member 12"""	SLC21A12		10873595	Standard	NM_016354		Approved	OATP-E, OATP4A1	uc002ydb.1	Q96BD0	OTTHUMG00000032923	ENST00000370507.1:c.1902C>T	20.37:g.61300307C>T		1052	Q9H4T7|Q9H4T8|Q9H8P2|Q9NWX8|Q9UI35|Q9UIG7	Silent	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal_dom,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	p.F634	ENST00000370507.1	37	c.1902	CCDS13501.1	20																																																																																			SLCO4A1	-	pfam_OA_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	ENSG00000101187		0.657	SLCO4A1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO4A1	HGNC	protein_coding	OTTHUMT00000080048.2	-	0.00	74	0	C	NM_016354		61300307	+1	tier1	rs201252224	no_errors	ENST00000217159	ensembl	human	known	74_37	silent	10.96	65	8	SNP	0.945	T
SLCO6A1	133482	genome.wustl.edu	37	5	101794130	101794130	+	Silent	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr5:101794130G>A	ENST00000506729.1	-	6	1258	c.1087C>T	c.(1087-1089)Ctg>Ttg	p.L363L	SLCO6A1_ENST00000389019.3_Silent_p.L301L|SLCO6A1_ENST00000514551.1_5'UTR|SLCO6A1_ENST00000379807.3_Silent_p.L363L|SLCO6A1_ENST00000513675.1_Intron|SLCO6A1_ENST00000379810.1_Intron			Q86UG4	SO6A1_HUMAN	solute carrier organic anion transporter family, member 6A1	363						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(17)|lung(22)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	60		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)		CCAAGTTTCAGATCTTTAAGT	0.299																																																	0													136.0	137.0	137.0					5																	101794130		2202	4295	6497	SO:0001819	synonymous_variant	0			AF505657	CCDS34206.1, CCDS75282.1	5q21.2	2013-05-22			ENSG00000205359	ENSG00000205359		"""Solute carriers"""	23613	protein-coding gene	gene with protein product	"""cancer/testis antigen 48"""	613365					Standard	XM_005271874		Approved	OATP6A1, OATPY, MGC26949, CT48	uc003knp.3	Q86UG4	OTTHUMG00000162759	ENST00000506729.1:c.1087C>T	5.37:g.101794130G>A			A6NHC1|Q6ZMY5|Q86UV2|Q8IYU5	Silent	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal_dom,superfamily_MFS_dom_general_subst_transpt,tigrfam_OA_transporter	p.L363	ENST00000506729.1	37	c.1087	CCDS34206.1	5																																																																																			SLCO6A1	-	pfam_OA_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,tigrfam_OA_transporter	ENSG00000205359		0.299	SLCO6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO6A1	HGNC	protein_coding	OTTHUMT00000370335.1	-	0.00	123	0	G	NM_173488		101794130	-1	tier1	-	no_errors	ENST00000379807	ensembl	human	known	74_37	silent	13.04	120	18	SNP	0.000	A
SMAD4	4089	genome.wustl.edu	37	18	48581229	48581229	+	Nonsense_Mutation	SNP	C	C	G	rs377767331		TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr18:48581229C>G	ENST00000342988.3	+	5	1071	c.533C>G	c.(532-534)tCa>tGa	p.S178*	RP11-729L2.2_ENST00000590722.2_3'UTR|SMAD4_ENST00000452201.2_3'UTR|SMAD4_ENST00000398417.2_Nonsense_Mutation_p.S178*|SMAD4_ENST00000588745.1_Nonsense_Mutation_p.S178*	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	178					atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.?(3)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		GAAGGACATTCAATTCAAACC	0.438																																																	39	Whole gene deletion(36)|Unknown(3)	pancreas(26)|large_intestine(3)|stomach(3)|breast(3)|lung(2)|upper_aerodigestive_tract(1)|oesophagus(1)	GRCh37	CM994756	SMAD4	M							196.0	138.0	157.0					18																	48581229		2203	4300	6503	SO:0001587	stop_gained	0			U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.533C>G	18.37:g.48581229C>G	ENSP00000341551:p.Ser178*		A8K405	Nonsense_Mutation	SNP	pfam_SMAD_dom_Dwarfin-type,pfam_MAD_homology1_Dwarfin-type,superfamily_SMAD_FHA_domain,superfamily_MAD_homology_MH1,smart_MAD_homology1_Dwarfin-type,smart_SMAD_dom_Dwarfin-type,pfscan_MAD_homology_MH1,pfscan_SMAD_dom_Dwarfin-type	p.S178*	ENST00000342988.3	37	c.533	CCDS11950.1	18	.	.	.	.	.	.	.	.	.	.	C	41	9.156137	0.99084	.	.	ENSG00000141646	ENST00000342988;ENST00000544926;ENST00000398417	.	.	.	5.86	5.86	0.93980	.	0.282373	0.35378	N	0.003258	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.09590	T	0.72	.	19.3335	0.94306	0.0:1.0:0.0:0.0	.	.	.	.	X	178	.	ENSP00000341551:S178X	S	+	2	0	SMAD4	46835227	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.952000	0.56691	2.937000	0.99478	0.650000	0.86243	TCA	SMAD4	-	NULL	ENSG00000141646		0.438	SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SMAD4	HGNC	protein_coding	OTTHUMT00000255993.3	-	0.00	34	0	C	NM_005359		48581229	+1	tier1	-	no_errors	ENST00000342988	ensembl	human	known	74_37	nonsense	15.38	22	4	SNP	1.000	G
SMARCA2	6595	genome.wustl.edu	37	9	2058298	2058298	+	Missense_Mutation	SNP	T	T	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr9:2058298T>C	ENST00000382203.1	+	8	1564	c.1355T>C	c.(1354-1356)cTg>cCg	p.L452P	SMARCA2_ENST00000349721.2_Missense_Mutation_p.L452P|SMARCA2_ENST00000382194.1_Missense_Mutation_p.L452P|SMARCA2_ENST00000357248.2_Missense_Mutation_p.L452P			P51531	SMCA2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2	452	HSA. {ECO:0000255|PROSITE- ProRule:PRU00549}.				aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|chromatin remodeling (GO:0006338)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		TAGGAATACCTGAACAGTATT	0.423																																																	0													144.0	155.0	151.0					9																	2058298		2203	4300	6503	SO:0001583	missense	0			D26155	CCDS34977.1, CCDS34978.1, CCDS75807.1, CCDS75808.1	9p24.3	2008-11-11	2006-11-09		ENSG00000080503	ENSG00000080503			11098	protein-coding gene	gene with protein product		600014		SNF2L2		8012116	Standard	NM_003070		Approved	BAF190, hSNF2a, hBRM, Sth1p, SNF2LA, BRM, SNF2, SWI2	uc003zhc.3	P51531	OTTHUMG00000019445	ENST00000382203.1:c.1355T>C	9.37:g.2058298T>C	ENSP00000371638:p.Leu452Pro		B1ALG3|B1ALG4|D3DRH4|D3DRH5	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Bromodomain,pfam_BRK_domain,pfam_Helicase/SANT-assoc_DNA-bd,pfam_Helicase_C,pfam_Gln-Leu-Gln_QLQ,superfamily_P-loop_NTPase,superfamily_Bromodomain,superfamily_RNaseH-like_dom,smart_Gln-Leu-Gln_QLQ,smart_HAS_subgr,smart_BRK_domain,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Bromodomain,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Bromodomain,prints_Bromodomain	p.L452P	ENST00000382203.1	37	c.1355	CCDS34977.1	9	.	.	.	.	.	.	.	.	.	.	T	17.72	3.459832	0.63401	.	.	ENSG00000080503	ENST00000349721;ENST00000357248;ENST00000450198;ENST00000382203;ENST00000382194	T;T;T;T;T	0.73152	-0.72;-0.72;-0.72;-0.72;-0.72	5.84	5.84	0.93424	Helicase/SANT-associated, DNA binding (1);HAS subgroup (1);HSA (1);	0.000000	0.64402	D	0.000003	D	0.87148	0.6105	M	0.89904	3.07	0.80722	D	1	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.91635	0.992;0.998;0.999	D	0.89745	0.3936	10	0.87932	D	0	-18.2976	16.2302	0.82332	0.0:0.0:0.0:1.0	.	53;452;452	B4DK35;P51531-2;P51531	.;.;SMCA2_HUMAN	P	452	ENSP00000265773:L452P;ENSP00000349788:L452P;ENSP00000392081:L452P;ENSP00000371638:L452P;ENSP00000371629:L452P	ENSP00000265773:L452P	L	+	2	0	SMARCA2	2048298	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.963000	0.87922	2.228000	0.72767	0.533000	0.62120	CTG	SMARCA2	-	pfam_Helicase/SANT-assoc_DNA-bd,smart_HAS_subgr,pfscan_Helicase/SANT-assoc_DNA-bd	ENSG00000080503		0.423	SMARCA2-003	KNOWN	basic|CCDS	protein_coding	SMARCA2	HGNC	protein_coding	OTTHUMT00000051505.1	-	0.00	55	0	T	NM_003070		2058298	+1	tier1	-	no_errors	ENST00000349721	ensembl	human	known	74_37	missense	45.68	44	37	SNP	1.000	C
SMG8	55181	genome.wustl.edu	37	17	57288495	57288495	+	Silent	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr17:57288495G>A	ENST00000543872.2	+	2	1347	c.1083G>A	c.(1081-1083)gtG>gtA	p.V361V	SMG8_ENST00000578922.1_Silent_p.V361V|SMG8_ENST00000580498.1_Intron|SMG8_ENST00000300917.5_Silent_p.V361V|CTD-2510F5.6_ENST00000577660.1_Intron			Q8ND04	SMG8_HUMAN	SMG8 nonsense mediated mRNA decay factor	361					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of protein kinase activity (GO:0045859)|RNA metabolic process (GO:0016070)	cytosol (GO:0005829)				NS(1)|breast(5)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(1)	33						ATTGTACTGTGAAGGACCCGG	0.537																																																	0													82.0	66.0	72.0					17																	57288495		2203	4300	6503	SO:0001819	synonymous_variant	0			AL834490	CCDS11615.1	17q23.2	2013-07-02	2013-07-02	2011-06-21					25551	protein-coding gene	gene with protein product		613175	"""chromosome 17 open reading frame 71"", ""smg-8 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C17orf71		19417104	Standard	NM_018149		Approved	FLJ10587, FLJ23205	uc002ixi.3	Q8ND04		ENST00000543872.2:c.1083G>A	17.37:g.57288495G>A			Q8N5U5|Q8TDN0|Q9H5P5|Q9NVQ1	Silent	SNP	pfam_Smg8/Smg9	p.V361	ENST00000543872.2	37	c.1083	CCDS11615.1	17																																																																																			SMG8	-	pfam_Smg8/Smg9	ENSG00000167447		0.537	SMG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMG8	HGNC	protein_coding	OTTHUMT00000445960.2	-	0.00	70	0	G	NM_018149		57288495	+1	tier1	-	no_errors	ENST00000300917	ensembl	human	known	74_37	silent	37.68	43	26	SNP	0.991	A
SMIM11	54065	genome.wustl.edu	37	21	35774492	35774492	+	3'UTR	DEL	T	T	-	rs534668511	byFrequency	TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr21:35774492delT	ENST00000399299.1	+	0	450				SMIM11_ENST00000481710.1_3'UTR|AP000322.54_ENST00000410005.1_5'Flank			P58511	SIM11_HUMAN	small integral membrane protein 11							integral component of membrane (GO:0016021)											TGGAGGAGGATTTTTTTTTTT	0.373																																																	0																																										SO:0001624	3_prime_UTR_variant	0			BC015596	CCDS33550.1	21q22.12	2012-12-03	2012-12-03	2012-12-03	ENSG00000205670	ENSG00000205670			1293	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 51"", ""family with sequence similarity 165, member B"""	C21orf51, FAM165B			Standard	NM_058182		Approved		uc002ytu.4	P58511	OTTHUMG00000086193	ENST00000399299.1:c.*98T>-	21.37:g.35774492delT				RNA	DEL	-	NULL	ENST00000399299.1	37	NULL		21																																																																																			SMIM11	-	-	ENSG00000205670		0.373	SMIM11-002	PUTATIVE	basic|exp_conf	protein_coding	SMIM11	HGNC	protein_coding	OTTHUMT00000194076.1		0.00	33	0	T	NM_058182		35774492	+1	tier1		no_errors	ENST00000481710	ensembl	human	known	74_37	rna	16.98	44	9	DEL	0.002	-
SMIM7	79086	genome.wustl.edu	37	19	16770258	16770258	+	Splice_Site	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr19:16770258C>G	ENST00000487416.2	-	3	115	c.69G>C	c.(67-69)ctG>ctC	p.L23L	CTC-429P9.4_ENST00000600705.1_Splice_Site_p.L23L|SMIM7_ENST00000597711.1_Splice_Site_p.L23L|SMIM7_ENST00000397349.2_5'UTR|SMIM7_ENST00000358726.6_Splice_Site_p.L23L|CTC-429P9.4_ENST00000593962.1_5'UTR|TMEM38A_ENST00000187762.2_5'Flank	NM_024104.3	NP_077009.2	Q9BQ49	SMIM7_HUMAN	small integral membrane protein 7	23						integral component of membrane (GO:0016021)											CCTTCTTTTTCCTACAAAGAG	0.532																																																	0													63.0	67.0	65.0					19																	16770258		1934	4145	6079	SO:0001630	splice_region_variant	0			AK025602	CCDS12348.2, CCDS74307.1	19p13.11	2012-10-26	2012-10-26	2012-10-26	ENSG00000214046	ENSG00000214046			28419	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 42"""	C19orf42		12477932	Standard	NM_024104		Approved	MGC2747	uc002ner.3	Q9BQ49	OTTHUMG00000149895	ENST00000487416.2:c.69-1G>C	19.37:g.16770258C>G			A8MX44	Silent	SNP	NULL	p.L23	ENST00000487416.2	37	c.69	CCDS12348.2	19																																																																																			SMIM7	-	NULL	ENSG00000214046		0.532	SMIM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMIM7	HGNC	protein_coding	OTTHUMT00000313801.2		0.00	24	0	C	NM_024104	Silent	16770258	-1			no_errors	ENST00000487803	ensembl	human	known	74_37	silent	25.00	15	5	SNP	1.000	G
SMPD1	6609	genome.wustl.edu	37	11	6411941	6411941	+	Missense_Mutation	SNP	C	C	T	rs550365194|rs550067660|rs71467507|rs78250081|rs558809956|rs3838786	byFrequency	TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr11:6411941C>T	ENST00000342245.4	+	1	281	c.113C>T	c.(112-114)gCg>gTg	p.A38V	SMPD1_ENST00000533196.1_3'UTR|SMPD1_ENST00000356761.2_Missense_Mutation_p.A38V|SMPD1_ENST00000527275.1_Missense_Mutation_p.A38V|SMPD1_ENST00000299397.3_Missense_Mutation_p.A38V	NM_000543.4|NM_001007593.2	NP_000534.3|NP_001007594.2	P17405	ASM_HUMAN	sphingomyelin phosphodiesterase 1, acid lysosomal	38					cell death (GO:0008219)|ceramide biosynthetic process (GO:0046513)|glycosphingolipid metabolic process (GO:0006687)|negative regulation of MAP kinase activity (GO:0043407)|nervous system development (GO:0007399)|positive regulation of apoptotic process (GO:0043065)|positive regulation of protein dephosphorylation (GO:0035307)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin catabolic process (GO:0006685)|sphingomyelin metabolic process (GO:0006684)|termination of signal transduction (GO:0023021)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lamellar body (GO:0042599)|lysosomal lumen (GO:0043202)	hydrolase activity, acting on glycosyl bonds (GO:0016798)|sphingomyelin phosphodiesterase activity (GO:0004767)			breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(3)	23		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;4.9e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)	Amlodipine(DB00381)|Chlorpromazine(DB00477)|Desipramine(DB01151)	ctggtgctggcgctggcgctg	0.711																																																	0													11.0	14.0	13.0					11																	6411941		2185	4258	6443	SO:0001583	missense	0			AB209775	CCDS31409.1, CCDS44531.1, CCDS31409.2	11p15.4-p15.1	2010-04-28	2008-02-04		ENSG00000166311	ENSG00000166311	3.1.4.12		11120	protein-coding gene	gene with protein product	"""acid sphingomyelinase"""	607608				1711683	Standard	NM_000543		Approved	ASM	uc001mcw.3	P17405	OTTHUMG00000165453	ENST00000342245.4:c.113C>T	11.37:g.6411941C>T	ENSP00000340409:p.Ala38Val		A8K8M3|E9PKS3|P17406|Q13811|Q16837|Q16841	Missense_Mutation	SNP	pfam_PEstase_dom,superfamily_Saposin-like,smart_SaposinB,pirsf_Sphingomy_PDE,pfscan_SaposinB	p.A38V	ENST00000342245.4	37	c.113	CCDS44531.1	11	.	.	.	.	.	.	.	.	.	.	C	13.43	2.234305	0.39498	.	.	ENSG00000166311	ENST00000299397;ENST00000356761;ENST00000342245;ENST00000527275	T;T;T;T	0.09723	2.95;2.95;2.95;2.95	4.54	-1.08	0.09936	.	.	.	.	.	T	0.04363	0.0120	N	0.08118	0	0.09310	N	1	B;B	0.15473	0.002;0.013	B;B	0.10450	0.002;0.005	T	0.47275	-0.9130	9	0.12103	T	0.63	.	6.8659	0.24093	0.0:0.5614:0.262:0.1766	.	38;38	E9PKS3;G3XAB5	.;.	V	38	ENSP00000299397:A38V;ENSP00000349203:A38V;ENSP00000340409:A38V;ENSP00000435350:A38V	ENSP00000299397:A38V	A	+	2	0	SMPD1	6368517	0.000000	0.05858	0.130000	0.21974	0.033000	0.12548	-2.110000	0.01334	-0.479000	0.06813	-1.305000	0.01319	GCG	SMPD1	-	pirsf_Sphingomy_PDE	ENSG00000166311		0.711	SMPD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SMPD1	HGNC	protein_coding	OTTHUMT00000384205.1	-	0.00	16	0	C	NM_000543		6411941	+1	tier1	rs78250081	no_errors	ENST00000342245	ensembl	human	known	74_37	missense	23.53	13	4	SNP	0.351	T
SNX30	401548	genome.wustl.edu	37	9	115580089	115580089	+	Silent	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr9:115580089C>G	ENST00000374232.3	+	3	617	c.453C>G	c.(451-453)ctC>ctG	p.L151L		NM_001012994.1	NP_001013012.1	Q5VWJ9	SNX30_HUMAN	sorting nexin family member 30	151	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				apoptotic process (GO:0006915)|intracellular protein transport (GO:0006886)	endosome (GO:0005768)	phosphatidylinositol binding (GO:0035091)			large_intestine(1)|lung(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	8						CCACTCATCTCATTCCCGTAG	0.463																																																	0													117.0	116.0	116.0					9																	115580089		1919	4129	6048	SO:0001819	synonymous_variant	0			AK126644	CCDS43865.1	9q33.1	2014-02-12			ENSG00000148158	ENSG00000148158		"""Sorting nexins"""	23685	protein-coding gene	gene with protein product							Standard	NM_001012994		Approved	ATG24A	uc004bgj.4	Q5VWJ9	OTTHUMG00000020512	ENST00000374232.3:c.453C>G	9.37:g.115580089C>G				Silent	SNP	pfam_Phox,pfam_Vps5_C,pfam_BAR_dom,superfamily_Phox,smart_Phox,pfscan_Phox	p.L151	ENST00000374232.3	37	c.453	CCDS43865.1	9																																																																																			SNX30	-	pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox	ENSG00000148158		0.463	SNX30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX30	HGNC	protein_coding	OTTHUMT00000053700.1	-	0.00	47	0	C			115580089	+1	tier1	-	no_errors	ENST00000374232	ensembl	human	known	74_37	silent	14.89	40	7	SNP	1.000	G
SNX8	29886	genome.wustl.edu	37	7	2317768	2317768	+	Silent	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr7:2317768G>A	ENST00000222990.3	-	2	309	c.267C>T	c.(265-267)ttC>ttT	p.F89F		NM_013321.2	NP_037453.1	Q9Y5X2	SNX8_HUMAN	sorting nexin 8	89	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				early endosome to Golgi transport (GO:0034498)|intracellular protein transport (GO:0006886)	early endosome membrane (GO:0031901)	identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)			breast(2)|endometrium(5)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(2)|skin(3)	26		Ovarian(82;0.11)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0853)|OV - Ovarian serous cystadenocarcinoma(56;3.79e-14)		CATGCTTCAGGAAGAGGCCCT	0.597																																																	0													102.0	88.0	93.0					7																	2317768		2203	4300	6503	SO:0001819	synonymous_variant	0			AF121858	CCDS5331.1	7p22.3	2010-08-05			ENSG00000106266	ENSG00000106266		"""Sorting nexins"""	14972	protein-coding gene	gene with protein product		614905					Standard	NM_013321		Approved	Mvp1	uc003slw.3	Q9Y5X2	OTTHUMG00000151512	ENST00000222990.3:c.267C>T	7.37:g.2317768G>A			A4D207|Q96I67	Silent	SNP	pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox	p.F89	ENST00000222990.3	37	c.267	CCDS5331.1	7																																																																																			SNX8	-	pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox	ENSG00000106266		0.597	SNX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX8	HGNC	protein_coding	OTTHUMT00000322949.2		0.00	28	0	G			2317768	-1			no_errors	ENST00000222990	ensembl	human	known	74_37	silent	8.89	41	4	SNP	1.000	A
SOX11	6664	genome.wustl.edu	37	2	5833136	5833136	+	Missense_Mutation	SNP	A	A	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr2:5833136A>C	ENST00000322002.3	+	1	338	c.283A>C	c.(283-285)Aag>Cag	p.K95Q	AC107057.2_ENST00000458264.1_RNA|AC108025.2_ENST00000420221.1_RNA|AC108025.2_ENST00000453678.1_RNA	NM_003108.3	NP_003099.1	P35716	SOX11_HUMAN	SRY (sex determining region Y)-box 11	95					cardiac ventricle formation (GO:0003211)|closure of optic fissure (GO:0061386)|cornea development in camera-type eye (GO:0061303)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic skeletal system morphogenesis (GO:0048704)|eyelid development in camera-type eye (GO:0061029)|glial cell development (GO:0021782)|glial cell proliferation (GO:0014009)|hard palate development (GO:0060022)|kidney development (GO:0001822)|lens morphogenesis in camera-type eye (GO:0002089)|limb bud formation (GO:0060174)|lung morphogenesis (GO:0060425)|negative regulation of cell death (GO:0060548)|negative regulation of gene expression (GO:0010629)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of lymphocyte proliferation (GO:0050672)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|neural crest cell development (GO:0014032)|neural tube formation (GO:0001841)|neuroepithelial cell differentiation (GO:0060563)|neuron differentiation (GO:0030182)|noradrenergic neuron differentiation (GO:0003357)|oligodendrocyte development (GO:0014003)|outflow tract morphogenesis (GO:0003151)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of hippo signaling (GO:0035332)|positive regulation of hormone secretion (GO:0046887)|positive regulation of lens epithelial cell proliferation (GO:2001111)|positive regulation of neurogenesis (GO:0050769)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of ossification (GO:0045778)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|signal transduction involved in cell cycle checkpoint (GO:0072395)|skeletal muscle cell differentiation (GO:0035914)|skeletal system development (GO:0001501)|soft palate development (GO:0060023)|somite development (GO:0061053)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|translation (GO:0006412)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enhancer sequence-specific DNA binding (GO:0001158)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|translation factor activity, nucleic acid binding (GO:0008135)			central_nervous_system(5)|cervix(1)|endometrium(1)|liver(1)|lung(4)|stomach(1)	13	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			OV - Ovarian serous cystadenocarcinoma(76;0.132)		GGACAGCGAGAAGATCCCGTT	0.597																																																	0													45.0	50.0	49.0					2																	5833136		2203	4300	6503	SO:0001583	missense	0				CCDS1654.1	2p25	2008-05-21			ENSG00000176887	ENSG00000176887		"""SRY (sex determining region Y)-boxes"""	11191	protein-coding gene	gene with protein product	"""SRY-related HMG-box gene 11"""	600898				8666406, 12637543	Standard	NM_003108		Approved		uc002qyj.3	P35716	OTTHUMG00000090333	ENST00000322002.3:c.283A>C	2.37:g.5833136A>C	ENSP00000322568:p.Lys95Gln		Q4ZFV8	Missense_Mutation	SNP	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pirsf_SOX-12/11/4a,pfscan_HMG_box_dom	p.K95Q	ENST00000322002.3	37	c.283	CCDS1654.1	2	.	.	.	.	.	.	.	.	.	.	A	24.5	4.536587	0.85812	.	.	ENSG00000176887	ENST00000322002	D	0.99483	-5.99	2.82	2.82	0.32997	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (4);	0.000000	0.64402	U	0.000001	D	0.99381	0.9782	M	0.83223	2.63	0.80722	D	1	P	0.41102	0.738	P	0.60609	0.877	D	0.98760	1.0724	10	0.87932	D	0	.	11.2381	0.48953	1.0:0.0:0.0:0.0	.	95	P35716	SOX11_HUMAN	Q	95	ENSP00000322568:K95Q	ENSP00000322568:K95Q	K	+	1	0	SOX11	5750587	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.691000	0.91279	1.271000	0.44313	0.391000	0.25812	AAG	SOX11	-	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pirsf_SOX-12/11/4a,pfscan_HMG_box_dom	ENSG00000176887		0.597	SOX11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOX11	HGNC	protein_coding	OTTHUMT00000206698.1	-	0.00	49	0	A	NM_003108		5833136	+1	tier1	-	no_errors	ENST00000322002	ensembl	human	known	74_37	missense	21.21	26	7	SNP	1.000	C
SPEN	23013	genome.wustl.edu	37	1	16263970	16263970	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:16263970C>G	ENST00000375759.3	+	12	10543	c.10339C>G	c.(10339-10341)Ctt>Gtt	p.L3447V		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	3447	Pro-rich.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		TCCAGTCTCTCTTCCCACTCA	0.582																																																	0													87.0	79.0	82.0					1																	16263970		2203	4300	6503	SO:0001583	missense	0				CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.10339C>G	1.37:g.16263970C>G	ENSP00000364912:p.Leu3447Val		Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Missense_Mutation	SNP	pfam_RRM_dom,pfam_SPOC_C,superfamily_SPOC_like_C_dom,smart_RRM_dom,pfscan_SPOC_met,pfscan_RRM_dom	p.L3447V	ENST00000375759.3	37	c.10339	CCDS164.1	1	.	.	.	.	.	.	.	.	.	.	C	8.961	0.970630	0.18659	.	.	ENSG00000065526	ENST00000375759	T	0.09911	2.93	5.23	5.23	0.72850	.	.	.	.	.	T	0.21881	0.0527	L	0.44542	1.39	0.25707	N	0.985523	P	0.50943	0.94	P	0.55545	0.778	T	0.12400	-1.0549	9	0.23302	T	0.38	-18.0397	19.1612	0.93533	0.0:1.0:0.0:0.0	.	3447	Q96T58	MINT_HUMAN	V	3447	ENSP00000364912:L3447V	ENSP00000364912:L3447V	L	+	1	0	SPEN	16136557	0.975000	0.34042	0.889000	0.34880	0.298000	0.27526	3.688000	0.54699	2.579000	0.87056	0.655000	0.94253	CTT	SPEN	-	NULL	ENSG00000065526		0.582	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPEN	HGNC	protein_coding	OTTHUMT00000025993.1	-	0.00	47	0	C	NM_015001		16263970	+1	tier1	-	no_errors	ENST00000375759	ensembl	human	known	74_37	missense	16.98	43	9	SNP	0.993	G
SPOCK3	50859	genome.wustl.edu	37	4	167713337	167713337	+	Silent	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr4:167713337C>T	ENST00000357154.3	-	8	839	c.702G>A	c.(700-702)ctG>ctA	p.L234L	SPOCK3_ENST00000421836.2_Silent_p.L183L|SPOCK3_ENST00000535728.1_Intron|SPOCK3_ENST00000511531.1_Silent_p.L234L|SPOCK3_ENST00000502330.1_Silent_p.L234L|SPOCK3_ENST00000357545.4_Silent_p.L231L|SPOCK3_ENST00000541354.1_Silent_p.L114L|SPOCK3_ENST00000534949.1_Silent_p.L138L|SPOCK3_ENST00000541637.1_Silent_p.L136L|SPOCK3_ENST00000510741.1_Intron|SPOCK3_ENST00000512648.1_Silent_p.L231L|SPOCK3_ENST00000504953.1_Silent_p.L231L|SPOCK3_ENST00000507137.1_5'UTR|SPOCK3_ENST00000512681.1_Silent_p.L136L|SPOCK3_ENST00000511269.1_Silent_p.L231L|SPOCK3_ENST00000506886.1_Silent_p.L234L	NM_016950.2	NP_058646.2	Q9BQ16	TICN3_HUMAN	sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3	234					negative regulation of endopeptidase activity (GO:0010951)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|signal transduction (GO:0007165)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|glycosaminoglycan binding (GO:0005539)|metalloendopeptidase inhibitor activity (GO:0008191)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	38	all_hematologic(180;0.221)	Prostate(90;0.0181)|Renal(120;0.0184)|Melanoma(52;0.0198)		GBM - Glioblastoma multiforme(119;0.02)		TCTCAGGCCTCAGCAATGTTT	0.398																																																	0													108.0	90.0	96.0					4																	167713337		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ001454	CCDS34095.1, CCDS54817.1, CCDS56343.1, CCDS56344.1, CCDS56346.1, CCDS56347.1, CCDS58931.1, CCDS75207.1	4q32.3	2011-10-10			ENSG00000196104	ENSG00000196104			13565	protein-coding gene	gene with protein product		607989				11751414	Standard	NM_001204352		Approved	testican-3	uc003iri.1	Q9BQ16	OTTHUMG00000161190	ENST00000357154.3:c.702G>A	4.37:g.167713337C>T			B2R7M7|B3KR67|B4DGK5|B4DHB4|B4DHV3|B4DI46|B4DJY3|E7EP61|F5H099|O75705|Q6UW53|Q96Q26	Silent	SNP	pfam_SPARC/Testican_Ca-bd-dom,pfam_Thyroglobulin_1,pfam_Kazal_dom,superfamily_Thyroglobulin_1,smart_Kazal_dom,smart_Thyroglobulin_1,pfscan_Thyroglobulin_1	p.L234	ENST00000357154.3	37	c.702	CCDS54817.1	4																																																																																			SPOCK3	-	pfam_SPARC/Testican_Ca-bd-dom	ENSG00000196104		0.398	SPOCK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPOCK3	HGNC	protein_coding	OTTHUMT00000364091.1	-	0.00	54	0	C			167713337	-1	tier1	-	no_errors	ENST00000357154	ensembl	human	known	74_37	silent	26.47	50	18	SNP	1.000	T
SPON1	10418	genome.wustl.edu	37	11	14277295	14277295	+	RNA	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr11:14277295C>T	ENST00000310358.7	+	0	1730							Q9HCB6	SPON1_HUMAN	spondin 1, extracellular matrix protein						cell adhesion (GO:0007155)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|endometrium(1)|large_intestine(5)|lung(11)|prostate(2)|upper_aerodigestive_tract(1)	21				Epithelial(150;0.00898)		GTCCATCACTCAAGTAGCCAG	0.552																																																	0													74.0	80.0	78.0					11																	14277295		1902	4111	6013			0			AB018305	CCDS73262.1	11p15.2	2014-05-06	2004-03-05		ENSG00000152268	ENSG00000262655			11252	protein-coding gene	gene with protein product		604989	"""spondin 1, (f-spondin) extracellular matrix protein"""			9872452	Standard	NM_006108		Approved	KIAA0762, f-spondin	uc001mle.3	Q9HCB6	OTTHUMG00000181576		11.37:g.14277295C>T			A8K6W5|O94862|Q8NCD7|Q8WUR5	RNA	SNP	-	NULL	ENST00000310358.7	37	NULL		11	.	.	.	.	.	.	.	.	.	.	C	42	9.779529	0.99261	.	.	ENSG00000152268	ENST00000310358	.	.	.	5.68	5.68	0.88126	.	0.122741	0.56097	D	0.000034	.	.	.	.	.	.	0.80722	A	1.000000	.	.	.	.	.	.	.	.	.	.	0.44086	T	0.13	.	17.2897	0.87152	0.0:1.0:0.0:0.0	.	.	.	.	X	398	.	ENSP00000309297:Q398X	Q	+	1	0	SPON1	14233871	0.999000	0.42202	1.000000	0.80357	0.998000	0.95712	2.502000	0.45398	2.689000	0.91719	0.655000	0.94253	CAA	SPON1	-	-	ENSG00000152268		0.552	SPON1-201	KNOWN	basic	processed_transcript	SPON1	HGNC	processed_transcript		-	0.00	38	0	C	NM_145584		14277295	+1	tier1	-	no_errors	ENST00000310358	ensembl	human	known	74_37	rna	33.96	35	18	SNP	1.000	T
SPRR2E	6704	genome.wustl.edu	37	1	153066153	153066153	+	Silent	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:153066153C>T	ENST00000368751.1	-	2	149	c.75G>A	c.(73-75)gaG>gaA	p.E25E	SPRR2E_ENST00000368750.3_Silent_p.E25E|SPRR2B_ENST00000368752.4_Intron			P22531	SPR2E_HUMAN	small proline-rich protein 2E	25	3 X 9 AA tandem repeats of P-K-C-P-[EQ]- P-C-P-P.				epidermis development (GO:0008544)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)	structural molecule activity (GO:0005198)			NS(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)	14	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			GTGGACATGGCTCTGGGCACT	0.597																																																	0													83.0	86.0	85.0					1																	153066153		2202	4277	6479	SO:0001819	synonymous_variant	0			AF333955	CCDS30866.1	1q21-q22	2008-02-05			ENSG00000203785	ENSG00000203785			11265	protein-coding gene	gene with protein product						8325635	Standard	NM_001024209		Approved		uc001fbh.3	P22531	OTTHUMG00000014397	ENST00000368751.1:c.75G>A	1.37:g.153066153C>T			Q5T9T4|Q96RM2	Silent	SNP	NULL	p.E25	ENST00000368751.1	37	c.75	CCDS30866.1	1																																																																																			SPRR2E	-	NULL	ENSG00000203785		0.597	SPRR2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPRR2E	HGNC	protein_coding	OTTHUMT00000040054.1	-	0.00	64	0	C			153066153	-1	tier1	-	no_errors	ENST00000368750	ensembl	human	known	74_37	silent	18.63	83	19	SNP	0.349	T
SPTAN1	6709	genome.wustl.edu	37	9	131371527	131371527	+	Silent	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr9:131371527G>A	ENST00000372731.4	+	36	4832	c.4722G>A	c.(4720-4722)gcG>gcA	p.A1574A	SPTAN1_ENST00000372739.3_Silent_p.A1574A|SPTAN1_ENST00000358161.5_Silent_p.A1574A	NM_001195532.1|NM_003127.3	NP_001182461.1|NP_003118.2	Q13813	SPTN1_HUMAN	spectrin, alpha, non-erythrocytic 1	1574					actin filament capping (GO:0051693)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cuticular plate (GO:0032437)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intracellular membrane-bounded organelle (GO:0043231)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|spectrin (GO:0008091)|vesicle (GO:0031982)|Z disc (GO:0030018)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(2)|breast(8)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(21)|liver(1)|lung(25)|ovary(5)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	87						TGCAAACAGCGAGTGATGAGT	0.438																																					NSCLC(120;833 1744 2558 35612 37579)												0													102.0	91.0	95.0					9																	131371527		2203	4300	6503	SO:0001819	synonymous_variant	0			M19725	CCDS6905.1, CCDS48036.1, CCDS75914.1	9q34.11	2013-01-10	2012-06-15		ENSG00000197694	ENSG00000197694		"""EF-hand domain containing"""	11273	protein-coding gene	gene with protein product	"""alpha-fodrin"""	182810				3336352	Standard	NM_003127		Approved		uc004bvm.4	Q13813	OTTHUMG00000020754	ENST00000372731.4:c.4722G>A	9.37:g.131371527G>A			Q13186|Q15324|Q16606|Q59EF1|Q5VXV5|Q5VXV6|Q7Z6M5|Q9P0V0	Silent	SNP	pfam_Spectrin_repeat,pfam_EF-hand_Ca_insen,pfam_SH3_domain,pfam_EF_hand_dom,pfam_SH3_2,superfamily_SH3_domain,smart_Spectrin/alpha-actinin,smart_SH3_domain,smart_EF_hand_dom,pfscan_EF_hand_dom,pfscan_SH3_domain,prints_Spectrin_alpha_SH3,prints_SH3_domain	p.A1574	ENST00000372731.4	37	c.4722	CCDS6905.1	9																																																																																			SPTAN1	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000197694		0.438	SPTAN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTAN1	HGNC	protein_coding	OTTHUMT00000054472.1	-	0.00	113	0	G	NM_003127		131371527	+1	tier1	-	no_errors	ENST00000358161	ensembl	human	known	74_37	silent	22.69	92	27	SNP	0.084	A
SREBF1	6720	genome.wustl.edu	37	17	17721640	17721640	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr17:17721640G>C	ENST00000261646.5	-	6	1301	c.1117C>G	c.(1117-1119)Ctg>Gtg	p.L373V	SREBF1_ENST00000395757.1_Missense_Mutation_p.L119V|SREBF1_ENST00000583732.1_5'Flank|SREBF1_ENST00000338854.5_Missense_Mutation_p.L373V|SREBF1_ENST00000435530.2_Missense_Mutation_p.L373V|SREBF1_ENST00000355815.4_Missense_Mutation_p.L403V	NM_004176.4	NP_004167.3	P36956	SRBP1_HUMAN	sterol regulatory element binding transcription factor 1	373	Interaction with LMNA. {ECO:0000250}.|Leucine-zipper.|bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				aging (GO:0007568)|cellular lipid metabolic process (GO:0044255)|cellular response to fatty acid (GO:0071398)|cellular response to starvation (GO:0009267)|cholesterol metabolic process (GO:0008203)|circadian rhythm (GO:0007623)|insulin receptor signaling pathway (GO:0008286)|lipid biosynthetic process (GO:0008610)|lipid metabolic process (GO:0006629)|lung development (GO:0030324)|negative regulation of insulin secretion (GO:0046676)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of fatty acid metabolic process (GO:0019217)|regulation of heart rate by chemical signal (GO:0003062)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cAMP (GO:0051591)|response to drug (GO:0042493)|response to food (GO:0032094)|response to glucagon (GO:0033762)|response to glucose (GO:0009749)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|sterol response element binding (GO:0032810)			cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|urinary_tract(1)	14						CTGTGTTGCAGAAAGCGAATG	0.562																																																	0													150.0	118.0	129.0					17																	17721640		2203	4300	6503	SO:0001583	missense	0			BC057388	CCDS11189.1, CCDS32583.1	17p11.2	2013-05-21			ENSG00000072310	ENSG00000072310		"""Basic helix-loop-helix proteins"""	11289	protein-coding gene	gene with protein product		184756				8402897, 7759101	Standard	NM_001005291		Approved	SREBP1, bHLHd1, SREBP-1c	uc002grt.2	P36956	OTTHUMG00000059313	ENST00000261646.5:c.1117C>G	17.37:g.17721640G>C	ENSP00000261646:p.Leu373Val		B0I4X3|B0I4X4|D3DXC4|Q16062|Q59F52|Q6P4R7|Q6PFW7|Q6PJ36|Q8TAK9	Missense_Mutation	SNP	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.L403V	ENST00000261646.5	37	c.1207	CCDS11189.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.59|17.59	3.426285|3.426285	0.62733|0.62733	.|.	.|.	ENSG00000072310|ENSG00000072310	ENST00000338854;ENST00000355815;ENST00000261646;ENST00000395757;ENST00000418712;ENST00000423161;ENST00000435530|ENST00000395751	D;D;D;D;D|.	0.99445|.	-5.91;-5.91;-5.91;-5.91;-5.91|.	5.13|5.13	1.66|1.66	0.24008|0.24008	Helix-loop-helix DNA-binding (5);|.	0.076328|.	0.53938|.	D|.	0.000046|.	T|T	0.78515|0.78515	0.4295|0.4295	M|M	0.93197|0.93197	3.39|3.39	0.58432|0.58432	D|D	0.999998|0.999998	D;D;D;D|.	0.71674|.	0.985;0.961;0.997;0.998|.	D;D;D;D|.	0.68353|.	0.927;0.939;0.957;0.928|.	T|T	0.77354|0.77354	-0.2619|-0.2619	10|5	0.56958|.	D|.	0.05|.	-10.104|-10.104	8.107|8.107	0.30892|0.30892	0.2799:0.0:0.7201:0.0|0.2799:0.0:0.7201:0.0	.|.	373;349;373;403|.	B0I4X3;B0I4X4;P36956;P36956-4|.	.;.;SRBP1_HUMAN;.|.	V|C	373;403;373;119;210;299;373|380	ENSP00000345822:L373V;ENSP00000348069:L403V;ENSP00000261646:L373V;ENSP00000379106:L119V;ENSP00000413389:L373V|.	ENSP00000261646:L373V|.	L|S	-|-	1|2	2|0	SREBF1|SREBF1	17662365|17662365	1.000000|1.000000	0.71417|0.71417	0.880000|0.880000	0.34516|0.34516	0.632000|0.632000	0.37999|0.37999	2.564000|2.564000	0.45931|0.45931	0.031000|0.031000	0.15407|0.15407	-0.258000|-0.258000	0.10820|0.10820	CTG|TCT	SREBF1	-	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	ENSG00000072310		0.562	SREBF1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SREBF1	HGNC	protein_coding	OTTHUMT00000131771.1	-	0.00	50	0	G	NM_004176		17721640	-1	tier1	-	no_errors	ENST00000355815	ensembl	human	known	74_37	missense	31.25	11	5	SNP	1.000	C
SRCIN1	80725	genome.wustl.edu	37	17	36719704	36719704	+	Missense_Mutation	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr17:36719704C>T	ENST00000264659.7	-	5	819	c.595G>A	c.(595-597)Gag>Aag	p.E199K	SRCIN1_ENST00000578925.1_Missense_Mutation_p.E233K|SRCIN1_ENST00000398579.4_5'UTR	NM_025248.2	NP_079524.2	Q9C0H9	SRCN1_HUMAN	SRC kinase signaling inhibitor 1	71					exocytosis (GO:0006887)|negative regulation of protein tyrosine kinase activity (GO:0061099)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell migration (GO:0030334)|regulation of dendritic spine morphogenesis (GO:0061001)|substrate adhesion-dependent cell spreading (GO:0034446)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	protein kinase binding (GO:0019901)			endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)	19						CTGCTGACCTCGTGCGTGATG	0.637																																																	0													40.0	44.0	43.0					17																	36719704		2172	4236	6408	SO:0001583	missense	0				CCDS45660.1	17q12	2009-12-14			ENSG00000017373	ENSG00000277363			29506	protein-coding gene	gene with protein product	"""p130Cas-associated protein"", ""SNAP-25-interacting protein"""	610786				11214970	Standard	NM_025248		Approved	SNIP, p140Cap, KIAA1684	uc002hqd.3	Q9C0H9		ENST00000264659.7:c.595G>A	17.37:g.36719704C>T	ENSP00000264659:p.Glu199Lys		Q75T46|Q8N4W8	Missense_Mutation	SNP	pfam_AIP3_C	p.E199K	ENST00000264659.7	37	c.595	CCDS45660.1	17	.	.	.	.	.	.	.	.	.	.	C	35	5.588948	0.96590	.	.	ENSG00000017373	ENST00000264659;ENST00000398579	T	0.64991	-0.13	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	T	0.79441	0.4446	M	0.73598	2.24	0.48901	D	0.999726	P;D;D;D	0.89917	0.947;1.0;1.0;1.0	B;D;D;D	0.85130	0.427;0.99;0.99;0.997	T	0.82116	-0.0616	10	0.87932	D	0	-32.2278	17.4279	0.87531	0.0:1.0:0.0:0.0	.	53;71;71;199	B4DHC2;Q9C0H9-2;Q9C0H9;Q9C0H9-5	.;.;SRCN1_HUMAN;.	K	199;53	ENSP00000264659:E199K	ENSP00000264659:E199K	E	-	1	0	SRCIN1	33973230	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.736000	0.68597	2.477000	0.83638	0.650000	0.86243	GAG	SRCIN1	-	pfam_AIP3_C	ENSG00000017373		0.637	SRCIN1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SRCIN1	HGNC	protein_coding	OTTHUMT00000441878.4	-	0.00	52	0	C	NM_025248		36719704	-1	tier1	-	no_errors	ENST00000264659	ensembl	human	known	74_37	missense	38.00	31	19	SNP	1.000	T
SRFBP1	153443	genome.wustl.edu	37	5	121356415	121356415	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr5:121356415G>C	ENST00000339397.4	+	6	1057	c.985G>C	c.(985-987)Gac>Cac	p.D329H	SRFBP1_ENST00000504881.1_3'UTR	NM_152546.2	NP_689759.2			serum response factor binding protein 1											central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|skin(1)	15		all_cancers(142;0.0124)|Prostate(80;0.0322)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000227)|Epithelial(69;0.000365)|all cancers(49;0.00517)		TACAAGAAATGACAAAATCAA	0.338																																																	0													62.0	57.0	59.0					5																	121356415		1829	4084	5913	SO:0001583	missense	0			AK058015	CCDS43354.1	5q23.1	2006-12-21				ENSG00000151304			26333	protein-coding gene	gene with protein product	"""BUD22 homolog (S. cerevisiae)"""	610479				15492011	Standard	NM_152546		Approved	FLJ25286, p49, STRAP, BUD22, Rlb1	uc003kst.1	Q8NEF9		ENST00000339397.4:c.985G>C	5.37:g.121356415G>C	ENSP00000341324:p.Asp329His			Missense_Mutation	SNP	pfam_Bud-site_select_BUD22	p.D329H	ENST00000339397.4	37	c.985	CCDS43354.1	5	.	.	.	.	.	.	.	.	.	.	G	14.89	2.671079	0.47781	.	.	ENSG00000151304	ENST00000339397	.	.	.	5.33	3.42	0.39159	.	0.448128	0.25919	N	0.027448	T	0.49949	0.1587	L	0.56769	1.78	0.09310	N	1	D	0.65815	0.995	P	0.57371	0.819	T	0.35574	-0.9783	9	0.54805	T	0.06	-13.3211	7.9078	0.29771	0.1472:0.1341:0.7187:0.0	.	329	Q8NEF9	SRFB1_HUMAN	H	329	.	ENSP00000341324:D329H	D	+	1	0	SRFBP1	121384314	0.005000	0.15991	0.076000	0.20297	0.075000	0.17131	1.289000	0.33307	1.373000	0.46208	0.563000	0.77884	GAC	SRFBP1	-	NULL	ENSG00000151304		0.338	SRFBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRFBP1	HGNC	protein_coding	OTTHUMT00000371200.1	-	0.00	49	0	G	NM_152546		121356415	+1	tier1	-	no_errors	ENST00000339397	ensembl	human	known	74_37	missense	21.05	45	12	SNP	0.006	C
SRFBP1	153443	genome.wustl.edu	37	5	121356424	121356424	+	Missense_Mutation	SNP	A	A	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr5:121356424A>C	ENST00000339397.4	+	6	1066	c.994A>C	c.(994-996)Aag>Cag	p.K332Q	SRFBP1_ENST00000504881.1_3'UTR	NM_152546.2	NP_689759.2			serum response factor binding protein 1											central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|skin(1)	15		all_cancers(142;0.0124)|Prostate(80;0.0322)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000227)|Epithelial(69;0.000365)|all cancers(49;0.00517)		TGACAAAATCAAGCCAAGTAC	0.328																																																	0													62.0	57.0	59.0					5																	121356424		1829	4085	5914	SO:0001583	missense	0			AK058015	CCDS43354.1	5q23.1	2006-12-21				ENSG00000151304			26333	protein-coding gene	gene with protein product	"""BUD22 homolog (S. cerevisiae)"""	610479				15492011	Standard	NM_152546		Approved	FLJ25286, p49, STRAP, BUD22, Rlb1	uc003kst.1	Q8NEF9		ENST00000339397.4:c.994A>C	5.37:g.121356424A>C	ENSP00000341324:p.Lys332Gln			Missense_Mutation	SNP	pfam_Bud-site_select_BUD22	p.K332Q	ENST00000339397.4	37	c.994	CCDS43354.1	5	.	.	.	.	.	.	.	.	.	.	A	11.53	1.667045	0.29604	.	.	ENSG00000151304	ENST00000339397	.	.	.	4.81	3.62	0.41486	.	0.782103	0.12855	N	0.433644	T	0.38799	0.1054	M	0.64997	1.995	0.09310	N	1	P	0.38195	0.622	B	0.32762	0.152	T	0.21965	-1.0230	9	0.54805	T	0.06	-1.6557	11.0111	0.47663	0.8438:0.1562:0.0:0.0	.	332	Q8NEF9	SRFB1_HUMAN	Q	332	.	ENSP00000341324:K332Q	K	+	1	0	SRFBP1	121384323	0.004000	0.15560	0.018000	0.16275	0.021000	0.10359	1.395000	0.34520	0.908000	0.36671	0.460000	0.39030	AAG	SRFBP1	-	NULL	ENSG00000151304		0.328	SRFBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRFBP1	HGNC	protein_coding	OTTHUMT00000371200.1	-	0.00	43	0	A	NM_152546		121356424	+1	tier1	-	no_errors	ENST00000339397	ensembl	human	known	74_37	missense	20.00	44	11	SNP	0.002	C
SRSF12	135295	genome.wustl.edu	37	6	89808431	89808431	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr6:89808431C>G	ENST00000452027.2	-	5	845	c.652G>C	c.(652-654)Gac>Cac	p.D218H		NM_080743.4	NP_542781.3	Q8WXF0	SRS12_HUMAN	serine/arginine-rich splicing factor 12	218	Arg/Ser-rich (RS domain).				cytoplasmic transport (GO:0016482)|mRNA 5'-splice site recognition (GO:0000395)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|spliceosomal tri-snRNP complex assembly (GO:0000244)	nucleoplasm (GO:0005654)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RS domain binding (GO:0050733)|unfolded protein binding (GO:0051082)			autonomic_ganglia(1)|breast(1)|endometrium(2)|large_intestine(4)	8						GCTATTGAGTCAGAATGTCTT	0.398																																																	0													272.0	249.0	256.0					6																	89808431		1898	4125	6023	SO:0001583	missense	0			AF449428	CCDS47459.1	6q16.1	2013-02-12	2010-06-22	2010-06-22	ENSG00000154548	ENSG00000154548		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	21220	protein-coding gene	gene with protein product	"""splicing factor, arginine/serine-rich 19"", ""SR splicing factor 12"""		"""splicing factor, arginine/serine-rich 13B"""	SFRS13B		11684676, 20516191	Standard	NM_080743		Approved	SRrp35, SFRS19	uc021zcq.1	Q8WXF0	OTTHUMG00000015192	ENST00000452027.2:c.652G>C	6.37:g.89808431C>G	ENSP00000414302:p.Asp218His		B2RA22|Q5T7K0|Q8WW25	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.D218H	ENST00000452027.2	37	c.652	CCDS47459.1	6	.	.	.	.	.	.	.	.	.	.	C	16.82	3.228360	0.58777	.	.	ENSG00000154548	ENST00000452027	T	0.07444	3.19	5.22	5.22	0.72569	.	0.309538	0.29916	N	0.010880	T	0.06917	0.0176	L	0.40543	1.245	0.36242	D	0.853361	B	0.32693	0.38	B	0.40329	0.326	T	0.18903	-1.0322	10	0.49607	T	0.09	.	17.719	0.88345	0.0:1.0:0.0:0.0	.	218	Q8WXF0	SRS12_HUMAN	H	218	ENSP00000414302:D218H	ENSP00000414302:D218H	D	-	1	0	SRSF12	89865150	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	1.631000	0.37092	2.724000	0.93272	0.591000	0.81541	GAC	SRSF12	-	NULL	ENSG00000154548		0.398	SRSF12-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	SRSF12	HGNC	protein_coding	OTTHUMT00000041474.2	-	0.00	77	0	C	NM_080743		89808431	-1	tier1	-	no_errors	ENST00000452027	ensembl	human	known	74_37	missense	28.75	57	23	SNP	1.000	G
STK11	6794	genome.wustl.edu	37	19	1220640	1220640	+	Nonsense_Mutation	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr19:1220640C>T	ENST00000326873.7	+	5	1831	c.658C>T	c.(658-660)Cag>Tag	p.Q220*		NM_000455.4	NP_000446.1	Q15831	STK11_HUMAN	serine/threonine kinase 11	220	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of protein kinase activity (GO:0032147)|anoikis (GO:0043276)|autophagy (GO:0006914)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|energy reserve metabolic process (GO:0006112)|establishment of cell polarity (GO:0030010)|glucose homeostasis (GO:0042593)|Golgi localization (GO:0051645)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|positive regulation of axonogenesis (GO:0050772)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive thymic T cell selection (GO:0045059)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of protein kinase B signaling (GO:0051896)|regulation of Wnt signaling pathway (GO:0030111)|response to glucagon (GO:0033762)|response to ionizing radiation (GO:0010212)|response to lipid (GO:0033993)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)|T cell receptor signaling pathway (GO:0050852)|TCR signalosome assembly (GO:0036399)|tissue homeostasis (GO:0001894)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|TCR signalosome (GO:0036398)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|p53 binding (GO:0002039)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.0?(20)|p.Q220*(4)|p.?(2)		biliary_tract(1)|breast(3)|cervix(35)|gastrointestinal_tract_(site_indeterminate)(5)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|liver(1)|lung(219)|oesophagus(1)|ovary(4)|pancreas(6)|prostate(2)|skin(15)|small_intestine(1)|stomach(9)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	328		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)		CCCGGCTTTCCAGCCGCCCGA	0.711		14	"""D, Mis, N, F, S"""		"""NSCLC, pancreatic"""	"""jejunal harmartoma, ovarian, testicular, pancreatic"""			Peutz-Jeghers syndrome	TSP Lung(3;<1E-08)																													yes	Rec	yes	Peutz-Jeghers syndrome	19	19p13.3	6794	serine/threonine kinase 11 gene (LKB1)		"""E, M, O"""	26	Whole gene deletion(20)|Substitution - Nonsense(4)|Unknown(2)	cervix(14)|lung(8)|oesophagus(1)|ovary(1)|kidney(1)|pancreas(1)	GRCh37	CM991157	STK11	M							13.0	18.0	17.0					19																	1220640		1947	4128	6075	SO:0001587	stop_gained	0	Familial Cancer Database	PJS, Hamartous Intestinal Polyposis	U63333	CCDS45896.1	19p13.3	2014-09-17	2005-12-13			ENSG00000118046			11389	protein-coding gene	gene with protein product	"""polarization-related protein LKB1"""	602216	"""serine/threonine kinase 11 (Peutz-Jeghers syndrome)"""			9425897	Standard	XM_005259617		Approved	PJS, LKB1	uc002lrl.1	Q15831		ENST00000326873.7:c.658C>T	19.37:g.1220640C>T	ENSP00000324856:p.Gln220*		B2RBX7|E7EW76	Nonsense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.Q220*	ENST00000326873.7	37	c.658	CCDS45896.1	19	.	.	.	.	.	.	.	.	.	.	C	48	14.216541	0.99785	.	.	ENSG00000118046	ENST00000326873;ENST00000405031	.	.	.	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	-51.9112	18.5988	0.91240	0.0:1.0:0.0:0.0	.	.	.	.	X	220	.	ENSP00000324856:Q220X	Q	+	1	0	STK11	1171640	1.000000	0.71417	1.000000	0.80357	0.695000	0.40330	7.712000	0.84684	2.644000	0.89710	0.561000	0.74099	CAG	STK11	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000118046		0.711	STK11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	STK11	HGNC	protein_coding	OTTHUMT00000449839.3		0.00	9	0	C	NM_000455		1220640	+1			no_errors	ENST00000326873	ensembl	human	known	74_37	nonsense	33.33	6	3	SNP	1.000	T
STK36	27148	genome.wustl.edu	37	2	219557016	219557016	+	Splice_Site	SNP	G	G	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr2:219557016G>T	ENST00000295709.3	+	15	2194	c.1915G>T	c.(1915-1917)Gga>Tga	p.G639*	STK36_ENST00000392106.2_Splice_Site_p.G639*|STK36_ENST00000440309.1_Splice_Site_p.G639*|STK36_ENST00000392105.3_Splice_Site_p.G639*	NM_015690.4	NP_056505.2			serine/threonine kinase 36											biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(20)|ovary(4)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	52		Renal(207;0.0915)		Epithelial(149;9.65e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.00984)		CACTCCCCAAGGTAACCAGAG	0.517																																																	0													68.0	75.0	72.0					2																	219557016		2203	4300	6503	SO:0001630	splice_region_variant	0			AB033104	CCDS2421.1, CCDS58750.1	2q35	2010-06-25	2010-06-25		ENSG00000163482	ENSG00000163482			17209	protein-coding gene	gene with protein product	"""fused homolog (Drosophila)"""	607652	"""serine/threonine kinase 36 (fused homolog, Drosophila)"""			10806483	Standard	NM_001243313		Approved	KIAA1278, FU	uc002viu.3	Q9NRP7	OTTHUMG00000133079	ENST00000295709.3:c.1915+1G>T	2.37:g.219557016G>T				Nonsense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.G639*	ENST00000295709.3	37	c.1915	CCDS2421.1	2	.	.	.	.	.	.	.	.	.	.	G	36	5.907288	0.97093	.	.	ENSG00000163482	ENST00000295709;ENST00000392106;ENST00000392105;ENST00000440309	.	.	.	4.72	4.72	0.59763	.	0.000000	0.41605	D	0.000856	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27785	T	0.31	-7.7601	14.9794	0.71301	0.0:0.0:1.0:0.0	.	.	.	.	X	639	.	ENSP00000295709:G639X	G	+	1	0	STK36	219265260	1.000000	0.71417	1.000000	0.80357	0.082000	0.17680	5.009000	0.63998	2.446000	0.82766	0.561000	0.74099	GGA	STK36	-	superfamily_ARM-type_fold	ENSG00000163482		0.517	STK36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK36	HGNC	protein_coding	OTTHUMT00000256723.2	-	0.00	19	0	G		Nonsense_Mutation	219557016	+1	tier1	-	no_errors	ENST00000295709	ensembl	human	known	74_37	nonsense	62.50	6	10	SNP	1.000	T
STK11IP	114790	genome.wustl.edu	37	2	220476466	220476466	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr2:220476466C>G	ENST00000456909.1	+	18	2335	c.2245C>G	c.(2245-2247)Cct>Gct	p.P749A	STK11IP_ENST00000295641.10_Missense_Mutation_p.P760A			Q8N1F8	S11IP_HUMAN	serine/threonine kinase 11 interacting protein	760					protein localization (GO:0008104)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)	protein kinase binding (GO:0019901)			breast(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|urinary_tract(1)	23		Renal(207;0.0183)		Epithelial(149;2.69e-07)|all cancers(144;5.91e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CTGCCACCCTCCTGGCCATGG	0.627																																																	0													44.0	52.0	49.0					2																	220476466		2105	4223	6328	SO:0001583	missense	0			AF450267	CCDS46521.1	2q35	2008-06-03			ENSG00000144589	ENSG00000144589			19184	protein-coding gene	gene with protein product	"""LKB1 interacting protein"""	607172				11741830	Standard	NM_052902		Approved	LIP1, KIAA1898, LKB1IP, STK11IP1	uc002vml.3	Q8N1F8	OTTHUMG00000059239	ENST00000456909.1:c.2245C>G	2.37:g.220476466C>G	ENSP00000389383:p.Pro749Ala		Q8NAW9|Q8WXE4|Q96CN3|Q96PY9	Missense_Mutation	SNP	NULL	p.P749A	ENST00000456909.1	37	c.2245		2	.	.	.	.	.	.	.	.	.	.	C	0.017	-1.496338	0.01009	.	.	ENSG00000144589	ENST00000456909;ENST00000295641	T;T	0.04406	3.64;3.63	4.68	-4.27	0.03744	.	1.059070	0.07309	N	0.875413	T	0.03136	0.0092	L	0.31294	0.92	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.48864	-0.8997	10	0.12430	T	0.62	0.2465	6.0755	0.19913	0.0:0.2216:0.265:0.5134	.	760	Q8N1F8	S11IP_HUMAN	A	749;760	ENSP00000389383:P749A;ENSP00000295641:P760A	ENSP00000295641:P760A	P	+	1	0	STK11IP	220184710	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	-0.393000	0.07305	-0.803000	0.04415	-1.102000	0.02115	CCT	STK11IP	-	NULL	ENSG00000144589		0.627	STK11IP-001	NOVEL	basic|appris_principal	protein_coding	STK11IP	HGNC	protein_coding	OTTHUMT00000131432.1	-	0.00	13	0	C	NM_052902		220476466	+1	tier1	-	no_errors	ENST00000456909	ensembl	human	novel	74_37	missense	37.50	10	6	SNP	0.000	G
STX1B	112755	genome.wustl.edu	37	16	31004737	31004737	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr16:31004737G>C	ENST00000215095.5	-	8	837	c.606C>G	c.(604-606)atC>atG	p.I202M	STX1B_ENST00000565419.1_Missense_Mutation_p.I202M	NM_052874.3	NP_443106.1	P61266	STX1B_HUMAN	syntaxin 1B	202	t-SNARE coiled-coil homology. {ECO:0000255|PROSITE-ProRule:PRU00202}.				intracellular protein transport (GO:0006886)|neurotransmitter transport (GO:0006836)|regulation of exocytosis (GO:0017157)|regulation of gene expression (GO:0010468)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)			breast(2)|endometrium(1)|large_intestine(5)|lung(5)	13						TCTCCAGCTTGATGATCTCAT	0.542																																																	0													191.0	148.0	163.0					16																	31004737		2197	4300	6497	SO:0001583	missense	0			AY028792	CCDS10699.1	16p12-p11	2008-02-05	2007-06-20	2007-06-20	ENSG00000099365	ENSG00000099365			18539	protein-coding gene	gene with protein product		601485	"""syntaxin 1B1"", ""syntaxin 1B2"""	STX1B1, STX1B2			Standard	NM_052874		Approved		uc010cad.2	P61266	OTTHUMG00000132391	ENST00000215095.5:c.606C>G	16.37:g.31004737G>C	ENSP00000215095:p.Ile202Met		Q15531|Q2VPS2	Missense_Mutation	SNP	pfam_Syntaxin_N,pfam_T_SNARE_dom,superfamily_t-SNARE,smart_Syntaxin_N,smart_T_SNARE_dom,pfscan_T_SNARE_dom	p.I202M	ENST00000215095.5	37	c.606	CCDS10699.1	16	.	.	.	.	.	.	.	.	.	.	G	8.348	0.830188	0.16749	.	.	ENSG00000099365	ENST00000215095	T	0.22134	1.97	5.0	5.0	0.66597	t-SNARE (1);Syntaxin/epimorphin, conserved site (1);Target SNARE coiled-coil domain (3);	0.076681	0.56097	D	0.000026	T	0.13243	0.0321	N	0.04805	-0.155	0.58432	D	0.999999	B;B	0.20671	0.047;0.041	B;B	0.27715	0.082;0.056	T	0.14504	-1.0470	10	0.29301	T	0.29	.	17.0941	0.86630	0.0:0.0:1.0:0.0	.	202;202	Q2VPS2;P61266	.;STX1B_HUMAN	M	202	ENSP00000215095:I202M	ENSP00000215095:I202M	I	-	3	3	STX1B	30912238	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	6.057000	0.71119	2.309000	0.77851	0.561000	0.74099	ATC	STX1B	-	pfam_T_SNARE_dom,superfamily_t-SNARE,smart_T_SNARE_dom,pfscan_T_SNARE_dom	ENSG00000099365		0.542	STX1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STX1B	HGNC	protein_coding	OTTHUMT00000255521.2	-	0.00	27	0	G			31004737	-1	tier1	-	no_errors	ENST00000215095	ensembl	human	known	74_37	missense	33.33	20	10	SNP	1.000	C
STXBP5L	9515	genome.wustl.edu	37	3	120957831	120957831	+	Missense_Mutation	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr3:120957831G>A	ENST00000273666.6	+	13	1469	c.1198G>A	c.(1198-1200)Gaa>Aaa	p.E400K	STXBP5L_ENST00000492541.1_Missense_Mutation_p.E400K|STXBP5L_ENST00000497029.1_Missense_Mutation_p.E400K|STXBP5L_ENST00000472879.1_Missense_Mutation_p.E400K|STXBP5L_ENST00000471454.1_Missense_Mutation_p.E400K	NM_014980.2	NP_055795.1	Q9Y2K9	STB5L_HUMAN	syntaxin binding protein 5-like	400					exocytosis (GO:0006887)|glucose homeostasis (GO:0042593)|negative regulation of insulin secretion (GO:0046676)|positive regulation of protein secretion (GO:0050714)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(12)|lung(28)|ovary(7)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				GBM - Glioblastoma multiforme(114;0.0694)		TCCAATCTTTGAAAATCCATA	0.313																																																	0													50.0	46.0	47.0					3																	120957831		1817	4077	5894	SO:0001583	missense	0			AB023223	CCDS43137.1	3q13.33-q21.1	2013-01-10			ENSG00000145087	ENSG00000145087		"""WD repeat domain containing"""	30757	protein-coding gene	gene with protein product		609381				10231032, 14767561	Standard	NM_014980		Approved	KIAA1006, LLGL4	uc003eec.4	Q9Y2K9	OTTHUMG00000159426	ENST00000273666.6:c.1198G>A	3.37:g.120957831G>A	ENSP00000273666:p.Glu400Lys		Q4G1B4|Q6PIC3	Missense_Mutation	SNP	pfam_LLGL2,pfam_WD40_repeat,pfam_Lgl_C_dom,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,pfscan_Synaptobrevin,prints_Lethal2_giant	p.E400K	ENST00000273666.6	37	c.1198	CCDS43137.1	3	.	.	.	.	.	.	.	.	.	.	G	27.2	4.806031	0.90623	.	.	ENSG00000145087	ENST00000273666;ENST00000471454;ENST00000472879;ENST00000497029;ENST00000492541;ENST00000471262	T;T;T;T;T;T	0.61627	1.87;0.09;0.09;1.19;0.09;0.09	4.97	4.97	0.65823	WD40 repeat-like-containing domain (2);	0.000000	0.85682	D	0.000000	T	0.72471	0.3464	L	0.58810	1.83	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.75484	0.986;0.986	T	0.69000	-0.5261	10	0.31617	T	0.26	-39.6187	18.4118	0.90554	0.0:0.0:1.0:0.0	.	400;400	E9PFI2;Q9Y2K9	.;STB5L_HUMAN	K	400	ENSP00000273666:E400K;ENSP00000420019:E400K;ENSP00000419627:E400K;ENSP00000420287:E400K;ENSP00000420666:E400K;ENSP00000420167:E400K	ENSP00000273666:E400K	E	+	1	0	STXBP5L	122440521	1.000000	0.71417	1.000000	0.80357	0.765000	0.43378	9.604000	0.98317	2.582000	0.87167	0.655000	0.94253	GAA	STXBP5L	-	superfamily_WD40_repeat_dom,smart_WD40_repeat	ENSG00000145087		0.313	STXBP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STXBP5L	HGNC	protein_coding	OTTHUMT00000355256.3	-	0.00	62	0	G			120957831	+1	tier1	-	no_errors	ENST00000273666	ensembl	human	known	74_37	missense	23.81	64	20	SNP	1.000	A
SYK	6850	genome.wustl.edu	37	9	93607824	93607824	+	Nonsense_Mutation	SNP	G	G	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr9:93607824G>T	ENST00000375754.4	+	3	674	c.526G>T	c.(526-528)Gaa>Taa	p.E176*	SYK_ENST00000375751.4_Nonsense_Mutation_p.E176*|SYK_ENST00000375747.1_Nonsense_Mutation_p.E176*|SYK_ENST00000375746.1_Nonsense_Mutation_p.E176*	NM_003177.5	NP_003168.2	P43405	KSYK_HUMAN	spleen tyrosine kinase	176	SH2 2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				activation of JUN kinase activity (GO:0007257)|adaptive immune response (GO:0002250)|angiogenesis (GO:0001525)|B cell receptor signaling pathway (GO:0050853)|beta selection (GO:0043366)|blood coagulation (GO:0007596)|blood vessel morphogenesis (GO:0048514)|cell proliferation (GO:0008283)|cellular response to molecule of fungal origin (GO:0071226)|defense response to bacterium (GO:0042742)|enzyme linked receptor protein signaling pathway (GO:0007167)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte activation involved in immune response (GO:0002366)|leukocyte cell-cell adhesion (GO:0007159)|leukotriene biosynthetic process (GO:0019370)|lymph vessel development (GO:0001945)|macrophage activation involved in immune response (GO:0002281)|neutrophil activation involved in immune response (GO:0002283)|neutrophil chemotaxis (GO:0030593)|organ morphogenesis (GO:0009887)|platelet activation (GO:0030168)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of bone resorption (GO:0045780)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of granulocyte macrophage colony-stimulating factor biosynthetic process (GO:0045425)|positive regulation of interleukin-3 biosynthetic process (GO:0045401)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of arachidonic acid secretion (GO:0090237)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of neutrophil degranulation (GO:0043313)|regulation of phagocytosis (GO:0050764)|regulation of platelet activation (GO:0010543)|regulation of platelet aggregation (GO:0090330)|regulation of superoxide anion generation (GO:0032928)|serotonin secretion by platelet (GO:0002554)|viral process (GO:0016032)	B cell receptor complex (GO:0019815)|cytosol (GO:0005829)|early phagosome (GO:0032009)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	ATP binding (GO:0005524)|integrin binding (GO:0005178)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)			breast(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|prostate(3)|skin(2)|stomach(2)	26						AATCTCTCGGGAAGAATCTGA	0.507			T	"""ETV6, ITK"""	"""MDS, peripheral T-cell lymphoma"""																																			Dom	yes		9	9q22	6850	spleen tyrosine kinase		L	0													89.0	85.0	86.0					9																	93607824		2203	4300	6503	SO:0001587	stop_gained	0			L28824	CCDS6688.1, CCDS47992.1	9q22	2013-02-14			ENSG00000165025	ENSG00000165025		"""SH2 domain containing"""	11491	protein-coding gene	gene with protein product		600085				8082894, 1423621	Standard	XM_005252147		Approved		uc004aqz.3	P43405	OTTHUMG00000020200	ENST00000375754.4:c.526G>T	9.37:g.93607824G>T	ENSP00000364907:p.Glu176*			Nonsense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,superfamily_Kinase-like_dom,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_non-rcpt_SYK/ZAP70,pfscan_SH2,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2	p.E176*	ENST00000375754.4	37	c.526	CCDS6688.1	9	.	.	.	.	.	.	.	.	.	.	G	21.6	4.169872	0.78452	.	.	ENSG00000165025	ENST00000375754;ENST00000375751;ENST00000375747;ENST00000375746	.	.	.	5.1	4.14	0.48551	.	0.286276	0.36893	N	0.002341	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07325	T	0.83	.	16.3811	0.83461	0.0:0.1318:0.8682:0.0	.	.	.	.	X	176	.	ENSP00000364898:E176X	E	+	1	0	SYK	92647645	1.000000	0.71417	0.198000	0.23420	0.038000	0.13279	4.855000	0.62925	2.803000	0.96430	0.585000	0.79938	GAA	SYK	-	pfam_SH2,smart_SH2,pirsf_Tyr_kinase_non-rcpt_SYK/ZAP70,pfscan_SH2,prints_SH2	ENSG00000165025		0.507	SYK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYK	HGNC	protein_coding	OTTHUMT00000053018.1	-	0.00	65	0	G			93607824	+1	tier1	-	no_errors	ENST00000375746	ensembl	human	known	74_37	nonsense	5.41	70	4	SNP	0.305	T
SYNCRIP	10492	genome.wustl.edu	37	6	86324929	86324929	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr6:86324929C>G	ENST00000369622.3	-	11	1917	c.1417G>C	c.(1417-1419)Gat>Cat	p.D473H	RP11-321N4.5_ENST00000503906.1_Missense_Mutation_p.M8I|SYNCRIP_ENST00000355238.6_Missense_Mutation_p.D473H	NM_001159675.1|NM_006372.4	NP_001153147.1|NP_006363.4	O60506	HNRPQ_HUMAN	synaptotagmin binding, cytoplasmic RNA interacting protein	473	3 X 4 AA repeats of Y-Y-G-Y.|8 X 3 AA repeats of R-G-G.|Interaction with APOBEC1.				cellular response to interferon-gamma (GO:0071346)|CRD-mediated mRNA stabilization (GO:0070934)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of translation (GO:0017148)|osteoblast differentiation (GO:0001649)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|CRD-mediated mRNA stability complex (GO:0070937)|endoplasmic reticulum (GO:0005783)|GAIT complex (GO:0097452)|histone pre-mRNA 3'end processing complex (GO:0071204)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(3)|kidney(2)|large_intestine(5)|liver(1)|lung(10)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	33		all_cancers(76;0.000137)|Acute lymphoblastic leukemia(125;3.66e-08)|Prostate(29;8.2e-07)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0297)		BRCA - Breast invasive adenocarcinoma(108;0.0389)		TTATGGTAATCATAACCATAA	0.433																																																	0													32.0	31.0	31.0					6																	86324929		2202	4290	6492	SO:0001583	missense	0			AF037448	CCDS5005.1, CCDS55041.1, CCDS75491.1	6q14-q15	2013-05-23			ENSG00000135316	ENSG00000135316		"""RNA binding motif (RRM) containing"""	16918	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein Q"""					9847309, 11352648	Standard	NM_006372		Approved	NSAP1, GRY-RBP, dJ3J17.2, HNRPQ1, hnRNP-Q, HNRNPQ	uc003pla.2	O60506	OTTHUMG00000015141	ENST00000369622.3:c.1417G>C	6.37:g.86324929C>G	ENSP00000358635:p.Asp473His		E1P501|E1P502|Q53H05|Q5TCG2|Q5TCG3|Q8IW78|Q8N599|Q96LC1|Q96LC2|Q9Y583	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP_R/Q_splicing_fac	p.D473H	ENST00000369622.3	37	c.1417	CCDS5005.1	6	.	.	.	.	.	.	.	.	.	.	C	14.12	2.441099	0.43326	.	.	ENSG00000135316	ENST00000355238;ENST00000369622	T;T	0.29397	1.59;1.57	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	T	0.50769	0.1635	M	0.76574	2.34	0.80722	D	1	D;D;D;D;D;D;D	0.89917	0.999;1.0;0.998;0.999;1.0;1.0;0.999	D;D;D;D;D;D;D	0.83275	0.99;0.996;0.99;0.996;0.996;0.996;0.99	T	0.49254	-0.8959	10	0.46703	T	0.11	.	19.177	0.93605	0.0:1.0:0.0:0.0	.	473;438;375;321;438;473;473	O60506;O60506-2;B7Z645;O60506-5;O60506-4;O60506-3;B2R8Z8	HNRPQ_HUMAN;.;.;.;.;.;.	H	473	ENSP00000347380:D473H;ENSP00000358635:D473H	ENSP00000347380:D473H	D	-	1	0	SYNCRIP	86381648	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.087000	0.71362	2.528000	0.85240	0.563000	0.77884	GAT	SYNCRIP	-	tigrfam_HnRNP_R/Q_splicing_fac	ENSG00000135316		0.433	SYNCRIP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNCRIP	HGNC	protein_coding	OTTHUMT00000041396.1	-	0.00	76	0	C	NM_006372		86324929	-1	tier1	-	no_errors	ENST00000369622	ensembl	human	known	74_37	missense	25.58	64	22	SNP	1.000	G
SYNE1	23345	genome.wustl.edu	37	6	152730772	152730772	+	Silent	SNP	G	G	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr6:152730772G>T	ENST00000367255.5	-	43	6904	c.6303C>A	c.(6301-6303)gtC>gtA	p.V2101V	RNA5SP223_ENST00000365174.1_RNA|SYNE1_ENST00000341594.5_Silent_p.V2138V|SYNE1_ENST00000265368.4_Silent_p.V2101V|SYNE1_ENST00000423061.1_Silent_p.V2108V|SYNE1_ENST00000448038.1_Silent_p.V2108V	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	2101					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.V2101V(2)|p.V2108V(1)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CATTTTCTAAGACTTTAGATA	0.333										HNSCC(10;0.0054)																																							3	Substitution - coding silent(3)	lung(3)											97.0	94.0	95.0					6																	152730772		2203	4300	6503	SO:0001819	synonymous_variant	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.6303C>A	6.37:g.152730772G>T			E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Silent	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.V2101	ENST00000367255.5	37	c.6303	CCDS5236.2	6																																																																																			SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_Spectrin/alpha-actinin	ENSG00000131018		0.333	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2		0.00	40	0	G	NM_182961		152730772	-1			no_errors	ENST00000265368	ensembl	human	known	74_37	silent	5.08	56	3	SNP	0.762	T
TAF15	8148	genome.wustl.edu	37	17	34171853	34171853	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr17:34171853G>C	ENST00000588240.1	+	15	1665	c.1550G>C	c.(1549-1551)gGa>gCa	p.G517A	TAF15_ENST00000311979.3_Missense_Mutation_p.G514A|TAF15_ENST00000592237.1_Intron	NM_003487.3|NM_139215.2	NP_003478.1|NP_631961.1	Q16514	TAF12_HUMAN	TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa	0					chromatin organization (GO:0006325)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone H3 acetylation (GO:0043966)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of RNA biosynthetic process (GO:2001141)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)		TAF15/NR4A3(33)	lung(1)|ovary(1)|skin(2)|stomach(1)	5		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)		ggttatggaggagatcgagga	0.607			T	"""TEC, CHN1, ZNF384"""	"""extraskeletal myxoid chondrosarcomas, ALL"""																																			Dom	yes		17	17q11.1-q11.2	8148	"""TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa"""		"""L, M"""	0													84.0	78.0	80.0					17																	34171853		2203	4300	6503	SO:0001583	missense	0			U51334	CCDS32623.1, CCDS59279.1	17q11.1-q11.2	2013-02-12	2002-08-29	2001-12-07		ENSG00000270647		"""RNA binding motif (RRM) containing"""	11547	protein-coding gene	gene with protein product		601574	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, N, 68kD (RNA-binding protein 56)"""	TAF2N		8954779, 9795213	Standard	NM_003487		Approved	hTAFII68, RBP56, Npl3	uc002hkd.4	Q92804		ENST00000588240.1:c.1550G>C	17.37:g.34171853G>C	ENSP00000466950:p.Gly517Ala		D3DPM5|Q15775|Q5T077	Missense_Mutation	SNP	pfam_RRM_dom,pfam_Znf_RanBP2,smart_RRM_dom,smart_Znf_RanBP2,pfscan_Znf_RanBP2,pfscan_RRM_dom	p.G517A	ENST00000588240.1	37	c.1550	CCDS32623.1	17	.	.	.	.	.	.	.	.	.	.	G	14.55	2.567543	0.45694	.	.	ENSG00000172660	ENST00000311979;ENST00000536077	D	0.94828	-3.53	4.38	4.38	0.52667	.	.	.	.	.	D	0.91331	0.7266	N	0.22421	0.69	0.27266	N	0.95851	P;P	0.45474	0.779;0.859	B;P	0.44477	0.264;0.451	D	0.86909	0.2059	9	0.87932	D	0	-3.3403	15.2273	0.73361	0.0:0.0:1.0:0.0	.	517;514	Q92804;Q92804-2	RBP56_HUMAN;.	A	517;320	ENSP00000309558:G517A	ENSP00000309558:G517A	G	+	2	0	TAF15	31195966	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.961000	0.87903	2.384000	0.81235	0.591000	0.81541	GGA	TAF15	-	NULL	ENSG00000172660		0.607	TAF15-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TAF15	HGNC	protein_coding	OTTHUMT00000449134.1	-	0.00	51	0	G	NM_139215		34171853	+1	tier1	-	no_errors	ENST00000588240	ensembl	human	known	74_37	missense	14.29	36	6	SNP	1.000	C
TAS1R2	80834	genome.wustl.edu	37	1	19166648	19166648	+	Silent	SNP	G	G	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:19166648G>T	ENST00000375371.3	-	6	1986	c.1965C>A	c.(1963-1965)atC>atA	p.I655I		NM_152232.2	NP_689418.2	Q8TE23	TS1R2_HUMAN	taste receptor, type 1, member 2	655					detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|sensory perception of sweet taste (GO:0050916)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(10)|lung(14)|ovary(1)|pancreas(3)|prostate(1)|skin(3)|stomach(1)	45		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Aspartame(DB00168)	AGGCGCAGACGATCTGGAAAG	0.607																																																	0													124.0	128.0	126.0					1																	19166648		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS187.1	1p36.13	2012-08-22	2003-03-07		ENSG00000179002	ENSG00000179002		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14905	protein-coding gene	gene with protein product		606226	"""G protein-coupled receptor 71"""	GPR71			Standard	NM_152232		Approved	T1R2, TR2	uc001bba.1	Q8TE23	OTTHUMG00000002442	ENST00000375371.3:c.1965C>A	1.37:g.19166648G>T			Q5TZ19	Silent	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,superfamily_Peripla_BP_I,pfscan_GPCR_3_C,prints_GPCR_3	p.I655	ENST00000375371.3	37	c.1965	CCDS187.1	1																																																																																			TAS1R2	-	pfam_GPCR_3_C,pfscan_GPCR_3_C,prints_GPCR_3	ENSG00000179002		0.607	TAS1R2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	TAS1R2	HGNC	protein_coding	OTTHUMT00000006953.1	-	0.00	23	0	G			19166648	-1	tier1	-	no_errors	ENST00000375371	ensembl	human	novel	74_37	silent	38.89	22	14	SNP	0.968	T
TBC1D20	128637	genome.wustl.edu	37	20	418412	418412	+	3'UTR	SNP	T	T	C	rs553816000		TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr20:418412T>C	ENST00000354200.4	-	0	2177				TBC1D20_ENST00000461188.1_5'UTR	NM_144628.2	NP_653229.1	Q96BZ9	TBC20_HUMAN	TBC1 domain family, member 20						acrosome assembly (GO:0001675)|cargo loading into COPII-coated vesicle (GO:0090110)|ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi organization (GO:0007030)|lens fiber cell morphogenesis (GO:0070309)|lipid particle organization (GO:0034389)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|seminiferous tubule development (GO:0072520)|virion assembly (GO:0019068)	endoplasmic reticulum membrane (GO:0005789)|integral component of Golgi membrane (GO:0030173)|nuclear membrane (GO:0031965)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	12		all_epithelial(17;0.228)|Breast(17;0.231)				TGATGAGAACTATTTTTTTTT	0.303																																																	0													37.0	32.0	34.0					20																	418412		692	1590	2282	SO:0001624	3_prime_UTR_variant	0			AK055573	CCDS13002.1	20p13	2013-07-10	2005-01-05	2005-01-05	ENSG00000125875	ENSG00000125875			16133	protein-coding gene	gene with protein product		611663	"""chromosome 20 open reading frame 140"""	C20orf140		17901050	Standard	XM_005260661		Approved	dJ852M4.2	uc002wds.3	Q96BZ9	OTTHUMG00000031637	ENST00000354200.4:c.*818A>G	20.37:g.418412T>C			A8K6I3|B9A6M1|Q5JWQ7|Q6ZSY8|Q96NE1|Q9BYM7|Q9H140	RNA	SNP	-	NULL	ENST00000354200.4	37	NULL	CCDS13002.1	20																																																																																			TBC1D20	-	-	ENSG00000125875		0.303	TBC1D20-004	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D20	HGNC	protein_coding	OTTHUMT00000251397.2	-	0.00	195	0	T	NM_144628		418412	-1	tier1	-	no_errors	ENST00000461188	ensembl	human	known	74_37	rna	20.24	134	34	SNP	0.000	C
TBX15	6913	genome.wustl.edu	37	1	119467289	119467289	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:119467289C>G	ENST00000369429.3	-	4	682	c.673G>C	c.(673-675)Gag>Cag	p.E225Q	TBX15_ENST00000207157.3_Missense_Mutation_p.E119Q			Q96SF7	TBX15_HUMAN	T-box 15	225					embryonic cranial skeleton morphogenesis (GO:0048701)	Tle3-Aes complex (GO:0070722)	RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(19)|ovary(1)|pancreas(1)|skin(5)	37	all_neural(166;0.117)	all_cancers(81;0.000692)|all_lung(203;3.05e-06)|Lung NSC(69;2.13e-05)|all_epithelial(167;0.000237)		Lung(183;0.044)|LUSC - Lung squamous cell carcinoma(189;0.141)		TCATCCAACTCATTGTTGGTA	0.448																																																	0													153.0	145.0	148.0					1																	119467289		2203	4300	6503	SO:0001583	missense	0			AK127536	CCDS30816.1	1p11.1	2008-02-05	2004-10-05		ENSG00000092607	ENSG00000092607		"""T-boxes"""	11594	protein-coding gene	gene with protein product		604127	"""T-box 14"""	TBX14		9693034	Standard	XM_005271162		Approved		uc001ehl.1	Q96SF7	OTTHUMG00000012263	ENST00000369429.3:c.673G>C	1.37:g.119467289C>G	ENSP00000358437:p.Glu225Gln		Q08E76|Q5JT54|Q5T9S7	Missense_Mutation	SNP	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box,prints_TF_T-box	p.E119Q	ENST00000369429.3	37	c.355		1	.	.	.	.	.	.	.	.	.	.	C	29.0	4.970200	0.92855	.	.	ENSG00000092607	ENST00000207157;ENST00000369429	D;D	0.87966	-2.32;-2.32	5.96	5.96	0.96718	p53-like transcription factor, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.91352	0.7272	M	0.63428	1.95	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87437	0.2392	10	0.26408	T	0.33	.	20.422	0.99049	0.0:1.0:0.0:0.0	.	225	Q96SF7	TBX15_HUMAN	Q	119;225	ENSP00000207157:E119Q;ENSP00000358437:E225Q	ENSP00000207157:E119Q	E	-	1	0	TBX15	119268812	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.818000	0.86416	2.832000	0.97577	0.655000	0.94253	GAG	TBX15	-	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box	ENSG00000092607		0.448	TBX15-002	PUTATIVE	not_organism_supported|upstream_ATG|basic|appris_principal	protein_coding	TBX15	HGNC	protein_coding	OTTHUMT00000034351.1	-	0.00	97	0	C	NM_152380		119467289	-1	tier1	-	no_errors	ENST00000207157	ensembl	human	known	74_37	missense	17.02	78	16	SNP	1.000	G
TCHHL1	126637	genome.wustl.edu	37	1	152058803	152058803	+	Missense_Mutation	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:152058803C>T	ENST00000368806.1	-	3	1419	c.1355G>A	c.(1354-1356)gGa>gAa	p.G452E		NM_001008536.1	NP_001008536.1	Q5QJ38	TCHL1_HUMAN	trichohyalin-like 1	452							calcium ion binding (GO:0005509)			breast(4)|endometrium(1)|kidney(2)|large_intestine(9)|lung(33)|ovary(2)|prostate(1)|skin(7)|stomach(1)	60	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.246)			AGTCTGATCTCCTCCTTCTGA	0.438																																																	0													237.0	222.0	227.0					1																	152058803		2203	4300	6503	SO:0001583	missense	0				CCDS30857.1	1q21.3	2011-10-11	2004-10-05	2006-01-27	ENSG00000182898	ENSG00000182898		"""S100 calcium binding proteins"""	31796	protein-coding gene	gene with protein product			"""S100 calcium binding protein A17"""	S100A17, THHL1			Standard	NM_001008536		Approved		uc001ezo.1	Q5QJ38	OTTHUMG00000013058	ENST00000368806.1:c.1355G>A	1.37:g.152058803C>T	ENSP00000357796:p.Gly452Glu		B2RPK8|Q5VTJ9	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub	p.G452E	ENST00000368806.1	37	c.1355	CCDS30857.1	1	.	.	.	.	.	.	.	.	.	.	.	15.41	2.826764	0.50739	.	.	ENSG00000182898	ENST00000368806	T	0.30714	1.52	4.73	-2.51	0.06365	.	0.982201	0.08286	N	0.969232	T	0.05364	0.0142	L	0.52573	1.65	0.09310	N	1	B	0.18310	0.027	B	0.15870	0.014	T	0.33343	-0.9872	10	0.06236	T	0.91	0.0	0.9253	0.01324	0.2821:0.2677:0.2765:0.1737	.	452	Q5QJ38	TCHL1_HUMAN	E	452	ENSP00000357796:G452E	ENSP00000357796:G452E	G	-	2	0	TCHHL1	150325427	0.000000	0.05858	0.000000	0.03702	0.206000	0.24218	-0.068000	0.11561	-0.210000	0.10140	-0.315000	0.08773	GGA	TCHHL1	-	NULL	ENSG00000182898		0.438	TCHHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCHHL1	HGNC	protein_coding	OTTHUMT00000036638.2	-	0.00	47	0	C	XM_060104		152058803	-1	tier1	-	no_errors	ENST00000368806	ensembl	human	known	74_37	missense	32.00	51	24	SNP	0.000	T
TDRD15	100129278	genome.wustl.edu	37	2	21360952	21360952	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr2:21360952C>G	ENST00000405799.1	+	4	943	c.613C>G	c.(613-615)Cca>Gca	p.P205A				B5MCY1	TDR15_HUMAN	tudor domain containing 15	205							hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)										TCAACAAATGCCAGATTTATT	0.348																																																	0																																										SO:0001583	missense	0					2p24.1	2013-01-23	2013-01-23	2013-01-23	ENSG00000218819	ENSG00000218819		"""Tudor domain containing"""	45037	protein-coding gene	gene with protein product							Standard	XR_425376		Approved			B5MCY1	OTTHUMG00000151795	ENST00000405799.1:c.613C>G	2.37:g.21360952C>G	ENSP00000384376:p.Pro205Ala			Missense_Mutation	SNP	pfam_Tudor,superfamily_Staphylococal_nuclease_OB-fold,smart_Tudor,pfscan_Tudor	p.P205A	ENST00000405799.1	37	c.613		2	.	.	.	.	.	.	.	.	.	.	C	11.37	1.619681	0.28801	.	.	ENSG00000218819	ENST00000405799	T	0.18657	2.2	5.51	3.72	0.42706	.	.	.	.	.	T	0.12220	0.0297	.	.	.	.	.	.	.	.	.	.	.	.	T	0.14337	-1.0476	5	0.06365	T	0.9	-3.0323	12.1761	0.54186	0.0:0.8611:0.0:0.1389	.	.	.	.	A	205	ENSP00000384376:P205A	ENSP00000384376:P205A	P	+	1	0	AC010872.2	21214457	1.000000	0.71417	0.996000	0.52242	0.804000	0.45430	3.561000	0.53770	0.693000	0.31634	0.544000	0.68410	CCA	TDRD15	-	NULL	ENSG00000218819		0.348	TDRD15-001	NOVEL	basic|appris_principal|exp_conf	protein_coding	TDRD15	HGNC	protein_coding	OTTHUMT00000323948.1	-	0.00	97	0	C			21360952	+1	tier1	-	no_errors	ENST00000405799	ensembl	human	novel	74_37	missense	9.71	93	10	SNP	0.998	G
TECPR1	25851	genome.wustl.edu	37	7	97862900	97862900	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr7:97862900G>C	ENST00000447648.2	-	11	1804	c.1505C>G	c.(1504-1506)tCg>tGg	p.S502W	TECPR1_ENST00000542604.1_Missense_Mutation_p.S432W|TECPR1_ENST00000379795.3_Missense_Mutation_p.S502W			Q7Z6L1	TCPR1_HUMAN	tectonin beta-propeller repeat containing 1	502					autophagic vacuole fusion (GO:0000046)|autophagy (GO:0006914)	autophagic vacuole membrane (GO:0000421)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	phosphatidylinositol-3-phosphate binding (GO:0032266)			central_nervous_system(2)|endometrium(8)|kidney(1)|large_intestine(1)|lung(9)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						GCCAGCGGCCGAGTGGCTGGG	0.692																																																	0																																										SO:0001583	missense	0				CCDS47648.1	7q21.3	2009-01-30			ENSG00000205356	ENSG00000205356			22214	protein-coding gene	gene with protein product		614781					Standard	NM_015395		Approved	DKFZP434B0335, FLJ23419, FLJ90593, KIAA1358	uc003upg.4	Q7Z6L1	OTTHUMG00000154273	ENST00000447648.2:c.1505C>G	7.37:g.97862900G>C	ENSP00000404923:p.Ser502Trp		A8KAD1|B3KPZ1|C9J024|F5GX57|Q96EB0|Q9P2I9|Q9UFR6	Missense_Mutation	SNP	pfam_Beta-propeller_rpt_TECPR,superfamily_RCC1/BLIP-II,smart_Beta-propeller_rpt_TECPR,smart_Peroxin/Ferlin	p.S502W	ENST00000447648.2	37	c.1505	CCDS47648.1	7	.	.	.	.	.	.	.	.	.	.	G	13.06	2.125325	0.37533	.	.	ENSG00000205356	ENST00000447648;ENST00000379795;ENST00000542604	T;T;T	0.34275	1.37;1.37;1.38	4.7	2.84	0.33178	.	1.356910	0.04568	N	0.392757	T	0.46308	0.1386	L	0.38175	1.15	0.09310	N	0.999999	D;D	0.62365	0.991;0.963	P;P	0.57283	0.817;0.543	T	0.29610	-1.0006	10	0.72032	D	0.01	0.0049	8.4783	0.33027	0.0817:0.0:0.766:0.1523	.	432;502	F5GX57;Q7Z6L1	.;TCPR1_HUMAN	W	502;502;432	ENSP00000404923:S502W;ENSP00000369121:S502W;ENSP00000441121:S432W	ENSP00000369121:S502W	S	-	2	0	TECPR1	97700836	0.969000	0.33509	0.000000	0.03702	0.357000	0.29423	4.444000	0.60001	0.392000	0.25172	-0.448000	0.05591	TCG	TECPR1	-	NULL	ENSG00000205356		0.692	TECPR1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TECPR1	HGNC	protein_coding	OTTHUMT00000334661.1	-	0.00	17	0	G	NM_015395		97862900	-1	tier1	-	no_errors	ENST00000379795	ensembl	human	known	74_37	missense	33.33	14	7	SNP	0.028	C
TERT	7015	genome.wustl.edu	37	5	1264696	1264696	+	Missense_Mutation	SNP	C	C	T	rs532158398		TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr5:1264696C>T	ENST00000310581.5	-	11	2723	c.2666G>A	c.(2665-2667)cGa>cAa	p.R889Q	TERT_ENST00000296820.5_3'UTR|TERT_ENST00000334602.6_Intron	NM_001193376.1|NM_198253.2	NP_001180305.1|NP_937983.2	O14746	TERT_HUMAN	telomerase reverse transcriptase	889	Reverse transcriptase. {ECO:0000255|PROSITE-ProRule:PRU00405}.				DNA strand elongation (GO:0022616)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|replicative senescence (GO:0090399)|telomere formation via telomerase (GO:0032203)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|telomerase holoenzyme complex (GO:0005697)	metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|telomerase activity (GO:0003720)|telomeric DNA binding (GO:0042162)|telomeric RNA binding (GO:0070034)|telomeric template RNA reverse transcriptase activity (GO:0003721)	p.R877Q(1)|p.R889Q(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|kidney(4)|large_intestine(3)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	41	all_cancers(3;3.17e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.87e-10)		Epithelial(17;0.00105)|all cancers(22;0.00178)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)		Zidovudine(DB00495)	AGGGACACCTCGGACCAGGGT	0.577									TERT Mutation-Associated Haematological Disorders;Pulmonary Fibrosis, Idiopathic;Congenital Dyskeratosis																																								2	Substitution - Missense(2)	lung(2)											72.0	78.0	76.0					5																	1264696		2102	4227	6329	SO:0001583	missense	0	Familial Cancer Database	;Hamman-Rich syndrome, Fibrocystic Pulmonary Dysplasia;Zinsser-Engman-Cole syndrome, Dyskeratosis Congenita	AF015950	CCDS3861.2, CCDS54831.1	5p15.33	2014-09-17			ENSG00000164362	ENSG00000164362			11730	protein-coding gene	gene with protein product		187270				9252327	Standard	NM_198253		Approved	TRT, TP2, TCS1, hEST2, EST2	uc003jcb.1	O14746	OTTHUMG00000090357	ENST00000310581.5:c.2666G>A	5.37:g.1264696C>T	ENSP00000309572:p.Arg889Gln		O14783|Q2XS35|Q8N6C3|Q8NG38|Q8NG46	Missense_Mutation	SNP	pfam_Telomerase_RBD,pfam_RVT,smart_Telomerase_RBD,pfscan_RVT,prints_Telomerase_RT	p.R889Q	ENST00000310581.5	37	c.2666	CCDS3861.2	5	.	.	.	.	.	.	.	.	.	.	C	3.550	-0.091861	0.07053	.	.	ENSG00000164362	ENST00000310581	D	0.97688	-4.49	4.09	-3.4	0.04853	Reverse transcriptase (2);	1.624070	0.03744	N	0.255471	D	0.94128	0.8117	L	0.58101	1.795	0.09310	N	1	P	0.36753	0.568	B	0.24394	0.053	D	0.87595	0.2493	10	0.13470	T	0.59	-12.0054	8.0136	0.30368	0.1302:0.1284:0.0:0.7414	.	889	O14746	TERT_HUMAN	Q	889	ENSP00000309572:R889Q	ENSP00000309572:R889Q	R	-	2	0	TERT	1317696	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.319000	0.08039	-0.558000	0.06118	-0.480000	0.04831	CGA	TERT	-	pfam_RVT,pfscan_RVT	ENSG00000164362		0.577	TERT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TERT	HGNC	protein_coding	OTTHUMT00000206729.2	-	0.00	58	0	C			1264696	-1	tier1	-	no_errors	ENST00000310581	ensembl	human	known	74_37	missense	5.52	137	8	SNP	0.000	T
TGS1	96764	genome.wustl.edu	37	8	56695312	56695312	+	Missense_Mutation	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr8:56695312G>A	ENST00000260129.5	+	2	584	c.107G>A	c.(106-108)cGa>cAa	p.R36Q		NM_024831.6	NP_079107.6	Q96RS0	TGS1_HUMAN	trimethylguanosine synthase 1	36					7-methylguanosine cap hypermethylation (GO:0036261)|7-methylguanosine RNA capping (GO:0009452)|cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|regulation of transcription, DNA-templated (GO:0006355)|ribonucleoprotein complex biogenesis (GO:0022613)|ribonucleoprotein complex import into nucleus (GO:0071167)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spliceosomal snRNP assembly (GO:0000387)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|small nuclear ribonucleoprotein complex (GO:0030532)	RNA trimethylguanosine synthase activity (GO:0071164)			breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(10)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		all_lung(136;0.119)|all_epithelial(80;0.125)|Lung NSC(129;0.147)	Epithelial(17;0.00027)|all cancers(17;0.00251)			CGCAGGGATCGAAAATTGTAC	0.313																																					Esophageal Squamous(34;275 823 4842 34837 48447)												0													72.0	80.0	77.0					8																	56695312		2203	4299	6502	SO:0001583	missense	0			AY028423	CCDS34894.1	8q11	2010-06-25	2010-06-25	2006-11-27	ENSG00000137574	ENSG00000137574	2.1.1.-		17843	protein-coding gene	gene with protein product		606461	"""nuclear receptor coactivator 6 interacting protein"", ""trimethylguanosine synthase homolog (S. cerevisiae)"""	NCOA6IP		11517327, 11983179, 19307714	Standard	NM_024831		Approved	PIMT	uc003xsj.4	Q96RS0	OTTHUMG00000164294	ENST00000260129.5:c.107G>A	8.37:g.56695312G>A	ENSP00000260129:p.Arg36Gln		A6NJQ5|Q5GH23|Q8TDG9|Q96QU3|Q9H5V3	Missense_Mutation	SNP	pfam_RNA_cap_Gua-N2-MeTrfase,pfam_RNA_methylase_dom,pfam_tRNA_Trfase_Trm5/Tyw2	p.R36Q	ENST00000260129.5	37	c.107	CCDS34894.1	8	.	.	.	.	.	.	.	.	.	.	G	23.7	4.442574	0.83993	.	.	ENSG00000137574	ENST00000260129	T	0.16897	2.31	5.16	5.16	0.70880	.	0.194769	0.33875	N	0.004467	T	0.41949	0.1181	M	0.76574	2.34	0.44409	D	0.997324	D	0.89917	1.0	D	0.65140	0.932	T	0.33777	-0.9855	10	0.72032	D	0.01	-13.8235	17.1982	0.86899	0.0:0.0:1.0:0.0	.	36	Q96RS0	TGS1_HUMAN	Q	36	ENSP00000260129:R36Q	ENSP00000260129:R36Q	R	+	2	0	TGS1	56857866	1.000000	0.71417	1.000000	0.80357	0.672000	0.39443	6.713000	0.74686	2.559000	0.86315	0.563000	0.77884	CGA	TGS1	-	NULL	ENSG00000137574		0.313	TGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGS1	HGNC	protein_coding	OTTHUMT00000378152.1	-	0.00	134	0	G	NM_024831		56695312	+1	tier1	-	no_errors	ENST00000260129	ensembl	human	known	74_37	missense	20.99	127	34	SNP	1.000	A
THAP9	79725	genome.wustl.edu	37	4	83821902	83821902	+	5'Flank	SNP	C	C	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr4:83821902C>A	ENST00000302236.5	+	0	0				THAP9-AS1_ENST00000511271.1_RNA|THAP9-AS1_ENST00000504792.2_RNA|THAP9-AS1_ENST00000504718.1_RNA|SEC31A_ENST00000355196.2_5'Flank|THAP9-AS1_ENST00000504869.1_RNA|THAP9-AS1_ENST00000505028.1_RNA|THAP9-AS1_ENST00000507660.1_RNA|THAP9-AS1_ENST00000512932.1_RNA|THAP9-AS1_ENST00000504520.2_RNA|THAP9-AS1_ENST00000508772.1_RNA|THAP9-AS1_ENST00000509007.1_RNA|THAP9-AS1_ENST00000513581.1_RNA|THAP9-AS1_ENST00000503704.1_RNA	NM_024672.4	NP_078948.3	Q9H5L6	THAP9_HUMAN	THAP domain containing 9						DNA integration (GO:0015074)|DNA recombination (GO:0006310)|transposition, DNA-mediated (GO:0006313)		metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|transferase activity (GO:0016740)|transposase activity (GO:0004803)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(13)|lung(5)|ovary(2)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(3)	33		Hepatocellular(203;0.114)				CTAAAGTGGTCGTGATTCATG	0.597																																																	0													15.0	22.0	20.0					4																	83821902		692	1589	2281	SO:0001631	upstream_gene_variant	0			AK091412	CCDS3598.1	4q21.3	2013-01-25			ENSG00000168152	ENSG00000168152		"""THAP (C2CH-type zinc finger) domain containing"""	23192	protein-coding gene	gene with protein product		612537				12575992	Standard	NM_024672		Approved	FLJ34093	uc003hnt.2	Q9H5L6	OTTHUMG00000130291		4.37:g.83821902C>A	Exception_encountered		B3KRE2|Q59AC9	RNA	SNP	-	NULL	ENST00000302236.5	37	NULL	CCDS3598.1	4																																																																																			THAP9-AS1	-	-	ENSG00000251022		0.597	THAP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THAP9-AS1	HGNC	protein_coding	OTTHUMT00000252633.1	-	0.00	118	0	C	NM_024672		83821902	-1	tier1	-	no_errors	ENST00000504520	ensembl	human	known	74_37	rna	33.33	88	44	SNP	0.000	A
TIMELESS	8914	genome.wustl.edu	37	12	56826260	56826260	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr12:56826260G>T	ENST00000553532.1	-	7	730	c.580C>A	c.(580-582)Cac>Aac	p.H194N	TIMELESS_ENST00000554616.1_Missense_Mutation_p.H194N|TIMELESS_ENST00000229201.4_Missense_Mutation_p.H193N					timeless circadian clock											NS(1)|breast(2)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(8)|lung(14)|ovary(7)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	49						CCGCTGAGGTGAATCGCCCAG	0.547																																																	0													113.0	107.0	109.0					12																	56826260		2203	4300	6503	SO:0001583	missense	0			AF098162	CCDS8918.1	12q13.3	2012-12-14	2012-12-14		ENSG00000111602	ENSG00000111602			11813	protein-coding gene	gene with protein product	"""Tof1 homolog (S. cerevisiae)"", ""timeless circadian clock 1"""	603887	"""timeless (Drosophila) homolog"", ""timeless homolog (Drosophila)"""			9856465	Standard	NM_003920		Approved	hTIM, TIM, TIM1	uc001slf.2	Q9UNS1	OTTHUMG00000170600	ENST00000553532.1:c.580C>A	12.37:g.56826260G>T	ENSP00000450607:p.His194Asn			Missense_Mutation	SNP	pfam_TIMELESS_C,pfam_Timeless	p.H194N	ENST00000553532.1	37	c.580	CCDS8918.1	12	.	.	.	.	.	.	.	.	.	.	G	26.5	4.740426	0.89573	.	.	ENSG00000111602	ENST00000229201;ENST00000553532;ENST00000554616	T;T;T	0.66099	-0.19;-0.19;0.88	5.21	5.21	0.72293	Timeless protein (1);	0.000000	0.85682	D	0.000000	T	0.75148	0.3810	M	0.77820	2.39	0.80722	D	1	D;D	0.58970	0.98;0.984	P;P	0.56216	0.69;0.794	T	0.74025	-0.3797	10	0.32370	T	0.25	-22.95	17.9104	0.88932	0.0:0.0:1.0:0.0	.	193;194	Q9UNS1-2;Q9UNS1	.;TIM_HUMAN	N	193;194;194	ENSP00000229201:H193N;ENSP00000450607:H194N;ENSP00000450848:H194N	ENSP00000229201:H194N	H	-	1	0	TIMELESS	55112527	1.000000	0.71417	0.961000	0.40146	0.945000	0.59286	9.336000	0.96533	2.619000	0.88677	0.462000	0.41574	CAC	TIMELESS	-	pfam_Timeless	ENSG00000111602		0.547	TIMELESS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TIMELESS	HGNC	protein_coding	OTTHUMT00000409771.1	-	0.00	30	0	G	NM_003920		56826260	-1	tier1	-	no_errors	ENST00000553532	ensembl	human	known	74_37	missense	25.00	33	11	SNP	1.000	T
TMC1	117531	genome.wustl.edu	37	9	75263520	75263520	+	5'UTR	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr9:75263520C>G	ENST00000297784.5	+	0	496				TMC1_ENST00000340019.3_5'UTR|TMC1_ENST00000396237.3_5'Flank	NM_138691.2	NP_619636.2	Q8TDI8	TMC1_HUMAN	transmembrane channel-like 1						auditory receptor cell development (GO:0060117)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|vestibular reflex (GO:0060005)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|stereocilium bundle tip (GO:0032426)	voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(21)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	36						CAGTCCCTCTCCAAACTAGCC	0.478																																					Pancreas(75;173 1345 14232 34245 43413)												0													124.0	123.0	123.0					9																	75263520		2203	4300	6503	SO:0001623	5_prime_UTR_variant	0			AF417578	CCDS6643.1	9q21	2014-01-28			ENSG00000165091	ENSG00000165091			16513	protein-coding gene	gene with protein product		606706	"""transmembrane, cochlear expressed, 1"""	DFNA36, DFNB7, DFNB11		11850618, 11850623	Standard	NM_138691		Approved		uc004aiz.1	Q8TDI8	OTTHUMG00000020014	ENST00000297784.5:c.-45C>G	9.37:g.75263520C>G			A8MVZ2|B1AM91	RNA	SNP	-	NULL	ENST00000297784.5	37	NULL	CCDS6643.1	9																																																																																			TMC1	-	-	ENSG00000165091		0.478	TMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMC1	HGNC	protein_coding	OTTHUMT00000052655.1	-	0.00	62	0	C			75263520	+1	tier1	-	no_errors	ENST00000492418	ensembl	human	known	74_37	rna	18.64	47	11	SNP	0.000	G
TMC1	117531	genome.wustl.edu	37	9	75451136	75451137	+	3'UTR	INS	-	-	T	rs71495343|rs78220845		TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr9:75451136_75451137insT	ENST00000297784.5	+	0	3070_3071				TMC1_ENST00000340019.3_3'UTR|TMC1_ENST00000486417.1_3'UTR	NM_138691.2	NP_619636.2	Q8TDI8	TMC1_HUMAN	transmembrane channel-like 1						auditory receptor cell development (GO:0060117)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|vestibular reflex (GO:0060005)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|stereocilium bundle tip (GO:0032426)	voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(21)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	36						CATTTCGTGACTTTTTTTTTTT	0.356																																					Pancreas(75;173 1345 14232 34245 43413)												0																																										SO:0001624	3_prime_UTR_variant	0			AF417578	CCDS6643.1	9q21	2014-01-28			ENSG00000165091	ENSG00000165091			16513	protein-coding gene	gene with protein product		606706	"""transmembrane, cochlear expressed, 1"""	DFNA36, DFNB7, DFNB11		11850618, 11850623	Standard	NM_138691		Approved		uc004aiz.1	Q8TDI8	OTTHUMG00000020014	ENST00000297784.5:c.*248->T	9.37:g.75451147_75451147dupT			A8MVZ2|B1AM91	RNA	INS	-	NULL	ENST00000297784.5	37	NULL	CCDS6643.1	9																																																																																			TMC1	-	-	ENSG00000165091		0.356	TMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMC1	HGNC	protein_coding	OTTHUMT00000052655.1		0.00	11	0	-			75451137	+1	tier1		no_errors	ENST00000486417	ensembl	human	known	74_37	rna	22.73	17	5	INS	0.000:0.000	T
TMC2	117532	genome.wustl.edu	37	20	2597825	2597825	+	Missense_Mutation	SNP	A	A	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr20:2597825A>G	ENST00000358864.1	+	16	2063	c.2048A>G	c.(2047-2049)gAa>gGa	p.E683G	TMC2_ENST00000496948.1_3'UTR	NM_080751.2	NP_542789.2	Q8TDI7	TMC2_HUMAN	transmembrane channel-like 2	683					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|vestibular reflex (GO:0060005)	integral component of membrane (GO:0016021)|stereocilium bundle tip (GO:0032426)	voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(3)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(14)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35						GTACCCCATGAACGCGTGTTC	0.582																																																	0													194.0	135.0	155.0					20																	2597825		2203	4300	6503	SO:0001583	missense	0			AF417580	CCDS13029.2	20p13	2010-08-05	2003-02-23		ENSG00000149488	ENSG00000149488			16527	protein-coding gene	gene with protein product		606707	"""transmembrane, cochlear expressed, 2"""	C20orf145		11850618, 12906855	Standard	XM_005260660		Approved	dJ686C3.3	uc002wgf.1	Q8TDI7	OTTHUMG00000031698	ENST00000358864.1:c.2048A>G	20.37:g.2597825A>G	ENSP00000351732:p.Glu683Gly		Q5JXT0|Q5JXT1|Q6UWW4|Q6ZS41|Q8N9F3|Q9BYN2|Q9BYN3|Q9BYN4|Q9BYN5	Missense_Mutation	SNP	pfam_TMC	p.E683G	ENST00000358864.1	37	c.2048	CCDS13029.2	20	.	.	.	.	.	.	.	.	.	.	A	22.0	4.226610	0.79576	.	.	ENSG00000149488	ENST00000358864	T	0.65178	-0.14	5.35	4.23	0.50019	.	0.095322	0.64402	D	0.000001	T	0.74680	0.3748	M	0.73962	2.25	0.47123	D	0.999326	D	0.55605	0.972	D	0.62955	0.909	T	0.75328	-0.3356	10	0.54805	T	0.06	-12.9998	10.8068	0.46522	0.8407:0.1593:0.0:0.0	.	683	Q8TDI7	TMC2_HUMAN	G	683	ENSP00000351732:E683G	ENSP00000351732:E683G	E	+	2	0	TMC2	2545825	0.998000	0.40836	0.922000	0.36590	0.944000	0.59088	3.638000	0.54332	0.937000	0.37394	0.528000	0.53228	GAA	TMC2	-	pfam_TMC	ENSG00000149488		0.582	TMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMC2	HGNC	protein_coding	OTTHUMT00000077601.2	-	0.00	52	0	A			2597825	+1	tier1	-	no_errors	ENST00000358864	ensembl	human	known	74_37	missense	47.50	21	19	SNP	1.000	G
TMEM154	201799	genome.wustl.edu	37	4	153564270	153564270	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr4:153564270C>G	ENST00000304385.3	-	5	679	c.448G>C	c.(448-450)Gat>Cat	p.D150H		NM_152680.2	NP_689893.1	Q6P9G4	TM154_HUMAN	transmembrane protein 154	150						integral component of membrane (GO:0016021)				kidney(2)|large_intestine(1)	3	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.138)				ATCCATTTATCAAGCTCTTCC	0.343																																																	0													185.0	179.0	181.0					4																	153564270		2202	4300	6502	SO:0001583	missense	0			AK056590	CCDS3779.1	4q31.3	2008-02-05			ENSG00000170006	ENSG00000170006			26489	protein-coding gene	gene with protein product						12477932	Standard	NM_152680		Approved	FLJ32028	uc003imw.2	Q6P9G4	OTTHUMG00000161463	ENST00000304385.3:c.448G>C	4.37:g.153564270C>G	ENSP00000302144:p.Asp150His		Q8WUT7|Q96MQ8	Missense_Mutation	SNP	NULL	p.D150H	ENST00000304385.3	37	c.448	CCDS3779.1	4	.	.	.	.	.	.	.	.	.	.	C	22.3	4.266487	0.80358	.	.	ENSG00000170006	ENST00000304385	T	0.54279	0.58	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	T	0.70789	0.3264	L	0.59436	1.845	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.71159	-0.4674	10	0.87932	D	0	-9.2075	18.0311	0.89285	0.0:1.0:0.0:0.0	.	150	Q6P9G4	TM154_HUMAN	H	150	ENSP00000302144:D150H	ENSP00000302144:D150H	D	-	1	0	TMEM154	153783720	0.998000	0.40836	0.978000	0.43139	0.985000	0.73830	4.906000	0.63293	2.857000	0.98124	0.650000	0.86243	GAT	TMEM154	-	NULL	ENSG00000170006		0.343	TMEM154-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM154	HGNC	protein_coding	OTTHUMT00000365024.1	-	0.00	79	0	C	NM_152680		153564270	-1	tier1	-	no_errors	ENST00000304385	ensembl	human	known	74_37	missense	27.85	57	22	SNP	1.000	G
TMEM181	57583	genome.wustl.edu	37	6	159006381	159006381	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr6:159006381G>T	ENST00000367090.3	+	5	727	c.716G>T	c.(715-717)gGt>gTt	p.G239V		NM_020823.1	NP_065874.1	Q9P2C4	TM181_HUMAN	transmembrane protein 181	239					pathogenesis (GO:0009405)	integral component of membrane (GO:0016021)	toxic substance binding (GO:0015643)			central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|skin(1)	22		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;8.15e-18)|BRCA - Breast invasive adenocarcinoma(81;1.38e-05)		AAAGTCGATGGTGTAGCTCAA	0.453																																																	0													97.0	89.0	91.0					6																	159006381		1931	4129	6060	SO:0001583	missense	0			AB037844	CCDS43520.1	6q25.3	2012-08-10	2006-10-19	2006-10-19	ENSG00000146433	ENSG00000146433			20958	protein-coding gene	gene with protein product		613209	"""G protein-coupled receptor 178"", ""KIAA1423"""	KIAA1423, GPR178		16452613	Standard	NM_020823		Approved		uc003qrm.4	Q9P2C4	OTTHUMG00000015913	ENST00000367090.3:c.716G>T	6.37:g.159006381G>T	ENSP00000356057:p.Gly239Val		Q5VTU1	Missense_Mutation	SNP	NULL	p.G239V	ENST00000367090.3	37	c.716	CCDS43520.1	6	.	.	.	.	.	.	.	.	.	.	G	22.0	4.231521	0.79688	.	.	ENSG00000146433	ENST00000314630;ENST00000367090	.	.	.	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.75087	0.3802	M	0.74881	2.28	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.75020	0.985;0.974	T	0.76575	-0.2909	9	0.59425	D	0.04	.	17.1951	0.86891	0.0:0.0:1.0:0.0	.	239;150	Q9P2C4;Q8N4V6	TM181_HUMAN;.	V	146;239	.	ENSP00000323755:G146V	G	+	2	0	TMEM181	158926369	1.000000	0.71417	0.455000	0.27031	0.993000	0.82548	5.605000	0.67634	2.657000	0.90304	0.655000	0.94253	GGT	TMEM181	-	NULL	ENSG00000146433		0.453	TMEM181-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM181	HGNC	protein_coding	OTTHUMT00000042873.1	-	0.00	36	0	G	NM_020823		159006381	+1	tier1	-	no_errors	ENST00000367090	ensembl	human	known	74_37	missense	7.55	49	4	SNP	0.983	T
TMPRSS7	344805	genome.wustl.edu	37	3	111799855	111799855	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr3:111799855C>G	ENST00000452346.2	+	18	2459	c.2456C>G	c.(2455-2457)cCa>cGa	p.P819R	TMPRSS7_ENST00000419127.1_Missense_Mutation_p.P693R			Q7RTY8	TMPS7_HUMAN	transmembrane protease, serine 7	819	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(2)|endometrium(6)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	34						AGTGGACGACCAAACTTTCCT	0.408																																																	0													231.0	230.0	231.0					3																	111799855		1993	4173	6166	SO:0001583	missense	0			BN000125	CCDS43129.2	3q13.2	2010-04-13	2004-03-16		ENSG00000176040	ENSG00000176040		"""Serine peptidases / Transmembrane"""	30846	protein-coding gene	gene with protein product			"""type II transmembrane serine protease 7"""			12838346	Standard	NM_001042575		Approved		uc010hqb.2	Q7RTY8	OTTHUMG00000157148	ENST00000452346.2:c.2456C>G	3.37:g.111799855C>G	ENSP00000398236:p.Pro819Arg		C9J8P7|E9PAS3|Q17RH4	Missense_Mutation	SNP	pfam_Peptidase_S1,pfam_SEA_dom,pfam_LDrepeatLR_classA_rpt,pfam_CUB_dom,superfamily_Trypsin-like_Pept_dom,superfamily_CUB_dom,superfamily_LDrepeatLR_classA_rpt,smart_CUB_dom,smart_LDrepeatLR_classA_rpt,smart_Peptidase_S1,pfscan_CUB_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_Peptidase_S1,prints_Peptidase_S1A,prints_LDrepeatLR_classA_rpt	p.P693R	ENST00000452346.2	37	c.2078		3	.	.	.	.	.	.	.	.	.	.	C	9.710	1.156910	0.21454	.	.	ENSG00000176040	ENST00000452346;ENST00000443106;ENST00000437906;ENST00000419127	D;D	0.88975	-2.45;-2.45	5.75	4.88	0.63580	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.121201	0.56097	N	0.000030	D	0.90263	0.6955	L	0.52011	1.625	0.48135	D	0.999592	D;D	0.60575	0.983;0.988	P;P	0.61800	0.867;0.894	D	0.87222	0.2254	10	0.06236	T	0.91	.	15.9464	0.79796	0.0:0.8645:0.1355:0.0	.	819;693	Q7RTY8;Q7RTY8-2	TMPS7_HUMAN;.	R	819;807;793;693	ENSP00000398236:P819R;ENSP00000411645:P693R	ENSP00000411645:P693R	P	+	2	0	TMPRSS7	113282545	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	5.396000	0.66297	1.456000	0.47831	-0.133000	0.14855	CCA	TMPRSS7	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1	ENSG00000176040		0.408	TMPRSS7-003	NOVEL	NAGNAG_splice_site|not_organism_supported|basic|exp_conf	protein_coding	TMPRSS7	HGNC	protein_coding	OTTHUMT00000347592.2	-	0.00	67	0	C	XM_293599		111799855	+1	tier1	-	no_errors	ENST00000419127	ensembl	human	known	74_37	missense	7.79	71	6	SNP	1.000	G
TMTC4	84899	genome.wustl.edu	37	13	101266675	101266675	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr13:101266675G>C	ENST00000376234.3	-	15	1978	c.1789C>G	c.(1789-1791)Ctc>Gtc	p.L597V	TMTC4_ENST00000328767.5_Missense_Mutation_p.L486V|TMTC4_ENST00000342624.5_Missense_Mutation_p.L616V	NM_001079669.1	NP_001073137.1	Q5T4D3	TMTC4_HUMAN	transmembrane and tetratricopeptide repeat containing 4	597						integral component of membrane (GO:0016021)				breast(3)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(14)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					TGGCGATTGAGATCTGCATAC	0.398																																																	0													132.0	117.0	122.0					13																	101266675		2203	4300	6503	SO:0001583	missense	0				CCDS9497.2, CCDS41904.1, CCDS66575.1	13q32.3	2013-01-10	2006-01-06		ENSG00000125247	ENSG00000125247		"""Tetratricopeptide (TTC) repeat domain containing"""	25904	protein-coding gene	gene with protein product							Standard	XM_005254082		Approved	FLJ14624, FLJ22153	uc001vot.3	Q5T4D3	OTTHUMG00000017289	ENST00000376234.3:c.1789C>G	13.37:g.101266675G>C	ENSP00000365408:p.Leu597Val		A6NLI7|B7Z666|Q5T4D4|Q5T4D5|Q5T4D6|Q8WV63|Q96SU8	Missense_Mutation	SNP	pfam_TPR_1,pfam_DUF1736,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.L616V	ENST00000376234.3	37	c.1846	CCDS41904.1	13	.	.	.	.	.	.	.	.	.	.	G	13.68	2.308884	0.40895	.	.	ENSG00000125247	ENST00000376234;ENST00000342624;ENST00000328767	T;T;T	0.64438	-0.1;-0.1;-0.1	5.53	4.56	0.56223	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.139379	0.47852	D	0.000205	T	0.65165	0.2665	M	0.62088	1.915	0.39374	D	0.966138	P;P;P	0.48294	0.908;0.605;0.72	P;B;B	0.51101	0.659;0.309;0.34	T	0.64457	-0.6403	10	0.33141	T	0.24	.	9.9816	0.41817	0.1522:0.0:0.8478:0.0	.	486;597;616	B7Z666;Q5T4D3;Q5T4D3-3	.;TMTC4_HUMAN;.	V	597;616;486	ENSP00000365408:L597V;ENSP00000343871:L616V;ENSP00000365409:L486V	ENSP00000365409:L486V	L	-	1	0	TMTC4	100064676	1.000000	0.71417	0.942000	0.38095	0.466000	0.32739	4.211000	0.58507	2.587000	0.87381	0.561000	0.74099	CTC	TMTC4	-	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000125247		0.398	TMTC4-004	KNOWN	basic|appris_principal|CCDS	protein_coding	TMTC4	HGNC	protein_coding	OTTHUMT00000045649.2	-	0.00	48	0	G	NM_032813		101266675	-1	tier1	-	no_errors	ENST00000342624	ensembl	human	known	74_37	missense	19.61	41	10	SNP	0.983	C
TNS3	64759	genome.wustl.edu	37	7	47323459	47323459	+	Silent	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr7:47323459G>A	ENST00000398879.1	-	28	4299	c.3933C>T	c.(3931-3933)tgC>tgT	p.C1311C	TNS3_ENST00000355730.3_Silent_p.C1071C|TNS3_ENST00000311160.9_Silent_p.C1311C			Q68CZ2	TENS3_HUMAN	tensin 3	1311					cell migration (GO:0016477)|lung alveolus development (GO:0048286)|positive regulation of cell proliferation (GO:0008284)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)				NS(1)|autonomic_ganglia(1)|breast(17)|endometrium(5)|kidney(4)|large_intestine(7)|liver(1)|lung(16)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	64						ACCACACATTGCAGGCTGGAA	0.552																																																	0													73.0	76.0	75.0					7																	47323459		2100	4240	6340	SO:0001819	synonymous_variant	0			AF378756	CCDS5506.2	7p12.3	2013-02-14	2005-05-13	2005-05-13	ENSG00000136205	ENSG00000136205		"""SH2 domain containing"""	21616	protein-coding gene	gene with protein product	"""tumor endothelial marker 6"""	606825	"""tensin-like SH2 domain-containing 1"""	TENS1		11559528	Standard	NM_022748		Approved	TEM6, H_NH0549I23.2, FLJ13732	uc003tnw.3	Q68CZ2	OTTHUMG00000074075	ENST00000398879.1:c.3933C>T	7.37:g.47323459G>A			B2RNV1|Q6IPQ2|Q8IZW7|Q8NAD0|Q96PE0|Q96S48	Silent	SNP	pfam_PTB,pfam_Tensin_phosphatase_C2-dom,pfam_SH2,superfamily_C2_dom,smart_Tyr_Pase_cat,smart_SH2,smart_PTB/PI_dom,pfscan_SH2,pfscan_Tyr/Dual-sp_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.C1311	ENST00000398879.1	37	c.3933	CCDS5506.2	7																																																																																			TNS3	-	pfam_PTB,smart_PTB/PI_dom	ENSG00000136205		0.552	TNS3-202	KNOWN	basic|appris_principal|CCDS	protein_coding	TNS3	HGNC	protein_coding	OTTHUMT00000157253.1	-	0.00	29	0	G	NM_022748		47323459	-1	tier1	-	no_errors	ENST00000311160	ensembl	human	known	74_37	silent	11.11	32	4	SNP	1.000	A
TOMM70A	9868	genome.wustl.edu	37	3	100086940	100086940	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr3:100086940C>G	ENST00000284320.5	-	11	2069	c.1621G>C	c.(1621-1623)Gac>Cac	p.D541H		NM_014820.4	NP_055635.3	O94826	TOM70_HUMAN	translocase of outer mitochondrial membrane 70 homolog A (S. cerevisiae)	541					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)|protein transmembrane transport (GO:0071806)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane translocase complex (GO:0005742)|mitochondrion (GO:0005739)	protein transmembrane transporter activity (GO:0008320)			endometrium(11)|large_intestine(5)|lung(10)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)	32						CATTTATTGTCAATTTCAATA	0.358																																																	0													120.0	115.0	117.0					3																	100086940		2203	4300	6503	SO:0001583	missense	0			AB018262	CCDS33807.1	3q12.2	2013-01-10	2006-04-04		ENSG00000154174	ENSG00000154174		"""Tetratricopeptide (TTC) repeat domain containing"""	11985	protein-coding gene	gene with protein product		606081	"""translocase of outer mitochondrial membrane 70 (yeast) homolog A"", ""translocase of outer mitochondrial membrane 70 homolog A (yeast)"""			10582581	Standard	NM_014820		Approved	KIAA0719	uc003dtw.3	O94826	OTTHUMG00000159065	ENST00000284320.5:c.1621G>C	3.37:g.100086940C>G	ENSP00000284320:p.Asp541His		D3DN48	Missense_Mutation	SNP	pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.D541H	ENST00000284320.5	37	c.1621	CCDS33807.1	3	.	.	.	.	.	.	.	.	.	.	C	28.2	4.898062	0.91962	.	.	ENSG00000154174	ENST00000284320;ENST00000544924	T	0.65178	-0.14	5.88	5.88	0.94601	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	D	0.85609	0.5736	M	0.93328	3.405	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.88346	0.2978	10	0.87932	D	0	-20.9086	20.2279	0.98344	0.0:1.0:0.0:0.0	.	541	O94826	TOM70_HUMAN	H	541;434	ENSP00000284320:D541H	ENSP00000284320:D541H	D	-	1	0	TOMM70A	101569630	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.487000	0.81328	2.778000	0.95560	0.655000	0.94253	GAC	TOMM70A	-	smart_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000154174		0.358	TOMM70A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOMM70A	HGNC	protein_coding	OTTHUMT00000353141.2	-	0.00	37	0	C			100086940	-1	tier1	-	no_errors	ENST00000284320	ensembl	human	known	74_37	missense	36.96	29	17	SNP	1.000	G
TOP3B	8940	genome.wustl.edu	37	22	22316763	22316763	+	Intron	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr22:22316763G>C	ENST00000398793.2	-	13	1960				TOP3B_ENST00000357179.5_Intron|TOP3B_ENST00000413067.2_Silent_p.V250V	NM_003935.3	NP_003926.1	O95985	TOP3B_HUMAN	topoisomerase (DNA) III beta						chromosome segregation (GO:0007059)|DNA topological change (GO:0006265)	condensed chromosome (GO:0000793)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA topoisomerase activity (GO:0003916)|DNA topoisomerase type I activity (GO:0003917)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(4)|lung(9)|ovary(1)	26	Colorectal(54;0.105)			READ - Rectum adenocarcinoma(21;0.145)		GAGTACTGGAGACGGAGCCGG	0.647																																																	0													44.0	49.0	48.0					22																	22316763		2203	4300	6503	SO:0001627	intron_variant	0			AF017146	CCDS13797.1	22q11.22	2011-05-24			ENSG00000100038	ENSG00000100038			11993	protein-coding gene	gene with protein product		603582				9786842, 9074928	Standard	XM_005261811		Approved		uc002zvs.3	O95985	OTTHUMG00000167438	ENST00000398793.2:c.1525+37C>G	22.37:g.22316763G>C			A0M8Q3|Q9BUP5	Silent	SNP	pfam_Topo_IA_cen,superfamily_Topo_IA_core_domain,smart_Topo_IA_DNA-bd	p.V250	ENST00000398793.2	37	c.750	CCDS13797.1	22																																																																																			TOP3B	-	smart_Topo_IA_DNA-bd	ENSG00000100038		0.647	TOP3B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TOP3B	HGNC	protein_coding	OTTHUMT00000320251.1	-	0.00	44	0	G	NM_003935		22316763	-1	tier1	-	no_errors	ENST00000413067	ensembl	human	known	74_37	silent	18.18	27	6	SNP	0.000	C
TP53	7157	genome.wustl.edu	37	17	7577118	7577118	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr17:7577118C>G	ENST00000269305.4	-	8	1009	c.820G>C	c.(820-822)Gtt>Ctt	p.V274L	TP53_ENST00000359597.4_Missense_Mutation_p.V274L|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.V274L|TP53_ENST00000445888.2_Missense_Mutation_p.V274L|TP53_ENST00000413465.2_Intron|TP53_ENST00000420246.2_Missense_Mutation_p.V274L	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	274	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		V -> A (in sporadic cancers; somatic mutation).|V -> D (in sporadic cancers; somatic mutation).|V -> F (in sporadic cancers; somatic mutation).|V -> G (in sporadic cancers; somatic mutation).|V -> I (in sporadic cancers; somatic mutation).|V -> L (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.V274F(21)|p.V274L(11)|p.0?(8)|p.V274I(4)|p.?(2)|p.R273_C275delRVC(1)|p.V274fs*71(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.V274_P278del(1)|p.R273fs*71(1)|p.F270_D281del12(1)|p.V272_K292del21(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CAGGCACAAACACGCACCTCA	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	54	Substitution - Missense(36)|Whole gene deletion(8)|Deletion - In frame(5)|Deletion - Frameshift(3)|Unknown(2)	large_intestine(9)|breast(7)|upper_aerodigestive_tract(6)|ovary(4)|prostate(4)|bone(4)|central_nervous_system(3)|urinary_tract(3)|lung(3)|oesophagus(3)|haematopoietic_and_lymphoid_tissue(2)|skin(2)|adrenal_gland(1)|stomach(1)|soft_tissue(1)|liver(1)											69.0	60.0	63.0					17																	7577118		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.820G>C	17.37:g.7577118C>G	ENSP00000269305:p.Val274Leu		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.V274L	ENST00000269305.4	37	c.820	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	13.98	2.397576	0.42512	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99812	-6.88;-6.88;-6.88;-6.88;-6.88;-6.88	4.92	-0.763	0.11030	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.312804	0.33382	N	0.004980	D	0.99411	0.9792	M	0.87456	2.885	0.34283	D	0.682342	B;B;B;B	0.28584	0.216;0.067;0.087;0.049	B;B;B;B	0.40375	0.185;0.096;0.327;0.195	D	0.99980	1.2436	10	0.87932	D	0	-10.2267	9.2232	0.37390	0.0:0.5803:0.0:0.4197	.	274;274;274;274	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	L	274;274;274;274;274;263;142	ENSP00000352610:V274L;ENSP00000269305:V274L;ENSP00000398846:V274L;ENSP00000391127:V274L;ENSP00000391478:V274L;ENSP00000425104:V142L	ENSP00000269305:V274L	V	-	1	0	TP53	7517843	0.002000	0.14202	0.148000	0.22405	0.724000	0.41520	-0.002000	0.12924	-0.004000	0.14419	0.462000	0.41574	GTT	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1		0.00	34	0	C	NM_000546		7577118	-1			no_errors	ENST00000269305	ensembl	human	known	74_37	missense	26.67	22	8	SNP	0.074	G
TPTE2	93492	genome.wustl.edu	37	13	20039660	20039660	+	Missense_Mutation	SNP	C	C	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr13:20039660C>A	ENST00000400230.2	-	8	601	c.557G>T	c.(556-558)aGa>aTa	p.R186I	TPTE2_ENST00000457266.2_Missense_Mutation_p.R75I|TPTE2_ENST00000382978.1_Missense_Mutation_p.R146I|TPTE2_ENST00000400103.2_Missense_Mutation_p.R75I|TPTE2_ENST00000390680.2_Missense_Mutation_p.R109I|TPTE2_ENST00000382975.4_Missense_Mutation_p.R146I|TPTE2_ENST00000255310.6_Missense_Mutation_p.R109I|TPTE2_ENST00000382977.4_Missense_Mutation_p.R186I			Q6XPS3	TPTE2_HUMAN	transmembrane phosphoinositide 3-phosphatase and tensin homolog 2	186					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.R109I(1)		NS(2)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(8)|lung(21)|pancreas(1)|prostate(8)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		ATGAAAAATTCTTATCAGAAT	0.299																																																	1	Substitution - Missense(1)	large_intestine(1)											42.0	41.0	42.0					13																	20039660		2202	4300	6502	SO:0001583	missense	0			AJ421032	CCDS9285.1, CCDS45013.1, CCDS45014.1	13q12.11	2012-12-10			ENSG00000132958	ENSG00000132958		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	17299	protein-coding gene	gene with protein product		606791				11716755, 12717346, 15057823	Standard	NM_130785		Approved	TPIP	uc001umd.3	Q6XPS3	OTTHUMG00000016493	ENST00000400230.2:c.557G>T	13.37:g.20039660C>A	ENSP00000383089:p.Arg186Ile		A1A4X0|A1A4X1|A8MX64|B1AQ16|B4DWZ2|Q5VUH2|Q8WWL4|Q8WWL5	Missense_Mutation	SNP	pfam_Tensin_phosphatase_C2-dom,pfam_Ion_trans_dom,pfam_Dual-sp_phosphatase_cat-dom,superfamily_C2_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.R186I	ENST00000400230.2	37	c.557	CCDS45014.1	13	.	.	.	.	.	.	.	.	.	.	c	13.39	2.221794	0.39300	.	.	ENSG00000132958	ENST00000382978;ENST00000400103;ENST00000400230;ENST00000255310;ENST00000390680;ENST00000382977;ENST00000382975;ENST00000457266;ENST00000343548;ENST00000419256	D;D;D;D;D;D;D;D	0.99637	-5.14;-3.6;-6.29;-5.14;-5.14;-6.29;-5.14;-3.6	2.79	2.79	0.32731	Ion transport (1);	0.000000	0.85682	U	0.000000	D	0.99324	0.9763	M	0.69358	2.11	0.80722	D	1	D;D;D	0.89917	0.998;1.0;1.0	D;D;D	0.97110	0.987;0.999;1.0	D	0.98150	1.0441	9	.	.	.	-26.9199	9.2507	0.37554	0.0:1.0:0.0:0.0	.	75;109;186	A8MX64;Q6XPS3-3;Q6XPS3	.;.;TPTE2_HUMAN	I	146;75;186;109;109;186;146;75;186;55	ENSP00000372438:R146I;ENSP00000382974:R75I;ENSP00000383089:R186I;ENSP00000255310:R109I;ENSP00000375098:R109I;ENSP00000372437:R186I;ENSP00000372435:R146I;ENSP00000442218:R75I	.	R	-	2	0	TPTE2	18937660	1.000000	0.71417	0.210000	0.23637	0.216000	0.24613	3.108000	0.50337	1.846000	0.53633	0.467000	0.42956	AGA	TPTE2	-	pfam_Ion_trans_dom	ENSG00000132958		0.299	TPTE2-205	KNOWN	basic|appris_principal|CCDS	protein_coding	TPTE2	HGNC	protein_coding		-	0.00	130	0	C	NM_199254		20039660	-1	tier1	-	no_errors	ENST00000382977	ensembl	human	known	74_37	missense	11.89	163	22	SNP	0.987	A
TPTEP1	387590	genome.wustl.edu	37	22	17119509	17119509	+	lincRNA	SNP	G	G	A	rs11089287		TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr22:17119509G>A	ENST00000426585.1	+	0	321									transmembrane phosphatase with tensin homology pseudogene 1																		TGTCACTCTCGTCCTTGCCGA	0.323																																																	0																																												0					22q11.1	2013-10-15			ENSG00000100181	ENSG00000100181			43648	pseudogene	pseudogene						14659893	Standard	NR_001591		Approved	psiTPTE22	uc002zlr.3		OTTHUMG00000141300		22.37:g.17119509G>A				RNA	SNP	-	NULL	ENST00000426585.1	37	NULL		22																																																																																			TPTEP1	-	-	ENSG00000100181		0.323	TPTEP1-002	KNOWN	basic	lincRNA	TPTEP1	HGNC	lincRNA	OTTHUMT00000280575.1	-	0.00	176	0	G	NR_001591		17119509	+1	tier1	rs11089287	no_errors	ENST00000383140	ensembl	human	known	74_37	rna	24.84	121	40	SNP	0.000	A
TPX2	22974	genome.wustl.edu	37	20	30358170	30358170	+	Silent	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr20:30358170G>A	ENST00000300403.6	+	6	909	c.381G>A	c.(379-381)caG>caA	p.Q127Q	TPX2_ENST00000340513.4_Silent_p.Q127Q	NM_012112.4	NP_036244.2	Q9ULW0	TPX2_HUMAN	TPX2, microtubule-associated	127					activation of protein kinase activity (GO:0032147)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|mitotic nuclear division (GO:0007067)|regulation of mitotic spindle organization (GO:0060236)	axon hillock (GO:0043203)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|protein kinase binding (GO:0019901)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28			Epithelial(4;0.000771)|Colorectal(19;0.00306)|all cancers(5;0.004)|COAD - Colon adenocarcinoma(19;0.0347)|OV - Ovarian serous cystadenocarcinoma(3;0.0656)			TTTCTGCTCAGAAGGATTTGG	0.328																																																	0													56.0	57.0	56.0					20																	30358170		2203	4300	6503	SO:0001819	synonymous_variant	0			AF098158	CCDS13190.1	20q11.2	2013-07-23	2013-07-23	2003-10-08	ENSG00000088325	ENSG00000088325			1249	protein-coding gene	gene with protein product		605917	"""chromosome 20 open reading frame 1"", ""TPX2, microtubule-associated, homolog (Xenopus laevis)"""	C20orf2, C20orf1		9207457, 10393424	Standard	NM_012112		Approved	p100, DIL-2	uc002wwp.1	Q9ULW0	OTTHUMG00000032190	ENST00000300403.6:c.381G>A	20.37:g.30358170G>A			Q9H1R4|Q9NRA3|Q9UFN9|Q9UL00|Q9Y2M1	Silent	SNP	pfam_TPX2_central_dom,pfam_Aurora-A-bd,pfam_TPX2_dom_C	p.Q127	ENST00000300403.6	37	c.381	CCDS13190.1	20																																																																																			TPX2	-	NULL	ENSG00000088325		0.328	TPX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPX2	HGNC	protein_coding	OTTHUMT00000078569.2	-	0.00	118	0	G			30358170	+1	tier1	-	no_errors	ENST00000340513	ensembl	human	known	74_37	silent	17.09	131	27	SNP	1.000	A
REV3L	5980	genome.wustl.edu	37	6	111805279	111805279	+	5'Flank	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr6:111805279C>G	ENST00000358835.3	-	0	0				REV3L_ENST00000368805.1_5'Flank|TRAF3IP2-AS1_ENST00000440001.2_RNA|TRAF3IP2-AS1_ENST00000440395.1_RNA|TRAF3IP2-AS1_ENST00000456352.2_RNA|TRAF3IP2-AS1_ENST00000532353.1_RNA|TRAF3IP2-AS1_ENST00000525151.1_RNA|TRAF3IP2-AS1_ENST00000438298.2_RNA|REV3L_ENST00000435970.1_5'Flank|TRAF3IP2-AS1_ENST00000532226.1_RNA|REV3L_ENST00000368802.3_5'Flank|TRAF3IP2-AS1_ENST00000449449.2_RNA|TRAF3IP2-AS1_ENST00000442928.2_RNA|TRAF3IP2-AS1_ENST00000420651.2_RNA			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit						DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		TTCCTTCCCTCTCGTCCTAAT	0.587								DNA polymerases (catalytic subunits)																																									0																																										SO:0001631	upstream_gene_variant	0			AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318		6.37:g.111805279C>G	Exception_encountered		O43214|Q5TC33	RNA	SNP	-	NULL	ENST00000358835.3	37	NULL	CCDS5091.2	6																																																																																			TRAF3IP2-AS1	-	-	ENSG00000231889		0.587	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAF3IP2-AS1	HGNC	protein_coding	OTTHUMT00000043695.1	-	0.00	53	0	C	NM_002912		111805279	+1	tier1	-	no_errors	ENST00000440001	ensembl	human	known	74_37	rna	35.85	34	19	SNP	0.011	G
AC005013.5	0	genome.wustl.edu	37	7	28997239	28997239	+	lincRNA	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr7:28997239C>G	ENST00000436594.1	+	0	0				TRIL_ENST00000322982.3_RNA																							CGGCTGATCTCGTTCCCGTTG	0.687																																																	0													16.0	19.0	18.0					7																	28997239		1949	4146	6095			0																															7.37:g.28997239C>G				RNA	SNP	-	NULL	ENST00000436594.1	37	NULL		7																																																																																			TRIL	-	-	ENSG00000176734		0.687	AC005013.5-001	KNOWN	basic|exp_conf	lincRNA	TRIL	HGNC	lincRNA	OTTHUMT00000327953.3	-	0.00	50	0	C			28997239	-1	tier1	-	no_errors	ENST00000322982	ensembl	human	known	74_37	rna	13.25	72	11	SNP	1.000	G
TRIM60	166655	genome.wustl.edu	37	4	165961854	165961854	+	Missense_Mutation	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr4:165961854G>A	ENST00000512596.1	+	3	846	c.630G>A	c.(628-630)atG>atA	p.M210I	TRIM60_ENST00000508504.1_Missense_Mutation_p.M210I|TRIM60_ENST00000341062.5_Missense_Mutation_p.M210I	NM_152620.2	NP_689833.1	Q495X7	TRI60_HUMAN	tripartite motif containing 60	210						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(3)|large_intestine(6)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	29	all_hematologic(180;0.221)	Prostate(90;0.0959)|Melanoma(52;0.18)		GBM - Glioblastoma multiforme(119;0.0844)		ATGAAGAGATGAACATTTTAG	0.333																																																	0													36.0	39.0	38.0					4																	165961854		2203	4300	6503	SO:0001583	missense	0			AK093201	CCDS3808.1	4q32.3	2013-01-09	2011-01-25	2004-11-17	ENSG00000176979	ENSG00000176979		"""RING-type (C3HC4) zinc fingers"", ""Tripartite motif containing / Tripartite motif containing"""	21162	protein-coding gene	gene with protein product			"""ring finger protein 129"", ""tripartite motif-containing 60"""	RNF129, RNF33			Standard	NM_152620		Approved	FLJ35882	uc003iqy.1	Q495X7	OTTHUMG00000161262	ENST00000512596.1:c.630G>A	4.37:g.165961854G>A	ENSP00000421142:p.Met210Ile		Q8NA35	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_C3HC4_RING-type,pfam_Znf_B-box,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.M210I	ENST00000512596.1	37	c.630	CCDS3808.1	4	.	.	.	.	.	.	.	.	.	.	G	6.954	0.545837	0.13312	.	.	ENSG00000176979	ENST00000512596;ENST00000508504;ENST00000341062	T;T;T	0.04603	3.59;3.59;3.59	2.49	-0.394	0.12434	.	0.955272	0.08497	U	0.937081	T	0.05547	0.0146	L	0.56769	1.78	0.09310	N	1	B	0.22480	0.07	B	0.22601	0.04	T	0.43589	-0.9382	10	0.42905	T	0.14	.	2.3911	0.04378	0.2943:0.0:0.469:0.2367	.	210	Q495X7	TRI60_HUMAN	I	210	ENSP00000421142:M210I;ENSP00000426496:M210I;ENSP00000343765:M210I	ENSP00000343765:M210I	M	+	3	0	TRIM60	166181304	0.001000	0.12720	0.000000	0.03702	0.353000	0.29299	0.867000	0.27968	-0.150000	0.11195	-0.136000	0.14681	ATG	TRIM60	-	NULL	ENSG00000176979		0.333	TRIM60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM60	HGNC	protein_coding	OTTHUMT00000364325.1	-	0.00	62	0	G	NM_152620		165961854	+1	tier1	-	no_errors	ENST00000341062	ensembl	human	known	74_37	missense	30.77	63	28	SNP	0.000	A
TRIO	7204	genome.wustl.edu	37	5	14369614	14369614	+	Silent	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr5:14369614G>A	ENST00000344204.4	+	18	3222	c.3198G>A	c.(3196-3198)caG>caA	p.Q1066Q	TRIO_ENST00000537187.1_Silent_p.Q1066Q|TRIO_ENST00000509967.2_Silent_p.Q1017Q	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	1066					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					ACCTGGAGCAGAAGGAGGCAT	0.607																																																	0													92.0	86.0	88.0					5																	14369614		2203	4300	6503	SO:0001819	synonymous_variant	0			AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.3198G>A	5.37:g.14369614G>A			D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Silent	SNP	pfam_DH-domain,pfam_Prot_kinase_dom,pfam_Spectrin_repeat,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_SH3_domain,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_SH3_domain,superfamily_CRAL-TRIO_dom,superfamily_Capsid/spike_ssDNA_virus,smart_CRAL-TRIO_dom,smart_Spectrin/alpha-actinin,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_CRAL-TRIO_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,pfscan_DH-domain	p.Q1066	ENST00000344204.4	37	c.3198	CCDS3883.1	5																																																																																			TRIO	-	NULL	ENSG00000038382		0.607	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIO	HGNC	protein_coding	OTTHUMT00000253711.2	-	0.00	37	0	G	NM_007118		14369614	+1	tier1	-	no_errors	ENST00000344204	ensembl	human	known	74_37	silent	8.97	132	13	SNP	0.980	A
TRIP12	9320	genome.wustl.edu	37	2	230744786	230744786	+	Missense_Mutation	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr2:230744786G>A	ENST00000283943.5	-	2	188	c.10C>T	c.(10-12)Cgg>Tgg	p.R4W	TRIP12_ENST00000389044.4_Missense_Mutation_p.R4W|TRIP12_ENST00000389045.3_Missense_Mutation_p.R4W|TRIP12_ENST00000409677.1_Missense_Mutation_p.R4W|TRIP12_ENST00000543084.1_Missense_Mutation_p.R4W	NM_001284214.1|NM_004238.1	NP_001271143.1|NP_004229.1	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	4					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|embryo development (GO:0009790)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|thyroid hormone receptor binding (GO:0046966)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(19)|lung(32)|ovary(5)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		TTATTAGGCCGGTTGGACATT	0.438																																																	0													114.0	107.0	110.0					2																	230744786		2203	4300	6503	SO:0001583	missense	0			L40383	CCDS33391.1, CCDS63145.1, CCDS63146.1	2q36.3	2008-05-27			ENSG00000153827	ENSG00000153827			12306	protein-coding gene	gene with protein product		604506				7776974	Standard	XM_005246961		Approved	KIAA0045	uc002vpw.1	Q14669	OTTHUMG00000153623	ENST00000283943.5:c.10C>T	2.37:g.230744786G>A	ENSP00000283943:p.Arg4Trp		D4HL82|Q14CA3|Q14CF1|Q15644|Q53R87|Q53TE7	Missense_Mutation	SNP	pfam_HECT,superfamily_HECT,superfamily_ARM-type_fold,smart_HECT,pfscan_HECT,pfscan_WWE-dom	p.R4W	ENST00000283943.5	37	c.10	CCDS33391.1	2	.	.	.	.	.	.	.	.	.	.	G	36	5.661041	0.96734	.	.	ENSG00000153827	ENST00000283943;ENST00000389045;ENST00000389044;ENST00000543084;ENST00000409677;ENST00000435716;ENST00000428959;ENST00000430954;ENST00000343290	T;T;T	0.63255	-0.01;0.39;-0.03	5.77	5.77	0.91146	.	0.059994	0.64402	D	0.000002	T	0.70055	0.3180	N	0.24115	0.695	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.71870	0.93;0.952;0.975;0.952	T	0.73379	-0.4001	10	0.87932	D	0	.	19.982	0.97329	0.0:0.0:1.0:0.0	.	4;4;4;4	D4HL82;Q14CF1;Q14CA3;Q14669	.;.;.;TRIPC_HUMAN	W	4	ENSP00000283943:R4W;ENSP00000373697:R4W;ENSP00000373696:R4W	ENSP00000283943:R4W	R	-	1	2	TRIP12	230453030	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.827000	0.99397	2.737000	0.93849	0.561000	0.74099	CGG	TRIP12	-	NULL	ENSG00000153827		0.438	TRIP12-001	KNOWN	basic|CCDS	protein_coding	TRIP12	HGNC	protein_coding	OTTHUMT00000331861.3	-	0.00	27	0	G	NM_004238		230744786	-1	tier1	-	no_errors	ENST00000283943	ensembl	human	known	74_37	missense	46.15	21	18	SNP	1.000	A
TRPC6	7225	genome.wustl.edu	37	11	101341989	101341989	+	Silent	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr11:101341989C>T	ENST00000344327.3	-	9	2758	c.2334G>A	c.(2332-2334)ctG>ctA	p.L778L	TRPC6_ENST00000532133.1_Silent_p.L700L|TRPC6_ENST00000348423.4_Silent_p.L662L|TRPC6_ENST00000360497.4_Silent_p.L723L	NM_004621.5	NP_004612.2	Q9Y210	TRPC6_HUMAN	transient receptor potential cation channel, subfamily C, member 6	778					aging (GO:0007568)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|ion transmembrane transport (GO:0034220)|platelet activation (GO:0030168)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ion transmembrane transporter activity (GO:0032414)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(14)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)		BRCA - Breast invasive adenocarcinoma(274;0.0442)		TTTTAAGCTTCAGTAAGAGAT	0.428																																					Colon(166;1315 1927 11094 12848 34731)												0													103.0	110.0	108.0					11																	101341989		2203	4298	6501	SO:0001819	synonymous_variant	0			AJ006276	CCDS8311.1	11q22.1	2014-02-04				ENSG00000137672		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12338	protein-coding gene	gene with protein product		603652	"""focal segmental glomerulosclerosis 2"""	FSGS2		9925922, 16382100, 15879175	Standard	NM_004621		Approved	TRP6	uc001pgk.4	Q9Y210		ENST00000344327.3:c.2334G>A	11.37:g.101341989C>T			Q52M59|Q9HCW3|Q9NQA8|Q9NQA9	Silent	SNP	pfam_Ion_trans_dom,pfam_TRP_dom,pfam_PKD1_2_channel,superfamily_Ankyrin_rpt-contain_dom,superfamily_ARM-type_fold,smart_Ankyrin_rpt,prints_TRPC6_channel,prints_TRPC_channel,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,tigrfam_TRP_channel	p.L778	ENST00000344327.3	37	c.2334	CCDS8311.1	11																																																																																			TRPC6	-	tigrfam_TRP_channel	ENSG00000137672		0.428	TRPC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPC6	HGNC	protein_coding	OTTHUMT00000394770.1	-	0.00	58	0	C	NM_004621		101341989	-1	tier1	-	no_errors	ENST00000344327	ensembl	human	known	74_37	silent	16.98	44	9	SNP	0.998	T
TTC30A	92104	genome.wustl.edu	37	2	178482187	178482187	+	Missense_Mutation	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr2:178482187C>T	ENST00000355689.5	-	1	1507	c.1243G>A	c.(1243-1245)Gaa>Aaa	p.E415K	AC073834.3_ENST00000357045.4_RNA	NM_152275.3	NP_689488.3	Q86WT1	TT30A_HUMAN	tetratricopeptide repeat domain 30A	415					cilium assembly (GO:0042384)|intraciliary transport (GO:0042073)	cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)				autonomic_ganglia(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(8)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	30			OV - Ovarian serous cystadenocarcinoma(117;0.000423)|Epithelial(96;0.00373)|all cancers(119;0.0169)			TCATCATATTCATTCACTGCC	0.433																																																	0													231.0	233.0	233.0					2																	178482187		2203	4300	6503	SO:0001583	missense	0			AK024008	CCDS2276.1	2q31.2	2013-01-11			ENSG00000197557	ENSG00000197557		"""Tetratricopeptide (TTC) repeat domain containing"""	25853	protein-coding gene	gene with protein product						12477932	Standard	NM_152275		Approved	FLJ13946	uc002ulo.3	Q86WT1	OTTHUMG00000132528	ENST00000355689.5:c.1243G>A	2.37:g.178482187C>T	ENSP00000347915:p.Glu415Lys		A8K8N0|Q8IVP2	Missense_Mutation	SNP	smart_TPR_repeat,pfscan_TPR-contain_dom	p.E415K	ENST00000355689.5	37	c.1243	CCDS2276.1	2	.	.	.	.	.	.	.	.	.	.	C	12.02	1.813098	0.32053	.	.	ENSG00000197557	ENST00000355689	T	0.35421	1.31	5.91	5.91	0.95273	Tetratricopeptide-like helical (1);	0.091871	0.64402	D	0.000001	T	0.47893	0.1470	M	0.82517	2.595	0.80722	D	1	B	0.33777	0.425	B	0.32465	0.146	T	0.50866	-0.8777	10	0.52906	T	0.07	.	20.3829	0.98937	0.0:1.0:0.0:0.0	.	415	Q86WT1	TT30A_HUMAN	K	415	ENSP00000347915:E415K	ENSP00000347915:E415K	E	-	1	0	TTC30A	178190433	1.000000	0.71417	0.998000	0.56505	0.171000	0.22731	6.720000	0.74723	2.823000	0.97156	0.644000	0.83932	GAA	TTC30A	-	NULL	ENSG00000197557		0.433	TTC30A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC30A	HGNC	protein_coding	OTTHUMT00000255728.2	-	0.00	45	0	C	NM_152275		178482187	-1	tier1	-	no_errors	ENST00000355689	ensembl	human	known	74_37	missense	9.38	58	6	SNP	1.000	T
TTC39A	22996	genome.wustl.edu	37	1	51767904	51767904	+	Intron	SNP	C	C	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:51767904C>A	ENST00000447632.2	-	11	1048				TTC39A_ENST00000371747.3_Intron|TTC39A_ENST00000262676.5_Missense_Mutation_p.R371I|TTC39A_ENST00000262675.7_Intron|TTC39A_ENST00000451380.1_Intron|TTC39A_ENST00000413473.2_Intron|TTC39A_ENST00000371750.5_Intron			Q5SRH9	TT39A_HUMAN	tetratricopeptide repeat domain 39A									p.0?(2)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(2)|prostate(2)|skin(3)|urinary_tract(1)	17						CTGGTTGGTTCTCTCTTGGCC	0.627																																																	2	Whole gene deletion(2)	thyroid(1)|central_nervous_system(1)																																								SO:0001627	intron_variant	0			AB007921	CCDS44143.1, CCDS44144.1, CCDS72789.1, CCDS72790.1	1p32.3	2013-01-11	2008-06-23	2008-06-23	ENSG00000085831	ENSG00000085831		"""Tetratricopeptide (TTC) repeat domain containing"""	18657	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 34"""	C1orf34		9455484, 9461476	Standard	XM_005270643		Approved	KIAA0452, DEME-6	uc010onf.2	Q5SRH9	OTTHUMG00000008193	ENST00000447632.2:c.999+124G>T	1.37:g.51767904C>A			B7Z782|E7EQY9|G3XAF8|O43417|O75040|Q5SRH5|Q5SRH6|Q5SRH7|Q5SRH8|Q5SRI0|Q5SRI1|Q5SRI2|Q5T7S1|Q6PIU8|Q9BT24	Missense_Mutation	SNP	pfam_OMP_IML2_mit/TPR_39	p.R371I	ENST00000447632.2	37	c.1112		1	.	.	.	.	.	.	.	.	.	.	C	11.49	1.655178	0.29425	.	.	ENSG00000085831	ENST00000262676	.	.	.	3.26	-0.957	0.10350	.	.	.	.	.	T	0.16385	0.0394	.	.	.	0.09310	N	1	P	0.39157	0.662	B	0.31191	0.125	T	0.14559	-1.0468	7	0.87932	D	0	.	3.4345	0.07441	0.0:0.4315:0.2009:0.3676	.	371	Q5SRH9-3	.	I	371	.	ENSP00000262676:R371I	R	-	2	0	TTC39A	51540492	0.000000	0.05858	0.000000	0.03702	0.046000	0.14306	-0.620000	0.05565	-0.166000	0.10890	-0.218000	0.12543	AGA	TTC39A	-	NULL	ENSG00000085831		0.627	TTC39A-004	KNOWN	basic	protein_coding	TTC39A	HGNC	protein_coding	OTTHUMT00000022434.2	-	0.00	100	0	C			51767904	-1	tier1	-	no_errors	ENST00000262676	ensembl	human	known	74_37	missense	16.80	103	21	SNP	0.000	A
CFAP46	54777	genome.wustl.edu	37	10	134628194	134628194	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr10:134628194G>T	ENST00000368586.5	-	52	7345	c.7245C>A	c.(7243-7245)ttC>ttA	p.F2415L	TTC40_ENST00000263170.5_Missense_Mutation_p.F576L	NM_001200049.2	NP_001186978.2														breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						GGATACACTTGAAGTTGTCTG	0.647																																																	0													19.0	22.0	21.0					10																	134628194		2197	4291	6488	SO:0001583	missense	0																														ENST00000368586.5:c.7245C>A	10.37:g.134628194G>T	ENSP00000357575:p.Phe2415Leu			Missense_Mutation	SNP	NULL	p.F576L	ENST00000368586.5	37	c.1728	CCDS58101.1	10	.	.	.	.	.	.	.	.	.	.	G	12.47	1.948546	0.34377	.	.	ENSG00000171811	ENST00000368586;ENST00000263170	T;T	0.27557	1.66;1.66	4.32	2.41	0.29592	.	0.353444	0.19955	N	0.102322	T	0.23249	0.0562	M	0.61703	1.905	0.58432	D	0.999992	P	0.37955	0.612	B	0.30716	0.119	T	0.04781	-1.0927	10	0.33141	T	0.24	.	6.524	0.22291	0.2024:0.0:0.7976:0.0	.	576	Q8IYW2	CJ092_HUMAN	L	2415;576	ENSP00000357575:F2415L;ENSP00000263170:F576L	ENSP00000263170:F576L	F	-	3	2	C10orf93	134478184	0.868000	0.29978	0.998000	0.56505	0.491000	0.33493	0.622000	0.24433	1.959000	0.56917	0.591000	0.81541	TTC	TTC40	-	NULL	ENSG00000171811		0.647	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	TTC40	HGNC	protein_coding	OTTHUMT00000051095.3	-	0.00	94	0	G			134628194	-1	tier1	-	no_errors	ENST00000263170	ensembl	human	known	74_37	missense	7.45	87	7	SNP	0.869	T
TTLL10	254173	genome.wustl.edu	37	1	1110887	1110887	+	Intron	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:1110887C>T	ENST00000379290.1	+	3	146				TTLL10-AS1_ENST00000379317.1_RNA|TTLL10_ENST00000379289.1_Intron			Q6ZVT0	TTL10_HUMAN	tubulin tyrosine ligase-like family, member 10						cellular protein modification process (GO:0006464)					haematopoietic_and_lymphoid_tissue(3)|large_intestine(1)|lung(2)|skin(1)	7	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;4.75e-36)|OV - Ovarian serous cystadenocarcinoma(86;5.82e-22)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;4.22e-05)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		CCGGCCTCCCCGGGTGGTGCC	0.582																																																	0																																										SO:0001627	intron_variant	0			AK093438	CCDS8.1, CCDS44036.1	1p36.33	2014-01-28	2005-07-29	2005-07-29	ENSG00000162571	ENSG00000162571		"""Tubulin tyrosine ligase-like family"""	26693	protein-coding gene	gene with protein product			"""tubulin tyrosine ligase-like family, member 5"""	TTLL5		15890843	Standard	NM_153254		Approved	FLJ36119	uc001acy.2	Q6ZVT0	OTTHUMG00000000851	ENST00000379290.1:c.-28+1018C>T	1.37:g.1110887C>T			B1AMF6|Q5T2W4|Q5T2W5|Q8N9X2	RNA	SNP	-	NULL	ENST00000379290.1	37	NULL	CCDS44036.1	1																																																																																			TTLL10-AS1	-	-	ENSG00000205231		0.582	TTLL10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TTLL10-AS1	HGNC	protein_coding	OTTHUMT00000002421.3	-	0.00	31	0	C	NM_153254		1110887	-1	tier1	-	no_errors	ENST00000379317	ensembl	human	known	74_37	rna	31.25	11	5	SNP	0.002	T
TUB	7275	genome.wustl.edu	37	11	8122402	8122402	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr11:8122402G>C	ENST00000299506.2	+	11	1394	c.1245G>C	c.(1243-1245)caG>caC	p.Q415H	TUB_ENST00000534099.1_Missense_Mutation_p.Q421H|TUB_ENST00000305253.4_Missense_Mutation_p.Q470H	NM_177972.2	NP_813977.1	P50607	TUB_HUMAN	tubby bipartite transcription factor	415					multicellular organismal macromolecule metabolic process (GO:0044259)|phagocytosis (GO:0006909)|phototransduction (GO:0007602)|positive regulation of phagocytosis (GO:0050766)|response to hormone (GO:0009725)|retina development in camera-type eye (GO:0060041)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein coupled photoreceptor activity (GO:0008020)|protein complex binding (GO:0032403)			breast(1)|cervix(1)|endometrium(9)|large_intestine(7)|lung(5)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	26		all_lung(207;6.91e-20)|Lung NSC(207;3.36e-17)		Epithelial(150;1.69e-62)|BRCA - Breast invasive adenocarcinoma(625;8.54e-06)|LUSC - Lung squamous cell carcinoma(625;0.000184)		CACGCTGGCAGAATAAGAACA	0.547																																																	0													143.0	127.0	132.0					11																	8122402		2201	4296	6497	SO:0001583	missense	0			U54644	CCDS7786.1, CCDS7787.1	11p15.5	2013-08-06	2013-08-06		ENSG00000166402	ENSG00000166402			12406	protein-coding gene	gene with protein product		601197	"""tubby (mouse) homolog"", ""tubby homolog (mouse)"""			8612280	Standard	NM_003320		Approved	rd5	uc001mfy.3	P50607	OTTHUMG00000165690	ENST00000299506.2:c.1245G>C	11.37:g.8122402G>C	ENSP00000299506:p.Gln415His		D3DQU4|O00293|Q6B007	Missense_Mutation	SNP	pfam_Tubby_C,superfamily_Tubby_C-like,prints_Tubby_N,prints_Tubby_C	p.Q470H	ENST00000299506.2	37	c.1410	CCDS7787.1	11	.	.	.	.	.	.	.	.	.	.	G	14.12	2.441887	0.43326	.	.	ENSG00000166402	ENST00000534099;ENST00000305253;ENST00000299506	D;D;D	0.96522	-4.04;-4.04;-4.04	5.19	2.23	0.28157	Tubby, C-terminal (3);	0.051046	0.85682	D	0.000000	D	0.93880	0.8042	L	0.53780	1.695	0.80722	D	1	B;B;B	0.20368	0.039;0.019;0.044	B;B;B	0.24541	0.036;0.054;0.032	D	0.90858	0.4736	10	0.59425	D	0.04	-18.093	11.4344	0.50060	0.2107:0.0:0.7893:0.0	.	421;415;470	E9PQR4;P50607;P50607-2	.;TUB_HUMAN;.	H	421;470;415	ENSP00000434400:Q421H;ENSP00000305426:Q470H;ENSP00000299506:Q415H	ENSP00000299506:Q415H	Q	+	3	2	TUB	8078978	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.459000	0.53021	0.697000	0.31718	0.655000	0.94253	CAG	TUB	-	pfam_Tubby_C,superfamily_Tubby_C-like	ENSG00000166402		0.547	TUB-003	PUTATIVE	basic|appris_principal|CCDS	protein_coding	TUB	HGNC	protein_coding	OTTHUMT00000385823.1	-	0.00	44	0	G	NM_003320		8122402	+1	tier1	-	no_errors	ENST00000305253	ensembl	human	known	74_37	missense	13.89	31	5	SNP	1.000	C
TUT1	64852	genome.wustl.edu	37	11	62343608	62343608	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr11:62343608G>C	ENST00000476907.1	-	9	2274	c.1583C>G	c.(1582-1584)tCt>tGt	p.S528C	EEF1G_ENST00000532986.1_5'Flank|TUT1_ENST00000308436.7_Missense_Mutation_p.S566C|EEF1G_ENST00000329251.4_5'Flank|EEF1G_ENST00000378019.3_5'Flank|MIR3654_ENST00000496634.2_Intron			Q9H6E5	STPAP_HUMAN	terminal uridylyl transferase 1, U6 snRNA-specific	528	PAP-associated.				mRNA cleavage (GO:0006379)|mRNA polyadenylation (GO:0006378)|snRNA processing (GO:0016180)	intercellular bridge (GO:0045171)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|mRNA 3'-UTR binding (GO:0003730)|polynucleotide adenylyltransferase activity (GO:0004652)|RNA binding (GO:0003723)|RNA uridylyltransferase activity (GO:0050265)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						CCAGAGATTAGAAGGCAGGCC	0.612																																																	0													17.0	20.0	19.0					11																	62343608		2199	4292	6491	SO:0001583	missense	0			BC005013	CCDS8021.1, CCDS8021.2	11q12.2	2014-03-05	2006-10-06	2006-10-06	ENSG00000149016	ENSG00000149016	2.7.7.52	"""RNA binding motif (RRM) containing"""	26184	protein-coding gene	gene with protein product	"""RNA uridylyltransferase"", ""U6 TUTase"", ""TUTase 6"""	610641	"""RNA binding motif protein 21"""	RBM21		16790842	Standard	NM_022830		Approved	FLJ22347, FLJ22267, FLJ21850, PAPD2, TUTase	uc001nto.2	Q9H6E5	OTTHUMG00000158564	ENST00000476907.1:c.1583C>G	11.37:g.62343608G>C	ENSP00000419607:p.Ser528Cys		A1A527|A8K995|Q2NL65|Q7L583|Q9H6H7	Missense_Mutation	SNP	pfam_PAP_assoc,pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.S566C	ENST00000476907.1	37	c.1697		11	.	.	.	.	.	.	.	.	.	.	G	18.24	3.580408	0.65992	.	.	ENSG00000149016	ENST00000308436;ENST00000476907	T;T	0.57273	0.41;0.41	5.39	4.42	0.53409	PAP/25A-associated (1);	0.565736	0.18598	N	0.136535	T	0.51160	0.1658	N	0.24115	0.695	0.28995	N	0.887836	D;D	0.63046	0.98;0.992	P;P	0.54346	0.749;0.634	T	0.50890	-0.8774	10	0.72032	D	0.01	-9.019	13.2818	0.60219	0.0:0.1603:0.8397:0.0	.	528;566	Q9H6E5;F5H0R1	STPAP_HUMAN;.	C	566;528	ENSP00000308000:S566C;ENSP00000419607:S528C	ENSP00000308000:S566C	S	-	2	0	TUT1	62100184	0.999000	0.42202	0.929000	0.37066	0.791000	0.44710	4.392000	0.59659	2.525000	0.85131	0.563000	0.77884	TCT	TUT1	-	pfam_PAP_assoc	ENSG00000149016		0.612	TUT1-001	KNOWN	basic|appris_candidate	protein_coding	TUT1	HGNC	protein_coding	OTTHUMT00000351319.2	-	0.00	38	0	G	NM_022830		62343608	-1	tier1	-	no_errors	ENST00000308436	ensembl	human	known	74_37	missense	8.06	57	5	SNP	0.872	C
U2SURP	23350	genome.wustl.edu	37	3	142772588	142772588	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr3:142772588C>G	ENST00000473835.2	+	26	2816	c.2726C>G	c.(2725-2727)tCc>tGc	p.S909C	U2SURP_ENST00000397933.2_Missense_Mutation_p.S500C|U2SURP_ENST00000493598.2_Missense_Mutation_p.S908C	NM_001080415.1	NP_001073884.1	O15042	SR140_HUMAN	U2 snRNP-associated SURP domain containing	909	Glu-rich.				RNA processing (GO:0006396)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	31						GAATCTCGCTCCAAAGACAAG	0.323																																																	0													81.0	79.0	80.0					3																	142772588		1831	4084	5915	SO:0001583	missense	0			BK000564	CCDS46928.1	3q23	2013-02-12			ENSG00000163714	ENSG00000163714		"""RNA binding motif (RRM) containing"""	30855	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein a"", ""Ser/Arg-rich domain protein, 140 kDa"", ""U2 associated SR140 protein"""					9205841, 12234937	Standard	NM_001080415		Approved	fSAPa, SR140	uc003evh.1	O15042	OTTHUMG00000159323	ENST00000473835.2:c.2726C>G	3.37:g.142772588C>G	ENSP00000418563:p.Ser909Cys		A0PJ60|Q0D2M1|Q2NKQ7|Q9BR70	Missense_Mutation	SNP	pfam_Surp,pfam_RRM_dom,superfamily_Surp,superfamily_ENTH_VHS,smart_RRM_dom,smart_Surp,smart_CID_dom,pfscan_Surp,pfscan_RRM_dom	p.S909C	ENST00000473835.2	37	c.2726	CCDS46928.1	3	.	.	.	.	.	.	.	.	.	.	C	18.07	3.541976	0.65198	.	.	ENSG00000163714	ENST00000473835;ENST00000319822;ENST00000397933;ENST00000493598;ENST00000480029	T;T;T;D	0.97256	2.14;0.92;2.14;-4.31	6.02	6.02	0.97574	.	0.399329	0.30930	N	0.008593	D	0.93083	0.7798	N	0.08118	0	0.54753	D	0.99998	P;B;P	0.47191	0.891;0.264;0.826	B;B;B	0.41946	0.371;0.264;0.205	D	0.94240	0.7484	10	0.87932	D	0	-3.4394	19.1045	0.93287	0.0:1.0:0.0:0.0	.	908;500;909	O15042-2;O15042-3;O15042	.;.;SR140_HUMAN	C	909;909;500;908;476	ENSP00000418563:S909C;ENSP00000381027:S500C;ENSP00000422011:S908C;ENSP00000417441:S476C	ENSP00000322376:S909C	S	+	2	0	U2SURP	144255278	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.086000	0.57664	2.865000	0.98341	0.655000	0.94253	TCC	U2SURP	-	NULL	ENSG00000163714		0.323	U2SURP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	U2SURP	HGNC	protein_coding	OTTHUMT00000354603.2	-	0.00	88	0	C	NM_001080415		142772588	+1	tier1	-	no_errors	ENST00000473835	ensembl	human	known	74_37	missense	15.08	107	19	SNP	1.000	G
UBAP2	55833	genome.wustl.edu	37	9	33927920	33927920	+	Nonsense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr9:33927920G>C	ENST00000379238.1	-	20	2363	c.2246C>G	c.(2245-2247)tCa>tGa	p.S749*	UBAP2_ENST00000360802.1_Nonsense_Mutation_p.S749*|UBAP2_ENST00000379235.1_5'UTR|UBAP2_ENST00000449054.1_Nonsense_Mutation_p.S749*|UBAP2_ENST00000379239.4_Nonsense_Mutation_p.S482*|UBAP2_ENST00000539807.1_Nonsense_Mutation_p.S504*|UBAP2_ENST00000418786.2_Missense_Mutation_p.Q674E					ubiquitin associated protein 2											endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(13)|ovary(3)|stomach(1)	32			LUSC - Lung squamous cell carcinoma(29;0.00575)	GBM - Glioblastoma multiforme(74;0.168)		TGCGGAACTTGAGACGGAGGT	0.612																																																	0													85.0	78.0	80.0					9																	33927920		2203	4300	6503	SO:0001587	stop_gained	0			AB040924	CCDS6547.1, CCDS75828.1	9p11.2	2008-02-05			ENSG00000137073	ENSG00000137073			14185	protein-coding gene	gene with protein product						8871400	Standard	NM_018449		Approved	KIAA1491, bA176F3.5, FLJ22435	uc003ztq.1	Q5T6F2	OTTHUMG00000000427	ENST00000379238.1:c.2246C>G	9.37:g.33927920G>C	ENSP00000368540:p.Ser749*			Nonsense_Mutation	SNP	pfam_DUF3697_Uba2,pfam_UBA/Ts_N,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk	p.S749*	ENST00000379238.1	37	c.2246	CCDS6547.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.2|22.2	4.251590|4.251590	0.80135|0.80135	.|.	.|.	ENSG00000137073|ENSG00000137073	ENST00000418786|ENST00000379238;ENST00000449054;ENST00000360802;ENST00000431417;ENST00000379239;ENST00000539807;ENST00000351580	T|.	0.17213|.	2.29|.	5.3|5.3	3.46|3.46	0.39613|0.39613	.|.	.|0.572374	.|0.18749	.|N	.|0.132258	T|.	0.42471|.	0.1204|.	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	B|.	0.19200|.	0.034|.	B|.	0.19391|.	0.025|.	T|.	0.26360|.	-1.0105|.	8|.	0.02654|0.46703	T|T	1|0.11	-0.4967|-0.4967	9.8687|9.8687	0.41160|0.41160	0.0732:0.0:0.7872:0.1396|0.0732:0.0:0.7872:0.1396	.|.	674|.	E7EWG4|.	.|.	E|X	674|749;749;749;658;482;504;185	ENSP00000404436:Q674E|.	ENSP00000404436:Q674E|ENSP00000259602:S185X	Q|S	-|-	1|2	0|0	UBAP2|UBAP2	33917920|33917920	1.000000|1.000000	0.71417|0.71417	0.001000|0.001000	0.08648|0.08648	0.006000|0.006000	0.05464|0.05464	4.742000|4.742000	0.62103|0.62103	0.613000|0.613000	0.30089|0.30089	0.655000|0.655000	0.94253|0.94253	CAA|TCA	UBAP2	-	NULL	ENSG00000137073		0.612	UBAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBAP2	HGNC	protein_coding	OTTHUMT00000001071.1	-	0.00	35	0	G	NM_018449		33927920	-1	tier1	-	no_errors	ENST00000360802	ensembl	human	known	74_37	nonsense	26.92	19	7	SNP	0.018	C
UBE2E3	10477	genome.wustl.edu	37	2	181846835	181846835	+	Silent	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr2:181846835G>A	ENST00000410062.4	+	2	459	c.66G>A	c.(64-66)gcG>gcA	p.A22A	UBE2E3_ENST00000392415.2_Silent_p.A22A|UBE2E3_ENST00000602710.1_Silent_p.A22A|UBE2E3_ENST00000602475.1_Silent_p.A22A|UBE2E3_ENST00000602632.1_Silent_p.A22A|UBE2E3_ENST00000602959.1_Silent_p.A22A|AC104076.3_ENST00000428080.1_RNA	NM_006357.2	NP_006348.1	Q969T4	UB2E3_HUMAN	ubiquitin-conjugating enzyme E2E 3	22					protein K11-linked ubiquitination (GO:0070979)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked ubiquitination (GO:0070534)|regulation of growth (GO:0040008)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin-protein transferase activity (GO:0004842)	p.A22A(1)		breast(2)|endometrium(3)|lung(4)|ovary(1)|skin(1)	11						GTTCAGATGCGGACCAGCGAG	0.493																																																	1	Substitution - coding silent(1)	ovary(1)											34.0	42.0	39.0					2																	181846835		2202	4279	6481	SO:0001819	synonymous_variant	0			AB017644	CCDS2282.1	2q31.3	2011-05-19	2011-05-19		ENSG00000170035	ENSG00000170035		"""Ubiquitin-conjugating enzymes E2"""	12479	protein-coding gene	gene with protein product		604151	"""ubiquitin-conjugating enzyme E2E 3 (homologous to yeast UBC4/5)"", ""ubiquitin-conjugating enzyme E2E 3 (UBC4/5 homolog, yeast)"""			10343118	Standard	NM_006357		Approved	UbcH9	uc002unq.1	Q969T4	OTTHUMG00000132585	ENST00000410062.4:c.66G>A	2.37:g.181846835G>A			B2RAD6|D3DPG3|Q5U0R7|Q7Z4W4	Silent	SNP	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	p.A22	ENST00000410062.4	37	c.66	CCDS2282.1	2																																																																																			UBE2E3	-	NULL	ENSG00000170035		0.493	UBE2E3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE2E3	HGNC	protein_coding	OTTHUMT00000255795.6	-	0.00	46	0	G	NM_006357		181846835	+1	tier1	-	no_errors	ENST00000392415	ensembl	human	known	74_37	silent	44.74	21	17	SNP	0.007	A
UBE4B	10277	genome.wustl.edu	37	1	10218487	10218487	+	Missense_Mutation	SNP	T	T	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:10218487T>A	ENST00000253251.8	+	21	3452	c.2613T>A	c.(2611-2613)ttT>ttA	p.F871L	UBE4B_ENST00000377157.3_Missense_Mutation_p.F755L|UBE4B_ENST00000343090.6_Missense_Mutation_p.F1000L					ubiquitination factor E4B											NS(3)|breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(14)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	48		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)		GCACCATTTTTAAAAGCCTTT	0.433																																																	0													113.0	112.0	112.0					1																	10218487		2203	4300	6503	SO:0001583	missense	0			AF091093	CCDS110.1, CCDS41245.1	1p36.1	2013-01-28	2011-05-19		ENSG00000130939	ENSG00000130939		"""U-box domain containing"""	12500	protein-coding gene	gene with protein product		613565	"""ubiquitination factor E4B (homologous to yeast UFD2)"", ""ubiquitination factor E4B (UFD2 homolog, yeast)"""			9734811, 10089879	Standard	NM_006048		Approved	UBOX3, E4, UFD2, KIAA0684	uc001aqs.4	O95155	OTTHUMG00000001797	ENST00000253251.8:c.2613T>A	1.37:g.10218487T>A	ENSP00000253251:p.Phe871Leu			Missense_Mutation	SNP	pfam_Ub_conjug_fac_E4_core,pfam_Ubox_domain,smart_Ubox_domain	p.F1000L	ENST00000253251.8	37	c.3000	CCDS110.1	1	.	.	.	.	.	.	.	.	.	.	T	14.21	2.468900	0.43839	.	.	ENSG00000130939	ENST00000253251;ENST00000377157;ENST00000343090	T;T;T	0.41065	1.01;1.01;1.01	5.32	0.152	0.14893	Ubiquitin conjugation factor E4, core (1);	0.000000	0.85682	D	0.000000	T	0.12987	0.0315	N	0.01824	-0.7	0.58432	D	0.999991	B;B	0.23854	0.053;0.092	B;B	0.23574	0.047;0.028	T	0.34950	-0.9808	10	0.02654	T	1	-19.9233	9.4255	0.38576	0.0:0.4878:0.0:0.5122	.	1000;871	O95155;O95155-2	UBE4B_HUMAN;.	L	871;755;1000	ENSP00000253251:F871L;ENSP00000366362:F755L;ENSP00000343001:F1000L	ENSP00000253251:F871L	F	+	3	2	UBE4B	10141074	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	1.832000	0.39151	0.055000	0.16094	0.460000	0.39030	TTT	UBE4B	-	pfam_Ub_conjug_fac_E4_core	ENSG00000130939		0.433	UBE4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE4B	HGNC	protein_coding	OTTHUMT00000005017.1	-	0.00	80	0	T	NM_006048		10218487	+1	tier1	-	no_errors	ENST00000343090	ensembl	human	known	74_37	missense	6.10	77	5	SNP	1.000	A
UBR5	51366	genome.wustl.edu	37	8	103274200	103274200	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr8:103274200G>C	ENST00000520539.1	-	55	8391	c.7785C>G	c.(7783-7785)ttC>ttG	p.F2595L	UBR5_ENST00000220959.4_Missense_Mutation_p.F2594L|UBR5_ENST00000518205.1_Missense_Mutation_p.F323L|UBR5_ENST00000521922.1_Missense_Mutation_p.F2588L	NM_001282873.1|NM_015902.5	NP_001269802.1|NP_056986.2	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin 5	2595	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of protein import into nucleus, translocation (GO:0033160)|progesterone receptor signaling pathway (GO:0050847)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-ubiquitin ligase activity (GO:0034450)|zinc ion binding (GO:0008270)			NS(1)|breast(13)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(19)|liver(1)|lung(51)|ovary(6)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	124	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			CCATTGCTGAGAAAACAGCAT	0.403																																					Ovarian(131;96 1741 5634 7352 27489)												0													140.0	135.0	136.0					8																	103274200		2203	4300	6503	SO:0001583	missense	0			AF006010	CCDS34933.1, CCDS64946.1	8q22	2008-06-23	2007-06-19	2007-06-19	ENSG00000104517	ENSG00000104517		"""Ubiquitin protein ligase E3 component n-recognins"""	16806	protein-coding gene	gene with protein product		608413	"""E3 ubiquitin protein ligase, HECT domain containing, 1"""	EDD1		10030672, 16055722	Standard	NM_015902		Approved	DD5, HYD, EDD, KIAA0896	uc003ykr.2	O95071	OTTHUMG00000164755	ENST00000520539.1:c.7785C>G	8.37:g.103274200G>C	ENSP00000429084:p.Phe2595Leu		B2RP24|J3KMW7|O94970|Q9NPL3	Missense_Mutation	SNP	pfam_HECT,pfam_E3_UbLigase_EDD_UBA,pfam_PABP_HYD,pfam_Znf_N-recognin,superfamily_HECT,superfamily_PABP_HYD,superfamily_RCC1/BLIP-II,smart_Znf_N-recognin_met,smart_PABP_HYD,smart_HECT,pfscan_HECT,pfscan_Znf_N-recognin	p.F2595L	ENST00000520539.1	37	c.7785	CCDS34933.1	8	.	.	.	.	.	.	.	.	.	.	G	14.15	2.448937	0.43531	.	.	ENSG00000104517	ENST00000520539;ENST00000220959;ENST00000518205;ENST00000521922	T;T;T;T	0.54479	0.57;0.57;0.57;0.57	5.48	2.68	0.31781	HECT (4);	0.000000	0.85682	D	0.000000	T	0.31389	0.0795	N	0.05608	-0.01	0.46749	D	0.99918	B;B	0.20887	0.049;0.049	B;B	0.34346	0.18;0.18	T	0.07712	-1.0758	10	0.32370	T	0.25	.	6.0031	0.19531	0.435:0.0:0.565:0.0	.	2588;2595	E7EMW7;O95071	.;UBR5_HUMAN	L	2595;2594;323;2588	ENSP00000429084:F2595L;ENSP00000220959:F2594L;ENSP00000428693:F323L;ENSP00000427819:F2588L	ENSP00000220959:F2594L	F	-	3	2	UBR5	103343376	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.643000	0.37217	1.307000	0.44944	0.585000	0.79938	TTC	UBR5	-	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT	ENSG00000104517		0.403	UBR5-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	UBR5	HGNC	protein_coding	OTTHUMT00000380075.2	-	0.00	91	0	G	NM_015902		103274200	-1	tier1	-	no_errors	ENST00000520539	ensembl	human	known	74_37	missense	17.81	60	13	SNP	1.000	C
UNC80	285175	genome.wustl.edu	37	2	210737501	210737501	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr2:210737501G>C	ENST00000439458.1	+	23	3733	c.3653G>C	c.(3652-3654)aGa>aCa	p.R1218T	UNC80_ENST00000272845.6_Missense_Mutation_p.R1213T	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	1218					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						GTGGTGGCCAGAGCAGCCTTG	0.463																																																	0													87.0	81.0	83.0					2																	210737501		692	1591	2283	SO:0001583	missense	0			AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.3653G>C	2.37:g.210737501G>C	ENSP00000391088:p.Arg1218Thr		B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Missense_Mutation	SNP	NULL	p.R1218T	ENST00000439458.1	37	c.3653	CCDS46504.1	2	.	.	.	.	.	.	.	.	.	.	G	32	5.155530	0.94686	.	.	ENSG00000144406	ENST00000439458;ENST00000272845	T;T	0.59772	0.24;0.25	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	T	0.74928	0.3781	L	0.57536	1.79	0.80722	D	1	D	0.61080	0.989	D	0.75020	0.985	T	0.75074	-0.3446	10	0.87932	D	0	-16.2765	20.3552	0.98837	0.0:0.0:1.0:0.0	.	1218	Q8N2C7	UNC80_HUMAN	T	1218;1213	ENSP00000391088:R1218T;ENSP00000272845:R1213T	ENSP00000272845:R1213T	R	+	2	0	UNC80	210445746	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.869000	0.99810	2.812000	0.96745	0.557000	0.71058	AGA	UNC80	-	NULL	ENSG00000144406		0.463	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC80	HGNC	protein_coding		-	0.00	30	0	G	NM_182587		210737501	+1	tier1	-	no_errors	ENST00000439458	ensembl	human	known	74_37	missense	31.43	24	11	SNP	1.000	C
UPF3A	65110	genome.wustl.edu	37	13	115067486	115067486	+	Nonsense_Mutation	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr13:115067486C>T	ENST00000375299.3	+	9	1344	c.1288C>T	c.(1288-1290)Cga>Tga	p.R430*	UPF3A_ENST00000475218.2_3'UTR|UPF3A_ENST00000351487.5_Nonsense_Mutation_p.R397*	NM_023011.3	NP_075387.1	Q9H1J1	REN3A_HUMAN	UPF3 regulator of nonsense transcripts homolog A (yeast)	430	Required for association with EIF4A3 and ECJ core components CASC3, MAGOH and RBM8A.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA transport (GO:0051028)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nucleocytoplasmic transport (GO:0006913)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			autonomic_ganglia(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	16	Lung NSC(43;0.00299)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0191)|all_epithelial(44;0.00716)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.238)	BRCA - Breast invasive adenocarcinoma(86;0.0886)	OV - Ovarian serous cystadenocarcinoma(48;0.195)|Epithelial(10;0.2)		CAGAAAAGAGCGACTGGCAAA	0.552																																																	0													22.0	29.0	27.0					13																	115067486		2168	4273	6441	SO:0001587	stop_gained	0			AF318575	CCDS9543.1, CCDS9544.1	13q34	2010-04-30			ENSG00000169062	ENSG00000169062			20332	protein-coding gene	gene with protein product		605530				11113196, 11163187	Standard	NM_023011		Approved	RENT3A, UPF3, HUPF3A	uc001vup.3	Q9H1J1	OTTHUMG00000017403	ENST00000375299.3:c.1288C>T	13.37:g.115067486C>T	ENSP00000364448:p.Arg430*		A2A366|Q5T8C3|Q5T8C9|Q7Z6N3|Q86YK1|Q9BZI8	Nonsense_Mutation	SNP	pfam_Nonsense_mediated_decay_UPF3	p.R430*	ENST00000375299.3	37	c.1288	CCDS9543.1	13	.	.	.	.	.	.	.	.	.	.	C	13.10	2.135651	0.37728	.	.	ENSG00000169062	ENST00000375299;ENST00000351487;ENST00000543577	.	.	.	5.05	-0.0725	0.13739	.	0.325090	0.31188	N	0.008099	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	3.0609	3.1313	0.06424	0.1247:0.5522:0.1211:0.202	.	.	.	.	X	430;397;162	.	.	R	+	1	2	UPF3A	114085588	0.971000	0.33674	0.000000	0.03702	0.067000	0.16453	0.481000	0.22260	-0.291000	0.09012	0.655000	0.94253	CGA	UPF3A	-	NULL	ENSG00000169062		0.552	UPF3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UPF3A	HGNC	protein_coding	OTTHUMT00000045968.2		0.00	29	0	C			115067486	+1			no_errors	ENST00000375299	ensembl	human	known	74_37	nonsense	6.00	47	3	SNP	0.460	T
UPRT	139596	genome.wustl.edu	37	X	74523419	74523419	+	3'UTR	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chrX:74523419C>T	ENST00000373383.4	+	0	1170				UPRT_ENST00000373379.1_3'UTR|UPRT_ENST00000530743.1_3'UTR	NM_145052.3	NP_659489.1	Q96BW1	UPP_HUMAN	uracil phosphoribosyltransferase (FUR1) homolog (S. cerevisiae)						female pregnancy (GO:0007565)|lactation (GO:0007595)|response to insulin (GO:0032868)|UMP biosynthetic process (GO:0006222)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(7)|kidney(2)|large_intestine(4)|lung(4)	18						TTTACTGATTCACTTGAGGGT	0.279																																																	0																																										SO:0001624	3_prime_UTR_variant	0			BC015116	CCDS14429.1	Xq13.3	2009-01-14			ENSG00000094841	ENSG00000094841			28334	protein-coding gene	gene with protein product		300656				12477932	Standard	NM_145052		Approved	DKFZp781E1243, MGC23937, FUR1, RP11-311P8.3	uc004ecb.2	Q96BW1	OTTHUMG00000021864	ENST00000373383.4:c.*73C>T	X.37:g.74523419C>T			Q5JRL1|Q5JRL3|Q68DN0|Q96MW2	RNA	SNP	-	NULL	ENST00000373383.4	37	NULL	CCDS14429.1	X																																																																																			UPRT	-	-	ENSG00000094841		0.279	UPRT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UPRT	HGNC	protein_coding	OTTHUMT00000057278.1	-	0.00	35	0	C	NM_145052		74523419	+1	tier1	-	no_errors	ENST00000474175	ensembl	human	known	74_37	rna	40.91	26	18	SNP	0.000	T
URI1	8725	genome.wustl.edu	37	19	30414647	30414647	+	Silent	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr19:30414647C>T	ENST00000360605.4	+	1	97	c.49C>T	c.(49-51)Ctg>Ttg	p.L17L		NM_001252641.1	NP_001239570.1	O94763	RMP_HUMAN	URI1, prefoldin-like chaperone	0					cellular response to growth factor stimulus (GO:0071363)|cellular response to steroid hormone stimulus (GO:0071383)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of phosphatase activity (GO:0010923)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein folding (GO:0006457)|regulation of cell growth (GO:0001558)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to virus (GO:0009615)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, core complex (GO:0005665)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|prefoldin complex (GO:0016272)	chromatin binding (GO:0003682)|protein phosphatase inhibitor activity (GO:0004864)|RNA polymerase II transcription corepressor activity (GO:0001106)										TAAGAGGGCTCTGGCATATGC	0.468																																																	0																																										SO:0001819	synonymous_variant	0			AF091095	CCDS12420.1, CCDS58658.1	19q12	2012-04-17	2011-11-21	2011-11-21	ENSG00000105176	ENSG00000105176		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	13236	protein-coding gene	gene with protein product	"""unconventional prefoldin RPB5 interactor"", ""RPB5-mediating protein"", ""protein phosphatase 1, regulatory subunit 19"""	603494	"""chromosome 19 open reading frame 2"""	C19orf2		9878255, 9819440	Standard	NM_003796		Approved	RMP, NNX3, FLJ10575, URI, PPP1R19	uc002nsr.3	O94763		ENST00000360605.4:c.49C>T	19.37:g.30414647C>T			A8K805|H7BY42|Q8TC23|Q9UNU3	Silent	SNP	pfam_Prefoldin_subunit_alpha,superfamily_Prefoldin	p.L17	ENST00000360605.4	37	c.49	CCDS58658.1	19																																																																																			URI1	-	NULL	ENSG00000105176		0.468	URI1-003	PUTATIVE	basic|appris_candidate|exp_conf|CCDS	protein_coding	URI1	HGNC	protein_coding	OTTHUMT00000439752.1	-	0.00	64	0	C	NM_134447		30414647	+1	tier1	-	no_errors	ENST00000360605	ensembl	human	putative	74_37	silent	20.69	23	6	SNP	0.000	T
URI1	8725	genome.wustl.edu	37	19	30499999	30499999	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr19:30499999G>T	ENST00000542441.2	+	8	1071	c.774G>T	c.(772-774)atG>atT	p.M258I	URI1_ENST00000360605.4_Missense_Mutation_p.M240I|URI1_ENST00000392271.1_Missense_Mutation_p.M182I|URI1_ENST00000312051.6_Missense_Mutation_p.M218I			O94763	RMP_HUMAN	URI1, prefoldin-like chaperone	258					cellular response to growth factor stimulus (GO:0071363)|cellular response to steroid hormone stimulus (GO:0071383)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of phosphatase activity (GO:0010923)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein folding (GO:0006457)|regulation of cell growth (GO:0001558)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to virus (GO:0009615)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, core complex (GO:0005665)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|prefoldin complex (GO:0016272)	chromatin binding (GO:0003682)|protein phosphatase inhibitor activity (GO:0004864)|RNA polymerase II transcription corepressor activity (GO:0001106)										TGAATGCGATGCATCAAGTAA	0.403																																																	0													149.0	122.0	131.0					19																	30499999		2203	4300	6503	SO:0001583	missense	0			AF091095	CCDS12420.1, CCDS58658.1	19q12	2012-04-17	2011-11-21	2011-11-21	ENSG00000105176	ENSG00000105176		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	13236	protein-coding gene	gene with protein product	"""unconventional prefoldin RPB5 interactor"", ""RPB5-mediating protein"", ""protein phosphatase 1, regulatory subunit 19"""	603494	"""chromosome 19 open reading frame 2"""	C19orf2		9878255, 9819440	Standard	NM_003796		Approved	RMP, NNX3, FLJ10575, URI, PPP1R19	uc002nsr.3	O94763		ENST00000542441.2:c.774G>T	19.37:g.30499999G>T	ENSP00000442436:p.Met258Ile		A8K805|H7BY42|Q8TC23|Q9UNU3	Missense_Mutation	SNP	pfam_Prefoldin_subunit_alpha,superfamily_Prefoldin	p.M258I	ENST00000542441.2	37	c.774	CCDS12420.1	19	.	.	.	.	.	.	.	.	.	.	G	6.756	0.508385	0.12883	.	.	ENSG00000105176	ENST00000360605;ENST00000392271;ENST00000542441;ENST00000312051	T;T;T	0.07688	3.17;3.17;3.17	5.57	0.256	0.15567	.	1.186130	0.05654	N	0.585637	T	0.05456	0.0144	N	0.25647	0.755	0.09310	N	1	B;B;B	0.06786	0.0;0.0;0.001	B;B;B	0.04013	0.001;0.001;0.001	T	0.44190	-0.9344	10	0.32370	T	0.25	0.1488	0.26	0.00217	0.3487:0.1394:0.2009:0.311	.	218;258;256	F8W9T0;O94763;Q8TC23	.;RMP_HUMAN;.	I	256;182;258;218	ENSP00000376097:M182I;ENSP00000442436:M258I;ENSP00000312530:M218I	ENSP00000312530:M218I	M	+	3	0	C19orf2	35191839	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.110000	0.10824	0.210000	0.20664	0.313000	0.20887	ATG	URI1	-	NULL	ENSG00000105176		0.403	URI1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	URI1	HGNC	protein_coding	OTTHUMT00000439756.1		0.00	38	0	G	NM_134447		30499999	+1			no_errors	ENST00000542441	ensembl	human	known	74_37	missense	5.00	38	2	SNP	0.000	T
URM1	81605	genome.wustl.edu	37	9	131133692	131133692	+	Silent	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr9:131133692C>T	ENST00000372853.4	+	1	95	c.33C>T	c.(31-33)ttC>ttT	p.F11F	URM1_ENST00000452446.1_Silent_p.F11F|URM1_ENST00000372850.1_Silent_p.F11F|URM1_ENST00000372847.1_Silent_p.F11F	NM_001265582.1|NM_030914.3	NP_001252511.1|NP_112176.1			ubiquitin related modifier 1											cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)	5						AGGTGGAGTTCGGGTGAGTCA	0.627																																																	0													47.0	49.0	49.0					9																	131133692		2203	4300	6503	SO:0001819	synonymous_variant	0			AK097029	CCDS6900.1, CCDS48035.1, CCDS59148.1	9q34.13	2010-06-24	2010-06-24	2006-11-28	ENSG00000167118	ENSG00000167118			28378	protein-coding gene	gene with protein product		612693	"""chromosome 9 open reading frame 74"", ""ubiquitin related modifier 1 homolog (S. cerevisiae)"""	C9orf74		16046629, 16864801	Standard	NM_030914		Approved	MGC2668	uc011may.2	Q9BTM9	OTTHUMG00000020742	ENST00000372853.4:c.33C>T	9.37:g.131133692C>T				Silent	SNP	pfam_Urm1,superfamily_Mopterin_synth/thiamin_S_b	p.F11	ENST00000372853.4	37	c.33	CCDS6900.1	9																																																																																			URM1	-	pfam_Urm1,superfamily_Mopterin_synth/thiamin_S_b	ENSG00000167118		0.627	URM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	URM1	HGNC	protein_coding	OTTHUMT00000054422.1	-	0.00	57	0	C	NM_030914		131133692	+1	tier1	-	no_errors	ENST00000452446	ensembl	human	known	74_37	silent	11.84	67	9	SNP	1.000	T
USH2A	7399	genome.wustl.edu	37	1	215931947	215931947	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:215931947C>G	ENST00000307340.3	-	58	11765	c.11379G>C	c.(11377-11379)tgG>tgC	p.W3793C	USH2A_ENST00000366943.2_Missense_Mutation_p.W3793C	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	3793	Fibronectin type-III 23. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CTGGTGGTATCCAAGCTACAA	0.299										HNSCC(13;0.011)																																							0													138.0	140.0	139.0					1																	215931947		2203	4300	6503	SO:0001583	missense	0			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.11379G>C	1.37:g.215931947C>G	ENSP00000305941:p.Trp3793Cys		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.W3793C	ENST00000307340.3	37	c.11379	CCDS31025.1	1	.	.	.	.	.	.	.	.	.	.	C	17.58	3.424432	0.62733	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	D;D	0.86297	-2.1;-2.1	5.9	5.9	0.94986	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.41712	D	0.000829	D	0.93949	0.8063	M	0.78801	2.425	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93820	0.7118	10	0.87932	D	0	.	20.3398	0.98759	0.0:1.0:0.0:0.0	.	3793	O75445	USH2A_HUMAN	C	3793	ENSP00000305941:W3793C;ENSP00000355910:W3793C	ENSP00000305941:W3793C	W	-	3	0	USH2A	213998570	1.000000	0.71417	0.971000	0.41717	0.560000	0.35617	6.473000	0.73572	2.803000	0.96430	0.586000	0.80456	TGG	USH2A	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000042781		0.299	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	HGNC	protein_coding	OTTHUMT00000128138.1	-	0.00	55	0	C	NM_007123		215931947	-1	tier1	-	no_errors	ENST00000366943	ensembl	human	known	74_37	missense	25.00	33	11	SNP	0.999	G
USP16	10600	genome.wustl.edu	37	21	30410683	30410683	+	Missense_Mutation	SNP	G	G	C	rs149141484		TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr21:30410683G>C	ENST00000334352.4	+	8	895	c.664G>C	c.(664-666)Gaa>Caa	p.E222Q	USP16_ENST00000399975.3_Missense_Mutation_p.E221Q|USP16_ENST00000535828.1_Intron|USP16_ENST00000399976.2_Missense_Mutation_p.E222Q	NM_001032410.1	NP_001027582.1			ubiquitin specific peptidase 16											breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|prostate(2)	34						AGTGCTTAGAGAACTACTAAA	0.318																																					Melanoma(92;625 1444 27493 34101 44971)												0													86.0	87.0	86.0					21																	30410683		2203	4299	6502	SO:0001583	missense	0			AF126736	CCDS13583.1, CCDS42912.1	21q21	2008-04-11	2005-08-08		ENSG00000156256	ENSG00000156256		"""Ubiquitin-specific peptidases"""	12614	protein-coding gene	gene with protein product		604735	"""ubiquitin specific protease 16"""			12838346	Standard	NM_006447		Approved	Ubp-M	uc002ymy.3	Q9Y5T5	OTTHUMG00000078802	ENST00000334352.4:c.664G>C	21.37:g.30410683G>C	ENSP00000334808:p.Glu222Gln			Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfam_Znf_UBP,smart_Znf_UBP,pfscan_Znf_UBP,pfscan_Peptidase_C19/C67	p.E222Q	ENST00000334352.4	37	c.664	CCDS13583.1	21	.	.	.	.	.	.	.	.	.	.	g	16.00	2.997921	0.54147	.	.	ENSG00000156256	ENST00000399975;ENST00000399976;ENST00000334352	T;T;T	0.32988	1.43;1.43;1.43	4.94	2.08	0.27032	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.213244	0.47852	N	0.000219	T	0.34658	0.0905	L	0.33189	0.99	0.80722	D	1	D;D;D	0.58970	0.957;0.98;0.984	P;P;P	0.58577	0.832;0.753;0.841	T	0.03706	-1.1011	10	0.51188	T	0.08	.	9.1666	0.37054	0.0743:0.276:0.6498:0.0	.	207;221;222	Q9Y5T5-3;Q9Y5T5-2;Q9Y5T5	.;.;UBP16_HUMAN	Q	221;222;222	ENSP00000382857:E221Q;ENSP00000382858:E222Q;ENSP00000334808:E222Q	ENSP00000334808:E222Q	E	+	1	0	USP16	29332554	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	3.485000	0.53208	0.351000	0.24027	-0.187000	0.12897	GAA	USP16	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	ENSG00000156256		0.318	USP16-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	USP16	HGNC	protein_coding	OTTHUMT00000171847.1	-	0.00	48	0	G			30410683	+1	tier1	-	no_errors	ENST00000334352	ensembl	human	known	74_37	missense	7.69	48	4	SNP	1.000	C
USP17L17	100287327	genome.wustl.edu	37	4	9245880	9245880	+	Frame_Shift_Del	DEL	C	C	-			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr4:9245880delC	ENST00000511568.1	+	1	276	c.276delC	c.(274-276)aacfs	p.N92fs		NM_001256857.1	NP_001243786.1	D6RBQ6	U17LH_HUMAN	ubiquitin specific peptidase 17-like family member 17	92	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)	endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)										GCTACGTGAACGCTTCCTTGC	0.572																																																	0																																										SO:0001589	frameshift_variant	0				CCDS59458.1	4p16.1	2012-10-09			ENSG00000249104	ENSG00000249104			44445	protein-coding gene	gene with protein product							Standard	NM_001256857		Approved		uc031sdl.1	D6RBQ6	OTTHUMG00000160158	ENST00000511568.1:c.276delC	4.37:g.9245880delC	ENSP00000422621:p.Asn92fs			Frame_Shift_Del	DEL	pfam_Peptidase_C19/C67,pfam_HABP4_PAIRBP1-bd,pfscan_Peptidase_C19/C67	p.N92fs	ENST00000511568.1	37	c.276	CCDS59458.1	4																																																																																			USP17L17	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	ENSG00000249104		0.572	USP17L17-001	NOVEL	basic|appris_principal|CCDS	protein_coding	USP17L17	HGNC	protein_coding	OTTHUMT00000359426.1		0.00	11	0	C	NM_001256857		9245880	+1			no_errors	ENST00000511568	ensembl	human	novel	74_37	frame_shift_del	33.33	6	3	DEL	0.997	0
USP33	23032	genome.wustl.edu	37	1	78163138	78163138	+	Missense_Mutation	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:78163138G>A	ENST00000370793.1	-	25	3039	c.2693C>T	c.(2692-2694)tCt>tTt	p.S898F	USP33_ENST00000357428.1_Missense_Mutation_p.S898F|USP33_ENST00000370794.3_Missense_Mutation_p.S867F	NM_015017.4	NP_055832.3	Q8TEY7	UBP33_HUMAN	ubiquitin specific peptidase 33	898	DUSP 2. {ECO:0000255|PROSITE- ProRule:PRU00613}.				axon guidance (GO:0007411)|cell migration (GO:0016477)|centrosome duplication (GO:0051298)|endocytosis (GO:0006897)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|ubiquitin-dependent protein catabolic process (GO:0006511)	cell body (GO:0044297)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|VCB complex (GO:0030891)	cysteine-type endopeptidase activity (GO:0004197)|G-protein coupled receptor binding (GO:0001664)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|prostate(2)|urinary_tract(1)	44						TGTTTCTTCAGAAATCTGGCC	0.393																																					Melanoma(152;72 1870 11110 26780 42647)												0													76.0	83.0	81.0					1																	78163138		2203	4300	6503	SO:0001583	missense	0			AF383173	CCDS678.1, CCDS679.1, CCDS680.1	1p31	2008-02-05	2005-08-08		ENSG00000077254	ENSG00000077254		"""Ubiquitin-specific peptidases"""	20059	protein-coding gene	gene with protein product		615146	"""ubiquitin specific protease 33"""			12838346	Standard	NM_015017		Approved	KIAA1097, VDU1	uc001dht.4	Q8TEY7	OTTHUMG00000009651	ENST00000370793.1:c.2693C>T	1.37:g.78163138G>A	ENSP00000359829:p.Ser898Phe		Q8TEY6|Q96AV6|Q9H9F0|Q9UPQ5	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfam_Pept_C19_DUSP,pfam_Znf_UBP,smart_Znf_UBP,smart_Pept_C19_DUSP,pfscan_Znf_UBP,pfscan_Peptidase_C19/C67	p.S898F	ENST00000370793.1	37	c.2693	CCDS678.1	1	.	.	.	.	.	.	.	.	.	.	G	28.0	4.884529	0.91814	.	.	ENSG00000077254	ENST00000370794;ENST00000370793;ENST00000357428	T;T;T	0.11495	2.78;2.77;2.77	5.0	5.0	0.66597	Peptidase C19, ubiquitin-specific peptidase, DUSP domain (3);	0.000000	0.85682	D	0.000000	T	0.29321	0.0730	M	0.89601	3.045	0.80722	D	1	P	0.51240	0.943	P	0.57548	0.823	T	0.21690	-1.0238	10	0.54805	T	0.06	.	18.6967	0.91603	0.0:0.0:1.0:0.0	.	898	Q8TEY7	UBP33_HUMAN	F	867;898;898	ENSP00000359830:S867F;ENSP00000359829:S898F;ENSP00000350009:S898F	ENSP00000350009:S898F	S	-	2	0	USP33	77935726	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.318000	0.96334	2.486000	0.83907	0.650000	0.86243	TCT	USP33	-	pfam_Pept_C19_DUSP,smart_Pept_C19_DUSP	ENSG00000077254		0.393	USP33-002	KNOWN	basic|CCDS	protein_coding	USP33	HGNC	protein_coding	OTTHUMT00000026923.2	-	0.00	99	0	G	NM_015017		78163138	-1	tier1	-	no_errors	ENST00000357428	ensembl	human	known	74_37	missense	25.23	83	28	SNP	1.000	A
USP35	57558	genome.wustl.edu	37	11	77924691	77924691	+	Splice_Site	SNP	G	G	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr11:77924691G>T	ENST00000529308.1	+	11	3150		c.e11-1		USP35_ENST00000530535.1_Splice_Site|USP35_ENST00000441408.2_Splice_Site|USP35_ENST00000530267.1_Splice_Site|USP35_ENST00000526425.1_Splice_Site	NM_020798.2	NP_065849.1	Q9P2H5	UBP35_HUMAN	ubiquitin specific peptidase 35						protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			endometrium(6)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(3)|urinary_tract(1)	23	all_cancers(14;3.77e-18)|all_epithelial(13;6.16e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.04e-25)			TGTGTTCCCAGGAGCAGGAGA	0.552																																																	0													40.0	41.0	41.0					11																	77924691		1930	4127	6057	SO:0001630	splice_region_variant	0			AB037793	CCDS41693.1	11q13.4	2008-02-05	2005-08-08			ENSG00000118369		"""Ubiquitin-specific peptidases"""	20061	protein-coding gene	gene with protein product			"""ubiquitin specific protease 35"""			12838346	Standard	NM_020798		Approved	KIAA1372	uc021qny.1	Q9P2H5		ENST00000529308.1:c.2890-1G>T	11.37:g.77924691G>T				Splice_Site	SNP	-	e10-1	ENST00000529308.1	37	c.2890-1	CCDS41693.1	11	.	.	.	.	.	.	.	.	.	.	g	21.2	4.117088	0.77323	.	.	ENSG00000118369	ENST00000530267;ENST00000529308;ENST00000441408;ENST00000526425	.	.	.	4.7	4.7	0.59300	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.842	0.88718	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	USP35	77602339	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	6.719000	0.74718	2.436000	0.82500	0.558000	0.71614	.	USP35	-	-	ENSG00000118369		0.552	USP35-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	USP35	HGNC	protein_coding	OTTHUMT00000390026.1	-	0.00	51	0	G	XM_290527	Intron	77924691	+1	tier1	-	no_errors	ENST00000529308	ensembl	human	known	74_37	splice_site	8.00	46	4	SNP	1.000	T
USP53	54532	genome.wustl.edu	37	4	120213663	120213663	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr4:120213663G>T	ENST00000274030.6	+	19	3698	c.2519G>T	c.(2518-2520)gGt>gTt	p.G840V	USP53_ENST00000450251.1_Missense_Mutation_p.G840V	NM_019050.2	NP_061923.2			ubiquitin specific peptidase 53											breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(5)|ovary(1)|pancreas(1)|skin(2)|stomach(1)	27						GAGAGAACAGGTTTGCCTTTT	0.383																																																	0													85.0	79.0	81.0					4																	120213663		1853	4090	5943	SO:0001583	missense	0			BC017382	CCDS43265.1	4q26	2010-05-12	2005-08-08		ENSG00000145390	ENSG00000145390		"""Ubiquitin-specific peptidases"""	29255	protein-coding gene	gene with protein product			"""ubiquitin specific protease 53"""			10718198, 14715245	Standard	NM_019050		Approved	KIAA1350	uc003ics.4	Q70EK8	OTTHUMG00000161331	ENST00000274030.6:c.2519G>T	4.37:g.120213663G>T	ENSP00000274030:p.Gly840Val			Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	p.G840V	ENST00000274030.6	37	c.2519	CCDS43265.1	4	.	.	.	.	.	.	.	.	.	.	G	12.26	1.885623	0.33255	.	.	ENSG00000145390	ENST00000274030;ENST00000450251	T;T	0.49139	0.79;0.79	5.4	2.58	0.30949	.	0.470387	0.21386	N	0.075399	T	0.36853	0.0982	M	0.61703	1.905	0.18873	N	0.999985	P	0.42409	0.779	B	0.34242	0.178	T	0.38436	-0.9661	10	0.66056	D	0.02	-11.7166	5.4223	0.16407	0.2586:0.2424:0.499:0.0	.	840	Q70EK8	UBP53_HUMAN	V	840	ENSP00000274030:G840V;ENSP00000409906:G840V	ENSP00000274030:G840V	G	+	2	0	USP53	120433111	0.016000	0.18221	0.950000	0.38849	0.921000	0.55340	0.387000	0.20718	0.771000	0.33359	0.585000	0.79938	GGT	USP53	-	NULL	ENSG00000145390		0.383	USP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP53	HGNC	protein_coding	OTTHUMT00000364564.2	-	0.00	53	0	G	XM_052597		120213663	+1	tier1	-	no_errors	ENST00000274030	ensembl	human	known	74_37	missense	6.06	62	4	SNP	0.005	T
VEGFB	7423	genome.wustl.edu	37	11	64005110	64005110	+	3'UTR	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr11:64005110C>G	ENST00000309422.2	+	0	925				VEGFB_ENST00000426086.2_Silent_p.L176L	NM_001243733.1|NM_003377.4	NP_001230662.1|NP_003368.1	P49765	VEGFB_HUMAN	vascular endothelial growth factor B						angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|coronary vasculature development (GO:0060976)|induction of positive chemotaxis (GO:0050930)|negative regulation of apoptotic process (GO:0043066)|negative regulation of gene expression (GO:0010629)|negative regulation of neuron apoptotic process (GO:0043524)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive chemotaxis (GO:0050918)|positive regulation of cell division (GO:0051781)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of mast cell chemotaxis (GO:0060754)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation of vascular wound healing (GO:0035470)|protein O-linked glycosylation (GO:0006493)|response to drug (GO:0042493)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|platelet alpha granule lumen (GO:0031093)	chemoattractant activity (GO:0042056)|heparin binding (GO:0008201)|vascular endothelial growth factor receptor 1 binding (GO:0043183)			endometrium(2)|large_intestine(2)|prostate(1)|stomach(1)	6					Aflibercept(DB08885)	GCTTAGAGCTCAACCCAGACA	0.677																																																	0													5.0	6.0	6.0					11																	64005110		2095	4104	6199	SO:0001624	3_prime_UTR_variant	0			BC008818	CCDS8062.1, CCDS58144.1	11q13	2005-09-29				ENSG00000173511			12681	protein-coding gene	gene with protein product		601398		VRF		8637916, 8919691	Standard	NM_001243733		Approved	VEGFL	uc001nyw.3	P49765		ENST00000309422.2:c.*5C>G	11.37:g.64005110C>G			Q16528	Silent	SNP	pfam_PDGF/VEGF_dom,superfamily_VEGF_C,smart_PDGF/VEGF_dom,pfscan_PDGF/VEGF_dom	p.L176	ENST00000309422.2	37	c.528	CCDS8062.1	11																																																																																			VEGFB	-	superfamily_VEGF_C	ENSG00000173511		0.677	VEGFB-001	KNOWN	basic|CCDS	protein_coding	VEGFB	HGNC	protein_coding	OTTHUMT00000396393.2		0.00	29	0	C	NM_003377		64005110	+1			no_errors	ENST00000426086	ensembl	human	known	74_37	silent	9.52	19	2	SNP	1.000	G
VSX1	30813	genome.wustl.edu	37	20	25059403	25059403	+	Intron	SNP	G	G	A	rs373947722		TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr20:25059403G>A	ENST00000376709.4	-	3	891				VSX1_ENST00000444511.2_Intron|VSX1_ENST00000429762.3_Intron|VSX1_ENST00000424574.1_Intron|VSX1_ENST00000451258.1_Intron|VSX1_ENST00000376707.3_Missense_Mutation_p.S230L	NM_014588.5	NP_055403.2	Q9NZR4	VSX1_HUMAN	visual system homeobox 1						neuron maturation (GO:0042551)|response to stimulus (GO:0050896)|retinal bipolar neuron differentiation (GO:0060040)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(3)|lung(2)	6						TTGGCTCACTGAATGTGGGAA	0.527																																																	0													188.0	173.0	179.0					20																	25059403		1327	2309	3636	SO:0001627	intron_variant	0			AF176797	CCDS13168.1, CCDS13169.1, CCDS58766.1, CCDS58767.1	20p11.21	2014-02-14	2007-07-12		ENSG00000100987	ENSG00000100987		"""Homeoboxes / PRD class"""	12723	protein-coding gene	gene with protein product		605020	"""posterior polymorphous corneal dystrophy"", ""visual system homeobox 1 homolog, CHX10-like (zebrafish)"""	PPCD		10673340	Standard	NM_001256272		Approved	PPD, PPCD1	uc002wuf.4	Q9NZR4	OTTHUMG00000032111	ENST00000376709.4:c.627+61C>T	20.37:g.25059403G>A			B9EGJ4|D1MF28|Q0GM60|Q0GM61|Q0GM62|Q0GM63|Q0GM64|Q0GM65|Q5TF40|Q5TF41|Q9HCU3|Q9NU27	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.S230L	ENST00000376709.4	37	c.689	CCDS13168.1	20	.	.	.	.	.	.	.	.	.	.	G	13.14	2.147855	0.37923	.	.	ENSG00000100987	ENST00000376707	D	0.92199	-2.99	3.36	0.26	0.15588	.	.	.	.	.	D	0.82976	0.5154	.	.	.	0.09310	N	1	B	0.13145	0.007	B	0.12156	0.007	T	0.69168	-0.5216	8	0.42905	T	0.14	.	0.598	0.00740	0.2336:0.1958:0.3699:0.2007	.	230	Q9NZR4-2	.	L	230	ENSP00000365897:S230L	ENSP00000365897:S230L	S	-	2	0	VSX1	25007403	0.000000	0.05858	0.000000	0.03702	0.063000	0.16089	0.115000	0.15540	0.088000	0.17205	0.561000	0.74099	TCA	VSX1	-	NULL	ENSG00000100987		0.527	VSX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VSX1	HGNC	protein_coding	OTTHUMT00000078384.3	-	0.00	104	0	G			25059403	-1	tier1	-	no_errors	ENST00000376707	ensembl	human	known	74_37	missense	7.87	116	10	SNP	0.000	A
VWA5A	4013	genome.wustl.edu	37	11	124006970	124006970	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr11:124006970C>G	ENST00000456829.2	+	13	1745	c.1494C>G	c.(1492-1494)atC>atG	p.I498M	VWA5A_ENST00000360334.4_Intron|VWA5A_ENST00000392748.1_Missense_Mutation_p.I498M	NM_001130142.1	NP_001123614.1	O00534	VMA5A_HUMAN	von Willebrand factor A domain containing 5A	498										autonomic_ganglia(1)|breast(3)|endometrium(5)|kidney(2)|large_intestine(11)|lung(17)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	47						AGAGATTAATCAGCTATGCCC	0.483																																																	0													102.0	96.0	98.0					11																	124006970		2201	4299	6500	SO:0001583	missense	0			AF002672	CCDS8444.1, CCDS8445.1	11q24.1	2008-07-25	2008-07-25	2008-07-25	ENSG00000110002	ENSG00000110002			6658	protein-coding gene	gene with protein product		602929	"""loss of heterozygosity, 11, chromosomal region 2, gene A"""	LOH11CR2A		9417908, 14504409	Standard	NM_001130142		Approved	BCSC-1	uc001pzt.3	O00534	OTTHUMG00000165971	ENST00000456829.2:c.1494C>G	11.37:g.124006970C>G	ENSP00000407726:p.Ile498Met		Q6UN19|Q6UN20|Q9BVF8	Missense_Mutation	SNP	pfam_VIT,pfam_VWF_A,smart_VIT,smart_VWF_A,pfscan_VWF_A	p.I498M	ENST00000456829.2	37	c.1494	CCDS8444.1	11	.	.	.	.	.	.	.	.	.	.	C	12.75	2.032850	0.35893	.	.	ENSG00000110002	ENST00000456829;ENST00000392748	T;T	0.04862	3.54;3.54	5.35	-1.02	0.10135	.	0.061318	0.64402	D	0.000004	T	0.20536	0.0494	M	0.85299	2.745	0.52099	D	0.999941	D	0.76494	0.999	D	0.68353	0.957	T	0.01228	-1.1412	10	0.34782	T	0.22	-26.0355	9.9084	0.41390	0.0:0.4343:0.0:0.5657	.	498	O00534	VMA5A_HUMAN	M	498	ENSP00000407726:I498M;ENSP00000376504:I498M	ENSP00000376504:I498M	I	+	3	3	VWA5A	123512180	0.001000	0.12720	0.041000	0.18516	0.552000	0.35366	-0.203000	0.09438	-0.204000	0.10235	0.650000	0.86243	ATC	VWA5A	-	NULL	ENSG00000110002		0.483	VWA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VWA5A	HGNC	protein_coding	OTTHUMT00000387273.1	-	0.00	23	0	C	NM_014622		124006970	+1	tier1	-	no_errors	ENST00000392748	ensembl	human	known	74_37	missense	13.64	38	6	SNP	0.008	G
WDPCP	51057	genome.wustl.edu	37	2	63631310	63631310	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr2:63631310G>T	ENST00000272321.7	-	10	1835	c.1308C>A	c.(1306-1308)agC>agA	p.S436R	WDPCP_ENST00000409120.1_Missense_Mutation_p.S244R|WDPCP_ENST00000409199.1_Missense_Mutation_p.S244R|WDPCP_ENST00000409835.1_5'UTR|WDPCP_ENST00000398544.3_Missense_Mutation_p.S277R|WDPCP_ENST00000409562.3_Missense_Mutation_p.S436R	NM_015910.5	NP_056994.3	O95876	FRITZ_HUMAN	WD repeat containing planar cell polarity effector	436					auditory receptor cell morphogenesis (GO:0002093)|camera-type eye development (GO:0043010)|cardiovascular system development (GO:0072358)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|digestive system development (GO:0055123)|embryonic digit morphogenesis (GO:0042733)|establishment of protein localization (GO:0045184)|glomerular visceral epithelial cell migration (GO:0090521)|kidney development (GO:0001822)|palate development (GO:0060021)|regulation of embryonic cell shape (GO:0016476)|regulation of establishment of cell polarity (GO:2000114)|regulation of fibroblast migration (GO:0010762)|regulation of focal adhesion assembly (GO:0051893)|regulation of protein localization (GO:0032880)|regulation of ruffle assembly (GO:1900027)|respiratory system development (GO:0060541)|septin cytoskeleton organization (GO:0032185)|smoothened signaling pathway (GO:0007224)	axonemal basal plate (GO:0097541)|axoneme (GO:0005930)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(19)|ovary(1)|skin(1)	35						GAACAAGACTGCTGGAGGCAT	0.433																																																	0													99.0	95.0	96.0					2																	63631310		1915	4129	6044	SO:0001583	missense	0				CCDS42688.1, CCDS46301.1	2p15	2014-04-24	2011-02-01	2011-02-01	ENSG00000143951	ENSG00000143951			28027	protein-coding gene	gene with protein product		613580	"""chromosome 2 open reading frame 86"""	C2orf86		15654087, 20671153	Standard	NM_015910		Approved	hFrtz, fritz, BBS15	uc002sch.3	O95876	OTTHUMG00000152566	ENST00000272321.7:c.1308C>A	2.37:g.63631310G>T	ENSP00000272321:p.Ser436Arg		Q53RW4|Q7Z2Z3	Missense_Mutation	SNP	pfam_DUF3312,superfamily_WD40_repeat_dom	p.S436R	ENST00000272321.7	37	c.1308	CCDS42688.1	2	.	.	.	.	.	.	.	.	.	.	G	10.56	1.383601	0.25031	.	.	ENSG00000143951	ENST00000272321;ENST00000409199;ENST00000409120;ENST00000398544;ENST00000409562	T;T;T;T;T	0.44482	0.92;0.92;0.92;0.92;0.92	5.52	3.55	0.40652	.	0.227075	0.49916	D	0.000137	T	0.43456	0.1248	M	0.65975	2.015	0.34497	D	0.705617	P;P;B;P	0.49090	0.655;0.919;0.372;0.603	B;P;B;B	0.46275	0.305;0.51;0.202;0.203	T	0.54827	-0.8235	10	0.22706	T	0.39	-3.1702	10.471	0.44638	0.2249:0.0:0.7751:0.0	.	244;436;436;277	E9PFG9;O95876-2;O95876;O95876-3	.;.;FRITZ_HUMAN;.	R	436;244;244;277;436	ENSP00000272321:S436R;ENSP00000386592:S244R;ENSP00000386769:S244R;ENSP00000381552:S277R;ENSP00000387222:S436R	ENSP00000272321:S436R	S	-	3	2	WDPCP	63484814	0.999000	0.42202	1.000000	0.80357	0.951000	0.60555	1.058000	0.30504	0.685000	0.31468	0.591000	0.81541	AGC	WDPCP	-	pfam_DUF3312	ENSG00000143951		0.433	WDPCP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	WDPCP	HGNC	protein_coding	OTTHUMT00000326820.1	-	0.00	53	0	G	NM_015910		63631310	-1	tier1	-	no_errors	ENST00000272321	ensembl	human	known	74_37	missense	43.10	33	25	SNP	1.000	T
WDR47	22911	genome.wustl.edu	37	1	109517260	109517260	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:109517260G>C	ENST00000369962.3	-	14	2737	c.2515C>G	c.(2515-2517)Cat>Gat	p.H839D	WDR47_ENST00000357672.3_Missense_Mutation_p.H811D|WDR47_ENST00000361054.3_Missense_Mutation_p.H811D|WDR47_ENST00000400794.3_Missense_Mutation_p.H847D|WDR47_ENST00000369965.4_Missense_Mutation_p.H840D			O94967	WDR47_HUMAN	WD repeat domain 47	839					multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	20		all_lung(203;0.00519)|all_epithelial(167;0.00611)|Lung NSC(277;0.00822)		Colorectal(144;0.0165)|Lung(183;0.0484)|COAD - Colon adenocarcinoma(174;0.128)|Epithelial(280;0.168)|all cancers(265;0.201)|LUSC - Lung squamous cell carcinoma(189;0.244)		GAATGAGGATGATAACTTTGT	0.438																																																	0													164.0	138.0	147.0					1																	109517260		2203	4300	6503	SO:0001583	missense	0			AB020700	CCDS30787.1, CCDS44186.1, CCDS44187.1	1p13.3	2013-01-09			ENSG00000085433	ENSG00000085433		"""WD repeat domain containing"""	29141	protein-coding gene	gene with protein product		615734				10048485	Standard	NM_014969		Approved	KIAA0893	uc001dwl.3	O94967	OTTHUMG00000011734	ENST00000369962.3:c.2515C>G	1.37:g.109517260G>C	ENSP00000358979:p.His839Asp		A8MX09|Q5TYV7|Q5TYV8|Q5TYV9|Q8IXT7|Q8IYU9	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_LisH_dimerisation,smart_CTLH_C,smart_WD40_repeat,pfscan_LisH_dimerisation,pfscan_CTLH_C,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.H847D	ENST00000369962.3	37	c.2539	CCDS44187.1	1	.	.	.	.	.	.	.	.	.	.	G	14.47	2.544749	0.45280	.	.	ENSG00000085433	ENST00000400794;ENST00000369962;ENST00000361054;ENST00000369965;ENST00000357672	T;T;T;T;T	0.59083	0.29;0.29;0.29;0.29;0.29	5.27	5.27	0.74061	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.053413	0.64402	D	0.000001	T	0.22936	0.0554	N	0.02830	-0.485	0.46954	D	0.999264	B;P;B;B	0.36282	0.057;0.546;0.425;0.219	B;B;B;B	0.37267	0.122;0.229;0.121;0.245	T	0.21690	-1.0238	10	0.25751	T	0.34	-14.6273	18.9158	0.92505	0.0:0.0:1.0:0.0	.	811;847;839;840	O94967-2;A8MX09;O94967;O94967-3	.;.;WDR47_HUMAN;.	D	847;839;811;840;811	ENSP00000383599:H847D;ENSP00000358979:H839D;ENSP00000354339:H811D;ENSP00000358982:H840D;ENSP00000350301:H811D	ENSP00000350301:H811D	H	-	1	0	WDR47	109318783	1.000000	0.71417	0.998000	0.56505	0.832000	0.47134	6.162000	0.71874	2.444000	0.82710	0.655000	0.94253	CAT	WDR47	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000085433		0.438	WDR47-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	WDR47	HGNC	protein_coding	OTTHUMT00000032414.2	-	0.00	28	0	G	NM_014969		109517260	-1	tier1	-	no_errors	ENST00000400794	ensembl	human	known	74_37	missense	15.38	22	4	SNP	1.000	C
WDR64	128025	genome.wustl.edu	37	1	241951283	241951283	+	Missense_Mutation	SNP	C	C	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:241951283C>A	ENST00000366552.2	+	23	3015	c.2808C>A	c.(2806-2808)agC>agA	p.S936R	WDR64_ENST00000437684.2_Missense_Mutation_p.S769R	NM_144625.4	NP_653226.4	B1ANS9	WDR64_HUMAN	WD repeat domain 64	936										breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(17)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)			AAGAAGAAAGCAAGTTCACAG	0.343																																																	0													88.0	88.0	88.0					1																	241951283		2203	4300	6503	SO:0001583	missense	0			AK057540		1q43	2013-01-09			ENSG00000162843	ENSG00000162843		"""WD repeat domain containing"""	26570	protein-coding gene	gene with protein product							Standard	NM_144625		Approved	FLJ32978	uc001hzg.2	B1ANS9	OTTHUMG00000039705	ENST00000366552.2:c.2808C>A	1.37:g.241951283C>A	ENSP00000355510:p.Ser936Arg		B1ANT0|Q7Z573|Q96LY9	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S936R	ENST00000366552.2	37	c.2808		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.44|13.44	2.236888|2.236888	0.39498|0.39498	.|.	.|.	ENSG00000162843|ENSG00000162843	ENST00000425826|ENST00000366552;ENST00000437684;ENST00000414635	.|T;T;T	.|0.43688	.|0.94;0.94;0.94	5.96|5.96	4.02|4.02	0.46733|0.46733	.|.	.|0.166873	.|0.42964	.|D	.|0.000630	T|T	0.39226|0.39226	0.1070|0.1070	L|L	0.54323|0.54323	1.7|1.7	0.24589|0.24589	N|N	0.993834|0.993834	.|P;D	.|0.54601	.|0.907;0.967	.|P;B	.|0.45377	.|0.478;0.439	T|T	0.27468|0.27468	-1.0073|-1.0073	5|10	.|0.37606	.|T	.|0.19	-9.5534|-9.5534	9.0897|9.0897	0.36603|0.36603	0.0:0.8173:0.0:0.1827|0.0:0.8173:0.0:0.1827	.|.	.|936;489	.|B1ANS9;D1MPS4	.|WDR64_HUMAN;.	E|R	415|936;769;540	.|ENSP00000355510:S936R;ENSP00000402446:S769R;ENSP00000406656:S540R	.|ENSP00000355510:S936R	A|S	+|+	2|3	0|2	WDR64|WDR64	240017906|240017906	0.999000|0.999000	0.42202|0.42202	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	0.668000|0.668000	0.25127|0.25127	1.440000|1.440000	0.47531|0.47531	0.643000|0.643000	0.83706|0.83706	GCA|AGC	WDR64	-	NULL	ENSG00000162843		0.343	WDR64-201	KNOWN	basic|appris_principal	protein_coding	WDR64	HGNC	protein_coding		-	0.00	81	0	C	NM_144625		241951283	+1	tier1	-	no_errors	ENST00000366552	ensembl	human	known	74_37	missense	25.76	49	17	SNP	1.000	A
WISP1	8840	genome.wustl.edu	37	8	134225290	134225290	+	Missense_Mutation	SNP	G	G	T	rs202221836		TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr8:134225290G>T	ENST00000250160.6	+	2	359	c.253G>T	c.(253-255)Gac>Tac	p.D85Y	WISP1_ENST00000220856.6_Missense_Mutation_p.D85Y|WISP1_ENST00000517423.1_Missense_Mutation_p.D85Y|WISP1_ENST00000519433.1_Intron|WISP1_ENST00000377863.2_Intron	NM_003882.3	NP_003873.1	O95388	WISP1_HUMAN	WNT1 inducible signaling pathway protein 1	85	IGFBP N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00653}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)				central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	21	all_epithelial(106;5.39e-23)|Lung NSC(106;7.26e-07)|all_lung(105;2.77e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0107)			GCAGCTTGGGGACAACTGCAC	0.637																																																	0													59.0	59.0	59.0					8																	134225290		2203	4300	6503	SO:0001583	missense	0			AF100779	CCDS6371.1, CCDS6372.1, CCDS56555.1, CCDS56556.1	8q24.22	2007-05-14			ENSG00000104415	ENSG00000104415			12769	protein-coding gene	gene with protein product		603398				9843955	Standard	NM_003882		Approved	CCN4	uc003yub.3	O95388	OTTHUMG00000164440	ENST00000250160.6:c.253G>T	8.37:g.134225290G>T	ENSP00000250160:p.Asp85Tyr		A8KAG6|E7EMM5|Q5JBS6|Q5JBS7|Q5JBS8|Q9HCS3	Missense_Mutation	SNP	pfam_IGFBP-like,pfam_VWF_C,pfam_Cys_knot,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_IGFBP-like,smart_VWF_C,smart_Thrombospondin_1_rpt,smart_Cys_knot_C,pirsf_IGFBP_CNN,pfscan_Cys_knot_C,pfscan_Thrombospondin_1_rpt,pfscan_VWF_C	p.D85Y	ENST00000250160.6	37	c.253	CCDS6371.1	8	.	.	.	.	.	.	.	.	.	.	G	26.0	4.698320	0.88830	.	.	ENSG00000104415	ENST00000250160;ENST00000517423;ENST00000220856	T;T;T	0.64991	-0.13;-0.13;-0.13	5.13	5.13	0.70059	Insulin-like growth factor-binding protein, IGFBP (3);Insulin-like growth factor binding protein, N-terminal, Cys-rich conserved site (1);	0.152713	0.56097	D	0.000024	T	0.72740	0.3498	L	0.42245	1.32	0.30488	N	0.771678	D;D;D	0.71674	0.989;0.974;0.998	P;P;D	0.66979	0.883;0.748;0.948	T	0.73646	-0.3917	10	0.72032	D	0.01	-29.0188	17.5582	0.87898	0.0:0.0:1.0:0.0	.	85;85;85	E7EMM5;O95388-2;O95388	.;.;WISP1_HUMAN	Y	85	ENSP00000250160:D85Y;ENSP00000427744:D85Y;ENSP00000220856:D85Y	ENSP00000220856:D85Y	D	+	1	0	WISP1	134294472	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	7.927000	0.87577	2.394000	0.81467	0.549000	0.68633	GAC	WISP1	-	pfam_IGFBP-like,smart_IGFBP-like,pirsf_IGFBP_CNN	ENSG00000104415		0.637	WISP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WISP1	HGNC	protein_coding	OTTHUMT00000378794.2	-	0.00	61	0	G	NM_003882		134225290	+1	tier1	-	no_errors	ENST00000250160	ensembl	human	known	74_37	missense	8.33	55	5	SNP	1.000	T
WTAP	9589	genome.wustl.edu	37	6	160176222	160176222	+	Missense_Mutation	SNP	C	C	G	rs543667028		TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr6:160176222C>G	ENST00000358372.4	+	8	2527	c.770C>G	c.(769-771)tCt>tGt	p.S257C	SOD2_ENST00000546087.1_Intron	NM_001270531.1|NM_004906.4	NP_001257460.1|NP_004897.2	Q15007	FL2D_HUMAN	Wilms tumor 1 associated protein	257					cell cycle (GO:0007049)|mRNA methylation (GO:0080009)|mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)	MIS complex (GO:0036396)|nuclear membrane (GO:0031965)|nuclear speck (GO:0016607)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(6)|prostate(2)|skin(1)|urinary_tract(1)	18		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.75e-18)|BRCA - Breast invasive adenocarcinoma(81;5.93e-06)		ACTACAGCTTCTGAACCTGTA	0.562																																																	0													53.0	47.0	49.0					6																	160176222		2203	4300	6503	SO:0001583	missense	0			AJ276706	CCDS5266.1, CCDS5267.1, CCDS75542.1	6q25-q27	2008-02-05			ENSG00000146457	ENSG00000146457			16846	protein-coding gene	gene with protein product		605442				7788527, 11001926	Standard	NM_004906		Approved	KIAA0105, MGC3925	uc003qsl.4	Q15007	OTTHUMG00000015933	ENST00000358372.4:c.770C>G	6.37:g.160176222C>G	ENSP00000351141:p.Ser257Cys		Q5TCL8|Q5TCL9|Q96T28|Q9BYJ7|Q9H4E2	Missense_Mutation	SNP	NULL	p.S257C	ENST00000358372.4	37	c.770	CCDS5266.1	6	.	.	.	.	.	.	.	.	.	.	C	19.55	3.849077	0.71603	.	.	ENSG00000146457	ENST00000358372	T	0.28069	1.63	6.17	6.17	0.99709	.	0.054807	0.85682	D	0.000000	T	0.35711	0.0941	N	0.24115	0.695	0.80722	D	1	D;D	0.76494	0.999;0.971	D;P	0.65443	0.935;0.789	T	0.13710	-1.0499	10	0.59425	D	0.04	-27.7688	20.8794	0.99867	0.0:1.0:0.0:0.0	.	257;257	A8K489;Q15007	.;FL2D_HUMAN	C	257	ENSP00000351141:S257C	ENSP00000351141:S257C	S	+	2	0	WTAP	160096212	0.997000	0.39634	0.503000	0.27626	0.966000	0.64601	3.583000	0.53928	2.941000	0.99782	0.655000	0.94253	TCT	WTAP	-	NULL	ENSG00000146457		0.562	WTAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WTAP	HGNC	protein_coding	OTTHUMT00000042905.1		0.00	20	0	C	NM_152857		160176222	+1			no_errors	ENST00000358372	ensembl	human	known	74_37	missense	8.70	21	2	SNP	0.811	G
MMP3	4314	genome.wustl.edu	37	11	102707181	102707181	+	Intron	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr11:102707181G>C	ENST00000299855.5	-	10	1590				WTAPP1_ENST00000525739.2_RNA	NM_002422.3	NP_002413.1	P08254	MMP3_HUMAN	matrix metallopeptidase 3 (stromelysin 1, progelatinase)						cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of hydrogen peroxide metabolic process (GO:0010727)|positive regulation of oxidative stress-induced cell death (GO:1903209)|proteolysis (GO:0006508)|regulation of cell migration (GO:0030334)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|endopeptidase activity (GO:0004175)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|large_intestine(3)|liver(1)|lung(7)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	22		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.0142)	Marimastat(DB00786)	tgagcaagttgaggttgagac	0.423																																																	0																																										SO:0001627	intron_variant	0			X05232	CCDS8323.1	11q22.3	2012-10-02	2005-08-08		ENSG00000149968	ENSG00000149968	3.4.24.17		7173	protein-coding gene	gene with protein product		185250	"""matrix metalloproteinase 3 (stromelysin 1, progelatinase)"""	STMY1, STMY			Standard	NM_002422		Approved		uc001phj.1	P08254	OTTHUMG00000048254	ENST00000299855.5:c.1334-224C>G	11.37:g.102707181G>C			B2R8B8|Q3B7S0|Q6GRF8	RNA	SNP	-	NULL	ENST00000299855.5	37	NULL	CCDS8323.1	11																																																																																			WTAPP1	-	-	ENSG00000255282		0.423	MMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WTAPP1	HGNC	protein_coding	OTTHUMT00000109758.2	-	0.00	43	0	G	NM_002422		102707181	+1	tier1	-	no_errors	ENST00000525739	ensembl	human	putative	74_37	rna	40.62	19	13	SNP	0.000	C
TSIX	9383	genome.wustl.edu	37	X	73048909	73048909	+	lincRNA	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chrX:73048909C>T	ENST00000604411.1	+	0	36870				XIST_ENST00000429829.1_lincRNA	NR_003255.2				TSIX transcript, XIST antisense RNA																		TTACTTCATTCAGCTATCCTC	0.463																																																	0													98.0	83.0	87.0					X																	73048909		876	1991	2867			0					Xq13.2	2012-10-19	2012-08-15			ENSG00000270641		"""Long non-coding RNAs"", ""-"""	12377	non-coding RNA	RNA, long non-coding	"""XIST antisense RNA (non-protein coding)"", ""long intergenic non-protein coding RNA 13"""	300181	"""X (inactive)-specific transcript, antisense"", ""TSIX transcript, XIST antisense RNA (non-protein coding)"""			10192391	Standard	NR_003255		Approved	NCRNA00013, XIST-AS1, LINC00013	uc004ebn.2				X.37:g.73048909C>T				RNA	SNP	-	NULL	ENST00000604411.1	37	NULL		X																																																																																			XIST	-	-	ENSG00000229807		0.463	TSIX-001	KNOWN	basic	lincRNA	XIST	HGNC	lincRNA	OTTHUMT00000469120.1	-	0.00	16	0	C	NR_003255		73048909	-1	tier1	-	no_errors	ENST00000429829	ensembl	human	known	74_37	rna	50.00	10	10	SNP	0.266	T
XXYLT1	152002	genome.wustl.edu	37	3	194896403	194896403	+	Intron	SNP	G	G	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr3:194896403G>T	ENST00000310380.6	-	3	761				XXYLT1_ENST00000429994.1_Intron|XXYLT1_ENST00000355729.4_5'Flank|XXYLT1_ENST00000437101.1_5'UTR	NM_152531.4	NP_689744.3	Q8NBI6	XXLT1_HUMAN	xyloside xylosyltransferase 1							endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	transferase activity, transferring pentosyl groups (GO:0016763)										gtggccacatgactagctcct	0.567																																																	0																																										SO:0001627	intron_variant	0			AK075551	CCDS43188.1	3q29	2013-02-22	2011-10-19	2011-10-19	ENSG00000173950	ENSG00000173950		"""Glycosyltransferase family 8 domain containing"""	26639	protein-coding gene	gene with protein product		614552	"""chromosome 3 open reading frame 21"""	C3orf21		22117070	Standard	NM_152531		Approved	FLJ35155	uc003fum.4	Q8NBI6	OTTHUMG00000155915	ENST00000310380.6:c.653-19093C>A	3.37:g.194896403G>T			D3DNW5|Q8NAL3|Q8WV03|Q96ME0	RNA	SNP	-	NULL	ENST00000310380.6	37	NULL	CCDS43188.1	3																																																																																			XXYLT1	-	-	ENSG00000173950		0.567	XXYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XXYLT1	HGNC	protein_coding	OTTHUMT00000342290.1	-	0.00	42	0	G	NM_152531		194896403	-1	tier1	-	no_errors	ENST00000476897	ensembl	human	known	74_37	rna	33.33	18	9	SNP	0.000	T
YAF2	10138	genome.wustl.edu	37	12	42604227	42604227	+	Intron	SNP	G	G	C	rs557526677		TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr12:42604227G>C	ENST00000534854.2	-	2	220				YAF2_ENST00000327791.4_Intron|YAF2_ENST00000380790.4_Intron|YAF2_ENST00000380788.3_Intron|YAF2_ENST00000442791.3_Intron	NM_005748.4	NP_005739.2	Q8IY57	YAF2_HUMAN	YY1 associated factor 2						negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(1)|large_intestine(1)|lung(3)|skin(1)	8	all_cancers(12;0.000425)	Lung NSC(34;0.0402)|all_lung(34;0.057)		GBM - Glioblastoma multiforme(48;0.0514)		TGTTCAGCATGAGAATCTTCC	0.463																																																	0																																										SO:0001627	intron_variant	0			U72209	CCDS31775.1, CCDS53778.1, CCDS53779.1, CCDS53780.1	12q12	2014-09-04			ENSG00000015153	ENSG00000015153			17363	protein-coding gene	gene with protein product		607534				9016636	Standard	NM_001190977		Approved		uc001rmw.3	Q8IY57	OTTHUMG00000169380	ENST00000534854.2:c.152+27173C>G	12.37:g.42604227G>C			A8K5P0|B4DFU3|G3V465|Q99710	Nonsense_Mutation	SNP	pfam_Znf_RanBP2,smart_Znf_RanBP2,pfscan_Znf_RanBP2	p.S119*	ENST00000534854.2	37	c.356	CCDS31775.1	12																																																																																			YAF2	-	NULL	ENSG00000015153		0.463	YAF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YAF2	HGNC	protein_coding	OTTHUMT00000403781.1	-	0.00	32	0	G			42604227	-1	tier1	-	no_errors	ENST00000552928	ensembl	human	known	74_37	nonsense	21.05	45	12	SNP	1.000	C
ZBTB7B	51043	genome.wustl.edu	37	1	154987266	154987266	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:154987266G>C	ENST00000368426.3	+	3	267	c.130G>C	c.(130-132)Gaa>Caa	p.E44Q	ZBTB7B_ENST00000292176.2_Missense_Mutation_p.E44Q|ZBTB7B_ENST00000535420.1_Missense_Mutation_p.E44Q|ZBTB7B_ENST00000417934.2_Missense_Mutation_p.E78Q|ZBTB7B_ENST00000487542.1_3'UTR	NM_001256455.1	NP_001243384.1	O15156	ZBT7B_HUMAN	zinc finger and BTB domain containing 7B	44	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				cell differentiation (GO:0030154)|ectoderm development (GO:0007398)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|kidney(1)|large_intestine(2)|liver(1)|lung(14)|ovary(1)|prostate(3)|skin(3)	29	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			GCAGGGCCTTGAATACCGCAC	0.617																																																	0													67.0	70.0	69.0					1																	154987266		2203	4300	6503	SO:0001583	missense	0			AF007833	CCDS1081.1, CCDS58030.1	1q21.2	2013-01-08		2005-04-07	ENSG00000160685	ENSG00000160685		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	18668	protein-coding gene	gene with protein product	"""zinc finger and BTB domain containing 15"""	607646	"""zinc finger protein 67 homolog (mouse)"""	ZFP67		9370309, 7937772	Standard	NR_045515		Approved	ZBTB15, c-Krox, hcKrox, ZNF857B	uc010peq.3	O15156	OTTHUMG00000037414	ENST00000368426.3:c.130G>C	1.37:g.154987266G>C	ENSP00000357411:p.Glu44Gln		B4E3K5|D3DV83|J3KQQ3|Q68DR2|Q96EP2	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.E78Q	ENST00000368426.3	37	c.232	CCDS1081.1	1	.	.	.	.	.	.	.	.	.	.	G	13.77	2.336404	0.41398	.	.	ENSG00000160685	ENST00000535420;ENST00000368426;ENST00000417934;ENST00000292176	T;T;T;T	0.69040	-0.37;-0.37;-0.37;-0.37	3.59	3.59	0.41128	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.271361	0.30235	N	0.010089	T	0.50326	0.1609	L	0.61036	1.89	0.09310	N	0.999999	P;P;P	0.42735	0.788;0.788;0.788	B;B;B	0.41440	0.357;0.357;0.357	T	0.46148	-0.9212	10	0.46703	T	0.11	.	12.7145	0.57107	0.0:0.0:1.0:0.0	.	44;44;78	A8K6F4;O15156;B4E3K5	.;ZBT7B_HUMAN;.	Q	44;44;78;44	ENSP00000438647:E44Q;ENSP00000357411:E44Q;ENSP00000406286:E78Q;ENSP00000292176:E44Q	ENSP00000292176:E44Q	E	+	1	0	ZBTB7B	153253890	1.000000	0.71417	0.993000	0.49108	0.976000	0.68499	6.656000	0.74396	1.827000	0.53221	0.462000	0.41574	GAA	ZBTB7B	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	ENSG00000160685		0.617	ZBTB7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB7B	HGNC	protein_coding	OTTHUMT00000091083.1	-	0.00	52	0	G	NM_015872		154987266	+1	tier1	-	no_errors	ENST00000417934	ensembl	human	known	74_37	missense	22.58	24	7	SNP	0.247	C
ZBTB37	84614	genome.wustl.edu	37	1	173854791	173854791	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:173854791G>C	ENST00000367701.5	+	4	1232	c.1041G>C	c.(1039-1041)atG>atC	p.M347I	ZBTB37_ENST00000427304.1_Missense_Mutation_p.M347I|ZBTB37_ENST00000367704.1_3'UTR			Q5TC79	ZBT37_HUMAN	zinc finger and BTB domain containing 37	347					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(1)|urinary_tract(4)	13						AGTCAGCAATGATGGGAGTAA	0.403																																																	0													88.0	76.0	80.0					1																	173854791		692	1591	2283	SO:0001583	missense	0			AK057310	CCDS1312.1, CCDS44278.1	1q24.2	2013-01-08			ENSG00000185278	ENSG00000185278		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	28365	protein-coding gene	gene with protein product						12477932	Standard	NM_032522		Approved	MGC2629, ZNF908	uc009wwp.1	Q5TC79	OTTHUMG00000037274	ENST00000367701.5:c.1041G>C	1.37:g.173854791G>C	ENSP00000356674:p.Met347Ile		Q5TC80|Q96M87|Q9BQ88	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.M347I	ENST00000367701.5	37	c.1041	CCDS44278.1	1	.	.	.	.	.	.	.	.	.	.	G	9.587	1.125231	0.20959	.	.	ENSG00000185278	ENST00000427304;ENST00000367703;ENST00000367701	T;T	0.12774	2.65;2.65	5.76	5.76	0.90799	.	0.407861	0.32503	N	0.006012	T	0.05868	0.0153	L	0.43152	1.355	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.16778	-1.0391	10	0.30078	T	0.28	.	11.287	0.49228	0.0:0.1365:0.722:0.1415	.	347	Q5TC79	ZBT37_HUMAN	I	347;255;347	ENSP00000415293:M347I;ENSP00000356674:M347I	ENSP00000356674:M347I	M	+	3	0	ZBTB37	172121414	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	4.239000	0.58694	2.706000	0.92434	0.655000	0.94253	ATG	ZBTB37	-	NULL	ENSG00000185278		0.403	ZBTB37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB37	HGNC	protein_coding	OTTHUMT00000090729.2	-	0.00	66	0	G	NM_032522		173854791	+1	tier1	-	no_errors	ENST00000367701	ensembl	human	known	74_37	missense	26.32	70	25	SNP	1.000	C
ZCCHC24	219654	genome.wustl.edu	37	10	81154181	81154181	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr10:81154181C>G	ENST00000372336.3	-	3	649	c.463G>C	c.(463-465)Gag>Cag	p.E155Q	ZCCHC24_ENST00000372333.3_Missense_Mutation_p.R95P|RP11-342M3.5_ENST00000438554.2_RNA	NM_153367.3	NP_699198.2	Q8N2G6	ZCH24_HUMAN	zinc finger, CCHC domain containing 24	155							poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|large_intestine(3)|lung(1)|skin(1)	9						GTCAGGCCCTCGCCTTTGGGG	0.587																																																	0													98.0	83.0	88.0					10																	81154181		2203	4300	6503	SO:0001583	missense	0			AK075279	CCDS7359.1	10q22.3	2014-02-20	2008-06-23	2008-06-23	ENSG00000165424	ENSG00000165424		"""Zinc fingers, CCHC domain containing"""	26911	protein-coding gene	gene with protein product	"""zinc finger, 3CxxC-type 8"""		"""chromosome 10 open reading frame 56"""	C10orf56		12477932	Standard	NM_153367		Approved	FLJ90798, Z3CXXC8	uc010qlr.2	Q8N2G6	OTTHUMG00000018561	ENST00000372336.3:c.463G>C	10.37:g.81154181C>G	ENSP00000361411:p.Glu155Gln		Q5U5T9|Q8TAG0	Missense_Mutation	SNP	superfamily_Znf_CCHC,pfscan_Znf_CCHC	p.E155Q	ENST00000372336.3	37	c.463	CCDS7359.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.97|16.97	3.267563|3.267563	0.59540|0.59540	.|.	.|.	ENSG00000165424|ENSG00000165424	ENST00000372336|ENST00000372333	T|.	0.77098|.	-1.07|.	5.31|5.31	5.31|5.31	0.75309|0.75309	Zinc finger, CCHC retroviral-type (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.77877|0.77877	0.4196|0.4196	M|M	0.63428|0.63428	1.95|1.95	0.35451|0.35451	D|D	0.795677|0.795677	D|D	0.71674|0.89917	0.998|1.0	D|D	0.73380|0.72982	0.98|0.979	D|D	0.83807|0.83807	0.0239|0.0239	10|8	0.72032|0.87932	D|D	0.01|0	-0.8518|-0.8518	18.9773|18.9773	0.92742|0.92742	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	155|95	Q8N2G6|Q5W133	ZCH24_HUMAN|.	Q|P	155|95	ENSP00000361411:E155Q|.	ENSP00000361411:E155Q|ENSP00000361408:R95P	E|R	-|-	1|2	0|0	ZCCHC24|ZCCHC24	80824187|80824187	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.996000|0.996000	0.88848|0.88848	7.474000|7.474000	0.81024|0.81024	2.479000|2.479000	0.83701|0.83701	0.514000|0.514000	0.50259|0.50259	GAG|CGA	ZCCHC24	-	superfamily_Znf_CCHC	ENSG00000165424		0.587	ZCCHC24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZCCHC24	HGNC	protein_coding	OTTHUMT00000048947.1	-	0.00	26	0	C	NM_153367		81154181	-1	tier1	-	no_errors	ENST00000372336	ensembl	human	known	74_37	missense	16.67	40	8	SNP	1.000	G
ZFAND5	7763	genome.wustl.edu	37	9	74970020	74970020	+	3'UTR	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr9:74970020C>G	ENST00000237937.3	-	0	2048				ZFAND5_ENST00000376960.4_3'UTR|ZFAND5_ENST00000376962.5_3'UTR|ZFAND5_ENST00000488164.1_5'UTR	NM_001102421.1|NM_001278243.1|NM_001278244.1|NM_001278245.1|NM_006007.2	NP_001095891.1|NP_001265172.1|NP_001265173.1|NP_001265174.1|NP_005998.1	O76080	ZFAN5_HUMAN	zinc finger, AN1-type domain 5						face development (GO:0060324)|fibroblast migration (GO:0010761)|in utero embryonic development (GO:0001701)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|respiratory system process (GO:0003016)|skeletal system morphogenesis (GO:0048705)|smooth muscle tissue development (GO:0048745)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			cervix(1)|kidney(2)|lung(2)|prostate(1)	6						AAAAATTATTCAGATACCTTT	0.299																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF062072	CCDS6642.1	9q13-q21	2008-05-02	2006-07-07	2006-07-07	ENSG00000107372	ENSG00000107372		"""Zinc fingers, AN1-type domain containing"""	13008	protein-coding gene	gene with protein product		604761	"""zinc finger protein 216"", ""zinc finger, A20 domain containing 2"""	ZNF216, ZA20D2		9758550	Standard	NM_001278243		Approved	ZFAND5A	uc004aiy.2	O76080	OTTHUMG00000020008	ENST00000237937.3:c.*849G>C	9.37:g.74970020C>G			A8K484	RNA	SNP	-	NULL	ENST00000237937.3	37	NULL	CCDS6642.1	9																																																																																			ZFAND5	-	-	ENSG00000107372		0.299	ZFAND5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFAND5	HGNC	protein_coding	OTTHUMT00000052644.1	-	0.00	67	0	C			74970020	-1	tier1	-	no_errors	ENST00000488164	ensembl	human	known	74_37	rna	25.00	87	29	SNP	1.000	G
ZFP36	7538	genome.wustl.edu	37	19	39898975	39898975	+	Missense_Mutation	SNP	C	C	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr19:39898975C>A	ENST00000248673.3	+	2	675	c.617C>A	c.(616-618)cCt>cAt	p.P206H	MIR4530_ENST00000581459.1_RNA|ZFP36_ENST00000597629.1_Missense_Mutation_p.P212H	NM_003407.3	NP_003398.2	P26651	TTP_HUMAN	ZFP36 ring finger protein	206					3'-UTR-mediated mRNA stabilization (GO:0070935)|gene expression (GO:0010467)|intracellular signal transduction (GO:0035556)|mRNA catabolic process (GO:0006402)|mRNA metabolic process (GO:0016071)|negative regulation of inflammatory response (GO:0050728)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of tumor necrosis factor production (GO:0032680)|response to starvation (GO:0042594)|RNA destabilization (GO:0050779)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|nucleus (GO:0005634)	14-3-3 protein binding (GO:0071889)|AU-rich element binding (GO:0017091)|C-C chemokine binding (GO:0019957)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|mRNA 3'-UTR AU-rich region binding (GO:0035925)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|single-stranded RNA binding (GO:0003727)	p.P206L(1)		large_intestine(1)|lung(5)|pancreas(1)	7	all_cancers(60;6.54e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;1.53e-06)|Ovarian(47;0.0512)		Epithelial(26;2.92e-26)|all cancers(26;2.01e-23)|Lung(45;0.000499)|LUSC - Lung squamous cell carcinoma(53;0.000657)			CTGGCCGGCCCTTCCCTGTCC	0.711																																					NSCLC(67;1164 1324 12056 21056 30097)												1	Substitution - Missense(1)	lung(1)											68.0	80.0	76.0					19																	39898975		2201	4299	6500	SO:0001583	missense	0			M63625	CCDS12534.1, CCDS12534.2	19q13.1	2012-11-27	2012-11-27			ENSG00000128016		"""RING-type (C3HC4) zinc fingers"""	12862	protein-coding gene	gene with protein product		190700	"""zinc finger protein 36, C3H type, homolog (mouse)"""			1699942	Standard	NM_003407		Approved	RNF162A, TIS11, G0S24, TTP, NUP475, tristetraprolin	uc002olh.2	P26651		ENST00000248673.3:c.617C>A	19.37:g.39898975C>A	ENSP00000248673:p.Pro206His		B2RA54	Missense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_CCCH	p.P212H	ENST00000248673.3	37	c.635		19	.	.	.	.	.	.	.	.	.	.	C	14.46	2.541067	0.45280	.	.	ENSG00000128016	ENST00000248673	T	0.23147	1.92	4.02	1.7	0.24286	.	0.593369	0.15290	N	0.270238	T	0.14787	0.0357	L	0.43152	1.355	0.30386	N	0.781456	P	0.45283	0.855	B	0.34038	0.174	T	0.12630	-1.0540	10	0.15499	T	0.54	-1.4256	7.7001	0.28617	0.0:0.7617:0.0:0.2383	.	206	P26651	TTP_HUMAN	H	206	ENSP00000248673:P206H	ENSP00000248673:P206H	P	+	2	0	ZFP36	44590815	0.076000	0.21285	0.998000	0.56505	0.508000	0.34012	0.395000	0.20850	0.916000	0.36871	0.442000	0.29010	CCT	ZFP36	-	NULL	ENSG00000128016		0.711	ZFP36-201	KNOWN	basic|appris_candidate	protein_coding	ZFP36	HGNC	protein_coding			0.00	73	0	C			39898975	+1			no_errors	ENST00000597629	ensembl	human	known	74_37	missense	5.63	67	4	SNP	0.802	A
ZFPM2	23414	genome.wustl.edu	37	8	106813358	106813358	+	Missense_Mutation	SNP	T	T	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr8:106813358T>A	ENST00000407775.2	+	8	1298	c.1048T>A	c.(1048-1050)Ttt>Att	p.F350I	ZFPM2_ENST00000378472.4_Missense_Mutation_p.F81I|RP11-152P17.2_ENST00000521622.1_RNA|RP11-152P17.2_ENST00000524045.2_RNA|RP11-152P17.2_ENST00000509144.2_RNA|ZFPM2_ENST00000520492.1_Missense_Mutation_p.F218I|RP11-152P17.2_ENST00000518932.1_RNA|RP11-152P17.2_ENST00000520433.1_RNA|ZFPM2_ENST00000517361.1_Missense_Mutation_p.F218I|ZFPM2_ENST00000522296.1_3'UTR|RP11-152P17.2_ENST00000520594.1_RNA	NM_012082.3	NP_036214.2	Q8WW38	FOG2_HUMAN	zinc finger protein, FOG family member 2	350					blood coagulation (GO:0007596)|embryonic organ development (GO:0048568)|gonadal mesoderm development (GO:0007506)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of female gonad development (GO:2000195)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of male gonad development (GO:2000020)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(4)|breast(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(11)|liver(2)|lung(48)|ovary(4)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	99			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			CGTGATCAACTTTCACCAACA	0.483																																																	0													203.0	197.0	199.0					8																	106813358		2029	4207	6236	SO:0001583	missense	0			AF119334	CCDS47908.1	8q23	2013-01-10	2012-11-27		ENSG00000169946	ENSG00000169946		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	16700	protein-coding gene	gene with protein product		603693	"""zinc finger protein, multitype 2"""			9927675, 10438528	Standard	NM_012082		Approved	FOG2, hFOG-2, ZNF89B, ZC2HC11B	uc003ymd.3	Q8WW38	OTTHUMG00000164818	ENST00000407775.2:c.1048T>A	8.37:g.106813358T>A	ENSP00000384179:p.Phe350Ile		Q32MA6|Q9NPL7|Q9NPS4|Q9UNI5	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.F350I	ENST00000407775.2	37	c.1048	CCDS47908.1	8	.	.	.	.	.	.	.	.	.	.	T	19.84	3.901429	0.72754	.	.	ENSG00000169946	ENST00000407775;ENST00000520492;ENST00000517361;ENST00000378472	T;T;T;T	0.28069	1.63;1.63;1.63;1.63	5.66	5.66	0.87406	Zinc finger, C2H2-like (1);	0.093893	0.85682	D	0.000000	T	0.28732	0.0712	L	0.43923	1.385	0.80722	D	1	P	0.49185	0.92	B	0.39152	0.292	T	0.09662	-1.0664	10	0.72032	D	0.01	.	16.1988	0.82053	0.0:0.0:0.0:1.0	.	350	Q8WW38	FOG2_HUMAN	I	350;218;218;81	ENSP00000384179:F350I;ENSP00000430757:F218I;ENSP00000428720:F218I;ENSP00000367733:F81I	ENSP00000367733:F81I	F	+	1	0	ZFPM2	106882534	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.655000	0.83696	2.284000	0.76573	0.528000	0.53228	TTT	ZFPM2	-	smart_Znf_C2H2-like	ENSG00000169946		0.483	ZFPM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFPM2	HGNC	protein_coding	OTTHUMT00000380614.1	-	0.00	51	0	T			106813358	+1	tier1	-	no_errors	ENST00000407775	ensembl	human	known	74_37	missense	7.81	59	5	SNP	1.000	A
ZMYND15	84225	genome.wustl.edu	37	17	4643965	4643965	+	Missense_Mutation	SNP	G	G	A	rs143444568		TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr17:4643965G>A	ENST00000433935.1	+	2	179	c.122G>A	c.(121-123)cGg>cAg	p.R41Q	ZMYND15_ENST00000269289.6_Missense_Mutation_p.R41Q|ZMYND15_ENST00000573751.2_Missense_Mutation_p.R41Q|ZMYND15_ENST00000592813.1_Missense_Mutation_p.R41Q|CXCL16_ENST00000574412.1_5'Flank|CXCL16_ENST00000293778.6_5'Flank	NM_001136046.2|NM_001267822.1	NP_001129518.1|NP_001254751.1	Q9H091	ZMY15_HUMAN	zinc finger, MYND-type containing 15	41					negative regulation of transcription, DNA-templated (GO:0045892)|spermatid development (GO:0007286)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(5)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|skin(2)	18						GGCCGCTGCCGGCAGCTGGAG	0.612																																																	0								G	GLN/ARG,GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	55.0	55.0	55.0		122,122	4.3	0.9	17	dbSNP_134	55	0,8600		0,0,4300	no	missense,missense	ZMYND15	NM_001136046.1,NM_032265.1	43,43	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign,benign	41/743,41/704	4643965	1,13005	2203	4300	6503	SO:0001583	missense	0			AL136893	CCDS11053.1, CCDS45584.1, CCDS58506.1	17p13.3	2008-05-02			ENSG00000141497	ENSG00000141497		"""Zinc fingers, MYND-type"""	20997	protein-coding gene	gene with protein product		614312				11230166	Standard	NM_001136046		Approved	DKFZp434N127	uc002fyu.3	Q9H091	OTTHUMG00000090760	ENST00000433935.1:c.122G>A	17.37:g.4643965G>A	ENSP00000391742:p.Arg41Gln		B4DXY5|I3L296	Missense_Mutation	SNP	pfam_Znf_MYND,pfscan_Znf_MYND	p.R41Q	ENST00000433935.1	37	c.122	CCDS45584.1	17	.	.	.	.	.	.	.	.	.	.	G	9.158	1.017991	0.19355	2.27E-4	0.0	ENSG00000141497	ENST00000433935;ENST00000269289	T;T	0.55413	0.53;0.52	5.26	4.3	0.51218	.	0.313877	0.22687	N	0.056869	T	0.33294	0.0858	N	0.14661	0.345	0.18873	N	0.999989	B;B	0.17268	0.021;0.019	B;B	0.09377	0.004;0.002	T	0.17167	-1.0378	10	0.38643	T	0.18	-0.1235	9.7128	0.40256	0.0932:0.0:0.9068:0.0	.	41;41	B4DXY5;Q9H091	.;ZMY15_HUMAN	Q	41	ENSP00000391742:R41Q;ENSP00000269289:R41Q	ENSP00000269289:R41Q	R	+	2	0	ZMYND15	4590714	0.918000	0.31147	0.932000	0.37286	0.038000	0.13279	2.784000	0.47774	1.464000	0.47987	0.643000	0.83706	CGG	ZMYND15	-	NULL	ENSG00000141497		0.612	ZMYND15-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMYND15	HGNC	protein_coding	OTTHUMT00000439580.1		0.00	24	0	G	NM_032265		4643965	+1			no_errors	ENST00000433935	ensembl	human	known	74_37	missense	6.45	29	2	SNP	0.490	A
ZNF233	353355	genome.wustl.edu	37	19	44764147	44764147	+	5'UTR	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr19:44764147G>A	ENST00000391958.2	+	0	72				ZNF233_ENST00000592581.1_Intron|ZNF233_ENST00000334152.1_Missense_Mutation_p.G85E|ZNF235_ENST00000589799.1_Intron	NM_181756.2	NP_861421.2	A6NK53	ZN233_HUMAN	zinc finger protein 233						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(4)|skin(3)|urinary_tract(1)	20		Prostate(69;0.0435)|all_neural(266;0.226)				CTGGGCGTTGGACTCGCAGGT	0.637																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AY166792	CCDS33047.1	19q13.31	2013-01-08				ENSG00000159915		"""Zinc fingers, C2H2-type"", ""-"""	30946	protein-coding gene	gene with protein product						12743021	Standard	NM_001207005		Approved	FLJ38032	uc021uvi.1	A6NK53		ENST00000391958.2:c.-56G>A	19.37:g.44764147G>A			B2RN78|B2RN79|Q86WL8	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G85E	ENST00000391958.2	37	c.254	CCDS33047.1	19	.	.	.	.	.	.	.	.	.	.	G	13.95	2.388945	0.42308	.	.	ENSG00000159915	ENST00000334152	T	0.05649	3.41	2.04	-3.39	0.04868	.	.	.	.	.	T	0.02267	0.0070	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.47156	-0.9139	6	0.11182	T	0.66	.	3.3093	0.07011	0.3442:0.3162:0.3395:0.0	.	.	.	.	E	85	ENSP00000334957:G85E	ENSP00000334957:G85E	G	+	2	0	ZNF233	49455987	0.000000	0.05858	0.001000	0.08648	0.052000	0.14988	-0.007000	0.12810	-0.673000	0.05259	0.609000	0.83330	GGA	ZNF233	-	NULL	ENSG00000159915		0.637	ZNF233-001	KNOWN	basic|CCDS	protein_coding	ZNF233	HGNC	protein_coding	OTTHUMT00000460737.1	-	0.00	19	0	G	NM_181756		44764147	+1	tier1	-	no_errors	ENST00000334152	ensembl	human	known	74_37	missense	31.58	13	6	SNP	0.001	A
ZNF251	90987	genome.wustl.edu	37	8	145948071	145948071	+	Missense_Mutation	SNP	T	T	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr8:145948071T>G	ENST00000292562.7	-	5	1249	c.974A>C	c.(973-975)gAa>gCa	p.E325A	ZNF251_ENST00000524394.1_Intron	NM_138367.1	NP_612376.1	Q9BRH9	ZN251_HUMAN	zinc finger protein 251	325					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|kidney(1)|large_intestine(5)|lung(9)|stomach(1)	17	all_cancers(97;3.54e-11)|all_epithelial(106;2.65e-10)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.75e-39)|Epithelial(56;7.54e-38)|all cancers(56;6.19e-33)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.11)	GBM - Glioblastoma multiforme(99;0.198)		TCTTCCACATTCATTACACTT	0.493																																																	0													38.0	43.0	41.0					8																	145948071		2170	4289	6459	SO:0001583	missense	0			AK000435	CCDS47944.1	8q24.3	2013-01-08			ENSG00000198169	ENSG00000198169		"""Zinc fingers, C2H2-type"", ""-"""	13045	protein-coding gene	gene with protein product							Standard	NM_138367		Approved		uc003zdv.4	Q9BRH9	OTTHUMG00000165189	ENST00000292562.7:c.974A>C	8.37:g.145948071T>G	ENSP00000292562:p.Glu325Ala		Q2M219	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E325A	ENST00000292562.7	37	c.974	CCDS47944.1	8	.	.	.	.	.	.	.	.	.	.	T	15.74	2.922768	0.52653	.	.	ENSG00000198169	ENST00000292562	T	0.35236	1.32	3.0	3.0	0.34707	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.38746	0.1052	M	0.70595	2.14	0.22412	N	0.999123	B	0.14012	0.009	B	0.19148	0.024	T	0.38972	-0.9636	9	0.72032	D	0.01	-5.8107	10.5131	0.44874	0.0:0.0:0.0:1.0	.	325	Q9BRH9	ZN251_HUMAN	A	325	ENSP00000292562:E325A	ENSP00000292562:E325A	E	-	2	0	ZNF251	145918880	0.001000	0.12720	0.689000	0.30133	0.946000	0.59487	1.109000	0.31135	1.362000	0.46000	0.460000	0.39030	GAA	ZNF251	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198169		0.493	ZNF251-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF251	HGNC	protein_coding	OTTHUMT00000382541.1	-	0.00	50	0	T	NM_138367		145948071	-1	tier1	-	no_errors	ENST00000292562	ensembl	human	known	74_37	missense	8.51	43	4	SNP	0.775	G
ZNF267	10308	genome.wustl.edu	37	16	31926132	31926132	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr16:31926132C>G	ENST00000300870.10	+	4	771	c.562C>G	c.(562-564)Cac>Gac	p.H188D		NM_001265588.1|NM_003414.5	NP_001252517.1|NP_003405	Q14586	ZN267_HUMAN	zinc finger protein 267	188					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(5)|kidney(1)|large_intestine(14)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	41						GGGAAAACATCACATATATGA	0.303																																																	0													44.0	46.0	45.0					16																	31926132		2197	4297	6494	SO:0001583	missense	0			X78925	CCDS32440.1	16p11.2	2013-01-08			ENSG00000185947	ENSG00000185947		"""Zinc fingers, C2H2-type"", ""-"""	13060	protein-coding gene	gene with protein product		604752				7865130	Standard	NM_003414		Approved	HZF2	uc002ecs.5	Q14586		ENST00000300870.10:c.562C>G	16.37:g.31926132C>G	ENSP00000300870:p.His188Asp		A0JNZ9|Q8NE41|Q9NRJ0	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H188D	ENST00000300870.10	37	c.562	CCDS32440.1	16	.	.	.	.	.	.	.	.	.	.	.	2.576	-0.298419	0.05532	.	.	ENSG00000185947	ENST00000300870;ENST00000394846	T	0.05139	3.49	0.458	-0.613	0.11594	.	.	.	.	.	T	0.07143	0.0181	M	0.63843	1.955	0.09310	N	0.999999	B	0.06786	0.001	B	0.01281	0.0	T	0.35400	-0.9790	9	0.72032	D	0.01	.	3.7552	0.08582	0.0:0.3743:0.0:0.6257	.	188	Q14586	ZN267_HUMAN	D	188;155	ENSP00000300870:H188D	ENSP00000300870:H188D	H	+	1	0	ZNF267	31833633	0.002000	0.14202	0.012000	0.15200	0.012000	0.07955	0.688000	0.25422	-0.354000	0.08212	-0.350000	0.07774	CAC	ZNF267	-	NULL	ENSG00000185947		0.303	ZNF267-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF267	HGNC	protein_coding	OTTHUMT00000432446.2	-	0.00	105	0	C	NM_003414		31926132	+1	tier1	-	no_errors	ENST00000300870	ensembl	human	known	74_37	missense	31.52	63	29	SNP	0.006	G
ZNF281	23528	genome.wustl.edu	37	1	200376438	200376438	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:200376438G>C	ENST00000294740.3	-	2	2520	c.2396C>G	c.(2395-2397)tCt>tGt	p.S799C	ZNF281_ENST00000367353.1_Missense_Mutation_p.S799C|ZNF281_ENST00000367352.3_Missense_Mutation_p.S763C	NM_001281293.1|NM_001281294.1|NM_012482.4	NP_001268222.1|NP_001268223.1|NP_036614.1	Q9Y2X9	ZN281_HUMAN	zinc finger protein 281	799					embryonic body morphogenesis (GO:0010172)|negative regulation of gene expression (GO:0010629)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|stem cell differentiation (GO:0048863)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	core promoter binding (GO:0001047)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			breast(4)|endometrium(3)|kidney(3)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	27						GCCTGTTGAAGACTCTAAGTT	0.413																																																	0													87.0	91.0	90.0					1																	200376438		2203	4300	6503	SO:0001583	missense	0			AF125158	CCDS1402.1, CCDS60384.1	1q32.1	2012-08-08			ENSG00000162702	ENSG00000162702		"""Zinc fingers, C2H2-type"""	13075	protein-coding gene	gene with protein product						10448078	Standard	NM_012482		Approved	ZBP-99	uc001gve.3	Q9Y2X9	OTTHUMG00000035724	ENST00000294740.3:c.2396C>G	1.37:g.200376438G>C	ENSP00000294740:p.Ser799Cys		A6NF48|B3KMX2|Q5RKW5|Q9NY92	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S799C	ENST00000294740.3	37	c.2396	CCDS1402.1	1	.	.	.	.	.	.	.	.	.	.	G	12.90	2.077415	0.36662	.	.	ENSG00000162702	ENST00000294740;ENST00000367353;ENST00000367352;ENST00000537759	T;T;T	0.10668	2.86;2.86;2.85	5.6	5.6	0.85130	.	0.300826	0.37261	N	0.002164	T	0.12902	0.0313	N	0.24115	0.695	0.47153	D	0.999333	B;B	0.22480	0.07;0.07	B;B	0.33196	0.159;0.159	T	0.14448	-1.0472	10	0.87932	D	0	-6.1219	19.6035	0.95573	0.0:0.0:1.0:0.0	.	763;799	A6NF48;Q9Y2X9	.;ZN281_HUMAN	C	799;799;763;504	ENSP00000294740:S799C;ENSP00000356322:S799C;ENSP00000356321:S763C	ENSP00000294740:S799C	S	-	2	0	ZNF281	198643061	1.000000	0.71417	1.000000	0.80357	0.570000	0.35934	6.768000	0.74980	2.626000	0.88956	0.655000	0.94253	TCT	ZNF281	-	NULL	ENSG00000162702		0.413	ZNF281-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF281	HGNC	protein_coding	OTTHUMT00000086879.2	-	0.00	33	0	G	NM_012482		200376438	-1	tier1	-	no_errors	ENST00000294740	ensembl	human	known	74_37	missense	22.45	38	11	SNP	1.000	C
ZNF420	147923	genome.wustl.edu	37	19	37619881	37619881	+	Missense_Mutation	SNP	G	G	A	rs140027212		TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr19:37619881G>A	ENST00000337995.3	+	5	2203	c.1988G>A	c.(1987-1989)aGa>aAa	p.R663K	ZNF585A_ENST00000588723.1_Intron|ZNF420_ENST00000586540.1_Intron|ZNF420_ENST00000304239.7_Intron|CTC-454I21.4_ENST00000587645.1_RNA	NM_144689.3	NP_653290.2	Q8TAQ5	ZN420_HUMAN	zinc finger protein 420	663					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R663I(1)		breast(2)|endometrium(2)|large_intestine(9)|lung(10)|prostate(1)|skin(3)	27			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CAACATCAGAGAATTCATATC	0.378																																																	1	Substitution - Missense(1)	large_intestine(1)											86.0	87.0	86.0					19																	37619881		2203	4299	6502	SO:0001583	missense	0			AK056695	CCDS12498.1	19q13.12	2013-01-08			ENSG00000197050	ENSG00000197050		"""Zinc fingers, C2H2-type"", ""-"""	20649	protein-coding gene	gene with protein product							Standard	NM_144689		Approved	FLJ32191	uc002ofl.3	Q8TAQ5	OTTHUMG00000048168	ENST00000337995.3:c.1988G>A	19.37:g.37619881G>A	ENSP00000338770:p.Arg663Lys		B2RDY6|Q96ML5	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R663K	ENST00000337995.3	37	c.1988	CCDS12498.1	19	.	.	.	.	.	.	.	.	.	.	G	12.40	1.926536	0.34002	.	.	ENSG00000197050	ENST00000337995	T	0.05513	3.43	4.46	-0.533	0.11887	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03608	0.0103	L	0.28458	0.855	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.43621	-0.9380	8	.	.	.	.	2.1726	0.03853	0.2501:0.13:0.4871:0.1327	.	663	Q8TAQ5	ZN420_HUMAN	K	663	ENSP00000338770:R663K	.	R	+	2	0	ZNF420	42311721	0.000000	0.05858	0.669000	0.29828	0.993000	0.82548	0.798000	0.27014	0.151000	0.19162	0.655000	0.94253	AGA	ZNF420	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197050		0.378	ZNF420-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF420	HGNC	protein_coding	OTTHUMT00000109587.3	-	0.00	76	0	G	NM_144689		37619881	+1	tier1	-	no_errors	ENST00000337995	ensembl	human	known	74_37	missense	23.33	46	14	SNP	1.000	A
ZNF521	25925	genome.wustl.edu	37	18	22807516	22807516	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr18:22807516G>T	ENST00000361524.3	-	4	514	c.366C>A	c.(364-366)ttC>ttA	p.F122L	ZNF521_ENST00000579111.1_5'Flank|ZNF521_ENST00000584787.1_De_novo_Start_OutOfFrame|ZNF521_ENST00000538137.2_Missense_Mutation_p.F122L	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	122					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					ACTTGTCACAGAATTGACACG	0.512			T	PAX5	ALL																																			Dom	yes		18	18q11.2	25925	zinc finger protein 521		L	0													111.0	104.0	107.0					18																	22807516		2203	4300	6503	SO:0001583	missense	0			AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.366C>A	18.37:g.22807516G>T	ENSP00000354794:p.Phe122Leu		A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.F122L	ENST00000361524.3	37	c.366	CCDS32806.1	18	.	.	.	.	.	.	.	.	.	.	G	9.009	0.982029	0.18812	.	.	ENSG00000198795	ENST00000361524;ENST00000538137;ENST00000399425	T;T	0.49720	0.77;0.77	6.07	5.2	0.72013	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.45216	0.1331	N	0.05230	-0.09	0.30413	N	0.778881	D	0.76494	0.999	D	0.85130	0.997	T	0.48068	-0.9067	10	0.56958	D	0.05	-32.9052	10.3364	0.43852	0.2218:0.0:0.7782:0.0	.	122	Q96K83	ZN521_HUMAN	L	122;156;122	ENSP00000354794:F122L;ENSP00000382352:F122L	ENSP00000354794:F122L	F	-	3	2	ZNF521	21061514	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	1.211000	0.32382	2.885000	0.99019	0.655000	0.94253	TTC	ZNF521	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198795		0.512	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	ZNF521	HGNC	protein_coding	OTTHUMT00000446781.2	-	0.00	50	0	G	NM_015461		22807516	-1	tier1	-	no_errors	ENST00000361524	ensembl	human	known	74_37	missense	15.49	60	11	SNP	1.000	T
ZNF622	90441	genome.wustl.edu	37	5	16463720	16463720	+	Missense_Mutation	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr5:16463720C>T	ENST00000308683.2	-	2	883	c.757G>A	c.(757-759)Gac>Aac	p.D253N		NM_033414.2	NP_219482.1	Q969S3	ZN622_HUMAN	zinc finger protein 622	253					intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|positive regulation of apoptotic process (GO:0043065)|positive regulation of JNK cascade (GO:0046330)|positive regulation of kinase activity (GO:0033674)|positive regulation of MAPK cascade (GO:0043410)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|prostate(2)|urinary_tract(1)	25						AATAAGCAGTCCGTGATAGGG	0.483																																																	0													181.0	181.0	181.0					5																	16463720		2203	4300	6503	SO:0001583	missense	0			AY046059	CCDS3886.1	5p15.1	2012-10-05			ENSG00000173545	ENSG00000173545			30958	protein-coding gene	gene with protein product		608694				11802789, 12645566	Standard	NM_033414		Approved	MGC2485, MGC17552, ZPR9	uc003jfq.3	Q969S3	OTTHUMG00000090567	ENST00000308683.2:c.757G>A	5.37:g.16463720C>T	ENSP00000310042:p.Asp253Asn			Missense_Mutation	SNP	pfam_Znf_C2H2_jaz,smart_Znf_U1,smart_Znf_C2H2-like	p.D253N	ENST00000308683.2	37	c.757	CCDS3886.1	5	.	.	.	.	.	.	.	.	.	.	C	21.4	4.150554	0.78001	.	.	ENSG00000173545	ENST00000308683	T	0.43294	0.95	5.75	4.88	0.63580	Zinc finger, C2H2-like (1);	0.000000	0.85682	D	0.000000	T	0.56277	0.1974	L	0.56396	1.775	0.80722	D	1	D	0.58620	0.983	P	0.61275	0.886	T	0.52200	-0.8607	10	0.20519	T	0.43	-20.5038	16.1926	0.82004	0.1343:0.8657:0.0:0.0	.	253	Q969S3	ZN622_HUMAN	N	253	ENSP00000310042:D253N	ENSP00000310042:D253N	D	-	1	0	ZNF622	16516720	1.000000	0.71417	0.878000	0.34440	0.310000	0.27922	5.529000	0.67135	1.411000	0.46957	0.561000	0.74099	GAC	ZNF622	-	smart_Znf_C2H2-like	ENSG00000173545		0.483	ZNF622-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF622	HGNC	protein_coding	OTTHUMT00000207105.1	-	0.00	35	0	C	NM_033414		16463720	-1	tier1	-	no_errors	ENST00000308683	ensembl	human	known	74_37	missense	12.50	98	14	SNP	1.000	T
ZNF608	57507	genome.wustl.edu	37	5	124079853	124079853	+	Missense_Mutation	SNP	C	C	T			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr5:124079853C>T	ENST00000306315.5	-	1	1265	c.830G>A	c.(829-831)gGa>gAa	p.G277E	ZNF608_ENST00000504926.1_Intron	NM_020747.2	NP_065798.2	Q9ULD9	ZN608_HUMAN	zinc finger protein 608	277							metal ion binding (GO:0046872)			breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(12)|ovary(3)|skin(6)|urinary_tract(1)	46		all_cancers(142;0.186)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.00126)|Epithelial(69;0.00238)|all cancers(49;0.00783)		CATAGAGTTTCCCATGAGCCC	0.567																																																	0													130.0	138.0	136.0					5																	124079853		2142	4179	6321	SO:0001583	missense	0			AB033107	CCDS34219.1	5q23.2	2008-05-02			ENSG00000168916	ENSG00000168916		"""Zinc fingers, C2H2-type"""	29238	protein-coding gene	gene with protein product						10574462, 10508479	Standard	NM_020747		Approved	KIAA1281, DKFZp434M098, NY-REN-36	uc003ktq.1	Q9ULD9	OTTHUMG00000162999	ENST00000306315.5:c.830G>A	5.37:g.124079853C>T	ENSP00000307746:p.Gly277Glu		A7E2W9|Q3SYM6|Q68D12|Q8IY05|Q9Y5A1	Missense_Mutation	SNP	NULL	p.G277E	ENST00000306315.5	37	c.830	CCDS34219.1	5	.	.	.	.	.	.	.	.	.	.	C	20.8	4.048557	0.75846	.	.	ENSG00000168916	ENST00000306315;ENST00000509799;ENST00000513986	T	0.46063	0.88	5.08	4.21	0.49690	.	0.419165	0.20442	N	0.092264	T	0.30603	0.0770	L	0.27053	0.805	0.44668	D	0.997656	B	0.11235	0.004	B	0.17433	0.018	T	0.05484	-1.0882	10	0.23891	T	0.37	-9.0762	13.23	0.59938	0.0:0.9218:0.0:0.0782	.	277	Q9ULD9	ZN608_HUMAN	E	277	ENSP00000307746:G277E	ENSP00000307746:G277E	G	-	2	0	ZNF608	124107752	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.559000	0.53756	1.261000	0.44149	0.655000	0.94253	GGA	ZNF608	-	NULL	ENSG00000168916		0.567	ZNF608-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF608	HGNC	protein_coding	OTTHUMT00000371300.1		0.00	32	0	C	XM_114432		124079853	-1			no_errors	ENST00000306315	ensembl	human	known	74_37	missense	13.04	20	3	SNP	1.000	T
ZNF679	168417	genome.wustl.edu	37	7	63726538	63726538	+	Missense_Mutation	SNP	C	C	A	rs375602152		TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr7:63726538C>A	ENST00000421025.1	+	5	796	c.527C>A	c.(526-528)aCa>aAa	p.T176K	ZNF679_ENST00000255746.4_Missense_Mutation_p.T176K	NM_001159524.1|NM_153363.2	NP_001152996.1|NP_699194.2	Q8IYX0	ZN679_HUMAN	zinc finger protein 679	176					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(3)|lung(11)|skin(1)|stomach(1)	18						AGACATAAGACAAGACATACT	0.313																																																	0													77.0	65.0	69.0					7																	63726538		692	1591	2283	SO:0001583	missense	0			BC033523	CCDS47592.1	7q11.21	2013-01-08			ENSG00000197123	ENSG00000197123		"""Zinc fingers, C2H2-type"", ""-"""	28650	protein-coding gene	gene with protein product	"""hypothetical protein MGC42415"""					12477932	Standard	NM_153363		Approved	MGC42415	uc003tsx.3	Q8IYX0	OTTHUMG00000156486	ENST00000421025.1:c.527C>A	7.37:g.63726538C>A	ENSP00000416809:p.Thr176Lys			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T176K	ENST00000421025.1	37	c.527	CCDS47592.1	7	.	.	.	.	.	.	.	.	.	.	C	0.194	-1.050424	0.01981	.	.	ENSG00000197123	ENST00000421025;ENST00000255746	T;T	0.26810	1.71;1.71	1.12	-2.23	0.06930	Zinc finger, C2H2 (1);	.	.	.	.	T	0.09379	0.0231	N	0.11651	0.15	0.22280	N	0.999235	P	0.50066	0.931	B	0.44224	0.444	T	0.09885	-1.0654	9	0.02654	T	1	.	2.8797	0.05644	0.2511:0.3017:0.4472:0.0	.	176	Q8IYX0	ZN679_HUMAN	K	176	ENSP00000416809:T176K;ENSP00000255746:T176K	ENSP00000255746:T176K	T	+	2	0	ZNF679	63363973	0.000000	0.05858	0.025000	0.17156	0.314000	0.28054	-1.266000	0.02842	-0.566000	0.06054	0.194000	0.17425	ACA	ZNF679	-	pfscan_Znf_C2H2	ENSG00000197123		0.313	ZNF679-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF679	HGNC	protein_coding	OTTHUMT00000344317.2	-	0.00	90	0	C	NM_153363		63726538	+1	tier1	-	no_errors	ENST00000255746	ensembl	human	known	74_37	missense	26.61	91	33	SNP	0.999	A
ZNF829	374899	genome.wustl.edu	37	19	37382734	37382734	+	Missense_Mutation	SNP	C	C	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr19:37382734C>A	ENST00000391711.3	-	6	1323	c.959G>T	c.(958-960)gGt>gTt	p.G320V	ZNF829_ENST00000520965.1_Missense_Mutation_p.G401V|ZNF345_ENST00000526123.1_Intron|ZNF345_ENST00000432005.2_Intron	NM_001037232.3	NP_001032309.2	Q3KNS6	ZN829_HUMAN	zinc finger protein 829	320					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|large_intestine(11)|lung(8)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	29	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			AGGTTTCTCACCAGTATGCAT	0.403																																																	0													77.0	79.0	78.0					19																	37382734		2198	4300	6498	SO:0001583	missense	0			BC107131	CCDS42557.1, CCDS59380.1	19q13.12	2013-01-08			ENSG00000185869	ENSG00000185869		"""Zinc fingers, C2H2-type"", ""-"""	34032	protein-coding gene	gene with protein product							Standard	NM_001037232		Approved	DKFZp779O175	uc021utr.1	Q3KNS6	OTTHUMG00000048161	ENST00000391711.3:c.959G>T	19.37:g.37382734C>A	ENSP00000429266:p.Gly320Val		Q3KNS7|Q6ZNN0|Q7Z657	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G401V	ENST00000391711.3	37	c.1202	CCDS42557.1	19	.	.	.	.	.	.	.	.	.	.	C	16.72	3.201482	0.58234	.	.	ENSG00000185869	ENST00000520965;ENST00000391711	T	0.01599	4.74	2.95	2.95	0.34219	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06554	0.0168	L	0.51422	1.61	0.53005	D	0.999969	D	0.76494	0.999	D	0.67548	0.952	T	0.34354	-0.9832	9	0.72032	D	0.01	.	13.7668	0.62999	0.0:1.0:0.0:0.0	.	320	Q3KNS6	ZN829_HUMAN	V	320	ENSP00000429266:G320V	ENSP00000429266:G320V	G	-	2	0	ZNF829	42074574	0.069000	0.21087	1.000000	0.80357	0.999000	0.98932	2.678000	0.46900	1.967000	0.57214	0.650000	0.86243	GGT	ZNF829	-	pfscan_Znf_C2H2	ENSG00000185869		0.403	ZNF829-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF829	HGNC	protein_coding	OTTHUMT00000109575.3	-	0.00	75	0	C	NM_001037232		37382734	-1	tier1	-	no_errors	ENST00000520965	ensembl	human	known	74_37	missense	17.31	43	9	SNP	1.000	A
ZNF773	374928	genome.wustl.edu	37	19	58018634	58018634	+	Missense_Mutation	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr19:58018634G>A	ENST00000282292.4	+	4	1311	c.1171G>A	c.(1171-1173)Gaa>Aaa	p.E391K	ZNF773_ENST00000599847.1_Intron|ZNF773_ENST00000598770.1_Missense_Mutation_p.E390K|ZNF773_ENST00000593916.1_Intron	NM_198542.1	NP_940944.1	Q6PK81	ZN773_HUMAN	zinc finger protein 773	391					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	22		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0254)		TAAGTGCAATGAATGTGGGAG	0.413																																																	0													104.0	108.0	107.0					19																	58018634		2203	4300	6503	SO:0001583	missense	0			BC005167	CCDS33134.1	19q13.43	2013-01-08	2006-12-15	2006-12-15		ENSG00000152439		"""Zinc fingers, C2H2-type"", ""-"""	30487	protein-coding gene	gene with protein product			"""zinc finger protein 419B"""	ZNF419B		12477932	Standard	NM_198542		Approved	MGC4728	uc002qox.3	Q6PK81		ENST00000282292.4:c.1171G>A	19.37:g.58018634G>A	ENSP00000282292:p.Glu391Lys		Q96DL8	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E391K	ENST00000282292.4	37	c.1171	CCDS33134.1	19	.	.	.	.	.	.	.	.	.	.	G	13.56	2.272283	0.40194	.	.	ENSG00000152439	ENST00000282292	T	0.07327	3.2	1.03	1.03	0.20045	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.12220	0.0297	N	0.17082	0.46	0.22701	N	0.998831	P;D	0.69078	0.893;0.997	P;D	0.76071	0.469;0.987	T	0.23297	-1.0192	9	0.59425	D	0.04	.	6.6574	0.22994	0.0:0.3016:0.6984:0.0	.	390;391	Q6PK81-2;Q6PK81	.;ZN773_HUMAN	K	391	ENSP00000282292:E391K	ENSP00000282292:E391K	E	+	1	0	ZNF773	62710446	0.000000	0.05858	0.976000	0.42696	0.899000	0.52679	0.162000	0.16501	0.837000	0.34925	0.305000	0.20034	GAA	ZNF773	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000152439		0.413	ZNF773-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF773	HGNC	protein_coding	OTTHUMT00000466475.1	-	0.00	105	0	G	NM_198542		58018634	+1	tier1	-	no_errors	ENST00000282292	ensembl	human	known	74_37	missense	15.00	85	15	SNP	0.821	A
ZRANB2	9406	genome.wustl.edu	37	1	71532985	71532985	+	Intron	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr1:71532985G>A	ENST00000370920.3	-	9	1072				MIR186_ENST00000384988.1_RNA|ZRANB2-AS1_ENST00000450461.1_RNA|ZRANB2-AS1_ENST00000426999.1_RNA|ZRANB2_ENST00000254821.6_Intron|ZRANB2_ENST00000477096.1_5'UTR	NM_203350.2	NP_976225.1	O95218	ZRAB2_HUMAN	zinc finger, RAN-binding domain containing 2						mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(4)|ovary(2)|stomach(1)	15						CCTTCCATTTGAGGATTAAAA	0.294																																																	0																																										SO:0001627	intron_variant	0			AF065391	CCDS659.1, CCDS660.1	1p31	2008-02-05	2006-06-28	2006-06-28	ENSG00000132485	ENSG00000132485		"""Zinc fingers, RAN-binding domain containing"""	13058	protein-coding gene	gene with protein product		604347	"""zinc finger protein 265"""	ZNF265		9931435	Standard	NM_005455		Approved	ZIS, ZIS1, ZIS2	uc001dft.3	O95218	OTTHUMG00000009660	ENST00000370920.3:c.771-368C>T	1.37:g.71532985G>A			D3DQ75|Q53GS3|Q59F92|Q5VV33|Q5VV34|Q8IXN6|Q9UP63	RNA	SNP	-	NULL	ENST00000370920.3	37	NULL	CCDS659.1	1																																																																																			ZRANB2	-	-	ENSG00000132485		0.294	ZRANB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZRANB2	HGNC	protein_coding	OTTHUMT00000026636.1	-	0.00	16	0	G	NM_203350		71532985	-1	tier1	-	no_errors	ENST00000477096	ensembl	human	known	74_37	rna	36.36	7	4	SNP	0.000	A
ZSCAN12	9753	genome.wustl.edu	37	6	28360708	28360708	+	Missense_Mutation	SNP	G	G	A			TCGA-Z6-AAPN-01A-11D-A403-09	TCGA-Z6-AAPN-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	21fd90ec-68fe-486d-a400-8ac0d8a448ef	b3988eaa-b02d-478b-8737-4c0850c13ad8	g.chr6:28360708G>A	ENST00000361028.1	-	3	663	c.518C>T	c.(517-519)tCt>tTt	p.S173F	ZSCAN12_ENST00000396827.3_Missense_Mutation_p.S173F			O43309	ZSC12_HUMAN	zinc finger and SCAN domain containing 12	173					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(3)|urinary_tract(1)	6						AAGTTCTGGAGATTCATACTT	0.478																																																	0													171.0	140.0	149.0					6																	28360708		692	1591	2283	SO:0001583	missense	0			AB007886		6p21	2013-01-08	2007-02-20	2007-02-20	ENSG00000158691	ENSG00000158691		"""-"", ""Zinc fingers, C2H2-type"""	13172	protein-coding gene	gene with protein product		603978	"""zinc finger protein 305"", ""zinc finger protein 96"""	ZNF305, ZNF96		9244436	Standard	NM_001163391		Approved	KIAA0426, ZNF29K1, ZFP96, dJ29K1.2	uc011dlh.2	O43309	OTTHUMG00000014522	ENST00000361028.1:c.518C>T	6.37:g.28360708G>A	ENSP00000354305:p.Ser173Phe		O43724	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.S173F	ENST00000361028.1	37	c.518		6	.	.	.	.	.	.	.	.	.	.	G	6.728	0.503105	0.12822	.	.	ENSG00000158691	ENST00000361028;ENST00000396827	T;T	0.07908	3.15;3.15	3.25	1.35	0.21983	.	.	.	.	.	T	0.01558	0.0050	L	0.27053	0.805	0.09310	N	1	B;B	0.34015	0.435;0.435	B;B	0.27170	0.077;0.077	T	0.45483	-0.9258	9	0.66056	D	0.02	.	4.1376	0.10178	0.145:0.2426:0.6124:0.0	.	173;173	A8K187;O43309	.;ZSC12_HUMAN	F	173	ENSP00000354305:S173F;ENSP00000380039:S173F	ENSP00000354305:S173F	S	-	2	0	ZSCAN12	28468687	0.000000	0.05858	0.002000	0.10522	0.399000	0.30720	0.300000	0.19156	0.185000	0.20105	0.655000	0.94253	TCT	ZSCAN12	-	NULL	ENSG00000158691		0.478	ZSCAN12-001	KNOWN	basic|appris_principal	protein_coding	ZSCAN12	HGNC	protein_coding	OTTHUMT00000040190.1	-	0.00	71	0	G	NM_014724		28360708	-1	tier1	-	no_errors	ENST00000361028	ensembl	human	known	74_37	missense	25.86	43	15	SNP	0.015	A
