#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
RERE	473	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	8422892	8422892	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr1:8422892G>T	ENST00000337907.3	-	17	2387	c.1753C>A	c.(1753-1755)Cgc>Agc	p.R585S	RERE_ENST00000476556.1_Missense_Mutation_p.R31S|RERE_ENST00000400907.2_Intron|RERE_ENST00000400908.2_Missense_Mutation_p.R585S|RERE_ENST00000377464.1_Missense_Mutation_p.R317S	NM_012102.3	NP_036234.3	Q9P2R6	RERE_HUMAN	arginine-glutamic acid dipeptide (RE) repeats	585					chromatin remodeling (GO:0006338)|multicellular organismal development (GO:0007275)|NLS-bearing protein import into nucleus (GO:0006607)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|poly-glutamine tract binding (GO:0008267)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(16)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	49	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)		CGACCACTGCGTAGTGTCGAC	0.617																																					p.R585S		.											.	RERE-515	0			c.C1753A						.						95.0	83.0	87.0					1																	8422892		2203	4300	6503	SO:0001583	missense	473	exon17			CACTGCGTAGTGT	AF016005	CCDS95.1, CCDS41243.1	1p36.23	2013-01-25			ENSG00000142599	ENSG00000142599		"""GATA zinc finger domain containing"""	9965	protein-coding gene	gene with protein product		605226		ATN1L		10814707, 10729226	Standard	NM_012102		Approved	KIAA0458, ARP, ARG, DNB1	uc001apf.3	Q9P2R6	OTTHUMG00000001765	ENST00000337907.3:c.1753C>A	1.37:g.8422892G>T	ENSP00000338629:p.Arg585Ser	120	0		92	29	NM_012102	0	0	0	0	0	O43393|O75046|O75359|Q5VXL9|Q6P6B9|Q9Y2W4	Missense_Mutation	SNP	ENST00000337907.3	37	CCDS95.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.444981	0.83993	.	.	ENSG00000142599	ENST00000337907;ENST00000377464;ENST00000476556;ENST00000400908;ENST00000505225	T;T;T;T	0.05025	3.51;3.51;3.51;3.51	5.8	5.8	0.92144	.	.	.	.	.	T	0.21509	0.0518	M	0.67953	2.075	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.85130	0.997;0.997	T	0.07481	-1.0770	9	0.06891	T	0.86	-30.1132	19.0501	0.93039	0.0:0.0:1.0:0.0	.	317;585	B1AKN3;Q9P2R6	.;RERE_HUMAN	S	585;317;31;585;5	ENSP00000338629:R585S;ENSP00000366684:R317S;ENSP00000422246:R31S;ENSP00000383700:R585S	ENSP00000338629:R585S	R	-	1	0	RERE	8345479	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	9.407000	0.97325	2.730000	0.93505	0.563000	0.77884	CGC	.		0.617	RERE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004916.1		
Unknown	0	ucsc.edu	37	1	16133912	16133912	+	IGR	SNP	T	T	C	rs570054582		TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr1:16133912T>C								FBLIM1 (20823 upstream) : RP11-169K16.9 (26647 downstream)																							GCAATGGTCCTTTGCATGCAA	0.463													T|||	1	0.000199681	0.0	0.0014	5008	,	,		19503	0.0		0.0	False		,,,				2504	0.0				p.K78R													.	.	0			c.A233G						.						163.0	165.0	164.0					1																	16133912		2203	4300	6503	SO:0001628	intergenic_variant	0	exon1			TGGTCCTTTGCAT																													1.37:g.16133912T>C		274	0		270	1	NM_001089591	0	0	0	0	0		Missense_Mutation	SNP		37																																																																																				.	0	0.463								
SPEN	23013	broad.mit.edu	37	1	16203085	16203085	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr1:16203085C>A	ENST00000375759.3	+	3	997	c.793C>A	c.(793-795)Ccc>Acc	p.P265T	SPEN_ENST00000471538.1_3'UTR	NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	265	Arg-rich.|Ser-rich.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		AGCATCTAGACCCACAAGGTC	0.527																																					p.P265T													.	SPEN-298	0			c.C793A						.						43.0	40.0	41.0					1																	16203085		2201	4290	6491	SO:0001583	missense	23013	exon3			TCTAGACCCACAA		CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.793C>A	1.37:g.16203085C>A	ENSP00000364912:p.Pro265Thr	86	0		95	4	NM_015001	0	0	18	18	0	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Missense_Mutation	SNP	ENST00000375759.3	37	CCDS164.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.76|13.76	2.332667|2.332667	0.41297|0.41297	.|.	.|.	ENSG00000065526|ENSG00000065526	ENST00000442985|ENST00000375759;ENST00000438066;ENST00000375753	.|T;T	.|0.31769	.|3.01;1.48	5.78|5.78	5.78|5.78	0.91487|0.91487	.|.	.|.	.|.	.|.	.|.	T|T	0.28366|0.28366	0.0701|0.0701	L|L	0.27053|0.27053	0.805|0.805	0.80722|0.80722	D|D	1|1	.|P	.|0.42692	.|0.787	.|B	.|0.40199	.|0.322	T|T	0.03933|0.03933	-1.0991|-1.0991	5|9	.|0.62326	.|D	.|0.03	-10.4615|-10.4615	20.0118|20.0118	0.97458|0.97458	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|265	.|Q96T58	.|MINT_HUMAN	E|T	5|265;224;224	.|ENSP00000364912:P265T;ENSP00000388021:P224T	.|ENSP00000364906:P224T	D|P	+|+	3|1	2|0	SPEN|SPEN	16075672|16075672	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	5.463000|5.463000	0.66712|0.66712	2.744000|2.744000	0.94065|0.94065	0.563000|0.563000	0.77884|0.77884	GAC|CCC	.		0.527	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025993.1	NM_015001	
MAST2	23139	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	46290209	46290209	+	Silent	SNP	T	T	C			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr1:46290209T>C	ENST00000361297.2	+	2	565	c.282T>C	c.(280-282)gaT>gaC	p.D94D	MAST2_ENST00000372009.2_Silent_p.D94D	NM_015112.2	NP_055927.2			microtubule associated serine/threonine kinase 2											breast(1)|lung(3)|ovary(5)|stomach(2)	11	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.184)					TGAGTCAGGATGATTGTAAGT	0.398																																					p.D94D		.											.	MAST2-581	0			c.T282C						.						166.0	149.0	154.0					1																	46290209		1856	4094	5950	SO:0001819	synonymous_variant	23139	exon2			TCAGGATGATTGT	AB047005	CCDS41326.1	1p34.1	2008-02-05			ENSG00000086015	ENSG00000086015			19035	protein-coding gene	gene with protein product		612257					Standard	NM_015112		Approved	MAST205, KIAA0807	uc001cov.3	Q6P0Q8	OTTHUMG00000008007	ENST00000361297.2:c.282T>C	1.37:g.46290209T>C		282	0		265	88	NM_015112	0	0	3	6	3		Silent	SNP	ENST00000361297.2	37	CCDS41326.1																																																																																			.		0.398	MAST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021977.1	NM_015112	
WDR3	10885	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	118502024	118502024	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr1:118502024A>G	ENST00000349139.5	+	27	2833	c.2786A>G	c.(2785-2787)aAg>aGg	p.K929R	SPAG17_ENST00000336338.5_Intron	NM_006784.2	NP_006775.1	Q9UNX4	WDR3_HUMAN	WD repeat domain 3	929						nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(9)|liver(2)|lung(22)|prostate(2)|upper_aerodigestive_tract(1)	49	Esophageal squamous(2;0.162)	all_cancers(81;2.72e-05)|Acute lymphoblastic leukemia(138;1e-08)|all_epithelial(167;4.4e-07)|all_lung(203;1.7e-06)|Lung NSC(69;1.98e-05)|Prostate(1639;0.00955)|Breast(1374;0.244)		OV - Ovarian serous cystadenocarcinoma(397;1.39e-08)|Epithelial(280;1.82e-07)|all cancers(265;2.04e-05)|Lung(183;0.0525)|BRCA - Breast invasive adenocarcinoma(282;0.0695)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.185)		GAAGagaagaagaggaagagg	0.378																																					p.K929R		.											.	WDR3-91	0			c.A2786G						.						70.0	77.0	74.0					1																	118502024		2203	4300	6503	SO:0001583	missense	10885	exon27			AGAAGAAGAGGAA	AF083217	CCDS898.1	1p12	2013-01-09			ENSG00000065183	ENSG00000065183		"""WD repeat domain containing"""	12755	protein-coding gene	gene with protein product		604737				10395803	Standard	NM_006784		Approved	FLJ12796, UTP12, DIP2	uc010oxe.1	Q9UNX4	OTTHUMG00000012197	ENST00000349139.5:c.2786A>G	1.37:g.118502024A>G	ENSP00000308179:p.Lys929Arg	50	0		66	24	NM_006784	0	0	20	46	26		Missense_Mutation	SNP	ENST00000349139.5	37	CCDS898.1	.	.	.	.	.	.	.	.	.	.	A	14.33	2.502821	0.44558	.	.	ENSG00000065183	ENST00000349139	T	0.54479	0.57	5.47	4.35	0.52113	.	0.188191	0.56097	D	0.000032	T	0.15782	0.0380	N	0.08118	0	0.80722	D	1	B	0.12013	0.005	B	0.12156	0.007	T	0.06734	-1.0810	10	0.28530	T	0.3	-11.5094	10.512	0.44868	0.9233:0.0:0.0767:0.0	.	929	Q9UNX4	WDR3_HUMAN	R	929	ENSP00000308179:K929R	ENSP00000308179:K929R	K	+	2	0	WDR3	118303547	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.417000	0.44653	2.091000	0.63221	0.496000	0.49642	AAG	.		0.378	WDR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033720.2	NM_006784	
PDZK1	5174	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	145761288	145761288	+	Silent	SNP	T	T	C			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr1:145761288T>C	ENST00000344770.2	+	7	1174	c.1101T>C	c.(1099-1101)gaT>gaC	p.D367D	PDZK1_ENST00000451928.2_Silent_p.D256D|PDZK1_ENST00000417171.1_Silent_p.D367D	NM_002614.4	NP_002605.2	Q5T2W1	NHRF3_HUMAN	PDZ domain containing 1	367					carnitine transport (GO:0015879)|cell proliferation (GO:0008283)|drug transport (GO:0015893)|establishment of protein localization to plasma membrane (GO:0090002)|positive regulation of ion transmembrane transport (GO:0034767)|positive regulation of protein targeting to membrane (GO:0090314)|regulation of anion transport (GO:0044070)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|transporter activity (GO:0005215)			NS(1)|endometrium(1)|large_intestine(1)|lung(3)|pancreas(1)	7	all_hematologic(18;0.00473)|Acute lymphoblastic leukemia(18;0.0786)		KIRC - Kidney renal clear cell carcinoma(6;0.0764)|Kidney(552;0.118)|Colorectal(543;0.229)			GTCCACCAGATACTACAGAGG	0.483																																					p.D367D		.											.	PDZK1-90	0			c.T1101C						.						91.0	96.0	94.0					1																	145761288		2201	4298	6499	SO:0001819	synonymous_variant	5174	exon8			ACCAGATACTACA	AF012281	CCDS72859.1, CCDS72860.1	1q21	2009-08-21			ENSG00000174827	ENSG00000174827			8821	protein-coding gene	gene with protein product		603831				9461128	Standard	NM_002614		Approved	PDZD1, NHERF3	uc001eoo.2	Q5T2W1	OTTHUMG00000013735	ENST00000344770.2:c.1101T>C	1.37:g.145761288T>C		176	0		184	69	NM_002614	0	0	345	693	348	B4DPB9|E7EU02|O60450|Q5T5P6|Q9BQ41	Silent	SNP	ENST00000344770.2	37	CCDS924.1																																																																																			.		0.483	PDZK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038502.2	NM_002614	
ASH1L	55870	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	155491175	155491175	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr1:155491175C>T	ENST00000368346.3	-	2	775	c.136G>A	c.(136-138)Gaa>Aaa	p.E46K	ASH1L_ENST00000548830.1_Missense_Mutation_p.E46K|ASH1L_ENST00000392403.3_Missense_Mutation_p.E46K			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)	46					cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			AGGTCCTCTTCCTCCTTTGTG	0.418																																					p.E46K		.											.	ASH1L-234	0			c.G136A						.						302.0	301.0	301.0					1																	155491175		2203	4300	6503	SO:0001583	missense	55870	exon2			CCTCTTCCTCCTT	AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.136G>A	1.37:g.155491175C>T	ENSP00000357330:p.Glu46Lys	518	0		495	164	NM_018489	0	0	10	33	23	Q59GP1|Q5T714|Q5T715|Q9P2C7	Missense_Mutation	SNP	ENST00000368346.3	37		.	.	.	.	.	.	.	.	.	.	C	36	5.771812	0.96922	.	.	ENSG00000116539	ENST00000368346;ENST00000392403;ENST00000548830	D;D	0.89875	-2.58;-2.58	5.51	5.51	0.81932	.	0.134693	0.48286	N	0.000192	T	0.73776	0.3630	N	0.08118	0	0.46874	D	0.999234	B;B	0.30281	0.18;0.275	B;B	0.28232	0.04;0.087	T	0.76487	-0.2941	10	0.72032	D	0.01	.	19.2027	0.93717	0.0:1.0:0.0:0.0	.	46;46	Q9NR48;Q9NR48-2	ASH1L_HUMAN;.	K	46	ENSP00000357330:E46K;ENSP00000376204:E46K	ENSP00000357330:E46K	E	-	1	0	ASH1L	153757799	1.000000	0.71417	0.998000	0.56505	0.991000	0.79684	7.059000	0.76684	2.868000	0.98415	0.557000	0.71058	GAA	.		0.418	ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000039400.1	NM_018489	
TOR1AIP2	163590	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	1	179834038	179834038	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr1:179834038C>A	ENST00000553856.1	-	1	273	c.274G>T	c.(274-276)Ggt>Tgt	p.G92C	TOR1AIP2_ENST00000482587.1_5'UTR|TOR1AIP2_ENST00000367612.3_Intron|TOR1AIP2_ENST00000609928.1_Intron	NM_022347.3	NP_071742.1	Q9H496	IFG15_HUMAN		92																	AGTGGAGGACCCAGAAGAAAT	0.428																																					p.G92C		.											.	TOR1AIP2-69	0			c.G274T						.						130.0	126.0	128.0					1																	179834038		1854	4087	5941	SO:0001583	missense	163590	exon3			GAGGACCCAGAAG																												ENST00000553856.1:c.274G>T	1.37:g.179834038C>A	ENSP00000452581:p.Gly92Cys	151	1		184	61	NM_022347	0	0	12	28	16	Q05BU2	Missense_Mutation	SNP	ENST00000553856.1	37	CCDS53439.1	.	.	.	.	.	.	.	.	.	.	C	13.91	2.377210	0.42105	.	.	ENSG00000258664	ENST00000553856	.	.	.	4.79	4.79	0.61399	.	.	.	.	.	T	0.50582	0.1624	N	0.08118	0	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	T	0.47262	-0.9131	7	.	.	.	.	13.6483	0.62294	0.0:1.0:0.0:0.0	.	92	Q9H496	.	C	92	.	.	G	-	1	0	AL359853.3	178100661	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.906000	0.48735	2.941000	0.99782	0.655000	0.94253	GGT	.		0.428	IFRG15-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
SLC41A1	254428	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	205770146	205770146	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr1:205770146C>T	ENST00000367137.3	-	3	1429	c.415G>A	c.(415-417)Gtg>Atg	p.V139M	SLC41A1_ENST00000468057.1_5'UTR	NM_173854.4	NP_776253.3	Q8IVJ1	S41A1_HUMAN	solute carrier family 41 (magnesium transporter), member 1	139					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation transmembrane transporter activity (GO:0008324)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(4)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	17	Breast(84;0.0799)		BRCA - Breast invasive adenocarcinoma(75;0.0252)			AGCGCAGGCACTAGGATGAAG	0.562																																					p.V139M		.											.	SLC41A1-92	0			c.G415A						.						109.0	105.0	106.0					1																	205770146		2203	4300	6503	SO:0001583	missense	254428	exon3			CAGGCACTAGGAT	AJ514402	CCDS30988.1	1q32.1	2013-07-17	2013-07-17		ENSG00000133065	ENSG00000133065		"""Solute carriers"""	19429	protein-coding gene	gene with protein product		610801				12810078, 18367447	Standard	NM_173854		Approved	MgtE	uc001hdh.1	Q8IVJ1	OTTHUMG00000036000	ENST00000367137.3:c.415G>A	1.37:g.205770146C>T	ENSP00000356105:p.Val139Met	151	0		133	39	NM_173854	0	0	25	46	21	Q63HJ4|Q658Z5|Q659A4|Q6MZK2	Missense_Mutation	SNP	ENST00000367137.3	37	CCDS30988.1	.	.	.	.	.	.	.	.	.	.	C	32	5.182269	0.94885	.	.	ENSG00000133065	ENST00000367137	T	0.29917	1.55	5.78	5.78	0.91487	MgtE magnesium transporter, integral membrane (1);	0.000000	0.85682	D	0.000000	T	0.68091	0.2963	M	0.93638	3.44	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.73538	-0.3951	10	0.51188	T	0.08	-13.616	19.9618	0.97254	0.0:1.0:0.0:0.0	.	139	Q8IVJ1	S41A1_HUMAN	M	139	ENSP00000356105:V139M	ENSP00000356105:V139M	V	-	1	0	SLC41A1	204036769	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.768000	0.85345	2.894000	0.99253	0.655000	0.94253	GTG	.		0.562	SLC41A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087731.1		
PIGR	5284	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	207109097	207109097	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr1:207109097C>T	ENST00000356495.4	-	5	1295	c.1112G>A	c.(1111-1113)tGc>tAc	p.C371Y		NM_002644.3	NP_002635.2	P01833	PIGR_HUMAN	polymeric immunoglobulin receptor	371	Ig-like V-type 4.				detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc receptor signaling pathway (GO:0038093)|immunoglobulin transcytosis in epithelial cells mediated by polymeric immunoglobulin receptor (GO:0002415)|receptor clustering (GO:0043113)|retina homeostasis (GO:0001895)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	polymeric immunoglobulin receptor activity (GO:0001792)			central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(7)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						GTTGTAGGGGCAGAGCACGGC	0.622											OREG0014186	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.C371Y		.											.	PIGR-92	0			c.G1112A						.						33.0	37.0	36.0					1																	207109097		2203	4300	6503	SO:0001583	missense	5284	exon5			TAGGGGCAGAGCA		CCDS1474.1	1q31-q41	2013-01-11			ENSG00000162896	ENSG00000162896		"""Immunoglobulin superfamily / V-set domain containing"""	8968	protein-coding gene	gene with protein product		173880					Standard	NM_002644		Approved		uc001hez.3	P01833	OTTHUMG00000036581	ENST00000356495.4:c.1112G>A	1.37:g.207109097C>T	ENSP00000348888:p.Cys371Tyr	41	0	2165	43	17	NM_002644	8	19	2506	5529	2996	Q68D81|Q8IZY7	Missense_Mutation	SNP	ENST00000356495.4	37	CCDS1474.1	.	.	.	.	.	.	.	.	.	.	C	15.86	2.956538	0.53293	.	.	ENSG00000162896	ENST00000356495	T	0.40476	1.03	5.55	5.55	0.83447	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000001	T	0.75882	0.3910	H	0.96518	3.835	0.53005	D	0.999964	D	0.89917	1.0	D	0.97110	1.0	D	0.83757	0.0212	10	0.87932	D	0	-23.806	16.2203	0.82255	0.0:1.0:0.0:0.0	.	371	P01833	PIGR_HUMAN	Y	371	ENSP00000348888:C371Y	ENSP00000348888:C371Y	C	-	2	0	PIGR	205175720	1.000000	0.71417	0.930000	0.37139	0.097000	0.18754	4.383000	0.59600	2.614000	0.88457	0.655000	0.94253	TGC	.		0.622	PIGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088975.1	NM_002644	
IRF6	3664	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	209974723	209974723	+	Silent	SNP	G	G	A			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr1:209974723G>A	ENST00000367021.3	-	3	208	c.36C>T	c.(34-36)ccC>ccT	p.P12P	IRF6_ENST00000542854.1_Intron	NM_006147.3	NP_006138.1	O14896	IRF6_HUMAN	interferon regulatory factor 6	12					cell cycle arrest (GO:0007050)|cell development (GO:0048468)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|keratinocyte differentiation (GO:0030216)|keratinocyte proliferation (GO:0043616)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell proliferation (GO:0008285)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|large_intestine(4)|lung(12)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	28				OV - Ovarian serous cystadenocarcinoma(81;0.0351)		CCACCAGCCAGGGCTTTAGCC	0.607										HNSCC(57;0.16)																											p.P12P		.											.	IRF6-92	0			c.C36T						.						55.0	63.0	60.0					1																	209974723		2202	4300	6502	SO:0001819	synonymous_variant	3664	exon3			CAGCCAGGGCTTT	AL022398	CCDS1492.1, CCDS55681.1	1q32.2-q32.3	2011-02-10			ENSG00000117595	ENSG00000117595			6121	protein-coding gene	gene with protein product		607199	"""Van der Woude syndrome"""	VWS, LPS		12219090	Standard	NM_006147		Approved	OFC6, VWS1	uc001hhq.2	O14896	OTTHUMG00000036521	ENST00000367021.3:c.36C>T	1.37:g.209974723G>A		161	0		151	46	NM_006147	0	0	23	30	7	B4DLE2|D3DT90|F5GWX8|G0ZTL0	Silent	SNP	ENST00000367021.3	37	CCDS1492.1																																																																																			.		0.607	IRF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088827.1	NM_006147	
LEFTY2	7044	hgsc.bcm.edu;broad.mit.edu	37	1	226127230	226127230	+	Silent	SNP	G	G	A			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr1:226127230G>A	ENST00000366820.5	-	3	916	c.568C>T	c.(568-570)Ctg>Ttg	p.L190L	LEFTY2_ENST00000420304.2_Silent_p.L156L|RP4-559A3.6_ENST00000513672.1_RNA|LEFTY2_ENST00000474493.1_5'UTR	NM_003240.3	NP_003231.2	O00292	LFTY2_HUMAN	left-right determination factor 2	190					blood coagulation (GO:0007596)|cell growth (GO:0016049)|multicellular organismal development (GO:0007275)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|platelet alpha granule lumen (GO:0031093)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(8)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	16	Breast(184;0.197)					GGCCGGCTCAGCTGCTGCCAG	0.672																																					p.L190L	Colon(172;116 2643 9098 43333)	.											.	LEFTY2-90	0			c.C568T						.						12.0	16.0	15.0					1																	226127230		2166	4217	6383	SO:0001819	synonymous_variant	7044	exon3			GGCTCAGCTGCTG	U81523	CCDS1549.1, CCDS53479.1	1q42.1	2008-07-18	2004-11-17	2004-11-17	ENSG00000143768	ENSG00000143768			3122	protein-coding gene	gene with protein product	"""transforming growth factor, beta-4 (endometrial bleeding-associated factor; LEFTY A)"""	601877	"""endometrial bleeding associated factor (left-right determination, factor A; transforming growth factor beta superfamily)"""	TGFB4, EBAF		9153275	Standard	NM_001172425		Approved	LEFTA, LEFTYA	uc001hpt.2	O00292	OTTHUMG00000037441	ENST00000366820.5:c.568C>T	1.37:g.226127230G>A		60	0		54	16	NM_003240	0	0	4	4	0	B3KNH4|B4E332|E9PDM4|O75611|Q5TE89|Q8NBQ9	Silent	SNP	ENST00000366820.5	37	CCDS1549.1																																																																																			.		0.672	LEFTY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091152.1	NM_003240	
EXOC8	149371	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	231472205	231472205	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr1:231472205C>A	ENST00000360394.2	-	1	1373	c.1287G>T	c.(1285-1287)gaG>gaT	p.E429D	EXOC8_ENST00000366645.1_Missense_Mutation_p.E425D|SPRTN_ENST00000008440.9_5'Flank|SPRTN_ENST00000391858.4_5'Flank|SPRTN_ENST00000295050.7_5'Flank	NM_175876.3	NP_787072.2	Q8IYI6	EXOC8_HUMAN	exocyst complex component 8	429					cellular protein localization (GO:0034613)|cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|protein transport (GO:0015031)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|exocyst (GO:0000145)|membrane (GO:0016020)|plasma membrane (GO:0005886)				cervix(2)|endometrium(1)|large_intestine(2)|liver(1)|lung(5)|prostate(1)|skin(1)|stomach(1)	14	Breast(184;0.0871)	all_cancers(173;0.151)|Prostate(94;0.183)				TCAAAAATAGCTCACAGGCCT	0.527																																					p.E429D		.											.	EXOC8-91	0			c.G1287T						.						48.0	49.0	49.0					1																	231472205		2203	4300	6503	SO:0001583	missense	149371	exon1			AAATAGCTCACAG	AL117352	CCDS1593.1	1q42.2	2013-01-22			ENSG00000116903	ENSG00000116903			24659	protein-coding gene	gene with protein product		615283				12477932	Standard	NM_175876		Approved	SEC84, EXO84, Exo84p	uc001huq.3	Q8IYI6	OTTHUMG00000038025	ENST00000360394.2:c.1287G>T	1.37:g.231472205C>A	ENSP00000353564:p.Glu429Asp	95	0		86	18	NM_175876	0	0	10	13	3	B3KU33|Q5TE82	Missense_Mutation	SNP	ENST00000360394.2	37	CCDS1593.1	.	.	.	.	.	.	.	.	.	.	C	11.50	1.657151	0.29425	.	.	ENSG00000116903	ENST00000360394;ENST00000366645	T;T	0.77098	-1.07;-1.07	5.97	5.05	0.67936	Cullin repeat-like-containing domain (1);	0.052227	0.85682	D	0.000000	T	0.67297	0.2878	L	0.31526	0.94	0.58432	D	0.999998	P	0.45957	0.869	B	0.43754	0.43	T	0.62431	-0.6856	10	0.15066	T	0.55	-29.5152	12.807	0.57619	0.0:0.8715:0.0:0.1285	.	429	Q8IYI6	EXOC8_HUMAN	D	429;425	ENSP00000353564:E429D;ENSP00000355605:E425D	ENSP00000353564:E429D	E	-	3	2	EXOC8	229538828	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	3.827000	0.55745	2.837000	0.97791	0.655000	0.94253	GAG	.		0.527	EXOC8-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_175876	
IRF2BP2	359948	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	234744251	234744251	+	Silent	SNP	G	G	T			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr1:234744251G>T	ENST00000366609.3	-	1	1020	c.990C>A	c.(988-990)gcC>gcA	p.A330A	RP4-781K5.2_ENST00000436039.1_RNA|IRF2BP2_ENST00000366610.3_Silent_p.A330A|IRF2BP2_ENST00000491430.1_5'Flank	NM_182972.2	NP_892017.2	Q7Z5L9	I2BP2_HUMAN	interferon regulatory factor 2 binding protein 2	330					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	11	Ovarian(103;0.0303)	all_cancers(173;0.0236)|Prostate(94;0.0115)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)|Epithelial(3;6.2e-05)			CTGCAGTCAGGGCCGGCTCCT	0.637																																					p.A330A		.											.	IRF2BP2-90	0			c.C990A						.						22.0	21.0	21.0					1																	234744251		2201	4300	6501	SO:0001819	synonymous_variant	359948	exon1			AGTCAGGGCCGGC	AY278023	CCDS1602.1, CCDS41475.1	1q42.3	2008-02-05			ENSG00000168264	ENSG00000168264			21729	protein-coding gene	gene with protein product		615332				12799427	Standard	NM_182972		Approved	IRF-2BP2	uc001hwg.3	Q7Z5L9	OTTHUMG00000037981	ENST00000366609.3:c.990C>A	1.37:g.234744251G>T		36	0		39	15	NM_182972	0	1	30	57	26	B1AM35|B1AM36|Q6P083|Q7Z5L8|Q8N351|Q8WUH8	Silent	SNP	ENST00000366609.3	37	CCDS1602.1																																																																																			.		0.637	IRF2BP2-002	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000092705.1	NM_182972	
MASTL	84930	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	27459483	27459483	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr10:27459483T>C	ENST00000375940.4	+	8	1652	c.1595T>C	c.(1594-1596)cTt>cCt	p.L532P	MASTL_ENST00000375946.4_Missense_Mutation_p.L532P|MASTL_ENST00000342386.6_Missense_Mutation_p.L532P|MASTL_ENST00000477034.1_3'UTR			Q96GX5	GWL_HUMAN	microtubule associated serine/threonine kinase-like	532	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to DNA damage stimulus (GO:0006974)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of protein phosphatase type 2A activity (GO:0034048)|regulation of cell cycle (GO:0051726)	centrosome (GO:0005813)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein phosphatase 2A binding (GO:0051721)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|cervix(2)|endometrium(2)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						GCAAAAAACCTTATGTGTGAA	0.313																																					p.L532P		.											.	MASTL-522	0			c.T1595C						.						89.0	92.0	91.0					10																	27459483		2203	4300	6503	SO:0001583	missense	84930	exon8			AAAACCTTATGTG	BC009107	CCDS7153.1, CCDS53502.1, CCDS53503.1	10p12.1	2005-11-03			ENSG00000120539	ENSG00000120539			19042	protein-coding gene	gene with protein product		608221					Standard	NM_001172303		Approved	FLJ14813, THC2	uc001itm.3	Q96GX5	OTTHUMG00000017855	ENST00000375940.4:c.1595T>C	10.37:g.27459483T>C	ENSP00000365107:p.Leu532Pro	122	0		132	46	NM_032844	0	0	3	5	2	Q5T8D5|Q5T8D7|Q8NCD6|Q96SJ5	Missense_Mutation	SNP	ENST00000375940.4	37	CCDS53502.1	.	.	.	.	.	.	.	.	.	.	T	15.96	2.985988	0.53934	.	.	ENSG00000120539	ENST00000375946;ENST00000342386;ENST00000375940	T;T;T	0.33654	1.4;1.4;1.4	5.67	5.67	0.87782	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.61590	0.2359	M	0.75264	2.295	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.65957	-0.6042	10	0.87932	D	0	-17.4573	15.9272	0.79628	0.0:0.0:0.0:1.0	.	532;532;532	Q96GX5-2;Q96GX5;Q96GX5-3	.;GWL_HUMAN;.	P	532	ENSP00000365113:L532P;ENSP00000343446:L532P;ENSP00000365107:L532P	ENSP00000343446:L532P	L	+	2	0	MASTL	27499489	1.000000	0.71417	0.861000	0.33841	0.432000	0.31715	6.170000	0.71920	2.153000	0.67306	0.533000	0.62120	CTT	.		0.313	MASTL-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047320.1	NM_032844	
UNC5B	219699	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	73055666	73055666	+	Silent	SNP	C	C	T			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr10:73055666C>T	ENST00000335350.6	+	14	2690	c.2274C>T	c.(2272-2274)ctC>ctT	p.L758L	UNC5B_ENST00000373192.4_Silent_p.L747L	NM_170744.4	NP_734465.2	Q8IZJ1	UNC5B_HUMAN	unc-5 homolog B (C. elegans)	758	UPA domain. {ECO:0000250}.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(4)|skin(4)	49						GCCTCTCCCTCCATGACCTCC	0.612																																					p.L758L		.											.	UNC5B-228	0			c.C2274T						.						133.0	105.0	115.0					10																	73055666		2203	4300	6503	SO:0001819	synonymous_variant	219699	exon14			CTCCCTCCATGAC	AB096256	CCDS7309.1, CCDS58083.1	10q22.2	2013-01-11	2001-11-28		ENSG00000107731	ENSG00000107731		"""Immunoglobulin superfamily / I-set domain containing"""	12568	protein-coding gene	gene with protein product		607870	"""unc5 (C.elegans homolog) b"""				Standard	NM_170744		Approved	UNC5H2, p53RDL1	uc001jro.3	Q8IZJ1	OTTHUMG00000018422	ENST00000335350.6:c.2274C>T	10.37:g.73055666C>T		116	0		116	46	NM_170744	0	0	2	2	0	Q5T3R9|Q5T3S0|Q86SN3|Q8N1Y2|Q9H9F3	Silent	SNP	ENST00000335350.6	37	CCDS7309.1																																																																																			.		0.612	UNC5B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048541.1	NM_170744	
FUT11	170384	hgsc.bcm.edu	37	10	75532345	75532345	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr10:75532345T>C	ENST00000372841.3	+	1	297	c.254T>C	c.(253-255)cTa>cCa	p.L85P	AC022400.2_ENST00000595757.1_Missense_Mutation_p.S12G|FUT11_ENST00000465695.1_3'UTR|RMRPP1_ENST00000517236.1_RNA|FUT11_ENST00000394790.1_Missense_Mutation_p.L85P	NM_173540.2	NP_775811.2	Q495W5	FUT11_HUMAN	fucosyltransferase 11 (alpha (1,3) fucosyltransferase)	85					protein glycosylation (GO:0006486)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-(1->3)-fucosyltransferase activity (GO:0046920)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(3)	7	Prostate(51;0.0112)					AGCCCAGGGCTATTCCCCCAC	0.746																																					p.L85P		.											.	FUT11-90	0			c.T254C						.						11.0	10.0	10.0					10																	75532345		2159	4225	6384	SO:0001583	missense	170384	exon1			CAGGGCTATTCCC	BC036037	CCDS7333.1, CCDS60558.1	10q22.3	2014-01-02			ENSG00000196968	ENSG00000196968		"""Fucosyltransferases"""	19233	protein-coding gene	gene with protein product						11698403, 24318988	Standard	NM_173540		Approved	MGC33202	uc001jva.3	Q495W5	OTTHUMG00000018483	ENST00000372841.3:c.254T>C	10.37:g.75532345T>C	ENSP00000361932:p.Leu85Pro	10	1		16	4	NM_173540	0	0	1	1	0	Q495W7|Q8IYE4	Missense_Mutation	SNP	ENST00000372841.3	37	CCDS7333.1	.	.	.	.	.	.	.	.	.	.	T	24.7	4.560436	0.86335	.	.	ENSG00000196968	ENST00000372841;ENST00000394790	T;T	0.23552	1.9;1.9	4.74	4.74	0.60224	.	0.152784	0.44285	D	0.000468	T	0.52468	0.1736	M	0.80847	2.515	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.81914	0.995;0.98;0.993	T	0.59182	-0.7502	10	0.72032	D	0.01	-17.3432	14.0401	0.64669	0.0:0.0:0.0:1.0	.	85;85;85	Q495W5;Q495W5-2;B2RC53	FUT11_HUMAN;.;.	P	85	ENSP00000361932:L85P;ENSP00000378270:L85P	ENSP00000361932:L85P	L	+	2	0	FUT11	75202351	1.000000	0.71417	0.893000	0.35052	0.927000	0.56198	4.480000	0.60243	1.995000	0.58328	0.379000	0.24179	CTA	.		0.746	FUT11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048689.1	NM_173540	
SEMA4G	57715	broad.mit.edu	37	10	102732887	102732887	+	Splice_Site	SNP	G	G	A			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr10:102732887G>A	ENST00000370250.4	+	2	499	c.126G>A	c.(124-126)gaG>gaA	p.E42E	SEMA4G_ENST00000517724.1_Splice_Site_p.E42E|SEMA4G_ENST00000519756.1_3'UTR|SEMA4G_ENST00000210633.3_Splice_Site_p.E42E|MIR608_ENST00000384820.1_RNA	NM_017893.3	NP_060363.2	Q9NTN9	SEM4G_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G	42	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			breast(3)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25		Colorectal(252;0.234)		Epithelial(162;3.71e-09)|all cancers(201;2.1e-07)		TCTCCCCAGAGCTCTCTGGGA	0.622																																					p.E42E													.	SEMA4G-154	0			c.G126A						.						43.0	43.0	43.0					10																	102732887		2203	4300	6503	SO:0001630	splice_region_variant	57715	exon2			CCCAGAGCTCTCT	AB046839	CCDS7501.1, CCDS55724.1	10q24.31	2013-01-11			ENSG00000095539	ENSG00000095539		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10735	protein-coding gene	gene with protein product							Standard	NM_017893		Approved	FLJ20590, KIAA1619	uc001krw.2	Q9NTN9	OTTHUMG00000018922	ENST00000370250.4:c.125-1G>A	10.37:g.102732887G>A		72	0		58	3	NM_001203244	0	0	0	0	0	A1A5C6|A6NJY8|Q58EY1|Q9HCF3	Silent	SNP	ENST00000370250.4	37																																																																																				.		0.622	SEMA4G-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000049920.2		Silent
PIK3C2A	5286	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	17124313	17124313	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr11:17124313A>C	ENST00000265970.7	-	23	3746	c.3747T>G	c.(3745-3747)tgT>tgG	p.C1249W	PIK3C2A_ENST00000531428.1_Intron|PIK3C2A_ENST00000540361.1_Missense_Mutation_p.C869W	NM_002645.2	NP_002636.2	O00443	P3C2A_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha	1249	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|exocytosis (GO:0006887)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|small molecule metabolic process (GO:0044281)|vascular smooth muscle contraction (GO:0014829)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol binding (GO:0035091)			central_nervous_system(4)|endometrium(5)|kidney(5)|large_intestine(7)|lung(24)|ovary(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	58						TGTGTCGATCACAGATGCCTA	0.383																																					p.C1249W		.											.	PIK3C2A-1310	0			c.T3747G						.						102.0	88.0	93.0					11																	17124313		2200	4293	6493	SO:0001583	missense	5286	exon23			TCGATCACAGATG	Y13367	CCDS7824.1	11p15.5-p14	2012-07-13	2012-07-13			ENSG00000011405	2.7.1.154		8971	protein-coding gene	gene with protein product		603601	"""phosphoinositide-3-kinase, class 2, alpha polypeptide"""			9337861	Standard	NM_002645		Approved	PI3K-C2alpha	uc001mmq.4	O00443		ENST00000265970.7:c.3747T>G	11.37:g.17124313A>C	ENSP00000265970:p.Cys1249Trp	110	0		103	37	NM_002645	0	0	14	32	18	B0LPH2|B4E2G4|Q14CQ9	Missense_Mutation	SNP	ENST00000265970.7	37	CCDS7824.1	.	.	.	.	.	.	.	.	.	.	A	17.56	3.420006	0.62622	.	.	ENSG00000011405	ENST00000265970;ENST00000540361	T;T	0.80909	-1.43;-1.43	5.45	4.32	0.51571	Protein kinase-like domain (1);Phosphatidylinositol 3/4-kinase, conserved site (1);Phosphatidylinositol 3-/4-kinase, catalytic (4);	0.000000	0.85682	D	0.000000	D	0.89199	0.6647	M	0.82517	2.595	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.89599	0.3833	10	0.72032	D	0.01	-12.9025	11.3328	0.49485	0.9285:0.0:0.0715:0.0	.	1249	O00443	P3C2A_HUMAN	W	1249;869	ENSP00000265970:C1249W;ENSP00000438687:C869W	ENSP00000265970:C1249W	C	-	3	2	PIK3C2A	17080889	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.320000	0.51991	1.021000	0.39600	0.533000	0.62120	TGT	.		0.383	PIK3C2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387553.1	NM_002645	
OOSP2	219990	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	59811100	59811100	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr11:59811100G>A	ENST00000278855.2	+	2	408	c.223G>A	c.(223-225)Gat>Aat	p.D75N	PLAC1L_ENST00000532905.1_Missense_Mutation_p.D44N	NM_173801.3	NP_776162.2	Q86WS3	OOSP2_HUMAN		75						extracellular region (GO:0005576)				breast(1)|lung(9)|ovary(2)|prostate(2)|skin(1)	15						TCTTGTTCGTGATTGTGGCAT	0.338																																					p.D75N		.											.	PLAC1L-93	0			c.G223A						.						80.0	77.0	78.0					11																	59811100		2201	4295	6496	SO:0001583	missense	219990	exon2			GTTCGTGATTGTG																												ENST00000278855.2:c.223G>A	11.37:g.59811100G>A	ENSP00000278855:p.Asp75Asn	53	1		64	26	NM_173801	0	0	0	0	0	E9PJA4|Q8N9U6	Missense_Mutation	SNP	ENST00000278855.2	37	CCDS7979.1	.	.	.	.	.	.	.	.	.	.	G	11.70	1.715783	0.30413	.	.	ENSG00000149507	ENST00000278855;ENST00000532905	D;D	0.82711	-1.64;-1.64	3.4	0.273	0.15650	.	1.719800	0.03545	N	0.224546	T	0.76765	0.4033	L	0.50333	1.59	0.09310	N	1	B	0.32160	0.358	B	0.24701	0.055	T	0.61964	-0.6954	10	0.59425	D	0.04	0.1876	5.3931	0.16255	0.1238:0.4285:0.4477:0.0	.	75	Q86WS3	PLACL_HUMAN	N	75;44	ENSP00000278855:D75N;ENSP00000433831:D44N	ENSP00000278855:D75N	D	+	1	0	PLAC1L	59567676	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	0.220000	0.17660	0.067000	0.16545	-0.312000	0.09012	GAT	.		0.338	PLAC1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394411.1		
ENDOD1	23052	hgsc.bcm.edu;broad.mit.edu	37	11	94823276	94823276	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr11:94823276C>T	ENST00000278505.4	+	1	303	c.185C>T	c.(184-186)gCt>gTt	p.A62V		NM_015036.2	NP_055851.1	O94919	ENDD1_HUMAN	endonuclease domain containing 1	62						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(2)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(1)	11		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.00824)				GCGGAGGGTGCTGAGCGCTTC	0.716																																					p.A62V		.											.	ENDOD1-68	0			c.C185T						.						12.0	17.0	15.0					11																	94823276		1882	4102	5984	SO:0001583	missense	23052	exon1			AGGGTGCTGAGCG	BC026191	CCDS41699.1	11q21	2010-03-19			ENSG00000149218	ENSG00000149218			29129	protein-coding gene	gene with protein product						10048485	Standard	NM_015036		Approved	KIAA0830	uc001pfh.3	O94919	OTTHUMG00000167835	ENST00000278505.4:c.185C>T	11.37:g.94823276C>T	ENSP00000278505:p.Ala62Val	15	0		17	7	NM_015036	0	0	6	11	5	A8K6K8|Q6GQY5|Q8TAQ8	Missense_Mutation	SNP	ENST00000278505.4	37	CCDS41699.1	.	.	.	.	.	.	.	.	.	.	C	13.98	2.399463	0.42512	.	.	ENSG00000149218	ENST00000278505	T	0.69306	-0.39	4.43	1.23	0.21249	DNA/RNA non-specific endonuclease (1);Extracellular Endonuclease, subunit A (2);	1.135320	0.06834	N	0.794557	T	0.55800	0.1943	L	0.36672	1.1	0.09310	N	0.999999	B	0.33413	0.411	B	0.40165	0.321	T	0.50206	-0.8855	10	0.28530	T	0.3	-13.357	2.0739	0.03619	0.3599:0.396:0.1335:0.1106	.	62	O94919	ENDD1_HUMAN	V	62	ENSP00000278505:A62V	ENSP00000278505:A62V	A	+	2	0	ENDOD1	94462924	0.076000	0.21285	0.977000	0.42913	0.495000	0.33615	0.653000	0.24902	0.848000	0.35191	0.585000	0.79938	GCT	.		0.716	ENDOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396545.1	NM_015036	
MMP8	4317	hgsc.bcm.edu	37	11	102589165	102589165	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr11:102589165T>C	ENST00000236826.3	-	5	862	c.764A>G	c.(763-765)gAt>gGt	p.D255G		NM_002424.2	NP_002415.1	P22894	MMP8_HUMAN	matrix metallopeptidase 8 (neutrophil collagenase)	255					collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|serine-type endopeptidase activity (GO:0004252)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(3)|kidney(1)|large_intestine(4)|lung(11)|ovary(4)|skin(6)|stomach(1)|urinary_tract(1)	32	all_cancers(8;0.00092)|all_epithelial(12;0.00389)|Lung NSC(15;0.227)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0555)|Lung(13;0.0828)|LUSC - Lung squamous cell carcinoma(19;0.151)|all cancers(10;0.189)	BRCA - Breast invasive adenocarcinoma(274;0.0141)	Marimastat(DB00786)	CTGAATGCCATCGATGTCATC	0.488																																					p.D255G		.											.	MMP8-229	0			c.A764G						.						109.0	90.0	96.0					11																	102589165		2203	4299	6502	SO:0001583	missense	4317	exon5			ATGCCATCGATGT	J05556	CCDS8320.1	11q21-q22	2008-02-05	2005-08-08		ENSG00000118113	ENSG00000118113	3.4.24.34		7175	protein-coding gene	gene with protein product		120355	"""matrix metalloproteinase 8 (neutrophil collagenase)"""	CLG1			Standard	NM_002424		Approved		uc001phe.2	P22894	OTTHUMG00000167587	ENST00000236826.3:c.764A>G	11.37:g.102589165T>C	ENSP00000236826:p.Asp255Gly	27	0		33	2	NM_002424	0	0	1	1	0	Q45F99	Missense_Mutation	SNP	ENST00000236826.3	37	CCDS8320.1	.	.	.	.	.	.	.	.	.	.	T	12.42	1.933886	0.34096	.	.	ENSG00000118113	ENST00000236826;ENST00000544383;ENST00000534942	T	0.21543	2.0	5.45	4.32	0.51571	Peptidase M10, metallopeptidase (1);Peptidase, metallopeptidase (1);Metallopeptidase, catalytic domain (1);	0.282103	0.30800	N	0.008847	T	0.31765	0.0807	M	0.74467	2.265	0.23669	N	0.997152	B;B;B	0.33826	0.06;0.427;0.179	B;B;B	0.42138	0.037;0.377;0.114	T	0.24404	-1.0161	10	0.72032	D	0.01	.	10.3966	0.44205	0.0:0.1373:0.0:0.8627	.	255;190;255	A8K9E4;F5GXB5;P22894	.;.;MMP8_HUMAN	G	255;232;190	ENSP00000236826:D255G	ENSP00000236826:D255G	D	-	2	0	MMP8	102094375	1.000000	0.71417	0.785000	0.31869	0.680000	0.39746	3.827000	0.55745	1.001000	0.39076	0.533000	0.62120	GAT	.		0.488	MMP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395223.1	NM_002424	
ATM	472	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	108155202	108155202	+	Splice_Site	SNP	T	T	C			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr11:108155202T>C	ENST00000452508.2	+	27	4182		c.e27+2		ATM_ENST00000278616.4_Splice_Site			Q13315	ATM_HUMAN	ATM serine/threonine kinase						brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	GGAAAACAGGTATGGCTTCAA	0.348			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																											.		.	yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	.	ATM-3419	0			c.3993+2T>C						.						93.0	90.0	91.0					11																	108155202		2201	4298	6499	SO:0001630	splice_region_variant	472	exon26	Familial Cancer Database	AT, Louis-Bar syndrome	AACAGGTATGGCT	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.3993+2T>C	11.37:g.108155202T>C		107	0		96	34	NM_000051	0	0	0	0	0	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Splice_Site	SNP	ENST00000452508.2	37	CCDS31669.1	.	.	.	.	.	.	.	.	.	.	T	17.13	3.311730	0.60414	.	.	ENSG00000149311	ENST00000527805;ENST00000278616;ENST00000452508;ENST00000531525	.	.	.	5.43	5.43	0.79202	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.4694	0.75429	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	ATM	107660412	1.000000	0.71417	0.998000	0.56505	0.827000	0.46813	7.450000	0.80656	2.070000	0.61991	0.455000	0.32223	.	.		0.348	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389938.1	NM_000051	Intron
VWF	7450	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	6138619	6138619	+	Silent	SNP	G	G	A			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr12:6138619G>A	ENST00000261405.5	-	22	3110	c.2856C>T	c.(2854-2856)caC>caT	p.H952H		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	952	VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	CCACCTCAAAGTGAGTCTCAT	0.572																																					p.H952H		.											.	VWF-163	0			c.C2856T						.						108.0	95.0	99.0					12																	6138619		2203	4300	6503	SO:0001819	synonymous_variant	7450	exon22			CTCAAAGTGAGTC		CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.2856C>T	12.37:g.6138619G>A		108	0		126	76	NM_000552	0	0	34	35	1	Q8TCE8|Q99806	Silent	SNP	ENST00000261405.5	37	CCDS8539.1																																																																																			.		0.572	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399020.1	NM_000552	
LRRC23	10233	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	7014840	7014840	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr12:7014840G>C	ENST00000007969.8	+	2	263	c.43G>C	c.(43-45)Gat>Cat	p.D15H	LRRC23_ENST00000323702.5_Missense_Mutation_p.D15H|LRRC23_ENST00000449039.1_3'UTR|LRRC23_ENST00000429740.1_Missense_Mutation_p.D15H|LRRC23_ENST00000443597.2_Missense_Mutation_p.D15H|LRRC23_ENST00000433346.1_Missense_Mutation_p.D15H|LRRC23_ENST00000436789.1_Missense_Mutation_p.D15H	NM_001135217.1|NM_201650.2	NP_001128689.1|NP_964013.1	Q53EV4	LRC23_HUMAN	leucine rich repeat containing 23	15										NS(1)|breast(1)|endometrium(2)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|stomach(1)	13						GCCAGACCAGGATGATTCTga	0.498																																					p.D15H		.											.	LRRC23-23	0			c.G43C						.						70.0	74.0	73.0					12																	7014840		2203	4300	6503	SO:0001583	missense	10233	exon2			GACCAGGATGATT	BC014450	CCDS8568.1, CCDS8569.1	12p13	2006-02-02			ENSG00000010626	ENSG00000010626			19138	protein-coding gene	gene with protein product						11830501, 11826754	Standard	NM_201650		Approved	B7, LRPB7	uc001qrp.3	Q53EV4	OTTHUMG00000156668	ENST00000007969.8:c.43G>C	12.37:g.7014840G>C	ENSP00000007969:p.Asp15His	120	0		148	43	NM_001135217	0	0	62	94	32	A8K8C6|D3DUT1|Q8N6K6|Q92977|Q99620	Missense_Mutation	SNP	ENST00000007969.8	37	CCDS8569.1	.	.	.	.	.	.	.	.	.	.	G	12.33	1.906459	0.33628	.	.	ENSG00000010626	ENST00000433346;ENST00000007969;ENST00000323702;ENST00000443597;ENST00000415834;ENST00000436789;ENST00000429740	T;T;T;T;T;T;T	0.71461	1.55;-0.26;-0.57;-0.26;0.55;1.6;1.19	4.74	4.74	0.60224	.	.	.	.	.	T	0.79088	0.4387	L	0.60455	1.87	0.47698	D	0.999497	D;D;D;D	0.69078	0.997;0.997;0.984;0.991	D;P;P;P	0.63877	0.919;0.884;0.769;0.769	T	0.80533	-0.1340	9	0.62326	D	0.03	-12.2314	13.0943	0.59182	0.0:0.0:1.0:0.0	.	15;15;15;15	E9PDZ4;Q53EV4-2;Q53EV4;C9JKE8	.;.;LRC23_HUMAN;.	H	15	ENSP00000402554:D15H;ENSP00000007969:D15H;ENSP00000317464:D15H;ENSP00000390932:D15H;ENSP00000408066:D15H;ENSP00000396049:D15H;ENSP00000397192:D15H	ENSP00000007969:D15H	D	+	1	0	LRRC23	6885101	0.995000	0.38212	0.960000	0.40013	0.183000	0.23260	2.632000	0.46511	2.452000	0.82932	0.561000	0.74099	GAT	.		0.498	LRRC23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345214.1	NM_006992	
SPX	80763	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	21679409	21679409	+	Start_Codon_SNP	SNP	G	G	A			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr12:21679409G>A	ENST00000256969.2	+	1	169	c.3G>A	c.(1-3)atG>atA	p.M1I		NM_030572.2	NP_085049.1	Q9BT56	SPXN_HUMAN		1					long-chain fatty acid import (GO:0044539)|negative regulation of appetite (GO:0032099)|negative regulation of heart rate (GO:0010459)|negative regulation of renal sodium excretion (GO:0035814)|positive regulation of systemic arterial blood pressure (GO:0003084)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of sensory perception of pain (GO:0051930)	cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)	neuropeptide hormone activity (GO:0005184)|type 2 galanin receptor binding (GO:0031765)|type 3 galanin receptor binding (GO:0031766)			endometrium(3)|large_intestine(1)|lung(2)|urinary_tract(1)	7						CGCAGAACATGAAGGTAAGTA	0.303																																					p.M1I		.											.	C12orf39-90	0			c.G3A						.						75.0	76.0	76.0					12																	21679409		2203	4300	6503	SO:0001582	initiator_codon_variant	80763	exon1			GAACATGAAGGTA																												ENST00000256969.2:c.3G>A	12.37:g.21679409G>A	ENSP00000256969:p.Met1Ile	49	0		43	13	NM_030572	0	0	0	0	0	B3KND6	Missense_Mutation	SNP	ENST00000256969.2	37	CCDS31757.1	.	.	.	.	.	.	.	.	.	.	G	11.08	1.533648	0.27387	.	.	ENSG00000134548	ENST00000256969	.	.	.	5.04	5.04	0.67666	.	0.205916	0.42821	D	0.000641	T	0.78375	0.4273	.	.	.	0.80722	D	1	D	0.61080	0.989	D	0.72982	0.979	T	0.80493	-0.1358	8	0.87932	D	0	-8.2451	14.0663	0.64831	0.0:0.0:1.0:0.0	.	1	Q9BT56	SPXN_HUMAN	I	1	.	ENSP00000256969:M1I	M	+	3	0	C12orf39	21570676	1.000000	0.71417	1.000000	0.80357	0.187000	0.23431	4.712000	0.61888	2.780000	0.95670	0.585000	0.79938	ATG	.		0.303	C12orf39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402389.1		Missense_Mutation
CMAS	55907	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	22218064	22218064	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr12:22218064T>A	ENST00000229329.2	+	8	1254	c.1124T>A	c.(1123-1125)gTg>gAg	p.V375E		NM_018686.4	NP_061156.1	Q8NFW8	NEUA_HUMAN	cytidine monophosphate N-acetylneuraminic acid synthetase	375					lipopolysaccharide biosynthetic process (GO:0009103)|N-acetylneuraminate metabolic process (GO:0006054)	membrane (GO:0016020)|nucleus (GO:0005634)	N-acylneuraminate cytidylyltransferase activity (GO:0008781)			autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(6)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	24						GGAAATGAAGTGTCTGATGAA	0.403																																					p.V375E		.											.	CMAS-93	0			c.T1124A						.						161.0	170.0	167.0					12																	22218064		2203	4300	6503	SO:0001583	missense	55907	exon8			ATGAAGTGTCTGA	AF271388	CCDS8696.1	12p12.1	2008-08-04			ENSG00000111726	ENSG00000111726			18290	protein-coding gene	gene with protein product	"""CMP-Neu5Ac synthetase"""	603316				8889549, 7566098	Standard	NM_018686		Approved		uc001rfm.4	Q8NFW8	OTTHUMG00000169097	ENST00000229329.2:c.1124T>A	12.37:g.22218064T>A	ENSP00000229329:p.Val375Glu	155	1		258	126	NM_018686	0	0	0	0	0	Q96AX5|Q9NQZ0	Missense_Mutation	SNP	ENST00000229329.2	37	CCDS8696.1	.	.	.	.	.	.	.	.	.	.	T	9.711	1.157024	0.21454	.	.	ENSG00000111726	ENST00000229329	T	0.24151	1.87	5.33	5.33	0.75918	HAD-like domain (2);	0.374692	0.26840	N	0.022237	T	0.17619	0.0423	L	0.32530	0.975	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.09357	-1.0678	10	0.18276	T	0.48	-0.3894	8.8914	0.35437	0.2119:0.0:0.0:0.788	.	375	Q8NFW8	NEUA_HUMAN	E	375	ENSP00000229329:V375E	ENSP00000229329:V375E	V	+	2	0	CMAS	22109331	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.188000	0.50958	2.001000	0.58596	0.455000	0.32223	GTG	.		0.403	CMAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402235.1	NM_018686	
KMT2D	8085	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	49416134	49416134	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr12:49416134A>C	ENST00000301067.7	-	52	16340	c.16341T>G	c.(16339-16341)aaT>aaG	p.N5447K		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	5447	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										AGATGCCTCGATTCTAGAAAG	0.512																																					p.N5447K		.											.	MLL2-612	0			c.T16341G						.						45.0	44.0	44.0					12																	49416134		2076	4217	6293	SO:0001583	missense	8085	exon52			GCCTCGATTCTAG	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.16341T>G	12.37:g.49416134A>C	ENSP00000301067:p.Asn5447Lys	21	0		26	14	NM_003482	0	0	0	0	0	O14687	Missense_Mutation	SNP	ENST00000301067.7	37	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	A	13.01	2.109690	0.37242	.	.	ENSG00000167548	ENST00000301067;ENST00000526209	T;T	0.80824	-1.42;-1.42	5.11	0.159	0.14968	SET domain (3);	0.000000	0.38326	N	0.001723	D	0.85013	0.5600	L	0.60067	1.865	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.82888	-0.0234	10	0.87932	D	0	.	10.057	0.42250	0.4781:0.0:0.5219:0.0	.	5447	O14686	MLL2_HUMAN	K	5447;128	ENSP00000301067:N5447K;ENSP00000435714:N128K	ENSP00000301067:N5447K	N	-	3	2	MLL2	47702401	1.000000	0.71417	0.997000	0.53966	0.985000	0.73830	1.117000	0.31234	-0.129000	0.11620	-0.256000	0.11100	AAT	.		0.512	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
ULK1	8408	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	132405713	132405713	+	Silent	SNP	C	C	G			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr12:132405713C>G	ENST00000321867.4	+	27	3381	c.3030C>G	c.(3028-3030)gcC>gcG	p.A1010A	ULK1_ENST00000540647.1_Silent_p.A255A	NM_003565.2	NP_003556	O75385	ULK1_HUMAN	unc-51 like autophagy activating kinase 1	1010					autophagic vacuole assembly (GO:0000045)|axon extension (GO:0048675)|cellular response to nutrient levels (GO:0031669)|cerebellar granule cell differentiation (GO:0021707)|negative regulation of collateral sprouting (GO:0048671)|neuron projection development (GO:0031175)|neuron projection regeneration (GO:0031102)|positive regulation of autophagy (GO:0010508)|positive regulation of macroautophagy (GO:0016239)|protein autophosphorylation (GO:0046777)|protein localization (GO:0008104)|protein phosphorylation (GO:0006468)|radial glia guided migration of cerebellar granule cell (GO:0021933)|Ras protein signal transduction (GO:0007265)|receptor internalization (GO:0031623)|regulation of autophagy (GO:0010506)|regulation of neurotrophin TRK receptor signaling pathway (GO:0051386)|response to starvation (GO:0042594)	ATG1/UKL1 signaling complex (GO:0034273)|autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extrinsic component of autophagic vacuole membrane (GO:0097635)|extrinsic component of omegasome membrane (GO:0097629)|extrinsic component of pre-autophagosomal structure membrane (GO:0097632)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|pre-autophagosomal structure membrane (GO:0034045)|ULK1-ATG13-FIP200 complex (GO:0070969)	ATP binding (GO:0005524)|protein complex binding (GO:0032403)|protein serine/threonine kinase activity (GO:0004674)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	29	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.07e-08)|Epithelial(86;2.56e-07)|all cancers(50;3.01e-07)		ACCACAAGGCCCTGCTGCTCC	0.677																																					p.A1010A		.											.	ULK1-758	0			c.C3030G						.						54.0	52.0	53.0					12																	132405713		2203	4299	6502	SO:0001819	synonymous_variant	8408	exon27			CAAGGCCCTGCTG	AF045458	CCDS9274.1	12q24.3	2014-02-12	2013-07-02		ENSG00000177169	ENSG00000177169			12558	protein-coding gene	gene with protein product	"""ATG1 autophagy related 1 homolog (S. cerevisiae)"""	603168	"""unc-51 (C. elegans)-like kinase 1"", ""unc-51-like kinase 1 (C. elegans)"""			9693035	Standard	NM_003565		Approved	ATG1, ATG1A	uc001uje.3	O75385	OTTHUMG00000168052	ENST00000321867.4:c.3030C>G	12.37:g.132405713C>G		89	0		96	53	NM_003565	0	0	21	42	21	Q9UQ28	Silent	SNP	ENST00000321867.4	37	CCDS9274.1																																																																																			.		0.677	ULK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397769.3		
SSTR1	6751	hgsc.bcm.edu	37	14	38678657	38678657	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr14:38678657C>G	ENST00000267377.2	+	3	680	c.63C>G	c.(61-63)tgC>tgG	p.C21W		NM_001049.2	NP_001040.1	P30872	SSR1_HUMAN	somatostatin receptor 1	21					cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular response to estradiol stimulus (GO:0071392)|cerebellum development (GO:0021549)|digestion (GO:0007586)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glutamate receptor signaling pathway (GO:0007215)|negative regulation of cell proliferation (GO:0008285)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)	p.C21C(1)		breast(1)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	29	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00444)	Octreotide(DB00104)|Pasireotide(DB06663)	CGGGCAGCTGCGGCGAAGGCG	0.736																																					p.C21W		.											.	SSTR1-947	1	Substitution - coding silent(1)	central_nervous_system(1)	c.C63G						.						12.0	13.0	13.0					14																	38678657		2183	4234	6417	SO:0001583	missense	6751	exon3			CAGCTGCGGCGAA		CCDS9666.1	14q13	2012-08-08			ENSG00000139874	ENSG00000139874		"""GPCR / Class A : Somatostatin receptors"""	11330	protein-coding gene	gene with protein product		182451				8449518	Standard	NM_001049		Approved		uc001wul.1	P30872	OTTHUMG00000140249	ENST00000267377.2:c.63C>G	14.37:g.38678657C>G	ENSP00000267377:p.Cys21Trp	28	0		13	2	NM_001049	0	0	1	1	0		Missense_Mutation	SNP	ENST00000267377.2	37	CCDS9666.1	.	.	.	.	.	.	.	.	.	.	C	11.34	1.608924	0.28623	.	.	ENSG00000139874	ENST00000267377	T	0.70045	-0.45	5.17	1.05	0.20165	.	0.310059	0.23375	N	0.048870	T	0.36496	0.0969	N	0.08118	0	0.39683	D	0.970939	P	0.35700	0.516	B	0.24541	0.054	T	0.12528	-1.0544	10	0.37606	T	0.19	.	8.1652	0.31222	0.0:0.6547:0.0:0.3453	.	21	P30872	SSR1_HUMAN	W	21	ENSP00000267377:C21W	ENSP00000267377:C21W	C	+	3	2	SSTR1	37748408	0.002000	0.14202	0.877000	0.34402	0.931000	0.56810	0.205000	0.17356	0.016000	0.14998	0.563000	0.77884	TGC	.		0.736	SSTR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409930.2		
ARID4A	5926	hgsc.bcm.edu	37	14	58827678	58827678	+	Silent	SNP	G	G	T			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr14:58827678G>T	ENST00000355431.3	+	19	2371	c.1998G>T	c.(1996-1998)cgG>cgT	p.R666R	ARID4A_ENST00000431317.2_Silent_p.R666R|ARID4A_ENST00000348476.3_Silent_p.R666R|ARID4A_ENST00000395168.3_Silent_p.R666R	NM_002892.3	NP_002883.3	P29374	ARI4A_HUMAN	AT rich interactive domain 4A (RBP1-like)	666					erythrocyte development (GO:0048821)|histone H3-K4 trimethylation (GO:0080182)|histone H3-K9 trimethylation (GO:0036124)|histone H4-K20 trimethylation (GO:0034773)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of gene expression by genetic imprinting (GO:0006349)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|central_nervous_system(1)|cervix(4)|endometrium(8)|kidney(2)|large_intestine(14)|lung(19)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						AGTCAAAACGGGGACGACCTC	0.433																																					p.R666R		.											.	ARID4A-231	0			c.G1998T						.						172.0	159.0	163.0					14																	58827678		2203	4300	6503	SO:0001819	synonymous_variant	5926	exon19			AAAACGGGGACGA	S57153	CCDS9732.1, CCDS9733.1, CCDS45114.1	14q22.3	2013-02-07	2004-01-28	2004-01-28	ENSG00000032219	ENSG00000032219		"""-"""	9885	protein-coding gene	gene with protein product		180201	"""retinoblastoma-binding protein 1"""	RBBP1		1857421, 8455946	Standard	NM_023000		Approved	RBP1, RBP-1	uc001xdp.3	P29374	OTTHUMG00000140320	ENST00000355431.3:c.1998G>T	14.37:g.58827678G>T		105	0		97	13	NM_002892	0	0	10	10	0	Q15991|Q15992|Q15993	Silent	SNP	ENST00000355431.3	37	CCDS9732.1																																																																																			.		0.433	ARID4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276927.2	NM_023001	
ARID4A	5926	hgsc.bcm.edu	37	14	58827680	58827680	+	Missense_Mutation	SNP	G	G	C	rs145426502		TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr14:58827680G>C	ENST00000355431.3	+	19	2373	c.2000G>C	c.(1999-2001)gGa>gCa	p.G667A	ARID4A_ENST00000431317.2_Missense_Mutation_p.G667A|ARID4A_ENST00000348476.3_Missense_Mutation_p.G667A|ARID4A_ENST00000395168.3_Missense_Mutation_p.G667A	NM_002892.3	NP_002883.3	P29374	ARI4A_HUMAN	AT rich interactive domain 4A (RBP1-like)	667					erythrocyte development (GO:0048821)|histone H3-K4 trimethylation (GO:0080182)|histone H3-K9 trimethylation (GO:0036124)|histone H4-K20 trimethylation (GO:0034773)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of gene expression by genetic imprinting (GO:0006349)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|central_nervous_system(1)|cervix(4)|endometrium(8)|kidney(2)|large_intestine(14)|lung(19)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						TCAAAACGGGGACGACCTCCT	0.443																																					p.G667A		.											.	ARID4A-231	0			c.G2000C						.						172.0	159.0	163.0					14																	58827680		2203	4300	6503	SO:0001583	missense	5926	exon19			AACGGGGACGACC	S57153	CCDS9732.1, CCDS9733.1, CCDS45114.1	14q22.3	2013-02-07	2004-01-28	2004-01-28	ENSG00000032219	ENSG00000032219		"""-"""	9885	protein-coding gene	gene with protein product		180201	"""retinoblastoma-binding protein 1"""	RBBP1		1857421, 8455946	Standard	NM_023000		Approved	RBP1, RBP-1	uc001xdp.3	P29374	OTTHUMG00000140320	ENST00000355431.3:c.2000G>C	14.37:g.58827680G>C	ENSP00000347602:p.Gly667Ala	105	0		99	14	NM_002892	0	0	15	15	0	Q15991|Q15992|Q15993	Missense_Mutation	SNP	ENST00000355431.3	37	CCDS9732.1	.	.	.	.	.	.	.	.	.	.	G	26.3	4.723941	0.89298	.	.	ENSG00000032219	ENST00000355431;ENST00000348476;ENST00000395168;ENST00000431317;ENST00000417477	T;T;T;T;T	0.42900	0.96;0.96;0.96;0.96;0.96	5.71	5.71	0.89125	Chromo domain-like (1);	0.105040	0.64402	D	0.000004	T	0.56124	0.1964	L	0.34521	1.04	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.999	T	0.49790	-0.8902	10	0.35671	T	0.21	-26.8249	19.8505	0.96738	0.0:0.0:1.0:0.0	.	667;667;667	P29374-3;P29374;P29374-2	.;ARI4A_HUMAN;.	A	667;667;667;667;345	ENSP00000347602:G667A;ENSP00000344556:G667A;ENSP00000378597:G667A;ENSP00000397368:G667A;ENSP00000416053:G345A	ENSP00000344556:G667A	G	+	2	0	ARID4A	57897433	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.225000	0.78051	2.688000	0.91661	0.655000	0.94253	GGA	G|1.000;A|0.000		0.443	ARID4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276927.2	NM_023001	
ARHGAP11A	9824	hgsc.bcm.edu;bcgsc.ca	37	15	32916475	32916475	+	Silent	SNP	C	C	T			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr15:32916475C>T	ENST00000361627.3	+	4	1121	c.399C>T	c.(397-399)ctC>ctT	p.L133L	ARHGAP11A_ENST00000543522.1_5'UTR|ARHGAP11A_ENST00000563864.1_Silent_p.L133L|ARHGAP11A_ENST00000565905.1_5'UTR|ARHGAP11A_ENST00000567348.1_Silent_p.L133L	NM_014783.3	NP_055598.1	Q6P4F7	RHGBA_HUMAN	Rho GTPase activating protein 11A	133	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	31		all_lung(180;1.3e-11)		all cancers(64;3.34e-21)|Epithelial(43;2.64e-15)|GBM - Glioblastoma multiforme(186;5.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.00112)|Lung(196;0.227)		AGCCCATTCTCCCAGCTGATT	0.453																																					p.L133L	Colon(45;757 1134 30003 36652)	.											.	ARHGAP11A-292	0			c.C399T						.						35.0	35.0	35.0					15																	32916475		2200	4295	6495	SO:0001819	synonymous_variant	9824	exon4			CATTCTCCCAGCT	D87717	CCDS10028.1, CCDS58349.1, CCDS66730.1	15q13.3	2006-09-19			ENSG00000198826	ENSG00000198826		"""Rho GTPase activating proteins"""	15783	protein-coding gene	gene with protein product	"""GAP (1-12)"""	610589				11829490	Standard	NM_199357		Approved	KIAA0013	uc001zgy.1	Q6P4F7	OTTHUMG00000129289	ENST00000361627.3:c.399C>T	15.37:g.32916475C>T		157	0		142	31	NM_199357	0	0	0	2	2	B4DZN9|Q6PI96|Q9Y3S6	Silent	SNP	ENST00000361627.3	37	CCDS10028.1																																																																																			.		0.453	ARHGAP11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251417.1	NM_014783	
CDAN1	146059	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	43023981	43023981	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr15:43023981C>T	ENST00000356231.3	-	11	1599	c.1576G>A	c.(1576-1578)Gag>Aag	p.E526K		NM_138477.2	NP_612486.2	Q8IWY9	CDAN1_HUMAN	codanin 1	526					chromatin assembly (GO:0031497)|chromatin organization (GO:0006325)|negative regulation of DNA replication (GO:0008156)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|endomembrane system (GO:0012505)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(2)|kidney(4)|large_intestine(3)|lung(6)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(3)	24		all_cancers(109;5.4e-16)|all_epithelial(112;2.97e-14)|Lung NSC(122;1.75e-08)|all_lung(180;5.99e-08)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;2.49e-07)		TCTGGGGCCTCGCCCAAGACG	0.587																																					p.E526K		.											.	CDAN1-92	0			c.G1576A						.						38.0	42.0	41.0					15																	43023981		2203	4299	6502	SO:0001583	missense	146059	exon11			GGGCCTCGCCCAA	AF525398	CCDS32209.1	15q15.2	2012-04-25	2012-04-25			ENSG00000140326			1713	protein-coding gene	gene with protein product		607465	"""congenital dyserythropoietic anemia, type I"""			8634422, 12434312	Standard	XM_005254177		Approved	CDA-I, CDAI	uc001zql.3	Q8IWY9		ENST00000356231.3:c.1576G>A	15.37:g.43023981C>T	ENSP00000348564:p.Glu526Lys	102	0		103	35	NM_138477	0	0	4	4	0	Q6NYD0|Q7Z7L5|Q969N3	Missense_Mutation	SNP	ENST00000356231.3	37	CCDS32209.1	.	.	.	.	.	.	.	.	.	.	c	21.0	4.074758	0.76415	.	.	ENSG00000140326	ENST00000356231;ENST00000267892	D	0.90324	-2.65	5.9	4.99	0.66335	.	0.297879	0.39020	N	0.001487	D	0.92708	0.7682	M	0.65975	2.015	0.44432	D	0.997352	D	0.71674	0.998	P	0.54312	0.748	D	0.93041	0.6457	10	0.59425	D	0.04	-19.189	15.0277	0.71682	0.0:0.9321:0.0:0.0679	.	526	Q8IWY9	CDAN1_HUMAN	K	526;524	ENSP00000348564:E526K	ENSP00000267892:E524K	E	-	1	0	CDAN1	40811273	1.000000	0.71417	0.246000	0.24233	0.217000	0.24651	7.039000	0.76544	1.511000	0.48818	0.651000	0.88453	GAG	.		0.587	CDAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000431103.1	XM_085300	
GNB5	10681	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	52446239	52446239	+	Silent	SNP	C	C	T			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr15:52446239C>T	ENST00000261837.7	-	4	338	c.273G>A	c.(271-273)ggG>ggA	p.G91G	GNB5_ENST00000396335.4_Silent_p.G49G|GNB5_ENST00000358784.7_Silent_p.G49G|GNB5_ENST00000560116.1_Silent_p.G49G	NM_016194.3	NP_057278.2	O14775	GBB5_HUMAN	guanine nucleotide binding protein (G protein), beta 5	91					GTP catabolic process (GO:0006184)|negative regulation of voltage-gated calcium channel activity (GO:1901386)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|signal transduction (GO:0007165)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	chaperone binding (GO:0051087)|G-protein gamma-subunit binding (GO:0031682)|GTPase activity (GO:0003924)|signal transducer activity (GO:0004871)			large_intestine(1)|lung(1)	2				all cancers(107;0.0163)		TGACAAACTGCCCCAGGGCCT	0.572																																					p.G91G		.											.	GNB5-227	0			c.G273A						.						115.0	95.0	102.0					15																	52446239		2195	4293	6488	SO:0001819	synonymous_variant	10681	exon4			AAACTGCCCCAGG	AF017656	CCDS10149.1, CCDS45261.1	15q21.1	2013-01-10			ENSG00000069966	ENSG00000069966		"""WD repeat domain containing"""	4401	protein-coding gene	gene with protein product		604447				9606987	Standard	NM_016194		Approved	GB5	uc031qrz.1	O14775	OTTHUMG00000131892	ENST00000261837.7:c.273G>A	15.37:g.52446239C>T		80	0		57	17	NM_016194	0	0	27	52	25	B2RBR5|Q9HAU9|Q9UFT3	Silent	SNP	ENST00000261837.7	37	CCDS10149.1																																																																																			.		0.572	GNB5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254842.1		
HERC1	8925	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	64021464	64021464	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr15:64021464C>T	ENST00000443617.2	-	16	3212	c.3125G>A	c.(3124-3126)tGg>tAg	p.W1042*		NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	1042					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						ACTGCCATTCCAAGGACTTTC	0.363																																					p.W1042X		.											.	HERC1-666	0			c.G3125A						.						43.0	40.0	41.0					15																	64021464		1833	4095	5928	SO:0001587	stop_gained	8925	exon16			CCATTCCAAGGAC	U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.3125G>A	15.37:g.64021464C>T	ENSP00000390158:p.Trp1042*	40	0		25	4	NM_003922	0	0	7	8	1	Q8IW65	Nonsense_Mutation	SNP	ENST00000443617.2	37	CCDS45277.1	.	.	.	.	.	.	.	.	.	.	C	41	8.909842	0.99000	.	.	ENSG00000103657	ENST00000443617	.	.	.	5.6	5.6	0.85130	.	0.000000	0.64402	U	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	.	19.6131	0.95618	0.0:1.0:0.0:0.0	.	.	.	.	X	1042	.	ENSP00000390158:W1042X	W	-	2	0	HERC1	61808517	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.840000	0.69402	2.652000	0.90054	0.561000	0.74099	TGG	.		0.363	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418523.1	NM_003922	
SYNM	23336	broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	99672333	99672333	+	Silent	SNP	G	G	T			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr15:99672333G>T	ENST00000336292.6	+	5	3885	c.3765G>T	c.(3763-3765)gtG>gtT	p.V1255V	RP11-6O2.4_ENST00000566974.1_RNA|SYNM_ENST00000561323.1_3'UTR|SYNM_ENST00000560674.1_Intron|SYNM_ENST00000328642.7_Intron	NM_145728.2	NP_663780.2	O15061	SYNEM_HUMAN	synemin, intermediate filament protein	1256	Interaction with DMD and UTRN.|Interaction with TLN1 and VCL.|Tail.				intermediate filament cytoskeleton organization (GO:0045104)	adherens junction (GO:0005912)|costamere (GO:0043034)|intermediate filament (GO:0005882)|membrane (GO:0016020)|neurofilament cytoskeleton (GO:0060053)	intermediate filament binding (GO:0019215)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(6)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	29						AAGAGTCAGTGGGTACCCAGA	0.478																																					.	Pancreas(125;1071 1762 21750 40003 40381)												.	SYNM-26	0			.						.						51.0	51.0	51.0					15																	99672333		1892	4113	6005	SO:0001819	synonymous_variant	23336	.			GTCAGTGGGTACC	AK026420	CCDS73786.1, CCDS73787.1	15q26.3	2014-09-17	2008-09-19	2008-09-19	ENSG00000182253	ENSG00000182253		"""A-kinase anchor proteins"", ""Intermediate filaments type IV"""	24466	protein-coding gene	gene with protein product	"""synemin alpha"", ""synemin beta"""	606087	"""desmuslin"""	DMN		11737198, 11454237	Standard	NM_145728		Approved	KIAA0353, SYN	uc002bup.3	O15061		ENST00000336292.6:c.3765G>T	15.37:g.99672333G>T		78	0		93	33	.	0	0	0	2	2	A7E2Y2|Q2TBJ4|Q5NJJ9|Q8TE61|Q8TE62	Silent	SNP	ENST00000336292.6	37																																																																																				.		0.478	SYNM-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_145728	
AXIN1	8312	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	396884	396884	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr16:396884T>G	ENST00000262320.3	-	2	513	c.142A>C	c.(142-144)Aaa>Caa	p.K48Q	AXIN1_ENST00000354866.3_Missense_Mutation_p.K48Q|AXIN1_ENST00000481769.1_Intron	NM_003502.3	NP_003493.1	O15169	AXIN1_HUMAN	axin 1	48					activation of JUN kinase activity (GO:0007257)|activation of protein kinase activity (GO:0032147)|apoptotic process (GO:0006915)|axial mesoderm formation (GO:0048320)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060823)|cell death (GO:0008219)|cellular protein complex assembly (GO:0043623)|cellular response to organic cyclic compound (GO:0071407)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|dorsal/ventral axis specification (GO:0009950)|embryonic eye morphogenesis (GO:0048048)|embryonic skeletal joint morphogenesis (GO:0060272)|forebrain anterior/posterior pattern specification (GO:0021797)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|muscle cell development (GO:0055001)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of protein metabolic process (GO:0051248)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of Wnt signaling pathway (GO:0030178)|nucleocytoplasmic transport (GO:0006913)|olfactory placode formation (GO:0030910)|optic placode formation (GO:0001743)|positive regulation of GTPase activity (GO:0043547)|positive regulation of JNK cascade (GO:0046330)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|post-anal tail morphogenesis (GO:0036342)|protein catabolic process (GO:0030163)|protein homooligomerization (GO:0051260)|protein polyubiquitination (GO:0000209)|regulation of catenin import into nucleus (GO:0035412)|sensory perception of sound (GO:0007605)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)|Wnt-activated signaling pathway involved in forebrain neuron fate commitment (GO:0021881)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|protein complex scaffold (GO:0032947)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|ubiquitin protein ligase binding (GO:0031625)			biliary_tract(27)|breast(4)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(20)|liver(81)|lung(5)|ovary(2)|prostate(3)|salivary_gland(7)|skin(5)|stomach(4)|thyroid(41)|upper_aerodigestive_tract(4)|urinary_tract(2)	221		all_cancers(16;2.75e-07)|all_epithelial(16;1.6e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00774)|all_lung(18;0.0187)				CCAACACCTTTCCCGGAGCAG	0.627											OREG0003698	type=REGULATORY REGION|Gene=AXIN1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.K48Q		.											.	AXIN1-684	0			c.A142C						.						44.0	44.0	44.0					16																	396884		2202	4300	6502	SO:0001583	missense	8312	exon2			CACCTTTCCCGGA	AF009674	CCDS10405.1, CCDS10406.1	16p13.3	2012-04-17			ENSG00000103126	ENSG00000103126		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	903	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 49"""	603816				9230313	Standard	NM_003502		Approved	PPP1R49	uc002cgp.2	O15169	OTTHUMG00000064930	ENST00000262320.3:c.142A>C	16.37:g.396884T>G	ENSP00000262320:p.Lys48Gln	59	0	588	70	39	NM_181050	0	0	11	28	17	Q4TT26|Q4TT27|Q86YA7|Q8WVW6|Q96S28	Missense_Mutation	SNP	ENST00000262320.3	37	CCDS10405.1	.	.	.	.	.	.	.	.	.	.	T	17.68	3.449477	0.63178	.	.	ENSG00000103126	ENST00000262320;ENST00000354866	T;T	0.61980	0.06;0.07	5.34	5.34	0.76211	.	0.138741	0.64402	D	0.000005	T	0.77143	0.4087	M	0.74258	2.255	0.58432	D	0.999991	D;D	0.69078	0.997;0.996	D;P	0.63703	0.917;0.894	T	0.80051	-0.1544	10	0.62326	D	0.03	-17.2364	15.3197	0.74112	0.0:0.0:0.0:1.0	.	48;48	O15169-2;O15169	.;AXIN1_HUMAN	Q	48	ENSP00000262320:K48Q;ENSP00000346935:K48Q	ENSP00000262320:K48Q	K	-	1	0	AXIN1	336885	1.000000	0.71417	0.998000	0.56505	0.388000	0.30384	5.889000	0.69766	2.039000	0.60335	0.533000	0.62120	AAA	.		0.627	AXIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139441.3		
HAGH	3029	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	1869997	1869997	+	Silent	SNP	A	A	G			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr16:1869997A>G	ENST00000397356.3	-	4	739	c.333T>C	c.(331-333)aaT>aaC	p.N111N	HAGH_ENST00000455446.2_Silent_p.N111N|HAGH_ENST00000566709.1_Silent_p.N63N|HAGH_ENST00000397353.2_Silent_p.N63N	NM_005326.4	NP_005317.2	Q16775	GLO2_HUMAN	hydroxyacylglutathione hydrolase	111					glutathione biosynthetic process (GO:0006750)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	hydroxyacylglutathione hydrolase activity (GO:0004416)|zinc ion binding (GO:0008270)			kidney(2)|lung(1)|ovary(1)|skin(1)	5		Hepatocellular(780;0.00335)			Glutathione(DB00143)	CCAGTTTCTCATTCCCGCCAG	0.617																																					p.N111N	Pancreas(55;1048 1176 25227 40124 41333)	.											.	HAGH-91	0			c.T333C						.						95.0	78.0	83.0					16																	1869997		2199	4300	6499	SO:0001819	synonymous_variant	3029	exon4			TTTCTCATTCCCG	X90999	CCDS32366.1, CCDS10447.2, CCDS66900.1	16p13.3	2012-10-02	2003-11-04		ENSG00000063854	ENSG00000063854	3.1.2.6		4805	protein-coding gene	gene with protein product		138760	"""hydroxyacyl glutathione hydrolase"""			3025077, 7327557	Standard	NM_001286249		Approved	GLO2, GLXII, HAGH1	uc002cna.3	Q16775	OTTHUMG00000128662	ENST00000397356.3:c.333T>C	16.37:g.1869997A>G		122	0		135	26	NM_005326	0	0	107	157	50	A8K290|B4DP33|B4DRA7|E7EN93	Silent	SNP	ENST00000397356.3	37	CCDS10447.2																																																																																			.		0.617	HAGH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250548.2	NM_005326	
CREBBP	1387	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	3807907	3807907	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr16:3807907G>A	ENST00000262367.5	-	18	4321	c.3512C>T	c.(3511-3513)aCa>aTa	p.T1171I	CREBBP_ENST00000382070.3_Missense_Mutation_p.T1133I	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	1171	Bromo. {ECO:0000255|PROSITE- ProRule:PRU00035}.|Interaction with ASF1A. {ECO:0000269|PubMed:24616510}.				cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		GACTCGGGATGTCTTGCGATT	0.502			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																														p.T1171I		.		Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	.	CREBBP-1807	0			c.C3512T	GRCh37	CI084721	CREBBP	I		.						148.0	125.0	133.0					16																	3807907		2197	4300	6497	SO:0001583	missense	1387	exon18			CGGGATGTCTTGC	U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.3512C>T	16.37:g.3807907G>A	ENSP00000262367:p.Thr1171Ile	111	0		147	39	NM_004380	0	0	11	12	1	D3DUC9|O00147|Q16376|Q4LE28	Missense_Mutation	SNP	ENST00000262367.5	37	CCDS10509.1	.	.	.	.	.	.	.	.	.	.	G	17.01	3.279568	0.59758	.	.	ENSG00000005339	ENST00000262367;ENST00000543883;ENST00000382070	T;T	0.19669	2.13;2.13	5.59	5.59	0.84812	Bromodomain (6);	0.000000	0.85682	D	0.000000	T	0.45236	0.1332	L	0.56199	1.76	0.80722	D	1	D;D	0.67145	0.996;0.996	D;D	0.83275	0.996;0.996	T	0.26608	-1.0098	10	0.62326	D	0.03	-14.9891	19.5896	0.95503	0.0:0.0:1.0:0.0	.	1201;1171	Q4LE28;Q92793	.;CBP_HUMAN	I	1171;1201;1133	ENSP00000262367:T1171I;ENSP00000371502:T1133I	ENSP00000262367:T1171I	T	-	2	0	CREBBP	3747908	1.000000	0.71417	0.993000	0.49108	0.989000	0.77384	9.731000	0.98807	2.632000	0.89209	0.585000	0.79938	ACA	.		0.502	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251591.2	NM_004380	
GLYR1	84656	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	4895118	4895118	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr16:4895118C>G	ENST00000321919.9	-	3	188	c.112G>C	c.(112-114)Gga>Cga	p.G38R	UBN1_ENST00000262376.6_5'Flank|GLYR1_ENST00000381983.3_Missense_Mutation_p.G38R|GLYR1_ENST00000591451.1_Missense_Mutation_p.G38R|UBN1_ENST00000545171.1_5'Flank|GLYR1_ENST00000436648.5_Missense_Mutation_p.G38R	NM_032569.3	NP_115958	Q49A26	GLYR1_HUMAN	glyoxylate reductase 1 homolog (Arabidopsis)	38	PWWP. {ECO:0000255|PROSITE- ProRule:PRU00162}.				pentose-phosphate shunt (GO:0006098)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|NAD binding (GO:0051287)|phosphogluconate dehydrogenase (decarboxylating) activity (GO:0004616)			endometrium(1)|kidney(1)|large_intestine(7)|lung(6)|prostate(2)|skin(1)|urinary_tract(1)	19						CATTTCTTTCCGCGAGGTTTC	0.463																																					p.G38R		.											.	GLYR1-90	0			c.G112C						.						107.0	118.0	115.0					16																	4895118		2197	4300	6497	SO:0001583	missense	84656	exon3			TCTTTCCGCGAGG	AF244907	CCDS10524.1	16p13.3	2010-02-17			ENSG00000140632	ENSG00000140632			24434	protein-coding gene	gene with protein product	"""nuclear protein 60kDa"""	610660				16352664	Standard	NM_032569		Approved	BM045, HIBDL, NP60, N-PAC	uc002cxx.4	Q49A26	OTTHUMG00000129530	ENST00000321919.9:c.112G>C	16.37:g.4895118C>G	ENSP00000322716:p.Gly38Arg	235	0		241	118	NM_032569	0	0	34	102	68	B4DL47|C9JJ40|C9JJ60|Q5U632|Q6P1Q2|Q6V3W7|Q9BTI1|Q9BXK2	Missense_Mutation	SNP	ENST00000321919.9	37	CCDS10524.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.062788	0.76187	.	.	ENSG00000140632	ENST00000321919;ENST00000381983;ENST00000436648	T;T;T	0.70045	-0.45;-0.45;-0.45	5.25	5.25	0.73442	PWWP (2);	0.000000	0.85682	D	0.000000	T	0.72787	0.3504	N	0.25647	0.755	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.72424	-0.4298	10	0.37606	T	0.19	-9.014	17.6028	0.88030	0.0:1.0:0.0:0.0	.	38;38;38	Q49A26-5;Q49A26-3;Q49A26	.;.;GLYR1_HUMAN	R	38	ENSP00000322716:G38R;ENSP00000371413:G38R;ENSP00000390276:G38R	ENSP00000322716:G38R	G	-	1	0	GLYR1	4835119	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	5.931000	0.70113	2.451000	0.82905	0.491000	0.48974	GGA	.		0.463	GLYR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251717.2	NM_032569	
PDXDC1	23042	hgsc.bcm.edu;broad.mit.edu	37	16	15122744	15122744	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr16:15122744T>G	ENST00000396410.4	+	15	1311	c.1214T>G	c.(1213-1215)tTt>tGt	p.F405C	PDXDC1_ENST00000450288.2_Missense_Mutation_p.F377C|PDXDC1_ENST00000563679.1_Missense_Mutation_p.F423C|PDXDC1_ENST00000325823.7_Missense_Mutation_p.F390C|PDXDC1_ENST00000447912.2_Missense_Mutation_p.F314C|PDXDC1_ENST00000569715.1_Missense_Mutation_p.F378C|PDXDC1_ENST00000455313.2_Missense_Mutation_p.F382C|PDXDC1_ENST00000535621.2_Missense_Mutation_p.F405C	NM_015027.2	NP_055842.2	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain containing 1	405					carboxylic acid metabolic process (GO:0019752)	Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)	carboxy-lyase activity (GO:0016831)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(2)|liver(1)|lung(10)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						GATCCGGTGTTTAAAGCCGTC	0.552																																					p.F405C		.											.	PDXDC1-91	0			c.T1214G						.						93.0	84.0	87.0					16																	15122744		2197	4300	6497	SO:0001583	missense	23042	exon15			CGGTGTTTAAAGC	AK025504, BX647809	CCDS32393.1, CCDS66954.1, CCDS66957.1, CCDS73830.1, CCDS73831.1	16p13.11	2008-02-05							28995	protein-coding gene	gene with protein product		614244					Standard	XM_005255173		Approved	KIAA0251	uc002dda.4	Q6P996	OTTHUMG00000166304	ENST00000396410.4:c.1214T>G	16.37:g.15122744T>G	ENSP00000379691:p.Phe405Cys	85	0		102	6	NM_015027	0	0	0	0	0	B4DR55|B4DSL3|E7EMH5|E7EPL4|H3BNZ1|O00236|Q4F6X7|Q6PID7|Q86YF1|Q8N4Q9|Q8TBS5	Missense_Mutation	SNP	ENST00000396410.4	37	CCDS32393.1	.	.	.	.	.	.	.	.	.	.	T	7.666	0.685974	0.14973	.	.	ENSG00000179889	ENST00000325823;ENST00000447912;ENST00000535621;ENST00000396410;ENST00000450288;ENST00000537781;ENST00000455313	T;T;T;T;T;T	0.28454	1.61;2.14;2.04;1.61;1.61;1.9	5.23	2.85	0.33270	Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.687962	0.14343	N	0.325608	T	0.19805	0.0476	N	0.22421	0.69	0.09310	N	1	P;P;P;P;P;P	0.42357	0.614;0.614;0.777;0.777;0.614;0.562	B;B;B;B;B;B	0.42916	0.243;0.243;0.312;0.312;0.227;0.402	T	0.07214	-1.0784	10	0.42905	T	0.14	-0.7059	3.6422	0.08172	0.1651:0.1907:0.0:0.6442	.	377;314;405;377;405;382	E7EPL4;E7EMH5;Q86XE2;B4DR55;Q6P996;Q6P996-2	.;.;.;.;PDXD1_HUMAN;.	C	390;314;405;405;377;111;382	ENSP00000322807:F390C;ENSP00000400310:F314C;ENSP00000437835:F405C;ENSP00000379691:F405C;ENSP00000391147:F377C;ENSP00000406703:F382C	ENSP00000322807:F390C	F	+	2	0	PDXDC1	15030245	0.000000	0.05858	0.230000	0.23976	0.025000	0.11179	-0.337000	0.07852	0.944000	0.37579	0.533000	0.62120	TTT	.		0.552	PDXDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389065.2	NM_015027	
PALB2	79728	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	23646368	23646368	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr16:23646368G>A	ENST00000261584.4	-	4	1651	c.1499C>T	c.(1498-1500)tCt>tTt	p.S500F		NM_024675.3	NP_078951.2	Q86YC2	PALB2_HUMAN	partner and localizer of BRCA2	500	DNA-binding (with the preference D loop > dsDNA > ssDNA).				DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|inner cell mass cell proliferation (GO:0001833)|mesoderm development (GO:0007498)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|post-anal tail morphogenesis (GO:0036342)|somitogenesis (GO:0001756)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(21)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(3)	55				GBM - Glioblastoma multiforme(48;0.0167)		TGCCTTCCTAGACAAGTCATT	0.473			"""F, N, Mis"""			"""Wilms tumor, medulloblastoma, AML ,breast"""		Involved in tolerance or repair of DNA crosslinks																													p.S500F		.	yes	Rec		"""Fanconi anaemia N, breast cancer susceptibility """	16	16p12.1	79728	partner and localizer of BRCA2		"""L, O, E"""	.	PALB2-1351	0			c.C1499T						.						146.0	143.0	144.0					16																	23646368		2197	4300	6497	SO:0001583	missense	79728	exon4			TTCCTAGACAAGT		CCDS32406.1	16p12.1	2014-09-17				ENSG00000083093		"""Fanconi anemia, complementation groups"""	26144	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group N"""	610355				16793542, 17200672	Standard	NM_024675		Approved	FLJ21816, FANCN	uc002dlx.1	Q86YC2		ENST00000261584.4:c.1499C>T	16.37:g.23646368G>A	ENSP00000261584:p.Ser500Phe	194	0		242	64	NM_024675	0	0	8	13	5	A6NIE1|Q8N7Y6|Q8ND31|Q9H6W1	Missense_Mutation	SNP	ENST00000261584.4	37	CCDS32406.1	.	.	.	.	.	.	.	.	.	.	g	17.98	3.521575	0.64747	.	.	ENSG00000083093	ENST00000261584	T	0.17691	2.26	5.27	1.12	0.20585	.	0.782893	0.11510	N	0.556845	T	0.15955	0.0384	L	0.57536	1.79	0.09310	N	1	B	0.11235	0.004	B	0.12156	0.007	T	0.27606	-1.0069	10	0.46703	T	0.11	-0.048	4.9673	0.14096	0.2567:0.1532:0.5902:0.0	.	500	Q86YC2	PALB2_HUMAN	F	500	ENSP00000261584:S500F	ENSP00000261584:S500F	S	-	2	0	PALB2	23553869	0.000000	0.05858	0.000000	0.03702	0.614000	0.37383	0.098000	0.15189	0.057000	0.16193	-0.121000	0.15023	TCT	.		0.473	PALB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435287.2	NM_024675	
CENPT	80152	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	67863889	67863889	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr16:67863889T>A	ENST00000562787.1	-	12	1513	c.965A>T	c.(964-966)gAa>gTa	p.E322V	CENPT_ENST00000440851.2_Missense_Mutation_p.E322V|CENPT_ENST00000562947.1_5'Flank|CENPT_ENST00000564817.1_Missense_Mutation_p.E322V|CENPT_ENST00000219172.3_Missense_Mutation_p.E322V	NM_025082.3	NP_079358.3	Q96BT3	CENPT_HUMAN	centromere protein T	322	Flexible stalk domain. {ECO:0000250}.				chromosome organization (GO:0051276)|chromosome segregation (GO:0007059)|kinetochore assembly (GO:0051382)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|lung(6)|urinary_tract(1)	10		Acute lymphoblastic leukemia(13;0.000299)|all_hematologic(13;0.0184)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00429)|Epithelial(162;0.019)|all cancers(182;0.124)		GGGCTCTACTTCATCTTCTCC	0.532																																					p.E322V		.											.	CENPT-90	0			c.A965T						.						189.0	187.0	188.0					16																	67863889		2040	4195	6235	SO:0001583	missense	80152	exon12			TCTACTTCATCTT	AK056097	CCDS42182.1	16q22.1	2013-11-05	2006-06-15	2006-06-15		ENSG00000102901			25787	protein-coding gene	gene with protein product		611510	"""chromosome 16 open reading frame 56"""	C16orf56		16622420, 16622419	Standard	NM_025082		Approved	FLJ13111, CENP-T	uc002eun.4	Q96BT3		ENST00000562787.1:c.965A>T	16.37:g.67863889T>A	ENSP00000457810:p.Glu322Val	290	0		314	79	NM_025082	0	0	34	44	10	Q96I29|Q96IC6|Q96NK9|Q9H901	Missense_Mutation	SNP	ENST00000562787.1	37	CCDS42182.1	.	.	.	.	.	.	.	.	.	.	T	10.97	1.502660	0.26949	.	.	ENSG00000102901	ENST00000440851;ENST00000436104;ENST00000219172	T;T	0.43294	0.95;0.95	4.08	-1.05	0.10036	.	0.294496	0.23852	N	0.043925	T	0.23249	0.0562	L	0.29908	0.895	0.26493	N	0.974919	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.09377	0.004;0.002;0.001	T	0.07635	-1.0762	10	0.42905	T	0.14	.	3.7971	0.08744	0.1696:0.5023:0.0:0.3281	.	80;322;322	F5H5A6;Q96BT3;B3KPB2	.;CENPT_HUMAN;.	V	322;80;322	ENSP00000400140:E322V;ENSP00000219172:E322V	ENSP00000219172:E322V	E	-	2	0	CENPT	66421390	0.000000	0.05858	0.023000	0.16930	0.019000	0.09904	-1.893000	0.01609	0.003000	0.14656	-0.313000	0.08912	GAA	.		0.532	CENPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422020.1	NM_025082	
KDM6B	23135	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	7755333	7755333	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr17:7755333G>C	ENST00000448097.2	+	18	4561	c.4230G>C	c.(4228-4230)tgG>tgC	p.W1410C	KDM6B_ENST00000254846.5_Missense_Mutation_p.W1410C			O15054	KDM6B_HUMAN	lysine (K)-specific demethylase 6B	1410	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				cardiac muscle cell differentiation (GO:0055007)|cellular response to hydrogen peroxide (GO:0070301)|endothelial cell differentiation (GO:0045446)|inflammatory response (GO:0006954)|mesodermal cell differentiation (GO:0048333)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(3)|lung(18)|ovary(1)|pancreas(1)|skin(5)	37						ACTGCGAGTGGTTCGCGGTGC	0.627											OREG0024145	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.W1410C		.											.	KDM6B-205	0			c.G4230C						.						93.0	80.0	84.0					17																	7755333		2203	4300	6503	SO:0001583	missense	23135	exon18			CGAGTGGTTCGCG	AB002344	CCDS32552.1	17p13.1	2011-07-01	2009-04-17	2009-04-17		ENSG00000132510		"""Chromatin-modifying enzymes / K-demethylases"""	29012	protein-coding gene	gene with protein product		611577	"""jumonji domain containing 3"", ""jumonji domain containing 3, histone lysine demethylase"""	JMJD3		10662545, 9205841	Standard	NM_001080424		Approved	KIAA0346	uc002giw.1	O15054		ENST00000448097.2:c.4230G>C	17.37:g.7755333G>C	ENSP00000412513:p.Trp1410Cys	86	0	644	71	14	NM_001080424	0	0	30	48	18	C9IZ40|Q96G33	Missense_Mutation	SNP	ENST00000448097.2	37		.	.	.	.	.	.	.	.	.	.	G	14.04	2.416033	0.42817	.	.	ENSG00000132510	ENST00000254846;ENST00000448097	D;D	0.86230	-2.09;-2.09	4.99	3.95	0.45737	Transcription factor jumonji/aspartyl beta-hydroxylase (2);Transcription factor jumonji (1);	0.062767	0.64402	D	0.000002	D	0.95194	0.8442	H	0.95780	3.72	0.80722	D	1	D;B	0.89917	1.0;0.058	D;B	0.97110	1.0;0.064	D	0.95975	0.8973	10	0.87932	D	0	-8.7797	15.1416	0.72615	0.0:0.1428:0.8572:0.0	.	1410;1410	O15054;O15054-1	KDM6B_HUMAN;.	C	1410	ENSP00000254846:W1410C;ENSP00000412513:W1410C	ENSP00000254846:W1410C	W	+	3	0	KDM6B	7696058	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	7.404000	0.79996	2.769000	0.95229	0.561000	0.74099	TGG	.		0.627	KDM6B-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000440248.1	XM_043272	
KRT33A	3883	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	39505660	39505660	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr17:39505660C>G	ENST00000007735.3	-	2	413	c.369G>C	c.(367-369)gaG>gaC	p.E123D		NM_004138.3	NP_004129.2	O76009	KT33A_HUMAN	keratin 33A	123	Coil 1B.|Rod.					extracellular space (GO:0005615)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	21		Breast(137;0.000496)				GCCTGGCATTCTCAGACTTGC	0.478																																					p.E123D		.											.	KRT33A-90	0			c.G369C						.						110.0	100.0	104.0					17																	39505660		2203	4300	6503	SO:0001583	missense	3883	exon2			GGCATTCTCAGAC	Y16788	CCDS11388.1	17q21.2	2013-06-20	2006-07-17	2006-07-17	ENSG00000006059	ENSG00000006059		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6450	protein-coding gene	gene with protein product	"""hard keratin type I 3I"""	602761	"""keratin, hair, acidic, 3A"""	KRTHA3A		7565656, 16831889	Standard	NM_004138		Approved	Ha-3I, Krt1-3	uc002hwk.2	O76009	OTTHUMG00000133432	ENST00000007735.3:c.369G>C	17.37:g.39505660C>G	ENSP00000007735:p.Glu123Asp	70	0		74	32	NM_004138	0	0	0	0	0	B2RA87|Q6NTB9|Q6ZZB9	Missense_Mutation	SNP	ENST00000007735.3	37	CCDS11388.1	.	.	.	.	.	.	.	.	.	.	C	12.38	1.920429	0.33908	.	.	ENSG00000006059	ENST00000007735	D	0.89617	-2.54	4.8	4.8	0.61643	Filament (1);	0.000000	0.64402	D	0.000019	D	0.84750	0.5541	L	0.42744	1.35	0.31832	N	0.624605	B	0.22211	0.066	B	0.34385	0.181	T	0.80443	-0.1380	10	0.27082	T	0.32	.	8.7524	0.34626	0.1523:0.572:0.2757:0.0	.	123	O76009	KT33A_HUMAN	D	123	ENSP00000007735:E123D	ENSP00000007735:E123D	E	-	3	2	KRT33A	36759186	0.937000	0.31787	1.000000	0.80357	0.994000	0.84299	0.006000	0.13152	2.643000	0.89663	0.655000	0.94253	GAG	.		0.478	KRT33A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257295.1	NM_004138	
SCRN2	90507	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	45916322	45916322	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr17:45916322C>A	ENST00000290216.9	-	5	732	c.607G>T	c.(607-609)Gcc>Tcc	p.A203S	SCRN2_ENST00000407215.3_Missense_Mutation_p.A203S|SCRN2_ENST00000584123.1_Missense_Mutation_p.A211S	NM_001145023.1|NM_138355.3	NP_001138495.1|NP_612364.2	Q96FV2	SCRN2_HUMAN	secernin 2	203						extracellular vesicular exosome (GO:0070062)	dipeptidase activity (GO:0016805)			cervix(1)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|skin(1)	14						GGGTGTTGGGCCGAGATGTCC	0.592																																					p.A203S		.											.	SCRN2-91	0			c.G607T						.						85.0	89.0	88.0					17																	45916322		2203	4300	6503	SO:0001583	missense	90507	exon5			GTTGGGCCGAGAT	BC002980	CCDS11519.1, CCDS45723.1	17q21	2008-02-05							30381	protein-coding gene	gene with protein product		614966				12221138	Standard	NM_001145023		Approved		uc002imd.3	Q96FV2		ENST00000290216.9:c.607G>T	17.37:g.45916322C>A	ENSP00000290216:p.Ala203Ser	219	0		177	57	NM_138355	0	0	42	82	40	A8K3N1|B7Z8S7|E9PBV5|Q96AC3|Q9BU04	Missense_Mutation	SNP	ENST00000290216.9	37	CCDS11519.1	.	.	.	.	.	.	.	.	.	.	C	1.216	-0.628224	0.03610	.	.	ENSG00000141295	ENST00000290216;ENST00000407215	T;T	0.20881	2.04;2.04	5.52	5.52	0.82312	.	0.215480	0.47455	D	0.000225	T	0.15392	0.0371	L	0.37630	1.12	0.09310	N	1	B;B;B	0.25850	0.051;0.136;0.051	B;B;B	0.27608	0.081;0.081;0.081	T	0.25606	-1.0127	10	0.07482	T	0.82	-11.1584	11.6628	0.51356	0.0:0.9174:0.0:0.0825	.	203;203;203	E9PBV5;Q96FV2;B7Z8S7	.;SCRN2_HUMAN;.	S	203	ENSP00000290216:A203S;ENSP00000383935:A203S	ENSP00000290216:A203S	A	-	1	0	SCRN2	43271321	0.000000	0.05858	0.026000	0.17262	0.066000	0.16364	0.485000	0.22324	2.588000	0.87417	0.655000	0.94253	GCC	.		0.592	SCRN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441383.1	NM_138355	
AATK	9625	broad.mit.edu	37	17	79094413	79094413	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr17:79094413A>C	ENST00000326724.4	-	11	3347	c.3323T>G	c.(3322-3324)cTg>cGg	p.L1108R	AATK_ENST00000417379.1_Missense_Mutation_p.L1005R	NM_001080395.2	NP_001073864.2	Q6ZMQ8	LMTK1_HUMAN	apoptosis-associated tyrosine kinase	1108	Pro-rich.				brain development (GO:0007420)|negative regulation of axon extension (GO:0030517)|neuron apoptotic process (GO:0051402)|peptidyl-tyrosine autophosphorylation (GO:0038083)|Rab protein signal transduction (GO:0032482)	axonal growth cone (GO:0044295)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			endometrium(2)|kidney(2)|lung(8)|ovary(3)|prostate(1)|stomach(4)|upper_aerodigestive_tract(1)	21	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			TTCTGATCTCAGCGGAACCGG	0.692																																					p.L1108R													.	AATK-933	0			c.T3323G						.						8.0	9.0	9.0					17																	79094413		1800	4036	5836	SO:0001583	missense	9625	exon11			GATCTCAGCGGAA	AB014541	CCDS45807.1, CCDS58607.1	17q25.3	2014-06-12			ENSG00000181409	ENSG00000181409			21	protein-coding gene	gene with protein product	"""lemur tyrosine kinase 1"", ""protein phosphatase 1, regulatory subunit 77"""	605276				9734811, 10083745	Standard	NM_001080395		Approved	AATYK, KIAA0641, LMTK1, LMR1, AATYK1, PPP1R77	uc010dia.3	Q6ZMQ8	OTTHUMG00000132717	ENST00000326724.4:c.3323T>G	17.37:g.79094413A>C	ENSP00000324196:p.Leu1108Arg	24	0		13	3	NM_001080395	0	0	0	0	0	O75136|Q6ZN31|Q86X28	Missense_Mutation	SNP	ENST00000326724.4	37	CCDS45807.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	7.862|7.862	0.726238|0.726238	0.15439|0.15439	.|.	.|.	ENSG00000181409|ENSG00000181409	ENST00000326724|ENST00000417379	T|.	0.79033|.	-1.23|.	4.32|4.32	-1.87|-1.87	0.07737|0.07737	.|.	1.360170|.	0.05149|.	N|.	0.495650|.	T|.	0.21427|.	0.0516|.	N|N	0.24115|0.24115	0.695|0.695	0.09310|0.09310	N|N	1|1	B|.	0.14438|.	0.01|.	B|.	0.11329|.	0.006|.	T|.	0.29912|.	-0.9996|.	10|.	0.72032|.	D|.	0.01|.	.|.	5.5575|5.5575	0.17125|0.17125	0.6453:0.1626:0.1921:0.0|0.6453:0.1626:0.1921:0.0	.|.	1108|.	Q6ZMQ8|.	LMTK1_HUMAN|.	R|G	1108|1061	ENSP00000324196:L1108R|.	ENSP00000324196:L1108R|.	L|X	-|-	2|1	0|0	AATK|AATK	76709008|76709008	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.024000|0.024000	0.10985|0.10985	-0.610000|-0.610000	0.05629|0.05629	-0.443000|-0.443000	0.07180|0.07180	0.260000|0.260000	0.18958|0.18958	CTG|TGA	.		0.692	AATK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256055.1	NM_004920	
NARF	26502	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	80443450	80443450	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr17:80443450G>A	ENST00000309794.11	+	10	1247	c.1049G>A	c.(1048-1050)cGa>cAa	p.R350Q	NARF-IT1_ENST00000584012.1_RNA|NARF_ENST00000345415.7_Missense_Mutation_p.R302Q|NARF_ENST00000390006.4_Missense_Mutation_p.R291Q|NARF_ENST00000457415.3_Missense_Mutation_p.R396Q	NM_012336.3|NM_031968.2	NP_036468.1|NP_114174.1	Q9UHQ1	NARF_HUMAN	nuclear prelamin A recognition factor	350						lamin filament (GO:0005638)|nuclear lamina (GO:0005652)|nuclear lumen (GO:0031981)|nucleus (GO:0005634)	lamin binding (GO:0005521)			endometrium(2)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.0143)|BRCA - Breast invasive adenocarcinoma(99;0.0369)			TATGGCTTTCGAAACATCCAG	0.493																																					p.R350Q		.											.	NARF-226	0			c.G1049A						.						151.0	133.0	139.0					17																	80443450		2203	4300	6503	SO:0001583	missense	26502	exon10			GCTTTCGAAACAT	BC000438	CCDS32777.1, CCDS42403.1, CCDS42404.1	17q25.3	2011-12-19			ENSG00000141562	ENSG00000141562			29916	protein-coding gene	gene with protein product	"""iron-only hydrogenase-like protein 2"""	605349				10514485, 15667261	Standard	NM_031968		Approved	FLJ10067, DKFZp434G0420, IOP2	uc002kfg.4	Q9UHQ1		ENST00000309794.11:c.1049G>A	17.37:g.80443450G>A	ENSP00000309899:p.Arg350Gln	156	0		142	18	NM_012336	0	0	70	84	14	A6NCJ3|B3KPX2|K4DI98|Q96AY9|Q9BWC6	Missense_Mutation	SNP	ENST00000309794.11	37	CCDS32777.1	.	.	.	.	.	.	.	.	.	.	.	16.94	3.261532	0.59431	.	.	ENSG00000141562	ENST00000390006;ENST00000374611;ENST00000309794;ENST00000345415	T;T;T	0.47177	0.85;0.85;0.85	5.32	5.32	0.75619	Iron hydrogenase, large subunit, C-terminal (1);Iron hydrogenase (1);	0.000000	0.85682	D	0.000000	T	0.63355	0.2504	M	0.77406	2.37	0.80722	D	1	D;D;D;P	0.55605	0.972;0.972;0.961;0.895	P;P;P;P	0.54140	0.743;0.743;0.727;0.473	T	0.63332	-0.6661	10	0.33940	T	0.23	-19.4724	17.9724	0.89117	0.0:0.0:1.0:0.0	.	396;302;397;350	Q9UHQ1-2;Q9UHQ1-3;E9PH27;Q9UHQ1	.;.;.;NARF_HUMAN	Q	291;397;350;302	ENSP00000374656:R291Q;ENSP00000309899:R350Q;ENSP00000283996:R302Q	ENSP00000309899:R350Q	R	+	2	0	NARF	78036739	1.000000	0.71417	0.941000	0.38009	0.854000	0.48673	9.273000	0.95719	2.480000	0.83734	0.561000	0.74099	CGA	.		0.493	NARF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443573.2	NM_031968	
EPB41L3	23136	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	5394764	5394764	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr18:5394764T>G	ENST00000341928.2	-	22	3522	c.3182A>C	c.(3181-3183)aAa>aCa	p.K1061T	EPB41L3_ENST00000342933.3_Missense_Mutation_p.K1061T|EPB41L3_ENST00000540638.2_Missense_Mutation_p.K839T|EPB41L3_ENST00000542146.1_Missense_Mutation_p.K366T|EPB41L3_ENST00000544123.1_Intron|EPB41L3_ENST00000400111.3_Missense_Mutation_p.K839T|EPB41L3_ENST00000427684.2_Missense_Mutation_p.K358T|EPB41L3_ENST00000542652.2_5'UTR	NM_012307.2	NP_036439.2	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	1061	C-terminal (CTD).				apoptotic process (GO:0006915)|cortical actin cytoskeleton organization (GO:0030866)|cortical cytoskeleton organization (GO:0030865)|cytoskeletal anchoring at plasma membrane (GO:0007016)|myelin maintenance (GO:0043217)|neuron projection morphogenesis (GO:0048812)|paranodal junction assembly (GO:0030913)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|protein localization to plasma membrane (GO:0072659)|regulation of cell shape (GO:0008360)	axolemma (GO:0030673)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|juxtaparanode region of axon (GO:0044224)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(52)|ovary(5)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	105						GTGCTGCTCTTTGGCCTCTTT	0.498																																					p.K1061T		.											.	EPB41L3-95	0			c.A3182C						.						208.0	171.0	184.0					18																	5394764		2203	4300	6503	SO:0001583	missense	23136	exon22			TGCTCTTTGGCCT	AB023204	CCDS11838.1, CCDS62381.1, CCDS62382.1	18p11.32	2006-06-28			ENSG00000082397	ENSG00000082397			3380	protein-coding gene	gene with protein product		605331				9828140, 9892180	Standard	NM_012307		Approved	DAL1, KIAA0987, 4.1B	uc002kmt.1	Q9Y2J2	OTTHUMG00000131562	ENST00000341928.2:c.3182A>C	18.37:g.5394764T>G	ENSP00000343158:p.Lys1061Thr	133	0		125	46	NM_012307	0	0	19	25	6	B7Z4I5|F5GX05|O95713|Q9BRP5	Missense_Mutation	SNP	ENST00000341928.2	37	CCDS11838.1	.	.	.	.	.	.	.	.	.	.	T	27.7	4.858556	0.91433	.	.	ENSG00000082397	ENST00000341928;ENST00000540638;ENST00000545076;ENST00000427684;ENST00000542146;ENST00000342933;ENST00000400111	T;D;T;T;T;T	0.85339	-1.48;-1.97;-1.48;-1.48;-1.48;-1.48	5.82	5.82	0.92795	Band 4.1, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.89996	0.6877	L	0.49126	1.545	0.80722	D	1	D;D;D;D;P;D;P	0.89917	1.0;1.0;1.0;1.0;0.66;1.0;0.887	D;D;D;D;B;D;P	0.91635	0.996;0.99;0.994;0.998;0.376;0.999;0.809	D	0.88953	0.3388	10	0.36615	T	0.2	.	16.1814	0.81903	0.0:0.0:0.0:1.0	.	358;366;453;730;839;1061;296	E7EUF8;F5H7W5;B7Z8M8;A8K968;Q9Y2J2-2;Q9Y2J2;B3KT50	.;.;.;.;.;E41L3_HUMAN;.	T	1061;730;730;358;366;1061;839	ENSP00000343158:K1061T;ENSP00000442091:K730T;ENSP00000392195:K358T;ENSP00000442233:K366T;ENSP00000341138:K1061T;ENSP00000382981:K839T	ENSP00000343158:K1061T	K	-	2	0	EPB41L3	5384764	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.991000	0.88244	2.234000	0.73211	0.533000	0.62120	AAA	.		0.498	EPB41L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254424.1	NM_012307	
STK11	6794	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	1223168	1223168	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr19:1223168C>T	ENST00000326873.7	+	8	2278	c.1105C>T	c.(1105-1107)Ccc>Tcc	p.P369S		NM_000455.4	NP_000446.1	Q15831	STK11_HUMAN	serine/threonine kinase 11	369					activation of protein kinase activity (GO:0032147)|anoikis (GO:0043276)|autophagy (GO:0006914)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|energy reserve metabolic process (GO:0006112)|establishment of cell polarity (GO:0030010)|glucose homeostasis (GO:0042593)|Golgi localization (GO:0051645)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|positive regulation of axonogenesis (GO:0050772)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive thymic T cell selection (GO:0045059)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of protein kinase B signaling (GO:0051896)|regulation of Wnt signaling pathway (GO:0030111)|response to glucagon (GO:0033762)|response to ionizing radiation (GO:0010212)|response to lipid (GO:0033993)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)|T cell receptor signaling pathway (GO:0050852)|TCR signalosome assembly (GO:0036399)|tissue homeostasis (GO:0001894)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|TCR signalosome (GO:0036398)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|p53 binding (GO:0002039)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.0?(20)		biliary_tract(1)|breast(3)|cervix(35)|gastrointestinal_tract_(site_indeterminate)(5)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|liver(1)|lung(219)|oesophagus(1)|ovary(4)|pancreas(6)|prostate(2)|skin(15)|small_intestine(1)|stomach(9)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	328		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)		CTTCACGGTGCCCGGTGAGTC	0.642		14	"""D, Mis, N, F, S"""		"""NSCLC, pancreatic"""	"""jejunal harmartoma, ovarian, testicular, pancreatic"""			Peutz-Jeghers syndrome	TSP Lung(3;<1E-08)																											p.P369S		.	yes	Rec	yes	Peutz-Jeghers syndrome	19	19p13.3	6794	serine/threonine kinase 11 gene (LKB1)		"""E, M, O"""	.	STK11-5227	20	Whole gene deletion(20)	cervix(14)|lung(2)|oesophagus(1)|ovary(1)|kidney(1)|pancreas(1)	c.C1105T						.						36.0	45.0	42.0					19																	1223168		2094	4215	6309	SO:0001583	missense	6794	exon8	Familial Cancer Database	PJS, Hamartous Intestinal Polyposis	ACGGTGCCCGGTG	U63333	CCDS45896.1	19p13.3	2014-09-17	2005-12-13			ENSG00000118046			11389	protein-coding gene	gene with protein product	"""polarization-related protein LKB1"""	602216	"""serine/threonine kinase 11 (Peutz-Jeghers syndrome)"""			9425897	Standard	XM_005259617		Approved	PJS, LKB1	uc002lrl.1	Q15831		ENST00000326873.7:c.1105C>T	19.37:g.1223168C>T	ENSP00000324856:p.Pro369Ser	26	0		23	10	NM_000455	0	0	0	0	0	B2RBX7|E7EW76	Missense_Mutation	SNP	ENST00000326873.7	37	CCDS45896.1	.	.	.	.	.	.	.	.	.	.	.	15.23	2.770635	0.49680	.	.	ENSG00000118046	ENST00000326873;ENST00000405031	T	0.68181	-0.31	3.66	3.66	0.41972	.	0.115197	0.64402	N	0.000011	T	0.62889	0.2465	M	0.71581	2.175	0.80722	D	1	P	0.40398	0.716	B	0.39339	0.297	T	0.62728	-0.6793	10	0.10636	T	0.68	-19.522	14.5402	0.67987	0.0:1.0:0.0:0.0	.	369	Q15831	STK11_HUMAN	S	369	ENSP00000324856:P369S	ENSP00000324856:P369S	P	+	1	0	STK11	1174168	1.000000	0.71417	1.000000	0.80357	0.216000	0.24613	7.025000	0.76449	1.884000	0.54569	0.313000	0.20887	CCC	.		0.642	STK11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449839.3	NM_000455	
ZNF433	163059	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	12126384	12126384	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr19:12126384G>T	ENST00000344980.6	-	4	1468	c.1298C>A	c.(1297-1299)tCt>tAt	p.S433Y	ZNF433_ENST00000419886.2_Missense_Mutation_p.S398Y|CTD-2006C1.2_ENST00000476474.1_RNA|CTD-2006C1.2_ENST00000495324.1_RNA|CTD-2006C1.2_ENST00000406892.2_RNA	NM_001080411.1	NP_001073880.1	Q8N7K0	ZN433_HUMAN	zinc finger protein 433	433					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(1)|prostate(1)|skin(1)	14						GAGTGAGGCAGATCTGAAGGC	0.418																																					p.S433Y		.											.	.	0			c.C1298A						.						93.0	97.0	96.0					19																	12126384		2202	4300	6502	SO:0001583	missense	163059	exon4			GAGGCAGATCTGA	AK098300	CCDS45983.1	19p13.13	2013-01-08			ENSG00000197647	ENSG00000197647		"""Zinc fingers, C2H2-type"", ""-"""	20811	protein-coding gene	gene with protein product							Standard	NM_001080411		Approved	FLJ40981	uc002msy.1	Q8N7K0	OTTHUMG00000156427	ENST00000344980.6:c.1298C>A	19.37:g.12126384G>T	ENSP00000339767:p.Ser433Tyr	128	0		118	34	NM_001080411	0	0	4	9	5	Q86VX3	Missense_Mutation	SNP	ENST00000344980.6	37	CCDS45983.1	.	.	.	.	.	.	.	.	.	.	G	1.694	-0.503274	0.04261	.	.	ENSG00000197647	ENST00000419886;ENST00000344980	T;T	0.06608	3.28;3.28	1.18	-2.37	0.06643	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06462	0.0166	L	0.45744	1.44	0.09310	N	1	D	0.56746	0.977	P	0.53224	0.721	T	0.16217	-1.0410	9	0.02654	T	1	.	0.9392	0.01351	0.1557:0.2904:0.2991:0.2549	.	433	Q8N7K0	ZN433_HUMAN	Y	398;433	ENSP00000393416:S398Y;ENSP00000339767:S433Y	ENSP00000339767:S433Y	S	-	2	0	ZNF433	11987384	0.000000	0.05858	0.000000	0.03702	0.881000	0.50899	-3.866000	0.00347	-1.541000	0.01727	0.298000	0.19748	TCT	.		0.418	ZNF433-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403716.1	NM_152602	
KIAA1683	80726	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	18368726	18368726	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr19:18368726C>G	ENST00000600328.3	-	4	3000	c.2807G>C	c.(2806-2808)gGc>gCc	p.G936A	PDE4C_ENST00000355502.3_5'Flank|PDE4C_ENST00000596647.1_5'Flank|KIAA1683_ENST00000392413.4_Missense_Mutation_p.G1123A|KIAA1683_ENST00000600359.3_Missense_Mutation_p.G890A			Q9H0B3	K1683_HUMAN	KIAA1683	936	IQ 2. {ECO:0000255|PROSITE- ProRule:PRU00116}.					mitochondrion (GO:0005739)|nucleus (GO:0005634)				breast(1)|endometrium(7)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37						GCCACGGACGCCCGCCTGGAT	0.672																																					p.G1123A		.											.	KIAA1683-92	0			c.G3368C						.						51.0	53.0	52.0					19																	18368726		2201	4295	6496	SO:0001583	missense	80726	exon4			CGGACGCCCGCCT	AB051470	CCDS32958.1, CCDS46017.1, CCDS46018.1	19p13.1	2008-02-05				ENSG00000130518			29350	protein-coding gene	gene with protein product						11214970, 11230166	Standard	NM_025249		Approved		uc010ebn.2	Q9H0B3		ENST00000600328.3:c.2807G>C	19.37:g.18368726C>G	ENSP00000470780:p.Gly936Ala	121	0		127	41	NM_001145304	0	0	0	0	0	B4DYH2|E9PDE0|E9PH54|Q2KHR5|Q8N4G8|Q96M14|Q9C0I0	Missense_Mutation	SNP	ENST00000600328.3	37	CCDS32958.1	.	.	.	.	.	.	.	.	.	.	C	8.574	0.880834	0.17467	.	.	ENSG00000130518	ENST00000392413;ENST00000359737;ENST00000427634;ENST00000392412;ENST00000411671	T;T;T	0.21932	1.98;1.98;1.98	4.33	-0.667	0.11395	.	0.473857	0.15866	N	0.240773	T	0.09992	0.0245	N	0.10972	0.075	0.09310	N	1	B;P	0.38148	0.101;0.62	B;P	0.45610	0.073;0.487	T	0.16988	-1.0384	10	0.16896	T	0.51	-0.3503	0.5212	0.00612	0.1866:0.3422:0.2124:0.2589	.	1123;936	E9PDE0;Q9H0B3	.;K1683_HUMAN	A	1123;936;890;200;550	ENSP00000376213:G1123A;ENSP00000352774:G936A;ENSP00000404501:G890A	ENSP00000352774:G936A	G	-	2	0	KIAA1683	18229726	0.000000	0.05858	0.002000	0.10522	0.074000	0.17049	0.457000	0.21875	0.249000	0.21456	0.313000	0.20887	GGC	.		0.672	KIAA1683-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000466312.3		
ZNF681	148213	hgsc.bcm.edu	37	19	23927139	23927139	+	Missense_Mutation	SNP	T	T	G	rs1852431		TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr19:23927139T>G	ENST00000402377.3	-	4	1354	c.1213A>C	c.(1213-1215)Aag>Cag	p.K405Q	ZNF681_ENST00000395385.3_Missense_Mutation_p.K336Q	NM_138286.2	NP_612143.2	Q96N22	ZN681_HUMAN	zinc finger protein 681	405					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(10)|prostate(1)|skin(1)|urinary_tract(3)	21		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				TGTGAGGACTTGTTAAAAGCT	0.403																																					p.K405Q		.											.	.	0			c.A1213C						.						69.0	73.0	72.0					19																	23927139		2203	4300	6503	SO:0001583	missense	148213	exon4			AGGACTTGTTAAA	AK056088	CCDS12414.2	19p12	2013-01-08			ENSG00000196172	ENSG00000196172		"""Zinc fingers, C2H2-type"", ""-"""	26457	protein-coding gene	gene with protein product	"""hypothetical protein FLJ31526"""						Standard	NM_138286		Approved	FLJ31526	uc002nrk.4	Q96N22	OTTHUMG00000150831	ENST00000402377.3:c.1213A>C	19.37:g.23927139T>G	ENSP00000384000:p.Lys405Gln	72	1		75	4	NM_138286	0	0	1	9	8	B3KVF7	Missense_Mutation	SNP	ENST00000402377.3	37	CCDS12414.2	.	.	.	.	.	.	.	.	.	.	.	0	-2.720447	0.00092	.	.	ENSG00000196172	ENST00000402377;ENST00000395385	T;T	0.07444	3.19;3.19	1.51	-3.01	0.05463	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02230	0.0069	N	0.02275	-0.615	0.09310	N	1	B	0.17465	0.022	B	0.15870	0.014	T	0.33033	-0.9884	9	0.02654	T	1	.	5.6438	0.17579	0.151:0.0:0.5623:0.2867	rs1852431	405	Q96N22	ZN681_HUMAN	Q	405;336	ENSP00000384000:K405Q;ENSP00000378783:K336Q	ENSP00000378783:K336Q	K	-	1	0	ZNF681	23718979	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-6.510000	0.00063	-2.559000	0.00474	-2.453000	0.00207	AAG	.		0.403	ZNF681-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320248.2	NM_138286	
U2AF2	11338	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	56180114	56180114	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr19:56180114G>A	ENST00000308924.4	+	9	941	c.901G>A	c.(901-903)Ggc>Agc	p.G301S	CTD-2537I9.12_ENST00000585940.1_RNA|CTD-2537I9.12_ENST00000589456.1_RNA|CTD-2537I9.13_ENST00000592252.1_RNA|U2AF2_ENST00000450554.2_Missense_Mutation_p.G301S|U2AF2_ENST00000590551.1_Missense_Mutation_p.G137S			P26368	U2AF2_HUMAN	U2 small nuclear RNA auxiliary factor 2	301	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	enzyme binding (GO:0019899)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			biliary_tract(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|urinary_tract(2)	21		Colorectal(82;0.00244)|Ovarian(87;0.133)	BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.107)		GCTCTCCAAGGGCTACGCCTT	0.617																																					p.G301S		.											.	U2AF2-91	0			c.G901A						.						68.0	65.0	66.0					19																	56180114		2203	4300	6503	SO:0001583	missense	11338	exon9			TCCAAGGGCTACG	BC008740	CCDS12933.1, CCDS46197.1	19q13.43	2014-09-17	2006-04-11			ENSG00000063244		"""RNA binding motif (RRM) containing"""	23156	protein-coding gene	gene with protein product	"""U2 small nuclear ribonucleoprotein auxiliary factor (65kD)"", ""splicing factor U2AF 65 kD subunit"", ""U2 snRNP auxiliary factor large subunit"""	191318	"""U2 (RNU2) small nuclear RNA auxiliary factor 2"""			1538748	Standard	XM_006722994		Approved	U2AF65	uc002qlu.3	P26368		ENST00000308924.4:c.901G>A	19.37:g.56180114G>A	ENSP00000307863:p.Gly301Ser	148	0		91	30	NM_001012478	0	0	72	163	91	Q96HC5	Missense_Mutation	SNP	ENST00000308924.4	37	CCDS12933.1	.	.	.	.	.	.	.	.	.	.	G	35	5.448539	0.96205	.	.	ENSG00000063244	ENST00000308924;ENST00000450554	D;T	0.83419	-1.72;0.1	4.4	4.4	0.53042	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	D	0.94683	0.8285	H	0.98646	4.29	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96949	0.9693	10	0.87932	D	0	-32.268	16.1527	0.81634	0.0:0.0:1.0:0.0	.	301;301	P26368;P26368-2	U2AF2_HUMAN;.	S	301	ENSP00000307863:G301S;ENSP00000388475:G301S	ENSP00000307863:G301S	G	+	1	0	U2AF2	60871926	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.145000	0.94634	2.184000	0.69523	0.655000	0.94253	GGC	.		0.617	U2AF2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453599.1	NM_007279	
OTOF	9381	ucsc.edu;bcgsc.ca	37	2	26700635	26700635	+	Intron	SNP	G	G	C			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr2:26700635G>C	ENST00000272371.2	-	19	2341				OTOF_ENST00000403946.3_Intron|OTOF_ENST00000338581.6_Intron|OTOF_ENST00000402415.3_Missense_Mutation_p.H43D|OTOF_ENST00000339598.3_Intron	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin						membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCAGGAGTGTGGGTGATGCTG	0.602																																					p.H43D	GBM(102;732 1451 20652 24062 31372)												.	OTOF-135	0			c.C127G						.						53.0	41.0	45.0					2																	26700635		2194	4294	6488	SO:0001627	intron_variant	9381	exon1			GAGTGTGGGTGAT	AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.2215-18C>G	2.37:g.26700635G>C		42	0		35	15	NM_194322	0	0	0	0	0	B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Missense_Mutation	SNP	ENST00000272371.2	37	CCDS1725.1	.	.	.	.	.	.	.	.	.	.	G	7.354	0.623380	0.14193	.	.	ENSG00000115155	ENST00000402415	T	0.76709	-1.04	3.28	-1.12	0.09808	.	.	.	.	.	T	0.59307	0.2184	.	.	.	0.09310	N	1	B	0.15473	0.013	B	0.16289	0.015	T	0.36138	-0.9760	7	.	.	.	.	6.8786	0.24160	0.2752:0.1313:0.5935:0.0	.	43	Q9HC10-3	.	D	43	ENSP00000383906:H43D	.	H	-	1	0	OTOF	26554139	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.033000	0.13754	-0.801000	0.04427	-1.268000	0.01426	CAC	.		0.602	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214047.3		
C2orf73	129852	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	54587528	54587528	+	Silent	SNP	G	G	T			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr2:54587528G>T	ENST00000398634.2	+	5	735	c.693G>T	c.(691-693)ctG>ctT	p.L231L	C2orf73_ENST00000405749.1_Intron|C2orf73_ENST00000491538.1_Intron	NM_001100396.1	NP_001093866.1	Q8N5S3	CB073_HUMAN	chromosome 2 open reading frame 73	231										breast(2)	2						CTCAGGAGCTGTTAGAGCCTA	0.493																																					p.L231L		.											.	.	0			c.G693T						.						35.0	34.0	35.0					2																	54587528		1907	4128	6035	SO:0001819	synonymous_variant	129852	exon5			GGAGCTGTTAGAG	BC031669, AK097617	CCDS46285.1	2p16.2	2008-07-07			ENSG00000177994	ENSG00000177994			26861	protein-coding gene	gene with protein product						14702039	Standard	NM_001100396		Approved	FLJ40298	uc002rxt.1	Q8N5S3	OTTHUMG00000151826	ENST00000398634.2:c.693G>T	2.37:g.54587528G>T		19	0		31	8	NM_001100396	0	0	1	1	0	A0AV79|A0AV81|Q8N7V4	Silent	SNP	ENST00000398634.2	37	CCDS46285.1																																																																																			.		0.493	C2orf73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324075.2	NM_001100396	
ZAP70	7535	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	2	98341626	98341626	+	Missense_Mutation	SNP	C	C	A	rs56404668	byFrequency	TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr2:98341626C>A	ENST00000264972.5	+	4	689	c.474C>A	c.(472-474)caC>caA	p.H158Q	ZAP70_ENST00000442208.1_Missense_Mutation_p.H32Q|ZAP70_ENST00000463643.1_3'UTR	NM_001079.3	NP_001070.2	P43403	ZAP70_HUMAN	zeta-chain (TCR) associated protein kinase 70kDa	158	Interdomain A.				adaptive immune response (GO:0002250)|B cell activation (GO:0042113)|beta selection (GO:0043366)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative thymic T cell selection (GO:0045060)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of T cell differentiation (GO:0045582)|positive thymic T cell selection (GO:0045059)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell activation (GO:0042110)|T cell aggregation (GO:0070489)|T cell differentiation (GO:0030217)|T cell migration (GO:0072678)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	29						CGACGGCCCACGAGCGGATGC	0.637																																					p.H158Q		.											.	ZAP70-955	0			c.C474A						.						48.0	43.0	45.0					2																	98341626		2203	4300	6503	SO:0001583	missense	7535	exon4			GGCCCACGAGCGG	L05148	CCDS33254.1, CCDS33255.1	2q11-q13	2014-09-17	2002-08-29		ENSG00000115085	ENSG00000115085		"""SH2 domain containing"""	12858	protein-coding gene	gene with protein product		176947	"""zeta-chain (TCR) associated protein kinase (70 kD)"""	SRK		1423621	Standard	NM_001079		Approved	ZAP-70, STD	uc002syd.1	P43403	OTTHUMG00000153060	ENST00000264972.5:c.474C>A	2.37:g.98341626C>A	ENSP00000264972:p.His158Gln	82	0		75	36	NM_001079	0	0	0	0	0	A6NFP4|Q6PIA4|Q8IXD6|Q9UBS6	Missense_Mutation	SNP	ENST00000264972.5	37	CCDS33254.1	.	.	.	.	.	.	.	.	.	.	C	18.52	3.642553	0.67244	.	.	ENSG00000115085	ENST00000264972;ENST00000442208	D;D	0.92858	-3.12;-3.12	5.37	1.01	0.19927	SH2 motif (1);	0.000000	0.50627	D	0.000112	D	0.93262	0.7853	L	0.58810	1.83	0.51012	D	0.999903	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;1.0;0.999	D	0.90788	0.4684	10	0.62326	D	0.03	.	6.7946	0.23719	0.0:0.491:0.0:0.509	.	158;32;158	B4E0E2;P43403-3;P43403	.;.;ZAP70_HUMAN	Q	158;32	ENSP00000264972:H158Q;ENSP00000411141:H32Q	ENSP00000264972:H158Q	H	+	3	2	ZAP70	97708058	0.004000	0.15560	1.000000	0.80357	0.763000	0.43281	-1.323000	0.02692	0.354000	0.24105	-0.216000	0.12614	CAC	C|0.998;T|0.002		0.637	ZAP70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329278.1		
UGT1A1	54658	broad.mit.edu	37	2	234526363	234526363	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr2:234526363A>G	ENST00000373450.4	+	1	73	c.10A>G	c.(10-12)Aca>Gca	p.T4A		NM_019076.4	NP_061949.3	P22309	UD11_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A1	0					acute-phase response (GO:0006953)|bilirubin conjugation (GO:0006789)|biphenyl catabolic process (GO:0070980)|cellular glucuronidation (GO:0052695)|cellular response to ethanol (GO:0071361)|cellular response to glucocorticoid stimulus (GO:0071385)|digestion (GO:0007586)|drug metabolic process (GO:0017144)|estrogen metabolic process (GO:0008210)|flavone metabolic process (GO:0051552)|flavonoid glucuronidation (GO:0052696)|heme catabolic process (GO:0042167)|heterocycle metabolic process (GO:0046483)|liver development (GO:0001889)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cellular glucuronidation (GO:2001030)|negative regulation of steroid metabolic process (GO:0045939)|organ regeneration (GO:0031100)|porphyrin-containing compound metabolic process (GO:0006778)|response to drug (GO:0042493)|response to lipopolysaccharide (GO:0032496)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|retinoic acid metabolic process (GO:0042573)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic glucuronidation (GO:0052697)|xenobiotic metabolic process (GO:0006805)	cytochrome complex (GO:0070069)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)	enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|retinoic acid binding (GO:0001972)|steroid binding (GO:0005496)	p.T4A(3)		breast(1)|central_nervous_system(2)|endometrium(7)|large_intestine(5)|lung(9)|skin(4)|urinary_tract(2)	30		Breast(86;0.000766)|all_lung(227;0.00271)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0461)|Lung SC(224;0.128)		Epithelial(121;4.1e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000435)|Lung(119;0.00211)|LUSC - Lung squamous cell carcinoma(224;0.0054)	Abacavir(DB01048)|Acetaminophen(DB00316)|Adenine(DB00173)|Atorvastatin(DB01076)|Axitinib(DB06626)|Diclofenac(DB00586)|Dolutegravir(DB08930)|Eltrombopag(DB06210)|Erlotinib(DB00530)|Estradiol(DB00783)|Etoposide(DB00773)|Ezetimibe(DB00973)|Ezogabine(DB04953)|Flunitrazepam(DB01544)|Flurbiprofen(DB00712)|Fluvastatin(DB01095)|Ibuprofen(DB01050)|Indacaterol(DB05039)|Indomethacin(DB00328)|Irinotecan(DB00762)|Losartan(DB00678)|Lovastatin(DB00227)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Naltrexone(DB00704)|Naproxen(DB00788)|Nilotinib(DB04868)|Pazopanib(DB06589)|Propofol(DB00818)|Raltegravir(DB06817)|Regorafenib(DB08896)|Rifampicin(DB01045)|Simvastatin(DB00641)|Sorafenib(DB00398)|Suprofen(DB00870)|Testosterone Propionate(DB01420)	CATGGCTCGCACAGGGTGGAC	0.562																																					p.T4A													.	UGT1A8-27	3	Substitution - Missense(3)	prostate(1)|lung(1)|kidney(1)	c.A10G						.						61.0	53.0	56.0					2																	234526363		2203	4300	6503	SO:0001583	missense	54576	exon1			GCTCGCACAGGGT	M57899	CCDS2510.1	2q37.1	2014-09-17	2005-07-20		ENSG00000242366	ENSG00000242366	2.4.1.17	"""UDP glucuronosyltransferases"""	12530	other	complex locus constituent		191740	"""UDP glycosyltransferase 1 family, polypeptide A1"""	UGT1, GNT1		9295054, 9535849	Standard	NM_000463		Approved	UGT1A		P22309	OTTHUMG00000059117	ENST00000373450.4:c.10A>G	2.37:g.234526363A>G	ENSP00000362549:p.Thr4Ala	72	1		88	3	NM_019076	0	0	0	0	0	A6NJC3|B8K286	Missense_Mutation	SNP	ENST00000373450.4	37	CCDS33402.1	.	.	.	.	.	.	.	.	.	.	A	1.349	-0.591910	0.03799	.	.	ENSG00000242366	ENST00000373450	T	0.57273	0.41	3.96	-1.46	0.08800	.	.	.	.	.	T	0.20577	0.0495	N	0.03115	-0.41	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.27331	-1.0077	9	0.06891	T	0.86	.	5.6018	0.17357	0.3817:0.1909:0.4274:0.0	.	4;4	Q5DSZ6;Q9HAW9	.;UD18_HUMAN	A	4	ENSP00000362549:T4A	ENSP00000362549:T4A	T	+	1	0	UGT1A8	234191102	0.000000	0.05858	0.003000	0.11579	0.000000	0.00434	0.041000	0.13927	-0.096000	0.12329	-1.318000	0.01297	ACA	A|1.000;G|0.000		0.562	UGT1A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000130994.1		
TBC1D20	128637	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	419913	419913	+	Silent	SNP	G	G	T			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr20:419913G>T	ENST00000354200.4	-	7	942	c.795C>A	c.(793-795)gtC>gtA	p.V265V	TBC1D20_ENST00000461188.1_5'UTR	NM_144628.2	NP_653229.1	Q96BZ9	TBC20_HUMAN	TBC1 domain family, member 20	265					acrosome assembly (GO:0001675)|cargo loading into COPII-coated vesicle (GO:0090110)|ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi organization (GO:0007030)|lens fiber cell morphogenesis (GO:0070309)|lipid particle organization (GO:0034389)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|seminiferous tubule development (GO:0072520)|virion assembly (GO:0019068)	endoplasmic reticulum membrane (GO:0005789)|integral component of Golgi membrane (GO:0030173)|nuclear membrane (GO:0031965)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	12		all_epithelial(17;0.228)|Breast(17;0.231)				CACAGTCCAGGACTTCCTGCT	0.562																																					p.V265V		.											.	TBC1D20-90	0			c.C795A						.						137.0	118.0	124.0					20																	419913		2203	4300	6503	SO:0001819	synonymous_variant	128637	exon7			GTCCAGGACTTCC	AK055573	CCDS13002.1	20p13	2013-07-10	2005-01-05	2005-01-05	ENSG00000125875	ENSG00000125875			16133	protein-coding gene	gene with protein product		611663	"""chromosome 20 open reading frame 140"""	C20orf140		17901050	Standard	XM_005260661		Approved	dJ852M4.2	uc002wds.3	Q96BZ9	OTTHUMG00000031637	ENST00000354200.4:c.795C>A	20.37:g.419913G>T		82	0		81	48	NM_144628	0	0	22	51	29	A8K6I3|B9A6M1|Q5JWQ7|Q6ZSY8|Q96NE1|Q9BYM7|Q9H140	Silent	SNP	ENST00000354200.4	37	CCDS13002.1																																																																																			.		0.562	TBC1D20-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251397.2	NM_144628	
FRG1B	284802	bcgsc.ca	37	20	29623219	29623219	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr20:29623219A>G	ENST00000278882.3	+	3	411	c.31A>G	c.(31-33)Atg>Gtg	p.M11V	FRG1B_ENST00000439954.2_Missense_Mutation_p.N12S|FRG1B_ENST00000358464.4_Missense_Mutation_p.M11V			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	11										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						GCACTCGACAATGGTCTTTTT	0.413																																					.													.	FRG1B-22	0			.						.																																			SO:0001583	missense	284802	.			TCGACAATGGTCT			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.31A>G	20.37:g.29623219A>G	ENSP00000278882:p.Met11Val	1162	15		1339	48	.	0	0	282	282	0	C4AME5	RNA	SNP	ENST00000278882.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	a|a	0.925|0.925	-0.714671|-0.714671	0.03206|0.03206	.|.	.|.	ENSG00000149531|ENSG00000149531	ENST00000278882;ENST00000358464|ENST00000439954	.|T	.|0.53206	.|0.63	1.93|1.93	1.93|1.93	0.25924|0.25924	.|.	0.114289|.	0.56097|.	U|.	0.000024|.	T|T	0.42040|0.42040	0.1185|0.1185	.|.	.|.	.|.	0.18873|0.18873	N|N	0.999983|0.999983	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.36648|0.36648	-0.9739|-0.9739	6|6	0.66056|0.54805	D|T	0.02|0.06	.|.	4.9441|4.9441	0.13980|0.13980	0.6812:0.3188:0.0:0.0|0.6812:0.3188:0.0:0.0	.|.	.|.	.|.	.|.	V|S	11|12	.|ENSP00000408863:N12S	ENSP00000278882:M11V|ENSP00000408863:N12S	M|N	+|+	1|2	0|0	FRG1B|FRG1B	28236880|28236880	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.107000|0.107000	0.19398|0.19398	3.154000|3.154000	0.50693|0.50693	1.147000|1.147000	0.42369|0.42369	0.347000|0.347000	0.21830|0.21830	ATG|AAT	.		0.413	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
NCOA6	23054	hgsc.bcm.edu;broad.mit.edu	37	20	33345756	33345756	+	Silent	SNP	T	T	C			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr20:33345756T>C	ENST00000374796.2	-	8	3365	c.795A>G	c.(793-795)caA>caG	p.Q265Q	NCOA6_ENST00000359003.2_Silent_p.Q265Q			Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	265	CREBBP-binding region.|Gln-rich.|NCOA1-binding region.|TBP/GTF2A-binding region.				brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-templated transcription, initiation (GO:0006352)|glucocorticoid receptor signaling pathway (GO:0042921)|heart development (GO:0007507)|intracellular estrogen receptor signaling pathway (GO:0030520)|labyrinthine layer blood vessel development (GO:0060716)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)	histone methyltransferase complex (GO:0035097)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)	p.Q265Q(1)		NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(8)|large_intestine(16)|lung(37)|ovary(4)|prostate(5)|skin(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	107						gttgttgttgttgctgctgct	0.537																																					p.Q265Q		.											.	NCOA6-292	1	Substitution - coding silent(1)	central_nervous_system(1)	c.A795G						.						62.0	52.0	55.0					20																	33345756		2203	4300	6503	SO:0001819	synonymous_variant	23054	exon7			TTGTTGTTGCTGC	AF128458	CCDS13241.1, CCDS74720.1	20q11	2008-08-01			ENSG00000198646	ENSG00000198646			15936	protein-coding gene	gene with protein product	"""nuclear receptor coactivator RAP250"", ""activating signal cointegrator-2"", ""peroxisome proliferator-activated receptor interacting protein"""	605299				8724849, 8263591	Standard	NM_014071		Approved	KIAA0181, RAP250, ASC2, AIB3, PRIP, TRBP, NRC	uc002xaw.3	Q14686	OTTHUMG00000032311	ENST00000374796.2:c.795A>G	20.37:g.33345756T>C		59	0		95	5	NM_014071	0	0	20	21	1	A6NLF1|B2RMN5|E1P5P7|Q9NTZ9|Q9UH74|Q9UK86	Silent	SNP	ENST00000374796.2	37	CCDS13241.1																																																																																			.		0.537	NCOA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078811.2	NM_014071	
FAM65C	140876	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	49219116	49219116	+	Silent	SNP	G	G	A			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr20:49219116G>A	ENST00000327979.2	-	13	1551	c.1140C>T	c.(1138-1140)ctC>ctT	p.L380L	FAM65C_ENST00000045083.2_Silent_p.L380L|FAM65C_ENST00000535356.1_Silent_p.L384L			Q96MK2	FA65C_HUMAN	family with sequence similarity 65, member C	380										endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|liver(1)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						ACAGGTAGCTGAGGATGGAGG	0.637																																					p.L380L		.											.	FAM65C-92	0			c.C1140T						.						26.0	28.0	27.0					20																	49219116		2061	4109	6170	SO:0001819	synonymous_variant	140876	exon13			GTAGCTGAGGATG	AL133230	CCDS13431.2	20q13.13	2011-11-24	2008-06-13	2008-06-13	ENSG00000042062	ENSG00000042062			16168	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 175"", ""chromosome 20 open reading frame 176"""	C20orf175, C20orf176			Standard	XM_005260294		Approved	dJ530I15.2, dJ530I15.3	uc002xvm.3	Q96MK2	OTTHUMG00000032724	ENST00000327979.2:c.1140C>T	20.37:g.49219116G>A		90	0		115	24	NM_080829	0	0	16	16	0	Q5QPB6|Q9NQQ2	Silent	SNP	ENST00000327979.2	37	CCDS13431.2																																																																																			.		0.637	FAM65C-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257962.1		
CYP24A1	1591	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	52773943	52773943	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr20:52773943T>C	ENST00000216862.3	-	10	1811	c.1418A>G	c.(1417-1419)cAt>cGt	p.H473R	CYP24A1_ENST00000395954.3_Missense_Mutation_p.H331R|CYP24A1_ENST00000460643.1_5'Flank|CYP24A1_ENST00000395955.3_Intron	NM_000782.4	NP_000773.2	Q07973	CP24A_HUMAN	cytochrome P450, family 24, subfamily A, polypeptide 1	473					osteoblast differentiation (GO:0001649)|oxidation-reduction process (GO:0055114)|response to vitamin D (GO:0033280)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D catabolic process (GO:0042369)|vitamin D metabolic process (GO:0042359)|vitamin D receptor signaling pathway (GO:0070561)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)	1-alpha,25-dihydroxyvitamin D3 24-hydroxylase activity (GO:0030342)|25-hydroxycholecalciferol-24-hydroxylase activity (GO:0008403)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity (GO:0016491)			breast(2)|endometrium(3)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24	Lung NSC(4;1.08e-05)|all_lung(4;2.7e-05)		STAD - Stomach adenocarcinoma(23;0.206)		Calcidiol(DB00146)|Calcipotriol(DB02300)|Calcitriol(DB00136)|Corticotropin(DB01285)|Ergocalciferol(DB00153)|Paricalcitol(DB00910)	AAGAGCCAAATGCAGTTGAAG	0.423																																					p.H473R		.											.	CYP24A1-228	0			c.A1418G						.						81.0	76.0	78.0					20																	52773943		2203	4300	6503	SO:0001583	missense	1591	exon10			GCCAAATGCAGTT	U60669	CCDS33491.1, CCDS46616.1	20q13.2-q13.3	2003-02-28	2003-02-14	2003-02-28	ENSG00000019186	ENSG00000019186		"""Cytochrome P450s"""	2602	protein-coding gene	gene with protein product		126065	"""cytochrome P450, subfamily XXIV (vitamin D 24-hydroxylase)"""	CYP24			Standard	NM_000782		Approved	CP24, P450-CC24	uc002xwv.2	Q07973	OTTHUMG00000032773	ENST00000216862.3:c.1418A>G	20.37:g.52773943T>C	ENSP00000216862:p.His473Arg	74	0		85	42	NM_000782	0	0	45	143	98	Q15807|Q32ML3|Q5I2W7	Missense_Mutation	SNP	ENST00000216862.3	37	CCDS33491.1	.	.	.	.	.	.	.	.	.	.	t	15.34	2.805491	0.50315	.	.	ENSG00000019186	ENST00000216862;ENST00000395954	T;T	0.67345	-0.26;-0.26	5.2	4.06	0.47325	.	0.101356	0.64402	D	0.000001	T	0.63698	0.2533	N	0.25992	0.78	0.41376	D	0.987529	D;P	0.54964	0.969;0.934	P;B	0.55161	0.77;0.424	T	0.60979	-0.7155	10	0.33141	T	0.24	-19.4807	11.563	0.50788	0.0:0.0:0.1498:0.8502	.	473;331	Q07973;Q5I2W7	CP24A_HUMAN;.	R	473;331	ENSP00000216862:H473R;ENSP00000379284:H331R	ENSP00000216862:H473R	H	-	2	0	CYP24A1	52207350	1.000000	0.71417	0.969000	0.41365	0.303000	0.27691	4.744000	0.62118	0.884000	0.36064	0.451000	0.29950	CAT	.		0.423	CYP24A1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079769.2		
LIME1	54923	broad.mit.edu	37	20	62369217	62369217	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr20:62369217C>T	ENST00000309546.3	+	3	229	c.142C>T	c.(142-144)Cgg>Tgg	p.R48W	LIME1_ENST00000490824.1_3'UTR|RP4-583P15.15_ENST00000490623.2_3'UTR|RP4-583P15.14_ENST00000467211.1_5'Flank|SLC2A4RG_ENST00000266077.2_5'Flank	NM_017806.2	NP_060276.2	Q9H400	LIME1_HUMAN	Lck interacting transmembrane adaptor 1	48					B cell receptor signaling pathway (GO:0050853)|T cell receptor signaling pathway (GO:0050852)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				kidney(1)|large_intestine(1)|liver(1)	3	all_cancers(38;1.13e-12)|all_epithelial(29;2.64e-14)|Lung NSC(23;4.79e-10)|all_lung(23;1.7e-09)					GCGGAGGCAGCGGGCGAGGCT	0.756																																					p.R48W													.	LIME1-44	0			c.C142T						.						7.0	8.0	7.0					20																	62369217		2102	4177	6279	SO:0001583	missense	54923	exon3			AGGCAGCGGGCGA	AK000413	CCDS13536.1	20q13.33	2010-05-11			ENSG00000203896	ENSG00000203896			26016	protein-coding gene	gene with protein product		609809				12477932	Standard	NM_017806		Approved	FLJ20406, dJ583P15.4, LIME	uc002ygp.4	Q9H400	OTTHUMG00000032999	ENST00000309546.3:c.142C>T	20.37:g.62369217C>T	ENSP00000309521:p.Arg48Trp	21	0		29	4	NM_017806	0	0	36	36	0	E1P5K5|E1P5K6|Q5JWJ2|Q6XYB3|Q9NX69	Missense_Mutation	SNP	ENST00000309546.3	37	CCDS13536.1	.	.	.	.	.	.	.	.	.	.	c	12.37	1.916705	0.33815	.	.	ENSG00000203896	ENST00000444951;ENST00000309546	T;T	0.46063	0.88;0.88	4.09	0.988	0.19796	.	.	.	.	.	T	0.20780	0.0500	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.19063	-1.0317	9	0.66056	D	0.02	.	5.114	0.14825	0.0:0.5647:0.1546:0.2807	.	48	Q9H400	LIME1_HUMAN	W	48	ENSP00000414506:R48W;ENSP00000309521:R48W	ENSP00000309521:R48W	R	+	1	2	LIME1	61839661	0.000000	0.05858	0.000000	0.03702	0.054000	0.15201	-0.255000	0.08769	0.325000	0.23359	-0.760000	0.03462	CGG	.		0.756	LIME1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080225.1	NM_017806	
APP	351	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	27348294	27348294	+	Silent	SNP	A	A	C			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr21:27348294A>C	ENST00000346798.3	-	10	1305	c.1272T>G	c.(1270-1272)ccT>ccG	p.P424P	APP_ENST00000359726.3_Silent_p.P368P|APP_ENST00000357903.3_Silent_p.P405P|APP_ENST00000440126.3_Silent_p.P400P|APP_ENST00000439274.2_Silent_p.P368P|APP_ENST00000348990.5_Silent_p.P349P|APP_ENST00000358918.3_Silent_p.P424P|APP_ENST00000448388.2_Silent_p.P314P|APP_ENST00000354192.3_Silent_p.P293P	NM_000484.3	NP_000475.1	P05067	A4_HUMAN	amyloid beta (A4) precursor protein	424					adult locomotory behavior (GO:0008344)|axon cargo transport (GO:0008088)|axon midline choice point recognition (GO:0016199)|axonogenesis (GO:0007409)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular copper ion homeostasis (GO:0006878)|cholesterol metabolic process (GO:0008203)|collateral sprouting in absence of injury (GO:0048669)|dendrite development (GO:0016358)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|innate immune response (GO:0045087)|ionotropic glutamate receptor signaling pathway (GO:0035235)|locomotory behavior (GO:0007626)|mating behavior (GO:0007617)|mRNA polyadenylation (GO:0006378)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of neuron differentiation (GO:0045665)|neuromuscular process controlling balance (GO:0050885)|neuron apoptotic process (GO:0051402)|neuron projection development (GO:0031175)|neuron remodeling (GO:0016322)|Notch signaling pathway (GO:0007219)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of multicellular organism growth (GO:0040014)|regulation of protein binding (GO:0043393)|regulation of synapse structure and activity (GO:0050803)|regulation of translation (GO:0006417)|response to oxidative stress (GO:0006979)|smooth endoplasmic reticulum calcium ion homeostasis (GO:0051563)|suckling behavior (GO:0001967)|synaptic growth at neuromuscular junction (GO:0051124)|visual learning (GO:0008542)	apical part of cell (GO:0045177)|axon (GO:0030424)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|ciliary rootlet (GO:0035253)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|endosome (GO:0005768)|ER to Golgi transport vesicle (GO:0030134)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane raft (GO:0045121)|neuromuscular junction (GO:0031594)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|receptor complex (GO:0043235)|spindle midzone (GO:0051233)|synapse (GO:0045202)	acetylcholine receptor binding (GO:0033130)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|peptidase activator activity (GO:0016504)|PTB domain binding (GO:0051425)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)|transition metal ion binding (GO:0046914)			endometrium(5)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	22		Breast(209;0.00295)				TATCAGCTTTAGGCAAGTTCT	0.383																																					p.P424P		.											.	APP-91	0			c.T1272G						.						249.0	199.0	216.0					21																	27348294		2203	4300	6503	SO:0001819	synonymous_variant	351	exon10			AGCTTTAGGCAAG	M15533	CCDS13576.1, CCDS13577.1, CCDS33523.1, CCDS46638.1, CCDS46639.1, CCDS56211.1, CCDS56212.1, CCDS56213.1	21q21.2	2014-01-30	2008-07-31		ENSG00000142192	ENSG00000142192		"""Endogenous ligands"""	620	protein-coding gene	gene with protein product	"""peptidase nexin-II"""	104760	"""Alzheimer disease"""	AD1		1679289	Standard	NM_001136130		Approved		uc002ylz.3	P05067	OTTHUMG00000078438	ENST00000346798.3:c.1272T>G	21.37:g.27348294A>C		94	0		96	28	NM_000484	3	4	2245	5139	2887	B2R5V1|B4DII8|D3DSD1|D3DSD2|D3DSD3|P09000|P78438|Q13764|Q13778|Q13793|Q16011|Q16014|Q16019|Q16020|Q6GSC0|Q8WZ99|Q9BT38|Q9UC33|Q9UCA9|Q9UCB6|Q9UCC8|Q9UCD1|Q9UQ58	Silent	SNP	ENST00000346798.3	37	CCDS13576.1	.	.	.	.	.	.	.	.	.	.	A	10.87	1.472507	0.26423	.	.	ENSG00000142192	ENST00000448850;ENST00000415997	.	.	.	5.11	-5.12	0.02893	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-6.1356	2.2262	0.03985	0.1134:0.1931:0.3431:0.3504	.	.	.	.	E	327;159	.	.	X	-	1	0	APP	26270165	0.085000	0.21516	0.973000	0.42090	0.999000	0.98932	-0.688000	0.05150	-0.726000	0.04895	0.529000	0.55759	TAA	.		0.383	APP-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000171340.1	NM_000484	
COL18A1	80781	hgsc.bcm.edu	37	21	46930115	46930115	+	Silent	SNP	G	G	A			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr21:46930115G>A	ENST00000359759.4	+	39	4899	c.4878G>A	c.(4876-4878)caG>caA	p.Q1626Q	SLC19A1_ENST00000468508.1_5'Flank|COL18A1_ENST00000355480.5_Silent_p.Q1391Q|COL18A1_ENST00000400337.2_Silent_p.Q1211Q|SLC19A1_ENST00000567670.1_Intron			P39060	COIA1_HUMAN	collagen, type XVIII, alpha 1	1626	Nonhelical region 11 (NC11).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endothelial cell morphogenesis (GO:0001886)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|response to drug (GO:0042493)|response to hydrostatic pressure (GO:0051599)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		CGCGCCTGCAGGACCTGTACA	0.726																																					p.Q1388Q		.											.	COL18A1-90	0			c.G4164A						.						8.0	11.0	10.0					21																	46930115		2006	4132	6138	SO:0001819	synonymous_variant	80781	exon40			CCTGCAGGACCTG		CCDS42971.1, CCDS42972.1	21q22.3	2013-01-16			ENSG00000182871	ENSG00000182871		"""Collagens"""	2195	protein-coding gene	gene with protein product	"""endostatin"""	120328	"""Knobloch syndrome, type 1"""	KNO		8188291, 8776601, 10942434, 17546652	Standard	NM_130445		Approved	KS, KNO1	uc002zhi.3	P39060	OTTHUMG00000090407	ENST00000359759.4:c.4878G>A	21.37:g.46930115G>A		12	0		12	2	NM_030582	0	0	162	162	0	A8MVI4|Q58EX6|Q6RZ39|Q6RZ40|Q6RZ41|Q8N4S4|Q8WXI5|Q96T70|Q9UK38|Q9Y6Q7|Q9Y6Q8	Silent	SNP	ENST00000359759.4	37		.	.	.	.	.	.	.	.	.	.	G	9.305	1.053998	0.19907	.	.	ENSG00000182871	ENST00000423214	.	.	.	4.46	1.57	0.23409	.	.	.	.	.	T	0.55721	0.1938	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.48222	-0.9054	4	.	.	.	.	8.1174	0.30950	0.3609:0.0:0.6391:0.0	.	.	.	.	K	196	.	.	R	+	2	0	COL18A1	45754543	1.000000	0.71417	1.000000	0.80357	0.830000	0.47004	0.958000	0.29227	0.444000	0.26612	-0.137000	0.14449	AGG	.		0.726	COL18A1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000206827.1		
TRIOBP	11078	hgsc.bcm.edu	37	22	38150890	38150890	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr22:38150890T>C	ENST00000406386.3	+	13	5641	c.5386T>C	c.(5386-5388)Tcc>Ccc	p.S1796P	TRIOBP_ENST00000407319.2_Missense_Mutation_p.S83P|TRIOBP_ENST00000403663.2_Missense_Mutation_p.S83P	NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	1796	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					GCAGCCTCCCTCCCCCTCGCT	0.517																																					p.S1796P		.											.	TRIOBP-136	0			c.T5386C						.						204.0	151.0	169.0					22																	38150890		2203	4300	6503	SO:0001583	missense	11078	exon13			CCTCCCTCCCCCT	AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.5386T>C	22.37:g.38150890T>C	ENSP00000384312:p.Ser1796Pro	102	1		108	7	NM_001039141	0	0	0	0	0	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Missense_Mutation	SNP	ENST00000406386.3	37	CCDS43015.1	.	.	.	.	.	.	.	.	.	.	T	13.78	2.340653	0.41498	.	.	ENSG00000100106	ENST00000406386;ENST00000407319;ENST00000403663;ENST00000418339;ENST00000452519;ENST00000417857	T	0.21361	2.01	4.81	-2.04	0.07343	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	.	.	.	.	T	0.15998	0.0385	L	0.52905	1.665	0.09310	N	1	B;B;B	0.12013	0.0;0.0;0.005	B;B;B	0.12156	0.0;0.002;0.007	T	0.31194	-0.9952	9	0.36615	T	0.2	.	3.4612	0.07533	0.2773:0.2069:0.0:0.5157	.	83;83;1796	F8W6V6;F2Z2W0;Q9H2D6	.;.;TARA_HUMAN	P	1796;83;83;42;12;12	ENSP00000384312:S1796P	ENSP00000386026:S83P	S	+	1	0	TRIOBP	36480836	0.002000	0.14202	0.012000	0.15200	0.667000	0.39255	0.161000	0.16481	-0.406000	0.07588	0.533000	0.62120	TCC	.		0.517	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2		
SUMF1	285362	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	4490972	4490972	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr3:4490972A>C	ENST00000272902.5	-	3	532	c.497T>G	c.(496-498)gTg>gGg	p.V166G	SUMF1_ENST00000383843.5_Intron|SUMF1_ENST00000534863.1_Missense_Mutation_p.V166G|SUMF1_ENST00000405420.2_Missense_Mutation_p.V166G|SUMF1_ENST00000458465.2_Intron	NM_182760.3	NP_877437.2	Q8NBK3	SUMF1_HUMAN	sulfatase modifying factor 1	166					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)	metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)			breast(1)|endometrium(1)|large_intestine(2)|lung(5)|prostate(1)|upper_aerodigestive_tract(3)	13		Melanoma(143;0.068)|Colorectal(144;0.233)		Epithelial(13;0.0147)|OV - Ovarian serous cystadenocarcinoma(96;0.0444)|all cancers(10;0.0549)		ATTGGTCTTCACTTGCTCACT	0.393																																					p.V166G		.											.	SUMF1-91	0			c.T497G						.						172.0	171.0	171.0					3																	4490972		2203	4300	6503	SO:0001583	missense	285362	exon3			GTCTTCACTTGCT	BC017005	CCDS2564.1, CCDS54548.1, CCDS54549.1	3p26.1	2009-07-23			ENSG00000144455	ENSG00000144455			20376	protein-coding gene	gene with protein product		607939				12757705, 12757706	Standard	NM_182760		Approved	FGE, UNQ3037	uc003bpz.2	Q8NBK3	OTTHUMG00000090269	ENST00000272902.5:c.497T>G	3.37:g.4490972A>C	ENSP00000272902:p.Val166Gly	235	0		260	84	NM_001164675	0	0	42	81	39	B4DXK5|B7XD05|E9PGL0|G5E9B0|Q0VAC6|Q0VAC7|Q2NL78|Q53ZE4|Q6UY39|Q96AK5|Q96DK8	Missense_Mutation	SNP	ENST00000272902.5	37	CCDS2564.1	.	.	.	.	.	.	.	.	.	.	A	20.5	4.002331	0.74932	.	.	ENSG00000144455	ENST00000534982;ENST00000534863;ENST00000272902;ENST00000405420	D;D;D	0.97553	-4.43;-4.43;-4.43	5.53	5.53	0.82687	C-type lectin fold (1);Formylglycine-generating sulphatase enzyme domain (2);	0.000000	0.85682	D	0.000000	D	0.97002	0.9021	L	0.41824	1.3	0.80722	D	1	D;P	0.67145	0.996;0.541	D;P	0.65684	0.937;0.566	D	0.96392	0.9290	10	0.32370	T	0.25	-14.8274	14.671	0.68945	1.0:0.0:0.0:0.0	.	166;166	E9PGL0;Q8NBK3	.;SUMF1_HUMAN	G	166	ENSP00000440421:V166G;ENSP00000272902:V166G;ENSP00000384977:V166G	ENSP00000272902:V166G	V	-	2	0	SUMF1	4465972	1.000000	0.71417	0.989000	0.46669	0.926000	0.56050	7.392000	0.79840	2.100000	0.63781	0.533000	0.62120	GTG	.		0.393	SUMF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206591.2	NM_182760	
ANO10	55129	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	43618738	43618738	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr3:43618738T>A	ENST00000292246.3	-	6	778	c.608A>T	c.(607-609)tAc>tTc	p.Y203F	ANO10_ENST00000451430.2_Missense_Mutation_p.Y92F|ANO10_ENST00000396091.3_Missense_Mutation_p.Y137F|ANO10_ENST00000414522.2_Missense_Mutation_p.Y203F|ANO10_ENST00000350459.4_Intron	NM_018075.3	NP_060545.3	Q9NW15	ANO10_HUMAN	anoctamin 10	203					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|cell death (GO:0008219)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|intracellular calcium activated chloride channel activity (GO:0005229)			NS(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(9)|ovary(3)|prostate(3)|skin(3)	29						TTCCCCAAAGTAGCCACGAAT	0.343																																					p.Y203F		.											.	ANO10-92	0			c.A608T						.						20.0	22.0	21.0					3																	43618738		2189	4296	6485	SO:0001583	missense	55129	exon6			CCAAAGTAGCCAC	AL832508	CCDS2710.2, CCDS56247.1, CCDS56248.1, CCDS56249.1, CCDS56250.1	3p22.1-p21.33	2014-04-09	2008-08-28	2008-08-28	ENSG00000160746	ENSG00000160746		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	25519	protein-coding gene	gene with protein product		613726	"""transmembrane protein 16K"""	TMEM16K		12477932, 24692353	Standard	NM_001204831		Approved	FLJ10375, MGC47890, SCAR10	uc003cmv.3	Q9NW15	OTTHUMG00000133044	ENST00000292246.3:c.608A>T	3.37:g.43618738T>A	ENSP00000292246:p.Tyr203Phe	42	0		51	18	NM_018075	0	0	9	21	12	A8K8K3|A8MV74|B3KTZ1|B3KY93|B4DJ83|B4DNK2|B7WP12|C9JHS1|Q8IXX9	Missense_Mutation	SNP	ENST00000292246.3	37	CCDS2710.2	.	.	.	.	.	.	.	.	.	.	T	24.3	4.511689	0.85389	.	.	ENSG00000160746	ENST00000292246;ENST00000396091;ENST00000414522;ENST00000451430;ENST00000428472	T;T;T;T;T	0.72167	-0.63;-0.63;-0.63;-0.63;-0.63	5.89	5.89	0.94794	.	0.000000	0.85682	D	0.000000	D	0.87577	0.6212	M	0.91354	3.2	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;1.0;1.0	D	0.90259	0.4299	10	0.87932	D	0	.	16.3127	0.82898	0.0:0.0:0.0:1.0	.	92;203;137;203	Q9NW15-4;C9JHS1;Q9NW15-3;Q9NW15	.;.;.;ANO10_HUMAN	F	203;137;203;92;92	ENSP00000292246:Y203F;ENSP00000379398:Y137F;ENSP00000396990:Y203F;ENSP00000394119:Y92F;ENSP00000416266:Y92F	ENSP00000292246:Y203F	Y	-	2	0	ANO10	43593742	1.000000	0.71417	1.000000	0.80357	0.715000	0.41141	8.040000	0.89188	2.246000	0.74042	0.533000	0.62120	TAC	.		0.343	ANO10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256649.2	NM_018075	
ARHGEF3	50650	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	56787577	56787577	+	Silent	SNP	G	G	C			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr3:56787577G>C	ENST00000296315.3	-	4	561	c.393C>G	c.(391-393)tcC>tcG	p.S131S	ARHGEF3_ENST00000496106.1_Silent_p.S137S|ARHGEF3_ENST00000338458.4_Silent_p.S163S|ARHGEF3_ENST00000498517.1_5'UTR|ARHGEF3_ENST00000495373.1_Silent_p.S131S|ARHGEF3_ENST00000413728.2_Silent_p.S137S|ARHGEF3_ENST00000497267.1_Silent_p.S102S	NM_019555.2	NP_062455.1	Q9NR81	ARHG3_HUMAN	Rho guanine nucleotide exchange factor (GEF) 3	131	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|intracellular (GO:0005622)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(1)	25				KIRC - Kidney renal clear cell carcinoma(284;0.0161)|Kidney(284;0.019)|OV - Ovarian serous cystadenocarcinoma(275;0.193)		CTTCTCCTTGGGAAAGCTCAA	0.363																																					p.S163S		.											.	ARHGEF3-228	0			c.C489G						.						116.0	120.0	118.0					3																	56787577		2203	4300	6503	SO:0001819	synonymous_variant	50650	exon7			TCCTTGGGAAAGC	AB209661	CCDS2878.1, CCDS46854.1, CCDS46855.1, CCDS74948.1	3p14.3	2012-09-20			ENSG00000163947	ENSG00000163947		"""Rho guanine nucleotide exchange factors"""	683	protein-coding gene	gene with protein product	"""exchange factor found in platelets and leukemic and neuronal tissues, XPLN"", ""RhoGEF protein"""	612115				10873612	Standard	NM_019555		Approved	STA3, XPLN, GEF3, DKFZP434F2429	uc003dih.2	Q9NR81	OTTHUMG00000158857	ENST00000296315.3:c.393C>G	3.37:g.56787577G>C		137	0		93	20	NM_001128615	0	0	30	47	17	A8K5U7|Q4FZB6|Q4QQI5|Q4QQQ0|Q59F00|Q6NUN3|Q7Z4U2|Q7Z5T2|Q9H7T4	Silent	SNP	ENST00000296315.3	37	CCDS2878.1																																																																																			.		0.363	ARHGEF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352431.2	NM_019555	
FRMD4B	23150	hgsc.bcm.edu	37	3	69336931	69336931	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr3:69336931A>G	ENST00000398540.3	-	5	556	c.473T>C	c.(472-474)tTc>tCc	p.F158S	FRMD4B_ENST00000542259.1_Missense_Mutation_p.F104S	NM_015123.1	NP_055938	Q9Y2L6	FRM4B_HUMAN	FERM domain containing 4B	158	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				establishment of epithelial cell polarity (GO:0090162)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|ruffle (GO:0001726)				NS(2)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(1)|ovary(3)|prostate(3)|skin(2)	19		Lung NSC(201;0.0138)|Prostate(884;0.11)		BRCA - Breast invasive adenocarcinoma(55;0.000201)|Epithelial(33;0.00141)|LUSC - Lung squamous cell carcinoma(21;0.00999)|Lung(16;0.0182)		TGCATTCAGGAAAAACAGCTC	0.443																																					p.F158S		.											.	FRMD4B-72	0			c.T473C						.						82.0	85.0	84.0					3																	69336931		1890	4113	6003	SO:0001583	missense	23150	exon5			TTCAGGAAAAACA	AL832231	CCDS46863.1	3p14.2	2006-04-12			ENSG00000114541	ENSG00000114541			24886	protein-coding gene	gene with protein product						10231032, 11445584	Standard	XM_005264720		Approved	KIAA1013, GRSP1	uc003dnv.2	Q9Y2L6	OTTHUMG00000158772	ENST00000398540.3:c.473T>C	3.37:g.69336931A>G	ENSP00000381549:p.Phe158Ser	39	0		31	2	NM_015123	0	0	0	0	0	Q8TAI3	Missense_Mutation	SNP	ENST00000398540.3	37	CCDS46863.1	.	.	.	.	.	.	.	.	.	.	A	22.7	4.326829	0.81690	.	.	ENSG00000114541	ENST00000398540;ENST00000542259;ENST00000493880;ENST00000473029;ENST00000460709;ENST00000459638	D;D;D;D;D;D	0.84516	-1.52;-1.52;-1.52;-1.52;-1.52;-1.86	5.76	5.76	0.90799	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);	0.055141	0.64402	D	0.000001	D	0.93294	0.7863	M	0.88570	2.965	0.58432	D	0.999995	D;D	0.89917	1.0;1.0	D;D	0.81914	0.986;0.995	D	0.94402	0.7624	10	0.87932	D	0	-18.8637	15.0592	0.71939	1.0:0.0:0.0:0.0	.	263;158	Q6PEW6;Q9Y2L6	.;FRM4B_HUMAN	S	158;104;49;104;104;104	ENSP00000381549:F158S;ENSP00000437658:F104S;ENSP00000418962:F49S;ENSP00000418373:F104S;ENSP00000418023:F104S;ENSP00000417550:F104S	ENSP00000381549:F158S	F	-	2	0	FRMD4B	69419621	1.000000	0.71417	1.000000	0.80357	0.854000	0.48673	7.367000	0.79558	2.202000	0.70862	0.533000	0.62120	TTC	.		0.443	FRMD4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352111.1		
EAF2	55840	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	121591418	121591418	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr3:121591418G>A	ENST00000273668.2	+	5	590	c.519G>A	c.(517-519)atG>atA	p.M173I	EAF2_ENST00000451944.2_Missense_Mutation_p.M173I	NM_018456.4	NP_060926.2	Q96CJ1	EAF2_HUMAN	ELL associated factor 2	173					apoptotic process (GO:0006915)|negative regulation of cell growth (GO:0030308)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	ELL-EAF complex (GO:0032783)|transcription elongation factor complex (GO:0008023)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			endometrium(1)|kidney(2)|large_intestine(1)|lung(4)|prostate(1)	9				GBM - Glioblastoma multiforme(114;0.0972)		TGGACCAGATGAGTAGTTGTG	0.313																																					p.M173I	Esophageal Squamous(194;1942 2097 24663 29345 31866)	.											.	EAF2-90	0			c.G519A						.						120.0	123.0	122.0					3																	121591418		2203	4300	6503	SO:0001583	missense	55840	exon5			CCAGATGAGTAGT	AF517829	CCDS3006.1	3q21.1	2007-08-01			ENSG00000145088	ENSG00000145088			23115	protein-coding gene	gene with protein product		607659				12446457, 12907652	Standard	NM_018456		Approved	BM040, TRAITS, U19	uc003een.3	Q96CJ1	OTTHUMG00000159424	ENST00000273668.2:c.519G>A	3.37:g.121591418G>A	ENSP00000273668:p.Met173Ile	184	0		288	154	NM_018456	0	0	5	12	7	Q9NZ82	Missense_Mutation	SNP	ENST00000273668.2	37	CCDS3006.1	.	.	.	.	.	.	.	.	.	.	G	16.45	3.127060	0.56721	.	.	ENSG00000145088	ENST00000273668;ENST00000451944	.	.	.	4.74	4.74	0.60224	.	0.135191	0.64402	D	0.000004	T	0.62258	0.2413	M	0.77820	2.39	0.47862	D	0.999539	B	0.30406	0.278	B	0.27887	0.084	T	0.62243	-0.6895	9	0.29301	T	0.29	-9.0448	15.2478	0.73521	0.0:0.0:1.0:0.0	.	173	Q96CJ1	EAF2_HUMAN	I	173	.	ENSP00000273668:M173I	M	+	3	0	EAF2	123074108	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.397000	0.79903	2.456000	0.83038	0.305000	0.20034	ATG	.		0.313	EAF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355247.1	NM_018456	
COL6A6	131873	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	130287032	130287032	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr3:130287032G>A	ENST00000358511.6	+	5	2016	c.1985G>A	c.(1984-1986)gGt>gAt	p.G662D	COL6A6_ENST00000453409.2_Missense_Mutation_p.G662D	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	662	Nonhelical region.|VWFA 4. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						GTGCAAATTGGTGTAGTCCAG	0.408																																					p.G662D		.											.	COL6A6-76	0			c.G1985A						.						176.0	171.0	173.0					3																	130287032		1915	4119	6034	SO:0001583	missense	131873	exon5			AAATTGGTGTAGT	AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.1985G>A	3.37:g.130287032G>A	ENSP00000351310:p.Gly662Asp	184	0		297	79	NM_001102608	0	0	0	0	0	A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Missense_Mutation	SNP	ENST00000358511.6	37	CCDS46911.1	.	.	.	.	.	.	.	.	.	.	G	14.84	2.654369	0.47467	.	.	ENSG00000206384	ENST00000358511;ENST00000453409	D;D	0.82711	-1.64;-1.64	5.53	5.53	0.82687	von Willebrand factor, type A (3);	0.000000	0.64402	D	0.000018	D	0.93350	0.7880	H	0.94886	3.595	0.54753	D	0.999986	D	0.89917	1.0	D	0.87578	0.998	D	0.94709	0.7890	10	0.87932	D	0	.	14.6487	0.68780	0.0:0.1454:0.8546:0.0	.	662	A6NMZ7	CO6A6_HUMAN	D	662	ENSP00000351310:G662D;ENSP00000399236:G662D	ENSP00000351310:G662D	G	+	2	0	COL6A6	131769722	1.000000	0.71417	0.353000	0.25747	0.014000	0.08584	5.227000	0.65305	2.616000	0.88540	0.655000	0.94253	GGT	.		0.408	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356705.5	NM_001102608	
CP	1356	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	148930432	148930432	+	Missense_Mutation	SNP	T	T	C	rs141532762		TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr3:148930432T>C	ENST00000264613.6	-	2	462	c.200A>G	c.(199-201)tAt>tGt	p.Y67C		NM_000096.3	NP_000087	P00450	CERU_HUMAN	ceruloplasmin (ferroxidase)	67	F5/8 type A 1.|Plastocyanin-like 1.				cellular iron ion homeostasis (GO:0006879)|copper ion transport (GO:0006825)|transmembrane transport (GO:0055085)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)	chaperone binding (GO:0051087)|copper ion binding (GO:0005507)|ferroxidase activity (GO:0004322)			breast(6)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		Prostate(884;0.00217)|Hepatocellular(537;0.00826)|Myeloproliferative disorder(1037;0.0122)|all_neural(597;0.0189)|Melanoma(1037;0.152)	LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)		Drotrecogin alfa(DB00055)	GGCCTTCTTATATAGTCTCCC	0.388																																					p.Y67C		.											.	CP-515	0			c.A200G						.	T	CYS/TYR	1,4405	2.1+/-5.4	0,1,2202	74.0	73.0	73.0		200	5.4	0.5	3	dbSNP_134	73	0,8600		0,0,4300	no	missense	CP	NM_000096.3	194	0,1,6502	CC,CT,TT		0.0,0.0227,0.0077	probably-damaging	67/1066	148930432	1,13005	2203	4300	6503	SO:0001583	missense	1356	exon2			TTCTTATATAGTC	M13536	CCDS3141.1	3q23-q25	2010-07-01			ENSG00000047457	ENSG00000047457	1.16.3.1		2295	protein-coding gene	gene with protein product		117700					Standard	NM_000096		Approved		uc003ewy.4	P00450	OTTHUMG00000159563	ENST00000264613.6:c.200A>G	3.37:g.148930432T>C	ENSP00000264613:p.Tyr67Cys	56	0		66	29	NM_000096	0	0	3	5	2	Q14063|Q2PP18|Q9UKS4	Missense_Mutation	SNP	ENST00000264613.6	37	CCDS3141.1	.	.	.	.	.	.	.	.	.	.	T	18.49	3.636271	0.67130	2.27E-4	0.0	ENSG00000047457	ENST00000264613;ENST00000455472	D;D	0.99277	-5.67;-5.67	5.42	5.42	0.78866	Cupredoxin (2);	0.000000	0.85682	D	0.000000	D	0.99530	0.9832	M	0.92784	3.345	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.984;0.993	D	0.98194	1.0464	10	0.87932	D	0	-24.6173	15.6278	0.76874	0.0:0.0:0.0:1.0	.	67;67	A8K5A4;P00450	.;CERU_HUMAN	C	67;107	ENSP00000264613:Y67C;ENSP00000426888:Y107C	ENSP00000264613:Y67C	Y	-	2	0	CP	150413122	1.000000	0.71417	0.500000	0.27589	0.701000	0.40568	7.525000	0.81892	2.280000	0.76307	0.460000	0.39030	TAT	T|1.000;C|0.000		0.388	CP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317498.1	NM_000096	
CLCN2	1181	hgsc.bcm.edu;broad.mit.edu	37	3	184071155	184071155	+	Silent	SNP	C	C	A			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr3:184071155C>A	ENST00000265593.4	-	17	2082	c.1911G>T	c.(1909-1911)ggG>ggT	p.G637G	CLCN2_ENST00000434054.2_Silent_p.G593G|EIF2B5_ENST00000444495.1_Intron|CLCN2_ENST00000423355.2_3'UTR|CLCN2_ENST00000344937.7_Silent_p.G620G|CLCN2_ENST00000475279.1_5'Flank|CLCN2_ENST00000457512.1_Silent_p.G637G	NM_004366.5	NP_004357.3	P51788	CLCN2_HUMAN	chloride channel, voltage-sensitive 2	637	CBS 1. {ECO:0000255|PROSITE- ProRule:PRU00703}.				cell differentiation involved in salivary gland development (GO:0060689)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|retina development in camera-type eye (GO:0060041)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)|voltage-gated chloride channel activity (GO:0005247)			breast(2)|central_nervous_system(4)|endometrium(1)|kidney(3)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	27	all_cancers(143;6.66e-11)|Ovarian(172;0.0339)		Epithelial(37;2.22e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		Lubiprostone(DB01046)	TCAGCTGGGCCCCCAACAATG	0.637																																					p.G637G		.											.	CLCN2-90	0			c.G1911T						.						29.0	31.0	31.0					3																	184071155		2201	4298	6499	SO:0001819	synonymous_variant	1181	exon17			CTGGGCCCCCAAC	S77770	CCDS3263.1, CCDS54690.1, CCDS54691.1, CCDS54692.1	3q27.1	2013-09-19	2012-02-23		ENSG00000114859	ENSG00000114859		"""Ion channels / Chloride channels : Voltage-sensitive"""	2020	protein-coding gene	gene with protein product		600570	"""chloride channel 2"""			7795595	Standard	NM_004366		Approved	CLC2, EJM6, ClC-2	uc003foi.4	P51788	OTTHUMG00000156747	ENST00000265593.4:c.1911G>T	3.37:g.184071155C>A		81	0		68	31	NM_004366	0	0	6	21	15	B4DQT9|B4DZ58|E9PBD9|E9PCD2|O14864|Q6IPA9|Q8WU13	Silent	SNP	ENST00000265593.4	37	CCDS3263.1																																																																																			.		0.637	CLCN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000345571.1		
HTT	3064	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	3156098	3156098	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr4:3156098C>A	ENST00000355072.5	+	27	3722	c.3577C>A	c.(3577-3579)Caa>Aaa	p.Q1193K		NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	1193					anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)			breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		ACCAGGAGAACAAGCATCTGT	0.498																																					p.Q1193K		.											.	HTT-281	0			c.C3577A						.						55.0	53.0	54.0					4																	3156098		2049	4207	6256	SO:0001583	missense	3064	exon27			GGAGAACAAGCAT	L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.3577C>A	4.37:g.3156098C>A	ENSP00000347184:p.Gln1193Lys	43	0		33	9	NM_002111	0	0	17	27	10	Q9UQB7	Missense_Mutation	SNP	ENST00000355072.5	37	CCDS43206.1	.	.	.	.	.	.	.	.	.	.	C	12.85	2.061554	0.36373	.	.	ENSG00000197386	ENST00000355072	T	0.05081	3.5	5.2	5.2	0.72013	.	0.378699	0.27906	N	0.017370	T	0.07683	0.0193	L	0.43152	1.355	0.27971	N	0.936396	B	0.20887	0.049	B	0.19148	0.024	T	0.21143	-1.0254	10	0.17832	T	0.49	.	16.9201	0.86162	0.0:1.0:0.0:0.0	.	1193	P42858	HD_HUMAN	K	1193	ENSP00000347184:Q1193K	ENSP00000347184:Q1193K	Q	+	1	0	HTT	3125896	0.989000	0.36119	0.644000	0.29465	0.961000	0.63080	3.195000	0.51013	2.430000	0.82344	0.557000	0.71058	CAA	.		0.498	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358234.2	NM_002111	
TECRL	253017	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	65180367	65180367	+	Splice_Site	SNP	G	G	A			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr4:65180367G>A	ENST00000381210.3	-	5	660	c.550C>T	c.(550-552)Cac>Tac	p.H184Y	TECRL_ENST00000513125.1_5'UTR|TECRL_ENST00000507440.1_Splice_Site_p.H184Y	NM_001010874.4	NP_001010874.2	Q5HYJ1	TECRL_HUMAN	trans-2,3-enoyl-CoA reductase-like	184					lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	oxidoreductase activity, acting on the CH-CH group of donors (GO:0016627)			endometrium(2)|kidney(5)|large_intestine(7)|lung(30)|prostate(1)|skin(1)|stomach(1)	47						ATCACTTACTGTACCACTGGG	0.428																																					p.H184Y		.											.	TECRL-90	0			c.C550T						.						83.0	76.0	78.0					4																	65180367		2203	4300	6503	SO:0001630	splice_region_variant	253017	exon5			CTTACTGTACCAC	AL833108	CCDS33990.1	4q13.1	2009-07-21			ENSG00000205678	ENSG00000205678			27365	protein-coding gene	gene with protein product	"""glycoprotein, synaptic 2-like"""					12477932	Standard	NM_001010874		Approved	GPSN2L, SRD5A2L2, DKFZp313D0829, DKFZp313B2333, TERL	uc003hcv.3	Q5HYJ1	OTTHUMG00000160680	ENST00000381210.3:c.551+1C>T	4.37:g.65180367G>A		51	0		33	10	NM_001010874	0	0	0	0	0		Missense_Mutation	SNP	ENST00000381210.3	37	CCDS33990.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.191677	0.78902	.	.	ENSG00000205678	ENST00000507440;ENST00000381210	T;T	0.42900	0.96;0.96	5.7	5.7	0.88788	.	0.124523	0.52532	D	0.000077	T	0.64832	0.2634	M	0.85777	2.775	0.80722	D	1	D;D	0.67145	0.996;0.993	D;P	0.78314	0.991;0.866	T	0.63537	-0.6615	10	0.07644	T	0.81	-12.79	16.5536	0.84479	0.0:0.0:1.0:0.0	.	184;184	Q6IN47;Q5HYJ1	.;TECRL_HUMAN	Y	184	ENSP00000426043:H184Y;ENSP00000370607:H184Y	ENSP00000370607:H184Y	H	-	1	0	TECRL	64862962	1.000000	0.71417	1.000000	0.80357	0.736000	0.42039	4.899000	0.63245	2.689000	0.91719	0.591000	0.81541	CAC	.		0.428	TECRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361705.4	NM_001010874	Missense_Mutation
SEPT11	55752	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	77941678	77941678	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr4:77941678T>G	ENST00000264893.6	+	7	1009	c.808T>G	c.(808-810)Ttt>Gtt	p.F270V	SEPT11_ENST00000502584.1_Missense_Mutation_p.F270V|SEPT11_ENST00000541121.1_Missense_Mutation_p.F280V|SEPT11_ENST00000512575.1_Intron|SEPT11_ENST00000510515.1_Missense_Mutation_p.F280V|SEPT11_ENST00000505788.1_Missense_Mutation_p.F270V	NM_018243.2	NP_060713.1	Q9NVA2	SEP11_HUMAN	septin 11	270	Septin-type G.				cell cycle (GO:0007049)|cell division (GO:0051301)|protein heterooligomerization (GO:0051291)	cell junction (GO:0030054)|cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|septin complex (GO:0031105)|stress fiber (GO:0001725)|synapse (GO:0045202)	GTP binding (GO:0005525)			endometrium(2)|kidney(3)|large_intestine(3)|lung(1)|skin(1)|stomach(1)	11						TCATTGCGATTTTGTGAAACT	0.468																																					p.F270V		.											.	SEPT11-68	0			c.T808G						.						96.0	93.0	94.0					4																	77941678		2203	4300	6503	SO:0001583	missense	55752	exon7			TGCGATTTTGTGA	AK001711	CCDS34018.1	4q21.1	2013-01-21			ENSG00000138758	ENSG00000138758		"""Septins"""	25589	protein-coding gene	gene with protein product		612887				14999297, 15140406	Standard	NM_018243		Approved	FLJ10849	uc003hkj.3	Q9NVA2	OTTHUMG00000160854	ENST00000264893.6:c.808T>G	4.37:g.77941678T>G	ENSP00000264893:p.Phe270Val	127	0		157	52	NM_018243	1	0	60	135	74	B7Z7Z6|E9KL32|Q4W5G1|Q7L4N1|Q96SP1|Q9UFY9	Missense_Mutation	SNP	ENST00000264893.6	37	CCDS34018.1	.	.	.	.	.	.	.	.	.	.	T	29.5	5.015347	0.93404	.	.	ENSG00000138758	ENST00000264893;ENST00000502584;ENST00000510641;ENST00000505788;ENST00000510515;ENST00000541121	T;T;T;T;T;T	0.68765	-0.35;-0.35;-0.35;-0.35;-0.35;-0.35	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	D	0.88724	0.6514	H	0.98388	4.22	0.58432	D	0.999996	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.80764	0.99;0.989;0.994	D	0.93076	0.6487	10	0.87932	D	0	.	15.1435	0.72630	0.0:0.0:0.0:1.0	.	280;262;270	Q9NVA2-2;D6RDU5;Q9NVA2	.;.;SEP11_HUMAN	V	270;270;262;270;280;280	ENSP00000264893:F270V;ENSP00000426344:F270V;ENSP00000420839:F262V;ENSP00000424925:F270V;ENSP00000422896:F280V;ENSP00000443701:F280V	ENSP00000264893:F270V	F	+	1	0	SEPT11	78160702	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.698000	0.84413	1.975000	0.57531	0.482000	0.46254	TTT	.		0.468	SEPT11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000362676.1	NM_018243	
LARP1B	55132	hgsc.bcm.edu	37	4	128998994	128998994	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr4:128998994A>C	ENST00000326639.6	+	4	305	c.94A>C	c.(94-96)Aaa>Caa	p.K32Q	LARP1B_ENST00000427266.1_Missense_Mutation_p.K32Q|LARP1B_ENST00000512292.1_Missense_Mutation_p.K32Q|LARP1B_ENST00000354456.3_5'UTR|LARP1B_ENST00000264584.5_Missense_Mutation_p.K32Q|LARP1B_ENST00000394288.3_Missense_Mutation_p.K32Q|LARP1B_ENST00000441387.1_Missense_Mutation_p.K32Q|LARP1B_ENST00000432347.2_Missense_Mutation_p.K32Q	NM_018078.2	NP_060548.2	Q659C4	LAR1B_HUMAN	La ribonucleoprotein domain family, member 1B	32						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|lung(11)|ovary(1)|prostate(3)	34						TAGAAAAGAAAAAGAAGAGAA	0.363																																					p.K32Q		.											.	LARP1B-68	0			c.A94C						.						55.0	58.0	57.0					4																	128998994		2203	4300	6503	SO:0001583	missense	55132	exon4			AAAGAAAAAGAAG		CCDS3738.1, CCDS47133.1, CCDS64057.1	4q28.2	2009-06-09	2009-06-09	2009-06-09	ENSG00000138709	ENSG00000138709		"""La ribonucleoprotein domain containing"""	24704	protein-coding gene	gene with protein product			"""La ribonucleoprotein domain family, member 2"""	LARP2		12045101	Standard	NM_018078		Approved	FLJ10378, DKFZp434K245, DKFZp686E0316	uc003iga.3	Q659C4	OTTHUMG00000133343	ENST00000326639.6:c.94A>C	4.37:g.128998994A>C	ENSP00000321997:p.Lys32Gln	49	0		34	2	NM_032239	0	0	53	53	0	Q2YDB6|Q4W599|Q4W5B2|Q659A0|Q6P5X2|Q7Z3F7|Q86VK7|Q8N6F4|Q8N7H4|Q8NAF2|Q9H5E7|Q9NW12	Missense_Mutation	SNP	ENST00000326639.6	37	CCDS3738.1	.	.	.	.	.	.	.	.	.	.	A	13.21	2.170063	0.38315	.	.	ENSG00000138709	ENST00000326639;ENST00000512292;ENST00000508819;ENST00000394288;ENST00000432347;ENST00000264584;ENST00000441387;ENST00000427266	T;T;T;T;T;T;T;T	0.48836	1.83;1.42;1.31;0.83;0.8;1.77;1.84;1.41	3.83	2.61	0.31194	.	0.451995	0.22773	N	0.055806	T	0.47857	0.1468	L	0.52573	1.65	0.80722	D	1	B;P;P;D	0.55800	0.22;0.934;0.796;0.973	B;P;B;P	0.51657	0.109;0.559;0.43;0.676	T	0.31251	-0.9950	10	0.22706	T	0.39	.	10.2386	0.43299	0.833:0.167:0.0:0.0	.	32;32;32;32	Q659C4;G3XAJ5;Q659C4-3;G3V0E9	LAR1B_HUMAN;.;.;.	Q	32	ENSP00000321997:K32Q;ENSP00000422850:K32Q;ENSP00000427281:K32Q;ENSP00000377829:K32Q;ENSP00000390395:K32Q;ENSP00000264584:K32Q;ENSP00000396521:K32Q;ENSP00000403586:K32Q	ENSP00000264584:K32Q	K	+	1	0	LARP1B	129218444	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	1.720000	0.38022	0.626000	0.30322	0.386000	0.25728	AAA	.		0.363	LARP1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257173.2	NM_018078	
NIPBL	25836	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	36984988	36984988	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr5:36984988A>T	ENST00000282516.8	+	10	2205	c.1706A>T	c.(1705-1707)gAa>gTa	p.E569V	NIPBL_ENST00000504430.1_3'UTR|NIPBL_ENST00000448238.2_Missense_Mutation_p.E569V	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)	569					brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			AAGCCTGAAGAAATCAAACAA	0.393																																					p.E569V		.											.	NIPBL-293	0			c.A1706T						.						92.0	96.0	94.0					5																	36984988		2203	4300	6503	SO:0001583	missense	25836	exon10			CTGAAGAAATCAA	AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.1706A>T	5.37:g.36984988A>T	ENSP00000282516:p.Glu569Val	143	0		179	72	NM_015384	0	0	18	29	11	Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Missense_Mutation	SNP	ENST00000282516.8	37	CCDS3920.1	.	.	.	.	.	.	.	.	.	.	A	12.56	1.974280	0.34848	.	.	ENSG00000164190	ENST00000282516;ENST00000448238	D;D	0.94417	-3.41;-3.42	5.98	5.98	0.97165	.	0.120361	0.64402	D	0.000018	D	0.90933	0.7150	N	0.19112	0.55	0.42318	D	0.992241	P;P	0.48503	0.856;0.911	B;P	0.44561	0.266;0.453	D	0.91908	0.5537	10	0.49607	T	0.09	.	16.4781	0.84144	1.0:0.0:0.0:0.0	.	569;569	Q6KC79;Q6KC79-2	NIPBL_HUMAN;.	V	569	ENSP00000282516:E569V;ENSP00000406266:E569V	ENSP00000282516:E569V	E	+	2	0	NIPBL	37020745	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.883000	0.69721	2.288000	0.76882	0.528000	0.53228	GAA	.		0.393	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207582.1	NM_015384	
ARHGAP26	23092	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	142416823	142416823	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr5:142416823A>G	ENST00000274498.4	+	13	1585	c.1207A>G	c.(1207-1209)Aga>Gga	p.R403G	ARHGAP26_ENST00000378004.3_Missense_Mutation_p.R403G	NM_015071.4	NP_055886.1	Q9UNA1	RHG26_HUMAN	Rho GTPase activating protein 26	403	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				actin cytoskeleton organization (GO:0030036)|filopodium assembly (GO:0046847)|nervous system development (GO:0007399)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)	phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(7)|ovary(1)	25		all_hematologic(541;0.0416)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TGTGGAAACCAGAGGTAAAGT	0.468																																					p.R403G		.											.	ARHGAP26-660	0			c.A1207G						.						127.0	106.0	113.0					5																	142416823		2203	4300	6503	SO:0001583	missense	23092	exon13			GAAACCAGAGGTA	AB014521	CCDS4277.1, CCDS47297.1	5q31	2011-06-29			ENSG00000145819	ENSG00000145819		"""Rho GTPase activating proteins"""	17073	protein-coding gene	gene with protein product	"""GTPase regulator associated with the focal adhesion kinase pp125"""	605370				9858476, 8649427	Standard	NM_001135608		Approved	GRAF, KIAA0621, OPHN1L, OPHN1L1	uc011dbj.2	Q9UNA1	OTTHUMG00000059705	ENST00000274498.4:c.1207A>G	5.37:g.142416823A>G	ENSP00000274498:p.Arg403Gly	59	0		81	41	NM_015071	0	0	0	0	0	O75117|Q5D035|Q9BYS6|Q9BYS7|Q9UJ00	Missense_Mutation	SNP	ENST00000274498.4	37	CCDS4277.1	.	.	.	.	.	.	.	.	.	.	A	21.4	4.144516	0.77888	.	.	ENSG00000145819	ENST00000274498;ENST00000378004	T;T	0.21031	2.03;2.03	5.84	4.64	0.57946	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.42268	0.1195	M	0.85945	2.785	0.58432	D	0.999996	P;D	0.53619	0.924;0.961	P;P	0.54590	0.508;0.756	T	0.42241	-0.9463	10	0.49607	T	0.09	.	12.0971	0.53761	0.856:0.144:0.0:0.0	.	403;403	Q9UNA1;Q9UNA1-2	RHG26_HUMAN;.	G	403	ENSP00000274498:R403G;ENSP00000367243:R403G	ENSP00000274498:R403G	R	+	1	2	ARHGAP26	142397016	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.389000	0.52516	0.988000	0.38734	0.455000	0.32223	AGA	.		0.468	ARHGAP26-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000132744.3	NM_015071	
JAKMIP2	9832	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	147000262	147000262	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr5:147000262G>T	ENST00000265272.5	-	18	2576	c.2109C>A	c.(2107-2109)gaC>gaA	p.D703E	JAKMIP2_ENST00000507386.1_Missense_Mutation_p.D682E|JAKMIP2_ENST00000333010.6_Missense_Mutation_p.D661E	NM_001270941.1|NM_014790.4	NP_001257870.1|NP_055605.2	Q96AA8	JKIP2_HUMAN	janus kinase and microtubule interacting protein 2	703						Golgi apparatus (GO:0005794)				NS(1)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(22)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTTTTCTGTAGTCTAGTTCTT	0.388																																					p.D703E		.											.	JAKMIP2-154	0			c.C2109A						.						308.0	258.0	275.0					5																	147000262		2203	4300	6503	SO:0001583	missense	9832	exon18			TCTGTAGTCTAGT	AB011127	CCDS4285.1, CCDS59495.1, CCDS64284.1, CCDS75352.1	5q32	2009-08-13	2009-08-13		ENSG00000176049	ENSG00000176049			29067	protein-coding gene	gene with protein product		611197				9628581	Standard	NM_001270941		Approved	JAMIP2, KIAA0555	uc010jgo.2	Q96AA8	OTTHUMG00000129731	ENST00000265272.5:c.2109C>A	5.37:g.147000262G>T	ENSP00000265272:p.Asp703Glu	105	0		176	85	NM_001270941	0	0	0	0	0	A4ZZA7|A8K5G5|B4DSG0|G5E9Y0|O60302|Q548S1	Missense_Mutation	SNP	ENST00000265272.5	37	CCDS4285.1	.	.	.	.	.	.	.	.	.	.	G	17.04	3.287394	0.59976	.	.	ENSG00000176049	ENST00000507386;ENST00000265272;ENST00000333010;ENST00000539401	T;T;T	0.25912	1.8;1.77;1.78	5.66	3.82	0.43975	.	0.000000	0.85682	D	0.000000	T	0.41558	0.1164	M	0.64404	1.975	0.49389	D	0.999788	D;D;D;D	0.61697	0.99;0.99;0.99;0.99	D;D;D;D	0.70935	0.971;0.971;0.971;0.971	T	0.22347	-1.0219	10	0.15952	T	0.53	.	10.5305	0.44973	0.1413:0.0:0.8587:0.0	.	661;703;682;703	B4DSG0;Q96AA8-3;G5E9Y0;Q96AA8	.;.;.;JKIP2_HUMAN	E	682;703;661;682	ENSP00000421398:D682E;ENSP00000265272:D703E;ENSP00000328989:D661E	ENSP00000265272:D703E	D	-	3	2	JAKMIP2	146980455	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.966000	0.40481	0.817000	0.34445	0.591000	0.81541	GAC	.		0.388	JAKMIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251941.1	NM_014790	
CREBRF	153222	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	172518026	172518026	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr5:172518026C>G	ENST00000296953.2	+	4	1163	c.844C>G	c.(844-846)Ctt>Gtt	p.L282V	CREBRF_ENST00000520420.1_Missense_Mutation_p.L282V|CREBRF_ENST00000522692.1_Missense_Mutation_p.L282V|CREBRF_ENST00000540014.1_Missense_Mutation_p.L282V	NM_153607.2	NP_705835.2	Q8IUR6	CRERF_HUMAN	CREB3 regulatory factor	282					negative regulation of endoplasmic reticulum unfolded protein response (GO:1900102)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of intracellular transport (GO:0032388)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein transport (GO:0051222)|response to endoplasmic reticulum stress (GO:0034976)|response to unfolded protein (GO:0006986)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)										GATGGAGCCTCTTCAAGGTCA	0.522																																					p.L282V		.											.	.	0			c.C844G						.						60.0	61.0	60.0					5																	172518026		2203	4300	6503	SO:0001583	missense	153222	exon4			GAGCCTCTTCAAG	AY139008	CCDS34293.1, CCDS54948.1	5q35.2	2012-03-06	2012-03-06	2012-03-06	ENSG00000164463	ENSG00000164463			24050	protein-coding gene	gene with protein product	"""luman/CREB3 recruitment factor"""		"""chromosome 5 open reading frame 41"""	C5orf41		18391022	Standard	NM_153607		Approved	LRF	uc003mch.3	Q8IUR6	OTTHUMG00000163322	ENST00000296953.2:c.844C>G	5.37:g.172518026C>G	ENSP00000296953:p.Leu282Val	91	0		96	26	NM_153607	0	0	9	21	12	B3DFH2|B3KW49|D3DQM2|F5GXN3|Q5HYG4|Q5HYK0|Q86YR3|Q8IZG1	Missense_Mutation	SNP	ENST00000296953.2	37	CCDS34293.1	.	.	.	.	.	.	.	.	.	.	C	3.060	-0.193550	0.06259	.	.	ENSG00000164463	ENST00000522692;ENST00000296953;ENST00000540014;ENST00000520420;ENST00000538538;ENST00000393776	T;T	0.43294	0.95;0.95	5.29	2.49	0.30216	.	0.733387	0.13308	N	0.397700	T	0.23766	0.0575	N	0.24115	0.695	0.09310	N	1	B;B	0.25609	0.039;0.13	B;B	0.24269	0.052;0.043	T	0.27191	-1.0081	10	0.07482	T	0.82	.	8.0149	0.30374	0.1291:0.7322:0.0:0.1387	.	282;282	Q8IUR6;Q8IUR6-2	CE041_HUMAN;.	V	282	ENSP00000296953:L282V;ENSP00000440075:L282V	ENSP00000296953:L282V	L	+	1	0	C5orf41	172450632	0.996000	0.38824	0.050000	0.19076	0.931000	0.56810	3.394000	0.52551	0.215000	0.20761	0.563000	0.77884	CTT	.		0.522	CREBRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372667.1	NM_153607	
SPDEF	25803	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	34512076	34512076	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr6:34512076G>T	ENST00000374037.3	-	2	571	c.157C>A	c.(157-159)Cag>Aag	p.Q53K	SPDEF_ENST00000544425.1_Missense_Mutation_p.Q53K	NM_012391.2	NP_036523.1	O95238	SPDEF_HUMAN	SAM pointed domain containing ETS transcription factor	53					cell differentiation (GO:0030154)|intestinal epithelial cell development (GO:0060576)|lung goblet cell differentiation (GO:0060480)|multicellular organismal development (GO:0007275)|negative regulation of cell fate commitment (GO:0010454)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell fate commitment (GO:0010455)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|skin(3)	15						GACAGGCCCTGCTCGGGCGTG	0.687																																					p.Q53K		.											.	SPDEF-653	0			c.C157A						.						35.0	40.0	38.0					6																	34512076		2203	4300	6503	SO:0001583	missense	25803	exon2			GGCCCTGCTCGGG	AF071538	CCDS4794.1, CCDS59013.1	6p21.3	2013-08-07	2013-08-07		ENSG00000124664	ENSG00000124664			17257	protein-coding gene	gene with protein product		608144	"""SAM pointed domain containing ets transcription factor"""			10625666, 6857767	Standard	NM_012391		Approved	PDEF, bA375E1.3	uc003ojq.2	O95238	OTTHUMG00000014548	ENST00000374037.3:c.157C>A	6.37:g.34512076G>T	ENSP00000363149:p.Gln53Lys	87	0		79	18	NM_001252294	0	0	0	0	0	B4DWH8|F5H778	Missense_Mutation	SNP	ENST00000374037.3	37	CCDS4794.1	.	.	.	.	.	.	.	.	.	.	G	14.43	2.534021	0.45073	.	.	ENSG00000124664	ENST00000374037;ENST00000544425	T;T	0.14022	2.54;2.73	4.97	4.97	0.65823	.	0.498805	0.17278	N	0.180107	T	0.04452	0.0122	L	0.27053	0.805	0.28482	N	0.914903	B;B	0.25904	0.137;0.085	B;B	0.25140	0.058;0.026	T	0.26121	-1.0112	10	0.35671	T	0.21	.	13.5867	0.61935	0.0:0.1561:0.8439:0.0	.	53;53	F5H778;O95238	.;SPDEF_HUMAN	K	53	ENSP00000363149:Q53K;ENSP00000442715:Q53K	ENSP00000363149:Q53K	Q	-	1	0	SPDEF	34620054	1.000000	0.71417	1.000000	0.80357	0.878000	0.50629	4.798000	0.62510	2.286000	0.76751	0.591000	0.81541	CAG	.		0.687	SPDEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040246.1	NM_012391	
SNX9	51429	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	158288583	158288583	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr6:158288583G>A	ENST00000392185.3	+	2	188	c.17G>A	c.(16-18)cGg>cAg	p.R6Q		NM_016224.3	NP_057308.1	Q9Y5X1	SNX9_HUMAN	sorting nexin 9	6	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				cleavage furrow formation (GO:0036089)|endocytosis (GO:0006897)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|lipid tube assembly (GO:0060988)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|positive regulation of GTPase activity (GO:0043547)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of protein oligomerization (GO:0032461)|receptor-mediated endocytosis (GO:0006898)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic vesicle membrane (GO:0030659)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	1-phosphatidylinositol binding (GO:0005545)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(10)|skin(1)|upper_aerodigestive_tract(1)	20		Breast(66;0.000776)|Ovarian(120;0.0303)|Prostate(117;0.167)		OV - Ovarian serous cystadenocarcinoma(65;8.06e-18)|BRCA - Breast invasive adenocarcinoma(81;4.48e-05)		TGATAGGCTCGGGTTATGTAT	0.393																																					p.R6Q		.											.	SNX9-226	0			c.G17A						.						171.0	140.0	150.0					6																	158288583		2203	4300	6503	SO:0001583	missense	51429	exon2			AGGCTCGGGTTAT	AF121859	CCDS5253.1	6q25.1-q26	2008-05-22			ENSG00000130340	ENSG00000130340		"""Sorting nexins"""	14973	protein-coding gene	gene with protein product		605952				10531379, 17609109	Standard	NM_016224		Approved	SH3PX1, SDP1, SH3PXD3A	uc003qqv.1	Q9Y5X1	OTTHUMG00000015903	ENST00000392185.3:c.17G>A	6.37:g.158288583G>A	ENSP00000376024:p.Arg6Gln	99	0		72	23	NM_016224	0	0	0	0	0	Q9BSI7|Q9BVM1|Q9UJH6|Q9UP20	Missense_Mutation	SNP	ENST00000392185.3	37	CCDS5253.1	.	.	.	.	.	.	.	.	.	.	G	15.69	2.908097	0.52333	.	.	ENSG00000130340	ENST00000539592;ENST00000392185	T	0.24350	1.86	5.22	4.33	0.51752	Src homology-3 domain (3);	0.434714	0.25546	N	0.029934	T	0.11281	0.0275	L	0.42686	1.345	0.80722	D	1	B	0.29936	0.262	B	0.26770	0.073	T	0.03514	-1.1029	10	0.45353	T	0.12	-7.1352	12.8925	0.58080	0.0:0.164:0.836:0.0	.	6	Q9Y5X1	SNX9_HUMAN	Q	6	ENSP00000376024:R6Q	ENSP00000376024:R6Q	R	+	2	0	SNX9	158208571	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	4.078000	0.57606	1.204000	0.43247	0.655000	0.94253	CGG	.		0.393	SNX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042856.1		
MET	4233	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	116417463	116417463	+	Missense_Mutation	SNP	C	C	T	rs121913244		TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr7:116417463C>T	ENST00000318493.6	+	16	3521	c.3334C>T	c.(3334-3336)Cat>Tat	p.H1112Y	MET_ENST00000539704.1_5'UTR|MET_ENST00000397752.3_Missense_Mutation_p.H1094Y			Q9NWH9	SLTM_HUMAN	MET proto-oncogene, receptor tyrosine kinase	0					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.H1112Y(1)		NS(10)|breast(4)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(25)|large_intestine(8)|liver(3)|lung(70)|ovary(10)|pleura(2)|prostate(4)|skin(5)|stomach(6)|testis(1)|thyroid(4)|upper_aerodigestive_tract(64)|urinary_tract(3)	233	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			TTGTGTATATCATGGGACTTT	0.343			Mis		"""papillary renal, head-neck squamous cell """	papillary renal			Hereditary Papillary Renal Carcinoma (type 1)																												p.H1112Y		.		Dom	yes	Familial Papillary Renal Cancer	7	7q31	4233	met proto-oncogene (hepatocyte growth factor receptor)		E	.	MET-5874	1	Substitution - Missense(1)	kidney(1)	c.C3334T	GRCh37	CM993668	MET	M	rs121913244	.						188.0	175.0	179.0					7																	116417463		1832	4086	5918	SO:0001583	missense	4233	exon16	Familial Cancer Database	HPRC, Hereditary Papillary Renal Cell Cancer	GTATATCATGGGA	M35073	CCDS43636.1, CCDS47689.1	7q31	2014-09-17	2014-06-26		ENSG00000105976	ENSG00000105976	2.7.10.1		7029	protein-coding gene	gene with protein product	"""hepatocyte growth factor receptor"""	164860	"""met proto-oncogene"""			1846706, 1611909	Standard	NM_001127500		Approved	HGFR, RCCP2	uc010lkh.3	P08581	OTTHUMG00000023299	ENST00000318493.6:c.3334C>T	7.37:g.116417463C>T	ENSP00000317272:p.His1112Tyr	199	0		276	144	NM_001127500	0	0	280	825	545	A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	ENST00000318493.6	37	CCDS47689.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.615896	0.87359	.	.	ENSG00000105976	ENST00000397752;ENST00000318493	T;T	0.33654	1.4;1.4	5.29	5.29	0.74685	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.43919	0.1269	N	0.11364	0.135	0.80722	D	1	P;D	0.89917	0.937;1.0	P;D	0.91635	0.854;0.999	T	0.52711	-0.8539	10	0.51188	T	0.08	-16.8984	19.2953	0.94119	0.0:1.0:0.0:0.0	.	1112;1094	P08581-2;P08581	.;MET_HUMAN	Y	1094;1112	ENSP00000380860:H1094Y;ENSP00000317272:H1112Y	ENSP00000317272:H1112Y	H	+	1	0	MET	116204699	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.776000	0.85560	2.628000	0.89032	0.655000	0.94253	CAT	.		0.343	MET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059620.3		
CTTNBP2	83992	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	117365303	117365303	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr7:117365303G>C	ENST00000160373.3	-	18	4155	c.4064C>G	c.(4063-4065)tCt>tGt	p.S1355C		NM_033427.2	NP_219499.1	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	1355					brain development (GO:0007420)	cell projection (GO:0042995)|synaptic vesicle (GO:0008021)				breast(3)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(36)|ovary(4)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		CCACAGCTTAGACATCCACCT	0.468																																					p.S1355C		.											.	CTTNBP2-94	0			c.C4064G						.						138.0	134.0	135.0					7																	117365303		2203	4300	6503	SO:0001583	missense	83992	exon18			AGCTTAGACATCC		CCDS5774.1	7q31	2013-01-10	2004-06-08	2004-06-09	ENSG00000077063	ENSG00000077063		"""Ankyrin repeat domain containing"""	15679	protein-coding gene	gene with protein product		609772	"""cortactin binding protein 2"""	CORTBP2, C7orf8		11707066	Standard	XM_005250635		Approved	KIAA1758, Orf4	uc003vjf.3	Q8WZ74	OTTHUMG00000022880	ENST00000160373.3:c.4064C>G	7.37:g.117365303G>C	ENSP00000160373:p.Ser1355Cys	192	0		326	72	NM_033427	0	0	0	0	0	O43389|Q7LG11|Q9C0A5	Missense_Mutation	SNP	ENST00000160373.3	37	CCDS5774.1	.	.	.	.	.	.	.	.	.	.	G	15.54	2.864762	0.51482	.	.	ENSG00000077063	ENST00000160373	D	0.91068	-2.78	5.72	5.72	0.89469	.	0.267144	0.43416	D	0.000578	D	0.87557	0.6207	L	0.41824	1.3	0.80722	D	1	B	0.14012	0.009	B	0.15484	0.013	T	0.81274	-0.1007	10	0.23891	T	0.37	9.6033	20.244	0.98389	0.0:0.0:1.0:0.0	.	1355	Q8WZ74	CTTB2_HUMAN	C	1355	ENSP00000160373:S1355C	ENSP00000160373:S1355C	S	-	2	0	CTTNBP2	117152539	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	6.149000	0.71795	2.865000	0.98341	0.655000	0.94253	TCT	.		0.468	CTTNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059201.4	NM_033427	
KMT2C	58508	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	151917756	151917756	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr7:151917756C>A	ENST00000262189.6	-	23	3782	c.3564G>T	c.(3562-3564)caG>caT	p.Q1188H	KMT2C_ENST00000355193.2_Missense_Mutation_p.Q1188H	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	1188					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										CTGTGAGGCTCTGTAACTGAG	0.408																																					p.Q1188H		.											.	MLL3-1398	0			c.G3564T						.						72.0	69.0	70.0					7																	151917756		2203	4298	6501	SO:0001583	missense	58508	exon23			GAGGCTCTGTAAC	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.3564G>T	7.37:g.151917756C>A	ENSP00000262189:p.Gln1188His	118	0		163	71	NM_170606	0	0	15	25	10	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	C	15.83	2.948672	0.53186	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	D;D	0.85171	-1.95;-1.95	4.44	3.56	0.40772	.	0.000000	0.41605	U	0.000856	D	0.89763	0.6809	L	0.56769	1.78	0.80722	D	1	D;D	0.76494	0.996;0.999	D;D	0.75484	0.986;0.971	D	0.89849	0.4008	10	0.66056	D	0.02	.	12.545	0.56195	0.0:0.9173:0.0:0.0827	.	1188;249	Q8NEZ4;Q8NEZ4-2	MLL3_HUMAN;.	H	1188	ENSP00000262189:Q1188H;ENSP00000347325:Q1188H	ENSP00000262189:Q1188H	Q	-	3	2	MLL3	151548689	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.614000	0.61183	0.976000	0.38417	0.484000	0.47621	CAG	.		0.408	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
RP1L1	94137	broad.mit.edu	37	8	10470573	10470573	+	Silent	SNP	C	C	T	rs73201157	byFrequency	TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr8:10470573C>T	ENST00000382483.3	-	4	1258	c.1035G>A	c.(1033-1035)agG>agA	p.R345R		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	345					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		GGGCGCTGGCCCTGCCCATCC	0.657													C|||	4	0.000798722	0.0	0.0	5008	,	,		16066	0.0		0.004	False		,,,				2504	0.0				p.R345R													.	RP1L1-139	0			c.G1035A						.	C		0,4218		0,0,2109	57.0	63.0	61.0		1035	4.3	0.7	8	dbSNP_130	61	6,8446		0,6,4220	no	coding-synonymous	RP1L1	NM_178857.5		0,6,6329	TT,TC,CC		0.071,0.0,0.0474		345/2401	10470573	6,12664	2109	4226	6335	SO:0001819	synonymous_variant	94137	exon4			GCTGGCCCTGCCC	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.1035G>A	8.37:g.10470573C>T		169	1		132	5	NM_178857	0	0	0	0	0	Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Silent	SNP	ENST00000382483.3	37	CCDS43708.1																																																																																			C|0.999;T|0.001		0.657	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1		
IDO2	169355	hgsc.bcm.edu	37	8	39862889	39862889	+	Silent	SNP	T	T	C			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr8:39862889T>C	ENST00000389060.4	+	8	711	c.711T>C	c.(709-711)ttT>ttC	p.F237F	IDO2_ENST00000502986.2_Silent_p.F250F|IDO2_ENST00000343295.4_Intron			Q6ZQW0	I23O2_HUMAN	indoleamine 2,3-dioxygenase 2	237					cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|tryptophan catabolic process (GO:0006569)|tryptophan catabolic process to kynurenine (GO:0019441)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	heme binding (GO:0020037)|indoleamine 2,3-dioxygenase activity (GO:0033754)|metal ion binding (GO:0046872)|tryptophan 2,3-dioxygenase activity (GO:0004833)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(6)|ovary(2)|upper_aerodigestive_tract(1)	18						TCCGGATCTTTCTCTCTGGGT	0.398																																					p.F250F		.											.	IDO2-24	0			c.T750C						.						190.0	162.0	171.0					8																	39862889		1876	4108	5984	SO:0001819	synonymous_variant	169355	exon9			GATCTTTCTCTCT	AK128691		8p11.21	2012-04-19	2009-01-07	2009-01-07	ENSG00000188676	ENSG00000188676			27269	protein-coding gene	gene with protein product		612129	"""indoleamine-pyrrole 2,3 dioxygenase-like 1"""	INDOL1			Standard	NM_194294		Approved		uc010lwy.1	Q6ZQW0	OTTHUMG00000141271	ENST00000389060.4:c.711T>C	8.37:g.39862889T>C		49	0		38	2	NM_194294	0	0	0	0	0	A4UD41	Silent	SNP	ENST00000389060.4	37																																																																																				.		0.398	IDO2-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000372742.1	NM_194294	
CDH17	1015	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	95201459	95201459	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr8:95201459A>C	ENST00000027335.3	-	3	230	c.106T>G	c.(106-108)Ttt>Gtt	p.F36V	CDH17_ENST00000450165.2_Missense_Mutation_p.F36V|CDH17_ENST00000441892.2_Missense_Mutation_p.F36V	NM_004063.3	NP_004054.3	Q12864	CAD17_HUMAN	cadherin 17, LI cadherin (liver-intestine)	36	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|oligopeptide transmembrane transport (GO:0035672)|oligopeptide transport (GO:0006857)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|proton-dependent oligopeptide secondary active transmembrane transporter activity (GO:0005427)|transporter activity (GO:0005215)			NS(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(18)|ovary(6)|prostate(3)|skin(4)|stomach(2)	52	Breast(36;4.65e-06)		BRCA - Breast invasive adenocarcinoma(8;0.00691)			TAAATAGAAAATGTCATGGGT	0.403																																					p.F36V		.											.	CDH17-96	0			c.T106G						.						118.0	120.0	119.0					8																	95201459		2203	4300	6503	SO:0001583	missense	1015	exon3			TAGAAAATGTCAT	X83228	CCDS6260.1	8q22.1	2010-01-26			ENSG00000079112	ENSG00000079112		"""Cadherins / Major cadherins"""	1756	protein-coding gene	gene with protein product		603017				9615235, 10191097	Standard	NM_004063		Approved	HPT-1, cadherin	uc003ygh.2	Q12864	OTTHUMG00000164391	ENST00000027335.3:c.106T>G	8.37:g.95201459A>C	ENSP00000027335:p.Phe36Val	102	0		97	76	NM_004063	0	0	1	17	16	Q15336|Q2M2E0	Missense_Mutation	SNP	ENST00000027335.3	37	CCDS6260.1	.	.	.	.	.	.	.	.	.	.	A	9.966	1.224134	0.22457	.	.	ENSG00000079112	ENST00000027335;ENST00000441892;ENST00000450165;ENST00000521491	T;T;T;T	0.60040	0.26;0.26;0.26;0.22	5.43	5.43	0.79202	Cadherin (1);Cadherin-like (1);	0.000000	0.49305	D	0.000150	T	0.59959	0.2232	L	0.39514	1.22	0.47374	D	0.999407	D;D	0.62365	0.979;0.991	P;P	0.56042	0.622;0.79	T	0.57365	-0.7824	10	0.30854	T	0.27	-19.528	11.8845	0.52594	1.0:0.0:0.0:0.0	.	36;36	E7EN24;Q12864	.;CAD17_HUMAN	V	36	ENSP00000027335:F36V;ENSP00000392811:F36V;ENSP00000401468:F36V;ENSP00000428189:F36V	ENSP00000027335:F36V	F	-	1	0	CDH17	95270635	0.957000	0.32711	0.996000	0.52242	0.606000	0.37113	2.732000	0.47352	2.057000	0.61298	0.482000	0.46254	TTT	.		0.403	CDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378560.1	NM_004063	
BNC2	54796	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	16419221	16419221	+	Silent	SNP	A	A	G			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr9:16419221A>G	ENST00000380672.4	-	7	3123	c.3066T>C	c.(3064-3066)tcT>tcC	p.S1022S	BNC2_ENST00000545497.1_Silent_p.S927S|BNC2_ENST00000380667.2_Silent_p.S955S	NM_017637.5	NP_060107.3			basonuclin 2											NS(2)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(16)|liver(1)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(50;9.01e-08)		TGAACATAAGAGATCCTGAAA	0.547																																					p.S1022S		.											.	BNC2-92	0			c.T3066C						.						81.0	72.0	75.0					9																	16419221		2203	4300	6503	SO:0001819	synonymous_variant	54796	exon7			CATAAGAGATCCT	AK092247	CCDS6482.2	9p22.2	2013-05-20			ENSG00000173068	ENSG00000173068		"""Zinc fingers, C2H2-type"""	30988	protein-coding gene	gene with protein product		608669				14702039	Standard	XM_006716784		Approved	BSN2, FLJ20043	uc003zml.3	Q6ZN30	OTTHUMG00000019593	ENST00000380672.4:c.3066T>C	9.37:g.16419221A>G		100	0		96	29	NM_017637	0	0	5	7	2		Silent	SNP	ENST00000380672.4	37	CCDS6482.2																																																																																			.		0.547	BNC2-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216901.5	NM_017637	
MLLT3	4300	broad.mit.edu	37	9	20414373	20414373	+	Silent	SNP	G	G	A			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr9:20414373G>A	ENST00000380338.4	-	5	757	c.471C>T	c.(469-471)agC>agT	p.S157S	MLLT3_ENST00000355930.6_5'UTR|MLLT3_ENST00000429426.2_Silent_p.S154S|MLLT3_ENST00000475957.1_5'UTR	NM_004529.2	NP_004520.2	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3	157	Poly-Ser.				anterior/posterior pattern specification (GO:0009952)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of transcription, DNA-templated (GO:0006355)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)		p.S157S(5)		central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(6)|lung(24)|ovary(1)|prostate(4)|skin(1)|urinary_tract(7)	66				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		tgctgctgctgctactgctgc	0.527			T	MLL	ALL																																p.S157S				Dom	yes		9	9p22	4300	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (AF9)"""		L	.	MLLT3-660	5	Substitution - coding silent(5)	endometrium(3)|urinary_tract(1)|prostate(1)	c.C471T						.						9.0	14.0	12.0					9																	20414373		1757	3647	5404	SO:0001819	synonymous_variant	4300	exon5			GCTGCTGCTACTG	L13744	CCDS6494.1	9p22	2008-02-05	2001-11-28		ENSG00000171843	ENSG00000171843			7136	protein-coding gene	gene with protein product		159558	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 3"""			8506309, 8414510	Standard	NM_001286691		Approved	AF-9, AF9, YEATS3	uc003zoe.2	P42568	OTTHUMG00000019650	ENST00000380338.4:c.471C>T	9.37:g.20414373G>A		49	1		72	6	NM_004529	0	0	33	33	0	B1AMQ2|B2R7B3|B7Z755|D3DRJ8|Q8IVB0	Silent	SNP	ENST00000380338.4	37	CCDS6494.1																																																																																			.		0.527	MLLT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051872.1	NM_004529	
GRIN3A	116443	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	104449145	104449145	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr9:104449145C>G	ENST00000361820.3	-	2	1637	c.1037G>C	c.(1036-1038)gGg>gCg	p.G346A		NM_133445.2	NP_597702.2	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3A	346					calcium ion transport (GO:0006816)|dendrite development (GO:0016358)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|response to ethanol (GO:0045471)|rhythmic process (GO:0048511)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|identical protein binding (GO:0042802)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|protein phosphatase 2A binding (GO:0051721)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(44)|ovary(4)|pancreas(1)|skin(7)|upper_aerodigestive_tract(1)	80		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Acetylcysteine(DB06151)|Amantadine(DB00915)|Atomoxetine(DB00289)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Gabapentin(DB00996)|Halothane(DB01159)|Ketamine(DB01221)|Ketobemidone(DB06738)|Memantine(DB01043)|Methadone(DB00333)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Procaine(DB00721)|Secobarbital(DB00418)|Tramadol(DB00193)	GGGCATGACCCCAAACTGGGT	0.507																																					p.G346A		.											.	GRIN3A-96	0			c.G1037C						.						66.0	64.0	65.0					9																	104449145		2203	4300	6503	SO:0001583	missense	116443	exon2			ATGACCCCAAACT		CCDS6758.1	9q31.1	2012-08-29			ENSG00000198785	ENSG00000198785		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16767	protein-coding gene	gene with protein product		606650					Standard	NM_133445		Approved	GluN3A	uc004bbp.2	Q8TCU5	OTTHUMG00000020387	ENST00000361820.3:c.1037G>C	9.37:g.104449145C>G	ENSP00000355155:p.Gly346Ala	54	0		68	33	NM_133445	0	0	0	0	0	B3DLF9|Q5VTR3|Q8TF29|Q8WXI6	Missense_Mutation	SNP	ENST00000361820.3	37	CCDS6758.1	.	.	.	.	.	.	.	.	.	.	C	14.98	2.696202	0.48202	.	.	ENSG00000198785	ENST00000361820	D	0.90732	-2.72	5.83	4.92	0.64577	.	0.942080	0.09021	N	0.860194	D	0.90017	0.6883	L	0.59436	1.845	0.58432	D	0.999992	B	0.28419	0.211	B	0.26864	0.074	D	0.83443	0.0044	10	0.66056	D	0.02	.	15.7632	0.78103	0.1471:0.8529:0.0:0.0	.	346	Q8TCU5	NMD3A_HUMAN	A	346	ENSP00000355155:G346A	ENSP00000355155:G346A	G	-	2	0	GRIN3A	103488966	1.000000	0.71417	0.885000	0.34714	0.653000	0.38743	4.782000	0.62396	1.403000	0.46800	0.563000	0.77884	GGG	.		0.507	GRIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053453.1		
SH2D3C	10044	hgsc.bcm.edu	37	9	130501166	130501166	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr9:130501166G>C	ENST00000314830.8	-	12	2555	c.2442C>G	c.(2440-2442)ttC>ttG	p.F814L	SH2D3C_ENST00000420366.1_Missense_Mutation_p.F656L|SH2D3C_ENST00000373276.3_Missense_Mutation_p.F746L|SH2D3C_ENST00000373277.4_Missense_Mutation_p.F657L|SH2D3C_ENST00000373274.3_Missense_Mutation_p.F654L|SH2D3C_ENST00000429553.1_Missense_Mutation_p.F460L	NM_170600.2	NP_733745.1	Q8N5H7	SH2D3_HUMAN	SH2 domain containing 3C	814	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				JNK cascade (GO:0007254)|positive regulation of signal transduction (GO:0009967)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)|SH3/SH2 adaptor activity (GO:0005070)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						ACTCCGTGCTGAACACCTCCA	0.637																																					p.F814L		.											.	SH2D3C-228	0			c.C2442G						.						34.0	30.0	32.0					9																	130501166		2198	4298	6496	SO:0001583	missense	10044	exon12			CGTGCTGAACACC	AF124251	CCDS6877.1, CCDS6878.1, CCDS48026.1, CCDS48028.1, CCDS59145.1	9q33.1-q33.3	2013-02-14	2002-01-14		ENSG00000095370	ENSG00000095370		"""SH2 domain containing"""	16884	protein-coding gene	gene with protein product		604722	"""SH2 domain-containing 3C"""			10187783	Standard	NM_170600		Approved	NSP3	uc004bsc.3	Q8N5H7	OTTHUMG00000020717	ENST00000314830.8:c.2442C>G	9.37:g.130501166G>C	ENSP00000317817:p.Phe814Leu	25	0		17	2	NM_170600	0	0	4	4	0	A8K5S8|E9PG48|Q5HYE5|Q5JU31|Q6UY42|Q8N6X3|Q9Y2X5	Missense_Mutation	SNP	ENST00000314830.8	37	CCDS6877.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.684832	0.88639	.	.	ENSG00000095370	ENST00000373277;ENST00000420366;ENST00000373276;ENST00000373274;ENST00000429553;ENST00000314830	T;T;T;T;T;T	0.29142	2.42;2.41;2.1;2.43;1.58;2.33	5.76	5.76	0.90799	Guanine-nucleotide dissociation stimulator CDC25 (2);	0.090299	0.85682	D	0.000000	T	0.44350	0.1289	L	0.48174	1.505	0.80722	D	1	P;D;B;P;D	0.69078	0.918;0.997;0.45;0.507;0.996	P;P;B;B;D	0.62955	0.485;0.591;0.281;0.232;0.909	T	0.08027	-1.0742	10	0.28530	T	0.3	-8.9959	13.8642	0.63578	0.0:0.0:0.8475:0.1525	.	654;814;746;657;656	E9PG48;Q8N5H7;E7EUN5;Q8N5H7-2;Q8N5H7-5	.;SH2D3_HUMAN;.;.;.	L	657;656;746;654;460;814	ENSP00000362374:F657L;ENSP00000388536:F656L;ENSP00000362373:F746L;ENSP00000362371:F654L;ENSP00000394632:F460L;ENSP00000317817:F814L	ENSP00000317817:F814L	F	-	3	2	SH2D3C	129540987	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.813000	0.86123	2.713000	0.92767	0.655000	0.94253	TTC	.		0.637	SH2D3C-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054264.1	NM_005489	
EXOSC2	23404	ucsc.edu	37	9	133569210	133569210	+	Missense_Mutation	SNP	G	G	C	rs202001690		TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr9:133569210G>C	ENST00000372358.5	+	1	103	c.32G>C	c.(31-33)cGc>cCc	p.R11P	EXOSC2_ENST00000372351.3_Missense_Mutation_p.R11P|EXOSC2_ENST00000372352.3_Missense_Mutation_p.R11P|EXOSC2_ENST00000546165.1_Missense_Mutation_p.R11P			Q13868	EXOS2_HUMAN	exosome component 2	11					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|positive regulation of cell growth (GO:0030307)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|nucleus (GO:0005634)	3'-5'-exoribonuclease activity (GO:0000175)|7S RNA binding (GO:0008312)			breast(1)|endometrium(1)|large_intestine(3)|ovary(1)	6		Acute lymphoblastic leukemia(5;0.0508)|all_hematologic(13;0.0588)		OV - Ovarian serous cystadenocarcinoma(145;0.000324)		CCAGTGGCTCGCAAGCCTCTT	0.587																																					p.R11P	Pancreas(134;1683 1824 10118 27928 31640)												.	EXOSC2-91	0			c.G32C						.						33.0	33.0	33.0					9																	133569210		2201	4299	6500	SO:0001583	missense	23404	exon1			TGGCTCGCAAGCC	AK001916	CCDS6935.1, CCDS65160.1, CCDS65161.1	9q34	2008-02-05			ENSG00000130713	ENSG00000130713			17097	protein-coding gene	gene with protein product	"""homolog of yeast RRP4 (ribosomal RNA processing 4), 3' 5' exoribonuclease (RRP4)"""	602238				8600032, 1538749	Standard	XM_005272176		Approved	hRrp4p, Rrp4p, RRP4, p7	uc004bzu.2	Q13868	OTTHUMG00000020811	ENST00000372358.5:c.32G>C	9.37:g.133569210G>C	ENSP00000361433:p.Arg11Pro	76	8		65	4	NM_014285	0	0	15	18	3	A3KFL3|B4DKK6|Q9NUY4	Missense_Mutation	SNP	ENST00000372358.5	37	CCDS6935.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.950566	0.73787	.	.	ENSG00000130713	ENST00000372358;ENST00000546165;ENST00000372352;ENST00000372351;ENST00000372350;ENST00000495699	.	.	.	6.06	6.06	0.98353	.	0.199231	0.43579	D	0.000553	T	0.57740	0.2074	L	0.55481	1.735	0.43476	D	0.995695	B;D	0.53312	0.051;0.959	B;P	0.45881	0.012;0.496	T	0.61282	-0.7094	9	0.62326	D	0.03	-21.9848	12.8575	0.57894	0.0736:0.0:0.9264:0.0	.	11;11	B4DKK6;Q13868	.;EXOS2_HUMAN	P	11	.	ENSP00000361425:R11P	R	+	2	0	EXOSC2	132559031	0.994000	0.37717	0.924000	0.36721	0.379000	0.30106	3.806000	0.55583	2.882000	0.98803	0.655000	0.94253	CGC	.		0.587	EXOSC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054673.1	NM_014285	
ARAF	369	hgsc.bcm.edu	37	X	47426120	47426120	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chrX:47426120T>G	ENST00000377045.4	+	7	834	c.640T>G	c.(640-642)Tcc>Gcc	p.S214A	ARAF_ENST00000290277.6_Intron	NM_001256196.1|NM_001654.4	NP_001243125.1|NP_001645.1	P10398	ARAF_HUMAN	A-Raf proto-oncogene, serine/threonine kinase	214					cellular protein modification process (GO:0006464)|negative regulation of apoptotic process (GO:0043066)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|regulation of TOR signaling (GO:0032006)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein activity (GO:0005057)			biliary_tract(1)|endometrium(4)|large_intestine(7)|liver(2)|lung(11)|ovary(2)|skin(1)|urinary_tract(1)	29					Adenosine triphosphate(DB00171)	CCGCTCCACGTCCACTCCCAA	0.662																																					p.S217A		.											.	ARAF-1557	0			c.T649G						.						71.0	57.0	62.0					X																	47426120		2203	4300	6503	SO:0001583	missense	369	exon7			TCCACGTCCACTC	X04790	CCDS35232.1, CCDS59164.1, CCDS75970.1	Xp11.3-p11.23	2014-06-26	2014-06-26	2005-01-19	ENSG00000078061	ENSG00000078061			646	protein-coding gene	gene with protein product		311010	"""v-raf murine sarcoma 3611 viral oncogene homolog 1"""	ARAF1			Standard	NM_001654		Approved		uc004dic.2	P10398	OTTHUMG00000021446	ENST00000377045.4:c.640T>G	X.37:g.47426120T>G	ENSP00000366244:p.Ser214Ala	34	0		34	2	NM_001256196	0	0	57	58	1	P07557|Q5H9B2|Q5H9B3	Missense_Mutation	SNP	ENST00000377045.4	37	CCDS35232.1	.	.	.	.	.	.	.	.	.	.	T	17.87	3.494658	0.64186	.	.	ENSG00000078061	ENST00000377045	T	0.75821	-0.97	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.77738	0.4175	M	0.78456	2.415	0.80722	D	1	B;P	0.39903	0.403;0.694	B;B	0.43018	0.142;0.405	T	0.80745	-0.1245	10	0.87932	D	0	.	12.2128	0.54389	0.0:0.0:0.0:1.0	.	214;80	P10398;B4DV85	ARAF_HUMAN;.	A	214	ENSP00000366244:S214A	ENSP00000366244:S214A	S	+	1	0	ARAF	47311064	1.000000	0.71417	0.887000	0.34795	0.944000	0.59088	7.542000	0.82095	1.788000	0.52465	0.441000	0.28932	TCC	.		0.662	ARAF-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056418.1		
TRO	7216	hgsc.bcm.edu	37	X	54948719	54948719	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chrX:54948719T>G	ENST00000173898.7	+	2	152	c.40T>G	c.(40-42)Ttt>Gtt	p.F14V	TRO_ENST00000375022.4_Missense_Mutation_p.F14V|TRO_ENST00000399736.1_Missense_Mutation_p.F14V|TRO_ENST00000484031.1_3'UTR|TRO_ENST00000375041.2_Missense_Mutation_p.F14V|TRO_ENST00000319167.8_Missense_Mutation_p.F14V|TRO_ENST00000420798.2_Intron	NM_001039705.2	NP_001034794.1	Q12816	TROP_HUMAN	trophinin	14					embryo implantation (GO:0007566)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|skin(2)|urinary_tract(1)	37						GGTGCCTCTATTTCAGGTGAG	0.507																																					p.F14V		.											.	TRO-131	0			c.T40G						.						127.0	114.0	118.0					X																	54948719		1971	4133	6104	SO:0001583	missense	7216	exon2			CCTCTATTTCAGG	U04811	CCDS43958.1, CCDS43959.1, CCDS59527.1, CCDS59528.1, CCDS59529.1	Xp11.22-p11.21	2008-02-05			ENSG00000067445	ENSG00000067445			12326	protein-coding gene	gene with protein product		300132				9533028, 11454705	Standard	NM_001039705		Approved	MAGE-D3, KIAA1114, MAGED3	uc004dtq.4	Q12816	OTTHUMG00000021640	ENST00000173898.7:c.40T>G	X.37:g.54948719T>G	ENSP00000173898:p.Phe14Val	21	0		22	2	NM_016157	0	0	3	3	0	B1AKE9|B1AKF1|F5GY27|Q96SX2|Q9NU89|Q9UPN8	Missense_Mutation	SNP	ENST00000173898.7	37	CCDS43959.1	.	.	.	.	.	.	.	.	.	.	T	3.075	-0.190361	0.06299	.	.	ENSG00000067445	ENST00000442098;ENST00000173898;ENST00000319167;ENST00000375022;ENST00000399736;ENST00000319179;ENST00000431115;ENST00000375041;ENST00000440759;ENST00000416704	T;T;T;T;T;T;T;T;T	0.55930	0.49;3.3;3.17;3.17;2.62;1.81;3.62;0.5;0.5	3.15	1.93	0.25924	.	.	.	.	.	T	0.29749	0.0743	N	0.24115	0.695	0.26674	N	0.971676	B;B;B;P	0.43094	0.384;0.056;0.036;0.799	B;B;B;B	0.30782	0.078;0.004;0.014;0.12	T	0.15809	-1.0424	9	0.72032	D	0.01	.	5.5808	0.17248	0.0:0.0:0.2837:0.7163	.	14;14;14;14	B1AKE9;B1AKF1;Q96SX2;Q12816	.;.;.;TROP_HUMAN	V	14	ENSP00000404645:F14V;ENSP00000173898:F14V;ENSP00000318278:F14V;ENSP00000364162:F14V;ENSP00000382641:F14V;ENSP00000407996:F14V;ENSP00000364181:F14V;ENSP00000406574:F14V;ENSP00000404767:F14V	ENSP00000173898:F14V	F	+	1	0	TRO	54965444	0.669000	0.27502	0.342000	0.25602	0.080000	0.17528	0.843000	0.27640	0.419000	0.25927	0.417000	0.27973	TTT	.		0.507	TRO-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056837.3	NM_016157	
EXOC5	10640	broad.mit.edu	37	14	57702498	57702498	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr14:57702498delA	ENST00000413566.2	-	7	959	c.600delT	c.(598-600)tttfs	p.F200fs	EXOC5_ENST00000340918.7_Frame_Shift_Del_p.F135fs	NM_006544.3	NP_006535.1	O00471	EXOC5_HUMAN	exocyst complex component 5	200					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)|vesicle docking (GO:0048278)	cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(3)|endometrium(1)|large_intestine(3)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	22						GAGCACTGGTAAACTCCTGAA	0.353																																					p.F200fs													.	EXOC5-137	0			c.600delT						.						55.0	49.0	51.0					14																	57702498		1853	4086	5939	SO:0001589	frameshift_variant	10640	exon7			ACTGGTAAACTCC	U85946	CCDS45111.1	14q22.3	2013-01-22	2005-11-01	2005-11-01	ENSG00000070367	ENSG00000070367			10696	protein-coding gene	gene with protein product		604469	"""SEC10 (S. cerevisiae)-like 1"", ""SEC10-like 1 (S. cerevisiae)"""	SEC10L1		9119050	Standard	XM_005267272		Approved	SEC10, SEC10P	uc001xct.3	O00471	OTTHUMG00000171309	ENST00000413566.2:c.600delT	14.37:g.57702498delA	ENSP00000389934:p.Phe200fs	13	0		6	2	NM_006544	0	0	0	0	0	B2R6C5	Frame_Shift_Del	DEL	ENST00000413566.2	37	CCDS45111.1																																																																																			.		0.353	EXOC5-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412905.1	NM_006544	
MEP1B	4225	broad.mit.edu;bcgsc.ca	37	18	29787415	29787415	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr18:29787415delA	ENST00000269202.6	+	8	795	c.748delA	c.(748-750)aatfs	p.N250fs	MEP1B_ENST00000581447.1_Frame_Shift_Del_p.N250fs	NM_005925.2	NP_005916.2	Q16820	MEP1B_HUMAN	meprin A, beta	250	Metalloprotease.				digestion (GO:0007586)|inflammatory response (GO:0006954)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23						CCTAAAGTTGAATCAACTGTA	0.398																																					p.N250fs													.	MEP1B-92	0			c.748delA						.						43.0	40.0	41.0					18																	29787415		1906	4127	6033	SO:0001589	frameshift_variant	4225	exon8			AAGTTGAATCAAC	X81333	CCDS45846.1	18q12.2-q12.3	2003-12-17				ENSG00000141434	3.4.24.18		7020	protein-coding gene	gene with protein product		600389				7774936	Standard	NM_005925		Approved		uc002kxj.4	Q16820		ENST00000269202.6:c.748delA	18.37:g.29787415delA	ENSP00000269202:p.Asn250fs	41	0		24	8	NM_005925	0	0	0	0	0	B7ZM35|B9EGL6|Q670J1	Frame_Shift_Del	DEL	ENST00000269202.6	37	CCDS45846.1																																																																																			.		0.398	MEP1B-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447755.1	NM_005925	
GPR113	165082	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	26533773	26533773	+	Frame_Shift_Del	DEL	C	C	-			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr2:26533773delC	ENST00000311519.1	-	11	2822	c.2823delG	c.(2821-2823)gggfs	p.G941fs	GPR113_ENST00000541401.1_Frame_Shift_Del_p.G544fs|GPR113_ENST00000459892.1_5'UTR|GPR113_ENST00000333478.6_Frame_Shift_Del_p.G742fs|GPR113_ENST00000421160.2_Frame_Shift_Del_p.G872fs	NM_001145168.1	NP_001138640.1	Q8IZF5	GP113_HUMAN	G protein-coupled receptor 113	941					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(4)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	24	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTAGTACCAGCCCATTCACGC	0.597																																					p.G941fs		.											.	GPR113-94	0			c.2823delG						.						58.0	51.0	53.0					2																	26533773		2203	4300	6503	SO:0001589	frameshift_variant	165082	exon11			.	AB083619	CCDS33159.2, CCDS46238.1, CCDS46239.1	2p24.1	2014-08-08			ENSG00000173567	ENSG00000173567		"""-"", ""GPCR / Class B : Orphans"""	18989	protein-coding gene	gene with protein product						12435584	Standard	NM_153835		Approved	hGPCR37, PGR23	uc002rhe.4	Q8IZF5	OTTHUMG00000150225	ENST00000311519.1:c.2823delG	2.37:g.26533773delC	ENSP00000307831:p.Gly941fs	36	0		39	18	NM_001145168	0	0	0	0	0	B4DF15|E9PEV1|Q53TA5|Q6UXT7|Q6UXX3|Q86SL7|Q8IXD8|Q8TDT3	Frame_Shift_Del	DEL	ENST00000311519.1	37	CCDS46239.1																																																																																			.		0.597	GPR113-004	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000316892.1	NM_153835	
TMF1	7110	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	69096768	69096770	+	In_Frame_Del	DEL	GAA	GAA	-			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	GAA	GAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr3:69096768_69096770delGAA	ENST00000398559.2	-	2	1302_1304	c.1086_1088delTTC	c.(1084-1089)tcttca>tca	p.362_363SS>S	CTD-2013N24.2_ENST00000598783.1_RNA|CTD-2013N24.2_ENST00000595925.1_RNA|CTD-2013N24.2_ENST00000601735.1_RNA|TMF1_ENST00000543976.1_In_Frame_Del_p.362_363SS>S|CTD-2013N24.2_ENST00000596274.1_RNA|MIR3136_ENST00000583498.1_RNA|CTD-2013N24.2_ENST00000596523.1_RNA|CTD-2013N24.2_ENST00000597950.1_RNA|CTD-2013N24.2_ENST00000596732.1_RNA|CTD-2013N24.2_ENST00000482368.2_RNA			P82094	TMF1_HUMAN	TATA element modulatory factor 1	362					acrosome assembly (GO:0001675)|cellular response to organic cyclic compound (GO:0071407)|defense response to bacterium (GO:0042742)|Leydig cell differentiation (GO:0033327)|luteinizing hormone secretion (GO:0032275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of gene expression (GO:0010629)|positive regulation of cytokine production (GO:0001819)|positive regulation of testosterone secretion (GO:2000845)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of transcription, DNA-templated (GO:0006355)|sperm motility (GO:0030317)|spermatid nucleus differentiation (GO:0007289)|transcription from RNA polymerase II promoter (GO:0006366)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription cofactor activity (GO:0003712)			cervix(1)|kidney(1)|large_intestine(4)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;4.48e-05)|Epithelial(33;0.000274)|LUSC - Lung squamous cell carcinoma(21;0.0123)|KIRC - Kidney renal clear cell carcinoma(39;0.211)|Kidney(39;0.247)		CTTTGGAGTTGAAGAATTAACTA	0.355																																					p.362_363del		.											.	TMF1-90	0			c.1086_1088del						.																																			SO:0001651	inframe_deletion	7110	exon2			.		CCDS43105.1	3p21-p12	2009-02-11			ENSG00000144747	ENSG00000144747			11870	protein-coding gene	gene with protein product		601126				1409643	Standard	NM_007114		Approved	ARA160, TMF	uc003dnn.3	P82094	OTTHUMG00000158771	ENST00000398559.2:c.1086_1088delTTC	3.37:g.69096771_69096773delGAA	ENSP00000381567:p.Ser363del	88	0		98	27	NM_007114	0	0	0	0	0	B7ZLJ2|Q17R87|Q59GK0	In_Frame_Del	DEL	ENST00000398559.2	37	CCDS43105.1																																																																																			.		0.355	TMF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352106.1	NM_007114	
FAM160B2	64760	broad.mit.edu	37	8	21953846	21953847	+	Splice_Site	DEL	AG	AG	-			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	AG	AG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr8:21953846_21953847delAG	ENST00000289921.7	+	3	170		c.e3-1			NM_022749.5	NP_073586.5	Q86V87	F16B2_HUMAN	family with sequence similarity 160, member B2											endometrium(2)|kidney(1)|lung(2)|prostate(3)|urinary_tract(1)	9						AAACATCATTAGATGAAAGCAC	0.564																																					.													.	.	0			.						.																																			SO:0001630	splice_region_variant	64760	.			ATCATTAGATGAA	AK025454	CCDS6021.2	8p21.3	2012-11-30	2008-06-05	2008-06-05	ENSG00000158863	ENSG00000158863			16492	protein-coding gene	gene with protein product			"""retinoic acid induced 16"""	RAI16		22971576, 15626329	Standard	XR_247128		Approved	FLJ21801	uc011kyx.2	Q86V87	OTTHUMG00000097088	ENST00000289921.7:c.125-1AG>-	8.37:g.21953846_21953847delAG		8	0		7	5	.	0	0	0	0	0	B2RDQ5|B3KNX1|Q2M211|Q71JB5|Q7L3J6|Q969T0|Q9H6W4	Splice_Site	DEL	ENST00000289921.7	37	CCDS6021.2																																																																																			.		0.564	FAM160B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375334.2		Intron
CLIP1	6249	broad.mit.edu	37	12	122812693	122812694	+	Frame_Shift_Ins	INS	-	-	T	rs77289752	byFrequency	TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr12:122812693_122812694insT	ENST00000540338.1	-	16	3090_3091	c.3049_3050insA	c.(3049-3051)acafs	p.T1017fs	CLIP1_ENST00000537178.1_Frame_Shift_Ins_p.T971fs|CLIP1_ENST00000302528.7_Frame_Shift_Ins_p.T1006fs|CLIP1_ENST00000358808.2_Frame_Shift_Ins_p.T1006fs|CLIP1_ENST00000545889.1_Frame_Shift_Ins_p.T592fs|CLIP1_ENST00000361654.4_Frame_Shift_Ins_p.T895fs			P30622	CLIP1_HUMAN	CAP-GLY domain containing linker protein 1	1017					microtubule bundle formation (GO:0001578)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|positive regulation of microtubule polymerization (GO:0031116)|transport (GO:0006810)	cell projection (GO:0042995)|centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|intermediate filament (GO:0005882)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	metal ion binding (GO:0046872)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|nucleic acid binding (GO:0003676)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|endometrium(4)|kidney(5)|large_intestine(16)|liver(1)|lung(21)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.81e-05)|Epithelial(86;6.85e-05)|BRCA - Breast invasive adenocarcinoma(302;0.226)		GTTGTGGCTTGTTTCCATTTTC	0.505																																					p.T1017fs													.	CLIP1-155	0			c.3050_3051insA						.																																			SO:0001589	frameshift_variant	6249	exon17			TGGCTTGTTTCCA		CCDS9232.1, CCDS9233.1, CCDS58285.1	12q24.3	2013-01-17	2007-01-05	2007-01-05	ENSG00000130779	ENSG00000130779			10461	protein-coding gene	gene with protein product	"""restin"""	179838	"""restin (Reed-Steinberg cell-expressed intermediate filament-associated protein)"""	RSN		8222754	Standard	NM_001247997		Approved	CYLN1, CLIP170, CLIP, CLIP-170	uc001ucg.2	P30622	OTTHUMG00000168922	ENST00000540338.1:c.3050dupA	12.37:g.122812696_122812696dupT	ENSP00000439093:p.Thr1017fs	169	0		280	8	NM_001247997	0	0	0	0	0	A0AVD3|Q17RS4|Q29RG0	Frame_Shift_Ins	INS	ENST00000540338.1	37	CCDS58285.1																																																																																			.		0.505	CLIP1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000401625.1	NM_002956	
