#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PAFAH2	5051	hgsc.bcm.edu	37	1	26301009	26301009	+	Missense_Mutation	SNP	T	T	C			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr1:26301009T>C	ENST00000374282.3	-	9	1070	c.891A>G	c.(889-891)atA>atG	p.I297M	PAFAH2_ENST00000374284.1_Missense_Mutation_p.I297M	NM_000437.3	NP_000428.2	Q99487	PAFA2_HUMAN	platelet-activating factor acetylhydrolase 2, 40kDa	297					lipid catabolic process (GO:0016042)|lipid metabolic process (GO:0006629)|negative regulation of apoptotic process (GO:0043066)	cytoplasm (GO:0005737)	1-alkyl-2-acetylglycerophosphocholine esterase activity (GO:0003847)|phospholipid binding (GO:0005543)			NS(1)|kidney(2)|large_intestine(2)|lung(1)|ovary(2)|urinary_tract(1)	9		Colorectal(325;3.47e-05)|Lung NSC(340;6.23e-05)|all_lung(284;9.48e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;3.84e-25)|Colorectal(126;3.57e-08)|COAD - Colon adenocarcinoma(152;1.84e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|BRCA - Breast invasive adenocarcinoma(304;0.00105)|STAD - Stomach adenocarcinoma(196;0.00155)|GBM - Glioblastoma multiforme(114;0.00717)|READ - Rectum adenocarcinoma(331;0.0649)		GCTGGGCACATATCTTCTTCA	0.483																																					p.I297M		.											.	PAFAH2-70	0			c.A891G						.						122.0	111.0	115.0					1																	26301009		2203	4300	6503	SO:0001583	missense	5051	exon9			GGCACATATCTTC	D87845	CCDS270.1	1p34.3	2008-09-19	2002-08-29		ENSG00000158006	ENSG00000158006			8579	protein-coding gene	gene with protein product		602344	"""platelet-activating factor acetylhydrolase 2 (40kD)"""			8955149, 9494101	Standard	NM_000437		Approved	HSD-PLA2	uc001bld.4	Q99487	OTTHUMG00000007437	ENST00000374282.3:c.891A>G	1.37:g.26301009T>C	ENSP00000363400:p.Ile297Met	125	0		59	3	NM_000437	0	0	3	3	0	D3DPK1|O15458|Q5SY02	Missense_Mutation	SNP	ENST00000374282.3	37	CCDS270.1	.	.	.	.	.	.	.	.	.	.	T	13.90	2.376158	0.42105	.	.	ENSG00000158006	ENST00000374282;ENST00000374284	T;T	0.55930	0.49;0.49	5.62	-7.94	0.01152	.	0.773311	0.11575	N	0.550395	T	0.29749	0.0743	L	0.31926	0.97	0.25838	N	0.984087	B	0.20052	0.041	B	0.24974	0.057	T	0.18555	-1.0333	10	0.31617	T	0.26	-0.4947	2.9217	0.05771	0.1873:0.1843:0.4707:0.1577	.	297	Q99487	PAFA2_HUMAN	M	297	ENSP00000363400:I297M;ENSP00000363402:I297M	ENSP00000363400:I297M	I	-	3	3	PAFAH2	26173596	0.145000	0.22656	0.777000	0.31699	0.998000	0.95712	-0.613000	0.05610	-1.073000	0.03137	0.529000	0.55759	ATA	.		0.483	PAFAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019544.1	NM_000437	
UBXN11	91544	hgsc.bcm.edu	37	1	26608825	26608825	+	Missense_Mutation	SNP	T	T	C	rs66614970		TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr1:26608825T>C	ENST00000374222.1	-	16	1992	c.1528A>G	c.(1528-1530)Agt>Ggt	p.S510G	UBXN11_ENST00000374217.2_Missense_Mutation_p.S477G|UBXN11_ENST00000314675.7_Missense_Mutation_p.S390G|UBXN11_ENST00000357089.4_Missense_Mutation_p.S477G|UBXN11_ENST00000374221.3_Missense_Mutation_p.S510G|UBXN11_ENST00000374223.1_Missense_Mutation_p.S267G			Q5T124	UBX11_HUMAN	UBX domain protein 11	510	3 X 8 AA tandem repeats of P-G-P-G-P-G-P- S.|Pro-rich.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.G490_P515delGPGPSPGPGPGPSPGPGPGPSPCPGP(1)		endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(3)	23						ggacagggactggggccggga	0.716																																					p.S510G		.											.	UBXN11-91	1	Deletion - In frame(1)	ovary(1)	c.A1528G						.						15.0	18.0	17.0					1																	26608825		1744	3959	5703	SO:0001583	missense	91544	exon16			AGGGACTGGGGCC	AF521017	CCDS41286.1, CCDS41287.1, CCDS41288.1	1p36.11	2008-07-25	2008-07-25	2008-07-25	ENSG00000158062	ENSG00000158062		"""UBX domain containing"""	30600	protein-coding gene	gene with protein product	"""socius"""	609151	"""UBX domain containing 5"""	UBXD5		11940653	Standard	NM_183008		Approved	SOC, SOCI	uc001blw.3	Q5T124	OTTHUMG00000003382	ENST00000374222.1:c.1528A>G	1.37:g.26608825T>C	ENSP00000363339:p.Ser510Gly	63	2		61	4	NM_183008	0	0	0	0	0	D3DPK6|Q5T117|Q5T120|Q5T125|Q5T126|Q5T129|Q5T131|Q5T133|Q63HM6|Q71RB3|Q8IY27|Q8N1L6|Q8N9M4|Q8NA18|Q8NFE3|Q8NFE4|Q8NFE6	Missense_Mutation	SNP	ENST00000374222.1	37	CCDS41288.1	.	.	.	.	.	.	.	.	.	.	-	2.154	-0.393781	0.04899	.	.	ENSG00000158062	ENST00000314675;ENST00000374223;ENST00000357089;ENST00000374221;ENST00000374222;ENST00000374217	T;T;T;T;T;T	0.18502	2.21;2.22;2.49;2.48;2.48;2.49	.	.	.	.	435.379000	0.00994	U	0.003579	T	0.07007	0.0178	N	0.02539	-0.55	0.18873	N	0.999985	.	.	.	.	.	.	T	0.21690	-1.0238	6	0.42905	T	0.14	.	.	.	.	.	477;390;510	Q5T124-2;Q5T124-3;Q5T124	.;.;UBX11_HUMAN	G	390;267;477;510;510;477	ENSP00000324721:S390G;ENSP00000363340:S267G;ENSP00000349601:S477G;ENSP00000363338:S510G;ENSP00000363339:S510G;ENSP00000363334:S477G	ENSP00000324721:S390G	S	-	1	0	UBXN11	26481412	0.000000	0.05858	0.130000	0.21974	0.142000	0.21351	-0.966000	0.03825	0.056000	0.16144	0.055000	0.15244	AGT	.		0.716	UBXN11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000009500.1	NM_145345	
BAI2	576	hgsc.bcm.edu	37	1	32210251	32210251	+	Missense_Mutation	SNP	G	G	C			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr1:32210251G>C	ENST00000373658.3	-	5	1261	c.920C>G	c.(919-921)aCa>aGa	p.T307R	BAI2_ENST00000373655.2_Missense_Mutation_p.T307R|BAI2_ENST00000440175.2_Missense_Mutation_p.T4R|BAI2_ENST00000398556.3_Missense_Mutation_p.T310R|BAI2_ENST00000257070.4_Missense_Mutation_p.T307R|BAI2_ENST00000398538.1_Missense_Mutation_p.T295R|BAI2_ENST00000398542.1_Missense_Mutation_p.T295R|BAI2_ENST00000527361.1_Missense_Mutation_p.T307R|BAI2_ENST00000398547.1_Missense_Mutation_p.T295R	NM_001703.2	NP_001694.2	O60241	BAI2_HUMAN	brain-specific angiogenesis inhibitor 2	307					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(2)|endometrium(1)|large_intestine(7)|liver(2)|lung(24)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	55		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)		STAD - Stomach adenocarcinoma(196;0.0557)		CGAGTTACCTGTCTGCGCCAT	0.627																																					p.T307R		.											.	BAI2-526	0			c.C920G						.						86.0	73.0	77.0					1																	32210251		2203	4300	6503	SO:0001583	missense	576	exon5			TTACCTGTCTGCG	AB005298	CCDS72746.1, CCDS72747.1	1p35	2014-08-08			ENSG00000121753	ENSG00000121753		"""-"", ""GPCR / Class B : Orphans"""	944	protein-coding gene	gene with protein product		602683				9533023	Standard	XM_006710783		Approved		uc001btn.3	O60241	OTTHUMG00000003885	ENST00000373658.3:c.920C>G	1.37:g.32210251G>C	ENSP00000362762:p.Thr307Arg	53	0		40	3	NM_001703	0	0	0	0	0	B9EGK9|Q5T6K0|Q8NGW8|Q96GZ9	Missense_Mutation	SNP	ENST00000373658.3	37	CCDS346.2	.	.	.	.	.	.	.	.	.	.	G	15.01	2.705214	0.48412	.	.	ENSG00000121753	ENST00000398556;ENST00000398547;ENST00000373658;ENST00000373655;ENST00000398542;ENST00000257070;ENST00000527361;ENST00000440175;ENST00000398538;ENST00000420125;ENST00000533175	T;T;T;T;T;T;T;T;T;T;T	0.47177	1.48;1.68;0.89;0.88;1.86;0.85;0.85;1.6;0.92;1.46;1.34	4.4	4.4	0.53042	.	0.000000	0.35067	N	0.003474	T	0.56262	0.1973	L	0.29908	0.895	0.24426	N	0.994593	D;D;D;D;D;D;D	0.89917	1.0;0.999;0.995;0.985;0.999;0.999;0.996	D;D;D;P;D;D;D	0.85130	0.997;0.986;0.974;0.72;0.979;0.991;0.943	T	0.51164	-0.8740	10	0.59425	D	0.04	.	14.2951	0.66308	0.0:0.0:1.0:0.0	.	295;307;295;4;295;307;307	A2A3C3;O60241-4;O60241-3;B4DKC3;A2A3C1;O60241-2;O60241	.;.;.;.;.;.;BAI2_HUMAN	R	310;295;307;307;295;307;307;4;295;300;341	ENSP00000381564:T310R;ENSP00000381555:T295R;ENSP00000362762:T307R;ENSP00000362759:T307R;ENSP00000381550:T295R;ENSP00000257070:T307R;ENSP00000435397:T307R;ENSP00000391071:T4R;ENSP00000381548:T295R;ENSP00000410921:T300R;ENSP00000437219:T341R	ENSP00000257070:T307R	T	-	2	0	BAI2	31982838	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	3.540000	0.53611	2.172000	0.68678	0.313000	0.20887	ACA	.		0.627	BAI2-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000381838.1	NM_001703	
KIAA0754	643314	hgsc.bcm.edu	37	1	39879289	39879289	+	Missense_Mutation	SNP	G	G	A			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr1:39879289G>A	ENST00000530275.1	+	1	3139	c.2944G>A	c.(2944-2946)Gcc>Acc	p.A982T	MACF1_ENST00000567887.1_Intron|MACF1_ENST00000372915.3_Intron|MACF1_ENST00000361689.2_Intron|MACF1_ENST00000564288.1_Intron|MACF1_ENST00000289893.4_Intron|MACF1_ENST00000539005.1_Intron|MACF1_ENST00000317713.7_Intron|MACF1_ENST00000545844.1_Intron	NM_015038.1	NP_055853.1	O94854	K0754_HUMAN	KIAA0754	982	Ala-rich.									central_nervous_system(1)|large_intestine(6)|skin(1)	8	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			AGAGGAGCCCGCCTCCCCAGC	0.721																																					p.A1118T		.											.	.	0			c.G3352A						.						5.0	7.0	6.0					1																	39879289		1733	3912	5645	SO:0001583	missense	643314	exon1			GAGCCCGCCTCCC			1p34.2	2009-07-09				ENSG00000255103			29111	protein-coding gene	gene with protein product						9872452	Standard	NM_015038		Approved		uc009vvt.1	O94854		ENST00000530275.1:c.2944G>A	1.37:g.39879289G>A	ENSP00000431179:p.Ala982Thr	19	2		59	11	NM_015038	0	0	0	0	0	E9PMC2|Q6ZSB2	Missense_Mutation	SNP	ENST00000530275.1	37		.	.	.	.	.	.	.	.	.	.	G	11.36	1.616131	0.28801	.	.	ENSG00000255103	ENST00000530275	T	0.24350	1.86	5.38	1.21	0.21127	.	.	.	.	.	T	0.12008	0.0292	N	0.14661	0.345	0.09310	N	1	B	0.23490	0.086	B	0.15052	0.012	T	0.37056	-0.9722	9	0.11182	T	0.66	.	7.8976	0.29715	0.4558:0.0:0.5442:0.0	.	982	O94854	K0754_HUMAN	T	982	ENSP00000431179:A982T	ENSP00000431179:A982T	A	+	1	0	RP4-562N20.1	39651876	0.000000	0.05858	0.001000	0.08648	0.145000	0.21501	-1.540000	0.02200	-0.011000	0.14247	0.491000	0.48974	GCC	.		0.721	KIAA0754-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000392100.1	NM_015038	
ZMPSTE24	10269	broad.mit.edu	37	1	40733505	40733505	+	Silent	SNP	A	A	G			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr1:40733505A>G	ENST00000372759.3	+	3	483	c.318A>G	c.(316-318)ggA>ggG	p.G106G		NM_005857.4	NP_005848.2	O75844	FACE1_HUMAN	zinc metallopeptidase STE24	106					CAAX-box protein processing (GO:0071586)|nuclear envelope organization (GO:0006998)|prenylated protein catabolic process (GO:0030327)|proteolysis (GO:0006508)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|metalloexopeptidase activity (GO:0008235)			endometrium(3)|kidney(3)|large_intestine(4)|lung(4)|prostate(1)|skin(1)	16	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;6.3e-18)			GACTTTCTGGACGGTTCTGTG	0.383																																					p.G106G													.	ZMPSTE24-226	0			c.A318G						.						263.0	249.0	254.0					1																	40733505		2203	4300	6503	SO:0001819	synonymous_variant	10269	exon3			TTCTGGACGGTTC	Y13834	CCDS449.1	1p34	2014-09-17	2012-12-10		ENSG00000084073	ENSG00000084073	3.4.24.84		12877	protein-coding gene	gene with protein product	"""Hutchinson-Gilford progeria syndrome"", ""CAAX prenyl protease 1 homolog"""	606480	"""zinc metalloproteinase (STE24 homolog, yeast)"", ""zinc metallopeptidase (STE24 homolog, yeast)"", ""zinc metallopeptidase STE24 homolog (S. cerevisiae)"""			10373325, 9700155, 16671095	Standard	NM_005857		Approved	FACE-1, Ste24p, STE24, HGPS, PRO1	uc001cfg.4	O75844	OTTHUMG00000005762	ENST00000372759.3:c.318A>G	1.37:g.40733505A>G		419	0		569	5	NM_005857	0	0	2	2	0	B3KQI7|D3DPU7|Q8NDZ8|Q9UBQ2	Silent	SNP	ENST00000372759.3	37	CCDS449.1																																																																																			.		0.383	ZMPSTE24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015766.1		
LRP8	7804	ucsc.edu	37	1	53723084	53723084	+	Silent	SNP	T	T	G			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr1:53723084T>G	ENST00000306052.6	-	15	2363	c.2262A>C	c.(2260-2262)gtA>gtC	p.V754V	LRP8_ENST00000460214.1_5'UTR|LRP8_ENST00000465675.1_Silent_p.V307V|LRP8_ENST00000347547.2_Silent_p.V584V|LRP8_ENST00000371454.2_Silent_p.V754V|LRP8_ENST00000354412.3_Intron	NM_004631.4	NP_004622.2	Q14114	LRP8_HUMAN	low density lipoprotein receptor-related protein 8, apolipoprotein e receptor	754	Clustered O-linked oligosaccharides.				ammon gyrus development (GO:0021541)|blood coagulation (GO:0007596)|cellular response to cholesterol (GO:0071397)|cellular response to growth factor stimulus (GO:0071363)|cytokine-mediated signaling pathway (GO:0019221)|endocytosis (GO:0006897)|layer formation in cerebral cortex (GO:0021819)|lipid metabolic process (GO:0006629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phototransduction, visible light (GO:0007603)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendrite development (GO:1900006)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein tyrosine kinase activity (GO:0061098)|proteolysis (GO:0006508)|receptor-mediated endocytosis (GO:0006898)|reelin-mediated signaling pathway (GO:0038026)|regulation of synaptic transmission (GO:0050804)|response to drug (GO:0042493)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)	caveola (GO:0005901)|dendrite (GO:0030425)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|high-density lipoprotein particle binding (GO:0008035)|reelin receptor activity (GO:0038025)|transmembrane signaling receptor activity (GO:0004888)|very-low-density lipoprotein particle receptor activity (GO:0030229)			endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(2)|skin(1)	21						TGGTGGCAGGTACTGTCCTCG	0.542																																					p.V754V													.	LRP8-90	0			c.A2262C						.						275.0	223.0	240.0					1																	53723084		2203	4300	6503	SO:0001819	synonymous_variant	7804	exon15			GGCAGGTACTGTC	D50678	CCDS578.1, CCDS579.1, CCDS580.1, CCDS30720.1	1p32.3	2013-05-29			ENSG00000157193	ENSG00000157193		"""Low density lipoprotein receptors"""	6700	protein-coding gene	gene with protein product		602600				8626535, 9079678	Standard	NM_004631		Approved	APOER2, MCI1, LRP-8, HSZ75190	uc001cvi.2	Q14114	OTTHUMG00000008924	ENST00000306052.6:c.2262A>C	1.37:g.53723084T>G		109	12		188	32	NM_004631	0	0	19	26	7	B1AMT6|B1AMT7|B1AMT8|O14968|Q86V27|Q99876|Q9BR78	Silent	SNP	ENST00000306052.6	37	CCDS578.1																																																																																			.		0.542	LRP8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000024699.1	NM_004631	
SASS6	163786	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	100572938	100572938	+	Missense_Mutation	SNP	C	C	G			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr1:100572938C>G	ENST00000287482.5	-	11	1458	c.1318G>C	c.(1318-1320)Gag>Cag	p.E440Q	SASS6_ENST00000462159.1_5'UTR|SASS6_ENST00000535161.1_Missense_Mutation_p.E273Q	NM_194292.1	NP_919268.1	Q6UVJ0	SAS6_HUMAN	spindle assembly 6 homolog (C. elegans)	440					centriole replication (GO:0007099)|centrosome duplication (GO:0051298)	centriole (GO:0005814)|centrosome (GO:0005813)|deuterosome (GO:0098536)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	19		all_epithelial(167;4.58e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)		Epithelial(280;0.085)|all cancers(265;0.139)|COAD - Colon adenocarcinoma(174;0.15)|Lung(183;0.197)		ACCTCTTGCTCTTTAATTCGA	0.294																																					p.E440Q		.											.	SASS6-70	0			c.G1318C						.						57.0	53.0	54.0					1																	100572938		2201	4289	6490	SO:0001583	missense	163786	exon11			CTTGCTCTTTAAT	AL834265	CCDS764.1	1p21.3	2008-02-05			ENSG00000156876	ENSG00000156876			25403	protein-coding gene	gene with protein product		609321				15665853, 14654843	Standard	NM_194292		Approved	DKFZp761A078, SAS-6, FLJ22097, SAS6	uc001dsu.3	Q6UVJ0	OTTHUMG00000010754	ENST00000287482.5:c.1318G>C	1.37:g.100572938C>G	ENSP00000287482:p.Glu440Gln	143	0		88	13	NM_194292	0	0	0	0	0	D3DT55|Q8N3K0	Missense_Mutation	SNP	ENST00000287482.5	37	CCDS764.1	.	.	.	.	.	.	.	.	.	.	C	12.02	1.812823	0.32053	.	.	ENSG00000156876	ENST00000287482;ENST00000539329;ENST00000535161	T;T	0.29397	1.57;1.57	5.38	5.38	0.77491	.	0.047861	0.85682	D	0.000000	T	0.23451	0.0567	L	0.60455	1.87	0.58432	D	0.999999	P	0.41546	0.754	B	0.39339	0.297	T	0.02743	-1.1116	10	0.35671	T	0.21	-9.3422	19.1244	0.93376	0.0:1.0:0.0:0.0	.	440	Q6UVJ0	SAS6_HUMAN	Q	440;413;273	ENSP00000287482:E440Q;ENSP00000440169:E273Q	ENSP00000287482:E440Q	E	-	1	0	SASS6	100345526	1.000000	0.71417	1.000000	0.80357	0.064000	0.16182	5.050000	0.64251	2.515000	0.84797	0.585000	0.79938	GAG	.		0.294	SASS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029656.2	NM_194292	
TARS2	80222	broad.mit.edu	37	1	150471422	150471422	+	Missense_Mutation	SNP	C	C	T			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr1:150471422C>T	ENST00000369064.3	+	12	1485	c.1451C>T	c.(1450-1452)gCc>gTc	p.A484V	TARS2_ENST00000463555.1_3'UTR|TARS2_ENST00000438568.2_3'UTR|TARS2_ENST00000606933.1_Missense_Mutation_p.A402V|TARS2_ENST00000369054.2_Missense_Mutation_p.A354V	NM_025150.3	NP_079426.2	Q9BW92	SYTM_HUMAN	threonyl-tRNA synthetase 2, mitochondrial (putative)	484					gene expression (GO:0010467)|mitochondrial threonyl-tRNA aminoacylation (GO:0070159)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|threonine-tRNA ligase activity (GO:0004829)			cervix(1)|endometrium(4)|large_intestine(7)|lung(19)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	35	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0757)|all cancers(9;1.51e-21)|BRCA - Breast invasive adenocarcinoma(12;0.000734)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)		L-Threonine(DB00156)	TCCGTCTATGCCGTTCTTGGC	0.587																																					p.A484V													.	TARS2-91	0			c.C1451T						.						163.0	136.0	145.0					1																	150471422		2203	4300	6503	SO:0001583	missense	80222	exon12			TCTATGCCGTTCT	BC007824	CCDS952.1, CCDS60251.1, CCDS60252.1	1q21.2	2012-10-26	2007-02-23	2007-02-23	ENSG00000143374	ENSG00000143374	6.1.1.3	"""Aminoacyl tRNA synthetases / Class II"""	30740	protein-coding gene	gene with protein product	"""threonine tRNA ligase 2, mitochondrial"""	612805	"""threonyl-tRNA synthetase-like 1"""	TARSL1			Standard	NM_001271895		Approved	FLJ12528	uc001euq.4	Q9BW92	OTTHUMG00000012809	ENST00000369064.3:c.1451C>T	1.37:g.150471422C>T	ENSP00000358060:p.Ala484Val	348	1		699	7	NM_025150	0	0	31	31	0	Q53GW7|Q96I50|Q9H9V2	Missense_Mutation	SNP	ENST00000369064.3	37	CCDS952.1	.	.	.	.	.	.	.	.	.	.	C	13.05	2.119981	0.37436	.	.	ENSG00000143374	ENST00000369054;ENST00000369064;ENST00000369051;ENST00000369052	T;T;T	0.68331	-0.32;-0.32;-0.32	4.81	2.86	0.33363	Aminoacyl-tRNA synthetase, class II (1);Aminoacyl-tRNA synthetase, class II (G/ H/ P/ S), conserved domain (1);	0.674200	0.15210	N	0.274517	T	0.49932	0.1586	M	0.63208	1.945	0.09310	N	0.999997	P;P;P	0.45634	0.863;0.849;0.629	B;B;B	0.43990	0.438;0.438;0.243	T	0.39272	-0.9622	10	0.56958	D	0.05	1.1321	10.2069	0.43118	0.154:0.6977:0.1484:0.0	.	354;209;484	Q9H9V2;E7EVR9;Q9BW92	.;.;SYTM_HUMAN	V	354;484;209;209	ENSP00000358050:A354V;ENSP00000358060:A484V;ENSP00000358047:A209V	ENSP00000358047:A209V	A	+	2	0	TARS2	148738046	0.042000	0.20092	0.001000	0.08648	0.220000	0.24768	2.457000	0.45005	0.583000	0.29574	0.655000	0.94253	GCC	.		0.587	TARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000035847.1	NM_025150	
RPTN	126638	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	152127802	152127802	+	Missense_Mutation	SNP	T	T	C			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr1:152127802T>C	ENST00000316073.3	-	3	1837	c.1773A>G	c.(1771-1773)atA>atG	p.I591M		NM_001122965.1	NP_001116437.1	Q6XPR3	RPTN_HUMAN	repetin	591	Gln-rich.					cornified envelope (GO:0001533)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|endometrium(14)|kidney(2)|large_intestine(1)|lung(32)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	59						TTTGCCCTTGTATTTCCCCAG	0.453																																					p.I591M		.											.	RPTN-68	0			c.A1773G						.						371.0	334.0	345.0					1																	152127802		1568	3582	5150	SO:0001583	missense	126638	exon3			CCCTTGTATTTCC	AK096436	CCDS41397.1	1q21.3	2013-01-10			ENSG00000215853	ENSG00000215853		"""EF-hand domain containing"""	26809	protein-coding gene	gene with protein product		613259				15854042	Standard	NM_001122965		Approved	FLJ39117	uc001ezs.1	Q6XPR3	OTTHUMG00000154095	ENST00000316073.3:c.1773A>G	1.37:g.152127802T>C	ENSP00000317895:p.Ile591Met	594	0		769	224	NM_001122965	0	0	0	0	0	B7ZBZ3	Missense_Mutation	SNP	ENST00000316073.3	37	CCDS41397.1	.	.	.	.	.	.	.	.	.	.	T	2.328	-0.353972	0.05173	.	.	ENSG00000215853	ENST00000316073;ENST00000541545	T	0.13307	2.6	3.14	1.75	0.24633	.	.	.	.	.	T	0.01765	0.0056	N	0.08118	0	0.09310	N	1	P	0.41265	0.744	B	0.36608	0.229	T	0.42413	-0.9453	9	0.32370	T	0.25	0.0237	6.2084	0.20615	0.3116:0.0:0.0:0.6884	.	591	Q6XPR3	RPTN_HUMAN	M	591;246	ENSP00000317895:I591M	ENSP00000317895:I591M	I	-	3	3	RPTN	150394426	0.005000	0.15991	0.015000	0.15790	0.332000	0.28634	-0.725000	0.04942	0.119000	0.18210	0.450000	0.29827	ATA	.		0.453	RPTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333867.1	XM_371312	
NUP210L	91181	broad.mit.edu	37	1	153991451	153991451	+	Missense_Mutation	SNP	C	C	A			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr1:153991451C>A	ENST00000368559.3	-	33	4682	c.4611G>T	c.(4609-4611)atG>atT	p.M1537I	NUP210L_ENST00000271854.3_Missense_Mutation_p.M1537I|NUP210L_ENST00000368553.1_Missense_Mutation_p.M470I	NM_207308.2	NP_997191.2	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like	1537					Sertoli cell development (GO:0060009)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|lung(34)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|urinary_tract(2)	80	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			CATGAAAAATCATTGCAGTCC	0.438																																					p.M1537I													.	NUP210L-77	0			c.G4611T						.						101.0	99.0	99.0					1																	153991451		1887	4112	5999	SO:0001583	missense	91181	exon33			AAAAATCATTGCA	AK125924	CCDS41399.1, CCDS53370.1	1q21.3	2008-02-05			ENSG00000143552	ENSG00000143552			29915	protein-coding gene	gene with protein product							Standard	NM_207308		Approved		uc001fdw.3	Q5VU65	OTTHUMG00000035852	ENST00000368559.3:c.4611G>T	1.37:g.153991451C>A	ENSP00000357547:p.Met1537Ile	136	0		183	6	NM_001159484	0	0	0	0	0	E7EP56|Q5T4L7|Q6ZRN1|Q6ZRT4|Q6ZU81|Q8NDI6|Q9UF31	Missense_Mutation	SNP	ENST00000368559.3	37	CCDS41399.1	.	.	.	.	.	.	.	.	.	.	C	13.47	2.247010	0.39697	.	.	ENSG00000143552	ENST00000368559;ENST00000368553;ENST00000271854	T;T;T	0.20738	3.66;2.05;3.37	5.61	-5.16	0.02857	.	0.431478	0.22335	N	0.061414	T	0.01523	0.0049	N	0.02539	-0.55	0.20196	N	0.99993	B;B	0.09022	0.002;0.002	B;B	0.06405	0.002;0.002	T	0.37009	-0.9724	10	0.49607	T	0.09	-32.0755	1.7189	0.02908	0.2068:0.3642:0.1855:0.2434	.	1537;1537	E7EP56;Q5VU65	.;P210L_HUMAN	I	1537;470;1537	ENSP00000357547:M1537I;ENSP00000357541:M470I;ENSP00000271854:M1537I	ENSP00000271854:M1537I	M	-	3	0	NUP210L	152258075	0.007000	0.16637	0.901000	0.35422	0.964000	0.63967	-0.837000	0.04377	-0.411000	0.07530	-0.302000	0.09304	ATG	.		0.438	NUP210L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087270.3	NM_207308	
GBA	2629	ucsc.edu	37	1	155206133	155206133	+	Missense_Mutation	SNP	A	A	C			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr1:155206133A>C	ENST00000327247.5	-	9	1359	c.1127T>G	c.(1126-1128)tTt>tGt	p.F376C	GBA_ENST00000536770.1_Missense_Mutation_p.F263C|GBA_ENST00000493842.1_5'Flank|GBA_ENST00000368373.3_Missense_Mutation_p.F376C|GBA_ENST00000427500.3_Missense_Mutation_p.F327C|AL713999.1_ENST00000401290.1_RNA|GBA_ENST00000428024.3_Missense_Mutation_p.F289C	NM_001005741.2|NM_001005742.2	NP_001005741.1|NP_001005742.1	P04062	GLCM_HUMAN	glucosidase, beta, acid	376					carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|cellular response to tumor necrosis factor (GO:0071356)|ceramide biosynthetic process (GO:0046513)|glucosylceramide catabolic process (GO:0006680)|glycosphingolipid metabolic process (GO:0006687)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of MAP kinase activity (GO:0043407)|positive regulation of protein dephosphorylation (GO:0035307)|regulation of water loss via skin (GO:0033561)|response to estrogen (GO:0043627)|response to glucocorticoid (GO:0051384)|response to pH (GO:0009268)|response to testosterone (GO:0033574)|response to thyroid hormone (GO:0097066)|skin morphogenesis (GO:0043589)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingosine biosynthetic process (GO:0046512)|termination of signal transduction (GO:0023021)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosomal membrane (GO:0005765)	glucosylceramidase activity (GO:0004348)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(9)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	26	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)		Velaglucerase alfa(DB06720)	CTCTGAGGCAAAGAGCATGGT	0.567									Gaucher disease type I																												p.F376C													.	GBA-92	0			c.T1127G						.						78.0	69.0	72.0					1																	155206133		2203	4300	6503	SO:0001583	missense	2629	exon9	Familial Cancer Database	glucocerebrosidase insufficiency	GAGGCAAAGAGCA	M19285	CCDS1102.1, CCDS53373.1, CCDS53374.1	1q22	2010-01-19	2010-01-19		ENSG00000177628	ENSG00000177628	3.2.1.21		4177	protein-coding gene	gene with protein product		606463	"""glucosylceramidase"", ""glucosidase, beta; acid (includes glucosylceramidase)"""	GLUC		3359914	Standard	NM_001005742		Approved	GBA1	uc001fjl.3	P04062	OTTHUMG00000035841	ENST00000327247.5:c.1127T>G	1.37:g.155206133A>C	ENSP00000314508:p.Phe376Cys	101	0		203	1	NM_001005742	0	0	29	37	8	A8K796|B7Z5G2|B7Z6S1|J3KQG4|J3KQK9|Q16545|Q4VX22|Q6I9R6|Q9UMJ8	Missense_Mutation	SNP	ENST00000327247.5	37	CCDS1102.1	.	.	.	.	.	.	.	.	.	.	.	19.68	3.873368	0.72180	.	.	ENSG00000177628	ENST00000427500;ENST00000428024;ENST00000368373;ENST00000327247;ENST00000536770;ENST00000536555;ENST00000402928	D;D;D;D;D	0.99220	-5.58;-5.58;-5.58;-5.58;-5.58	3.67	3.67	0.42095	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.000000	0.64402	D	0.000001	D	0.99108	0.9693	M	0.79926	2.475	0.50467	D	0.999875	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.79784	0.984;0.988;0.993	D	0.99780	1.1027	10	0.87932	D	0	.	8.823	0.35039	1.0:0.0:0.0:0.0	.	327;263;376	B7Z5G2;F5H241;P04062	.;.;GLCM_HUMAN	C	327;289;376;376;263;333;361	ENSP00000402577:F327C;ENSP00000397986:F289C;ENSP00000357357:F376C;ENSP00000314508:F376C;ENSP00000445560:F263C	ENSP00000314508:F376C	F	-	2	0	GBA	153472757	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.259000	0.89855	1.650000	0.50662	0.397000	0.26171	TTT	.		0.567	GBA-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087204.1	NM_000157	
FAM129A	116496	hgsc.bcm.edu;broad.mit.edu	37	1	184767228	184767228	+	Missense_Mutation	SNP	C	C	A			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr1:184767228C>A	ENST00000367511.3	-	13	1844	c.1651G>T	c.(1651-1653)Gat>Tat	p.D551Y	FAM129A_ENST00000487074.1_5'UTR	NM_052966.2	NP_443198.1	Q9BZQ8	NIBAN_HUMAN	family with sequence similarity 129, member A	551					negative regulation of protein phosphorylation (GO:0001933)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of translation (GO:0045727)|response to endoplasmic reticulum stress (GO:0034976)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(1)|cervix(2)|endometrium(4)|large_intestine(6)|liver(1)|lung(22)|ovary(3)|skin(3)|upper_aerodigestive_tract(2)	45						AGAGTTTCATCAAGCAGGATC	0.453																																					p.D551Y		.											.	FAM129A-94	0			c.G1651T						.						87.0	78.0	81.0					1																	184767228		2203	4300	6503	SO:0001583	missense	116496	exon13			TTTCATCAAGCAG	AF288391	CCDS1364.1	1q25	2008-10-08	2006-11-23	2006-11-23	ENSG00000135842	ENSG00000135842			16784	protein-coding gene	gene with protein product	"""cell growth inhibiting protein 39"""		"""chromosome 1 open reading frame 24"""	C1orf24		15085203, 16444351	Standard	NM_052966		Approved	NIBAN, GIG39	uc001gra.4	Q9BZQ8	OTTHUMG00000035388	ENST00000367511.3:c.1651G>T	1.37:g.184767228C>A	ENSP00000356481:p.Asp551Tyr	69	0		87	8	NM_052966	0	0	0	0	0	Q2TTR2|Q5TEM8|Q8TEI5|Q9H593|Q9H9Y8|Q9HCB9	Missense_Mutation	SNP	ENST00000367511.3	37	CCDS1364.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.62|16.62	3.173955|3.173955	0.57692|0.57692	.|.	.|.	ENSG00000135842|ENSG00000135842	ENST00000367511|ENST00000417056	T|.	0.13307|.	2.6|.	5.37|5.37	4.44|4.44	0.53790|0.53790	.|.	0.408987|.	0.29225|.	N|.	0.012780|.	T|.	0.63189|.	0.2490|.	L|L	0.54323|0.54323	1.7|1.7	0.34170|0.34170	D|D	0.669652|0.669652	D;D|.	0.89917|.	0.986;1.0|.	P;D|.	0.73380|.	0.742;0.98|.	T|.	0.71794|.	-0.4485|.	10|.	0.72032|.	D|.	0.01|.	-7.0804|-7.0804	14.591|14.591	0.68365|0.68365	0.0:0.8548:0.1452:0.0|0.0:0.8548:0.1452:0.0	.|.	82;551|.	Q5TEY9;Q9BZQ8|.	.;NIBAN_HUMAN|.	Y|L	551|82	ENSP00000356481:D551Y|.	ENSP00000356481:D551Y|.	D|X	-|-	1|2	0|2	FAM129A|FAM129A	183033851|183033851	0.876000|0.876000	0.30132|0.30132	0.985000|0.985000	0.45067|0.45067	0.994000|0.994000	0.84299|0.84299	2.463000|2.463000	0.45058|0.45058	1.233000|1.233000	0.43693|0.43693	0.655000|0.655000	0.94253|0.94253	GAT|TGA	.		0.453	FAM129A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085786.1		
PTPN14	5784	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	214557259	214557259	+	Missense_Mutation	SNP	T	T	C			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr1:214557259T>C	ENST00000366956.5	-	13	2133	c.1939A>G	c.(1939-1941)Aac>Gac	p.N647D	PTPN14_ENST00000543945.1_3'UTR	NM_005401.4	NP_005392.2	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type 14	647					lymphangiogenesis (GO:0001946)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of protein export from nucleus (GO:0046825)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)			NS(2)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(9)|liver(3)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	58				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		ACCATGCTGTTCATCACCTCC	0.662																																					p.N647D	Colon(92;557 1424 24372 34121 40073)	.											.	PTPN14-290	0			c.A1939G						.						50.0	42.0	45.0					1																	214557259		2203	4300	6503	SO:0001583	missense	5784	exon13			TGCTGTTCATCAC	X82676	CCDS1514.1	1q32.2	2011-06-09			ENSG00000152104	ENSG00000152104		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9647	protein-coding gene	gene with protein product		603155				7733990	Standard	NM_005401		Approved	PEZ	uc001hkk.2	Q15678	OTTHUMG00000037039	ENST00000366956.5:c.1939A>G	1.37:g.214557259T>C	ENSP00000355923:p.Asn647Asp	71	0		169	55	NM_005401	0	0	0	0	0	Q5VSI0	Missense_Mutation	SNP	ENST00000366956.5	37	CCDS1514.1	.	.	.	.	.	.	.	.	.	.	T	14.65	2.600155	0.46423	.	.	ENSG00000152104	ENST00000366956	T	0.66815	-0.23	5.66	4.43	0.53597	.	0.373344	0.33217	N	0.005146	T	0.45458	0.1343	N	0.08118	0	0.80722	D	1	B	0.12630	0.006	B	0.10450	0.005	T	0.35525	-0.9785	10	0.62326	D	0.03	.	9.7306	0.40359	0.0:0.1:0.0:0.9	.	647	Q15678	PTN14_HUMAN	D	647	ENSP00000355923:N647D	ENSP00000355923:N647D	N	-	1	0	PTPN14	212623882	1.000000	0.71417	0.970000	0.41538	0.991000	0.79684	3.785000	0.55424	0.847000	0.35167	0.455000	0.32223	AAC	.		0.662	PTPN14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089918.2	NM_005401	
MARC1	64757	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	220971317	220971317	+	Silent	SNP	G	G	A			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr1:220971317G>A	ENST00000366910.5	+	4	900	c.714G>A	c.(712-714)agG>agA	p.R238R	MARC1_ENST00000496110.1_3'UTR	NM_022746.3	NP_073583.3	Q5VT66	MARC1_HUMAN	mitochondrial amidoxime reducing component 1	238	MOSC. {ECO:0000255|PROSITE- ProRule:PRU00670}.				detoxification of nitrogen compound (GO:0051410)|nitrate metabolic process (GO:0042126)|oxidation-reduction process (GO:0055114)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	molybdenum ion binding (GO:0030151)|molybdopterin cofactor binding (GO:0043546)|nitrate reductase activity (GO:0008940)|pyridoxal phosphate binding (GO:0030170)										CCAACTTCAGGCCCAATATTG	0.443																																					p.R238R		.											.	.	0			c.G714A						.						168.0	167.0	167.0					1																	220971317		2203	4300	6503	SO:0001819	synonymous_variant	64757	exon4			CTTCAGGCCCAAT	AK026043	CCDS1526.1	1q41	2011-11-02	2011-11-02	2011-11-02	ENSG00000186205	ENSG00000186205			26189	protein-coding gene	gene with protein product		614126	"""MOCO sulphurase C-terminal domain containing 1"""	MOSC1		11886751	Standard	NM_022746		Approved	FLJ22390	uc001hms.3	Q5VT66	OTTHUMG00000037353	ENST00000366910.5:c.714G>A	1.37:g.220971317G>A		376	0		498	119	NM_022746	0	0	9	17	8	A8K447|B2D078|Q5VVS9|Q5VVT0|Q5VVT1|Q8N9P5|Q96FN8|Q9H6C7	Silent	SNP	ENST00000366910.5	37	CCDS1526.1	.	.	.	.	.	.	.	.	.	.	G	2.055	-0.416878	0.04766	.	.	ENSG00000186205	ENST00000407981	.	.	.	4.95	3.04	0.35103	.	.	.	.	.	T	0.47875	0.1469	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.39057	-0.9632	4	.	.	.	-19.1717	4.6342	0.12516	0.2726:0.1776:0.5497:0.0	.	.	.	.	T	147	.	.	A	+	1	0	MOSC1	219037940	0.990000	0.36364	0.996000	0.52242	0.079000	0.17450	0.098000	0.15189	1.211000	0.43351	0.655000	0.94253	GCC	.		0.443	MARC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090904.1	NM_022746	
SLC35F3	148641	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	234458910	234458910	+	Missense_Mutation	SNP	A	A	T			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr1:234458910A>T	ENST00000366617.3	+	7	1415	c.1187A>T	c.(1186-1188)gAg>gTg	p.E396V	SLC35F3_ENST00000366618.3_Missense_Mutation_p.E465V			Q8IY50	S35F3_HUMAN	solute carrier family 35, member F3	396					thiamine transport (GO:0015888)	integral component of membrane (GO:0016021)				breast(2)|endometrium(3)|kidney(2)|large_intestine(7)|lung(13)|ovary(2)|skin(2)|urinary_tract(1)	32	Ovarian(103;0.0454)	all_cancers(173;0.145)|Prostate(94;0.0885)	OV - Ovarian serous cystadenocarcinoma(106;0.00531)			AAGAAGGAGGAGCCTGCAGAG	0.587											OREG0014330	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E465V		.											.	SLC35F3-92	0			c.A1394T						.						74.0	73.0	74.0					1																	234458910		2203	4300	6503	SO:0001583	missense	148641	exon8			AGGAGGAGCCTGC		CCDS1600.1, CCDS73050.1	1q42.3	2013-05-22			ENSG00000183780	ENSG00000183780		"""Solute carriers"""	23616	protein-coding gene	gene with protein product							Standard	XM_005273070		Approved	FLJ37712	uc001hvy.1	Q8IY50	OTTHUMG00000037929	ENST00000366617.3:c.1187A>T	1.37:g.234458910A>T	ENSP00000355576:p.Glu396Val	160	0	2373	281	36	NM_173508	0	0	0	0	0	Q5TDD6|Q8N9C9	Missense_Mutation	SNP	ENST00000366617.3	37		.	.	.	.	.	.	.	.	.	.	A	25.5	4.643874	0.87859	.	.	ENSG00000183780	ENST00000366618;ENST00000366617	T;T	0.53857	0.6;0.62	5.62	5.62	0.85841	.	0.214041	0.48767	D	0.000163	T	0.58623	0.2135	L	0.50333	1.59	0.51482	D	0.999922	D;D	0.57571	0.966;0.98	P;P	0.51229	0.543;0.663	T	0.61983	-0.6950	10	0.59425	D	0.04	-20.2302	15.7908	0.78364	1.0:0.0:0.0:0.0	.	396;465	Q8IY50;Q8IY50-2	S35F3_HUMAN;.	V	465;396	ENSP00000355577:E465V;ENSP00000355576:E396V	ENSP00000355576:E396V	E	+	2	0	SLC35F3	232525533	1.000000	0.71417	0.996000	0.52242	0.989000	0.77384	8.954000	0.93051	2.132000	0.65825	0.402000	0.26972	GAG	.		0.587	SLC35F3-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000128322.1	NM_173508	
GTPBP4	23560	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	1043230	1043230	+	Silent	SNP	G	G	A			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr10:1043230G>A	ENST00000360803.4	+	5	625	c.543G>A	c.(541-543)aaG>aaA	p.K181K	GTPBP4_ENST00000538293.1_Silent_p.K65K|GTPBP4_ENST00000545048.1_Silent_p.K134K|GTPBP4_ENST00000491635.1_3'UTR	NM_012341.2	NP_036473.2	Q9BZE4	NOG1_HUMAN	GTP binding protein 4	181	OBG-type G. {ECO:0000255|PROSITE- ProRule:PRU01047}.				GTP catabolic process (GO:0006184)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of collagen binding (GO:0033342)|negative regulation of DNA replication (GO:0008156)|negative regulation of protein ubiquitination (GO:0031397)|osteoblast differentiation (GO:0001649)|protein stabilization (GO:0050821)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|ribosome biogenesis (GO:0042254)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(1)|large_intestine(3)|lung(11)|ovary(1)|prostate(2)|skin(1)	21		all_epithelial(10;0.107)|Colorectal(49;0.14)	OV - Ovarian serous cystadenocarcinoma(33;0.0814)	Epithelial(11;0.0513)|all cancers(11;0.135)|OV - Ovarian serous cystadenocarcinoma(14;0.173)		ATGTTGGGAAGTCCAGCTTCA	0.443																																					p.K181K		.											.	GTPBP4-92	0			c.G543A						.						180.0	169.0	172.0					10																	1043230		2203	4300	6503	SO:0001819	synonymous_variant	23560	exon5			TGGGAAGTCCAGC	AK001548	CCDS31132.1	10p15-p14	2007-07-27			ENSG00000107937	ENSG00000107937			21535	protein-coding gene	gene with protein product	"""G protein-binding protein CRFG"", "" GTP-binding protein"""					11316846	Standard	NM_012341		Approved	CRFG, NGB, FLJ10690, FLJ10686, NOG1	uc001ift.3	Q9BZE4	OTTHUMG00000017538	ENST00000360803.4:c.543G>A	10.37:g.1043230G>A		390	1		456	204	NM_012341	0	0	11	20	9	B3KMC5|B4DY13|B7Z7A3|O95446|Q5T3R8|Q9NVJ8	Silent	SNP	ENST00000360803.4	37	CCDS31132.1																																																																																			.		0.443	GTPBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046412.1	NM_012341	
PFKP	5214	ucsc.edu	37	10	3172124	3172124	+	Silent	SNP	A	A	G			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr10:3172124A>G	ENST00000381125.4	+	17	1873	c.1797A>G	c.(1795-1797)ggA>ggG	p.G599G	PFKP_ENST00000381075.2_Silent_p.G591G|PFKP_ENST00000381072.1_Silent_p.G17G	NM_002627.4	NP_002618.1	Q01813	PFKAP_HUMAN	phosphofructokinase, platelet	599	C-terminal regulatory PFK domain 2.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 6-phosphate metabolic process (GO:0006002)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	6-phosphofructokinase activity (GO:0003872)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein complex binding (GO:0032403)			breast(2)|central_nervous_system(4)|endometrium(3)|large_intestine(3)|lung(10)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31				GBM - Glioblastoma multiforme(1;0.000975)|all cancers(11;0.00351)|Epithelial(11;0.142)		TCGCGGCCGGAGCTGATGCCG	0.637																																					p.G599G													.	PFKP-253	0			c.A1797G						.						46.0	44.0	45.0					10																	3172124		2203	4300	6503	SO:0001819	synonymous_variant	5214	exon17			GGCCGGAGCTGAT	AK092597	CCDS7059.1, CCDS55698.1	10p15.3-p15.2	2006-08-25			ENSG00000067057	ENSG00000067057	2.7.1.11		8878	protein-coding gene	gene with protein product	"""Phosphofructokinase, platelet type"""	171840					Standard	NM_002627		Approved	PFK-C, PFKF	uc001igp.3	Q01813	OTTHUMG00000017556	ENST00000381125.4:c.1797A>G	10.37:g.3172124A>G		98	4		125	4	NM_002627	0	0	0	0	0	B3KS15|Q5VSR7|Q5VSR8	Silent	SNP	ENST00000381125.4	37	CCDS7059.1	.	.	.	.	.	.	.	.	.	.	a	0.412	-0.912933	0.02415	.	.	ENSG00000067057	ENST00000413079	.	.	.	4.49	-1.22	0.09494	.	.	.	.	.	T	0.39200	0.1069	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.27434	-1.0074	4	.	.	.	.	0.901	0.01274	0.3028:0.2525:0.0973:0.3474	.	.	.	.	G	163	.	.	S	+	1	0	PFKP	3162124	0.000000	0.05858	0.287000	0.24848	0.008000	0.06430	-2.641000	0.00864	-0.159000	0.11021	-0.666000	0.03841	AGC	.		0.637	PFKP-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046454.1	NM_002627	
R3HCC1L	27291	hgsc.bcm.edu	37	10	99967975	99967975	+	Missense_Mutation	SNP	A	A	G			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr10:99967975A>G	ENST00000298999.3	+	5	407	c.104A>G	c.(103-105)gAt>gGt	p.D35G	R3HCC1L_ENST00000370586.2_Intron|R3HCC1L_ENST00000314594.5_5'UTR|R3HCC1L_ENST00000370584.3_Missense_Mutation_p.D35G	NM_014472.4	NP_055287	Q7Z5L2	R3HCL_HUMAN	R3H domain and coiled-coil containing 1-like	35							nucleotide binding (GO:0000166)										AAGACAGGTGATGAAGAAGAA	0.443																																					p.D35G		.											.	.	0			c.A104G						.						61.0	63.0	63.0					10																	99967975		2203	4300	6503	SO:0001583	missense	27291	exon4			CAGGTGATGAAGA	AF525304	CCDS31267.1, CCDS58093.1, CCDS73178.1	10q24.2	2012-05-23	2012-05-23	2012-05-23	ENSG00000166024	ENSG00000166024			23512	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 28"""	C10orf28			Standard	NM_014472		Approved	GIDRP86, PSORT	uc001kox.4	Q7Z5L2	OTTHUMG00000018873	ENST00000298999.3:c.104A>G	10.37:g.99967975A>G	ENSP00000298999:p.Asp35Gly	142	0		29	2	NM_001256620	0	0	5	5	0	O60598|Q5W0B4|Q5W0B5|Q86VT9|Q8N9H0	Missense_Mutation	SNP	ENST00000298999.3	37	CCDS31267.1	.	.	.	.	.	.	.	.	.	.	A	2.186	-0.386501	0.04966	.	.	ENSG00000166024	ENST00000370584;ENST00000538495;ENST00000298999	T;T	0.13089	2.62;2.62	5.67	1.58	0.23477	.	0.627416	0.15583	N	0.254798	T	0.09555	0.0235	L	0.41824	1.3	0.09310	N	0.999998	B;B	0.06786	0.001;0.001	B;B	0.08055	0.003;0.003	T	0.35226	-0.9797	9	.	.	.	-0.1034	4.8076	0.13328	0.6597:0.1568:0.1834:0.0	.	35;35	Q7Z5L2;Q7Z5L2-2	GIDRP_HUMAN;.	G	35	ENSP00000359616:D35G;ENSP00000298999:D35G	.	D	+	2	0	C10orf28	99957965	0.382000	0.25148	0.002000	0.10522	0.018000	0.09664	1.329000	0.33770	0.027000	0.15297	0.454000	0.30748	GAT	.		0.443	R3HCC1L-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049764.1	NM_014472	
MUC5B	727897	broad.mit.edu	37	11	1258389	1258389	+	Missense_Mutation	SNP	T	T	G			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr11:1258389T>G	ENST00000529681.1	+	25	3350	c.3292T>G	c.(3292-3294)Tcc>Gcc	p.S1098A	MUC5B_ENST00000447027.1_Missense_Mutation_p.S1101A	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	1098	VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CGCCTGCCGCTCCCAGGTGGG	0.682																																					p.S1098A													.	.	0			c.T3292G						.						10.0	15.0	13.0					11																	1258389		1897	4084	5981	SO:0001583	missense	727897	exon25			TGCCGCTCCCAGG	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.3292T>G	11.37:g.1258389T>G	ENSP00000436812:p.Ser1098Ala	36	1		30	3	NM_002458	0	0	0	0	0	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	T	5.715	0.316511	0.10845	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.76839	-1.05;-1.05	4.38	-4.2	0.03823	von Willebrand factor, type D domain (1);Uncharacterised domain, cysteine-rich (2);	.	.	.	.	T	0.59473	0.2196	N	0.10645	0.015	0.27479	N	0.952642	B;P;P	0.48089	0.026;0.905;0.905	B;P;P	0.47376	0.027;0.545;0.545	T	0.57613	-0.7781	9	0.87932	D	0	.	6.1245	0.20172	0.0:0.2029:0.3546:0.4425	.	1098;1791;1101	Q9HC84;A7Y9J9;E9PBJ0	MUC5B_HUMAN;.;.	A	1098;1101;1099;1168	ENSP00000436812:S1098A;ENSP00000415793:S1101A	ENSP00000343037:S1099A	S	+	1	0	MUC5B	1214965	0.000000	0.05858	0.074000	0.20217	0.008000	0.06430	-0.169000	0.09911	-0.576000	0.05974	-0.648000	0.03929	TCC	.		0.682	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
PIK3C2A	5286	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	17190402	17190402	+	Missense_Mutation	SNP	G	G	A			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr11:17190402G>A	ENST00000265970.7	-	1	886	c.887C>T	c.(886-888)tCa>tTa	p.S296L	PIK3C2A_ENST00000531428.1_Intron|PIK3C2A_ENST00000540361.1_Intron	NM_002645.2	NP_002636.2	O00443	P3C2A_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha	296					clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|exocytosis (GO:0006887)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|small molecule metabolic process (GO:0044281)|vascular smooth muscle contraction (GO:0014829)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol binding (GO:0035091)			central_nervous_system(4)|endometrium(5)|kidney(5)|large_intestine(7)|lung(24)|ovary(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	58						TAGCAAACTTGAAACATTTTT	0.393																																					p.S296L		.											.	PIK3C2A-1310	0			c.C887T						.						176.0	170.0	172.0					11																	17190402		2200	4293	6493	SO:0001583	missense	5286	exon1			AAACTTGAAACAT	Y13367	CCDS7824.1	11p15.5-p14	2012-07-13	2012-07-13			ENSG00000011405	2.7.1.154		8971	protein-coding gene	gene with protein product		603601	"""phosphoinositide-3-kinase, class 2, alpha polypeptide"""			9337861	Standard	NM_002645		Approved	PI3K-C2alpha	uc001mmq.4	O00443		ENST00000265970.7:c.887C>T	11.37:g.17190402G>A	ENSP00000265970:p.Ser296Leu	276	0		278	59	NM_002645	0	0	9	9	0	B0LPH2|B4E2G4|Q14CQ9	Missense_Mutation	SNP	ENST00000265970.7	37	CCDS7824.1	.	.	.	.	.	.	.	.	.	.	G	10.03	1.239126	0.22711	.	.	ENSG00000011405	ENST00000265970;ENST00000544896	T	0.62639	0.01	5.49	5.49	0.81192	.	1.281530	0.04815	N	0.435973	T	0.54838	0.1883	N	0.19112	0.55	0.54753	D	0.999987	B;B	0.26258	0.145;0.0	B;B	0.21708	0.036;0.0	T	0.09422	-1.0675	10	0.51188	T	0.08	-3.6563	15.6995	0.77533	0.0:0.137:0.863:0.0	.	296;296	F5H5W9;O00443	.;P3C2A_HUMAN	L	296	ENSP00000265970:S296L	ENSP00000265970:S296L	S	-	2	0	PIK3C2A	17146978	0.228000	0.23718	0.359000	0.25824	0.485000	0.33311	1.793000	0.38764	2.570000	0.86706	0.563000	0.77884	TCA	.		0.393	PIK3C2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387553.1	NM_002645	
MS4A12	54860	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	60268545	60268545	+	Missense_Mutation	SNP	C	C	T			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr11:60268545C>T	ENST00000016913.4	+	3	361	c.304C>T	c.(304-306)Cac>Tac	p.H102Y	MS4A12_ENST00000537076.1_Intron	NM_017716.2	NP_060186.2	Q9NXJ0	M4A12_HUMAN	membrane-spanning 4-domains, subfamily A, member 12	102						integral component of membrane (GO:0016021)				breast(1)|kidney(3)|large_intestine(2)|lung(9)|prostate(2)	17						TGGATTGATGCACATTGGTTT	0.373																																					p.H102Y		.											.	MS4A12-90	0			c.C304T						.						292.0	286.0	288.0					11																	60268545		2203	4300	6503	SO:0001583	missense	54860	exon3			TTGATGCACATTG	AK000224	CCDS7988.1, CCDS53638.1	11q12	2008-03-25				ENSG00000071203			13370	protein-coding gene	gene with protein product		606550				11401424, 11486273	Standard	NM_017716		Approved	Ms4a10, FLJ20217	uc001npr.3	Q9NXJ0		ENST00000016913.4:c.304C>T	11.37:g.60268545C>T	ENSP00000016913:p.His102Tyr	591	0		298	44	NM_017716	0	0	0	0	0	F5GX98|Q8N6L4	Missense_Mutation	SNP	ENST00000016913.4	37	CCDS7988.1	.	.	.	.	.	.	.	.	.	.	C	13.57	2.277327	0.40294	.	.	ENSG00000071203	ENST00000016913;ENST00000530007	T;T	0.58506	4.27;0.33	5.14	5.14	0.70334	.	0.454353	0.25506	N	0.030212	T	0.66177	0.2763	L	0.55990	1.75	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.62243	-0.6895	10	0.02654	T	1	.	14.0807	0.64919	0.0:1.0:0.0:0.0	.	102	Q9NXJ0	M4A12_HUMAN	Y	102	ENSP00000016913:H102Y;ENSP00000434783:H102Y	ENSP00000016913:H102Y	H	+	1	0	MS4A12	60025121	0.679000	0.27596	0.572000	0.28498	0.095000	0.18619	2.340000	0.43974	2.375000	0.81037	0.462000	0.41574	CAC	.		0.373	MS4A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383627.1		
VWCE	220001	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	61026692	61026692	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr11:61026692C>A	ENST00000335613.5	-	20	2709	c.2323G>T	c.(2323-2325)Gag>Tag	p.E775*	VWCE_ENST00000535710.1_Nonsense_Mutation_p.E240*	NM_152718.2	NP_689931.2	Q96DN2	VWCE_HUMAN	von Willebrand factor C and EGF domains	775						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			biliary_tract(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(17)|ovary(3)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37						ACAGGGGCCTCAGTGTCTCCA	0.567																																					p.E775X		.											.	VWCE-91	0			c.G2323T						.						40.0	42.0	41.0					11																	61026692		2203	4299	6502	SO:0001587	stop_gained	220001	exon20			GGGCCTCAGTGTC	AK056571	CCDS8002.1	11q12.2	2006-08-04			ENSG00000167992	ENSG00000167992			26487	protein-coding gene	gene with protein product		611115				12869306	Standard	NM_152718		Approved	URG11, FLJ32009, VWC1	uc001nra.3	Q96DN2	OTTHUMG00000168208	ENST00000335613.5:c.2323G>T	11.37:g.61026692C>A	ENSP00000334186:p.Glu775*	117	0		112	22	NM_152718	0	0	0	0	0	A5PKV0|Q7Z7L6|Q86WK8	Nonsense_Mutation	SNP	ENST00000335613.5	37	CCDS8002.1	.	.	.	.	.	.	.	.	.	.	C	37	6.304859	0.97458	.	.	ENSG00000167992	ENST00000335613;ENST00000535710	.	.	.	4.63	-0.214	0.13161	.	0.840398	0.09913	N	0.739540	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	.	3.1614	0.06521	0.1831:0.4481:0.0:0.3689	.	.	.	.	X	775;240	.	ENSP00000334186:E775X	E	-	1	0	VWCE	60783268	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.666000	0.05280	0.047000	0.15862	-0.982000	0.02568	GAG	.		0.567	VWCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398811.1	NM_152718	
AHNAK	79026	ucsc.edu	37	11	62295728	62295728	+	Missense_Mutation	SNP	G	G	A			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr11:62295728G>A	ENST00000378024.4	-	5	6435	c.6161C>T	c.(6160-6162)cCc>cTc	p.P2054L	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	2054					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				GCTGAACTTGGGCATTTTCAT	0.507																																					p.P2054L													.	AHNAK-109	0			c.C6161T						.						280.0	285.0	283.0					11																	62295728		2202	4297	6499	SO:0001583	missense	79026	exon5			AACTTGGGCATTT	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.6161C>T	11.37:g.62295728G>A	ENSP00000367263:p.Pro2054Leu	615	1		802	2	NM_001620	0	0	39	46	7	A1A586	Missense_Mutation	SNP	ENST00000378024.4	37	CCDS31584.1	.	.	.	.	.	.	.	.	.	.	g	19.32	3.805699	0.70682	.	.	ENSG00000124942	ENST00000244934;ENST00000378024	T	0.03004	4.08	4.05	4.05	0.47172	.	0.000000	0.34555	U	0.003874	T	0.32734	0.0839	H	0.98507	4.25	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.61397	-0.7071	10	0.87932	D	0	.	15.8511	0.78930	0.0:0.0:1.0:0.0	.	2054	Q09666	AHNK_HUMAN	L	143;2054	ENSP00000367263:P2054L	ENSP00000244934:P143L	P	-	2	0	AHNAK	62052304	1.000000	0.71417	1.000000	0.80357	0.851000	0.48451	6.174000	0.71943	1.803000	0.52742	0.298000	0.19748	CCC	.		0.507	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060	
NXPE4	54827	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	114465481	114465481	+	Start_Codon_SNP	SNP	T	T	G			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr11:114465481T>G	ENST00000375478.3	-	2	181	c.1A>C	c.(1-3)Atg>Ctg	p.M1L	NXPE4_ENST00000424261.2_5'UTR	NM_001077639.1	NP_001071107.1	Q6UWF7	NXPE4_HUMAN	neurexophilin and PC-esterase domain family, member 4	1						extracellular vesicular exosome (GO:0070062)											CTTATTTTCATGATTAGGATC	0.318																																					p.M1L		.											.	.	0			c.A1C						.						84.0	81.0	82.0					11																	114465481		1818	4069	5887	SO:0001582	initiator_codon_variant	54827	exon2			TTTTCATGATTAG	AK000134	CCDS41718.1, CCDS44737.1	11q23.3	2012-06-14	2012-06-11	2012-06-11	ENSG00000137634	ENSG00000137634			23117	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 33"", ""family with sequence similarity 55, member D"""	C11orf33, FAM55D		20056006	Standard	NM_017678		Approved	FLJ20127	uc001ppc.3	Q6UWF7	OTTHUMG00000168291	ENST00000375478.3:c.1A>C	11.37:g.114465481T>G	ENSP00000364627:p.Met1Leu	155	0		45	8	NM_001077639	0	0	0	0	0	Q6QDB4|Q9NXP5	Missense_Mutation	SNP	ENST00000375478.3	37	CCDS41718.1	.	.	.	.	.	.	.	.	.	.	T	16.08	3.022575	0.54683	.	.	ENSG00000137634	ENST00000375478	T	0.09911	2.93	4.82	3.62	0.41486	.	0.133839	0.32719	N	0.005731	T	0.08313	0.0207	.	.	.	0.20307	N	0.999919	B	0.06786	0.001	B	0.06405	0.002	T	0.17379	-1.0371	9	0.87932	D	0	.	7.3579	0.26729	0.1944:0.0:0.0:0.8056	.	1	Q6UWF7	FA55D_HUMAN	L	1	ENSP00000364627:M1L	ENSP00000364627:M1L	M	-	1	0	FAM55D	113970691	0.001000	0.12720	0.932000	0.37286	0.614000	0.37383	0.129000	0.15830	2.144000	0.66660	0.533000	0.62120	ATG	.		0.318	NXPE4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000399179.1	NM_017678	Missense_Mutation
PCSK7	9159	hgsc.bcm.edu	37	11	117079626	117079626	+	Missense_Mutation	SNP	G	G	C	rs202038275		TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr11:117079626G>C	ENST00000320934.3	-	13	2308	c.1678C>G	c.(1678-1680)Cgc>Ggc	p.R560G	PCSK7_ENST00000529458.1_5'Flank|PCSK7_ENST00000540028.1_Missense_Mutation_p.R201G	NM_004716.2	NP_004707.2	Q16549	PCSK7_HUMAN	proprotein convertase subtilisin/kexin type 7	560					peptide hormone processing (GO:0016486)|protein processing (GO:0016485)	integral component of Golgi membrane (GO:0030173)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			NS(1)|endometrium(3)|large_intestine(2)|lung(8)|ovary(1)|skin(1)	16	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.72e-06)|Epithelial(105;6.71e-05)|all cancers(92;0.000537)		TCCATGCTGCGGGGGGCGCCG	0.597			T	IGH@	MLCLS																																p.R560G		.		Dom	yes		11	11q23.3	9159	proprotein convertase subtilisin/kexin type 7		L	.	PCSK7-658	0			c.C1678G						.						40.0	43.0	42.0					11																	117079626		2201	4296	6497	SO:0001583	missense	9159	exon13			TGCTGCGGGGGGC	U40623	CCDS8382.1	11q23-q24	2008-02-01			ENSG00000160613	ENSG00000160613			8748	protein-coding gene	gene with protein product		604872				8615762, 9820811	Standard	XM_006718938		Approved	PC7, PC8, LPC, SPC7	uc001pqr.3	Q16549	OTTHUMG00000165640	ENST00000320934.3:c.1678C>G	11.37:g.117079626G>C	ENSP00000325917:p.Arg560Gly	46	2		45	11	NM_004716	0	0	4	4	0	B0YJ60|Q3C1X1|Q53GM4|Q96FK8|Q9UL57	Missense_Mutation	SNP	ENST00000320934.3	37	CCDS8382.1	.	.	.	.	.	.	.	.	.	.	G	12.92	2.082462	0.36758	.	.	ENSG00000160613	ENST00000320934;ENST00000540028;ENST00000543900	T;T	0.71222	-0.55;-0.55	4.68	3.77	0.43336	Proprotein convertase, P (1);Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	D	0.82875	0.5132	M	0.85099	2.735	0.58432	D	0.999992	D	0.89917	1.0	D	0.83275	0.996	D	0.83562	0.0107	10	0.87932	D	0	-26.4093	7.8865	0.29653	0.0864:0.0:0.7545:0.1591	.	560	Q16549	PCSK7_HUMAN	G	560;201;560	ENSP00000325917:R560G;ENSP00000441944:R201G	ENSP00000325917:R560G	R	-	1	0	PCSK7	116584836	1.000000	0.71417	1.000000	0.80357	0.121000	0.20230	1.527000	0.35975	1.207000	0.43291	-0.362000	0.07510	CGC	G|0.875;C|0.125		0.597	PCSK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385529.2	NM_004716	
ESAM	90952	broad.mit.edu	37	11	124624584	124624584	+	Missense_Mutation	SNP	T	T	C			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr11:124624584T>C	ENST00000278927.5	-	5	812	c.683A>G	c.(682-684)aAt>aGt	p.N228S	VSIG2_ENST00000326621.5_5'Flank|VSIG2_ENST00000403470.1_5'Flank|ESAM_ENST00000442070.2_Missense_Mutation_p.N49S	NM_138961.2	NP_620411.2	Q96AP7	ESAM_HUMAN	endothelial cell adhesion molecule	228	Ig-like C2-type.				blood coagulation (GO:0007596)|homophilic cell adhesion (GO:0007156)|leukocyte migration (GO:0050900)|single organismal cell-cell adhesion (GO:0016337)	adherens junction (GO:0005912)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				endometrium(2)|kidney(1)|large_intestine(6)|lung(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	16	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.022)		GCCCACCTCATTGTGGGCCTT	0.522																																					p.N228S													.	ESAM-90	0			c.A683G						.						199.0	176.0	184.0					11																	124624584		2201	4299	6500	SO:0001583	missense	90952	exon5			ACCTCATTGTGGG	AK075396	CCDS8453.1	11q24.2	2013-01-29			ENSG00000149564	ENSG00000149564		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17474	protein-coding gene	gene with protein product		614281				11279107, 11906820	Standard	NM_138961		Approved	W117m	uc001qav.4	Q96AP7	OTTHUMG00000151986	ENST00000278927.5:c.683A>G	11.37:g.124624584T>C	ENSP00000278927:p.Asn228Ser	244	0		304	4	NM_138961	0	0	0	0	0	B4DVN8|Q96T50	Missense_Mutation	SNP	ENST00000278927.5	37	CCDS8453.1	.	.	.	.	.	.	.	.	.	.	T	19.54	3.846380	0.71603	.	.	ENSG00000149564	ENST00000442070;ENST00000444566;ENST00000278927;ENST00000435477	T;T;T;T	0.22743	3.53;3.53;1.94;1.94	5.83	5.83	0.93111	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.47377	0.1442	M	0.86864	2.845	0.54753	D	0.999988	P;D;D;D	0.76494	0.873;0.998;0.999;0.984	P;D;D;D	0.68039	0.707;0.955;0.936;0.93	T	0.54309	-0.8313	10	0.72032	D	0.01	.	8.7082	0.34367	0.0:0.0844:0.0:0.9156	.	49;228;228;101	B4DVN8;F8WDW9;Q96AP7;C9JIE7	.;.;ESAM_HUMAN;.	S	49;49;228;101	ENSP00000410351:N49S;ENSP00000406689:N49S;ENSP00000278927:N228S;ENSP00000415893:N101S	ENSP00000278927:N228S	N	-	2	0	ESAM	124129794	0.983000	0.35010	0.860000	0.33809	0.987000	0.75469	2.952000	0.49097	2.220000	0.72140	0.533000	0.62120	AAT	.		0.522	ESAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324686.1	NM_138961	
M6PR	4074	hgsc.bcm.edu;broad.mit.edu	37	12	9096395	9096395	+	Splice_Site	SNP	A	A	G			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr12:9096395A>G	ENST00000000412.3	-	4	922		c.e4+1			NM_002355.3	NP_002346.1	P20645	MPRD_HUMAN	mannose-6-phosphate receptor (cation dependent)						endosome to lysosome transport (GO:0008333)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)	mannose binding (GO:0005537)|mannose transmembrane transporter activity (GO:0015578)|transmembrane signaling receptor activity (GO:0004888)			cervix(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(1)	11		Hepatocellular(102;0.137)		BRCA - Breast invasive adenocarcinoma(232;0.0146)	Alglucosidase alfa(DB01272)	AGGGTGCCTCACCGCTAGGGT	0.527																																					.		.											.	M6PR-90	0			c.453+2T>C						.						79.0	64.0	69.0					12																	9096395		2203	4300	6503	SO:0001630	splice_region_variant	4074	exon5			TGCCTCACCGCTA		CCDS8598.1, CCDS73440.1	12p13.31	2013-09-20			ENSG00000003056	ENSG00000003056			6752	protein-coding gene	gene with protein product		154540					Standard	NM_002355		Approved		uc001qvf.3	P20645	OTTHUMG00000168276	ENST00000000412.3:c.453+1T>C	12.37:g.9096395A>G		150	0		100	18	NM_002355	0	0	0	0	0	A8K528|D3DUV5	Splice_Site	SNP	ENST00000000412.3	37	CCDS8598.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.111457	0.77210	.	.	ENSG00000003056	ENST00000000412;ENST00000537621	.	.	.	5.71	5.71	0.89125	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.6658	0.77227	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	M6PR	8987662	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.075000	0.76798	2.191000	0.70037	0.528000	0.53228	.	.		0.527	M6PR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399130.1		Intron
HEATR5A	25938	ucsc.edu	37	14	31782236	31782236	+	Missense_Mutation	SNP	G	G	A			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr14:31782236G>A	ENST00000389961.3	-	27	4360	c.4361C>T	c.(4360-4362)gCa>gTa	p.A1454V	AL136418.1_ENST00000582500.1_RNA|HEATR5A_ENST00000439727.1_Missense_Mutation_p.A1167V|HEATR5A_ENST00000543095.2_Missense_Mutation_p.A1460V|HEATR5A_ENST00000439348.1_Missense_Mutation_p.A1454V			Q86XA9	HTR5A_HUMAN	HEAT repeat containing 5A	1454										breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(13)|ovary(1)	26	Hepatocellular(127;0.0877)|Breast(36;0.137)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.0797)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.0059)		ATCCTGAAGTGCAGCAAGCCA	0.413																																					p.A1460V													.	HEATR5A-23	0			c.C4379T						.						151.0	145.0	147.0					14																	31782236		1987	4191	6178	SO:0001583	missense	25938	exon28			TGAAGTGCAGCAA	AB037737		14q12	2012-04-19	2007-01-02	2007-01-02	ENSG00000129493	ENSG00000129493			20276	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 125"""	C14orf125			Standard	NM_015473		Approved	DKFZP434I1735	uc001wrf.4	Q86XA9	OTTHUMG00000169043	ENST00000389961.3:c.4361C>T	14.37:g.31782236G>A	ENSP00000374611:p.Ala1454Val	176	0		116	1	NM_015473	0	0	0	0	0	Q68DD8|Q6P3S5|Q6P5R9|Q9H8D7|Q9NXB7|Q9P2N0|Q9UFQ3	Missense_Mutation	SNP	ENST00000389961.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.9|20.9	4.073683|4.073683	0.76415|0.76415	.|.	.|.	ENSG00000129493|ENSG00000129493	ENST00000389961;ENST00000439348;ENST00000439727;ENST00000543095|ENST00000538864	T;T;T;T|.	0.53857|.	0.6;0.6;0.6;0.6|.	4.68|4.68	4.68|4.68	0.58851|0.58851	.|.	0.055107|.	0.64402|.	D|.	0.000001|.	T|T	0.69223|0.69223	0.3087|0.3087	L|L	0.52126|0.52126	1.63|1.63	0.80722|0.80722	D|D	1|1	P|.	0.34629|.	0.46|.	B|.	0.40375|.	0.327|.	T|T	0.67503|0.67503	-0.5654|-0.5654	10|5	0.40728|.	T|.	0.16|.	.|.	17.9551|17.9551	0.89065|0.89065	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1454|.	Q86XA9-2|.	.|.	V|Y	1454;1454;1167;1460|1088	ENSP00000374611:A1454V;ENSP00000405407:A1454V;ENSP00000408681:A1167V;ENSP00000437968:A1460V|.	ENSP00000374611:A1454V|.	A|H	-|-	2|1	0|0	HEATR5A|HEATR5A	30851987|30851987	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.996000|0.996000	0.88848|0.88848	5.153000|5.153000	0.64888|0.64888	2.310000|2.310000	0.77875|0.77875	0.561000|0.561000	0.74099|0.74099	GCA|CAC	.		0.413	HEATR5A-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_015473	
AHNAK2	113146	broad.mit.edu	37	14	105412623	105412623	+	Silent	SNP	A	A	G			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr14:105412623A>G	ENST00000333244.5	-	7	9284	c.9165T>C	c.(9163-9165)gcT>gcC	p.A3055A	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3055						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CTTTGAGGCCAGCTCCCTCGG	0.607																																					p.A3055A													.	AHNAK2-47	0			c.T9165C						.						105.0	109.0	108.0					14																	105412623		1900	4099	5999	SO:0001819	synonymous_variant	113146	exon7			GAGGCCAGCTCCC	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.9165T>C	14.37:g.105412623A>G		316	0		319	5	NM_138420	0	0	0	11	11	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Silent	SNP	ENST00000333244.5	37	CCDS45177.1																																																																																			.		0.607	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
MEIS2	4212	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	37184626	37184626	+	Missense_Mutation	SNP	C	C	A			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr15:37184626C>A	ENST00000561208.1	-	12	1600	c.1182G>T	c.(1180-1182)caG>caT	p.Q394H	MEIS2_ENST00000424352.2_3'UTR|MEIS2_ENST00000444725.1_3'UTR|MEIS2_ENST00000397620.2_3'UTR|MEIS2_ENST00000219869.9_3'UTR|MEIS2_ENST00000557796.2_3'UTR|MEIS2_ENST00000559408.1_5'Flank|MEIS2_ENST00000382766.2_Missense_Mutation_p.Q387H|MEIS2_ENST00000397624.3_3'UTR|MEIS2_ENST00000559085.1_3'UTR|MEIS2_ENST00000340545.5_3'UTR|MEIS2_ENST00000338564.5_Missense_Mutation_p.Q387H			O14770	MEIS2_HUMAN	Meis homeobox 2	394	Transcriptional activation domain.				eye development (GO:0001654)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|pancreas development (GO:0031016)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to growth factor (GO:0070848)|response to mechanical stimulus (GO:0009612)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	36		all_epithelial(112;9.77e-14)|Lung NSC(122;1.42e-09)|all_lung(180;2.2e-08)|Ovarian(310;0.134)|Melanoma(134;0.155)		all cancers(64;9.33e-21)|GBM - Glioblastoma multiforme(113;1.71e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0288)		TAGGACCACCCTGAGAAACGT	0.458																																					p.Q394H		.											.	MEIS2-92	0			c.G1182T						.						187.0	188.0	188.0					15																	37184626		2201	4297	6498	SO:0001583	missense	4212	exon12			ACCACCCTGAGAA	AF017418	CCDS10044.1, CCDS10045.1, CCDS42014.1, CCDS45217.1, CCDS45218.1, CCDS45219.1, CCDS45220.1	15q14	2011-06-20	2007-02-15		ENSG00000134138	ENSG00000134138		"""Homeoboxes / TALE class"""	7001	protein-coding gene	gene with protein product		601740	"""Meis (mouse) homolog 2"", ""Meis1, myeloid ecotropic viral integration site 1 homolog 2 (mouse)"""			9383298	Standard	NM_172315		Approved	MRG1, HsT18361	uc001zjr.4	O14770	OTTHUMG00000129781	ENST00000561208.1:c.1182G>T	15.37:g.37184626C>A	ENSP00000453793:p.Gln394His	591	1		214	59	NM_170675	0	0	0	0	0	A6NJI5|A8MWD5|B3KP98|B3KPQ6|Q96DI2|Q96KI4|Q96KI5|Q9NRS1|Q9NRS2|Q9NRS3	Missense_Mutation	SNP	ENST00000561208.1	37	CCDS10044.1	.	.	.	.	.	.	.	.	.	.	C	11.46	1.645203	0.29246	.	.	ENSG00000134138	ENST00000314177;ENST00000338564;ENST00000382766	D;D	0.86627	-2.15;-2.15	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.78046	0.4222	N	0.12182	0.205	0.80722	D	1	B;B;B;B	0.13145	0.001;0.002;0.001;0.007	B;B;B;B	0.13407	0.002;0.002;0.002;0.009	T	0.71087	-0.4694	10	0.22706	T	0.39	-1.914	18.9968	0.92817	0.0:1.0:0.0:0.0	.	387;394;374;90	O14770-4;O14770;B7Z6F6;Q6V703	.;MEIS2_HUMAN;.;.	H	394;387;387	ENSP00000341400:Q387H;ENSP00000372216:Q387H	ENSP00000326296:Q394H	Q	-	3	2	MEIS2	34971918	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.801000	0.69115	2.705000	0.92388	0.655000	0.94253	CAG	.		0.458	MEIS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252003.2	NM_170677	
RHBDL1	9028	hgsc.bcm.edu	37	16	726121	726121	+	Missense_Mutation	SNP	G	G	C	rs200482219	byFrequency	TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr16:726121G>C	ENST00000219551.2	+	1	47	c.20G>C	c.(19-21)gGg>gCg	p.G7A	RHBDL1_ENST00000352681.3_Intron|LA16c-313D11.9_ENST00000571933.1_RNA|LA16c-313D11.9_ENST00000567091.1_RNA			O75783	RHBL1_HUMAN	rhomboid, veinlet-like 1 (Drosophila)	7					signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)			endometrium(1)|kidney(1)|lung(4)|urinary_tract(3)	9		Hepatocellular(780;0.0218)				GTGGAAGACGGGGGAACAACT	0.682													G|||	4	0.000798722	0.0	0.0014	5008	,	,		10105	0.0		0.001	False		,,,				2504	0.002				p.G7A		.											.	RHBDL1-90	0			c.G20C						.	G	ALA/GLY	1,3923		0,1,1961	4.0	3.0	4.0		20	-0.9	0.0	16		4	2,7792		0,2,3895	yes	missense	RHBDL1	NM_003961.1	60	0,3,5856	CC,CG,GG		0.0257,0.0255,0.0256	benign	7/439	726121	3,11715	1962	3897	5859	SO:0001583	missense	9028	exon1			AAGACGGGGGAAC	Y17108	CCDS61779.1	16p13.3	2008-02-05	2001-11-28	2003-04-11	ENSG00000103269	ENSG00000103269			10007	protein-coding gene	gene with protein product		603264	"""rhomboid (veinlet, Drosophila)-like"""	RHBDL		9662444	Standard	NM_001278720		Approved	RRP	uc002cis.1	O75783	OTTHUMG00000121141	ENST00000219551.2:c.20G>C	16.37:g.726121G>C	ENSP00000219551:p.Gly7Ala	6	2		11	6	NM_003961	0	0	0	3	3	A2IDC0|A2IDC1|Q0VAX4|Q9NQ85	Missense_Mutation	SNP	ENST00000219551.2	37	CCDS10418.1	4	0.0018315018315018315	2	0.0040650406504065045	1	0.0027624309392265192	0	0.0	1	0.0013192612137203166	G	10.26	1.301490	0.23736	2.55E-4	2.57E-4	ENSG00000103269	ENST00000219551	T	0.38722	1.12	3.59	-0.853	0.10709	.	.	.	.	.	T	0.19805	0.0476	N	0.08118	0	0.09310	N	1	B	0.13594	0.008	B	0.14578	0.011	T	0.20605	-1.0270	9	0.87932	D	0	.	4.0885	0.09958	0.3061:0.0:0.5279:0.1659	.	7	O75783	RHBL1_HUMAN	A	7	ENSP00000219551:G7A	ENSP00000219551:G7A	G	+	2	0	RHBDL1	666122	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.053000	0.11846	0.005000	0.14708	-0.521000	0.04368	GGG	G|0.998;C|0.002		0.682	RHBDL1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000241619.1	NM_003961	
TNP2	7142	broad.mit.edu	37	16	11362955	11362955	+	Silent	SNP	G	G	A			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr16:11362955G>A	ENST00000312693.3	-	1	234	c.165C>T	c.(163-165)agC>agT	p.S55S	RMI2_ENST00000572173.1_Intron	NM_005425.4	NP_005416.1	Q05952	STP2_HUMAN	transition protein 2 (during histone to protamine replacement)	55					acrosome reaction (GO:0007340)|binding of sperm to zona pellucida (GO:0007339)|cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|penetration of zona pellucida (GO:0007341)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S55R(1)|p.0?(1)		large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	6						GGTTGCGGTGGCTGGCCGGGC	0.617																																					p.S55S													.	.	2	Substitution - Missense(1)|Whole gene deletion(1)	upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)	c.C165T						.						133.0	149.0	143.0					16																	11362955		2067	4203	6270	SO:0001819	synonymous_variant	7142	exon1			GCGGTGGCTGGCC		CCDS45410.1	16p13.13	2008-08-01				ENSG00000178279			11952	protein-coding gene	gene with protein product		190232				1395729, 2250010	Standard	NM_005425		Approved	TP2	uc002das.3	Q05952		ENST00000312693.3:c.165C>T	16.37:g.11362955G>A		309	0		612	7	NM_005425	0	0	0	0	0	Q9NZB0	Silent	SNP	ENST00000312693.3	37	CCDS45410.1																																																																																			.		0.617	TNP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417806.1	NM_005425	
C16orf70	80262	hgsc.bcm.edu	37	16	67183948	67183948	+	IGR	SNP	C	C	T	rs146483793	byFrequency	TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr16:67183948C>T	ENST00000219139.3	+	0	2865				B3GNT9_ENST00000449549.3_Silent_p.G147G	NM_025187.3	NP_079463.2	Q9BSU1	CP070_HUMAN	chromosome 16 open reading frame 70											cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(3)|skin(1)	17		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0017)|Epithelial(162;0.00655)|all cancers(182;0.0579)		GCACCAGCGCCCCCTGCACGC	0.746													c|||	3	0.000599042	0.0	0.0	5008	,	,		11171	0.0		0.003	False		,,,				2504	0.0				p.G147G		.											.	.	0			c.G441A						.			2,3338		0,2,1668	4.0	4.0	4.0		441	4.3	1.0	16	dbSNP_134	4	24,7148		0,24,3562	no	coding-synonymous	B3GNT9	NM_033309.2		0,26,5230	TT,TC,CC		0.3346,0.0599,0.2473		147/403	67183948	26,10486	1670	3586	5256	SO:0001628	intergenic_variant	84752	exon2			CAGCGCCCCCTGC	AK022138	CCDS10828.1	16q22.1	2011-01-25	2006-04-12	2006-04-12	ENSG00000125149	ENSG00000125149			29564	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 6"""	C16orf6, LIN10		12477932	Standard	NM_025187		Approved	lin-10, FLJ12076	uc002erd.3	Q9BSU1	OTTHUMG00000137510		16.37:g.67183948C>T		4	1		7	4	NM_033309	0	0	0	0	0	Q9HA86	Silent	SNP	ENST00000219139.3	37	CCDS10828.1																																																																																			C|0.998;T|0.002		0.746	C16orf70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268829.2	NM_025187	
CRISPLD2	83716	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	84940197	84940197	+	Silent	SNP	G	G	A			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr16:84940197G>A	ENST00000262424.5	+	15	1667	c.1443G>A	c.(1441-1443)ctG>ctA	p.L481L	CRISPLD2_ENST00000567845.1_Silent_p.L480L	NM_031476.3	NP_113664.1	Q9H0B8	CRLD2_HUMAN	cysteine-rich secretory protein LCCL domain containing 2	481	LCCL 2. {ECO:0000255|PROSITE- ProRule:PRU00123}.				extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|lung development (GO:0030324)	extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|transport vesicle (GO:0030133)	heparin binding (GO:0008201)			endometrium(3)|large_intestine(5)|lung(8)|prostate(1)|stomach(1)	18						TTTTCAGCCTGGGGACTCCTC	0.597																																					p.L481L		.											.	CRISPLD2-90	0			c.G1443A						.						54.0	58.0	57.0					16																	84940197		2199	4300	6499	SO:0001819	synonymous_variant	83716	exon15			CAGCCTGGGGACT	AL136861	CCDS10949.1	16q24.1	2008-02-05	2005-02-16	2005-02-16	ENSG00000103196	ENSG00000103196			25248	protein-coding gene	gene with protein product		612434	"""LCCL domain containing cysteine-rich secretory protein 2"""	LCRISP2		11230166	Standard	NM_031476		Approved	DKFZP434B044	uc010voh.1	Q9H0B8	OTTHUMG00000137644	ENST00000262424.5:c.1443G>A	16.37:g.84940197G>A		256	0		282	59	NM_031476	0	0	0	0	0	D3DUM0|Q6P590|Q6UWH0|Q6UXC6|Q96IB1|Q96K61	Silent	SNP	ENST00000262424.5	37	CCDS10949.1																																																																																			.		0.597	CRISPLD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269086.2	NM_031476	
ACACA	31	ucsc.edu	37	17	35487095	35487095	+	Missense_Mutation	SNP	T	T	C			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr17:35487095T>C	ENST00000394406.2	-	46	5808	c.5618A>G	c.(5617-5619)cAg>cGg	p.Q1873R	ACACA_ENST00000361253.5_5'UTR|ACACA_ENST00000353139.5_Missense_Mutation_p.Q1910R|ACACA_ENST00000335166.5_Missense_Mutation_p.Q1795R|ACACA_ENST00000360679.3_Missense_Mutation_p.Q1815R	NM_198836.1	NP_942133.1	Q13085	ACACA_HUMAN	acetyl-CoA carboxylase alpha	1873	Carboxyltransferase.				acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|lipid homeostasis (GO:0055088)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|malonyl-CoA biosynthetic process (GO:2001295)|multicellular organismal protein metabolic process (GO:0044268)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(2)|breast(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(24)|lung(23)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	83		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)	GTGCATAATCTGGATGCCCCC	0.493																																					p.Q1910R	Colon(23;82 258 739 2117 10493 24037 27661 34815 35438 36249)												.	ACACA-154	0			c.A5729G						.						187.0	166.0	173.0					17																	35487095		2203	4300	6503	SO:0001583	missense	31	exon46			ATAATCTGGATGC	U19822	CCDS11317.1, CCDS11318.1, CCDS42302.1, CCDS42303.1	17q21	2014-05-06	2010-04-30		ENSG00000132142	ENSG00000278540	6.4.1.2		84	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 1"""	200350	"""acetyl-Coenzyme A carboxylase alpha"""	ACAC, ACC			Standard	NM_198837		Approved	ACC1	uc002hno.3	Q13085	OTTHUMG00000188463	ENST00000394406.2:c.5618A>G	17.37:g.35487095T>C	ENSP00000377928:p.Gln1873Arg	296	0		511	2	NM_198834	0	0	0	0	0	B2RP68|Q6KEV6|Q6XDA8|Q7Z2G8|Q7Z561|Q7Z563|Q7Z564|Q86WB2|Q86WB3	Missense_Mutation	SNP	ENST00000394406.2	37	CCDS11317.1	.	.	.	.	.	.	.	.	.	.	T	32	5.110753	0.94292	.	.	ENSG00000132142	ENST00000353139;ENST00000360679;ENST00000394406;ENST00000452074;ENST00000335166;ENST00000427330	D;D;D;D	0.97665	-4.48;-4.48;-4.48;-4.48	5.83	5.83	0.93111	Carboxyl transferase (1);Acetyl-coenzyme A carboxyltransferase, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.98188	0.9401	M	0.79475	2.455	0.80722	D	1	D;P;D;D	0.65815	0.995;0.956;0.989;0.986	P;P;D;P	0.66716	0.885;0.648;0.946;0.877	D	0.98678	1.0691	10	0.52906	T	0.07	-14.2837	16.1846	0.81942	0.0:0.0:0.0:1.0	.	572;1910;1873;1815	F8W6G0;Q13085-4;Q13085;Q13085-2	.;.;ACACA_HUMAN;.	R	1910;1815;1873;1897;1795;572	ENSP00000344789:Q1910R;ENSP00000353898:Q1815R;ENSP00000377928:Q1873R;ENSP00000335323:Q1795R	ENSP00000335323:Q1795R	Q	-	2	0	ACACA	32561208	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.040000	0.89188	2.229000	0.72834	0.533000	0.62120	CAG	.		0.493	ACACA-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256696.1	NM_198836	
KRTAP4-9	100132386	broad.mit.edu	37	17	39262039	39262039	+	Missense_Mutation	SNP	C	C	G	rs370251849		TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr17:39262039C>G	ENST00000391415.1	+	1	456	c.399C>G	c.(397-399)agC>agG	p.S133R		NM_001146041.1	NP_001139513.1	Q9BYQ8	KRA49_HUMAN	keratin associated protein 4-9	133	29 X 5 AA repeats of C-C-[RQVHIEK]- [SPTR]-[VSTQCRNP].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)		p.S133R(1)|p.S121R(1)		central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|urinary_tract(3)	14						gtgtgtccagctgctgcaagc	0.652																																					p.S133R													.	.	2	Substitution - Missense(2)	lung(2)	c.C399G						.						7.0	13.0	11.0					17																	39262039		676	1567	2243	SO:0001583	missense	100132386	exon1			GTCCAGCTGCTGC	AJ406941	CCDS54124.1	17q21.2	2013-06-25			ENSG00000212722	ENSG00000212722		"""Keratin associated proteins"""	18910	protein-coding gene	gene with protein product							Standard	NM_001146041		Approved	KAP4.9	uc010wfp.2	Q9BYQ8	OTTHUMG00000133584	ENST00000391415.1:c.399C>G	17.37:g.39262039C>G	ENSP00000375234:p.Ser133Arg	50	2		193	21	NM_001146041	0	0	0	0	0		Missense_Mutation	SNP	ENST00000391415.1	37	CCDS54124.1	.	.	.	.	.	.	.	.	.	.	.	12.64	1.997952	0.35226	.	.	ENSG00000212722	ENST00000377734;ENST00000391415;ENST00000333994	T	0.38401	1.14	3.32	2.33	0.28932	.	11.718500	0.01159	U	0.006593	T	0.54679	0.1873	M	0.78223	2.4	0.32657	N	0.518627	P	0.49307	0.922	P	0.54100	0.742	T	0.30149	-0.9988	10	0.54805	T	0.06	.	5.7349	0.18061	0.0:0.7348:0.0:0.2652	.	133	Q9BYQ8	KRA49_HUMAN	R	121;133;124	ENSP00000375234:S133R	ENSP00000334461:S124R	S	+	3	2	KRTAP4-9	36515565	0.828000	0.29307	0.682000	0.30024	0.211000	0.24417	0.599000	0.24089	0.501000	0.28013	0.306000	0.20318	AGC	.		0.652	KRTAP4-9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257688.1	NM_001146041	
KRTAP4-5	85289	hgsc.bcm.edu	37	17	39305625	39305625	+	Missense_Mutation	SNP	T	T	C			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr17:39305625T>C	ENST00000343246.4	-	1	429	c.395A>G	c.(394-396)cAc>cGc	p.H132R		NM_033188.3	NP_149445.3	Q9BYR2	KRA45_HUMAN	keratin associated protein 4-5	132	26 X 5 AA repeats of C-C-[GRQVCHIEK]- [SPTR]-[VSTQYC].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(4)	6		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			gcaagaggggtggcagcagct	0.642																																					p.H132R		.											.	KRTAP4-5-90	0			c.A395G						.						23.0	22.0	23.0					17																	39305625		2197	4285	6482	SO:0001583	missense	85289	exon1			GAGGGGTGGCAGC	AJ406937	CCDS32650.1	17q21.2	2013-06-25			ENSG00000198271	ENSG00000198271		"""Keratin associated proteins"""	18899	protein-coding gene	gene with protein product						11279113	Standard	NM_033188		Approved	KAP4.5	uc002hwb.3	Q9BYR2	OTTHUMG00000133638	ENST00000343246.4:c.395A>G	17.37:g.39305625T>C	ENSP00000340546:p.His132Arg	47	1		181	10	NM_033188	0	0	0	0	0		Missense_Mutation	SNP	ENST00000343246.4	37	CCDS32650.1	.	.	.	.	.	.	.	.	.	.	.	0.039	-1.292893	0.01375	.	.	ENSG00000198271	ENST00000343246	T	0.01215	5.16	3.68	-2.53	0.06326	.	0.249624	0.17496	N	0.172162	T	0.00271	0.0008	N	0.00190	-1.885	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.40627	-0.9553	10	0.02654	T	1	.	1.232	0.01945	0.1439:0.3518:0.1413:0.363	.	137	Q9BYR2	KRA45_HUMAN	R	132	ENSP00000340546:H132R	ENSP00000340546:H132R	H	-	2	0	KRTAP4-5	36559151	0.000000	0.05858	0.000000	0.03702	0.059000	0.15707	-0.650000	0.05378	-0.582000	0.05929	-1.092000	0.02172	CAC	.		0.642	KRTAP4-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257783.1		
PLEKHM1	9842	broad.mit.edu	37	17	43531102	43531102	+	Missense_Mutation	SNP	A	A	G			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr17:43531102A>G	ENST00000430334.3	-	7	2249	c.2116T>C	c.(2116-2118)Tcc>Ccc	p.S706P	PLEKHM1_ENST00000421073.2_Missense_Mutation_p.S617P|AC091132.1_ENST00000433601.1_RNA	NM_014798.2	NP_055613.1	Q9Y4G2	PKHM1_HUMAN	pleckstrin homology domain containing, family M (with RUN domain) member 1	706	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.				intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(6)|large_intestine(1)|lung(10)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	26	Renal(3;0.0405)					GCCTCCAAGGACAGAGAAAAT	0.542																																					p.S706P													.	PLEKHM1-90	0			c.T2116C						.						47.0	44.0	45.0					17																	43531102		2203	4300	6503	SO:0001583	missense	9842	exon7			CCAAGGACAGAGA	X85792	CCDS32671.1	17q21.31	2013-01-11				ENSG00000225190		"""Pleckstrin homology (PH) domain containing"""	29017	protein-coding gene	gene with protein product		611466				9205841, 12820725	Standard	NM_014798		Approved	KIAA0356	uc002ija.3	Q9Y4G2		ENST00000430334.3:c.2116T>C	17.37:g.43531102A>G	ENSP00000389913:p.Ser706Pro	122	1		209	4	NM_014798	0	0	0	10	10	Q6P2R5|Q8TEL9|Q9NPP5|Q9NYA0	Missense_Mutation	SNP	ENST00000430334.3	37	CCDS32671.1	.	.	.	.	.	.	.	.	.	.	A	13.41	2.229476	0.39399	.	.	ENSG00000225190	ENST00000430334;ENST00000446609;ENST00000421073	T;T	0.64085	-0.08;-0.08	4.91	4.91	0.64330	Pleckstrin homology-type (1);Pleckstrin homology domain (1);	0.063686	0.64402	D	0.000004	T	0.66386	0.2784	L	0.29908	0.895	0.46564	D	0.999104	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.83275	0.994;0.996;0.991	T	0.68484	-0.5396	10	0.62326	D	0.03	.	9.0391	0.36307	0.8356:0.0:0.0:0.1644	.	617;655;706	F8W648;B4DRX1;Q9Y4G2	.;.;PKHM1_HUMAN	P	706;655;617	ENSP00000389913:S706P;ENSP00000414352:S617P	ENSP00000414352:S617P	S	-	1	0	PLEKHM1	40886885	1.000000	0.71417	1.000000	0.80357	0.062000	0.15995	6.744000	0.74854	2.079000	0.62486	0.477000	0.44152	TCC	.		0.542	PLEKHM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444659.1	NM_014798	
NGFR	4804	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	47588006	47588006	+	Silent	SNP	G	G	T			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr17:47588006G>T	ENST00000172229.3	+	4	926	c.801G>T	c.(799-801)gtG>gtT	p.V267V	RP5-1029K10.2_ENST00000514506.1_RNA|NGFR_ENST00000504201.1_Silent_p.V173V	NM_002507.3	NP_002498.1	P08138	TNR16_HUMAN	nerve growth factor receptor	267					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|central nervous system development (GO:0007417)|circadian regulation of gene expression (GO:0032922)|detection of temperature stimulus (GO:0016048)|glucose homeostasis (GO:0042593)|hair follicle morphogenesis (GO:0031069)|intracellular protein transport (GO:0006886)|membrane protein intracellular domain proteolysis (GO:0031293)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell cycle (GO:0045786)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of hair follicle development (GO:0051799)|nerve development (GO:0021675)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of axonogenesis (GO:0050772)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of odontogenesis of dentin-containing tooth (GO:0042488)|regulation of axonogenesis (GO:0050770)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of glucose import in response to insulin stimulus (GO:2001273)	cell surface (GO:0009986)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|neuronal postsynaptic density (GO:0097481)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	death receptor activity (GO:0005035)|Rab GTPase binding (GO:0017137)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)	17	all_cancers(4;1.45e-13)|Breast(4;6.34e-28)|all_epithelial(4;4.95e-17)					TGGGCCTTGTGGCCTACATAG	0.577																																					p.V267V		.											.	NGFR-947	0			c.G801T						.						112.0	101.0	105.0					17																	47588006		2203	4300	6503	SO:0001819	synonymous_variant	4804	exon4			CCTTGTGGCCTAC	M14764	CCDS11549.1	17q21-q22	2013-05-22	2010-04-28		ENSG00000064300	ENSG00000064300		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	7809	protein-coding gene	gene with protein product	"""low affinity nerve growth factor receptor"", ""TNFR superfamily, member 16"""	162010	"""nerve growth factor receptor (TNFR superfamily, member 16)"""			3022937, 3006050	Standard	NM_002507		Approved	TNFRSF16, CD271, p75NTR	uc002ioz.4	P08138	OTTHUMG00000161495	ENST00000172229.3:c.801G>T	17.37:g.47588006G>T		205	0		333	56	NM_002507	0	0	0	0	0	B2R961|B4E096	Silent	SNP	ENST00000172229.3	37	CCDS11549.1																																																																																			.		0.577	NGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365150.1		
CA10	56934	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	49710848	49710848	+	Missense_Mutation	SNP	A	A	C			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr17:49710848A>C	ENST00000285273.4	-	9	2064	c.953T>G	c.(952-954)cTt>cGt	p.L318R	CA10_ENST00000340813.6_Missense_Mutation_p.L324R|CA10_ENST00000442502.2_Missense_Mutation_p.L318R|CA10_ENST00000570565.1_Missense_Mutation_p.L243R|CA10_ENST00000571918.1_5'Flank|CA10_ENST00000451037.2_Missense_Mutation_p.L318R	NM_001082533.1	NP_001076002.1	Q9NS85	CAH10_HUMAN	carbonic anhydrase X	318					brain development (GO:0007420)					cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(21)|ovary(1)|skin(3)|stomach(2)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(22;4.74e-06)		Zonisamide(DB00909)	TCTATACTGAAGCTTCTGGGC	0.502																																					p.L318R		.											.	CA10-516	0			c.T953G						.						123.0	112.0	116.0					17																	49710848		2203	4300	6503	SO:0001583	missense	56934	exon9			TACTGAAGCTTCT	AF288385	CCDS32684.1	17q21	2012-08-21			ENSG00000154975	ENSG00000154975		"""Carbonic anhydrases"""	1369	protein-coding gene	gene with protein product		604642				8673298, 9921901	Standard	NM_020178		Approved	CARPX, CA-RPX, HUCEP-15	uc002itx.4	Q9NS85	OTTHUMG00000177544	ENST00000285273.4:c.953T>G	17.37:g.49710848A>C	ENSP00000285273:p.Leu318Arg	197	1		156	23	NM_001082534	0	0	0	0	0	B2R7J0|B4DGL6	Missense_Mutation	SNP	ENST00000285273.4	37	CCDS32684.1	.	.	.	.	.	.	.	.	.	.	A	17.48	3.398967	0.62177	.	.	ENSG00000154975	ENST00000442502;ENST00000285273;ENST00000451037;ENST00000340813	T;T;T;T	0.71341	-0.51;-0.51;-0.51;-0.56	5.44	5.44	0.79542	.	0.000000	0.64402	D	0.000001	T	0.61825	0.2378	N	0.19112	0.55	0.58432	D	0.999998	P;P;P	0.44578	0.838;0.838;0.835	B;B;B	0.44278	0.276;0.276;0.445	T	0.67325	-0.5699	10	0.59425	D	0.04	.	14.6889	0.69070	1.0:0.0:0.0:0.0	.	318;324;243	Q9NS85;Q68D28;B4DGL6	CAH10_HUMAN;.;.	R	318;318;318;324	ENSP00000390666:L318R;ENSP00000285273:L318R;ENSP00000405388:L318R;ENSP00000340363:L324R	ENSP00000285273:L318R	L	-	2	0	CA10	47065847	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.301000	0.78850	2.069000	0.61940	0.533000	0.62120	CTT	.		0.502	CA10-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000437480.1	NM_020178	
OR4D1	26689	broad.mit.edu	37	17	56232804	56232804	+	Missense_Mutation	SNP	G	G	A			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr17:56232804G>A	ENST00000268912.5	+	1	311	c.290G>A	c.(289-291)tGc>tAc	p.C97Y		NM_012374.1	NP_036506.1	Q15615	OR4D1_HUMAN	olfactory receptor, family 4, subfamily D, member 1	97					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(2)|large_intestine(4)|lung(4)|ovary(1)|stomach(1)|urinary_tract(1)	13						TACCAGGGCTGCATGGCCCAG	0.522																																					p.C97Y													.	OR4D1-91	0			c.G290A						.						116.0	120.0	119.0					17																	56232804		2177	4286	6463	SO:0001583	missense	26689	exon1			AGGGCTGCATGGC	X89670	CCDS42365.1	17q22	2012-08-09			ENSG00000141194	ENSG00000141194		"""GPCR / Class A : Olfactory receptors"""	8293	protein-coding gene	gene with protein product				OR4D3		9119360	Standard	NM_012374		Approved	TPCR16	uc010wno.2	Q15615		ENST00000268912.5:c.290G>A	17.37:g.56232804G>A	ENSP00000365451:p.Cys97Tyr	227	1		583	7	NM_012374	0	0	0	0	0	B2RN14|Q8NGB1|Q96R76	Missense_Mutation	SNP	ENST00000268912.5	37	CCDS42365.1	.	.	.	.	.	.	.	.	.	.	g	22.3	4.276326	0.80580	.	.	ENSG00000141194	ENST00000268912	T	0.17054	2.3	5.63	5.63	0.86233	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000003	T	0.57344	0.2047	H	0.96365	3.81	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	T	0.71427	-0.4596	10	0.87932	D	0	-23.2293	17.178	0.86846	0.0:0.0:1.0:0.0	.	97	Q15615	OR4D1_HUMAN	Y	97	ENSP00000365451:C97Y	ENSP00000365451:C97Y	C	+	2	0	OR4D1	53587803	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.611000	0.67674	2.652000	0.90054	0.543000	0.68304	TGC	.		0.522	OR4D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443364.1		
COG1	9382	broad.mit.edu	37	17	71204538	71204538	+	Missense_Mutation	SNP	C	C	T			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr17:71204538C>T	ENST00000299886.4	+	14	2971	c.2891C>T	c.(2890-2892)aCg>aTg	p.T964M	FAM104A_ENST00000405159.3_3'UTR|FAM104A_ENST00000583178.1_5'Flank|FAM104A_ENST00000403627.3_3'UTR	NM_018714.2	NP_061184.1	Q8WTW3	COG1_HUMAN	component of oligomeric golgi complex 1	964					Golgi organization (GO:0007030)|intra-Golgi vesicle-mediated transport (GO:0006891)|protein transport (GO:0015031)	Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18			LUSC - Lung squamous cell carcinoma(166;0.197)			GAAGACAACACGTCTGCACCT	0.473																																					p.T964M													.	COG1-91	0			c.C2891T						.						170.0	154.0	159.0					17																	71204538		2203	4300	6503	SO:0001583	missense	9382	exon14			ACAACACGTCTGC		CCDS11692.1	17q25.1	2008-05-14	2002-05-28	2002-05-31		ENSG00000166685		"""Components of oligomeric golgi complex"""	6545	protein-coding gene	gene with protein product		606973	"""low density lipoprotein receptor defect B complementing"""	LDLB		9927668	Standard	NM_018714		Approved	KIAA1381	uc002jjg.3	Q8WTW3		ENST00000299886.4:c.2891C>T	17.37:g.71204538C>T	ENSP00000299886:p.Thr964Met	275	0		776	7	NM_018714	0	0	96	96	0	Q9NPV9|Q9P2G6	Missense_Mutation	SNP	ENST00000299886.4	37	CCDS11692.1	.	.	.	.	.	.	.	.	.	.	C	17.80	3.478672	0.63849	.	.	ENSG00000166685	ENST00000299886	T	0.24151	1.87	6.03	6.03	0.97812	.	0.449527	0.25951	N	0.027256	T	0.33265	0.0857	L	0.36672	1.1	0.80722	D	1	D	0.61080	0.989	P	0.49637	0.617	T	0.00615	-1.1643	10	0.41790	T	0.15	-12.1843	20.5666	0.99351	0.0:1.0:0.0:0.0	.	964	Q8WTW3	COG1_HUMAN	M	964	ENSP00000299886:T964M	ENSP00000299886:T964M	T	+	2	0	COG1	68716133	0.679000	0.27596	0.022000	0.16811	0.252000	0.25951	6.910000	0.75741	2.854000	0.98071	0.655000	0.94253	ACG	.		0.473	COG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441638.1		
OLFM2	93145	ucsc.edu	37	19	9968019	9968019	+	Missense_Mutation	SNP	A	A	G			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr19:9968019A>G	ENST00000264833.4	-	4	685	c.500T>C	c.(499-501)aTg>aCg	p.M167T	OLFM2_ENST00000590841.1_Missense_Mutation_p.M89T	NM_058164.2	NP_477512.1	O95897	NOE2_HUMAN	olfactomedin 2	167					protein secretion (GO:0009306)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular region (GO:0005576)|synapse (GO:0045202)				breast(1)|cervix(1)|endometrium(3)|large_intestine(8)|lung(9)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	31						GTAGGCACCCATCTCCTCCTG	0.642																																					p.M167T													.	OLFM2-132	0			c.T500C						.						96.0	77.0	83.0					19																	9968019		2203	4300	6503	SO:0001583	missense	93145	exon4			GCACCCATCTCCT	AF131839	CCDS12221.1	19p13.2	2008-07-03				ENSG00000105088			17189	protein-coding gene	gene with protein product	"""noelin 2"""						Standard	NM_058164		Approved	OlfC, NOE2	uc002mmp.3	O95897		ENST00000264833.4:c.500T>C	19.37:g.9968019A>G	ENSP00000264833:p.Met167Thr	145	0		187	1	NM_058164	0	0	5	15	10	Q6IMJ3|Q96FC2	Missense_Mutation	SNP	ENST00000264833.4	37	CCDS12221.1	.	.	.	.	.	.	.	.	.	.	A	15.50	2.852880	0.51270	.	.	ENSG00000105088	ENST00000264833	D	0.87491	-2.26	3.84	3.84	0.44239	.	0.000000	0.85682	D	0.000000	T	0.80502	0.4635	L	0.43152	1.355	0.53688	D	0.999974	B	0.32051	0.354	B	0.30716	0.119	T	0.76591	-0.2903	9	.	.	.	.	10.6376	0.45573	1.0:0.0:0.0:0.0	.	167	O95897	NOE2_HUMAN	T	167	ENSP00000264833:M167T	.	M	-	2	0	OLFM2	9829019	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	7.225000	0.78051	1.619000	0.50296	0.379000	0.24179	ATG	.		0.642	OLFM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451119.1		
ZNF681	148213	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	23926850	23926850	+	Missense_Mutation	SNP	G	G	A			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr19:23926850G>A	ENST00000402377.3	-	4	1643	c.1502C>T	c.(1501-1503)aCt>aTt	p.T501I	ZNF681_ENST00000395385.3_Missense_Mutation_p.T432I	NM_138286.2	NP_612143.2	Q96N22	ZN681_HUMAN	zinc finger protein 681	501					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(10)|prostate(1)|skin(1)|urinary_tract(3)	21		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				TTTCTCTCCAGTATGAATTCT	0.363																																					p.T501I		.											.	.	0			c.C1502T						.						49.0	54.0	52.0					19																	23926850		2190	4290	6480	SO:0001583	missense	148213	exon4			TCTCCAGTATGAA	AK056088	CCDS12414.2	19p12	2013-01-08			ENSG00000196172	ENSG00000196172		"""Zinc fingers, C2H2-type"", ""-"""	26457	protein-coding gene	gene with protein product	"""hypothetical protein FLJ31526"""						Standard	NM_138286		Approved	FLJ31526	uc002nrk.4	Q96N22	OTTHUMG00000150831	ENST00000402377.3:c.1502C>T	19.37:g.23926850G>A	ENSP00000384000:p.Thr501Ile	186	1		56	13	NM_138286	0	0	0	0	0	B3KVF7	Missense_Mutation	SNP	ENST00000402377.3	37	CCDS12414.2	.	.	.	.	.	.	.	.	.	.	.	8.433	0.848964	0.17034	.	.	ENSG00000196172	ENST00000402377;ENST00000395385	T;T	0.25749	1.78;1.78	1.51	0.0946	0.14481	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.46151	0.1378	M	0.77406	2.37	0.24791	N	0.992756	D	0.76494	0.999	D	0.76575	0.988	T	0.26643	-1.0097	9	0.72032	D	0.01	.	6.9774	0.24683	0.0:0.2884:0.7116:0.0	.	501	Q96N22	ZN681_HUMAN	I	501;432	ENSP00000384000:T501I;ENSP00000378783:T432I	ENSP00000378783:T432I	T	-	2	0	ZNF681	23718690	0.453000	0.25721	0.248000	0.24265	0.199000	0.23934	1.070000	0.30653	-0.136000	0.11475	0.313000	0.20887	ACT	.		0.363	ZNF681-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320248.2	NM_138286	
RYR1	6261	hgsc.bcm.edu	37	19	38943527	38943527	+	Missense_Mutation	SNP	A	A	G			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr19:38943527A>G	ENST00000359596.3	+	13	1313	c.1313A>G	c.(1312-1314)gAg>gGg	p.E438G	RYR1_ENST00000355481.4_Missense_Mutation_p.E438G|RYR1_ENST00000360985.3_Missense_Mutation_p.E438G			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	438					calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	CTGCCCATCGAGGGCGTTATC	0.662																																					p.E438G		.											.	RYR1-100	0			c.A1313G						.						38.0	27.0	31.0					19																	38943527		2201	4300	6501	SO:0001583	missense	6261	exon13			CCATCGAGGGCGT	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.1313A>G	19.37:g.38943527A>G	ENSP00000352608:p.Glu438Gly	25	0		34	2	NM_001042723	0	0	3	3	0	Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	37	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	A	18.73	3.686099	0.68157	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.89270	-2.49;-2.49;-2.49	4.47	4.47	0.54385	.	0.259510	0.29861	U	0.011004	D	0.89033	0.6600	L	0.52126	1.63	0.40231	D	0.977844	P;B	0.50943	0.94;0.402	P;B	0.50440	0.641;0.17	D	0.89761	0.3947	10	0.51188	T	0.08	.	13.6427	0.62260	1.0:0.0:0.0:0.0	.	438;438	P21817-2;P21817	.;RYR1_HUMAN	G	438	ENSP00000352608:E438G;ENSP00000347667:E438G;ENSP00000354254:E438G	ENSP00000347667:E438G	E	+	2	0	RYR1	43635367	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.701000	0.68325	1.892000	0.54788	0.456000	0.33151	GAG	.		0.662	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1		
ADCK4	79934	broad.mit.edu	37	19	41198098	41198098	+	Missense_Mutation	SNP	C	C	T			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr19:41198098C>T	ENST00000324464.3	-	15	1778	c.1477G>A	c.(1477-1479)Gca>Aca	p.A493T	NUMBL_ENST00000599594.1_5'Flank|ADCK4_ENST00000243583.6_Missense_Mutation_p.A452T|NUMBL_ENST00000252891.4_5'Flank|ADCK4_ENST00000450541.1_Missense_Mutation_p.A452T|NUMBL_ENST00000540131.1_5'Flank|NUMBL_ENST00000598779.1_5'Flank	NM_024876.3	NP_079152.3	Q96D53	ADCK4_HUMAN	aarF domain containing kinase 4	493						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|endometrium(3)|large_intestine(3)|lung(6)|stomach(2)|urinary_tract(1)	17			Lung(22;9.49e-05)|LUSC - Lung squamous cell carcinoma(20;0.000219)			AAAGCCCCTGCCAGCTTGCGG	0.687																																					p.A493T													.	ADCK4-319	0			c.G1477A						.						28.0	28.0	28.0					19																	41198098		2194	4292	6486	SO:0001583	missense	79934	exon15			CCCCTGCCAGCTT	AK022291	CCDS12562.1, CCDS46081.1	19q13.2	2008-02-05				ENSG00000123815			19041	protein-coding gene	gene with protein product		615567					Standard	NM_024876		Approved	FLJ12229, COQ8	uc002oor.2	Q96D53		ENST00000324464.3:c.1477G>A	19.37:g.41198098C>T	ENSP00000315118:p.Ala493Thr	16	0		22	3	NM_024876	0	0	9	9	0	Q8TAJ1|Q9HA52	Missense_Mutation	SNP	ENST00000324464.3	37	CCDS12562.1	.	.	.	.	.	.	.	.	.	.	C	36	5.637838	0.96693	.	.	ENSG00000123815	ENST00000324464;ENST00000450541;ENST00000243583	T;T;T	0.75154	-0.91;-0.44;-0.44	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	D	0.86230	0.5883	M	0.86268	2.805	0.58432	D	0.999998	P;D	0.54772	0.945;0.968	P;P	0.59171	0.647;0.853	D	0.88110	0.2825	10	0.66056	D	0.02	-10.2873	18.0164	0.89242	0.0:1.0:0.0:0.0	.	493;452	Q96D53;Q96D53-2	ADCK4_HUMAN;.	T	493;452;452	ENSP00000315118:A493T;ENSP00000412839:A452T;ENSP00000243583:A452T	ENSP00000243583:A452T	A	-	1	0	ADCK4	45889938	1.000000	0.71417	0.998000	0.56505	0.961000	0.63080	5.695000	0.68279	2.560000	0.86352	0.561000	0.74099	GCA	.		0.687	ADCK4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462731.1	NM_024876	
GRIN2D	2906	hgsc.bcm.edu	37	19	48945880	48945880	+	Silent	SNP	T	T	C	rs62130268	byFrequency	TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr19:48945880T>C	ENST00000263269.3	+	13	2785	c.2697T>C	c.(2695-2697)gcT>gcC	p.A899A		NM_000836.2	NP_000827.2	O15399	NMDE4_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2D	899					adult locomotory behavior (GO:0008344)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|regulation of sensory perception of pain (GO:0051930)|signal transduction (GO:0007165)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)			autonomic_ganglia(1)|breast(6)|endometrium(2)|large_intestine(9)|lung(12)|ovary(5)|pancreas(1)|prostate(1)	37		all_epithelial(76;1.11e-06)|all_lung(116;5.79e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		all cancers(93;0.00014)|OV - Ovarian serous cystadenocarcinoma(262;0.000233)|Epithelial(262;0.0112)|GBM - Glioblastoma multiforme(486;0.0161)	Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GCTGCAGCGCTGAGGCCGCCC	0.781													c|||	3742	0.747204	0.6188	0.8545	5008	,	,		4716	0.6548		0.8887	False		,,,				2504	0.7945				p.A899A		.											.	GRIN2D-156	0			c.T2697C						.			1689,437		638,413,12	1.0	1.0	1.0		2697	-3.3	1.0	19	dbSNP_129	1	3712,202		1757,198,2	no	coding-synonymous	GRIN2D	NM_000836.2		2395,611,14	CC,CT,TT		5.161,20.555,10.5795		899/1337	48945880	5401,639	1063	1957	3020	SO:0001819	synonymous_variant	2906	exon13			CAGCGCTGAGGCC	U77783	CCDS12719.1	19q13.33	2012-08-29			ENSG00000105464	ENSG00000105464		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4588	protein-coding gene	gene with protein product	"""N-methyl-d-aspartate receptor subunit 2D"""	602717		NMDAR2D		9480759, 9418891	Standard	NM_000836		Approved	GluN2D, EB11, NR2D	uc002pjc.4	O15399		ENST00000263269.3:c.2697T>C	19.37:g.48945880T>C		1	1		5	5	NM_000836	0	0	0	0	0		Silent	SNP	ENST00000263269.3	37	CCDS12719.1																																																																																			T|0.245;C|0.755		0.781	GRIN2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466121.1		
HRC	3270	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	49657602	49657602	+	Missense_Mutation	SNP	C	C	T	rs146437807		TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr19:49657602C>T	ENST00000252825.4	-	1	1079	c.893G>A	c.(892-894)cGa>cAa	p.R298Q	HRC_ENST00000595625.1_Missense_Mutation_p.R298Q	NM_002152.2	NP_002143.1	P23327	SRCH_HUMAN	histidine rich calcium binding protein	298	4 X tandem repeats, acidic.|6 X approximate tandem repeats.				cytosolic calcium ion homeostasis (GO:0051480)|muscle contraction (GO:0006936)|positive regulation of heart contraction (GO:0045823)|positive regulation of heart rate (GO:0010460)|positive regulation of relaxation of cardiac muscle (GO:1901899)|regulation of calcium ion transmembrane transport (GO:1903169)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(10)|lung(10)|ovary(1)|prostate(3)|urinary_tract(2)	34		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.01e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.00019)|GBM - Glioblastoma multiforme(486;0.00279)|Epithelial(262;0.00622)		TTCATGGCTTCGGTGCCTGTG	0.527																																					p.R298Q	Melanoma(37;75 1097 24567 25669 30645)	.											.	HRC-91	0			c.G893A						.						155.0	124.0	134.0					19																	49657602		2203	4300	6503	SO:0001583	missense	3270	exon1			TGGCTTCGGTGCC		CCDS12759.1	19q13.3	2008-07-16	2001-11-28			ENSG00000130528			5178	protein-coding gene	gene with protein product		142705	"""histidine-rich calcium-binding protein"""			2037293	Standard	XR_243928		Approved	MGC133236	uc002pmv.3	P23327		ENST00000252825.4:c.893G>A	19.37:g.49657602C>T	ENSP00000252825:p.Arg298Gln	95	0		164	88	NM_002152	0	0	0	0	0	Q504Y6	Missense_Mutation	SNP	ENST00000252825.4	37	CCDS12759.1	.	.	.	.	.	.	.	.	.	.	C	8.156	0.788501	0.16258	.	.	ENSG00000130528	ENST00000252825;ENST00000434964	T	0.27890	1.64	3.12	-4.41	0.03590	.	.	.	.	.	T	0.13543	0.0328	N	0.16307	0.4	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.40098	-0.9581	9	0.07990	T	0.79	-0.3586	8.5526	0.33460	0.0:0.435:0.0:0.565	.	298	P23327	SRCH_HUMAN	Q	298;268	ENSP00000252825:R298Q	ENSP00000252825:R298Q	R	-	2	0	HRC	54349414	0.000000	0.05858	0.007000	0.13788	0.005000	0.04900	-4.228000	0.00270	-0.724000	0.04908	-0.368000	0.07277	CGA	C|1.000;T|0.000		0.527	HRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465649.1	NM_002152	
MYT1L	23040	broad.mit.edu	37	2	1921002	1921002	+	Silent	SNP	C	C	T			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr2:1921002C>T	ENST00000399161.2	-	11	2340	c.1593G>A	c.(1591-1593)ccG>ccA	p.P531P	MYT1L_ENST00000428368.2_Silent_p.P529P	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	531					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.P531P(2)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		TATCTTTGTGCGGGCATCCGG	0.562																																					p.P529P													.	MYT1L-95	2	Substitution - coding silent(2)	lung(1)|kidney(1)	c.G1587A						.						192.0	200.0	197.0					2																	1921002		2038	4190	6228	SO:0001819	synonymous_variant	23040	exon11			TTTGTGCGGGCAT	AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.1593G>A	2.37:g.1921002C>T		448	1		807	8	NM_015025	0	0	0	0	0	A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Silent	SNP	ENST00000399161.2	37																																																																																				.		0.562	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000322493.1	NM_015025	
RAB11FIP5	26056	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	73315269	73315269	+	Missense_Mutation	SNP	C	C	T			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr2:73315269C>T	ENST00000258098.6	-	3	1717	c.1477G>A	c.(1477-1479)Gcc>Acc	p.A493T	RAB11FIP5_ENST00000493523.2_5'UTR	NM_015470.2	NP_056285.1	Q9BXF6	RFIP5_HUMAN	RAB11 family interacting protein 5 (class I)	493					cellular response to acidic pH (GO:0071468)|insulin secretion involved in cellular response to glucose stimulus (GO:0035773)|protein transport (GO:0015031)|regulated secretory pathway (GO:0045055)|regulation of protein localization to cell surface (GO:2000008)	early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|microtubule organizing center (GO:0005815)|mitochondrial outer membrane (GO:0005741)|recycling endosome (GO:0055037)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)			biliary_tract(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(9)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	23						TGTGGGGAGGCCCCCAGGATG	0.607																																					p.A493T		.											.	RAB11FIP5-90	0			c.G1477A						.						69.0	74.0	72.0					2																	73315269		2203	4300	6503	SO:0001583	missense	26056	exon3			GGGAGGCCCCCAG	AF334812	CCDS1923.1	2p13	2008-02-05			ENSG00000135631	ENSG00000135631			24845	protein-coding gene	gene with protein product		605536				10048485, 11163216	Standard	NM_015470		Approved	GAF1, KIAA0857, RIP11, pp75	uc002sis.4	Q9BXF6	OTTHUMG00000129779	ENST00000258098.6:c.1477G>A	2.37:g.73315269C>T	ENSP00000258098:p.Ala493Thr	249	0		484	55	NM_015470	0	0	0	0	0	O94939|Q9P0M1	Missense_Mutation	SNP	ENST00000258098.6	37	CCDS1923.1	.	.	.	.	.	.	.	.	.	.	C	16.78	3.217658	0.58560	.	.	ENSG00000135631	ENST00000258098	T	0.50548	0.74	4.52	4.52	0.55395	.	0.334564	0.25935	N	0.027344	T	0.50905	0.1643	N	0.19112	0.55	0.34421	D	0.697508	D;D	0.63880	0.993;0.993	D;D	0.74674	0.971;0.984	T	0.55780	-0.8087	10	0.23891	T	0.37	-11.0892	14.4444	0.67340	0.0:1.0:0.0:0.0	.	493;493	Q9BXF6;Q2Z1P3	RFIP5_HUMAN;.	T	493	ENSP00000258098:A493T	ENSP00000258098:A493T	A	-	1	0	RAB11FIP5	73168777	0.002000	0.14202	0.992000	0.48379	0.966000	0.64601	-0.184000	0.09698	2.527000	0.85204	0.491000	0.48974	GCC	.		0.607	RAB11FIP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251995.1	NM_015470	
RETSAT	54884	broad.mit.edu	37	2	85571180	85571180	+	Missense_Mutation	SNP	G	G	A	rs149307146		TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr2:85571180G>A	ENST00000295802.4	-	9	1587	c.1475C>T	c.(1474-1476)tCc>tTc	p.S492F	RETSAT_ENST00000263854.6_Intron|RETSAT_ENST00000457495.2_Missense_Mutation_p.S431F|RETSAT_ENST00000475624.2_Intron	NM_017750.3	NP_060220.3	Q6NUM9	RETST_HUMAN	retinol saturase (all-trans-retinol 13,14-reductase)	492					oxidation-reduction process (GO:0055114)|retinol metabolic process (GO:0042572)	endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nuclear outer membrane (GO:0005640)	all-trans-retinol 13,14-reductase activity (GO:0051786)|oxidoreductase activity (GO:0016491)	p.S492F(1)		NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	30					Vitamin A(DB00162)	TTCCACAAAGGAGTTTTTGAA	0.537																																					p.S492F													.	RETSAT-70	1	Substitution - Missense(1)	endometrium(1)	c.C1475T						.	G	PHE/SER	0,4406		0,0,2203	98.0	106.0	104.0		1475	5.1	0.4	2	dbSNP_134	104	4,8596	3.0+/-9.4	0,4,4296	yes	missense	RETSAT	NM_017750.3	155	0,4,6499	AA,AG,GG		0.0465,0.0,0.0308	benign	492/611	85571180	4,13002	2203	4300	6503	SO:0001583	missense	54884	exon9			ACAAAGGAGTTTT	AK075261	CCDS1972.1	2p11.2	2008-02-05			ENSG00000042445	ENSG00000042445	1.3.99.23		25991	protein-coding gene	gene with protein product						12975309, 15358783	Standard	NM_017750		Approved	FLJ20296	uc002spd.3	Q6NUM9	OTTHUMG00000154611	ENST00000295802.4:c.1475C>T	2.37:g.85571180G>A	ENSP00000295802:p.Ser492Phe	181	0		344	6	NM_017750	0	0	0	7	7	A6NIK3|Q53R95|Q53SA9|Q6UX05|Q8N2H5|Q96FA4|Q9NXE5	Missense_Mutation	SNP	ENST00000295802.4	37	CCDS1972.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.76|15.76	2.928287|2.928287	0.52759|0.52759	0.0|0.0	4.65E-4|4.65E-4	ENSG00000042445|ENSG00000042445	ENST00000449375|ENST00000295802;ENST00000457495	.|T;T	.|0.23552	.|1.9;1.9	5.14|5.14	5.14|5.14	0.70334|0.70334	.|.	.|0.852245	.|0.10867	.|N	.|0.625371	T|T	0.36303|0.36303	0.0962|0.0962	M|M	0.65975|0.65975	2.015|2.015	0.35609|0.35609	D|D	0.808519|0.808519	.|P;P;P	.|0.48089	.|0.905;0.905;0.748	.|P;P;B	.|0.46585	.|0.521;0.521;0.243	T|T	0.45760|0.45760	-0.9239|-0.9239	5|10	.|0.56958	.|D	.|0.05	-8.7214|-8.7214	12.225|12.225	0.54455|0.54455	0.0:0.1718:0.8282:0.0|0.0:0.1718:0.8282:0.0	.|.	.|431;431;492	.|G5E9N3;B4DKE1;Q6NUM9	.|.;.;RETST_HUMAN	S|F	281|492;431	.|ENSP00000295802:S492F;ENSP00000405040:S431F	.|ENSP00000295802:S492F	P|S	-|-	1|2	0|0	RETSAT|RETSAT	85424691|85424691	0.967000|0.967000	0.33354|0.33354	0.392000|0.392000	0.26245|0.26245	0.722000|0.722000	0.41435|0.41435	3.004000|3.004000	0.49513|0.49513	2.561000|2.561000	0.86390|0.86390	0.561000|0.561000	0.74099|0.74099	CCT|TCC	G|1.000;A|0.000		0.537	RETSAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252489.1	NM_017750	
LCT	3938	broad.mit.edu	37	2	136575259	136575259	+	Missense_Mutation	SNP	G	G	C			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr2:136575259G>C	ENST00000264162.2	-	6	1369	c.1359C>G	c.(1357-1359)ttC>ttG	p.F453L	AC011893.3_ENST00000437007.1_RNA	NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	453	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)			breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	AGGAGATGGAGAACTTGTACA	0.622																																					p.F453L													.	LCT-101	0			c.C1359G						.						63.0	60.0	61.0					2																	136575259		2203	4300	6503	SO:0001583	missense	3938	exon6			GATGGAGAACTTG	X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.1359C>G	2.37:g.136575259G>C	ENSP00000264162:p.Phe453Leu	157	0		275	4	NM_002299	0	0	0	0	0	Q4ZG58	Missense_Mutation	SNP	ENST00000264162.2	37	CCDS2178.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.252680	0.80135	.	.	ENSG00000115850	ENST00000264162	T	0.38887	1.11	5.77	1.76	0.24704	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.101961	0.64402	D	0.000002	T	0.61751	0.2372	M	0.82132	2.575	0.45946	D	0.998775	D	0.89917	1.0	D	0.91635	0.999	T	0.63070	-0.6719	10	0.87932	D	0	-31.2631	9.6032	0.39617	0.3854:0.0:0.6146:0.0	.	453	P09848	LPH_HUMAN	L	453	ENSP00000264162:F453L	ENSP00000264162:F453L	F	-	3	2	LCT	136291729	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	1.967000	0.40491	0.400000	0.25396	0.655000	0.94253	TTC	.		0.622	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254657.1	NM_002299	
SCN3A	6328	broad.mit.edu	37	2	166010994	166010994	+	Missense_Mutation	SNP	C	C	T			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr2:166010994C>T	ENST00000360093.3	-	11	1839	c.1348G>A	c.(1348-1350)Gaa>Aaa	p.E450K	SCN3A_ENST00000409101.3_Missense_Mutation_p.E450K|SCN3A_ENST00000283254.7_Missense_Mutation_p.E450K	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	450					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.E450K(1)		NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TTAAGCTGTTCGAGCATCTGC	0.403																																					p.E450K													.	SCN3A-141	1	Substitution - Missense(1)	large_intestine(1)	c.G1348A						.						117.0	113.0	114.0					2																	166010994		2203	4300	6503	SO:0001583	missense	6328	exon11			GCTGTTCGAGCAT	AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.1348G>A	2.37:g.166010994C>T	ENSP00000353206:p.Glu450Lys	202	1		90	7	NM_001081676	0	0	0	0	0	Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Missense_Mutation	SNP	ENST00000360093.3	37		.	.	.	.	.	.	.	.	.	.	C	21.2	4.109195	0.77096	.	.	ENSG00000153253	ENST00000360093;ENST00000283254;ENST00000409101;ENST00000440431	D;D;D;D	0.96913	-4.17;-4.17;-4.15;-4.02	5.6	5.6	0.85130	.	0.100000	0.43579	D	0.000547	D	0.95214	0.8448	M	0.66439	2.03	0.80722	D	1	B;B;B;B;B	0.31837	0.342;0.342;0.198;0.198;0.198	B;B;B;B;B	0.23852	0.022;0.022;0.049;0.049;0.049	D	0.94142	0.7398	10	0.72032	D	0.01	.	19.6137	0.95619	0.0:1.0:0.0:0.0	.	450;450;450;450;450	Q9NY46;E7EUE6;Q9NY46-2;Q9NY46-4;Q9NY46-3	SCN3A_HUMAN;.;.;.;.	K	450	ENSP00000353206:E450K;ENSP00000283254:E450K;ENSP00000386726:E450K;ENSP00000403348:E450K	ENSP00000283254:E450K	E	-	1	0	SCN3A	165719240	1.000000	0.71417	0.915000	0.36163	0.980000	0.70556	7.818000	0.86416	2.636000	0.89361	0.591000	0.81541	GAA	.		0.403	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_006922	
TTC30B	150737	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	178416990	178416990	+	Missense_Mutation	SNP	C	C	T			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr2:178416990C>T	ENST00000408939.3	-	1	752	c.502G>A	c.(502-504)Gga>Aga	p.G168R		NM_152517.2	NP_689730.2	Q8N4P2	TT30B_HUMAN	tetratricopeptide repeat domain 30B	168				Missing (in Ref. 1; BAB70953). {ECO:0000305}.	cilium assembly (GO:0042384)|intraciliary transport (GO:0042073)	cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)				cervix(1)|endometrium(1)|kidney(4)|large_intestine(7)|lung(6)|prostate(1)|skin(2)|urinary_tract(1)	23			OV - Ovarian serous cystadenocarcinoma(117;0.00151)|Epithelial(96;0.00931)|all cancers(119;0.0362)			TCATACTGTCCCTCCTTGTAG	0.567																																					p.G168R		.											.	.	0			c.G502A						.						161.0	177.0	172.0					2																	178416990		2203	4300	6503	SO:0001583	missense	150737	exon1			ACTGTCCCTCCTT	AK055552	CCDS42784.1	2q31.2	2014-02-21			ENSG00000196659	ENSG00000196659		"""Tetratricopeptide (TTC) repeat domain containing"", ""Intraflagellar transport homologs"""	26425	protein-coding gene	gene with protein product						12477932	Standard	NM_152517		Approved	FLJ30990, fleer, IFT70	uc002uln.3	Q8N4P2	OTTHUMG00000154166	ENST00000408939.3:c.502G>A	2.37:g.178416990C>T	ENSP00000386181:p.Gly168Arg	459	1		828	103	NM_152517	0	0	0	0	0	Q63HQ1|Q96NE6	Missense_Mutation	SNP	ENST00000408939.3	37	CCDS42784.1	.	.	.	.	.	.	.	.	.	.	C	15.10	2.733709	0.48939	.	.	ENSG00000196659	ENST00000500357;ENST00000408939	T	0.65916	-0.18	4.51	4.51	0.55191	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.77758	0.4178	M	0.78916	2.43	0.80722	D	1	D	0.53462	0.96	P	0.61070	0.883	T	0.80792	-0.1224	10	0.59425	D	0.04	.	17.7624	0.88468	0.0:1.0:0.0:0.0	.	168	Q8N4P2	TT30B_HUMAN	R	121;168	ENSP00000386181:G168R	ENSP00000386181:G168R	G	-	1	0	TTC30B	178125236	1.000000	0.71417	0.999000	0.59377	0.158000	0.22134	7.532000	0.81985	2.487000	0.83934	0.655000	0.94253	GGA	.		0.567	TTC30B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334193.2	NM_152517	
TTN	7273	broad.mit.edu	37	2	179415765	179415765	+	Missense_Mutation	SNP	G	G	A			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr2:179415765G>A	ENST00000591111.1	-	286	86794	c.86570C>T	c.(86569-86571)gCa>gTa	p.A28857V	TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.A21433V|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.A21625V|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.A30498V|TTN_ENST00000342992.6_Missense_Mutation_p.A27930V|TTN-AS1_ENST00000586831.1_RNA|RP11-65L3.2_ENST00000603415.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.A21558V|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000419746.1_RNA			Q8WZ42	TITIN_HUMAN	titin	28857	Fibronectin type-III 110. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGCATTTCTTGCAATTATTCT	0.418																																					p.A30498V													.	TTN-636	0			c.C91493T						.						80.0	76.0	77.0					2																	179415765		1885	4117	6002	SO:0001583	missense	7273	exon336			TTTCTTGCAATTA	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.86570C>T	2.37:g.179415765G>A	ENSP00000465570:p.Ala28857Val	83	0		36	3	NM_001267550	0	0	0	0	0	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	G	35	5.467341	0.96257	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.76060	-0.99;-0.99;-0.99;-0.99	5.9	5.9	0.94986	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.91408	0.7289	H	0.96301	3.8	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.998;0.998;0.998	D	0.93227	0.6614	9	0.87932	D	0	.	20.2787	0.98501	0.0:0.0:1.0:0.0	.	21433;21558;21625;28857	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	V	27930;21433;21625;21558;21430	ENSP00000343764:A27930V;ENSP00000434586:A21433V;ENSP00000340554:A21625V;ENSP00000352154:A21558V	ENSP00000340554:A21625V	A	-	2	0	TTN	179124011	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.869000	0.99810	2.798000	0.96311	0.650000	0.86243	GCA	.		0.418	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TTLL4	9654	broad.mit.edu	37	2	219612347	219612347	+	Silent	SNP	C	C	T			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr2:219612347C>T	ENST00000392102.1	+	11	2617	c.2277C>T	c.(2275-2277)agC>agT	p.S759S	TTLL4_ENST00000457313.1_Silent_p.S594S|TTLL4_ENST00000442769.1_Silent_p.S695S|TTLL4_ENST00000258398.4_Silent_p.S759S	NM_014640.4	NP_055455.3	Q14679	TTLL4_HUMAN	tubulin tyrosine ligase-like family, member 4	759	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				protein polyglutamylation (GO:0018095)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ligase activity (GO:0016874)|tubulin binding (GO:0015631)			endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(3)|skin(3)|upper_aerodigestive_tract(2)	39		Renal(207;0.0915)		Epithelial(149;5.03e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0101)		ACCTCATCAGCGGCAGCAAGT	0.493																																					p.S759S	GBM(172;1818 2053 15407 20943 49753)												.	TTLL4-93	0			c.C2277T						.						153.0	140.0	145.0					2																	219612347		2203	4300	6503	SO:0001819	synonymous_variant	9654	exon11			CATCAGCGGCAGC		CCDS2422.1	2p24.3-p24.1	2013-02-14			ENSG00000135912	ENSG00000135912		"""Tubulin tyrosine ligase-like family"""	28976	protein-coding gene	gene with protein product						11054573	Standard	NM_014640		Approved	KIAA0173	uc002viy.3	Q14679	OTTHUMG00000133081	ENST00000392102.1:c.2277C>T	2.37:g.219612347C>T		225	0		383	7	NM_014640	0	0	6	6	0	A8K6V5|Q8WW29	Silent	SNP	ENST00000392102.1	37	CCDS2422.1	.	.	.	.	.	.	.	.	.	.	c	14.18	2.457214	0.43634	.	.	ENSG00000135912	ENST00000448224	.	.	.	5.28	-7.51	0.01346	.	.	.	.	.	T	0.64670	0.2619	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.69461	-0.5139	4	.	.	.	.	17.4246	0.87522	0.0:0.3253:0.0:0.6747	.	.	.	.	V	91	.	.	A	+	2	0	TTLL4	219320591	0.000000	0.05858	0.683000	0.30040	0.987000	0.75469	-2.811000	0.00755	-1.636000	0.01533	-0.766000	0.03442	GCG	.		0.493	TTLL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256726.1	NM_014640	
FAM124B	79843	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	225266233	225266233	+	Missense_Mutation	SNP	C	C	T			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr2:225266233C>T	ENST00000409685.3	-	1	518	c.253G>A	c.(253-255)Gtc>Atc	p.V85I	FAM124B_ENST00000389874.3_Missense_Mutation_p.V85I|FAM124B_ENST00000243806.2_Missense_Mutation_p.V85I	NM_001122779.1	NP_001116251.1	Q9H5Z6	F124B_HUMAN	family with sequence similarity 124B	85								p.V85I(2)		endometrium(2)|large_intestine(2)|lung(7)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	16		Renal(207;0.0112)|all_lung(227;0.0126)|Lung NSC(271;0.0161)|all_hematologic(139;0.138)		Epithelial(121;4.4e-10)|all cancers(144;2.02e-07)|Lung(261;0.00766)|LUSC - Lung squamous cell carcinoma(224;0.00825)		GAGTCCAGGACGCGAAATAGC	0.552																																					p.V85I		.											.	FAM124B-92	2	Substitution - Missense(2)	endometrium(2)	c.G253A						.						59.0	57.0	58.0					2																	225266233		2203	4300	6503	SO:0001583	missense	79843	exon1			CCAGGACGCGAAA	AK075126	CCDS2461.1, CCDS46527.1	2q36.2	2008-02-05			ENSG00000124019	ENSG00000124019			26224	protein-coding gene	gene with protein product						12477932	Standard	NM_001122779		Approved	FLJ22746	uc002vnx.3	Q9H5Z6	OTTHUMG00000133168	ENST00000409685.3:c.253G>A	2.37:g.225266233C>T	ENSP00000386895:p.Val85Ile	105	0		145	20	NM_024785	0	0	0	0	0	A6NNC7|Q8NBZ4|Q8TAV7	Missense_Mutation	SNP	ENST00000409685.3	37	CCDS46527.1	.	.	.	.	.	.	.	.	.	.	C	4.854	0.158738	0.09236	.	.	ENSG00000124019	ENST00000389874;ENST00000409685;ENST00000243806	T;T;T	0.46063	0.88;0.88;0.88	5.69	1.32	0.21799	.	0.311841	0.33691	N	0.004645	T	0.30510	0.0767	L	0.42686	1.345	0.09310	N	1	B;B	0.21452	0.056;0.004	B;B	0.17433	0.018;0.003	T	0.18871	-1.0323	10	0.44086	T	0.13	-7.8837	7.6061	0.28103	0.0:0.574:0.22:0.206	.	85;85	Q9H5Z6;Q9H5Z6-2	F124B_HUMAN;.	I	85	ENSP00000374524:V85I;ENSP00000386895:V85I;ENSP00000243806:V85I	ENSP00000243806:V85I	V	-	1	0	FAM124B	224974477	0.625000	0.27111	0.000000	0.03702	0.001000	0.01503	1.550000	0.36223	0.332000	0.23536	-0.137000	0.14449	GTC	.		0.552	FAM124B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330873.1	NM_024785	
COL6A3	1293	bcgsc.ca	37	2	238244962	238244962	+	Missense_Mutation	SNP	C	C	G			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr2:238244962C>G	ENST00000295550.4	-	40	9233	c.8781G>C	c.(8779-8781)atG>atC	p.M2927I	COL6A3_ENST00000409809.1_Missense_Mutation_p.M2721I|COL6A3_ENST00000353578.4_Missense_Mutation_p.M2721I|COL6A3_ENST00000472056.1_Missense_Mutation_p.M2320I|COL6A3_ENST00000347401.3_Missense_Mutation_p.M2726I|COL6A3_ENST00000346358.4_Missense_Mutation_p.M2727I	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	2927	Ala-rich.|Nonhelical region.		M -> T (in dbSNP:rs6728818). {ECO:0000269|PubMed:1689238}.		axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		TAACAGTGGCCATCTTTGTGG	0.592																																					p.M2927I													.	COL6A3-526	0			c.G8781C						.						62.0	75.0	71.0					2																	238244962		2203	4299	6502	SO:0001583	missense	1293	exon40			AGTGGCCATCTTT	X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.8781G>C	2.37:g.238244962C>G	ENSP00000295550:p.Met2927Ile	190	0		376	17	NM_004369	0	0	0	0	0	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	ENST00000295550.4	37	CCDS33412.1	.	.	.	.	.	.	.	.	.	.	C	9.410	1.080267	0.20309	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358	D;D;D;D;D;D	0.87650	-2.28;-2.27;-2.25;-2.24;-2.25;-2.24	5.34	-6.48	0.01896	.	1.643600	0.03837	N	0.270051	T	0.74612	0.3739	N	0.22421	0.69	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.59705	-0.7404	10	0.48119	T	0.1	.	3.8981	0.09149	0.1155:0.1768:0.1145:0.5932	.	2320;2721;2927	E9PFQ6;P12111-2;P12111	.;.;CO6A3_HUMAN	I	2927;2726;2721;2320;2721;2727	ENSP00000295550:M2927I;ENSP00000315609:M2726I;ENSP00000315873:M2721I;ENSP00000418285:M2320I;ENSP00000386844:M2721I;ENSP00000295546:M2727I	ENSP00000295550:M2927I	M	-	3	0	COL6A3	237909701	0.000000	0.05858	0.001000	0.08648	0.012000	0.07955	-2.790000	0.00767	-1.377000	0.02123	-1.008000	0.02478	ATG	.		0.592	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369	
GFRA4	64096	hgsc.bcm.edu	37	20	3641542	3641542	+	Silent	SNP	G	G	A	rs58634535	byFrequency	TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr20:3641542G>A	ENST00000319242.3	-	2	440	c.441C>T	c.(439-441)ctC>ctT	p.L147L	GFRA4_ENST00000290417.2_Intron			Q9GZZ7	GFRA4_HUMAN	GDNF family receptor alpha 4	147					negative regulation of ossification (GO:0030279)	anchored component of membrane (GO:0031225)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	glial cell-derived neurotrophic factor receptor activity (GO:0016167)			large_intestine(1)|lung(2)	3						GAGCCGGAGAGAGGCCCCGTC	0.761													G|||	1080	0.215655	0.2897	0.2075	5008	,	,		6888	0.2163		0.16	False		,,,				2504	0.1779				p.L147L		.											.	GFRA4-90	0			c.C441T						.	G	,	373,1901		10,353,774	1.0	2.0	2.0		,441	1.0	0.0	20	dbSNP_129	2	558,4460		15,528,1966	no	intron,coding-synonymous	GFRA4	NM_022139.3,NM_145762.2	,	25,881,2740	AA,AG,GG		11.12,16.4028,12.7674	,	,147/300	3641542	931,6361	1137	2509	3646	SO:0001819	synonymous_variant	64096	exon2			CGGAGAGAGGCCC	AF253318	CCDS13055.1, CCDS13056.1	20p13-p12	2008-07-16			ENSG00000125861	ENSG00000125861			13821	protein-coding gene	gene with protein product	"""persephin receptor"""					10958791, 15225646	Standard	XM_005260793		Approved		uc002win.3	Q9GZZ7	OTTHUMG00000031748	ENST00000319242.3:c.441C>T	20.37:g.3641542G>A		3	1		4	4	NM_145762	0	0	0	0	0	Q5JT74|Q9H191|Q9H192	Silent	SNP	ENST00000319242.3	37	CCDS13056.1																																																																																			G|0.788;A|0.212		0.761	GFRA4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077744.1	NM_145762	
LTN1	26046	hgsc.bcm.edu	37	21	30339122	30339122	+	Missense_Mutation	SNP	T	T	C			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr21:30339122T>C	ENST00000361371.5	-	10	1770	c.1691A>G	c.(1690-1692)gAa>gGa	p.E564G	LTN1_ENST00000389195.2_Missense_Mutation_p.E610G|LTN1_ENST00000389194.2_Missense_Mutation_p.E610G			O94822	LTN1_HUMAN	listerin E3 ubiquitin protein ligase 1	564					protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(12)|lung(19)|ovary(5)|pancreas(1)|prostate(2)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)	60						TTCCCAGCCTTCAATCTTCTC	0.348																																					p.E610G		.											.	LTN1-530	0			c.A1829G						.						59.0	55.0	56.0					21																	30339122		2203	4300	6503	SO:0001583	missense	26046	exon10			CAGCCTTCAATCT	AK001915	CCDS33527.1, CCDS33527.2	21q21.3	2013-01-09	2010-09-17	2010-09-17	ENSG00000198862	ENSG00000198862		"""RING-type (C3HC4) zinc fingers"""	13082	protein-coding gene	gene with protein product	"""listerin"""	613083	"""chromosome 21 open reading frame 98"", ""zinc finger protein 294"", ""ring finger protein 160"""	C21orf98, C21orf10, ZNF294, RNF160		20835226, 19196968	Standard	NM_015565		Approved	KIAA0714, FLJ11053, LISTERIN	uc002ymr.2	O94822	OTTHUMG00000078803	ENST00000361371.5:c.1691A>G	21.37:g.30339122T>C	ENSP00000354977:p.Glu564Gly	122	0		36	2	NM_015565	0	0	0	0	0	A6NL41|A7E2D0|B2RTS0|C9J7U3|J3KPL4|Q05C47|Q9H8M4|Q9NUY5|Q9P0E9	Missense_Mutation	SNP	ENST00000361371.5	37		.	.	.	.	.	.	.	.	.	.	T	3.601	-0.081617	0.07141	.	.	ENSG00000198862	ENST00000389194;ENST00000361371;ENST00000389195	T;T;T	0.26373	2.08;2.09;1.74	4.75	2.26	0.28386	.	0.523268	0.20481	N	0.091497	T	0.11153	0.0272	N	0.14661	0.345	0.09310	N	1	B	0.24258	0.1	B	0.19148	0.024	T	0.26155	-1.0111	10	0.20046	T	0.44	.	4.0986	0.10004	0.1787:0.0971:0.0:0.7242	.	564	O94822	LTN1_HUMAN	G	610;564;610	ENSP00000373846:E610G;ENSP00000354977:E564G;ENSP00000373847:E610G	ENSP00000354977:E564G	E	-	2	0	LTN1	29260993	0.000000	0.05858	0.003000	0.11579	0.003000	0.03518	0.551000	0.23361	0.357000	0.24183	0.528000	0.53228	GAA	.		0.348	LTN1-008	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000472108.1	NM_015565	
SCAF4	57466	ucsc.edu	37	21	33044135	33044135	+	Silent	SNP	A	A	G			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr21:33044135A>G	ENST00000286835.7	-	20	3403	c.3021T>C	c.(3019-3021)aaT>aaC	p.N1007N	SCAF4_ENST00000399804.1_Silent_p.N985N|SCAF4_ENST00000434667.3_Silent_p.N992N	NM_020706.2	NP_065757.1	O95104	SFR15_HUMAN	SR-related CTD-associated factor 4	1007						nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(11)|lung(15)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	54						TTTCCACCCTATTTCCAAAAG	0.478																																					p.N1007N													.	SCAF4-90	0			c.T3021C						.						145.0	144.0	144.0					21																	33044135		2203	4300	6503	SO:0001819	synonymous_variant	57466	exon20			CACCCTATTTCCA	AB032998	CCDS33537.1, CCDS46644.1, CCDS54482.1	21q22.1	2013-02-12	2011-01-10	2011-01-10	ENSG00000156304	ENSG00000156304		"""RNA binding motif (RRM) containing"""	19304	protein-coding gene	gene with protein product			"""splicing factor, arginine/serine-rich 15"""	SFRS15		10574461	Standard	NM_020706		Approved	KIAA1172, DKFZp434E098, SRA4	uc002ypd.2	O95104	OTTHUMG00000084903	ENST00000286835.7:c.3021T>C	21.37:g.33044135A>G		296	0		372	1	NM_020706	0	0	10	10	0	C9JLZ0|Q0P5W8|Q6P1M5|Q8N3I8|Q9UFM1|Q9ULP8	Silent	SNP	ENST00000286835.7	37	CCDS33537.1																																																																																			.		0.478	SCAF4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000192659.1	XM_047889	
THOC5	8563	ucsc.edu	37	22	29924124	29924124	+	Missense_Mutation	SNP	G	G	A			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr22:29924124G>A	ENST00000490103.1	-	11	1131	c.1009C>T	c.(1009-1011)Cgc>Tgc	p.R337C	THOC5_ENST00000397871.1_Missense_Mutation_p.R337C|CTA-256D12.11_ENST00000411969.1_RNA|THOC5_ENST00000397872.1_Missense_Mutation_p.R337C|THOC5_ENST00000397873.2_Missense_Mutation_p.R337C	NM_003678.4	NP_003669.4	Q13769	THOC5_HUMAN	THO complex 5	337					blastocyst development (GO:0001824)|cell morphogenesis (GO:0000902)|monocyte differentiation (GO:0030224)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|negative regulation of DNA damage checkpoint (GO:2000002)|negative regulation of macrophage differentiation (GO:0045650)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|primitive hemopoiesis (GO:0060215)|regulation of mRNA export from nucleus (GO:0010793)|regulation of stem cell division (GO:2000035)|RNA splicing (GO:0008380)|stem cell division (GO:0017145)|viral mRNA export from host cell nucleus (GO:0046784)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	mRNA binding (GO:0003729)			NS(1)|breast(4)|cervix(1)|endometrium(2)|large_intestine(4)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						ATCTCCTTGCGTTTGTCGTCC	0.527																																					p.R337C													.	THOC5-585	0			c.C1009T						.						130.0	116.0	121.0					22																	29924124		2203	4300	6503	SO:0001583	missense	8563	exon12			CCTTGCGTTTGTC	AB023200	CCDS13859.1	22q12	2013-02-11			ENSG00000100296	ENSG00000100296		"""THO complex subunits"""	19074	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 79"""	612733	"""chromosome 22 open reading frame 19"""	C22orf19		11979277, 8242058, 10231032, 19015024, 18373705	Standard	NM_003678		Approved	PK1.3, KIAA0983, Fmip, fSAP79	uc003afs.3	Q13769	OTTHUMG00000151291	ENST00000490103.1:c.1009C>T	22.37:g.29924124G>A	ENSP00000420306:p.Arg337Cys	205	0		204	1	NM_001002878	0	0	2	7	5	O60839|Q9UPZ5	Missense_Mutation	SNP	ENST00000490103.1	37	CCDS13859.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.7|21.7	4.188467|4.188467	0.78789|0.78789	.|.	.|.	ENSG00000100296|ENSG00000100296	ENST00000490103;ENST00000397872;ENST00000397871;ENST00000397873|ENST00000443089	T;T;T;T|.	0.26373|.	1.74;1.74;1.74;1.74|.	4.99|4.99	3.95|3.95	0.45737|0.45737	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.73102|0.73102	0.3544|0.3544	M|M	0.77103|0.77103	2.36|2.36	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.73380|.	0.98|.	T|T	0.74402|0.74402	-0.3677|-0.3677	10|5	0.72032|.	D|.	0.01|.	-14.3349|-14.3349	12.6222|12.6222	0.56610|0.56610	0.0:0.0:0.6985:0.3015|0.0:0.0:0.6985:0.3015	.|.	337|.	Q13769|.	THOC5_HUMAN|.	C|M	337|207	ENSP00000420306:R337C;ENSP00000380970:R337C;ENSP00000380969:R337C;ENSP00000380971:R337C|.	ENSP00000380969:R337C|.	R|T	-|-	1|2	0|0	THOC5|THOC5	28254124|28254124	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.913000|0.913000	0.54294|0.54294	3.368000|3.368000	0.52357|0.52357	1.310000|1.310000	0.45006|0.45006	0.552000|0.552000	0.68991|0.68991	CGC|ACG	.		0.527	THOC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322097.1	NM_003678	
EXOSC7	23016	ucsc.edu	37	3	45049021	45049021	+	Missense_Mutation	SNP	T	T	G			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr3:45049021T>G	ENST00000265564.7	+	7	773	c.725T>G	c.(724-726)gTg>gGg	p.V242G	CLEC3B_ENST00000490386.1_Intron|EXOSC7_ENST00000461361.1_3'UTR	NM_015004.3	NP_055819.2	Q15024	EXOS7_HUMAN	exosome component 7	242					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA catabolic process (GO:0006401)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA processing (GO:0006364)	cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|nucleus (GO:0005634)	3'-5'-exoribonuclease activity (GO:0000175)|RNA binding (GO:0003723)			endometrium(3)|large_intestine(1)|lung(3)	7				BRCA - Breast invasive adenocarcinoma(193;0.00911)|KIRC - Kidney renal clear cell carcinoma(197;0.0509)|Kidney(197;0.064)		ATGAGGAAAGTGGGGAAGGGC	0.612																																					p.V242G													.	EXOSC7-90	0			c.T725G						.						105.0	86.0	93.0					3																	45049021		2203	4300	6503	SO:0001583	missense	23016	exon7			GGAAAGTGGGGAA	BC012831	CCDS2725.1	3p21.32	2010-05-07			ENSG00000075914	ENSG00000075914	3.1.13.-		28112	protein-coding gene	gene with protein product		606488				11719186, 11812149	Standard	NR_023353		Approved	hRrp42p, Rrp42p, RRP42, EAP1, KIAA0116, p8	uc003coi.2	Q15024	OTTHUMG00000133095	ENST00000265564.7:c.725T>G	3.37:g.45049021T>G	ENSP00000265564:p.Val242Gly	61	0		71	2	NM_015004	0	0	0	0	0	Q96E72	Missense_Mutation	SNP	ENST00000265564.7	37	CCDS2725.1	.	.	.	.	.	.	.	.	.	.	T	13.38	2.218944	0.39201	.	.	ENSG00000075914	ENST00000265564	T	0.43294	0.95	5.77	5.77	0.91146	Exoribonuclease, phosphorolytic domain 2 (1);	0.185749	0.49305	D	0.000151	T	0.28665	0.0710	N	0.16368	0.405	0.80722	D	1	B;B	0.06786	0.001;0.001	B;B	0.08055	0.003;0.003	T	0.08994	-1.0695	10	0.17832	T	0.49	-15.0992	16.0957	0.81123	0.0:0.0:0.0:1.0	.	242;242	B2RDZ9;Q15024	.;EXOS7_HUMAN	G	242	ENSP00000265564:V242G	ENSP00000265564:V242G	V	+	2	0	EXOSC7	45024025	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.289000	0.72696	2.199000	0.70637	0.533000	0.62120	GTG	.		0.612	EXOSC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256754.2	NM_015004	
PFKFB4	5210	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	48577177	48577177	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr3:48577177C>A	ENST00000232375.3	-	5	518	c.406G>T	c.(406-408)Gaa>Taa	p.E136*	PFKFB4_ENST00000541519.1_Nonsense_Mutation_p.E102*|PFKFB4_ENST00000536104.1_Nonsense_Mutation_p.E125*|PFKFB4_ENST00000545984.1_Missense_Mutation_p.E113D|PFKFB4_ENST00000490115.1_5'UTR|PFKFB4_ENST00000383734.2_Nonsense_Mutation_p.E136*|PFKFB4_ENST00000416568.1_Nonsense_Mutation_p.E136*	NM_004567.2	NP_004558.1	Q16877	F264_HUMAN	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4	136	6-phosphofructo-2-kinase.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|fructose metabolic process (GO:0006000)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	6-phosphofructo-2-kinase activity (GO:0003873)|ATP binding (GO:0005524)|fructose-2,6-bisphosphate 2-phosphatase activity (GO:0004331)			breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(5)|ovary(1)|urinary_tract(1)	14				BRCA - Breast invasive adenocarcinoma(193;0.0003)|KIRC - Kidney renal clear cell carcinoma(197;0.00596)|Kidney(197;0.00684)		GCTCTCCGTTCTCGGGTGGTG	0.567																																					p.E136X		.											.	PFKFB4-153	0			c.G406T						.						114.0	107.0	109.0					3																	48577177		2203	4300	6503	SO:0001587	stop_gained	5210	exon5			TCCGTTCTCGGGT	BC010269	CCDS2771.1	3p22-p21	2004-03-02			ENSG00000114268	ENSG00000114268			8875	protein-coding gene	gene with protein product		605320				8830046, 10095107	Standard	NM_004567		Approved		uc003ctv.3	Q16877	OTTHUMG00000133528	ENST00000232375.3:c.406G>T	3.37:g.48577177C>A	ENSP00000232375:p.Glu136*	143	0		124	49	NM_004567	0	0	0	0	0	Q5S3G5|Q5XLC2|Q64EX5	Nonsense_Mutation	SNP	ENST00000232375.3	37	CCDS2771.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.32|15.32	2.797337|2.797337	0.50208|0.50208	.|.	.|.	ENSG00000114268|ENSG00000114268	ENST00000545984|ENST00000232375;ENST00000536104;ENST00000416568;ENST00000383734;ENST00000541519;ENST00000452531;ENST00000412035	.|.	.|.	.|.	4.62|4.62	4.62|4.62	0.57501|0.57501	.|.	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	T|.	0.63307|.	0.2500|.	.|.	.|.	.|.	0.31708|0.31708	N|N	0.639831|0.639831	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.71906|.	-0.4451|.	6|.	0.02654|0.87932	T|D	1|0	-15.7704|-15.7704	15.0132|15.0132	0.71565|0.71565	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	D|X	113|136;125;136;136;102;125;102	.|.	ENSP00000437844:E113D|ENSP00000232375:E136X	E|E	-|-	3|1	2|0	PFKFB4|PFKFB4	48552181|48552181	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.769000|0.769000	0.43574|0.43574	7.645000|7.645000	0.83430|0.83430	2.419000|2.419000	0.82065|0.82065	0.467000|0.467000	0.42956|0.42956	GAG|GAA	.		0.567	PFKFB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257503.2	NM_004567	
NPRL2	10641	ucsc.edu	37	3	50385070	50385070	+	Missense_Mutation	SNP	T	T	A			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr3:50385070T>A	ENST00000232501.3	-	11	1548	c.1110A>T	c.(1108-1110)gaA>gaT	p.E370D	ZMYND10-AS1_ENST00000440013.1_RNA|ZMYND10_ENST00000360165.3_5'Flank|NPRL2_ENST00000493465.1_5'UTR|ZMYND10_ENST00000231749.3_5'Flank	NM_006545.4	NP_006536.3	Q8WTW4	NPRL2_HUMAN	nitrogen permease regulator-like 2 (S. cerevisiae)	370					negative regulation of kinase activity (GO:0033673)|protein phosphorylation (GO:0006468)		GTPase activator activity (GO:0005096)|protein kinase activity (GO:0004672)			breast(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|urinary_tract(1)	11						TGGGGTCATTTTCAAGCCGCT	0.577																																					p.E370D													.	NPRL2-278	0			c.A1110T						.						148.0	116.0	127.0					3																	50385070		2203	4300	6503	SO:0001583	missense	10641	exon11			GTCATTTTCAAGC	AF040708	CCDS2826.1	3p21.3	2010-03-30	2010-03-30	2010-03-30	ENSG00000114388	ENSG00000114388			24969	protein-coding gene	gene with protein product		607072	"""tumor suppressor candidate 4"""	TUSC4		11085536	Standard	NM_006545		Approved	NPR2L, NPR2	uc003daj.1	Q8WTW4	OTTHUMG00000156864	ENST00000232501.3:c.1110A>T	3.37:g.50385070T>A	ENSP00000232501:p.Glu370Asp	106	0		113	1	NM_006545	0	0	10	21	11	A8K831|Q6FGS2|Q9Y249|Q9Y497	Missense_Mutation	SNP	ENST00000232501.3	37	CCDS2826.1	.	.	.	.	.	.	.	.	.	.	T	12.95	2.090731	0.36855	.	.	ENSG00000114388	ENST00000232501	.	.	.	4.89	0.998	0.19857	.	0.050252	0.85682	D	0.000000	T	0.36635	0.0974	L	0.29908	0.895	0.53688	D	0.999977	B	0.06786	0.001	B	0.09377	0.004	T	0.07597	-1.0764	9	0.30854	T	0.27	-12.6028	4.0461	0.09773	0.0:0.3313:0.1858:0.4829	.	370	Q8WTW4	NPRL2_HUMAN	D	370	.	ENSP00000232501:E370D	E	-	3	2	NPRL2	50360074	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	1.528000	0.35985	0.455000	0.26910	0.459000	0.35465	GAA	.		0.577	NPRL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346299.1	NM_006545	
TKT	7086	hgsc.bcm.edu;broad.mit.edu	37	3	53264627	53264627	+	Missense_Mutation	SNP	C	C	T			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr3:53264627C>T	ENST00000462138.1	-	8	1041	c.953G>A	c.(952-954)cGc>cAc	p.R318H	TKT_ENST00000423516.1_Missense_Mutation_p.R326H|TKT_ENST00000296289.6_Missense_Mutation_p.R271H|TKT_ENST00000423525.2_Missense_Mutation_p.R318H|TKT_ENST00000461139.1_5'UTR			P29401	TKT_HUMAN	transketolase	318					carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|glyceraldehyde-3-phosphate biosynthetic process (GO:0046166)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, non-oxidative branch (GO:0009052)|regulation of growth (GO:0040008)|small molecule metabolic process (GO:0044281)|xylulose biosynthetic process (GO:0005999)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|peroxisome (GO:0005777)|vesicle (GO:0031982)	cofactor binding (GO:0048037)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|transketolase activity (GO:0004802)			endometrium(5)|large_intestine(4)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	17		Prostate(884;0.0959)		BRCA - Breast invasive adenocarcinoma(193;0.000159)|OV - Ovarian serous cystadenocarcinoma(275;0.000314)|Kidney(197;0.00178)|KIRC - Kidney renal clear cell carcinoma(197;0.00201)		GTAGGCCTTGCGGGTGGCTAT	0.587																																					p.R326H	Colon(133;1506 2347 35238 42177)	.											.	TKT-92	0			c.G977A						.						59.0	56.0	57.0					3																	53264627		2203	4300	6503	SO:0001583	missense	7086	exon9			GCCTTGCGGGTGG		CCDS2871.1, CCDS58834.1	3p14.3	2008-07-31	2008-07-31		ENSG00000163931	ENSG00000163931	2.2.1.1		11834	protein-coding gene	gene with protein product	"""Wernicke-Korsakoff syndrome"""	606781				1567394	Standard	NM_001064		Approved		uc011beq.2	P29401	OTTHUMG00000158192	ENST00000462138.1:c.953G>A	3.37:g.53264627C>T	ENSP00000417773:p.Arg318His	72	0		98	6	NM_001258028	0	0	1	1	0	A8K089|B4DE31|E7EPA7|Q8TBA3|Q96HH3	Missense_Mutation	SNP	ENST00000462138.1	37	CCDS2871.1	.	.	.	.	.	.	.	.	.	.	C	35	5.563617	0.96527	.	.	ENSG00000163931	ENST00000462138;ENST00000423525;ENST00000423516;ENST00000296289;ENST00000414014	D;D;D;D	0.92965	-3.14;-3.14;-3.14;-3.14	5.69	5.69	0.88448	Transketolase-like, pyrimidine-binding domain (2);	0.047547	0.85682	D	0.000000	D	0.97763	0.9266	H	0.97682	4.055	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.72338	0.963;0.977;0.971	D	0.98701	1.0700	10	0.87932	D	0	-15.8701	19.8045	0.96525	0.0:1.0:0.0:0.0	.	326;235;318	E7EPA7;B3KSI4;P29401	.;.;TKT_HUMAN	H	318;318;326;271;152	ENSP00000417773:R318H;ENSP00000405455:R318H;ENSP00000391481:R326H;ENSP00000296289:R271H	ENSP00000296289:R271H	R	-	2	0	TKT	53239667	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.818000	0.86416	2.676000	0.91093	0.655000	0.94253	CGC	.		0.587	TKT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350356.1		
PPP4R2	151987	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	73110176	73110176	+	Missense_Mutation	SNP	T	T	A			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr3:73110176T>A	ENST00000356692.5	+	5	637	c.384T>A	c.(382-384)aaT>aaA	p.N128K	PPP4R2_ENST00000394284.3_Missense_Mutation_p.N71K|PPP4R2_ENST00000295862.9_Missense_Mutation_p.N72K|EBLN2_ENST00000533473.1_5'Flank			Q9NY27	PP4R2_HUMAN	protein phosphatase 4, regulatory subunit 2	128					cellular protein modification process (GO:0006464)|hematopoietic progenitor cell differentiation (GO:0002244)|mRNA processing (GO:0006397)|regulation of catalytic activity (GO:0050790)|regulation of double-strand break repair via homologous recombination (GO:0010569)|RNA splicing (GO:0008380)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein phosphatase 4 complex (GO:0030289)	protein binding, bridging (GO:0030674)|protein phosphatase type 4 regulator activity (GO:0030362)			breast(2)|endometrium(1)|large_intestine(1)|lung(3)|skin(2)|stomach(1)|urinary_tract(2)	12		Prostate(10;0.0187)|Lung SC(41;0.236)		Epithelial(33;1.76e-07)|BRCA - Breast invasive adenocarcinoma(55;9.42e-05)|LUSC - Lung squamous cell carcinoma(21;0.00211)|Lung(16;0.00643)|KIRC - Kidney renal clear cell carcinoma(39;0.0164)|Kidney(39;0.0193)|OV - Ovarian serous cystadenocarcinoma(275;0.031)		TATTGCAGAATGTGATGGTTG	0.259																																					p.N128K		.											.	PPP4R2-227	0			c.T384A						.						102.0	96.0	98.0					3																	73110176		2199	4292	6491	SO:0001583	missense	151987	exon5			GCAGAATGTGATG	AJ271448	CCDS2917.1	3q29	2010-06-18			ENSG00000163605	ENSG00000163605		"""Serine/threonine phosphatases / Protein phosphatase 4, regulatory subunits"""	18296	protein-coding gene	gene with protein product		613822				10769191	Standard	NM_174907		Approved		uc003dph.1	Q9NY27	OTTHUMG00000158816	ENST00000356692.5:c.384T>A	3.37:g.73110176T>A	ENSP00000349124:p.Asn128Lys	68	0		34	8	NM_174907	0	0	0	0	0	A8K1I6|Q2TAJ9|Q498B8|Q8WXX6	Missense_Mutation	SNP	ENST00000356692.5	37	CCDS2917.1	.	.	.	.	.	.	.	.	.	.	T	17.55	3.417029	0.62511	.	.	ENSG00000163605	ENST00000356692;ENST00000488810;ENST00000394284;ENST00000295862	T;T;T;T	0.54071	0.59;0.59;0.59;0.59	4.96	2.54	0.30619	.	0.000000	0.85682	D	0.000000	T	0.57036	0.2026	M	0.86178	2.8	0.80722	D	1	P;P	0.39903	0.694;0.505	B;B	0.41374	0.353;0.355	T	0.59467	-0.7449	10	0.72032	D	0.01	.	9.3514	0.38140	0.0:0.1471:0.0:0.8529	.	71;128	Q9NY27-2;Q9NY27	.;PP4R2_HUMAN	K	128;128;71;72	ENSP00000349124:N128K;ENSP00000418750:N128K;ENSP00000377825:N71K;ENSP00000295862:N72K	ENSP00000295862:N72K	N	+	3	2	PPP4R2	73192866	1.000000	0.71417	1.000000	0.80357	0.829000	0.46940	3.134000	0.50538	0.329000	0.23460	-0.297000	0.09499	AAT	.		0.259	PPP4R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352321.1	NM_174907	
MED12L	116931	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	151072983	151072983	+	Missense_Mutation	SNP	C	C	T	rs200848773		TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr3:151072983C>T	ENST00000474524.1	+	16	2406	c.2368C>T	c.(2368-2370)Ctc>Ttc	p.L790F	MED12L_ENST00000273432.4_Missense_Mutation_p.L650F|MED12L_ENST00000491549.1_3'UTR|P2RY12_ENST00000302632.3_Intron	NM_053002.4	NP_443728.3	Q86YW9	MD12L_HUMAN	mediator complex subunit 12-like	790						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(27)|lung(50)|ovary(6)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	128			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			GTTCACTAAACTCCAGCTCCT	0.358																																					p.L790F		.											.	MED12L-576	0			c.C2368T						.						103.0	104.0	103.0					3																	151072983		2203	4300	6503	SO:0001583	missense	116931	exon16			ACTAAACTCCAGC	AB046855, AF388364	CCDS33876.1	3q25.1	2007-07-30	2007-07-30		ENSG00000144893	ENSG00000144893			16050	protein-coding gene	gene with protein product		611318	"""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)-like"""			11524702	Standard	XM_006713487		Approved	KIAA1635, TNRC11L, TRALPUSH, TRALP	uc003eyp.3	Q86YW9	OTTHUMG00000159844	ENST00000474524.1:c.2368C>T	3.37:g.151072983C>T	ENSP00000417235:p.Leu790Phe	151	0		61	17	NM_053002	0	0	0	0	0	Q96PC7|Q96PC8|Q9H9M5|Q9HCD7|Q9UI69	Missense_Mutation	SNP	ENST00000474524.1	37	CCDS33876.1	.	.	.	.	.	.	.	.	.	.	C	3.897	-0.022893	0.07634	.	.	ENSG00000144893	ENST00000474524;ENST00000273432	T;T	0.71341	-0.56;-0.56	5.35	5.35	0.76521	.	0.059800	0.64402	D	0.000002	T	0.31918	0.0812	N	0.00186	-1.895	0.80722	D	1	B;B	0.15141	0.006;0.012	B;B	0.17098	0.017;0.012	T	0.46830	-0.9163	10	0.11182	T	0.66	-18.4403	12.407	0.55445	0.0:0.922:0.0:0.078	.	650;790	F8WAE6;Q86YW9	.;MD12L_HUMAN	F	790;650	ENSP00000417235:L790F;ENSP00000273432:L650F	ENSP00000273432:L650F	L	+	1	0	MED12L	152555673	1.000000	0.71417	1.000000	0.80357	0.545000	0.35147	3.177000	0.50871	2.656000	0.90262	0.650000	0.86243	CTC	C|0.999;G|0.001		0.358	MED12L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357707.2	NM_053002	
SLC6A18	348932	broad.mit.edu	37	5	1244416	1244416	+	Missense_Mutation	SNP	C	C	T			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr5:1244416C>T	ENST00000324642.3	+	10	1547	c.1424C>T	c.(1423-1425)gCc>gTc	p.A475V	SLC6A18_ENST00000296821.4_Missense_Mutation_p.A373V	NM_182632.2	NP_872438.2	Q96N87	S6A18_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 18	475					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)			endometrium(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(4)|upper_aerodigestive_tract(1)	34	all_cancers(3;2.99e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.76e-10)		Epithelial(17;0.000356)|all cancers(22;0.00124)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			GACAATTTTGCCGCTTCCCCG	0.582																																					p.A475V													.	SLC6A18-91	0			c.C1424T						.						147.0	147.0	147.0					5																	1244416		2203	4300	6503	SO:0001583	missense	348932	exon10			ATTTTGCCGCTTC	AK055798	CCDS3860.1	5p15	2013-07-19	2013-07-19		ENSG00000164363	ENSG00000164363		"""Solute carriers"""	26441	protein-coding gene	gene with protein product		610300	"""solute carrier family 6 (neurotransmitter transporter), member 18"", ""solute carrier family 6, member 18"""			19478081	Standard	NM_182632		Approved	FLJ31236, Xtrp2	uc003jby.2	Q96N87	OTTHUMG00000090356	ENST00000324642.3:c.1424C>T	5.37:g.1244416C>T	ENSP00000323549:p.Ala475Val	214	1		246	5	NM_182632	0	0	1	1	0		Missense_Mutation	SNP	ENST00000324642.3	37	CCDS3860.1	.	.	.	.	.	.	.	.	.	.	C	12.56	1.975383	0.34848	.	.	ENSG00000164363	ENST00000324642;ENST00000296821	T;T	0.76578	-1.03;-1.03	4.87	-1.66	0.08265	.	0.373560	0.27126	N	0.020814	T	0.58177	0.2104	N	0.21617	0.685	0.09310	N	1	B	0.16802	0.019	B	0.15052	0.012	T	0.49341	-0.8950	10	0.87932	D	0	.	5.9492	0.19235	0.0:0.3423:0.141:0.5167	.	475	Q96N87	S6A18_HUMAN	V	475;373	ENSP00000323549:A475V;ENSP00000296821:A373V	ENSP00000296821:A373V	A	+	2	0	SLC6A18	1297416	0.226000	0.23696	0.000000	0.03702	0.001000	0.01503	0.643000	0.24750	-0.361000	0.08125	-1.036000	0.02392	GCC	.		0.582	SLC6A18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206728.3	NM_182632	
HIST1H2BL	8340	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	27775403	27775403	+	Silent	SNP	C	C	T	rs141648774		TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr6:27775403C>T	ENST00000377401.2	-	1	306	c.282G>A	c.(280-282)gaG>gaA	p.E94E	HIST1H3H_ENST00000369163.2_5'Flank|HIST1H2AI_ENST00000358739.3_5'Flank	NM_003519.3	NP_003510.1	Q99880	H2B1L_HUMAN	histone cluster 1, H2bl	94					chromatin organization (GO:0006325)|nucleosome assembly (GO:0006334)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(1)|large_intestine(2)|lung(7)|urinary_tract(1)	12						CGGTCTGGATCTCCCTGGAGG	0.617																																					p.E94E		.											.	HIST1H2BL-90	0			c.G282A						.						92.0	94.0	93.0					6																	27775403		2203	4300	6503	SO:0001819	synonymous_variant	8340	exon1			CTGGATCTCCCTG	Z83740	CCDS4625.1	6p22.1	2011-01-27	2006-10-11	2003-02-28	ENSG00000185130	ENSG00000185130		"""Histones / Replication-dependent"""	4748	protein-coding gene	gene with protein product		602800	"""H2B histone family, member C"", ""histone 1, H2bl"""	H2BFC		9439656, 12408966	Standard	NM_003519		Approved	H2B/c, dJ97D16.4	uc003njl.3	Q99880	OTTHUMG00000014485	ENST00000377401.2:c.282G>A	6.37:g.27775403C>T		176	0		197	143	NM_003519	0	0	0	6	6	B2R5A3|Q52LW9	Silent	SNP	ENST00000377401.2	37	CCDS4625.1																																																																																			C|1.000;A|0.000		0.617	HIST1H2BL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040153.1	NM_003519	
HLA-C	3107	hgsc.bcm.edu	37	6	31239420	31239420	+	Missense_Mutation	SNP	A	A	T	rs41550619		TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr6:31239420A>T	ENST00000376228.5	-	2	313	c.299T>A	c.(298-300)gTg>gAg	p.V100E	HLA-C_ENST00000383329.3_Missense_Mutation_p.V100E	NM_002117.5	NP_002108.4	Q95604	1C17_HUMAN	major histocompatibility complex, class I, C	100	Alpha-1.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	17						CCGCAGGCTCACTCGGTCAGC	0.706																																					p.V100E		.											.	HLA-C-90	0			c.T299A						.						43.0	44.0	43.0					6																	31239420		1511	2709	4220	SO:0001583	missense	3107	exon2			AGGCTCACTCGGT	M11886	CCDS34393.1	6p21.3	2014-01-30			ENSG00000204525	ENSG00000204525		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4933	protein-coding gene	gene with protein product		142840	"""psoriasis susceptibility 1"""	HLA-JY3, D6S204, PSORS1		3863816, 16642438	Standard	NM_001243042		Approved		uc003nsy.3	P04222	OTTHUMG00000031154	ENST00000376228.5:c.299T>A	6.37:g.31239420A>T	ENSP00000365402:p.Val100Glu	80	1		149	10	NM_002117	0	0	140	140	0	O02864|O02958|Q29643|Q9MY30	Missense_Mutation	SNP	ENST00000376228.5	37	CCDS34393.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	N|N	11.64|11.64	1.699559|1.699559	0.30142|0.30142	.|.	.|.	ENSG00000204525|ENSG00000204525	ENST00000415537|ENST00000376228;ENST00000383329;ENST00000396254;ENST00000539307	.|T;T	.|0.00695	.|5.83;5.83	2.81|2.81	0.196|0.196	0.15159|0.15159	.|MHC class I, alpha chain, alpha1/alpha2 (2);MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	.|0.811394	.|0.09501	.|U	.|0.793662	T|T	0.00695|0.00695	0.0023|0.0023	L|L	0.59967|0.59967	1.855|1.855	0.09310|0.09310	N|N	1|1	.|D;B;D;B	.|0.71674	.|0.998;0.004;0.998;0.019	.|D;B;D;B	.|0.87578	.|0.998;0.047;0.998;0.078	T|T	0.42682|0.42682	-0.9437|-0.9437	5|10	.|0.09843	.|T	.|0.71	.|.	3.1169|3.1169	0.06377|0.06377	0.6065:0.2501:0.1435:0.0|0.6065:0.2501:0.1435:0.0	rs41550619|rs41550619	.|100;100;100;100	.|A2AEA4;A6H578;A2AEA2;P10321	.|.;.;.;1C07_HUMAN	R|E	99|100;100;100;137	.|ENSP00000365402:V100E;ENSP00000372819:V100E	.|ENSP00000365402:V100E	S|V	-|-	3|2	2|0	HLA-C|HLA-C	31347399|31347399	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.015000|0.015000	0.08874|0.08874	-3.401000|-3.401000	0.00483|0.00483	0.042000|0.042000	0.15717|0.15717	0.254000|0.254000	0.18369|0.18369	AGT|GTG	.		0.706	HLA-C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076281.3	NM_002117	
LY6G6F	259215	broad.mit.edu	37	6	31675742	31675742	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr6:31675742G>A	ENST00000375832.4	+	3	499	c.477G>A	c.(475-477)tgG>tgA	p.W159*	MEGT1_ENST00000503322.1_Nonsense_Mutation_p.W159*|LY6G6F_ENST00000556581.1_Nonsense_Mutation_p.W159*|XXbac-BPG32J3.20_ENST00000461287.1_Intron	NM_001003693.1	NP_001003693.1	Q5SQ64	LY66F_HUMAN	lymphocyte antigen 6 complex, locus G6F	159						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(4)	12						CTGTGACCTGGCAGGAAGGGA	0.617																																					p.W159X													.	LY6G6F-567	0			c.G477A						.						89.0	87.0	88.0					6																	31675742		1511	2709	4220	SO:0001587	stop_gained	259215	exon3			GACCTGGCAGGAA		CCDS34403.1	6p21	2013-01-11	2008-05-21	2008-05-21		ENSG00000204424		"""Immunoglobulin superfamily / V-set domain containing"""	13933	protein-coding gene	gene with protein product		611404	"""chromosome 6 open reading frame 21"""	LY6G6D, C6orf21		12852788	Standard	NM_001003693		Approved	G6f, NG32	uc003nwa.1	Q5SQ64	OTTHUMG00000031252	ENST00000375832.4:c.477G>A	6.37:g.31675742G>A	ENSP00000364992:p.Trp159*	173	1		228	6	NM_001003693	0	0	0	0	0	B0UXB7|O95869|Q7Z5H2|Q96QC7|Q9NZJ1	Nonsense_Mutation	SNP	ENST00000375832.4	37	CCDS34403.1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.708008	0.89018	.	.	ENSG00000204424;ENSG00000204424;ENSG00000250641	ENST00000556581;ENST00000375832;ENST00000503322	.	.	.	5.5	5.5	0.81552	.	0.000000	0.64402	D	0.000017	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.5869	14.8659	0.70416	0.0:0.0:1.0:0.0	.	.	.	.	X	159	.	ENSP00000364992:W159X	W	+	3	0	XXbac-BPG32J3.19;LY6G6F	31783721	1.000000	0.71417	0.999000	0.59377	0.475000	0.33008	4.259000	0.58828	2.596000	0.87737	0.591000	0.81541	TGG	.		0.617	LY6G6F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076532.2	NM_001003693	
HLA-DRB5	3127	hgsc.bcm.edu	37	6	32489853	32489853	+	Silent	SNP	A	A	G	rs78961241	byFrequency	TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr6:32489853A>G	ENST00000374975.3	-	2	261	c.199T>C	c.(199-201)Ttg>Ctg	p.L67L		NM_002125.3	NP_002116.2			major histocompatibility complex, class II, DR beta 5											NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|pancreas(1)|prostate(1)|stomach(2)	10						TCGAAGCGCAAGTCCTCCTCT	0.577																																					p.L67L		.											.	HLA-DRB5-90	0			c.T199C						.						36.0	33.0	34.0					6																	32489853		1895	3648	5543	SO:0001819	synonymous_variant	3127	exon2			AGCGCAAGTCCTC		CCDS4751.1	6p21.3	2013-01-11			ENSG00000198502	ENSG00000198502		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4953	protein-coding gene	gene with protein product		604776					Standard	NM_002125		Approved		uc003obj.3	Q30154	OTTHUMG00000031027	ENST00000374975.3:c.199T>C	6.37:g.32489853A>G		5	2		8	8	NM_002125	0	0	0	0	0		Silent	SNP	ENST00000374975.3	37	CCDS4751.1																																																																																			A|0.266;C|0.734		0.577	HLA-DRB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076022.2	NM_002125	
DEFB112	245915	hgsc.bcm.edu	37	6	50011485	50011485	+	Missense_Mutation	SNP	T	T	C			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr6:50011485T>C	ENST00000322246.4	-	2	144	c.145A>G	c.(145-147)Agt>Ggt	p.S49G		NM_001037498.1	NP_001032587.1	Q30KQ8	DB112_HUMAN	defensin, beta 112	49					defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)				central_nervous_system(1)|large_intestine(3)|lung(12)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	19	Lung NSC(77;0.042)					TTCCACCTACTAAAGGTGATA	0.408																																					p.S49G		.											.	DEFB112-90	0			c.A145G						.						157.0	127.0	137.0					6																	50011485		2203	4300	6503	SO:0001583	missense	245915	exon2			ACCTACTAAAGGT	DQ012016	CCDS34476.1	6p12.3	2010-03-30			ENSG00000180872	ENSG00000180872		"""Defensins, beta"""	18093	protein-coding gene	gene with protein product						11854508, 16033865	Standard	NM_001037498		Approved	DEFB-12	uc011dws.2	Q30KQ8	OTTHUMG00000160215	ENST00000322246.4:c.145A>G	6.37:g.50011485T>C	ENSP00000319126:p.Ser49Gly	265	1		34	2	NM_001037498	0	0	0	0	0	Q8NET0	Missense_Mutation	SNP	ENST00000322246.4	37	CCDS34476.1	.	.	.	.	.	.	.	.	.	.	T	8.550	0.875373	0.17395	.	.	ENSG00000180872	ENST00000322246	T	0.22539	1.95	3.43	-1.99	0.07457	.	1.179380	0.06513	N	0.738451	T	0.03095	0.0091	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.44937	-0.9295	10	0.41790	T	0.15	-6.032	7.9034	0.29748	0.0:0.5629:0.0:0.4371	.	49	Q30KQ8	DB112_HUMAN	G	49	ENSP00000319126:S49G	ENSP00000319126:S49G	S	-	1	0	DEFB112	50119444	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.890000	0.04140	-0.360000	0.08138	-0.384000	0.06662	AGT	.		0.408	DEFB112-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359672.1	NM_001037498	
MLIP	90523	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	53989447	53989447	+	Silent	SNP	T	T	C			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr6:53989447T>C	ENST00000274897.5	+	3	509	c.396T>C	c.(394-396)atT>atC	p.I132I	MLIP_ENST00000370877.2_Silent_p.I80I|MLIP_ENST00000511744.1_3'UTR|MLIP_ENST00000502396.1_Silent_p.I143I|MLIP_ENST00000358276.5_Silent_p.I126I|MLIP_ENST00000370876.2_Silent_p.I70I|MLIP_ENST00000509997.1_Silent_p.I80I|MLIP_ENST00000514921.1_Silent_p.I132I	NM_138569.2	NP_612636.2	Q5VWP3	MLIP_HUMAN	muscular LMNA-interacting protein	132						nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|PML body (GO:0016605)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(16)|ovary(8)|skin(4)|stomach(1)|urinary_tract(1)	34						ATGTCCTTATTGTGGACTCCG	0.502																																					p.I132I		.											.	MLIP-99	0			c.T396C						.						100.0	99.0	100.0					6																	53989447		2203	4300	6503	SO:0001819	synonymous_variant	90523	exon3			CCTTATTGTGGAC	AK055530	CCDS4954.1, CCDS64448.1, CCDS64449.1	6p12.2-p12.1	2011-04-29	2011-04-29	2011-04-29	ENSG00000146147	ENSG00000146147			21355	protein-coding gene	gene with protein product	"""muscle-enriched A-type lamin interacting protein"""	614106	"""chromosome 6 open reading frame 142"""	C6orf142		21498514	Standard	NM_138569		Approved	MGC18257	uc011dxa.2	Q5VWP3	OTTHUMG00000014891	ENST00000274897.5:c.396T>C	6.37:g.53989447T>C		250	0		166	127	NM_138569	0	0	0	0	0	B7Z2N0|D6RE05|Q96H08|Q96NF7	Silent	SNP	ENST00000274897.5	37	CCDS4954.1																																																																																			.		0.502	MLIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040979.3	NM_138569	
TRRAP	8295	broad.mit.edu	37	7	98563408	98563408	+	Missense_Mutation	SNP	G	G	T			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr7:98563408G>T	ENST00000359863.4	+	48	7254	c.7045G>T	c.(7045-7047)Gcc>Tcc	p.A2349S	TRRAP_ENST00000355540.3_Missense_Mutation_p.A2331S|TRRAP_ENST00000446306.3_Missense_Mutation_p.A2331S	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	2349	Interaction with TP53.				chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)			NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			CTTCATCCAGGCCATCCTGAC	0.542																																					p.A2349S													.	TRRAP-923	0			c.G7045T						.						119.0	102.0	108.0					7																	98563408		2203	4300	6503	SO:0001583	missense	8295	exon48			ATCCAGGCCATCC	AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.7045G>T	7.37:g.98563408G>T	ENSP00000352925:p.Ala2349Ser	105	1		135	9	NM_001244580	0	0	0	0	0	A4D265|O75218|Q9Y631|Q9Y6H4	Missense_Mutation	SNP	ENST00000359863.4	37	CCDS59066.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.66|10.66	1.413760|1.413760	0.25465|0.25465	.|.	.|.	ENSG00000196367|ENSG00000196367	ENST00000359863;ENST00000355540;ENST00000446306|ENST00000456197	T;T|.	0.65549|.	-0.16;-0.16|.	6.02|6.02	4.21|4.21	0.49690|0.49690	Armadillo-like helical (1);|.	0.163532|.	0.56097|.	D|.	0.000038|.	T|T	0.28300|0.28300	0.0699|0.0699	N|N	0.08118|0.08118	0|0	0.32948|0.32948	D|D	0.519326|0.519326	B;B;B|.	0.12013|.	0.003;0.003;0.005|.	B;B;B|.	0.08055|.	0.003;0.002;0.002|.	T|T	0.36625|0.36625	-0.9740|-0.9740	10|5	0.07813|.	T|.	0.8|.	.|.	9.4337|9.4337	0.38626|0.38626	0.2161:0.0:0.7839:0.0|0.2161:0.0:0.7839:0.0	.|.	2331;2070;2349|.	Q9Y4A5-2;Q59FH1;Q9Y4A5|.	.;.;TRRAP_HUMAN|.	S|S	2349;2331;2330|2070	ENSP00000352925:A2349S;ENSP00000347733:A2331S|.	ENSP00000347733:A2331S|.	A|R	+|+	1|3	0|2	TRRAP|TRRAP	98401344|98401344	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	6.445000|6.445000	0.73456|0.73456	0.873000|0.873000	0.35799|0.35799	0.655000|0.655000	0.94253|0.94253	GCC|AGG	.		0.542	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317978.1	NM_003496	
NOS3	4846	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	150698913	150698913	+	Missense_Mutation	SNP	G	G	A			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr7:150698913G>A	ENST00000484524.1	+	12	1507	c.1507G>A	c.(1507-1509)Gtg>Atg	p.V503M	NOS3_ENST00000461406.1_Missense_Mutation_p.V297M|NOS3_ENST00000467517.1_Missense_Mutation_p.V503M|NOS3_ENST00000297494.3_Missense_Mutation_p.V503M	NM_001160111.1	NP_001153583.1	P60323	NANO3_HUMAN	nitric oxide synthase 3 (endothelial cell)	0					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic signaling pathway (GO:2001234)|oogenesis (GO:0048477)|regulation of cell cycle (GO:0051726)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(5)|endometrium(1)|kidney(4)|large_intestine(6)|liver(2)|lung(11)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	50	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CCGCAGCGCCGTGAAGATCTC	0.642																																					p.V503M		.											.	NOS3-1011	0			c.G1507A						.						53.0	51.0	52.0					7																	150698913		2203	4300	6503	SO:0001583	missense	4846	exon12			AGCGCCGTGAAGA		CCDS5912.1, CCDS55182.1, CCDS55183.1	7q36	2007-02-15			ENSG00000164867	ENSG00000164867	1.14.13.39		7876	protein-coding gene	gene with protein product	"""endothelial nitric oxide synthase"""	163729				1379542	Standard	NM_000603		Approved	ECNOS, eNOS	uc003wif.3	P29474	OTTHUMG00000158343	ENST00000484524.1:c.1507G>A	7.37:g.150698913G>A	ENSP00000420215:p.Val503Met	148	0		174	53	NM_001160111	0	0	0	0	0	Q495E5	Missense_Mutation	SNP	ENST00000484524.1	37	CCDS55182.1	.	.	.	.	.	.	.	.	.	.	G	19.87	3.907322	0.72868	.	.	ENSG00000164867	ENST00000297494;ENST00000461406;ENST00000484524;ENST00000467517	T;T;T;T	0.17691	4.46;4.33;2.67;2.26	4.8	4.8	0.61643	.	0.000000	0.48767	D	0.000162	T	0.48660	0.1512	M	0.89414	3.03	0.58432	D	0.99999	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.79784	0.98;0.98;0.991;0.993;0.991	T	0.58869	-0.7560	10	0.87932	D	0	-4.5235	15.7394	0.77876	0.0:0.0:1.0:0.0	.	503;503;503;297;503	A0S0A6;E9PFR2;A0S0A8;E7ESA7;P29474	.;.;.;.;NOS3_HUMAN	M	503;297;503;503	ENSP00000297494:V503M;ENSP00000417143:V297M;ENSP00000420215:V503M;ENSP00000420551:V503M	ENSP00000297494:V503M	V	+	1	0	NOS3	150329846	1.000000	0.71417	0.946000	0.38457	0.522000	0.34438	9.261000	0.95576	2.376000	0.81061	0.655000	0.94253	GTG	.		0.642	NOS3-004	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000351550.1	NM_000603	
OXR1	55074	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	107752622	107752622	+	Missense_Mutation	SNP	T	T	A			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr8:107752622T>A	ENST00000442977.2	+	13	2317	c.2218T>A	c.(2218-2220)Tat>Aat	p.Y740N	OXR1_ENST00000297447.6_Missense_Mutation_p.Y109N|OXR1_ENST00000521592.1_De_novo_Start_OutOfFrame|OXR1_ENST00000449762.2_Missense_Mutation_p.Y82N|OXR1_ENST00000445937.1_Missense_Mutation_p.Y712N|OXR1_ENST00000452423.2_Missense_Mutation_p.Y160N|OXR1_ENST00000517566.2_Missense_Mutation_p.Y739N|OXR1_ENST00000312046.6_Missense_Mutation_p.Y705N|OXR1_ENST00000531443.1_Missense_Mutation_p.Y712N	NM_001198532.1	NP_001185461.1	Q8N573	OXR1_HUMAN	oxidation resistance 1	740	TLD.				adult walking behavior (GO:0007628)|cellular response to hydroperoxide (GO:0071447)|negative regulation of neuron apoptotic process (GO:0043524)|response to oxidative stress (GO:0006979)	mitochondrion (GO:0005739)|nucleolus (GO:0005730)	oxidoreductase activity (GO:0016491)			NS(2)|breast(2)|endometrium(2)|large_intestine(9)|lung(10)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	31			OV - Ovarian serous cystadenocarcinoma(57;1.81e-09)			GACTCTTGTTTATGGTACTGG	0.383																																					p.Y740N		.											.	OXR1-68	0			c.T2218A						.						129.0	119.0	122.0					8																	107752622		2203	4300	6503	SO:0001583	missense	55074	exon13			CTTGTTTATGGTA	AF309387	CCDS6304.2, CCDS47909.1, CCDS56547.1, CCDS56548.1, CCDS56549.1, CCDS56550.1	8q23	2013-03-14			ENSG00000164830	ENSG00000164830			15822	protein-coding gene	gene with protein product	"""TBC/LysM-associated domain containing 3"""	605609				11114193	Standard	NM_181354		Approved	TLDC3	uc011lht.2	Q8N573	OTTHUMG00000167682	ENST00000442977.2:c.2218T>A	8.37:g.107752622T>A	ENSP00000405424:p.Tyr740Asn	234	0		75	11	NM_001198532	0	0	32	32	0	A6NK11|A8KA34|B3KXL1|B7Z402|B7Z8N5|D3HIS6|Q3LIB5|Q6ZVK9|Q8N8V0|Q9H266|Q9NWC7	Missense_Mutation	SNP	ENST00000442977.2	37	CCDS56548.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	25.4|25.4	4.629261|4.629261	0.87560|0.87560	.|.	.|.	ENSG00000164830|ENSG00000164830	ENST00000519415|ENST00000445937;ENST00000531443;ENST00000517566;ENST00000452423;ENST00000442977;ENST00000312046;ENST00000449762;ENST00000297447	.|T;T;T;T;T;T;T;T	.|0.54279	.|0.58;0.58;0.58;0.58;0.58;0.58;0.58;0.58	5.48|5.48	5.48|5.48	0.80851|0.80851	.|TLDc (2);	.|0.054965	.|0.85682	.|D	.|0.000000	T|T	0.82204|0.82204	0.4986|0.4986	H|H	0.97540|0.97540	4.025|4.025	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D;D	.|0.89917	.|0.999;0.999;1.0;0.999;0.992;0.998	.|D;D;D;D;D;D	.|0.81914	.|0.991;0.987;0.995;0.977;0.942;0.983	D|D	0.88810|0.88810	0.3291|0.3291	5|10	.|0.87932	.|D	.|0	-15.1603|-15.1603	15.5747|15.5747	0.76368|0.76368	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|705;740;739;82;109;712	.|Q8N573-2;Q8N573;D3HIS6;B7Z8N5;Q8N573-4;Q8N573-5	.|.;OXR1_HUMAN;.;.;.;.	L|N	383|712;712;739;160;740;705;82;109	.|ENSP00000402918:Y712N;ENSP00000431966:Y712N;ENSP00000429205:Y739N;ENSP00000395032:Y160N;ENSP00000405424:Y740N;ENSP00000311026:Y705N;ENSP00000408659:Y82N;ENSP00000297447:Y109N	.|ENSP00000297447:Y109N	F|Y	+|+	3|1	2|0	OXR1|OXR1	107821798|107821798	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	8.040000|8.040000	0.89188|0.89188	2.066000|2.066000	0.61787|0.61787	0.533000|0.533000	0.62120|0.62120	TTT|TAT	.		0.383	OXR1-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_181354	
AAED1	195827	hgsc.bcm.edu	37	9	99413724	99413724	+	Silent	SNP	T	T	C			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr9:99413724T>C	ENST00000375234.3	-	4	368	c.369A>G	c.(367-369)agA>agG	p.R123R	AAED1_ENST00000464512.1_5'UTR	NM_153698.1	NP_714542.1	Q7RTV5	AAED1_HUMAN	AhpC/TSA antioxidant enzyme domain containing 1	123																	TATAAATTTCTCTCTCAGGAT	0.353																																					p.R123R		.											.	.	0			c.A369G						.						68.0	65.0	66.0					9																	99413724		2202	4300	6502	SO:0001819	synonymous_variant	195827	exon4			AATTTCTCTCTCA	BK000255	CCDS35073.1	9q22.32	2013-01-07	2012-03-06	2012-03-06	ENSG00000158122	ENSG00000158122			16881	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 21"""	C9orf21			Standard	XM_005251783		Approved		uc004awm.3	Q7RTV5	OTTHUMG00000020299	ENST00000375234.3:c.369A>G	9.37:g.99413724T>C		106	0		57	3	NM_153698	0	0	9	9	0	B2RMW4|Q5JU02	Silent	SNP	ENST00000375234.3	37	CCDS35073.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	10.35|10.35	1.325957|1.325957	0.24080|0.24080	.|.	.|.	ENSG00000158122|ENSG00000158122	ENST00000411939|ENST00000446045	.|T	.|0.43688	.|0.94	4.72|4.72	4.72|4.72	0.59763|0.59763	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.51584|0.51584	0.1683|0.1683	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.49143|0.49143	-0.8970|-0.8970	4|6	.|.	.|.	.|.	-9.3239|-9.3239	13.3489|13.3489	0.60591|0.60591	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|.	.|.	.|.	G|G	51|77	.|ENSP00000398933:R77G	.|.	E|R	-|-	2|1	0|2	C9orf21|C9orf21	98453545|98453545	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	1.671000|1.671000	0.37513|0.37513	1.990000|1.990000	0.58119|0.58119	0.533000|0.533000	0.62120|0.62120	GAG|AGA	.		0.353	AAED1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053273.1	NM_153698	
AKNA	80709	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	117139726	117139726	+	Missense_Mutation	SNP	T	T	C	rs371041163		TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr9:117139726T>C	ENST00000307564.4	-	3	522	c.361A>G	c.(361-363)Act>Gct	p.T121A	AKNA_ENST00000312033.3_Missense_Mutation_p.T121A|AKNA_ENST00000223791.3_5'Flank|AKNA_ENST00000374075.5_Missense_Mutation_p.T40A|AKNA_ENST00000374088.3_Missense_Mutation_p.T121A	NM_030767.4	NP_110394.3	Q7Z591	AKNA_HUMAN	AT-hook transcription factor	121					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	membrane (GO:0016020)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(7)|liver(2)|lung(22)|ovary(4)|stomach(2)	51						TCCTCTTCAGTCATGTCCAGC	0.602																																					p.T121A		.											.	AKNA-94	0			c.A361G						.						44.0	45.0	45.0					9																	117139726		2203	4300	6503	SO:0001583	missense	80709	exon3			CTTCAGTCATGTC	AK024431	CCDS6805.1	9q32	2008-02-05			ENSG00000106948	ENSG00000106948			24108	protein-coding gene	gene with protein product		605729				11268217, 11853319	Standard	NM_030767		Approved	KIAA1968	uc004bis.3	Q7Z591	OTTHUMG00000020538	ENST00000307564.4:c.361A>G	9.37:g.117139726T>C	ENSP00000303769:p.Thr121Ala	129	0		163	84	NM_030767	0	0	0	0	0	Q05BK5|Q5T535|Q5T536|Q5T537|Q64FX6|Q64FX7|Q64FX8|Q64FY2|Q6ZMK0|Q6ZNL2|Q6ZTX0|Q8TET1|Q8TF33|Q96RR9|Q9H7P7	Missense_Mutation	SNP	ENST00000307564.4	37	CCDS6805.1	.	.	.	.	.	.	.	.	.	.	T	17.95	3.512748	0.64522	.	.	ENSG00000106948	ENST00000307564;ENST00000374088;ENST00000374075;ENST00000312033;ENST00000394574	T;T;T;T	0.32272	2.69;2.69;2.7;1.46	4.58	0.597	0.17504	.	0.519095	0.16285	N	0.221162	T	0.18759	0.0450	L	0.27053	0.805	0.80722	D	1	B;B;B	0.33807	0.22;0.075;0.426	B;B;B	0.37692	0.208;0.035;0.256	T	0.06954	-1.0798	10	0.34782	T	0.22	-4.4222	3.703	0.08390	0.3391:0.1032:0.0:0.5577	.	121;121;40	Q7Z591-6;Q7Z591;Q7Z591-2	.;AKNA_HUMAN;.	A	121;121;40;121;121	ENSP00000303769:T121A;ENSP00000363201:T121A;ENSP00000363188:T40A;ENSP00000309222:T121A	ENSP00000303769:T121A	T	-	1	0	AKNA	116179547	0.975000	0.34042	0.174000	0.22961	0.155000	0.21991	0.491000	0.22419	0.172000	0.19760	0.379000	0.24179	ACT	.		0.602	AKNA-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053767.2	NM_030767	
BRINP1	1620	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	121930244	121930244	+	Silent	SNP	C	C	T	rs370346617		TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr9:121930244C>T	ENST00000265922.3	-	8	1865	c.1404G>A	c.(1402-1404)tcG>tcA	p.S468S	BRINP1_ENST00000482797.1_Intron	NM_014618.2	NP_055433.2	O60477	BRNP1_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 1	468					cell cycle arrest (GO:0007050)|cell death (GO:0008219)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell cycle (GO:0045786)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	cytoplasm (GO:0005737)											CGCTCCGCTCCGAGTCCACGT	0.592																																					p.S468S		.											.	DBC1-582	0			c.G1404A						.	C		1,4405	2.1+/-5.4	0,1,2202	149.0	122.0	131.0		1404	0.4	1.0	9		131	0,8600		0,0,4300	no	coding-synonymous	DBC1	NM_014618.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		468/762	121930244	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	1620	exon8			CCGCTCCGAGTCC	AF027734	CCDS6822.1	9q32-q33	2013-08-06	2013-08-06	2013-07-31	ENSG00000078725	ENSG00000078725			2687	protein-coding gene	gene with protein product		602865	"""deleted in bladder cancer chromosome region candidate 1"", ""deleted in bladder cancer 1"""	DBCCR1, DBC1		9175739, 10444335, 15193422	Standard	NM_014618		Approved	FAM5A	uc004bkc.2	O60477	OTTHUMG00000021020	ENST00000265922.3:c.1404G>A	9.37:g.121930244C>T		92	0		107	26	NM_014618	0	0	0	0	0	Q6IPV6|Q6P1A0|Q8WU22	Silent	SNP	ENST00000265922.3	37	CCDS6822.1																																																																																			.		0.592	BRINP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055440.2	NM_014618	
NLGN3	54413	broad.mit.edu	37	X	70387072	70387072	+	Silent	SNP	C	C	T			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chrX:70387072C>T	ENST00000358741.3	+	7	1428	c.1125C>T	c.(1123-1125)ggC>ggT	p.G375G	NLGN3_ENST00000374051.3_Silent_p.G355G|NLGN3_ENST00000536169.1_Silent_p.G335G|NLGN3_ENST00000476589.1_3'UTR	NM_181303.1	NP_851820.1	Q9NZ94	NLGN3_HUMAN	neuroligin 3	375					adult behavior (GO:0030534)|axon extension (GO:0048675)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|oligodendrocyte differentiation (GO:0048709)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor-mediated endocytosis (GO:0006898)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term synaptic potentiation (GO:1900271)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of synaptic transmission (GO:0050804)|regulation of terminal button organization (GO:2000331)|rhythmic synaptic transmission (GO:0060024)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse organization (GO:0050808)|visual learning (GO:0008542)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|endocytic vesicle (GO:0030139)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)			biliary_tract(1)|breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(10)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	37	Renal(35;0.156)					TGGCCTTTGGCCCTGTGATTG	0.557																																					p.G375G	Esophageal Squamous(103;760 1488 16849 22250 40351)												.	NLGN3-131	0			c.C1125T						.						126.0	87.0	100.0					X																	70387072		2203	4300	6503	SO:0001819	synonymous_variant	54413	exon7			CTTTGGCCCTGTG	AB040913	CCDS14407.1, CCDS55441.1, CCDS55442.1	Xq13.1	2008-08-01			ENSG00000196338	ENSG00000196338			14289	protein-coding gene	gene with protein product		300336				10767552, 10819331	Standard	NM_181303		Approved	HNL3, KIAA1480, ASPGX1, AUTSX1	uc004dzd.2	Q9NZ94	OTTHUMG00000021790	ENST00000358741.3:c.1125C>T	X.37:g.70387072C>T		73	0		145	4	NM_181303	0	0	0	0	0	B2RBK1|D2X2H6|D3DVV0|D3DVV1|Q86V51|Q8NCD0|Q9NZ95|Q9NZ96|Q9NZ97|Q9P248	Silent	SNP	ENST00000358741.3	37	CCDS55441.1																																																																																			.		0.557	NLGN3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057121.1	NM_018977	
HDAC8	55869	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	71681922	71681922	+	Missense_Mutation	SNP	G	G	C			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chrX:71681922G>C	ENST00000373573.3	-	9	1278	c.937C>G	c.(937-939)Cga>Gga	p.R313G	HDAC8_ENST00000429103.2_Missense_Mutation_p.R118G|HDAC8_ENST00000373589.4_Missense_Mutation_p.R222G|HDAC8_ENST00000373583.1_Intron	NM_018486.2	NP_060956.1	Q9BY41	HDAC8_HUMAN	histone deacetylase 8	313	Histone deacetylase.				chromatin assembly or disassembly (GO:0006333)|chromatin modification (GO:0016568)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of cohesin localization to chromatin (GO:0071922)|sister chromatid cohesion (GO:0007062)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone deacetylase complex (GO:0000118)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	histone deacetylase activity (GO:0004407)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|transcription factor binding (GO:0008134)			breast(3)|cervix(1)|endometrium(1)|lung(4)|prostate(1)	10	Renal(35;0.156)				Vorinostat(DB02546)	GTCCAGCATCGAGCCGTGTTG	0.473																																					p.R313G		.											.	HDAC8-226	0			c.C937G						.						121.0	99.0	106.0					X																	71681922		2203	4300	6503	SO:0001583	missense	55869	exon9			AGCATCGAGCCGT	AF230097	CCDS14420.1, CCDS55448.1, CCDS55449.1, CCDS55450.1, CCDS55451.1, CCDS55452.1	Xq13	2014-01-29	2002-09-02	2002-09-06	ENSG00000147099	ENSG00000147099			13315	protein-coding gene	gene with protein product		300269	"""histone deacetylase-like 1"", ""Wilson-Turner X-linked mental retardation syndrome"""	HDACL1, WTS, MRXS6		10756090, 10922473, 22889856	Standard	NM_001166448		Approved	RPD3	uc004eau.3	Q9BY41	OTTHUMG00000021814	ENST00000373573.3:c.937C>G	X.37:g.71681922G>C	ENSP00000362674:p.Arg313Gly	77	1		35	10	NM_018486	0	0	8	8	0	A6ND12|A6ND61|A6NET3|A6NJR3|A8MQ62|B4DKN0|B4DV22|Q86VC8|Q9NP76|Q9NYH4	Missense_Mutation	SNP	ENST00000373573.3	37	CCDS14420.1	.	.	.	.	.	.	.	.	.	.	G	18.91	3.722648	0.68959	.	.	ENSG00000147099	ENST00000373573;ENST00000373589;ENST00000429103;ENST00000373568;ENST00000415409	T;T;T;T;T	0.75704	-0.57;-0.57;-0.57;-0.57;-0.96	5.3	5.3	0.74995	Histone deacetylase domain (2);	0.000000	0.85682	D	0.000000	D	0.90758	0.7099	H	0.96748	3.875	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.997;0.993;1.0	D	0.93702	0.7016	10	0.87932	D	0	-8.4243	15.5432	0.76074	0.0:0.0:1.0:0.0	.	222;222;313	B4DKN0;A6NGJ7;Q9BY41	.;.;HDAC8_HUMAN	G	313;222;118;222;287	ENSP00000362674:R313G;ENSP00000362691:R222G;ENSP00000388459:R118G;ENSP00000362669:R222G;ENSP00000396424:R287G	ENSP00000362669:R222G	R	-	1	2	HDAC8	71598647	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.297000	0.96120	2.352000	0.79861	0.594000	0.82650	CGA	.		0.473	HDAC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057193.2	NM_018486	
TMCO2	127391	broad.mit.edu	37	1	40713708	40713709	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	TC	TC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr1:40713708_40713709delTC	ENST00000372766.3	+	1	136_137	c.43_44delTC	c.(43-45)tctfs	p.S15fs	TMCO2_ENST00000468258.1_Intron	NM_001008740.3	NP_001008740.1	Q7Z6W1	TMCO2_HUMAN	transmembrane and coiled-coil domains 2	15						integral component of membrane (GO:0016021)|nucleus (GO:0005634)				kidney(1)|large_intestine(3)|lung(1)|ovary(1)	6	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;6.3e-18)			CCTCTTAGAGTCTCTCTCTCTC	0.406																																					p.15_15del													.	TMCO2-91	0			c.43_44del						.																																			SO:0001589	frameshift_variant	127391	exon1			TTAGAGTCTCTCT	AL050341	CCDS30684.1	1p34.2	2014-02-12			ENSG00000188800	ENSG00000188800			23312	protein-coding gene	gene with protein product							Standard	NM_001008740		Approved	dJ39G22.2	uc001cfe.2	Q7Z6W1	OTTHUMG00000005764	ENST00000372766.3:c.43_44delTC	1.37:g.40713718_40713719delTC	ENSP00000361852:p.Ser15fs	412	0		596	9	NM_001008740	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000372766.3	37	CCDS30684.1																																																																																			.		0.406	TMCO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015769.1	NM_001008740	
NES	10763	broad.mit.edu	37	1	156642804	156642804	+	Frame_Shift_Del	DEL	G	G	-	rs372020167		TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr1:156642804delG	ENST00000368223.3	-	4	1308	c.1176delC	c.(1174-1176)cccfs	p.P392fs		NM_006617.1	NP_006608.1	P48681	NEST_HUMAN	nestin	392	Tail.				brain development (GO:0007420)|cell projection morphogenesis (GO:0048858)|central nervous system development (GO:0007417)|embryonic camera-type eye development (GO:0031076)|G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of catalytic activity (GO:0043086)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein binding (GO:0032091)|positive regulation of intermediate filament depolymerization (GO:0030844)|positive regulation of neural precursor cell proliferation (GO:2000179)|stem cell proliferation (GO:0072089)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)	intermediate filament binding (GO:0019215)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(30)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(4)	64	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CCTGAGGTGTGGGGGGGATGG	0.597																																					p.P392fs													.	NES-520	0			c.1176delC						.						74.0	93.0	86.0					1																	156642804		2203	4299	6502	SO:0001589	frameshift_variant	10763	exon4			AGGTGTGGGGGGG	X65964	CCDS1151.1	1q23	2013-01-16			ENSG00000132688	ENSG00000132688		"""Intermediate filaments type IV"""	7756	protein-coding gene	gene with protein product		600915				1478958, 9104587	Standard	NM_006617		Approved	FLJ21841	uc001fpq.3	P48681	OTTHUMG00000034299	ENST00000368223.3:c.1176delC	1.37:g.156642804delG	ENSP00000357206:p.Pro392fs	385	0		806	7	NM_006617	0	0	0	0	0	O00552|Q3LIF5|Q5SYZ6	Frame_Shift_Del	DEL	ENST00000368223.3	37	CCDS1151.1																																																																																			.		0.597	NES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082844.2	NM_006617	
TPR	7175	broad.mit.edu	37	1	186327733	186327735	+	In_Frame_Del	DEL	GAT	GAT	-			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	GAT	GAT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr1:186327733_186327735delGAT	ENST00000367478.4	-	13	1733_1735	c.1437_1439delATC	c.(1435-1440)tcatct>tct	p.479_480SS>S	TPR_ENST00000474852.1_5'UTR	NM_003292.2	NP_003283.2	P12270	TPR_HUMAN	translocated promoter region, nuclear basket protein	479	Necessary for association to the NPC.				carbohydrate metabolic process (GO:0005975)|cellular response to heat (GO:0034605)|cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|MAPK import into nucleus (GO:0000189)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic spindle assembly checkpoint (GO:0007094)|mRNA export from nucleus in response to heat stress (GO:0031990)|negative regulation of RNA export from nucleus (GO:0046832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translational initiation (GO:0045947)|nuclear pore organization (GO:0006999)|positive regulation of heterochromatin assembly (GO:0031453)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein import into nucleus (GO:0042307)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|regulation of mitotic sister chromatid separation (GO:0010965)|regulation of spindle assembly involved in mitosis (GO:1901673)|response to epidermal growth factor (GO:0070849)|RNA export from nucleus (GO:0006405)|RNA import into nucleus (GO:0006404)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|extrinsic component of membrane (GO:0019898)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|dynein complex binding (GO:0070840)|heat shock protein binding (GO:0031072)|mitogen-activated protein kinase binding (GO:0051019)|mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)			autonomic_ganglia(1)|breast(5)|central_nervous_system(4)|cervix(2)|endometrium(9)|kidney(12)|large_intestine(23)|liver(1)|lung(45)|ovary(2)|pancreas(1)|prostate(6)|skin(3)|stomach(1)|urinary_tract(8)	123		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		CTCAAGTACAGATGATTGCTTGT	0.32			T	NTRK1	papillary thyroid																																p.479_480del				Dom	yes		1	1q25	7175	translocated promoter region		E	.	TPR-228	0			c.1437_1439del						.																																			SO:0001651	inframe_deletion	7175	exon13			AGTACAGATGATT	U69668	CCDS41446.1	1q25	2012-03-13	2012-03-13		ENSG00000047410	ENSG00000047410			12017	protein-coding gene	gene with protein product		189940	"""translocated promoter region (to activated MET oncogene)"""			1611909, 15229283	Standard	NM_003292		Approved		uc001grv.3	P12270	OTTHUMG00000035580	ENST00000367478.4:c.1437_1439delATC	1.37:g.186327736_186327738delGAT	ENSP00000356448:p.Ser480del	205	0		63	7	NM_003292	0	0	0	0	0	Q15655|Q5SWY0|Q99968	In_Frame_Del	DEL	ENST00000367478.4	37	CCDS41446.1																																																																																			.		0.320	TPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086353.2	NM_003292	
TMC8	147138	broad.mit.edu	37	17	76134728	76134757	+	In_Frame_Del	DEL	GCCCTTGGGCTCCCGCCCATTGGCCAGCGT	GCCCTTGGGCTCCCGCCCATTGGCCAGCGT	-	rs535003756|rs150356106|rs375895539		TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	GCCCTTGGGCTCCCGCCCATTGGCCAGCGT	GCCCTTGGGCTCCCGCCCATTGGCCAGCGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr17:76134728_76134757delGCCCTTGGGCTCCCGCCCATTGGCCAGCGT	ENST00000318430.5	+	14	2112_2141	c.1738_1767delGCCCTTGGGCTCCCGCCCATTGGCCAGCGT	c.(1738-1767)gcccttgggctcccgcccattggccagcgtdel	p.ALGLPPIGQR580del	TMC8_ENST00000589691.1_In_Frame_Del_p.ALGLPPIGQR357del|TMC8_ENST00000591144.1_3'UTR	NM_152468.4	NP_689681.2	Q8IU68	TMC8_HUMAN	transmembrane channel-like 8	580					ion transport (GO:0006811)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|regulation of cell growth (GO:0001558)|regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902041)|zinc ion homeostasis (GO:0055069)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	receptor binding (GO:0005102)	p.R589C(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	12			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)|OV - Ovarian serous cystadenocarcinoma(97;0.192)			GGAGCTGGTGGCCCTTGGGCTCCCGCCCATTGGCCAGCGTGCCCTCCACT	0.67																																					p.580_589del													.	TMC8-90	1	Substitution - Missense(1)	prostate(1)	c.1738_1767del						.																																			SO:0001651	inframe_deletion	147138	exon14			CTGGTGGCCCTTG	AY057380	CCDS32749.1	17q25.3	2014-09-17	2005-11-10	2005-11-10	ENSG00000167895	ENSG00000167895			20474	protein-coding gene	gene with protein product		605829	"""epidermodysplasia verruciformis 2"""	EVER2		12426567	Standard	NM_152468		Approved	EVIN2	uc002jup.2	Q8IU68		ENST00000318430.5:c.1738_1767delGCCCTTGGGCTCCCGCCCATTGGCCAGCGT	17.37:g.76134728_76134757delGCCCTTGGGCTCCCGCCCATTGGCCAGCGT	ENSP00000325561:p.Ala580_Arg589del	172	0		470	9	NM_152468	0	0	0	0	0	Q2YDC0|Q8IWU7|Q8N358|Q8NF04	In_Frame_Del	DEL	ENST00000318430.5	37	CCDS32749.1																																																																																			.		0.670	TMC8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436900.3		
HAVCR1	26762	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	156482352	156482362	+	Frame_Shift_Del	DEL	AATAGCTTATA	AATAGCTTATA	-	rs111358310	byFrequency	TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	AATAGCTTATA	AATAGCTTATA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr5:156482352_156482362delAATAGCTTATA	ENST00000339252.3	-	2	761_771	c.229_239delTATAAGCTATT	c.(229-240)tataagctattgfs	p.YKLL77fs	HAVCR1_ENST00000522693.1_Frame_Shift_Del_p.YKLL77fs|HAVCR1_ENST00000425854.1_Frame_Shift_Del_p.YKLL77fs|HAVCR1_ENST00000523175.1_Frame_Shift_Del_p.YKLL77fs|HAVCR1_ENST00000544197.1_Frame_Shift_Del_p.YKLL77fs	NM_012206.2	NP_036338.2	Q96D42	HAVR1_HUMAN	hepatitis A virus cellular receptor 1	0	Ig-like V-type.				viral process (GO:0016032)	integral component of membrane (GO:0016021)	virus receptor activity (GO:0001618)			endometrium(3)|large_intestine(2)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			AAGGTCCCCCAATAGCTTATAGCGTGTGTCC	0.479																																					p.77_80del		.											.	HAVCR1-92	0			c.229_239del						.																																			SO:0001589	frameshift_variant	26762	exon3			.	AF043724	CCDS43392.1	5q33.2	2014-01-14			ENSG00000113249	ENSG00000113249		"""Immunoglobulin superfamily / V-set domain containing"""	17866	protein-coding gene	gene with protein product	"""T-cell immunoglobulin mucin family member 1"""	606518				9658108, 11725301	Standard	NM_012206		Approved	HAVCR-1, TIM-1, TIM1, HAVCR, TIMD1	uc021ygj.1	Q96D42	OTTHUMG00000163466	ENST00000339252.3:c.229_239delTATAAGCTATT	5.37:g.156482352_156482362delAATAGCTTATA	ENSP00000344844:p.Tyr77fs	128	0		271	52	NM_001099414	0	0	0	0	0	O43656	Frame_Shift_Del	DEL	ENST00000339252.3	37	CCDS43392.1																																																																																			.		0.479	HAVCR1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373698.1		
NSD1	64324	broad.mit.edu	37	5	176710903	176710903	+	Frame_Shift_Del	DEL	T	T	-			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr5:176710903delT	ENST00000439151.2	+	20	6170	c.6125delT	c.(6124-6126)cttfs	p.L2042fs	NSD1_ENST00000347982.4_Frame_Shift_Del_p.L1773fs|NSD1_ENST00000361032.4_Frame_Shift_Del_p.L1939fs|NSD1_ENST00000354179.4_Frame_Shift_Del_p.L1773fs	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	2042	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				gastrulation with mouth forming second (GO:0001702)|histone H3-K36 methylation (GO:0010452)|histone H4-K20 methylation (GO:0034770)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H4-K20 specific) (GO:0042799)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		CGTGTAGGCCTTTTTGCACTA	0.438			T	NUP98	AML		Sotos Syndrome		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	HNSCC(47;0.14)																											p.L2042fs				Dom	yes		5	5q35	64324	nuclear receptor binding SET domain protein 1	yes	L	.	NSD1-188	0			c.6125delT						.						162.0	158.0	159.0					5																	176710903		2203	4300	6503	SO:0001589	frameshift_variant	64324	exon20	Familial Cancer Database	Weaver-Smith syndrome;Cerebral Gigantism;BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	TAGGCCTTTTTGC	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO		9628876, 11896389	Standard	NM_022455		Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.6125delT	5.37:g.176710903delT	ENSP00000395929:p.Leu2042fs	371	0		1028	7	NM_022455	0	0	0	0	0	Q96PD8|Q96RN7	Frame_Shift_Del	DEL	ENST00000439151.2	37	CCDS4412.1																																																																																			.		0.438	NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253412.2	NM_172349	
RGS9	8787	broad.mit.edu	37	17	63156389	63156390	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr17:63156389_63156390insA	ENST00000262406.9	+	4	311_312	c.244_245insA	c.(244-246)tacfs	p.Y82fs	RGS9_ENST00000449996.3_Frame_Shift_Ins_p.Y82fs|RGS9_ENST00000443584.3_Frame_Shift_Ins_p.Y82fs|RGS9_ENST00000577186.1_3'UTR	NM_003835.3	NP_003826.2	O75916	RGS9_HUMAN	regulator of G-protein signaling 9	82	DEP. {ECO:0000255|PROSITE- ProRule:PRU00066}.				dopamine receptor signaling pathway (GO:0007212)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|response to estrogen (GO:0043627)|rhodopsin mediated signaling pathway (GO:0016056)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|heterotrimeric G-protein complex (GO:0005834)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(8)|liver(2)|lung(12)|ovary(2)|prostate(3)|skin(3)	41						CAGGTATGGCTACATTTACCCC	0.5																																					p.Y82_I83delinsX													.	RGS9-94	0			c.244_245insA						.																																			SO:0001589	frameshift_variant	8787	exon4			TATGGCTACATTT	AF071476	CCDS42373.1, CCDS45764.1	17q24	2008-07-18	2007-08-14			ENSG00000108370		"""Regulators of G-protein signaling"""	10004	protein-coding gene	gene with protein product	"""regulator of G protein signalling 9"", ""regulator of G protein signalling 9L"", ""regulator of G-protein signaling 9L"""	604067	"""regulator of G-protein signalling 9"""			9765512	Standard	NM_003835		Approved	PERRS, RGS9L, MGC26458, MGC111763	uc002jfe.3	O75916		ENST00000262406.9:c.245dupA	17.37:g.63156390_63156390dupA	ENSP00000262406:p.Tyr82fs	168	0		618	13	NM_001081955	0	0	0	0	0	A8K3C0|O75573|Q696R2|Q8TD64|Q8TD65|Q9HC32|Q9HC33	Nonsense_Mutation	INS	ENST00000262406.9	37	CCDS42373.1																																																																																			.		0.500	RGS9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445885.1	NM_003835	
EPG5	57724	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	18	43514887	43514888	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr18:43514887_43514888insA	ENST00000282041.5	-	11	2178_2179	c.2144_2145insT	c.(2143-2145)ctgfs	p.L715fs		NM_020964.2	NP_066015.2	Q9HCE0	EPG5_HUMAN	ectopic P-granules autophagy protein 5 homolog (C. elegans)	715					autophagic vacuole maturation (GO:0097352)|autophagy (GO:0006914)|endocytic recycling (GO:0032456)					NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(35)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	95						TTTGCACAGACAGAGTCCCAAA	0.495																																					p.L715fs		.											.	EPG5-580	0			c.2145_2146insT						.																																			SO:0001589	frameshift_variant	57724	exon11			.	AK023817	CCDS11926.2	18q12.3	2011-03-02	2011-03-02	2011-03-02	ENSG00000152223	ENSG00000152223			29331	protein-coding gene	gene with protein product		615068	"""KIAA1632"""	KIAA1632		10997877, 20550938	Standard	XM_005258323		Approved	hEPG5	uc002lbm.3	Q9HCE0	OTTHUMG00000132626	ENST00000282041.5:c.2145dupT	18.37:g.43514888_43514888dupA	ENSP00000282041:p.Leu715fs	123	0		151	34	NM_020964	0	0	0	0	0	A2BDF3|Q9H8C8	Frame_Shift_Ins	INS	ENST00000282041.5	37	CCDS11926.2																																																																																			.		0.495	EPG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445081.1	NM_020964	
