#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
C10orf120	399814	hgsc.bcm.edu;bcgsc.ca	37	10	124457697	124457697	+	Missense_Mutation	SNP	T	T	G			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr10:124457697T>G	ENST00000329446.4	-	3	591	c.560A>C	c.(559-561)gAa>gCa	p.E187A		NM_001010912.1	NP_001010912.1	Q5SQS8	CJ120_HUMAN	chromosome 10 open reading frame 120	187										endometrium(1)|kidney(1)|large_intestine(6)|lung(9)|skin(2)|stomach(1)|urinary_tract(1)	21		all_neural(114;0.169)|Glioma(114;0.222)				TGTAAACCTTTCAATGTAGGG	0.473																																						.											0													137.0	122.0	127.0					10																	124457697		2203	4300	6503	SO:0001583	missense	399814				CCDS31302.1	10q26.13	2012-06-12			ENSG00000183559	ENSG00000183559			25707	protein-coding gene	gene with protein product							Standard	NM_001010912		Approved	bA318C4.1	uc001lgn.3	Q5SQS8	OTTHUMG00000019187	ENST00000329446.4:c.560A>C	10.37:g.124457697T>G	ENSP00000331012:p.Glu187Ala		B2RU17	Missense_Mutation	SNP	ENST00000329446.4	37	CCDS31302.1	.	.	.	.	.	.	.	.	.	.	T	11.58	1.680512	0.29872	.	.	ENSG00000183559	ENST00000329446	T	0.31510	1.49	4.57	0.639	0.17747	.	0.393246	0.21776	N	0.069282	T	0.23532	0.0569	L	0.43152	1.355	0.09310	N	1	P	0.34639	0.461	B	0.39562	0.303	T	0.12016	-1.0564	10	0.40728	T	0.16	-12.4131	4.0837	0.09937	0.0:0.1945:0.1776:0.6279	.	187	Q5SQS8	CJ120_HUMAN	A	187	ENSP00000331012:E187A	ENSP00000331012:E187A	E	-	2	0	C10orf120	124447687	0.011000	0.17503	0.003000	0.11579	0.008000	0.06430	0.943000	0.29030	0.003000	0.14656	0.491000	0.48974	GAA		0.473	C10orf120-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050803.1	NM_001010912	
REC8	9985	hgsc.bcm.edu	37	14	24646406	24646406	+	Silent	SNP	G	G	A	rs397808102|rs10690822|rs80136823	byFrequency	TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr14:24646406G>A	ENST00000311457.3	+	9	1280	c.681G>A	c.(679-681)gaG>gaA	p.E227E	REC8_ENST00000559919.1_Silent_p.E227E			O95072	REC8_HUMAN	REC8 meiotic recombination protein	227	Glu-rich.				double-strand break repair via homologous recombination (GO:0000724)|fertilization (GO:0009566)|linear element assembly (GO:0030999)|male meiosis I (GO:0007141)|meiotic nuclear division (GO:0007126)|oocyte maturation (GO:0001556)|reciprocal meiotic recombination (GO:0007131)|seminiferous tubule development (GO:0072520)|sister chromatid cohesion (GO:0007062)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)	condensed nuclear chromosome kinetochore (GO:0000778)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|nuclear meiotic cohesin complex (GO:0034991)|nucleus (GO:0005634)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	15				GBM - Glioblastoma multiforme(265;0.00839)		TGATCGCAGAGGAAGAAGCTA	0.577																																					NSCLC(139;1764 2537 12868 49041)	.											0													60.0	65.0	64.0					14																	24646406		1925	4119	6044	SO:0001819	synonymous_variant	9985			AF006264	CCDS41932.1	14q11.2-q12	2013-08-06	2013-08-06	2007-04-03		ENSG00000100918			16879	protein-coding gene	gene with protein product		608193	"""REC8-like 1 (yeast)"", ""REC8 homolog (yeast)"""	REC8L1		10207075, 15935783, 12759374	Standard	NM_005132		Approved	Rec8p, kleisin-alpha	uc001wms.3	O95072		ENST00000311457.3:c.681G>A	14.37:g.24646406G>A			A8K576|D3DS62|Q658V5|Q6IA92|Q8WUV8|Q9BTF2|Q9NVQ9	Silent	SNP	ENST00000311457.3	37	CCDS41932.1																																																																																				0.577	REC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415889.3	NM_005132	
TAL1	6886	hgsc.bcm.edu	37	1	47685487	47685487	+	Missense_Mutation	SNP	G	G	T			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr1:47685487G>T	ENST00000294339.3	-	4	1477	c.901C>A	c.(901-903)Ccg>Acg	p.P301T	TAL1_ENST00000371884.2_Missense_Mutation_p.P301T|TAL1_ENST00000371883.3_Missense_Mutation_p.P303T|TAL1_ENST00000459729.1_5'UTR	NM_003189.2	NP_003180.1	P17542	TAL1_HUMAN	T-cell acute lymphocytic leukemia 1	301					angiogenesis (GO:0001525)|astrocyte fate commitment (GO:0060018)|basophil differentiation (GO:0030221)|cell fate commitment (GO:0045165)|definitive hemopoiesis (GO:0060216)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|erythrocyte maturation (GO:0043249)|hemangioblast cell differentiation (GO:0060217)|hematopoietic stem cell differentiation (GO:0060218)|hemopoiesis (GO:0030097)|locomotory behavior (GO:0007626)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|platelet formation (GO:0030220)|positive regulation of cell division (GO:0051781)|positive regulation of chromatin assembly or disassembly (GO:0045799)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell proliferation (GO:0042127)|regulation of mast cell differentiation (GO:0060375)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spinal cord association neuron differentiation (GO:0021527)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|E-box binding (GO:0070888)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			haematopoietic_and_lymphoid_tissue(1)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)	15						TAGCTGTCCGGGCTGGCTGCC	0.711			T	"""TRD@, SIL"""	lymphoblastic leukemia/biphasic																																	.		Dom	yes		1	1p32	6886	T-cell acute lymphocytic leukemia 1 (SCL)		L	0													24.0	29.0	27.0					1																	47685487		2189	4280	6469	SO:0001583	missense	6886			M29038	CCDS547.1	1p32	2013-05-21	2001-12-04		ENSG00000162367	ENSG00000162367		"""Basic helix-loop-helix proteins"""	11556	protein-coding gene	gene with protein product		187040		TCL5		2740341	Standard	NM_001287347		Approved	SCL, bHLHa17	uc009vyq.2	P17542	OTTHUMG00000007847	ENST00000294339.3:c.901C>A	1.37:g.47685487G>T	ENSP00000294339:p.Pro301Thr		D3DQ24	Missense_Mutation	SNP	ENST00000294339.3	37	CCDS547.1	.	.	.	.	.	.	.	.	.	.	G	19.08	3.758806	0.69763	.	.	ENSG00000162367	ENST00000371884;ENST00000371883;ENST00000294339	D;D;D	0.98633	-5.03;-5.04;-5.03	5.05	4.07	0.47477	.	0.000000	0.85682	D	0.000000	D	0.96420	0.8832	L	0.34521	1.04	0.58432	D	0.999998	P	0.48503	0.911	B	0.42282	0.382	D	0.96746	0.9550	10	0.66056	D	0.02	.	14.214	0.65781	0.0:0.0:0.85:0.15	.	301	P17542	TAL1_HUMAN	T	301;303;301	ENSP00000360951:P301T;ENSP00000360950:P303T;ENSP00000294339:P301T	ENSP00000294339:P301T	P	-	1	0	TAL1	47458074	1.000000	0.71417	1.000000	0.80357	0.763000	0.43281	7.404000	0.79996	2.363000	0.80096	0.478000	0.44815	CCG		0.711	TAL1-002	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000021640.1	NM_003189	
ANP32A	8125	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	15	69079816	69079816	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr15:69079816G>A	ENST00000465139.2	-	3	406	c.263C>T	c.(262-264)cCg>cTg	p.P88L	ANP32A_ENST00000483551.2_5'UTR|ANP32A_ENST00000560303.1_Missense_Mutation_p.P88L	NM_006305.3	NP_006296.1	P39687	AN32A_HUMAN	acidic (leucine-rich) nuclear phosphoprotein 32 family, member A	88					gene expression (GO:0010467)|intracellular signal transduction (GO:0035556)|mRNA metabolic process (GO:0016071)|nucleocytoplasmic transport (GO:0006913)|regulation of transcription, DNA-templated (GO:0006355)|RNA metabolic process (GO:0016070)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(1)|lung(2)	4						CGTGAGGTTCGGACACTTTTC	0.453																																						.											0													107.0	115.0	112.0					15																	69079816		2200	4298	6498	SO:0001583	missense	8125			AF025684	CCDS45292.1	15q23	2008-05-14			ENSG00000140350	ENSG00000140350		"""ANP32 acidic nuclear phosphoproteins"""	13233	protein-coding gene	gene with protein product		600832		C15orf1		8970164, 9144194	Standard	NM_006305		Approved	LANP, PP32, I1PP2A, PHAPI, MAPM, mapmodulin	uc002arl.3	P39687	OTTHUMG00000154502	ENST00000465139.2:c.263C>T	15.37:g.69079816G>A	ENSP00000417864:p.Pro88Leu		B2R6T4|Q53FK4|Q5J8L8|Q7M4N6	Missense_Mutation	SNP	ENST00000465139.2	37	CCDS45292.1	.	.	.	.	.	.	.	.	.	.	G	37	6.477195	0.97598	.	.	ENSG00000140350	ENST00000358235;ENST00000465139	T	0.64085	-0.08	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.80476	0.4630	M	0.92268	3.29	0.80722	D	1	D	0.59767	0.986	P	0.53360	0.724	D	0.85654	0.1284	10	0.87932	D	0	.	18.6073	0.91271	0.0:0.0:1.0:0.0	.	88	P39687	AN32A_HUMAN	L	88	ENSP00000417864:P88L	ENSP00000350970:P88L	P	-	2	0	ANP32A	66866870	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.611000	0.98342	2.640000	0.89533	0.655000	0.94253	CCG		0.453	ANP32A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335525.2		
NFIA	4774	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	1	61869880	61869880	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr1:61869880G>A	ENST00000403491.3	+	8	1664	c.1180G>A	c.(1180-1182)Gag>Aag	p.E394K	NFIA_ENST00000357977.5_Missense_Mutation_p.E42K|NFIA_ENST00000371184.2_Missense_Mutation_p.E265K|NFIA_ENST00000371191.1_Missense_Mutation_p.E417K|NFIA_ENST00000407417.3_Missense_Mutation_p.E386K|NFIA_ENST00000371189.4_Missense_Mutation_p.E439K|NFIA_ENST00000371185.2_Missense_Mutation_p.E372K|NFIA_ENST00000479364.1_3'UTR|NFIA_ENST00000485903.2_Missense_Mutation_p.E351K|NFIA_ENST00000371187.3_Missense_Mutation_p.E394K	NM_001134673.3|NM_005595.4	NP_001128145.1|NP_005586.1	Q12857	NFIA_HUMAN	nuclear factor I/A	394					DNA replication (GO:0006260)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to organic cyclic compound (GO:0014070)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)		NFIA/EHF(2)	endometrium(1)|kidney(2)|large_intestine(8)|lung(20)|pancreas(1)|prostate(1)|skin(1)	34						TCACCCTCAGGAGACGCTGAA	0.512																																						.											0													107.0	96.0	100.0					1																	61869880		2203	4300	6503	SO:0001583	missense	4774			U07809	CCDS615.1, CCDS44156.1, CCDS53322.1, CCDS53321.1	1p31.3-p31.2	2008-02-05			ENSG00000162599	ENSG00000162599			7784	protein-coding gene	gene with protein product		600727				7590749	Standard	NM_001134673		Approved	NFI-L, KIAA1439	uc010oos.2	Q12857	OTTHUMG00000008618	ENST00000403491.3:c.1180G>A	1.37:g.61869880G>A	ENSP00000384523:p.Glu394Lys		B4DRJ3|B4DS53|F5H0R0|F8W8W3|Q8TA97|Q9H3X9|Q9P2A9	Missense_Mutation	SNP	ENST00000403491.3	37	CCDS44156.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.967262	0.74131	.	.	ENSG00000162599	ENST00000371191;ENST00000407417;ENST00000371189;ENST00000403491;ENST00000485903;ENST00000371185;ENST00000371184;ENST00000371187	T;T;T;T;T;T	0.50813	0.73;0.73;0.73;0.73;0.73;0.73	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	T	0.42607	0.1210	N	0.19112	0.55	0.80722	D	1	D;P;B;P;B	0.54964	0.969;0.884;0.022;0.884;0.017	P;P;B;P;B	0.47673	0.554;0.482;0.015;0.482;0.008	T	0.14559	-1.0468	10	0.25751	T	0.34	-14.2049	20.0274	0.97527	0.0:0.0:1.0:0.0	.	439;417;372;394;394	F8W8W3;B1AKN8;B1AKN5;Q12857;Q12857-2	.;.;.;NFIA_HUMAN;.	K	417;386;439;394;394;372;265;351	ENSP00000360233:E417K;ENSP00000384680:E386K;ENSP00000360231:E439K;ENSP00000384523:E394K;ENSP00000360227:E372K;ENSP00000360226:E265K	ENSP00000360226:E265K	E	+	1	0	NFIA	61642468	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.379000	0.97198	2.798000	0.96311	0.557000	0.71058	GAG		0.512	NFIA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023799.3	NM_005595	
GAS8	2622	hgsc.bcm.edu	37	16	90095603	90095604	+	Intron	INS	-	-	GGCTGCGGGGCA			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr16:90095603_90095604insGGCTGCGGGGCA	ENST00000268699.4	+	2	212				GAS8_ENST00000540721.1_Intron|C16orf3_ENST00000408886.2_In_Frame_Ins_p.50_51insPAAC|GAS8_ENST00000536122.1_Intron	NM_001481.2	NP_001472.1	O95995	GAS8_HUMAN	growth arrest-specific 8						cellular protein localization (GO:0034613)|negative regulation of cell proliferation (GO:0008285)|sperm motility (GO:0030317)	Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile cilium (GO:0031514)				endometrium(3)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	14		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.029)		gctatggggcagcctacggggc	0.658																																						.											0																																										SO:0001627	intron_variant	750			AF050079	CCDS10992.1, CCDS67101.1, CCDS73932.1	16q24.3	2014-07-18	2003-01-16	2003-01-17	ENSG00000141013	ENSG00000141013			4166	protein-coding gene	gene with protein product		605178	"""growth arrest-specific 11"""	GAS11		9790751	Standard	NM_001481		Approved		uc002fqi.1	O95995	OTTHUMG00000138988	ENST00000268699.4:c.90+1473->GGCTGCGGGGCA	16.37:g.90095603_90095604insGGCTGCGGGGCA			B2RCT1|B7Z4U1|G3V1L5|Q2M234	In_Frame_Ins	INS	ENST00000268699.4	37	CCDS10992.1																																																																																				0.658	GAS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000272877.2		
LSM14A	26065	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	19	34712450	34712450	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr19:34712450A>G	ENST00000433627.5	+	9	1250	c.1175A>G	c.(1174-1176)aAt>aGt	p.N392S	LSM14A_ENST00000544216.3_Missense_Mutation_p.N392S|LSM14A_ENST00000540746.2_Missense_Mutation_p.N351S	NM_001114093.1	NP_001107565.1	Q8ND56	LS14A_HUMAN	LSM14A, SCD6 homolog A (S. cerevisiae)	392					cytoplasmic mRNA processing body assembly (GO:0033962)|multicellular organismal development (GO:0007275)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of translation (GO:0006417)|RIG-I signaling pathway (GO:0039529)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|intracellular membrane-bounded organelle (GO:0043231)	double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|single-stranded RNA binding (GO:0003727)	p.N392S(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(7)|skin(1)	22	Esophageal squamous(110;0.162)					AGAAGATTAAATGCTGAAACA	0.463																																						.											1	Substitution - Missense(1)	lung(1)											82.0	69.0	74.0					19																	34712450		2203	4300	6503	SO:0001583	missense	26065			AL834398	CCDS12435.1, CCDS46040.1	19q13.12	2010-01-27	2006-12-21	2006-01-24		ENSG00000257103			24489	protein-coding gene	gene with protein product		610677	"""chromosome 19 open reading frame 13"", ""family with sequence similarity 61, member A"", ""LSM14 homolog A (SCD6, S. cerevisiae)"""	C19orf13, FAM61A		12477932	Standard	NM_015578		Approved	DKFZP434D1335, RAP55A, RAP55	uc002nva.4	Q8ND56		ENST00000433627.5:c.1175A>G	19.37:g.34712450A>G	ENSP00000413964:p.Asn392Ser		B4DTG6|Q76LX7|Q96AR3|Q96K73|Q96SN5|Q9UFR3	Missense_Mutation	SNP	ENST00000433627.5	37	CCDS46040.1	.	.	.	.	.	.	.	.	.	.	a	27.6	4.844127	0.91197	.	.	ENSG00000257103	ENST00000544216;ENST00000433627;ENST00000540746	T;T;T	0.58210	0.35;0.36;0.39	5.96	5.96	0.96718	FFD/TFG box motif (1);	0.000000	0.85682	D	0.000000	T	0.78991	0.4371	M	0.91717	3.235	0.80722	D	1	D;D;D	0.89917	1.0;0.997;1.0	D;D;D	0.85130	0.995;0.989;0.997	D	0.83929	0.0305	10	0.87932	D	0	-17.9772	16.4277	0.83824	1.0:0.0:0.0:0.0	.	351;392;392	B4DTG6;Q8ND56;Q8ND56-2	.;LS14A_HUMAN;.	S	392;392;351	ENSP00000446271:N392S;ENSP00000413964:N392S;ENSP00000446451:N351S	ENSP00000314768:N392S	N	+	2	0	LSM14A	39404290	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.874000	0.92363	2.279000	0.76181	0.533000	0.62120	AAT		0.463	LSM14A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451576.3	NM_015578	
LRP2	4036	hgsc.bcm.edu;ucsc.edu	37	2	170129474	170129474	+	Silent	SNP	G	G	A	rs145709922	byFrequency	TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr2:170129474G>A	ENST00000263816.3	-	15	2364	c.2079C>T	c.(2077-2079)ttC>ttT	p.F693F	LRP2_ENST00000443831.1_Silent_p.F624F	NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	693	EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	GTTGGAAGCCGAATGTGCACT	0.488													G|||	2	0.000399361	0.0	0.0014	5008	,	,		20591	0.0		0.001	False		,,,				2504	0.0					.											0								G		4,4402	8.1+/-20.4	0,4,2199	249.0	233.0	239.0		2079	-11.0	0.0	2	dbSNP_134	239	35,8565	24.6+/-71.5	0,35,4265	no	coding-synonymous	LRP2	NM_004525.2		0,39,6464	AA,AG,GG		0.407,0.0908,0.2999		693/4656	170129474	39,12967	2203	4300	6503	SO:0001819	synonymous_variant	4036				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.2079C>T	2.37:g.170129474G>A			O00711|Q16215	Silent	SNP	ENST00000263816.3	37	CCDS2232.1																																																																																				0.488	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	
TACC3	10460	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	4	1729580	1729580	+	Missense_Mutation	SNP	G	G	T			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr4:1729580G>T	ENST00000313288.4	+	4	557	c.451G>T	c.(451-453)Gac>Tac	p.D151Y		NM_006342.2	NP_006333.1	Q9Y6A5	TACC3_HUMAN	transforming, acidic coiled-coil containing protein 3	151					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|cytoplasmic sequestering of transcription factor (GO:0042994)|hemopoiesis (GO:0030097)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of cell cycle (GO:0051726)|regulation of microtubule-based process (GO:0032886)|response to hypoxia (GO:0001666)	centrosome (GO:0005813)|cytoplasm (GO:0005737)				central_nervous_system(1)|endometrium(4)|large_intestine(1)|lung(10)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	25		Breast(71;0.212)|all_epithelial(65;0.241)	OV - Ovarian serous cystadenocarcinoma(23;0.00765)|Epithelial(3;0.0126)			TGCCCTGGCTGACCTGGACTG	0.602																																					Ovarian(120;482 2294 11894 35824)	.											0													86.0	100.0	95.0					4																	1729580		2203	4300	6503	SO:0001583	missense	10460			AF093543	CCDS3352.1	4p16.3	2008-07-29			ENSG00000013810	ENSG00000013810			11524	protein-coding gene	gene with protein product		605303				17675670	Standard	NM_006342		Approved	ERIC1	uc003gdo.3	Q9Y6A5	OTTHUMG00000089535	ENST00000313288.4:c.451G>T	4.37:g.1729580G>T	ENSP00000326550:p.Asp151Tyr		Q2NKK4|Q3KQS5|Q9UMQ1	Missense_Mutation	SNP	ENST00000313288.4	37	CCDS3352.1	.	.	.	.	.	.	.	.	.	.	G	13.70	2.315439	0.40996	.	.	ENSG00000013810	ENST00000313288;ENST00000493975;ENST00000458173	T;T;T	0.55930	2.46;0.49;0.49	4.0	-2.72	0.05968	.	3.916390	0.01690	N	0.026626	T	0.56992	0.2023	L	0.36672	1.1	0.09310	N	1	D;D	0.76494	0.999;0.997	D;P	0.66847	0.947;0.808	T	0.49504	-0.8933	10	0.72032	D	0.01	0.4971	1.7812	0.03032	0.1921:0.2484:0.4313:0.1282	.	151;151	B4DYJ1;Q9Y6A5	.;TACC3_HUMAN	Y	151	ENSP00000326550:D151Y;ENSP00000418095:D151Y;ENSP00000415914:D151Y	ENSP00000326550:D151Y	D	+	1	0	TACC3	1699378	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.681000	0.05191	-1.111000	0.02988	0.563000	0.77884	GAC		0.602	TACC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000203730.2		
PKD2	5311	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	4	88986631	88986631	+	Nonsense_Mutation	SNP	C	C	T	rs121918040		TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr4:88986631C>T	ENST00000508588.1	+	6	873	c.478C>T	c.(478-480)Cga>Tga	p.R160*	PKD2_ENST00000511337.1_3'UTR|PKD2_ENST00000237596.2_Nonsense_Mutation_p.R742*|PKD2_ENST00000502363.1_Nonsense_Mutation_p.R160*			Q9BZL6	KPCD2_HUMAN	polycystic kidney disease 2 (autosomal dominant)	0					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial tube morphogenesis (GO:0061154)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell receptor signaling pathway (GO:0050862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)	p.R742*(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|liver(2)|lung(15)|skin(4)|upper_aerodigestive_tract(1)	36		Hepatocellular(203;0.114)|Acute lymphoblastic leukemia(40;0.221)		OV - Ovarian serous cystadenocarcinoma(123;9.98e-10)|COAD - Colon adenocarcinoma(81;0.0237)		TGACGAACTTCGACAAGATCT	0.403																																						.											1	Substitution - Nonsense(1)	endometrium(1)	GRCh37	CM961124	PKD2	M	rs121918040						86.0	82.0	83.0					4																	88986631		2203	4300	6503	SO:0001587	stop_gained	5311			U50928	CCDS3627.1	4q22.1	2014-01-28			ENSG00000118762	ENSG00000118762		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""EF-hand domain containing"""	9009	protein-coding gene	gene with protein product	"""transient receptor potential cation channel, subfamily P, member 2"""	173910				8298643	Standard	NM_000297		Approved	PKD4, PC2, Pc-2, TRPP2	uc003hre.3	Q13563	OTTHUMG00000160982	ENST00000508588.1:c.478C>T	4.37:g.88986631C>T	ENSP00000427131:p.Arg160*		Q8TB08|Q9P0T6|Q9Y3X8	Nonsense_Mutation	SNP	ENST00000508588.1	37		.	.	.	.	.	.	.	.	.	.	C	41	8.974909	0.99023	.	.	ENSG00000118762	ENST00000237596;ENST00000508588;ENST00000502363	.	.	.	5.89	5.05	0.67936	.	0.062020	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.2108	14.8891	0.70594	0.0:0.9315:0.0:0.0685	.	.	.	.	X	742;160;160	.	ENSP00000237596:R742X	R	+	1	2	PKD2	89205655	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	5.802000	0.69122	1.497000	0.48584	0.655000	0.94253	CGA		0.403	PKD2-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000363253.2	NM_000297	
GRID2	2895	hgsc.bcm.edu;mdanderson.org	37	4	94411803	94411803	+	Silent	SNP	G	G	A	rs188016557	byFrequency	TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr4:94411803G>A	ENST00000282020.4	+	12	2130	c.1872G>A	c.(1870-1872)ccG>ccA	p.P624P	GRID2_ENST00000510992.1_Silent_p.P529P	NM_001510.2	NP_001501.2	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	624					cellular protein localization (GO:0034613)|cerebellar granule cell differentiation (GO:0021707)|glutamate receptor signaling pathway (GO:0007215)|heterophilic cell-cell adhesion (GO:0007157)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|ionotropic glutamate receptor complex (GO:0008328)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|PDZ domain binding (GO:0030165)|scaffold protein binding (GO:0097110)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(18)|lung(45)|ovary(3)|prostate(6)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(1)	100		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)		GGGAAGTCCCGTACACGACTC	0.423													G|||	12	0.00239617	0.0	0.0	5008	,	,		14519	0.0109		0.0	False		,,,				2504	0.001					.											0													114.0	124.0	120.0					4																	94411803		2203	4300	6503	SO:0001819	synonymous_variant	2895			AF009014	CCDS3637.1, CCDS68758.1	4q22	2012-08-29			ENSG00000152208	ENSG00000152208		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4576	protein-coding gene	gene with protein product		602368				9465309	Standard	NM_001510		Approved	GluD2, GluR-delta-2	uc011cdt.2	O43424	OTTHUMG00000130975	ENST00000282020.4:c.1872G>A	4.37:g.94411803G>A			E9PH24|Q4KKU8|Q4KKU9|Q4KKV0|Q59FZ1	Silent	SNP	ENST00000282020.4	37	CCDS3637.1																																																																																				0.423	GRID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253588.2		
PROP1	5626	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	5	177421251	177421251	+	Silent	SNP	C	C	T			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr5:177421251C>T	ENST00000308304.2	-	2	506	c.198G>A	c.(196-198)ccG>ccA	p.P66P		NM_006261.4	NP_006252	O75360	PROP1_HUMAN	PROP paired-like homeobox 1	66					blood vessel development (GO:0001568)|canonical Wnt signaling pathway (GO:0060070)|cell migration (GO:0016477)|central nervous system development (GO:0007417)|dorsal/ventral pattern formation (GO:0009953)|hypophysis morphogenesis (GO:0048850)|hypothalamus cell differentiation (GO:0021979)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|somatotropin secreting cell differentiation (GO:0060126)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)	p.P66P(2)		endometrium(1)|large_intestine(2)|lung(9)|stomach(1)	13	all_cancers(89;0.00176)|Renal(175;0.000269)|Lung NSC(126;0.00858)|all_lung(126;0.0139)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCCGGGAGTGCGGGCGGCCCC	0.662																																						.											2	Substitution - coding silent(2)	large_intestine(1)|lung(1)											34.0	37.0	36.0					5																	177421251		2203	4300	6503	SO:0001819	synonymous_variant	5626			AF076215	CCDS4430.1	5q35.3	2011-06-20	2007-07-12		ENSG00000175325	ENSG00000175325		"""Homeoboxes / PRD class"""	9455	protein-coding gene	gene with protein product		601538	"""prophet of Pit1, paired-like homeodomain transcription factor"""			9462743	Standard	NM_006261		Approved		uc003mif.1	O75360	OTTHUMG00000130887	ENST00000308304.2:c.198G>A	5.37:g.177421251C>T				Silent	SNP	ENST00000308304.2	37	CCDS4430.1																																																																																				0.662	PROP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253472.1	NM_006261	
ZNF354C	30832	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	5	178506374	178506374	+	Missense_Mutation	SNP	C	C	A			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr5:178506374C>A	ENST00000315475.6	+	5	1247	c.941C>A	c.(940-942)aCc>aAc	p.T314N		NM_014594.1	NP_055409.1	Q86Y25	Z354C_HUMAN	zinc finger protein 354C	314					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(1)|large_intestine(10)|lung(13)|ovary(1)|urinary_tract(3)	30	all_cancers(89;0.00065)|all_epithelial(37;0.000153)|Renal(175;0.000159)|Lung NSC(126;0.00175)|all_lung(126;0.00309)	all_cancers(40;0.19)|all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.247)		CAGTGTTCAACCCTCACTGTA	0.428																																						.											0													174.0	175.0	175.0					5																	178506374		2203	4300	6503	SO:0001583	missense	30832				CCDS4443.1	5q35	2013-01-08			ENSG00000177932	ENSG00000177932		"""Zinc fingers, C2H2-type"", ""-"""	16736	protein-coding gene	gene with protein product						10786630	Standard	NM_014594		Approved	KID3	uc003mju.3	Q86Y25	OTTHUMG00000130888	ENST00000315475.6:c.941C>A	5.37:g.178506374C>A	ENSP00000324064:p.Thr314Asn		Q6P4P9|Q8NFX1	Missense_Mutation	SNP	ENST00000315475.6	37	CCDS4443.1	.	.	.	.	.	.	.	.	.	.	C	13.34	2.209317	0.39003	.	.	ENSG00000177932	ENST00000315475	T	0.07800	3.16	4.04	4.04	0.47022	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.08358	0.0208	N	0.02315	-0.6	0.34396	D	0.694743	D	0.63880	0.993	D	0.64776	0.929	T	0.48151	-0.9060	9	0.15499	T	0.54	-13.1132	14.0864	0.64959	0.0:1.0:0.0:0.0	.	314	Q86Y25	Z354C_HUMAN	N	314	ENSP00000324064:T314N	ENSP00000324064:T314N	T	+	2	0	ZNF354C	178438980	0.000000	0.05858	0.999000	0.59377	0.860000	0.49131	-0.003000	0.12901	2.226000	0.72624	0.591000	0.81541	ACC		0.428	ZNF354C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253473.2		
AKAP12	9590	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	6	151673069	151673069	+	Silent	SNP	C	C	T	rs573717108		TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr6:151673069C>T	ENST00000253332.1	+	3	3732	c.3543C>T	c.(3541-3543)gaC>gaT	p.D1181D	AKAP12_ENST00000359755.5_Silent_p.D1076D|AKAP12_ENST00000354675.6_Silent_p.D1083D|AKAP12_ENST00000402676.2_Silent_p.D1181D			Q02952	AKA12_HUMAN	A kinase (PRKA) anchor protein 12	1181					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of protein kinase A signaling (GO:0010739)|protein targeting (GO:0006605)|regulation of protein kinase C signaling (GO:0090036)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	adenylate cyclase binding (GO:0008179)|protein kinase A binding (GO:0051018)	p.D1181D(1)		breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	68		Ovarian(120;0.125)	BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.98e-11)		CCGACTTTGACGCACCAGGCA	0.552													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19234	0.0		0.0	False		,,,				2504	0.0				Melanoma(141;1616 1805 10049 24534 51979)	.											1	Substitution - coding silent(1)	large_intestine(1)											110.0	107.0	108.0					6																	151673069		2203	4300	6503	SO:0001819	synonymous_variant	9590			U81607	CCDS5229.1, CCDS5230.1	6q24-q25	2011-07-01	2008-08-29		ENSG00000131016	ENSG00000131016		"""A-kinase anchor proteins"""	370	protein-coding gene	gene with protein product	"""gravin"", ""Src-Suppressed C Kinase Substrate"""	604698	"""A kinase (PRKA) anchor protein (gravin) 12"""			9000000	Standard	NM_144497		Approved	AKAP250, SSeCKS	uc011eep.2	Q02952	OTTHUMG00000015833	ENST00000253332.1:c.3543C>T	6.37:g.151673069C>T			O00310|O00498|Q4LE68|Q5SZ80|Q5TGN1|Q68D82|Q99970	Silent	SNP	ENST00000253332.1	37	CCDS5229.1																																																																																				0.552	AKAP12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042712.1		
FNDC1	84624	hgsc.bcm.edu;bcgsc.ca	37	6	159660825	159660825	+	Missense_Mutation	SNP	G	G	A	rs547791202	byFrequency	TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr6:159660825G>A	ENST00000297267.9	+	14	4657	c.4457G>A	c.(4456-4458)cGt>cAt	p.R1486H	FNDC1-IT1_ENST00000419703.1_RNA|FNDC1_ENST00000340366.6_Missense_Mutation_p.R1423H	NM_032532.2	NP_115921.2	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1	1486	Thr-rich.				cellular response to hypoxia (GO:0071456)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of protein phosphorylation (GO:0001934)|regulation of protein transport (GO:0051223)	cell-cell junction (GO:0005911)|extracellular region (GO:0005576)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(29)|liver(2)|lung(23)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)	93		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)		accaccaggcgtccaacaacc	0.677													G|||	2	0.000399361	0.0	0.0	5008	,	,		11191	0.0		0.0	False		,,,				2504	0.002					.											0													68.0	96.0	86.0					6																	159660825		1826	3640	5466	SO:0001583	missense	84624			AB058769	CCDS47512.1	6q25	2013-02-11			ENSG00000164694	ENSG00000164694		"""Fibronectin type III domain containing"""	21184	protein-coding gene	gene with protein product		609991	"""fibronectin type III domain containing 2"""	FNDC2		11347906	Standard	NM_032532		Approved	bA243O10.1, KIAA1866, dJ322A24.1	uc010kjv.3	Q4ZHG4	OTTHUMG00000015927	ENST00000297267.9:c.4457G>A	6.37:g.159660825G>A	ENSP00000297267:p.Arg1486His		A6H8X2|B7ZBR4|B7ZBR5|B9EK49|Q5JPI0|Q5VU31|Q5VU32|Q5VXX4|Q70CQ6|Q96JG1	Missense_Mutation	SNP	ENST00000297267.9	37	CCDS47512.1	.	.	.	.	.	.	.	.	.	.	G	6.865	0.529009	0.13127	.	.	ENSG00000164694	ENST00000297267;ENST00000340366	T;T	0.08193	3.12;3.94	4.3	1.13	0.20643	.	0.377447	0.21663	N	0.070996	T	0.01254	0.0041	N	0.14661	0.345	0.09310	N	1	B;B	0.25521	0.128;0.029	B;B	0.14578	0.011;0.005	T	0.45848	-0.9233	10	0.46703	T	0.11	-4.7996	4.7665	0.13135	0.2001:0.3385:0.4614:0.0	.	1423;1486	Q4ZHG4-2;Q4ZHG4	.;FNDC1_HUMAN	H	1486;1423	ENSP00000297267:R1486H;ENSP00000342460:R1423H	ENSP00000297267:R1486H	R	+	2	0	FNDC1	159580815	1.000000	0.71417	0.011000	0.14972	0.021000	0.10359	1.459000	0.35234	0.506000	0.28125	0.655000	0.94253	CGT		0.677	FNDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042897.3	NM_032532	
MLXIPL	51085	hgsc.bcm.edu;ucsc.edu	37	7	73020310	73020310	+	Silent	SNP	G	G	A	rs578022743		TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr7:73020310G>A	ENST00000313375.3	-	6	797	c.750C>T	c.(748-750)tcC>tcT	p.S250S	MLXIPL_ENST00000354613.1_Silent_p.S250S|MLXIPL_ENST00000429400.2_Silent_p.S250S|MLXIPL_ENST00000414749.2_Silent_p.S250S|MLXIPL_ENST00000395189.1_Intron|MLXIPL_ENST00000434326.1_Intron	NM_032951.2|NM_032953.2	NP_116569.1|NP_116571.1	Q9NP71	MLXPL_HUMAN	MLX interacting protein-like	250					anatomical structure morphogenesis (GO:0009653)|energy reserve metabolic process (GO:0006112)|fatty acid homeostasis (GO:0055089)|glucose homeostasis (GO:0042593)|glucose mediated signaling pathway (GO:0010255)|intracellular signal transduction (GO:0035556)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of oxidative phosphorylation (GO:0090324)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular metabolic process (GO:0031325)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of glycolytic process (GO:0045821)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of energy homeostasis (GO:2000505)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride homeostasis (GO:0070328)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	carbohydrate response element binding (GO:0035538)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			cervix(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	13		Lung NSC(55;0.0659)|all_lung(88;0.152)				CTGAGATGTCGGACAAAAAGC	0.627													G|||	1	0.000199681	0.0	0.0	5008	,	,		17309	0.001		0.0	False		,,,				2504	0.0					.											0													38.0	37.0	37.0					7																	73020310		2203	4300	6503	SO:0001819	synonymous_variant	51085			AK055029	CCDS5553.1, CCDS5554.1, CCDS47605.1, CCDS47606.1	7q11.23	2013-05-21	2005-10-31	2005-10-31	ENSG00000009950	ENSG00000009950			12744	protein-coding gene	gene with protein product	"""carbohydrate response element binding protein"""	605678	"""Williams Beuren syndrome chromosome region 14"""	WBSCR14		9860302	Standard	XM_005250399		Approved	WS-bHLH, MIO, CHREBP, MONDOB, bHLHd14	uc003tyn.1	Q9NP71	OTTHUMG00000129995	ENST00000313375.3:c.750C>T	7.37:g.73020310G>A			C5HU02|C5HU03|C5HU04|Q96E48|Q9BY03|Q9BY04|Q9BY05|Q9BY06|Q9Y2P3	Silent	SNP	ENST00000313375.3	37	CCDS5553.1																																																																																				0.627	MLXIPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252262.1	NM_032951	
NPTX2	4885	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	7	98254299	98254299	+	Missense_Mutation	SNP	T	T	G			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr7:98254299T>G	ENST00000265634.3	+	3	874	c.709T>G	c.(709-711)Tac>Gac	p.Y237D		NM_002523.2	NP_002514.1	P47972	NPTX2_HUMAN	neuronal pentraxin II	237	Pentaxin.				synaptic transmission (GO:0007268)	extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(5)|lung(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	18	all_cancers(62;2.28e-09)|all_epithelial(64;4.86e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0128)|all_lung(186;0.0142)		STAD - Stomach adenocarcinoma(171;0.215)			AAACTACCTATACGGCAAGAT	0.587																																						.											0													223.0	178.0	193.0					7																	98254299		2203	4300	6503	SO:0001583	missense	4885				CCDS5657.1	7q21.3-q22.1	2008-04-30			ENSG00000106236	ENSG00000106236			7953	protein-coding gene	gene with protein product	"""apexin"""	600750				8530029	Standard	NM_002523		Approved		uc003upl.2	P47972	OTTHUMG00000154369	ENST00000265634.3:c.709T>G	7.37:g.98254299T>G	ENSP00000265634:p.Tyr237Asp		A4D267|Q86XV7|Q96G70	Missense_Mutation	SNP	ENST00000265634.3	37	CCDS5657.1	.	.	.	.	.	.	.	.	.	.	T	17.95	3.514425	0.64522	.	.	ENSG00000106236	ENST00000265634	T	0.05925	3.37	5.57	5.57	0.84162	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.053697	0.85682	D	0.000000	T	0.36220	0.0959	H	0.95151	3.63	0.80722	D	1	D	0.76494	0.999	D	0.71184	0.972	T	0.53229	-0.8468	10	0.87932	D	0	-18.2805	14.9047	0.70709	0.0:0.0:0.0:1.0	.	237	P47972	NPTX2_HUMAN	D	237	ENSP00000265634:Y237D	ENSP00000265634:Y237D	Y	+	1	0	NPTX2	98092235	1.000000	0.71417	0.916000	0.36221	0.244000	0.25665	7.997000	0.88414	2.116000	0.64780	0.459000	0.35465	TAC		0.587	NPTX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334982.1	NM_002523	
CHPF2	54480	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	7	150932432	150932432	+	Nonsense_Mutation	SNP	C	C	T			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr7:150932432C>T	ENST00000035307.2	+	2	2075	c.562C>T	c.(562-564)Cag>Tag	p.Q188*	CHPF2_ENST00000495645.1_Nonsense_Mutation_p.Q180*	NM_019015.1	NP_061888.1	Q9P2E5	CHPF2_HUMAN	chondroitin polymerizing factor 2	188					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	acetylgalactosaminyltransferase activity (GO:0008376)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)			breast(1)|endometrium(2)|large_intestine(3)|lung(3)|ovary(4)|prostate(1)|skin(3)	17						CACATATGTGCAGGCCCCCCG	0.627																																						.											0													92.0	94.0	93.0					7																	150932432		2203	4300	6503	SO:0001587	stop_gained	54480			AB037823	CCDS34779.1, CCDS64803.1	7q36.1	2013-02-19			ENSG00000033100	ENSG00000033100	2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	29270	protein-coding gene	gene with protein product		608037				10718198, 12145278, 18316376	Standard	NM_019015		Approved	KIAA1402, ChSy-3, CSGlcA-T	uc003wjr.1	Q9P2E5	OTTHUMG00000157380	ENST00000035307.2:c.562C>T	7.37:g.150932432C>T	ENSP00000035307:p.Gln188*		B2DBD8|Q6P2I4|Q6UXD2	Nonsense_Mutation	SNP	ENST00000035307.2	37	CCDS34779.1	.	.	.	.	.	.	.	.	.	.	C	38	7.243506	0.98161	.	.	ENSG00000033100	ENST00000495645;ENST00000035307;ENST00000377851	.	.	.	5.43	5.43	0.79202	.	0.155451	0.64402	D	0.000014	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-28.4784	13.2489	0.60039	0.1585:0.8415:0.0:0.0	.	.	.	.	X	180;188;188	.	.	Q	+	1	0	CHPF2	150563365	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.180000	0.50895	2.547000	0.85894	0.591000	0.81541	CAG		0.627	CHPF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348648.2	NM_019015	
SMARCA2	6595	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	9	2056812	2056812	+	Silent	SNP	T	T	A			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr9:2056812T>A	ENST00000382203.1	+	7	1523	c.1314T>A	c.(1312-1314)atT>atA	p.I438I	SMARCA2_ENST00000349721.2_Silent_p.I438I|SMARCA2_ENST00000357248.2_Silent_p.I438I|SMARCA2_ENST00000382194.1_Silent_p.I438I			P51531	SMCA2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2	438	HSA. {ECO:0000255|PROSITE- ProRule:PRU00549}.				aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|chromatin remodeling (GO:0006338)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		AGCAGAAGATTGAGCAGGAGA	0.532																																						.											0													83.0	77.0	79.0					9																	2056812		2203	4300	6503	SO:0001819	synonymous_variant	6595			D26155	CCDS34977.1, CCDS34978.1, CCDS75807.1, CCDS75808.1	9p24.3	2008-11-11	2006-11-09		ENSG00000080503	ENSG00000080503			11098	protein-coding gene	gene with protein product		600014		SNF2L2		8012116	Standard	NM_003070		Approved	BAF190, hSNF2a, hBRM, Sth1p, SNF2LA, BRM, SNF2, SWI2	uc003zhc.3	P51531	OTTHUMG00000019445	ENST00000382203.1:c.1314T>A	9.37:g.2056812T>A			B1ALG3|B1ALG4|D3DRH4|D3DRH5	Silent	SNP	ENST00000382203.1	37	CCDS34977.1																																																																																				0.532	SMARCA2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000051505.1	NM_003070	
OR13C2	392376	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	9	107367649	107367649	+	Nonsense_Mutation	SNP	G	G	C			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr9:107367649G>C	ENST00000542196.1	-	1	302	c.260C>G	c.(259-261)tCa>tGa	p.S87*		NM_001004481.1	NP_001004481.1	Q8NGS9	O13C2_HUMAN	olfactory receptor, family 13, subfamily C, member 2	87						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	22						CTTTCTTTCTGAAAGGAAGCT	0.517																																						.											0													49.0	52.0	51.0					9																	107367649		2195	4295	6490	SO:0001587	stop_gained	392376				CCDS35092.1	9q31.1	2012-10-03			ENSG00000257019	ENSG00000276119		"""GPCR / Class A : Olfactory receptors"""	14701	protein-coding gene	gene with protein product							Standard	NM_001004481		Approved		uc011lvq.2	Q8NGS9	OTTHUMG00000020415	ENST00000542196.1:c.260C>G	9.37:g.107367649G>C	ENSP00000438815:p.Ser87*		B9EGV8|Q6IF54	Nonsense_Mutation	SNP	ENST00000542196.1	37	CCDS35092.1	.	.	.	.	.	.	.	.	.	.	G	11.13	1.547621	0.27652	.	.	ENSG00000257019	ENST00000542196	.	.	.	3.39	3.39	0.38822	.	0.000000	0.32055	U	0.006658	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	12.3016	0.54878	0.0:0.0:1.0:0.0	.	.	.	.	X	87	.	ENSP00000438815:S87X	S	-	2	0	OR13C2	106407470	0.000000	0.05858	0.011000	0.14972	0.201000	0.24016	0.721000	0.25911	1.723000	0.51488	0.462000	0.41574	TCA		0.517	OR13C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053489.2	NM_001004481	
TMEM27	57393	broad.mit.edu;hgsc.bcm.edu;mdanderson.org	37	X	15657840	15657840	+	Silent	SNP	A	A	G			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chrX:15657840A>G	ENST00000380342.3	-	5	612	c.357T>C	c.(355-357)aaT>aaC	p.N119N		NM_020665.4	NP_065716.1	Q9HBJ8	TMM27_HUMAN	transmembrane protein 27	119					positive regulation of amino acid transport (GO:0051957)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of SNARE complex assembly (GO:0035543)	brush border membrane (GO:0031526)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	metallopeptidase activity (GO:0008237)|peptidyl-dipeptidase activity (GO:0008241)			endometrium(3)|lung(4)|ovary(1)	8	Hepatocellular(33;0.183)					GAGTTTGGTCATTTAGAAAGA	0.328																																						.											0													136.0	140.0	139.0					X																	15657840		2203	4300	6503	SO:0001819	synonymous_variant	57393			AF229179	CCDS14170.1	Xp22	2012-04-13			ENSG00000147003	ENSG00000147003			29437	protein-coding gene	gene with protein product	"""collectrin"""	300631				11278314	Standard	NM_020665		Approved	NX17	uc004cxc.2	Q9HBJ8	OTTHUMG00000021181	ENST00000380342.3:c.357T>C	X.37:g.15657840A>G			B2R9M1|Q6UW07	Silent	SNP	ENST00000380342.3	37	CCDS14170.1																																																																																				0.328	TMEM27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055879.1	NM_020665	
CEMIP	57214	broad.mit.edu;hgsc.bcm.edu;mdanderson.org	37	15	81216982	81216982	+	Silent	SNP	C	C	T			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr15:81216982C>T	ENST00000394685.3	+	18	2642	c.2223C>T	c.(2221-2223)aaC>aaT	p.N741N	RP11-351M8.2_ENST00000560873.1_RNA|KIAA1199_ENST00000220244.3_Silent_p.N741N|KIAA1199_ENST00000356249.5_Silent_p.N741N			Q8WUJ3	CEMIP_HUMAN		741					hyaluronan catabolic process (GO:0030214)|positive regulation of cell migration (GO:0030335)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase C activity (GO:1900020)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|sensory perception of sound (GO:0007605)	clathrin-coated vesicle membrane (GO:0030665)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	clathrin heavy chain binding (GO:0032050)|ER retention sequence binding (GO:0046923)|hyaluronic acid binding (GO:0005540)|hyalurononglucosaminidase activity (GO:0004415)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(14)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						TCATAGACAACGGAGTCAAAA	0.527																																						.											0													116.0	96.0	102.0					15																	81216982		2203	4300	6503	SO:0001819	synonymous_variant	57214																														ENST00000394685.3:c.2223C>T	15.37:g.81216982C>T			Q6L9J5|Q9H1K5|Q9NPN9|Q9ULM1	Silent	SNP	ENST00000394685.3	37	CCDS10315.1																																																																																				0.527	KIAA1199-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000291389.1		
MEF2A	4205	hgsc.bcm.edu	37	15	100250958	100250958	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr15:100250958T>C	ENST00000557785.1	+	10	1454	c.1105T>C	c.(1105-1107)Tct>Cct	p.S369P	MEF2A_ENST00000354410.5_Missense_Mutation_p.S371P|MEF2A_ENST00000338042.6_Missense_Mutation_p.S378P|MEF2A_ENST00000558812.1_Missense_Mutation_p.S309P|MEF2A_ENST00000557942.1_Missense_Mutation_p.S377P|MEF2A_ENST00000449277.2_Missense_Mutation_p.S301P|MEF2A_ENST00000453228.2_Missense_Mutation_p.S369P	NM_001171894.1	NP_001165365.1	Q02078	MEF2A_HUMAN	myocyte enhancer factor 2A	379					apoptotic process (GO:0006915)|cardiac conduction (GO:0061337)|cellular response to calcium ion (GO:0071277)|dendrite morphogenesis (GO:0048813)|ERK5 cascade (GO:0070375)|heart development (GO:0007507)|innate immune response (GO:0045087)|MAPK cascade (GO:0000165)|mitochondrial genome maintenance (GO:0000002)|mitochondrion distribution (GO:0048311)|muscle cell differentiation (GO:0042692)|muscle organ development (GO:0007517)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ventricular cardiac myofibril assembly (GO:0055005)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)	p.S379T(1)		endometrium(2)|large_intestine(2)|lung(7)|ovary(1)	12	Lung NSC(78;0.00335)|all_lung(78;0.00659)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		OV - Ovarian serous cystadenocarcinoma(32;0.00085)			AGCCCTCAGCTCTCTTGTGTG	0.527																																						.											1	Substitution - Missense(1)	ovary(1)											45.0	47.0	46.0					15																	100250958		2051	4204	6255	SO:0001583	missense	4205				CCDS45362.1, CCDS45363.1, CCDS53978.1, CCDS58401.1	15q26	2008-02-05	2007-04-24			ENSG00000068305		"""Myocyte enhancer factors"""	6993	protein-coding gene	gene with protein product		600660				1516833	Standard	NM_005587		Approved	RSRFC4, RSRFC9	uc002bvf.3	Q02078		ENST00000557785.1:c.1105T>C	15.37:g.100250958T>C	ENSP00000453441:p.Ser369Pro		B4DFQ7|F6XG23|O43814|Q14223|Q14224|Q59GX4|Q7Z6C9|Q96D14	Missense_Mutation	SNP	ENST00000557785.1	37	CCDS53978.1	.	.	.	.	.	.	.	.	.	.	T	25.3	4.619364	0.87460	.	.	ENSG00000068305	ENST00000453228;ENST00000354410;ENST00000338042;ENST00000449277	T;T;T;T	0.10763	2.84;2.84;2.84;3.1	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.23806	0.0576	L	0.34521	1.04	0.43377	D	0.995477	D;D;D;D;D;D	0.89917	0.998;0.998;0.99;1.0;0.999;0.997	D;D;D;D;D;D	0.87578	0.995;0.981;0.972;0.997;0.998;0.991	T	0.00931	-1.1510	10	0.49607	T	0.09	-20.8248	15.8544	0.78965	0.0:0.0:0.0:1.0	.	379;309;290;369;371;377	Q02078;B4DFQ7;Q7Z6C9;Q02078-6;Q02078-5;Q02078-2	MEF2A_HUMAN;.;.;.;.;.	P	369;371;378;309	ENSP00000404110:S369P;ENSP00000346389:S371P;ENSP00000337202:S378P;ENSP00000399460:S309P	ENSP00000337202:S378P	S	+	1	0	MEF2A	98068481	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.651000	0.83577	2.147000	0.66899	0.460000	0.39030	TCT		0.527	MEF2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415985.1		
SOWAHB	345079	hgsc.bcm.edu	37	4	77816688	77816690	+	In_Frame_Del	DEL	TTG	TTG	-			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	TTG	TTG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr4:77816688_77816690delTTG	ENST00000334306.2	-	1	2312_2314	c.2313_2315delCAA	c.(2311-2316)aacaag>aag	p.N771del		NM_001029870.1	NP_001025041.1	A6NEL2	SWAHB_HUMAN	sosondowah ankyrin repeat domain family member B	771																	CAGTTTCCACTTGTTGTGCTGAC	0.473																																						.											0										5,4261		1,3,2129						0.5	1.0			240	0,8254		0,0,4127	no	coding	ANKRD56	NM_001029870.1		1,3,6256	A1A1,A1R,RR		0.0,0.1172,0.0399				5,12515				SO:0001651	inframe_deletion	345079				CCDS34017.1	4q21.1	2013-01-10	2012-01-12	2012-01-12	ENSG00000186212	ENSG00000186212		"""Ankyrin repeat domain containing"""	32958	protein-coding gene	gene with protein product			"""ankyrin repeat domain 56"""	ANKRD56		22234889	Standard	NM_001029870		Approved		uc003hki.3	A6NEL2	OTTHUMG00000160876	ENST00000334306.2:c.2313_2315delCAA	4.37:g.77816691_77816693delTTG	ENSP00000334879:p.Asn771del		B2RP29	In_Frame_Del	DEL	ENST00000334306.2	37	CCDS34017.1																																																																																				0.473	SOWAHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362762.1	NM_001029870	
CNTNAP2	26047	hgsc.bcm.edu;ucsc.edu	37	7	146829390	146829390	+	Silent	SNP	C	C	T	rs78543192	byFrequency	TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr7:146829390C>T	ENST00000361727.3	+	8	1653	c.1137C>T	c.(1135-1137)aaC>aaT	p.N379N		NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2	379					adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)			NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			TCTTTTTCAACGCTACAAGTT	0.458										HNSCC(39;0.1)			T|||	30	0.00599042	0.0219	0.0014	5008	,	,		20040	0.0		0.0	False		,,,				2504	0.0					.											0								T		66,4340	820.5+/-416.4	0,66,2137	126.0	121.0	122.0		1137	3.3	1.0	7	dbSNP_132	122	0,8600		0,0,4300	no	coding-synonymous	CNTNAP2	NM_014141.5		0,66,6437	TT,TC,CC		0.0,1.498,0.5075		379/1332	146829390	66,12940	2203	4300	6503	SO:0001819	synonymous_variant	26047			AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.1137C>T	7.37:g.146829390C>T			D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	Silent	SNP	ENST00000361727.3	37	CCDS5889.1																																																																																				0.458	CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327668.1		
ZBTB17	7709	broad.mit.edu	37	1	16268583	16268583	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr1:16268583C>T	ENST00000375743.4	-	16	2525	c.2293G>A	c.(2293-2295)Gcc>Acc	p.A765T	ZBTB17_ENST00000375733.2_Missense_Mutation_p.A772T|ZBTB17_ENST00000537142.1_Missense_Mutation_p.A683T	NM_003443.2	NP_003434.2	Q13105	ZBT17_HUMAN	zinc finger and BTB domain containing 17	765	Interaction with HCFC1.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|ectoderm development (GO:0007398)|endoplasmic reticulum unfolded protein response (GO:0030968)|gastrulation with mouth forming second (GO:0001702)|negative regulation of cell cycle (GO:0045786)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(4)|large_intestine(1)|lung(4)|ovary(2)|prostate(2)	15		Colorectal(325;0.000257)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|Colorectal(212;4.12e-07)|COAD - Colon adenocarcinoma(227;2.43e-05)|BRCA - Breast invasive adenocarcinoma(304;9.97e-05)|Kidney(64;0.000182)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0649)		ACCTGCCCGGCAGGCCACGTG	0.657																																						.											0													56.0	52.0	53.0					1																	16268583		2203	4300	6503	SO:0001583	missense	7709			U20647	CCDS165.1, CCDS55576.1, CCDS72712.1	1p36.13	2013-01-08	2004-07-16	2004-07-16	ENSG00000116809	ENSG00000116809		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	12936	protein-coding gene	gene with protein product		604084	"""zinc finger protein 151 (pHZ-67)"", ""zinc finger protein 60"""	ZNF151, ZNF60			Standard	NM_003443		Approved	MIZ1, pHZ-67	uc001axl.4	Q13105	OTTHUMG00000009377	ENST00000375743.4:c.2293G>A	1.37:g.16268583C>T	ENSP00000364895:p.Ala765Thr		A0AV07|B4DXB4|B7ZLQ9|F5H411|Q15932|Q5JYB2|Q9NUC9	Missense_Mutation	SNP	ENST00000375743.4	37	CCDS165.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.427|8.427	0.847741|0.847741	0.17034|0.17034	.|.	.|.	ENSG00000116809|ENSG00000116809	ENST00000375743;ENST00000375733;ENST00000444654;ENST00000537142|ENST00000440560	T;T;T|.	0.13307|.	2.6;2.61;2.78|.	4.43|4.43	4.43|4.43	0.53597|0.53597	.|.	0.070862|.	0.56097|.	D|.	0.000028|.	T|T	0.31327|0.31327	0.0793|0.0793	N|N	0.04880|0.04880	-0.145|-0.145	0.80722|0.80722	D|D	1|1	P;B;B|.	0.37731|.	0.607;0.1;0.004|.	B;B;B|.	0.32465|.	0.146;0.038;0.005|.	T|T	0.12243|0.12243	-1.0555|-1.0555	10|5	0.11794|.	T|.	0.64|.	.|.	8.3812|8.3812	0.32472|0.32472	0.0:0.8123:0.0:0.1877|0.0:0.8123:0.0:0.1877	.|.	772;683;765|.	Q13105-2;F5H411;Q13105|.	.;.;ZBT17_HUMAN|.	T|Y	765;772;684;683|171	ENSP00000364895:A765T;ENSP00000364885:A772T;ENSP00000438529:A683T|.	ENSP00000364885:A772T|.	A|C	-|-	1|2	0|0	ZBTB17|ZBTB17	16141170|16141170	0.025000|0.025000	0.19082|0.19082	0.984000|0.984000	0.44739|0.44739	0.435000|0.435000	0.31806|0.31806	0.600000|0.600000	0.24104|0.24104	2.173000|2.173000	0.68751|0.68751	0.563000|0.563000	0.77884|0.77884	GCC|TGC		0.657	ZBTB17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025998.1	NM_003443	
PEF1	553115	broad.mit.edu	37	1	32101118	32101118	+	Silent	SNP	G	G	A			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr1:32101118G>A	ENST00000373703.4	-	2	52	c.30C>T	c.(28-30)tgC>tgT	p.C10C	PEF1_ENST00000492061.1_5'UTR|PEF1_ENST00000440872.2_Silent_p.C10C	NM_012392.3	NP_036524.1	Q9UBV8	PEF1_HUMAN	penta-EF-hand domain containing 1	10					proteolysis (GO:0006508)|response to calcium ion (GO:0051592)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|poly(A) RNA binding (GO:0044822)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|prostate(2)|upper_aerodigestive_tract(1)	7		Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)|all_neural(195;0.186)		STAD - Stomach adenocarcinoma(196;0.0546)		CAGCTCCTGGGCAGCCCTGCA	0.562																																						.											0													18.0	20.0	19.0					1																	32101118		2189	4282	6471	SO:0001819	synonymous_variant	553115				CCDS345.1	1p34	2013-01-10			ENSG00000162517	ENSG00000162517		"""EF-hand domain containing"""	30009	protein-coding gene	gene with protein product	"""peflin"""	610033				10486255, 11883899	Standard	NM_012392		Approved	PEF1A	uc001bth.2	Q9UBV8	OTTHUMG00000003877	ENST00000373703.4:c.30C>T	1.37:g.32101118G>A				Silent	SNP	ENST00000373703.4	37	CCDS345.1																																																																																				0.562	PEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011046.1	NM_012392	
PI4K2A	55361	broad.mit.edu	37	10	99400542	99400542	+	Frame_Shift_Del	DEL	C	C	-			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr10:99400542delC	ENST00000370631.3	+	1	100	c.43delC	c.(43-45)cccfs	p.P16fs	PI4K2A_ENST00000555577.1_Intron|PI4K2A_ENST00000370649.3_Intron	NM_018425.2	NP_060895.1	Q9BTU6	P4K2A_HUMAN	phosphatidylinositol 4-kinase type 2 alpha	16					basophil degranulation (GO:0002561)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|early endosome membrane (GO:0031901)|endosome (GO:0005768)|exocytic vesicle (GO:0070382)|Golgi apparatus (GO:0005794)|growing cell tip (GO:0035838)|host cell presynaptic membrane (GO:0044231)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|presynaptic membrane (GO:0042734)|protein complex (GO:0043234)|synaptic vesicle membrane (GO:0030672)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|AP-3 adaptor complex binding (GO:0035651)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)			endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|skin(1)	12		Colorectal(252;0.162)		Epithelial(162;1.24e-10)|all cancers(201;1.2e-08)		GCGGGCCCAACCCCCGGACTA	0.766																																						.											0													11.0	13.0	12.0					10																	99400542		2163	4274	6437	SO:0001589	frameshift_variant	55361			AF070611	CCDS7469.1	10q24	2011-02-09			ENSG00000155252	ENSG00000155252			30031	protein-coding gene	gene with protein product		609763				11244087, 11279162	Standard	NM_018425		Approved	PI4KII, DKFZP761G1923, PIK42A	uc001kog.1	Q9BTU6	OTTHUMG00000018863	ENST00000370631.3:c.43delC	10.37:g.99400542delC	ENSP00000359665:p.Pro16fs		D3DR59|Q9NSG8	Frame_Shift_Del	DEL	ENST00000370631.3	37	CCDS7469.1																																																																																				0.766	PI4K2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049735.1	NM_018425	
C10orf120	399814	broad.mit.edu;bcgsc.ca	37	10	124457698	124457698	+	Nonsense_Mutation	SNP	C	C	A			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr10:124457698C>A	ENST00000329446.4	-	3	590	c.559G>T	c.(559-561)Gaa>Taa	p.E187*		NM_001010912.1	NP_001010912.1	Q5SQS8	CJ120_HUMAN	chromosome 10 open reading frame 120	187										endometrium(1)|kidney(1)|large_intestine(6)|lung(9)|skin(2)|stomach(1)|urinary_tract(1)	21		all_neural(114;0.169)|Glioma(114;0.222)				GTAAACCTTTCAATGTAGGGT	0.473																																						.											0													137.0	122.0	127.0					10																	124457698		2203	4300	6503	SO:0001587	stop_gained	399814				CCDS31302.1	10q26.13	2012-06-12			ENSG00000183559	ENSG00000183559			25707	protein-coding gene	gene with protein product							Standard	NM_001010912		Approved	bA318C4.1	uc001lgn.3	Q5SQS8	OTTHUMG00000019187	ENST00000329446.4:c.559G>T	10.37:g.124457698C>A	ENSP00000331012:p.Glu187*		B2RU17	Nonsense_Mutation	SNP	ENST00000329446.4	37	CCDS31302.1	.	.	.	.	.	.	.	.	.	.	C	16.92	3.256243	0.59321	.	.	ENSG00000183559	ENST00000329446	.	.	.	4.57	4.57	0.56435	.	0.393246	0.21776	N	0.069282	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	-12.4131	13.0518	0.58958	0.0:1.0:0.0:0.0	.	.	.	.	X	187	.	ENSP00000331012:E187X	E	-	1	0	C10orf120	124447688	0.008000	0.16893	0.007000	0.13788	0.007000	0.05969	0.897000	0.28390	2.507000	0.84556	0.603000	0.83216	GAA		0.473	C10orf120-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050803.1	NM_001010912	
DSCAML1	57453	broad.mit.edu	37	11	117392079	117392079	+	Missense_Mutation	SNP	C	C	T	rs373292920		TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr11:117392079C>T	ENST00000321322.6	-	6	1160	c.1159G>A	c.(1159-1161)Ggc>Agc	p.G387S	DSCAML1_ENST00000527706.1_Missense_Mutation_p.G117S	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	327	Ig-like C2-type 4.				axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		CTGCCAATGCCGGTCTTCAGC	0.607													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17278	0.0		0.0	False		,,,				2504	0.0					.											0								C	SER/GLY	0,4402		0,0,2201	41.0	38.0	39.0		1159	4.5	1.0	11		39	4,8588	3.7+/-12.6	0,4,4292	no	missense	DSCAML1	NM_020693.2	56	0,4,6493	TT,TC,CC		0.0466,0.0,0.0308	possibly-damaging	387/2114	117392079	4,12990	2201	4296	6497	SO:0001583	missense	57453				CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.1159G>A	11.37:g.117392079C>T	ENSP00000315465:p.Gly387Ser		Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Missense_Mutation	SNP	ENST00000321322.6	37	CCDS8384.1	.	.	.	.	.	.	.	.	.	.	C	11.38	1.622344	0.28889	0.0	4.66E-4	ENSG00000177103	ENST00000527706;ENST00000321322;ENST00000446508	T;T	0.63744	-0.06;-0.06	4.5	4.5	0.54988	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.36441	0.0967	N	0.01576	-0.805	0.58432	D	0.999999	P;P	0.48089	0.607;0.905	B;B	0.43386	0.217;0.418	T	0.42258	-0.9462	9	0.11182	T	0.66	.	17.3845	0.87413	0.0:1.0:0.0:0.0	.	117;327	G3V1B5;Q8TD84	.;DSCL1_HUMAN	S	117;387;94	ENSP00000434335:G117S;ENSP00000315465:G387S	ENSP00000315465:G387S	G	-	1	0	DSCAML1	116897289	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	4.734000	0.62043	2.333000	0.79357	0.609000	0.83330	GGC		0.607	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392907.2	NM_020693	
CHD4	1108	broad.mit.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	12	6701640	6701640	+	Missense_Mutation	SNP	C	C	A			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr12:6701640C>A	ENST00000357008.2	-	19	3030	c.2867G>T	c.(2866-2868)cGg>cTg	p.R956L	CHD4_ENST00000544040.1_Missense_Mutation_p.R949L|CHD4_ENST00000544484.1_Missense_Mutation_p.R953L|CHD4_ENST00000309577.6_Missense_Mutation_p.R956L	NM_001273.2	NP_001264.2	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	956					ATP-dependent chromatin remodeling (GO:0043044)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|RNA polymerase II repressing transcription factor binding (GO:0001103)|zinc ion binding (GO:0008270)			central_nervous_system(2)	2						TTTGAGCCGCCGCAACATGTG	0.498																																					Colon(32;586 792 4568 16848 45314)	.											0													89.0	89.0	89.0					12																	6701640		2203	4300	6503	SO:0001583	missense	1108			X86691	CCDS8552.1	12p13	2013-01-28				ENSG00000111642		"""Zinc fingers, PHD-type"""	1919	protein-coding gene	gene with protein product		603277				7575689, 8843877	Standard	XM_006718958		Approved	Mi-2b, Mi2-BETA	uc001qpo.3	Q14839		ENST00000357008.2:c.2867G>T	12.37:g.6701640C>A	ENSP00000349508:p.Arg956Leu		Q8IXZ5	Missense_Mutation	SNP	ENST00000357008.2	37	CCDS8552.1	.	.	.	.	.	.	.	.	.	.	C	28.4	4.918904	0.92249	.	.	ENSG00000111642	ENST00000544484;ENST00000544040;ENST00000309577;ENST00000357008;ENST00000537464	D;D;D;D	0.96967	-4.19;-4.19;-4.19;-4.19	5.4	5.4	0.78164	SNF2-related (1);	0.056531	0.64402	D	0.000002	D	0.99077	0.9683	H	0.98769	4.325	0.80722	D	1	D;D;P	0.89917	0.999;1.0;0.932	D;D;P	0.97110	0.996;1.0;0.675	D	0.99047	1.0826	10	0.87932	D	0	.	19.1812	0.93623	0.0:1.0:0.0:0.0	.	956;956;949	Q14839-2;Q14839;F5GWX5	.;CHD4_HUMAN;.	L	953;949;956;956;930	ENSP00000440392:R953L;ENSP00000440542:R949L;ENSP00000312419:R956L;ENSP00000349508:R956L	ENSP00000312419:R956L	R	-	2	0	CHD4	6571901	1.000000	0.71417	1.000000	0.80357	0.802000	0.45316	7.792000	0.85828	2.530000	0.85305	0.563000	0.77884	CGG		0.498	CHD4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001273	
DUSP16	80824	broad.mit.edu	37	12	12630273	12630273	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr12:12630273A>G	ENST00000228862.2	-	7	2123	c.1492T>C	c.(1492-1494)Tcc>Ccc	p.S498P	DUSP16_ENST00000298573.4_3'UTR|DUSP16_ENST00000545864.1_5'Flank	NM_030640.2	NP_085143.1	Q9BY84	DUS16_HUMAN	dual specificity phosphatase 16	498					dephosphorylation (GO:0016311)|inactivation of MAPK activity (GO:0000188)|MAPK export from nucleus (GO:0045204)|MAPK phosphatase export from nucleus, leptomycin B sensitive (GO:0045209)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			endometrium(7)|kidney(2)|large_intestine(6)|lung(6)|pancreas(1)|prostate(1)|urinary_tract(3)	26		Prostate(47;0.0687)		BRCA - Breast invasive adenocarcinoma(232;0.0203)		GATAAAAGGGACCTCTGGGCG	0.582																																					Ovarian(158;443 1896 15437 36069 46477)	.											0													71.0	71.0	71.0					12																	12630273		2203	4300	6503	SO:0001583	missense	80824			AB052156	CCDS8650.1	12p13	2011-06-09				ENSG00000111266		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	17909	protein-coding gene	gene with protein product	"""MAPK phosphatase-7"""	607175				11359773, 11489891, 15888437	Standard	NM_030640		Approved	MKP-7, KIAA1700, MKP7	uc001rao.2	Q9BY84		ENST00000228862.2:c.1492T>C	12.37:g.12630273A>G	ENSP00000228862:p.Ser498Pro		Q547C7|Q96QS2|Q9C0G3	Missense_Mutation	SNP	ENST00000228862.2	37	CCDS8650.1	.	.	.	.	.	.	.	.	.	.	A	2.707	-0.269691	0.05716	.	.	ENSG00000111266	ENST00000228862	T	0.02015	4.5	5.27	-9.11	0.00711	.	1.150150	0.06307	N	0.702034	T	0.01061	0.0035	N	0.03324	-0.35	0.43902	D	0.996538	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.49390	-0.8945	10	0.20046	T	0.44	.	10.3793	0.44101	0.2491:0.4277:0.3233:0.0	.	498;498	Q9BY84;Q96N49	DUS16_HUMAN;.	P	498	ENSP00000228862:S498P	ENSP00000228862:S498P	S	-	1	0	DUSP16	12521540	0.000000	0.05858	0.004000	0.12327	0.035000	0.12851	-2.226000	0.01211	-1.560000	0.01686	-0.250000	0.11733	TCC		0.582	DUSP16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400311.1	NM_030640	
GALNT6	11226	broad.mit.edu	37	12	51752937	51752937	+	Missense_Mutation	SNP	C	C	G			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr12:51752937C>G	ENST00000543196.2	-	7	1552	c.1347G>C	c.(1345-1347)caG>caC	p.Q449H	GALNT6_ENST00000356317.3_Missense_Mutation_p.Q449H			Q8NCL4	GALT6_HUMAN	polypeptide N-acetylgalactosaminyltransferase 6	449					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			endometrium(2)|large_intestine(6)|lung(7)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						TCTTTGCTGCCTGCAGATTTC	0.522																																						.											0													179.0	199.0	192.0					12																	51752937		2203	4300	6503	SO:0001583	missense	11226			Y08565	CCDS8813.1	12q13	2014-03-13	2014-03-13		ENSG00000139629	ENSG00000139629		"""Glycosyltransferase family 2 domain containing"""	4128	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 6"""	605148	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 6 (GalNAc-T6)"""			10464263	Standard	NM_007210		Approved	GalNAc-T6	uc001ryl.1	Q8NCL4		ENST00000543196.2:c.1347G>C	12.37:g.51752937C>G	ENSP00000444171:p.Gln449His		Q8IYH4|Q9H6G2|Q9UIV5	Missense_Mutation	SNP	ENST00000543196.2	37	CCDS8813.1	.	.	.	.	.	.	.	.	.	.	C	11.78	1.739970	0.30865	.	.	ENSG00000139629	ENST00000543196;ENST00000356317;ENST00000546163	T;T	0.59083	0.29;0.29	4.26	-0.848	0.10727	.	0.836851	0.10439	N	0.674486	T	0.43765	0.1262	N	0.25825	0.765	0.38323	D	0.943575	B	0.32543	0.375	B	0.40534	0.332	T	0.35400	-0.9790	10	0.31617	T	0.26	.	5.315	0.15850	0.131:0.4741:0.0:0.395	.	449	Q8NCL4	GALT6_HUMAN	H	449;449;430	ENSP00000444171:Q449H;ENSP00000348668:Q449H	ENSP00000348668:Q449H	Q	-	3	2	GALNT6	50039204	0.001000	0.12720	0.665000	0.29768	0.965000	0.64279	-1.549000	0.02182	-0.156000	0.11079	-0.258000	0.10820	CAG		0.522	GALNT6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469735.1	NM_007210	
E2F7	144455	broad.mit.edu	37	12	77419489	77419490	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	TT	TT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr12:77419489_77419490delTT	ENST00000322886.7	-	12	2648_2649	c.2413_2414delAA	c.(2413-2415)aagfs	p.K805fs	E2F7_ENST00000416496.2_Intron	NM_203394.2	NP_976328.2	Q96AV8	E2F7_HUMAN	E2F transcription factor 7	805					chorionic trophoblast cell differentiation (GO:0060718)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|hepatocyte differentiation (GO:0070365)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cytokinesis (GO:0032466)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|placenta development (GO:0001890)|positive regulation of DNA endoreduplication (GO:0032877)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sprouting angiogenesis (GO:0002040)|trophoblast giant cell differentiation (GO:0060707)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|identical protein binding (GO:0042802)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(15)|lung(14)|ovary(3)|upper_aerodigestive_tract(2)	42						TGTGGACGACTTTGGATTAACC	0.53																																						.											0																																										SO:0001589	frameshift_variant	144455			BC016658	CCDS9016.1	12q21.1	2008-02-05				ENSG00000165891			23820	protein-coding gene	gene with protein product		612046				12893818	Standard	NM_203394		Approved		uc001sym.4	Q96AV8	OTTHUMG00000169969	ENST00000322886.7:c.2413_2414delAA	12.37:g.77419489_77419490delTT	ENSP00000323246:p.Lys805fs		A6NC74|B2RMR7|B3KTZ5|B3KUP8|B5MED9	Frame_Shift_Del	DEL	ENST00000322886.7	37	CCDS9016.1																																																																																				0.530	E2F7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406716.1	XM_084871	
FREM2	341640	broad.mit.edu	37	13	39446906	39446906	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr13:39446906A>G	ENST00000280481.7	+	17	8227	c.8011A>G	c.(8011-8013)Acc>Gcc	p.T2671A		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	2671					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		GTCCTATGTGACCCTTCGAGT	0.443																																						.											0													165.0	154.0	158.0					13																	39446906		2203	4300	6503	SO:0001583	missense	341640			BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.8011A>G	13.37:g.39446906A>G	ENSP00000280481:p.Thr2671Ala		Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	ENST00000280481.7	37	CCDS31960.1	.	.	.	.	.	.	.	.	.	.	A	27.1	4.802831	0.90623	.	.	ENSG00000150893	ENST00000280481	T	0.28895	1.59	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.44350	0.1289	M	0.83012	2.62	0.80722	D	1	P	0.45212	0.853	B	0.43052	0.406	T	0.54084	-0.8346	10	0.87932	D	0	.	16.1146	0.81295	1.0:0.0:0.0:0.0	.	2671	Q5SZK8	FREM2_HUMAN	A	2671	ENSP00000280481:T2671A	ENSP00000280481:T2671A	T	+	1	0	FREM2	38344906	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.309000	0.96252	2.200000	0.70718	0.460000	0.39030	ACC		0.443	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361	
TPT1-AS1	100190939	broad.mit.edu	37	13	45963872	45963875	+	RNA	DEL	AAAC	AAAC	-	rs533483571|rs200606044	byFrequency	TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	AAAC	AAAC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr13:45963872_45963875delAAAC	ENST00000517509.1	+	0	991_994				TPT1-AS1_ENST00000522673.1_RNA|TPT1-AS1_ENST00000519454.1_RNA|TPT1-AS1_ENST00000520585.1_RNA	NR_024458.1				TPT1 antisense RNA 1																		TTTAATAGAAAAACAAACAAAGAC	0.324														250	0.0499201	0.1483	0.0202	5008	,	,		20268	0.003		0.0199	False		,,,				2504	0.0174					.											0																																												100190939			AF318337		13q14.13	2012-10-12	2012-08-15		ENSG00000170919	ENSG00000170919		"""Long non-coding RNAs"""	43686	non-coding RNA	RNA, long non-coding			"""TPT1 antisense RNA 1 (non-protein coding)"""				Standard	NR_024458		Approved		uc021rjh.1		OTTHUMG00000016851		13.37:g.45963876_45963879delAAAC				RNA	DEL	ENST00000517509.1	37																																																																																					0.324	TPT1-AS1-003	KNOWN	basic	antisense	antisense	OTTHUMT00000374919.1	NR_024458	
PNP	4860	broad.mit.edu;bcgsc.ca	37	14	20944680	20944680	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr14:20944680G>A	ENST00000361505.5	+	6	936	c.790G>A	c.(790-792)Ggc>Agc	p.G264S	RP11-203M5.8_ENST00000554678.1_lincRNA	NM_000270.3	NP_000261.2	P01298	PAHO_HUMAN	purine nucleoside phosphorylase	0					digestion (GO:0007586)|protein secretion (GO:0009306)	extracellular region (GO:0005576)	hormone activity (GO:0005179)|receptor binding (GO:0005102)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|stomach(2)	10						CTTAGCAGCTGGCAAACAAGC	0.483																																						.											0													106.0	97.0	100.0					14																	20944680		2203	4300	6503	SO:0001583	missense	4860				CCDS9552.1	14q11.2	2014-09-17	2009-12-02	2009-12-02	ENSG00000198805	ENSG00000198805	2.4.2.1		7892	protein-coding gene	gene with protein product		164050	"""nucleoside phosphorylase"""	NP		6087295	Standard	NM_000270		Approved	PUNP	uc001vxo.4	P00491	OTTHUMG00000029546	ENST00000361505.5:c.790G>A	14.37:g.20944680G>A	ENSP00000354532:p.Gly264Ser			Missense_Mutation	SNP	ENST00000361505.5	37	CCDS9552.1	.	.	.	.	.	.	.	.	.	.	G	8.277	0.814701	0.16607	.	.	ENSG00000198805	ENST00000361505	D	0.93189	-3.18	4.88	3.99	0.46301	Nucleoside phosphorylase domain (1);	0.212230	0.48767	D	0.000161	D	0.88306	0.6401	L	0.42632	1.34	0.49915	D	0.999834	B	0.02656	0.0	B	0.11329	0.006	T	0.81837	-0.0749	10	0.18710	T	0.47	-14.0071	9.415	0.38517	0.1721:0.0:0.8279:0.0	.	264	P00491	PNPH_HUMAN	S	264	ENSP00000354532:G264S	ENSP00000354532:G264S	G	+	1	0	PNP	20014520	1.000000	0.71417	0.593000	0.28771	0.128000	0.20619	3.182000	0.50910	1.281000	0.44480	-0.137000	0.14449	GGC		0.483	PNP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073646.2	NM_000270.2	
C14orf142	84520	broad.mit.edu;mdanderson.org	37	14	93670052	93670052	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr14:93670052C>T	ENST00000306954.4	-	2	340	c.284G>A	c.(283-285)cGg>cAg	p.R95Q	RP11-371E8.4_ENST00000557048.1_Intron|RP11-371E8.4_ENST00000557574.1_Intron	NM_032490.4	NP_115879.2	Q9BXV9	CN142_HUMAN	chromosome 14 open reading frame 142	95										endometrium(1)|skin(1)	2		all_cancers(154;0.00528)|Acute lymphoblastic leukemia(33;0.0497)|all_epithelial(191;0.125)|all_neural(303;0.13)		Epithelial(152;0.177)|all cancers(159;0.198)|COAD - Colon adenocarcinoma(157;0.203)		TGTTTTTGGCCGTTTTGCAGA	0.338																																						.											0													260.0	242.0	248.0					14																	93670052		1921	4144	6065	SO:0001583	missense	84520			AF277185	CCDS41981.1	14q32.12	2012-09-25			ENSG00000170270	ENSG00000170270			20356	protein-coding gene	gene with protein product							Standard	NM_032490		Approved		uc001ybl.1	Q9BXV9	OTTHUMG00000171267	ENST00000306954.4:c.284G>A	14.37:g.93670052C>T	ENSP00000306320:p.Arg95Gln		Q0D2N1|Q0P6C4|Q3B7W5	Missense_Mutation	SNP	ENST00000306954.4	37	CCDS41981.1	.	.	.	.	.	.	.	.	.	.	C	23.6	4.441495	0.83993	.	.	ENSG00000170270	ENST00000306954;ENST00000556566	.	.	.	5.33	4.44	0.53790	.	.	.	.	.	T	0.24198	0.0586	N	0.24115	0.695	0.26450	N	0.97563	P	0.51057	0.941	B	0.39027	0.288	T	0.06881	-1.0802	8	0.62326	D	0.03	-0.4036	10.2431	0.43324	0.0:0.9089:0.0:0.0911	.	95	Q9BXV9	CN142_HUMAN	Q	95;66	.	ENSP00000306320:R95Q	R	-	2	0	C14orf142	92739805	0.994000	0.37717	0.992000	0.48379	0.989000	0.77384	2.733000	0.47360	1.389000	0.46526	0.655000	0.94253	CGG		0.338	C14orf142-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412691.1	NM_032490	
USP3	9960	broad.mit.edu;mdanderson.org	37	15	63866525	63866525	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr15:63866525T>C	ENST00000380324.3	+	11	1148	c.1019T>C	c.(1018-1020)cTt>cCt	p.L340P	USP3-AS1_ENST00000560350.1_RNA|USP3_ENST00000539772.1_Missense_Mutation_p.L91P|USP3_ENST00000540797.1_Missense_Mutation_p.L296P|USP3_ENST00000268049.7_Missense_Mutation_p.L318P|USP3_ENST00000536001.1_3'UTR|USP3-AS1_ENST00000559357.1_RNA|USP3_ENST00000559711.1_Missense_Mutation_p.L251P|USP3_ENST00000558285.1_Missense_Mutation_p.L323P|USP3-AS1_ENST00000559861.1_RNA	NM_006537.3	NP_006528.2	Q9Y6I4	UBP3_HUMAN	ubiquitin specific peptidase 3	340	USP.				DNA repair (GO:0006281)|histone deubiquitination (GO:0016578)|mitotic cell cycle (GO:0000278)|regulation of protein stability (GO:0031647)|ubiquitin-dependent protein catabolic process (GO:0006511)	nuclear chromatin (GO:0000790)	histone binding (GO:0042393)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			endometrium(3)|large_intestine(7)|lung(4)	14				GBM - Glioblastoma multiforme(80;0.0187)		TTTTAAGACCTTTCATTAGAT	0.338																																						.											0													109.0	108.0	108.0					15																	63866525		2203	4300	6503	SO:0001583	missense	9960			AF073344	CCDS32265.1, CCDS58370.1	15q22.3	2008-04-11	2005-08-08			ENSG00000140455		"""Ubiquitin-specific peptidases"""	12626	protein-coding gene	gene with protein product		604728	"""ubiquitin specific protease 3"""			12838346	Standard	NM_006537		Approved		uc002amf.4	Q9Y6I4		ENST00000380324.3:c.1019T>C	15.37:g.63866525T>C	ENSP00000369681:p.Leu340Pro		B4DVU5|F5H1A6|Q8WVD0	Missense_Mutation	SNP	ENST00000380324.3	37	CCDS32265.1	.	.	.	.	.	.	.	.	.	.	T	24.8	4.567491	0.86439	.	.	ENSG00000140455	ENST00000540797;ENST00000380324;ENST00000268049;ENST00000539772;ENST00000536848;ENST00000538686	T;T;T;T	0.05025	3.51;3.51;3.51;3.51	5.84	5.84	0.93424	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	T	0.36110	0.0955	M	0.93197	3.39	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.999;0.999;0.999	T	0.49214	-0.8963	10	0.87932	D	0	.	16.2055	0.82126	0.0:0.0:0.0:1.0	.	296;296;318;340	F5H1A6;B4DVU5;Q6JHV3;Q9Y6I4	.;.;.;UBP3_HUMAN	P	296;340;318;91;255;171	ENSP00000445828:L296P;ENSP00000369681:L340P;ENSP00000268049:L318P;ENSP00000445642:L91P	ENSP00000268049:L318P	L	+	2	0	USP3	61653578	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.698000	0.84413	2.226000	0.72624	0.482000	0.46254	CTT		0.338	USP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417773.1		
LRRK1	79705	broad.mit.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	15	101606197	101606197	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr15:101606197C>T	ENST00000388948.3	+	32	5914	c.5555C>T	c.(5554-5556)gCt>gTt	p.A1852V	RP11-505E24.2_ENST00000559857.1_RNA|LRRK1_ENST00000532145.1_3'UTR|LRRK1_ENST00000284395.5_Missense_Mutation_p.A1849V	NM_024652.3	NP_078928.3			leucine-rich repeat kinase 1											breast(2)|central_nervous_system(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(25)|ovary(4)|prostate(1)|skin(1)	72	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			CCCCGCCAGGCTGCCAGGTCC	0.597																																						.											0													78.0	90.0	86.0					15																	101606197		2116	4230	6346	SO:0001583	missense	79705			AB058693	CCDS42086.1	15q26.3	2007-01-29			ENSG00000154237	ENSG00000154237			18608	protein-coding gene	gene with protein product		610986				11347906, 14654223	Standard	XM_005254979		Approved	FLJ23119, KIAA1790, Roco1, RIPK6	uc002bwr.3	Q38SD2	OTTHUMG00000165514	ENST00000388948.3:c.5555C>T	15.37:g.101606197C>T	ENSP00000373600:p.Ala1852Val			Missense_Mutation	SNP	ENST00000388948.3	37	CCDS42086.1	.	.	.	.	.	.	.	.	.	.	C	0.125	-1.121064	0.01785	.	.	ENSG00000154237	ENST00000388948;ENST00000284395;ENST00000529762;ENST00000542170	T;T	0.71698	-0.57;-0.59	5.61	-3.26	0.05064	.	1.306490	0.05010	N	0.470847	T	0.38188	0.1031	N	0.01705	-0.755	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.14364	-1.0475	10	0.21540	T	0.41	.	4.1954	0.10441	0.0988:0.4295:0.0936:0.378	.	1852	Q38SD2	LRRK1_HUMAN	V	1852;1849;543;406	ENSP00000373600:A1852V;ENSP00000284395:A1849V	ENSP00000284395:A1849V	A	+	2	0	LRRK1	99423720	0.000000	0.05858	0.000000	0.03702	0.182000	0.23217	0.101000	0.15251	-0.464000	0.06963	-0.136000	0.14681	GCT		0.597	LRRK1-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384567.2	NM_024652	
CNDP1	84735	broad.mit.edu;mdanderson.org	37	18	72234590	72234590	+	Silent	SNP	T	T	C			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr18:72234590T>C	ENST00000358821.3	+	6	906	c.678T>C	c.(676-678)atT>atC	p.I226I	CNDP1_ENST00000582365.1_Silent_p.I183I	NM_032649.5	NP_116038	Q96KN2	CNDP1_HUMAN	carnosine dipeptidase 1 (metallopeptidase M20 family)	226						extracellular region (GO:0005576)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|tripeptidase activity (GO:0034701)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(12)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27		Esophageal squamous(42;0.129)|Prostate(75;0.157)|Melanoma(33;0.211)		BRCA - Breast invasive adenocarcinoma(31;0.109)		ACATTGTAATTTCAGATAACC	0.493																																					Melanoma(32;1029 1042 25286 38395 44237)	.											0													115.0	120.0	118.0					18																	72234590		2203	4300	6503	SO:0001819	synonymous_variant	84735				CCDS12007.1	18q22.3	2014-07-14			ENSG00000150656	ENSG00000150656	3.4.13.20		20675	protein-coding gene	gene with protein product	"""carnosinase 1"", ""glutamate carboxypeptidase-like protein 2"""	609064				12473676	Standard	NM_032649		Approved	MGC10825, CN1, CPGL2, HsT2308	uc002llq.3	Q96KN2	OTTHUMG00000132852	ENST00000358821.3:c.678T>C	18.37:g.72234590T>C			Q14D40|Q17S05|Q2TBG0|Q6UWK2|Q9BT98	Silent	SNP	ENST00000358821.3	37	CCDS12007.1																																																																																				0.493	CNDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256326.1	NM_032649	
RFX2	5990	broad.mit.edu;mdanderson.org	37	19	6004252	6004252	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr19:6004252T>C	ENST00000303657.5	-	13	1609	c.1460A>G	c.(1459-1461)aAt>aGt	p.N487S	CTC-232P5.1_ENST00000587836.1_RNA|RFX2_ENST00000592546.1_Missense_Mutation_p.N462S|RFX2_ENST00000359161.3_Missense_Mutation_p.N487S	NM_000635.3	NP_000626.2	P48378	RFX2_HUMAN	regulatory factor X, 2 (influences HLA class II expression)	487					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(4)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	21						ACTCATGGCATTTGTCAACCA	0.577																																					Colon(38;171 817 19800 47433 48051)	.											0													201.0	172.0	182.0					19																	6004252		2203	4300	6503	SO:0001583	missense	5990				CCDS12157.1, CCDS12158.1	19p13.3	2011-11-23			ENSG00000087903	ENSG00000087903			9983	protein-coding gene	gene with protein product	"""trans-acting regulatory factor 2"", ""DNA binding protein RFX2"", ""HLA class II regulatory factor RFX2"""	142765				1505960	Standard	NM_000635		Approved	FLJ14226	uc002meb.3	P48378		ENST00000303657.5:c.1460A>G	19.37:g.6004252T>C	ENSP00000306335:p.Asn487Ser		A8K581|B3KNC4|Q6IQ44|Q8SNA2	Missense_Mutation	SNP	ENST00000303657.5	37	CCDS12157.1	.	.	.	.	.	.	.	.	.	.	T	10.08	1.253017	0.22965	.	.	ENSG00000087903	ENST00000303657;ENST00000359161;ENST00000537791	T	0.06608	3.28	5.14	5.14	0.70334	.	0.098858	0.64402	D	0.000003	T	0.03263	0.0095	N	0.03948	-0.315	0.49687	D	0.999812	B;B	0.12630	0.006;0.004	B;B	0.17979	0.02;0.004	T	0.48927	-0.8991	10	0.11794	T	0.64	-30.9915	14.0709	0.64858	0.0:0.0:0.0:1.0	.	462;487	P48378-2;P48378	.;RFX2_HUMAN	S	487;462;274	ENSP00000306335:N487S	ENSP00000306335:N487S	N	-	2	0	RFX2	5955252	0.972000	0.33761	0.542000	0.28115	0.634000	0.38068	1.682000	0.37628	2.057000	0.61298	0.533000	0.62120	AAT		0.577	RFX2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452687.1	NM_000635	
MBD5	55777	broad.mit.edu;mdanderson.org	37	2	149226187	149226187	+	Silent	SNP	G	G	A			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr2:149226187G>A	ENST00000407073.1	+	9	1672	c.675G>A	c.(673-675)gcG>gcA	p.A225A	MBD5_ENST00000404807.1_Silent_p.A225A	NM_018328.4	NP_060798.2	Q9P267	MBD5_HUMAN	methyl-CpG binding domain protein 5	225					glucose homeostasis (GO:0042593)|nervous system development (GO:0007399)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|regulation of multicellular organism growth (GO:0040014)|single-organism behavior (GO:0044708)	chromocenter (GO:0010369)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(16)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	62				BRCA - Breast invasive adenocarcinoma(221;0.0569)		CCAGCCCAGCGTCATCAGGTT	0.512																																						.											0													97.0	101.0	100.0					2																	149226187		2203	4300	6503	SO:0001819	synonymous_variant	55777			AB040894	CCDS33302.1	2q23.2	2009-04-17			ENSG00000204406	ENSG00000204406			20444	protein-coding gene	gene with protein product		611472				12529184	Standard	NM_018328		Approved	FLJ11113, KIAA1461	uc002twm.4	Q9P267	OTTHUMG00000150440	ENST00000407073.1:c.675G>A	2.37:g.149226187G>A			A5HMQ4|A7E2B1|Q53SR1|Q9NUV6	Silent	SNP	ENST00000407073.1	37	CCDS33302.1																																																																																				0.512	MBD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318111.2		
XIRP2	129446	broad.mit.edu	37	2	168100984	168100984	+	Nonsense_Mutation	SNP	C	C	T			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr2:168100984C>T	ENST00000409195.1	+	9	3171	c.3082C>T	c.(3082-3084)Cag>Tag	p.Q1028*	XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409273.1_Nonsense_Mutation_p.Q806*|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000295237.9_Nonsense_Mutation_p.Q1028*|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409728.1_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	853					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						GCCCATTGACCAGTTTGATGA	0.363																																						.											0													62.0	58.0	59.0					2																	168100984		1836	4084	5920	SO:0001587	stop_gained	129446			AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.3082C>T	2.37:g.168100984C>T	ENSP00000386840:p.Gln1028*		A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Nonsense_Mutation	SNP	ENST00000409195.1	37	CCDS42769.1	.	.	.	.	.	.	.	.	.	.	C	41	8.956275	0.99016	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273	.	.	.	6.08	6.08	0.98989	.	0.109913	0.64402	D	0.000007	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-10.9057	19.4349	0.94788	0.0:1.0:0.0:0.0	.	.	.	.	X	1028;1028;806	.	ENSP00000295237:Q1028X	Q	+	1	0	XIRP2	167809230	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.088000	0.50175	2.894000	0.99253	0.655000	0.94253	CAG		0.363	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381	
CCDC66	285331	broad.mit.edu;mdanderson.org	37	3	56649272	56649272	+	Silent	SNP	C	C	T			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr3:56649272C>T	ENST00000394672.3	+	12	1753	c.1683C>T	c.(1681-1683)gaC>gaT	p.D561D	CCDC66_ENST00000326595.7_Silent_p.D527D|CCDC66_ENST00000436465.2_Silent_p.D561D	NM_001012506.4|NM_001141947.1	NP_001012524.4|NP_001135419.1	A2RUB6	CCD66_HUMAN	coiled-coil domain containing 66	561					post-embryonic retina morphogenesis in camera-type eye (GO:0060060)|retinal rod cell development (GO:0046548)					breast(1)|kidney(1)|large_intestine(2)|liver(1)|lung(4)|skin(2)|urinary_tract(1)	12				KIRC - Kidney renal clear cell carcinoma(284;0.0478)|Kidney(284;0.0597)|OV - Ovarian serous cystadenocarcinoma(275;0.233)		AGGGACATGACACTTCTAGAC	0.358																																						.											0													105.0	105.0	105.0					3																	56649272		2203	4300	6503	SO:0001819	synonymous_variant	285331			AL832692	CCDS33770.2, CCDS46852.1	3p14.3	2006-03-27			ENSG00000180376	ENSG00000180376			27709	protein-coding gene	gene with protein product						14702039	Standard	NR_024460		Approved	DKFZp686C0433	uc003dhz.3	A2RUB6	OTTHUMG00000155748	ENST00000394672.3:c.1683C>T	3.37:g.56649272C>T			B3KWL8|Q4VC34|Q8N949	Silent	SNP	ENST00000394672.3	37	CCDS46852.1																																																																																				0.358	CCDC66-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341473.1	NM_001012506	
ROBO2	6092	broad.mit.edu;mdanderson.org	37	3	77571941	77571941	+	Silent	SNP	C	C	T	rs201344460		TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr3:77571941C>T	ENST00000461745.1	+	6	1722	c.822C>T	c.(820-822)gaC>gaT	p.D274D	ROBO2_ENST00000487694.3_Silent_p.D290D|ROBO2_ENST00000332191.8_Silent_p.D274D	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)	274	Ig-like C2-type 3.				apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)			NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		ACATCAAAGACGATTACACAC	0.333													C|||	1	0.000199681	0.0	0.0	5008	,	,		16147	0.0		0.001	False		,,,				2504	0.0					.											0								C	,	2,3668		0,2,1833	121.0	115.0	117.0		870,822	0.4	1.0	3		117	1,8145		0,1,4072	yes	coding-synonymous,coding-synonymous	ROBO2	NM_001128929.2,NM_002942.4	,	0,3,5905	TT,TC,CC		0.0123,0.0545,0.0254	,	290/1395,274/1379	77571941	3,11813	1835	4073	5908	SO:0001819	synonymous_variant	6092			AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	ENST00000461745.1:c.822C>T	3.37:g.77571941C>T			O43608|Q19AB4|Q19AB5	Silent	SNP	ENST00000461745.1	37	CCDS43109.1																																																																																				0.333	ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352600.2	XM_031246	
CRYBG3	131544	broad.mit.edu	37	3	97596465	97596468	+	Frame_Shift_Del	DEL	AGAG	AGAG	-			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	AGAG	AGAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr3:97596465_97596468delAGAG	ENST00000182096.4	+	1	647_650	c.583_586delAGAG	c.(583-588)agagagfs	p.RE195fs		NM_153605.3	NP_705833.3	Q68DQ2	CRBG3_HUMAN	beta-gamma crystallin domain containing 3	2143							carbohydrate binding (GO:0030246)			breast(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(10)|stomach(1)|upper_aerodigestive_tract(2)	32						TGAAGATGACAGAGAGGCAGCTGA	0.471																																						.											0																																										SO:0001589	frameshift_variant	131544					3q11.2	2008-09-30			ENSG00000080200	ENSG00000080200			34427	protein-coding gene	gene with protein product							Standard	NM_153605		Approved	DKFZp667G2110	uc021xbn.2	Q68DQ2	OTTHUMG00000159187	ENST00000182096.4:c.583_586delAGAG	3.37:g.97596465_97596468delAGAG	ENSP00000182096:p.Arg195fs		B4DLE8|F6VHI2|Q4G0V8|Q7Z4R9|Q86VD0|Q8N262|Q8N7F1|Q8NDQ8	Frame_Shift_Del	DEL	ENST00000182096.4	37																																																																																					0.471	CRYBG3-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000353751.1	NM_153605	
TM4SF4	7104	broad.mit.edu	37	3	149192812	149192812	+	Missense_Mutation	SNP	G	G	A	rs556358999	byFrequency	TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr3:149192812G>A	ENST00000305354.4	+	1	1052	c.148G>A	c.(148-150)Gga>Aga	p.G50R		NM_004617.3	NP_004608.1	P48230	T4S4_HUMAN	transmembrane 4 L six family member 4	50					tissue regeneration (GO:0042246)	integral component of membrane (GO:0016021)				large_intestine(3)|lung(4)|ovary(1)|prostate(1)	9			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			CTGGTTTTTCGGAGGAATATT	0.428													G|||	2	0.000399361	0.0	0.0	5008	,	,		18859	0.0		0.0	False		,,,				2504	0.002					.											0													63.0	58.0	59.0					3																	149192812		1833	4087	5920	SO:0001583	missense	7104				CCDS46932.1	3q25	2005-03-21	2005-03-21		ENSG00000169903	ENSG00000169903			11856	protein-coding gene	gene with protein product		606567	"""transmembrane 4 superfamily member 4"""			7665614	Standard	NM_004617		Approved	il-TMP	uc003exd.2	P48230	OTTHUMG00000159619	ENST00000305354.4:c.148G>A	3.37:g.149192812G>A	ENSP00000305852:p.Gly50Arg		B2RDA4	Missense_Mutation	SNP	ENST00000305354.4	37	CCDS46932.1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.704458	0.88924	.	.	ENSG00000169903	ENST00000305354;ENST00000465758	T;T	0.30182	1.54;1.54	5.08	5.08	0.68730	.	0.152366	0.64402	D	0.000015	T	0.64148	0.2572	M	0.90759	3.145	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.69661	-0.5085	10	0.45353	T	0.12	-17.0483	18.8542	0.92244	0.0:0.0:1.0:0.0	.	50	P48230	T4S4_HUMAN	R	50	ENSP00000305852:G50R;ENSP00000419367:G50R	ENSP00000305852:G50R	G	+	1	0	TM4SF4	150675502	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.084000	0.94076	2.524000	0.85096	0.561000	0.74099	GGA		0.428	TM4SF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356528.1		
Unknown	0	broad.mit.edu;mdanderson.org	37	6	28240025	28240025	+	IGR	SNP	G	G	A			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr6:28240025G>A								NKAPL (11289 upstream) : PGBD1 (9288 downstream)																							CTCCAGGCCCGGGTGCAGGAG	0.567																																						.											0													20.0	20.0	20.0					6																	28240025		692	1591	2283	SO:0001628	intergenic_variant	7741																															6.37:g.28240025G>A				Missense_Mutation	SNP		37																																																																																				0	0.567								
BCLAF1	9774	broad.mit.edu;mdanderson.org;bcgsc.ca	37	6	136599231	136599231	+	Missense_Mutation	SNP	T	T	A			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr6:136599231T>A	ENST00000531224.1	-	4	1040	c.788A>T	c.(787-789)cAt>cTt	p.H263L	BCLAF1_ENST00000527759.1_Missense_Mutation_p.H261L|BCLAF1_ENST00000392348.2_Missense_Mutation_p.H261L|BCLAF1_ENST00000353331.4_Missense_Mutation_p.H261L|BCLAF1_ENST00000530767.1_Missense_Mutation_p.H263L|BCLAF1_ENST00000527536.1_Missense_Mutation_p.H263L	NM_001077441.1|NM_014739.2	NP_001070909.1|NP_055554.1	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1	263					apoptotic process (GO:0006915)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA-templated transcription, initiation (GO:2000144)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of response to DNA damage stimulus (GO:2001022)|regulation of DNA-templated transcription in response to stress (GO:0043620)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|ovary(1)|skin(1)	9	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		CTGAATGGAATGTGAATGCTG	0.443																																					Colon(142;1534 1789 5427 7063 28491)	.											0													130.0	121.0	124.0					6																	136599231		2203	4300	6503	SO:0001583	missense	9774			AF249273	CCDS5177.1, CCDS47485.1, CCDS47486.1, CCDS75525.1	6q22-q23	2007-03-02			ENSG00000029363	ENSG00000029363			16863	protein-coding gene	gene with protein product		612588				8724849, 10330179	Standard	NM_001077440		Approved	KIAA0164, BTF	uc003qgx.1	Q9NYF8	OTTHUMG00000033323	ENST00000531224.1:c.788A>T	6.37:g.136599231T>A	ENSP00000435210:p.His263Leu		A2RU75|B7ZM58|E1P586|Q14673|Q86WU6|Q86WY0	Missense_Mutation	SNP	ENST00000531224.1	37	CCDS5177.1	.	.	.	.	.	.	.	.	.	.	T	15.81	2.941948	0.53079	.	.	ENSG00000029363	ENST00000531224;ENST00000353331;ENST00000527536;ENST00000530767;ENST00000527759;ENST00000392348;ENST00000529826	T;T;T;T;T;T;T	0.14893	2.47;2.47;2.47;2.47;2.47;2.47;2.47	5.82	5.82	0.92795	.	0.000000	0.64402	D	0.000002	T	0.13500	0.0327	N	0.08118	0	0.80722	D	1	D;D;D;D	0.53462	0.96;0.96;0.96;0.96	D;D;D;D	0.64237	0.923;0.923;0.923;0.923	T	0.31558	-0.9939	10	0.48119	T	0.1	-13.1518	16.182	0.81915	0.0:0.0:0.0:1.0	.	261;261;263;263	Q9NYF8-2;Q9NYF8-3;Q9NYF8;Q9NYF8-4	.;.;BCLF1_HUMAN;.	L	263;261;263;263;261;261;263	ENSP00000435210:H263L;ENSP00000229446:H261L;ENSP00000435441:H263L;ENSP00000436501:H263L;ENSP00000434826:H261L;ENSP00000376159:H261L;ENSP00000431734:H263L	ENSP00000229446:H261L	H	-	2	0	BCLAF1	136640924	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.767000	0.68850	2.222000	0.72286	0.528000	0.53228	CAT		0.443	BCLAF1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042375.2	NM_014739	
MUSK	4593	broad.mit.edu;mdanderson.org	37	9	113563201	113563201	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr9:113563201G>A	ENST00000374448.4	+	15	2677	c.2543G>A	c.(2542-2544)aGt>aAt	p.S848N	MUSK_ENST00000189978.5_Missense_Mutation_p.S848N|MUSK_ENST00000416899.2_Missense_Mutation_p.S840N	NM_001166281.1|NM_005592.3	NP_001159753.1|NP_005583.1	O15146	MUSK_HUMAN	muscle, skeletal, receptor tyrosine kinase	848	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|memory (GO:0007613)|multicellular organismal development (GO:0007275)|neuromuscular junction development (GO:0007528)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of protein geranylgeranylation (GO:2000541)|positive regulation of protein phosphorylation (GO:0001934)|protein autophosphorylation (GO:0046777)|regulation of synaptic growth at neuromuscular junction (GO:0008582)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(23)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	49						GACAGACCCAGTTTCACCAGT	0.507																																						.											0													41.0	39.0	40.0					9																	113563201		2021	4185	6206	SO:0001583	missense	4593			AF006464	CCDS48005.1, CCDS75874.1	9q31.3-q32	2013-01-29			ENSG00000030304	ENSG00000030304		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7525	protein-coding gene	gene with protein product		601296				7546737	Standard	NM_005592		Approved		uc022blv.1	O15146	OTTHUMG00000020485	ENST00000374448.4:c.2543G>A	9.37:g.113563201G>A	ENSP00000363571:p.Ser848Asn		Q32MJ8|Q32MJ9|Q5VZW7|Q5VZW8	Missense_Mutation	SNP	ENST00000374448.4	37	CCDS48005.1	.	.	.	.	.	.	.	.	.	.	G	17.18	3.323273	0.60634	.	.	ENSG00000030304	ENST00000189978;ENST00000374448;ENST00000543335;ENST00000374447;ENST00000545907;ENST00000416899	T	0.53857	0.6	5.62	5.62	0.85841	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.125544	0.64402	D	0.000001	T	0.58323	0.2114	L	0.41492	1.28	0.80722	D	1	P	0.34743	0.466	P	0.46339	0.513	T	0.55939	-0.8061	10	0.48119	T	0.1	.	19.0078	0.92859	0.0:0.0:1.0:0.0	.	848	O15146	MUSK_HUMAN	N	854;848;848;762;762;846	ENSP00000363571:S848N	ENSP00000189978:S854N	S	+	2	0	MUSK	112603022	1.000000	0.71417	0.989000	0.46669	0.975000	0.68041	9.813000	0.99286	2.809000	0.96659	0.557000	0.71058	AGT		0.507	MUSK-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
ABCA12	26154	ucsc.edu	37	2	215797365	215797365	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr2:215797365T>C	ENST00000272895.7	-	53	8000	c.7781A>G	c.(7780-7782)gAg>gGg	p.E2594G	AC072062.1_ENST00000607412.1_RNA|ABCA12_ENST00000389661.4_Missense_Mutation_p.E2276G	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	2594					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		GTGTTAAGACTCCATCTGGTC	0.418																																					Ovarian(66;664 1488 5121 34295)	.											0													111.0	105.0	107.0					2																	215797365		2203	4300	6503	SO:0001583	missense	26154			AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.7781A>G	2.37:g.215797365T>C	ENSP00000272895:p.Glu2594Gly		Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	ENST00000272895.7	37	CCDS33372.1	.	.	.	.	.	.	.	.	.	.	T	14.33	2.503623	0.44558	.	.	ENSG00000144452	ENST00000272895;ENST00000389661	D;D	0.89746	-2.56;-2.53	5.8	5.8	0.92144	.	1.521370	0.04281	N	0.343875	D	0.85159	0.5633	N	0.24115	0.695	0.80722	D	1	B;B	0.30361	0.039;0.277	B;B	0.24394	0.024;0.053	T	0.64807	-0.6320	10	0.72032	D	0.01	.	15.1201	0.72434	0.0:0.0:0.0:1.0	.	2594;2276	Q86UK0;Q86UK0-2	ABCAC_HUMAN;.	G	2594;2276	ENSP00000272895:E2594G;ENSP00000374312:E2276G	ENSP00000272895:E2594G	E	-	2	0	ABCA12	215505610	0.024000	0.19004	0.003000	0.11579	0.966000	0.64601	2.645000	0.46621	2.214000	0.71695	0.455000	0.32223	GAG		0.418	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076	
AMBRA1	55626	ucsc.edu;bcgsc.ca	37	11	46515749	46515749	+	Missense_Mutation	SNP	T	T	C	rs147544015	byFrequency	TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr11:46515749T>C	ENST00000458649.2	-	10	2763	c.2345A>G	c.(2344-2346)aAt>aGt	p.N782S	AMBRA1_ENST00000533727.1_Missense_Mutation_p.N663S|AMBRA1_ENST00000529963.1_5'UTR|AMBRA1_ENST00000426438.1_Missense_Mutation_p.N753S|AMBRA1_ENST00000298834.3_Missense_Mutation_p.N722S|AMBRA1_ENST00000528950.1_Missense_Mutation_p.N753S|AMBRA1_ENST00000314845.3_Missense_Mutation_p.N692S|AMBRA1_ENST00000534300.1_Missense_Mutation_p.N722S			Q9C0C7	AMRA1_HUMAN	autophagy/beclin-1 regulator 1	782					autophagy (GO:0006914)|cell differentiation (GO:0030154)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neural tube development (GO:0021915)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|phagocytic vesicle (GO:0045335)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	39				GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)		TCTGTCACCATTGTCCCTGAA	0.468													T|||	3	0.000599042	0.0	0.0043	5008	,	,		18258	0.0		0.0	False		,,,				2504	0.0					.											0								T	SER/ASN	0,4402		0,0,2201	49.0	43.0	45.0		2075	2.4	1.0	11	dbSNP_134	45	1,8597	1.2+/-3.3	0,1,4298	yes	missense	AMBRA1	NM_017749.2	46	0,1,6499	CC,CT,TT		0.0116,0.0,0.0077	benign	692/1209	46515749	1,12999	2201	4299	6500	SO:0001583	missense	55626			AB051523	CCDS31475.1, CCDS58132.1, CCDS73281.1	11p11.2	2013-01-09			ENSG00000110497	ENSG00000110497		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	25990	protein-coding gene	gene with protein product	"""WD repeat domain 94"", ""DDB1 and CUL4 associated factor 3"""	611359				17622796, 17603510, 17589504	Standard	NM_001267782		Approved	FLJ20294, KIAA1736, WDR94, DCAF3	uc001ncv.3	Q9C0C7	OTTHUMG00000166500	ENST00000458649.2:c.2345A>G	11.37:g.46515749T>C	ENSP00000415327:p.Asn782Ser		A6XN33|D3DQP8|G3V193|Q86XD6|Q9H8Z0|Q9NXE7	Missense_Mutation	SNP	ENST00000458649.2	37		2	9.157509157509158E-4	0	0.0	2	0.0055248618784530384	0	0.0	0	0.0	T	16.46	3.130274	0.56721	0.0	1.16E-4	ENSG00000110497	ENST00000314845;ENST00000533727;ENST00000534300;ENST00000426438;ENST00000298834;ENST00000458649;ENST00000528950	D;D;D;D;D;D;D	0.90732	-2.72;-2.72;-2.72;-2.72;-2.72;-2.72;-2.72	4.78	2.43	0.29744	.	0.178269	0.64402	N	0.000016	T	0.75547	0.3864	L	0.27053	0.805	0.27935	N	0.937725	P;B;B;B;B;B	0.48764	0.915;0.002;0.002;0.002;0.003;0.0	B;B;B;B;B;B	0.39465	0.3;0.002;0.002;0.002;0.004;0.002	T	0.70626	-0.4820	10	0.27082	T	0.32	.	8.2757	0.31871	0.0:0.1603:0.0:0.8397	.	782;753;722;663;785;692	Q9C0C7;Q9C0C7-3;Q9C0C7-2;G3V193;Q9C0C7-5;Q9C0C7-4	AMRA1_HUMAN;.;.;.;.;.	S	692;663;722;753;722;782;753	ENSP00000318313:N692S;ENSP00000433372:N663S;ENSP00000431926:N722S;ENSP00000410899:N753S;ENSP00000298834:N722S;ENSP00000415327:N782S;ENSP00000433945:N753S	ENSP00000298834:N722S	N	-	2	0	AMBRA1	46472325	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.842000	0.39250	0.396000	0.25283	0.529000	0.55759	AAT		0.468	AMBRA1-005	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000390103.1	NM_017749	
C10orf120	399814	ucsc.edu;mdanderson.org	37	10	124457697	124457698	+	Missense_Mutation	DNP	TC	TC	GA			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	TC	TC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr10:124457697_124457698TC>GA	ENST00000329446.4	-	3	590_591	c.559_560GA>TC	c.(559-561)GAa>TCa	p.E187S		NM_001010912.1	NP_001010912.1	Q5SQS8	CJ120_HUMAN	chromosome 10 open reading frame 120	187										endometrium(1)|kidney(1)|large_intestine(6)|lung(9)|skin(2)|stomach(1)|urinary_tract(1)	21		all_neural(114;0.169)|Glioma(114;0.222)				TGTAAACCTTTCAATGTAGGGT	0.47																																						.											0																																										SO:0001583	missense	399814				CCDS31302.1	10q26.13	2012-06-12			ENSG00000183559	ENSG00000183559			25707	protein-coding gene	gene with protein product							Standard	NM_001010912		Approved	bA318C4.1	uc001lgn.3	Q5SQS8	OTTHUMG00000019187	ENST00000329446.4:c.559_560delinsGA	10.37:g.124457697_124457698delinsGA	ENSP00000331012:p.Glu187Ser		B2RU17	Nonsense_Mutation	DNP	ENST00000329446.4	37	CCDS31302.1																																																																																				0.470	C10orf120-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050803.1	NM_001010912	
DNAH8	1769	ucsc.edu	37	6	38690885	38690885	+	5'Flank	SNP	G	G	A			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr6:38690885G>A	ENST00000359357.3	+	0	0				DNAH8_ENST00000449981.2_Silent_p.V100V			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8						cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						TTTCGGAAGTGCTGTCCTTGC	0.507																																						.											0													106.0	96.0	99.0					6																	38690885		876	1991	2867	SO:0001631	upstream_gene_variant	1769			Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253		6.37:g.38690885G>A	Exception_encountered		O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Silent	SNP	ENST00000359357.3	37																																																																																					0.507	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927	
EXOC6B	23233	ucsc.edu;bcgsc.ca	37	2	72725650	72725650	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr2:72725650C>T	ENST00000272427.6	-	13	1400	c.1270G>A	c.(1270-1272)Gac>Aac	p.D424N	EXOC6B_ENST00000410104.1_Missense_Mutation_p.D424N	NM_015189.1	NP_056004.1	Q9Y2D4	EXC6B_HUMAN	exocyst complex component 6B	424					protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	exocyst (GO:0000145)		p.D424H(1)		breast(1)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)	10						AACAGCATGTCAAAAAGCTGA	0.338																																						.											1	Substitution - Missense(1)	NS(1)											87.0	78.0	81.0					2																	72725650		1821	4093	5914	SO:0001583	missense	23233			AB023136	CCDS46333.1	2p13.2	2013-01-22	2006-11-07	2006-11-07	ENSG00000144036	ENSG00000144036			17085	protein-coding gene	gene with protein product		607880	"""SEC15-like 2 (S. cerevisiae)"", ""SEC15 homolog B (S. cerevisiae)"""	SEC15L2, SEC15B		10231032, 11406615	Standard	NM_015189		Approved	KIAA0919	uc010fep.3	Q9Y2D4	OTTHUMG00000152723	ENST00000272427.6:c.1270G>A	2.37:g.72725650C>T	ENSP00000272427:p.Asp424Asn		B8ZZY3	Missense_Mutation	SNP	ENST00000272427.6	37	CCDS46333.1	.	.	.	.	.	.	.	.	.	.	C	28.9	4.957160	0.92726	.	.	ENSG00000144036	ENST00000272427;ENST00000410104;ENST00000290144	T;T	0.30714	1.52;1.52	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	T	0.49338	0.1551	L	0.54323	1.7	0.80722	D	1	D;P	0.63880	0.993;0.92	D;P	0.70935	0.971;0.73	T	0.25082	-1.0142	10	0.31617	T	0.26	.	16.1342	0.81471	0.0:1.0:0.0:0.0	.	424;424	Q9Y2D4;Q9Y2D4-2	EXC6B_HUMAN;.	N	424	ENSP00000272427:D424N;ENSP00000386698:D424N	ENSP00000272427:D424N	D	-	1	0	EXOC6B	72579158	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.434000	0.80377	2.693000	0.91896	0.650000	0.86243	GAC		0.338	EXOC6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327558.1	XM_039570	
GPR144	347088	ucsc.edu	37	9	127232841	127232841	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr9:127232841T>C	ENST00000334810.1	+	17	2627	c.2627T>C	c.(2626-2628)gTg>gCg	p.V876A				Q7Z7M1	GP144_HUMAN	G protein-coupled receptor 144	876					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(3)	4						GGCATCCTGGTGCACCTGAGC	0.672																																						.											0													30.0	38.0	36.0					9																	127232841		692	1591	2283	SO:0001583	missense	347088			AY278562		9q34.11	2014-08-08			ENSG00000180264	ENSG00000180264		"""-"", ""GPCR / Class B : Orphans"""	18651	protein-coding gene	gene with protein product							Standard	XM_006710216		Approved	PGR24	uc010mwn.3	Q7Z7M1	OTTHUMG00000020652	ENST00000334810.1:c.2627T>C	9.37:g.127232841T>C	ENSP00000335156:p.Val876Ala		Q86SL4|Q8NH12	Missense_Mutation	SNP	ENST00000334810.1	37	CCDS48016.1	.	.	.	.	.	.	.	.	.	.	T	12.01	1.808625	0.31961	.	.	ENSG00000180264	ENST00000334810;ENST00000446588	T	0.36878	1.23	4.63	0.38	0.16222	GPCR, family 2-like (1);	.	.	.	.	T	0.16041	0.0386	N	0.05574	-0.02	0.34264	D	0.680245	B;B	0.31790	0.06;0.34	B;B	0.37601	0.028;0.254	T	0.33033	-0.9884	9	0.07175	T	0.84	.	5.9987	0.19509	0.0:0.1814:0.1437:0.6749	.	61;876	A1E4E8;Q7Z7M1	.;GP144_HUMAN	A	876;61	ENSP00000335156:V876A	ENSP00000335156:V876A	V	+	2	0	GPR144	126272662	0.999000	0.42202	0.932000	0.37286	0.251000	0.25915	3.363000	0.52321	0.155000	0.19261	0.459000	0.35465	GTG		0.672	GPR144-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054026.2	NM_182611	
IL1RL1	9173	ucsc.edu	37	2	102964403	102964403	+	Splice_Site	SNP	A	A	G			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr2:102964403A>G	ENST00000233954.1	+	9	1241		c.e9-1			NM_016232.4	NP_057316.3	Q01638	ILRL1_HUMAN	interleukin 1 receptor-like 1						immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of T-helper 1 type immune response (GO:0002826)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of macrophage activation (GO:0043032)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	cytokine receptor activity (GO:0004896)|interleukin-1 receptor activity (GO:0004908)|interleukin-33 receptor activity (GO:0002114)|receptor signaling protein activity (GO:0005057)			NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(3)|urinary_tract(1)	16						TCTTTTGAATAGTTGATCATC	0.313																																						.											0													74.0	72.0	72.0					2																	102964403		2203	4300	6503	SO:0001630	splice_region_variant	9173			D12764	CCDS2057.1, CCDS2058.1, CCDS74548.1	2q12	2013-01-29			ENSG00000115602	ENSG00000115602		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5998	protein-coding gene	gene with protein product	"""homolog of mouse growth stimulation-expressed"""	601203				1482686, 10191101, 16286016	Standard	NM_016232		Approved	ST2, FIT-1, ST2L, ST2V, DER4, T1, IL33R	uc002tbu.1	Q01638	OTTHUMG00000130782	ENST00000233954.1:c.971-1A>G	2.37:g.102964403A>G			A8K6B3|B4E0I3|Q53TU7|Q8NEJ3|Q9ULV7|Q9UQ44	Splice_Site	SNP	ENST00000233954.1	37	CCDS2057.1	.	.	.	.	.	.	.	.	.	.	a	13.35	2.212003	0.39102	.	.	ENSG00000115602	ENST00000233954	.	.	.	5.53	5.53	0.82687	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.3356	0.60516	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	IL1RL1	102330835	1.000000	0.71417	0.996000	0.52242	0.375000	0.29983	4.979000	0.63806	2.231000	0.72958	0.455000	0.32223	.		0.313	IL1RL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253296.1	NM_016232	Intron
IQGAP3	128239	ucsc.edu;bcgsc.ca	37	1	156531643	156531643	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr1:156531643T>C	ENST00000361170.2	-	10	1038	c.1028A>G	c.(1027-1029)gAg>gGg	p.E343G		NM_178229.4	NP_839943.2	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	343					activation of MAPK activity (GO:0000187)|cellular response to organic substance (GO:0071310)|ERK1 and ERK2 cascade (GO:0070371)|G1/S transition of mitotic cell cycle (GO:0000082)|negative regulation of gene expression (GO:0010629)|positive regulation of gene expression (GO:0010628)|positive regulation of mammary gland epithelial cell proliferation (GO:0033601)|Ras protein signal transduction (GO:0007265)|regulation of cell size (GO:0008361)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)	Ras GTPase activator activity (GO:0005099)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(14)|lung(29)|ovary(5)|prostate(5)|skin(5)|urinary_tract(3)	75	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					TGCCTTCTGCTCTCTGTCTGA	0.552																																						.											0													99.0	78.0	85.0					1																	156531643		2203	4300	6503	SO:0001583	missense	128239			AY253300	CCDS1144.1	1q21.3	2008-02-05			ENSG00000183856	ENSG00000183856			20669	protein-coding gene	gene with protein product							Standard	NM_178229		Approved		uc001fpf.3	Q86VI3	OTTHUMG00000033114	ENST00000361170.2:c.1028A>G	1.37:g.156531643T>C	ENSP00000354451:p.Glu343Gly		Q5T3H8	Missense_Mutation	SNP	ENST00000361170.2	37	CCDS1144.1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.946957	0.73672	.	.	ENSG00000183856	ENST00000361170	T	0.06449	3.3	5.41	5.41	0.78517	.	0.060400	0.64402	D	0.000004	T	0.06917	0.0176	M	0.69248	2.105	0.51233	D	0.999918	P	0.49090	0.919	P	0.45343	0.477	T	0.04635	-1.0937	10	0.62326	D	0.03	-28.6821	14.2677	0.66129	0.0:0.0:0.0:1.0	.	343	Q86VI3	IQGA3_HUMAN	G	343	ENSP00000354451:E343G	ENSP00000354451:E343G	E	-	2	0	IQGAP3	154798267	1.000000	0.71417	1.000000	0.80357	0.891000	0.51852	7.845000	0.86875	2.059000	0.61396	0.459000	0.35465	GAG		0.552	IQGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080657.1	NM_178229	
MTBP	27085	ucsc.edu;bcgsc.ca	37	8	121467780	121467780	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr8:121467780A>G	ENST00000305949.1	+	6	635	c.590A>G	c.(589-591)tAt>tGt	p.Y197C		NM_022045.4	NP_071328.2	Q96DY7	MTBP_HUMAN	MDM2 binding protein	197					cell cycle arrest (GO:0007050)|mitotic spindle checkpoint (GO:0071174)|negative regulation of cell proliferation (GO:0008285)|protein localization to kinetochore (GO:0034501)|traversing start control point of mitotic cell cycle (GO:0007089)	chromatin (GO:0000785)|kinetochore (GO:0000776)				NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	30	Lung NSC(37;5.68e-08)|Ovarian(258;0.00769)|all_neural(195;0.0804)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00503)			AGAGAATGGTATTCAGCAAAG	0.328																																						.											0													148.0	148.0	148.0					8																	121467780		2203	4296	6499	SO:0001583	missense	27085				CCDS6333.1	8q24.1-q24.2	2014-03-03	2014-03-03		ENSG00000172167	ENSG00000172167			7417	protein-coding gene	gene with protein product		605927	"""MDM2 (mouse double minute 2)-binding protein, 104kD"", ""Mdm2, transformed 3T3 cell double minute 2, p53 binding protein (mouse) binding protein, 104kDa"""			10906133, 11060448	Standard	NM_022045		Approved		uc003ypc.2	Q96DY7	OTTHUMG00000165040	ENST00000305949.1:c.590A>G	8.37:g.121467780A>G	ENSP00000303398:p.Tyr197Cys		B4DUR5|Q9HA89	Missense_Mutation	SNP	ENST00000305949.1	37	CCDS6333.1	.	.	.	.	.	.	.	.	.	.	A	19.13	3.767765	0.69878	.	.	ENSG00000172167	ENST00000305949	.	.	.	5.58	5.58	0.84498	.	0.111345	0.64402	D	0.000014	T	0.60431	0.2268	L	0.51422	1.61	0.33018	D	0.528502	D	0.60575	0.988	P	0.53360	0.724	T	0.73228	-0.4049	9	0.87932	D	0	-6.7991	15.7325	0.77817	1.0:0.0:0.0:0.0	.	197	Q96DY7	MTBP_HUMAN	C	197	.	ENSP00000303398:Y197C	Y	+	2	0	MTBP	121536961	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	6.919000	0.75793	2.128000	0.65567	0.391000	0.25812	TAT		0.328	MTBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381530.1	NM_022045	
RAB1B	81876	ucsc.edu	37	11	66043329	66043329	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr11:66043329G>A	ENST00000311481.6	+	5	481	c.334G>A	c.(334-336)Gag>Aag	p.E112K	RP11-867G23.3_ENST00000501708.1_lincRNA|RP11-867G23.4_ENST00000526951.1_RNA|RAB1B_ENST00000527397.1_Missense_Mutation_p.E80K|RP11-867G23.4_ENST00000528650.1_RNA|CNIH2_ENST00000528852.1_5'Flank|CNIH2_ENST00000311445.6_5'Flank	NM_030981.2	NP_112243.1	Q9H0U4	RAB1B_HUMAN	RAB1B, member RAS oncogene family	112					ER to Golgi vesicle-mediated transport (GO:0006888)|positive regulation of glycoprotein metabolic process (GO:1903020)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)|virion assembly (GO:0019068)	endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)			large_intestine(2)|lung(1)|ovary(1)|prostate(1)	5						CTATGCCAGCGAGAACGTCAA	0.577																																						.											0													32.0	31.0	31.0					11																	66043329		2199	4291	6490	SO:0001583	missense	81876			AJ245875	CCDS31613.1	11q13.1	2008-02-05			ENSG00000174903	ENSG00000174903		"""RAB, member RAS oncogene"""	18370	protein-coding gene	gene with protein product		612565				9030196	Standard	NM_030981		Approved		uc001ohf.3	Q9H0U4	OTTHUMG00000166916	ENST00000311481.6:c.334G>A	11.37:g.66043329G>A	ENSP00000310226:p.Glu112Lys		A8K7S1	Missense_Mutation	SNP	ENST00000311481.6	37	CCDS31613.1	.	.	.	.	.	.	.	.	.	.	G	16.99	3.273458	0.59649	.	.	ENSG00000174903	ENST00000311481;ENST00000527397;ENST00000394080	T;T	0.76839	-1.05;-1.05	4.53	4.53	0.55603	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	T	0.62804	0.2458	N	0.12637	0.245	0.80722	D	1	B	0.23891	0.093	B	0.18561	0.022	T	0.64305	-0.6439	10	0.72032	D	0.01	.	14.731	0.69383	0.0:0.0:1.0:0.0	.	112	Q9H0U4	RAB1B_HUMAN	K	112;80;112	ENSP00000310226:E112K;ENSP00000435195:E80K	ENSP00000310226:E112K	E	+	1	0	RAB1B	65799905	1.000000	0.71417	0.997000	0.53966	0.380000	0.30137	9.678000	0.98647	2.068000	0.61886	0.313000	0.20887	GAG		0.577	RAB1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391886.2	NM_030981	
SDK2	54549	ucsc.edu	37	17	71468293	71468293	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr17:71468293T>C	ENST00000392650.3	-	3	289	c.289A>G	c.(289-291)Atg>Gtg	p.M97V	SDK2_ENST00000388726.3_Missense_Mutation_p.M97V	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	97	Ig-like C2-type 1.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						AGGGCCCCCATTCGGTTCCGC	0.632																																						.											0													31.0	33.0	32.0					17																	71468293		692	1591	2283	SO:0001583	missense	54549			AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.289A>G	17.37:g.71468293T>C	ENSP00000376421:p.Met97Val		A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Missense_Mutation	SNP	ENST00000392650.3	37	CCDS45769.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	5.042|5.042	0.193439|0.193439	0.09599|0.09599	.|.	.|.	ENSG00000069188|ENSG00000069188	ENST00000392650;ENST00000388726;ENST00000316893|ENST00000416616	T;T|.	0.35973|.	1.28;1.28|.	4.76|4.76	4.76|4.76	0.60689|0.60689	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);|.	0.084158|.	0.47455|.	U|.	0.000221|.	T|T	0.31888|0.31888	0.0811|0.0811	N|N	0.02802|0.02802	-0.49|-0.49	0.43326|0.43326	D|D	0.995352|0.995352	B|.	0.06786|.	0.001|.	B|.	0.11329|.	0.006|.	T|T	0.24297|0.24297	-1.0164|-1.0164	10|5	0.08599|.	T|.	0.76|.	.|.	14.2239|14.2239	0.65845|0.65845	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	97|.	Q58EX2|.	SDK2_HUMAN|.	V|S	97|1	ENSP00000376421:M97V;ENSP00000373378:M97V|.	ENSP00000324967:M97V|.	M|N	-|-	1|2	0|0	SDK2|SDK2	68979888|68979888	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.404000|0.404000	0.30871|0.30871	4.217000|4.217000	0.58547|0.58547	1.907000|1.907000	0.55213|0.55213	0.247000|0.247000	0.18012|0.18012	ATG|AAT		0.632	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327598.2	NM_019064	
AHNAK2	113146	mdanderson.org	37	14	105418155	105418155	+	Silent	SNP	G	G	C	rs141600524		TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr14:105418155G>C	ENST00000333244.5	-	7	3752	c.3633C>G	c.(3631-3633)ctC>ctG	p.L1211L	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	1211						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GCTGAATGCTGAGGTCAGTGG	0.647																																						.											0								G		80,3750		19,42,1854	104.0	78.0	86.0		3633	-6.0	0.0	14	dbSNP_134	86	913,6543		290,333,3105	no	coding-synonymous	AHNAK2	NM_138420.2		309,375,4959	CC,CG,GG		12.2452,2.0888,8.7985		1211/5796	105418155	993,10293	1915	3728	5643	SO:0001819	synonymous_variant	113146			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.3633C>G	14.37:g.105418155G>C			Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Silent	SNP	ENST00000333244.5	37	CCDS45177.1																																																																																				0.647	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
ANO6	196527	mdanderson.org	37	12	45725162	45725162	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr12:45725162A>G	ENST00000320560.8	+	3	437	c.235A>G	c.(235-237)Agc>Ggc	p.S79G	ANO6_ENST00000425752.2_Missense_Mutation_p.S79G|ANO6_ENST00000426898.2_3'UTR|ANO6_ENST00000435642.1_Missense_Mutation_p.S79G|ANO6_ENST00000441606.2_Missense_Mutation_p.S61G|ANO6_ENST00000423947.3_Missense_Mutation_p.S100G	NM_001025356.2	NP_001020527.2	Q4KMQ2	ANO6_HUMAN	anoctamin 6	79					activation of blood coagulation via clotting cascade (GO:0002543)|blood coagulation (GO:0007596)|bone mineralization involved in bone maturation (GO:0035630)|calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|calcium activated phosphatidylserine scrambling (GO:0061589)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|dendritic cell chemotaxis (GO:0002407)|ion transmembrane transport (GO:0034220)|phosphatidylserine exposure on blood platelet (GO:0097045)|phospholipid scrambling (GO:0017121)|positive regulation of endothelial cell apoptotic process (GO:2000353)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)	cell surface (GO:0009986)|chloride channel complex (GO:0034707)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|intracellular calcium activated chloride channel activity (GO:0005229)|phospholipid scramblase activity (GO:0017128)|voltage-gated chloride channel activity (GO:0005247)|voltage-gated ion channel activity (GO:0005244)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(23)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	46						TGAGGATGAAAGCAGAAAAGA	0.303																																						.											0													76.0	80.0	78.0					12																	45725162		2203	4299	6502	SO:0001583	missense	196527			AL832340	CCDS31782.1, CCDS44865.1, CCDS44866.1, CCDS55819.1	12q12-q13.11	2014-09-17	2008-08-28	2008-08-28				"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	25240	protein-coding gene	gene with protein product		608663	"""transmembrane protein 16F"""	TMEM16F		15067359, 24692353	Standard	NM_001025356		Approved	DKFZp313M0720	uc010slf.2	Q4KMQ2	OTTHUMG00000169564	ENST00000320560.8:c.235A>G	12.37:g.45725162A>G	ENSP00000320087:p.Ser79Gly		A6NNM6|B9EGG0|E7ENK4|E9PB30|E9PCT2|Q8N3Q2	Missense_Mutation	SNP	ENST00000320560.8	37	CCDS31782.1	.	.	.	.	.	.	.	.	.	.	A	10.45	1.352937	0.24512	.	.	ENSG00000177119	ENST00000425752;ENST00000423947;ENST00000435642;ENST00000320560;ENST00000441606	T;T;T;T;T	0.68903	-0.36;-0.36;-0.36;-0.36;-0.36	5.17	1.24	0.21308	.	0.364642	0.32416	N	0.006135	T	0.51702	0.1690	L	0.50333	1.59	0.31878	N	0.618855	B;B;B;B	0.26672	0.004;0.01;0.156;0.008	B;B;B;B	0.17098	0.017;0.017;0.016;0.005	T	0.49679	-0.8914	10	0.22706	T	0.39	.	7.1651	0.25685	0.6484:0.2749:0.0767:0.0	.	61;100;79;79	E9PB30;B9EGG0;E9PCT2;Q4KMQ2	.;.;.;ANO6_HUMAN	G	79;100;79;79;61	ENSP00000391417:S79G;ENSP00000409126:S100G;ENSP00000413840:S79G;ENSP00000320087:S79G;ENSP00000413137:S61G	ENSP00000320087:S79G	S	+	1	0	ANO6	44011429	0.998000	0.40836	0.935000	0.37517	0.905000	0.53344	2.285000	0.43487	0.483000	0.27608	0.482000	0.46254	AGC		0.303	ANO6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000404822.1	XM_113743	
CACNA1H	8912	mdanderson.org	37	16	1250389	1250389	+	Missense_Mutation	SNP	A	A	G	rs36117280	byFrequency	TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr16:1250389A>G	ENST00000348261.5	+	7	1185	c.937A>G	c.(937-939)Atg>Gtg	p.M313V	CACNA1H_ENST00000358590.4_Missense_Mutation_p.M313V|CACNA1H_ENST00000565831.1_Missense_Mutation_p.M313V	NM_021098.2	NP_066921.2	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type, alpha 1H subunit	313			M -> V (in dbSNP:rs36117280). {ECO:0000269|PubMed:11157797, ECO:0000269|PubMed:12891677, ECO:0000269|PubMed:15616553}.		aldosterone biosynthetic process (GO:0032342)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|positive regulation of acrosome reaction (GO:2000344)|regulation of heart contraction (GO:0008016)|regulation of membrane potential (GO:0042391)|transport (GO:0006810)	caveola (GO:0005901)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)			breast(4)|endometrium(5)|kidney(2)|lung(23)	34		Hepatocellular(780;0.00369)			Amiodarone(DB01118)|Bepridil(DB01244)|Cinnarizine(DB00568)|Felodipine(DB01023)|Flunarizine(DB04841)|Isradipine(DB00270)|Nifedipine(DB01115)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Zonisamide(DB00909)	CGAGCTGCGCATGCCCTGCAC	0.672													g|||	514	0.102636	0.0651	0.0965	5008	,	,		17775	0.0625		0.1392	False		,,,				2504	0.1616					.											0									VAL/MET,VAL/MET	286,3770		8,270,1750	21.0	23.0	23.0		937,937	1.3	0.8	16	dbSNP_126	23	1201,7121		95,1011,3055	yes	missense,missense	CACNA1H	NM_001005407.1,NM_021098.2	21,21	103,1281,4805	GG,GA,AA		14.4316,7.0513,12.0132	benign,benign	313/2348,313/2354	1250389	1487,10891	2028	4161	6189	SO:0001583	missense	8912			AL031703	CCDS45375.1, CCDS45376.1	16p13.3	2012-03-07	2007-02-16					"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1395	protein-coding gene	gene with protein product		607904				9670923, 16382099	Standard	NM_021098		Approved	Cav3.2	uc002cks.3	O95180		ENST00000348261.5:c.937A>G	16.37:g.1250389A>G	ENSP00000334198:p.Met313Val		B5ME00|F8WFD1|O95802|Q8WWI6|Q96QI6|Q96RZ9|Q9NYY4|Q9NYY5	Missense_Mutation	SNP	ENST00000348261.5	37	CCDS45375.1	212	0.09706959706959707	34	0.06910569105691057	37	0.10220994475138122	29	0.050699300699300696	112	0.14775725593667546	G	0.522	-0.861845	0.02610	0.070513	0.144316	ENSG00000196557	ENST00000348261;ENST00000358590	D;D	0.95821	-3.82;-3.76	4.4	1.31	0.21738	Ion transport (1);	3.577580	0.00786	N	0.001311	T	0.02047	0.0064	N	0.00742	-1.23	0.53688	P	2.6999999999999247E-5	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.65249	-0.6214	9	0.15499	T	0.54	.	5.2097	0.15310	0.2553:0.1716:0.5731:0.0	rs36117280;rs58100776	313;313	O95180-2;O95180	.;CAC1H_HUMAN	V	313	ENSP00000334198:M313V;ENSP00000351401:M313V	ENSP00000334198:M313V	M	+	1	0	CACNA1H	1190390	0.025000	0.19082	0.832000	0.32986	0.360000	0.29518	0.078000	0.14761	-0.083000	0.12618	-0.195000	0.12781	ATG		0.672	CACNA1H-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000421601.1	NM_001005407	
CCDC144NL	339184	mdanderson.org	37	17	20770017	20770017	+	Splice_Site	SNP	C	C	T			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr17:20770017C>T	ENST00000327925.5	-	3	535		c.e3-1		RP11-344E13.3_ENST00000577860.1_RNA|RP11-344E13.3_ENST00000577537.1_RNA|CCDC144NL_ENST00000539484.1_Splice_Site|RP11-344E13.3_ENST00000583962.1_RNA|RP11-344E13.3_ENST00000439794.2_RNA|RP11-344E13.3_ENST00000582324.1_RNA|RP11-344E13.3_ENST00000417232.2_RNA	NM_001004306.1	NP_001004306.1	Q6NUI1	C144L_HUMAN	coiled-coil domain containing 144 family, N-terminal like											large_intestine(3)|lung(3)|skin(1)	7						cttggagcagctgggcaggca	0.567																																						.											0													32.0	23.0	26.0					17																	20770017		2092	3965	6057	SO:0001630	splice_region_variant	339184				CCDS32591.1	17p11.2	2009-01-15			ENSG00000205212	ENSG00000205212			33735	protein-coding gene	gene with protein product							Standard	NM_001004306		Approved	MGC87631	uc002gyf.3	Q6NUI1	OTTHUMG00000132271	ENST00000327925.5:c.416-1G>A	17.37:g.20770017C>T				Splice_Site	SNP	ENST00000327925.5	37	CCDS32591.1																																																																																				0.567	CCDC144NL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255361.2	NM_001004306	Intron
CEP170B	283638	mdanderson.org	37	14	105349388	105349388	+	Silent	SNP	A	A	C	rs2028414	byFrequency	TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr14:105349388A>C	ENST00000414716.3	+	8	822	c.594A>C	c.(592-594)ccA>ccC	p.P198P	CEP170B_ENST00000418279.1_Silent_p.P128P|CEP170B_ENST00000556508.1_Silent_p.P128P|CEP170B_ENST00000453495.1_Silent_p.P199P	NM_001112726.2	NP_001106197.1	Q9Y4F5	C170B_HUMAN	centrosomal protein 170B	198						cytoplasm (GO:0005737)|microtubule (GO:0005874)											CCAAGGGACCAGTGCAGCAGG	0.672													g|||	2589	0.516973	0.5174	0.5865	5008	,	,		12916	0.2302		0.669	False		,,,				2504	0.6063					.											0									,	2039,1829		591,857,486	5.0	7.0	7.0		594,384	-5.3	0.0	14	dbSNP_94	7	5324,2774		1859,1606,584	no	coding-synonymous,coding-synonymous	KIAA0284	NM_001112726.2,NM_015005.2	,	2450,2463,1070	CC,CA,AA		34.2554,47.2854,38.4673	,	198/1555,128/1520	105349388	7363,4603	1934	4049	5983	SO:0001819	synonymous_variant	283638			AB006622	CCDS45175.1, CCDS45176.1, CCDS45176.2	14q32.33	2014-02-20	2012-11-30	2012-11-30	ENSG00000099814	ENSG00000099814			20362	protein-coding gene	gene with protein product	"""Cep170-related"""		"""KIAA0284"""	KIAA0284		23087211	Standard	NM_015005		Approved	FAM68C, Cep170R	uc010axb.4	Q9Y4F5	OTTHUMG00000170763	ENST00000414716.3:c.594A>C	14.37:g.105349388A>C			Q2KHR7|Q86TI7	Silent	SNP	ENST00000414716.3	37	CCDS45175.1																																																																																				0.672	CEP170B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000410289.2	NM_001112726	
CLEC18B	497190	mdanderson.org	37	16	74447510	74447510	+	Missense_Mutation	SNP	G	G	A	rs201069655		TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr16:74447510G>A	ENST00000339953.5	-	4	642	c.521C>T	c.(520-522)gCg>gTg	p.A174V		NM_001011880.2	NP_001011880.2	Q6UXF7	CL18B_HUMAN	C-type lectin domain family 18, member B	174	SCP.					extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)	p.A174V(1)		endometrium(3)|kidney(9)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27						GGCTTCTATCGCTGTCTGGCC	0.607																																						.											1	Substitution - Missense(1)	ovary(1)																																								SO:0001583	missense	497190			AY358373	CCDS32484.1	16q22.3	2010-04-27	2009-03-10	2009-03-10		ENSG00000140839		"""C-type lectin domain containing"""	33849	protein-coding gene	gene with protein product							Standard	NM_001011880		Approved		uc002fct.3	Q6UXF7		ENST00000339953.5:c.521C>T	16.37:g.74447510G>A	ENSP00000341051:p.Ala174Val		B4DF90	Missense_Mutation	SNP	ENST00000339953.5	37	CCDS32484.1	.	.	.	.	.	.	.	.	.	.	g	0.788	-0.759876	0.03019	.	.	ENSG00000140839	ENST00000429489;ENST00000339953;ENST00000268492;ENST00000425714	T	0.09163	3.01	3.1	2.07	0.26955	CAP domain (3);	0.396709	0.26397	N	0.024613	T	0.03608	0.0103	N	0.05554	-0.025	0.09310	N	1	P;B;B	0.36222	0.544;0.005;0.005	B;B;B	0.28385	0.089;0.005;0.007	T	0.43491	-0.9388	10	0.16420	T	0.52	.	6.2019	0.20581	0.0:0.0:0.5117:0.4883	.	94;174;174	Q6UXF7-2;C9JSV1;Q6UXF7	.;.;CL18B_HUMAN	V	174;174;174;94	ENSP00000341051:A174V	ENSP00000268492:A174V	A	-	2	0	CLEC18B	73005011	0.004000	0.15560	0.030000	0.17652	0.250000	0.25880	0.525000	0.22956	0.423000	0.26033	0.537000	0.68136	GCG		0.607	CLEC18B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434697.1	NM_001011880	
FRG1B	284802	mdanderson.org	37	20	29624046	29624046	+	Missense_Mutation	SNP	C	C	T	rs10153995		TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr20:29624046C>T	ENST00000278882.3	+	4	450	c.70C>T	c.(70-72)Cct>Tct	p.P24S	FRG1B_ENST00000358464.4_Missense_Mutation_p.P24S|FRG1B_ENST00000439954.2_Missense_Mutation_p.P29S			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	24										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						TGATGAGGGCCCTAGTCCTCC	0.279																																						.											0																																										SO:0001583	missense	284802					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.70C>T	20.37:g.29624046C>T	ENSP00000278882:p.Pro24Ser		C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	c	13.70	2.316522	0.40996	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.72394	-0.65	1.91	1.91	0.25777	.	0.000000	0.85682	D	0.000000	T	0.74861	0.3772	.	.	.	0.54753	D	0.999982	.	.	.	.	.	.	T	0.76260	-0.3024	7	0.56958	D	0.05	.	9.8627	0.41125	0.0:1.0:0.0:0.0	rs10153995	.	.	.	S	24;29;24	ENSP00000408863:P29S	ENSP00000278882:P24S	P	+	1	0	FRG1B	28237707	1.000000	0.71417	0.999000	0.59377	0.522000	0.34438	6.186000	0.72026	1.383000	0.46405	0.184000	0.17185	CCT		0.279	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
FRG1B	284802	mdanderson.org	37	20	29633901	29633901	+	Silent	SNP	A	A	G			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr20:29633901A>G	ENST00000278882.3	+	9	920	c.540A>G	c.(538-540)gaA>gaG	p.E180E	FRG1B_ENST00000358464.4_Silent_p.E180E			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	180										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						AAACAAGAGAACCAAATTGAA	0.269																																						.											0																																										SO:0001819	synonymous_variant	284802					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.540A>G	20.37:g.29633901A>G			C4AME5	RNA	SNP	ENST00000278882.3	37																																																																																					0.269	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
FRG1	2483	mdanderson.org	37	4	190878552	190878552	+	Splice_Site	SNP	G	G	A			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr4:190878552G>A	ENST00000226798.4	+	6	654		c.e6-1		FRG1_ENST00000514482.1_Splice_Site	NM_004477.2	NP_004468.1	Q14331	FRG1_HUMAN	FSHD region gene 1						mRNA splicing, via spliceosome (GO:0000398)|muscle organ development (GO:0007517)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|lung(11)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|urinary_tract(1)	32		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		GTTTCACTTAGGGGAAAATGG	0.353																																						.											0													10.0	16.0	14.0					4																	190878552		2087	4234	6321	SO:0001630	splice_region_variant	2483			L76159	CCDS34121.1	4q35	2008-02-05			ENSG00000109536	ENSG00000109536			3954	protein-coding gene	gene with protein product		601278				8733123	Standard	XM_005262880		Approved	FSG1, FRG1A	uc003izs.3	Q14331	OTTHUMG00000160202	ENST00000226798.4:c.433-1G>A	4.37:g.190878552G>A			A8K775	Splice_Site	SNP	ENST00000226798.4	37	CCDS34121.1	.	.	.	.	.	.	.	.	.	.	N	14.16	2.452126	0.43531	.	.	ENSG00000109536	ENST00000226798;ENST00000524583;ENST00000531991	.	.	.	3.8	3.8	0.43715	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.6226	0.62146	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FRG1	191115546	1.000000	0.71417	1.000000	0.80357	0.449000	0.32228	9.545000	0.98095	1.860000	0.53959	0.454000	0.30748	.		0.353	FRG1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000359622.4	NM_004477	Intron
HLA-C	3107	mdanderson.org	37	6	31238929	31238929	+	Silent	SNP	C	C	G	rs2308592	byFrequency	TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr6:31238929C>G	ENST00000376228.5	-	3	554	c.540G>C	c.(538-540)ctG>ctC	p.L180L	HLA-C_ENST00000383329.3_Silent_p.L180L	NM_002117.5	NP_002108.4	Q95604	1C17_HUMAN	major histocompatibility complex, class I, C	180	Alpha-2.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	17						GGTAGGCTCTCAGCTGCTCCG	0.692																																						.											0													44.0	31.0	36.0					6																	31238929		2196	4292	6488	SO:0001819	synonymous_variant	3107			M11886	CCDS34393.1	6p21.3	2014-01-30			ENSG00000204525	ENSG00000204525		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4933	protein-coding gene	gene with protein product		142840	"""psoriasis susceptibility 1"""	HLA-JY3, D6S204, PSORS1		3863816, 16642438	Standard	NM_001243042		Approved		uc003nsy.3	P04222	OTTHUMG00000031154	ENST00000376228.5:c.540G>C	6.37:g.31238929C>G			O02864|O02958|Q29643|Q9MY30	Silent	SNP	ENST00000376228.5	37	CCDS34393.1	.	.	.	.	.	.	.	.	.	.	.	5.596	0.294742	0.10567	.	.	ENSG00000204525	ENST00000415537	.	.	.	2.81	-5.62	0.02481	.	.	.	.	.	T	0.06600	0.0169	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	T	0.26744	-1.0094	4	.	.	.	.	3.9618	0.09413	0.0987:0.4803:0.1638:0.2572	rs41547419	.	.	.	Q	180	.	.	E	-	1	0	HLA-C	31346908	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-2.653000	0.00856	-1.717000	0.01385	0.305000	0.20034	GAG		0.692	HLA-C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076281.3	NM_002117	
HLA-C	3107	mdanderson.org	37	6	31238931	31238931	+	Missense_Mutation	SNP	G	G	C	rs697743	byFrequency	TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr6:31238931G>C	ENST00000376228.5	-	3	552	c.538C>G	c.(538-540)Ctg>Gtg	p.L180V	HLA-C_ENST00000383329.3_Missense_Mutation_p.L180V	NM_002117.5	NP_002108.4	Q95604	1C17_HUMAN	major histocompatibility complex, class I, C	180	Alpha-2.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)	p.L180L(2)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	17						TAGGCTCTCAGCTGCTCCGCC	0.682																																						.											2	Substitution - coding silent(2)	prostate(2)											43.0	30.0	34.0					6																	31238931		2197	4291	6488	SO:0001583	missense	3107			M11886	CCDS34393.1	6p21.3	2014-01-30			ENSG00000204525	ENSG00000204525		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4933	protein-coding gene	gene with protein product		142840	"""psoriasis susceptibility 1"""	HLA-JY3, D6S204, PSORS1		3863816, 16642438	Standard	NM_001243042		Approved		uc003nsy.3	P04222	OTTHUMG00000031154	ENST00000376228.5:c.538C>G	6.37:g.31238931G>C	ENSP00000365402:p.Leu180Val		O02864|O02958|Q29643|Q9MY30	Missense_Mutation	SNP	ENST00000376228.5	37	CCDS34393.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.115|0.115	-1.133170|-1.133170	0.01756|0.01756	.|.	.|.	ENSG00000204525|ENSG00000204525	ENST00000415537|ENST00000376228;ENST00000383329;ENST00000396254;ENST00000539307	.|T;T	.|0.00009	.|9.46;9.46	2.81|2.81	-5.62|-5.62	0.02481|0.02481	.|MHC class I, alpha chain, alpha1/alpha2 (1);MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	.|115.764000	.|0.00166	.|U	.|0.000008	T|T	0.00012|0.00012	0.0000|0.0000	L|L	0.39514|0.39514	1.22|1.22	0.09310|0.09310	N|N	1|1	.|B;B;B;B	.|0.19331	.|0.035;0.01;0.005;0.01	.|B;B;B;B	.|0.31812	.|0.136;0.056;0.04;0.056	T|T	0.44065|0.44065	-0.9352|-0.9352	5|10	.|0.18710	.|T	.|0.47	.|.	2.8574|2.8574	0.05576|0.05576	0.25:0.4691:0.1066:0.1744|0.25:0.4691:0.1066:0.1744	rs697743;rs2308591;rs3176036;rs3179868;rs3200237;rs3204480;rs12721958;rs17839941;rs28732104|rs697743;rs2308591;rs3176036;rs3179868;rs3200237;rs3204480;rs12721958;rs17839941;rs28732104	.|180;180;180;180	.|A2AEA4;A6H578;A2AEA2;P10321	.|.;.;.;1C07_HUMAN	G|V	179|180;180;180;217	.|ENSP00000365402:L180V;ENSP00000372819:L180V	.|ENSP00000365402:L180V	A|L	-|-	2|1	0|2	HLA-C|HLA-C	31346910|31346910	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	-12.042000|-12.042000	0.00002|0.00002	-4.714000|-4.714000	0.00035|0.00035	-1.872000|-1.872000	0.00552|0.00552	GCT|CTG		0.682	HLA-C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076281.3	NM_002117	
IKBIP	121457	mdanderson.org	37	12	99020139	99020139	+	Intron	SNP	T	T	C			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr12:99020139T>C	ENST00000342502.2	-	2	709				IKBIP_ENST00000393042.3_Intron|IKBIP_ENST00000420861.1_Intron|IKBIP_ENST00000299157.4_Missense_Mutation_p.T235A	NM_201612.2	NP_963906.1	Q70UQ0	IKIP_HUMAN	IKBKB interacting protein						response to X-ray (GO:0010165)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				NS(1)|kidney(1)|large_intestine(1)|lung(1)|prostate(2)	6						ATTGCCTTTGTATCAGAGCCT	0.398																																						.											0													141.0	135.0	137.0					12																	99020139		2203	4300	6503	SO:0001627	intron_variant	121457			AJ539425	CCDS9067.1, CCDS9068.1, CCDS41822.1	12q23.1	2010-02-17			ENSG00000166130	ENSG00000166130			26430	protein-coding gene	gene with protein product	"""I kappa B kinase interacting protein"""	609861				15389287	Standard	NM_153687		Approved	FLJ31051, IKIP	uc001tfx.4	Q70UQ0	OTTHUMG00000170213	ENST00000342502.2:c.297+7934A>G	12.37:g.99020139T>C			Q6ZWH4|Q70UP9|Q86V91|Q96ND2	Missense_Mutation	SNP	ENST00000342502.2	37	CCDS9067.1	.	.	.	.	.	.	.	.	.	.	T	10.48	1.362014	0.24684	.	.	ENSG00000166130	ENST00000299157	T	0.49432	0.78	5.59	0.294	0.15747	.	0.465264	0.24143	N	0.041153	T	0.26810	0.0656	.	.	.	0.80722	D	1	B	0.09022	0.002	B	0.11329	0.006	T	0.04593	-1.0940	9	0.19590	T	0.45	-3.0795	5.3045	0.15795	0.128:0.3427:0.0:0.5293	.	235	Q70UQ0-4	.	A	235	ENSP00000299157:T235A	ENSP00000299157:T235A	T	-	1	0	IKBIP	97544270	0.968000	0.33430	0.788000	0.31933	0.518000	0.34316	0.767000	0.26575	0.086000	0.17137	0.528000	0.53228	ACA		0.398	IKBIP-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000408003.2	NM_153687	
IRGC	56269	mdanderson.org	37	19	44223180	44223180	+	Missense_Mutation	SNP	T	T	C	rs142490244		TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr19:44223180T>C	ENST00000244314.5	+	2	669	c.470T>C	c.(469-471)cTg>cCg	p.L157P		NM_019612.3	NP_062558.1	Q6NXR0	IIGP5_HUMAN	immunity-related GTPase family, cinema	157	IRG-type G.					membrane (GO:0016020)	GTP binding (GO:0005525)|hydrolase activity, acting on acid anhydrides (GO:0016817)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|skin(2)	25		Prostate(69;0.0435)				GCTGAGATCCTGTGCCAGGGC	0.652																																					Colon(189;350 2037 11447 13433 38914)	.											0								T	PRO/LEU	0,4366		0,0,2183	16.0	16.0	16.0		470	-0.9	0.6	19	dbSNP_134	16	6,8528		0,6,4261	yes	missense	IRGC	NM_019612.3	98	0,6,6444	CC,CT,TT		0.0703,0.0,0.0465	probably-damaging	157/464	44223180	6,12894	2183	4267	6450	SO:0001583	missense	56269			BC066939	CCDS12629.1	19q13.32	2008-02-05	2005-10-31	2005-10-31	ENSG00000124449	ENSG00000124449			28835	protein-coding gene	gene with protein product			"""immunity-related GTPase family, cinema 1"""	IRGC1		12477932	Standard	NM_019612		Approved	Iigp5, CINEMA	uc002oxh.3	Q6NXR0	OTTHUMG00000154587	ENST00000244314.5:c.470T>C	19.37:g.44223180T>C	ENSP00000244314:p.Leu157Pro		Q05BR8	Missense_Mutation	SNP	ENST00000244314.5	37	CCDS12629.1	.	.	.	.	.	.	.	.	.	.	T	12.02	1.813862	0.32053	0.0	7.03E-4	ENSG00000124449	ENST00000244314	T	0.21932	1.98	5.71	-0.933	0.10431	.	0.560197	0.15908	N	0.238733	T	0.14527	0.0351	N	0.19112	0.55	0.33327	D	0.568032	D	0.53312	0.959	P	0.49421	0.61	T	0.34378	-0.9831	10	0.30854	T	0.27	.	6.4041	0.21654	0.4974:0.0:0.1315:0.3711	.	157	Q6NXR0	IIGP5_HUMAN	P	157	ENSP00000244314:L157P	ENSP00000244314:L157P	L	+	2	0	IRGC	48915020	1.000000	0.71417	0.615000	0.29064	0.582000	0.36321	2.781000	0.47750	0.065000	0.16485	0.454000	0.30748	CTG		0.652	IRGC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336191.1	NM_019612	
ISM2	145501	mdanderson.org	37	14	77942316	77942316	+	Silent	SNP	G	G	A	rs3742732	byFrequency	TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr14:77942316G>A	ENST00000342219.4	-	7	1394	c.1338C>T	c.(1336-1338)gaC>gaT	p.D446D	ISM2_ENST00000493585.1_3'UTR|ISM2_ENST00000393684.3_Silent_p.D358D|ISM2_ENST00000412904.1_Silent_p.D365D|ISM2_ENST00000429906.1_Silent_p.D365D	NM_199296.2	NP_954993.1	Q6H9L7	ISM2_HUMAN	isthmin 2	446	AMOP. {ECO:0000255|PROSITE- ProRule:PRU00347}.					extracellular region (GO:0005576)				endometrium(3)|large_intestine(4)|lung(11)|prostate(1)|skin(1)|urinary_tract(1)	21						CCTGGTGCTCGTCCTGTAGGC	0.652													G|||	322	0.0642971	0.0363	0.1571	5008	,	,		17437	0.0149		0.0765	False		,,,				2504	0.0746					.											0								G	,	210,4196	127.8+/-164.7	6,198,1999	36.0	38.0	37.0		,1338	-3.0	0.3	14	dbSNP_107	37	775,7825	179.2+/-228.4	32,711,3557	no	utr-3,coding-synonymous	ISM2	NM_182509.3,NM_199296.2	,	38,909,5556	AA,AG,GG		9.0116,4.7662,7.5734	,	,446/572	77942316	985,12021	2203	4300	6503	SO:0001819	synonymous_variant	145501			AK056709	CCDS9864.1, CCDS45143.1	14q24.3	2013-05-15	2013-05-15	2008-12-23	ENSG00000100593	ENSG00000100593			23176	protein-coding gene	gene with protein product	"""thrombospondin and AMOP containing isthmin-like 1"""	612684	"""thrombospondin, type I domain-containing 3"", ""thrombospondin, type I, domain containing 3"", ""isthmin 2 homolog (zebrafish)"""	THSD3		15194193	Standard	NM_199296		Approved	FLJ32147, TAIL1	uc001xtz.3	Q6H9L7	OTTHUMG00000158563	ENST00000342219.4:c.1338C>T	14.37:g.77942316G>A			A8K6D5|O95432|Q495U5|Q68CN3|Q86TQ7|Q86TW3|Q86TW4|Q8N501|Q8NBL0	Silent	SNP	ENST00000342219.4	37	CCDS9864.1																																																																																				0.652	ISM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000351309.1	NM_182509	
KAT2B	8850	mdanderson.org	37	3	20169035	20169035	+	Silent	SNP	A	A	G			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr3:20169035A>G	ENST00000263754.4	+	11	2198	c.1743A>G	c.(1741-1743)caA>caG	p.Q581Q		NM_003884.4	NP_003875.3	Q92831	KAT2B_HUMAN	K(lysine) acetyltransferase 2B	581	Acetyl-CoA binding. {ECO:0000269|PubMed:10393169}.|N-acetyltransferase. {ECO:0000250|UniProtKB:Q92830, ECO:0000255|PROSITE-ProRule:PRU00532}.				cell cycle arrest (GO:0007050)|cellular response to insulin stimulus (GO:0032869)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|gene expression (GO:0010467)|histone H3 acetylation (GO:0043966)|histone H3-K9 acetylation (GO:0043970)|internal peptidyl-lysine acetylation (GO:0018393)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|Notch signaling pathway (GO:0007219)|peptidyl-lysine acetylation (GO:0018394)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein acetylation (GO:0006473)|regulation of protein ADP-ribosylation (GO:0010835)|rhythmic process (GO:0048511)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	A band (GO:0031672)|actomyosin (GO:0042641)|Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|I band (GO:0031674)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)	acetyltransferase activity (GO:0016407)|cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|histone acetyltransferase activity (GO:0004402)|histone deacetylase binding (GO:0042826)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|transcription factor binding (GO:0008134)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	40						CAAATGAGCAAGTCAAGGTAA	0.458																																						.											0													161.0	142.0	149.0					3																	20169035		2203	4300	6503	SO:0001819	synonymous_variant	8850			U57316	CCDS2634.1	3p24	2011-07-01	2008-07-04	2008-07-04	ENSG00000114166	ENSG00000114166		"""Chromatin-modifying enzymes / K-acetyltransferases"""	8638	protein-coding gene	gene with protein product		602303	"""p300/CBP-associated factor"""	PCAF		8684459, 9722949	Standard	NM_003884		Approved	P/CAF, GCN5, GCN5L	uc003cbq.3	Q92831	OTTHUMG00000130481	ENST00000263754.4:c.1743A>G	3.37:g.20169035A>G			Q6NSK1	Silent	SNP	ENST00000263754.4	37	CCDS2634.1																																																																																				0.458	KAT2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252880.1	NM_003884	
KLC3	147700	mdanderson.org	37	19	45849909	45849909	+	Silent	SNP	A	A	G	rs9749618	byFrequency	TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr19:45849909A>G	ENST00000391946.2	+	3	468	c.366A>G	c.(364-366)gaA>gaG	p.E122E	KLC3_ENST00000470402.1_Silent_p.E136E|KLC3_ENST00000585434.1_Silent_p.E122E	NM_177417.2	NP_803136.2	Q6P597	KLC3_HUMAN	kinesin light chain 3	122					axon cargo transport (GO:0008088)	ciliary rootlet (GO:0035253)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|motile cilium (GO:0031514)|neuron projection (GO:0043005)	microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(1)|lung(1)|ovary(1)	8		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		TGCGGGAGGAACTGGAGGAGA	0.701													A|||	983	0.196286	0.0809	0.1873	5008	,	,		11388	0.0873		0.334	False		,,,				2504	0.3292					.											0								A		444,3498		44,356,1571	5.0	7.0	6.0		366	1.9	1.0	19	dbSNP_119	6	2326,5724		403,1520,2102	no	coding-synonymous	KLC3	NM_177417.2		447,1876,3673	GG,GA,AA		28.8944,11.2633,23.0987		122/505	45849909	2770,9222	1971	4025	5996	SO:0001819	synonymous_variant	147700			AK092481	CCDS12660.2	19q13	2013-01-10			ENSG00000104892	ENSG00000104892		"""Tetratricopeptide (TTC) repeat domain containing"""	20717	protein-coding gene	gene with protein product		601334					Standard	XM_005258536		Approved	KLC2L, KNS2B, KLCt	uc002pbf.1	Q6P597	OTTHUMG00000143722	ENST00000391946.2:c.366A>G	19.37:g.45849909A>G			A0AVM3|A2RUT6|Q6GMU2|Q8NAL1|Q8WWJ9	Silent	SNP	ENST00000391946.2	37	CCDS12660.2																																																																																				0.701	KLC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000289776.1	NM_145275	
LILRA2	11027	mdanderson.org	37	19	55086955	55086955	+	Silent	SNP	C	C	T	rs145792151	byFrequency	TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr19:55086955C>T	ENST00000251377.3	+	6	1021	c.888C>T	c.(886-888)taC>taT	p.Y296Y	LILRA2_ENST00000251376.3_Silent_p.Y296Y|LILRA2_ENST00000391737.1_Silent_p.Y284Y|LILRA2_ENST00000391738.3_Silent_p.Y296Y|LILRB1_ENST00000396321.2_Intron|LILRB1_ENST00000418536.2_Intron|LILRB1_ENST00000448689.1_Intron			Q8N149	LIRA2_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 2	296	Ig-like C2-type 3.				defense response (GO:0006952)|immune system process (GO:0002376)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	antigen binding (GO:0003823)|receptor activity (GO:0004872)			breast(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(33)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	50				GBM - Glioblastoma multiforme(193;0.0963)		ACAGATGCTACAGTGCACACA	0.672													c|||	52	0.0103834	0.0363	0.0043	5008	,	,		15740	0.001		0.0	False		,,,				2504	0.0					.											0													50.0	53.0	52.0					19																	55086955		2203	4299	6502	SO:0001819	synonymous_variant	11027			U82275	CCDS12900.1, CCDS46179.1, CCDS74453.1	19q13.4	2013-01-11			ENSG00000239998	ENSG00000239998		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6603	protein-coding gene	gene with protein product		604812				9079806, 9548455	Standard	XM_005258452		Approved	LIR-7, ILT1, CD85h, LIR7		Q8N149	OTTHUMG00000065703	ENST00000251377.3:c.888C>T	19.37:g.55086955C>T			O75020	Silent	SNP	ENST00000251377.3	37	CCDS46179.1																																																																																				0.672	LILRA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140813.2		
MSH6	2956	mdanderson.org	37	2	48010558	48010558	+	Silent	SNP	C	C	A	rs1042820	byFrequency	TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr2:48010558C>A	ENST00000234420.5	+	1	338	c.186C>A	c.(184-186)cgC>cgA	p.R62R	RNU6-688P_ENST00000516063.1_RNA|MSH6_ENST00000538136.1_5'Flank|MSH6_ENST00000540021.1_Silent_p.R62R	NM_000179.2	NP_000170.1	P52701	MSH6_HUMAN	mutS homolog 6	62					ATP catabolic process (GO:0006200)|determination of adult lifespan (GO:0008340)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|isotype switching (GO:0045190)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|response to UV (GO:0009411)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|MutSalpha complex (GO:0032301)|nuclear chromatin (GO:0000790)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|guanine/thymine mispair binding (GO:0032137)|methylated histone binding (GO:0035064)|mismatched DNA binding (GO:0030983)	p.0?(2)		breast(8)|central_nervous_system(29)|cervix(1)|endometrium(32)|haematopoietic_and_lymphoid_tissue(12)|kidney(2)|large_intestine(75)|lung(25)|ovary(3)|prostate(3)|skin(10)|stomach(22)|thyroid(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	229		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			CCTTGGCGCGCTCCGCGTCAC	0.756			"""Mis, N, F, S"""		colorectal	"""colorectal, endometrial, ovarian"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome				C|||	346	0.0690895	0.0204	0.1138	5008	,	,		8411	0.0		0.175	False		,,,				2504	0.0654					.	yes	Rec	yes	Hereditary non-polyposis colorectal cancer	2	2p16	2956	mutS homolog 6 (E. coli)		E	2	Whole gene deletion(2)	haematopoietic_and_lymphoid_tissue(2)						C		157,3307		7,143,1582	3.0	4.0	3.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	186	1.4	0.0	2	dbSNP_86	3	1075,6023		89,897,2563	no	coding-synonymous	MSH6	NM_000179.2		96,1040,4145	AA,AC,CC		15.1451,4.5323,11.6645		62/1361	48010558	1232,9330	1732	3549	5281	SO:0001819	synonymous_variant	2956	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	U54777	CCDS1836.1, CCDS62906.1, CCDS62907.1	2p16	2014-09-17	2013-09-12		ENSG00000116062	ENSG00000116062			7329	protein-coding gene	gene with protein product		600678	"""mutS (E. coli) homolog 6"", ""mutS homolog 6 (E. coli)"""	GTBP		7604266	Standard	NM_000179		Approved		uc002rwd.4	P52701	OTTHUMG00000129129	ENST00000234420.5:c.186C>A	2.37:g.48010558C>A			B4DF41|B4E3I4|F5H2F9|O43706|O43917|Q8TCX4|Q9BTB5	Silent	SNP	ENST00000234420.5	37	CCDS1836.1																																																																																				0.756	MSH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251180.4	NM_000179	
MUC4	4585	mdanderson.org	37	3	195512674	195512674	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr3:195512674A>G	ENST00000463781.3	-	2	6236	c.5777T>C	c.(5776-5778)cTt>cCt	p.L1926P	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.L1926P	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGCTGAGGAAAGGCTGGTGAC	0.577																																						.											0													43.0	37.0	39.0					3																	195512674		689	1587	2276	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.5777T>C	3.37:g.195512674A>G	ENSP00000417498:p.Leu1926Pro		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	4.493	0.091358	0.08632	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.33865	1.39;1.39	.	.	.	.	.	.	.	.	T	0.15869	0.0382	N	0.19112	0.55	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.20505	-1.0273	6	.	.	.	.	.	.	.	.	1926	E7ESK3	.	P	1926	ENSP00000417498:L1926P;ENSP00000420243:L1926P	.	L	-	2	0	MUC4	196997069	.	.	0.000000	0.03702	0.002000	0.02628	.	.	-1.769000	0.01297	-2.094000	0.00368	CTT		0.577	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MYO1E	4643	mdanderson.org	37	15	59466112	59466112	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr15:59466112A>G	ENST00000288235.4	-	21	2566	c.2167T>C	c.(2167-2169)Tca>Cca	p.S723P	MIR2116_ENST00000517221.1_RNA	NM_004998.3	NP_004989.2	Q12965	MYO1E_HUMAN	myosin IE	723	IQ. {ECO:0000255|PROSITE- ProRule:PRU00116}.|Myosin tail. {ECO:0000255}.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|endocytosis (GO:0006897)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|glomerular visceral epithelial cell development (GO:0072015)|in utero embryonic development (GO:0001701)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|post-embryonic hemopoiesis (GO:0035166)|vasculogenesis (GO:0001570)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(6)|lung(10)|pancreas(2)|prostate(1)|urinary_tract(1)	33				all cancers(107;0.207)		AAGAGGTCTGAGGCTACAATT	0.403																																						.											0													135.0	145.0	142.0					15																	59466112		2191	4291	6482	SO:0001583	missense	4643			U14391	CCDS32254.1	15q21-q22	2011-09-27				ENSG00000157483		"""Myosins / Myosin superfamily : Class I"""	7599	protein-coding gene	gene with protein product	"""myosin-IC"""	601479				8884266	Standard	NM_004998		Approved	MYO1C, HuncM-IC, MGC104638	uc002aga.4	Q12965		ENST00000288235.4:c.2167T>C	15.37:g.59466112A>G	ENSP00000288235:p.Ser723Pro		Q14778	Missense_Mutation	SNP	ENST00000288235.4	37	CCDS32254.1	.	.	.	.	.	.	.	.	.	.	A	19.19	3.779860	0.70222	.	.	ENSG00000157483	ENST00000288235	T	0.39229	1.09	5.18	5.18	0.71444	Myosin tail 2 (1);	0.000000	0.85682	D	0.000000	T	0.69548	0.3123	M	0.90814	3.15	0.80722	D	1	D	0.61697	0.99	D	0.69142	0.962	T	0.76022	-0.3111	10	0.54805	T	0.06	.	15.1913	0.73047	1.0:0.0:0.0:0.0	.	723	Q12965	MYO1E_HUMAN	P	723	ENSP00000288235:S723P	ENSP00000288235:S723P	S	-	1	0	MYO1E	57253404	1.000000	0.71417	1.000000	0.80357	0.428000	0.31595	9.126000	0.94411	2.165000	0.68154	0.533000	0.62120	TCA		0.403	MYO1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416024.1	NM_004998	
NBPF10	100132406	mdanderson.org	37	1	145304613	145304613	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr1:145304613T>C	ENST00000369339.3	+	7	986	c.733T>C	c.(733-735)Tct>Cct	p.S245P	NBPF10_ENST00000342960.5_Missense_Mutation_p.S516P|NBPF10_ENST00000369338.1_Missense_Mutation_p.S245P|RP11-458D21.5_ENST00000468030.1_3'UTR			Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	516	NBPF 1. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		TGGCTCATCCTCTCATGTTGA	0.428																																						.											0																																										SO:0001583	missense	100132406			BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000369339.3:c.733T>C	1.37:g.145304613T>C	ENSP00000358345:p.Ser245Pro		Q5RHC0|Q9NWN6	Missense_Mutation	SNP	ENST00000369339.3	37		.	.	.	.	.	.	.	.	.	.	.	7.591	0.670689	0.14776	.	.	ENSG00000163386	ENST00000448873;ENST00000369338;ENST00000369334;ENST00000342960;ENST00000449032	T;T	0.03607	3.87;3.91	0.745	0.745	0.18359	.	.	.	.	.	T	0.03695	0.0105	L	0.50333	1.59	0.09310	N	1	P;D;D;D	0.64830	0.676;0.994;0.962;0.985	B;D;P;P	0.64144	0.307;0.922;0.756;0.783	T	0.39542	-0.9609	9	0.72032	D	0.01	.	3.8102	0.08793	0.0:0.0:0.0:1.0	.	191;481;447;245	Q4VC10;Q3BBV7;Q5U227;A8MQ30	.;.;.;.	P	441;245;245;516;5	ENSP00000358344:S245P;ENSP00000345684:S516P	ENSP00000345684:S516P	S	+	1	0	NBPF10	144015970	0.001000	0.12720	0.003000	0.11579	0.041000	0.13682	1.237000	0.32695	0.571000	0.29365	0.136000	0.15936	TCT		0.428	NBPF10-001	KNOWN	not_best_in_genome_evidence|basic	protein_coding	protein_coding	OTTHUMT00000038550.3	NM_001039703	
POM121L4P	266697	mdanderson.org	37	22	21044498	21044498	+	RNA	SNP	G	G	C	rs10427816		TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr22:21044498G>C	ENST00000412250.3	+	0	180									POM121 transmembrane nucleoporin-like 4 pseudogene											breast(2)	2						ATCAGAGAAGGGTCCCCGAGG	0.632																																						.											0																																												266697					22q11.2	2012-03-13	2012-03-13		ENSG00000217261	ENSG00000217261			19326	pseudogene	pseudogene			"""POM121 membrane glycoprotein-like 4 pseudogene (rat)"", ""POM121 membrane glycoprotein-like 4 pseudogene"""				Standard	NR_024592		Approved		uc002zsw.2		OTTHUMG00000150756		22.37:g.21044498G>C				RNA	SNP	ENST00000412250.3	37		.	.	.	.	.	.	.	.	.	.	G	10.91	1.484344	0.26598	.	.	ENSG00000217261	ENST00000412250	.	.	.	0.507	0.507	0.16967	.	.	.	.	.	T	0.42653	0.1212	.	.	.	0.80722	P	0.0	P	0.45531	0.86	B	0.44044	0.439	T	0.54866	-0.8229	5	0.62326	D	0.03	.	.	.	.	.	60	F5H5H7	.	S	60	.	ENSP00000443399:R60S	R	+	3	2	POM121L4P	19374498	0.006000	0.16342	0.003000	0.11579	0.097000	0.18754	0.268000	0.18571	0.519000	0.28406	0.163000	0.16589	AGG		0.632	POM121L4P-002	KNOWN	basic|exp_conf	processed_transcript	pseudogene	OTTHUMT00000468456.1		
POM121L4P	266697	mdanderson.org	37	22	21044504	21044504	+	RNA	SNP	C	C	G	rs10427707	byFrequency	TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr22:21044504C>G	ENST00000412250.3	+	0	186									POM121 transmembrane nucleoporin-like 4 pseudogene											breast(2)	2						GAAGGGTCCCCGAGGTCACCG	0.632													N|||	377	0.0752796	0.0976	0.062	5008	,	,		18483	0.0873		0.0686	False		,,,				2504	0.0491					.											0																																												266697					22q11.2	2012-03-13	2012-03-13		ENSG00000217261	ENSG00000217261			19326	pseudogene	pseudogene			"""POM121 membrane glycoprotein-like 4 pseudogene (rat)"", ""POM121 membrane glycoprotein-like 4 pseudogene"""				Standard	NR_024592		Approved		uc002zsw.2		OTTHUMG00000150756		22.37:g.21044504C>G				RNA	SNP	ENST00000412250.3	37																																																																																					0.632	POM121L4P-002	KNOWN	basic|exp_conf	processed_transcript	pseudogene	OTTHUMT00000468456.1		
POTEG	404785	mdanderson.org	37	14	19553653	19553653	+	Silent	SNP	C	C	T	rs201360940		TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr14:19553653C>T	ENST00000409832.3	+	1	289	c.237C>T	c.(235-237)aaC>aaT	p.N79N		NM_001005356.2	NP_001005356.1	Q6S5H5	POTEG_HUMAN	POTE ankyrin domain family, member G	79										cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(31)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	47						GCAAGAGCAACGTGGGCACTT	0.602																																						.											0													100.0	129.0	119.0					14																	19553653		1939	3935	5874	SO:0001819	synonymous_variant	404785				CCDS73610.1	14q11.2	2013-01-10	2008-11-26	2008-11-26	ENSG00000222036	ENSG00000222036		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33896	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 4"""	608916	"""ANKRD26-like family C, member 2"""	A26C2			Standard	NR_027480		Approved	POTE14, POTE-14, POTE14alpha, CT104.4	uc001vuz.1	Q6S5H5	OTTHUMG00000170340	ENST00000409832.3:c.237C>T	14.37:g.19553653C>T			A1L153|A6NMI9|Q6S5H6|Q6S8J2	Silent	SNP	ENST00000409832.3	37	CCDS32018.1																																																																																				0.602	POTEG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408579.1	NM_001005356	
PPP5C	5536	mdanderson.org	37	19	46878881	46878881	+	Silent	SNP	T	T	C	rs576127473	byFrequency	TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr19:46878881T>C	ENST00000012443.4	+	3	487	c.384T>C	c.(382-384)caT>caC	p.H128H	PPP5C_ENST00000391919.1_Silent_p.H22H	NM_006247.3	NP_006238.1	P53041	PPP5_HUMAN	protein phosphatase 5, catalytic subunit	128					cell death (GO:0008219)|DNA repair (GO:0006281)|mitotic nuclear division (GO:0007067)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein dephosphorylation (GO:0006470)|protein heterooligomerization (GO:0051291)|response to morphine (GO:0043278)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)|metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|RNA binding (GO:0003723)|signal transducer activity (GO:0004871)			endometrium(4)|kidney(1)|large_intestine(5)|liver(2)|lung(4)|ovary(1)|pancreas(1)	18		Ovarian(192;0.0731)|all_neural(266;0.196)		OV - Ovarian serous cystadenocarcinoma(262;0.000196)|all cancers(93;0.00192)|GBM - Glioblastoma multiforme(486;0.0499)|Epithelial(262;0.0504)		TGAAGCCCCATGACAAGGATG	0.632													C|||	2	0.000399361	0.0008	0.0	5008	,	,		17659	0.0		0.0	False		,,,				2504	0.001					.											0													74.0	57.0	63.0					19																	46878881		2203	4300	6503	SO:0001819	synonymous_variant	5536				CCDS12684.1	19q13.3	2013-01-10			ENSG00000011485	ENSG00000011485	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	9322	protein-coding gene	gene with protein product		600658		PPP5		8666404	Standard	NM_006247		Approved	PP5	uc002pem.3	P53041	OTTHUMG00000134287	ENST00000012443.4:c.384T>C	19.37:g.46878881T>C			Q16722|Q53XV2	Silent	SNP	ENST00000012443.4	37	CCDS12684.1																																																																																				0.632	PPP5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258969.2	NM_006247	
PRB4	5545	mdanderson.org	37	12	11461769	11461769	+	Missense_Mutation	SNP	G	G	T	rs144658455	byFrequency	TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr12:11461769G>T	ENST00000535904.1	-	3	181	c.148C>A	c.(148-150)Ccc>Acc	p.P50T	PRB4_ENST00000279575.1_Missense_Mutation_p.P50T|PRB4_ENST00000445719.2_Missense_Mutation_p.P50T			P10163	PRB4_HUMAN	proline-rich protein BstNI subfamily 4	71	9.5 X 21 AA tandem repeats of K-P-[EQ]- [GR]-[PR]-[PR]-P-Q-G-G-N-Q-[PS]-[QH]- [RG]-[PT]-P-P-[PH]-P-G.					extracellular region (GO:0005576)		p.P50T(2)		breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|skin(4)|upper_aerodigestive_tract(3)	30						GGAGGTGGGGGACGTTGGGGC	0.587										HNSCC(22;0.051)																												.											2	Substitution - Missense(2)	upper_aerodigestive_tract(1)|skin(1)											192.0	207.0	202.0					12																	11461769		2193	4290	6483	SO:0001583	missense	5545				CCDS8641.1, CCDS58208.1	12p13.2	2012-10-02			ENSG00000230657	ENSG00000230657			9340	protein-coding gene	gene with protein product		180990					Standard	NM_002723		Approved		uc001qzt.4	P10163	OTTHUMG00000169116	ENST00000535904.1:c.148C>A	12.37:g.11461769G>T	ENSP00000442834:p.Pro50Thr		A1L439|O00600|P02813|P10161|P10162|P81489	Missense_Mutation	SNP	ENST00000535904.1	37	CCDS8641.1	.	.	.	.	.	.	.	.	.	.	.	3.828	-0.036358	0.07497	.	.	ENSG00000230657	ENST00000279575;ENST00000535904;ENST00000445719	T;T;T	0.08282	3.11;3.11;3.11	0.956	-0.0291	0.13919	.	.	.	.	.	T	0.08714	0.0216	L	0.41961	1.31	0.09310	N	1	D	0.61080	0.989	P	0.47744	0.556	T	0.25328	-1.0135	9	0.44086	T	0.13	.	3.4148	0.07372	0.301:0.0:0.699:0.0	.	50	E9PAL0	.	T	50	ENSP00000279575:P50T;ENSP00000442834:P50T;ENSP00000412740:P50T	ENSP00000279575:P50T	P	-	1	0	PRB4	11353036	0.036000	0.19791	0.000000	0.03702	0.015000	0.08874	2.074000	0.41529	-0.022000	0.13986	0.196000	0.17591	CCC		0.587	PRB4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402308.1	NM_002723	
RFPL3	10738	mdanderson.org	37	22	32756407	32756407	+	Missense_Mutation	SNP	A	A	G	rs5749408	byFrequency	TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr22:32756407A>G	ENST00000249007.4	+	2	747	c.542A>G	c.(541-543)tAc>tGc	p.Y181C	RFPL3_ENST00000397468.1_Missense_Mutation_p.Y152C|RFPL3S_ENST00000461833.1_5'Flank|RFPL3_ENST00000382088.3_Missense_Mutation_p.Y152C|RFPL3S_ENST00000400234.1_3'UTR|RFPL3S_ENST00000382084.4_3'UTR	NM_001098535.1	NP_001092005.1	O75679	RFPL3_HUMAN	ret finger protein-like 3	181	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.		Y -> C (in dbSNP:rs5749408).				zinc ion binding (GO:0008270)	p.Y152C(1)|p.Y181C(1)		cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|skin(2)|stomach(1)	15						GGCCGCCACTACTGGGAGGTG	0.562													a|||	851	0.169928	0.1059	0.1124	5008	,	,		18743	0.4583		0.0467	False		,,,				2504	0.1268					.											2	Substitution - Missense(2)	stomach(2)						A	CYS/TYR,CYS/TYR	499,3907	228.1+/-243.1	40,419,1744	85.0	86.0	85.0		542,455	0.7	0.2	22	dbSNP_114	85	479,8117	140.3+/-196.8	11,457,3830	no	missense,missense	RFPL3	NM_001098535.1,NM_006604.2	194,194	51,876,5574	GG,GA,AA		5.5724,11.3255,7.5219	benign,benign	181/318,152/289	32756407	978,12024	2203	4298	6501	SO:0001583	missense	10738			AJ010232	CCDS13904.1, CCDS43011.1	22q12	2006-04-25			ENSG00000128276	ENSG00000128276			9980	protein-coding gene	gene with protein product		605970				10508838	Standard	NM_006604		Approved		uc010gwn.3	O75679	OTTHUMG00000030290	ENST00000249007.4:c.542A>G	22.37:g.32756407A>G	ENSP00000249007:p.Tyr181Cys		A2A279|Q6IC03|Q6IC04|Q6NSX3|Q8N5R4	Missense_Mutation	SNP	ENST00000249007.4	37	CCDS43011.1	386	0.17673992673992675	52	0.10569105691056911	46	0.1270718232044199	254	0.44405594405594406	34	0.044854881266490766	A	8.527	0.870091	0.17322	0.113255	0.055724	ENSG00000128276	ENST00000397468;ENST00000249007;ENST00000382088	T;T;T	0.74947	-0.89;-0.89;-0.89	0.704	0.704	0.18121	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	.	.	.	.	T	0.00012	0.0000	M	0.81497	2.545	0.09310	P	0.999999999404185	B	0.33413	0.411	B	0.28709	0.093	T	0.22556	-1.0213	8	0.54805	T	0.06	.	5.601	0.17353	0.9999:0.0:1.0E-4:0.0	rs5749408	181	O75679	RFPL3_HUMAN	C	152;181;152	ENSP00000380609:Y152C;ENSP00000249007:Y181C;ENSP00000371520:Y152C	ENSP00000249007:Y181C	Y	+	2	0	RFPL3	31086407	0.989000	0.36119	0.246000	0.24233	0.050000	0.14768	1.786000	0.38694	0.528000	0.28580	0.172000	0.16884	TAC		0.562	RFPL3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000075172.3	NM_006604	
RPS6KA4	8986	mdanderson.org	37	11	64127744	64127744	+	Silent	SNP	A	A	G	rs521950	byFrequency	TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr11:64127744A>G	ENST00000334205.4	+	3	302	c.237A>G	c.(235-237)caA>caG	p.Q79Q	RPS6KA4_ENST00000294261.4_Silent_p.Q79Q|RPS6KA4_ENST00000528057.1_Silent_p.Q79Q	NM_003942.2	NP_003933.1	O75676	KS6A4_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 4	79	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|histone H3-S10 phosphorylation (GO:0043987)|histone H3-S28 phosphorylation (GO:0043988)|histone phosphorylation (GO:0016572)|inflammatory response (GO:0006954)|interleukin-1-mediated signaling pathway (GO:0070498)|intracellular signal transduction (GO:0035556)|negative regulation of cytokine production (GO:0001818)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone phosphorylation (GO:0033129)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|mitogen-activated protein kinase p38 binding (GO:0048273)|protein serine/threonine kinase activity (GO:0004674)|ribosomal protein S6 kinase activity (GO:0004711)			breast(1)|endometrium(3)|lung(7)|ovary(1)|prostate(1)	13						CCAAGACGCAAGAGCACACGC	0.687													G|||	1350	0.269569	0.0499	0.4078	5008	,	,		15083	0.2083		0.4324	False		,,,				2504	0.364					.											0								G	,	434,3564		35,364,1600	12.0	10.0	10.0		237,237	3.1	1.0	11	dbSNP_83	10	2989,4947		559,1871,1538	no	coding-synonymous,coding-synonymous	RPS6KA4	NM_001006944.1,NM_003942.2	,	594,2235,3138	GG,GA,AA		37.6638,10.8554,28.6828	,	79/767,79/773	64127744	3423,8511	1999	3968	5967	SO:0001819	synonymous_variant	8986			AJ010119	CCDS8073.1, CCDS73313.1	11q11-q13	2011-04-05	2002-08-29		ENSG00000162302	ENSG00000162302			10433	protein-coding gene	gene with protein product		603606	"""ribosomal protein S6 kinase, 90kD, polypeptide 4"""			9792677, 9687510	Standard	XM_005274379		Approved	RSK-B, MSK2	uc001oae.3	O75676	OTTHUMG00000046094	ENST00000334205.4:c.237A>G	11.37:g.64127744A>G			A8K7Z8|O75585|Q53ES8	Silent	SNP	ENST00000334205.4	37	CCDS8073.1																																																																																				0.687	RPS6KA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106246.2	NM_003942	
UGT2B11	10720	mdanderson.org	37	4	70066424	70066424	+	Missense_Mutation	SNP	T	T	C	rs201914215	byFrequency	TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr4:70066424T>C	ENST00000446444.1	-	6	1332	c.1324A>G	c.(1324-1326)Att>Gtt	p.I442V	RP11-704M14.1_ENST00000505646.1_RNA|RP11-704M14.1_ENST00000504301.1_RNA	NM_001073.1	NP_001064.1	O75310	UDB11_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B11	442					estrogen metabolic process (GO:0008210)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	42						AATTTCATAATATTCTCTTTA	0.353																																						.											0													49.0	53.0	52.0					4																	70066424		2202	4297	6499	SO:0001583	missense	10720			AF016492	CCDS3527.1	4q13.3	2008-02-05	2005-07-20		ENSG00000213759	ENSG00000213759		"""UDP glucuronosyltransferases"""	12545	protein-coding gene	gene with protein product		603064	"""UDP glycosyltransferase 2 family, polypeptide B11"""			9675083	Standard	NM_001073		Approved		uc003heh.3	O75310	OTTHUMG00000129395	ENST00000446444.1:c.1324A>G	4.37:g.70066424T>C	ENSP00000387683:p.Ile442Val		Q3KNV9	Missense_Mutation	SNP	ENST00000446444.1	37	CCDS3527.1	.	.	.	.	.	.	.	.	.	.	-	0.006	-2.115061	0.00349	.	.	ENSG00000213759	ENST00000446444	T	0.60424	0.19	1.27	0.361	0.16107	.	0.406771	0.21417	N	0.074883	T	0.23289	0.0563	N	0.03238	-0.38	0.09310	N	1	B	0.02656	0.0	B	0.14578	0.011	T	0.27905	-1.0060	10	0.05351	T	0.99	.	5.5851	0.17269	0.0:0.638:0.0:0.362	.	442	O75310	UDB11_HUMAN	V	442	ENSP00000387683:I442V	ENSP00000387683:I442V	I	-	1	0	UGT2B11	70101013	0.000000	0.05858	0.365000	0.25901	0.209000	0.24338	-0.402000	0.07223	-0.273000	0.09246	-1.160000	0.01791	ATT		0.353	UGT2B11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251551.2	NM_001073	
ZNF763	284390	mdanderson.org	37	19	12087921	12087921	+	Silent	SNP	G	G	C	rs376310072	byFrequency	TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr19:12087921G>C	ENST00000358987.3	+	2	199	c.72G>C	c.(70-72)tcG>tcC	p.S24S	ZNF763_ENST00000591944.1_Silent_p.S93S|ZNF763_ENST00000343949.5_Silent_p.S27S|ZNF763_ENST00000545530.1_Intron|ZNF763_ENST00000590798.1_Silent_p.S44S|ZNF763_ENST00000592625.1_Silent_p.S24S|ZNF763_ENST00000538752.1_Silent_p.S44S			Q0D2J5	ZN763_HUMAN	zinc finger protein 763	24	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(9)	15						TGGATATTTCGCAGAGGAAAC	0.493													N|||	4	0.000798722	0.0023	0.0	5008	,	,		18630	0.0		0.001	False		,,,				2504	0.0					.											0													150.0	152.0	151.0					19																	12087921		2203	4300	6503	SO:0001819	synonymous_variant	284390			AK092240	CCDS45982.1	19p13.2	2014-02-12	2006-08-14		ENSG00000197054	ENSG00000197054		"""Zinc fingers, C2H2-type"", ""-"""	27614	protein-coding gene	gene with protein product							Standard	NM_001012753		Approved	ZNF440L		Q0D2J5	OTTHUMG00000156430	ENST00000358987.3:c.72G>C	19.37:g.12087921G>C			B3KRU3|B4DRE7	Silent	SNP	ENST00000358987.3	37																																																																																					0.493	ZNF763-002	KNOWN	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000344158.1	NM_001012753	
ZNF235	9310	mdanderson.org	37	19	44791618	44791618	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr19:44791618C>T	ENST00000291182.4	-	5	2072	c.1970G>A	c.(1969-1971)tGt>tAt	p.C657Y	ZNF235_ENST00000589248.1_Intron|ZNF235_ENST00000589799.1_Intron	NM_004234.4	NP_004225.3	Q14590	ZN235_HUMAN	zinc finger protein 235	657					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	29		Prostate(69;0.0352)|all_neural(266;0.116)				ACATTCCTCACATTTAAATGG	0.458																																						.											0													107.0	100.0	103.0					19																	44791618		2203	4300	6503	SO:0001583	missense	9310			X78929	CCDS33048.1	19q13.2	2013-01-08	2002-11-04	2002-11-08	ENSG00000159917	ENSG00000159917		"""Zinc fingers, C2H2-type"", ""-"""	12866	protein-coding gene	gene with protein product		604749	"""zinc finger protein homologous to Zfp93 in mouse"""	ZNF270, ZFP93		7865130, 9570955	Standard	NM_004234		Approved	HZF6, ANF270	uc002oza.4	Q14590		ENST00000291182.4:c.1970G>A	19.37:g.44791618C>T	ENSP00000291182:p.Cys657Tyr		B4DTQ7|O14898|O14899|Q17RR8	Missense_Mutation	SNP	ENST00000291182.4	37	CCDS33048.1	.	.	.	.	.	.	.	.	.	.	C	20.5	3.995989	0.74703	.	.	ENSG00000159917	ENST00000391957;ENST00000291182;ENST00000359844	D	0.85088	-1.94	4.96	4.96	0.65561	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.44688	D	0.000432	D	0.94788	0.8317	H	0.95745	3.715	0.58432	D	0.999994	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.96269	0.9197	10	0.87932	D	0	-20.7433	17.3494	0.87318	0.0:1.0:0.0:0.0	.	653;657	Q14590-2;Q14590	.;ZN235_HUMAN	Y	657;657;549	ENSP00000291182:C657Y	ENSP00000291182:C657Y	C	-	2	0	ZNF235	49483458	1.000000	0.71417	0.974000	0.42286	0.927000	0.56198	7.446000	0.80609	2.469000	0.83416	0.305000	0.20034	TGT		0.458	ZNF235-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460732.1		
RASAL2	9462	bcgsc.ca	37	1	178426034	178426034	+	Splice_Site	SNP	G	G	T			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr1:178426034G>T	ENST00000462775.1	+	11	2092	c.1967G>T	c.(1966-1968)aGt>aTt	p.S656I	RASAL2_ENST00000367649.3_Splice_Site_p.S797I|RASAL2_ENST00000448150.3_Splice_Site_p.S786I	NM_004841.3	NP_004832.1	Q9UJF2	NGAP_HUMAN	RAS protein activator like 2	656					negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Ras GTPase activator activity (GO:0005099)			biliary_tract(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(2)|lung(25)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	54						CCCACTGACAGGTATGAAAGA	0.388																																						.											0													61.0	64.0	63.0					1																	178426034		2203	4300	6503	SO:0001630	splice_region_variant	9462			AF047711	CCDS1321.1, CCDS1322.1, CCDS1321.2	1q25	2013-01-10			ENSG00000075391	ENSG00000075391		"""Pleckstrin homology (PH) domain containing"""	9874	protein-coding gene	gene with protein product	"""Ras GTPase activating protein-like"", ""Ras protein activator like 1"""	606136				9877179	Standard	NM_004841		Approved	nGAP	uc001glq.3	Q9UJF2	OTTHUMG00000035022	ENST00000462775.1:c.1967+1G>T	1.37:g.178426034G>T			F8W755|O95174|Q2TB22|Q5TFU9	Missense_Mutation	SNP	ENST00000462775.1	37	CCDS1322.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.11|18.11	3.551036|3.551036	0.65311|0.65311	.|.	.|.	ENSG00000075391|ENSG00000075391	ENST00000433130|ENST00000448150;ENST00000367649;ENST00000462775	.|T;T;T	.|0.10477	.|2.87;2.87;2.87	5.26|5.26	5.26|5.26	0.73747|0.73747	.|.	.|0.110656	.|0.40144	.|N	.|0.001179	T|T	0.12944|0.12944	0.0314|0.0314	N|N	0.25485|0.25485	0.75|0.75	0.80722|0.80722	D|D	1|1	.|P;P;P	.|0.50528	.|0.57;0.57;0.936	.|P;B;B	.|0.45577	.|0.486;0.292;0.282	T|T	0.02009|0.02009	-1.1230|-1.1230	5|10	.|0.56958	.|D	.|0.05	.|.	18.8667|18.8667	0.92294|0.92294	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|786;656;797	.|B1AKC7;Q9UJF2;F8W755	.|.;NGAP_HUMAN;.	H|I	206|786;797;656	.|ENSP00000407768:S786I;ENSP00000356621:S797I;ENSP00000420558:S656I	.|ENSP00000356621:S797I	Q|S	+|+	3|2	2|0	RASAL2|RASAL2	176692657|176692657	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	9.024000|9.024000	0.93689|0.93689	2.438000|2.438000	0.82558|0.82558	0.655000|0.655000	0.94253|0.94253	CAG|AGT		0.388	RASAL2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000084758.3	NM_170692	Missense_Mutation
RBBP5	5929	bcgsc.ca	37	1	205070729	205070729	+	Splice_Site	SNP	T	T	C			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr1:205070729T>C	ENST00000264515.6	-	6	772	c.631A>G	c.(631-633)Agt>Ggt	p.S211G	RBBP5_ENST00000367164.1_Splice_Site_p.S211G	NM_001193273.1|NM_005057.3	NP_001180202.1|NP_005048.2	Q15291	RBBP5_HUMAN	retinoblastoma binding protein 5	211					cellular response to DNA damage stimulus (GO:0006974)|histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleolus (GO:0005730)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	methylated histone binding (GO:0035064)|transcription regulatory region DNA binding (GO:0044212)			cervix(1)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	27	Breast(84;0.0505)		BRCA - Breast invasive adenocarcinoma(75;0.0923)			CTCACTCACCTCCCCTTCCGG	0.383																																						.											0													194.0	192.0	192.0					1																	205070729		2203	4300	6503	SO:0001630	splice_region_variant	5929			BC053856	CCDS30983.1, CCDS53463.1	1q32	2013-01-10	2001-11-28		ENSG00000117222	ENSG00000117222		"""WD repeat domain containing"""	9888	protein-coding gene	gene with protein product	"""SWD1, Set1c WD40 repeat protein, homolog (S. cerevisiae)"""	600697	"""retinoblastoma-binding protein 5"""			7558034	Standard	NM_005057		Approved	RBQ3, SWD1	uc001hbu.2	Q15291	OTTHUMG00000037104	ENST00000264515.6:c.632+1A>G	1.37:g.205070729T>C			A8K272|Q7Z6D8|Q8NDZ7	Missense_Mutation	SNP	ENST00000264515.6	37	CCDS30983.1	.	.	.	.	.	.	.	.	.	.	T	16.53	3.149489	0.57151	.	.	ENSG00000117222	ENST00000264515;ENST00000367164	T;T	0.19105	2.17;2.17	5.83	5.83	0.93111	WD40/YVTN repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.24005	0.0581	L	0.50333	1.59	0.80722	D	1	B;B;B;B	0.15141	0.005;0.007;0.007;0.012	B;B;B;B	0.16722	0.016;0.013;0.009;0.013	T	0.01661	-1.1301	10	0.49607	T	0.09	.	15.902	0.79384	0.0:0.0:0.0:1.0	.	84;246;211;211	B4DLF8;B4DMM7;Q15291-2;Q15291	.;.;.;RBBP5_HUMAN	G	211	ENSP00000264515:S211G;ENSP00000356132:S211G	ENSP00000264515:S211G	S	-	1	0	RBBP5	203337352	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.920000	0.87521	2.238000	0.73509	0.477000	0.44152	AGT		0.383	RBBP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090077.1	NM_005057	Missense_Mutation
SPATA7	55812	bcgsc.ca	37	14	88892586	88892586	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr14:88892586A>G	ENST00000393545.4	+	6	672	c.383A>G	c.(382-384)gAa>gGa	p.E128G	SPATA7_ENST00000045347.7_Missense_Mutation_p.E128G|SPATA7_ENST00000356583.5_Missense_Mutation_p.E96G|SPATA7_ENST00000556553.1_Missense_Mutation_p.E96G	NM_018418.4	NP_060888.2	Q9P0W8	SPAT7_HUMAN	spermatogenesis associated 7	128					response to stimulus (GO:0050896)|visual perception (GO:0007601)					cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)	18						CCCTCAGGCGAACCGCAAATT	0.373																																						.											0													43.0	41.0	42.0					14																	88892586		2203	4300	6503	SO:0001583	missense	55812			AF144487	CCDS9883.1, CCDS32132.1	14q31.3	2011-02-17				ENSG00000042317			20423	protein-coding gene	gene with protein product		609868	"""Leber congenital amaurosis 3"""	LCA3		9799089, 19268277	Standard	NM_018418		Approved	HSD3	uc001xwq.3	Q9P0W8		ENST00000393545.4:c.383A>G	14.37:g.88892586A>G	ENSP00000377176:p.Glu128Gly		Q5BKY5|Q8WX30|Q96HF3|Q9H0X0|Q9P0W7	Missense_Mutation	SNP	ENST00000393545.4	37	CCDS9883.1	.	.	.	.	.	.	.	.	.	.	A	15.18	2.757492	0.49468	.	.	ENSG00000042317	ENST00000556553;ENST00000393545;ENST00000356583;ENST00000555401;ENST00000553885;ENST00000045347	T;T;T;T;T;T	0.20738	2.05;2.05;2.05;2.05;2.05;2.05	5.38	5.38	0.77491	.	0.062767	0.64402	D	0.000006	T	0.45418	0.1341	M	0.70595	2.14	0.37018	D	0.896074	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.974	T	0.53913	-0.8371	10	0.56958	D	0.05	-24.6762	13.6381	0.62233	1.0:0.0:0.0:0.0	.	96;128	Q9P0W8-2;Q9P0W8	.;SPAT7_HUMAN	G	96;128;96;71;114;128	ENSP00000451128:E96G;ENSP00000377176:E128G;ENSP00000348991:E96G;ENSP00000452435:E71G;ENSP00000450606:E114G;ENSP00000045347:E128G	ENSP00000045347:E128G	E	+	2	0	SPATA7	87962339	0.995000	0.38212	0.959000	0.39883	0.072000	0.16883	4.827000	0.62723	2.159000	0.67721	0.528000	0.53228	GAA		0.373	SPATA7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410172.1		
NPRL3	8131	bcgsc.ca	37	16	169144	169144	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr16:169144A>G	ENST00000399953.3	-	3	701	c.299T>C	c.(298-300)cTa>cCa	p.L100P	NPRL3_ENST00000405960.3_5'UTR|NPRL3_ENST00000399951.3_Intron	NM_001077350.2|NM_001243247.1|NM_001243248.1|NM_001243249.1	NP_001070818.1|NP_001230176.1|NP_001230177.1|NP_001230178.1	Q12980	NPRL3_HUMAN	nitrogen permease regulator-like 3 (S. cerevisiae)	100					aorta morphogenesis (GO:0035909)|cardiac muscle tissue development (GO:0048738)|palate development (GO:0060021)|ventricular septum development (GO:0003281)		GTPase activator activity (GO:0005096)			endometrium(1)|large_intestine(3)|ovary(2)	6						AGCATGCTGTAGCAGTGTTGG	0.532																																						.											0													78.0	83.0	81.0					16																	169144		2013	4162	6175	SO:0001583	missense	8131				CCDS73794.1, CCDS73795.1	16p13.3	2011-01-06	2010-03-30	2010-03-30	ENSG00000103148	ENSG00000103148			14124	protein-coding gene	gene with protein product	"""conserved gene telomeric to alpha globin cluster"""	600928	"""chromosome 16 open reading frame 35"""	C16orf35		8575760	Standard	NM_001243247		Approved	CGTHBA, RMD11, NPR3, MARE, HS-40	uc002cfr.3	Q12980	OTTHUMG00000047792	ENST00000399953.3:c.299T>C	16.37:g.169144A>G	ENSP00000382834:p.Leu100Pro		D3DU40|Q1W6H0|Q4TT56|Q92469	Missense_Mutation	SNP	ENST00000399953.3	37		.	.	.	.	.	.	.	.	.	.	A	13.35	2.211931	0.39102	.	.	ENSG00000103148	ENST00000399953;ENST00000262313;ENST00000419636	.	.	.	5.18	4.06	0.47325	Galactose-binding domain-like (1);	0.137738	0.50627	D	0.000116	T	0.75968	0.3922	.	.	.	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;0.997;0.986	D;D;D;P	0.74348	0.972;0.983;0.952;0.9	T	0.75519	-0.3289	8	0.45353	T	0.12	-14.1353	11.5109	0.50492	0.8495:0.1505:0.0:0.0	.	22;100;100;100	B7Z220;Q4TT55;B7Z6Q0;Q12980	.;.;.;NPRL3_HUMAN	P	100;100;113	.	ENSP00000262313:L100P	L	-	2	0	NPRL3	109144	1.000000	0.71417	0.999000	0.59377	0.964000	0.63967	8.948000	0.93006	0.877000	0.35895	0.533000	0.62120	CTA		0.532	NPRL3-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001039476	
OR1A2	26189	bcgsc.ca	37	17	3101590	3101590	+	Missense_Mutation	SNP	C	C	T	rs2469791	byFrequency	TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr17:3101590C>T	ENST00000381951.1	+	1	778	c.778C>T	c.(778-780)Cgc>Tgc	p.R260C		NM_012352.1	NP_036484.1	Q9Y585	OR1A2_HUMAN	olfactory receptor, family 1, subfamily A, member 2	260			R -> C (in dbSNP:rs2469791). {ECO:0000269|PubMed:15489334}.		positive regulation of cytokinesis (GO:0032467)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(4)|large_intestine(2)|lung(5)|skin(4)|stomach(2)	18						CATGTATTTCCGCCCTCTGAC	0.438													C|||	740	0.147764	0.2194	0.1571	5008	,	,		18666	0.001		0.2406	False		,,,				2504	0.1002					.											0								C	CYS/ARG	932,3474	356.4+/-313.5	100,732,1371	115.0	110.0	112.0		778	-0.6	0.0	17	dbSNP_100	112	2170,6430	370.0+/-335.7	279,1612,2409	yes	missense	OR1A2	NM_012352.1	180	379,2344,3780	TT,TC,CC		25.2326,21.153,23.8505	probably-damaging	260/310	3101590	3102,9904	2203	4300	6503	SO:0001583	missense	26189			AF155225	CCDS11021.1	17p13.3	2012-08-09			ENSG00000172150	ENSG00000172150		"""GPCR / Class A : Olfactory receptors"""	8180	protein-coding gene	gene with protein product						10673334	Standard	NM_012352		Approved	OR17-6	uc002fvd.1	Q9Y585	OTTHUMG00000090638	ENST00000381951.1:c.778C>T	17.37:g.3101590C>T	ENSP00000371377:p.Arg260Cys		Q3KPH3|Q6IFM0|Q6NTD8|Q96R86	Missense_Mutation	SNP	ENST00000381951.1	37	CCDS11021.1	338	0.15476190476190477	104	0.21138211382113822	61	0.1685082872928177	0	0.0	173	0.22823218997361477	C	1.569	-0.534700	0.04082	0.21153	0.252326	ENSG00000172150	ENST00000381951	T	0.35789	1.29	4.0	-0.599	0.11645	GPCR, rhodopsin-like superfamily (1);	0.135982	0.34268	N	0.004118	T	0.00012	0.0000	L	0.52573	1.65	0.80722	P	0.0	P	0.36535	0.557	B	0.34093	0.175	T	0.28713	-1.0035	9	0.23302	T	0.38	.	4.6096	0.12395	0.157:0.5721:0.0:0.2709	rs2469791;rs52812308;rs56722735;rs2469791	260	Q9Y585	OR1A2_HUMAN	C	260	ENSP00000371377:R260C	ENSP00000371377:R260C	R	+	1	0	OR1A2	3048340	0.000000	0.05858	0.012000	0.15200	0.177000	0.22998	-1.119000	0.03276	-0.147000	0.11254	0.543000	0.68304	CGC		0.438	OR1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207293.1	NM_012352	
C2orf43	60526	bcgsc.ca	37	2	20886772	20886772	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr2:20886772T>C	ENST00000237822.3	-	7	948	c.869A>G	c.(868-870)gAc>gGc	p.D290G	C2orf43_ENST00000381090.3_Missense_Mutation_p.D290G|C2orf43_ENST00000541941.1_Missense_Mutation_p.D160G|C2orf43_ENST00000403006.2_Missense_Mutation_p.D160G|C2orf43_ENST00000440866.2_3'UTR|C2orf43_ENST00000435420.2_Missense_Mutation_p.D242G	NM_001282721.1|NM_021925.2	NP_001269650.1|NP_068744.1	Q9H6V9	CB043_HUMAN	chromosome 2 open reading frame 43	290										endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|stomach(1)	6	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GAGTCGAATGTCTCCTTCTGG	0.383																																						.											0													133.0	122.0	125.0					2																	20886772		2203	4300	6503	SO:0001583	missense	60526			AK025473	CCDS1702.1, CCDS62864.1, CCDS74488.1, CCDS74489.1	2p24.1	2014-02-07			ENSG00000118961	ENSG00000118961			26145	protein-coding gene	gene with protein product		613570				17135363, 24357060	Standard	NM_001282723		Approved	FLJ21820	uc002rec.3	Q9H6V9	OTTHUMG00000122097	ENST00000237822.3:c.869A>G	2.37:g.20886772T>C	ENSP00000237822:p.Asp290Gly		B7ZA47|B7ZAJ5|D6W530|E7ESN0|Q53T37|Q53T58	Missense_Mutation	SNP	ENST00000237822.3	37	CCDS1702.1	.	.	.	.	.	.	.	.	.	.	T	29.2	4.981877	0.93044	.	.	ENSG00000118961	ENST00000403006;ENST00000381090;ENST00000237822;ENST00000435420;ENST00000541941	T;T;T	0.44881	0.91;1.54;0.91	6.08	6.08	0.98989	.	0.382752	0.28766	N	0.014219	T	0.57403	0.2051	L	0.58669	1.825	0.80722	D	1	D;D;P;P	0.89917	0.992;1.0;0.67;0.619	P;D;B;B	0.64506	0.85;0.926;0.232;0.178	T	0.51325	-0.8720	10	0.21540	T	0.41	-22.398	15.2149	0.73258	0.0:0.0:0.0:1.0	.	248;242;290;290	B4DS38;B7ZAJ5;Q9H6V9;B5MDU6	.;.;CB043_HUMAN;.	G	160;290;290;242;160	ENSP00000384267:D160G;ENSP00000388635:D242G;ENSP00000440570:D160G	ENSP00000237822:D290G	D	-	2	0	C2orf43	20750253	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	5.604000	0.67626	2.333000	0.79357	0.533000	0.62120	GAC		0.383	C2orf43-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242861.1	NM_021925	
FRG1B	284802	bcgsc.ca	37	20	29628225	29628225	+	Splice_Site	SNP	A	A	G			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr20:29628225A>G	ENST00000278882.3	+	6	608		c.e6-1		FRG1B_ENST00000358464.4_Splice_Site|FRG1B_ENST00000439954.2_Splice_Site			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B											endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						TGTTTCACTTAGGGGAAAATG	0.358																																						.											0																																										SO:0001630	splice_region_variant	284802					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.229-1A>G	20.37:g.29628225A>G			C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	.	8.410	0.843922	0.16963	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	.	.	.	1.89	1.89	0.25635	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.7774	0.29046	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FRG1B	28241886	1.000000	0.71417	0.998000	0.56505	0.247000	0.25773	7.946000	0.87746	1.131000	0.42111	0.147000	0.16070	.		0.358	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	Intron
SOWAHB	345079	bcgsc.ca	37	4	77816689	77816691	+	In_Frame_Del	DEL	TTG	TTG	-			TCGA-KL-8328-01A-11D-2310-10	TCGA-KL-8328-11A-01D-2310-10	TTG	TTG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2ccd028d-e7e0-4f77-a512-f658a31819a4	f468e484-9121-46a5-90cf-abe4cf4e7335	g.chr4:77816689_77816691delTTG	ENST00000334306.2	-	1	2311_2313	c.2312_2314delCAA	c.(2311-2316)acaaag>aag	p.T771del		NM_001029870.1	NP_001025041.1	A6NEL2	SWAHB_HUMAN	sosondowah ankyrin repeat domain family member B	771																	AGTTTCCACTTGTTGTGCTGACT	0.473																																						.											0																																										SO:0001651	inframe_deletion	345079				CCDS34017.1	4q21.1	2013-01-10	2012-01-12	2012-01-12	ENSG00000186212	ENSG00000186212		"""Ankyrin repeat domain containing"""	32958	protein-coding gene	gene with protein product			"""ankyrin repeat domain 56"""	ANKRD56		22234889	Standard	NM_001029870		Approved		uc003hki.3	A6NEL2	OTTHUMG00000160876	ENST00000334306.2:c.2312_2314delCAA	4.37:g.77816689_77816691delTTG	ENSP00000334879:p.Thr771del		B2RP29	In_Frame_Del	DEL	ENST00000334306.2	37	CCDS34017.1																																																																																				0.473	SOWAHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362762.1	NM_001029870	
