#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ABCA5	23461	hgsc.bcm.edu	37	17	67266771	67266771	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-4635-01A-02D-1373-10	TCGA-CJ-4635-11B-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	2504b5cf-c2ff-4d30-8b3f-27e43f862e17	d095c7c8-99bf-4b02-ba05-ace6938b7fa6	g.chr17:67266771T>C	ENST00000392676.3	-	22	3077	c.3013A>G	c.(3013-3015)Agt>Ggt	p.S1005G	ABCA5_ENST00000588877.1_Missense_Mutation_p.S1005G|ABCA5_ENST00000392677.2_Missense_Mutation_p.S1006G			Q8WWZ7	ABCA5_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 5	1005					cholesterol efflux (GO:0033344)|high-density lipoprotein particle remodeling (GO:0034375)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|reverse cholesterol transport (GO:0043691)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(18)|lung(19)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	54	Breast(10;3.72e-11)				Tacrolimus(DB00864)	AATGGGGTACTCCAGATCTGG	0.274																																																	0													123.0	139.0	134.0					17																	67266771		2203	4281	6484	SO:0001583	missense	23461			U66672	CCDS11685.1	17q24.3	2012-03-14			ENSG00000154265	ENSG00000154265		"""ATP binding cassette transporters / subfamily A"""	35	protein-coding gene	gene with protein product		612503				8894702	Standard	NM_172232		Approved	EST90625	uc002jig.2	Q8WWZ7		ENST00000392676.3:c.3013A>G	17.37:g.67266771T>C	ENSP00000376443:p.Ser1005Gly		Q8IVJ2|Q96LJ1|Q96MS4|Q96PZ9|Q9NY14	Missense_Mutation	SNP	ENST00000392676.3	37	CCDS11685.1	.	.	.	.	.	.	.	.	.	.	T	17.35	3.368150	0.61513	.	.	ENSG00000154265	ENST00000392677;ENST00000392676	D;D	0.84298	-1.83;-1.83	5.45	5.45	0.79879	.	0.386874	0.27464	N	0.019257	D	0.85405	0.5689	M	0.65498	2.005	0.51482	D	0.999927	B	0.19200	0.034	B	0.33121	0.158	T	0.81291	-0.0999	9	.	.	.	.	14.4987	0.67707	0.0:0.0:0.0:1.0	.	1005	Q8WWZ7	ABCA5_HUMAN	G	1006;1005	ENSP00000376444:S1006G;ENSP00000376443:S1005G	.	S	-	1	0	ABCA5	64778366	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.716000	0.68437	2.062000	0.61559	0.482000	0.46254	AGT		0.274	ABCA5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450654.1		NM_018672	
ACAN	176	hgsc.bcm.edu	37	15	89398671	89398671	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-4635-01A-02D-1373-10	TCGA-CJ-4635-11B-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	2504b5cf-c2ff-4d30-8b3f-27e43f862e17	d095c7c8-99bf-4b02-ba05-ace6938b7fa6	g.chr15:89398671G>A	ENST00000561243.1	+	11	2855	c.2855G>A	c.(2854-2856)gGg>gAg	p.G952E	ACAN_ENST00000439576.2_Missense_Mutation_p.G952E|ACAN_ENST00000352105.7_Missense_Mutation_p.G952E|ACAN_ENST00000559004.1_Missense_Mutation_p.G952E			P16112	PGCA_HUMAN	aggrecan	951	29 X 19 AA approximate tandem repeats of E-[IVDG]-[LV]-[EV]-[GTI]-[STA]-[ATV]- [SP]-[GA]-[VIFAD]-[GEDL]-[DE]-[LVI]-[SG]- [GERK]-[LV]-P-S-G.|CS-1.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|extracellular matrix structural constituent (GO:0005201)|hyaluronic acid binding (GO:0005540)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(15)|liver(2)|lung(40)|ovary(2)|prostate(5)|skin(5)|stomach(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	93	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			TCTGGAGTTGGGGATCTCAGT	0.552																																																	0													77.0	82.0	81.0					15																	89398671		1859	4111	5970	SO:0001583	missense	176			M55172	CCDS53970.1, CCDS53971.1	15q26.1	2013-05-07	2007-02-16	2007-02-16	ENSG00000157766	ENSG00000157766		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	319	protein-coding gene	gene with protein product	"""aggrecan proteoglycan"""	155760	"""chondroitin sulfate proteoglycan 1"", ""aggrecan 1"""	MSK16, CSPG1, AGC1		1985970	Standard	NM_013227		Approved	CSPGCP	uc010upo.1	P16112	OTTHUMG00000171989	ENST00000561243.1:c.2855G>A	15.37:g.89398671G>A	ENSP00000453342:p.Gly952Glu		Q13650|Q9UCD3|Q9UCP4|Q9UCP5|Q9UDE0	Missense_Mutation	SNP	ENST00000561243.1	37	CCDS53970.1	.	.	.	.	.	.	.	.	.	.	G	0.061	-1.225151	0.01530	.	.	ENSG00000157766	ENST00000439576;ENST00000352105;ENST00000268134	D;D	0.92699	-3.09;-3.09	4.49	-4.63	0.03359	.	.	.	.	.	T	0.67795	0.2931	N	0.01242	-0.935	0.09310	N	1	P;P	0.42827	0.791;0.791	B;B	0.40702	0.338;0.338	T	0.71925	-0.4445	9	0.02654	T	1	-0.1837	1.5117	0.02497	0.4953:0.1204:0.1943:0.1901	.	952;952	E7ENV9;E7EX88	.;.	E	952	ENSP00000387356:G952E;ENSP00000341615:G952E	ENSP00000268134:G952E	G	+	2	0	ACAN	87199675	0.000000	0.05858	0.021000	0.16686	0.161000	0.22273	-1.334000	0.02665	-0.378000	0.07918	-0.253000	0.11424	GGG		0.552	ACAN-006	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416267.2		NM_001135	
ACSS1	84532	hgsc.bcm.edu	37	20	25038484	25038484	+	Silent	SNP	G	G	T	rs66817095	byFrequency	TCGA-CJ-4635-01A-02D-1373-10	TCGA-CJ-4635-11B-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	2504b5cf-c2ff-4d30-8b3f-27e43f862e17	d095c7c8-99bf-4b02-ba05-ace6938b7fa6	g.chr20:25038484G>T	ENST00000323482.4	-	1	334	c.255C>A	c.(253-255)acC>acA	p.T85T	ACSS1_ENST00000376726.3_Silent_p.T85T|ACSS1_ENST00000432802.2_Silent_p.T85T	NM_001252675.1|NM_032501.3	NP_001239604.1|NP_115890.2	Q9NUB1	ACS2L_HUMAN	acyl-CoA synthetase short-chain family member 1	85					acetate biosynthetic process (GO:0019413)|acetyl-CoA biosynthetic process (GO:0006085)|acetyl-CoA biosynthetic process from acetate (GO:0019427)|ethanol oxidation (GO:0006069)|propionate biosynthetic process (GO:0019542)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	mitochondrial matrix (GO:0005759)	acetate-CoA ligase activity (GO:0003987)|AMP binding (GO:0016208)|ATP binding (GO:0005524)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	26					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	TGTGGTAGGGGGTGTCCCACA	0.662													G|||	959	0.191494	0.0098	0.2032	5008	,	,		10301	0.4812		0.1829	False		,,,				2504	0.1391																0								G		158,4248	101.6+/-140.2	2,154,2047	42.0	47.0	45.0		255	1.5	1.0	20	dbSNP_130	45	1447,7153	267.5+/-287.3	106,1235,2959	no	coding-synonymous	ACSS1	NM_032501.2		108,1389,5006	TT,TG,GG		16.8256,3.586,12.3405		85/690	25038484	1605,11401	2203	4300	6503	SO:0001819	synonymous_variant	84532				CCDS13167.1, CCDS58764.1, CCDS58765.1	20p11.23-p11.21	2012-07-13	2005-09-08	2005-09-08	ENSG00000154930	ENSG00000154930	6.2.1.1	"""Acyl-CoA synthetase family"""	16091	protein-coding gene	gene with protein product		614355	"""acetyl-Coenzyme A synthetase 2 (AMP forming)-like"""	ACAS2L			Standard	NM_032501		Approved	dJ568C11.3, AceCS2L, MGC33843	uc002wub.3	Q9NUB1	OTTHUMG00000032112	ENST00000323482.4:c.255C>A	20.37:g.25038484G>T			B3KXL2|B4DJZ3|D3DW48|F5H6F4|F8W7Y1|Q5TF42|Q8IV99|Q8N234|Q96JI1|Q96JX6|Q9NU28	Silent	SNP	ENST00000323482.4	37	CCDS13167.1																																																																																				0.662	ACSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078386.2		NM_032501	
ACTR10	55860	hgsc.bcm.edu;ucsc.edu	37	14	58701185	58701185	+	Silent	SNP	C	C	T			TCGA-CJ-4635-01A-02D-1373-10	TCGA-CJ-4635-11B-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	2504b5cf-c2ff-4d30-8b3f-27e43f862e17	d095c7c8-99bf-4b02-ba05-ace6938b7fa6	g.chr14:58701185C>T	ENST00000254286.4	+	13	1250	c.1170C>T	c.(1168-1170)ctC>ctT	p.L390L		NM_018477.2	NP_060947.1	Q9NZ32	ARP10_HUMAN	actin-related protein 10 homolog (S. cerevisiae)	390					microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|dynactin complex (GO:0005869)				central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(6)|prostate(1)|skin(1)|urinary_tract(1)	13						GGTGTTCTCTCAATAACCCAC	0.393																																																	0													112.0	107.0	109.0					14																	58701185		2203	4300	6503	SO:0001819	synonymous_variant	55860			AF220190	CCDS32090.1	14q23.1	2014-08-08			ENSG00000131966	ENSG00000131966			17372	protein-coding gene	gene with protein product						12857853	Standard	NM_018477		Approved	HARP11, ACTR11, Arp11	uc001xdf.3	Q9NZ32	OTTHUMG00000171049	ENST00000254286.4:c.1170C>T	14.37:g.58701185C>T			Q9H9Y5|Q9NWY2	Silent	SNP	ENST00000254286.4	37	CCDS32090.1	.	.	.	.	.	.	.	.	.	.	C	9.206	1.029809	0.19512	.	.	ENSG00000131966	ENST00000554642	.	.	.	5.78	2.67	0.31697	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	0.1828	9.2211	0.37377	0.0:0.3084:0.5925:0.0991	.	.	.	.	X	122	.	.	Q	+	1	0	ACTR10	57770938	0.992000	0.36948	1.000000	0.80357	0.990000	0.78478	0.139000	0.16036	0.305000	0.22832	0.655000	0.94253	CAA		0.393	ACTR10-002	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411405.1			
ALAS1	211	hgsc.bcm.edu	37	3	52239907	52239907	+	Missense_Mutation	SNP	G	G	C			TCGA-CJ-4635-01A-02D-1373-10	TCGA-CJ-4635-11B-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	2504b5cf-c2ff-4d30-8b3f-27e43f862e17	d095c7c8-99bf-4b02-ba05-ace6938b7fa6	g.chr3:52239907G>C	ENST00000394965.2	+	7	1213	c.853G>C	c.(853-855)Gga>Cga	p.G285R	ALAS1_ENST00000310271.2_Missense_Mutation_p.G285R|ALAS1_ENST00000469224.1_Missense_Mutation_p.G285R|ALAS1_ENST00000484952.1_Missense_Mutation_p.G285R	NM_000688.5	NP_000679.1	P13196	HEM1_HUMAN	aminolevulinate, delta-, synthase 1	285					cellular lipid metabolic process (GO:0044255)|heme biosynthetic process (GO:0006783)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	5-aminolevulinate synthase activity (GO:0003870)|pyridoxal phosphate binding (GO:0030170)			endometrium(3)|kidney(3)|large_intestine(7)|liver(2)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	23				BRCA - Breast invasive adenocarcinoma(193;5.13e-05)|Kidney(197;0.000583)|KIRC - Kidney renal clear cell carcinoma(197;0.000751)	Glycine(DB00145)	AAATATTTCTGGAACTAGTAA	0.443																																																	0													111.0	115.0	114.0					3																	52239907		2203	4300	6503	SO:0001583	missense	211			X56351	CCDS2847.1	3p21	2004-11-18			ENSG00000023330	ENSG00000023330	2.3.1.37		396	protein-coding gene	gene with protein product		125290		ALAS3, ALAS			Standard	NM_000688		Approved		uc003dcz.2	P13196	OTTHUMG00000158108	ENST00000394965.2:c.853G>C	3.37:g.52239907G>C	ENSP00000378416:p.Gly285Arg			Missense_Mutation	SNP	ENST00000394965.2	37	CCDS2847.1	.	.	.	.	.	.	.	.	.	.	G	33	5.277922	0.95459	.	.	ENSG00000023330	ENST00000469224;ENST00000394965;ENST00000310271;ENST00000484952	D;D;D;D	0.97232	-4.3;-4.3;-4.3;-4.3	5.83	5.83	0.93111	Aminotransferase, class I/classII (1);Tetrapyrrole biosynthesis, 5-aminolevulinic acid synthase (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	D	0.99411	0.9792	H	0.99906	4.925	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97927	1.0318	10	0.87932	D	0	-17.9898	20.1005	0.97872	0.0:0.0:1.0:0.0	.	302;285	B4DVA0;P13196	.;HEM1_HUMAN	R	285	ENSP00000417719:G285R;ENSP00000378416:G285R;ENSP00000309259:G285R;ENSP00000418779:G285R	ENSP00000309259:G285R	G	+	1	0	ALAS1	52214947	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.793000	0.99091	2.758000	0.94735	0.467000	0.42956	GGA		0.443	ALAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350207.1			
ANK2	287	hgsc.bcm.edu	37	4	114170963	114170963	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-4635-01A-02D-1373-10	TCGA-CJ-4635-11B-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	2504b5cf-c2ff-4d30-8b3f-27e43f862e17	d095c7c8-99bf-4b02-ba05-ace6938b7fa6	g.chr4:114170963A>G	ENST00000357077.4	+	10	988	c.935A>G	c.(934-936)gAc>gGc	p.D312G	ANK2_ENST00000506722.1_Missense_Mutation_p.D291G|ANK2_ENST00000264366.6_Missense_Mutation_p.D312G|ANK2_ENST00000394537.3_Missense_Mutation_p.D312G	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	312					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		AGTGGGCATGACCAAGTGGTG	0.443																																																	0													104.0	98.0	100.0					4																	114170963		2203	4300	6503	SO:0001583	missense	287			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.935A>G	4.37:g.114170963A>G	ENSP00000349588:p.Asp312Gly		Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	37	CCDS3702.1	.	.	.	.	.	.	.	.	.	.	A	20.7	4.035034	0.75617	.	.	ENSG00000145362	ENST00000503271;ENST00000503423;ENST00000506722;ENST00000504454;ENST00000394537;ENST00000357077;ENST00000264366;ENST00000343056	T;T;T;T;T;T;T	0.71222	-0.55;-0.07;-0.07;-0.07;-0.07;-0.07;-0.07	5.81	5.81	0.92471	Ankyrin repeat-containing domain (3);	0.000000	0.64402	D	0.000015	T	0.69833	0.3155	N	0.04724	-0.175	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.982;1.0;1.0;0.998	D;D;D;D;D	0.97110	1.0;0.939;0.999;0.999;0.996	T	0.75190	-0.3405	10	0.40728	T	0.16	.	16.1616	0.81721	1.0:0.0:0.0:0.0	.	312;312;312;291;291	Q01484;Q01484-2;Q01484-4;Q01484-5;F8WEF9	ANK2_HUMAN;.;.;.;.	G	291;291;291;327;312;312;312;291	ENSP00000423799:D291G;ENSP00000421011:D291G;ENSP00000421067:D291G;ENSP00000424722:D327G;ENSP00000378044:D312G;ENSP00000349588:D312G;ENSP00000264366:D312G	ENSP00000264366:D312G	D	+	2	0	ANK2	114390412	1.000000	0.71417	0.990000	0.47175	0.987000	0.75469	9.339000	0.96797	2.221000	0.72209	0.454000	0.30748	GAC		0.443	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2		NM_001148	
ANKRD55	79722	hgsc.bcm.edu	37	5	55455707	55455707	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-4635-01A-02D-1373-10	TCGA-CJ-4635-11B-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	2504b5cf-c2ff-4d30-8b3f-27e43f862e17	d095c7c8-99bf-4b02-ba05-ace6938b7fa6	g.chr5:55455707G>T	ENST00000341048.4	-	6	587	c.436C>A	c.(436-438)Ctg>Atg	p.L146M	ANKRD55_ENST00000504958.2_Missense_Mutation_p.L146M|ANKRD55_ENST00000513241.2_Missense_Mutation_p.L117M|ANKRD55_ENST00000505970.2_5'UTR	NM_024669.2	NP_078945.2	Q3KP44	ANR55_HUMAN	ankyrin repeat domain 55	146										breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(17)|ovary(1)|prostate(1)|skin(2)|stomach(1)	34		Lung NSC(810;8.69e-05)|Prostate(74;0.00634)|Breast(144;0.0334)|Ovarian(174;0.223)				TGTTGCAACAGGACCGTGAGG	0.448																																																	0													128.0	114.0	119.0					5																	55455707		2203	4300	6503	SO:0001583	missense	79722			AK021857	CCDS34161.1	5q11.2	2013-01-10			ENSG00000164512	ENSG00000164512		"""Ankyrin repeat domain containing"""	25681	protein-coding gene	gene with protein product		615189					Standard	XM_005248599		Approved	FLJ11795	uc003jqu.3	Q3KP44	OTTHUMG00000162305	ENST00000341048.4:c.436C>A	5.37:g.55455707G>T	ENSP00000342295:p.Leu146Met		B3KVT8|Q3KP45|Q9HAD3	Missense_Mutation	SNP	ENST00000341048.4	37	CCDS34161.1	.	.	.	.	.	.	.	.	.	.	G	16.09	3.023613	0.54683	.	.	ENSG00000164512	ENST00000507283;ENST00000341048;ENST00000504958;ENST00000513241;ENST00000519586	T;T;T	0.66995	1.33;-0.24;-0.24	5.33	4.34	0.51931	.	0.000000	0.64402	D	0.000004	T	0.82213	0.4988	M	0.88775	2.98	0.40530	D	0.98092	D	0.76494	0.999	D	0.87578	0.998	D	0.84093	0.0391	10	0.87932	D	0	.	8.8775	0.35354	0.1202:0.0:0.8798:0.0	.	146	B3KVT8	.	M	146;146;146;117;146	ENSP00000342295:L146M;ENSP00000424230:L146M;ENSP00000423507:L117M	ENSP00000342295:L146M	L	-	1	2	ANKRD55	55491464	1.000000	0.71417	0.995000	0.50966	0.583000	0.36354	2.418000	0.44662	1.108000	0.41662	0.650000	0.86243	CTG		0.448	ANKRD55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368510.4		NM_024669	
ANXA4	307	hgsc.bcm.edu;ucsc.edu	37	2	70008703	70008703	+	De_novo_Start_OutOfFrame	SNP	C	C	A			TCGA-CJ-4635-01A-02D-1373-10	TCGA-CJ-4635-11B-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	2504b5cf-c2ff-4d30-8b3f-27e43f862e17	d095c7c8-99bf-4b02-ba05-ace6938b7fa6	g.chr2:70008703C>A	ENST00000536030.1	+	0	124				ANXA4_ENST00000409920.1_Silent_p.A2A|ANXA4_ENST00000394295.4_Silent_p.A2A			P09525	ANXA4_HUMAN	annexin A4						epithelial cell differentiation (GO:0030855)|negative regulation of apoptotic process (GO:0043066)|negative regulation of catalytic activity (GO:0043086)|negative regulation of interleukin-8 secretion (GO:2000483)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|identical protein binding (GO:0042802)|NF-kappaB binding (GO:0051059)|phospholipase inhibitor activity (GO:0004859)			endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)	11						GAGTCATGGCCATGGTAAGTT	0.443																																																	0													145.0	116.0	126.0					2																	70008703		2203	4300	6503			307			M82809	CCDS1894.1	2p13.3	2008-02-05			ENSG00000196975	ENSG00000196975		"""Annexins"""	542	protein-coding gene	gene with protein product		106491		ANX4		1346776	Standard	NM_001153		Approved		uc002sfr.4	P09525	OTTHUMG00000129649	ENST00000536030.1:c.-282C>A	2.37:g.70008703C>A			B4DDF9|Q96F33|Q9BWK1	Silent	SNP	ENST00000536030.1	37																																																																																					0.443	ANXA4-201	KNOWN	basic	protein_coding	protein_coding			NM_001153	
AP3B1	8546	hgsc.bcm.edu	37	5	77406143	77406143	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-4635-01A-02D-1373-10	TCGA-CJ-4635-11B-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	2504b5cf-c2ff-4d30-8b3f-27e43f862e17	d095c7c8-99bf-4b02-ba05-ace6938b7fa6	g.chr5:77406143G>A	ENST00000255194.6	-	20	2460	c.2285C>T	c.(2284-2286)tCt>tTt	p.S762F	AP3B1_ENST00000519295.1_Missense_Mutation_p.S713F	NM_001271769.1	NP_001258698.1	O00203	AP3B1_HUMAN	adaptor-related protein complex 3, beta 1 subunit	762	Glu/Ser-rich.				anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|antigen processing and presentation, exogenous lipid antigen via MHC class Ib (GO:0048007)|blood coagulation (GO:0007596)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|positive regulation of NK T cell differentiation (GO:0051138)|protein targeting to lysosome (GO:0006622)	AP-3 adaptor complex (GO:0030123)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	GTP-dependent protein binding (GO:0030742)|protein phosphatase binding (GO:0019903)			breast(5)|central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(12)|lung(12)|prostate(1)|skin(2)|urinary_tract(1)	39		all_lung(232;0.000397)|Lung NSC(167;0.00106)|Ovarian(174;0.0105)|Prostate(461;0.215)		OV - Ovarian serous cystadenocarcinoma(54;8.23e-47)|Epithelial(54;2.74e-41)|all cancers(79;4.8e-36)		TGAAGTTTTAGATTTTTCATT	0.308									Hermansky-Pudlak syndrome																																								0													56.0	53.0	54.0					5																	77406143		2199	4296	6495	SO:0001583	missense	8546	Familial Cancer Database	HPS, HPS1-8	U81504	CCDS4041.1, CCDS64186.1	5q14.1	2014-09-17			ENSG00000132842	ENSG00000132842			566	protein-coding gene	gene with protein product		603401				9182526, 9151686	Standard	NM_003664		Approved	ADTB3A, HPS2	uc003kfj.4	O00203	OTTHUMG00000106919	ENST00000255194.6:c.2285C>T	5.37:g.77406143G>A	ENSP00000255194:p.Ser762Phe		E5RJ68|O00580|Q7Z393|Q9HD66	Missense_Mutation	SNP	ENST00000255194.6	37	CCDS4041.1	.	.	.	.	.	.	.	.	.	.	G	15.64	2.892147	0.52014	.	.	ENSG00000132842	ENST00000255194;ENST00000519295;ENST00000535760	D;D	0.97328	-4.34;-4.34	5.68	3.6	0.41247	.	1.052430	0.07302	N	0.874226	D	0.94026	0.8086	L	0.34521	1.04	0.09310	N	1	B	0.31054	0.306	B	0.31191	0.125	D	0.88757	0.3254	10	0.72032	D	0.01	-4.0283	8.1551	0.31165	0.1122:0.1633:0.7245:0.0	.	762	O00203	AP3B1_HUMAN	F	762;713;762	ENSP00000255194:S762F;ENSP00000430597:S713F	ENSP00000255194:S762F	S	-	2	0	AP3B1	77441899	0.853000	0.29707	0.230000	0.23976	0.998000	0.95712	1.767000	0.38501	1.350000	0.45770	0.655000	0.94253	TCT		0.308	AP3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000225548.2			
ARHGAP19	84986	hgsc.bcm.edu;ucsc.edu	37	10	99019161	99019161	+	Missense_Mutation	SNP	T	T	G			TCGA-CJ-4635-01A-02D-1373-10	TCGA-CJ-4635-11B-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	2504b5cf-c2ff-4d30-8b3f-27e43f862e17	d095c7c8-99bf-4b02-ba05-ace6938b7fa6	g.chr10:99019161T>G	ENST00000358531.4	-	5	866	c.838A>C	c.(838-840)Aat>Cat	p.N280H	ARHGAP19-SLIT1_ENST00000453547.2_Missense_Mutation_p.N280H|ARHGAP19-SLIT1_ENST00000316676.8_Missense_Mutation_p.N280H|ARHGAP19_ENST00000487035.1_5'Flank|ARHGAP19_ENST00000355366.5_Missense_Mutation_p.N271H|ARHGAP19-SLIT1_ENST00000358308.3_Missense_Mutation_p.N280H|ARHGAP19_ENST00000371027.1_Missense_Mutation_p.N271H	NM_001204300.1|NM_032900.5	NP_001191229.1|NP_116289.4	Q14CB8	RHG19_HUMAN	Rho GTPase activating protein 19	280	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)|stomach(2)|urinary_tract(1)	13		Colorectal(252;0.0854)		Epithelial(162;7.65e-09)|all cancers(201;4.49e-07)		ACACTCACATTTTTTGGCCAC	0.453																																																	0													314.0	251.0	273.0					10																	99019161		2203	4300	6503	SO:0001583	missense	84986			AK074122	CCDS7454.2, CCDS58092.1, CCDS73175.1	10q24.2	2011-06-29			ENSG00000213390	ENSG00000213390		"""Rho GTPase activating proteins"""	23724	protein-coding gene	gene with protein product		611587					Standard	NM_032900		Approved	FLJ00194, MGC14258	uc001knb.3	Q14CB8	OTTHUMG00000018845	ENST00000358531.4:c.838A>C	10.37:g.99019161T>G	ENSP00000351333:p.Asn280His		A1XCP1|B4DZR1|Q14CF2|Q5J8M2|Q5T460|Q5T462|Q68DG6|Q8N9X1|Q8NF34|Q8TEK1	Missense_Mutation	SNP	ENST00000358531.4	37	CCDS7454.2	.	.	.	.	.	.	.	.	.	.	T	15.52	2.857690	0.51376	.	.	ENSG00000213390	ENST00000453547;ENST00000316676;ENST00000355366;ENST00000358531;ENST00000371027;ENST00000393817;ENST00000358308	T;T;T;T;T;T	0.44482	2.19;2.19;2.19;2.19;2.19;0.92	5.11	5.11	0.69529	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.119992	0.53938	U	0.000056	T	0.33294	0.0858	L	0.41492	1.28	0.25274	N	0.989493	B;B;B	0.19331	0.034;0.005;0.035	B;B;B	0.15870	0.014;0.011;0.009	T	0.14783	-1.0460	10	0.12766	T	0.61	-12.4652	14.8809	0.70531	0.0:0.0:0.0:1.0	.	280;280;271	Q14CB8-6;Q14CB8;Q14CB8-3	.;RHG19_HUMAN;.	H	280;280;271;280;271;99;280	ENSP00000414774:N280H;ENSP00000324468:N280H;ENSP00000347526:N271H;ENSP00000351333:N280H;ENSP00000360066:N271H;ENSP00000351058:N280H	ENSP00000324468:N280H	N	-	1	0	ARHGAP19	99009151	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.128000	0.57951	1.922000	0.55676	0.533000	0.62120	AAT		0.453	ARHGAP19-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049647.2		NM_032900	
ARHGAP33	115703	hgsc.bcm.edu	37	19	36273301	36273301	+	Missense_Mutation	SNP	C	C	A	rs150993015		TCGA-CJ-4635-01A-02D-1373-10	TCGA-CJ-4635-11B-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	2504b5cf-c2ff-4d30-8b3f-27e43f862e17	d095c7c8-99bf-4b02-ba05-ace6938b7fa6	g.chr19:36273301C>A	ENST00000007510.4	+	13	1256	c.1112C>A	c.(1111-1113)cCg>cAg	p.P371Q	ARHGAP33_ENST00000378944.5_Missense_Mutation_p.P235Q|ARHGAP33_ENST00000314737.5_Missense_Mutation_p.P371Q			O14559	RHG33_HUMAN	Rho GTPase activating protein 33	371	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				protein transport (GO:0015031)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)|Rac GTPase activator activity (GO:0030675)			endometrium(7)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	37						GAGAGGATCCCGGAGCTGTCT	0.607																																																	0													118.0	103.0	108.0					19																	36273301		2203	4300	6503	SO:0001583	missense	115703			AY044864	CCDS12477.1, CCDS54254.1	19q13.13	2011-06-29	2010-02-19	2010-02-19		ENSG00000004777		"""Rho GTPase activating proteins"""	23085	protein-coding gene	gene with protein product		614902	"""sorting nexin 26"""	SNX26		12297274, 12461558	Standard	NM_052948		Approved	FLJ39019, TCGAP	uc002obs.2	O14559		ENST00000007510.4:c.1112C>A	19.37:g.36273301C>A	ENSP00000007510:p.Pro371Gln		O14552|O14560|Q6ZSP6|Q96CP3|Q9NT23	Missense_Mutation	SNP	ENST00000007510.4	37		.	.	.	.	.	.	.	.	.	.	c	15.68	2.906304	0.52333	.	.	ENSG00000004777	ENST00000007510;ENST00000314737;ENST00000378944	T;T;T	0.11712	2.75;2.75;2.75	5.3	4.26	0.50523	.	0.064424	0.64402	D	0.000008	T	0.41213	0.1149	M	0.91354	3.2	0.54753	D	0.999983	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.991	T	0.54316	-0.8312	10	0.72032	D	0.01	.	14.4028	0.67060	0.1488:0.8512:0.0:0.0	.	235;371	O14559-10;O14559-11	.;.	Q	371;371;235	ENSP00000007510:P371Q;ENSP00000320038:P371Q;ENSP00000368227:P235Q	ENSP00000007510:P371Q	P	+	2	0	ARHGAP33	40965141	1.000000	0.71417	0.932000	0.37286	0.061000	0.15899	7.658000	0.83755	1.233000	0.43693	0.457000	0.33378	CCG		0.607	ARHGAP33-201	KNOWN	basic	protein_coding	protein_coding			NM_052948	
ARID5B	84159	hgsc.bcm.edu;ucsc.edu	37	10	63845486	63845486	+	Missense_Mutation	SNP	A	A	C			TCGA-CJ-4635-01A-02D-1373-10	TCGA-CJ-4635-11B-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	2504b5cf-c2ff-4d30-8b3f-27e43f862e17	d095c7c8-99bf-4b02-ba05-ace6938b7fa6	g.chr10:63845486A>C	ENST00000279873.7	+	9	1635	c.1225A>C	c.(1225-1227)Att>Ctt	p.I409L	ARID5B_ENST00000309334.5_Missense_Mutation_p.I166L	NM_032199.2	NP_115575.1	Q14865	ARI5B_HUMAN	AT rich interactive domain 5B (MRF1-like)	409	ARID. {ECO:0000255|PROSITE- ProRule:PRU00355}.				adipose tissue development (GO:0060612)|adrenal gland development (GO:0030325)|cell development (GO:0048468)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|fat pad development (GO:0060613)|female gonad development (GO:0008585)|fibroblast migration (GO:0010761)|kidney development (GO:0001822)|liver development (GO:0001889)|male gonad development (GO:0008584)|multicellular organism growth (GO:0035264)|muscle organ morphogenesis (GO:0048644)|negative regulation of transcription, DNA-templated (GO:0045892)|palate development (GO:0060021)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|post-embryonic development (GO:0009791)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(2)|endometrium(13)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	44	Prostate(12;0.016)|all_hematologic(501;0.215)					TGAAAGATTTATTAAAGGAGA	0.383																																																	0													122.0	134.0	130.0					10																	63845486		2203	4300	6503	SO:0001583	missense	84159			M73837	CCDS31208.1, CCDS58082.1	10q11.22	2013-02-07			ENSG00000150347	ENSG00000150347		"""-"""	17362	protein-coding gene	gene with protein product		608538				11483573, 11478881	Standard	NM_032199		Approved	FLJ21150, MRF2	uc001jlt.2	Q14865	OTTHUMG00000018298	ENST00000279873.7:c.1225A>C	10.37:g.63845486A>C	ENSP00000279873:p.Ile409Leu		B4DLB3|Q05DG6|Q32Q59|Q5VST4|Q6NZ42|Q7Z3M4|Q8N421|Q9H786	Missense_Mutation	SNP	ENST00000279873.7	37	CCDS31208.1	.	.	.	.	.	.	.	.	.	.	A	15.99	2.995122	0.54147	.	.	ENSG00000150347	ENST00000279873;ENST00000309334	T;T	0.60920	0.15;0.15	5.87	5.87	0.94306	ARID/BRIGHT DNA-binding domain (4);	0.144833	0.64402	D	0.000009	T	0.40297	0.1111	N	0.02181	-0.65	0.43271	D	0.995224	B;B	0.17268	0.021;0.006	B;B	0.40165	0.321;0.04	T	0.41288	-0.9517	10	0.09084	T	0.74	-12.4033	16.5764	0.84681	1.0:0.0:0.0:0.0	.	166;409	Q14865-2;Q14865	.;ARI5B_HUMAN	L	409;166	ENSP00000279873:I409L;ENSP00000308862:I166L	ENSP00000279873:I409L	I	+	1	0	ARID5B	63515492	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.170000	0.58229	2.371000	0.80710	0.533000	0.62120	ATT		0.383	ARID5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048233.1		XM_084482	
BIRC2	329	hgsc.bcm.edu;ucsc.edu	37	11	102248743	102248743	+	Silent	SNP	G	G	A			TCGA-CJ-4635-01A-02D-1373-10	TCGA-CJ-4635-11B-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	2504b5cf-c2ff-4d30-8b3f-27e43f862e17	d095c7c8-99bf-4b02-ba05-ace6938b7fa6	g.chr11:102248743G>A	ENST00000227758.2	+	9	3085	c.1686G>A	c.(1684-1686)ttG>ttA	p.L562L	BIRC2_ENST00000527910.1_3'UTR|BIRC2_ENST00000530675.1_Silent_p.L513L|BIRC2_ENST00000532672.1_Silent_p.L541L	NM_001166.4|NM_001256163.1	NP_001157.1|NP_001243092.1	Q13490	BIRC2_HUMAN	baculoviral IAP repeat containing 2	562					apoptotic process (GO:0006915)|cell surface receptor signaling pathway (GO:0007166)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein K48-linked ubiquitination (GO:1902524)|positive regulation of protein K63-linked ubiquitination (GO:1902523)|positive regulation of protein monoubiquitination (GO:1902527)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cell cycle (GO:0051726)|regulation of cell differentiation (GO:0045595)|regulation of cell proliferation (GO:0042127)|regulation of cysteine-type endopeptidase activity (GO:2000116)|regulation of inflammatory response (GO:0050727)|regulation of innate immune response (GO:0045088)|regulation of necroptotic process (GO:0060544)|regulation of nucleotide-binding oligomerization domain containing signaling pathway (GO:0070424)|regulation of RIG-I signaling pathway (GO:0039535)|regulation of toll-like receptor signaling pathway (GO:0034121)|regulation of transcription, DNA-templated (GO:0006355)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	CD40 receptor complex (GO:0035631)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|protein N-terminus binding (GO:0047485)|transcription coactivator activity (GO:0003713)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|liver(2)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	all_cancers(8;0.00044)|all_epithelial(12;0.00348)|Lung NSC(15;0.227)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0093)	Lung(13;0.109)|Epithelial(9;0.11)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0144)		AAGAACAATTGAGGAGGTTGC	0.338																																																	0													132.0	124.0	126.0					11																	102248743		2203	4299	6502	SO:0001819	synonymous_variant	329			L49431	CCDS8316.1, CCDS58169.1	11q22	2011-01-25	2011-01-25		ENSG00000110330	ENSG00000110330		"""Baculoviral IAP repeat containing"", ""RING-type (C3HC4) zinc fingers"""	590	protein-coding gene	gene with protein product	"""NFR2-TRAF signalling complex protein"", ""apoptosis inhibitor 1"""	601712	"""baculoviral IAP repeat-containing 2"""	API1		8552191, 8548810	Standard	NM_001166		Approved	cIAP1, hiap-2, MIHB, RNF48, c-IAP1	uc010ruq.3	Q13490	OTTHUMG00000167325	ENST00000227758.2:c.1686G>A	11.37:g.102248743G>A			B4E026|Q16516|Q4TTG0	Silent	SNP	ENST00000227758.2	37	CCDS8316.1																																																																																				0.338	BIRC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000394170.1		NM_001166	
BMP7	655	hgsc.bcm.edu	37	20	55758892	55758892	+	Missense_Mutation	SNP	T	T	G			TCGA-CJ-4635-01A-02D-1373-10	TCGA-CJ-4635-11B-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	2504b5cf-c2ff-4d30-8b3f-27e43f862e17	d095c7c8-99bf-4b02-ba05-ace6938b7fa6	g.chr20:55758892T>G	ENST00000395863.3	-	4	1349	c.844A>C	c.(844-846)Aag>Cag	p.K282Q	BMP7_ENST00000450594.2_Missense_Mutation_p.K282Q|BMP7_ENST00000395864.3_Intron|BMP7_ENST00000460817.1_5'UTR	NM_001719.2	NP_001710.1	P18075	BMP7_HUMAN	bone morphogenetic protein 7	282					axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|branching involved in salivary gland morphogenesis (GO:0060445)|branching morphogenesis of an epithelial tube (GO:0048754)|cartilage development (GO:0051216)|cellular response to hypoxia (GO:0071456)|dendrite development (GO:0016358)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic skeletal joint morphogenesis (GO:0060272)|epithelial cell differentiation (GO:0030855)|epithelial to mesenchymal transition (GO:0001837)|extracellular matrix organization (GO:0030198)|growth (GO:0040007)|mesenchymal cell differentiation (GO:0048762)|mesenchyme development (GO:0060485)|mesoderm formation (GO:0001707)|mesonephros development (GO:0001823)|metanephric mesenchymal cell proliferation involved in metanephros development (GO:0072136)|metanephric mesenchyme morphogenesis (GO:0072133)|metanephros development (GO:0001656)|monocyte aggregation (GO:0070487)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell death (GO:0060548)|negative regulation of glomerular mesangial cell proliferation (GO:0072125)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of mesenchymal cell apoptotic process involved in nephron morphogenesis (GO:0072040)|negative regulation of mitosis (GO:0045839)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of phosphorylation (GO:0042326)|negative regulation of prostatic bud formation (GO:0060686)|negative regulation of striated muscle cell apoptotic process (GO:0010664)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neuron projection morphogenesis (GO:0048812)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone mineralization (GO:0030501)|positive regulation of dendrite development (GO:1900006)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of hyaluranon cable assembly (GO:1900106)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to nucleus (GO:0034504)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of pathway-restricted SMAD protein phosphorylation (GO:0060393)|regulation of removal of superoxide radicals (GO:2000121)|response to estradiol (GO:0032355)|response to peptide hormone (GO:0043434)|response to vitamin D (GO:0033280)|skeletal system development (GO:0001501)|SMAD protein signal transduction (GO:0060395)|steroid hormone mediated signaling pathway (GO:0043401)|ureteric bud development (GO:0001657)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane-bounded vesicle (GO:0031988)	heparin binding (GO:0008201)			endometrium(4)|kidney(1)|large_intestine(7)|lung(6)|prostate(1)|skin(1)	20	all_lung(29;0.0133)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(4;2.49e-13)|Epithelial(14;1.74e-08)|all cancers(14;2.05e-07)			TCCGTGGCCTTGAAGAAAGCC	0.637																																																	0													56.0	52.0	53.0					20																	55758892		2203	4300	6503	SO:0001583	missense	655				CCDS13455.1	20q13	2014-01-30	2008-05-22		ENSG00000101144	ENSG00000101144		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1074	protein-coding gene	gene with protein product	"""osteogenic protein 1"""	112267				1427904	Standard	NM_001719		Approved	OP-1	uc010gip.1	P18075	OTTHUMG00000032812	ENST00000395863.3:c.844A>C	20.37:g.55758892T>G	ENSP00000379204:p.Lys282Gln		Q9H512|Q9NTQ7	Missense_Mutation	SNP	ENST00000395863.3	37	CCDS13455.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	20.4|20.4	3.987288|3.987288	0.74589|0.74589	.|.	.|.	ENSG00000101144|ENSG00000101144	ENST00000395863;ENST00000450594|ENST00000433911	T;T|.	0.81415|.	-1.01;-1.49|.	5.48|5.48	5.48|5.48	0.80851|0.80851	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.63850|0.63850	0.2546|0.2546	L|L	0.49126|0.49126	1.545|1.545	0.58432|0.58432	D|D	0.999993|0.999993	B;D|.	0.76494|.	0.105;0.999|.	B;D|.	0.72982|.	0.094;0.979|.	T|T	0.61426|0.61426	-0.7065|-0.7065	10|5	0.46703|.	T|.	0.11|.	.|.	15.5714|15.5714	0.76341|0.76341	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	282;282|.	P18075;B1AL00|.	BMP7_HUMAN;.|.	Q|P	282|203	ENSP00000379204:K282Q;ENSP00000398687:K282Q|.	ENSP00000379204:K282Q|.	K|Q	-|-	1|2	0|0	BMP7|BMP7	55192299|55192299	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	6.032000|6.032000	0.70918|0.70918	2.069000|2.069000	0.61940|0.61940	0.523000|0.523000	0.50628|0.50628	AAG|CAA		0.637	BMP7-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079831.2			
BRWD1	54014	hgsc.bcm.edu	37	21	40649200	40649200	+	Missense_Mutation	SNP	T	T	G			TCGA-CJ-4635-01A-02D-1373-10	TCGA-CJ-4635-11B-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	2504b5cf-c2ff-4d30-8b3f-27e43f862e17	d095c7c8-99bf-4b02-ba05-ace6938b7fa6	g.chr21:40649200T>G	ENST00000333229.2	-	11	1408	c.1081A>C	c.(1081-1083)Atc>Ctc	p.I361L	BRWD1_ENST00000342449.3_Missense_Mutation_p.I361L|BRWD1_ENST00000380800.3_Missense_Mutation_p.I361L	NM_018963.4	NP_061836.2	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1	361					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(2)|endometrium(6)|kidney(8)|large_intestine(14)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(7)|urinary_tract(2)	58		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				AGTTCTGCGATTTTTTCGGGT	0.343																																					Melanoma(170;988 1986 4794 16843 39731)												0													86.0	83.0	84.0					21																	40649200		2203	4300	6503	SO:0001583	missense	54014			AJ002572	CCDS13662.1, CCDS13663.1, CCDS33557.1	21q22.2	2013-05-21	2005-05-13	2005-05-13	ENSG00000185658	ENSG00000185658		"""WD repeat domain containing"""	12760	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 107"", ""WD repeat domain 9"""	C21orf107, WDR9			Standard	NM_033656		Approved	FLJ11315, N143	uc002yxk.2	Q9NSI6	OTTHUMG00000066030	ENST00000333229.2:c.1081A>C	21.37:g.40649200T>G	ENSP00000330753:p.Ile361Leu		C9JK25|O43721|Q5R2V0|Q5R2V1|Q6P2D1|Q8TCV3|Q96QG9|Q96QH0|Q9NUK1	Missense_Mutation	SNP	ENST00000333229.2	37	CCDS13662.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.28|14.28	2.487826|2.487826	0.44249|0.44249	.|.	.|.	ENSG00000185658|ENSG00000185658	ENST00000333229;ENST00000342449;ENST00000380800|ENST00000455867	T;T;T|.	0.57595|.	0.39;0.39;0.39|.	4.71|4.71	4.71|4.71	0.59529|0.59529	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);|.	0.086880|.	0.47852|.	D|.	0.000217|.	T|T	0.50939|0.50939	0.1645|0.1645	L|L	0.31420|0.31420	0.93|0.93	0.80722|0.80722	D|D	1|1	B;B;B|.	0.28667|.	0.031;0.207;0.219|.	B;B;B|.	0.36567|.	0.038;0.219;0.228|.	T|T	0.46735|0.46735	-0.9170|-0.9170	10|5	0.49607|.	T|.	0.09|.	-5.3484|-5.3484	10.6408|10.6408	0.45592|0.45592	0.0:0.0:0.1607:0.8393|0.0:0.0:0.1607:0.8393	.|.	72;361;361|.	Q5R2U6;Q9NSI6-2;Q9NSI6|.	.;.;BRWD1_HUMAN|.	L|T	361|72	ENSP00000330753:I361L;ENSP00000344333:I361L;ENSP00000370178:I361L|.	ENSP00000330753:I361L|.	I|N	-|-	1|2	0|0	BRWD1|BRWD1	39571070|39571070	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.992000|0.992000	0.81027|0.81027	1.654000|1.654000	0.37334|0.37334	1.878000|1.878000	0.54408|0.54408	0.482000|0.482000	0.46254|0.46254	ATC|AAT		0.343	BRWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141398.3		NM_033656	
C19orf53	28974	hgsc.bcm.edu	37	19	13885310	13885310	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-4635-01A-02D-1373-10	TCGA-CJ-4635-11B-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	2504b5cf-c2ff-4d30-8b3f-27e43f862e17	d095c7c8-99bf-4b02-ba05-ace6938b7fa6	g.chr19:13885310A>G	ENST00000588234.1	+	1	329	c.19A>G	c.(19-21)Aag>Gag	p.K7E	C19orf53_ENST00000593274.1_5'Flank|CTB-5E10.3_ENST00000586894.1_RNA|CTB-5E10.3_ENST00000586297.1_RNA|CTB-5E10.3_ENST00000591826.1_RNA	NM_014047.2	NP_054766.1	Q9UNZ5	L10K_HUMAN	chromosome 19 open reading frame 53	7										breast(1)|large_intestine(1)|lung(1)|ovary(2)|upper_aerodigestive_tract(1)	6			OV - Ovarian serous cystadenocarcinoma(19;7.7e-24)|Epithelial(5;2.53e-19)			GGGGCAGCGCAAGTTTCAGGC	0.642																																																	0													16.0	19.0	18.0					19																	13885310		2198	4294	6492	SO:0001583	missense	28974			AF078852	CCDS12298.1	19p13.2	2011-11-24			ENSG00000104979	ENSG00000104979			24991	protein-coding gene	gene with protein product	"""leydig cell tumor 10 kDa protein homolog"""					11042152	Standard	NM_014047		Approved	HSPC023, LYDG10	uc002mxg.3	Q9UNZ5		ENST00000588234.1:c.19A>G	19.37:g.13885310A>G	ENSP00000465432:p.Lys7Glu		B2R4J9	Missense_Mutation	SNP	ENST00000588234.1	37	CCDS12298.1	.	.	.	.	.	.	.	.	.	.	A	23.7	4.443951	0.83993	.	.	ENSG00000104979	ENST00000221576	.	.	.	5.04	5.04	0.67666	.	0.000000	0.85682	D	0.000000	T	0.77445	0.4131	.	.	.	0.80722	D	1	D	0.69078	0.997	D	0.80764	0.994	T	0.80276	-0.1450	8	0.87932	D	0	.	11.1405	0.48400	1.0:0.0:0.0:0.0	.	7	Q9UNZ5	L10K_HUMAN	E	7	.	ENSP00000221576:K7E	K	+	1	0	C19orf53	13746310	1.000000	0.71417	1.000000	0.80357	0.536000	0.34869	4.680000	0.61656	2.135000	0.66039	0.449000	0.29647	AAG		0.642	C19orf53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453621.1		NM_014047	
CNBD2	140894	hgsc.bcm.edu;ucsc.edu	37	20	34611538	34611538	+	Silent	SNP	C	C	A			TCGA-CJ-4635-01A-02D-1373-10	TCGA-CJ-4635-11B-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	2504b5cf-c2ff-4d30-8b3f-27e43f862e17	d095c7c8-99bf-4b02-ba05-ace6938b7fa6	g.chr20:34611538C>A	ENST00000373973.3	+	11	1457	c.1284C>A	c.(1282-1284)gcC>gcA	p.A428A	CNBD2_ENST00000349339.1_Silent_p.A424A|CNBD2_ENST00000538900.1_Intron			Q96M20	CNBD2_HUMAN	cyclic nucleotide binding domain containing 2	428																	TTCACCAGGCCTTCCTTCCAG	0.443																																																	0													84.0	83.0	83.0					20																	34611538		2203	4300	6503	SO:0001819	synonymous_variant	0			AL359828	CCDS13270.1, CCDS56189.1	20q11.23	2012-11-15	2012-11-15	2012-11-15	ENSG00000149646	ENSG00000149646			16145	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 152"", ""cyclic nucleotide (cNMP) binding domain containing 1"""	C20orf152, CNMPD1		11780052	Standard	NM_080834		Approved	dJ954P9.1	uc002xer.1	Q96M20	OTTHUMG00000032371	ENST00000373973.3:c.1284C>A	20.37:g.34611538C>A			Q14C79|Q5JWY7|Q5T3S1|Q9BR36|Q9BWY5	Silent	SNP	ENST00000373973.3	37																																																																																					0.443	CNBD2-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000078960.2		NM_080834	
CNTLN	54875	hgsc.bcm.edu;ucsc.edu	37	9	17394889	17394889	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-4635-01A-02D-1373-10	TCGA-CJ-4635-11B-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	2504b5cf-c2ff-4d30-8b3f-27e43f862e17	d095c7c8-99bf-4b02-ba05-ace6938b7fa6	g.chr9:17394889A>G	ENST00000380647.3	+	15	2521	c.2437A>G	c.(2437-2439)Aaa>Gaa	p.K813E	CNTLN_ENST00000262360.5_Missense_Mutation_p.K813E|CNTLN_ENST00000425824.1_Missense_Mutation_p.K813E			Q9NXG0	CNTLN_HUMAN	centlein, centrosomal protein	813					centriole-centriole cohesion (GO:0010457)|protein localization to organelle (GO:0033365)	centriole (GO:0005814)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	phosphorelay sensor kinase activity (GO:0000155)|protein binding, bridging (GO:0030674)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(6)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(17)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53				GBM - Glioblastoma multiforme(50;6.14e-10)		GGCCACCATGAAAGTGAGATC	0.418																																																	0													112.0	111.0	112.0					9																	17394889		1970	4166	6136	SO:0001583	missense	54875			AK000283	CCDS43789.1, CCDS47953.1	9p22.2-p22.1	2008-11-11	2008-02-08	2008-02-08	ENSG00000044459	ENSG00000044459			23432	protein-coding gene	gene with protein product		611870	"""chromosome 9 open reading frame 101"", ""chromosome 9 open reading frame 39"""	C9orf101, C9orf39		18086554	Standard	XM_005251492		Approved	FLJ20276, bA340N12.1, OTTHUMG00000019597	uc003zmy.3	Q9NXG0	OTTHUMG00000019599	ENST00000380647.3:c.2437A>G	9.37:g.17394889A>G	ENSP00000370021:p.Lys813Glu		A5Z2X6|Q5VYJ0|Q8N1G9|Q9HAJ5	Missense_Mutation	SNP	ENST00000380647.3	37	CCDS43789.1	.	.	.	.	.	.	.	.	.	.	G	0.001	-3.731875	0.00005	.	.	ENSG00000044459	ENST00000380647;ENST00000425824;ENST00000262360	T;T;T	0.16597	2.33;2.33;2.58	5.93	0.984	0.19773	.	.	.	.	.	T	0.04724	0.0128	N	0.01188	-0.97	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.42292	-0.9460	9	0.02654	T	1	.	9.8945	0.41309	0.3014:0.0883:0.6104:0.0	.	813;813;813	Q9NXG0;C9J1F9;Q9NXG0-2	CNTLN_HUMAN;.;.	E	813	ENSP00000370021:K813E;ENSP00000392798:K813E;ENSP00000262360:K813E	ENSP00000262360:K813E	K	+	1	0	CNTLN	17384889	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.714000	0.25808	-0.557000	0.06126	-4.378000	0.00006	AAA		0.418	CNTLN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051793.3		NM_017738	
COL15A1	1306	hgsc.bcm.edu;ucsc.edu	37	9	101759361	101759361	+	Missense_Mutation	SNP	A	A	T			TCGA-CJ-4635-01A-02D-1373-10	TCGA-CJ-4635-11B-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	2504b5cf-c2ff-4d30-8b3f-27e43f862e17	d095c7c8-99bf-4b02-ba05-ace6938b7fa6	g.chr9:101759361A>T	ENST00000375001.3	+	6	1373	c.950A>T	c.(949-951)cAa>cTa	p.Q317L		NM_001855.3	NP_001846.3	P39059	COFA1_HUMAN	collagen, type XV, alpha 1	317	Nonhelical region 1 (NC1).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|signal transduction (GO:0007165)	collagen type XV trimer (GO:0005582)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(20)|liver(1)|lung(42)|ovary(6)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	107		Acute lymphoblastic leukemia(62;0.0562)				AGCCCCAAACAAGGCAAGTCC	0.502																																																	0													138.0	123.0	128.0					9																	101759361		2203	4300	6503	SO:0001583	missense	1306			L25286	CCDS35081.1	9q21-q22	2013-01-16			ENSG00000204291	ENSG00000204291		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2192	protein-coding gene	gene with protein product	"""collagen type XV proteoglycan"""	120325				1427836	Standard	NM_001855		Approved		uc004azb.2	P39059	OTTHUMG00000020351	ENST00000375001.3:c.950A>T	9.37:g.101759361A>T	ENSP00000364140:p.Gln317Leu		Q5T6J4|Q9UDC5|Q9Y4W4	Missense_Mutation	SNP	ENST00000375001.3	37	CCDS35081.1	.	.	.	.	.	.	.	.	.	.	A	3.818	-0.038293	0.07497	.	.	ENSG00000204291	ENST00000375001;ENST00000536083	D	0.90385	-2.66	3.77	1.33	0.21861	.	2.646930	0.01029	N	0.004115	D	0.86285	0.5896	L	0.36672	1.1	0.30498	N	0.770693	B	0.18166	0.026	B	0.15484	0.013	T	0.71066	-0.4700	10	0.28530	T	0.3	-1.8668	8.1026	0.30865	0.5375:0.4625:0.0:0.0	.	317	P39059	COFA1_HUMAN	L	317;287	ENSP00000364140:Q317L	ENSP00000364140:Q317L	Q	+	2	0	COL15A1	100799182	1.000000	0.71417	0.928000	0.36995	0.078000	0.17371	1.319000	0.33655	0.265000	0.21872	0.402000	0.26972	CAA		0.502	COL15A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053386.3		NM_001855	
DCT	1638	hgsc.bcm.edu;ucsc.edu	37	13	95117927	95117927	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-4635-01A-02D-1373-10	TCGA-CJ-4635-11B-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	2504b5cf-c2ff-4d30-8b3f-27e43f862e17	d095c7c8-99bf-4b02-ba05-ace6938b7fa6	g.chr13:95117927G>A	ENST00000377028.5	-	4	1236	c.823C>T	c.(823-825)Cgg>Tgg	p.R275W	DCT_ENST00000446125.1_Missense_Mutation_p.R275W|DCT_ENST00000490854.1_5'UTR|AL139318.1_ENST00000390768.1_RNA	NM_001922.3	NP_001913.2	P40126	TYRP2_HUMAN	dopachrome tautomerase	275					cell development (GO:0048468)|developmental pigmentation (GO:0048066)|epidermis development (GO:0008544)|melanin biosynthetic process from tyrosine (GO:0006583)|positive regulation of neuroblast proliferation (GO:0002052)|ventricular zone neuroblast division (GO:0021847)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|melanosome (GO:0042470)	copper ion binding (GO:0005507)|dopachrome isomerase activity (GO:0004167)|oxidoreductase activity (GO:0016491)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	50	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;3.71e-42)|all_epithelial(2;3.76e-31)|all_lung(2;5.16e-14)|Lung NSC(4;1.33e-13)|Breast(118;0.0013)|Hepatocellular(115;0.00886)|Renal(2;0.00988)		COAD - Colon adenocarcinoma(199;7.07e-05)|GBM - Glioblastoma multiforme(99;0.000472)		CTTGAGTTCCGACTAATCAGA	0.498																																																	0													117.0	100.0	106.0					13																	95117927		2203	4300	6503	SO:0001583	missense	1638			D17547	CCDS9470.1, CCDS45060.1	13q32	2012-09-28	2012-09-28		ENSG00000080166	ENSG00000080166	5.3.3.12		2709	protein-coding gene	gene with protein product	"""dopachrome delta-isomerase"""	191275	"""tyrosine-related protein 2"""	TYRP2		8306979	Standard	NM_001922		Approved		uc010afh.3	P40126	OTTHUMG00000017206	ENST00000377028.5:c.823C>T	13.37:g.95117927G>A	ENSP00000366227:p.Arg275Trp		Q09GT4	Missense_Mutation	SNP	ENST00000377028.5	37	CCDS9470.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.965228	0.74131	.	.	ENSG00000080166	ENST00000377028;ENST00000446125	D;D	0.98313	-4.86;-4.86	5.95	4.2	0.49525	Tyrosinase (1);Uncharacterised domain, di-copper centre (2);	0.713875	0.14824	N	0.296247	D	0.97201	0.9085	L	0.34521	1.04	0.21627	N	0.99962	P;P	0.44734	0.754;0.842	P;B	0.49301	0.606;0.36	D	0.92603	0.6093	10	0.87932	D	0	-1.7275	16.2333	0.82358	0.0:0.3769:0.6231:0.0	.	275;275	Q09GT4;P40126	.;TYRP2_HUMAN	W	275	ENSP00000366227:R275W;ENSP00000392762:R275W	ENSP00000366227:R275W	R	-	1	2	DCT	93915928	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	3.004000	0.49513	0.827000	0.34685	0.655000	0.94253	CGG		0.498	DCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045461.3			
DHX34	9704	hgsc.bcm.edu	37	19	47861187	47861187	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4635-01A-02D-1373-10	TCGA-CJ-4635-11B-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	2504b5cf-c2ff-4d30-8b3f-27e43f862e17	d095c7c8-99bf-4b02-ba05-ace6938b7fa6	g.chr19:47861187C>T	ENST00000328771.4	+	4	1431	c.1082C>T	c.(1081-1083)cCt>cTt	p.P361L		NM_014681.5	NP_055496.2	Q14147	DHX34_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 34	361					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	membrane (GO:0016020)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(5)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		all_cancers(25;1.65e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;7.16e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000489)|GBM - Glioblastoma multiforme(486;0.00413)|Epithelial(262;0.0132)		GACCCGCGGCCTTTCCTGAGG	0.642																																																	0													54.0	43.0	47.0					19																	47861187		2203	4300	6503	SO:0001583	missense	9704			D50924	CCDS12700.1	19q13.3	2003-06-13	2003-06-13	2003-06-13	ENSG00000134815	ENSG00000134815		"""DEAH-boxes"""	16719	protein-coding gene	gene with protein product		615475	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 34"""	DDX34		10708517, 8590280	Standard	NM_014681		Approved	KIAA0134	uc010xyn.2	Q14147	OTTHUMG00000149959	ENST00000328771.4:c.1082C>T	19.37:g.47861187C>T	ENSP00000331907:p.Pro361Leu		B4DMY8	Missense_Mutation	SNP	ENST00000328771.4	37	CCDS12700.1	.	.	.	.	.	.	.	.	.	.	C	15.69	2.909373	0.52439	.	.	ENSG00000134815	ENST00000328771	T	0.02944	4.1	4.88	3.84	0.44239	.	0.096980	0.43747	D	0.000538	T	0.08935	0.0221	L	0.37630	1.12	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	T	0.09228	-1.0684	10	0.87932	D	0	-0.3797	13.5046	0.61477	0.1579:0.8421:0.0:0.0	.	361	Q14147	DHX34_HUMAN	L	361	ENSP00000331907:P361L	ENSP00000331907:P361L	P	+	2	0	DHX34	52553025	1.000000	0.71417	0.973000	0.42090	0.016000	0.09150	7.132000	0.77251	1.246000	0.43901	-0.188000	0.12872	CCT		0.642	DHX34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314313.3		NM_014681	
DIDO1	11083	hgsc.bcm.edu;ucsc.edu	37	20	61537212	61537212	+	Intron	SNP	G	G	A			TCGA-CJ-4635-01A-02D-1373-10	TCGA-CJ-4635-11B-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	2504b5cf-c2ff-4d30-8b3f-27e43f862e17	d095c7c8-99bf-4b02-ba05-ace6938b7fa6	g.chr20:61537212G>A	ENST00000266070.4	-	6	1914				DIDO1_ENST00000395335.2_Intron|DIDO1_ENST00000370368.1_Silent_p.L539L|DIDO1_ENST00000266071.5_Intron|DIDO1_ENST00000395343.1_Intron|DIDO1_ENST00000370371.4_Silent_p.L539L|DIDO1_ENST00000354665.4_Silent_p.L539L|DIDO1_ENST00000370366.1_Intron|DIDO1_ENST00000395340.1_Intron	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1						apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					GAGGGGTCCAGGAGGCCAACC	0.537																																					Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)												0													122.0	116.0	118.0					20																	61537212		2203	4300	6503	SO:0001627	intron_variant	11083			AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.1588+26C>T	20.37:g.61537212G>A			A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Silent	SNP	ENST00000266070.4	37	CCDS33506.1																																																																																				0.537	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080091.2		NM_080796	
DNAJC10	54431	hgsc.bcm.edu	37	2	183622508	183622508	+	Silent	SNP	G	G	A			TCGA-CJ-4635-01A-02D-1373-10	TCGA-CJ-4635-11B-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	2504b5cf-c2ff-4d30-8b3f-27e43f862e17	d095c7c8-99bf-4b02-ba05-ace6938b7fa6	g.chr2:183622508G>A	ENST00000264065.7	+	19	2314	c.1899G>A	c.(1897-1899)gaG>gaA	p.E633E		NM_018981.1	NP_061854.1	Q8IXB1	DJC10_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 10	633	Thioredoxin 3. {ECO:0000255|PROSITE- ProRule:PRU00691}.			E -> K (in Ref. 8; CAB70858). {ECO:0000305}.	cell redox homeostasis (GO:0045454)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of ATPase activity (GO:0032781)|protein folding in endoplasmic reticulum (GO:0034975)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum chaperone complex (GO:0034663)|endoplasmic reticulum lumen (GO:0005788)|membrane (GO:0016020)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|chaperone binding (GO:0051087)|disulfide oxidoreductase activity (GO:0015036)|Hsp70 protein binding (GO:0030544)|misfolded protein binding (GO:0051787)|oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor (GO:0016671)|protein disulfide oxidoreductase activity (GO:0015035)			breast(3)|endometrium(1)|kidney(4)|large_intestine(7)|lung(15)|ovary(1)|skin(1)	32			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			GATACCCTGAGATAAGATTTT	0.308																																					Pancreas(56;860 1183 25669 35822 48585)												0													70.0	76.0	74.0					2																	183622508		2203	4300	6503	SO:0001819	synonymous_variant	54431				CCDS33345.1, CCDS74613.1	2q32.1	2011-11-23			ENSG00000077232	ENSG00000077232		"""Heat shock proteins / DNAJ (HSP40)"", ""Protein disulfide isomerases"""	24637	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 19"""	607987				12411443, 12446677	Standard	NM_018981		Approved	ERdj5, PDIA19	uc002uow.2	Q8IXB1	OTTHUMG00000154209	ENST00000264065.7:c.1899G>A	2.37:g.183622508G>A			Q17RJ6|Q3B7W8|Q4ZG06|Q53QT7|Q6UWZ6|Q86T61|Q8NC82|Q8TD87|Q96K38|Q96K44|Q96K54|Q9NSY6	Silent	SNP	ENST00000264065.7	37	CCDS33345.1																																																																																				0.308	DNAJC10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334418.2		NM_018981	
DRP2	1821	hgsc.bcm.edu	37	X	100509876	100509876	+	Missense_Mutation	SNP	G	G	A	rs201156733		TCGA-CJ-4635-01A-02D-1373-10	TCGA-CJ-4635-11B-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	2504b5cf-c2ff-4d30-8b3f-27e43f862e17	d095c7c8-99bf-4b02-ba05-ace6938b7fa6	g.chrX:100509876G>A	ENST00000395209.3	+	19	2670	c.2143G>A	c.(2143-2145)Gcc>Acc	p.A715T	DRP2_ENST00000538510.1_Missense_Mutation_p.A715T|DRP2_ENST00000402866.1_Missense_Mutation_p.A715T|DRP2_ENST00000541709.1_Missense_Mutation_p.A637T	NM_001939.2	NP_001930.2	Q13474	DRP2_HUMAN	dystrophin related protein 2	715					central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(10)|ovary(3)|prostate(1)|skin(2)|urinary_tract(2)	31						GTGGCCACACGCCGACACACA	0.582																																																	0													124.0	100.0	108.0					X																	100509876		2203	4300	6503	SO:0001583	missense	1821			U43519	CCDS14480.2, CCDS55465.1	Xq22	2008-02-05			ENSG00000102385	ENSG00000102385			3032	protein-coding gene	gene with protein product		300052				8640231	Standard	NM_001939		Approved		uc004egz.2	Q13474	OTTHUMG00000022020	ENST00000395209.3:c.2143G>A	X.37:g.100509876G>A	ENSP00000378635:p.Ala715Thr		A6ZKI5|A8K1B0|B1B1F3|B4DIZ0	Missense_Mutation	SNP	ENST00000395209.3	37	CCDS14480.2	.	.	.	.	.	.	.	.	.	.	G	11.06	1.526424	0.27299	.	.	ENSG00000102385	ENST00000402866;ENST00000395209;ENST00000541709;ENST00000538510	D;D;D;D	0.89196	-2.48;-2.48;-2.48;-2.48	4.82	3.88	0.44766	.	0.173376	0.49916	D	0.000128	D	0.86297	0.5899	M	0.65975	2.015	0.50813	D	0.999893	B	0.31837	0.342	B	0.26202	0.067	D	0.85983	0.1484	10	0.40728	T	0.16	-7.7831	14.2835	0.66228	0.0:0.0:0.8404:0.1596	.	715	Q13474	DRP2_HUMAN	T	715;715;637;715	ENSP00000385038:A715T;ENSP00000378635:A715T;ENSP00000444752:A637T;ENSP00000441051:A715T	ENSP00000378635:A715T	A	+	1	0	DRP2	100396532	1.000000	0.71417	0.888000	0.34837	0.416000	0.31233	7.579000	0.82511	2.215000	0.71742	0.600000	0.82982	GCC		0.582	DRP2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057522.3		NM_001939	
DUOX2	50506	hgsc.bcm.edu	37	15	45387206	45387206	+	Silent	SNP	G	G	A			TCGA-CJ-4635-01A-02D-1373-10	TCGA-CJ-4635-11B-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	2504b5cf-c2ff-4d30-8b3f-27e43f862e17	d095c7c8-99bf-4b02-ba05-ace6938b7fa6	g.chr15:45387206G>A	ENST00000603300.1	-	32	4525	c.4323C>T	c.(4321-4323)caC>caT	p.H1441H	DUOX2_ENST00000389039.6_Silent_p.H1441H	NM_014080.4	NP_054799.4	Q9NRD8	DUOX2_HUMAN	dual oxidase 2	1441					adenohypophysis morphogenesis (GO:0048855)|bone mineralization (GO:0030282)|cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|fertilization (GO:0009566)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|inner ear development (GO:0048839)|multicellular organism growth (GO:0035264)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|response to virus (GO:0009615)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|peroxidase activity (GO:0004601)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(7)|urinary_tract(1)	63		all_cancers(109;3.79e-11)|all_epithelial(112;2.92e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.05e-18)|GBM - Glioblastoma multiforme(94;4.23e-07)|COAD - Colon adenocarcinoma(120;0.0668)|Colorectal(133;0.068)		CCAGGTCCTGGTGGTCGTTCT	0.577																																																	0													115.0	98.0	104.0					15																	45387206		2198	4298	6496	SO:0001819	synonymous_variant	50506			AF181972	CCDS10117.1	15q15.3-q21	2013-01-10			ENSG00000140279	ENSG00000140279		"""EF-hand domain containing"""	13273	protein-coding gene	gene with protein product	"""dual oxidase-like domains 2"", ""nicotinamide adenine dinucleotide phosphate oxidase"", ""flavoprotein NADPH oxidase"", ""NADPH thyroid oxidase 2"", ""NADH/NADPH thyroid oxidase p138-tox"", ""NADPH oxidase/peroxidase DUOX2"""	606759				10601291, 10806195	Standard	NM_014080		Approved	P138-TOX, P138(TOX), THOX2, LNOX2	uc010bea.3	Q9NRD8	OTTHUMG00000131355	ENST00000603300.1:c.4323C>T	15.37:g.45387206G>A			A8MQ13|D2XI64|Q9NR02|Q9UHF9	Silent	SNP	ENST00000603300.1	37	CCDS10117.1																																																																																				0.577	DUOX2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			NM_014080	
FAM111B	374393	hgsc.bcm.edu;ucsc.edu	37	11	58877131	58877131	+	Silent	SNP	A	A	C			TCGA-CJ-4635-01A-02D-1373-10	TCGA-CJ-4635-11B-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	2504b5cf-c2ff-4d30-8b3f-27e43f862e17	d095c7c8-99bf-4b02-ba05-ace6938b7fa6	g.chr11:58877131A>C	ENST00000343597.3	+	3	224	c.33A>C	c.(31-33)tcA>tcC	p.S11S	FAM111B_ENST00000529618.1_Intron|FAM111B_ENST00000411426.1_Intron	NM_198947.3	NP_945185.1	Q6SJ93	F111B_HUMAN	family with sequence similarity 111, member B	11							catalytic activity (GO:0003824)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(12)|ovary(3)|pancreas(1)|skin(1)	40						AAAACAAGTCATTTAGCGCTA	0.358																																																	0													105.0	95.0	99.0					11																	58877131		2201	4295	6496	SO:0001819	synonymous_variant	374393			BC062456	CCDS7972.1, CCDS44611.1	11q12.1	2014-03-13			ENSG00000189057	ENSG00000189057			24200	protein-coding gene	gene with protein product		615584				24268661	Standard	NM_198947		Approved	CANP	uc001nnl.3	Q6SJ93	OTTHUMG00000167279	ENST00000343597.3:c.33A>C	11.37:g.58877131A>C			B4E2G2|Q6P661	Silent	SNP	ENST00000343597.3	37	CCDS7972.1																																																																																				0.358	FAM111B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393974.1		NM_198947	
FBXO21	23014	hgsc.bcm.edu;ucsc.edu	37	12	117627030	117627030	+	Splice_Site	SNP	A	A	G			TCGA-CJ-4635-01A-02D-1373-10	TCGA-CJ-4635-11B-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	2504b5cf-c2ff-4d30-8b3f-27e43f862e17	d095c7c8-99bf-4b02-ba05-ace6938b7fa6	g.chr12:117627030A>G	ENST00000330622.5	-	2	375		c.e2+1		FBXO21_ENST00000427718.2_Splice_Site|FBXO21_ENST00000549689.1_5'Flank			O94952	FBX21_HUMAN	F-box protein 21						protein ubiquitination (GO:0016567)|ubiquitin-dependent protein catabolic process (GO:0006511)	ubiquitin ligase complex (GO:0000151)	DNA binding (GO:0003677)|ubiquitin-protein transferase activity (GO:0004842)			breast(4)|endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|pancreas(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	29	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0291)		ACAGATCCTTACGTGCTCTGA	0.463																																					GBM(168;452 2038 13535 17701 43680)												0													164.0	139.0	147.0					12																	117627030		2203	4300	6503	SO:0001630	splice_region_variant	23014			AB020682	CCDS9184.1, CCDS44989.1	12q24.23	2004-06-15	2004-06-15					"""F-boxes /  ""other"""""	13592	protein-coding gene	gene with protein product		609095	"""F-box only protein 21"""			10048485, 10531035	Standard	NM_033624		Approved	FBX21, KIAA0875	uc001twk.3	O94952	OTTHUMG00000169495	ENST00000330622.5:c.375+1T>C	12.37:g.117627030A>G			B3KMF0|Q5BJG0|Q9H087	Splice_Site	SNP	ENST00000330622.5	37	CCDS9184.1	.	.	.	.	.	.	.	.	.	.	A	21.7	4.184152	0.78677	.	.	ENSG00000135108	ENST00000427718;ENST00000257563;ENST00000550180;ENST00000535590;ENST00000330622	.	.	.	4.95	4.95	0.65309	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.5742	0.68235	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	FBXO21	116111413	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.435000	0.73412	1.978000	0.57642	0.533000	0.62120	.		0.463	FBXO21-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000404409.1		NM_033624	Intron
FN3KRP	79672	hgsc.bcm.edu;ucsc.edu	37	17	80680693	80680693	+	Silent	SNP	G	G	A			TCGA-CJ-4635-01A-02D-1373-10	TCGA-CJ-4635-11B-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	2504b5cf-c2ff-4d30-8b3f-27e43f862e17	d095c7c8-99bf-4b02-ba05-ace6938b7fa6	g.chr17:80680693G>A	ENST00000269373.6	+	4	472	c.399G>A	c.(397-399)ggG>ggA	p.G133G	FN3KRP_ENST00000535965.1_Silent_p.G83G	NM_024619.3	NP_078895.2	Q9HA64	KT3K_HUMAN	fructosamine 3 kinase related protein	133							kinase activity (GO:0016301)			breast(1)|large_intestine(2)|lung(1)|ovary(2)|upper_aerodigestive_tract(1)	7	Breast(20;0.000523)|all_neural(118;0.0952)		BRCA - Breast invasive adenocarcinoma(99;0.0344)|OV - Ovarian serous cystadenocarcinoma(97;0.061)			GAGGAGGTGGGCAGGAGGAAC	0.537																																																	0													199.0	168.0	178.0					17																	80680693		2203	4300	6503	SO:0001819	synonymous_variant	79672			AY360465	CCDS11817.1	17q25.3	2014-08-12			ENSG00000141560	ENSG00000141560			25700	protein-coding gene	gene with protein product		611683				14633848	Standard	NM_024619		Approved	FLJ12171, FN3KL	uc002kfu.3	Q9HA64	OTTHUMG00000177846	ENST00000269373.6:c.399G>A	17.37:g.80680693G>A			Q969F4|Q9H0U7	Silent	SNP	ENST00000269373.6	37	CCDS11817.1																																																																																				0.537	FN3KRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439219.1		NM_024619	
FRY	10129	hgsc.bcm.edu;ucsc.edu	37	13	32798431	32798431	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CJ-4635-01A-02D-1373-10	TCGA-CJ-4635-11B-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	2504b5cf-c2ff-4d30-8b3f-27e43f862e17	d095c7c8-99bf-4b02-ba05-ace6938b7fa6	g.chr13:32798431C>T	ENST00000380250.3	+	37	5321	c.4825C>T	c.(4825-4827)Cag>Tag	p.Q1609*		NM_023037.2	NP_075463.2	Q5TBA9	FRY_HUMAN	furry homolog (Drosophila)	1609						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(3)|breast(4)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(31)|lung(50)|ovary(5)|pancreas(1)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	132		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		CAAGCAGCCGCAGCCCTTACC	0.567																																																	0													66.0	70.0	69.0					13																	32798431		1893	4118	6011	SO:0001587	stop_gained	10129			AL049784	CCDS41875.1	13q13.1	2008-02-05	2005-11-24	2005-11-24	ENSG00000073910	ENSG00000073910			20367	protein-coding gene	gene with protein product		614818	"""chromosome 13 open reading frame 14"""	C13orf14		14702039, 8812419	Standard	NM_023037		Approved	bA37E23.1, 13CDNA73, CG003	uc001utx.3	Q5TBA9	OTTHUMG00000016696	ENST00000380250.3:c.4825C>T	13.37:g.32798431C>T	ENSP00000369600:p.Gln1609*		Q9Y3N6	Nonsense_Mutation	SNP	ENST00000380250.3	37	CCDS41875.1	.	.	.	.	.	.	.	.	.	.	C	49	15.503186	0.99836	.	.	ENSG00000073910	ENST00000380250;ENST00000380257	.	.	.	5.44	5.44	0.79542	.	0.135786	0.53938	D	0.000059	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.22109	T	0.4	.	19.2474	0.93908	0.0:1.0:0.0:0.0	.	.	.	.	X	1609;446	.	ENSP00000369600:Q1609X	Q	+	1	0	FRY	31696431	1.000000	0.71417	0.954000	0.39281	0.972000	0.66771	7.474000	0.81024	2.553000	0.86117	0.411000	0.27672	CAG		0.567	FRY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044405.1		NM_023037	
GLI1	2735	hgsc.bcm.edu	37	12	57865037	57865037	+	Missense_Mutation	SNP	T	T	G			TCGA-CJ-4635-01A-02D-1373-10	TCGA-CJ-4635-11B-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	2504b5cf-c2ff-4d30-8b3f-27e43f862e17	d095c7c8-99bf-4b02-ba05-ace6938b7fa6	g.chr12:57865037T>G	ENST00000228682.2	+	12	2605	c.2514T>G	c.(2512-2514)agT>agG	p.S838R	GLI1_ENST00000543426.1_Missense_Mutation_p.S710R|GLI1_ENST00000546141.1_Missense_Mutation_p.S797R	NM_005269.2	NP_005260.1	P08151	GLI1_HUMAN	GLI family zinc finger 1	838					cerebellar cortex morphogenesis (GO:0021696)|digestive tract morphogenesis (GO:0048546)|dorsal/ventral pattern formation (GO:0009953)|epidermal cell differentiation (GO:0009913)|lung development (GO:0030324)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|notochord regression (GO:0060032)|osteoblast differentiation (GO:0001649)|pituitary gland development (GO:0021983)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proximal/distal pattern formation (GO:0009954)|regulation of smoothened signaling pathway (GO:0008589)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in regulation of cerebellar granule cell precursor cell proliferation (GO:0021938)|spermatogenesis (GO:0007283)|ventral midline development (GO:0007418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|primary cilium (GO:0072372)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(8)|lung(22)|ovary(6)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69			GBM - Glioblastoma multiforme(3;3.99e-32)			CCCACCCCAGTGAGGGGCCCC	0.592																																					Pancreas(157;841 1936 10503 41495 50368)												0													64.0	74.0	70.0					12																	57865037		2203	4300	6503	SO:0001583	missense	2735				CCDS8940.1, CCDS53806.1, CCDS53807.1	12q13.2-q13.3	2013-01-25	2009-03-05	2005-01-14		ENSG00000111087		"""Zinc fingers, C2H2-type"""	4317	protein-coding gene	gene with protein product		165220	"""glioma-associated oncogene homolog 1 (zinc finger protein)"", ""glioma-associated oncogene family zinc finger 1"""	GLI		2850480	Standard	NM_005269		Approved		uc001snx.3	P08151		ENST00000228682.2:c.2514T>G	12.37:g.57865037T>G	ENSP00000228682:p.Ser838Arg		D0EUY3|E9PQQ9|F5H6H8|Q8TDN9	Missense_Mutation	SNP	ENST00000228682.2	37	CCDS8940.1	.	.	.	.	.	.	.	.	.	.	T	8.756	0.922512	0.17982	.	.	ENSG00000111087	ENST00000543426;ENST00000228682;ENST00000546141;ENST00000528467	T;T;T;T	0.13420	2.7;2.59;2.67;2.67	4.62	3.45	0.39498	.	0.723538	0.12502	N	0.463253	T	0.10035	0.0246	N	0.22421	0.69	0.28309	N	0.922743	B	0.18166	0.026	B	0.20577	0.03	T	0.26395	-1.0104	10	0.25751	T	0.34	.	10.7475	0.46189	0.0:0.0:0.1602:0.8398	.	838	P08151	GLI1_HUMAN	R	710;838;797;797	ENSP00000437607:S710R;ENSP00000228682:S838R;ENSP00000441006:S797R;ENSP00000434408:S797R	ENSP00000228682:S838R	S	+	3	2	GLI1	56151304	0.000000	0.05858	0.902000	0.35471	0.506000	0.33950	0.133000	0.15912	0.888000	0.36160	0.397000	0.26171	AGT		0.592	GLI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394197.1		NM_005269	
GLI1	2735	hgsc.bcm.edu	37	12	57865608	57865608	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4635-01A-02D-1373-10	TCGA-CJ-4635-11B-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	2504b5cf-c2ff-4d30-8b3f-27e43f862e17	d095c7c8-99bf-4b02-ba05-ace6938b7fa6	g.chr12:57865608C>T	ENST00000228682.2	+	12	3176	c.3085C>T	c.(3085-3087)Ccc>Tcc	p.P1029S	GLI1_ENST00000543426.1_Missense_Mutation_p.P901S|GLI1_ENST00000546141.1_Missense_Mutation_p.P988S	NM_005269.2	NP_005260.1	P08151	GLI1_HUMAN	GLI family zinc finger 1	1029					cerebellar cortex morphogenesis (GO:0021696)|digestive tract morphogenesis (GO:0048546)|dorsal/ventral pattern formation (GO:0009953)|epidermal cell differentiation (GO:0009913)|lung development (GO:0030324)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|notochord regression (GO:0060032)|osteoblast differentiation (GO:0001649)|pituitary gland development (GO:0021983)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proximal/distal pattern formation (GO:0009954)|regulation of smoothened signaling pathway (GO:0008589)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in regulation of cerebellar granule cell precursor cell proliferation (GO:0021938)|spermatogenesis (GO:0007283)|ventral midline development (GO:0007418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|primary cilium (GO:0072372)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(8)|lung(22)|ovary(6)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69			GBM - Glioblastoma multiforme(3;3.99e-32)			GTACCCTCCTCCCGAAGGACA	0.587																																					Pancreas(157;841 1936 10503 41495 50368)												0													144.0	134.0	137.0					12																	57865608		2203	4300	6503	SO:0001583	missense	2735				CCDS8940.1, CCDS53806.1, CCDS53807.1	12q13.2-q13.3	2013-01-25	2009-03-05	2005-01-14		ENSG00000111087		"""Zinc fingers, C2H2-type"""	4317	protein-coding gene	gene with protein product		165220	"""glioma-associated oncogene homolog 1 (zinc finger protein)"", ""glioma-associated oncogene family zinc finger 1"""	GLI		2850480	Standard	NM_005269		Approved		uc001snx.3	P08151		ENST00000228682.2:c.3085C>T	12.37:g.57865608C>T	ENSP00000228682:p.Pro1029Ser		D0EUY3|E9PQQ9|F5H6H8|Q8TDN9	Missense_Mutation	SNP	ENST00000228682.2	37	CCDS8940.1	.	.	.	.	.	.	.	.	.	.	C	16.78	3.217191	0.58560	.	.	ENSG00000111087	ENST00000543426;ENST00000228682;ENST00000546141;ENST00000528467;ENST00000443131	T;T;T;T	0.15487	2.5;2.42;2.5;2.5	4.73	3.84	0.44239	.	0.363429	0.20852	N	0.084511	T	0.27524	0.0676	L	0.36672	1.1	0.48341	D	0.999632	D	0.89917	1.0	D	0.83275	0.996	T	0.01729	-1.1286	10	0.23302	T	0.38	.	10.4369	0.44441	0.0:0.9077:0.0:0.0923	.	1029	P08151	GLI1_HUMAN	S	901;1029;988;988;497	ENSP00000437607:P901S;ENSP00000228682:P1029S;ENSP00000441006:P988S;ENSP00000434408:P988S	ENSP00000228682:P1029S	P	+	1	0	GLI1	56151875	0.290000	0.24343	0.997000	0.53966	0.966000	0.64601	1.792000	0.38754	1.349000	0.45751	0.561000	0.74099	CCC		0.587	GLI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394197.1		NM_005269	
GPRIN2	9721	hgsc.bcm.edu	37	10	46999601	46999601	+	Missense_Mutation	SNP	G	G	A	rs9422022	byFrequency	TCGA-CJ-4635-01A-02D-1373-10	TCGA-CJ-4635-11B-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	2504b5cf-c2ff-4d30-8b3f-27e43f862e17	d095c7c8-99bf-4b02-ba05-ace6938b7fa6	g.chr10:46999601G>A	ENST00000374317.1	+	3	994	c.721G>A	c.(721-723)Gtg>Atg	p.V241M	GPRIN2_ENST00000374314.4_Missense_Mutation_p.V241M	NM_014696.3	NP_055511.2	O60269	GRIN2_HUMAN	G protein regulated inducer of neurite outgrowth 2	241			V -> M (in dbSNP:rs9422022).	VR -> MREVG (in Ref. 1; BAA25440 and 3; AAH11672). {ECO:0000305}.						breast(2)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)	18						CATGAGGGAGGTGAGGGCTGG	0.632													G|||	32	0.00638978	0.0023	0.0014	5008	,	,		31210	0.0139		0.0109	False		,,,				2504	0.0031																0													51.0	53.0	53.0					10																	46999601		2203	4299	6502	SO:0001583	missense	9721			BC011672	CCDS73101.1	10q11.22	2006-08-24	2006-08-24	2006-08-24	ENSG00000204175	ENSG00000204175			23730	protein-coding gene	gene with protein product		611240	"""KIAA0514"""	KIAA0514		9628581	Standard	NM_014696		Approved	MGC15171	uc001jec.3	O60269	OTTHUMG00000018107	ENST00000374317.1:c.721G>A	10.37:g.46999601G>A	ENSP00000363436:p.Val241Met		Q5SVF0	Missense_Mutation	SNP	ENST00000374317.1	37	CCDS31192.1	786	0.3598901098901099	179	0.3638211382113821	126	0.34806629834254144	219	0.38286713286713286	262	0.34564643799472294	G	3.183	-0.167470	0.06461	.	.	ENSG00000204175	ENST00000374317;ENST00000374314	T;T	0.03496	3.91;3.91	5.12	-1.64	0.08318	.	1.524420	0.04254	N	0.339078	T	0.00012	0.0000	L	0.34521	1.04	0.09310	N	1	B	0.15473	0.013	B	0.09377	0.004	T	0.46978	-0.9152	10	0.27082	T	0.32	0.3266	1.758	0.02986	0.326:0.1295:0.4122:0.1323	rs9422022	241	O60269	GRIN2_HUMAN	M	241	ENSP00000363436:V241M;ENSP00000363433:V241M	ENSP00000363433:V241M	V	+	1	0	GPRIN2	46419607	0.099000	0.21834	0.004000	0.12327	0.003000	0.03518	0.140000	0.16056	-0.217000	0.10033	-0.498000	0.04607	GTG		0.632	GPRIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047836.1		NM_014696	
HBS1L	10767	hgsc.bcm.edu	37	6	135300385	135300385	+	Missense_Mutation	SNP	G	G	C	rs145782441		TCGA-CJ-4635-01A-02D-1373-10	TCGA-CJ-4635-11B-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	2504b5cf-c2ff-4d30-8b3f-27e43f862e17	d095c7c8-99bf-4b02-ba05-ace6938b7fa6	g.chr6:135300385G>C	ENST00000367837.5	-	14	1825	c.1619C>G	c.(1618-1620)cCt>cGt	p.P540R	HBS1L_ENST00000367826.2_Missense_Mutation_p.P498R|HBS1L_ENST00000527578.1_Missense_Mutation_p.P376R|HBS1L_ENST00000367824.4_Missense_Mutation_p.P376R|HBS1L_ENST00000445176.2_Missense_Mutation_p.P264R|HBS1L_ENST00000415177.2_Missense_Mutation_p.P475R	NM_001145158.1|NM_006620.3	NP_001138630.1|NP_006611.1	Q9Y450	HBS1L_HUMAN	HBS1-like translational GTPase	540					signal transduction (GO:0007165)|translation (GO:0006412)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|translation elongation factor activity (GO:0003746)	p.P540L(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	20	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.0046)|GBM - Glioblastoma multiforme(68;0.00702)		CCAGTCGACAGGTTCATCATG	0.423																																																	1	Substitution - Missense(1)	skin(1)											85.0	75.0	78.0					6																	135300385		2203	4299	6502	SO:0001583	missense	10767			U87791	CCDS5173.1, CCDS47479.1, CCDS47480.1	6q23.3	2014-04-30	2014-04-30		ENSG00000112339	ENSG00000112339			4834	protein-coding gene	gene with protein product	"""eRF3 family member"""	612450	"""HBS1 (S. cerevisiae)-like"", ""HBS1-like (S. cerevisiae)"""			9872408, 23667253	Standard	NM_006620		Approved	ERFS, HBS1, HSPC276, KIAA1038, DKFZp434g247, EF-1a, eRF3c	uc003qez.2	Q9Y450	OTTHUMG00000015626	ENST00000367837.5:c.1619C>G	6.37:g.135300385G>C	ENSP00000356811:p.Pro540Arg		B7Z365|Q4VX89|Q4VX90|Q5T7G3|Q8NDW9|Q9UPW3	Missense_Mutation	SNP	ENST00000367837.5	37	CCDS5173.1	.	.	.	.	.	.	.	.	.	.	G	19.83	3.899346	0.72754	.	.	ENSG00000112339	ENST00000367837;ENST00000527578;ENST00000415177;ENST00000367826;ENST00000367824;ENST00000533274;ENST00000445176	T;T;T;T;T;T;T	0.64085	-0.08;-0.08;-0.08;-0.08;-0.08;-0.08;-0.08	5.72	5.72	0.89469	Translation elongation factor EFTu/EF1A, domain 2 (1);Translation elongation/initiation factor/Ribosomal, beta-barrel (1);	0.205944	0.51477	D	0.000081	T	0.72961	0.3526	L	0.61036	1.89	0.58432	D	0.999998	D;D	0.63880	0.993;0.99	P;D	0.63703	0.865;0.917	T	0.74765	-0.3554	10	0.87932	D	0	-19.297	19.8674	0.96824	0.0:0.0:1.0:0.0	.	498;540	Q9Y450-4;Q9Y450	.;HBS1L_HUMAN	R	540;376;475;498;376;410;264	ENSP00000356811:P540R;ENSP00000436256:P376R;ENSP00000389826:P475R;ENSP00000356800:P498R;ENSP00000356798:P376R;ENSP00000434533:P410R;ENSP00000415305:P264R	ENSP00000356798:P376R	P	-	2	0	HBS1L	135342078	1.000000	0.71417	1.000000	0.80357	0.826000	0.46750	9.675000	0.98638	2.690000	0.91761	0.655000	0.94253	CCT		0.423	HBS1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042339.2			
HERC3	8916	hgsc.bcm.edu;ucsc.edu	37	4	89583638	89583638	+	Missense_Mutation	SNP	A	A	C			TCGA-CJ-4635-01A-02D-1373-10	TCGA-CJ-4635-11B-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	2504b5cf-c2ff-4d30-8b3f-27e43f862e17	d095c7c8-99bf-4b02-ba05-ace6938b7fa6	g.chr4:89583638A>C	ENST00000402738.1	+	11	1442	c.1203A>C	c.(1201-1203)ttA>ttC	p.L401F	HERC3_ENST00000264345.3_Missense_Mutation_p.L401F|HERC3_ENST00000543130.1_Intron	NM_001271602.1|NM_014606.1	NP_001258531.1|NP_055421.1	Q15034	HERC3_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 3	401					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(14)|prostate(2)|skin(2)	45				OV - Ovarian serous cystadenocarcinoma(123;0.000319)		ATACCAGTTTAATAAATGATG	0.333																																																	0													114.0	108.0	110.0					4																	89583638		2203	4300	6503	SO:0001583	missense	8916			D25215	CCDS34028.1	4q21	2012-02-23	2012-02-23		ENSG00000138641	ENSG00000138641			4876	protein-coding gene	gene with protein product		605200	"""hect domain and RLD 3"""			10702688	Standard	NM_014606		Approved	KIAA0032	uc003hrw.2	Q15034	OTTHUMG00000150436	ENST00000402738.1:c.1203A>C	4.37:g.89583638A>C	ENSP00000385684:p.Leu401Phe		A8K1S5|Q8IXX3	Missense_Mutation	SNP	ENST00000402738.1	37	CCDS34028.1	.	.	.	.	.	.	.	.	.	.	A	14.34	2.505457	0.44558	.	.	ENSG00000138641	ENST00000402738;ENST00000264345	T;T	0.42900	0.96;0.96	4.57	4.57	0.56435	.	0.171891	0.41500	D	0.000880	T	0.20292	0.0488	N	0.08118	0	0.80722	D	1	B	0.15141	0.012	B	0.14023	0.01	T	0.08848	-1.0702	10	0.09843	T	0.71	.	10.5489	0.45077	0.8381:0.1619:0.0:0.0	.	401	Q15034	HERC3_HUMAN	F	401	ENSP00000385684:L401F;ENSP00000264345:L401F	ENSP00000264345:L401F	L	+	3	2	HERC3	89802661	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.840000	0.39230	2.044000	0.60594	0.533000	0.62120	TTA		0.333	HERC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318081.2		NM_014606	
IRF1	3659	hgsc.bcm.edu	37	5	131821389	131821389	+	Silent	SNP	C	C	T			TCGA-CJ-4635-01A-02D-1373-10	TCGA-CJ-4635-11B-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	2504b5cf-c2ff-4d30-8b3f-27e43f862e17	d095c7c8-99bf-4b02-ba05-ace6938b7fa6	g.chr5:131821389C>T	ENST00000245414.4	-	8	945	c.687G>A	c.(685-687)gaG>gaA	p.E229E	IRF1_ENST00000405885.2_Silent_p.E229E|IRF1_ENST00000463784.1_5'Flank	NM_002198.2	NP_002189.1	P10914	IRF1_HUMAN	interferon regulatory factor 1	229					apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|CD8-positive, alpha-beta T cell differentiation (GO:0043374)|cell cycle arrest (GO:0007050)|cellular response to interferon-beta (GO:0035458)|cellular response to mechanical stimulus (GO:0071260)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of cell proliferation (GO:0008285)|negative regulation of regulatory T cell differentiation (GO:0045590)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|regulation of adaptive immune response (GO:0002819)|regulation of CD8-positive, alpha-beta T cell proliferation (GO:2000564)|regulation of cell cycle (GO:0051726)|regulation of innate immune response (GO:0045088)|regulation of MyD88-dependent toll-like receptor signaling pathway (GO:0034124)|transcription from RNA polymerase II promoter (GO:0006366)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|lung(2)|prostate(2)|skin(1)|urinary_tract(1)	11		all_cancers(142;0.026)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	LUAD - Lung adenocarcinoma(142;0.247)		ATTTCCCTTCCTCATCCTCAT	0.537																																																	0													311.0	225.0	254.0					5																	131821389		2203	4300	6503	SO:0001819	synonymous_variant	3659				CCDS4155.1	5q23-q31	2008-07-18			ENSG00000125347	ENSG00000125347			6116	protein-coding gene	gene with protein product	"""interferon regulatory factor-1"""	147575				2726461, 1680796	Standard	NM_002198		Approved	MAR	uc003kxa.2	P10914	OTTHUMG00000059497	ENST00000245414.4:c.687G>A	5.37:g.131821389C>T			Q96GG7	Silent	SNP	ENST00000245414.4	37	CCDS4155.1																																																																																				0.537	IRF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132340.1		NM_002198	
KCNJ16	3773	hgsc.bcm.edu;ucsc.edu	37	17	68128601	68128601	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-4635-01A-02D-1373-10	TCGA-CJ-4635-11B-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	2504b5cf-c2ff-4d30-8b3f-27e43f862e17	d095c7c8-99bf-4b02-ba05-ace6938b7fa6	g.chr17:68128601T>C	ENST00000589377.1	+	2	536	c.373T>C	c.(373-375)Tcc>Ccc	p.S125P	KCNJ16_ENST00000392670.1_Missense_Mutation_p.S125P|KCNJ16_ENST00000585558.1_Missense_Mutation_p.S160P|KCNJ16_ENST00000283936.1_Missense_Mutation_p.S125P|KCNJ16_ENST00000586462.1_Missense_Mutation_p.S164P|KCNJ16_ENST00000392671.1_Missense_Mutation_p.S125P	NM_001270422.1	NP_001257351.1	Q9NPI9	KCJ16_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 16	125					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	inward rectifier potassium channel activity (GO:0005242)			breast(3)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	32	Breast(10;2.96e-09)					CTTTTTGTTCTCCCTAGAGAC	0.453																																																	0													79.0	70.0	73.0					17																	68128601		2203	4300	6503	SO:0001583	missense	3773			AF153815	CCDS11687.1, CCDS74141.1	17q24.3	2011-07-05				ENSG00000153822		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6262	protein-coding gene	gene with protein product		605722				11240146, 16382105	Standard	NM_018658		Approved	Kir5.1, BIR9	uc002jio.4	Q9NPI9		ENST00000589377.1:c.373T>C	17.37:g.68128601T>C	ENSP00000465967:p.Ser125Pro			Missense_Mutation	SNP	ENST00000589377.1	37	CCDS11687.1	.	.	.	.	.	.	.	.	.	.	T	16.76	3.212101	0.58452	.	.	ENSG00000153822	ENST00000283936;ENST00000392671;ENST00000392670	D;D;D	0.96830	-4.14;-4.14;-4.14	5.84	5.84	0.93424	Potassium channel, inwardly rectifying, Kir, conserved region 2 (2);	0.000000	0.85682	D	0.000000	D	0.98541	0.9513	M	0.92268	3.29	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.99679	1.0998	9	.	.	.	.	15.8874	0.79261	0.0:0.0:0.0:1.0	.	125;125	A8K434;Q9NPI9	.;IRK16_HUMAN	P	125	ENSP00000283936:S125P;ENSP00000376439:S125P;ENSP00000376438:S125P	.	S	+	1	0	KCNJ16	65640196	1.000000	0.71417	1.000000	0.80357	0.047000	0.14425	6.117000	0.71577	2.230000	0.72887	0.528000	0.53228	TCC		0.453	KCNJ16-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450880.1		NM_018658	
TRAPPC8	22878	hgsc.bcm.edu	37	18	29437670	29437670	+	Silent	SNP	G	G	A			TCGA-CJ-4635-01A-02D-1373-10	TCGA-CJ-4635-11B-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	2504b5cf-c2ff-4d30-8b3f-27e43f862e17	d095c7c8-99bf-4b02-ba05-ace6938b7fa6	g.chr18:29437670G>A	ENST00000283351.4	-	20	3356	c.3021C>T	c.(3019-3021)ggC>ggT	p.G1007G	TRAPPC8_ENST00000582539.1_Silent_p.G953G	NM_014939.3	NP_055754	Q9Y2L5	TPPC8_HUMAN	trafficking protein particle complex 8	1007					vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(7)|liver(2)|lung(13)|ovary(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						GACTTCCTGTGCCAATGCCAA	0.493																																																	0													129.0	116.0	121.0					18																	29437670		2203	4300	6503	SO:0001819	synonymous_variant	0			AB023229	CCDS11901.1	18q12.1	2011-10-10	2010-06-29	2010-06-29	ENSG00000153339	ENSG00000153339		"""Trafficking protein particle complex"""	29169	protein-coding gene	gene with protein product	"""general sporulation gene 1 homolog (S. cerevisiae)"""	614136	"""KIAA1012"""	KIAA1012		10231032, 11230166	Standard	NM_014939		Approved	HsT2706, TRS85, GSG1	uc002kxc.4	Q9Y2L5	OTTHUMG00000132267	ENST00000283351.4:c.3021C>T	18.37:g.29437670G>A			A0JP15|B3KME5|Q9H0L2	Silent	SNP	ENST00000283351.4	37	CCDS11901.1																																																																																				0.493	TRAPPC8-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255355.1		NM_014939	
KIAA1324L	222223	hgsc.bcm.edu;ucsc.edu	37	7	86548618	86548618	+	Missense_Mutation	SNP	C	C	G			TCGA-CJ-4635-01A-02D-1373-10	TCGA-CJ-4635-11B-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	2504b5cf-c2ff-4d30-8b3f-27e43f862e17	d095c7c8-99bf-4b02-ba05-ace6938b7fa6	g.chr7:86548618C>G	ENST00000450689.2	-	11	1593	c.1408G>C	c.(1408-1410)Gtg>Ctg	p.V470L	KIAA1324L_ENST00000297222.6_Missense_Mutation_p.V230L|KIAA1324L_ENST00000444627.1_Missense_Mutation_p.V470L|KIAA1324L_ENST00000416314.1_Missense_Mutation_p.V303L|KIAA1324L_ENST00000490995.1_5'UTR	NM_001142749.2	NP_001136221.1	A8MWY0	K132L_HUMAN	KIAA1324-like	470						integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(14)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	44	Esophageal squamous(14;0.0058)					TCTCCAGCCACCTCCCAACCT	0.328																																																	0													58.0	58.0	58.0					7																	86548618		2203	4300	6503	SO:0001583	missense	222223			AK055902	CCDS34677.1, CCDS47632.1, CCDS34677.2	7q21.12	2008-09-18			ENSG00000164659	ENSG00000164659			21945	protein-coding gene	gene with protein product	"""EIG121-like"""	614048					Standard	NM_001142749		Approved	FLJ31340, EIG121L	uc011kha.2	A8MWY0	OTTHUMG00000153995	ENST00000450689.2:c.1408G>C	7.37:g.86548618C>G	ENSP00000413445:p.Val470Leu		A4D1C9|B4DJV3|Q17RI6|Q96DP2	Missense_Mutation	SNP	ENST00000450689.2	37	CCDS47632.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.6|21.6	4.172544|4.172544	0.78452|0.78452	.|.	.|.	ENSG00000164659|ENSG00000164659	ENST00000423294|ENST00000450689;ENST00000297222;ENST00000444627;ENST00000416314	.|T;T;T;T	.|0.55234	.|0.53;0.53;0.53;0.53	5.94|5.94	5.06|5.06	0.68205|0.68205	.|Growth factor, receptor (1);	.|0.055696	.|0.64402	.|D	.|0.000001	T|T	0.64962|0.64962	0.2646|0.2646	L|L	0.52905|0.52905	1.665|1.665	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|0.966;1.0;1.0	.|P;D;D	.|0.80764	.|0.747;0.994;0.994	T|T	0.60821|0.60821	-0.7187|-0.7187	5|10	.|0.17369	.|T	.|0.5	.|.	13.9742|13.9742	0.64262|0.64262	0.0:0.9278:0.0:0.0722|0.0:0.9278:0.0:0.0722	.|.	.|470;230;303	.|A8MWY0;A8MWY0-2;B4DJV3	.|K132L_HUMAN;.;.	A|L	430|470;230;470;303	.|ENSP00000413445:V470L;ENSP00000297222:V230L;ENSP00000397377:V470L;ENSP00000402390:V303L	.|ENSP00000297222:V230L	G|V	-|-	2|1	0|0	KIAA1324L|KIAA1324L	86386554|86386554	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.764000|7.764000	0.85297|0.85297	1.511000|1.511000	0.48818|0.48818	0.655000|0.655000	0.94253|0.94253	GGT|GTG		0.328	KIAA1324L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333372.3		NM_152748	
MAGEB2	4113	hgsc.bcm.edu	37	X	30236765	30236765	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-4635-01A-02D-1373-10	TCGA-CJ-4635-11B-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	2504b5cf-c2ff-4d30-8b3f-27e43f862e17	d095c7c8-99bf-4b02-ba05-ace6938b7fa6	g.chrX:30236765G>A	ENST00000378988.4	+	2	169	c.68G>A	c.(67-69)cGg>cAg	p.R23Q		NM_002364.4	NP_002355.2	O15479	MAGB2_HUMAN	melanoma antigen family B, 2	23										breast(1)|large_intestine(3)|lung(17)|ovary(1)|skin(1)	23						GATGAGACCCGGGGTCTCAAT	0.567																																																	0													37.0	35.0	36.0					X																	30236765		2202	4300	6502	SO:0001583	missense	4113			AF015766	CCDS14219.1	Xp21.3	2009-03-17			ENSG00000099399	ENSG00000099399			6809	protein-coding gene	gene with protein product	"""DSS/AHC critical interval MAGE superfamily 6"", ""melanoma-associated antigen B2"", ""cancer/testis antigen family 3, member 2"""	300098				9441743	Standard	NM_002364		Approved	DAM6, MAGE-XP-2, MGC26438, CT3.2	uc004dbz.3	O15479	OTTHUMG00000021319	ENST00000378988.4:c.68G>A	X.37:g.30236765G>A	ENSP00000368273:p.Arg23Gln		O75860	Missense_Mutation	SNP	ENST00000378988.4	37	CCDS14219.1	.	.	.	.	.	.	.	.	.	.	A	0.186	-1.057326	0.01965	.	.	ENSG00000099399	ENST00000378988	T	0.02974	4.09	3.43	0.959	0.19624	Melanoma associated antigen, MAGE, N-terminal (1);	0.653207	0.14428	N	0.320189	T	0.00468	0.0015	N	0.00036	-2.535	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.43766	-0.9371	10	0.02654	T	1	.	3.0051	0.06026	0.5076:0.2281:0.2643:0.0	.	23	O15479	MAGB2_HUMAN	Q	23	ENSP00000368273:R23Q	ENSP00000368273:R23Q	R	+	2	0	MAGEB2	30146686	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.065000	0.11617	-0.166000	0.10890	-1.641000	0.00772	CGG		0.567	MAGEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056157.1		NM_002364	
MDN1	23195	hgsc.bcm.edu;ucsc.edu	37	6	90362818	90362818	+	Missense_Mutation	SNP	G	G	A	rs149487165	byFrequency	TCGA-CJ-4635-01A-02D-1373-10	TCGA-CJ-4635-11B-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	2504b5cf-c2ff-4d30-8b3f-27e43f862e17	d095c7c8-99bf-4b02-ba05-ace6938b7fa6	g.chr6:90362818G>A	ENST00000369393.3	-	94	15833	c.15718C>T	c.(15718-15720)Ccc>Tcc	p.P5240S	MDN1_ENST00000428876.1_Missense_Mutation_p.P5240S			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	5240					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		TCTGTTCTGGGGTCTTGGTCT	0.393																																																	0													272.0	265.0	267.0					6																	90362818		2203	4300	6503	SO:0001583	missense	23195			AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.15718C>T	6.37:g.90362818G>A	ENSP00000358400:p.Pro5240Ser		O15019|Q5T794	Missense_Mutation	SNP	ENST00000369393.3	37	CCDS5024.1	.	.	.	.	.	.	.	.	.	.	G	2.456	-0.325198	0.05350	.	.	ENSG00000112159	ENST00000369393;ENST00000428876	T;T	0.39592	1.07;1.07	6.17	3.47	0.39725	.	0.638714	0.16064	N	0.231346	T	0.13628	0.0330	L	0.54323	1.7	0.09310	N	1	B	0.12013	0.005	B	0.08055	0.003	T	0.34054	-0.9844	10	0.08599	T	0.76	.	9.118	0.36769	0.2998:0.0:0.7002:0.0	.	5240	Q9NU22	MDN1_HUMAN	S	5240	ENSP00000358400:P5240S;ENSP00000413970:P5240S	ENSP00000358400:P5240S	P	-	1	0	MDN1	90419539	0.000000	0.05858	0.075000	0.20258	0.004000	0.04260	0.127000	0.15790	0.492000	0.27815	-0.150000	0.13652	CCC		0.393	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041514.2			
MT1X	4501	hgsc.bcm.edu	37	16	56717913	56717913	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-4635-01A-02D-1373-10	TCGA-CJ-4635-11B-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	2504b5cf-c2ff-4d30-8b3f-27e43f862e17	d095c7c8-99bf-4b02-ba05-ace6938b7fa6	g.chr16:56717913G>T	ENST00000394485.4	+	3	255	c.138G>T	c.(136-138)caG>caT	p.Q46H	RP11-343H19.2_ENST00000567563.1_RNA	NM_005952.3	NP_005943.1	P80297	MT1X_HUMAN	metallothionein 1X	46	Alpha.				cellular response to cadmium ion (GO:0071276)|cellular response to erythropoietin (GO:0036018)|cellular response to zinc ion (GO:0071294)|negative regulation of growth (GO:0045926)|response to metal ion (GO:0010038)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	metal ion binding (GO:0046872)|zinc ion binding (GO:0008270)			kidney(2)	2						AGTGTGCCCAGGGCTGCATCT	0.567																																																	0													196.0	197.0	196.0					16																	56717913		2198	4300	6498	SO:0001583	missense	4501			BC032338	CCDS10768.1	16q13	2010-10-20			ENSG00000187193	ENSG00000187193		"""Metallothioneins"""	7405	protein-coding gene	gene with protein product		156359		MT1		2286373, 8049263	Standard	NM_005952		Approved	MT-1l	uc002ejy.3	P80297	OTTHUMG00000133280	ENST00000394485.4:c.138G>T	16.37:g.56717913G>T	ENSP00000377995:p.Gln46His		A8MUC7	Missense_Mutation	SNP	ENST00000394485.4	37	CCDS10768.1	.	.	.	.	.	.	.	.	.	.	G	15.18	2.756408	0.49362	.	.	ENSG00000187193	ENST00000394485	T	0.10477	2.87	4.22	3.25	0.37280	Metallothionein domain, vertebrate (1);Metallothionein domain (1);	.	.	.	.	T	0.25791	0.0628	.	.	.	0.80722	D	1	D	0.61697	0.99	P	0.61658	0.892	T	0.01276	-1.1398	8	0.66056	D	0.02	.	9.8419	0.41004	0.1002:0.0:0.8998:0.0	.	46	P80297	MT1X_HUMAN	H	46	ENSP00000377995:Q46H	ENSP00000377995:Q46H	Q	+	3	2	MT1X	55275414	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.825000	0.39081	1.114000	0.41781	0.561000	0.74099	CAG		0.567	MT1X-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257060.1		NM_005952	
MYLK4	340156	hgsc.bcm.edu;ucsc.edu	37	6	2678597	2678597	+	Silent	SNP	A	A	G			TCGA-CJ-4635-01A-02D-1373-10	TCGA-CJ-4635-11B-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	2504b5cf-c2ff-4d30-8b3f-27e43f862e17	d095c7c8-99bf-4b02-ba05-ace6938b7fa6	g.chr6:2678597A>G	ENST00000274643.7	-	10	1239	c.897T>C	c.(895-897)ggT>ggC	p.G299G	MYLK4_ENST00000268446.5_Silent_p.G299G	NM_001012418.3	NP_001012418.2	Q86YV6	MYLK4_HUMAN	myosin light chain kinase family, member 4	299	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(10)|ovary(2)|skin(1)	23	Ovarian(93;0.0412)	all_hematologic(90;0.0897)				AAGGCGACAAACCGCTAAGTC	0.488																																																	0													95.0	85.0	88.0					6																	2678597		2203	4300	6503	SO:0001819	synonymous_variant	340156				CCDS34330.1	6p25.2	2008-01-23			ENSG00000145949	ENSG00000145949			27972	protein-coding gene	gene with protein product	"""caMLCK like"""						Standard	NM_001012418		Approved	SgK085	uc003mty.4	Q86YV6	OTTHUMG00000014121	ENST00000274643.7:c.897T>C	6.37:g.2678597A>G			A2RUC0|Q5TAW2	Silent	SNP	ENST00000274643.7	37	CCDS34330.1																																																																																				0.488	MYLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039632.2		NM_001012418	
MYPN	84665	hgsc.bcm.edu;ucsc.edu	37	10	69925513	69925513	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-4635-01A-02D-1373-10	TCGA-CJ-4635-11B-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	2504b5cf-c2ff-4d30-8b3f-27e43f862e17	d095c7c8-99bf-4b02-ba05-ace6938b7fa6	g.chr10:69925513T>C	ENST00000358913.5	+	9	2026	c.1538T>C	c.(1537-1539)tTc>tCc	p.F513S	MYPN_ENST00000354393.2_Missense_Mutation_p.F238S|MYPN_ENST00000540630.1_Missense_Mutation_p.F513S	NM_001256267.1|NM_032578.3	NP_001243196.1|NP_115967.2	Q86TC9	MYPN_HUMAN	myopalladin	513	Ig-like 2.|Interaction with CARP.				sarcomere organization (GO:0045214)	I band (GO:0031674)|nucleus (GO:0005634)|Z disc (GO:0030018)	cytoskeletal protein binding (GO:0008092)|muscle alpha-actinin binding (GO:0051371)|SH3 domain binding (GO:0017124)			breast(2)|central_nervous_system(1)|endometrium(13)|kidney(6)|large_intestine(13)|liver(1)|lung(43)|ovary(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(5)	94						TCTGGGTGCTTCACATGTACT	0.433																																																	0													156.0	127.0	137.0					10																	69925513		2203	4300	6503	SO:0001583	missense	84665			AL834247	CCDS7275.1, CCDS73142.1	10q22.1	2014-09-17			ENSG00000138347	ENSG00000138347		"""Immunoglobulin superfamily / I-set domain containing"""	23246	protein-coding gene	gene with protein product	"""sarcomeric protein myopalladin, 145 kDa"""	608517				11309420, 12482578	Standard	NM_032578		Approved	MYOP	uc001jnm.5	Q86TC9	OTTHUMG00000018344	ENST00000358913.5:c.1538T>C	10.37:g.69925513T>C	ENSP00000351790:p.Phe513Ser		Q5VV35|Q5VV36|Q86T37|Q8N3L4|Q96K90|Q96KF5	Missense_Mutation	SNP	ENST00000358913.5	37	CCDS7275.1	.	.	.	.	.	.	.	.	.	.	T	27.6	4.844174	0.91197	.	.	ENSG00000138347	ENST00000354393;ENST00000542332;ENST00000358913;ENST00000540630	T;T;T	0.70869	-0.52;-0.52;-0.52	5.23	5.23	0.72850	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.86188	0.5873	M	0.88640	2.97	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.91635	0.994;0.999;0.999	D	0.88585	0.3139	9	.	.	.	.	15.1361	0.72566	0.0:0.0:0.0:1.0	.	513;238;513	F5GWA6;Q86TC9-2;Q86TC9	.;.;MYPN_HUMAN	S	238;238;513;513	ENSP00000346369:F238S;ENSP00000351790:F513S;ENSP00000441668:F513S	.	F	+	2	0	MYPN	69595519	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.665000	0.83852	1.969000	0.57287	0.459000	0.35465	TTC		0.433	MYPN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048307.1		NM_032578	
NAA25	80018	hgsc.bcm.edu	37	12	112516503	112516503	+	Silent	SNP	G	G	A			TCGA-CJ-4635-01A-02D-1373-10	TCGA-CJ-4635-11B-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	2504b5cf-c2ff-4d30-8b3f-27e43f862e17	d095c7c8-99bf-4b02-ba05-ace6938b7fa6	g.chr12:112516503G>A	ENST00000261745.4	-	6	768	c.520C>T	c.(520-522)Ctg>Ttg	p.L174L		NM_024953.3	NP_079229.2	Q14CX7	NAA25_HUMAN	N(alpha)-acetyltransferase 25, NatB auxiliary subunit	174						cytoplasm (GO:0005737)				autonomic_ganglia(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(1)|lung(14)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	46						GCAAGGGGCAGAAACATTGTT	0.368																																																	0													168.0	152.0	158.0					12																	112516503		2203	4300	6503	SO:0001819	synonymous_variant	80018			AB054990	CCDS9159.1	12q24.13	2013-10-11	2010-01-14	2010-01-14		ENSG00000111300		"""N(alpha)-acetyltransferase subunits"""	25783	protein-coding gene	gene with protein product		612755	"""chromosome 12 open reading frame 30"""	C12orf30		19660095	Standard	NM_024953		Approved	FLJ13089	uc001ttm.3	Q14CX7	OTTHUMG00000169638	ENST00000261745.4:c.520C>T	12.37:g.112516503G>A			A0JLU7|Q6MZH1|Q7Z4N6|Q9H911	Silent	SNP	ENST00000261745.4	37	CCDS9159.1	.	.	.	.	.	.	.	.	.	.	G	8.105	0.777515	0.16120	.	.	ENSG00000111300	ENST00000547133	.	.	.	6.05	4.02	0.46733	.	.	.	.	.	T	0.48409	0.1498	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.45131	-0.9282	4	.	.	.	-7.5836	4.3651	0.11220	0.4245:0.0:0.5755:0.0	.	.	.	.	F	135	.	.	S	-	2	0	NAA25	111000886	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.161000	0.50747	1.577000	0.49804	0.650000	0.86243	TCT		0.368	NAA25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405205.1		NM_024953	
ODF1	4956	hgsc.bcm.edu	37	8	103573001	103573001	+	Silent	SNP	C	C	G	rs3018445|rs386728347|rs386728346	byFrequency	TCGA-CJ-4635-01A-02D-1373-10	TCGA-CJ-4635-11B-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	2504b5cf-c2ff-4d30-8b3f-27e43f862e17	d095c7c8-99bf-4b02-ba05-ace6938b7fa6	g.chr8:103573001C>G	ENST00000285402.3	+	2	798	c.642C>G	c.(640-642)ccC>ccG	p.P214P	ODF1_ENST00000518835.1_Silent_p.P7P	NM_024410.3	NP_077721.2	Q14990	ODFP1_HUMAN	outer dense fiber of sperm tails 1	214	C-X-P repeat region.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|outer dense fiber (GO:0001520)				NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	20	all_cancers(14;2.76e-05)|all_epithelial(15;4.54e-08)|Lung NSC(17;4.08e-05)|all_lung(17;9.15e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000125)|STAD - Stomach adenocarcinoma(118;0.0826)			cctgcagcccctgcagcccct	0.567													C|||	2457	0.490615	0.4486	0.5043	5008	,	,		15391	0.3056		0.6431	False		,,,				2504	0.5716																0								C		2009,2397	553.2+/-378.7	457,1095,651	68.0	63.0	64.0		642	0.5	1.0	8	dbSNP_101	64	5481,3119	654.4+/-401.1	1755,1971,574	no	coding-synonymous	ODF1	NM_024410.3		2212,3066,1225	GG,GC,CC		36.2674,45.5969,42.4112		214/251	103573001	7490,5516	2203	4300	6503	SO:0001819	synonymous_variant	4956			M93131	CCDS6293.1	8q22	2011-09-05	2002-10-21		ENSG00000155087	ENSG00000155087		"""Heat shock proteins / HSPB"""	8113	protein-coding gene	gene with protein product	"""cancer/testis antigen 133"""	182878	"""outer dense fibre of sperm tails 1"""			8305202	Standard	NM_024410		Approved	ODFPG, ODF27, RT7, HSPB10, CT133	uc003ykt.2	Q14990	OTTHUMG00000164719	ENST00000285402.3:c.642C>G	8.37:g.103573001C>G			Q3SX72	Silent	SNP	ENST00000285402.3	37	CCDS6293.1																																																																																				0.567	ODF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379884.1			
OVOL2	58495	hgsc.bcm.edu;ucsc.edu	37	20	18005499	18005499	+	Silent	SNP	C	C	T			TCGA-CJ-4635-01A-02D-1373-10	TCGA-CJ-4635-11B-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	2504b5cf-c2ff-4d30-8b3f-27e43f862e17	d095c7c8-99bf-4b02-ba05-ace6938b7fa6	g.chr20:18005499C>T	ENST00000278780.6	-	4	851	c.609G>A	c.(607-609)caG>caA	p.Q203Q	OVOL2_ENST00000483661.1_5'UTR	NM_021220.2	NP_067043.2	Q9BRP0	OVOL2_HUMAN	ovo-like zinc finger 2	203					angiogenesis (GO:0001525)|dorsal/ventral pattern formation (GO:0009953)|embryonic digestive tract morphogenesis (GO:0048557)|endocardium formation (GO:0060214)|heart looping (GO:0001947)|heart trabecula formation (GO:0060347)|labyrinthine layer blood vessel development (GO:0060716)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell migration (GO:0001755)|neural fold formation (GO:0001842)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle (GO:0051726)|regulation of keratinocyte proliferation (GO:0010837)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(3)	6						TATAGGCATACTGCTGCTGCA	0.582																																																	0													89.0	83.0	85.0					20																	18005499		2203	4300	6503	SO:0001819	synonymous_variant	58495			AK022284	CCDS13132.1	20p11.23	2013-10-17	2013-10-17	2005-05-31	ENSG00000125850	ENSG00000125850		"""Zinc fingers, C2H2-type"""	15804	protein-coding gene	gene with protein product			"""zinc finger protein 339"", ""ovo-like 2 (Drosophila)"""	ZNF339			Standard	NM_021220		Approved	bA504H3.3, HOVO2	uc002wqi.1	Q9BRP0	OTTHUMG00000031960	ENST00000278780.6:c.609G>A	20.37:g.18005499C>T			Q5T8B4|Q9BX22|Q9HA54|Q9Y4M0	Silent	SNP	ENST00000278780.6	37	CCDS13132.1																																																																																				0.582	OVOL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078148.5		NM_021220	
PBRM1	55193	hgsc.bcm.edu	37	3	52713700	52713700	+	Missense_Mutation	SNP	A	A	T			TCGA-CJ-4635-01A-02D-1373-10	TCGA-CJ-4635-11B-01D-1373-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			SOLID	2504b5cf-c2ff-4d30-8b3f-27e43f862e17	d095c7c8-99bf-4b02-ba05-ace6938b7fa6	g.chr3:52713700A>T	ENST00000296302.7	-	1	29	c.28T>A	c.(28-30)Tcc>Acc	p.S10T	PBRM1_ENST00000337303.4_Missense_Mutation_p.S10T|PBRM1_ENST00000410007.1_Missense_Mutation_p.S10T|PBRM1_ENST00000394830.3_Missense_Mutation_p.S10T|PBRM1_ENST00000356770.4_Missense_Mutation_p.S10T|PBRM1_ENST00000409767.1_Missense_Mutation_p.S10T|PBRM1_ENST00000409114.3_Missense_Mutation_p.S10T|PBRM1_ENST00000409057.1_Missense_Mutation_p.S10T			Q86U86	PB1_HUMAN	polybromo 1	10					chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		CTGGAAGGGGAGGTAGCTCTT	0.458			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																			Rec	yes		3	3p21	55193	polybromo 1		E	0													90.0	85.0	87.0					3																	52713700		2203	4300	6503	SO:0001583	missense	55193			BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.28T>A	3.37:g.52713700A>T	ENSP00000296302:p.Ser10Thr		A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Missense_Mutation	SNP	ENST00000296302.7	37		.	.	.	.	.	.	.	.	.	.	A	21.6	4.174006	0.78452	.	.	ENSG00000163939	ENST00000356770;ENST00000394830;ENST00000296302;ENST00000337303;ENST00000409057;ENST00000410007;ENST00000409114;ENST00000409767;ENST00000423351;ENST00000431678;ENST00000420148;ENST00000449505;ENST00000450271;ENST00000439181;ENST00000458294;ENST00000424867	T;T;T;T;T;T;T;T;T;T;T;T;T	0.52983	1.06;1.01;1.02;0.99;1.01;1.01;1.45;0.99;1.01;0.89;0.94;0.91;0.64	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.64843	0.2635	L	0.54323	1.7	0.58432	D	0.999996	D;D;D;D;D;D;D;D	0.76494	0.99;0.974;0.99;0.974;0.999;0.982;0.99;0.974	D;D;D;D;D;D;D;D	0.80764	0.979;0.969;0.979;0.969;0.994;0.952;0.979;0.969	T	0.67397	-0.5681	10	0.72032	D	0.01	-6.3538	15.8614	0.79026	1.0:0.0:0.0:0.0	.	10;10;10;10;10;10;10;10	Q86U86-9;Q86U86-4;Q86U86-2;Q86U86-8;Q86U86-7;Q86U86;Q86U86-3;Q86U86-5	.;.;.;.;.;PB1_HUMAN;.;.	T	10	ENSP00000349213:S10T;ENSP00000378307:S10T;ENSP00000296302:S10T;ENSP00000338302:S10T;ENSP00000386593:S10T;ENSP00000386529:S10T;ENSP00000386643:S10T;ENSP00000386601:S10T;ENSP00000387775:S10T;ENSP00000409939:S10T;ENSP00000389390:S10T;ENSP00000412401:S10T;ENSP00000416851:S10T	ENSP00000296302:S10T	S	-	1	0	PBRM1	52688740	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.962000	0.93254	2.142000	0.66516	0.477000	0.44152	TCC		0.458	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1		NM_018165	
PCIF1	63935	hgsc.bcm.edu	37	20	44571762	44571762	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-4635-01A-02D-1373-10	TCGA-CJ-4635-11B-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	2504b5cf-c2ff-4d30-8b3f-27e43f862e17	d095c7c8-99bf-4b02-ba05-ace6938b7fa6	g.chr20:44571762A>G	ENST00000372409.3	+	8	1064	c.700A>G	c.(700-702)Aac>Gac	p.N234D		NM_022104.3	NP_071387.1	Q9H4Z3	PCIF1_HUMAN	PDX1 C-terminal inhibiting factor 1	234					negative regulation of phosphatase activity (GO:0010923)	intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	20						GGAGTCTTTCAACCGCTGGAT	0.537																																																	0													61.0	50.0	54.0					20																	44571762		2203	4300	6503	SO:0001583	missense	63935			AB050014	CCDS13388.1	20q13.12	2014-06-13	2008-04-29	2008-04-29	ENSG00000100982	ENSG00000100982			16200	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 121"""		"""chromosome 20 open reading frame 67"""	C20orf67		12565871, 15121856	Standard	NM_022104		Approved	bA465L10.1, PPP1R121	uc002xqs.3	Q9H4Z3	OTTHUMG00000032635	ENST00000372409.3:c.700A>G	20.37:g.44571762A>G	ENSP00000361486:p.Asn234Asp		E1P5P1|Q54AB9|Q9NT85	Missense_Mutation	SNP	ENST00000372409.3	37	CCDS13388.1	.	.	.	.	.	.	.	.	.	.	A	24.7	4.555803	0.86231	.	.	ENSG00000100982	ENST00000372409;ENST00000443130	.	.	.	5.01	5.01	0.66863	.	0.000000	0.85682	D	0.000000	T	0.77765	0.4179	M	0.78637	2.42	0.80722	D	1	D	0.71674	0.998	D	0.68039	0.955	T	0.80892	-0.1179	9	0.66056	D	0.02	-31.2663	14.0642	0.64819	1.0:0.0:0.0:0.0	.	234	Q9H4Z3	PCIF1_HUMAN	D	234	.	ENSP00000361486:N234D	N	+	1	0	PCIF1	44005169	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.009000	0.93606	2.107000	0.64212	0.533000	0.62120	AAC		0.537	PCIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079550.1		NM_022104	
PDE4DIP	9659	hgsc.bcm.edu	37	1	144906421	144906421	+	Splice_Site	SNP	C	C	G			TCGA-CJ-4635-01A-02D-1373-10	TCGA-CJ-4635-11B-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	2504b5cf-c2ff-4d30-8b3f-27e43f862e17	d095c7c8-99bf-4b02-ba05-ace6938b7fa6	g.chr1:144906421C>G	ENST00000369354.3	-	18	2625	c.2436G>C	c.(2434-2436)aaG>aaC	p.K812N	PDE4DIP_ENST00000530740.1_Splice_Site_p.K949N|PDE4DIP_ENST00000479408.2_Splice_Site_p.K599N|PDE4DIP_ENST00000369351.3_Splice_Site_p.K812N|PDE4DIP_ENST00000313431.9_Splice_Site_p.K975N|PDE4DIP_ENST00000313382.9_Splice_Site_p.K878N|PDE4DIP_ENST00000529945.1_Splice_Site_p.K975N|PDE4DIP_ENST00000524974.1_Intron|PDE4DIP_ENST00000369359.4_Splice_Site_p.K949N|PDE4DIP_ENST00000369356.4_Splice_Site_p.K812N|PDE4DIP_ENST00000369349.3_Splice_Site_p.K812N			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	812					cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		TTTGAAAGACCTTTATGAGAT	0.443			T	PDGFRB	MPD																																			Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	0													108.0	110.0	109.0					1																	144906421		2203	4296	6499	SO:0001630	splice_region_variant	9659			AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.2436+1G>C	1.37:g.144906421C>G			A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Missense_Mutation	SNP	ENST00000369354.3	37	CCDS30824.1	.	.	.	.	.	.	.	.	.	.	C	18.54	3.645960	0.67358	.	.	ENSG00000178104	ENST00000313382;ENST00000369354;ENST00000369356;ENST00000369353;ENST00000530740;ENST00000369359;ENST00000369351;ENST00000369349;ENST00000313431;ENST00000529945;ENST00000479408	T;T;T;T;T;T;T;T;T;T	0.13901	4.57;4.63;4.63;4.69;4.66;3.61;3.63;2.59;2.59;2.55	6.07	6.07	0.98685	.	.	.	.	.	T	0.19685	0.0473	L	0.34521	1.04	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.997;0.991;0.999;0.997;0.997	T	0.00915	-1.1516	8	.	.	.	.	18.3129	0.90207	0.0:1.0:0.0:0.0	.	975;812;975;878;812	E9PL24;Q5VU43-7;Q5VU43-2;Q5VU43-3;Q5VU43	.;.;.;.;MYOME_HUMAN	N	878;812;812;975;949;949;812;812;975;975;599	ENSP00000327209:K878N;ENSP00000358360:K812N;ENSP00000358363:K812N;ENSP00000435654:K949N;ENSP00000358366:K949N;ENSP00000358357:K812N;ENSP00000358355:K812N;ENSP00000316434:K975N;ENSP00000433392:K975N;ENSP00000436791:K599N	.	K	-	3	2	PDE4DIP	143617778	1.000000	0.71417	1.000000	0.80357	0.503000	0.33858	5.379000	0.66196	2.928000	0.99379	0.638000	0.83543	AAG		0.443	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000038858.2		NM_022359	Missense_Mutation
PDS5A	23244	hgsc.bcm.edu;ucsc.edu	37	4	39929780	39929780	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-4635-01A-02D-1373-10	TCGA-CJ-4635-11B-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	2504b5cf-c2ff-4d30-8b3f-27e43f862e17	d095c7c8-99bf-4b02-ba05-ace6938b7fa6	g.chr4:39929780A>G	ENST00000303538.8	-	3	682	c.143T>C	c.(142-144)gTa>gCa	p.V48A	PDS5A_ENST00000503396.1_Missense_Mutation_p.V48A	NM_001100399.1	NP_001093869.1			PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae)											breast(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(9)|lung(14)|prostate(3)|skin(1)|urinary_tract(1)	39						GGTTTTCACTACCATCTGTAA	0.353																																																	0													73.0	64.0	67.0					4																	39929780		1841	4095	5936	SO:0001583	missense	23244			AF294791	CCDS47045.1, CCDS54759.1	4p14	2007-06-20			ENSG00000121892	ENSG00000121892			29088	protein-coding gene	gene with protein product		613200				11076961, 15855230	Standard	NM_001100399		Approved	KIAA0648, PIG54, SCC-112	uc003guv.4	Q29RF7	OTTHUMG00000160582	ENST00000303538.8:c.143T>C	4.37:g.39929780A>G	ENSP00000303427:p.Val48Ala			Missense_Mutation	SNP	ENST00000303538.8	37	CCDS47045.1	.	.	.	.	.	.	.	.	.	.	A	24.6	4.544585	0.86022	.	.	ENSG00000121892	ENST00000303538;ENST00000503396	.	.	.	5.57	5.57	0.84162	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.68128	0.2967	L	0.46157	1.445	0.80722	D	1	P;D	0.71674	0.917;0.998	P;D	0.65010	0.693;0.931	T	0.66728	-0.5850	8	.	.	.	-10.3992	15.7319	0.77814	1.0:0.0:0.0:0.0	.	48;48	Q29RF7-3;Q29RF7	.;PDS5A_HUMAN	A	48	.	.	V	-	2	0	PDS5A	39606175	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.339000	0.96797	2.109000	0.64355	0.482000	0.46254	GTA		0.353	PDS5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361287.1		NM_015200	
PPIH	10465	hgsc.bcm.edu;ucsc.edu	37	1	43124123	43124123	+	Silent	SNP	G	G	A			TCGA-CJ-4635-01A-02D-1373-10	TCGA-CJ-4635-11B-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	2504b5cf-c2ff-4d30-8b3f-27e43f862e17	d095c7c8-99bf-4b02-ba05-ace6938b7fa6	g.chr1:43124123G>A	ENST00000304979.3	+	1	28	c.6G>A	c.(4-6)gcG>gcA	p.A2A	PPIH_ENST00000455203.2_5'Flank|PPIH_ENST00000372549.1_5'Flank|PPIH_ENST00000372550.1_5'Flank	NM_006347.3	NP_006338.1	O43447	PPIH_HUMAN	peptidylprolyl isomerase H (cyclophilin H)	2					mRNA splicing, via spliceosome (GO:0000398)|positive regulation of viral genome replication (GO:0045070)|protein complex assembly (GO:0006461)|protein folding (GO:0006457)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|spliceosomal complex (GO:0005681)|U4/U6 snRNP (GO:0071001)|U4/U6 x U5 tri-snRNP complex (GO:0046540)	cyclosporin A binding (GO:0016018)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|ribonucleoprotein complex binding (GO:0043021)			endometrium(1)|large_intestine(1)|lung(2)	4	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)			L-Proline(DB00172)	GAGCCATGGCGGTGGCAAATT	0.617																																					NSCLC(73;23 1942 10718 46854)												0													116.0	109.0	112.0					1																	43124123		2203	4300	6503	SO:0001819	synonymous_variant	10465			AF016371	CCDS469.1	1p34.1	2012-06-07	2006-01-12		ENSG00000171960	ENSG00000171960			14651	protein-coding gene	gene with protein product	"""USA-CyP SnuCyp-20"", ""cyclophilin H"", ""U-snRNP-associated cyclophilin SunCyp-20"", ""small nuclear ribonucleoprotein particle-specific cyclophilin H"", ""rotamase H"", ""peptidyl-prolyl cis-trans isomerase H"", ""PPIase h"""	606095	"""peptidyl prolyl isomerase H (cyclophilin H)"""			9404889, 9570313	Standard	NM_006347		Approved	USA-CYP, CYP-20, SnuCyp-20, CYPH, MGC5016	uc001chq.3	O43447	OTTHUMG00000007520	ENST00000304979.3:c.6G>A	1.37:g.43124123G>A			A6NNE7	Silent	SNP	ENST00000304979.3	37	CCDS469.1																																																																																				0.617	PPIH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019778.1		NM_006347	
PRODH	5625	hgsc.bcm.edu	37	22	18904467	18904467	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-4635-01A-02D-1373-10	TCGA-CJ-4635-11B-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	2504b5cf-c2ff-4d30-8b3f-27e43f862e17	d095c7c8-99bf-4b02-ba05-ace6938b7fa6	g.chr22:18904467T>C	ENST00000357068.6	-	12	1727	c.1462A>G	c.(1462-1464)Aac>Gac	p.N488D	PRODH_ENST00000334029.2_Missense_Mutation_p.N380D|PRODH_ENST00000420436.1_Missense_Mutation_p.N380D	NM_016335.4	NP_057419	O43272	PROD_HUMAN	proline dehydrogenase (oxidase) 1	488			N -> S (in a breast cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		4-hydroxyproline catabolic process (GO:0019470)|cellular nitrogen compound metabolic process (GO:0034641)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|proline catabolic process (GO:0006562)|proline catabolic process to glutamate (GO:0010133)|proline metabolic process (GO:0006560)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)	FAD binding (GO:0071949)|proline dehydrogenase activity (GO:0004657)			breast(1)|endometrium(3)|lung(4)|upper_aerodigestive_tract(1)	9					L-Proline(DB00172)	GCCTTGGCGTTGTGCTTCAGC	0.607																																																	0													140.0	91.0	108.0					22																	18904467		2203	4300	6503	SO:0001583	missense	5625			AF010310	CCDS13754.1, CCDS56223.1	22q11.2	2014-07-10	2001-12-05		ENSG00000100033	ENSG00000100033	1.5.5.2		9453	protein-coding gene	gene with protein product		606810	"""proline dehydrogenase (proline oxidase )"""			9385373, 10192398	Standard	NM_001195226		Approved	HSPOX2, PRODH1, PIG6, PRODH2, TP53I6	uc002zok.4	O43272	OTTHUMG00000150163	ENST00000357068.6:c.1462A>G	22.37:g.18904467T>C	ENSP00000349577:p.Asn488Asp		A6NF53|O14680|Q0P507|Q147W8|Q504W1|Q59FI8|Q6NV86|Q9UF13	Missense_Mutation	SNP	ENST00000357068.6	37	CCDS13754.1	.	.	.	.	.	.	.	.	.	.	t	7.515	0.655470	0.14580	.	.	ENSG00000100033	ENST00000357068;ENST00000313755	T	0.33216	1.42	4.43	3.31	0.37934	Proline dehydrogenase (1);	0.188793	0.56097	D	0.000027	T	0.24198	0.0586	L	0.49256	1.55	0.31145	N	0.70616	B;B;B	0.20164	0.008;0.042;0.01	B;B;B	0.22152	0.015;0.038;0.026	T	0.16719	-1.0393	10	0.11182	T	0.66	-31.2949	9.8902	0.41285	0.0:0.0:0.1699:0.8301	.	404;488;380	O43272-1;O43272;E7EQL6	.;PROD_HUMAN;.	D	488;133	ENSP00000349577:N488D	ENSP00000318329:N133D	N	-	1	0	PRODH	17284467	1.000000	0.71417	0.956000	0.39512	0.604000	0.37047	2.972000	0.49256	1.792000	0.52537	0.402000	0.26972	AAC		0.607	PRODH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316637.2		NM_016335	
PTPRR	5801	hgsc.bcm.edu	37	12	71092114	71092114	+	Missense_Mutation	SNP	A	A	C			TCGA-CJ-4635-01A-02D-1373-10	TCGA-CJ-4635-11B-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	2504b5cf-c2ff-4d30-8b3f-27e43f862e17	d095c7c8-99bf-4b02-ba05-ace6938b7fa6	g.chr12:71092114A>C	ENST00000283228.2	-	8	1662	c.1210T>G	c.(1210-1212)Ttt>Gtt	p.F404V	PTPRR_ENST00000342084.4_Missense_Mutation_p.F292V|PTPRR_ENST00000440835.2_Missense_Mutation_p.F159V|PTPRR_ENST00000378778.1_Missense_Mutation_p.F198V|PTPRR_ENST00000549308.1_Missense_Mutation_p.F159V	NM_002849.3	NP_002840.2	Q15256	PTPRR_HUMAN	protein tyrosine phosphatase, receptor type, R	404	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				ERBB2 signaling pathway (GO:0038128)|in utero embryonic development (GO:0001701)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(22)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	41			GBM - Glioblastoma multiforme(2;5.67e-07)|Lung(24;0.00283)|OV - Ovarian serous cystadenocarcinoma(12;0.00578)|LUSC - Lung squamous cell carcinoma(43;0.132)	COAD - Colon adenocarcinoma(1;0.136)		GGATCCACAAAGTTCATTGGT	0.338																																																	0													68.0	71.0	70.0					12																	71092114		2203	4300	6503	SO:0001583	missense	5801			D64053	CCDS8998.1, CCDS44945.1, CCDS55847.1, CCDS55848.1	12q15	2011-10-07			ENSG00000153233	ENSG00000153233		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9680	protein-coding gene	gene with protein product		602853		PTPRQ		7557444, 10393441	Standard	NM_002849		Approved	PTPBR7, PTP-SL, EC-PTP, PCPTP1	uc001swi.2	Q15256	OTTHUMG00000169502	ENST00000283228.2:c.1210T>G	12.37:g.71092114A>C	ENSP00000283228:p.Phe404Val		B2R5Z7|B7Z3J1|F5GXR7|O00342|Q92682|Q9UE65	Missense_Mutation	SNP	ENST00000283228.2	37	CCDS8998.1	.	.	.	.	.	.	.	.	.	.	A	21.8	4.203253	0.79127	.	.	ENSG00000153233	ENST00000440835;ENST00000283228;ENST00000378778;ENST00000342084;ENST00000549308;ENST00000550661	T;T;T;T;T;T	0.28454	1.61;1.61;1.61;1.61;1.61;1.61	5.79	5.79	0.91817	Protein-tyrosine phosphatase, receptor/non-receptor type (2);	0.000000	0.53938	D	0.000046	T	0.52354	0.1729	L	0.60845	1.875	0.58432	D	0.999999	D;D;D;D	0.89917	0.999;0.997;1.0;0.999	D;D;D;D	0.85130	0.992;0.988;0.997;0.992	T	0.47535	-0.9110	10	0.40728	T	0.16	-18.5495	16.1323	0.81449	1.0:0.0:0.0:0.0	.	253;292;198;404	B7Z998;F5GXR7;Q15256-4;Q15256	.;.;.;PTPRR_HUMAN	V	159;404;198;292;159;159	ENSP00000391750:F159V;ENSP00000283228:F404V;ENSP00000368054:F198V;ENSP00000339605:F292V;ENSP00000446943:F159V;ENSP00000449616:F159V	ENSP00000283228:F404V	F	-	1	0	PTPRR	69378381	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	6.319000	0.72871	2.223000	0.72356	0.454000	0.30748	TTT		0.338	PTPRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404485.1		NM_002849	
RAB3B	5865	hgsc.bcm.edu;ucsc.edu	37	1	52385647	52385647	+	Silent	SNP	C	C	T			TCGA-CJ-4635-01A-02D-1373-10	TCGA-CJ-4635-11B-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	2504b5cf-c2ff-4d30-8b3f-27e43f862e17	d095c7c8-99bf-4b02-ba05-ace6938b7fa6	g.chr1:52385647C>T	ENST00000371655.3	-	5	824	c.612G>A	c.(610-612)acG>acA	p.T204T		NM_002867.3	NP_002858.2	P20337	RAB3B_HUMAN	RAB3B, member RAS oncogene family	204					antigen processing and presentation (GO:0019882)|GTP catabolic process (GO:0006184)|peptidyl-cysteine methylation (GO:0018125)|positive regulation of dopamine uptake involved in synaptic transmission (GO:0051586)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)|regulation of vesicle size (GO:0097494)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|synaptic vesicle (GO:0008021)|vesicle (GO:0031982)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)			large_intestine(2)|lung(4)|ovary(1)|prostate(1)|skin(1)	9						CCGAGAGACGCGTGTTCTTGG	0.602																																																	0													117.0	94.0	102.0					1																	52385647		2203	4300	6503	SO:0001819	synonymous_variant	5865			BC005035	CCDS560.1	1p32-p31	2008-02-05			ENSG00000169213	ENSG00000169213		"""RAB, member RAS oncogene"""	9778	protein-coding gene	gene with protein product		179510					Standard	NM_002867		Approved		uc001cth.3	P20337	OTTHUMG00000008627	ENST00000371655.3:c.612G>A	1.37:g.52385647C>T			Q5VUL2|Q9BSI1	Silent	SNP	ENST00000371655.3	37	CCDS560.1																																																																																				0.602	RAB3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023816.1		NM_002867	
RGS17	26575	hgsc.bcm.edu;ucsc.edu	37	6	153345485	153345485	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-4635-01A-02D-1373-10	TCGA-CJ-4635-11B-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	2504b5cf-c2ff-4d30-8b3f-27e43f862e17	d095c7c8-99bf-4b02-ba05-ace6938b7fa6	g.chr6:153345485T>C	ENST00000367225.2	-	3	380	c.356A>G	c.(355-357)gAc>gGc	p.D119G	RGS17_ENST00000206262.1_Missense_Mutation_p.D119G			Q9UGC6	RGS17_HUMAN	regulator of G-protein signaling 17	119	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			cervix(2)|endometrium(2)|large_intestine(4)|lung(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	14		Ovarian(120;0.126)		OV - Ovarian serous cystadenocarcinoma(155;1.09e-09)|BRCA - Breast invasive adenocarcinoma(81;0.0429)		CTTCTTTAAGTCTTCACAAGC	0.383																																					Esophageal Squamous(78;500 1236 6775 24364 49058)												0													99.0	92.0	94.0					6																	153345485		2203	4300	6503	SO:0001583	missense	26575			AF202257	CCDS5244.1	6q25-q26	2009-05-29	2007-08-14		ENSG00000091844	ENSG00000091844		"""Regulators of G-protein signaling"""	14088	protein-coding gene	gene with protein product		607191	"""regulator of G-protein signalling 17"""			10419452	Standard	NM_012419		Approved	RGSZ2, RGS-17	uc003qpm.3	Q9UGC6	OTTHUMG00000015858	ENST00000367225.2:c.356A>G	6.37:g.153345485T>C	ENSP00000356194:p.Asp119Gly		Q5TF49|Q8TD61|Q9UJS8	Missense_Mutation	SNP	ENST00000367225.2	37	CCDS5244.1	.	.	.	.	.	.	.	.	.	.	T	24.1	4.493791	0.84962	.	.	ENSG00000091844	ENST00000367225;ENST00000206262	T;T	0.02140	4.43;4.43	6.03	6.03	0.97812	Regulator of G protein signalling (4);Regulator of G protein signalling superfamily (1);	0.090833	0.85682	D	0.000000	T	0.04952	0.0133	M	0.74467	2.265	0.80722	D	1	B	0.34399	0.452	P	0.46975	0.533	T	0.02457	-1.1156	10	0.87932	D	0	-23.4152	16.5655	0.84588	0.0:0.0:0.0:1.0	.	119	Q9UGC6	RGS17_HUMAN	G	119	ENSP00000356194:D119G;ENSP00000206262:D119G	ENSP00000206262:D119G	D	-	2	0	RGS17	153387178	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.007000	0.88571	2.302000	0.77476	0.533000	0.62120	GAC		0.383	RGS17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042773.2			
SGSM1	129049	hgsc.bcm.edu	37	22	25282669	25282669	+	Missense_Mutation	SNP	G	G	C			TCGA-CJ-4635-01A-02D-1373-10	TCGA-CJ-4635-11B-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	2504b5cf-c2ff-4d30-8b3f-27e43f862e17	d095c7c8-99bf-4b02-ba05-ace6938b7fa6	g.chr22:25282669G>C	ENST00000400359.4	+	17	1916	c.1909G>C	c.(1909-1911)Ggg>Cgg	p.G637R	SGSM1_ENST00000400358.4_Missense_Mutation_p.G582R	NM_001039948.2|NM_133454.2	NP_001035037.1|NP_597711.1	Q2NKQ1	SGSM1_HUMAN	small G protein signaling modulator 1	637	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.					Golgi apparatus (GO:0005794)	Rab GTPase activator activity (GO:0005097)			NS(2)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(14)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	41						CTACCAGTTCGGGATGACGGA	0.592																																																	0													24.0	23.0	23.0					22																	25282669		1964	4151	6115	SO:0001583	missense	129049			AB075821	CCDS46674.1, CCDS46675.1, CCDS74834.1	22q11.23	2013-07-09	2007-08-14	2007-08-14	ENSG00000167037	ENSG00000167037		"""Small G protein signaling modulators"""	29410	protein-coding gene	gene with protein product		611417	"""RUN and TBC1 domain containing 2"""	RUTBC2		11853319, 17509819, 22637480	Standard	NM_133454		Approved	KIAA1941	uc003abg.2	Q2NKQ1	OTTHUMG00000150837	ENST00000400359.4:c.1909G>C	22.37:g.25282669G>C	ENSP00000383212:p.Gly637Arg		A5LGW1|A8MUT4|B0QYW0|B0QYW1|B5MEG1|B9A6J4|Q5TFL3|Q8TF60	Missense_Mutation	SNP	ENST00000400359.4	37	CCDS46674.1	.	.	.	.	.	.	.	.	.	.	G	32	5.109264	0.94292	.	.	ENSG00000167037	ENST00000403206;ENST00000400358;ENST00000400359	T;T	0.04049	3.72;3.72	5.85	5.85	0.93711	Rab-GAP/TBC domain (2);	0.044581	0.85682	D	0.000000	T	0.21427	0.0516	M	0.64404	1.975	0.80722	D	1	D;D;D;D	0.89917	1.0;0.998;1.0;1.0	D;D;D;D	0.97110	1.0;0.978;0.99;1.0	T	0.00003	-1.2602	10	0.72032	D	0.01	-20.7051	19.5349	0.95247	0.0:0.0:1.0:0.0	.	582;698;715;637	Q2NKQ1-4;C9J7S8;Q2NKQ1-3;Q2NKQ1	.;.;.;SGSM1_HUMAN	R	698;582;637	ENSP00000383211:G582R;ENSP00000383212:G637R	ENSP00000383211:G582R	G	+	1	0	SGSM1	23612669	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.294000	0.72738	2.941000	0.99782	0.655000	0.94253	GGG		0.592	SGSM1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000320282.1		XM_059318	
SLC9A4	389015	hgsc.bcm.edu;ucsc.edu	37	2	103148953	103148953	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CJ-4635-01A-02D-1373-10	TCGA-CJ-4635-11B-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	2504b5cf-c2ff-4d30-8b3f-27e43f862e17	d095c7c8-99bf-4b02-ba05-ace6938b7fa6	g.chr2:103148953G>T	ENST00000295269.4	+	12	2660	c.2203G>T	c.(2203-2205)Gag>Tag	p.E735*		NM_001011552.3	NP_001011552.2	Q6AI14	SL9A4_HUMAN	solute carrier family 9, subfamily A (NHE4, cation proton antiporter 4), member 4	735					epithelial cell development (GO:0002064)|gastric acid secretion (GO:0001696)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:proton antiporter activity (GO:0015385)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43						AAGCCAAGAAGAGTACTTGGG	0.488																																																	0													93.0	76.0	82.0					2																	103148953		2203	4300	6503	SO:0001587	stop_gained	389015				CCDS33264.1	2q12.1	2013-05-22	2012-03-22		ENSG00000180251	ENSG00000180251		"""Solute carriers"""	11077	protein-coding gene	gene with protein product		600531	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 4"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 4"""			8199403	Standard	NM_001011552		Approved	NHE4	uc002tbz.4	Q6AI14	OTTHUMG00000153093	ENST00000295269.4:c.2203G>T	2.37:g.103148953G>T	ENSP00000295269:p.Glu735*		Q69YK0	Nonsense_Mutation	SNP	ENST00000295269.4	37	CCDS33264.1	.	.	.	.	.	.	.	.	.	.	G	38	7.285073	0.98186	.	.	ENSG00000180251	ENST00000295269	.	.	.	4.89	1.78	0.24846	.	1.222410	0.05433	N	0.546318	.	.	.	.	.	.	0.58432	D	0.999996	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	.	7.3763	0.26831	0.0915:0.3238:0.5847:0.0	.	.	.	.	X	735	.	ENSP00000295269:E735X	E	+	1	0	SLC9A4	102515385	0.098000	0.21812	0.001000	0.08648	0.016000	0.09150	2.150000	0.42254	0.548000	0.28955	0.655000	0.94253	GAG		0.488	SLC9A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329498.1		NM_001011552.3	
SRRM2	23524	hgsc.bcm.edu	37	16	2816400	2816400	+	Silent	SNP	G	G	A			TCGA-CJ-4635-01A-02D-1373-10	TCGA-CJ-4635-11B-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	2504b5cf-c2ff-4d30-8b3f-27e43f862e17	d095c7c8-99bf-4b02-ba05-ace6938b7fa6	g.chr16:2816400G>A	ENST00000301740.8	+	11	6420	c.5871G>A	c.(5869-5871)agG>agA	p.R1957R		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	1957	Arg-rich.|Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						CTCGCAGAAGGTCCAGATCCA	0.567																																																	0													68.0	70.0	70.0					16																	2816400		2198	4300	6498	SO:0001819	synonymous_variant	23524			AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.5871G>A	16.37:g.2816400G>A			A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Silent	SNP	ENST00000301740.8	37	CCDS32373.1																																																																																				0.567	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436411.1			
TARS2	80222	hgsc.bcm.edu;ucsc.edu	37	1	150460370	150460370	+	Missense_Mutation	SNP	C	C	G			TCGA-CJ-4635-01A-02D-1373-10	TCGA-CJ-4635-11B-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	2504b5cf-c2ff-4d30-8b3f-27e43f862e17	d095c7c8-99bf-4b02-ba05-ace6938b7fa6	g.chr1:150460370C>G	ENST00000369064.3	+	2	137	c.103C>G	c.(103-105)Cgg>Ggg	p.R35G	TARS2_ENST00000438568.2_Missense_Mutation_p.R35G|TARS2_ENST00000369054.2_Missense_Mutation_p.R35G|TARS2_ENST00000606933.1_Missense_Mutation_p.R35G	NM_025150.3	NP_079426.2	Q9BW92	SYTM_HUMAN	threonyl-tRNA synthetase 2, mitochondrial (putative)	35					gene expression (GO:0010467)|mitochondrial threonyl-tRNA aminoacylation (GO:0070159)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|threonine-tRNA ligase activity (GO:0004829)			cervix(1)|endometrium(4)|large_intestine(7)|lung(19)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	35	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0757)|all cancers(9;1.51e-21)|BRCA - Breast invasive adenocarcinoma(12;0.000734)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)		L-Threonine(DB00156)	GTTGGCAGAGCGGCTTGGCCT	0.502																																																	0													67.0	73.0	71.0					1																	150460370		2203	4300	6503	SO:0001583	missense	80222			BC007824	CCDS952.1, CCDS60251.1, CCDS60252.1	1q21.2	2012-10-26	2007-02-23	2007-02-23	ENSG00000143374	ENSG00000143374	6.1.1.3	"""Aminoacyl tRNA synthetases / Class II"""	30740	protein-coding gene	gene with protein product	"""threonine tRNA ligase 2, mitochondrial"""	612805	"""threonyl-tRNA synthetase-like 1"""	TARSL1			Standard	NM_001271895		Approved	FLJ12528	uc001euq.4	Q9BW92	OTTHUMG00000012809	ENST00000369064.3:c.103C>G	1.37:g.150460370C>G	ENSP00000358060:p.Arg35Gly		Q53GW7|Q96I50|Q9H9V2	Missense_Mutation	SNP	ENST00000369064.3	37	CCDS952.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.301880	0.81136	.	.	ENSG00000143374	ENST00000438568;ENST00000369054;ENST00000369064;ENST00000369053	.	.	.	5.09	3.01	0.34805	.	0.070681	0.56097	D	0.000031	T	0.68613	0.3020	M	0.69823	2.125	0.46609	D	0.999123	D;D	0.89917	0.999;1.0	D;D	0.85130	0.995;0.997	T	0.72962	-0.4132	9	0.87932	D	0	-12.0086	10.3953	0.44196	0.528:0.472:0.0:0.0	.	35;35	Q9H9V2;Q9BW92	.;SYTM_HUMAN	G	35	.	ENSP00000358049:R35G	R	+	1	2	TARS2	148726994	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	1.247000	0.32815	1.293000	0.44690	0.561000	0.74099	CGG		0.502	TARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000035847.1		NM_025150	
THEG	51298	hgsc.bcm.edu	37	19	362217	362217	+	Missense_Mutation	SNP	G	G	C			TCGA-CJ-4635-01A-02D-1373-10	TCGA-CJ-4635-11B-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	2504b5cf-c2ff-4d30-8b3f-27e43f862e17	d095c7c8-99bf-4b02-ba05-ace6938b7fa6	g.chr19:362217G>C	ENST00000342640.4	-	8	1165	c.1123C>G	c.(1123-1125)Ccc>Gcc	p.P375A	THEG_ENST00000346878.2_Missense_Mutation_p.P351A	NM_016585.4	NP_057669.1	Q9P2T0	THEG_HUMAN	theg spermatid protein	375					cell differentiation (GO:0030154)|chaperone-mediated protein complex assembly (GO:0051131)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)				NS(1)|breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(9)|ovary(1)|prostate(1)|skin(2)|soft_tissue(1)	29		all_cancers(10;1.13e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCAGGCCTGGGTTGATCACAC	0.562																																																	0													169.0	167.0	168.0					19																	362217		2203	4300	6503	SO:0001583	missense	51298			AF268610	CCDS12025.1, CCDS12026.1	19p13.3	2012-02-24	2012-02-24		ENSG00000105549	ENSG00000105549			13706	protein-coding gene	gene with protein product	"""cancer/testis antigen 56"""	609503	"""Theg homolog (mouse)"""			11173852	Standard	NM_016585		Approved	CT56, THEG1	uc002lol.3	Q9P2T0	OTTHUMG00000165491	ENST00000342640.4:c.1123C>G	19.37:g.362217G>C	ENSP00000340088:p.Pro375Ala		A6NMJ8	Missense_Mutation	SNP	ENST00000342640.4	37	CCDS12025.1	.	.	.	.	.	.	.	.	.	.	G	5.775	0.327383	0.10956	.	.	ENSG00000105549	ENST00000342640;ENST00000346878	T;T	0.22539	1.95;2.08	1.73	1.73	0.24493	.	0.682088	0.13299	N	0.398413	T	0.04407	0.0121	N	0.01352	-0.895	0.09310	N	1	P;P	0.38110	0.618;0.618	B;B	0.31101	0.124;0.124	T	0.24440	-1.0160	10	0.05436	T	0.98	-26.5696	6.9747	0.24669	0.0:0.0:1.0:0.0	.	351;375	Q9P2T0-2;Q9P2T0	.;THEG_HUMAN	A	375;351	ENSP00000340088:P375A;ENSP00000264820:P351A	ENSP00000340088:P375A	P	-	1	0	THEG	313217	0.002000	0.14202	0.010000	0.14722	0.005000	0.04900	0.740000	0.26188	1.312000	0.45043	0.650000	0.86243	CCC		0.562	THEG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384431.2			
UNK	85451	hgsc.bcm.edu	37	17	73818637	73818637	+	Silent	SNP	A	A	T			TCGA-CJ-4635-01A-02D-1373-10	TCGA-CJ-4635-11B-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	2504b5cf-c2ff-4d30-8b3f-27e43f862e17	d095c7c8-99bf-4b02-ba05-ace6938b7fa6	g.chr17:73818637A>T	ENST00000589666.1	+	14	2027	c.1917A>T	c.(1915-1917)ctA>ctT	p.L639L	RP11-552F3.4_ENST00000586808.1_RNA|UNK_ENST00000293218.3_Silent_p.L715L	NM_001080419.2	NP_001073888.2	Q9C0B0	UNK_HUMAN	unkempt family zinc finger	639							poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			cervix(3)|endometrium(8)|kidney(2)|large_intestine(5)|lung(3)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	25			all cancers(21;2.61e-06)|Epithelial(20;7.39e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|LUSC - Lung squamous cell carcinoma(166;0.154)			CCGCTTTCCTATCAGGGCCAG	0.612																																																	0													64.0	73.0	70.0					17																	73818637		1948	4137	6085	SO:0001819	synonymous_variant	85451			AB051540	CCDS45778.1, CCDS45778.2	17q25.3	2013-10-17	2013-10-17	2007-02-06		ENSG00000132478		"""Zinc fingers, CCCH-type domain containing"""	29369	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 5"", ""zinc finger CCCH-type containing 5"", ""unkempt homolog (Drosophila)"""	ZC3HDC5, ZC3H5		11214970	Standard	NM_001080419		Approved	KIAA1753	uc021udd.2	Q9C0B0		ENST00000589666.1:c.1917A>T	17.37:g.73818637A>T				Silent	SNP	ENST00000589666.1	37	CCDS45778.2																																																																																				0.612	UNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448835.1		NM_001080419	
ZNF732	654254	hgsc.bcm.edu;ucsc.edu	37	4	265943	265943	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-4635-01A-02D-1373-10	TCGA-CJ-4635-11B-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	2504b5cf-c2ff-4d30-8b3f-27e43f862e17	d095c7c8-99bf-4b02-ba05-ace6938b7fa6	g.chr4:265943A>G	ENST00000419098.1	-	4	713	c.703T>C	c.(703-705)Tcc>Ccc	p.S235P		NM_001137608.1	NP_001131080.1	B4DXR9	ZN732_HUMAN	zinc finger protein 732	235					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|lung(2)	3						AAGTTTGAGGATGTGGTAAAG	0.338																																																	0													80.0	70.0	73.0					4																	265943		692	1591	2283	SO:0001583	missense	654254			AK302099	CCDS46990.1	4p16.3	2014-02-12	2009-07-22		ENSG00000186777	ENSG00000186777		"""Zinc fingers, C2H2-type"", ""-"""	37138	protein-coding gene	gene with protein product							Standard	NM_001137608		Approved	FLJ59067	uc011buu.1	B4DXR9	OTTHUMG00000159883	ENST00000419098.1:c.703T>C	4.37:g.265943A>G	ENSP00000415774:p.Ser235Pro			Missense_Mutation	SNP	ENST00000419098.1	37	CCDS46990.1	.	.	.	.	.	.	.	.	.	.	A	4.901	0.167475	0.09339	.	.	ENSG00000186777	ENST00000419098	T	0.61274	0.12	0.946	-1.48	0.08745	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.35008	0.0917	N	0.20610	0.595	0.09310	N	1	P	0.37781	0.608	B	0.37144	0.242	T	0.24154	-1.0168	9	0.44086	T	0.13	.	3.3894	0.07283	0.4025:0.0:0.0:0.5974	.	235	B4DXR9	ZN732_HUMAN	P	235	ENSP00000415774:S235P	ENSP00000415774:S235P	S	-	1	0	ZNF732	255943	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.077000	0.11394	0.339000	0.23719	0.329000	0.21502	TCC		0.338	ZNF732-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000357937.2		NM_001137608	
