#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ADAM19	8728	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	156923994	156923994	+	Missense_Mutation	SNP	A	A	T			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr5:156923994A>T	ENST00000517905.1	-	14	1546	c.1502T>A	c.(1501-1503)aTg>aAg	p.M501K	ADAM19_ENST00000257527.4_Missense_Mutation_p.M501K|ADAM19_ENST00000394020.1_Missense_Mutation_p.M503K|ADAM19_ENST00000430702.2_Missense_Mutation_p.M234K			Q9H013	ADA19_HUMAN	ADAM metallopeptidase domain 19	501	Disintegrin. {ECO:0000255|PROSITE- ProRule:PRU00068}.				heart development (GO:0007507)|membrane protein ectodomain proteolysis (GO:0006509)	integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.M502K(1)|p.M501K(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(33)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	53	Renal(175;0.00488)	Medulloblastoma(196;0.0359)|all_neural(177;0.14)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GGTACCATCCATCTGGTAGAA	0.637																																																	2	Substitution - Missense(2)	kidney(2)											44.0	42.0	43.0					5																	156923994		2203	4300	6503	SO:0001583	missense	8728			AF311317	CCDS4338.1	5q33.3	2010-06-24	2010-06-24		ENSG00000135074	ENSG00000135074		"""ADAM metallopeptidase domain containing"""	197	protein-coding gene	gene with protein product	"""meltrin beta"""	603640	"""a disintegrin and metalloproteinase domain 19 (meltrin beta)"""			9806848	Standard	NM_033274		Approved	MLTNB	uc003lwz.4	Q9H013	OTTHUMG00000130242	ENST00000517905.1:c.1502T>A	5.37:g.156923994A>T	ENSP00000428654:p.Met501Lys		Q9BZL5|Q9UHP2	Missense_Mutation	SNP	ENST00000517905.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	27.5|27.5	4.832640|4.832640	0.91036|0.91036	.|.	.|.	ENSG00000135074|ENSG00000135074	ENST00000430702;ENST00000257527;ENST00000394020;ENST00000517905|ENST00000517374	T;T;T;T|.	0.01527|.	4.8;4.92;4.95;4.92|.	5.49|5.49	5.49|5.49	0.81192|0.81192	ADAM, cysteine-rich (1);Blood coagulation inhibitor, Disintegrin (2);|.	0.146679|.	0.48286|.	D|.	0.000185|.	T|T	0.52948|0.52948	0.1766|0.1766	N|N	0.25286|0.25286	0.73|0.73	0.48511|0.48511	D|D	0.999664|0.999664	D;P;D|.	0.56521|.	0.97;0.949;0.976|.	P;P;P|.	0.52066|.	0.689;0.491;0.609|.	T|T	0.50268|0.50268	-0.8848|-0.8848	10|5	0.62326|.	D|.	0.03|.	.|.	15.5844|15.5844	0.76470|0.76470	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	501;501;234|.	Q9H013-2;Q9H013;E9PD32|.	.;ADA19_HUMAN;.|.	K|R	234;501;503;501|72	ENSP00000414088:M234K;ENSP00000257527:M501K;ENSP00000377588:M503K;ENSP00000428654:M501K|.	ENSP00000257527:M501K|.	M|W	-|-	2|1	0|0	ADAM19|ADAM19	156856572|156856572	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	6.253000|6.253000	0.72453|0.72453	2.080000|2.080000	0.62538|0.62538	0.455000|0.455000	0.32223|0.32223	ATG|TGG		0.637	ADAM19-003	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000373918.1		NM_033274	
ANKRD11	29123	hgsc.bcm.edu;ucsc.edu	37	16	89350692	89350692	+	Frame_Shift_Del	DEL	G	G	-	rs143279397		TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr16:89350692delG	ENST00000301030.4	-	9	2718	c.2258delC	c.(2257-2259)ccgfs	p.P753fs	ANKRD11_ENST00000378330.2_Frame_Shift_Del_p.P753fs	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	753	Lys-rich.				bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		TTCTTCTTTCGGAGACTTTTC	0.388																																																	0													64.0	67.0	66.0					16																	89350692		2198	4299	6497	SO:0001589	frameshift_variant	29123			AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.2258delC	16.37:g.89350692delG	ENSP00000301030:p.Pro753fs		Q6NTG1|Q6QMF8	Frame_Shift_Del	DEL	ENST00000301030.4	37	CCDS32513.1																																																																																				0.388	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430462.3		NM_013275	
ARHGAP15	55843	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	143913197	143913197	+	Silent	SNP	C	C	T			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr2:143913197C>T	ENST00000295095.6	+	2	305	c.138C>T	c.(136-138)ctC>ctT	p.L46L	ARHGAP15_ENST00000409869.1_Silent_p.L46L	NM_018460.3	NP_060930.3	Q53QZ3	RHG15_HUMAN	Rho GTPase activating protein 15	46					positive regulation of Rac GTPase activity (GO:0032855)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)	p.L46L(1)		endometrium(1)|kidney(5)|large_intestine(8)|liver(2)|lung(15)|ovary(1)|skin(2)	34				BRCA - Breast invasive adenocarcinoma(221;0.151)		CCATGATCCTCACCGATGTCG	0.428																																																	1	Substitution - coding silent(1)	kidney(1)											108.0	96.0	100.0					2																	143913197		2203	4300	6503	SO:0001819	synonymous_variant	55843			AY219338	CCDS2184.1	2q22.2-q22.3	2013-01-10			ENSG00000075884	ENSG00000075884		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	21030	protein-coding gene	gene with protein product		610578				12650940, 11042152	Standard	NM_018460		Approved	BM046	uc002tvm.4	Q53QZ3	OTTHUMG00000131845	ENST00000295095.6:c.138C>T	2.37:g.143913197C>T			Q53R36|Q53RD7|Q53RT6|Q53SX9|Q584N9|Q6PJE6|Q86WP1|Q8IXX1|Q9NRL8|Q9NZ77|Q9NZ91	Silent	SNP	ENST00000295095.6	37	CCDS2184.1																																																																																				0.428	ARHGAP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254793.2		NM_018460	
ATP12A	479	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	13	25284712	25284712	+	Missense_Mutation	SNP	T	T	A			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr13:25284712T>A	ENST00000381946.3	+	20	3045	c.2878T>A	c.(2878-2880)Ttc>Atc	p.F960I	ATP12A_ENST00000218548.6_Missense_Mutation_p.F966I			P54707	AT12A_HUMAN	ATPase, H+/K+ transporting, nongastric, alpha polypeptide	960					ATP biosynthetic process (GO:0006754)|ion transmembrane transport (GO:0034220)|potassium ion homeostasis (GO:0055075)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|hydrogen:potassium-exchanging ATPase complex (GO:0005889)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|metal ion binding (GO:0046872)	p.F960I(1)		breast(6)|central_nervous_system(4)|endometrium(3)|kidney(5)|large_intestine(23)|lung(23)|ovary(2)|pancreas(1)|prostate(2)|skin(5)	74		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)		GAATTCCATCTTCCAGCAGGG	0.527																																					Pancreas(156;1582 1935 18898 22665 26498)												1	Substitution - Missense(1)	kidney(1)											89.0	94.0	92.0					13																	25284712		2203	4300	6503	SO:0001583	missense	479			L42558	CCDS31948.1, CCDS53858.1	13q11-q12.1	2010-04-20	2002-02-25		ENSG00000075673	ENSG00000075673	3.6.3.10	"""ATPases / P-type"""	13816	protein-coding gene	gene with protein product	"""ATPase, Na+K+ transporting, alpha-1 polypeptide-like"", ""potassium-transporting ATPase alpha chain 2"", ""proton pump"", ""non-gastric H(+)/K(+) ATPase alpha subunit"", ""sodium/potassium ATPase, alpha polypeptide-like"""	182360	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 1"""	ATP1AL1		8838794, 2842249	Standard	NM_001676		Approved		uc010aaa.3	P54707	OTTHUMG00000016588	ENST00000381946.3:c.2878T>A	13.37:g.25284712T>A	ENSP00000371372:p.Phe960Ile		Q13816|Q13817|Q16734|Q5W035|Q8N5U2	Missense_Mutation	SNP	ENST00000381946.3	37	CCDS31948.1	.	.	.	.	.	.	.	.	.	.	T	16.65	3.181917	0.57800	.	.	ENSG00000075673	ENST00000218548;ENST00000381946	D;D	0.90676	-2.71;-2.71	5.49	5.49	0.81192	ATPase, P-type cation-transporter, C-terminal (1);ATPase, P-type,  transmembrane domain (1);	0.065844	0.64402	D	0.000005	D	0.87985	0.6316	M	0.63169	1.94	0.49687	D	0.999811	B;B	0.18310	0.027;0.012	B;B	0.17979	0.02;0.013	D	0.84795	0.0781	10	0.56958	D	0.05	.	8.9557	0.35816	0.1653:0.0:0.0:0.8347	.	966;960	P54707-2;P54707	.;AT12A_HUMAN	I	966;960	ENSP00000218548:F966I;ENSP00000371372:F960I	ENSP00000218548:F966I	F	+	1	0	ATP12A	24182712	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	5.792000	0.69052	2.076000	0.62316	0.533000	0.62120	TTC		0.527	ATP12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044199.1		NM_001676	
BMPR2	659	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	203407042	203407042	+	Missense_Mutation	SNP	G	G	T	rs146957466		TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr2:203407042G>T	ENST00000374580.4	+	10	1824	c.1285G>T	c.(1285-1287)Gta>Tta	p.V429L	BMPR2_ENST00000374574.2_Missense_Mutation_p.V429L	NM_001204.6	NP_001195.2	Q13873	BMPR2_HUMAN	bone morphogenetic protein receptor, type II (serine/threonine kinase)	429	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|blood vessel remodeling (GO:0001974)|BMP signaling pathway (GO:0030509)|brain development (GO:0007420)|cellular response to starvation (GO:0009267)|chondrocyte development (GO:0002063)|limb development (GO:0060173)|lung alveolus development (GO:0048286)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|mesoderm formation (GO:0001707)|negative regulation of cell growth (GO:0030308)|negative regulation of chondrocyte proliferation (GO:1902731)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of systemic arterial blood pressure (GO:0003085)|negative regulation of vasoconstriction (GO:0045906)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of bone mineralization (GO:0030501)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|regulation of cell proliferation (GO:0042127)|regulation of lung blood pressure (GO:0014916)|retina vasculature development in camera-type eye (GO:0061298)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|venous blood vessel development (GO:0060841)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|caveola (GO:0005901)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|fully spanning plasma membrane (GO:0044214)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	activin receptor activity, type II (GO:0016362)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)	p.V429L(1)		autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(11)|lung(7)|ovary(4)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(2)	42						AGGGGAATCCGTACCAGAGTA	0.393																																																	1	Substitution - Missense(1)	kidney(1)											62.0	64.0	64.0					2																	203407042		2203	4299	6502	SO:0001583	missense	659			Z48923	CCDS33361.1	2q33-q34	2014-09-17			ENSG00000204217	ENSG00000204217			1078	protein-coding gene	gene with protein product		600799	"""primary pulmonary hypertension 1"""	PPH1		7791754	Standard	NM_001204		Approved	BRK-3, T-ALK, BMPR3, BMPR-II	uc002uzf.4	Q13873	OTTHUMG00000133617	ENST00000374580.4:c.1285G>T	2.37:g.203407042G>T	ENSP00000363708:p.Val429Leu		Q13161|Q16569|Q4ZG08|Q53SA5|Q585T8	Missense_Mutation	SNP	ENST00000374580.4	37	CCDS33361.1	.	.	.	.	.	.	.	.	.	.	G	15.07	2.725628	0.48833	.	.	ENSG00000204217	ENST00000374580;ENST00000374574	D;D	0.89552	-2.53;-2.42	5.17	4.28	0.50868	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.111775	0.64402	D	0.000011	D	0.87716	0.6247	L	0.43701	1.375	0.42829	D	0.994017	P;P	0.44690	0.679;0.841	B;P	0.44673	0.25;0.457	D	0.87118	0.2189	10	0.72032	D	0.01	.	16.7798	0.85560	0.0697:0.0:0.9303:0.0	.	429;429	Q13161;Q13873	.;BMPR2_HUMAN	L	429	ENSP00000363708:V429L;ENSP00000363702:V429L	ENSP00000363702:V429L	V	+	1	0	BMPR2	203115287	1.000000	0.71417	1.000000	0.80357	0.833000	0.47200	6.840000	0.75369	0.579000	0.29504	-1.119000	0.02030	GTA		0.393	BMPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257743.1		NM_001204	
BTNL2	56244	hgsc.bcm.edu	37	6	32370970	32370970	+	Frame_Shift_Del	DEL	G	G	-	rs370253771|rs60740710	byFrequency	TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr6:32370970delG	ENST00000374993.1	-	3	450	c.451delC	c.(451-453)cacfs	p.H151fs	BTNL2_ENST00000454136.3_Frame_Shift_Del_p.H151fs|BTNL2_ENST00000429232.2_Intron|BTNL2_ENST00000540315.1_Intron|BTNL2_ENST00000544175.1_Intron|BTNL2_ENST00000374995.3_Intron|BTNL2_ENST00000414363.1_Intron	NM_019602.1	NP_062548.1	Q9UIR0	BTNL2_HUMAN	butyrophilin-like 2 (MHC class II associated)	151	Ig-like V-type 2.					integral component of membrane (GO:0016021)		p.H151fs*96(1)		central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|prostate(1)|urinary_tract(1)	19						CCCTCCATGTGGATGCTAGGG	0.602													GG|GG|G|deletion	672	0.134185	0.1369	0.1369	5008	,	,		18467	0.1984		0.0974	False		,,,				2504	0.1002																1	Deletion - Frameshift(1)	kidney(1)								408,3086		47,314,1386	22.0	22.0	22.0			3.5	0.9	6	dbSNP_129	24	520,6118		63,394,2862	yes	frameshift	BTNL2	NM_019602.1		110,708,4248	A1A1,A1R,RR		7.8337,11.6772,9.1591			32370970	928,9204	1502	2696	4198	SO:0001589	frameshift_variant	56244			AF186588		6p21.3	2014-01-14			ENSG00000204290	ENSG00000204290		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1142	protein-coding gene	gene with protein product		606000				10803852, 15735647	Standard	XM_006726138		Approved	HSBLMHC1, BTL-II, BTN7	uc003obg.1	Q9UIR0	OTTHUMG00000031102	ENST00000374993.1:c.451delC	6.37:g.32370970delG	ENSP00000364132:p.His151fs		A0PJV5|B0UYW9|B0V0N6|O98261|Q08E96|Q58R22|Q58R23|Q5JYF9|Q5MP42|Q5MP43|Q5RIF8|Q5SP08|Q5SP09|Q5SRW3|Q5SRW4|Q5SU36|Q95HK0	Frame_Shift_Del	DEL	ENST00000374993.1	37																																																																																					0.602	BTNL2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			NM_019602	
KIAA1549L	25758	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	33565157	33565157	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr11:33565157C>A	ENST00000321505.4	+	1	1337	c.1157C>A	c.(1156-1158)aCa>aAa	p.T386K	KIAA1549L_ENST00000265654.5_Missense_Mutation_p.T386K|KIAA1549L_ENST00000389726.3_Missense_Mutation_p.T386K			Q6ZVL6	K154L_HUMAN	KIAA1549-like	386						integral component of membrane (GO:0016021)		p.T386K(2)									GATTCCTTAACAATAGGAGAC	0.458											OREG0020868	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					2	Substitution - Missense(2)	kidney(2)											35.0	34.0	34.0					11																	33565157		1906	4126	6032	SO:0001583	missense	0			U10991	CCDS44565.1, CCDS44565.2	11p13	2012-08-09	2012-08-09	2012-08-09	ENSG00000110427	ENSG00000110427			24836	protein-coding gene	gene with protein product		612297	"""chromosome 11 open reading frame 69"", ""chromosome 11 open reading frame 41"""	C11orf69, C11orf41			Standard	NM_012194		Approved	G2, MGC34830	uc021qfs.1	Q6ZVL6	OTTHUMG00000150410	ENST00000321505.4:c.1157C>A	11.37:g.33565157C>A	ENSP00000315295:p.Thr386Lys	841	B0QYU0	Missense_Mutation	SNP	ENST00000321505.4	37	CCDS44565.2	.	.	.	.	.	.	.	.	.	.	C	7.631	0.678761	0.14841	.	.	ENSG00000110427	ENST00000321505;ENST00000389726;ENST00000265654;ENST00000536568	.	.	.	5.46	3.58	0.41010	.	0.709669	0.13223	N	0.404221	T	0.27313	0.0670	L	0.54323	1.7	0.09310	N	1	P;P	0.38078	0.483;0.617	B;B	0.37144	0.058;0.242	T	0.11991	-1.0565	9	0.08381	T	0.77	-1.7723	5.5837	0.17264	0.1565:0.6756:0.0:0.1679	.	386;386	E9PAT2;Q6ZVL6-2	.;.	K	386;386;386;226	.	ENSP00000265654:T386K	T	+	2	0	C11orf41	33521733	0.013000	0.17824	0.786000	0.31890	0.360000	0.29518	0.544000	0.23253	1.308000	0.44962	0.555000	0.69702	ACA		0.458	KIAA1549L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317998.1		NM_012194	
FAM209A	200232	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	55101052	55101052	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr20:55101052C>T	ENST00000371328.3	+	2	765	c.442C>T	c.(442-444)Cga>Tga	p.R148*	GCNT7_ENST00000243913.4_5'Flank|FAM209A_ENST00000481560.1_3'UTR	NM_001012971.3	NP_001012989.2	Q5JX71	F209A_HUMAN	family with sequence similarity 209, member A	148						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)		p.R148*(1)									CCTCAGGCTTCGAAAGTCAGA	0.453																																																	1	Substitution - Nonsense(1)	kidney(1)											113.0	103.0	106.0					20																	55101052		2203	4300	6503	SO:0001587	stop_gained	0			AL109806	CCDS33493.1	20q13.31	2011-11-24	2011-11-24	2011-11-24	ENSG00000124103	ENSG00000124103			16100	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 106"""	C20orf106			Standard	NM_001012971		Approved	dJ1153D9.3		Q5JX71	OTTHUMG00000032799	ENST00000371328.3:c.442C>T	20.37:g.55101052C>T	ENSP00000360379:p.Arg148*		Q05C43	Nonsense_Mutation	SNP	ENST00000371328.3	37	CCDS33493.1	.	.	.	.	.	.	.	.	.	.	C	26.4	4.737948	0.89573	.	.	ENSG00000124103	ENST00000371328	.	.	.	4.27	2.14	0.27477	.	0.483859	0.17167	N	0.184431	.	.	.	.	.	.	0.58432	D	0.999994	.	.	.	.	.	.	.	.	.	.	0.06625	T	0.88	-0.7587	4.3602	0.11199	0.2225:0.6567:0.0:0.1208	.	.	.	.	X	148	.	ENSP00000360379:R148X	R	+	1	2	C20orf106	54534459	0.000000	0.05858	0.001000	0.08648	0.023000	0.10783	0.299000	0.19138	0.774000	0.33427	0.411000	0.27672	CGA		0.453	FAM209A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079815.2			
CEP83	51134	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	94772632	94772632	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr12:94772632C>T	ENST00000397809.5	-	7	1285	c.736G>A	c.(736-738)Gaa>Aaa	p.E246K	CCDC41_ENST00000549352.1_5'UTR|CCDC41_ENST00000397807.2_Missense_Mutation_p.E213K|CCDC41_ENST00000339839.5_Missense_Mutation_p.E246K|CCDC41_ENST00000547575.1_Missense_Mutation_p.E246K	NM_016122.2	NP_057206.2	Q9Y592	CEP83_HUMAN		238					cilium assembly (GO:0042384)|protein localization to centrosome (GO:0071539)|vesicle docking (GO:0048278)	centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|Golgi apparatus (GO:0005794)		p.E246K(1)		breast(1)|central_nervous_system(3)|kidney(3)|large_intestine(8)|lung(8)|prostate(2)|skin(2)	27						TGGGCATTTTCCACCTGAGCC	0.433																																																	1	Substitution - Missense(1)	kidney(1)											136.0	132.0	133.0					12																	94772632		1878	4122	6000	SO:0001583	missense	51134																														ENST00000397809.5:c.736G>A	12.37:g.94772632C>T	ENSP00000380911:p.Glu246Lys		A4FVB1|Q08AP1	Missense_Mutation	SNP	ENST00000397809.5	37	CCDS41820.1	.	.	.	.	.	.	.	.	.	.	C	33	5.226445	0.95173	.	.	ENSG00000173588	ENST00000339839;ENST00000397809;ENST00000397807;ENST00000547575	T;T;T;T	0.23552	1.9;1.9;1.9;1.9	5.69	5.69	0.88448	.	.	.	.	.	T	0.44623	0.1302	M	0.63843	1.955	0.53005	D	0.999963	D;D;D	0.55385	0.971;0.971;0.971	P;P;P	0.55749	0.654;0.783;0.721	T	0.10154	-1.0642	9	0.37606	T	0.19	-15.5283	19.8051	0.96529	0.0:1.0:0.0:0.0	.	246;213;238	F8VYN8;Q9Y592-2;Q9Y592	.;.;CCD41_HUMAN	K	246;246;213;246	ENSP00000344655:E246K;ENSP00000380911:E246K;ENSP00000380909:E213K;ENSP00000448913:E246K	ENSP00000344655:E246K	E	-	1	0	CCDC41	93296763	1.000000	0.71417	1.000000	0.80357	0.774000	0.43823	6.688000	0.74557	2.691000	0.91804	0.585000	0.79938	GAA		0.433	CCDC41-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408147.3			
CD109	135228	broad.mit.edu;ucsc.edu	37	6	74516670	74516670	+	Missense_Mutation	SNP	A	A	C			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr6:74516670A>C	ENST00000287097.5	+	25	3176	c.3064A>C	c.(3064-3066)Aaa>Caa	p.K1022Q	CD109_ENST00000422508.2_Missense_Mutation_p.K945Q|CD109_ENST00000437994.2_Missense_Mutation_p.K1022Q			Q6YHK3	CD109_HUMAN	CD109 molecule	1022					negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of wound healing (GO:0061045)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)|transforming growth factor beta binding (GO:0050431)	p.K1022Q(1)		NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						AGGACATCAGAAATCCAACGG	0.383																																																	1	Substitution - Missense(1)	kidney(1)											92.0	86.0	88.0					6																	74516670		2203	4300	6503	SO:0001583	missense	135228			AF410459	CCDS4982.1, CCDS55038.1, CCDS55039.1	6q14.1	2008-02-05	2006-03-28		ENSG00000156535	ENSG00000156535		"""CD molecules"""	21685	protein-coding gene	gene with protein product		608859	"""CD109 antigen (Gov platelet alloantigens)"""			11861284, 11861285	Standard	XM_005248659		Approved	FLJ38569, DKFZp762L1111, CPAMD7	uc003php.3	Q6YHK3	OTTHUMG00000015040	ENST00000287097.5:c.3064A>C	6.37:g.74516670A>C	ENSP00000287097:p.Lys1022Gln		A5YKK4|B2R948|B3KW25|Q0P6K7|Q5SYA8|Q5XUM7|Q5XUM9|Q6MZI7|Q8N3A7|Q8N915|Q8TDJ2|Q8TDJ3	Missense_Mutation	SNP	ENST00000287097.5	37	CCDS4982.1	.	.	.	.	.	.	.	.	.	.	A	13.70	2.314903	0.40996	.	.	ENSG00000156535	ENST00000437994;ENST00000422508;ENST00000287097	T;T;T	0.33865	1.39;1.39;1.39	4.62	4.62	0.57501	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);A-macroglobulin complement component (1);	0.742274	0.13146	N	0.410235	T	0.17195	0.0413	L	0.39898	1.24	0.28015	N	0.934753	P;B;B	0.43885	0.82;0.36;0.03	B;B;B	0.41764	0.366;0.177;0.071	T	0.03818	-1.1001	10	0.38643	T	0.18	.	10.6201	0.45474	0.8391:0.1609:0.0:0.0	.	945;1022;1022	Q6YHK3-2;Q6YHK3-4;Q6YHK3	.;.;CD109_HUMAN	Q	1022;945;1022	ENSP00000388062:K1022Q;ENSP00000404475:K945Q;ENSP00000287097:K1022Q	ENSP00000287097:K1022Q	K	+	1	0	CD109	74573391	1.000000	0.71417	0.983000	0.44433	0.603000	0.37013	2.785000	0.47782	2.071000	0.62044	0.528000	0.53228	AAA		0.383	CD109-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041230.3		NM_133493	
CNR2	1269	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	24201824	24201824	+	Missense_Mutation	SNP	T	T	A			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr1:24201824T>A	ENST00000374472.4	-	2	445	c.284A>T	c.(283-285)cAt>cTt	p.H95L	CNR2_ENST00000536471.1_Missense_Mutation_p.H95L	NM_001841.2	NP_001832.1	P34972	CNR2_HUMAN	cannabinoid receptor 2 (macrophage)	95					G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|immune response (GO:0006955)|inflammatory response (GO:0006954)|negative regulation of action potential (GO:0045759)|negative regulation of inflammatory response (GO:0050728)|negative regulation of mast cell activation (GO:0033004)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|response to amphetamine (GO:0001975)|response to lipopolysaccharide (GO:0032496)|sensory perception of pain (GO:0019233)	dendrite (GO:0030425)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	cannabinoid receptor activity (GO:0004949)	p.H95L(2)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|lung(9)|pancreas(1)|skin(2)|stomach(6)|upper_aerodigestive_tract(2)	26		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.00957)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.32e-24)|Colorectal(126;6.09e-08)|COAD - Colon adenocarcinoma(152;3.33e-06)|GBM - Glioblastoma multiforme(114;2.9e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|KIRC - Kidney renal clear cell carcinoma(1967;0.00359)|STAD - Stomach adenocarcinoma(196;0.0131)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.146)	Dronabinol(DB00470)|Nabilone(DB00486)	ATGGAAAACATGGAAATTCAC	0.552																																																	2	Substitution - Missense(2)	kidney(2)											89.0	91.0	90.0					1																	24201824		2203	4300	6503	SO:0001583	missense	1269			X74328	CCDS245.1	1p	2012-08-08			ENSG00000188822	ENSG00000188822		"""GPCR / Class A : Cannabinoid receptors"""	2160	protein-coding gene	gene with protein product		605051					Standard	NM_001841		Approved	CB2	uc001bif.3	P34972	OTTHUMG00000013892	ENST00000374472.4:c.284A>T	1.37:g.24201824T>A	ENSP00000363596:p.His95Leu		C6ES44|Q4VBK8|Q5JRH7|Q6B0G7|Q6NSY0	Missense_Mutation	SNP	ENST00000374472.4	37	CCDS245.1	.	.	.	.	.	.	.	.	.	.	T	17.98	3.521348	0.64747	.	.	ENSG00000188822	ENST00000374472;ENST00000536471	T;T	0.29655	1.56;1.56	5.79	5.79	0.91817	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.49218	0.1544	L	0.43152	1.355	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.47598	-0.9105	10	0.62326	D	0.03	.	16.1262	0.81397	0.0:0.0:0.0:1.0	.	95	P34972	CNR2_HUMAN	L	95	ENSP00000363596:H95L;ENSP00000442830:H95L	ENSP00000363596:H95L	H	-	2	0	CNR2	24074411	1.000000	0.71417	0.990000	0.47175	0.244000	0.25665	8.033000	0.88852	2.203000	0.70933	0.459000	0.35465	CAT		0.552	CNR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038949.1		NM_001841	
CORO2A	7464	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	100899899	100899899	+	Missense_Mutation	SNP	G	G	C			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr9:100899899G>C	ENST00000343933.5	-	3	530	c.273C>G	c.(271-273)aaC>aaG	p.N91K	CORO2A_ENST00000375077.4_Missense_Mutation_p.N91K	NM_003389.3	NP_003380.3	Q92828	COR2A_HUMAN	coronin, actin binding protein, 2A	91					actin cytoskeleton organization (GO:0030036)|intracellular signal transduction (GO:0035556)	actin cytoskeleton (GO:0015629)|transcriptional repressor complex (GO:0017053)	actin filament binding (GO:0051015)	p.N91K(1)		endometrium(2)|kidney(2)|large_intestine(8)|lung(7)|ovary(1)|pancreas(1)|skin(4)|urinary_tract(1)	26		Acute lymphoblastic leukemia(62;0.0559)				CATCAAAAGGGTTCCACTTGA	0.557																																																	1	Substitution - Missense(1)	kidney(1)											129.0	122.0	124.0					9																	100899899		2203	4300	6503	SO:0001583	missense	7464			U57057	CCDS6735.1	9q22.3	2013-01-10	2001-11-28		ENSG00000106789	ENSG00000106789		"""Coronins"", ""WD repeat domain containing"""	2255	protein-coding gene	gene with protein product	"""coronin 2A"", ""coronin-like protein B"", ""WD protein IR10"", ""WD-repeat protein 2"""	602159	"""coronin, actin-binding protein, 2A"""			8985118	Standard	NM_052820		Approved	IR10, WDR2	uc004aym.3	Q92828	OTTHUMG00000020340	ENST00000343933.5:c.273C>G	9.37:g.100899899G>C	ENSP00000343746:p.Asn91Lys		Q5TBR5|Q92829|Q9BWS5	Missense_Mutation	SNP	ENST00000343933.5	37	CCDS6735.1	.	.	.	.	.	.	.	.	.	.	G	14.96	2.691135	0.48097	.	.	ENSG00000106789	ENST00000343933;ENST00000375077	T;T	0.61040	0.14;0.14	4.58	2.19	0.27852	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.68723	0.3032	M	0.66560	2.04	0.58432	D	0.999996	D	0.76494	0.999	D	0.81914	0.995	T	0.66460	-0.5918	10	0.59425	D	0.04	-33.4489	7.65	0.28342	0.3473:0.0:0.6527:0.0	.	91	Q92828	COR2A_HUMAN	K	91	ENSP00000343746:N91K;ENSP00000364218:N91K	ENSP00000343746:N91K	N	-	3	2	CORO2A	99939720	0.999000	0.42202	1.000000	0.80357	0.811000	0.45836	0.660000	0.25009	0.376000	0.24707	0.561000	0.74099	AAC		0.557	CORO2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053357.1		NM_003389	
F2RL3	9002	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	17003921	17003921	+	IGR	SNP	A	A	C			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr19:17003921A>C	ENST00000248076.3	+	0	3473				CPAMD8_ENST00000443236.1_Nonstop_Mutation_p.*1933E|CPAMD8_ENST00000597335.1_5'Flank	NM_003950.2	NP_003941.2	Q96RI0	PAR4_HUMAN	coagulation factor II (thrombin) receptor-like 3						blood coagulation (GO:0007596)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|platelet activation (GO:0030168)|platelet dense granule organization (GO:0060155)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|response to wounding (GO:0009611)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	thrombin receptor activity (GO:0015057)	p.*1933E(1)		cervix(1)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	7						ttgtaggattatctcaaGGTG	0.537																																																	1	Nonstop extension(1)	kidney(1)											51.0	51.0	51.0					19																	17003921		1959	4155	6114	SO:0001628	intergenic_variant	27151			AF055917	CCDS12350.1	19p12	2012-08-08						"""GPCR / Class A : Protease activated receptors"""	3540	protein-coding gene	gene with protein product	"""proteinase-activated receptor-4"""	602779				9618465	Standard	XM_005260139		Approved	PAR4	uc002nfa.3	Q96RI0			19.37:g.17003921A>C			O76067|Q6DK42	Missense_Mutation	SNP	ENST00000248076.3	37	CCDS12350.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	5.982|5.982	0.365178|0.365178	0.11352|0.11352	.|.	.|.	ENSG00000160111|ENSG00000160111	ENST00000443236|ENST00000291440	.|.	.|.	.|.	1.73|1.73	1.73|1.73	0.24493|0.24493	.|.	.|.	.|.	.|.	.|.	T|.	0.26048|.	0.0635|.	.|.	.|.	.|.	0.20975|0.20975	N|N	0.999814|0.999814	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.20075|.	-1.0286|.	4|.	.|.	.|.	.|.	.|.	5.5354|5.5354	0.17007|0.17007	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|.	.|.	.|.	E|E	1943|1933	.|.	.|.	D|X	-|-	3|1	2|0	CPAMD8|CPAMD8	16864921|16864921	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.019000|0.019000	0.09904|0.09904	-0.047000|-0.047000	0.11963|0.11963	1.063000|1.063000	0.40649|0.40649	0.402000|0.402000	0.26972|0.26972	GAT|TAA		0.537	F2RL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462875.1			
CSMD3	114788	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	113323219	113323219	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr8:113323219G>A	ENST00000297405.5	-	50	8117	c.7873C>T	c.(7873-7875)Cct>Tct	p.P2625S	CSMD3_ENST00000343508.3_Missense_Mutation_p.P2585S|CSMD3_ENST00000352409.3_Missense_Mutation_p.P2555S|CSMD3_ENST00000455883.2_Missense_Mutation_p.P2521S	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	2625	Sushi 14. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.P2625S(1)|p.P2585S(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						TGACAGGCAGGGACTGGCGCA	0.433										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																																							2	Substitution - Missense(2)	kidney(2)											110.0	91.0	98.0					8																	113323219		2203	4300	6503	SO:0001583	missense	114788			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.7873C>T	8.37:g.113323219G>A	ENSP00000297405:p.Pro2625Ser		Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.043309	0.75732	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.76968	-1.06;-1.06;-1.06;-1.06;-1.06	5.53	5.53	0.82687	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.64402	D	0.000001	D	0.93132	0.7813	H	0.97918	4.105	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.95395	0.8485	10	0.87932	D	0	.	19.4376	0.94804	0.0:0.0:1.0:0.0	.	2521;2625;2585	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	S	2585;2625;1895;2521;2555	ENSP00000345799:P2585S;ENSP00000297405:P2625S;ENSP00000341558:P1895S;ENSP00000412263:P2521S;ENSP00000343124:P2555S	ENSP00000297405:P2625S	P	-	1	0	CSMD3	113392395	1.000000	0.71417	0.957000	0.39632	0.360000	0.29518	9.864000	0.99589	2.581000	0.87130	0.591000	0.81541	CCT		0.433	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1		NM_052900	
DIAPH1	1729	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	140954549	140954549	+	Silent	SNP	G	G	T			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr5:140954549G>T	ENST00000398557.4	-	15	1766	c.1626C>A	c.(1624-1626)tcC>tcA	p.S542S	DIAPH1_ENST00000518047.1_Silent_p.S533S|DIAPH1_ENST00000398562.2_Silent_p.S533S|DIAPH1_ENST00000253811.6_Silent_p.S542S|DIAPH1_ENST00000398566.3_Silent_p.S533S|DIAPH1_ENST00000520569.1_Silent_p.S488S|DIAPH1_ENST00000389057.5_Silent_p.S533S|DIAPH1_ENST00000389054.3_Silent_p.S542S	NM_005219.4	NP_005210.3	O60610	DIAP1_HUMAN	diaphanous-related formin 1	542					actin filament polymerization (GO:0030041)|cellular response to histamine (GO:0071420)|cytoskeleton organization (GO:0007010)|positive regulation of cell migration (GO:0030335)|protein localization to microtubule (GO:0035372)|regulation of cell shape (GO:0008360)|regulation of microtubule-based process (GO:0032886)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|mitotic spindle (GO:0072686)|ruffle membrane (GO:0032587)	ion channel binding (GO:0044325)|poly(A) RNA binding (GO:0044822)|receptor binding (GO:0005102)	p.S542S(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(12)|pancreas(1)|skin(2)|stomach(2)	23			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGTGAGCTGGGACACCTCTG	0.502																																																	1	Substitution - coding silent(1)	kidney(1)											152.0	143.0	146.0					5																	140954549		2045	4202	6247	SO:0001819	synonymous_variant	1729			BC007411		5q31	2013-05-24	2013-05-24		ENSG00000131504	ENSG00000131504			2876	protein-coding gene	gene with protein product		602121	"""diaphanous (Drosophila, homolog) 1"", ""diaphanous homolog 1 (Drosophila)"""	DFNA1		9360932, 1350680	Standard	NM_005219		Approved	hDIA1, LFHL1	uc003llb.4	O60610	OTTHUMG00000149893	ENST00000398557.4:c.1626C>A	5.37:g.140954549G>T			A6NF18|B7ZKW2|E9PEZ2|Q17RN4|Q59FH8|Q9UC76	Silent	SNP	ENST00000398557.4	37	CCDS43374.1																																																																																				0.502	DIAPH1-203	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding			NM_005219	
DOT1L	84444	broad.mit.edu;ucsc.edu	37	19	2229790	2229790	+	Nonstop_Mutation	SNP	A	A	C			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr19:2229790A>C	ENST00000398665.3	+	28	4649	c.4613A>C	c.(4612-4614)tAg>tCg	p.*1538S		NM_032482.2	NP_115871.1	Q8TEK3	DOT1L_HUMAN	DOT1-like histone H3K79 methyltransferase	0					histone lysine methylation (GO:0034968)|regulation of JAK-STAT cascade (GO:0046425)|regulation of transcription regulatory region DNA binding (GO:2000677)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription factor binding (GO:0008134)	p.*1538S(1)		NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(2)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(9)	42		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCAGGTAACTAGGATTTCTAC	0.677																																																	1	Nonstop extension(1)	kidney(1)											96.0	103.0	101.0					19																	2229790		1997	4148	6145	SO:0001578	stop_lost	84444			AF509504	CCDS42460.1	19p13.3	2013-05-21	2013-05-21		ENSG00000104885	ENSG00000104885	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"""	24948	protein-coding gene	gene with protein product	"""histone methyltransferase DOT1L"""	607375	"""DOT1-like, histone H3 methyltransferase (S. cerevisiae)"""			11347906, 12123582	Standard	NM_032482		Approved	KIAA1814, DOT1, KMT4	uc002lvb.4	Q8TEK3	OTTHUMG00000150431	ENST00000398665.3:c.4613A>C	19.37:g.2229790A>C	ENSP00000381657:p.*1538Serext*63		O60379|Q96JL1	Nonstop_Mutation	SNP	ENST00000398665.3	37	CCDS42460.1	.	.	.	.	.	.	.	.	.	.	A	17.91	3.505369	0.64410	.	.	ENSG00000104885	ENST00000398665	.	.	.	4.34	4.34	0.51931	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.5652	0.50800	1.0:0.0:0.0:0.0	.	.	.	.	S	1538	.	.	X	+	2	0	DOT1L	2180790	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.735000	0.68587	1.732000	0.51606	0.459000	0.35465	TAG		0.677	DOT1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318066.1		NM_032482	
DPYSL4	10570	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	134012456	134012456	+	Silent	SNP	C	C	A			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr10:134012456C>A	ENST00000338492.4	+	8	956	c.792C>A	c.(790-792)atC>atA	p.I264I	DPYSL4_ENST00000368629.1_Silent_p.I164I|DPYSL4_ENST00000368627.1_Silent_p.I164I	NM_006426.2	NP_006417.2	O14531	DPYL4_HUMAN	dihydropyrimidinase-like 4	264					axon guidance (GO:0007411)|nervous system development (GO:0007399)|pyrimidine nucleobase catabolic process (GO:0006208)	cytosol (GO:0005829)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)	p.I264I(1)		NS(1)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		all_cancers(35;4.33e-08)|all_epithelial(44;6.75e-06)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)|Colorectal(31;0.19)		OV - Ovarian serous cystadenocarcinoma(35;7.21e-05)|Epithelial(32;8.01e-05)|all cancers(32;9.29e-05)|BRCA - Breast invasive adenocarcinoma(275;0.206)		CCGACGCCATCGCTCAGGCCA	0.672																																																	1	Substitution - coding silent(1)	kidney(1)											68.0	56.0	60.0					10																	134012456		2202	4300	6502	SO:0001819	synonymous_variant	10570			AB006713	CCDS7665.1	10q25.2-q26	2008-05-14			ENSG00000151640	ENSG00000151640			3016	protein-coding gene	gene with protein product		608407				8973361, 9652388	Standard	NM_006426		Approved	ULIP4, DRP-4	uc009ybb.3	O14531	OTTHUMG00000019283	ENST00000338492.4:c.792C>A	10.37:g.134012456C>A			B2RMQ1|D3DRG5|O00240|Q5T0Q7	Silent	SNP	ENST00000338492.4	37	CCDS7665.1																																																																																				0.672	DPYSL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051050.2			
DUS2	54920	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	68109279	68109279	+	Silent	SNP	C	C	A			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr16:68109279C>A	ENST00000565263.1	+	14	1448	c.954C>A	c.(952-954)gcC>gcA	p.A318A	RP11-67A1.2_ENST00000548144.1_RNA|DUS2_ENST00000358896.6_Silent_p.A318A|DUS2_ENST00000432752.1_Silent_p.A283A	NM_017803.3	NP_060273.1	Q9NX74	DUS2L_HUMAN	dihydrouridine synthase 2	318					negative regulation of cell death (GO:0060548)|negative regulation of protein kinase activity (GO:0006469)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)	double-stranded RNA binding (GO:0003725)|flavin adenine dinucleotide binding (GO:0050660)|protein kinase inhibitor activity (GO:0004860)|tRNA dihydrouridine synthase activity (GO:0017150)	p.A318A(1)									GCCTTGGTGCCTTCTATGAGG	0.592																																																	1	Substitution - coding silent(1)	kidney(1)											59.0	57.0	58.0					16																	68109279		2198	4300	6498	SO:0001819	synonymous_variant	54920				CCDS10859.1, CCDS61970.1	16q22.1	2013-07-23	2013-07-23	2013-07-23	ENSG00000167264	ENSG00000167264			26014	protein-coding gene	gene with protein product	"""SMM1 homolog (S. cerevisiae)"""	609707	"""dihydrouridine synthase 2-like (SMM1, S. cerevisiae)"", ""dihydrouridine synthase 2-like, SMM1 homolog (S. cerevisiae)"", ""dihydrouridine synthase 2-like"""	DUS2L		15994936, 22741570	Standard	NM_017803		Approved	FLJ20399, SMM1	uc002evj.4	Q9NX74	OTTHUMG00000137538	ENST00000565263.1:c.954C>A	16.37:g.68109279C>A			A8K3G3|Q4H4D9	Silent	SNP	ENST00000565263.1	37	CCDS10859.1																																																																																				0.592	DUS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268869.2		NM_017803	
FANCE	2178	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	35423912	35423912	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr6:35423912G>A	ENST00000229769.2	+	2	822	c.637G>A	c.(637-639)Ggg>Agg	p.G213R		NM_021922.2	NP_068741.1	Q9HB96	FANCE_HUMAN	Fanconi anemia, complementation group E	213	Interaction with FANCC.				DNA repair (GO:0006281)	Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.G213R(1)		NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(3)|ovary(1)|skin(2)	13						CAGTCCTGAGGGGAAGAGGGT	0.557			"""N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																														yes	Rec		Fanconi anaemia E	6	6p21-p22	2178	"""Fanconi anemia, complementation group E"""		L	1	Substitution - Missense(1)	kidney(1)											60.0	56.0	57.0					6																	35423912		2203	4300	6503	SO:0001583	missense	2178	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	AF265210	CCDS4805.1	6p22-p21	2014-09-17			ENSG00000112039	ENSG00000112039		"""Fanconi anemia, complementation groups"""	3586	protein-coding gene	gene with protein product		613976		FACE		7662964, 11001585	Standard	XM_005248885		Approved	FAE	uc003oko.1	Q9HB96	OTTHUMG00000014565	ENST00000229769.2:c.637G>A	6.37:g.35423912G>A	ENSP00000229769:p.Gly213Arg		A8K907|Q4ZGH2	Missense_Mutation	SNP	ENST00000229769.2	37	CCDS4805.1	.	.	.	.	.	.	.	.	.	.	G	4.812	0.150997	0.09185	.	.	ENSG00000112039	ENST00000229769	T	0.44881	0.91	5.41	0.035	0.14185	.	0.404248	0.27210	N	0.020403	T	0.06690	0.0171	L	0.29908	0.895	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.30707	-0.9969	10	0.09084	T	0.74	-8.3424	1.7224	0.02915	0.2138:0.2598:0.3859:0.1405	.	213	Q9HB96	FANCE_HUMAN	R	213	ENSP00000229769:G213R	ENSP00000229769:G213R	G	+	1	0	FANCE	35531890	0.001000	0.12720	0.007000	0.13788	0.162000	0.22319	0.150000	0.16263	0.222000	0.20900	0.511000	0.50034	GGG		0.557	FANCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040282.1			
FAT3	120114	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	92531032	92531032	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr11:92531032C>T	ENST00000298047.6	+	9	4870	c.4853C>T	c.(4852-4854)cCg>cTg	p.P1618L	FAT3_ENST00000525166.1_Missense_Mutation_p.P1468L|FAT3_ENST00000409404.2_Missense_Mutation_p.P1618L			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	1618	Cadherin 15. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P1618L(4)		NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				AAGATCGAACCGGTCCTAGGC	0.423										TCGA Ovarian(4;0.039)																																							4	Substitution - Missense(4)	endometrium(2)|kidney(2)											111.0	107.0	108.0					11																	92531032		1983	4160	6143	SO:0001583	missense	120114			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.4853C>T	11.37:g.92531032C>T	ENSP00000298047:p.Pro1618Leu		B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	37		.	.	.	.	.	.	.	.	.	.	C	17.15	3.315679	0.60524	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.55234	0.53;0.53;0.53	5.81	4.87	0.63330	.	.	.	.	.	T	0.73976	0.3656	M	0.83118	2.625	0.80722	D	1	D	0.89917	1.0	D	0.69654	0.965	T	0.77440	-0.2587	9	0.62326	D	0.03	.	17.0019	0.86383	0.0:0.8732:0.1268:0.0	.	1618	Q8TDW7-3	.	L	1618;1618;1468	ENSP00000298047:P1618L;ENSP00000387040:P1618L;ENSP00000432586:P1468L	ENSP00000298047:P1618L	P	+	2	0	FAT3	92170680	1.000000	0.71417	0.998000	0.56505	0.100000	0.18952	4.915000	0.63355	2.755000	0.94549	0.650000	0.86243	CCG		0.423	FAT3-201	KNOWN	basic	protein_coding	protein_coding			NM_001008781	
FBN1	2200	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	48782117	48782117	+	Nonsense_Mutation	SNP	C	C	A	rs564713154		TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr15:48782117C>A	ENST00000316623.5	-	25	3468	c.3013G>T	c.(3013-3015)Gag>Tag	p.E1005*		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	1005	TB 5.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.E1005*(2)		NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		CACAGCTCCTCGTACTCAGGA	0.537																																																	2	Substitution - Nonsense(2)	lung(1)|kidney(1)											108.0	102.0	104.0					15																	48782117		2198	4296	6494	SO:0001587	stop_gained	2200			X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.3013G>T	15.37:g.48782117C>A	ENSP00000325527:p.Glu1005*		B2RUU0|D2JYH6|Q15972|Q75N87	Nonsense_Mutation	SNP	ENST00000316623.5	37	CCDS32232.1	.	.	.	.	.	.	.	.	.	.	C	45	11.963042	0.99622	.	.	ENSG00000166147	ENST00000316623	.	.	.	5.56	5.56	0.83823	.	0.257208	0.43110	D	0.000614	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.09843	T	0.71	.	19.1065	0.93299	0.0:1.0:0.0:0.0	.	.	.	.	X	1005	.	ENSP00000325527:E1005X	E	-	1	0	FBN1	46569409	0.114000	0.22134	0.992000	0.48379	0.944000	0.59088	2.045000	0.41250	2.600000	0.87896	0.655000	0.94253	GAG		0.537	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417355.1			
FKBP11	51303	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	49315838	49315838	+	Nonsense_Mutation	SNP	T	T	A			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr12:49315838T>A	ENST00000550765.1	-	6	933	c.535A>T	c.(535-537)Aag>Tag	p.K179*	RP11-302B13.5_ENST00000398092.4_Intron|AC073610.5_ENST00000537495.1_3'UTR|CCDC65_ENST00000266984.5_Intron|FKBP11_ENST00000444214.2_Nonsense_Mutation_p.K77*	NM_016594.2	NP_057678.1	Q9NYL4	FKB11_HUMAN	FK506 binding protein 11, 19 kDa	179					chaperone-mediated protein folding (GO:0061077)|protein peptidyl-prolyl isomerization (GO:0000413)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)	p.K179*(1)		kidney(1)|large_intestine(3)|lung(1)	5						CTATTGGCCTTTCTGTATAGG	0.418																																																	1	Substitution - Nonsense(1)	kidney(1)											87.0	91.0	90.0					12																	49315838		2203	4300	6503	SO:0001587	stop_gained	51303			AF238079	CCDS8773.1, CCDS44870.1, CCDS44871.1	12q13.12	2008-08-04	2002-08-29			ENSG00000134285			18624	protein-coding gene	gene with protein product		610571	"""FK506 binding protein 11 (19 kDa)"""			12036304, 16596453	Standard	NM_016594		Approved	FKBP19	uc001rsp.3	Q9NYL4		ENST00000550765.1:c.535A>T	12.37:g.49315838T>A	ENSP00000449751:p.Lys179*		B4DWB7	Nonsense_Mutation	SNP	ENST00000550765.1	37	CCDS8773.1	.	.	.	.	.	.	.	.	.	.	T	36	5.781279	0.96929	.	.	ENSG00000134285	ENST00000444214;ENST00000550765	.	.	.	5.85	5.85	0.93711	.	0.105434	0.64402	D	0.000007	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.8662	15.5289	0.75936	0.0:0.0:0.0:1.0	.	.	.	.	X	77;179	.	ENSP00000412403:K77X	K	-	1	0	FKBP11	47602105	1.000000	0.71417	0.998000	0.56505	0.925000	0.55904	7.010000	0.76353	2.371000	0.80710	0.533000	0.62120	AAG		0.418	FKBP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408927.1		NM_016594	
GRM7	2917	broad.mit.edu;ucsc.edu	37	3	6903262	6903262	+	Missense_Mutation	SNP	A	A	C			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr3:6903262A>C	ENST00000357716.4	+	1	461	c.187A>C	c.(187-189)Agc>Cgc	p.S63R	GRM7_ENST00000402647.2_Missense_Mutation_p.S63R|GRM7_ENST00000389336.4_Missense_Mutation_p.S63R|GRM7_ENST00000486284.1_Missense_Mutation_p.S63R|GRM7_ENST00000403881.1_Missense_Mutation_p.S63R	NM_000844.3	NP_000835.1	Q14831	GRM7_HUMAN	glutamate receptor, metabotropic 7	63					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|adult behavior (GO:0030534)|conditioned taste aversion (GO:0001661)|multicellular organismal response to stress (GO:0033555)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of glutamate secretion (GO:0014050)|regulation of cyclase activity (GO:0031279)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|short-term memory (GO:0007614)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	asymmetric synapse (GO:0032279)|axon (GO:0030424)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)	adenylate cyclase inhibitor activity (GO:0010855)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|glutamate binding (GO:0016595)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)|PDZ domain binding (GO:0030165)|serine binding (GO:0070905)|voltage-gated calcium channel activity (GO:0005245)	p.S63R(1)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(35)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	76						CAAGGGTCCCAGCGGAGTGCC	0.662																																																	1	Substitution - Missense(1)	kidney(1)											21.0	22.0	21.0					3																	6903262		2202	4299	6501	SO:0001583	missense	2917			U92458	CCDS43042.1	3p26-p25	2014-06-12			ENSG00000196277	ENSG00000196277		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4599	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 87"""	604101				8288585, 8840028	Standard	NM_000844		Approved	GLUR7, GPRC1G, mGlu7, MGLUR7, PPP1R87	uc003bql.2	Q14831	OTTHUMG00000125549	ENST00000357716.4:c.187A>C	3.37:g.6903262A>C	ENSP00000350348:p.Ser63Arg		Q8NFS2|Q8NFS3|Q8NFS4	Missense_Mutation	SNP	ENST00000357716.4	37	CCDS43042.1	.	.	.	.	.	.	.	.	.	.	A	5.528	0.282287	0.10458	.	.	ENSG00000196277	ENST00000357716;ENST00000486284;ENST00000389336;ENST00000403881;ENST00000525747;ENST00000402647;ENST00000413492	T;T;T;T;T	0.72167	-0.63;-0.63;-0.63;-0.63;-0.63	5.38	5.38	0.77491	.	0.320653	0.30134	N	0.010340	T	0.51584	0.1683	N	0.16790	0.44	0.34484	D	0.704169	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.0;0.001	T	0.56860	-0.7909	10	0.19590	T	0.45	.	10.1121	0.42568	0.7227:0.2772:0.0:0.0	.	63;63;63	Q14831-5;Q14831;Q14831-2	.;GRM7_HUMAN;.	R	63	ENSP00000350348:S63R;ENSP00000417536:S63R;ENSP00000373987:S63R;ENSP00000385664:S63R;ENSP00000384585:S63R	ENSP00000350348:S63R	S	+	1	0	GRM7	6878262	0.000000	0.05858	1.000000	0.80357	0.993000	0.82548	0.329000	0.19698	2.026000	0.59711	0.455000	0.32223	AGC		0.662	GRM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000246895.3		NM_000844	
GTF3C1	2975	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	27523128	27523128	+	Silent	SNP	T	T	C			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr16:27523128T>C	ENST00000356183.4	-	7	1083	c.1068A>G	c.(1066-1068)acA>acG	p.T356T	GTF3C1_ENST00000561623.1_Silent_p.T356T	NM_001520.3	NP_001511.2	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide 1, alpha 220kDa	356					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription (GO:0009304)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)	p.T356T(1)		breast(2)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|liver(3)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	80						CTGGAGGCACTGTCTTGGAGA	0.527																																																	1	Substitution - coding silent(1)	kidney(1)											214.0	159.0	178.0					16																	27523128		2197	4300	6497	SO:0001819	synonymous_variant	2975			U06485	CCDS32414.1, CCDS66988.1	16p12	2010-03-23	2002-08-29			ENSG00000077235		"""General transcription factors"""	4664	protein-coding gene	gene with protein product		603246	"""general transcription factor IIIC, polypeptide 1 (alpha subunit, 220kD )"""			8164661, 8127861	Standard	NM_001520		Approved	TFIIIC220	uc002dov.2	Q12789		ENST00000356183.4:c.1068A>G	16.37:g.27523128T>C			B2RP21|Q12838|Q6DKN9|Q9Y4W9	Silent	SNP	ENST00000356183.4	37	CCDS32414.1																																																																																				0.527	GTF3C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433856.1		NM_001520	
HERC1	8925	hgsc.bcm.edu;ucsc.edu	37	15	63955309	63955310	+	Frame_Shift_Ins	INS	-	-	TT			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr15:63955309_63955310insTT	ENST00000443617.2	-	44	8861_8862	c.8774_8775insAA	c.(8773-8775)aatfs	p.N2925fs		NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	2925					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						CCTCATCTAAATTAAAGTCATA	0.455																																																	0																																										SO:0001589	frameshift_variant	8925			U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.8773_8774dupAA	15.37:g.63955310_63955311dupTT	ENSP00000390158:p.Asn2925fs		Q8IW65	Frame_Shift_Ins	INS	ENST00000443617.2	37	CCDS45277.1																																																																																				0.455	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418523.1		NM_003922	
HIBADH	11112	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	27570888	27570888	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr7:27570888G>T	ENST00000265395.2	-	7	981	c.775C>A	c.(775-777)Cct>Act	p.P259T		NM_152740.3	NP_689953.1	P31937	3HIDH_HUMAN	3-hydroxyisobutyrate dehydrogenase	259					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|pentose-phosphate shunt (GO:0006098)|small molecule metabolic process (GO:0044281)|valine catabolic process (GO:0006574)	mitochondrial matrix (GO:0005759)	3-hydroxyisobutyrate dehydrogenase activity (GO:0008442)|NAD binding (GO:0051287)|phosphogluconate dehydrogenase (decarboxylating) activity (GO:0004616)	p.P259T(1)		endometrium(4)|kidney(2)|lung(3)|ovary(2)|prostate(1)	12			GBM - Glioblastoma multiforme(3;0.0368)			CCAGGTACAGGATTATAAGTG	0.443																																																	1	Substitution - Missense(1)	kidney(1)											142.0	121.0	128.0					7																	27570888		2203	4300	6503	SO:0001583	missense	11112			AF529362	CCDS5414.1	7p15	2009-06-12			ENSG00000106049	ENSG00000106049	1.1.1.31		4907	protein-coding gene	gene with protein product		608475					Standard	NM_152740		Approved	NS5ATP1	uc003szf.3	P31937	OTTHUMG00000097035	ENST00000265395.2:c.775C>A	7.37:g.27570888G>T	ENSP00000265395:p.Pro259Thr		Q546Z2|Q9UDN3	Missense_Mutation	SNP	ENST00000265395.2	37	CCDS5414.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.112841	0.77210	.	.	ENSG00000106049	ENST00000265395	T	0.37584	1.19	6.17	6.17	0.99709	Dehydrogenase, multihelical (1);6-phosphogluconate dehydrogenase, C-terminal-like (1);	0.047437	0.85682	D	0.000000	T	0.77445	0.4131	H	0.98295	4.195	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	D	0.85164	0.0994	10	0.87932	D	0	-7.9317	20.8794	0.99867	0.0:0.0:1.0:0.0	.	259	P31937	3HIDH_HUMAN	T	259	ENSP00000265395:P259T	ENSP00000265395:P259T	P	-	1	0	HIBADH	27537413	1.000000	0.71417	0.978000	0.43139	0.452000	0.32318	9.869000	0.99810	2.941000	0.99782	0.655000	0.94253	CCT		0.443	HIBADH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214132.1		NM_152740	
HSPA6	3310	hgsc.bcm.edu	37	1	161495527	161495527	+	Missense_Mutation	SNP	A	A	T			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr1:161495527A>T	ENST00000309758.4	+	1	1492	c.1079A>T	c.(1078-1080)gAg>gTg	p.E360V	RP11-25K21.6_ENST00000537821.2_RNA	NM_002155.3	NP_002146.2	P17066	HSP76_HUMAN	heat shock 70kDa protein 6 (HSP70B')	360					ATP catabolic process (GO:0006200)|cellular response to heat (GO:0034605)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)	blood microparticle (GO:0072562)|centriole (GO:0005814)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|enzyme binding (GO:0019899)|heat shock protein binding (GO:0031072)|unfolded protein binding (GO:0051082)			endometrium(3)|large_intestine(5)|lung(9)|prostate(2)|skin(2)	21	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)			AACGGCAAGGAGCTGAACAAG	0.577																																																	0													17.0	17.0	17.0					1																	161495527		2202	4293	6495	SO:0001583	missense	3310				CCDS1231.1	1q23.3	2011-09-02	2002-08-29		ENSG00000173110	ENSG00000173110		"""Heat shock proteins / HSP70"""	5239	protein-coding gene	gene with protein product		140555	"""heat shock 70kD protein 6 (HSP70B')"""			1346391	Standard	NM_002155		Approved		uc001gaq.3	P17066	OTTHUMG00000034461	ENST00000309758.4:c.1079A>T	1.37:g.161495527A>T	ENSP00000310219:p.Glu360Val		Q1HBA8|Q8IYK7|Q9BT95	Missense_Mutation	SNP	ENST00000309758.4	37	CCDS1231.1	.	.	.	.	.	.	.	.	.	.	.	13.03	2.116496	0.37339	.	.	ENSG00000173110	ENST00000309758;ENST00000545155	T	0.01197	5.19	3.23	2.09	0.27110	.	0.000000	0.39341	U	0.001397	T	0.02012	0.0063	M	0.89095	3.005	0.41973	D	0.990767	P	0.43094	0.799	P	0.52454	0.699	T	0.32188	-0.9916	10	0.87932	D	0	.	6.2172	0.20661	0.8702:0.0:0.1298:0.0	.	360	P17066	HSP76_HUMAN	V	360;336	ENSP00000310219:E360V	ENSP00000310219:E360V	E	+	2	0	HSPA6	159762151	1.000000	0.71417	0.938000	0.37757	0.249000	0.25844	6.269000	0.72558	0.334000	0.23590	0.443000	0.29094	GAG		0.577	HSPA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083308.1		NM_002155	
LAMC2	3918	broad.mit.edu;hgsc.bcm.edu	37	1	183195848	183195848	+	Missense_Mutation	SNP	A	A	C			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr1:183195848A>C	ENST00000264144.4	+	9	1147	c.1082A>C	c.(1081-1083)gAc>gCc	p.D361A	LAMC2_ENST00000493293.1_Missense_Mutation_p.D361A	NM_005562.2	NP_005553.2	Q13753	LAMC2_HUMAN	laminin, gamma 2	361	Laminin IV type A. {ECO:0000255|PROSITE- ProRule:PRU00458}.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	cell cortex (GO:0005938)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-2 complex (GO:0005607)|laminin-5 complex (GO:0005610)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	heparin binding (GO:0008201)	p.D361A(1)		breast(2)|endometrium(6)|kidney(8)|large_intestine(11)|lung(18)|ovary(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55						GGGTACATTGACAATGTGACC	0.478																																																	1	Substitution - Missense(1)	kidney(1)											113.0	114.0	114.0					1																	183195848		2203	4300	6503	SO:0001583	missense	3918			Z15008	CCDS1352.1, CCDS44285.1	1q25-q31	2013-03-01	2002-08-29		ENSG00000058085	ENSG00000058085		"""Laminins"""	6493	protein-coding gene	gene with protein product		150292	"""laminin, gamma 2 (nicein (100kD), kalinin (105kD), BM600 (100kD), Herlitz junctional epidermolysis bullosa))"""	EBR2, LAMB2T, LAMNB2, EBR2A		1383240	Standard	NM_005562		Approved	nicein-100kDa, kalinin-105kDa, BM600-100kDa	uc001gqa.2	Q13753	OTTHUMG00000035520	ENST00000264144.4:c.1082A>C	1.37:g.183195848A>C	ENSP00000264144:p.Asp361Ala		Q02536|Q02537|Q13752|Q14941|Q14DF7|Q2M1N2|Q5VYE8	Missense_Mutation	SNP	ENST00000264144.4	37	CCDS1352.1	.	.	.	.	.	.	.	.	.	.	A	20.8	4.049117	0.75846	.	.	ENSG00000058085	ENST00000493293;ENST00000537180;ENST00000264144	T;T	0.36699	1.24;1.24	5.39	5.39	0.77823	Laminin B type IV (2);Laminin B, subgroup (1);Growth factor, receptor (1);	0.147928	0.47093	D	0.000250	T	0.54919	0.1888	M	0.65975	2.015	0.58432	D	0.999995	D;D;D	0.89917	1.0;0.983;0.999	D;P;D	0.69824	0.966;0.867;0.922	T	0.57335	-0.7829	10	0.56958	D	0.05	.	10.6007	0.45365	0.9247:0.0:0.0753:0.0	.	361;361;361	Q2M1N2;Q13753;Q13753-2	.;LAMC2_HUMAN;.	A	361	ENSP00000432063:D361A;ENSP00000264144:D361A	ENSP00000264144:D361A	D	+	2	0	LAMC2	181462471	1.000000	0.71417	0.994000	0.49952	0.977000	0.68977	3.856000	0.55964	2.032000	0.59987	0.448000	0.29417	GAC		0.478	LAMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086258.1		NM_005562	
LRIG3	121227	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	59268041	59268041	+	Frame_Shift_Del	DEL	A	A	-	rs143823251		TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr12:59268041delA	ENST00000320743.3	-	18	3197	c.2911delT	c.(2911-2913)tacfs	p.Y971fs	LRIG3_ENST00000379141.4_Frame_Shift_Del_p.Y911fs	NM_153377.4	NP_700356.2	Q6UXM1	LRIG3_HUMAN	leucine-rich repeats and immunoglobulin-like domains 3	971					otolith morphogenesis (GO:0032474)	cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)			LRIG3/ROS1(2)	breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(12)|liver(1)|lung(14)|ovary(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48			GBM - Glioblastoma multiforme(1;1.17e-18)			GAACATGGGTAGCACTCCTTT	0.433			T	ROS1	NSCLC																																			Dom	yes		12	12q14.1	121227	leucine-rich repeats and immunoglobulin-like domains 3		E	0													108.0	103.0	105.0					12																	59268041		2203	4300	6503	SO:0001589	frameshift_variant	121227			AY505340	CCDS8960.1, CCDS44933.1	12q13.2	2013-01-11				ENSG00000139263		"""Immunoglobulin superfamily / I-set domain containing"""	30991	protein-coding gene	gene with protein product		608870					Standard	NM_153377		Approved	FLJ90440, KIAA3016	uc001sqr.4	Q6UXM1	OTTHUMG00000169940	ENST00000320743.3:c.2911delT	12.37:g.59268041delA	ENSP00000326759:p.Tyr971fs		Q6UXL7|Q8NC72	Frame_Shift_Del	DEL	ENST00000320743.3	37	CCDS8960.1																																																																																				0.433	LRIG3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406623.1		NM_153377	
LRP12	29967	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	105507335	105507335	+	Silent	SNP	A	A	T			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr8:105507335A>T	ENST00000276654.5	-	6	1791	c.1683T>A	c.(1681-1683)gtT>gtA	p.V561V	LRP12_ENST00000424843.2_Silent_p.V542V|LRP12_ENST00000518375.1_5'UTR	NM_013437.4	NP_038465.1	Q9Y561	LRP12_HUMAN	low density lipoprotein receptor-related protein 12	561					endocytosis (GO:0006897)|receptor-mediated endocytosis (GO:0006898)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	low-density lipoprotein receptor activity (GO:0005041)	p.V561V(1)		NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48			OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)			GAAAATCTTCAACTGGTGGAA	0.358																																																	1	Substitution - coding silent(1)	kidney(1)											122.0	128.0	126.0					8																	105507335		2203	4300	6503	SO:0001819	synonymous_variant	29967			AF166350	CCDS6303.1, CCDS47907.1	8q22.2	2013-02-27	2010-01-26		ENSG00000147650	ENSG00000147650		"""Low density lipoprotein receptors"""	31708	protein-coding gene	gene with protein product						12809483, 14676824	Standard	NM_013437		Approved	ST7, FLJ12929	uc003yma.3	Q9Y561	OTTHUMG00000164892	ENST00000276654.5:c.1683T>A	8.37:g.105507335A>T			A8K137|B4DRQ2	Silent	SNP	ENST00000276654.5	37	CCDS6303.1																																																																																				0.358	LRP12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380821.1		NM_013437	
LRPPRC	10128	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	44145201	44145201	+	Missense_Mutation	SNP	T	T	A			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr2:44145201T>A	ENST00000260665.7	-	29	3168	c.3111A>T	c.(3109-3111)aaA>aaT	p.K1037N		NM_133259.3	NP_573566.2	P42704	LPPRC_HUMAN	leucine-rich pentatricopeptide repeat containing	1037					mitochondrion transport along microtubule (GO:0047497)|mRNA transport (GO:0051028)|negative regulation of mitochondrial RNA catabolic process (GO:0000961)|regulation of mitochondrial translation (GO:0070129)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|microtubule (GO:0005874)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribonucleoprotein complex (GO:0030529)	beta-tubulin binding (GO:0048487)|microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)	p.K1037N(1)		breast(3)|endometrium(3)|kidney(5)|large_intestine(9)|lung(15)|ovary(2)|prostate(2)|skin(2)	41		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				TCAATATATCTTTCTGGAAAT	0.413																																																	1	Substitution - Missense(1)	kidney(1)											98.0	95.0	96.0					2																	44145201		2203	4300	6503	SO:0001583	missense	10128			M92439	CCDS33189.1	2p21	2012-02-24	2012-02-24		ENSG00000138095	ENSG00000138095			15714	protein-coding gene	gene with protein product		607544	"""Leigh syndrome, French-Canadian type (cytochrome oxidase deficiency)"""	LSFC		8012652, 8619474, 22045337	Standard	NM_133259		Approved	GP130, LRP130	uc002rtr.2	P42704	OTTHUMG00000152782	ENST00000260665.7:c.3111A>T	2.37:g.44145201T>A	ENSP00000260665:p.Lys1037Asn		A0PJE3|A8K1V1|Q53PC0|Q53QN7|Q6ZUD8|Q7Z7A6|Q96D84	Missense_Mutation	SNP	ENST00000260665.7	37	CCDS33189.1	.	.	.	.	.	.	.	.	.	.	T	10.93	1.489903	0.26686	.	.	ENSG00000138095	ENST00000465633;ENST00000260665	T	0.57436	0.4	5.62	1.88	0.25563	.	0.429836	0.25570	N	0.029779	T	0.38532	0.1044	L	0.47716	1.5	0.09310	N	0.999999	B;B	0.14012	0.002;0.009	B;B	0.15052	0.004;0.012	T	0.30995	-0.9959	10	0.49607	T	0.09	-8.5132	2.7607	0.05306	0.1456:0.0811:0.1522:0.6212	.	937;1037	F5H4J6;P42704	.;LPPRC_HUMAN	N	937;1037	ENSP00000260665:K1037N	ENSP00000260665:K1037N	K	-	3	2	LRPPRC	43998705	0.009000	0.17119	0.012000	0.15200	0.004000	0.04260	-0.152000	0.10159	0.080000	0.16959	-0.444000	0.05651	AAA		0.413	LRPPRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327823.1		NM_133259	
MACF1	23499	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	39908131	39908131	+	Silent	SNP	C	C	A			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr1:39908131C>A	ENST00000372915.3	+	76	18780	c.18693C>A	c.(18691-18693)gcC>gcA	p.A6231A	MACF1_ENST00000539005.1_Silent_p.A4143A|MACF1_ENST00000317713.7_Silent_p.A4273A|MACF1_ENST00000545844.1_Silent_p.A4273A|MACF1_ENST00000567887.1_Silent_p.A6369A|MACF1_ENST00000564288.1_Silent_p.A6332A|MACF1_ENST00000361689.2_Silent_p.A4273A|MACF1_ENST00000289893.4_Silent_p.A4775A			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	6231					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)	p.A4273A(1)|p.A4775A(1)		breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TCCAGCATGCCTTAGAGGAAC	0.443																																																	2	Substitution - coding silent(2)	kidney(2)											62.0	63.0	63.0					1																	39908131		2203	4300	6503	SO:0001819	synonymous_variant	23499			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.18693C>A	1.37:g.39908131C>A			B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Silent	SNP	ENST00000372915.3	37		.	.	.	.	.	.	.	.	.	.	C	8.647	0.897413	0.17686	.	.	ENSG00000127603	ENST00000372925	.	.	.	6.03	3.99	0.46301	.	.	.	.	.	T	0.54967	0.1891	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52764	-0.8532	4	.	.	.	.	5.913	0.19039	0.1196:0.6422:0.1052:0.133	.	.	.	.	I	3277	.	.	L	+	1	0	MACF1	39680718	0.992000	0.36948	1.000000	0.80357	0.998000	0.95712	0.693000	0.25497	1.558000	0.49541	0.655000	0.94253	CTT		0.443	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1		NM_033044	
MGAT4B	11282	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	179225513	179225513	+	Splice_Site	SNP	G	G	A	rs552336424		TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr5:179225513G>A	ENST00000292591.7	-	12	1772	c.1422C>T	c.(1420-1422)gaC>gaT	p.D474D	MIR1229_ENST00000408467.1_RNA|MGAT4B_ENST00000337755.5_Splice_Site_p.D489D|MGAT4B_ENST00000521305.1_5'Flank	NM_014275.4	NP_055090.1	Q9UQ53	MGT4B_HUMAN	mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme B	474					cellular protein metabolic process (GO:0044267)|N-glycan processing (GO:0006491)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity (GO:0008454)|metal ion binding (GO:0046872)	p.D489D(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(2)|skin(1)|urinary_tract(1)	13	all_cancers(89;0.000201)|all_epithelial(37;6.84e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0525)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CCGAACTTACGTCGAAGGGCA	0.607													G|||	1	0.000199681	0.0	0.0	5008	,	,		18398	0.0		0.0	False		,,,				2504	0.001				GBM(13;414 434 4098 22176 23230)												1	Substitution - coding silent(1)	kidney(1)											104.0	84.0	91.0					5																	179225513		2203	4300	6503	SO:0001630	splice_region_variant	11282			AB000624	CCDS4448.1, CCDS4449.1	5q35	2013-02-25	2005-11-16		ENSG00000161013	ENSG00000161013	2.4.1.145	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7048	protein-coding gene	gene with protein product		604561	"""mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isoenzyme B"""			10372966	Standard	NM_014275		Approved	GnT-Ivb	uc003mks.3	Q9UQ53	OTTHUMG00000130912	ENST00000292591.7:c.1422+1C>T	5.37:g.179225513G>A			A8MPR0|Q86TF1|Q96GH4|Q9NSK6	Silent	SNP	ENST00000292591.7	37	CCDS4448.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.12|12.12	1.842028|1.842028	0.32513|0.32513	.|.	.|.	ENSG00000161013|ENSG00000161013	ENST00000518778;ENST00000520875|ENST00000520969;ENST00000518980;ENST00000518867	.|.	.|.	.|.	3.96|3.96	-5.89|-5.89	0.02282|0.02282	.|.	.|.	.|.	.|.	.|.	.|T	.|0.60418	.|0.2267	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.62868	.|-0.6763	.|4	.|.	.|.	.|.	-14.549|-14.549	13.4221|13.4221	0.61005|0.61005	0.4947:0.0:0.5053:0.0|0.4947:0.0:0.5053:0.0	.|.	.|.	.|.	.|.	X|I	299;255|166;220;235	.|.	.|.	Q|T	-|-	1|2	0|0	MGAT4B|MGAT4B	179158119|179158119	0.043000|0.043000	0.20138|0.20138	0.889000|0.889000	0.34880|0.34880	0.375000|0.375000	0.29983|0.29983	-0.700000|-0.700000	0.05081|0.05081	-0.869000|-0.869000	0.04052|0.04052	-0.672000|-0.672000	0.03802|0.03802	CAA|ACA		0.607	MGAT4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253503.3		NM_014275	Silent
MTMR14	64419	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	9724925	9724925	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr3:9724925G>A	ENST00000296003.4	+	10	1083	c.961G>A	c.(961-963)Gat>Aat	p.D321N	MTMR14_ENST00000420925.1_Missense_Mutation_p.D75N|MTMR14_ENST00000353332.5_Missense_Mutation_p.D321N|MTMR14_ENST00000351233.5_Missense_Mutation_p.D321N	NM_001077525.2	NP_001070993.1	Q8NCE2	MTMRE_HUMAN	myotubularin related protein 14	321					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein tyrosine phosphatase activity (GO:0004725)	p.D321N(1)		breast(1)|endometrium(3)|kidney(2)|lung(10)|skin(3)|upper_aerodigestive_tract(2)	21	Medulloblastoma(99;0.227)					AGTTAACAGTGATGGTGAGTC	0.478																																																	1	Substitution - Missense(1)	kidney(1)											82.0	85.0	84.0					3																	9724925		1951	4156	6107	SO:0001583	missense	64419			BC001674	CCDS43043.1, CCDS43044.1, CCDS43045.1	3p26	2011-06-09	2006-12-18	2006-12-18	ENSG00000163719	ENSG00000163719		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	26190	protein-coding gene	gene with protein product	"""egg-derived tyrosine phosphatase homolog (Drosophila)"""	611089	"""chromosome 3 open reading frame 29"""	C3orf29		15186772	Standard	NM_022485		Approved	FLJ22405, FLJ90311, hJumpy, hEDTP	uc003brz.3	Q8NCE2	OTTHUMG00000155111	ENST00000296003.4:c.961G>A	3.37:g.9724925G>A	ENSP00000296003:p.Asp321Asn		Q0JTH5|Q0JU83|Q6PIZ4|Q6QE21|Q86VK9|Q8IYK1|Q8TCM7|Q9H6C0	Missense_Mutation	SNP	ENST00000296003.4	37	CCDS43043.1	.	.	.	.	.	.	.	.	.	.	G	32	5.112955	0.94339	.	.	ENSG00000163719	ENST00000353332;ENST00000420925;ENST00000296003;ENST00000351233;ENST00000419048;ENST00000431250	D;D;D;D;D	0.92699	-2.62;-3.09;-2.62;-2.62;-2.62	5.72	5.72	0.89469	.	0.088300	0.85682	D	0.000000	D	0.93416	0.7900	L	0.59436	1.845	0.80722	D	1	B;P;B;B	0.51791	0.06;0.948;0.303;0.038	B;P;B;B	0.50490	0.094;0.642;0.111;0.01	D	0.93671	0.6990	10	0.72032	D	0.01	3.3056	19.8829	0.96904	0.0:0.0:1.0:0.0	.	75;321;321;321	C9JSR1;Q8NCE2-3;Q8NCE2-2;Q8NCE2	.;.;.;MTMRE_HUMAN	N	321;75;321;321;321;93	ENSP00000323462:D321N;ENSP00000401993:D75N;ENSP00000296003:D321N;ENSP00000334070:D321N;ENSP00000388746:D93N	ENSP00000296003:D321N	D	+	1	0	MTMR14	9699925	1.000000	0.71417	0.922000	0.36590	0.648000	0.38561	8.564000	0.90726	2.717000	0.92951	0.650000	0.86243	GAT		0.478	MTMR14-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338435.1		NM_022485	
MTMR9	66036	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	11142463	11142463	+	Silent	SNP	C	C	T			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr8:11142463C>T	ENST00000221086.3	+	1	539	c.66C>T	c.(64-66)taC>taT	p.Y22Y	MTMR9_ENST00000526292.1_5'Flank	NM_015458.3	NP_056273.2	Q96QG7	MTMR9_HUMAN	myotubularin related protein 9	22						cytoplasm (GO:0005737)	enzyme regulator activity (GO:0030234)|phosphatase activity (GO:0016791)	p.Y22Y(1)		cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|urinary_tract(2)	16			STAD - Stomach adenocarcinoma(15;0.215)	COAD - Colon adenocarcinoma(149;0.0678)		GGCCTTTCTACCCGGCTGTCG	0.647																																																	1	Substitution - coding silent(1)	kidney(1)											44.0	45.0	45.0					8																	11142463		2203	4300	6503	SO:0001819	synonymous_variant	66036			AJ297823	CCDS5979.1	8p23-p22	2011-06-09	2002-09-05	2002-09-06	ENSG00000104643	ENSG00000104643		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	14596	protein-coding gene	gene with protein product		606260	"""myotubularin related protein 8"""	C8orf9, MTMR8		11472061, 11896452, 12890864	Standard	NM_015458		Approved	DKFZp434K171, LIP-STYX	uc003wtm.3	Q96QG7	OTTHUMG00000090647	ENST00000221086.3:c.66C>T	8.37:g.11142463C>T			B7Z291|Q52LU3|Q8WW11|Q96QG6|Q9NX50	Silent	SNP	ENST00000221086.3	37	CCDS5979.1																																																																																				0.647	MTMR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207307.2		NM_015458	
MYO10	4651	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	16701663	16701663	+	Silent	SNP	G	G	A			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr5:16701663G>A	ENST00000513610.1	-	25	3295	c.2841C>T	c.(2839-2841)ttC>ttT	p.F947F	MYO10_ENST00000274203.9_Silent_p.F304F|MYO10_ENST00000515803.1_Silent_p.F286F|MYO10_ENST00000512061.1_5'Flank|MYO10_ENST00000427430.2_Silent_p.F304F|MYO10_ENST00000505695.1_Silent_p.F286F	NM_012334.2	NP_036466.2	Q9HD67	MYO10_HUMAN	myosin X	947					ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cytoskeleton-dependent intracellular transport (GO:0030705)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|regulation of cell shape (GO:0008360)|regulation of filopodium assembly (GO:0051489)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|plus-end directed microfilament motor activity (GO:0060002)|spectrin binding (GO:0030507)	p.F947F(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|lung(28)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	86						CGATCTCGTCGAAATTGAGGG	0.632																																																	1	Substitution - coding silent(1)	kidney(1)											38.0	44.0	42.0					5																	16701663		2150	4273	6423	SO:0001819	synonymous_variant	4651			AF247457	CCDS54834.1	5p15.1-p14.3	2013-01-10				ENSG00000145555		"""Myosins / Myosin superfamily : Class X"", ""Pleckstrin homology (PH) domain containing"""	7593	protein-coding gene	gene with protein product		601481				8884266	Standard	NM_012334		Approved	KIAA0799	uc003jft.4	Q9HD67		ENST00000513610.1:c.2841C>T	5.37:g.16701663G>A			A7E2D1|O94893|Q8IVX5|Q9NYM7|Q9P110|Q9P111|Q9UHF6	Silent	SNP	ENST00000513610.1	37	CCDS54834.1																																																																																				0.632	MYO10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366167.1		NM_012334	
NOL11	25926	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	65718733	65718733	+	Missense_Mutation	SNP	T	T	G			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr17:65718733T>G	ENST00000253247.4	+	5	614	c.499T>G	c.(499-501)Tta>Gta	p.L167V	NOL11_ENST00000535137.1_Intron	NM_015462.3	NP_056277.2	Q9H8H0	NOL11_HUMAN	nucleolar protein 11	167					maturation of SSU-rRNA (GO:0030490)|positive regulation of transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:1901838)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|t-UTP complex (GO:0034455)	poly(A) RNA binding (GO:0044822)	p.L167V(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)	11	all_cancers(12;1.54e-10)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0518)|COAD - Colon adenocarcinoma(4;0.0977)|LUSC - Lung squamous cell carcinoma(166;0.24)			ACATCCTGTTTTAATTTTTAT	0.294																																																	1	Substitution - Missense(1)	kidney(1)											38.0	41.0	40.0					17																	65718733		2199	4295	6494	SO:0001583	missense	25926			AK023702	CCDS11671.1	17q24.2	2005-08-08							24557	protein-coding gene	gene with protein product		615366				12477932	Standard	NM_015462		Approved	DKFZP586L0724	uc002jgd.1	Q9H8H0		ENST00000253247.4:c.499T>G	17.37:g.65718733T>G	ENSP00000253247:p.Leu167Val		B7Z5V9|Q7L5S1|Q9UG18	Missense_Mutation	SNP	ENST00000253247.4	37	CCDS11671.1	.	.	.	.	.	.	.	.	.	.	T	8.800	0.932577	0.18131	.	.	ENSG00000130935	ENST00000253247	T	0.21932	1.98	4.38	3.3	0.37823	.	0.082176	0.51477	D	0.000088	T	0.15696	0.0378	L	0.46157	1.445	0.80722	D	1	B	0.25390	0.125	B	0.20184	0.028	T	0.07366	-1.0776	10	0.32370	T	0.25	-13.0445	5.6028	0.17363	0.0:0.239:0.0:0.761	.	167	Q9H8H0	NOL11_HUMAN	V	167	ENSP00000253247:L167V	ENSP00000253247:L167V	L	+	1	2	NOL11	63149195	0.998000	0.40836	0.988000	0.46212	0.951000	0.60555	0.514000	0.22786	0.670000	0.31165	0.455000	0.32223	TTA		0.294	NOL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448074.1		NM_015462	
NPHP1	4867	broad.mit.edu;hgsc.bcm.edu	37	2	110926096	110926096	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr2:110926096G>T	ENST00000393272.3	-	6	654	c.557C>A	c.(556-558)cCt>cAt	p.P186H	NPHP1_ENST00000445609.2_Missense_Mutation_p.P186H|NPHP1_ENST00000355301.4_Missense_Mutation_p.P124H|NPHP1_ENST00000417665.1_Missense_Mutation_p.P186H|NPHP1_ENST00000316534.4_Missense_Mutation_p.P186H	NM_000272.3|NM_207181.2	NP_000263.2|NP_997064.2	O15259	NPHP1_HUMAN	nephronophthisis 1 (juvenile)	186	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				actin cytoskeleton organization (GO:0030036)|cell projection organization (GO:0030030)|cellular protein localization (GO:0034613)|excretion (GO:0007588)|photoreceptor cell outer segment organization (GO:0035845)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|spermatid differentiation (GO:0048515)|visual behavior (GO:0007632)	cell-cell junction (GO:0005911)|ciliary transition zone (GO:0035869)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|motile cilium (GO:0031514)|photoreceptor connecting cilium (GO:0032391)|tight junction (GO:0005923)	structural molecule activity (GO:0005198)	p.P186H(1)		autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|ovary(2)	24						CCAACCATCAGGTTTTTTTTC	0.343																																																	1	Substitution - Missense(1)	kidney(1)											135.0	139.0	138.0					2																	110926096		2203	4300	6503	SO:0001583	missense	4867			AF023674	CCDS2086.1, CCDS46384.1, CCDS46385.1, CCDS46386.1	2q13	2014-01-28			ENSG00000144061	ENSG00000144061			7905	protein-coding gene	gene with protein product	"""nephrocystin-1"""	607100		NPH1			Standard	NM_000272		Approved	JBTS4, SLSN1	uc002tfm.4	O15259	OTTHUMG00000131195	ENST00000393272.3:c.557C>A	2.37:g.110926096G>T	ENSP00000376953:p.Pro186His		O14837	Missense_Mutation	SNP	ENST00000393272.3	37	CCDS46385.1	.	.	.	.	.	.	.	.	.	.	G	17.33	3.362733	0.61403	.	.	ENSG00000144061	ENST00000316534;ENST00000445609;ENST00000393272;ENST00000355301;ENST00000417665	T;T;T;T;T	0.68479	-0.33;-0.33;-0.33;-0.33;-0.33	5.09	5.09	0.68999	Src homology-3 domain (4);	0.549745	0.20217	N	0.096779	T	0.68997	0.3062	L	0.28014	0.82	0.80722	D	1	D;D;D;D;D;D	0.89917	0.996;0.998;0.989;0.999;0.994;1.0	P;D;P;D;P;D	0.70935	0.823;0.937;0.893;0.956;0.73;0.971	T	0.69964	-0.5002	10	0.56958	D	0.05	-7.2232	9.5942	0.39565	0.096:0.0:0.904:0.0	.	186;186;124;186;186;186	B4DQY0;C9JNM7;O15259-3;O15259;O15259-2;O15259-4	.;.;.;NPHP1_HUMAN;.;.	H	186;186;186;124;186	ENSP00000313169:P186H;ENSP00000389879:P186H;ENSP00000376953:P186H;ENSP00000347452:P124H;ENSP00000402176:P186H	ENSP00000313169:P186H	P	-	2	0	NPHP1	110283385	1.000000	0.71417	0.493000	0.27502	0.977000	0.68977	4.008000	0.57103	2.362000	0.80069	0.462000	0.41574	CCT		0.343	NPHP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000253919.3		NM_000272	
OR4Q3	441669	broad.mit.edu;hgsc.bcm.edu	37	14	20216035	20216035	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr14:20216035G>T	ENST00000331723.1	+	1	449	c.449G>T	c.(448-450)tGg>tTg	p.W150L		NM_172194.1	NP_751944.1	Q8NH05	OR4Q3_HUMAN	olfactory receptor, family 4, subfamily Q, member 3	150						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.W150L(1)		NS(2)|breast(4)|endometrium(3)|kidney(2)|large_intestine(1)|lung(28)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)	47	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		CTTGCCTGCTGGTGTGGGGGT	0.498																																																	1	Substitution - Missense(1)	kidney(1)											88.0	91.0	90.0					14																	20216035		2203	4298	6501	SO:0001583	missense	441669			AF179768	CCDS32020.1	14p13	2012-08-09				ENSG00000182652		"""GPCR / Class A : Olfactory receptors"""	15426	protein-coding gene	gene with protein product				OR4Q4			Standard	NM_172194		Approved	C14orf13	uc010tkt.2	Q8NH05		ENST00000331723.1:c.449G>T	14.37:g.20216035G>T	ENSP00000330049:p.Trp150Leu		Q6IEX4	Missense_Mutation	SNP	ENST00000331723.1	37	CCDS32020.1	.	.	.	.	.	.	.	.	.	.	.	14.27	2.486596	0.44249	.	.	ENSG00000182652	ENST00000331723	T	0.58210	0.35	4.09	4.09	0.47781	GPCR, rhodopsin-like superfamily (1);	0.000000	0.38111	U	0.001819	T	0.73729	0.3624	M	0.85859	2.78	0.09310	N	0.999992	D	0.89917	1.0	D	0.80764	0.994	T	0.67421	-0.5675	10	0.87932	D	0	.	13.8329	0.63391	0.0:0.0:1.0:0.0	.	150	Q8NH05	OR4Q3_HUMAN	L	150	ENSP00000330049:W150L	ENSP00000330049:W150L	W	+	2	0	OR4Q3	19285875	1.000000	0.71417	1.000000	0.80357	0.794000	0.44872	1.386000	0.34419	2.105000	0.64084	0.406000	0.27484	TGG		0.498	OR4Q3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409818.2			
P2RX2	22953	hgsc.bcm.edu;ucsc.edu	37	12	133198066	133198067	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr12:133198066_133198067insA	ENST00000389110.3	+	10	1039_1040	c.1002_1003insA	c.(1003-1005)aagfs	p.K335fs	P2RX2_ENST00000350048.5_Frame_Shift_Ins_p.K311fs|P2RX2_ENST00000343948.4_Frame_Shift_Ins_p.K335fs|P2RX2_ENST00000352418.4_Frame_Shift_Ins_p.K263fs|P2RX2_ENST00000348800.5_Frame_Shift_Ins_p.K335fs|P2RX2_ENST00000351222.4_Frame_Shift_Ins_p.K243fs|P2RX2_ENST00000449132.2_Frame_Shift_Ins_p.K301fs	NM_170682.2|NM_170683.2|NM_174873.1	NP_733782.1|NP_733783.1|NP_777362.1	Q9UBL9	P2RX2_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 2	335					behavioral response to pain (GO:0048266)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of hypoxic conditions in blood by carotid body chemoreceptor signaling (GO:0003029)|ion transmembrane transport (GO:0034220)|neuromuscular junction development (GO:0007528)|neuromuscular synaptic transmission (GO:0007274)|neuronal action potential (GO:0019228)|peristalsis (GO:0030432)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of calcium-mediated signaling (GO:0050850)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|purinergic nucleotide receptor signaling pathway (GO:0035590)|response to ATP (GO:0033198)|response to carbohydrate (GO:0009743)|response to hypoxia (GO:0001666)|sensory perception of sound (GO:0007605)|sensory perception of taste (GO:0050909)|skeletal muscle fiber development (GO:0048741)|urinary bladder smooth muscle contraction (GO:0014832)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|dendritic spine (GO:0043197)|integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|cadmium ion binding (GO:0046870)|cobalt ion binding (GO:0050897)|copper ion binding (GO:0005507)|drug binding (GO:0008144)|extracellular ATP-gated cation channel activity (GO:0004931)|identical protein binding (GO:0042802)|ligand-gated ion channel activity (GO:0015276)|mercury ion binding (GO:0045340)|nickel cation binding (GO:0016151)|phosphatidylinositol binding (GO:0035091)|purinergic nucleotide receptor activity (GO:0001614)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|kidney(2)|large_intestine(2)|liver(2)|lung(8)|ovary(1)|prostate(3)	20	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0767)		OV - Ovarian serous cystadenocarcinoma(86;2.32e-08)|Epithelial(86;8.62e-08)|all cancers(50;4.5e-06)		CCCAGGCCGGGAAGTTCAGCCT	0.624																																																	0																																										SO:0001589	frameshift_variant	22953			AF109387	CCDS31930.1, CCDS31931.1, CCDS31932.1, CCDS31933.1, CCDS31934.1, CCDS31935.1, CCDS61286.1, CCDS73548.1	12q24.33	2013-03-22			ENSG00000187848	ENSG00000187848		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	15459	protein-coding gene	gene with protein product		600844	"""deafness, autosomal dominant 41"""	DFNA41		10570044, 7523952, 23345450	Standard	XM_005266154		Approved	P2X2	uc001ukk.1	Q9UBL9	OTTHUMG00000168018	ENST00000389110.3:c.1004dupA	12.37:g.133198068_133198068dupA	ENSP00000373762:p.Lys335fs		A6NGB4|A6NH93|A6NHC2|A6NHU3|A6NIG9|Q6V9R6|Q9NR37|Q9NR38|Q9UHD5|Q9UHD6|Q9UHD7|Q9Y637|Q9Y638	Frame_Shift_Ins	INS	ENST00000389110.3	37	CCDS31931.1																																																																																				0.624	P2RX2-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397542.1			
PBRM1	55193	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	52623121	52623122	+	Frame_Shift_Del	DEL	AT	AT	-			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	AT	AT	AT	-	AT	AT	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr3:52623121_52623122delAT	ENST00000296302.7	-	18	2930_2931	c.2929_2930delAT	c.(2929-2931)atcfs	p.I977fs	PBRM1_ENST00000409767.1_Frame_Shift_Del_p.I992fs|PBRM1_ENST00000337303.4_Frame_Shift_Del_p.I977fs|PBRM1_ENST00000409057.1_Frame_Shift_Del_p.I977fs|PBRM1_ENST00000394830.3_Frame_Shift_Del_p.I977fs|PBRM1_ENST00000409114.3_Frame_Shift_Del_p.I992fs|PBRM1_ENST00000410007.1_Frame_Shift_Del_p.I977fs|PBRM1_ENST00000356770.4_Frame_Shift_Del_p.I945fs			Q86U86	PB1_HUMAN	polybromo 1	977	BAH 1. {ECO:0000255|PROSITE- ProRule:PRU00370}.				chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		AATACAGACGATATGTGGTTGT	0.426			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																			Rec	yes		3	3p21	55193	polybromo 1		E	0																																										SO:0001589	frameshift_variant	55193			BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.2929_2930delAT	3.37:g.52623123_52623124delAT	ENSP00000296302:p.Ile977fs		A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Frame_Shift_Del	DEL	ENST00000296302.7	37																																																																																					0.426	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1		NM_018165	
PCDHA12	56137	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	140256882	140256882	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr5:140256882T>C	ENST00000398631.2	+	1	1825	c.1825T>C	c.(1825-1827)Tac>Cac	p.Y609H	PCDHA4_ENST00000530339.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA2_ENST00000526136.1_Intron	NM_018903.2|NM_031864.2	NP_061726.1|NP_114070.1	Q9UN75	PCDAC_HUMAN	protocadherin alpha 12	609	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.Y609H(1)		NS(4)|breast(2)|cervix(1)|endometrium(19)|kidney(8)|large_intestine(8)|liver(2)|lung(25)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTGGCTGTCCTACGAGTTGCA	0.667																																					Pancreas(113;759 1672 13322 24104 50104)												1	Substitution - Missense(1)	kidney(1)											386.0	337.0	353.0					5																	140256882		2203	4299	6502	SO:0001583	missense	56137			AF152477	CCDS47285.1, CCDS75327.1	5q31	2010-11-26			ENSG00000251664	ENSG00000251664		"""Cadherins / Protocadherins : Clustered"""	8666	other	complex locus constituent	"""KIAA0345-like 2"""	606318				10380929	Standard	NM_018903		Approved	PCDH-ALPHA12	uc003lic.2	Q9UN75	OTTHUMG00000163366	ENST00000398631.2:c.1825T>C	5.37:g.140256882T>C	ENSP00000381628:p.Tyr609His		O75278|Q2M1N8	Missense_Mutation	SNP	ENST00000398631.2	37	CCDS47285.1	.	.	.	.	.	.	.	.	.	.	T	13.61	2.287187	0.40494	.	.	ENSG00000251664	ENST00000398631	T	0.62941	-0.01	4.71	4.71	0.59529	Cadherin (4);Cadherin-like (1);	.	.	.	.	D	0.88518	0.6458	H	0.99726	4.73	0.25205	N	0.990029	D;D	0.89917	1.0;1.0	D;D	0.83275	0.987;0.996	D	0.83935	0.0308	9	0.87932	D	0	.	13.8645	0.63581	0.0:0.0:0.0:1.0	.	609;609	Q9UN75-2;Q9UN75	.;PCDAC_HUMAN	H	609	ENSP00000381628:Y609H	ENSP00000381628:Y609H	Y	+	1	0	PCDHA12	140237066	0.977000	0.34250	0.045000	0.18777	0.425000	0.31504	5.704000	0.68347	1.752000	0.51891	0.459000	0.35465	TAC		0.667	PCDHA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372882.2		NM_018903	
PCNX	22990	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	71462626	71462626	+	Silent	SNP	T	T	C			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr14:71462626T>C	ENST00000304743.2	+	8	3059	c.2613T>C	c.(2611-2613)agT>agC	p.S871S	PCNX_ENST00000439984.3_Intron|PCNX_ENST00000238570.5_Silent_p.S871S	NM_014982.2	NP_055797.2	Q96RV3	PCX1_HUMAN	pecanex homolog (Drosophila)	871						integral component of membrane (GO:0016021)		p.S871S(1)		NS(2)|biliary_tract(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(14)|liver(2)|lung(40)|ovary(1)|prostate(7)|skin(2)|urinary_tract(1)	87			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		GCGGTAGCAGTTTGCACGATG	0.443																																																	1	Substitution - coding silent(1)	kidney(1)											124.0	102.0	110.0					14																	71462626		2203	4300	6503	SO:0001819	synonymous_variant	22990			AF233450, AB018348	CCDS9806.1	14q24.2	2014-07-03							19740	protein-coding gene	gene with protein product			"""pecanex-like 1 (Drosophila)"""	PCNXL1		9244429, 15777640	Standard	NM_014982		Approved	KIAA0995, KIAA0805, pecanex	uc001xmo.2	Q96RV3		ENST00000304743.2:c.2613T>C	14.37:g.71462626T>C			B2RTR6|O94897|Q96AI7|Q9Y2J9	Silent	SNP	ENST00000304743.2	37	CCDS9806.1																																																																																				0.443	PCNX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412479.1		NM_014982	
PEG3	5178	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	57325778	57325778	+	Missense_Mutation	SNP	G	G	C			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr19:57325778G>C	ENST00000326441.9	-	10	4395	c.4032C>G	c.(4030-4032)agC>agG	p.S1344R	PEG3_ENST00000423103.2_Missense_Mutation_p.S1344R|ZIM2_ENST00000601070.1_Intron|ZIM2_ENST00000599935.1_Intron|ZIM2_ENST00000391708.3_Intron|PEG3_ENST00000593695.1_Missense_Mutation_p.S1218R|PEG3_ENST00000598410.1_Missense_Mutation_p.S1220R|ZIM2_ENST00000221722.5_Intron|ZIM2_ENST00000593711.1_Intron	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	1344					apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.S1344R(2)		NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		TGAGGACTGTGCTATGAATAA	0.463																																																	2	Substitution - Missense(2)	kidney(2)											71.0	69.0	70.0					19																	57325778		2203	4300	6503	SO:0001583	missense	5178			AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.4032C>G	19.37:g.57325778G>C	ENSP00000326581:p.Ser1344Arg		A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Missense_Mutation	SNP	ENST00000326441.9	37	CCDS12948.1	.	.	.	.	.	.	.	.	.	.	G	9.677	1.148287	0.21288	.	.	ENSG00000198300	ENST00000326441;ENST00000423103	T;T	0.51325	0.71;0.71	4.48	3.45	0.39498	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	1.100610	0.06942	N	0.813069	T	0.36908	0.0984	N	0.17901	0.54	.	.	.	B;P;P	0.38677	0.033;0.642;0.642	B;B;B	0.43360	0.043;0.417;0.339	T	0.36212	-0.9757	9	0.29301	T	0.29	-11.7891	5.5865	0.17277	0.0987:0.0:0.7055:0.1958	.	1220;1344;1279	A7E2B8;Q9GZU2;Q96Q96	.;PEG3_HUMAN;.	R	1344	ENSP00000326581:S1344R;ENSP00000403051:S1344R	ENSP00000326581:S1344R	S	-	3	2	ZIM2	62017590	0.000000	0.05858	0.062000	0.19696	0.984000	0.73092	-0.093000	0.11111	1.480000	0.48289	0.655000	0.94253	AGC		0.463	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416099.2			
PI4KA	5297	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	22	21075676	21075676	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr22:21075676C>T	ENST00000572273.1	-	43	5082	c.4852G>A	c.(4852-4854)Gca>Aca	p.A1618T	AC007308.6_ENST00000430719.1_RNA|PI4KA_ENST00000414196.3_Missense_Mutation_p.A428T|PI4KA_ENST00000255882.6_Missense_Mutation_p.A1676T			P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase, catalytic, alpha	1618	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi-associated vesicle membrane (GO:0030660)|membrane (GO:0016020)|plasma membrane (GO:0005886)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)	p.A1618T(2)		breast(3)|endometrium(8)|kidney(9)|large_intestine(19)|lung(29)|ovary(1)|pancreas(1)|prostate(3)|salivary_gland(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	79	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			TTAGACGCTGCCCACAGAATA	0.532																																					GBM(136;1332 1831 3115 23601 50806)												2	Substitution - Missense(2)	kidney(2)											129.0	119.0	123.0					22																	21075676		2203	4300	6503	SO:0001583	missense	5297			L36151	CCDS33603.1, CCDS33603.2	22q11.21	2011-05-25	2007-08-14	2007-08-02	ENSG00000241973	ENSG00000241973			8983	protein-coding gene	gene with protein product		600286		PIK4CA		7961848, 8662589	Standard	NM_002650		Approved	PI4K-ALPHA, pi4K230	uc002zsz.5	P42356	OTTHUMG00000167440	ENST00000572273.1:c.4852G>A	22.37:g.21075676C>T	ENSP00000458238:p.Ala1618Thr		Q7Z625|Q9UPG2	Missense_Mutation	SNP	ENST00000572273.1	37		.	.	.	.	.	.	.	.	.	.	C	33	5.270873	0.95429	.	.	ENSG00000241973	ENST00000255882;ENST00000414196;ENST00000399213	T;T	0.62941	-0.01;-0.01	5.12	5.12	0.69794	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.64327	0.2588	N	0.20530	0.585	0.80722	D	1	P;D	0.56035	0.786;0.974	P;D	0.63033	0.752;0.91	T	0.59402	-0.7461	10	0.16420	T	0.52	-12.2673	18.5538	0.91075	0.0:1.0:0.0:0.0	.	11;1618	A8MTF1;P42356	.;PI4KA_HUMAN	T	1618;428;11	ENSP00000402981:A428T;ENSP00000382162:A11T	ENSP00000255882:A1618T	A	-	1	0	PI4KA	19405676	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.627000	0.83176	2.389000	0.81357	0.591000	0.81541	GCA		0.532	PI4KA-202	KNOWN	basic|appris_principal	protein_coding	protein_coding			NM_058004	
PIP5KL1	138429	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	130687392	130687392	+	Missense_Mutation	SNP	G	G	C	rs149767177	byFrequency	TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr9:130687392G>C	ENST00000388747.4	-	9	955	c.911C>G	c.(910-912)aCg>aGg	p.T304R	PIP5KL1_ENST00000300432.3_Missense_Mutation_p.T101R|PIP5KL1_ENST00000490773.1_5'Flank	NM_001135219.1	NP_001128691.1	Q5T9C9	PI5L1_HUMAN	phosphatidylinositol-4-phosphate 5-kinase-like 1	304	PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.					cell projection (GO:0042995)|cytoplasm (GO:0005737)|membrane (GO:0016020)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)	p.T304R(1)|p.T101R(1)		endometrium(1)|kidney(2)|large_intestine(1)|lung(3)|skin(1)	8						TCACCTGGCCGTGCGGAAGAT	0.617																																																	2	Substitution - Missense(2)	kidney(2)											73.0	78.0	76.0					9																	130687392		2203	4300	6503	SO:0001583	missense	138429			BC042184	CCDS6885.1, CCDS48030.1	9q34.13	2008-02-05			ENSG00000167103	ENSG00000167103			28711	protein-coding gene	gene with protein product		612865				12477932	Standard	NM_001135219		Approved	bA203J24.5, MGC46424	uc011mao.2	Q5T9C9	OTTHUMG00000020719	ENST00000388747.4:c.911C>G	9.37:g.130687392G>C	ENSP00000373399:p.Thr304Arg		Q8IVS3	Missense_Mutation	SNP	ENST00000388747.4	37	CCDS48030.1	.	.	.	.	.	.	.	.	.	.	G	15.13	2.743019	0.49151	.	.	ENSG00000167103	ENST00000388747;ENST00000300432	T;T	0.29397	1.57;1.57	4.83	-2.67	0.06059	Phosphatidylinositol-4-phosphate 5-kinase, core (2);	1.526220	0.03908	N	0.281412	T	0.38480	0.1042	L	0.57536	1.79	0.18873	N	0.999986	P	0.50066	0.931	P	0.50314	0.637	T	0.47623	-0.9103	10	0.23302	T	0.38	0.4924	10.4932	0.44762	0.6486:0.0:0.3514:0.0	.	304	Q5T9C9	PI5L1_HUMAN	R	304;101	ENSP00000373399:T304R;ENSP00000300432:T101R	ENSP00000300432:T101R	T	-	2	0	PIP5KL1	129727213	0.001000	0.12720	0.004000	0.12327	0.026000	0.11368	-0.156000	0.10100	-0.448000	0.07128	-0.339000	0.08088	ACG		0.617	PIP5KL1-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054289.2		NM_173492	
PKP2	5318	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	32976979	32976979	+	Splice_Site	SNP	C	C	G			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr12:32976979C>G	ENST00000070846.6	-	8	1830	c.1806G>C	c.(1804-1806)aaG>aaC	p.K602N	PKP2_ENST00000340811.4_Splice_Site_p.K558N	NM_004572.3	NP_004563.2	Q99959	PKP2_HUMAN	plakophilin 2	602					adherens junction maintenance (GO:0034334)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential (GO:0086001)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cell-cell signaling involved in cardiac conduction (GO:0086019)|desmosome assembly (GO:0002159)|gap junction assembly (GO:0016264)|heart development (GO:0007507)|intermediate filament bundle assembly (GO:0045110)|lipid homeostasis (GO:0055088)|maintenance of organ identity (GO:0048496)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|positive regulation of sodium ion transport (GO:0010765)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of tight junction assembly (GO:2000810)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	adherens junction (GO:0005912)|cell junction (GO:0030054)|cell-cell junction (GO:0005911)|desmosome (GO:0030057)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intermediate filament binding (GO:0019215)|ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|protein kinase C binding (GO:0005080)|sodium channel regulator activity (GO:0017080)	p.K602N(1)		NS(1)|breast(2)|endometrium(1)|kidney(9)|large_intestine(8)|lung(21)|ovary(1)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	50	Lung NSC(5;9.35e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)					CTTGAATTACCTTGTCATCTG	0.398																																																	1	Substitution - Missense(1)	kidney(1)											139.0	120.0	126.0					12																	32976979		2203	4300	6503	SO:0001630	splice_region_variant	5318			X97675	CCDS8731.1, CCDS31771.1	12p11	2014-09-17				ENSG00000057294		"""Armadillo repeat containing"""	9024	protein-coding gene	gene with protein product		602861				8922383	Standard	NM_001005242		Approved		uc001rlj.4	Q99959	OTTHUMG00000169500	ENST00000070846.6:c.1806+1G>C	12.37:g.32976979C>G			A0AV37|B8QFA1|B8QGS6|B8QGS7|D3DUW9|Q4VC01|Q99960	Missense_Mutation	SNP	ENST00000070846.6	37	CCDS8731.1	.	.	.	.	.	.	.	.	.	.	C	17.33	3.361164	0.61403	.	.	ENSG00000057294	ENST00000340811;ENST00000070846;ENST00000537278	D;D	0.85339	-1.97;-1.97	5.32	3.5	0.40072	Armadillo-like helical (1);Armadillo-type fold (1);	0.156332	0.56097	D	0.000029	D	0.92479	0.7612	M	0.87097	2.86	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.995;0.995	D	0.92334	0.5876	9	.	.	.	-0.5275	13.0404	0.58895	0.0:0.9004:0.0:0.0996	.	558;558;602	Q99959-2;A0AV37;Q99959	.;.;PKP2_HUMAN	N	558;602;602	ENSP00000342800:K558N;ENSP00000070846:K602N	.	K	-	3	2	PKP2	32868246	1.000000	0.71417	0.997000	0.53966	0.535000	0.34838	5.017000	0.64047	0.633000	0.30452	0.585000	0.79938	AAG		0.398	PKP2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000404449.1		NM_004572	Missense_Mutation
PLOD2	5352	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	145788846	145788846	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr3:145788846C>T	ENST00000360060.3	-	18	2218	c.2041G>A	c.(2041-2043)Gtg>Atg	p.V681M	RP11-274H2.3_ENST00000490375.1_RNA|PLOD2_ENST00000282903.5_Missense_Mutation_p.V702M|RP11-274H2.2_ENST00000480247.1_RNA|PLOD2_ENST00000494950.1_Missense_Mutation_p.V647M|PLOD2_ENST00000461497.1_Missense_Mutation_p.V362M|RP11-274H2.2_ENST00000494745.2_RNA	NM_000935.2	NP_000926.2	O00469	PLOD2_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2	681	Fe2OG dioxygenase. {ECO:0000255|PROSITE- ProRule:PRU00805}.				cellular protein modification process (GO:0006464)|extracellular matrix organization (GO:0030198)|response to hypoxia (GO:0001666)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-lysine 5-dioxygenase activity (GO:0008475)	p.V702M(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29					Vitamin C(DB00126)	TCTTCTCCCACGTTATTAAGT	0.343																																																	1	Substitution - Missense(1)	kidney(1)											72.0	73.0	73.0					3																	145788846		2203	4300	6503	SO:0001583	missense	5352			U84573	CCDS3131.1, CCDS3132.1	3q24	2011-08-24	2005-01-04		ENSG00000152952	ENSG00000152952			9082	protein-coding gene	gene with protein product	"""lysyl hydroxlase 2"""	601865	"""procollagen-lysine, 2-oxoglutarate 5-dioxygenase (lysine hydroxylase) 2"""			9054364	Standard	XM_005247535		Approved	LH2	uc003evr.1	O00469	OTTHUMG00000159417	ENST00000360060.3:c.2041G>A	3.37:g.145788846C>T	ENSP00000353170:p.Val681Met		B3KWS3|Q59ED2|Q8N170	Missense_Mutation	SNP	ENST00000360060.3	37	CCDS3131.1	.	.	.	.	.	.	.	.	.	.	C	14.29	2.490045	0.44249	.	.	ENSG00000152952	ENST00000461497;ENST00000282903;ENST00000360060;ENST00000494950	D;T;T;T	0.90385	-2.66;-0.08;-0.07;-0.07	4.85	4.85	0.62838	Oxoglutarate/iron-dependent oxygenase (2);Prolyl 4-hydroxylase, alpha subunit (1);	0.269957	0.37437	N	0.002094	D	0.94404	0.8200	M	0.75615	2.305	0.40517	D	0.980793	D;D;D;D	0.71674	0.996;0.991;0.998;0.997	P;P;D;D	0.64042	0.763;0.803;0.921;0.909	D	0.93964	0.7243	10	0.35671	T	0.21	-15.3527	17.95	0.89050	0.0:1.0:0.0:0.0	.	647;681;702;362	E7ETU9;O00469;O00469-2;B3KWS3	.;PLOD2_HUMAN;.;.	M	362;702;681;647	ENSP00000419354:V362M;ENSP00000282903:V702M;ENSP00000353170:V681M;ENSP00000420094:V647M	ENSP00000282903:V702M	V	-	1	0	PLOD2	147271536	0.996000	0.38824	0.995000	0.50966	0.259000	0.26198	3.000000	0.49481	2.247000	0.74100	0.585000	0.79938	GTG		0.343	PLOD2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000355185.1		NM_000935	
POLG2	11232	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	62479086	62479086	+	Missense_Mutation	SNP	T	T	C	rs146731596		TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr17:62479086T>C	ENST00000539111.2	-	6	1208	c.1141A>G	c.(1141-1143)Att>Gtt	p.I381V	POLG2_ENST00000582501.1_5'UTR	NM_007215.3	NP_009146.2	Q9UHN1	DPOG2_HUMAN	polymerase (DNA directed), gamma 2, accessory subunit	381					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-dependent DNA replication (GO:0006261)	extracellular vesicular exosome (GO:0070062)|mitochondrial chromosome (GO:0000262)|mitochondrial nucleoid (GO:0042645)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)	p.I381V(1)		central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(4)|skin(2)|stomach(1)|urinary_tract(1)	15	Breast(5;2.15e-14)		BRCA - Breast invasive adenocarcinoma(8;4.97e-11)			GCAACCTTAATAGGGGCTAAA	0.373																																					Colon(3;18 21 435 17652 48887)												1	Substitution - Missense(1)	kidney(1)						T	VAL/ILE	1,4405	2.1+/-5.4	0,1,2202	69.0	69.0	69.0		1141	-4.3	0.3	17	dbSNP_134	69	0,8600		0,0,4300	no	missense	POLG2	NM_007215.3	29	0,1,6502	CC,CT,TT		0.0,0.0227,0.0077	benign	381/486	62479086	1,13005	2203	4300	6503	SO:0001583	missense	11232			U94703	CCDS32706.1	17q23.3	2012-05-18			ENSG00000256525	ENSG00000256525		"""DNA polymerases"""	9180	protein-coding gene	gene with protein product		604983				9153213	Standard	NM_007215		Approved	MTPOLB, HP55	uc002jei.3	Q9UHN1		ENST00000539111.2:c.1141A>G	17.37:g.62479086T>C	ENSP00000442563:p.Ile381Val		O00419|Q0IJ81|Q96GW2|Q9UK35|Q9UK94	Missense_Mutation	SNP	ENST00000539111.2	37	CCDS32706.1	.	.	.	.	.	.	.	.	.	.	T	7.056	0.565360	0.13498	2.27E-4	0.0	ENSG00000256525	ENST00000539111	D	0.85484	-1.99	5.91	-4.31	0.03698	Anticodon-binding (2);	0.311546	0.34025	N	0.004328	T	0.61009	0.2313	N	0.10618	0.005	0.09310	N	0.999999	B	0.09022	0.002	B	0.13407	0.009	T	0.56517	-0.7966	10	0.02654	T	1	-7.4278	11.247	0.49002	0.0:0.5158:0.1047:0.3795	.	381	Q9UHN1	DPOG2_HUMAN	V	381	ENSP00000442563:I381V	ENSP00000442563:I381V	I	-	1	0	POLG2	59909548	0.022000	0.18835	0.327000	0.25402	0.884000	0.51177	-0.086000	0.11233	-0.614000	0.05687	-0.923000	0.02734	ATT		0.373	POLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443820.1		NM_007215	
POM121	9883	broad.mit.edu;hgsc.bcm.edu	37	7	72398925	72398925	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr7:72398925G>A	ENST00000434423.2	+	4	1025	c.1025G>A	c.(1024-1026)cGc>cAc	p.R342H	POM121_ENST00000446813.1_Missense_Mutation_p.R77H|POM121_ENST00000257622.4_Missense_Mutation_p.R77H|POM121_ENST00000395270.1_Missense_Mutation_p.R77H|POM121_ENST00000358357.3_Missense_Mutation_p.R77H			Q96HA1	P121A_HUMAN	POM121 transmembrane nucleoporin	342	Pore side. {ECO:0000255}.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)		p.R77H(2)		NS(1)|breast(1)|endometrium(9)|kidney(4)|large_intestine(6)|lung(12)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Lung NSC(55;0.163)				TGTCGCAGGCGCCATGATAGC	0.448																																																	2	Substitution - Missense(2)	kidney(2)											180.0	184.0	183.0					7																	72398925		2203	4300	6503	SO:0001583	missense	9883			AB014518	CCDS5542.1, CCDS59059.1	7q11.23	2013-01-08	2012-03-13		ENSG00000196313	ENSG00000196313		"""-"""	19702	protein-coding gene	gene with protein product		615753	"""POM121 membrane glycoprotein (rat)"", ""POM121 membrane glycoprotein"""			8335683, 9734811, 17900573	Standard	NM_172020		Approved	KIAA0618, DKFZP586G1822, DKFZP586P2220, POM121A	uc003twk.2	Q96HA1	OTTHUMG00000023527	ENST00000434423.2:c.1025G>A	7.37:g.72398925G>A	ENSP00000405562:p.Arg342His		A6NFS9|A8CDT4|A8K933|A8MXF9|O75115|Q96DI0|Q9H9X1|Q9Y2N3|Q9Y4S7	Missense_Mutation	SNP	ENST00000434423.2	37		.	.	.	.	.	.	.	.	.	.	G	10.61	1.397626	0.25205	.	.	ENSG00000196313	ENST00000446813;ENST00000257622;ENST00000395270;ENST00000358357;ENST00000434423	T;T;T;T;T	0.13089	2.62;2.62;2.62;2.62;2.62	4.0	3.1	0.35709	.	0.345496	0.21168	N	0.079031	T	0.32823	0.0842	M	0.77103	2.36	0.37203	D	0.904477	D;P	0.76494	0.999;0.937	P;P	0.62014	0.897;0.799	T	0.36335	-0.9752	10	0.62326	D	0.03	.	11.0919	0.48121	0.0:0.1881:0.8119:0.0	.	77;342	A8MXF9;Q96HA1	.;P121A_HUMAN	H	77;77;77;77;342	ENSP00000393020:R77H;ENSP00000257622:R77H;ENSP00000378687:R77H;ENSP00000351124:R77H;ENSP00000405562:R342H	ENSP00000257622:R77H	R	+	2	0	POM121	72036861	1.000000	0.71417	0.998000	0.56505	0.057000	0.15508	7.194000	0.77789	0.863000	0.35553	-0.514000	0.04452	CGC		0.448	POM121-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000347344.1			
RPAP1	26015	hgsc.bcm.edu;ucsc.edu	37	15	41819689	41819689	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr15:41819689delC	ENST00000304330.4	-	12	1659	c.1543delG	c.(1543-1545)gcafs	p.A515fs	RPAP1_ENST00000561603.1_Frame_Shift_Del_p.A515fs|RPAP1_ENST00000568413.1_5'Flank	NM_015540.2	NP_056355.2	Q9BWH6	RPAP1_HUMAN	RNA polymerase II associated protein 1	515						nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			NS(1)|breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(16)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	45		all_cancers(109;6.59e-20)|all_epithelial(112;7.67e-17)|Lung NSC(122;5.34e-11)|all_lung(180;4.17e-10)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		OV - Ovarian serous cystadenocarcinoma(18;2.84e-17)|GBM - Glioblastoma multiforme(113;1.68e-06)|Colorectal(105;0.0163)|BRCA - Breast invasive adenocarcinoma(123;0.117)		TTCCTTTTTGCTTTTCCTGCT	0.537																																																	0													94.0	93.0	94.0					15																	41819689		2203	4300	6503	SO:0001589	frameshift_variant	26015			BC000246	CCDS10079.1	15q14	2004-03-16			ENSG00000103932	ENSG00000103932			24567	protein-coding gene	gene with protein product		611475				10718198	Standard	XM_005254297		Approved	DKFZP727M111, KIAA1403, MGC858, FLJ12732	uc001zod.3	Q9BWH6	OTTHUMG00000130342	ENST00000304330.4:c.1543delG	15.37:g.41819689delC	ENSP00000306123:p.Ala515fs		Q9H9I2|Q9NSQ5|Q9P2E4|Q9UFS7	Frame_Shift_Del	DEL	ENST00000304330.4	37	CCDS10079.1																																																																																				0.537	RPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252694.2		NM_015540	
RSF1	51773	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	77412360	77412360	+	Nonsense_Mutation	SNP	A	A	T			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr11:77412360A>T	ENST00000308488.6	-	6	2216	c.1914T>A	c.(1912-1914)tgT>tgA	p.C638*	RSF1_ENST00000480887.1_Nonsense_Mutation_p.C386*|RSF1_ENST00000360355.2_Nonsense_Mutation_p.C607*			Q96T23	RSF1_HUMAN	remodeling and spacing factor 1	638					CENP-A containing nucleosome assembly (GO:0034080)|chromatin remodeling (GO:0006338)|DNA-templated transcription, initiation (GO:0006352)|negative regulation of DNA binding (GO:0043392)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral transcription (GO:0050434)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|RSF complex (GO:0031213)	histone binding (GO:0042393)|zinc ion binding (GO:0008270)	p.C638*(1)		breast(3)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(9)|lung(14)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	43	all_cancers(14;1.54e-17)|all_epithelial(13;4.06e-20)|Ovarian(111;0.152)		Epithelial(5;3e-50)|all cancers(3;6.37e-47)|BRCA - Breast invasive adenocarcinoma(5;9.82e-31)			CTAGTTTCTCACAGTGGTCAA	0.438																																																	1	Substitution - Nonsense(1)	kidney(1)											115.0	119.0	118.0					11																	77412360		2196	4290	6486	SO:0001587	stop_gained	51773			AF380176, AF227948	CCDS8253.1	11q14.1	2013-01-28	2006-05-25	2006-05-25	ENSG00000048649	ENSG00000048649		"""Zinc fingers, PHD-type"""	18118	protein-coding gene	gene with protein product		608522	"""hepatitis B virus x associated protein"""	HBXAP		11788598, 12972596	Standard	NM_016578		Approved	XAP8, RSF-1, p325	uc001oyn.3	Q96T23	OTTHUMG00000150433	ENST00000308488.6:c.1914T>A	11.37:g.77412360A>T	ENSP00000311513:p.Cys638*		Q86X86|Q9H3L8|Q9NVZ8|Q9NYU0	Nonsense_Mutation	SNP	ENST00000308488.6	37	CCDS8253.1	.	.	.	.	.	.	.	.	.	.	A	36	5.627146	0.96671	.	.	ENSG00000048649	ENST00000308488;ENST00000480887;ENST00000360355;ENST00000526324;ENST00000528095	.	.	.	5.23	1.54	0.23209	.	1.040500	0.07526	N	0.911385	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	0.2736	6.1145	0.20120	0.5496:0.2598:0.0:0.1906	.	.	.	.	X	638;386;607;439;637	.	ENSP00000311513:C638X	C	-	3	2	RSF1	77090008	0.000000	0.05858	0.090000	0.20809	0.456000	0.32438	0.306000	0.19279	0.993000	0.38866	0.533000	0.62120	TGT		0.438	RSF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318075.2		NM_016578	
RTN2	6253	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	45997672	45997672	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr19:45997672T>C	ENST00000245923.4	-	4	801	c.566A>G	c.(565-567)gAc>gGc	p.D189G	RTN2_ENST00000430715.2_5'Flank|RTN2_ENST00000344680.4_Missense_Mutation_p.D189G|PPM1N_ENST00000456399.2_5'Flank|PPM1N_ENST00000401705.1_Intron|PPM1N_ENST00000396737.2_5'Flank|RTN2_ENST00000590526.1_5'UTR|RTN2_ENST00000589384.1_5'Flank	NM_005619.4	NP_005610.1	O75298	RTN2_HUMAN	reticulon 2	189					cell death (GO:0008219)|intracellular protein transmembrane transport (GO:0065002)|regulation of glucose import (GO:0046324)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)		p.D189G(1)		cervix(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(4)|skin(1)|urinary_tract(1)	20		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00829)|Epithelial(262;0.184)|GBM - Glioblastoma multiforme(486;0.246)		GAGTCGTAGGTCCAGTTCTGA	0.622																																																	1	Substitution - Missense(1)	kidney(1)											63.0	57.0	59.0					19																	45997672		2203	4300	6503	SO:0001583	missense	6253			AF038540	CCDS12665.1, CCDS12666.1, CCDS46114.1	19q13.2-q13.3	2012-03-30				ENSG00000125744			10468	protein-coding gene	gene with protein product	"""NSP-like protein 1"", ""Neuroendocrine-specific protein-like 1"""	603183	"""spastic paraplegia 12 (autosomal dominant)"""	SPG12		8812484, 9530622, 22232211	Standard	NM_005619		Approved	NSP2, NSPL1	uc002pcb.4	O75298		ENST00000245923.4:c.566A>G	19.37:g.45997672T>C	ENSP00000245923:p.Asp189Gly		O60509|Q7RTM6|Q7RTN1|Q7RTN2	Missense_Mutation	SNP	ENST00000245923.4	37	CCDS12665.1	.	.	.	.	.	.	.	.	.	.	T	16.23	3.063959	0.55432	.	.	ENSG00000125744	ENST00000344680;ENST00000245923	T;T	0.52526	0.7;0.66	5.43	4.41	0.53225	.	10.726000	0.00899	U	0.002325	T	0.40546	0.1121	N	0.24115	0.695	0.31714	N	0.639122	B;B	0.25272	0.122;0.001	B;B	0.28305	0.088;0.001	T	0.33803	-0.9854	10	0.42905	T	0.14	-11.3548	7.8592	0.29499	0.0:0.0941:0.0:0.9059	.	189;189	O75298-2;O75298	.;RTN2_HUMAN	G	189	ENSP00000345127:D189G;ENSP00000245923:D189G	ENSP00000245923:D189G	D	-	2	0	RTN2	50689512	0.014000	0.17966	0.839000	0.33178	0.472000	0.32918	0.838000	0.27572	0.906000	0.36621	0.460000	0.39030	GAC		0.622	RTN2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000459574.1		NM_005619	
SETD2	29072	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	47084168	47084175	+	Frame_Shift_Del	DEL	TTATTTGT	TTATTTGT	-	rs114833216		TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	TTATTTGT	TTATTTGT	TTATTTGT	-	TTATTTGT	TTATTTGT	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr3:47084168_47084175delTTATTTGT	ENST00000409792.3	-	17	7156_7163	c.7114_7121delACAAATAA	c.(7114-7122)acaaataatfs	p.TNN2372fs		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	2372					angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		ATCCAAGAGATTATTTGTCACAACCATT	0.413			"""N, F, S, Mis"""		clear cell renal carcinoma																																			Rec	yes		3	3p21.31	29072	SET domain containing 2		E	0																																										SO:0001589	frameshift_variant	29072			AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.7114_7121delACAAATAA	3.37:g.47084168_47084175delTTATTTGT	ENSP00000386759:p.Thr2372fs		O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Frame_Shift_Del	DEL	ENST00000409792.3	37	CCDS2749.2																																																																																				0.413	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2		NM_014159	
SLC24A4	123041	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	92958092	92958092	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr14:92958092C>T	ENST00000532405.1	+	15	1847	c.1621C>T	c.(1621-1623)Cag>Tag	p.Q541*	SLC24A4_ENST00000393265.2_Nonsense_Mutation_p.Q477*|SLC24A4_ENST00000531433.1_Nonsense_Mutation_p.Q522*|SLC24A4_ENST00000351924.5_Nonsense_Mutation_p.Q505*|SLC24A4_ENST00000298877.1_Nonsense_Mutation_p.Q524*			Q8NFF2	NCKX4_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 4	541					amelogenesis (GO:0097186)|cellular calcium ion homeostasis (GO:0006874)|ion transport (GO:0006811)|response to stimulus (GO:0050896)|sensory perception of smell (GO:0007608)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium, potassium:sodium antiporter activity (GO:0008273)|symporter activity (GO:0015293)	p.Q524*(1)		breast(3)|endometrium(2)|kidney(2)|large_intestine(6)|lung(20)|ovary(2)|skin(1)	36		all_cancers(154;0.0347)|all_epithelial(191;0.163)		Colorectal(1;0.00242)|COAD - Colon adenocarcinoma(157;0.047)|Epithelial(152;0.0781)|READ - Rectum adenocarcinoma(1;0.176)|all cancers(159;0.182)		GTGGGGCCTGCAGACCATGGT	0.512																																					NSCLC(10;315 435 10383 28450 38798)												1	Substitution - Nonsense(1)	kidney(1)											186.0	159.0	168.0					14																	92958092		2203	4300	6503	SO:0001587	stop_gained	123041			AF520704	CCDS9903.1, CCDS45155.1, CCDS45156.1, CCDS9903.2, CCDS45155.2	14q32.12	2013-05-22			ENSG00000140090	ENSG00000140090		"""Solute carriers"""	10978	protein-coding gene	gene with protein product		609840					Standard	NM_153646		Approved	NCKX4	uc001yak.3	Q8NFF2	OTTHUMG00000167589	ENST00000532405.1:c.1621C>T	14.37:g.92958092C>T	ENSP00000431840:p.Gln541*		B4DHE7|B9ZVY2|Q8N8U6|Q8NCX1|Q8NFF0|Q8NFF1	Nonsense_Mutation	SNP	ENST00000532405.1	37	CCDS9903.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	39|39	7.299956|7.299956	0.98196|0.98196	.|.	.|.	ENSG00000140090|ENSG00000140090	ENST00000525557|ENST00000393265;ENST00000531433;ENST00000532405;ENST00000298877;ENST00000351924	.|.	.|.	.|.	5.56|5.56	5.56|5.56	0.83823|0.83823	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.70185|.	0.3195|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.63337|.	-0.6660|.	3|.	.|0.22109	.|T	.|0.4	.|.	19.5349|19.5349	0.95247|0.95247	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	V|X	406|477;522;541;524;505	.|.	.|ENSP00000298877:Q524X	A|Q	+|+	2|1	0|0	SLC24A4|SLC24A4	92027845|92027845	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.924000|0.924000	0.55760|0.55760	7.726000|7.726000	0.84824|0.84824	2.618000|2.618000	0.88619|0.88619	0.561000|0.561000	0.74099|0.74099	GCA|CAG		0.512	SLC24A4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000395240.1		NM_153646	
SLC4A1	6521	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	42333125	42333125	+	Silent	SNP	G	G	A			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr17:42333125G>A	ENST00000262418.6	-	14	1871	c.1716C>T	c.(1714-1716)ctC>ctT	p.L572L	AC003043.1_ENST00000597382.1_5'Flank	NM_000342.3	NP_000333.1	P02730	B3AT_HUMAN	solute carrier family 4 (anion exchanger), member 1 (Diego blood group)	572	Involved in anion transport.|Membrane (anion exchange).				anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|cellular ion homeostasis (GO:0006873)|chloride transport (GO:0006821)|ion transport (GO:0006811)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|blood microparticle (GO:0072562)|cortical cytoskeleton (GO:0030863)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	anion transmembrane transporter activity (GO:0008509)|anion:anion antiporter activity (GO:0015301)|ankyrin binding (GO:0030506)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride transmembrane transporter activity (GO:0015108)|inorganic anion exchanger activity (GO:0005452)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)	p.L572L(1)		central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(16)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	40		Breast(137;0.014)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.115)		CAAGGGAGAGGAGGGCTGTGT	0.537																																																	1	Substitution - coding silent(1)	kidney(1)											185.0	171.0	176.0					17																	42333125		2203	4300	6503	SO:0001819	synonymous_variant	6521				CCDS11481.1	17q21.31	2014-07-19	2014-01-02		ENSG00000004939	ENSG00000004939		"""CD molecules"", ""Blood group antigens"", ""Solute carriers"""	11027	protein-coding gene	gene with protein product	"""Froese blood group"", ""Swann blood group"", ""Wright blood group"""	109270	"""Waldner blood group"", ""erythrocyte membrane protein band 3"", ""Diego blood group"", ""solute carrier family 4, anion exchanger, member 1 (erythrocyte membrane protein band 3, Diego blood group)"", ""solute carrier family 4 (anion exchanger), member 1"""	EPB3, AE1, DI, WD		8434259	Standard	NM_000342		Approved	RTA1A, CD233, FR, SW, WR	uc002igf.4	P02730	OTTHUMG00000156843	ENST00000262418.6:c.1716C>T	17.37:g.42333125G>A			G4V2I6|P78487|Q1ZZ45|Q4KKW9|Q4VB84|Q9UCY7|Q9UDJ1	Silent	SNP	ENST00000262418.6	37	CCDS11481.1																																																																																				0.537	SLC4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346194.1		NM_000342	
TAF2	6873	hgsc.bcm.edu;ucsc.edu	37	8	120744220	120744221	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr8:120744220_120744221insA	ENST00000378164.2	-	26	3841_3842	c.3543_3544insT	c.(3541-3546)ttcactfs	p.T1182fs		NM_003184.3	NP_003175	Q6P1X5	TAF2_HUMAN	TAF2 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 150kDa	1182					G2/M transition of mitotic cell cycle (GO:0000086)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to organic cyclic compound (GO:0014070)|transcription initiation from RNA polymerase II promoter (GO:0006367)	transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	metallopeptidase activity (GO:0008237)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(2)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(21)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	49	Lung NSC(37;9.35e-07)|Ovarian(258;0.011)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			CTGGAGAAAGTGAAAGGCTCCT	0.436																																																	0																																										SO:0001589	frameshift_variant	6873			AF040701	CCDS34937.1	8q24	2012-07-18	2002-08-29	2001-12-07	ENSG00000064313	ENSG00000064313			11536	protein-coding gene	gene with protein product		604912	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, B, 150kD"""	TAF2B		9774672, 9418870	Standard	NM_003184		Approved	TAFII150, CIF150	uc003you.3	Q6P1X5	OTTHUMG00000165009	ENST00000378164.2:c.3543_3544insT	8.37:g.120744220_120744221insA	ENSP00000367406:p.Thr1182fs		B2RE82|O43487|O43604|O60668|Q86WW7|Q8IWK4	Frame_Shift_Ins	INS	ENST00000378164.2	37	CCDS34937.1																																																																																				0.436	TAF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381436.1		NM_003184	
TMEM132E	124842	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	32954049	32954049	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr17:32954049G>A	ENST00000321639.5	+	3	1029	c.701G>A	c.(700-702)aGc>aAc	p.S234N		NM_207313.1	NP_997196.1	Q6IEE7	T132E_HUMAN	transmembrane protein 132E	234						integral component of membrane (GO:0016021)		p.S234N(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(28)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	57				BRCA - Breast invasive adenocarcinoma(366;0.231)		TCGCCCTCCAGCCCCAGCGTG	0.602																																																	1	Substitution - Missense(1)	kidney(1)											58.0	58.0	58.0					17																	32954049		2203	4300	6503	SO:0001583	missense	124842			BN000149	CCDS11283.1	17q12	2012-11-01			ENSG00000181291	ENSG00000181291			26991	protein-coding gene	gene with protein product							Standard	NM_207313		Approved		uc002hif.3	Q6IEE7	OTTHUMG00000132927	ENST00000321639.5:c.701G>A	17.37:g.32954049G>A	ENSP00000316532:p.Ser234Asn		Q8WUF4|Q8WVA5	Missense_Mutation	SNP	ENST00000321639.5	37	CCDS11283.1	.	.	.	.	.	.	.	.	.	.	G	12.52	1.962608	0.34659	.	.	ENSG00000181291	ENST00000321639	T	0.15718	2.4	5.35	1.49	0.22878	.	0.389693	0.25138	N	0.032847	T	0.05686	0.0149	N	0.08118	0	0.24694	N	0.9933	B	0.02656	0.0	B	0.01281	0.0	T	0.25847	-1.0120	10	0.22109	T	0.4	-19.0483	0.515	0.00602	0.2027:0.2374:0.3192:0.2407	.	234	Q6IEE7	T132E_HUMAN	N	234	ENSP00000316532:S234N	ENSP00000316532:S234N	S	+	2	0	TMEM132E	29978162	1.000000	0.71417	1.000000	0.80357	0.843000	0.47879	1.036000	0.30228	1.198000	0.43158	0.442000	0.29010	AGC		0.602	TMEM132E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256440.2		NM_207313	
TMPRSS6	164656	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	22	37462221	37462221	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr22:37462221C>G	ENST00000346753.3	-	18	2451	c.2335G>C	c.(2335-2337)Ggg>Cgg	p.G779R	TMPRSS6_ENST00000406856.1_Missense_Mutation_p.G792R|TMPRSS6_ENST00000381792.2_Missense_Mutation_p.G792R|TMPRSS6_ENST00000406725.1_Missense_Mutation_p.G770R	NM_153609.2	NP_705837.1	Q8IU80	TMPS6_HUMAN	transmembrane protease, serine 6	779	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				angiogenesis (GO:0001525)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|intracellular signal transduction (GO:0035556)|iron ion homeostasis (GO:0055072)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)	p.G779R(1)		breast(5)|central_nervous_system(4)|endometrium(4)|kidney(4)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(2)|stomach(3)	40						CTGACCAGCCCCGCCAGGAAC	0.622																																																	1	Substitution - Missense(1)	kidney(1)											29.0	31.0	30.0					22																	37462221		2203	4297	6500	SO:0001583	missense	164656			AY055383	CCDS13941.1, CCDS74856.1, CCDS74857.1	22q13.1	2010-04-13			ENSG00000187045	ENSG00000187045		"""Serine peptidases / Transmembrane"""	16517	protein-coding gene	gene with protein product		609862					Standard	NM_001289000		Approved	FLJ30744	uc003aqs.1	Q8IU80	OTTHUMG00000150541	ENST00000346753.3:c.2335G>C	22.37:g.37462221C>G	ENSP00000334962:p.Gly779Arg		B0QYB4|B0QYB7|B0QYB8|Q5TI06|Q6ICC2|Q6UXD8|Q8IUE2|Q8IXV8	Missense_Mutation	SNP	ENST00000346753.3	37	CCDS13941.1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.787037	0.90367	.	.	ENSG00000187045	ENST00000381792;ENST00000346753;ENST00000406725;ENST00000406856	D;D;D;D	0.99545	-6.13;-6.13;-6.13;-6.13	4.46	4.46	0.54185	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.141721	0.46442	D	0.000299	D	0.99829	0.9923	H	0.98721	4.31	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96385	0.9284	10	0.87932	D	0	.	17.4693	0.87641	0.0:1.0:0.0:0.0	.	792;779	Q8IU80-5;Q8IU80	.;TMPS6_HUMAN	R	792;779;770;792	ENSP00000371211:G792R;ENSP00000334962:G779R;ENSP00000385453:G770R;ENSP00000384964:G792R	ENSP00000334962:G779R	G	-	1	0	TMPRSS6	35792167	1.000000	0.71417	0.901000	0.35422	0.870000	0.49936	7.675000	0.84002	2.178000	0.69098	0.467000	0.42956	GGG		0.622	TMPRSS6-003	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000318822.1		NM_153609	
TTN	7273	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	179634604	179634604	+	Nonsense_Mutation	SNP	C	C	A	rs143767300		TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr2:179634604C>A	ENST00000591111.1	-	37	8928	c.8704G>T	c.(8704-8706)Gag>Tag	p.E2902*	TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Nonsense_Mutation_p.E2902*|TTN_ENST00000359218.5_Nonsense_Mutation_p.E2856*|TTN_ENST00000342175.6_Nonsense_Mutation_p.E2856*|TTN-AS1_ENST00000610005.1_RNA|TTN_ENST00000589042.1_Nonsense_Mutation_p.E2902*|TTN_ENST00000360870.5_Nonsense_Mutation_p.E2902*|TTN_ENST00000460472.2_Nonsense_Mutation_p.E2856*			Q8WZ42	TITIN_HUMAN	titin	13232	Ig-like 16.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.E2902*(3)|p.E2856*(3)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACCTCACACTCAAAAGAGGCA	0.388																																																	6	Substitution - Nonsense(6)	kidney(6)											110.0	110.0	110.0					2																	179634604		2203	4300	6503	SO:0001587	stop_gained	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.8704G>T	2.37:g.179634604C>A	ENSP00000465570:p.Glu2902*		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Nonsense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	C	51	17.727153	0.99892	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	.	.	.	6.06	6.06	0.98353	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	15.9066	0.79436	0.0:0.754:0.246:0.0	.	.	.	.	X	2902;2856;2856;2856;2856;2902	.	ENSP00000340554:E2856X	E	-	1	0	TTN	179342849	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	3.127000	0.50484	2.882000	0.98803	0.655000	0.94253	GAG		0.388	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1		NM_133378	
USP22	23326	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	20911265	20911265	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr17:20911265C>T	ENST00000261497.4	-	9	1351	c.1148G>A	c.(1147-1149)tGc>tAc	p.C383Y	USP22_ENST00000455117.2_Intron|USP22_ENST00000537526.2_Missense_Mutation_p.C371Y	NM_015276.1	NP_056091.1	Q9UPT9	UBP22_HUMAN	ubiquitin specific peptidase 22	383	USP.				cell cycle (GO:0007049)|chromatin organization (GO:0006325)|embryo development (GO:0009790)|histone deubiquitination (GO:0016578)|histone H4 acetylation (GO:0043967)|histone ubiquitination (GO:0016574)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|protein deubiquitination (GO:0016579)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	SAGA complex (GO:0000124)	enzyme binding (GO:0019899)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|transcription coactivator activity (GO:0003713)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.C605Y(1)		endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)	15						GCAACCGCTGCACTTGATCTT	0.483																																																	1	Substitution - Missense(1)	kidney(1)											94.0	88.0	90.0					17																	20911265		1936	4165	6101	SO:0001583	missense	23326			AB028986	CCDS42285.1	17p11.2	2006-11-24	2005-08-08		ENSG00000124422	ENSG00000124422		"""Ubiquitin-specific peptidases"""	12621	protein-coding gene	gene with protein product		612116	"""ubiquitin specific protease 22"", ""ubiquitin specific peptidase 3-like"""	USP3L		12838346	Standard	NM_015276		Approved	KIAA1063	uc002gym.4	Q9UPT9	OTTHUMG00000133621	ENST00000261497.4:c.1148G>A	17.37:g.20911265C>T	ENSP00000261497:p.Cys383Tyr		A0JNS3|Q2NLE2|Q6MZY4|Q8TBS8|Q96IW5	Missense_Mutation	SNP	ENST00000261497.4	37	CCDS42285.1	.	.	.	.	.	.	.	.	.	.	C	18.77	3.694434	0.68386	.	.	ENSG00000124422	ENST00000455117;ENST00000537526;ENST00000261497	T;T	0.27557	1.73;1.66	4.06	4.06	0.47325	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	T	0.72431	0.3459	H	0.98786	4.33	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.85881	0.1422	10	0.87932	D	0	.	16.615	0.84904	0.0:1.0:0.0:0.0	.	371;383	Q9UPT9-2;Q9UPT9	.;UBP22_HUMAN	Y	451;371;383	ENSP00000440950:C371Y;ENSP00000261497:C383Y	ENSP00000261497:C383Y	C	-	2	0	USP22	20851857	1.000000	0.71417	0.546000	0.28166	0.541000	0.35023	6.963000	0.76055	1.996000	0.58369	0.655000	0.94253	TGC		0.483	USP22-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444169.1			
VHL	7428	hgsc.bcm.edu	37	3	10191489	10191492	+	Frame_Shift_Del	DEL	GATG	GATG	-	rs397516444|rs5030622		TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	GATG	GATG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr3:10191489_10191492delGATG	ENST00000256474.2	+	3	1322_1325	c.482_485delGATG	c.(481-486)cgatgcfs	p.RC161fs	VHL_ENST00000477538.1_3'UTR|VHL_ENST00000345392.2_Frame_Shift_Del_p.RC120fs	NM_000551.3	NP_000542.1	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase	161	Interaction with Elongin BC complex.		R -> G (in VHLD; type II; dbSNP:rs5030818).|R -> P (in pheochromocytoma and VHLD; type I). {ECO:0000269|PubMed:12000816, ECO:0000269|PubMed:8956040}.|R -> Q (in pheochromocytoma and VHLD; type II). {ECO:0000269|PubMed:12000816, ECO:0000269|PubMed:9829912}.		cell morphogenesis (GO:0000902)|cellular response to hypoxia (GO:0071456)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|transcription factor binding (GO:0008134)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin-protein transferase activity (GO:0004842)	p.C162Y(5)|p.R161P(4)|p.C162R(4)|p.C162F(3)|p.C162fs*12(2)|p.R161del(1)|p.R161fs*12(1)|p.E160fs*9(1)|p.?fs(1)|p.C162fs*9(1)|p.L158fs*6(1)|p.R161Q(1)		adrenal_gland(25)|autonomic_ganglia(3)|central_nervous_system(2)|endometrium(6)|kidney(1662)|large_intestine(14)|lung(6)|pancreas(18)|paratesticular_tissues(1)|pleura(1)|skin(1)|soft_tissue(24)|thyroid(3)|upper_aerodigestive_tract(3)	1769				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		CTGAAAGAGCGATGCCTCCAGGTT	0.505		1	"""D, Mis, N, F, S"""		"""renal, hemangioma, pheochromocytoma"""	"""renal, hemangioma, pheochromocytoma"""			von Hippel-Lindau disease;Pheochromocytoma (Adrenal), Familial;Chuvash Polycythemia																														yes	Rec	yes	von Hippel-Lindau syndrome	3	3p25	7428	von Hippel-Lindau syndrome gene		"""E, M, O"""	25	Substitution - Missense(17)|Deletion - Frameshift(4)|Insertion - Frameshift(3)|Deletion - In frame(1)	kidney(24)|adrenal_gland(1)	GRCh37	CI011898|CM951290|CM951291|CM951292|CM951294|CM961431	VHL	I|M																																				SO:0001589	frameshift_variant	7428	Familial Cancer Database	VHL; ;Erythrocytosis, Familial type 2	L15409	CCDS2597.1, CCDS2598.1	3p25.3	2014-09-17	2012-02-23		ENSG00000134086	ENSG00000134086			12687	protein-coding gene	gene with protein product		608537	"""von Hippel-Lindau syndrome"", ""von Hippel-Lindau tumor suppressor"""			9671762	Standard	NM_000551		Approved	VHL1	uc003bvc.3	P40337	OTTHUMG00000128668	ENST00000256474.2:c.482_485delGATG	3.37:g.10191489_10191492delGATG	ENSP00000256474:p.Arg161fs		B2RE45|Q13599|Q6PDA9	Frame_Shift_Del	DEL	ENST00000256474.2	37	CCDS2597.1																																																																																				0.505	VHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250559.1		NM_000551	
WDR36	134430	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	110434508	110434508	+	Missense_Mutation	SNP	T	T	G			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr5:110434508T>G	ENST00000513710.2	+	4	552	c.548T>G	c.(547-549)aTt>aGt	p.I183S	WDR36_ENST00000505303.1_Missense_Mutation_p.I127S|WDR36_ENST00000506538.2_Missense_Mutation_p.I183S			Q8NI36	WDR36_HUMAN	WD repeat domain 36	183					regulation of axon extension (GO:0030516)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|rRNA processing (GO:0006364)|visual perception (GO:0007601)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)	p.I183S(1)		cervix(1)|endometrium(9)|kidney(4)|large_intestine(11)|lung(13)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(142;2.72e-05)|all_epithelial(76;4.4e-07)|Prostate(80;0.00955)|Lung NSC(167;0.0418)|Ovarian(225;0.0443)|Colorectal(57;0.0465)|all_lung(232;0.0508)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;1.39e-08)|Epithelial(69;1.82e-07)|all cancers(49;2.04e-05)|COAD - Colon adenocarcinoma(37;0.111)		ACTGATGGCATTCTTATTATT	0.313																																																	1	Substitution - Missense(1)	kidney(1)											134.0	129.0	131.0					5																	110434508		2202	4298	6500	SO:0001583	missense	134430			AF385437	CCDS4102.1	5q22.2	2013-01-09			ENSG00000134987	ENSG00000134987		"""WD repeat domain containing"""	30696	protein-coding gene	gene with protein product		609669	"""glaucoma 1, open angle, G"""	GLC1G		15590835, 15677485	Standard	NM_139281		Approved	TA-WDRP, UTP21	uc003kpd.3	Q8NI36	OTTHUMG00000128790	ENST00000513710.2:c.548T>G	5.37:g.110434508T>G	ENSP00000424628:p.Ile183Ser		A2RUS4|Q68E02|Q8N1Q2	Missense_Mutation	SNP	ENST00000513710.2	37	CCDS4102.1	.	.	.	.	.	.	.	.	.	.	T	12.86	2.064425	0.36470	.	.	ENSG00000134987	ENST00000506538;ENST00000513710;ENST00000505303;ENST00000504122	T;T;T;T	0.33216	1.75;1.75;3.45;1.42	5.72	5.72	0.89469	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.495241	0.23288	N	0.049838	T	0.18425	0.0442	N	0.04508	-0.205	0.38217	D	0.940652	B	0.20887	0.049	B	0.18263	0.021	T	0.10847	-1.0612	10	0.87932	D	0	-5.0434	16.0011	0.80292	0.0:0.0:0.0:1.0	.	183	Q8NI36	WDR36_HUMAN	S	183;183;127;54	ENSP00000423067:I183S;ENSP00000424628:I183S;ENSP00000422158:I127S;ENSP00000426509:I54S	ENSP00000426509:I54S	I	+	2	0	WDR36	110462407	1.000000	0.71417	0.962000	0.40283	0.970000	0.65996	4.888000	0.63164	2.177000	0.69029	0.528000	0.53228	ATT		0.313	WDR36-008	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000373504.3		NM_139281	
WDR64	128025	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	241886621	241886621	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr1:241886621G>T	ENST00000366552.2	+	9	1254	c.1047G>T	c.(1045-1047)ttG>ttT	p.L349F	WDR64_ENST00000437684.2_Missense_Mutation_p.L349F	NM_144625.4	NP_653226.4	B1ANS9	WDR64_HUMAN	WD repeat domain 64	349								p.L349F(1)|p.L69F(1)		breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(17)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)			TCATCCGGTTGTGGCACCCCA	0.443																																																	2	Substitution - Missense(2)	kidney(2)											111.0	103.0	106.0					1																	241886621		2203	4300	6503	SO:0001583	missense	128025			AK057540		1q43	2013-01-09			ENSG00000162843	ENSG00000162843		"""WD repeat domain containing"""	26570	protein-coding gene	gene with protein product							Standard	NM_144625		Approved	FLJ32978	uc001hzg.2	B1ANS9	OTTHUMG00000039705	ENST00000366552.2:c.1047G>T	1.37:g.241886621G>T	ENSP00000355510:p.Leu349Phe		B1ANT0|Q7Z573|Q96LY9	Missense_Mutation	SNP	ENST00000366552.2	37		.	.	.	.	.	.	.	.	.	.	G	15.77	2.930054	0.52759	.	.	ENSG00000162843	ENST00000366552;ENST00000437684;ENST00000414635	T;T;T	0.47528	1.34;0.84;4.75	4.7	3.51	0.40186	.	0.164522	0.27961	N	0.017146	T	0.60919	0.2306	M	0.62723	1.935	0.31950	N	0.609793	D	0.76494	0.999	D	0.91635	0.999	T	0.65841	-0.6070	10	0.66056	D	0.02	-16.4526	8.2345	0.31618	0.1572:0.0:0.8428:0.0	.	69	D1MPS4	.	F	349;349;120	ENSP00000355510:L349F;ENSP00000402446:L349F;ENSP00000406656:L120F	ENSP00000355510:L349F	L	+	3	2	WDR64	239953244	1.000000	0.71417	0.992000	0.48379	0.692000	0.40212	1.110000	0.31147	2.308000	0.77769	0.563000	0.77884	TTG		0.443	WDR64-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			NM_144625	
WIPF2	147179	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	38420931	38420931	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr17:38420931C>T	ENST00000323571.4	+	5	743	c.503C>T	c.(502-504)aCg>aTg	p.T168M	WIPF2_ENST00000494757.1_3'UTR|WIPF2_ENST00000585043.1_Missense_Mutation_p.T168M|WIPF2_ENST00000394103.3_Intron|WIPF2_ENST00000583130.1_Missense_Mutation_p.T168M|WIPF2_ENST00000536600.1_Intron	NM_133264.4	NP_573571.1	Q8TF74	WIPF2_HUMAN	WAS/WASL interacting protein family, member 2	168					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)		p.T168M(1)		NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	30						ACCAGCAGTACGGGCATGAAG	0.647										HNSCC(43;0.11)																																							1	Substitution - Missense(1)	kidney(1)											79.0	80.0	80.0					17																	38420931		2203	4300	6503	SO:0001583	missense	147179			BC025965	CCDS11364.1	17q21.2	2006-10-12			ENSG00000171475	ENSG00000171475			30923	protein-coding gene	gene with protein product		609692				12213210, 11829459	Standard	XM_005257083		Approved	WICH, WIRE	uc002hug.1	Q8TF74	OTTHUMG00000133331	ENST00000323571.4:c.503C>T	17.37:g.38420931C>T	ENSP00000320924:p.Thr168Met		A8K0L3|Q658J8|Q71RE1|Q8TE44	Missense_Mutation	SNP	ENST00000323571.4	37	CCDS11364.1	.	.	.	.	.	.	.	.	.	.	C	16.99	3.272971	0.59649	.	.	ENSG00000171475	ENST00000323571	T	0.32023	1.47	5.81	4.81	0.61882	.	0.546723	0.19394	N	0.115332	T	0.28962	0.0719	L	0.40543	1.245	0.80722	D	1	P	0.36660	0.564	B	0.34385	0.181	T	0.08827	-1.0703	10	0.66056	D	0.02	-0.2601	16.7385	0.85453	0.0:0.8707:0.1293:0.0	.	168	Q8TF74	WIPF2_HUMAN	M	168	ENSP00000320924:T168M	ENSP00000320924:T168M	T	+	2	0	WIPF2	35674457	0.781000	0.28676	0.633000	0.29310	0.938000	0.57974	2.753000	0.47524	1.412000	0.46977	0.549000	0.68633	ACG		0.647	WIPF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257157.2		NM_133264	
XIRP2	129446	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	168099752	168099752	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr2:168099752C>A	ENST00000409195.1	+	9	1939	c.1850C>A	c.(1849-1851)aCc>aAc	p.T617N	XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409273.1_Missense_Mutation_p.T395N|XIRP2_ENST00000295237.9_Missense_Mutation_p.T617N|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000420519.1_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	442					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)		p.T617N(1)		NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						GTGAAATATACCACATGGATG	0.438																																																	1	Substitution - Missense(1)	kidney(1)											89.0	92.0	91.0					2																	168099752		1962	4131	6093	SO:0001583	missense	129446			AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.1850C>A	2.37:g.168099752C>A	ENSP00000386840:p.Thr617Asn		A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409195.1	37	CCDS42769.1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.523977	0.85600	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273	T;T;T	0.35048	1.33;1.33;1.33	5.54	5.54	0.83059	.	0.108151	0.64402	D	0.000007	T	0.50871	0.1641	L	0.29908	0.895	0.58432	D	0.999998	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.76071	0.974;0.956;0.987	T	0.52155	-0.8613	10	0.66056	D	0.02	-10.1066	19.0979	0.93260	0.0:1.0:0.0:0.0	.	442;442;395	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	N	617;617;395	ENSP00000386840:T617N;ENSP00000295237:T617N;ENSP00000387255:T395N	ENSP00000295237:T617N	T	+	2	0	XIRP2	167807998	0.977000	0.34250	0.993000	0.49108	0.941000	0.58515	3.316000	0.51960	2.615000	0.88500	0.655000	0.94253	ACC		0.438	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1		NM_152381	
YEATS4	8089	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	69764550	69764550	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr12:69764550C>G	ENST00000247843.2	+	5	668	c.398C>G	c.(397-399)aCa>aGa	p.T133R	YEATS4_ENST00000548020.1_Missense_Mutation_p.T79R	NM_006530.2	NP_006521.1	O95619	YETS4_HUMAN	YEATS domain containing 4	133					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic nuclear division (GO:0007067)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|protein C-terminus binding (GO:0008022)|sequence-specific DNA binding transcription factor activity (GO:0003700)|structural constituent of cytoskeleton (GO:0005200)	p.T133R(1)		breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(1)	5	all_epithelial(5;9.25e-35)|Breast(13;9.83e-07)|Esophageal squamous(21;0.187)		Epithelial(6;6.89e-18)|BRCA - Breast invasive adenocarcinoma(5;3.14e-09)|Lung(24;9.68e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|OV - Ovarian serous cystadenocarcinoma(12;0.00691)|STAD - Stomach adenocarcinoma(21;0.0151)|LUSC - Lung squamous cell carcinoma(43;0.24)|Kidney(9;0.241)			GGGAAAAAGACAGTGGTTTCA	0.343																																																	1	Substitution - Missense(1)	kidney(1)											99.0	99.0	99.0					12																	69764550		2203	4300	6503	SO:0001583	missense	8089			AJ245746	CCDS8990.1, CCDS73495.1	12q13-q15	2008-02-05				ENSG00000127337			24859	protein-coding gene	gene with protein product		602116				9302258, 11903063	Standard	XM_005269163		Approved	NuBI-1, GAS41, YAF9	uc001sux.3	O95619	OTTHUMG00000169358	ENST00000247843.2:c.398C>G	12.37:g.69764550C>G	ENSP00000247843:p.Thr133Arg		Q9NQD0	Missense_Mutation	SNP	ENST00000247843.2	37	CCDS8990.1	.	.	.	.	.	.	.	.	.	.	C	13.59	2.282306	0.40394	.	.	ENSG00000127337	ENST00000247843;ENST00000548020;ENST00000549685;ENST00000552955	.	.	.	6.04	6.04	0.98038	.	0.000000	0.85682	D	0.000000	T	0.52175	0.1718	N	0.25647	0.755	0.80722	D	1	B	0.14438	0.01	B	0.09377	0.004	T	0.42413	-0.9453	8	.	.	.	-25.2701	20.6396	0.99537	0.0:1.0:0.0:0.0	.	133	O95619	YETS4_HUMAN	R	133;79;75;174	.	.	T	+	2	0	YEATS4	68050817	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.440000	0.80464	2.881000	0.98747	0.650000	0.86243	ACA		0.343	YEATS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403663.1		NM_006530	
ZNF267	10308	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	31927436	31927436	+	Missense_Mutation	SNP	T	T	G			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr16:31927436T>G	ENST00000300870.10	+	4	2075	c.1866T>G	c.(1864-1866)caT>caG	p.H622Q		NM_001265588.1|NM_003414.5	NP_001252517.1|NP_003405	Q14586	ZN267_HUMAN	zinc finger protein 267	622					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.H622Q(1)		breast(3)|endometrium(5)|kidney(1)|large_intestine(14)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	41						TTATTCAGCATCGGAGAATTC	0.423																																																	1	Substitution - Missense(1)	kidney(1)											73.0	76.0	75.0					16																	31927436		2197	4300	6497	SO:0001583	missense	10308			X78925	CCDS32440.1	16p11.2	2013-01-08			ENSG00000185947	ENSG00000185947		"""Zinc fingers, C2H2-type"", ""-"""	13060	protein-coding gene	gene with protein product		604752				7865130	Standard	NM_003414		Approved	HZF2	uc002ecs.5	Q14586		ENST00000300870.10:c.1866T>G	16.37:g.31927436T>G	ENSP00000300870:p.His622Gln		A0JNZ9|Q8NE41|Q9NRJ0	Missense_Mutation	SNP	ENST00000300870.10	37	CCDS32440.1	.	.	.	.	.	.	.	.	.	.	.	13.65	2.300781	0.40694	.	.	ENSG00000185947	ENST00000300870	D	0.86865	-2.18	0.468	0.468	0.16732	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.93406	0.7897	H	0.94345	3.525	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	D	0.90556	0.4512	9	0.72032	D	0.01	.	5.2175	0.15350	0.0:1.0E-4:0.0:0.9999	.	622	Q14586	ZN267_HUMAN	Q	622	ENSP00000300870:H622Q	ENSP00000300870:H622Q	H	+	3	2	ZNF267	31834937	0.000000	0.05858	0.217000	0.23759	0.201000	0.24016	-0.491000	0.06474	0.413000	0.25759	0.402000	0.26972	CAT		0.423	ZNF267-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432446.2		NM_003414	
ZNF616	90317	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	52618234	52618234	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr19:52618234C>T	ENST00000600228.1	-	4	2444	c.2183G>A	c.(2182-2184)cGg>cAg	p.R728Q	ZNF616_ENST00000330123.5_3'UTR	NM_178523.3	NP_848618.2	Q08AN1	ZN616_HUMAN	zinc finger protein 616	728					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R728Q(1)		breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(14)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	48				GBM - Glioblastoma multiforme(134;0.00392)|OV - Ovarian serous cystadenocarcinoma(262;0.0189)		GGAAAACAACCGCCCAAAGGC	0.408																																																	1	Substitution - Missense(1)	kidney(1)											134.0	134.0	134.0					19																	52618234		2203	4300	6503	SO:0001583	missense	90317			AK092266	CCDS33090.1	19q13.41	2013-01-08				ENSG00000204611		"""Zinc fingers, C2H2-type"", ""-"""	28062	protein-coding gene	gene with protein product							Standard	NM_178523		Approved	MGC45556	uc002pym.3	Q08AN1		ENST00000600228.1:c.2183G>A	19.37:g.52618234C>T	ENSP00000471000:p.Arg728Gln		B3KRV1|Q0P658|Q658V7	Missense_Mutation	SNP	ENST00000600228.1	37	CCDS33090.1	.	.	.	.	.	.	.	.	.	.	C	2.699	-0.271409	0.05716	.	.	ENSG00000204611	ENST00000330123	.	.	.	1.8	-1.01	0.10169	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06462	0.0166	N	0.05259	-0.085	0.09310	N	1	P	0.38020	0.615	B	0.21151	0.033	T	0.29119	-1.0022	8	0.05959	T	0.93	.	5.4344	0.16472	0.0:0.346:0.0:0.654	.	728	Q08AN1	ZN616_HUMAN	Q	728	.	ENSP00000328722:R728Q	R	-	2	0	ZNF616	57310046	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-3.171000	0.00573	-0.580000	0.05944	-0.350000	0.07774	CGG		0.408	ZNF616-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462451.1		XM_030892	
ZNFX1	57169	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	47887879	47887879	+	Missense_Mutation	SNP	G	G	C			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr20:47887879G>C	ENST00000396105.1	-	3	716	c.470C>G	c.(469-471)cCt>cGt	p.P157R	ZNFX1_ENST00000371752.1_Missense_Mutation_p.P157R|ZNFX1_ENST00000371754.4_Missense_Mutation_p.P157R	NM_021035.2	NP_066363.1	Q9P2E3	ZNFX1_HUMAN	zinc finger, NFX1-type containing 1	157							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.P157R(2)		cervix(2)|endometrium(8)|kidney(7)|large_intestine(15)|liver(1)|lung(17)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	60			BRCA - Breast invasive adenocarcinoma(12;0.00173)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			CACCTCAGAAGGGTCTTTCTG	0.488																																																	2	Substitution - Missense(2)	kidney(2)											105.0	111.0	109.0					20																	47887879		2203	4300	6503	SO:0001583	missense	57169			AK022641	CCDS13417.1	20q13.13	2014-02-12			ENSG00000124201	ENSG00000124201			29271	protein-coding gene	gene with protein product						10718198	Standard	NM_021035		Approved	KIAA1404, FLJ11277	uc002xui.3	Q9P2E3	OTTHUMG00000032696	ENST00000396105.1:c.470C>G	20.37:g.47887879G>C	ENSP00000379412:p.Pro157Arg		Q9BQM7|Q9BQM8|Q9H8C1|Q9H9S2|Q9NUM1|Q9NWW1	Missense_Mutation	SNP	ENST00000396105.1	37	CCDS13417.1	.	.	.	.	.	.	.	.	.	.	G	15.90	2.969614	0.53614	.	.	ENSG00000124201	ENST00000396106;ENST00000371754;ENST00000371752;ENST00000396105;ENST00000371744	T;T;T;T	0.67345	-0.26;-0.26;-0.26;-0.26	5.97	5.97	0.96955	.	0.213266	0.49305	D	0.000143	T	0.72382	0.3453	M	0.63843	1.955	0.20489	N	0.999896	P	0.47191	0.891	P	0.47206	0.541	T	0.68849	-0.5300	10	0.62326	D	0.03	-6.2143	19.0026	0.92839	0.0:0.0:1.0:0.0	.	157	Q9P2E3	ZNFX1_HUMAN	R	157	ENSP00000360819:P157R;ENSP00000360817:P157R;ENSP00000379412:P157R;ENSP00000360809:P157R	ENSP00000360809:P157R	P	-	2	0	ZNFX1	47321286	1.000000	0.71417	0.958000	0.39756	0.989000	0.77384	7.941000	0.87700	2.836000	0.97738	0.655000	0.94253	CCT		0.488	ZNFX1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079647.2		NM_021035	
LOC100288637	100288637	broad.mit.edu	37	15	30938483	30938483	+	lincRNA	SNP	T	T	C	rs145453249		TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr15:30938483T>C	ENST00000602684.1	+	0	0																											CCACCAGGCTTCTCCTTTCCC	0.463																																																	0																																												89839																															15.37:g.30938483T>C				RNA	SNP	ENST00000602684.1	37																																																																																					0.463	RP11-932O9.10-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000467507.1			
COL26A1	136227	broad.mit.edu	37	7	101006350	101006350	+	RNA	SNP	T	T	G			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr7:101006350T>G	ENST00000397927.3	+	0	250				COL26A1_ENST00000313669.7_RNA|COL26A1_ENST00000528707.1_RNA	NM_001278563.1	NP_001265492.1	Q96A83	COQA1_HUMAN	collagen, type XXVI, alpha 1						collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)		p.C13G(1)									GGCGTGTTGCTGCCTCTGCGG	0.751																																																	1	Substitution - Missense(1)	kidney(1)											5.0	7.0	6.0					7																	101006350		1981	4095	6076			136227			AJ416091	CCDS64739.1	7q22.1	2013-01-16	2013-01-16	2013-01-16	ENSG00000160963	ENSG00000160963		"""Collagens"", ""EMI domain containing"""	18038	protein-coding gene	gene with protein product	"""Emu2 gene"""	608927	"""EMI domain containing 2"""	EMID2		12221002, 12145293	Standard	NM_001278563		Approved	Emu2, EMI6	uc003uyo.1	Q96A83	OTTHUMG00000150033		7.37:g.101006350T>G			Q32M90	Missense_Mutation	SNP	ENST00000397927.3	37		.	.	.	.	.	.	.	.	.	.	T	13.89	2.371233	0.42003	.	.	ENSG00000160963	ENST00000313669	D	0.91180	-2.8	4.02	2.87	0.33458	.	0.000000	0.36893	U	0.002351	T	0.76241	0.3960	N	0.08118	0	0.22017	N	0.999419	D;D	0.53885	0.963;0.963	B;B	0.41036	0.346;0.346	T	0.69476	-0.5135	10	0.35671	T	0.21	.	5.339	0.15973	0.0:0.1328:0.0:0.8672	.	13;13	Q96A83;C9JPW4	EMID2_HUMAN;.	G	13	ENSP00000318234:C13G	ENSP00000318234:C13G	C	+	1	0	EMID2	100793070	1.000000	0.71417	1.000000	0.80357	0.873000	0.50193	4.278000	0.58946	1.436000	0.47453	0.254000	0.18369	TGC		0.751	COL26A1-002	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000315898.2		NM_133457	
KCNJ3	3760	broad.mit.edu	37	2	155555946	155555946	+	Missense_Mutation	SNP	A	A	C	rs200105020		TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr2:155555946A>C	ENST00000295101.2	+	1	1136	c.659A>C	c.(658-660)aAc>aCc	p.N220T	KCNJ3_ENST00000544049.1_Missense_Mutation_p.N220T|AC061961.2_ENST00000443901.1_RNA	NM_001260509.1|NM_002239.3	NP_001247438.1|NP_002230.1	P48549	KCNJ3_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 3	220					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|response to electrical stimulus (GO:0051602)|synaptic transmission (GO:0007268)	external side of plasma membrane (GO:0009897)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated potassium channel complex (GO:0008076)	G-protein activated inward rectifier potassium channel activity (GO:0015467)	p.N220T(1)		breast(2)|endometrium(2)|kidney(3)|large_intestine(9)|lung(30)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	54					Halothane(DB01159)	AACCTGCGCAACAGCCACATG	0.632																																																	1	Substitution - Missense(1)	kidney(1)											32.0	28.0	30.0					2																	155555946		2203	4300	6503	SO:0001583	missense	3760			U50964	CCDS2200.1, CCDS58733.1	2q24.1	2011-07-05			ENSG00000162989	ENSG00000162989		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6264	protein-coding gene	gene with protein product		601534				8088798, 16382105	Standard	NM_002239		Approved	Kir3.1, GIRK1, KGA	uc002tyv.2	P48549	OTTHUMG00000131937	ENST00000295101.2:c.659A>C	2.37:g.155555946A>C	ENSP00000295101:p.Asn220Thr		B4DEW7|Q8TBI0	Missense_Mutation	SNP	ENST00000295101.2	37	CCDS2200.1	.	.	.	.	.	.	.	.	.	.	A	27.5	4.836579	0.91117	.	.	ENSG00000162989	ENST00000295101;ENST00000544049	D;D	0.94000	-2.89;-3.33	5.61	5.61	0.85477	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (1);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.000000	0.85682	D	0.000000	D	0.95683	0.8596	M	0.72353	2.195	0.80722	D	1	P;P	0.51537	0.474;0.946	B;P	0.60886	0.383;0.88	D	0.95928	0.8936	10	0.66056	D	0.02	.	14.6234	0.68602	1.0:0.0:0.0:0.0	.	220;220	B4DEW7;P48549	.;IRK3_HUMAN	T	220	ENSP00000295101:N220T;ENSP00000438410:N220T	ENSP00000295101:N220T	N	+	2	0	KCNJ3	155264192	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.451000	0.80668	2.135000	0.66039	0.459000	0.35465	AAC		0.632	KCNJ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254890.2		NM_002239	
KIAA1147	57189	broad.mit.edu	37	7	141364002	141364002	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr7:141364002T>C	ENST00000536163.1	-	8	1141	c.1142A>G	c.(1141-1143)tAc>tGc	p.Y381C	RP5-894A10.6_ENST00000602609.1_RNA|KIAA1147_ENST00000482493.1_Missense_Mutation_p.Y277C	NM_001080392.1	NP_001073861.1	A4D1U4	LCHN_HUMAN	KIAA1147	381								p.Y381C(1)		breast(3)|endometrium(4)|kidney(2)|large_intestine(1)|ovary(1)|skin(1)	12	Melanoma(164;0.0171)					ACAAGGGTTGTAGTCTTCTTC	0.572																																																	1	Substitution - Missense(1)	kidney(1)											64.0	71.0	69.0					7																	141364002		2069	4194	6263	SO:0001583	missense	57189			AB032973	CCDS47726.1	7q34	2012-10-04			ENSG00000257093	ENSG00000257093			29472	protein-coding gene	gene with protein product							Standard	NM_001080392		Approved	LCHN	uc003vwk.3	A4D1U4	OTTHUMG00000157539	ENST00000536163.1:c.1142A>G	7.37:g.141364002T>C	ENSP00000445768:p.Tyr381Cys		Q9ULS3	Missense_Mutation	SNP	ENST00000536163.1	37	CCDS47726.1	.	.	.	.	.	.	.	.	.	.	T	12.96	2.095882	0.36952	.	.	ENSG00000257093	ENST00000536163;ENST00000482493	.	.	.	6.07	2.36	0.29203	.	0.264283	0.44483	N	0.000448	T	0.06280	0.0162	N	0.00237	-1.79	0.30728	N	0.747576	B	0.06786	0.001	B	0.09377	0.004	T	0.11131	-1.0600	9	0.38643	T	0.18	-17.1836	2.8376	0.05520	0.0:0.3034:0.249:0.4476	.	381	A4D1U4	LCHN_HUMAN	C	381;277	.	ENSP00000297761:Y381C	Y	-	2	0	KIAA1147	141010471	1.000000	0.71417	0.871000	0.34182	0.979000	0.70002	2.811000	0.47986	0.511000	0.28236	-0.256000	0.11100	TAC		0.572	KIAA1147-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349104.1			
RP11-38M15.11	0	broad.mit.edu	37	13	19433013	19433013	+	lincRNA	SNP	G	G	A			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr13:19433013G>A	ENST00000418741.1	+	0	0																											CATGGAAAATGCTTGGGAGCA	0.353																																																	0																																												0																															13.37:g.19433013G>A				RNA	SNP	ENST00000418741.1	37																																																																																					0.353	RP11-38M15.11-001	KNOWN	not_best_in_genome_evidence|basic	lincRNA	lincRNA	OTTHUMT00000043983.1			
PVRL3	25945	broad.mit.edu	37	3	110837556	110837556	+	Missense_Mutation	SNP	A	A	T			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr3:110837556A>T	ENST00000485303.1	+	3	831	c.556A>T	c.(556-558)Aat>Tat	p.N186Y	PVRL3_ENST00000319792.3_Missense_Mutation_p.N186Y|PVRL3_ENST00000493615.1_Missense_Mutation_p.N163Y	NM_001243286.1|NM_015480.2	NP_001230215.1|NP_056295.1	Q9NQS3	PVRL3_HUMAN	poliovirus receptor-related 3	186	Ig-like C2-type 1.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|fertilization (GO:0009566)|homophilic cell adhesion (GO:0007156)|lens morphogenesis in camera-type eye (GO:0002089)|retina morphogenesis in camera-type eye (GO:0060042)|single organismal cell-cell adhesion (GO:0016337)	apical junction complex (GO:0043296)|cell-cell adherens junction (GO:0005913)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	cell adhesion molecule binding (GO:0050839)|protein homodimerization activity (GO:0042803)	p.N163Y(1)|p.N186Y(1)		breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(3)	19						TGATGGAGGAAATGAAACAGT	0.378																																																	2	Substitution - Missense(2)	kidney(2)											41.0	37.0	38.0					3																	110837556		2203	4300	6503	SO:0001583	missense	25945			AF282874	CCDS2957.1, CCDS58842.1, CCDS58843.1	3q13	2013-01-29			ENSG00000177707	ENSG00000177707		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17664	protein-coding gene	gene with protein product		607147				11024295	Standard	NM_015480		Approved	nectin-3, PPR3, PVRR3, DKFZP566B0846, CDw113, CD113	uc003dxt.2	Q9NQS3	OTTHUMG00000159239	ENST00000485303.1:c.556A>T	3.37:g.110837556A>T	ENSP00000418070:p.Asn186Tyr		E9PFR0|Q6NVZ3|Q8NC05|Q8WVU4|Q9BVA9|Q9Y412	Missense_Mutation	SNP	ENST00000485303.1	37	CCDS2957.1	.	.	.	.	.	.	.	.	.	.	A	23.4	4.414618	0.83449	.	.	ENSG00000177707	ENST00000485303;ENST00000319792;ENST00000493615	T;T;T	0.00626	6.13;6.13;6.13	5.6	5.6	0.85130	CD80-like, immunoglobulin C2-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.092464	0.64402	D	0.000001	T	0.02848	0.0085	M	0.62723	1.935	0.58432	D	0.999998	D;D	0.76494	0.998;0.999	D;D	0.81914	0.995;0.979	T	0.53641	-0.8410	10	0.87932	D	0	.	13.7501	0.62901	1.0:0.0:0.0:0.0	.	163;186	E9PFR0;Q9NQS3	.;PVRL3_HUMAN	Y	186;186;163	ENSP00000418070:N186Y;ENSP00000321514:N186Y;ENSP00000420579:N163Y	ENSP00000321514:N186Y	N	+	1	0	PVRL3	112320246	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.133000	0.89605	2.140000	0.66376	0.528000	0.53228	AAT		0.378	PVRL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354045.1		NM_015480	
MUC4	4585	broad.mit.edu	37	3	195505830	195505830	+	Silent	SNP	G	G	C	rs373203224		TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr3:195505830G>C	ENST00000463781.3	-	2	13080	c.12621C>G	c.(12619-12621)acC>acG	p.T4207T	MUC4_ENST00000475231.1_Silent_p.T4207T|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.T4207T(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CAGGAAGAGGGGTGGCGTGAC	0.602																																																	1	Substitution - coding silent(1)	kidney(1)											16.0	15.0	15.0					3																	195505830		686	1569	2255	SO:0001819	synonymous_variant	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12621C>G	3.37:g.195505830G>C			O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																				0.602	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6		NM_018406	
RPAP1	26015	broad.mit.edu	37	15	41815528	41815528	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr15:41815528G>T	ENST00000304330.4	-	18	2577	c.2461C>A	c.(2461-2463)Ctc>Atc	p.L821I	RPAP1_ENST00000561603.1_Missense_Mutation_p.L821I	NM_015540.2	NP_056355.2	Q9BWH6	RPAP1_HUMAN	RNA polymerase II associated protein 1	821						nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)	p.L821I(1)		NS(1)|breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(16)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	45		all_cancers(109;6.59e-20)|all_epithelial(112;7.67e-17)|Lung NSC(122;5.34e-11)|all_lung(180;4.17e-10)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		OV - Ovarian serous cystadenocarcinoma(18;2.84e-17)|GBM - Glioblastoma multiforme(113;1.68e-06)|Colorectal(105;0.0163)|BRCA - Breast invasive adenocarcinoma(123;0.117)		ATGTCCTGGAGCCAATCCTCC	0.577																																																	1	Substitution - Missense(1)	kidney(1)											37.0	39.0	38.0					15																	41815528		2203	4300	6503	SO:0001583	missense	26015			BC000246	CCDS10079.1	15q14	2004-03-16			ENSG00000103932	ENSG00000103932			24567	protein-coding gene	gene with protein product		611475				10718198	Standard	XM_005254297		Approved	DKFZP727M111, KIAA1403, MGC858, FLJ12732	uc001zod.3	Q9BWH6	OTTHUMG00000130342	ENST00000304330.4:c.2461C>A	15.37:g.41815528G>T	ENSP00000306123:p.Leu821Ile		Q9H9I2|Q9NSQ5|Q9P2E4|Q9UFS7	Missense_Mutation	SNP	ENST00000304330.4	37	CCDS10079.1	.	.	.	.	.	.	.	.	.	.	G	18.00	3.525485	0.64860	.	.	ENSG00000103932	ENST00000304330	T	0.67345	-0.26	5.7	5.7	0.88788	.	0.218096	0.37577	N	0.002036	T	0.77805	0.4185	M	0.66939	2.045	0.36757	D	0.88309	D	0.89917	1.0	D	0.71184	0.972	T	0.82629	-0.0363	10	0.87932	D	0	-13.6196	10.1363	0.42708	0.0942:0.0:0.9058:0.0	.	821	Q9BWH6	RPAP1_HUMAN	I	821	ENSP00000306123:L821I	ENSP00000306123:L821I	L	-	1	0	RPAP1	39602820	1.000000	0.71417	1.000000	0.80357	0.450000	0.32258	4.664000	0.61540	2.679000	0.91253	0.655000	0.94253	CTC		0.577	RPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252694.2		NM_015540	
ZNF66	7617	broad.mit.edu	37	19	20975384	20975384	+	Missense_Mutation	SNP	G	G	C			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr19:20975384G>C	ENST00000344519.8	+	2	93	c.70G>C	c.(70-72)Gca>Cca	p.A24P	ZNF66_ENST00000425625.1_Missense_Mutation_p.A70P|ZNF66_ENST00000360204.5_Missense_Mutation_p.A2P|ZNF66_ENST00000594534.1_Missense_Mutation_p.A24P			Q6ZN08	ZNF66_HUMAN	zinc finger protein 66	24	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A70P(1)|p.A24P(1)									CCTGGACATGGCACAGCGGAA	0.388																																																	2	Substitution - Missense(2)	kidney(2)																																								SO:0001583	missense	0			M88375		19p12	2013-03-06	2013-03-06	2013-03-06	ENSG00000160229	ENSG00000160229			13135	other	unknown			"""zinc finger protein 66, pseudogene"""	ZNF66P		1505991	Standard	NG_023377		Approved	FLJ16537	uc002npe.3	Q6ZN08	OTTHUMG00000167735	ENST00000344519.8:c.70G>C	19.37:g.20975384G>C	ENSP00000461425:p.Ala24Pro		I3L4P5|Q15939	RNA	SNP	ENST00000344519.8	37																																																																																					0.388	ZNF66-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000395955.2		NG_023377	
C3orf56	285311	broad.mit.edu	37	3	126916008	126916008	+	Silent	SNP	T	T	C			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr3:126916008T>C	ENST00000398112.1	+	2	720	c.480T>C	c.(478-480)acT>acC	p.T160T		NM_001007534.2	NP_001007535.1	Q8N813	CC056_HUMAN	chromosome 3 open reading frame 56	160								p.T160T(1)		breast(1)|endometrium(2)|kidney(1)|lung(5)	9				GBM - Glioblastoma multiforme(114;0.142)		GATGCTGGACTCCAGCCAGCT	0.617																																																	1	Substitution - coding silent(1)	kidney(1)											39.0	46.0	44.0					3																	126916008		1888	4110	5998	SO:0001819	synonymous_variant	0			AK097460	CCDS63757.1	3q21.3	2012-08-08			ENSG00000214324	ENSG00000214324			32481	protein-coding gene	gene with protein product						14702039	Standard	NM_001007534		Approved	FLJ40141	uc003eji.1	Q8N813	OTTHUMG00000159593	ENST00000398112.1:c.480T>C	3.37:g.126916008T>C			B2RNW5	Silent	SNP	ENST00000398112.1	37																																																																																					0.617	C3orf56-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000356354.1			
ZNF841	284371	broad.mit.edu	37	19	52570738	52570738	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr19:52570738C>A	ENST00000426391.2	-	5	600	c.49G>T	c.(49-51)Gaa>Taa	p.E17*	ZNF841_ENST00000359973.2_Nonsense_Mutation_p.E17*|ZNF841_ENST00000594295.1_Nonsense_Mutation_p.E133*|ZNF432_ENST00000598446.1_Intron|ZNF841_ENST00000389534.4_Nonsense_Mutation_p.E133*			Q6ZN19	ZN841_HUMAN	zinc finger protein 841	17					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E133*(2)|p.E17*(1)		breast(1)|endometrium(4)|kidney(3)|lung(3)	11						TTCCGGATTTCCCTGAAGTAA	0.368																																																	3	Substitution - Nonsense(3)	kidney(3)											115.0	86.0	95.0					19																	52570738		692	1591	2283	SO:0001587	stop_gained	284371			AK131409	CCDS46161.1	19q13.41	2013-01-08			ENSG00000197608	ENSG00000197608		"""Zinc fingers, C2H2-type"", ""-"""	27611	protein-coding gene	gene with protein product							Standard	NM_001136499		Approved	LOC284371	uc010ydh.1	Q6ZN19		ENST00000426391.2:c.49G>T	19.37:g.52570738C>A	ENSP00000415453:p.Glu17*		B9EG58|Q6ZN82|Q6ZP71|Q8N9U7	Nonsense_Mutation	SNP	ENST00000426391.2	37		.	.	.	.	.	.	.	.	.	.	C	38	6.636411	0.97722	.	.	ENSG00000197608	ENST00000389534;ENST00000426391;ENST00000359973	.	.	.	2.88	-2.84	0.05751	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	.	4.3427	0.11117	0.0:0.2678:0.4426:0.2896	.	.	.	.	X	133;17;17	.	ENSP00000353060:E17X	E	-	1	0	ZNF841	57262550	0.000000	0.05858	0.005000	0.12908	0.079000	0.17450	0.104000	0.15313	-0.258000	0.09446	0.313000	0.20887	GAA		0.368	ZNF841-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000462435.1		XM_209155	
ZSCAN2	54993	broad.mit.edu	37	15	85147434	85147434	+	Silent	SNP	A	A	T			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr15:85147434A>T	ENST00000448803.2	+	2	568	c.276A>T	c.(274-276)gtA>gtT	p.V92V	ZSCAN2_ENST00000541040.1_Silent_p.V92V|ZSCAN2_ENST00000379358.3_Silent_p.V92V|ZSCAN2_ENST00000485222.2_Silent_p.V92V|ZSCAN2_ENST00000327179.6_Silent_p.V92V|ZSCAN2_ENST00000334141.3_Silent_p.V92V|ZSCAN2_ENST00000538076.1_Silent_p.V92V|ZSCAN2_ENST00000546148.1_Silent_p.V92V|ZSCAN2_ENST00000358472.3_Intron	NM_181877.3	NP_870992.2	Q7Z7L9	ZSCA2_HUMAN	zinc finger and SCAN domain containing 2	92	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.V92V(1)		breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(7)|liver(2)|lung(4)|ovary(1)|pancreas(1)	19				UCEC - Uterine corpus endometrioid carcinoma (272;0.168)|all cancers(203;5.43e-22)		GACCAGAGGTACACACCAAGG	0.642																																																	1	Substitution - coding silent(1)	kidney(1)											41.0	37.0	39.0					15																	85147434		2203	4299	6502	SO:0001819	synonymous_variant	54993			BC041620	CCDS10329.2, CCDS32315.1, CCDS32316.1	15q25.2	2013-01-08	2004-11-01	2004-11-02	ENSG00000176371	ENSG00000176371		"""-"", ""Zinc fingers, C2H2-type"""	20994	protein-coding gene	gene with protein product			"""zinc finger protein 29"""	ZFP29		1937051	Standard	NM_017894		Approved	FLJ20595, ZNF854	uc002bkr.3	Q7Z7L9	OTTHUMG00000074027	ENST00000448803.2:c.276A>T	15.37:g.85147434A>T			A6NG83|B2RMQ9|Q6ZQY9|Q9NWU4	Silent	SNP	ENST00000448803.2	37	CCDS10329.2																																																																																				0.642	ZSCAN2-007	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396956.1		NM_017894	
C10orf105	414152	broad.mit.edu	37	10	73499530	73499530	+	5'Flank	SNP	G	G	T			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454	.		Illumina GAIIx	ac66d658-97d4-416b-8028-0077a1c8a01d	7c55a5d6-c39b-465f-9ff9-bdb754beea82	g.chr10:73499530G>T	ENST00000398786.2	-	0	0				CDH23_ENST00000224721.6_Splice_Site	NM_001168390.1	NP_001161862.1	Q8TEF2	CJ105_HUMAN	chromosome 10 open reading frame 105							integral component of membrane (GO:0016021)		p.?(1)									CATCCTCCAGGTGGGGCCTGG	0.592																																						.											1	Unknown(1)	kidney(1)											29.0	31.0	31.0					10																	73499530		1968	4133	6101	SO:0001631	upstream_gene_variant	64072			AK074172	CCDS44430.1	10q22.1	2012-06-01			ENSG00000214688	ENSG00000214688			20304	protein-coding gene	gene with protein product							Standard	NM_001164375		Approved	FLJ00245	uc001jsa.2	Q8TEF2	OTTHUMG00000018427		10.37:g.73499530G>T	Exception_encountered			Splice_Site	SNP	ENST00000398786.2	37	CCDS44430.1	.	.	.	.	.	.	.	.	.	.	G	26.0	4.690886	0.88735	.	.	ENSG00000107736	ENST00000398860;ENST00000398855;ENST00000224721;ENST00000398792	.	.	.	5.67	5.67	0.87782	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.7591	0.96306	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CDH23	73169536	1.000000	0.71417	0.998000	0.56505	0.967000	0.64934	8.314000	0.89980	2.681000	0.91329	0.655000	0.94253	.		0.592	C10orf105-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048551.2		NM_001164375	
