#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
KRTAP5-4	387267	hgsc.bcm.edu	37	11	1643255	1643255	+	Silent	SNP	G	G	A			TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr11:1643255G>A	ENST00000399682.1	-	1	113	c.69C>T	c.(67-69)ggC>ggT	p.G23G		NM_001012709.1	NP_001012727	Q6L8H1	KRA54_HUMAN	keratin associated protein 5-4	0						keratin filament (GO:0045095)		p.G23G(1)		NS(1)|endometrium(9)|kidney(2)|lung(2)|pancreas(1)|prostate(3)|skin(2)	20		all_epithelial(84;0.00819)|Breast(177;0.00832)|Ovarian(85;0.0256)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		cagagccacagcccccacagc	0.687																																						.											1	Substitution - coding silent(1)	kidney(1)											4.0	8.0	7.0					11																	1643255		646	1526	2172	SO:0001819	synonymous_variant	387267			AB126073		11p15.5	2012-04-19			ENSG00000241598	ENSG00000241598		"""Keratin associated proteins"""	23599	protein-coding gene	gene with protein product						15144888	Standard	NM_001012709		Approved	KRTAP5.4	uc009ycy.1	Q6L8H1	OTTHUMG00000057553	ENST00000399682.1:c.69C>T	11.37:g.1643255G>A				Silent	SNP	ENST00000399682.1	37																																																																																					0.687	KRTAP5-4-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000127918.1	NM_001012709	
VWCE	220001	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	11	61026257	61026257	+	Missense_Mutation	SNP	C	C	T	rs550040653		TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr11:61026257C>T	ENST00000335613.5	-	20	3144	c.2758G>A	c.(2758-2760)Gtg>Atg	p.V920M	VWCE_ENST00000535710.1_Missense_Mutation_p.V385M	NM_152718.2	NP_689931.2	Q96DN2	VWCE_HUMAN	von Willebrand factor C and EGF domains	920						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			biliary_tract(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(17)|ovary(3)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37						GGAGAAAGCACGCGAGGCCCG	0.667																																						.											0													58.0	65.0	63.0					11																	61026257		2203	4299	6502	SO:0001583	missense	220001			AK056571	CCDS8002.1	11q12.2	2006-08-04			ENSG00000167992	ENSG00000167992			26487	protein-coding gene	gene with protein product		611115				12869306	Standard	NM_152718		Approved	URG11, FLJ32009, VWC1	uc001nra.3	Q96DN2	OTTHUMG00000168208	ENST00000335613.5:c.2758G>A	11.37:g.61026257C>T	ENSP00000334186:p.Val920Met		A5PKV0|Q7Z7L6|Q86WK8	Missense_Mutation	SNP	ENST00000335613.5	37	CCDS8002.1	.	.	.	.	.	.	.	.	.	.	T	9.953	1.220611	0.22457	.	.	ENSG00000167992	ENST00000335613;ENST00000535710	T;T	0.69175	-0.38;3.49	4.81	2.16	0.27623	.	0.708805	0.11573	N	0.550511	T	0.42630	0.1211	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.26780	-1.0093	10	0.40728	T	0.16	.	5.9278	0.19122	0.0:0.3978:0.0:0.6022	.	920	Q96DN2	VWCE_HUMAN	M	920;385	ENSP00000334186:V920M;ENSP00000442570:V385M	ENSP00000334186:V920M	V	-	1	0	VWCE	60782833	0.000000	0.05858	0.001000	0.08648	0.000000	0.00434	0.048000	0.14078	0.290000	0.22444	-0.361000	0.07541	GTG		0.667	VWCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398811.1	NM_152718	
RBM19	9904	hgsc.bcm.edu;ucsc.edu	37	12	114261040	114261040	+	Missense_Mutation	SNP	G	G	T			TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr12:114261040G>T	ENST00000545145.2	-	24	2950	c.2872C>A	c.(2872-2874)Ctt>Att	p.L958I	RBM19_ENST00000392561.3_Missense_Mutation_p.L958I|RBM19_ENST00000261741.5_Missense_Mutation_p.L958I	NM_001146699.1	NP_001140171.1	Q9Y4C8	RBM19_HUMAN	RNA binding motif protein 19	958					multicellular organismal development (GO:0007275)|positive regulation of embryonic development (GO:0040019)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(4)	55	Medulloblastoma(191;0.163)|all_neural(191;0.178)					CACAGCTGAAGGGTCTGCTCC	0.657																																						.											0													46.0	40.0	42.0					12																	114261040		2203	4300	6503	SO:0001583	missense	9904			AL117547	CCDS9172.1	12q24.21	2013-02-12				ENSG00000122965		"""RNA binding motif (RRM) containing"""	29098	protein-coding gene	gene with protein product						9734811, 11230166	Standard	NM_016196		Approved	DKFZp586F1023, KIAA0682	uc009zwi.2	Q9Y4C8	OTTHUMG00000169646	ENST00000545145.2:c.2872C>A	12.37:g.114261040G>T	ENSP00000442053:p.Leu958Ile		A8K5X9|Q9BPY6|Q9UFN5	Missense_Mutation	SNP	ENST00000545145.2	37	CCDS9172.1	.	.	.	.	.	.	.	.	.	.	G	18.65	3.670262	0.67814	.	.	ENSG00000122965	ENST00000545145;ENST00000392561;ENST00000261741	T;T;T	0.05786	3.39;3.39;3.39	4.39	4.39	0.52855	.	0.000000	0.43579	D	0.000543	T	0.05318	0.0141	N	0.22421	0.69	0.22479	N	0.999061	B	0.15719	0.014	B	0.15870	0.014	T	0.28396	-1.0045	10	0.52906	T	0.07	-2.5835	11.2472	0.49004	0.0:0.0:0.818:0.182	.	958	Q9Y4C8	RBM19_HUMAN	I	958	ENSP00000442053:L958I;ENSP00000376344:L958I;ENSP00000261741:L958I	ENSP00000261741:L958I	L	-	1	0	RBM19	112745423	1.000000	0.71417	0.974000	0.42286	0.971000	0.66376	3.487000	0.53222	2.281000	0.76405	0.462000	0.41574	CTT		0.657	RBM19-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405251.1	NM_016196	
FOXO1	2308	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	13	41134356	41134356	+	Nonsense_Mutation	SNP	A	A	T			TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr13:41134356A>T	ENST00000379561.5	-	2	1656	c.1272T>A	c.(1270-1272)taT>taA	p.Y424*	FOXO1_ENST00000473775.1_5'Flank	NM_002015.3	NP_002006.2	Q12778	FOXO1_HUMAN	forkhead box O1	424	Required for interaction with RUNX2. {ECO:0000250}.|Sufficient for interaction with NLK. {ECO:0000250}.				apoptotic process (GO:0006915)|autophagy (GO:0006914)|blood vessel development (GO:0001568)|cellular glucose homeostasis (GO:0001678)|cellular response to cold (GO:0070417)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hyperoxia (GO:0071455)|cellular response to insulin stimulus (GO:0032869)|cellular response to nitric oxide (GO:0071732)|cellular response to oxidative stress (GO:0034599)|cellular response to starvation (GO:0009267)|endocrine pancreas development (GO:0031018)|epidermal growth factor receptor signaling pathway (GO:0007173)|fat cell differentiation (GO:0045444)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of apoptotic process (GO:0043065)|positive regulation of autophagy (GO:0010508)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein acetylation (GO:0006473)|regulation of cell proliferation (GO:0042127)|regulation of energy homeostasis (GO:2000505)|regulation of gluconeogenesis by regulation of transcription from RNA polymerase II promoter (GO:0035947)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|protein phosphatase 2A binding (GO:0051721)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin protein ligase binding (GO:0031625)		PAX7/FOXO1(197)|PAX3/FOXO1(749)	central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(7)|kidney(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	20		Lung NSC(96;1.18e-05)|Breast(139;0.00394)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(188;0.194)		all cancers(112;7.32e-09)|Epithelial(112;2.87e-06)|OV - Ovarian serous cystadenocarcinoma(117;6.98e-05)|GBM - Glioblastoma multiforme(144;0.00394)|BRCA - Breast invasive adenocarcinoma(63;0.0815)		GGCCATATGTATATTTTTGGT	0.488																																						.											0													127.0	115.0	119.0					13																	41134356		2203	4300	6503	SO:0001587	stop_gained	2308				CCDS9371.1	13q14.1	2011-08-01	2007-05-02	2007-05-02	ENSG00000150907	ENSG00000150907		"""Forkhead boxes"""	3819	protein-coding gene	gene with protein product		136533	"""forkhead homolog in rhabdomyosarcoma"""	FKHR, FOXO1A		8275086, 15057823	Standard	NM_002015		Approved	FKH1	uc001uxl.4	Q12778	OTTHUMG00000016775	ENST00000379561.5:c.1272T>A	13.37:g.41134356A>T	ENSP00000368880:p.Tyr424*		O43523|Q5VYC7|Q6NSK6	Nonsense_Mutation	SNP	ENST00000379561.5	37	CCDS9371.1	.	.	.	.	.	.	.	.	.	.	A	36	5.891446	0.97074	.	.	ENSG00000150907	ENST00000379561	.	.	.	5.78	-3.28	0.05033	.	0.164042	0.56097	D	0.000027	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.8585	14.9205	0.70835	0.6511:0.0:0.3489:0.0	.	.	.	.	X	424	.	ENSP00000368880:Y424X	Y	-	3	2	FOXO1	40032356	0.044000	0.20184	0.032000	0.17829	0.584000	0.36387	-0.617000	0.05584	-0.725000	0.04901	-0.959000	0.02639	TAT		0.488	FOXO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044634.3	NM_002015	
DDX24	57062	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	14	94524209	94524209	+	Missense_Mutation	SNP	C	C	A			TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr14:94524209C>A	ENST00000330836.5	-	6	2079	c.1948G>T	c.(1948-1950)Ggt>Tgt	p.G650C	DDX24_ENST00000555054.1_Missense_Mutation_p.G607C|DDX24_ENST00000544005.1_Missense_Mutation_p.G400C	NM_020414.3	NP_065147.1	Q9GZR7	DDX24_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 24	650	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				RNA metabolic process (GO:0016070)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)			cervix(3)|endometrium(4)|kidney(4)|large_intestine(5)|lung(3)|ovary(2)|skin(1)|urinary_tract(1)	23		all_cancers(154;0.12)		Epithelial(152;0.114)|all cancers(159;0.19)|COAD - Colon adenocarcinoma(157;0.207)		ATATCCAGACCCCGAGCTGCC	0.423																																						.											0													56.0	56.0	56.0					14																	94524209		2203	4300	6503	SO:0001583	missense	57062			AF214731	CCDS9918.1	14q32	2013-07-16	2013-07-16			ENSG00000089737		"""DEAD-boxes"""	13266	protein-coding gene	gene with protein product		606181	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 24"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 24"""			10936056, 18289627	Standard	NM_020414		Approved		uc001ycj.3	Q9GZR7		ENST00000330836.5:c.1948G>T	14.37:g.94524209C>A	ENSP00000328690:p.Gly650Cys		E7EMJ4|Q4V9L5	Missense_Mutation	SNP	ENST00000330836.5	37	CCDS9918.1	.	.	.	.	.	.	.	.	.	.	C	28.5	4.926437	0.92319	.	.	ENSG00000089737	ENST00000330836;ENST00000544005;ENST00000440370;ENST00000543787;ENST00000555054;ENST00000542247	T;T;T	0.63417	-0.04;-0.04;-0.04	5.5	5.5	0.81552	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.87861	0.6284	H	0.98199	4.17	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91925	0.5550	10	0.87932	D	0	8.0052	19.7499	0.96263	0.0:1.0:0.0:0.0	.	650	Q9GZR7	DDX24_HUMAN	C	650;400;595;276;607;607	ENSP00000328690:G650C;ENSP00000440623:G400C;ENSP00000452145:G607C	ENSP00000328690:G650C	G	-	1	0	DDX24	93593962	1.000000	0.71417	0.998000	0.56505	0.983000	0.72400	7.818000	0.86416	2.729000	0.93468	0.563000	0.77884	GGT		0.423	DDX24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412861.1	NM_020414	
KIAA0430	9665	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	16	15695994	15695994	+	Missense_Mutation	SNP	C	C	A			TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr16:15695994C>A	ENST00000396368.3	-	23	4686	c.4480G>T	c.(4480-4482)Gtg>Ttg	p.V1494L	KIAA0430_ENST00000344181.3_Missense_Mutation_p.V1177L|KIAA0430_ENST00000602337.1_Missense_Mutation_p.V1491L|KIAA0430_ENST00000551742.1_Missense_Mutation_p.V1494L|KIAA0430_ENST00000540441.2_Missense_Mutation_p.V1329L|KIAA0430_ENST00000548025.1_Missense_Mutation_p.V1491L|KIAA0430_ENST00000547936.1_5'UTR	NM_001184998.1|NM_001184999.1|NM_014647.3	NP_001171927.1|NP_001171928.1|NP_055462.2	Q9Y4F3	MARF1_HUMAN	KIAA0430	1494	HTH OST-type 8. {ECO:0000255|PROSITE- ProRule:PRU00975}.				double-strand break repair (GO:0006302)|female meiotic division (GO:0007143)|negative regulation of phosphatase activity (GO:0010923)|oogenesis (GO:0048477)|regulation of gene expression (GO:0010468)	membrane (GO:0016020)|peroxisome (GO:0005777)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(4)|endometrium(8)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(5)|skin(1)	40						AAAGACCGCACATTCTTTGCA	0.388																																						.											0													205.0	206.0	206.0					16																	15695994		1888	4121	6009	SO:0001583	missense	9665			AB007890	CCDS10562.2, CCDS53990.1, CCDS55991.1	16p13.11	2013-01-11			ENSG00000166783	ENSG00000166783		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29562	protein-coding gene	gene with protein product	"""limkain b1"", ""protein phosphatase 1, regulatory subunit 34"", ""meiosis arrest female 1"""	614593				9455477, 10493829, 15932519, 22442484, 23090997	Standard	NM_014647		Approved	LKAP, PPP1R34, Marf1	uc010uzw.2	Q9Y4F3	OTTHUMG00000129884	ENST00000396368.3:c.4480G>T	16.37:g.15695994C>A	ENSP00000379654:p.Val1494Leu		A8MSK2|B2RNX2|B4DYY9|B7ZMG1|B7ZMG2|F8VV09|Q6P1R6|Q8WYR2|Q9Y4J9	Missense_Mutation	SNP	ENST00000396368.3	37	CCDS10562.2	.	.	.	.	.	.	.	.	.	.	C	16.56	3.157561	0.57368	.	.	ENSG00000166783	ENST00000396368;ENST00000540441;ENST00000321370;ENST00000344181;ENST00000548025;ENST00000551742;ENST00000551298	T;T;T;T;T	0.29655	1.56;1.56;1.56;1.56;1.56	5.69	5.69	0.88448	.	0.063140	0.64402	D	0.000007	T	0.45256	0.1333	L	0.36672	1.1	0.28960	N	0.88988	D;P;P;D	0.71674	0.997;0.88;0.88;0.998	D;B;B;D	0.80764	0.99;0.23;0.23;0.994	T	0.36138	-0.9760	10	0.11485	T	0.65	.	19.816	0.96568	0.0:1.0:0.0:0.0	.	1493;1491;1490;1493	Q9Y4F3-5;F8VV09;Q9Y4F3-4;Q9Y4F3	.;.;.;LKAP_HUMAN	L	1494;1329;1434;1177;1491;1494;1355	ENSP00000379654:V1494L;ENSP00000439819:V1329L;ENSP00000341939:V1177L;ENSP00000449376:V1491L;ENSP00000450309:V1494L	ENSP00000315718:V1434L	V	-	1	0	KIAA0430	15603495	1.000000	0.71417	0.985000	0.45067	0.188000	0.23474	4.643000	0.61390	2.687000	0.91594	0.561000	0.74099	GTG		0.388	KIAA0430-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252131.2	NM_014647	
PKD1L2	114780	hgsc.bcm.edu;bcgsc.ca	37	16	81213360	81213360	+	RNA	SNP	C	C	T			TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr16:81213360C>T	ENST00000527937.1	-	0	208				PKD1L2_ENST00000525539.1_RNA|PKD1L2_ENST00000531391.1_RNA|PKD1L2_ENST00000533478.1_RNA|PKD1L2_ENST00000337114.4_RNA			Q7Z442	PK1L2_HUMAN	polycystic kidney disease 1-like 2						ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						CCAAAATCCTCTGAGTCTGCA	0.597																																						.											0													61.0	63.0	63.0					16																	81213360		1958	4156	6114			114780			AY164483	CCDS61998.1, CCDS61999.1	16q23.2	2014-09-11			ENSG00000166473	ENSG00000166473			21715	protein-coding gene	gene with protein product		607894				12782129	Standard	NM_052892		Approved	KIAA1879	uc002fgf.1	Q7Z442	OTTHUMG00000166126		16.37:g.81213360C>T			Q6UEE1|Q6ZN46|Q6ZSP2|Q8N1H9|Q96CL2|Q96Q08	Missense_Mutation	SNP	ENST00000527937.1	37		.	.	.	.	.	.	.	.	.	.	C	7.712	0.695352	0.15106	.	.	ENSG00000166473	ENST00000531391;ENST00000337114;ENST00000527937	T;T;T	0.69306	2.5;-0.39;2.15	5.02	-3.31	0.04988	Egg jelly receptor, REJ-like (1);PKD/REJ-like protein (1);	1.373740	0.04784	N	0.430403	T	0.52256	0.1723	.	.	.	0.09310	N	1	B;B;B	0.28933	0.103;0.228;0.082	B;B;B	0.28011	0.085;0.083;0.019	T	0.42413	-0.9453	9	0.54805	T	0.06	7.5086	5.859	0.18736	0.0:0.3056:0.3519:0.3425	.	32;717;717	Q7Z442-6;Q7Z442-3;Q7Z442	.;.;PK1L2_HUMAN	K	32;717;32	ENSP00000436309:R32K;ENSP00000337397:R717K;ENSP00000432818:R32K	ENSP00000337397:R717K	R	-	2	0	PKD1L2	79770861	0.000000	0.05858	0.000000	0.03702	0.044000	0.14063	-2.213000	0.01224	-1.028000	0.03321	0.462000	0.41574	AGA		0.597	PKD1L2-007	KNOWN	basic|exp_conf	protein_coding	polymorphic_pseudogene	OTTHUMT00000387978.1		
KCNJ12	3768	hgsc.bcm.edu	37	17	21318691	21318692	+	Frame_Shift_Del	DEL	GT	GT	-	rs556074330	byFrequency	TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	GT	GT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr17:21318691_21318692delGT	ENST00000583088.1	+	3	932_933	c.37_38delGT	c.(37-39)gtgfs	p.V13fs	KCNJ12_ENST00000331718.5_Frame_Shift_Del_p.V13fs	NM_021012.4	NP_066292.2	Q14500	KCJ12_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 12	13					muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of heart contraction (GO:0008016)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|intrinsic component of membrane (GO:0031224)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)			NS(1)|breast(4)|endometrium(4)|kidney(1)|large_intestine(5)|lung(39)|ovary(5)|skin(8)|stomach(3)	70				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)|Yohimbine(DB01392)	CTACAGCATCGTGTCATCGGAG	0.708										Prostate(3;0.18)				24	0.00479233	0.0174	0.0014	5008	,	,		32853	0.0		0.0	False		,,,				2504	0.0					.											0																																										SO:0001589	frameshift_variant	100134444			L36069	CCDS11219.1	17p11.1	2011-07-05	2004-01-13		ENSG00000184185	ENSG00000184185		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6258	protein-coding gene	gene with protein product		602323	"""potassium inwardly-rectifying channel, subfamily J, inhibitor 1"""	KCNJN1		7859381, 12417321, 16382105	Standard	NM_021012		Approved	Kir2.2, Kir2.2v, IRK2, hIRK1	uc021tss.1	Q14500	OTTHUMG00000132039	ENST00000583088.1:c.37_38delGT	17.37:g.21318693_21318694delGT	ENSP00000463778:p.Val13fs		O43401|Q15756|Q8NG63	Frame_Shift_Del	DEL	ENST00000583088.1	37	CCDS11219.1																																																																																				0.708	KCNJ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255060.2	NM_021012	
GLP2R	9340	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	17	9763353	9763353	+	Missense_Mutation	SNP	C	C	T	rs145296340		TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr17:9763353C>T	ENST00000262441.5	+	7	1373	c.860C>T	c.(859-861)aCg>aTg	p.T287M	GLP2R_ENST00000574745.1_Missense_Mutation_p.T107M	NM_004246.1	NP_004237.1	O95838	GLP2R_HUMAN	glucagon-like peptide 2 receptor	287					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|positive regulation of cell proliferation (GO:0008284)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|glucagon receptor activity (GO:0004967)			endometrium(4)|large_intestine(7)|lung(22)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	44					Glucagon recombinant(DB00040)|Teduglutide(DB08900)	TACCTCCACACGCTGCTGGAG	0.577													C|||	1	0.000199681	0.0	0.0	5008	,	,		14640	0.0		0.001	False		,,,				2504	0.0					.											0								C	MET/THR	1,4405	2.1+/-5.4	0,1,2202	81.0	70.0	74.0		860	3.2	0.0	17	dbSNP_134	74	17,8583	11.9+/-42.8	0,17,4283	yes	missense	GLP2R	NM_004246.1	81	0,18,6485	TT,TC,CC		0.1977,0.0227,0.1384	possibly-damaging	287/554	9763353	18,12988	2203	4300	6503	SO:0001583	missense	9340			AF105367	CCDS11150.1	17p13.3	2012-08-10			ENSG00000065325	ENSG00000065325		"""GPCR / Class B : Glucagon receptors"""	4325	protein-coding gene	gene with protein product		603659				9990065	Standard	NM_004246		Approved		uc002gmd.1	O95838	OTTHUMG00000130269	ENST00000262441.5:c.860C>T	17.37:g.9763353C>T	ENSP00000262441:p.Thr287Met		Q4VAT3	Missense_Mutation	SNP	ENST00000262441.5	37	CCDS11150.1	1|1	4.578754578754579E-4|4.578754578754579E-4	0|0	0.0|0.0	0|0	0.0|0.0	0|0	0.0|0.0	1|1	0.0013192612137203166|0.0013192612137203166	C|C	2.108|2.108	-0.404495|-0.404495	0.04832|0.04832	2.27E-4|2.27E-4	0.001977|0.001977	ENSG00000065325|ENSG00000065325	ENST00000458005|ENST00000396206;ENST00000304773;ENST00000262441	.|T	.|0.36699	.|1.24	5.34|5.34	3.25|3.25	0.37280|0.37280	.|GPCR, family 2-like (1);	.|1.422570	.|0.05107	.|N	.|0.488161	T|T	0.50274|0.50274	0.1606|0.1606	L|L	0.56124|0.56124	1.755|1.755	0.09310|0.09310	N|N	1|1	.|P	.|0.43412	.|0.806	.|P	.|0.48770	.|0.589	T|T	0.52328|0.52328	-0.8590|-0.8590	5|10	.|0.87932	.|D	.|0	.|.	14.9932|14.9932	0.71406|0.71406	0.0:0.5598:0.4402:0.0|0.0:0.5598:0.4402:0.0	.|.	.|287	.|O95838	.|GLP2R_HUMAN	C|M	140|287;262;287	.|ENSP00000262441:T287M	.|ENSP00000262441:T287M	R|T	+|+	1|2	0|0	GLP2R|GLP2R	9704078|9704078	0.026000|0.026000	0.19158|0.19158	0.000000|0.000000	0.03702|0.03702	0.012000|0.012000	0.07955|0.07955	0.682000|0.682000	0.25335|0.25335	0.657000|0.657000	0.30906|0.30906	0.655000|0.655000	0.94253|0.94253	CGC|ACG		0.577	GLP2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252601.4		
DSCAM	1826	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	21	42080523	42080523	+	Missense_Mutation	SNP	C	C	T			TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr21:42080523C>T	ENST00000400454.1	-	2	695	c.218G>A	c.(217-219)cGc>cAc	p.R73H		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	73	Ig-like C2-type 1.				cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.R73L(1)		NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				GTGGACGTGGCGGATCCCGGG	0.547																																					Melanoma(134;970 1778 1785 21664 32388)	.											1	Substitution - Missense(1)	lung(1)											92.0	95.0	94.0					21																	42080523		1965	4156	6121	SO:0001583	missense	1826			AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.218G>A	21.37:g.42080523C>T	ENSP00000383303:p.Arg73His		O60468	Missense_Mutation	SNP	ENST00000400454.1	37	CCDS42929.1	.	.	.	.	.	.	.	.	.	.	C	29.3	4.998174	0.93227	.	.	ENSG00000171587	ENST00000400454	T	0.38887	1.11	5.1	5.1	0.69264	Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.62672	0.2447	M	0.64404	1.975	0.51767	D	0.999936	D	0.76494	0.999	D	0.80764	0.994	T	0.64918	-0.6294	10	0.66056	D	0.02	.	17.0669	0.86561	0.0:1.0:0.0:0.0	.	73	O60469	DSCAM_HUMAN	H	73	ENSP00000383303:R73H	ENSP00000383303:R73H	R	-	2	0	DSCAM	41002393	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.354000	0.79424	2.547000	0.85894	0.585000	0.79938	CGC		0.547	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195029.1	NM_001389	
NUDT9	53343	broad.mit.edu;hgsc.bcm.edu;mdanderson.org	37	4	88379168	88379168	+	Silent	SNP	T	T	C			TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr4:88379168T>C	ENST00000302174.4	+	8	1372	c.1048T>C	c.(1048-1050)Ttg>Ctg	p.L350L	RP11-710E1.2_ENST00000609450.1_lincRNA|NUDT9_ENST00000473942.1_Silent_p.L300L	NM_024047.4	NP_076952.1	Q9BW91	NUDT9_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 9	350					ADP catabolic process (GO:0046032)|IDP catabolic process (GO:0046709)|nucleobase-containing small molecule catabolic process (GO:0034656)|nucleobase-containing small molecule metabolic process (GO:0055086)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|mitochondrial matrix (GO:0005759)	adenosine-diphosphatase activity (GO:0043262)|ADP-ribose diphosphatase activity (GO:0047631)|ADP-sugar diphosphatase activity (GO:0019144)			endometrium(1)|large_intestine(4)|lung(6)	11		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000937)		CTGCCATGCGTTGTAGCTGAT	0.458																																						.											0													83.0	72.0	75.0					4																	88379168		2203	4300	6503	SO:0001819	synonymous_variant	53343			AY026252	CCDS3620.1, CCDS3621.1	4q22.1	2008-08-29			ENSG00000170502	ENSG00000170502		"""Nudix motif containing"""	8056	protein-coding gene	gene with protein product		606022				11385575, 12427752	Standard	NM_024047		Approved	MGC3037	uc003hqq.3	Q9BW91	OTTHUMG00000130591	ENST00000302174.4:c.1048T>C	4.37:g.88379168T>C			Q8NBN1|Q8NCB9|Q8NG25	Silent	SNP	ENST00000302174.4	37	CCDS3620.1																																																																																				0.458	NUDT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253035.2		
TCERG1	10915	hgsc.bcm.edu	37	5	145838641	145838641	+	Silent	SNP	C	C	T			TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr5:145838641C>T	ENST00000296702.5	+	4	671	c.633C>T	c.(631-633)gcC>gcT	p.A211A	TCERG1_ENST00000394421.2_Silent_p.A211A	NM_006706.3	NP_006697.2	O14776	TCRG1_HUMAN	transcription elongation regulator 1	211	Ala/Gln-rich.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription coactivator activity (GO:0003713)	p.A211A(1)		breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(18)|lung(9)|ovary(2)|prostate(3)|skin(1)	46		Lung NSC(249;0.00188)|all_lung(500;0.00307)|all_neural(839;0.0424)|Breast(839;0.0743)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			aggctcaggcccaggcccagg	0.731																																						.											1	Substitution - coding silent(1)	central_nervous_system(1)											11.0	15.0	13.0					5																	145838641		2184	4278	6462	SO:0001819	synonymous_variant	10915			AF017789	CCDS4282.1, CCDS43379.1	5q31	2010-01-25	2002-01-24	2002-01-25	ENSG00000113649	ENSG00000113649			15630	protein-coding gene	gene with protein product	"""transcription factor CA150"", ""co-activator of 150 kDa"", ""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"", ""TATA box-binding protein-associated factor 2S"""	605409	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"""	TAF2S		9315662, 11003711	Standard	XM_005268365		Approved	CA150, Urn1	uc003lob.3	O14776	OTTHUMG00000129683	ENST00000296702.5:c.633C>T	5.37:g.145838641C>T			Q2NKN2|Q59EA1	Silent	SNP	ENST00000296702.5	37	CCDS4282.1																																																																																				0.731	TCERG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251886.1	NM_001040006	
CELF2	10659	hgsc.bcm.edu	37	10	11207550	11207550	+	Missense_Mutation	SNP	C	C	T			TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr10:11207550C>T	ENST00000379261.4	+	2	247	c.155C>T	c.(154-156)tCg>tTg	p.S52L	CELF2_ENST00000399850.3_Missense_Mutation_p.S28L|CELF2_ENST00000315874.4_Missense_Mutation_p.S28L|CELF2_ENST00000537122.1_5'UTR|CELF2_ENST00000608830.1_Missense_Mutation_p.S28L|CELF2_ENST00000354440.2_Missense_Mutation_p.S28L|CELF2_ENST00000354897.3_Missense_Mutation_p.S28L|CELF2_ENST00000427450.1_Missense_Mutation_p.S28L|CELF2_ENST00000450189.1_Missense_Mutation_p.S59L|CELF2_ENST00000417956.2_Missense_Mutation_p.S28L|CELF2_ENST00000542579.1_Missense_Mutation_p.S59L|CELF2_ENST00000609692.1_Missense_Mutation_p.S28L|CELF2_ENST00000416382.2_Missense_Mutation_p.S52L	NM_001025077.2	NP_001020248.1	O95319	CELF2_HUMAN	CUGBP, Elav-like family member 2	52	Necessary for RNA-binding, TNNT2 exon 5 and NMDA R1 exon 21 inclusion.|RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|regulation of heart contraction (GO:0008016)|RNA processing (GO:0006396)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(2)|lung(5)|prostate(1)|skin(1)	16						CGGTCATGGTCGGAAAAGGAG	0.527																																						.											0													89.0	94.0	93.0					10																	11207550		1945	4147	6092	SO:0001583	missense	10659			U69546	CCDS41488.1, CCDS44354.1, CCDS44355.1, CCDS44356.1	10p13	2013-02-12	2010-02-19	2010-02-19	ENSG00000048740	ENSG00000048740		"""RNA binding motif (RRM) containing"""	2550	protein-coding gene	gene with protein product		602538	"""CUG triplet repeat, RNA-binding protein 2"", ""CUG triplet repeat, RNA binding protein 2"""	CUGBP2		7869393, 9887331	Standard	NM_006561		Approved	Etr-3, NAPOR-2, BRUNOL3	uc001ikl.4	O95319	OTTHUMG00000017668	ENST00000379261.4:c.155C>T	10.37:g.11207550C>T	ENSP00000368563:p.Ser52Leu		B7ZAN9|Q7KYU4|Q8N499|Q92950|Q96NW9|Q96RQ5|Q96RQ6|Q9UL67	Missense_Mutation	SNP	ENST00000379261.4	37	CCDS44354.1	.	.	.	.	.	.	.	.	.	.	C	18.53	3.644377	0.67244	.	.	ENSG00000048740	ENST00000379261;ENST00000416382;ENST00000450189;ENST00000542579;ENST00000399850;ENST00000417956;ENST00000315874;ENST00000354440;ENST00000354897;ENST00000427450	T;T;T;T;T;T;T;T;T	0.18016	2.24;2.24;2.24;2.24;2.24;2.24;2.24;2.24;2.24	5.51	5.51	0.81932	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.29093	0.0723	L	0.46157	1.445	0.80722	D	1	D;D;P;P;D;D;D	0.56035	0.957;0.957;0.802;0.92;0.974;0.969;0.957	P;P;B;B;P;P;P	0.51582	0.556;0.674;0.138;0.381;0.558;0.544;0.674	T	0.00546	-1.1678	10	0.62326	D	0.03	-5.2597	19.807	0.96535	0.0:1.0:0.0:0.0	.	36;52;28;47;59;47;52	B4DDE7;B4DS31;B4DSZ2;B2RA86;E9PC62;O95319-3;O95319	.;.;.;.;.;.;CELF2_HUMAN	L	52;52;59;59;28;28;28;28;28;28	ENSP00000368563:S52L;ENSP00000406451:S52L;ENSP00000389951:S59L;ENSP00000443926:S59L;ENSP00000382743:S28L;ENSP00000404834:S28L;ENSP00000315328:S28L;ENSP00000346426:S28L;ENSP00000388530:S28L	ENSP00000315328:S28L	S	+	2	0	CELF2	11247556	1.000000	0.71417	0.976000	0.42696	0.967000	0.64934	5.846000	0.69444	2.759000	0.94783	0.563000	0.77884	TCG		0.527	CELF2-201	KNOWN	basic|CCDS	protein_coding	protein_coding			
MAML2	84441	hgsc.bcm.edu	37	11	95825362	95825362	+	Silent	SNP	C	C	T			TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr11:95825362C>T	ENST00000524717.1	-	2	3117	c.1833G>A	c.(1831-1833)caG>caA	p.Q611Q		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	611					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)	p.Q611Q(2)	CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				gctgttgctgctgctgctgct	0.542			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid																																	.		Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	2	Substitution - coding silent(2)	endometrium(1)|kidney(1)											39.0	44.0	42.0					11																	95825362		2057	4042	6099	SO:0001819	synonymous_variant	84441			AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.1833G>A	11.37:g.95825362C>T			A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Silent	SNP	ENST00000524717.1	37	CCDS44714.1																																																																																				0.542	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395540.1		
H2AFZ	3015	broad.mit.edu;hgsc.bcm.edu;bcgsc.ca	37	4	100870503	100870503	+	Missense_Mutation	SNP	G	G	T			TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr4:100870503G>T	ENST00000296417.5	-	3	339	c.122C>A	c.(121-123)aCg>aAg	p.T41K	RP11-15B17.1_ENST00000507494.1_RNA|H2AFZ_ENST00000529158.1_5'UTR|RP11-15B17.1_ENST00000501976.2_RNA|RP11-15B17.1_ENST00000514624.1_RNA|DNAJB14_ENST00000442697.2_5'Flank|DNAJB14_ENST00000471738.1_5'Flank	NM_002106.3	NP_002097.1	P0C0S5	H2AZ_HUMAN	H2A histone family, member Z	41					cellular response to estradiol stimulus (GO:0071392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	extracellular vesicular exosome (GO:0070062)|nuclear euchromatin (GO:0005719)|nuclear heterochromatin (GO:0005720)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|nucleosomal DNA binding (GO:0031492)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)			breast(1)|endometrium(3)|lung(1)	5				OV - Ovarian serous cystadenocarcinoma(123;2.32e-08)		ATGACTGGTCGTCCTAGATTT	0.488											OREG0016271	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										.											0													60.0	59.0	59.0					4																	100870503		2203	4300	6503	SO:0001583	missense	3015			X52317	CCDS3654.1	4q23	2011-01-27			ENSG00000164032	ENSG00000164032		"""Histones / Replication-independent"""	4741	protein-coding gene	gene with protein product		142763		H2AZ		1697587	Standard	XM_005262971		Approved	H2A.Z	uc003hvo.1	P0C0S5	OTTHUMG00000131048	ENST00000296417.5:c.122C>A	4.37:g.100870503G>T	ENSP00000296417:p.Thr41Lys	1354	B2RD56|P17317|Q6I9U0	Missense_Mutation	SNP	ENST00000296417.5	37	CCDS3654.1	.	.	.	.	.	.	.	.	.	.	G	17.22	3.333693	0.60853	.	.	ENSG00000164032	ENST00000296417	T	0.67523	-0.27	3.76	3.76	0.43208	Histone-fold (2);Histone core (1);Histone H2A (1);	0.000000	0.85682	D	0.000000	T	0.44644	0.1303	N	0.10945	0.07	0.80722	D	1	P	0.39022	0.655	B	0.29598	0.104	T	0.58289	-0.7662	10	0.72032	D	0.01	.	15.7927	0.78380	0.0:0.0:1.0:0.0	.	41	P0C0S5	H2AZ_HUMAN	K	41	ENSP00000296417:T41K	ENSP00000296417:T41K	T	-	2	0	H2AFZ	101089526	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.608000	0.90895	1.938000	0.56188	0.555000	0.69702	ACG		0.488	H2AFZ-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000253695.1	NM_002106	
AHNAK	79026	broad.mit.edu	37	11	62294617	62294617	+	Silent	SNP	C	C	T	rs143003772		TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr11:62294617C>T	ENST00000378024.4	-	5	7546	c.7272G>A	c.(7270-7272)ggG>ggA	p.G2424G	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	2424					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				CAATGTCTGGCCCACTGACAT	0.478																																						.											0													78.0	76.0	77.0					11																	62294617		2202	4299	6501	SO:0001819	synonymous_variant	79026			M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.7272G>A	11.37:g.62294617C>T			A1A586	Silent	SNP	ENST00000378024.4	37	CCDS31584.1																																																																																				0.478	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060	
SMCO2	341346	broad.mit.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	12	27654933	27654933	+	Missense_Mutation	SNP	G	G	T			TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr12:27654933G>T	ENST00000535986.1	+	8	911	c.911G>T	c.(910-912)gGt>gTt	p.G304V	SMCO2_ENST00000416383.1_Missense_Mutation_p.G304V|SMCO2_ENST00000298876.4_Missense_Mutation_p.G254V			A6NFE2	SMCO2_HUMAN	single-pass membrane protein with coiled-coil domains 2	304						integral component of membrane (GO:0016021)											CTATTTTTTGGTGCTACATTT	0.433																																						.											0													231.0	196.0	206.0					12																	27654933		683	1590	2273	SO:0001583	missense	0				CCDS44852.1	12p11.23	2013-03-11	2013-03-11	2013-03-11	ENSG00000165935	ENSG00000165935			34448	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 70"""	C12orf70			Standard	NM_001145010		Approved	LOC341346	uc010sjq.2	A6NFE2	OTTHUMG00000169205	ENST00000535986.1:c.911G>T	12.37:g.27654933G>T	ENSP00000441688:p.Gly304Val			Missense_Mutation	SNP	ENST00000535986.1	37	CCDS44852.1	.	.	.	.	.	.	.	.	.	.	G	9.734	1.163115	0.21538	.	.	ENSG00000165935	ENST00000298876;ENST00000416383;ENST00000535986	.	.	.	4.47	3.24	0.37175	.	0.138657	0.33457	N	0.004882	T	0.27697	0.0681	N	0.14661	0.345	0.40944	D	0.984497	P	0.35982	0.531	B	0.35353	0.201	T	0.11591	-1.0581	9	0.62326	D	0.03	-12.4019	6.7562	0.23516	0.8922:0.0:0.1078:0.0	.	304	A6NFE2	CL070_HUMAN	V	254;304;304	.	ENSP00000298876:G254V	G	+	2	0	C12orf70	27546200	0.986000	0.35501	0.374000	0.26016	0.004000	0.04260	2.085000	0.41634	0.854000	0.35336	-0.290000	0.09829	GGT		0.433	SMCO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402867.1	NM_001145010	
TPTE2P3	220115	broad.mit.edu	37	13	53151292	53151293	+	IGR	DNP	AG	AG	CA	rs200715678|rs199793614	byFrequency	TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr13:53151292_53151293AG>CA								RP11-78J21.4 (77852 upstream) : HNRNPA1L2 (40311 downstream)														p.V286I(2)|p.L285F(2)									TAAAAAGATTAGTTATTTATTC	0.361																																						.											4	Substitution - Missense(4)	prostate(2)|endometrium(2)																																								SO:0001628	intergenic_variant	220115																															13.37:g.53151292_53151293delinsCA				RNA	DNP		37																																																																																				0	0.361								
WHAMMP2	440253	broad.mit.edu	37	15	28991148	28991148	+	RNA	SNP	G	G	C	rs200178304		TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr15:28991148G>C	ENST00000512149.2	+	0	0					NR_026589.1				WAS protein homolog associated with actin, golgi membranes and microtubules pseudogene 2																		AAATGGAACAGGATGTGAAGA	0.378																																						.											0																																												440253			BC035099		15q13.1	2014-03-20	2011-06-24	2011-06-24	ENSG00000248334	ENSG00000248334			32360	pseudogene	pseudogene			"""WAS protein homology region 2 domain containing 1-like 2 (pseudogene)"", ""WAS protein homolog associated with actin, golgi membranes and microtubules-like 2 (pseudogene)"""	WHDC1L2, WHAMML2			Standard	NR_026589		Approved		uc010uap.2		OTTHUMG00000176340		15.37:g.28991148G>C				RNA	SNP	ENST00000512149.2	37																																																																																					0.378	WHAMMP2-003	PUTATIVE	basic	processed_transcript	pseudogene	OTTHUMT00000431783.1	NR_026589	
SLC24A1	9187	broad.mit.edu	37	15	65916547	65916547	+	Silent	SNP	A	A	G			TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr15:65916547A>G	ENST00000261892.6	+	2	416	c.129A>G	c.(127-129)agA>agG	p.R43R	SLC24A1_ENST00000546330.1_Silent_p.R43R|SLC24A1_ENST00000339868.6_Silent_p.R43R|SLC24A1_ENST00000544319.2_Silent_p.R43R|SLC24A1_ENST00000537259.1_Silent_p.R43R|SLC24A1_ENST00000399033.4_Silent_p.R43R	NM_001254740.1|NM_004727.2	NP_001241669.1|NP_004718.1	O60721	NCKX1_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 1	43					calcium ion transport (GO:0006816)|ion transport (GO:0006811)|phototransduction, visible light (GO:0007603)|response to light intensity (GO:0009642)|rhodopsin mediated signaling pathway (GO:0016056)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|outer membrane (GO:0019867)|plasma membrane (GO:0005886)	calcium, potassium:sodium antiporter activity (GO:0008273)|symporter activity (GO:0015293)			breast(2)|endometrium(7)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23						ACCTTAGGAGACCCCGGGGCC	0.512																																						.											0													66.0	66.0	66.0					15																	65916547		1916	4115	6031	SO:0001819	synonymous_variant	9187			AF062922	CCDS45284.1, CCDS73742.1, CCDS73743.1, CCDS73744.1	15q22.31	2014-01-28			ENSG00000074621	ENSG00000074621		"""Solute carriers"""	10975	protein-coding gene	gene with protein product		603617				9856482	Standard	NM_004727		Approved	NCKX1, NCKX, RODX, KIAA0702, HsT17412, CSNB1D	uc010ujf.2	O60721	OTTHUMG00000167960	ENST00000261892.6:c.129A>G	15.37:g.65916547A>G			O43485|O75184|Q17RM9	Silent	SNP	ENST00000261892.6	37	CCDS45284.1																																																																																				0.512	SLC24A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397304.1	NM_004727	
CSK	1445	broad.mit.edu	37	15	75093415	75093415	+	Missense_Mutation	SNP	T	T	C			TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr15:75093415T>C	ENST00000220003.9	+	9	1514	c.785T>C	c.(784-786)cTc>cCc	p.L262P	CSK_ENST00000309470.9_Missense_Mutation_p.L262P|CSK_ENST00000439220.2_Missense_Mutation_p.L262P|CSK_ENST00000567571.1_Missense_Mutation_p.L262P	NM_004383.2	NP_004374.1	P41240	CSK_HUMAN	c-src tyrosine kinase	262	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				adherens junction organization (GO:0034332)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cellular response to peptide hormone stimulus (GO:0071375)|epidermal growth factor receptor signaling pathway (GO:0007173)|negative regulation of bone resorption (GO:0045779)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of Golgi to plasma membrane protein transport (GO:0042997)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of kinase activity (GO:0033673)|negative regulation of low-density lipoprotein particle clearance (GO:0010989)|negative regulation of phagocytosis (GO:0050765)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet activation (GO:0030168)|positive regulation of MAP kinase activity (GO:0043406)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of Fc receptor mediated stimulatory signaling pathway (GO:0060368)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein C-terminus binding (GO:0008022)|protein tyrosine kinase activity (GO:0004713)	p.L262R(1)		central_nervous_system(1)|lung(2)	3						AAGGGCGGGCTCTACATCGTC	0.642																																						.											1	Substitution - Missense(1)	skin(1)											86.0	87.0	86.0					15																	75093415		2197	4296	6493	SO:0001583	missense	1445				CCDS10269.1	15q24.1	2013-02-14			ENSG00000103653	ENSG00000103653	2.7.10.1	"""SH2 domain containing"""	2444	protein-coding gene	gene with protein product		124095				1377109	Standard	NM_004383		Approved		uc010bka.3	P41240	OTTHUMG00000142814	ENST00000220003.9:c.785T>C	15.37:g.75093415T>C	ENSP00000220003:p.Leu262Pro		Q2M3N2|Q6FGZ6	Missense_Mutation	SNP	ENST00000220003.9	37	CCDS10269.1	.	.	.	.	.	.	.	.	.	.	T	23.2	4.382491	0.82792	.	.	ENSG00000103653	ENST00000220003;ENST00000439220;ENST00000451345;ENST00000309470	T;T;T	0.38560	1.13;1.13;1.13	5.4	5.4	0.78164	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000004	T	0.50017	0.1591	L	0.33189	0.99	0.80722	D	1	D	0.59357	0.985	D	0.66351	0.943	T	0.52983	-0.8502	10	0.87932	D	0	-20.0374	10.6013	0.45369	0.0:0.0779:0.0:0.9221	.	262	P41240	CSK_HUMAN	P	262;262;211;262	ENSP00000220003:L262P;ENSP00000414764:L262P;ENSP00000438808:L262P	ENSP00000220003:L262P	L	+	2	0	CSK	72880468	1.000000	0.71417	0.997000	0.53966	0.990000	0.78478	7.553000	0.82203	2.043000	0.60533	0.482000	0.46254	CTC		0.642	CSK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286398.2	NM_004383	
CLEC17A	388512	broad.mit.edu	37	19	14710546	14710548	+	In_Frame_Del	DEL	CTA	CTA	-			TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	CTA	CTA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr19:14710546_14710548delCTA	ENST00000417570.1	+	11	702_704	c.664_666delCTA	c.(664-666)ctadel	p.L222del	CLEC17A_ENST00000397439.2_In_Frame_Del_p.L205del|CLEC17A_ENST00000547437.1_In_Frame_Del_p.L222del	NM_001204118.1	NP_001191047.1	Q6ZS10	CL17A_HUMAN	C-type lectin domain family 17, member A	222						cell surface (GO:0009986)|integral component of membrane (GO:0016021)	fucose binding (GO:0042806)|mannose binding (GO:0005537)|metal ion binding (GO:0046872)										CATGGCAGGGCTAGCTGGCCTGA	0.547																																						.											0																																										SO:0001651	inframe_deletion	388512			AK127809	CCDS46002.1, CCDS46002.2, CCDS56087.1	19p13.12	2009-06-26			ENSG00000187912	ENSG00000187912		"""C-type lectin domain containing"""	34520	protein-coding gene	gene with protein product	"""prolectin"""					19419970	Standard	NM_207390		Approved	FLJ45910	uc010dzn.2	Q6ZS10		ENST00000417570.1:c.664_666delCTA	19.37:g.14710546_14710548delCTA	ENSP00000393719:p.Leu222del		A8MX68|B2RTX0|B7ZMM4	In_Frame_Del	DEL	ENST00000417570.1	37	CCDS56087.1																																																																																				0.547	CLEC17A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403400.1	NM_207390	
BIRC6	57448	broad.mit.edu;mdanderson.org	37	2	32694461	32694461	+	Splice_Site	SNP	A	A	G			TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr2:32694461A>G	ENST00000421745.2	+	30	6261		c.e30-1			NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6						apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					TTCTTGTAATAGGACACTCTG	0.368																																					Pancreas(94;175 1509 16028 18060 45422)	.											0													82.0	80.0	81.0					2																	32694461		2203	4300	6503	SO:0001630	splice_region_variant	57448			AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.6128-1A>G	2.37:g.32694461A>G			Q9ULD1	Splice_Site	SNP	ENST00000421745.2	37	CCDS33175.2	.	.	.	.	.	.	.	.	.	.	A	23.3	4.395497	0.83011	.	.	ENSG00000115760	ENST00000421745	.	.	.	4.99	4.99	0.66335	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.0416	0.71796	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	BIRC6	32547965	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.287000	0.95975	2.014000	0.59158	0.477000	0.44152	.		0.368	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3	NM_016252	Intron
CTNNA2	1496	broad.mit.edu;mdanderson.org	37	2	80816475	80816475	+	Missense_Mutation	SNP	A	A	T			TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr2:80816475A>T	ENST00000402739.4	+	14	2059	c.2054A>T	c.(2053-2055)gAg>gTg	p.E685V	AC008067.2_ENST00000596887.1_RNA|CTNNA2_ENST00000541047.1_Missense_Mutation_p.E685V|CTNNA2_ENST00000343114.3_Missense_Mutation_p.E364V|CTNNA2_ENST00000540488.1_Missense_Mutation_p.E685V|CTNNA2_ENST00000361291.4_Missense_Mutation_p.E719V|CTNNA2_ENST00000496558.1_Missense_Mutation_p.E685V|AC008067.2_ENST00000430876.1_RNA|AC008067.2_ENST00000595478.1_RNA|CTNNA2_ENST00000466387.1_Missense_Mutation_p.E685V|AC008067.2_ENST00000609950.1_RNA	NM_001282597.1	NP_001269526.1	P26232	CTNA2_HUMAN	catenin (cadherin-associated protein), alpha 2	685					axonogenesis (GO:0007409)|brain morphogenesis (GO:0048854)|dendrite morphogenesis (GO:0048813)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|prepulse inhibition (GO:0060134)|radial glia guided migration of Purkinje cell (GO:0021942)|regulation of synapse structural plasticity (GO:0051823)|single organismal cell-cell adhesion (GO:0016337)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	structural constituent of cytoskeleton (GO:0005200)			breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(49)|pancreas(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	78						AAAATAGCTGAGCAGGTGGAG	0.507																																						.											0													90.0	98.0	95.0					2																	80816475		2191	4299	6490	SO:0001583	missense	1496				CCDS42703.2, CCDS62944.1, CCDS62945.1, CCDS74531.1	2p12-p11.1	2010-05-04			ENSG00000066032	ENSG00000066032			2510	protein-coding gene	gene with protein product	"""cadherin-associated protein, related"", ""cancer/testis antigen 114"""	114025				8432524	Standard	NM_004389		Approved	CAP-R, CT114	uc010ysf.2	P26232	OTTHUMG00000152903	ENST00000402739.4:c.2054A>T	2.37:g.80816475A>T	ENSP00000384638:p.Glu685Val		B3KXE5|B7Z2W7|B7Z352|B7Z898|Q4ZFW1|Q53R26|Q53R33|Q53T67|Q53T71|Q53TM8|Q7Z3L1|Q7Z3Y0	Missense_Mutation	SNP	ENST00000402739.4	37		.	.	.	.	.	.	.	.	.	.	A	21.6	4.172010	0.78452	.	.	ENSG00000066032	ENST00000466387;ENST00000496558;ENST00000361291;ENST00000402739;ENST00000541047;ENST00000540488;ENST00000343114	T;T;T;T;T;T;T	0.56611	0.45;0.45;0.45;0.45;0.45;0.45;0.45	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	T	0.72293	0.3442	M	0.77616	2.38	0.80722	D	1	B;D;D;D	0.65815	0.354;0.993;0.991;0.995	B;D;P;D	0.65987	0.355;0.94;0.9;0.931	T	0.73786	-0.3873	9	.	.	.	.	16.4608	0.84044	1.0:0.0:0.0:0.0	.	317;685;685;685	F6KRI5;P26232;P26232-3;P26232-2	.;CTNA2_HUMAN;.;.	V	685;685;719;685;685;685;364	ENSP00000418191:E685V;ENSP00000419295:E685V;ENSP00000355398:E719V;ENSP00000384638:E685V;ENSP00000444675:E685V;ENSP00000441705:E685V;ENSP00000341500:E364V	.	E	+	2	0	CTNNA2	80669986	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.109000	0.94291	2.288000	0.76882	0.533000	0.62120	GAG		0.507	CTNNA2-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000328511.4	NM_004389	
CLTCL1	8218	broad.mit.edu;bcgsc.ca	37	22	19203748	19203748	+	Missense_Mutation	SNP	A	A	G			TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr22:19203748A>G	ENST00000263200.10	-	19	3010	c.2938T>C	c.(2938-2940)Tca>Cca	p.S980P	CLTCL1_ENST00000353891.5_Missense_Mutation_p.S980P|CLTCL1_ENST00000427926.1_Missense_Mutation_p.S980P	NM_007098.3	NP_009029.3	P53675	CLH2_HUMAN	clathrin, heavy chain-like 1	980	Heavy chain arm.|Proximal segment.				anatomical structure morphogenesis (GO:0009653)|intracellular protein transport (GO:0006886)|mitotic nuclear division (GO:0007067)|positive regulation of glucose import (GO:0046326)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|coated vesicle (GO:0030135)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|spindle (GO:0005819)|trans-Golgi network (GO:0005802)	signal transducer activity (GO:0004871)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49	Colorectal(54;0.0993)					CGTGTTTCTGACAATGCTGTC	0.408			T	?	ALCL																																	.		Dom	yes		22	22q11.21	8218	"""clathrin, heavy polypeptide-like 1"""		L	0													90.0	86.0	88.0					22																	19203748		1866	4109	5975	SO:0001583	missense	8218				CCDS46662.1, CCDS54497.1, CCDS46662.2, CCDS54497.2	22q11.2	2008-06-10	2006-09-29		ENSG00000070371	ENSG00000070371			2093	protein-coding gene	gene with protein product		601273	"""clathrin, heavy polypeptide-like 1"""	CLTCL		8844170, 15133132	Standard	NM_007098		Approved	CLTD, CLH22, CHC22	uc021wle.1	P53675	OTTHUMG00000150109	ENST00000263200.10:c.2938T>C	22.37:g.19203748A>G	ENSP00000445677:p.Ser980Pro		B7Z7U5|Q14017|Q15808|Q15809	Missense_Mutation	SNP	ENST00000263200.10	37	CCDS46662.1	.	.	.	.	.	.	.	.	.	.	A	0.617	-0.822774	0.02755	.	.	ENSG00000070371	ENST00000353891;ENST00000263200;ENST00000427926	T;T;T	0.18657	2.2;2.2;2.2	3.4	2.35	0.29111	Tetratricopeptide-like helical (1);Armadillo-type fold (1);	0.095551	0.44902	N	0.000401	T	0.08088	0.0202	N	0.04275	-0.24	0.58432	D	0.999999	B;B	0.13145	0.002;0.007	B;B	0.28638	0.022;0.092	T	0.27606	-1.0069	10	0.02654	T	1	-1.3257	8.3632	0.32372	0.9031:0.0:0.0969:0.0	.	980;980	P53675-2;P53675	.;CLH2_HUMAN	P	980	ENSP00000439662:S980P;ENSP00000445677:S980P;ENSP00000441158:S980P	ENSP00000445677:S980P	S	-	1	0	CLTCL1	17583748	1.000000	0.71417	0.988000	0.46212	0.591000	0.36615	3.759000	0.55227	0.495000	0.27882	0.460000	0.39030	TCA		0.408	CLTCL1-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316397.5	NM_007098	
SCARF2	91179	broad.mit.edu	37	22	20791941	20791943	+	In_Frame_Del	DEL	AGC	AGC	-			TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	AGC	AGC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr22:20791941_20791943delAGC	ENST00000266214.5	-	1	203_205	c.99_101delGCT	c.(97-102)ctgctc>ctc	p.33_34LL>L	SCARF2_ENST00000405555.3_In_Frame_Del_p.33_34LL>L	NM_153334.4	NP_699165.2	Q96GP6	SREC2_HUMAN	scavenger receptor class F, member 2	33					cell adhesion (GO:0007155)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|skin(2)	10	Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			CAGCATCCAGagcagcagcagca	0.778																																						.											0									,	41,2921		6,29,1446					,	2.4	1.0			4	128,6158		10,108,3025	no	coding,coding	SCARF2	NM_182895.2,NM_153334.4	,	16,137,4471	A1A1,A1R,RR		2.0363,1.3842,1.8274	,	,		169,9079				SO:0001651	inframe_deletion	91179			AF522196	CCDS13779.1, CCDS46666.1	22q11.21	2011-10-10			ENSG00000244486	ENSG00000244486			19869	protein-coding gene	gene with protein product		613619				12154095	Standard	XM_006724364		Approved	SREC-II, SREC2, HUMZD58C02	uc002zsk.2	Q96GP6	OTTHUMG00000150779	ENST00000266214.5:c.99_101delGCT	22.37:g.20791950_20791952delAGC	ENSP00000266214:p.Leu34del		E5RFB8|Q58A83|Q8IXF3|Q9BW74	In_Frame_Del	DEL	ENST00000266214.5	37	CCDS13779.1																																																																																				0.778	SCARF2-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320047.1		
PKDREJ	10343	broad.mit.edu	37	22	46653502	46653502	+	Nonsense_Mutation	SNP	C	C	T			TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr22:46653502C>T	ENST00000253255.5	-	1	5717	c.5718G>A	c.(5716-5718)tgG>tgA	p.W1906*		NM_006071.1	NP_006062.1	Q9NTG1	PKDRE_HUMAN	polycystin (PKD) family receptor for egg jelly	1906					acrosome reaction (GO:0007340)|calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|neuropeptide signaling pathway (GO:0007218)|regulation of acrosome reaction (GO:0060046)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)			NS(2)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(4)|kidney(5)|large_intestine(21)|lung(16)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	73		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00459)		TCTCATCCAGCCAATTGCTTT	0.393																																						.											0													109.0	115.0	113.0					22																	46653502		2203	4300	6503	SO:0001587	stop_gained	10343			AF116458	CCDS14073.1	22q13.31	2013-07-31	2013-07-31		ENSG00000130943	ENSG00000130943			9015	protein-coding gene	gene with protein product		604670	"""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly, sea urchin homolog)-like"", ""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly homolog, sea urchin)-like"", ""polycystic kidney disease (polycystin) and REJ homolog (sperm receptor for egg jelly homolog, sea urchin)"""			9949214, 10591208	Standard	NM_006071		Approved		uc003bhh.3	Q9NTG1	OTTHUMG00000150493	ENST00000253255.5:c.5718G>A	22.37:g.46653502C>T	ENSP00000253255:p.Trp1906*		B1AJY3|O95850	Nonsense_Mutation	SNP	ENST00000253255.5	37	CCDS14073.1	.	.	.	.	.	.	.	.	.	.	C	45	11.351184	0.99550	.	.	ENSG00000130943	ENST00000253255	.	.	.	5.55	5.55	0.83447	.	0.000000	0.56097	D	0.000023	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-21.1151	16.215	0.82206	0.0:1.0:0.0:0.0	.	.	.	.	X	1906	.	ENSP00000253255:W1906X	W	-	3	0	PKDREJ	45032166	1.000000	0.71417	1.000000	0.80357	0.722000	0.41435	4.876000	0.63079	2.618000	0.88619	0.455000	0.32223	TGG		0.393	PKDREJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318466.1	NM_006071	
RBMS3	27303	broad.mit.edu;bcgsc.ca	37	3	29628650	29628650	+	Missense_Mutation	SNP	C	C	T			TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr3:29628650C>T	ENST00000383767.2	+	4	689	c.353C>T	c.(352-354)gCg>gTg	p.A118V	RBMS3_ENST00000383766.2_Missense_Mutation_p.A117V|RBMS3_ENST00000273139.9_Missense_Mutation_p.A118V|RBMS3_ENST00000445033.1_Missense_Mutation_p.A118V|RBMS3_ENST00000434693.2_Missense_Mutation_p.A117V|RBMS3_ENST00000456853.1_Missense_Mutation_p.A118V|RBMS3_ENST00000452462.1_Missense_Mutation_p.A118V|RBMS3_ENST00000396583.3_Missense_Mutation_p.A118V			Q6XE24	RBMS3_HUMAN	RNA binding motif, single stranded interacting protein 3	118	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				positive regulation of translation (GO:0045727)	cytoplasm (GO:0005737)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)			breast(1)|central_nervous_system(1)|large_intestine(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	11		Ovarian(412;0.0956)				GCACAGAAAGCGGTAGCATCT	0.388																																						.											0													124.0	131.0	129.0					3																	29628650		2203	4300	6503	SO:0001583	missense	27303			AF023259	CCDS33724.1, CCDS33725.1, CCDS33726.1, CCDS54557.1, CCDS54558.1	3p24-p23	2013-02-12	2010-04-20		ENSG00000144642	ENSG00000144642		"""RNA binding motif (RRM) containing"""	13427	protein-coding gene	gene with protein product	"""RNA-binding protein"""	605786	"""RNA binding motif, single stranded interacting protein"""			10675610	Standard	NM_001003793		Approved		uc003cel.3	Q6XE24	OTTHUMG00000155699	ENST00000383767.2:c.353C>T	3.37:g.29628650C>T	ENSP00000373277:p.Ala118Val		A8K9S4|B7ZL17|G5E9J9|O75876|Q17RI0|Q6XE23	Missense_Mutation	SNP	ENST00000383767.2	37	CCDS33724.1	.	.	.	.	.	.	.	.	.	.	C	36	5.609392	0.96637	.	.	ENSG00000144642	ENST00000434693;ENST00000396583;ENST00000383767;ENST00000445033;ENST00000273139;ENST00000383766;ENST00000452462;ENST00000456853	T;T;T;T;T;T;T;T	0.62788	-0.0;1.28;-0.0;-0.0;-0.0;1.28;-0.0;1.28	5.77	5.77	0.91146	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.73799	0.3633	L	0.52011	1.625	0.80722	D	1	D;D;D;D	0.69078	0.997;0.985;0.996;0.99	P;P;P;P	0.62014	0.841;0.897;0.836;0.843	T	0.70392	-0.4884	9	.	.	.	.	19.9655	0.97263	0.0:1.0:0.0:0.0	.	118;118;117;118	G5E9J9;Q6XE24-2;Q6XE24-3;Q6XE24	.;.;.;RBMS3_HUMAN	V	117;118;118;118;118;117;118;118	ENSP00000395592:A117V;ENSP00000379828:A118V;ENSP00000373277:A118V;ENSP00000391934:A118V;ENSP00000273139:A118V;ENSP00000373276:A117V;ENSP00000397926:A118V;ENSP00000400519:A118V	.	A	+	2	0	RBMS3	29603654	1.000000	0.71417	0.990000	0.47175	0.983000	0.72400	7.818000	0.86416	2.732000	0.93576	0.542000	0.68232	GCG		0.388	RBMS3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000341306.1	NM_001003792	
RAD54L2	23132	broad.mit.edu	37	3	51690165	51690165	+	Nonsense_Mutation	SNP	C	C	T			TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr3:51690165C>T	ENST00000409535.2	+	19	3330	c.3205C>T	c.(3205-3207)Cag>Tag	p.Q1069*	RAD54L2_ENST00000296477.3_Nonsense_Mutation_p.Q763*	NM_015106.2	NP_055921.2	Q9Y4B4	ARIP4_HUMAN	RAD54-like 2 (S. cerevisiae)	1069						nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|transcription cofactor activity (GO:0003712)			NS(2)|breast(1)|cervix(2)|endometrium(4)|large_intestine(5)|liver(2)|lung(9)|ovary(4)|skin(2)	31				BRCA - Breast invasive adenocarcinoma(193;0.000102)|Kidney(197;0.000758)|KIRC - Kidney renal clear cell carcinoma(197;0.000896)		AGTCCTTGTGCAGAAGGTGGT	0.493																																						.											0													73.0	64.0	67.0					3																	51690165		2203	4300	6503	SO:0001587	stop_gained	23132			AB018352	CCDS33765.2	3p21.2	2006-01-17			ENSG00000164080	ENSG00000164080			29123	protein-coding gene	gene with protein product						9872452	Standard	NM_015106		Approved	KIAA0809, SRISNF2L	uc011bdt.2	Q9Y4B4	OTTHUMG00000152936	ENST00000409535.2:c.3205C>T	3.37:g.51690165C>T	ENSP00000386520:p.Gln1069*		Q8TB57|Q9BV54	Nonsense_Mutation	SNP	ENST00000409535.2	37	CCDS33765.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	43|43	9.947530|9.947530	0.99302|0.99302	.|.	.|.	ENSG00000164080|ENSG00000164080	ENST00000432863|ENST00000409535;ENST00000296477	.|.	.|.	.|.	5.68|5.68	5.68|5.68	0.88126|0.88126	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.77785|.	0.4182|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.78448|.	-0.2200|.	3|.	.|0.56958	.|D	.|0.05	-14.7333|-14.7333	18.7862|18.7862	0.91955|0.91955	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	V|X	897|1069;763	.|.	.|ENSP00000296477:Q763X	A|Q	+|+	2|1	0|0	RAD54L2|RAD54L2	51665205|51665205	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	7.453000|7.453000	0.80700|0.80700	2.677000|2.677000	0.91161|0.91161	0.563000|0.563000	0.77884|0.77884	GCA|CAG		0.493	RAD54L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328700.2	NM_015106	
DGKQ	1609	broad.mit.edu	37	4	961063	961063	+	Silent	SNP	G	G	A	rs376274353		TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr4:961063G>A	ENST00000273814.3	-	9	1147	c.1074C>T	c.(1072-1074)gaC>gaT	p.D358D	DGKQ_ENST00000502309.1_5'Flank	NM_001347.3	NP_001338.2	P52824	DGKQ_HUMAN	diacylglycerol kinase, theta 110kDa	358					blood coagulation (GO:0007596)|cAMP-mediated signaling (GO:0019933)|G-protein coupled receptor signaling pathway (GO:0007186)|platelet activation (GO:0030168)|protein kinase C signaling (GO:0070528)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to ATP (GO:0033198)|thrombin receptor signaling pathway (GO:0070493)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	activating transcription factor binding (GO:0033613)|ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|kinase binding (GO:0019900)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|phospholipase binding (GO:0043274)			breast(1)|endometrium(2)|kidney(2)|lung(2)|prostate(2)	9			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			CAGCCCAGGCGTCACAGGCCT	0.726													G|||	1	0.000199681	0.0	0.0	5008	,	,		10427	0.0		0.0	False		,,,				2504	0.001				Esophageal Squamous(17;537 645 4447 26373)	.											0								G		0,4126		0,0,2063	8.0	11.0	10.0		1074	-7.6	0.0	4		10	1,8143		0,1,4071	no	coding-synonymous	DGKQ	NM_001347.2		0,1,6134	AA,AG,GG		0.0123,0.0,0.0081		358/943	961063	1,12269	2063	4072	6135	SO:0001819	synonymous_variant	1609			L38707	CCDS3342.1	4p16.3	2008-08-29	2002-08-29		ENSG00000145214	ENSG00000145214			2856	protein-coding gene	gene with protein product		601207	"""diacylglycerol kinase, theta (110kD)"""	DAGK4		8617502, 9099683	Standard	NM_001347		Approved	DAGK, DAGK7	uc003gbw.4	P52824	OTTHUMG00000088629	ENST00000273814.3:c.1074C>T	4.37:g.961063G>A			Q6P3W4	Silent	SNP	ENST00000273814.3	37	CCDS3342.1	.	.	.	.	.	.	.	.	.	.	G	4.346	0.063712	0.08388	0.0	1.23E-4	ENSG00000145214	ENST00000509465	.	.	.	3.78	-7.55	0.01327	.	.	.	.	.	T	0.23210	0.0561	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.19745	-1.0296	4	.	.	.	.	5.4238	0.16415	0.6615:0.1082:0.1219:0.1084	.	.	.	.	M	305	.	.	T	-	2	0	DGKQ	951063	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.351000	0.07711	-2.330000	0.00633	-1.723000	0.00705	ACG		0.726	DGKQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000200888.1		
UGT2B27P	54569	broad.mit.edu	37	4	69870669	69870669	+	IGR	SNP	C	C	A			TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr4:69870669C>A								UGT2A3 (53160 upstream) : UGT2B7 (46524 downstream)																							GCCACACAGGCCAGCAGGAAC	0.448																																						.											0													194.0	143.0	159.0					4																	69870669		692	1591	2283	SO:0001628	intergenic_variant	7365																															4.37:g.69870669C>A				Missense_Mutation	SNP		37																																																																																				0	0.448								
TRIM4	89122	broad.mit.edu	37	7	99514382	99514382	+	Silent	SNP	G	G	A			TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr7:99514382G>A	ENST00000355947.2	-	2	543	c.414C>T	c.(412-414)caC>caT	p.H138H	TRIM4_ENST00000354241.5_Intron|TRIM4_ENST00000349062.2_Intron	NM_033017.3	NP_148977.2	Q9C037	TRIM4_HUMAN	tripartite motif containing 4	138					protein trimerization (GO:0070206)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(1)	17	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)	Ovarian(593;0.238)				attcatccacgtggatgtcaa	0.403																																						.											0													208.0	216.0	213.0					7																	99514382		2203	4300	6503	SO:0001819	synonymous_variant	89122			AF220023	CCDS5678.1, CCDS5679.1	7q22-q31.1	2013-01-09	2011-01-25		ENSG00000146833	ENSG00000146833		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16275	protein-coding gene	gene with protein product	"""tripartite motif protein TRIM4"", ""tripartite motif protein 4"""		"""tripartite motif-containing 4"""			11331580	Standard	NM_033017		Approved	RNF87	uc003use.3	Q9C037	OTTHUMG00000156648	ENST00000355947.2:c.414C>T	7.37:g.99514382G>A			A4D298|Q75MK1|Q96F06|Q9C036	Silent	SNP	ENST00000355947.2	37	CCDS5679.1																																																																																				0.403	TRIM4-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000345050.1	NM_033017	
KPTN	11133	broad.mit.edu	37	19	47987306	47987307	+	Frame_Shift_Ins	INS	-	-	C	rs540521125		TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr19:47987306_47987307insC	ENST00000338134.3	-	1	218_219	c.111_112insG	c.(109-114)gggcgcfs	p.R38fs	NAPA-AS1_ENST00000594367.1_RNA|KPTN_ENST00000595484.1_5'UTR|KPTN_ENST00000536339.1_5'UTR|NAPA-AS1_ENST00000593284.1_RNA	NM_007059.2	NP_008990.2	Q9Y664	KPTN_HUMAN	kaptin (actin binding protein)	38					actin filament organization (GO:0007015)|cellular component movement (GO:0006928)|sensory perception of sound (GO:0007605)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)	actin binding (GO:0003779)			breast(1)|lung(3)|ovary(2)|pancreas(2)	8		all_cancers(25;1.55e-10)|all_epithelial(76;3.4e-08)|all_lung(116;1.73e-07)|Lung NSC(112;3.95e-07)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		OV - Ovarian serous cystadenocarcinoma(262;0.000428)|all cancers(93;0.000631)|Epithelial(262;0.0153)|GBM - Glioblastoma multiforme(486;0.0694)		AGCTccccgcgcccgccggcgc	0.683											OREG0025593	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										.											0																																										SO:0001589	frameshift_variant	11133			AF105369	CCDS42583.1	19q13.32	2014-08-13	2001-11-28		ENSG00000118162	ENSG00000118162			6404	protein-coding gene	gene with protein product		615620	"""kaptin (actin-binding protein)"""			10099934	Standard	XM_005258467		Approved	2E4	uc002pgy.3	Q9Y664	OTTHUMG00000183443	ENST00000338134.3:c.112dupG	19.37:g.47987309_47987309dupC	ENSP00000337850:p.Arg38fs	951	B3KN86|B4DQ76|Q96GT1	Frame_Shift_Ins	INS	ENST00000338134.3	37	CCDS42583.1																																																																																				0.683	KPTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466672.2		
POM121C	100101267	broad.mit.edu	37	7	75055685	75055686	+	Frame_Shift_Ins	INS	-	-	CC			TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr7:75055685_75055686insCC	ENST00000257665.5	-	6	1255_1256	c.1256_1257insGG	c.(1255-1257)tcafs	p.S419fs	POM121C_ENST00000473168.1_Intron|POM121C_ENST00000453279.2_Frame_Shift_Ins_p.S177fs			A8CG34	P121C_HUMAN	POM121 transmembrane nucleoporin C	419	Pore side. {ECO:0000255}.|Ser-rich.				mRNA transport (GO:0051028)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|nuclear pore (GO:0005643)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|skin(1)|urinary_tract(1)	14						GGGAGCGGGATGAGGCTGGGCT	0.505																																						.											0																																										SO:0001589	frameshift_variant	100101267				CCDS47617.1	7q11.23	2012-03-13	2012-03-13		ENSG00000135213	ENSG00000272391			34005	protein-coding gene	gene with protein product		615754	"""POM121 membrane glycoprotein C"""			17900573	Standard	NM_001099415		Approved		uc003udk.4	A8CG34	OTTHUMG00000156238	ENST00000257665.5:c.1256_1257insGG	7.37:g.75055685_75055686insCC	ENSP00000257665:p.Ser419fs		O75115|Q9Y2N3|Q9Y4S7	Frame_Shift_Ins	INS	ENST00000257665.5	37																																																																																					0.505	POM121C-003	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000343919.2	NM_001099415	
DEFB132	400830	ucsc.edu	37	20	238438	238438	+	Missense_Mutation	SNP	G	G	C	rs66489228|rs371825938|rs79204234	byFrequency	TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr20:238438G>C	ENST00000382376.3	+	1	62	c.19G>C	c.(19-21)Gtc>Ctc	p.V7L		NM_207469.2	NP_997352.1	Q7Z7B7	DB132_HUMAN	defensin, beta 132	7					defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)				breast(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	4						CCTGCTCCTGGTCTTGGCAGC	0.517																																						.											0													57.0	49.0	51.0					20																	238438		2195	4273	6468	SO:0001583	missense	400830			AF525932	CCDS12993.1	20p13	2009-12-04	2008-10-23		ENSG00000186458	ENSG00000186458		"""Defensins, beta"""	33806	protein-coding gene	gene with protein product						18416833	Standard	NM_207469		Approved	RP5-1103G7.6, DEFB32	uc002wdb.3	Q7Z7B7	OTTHUMG00000043061	ENST00000382376.3:c.19G>C	20.37:g.238438G>C	ENSP00000371813:p.Val7Leu		B2RP72|Q4QY40	Missense_Mutation	SNP	ENST00000382376.3	37	CCDS12993.1	111	0.050824175824175824	29	0.05894308943089431	12	0.03314917127071823	23	0.04020979020979021	47	0.06200527704485488	G	6.656	0.489507	0.12641	.	.	ENSG00000186458	ENST00000382376	T	0.12465	2.68	4.26	-0.665	0.11403	.	0.870371	0.09352	N	0.813957	T	0.01029	0.0034	.	.	.	0.20563	N	0.999884	B	0.14012	0.009	B	0.12156	0.007	T	0.33904	-0.9850	9	0.87932	D	0	.	7.4251	0.27094	0.1052:0.4457:0.4491:0.0	.	7	Q7Z7B7	DB132_HUMAN	L	7	ENSP00000371813:V7L	ENSP00000371813:V7L	V	+	1	0	DEFB132	186438	0.482000	0.25948	0.810000	0.32431	0.026000	0.11368	-0.140000	0.10342	-0.145000	0.11294	-1.135000	0.01939	GTC		0.517	DEFB132-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000101365.1	NM_207469	
DEFB132	400830	ucsc.edu	37	20	238441	238441	+	Silent	SNP	T	T	C	rs66489228|rs398088193|rs371825938|rs74636637		TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr20:238441T>C	ENST00000382376.3	+	1	65	c.22T>C	c.(22-24)Ttg>Ctg	p.L8L		NM_207469.2	NP_997352.1	Q7Z7B7	DB132_HUMAN	defensin, beta 132	8					defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)				breast(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	4						GCTCCTGGTCTTGGCAGCCCT	0.527																																						.											0													60.0	54.0	56.0					20																	238441		1843	3522	5365	SO:0001819	synonymous_variant	400830			AF525932	CCDS12993.1	20p13	2009-12-04	2008-10-23		ENSG00000186458	ENSG00000186458		"""Defensins, beta"""	33806	protein-coding gene	gene with protein product						18416833	Standard	NM_207469		Approved	RP5-1103G7.6, DEFB32	uc002wdb.3	Q7Z7B7	OTTHUMG00000043061	ENST00000382376.3:c.22T>C	20.37:g.238441T>C			B2RP72|Q4QY40	Silent	SNP	ENST00000382376.3	37	CCDS12993.1																																																																																				0.527	DEFB132-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000101365.1	NM_207469	
EXOC8	149371	ucsc.edu;bcgsc.ca	37	1	231473244	231473244	+	Missense_Mutation	SNP	T	T	C			TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr1:231473244T>C	ENST00000360394.2	-	1	334	c.248A>G	c.(247-249)gAg>gGg	p.E83G	EXOC8_ENST00000366645.1_Missense_Mutation_p.E79G|SPRTN_ENST00000391858.4_5'UTR|SPRTN_ENST00000295050.7_5'Flank|SPRTN_ENST00000008440.9_5'Flank	NM_175876.3	NP_787072.2	Q8IYI6	EXOC8_HUMAN	exocyst complex component 8	83					cellular protein localization (GO:0034613)|cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|protein transport (GO:0015031)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|exocyst (GO:0000145)|membrane (GO:0016020)|plasma membrane (GO:0005886)				cervix(2)|endometrium(1)|large_intestine(2)|liver(1)|lung(5)|prostate(1)|skin(1)|stomach(1)	14	Breast(184;0.0871)	all_cancers(173;0.151)|Prostate(94;0.183)				CTGGTACATCTCGCTCTCCAG	0.637																																						.											0													57.0	47.0	50.0					1																	231473244		2203	4300	6503	SO:0001583	missense	149371			AL117352	CCDS1593.1	1q42.2	2013-01-22			ENSG00000116903	ENSG00000116903			24659	protein-coding gene	gene with protein product		615283				12477932	Standard	NM_175876		Approved	SEC84, EXO84, Exo84p	uc001huq.3	Q8IYI6	OTTHUMG00000038025	ENST00000360394.2:c.248A>G	1.37:g.231473244T>C	ENSP00000353564:p.Glu83Gly		B3KU33|Q5TE82	Missense_Mutation	SNP	ENST00000360394.2	37	CCDS1593.1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.095866	0.76870	.	.	ENSG00000116903	ENST00000360394;ENST00000366645	D;D	0.84660	-1.88;-1.88	5.78	4.59	0.56863	.	0.053552	0.64402	D	0.000001	D	0.92198	0.7526	M	0.87269	2.87	0.80722	D	1	D	0.69078	0.997	D	0.68483	0.958	D	0.93047	0.6462	10	0.62326	D	0.03	-27.3345	12.6391	0.56698	0.0:0.0:0.1379:0.8621	.	83	Q8IYI6	EXOC8_HUMAN	G	83;79	ENSP00000353564:E83G;ENSP00000355605:E79G	ENSP00000353564:E83G	E	-	2	0	EXOC8	229539867	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.049000	0.71053	2.198000	0.70561	0.528000	0.53228	GAG		0.637	EXOC8-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_175876	
HEXIM1	10614	ucsc.edu	37	17	43226939	43226939	+	Missense_Mutation	SNP	A	A	G			TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr17:43226939A>G	ENST00000332499.2	+	1	2256	c.382A>G	c.(382-384)Agt>Ggt	p.S128G	AC002117.1_ENST00000452741.1_RNA|AC002117.1_ENST00000589950.1_RNA	NM_006460.2	NP_006451.1	O94992	HEXI1_HUMAN	hexamethylene bis-acetamide inducible 1	128					heart development (GO:0007507)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|snRNA binding (GO:0017069)			breast(1)|kidney(2)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						CTCCGAGGCCAGTAAGTTGGG	0.652											OREG0024474	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										.											0													9.0	12.0	11.0					17																	43226939		2179	4275	6454	SO:0001583	missense	10614			AB021179	CCDS11495.1	17q21.31	2006-03-28				ENSG00000186834			24953	protein-coding gene	gene with protein product		607328				12119119, 12832472	Standard	NM_006460		Approved	CLP-1, HIS1, MAQ1, EDG1	uc002iig.3	O94992		ENST00000332499.2:c.382A>G	17.37:g.43226939A>G	ENSP00000328773:p.Ser128Gly	914	B2R8Y5	Missense_Mutation	SNP	ENST00000332499.2	37	CCDS11495.1	.	.	.	.	.	.	.	.	.	.	A	9.214	1.031790	0.19590	.	.	ENSG00000186834	ENST00000332499	.	.	.	4.33	0.526	0.17078	.	0.614097	0.13321	U	0.396724	T	0.14874	0.0359	N	0.08118	0	0.22803	N	0.998716	B	0.02656	0.0	B	0.01281	0.0	T	0.22626	-1.0211	9	0.23302	T	0.38	-5.1148	4.2217	0.10561	0.4485:0.429:0.1225:0.0	.	128	O94992	HEXI1_HUMAN	G	128	.	ENSP00000328773:S128G	S	+	1	0	HEXIM1	40582722	0.900000	0.30661	0.829000	0.32907	0.695000	0.40330	1.409000	0.34680	0.189000	0.20188	0.459000	0.35465	AGT		0.652	HEXIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449821.2	NM_006460	
KCNK16	83795	ucsc.edu;bcgsc.ca	37	6	39290273	39290273	+	Missense_Mutation	SNP	A	A	G			TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr6:39290273A>G	ENST00000373229.5	-	1	57	c.44T>C	c.(43-45)cTg>cCg	p.L15P	KCNK16_ENST00000437525.2_Missense_Mutation_p.L15P|KCNK16_ENST00000425054.2_Missense_Mutation_p.L15P|KCNK16_ENST00000373227.4_Missense_Mutation_p.L15P|KCNK16_ENST00000507712.1_Intron	NM_032115.3	NP_115491.1	Q96T55	KCNKG_HUMAN	potassium channel, subfamily K, member 16	15					potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			large_intestine(1)|lung(7)|ovary(2)|prostate(1)|skin(2)	13						CAGCAGGGGCAGCACCCGGCC	0.662																																						.											0													24.0	22.0	23.0					6																	39290273		2203	4298	6501	SO:0001583	missense	83795			AF358909	CCDS4843.1, CCDS47420.1, CCDS47421.1, CCDS47422.1	6p21.2-p21.1	2012-03-07			ENSG00000095981	ENSG00000095981		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	14464	protein-coding gene	gene with protein product		607369				11263999, 16382106	Standard	NM_032115		Approved	K2p16.1, TALK-1, TALK1	uc003ooq.3	Q96T55	OTTHUMG00000014645	ENST00000373229.5:c.44T>C	6.37:g.39290273A>G	ENSP00000362326:p.Leu15Pro		B5TJL9|Q2M2N9|Q5TCF3|Q6X6Z3|Q6X6Z4|Q6X6Z5|Q9H591	Missense_Mutation	SNP	ENST00000373229.5	37	CCDS4843.1	.	.	.	.	.	.	.	.	.	.	A	15.28	2.785389	0.49997	.	.	ENSG00000095981	ENST00000373229;ENST00000425054;ENST00000373227;ENST00000437525	T;T;T;T	0.27720	1.65;1.65;1.65;1.65	5.79	5.79	0.91817	.	0.279371	0.30519	N	0.009456	T	0.23886	0.0578	M	0.78049	2.395	0.80722	D	1	B;B;B;B	0.31769	0.076;0.125;0.339;0.076	B;B;B;B	0.33620	0.016;0.037;0.167;0.016	T	0.21655	-1.0239	10	0.87932	D	0	.	9.8431	0.41010	0.9213:0.0:0.0787:0.0	.	15;15;15;15	B5TJL9;Q96T55-5;Q96T55-4;Q96T55	.;.;.;KCNKG_HUMAN	P	15	ENSP00000362326:L15P;ENSP00000391498:L15P;ENSP00000362324:L15P;ENSP00000415375:L15P	ENSP00000362324:L15P	L	-	2	0	KCNK16	39398251	0.992000	0.36948	0.992000	0.48379	0.454000	0.32378	1.697000	0.37784	2.208000	0.71279	0.459000	0.35465	CTG		0.662	KCNK16-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000040452.2	NM_032115	
KMT2D	8085	ucsc.edu;mdanderson.org;bcgsc.ca	37	12	49436390	49436390	+	Missense_Mutation	SNP	T	T	C	rs372271746		TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr12:49436390T>C	ENST00000301067.7	-	27	5820	c.5821A>G	c.(5821-5823)Atg>Gtg	p.M1941V		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	1941					chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										TAGGAGTCCATTGGGCTGCTG	0.562																																						.											0								T	VAL/MET	1,3979		0,1,1989	63.0	69.0	67.0		5821	4.2	1.0	12		67	0,8330		0,0,4165	no	missense	MLL2	NM_003482.3	21	0,1,6154	CC,CT,TT		0.0,0.0251,0.0081	benign	1941/5538	49436390	1,12309	1990	4165	6155	SO:0001583	missense	8085			AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.5821A>G	12.37:g.49436390T>C	ENSP00000301067:p.Met1941Val		O14687	Missense_Mutation	SNP	ENST00000301067.7	37	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	T	9.790	1.177703	0.21787	2.51E-4	0.0	ENSG00000167548	ENST00000301067	T	0.79352	-1.26	5.36	4.18	0.49190	.	0.163095	0.29424	N	0.012200	T	0.60508	0.2274	N	0.12182	0.205	0.31552	N	0.658643	B	0.14012	0.009	B	0.11329	0.006	T	0.61888	-0.6970	10	0.87932	D	0	.	9.4065	0.38464	0.1589:0.0:0.0:0.8411	.	1941	O14686	MLL2_HUMAN	V	1941	ENSP00000301067:M1941V	ENSP00000301067:M1941V	M	-	1	0	MLL2	47722657	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.991000	0.40727	0.836000	0.34901	0.459000	0.35465	ATG		0.562	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
PDCD11	22984	ucsc.edu	37	10	105160258	105160258	+	Silent	SNP	A	A	G			TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr10:105160258A>G	ENST00000369797.3	+	3	301	c.207A>G	c.(205-207)agA>agG	p.R69R		NM_014976.1	NP_055791.1	Q14690	RRP5_HUMAN	programmed cell death 11	69					mRNA processing (GO:0006397)|rRNA processing (GO:0006364)	cytosol (GO:0005829)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	64		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		AGTCCGCAAGAGAGAAGTTTG	0.373																																						.											0													121.0	133.0	129.0					10																	105160258		2203	4300	6503	SO:0001819	synonymous_variant	22984			D80007	CCDS31276.1	10q24.32	2010-07-06			ENSG00000148843	ENSG00000148843			13408	protein-coding gene	gene with protein product		612333				10229231	Standard	XM_005269647		Approved	KIAA0185, ALG-4, RRP5	uc001kwy.1	Q14690	OTTHUMG00000018988	ENST00000369797.3:c.207A>G	10.37:g.105160258A>G			Q2TA92|Q5W093|Q6P2J3|Q86VQ8|Q9H4P1	Silent	SNP	ENST00000369797.3	37	CCDS31276.1																																																																																				0.373	PDCD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050151.1		
RNF181	51255	ucsc.edu	37	2	85823695	85823695	+	Missense_Mutation	SNP	A	A	G			TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr2:85823695A>G	ENST00000306368.4	+	2	170	c.140A>G	c.(139-141)gAc>gGc	p.D47G	RNF181_ENST00000441634.1_Missense_Mutation_p.D47G	NM_016494.3	NP_057578.1	Q9P0P0	RN181_HUMAN	ring finger protein 181	47					protein autoubiquitination (GO:0051865)		ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			lung(1)|stomach(1)	2						GTAGATTGGGACCACCACCTG	0.498																																						.											0													65.0	66.0	66.0					2																	85823695		2203	4300	6503	SO:0001583	missense	51255			AF151072	CCDS1981.1	2p11.2	2013-01-09			ENSG00000168894	ENSG00000168894		"""RING-type (C3HC4) zinc fingers"""	28037	protein-coding gene	gene with protein product		612490				11042152	Standard	XM_005264359		Approved	HSPC238	uc002spv.1	Q9P0P0	OTTHUMG00000130182	ENST00000306368.4:c.140A>G	2.37:g.85823695A>G	ENSP00000306906:p.Asp47Gly		Q53H81	Missense_Mutation	SNP	ENST00000306368.4	37	CCDS1981.1	.	.	.	.	.	.	.	.	.	.	A	16.50	3.141952	0.57044	.	.	ENSG00000168894	ENST00000441634;ENST00000306368;ENST00000414390	D;D	0.90504	-2.68;-2.68	5.75	4.58	0.56647	.	0.191798	0.52532	D	0.000063	D	0.85805	0.5782	L	0.47016	1.485	0.41740	D	0.989605	B	0.06786	0.001	B	0.08055	0.003	T	0.79122	-0.1933	10	0.21540	T	0.41	.	11.1994	0.48733	0.8458:0.1542:0.0:0.0	.	47	Q9P0P0	RN181_HUMAN	G	47	ENSP00000412025:D47G;ENSP00000306906:D47G	ENSP00000306906:D47G	D	+	2	0	RNF181	85677206	1.000000	0.71417	0.966000	0.40874	0.041000	0.13682	7.088000	0.76901	0.976000	0.38417	0.533000	0.62120	GAC		0.498	RNF181-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252500.1	NM_016494	
ANKRD20A5P	440482	mdanderson.org	37	18	14183680	14183680	+	RNA	SNP	G	G	A	rs75090388	byFrequency	TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr18:14183680G>A	ENST00000581935.1	+	0	531							A0PJZ0	A20A5_HUMAN	ankyrin repeat domain 20 family, member A5, pseudogene											lung(3)	3						TGTGCCAGTGGCCATGTGAAA	0.388																																						.											0																																												440482			BC022023		18p11.21	2011-06-01	2011-06-01	2011-06-01	ENSG00000186481	ENSG00000186481			33833	pseudogene	pseudogene			"""ankyrin repeat domain 20 family, member A5"""	ANKRD20A5			Standard	NR_040113		Approved	MGC26718	uc010xag.2	A0PJZ0	OTTHUMG00000157172		18.37:g.14183680G>A			Q4G1B6	RNA	SNP	ENST00000581935.1	37																																																																																					0.388	ANKRD20A5P-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000442833.1		
CACNA1A	773	mdanderson.org	37	19	13319693	13319693	+	Silent	SNP	A	A	G	rs16051	byFrequency	TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr19:13319693A>G	ENST00000360228.5	-	46	6656	c.6657T>C	c.(6655-6657)caT>caC	p.H2219H	CACNA1A_ENST00000573710.2_Silent_p.H2220H	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	2220	Poly-His.				adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	GGGGCGGGGGAtggtggtggt	0.731													g|||	3440	0.686901	0.7874	0.6081	5008	,	,		6615	0.7897		0.6252	False		,,,				2504	0.5644					.											0									,,,,	2283,905		898,487,209	3.0	4.0	3.0		6675,6660,6657,6666,6675		1.0	19	dbSNP_54	3	3993,3127		1321,1351,888	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	CACNA1A	NM_000068.3,NM_001127221.1,NM_001127222.1,NM_001174080.1,NM_023035.2	,,,,	2219,1838,1097	GG,GA,AA		43.9185,28.3877,39.1153	,,,,	2225/2267,2220/2262,2219/2507,2222/2264,2225/2513	13319693	6276,4032	1594	3560	5154	SO:0001819	synonymous_variant	773			U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.6657T>C	19.37:g.13319693A>G			J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Silent	SNP	ENST00000360228.5	37	CCDS45998.1																																																																																				0.731	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104062.2	NM_000068	
COQ7	10229	mdanderson.org;bcgsc.ca	37	16	19085298	19085298	+	Missense_Mutation	SNP	C	C	T	rs11074359	byFrequency	TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr16:19085298C>T	ENST00000321998.5	+	3	374	c.308C>T	c.(307-309)aCg>aTg	p.T103M	COQ7_ENST00000568985.1_Missense_Mutation_p.T103M|COQ7_ENST00000544894.2_Missense_Mutation_p.T65M|COQ7_ENST00000569127.1_Missense_Mutation_p.T80M	NM_016138.4	NP_057222.2	Q99807	COQ7_HUMAN	coenzyme Q7 homolog, ubiquinone (yeast)	103	2 X approximate tandem repeats.		T -> M (in dbSNP:rs11074359). {ECO:0000269|PubMed:10373327, ECO:0000269|PubMed:10501970, ECO:0000269|PubMed:11230166, ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:9020081}.		age-dependent response to oxidative stress (GO:0001306)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|in utero embryonic development (GO:0001701)|mitochondrial ATP synthesis coupled electron transport (GO:0042775)|mitochondrion morphogenesis (GO:0070584)|neural tube formation (GO:0001841)|neurogenesis (GO:0022008)|small molecule metabolic process (GO:0044281)|ubiquinone biosynthetic process (GO:0006744)	mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(1)|large_intestine(1)|lung(3)|prostate(1)|skin(3)|urinary_tract(1)	10						TTGATGGTTACGTTCAGGGTC	0.448													C|||	2878	0.574681	0.2655	0.6196	5008	,	,		19214	0.8145		0.6461	False		,,,				2504	0.6401					.											0								C	MET/THR,MET/THR	1489,2905	475.2+/-357.2	229,1031,937	125.0	104.0	111.0		194,308	5.9	0.3	16	dbSNP_120	111	5496,3104	657.7+/-401.5	1773,1950,577	yes	missense,missense	COQ7	NM_001190983.1,NM_016138.4	81,81	2002,2981,1514	TT,TC,CC		36.093,33.8871,46.2444	possibly-damaging,possibly-damaging	65/180,103/218	19085298	6985,6009	2197	4300	6497	SO:0001583	missense	10229			U81276	CCDS10574.1, CCDS53993.1	16p12.3	2008-05-14	2001-11-28		ENSG00000167186	ENSG00000167186			2244	protein-coding gene	gene with protein product		601683	"""coenzyme Q, 7 (rat, yeast) homolog"""			9020081, 10373325	Standard	NM_016138		Approved	CLK-1, CAT5	uc002dfr.3	Q99807	OTTHUMG00000131455	ENST00000321998.5:c.308C>T	16.37:g.19085298C>T	ENSP00000322316:p.Thr103Met		B2RDA9|Q9BTT7|Q9H0T5|Q9UEW5|Q9UNR5	Missense_Mutation	SNP	ENST00000321998.5	37	CCDS10574.1	1329	0.6085164835164835	146	0.2967479674796748	225	0.6215469613259669	473	0.8269230769230769	485	0.6398416886543535	C	18.35	3.605641	0.66445	0.338871	0.63907	ENSG00000167186	ENST00000321998;ENST00000544894	T;T	0.43688	0.94;0.94	5.91	5.91	0.95273	Ferritin/ribonucleotide reductase-like (1);Ferritin-related (1);	0.424017	0.29616	N	0.011650	T	0.00012	0.0000	L	0.39898	1.24	0.80722	P	0.0	P	0.47034	0.889	P	0.50109	0.631	T	0.13791	-1.0496	9	0.66056	D	0.02	-4.7588	19.9089	0.97019	0.0:1.0:0.0:0.0	rs11074359;rs17357840;rs60588972;rs11074359	103	Q99807	COQ7_HUMAN	M	103;65	ENSP00000322316:T103M;ENSP00000442923:T65M	ENSP00000322316:T103M	T	+	2	0	COQ7	18992799	0.228000	0.23718	0.328000	0.25416	0.913000	0.54294	3.071000	0.50041	2.793000	0.96121	0.655000	0.94253	ACG		0.448	COQ7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254275.3	NM_016138	
CR1	1378	mdanderson.org	37	1	207787831	207787831	+	Nonsense_Mutation	SNP	G	G	T			TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr1:207787831G>T	ENST00000367049.4	+	40	6658	c.6658G>T	c.(6658-6660)Gaa>Taa	p.E2220*	CR1_ENST00000400960.2_Nonsense_Mutation_p.E1770*|CR1_ENST00000367052.1_Nonsense_Mutation_p.E1770*|CR1_ENST00000367053.1_Nonsense_Mutation_p.E1770*|CR1_ENST00000367051.1_Nonsense_Mutation_p.E1770*	NM_000651.4	NP_000642.3	P17927	CR1_HUMAN	complement component (3b/4b) receptor 1 (Knops blood group)	1770					complement activation, classical pathway (GO:0006958)|complement receptor mediated signaling pathway (GO:0002430)|innate immune response (GO:0045087)|negative regulation of complement activation, alternative pathway (GO:0045957)|negative regulation of complement activation, classical pathway (GO:0045959)|negative regulation of serine-type endopeptidase activity (GO:1900004)|positive regulation of serine-type endopeptidase activity (GO:1900005)|regulation of complement activation (GO:0030449)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	complement component C3b binding (GO:0001851)|complement component C3b receptor activity (GO:0004877)|complement component C4b binding (GO:0001855)|complement component C4b receptor activity (GO:0001861)	p.E2220*(6)|p.E1775*(6)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(9)|kidney(11)|large_intestine(13)|lung(33)|ovary(3)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						TCCAGTGTGTGAACGTGAGTA	0.408																																						.											12	Substitution - Nonsense(12)	kidney(8)|endometrium(4)											131.0	122.0	125.0					1																	207787831		1887	4127	6014	SO:0001587	stop_gained	1378			Y00816	CCDS44308.1, CCDS44309.1	1q32	2014-07-19	2006-01-12		ENSG00000203710	ENSG00000203710		"""CD molecules"", ""Blood group antigens"", ""Complement system"""	2334	protein-coding gene	gene with protein product		120620	"""complement component (3b/4b) receptor 1, including Knops blood group system"""			1708809	Standard	XM_005273064		Approved	CD35, KN	uc001hfx.3	P17927	OTTHUMG00000036311	ENST00000367049.4:c.6658G>T	1.37:g.207787831G>T	ENSP00000356016:p.Glu2220*		Q16744|Q16745|Q5SR43|Q5SR45|Q9UQV2	Nonsense_Mutation	SNP	ENST00000367049.4	37	CCDS44308.1	.	.	.	.	.	.	.	.	.	.	G	45	12.061806	0.99632	.	.	ENSG00000203710	ENST00000367052;ENST00000367051;ENST00000367053;ENST00000400960;ENST00000367049	.	.	.	4.29	4.29	0.51040	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06236	T	0.91	.	12.9543	0.58418	0.0:0.0:1.0:0.0	.	.	.	.	X	1770;1770;1770;1770;2220	.	ENSP00000356016:E2220X	E	+	1	0	CR1	205854454	1.000000	0.71417	0.999000	0.59377	0.893000	0.52053	2.536000	0.45693	2.316000	0.78162	0.436000	0.28706	GAA		0.408	CR1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382527.1	NM_000573	
EEF1D	1936	mdanderson.org	37	8	144671244	144671244	+	Intron	SNP	C	C	A	rs4874160	byFrequency	TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr8:144671244C>A	ENST00000529272.1	-	2	397				EEF1D_ENST00000532741.1_Silent_p.R386R|EEF1D_ENST00000395119.3_Intron|EEF1D_ENST00000528610.1_Intron|EEF1D_ENST00000532400.1_Intron|EEF1D_ENST00000526838.1_Intron|EEF1D_ENST00000531621.1_Intron|EEF1D_ENST00000419152.2_Intron|EEF1D_ENST00000423316.2_Silent_p.R336R|EEF1D_ENST00000317198.6_Intron|EEF1D_ENST00000442189.2_Silent_p.R336R|EEF1D_ENST00000524624.1_Intron			P29692	EF1D_HUMAN	eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein)						cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)|translation elongation factor activity (GO:0003746)|translation factor activity, nucleic acid binding (GO:0008135)			breast(2)|cervix(1)|endometrium(1)|kidney(4)|lung(2)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.239)			ACCAGGCCACCCGCAGGGCCT	0.662													G|||	3218	0.642572	0.4879	0.7536	5008	,	,		16212	0.5149		0.8499	False		,,,				2504	0.6912					.											0								G	,,,,,,	2422,1970		730,962,504	22.0	21.0	22.0		1008,,,,,,1008	2.6	1.0	8	dbSNP_111	22	7854,740		3631,592,74	no	coding-synonymous,intron,intron,intron,intron,intron,coding-synonymous	EEF1D	NM_001130053.2,NM_001130055.2,NM_001130056.2,NM_001130057.2,NM_001195203.1,NM_001960.4,NM_032378.4	,,,,,,	4361,1554,578	AA,AC,CC		8.6107,44.8543,20.8686	,,,,,,	336/648,,,,,,336/648	144671244	10276,2710	2196	4297	6493	SO:0001627	intron_variant	1936			AK024550	CCDS6404.1, CCDS6405.1, CCDS47930.1, CCDS56559.1	8q24	2011-09-15			ENSG00000104529	ENSG00000104529			3211	protein-coding gene	gene with protein product		130592				8334168	Standard	NM_001960		Approved	EF-1D, FLJ20897	uc003yyt.3	P29692	OTTHUMG00000165191	ENST00000529272.1:c.4-2225G>T	8.37:g.144671244C>A			B4DDU4|D3DWK3|E9PBQ9|Q4VBZ6|Q969J1|Q96I38	Silent	SNP	ENST00000529272.1	37	CCDS6405.1																																																																																				0.662	EEF1D-006	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382592.2	NM_032378	
FRG1B	284802	mdanderson.org	37	20	29625905	29625905	+	Missense_Mutation	SNP	T	T	C			TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr20:29625905T>C	ENST00000278882.3	+	5	529	c.149T>C	c.(148-150)cTt>cCt	p.L50P	FRG1B_ENST00000358464.4_Missense_Mutation_p.L50P|FRG1B_ENST00000439954.2_Missense_Mutation_p.L55P			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	50								p.L50P(2)		endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						GGAAAATATCTTGGTATAAAT	0.333																																						.											2	Substitution - Missense(2)	kidney(2)																																								SO:0001583	missense	284802					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.149T>C	20.37:g.29625905T>C	ENSP00000278882:p.Leu50Pro		C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	t	10.74	1.434729	0.25813	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.56611	0.45	1.68	1.68	0.24146	.	0.000000	0.85682	D	0.000000	T	0.67316	0.2880	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.68300	-0.5445	9	0.87932	D	0	.	7.3757	0.26827	0.0:0.0:0.0:1.0	.	55	F5H5R5	.	P	50;55;50	ENSP00000408863:L55P	ENSP00000278882:L50P	L	+	2	0	FRG1B	28239566	1.000000	0.71417	1.000000	0.80357	0.038000	0.13279	6.623000	0.74238	1.028000	0.39785	0.155000	0.16302	CTT		0.333	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
KLB	152831	mdanderson.org	37	4	39448542	39448542	+	Silent	SNP	C	C	G	rs7685429	byFrequency	TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr4:39448542C>G	ENST00000257408.4	+	4	2293	c.2196C>G	c.(2194-2196)ccC>ccG	p.P732P		NM_175737.3	NP_783864.1	Q86Z14	KLOTB_HUMAN	klotho beta	732	Glycosyl hydrolase-1 2.				carbohydrate metabolic process (GO:0005975)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fibroblast growth factor binding (GO:0017134)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(11)|skin(6)	29						AGTTCAGGCCCTCACAGCGCG	0.701													G|||	3832	0.765176	0.7201	0.8516	5008	,	,		16291	0.7212		0.7505	False		,,,				2504	0.8252					.											0								G		3156,1242		1134,888,177	25.0	27.0	26.0		2196	-2.3	0.0	4	dbSNP_116	26	6590,1996		2531,1528,234	no	coding-synonymous	KLB	NM_175737.3		3665,2416,411	GG,GC,CC		23.2471,28.2401,24.9384		732/1045	39448542	9746,3238	2199	4293	6492	SO:0001819	synonymous_variant	152831			AB079373	CCDS3451.1	4p14	2008-02-05			ENSG00000134962	ENSG00000134962			15527	protein-coding gene	gene with protein product		611135					Standard	NM_175737		Approved		uc003gua.3	Q86Z14	OTTHUMG00000128577	ENST00000257408.4:c.2196C>G	4.37:g.39448542C>G			Q2M3K8	Silent	SNP	ENST00000257408.4	37	CCDS3451.1																																																																																				0.701	KLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250429.1	NM_175737	
FRG1	2483	mdanderson.org	37	4	190874235	190874235	+	Missense_Mutation	SNP	C	C	T			TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr4:190874235C>T	ENST00000226798.4	+	4	494	c.272C>T	c.(271-273)cCt>cTt	p.P91L	FRG1_ENST00000514482.1_3'UTR	NM_004477.2	NP_004468.1	Q14331	FRG1_HUMAN	FSHD region gene 1	91					mRNA splicing, via spliceosome (GO:0000398)|muscle organ development (GO:0007517)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|lung(11)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|urinary_tract(1)	32		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		GATGAGGGCCCTAGTCCTCCA	0.284																																						.											0													11.0	11.0	11.0					4																	190874235		2004	4059	6063	SO:0001583	missense	2483			L76159	CCDS34121.1	4q35	2008-02-05			ENSG00000109536	ENSG00000109536			3954	protein-coding gene	gene with protein product		601278				8733123	Standard	XM_005262880		Approved	FSG1, FRG1A	uc003izs.3	Q14331	OTTHUMG00000160202	ENST00000226798.4:c.272C>T	4.37:g.190874235C>T	ENSP00000226798:p.Pro91Leu		A8K775	Missense_Mutation	SNP	ENST00000226798.4	37	CCDS34121.1	.	.	.	.	.	.	.	.	.	.	.	20.5	4.005972	0.74932	.	.	ENSG00000109536	ENST00000226798;ENST00000531991	T;T	0.71817	2.12;-0.6	3.71	3.71	0.42584	Actin cross-linking (1);	0.000000	0.85682	D	0.000000	D	0.84042	0.5385	M	0.89904	3.07	0.80722	D	1	P	0.46987	0.888	P	0.57776	0.827	D	0.87755	0.2594	10	0.72032	D	0.01	-24.9555	13.8593	0.63550	0.0:1.0:0.0:0.0	.	91	Q14331	FRG1_HUMAN	L	91;28	ENSP00000226798:P91L;ENSP00000435943:P28L	ENSP00000226798:P91L	P	+	2	0	FRG1	191111229	1.000000	0.71417	0.998000	0.56505	0.944000	0.59088	5.379000	0.66196	2.022000	0.59522	0.632000	0.83419	CCT		0.284	FRG1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000359622.4	NM_004477	
KLF14	136259	mdanderson.org	37	7	130418525	130418525	+	Silent	SNP	G	G	A	rs76603546	byFrequency	TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr7:130418525G>A	ENST00000310992.4	-	1	363	c.336C>T	c.(334-336)tcC>tcT	p.S112S		NM_138693.2	NP_619638.2	Q8TD94	KLF14_HUMAN	Kruppel-like factor 14	112					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(3)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6	Melanoma(18;0.0435)					CGGAGAAGCCGGACGAGGCGC	0.746													G|||	1930	0.385383	0.1067	0.4697	5008	,	,		9011	0.5397		0.498	False		,,,				2504	0.4274					.											0								G		729,3497		105,519,1489	6.0	10.0	8.0		336	-6.1	0.0	7	dbSNP_131	8	3856,4508		998,1860,1324	no	coding-synonymous	KLF14	NM_138693.2		1103,2379,2813	AA,AG,GG		46.1023,17.2504,36.4178		112/324	130418525	4585,8005	2113	4182	6295	SO:0001819	synonymous_variant	136259			AF490374	CCDS5825.1	7q32.3	2014-05-06			ENSG00000174595	ENSG00000266265		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	23025	protein-coding gene	gene with protein product		609393				17480121	Standard	NM_138693		Approved	BTEB5	uc003vqk.2	Q8TD94	OTTHUMG00000188298	ENST00000310992.4:c.336C>T	7.37:g.130418525G>A			Q19A42|Q19A43	Silent	SNP	ENST00000310992.4	37	CCDS5825.1																																																																																				0.746	KLF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338013.1	NM_138693	
KRTAP10-10	353333	mdanderson.org	37	21	46058034	46058034	+	Missense_Mutation	SNP	G	G	A	rs142158982	byFrequency	TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr21:46058034G>A	ENST00000380095.1	+	1	762	c.700G>A	c.(700-702)Gtg>Atg	p.V234M	TSPEAR_ENST00000323084.4_Intron	NM_181688.1	NP_859016.1	P60014	KR10A_HUMAN	keratin associated protein 10-10	234						keratin filament (GO:0045095)				NS(1)|endometrium(2)|kidney(1)|lung(6)|prostate(1)|skin(2)	13						CTGCCGCCCCGTGTGCTCCCG	0.692																																						.											0								G	,MET/VAL	54,4352		0,54,2149	54.0	58.0	57.0		,700	-2.9	0.0	21	dbSNP_134	57	16,8582		0,16,4283	no	intron,missense	TSPEAR,KRTAP10-10	NM_144991.2,NM_181688.1	,21	0,70,6432	AA,AG,GG		0.1861,1.2256,0.5383	,possibly-damaging	,234/252	46058034	70,12934	2203	4299	6502	SO:0001583	missense	353333			AJ566387	CCDS33585.1	21q22.3	2006-03-13			ENSG00000221859	ENSG00000221859		"""Keratin associated proteins"""	22972	protein-coding gene	gene with protein product							Standard	NM_181688		Approved	KAP10.10, KAP18.10, KRTAP18-10	uc002zfq.3	P60014	OTTHUMG00000057631	ENST00000380095.1:c.700G>A	21.37:g.46058034G>A	ENSP00000369438:p.Val234Met			Missense_Mutation	SNP	ENST00000380095.1	37	CCDS33585.1	94	0.04304029304029304	28	0.056910569105691054	7	0.019337016574585635	29	0.050699300699300696	30	0.0395778364116095	g	0.883	-0.728095	0.03135	0.012256	0.001861	ENSG00000221859	ENST00000380095	T	0.01215	5.16	3.52	-2.88	0.05682	.	.	.	.	.	T	0.00241	0.0007	M	0.71206	2.165	0.09310	N	1	B	0.20459	0.045	B	0.20955	0.032	T	0.38178	-0.9673	9	0.42905	T	0.14	.	5.1831	0.15171	0.3582:0.0:0.4952:0.1466	.	234	P60014	KR10A_HUMAN	M	234	ENSP00000369438:V234M	ENSP00000369438:V234M	V	+	1	0	KRTAP10-10	44882462	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.581000	0.02119	-0.564000	0.06070	-1.314000	0.01303	GTG		0.692	KRTAP10-10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128034.1	NM_181688	
KRTAP4-11	653240	mdanderson.org	37	17	39274157	39274157	+	Silent	SNP	G	G	A	rs145503152		TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr17:39274157G>A	ENST00000391413.2	-	1	449	c.411C>T	c.(409-411)ccC>ccT	p.P137P		NM_033059.3	NP_149048.2	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	137	27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].					keratin filament (GO:0045095)		p.P137P(3)		endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(8)|prostate(5)|skin(1)	33		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			tgctgcagctggggtggcagc	0.672																																						.											3	Substitution - coding silent(3)	prostate(1)|lung(1)|endometrium(1)											8.0	13.0	12.0					17																	39274157		684	1586	2270	SO:0001819	synonymous_variant	653240			AC025904	CCDS45675.1	17q21.2	2013-06-25			ENSG00000212721	ENSG00000212721		"""Keratin associated proteins"""	18911	protein-coding gene	gene with protein product			"""keratin associated protein 4-14"""	KRTAP4-14			Standard	NM_033059		Approved	KAP4.11, KAP4.14	uc002hvz.3	Q9BYQ6	OTTHUMG00000133586	ENST00000391413.2:c.411C>T	17.37:g.39274157G>A			A0AUY2	Silent	SNP	ENST00000391413.2	37	CCDS45675.1																																																																																				0.672	KRTAP4-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257690.1		
LIPE	3991	mdanderson.org	37	19	42905986	42905986	+	Missense_Mutation	SNP	C	C	A			TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr19:42905986C>A	ENST00000244289.4	-	10	3485	c.3209G>T	c.(3208-3210)gGg>gTg	p.G1070V	LIPE-AS1_ENST00000594624.2_RNA|LIPE-AS1_ENST00000593491.2_RNA|LIPE-AS1_ENST00000599276.1_RNA|LIPE-AS1_ENST00000597203.1_RNA	NM_005357.2	NP_005348.2	Q05469	LIPS_HUMAN	lipase, hormone-sensitive	1070					cholesterol metabolic process (GO:0008203)|diacylglycerol catabolic process (GO:0046340)|lipid catabolic process (GO:0016042)|long-chain fatty acid catabolic process (GO:0042758)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)	cytosol (GO:0005829)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)	hormone-sensitive lipase activity (GO:0033878)|triglyceride lipase activity (GO:0004806)			breast(2)|endometrium(4)|kidney(7)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	32		Prostate(69;0.00682)				CCCGCAGCCCCCGTCTACCCC	0.736																																						.											0													2.0	3.0	2.0					19																	42905986		1240	2515	3755	SO:0001583	missense	3991			L11706	CCDS12607.1	19q13.1-q13.2	2014-03-14			ENSG00000079435	ENSG00000079435	3.1.1.3		6621	protein-coding gene	gene with protein product		151750				8506334	Standard	NM_005357		Approved	HSL	uc002otr.3	Q05469	OTTHUMG00000182814	ENST00000244289.4:c.3209G>T	19.37:g.42905986C>A	ENSP00000244289:p.Gly1070Val		Q3LRT2|Q6NSL7	Missense_Mutation	SNP	ENST00000244289.4	37	CCDS12607.1	.	.	.	.	.	.	.	.	.	.	C	11.04	1.522287	0.27211	.	.	ENSG00000079435	ENST00000244289	T	0.04317	3.65	3.11	2.05	0.26809	.	.	.	.	.	T	0.03695	0.0105	N	0.08118	0	0.18873	N	0.999986	P	0.52316	0.952	P	0.49140	0.601	T	0.45775	-0.9238	9	0.32370	T	0.25	.	5.9892	0.19452	0.0:0.7376:0.0:0.2624	.	1070	Q05469	LIPS_HUMAN	V	1070	ENSP00000244289:G1070V	ENSP00000244289:G1070V	G	-	2	0	LIPE	47597826	0.000000	0.05858	0.081000	0.20488	0.198000	0.23893	-0.333000	0.07894	0.595000	0.29777	-0.480000	0.04831	GGG		0.736	LIPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463861.1	NM_005357	
KMT2C	58508	mdanderson.org	37	7	151962290	151962290	+	Missense_Mutation	SNP	C	C	G			TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr7:151962290C>G	ENST00000262189.6	-	8	1235	c.1017G>C	c.(1015-1017)aaG>aaC	p.K339N	KMT2C_ENST00000355193.2_Missense_Mutation_p.K339N	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	339					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										TTGCATCTTCCTTCGCTATAA	0.368																																						.											0													77.0	71.0	73.0					7																	151962290		2203	4299	6502	SO:0001583	missense	58508			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.1017G>C	7.37:g.151962290C>G	ENSP00000262189:p.Lys339Asn		Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	C	6.180	0.401340	0.11696	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	D;D	0.98822	-5.16;-5.16	4.65	3.77	0.43336	Zinc finger, RING/FYVE/PHD-type (1);Protein kinase C-like, phorbol ester/diacylglycerol binding (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.43416	U	0.000576	D	0.97807	0.9280	L	0.34521	1.04	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	D	0.95779	0.8815	10	0.14656	T	0.56	.	11.2491	0.49015	0.0:0.8451:0.0:0.1549	.	339	Q8NEZ4	MLL3_HUMAN	N	339	ENSP00000262189:K339N;ENSP00000347325:K339N	ENSP00000262189:K339N	K	-	3	2	MLL3	151593223	1.000000	0.71417	1.000000	0.80357	0.006000	0.05464	1.789000	0.38724	1.072000	0.40860	-0.262000	0.10625	AAG		0.368	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
MUC21	394263	mdanderson.org	37	6	30955089	30955089	+	Missense_Mutation	SNP	G	G	C	rs79399059	byFrequency	TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr6:30955089G>C	ENST00000376296.3	+	2	1378	c.1137G>C	c.(1135-1137)gaG>gaC	p.E379D	MUC21_ENST00000486149.2_5'UTR	NM_001010909.2	NP_001010909.2	Q5SSG8	MUC21_HUMAN	mucin 21, cell surface associated	379	28 X 15 AA approximate tandem repeats.|Ser-rich.				cellular protein metabolic process (GO:0044267)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(4)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						CCAACTCTGAGTCCAGCACAG	0.632																																						.											0								G	ASP/GLU	8,4392	9.9+/-24.2	0,8,2192	149.0	145.0	146.0		1137	-8.5	0.0	6	dbSNP_131	146	22,8572	13.3+/-46.6	0,22,4275	no	missense	MUC21	NM_001010909.2	45	0,30,6467	CC,CG,GG		0.256,0.1818,0.2309	possibly-damaging	379/567	30955089	30,12964	2200	4297	6497	SO:0001583	missense	394263			AK056612	CCDS34388.1	6p21.33	2008-05-14	2008-05-14	2008-05-14	ENSG00000204544	ENSG00000204544		"""Mucins"""	21661	protein-coding gene	gene with protein product	"""epiglycanin"""		"""chromosome 6 open reading frame 205"""	C6orf205		17977904	Standard	NM_001010909		Approved	bCX31G15.2	uc003nsh.2	Q5SSG8	OTTHUMG00000031216	ENST00000376296.3:c.1137G>C	6.37:g.30955089G>C	ENSP00000365473:p.Glu379Asp		B0UZT7|B4DQ55|C9JMK2|D9N007|Q0VGF1|Q3B7T2|Q5SS94|Q6UXC5	Missense_Mutation	SNP	ENST00000376296.3	37	CCDS34388.1	.	.	.	.	.	.	.	.	.	.	g	7.624	0.677458	0.14841	0.001818	0.00256	ENSG00000204544	ENST00000450707;ENST00000376296	T	0.01963	4.53	4.24	-8.47	0.00939	.	.	.	.	.	T	0.00412	0.0013	L	0.27053	0.805	0.09310	N	1	P	0.37955	0.612	B	0.37451	0.25	T	0.45963	-0.9225	9	0.14252	T	0.57	1.253	3.6409	0.08166	0.1653:0.33:0.3946:0.1101	.	379	Q5SSG8	MUC21_HUMAN	D	229;379	ENSP00000365473:E379D	ENSP00000365473:E379D	E	+	3	2	MUC21	31063068	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	-0.635000	0.05471	-1.527000	0.01758	0.579000	0.79373	GAG		0.632	MUC21-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000128579.3	NM_001010909	
MUC21	394263	mdanderson.org	37	6	30955119	30955119	+	Silent	SNP	A	A	T	rs55918804	byFrequency	TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr6:30955119A>T	ENST00000376296.3	+	2	1408	c.1167A>T	c.(1165-1167)acA>acT	p.T389T	MUC21_ENST00000486149.2_5'UTR	NM_001010909.2	NP_001010909.2	Q5SSG8	MUC21_HUMAN	mucin 21, cell surface associated	389	28 X 15 AA approximate tandem repeats.|Ser-rich.				cellular protein metabolic process (GO:0044267)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(4)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						GGGCCAGCACAGCCACCACCT	0.637																																						.											0													143.0	140.0	141.0					6																	30955119		2203	4294	6497	SO:0001819	synonymous_variant	394263			AK056612	CCDS34388.1	6p21.33	2008-05-14	2008-05-14	2008-05-14	ENSG00000204544	ENSG00000204544		"""Mucins"""	21661	protein-coding gene	gene with protein product	"""epiglycanin"""		"""chromosome 6 open reading frame 205"""	C6orf205		17977904	Standard	NM_001010909		Approved	bCX31G15.2	uc003nsh.2	Q5SSG8	OTTHUMG00000031216	ENST00000376296.3:c.1167A>T	6.37:g.30955119A>T			B0UZT7|B4DQ55|C9JMK2|D9N007|Q0VGF1|Q3B7T2|Q5SS94|Q6UXC5	Silent	SNP	ENST00000376296.3	37	CCDS34388.1																																																																																				0.637	MUC21-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000128579.3	NM_001010909	
MUC4	4585	mdanderson.org	37	3	195505787	195505787	+	Missense_Mutation	SNP	C	C	T	rs11915935		TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr3:195505787C>T	ENST00000463781.3	-	2	13123	c.12664G>A	c.(12664-12666)Gcc>Acc	p.A4222T	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.A4222T|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	979					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGAGGGGTGGCGTGACCTGTG	0.587																																						.											0													27.0	28.0	27.0					3																	195505787		2081	4173	6254	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12664G>A	3.37:g.195505787C>T	ENSP00000417498:p.Ala4222Thr		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	c	9.614	1.132017	0.21041	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.35048	1.37;1.33	1.25	-1.78	0.07957	.	.	.	.	.	T	0.13030	0.0316	N	0.22421	0.69	0.09310	N	1	P	0.45986	0.87	B	0.24006	0.05	T	0.19160	-1.0314	8	.	.	.	.	2.6937	0.05128	0.3974:0.3581:0.2445:0.0	rs11915935	4094	E7ESK3	.	T	4222	ENSP00000417498:A4222T;ENSP00000420243:A4222T	.	A	-	1	0	MUC4	196990566	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.565000	0.05929	-0.465000	0.06953	0.487000	0.48397	GCC		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195505844	195505844	+	Missense_Mutation	SNP	T	T	A			TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr3:195505844T>A	ENST00000463781.3	-	2	13066	c.12607A>T	c.(12607-12609)Aca>Tca	p.T4203S	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.T4203S|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GCGTGACCTGTGGATGCTGAG	0.597																																						.											0																																										SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12607A>T	3.37:g.195505844T>A	ENSP00000417498:p.Thr4203Ser		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	t	2.633	-0.285914	0.05605	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.37058	1.22;1.29	.	.	.	.	.	.	.	.	T	0.35219	0.0924	N	0.19112	0.55	0.19945	N	0.99994	D	0.53151	0.958	P	0.60682	0.878	T	0.20107	-1.0285	6	.	.	.	.	.	.	.	.	4075	E7ESK3	.	S	4203	ENSP00000417498:T4203S;ENSP00000420243:T4203S	.	T	-	1	0	MUC4	196990623	0.982000	0.34865	0.016000	0.15963	0.044000	0.14063	3.144000	0.50616	0.380000	0.24823	0.063000	0.15292	ACA		0.597	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195505886	195505886	+	Missense_Mutation	SNP	C	C	G	rs373784830	byFrequency	TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr3:195505886C>G	ENST00000463781.3	-	2	13024	c.12565G>C	c.(12565-12567)Gac>Cac	p.D4189H	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.D4189H|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGGGTGGTGTCACCTGTGGAT	0.597													.|||	6	0.00119808	0.0008	0.0029	5008	,	,		10744	0.001		0.002	False		,,,				2504	0.0					.											0													23.0	16.0	18.0					3																	195505886		690	1580	2270	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12565G>C	3.37:g.195505886C>G	ENSP00000417498:p.Asp4189His		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	N	2.672	-0.277413	0.05679	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.32272	1.47;1.46	.	.	.	.	.	.	.	.	T	0.11495	0.0280	N	0.08118	0	0.09310	N	1	B	0.22683	0.073	B	0.23275	0.045	T	0.26326	-1.0106	7	.	.	.	.	5.4813	0.16725	1.0E-4:0.3482:0.6517:0.0	.	4061	E7ESK3	.	H	4189	ENSP00000417498:D4189H;ENSP00000420243:D4189H	.	D	-	1	0	MUC4	196990665	0.014000	0.17966	0.052000	0.19188	0.009000	0.06853	-2.385000	0.01062	-2.328000	0.00635	-2.337000	0.00247	GAC		0.597	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195509832	195509832	+	Silent	SNP	C	C	T	rs199909366	byFrequency	TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr3:195509832C>T	ENST00000463781.3	-	2	9078	c.8619G>A	c.(8617-8619)gtG>gtA	p.V2873V	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Silent_p.V2873V|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GACCTGTGGACACTGAGGAAG	0.592													.|||	100	0.0199681	0.0688	0.0043	5008	,	,		5179	0.002		0.002	False		,,,				2504	0.002					.											0													17.0	18.0	17.0					3																	195509832		665	1551	2216	SO:0001819	synonymous_variant	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8619G>A	3.37:g.195509832C>T			O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																				0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195509843	195509843	+	Missense_Mutation	SNP	C	C	T	rs200739317		TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr3:195509843C>T	ENST00000463781.3	-	2	9067	c.8608G>A	c.(8608-8610)Gct>Act	p.A2870T	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.A2870T|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACTGAGGAAGCGTCGGTGACA	0.597																																						.											0													24.0	21.0	22.0					3																	195509843		675	1566	2241	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8608G>A	3.37:g.195509843C>T	ENSP00000417498:p.Ala2870Thr		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	N	15.45	2.838365	0.51057	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.31769	1.48;1.48	.	.	.	.	.	.	.	.	T	0.28499	0.0705	N	0.14661	0.345	0.20821	N	0.999847	D	0.69078	0.997	D	0.65573	0.936	T	0.15925	-1.0420	7	.	.	.	.	4.8018	0.13301	0.3429:0.657:0.0:1.0E-4	.	2742	E7ESK3	.	T	2870	ENSP00000417498:A2870T;ENSP00000420243:A2870T	.	A	-	1	0	MUC4	196994622	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.830000	0.00355	-0.000000	0.14550	0.000000	0.15137	GCT		0.597	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195512483	195512483	+	Missense_Mutation	SNP	C	C	T	rs574315784	byFrequency	TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr3:195512483C>T	ENST00000463781.3	-	2	6427	c.5968G>A	c.(5968-5970)Gct>Act	p.A1990T	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.A1990T|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACTGAGGAAGCGTCGGTGACA	0.602																																						.											0													44.0	40.0	42.0					3																	195512483		691	1589	2280	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.5968G>A	3.37:g.195512483C>T	ENSP00000417498:p.Ala1990Thr		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	C	7.698	0.692446	0.15039	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.34667	1.35;1.38	.	.	.	.	.	.	.	.	T	0.13457	0.0326	N	0.19112	0.55	0.09310	N	1	P	0.45986	0.87	B	0.26310	0.068	T	0.18053	-1.0349	7	.	.	.	.	4.7077	0.12858	0.3536:0.6463:0.0:1.0E-4	.	1990	E7ESK3	.	T	1990	ENSP00000417498:A1990T;ENSP00000420243:A1990T	.	A	-	1	0	MUC4	196996878	0.951000	0.32395	0.001000	0.08648	0.169000	0.22640	-0.273000	0.08548	-0.833000	0.04245	0.064000	0.15345	GCT		0.602	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195513780	195513780	+	Silent	SNP	G	G	A			TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr3:195513780G>A	ENST00000463781.3	-	2	5130	c.4671C>T	c.(4669-4671)gaC>gaT	p.D1557D	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Silent_p.D1557D|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0	VWFD. {ECO:0000255|PROSITE- ProRule:PRU00580}.			V -> A (in Ref. 2; CAB81773/CAC14143/ CAC10061 and 3; AAM66747). {ECO:0000305}.	cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CTGAGGAAGCGTCGGTGACAG	0.577																																						.											0													11.0	9.0	10.0					3																	195513780		680	1557	2237	SO:0001819	synonymous_variant	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.4671C>T	3.37:g.195513780G>A			O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																				0.577	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
PIK3C3	5289	mdanderson.org;bcgsc.ca	37	18	39607490	39607490	+	Missense_Mutation	SNP	G	G	T			TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr18:39607490G>T	ENST00000262039.4	+	14	1654	c.1568G>T	c.(1567-1569)aGa>aTa	p.R523I	PIK3C3_ENST00000398870.3_Missense_Mutation_p.R460I|PIK3C3_ENST00000593098.1_Missense_Mutation_p.R8I	NM_002647.2	NP_002638.2	Q8NEB9	PK3C3_HUMAN	phosphatidylinositol 3-kinase, catalytic subunit type 3	523					autophagic vacuole assembly (GO:0000045)|cytokinesis (GO:0000910)|early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein processing (GO:0016485)|regulation of protein secretion (GO:0050708)|response to leucine (GO:0043201)|small molecule metabolic process (GO:0044281)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	axoneme (GO:0005930)|cytosol (GO:0005829)|late endosome (GO:0005770)|membrane (GO:0016020)|midbody (GO:0030496)|phagocytic vesicle (GO:0045335)|phosphatidylinositol 3-kinase complex (GO:0005942)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|protein kinase activity (GO:0004672)			breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(10)|liver(1)|lung(25)|ovary(1)|skin(2)|urinary_tract(1)	49						GTAATGAGAAGATTCAGCCAA	0.423										TSP Lung(28;0.18)																											NSCLC(37;552 1060 2683 16430 37914)	.											0													119.0	97.0	104.0					18																	39607490		2203	4300	6503	SO:0001583	missense	5289			Z46973	CCDS11920.1	18q12.3	2012-07-13	2012-07-13		ENSG00000078142	ENSG00000078142	2.7.1.137		8974	protein-coding gene	gene with protein product		602609	"""phosphoinositide-3-kinase, class 3"""			7628435	Standard	NM_002647		Approved	Vps34	uc002lap.3	Q8NEB9	OTTHUMG00000132593	ENST00000262039.4:c.1568G>T	18.37:g.39607490G>T	ENSP00000262039:p.Arg523Ile		Q15134	Missense_Mutation	SNP	ENST00000262039.4	37	CCDS11920.1	.	.	.	.	.	.	.	.	.	.	G	18.20	3.570993	0.65765	.	.	ENSG00000078142	ENST00000262039;ENST00000398870	T;T	0.66099	-0.19;0.2	5.73	5.73	0.89815	Phosphoinositide 3-kinase, accessory (PIK) domain (1);	0.166870	0.52532	D	0.000076	T	0.64114	0.2569	M	0.64567	1.98	0.80722	D	1	B;B	0.26547	0.152;0.039	B;B	0.32928	0.155;0.065	T	0.58853	-0.7563	9	.	.	.	.	18.1556	0.89689	0.0:0.0:1.0:0.0	.	460;523	A8MYT4;Q8NEB9	.;PK3C3_HUMAN	I	523;460	ENSP00000262039:R523I;ENSP00000381845:R460I	.	R	+	2	0	PIK3C3	37861488	1.000000	0.71417	1.000000	0.80357	0.817000	0.46193	9.723000	0.98772	2.724000	0.93272	0.586000	0.80456	AGA		0.423	PIK3C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255804.1	NM_002647	
PRSS1	5644	mdanderson.org	37	7	142460779	142460779	+	Missense_Mutation	SNP	G	G	T	rs574391339		TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr7:142460779G>T	ENST00000311737.7	+	5	658	c.652G>T	c.(652-654)Gat>Tat	p.D218Y	PRSS1_ENST00000486171.1_Missense_Mutation_p.D232Y	NM_002769.4	NP_002760.1	P07477	TRY1_HUMAN	protease, serine, 1 (trypsin 1)	218	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(24)|prostate(2)	38	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)		Aprotinin(DB06692)	CTCCTGGGGTGATGGCTGTGC	0.522													g|||	1	0.000199681	0.0	0.0	5008	,	,		16476	0.001		0.0	False		,,,				2504	0.0					.											0													81.0	82.0	82.0					7																	142460779		2203	4300	6503	SO:0001583	missense	5644			M22612	CCDS5872.1	7q34	2012-10-02			ENSG00000204983	ENSG00000204983	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9475	protein-coding gene	gene with protein product		276000		TRY1			Standard	NM_002769		Approved		uc003wak.2	P07477	OTTHUMG00000158923	ENST00000311737.7:c.652G>T	7.37:g.142460779G>T	ENSP00000308720:p.Asp218Tyr		A1A509|A6NJ71|B2R5I5|Q5NV57|Q7M4N3|Q7M4N4|Q92955|Q9HAN4|Q9HAN5|Q9HAN6|Q9HAN7	Missense_Mutation	SNP	ENST00000311737.7	37	CCDS5872.1	.	.	.	.	.	.	.	.	.	.	g	0.001	-3.097197	0.00034	.	.	ENSG00000204983	ENST00000486171;ENST00000311737;ENST00000529243	D;D	0.88896	-2.44;-2.44	3.18	1.99	0.26369	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.434585	0.27223	N	0.020352	T	0.65417	0.2689	N	0.02765	-0.5	0.24198	N	0.995522	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.56444	-0.7978	10	0.02654	T	1	.	4.1291	0.10141	0.3145:0.0:0.1737:0.5118	.	232;218	E7EQ64;P07477	.;TRY1_HUMAN	Y	232;218;208	ENSP00000417854:D232Y;ENSP00000308720:D218Y	ENSP00000308720:D218Y	D	+	1	0	PRSS1	142140353	0.000000	0.05858	0.995000	0.50966	0.013000	0.08279	0.233000	0.17911	0.385000	0.24970	-1.375000	0.01183	GAT		0.522	PRSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352538.2		
SIRPB1	10326	mdanderson.org	37	20	1592120	1592120	+	Intron	SNP	G	G	T	rs1135201		TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr20:1592120G>T	ENST00000381605.4	-	1	141				SIRPB1_ENST00000279477.7_Missense_Mutation_p.R106S|RP4-576H24.4_ENST00000564763.1_Intron|SIRPB1_ENST00000381596.1_5'UTR|SIRPB1_ENST00000568365.1_Missense_Mutation_p.R106S|SIRPB1_ENST00000381603.3_Intron	NM_006065.3	NP_006056.2	O00241	SIRB1_HUMAN	signal-regulatory protein beta 1						cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				central_nervous_system(2)|kidney(2)|large_intestine(4)|lung(16)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	31						TTACTGATGCGGATGGAAAAG	0.512																																						.											0													105.0	121.0	117.0					20																	1592120		448	1337	1785	SO:0001627	intron_variant	10326			Y10376	CCDS13019.1, CCDS42850.1, CCDS46571.1	20p13	2013-01-11			ENSG00000101307	ENSG00000101307		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	15928	protein-coding gene	gene with protein product		603889				9062191, 16339511	Standard	NM_001083910		Approved	SIRP-BETA-1, CD172b	uc010gai.3	O00241	OTTHUMG00000031676	ENST00000381605.4:c.76+8394C>A	20.37:g.1592120G>T			A6NLM2|B2R8V0|Q5TFQ9|Q5TFR0|Q8TB12|Q9H1U5|Q9Y4V0	Missense_Mutation	SNP	ENST00000381605.4	37	CCDS13019.1	560	0.2564102564102564	150	0.3048780487804878	74	0.20441988950276244	183	0.31993006993006995	153	0.20184696569920843	.	2.402	-0.337253	0.05278	.	.	ENSG00000101307	ENST00000279477;ENST00000381596	T	0.65364	-0.15	2.65	-2.79	0.05841	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.00012	0.0000	L	0.52266	1.64	0.34870	D	0.743495	B	0.31435	0.323	B	0.31869	0.137	T	0.37753	-0.9692	9	0.37606	T	0.19	.	4.2858	0.10855	0.1304:0.0:0.2968:0.5727	rs1135201;rs3197735	106	Q5TFQ8	SIRBL_HUMAN	S	106	ENSP00000279477:R106S	ENSP00000279477:R106S	R	-	1	0	SIRPB1	1540120	0.081000	0.21417	0.142000	0.22268	0.020000	0.10135	0.000000	0.12993	-0.294000	0.08973	-2.062000	0.00397	CGC		0.512	SIRPB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077555.2	NM_006065	
SIRT6	51548	mdanderson.org	37	19	4174859	4174859	+	Missense_Mutation	SNP	C	C	T	rs74317014	byFrequency	TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr19:4174859C>T	ENST00000337491.2	-	8	887	c.823G>A	c.(823-825)Gcc>Acc	p.A275T	SIRT6_ENST00000381935.3_Missense_Mutation_p.A203T|SIRT6_ENST00000594279.1_3'UTR|SIRT6_ENST00000305232.6_Missense_Mutation_p.A248T|SIRT6_ENST00000601488.1_3'UTR	NM_016539.2	NP_057623.2	Q8N6T7	SIR6_HUMAN	sirtuin 6	275					histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|protein ADP-ribosylation (GO:0006471)|regulation of double-strand break repair via homologous recombination (GO:0010569)	nuclear telomeric heterochromatin (GO:0005724)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|NAD(P)+-protein-arginine ADP-ribosyltransferase activity (GO:0003956)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|NAD+ binding (GO:0070403)|NAD-dependent histone deacetylase activity (GO:0017136)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(1)|lung(4)|ovary(1)|skin(1)	8		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.023)|STAD - Stomach adenocarcinoma(1328;0.18)		CCGTCCCAGGCGGGGATCTCC	0.697													C|||	70	0.0139776	0.0492	0.0072	5008	,	,		6715	0.0		0.0	False		,,,				2504	0.0					.											0								C	THR/ALA,THR/ALA	133,4099		1,131,1984	15.0	13.0	14.0		742,823	-0.8	0.7	19	dbSNP_131	14	2,8254		0,2,4126	yes	missense,missense	SIRT6	NM_001193285.1,NM_016539.2	58,58	1,133,6110	TT,TC,CC		0.0242,3.1427,1.081	benign,benign	248/329,275/356	4174859	135,12353	2116	4128	6244	SO:0001583	missense	51548			AF233396	CCDS12122.1, CCDS54199.1	19p13.3	2010-06-25	2010-06-25			ENSG00000077463			14934	protein-coding gene	gene with protein product		606211	"""sirtuin (silent mating type information regulation 2, S. cerevisiae, homolog) 6"", ""sirtuin (silent mating type information regulation 2 homolog) 6 (S. cerevisiae)"""			10873683	Standard	NM_016539		Approved		uc002lzo.3	Q8N6T7		ENST00000337491.2:c.823G>A	19.37:g.4174859C>T	ENSP00000337332:p.Ala275Thr		B2RCD0|O75291|Q6IAF5|Q6PK99|Q8NCD2|Q9BSI5|Q9BWP3|Q9NRC7|Q9UQD1	Missense_Mutation	SNP	ENST00000337491.2	37	CCDS12122.1	26	0.011904761904761904	24	0.04878048780487805	2	0.0055248618784530384	0	0.0	0	0.0	C	10.99	1.507377	0.27036	0.031427	2.42E-4	ENSG00000077463	ENST00000337491;ENST00000305232;ENST00000381935	T;T;T	0.16897	2.31;2.31;2.31	4.28	-0.788	0.10939	.	0.510295	0.21114	N	0.079938	T	0.01092	0.0036	N	0.17723	0.515	0.26940	N	0.966267	B;B	0.09022	0.002;0.001	B;B	0.06405	0.002;0.001	T	0.34775	-0.9815	10	0.18276	T	0.48	-23.0487	5.7039	0.17897	0.0:0.6019:0.1408:0.2573	.	248;275	Q8N6T7-2;Q8N6T7	.;SIRT6_HUMAN	T	275;248;203	ENSP00000337332:A275T;ENSP00000305310:A248T;ENSP00000371360:A203T	ENSP00000305310:A248T	A	-	1	0	SIRT6	4125859	0.000000	0.05858	0.749000	0.31150	0.888000	0.51559	-0.184000	0.09698	-0.344000	0.08338	0.462000	0.41574	GCC		0.697	SIRT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457931.2		
TSEN54	283989	mdanderson.org	37	17	73518328	73518328	+	Missense_Mutation	SNP	A	A	C	rs77247739	byFrequency	TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr17:73518328A>C	ENST00000333213.6	+	8	1202	c.1166A>C	c.(1165-1167)cAg>cCg	p.Q389P		NM_207346.2	NP_997229.2	Q7Z6J9	SEN54_HUMAN	TSEN54 tRNA splicing endonuclease subunit	389					mRNA processing (GO:0006397)|tRNA splicing, via endonucleolytic cleavage and ligation (GO:0006388)	nucleus (GO:0005634)				endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(5)|ovary(2)	13	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;4.57e-07)|Epithelial(20;2.92e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			CAGCGGCGGCAGGTGCAGAGG	0.716													A|||	354	0.0706869	0.0976	0.0648	5008	,	,		13683	0.0		0.0984	False		,,,				2504	0.0828					.											0								A	PRO/GLN	290,3664		11,268,1698	5.0	5.0	5.0		1166	-0.1	0.0	17	dbSNP_131	5	522,7188		9,504,3342	no	missense	TSEN54	NM_207346.2	76	20,772,5040	CC,CA,AA		6.7704,7.3343,6.9616	benign	389/527	73518328	812,10852	1977	3855	5832	SO:0001583	missense	283989			AK097583	CCDS11724.1	17q25.1	2013-08-06	2013-08-06		ENSG00000182173	ENSG00000182173		"""tRNA splicing endonuclease subunits"""	27561	protein-coding gene	gene with protein product		608755	"""tRNA splicing endonuclease 54 homolog (SEN54, S. cerevisiae)"", ""tRNA splicing endonuclease 54 homolog (S. cerevisiae)"""			15109492	Standard	NM_207346		Approved	SEN54, SEN54L	uc002jof.1	Q7Z6J9		ENST00000333213.6:c.1166A>C	17.37:g.73518328A>C	ENSP00000327487:p.Gln389Pro		Q86WV3|Q86XE4|Q8N9H2	Missense_Mutation	SNP	ENST00000333213.6	37	CCDS11724.1	162	0.07417582417582418	55	0.11178861788617886	36	0.09944751381215469	0	0.0	71	0.09366754617414248	A	3.847	-0.032674	0.07543	0.073343	0.067704	ENSG00000182173	ENST00000333213	T	0.58060	0.36	5.47	-0.0634	0.13777	.	0.913377	0.09679	N	0.770042	T	0.00936	0.0031	L	0.43152	1.355	0.80722	P	0.0	B	0.25609	0.13	B	0.22601	0.04	T	0.12528	-1.0544	9	0.33141	T	0.24	-2.0841	9.9457	0.41607	0.3984:0.0:0.6016:0.0	.	389	Q7Z6J9	SEN54_HUMAN	P	389	ENSP00000327487:Q389P	ENSP00000327487:Q389P	Q	+	2	0	TSEN54	71029923	0.000000	0.05858	0.004000	0.12327	0.007000	0.05969	0.306000	0.19279	0.036000	0.15547	0.533000	0.62120	CAG		0.716	TSEN54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447618.1	NM_207346	
TTC16	158248	mdanderson.org	37	9	130487157	130487157	+	Missense_Mutation	SNP	T	T	G	rs77630455	byFrequency	TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr9:130487157T>G	ENST00000373289.3	+	9	1320	c.1240T>G	c.(1240-1242)Ttc>Gtc	p.F414V	TTC16_ENST00000489226.1_Intron|PTRH1_ENST00000429848.1_5'Flank|TTC16_ENST00000393748.4_3'UTR|PTRH1_ENST00000419060.1_5'Flank	NM_144965.1	NP_659402.1	Q8NEE8	TTC16_HUMAN	tetratricopeptide repeat domain 16	414										central_nervous_system(2)|endometrium(3)|lung(7)|ovary(3)|pancreas(2)|prostate(4)|skin(1)	22						GAAGATGGGCTTCTGCGAGCA	0.726													T|||	33	0.00658946	0.0234	0.0029	5008	,	,		12083	0.0		0.0	False		,,,				2504	0.0					.											0								T	VAL/PHE	100,4252		2,96,2078	8.0	9.0	8.0		1240	1.0	0.0	9	dbSNP_131	8	0,8550		0,0,4275	yes	missense	TTC16	NM_144965.1	50	2,96,6353	GG,GT,TT		0.0,2.2978,0.7751	benign	414/874	130487157	100,12802	2176	4275	6451	SO:0001583	missense	158248			AK057342	CCDS6875.1	9q34.13	2013-01-10			ENSG00000167094	ENSG00000167094		"""Tetratricopeptide (TTC) repeat domain containing"""	26536	protein-coding gene	gene with protein product						12477932	Standard	NM_144965		Approved	FLJ32780	uc004brq.1	Q8NEE8	OTTHUMG00000020711	ENST00000373289.3:c.1240T>G	9.37:g.130487157T>G	ENSP00000362386:p.Phe414Val		B4DYG4|B5ME24|Q5JU66|Q96M72	Missense_Mutation	SNP	ENST00000373289.3	37	CCDS6875.1	9	0.004120879120879121	8	0.016260162601626018	1	0.0027624309392265192	0	0.0	0	0.0	T	10.99	1.506864	0.26949	0.022978	0.0	ENSG00000167094	ENST00000373289	T	0.62498	0.02	4.86	1.03	0.20045	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.802502	0.11065	N	0.603527	T	0.26122	0.0637	L	0.27053	0.805	0.19300	N	0.99998	P;P	0.45176	0.852;0.852	B;B	0.39217	0.294;0.294	T	0.12016	-1.0564	10	0.38643	T	0.18	-5.8329	4.0479	0.09781	0.0:0.3269:0.182:0.4912	.	401;414	B4DZ42;Q8NEE8	.;TTC16_HUMAN	V	414	ENSP00000362386:F414V	ENSP00000362386:F414V	F	+	1	0	TTC16	129526978	0.000000	0.05858	0.010000	0.14722	0.018000	0.09664	-0.338000	0.07842	0.211000	0.20683	0.260000	0.18958	TTC		0.726	TTC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054224.1	NM_144965	
TUBB8	347688	mdanderson.org	37	10	94006	94006	+	Missense_Mutation	SNP	C	C	T	rs368995010		TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr10:94006C>T	ENST00000309812.4	-	4	388	c.326G>A	c.(325-327)gGc>gAc	p.G109D	TUBB8_ENST00000447903.2_Missense_Mutation_p.G37D|TUBB8_ENST00000413237.3_5'UTR|TUBB8_ENST00000332708.5_Missense_Mutation_p.A73T	NM_177987.2	NP_817124.1	Q3ZCM7	TBB8_HUMAN	tubulin, beta 8 class VIII	109					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(12)|ovary(2)|prostate(3)|skin(3)|stomach(1)	32		all_cancers(4;0.00131)|all_lung(4;0.000777)|Lung NSC(4;0.0043)|all_epithelial(10;0.0154)|Colorectal(49;0.235)		Epithelial(11;0.00341)|all cancers(11;0.00922)|OV - Ovarian serous cystadenocarcinoma(14;0.0508)|Lung(33;0.132)		CAGCTCCGCGCCTTCGGTGTA	0.607																																					Pancreas(192;2041 3010 9013 18103)	.											0													73.0	62.0	66.0					10																	94006		2203	4300	6503	SO:0001583	missense	347688			AF355127	CCDS7051.1	10p15.3	2014-05-06			ENSG00000173876			"""Tubulins"""	20773	protein-coding gene	gene with protein product	"""class VIII beta-tubulin"""						Standard	NM_177987		Approved	bA631M21.2	uc001ifi.2	Q3ZCM7	OTTHUMG00000174803	ENST00000309812.4:c.326G>A	10.37:g.94006C>T	ENSP00000311042:p.Gly109Asp		Q5SQX9|Q8WZ78	Missense_Mutation	SNP	ENST00000309812.4	37	CCDS7051.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.54|12.54	1.968692|1.968692	0.34754|0.34754	.|.	.|.	ENSG00000173876|ENSG00000173876	ENST00000309812;ENST00000332708|ENST00000447903;ENST00000272035;ENST00000440680;ENST00000328974	.|T	.|0.75704	.|-0.96	.|.	.|.	.|.	.|Tubulin/FtsZ, GTPase domain (4);	.|0.000000	.|0.64402	.|U	.|0.000010	D|D	0.90594|0.90594	0.7051|0.7051	H|H	0.99777|0.99777	4.77|4.77	0.39819|0.39819	D|D	0.972819|0.972819	.|D;D	.|0.89917	.|0.997;1.0	.|D;D	.|0.97110	.|0.982;1.0	D|D	0.86775|0.86775	0.1975|0.1975	5|9	0.87932|0.87932	D|D	0|0	.|.	5.9051|5.9051	0.18992|0.18992	0.0:0.9992:0.0:8.0E-4|0.0:0.9992:0.0:8.0E-4	.|.	.|72;109	.|C9JAA5;Q3ZCM7	.|.;TBB8_HUMAN	T|D	117;73|37;75;72;109	.|ENSP00000403895:G37D	ENSP00000311042:A117T|ENSP00000272035:G75D	A|G	-|-	1|2	0|0	RP11-631M21.2|RP11-631M21.2	84006|84006	0.998000|0.998000	0.40836|0.40836	0.282000|0.282000	0.24776|0.24776	0.286000|0.286000	0.27126|0.27126	5.268000|5.268000	0.65536|0.65536	0.119000|0.119000	0.18210|0.18210	0.121000|0.121000	0.15741|0.15741	GCG|GGC		0.607	TUBB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467795.1	NM_177987	
ZNF658	26149	mdanderson.org	37	9	40775035	40775035	+	Splice_Site	SNP	C	C	T	rs62561230	byFrequency	TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr9:40775035C>T	ENST00000602553.1	-	5	534	c.240G>A	c.(238-240)ggG>ggA	p.G80G	ZNF658_ENST00000377626.3_Splice_Site_p.G80G|ZNF658_ENST00000441795.1_Splice_Site_p.G78G			Q5TYW1	ZN658_HUMAN	zinc finger protein 658	80					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(9)|lung(21)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	46				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		CTTTAAAATACCCTAAAATGA	0.299													T|||	3162	0.63139	0.6687	0.7046	5008	,	,		6646	0.748		0.6451	False		,,,				2504	0.3947					.											0													15.0	18.0	17.0					9																	40775035		714	1718	2432	SO:0001630	splice_region_variant	26149			AA482262	CCDS75846.1	9p13.1	2013-01-08			ENSG00000196409	ENSG00000274349		"""Zinc fingers, C2H2-type"", ""-"""	25226	protein-coding gene	gene with protein product							Standard	NM_033160		Approved	MGC35232, DKFZp572C163, FLJ32813	uc004abs.2	Q5TYW1	OTTHUMG00000013392	ENST00000602553.1:c.239-1G>A	9.37:g.40775035C>T			Q6PIP3|Q96M55|Q9H9S6|Q9UG02	Silent	SNP	ENST00000602553.1	37	CCDS35023.1																																																																																				0.299	ZNF658-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467800.1	NM_033160	Silent
VWA5B1	127731	bcgsc.ca	37	1	20680718	20680718	+	Missense_Mutation	SNP	G	G	A	rs2072751	byFrequency	TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr1:20680718G>A	ENST00000375079.2	+	22	3821	c.3625G>A	c.(3625-3627)Gag>Aag	p.E1209K	VWA5B1_ENST00000289815.8_Missense_Mutation_p.E1178K	NM_001039500.2	NP_001034589.2	Q5TIE3	VW5B1_HUMAN	von Willebrand factor A domain containing 5B1	1209						extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(3)|kidney(1)|prostate(1)|skin(1)	7						TGAGAATCTCGAGTTCAATAT	0.607													G|||	1149	0.229433	0.208	0.1801	5008	,	,		17189	0.2887		0.2237	False		,,,				2504	0.2382					.											0													7.0	11.0	10.0					1																	20680718		690	1588	2278	SO:0001583	missense	127731			AK125833, AK057346		1p36.12	2014-02-12			ENSG00000158816	ENSG00000158816			26538	protein-coding gene	gene with protein product							Standard	NM_001039500		Approved	FLJ32784	uc009vps.2	Q5TIE3	OTTHUMG00000002835	ENST00000375079.2:c.3625G>A	1.37:g.20680718G>A	ENSP00000364220:p.Glu1209Lys		A4IF35|A4IF36|Q3ZCM4|Q6ZUB4|Q96M71	Missense_Mutation	SNP	ENST00000375079.2	37		507	0.23214285714285715	84	0.17073170731707318	75	0.20718232044198895	189	0.3304195804195804	159	0.20976253298153033	G	9.915	1.210621	0.22289	.	.	ENSG00000158816	ENST00000375089;ENST00000289815;ENST00000375079	T;T	0.33438	1.41;1.41	5.58	4.67	0.58626	.	0.128661	0.53938	N	0.000059	T	0.00012	0.0000	N	0.20685	0.6	0.09310	P	0.9999999999999991	P;B;D	0.65815	0.94;0.016;0.995	B;B;P	0.49332	0.187;0.016;0.607	T	0.44003	-0.9356	9	0.22706	T	0.39	-6.2611	11.7748	0.51979	0.0726:0.1247:0.8026:0.0	rs2072751;rs59623880;rs2072751	1209;1179;1204	Q5TIE3;Q5TIE3-5;Q5TIE3-2	VW5B1_HUMAN;.;.	K	1209;1178;1209	ENSP00000289815:E1178K;ENSP00000364220:E1209K	ENSP00000289815:E1178K	E	+	1	0	VWA5B1	20553305	1.000000	0.71417	0.892000	0.35008	0.362000	0.29581	4.651000	0.61447	0.737000	0.32582	-1.688000	0.00730	GAG		0.607	VWA5B1-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000007945.4	XM_001722222	
DZIP1	22873	bcgsc.ca	37	13	96293631	96293631	+	Missense_Mutation	SNP	G	G	A	rs9561921	byFrequency	TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr13:96293631G>A	ENST00000376829.2	-	5	1366	c.515C>T	c.(514-516)aCg>aTg	p.T172M	DZIP1_ENST00000361156.3_Missense_Mutation_p.T172M|DZIP1_ENST00000466027.1_5'UTR|DZIP1_ENST00000361396.2_Missense_Mutation_p.T172M|DZIP1_ENST00000347108.3_Missense_Mutation_p.T172M	NM_198968.3	NP_945319.1	Q86YF9	DZIP1_HUMAN	DAZ interacting zinc finger protein 1	172			T -> M (in dbSNP:rs9561921).		cilium assembly (GO:0042384)|germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(20)|lung(11)|ovary(2)|pancreas(1)|skin(1)|stomach(1)	38	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.141)			TTCCTTGAGCGTCTTGATCTC	0.602													G|||	493	0.0984425	0.112	0.0922	5008	,	,		16754	0.1716		0.0656	False		,,,				2504	0.0429					.											0								G	MET/THR,MET/THR	475,3931	223.9+/-240.3	30,415,1758	112.0	71.0	85.0		515,515	3.5	0.1	13	dbSNP_119	85	758,7842	181.3+/-230.0	34,690,3576	yes	missense,missense	DZIP1	NM_014934.3,NM_198968.2	81,81	64,1105,5334	AA,AG,GG		8.814,10.7808,9.4802	benign,benign	172/849,172/868	96293631	1233,11773	2203	4300	6503	SO:0001583	missense	22873			AB023213	CCDS9477.1, CCDS9478.1	13q32.1	2013-05-22	2013-05-22		ENSG00000134874	ENSG00000134874		"""Zinc fingers, C2H2-type"""	20908	protein-coding gene	gene with protein product		608671	"""DAZ interacting protein 1"""				Standard	NM_014934		Approved	KIAA0996, DZIP	uc001vmk.4	Q86YF9	OTTHUMG00000017224	ENST00000376829.2:c.515C>T	13.37:g.96293631G>A	ENSP00000366025:p.Thr172Met		Q5W078|Q5W079|Q8WY45|Q8WY46|Q9UGA5|Q9Y2K0	Missense_Mutation	SNP	ENST00000376829.2	37	CCDS9478.1	265	0.12133699633699634	68	0.13821138211382114	43	0.11878453038674033	102	0.17832167832167833	52	0.06860158311345646	G	1.494	-0.553964	0.03996	0.107808	0.08814	ENSG00000134874	ENST00000347108;ENST00000361156;ENST00000361396;ENST00000376829	T;T;T;T	0.42513	0.97;0.97;0.97;0.97	4.68	3.49	0.39957	.	1.685550	0.02965	N	0.143627	T	0.00039	0.0001	N	0.02011	-0.69	0.80722	P	0.0	B;B	0.06786	0.001;0.001	B;B	0.01281	0.0;0.0	T	0.09840	-1.0656	9	0.39692	T	0.17	-7.0E-4	4.2879	0.10863	0.5511:0.1859:0.263:0.0	rs9561921;rs57792076;rs9561921	172;172	Q86YF9-2;Q86YF9	.;DZIP1_HUMAN	M	172	ENSP00000257312:T172M;ENSP00000355018:T172M;ENSP00000355175:T172M;ENSP00000366025:T172M	ENSP00000257312:T172M	T	-	2	0	DZIP1	95091632	0.000000	0.05858	0.139000	0.22197	0.002000	0.02628	0.646000	0.24797	0.661000	0.30985	-0.238000	0.12139	ACG		0.602	DZIP1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045496.3	NM_014934	
CES5A	221223	bcgsc.ca	37	16	55883563	55883563	+	Missense_Mutation	SNP	A	A	G			TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr16:55883563A>G	ENST00000290567.9	-	11	1517	c.1396T>C	c.(1396-1398)Ttc>Ctc	p.F466L	CES5A_ENST00000521992.1_Missense_Mutation_p.F495L|CES5A_ENST00000319165.9_Intron|CES5A_ENST00000541580.1_5'UTR|CES5A_ENST00000520435.1_Missense_Mutation_p.F436L|CES5A_ENST00000518005.1_Missense_Mutation_p.F360L	NM_001143685.1	NP_001137157.1	Q6NT32	EST5A_HUMAN	carboxylesterase 5A	466						extracellular region (GO:0005576)	carboxylic ester hydrolase activity (GO:0052689)			breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(13)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	39						CCCTTCAGGAAGGCACCACCG	0.552																																						.											0													190.0	164.0	172.0					16																	55883563		1568	3582	5150	SO:0001583	missense	221223			AK090997	CCDS10755.1, CCDS45490.1, CCDS54012.1	16q13	2010-10-12	2010-10-12	2010-10-12	ENSG00000159398	ENSG00000159398	3.1.1.1	"""Carboxylesterases"""	26459	protein-coding gene	gene with protein product			"""carboxylesterase 7"""	CES7		20931200	Standard	NM_145024		Approved	FLJ31547, CES4C1, CES5, CAUXIN	uc021tir.1	Q6NT32	OTTHUMG00000133236	ENST00000290567.9:c.1396T>C	16.37:g.55883563A>G	ENSP00000290567:p.Phe466Leu		B7Z252|B7ZLB6|Q8NBC8|Q96DN9	Missense_Mutation	SNP	ENST00000290567.9	37	CCDS45490.1	.	.	.	.	.	.	.	.	.	.	.	15.06	2.721874	0.48728	.	.	ENSG00000159398	ENST00000521992;ENST00000518005;ENST00000290567;ENST00000520435;ENST00000541580	T;T;T;T	0.64991	-0.13;-0.13;-0.13;-0.13	5.16	4.07	0.47477	Carboxylesterase, type B (1);	0.594901	0.15246	N	0.272633	T	0.46171	0.1379	N	0.25380	0.74	0.39277	D	0.964483	B	0.19331	0.035	B	0.26202	0.067	T	0.24584	-1.0156	10	0.10111	T	0.7	.	9.7766	0.40623	0.9157:0.0:0.0843:0.0	.	466	Q6NT32	EST5A_HUMAN	L	495;360;466;436;246	ENSP00000428864:F495L;ENSP00000428571:F360L;ENSP00000290567:F466L;ENSP00000428887:F436L	ENSP00000290567:F466L	F	-	1	0	CES5A	54441064	0.999000	0.42202	1.000000	0.80357	0.950000	0.60333	0.852000	0.27764	1.046000	0.40249	-0.274000	0.10170	TTC		0.552	CES5A-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000256975.3	NM_145024	
DNAH17	8632	bcgsc.ca	37	17	76455172	76455172	+	Missense_Mutation	SNP	C	C	T			TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr17:76455172C>T	ENST00000585328.1	-	61	9881	c.9757G>A	c.(9757-9759)Gtg>Atg	p.V3253M	DNAH17_ENST00000586052.1_5'UTR|DNAH17_ENST00000389840.5_Missense_Mutation_p.V3244M	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	3244	Stalk. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			TTGGGCGCCACGTCGCAGTAG	0.612																																						.											0													142.0	140.0	141.0					17																	76455172		2203	4300	6503	SO:0001583	missense	8632			AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.9757G>A	17.37:g.76455172C>T	ENSP00000465516:p.Val3253Met		O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Missense_Mutation	SNP	ENST00000585328.1	37		.	.	.	.	.	.	.	.	.	.	C	25.0	4.597316	0.87055	.	.	ENSG00000187775	ENST00000300671;ENST00000389840	T	0.80566	-1.39	5.35	5.35	0.76521	.	0.221905	0.31612	N	0.007342	D	0.94430	0.8208	H	0.99042	4.41	0.38273	D	0.942201	D	0.89917	1.0	D	0.97110	1.0	D	0.97749	1.0213	10	0.87932	D	0	.	18.6873	0.91570	0.0:1.0:0.0:0.0	.	3253	E7EUM8	.	M	3253;3244	ENSP00000374490:V3244M	ENSP00000300671:V3253M	V	-	1	0	DNAH17	73966767	1.000000	0.71417	0.999000	0.59377	0.967000	0.64934	7.254000	0.78329	2.491000	0.84063	0.655000	0.94253	GTG		0.612	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000318962.2	NM_173628	
ANKRD30BL	554226	bcgsc.ca	37	2	132905706	132905706	+	Nonstop_Mutation	SNP	A	A	G	rs142209162		TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr2:132905706A>G	ENST00000409867.1	-	6	1024	c.775T>C	c.(775-777)Tag>Cag	p.*259Q	ANKRD30BL_ENST00000470729.1_5'UTR			A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like	0										endometrium(1)|kidney(3)	4						ACTGTATCCTATTCATCAGGT	0.438																																						.											0																																										SO:0001578	stop_lost	554226					2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000409867.1:c.775T>C	2.37:g.132905706A>G	ENSP00000386398:p.*259Gluext*29		B8ZZL7	RNA	SNP	ENST00000409867.1	37		.	.	.	.	.	.	.	.	.	.	.	0.034	-1.317389	0.01331	.	.	ENSG00000163046	ENST00000409867	.	.	.	0.109	0.109	0.14578	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	Q	259	.	.	X	-	1	0	ANKRD30BL	132622176	0.072000	0.21174	0.103000	0.21229	0.104000	0.19210	0.225000	0.17757	0.156000	0.19299	0.155000	0.16302	TAG		0.438	ANKRD30BL-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331353.2	NR_027019	
FAM182A	284800	bcgsc.ca	37	20	26061967	26061967	+	RNA	SNP	G	G	T	rs200610416	byFrequency	TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr20:26061967G>T	ENST00000376398.2	+	0	987					NR_026713.1		Q5T1J6	F182A_HUMAN	family with sequence similarity 182, member A											breast(1)|endometrium(2)|kidney(1)	4						GCCTCAGTCGGCATCGCAGCT	0.587																																						.											0													20.0	17.0	18.0					20																	26061967		692	1571	2263			284800			AL391119		20p11	2013-03-18	2008-08-05	2008-08-05	ENSG00000125804	ENSG00000125804			16222	other	unknown			"""chromosome 20 open reading frame 91"""	C20orf91			Standard	NR_026713		Approved	bB329D4.1, C20orf91A	uc010gdq.3	Q5T1J6	OTTHUMG00000032144		20.37:g.26061967G>T			A2RRD0|Q8N947	RNA	SNP	ENST00000376398.2	37		.	.	.	.	.	.	.	.	.	.	N	7.925	0.739464	0.15642	.	.	ENSG00000125804	ENST00000376398;ENST00000246000;ENST00000415411	.	.	.	.	.	.	.	.	.	.	.	T	0.39172	0.1068	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.38779	-0.9645	3	0.87932	D	0	.	.	.	.	.	.	.	.	S	107;107;48	.	ENSP00000246000:A107S	A	+	1	0	FAM182A	26009967	0.049000	0.20398	0.112000	0.21494	0.114000	0.19823	1.160000	0.31761	0.121000	0.18284	0.123000	0.15791	GCA		0.587	FAM182A-001	KNOWN	basic	lincRNA	processed_transcript	OTTHUMT00000078473.2		
MRPS12	6183	bcgsc.ca	37	19	39423174	39423175	+	Frame_Shift_Ins	INS	-	-	GGCTCAGCACTGGCCGCGA	rs35977895	byFrequency	TCGA-KM-8440-01A-11D-2310-10	TCGA-KM-8440-10A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cdf313c8-59f9-41c6-9bd2-f47cb4287da5	f6d8bf61-9da3-4ce4-b6cc-e1391c0c0186	g.chr19:39423174_39423175insGGCTCAGCACTGGCCGCGA	ENST00000407800.2	+	2	592_593	c.251_252insGGCTCAGCACTGGCCGCGA	c.(250-255)cggctcfs	p.L85fs	CTC-360G5.9_ENST00000599320.1_lincRNA|SARS2_ENST00000594171.1_5'Flank|MRPS12_ENST00000402029.3_Frame_Shift_Ins_p.L85fs|SARS2_ENST00000430193.3_5'Flank|SARS2_ENST00000600042.1_5'Flank|SARS2_ENST00000221431.6_5'Flank|CTC-360G5.8_ENST00000599996.1_Intron|MRPS12_ENST00000308018.4_Frame_Shift_Ins_p.L85fs|SARS2_ENST00000448145.2_Intron	NM_021107.1	NP_066930.1	O15235	RT12_HUMAN	mitochondrial ribosomal protein S12	85					translation (GO:0006412)	mitochondrial ribosome (GO:0005761)|small ribosomal subunit (GO:0015935)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			endometrium(1)|large_intestine(1)	2	all_cancers(60;8.37e-07)|all_lung(34;3.71e-07)|Lung NSC(34;4.17e-07)|all_epithelial(25;1.13e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			TGTCGAGTGCGGCTCAGCACTG	0.663																																						.											0																																										SO:0001589	frameshift_variant	6183			Y11681	CCDS12525.1	19q13.1-q13.2	2012-09-13			ENSG00000128626	ENSG00000128626		"""Mitochondrial ribosomal proteins / small subunits"""	10380	protein-coding gene	gene with protein product		603021		RPMS12		9545647, 9790755	Standard	NM_021107		Approved	RPS12, RPSM12	uc002oke.3	O15235		Exception_encountered	19.37:g.39423174_39423175insGGCTCAGCACTGGCCGCGA	ENSP00000384952:p.Leu85fs		Q53X98	Frame_Shift_Ins	INS	ENST00000407800.2	37	CCDS12525.1																																																																																				0.663	MRPS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463154.1		
