#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ACAN	176	hgsc.bcm.edu	37	15	89398733	89398733	+	Missense_Mutation	SNP	C	C	A			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr15:89398733C>A	ENST00000561243.1	+	11	2917	c.2917C>A	c.(2917-2919)Ctc>Atc	p.L973I	ACAN_ENST00000439576.2_Missense_Mutation_p.L973I|ACAN_ENST00000352105.7_Missense_Mutation_p.L973I|ACAN_ENST00000559004.1_Missense_Mutation_p.L973I			P16112	PGCA_HUMAN	aggrecan	972	29 X 19 AA approximate tandem repeats of E-[IVDG]-[LV]-[EV]-[GTI]-[STA]-[ATV]- [SP]-[GA]-[VIFAD]-[GEDL]-[DE]-[LVI]-[SG]- [GERK]-[LV]-P-S-G.|CS-1.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|extracellular matrix structural constituent (GO:0005201)|hyaluronic acid binding (GO:0005540)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(15)|liver(2)|lung(40)|ovary(2)|prostate(5)|skin(5)|stomach(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	93	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			AGTAGGAGACCTCAGTGGGCT	0.557																																																	0													142.0	146.0	145.0					15																	89398733		1842	4088	5930	SO:0001583	missense	176			M55172	CCDS53970.1, CCDS53971.1	15q26.1	2013-05-07	2007-02-16	2007-02-16	ENSG00000157766	ENSG00000157766		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	319	protein-coding gene	gene with protein product	"""aggrecan proteoglycan"""	155760	"""chondroitin sulfate proteoglycan 1"", ""aggrecan 1"""	MSK16, CSPG1, AGC1		1985970	Standard	NM_013227		Approved	CSPGCP	uc010upo.1	P16112	OTTHUMG00000171989	ENST00000561243.1:c.2917C>A	15.37:g.89398733C>A	ENSP00000453342:p.Leu973Ile		Q13650|Q9UCD3|Q9UCP4|Q9UCP5|Q9UDE0	Missense_Mutation	SNP	ENST00000561243.1	37	CCDS53970.1	.	.	.	.	.	.	.	.	.	.	C	0.013	-1.635073	0.00806	.	.	ENSG00000157766	ENST00000439576;ENST00000352105;ENST00000268134	D;D	0.95788	-3.81;-3.81	4.48	-1.44	0.08856	.	1.458670	0.05162	N	0.497976	D	0.89118	0.6624	N	0.17674	0.51	0.09310	N	1	B;B	0.20887	0.049;0.049	B;B	0.32393	0.109;0.145	T	0.79680	-0.1702	10	0.08599	T	0.76	-2.7456	4.1285	0.10138	0.543:0.2503:0.1224:0.0842	.	973;973	E7ENV9;E7EX88	.;.	I	973	ENSP00000387356:L973I;ENSP00000341615:L973I	ENSP00000268134:L973I	L	+	1	0	ACAN	87199737	0.000000	0.05858	0.000000	0.03702	0.088000	0.18126	-1.178000	0.03093	-0.158000	0.11040	-0.311000	0.09066	CTC		0.557	ACAN-006	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416267.2		NM_001135	
ADORA2B	136	hgsc.bcm.edu	37	17	15878585	15878585	+	Missense_Mutation	SNP	C	C	A			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr17:15878585C>A	ENST00000304222.2	+	2	1260	c.928C>A	c.(928-930)Ctc>Atc	p.L310I	ZSWIM7_ENST00000399280.2_5'Flank	NM_000676.2	NP_000667.1	P29275	AA2BR_HUMAN	adenosine A2b receptor	310					activation of adenylate cyclase activity (GO:0007190)|activation of MAPK activity (GO:0000187)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|cellular defense response (GO:0006968)|cellular response to extracellular stimulus (GO:0031668)|excretion (GO:0007588)|G-protein coupled receptor signaling pathway (GO:0007186)|JNK cascade (GO:0007254)|positive regulation of cGMP biosynthetic process (GO:0030828)|positive regulation of chemokine production (GO:0032722)|positive regulation of chronic inflammatory response to non-antigenic stimulus (GO:0002882)|positive regulation of guanylate cyclase activity (GO:0031284)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation vascular endothelial growth factor production (GO:0010575)|relaxation of vascular smooth muscle (GO:0060087)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled adenosine receptor activity (GO:0001609)	p.L310F(1)		breast(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)	9				UCEC - Uterine corpus endometrioid carcinoma (92;0.0855)	Adenosine(DB00640)|Defibrotide(DB04932)|Enprofylline(DB00824)|Theophylline(DB00277)	CAGGTATCTTCTCTGCCAAGC	0.498																																																	1	Substitution - Missense(1)	ovary(1)											103.0	109.0	107.0					17																	15878585		2203	4300	6503	SO:0001583	missense	136			M97759	CCDS11173.1	17p12	2012-08-08			ENSG00000170425	ENSG00000170425		"""GPCR / Class A : Adenosine receptors"""	264	protein-coding gene	gene with protein product		600446				7558011	Standard	NM_000676		Approved		uc002gpd.1	P29275	OTTHUMG00000059140	ENST00000304222.2:c.928C>A	17.37:g.15878585C>A	ENSP00000304501:p.Leu310Ile			Missense_Mutation	SNP	ENST00000304222.2	37	CCDS11173.1	.	.	.	.	.	.	.	.	.	.	C	12.60	1.986112	0.35036	.	.	ENSG00000170425	ENST00000304222	T	0.37411	1.2	5.79	4.82	0.62117	.	0.000000	0.85682	D	0.000000	T	0.27063	0.0663	L	0.27053	0.805	0.42896	D	0.994211	B	0.22346	0.068	B	0.29440	0.102	T	0.08249	-1.0731	10	0.40728	T	0.16	-13.9349	9.6001	0.39598	0.0:0.7842:0.1416:0.0742	.	310	P29275	AA2BR_HUMAN	I	310	ENSP00000304501:L310I	ENSP00000304501:L310I	L	+	1	0	ADORA2B	15819310	1.000000	0.71417	0.920000	0.36463	0.512000	0.34134	4.280000	0.58959	1.464000	0.47987	-0.253000	0.11424	CTC		0.498	ADORA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131032.1			
AHR	196	hgsc.bcm.edu;ucsc.edu	37	7	17378783	17378783	+	Missense_Mutation	SNP	C	C	T			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr7:17378783C>T	ENST00000242057.4	+	10	1977	c.1334C>T	c.(1333-1335)aCt>aTt	p.T445I	AHR_ENST00000492120.1_3'UTR	NM_001621.4	NP_001612.1	P35869	AHR_HUMAN	aryl hydrocarbon receptor	445					apoptotic process (GO:0006915)|blood vessel development (GO:0001568)|cell cycle (GO:0007049)|circadian regulation of gene expression (GO:0032922)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|regulation of B cell proliferation (GO:0030888)|regulation of gene expression (GO:0010468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to toxic substance (GO:0009636)|response to xenobiotic stimulus (GO:0009410)|transcription from RNA polymerase II promoter (GO:0006366)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosolic aryl hydrocarbon receptor complex (GO:0034752)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer binding (GO:0035326)|Hsp90 protein binding (GO:0051879)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(11)|ovary(1)|pancreas(1)|urinary_tract(3)	33	Lung NSC(10;0.0392)|all_lung(11;0.0754)				Atorvastatin(DB01076)|Flutamide(DB00499)|Ginseng(DB01404)|Leflunomide(DB01097)|Mexiletine(DB00379)|Nimodipine(DB00393)	ACCACATCCACTCTAAGCAAG	0.443																																																	0													123.0	113.0	116.0					7																	17378783		2203	4300	6503	SO:0001583	missense	196			L19872	CCDS5366.1	7p15	2013-05-21			ENSG00000106546	ENSG00000106546		"""Basic helix-loop-helix proteins"""	348	protein-coding gene	gene with protein product		600253				8125016	Standard	NM_001621		Approved	bHLHe76	uc011jxz.1	P35869	OTTHUMG00000149967	ENST00000242057.4:c.1334C>T	7.37:g.17378783C>T	ENSP00000242057:p.Thr445Ile		A4D130|Q13728|Q13803|Q13804	Missense_Mutation	SNP	ENST00000242057.4	37	CCDS5366.1	.	.	.	.	.	.	.	.	.	.	C	3.924	-0.017509	0.07681	.	.	ENSG00000106546	ENST00000242057	T	0.05382	3.45	5.88	4.98	0.66077	.	0.428625	0.23191	N	0.050919	T	0.11495	0.0280	M	0.68317	2.08	0.09310	N	1	P	0.41475	0.751	B	0.41723	0.365	T	0.14392	-1.0474	10	0.21540	T	0.41	.	16.8195	0.85742	0.0:0.8713:0.1287:0.0	.	445	P35869	AHR_HUMAN	I	445	ENSP00000242057:T445I	ENSP00000242057:T445I	T	+	2	0	AHR	17345308	0.000000	0.05858	0.011000	0.14972	0.007000	0.05969	1.073000	0.30691	1.426000	0.47256	0.655000	0.94253	ACT		0.443	AHR-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314620.2		NM_001621	
ANKFY1	51479	hgsc.bcm.edu	37	17	4083152	4083152	+	Missense_Mutation	SNP	G	G	T			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr17:4083152G>T	ENST00000341657.4	-	17	2296	c.2261C>A	c.(2260-2262)cCc>cAc	p.P754H	CYB5D2_ENST00000573984.1_Intron|ANKFY1_ENST00000570535.1_Missense_Mutation_p.P796H|ANKFY1_ENST00000574367.1_Missense_Mutation_p.P755H	NM_016376.3	NP_057460.3	Q9P2R3	ANFY1_HUMAN	ankyrin repeat and FYVE domain containing 1	754	Interaction with RHOD and RAB5A. {ECO:0000269|PubMed:24102721}.				endosomal vesicle fusion (GO:0034058)|endosome localization (GO:0032439)|Golgi to lysosome transport (GO:0090160)|positive regulation of pinocytosis (GO:0048549)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|macropinosome (GO:0044354)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phosphatidylinositol phosphate binding (GO:1901981)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(11)|liver(1)|lung(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32						TGGTTGTCTGGGACTGTTCAC	0.522																																																	0													177.0	181.0	180.0					17																	4083152		1941	4147	6088	SO:0001583	missense	51479			AB033081	CCDS42236.1, CCDS58502.1	17p13.3	2013-01-10			ENSG00000185722	ENSG00000185722		"""Zinc fingers, FYVE domain containing"", ""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	20763	protein-coding gene	gene with protein product		607927				10940552, 17273843	Standard	NM_016376		Approved	ANKHZN, KIAA1255, ZFYVE14, BTBD23	uc002fxn.3	Q9P2R3	OTTHUMG00000177727	ENST00000341657.4:c.2261C>A	17.37:g.4083152G>T	ENSP00000343362:p.Pro754His		A8KA65|Q5RKV4|Q9ULG5	Missense_Mutation	SNP	ENST00000341657.4	37		.	.	.	.	.	.	.	.	.	.	G	19.24	3.788956	0.70337	.	.	ENSG00000185722	ENST00000341657;ENST00000535427	.	.	.	5.35	5.35	0.76521	Ankyrin repeat-containing domain (4);	0.230663	0.46145	D	0.000320	T	0.65281	0.2676	L	0.58302	1.8	0.80722	D	1	D;P;P;P	0.53885	0.963;0.794;0.755;0.904	P;P;B;P	0.53593	0.73;0.478;0.346;0.465	T	0.58092	-0.7697	9	0.16896	T	0.51	-21.8447	18.2323	0.89937	0.0:0.0:1.0:0.0	.	696;754;755;796	F5H754;Q9P2R3;Q9P2R3-2;Q9P2R3-4	.;ANFY1_HUMAN;.;.	H	755;696	.	ENSP00000343362:P755H	P	-	2	0	ANKFY1	4029901	1.000000	0.71417	1.000000	0.80357	0.625000	0.37756	7.384000	0.79751	2.790000	0.95986	0.591000	0.81541	CCC		0.522	ANKFY1-008	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000438702.1		NM_016376	
ARFGEF1	10565	hgsc.bcm.edu;ucsc.edu	37	8	68128844	68128844	+	Missense_Mutation	SNP	G	G	C			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr8:68128844G>C	ENST00000262215.3	-	33	5056	c.4667C>G	c.(4666-4668)cCt>cGt	p.P1556R	ARFGEF1_ENST00000520381.1_Missense_Mutation_p.P1010R|ARFGEF1_ENST00000518230.1_Missense_Mutation_p.P394R	NM_006421.4	NP_006412.2	Q9Y6D6	BIG1_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 1 (brefeldin A-inhibited)	1556					endomembrane system organization (GO:0010256)|exocytosis (GO:0006887)|Golgi organization (GO:0007030)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of Rho GTPase activity (GO:0034259)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein glycosylation in Golgi (GO:0090284)|positive regulation of wound healing (GO:0090303)|protein transport (GO:0015031)|regulation of ARF protein signal transduction (GO:0032012)|regulation of establishment of cell polarity (GO:2000114)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|small nuclear ribonucleoprotein complex (GO:0030532)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|guanyl-nucleotide exchange factor activity (GO:0005085)|myosin binding (GO:0017022)|protein kinase A regulatory subunit binding (GO:0034237)			breast(1)|endometrium(14)|kidney(4)|large_intestine(17)|lung(20)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)			TTCACTTACAGGAGATGGAGG	0.398																																																	0													54.0	58.0	56.0					8																	68128844		2203	4300	6503	SO:0001583	missense	10565			AF084520	CCDS6199.1	8q13	2011-08-18	2011-08-18		ENSG00000066777	ENSG00000066777			15772	protein-coding gene	gene with protein product		604141				10212200, 8917509	Standard	NM_006421		Approved	DKFZP434L057, BIG1, ARFGEP1, p200	uc003xxo.2	Q9Y6D6	OTTHUMG00000164626	ENST00000262215.3:c.4667C>G	8.37:g.68128844G>C	ENSP00000262215:p.Pro1556Arg		Q9NV46|Q9UFV2|Q9UNL0	Missense_Mutation	SNP	ENST00000262215.3	37	CCDS6199.1	.	.	.	.	.	.	.	.	.	.	G	10.58	1.388984	0.25118	.	.	ENSG00000066777	ENST00000520381;ENST00000262215;ENST00000518230	T;T;T	0.40476	1.03;1.03;1.03	5.79	4.91	0.64330	.	0.862209	0.10585	N	0.657500	T	0.25158	0.0611	N	0.14661	0.345	0.24656	N	0.993491	B;B;B	0.14012	0.004;0.009;0.009	B;B;B	0.20184	0.004;0.028;0.028	T	0.28073	-1.0055	10	0.14656	T	0.56	.	7.6323	0.28247	0.0831:0.0:0.7541:0.1628	.	1556;1034;1010	Q9Y6D6;Q59FY5;E5RIF2	BIG1_HUMAN;.;.	R	1010;1556;394	ENSP00000428429:P1010R;ENSP00000262215:P1556R;ENSP00000430891:P394R	ENSP00000262215:P1556R	P	-	2	0	ARFGEF1	68291398	1.000000	0.71417	0.992000	0.48379	0.973000	0.67179	3.506000	0.53364	1.432000	0.47375	0.655000	0.94253	CCT		0.398	ARFGEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379441.4		NM_006421	
ARHGEF17	9828	hgsc.bcm.edu	37	11	73068089	73068089	+	Missense_Mutation	SNP	A	A	T			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr11:73068089A>T	ENST00000263674.3	+	8	4261	c.3911A>T	c.(3910-3912)aAg>aTg	p.K1304M	AP002761.1_ENST00000582555.1_RNA	NM_014786.3	NP_055601.2	Q96PE2	ARHGH_HUMAN	Rho guanine nucleotide exchange factor (GEF) 17	1304					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|skin(2)	32						GGTGGCAAGAAGGACCGGTCT	0.612																																																	0													108.0	87.0	94.0					11																	73068089		2200	4293	6493	SO:0001583	missense	9828			AF378754	CCDS8221.1	11q13.3	2011-11-16			ENSG00000110237	ENSG00000110237		"""Rho guanine nucleotide exchange factors"""	21726	protein-coding gene	gene with protein product	"""Rho-specific guanine-nucleotide exchange factor 164 kDa"", ""tumor endothelial marker 4"""					11559528, 12071859	Standard	NM_014786		Approved	TEM4, KIAA0337, p164-RhoGEF	uc001otu.3	Q96PE2	OTTHUMG00000167971	ENST00000263674.3:c.3911A>T	11.37:g.73068089A>T	ENSP00000263674:p.Lys1304Met		B2RP20|Q86XU2|Q8N2S0|Q9Y4G3	Missense_Mutation	SNP	ENST00000263674.3	37	CCDS8221.1	.	.	.	.	.	.	.	.	.	.	A	19.85	3.903437	0.72754	.	.	ENSG00000110237	ENST00000263674	T	0.37411	1.2	4.8	4.8	0.61643	Pleckstrin homology-type (1);	0.052880	0.85682	D	0.000000	T	0.58652	0.2137	M	0.73217	2.22	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.63492	-0.6625	10	0.87932	D	0	-26.6305	13.6833	0.62499	1.0:0.0:0.0:0.0	.	1304	Q96PE2	ARHGH_HUMAN	M	1304	ENSP00000263674:K1304M	ENSP00000263674:K1304M	K	+	2	0	ARHGEF17	72745737	1.000000	0.71417	1.000000	0.80357	0.745000	0.42441	9.114000	0.94329	2.016000	0.59253	0.402000	0.26972	AAG		0.612	ARHGEF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397365.1		NM_014786	
BLK	640	hgsc.bcm.edu;ucsc.edu	37	8	11415475	11415475	+	Silent	SNP	C	C	T			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr8:11415475C>T	ENST00000259089.4	+	10	1549	c.957C>T	c.(955-957)tgC>tgT	p.C319C	BLK_ENST00000529894.1_Silent_p.C248C|RP11-148O21.2_ENST00000533322.1_RNA|RP11-148O21.4_ENST00000528629.1_RNA	NM_001715.2	NP_001706.2	P51451	BLK_HUMAN	BLK proto-oncogene, Src family tyrosine kinase	319	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				B cell receptor signaling pathway (GO:0050853)|intracellular signal transduction (GO:0035556)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of insulin secretion (GO:0032024)	plasma membrane (GO:0005886)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			endometrium(1)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|skin(4)|stomach(1)	27			STAD - Stomach adenocarcinoma(15;0.00391)	COAD - Colon adenocarcinoma(149;0.207)		TCTTAGGATGCCTGCTGGATT	0.562																																																	0													125.0	105.0	112.0					8																	11415475		2203	4300	6503	SO:0001819	synonymous_variant	640			BC004473	CCDS5982.1	8p23-p22	2014-06-25	2014-06-25		ENSG00000136573	ENSG00000136573		"""SH2 domain containing"""	1057	protein-coding gene	gene with protein product		191305	"""B lymphoid tyrosine kinase"""			7845672	Standard	NM_001715		Approved	MGC10442	uc003wty.3	P51451	OTTHUMG00000090729	ENST00000259089.4:c.957C>T	8.37:g.11415475C>T			Q16291|Q96IN1	Silent	SNP	ENST00000259089.4	37	CCDS5982.1																																																																																				0.562	BLK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207460.1			
BTBD2	55643	hgsc.bcm.edu	37	19	1986502	1986502	+	Silent	SNP	G	G	A			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr19:1986502G>A	ENST00000255608.4	-	9	1579	c.1563C>T	c.(1561-1563)gtC>gtT	p.V521V	AC005306.3_ENST00000587498.1_RNA	NM_017797.3	NP_060267.2	Q9BX70	BTBD2_HUMAN	BTB (POZ) domain containing 2	521						cytoplasmic mRNA processing body (GO:0000932)				endometrium(5)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|stomach(1)	12		Ovarian(11;2.11e-07)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGTAGAAGATGACCTCGGGGA	0.667																																																	0													159.0	108.0	125.0					19																	1986502		2203	4300	6503	SO:0001819	synonymous_variant	55643			AF355797	CCDS12078.1	19p13.3	2013-10-02			ENSG00000133243	ENSG00000133243		"""BTB/POZ domain containing"""	15504	protein-coding gene	gene with protein product		608531				11179693	Standard	XM_005259593		Approved		uc002lup.1	Q9BX70	OTTHUMG00000180017	ENST00000255608.4:c.1563C>T	19.37:g.1986502G>A			O60418|O75248|Q4VBZ1|Q6IAC5|Q7Z5W0|Q96SX8|Q9NPS1|Q9NX81	Silent	SNP	ENST00000255608.4	37	CCDS12078.1																																																																																				0.667	BTBD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449300.2			
C16orf78	123970	hgsc.bcm.edu	37	16	49412406	49412406	+	Missense_Mutation	SNP	A	A	G			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr16:49412406A>G	ENST00000299191.3	+	3	413	c.296A>G	c.(295-297)gAc>gGc	p.D99G		NM_144602.2	NP_653203.1	Q8WTQ4	CP078_HUMAN	chromosome 16 open reading frame 78	99						nucleus (GO:0005634)		p.D99G(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|upper_aerodigestive_tract(1)	22						TTCAGGAAGGACGCCGCCTCC	0.572																																																	1	Substitution - Missense(1)	central_nervous_system(1)											42.0	37.0	39.0					16																	49412406		2199	4300	6499	SO:0001583	missense	123970			BC021181	CCDS10738.1	16q12.1	2008-02-05			ENSG00000166152	ENSG00000166152			28479	protein-coding gene	gene with protein product						12477932	Standard	NM_144602		Approved	MGC33367	uc002efr.3	Q8WTQ4	OTTHUMG00000133149	ENST00000299191.3:c.296A>G	16.37:g.49412406A>G	ENSP00000299191:p.Asp99Gly			Missense_Mutation	SNP	ENST00000299191.3	37	CCDS10738.1	.	.	.	.	.	.	.	.	.	.	A	7.255	0.604063	0.14002	.	.	ENSG00000166152	ENST00000299191	T	0.47528	0.84	3.04	0.627	0.17675	.	1.930630	0.02833	N	0.127039	T	0.33673	0.0871	L	0.27053	0.805	0.09310	N	1	B	0.33807	0.426	B	0.29077	0.098	T	0.18241	-1.0343	9	.	.	.	-5.9787	7.3006	0.26418	0.5015:0.4985:0.0:0.0	.	99	Q8WTQ4	CP078_HUMAN	G	99	ENSP00000299191:D99G	.	D	+	2	0	C16orf78	47969907	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.321000	0.08018	0.092000	0.17331	0.379000	0.24179	GAC		0.572	C16orf78-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256846.1		NM_144602	
C1QA	712	hgsc.bcm.edu	37	1	22965443	22965443	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr1:22965443G>A	ENST00000374642.3	+	3	485	c.281G>A	c.(280-282)cGt>cAt	p.R94H	C1QA_ENST00000402322.1_Missense_Mutation_p.R94H	NM_015991.2	NP_057075.1	P02745	C1QA_HUMAN	complement component 1, q subcomponent, A chain	94	Collagen-like.				cell-cell signaling (GO:0007267)|complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)	collagen trimer (GO:0005581)|complement component C1 complex (GO:0005602)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)				autonomic_ganglia(1)|liver(1)|lung(3)|skin(1)	6		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;6.41e-27)|Colorectal(126;1.52e-07)|COAD - Colon adenocarcinoma(152;1.12e-05)|GBM - Glioblastoma multiforme(114;1.63e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000541)|KIRC - Kidney renal clear cell carcinoma(1967;0.00269)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.197)	Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	CTCGGAGCCCGTGGCATCCCG	0.662																																																	0													13.0	17.0	16.0					1																	22965443		2196	4296	6492	SO:0001583	missense	712			AF135157	CCDS226.1	1p36.3-p34.1	2014-09-17	2006-02-09		ENSG00000173372	ENSG00000173372		"""Complement system"""	1241	protein-coding gene	gene with protein product		120550	"""complement component 1, q subcomponent, alpha polypeptide"""			1537612	Standard	NM_015991		Approved		uc001bfy.3	P02745	OTTHUMG00000002893	ENST00000374642.3:c.281G>A	1.37:g.22965443G>A	ENSP00000363773:p.Arg94His		B2R4X2|Q5T963	Missense_Mutation	SNP	ENST00000374642.3	37	CCDS226.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	7.326|7.326	0.618039|0.618039	0.14129|0.14129	.|.	.|.	ENSG00000173372|ENSG00000173372	ENST00000339353|ENST00000374642;ENST00000438241;ENST00000402322	.|D;D;D	.|0.96104	.|-3.91;-3.91;-3.91	5.48|5.48	-0.322|-0.322	0.12713|0.12713	.|.	.|.	.|.	.|.	.|.	.|D	.|0.90393	.|0.6993	L|L	0.39147|0.39147	1.195|1.195	0.09310|0.09310	N|N	1|1	.|B	.|0.17038	.|0.02	.|B	.|0.17098	.|0.017	.|T	.|0.81274	.|-0.1007	.|9	.|0.54805	.|T	.|0.06	.|.	3.7044|3.7044	0.08394|0.08394	0.4033:0.3686:0.1431:0.085|0.4033:0.3686:0.1431:0.085	.|.	.|94	.|P02745	.|C1QA_HUMAN	.|H	-1|94	.|ENSP00000363773:R94H;ENSP00000416841:R94H;ENSP00000385564:R94H	.|ENSP00000363773:R94H	.|R	+|+	.|2	.|0	C1QA|C1QA	22838030|22838030	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.007000|0.007000	0.05969|0.05969	0.099000|0.099000	0.15210|0.15210	0.044000|0.044000	0.15775|0.15775	-0.254000|-0.254000	0.11334|0.11334	.|CGT		0.662	C1QA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008087.2		NM_015991	
CEP89	84902	hgsc.bcm.edu	37	19	33444682	33444682	+	Nonsense_Mutation	SNP	T	T	A			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr19:33444682T>A	ENST00000305768.5	-	4	419	c.331A>T	c.(331-333)Aga>Tga	p.R111*	CEP89_ENST00000590597.2_Nonsense_Mutation_p.R111*	NM_032816.3	NP_116205.3	Q96ST8	CEP89_HUMAN	centrosomal protein 89kDa	111					cilium assembly (GO:0042384)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary transition fiber (GO:0097539)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)				breast(2)|cervix(1)|endometrium(4)|large_intestine(4)|lung(15)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	35						GAAGATCTTCTTCCCATCTCA	0.408																																																	0													143.0	112.0	122.0					19																	33444682		2203	4300	6503	SO:0001587	stop_gained	0			AL832158	CCDS32987.1	19q13.11	2014-02-20	2011-05-06	2011-05-06		ENSG00000121289			25907	protein-coding gene	gene with protein product		615470	"""coiled-coil domain containing 123"""	CCDC123		16395595	Standard	NM_032816		Approved	FLJ14640	uc002nty.3	Q96ST8		ENST00000305768.5:c.331A>T	19.37:g.33444682T>A	ENSP00000306105:p.Arg111*		B9EGA6|Q8N5J8	Nonsense_Mutation	SNP	ENST00000305768.5	37	CCDS32987.1	.	.	.	.	.	.	.	.	.	.	T	36	5.676359	0.96764	.	.	ENSG00000121289	ENST00000305768	.	.	.	4.97	3.92	0.45320	.	0.482216	0.23793	N	0.044504	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.7577	8.813	0.34978	0.0:0.0:0.1906:0.8094	.	.	.	.	X	111	.	ENSP00000306105:R111X	R	-	1	2	CEP89	38136522	0.001000	0.12720	0.001000	0.08648	0.497000	0.33675	0.648000	0.24828	0.799000	0.34018	0.477000	0.44152	AGA		0.408	CEP89-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451300.2		NM_032816	
CCDC36	339834	hgsc.bcm.edu;ucsc.edu	37	3	49293580	49293580	+	Missense_Mutation	SNP	T	T	C			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr3:49293580T>C	ENST00000438782.1	+	8	886	c.650T>C	c.(649-651)tTt>tCt	p.F217S	CCDC36_ENST00000296449.5_Missense_Mutation_p.F217S|CCDC36_ENST00000452691.2_Missense_Mutation_p.F217S			Q8IYA8	CCD36_HUMAN	coiled-coil domain containing 36	217										endometrium(1)|kidney(2)|large_intestine(3)|liver(1)|lung(3)|ovary(1)|urinary_tract(3)	14				BRCA - Breast invasive adenocarcinoma(193;9.11e-05)|Kidney(197;0.00248)|KIRC - Kidney renal clear cell carcinoma(197;0.00262)		CAAGGAGAGTTTATAGAAATG	0.463																																																	0													112.0	116.0	114.0					3																	49293580		2203	4300	6503	SO:0001583	missense	339834			AK058049	CCDS33755.2	3p21.31	2009-08-06			ENSG00000173421	ENSG00000173421			27945	protein-coding gene	gene with protein product	"""cancer/testis antigen 74"""						Standard	NM_178173		Approved	FLJ25320, CT74	uc011bck.1	Q8IYA8	OTTHUMG00000155920	ENST00000438782.1:c.650T>C	3.37:g.49293580T>C	ENSP00000391788:p.Phe217Ser		C9JJL0|Q05DG9|Q96LP7	Missense_Mutation	SNP	ENST00000438782.1	37	CCDS33755.2	.	.	.	.	.	.	.	.	.	.	T	16.91	3.251904	0.59212	.	.	ENSG00000173421	ENST00000296449;ENST00000438782;ENST00000452691;ENST00000309062	T;T;T	0.15952	2.38;2.38;2.38	5.13	5.13	0.70059	.	0.348665	0.24848	N	0.035115	T	0.26702	0.0653	L	0.32530	0.975	0.58432	D	0.999996	D	0.61080	0.989	P	0.61722	0.893	T	0.01448	-1.1352	10	0.87932	D	0	-4.6869	11.2623	0.49091	0.0:0.0:0.0:1.0	.	217	Q8IYA8	CCD36_HUMAN	S	217;217;217;197	ENSP00000296449:F217S;ENSP00000391788:F217S;ENSP00000407837:F217S	ENSP00000296449:F217S	F	+	2	0	CCDC36	49268584	0.912000	0.30974	0.275000	0.24674	0.760000	0.43138	3.773000	0.55333	2.163000	0.67991	0.482000	0.46254	TTT		0.463	CCDC36-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342332.1		NM_178173	
CCDC74B	91409	hgsc.bcm.edu	37	2	130897218	130897218	+	Silent	SNP	T	T	C	rs13006246	byFrequency	TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr2:130897218T>C	ENST00000310463.6	-	8	1190	c.1053A>G	c.(1051-1053)gcA>gcG	p.A351A	MED15P9_ENST00000427638.1_RNA|CCDC74B_ENST00000409943.3_Silent_p.A285A|CCDC74B_ENST00000392984.3_Silent_p.A453A	NM_207310.2	NP_997193.1	Q96LY2	CC74B_HUMAN	coiled-coil domain containing 74B	351										endometrium(2)|large_intestine(1)|lung(3)	6	Colorectal(110;0.1)					TCTGCTTCAGTGCGGGCAGGA	0.632													.|||	549	0.109625	0.025	0.1873	5008	,	,		16457	0.0288		0.2863	False		,,,				2504	0.0706																0								T		293,4109		9,275,1917	40.0	36.0	37.0		1053	-9.4	0.0	2	dbSNP_121	37	2250,6348		287,1676,2336	no	coding-synonymous	CCDC74B	NM_207310.1		296,1951,4253	CC,CT,TT		26.1689,6.6561,19.5615		351/381	130897218	2543,10457	2201	4299	6500	SO:0001819	synonymous_variant	91409				CCDS2155.1, CCDS58726.1	2q21.1	2006-11-29		2006-02-16	ENSG00000152076	ENSG00000152076			25267	protein-coding gene	gene with protein product							Standard	NM_001258307		Approved	DKFZp434E2321	uc002tqn.2	Q96LY2	OTTHUMG00000131629	ENST00000310463.6:c.1053A>G	2.37:g.130897218T>C			Q6NW18	Silent	SNP	ENST00000310463.6	37	CCDS2155.1	305	0.13965201465201466	16	0.032520325203252036	80	0.22099447513812154	21	0.03671328671328671	188	0.24802110817941952	.	0.207	-1.039639	0.02013	0.066561	0.261689	ENSG00000152076	ENST00000409488	.	.	.	4.68	-9.37	0.00626	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.09310	P	0.999999467645	.	.	.	.	.	.	T	0.16837	-1.0389	4	0.87932	D	0	.	2.0144	0.03495	0.1495:0.3335:0.2059:0.3111	rs13006246	.	.	.	R	245	.	ENSP00000386250:H245R	H	-	2	0	CCDC74B	130613688	0.408000	0.25360	0.005000	0.12908	0.007000	0.05969	-1.147000	0.03188	-3.106000	0.00243	-2.385000	0.00230	CAC		0.632	CCDC74B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254522.3		NM_207310	
CD177	57126	hgsc.bcm.edu	37	19	43860255	43860255	+	RNA	SNP	T	T	G	rs200662237	byFrequency	TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr19:43860255T>G	ENST00000607517.1	+	0	670				CD177_ENST00000378012.2_RNA|CD177_ENST00000378009.4_RNA			Q8N6Q3	CD177_HUMAN	CD177 molecule						blood coagulation (GO:0007596)|leukocyte migration (GO:0050900)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)	5		Prostate(69;0.00682)				AACTGCGATATGAAAGGTGAG	0.582													t|||	4612	0.920927	0.8359	0.9697	5008	,	,		19389	0.9306		0.9523	False		,,,				2504	0.9591																0													4.0	3.0	3.0					19																	43860255		1158	2550	3708			57126			AF146747	CCDS62700.1	19q13.31	2013-10-02	2006-03-28		ENSG00000204936	ENSG00000204936		"""CD molecules"""	30072	protein-coding gene	gene with protein product	"""polycythemia rubra vera 1"""	162860	"""CD177 antigen"""			10753836, 5552408	Standard	NM_020406		Approved	PRV1, HNA2A, NB1	uc002owi.3	Q8N6Q3	OTTHUMG00000185320		19.37:g.43860255T>G			Q711Q2|Q8NCV9|Q96QH1|Q9HDA5	Missense_Mutation	SNP	ENST00000607517.1	37		.	.	.	.	.	.	.	.	.	.	N	2.601	-0.292906	0.05568	.	.	ENSG00000204936	ENST00000378009	T	0.68025	-0.3	3.07	-3.82	0.04281	.	.	.	.	.	T	0.38825	0.1055	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.23261	-1.0193	5	0.20046	T	0.44	.	0.1411	0.00083	0.3043:0.2207:0.1502:0.3248	.	.	.	.	R	205	ENSP00000367248:M205R	ENSP00000367248:M205R	M	+	2	0	CD177	48552095	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.471000	0.06631	-1.046000	0.03246	-1.273000	0.01405	ATG		0.582	CD177-001	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000470162.1		NM_020406	
CDH11	1009	hgsc.bcm.edu;ucsc.edu	37	16	65022084	65022084	+	Missense_Mutation	SNP	C	C	A			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr16:65022084C>A	ENST00000268603.4	-	7	1590	c.975G>T	c.(973-975)caG>caT	p.Q325H	CDH11_ENST00000394156.3_Missense_Mutation_p.Q325H|CDH11_ENST00000566827.1_Missense_Mutation_p.Q199H	NM_001797.2	NP_001788.2	P55287	CAD11_HUMAN	cadherin 11, type 2, OB-cadherin (osteoblast)	325	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|corticospinal tract morphogenesis (GO:0021957)|homophilic cell adhesion (GO:0007156)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(19)|lung(40)|ovary(3)|prostate(3)|skin(2)|urinary_tract(2)	88		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		TCACCCCCTCCTGTGTTTCAT	0.443			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)																														Dom	yes		16	16q22.1	1009	"""cadherin 11, type 2, OB-cadherin (osteoblast)"""		M	0													365.0	305.0	326.0					16																	65022084		2203	4300	6503	SO:0001583	missense	1009			D21255	CCDS10803.1	16q21	2010-01-26			ENSG00000140937	ENSG00000140937		"""Cadherins / Major cadherins"""	1750	protein-coding gene	gene with protein product	"""OB-Cadherin"""	600023				9615235	Standard	NM_001797		Approved	OB, CAD11	uc002eoi.3	P55287	OTTHUMG00000137494	ENST00000268603.4:c.975G>T	16.37:g.65022084C>A	ENSP00000268603:p.Gln325His		A8K5D6|A8MZC8|B7WP28|Q15065|Q15066|Q9UQ93|Q9UQ94	Missense_Mutation	SNP	ENST00000268603.4	37	CCDS10803.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.107447	0.77096	.	.	ENSG00000140937	ENST00000268603;ENST00000394156;ENST00000538390	T;T	0.01767	4.65;4.65	5.65	4.69	0.59074	Cadherin (5);Cadherin-like (1);	0.105172	0.64402	D	0.000003	T	0.09512	0.0234	M	0.74258	2.255	0.58432	D	0.999996	D;D	0.69078	0.997;0.997	P;D	0.70935	0.833;0.971	T	0.00822	-1.1552	10	0.87932	D	0	.	13.971	0.64240	0.0:0.9262:0.0:0.0738	.	325;325	P55287-2;P55287	.;CAD11_HUMAN	H	325;325;308	ENSP00000268603:Q325H;ENSP00000377711:Q325H	ENSP00000268603:Q325H	Q	-	3	2	CDH11	63579585	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	2.100000	0.41777	1.366000	0.46076	0.650000	0.86243	CAG		0.443	CDH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268755.1		NM_033664	
CDH19	28513	hgsc.bcm.edu;ucsc.edu	37	18	64172144	64172144	+	Missense_Mutation	SNP	C	C	G			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr18:64172144C>G	ENST00000262150.2	-	12	2516	c.2224G>C	c.(2224-2226)Gat>Cat	p.D742H		NM_021153.3	NP_066976.1	Q96JQ0	PCD16_HUMAN	cadherin 19, type 2	3156	Cadherin 7. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(22)|ovary(1)|prostate(3)|skin(7)	61		Esophageal squamous(42;0.0132)				TCATCCTGATCAGAGACTGCT	0.458																																																	0													88.0	80.0	83.0					18																	64172144		2203	4300	6503	SO:0001583	missense	28513			AJ007607	CCDS11994.1, CCDS59325.1	18q22.1	2010-01-26			ENSG00000071991	ENSG00000071991		"""Cadherins / Major cadherins"""	1758	protein-coding gene	gene with protein product		603016				10995570	Standard	NM_021153		Approved	CDH7	uc002lkc.2	Q9H159	OTTHUMG00000132802	ENST00000262150.2:c.2224G>C	18.37:g.64172144C>G	ENSP00000262150:p.Asp742His		O15098	Missense_Mutation	SNP	ENST00000262150.2	37	CCDS11994.1	.	.	.	.	.	.	.	.	.	.	C	19.57	3.851937	0.71719	.	.	ENSG00000071991	ENST00000262150	T	0.79033	-1.23	5.1	5.1	0.69264	Cadherin, cytoplasmic domain (1);	0.306175	0.34223	N	0.004143	D	0.89839	0.6831	M	0.88640	2.97	0.80722	D	1	D	0.76494	0.999	D	0.69479	0.964	D	0.91481	0.5204	10	0.66056	D	0.02	.	18.8816	0.92357	0.0:1.0:0.0:0.0	.	742	Q9H159	CAD19_HUMAN	H	742	ENSP00000262150:D742H	ENSP00000262150:D742H	D	-	1	0	CDH19	62323124	0.998000	0.40836	0.262000	0.24481	0.518000	0.34316	3.631000	0.54280	2.521000	0.84997	0.591000	0.81541	GAT		0.458	CDH19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256219.1		NM_021153	
CHGA	1113	hgsc.bcm.edu	37	14	93397681	93397681	+	Missense_Mutation	SNP	G	G	A	rs150244309		TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr14:93397681G>A	ENST00000216492.5	+	6	722	c.442G>A	c.(442-444)Gga>Aga	p.G148R	CHGA_ENST00000334654.4_Intron|CHGA_ENST00000553866.1_3'UTR	NM_001275.3	NP_001266.1	P10645	CMGA_HUMAN	chromogranin A (parathyroid secretory protein 1)	148					regulation of blood pressure (GO:0008217)	extracellular region (GO:0005576)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|secretory granule (GO:0030141)		p.G148R(1)		cervix(1)|large_intestine(1)|lung(3)|skin(3)	8		all_cancers(154;0.0843)		Epithelial(152;0.102)|COAD - Colon adenocarcinoma(157;0.208)|all cancers(159;0.224)		AGCCACAGACGGAGCCAGGCC	0.602													G|||	1	0.000199681	0.0	0.0	5008	,	,		17625	0.001		0.0	False		,,,				2504	0.0				Colon(31;154 822 45066 49155)|NSCLC(28;804 1157 13734 25204)												1	Substitution - Missense(1)	skin(1)											31.0	37.0	35.0					14																	93397681		2203	4300	6503	SO:0001583	missense	1113				CCDS9906.1	14q32	2012-10-02			ENSG00000100604	ENSG00000100604			1929	protein-coding gene	gene with protein product	"""vasostatin"", ""pancreastatin"", ""parastatin"""	118910				3403545	Standard	NM_001275		Approved		uc001ybc.4	P10645		ENST00000216492.5:c.442G>A	14.37:g.93397681G>A	ENSP00000216492:p.Gly148Arg		B2R9E9|Q53FA8|Q6NR84|Q96E84|Q96GL7|Q9BQB5	Missense_Mutation	SNP	ENST00000216492.5	37	CCDS9906.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	11.99	1.804959	0.31961	.	.	ENSG00000100604	ENST00000216492	T	0.01725	4.67	4.52	1.44	0.22558	.	0.529179	0.20896	N	0.083721	T	0.01870	0.0059	L	0.54323	1.7	0.09310	N	1	B	0.32396	0.369	B	0.27500	0.08	T	0.44019	-0.9355	10	0.56958	D	0.05	-0.7663	4.252	0.10700	0.2144:0.1909:0.5947:0.0	.	148	P10645	CMGA_HUMAN	R	148	ENSP00000216492:G148R	ENSP00000216492:G148R	G	+	1	0	CHGA	92467434	0.001000	0.12720	0.001000	0.08648	0.224000	0.24922	0.963000	0.29293	0.467000	0.27218	0.561000	0.74099	GGA		0.602	CHGA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412411.1		NM_001275	
CNN2	1265	hgsc.bcm.edu	37	19	1036169	1036169	+	Missense_Mutation	SNP	T	T	A			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr19:1036169T>A	ENST00000263097.4	+	5	794	c.431T>A	c.(430-432)gTc>gAc	p.V144D	AC011558.5_ENST00000585757.1_RNA|CNN2_ENST00000565096.2_Missense_Mutation_p.V133D|CNN2_ENST00000348419.3_Intron|CNN2_ENST00000606983.1_Intron|CNN2_ENST00000562958.2_Missense_Mutation_p.V165D	NM_004368.2	NP_004359.1	Q99439	CNN2_HUMAN	calponin 2	144					actomyosin structure organization (GO:0031032)|cellular response to mechanical stimulus (GO:0071260)|cytoskeleton organization (GO:0007010)|hemopoiesis (GO:0030097)|negative regulation of cell migration (GO:0030336)|negative regulation of phagocytosis (GO:0050765)|positive regulation of gene expression (GO:0010628)|regulation of actin filament-based process (GO:0032970)|regulation of cell proliferation (GO:0042127)|wound healing (GO:0042060)	cell-cell junction (GO:0005911)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|stress fiber (GO:0001725)	actin binding (GO:0003779)			endometrium(1)|large_intestine(2)|lung(3)|prostate(1)|skin(3)	10		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GACATTGGCGTCAAGTACTCG	0.642																																																	0													44.0	40.0	41.0					19																	1036169		2203	4300	6503	SO:0001583	missense	1265			D83735	CCDS12053.1, CCDS12054.1	19p13.3	2011-02-18			ENSG00000064666	ENSG00000064666			2156	protein-coding gene	gene with protein product		602373				8889829	Standard	NM_004368		Approved		uc002lqu.3	Q99439		ENST00000263097.4:c.431T>A	19.37:g.1036169T>A	ENSP00000263097:p.Val144Asp		A5D8U8|A6NFI4|D6W5X9|Q92578	Missense_Mutation	SNP	ENST00000263097.4	37	CCDS12053.1	.	.	.	.	.	.	.	.	.	.	T	15.62	2.888189	0.52014	.	.	ENSG00000064666	ENST00000263097;ENST00000442531	T	0.64618	-0.11	4.67	4.67	0.58626	Calponin homology domain (2);	0.071555	0.56097	U	0.000039	T	0.63153	0.2487	M	0.80982	2.52	0.80722	D	1	B;B;B	0.19445	0.036;0.007;0.004	B;B;B	0.16289	0.01;0.015;0.003	T	0.63726	-0.6572	10	0.46703	T	0.11	.	12.018	0.53326	0.0:0.0:0.0:1.0	.	165;133;144	B4DUT8;B4DDF4;Q99439	.;.;CNN2_HUMAN	D	144;123	ENSP00000263097:V144D	ENSP00000263097:V144D	V	+	2	0	CNN2	987169	1.000000	0.71417	0.849000	0.33467	0.811000	0.45836	7.418000	0.80167	1.730000	0.51580	0.459000	0.35465	GTC		0.642	CNN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000420293.3		NM_004368	
CHST8	64377	hgsc.bcm.edu	37	19	34180263	34180263	+	Silent	SNP	G	G	A			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr19:34180263G>A	ENST00000262622.4	+	2	854	c.96G>A	c.(94-96)caG>caA	p.Q32Q	CHST8_ENST00000604556.1_3'UTR|CHST8_ENST00000438847.3_Silent_p.Q32Q|CHST8_ENST00000434302.1_Silent_p.Q32Q	NM_022467.3	NP_071912.2	Q9H2A9	CHST8_HUMAN	carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 8	32					carbohydrate biosynthetic process (GO:0016051)|central nervous system development (GO:0007417)|hormone biosynthetic process (GO:0042446)|proteoglycan biosynthetic process (GO:0030166)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	N-acetylgalactosamine 4-O-sulfotransferase activity (GO:0001537)			NS(1)|endometrium(3)|kidney(2)|large_intestine(4)|liver(2)|lung(8)|ovary(1)|prostate(1)|skin(5)	27	Esophageal squamous(110;0.162)					TCAGCCTGCAGGACCCTACGG	0.637																																																	0													92.0	92.0	92.0					19																	34180263		2203	4300	6503	SO:0001819	synonymous_variant	64377			AB047801	CCDS12433.1	19q13.1	2008-02-05				ENSG00000124302		"""Sulfotransferases, membrane-bound"""	15993	protein-coding gene	gene with protein product		610190				10988300, 11001942	Standard	NM_001127895		Approved	GALNAC-4-ST1	uc002nut.4	Q9H2A9		ENST00000262622.4:c.96G>A	19.37:g.34180263G>A			Q9H3N2	Silent	SNP	ENST00000262622.4	37	CCDS12433.1																																																																																				0.637	CHST8-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451453.1		NM_022467	
CNPY2	10330	hgsc.bcm.edu;ucsc.edu	37	12	56705186	56705186	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr12:56705186G>A	ENST00000273308.4	-	4	757	c.217C>T	c.(217-219)Cgc>Tgc	p.R73C	RP11-977G19.11_ENST00000549860.1_RNA|RP11-977G19.11_ENST00000549565.1_RNA|RP11-977G19.10_ENST00000549318.1_Missense_Mutation_p.R73C|CNPY2_ENST00000551720.1_Intron|RP11-977G19.12_ENST00000546789.1_RNA	NM_014255.5	NP_055070.1	Q9Y2B0	CNPY2_HUMAN	canopy FGF signaling regulator 2	73	Saposin B-type. {ECO:0000255|PROSITE- ProRule:PRU00415}.				negative regulation of gene expression (GO:0010629)|positive regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045716)|regulation of low-density lipoprotein particle clearance (GO:0010988)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)				large_intestine(2)|lung(2)	4						GCCTCTGAGCGGGCATAAGGC	0.478																																																	0													108.0	107.0	108.0					12																	56705186		2203	4300	6503	SO:0001583	missense	10330			AB015631	CCDS8914.1	12q15	2013-07-23	2013-07-23	2007-10-22		ENSG00000257727			13529	protein-coding gene	gene with protein product		605861	"""transmembrane protein 4"", ""canopy 2 homolog (zebrafish)"""	TMEM4		10072769, 15905959	Standard	NM_001190991		Approved	HP10390, ZSIG9, Cnpy2	uc001sku.2	Q9Y2B0	OTTHUMG00000170330	ENST00000273308.4:c.217C>T	12.37:g.56705186G>A	ENSP00000273308:p.Arg73Cys		B2R7B9|Q9UHE9	Missense_Mutation	SNP	ENST00000273308.4	37	CCDS8914.1	.	.	.	.	.	.	.	.	.	.	G	19.45	3.829476	0.71258	.	.	ENSG00000144785;ENSG00000257727;ENSG00000257727;ENSG00000257727	ENST00000549318;ENST00000273308;ENST00000551475;ENST00000551286	T;T;T;T	0.38077	1.16;1.16;1.16;1.16	5.13	5.13	0.70059	Saposin B (1);	0.000000	0.85682	D	0.000000	T	0.62085	0.2399	M	0.84683	2.71	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.66638	-0.5873	10	0.66056	D	0.02	-11.3518	11.487	0.50358	0.0:0.0:0.7126:0.2874	.	73	Q9Y2B0	CNPY2_HUMAN	C	73;73;73;21	ENSP00000446743:R73C;ENSP00000273308:R73C;ENSP00000448809:R73C;ENSP00000446784:R21C	ENSP00000273308:R73C	R	-	1	0	RP11-977G19.10;CNPY2	54991453	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.550000	0.60733	2.578000	0.87016	0.561000	0.74099	CGC		0.478	CNPY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408546.1		NM_014255	
CT47B1	643311	hgsc.bcm.edu	37	X	120008791	120008791	+	Missense_Mutation	SNP	G	G	T			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chrX:120008791G>T	ENST00000371311.3	-	1	988	c.734C>A	c.(733-735)gCc>gAc	p.A245D		NM_001145718.1	NP_001139190.1	P0C2W7	CT47B_HUMAN	cancer/testis antigen family 47, member B1	245										breast(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|lung(9)|ovary(1)|skin(1)	22						TTCCTCTGCGGCCGGTtcctc	0.692																																																	0													48.0	43.0	45.0					X																	120008791		692	1589	2281	SO:0001583	missense	643311				CCDS48161.1	Xq24	2014-05-06	2011-03-24		ENSG00000236446	ENSG00000236446			33293	protein-coding gene	gene with protein product	"""cancer/testis CT47 family, member 13"""	300790				16382448	Standard	NM_001145718		Approved	CT47.13	uc011muc.2	P0C2W7	OTTHUMG00000187483	ENST00000371311.3:c.734C>A	X.37:g.120008791G>T	ENSP00000360360:p.Ala245Asp		A6NM97	Missense_Mutation	SNP	ENST00000371311.3	37	CCDS48161.1	.	.	.	.	.	.	.	.	.	.	G	2.066	-0.414207	0.04766	.	.	ENSG00000236446	ENST00000371311	.	.	.	1.59	-3.17	0.05202	.	.	.	.	.	T	0.23289	0.0563	L	0.29908	0.895	0.09310	N	1	B	0.14438	0.01	B	0.06405	0.002	T	0.15809	-1.0424	8	0.39692	T	0.17	.	1.9656	0.03395	0.3048:0.0:0.3337:0.3615	.	245	P0C2W7	CT47B_HUMAN	D	245	.	ENSP00000360360:A245D	A	-	2	0	CT47B1	119892819	0.000000	0.05858	0.000000	0.03702	0.060000	0.15804	-0.562000	0.05950	-1.075000	0.03129	0.171000	0.16805	GCC		0.692	CT47B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058121.1		NM_001145718	
CT47B1	643311	hgsc.bcm.edu;ucsc.edu	37	X	120009118	120009118	+	Missense_Mutation	SNP	T	T	G			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chrX:120009118T>G	ENST00000371311.3	-	1	661	c.407A>C	c.(406-408)tAt>tCt	p.Y136S		NM_001145718.1	NP_001139190.1	P0C2W7	CT47B_HUMAN	cancer/testis antigen family 47, member B1	136										breast(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|lung(9)|ovary(1)|skin(1)	22						GTCGTTGTGATAGAGGCGGCG	0.657																																																	0													125.0	117.0	119.0					X																	120009118		692	1590	2282	SO:0001583	missense	643311				CCDS48161.1	Xq24	2014-05-06	2011-03-24		ENSG00000236446	ENSG00000236446			33293	protein-coding gene	gene with protein product	"""cancer/testis CT47 family, member 13"""	300790				16382448	Standard	NM_001145718		Approved	CT47.13	uc011muc.2	P0C2W7	OTTHUMG00000187483	ENST00000371311.3:c.407A>C	X.37:g.120009118T>G	ENSP00000360360:p.Tyr136Ser		A6NM97	Missense_Mutation	SNP	ENST00000371311.3	37	CCDS48161.1	.	.	.	.	.	.	.	.	.	.	T	7.946	0.743746	0.15642	.	.	ENSG00000236446	ENST00000371311	.	.	.	2.01	-4.03	0.04021	.	.	.	.	.	T	0.16981	0.0408	N	0.20986	0.625	0.09310	N	1	B	0.17038	0.02	B	0.18871	0.023	T	0.21621	-1.0240	8	0.25106	T	0.35	.	0.9819	0.01438	0.1991:0.1642:0.398:0.2387	.	136	P0C2W7	CT47B_HUMAN	S	136	.	ENSP00000360360:Y136S	Y	-	2	0	CT47B1	119893146	0.000000	0.05858	0.000000	0.03702	0.121000	0.20230	-0.030000	0.12308	-1.523000	0.01767	0.143000	0.16000	TAT		0.657	CT47B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058121.1		NM_001145718	
CYFIP1	23191	hgsc.bcm.edu	37	15	22926030	22926030	+	Missense_Mutation	SNP	A	A	G			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr15:22926030A>G	ENST00000313077.7	+	3	297	c.172A>G	c.(172-174)Aga>Gga	p.R58G	CYFIP1_ENST00000560848.1_Missense_Mutation_p.R58G	NM_014608.2	NP_055423.1			cytoplasmic FMR1 interacting protein 1											endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|liver(1)|lung(14)|ovary(4)|pancreas(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	40		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.22e-06)|Epithelial(43;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00101)		TGGCATCGCAAGATACATTGA	0.443																																																	0													145.0	128.0	134.0					15																	22926030		2203	4300	6503	SO:0001583	missense	23191			D38549	CCDS73695.1, CCDS73696.1	15q11	2008-07-18			ENSG00000068793	ENSG00000273749			13759	protein-coding gene	gene with protein product	"""selective hybridizing clone"", ""cytoplasmic FMRP interacting protein 1"""	606322				11438699	Standard	XM_005272543		Approved	KIAA0068, P140SRA-1, SHYC	uc001yus.3	Q7L576	OTTHUMG00000129100	ENST00000313077.7:c.172A>G	15.37:g.22926030A>G	ENSP00000324549:p.Arg58Gly			Missense_Mutation	SNP	ENST00000313077.7	37	CCDS10009.1	.	.	.	.	.	.	.	.	.	.	A	13.73	2.322895	0.41096	.	.	ENSG00000068793	ENST00000313077	T	0.46451	0.87	5.29	4.13	0.48395	.	0.000000	0.85682	D	0.000000	T	0.37865	0.1019	L	0.46157	1.445	0.80722	D	1	B	0.19200	0.034	B	0.19946	0.027	T	0.23154	-1.0196	10	0.72032	D	0.01	.	12.4125	0.55476	0.8593:0.1407:0.0:0.0	.	58	Q7L576	CYFP1_HUMAN	G	58	ENSP00000324549:R58G	ENSP00000324549:R58G	R	+	1	2	CYFIP1	20477471	0.975000	0.34042	0.963000	0.40424	0.700000	0.40528	2.517000	0.45529	0.921000	0.36994	0.459000	0.35465	AGA		0.443	CYFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251136.2		NM_014608	
DHX36	170506	hgsc.bcm.edu;ucsc.edu	37	3	154018902	154018902	+	Missense_Mutation	SNP	T	T	C			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr3:154018902T>C	ENST00000496811.1	-	10	1312	c.1232A>G	c.(1231-1233)cAa>cGa	p.Q411R	DHX36_ENST00000308361.6_Missense_Mutation_p.Q411R|DHX36_ENST00000329463.5_Missense_Mutation_p.Q411R|DHX36_ENST00000544526.1_Missense_Mutation_p.Q411R	NM_020865.2	NP_065916.2	Q9H2U1	DHX36_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 36	411					ATP catabolic process (GO:0006200)|innate immune response (GO:0045087)|ossification (GO:0001503)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|RNA secondary structure unwinding (GO:0010501)|transcription, DNA-templated (GO:0006351)	chromosome, telomeric region (GO:0000781)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|core promoter binding (GO:0001047)|DNA-dependent ATPase activity (GO:0008094)|double-stranded RNA binding (GO:0003725)|G-quadruplex DNA binding (GO:0051880)|G-quadruplex RNA binding (GO:0002151)|histone deacetylase binding (GO:0042826)|poly(A) RNA binding (GO:0044822)|transcription regulatory region DNA binding (GO:0044212)			endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(7)|lung(11)|prostate(2)|skin(1)|urinary_tract(1)	35			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			GTGTTCTTTTTGTTCTGGAAC	0.303																																																	0													73.0	75.0	74.0					3																	154018902		2203	4299	6502	SO:0001583	missense	170506			AF217190	CCDS3171.1, CCDS54657.1	3q25.2	2012-09-20	2003-06-13	2003-06-20	ENSG00000174953	ENSG00000174953		"""DEAH-boxes"""	14410	protein-coding gene	gene with protein product		612767	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 36"""	DDX36			Standard	NM_020865		Approved	MLEL1, KIAA1488	uc003ezy.4	Q9H2U1	OTTHUMG00000159109	ENST00000496811.1:c.1232A>G	3.37:g.154018902T>C	ENSP00000417078:p.Gln411Arg		B2RB00|Q70JU3|Q8IYE5|Q9P240	Missense_Mutation	SNP	ENST00000496811.1	37	CCDS3171.1	.	.	.	.	.	.	.	.	.	.	T	14.25	2.479924	0.44044	.	.	ENSG00000174953	ENST00000496811;ENST00000308361;ENST00000544526;ENST00000329463;ENST00000481941	T;T;T;T;T	0.13420	2.59;2.59;2.59;2.59;2.59	5.89	4.74	0.60224	.	0.290348	0.42172	D	0.000760	T	0.06962	0.0177	N	0.10707	0.03	0.31627	N	0.649486	B;B;B	0.14012	0.001;0.009;0.005	B;B;B	0.14578	0.002;0.011;0.005	T	0.14364	-1.0475	10	0.19147	T	0.46	.	11.402	0.49875	0.0:0.07:0.0:0.93	.	411;411;411	Q9H2U1-2;Q9H2U1-3;Q9H2U1	.;.;DHX36_HUMAN	R	411;411;411;411;325	ENSP00000417078:Q411R;ENSP00000309296:Q411R;ENSP00000444247:Q411R;ENSP00000330113:Q411R;ENSP00000419862:Q325R	ENSP00000309296:Q411R	Q	-	2	0	DHX36	155501596	1.000000	0.71417	0.997000	0.53966	0.945000	0.59286	4.842000	0.62831	2.250000	0.74265	0.455000	0.32223	CAA		0.303	DHX36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353349.1		NM_020865	
DPY19L2	283417	hgsc.bcm.edu	37	12	64062052	64062052	+	Missense_Mutation	SNP	G	G	A	rs10878074	byFrequency	TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr12:64062052G>A	ENST00000324472.4	-	1	305	c.122C>T	c.(121-123)gCc>gTc	p.A41V	RP11-415I12.3_ENST00000509615.2_RNA	NM_173812.4	NP_776173.3	Q6NUT2	D19L2_HUMAN	dpy-19-like 2 (C. elegans)	41			A -> V (in dbSNP:rs10878074). {ECO:0000269|PubMed:12975309, ECO:0000269|PubMed:15489334}.		multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|nuclear inner membrane (GO:0005637)|nucleus (GO:0005634)	transferase activity, transferring glycosyl groups (GO:0016757)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(19)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	45			GBM - Glioblastoma multiforme(1;2.77e-05)	GBM - Glioblastoma multiforme(28;0.044)		GCCGCCTAGGGCCGACTTTTC	0.657													G|||	1979	0.395168	0.4425	0.2565	5008	,	,		14964	0.5714		0.1978	False		,,,				2504	0.4509																0								G	VAL/ALA	1679,2717		309,1061,828	32.0	41.0	38.0		122	-0.6	0.0	12	dbSNP_120	38	1704,6888		179,1346,2771	yes	missense	DPY19L2	NM_173812.4	64	488,2407,3599	AA,AG,GG		19.8324,38.1938,26.0471	benign	41/759	64062052	3383,9605	2198	4296	6494	SO:0001583	missense	283417				CCDS31851.1	12q14.2	2012-11-14			ENSG00000177990	ENSG00000177990			19414	protein-coding gene	gene with protein product	"""spermatogenesis associated 34"""	613893				12975309	Standard	XM_006719348		Approved	FLJ32949, SPATA34	uc001srp.1	Q6NUT2	OTTHUMG00000168712	ENST00000324472.4:c.122C>T	12.37:g.64062052G>A	ENSP00000315988:p.Ala41Val		A4FVC1|B4E191|Q3ZCX2|Q6UWG8|Q96LZ9	Missense_Mutation	SNP	ENST00000324472.4	37	CCDS31851.1	766	0.3507326007326007	189	0.38414634146341464	99	0.27348066298342544	330	0.5769230769230769	148	0.19525065963060687	G	4.869	0.161472	0.09287	0.381938	0.198324	ENSG00000177990	ENST00000324472;ENST00000542209	T;T	0.39787	1.06;1.82	1.61	-0.623	0.11556	.	0.555051	0.14868	N	0.293715	T	0.00012	0.0000	N	0.19112	0.55	0.58432	P	1.0000000000287557E-6	B	0.10296	0.003	B	0.04013	0.001	T	0.44937	-0.9295	8	.	.	.	.	2.4499	0.04516	0.2454:0.3274:0.4272:0.0	rs10878074	41	Q6NUT2	D19L2_HUMAN	V	41	ENSP00000315988:A41V;ENSP00000444932:A41V	.	A	-	2	0	DPY19L2	62348319	0.001000	0.12720	0.000000	0.03702	0.003000	0.03518	0.946000	0.29069	-0.190000	0.10465	0.195000	0.17529	GCC		0.657	DPY19L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400689.2		NM_173812	
DPYSL3	1809	hgsc.bcm.edu;ucsc.edu	37	5	146780285	146780285	+	Missense_Mutation	SNP	C	C	A			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr5:146780285C>A	ENST00000398514.3	-	10	1451	c.1080G>T	c.(1078-1080)gaG>gaT	p.E360D	CTB-108O6.2_ENST00000607270.1_RNA|DPYSL3_ENST00000343218.5_Missense_Mutation_p.E474D|DPYSL3_ENST00000534907.1_Intron	NM_001387.2	NP_001378.1	Q14195	DPYL3_HUMAN	dihydropyrimidinase-like 3	360					actin crosslink formation (GO:0051764)|actin filament bundle assembly (GO:0051017)|axon guidance (GO:0007411)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cell migration (GO:0030336)|negative regulation of neuron projection development (GO:0010977)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of neuron projection development (GO:0010976)|protein homooligomerization (GO:0051260)|pyrimidine nucleobase catabolic process (GO:0006208)|response to axon injury (GO:0048678)	cell body (GO:0044297)|cytosol (GO:0005829)|extracellular space (GO:0005615)|filamentous actin (GO:0031941)|growth cone (GO:0030426)|lamellipodium (GO:0030027)	chondroitin sulfate binding (GO:0035374)|hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)|SH3 domain binding (GO:0017124)			breast(2)|endometrium(1)|kidney(4)|large_intestine(6)|liver(1)|lung(9)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGACATCCGCTCCTCCACAC	0.567																																																	0													114.0	120.0	118.0					5																	146780285		2203	4300	6503	SO:0001583	missense	1809			D78014	CCDS43381.1, CCDS56387.1	5q32	2008-02-05							3015	protein-coding gene	gene with protein product		601168				8973361, 9115293	Standard	NM_001197294		Approved	DRP-3, ULIP, CRMP4	uc003loo.3	Q14195		ENST00000398514.3:c.1080G>T	5.37:g.146780285C>A	ENSP00000381526:p.Glu360Asp		B3SXQ8|Q93012	Missense_Mutation	SNP	ENST00000398514.3	37	CCDS43381.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.11|11.11	1.542608|1.542608	0.27563|0.27563	.|.	.|.	ENSG00000113657|ENSG00000113657	ENST00000520473|ENST00000398514;ENST00000343218	.|D;D	.|0.89939	.|-2.59;-2.59	5.53|5.53	5.53|5.53	0.82687|0.82687	.|Amidohydrolase 1 (1);Metal-dependent hydrolase, composite domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.87577|0.87577	0.6212|0.6212	L|L	0.33189|0.33189	0.99|0.99	0.80722|0.80722	D|D	1|1	.|D;B	.|0.69078	.|0.997;0.038	.|D;B	.|0.76575	.|0.988;0.036	T|T	0.82744|0.82744	-0.0306|-0.0306	5|10	.|0.02654	.|T	.|1	-3.753|-3.753	7.5424|7.5424	0.27746|0.27746	0.0:0.8018:0.0:0.1982|0.0:0.8018:0.0:0.1982	.|.	.|474;360	.|B3SXQ8;Q14195	.|.;DPYL3_HUMAN	S|D	59|360;474	.|ENSP00000381526:E360D;ENSP00000343690:E474D	.|ENSP00000343690:E474D	A|E	-|-	1|3	0|2	DPYSL3|DPYSL3	146760478|146760478	0.998000|0.998000	0.40836|0.40836	1.000000|1.000000	0.80357|0.80357	0.935000|0.935000	0.57460|0.57460	0.627000|0.627000	0.24506|0.24506	2.761000|2.761000	0.94854|0.94854	0.650000|0.650000	0.86243|0.86243	GCG|GAG		0.567	DPYSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373421.2		NM_001387	
ERVFRD-1	405754	hgsc.bcm.edu	37	6	11105465	11105465	+	Missense_Mutation	SNP	T	T	C			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr6:11105465T>C	ENST00000472091.1	-	2	454	c.79A>G	c.(79-81)Aaa>Gaa	p.K27E	SMIM13_ENST00000416247.2_Intron|ERVFRD-1_ENST00000542862.1_Missense_Mutation_p.K27E	NM_207582.2	NP_997465.1	P60508	SYCY2_HUMAN	endogenous retrovirus group FRD, member 1	27					syncytium formation (GO:0006949)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|viral envelope (GO:0019031)		p.K27E(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|ovary(4)|stomach(1)	15						TGCTGAGCTTTTTCCAATAAC	0.507																																																	1	Substitution - Missense(1)	ovary(1)											59.0	60.0	59.0					6																	11105465		2203	4300	6503	SO:0001583	missense	0			AK075092, AK123938, AY358244	CCDS4519.1	6p24.2	2014-05-02			ENSG00000244476	ENSG00000244476			33823	other	endogenous retrovirus		610524				12970426, 14557543, 15476554, 21542922	Standard	NM_207582		Approved	HERV-W/FRD, HERV-FRD, envFRD, ERVFRDE1, syncytin-2	uc003mzt.3	P60508	OTTHUMG00000159193	ENST00000472091.1:c.79A>G	6.37:g.11105465T>C	ENSP00000420174:p.Lys27Glu			Missense_Mutation	SNP	ENST00000472091.1	37	CCDS4519.1	.	.	.	.	.	.	.	.	.	.	T	13.94	2.386946	0.42308	.	.	ENSG00000244476	ENST00000472091;ENST00000542862	T;T	0.15372	2.43;2.43	0.235	0.235	0.15431	.	.	.	.	.	T	0.02267	0.0070	N	0.14661	0.345	0.19575	N	0.999966	P	0.38110	0.618	B	0.25759	0.063	T	0.39482	-0.9612	8	0.62326	D	0.03	.	.	.	.	.	27	P60508	EFRD1_HUMAN	E	27	ENSP00000420174:K27E;ENSP00000444461:K27E	ENSP00000420174:K27E	K	-	1	0	ERVFRD-1	11213451	0.763000	0.28462	0.735000	0.30896	0.740000	0.42216	0.310000	0.19356	0.263000	0.21812	0.260000	0.18958	AAA		0.507	ERVFRD-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353776.1		NM_207582	
EXPH5	23086	hgsc.bcm.edu	37	11	108385374	108385374	+	Missense_Mutation	SNP	A	A	G			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr11:108385374A>G	ENST00000265843.4	-	6	970	c.860T>C	c.(859-861)tTt>tCt	p.F287S	EXPH5_ENST00000524840.1_5'UTR|EXPH5_ENST00000525344.1_Missense_Mutation_p.F280S|EXPH5_ENST00000443411.1_Missense_Mutation_p.F99S|EXPH5_ENST00000428840.1_Missense_Mutation_p.F211S	NM_015065.2	NP_055880	Q8NEV8	EXPH5_HUMAN	exophilin 5	287					intracellular protein transport (GO:0006886)|keratinocyte development (GO:0003334)|multivesicular body sorting pathway (GO:0071985)|positive regulation of exocytosis (GO:0045921)|positive regulation of protein secretion (GO:0050714)	endosome (GO:0005768)	Rab GTPase binding (GO:0017137)	p.F287S(1)		breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(13)|liver(1)|lung(34)|ovary(3)|pancreas(2)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(1)	91		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)		CCTAGGAGAAAAGGTTTTAAA	0.363																																																	1	Substitution - Missense(1)	ovary(1)											95.0	90.0	92.0					11																	108385374		2201	4298	6499	SO:0001583	missense	23086				CCDS8341.1	11q22.3	2008-02-05			ENSG00000110723	ENSG00000110723			30578	protein-coding gene	gene with protein product	"""synaptotagmin-like homologue lacking C2 domains b"""	612878				9734811, 11773082	Standard	NM_015065		Approved	SLAC2-B	uc001pkk.3	Q8NEV8	OTTHUMG00000166536	ENST00000265843.4:c.860T>C	11.37:g.108385374A>G	ENSP00000265843:p.Phe287Ser		Q2KHM1|Q9Y4D6	Missense_Mutation	SNP	ENST00000265843.4	37	CCDS8341.1	.	.	.	.	.	.	.	.	.	.	A	17.73	3.460487	0.63401	.	.	ENSG00000110723	ENST00000265843;ENST00000428840;ENST00000443411;ENST00000525344;ENST00000439956;ENST00000526312;ENST00000533052	T;T;T;T;T;T	0.06294	3.92;3.83;3.69;3.92;3.73;3.32	5.67	5.67	0.87782	.	0.105878	0.42548	D	0.000685	T	0.19446	0.0467	M	0.69823	2.125	0.31610	N	0.651609	D	0.89917	1.0	D	0.85130	0.997	T	0.26710	-1.0095	10	0.66056	D	0.02	-20.0778	5.0773	0.14638	0.708:0.1762:0.1158:0.0	.	287	Q8NEV8	EXPH5_HUMAN	S	287;211;99;280;131;211;99	ENSP00000265843:F287S;ENSP00000391966:F211S;ENSP00000411390:F99S;ENSP00000432546:F280S;ENSP00000432683:F211S;ENSP00000446434:F99S	ENSP00000265843:F287S	F	-	2	0	EXPH5	107890584	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.272000	0.51616	2.154000	0.67381	0.533000	0.62120	TTT		0.363	EXPH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390279.1		NM_015065	
F12	2161	hgsc.bcm.edu	37	5	176832137	176832137	+	Missense_Mutation	SNP	T	T	C			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr5:176832137T>C	ENST00000253496.3	-	6	495	c.447A>G	c.(445-447)atA>atG	p.I149M	F12_ENST00000514943.1_5'Flank	NM_000505.3	NP_000496.2	P00748	FA12_HUMAN	coagulation factor XII (Hageman factor)	149	Fibronectin type-I. {ECO:0000255|PROSITE- ProRule:PRU00478}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|Factor XII activation (GO:0002542)|fibrinolysis (GO:0042730)|innate immune response (GO:0045087)|plasma kallikrein-kinin cascade (GO:0002353)|positive regulation of blood coagulation (GO:0030194)|positive regulation of fibrinolysis (GO:0051919)|positive regulation of plasminogen activation (GO:0010756)|protein autoprocessing (GO:0016540)|protein processing (GO:0016485)|response to misfolded protein (GO:0051788)|zymogen activation (GO:0031638)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	misfolded protein binding (GO:0051787)|serine-type aminopeptidase activity (GO:0070009)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|urinary_tract(1)	12	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Ethanolamine Oleate(DB06689)	TTCTATACCATATCTCATTCT	0.552									Hereditary Angioedema																																								0													64.0	66.0	66.0					5																	176832137		2203	4300	6503	SO:0001583	missense	2161	Familial Cancer Database	HAE, type I-III, Hereditary Angioneurotic Edema, HANE,	M31315	CCDS34302.1	5q35.3	2014-09-17			ENSG00000131187	ENSG00000131187	3.4.21.38		3530	protein-coding gene	gene with protein product		610619					Standard	NM_000505		Approved		uc003mgo.4	P00748	OTTHUMG00000163403	ENST00000253496.3:c.447A>G	5.37:g.176832137T>C	ENSP00000253496:p.Ile149Met		P78339	Missense_Mutation	SNP	ENST00000253496.3	37	CCDS34302.1	.	.	.	.	.	.	.	.	.	.	T	5.414	0.261503	0.10239	.	.	ENSG00000131187	ENST00000253496	T	0.43688	0.94	5.86	-8.32	0.00996	Fibronectin, type I (4);	1.030140	0.07709	N	0.941689	T	0.23054	0.0557	L	0.40543	1.245	0.09310	N	0.999998	B	0.26002	0.139	B	0.21917	0.037	T	0.29305	-1.0016	10	0.45353	T	0.12	.	1.2123	0.01907	0.3255:0.3302:0.1455:0.1988	.	149	P00748	FA12_HUMAN	M	149	ENSP00000253496:I149M	ENSP00000253496:I149M	I	-	3	3	F12	176764743	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	-1.164000	0.03135	-0.926000	0.03770	-0.290000	0.09829	ATA		0.552	F12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373217.1			
FKBP15	23307	hgsc.bcm.edu;ucsc.edu	37	9	115931605	115931605	+	Silent	SNP	G	G	A			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr9:115931605G>A	ENST00000238256.3	-	26	3501	c.3384C>T	c.(3382-3384)gtC>gtT	p.V1128V		NM_015258.1	NP_056073.1	Q5T1M5	FKB15_HUMAN	FK506 binding protein 15, 133kDa	1128					endocytosis (GO:0006897)|negative regulation of phosphatase activity (GO:0010923)|protein folding (GO:0006457)	actin filament (GO:0005884)|axon (GO:0030424)|endosome (GO:0005768)|growth cone (GO:0030426)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(9)|ovary(3)|urinary_tract(1)	26						TGGAGCTAGTGACATCATCTT	0.602																																																	0													77.0	80.0	79.0					9																	115931605		2091	4202	6293	SO:0001819	synonymous_variant	23307			AB014574	CCDS48007.1	9q33.1	2014-05-09	2006-10-31	2006-10-31	ENSG00000119321	ENSG00000119321		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	23397	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 76"", ""WASP and FKBP-like protein"""		"""KIAA0674"""	KIAA0674		16756961, 20376207	Standard	NM_015258		Approved	PPP1R76, FKBP133, WAFL	uc004bgs.2	Q5T1M5	OTTHUMG00000020518	ENST00000238256.3:c.3384C>T	9.37:g.115931605G>A			Q05DK8|Q5T1M2|Q6DD85|Q9Y4D0	Silent	SNP	ENST00000238256.3	37	CCDS48007.1																																																																																				0.602	FKBP15-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			NM_015258	
GALNT2	2590	hgsc.bcm.edu;ucsc.edu	37	1	230338993	230338993	+	Nonsense_Mutation	SNP	A	A	T			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr1:230338993A>T	ENST00000366672.4	+	3	403	c.331A>T	c.(331-333)Aag>Tag	p.K111*	GALNT2_ENST00000543760.1_Nonsense_Mutation_p.K73*|GALNT2_ENST00000541865.1_Nonsense_Mutation_p.K21*	NM_004481.3	NP_004472.1	Q10471	GALT2_HUMAN	polypeptide N-acetylgalactosaminyltransferase 2	111					cellular protein metabolic process (GO:0044267)|immunoglobulin biosynthetic process (GO:0002378)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)|protein O-linked glycosylation via serine (GO:0018242)|protein O-linked glycosylation via threonine (GO:0018243)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|manganese ion binding (GO:0030145)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(5)|skin(2)	32	Breast(184;0.193)|Ovarian(103;0.249)	all_cancers(173;0.156)|Prostate(94;0.179)				GGAGAGTGATAAGCTTCGAAT	0.542																																																	0													124.0	121.0	122.0					1																	230338993		2203	4300	6503	SO:0001587	stop_gained	2590			BC041120	CCDS1582.1	1q41-q42	2014-03-13	2014-03-13		ENSG00000143641	ENSG00000143641	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4124	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 2"""	602274	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 (GalNAc-T2)"""			9592121, 7592619	Standard	NM_004481		Approved	GalNAc-T2	uc010pwa.1	Q10471	OTTHUMG00000037771	ENST00000366672.4:c.331A>T	1.37:g.230338993A>T	ENSP00000355632:p.Lys111*		A8K1Y3|B7Z8V8|C5HU00|Q9NPY4	Nonsense_Mutation	SNP	ENST00000366672.4	37	CCDS1582.1	.	.	.	.	.	.	.	.	.	.	A	38	7.261761	0.98171	.	.	ENSG00000143641	ENST00000543760;ENST00000366672;ENST00000541865	.	.	.	5.63	5.63	0.86233	.	0.041001	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.1485	0.81594	1.0:0.0:0.0:0.0	.	.	.	.	X	73;111;21	.	ENSP00000355632:K111X	K	+	1	0	GALNT2	228405616	1.000000	0.71417	0.655000	0.29622	0.662000	0.39071	9.268000	0.95675	2.281000	0.76405	0.533000	0.62120	AAG		0.542	GALNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092158.1		NM_004481	
GDPD5	81544	hgsc.bcm.edu	37	11	75188686	75188686	+	Missense_Mutation	SNP	C	C	T			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr11:75188686C>T	ENST00000336898.3	-	3	932	c.95G>A	c.(94-96)cGc>cAc	p.R32H	GDPD5_ENST00000376282.3_Missense_Mutation_p.R32H|GDPD5_ENST00000443276.2_Missense_Mutation_p.R32H|GDPD5_ENST00000533784.1_Missense_Mutation_p.R32H|GDPD5_ENST00000529721.1_Missense_Mutation_p.R32H	NM_030792.6	NP_110419.5	Q8WTR4	GDPD5_HUMAN	glycerophosphodiester phosphodiesterase domain containing 5	32					cerebral cortex neuron differentiation (GO:0021895)|glycerol metabolic process (GO:0006071)|lipid metabolic process (GO:0006629)|negative regulation of Notch signaling pathway (GO:0045746)|neuron projection development (GO:0031175)|positive regulation of neuron differentiation (GO:0045666)|regulation of timing of cell differentiation (GO:0048505)|spinal cord motor neuron differentiation (GO:0021522)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	glycerophosphodiester phosphodiesterase activity (GO:0008889)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(3)|skin(2)	20						ATCATGGGAGCGCTGGTAGCG	0.632																																																	0													45.0	40.0	42.0					11																	75188686		2200	4293	6493	SO:0001583	missense	81544			AF318377	CCDS8238.1	11q13.4-q13.5	2011-01-25				ENSG00000158555			28804	protein-coding gene	gene with protein product		609632				18667693, 17275818	Standard	NM_030792		Approved	PP1665, GDE2	uc001owp.4	Q8WTR4		ENST00000336898.3:c.95G>A	11.37:g.75188686C>T	ENSP00000337972:p.Arg32His		Q49AQ5|Q6UX76|Q7Z4S0|Q8N781|Q8NCB7|Q8TB77	Missense_Mutation	SNP	ENST00000336898.3	37	CCDS8238.1	.	.	.	.	.	.	.	.	.	.	C	19.14	3.769591	0.69992	.	.	ENSG00000158555	ENST00000533784;ENST00000529721;ENST00000336898;ENST00000376282;ENST00000443276;ENST00000532435	T;T;T;T;T	0.34667	2.11;1.35;1.35;2.11;1.35	4.88	4.88	0.63580	.	0.124090	0.53938	D	0.000055	T	0.53481	0.1799	L	0.47016	1.485	0.58432	D	0.999994	D;B	0.89917	1.0;0.322	D;B	0.87578	0.998;0.033	T	0.53578	-0.8419	10	0.54805	T	0.06	-24.3836	15.9013	0.79380	0.0:1.0:0.0:0.0	.	32;32	Q8WTR4-2;Q8WTR4	.;GDPD5_HUMAN	H	32	ENSP00000437049:R32H;ENSP00000433214:R32H;ENSP00000337972:R32H;ENSP00000365459:R32H;ENSP00000396535:R32H	ENSP00000337972:R32H	R	-	2	0	GDPD5	74866334	1.000000	0.71417	0.914000	0.36105	0.975000	0.68041	7.396000	0.79891	2.406000	0.81754	0.655000	0.94253	CGC		0.632	GDPD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384409.1		NM_030792	
GRAMD1B	57476	hgsc.bcm.edu;ucsc.edu	37	11	123489493	123489493	+	Missense_Mutation	SNP	T	T	A			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr11:123489493T>A	ENST00000529750.1	+	18	2321	c.1994T>A	c.(1993-1995)cTa>cAa	p.L665Q	GRAMD1B_ENST00000322282.7_Missense_Mutation_p.L665Q|GRAMD1B_ENST00000450171.2_Missense_Mutation_p.L352Q|GRAMD1B_ENST00000456860.2_Missense_Mutation_p.L672Q	NM_020716.1	NP_065767.1	Q3KR37	GRM1B_HUMAN	GRAM domain containing 1B	665						integral component of membrane (GO:0016021)|membrane (GO:0016020)				NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(17)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	30		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.32e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0394)		TGGCAGGGTCTAAGGCTCCAA	0.547																																																	0													47.0	49.0	48.0					11																	123489493		2049	4190	6239	SO:0001583	missense	57476			AB033027	CCDS53720.1, CCDS66253.1, CCDS66254.1	11q24.1	2005-11-02				ENSG00000023171			29214	protein-coding gene	gene with protein product						10574462	Standard	NM_001286564		Approved	KIAA1201	uc001pyx.2	Q3KR37		ENST00000529750.1:c.1994T>A	11.37:g.123489493T>A	ENSP00000436500:p.Leu665Gln		Q6UW85|Q9ULL9	Missense_Mutation	SNP	ENST00000529750.1	37	CCDS53720.1	.	.	.	.	.	.	.	.	.	.	T	22.4	4.286113	0.80803	.	.	ENSG00000023171	ENST00000539133;ENST00000456860;ENST00000322282;ENST00000529750;ENST00000529432;ENST00000450171	T;T;T;T;T	0.55052	1.52;1.54;1.52;1.55;0.54	4.83	4.83	0.62350	.	0.000000	0.64402	D	0.000003	T	0.71204	0.3312	M	0.73598	2.24	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;0.998;0.999	D;D;P;D	0.91635	0.961;0.999;0.896;0.984	T	0.73251	-0.4042	10	0.46703	T	0.11	.	14.3952	0.67005	0.0:0.0:0.0:1.0	.	621;352;665;672	B7Z4N9;Q3KR37-3;Q3KR37;E7EPH8	.;.;GRM1B_HUMAN;.	Q	672;672;665;665;625;352	ENSP00000402457:L672Q;ENSP00000325628:L665Q;ENSP00000436500:L665Q;ENSP00000432987:L625Q;ENSP00000388458:L352Q	ENSP00000325628:L665Q	L	+	2	0	GRAMD1B	122994703	1.000000	0.71417	0.984000	0.44739	0.968000	0.65278	7.925000	0.87563	1.938000	0.56188	0.374000	0.22700	CTA		0.547	GRAMD1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387404.2		XM_370660	
GXYLT1	283464	hgsc.bcm.edu	37	12	42491289	42491289	+	Silent	SNP	G	G	A	rs200393853		TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr12:42491289G>A	ENST00000398675.3	-	7	1348	c.1116C>T	c.(1114-1116)gaC>gaT	p.D372D	GXYLT1_ENST00000280876.6_Silent_p.D341D	NM_001099650.1|NM_173601.1	NP_001093120.1|NP_775872.1	Q4G148	GXLT1_HUMAN	glucoside xylosyltransferase 1	372					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|O-glycan processing (GO:0016266)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	UDP-xylosyltransferase activity (GO:0035252)			kidney(2)|large_intestine(4)|liver(3)|lung(8)	17						GTTGCTTATCGTCATGGTAAA	0.353																																																	0													121.0	114.0	116.0					12																	42491289		1864	4113	5977	SO:0001819	synonymous_variant	283464			BC015597	CCDS41771.1, CCDS41772.1	12q12	2013-10-11	2009-11-17	2009-11-17	ENSG00000151233	ENSG00000151233		"""Glycosyltransferase family 8 domain containing"""	27482	protein-coding gene	gene with protein product		613321	"""glycosyltransferase 8 domain containing 3"""	GLT8D3		19940119	Standard	NM_001099650		Approved	FLJ43151	uc001rms.4	Q4G148	OTTHUMG00000169379	ENST00000398675.3:c.1116C>T	12.37:g.42491289G>A			B3KWJ2|Q8IXV1|Q96BH4	Silent	SNP	ENST00000398675.3	37	CCDS41772.1																																																																																				0.353	GXYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403778.1		XM_290597	
HSPA8	3312	hgsc.bcm.edu	37	11	122928453	122928453	+	Missense_Mutation	SNP	C	C	T			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr11:122928453C>T	ENST00000532636.1	-	9	2049	c.1930G>A	c.(1930-1932)Gag>Aag	p.E644K	SNORD14C_ENST00000365382.1_RNA|HSPA8_ENST00000534319.1_Missense_Mutation_p.E408K|SNORD14D_ENST00000384390.1_RNA|HSPA8_ENST00000526110.1_Missense_Mutation_p.E625K|HSPA8_ENST00000533540.1_Missense_Mutation_p.E498K|HSPA8_ENST00000526862.1_5'Flank|HSPA8_ENST00000227378.3_Missense_Mutation_p.E644K|HSPA8_ENST00000534624.1_Missense_Mutation_p.E644K|HSPA8_ENST00000453788.2_Missense_Mutation_p.E491K|SNORD14E_ENST00000364009.1_RNA			P11142	HSP7C_HUMAN	heat shock 70kDa protein 8	644					ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|chaperone mediated protein folding requiring cofactor (GO:0051085)|clathrin coat disassembly (GO:0072318)|gene expression (GO:0010467)|membrane organization (GO:0061024)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|negative regulation of fibril organization (GO:1902904)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotransmitter secretion (GO:0007269)|post-Golgi vesicle-mediated transport (GO:0006892)|protein folding (GO:0006457)|protein refolding (GO:0042026)|regulation of cell cycle (GO:0051726)|response to unfolded protein (GO:0006986)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|synaptic transmission (GO:0007268)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	blood microparticle (GO:0072562)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Prp19 complex (GO:0000974)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|enzyme binding (GO:0019899)|G-protein coupled receptor binding (GO:0001664)|heat shock protein binding (GO:0031072)|MHC class II protein complex binding (GO:0023026)|poly(A) RNA binding (GO:0044822)|ubiquitin protein ligase binding (GO:0031625)|unfolded protein binding (GO:0051082)			breast(1)|central_nervous_system(7)|endometrium(1)|kidney(9)|large_intestine(4)|lung(13)|upper_aerodigestive_tract(1)	36		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		TAATCAACCTCTTCAATGGTG	0.483																																					Colon(21;486 594 5900 6733 14272)												0													65.0	68.0	67.0					11																	122928453		2202	4299	6501	SO:0001583	missense	3312			Y00371	CCDS8440.1, CCDS44754.1	11q24.1	2011-09-02	2002-08-29		ENSG00000109971	ENSG00000109971		"""Heat shock proteins / HSP70"""	5241	protein-coding gene	gene with protein product		600816	"""heat shock 70kD protein 8"""	HSPA10		8530083, 3037489	Standard	NM_006597		Approved	HSC71, HSC70, HSP73	uc001pyo.3	P11142	OTTHUMG00000166030	ENST00000532636.1:c.1930G>A	11.37:g.122928453C>T	ENSP00000437125:p.Glu644Lys		Q9H3R6	Missense_Mutation	SNP	ENST00000532636.1	37	CCDS8440.1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.495820	0.85069	.	.	ENSG00000109971	ENST00000532636;ENST00000533540;ENST00000534624;ENST00000453788;ENST00000227378;ENST00000534319;ENST00000526110	T;T;T;T;T;T;T	0.09350	5.06;4.43;5.06;2.99;5.06;4.0;5.1	4.65	4.65	0.58169	.	0.000000	0.85682	D	0.000000	T	0.40347	0.1113	M	0.94021	3.485	0.80722	D	1	P;P;P	0.37398	0.458;0.593;0.458	B;P;P	0.51742	0.292;0.486;0.678	T	0.52563	-0.8559	10	0.87932	D	0	-16.0469	17.8802	0.88838	0.0:1.0:0.0:0.0	.	644;491;644	Q53GZ6;P11142-2;P11142	.;.;HSP7C_HUMAN	K	644;498;644;491;644;408;625	ENSP00000437125:E644K;ENSP00000437189:E498K;ENSP00000432083:E644K;ENSP00000404372:E491K;ENSP00000227378:E644K;ENSP00000433316:E408K;ENSP00000433584:E625K	ENSP00000227378:E644K	E	-	1	0	HSPA8	122433663	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.815000	0.86186	2.285000	0.76669	0.561000	0.74099	GAG		0.483	HSPA8-004	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387515.1			
IGF2BP2	10644	hgsc.bcm.edu;ucsc.edu	37	3	185376129	185376129	+	Splice_Site	SNP	A	A	C			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr3:185376129A>C	ENST00000382199.2	-	11	1364	c.1269T>G	c.(1267-1269)tcT>tcG	p.S423S	IGF2BP2_ENST00000457616.2_Splice_Site_p.S429S|IGF2BP2_ENST00000421047.2_Splice_Site_p.S366S|IGF2BP2_ENST00000346192.3_Splice_Site_p.S380S|IGF2BP2_ENST00000494906.1_5'UTR	NM_006548.4	NP_006539.3	Q9Y6M1	IF2B2_HUMAN	insulin-like growth factor 2 mRNA binding protein 2	423					anatomical structure morphogenesis (GO:0009653)|gene expression (GO:0010467)|mRNA transport (GO:0051028)|negative regulation of translation (GO:0017148)|regulation of cytokine biosynthetic process (GO:0042035)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|translation regulator activity (GO:0045182)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)|skin(3)	20	all_cancers(143;5.84e-11)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)			GGGCACTTACAGAGTGATGAT	0.582																																																	0													94.0	92.0	93.0					3																	185376129		2203	4300	6503	SO:0001630	splice_region_variant	10644			BC021290	CCDS3273.2, CCDS33903.1	3q27.2	2013-02-12			ENSG00000073792	ENSG00000073792		"""RNA binding motif (RRM) containing"""	28867	protein-coding gene	gene with protein product	"""IGF II mRNA binding protein 2"""	608289				10190901, 9891060	Standard	NM_001007225		Approved	IMP-2	uc003fpo.3	Q9Y6M1	OTTHUMG00000074025	ENST00000382199.2:c.1269+1T>G	3.37:g.185376129A>C			A0A4Z0|B3FTN2|B3FTN3|B3FTN4	Silent	SNP	ENST00000382199.2	37	CCDS3273.2																																																																																				0.582	IGF2BP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000157087.2		NM_006548	Silent
IL22RA1	58985	hgsc.bcm.edu;ucsc.edu	37	1	24460780	24460780	+	Missense_Mutation	SNP	C	C	A			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr1:24460780C>A	ENST00000270800.1	-	4	490	c.452G>T	c.(451-453)gGc>gTc	p.G151V		NM_021258.3	NP_067081.2	Q8N6P7	I22R1_HUMAN	interleukin 22 receptor, alpha 1	151	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cytokine-mediated signaling pathway (GO:0019221)|defense response to Gram-negative bacterium (GO:0050829)	integral component of membrane (GO:0016021)	interferon receptor activity (GO:0004904)			breast(2)|endometrium(2)|large_intestine(4)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	19		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000992)|all_lung(284;0.00138)|Ovarian(437;0.00348)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;3.84e-24)|Colorectal(126;6.43e-08)|COAD - Colon adenocarcinoma(152;3.51e-06)|GBM - Glioblastoma multiforme(114;5.06e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00911)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.148)		TAGCCGGTGGCCATCGCCTGC	0.532																																																	0													115.0	99.0	104.0					1																	24460780		2203	4300	6503	SO:0001583	missense	58985			AF286095	CCDS247.1	1p36.11	2009-10-06	2002-12-02	2002-12-06	ENSG00000142677	ENSG00000142677		"""Interleukins and interleukin receptors"""	13700	protein-coding gene	gene with protein product		605457	"""interleukin 22 receptor"""	IL22R		10875937	Standard	NM_021258		Approved	CRF2-9	uc001biq.2	Q8N6P7	OTTHUMG00000003041	ENST00000270800.1:c.452G>T	1.37:g.24460780C>A	ENSP00000270800:p.Gly151Val		A8K839|B2R9Y9|Q9HB22	Missense_Mutation	SNP	ENST00000270800.1	37	CCDS247.1	.	.	.	.	.	.	.	.	.	.	C	13.62	2.290194	0.40494	.	.	ENSG00000142677	ENST00000270800	T	0.50277	0.75	4.98	4.98	0.66077	Interferon alpha/beta receptor, beta chain (1);Immunoglobulin-like fold (1);	0.565490	0.19415	N	0.114847	T	0.59059	0.2166	L	0.36672	1.1	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.61078	-0.7135	10	0.72032	D	0.01	-7.5582	13.7585	0.62950	0.0:1.0:0.0:0.0	.	43;151	B4E2V9;Q8N6P7	.;I22R1_HUMAN	V	151	ENSP00000270800:G151V	ENSP00000270800:G151V	G	-	2	0	IL22RA1	24333367	1.000000	0.71417	0.642000	0.29436	0.005000	0.04900	3.721000	0.54941	2.313000	0.78055	0.561000	0.74099	GGC		0.532	IL22RA1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008412.1			
ISLR	3671	hgsc.bcm.edu	37	15	74467763	74467763	+	Missense_Mutation	SNP	C	C	G	rs138253214		TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr15:74467763C>G	ENST00000249842.3	+	2	921	c.564C>G	c.(562-564)atC>atG	p.I188M	ISLR_ENST00000395118.1_Missense_Mutation_p.I188M|RP11-665J16.1_ENST00000561647.1_RNA	NM_005545.3	NP_005536.1	O14498	ISLR_HUMAN	immunoglobulin superfamily containing leucine-rich repeat	188	LRRCT.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)		p.I188I(1)		central_nervous_system(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(1)	20						CCTGCGGCATCGTGTGGCTCA	0.637																																																	1	Substitution - coding silent(1)	skin(1)											55.0	46.0	49.0					15																	74467763		2198	4297	6495	SO:0001583	missense	3671			AB003184	CCDS10260.1	15q23-q24	2013-01-11			ENSG00000129009	ENSG00000129009		"""Immunoglobulin superfamily / I-set domain containing"""	6133	protein-coding gene	gene with protein product		602059				9325048	Standard	NM_005545		Approved	HsT17563	uc002axh.1	O14498	OTTHUMG00000137623	ENST00000249842.3:c.564C>G	15.37:g.74467763C>G	ENSP00000249842:p.Ile188Met			Missense_Mutation	SNP	ENST00000249842.3	37	CCDS10260.1	.	.	.	.	.	.	.	.	.	.	C	6.806	0.517825	0.13005	.	.	ENSG00000129009	ENST00000249842;ENST00000395118	T;T	0.54866	0.55;0.55	4.05	0.579	0.17397	Cysteine-rich flanking region, C-terminal (1);	0.141749	0.27168	U	0.020614	T	0.32133	0.0819	L	0.28115	0.83	0.22081	N	0.999378	P	0.43094	0.799	B	0.35727	0.209	T	0.20940	-1.0260	10	0.56958	D	0.05	.	8.3986	0.32572	0.0:0.6915:0.14:0.1685	.	188	O14498	ISLR_HUMAN	M	188	ENSP00000249842:I188M;ENSP00000378550:I188M	ENSP00000249842:I188M	I	+	3	3	ISLR	72254816	0.000000	0.05858	0.997000	0.53966	0.564000	0.35744	-0.718000	0.04980	0.209000	0.20645	0.313000	0.20887	ATC		0.637	ISLR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269044.1		NM_005545	
ITLN1	55600	hgsc.bcm.edu;ucsc.edu	37	1	160853223	160853223	+	Missense_Mutation	SNP	G	G	T			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr1:160853223G>T	ENST00000326245.3	-	3	267	c.152C>A	c.(151-153)gCa>gAa	p.A51E	ITLN1_ENST00000487531.1_5'Flank	NM_017625.2	NP_060095.2	Q8WWA0	ITLN1_HUMAN	intelectin 1 (galactofuranose binding)	51	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				positive regulation of glucose import (GO:0046326)|positive regulation of protein phosphorylation (GO:0001934)|response to nematode (GO:0009624)	anchored component of membrane (GO:0031225)|brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|receptor complex (GO:0043235)	carbohydrate binding (GO:0030246)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(6)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	21	all_cancers(52;2.99e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			CTCACCAAATGCACTAGGACA	0.408																																																	0													154.0	135.0	142.0					1																	160853223		2203	4300	6503	SO:0001583	missense	55600			AB036706	CCDS1211.1	1q21.3	2008-02-05			ENSG00000179914	ENSG00000179914			18259	protein-coding gene	gene with protein product		609873				11313366, 11181563	Standard	NM_017625		Approved	ITLN, FLJ20022, LFR, HL-1, hIntL	uc001fxc.3	Q8WWA0	OTTHUMG00000028604	ENST00000326245.3:c.152C>A	1.37:g.160853223G>T	ENSP00000323587:p.Ala51Glu		Q5IWS4|Q5VYI4|Q6YDJ3|Q9NP67	Missense_Mutation	SNP	ENST00000326245.3	37	CCDS1211.1	.	.	.	.	.	.	.	.	.	.	G	9.870	1.198637	0.22121	.	.	ENSG00000179914	ENST00000326245	D	0.93307	-3.2	3.59	2.68	0.31781	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (3);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);	0.879086	0.09291	U	0.822340	D	0.86171	0.5869	M	0.75447	2.3	0.09310	N	1	B	0.10296	0.003	B	0.24269	0.052	T	0.77035	-0.2737	10	0.29301	T	0.29	-4.5921	7.2627	0.26212	0.125:0.0:0.875:0.0	.	51	Q8WWA0	ITLN1_HUMAN	E	51	ENSP00000323587:A51E	ENSP00000323587:A51E	A	-	2	0	ITLN1	159119847	0.019000	0.18553	0.002000	0.10522	0.004000	0.04260	2.239000	0.43079	0.841000	0.35020	-0.126000	0.14955	GCA		0.408	ITLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071462.1		NM_017625	
ITPR3	3710	hgsc.bcm.edu;ucsc.edu	37	6	33635679	33635679	+	Missense_Mutation	SNP	G	G	T			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr6:33635679G>T	ENST00000374316.5	+	17	2884	c.1824G>T	c.(1822-1824)aaG>aaT	p.K608N	ITPR3_ENST00000605930.1_Missense_Mutation_p.K608N			Q14573	ITPR3_HUMAN	inositol 1,4,5-trisphosphate receptor, type 3	608					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport into cytosol (GO:0060402)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to calcium ion (GO:0051592)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear outer membrane (GO:0005640)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)	inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|inositol 1,4,5 trisphosphate binding (GO:0070679)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|inositol hexakisphosphate binding (GO:0000822)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)	p.K608K(1)		NS(1)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(24)|ovary(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	85					Caffeine(DB00201)	TCCTGGAAAAGCACATCACCA	0.627																																																	1	Substitution - coding silent(1)	large_intestine(1)											192.0	147.0	162.0					6																	33635679		2203	4300	6503	SO:0001583	missense	3710			D26351	CCDS4783.1	6p21.31	2011-11-24	2011-04-28		ENSG00000096433	ENSG00000096433		"""Ion channels / Inositol triphosphate receptors"""	6182	protein-coding gene	gene with protein product		147267	"""inositol 1,4,5-triphosphate receptor, type 3"""			8081734, 8288584	Standard	NM_002224		Approved	IP3R3	uc021ywr.1	Q14573	OTTHUMG00000014532	ENST00000374316.5:c.1824G>T	6.37:g.33635679G>T	ENSP00000363435:p.Lys608Asn		Q14649|Q5TAQ2	Missense_Mutation	SNP	ENST00000374316.5	37	CCDS4783.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.105428	0.77096	.	.	ENSG00000096433	ENST00000374316	D	0.95622	-3.76	5.27	3.46	0.39613	Intracellular calcium-release channel (1);	0.000000	0.85682	D	0.000000	D	0.96463	0.8846	M	0.90198	3.095	0.54753	D	0.999984	D	0.53619	0.961	P	0.57846	0.828	D	0.95899	0.8913	10	0.87932	D	0	-38.0154	9.4834	0.38915	0.2215:0.0:0.7785:0.0	.	608	Q14573	ITPR3_HUMAN	N	608	ENSP00000363435:K608N	ENSP00000363435:K608N	K	+	3	2	ITPR3	33743657	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	2.125000	0.42016	0.585000	0.29608	0.555000	0.69702	AAG		0.627	ITPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040204.2		NM_002224	
JUNB	3726	hgsc.bcm.edu	37	19	12903618	12903618	+	Missense_Mutation	SNP	C	C	G			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr19:12903618C>G	ENST00000302754.4	+	1	1309	c.1033C>G	c.(1033-1035)Cac>Gac	p.H345D		NM_002229.2	NP_002220.1	P17275	JUNB_HUMAN	jun B proto-oncogene	345					cellular response to calcium ion (GO:0071277)|cellular response to hormone stimulus (GO:0032870)|decidualization (GO:0046697)|embryonic process involved in female pregnancy (GO:0060136)|gene expression (GO:0010467)|labyrinthine layer blood vessel development (GO:0060716)|osteoblast differentiation (GO:0001649)|osteoblast proliferation (GO:0033687)|osteoclast differentiation (GO:0030316)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cAMP (GO:0051591)|response to corticosterone (GO:0051412)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to light stimulus (GO:0009416)|response to mechanical stimulus (GO:0009612)|response to peptide hormone (GO:0043434)|response to progesterone (GO:0032570)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|trophectodermal cell differentiation (GO:0001829)|vasculogenesis (GO:0001570)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|cervix(1)|kidney(1)|lung(3)	6						GGTCAAGGGACACGCCTTCTG	0.672																																																	0													38.0	35.0	36.0					19																	12903618		2203	4300	6503	SO:0001583	missense	3726			M29039	CCDS12280.1	19p13.13	2013-01-10				ENSG00000171223		"""basic leucine zipper proteins"""	6205	protein-coding gene	gene with protein product		165161				2513129	Standard	NM_002229		Approved		uc002mvc.3	P17275		ENST00000302754.4:c.1033C>G	19.37:g.12903618C>G	ENSP00000303315:p.His345Asp		Q96GH3	Missense_Mutation	SNP	ENST00000302754.4	37	CCDS12280.1	.	.	.	.	.	.	.	.	.	.	C	11.57	1.676748	0.29783	.	.	ENSG00000171223	ENST00000302754	T	0.29655	1.56	4.08	4.08	0.47627	.	0.206931	0.40728	U	0.001034	T	0.23094	0.0558	N	0.22421	0.69	0.39162	D	0.962424	B	0.22003	0.063	B	0.19666	0.026	T	0.10064	-1.0646	10	0.51188	T	0.08	-10.5405	15.0435	0.71811	0.0:1.0:0.0:0.0	.	345	P17275	JUNB_HUMAN	D	345	ENSP00000303315:H345D	ENSP00000303315:H345D	H	+	1	0	JUNB	12764618	0.994000	0.37717	1.000000	0.80357	0.833000	0.47200	3.294000	0.51787	1.834000	0.53371	0.448000	0.29417	CAC		0.672	JUNB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451015.1		NM_002229	
KIAA0907	22889	hgsc.bcm.edu	37	1	155887391	155887391	+	Missense_Mutation	SNP	G	G	C			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr1:155887391G>C	ENST00000368321.3	-	11	1362	c.1339C>G	c.(1339-1341)Ccc>Gcc	p.P447A	SNORA42_ENST00000384744.1_RNA|KIAA0907_ENST00000368320.3_Missense_Mutation_p.P447A	NM_014949.2	NP_055764.2	Q7Z7F0	K0907_HUMAN	KIAA0907	447	Pro-rich.						RNA binding (GO:0003723)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|urinary_tract(1)	21	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		OV - Ovarian serous cystadenocarcinoma(3;8.82e-06)			tggggctggggctggggctgg	0.572																																																	0													16.0	20.0	19.0					1																	155887391		2156	4279	6435	SO:0001583	missense	22889			BC062637	CCDS30885.1	1q22	2012-11-30			ENSG00000132680	ENSG00000132680			29145	protein-coding gene	gene with protein product						10048485	Standard	NM_014949		Approved	BLOM7	uc001fmi.1	Q7Z7F0	OTTHUMG00000014103	ENST00000368321.3:c.1339C>G	1.37:g.155887391G>C	ENSP00000357304:p.Pro447Ala		O94981|Q7L7Q2|Q7Z7E9|Q8TBQ0	Missense_Mutation	SNP	ENST00000368321.3	37	CCDS30885.1	.	.	.	.	.	.	.	.	.	.	G	12.68	2.012064	0.35511	.	.	ENSG00000132680	ENST00000368321;ENST00000368320	T;T	0.23348	1.91;1.91	5.81	4.9	0.64082	.	0.320644	0.29558	N	0.011803	T	0.05868	0.0153	N	0.08118	0	0.29884	N	0.825788	B;B	0.22683	0.073;0.073	B;B	0.25405	0.06;0.06	T	0.18618	-1.0331	10	0.54805	T	0.06	-5.0955	10.9801	0.47488	0.0725:0.1641:0.7633:0.0	.	447;447	Q7Z7F0-2;Q7Z7F0	.;K0907_HUMAN	A	447	ENSP00000357304:P447A;ENSP00000357303:P447A	ENSP00000357303:P447A	P	-	1	0	KIAA0907	154154015	1.000000	0.71417	0.994000	0.49952	0.988000	0.76386	3.199000	0.51043	1.600000	0.50102	0.655000	0.94253	CCC		0.572	KIAA0907-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039583.1		NM_014949	
TLDC1	57707	hgsc.bcm.edu	37	16	84529460	84529460	+	Silent	SNP	C	C	A			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr16:84529460C>A	ENST00000343629.6	-	3	395	c.213G>T	c.(211-213)cgG>cgT	p.R71R	RP11-517C16.4_ENST00000568771.1_RNA|TLDC1_ENST00000535580.1_Silent_p.R44R|TLDC1_ENST00000561807.1_5'UTR	NM_020947.3	NP_065998.3	Q6P9B6	TLDC1_HUMAN	TBC/LysM-associated domain containing 1	71						lysosomal membrane (GO:0005765)											GGTCGACCCTCCGCATGCCAT	0.567																																																	0													151.0	117.0	129.0					16																	84529460		2200	4300	6500	SO:0001819	synonymous_variant	57707			AB046829	CCDS32498.1	16q24.1	2013-03-14	2013-03-14	2013-03-14	ENSG00000140950	ENSG00000140950			29325	protein-coding gene	gene with protein product	"""TLD domain containing 1"""		"""KIAA1609"""	KIAA1609		10997877	Standard	NM_020947		Approved		uc002fib.3	Q6P9B6	OTTHUMG00000176739	ENST00000343629.6:c.213G>T	16.37:g.84529460C>A			Q8IZ64|Q9HCG3|Q9NTE8	Silent	SNP	ENST00000343629.6	37	CCDS32498.1																																																																																				0.567	TLDC1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433421.1		NM_020947	
KIF4A	24137	hgsc.bcm.edu	37	X	69561758	69561758	+	Missense_Mutation	SNP	C	C	A			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chrX:69561758C>A	ENST00000374403.3	+	11	1325	c.1243C>A	c.(1243-1245)Cag>Aag	p.Q415K	KIF4A_ENST00000374388.3_Missense_Mutation_p.Q415K	NM_012310.4	NP_036442.3	O95239	KIF4A_HUMAN	kinesin family member 4A	415					anterograde axon cargo transport (GO:0008089)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle organization (GO:0006996)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)	p.Q415*(1)		breast(6)|endometrium(9)|kidney(3)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	51						TCAGACAGCCCAGATGTTGGA	0.418																																																	1	Substitution - Nonsense(1)	lung(1)											102.0	101.0	101.0					X																	69561758		2203	4300	6503	SO:0001583	missense	24137			AF179308	CCDS14401.1	Xq13.1	2008-08-11			ENSG00000090889	ENSG00000090889		"""Kinesins"""	13339	protein-coding gene	gene with protein product	"""chromokinesin"""	300521				10773663	Standard	NM_012310		Approved	KIF4-G1, KIF4, HSA271784, FLJ12530, FLJ12655, FLJ14204, FLJ20631	uc004dyg.3	O95239	OTTHUMG00000021775	ENST00000374403.3:c.1243C>A	X.37:g.69561758C>A	ENSP00000363524:p.Gln415Lys		B2R7V5|D3DVU4|Q86TN3|Q86XX7|Q9NNY6|Q9NY24|Q9UMW3	Missense_Mutation	SNP	ENST00000374403.3	37	CCDS14401.1	.	.	.	.	.	.	.	.	.	.	C	14.70	2.613671	0.46631	.	.	ENSG00000090889	ENST00000374388;ENST00000374403	T;T	0.52295	0.67;0.67	4.77	3.88	0.44766	.	0.248403	0.28510	N	0.015090	T	0.43765	0.1262	L	0.57536	1.79	0.34560	D	0.71232	P;B	0.50617	0.937;0.13	P;B	0.46110	0.504;0.064	T	0.52823	-0.8524	10	0.06891	T	0.86	.	12.0176	0.53324	0.1741:0.8259:0.0:0.0	.	415;415	O95239;O95239-2	KIF4A_HUMAN;.	K	415	ENSP00000363509:Q415K;ENSP00000363524:Q415K	ENSP00000363509:Q415K	Q	+	1	0	KIF4A	69478483	0.995000	0.38212	0.998000	0.56505	0.941000	0.58515	2.289000	0.43523	0.964000	0.38108	0.422000	0.28245	CAG		0.418	KIF4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057068.1		NM_012310	
KRTAP5-10	387273	hgsc.bcm.edu	37	11	71276827	71276827	+	Missense_Mutation	SNP	G	G	T			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr11:71276827G>T	ENST00000398531.1	+	1	219	c.194G>T	c.(193-195)gGc>gTc	p.G65V	KRTAP5-10_ENST00000376536.4_Missense_Mutation_p.G65V	NM_001012710.1	NP_001012728.1	Q6L8G5	KR510_HUMAN	keratin associated protein 5-10	65	7 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				endometrium(2)|large_intestine(1)|lung(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	12						TCCAGCTGTGGCTCCTGTGGG	0.682																																																	0													61.0	82.0	75.0					11																	71276827		2173	4252	6425	SO:0001583	missense	387273			AB126079	CCDS41684.1	11q13.4	2008-02-05			ENSG00000204572	ENSG00000204572		"""Keratin associated proteins"""	23605	protein-coding gene	gene with protein product						15144888	Standard	NM_001012710		Approved	KRTAP5.10	uc001oqt.1	Q6L8G5	OTTHUMG00000057585	ENST00000398531.1:c.194G>T	11.37:g.71276827G>T	ENSP00000381542:p.Gly65Val		B9EHA4	Missense_Mutation	SNP	ENST00000398531.1	37	CCDS41684.1	.	.	.	.	.	.	.	.	.	.	g	2.065	-0.414339	0.04766	.	.	ENSG00000204572	ENST00000398531;ENST00000376536	T;T	0.01228	5.16;5.14	1.67	1.67	0.24075	.	.	.	.	.	T	0.08223	0.0205	M	0.88640	2.97	0.48185	D	0.999602	D	0.76494	0.999	D	0.72075	0.976	T	0.03875	-1.0996	9	0.54805	T	0.06	.	9.3455	0.38107	0.0:0.0:1.0:0.0	.	65	Q6L8G5	KR510_HUMAN	V	65	ENSP00000381542:G65V;ENSP00000365719:G65V	ENSP00000365719:G65V	G	+	2	0	KRTAP5-10	70954475	0.990000	0.36364	0.970000	0.41538	0.310000	0.27922	2.237000	0.43061	1.285000	0.44548	0.405000	0.27470	GGC		0.682	KRTAP5-10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000127968.2			
LRP2	4036	hgsc.bcm.edu;ucsc.edu	37	2	170029718	170029718	+	Silent	SNP	G	G	A			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr2:170029718G>A	ENST00000263816.3	-	57	11316	c.11031C>T	c.(11029-11031)ctC>ctT	p.L3677L		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	3677	LDL-receptor class A 30. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	AGTTGTCACAGAGATGGGCAG	0.478																																																	0													88.0	86.0	87.0					2																	170029718		2203	4300	6503	SO:0001819	synonymous_variant	4036				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.11031C>T	2.37:g.170029718G>A			O00711|Q16215	Silent	SNP	ENST00000263816.3	37	CCDS2232.1																																																																																				0.478	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2		NM_004525	
MAGEF1	64110	hgsc.bcm.edu	37	3	184429133	184429134	+	In_Frame_Ins	INS	-	-	TCC	rs397720350|rs34995413|rs112819846|rs372659667	byFrequency	TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr3:184429133_184429134insTCC	ENST00000317897.3	-	1	702_703	c.476_477insGGA	c.(475-477)gat>gaGGAt	p.158_159insE		NM_022149.4	NP_071432.2	Q9HAY2	MAGF1_HUMAN	melanoma antigen family F, 1	158	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.			E -> EE (in Ref. 1; AAG30208, 2; AAG38606 and 3; AAH10056). {ECO:0000305}.		extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|large_intestine(1)|lung(5)|ovary(2)|urinary_tract(1)	11	all_cancers(143;4.61e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;5.64e-35)|OV - Ovarian serous cystadenocarcinoma(80;2.56e-22)			CTCCTCCCAGAtcctcctcctc	0.51																																																	0																																										SO:0001652	inframe_insertion	64110			AF295378	CCDS3269.1	3q13	2008-02-05			ENSG00000177383	ENSG00000177383			29639	protein-coding gene	gene with protein product		609267				11313144	Standard	NM_022149		Approved		uc003fpa.3	Q9HAY2	OTTHUMG00000156712	ENST00000317897.3:c.474_476dupGGA	3.37:g.184429140_184429142dupTCC	ENSP00000315064:p.Glu158_Glu158dup		Q9H215	In_Frame_Ins	INS	ENST00000317897.3	37	CCDS3269.1																																																																																				0.510	MAGEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345417.1		NM_022149	
MAP3K1	4214	hgsc.bcm.edu	37	5	56178606	56178606	+	Missense_Mutation	SNP	G	G	C			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr5:56178606G>C	ENST00000399503.3	+	14	3579	c.3579G>C	c.(3577-3579)atG>atC	p.M1193I		NM_005921.1	NP_005912.1	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase	1193					activation of MAPKK activity (GO:0000186)|apoptotic mitochondrial changes (GO:0008637)|cellular response to mechanical stimulus (GO:0071260)|epithelial cell morphogenesis (GO:0003382)|eyelid development in camera-type eye (GO:0061029)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of actin filament polymerization (GO:0030838)|protein phosphorylation (GO:0006468)|regulation of cell migration (GO:0030334)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	cytosol (GO:0005829)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)			NS(1)|breast(19)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(11)|ovary(1)|skin(3)|urinary_tract(1)	57		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		CAATTGCCATGGCAATGTCAG	0.398																																																	0													84.0	86.0	85.0					5																	56178606		2114	4251	6365	SO:0001583	missense	4214			U29671, AF042838	CCDS43318.1	5q11.2	2012-02-23	2012-02-23		ENSG00000095015	ENSG00000095015		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6848	protein-coding gene	gene with protein product		600982	"""mitogen-activated protein kinase kinase kinase 1"""	MEKK1		8597633	Standard	NM_005921		Approved	MEKK, MAPKKK1	uc003jqw.4	Q13233	OTTHUMG00000059486	ENST00000399503.3:c.3579G>C	5.37:g.56178606G>C	ENSP00000382423:p.Met1193Ile			Missense_Mutation	SNP	ENST00000399503.3	37	CCDS43318.1	.	.	.	.	.	.	.	.	.	.	G	15.32	2.800115	0.50208	.	.	ENSG00000095015	ENST00000399503	T	0.68331	-0.32	6.17	6.17	0.99709	.	0.042575	0.85682	D	0.000000	T	0.63943	0.2554	L	0.47716	1.5	0.58432	D	0.999999	B	0.30406	0.278	B	0.24974	0.057	T	0.61431	-0.7064	10	0.59425	D	0.04	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	1193	Q13233	M3K1_HUMAN	I	1193	ENSP00000382423:M1193I	ENSP00000382423:M1193I	M	+	3	0	MAP3K1	56214363	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.121000	0.89582	2.941000	0.99782	0.655000	0.94253	ATG		0.398	MAP3K1-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000132309.2		XM_042066	
MDC1	9656	hgsc.bcm.edu;ucsc.edu	37	6	30672175	30672175	+	Silent	SNP	C	C	G			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr6:30672175C>G	ENST00000376406.3	-	10	5432	c.4785G>C	c.(4783-4785)cgG>cgC	p.R1595R	MDC1-AS1_ENST00000442150.1_RNA|MDC1_ENST00000376405.2_Silent_p.R1331R	NM_014641.2	NP_055456.2	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1	1595	Interaction with the PRKDC complex.				DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|intra-S DNA damage checkpoint (GO:0031573)	chromosome (GO:0005694)|focal adhesion (GO:0005925)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	FHA domain binding (GO:0070975)|protein C-terminus binding (GO:0008022)			breast(2)|kidney(1)|ovary(1)	4						ACCTAGTGGCCCGAGATGTGG	0.587								Other conserved DNA damage response genes																																									0													116.0	129.0	124.0					6																	30672175		2203	4300	6503	SO:0001819	synonymous_variant	9656			D79992	CCDS34384.1	6p21.3	2010-02-17	2009-06-12		ENSG00000137337	ENSG00000137337			21163	protein-coding gene	gene with protein product		607593				10975465, 12607005	Standard	NM_014641		Approved	NFBD1, KIAA0170, Em:AB023051.5	uc003nrg.4	Q14676	OTTHUMG00000031075	ENST00000376406.3:c.4785G>C	6.37:g.30672175C>G			A2AB04|A2BF04|A2RRA8|A7YY86|B0S8A2|Q0EFC2|Q2L6H7|Q2TAZ4|Q5JP55|Q5JP56|Q5ST83|Q68CQ3|Q86Z06|Q96QC2	Silent	SNP	ENST00000376406.3	37	CCDS34384.1																																																																																				0.587	MDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076103.1		NM_014641	
MPHOSPH6	10200	hgsc.bcm.edu	37	16	82203742	82203742	+	Silent	SNP	T	T	C	rs1134847	byFrequency	TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr16:82203742T>C	ENST00000258169.4	-	1	89	c.39A>G	c.(37-39)ctA>ctG	p.L13L	CTD-2588J6.2_ENST00000563841.1_lincRNA|MPHOSPH6_ENST00000563504.1_5'UTR|MPHOSPH6_ENST00000567729.1_5'UTR|MPHOSPH6_ENST00000569021.1_Silent_p.L13L	NM_005792.2	NP_005783.2	Q99547	MPH6_HUMAN	M-phase phosphoprotein 6	13					maturation of 5.8S rRNA (GO:0000460)	cytoplasm (GO:0005737)|exosome (RNase complex) (GO:0000178)|nucleolus (GO:0005730)|nucleus (GO:0005634)	RNA binding (GO:0003723)			endometrium(1)|large_intestine(1)|lung(3)	5						TCATGCGCAGTAGATTCTTGG	0.711													C|||	3218	0.642572	0.4054	0.8127	5008	,	,		13310	0.7649		0.7465	False		,,,				2504	0.6094																0								C		2116,2282		524,1068,607	32.0	24.0	27.0		39	2.6	1.0	16	dbSNP_86	27	6335,2261		2348,1639,311	no	coding-synonymous	MPHOSPH6	NM_005792.2		2872,2707,918	CC,CT,TT		26.3029,48.1128,34.9623		13/161	82203742	8451,4543	2199	4298	6497	SO:0001819	synonymous_variant	10200			X98263	CCDS10937.1	16q23.3	2008-03-03			ENSG00000135698	ENSG00000135698			7214	protein-coding gene	gene with protein product		605500				8885239	Standard	NM_005792		Approved	MPP6	uc002fgw.3	Q99547	OTTHUMG00000137632	ENST00000258169.4:c.39A>G	16.37:g.82203742T>C			B2RAF0	Silent	SNP	ENST00000258169.4	37	CCDS10937.1																																																																																				0.711	MPHOSPH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269058.1		NM_005792	
MPHOSPH8	54737	hgsc.bcm.edu	37	13	20220763	20220763	+	Missense_Mutation	SNP	C	C	A			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr13:20220763C>A	ENST00000361479.5	+	3	618	c.550C>A	c.(550-552)Cca>Aca	p.P184T	MPHOSPH8_ENST00000414242.2_Missense_Mutation_p.P184T	NM_017520.3	NP_059990.2	Q99549	MPP8_HUMAN	M-phase phosphoprotein 8	184	Lys-rich.				negative regulation of transcription, DNA-templated (GO:0045892)|regulation of DNA methylation (GO:0044030)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear heterochromatin (GO:0005720)|nuclear nucleosome (GO:0000788)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	methylated histone binding (GO:0035064)			breast(2)|endometrium(1)|large_intestine(2)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		all_cancers(29;2.83e-16)|all_lung(29;1.16e-17)|all_epithelial(30;8.13e-16)|Lung NSC(5;6.91e-15)|Lung SC(185;0.0367)		all cancers(112;8.43e-05)|Epithelial(112;0.000426)|OV - Ovarian serous cystadenocarcinoma(117;0.00596)|Lung(94;0.015)|LUSC - Lung squamous cell carcinoma(192;0.0795)		CAAGTCCAAACCAGACCTGGA	0.378																																																	0													31.0	34.0	33.0					13																	20220763		2203	4300	6503	SO:0001583	missense	54737			AK056785, AJ293409	CCDS9287.1	13q12.11	2013-01-10			ENSG00000196199	ENSG00000196199		"""Ankyrin repeat domain containing"""	29810	protein-coding gene	gene with protein product		611626				8885239	Standard	NM_017520		Approved	mpp8, HSMPP8	uc001umh.3	Q99549	OTTHUMG00000016498	ENST00000361479.5:c.550C>A	13.37:g.20220763C>A	ENSP00000355388:p.Pro184Thr		B7Z6F9|Q5JPE5|Q5JTQ0|Q86TK3|Q96MK4|Q9BTP1	Missense_Mutation	SNP	ENST00000361479.5	37	CCDS9287.1	.	.	.	.	.	.	.	.	.	.	C	0.001	-3.137475	0.00030	.	.	ENSG00000196199	ENST00000414242;ENST00000361479;ENST00000538024	T;T	0.34667	1.36;1.35	5.45	-6.13	0.02118	.	1.239540	0.05220	N	0.508344	T	0.11110	0.0271	N	0.04203	-0.255	0.09310	N	1	B;B;B	0.11235	0.001;0.004;0.001	B;B;B	0.10450	0.002;0.005;0.001	T	0.20472	-1.0274	10	0.06099	T	0.92	.	1.4914	0.02457	0.1964:0.3667:0.1361:0.3008	.	184;184;184	Q99549;Q99549-2;B3KS10	MPP8_HUMAN;.;.	T	184	ENSP00000414663:P184T;ENSP00000355388:P184T	ENSP00000355388:P184T	P	+	1	0	MPHOSPH8	19118763	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	-1.273000	0.02823	-1.406000	0.02045	-2.084000	0.00378	CCA		0.378	MPHOSPH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044028.2		NM_017520	
MTRR	4552	hgsc.bcm.edu;ucsc.edu	37	5	7875376	7875376	+	Missense_Mutation	SNP	G	G	T			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr5:7875376G>T	ENST00000264668.2	+	4	400	c.370G>T	c.(370-372)Ggt>Tgt	p.G124C	MTRR_ENST00000502509.1_3'UTR|MTRR_ENST00000440940.2_Missense_Mutation_p.G97C|MTRR_ENST00000341013.6_Silent_p.S45S	NM_002454.2|NM_024010.2	NP_002445.2|NP_076915.2	Q9UBK8	MTRR_HUMAN	5-methyltetrahydrofolate-homocysteine methyltransferase reductase	124	Flavodoxin-like. {ECO:0000255|PROSITE- ProRule:PRU00088}.				cellular nitrogen compound metabolic process (GO:0034641)|cobalamin metabolic process (GO:0009235)|DNA methylation (GO:0006306)|folic acid metabolic process (GO:0046655)|methionine biosynthetic process (GO:0009086)|methionine metabolic process (GO:0006555)|methylation (GO:0032259)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	[methionine synthase] reductase activity (GO:0030586)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|oxidoreductase activity, oxidizing metal ions, NAD or NADP as acceptor (GO:0016723)			NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(14)|ovary(1)|prostate(3)|stomach(1)	31					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)	TCTAGGTCTCGGTGATTCAGA	0.348																																																	0													110.0	117.0	115.0					5																	7875376		2203	4300	6503	SO:0001583	missense	4552			AF025794	CCDS3874.1, CCDS47190.1	5p15.31	2011-05-12			ENSG00000124275	ENSG00000124275	1.16.1.8		7473	protein-coding gene	gene with protein product		602568				9501215	Standard	NM_024010		Approved	cblE	uc003jed.3	Q9UBK8	OTTHUMG00000090477	ENST00000264668.2:c.370G>T	5.37:g.7875376G>T	ENSP00000264668:p.Gly124Cys		O60471|Q32MA9|Q7Z4M8	Missense_Mutation	SNP	ENST00000264668.2	37	CCDS3874.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.84|16.84	3.233120|3.233120	0.58777|0.58777	.|.	.|.	ENSG00000124275|ENSG00000124275	ENST00000264668;ENST00000440940;ENST00000502550;ENST00000512217|ENST00000514220	D;D;D;D|.	0.93019|.	-3.15;-3.15;-3.15;-3.15|.	5.46|5.46	5.46|5.46	0.80206|0.80206	Flavodoxin/nitric oxide synthase (2);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.91085|0.91085	0.7194|0.7194	H|H	0.98466|0.98466	4.24|4.24	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.97110|.	1.0|.	D|D	0.94148|0.94148	0.7403|0.7403	10|5	0.87932|.	D|.	0|.	-34.0986|-34.0986	19.6891|19.6891	0.95991|0.95991	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	124|.	Q9UBK8|.	MTRR_HUMAN|.	C|L	124;97;97;97|25	ENSP00000264668:G124C;ENSP00000402510:G97C;ENSP00000424599:G97C;ENSP00000421318:G97C|.	ENSP00000264668:G124C|.	G|R	+|+	1|2	0|0	MTRR|MTRR	7928376|7928376	1.000000|1.000000	0.71417|0.71417	0.820000|0.820000	0.32676|0.32676	0.054000|0.054000	0.15201|0.15201	8.304000|8.304000	0.89958|0.89958	2.706000|2.706000	0.92434|0.92434	0.655000|0.655000	0.94253|0.94253	GGT|CGG		0.348	MTRR-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000206931.1			
MUC13	56667	hgsc.bcm.edu;ucsc.edu	37	3	124632487	124632487	+	Missense_Mutation	SNP	C	C	A			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr3:124632487C>A	ENST00000311075.3	-	7	1041	c.1003G>T	c.(1003-1005)Gat>Tat	p.D335Y		NM_033049.3	NP_149038	Q9H3R2	MUC13_HUMAN	mucin 13, cell surface associated	336	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.|SEA. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(6)|lung(5)|prostate(1)|skin(1)|stomach(1)	18						AGGCAGTCATCCGCAGTCTGG	0.423																																																	0													94.0	84.0	88.0					3																	124632487		2203	4300	6503	SO:0001583	missense	56667			AF286113		3q21.2	2007-01-17	2006-03-14		ENSG00000173702	ENSG00000173702		"""Mucins"""	7511	protein-coding gene	gene with protein product		612181	"""down-regulated in colon cancer 1"", ""mucin 13, epithelial transmembrane"""	DRCC1		11278439	Standard	NM_033049		Approved		uc003ehq.2	Q9H3R2	OTTHUMG00000159484	ENST00000311075.3:c.1003G>T	3.37:g.124632487C>A	ENSP00000312235:p.Asp335Tyr		Q6UWD9|Q9NXT5	Missense_Mutation	SNP	ENST00000311075.3	37		.	.	.	.	.	.	.	.	.	.	C	12.82	2.052219	0.36181	.	.	ENSG00000173702	ENST00000311075	D	0.87729	-2.29	4.08	-0.568	0.11760	.	1.288510	0.05157	N	0.496946	D	0.89269	0.6667	L	0.53249	1.67	0.09310	N	1	D	0.76494	0.999	P	0.62885	0.908	T	0.75235	-0.3389	10	0.66056	D	0.02	-17.5788	3.7128	0.08427	0.0:0.3931:0.1908:0.4162	.	335	Q9H3R2	MUC13_HUMAN	Y	335	ENSP00000312235:D335Y	ENSP00000312235:D335Y	D	-	1	0	MUC13	126115177	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.564000	0.05936	-0.111000	0.12001	0.455000	0.32223	GAT		0.423	MUC13-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000355714.1		NM_033049	
NAPRT	93100	hgsc.bcm.edu	37	8	144658711	144658711	+	Silent	SNP	G	G	A	rs872935	byFrequency	TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr8:144658711G>A	ENST00000449291.2	-	7	1207	c.913C>T	c.(913-915)Ctg>Ttg	p.L305L	NAPRT1_ENST00000426292.3_Silent_p.L305L|NAPRT1_ENST00000276844.7_Silent_p.L305L|NAPRT1_ENST00000435154.3_Silent_p.L305L|RP11-661A12.9_ENST00000531730.1_RNA|NAPRT1_ENST00000460623.1_5'Flank																endometrium(1)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	6	all_cancers(97;6.49e-11)|all_epithelial(106;4.73e-09)|Lung NSC(106;0.000202)|all_lung(105;0.000548)|Ovarian(258;0.014)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.146)			CCCAGGGCCAGGGCGACTGCT	0.627													G|||	1990	0.397364	0.1672	0.4611	5008	,	,		17958	0.3938		0.6262	False		,,,				2504	0.4315																0								G		1024,3376	356.4+/-313.5	121,782,1297	27.0	27.0	27.0		913	1.4	0.7	8	dbSNP_86	27	5389,3211	629.3+/-398.2	1704,1981,615	no	coding-synonymous	NAPRT1	NM_145201.4		1825,2763,1912	AA,AG,GG		37.3372,23.2727,49.3308		305/539	144658711	6413,6587	2200	4300	6500	SO:0001819	synonymous_variant	93100																														ENST00000449291.2:c.913C>T	8.37:g.144658711G>A				Silent	SNP	ENST00000449291.2	37	CCDS6403.2																																																																																				0.627	NAPRT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346708.3			
NBPF3	84224	hgsc.bcm.edu	37	1	21808099	21808099	+	Silent	SNP	A	A	G			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr1:21808099A>G	ENST00000318249.5	+	13	1793	c.1443A>G	c.(1441-1443)agA>agG	p.R481R	NBPF3_ENST00000454000.2_Silent_p.R411R|NBPF3_ENST00000318220.6_Silent_p.R425R|NBPF3_ENST00000342104.5_Silent_p.R469R	NM_032264.3	NP_115640.1	Q9H094	NBPF3_HUMAN	neuroblastoma breakpoint family, member 3	481	NBPF 4. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)				breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	20		all_lung(284;2.16e-05)|Lung NSC(340;2.19e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00432)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|OV - Ovarian serous cystadenocarcinoma(117;7.53e-27)|COAD - Colon adenocarcinoma(152;1.18e-05)|GBM - Glioblastoma multiforme(114;3.47e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000143)|STAD - Stomach adenocarcinoma(196;0.00306)|KIRC - Kidney renal clear cell carcinoma(1967;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		GGCTCAGCAGAGAGCTGCCGG	0.483																																																	0													64.0	77.0	72.0					1																	21808099		2200	4298	6498	SO:0001819	synonymous_variant	84224			BC024011	CCDS216.1, CCDS57976.1, CCDS57977.1	1p36.12	2013-01-17			ENSG00000142794	ENSG00000142794		"""neuroblastoma breakpoint family"""	25076	protein-coding gene	gene with protein product		612992				11230166, 16079250	Standard	NM_032264		Approved	AE2	uc001ber.4	Q9H094	OTTHUMG00000002944	ENST00000318249.5:c.1443A>G	1.37:g.21808099A>G			A8K965|B4DSP2|I3L0I8|Q3BBW1|Q5VTG2|Q5VTG3|Q5VTG4|Q8IX78|Q8ND86|Q8TC96	Silent	SNP	ENST00000318249.5	37	CCDS216.1																																																																																				0.483	NBPF3-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			NM_032264	
NBPF3	84224	hgsc.bcm.edu	37	1	21808128	21808128	+	Missense_Mutation	SNP	A	A	T			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr1:21808128A>T	ENST00000318249.5	+	13	1822	c.1472A>T	c.(1471-1473)gAc>gTc	p.D491V	NBPF3_ENST00000454000.2_Missense_Mutation_p.D421V|NBPF3_ENST00000318220.6_Missense_Mutation_p.D435V|NBPF3_ENST00000342104.5_Missense_Mutation_p.D479V	NM_032264.3	NP_115640.1	Q9H094	NBPF3_HUMAN	neuroblastoma breakpoint family, member 3	491	NBPF 4. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)				breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	20		all_lung(284;2.16e-05)|Lung NSC(340;2.19e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00432)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|OV - Ovarian serous cystadenocarcinoma(117;7.53e-27)|COAD - Colon adenocarcinoma(152;1.18e-05)|GBM - Glioblastoma multiforme(114;3.47e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000143)|STAD - Stomach adenocarcinoma(196;0.00306)|KIRC - Kidney renal clear cell carcinoma(1967;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		GAGCCTGAGGACTTGCAGGAC	0.488																																																	0													62.0	73.0	70.0					1																	21808128		2202	4298	6500	SO:0001583	missense	84224			BC024011	CCDS216.1, CCDS57976.1, CCDS57977.1	1p36.12	2013-01-17			ENSG00000142794	ENSG00000142794		"""neuroblastoma breakpoint family"""	25076	protein-coding gene	gene with protein product		612992				11230166, 16079250	Standard	NM_032264		Approved	AE2	uc001ber.4	Q9H094	OTTHUMG00000002944	ENST00000318249.5:c.1472A>T	1.37:g.21808128A>T	ENSP00000316782:p.Asp491Val		A8K965|B4DSP2|I3L0I8|Q3BBW1|Q5VTG2|Q5VTG3|Q5VTG4|Q8IX78|Q8ND86|Q8TC96	Missense_Mutation	SNP	ENST00000318249.5	37	CCDS216.1	.	.	.	.	.	.	.	.	.	.	.	0.001	-3.636860	0.00007	.	.	ENSG00000142794	ENST00000454000;ENST00000318220;ENST00000318249;ENST00000342104;ENST00000434838	T;T;T;T;T	0.02103	4.45;4.45;4.45;4.45;4.45	0.766	-1.53	0.08611	DUF1220 (2);	.	.	.	.	T	0.00468	0.0015	N	0.00102	-2.13	0.09310	N	1	B;B;B	0.10296	0.001;0.003;0.0	B;B;B	0.06405	0.002;0.0;0.001	T	0.36817	-0.9732	9	0.02654	T	1	.	2.1133	0.03708	0.2551:0.3586:0.0:0.3863	.	421;479;491	B4DSP2;Q9H094-3;Q9H094	.;.;NBPF3_HUMAN	V	421;435;491;479;435	ENSP00000415711:D421V;ENSP00000316739:D435V;ENSP00000316782:D491V;ENSP00000340336:D479V;ENSP00000391865:D435V	ENSP00000316739:D435V	D	+	2	0	NBPF3	21680715	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.375000	0.07475	-1.691000	0.01430	-2.159000	0.00328	GAC		0.488	NBPF3-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			NM_032264	
NUP210	23225	hgsc.bcm.edu;ucsc.edu	37	3	13415333	13415333	+	Missense_Mutation	SNP	C	C	T			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr3:13415333C>T	ENST00000254508.5	-	12	1554	c.1472G>A	c.(1471-1473)aGc>aAc	p.S491N		NM_024923.2	NP_079199.2	Q8TEM1	PO210_HUMAN	nucleoporin 210kDa	491	Poly-Ser.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|liver(1)|lung(16)|ovary(7)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	66	all_neural(104;0.187)					AACCAGGTGGCTTGACGAAGA	0.582																																																	0													141.0	98.0	112.0					3																	13415333		2203	4300	6503	SO:0001583	missense	23225			AB020713	CCDS33704.1	3p25	2008-02-05			ENSG00000132182	ENSG00000132182			30052	protein-coding gene	gene with protein product		607703				2184032, 7504063	Standard	NM_024923		Approved	GP210, POM210, FLJ22389, KIAA0906	uc003bxv.1	Q8TEM1	OTTHUMG00000157268	ENST00000254508.5:c.1472G>A	3.37:g.13415333C>T	ENSP00000254508:p.Ser491Asn		A6NN56|O94980|Q6NXG6|Q8NBJ1|Q9H6C8|Q9UFP3	Missense_Mutation	SNP	ENST00000254508.5	37	CCDS33704.1	.	.	.	.	.	.	.	.	.	.	C	1.514	-0.548689	0.04024	.	.	ENSG00000132182	ENST00000254508	T	0.33865	1.39	5.8	0.801	0.18679	Invasin/intimin cell-adhesion (1);	0.318375	0.38959	N	0.001502	T	0.09555	0.0235	N	0.01800	-0.715	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.001	T	0.34850	-0.9812	10	0.02654	T	1	.	5.2266	0.15397	0.0:0.3792:0.2557:0.3652	.	491;491	Q8TEM1-2;Q8TEM1	.;PO210_HUMAN	N	491	ENSP00000254508:S491N	ENSP00000254508:S491N	S	-	2	0	NUP210	13390333	0.995000	0.38212	0.001000	0.08648	0.737000	0.42083	1.650000	0.37292	0.083000	0.17047	0.655000	0.94253	AGC		0.582	NUP210-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340085.1		NM_024923	
OAS2	4939	hgsc.bcm.edu;ucsc.edu	37	12	113448226	113448226	+	Silent	SNP	C	C	T			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr12:113448226C>T	ENST00000342315.4	+	11	2311	c.2097C>T	c.(2095-2097)gtC>gtT	p.V699V	OAS2_ENST00000392583.2_3'UTR|RP1-71H24.1_ENST00000552784.1_RNA	NM_016817.2	NP_058197.2	P29728	OAS2_HUMAN	2'-5'-oligoadenylate synthetase 2, 69/71kDa	699					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|nucleobase-containing compound metabolic process (GO:0006139)|protein glycosylation (GO:0006486)|protein myristoylation (GO:0018377)|purine nucleotide biosynthetic process (GO:0006164)|response to virus (GO:0009615)|RNA catabolic process (GO:0006401)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	2'-5'-oligoadenylate synthetase activity (GO:0001730)|ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(4)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	28						ATCCTATTGTCAATGAGATGT	0.388																																					Pancreas(199;709 2232 18410 33584 35052)												0													242.0	251.0	248.0					12																	113448226		2203	4300	6503	SO:0001819	synonymous_variant	4939			M87284	CCDS31906.1, CCDS41839.1, CCDS44982.1	12q24.2	2008-05-02	2002-08-29			ENSG00000111335			8087	protein-coding gene	gene with protein product		603350	"""2'-5'-oligoadenylate synthetase 2 (69-71 kD)"""			9790745	Standard	NM_002535		Approved		uc001tuj.3	P29728	OTTHUMG00000169802	ENST00000342315.4:c.2097C>T	12.37:g.113448226C>T			A8K9T1|Q6PJ33|Q86XX8	Silent	SNP	ENST00000342315.4	37	CCDS31906.1																																																																																				0.388	OAS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405937.1			
OR5B3	441608	hgsc.bcm.edu;ucsc.edu	37	11	58170027	58170027	+	Missense_Mutation	SNP	G	G	T			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr11:58170027G>T	ENST00000309403.2	-	1	855	c.856C>A	c.(856-858)Ctg>Atg	p.L286M		NM_001005469.1	NP_001005469.1	Q8NH48	OR5B3_HUMAN	olfactory receptor, family 5, subfamily B, member 3	286						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L286L(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(17)|ovary(1)|prostate(1)|skin(2)|stomach(6)|upper_aerodigestive_tract(1)	34	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				CTATAGACCAGAGGGTTCAGC	0.428																																																	1	Substitution - coding silent(1)	skin(1)											140.0	121.0	127.0					11																	58170027		2201	4295	6496	SO:0001583	missense	441608			AB065545	CCDS31549.1	11q12.1	2012-08-09			ENSG00000172769	ENSG00000172769		"""GPCR / Class A : Olfactory receptors"""	8324	protein-coding gene	gene with protein product				OR5B13			Standard	NM_001005469		Approved	OST129	uc010rkf.2	Q8NH48	OTTHUMG00000167516	ENST00000309403.2:c.856C>A	11.37:g.58170027G>T	ENSP00000308270:p.Leu286Met		Q6IEV6	Missense_Mutation	SNP	ENST00000309403.2	37	CCDS31549.1	.	.	.	.	.	.	.	.	.	.	g	0.364	-0.937668	0.02340	.	.	ENSG00000172769	ENST00000309403	T	0.45668	0.89	4.06	-8.11	0.01082	GPCR, rhodopsin-like superfamily (1);	1.902410	0.02779	N	0.120619	T	0.26231	0.0640	L	0.38692	1.165	0.09310	N	1	B	0.32010	0.351	B	0.29267	0.1	T	0.13872	-1.0493	10	0.54805	T	0.06	0.2983	2.5094	0.04652	0.1574:0.1117:0.326:0.4049	.	286	Q8NH48	OR5B3_HUMAN	M	286	ENSP00000308270:L286M	ENSP00000308270:L286M	L	-	1	2	OR5B3	57926603	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-6.355000	0.00069	-2.490000	0.00517	-0.165000	0.13383	CTG		0.428	OR5B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394886.1		NM_001005469	
ORC2	4999	hgsc.bcm.edu	37	2	201814292	201814292	+	Missense_Mutation	SNP	T	T	C			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr2:201814292T>C	ENST00000234296.2	-	5	562	c.313A>G	c.(313-315)Aag>Gag	p.K105E	ORC2_ENST00000467605.1_5'UTR	NM_006190.4	NP_006181.1	Q13416	ORC2_HUMAN	origin recognition complex, subunit 2	105					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	condensed chromosome inner kinetochore (GO:0000939)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|origin recognition complex (GO:0000808)|plasma membrane (GO:0005886)	DNA replication origin binding (GO:0003688)			breast(1)|endometrium(1)|large_intestine(2)|lung(10)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	20						TTAGCCATCTTTTCAGAGTGT	0.308																																																	0													49.0	46.0	47.0					2																	201814292		2201	4285	6486	SO:0001583	missense	0				CCDS2334.1	2q33	2010-10-12	2010-10-12	2010-10-12	ENSG00000115942	ENSG00000115942			8488	protein-coding gene	gene with protein product		601182	"""origin recognition complex, subunit 2 (yeast homolog)-like"", ""origin recognition complex, subunit 2-like (yeast)"", ""origin recognition complex, subunit 2 homolog (yeast)"""	ORC2L		8808289	Standard	NM_006190		Approved		uc002uwr.3	Q13416	OTTHUMG00000132783	ENST00000234296.2:c.313A>G	2.37:g.201814292T>C	ENSP00000234296:p.Lys105Glu		Q13204|Q53TX5	Missense_Mutation	SNP	ENST00000234296.2	37	CCDS2334.1	.	.	.	.	.	.	.	.	.	.	T	13.92	2.380822	0.42207	.	.	ENSG00000115942	ENST00000234296;ENST00000410039	T;T	0.50548	1.33;0.74	5.71	4.56	0.56223	.	0.202175	0.52532	N	0.000080	T	0.25754	0.0627	N	0.14661	0.345	0.31695	N	0.641374	B;B	0.16802	0.019;0.019	B;B	0.14578	0.009;0.011	T	0.25328	-1.0135	10	0.11485	T	0.65	-7.9395	7.7723	0.29015	0.0:0.0959:0.0:0.9041	.	105;105	B4DYU9;Q13416	.;ORC2_HUMAN	E	105	ENSP00000234296:K105E;ENSP00000386390:K105E	ENSP00000234296:K105E	K	-	1	0	ORC2	201522537	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.842000	0.48230	1.001000	0.39076	0.477000	0.44152	AAG		0.308	ORC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256191.2		NM_006190	
PABPC1	26986	hgsc.bcm.edu	37	8	101721709	101721709	+	Missense_Mutation	SNP	T	T	A	rs146200489	byFrequency	TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr8:101721709T>A	ENST00000318607.5	-	8	2351	c.1223A>T	c.(1222-1224)tAc>tTc	p.Y408F	PABPC1_ENST00000522387.1_Missense_Mutation_p.Y376F|PABPC1_ENST00000519596.1_5'UTR|PABPC1_ENST00000519004.1_Missense_Mutation_p.Y363F|AP001205.1_ENST00000579868.1_RNA	NM_002568.3	NP_002559.2	P11940	PABP1_HUMAN	poly(A) binding protein, cytoplasmic 1	408					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|mRNA stabilization (GO:0048255)|negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|translation activator activity (GO:0008494)			breast(2)|endometrium(4)|kidney(15)|large_intestine(4)|lung(13)|prostate(1)|skin(1)	40	all_cancers(14;6.8e-05)|all_epithelial(15;3.16e-07)|Lung NSC(17;0.000453)|all_lung(17;0.00125)		Epithelial(11;6.37e-11)|all cancers(13;1.11e-08)|OV - Ovarian serous cystadenocarcinoma(57;3.91e-05)|STAD - Stomach adenocarcinoma(118;0.206)			TGCCATGAAGTAACCTGAAGG	0.493																																																	0													103.0	93.0	96.0					8																	101721709		2203	4300	6503	SO:0001583	missense	26986			Y00345	CCDS6289.1	8q22.2-q23	2013-02-12	2004-04-20		ENSG00000070756	ENSG00000070756		"""RNA binding motif (RRM) containing"""	8554	protein-coding gene	gene with protein product		604679	"""poly(A)-binding protein, cytoplasmic 2"""	PAB1, PABPC2		2885805	Standard	XM_005250861		Approved	PABP1, PABPL1	uc003yjs.1	P11940	OTTHUMG00000164779	ENST00000318607.5:c.1223A>T	8.37:g.101721709T>A	ENSP00000313007:p.Tyr408Phe		Q15097|Q93004	Missense_Mutation	SNP	ENST00000318607.5	37	CCDS6289.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	T|T|T	17.26|17.26|17.26	3.344254|3.344254|3.344254	0.61073|0.61073|0.61073	.|.|.	.|.|.	ENSG00000070756|ENSG00000070756|ENSG00000070756	ENST00000519596|ENST00000517403;ENST00000519100|ENST00000318607;ENST00000347137;ENST00000519004;ENST00000522387	.|.|T;T;T	.|.|0.29917	.|.|1.64;1.55;2.61	5.37|5.37|5.37	5.37|5.37|5.37	0.77165|0.77165|0.77165	.|.|.	.|.|0.000000	.|.|0.64402	.|.|D	.|.|0.000016	T|T|T	0.31796|0.31796|0.31796	0.0808|0.0808|0.0808	L|L|L	0.54908|0.54908|0.54908	1.71|1.71|1.71	0.53688|0.53688|0.53688	D|D|D	0.999979|0.999979|0.999979	.|.|B;B;B	.|.|0.09022	.|.|0.0;0.002;0.002	.|.|B;B;B	.|.|0.10450	.|.|0.005;0.003;0.005	T|T|T	0.05257|0.05257|0.05257	-1.0896|-1.0896|-1.0896	5|5|10	.|.|0.33141	.|.|T	.|.|0.24	.|.|.	15.6695|15.6695|15.6695	0.77262|0.77262|0.77262	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.|.	.|.|376;408;408	.|.|E7ERJ7;B3KT93;P11940	.|.|.;.;PABP1_HUMAN	F|S|F	240|61;277|408;408;363;376	.|.|ENSP00000313007:Y408F;ENSP00000429594:Y363F;ENSP00000429395:Y376F	.|.|ENSP00000313007:Y408F	L|T|Y	-|-|-	3|1|2	2|0|0	PABPC1|PABPC1|PABPC1	101790885|101790885|101790885	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.998000|0.998000|0.998000	0.95712|0.95712|0.95712	8.010000|8.010000|8.010000	0.88615|0.88615|0.88615	2.163000|2.163000|2.163000	0.67991|0.67991|0.67991	0.533000|0.533000|0.533000	0.62120|0.62120|0.62120	TTA|ACT|TAC		0.493	PABPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380217.1		NM_002568	
PABPC1L	80336	hgsc.bcm.edu;ucsc.edu	37	20	43559156	43559156	+	Missense_Mutation	SNP	C	C	G			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr20:43559156C>G	ENST00000217073.2	+	8	1028	c.1028C>G	c.(1027-1029)cCa>cGa	p.P343R	PABPC1L_ENST00000255136.3_Missense_Mutation_p.P343R|PABPC1L_ENST00000372819.1_5'Flank|PABPC1L_ENST00000490798.1_3'UTR|PABPC1L_ENST00000372824.1_5'Flank|PABPC1L_ENST00000217074.4_Intron|PABPC1L_ENST00000217075.2_5'Flank|PABPC1L_ENST00000537323.1_Intron			Q4VXU2	PAP1L_HUMAN	poly(A) binding protein, cytoplasmic 1-like	343	RRM 4. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA polyadenylation (GO:0006378)|oocyte maturation (GO:0001556)	extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)	20						TTTTCCTCCCCAGAAGAGGCG	0.587																																																	0													217.0	202.0	207.0					20																	43559156		1568	3582	5150	SO:0001583	missense	80336			AK026760	CCDS42878.1	20q12-q13.1	2013-02-12	2007-11-21	2007-11-21	ENSG00000101104	ENSG00000101104		"""RNA binding motif (RRM) containing"""	15797	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 119"""	C20orf119		11549316	Standard	NM_001124756		Approved	dJ1069P2.3, PABPC1L1, ePAB	uc010ggv.1	Q4VXU2	OTTHUMG00000032553	ENST00000217073.2:c.1028C>G	20.37:g.43559156C>G	ENSP00000217073:p.Pro343Arg		Q4VY17	Missense_Mutation	SNP	ENST00000217073.2	37	CCDS42878.1	.	.	.	.	.	.	.	.	.	.	C	29.2	4.985572	0.93044	.	.	ENSG00000101104	ENST00000255136;ENST00000217073	T;T	0.15952	2.38;2.38	5.81	5.81	0.92471	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.33030	0.0849	L	0.27975	0.815	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.04140	-1.0974	10	0.66056	D	0.02	.	20.0826	0.97783	0.0:1.0:0.0:0.0	.	343	Q4VXU2	PAP1L_HUMAN	R	343	ENSP00000255136:P343R;ENSP00000217073:P343R	ENSP00000217073:P343R	P	+	2	0	PABPC1L	42992570	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.784000	0.85713	2.746000	0.94184	0.655000	0.94253	CCA		0.587	PABPC1L-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127816.2			
PABPC3	5042	hgsc.bcm.edu;ucsc.edu	37	13	25670868	25670868	+	Missense_Mutation	SNP	G	G	A	rs200859889	byFrequency	TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr13:25670868G>A	ENST00000281589.3	+	1	569	c.532G>A	c.(532-534)Gaa>Aaa	p.E178K		NM_030979.2	NP_112241.2	Q9H361	PABP3_HUMAN	poly(A) binding protein, cytoplasmic 3	178					mRNA metabolic process (GO:0016071)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|pancreas(1)|skin(3)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		GTCTCGTAAAGAACGAGAAGC	0.403													g|||	262	0.0523163	0.0756	0.0591	5008	,	,		22159	0.0298		0.0308	False		,,,				2504	0.0613																0													104.0	98.0	100.0					13																	25670868		2203	4300	6503	SO:0001583	missense	5042			AF132026	CCDS9311.1	13q12-q13	2013-02-12	2001-11-28		ENSG00000151846	ENSG00000151846		"""RNA binding motif (RRM) containing"""	8556	protein-coding gene	gene with protein product	"""testis PABP"""	604680	"""poly(A)-binding protein, cytoplasmic 3"""	PABPL3		8432538, 10543404	Standard	NM_030979		Approved	PABP3, tPABP	uc001upy.3	Q9H361	OTTHUMG00000016601	ENST00000281589.3:c.532G>A	13.37:g.25670868G>A	ENSP00000281589:p.Glu178Lys		Q8NHV0|Q9H086	Missense_Mutation	SNP	ENST00000281589.3	37	CCDS9311.1	.	.	.	.	.	.	.	.	.	.	G	15.69	2.906877	0.52333	.	.	ENSG00000151846	ENST00000281589	D	0.85861	-2.04	0.828	0.828	0.18841	Nucleotide-binding, alpha-beta plait (1);	0.000000	0.47455	U	0.000224	T	0.76076	0.3937	L	0.60455	1.87	0.50632	D	0.999885	P	0.38455	0.632	B	0.28784	0.094	T	0.73858	-0.3850	10	0.66056	D	0.02	.	7.4633	0.27308	1.0E-4:0.0:0.9999:0.0	.	178	Q9H361	PABP3_HUMAN	K	178	ENSP00000281589:E178K	ENSP00000281589:E178K	E	+	1	0	PABPC3	24568868	1.000000	0.71417	0.959000	0.39883	0.390000	0.30446	6.438000	0.73426	0.748000	0.32831	0.305000	0.20034	GAA		0.403	PABPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044220.2		NM_030979	
PABPC3	5042	hgsc.bcm.edu;ucsc.edu	37	13	25670873	25670873	+	Silent	SNP	A	A	G	rs77142265	byFrequency	TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr13:25670873A>G	ENST00000281589.3	+	1	574	c.537A>G	c.(535-537)cgA>cgG	p.R179R		NM_030979.2	NP_112241.2	Q9H361	PABP3_HUMAN	poly(A) binding protein, cytoplasmic 3	179					mRNA metabolic process (GO:0016071)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|pancreas(1)|skin(3)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		GTAAAGAACGAGAAGCTGAAC	0.408													a|||	274	0.0547125	0.0779	0.0591	5008	,	,		22193	0.0347		0.0318	False		,,,				2504	0.0644																0													103.0	96.0	98.0					13																	25670873		2203	4300	6503	SO:0001819	synonymous_variant	5042			AF132026	CCDS9311.1	13q12-q13	2013-02-12	2001-11-28		ENSG00000151846	ENSG00000151846		"""RNA binding motif (RRM) containing"""	8556	protein-coding gene	gene with protein product	"""testis PABP"""	604680	"""poly(A)-binding protein, cytoplasmic 3"""	PABPL3		8432538, 10543404	Standard	NM_030979		Approved	PABP3, tPABP	uc001upy.3	Q9H361	OTTHUMG00000016601	ENST00000281589.3:c.537A>G	13.37:g.25670873A>G			Q8NHV0|Q9H086	Silent	SNP	ENST00000281589.3	37	CCDS9311.1																																																																																				0.408	PABPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044220.2		NM_030979	
PABPC3	5042	hgsc.bcm.edu	37	13	25670877	25670877	+	Missense_Mutation	SNP	G	G	A	rs112107735	byFrequency	TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr13:25670877G>A	ENST00000281589.3	+	1	578	c.541G>A	c.(541-543)Gct>Act	p.A181T		NM_030979.2	NP_112241.2	Q9H361	PABP3_HUMAN	poly(A) binding protein, cytoplasmic 3	181					mRNA metabolic process (GO:0016071)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|pancreas(1)|skin(3)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		AGAACGAGAAGCTGAACTTGG	0.403													g|||	36	0.0071885	0.0151	0.0043	5008	,	,		22319	0.002		0.003	False		,,,				2504	0.0082																0													101.0	95.0	97.0					13																	25670877		2203	4300	6503	SO:0001583	missense	5042			AF132026	CCDS9311.1	13q12-q13	2013-02-12	2001-11-28		ENSG00000151846	ENSG00000151846		"""RNA binding motif (RRM) containing"""	8556	protein-coding gene	gene with protein product	"""testis PABP"""	604680	"""poly(A)-binding protein, cytoplasmic 3"""	PABPL3		8432538, 10543404	Standard	NM_030979		Approved	PABP3, tPABP	uc001upy.3	Q9H361	OTTHUMG00000016601	ENST00000281589.3:c.541G>A	13.37:g.25670877G>A	ENSP00000281589:p.Ala181Thr		Q8NHV0|Q9H086	Missense_Mutation	SNP	ENST00000281589.3	37	CCDS9311.1	.	.	.	.	.	.	.	.	.	.	G	16.47	3.133453	0.56828	.	.	ENSG00000151846	ENST00000281589	D	0.85629	-2.01	0.828	0.828	0.18841	Nucleotide-binding, alpha-beta plait (1);	0.000000	0.46758	U	0.000272	T	0.80341	0.4605	M	0.69463	2.115	0.43275	D	0.995232	P	0.38335	0.627	B	0.37550	0.253	T	0.76849	-0.2807	10	0.51188	T	0.08	.	7.4633	0.27308	1.0E-4:0.0:0.9999:0.0	.	181	Q9H361	PABP3_HUMAN	T	181	ENSP00000281589:A181T	ENSP00000281589:A181T	A	+	1	0	PABPC3	24568877	1.000000	0.71417	0.873000	0.34254	0.379000	0.30106	4.761000	0.62243	0.748000	0.32831	0.305000	0.20034	GCT		0.403	PABPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044220.2		NM_030979	
PADI6	353238	hgsc.bcm.edu	37	1	17699723	17699723	+	RNA	SNP	G	G	A			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr1:17699723G>A	ENST00000434762.2	+	0	339							Q6TGC4	PADI6_HUMAN	peptidyl arginine deiminase, type VI						cytoplasm organization (GO:0007028)|cytoskeleton organization (GO:0007010)|protein citrullination (GO:0018101)|regulation of translation by machinery localization (GO:0043143)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(2)	29		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;7.59e-06)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.0134)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)	CGTGGATGCGGATAAGGTAAG	0.617																																																	0													46.0	48.0	47.0					1																	17699723		2153	4259	6412			353238			AY422079	CCDS72715.1	1p36.13	2014-07-10			ENSG00000256049	ENSG00000276747	3.5.3.15	"""Peptidyl arginine deiminases"""	20449	protein-coding gene	gene with protein product		610363				15087120	Standard	NM_207421		Approved		uc001bak.1	Q6TGC4	OTTHUMG00000002372		1.37:g.17699723G>A			Q330K5|Q70SX3	Missense_Mutation	SNP	ENST00000434762.2	37																																																																																					0.617	PADI6-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000006804.4		NM_207421	
PLXNA3	55558	hgsc.bcm.edu	37	X	153692792	153692792	+	Missense_Mutation	SNP	G	G	A	rs375186286		TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chrX:153692792G>A	ENST00000369682.3	+	9	2051	c.1876G>A	c.(1876-1878)Gtg>Atg	p.V626M		NM_017514.3	NP_059984.3	P51805	PLXA3_HUMAN	plexin A3	626					axon guidance (GO:0007411)|branchiomotor neuron axon guidance (GO:0021785)|facial nerve structural organization (GO:0021612)|hippocampus development (GO:0021766)|multicellular organismal development (GO:0007275)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|positive regulation of cytoskeleton organization (GO:0051495)|pyramidal neuron development (GO:0021860)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|trigeminal nerve structural organization (GO:0021637)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)|transmembrane signaling receptor activity (GO:0004888)	p.V626L(1)		breast(2)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(26)|ovary(2)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	48	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GGAGACAGGCGTGAGGTTTGC	0.652																																																	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)							MET/VAL	0,3835		0,0,1632,571	103.0	82.0	89.0		1876	2.5	0.0	X		89	1,6727		0,1,2427,1872	no	missense	PLXNA3	NM_017514.3	21	0,1,4059,2443	AA,AG,GG,G		0.0149,0.0,0.0095	benign	626/1872	153692792	1,10562	2203	4300	6503	SO:0001583	missense	55558			X74609	CCDS14752.1	Xq28	2008-02-05			ENSG00000130827	ENSG00000130827		"""Plexins"""	9101	protein-coding gene	gene with protein product		300022		PLXN4		8248200, 8733135	Standard	NM_017514		Approved	SEX, XAP-6, 6.3, Plxn3	uc004flm.3	P51805	OTTHUMG00000033290	ENST00000369682.3:c.1876G>A	X.37:g.153692792G>A	ENSP00000358696:p.Val626Met		Q5HY36	Missense_Mutation	SNP	ENST00000369682.3	37	CCDS14752.1	.	.	.	.	.	.	.	.	.	.	G	8.520	0.868600	0.17322	0.0	1.49E-4	ENSG00000130827	ENST00000369682	T	0.01113	5.32	5.51	2.5	0.30297	.	0.353013	0.28871	N	0.013869	T	0.00754	0.0025	N	0.14661	0.345	0.09310	N	1	B	0.14438	0.01	B	0.08055	0.003	T	0.49051	-0.8979	10	0.42905	T	0.14	.	2.6552	0.05010	0.1845:0.1328:0.5275:0.1553	.	626	P51805	PLXA3_HUMAN	M	626	ENSP00000358696:V626M	ENSP00000358696:V626M	V	+	1	0	PLXNA3	153345986	0.000000	0.05858	0.040000	0.18447	0.591000	0.36615	0.057000	0.14279	1.083000	0.41159	0.597000	0.82753	GTG		0.652	PLXNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081634.1		NM_017514	
POU6F2	11281	hgsc.bcm.edu;ucsc.edu	37	7	39472854	39472854	+	Missense_Mutation	SNP	C	C	T	rs146637189		TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr7:39472854C>T	ENST00000403058.1	+	8	1359	c.1205C>T	c.(1204-1206)aCg>aTg	p.T402M	POU6F2_ENST00000518318.2_Missense_Mutation_p.T402M|POU6F2_ENST00000559001.1_Missense_Mutation_p.T347M	NM_001166018.1|NM_007252.3	NP_001159490.1|NP_009183.3	P78424	PO6F2_HUMAN	POU class 6 homeobox 2	402	Gln-rich.				central nervous system development (GO:0007417)|ganglion mother cell fate determination (GO:0007402)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|visual perception (GO:0007601)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(16)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	42						CAGGGCATCACGCTGTCACCC	0.587																																																	0													101.0	77.0	85.0					7																	39472854		2203	4300	6503	SO:0001583	missense	11281			U91934	CCDS34620.2, CCDS55103.1	7p14.1	2011-06-20	2007-07-13		ENSG00000106536	ENSG00000106536		"""Homeoboxes / POU class"""	21694	protein-coding gene	gene with protein product	"""Retina-derived POU-domain factor-1"""	609062	"""POU domain, class 6, transcription factor 2"""			8601806	Standard	NM_007252		Approved	RPF-1	uc003thb.2	P78424	OTTHUMG00000150803	ENST00000403058.1:c.1205C>T	7.37:g.39472854C>T	ENSP00000384004:p.Thr402Met		A4D1W2|C4AMB9|P78425|Q75ME8|Q86UM6|Q9UDS7	Missense_Mutation	SNP	ENST00000403058.1	37	CCDS34620.2	.	.	.	.	.	.	.	.	.	.	C	22.0	4.227053	0.79576	.	.	ENSG00000106536	ENST00000403058;ENST00000518318	D;D	0.86164	-2.04;-2.08	5.82	5.82	0.92795	.	0.481200	0.23418	N	0.048384	D	0.90386	0.6991	L	0.29908	0.895	0.58432	D	0.999994	D	0.89917	1.0	D	0.83275	0.996	D	0.89703	0.3906	10	0.44086	T	0.13	.	20.0871	0.97801	0.0:1.0:0.0:0.0	.	402	P78424	PO6F2_HUMAN	M	402	ENSP00000384004:T402M;ENSP00000430514:T402M	ENSP00000384004:T402M	T	+	2	0	POU6F2	39439379	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.782000	0.85680	2.748000	0.94277	0.650000	0.86243	ACG		0.587	POU6F2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000320146.3		NM_007252	
PPARGC1A	10891	hgsc.bcm.edu;ucsc.edu	37	4	23815962	23815962	+	Missense_Mutation	SNP	C	C	T			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr4:23815962C>T	ENST00000264867.2	-	8	1263	c.1144G>A	c.(1144-1146)Ggt>Agt	p.G382S	PPARGC1A_ENST00000509702.1_5'UTR	NM_013261.3	NP_037393.1	Q9UBK2	PRGC1_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator 1 alpha	382	Mediates interaction with RNF34. {ECO:0000269|PubMed:22064484}.				androgen metabolic process (GO:0008209)|androgen receptor signaling pathway (GO:0030521)|brown fat cell differentiation (GO:0050873)|cellular glucose homeostasis (GO:0001678)|cellular respiration (GO:0045333)|cellular response to fatty acid (GO:0071398)|cellular response to hypoxia (GO:0071456)|cellular response to nitrite (GO:0071250)|cellular response to oxidative stress (GO:0034599)|cellular response to thyroid hormone stimulus (GO:0097067)|cellular response to tumor necrosis factor (GO:0071356)|circadian regulation of gene expression (GO:0032922)|digestion (GO:0007586)|fatty acid oxidation (GO:0019395)|flavone metabolic process (GO:0051552)|galactose metabolic process (GO:0006012)|gluconeogenesis (GO:0006094)|mitochondrion organization (GO:0007005)|mRNA processing (GO:0006397)|negative regulation of glycolytic process (GO:0045820)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron death (GO:1901215)|negative regulation of receptor activity (GO:2000272)|positive regulation of ATP biosynthetic process (GO:2001171)|positive regulation of cellular respiration (GO:1901857)|positive regulation of energy homeostasis (GO:2000507)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of histone acetylation (GO:0035066)|positive regulation of mitochondrial DNA metabolic process (GO:1901860)|positive regulation of mitochondrion organization (GO:0010822)|positive regulation of muscle tissue development (GO:1901863)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein stabilization (GO:0050821)|regulation of circadian rhythm (GO:0042752)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of transcription, DNA-templated (GO:0006355)|respiratory electron transport chain (GO:0022904)|response to cold (GO:0009409)|response to epinephrine (GO:0071871)|response to leucine (GO:0043201)|response to muscle activity (GO:0014850)|response to norepinephrine (GO:0071873)|response to starvation (GO:0042594)|response to statin (GO:0036273)|RNA splicing (GO:0008380)|temperature homeostasis (GO:0001659)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytosol (GO:0005829)|DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|liver(1)|lung(24)|ovary(3)|skin(5)	51		Breast(46;0.0503)				TCATGGTCACCAAACAGCCGC	0.458																																					Esophageal Squamous(29;694 744 13796 34866 44181)												0													72.0	77.0	75.0					4																	23815962		2203	4300	6503	SO:0001583	missense	10891			AF106698	CCDS3429.1	4p15.1	2013-02-12	2006-10-17	2004-02-04	ENSG00000109819	ENSG00000109819		"""RNA binding motif (RRM) containing"""	9237	protein-coding gene	gene with protein product		604517	"""peroxisome proliferative activated receptor, gamma, coactivator 1"", ""peroxisome proliferative activated receptor, gamma, coactivator 1, alpha"""	PPARGC1		10585775	Standard	NM_013261		Approved	PGC1, PGC1A	uc003gqs.3	Q9UBK2	OTTHUMG00000097747	ENST00000264867.2:c.1144G>A	4.37:g.23815962C>T	ENSP00000264867:p.Gly382Ser		B7Z406|G8DM16|I3RTT5|I3RTT6|I3RTT7|I3RTT8|I3RTT9|Q3LIG1|Q4W5M7|Q9UN32	Missense_Mutation	SNP	ENST00000264867.2	37	CCDS3429.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.101408	0.76983	.	.	ENSG00000109819	ENST00000264867	T	0.32988	1.43	6.16	6.16	0.99307	.	0.043448	0.85682	D	0.000000	T	0.54743	0.1877	L	0.53780	1.695	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.42292	-0.9460	10	0.49607	T	0.09	-9.4747	20.8598	0.99761	0.0:1.0:0.0:0.0	.	382	Q9UBK2	PRGC1_HUMAN	S	382	ENSP00000264867:G382S	ENSP00000264867:G382S	G	-	1	0	PPARGC1A	23425060	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.535000	0.67173	2.937000	0.99478	0.650000	0.86243	GGT		0.458	PPARGC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214976.1		NM_013261	
PRB3	5544	hgsc.bcm.edu	37	12	11420895	11420895	+	Silent	SNP	C	C	T			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr12:11420895C>T	ENST00000279573.7	-	3	423	c.288G>A	c.(286-288)ccG>ccA	p.P96P	PRB3_ENST00000381842.3_Silent_p.P96P|PRB3_ENST00000538488.1_Silent_p.P96P|PRB3_ENST00000440870.3_Intron			Q04118	PRB3_HUMAN	proline-rich protein BstNI subfamily 3	96	10 X 21 AA tandem repeats of [RH]-P-G-K- P-[EQ]-G-[PQS]-P-[PS]-Q-[GE]-G-N-[QK]- [SP]-[QR]-[GR]-P-P-P.|Pro-rich.				defense response to Gram-negative bacterium (GO:0050829)	extracellular region (GO:0005576)				breast(2)|endometrium(1)|kidney(2)|large_intestine(1)|lung(13)|ovary(1)|skin(5)	25			OV - Ovarian serous cystadenocarcinoma(49;0.201)			CTGGCTTTCCCGGACGAGGTG	0.622																																																	0																																										SO:0001819	synonymous_variant	5544					12p13.2	2012-10-02				ENSG00000197870			9339	protein-coding gene	gene with protein product		168840				1894623	Standard	NM_006249		Approved	PRG	uc001qzs.3	Q04118		ENST00000279573.7:c.288G>A	12.37:g.11420895C>T			Q15188|Q4VAY3|Q4VAY4|Q7M4M9|Q9UCT9	Silent	SNP	ENST00000279573.7	37																																																																																					0.622	PRB3-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000402119.5		NM_006249	
LRRC14	9684	hgsc.bcm.edu;ucsc.edu	37	8	145740784	145740784	+	5'Flank	SNP	G	G	T			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr8:145740784G>T	ENST00000292524.1	+	0	0				RECQL4_ENST00000532237.1_5'UTR|RECQL4_ENST00000428558.2_Missense_Mutation_p.P439H|CTD-2517M22.17_ENST00000580385.1_RNA|LRRC14_ENST00000529022.1_5'Flank	NM_001272036.1|NM_014665.2	NP_001258965.1|NP_055480.1	Q15048	LRC14_HUMAN	leucine rich repeat containing 14											endometrium(1)|lung(3)|prostate(1)	5	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			CTCAGGTACAGGTTGTGGTGA	0.632																																																	0													67.0	76.0	73.0					8																	145740784		2056	4194	6250	SO:0001631	upstream_gene_variant	9401			BC011377	CCDS6432.1	8q24.3	2012-08-20			ENSG00000160959	ENSG00000160959			20419	protein-coding gene	gene with protein product						7584026	Standard	NM_001272036		Approved	KIAA0014, LRRC14A	uc003zdk.3	Q15048	OTTHUMG00000165179		8.37:g.145740784G>T	Exception_encountered		A8K0A8|D3DWM8	Missense_Mutation	SNP	ENST00000292524.1	37	CCDS6432.1																																																																																				0.632	LRRC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382494.1		NM_014665	
RNF217	154214	hgsc.bcm.edu	37	6	125366368	125366368	+	Silent	SNP	C	C	G			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr6:125366368C>G	ENST00000521654.2	+	2	894	c.894C>G	c.(892-894)ggC>ggG	p.G298G	RNF217_ENST00000560949.1_Silent_p.G63G|RNF217_ENST00000454842.2_3'UTR|RNF217_ENST00000359704.2_Silent_p.G6G|RNF217_ENST00000275184.6_5'Flank|RNF217_ENST00000368414.2_5'UTR			Q8TC41	RN217_HUMAN	ring finger protein 217	298					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|skin(1)|urinary_tract(1)	11			LUSC - Lung squamous cell carcinoma(4;0.0263)|Lung(4;0.0828)	GBM - Glioblastoma multiforme(226;0.0162)		TACAACTTGGCCAAGTAGAAA	0.343																																																	0													87.0	81.0	83.0					6																	125366368		2203	4300	6503	SO:0001819	synonymous_variant	154214			BC026087	CCDS5129.1, CCDS69191.1	6q22.33	2014-07-15	2007-08-20	2007-08-20	ENSG00000146373	ENSG00000146373		"""RING-type (C3HC4) zinc fingers"""	21487	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 172"", ""IBR domain containing 1"""	C6orf172, IBRDC1			Standard	NM_001286398		Approved	MGC26996, dJ84N20.1	uc003pzs.3	Q8TC41	OTTHUMG00000015504	ENST00000521654.2:c.894C>G	6.37:g.125366368C>G			H7C5V4|Q5TCA4|Q9BX48	Silent	SNP	ENST00000521654.2	37																																																																																					0.343	RNF217-002	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000042063.3		NM_152553	
SIGLEC8	27181	hgsc.bcm.edu;ucsc.edu	37	19	51955677	51955677	+	Missense_Mutation	SNP	A	A	C			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr19:51955677A>C	ENST00000321424.3	-	7	1522	c.1456T>G	c.(1456-1458)Tgt>Ggt	p.C486G	SIGLEC8_ENST00000430817.1_Missense_Mutation_p.C377G|SIGLEC8_ENST00000340550.5_Missense_Mutation_p.C393G	NM_014442.2	NP_055257.2	Q9NYZ4	SIGL8_HUMAN	sialic acid binding Ig-like lectin 8	486					cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|central_nervous_system(3)|endometrium(2)|kidney(4)|large_intestine(11)|liver(3)|lung(15)|ovary(2)|skin(4)|stomach(3)|urinary_tract(2)	50		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000627)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		TTCCTCAAACAGGCCTGAGTC	0.527																																																	0													130.0	118.0	122.0					19																	51955677		2203	4300	6503	SO:0001583	missense	27181			AF195092	CCDS33086.1	19q13.33-q13.41	2013-01-29			ENSG00000105366	ENSG00000105366		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10877	protein-coding gene	gene with protein product		605639				10625619	Standard	XR_243922		Approved	SIGLEC-8, SAF2, SIGLEC8L, MGC59785	uc002pwt.3	Q9NYZ4		ENST00000321424.3:c.1456T>G	19.37:g.51955677A>C	ENSP00000321077:p.Cys486Gly		Q7Z728	Missense_Mutation	SNP	ENST00000321424.3	37	CCDS33086.1	.	.	.	.	.	.	.	.	.	.	.	9.440	1.087739	0.20390	.	.	ENSG00000105366	ENST00000430817;ENST00000321424;ENST00000340550	T;T;T	0.62105	1.33;0.05;1.11	1.31	0.213	0.15244	.	.	.	.	.	T	0.35970	0.0950	N	0.08118	0	0.09310	N	1	B;B;B	0.12013	0.003;0.005;0.003	B;B;B	0.08055	0.001;0.003;0.001	T	0.24333	-1.0163	9	0.87932	D	0	.	3.225	0.06729	0.7385:0.0:0.2615:0.0	.	377;393;486	C9JT30;Q9NYZ4-2;Q9NYZ4	.;.;SIGL8_HUMAN	G	377;486;393	ENSP00000389142:C377G;ENSP00000321077:C486G;ENSP00000339448:C393G	ENSP00000321077:C486G	C	-	1	0	SIGLEC8	56647489	0.001000	0.12720	0.001000	0.08648	0.003000	0.03518	1.295000	0.33377	0.009000	0.14813	0.411000	0.27672	TGT		0.527	SIGLEC8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463648.2		NM_014442	
SIPA1L2	57568	hgsc.bcm.edu	37	1	232581296	232581296	+	Missense_Mutation	SNP	C	C	T	rs557448632		TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr1:232581296C>T	ENST00000366630.1	-	10	3690	c.3332G>A	c.(3331-3333)cGg>cAg	p.R1111Q	SIPA1L2_ENST00000308942.4_Missense_Mutation_p.R185Q|SIPA1L2_ENST00000262861.4_Missense_Mutation_p.R1111Q			Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like 2	1111					regulation of small GTPase mediated signal transduction (GO:0051056)		GTPase activator activity (GO:0005096)	p.R1111Q(1)		NS(1)|breast(5)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(49)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	103		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				GGGCAGCTTCCGGTCGAAGGA	0.612																																																	1	Substitution - Missense(1)	ovary(1)											35.0	40.0	38.0					1																	232581296		2014	4173	6187	SO:0001583	missense	57568			AB037810	CCDS41474.1	1q42.2	2008-02-05			ENSG00000116991	ENSG00000116991			23800	protein-coding gene	gene with protein product		611609					Standard	NM_020808		Approved	KIAA1389	uc001hvg.3	Q9P2F8	OTTHUMG00000037820	ENST00000366630.1:c.3332G>A	1.37:g.232581296C>T	ENSP00000355589:p.Arg1111Gln		Q2TV88|Q5VXR7|Q5VXR8|Q641Q4|Q8NA38|Q96DZ3|Q9H9F6	Missense_Mutation	SNP	ENST00000366630.1	37	CCDS41474.1	.	.	.	.	.	.	.	.	.	.	C	15.53	2.861376	0.51482	.	.	ENSG00000116991	ENST00000366630;ENST00000262861;ENST00000308942	T;T;T	0.60548	0.18;0.18;0.18	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	T	0.55289	0.1911	L	0.54323	1.7	0.43936	D	0.996594	P;D	0.54601	0.944;0.967	B;P	0.47044	0.182;0.535	T	0.50617	-0.8807	10	0.15499	T	0.54	-23.0501	12.6564	0.56790	0.0:0.9244:0.0:0.0756	.	1111;185	Q9P2F8;Q9P2F8-2	SI1L2_HUMAN;.	Q	1111;1111;185	ENSP00000355589:R1111Q;ENSP00000262861:R1111Q;ENSP00000309102:R185Q	ENSP00000262861:R1111Q	R	-	2	0	SIPA1L2	230647919	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	4.593000	0.61034	2.560000	0.86352	0.655000	0.94253	CGG		0.612	SIPA1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092318.1		XM_045839	
SLC22A20	440044	hgsc.bcm.edu;ucsc.edu	37	11	64985140	64985140	+	RNA	SNP	T	T	A			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr11:64985140T>A	ENST00000525437.1	+	0	653							A6NK97	S22AK_HUMAN	solute carrier family 22, member 20						ion transport (GO:0006811)	integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(2)|prostate(2)	8						TCTGGCATCATCCTCAACTCC	0.652																																																	0													44.0	47.0	46.0					11																	64985140		1990	4153	6143			440044			DQ053017		11q13.1	2014-02-20			ENSG00000197847	ENSG00000197847		"""Solute carriers"""	29867	other	unknown		611696				15369770, 16478971	Standard	NM_001004326		Approved	Oat6, FLJ16331	uc021qlh.1	A6NK97	OTTHUMG00000165615		11.37:g.64985140T>A			B9EJB2|Q6ZN88	Missense_Mutation	SNP	ENST00000525437.1	37																																																																																					0.652	SLC22A20-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000385336.1		NM_001004326	
SLC25A5	292	hgsc.bcm.edu	37	X	118603864	118603864	+	Missense_Mutation	SNP	G	G	A	rs199707714		TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chrX:118603864G>A	ENST00000317881.8	+	2	468	c.352G>A	c.(352-354)Gca>Aca	p.A118T	SLC25A5-AS1_ENST00000446986.1_RNA|SLC25A5_ENST00000460013.1_3'UTR	NM_001152.4	NP_001143.2	P05141	ADT2_HUMAN	solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 5	118					adenine transport (GO:0015853)|chromosome segregation (GO:0007059)|energy reserve metabolic process (GO:0006112)|negative regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901029)|positive regulation of cell proliferation (GO:0008284)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|MMXD complex (GO:0071817)|nucleus (GO:0005634)	adenine transmembrane transporter activity (GO:0015207)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|stomach(2)	12					Clodronate(DB00720)	AGGGAATCTGGCATCGGGTGG	0.522																																																	0																																										SO:0001583	missense	292			BC068199	CCDS14578.1	Xq24	2013-08-09			ENSG00000005022	ENSG00000005022		"""Solute carriers"""	10991	protein-coding gene	gene with protein product		300150		ANT2		2168878, 2829183	Standard	NM_001152		Approved	T2, 2F1, T3	uc004erh.4	P05141	OTTHUMG00000022715	ENST00000317881.8:c.352G>A	X.37:g.118603864G>A	ENSP00000360671:p.Ala118Thr		B2RCV1|O43350	Missense_Mutation	SNP	ENST00000317881.8	37	CCDS14578.1	.	.	.	.	.	.	.	.	.	.	G	17.92	3.507272	0.64410	.	.	ENSG00000005022	ENST00000317881	T	0.79033	-1.23	4.35	4.35	0.52113	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	T	0.79435	0.4445	M	0.83852	2.665	0.80722	D	1	P	0.34997	0.479	B	0.33568	0.166	D	0.83564	0.0108	10	0.87932	D	0	.	15.2759	0.73742	0.0:0.0:1.0:0.0	.	118	P05141	ADT2_HUMAN	T	118	ENSP00000360671:A118T	ENSP00000360671:A118T	A	+	1	0	SLC25A5	118487892	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.356000	0.97091	2.100000	0.63781	0.529000	0.55759	GCA		0.522	SLC25A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058952.2		NM_001152	
SLC25A5	292	hgsc.bcm.edu	37	X	118604409	118604409	+	Silent	SNP	C	C	T	rs201855156		TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chrX:118604409C>T	ENST00000317881.8	+	3	788	c.672C>T	c.(670-672)gcC>gcT	p.A224A	SLC25A5-AS1_ENST00000446986.1_RNA|SLC25A5_ENST00000460013.1_3'UTR	NM_001152.4	NP_001143.2	P05141	ADT2_HUMAN	solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 5	224					adenine transport (GO:0015853)|chromosome segregation (GO:0007059)|energy reserve metabolic process (GO:0006112)|negative regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901029)|positive regulation of cell proliferation (GO:0008284)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|MMXD complex (GO:0071817)|nucleus (GO:0005634)	adenine transmembrane transporter activity (GO:0015207)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|stomach(2)	12					Clodronate(DB00720)	CTGCTGTTGCCGGGTTGACTT	0.488																																																	0													84.0	71.0	75.0					X																	118604409		2203	4300	6503	SO:0001819	synonymous_variant	292			BC068199	CCDS14578.1	Xq24	2013-08-09			ENSG00000005022	ENSG00000005022		"""Solute carriers"""	10991	protein-coding gene	gene with protein product		300150		ANT2		2168878, 2829183	Standard	NM_001152		Approved	T2, 2F1, T3	uc004erh.4	P05141	OTTHUMG00000022715	ENST00000317881.8:c.672C>T	X.37:g.118604409C>T			B2RCV1|O43350	Silent	SNP	ENST00000317881.8	37	CCDS14578.1																																																																																				0.488	SLC25A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058952.2		NM_001152	
SLC48A1	55652	hgsc.bcm.edu;ucsc.edu	37	12	48172917	48172917	+	Missense_Mutation	SNP	C	C	A			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr12:48172917C>A	ENST00000442218.2	+	2	340	c.243C>A	c.(241-243)ttC>ttA	p.F81L	SLC48A1_ENST00000476104.1_3'UTR|SLC48A1_ENST00000442892.2_Missense_Mutation_p.F24L|SLC48A1_ENST00000547002.1_Missense_Mutation_p.F24L	NM_017842.2	NP_060312.2	Q6P1K1	HRG1_HUMAN	solute carrier family 48 (heme transporter), member 1	81					heme transport (GO:0015886)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)	heme transporter activity (GO:0015232)			large_intestine(1)|lung(3)|urinary_tract(1)	5						GCGTCCTCTTCTCGGCCGTCT	0.622											OREG0021755	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													166.0	139.0	147.0					12																	48172917		692	1591	2283	SO:0001583	missense	55652				CCDS8755.2	12q13.11	2013-05-22			ENSG00000211584	ENSG00000211584		"""Solute carriers"""	26035	protein-coding gene	gene with protein product		612187				18418376	Standard	NM_017842		Approved	FLJ20489, hHRG-1, HRG1	uc001rqd.3	Q6P1K1	OTTHUMG00000156983	ENST00000442218.2:c.243C>A	12.37:g.48172917C>A	ENSP00000415998:p.Phe81Leu	952	Q9BUB3|Q9NX17	Missense_Mutation	SNP	ENST00000442218.2	37	CCDS8755.2	.	.	.	.	.	.	.	.	.	.	C	21.6	4.175867	0.78564	.	.	ENSG00000211584	ENST00000548498;ENST00000547002;ENST00000442892;ENST00000442218;ENST00000432662	.	.	.	4.91	4.02	0.46733	.	.	.	.	.	T	0.65554	0.2702	L	0.41824	1.3	0.80722	D	1	D	0.71674	0.998	D	0.76071	0.987	T	0.63418	-0.6642	8	0.34782	T	0.22	.	12.8195	0.57685	0.0:0.9182:0.0:0.0818	.	81	Q6P1K1	HRG1_HUMAN	L	24;24;24;81;81	.	ENSP00000389956:F81L	F	+	3	2	SLC48A1	46459184	1.000000	0.71417	0.997000	0.53966	0.737000	0.42083	4.698000	0.61789	1.389000	0.46526	0.655000	0.94253	TTC		0.622	SLC48A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346966.1		NM_017842	
SLC4A4	8671	hgsc.bcm.edu	37	4	72400063	72400063	+	Missense_Mutation	SNP	A	A	C			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr4:72400063A>C	ENST00000264485.5	+	18	2517	c.2400A>C	c.(2398-2400)caA>caC	p.Q800H	SLC4A4_ENST00000340595.3_Missense_Mutation_p.Q756H|SLC4A4_ENST00000425175.1_Missense_Mutation_p.Q800H|SLC4A4_ENST00000351898.6_Missense_Mutation_p.Q800H	NM_001098484.2	NP_001091954.1	Q9Y6R1	S4A4_HUMAN	solute carrier family 4 (sodium bicarbonate cotransporter), member 4	800					bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	58			Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)		Sodium bicarbonate(DB01390)	TGGACCAACAAATTACAGCTG	0.413																																																	0													91.0	91.0	91.0					4																	72400063		2203	4300	6503	SO:0001583	missense	8671			AF007216	CCDS3549.1, CCDS43236.1, CCDS47071.1	4q13.3	2013-07-19	2013-07-19		ENSG00000080493	ENSG00000080493		"""Solute carriers"""	11030	protein-coding gene	gene with protein product		603345	"""solute carrier family 4, sodium bicarbonate cotransporter, member 4"""	SLC4A5		9235899, 9651366	Standard	NM_001098484		Approved	NBC1, HNBC1, NBC2, pNBC, hhNMC	uc010iic.3	Q9Y6R1	OTTHUMG00000129907	ENST00000264485.5:c.2400A>C	4.37:g.72400063A>C	ENSP00000264485:p.Gln800His		C4B714|O15153|Q8NEJ2|Q9H262|Q9NRZ1|Q9UIC0|Q9UIC1|Q9UP50	Missense_Mutation	SNP	ENST00000264485.5	37	CCDS43236.1	.	.	.	.	.	.	.	.	.	.	A	20.6	4.013541	0.75161	.	.	ENSG00000080493	ENST00000264485;ENST00000425175;ENST00000351898;ENST00000340595	T;T;T;T	0.80994	-1.44;-1.44;-1.44;-1.44	5.69	-3.8	0.04307	Bicarbonate transporter, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.87386	0.6164	M	0.78637	2.42	0.80722	D	1	D;B;D;D	0.89917	1.0;0.244;1.0;1.0	D;B;D;D	0.85130	0.997;0.183;0.993;0.996	D	0.87327	0.2322	10	0.66056	D	0.02	.	15.8434	0.78868	0.4125:0.0:0.5875:0.0	.	800;800;756;800	A5JJ20;Q9Y6R1-4;Q9Y6R1-2;Q9Y6R1	.;.;.;S4A4_HUMAN	H	800;800;800;756	ENSP00000264485:Q800H;ENSP00000393557:Q800H;ENSP00000307349:Q800H;ENSP00000344272:Q756H	ENSP00000264485:Q800H	Q	+	3	2	SLC4A4	72618927	0.989000	0.36119	0.988000	0.46212	0.985000	0.73830	0.260000	0.18424	-0.451000	0.07097	-0.263000	0.10527	CAA		0.413	SLC4A4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362090.1		NM_003759	
SLC9A9	285195	hgsc.bcm.edu	37	3	142985575	142985575	+	Missense_Mutation	SNP	T	T	C			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr3:142985575T>C	ENST00000316549.6	-	16	2115	c.1907A>G	c.(1906-1908)gAg>gGg	p.E636G		NM_173653.3	NP_775924.1	Q8IVB4	SL9A9_HUMAN	solute carrier family 9, subfamily A (NHE9, cation proton antiporter 9), member 9	636					ion transport (GO:0006811)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|recycling endosome (GO:0055037)	sodium:proton antiporter activity (GO:0015385)			breast(2)|endometrium(5)|kidney(2)|large_intestine(13)|lung(29)|ovary(2)|skin(3)|stomach(1)	57						CAAAGTTTGCTCAAGCTTGAG	0.473																																																	0													103.0	99.0	100.0					3																	142985575		2203	4300	6503	SO:0001583	missense	285195			AY254100	CCDS33872.1	3q23-q24	2014-01-28	2012-03-22		ENSG00000181804	ENSG00000181804		"""Solute carriers"""	20653	protein-coding gene	gene with protein product		608396	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 9"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 9"""			14569117	Standard	NM_173653		Approved	FLJ35613, NHE9	uc003evn.3	Q8IVB4	OTTHUMG00000159373	ENST00000316549.6:c.1907A>G	3.37:g.142985575T>C	ENSP00000320246:p.Glu636Gly		A6NMQ9|Q3LIC2|Q5JPI6|Q5WA58|Q8NAB9	Missense_Mutation	SNP	ENST00000316549.6	37	CCDS33872.1	.	.	.	.	.	.	.	.	.	.	T	23.3	4.395700	0.83011	.	.	ENSG00000181804	ENST00000316549	T	0.57595	0.39	5.69	5.69	0.88448	.	0.069540	0.64402	D	0.000016	T	0.51584	0.1683	M	0.63428	1.95	0.44337	D	0.997227	B	0.31318	0.319	B	0.26614	0.071	T	0.55412	-0.8145	10	0.72032	D	0.01	.	15.9584	0.79906	0.0:0.0:0.0:1.0	.	636	Q8IVB4	SL9A9_HUMAN	G	636	ENSP00000320246:E636G	ENSP00000320246:E636G	E	-	2	0	SLC9A9	144468265	1.000000	0.71417	0.988000	0.46212	0.977000	0.68977	3.832000	0.55783	2.165000	0.68154	0.528000	0.53228	GAG		0.473	SLC9A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354994.1		NM_173653	
STON2	85439	hgsc.bcm.edu	37	14	81744471	81744471	+	Missense_Mutation	SNP	T	T	C			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr14:81744471T>C	ENST00000267540.2	-	4	1384	c.1184A>G	c.(1183-1185)cAc>cGc	p.H395R	STON2_ENST00000555447.1_Missense_Mutation_p.H395R|STON2_ENST00000556280.1_5'Flank	NM_033104.3	NP_149095.2	Q8WXE9	STON2_HUMAN	stonin 2	395					hematopoietic progenitor cell differentiation (GO:0002244)|intracellular protein transport (GO:0006886)|regulation of endocytosis (GO:0030100)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nucleolus (GO:0005730)|synaptic vesicle (GO:0008021)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(13)|pancreas(2)|prostate(1)|skin(5)	34				BRCA - Breast invasive adenocarcinoma(234;0.0348)		ACTGCCAAAGTGATCAGGGTC	0.493																																																	0													88.0	84.0	85.0					14																	81744471		2203	4300	6503	SO:0001583	missense	85439			AB208948	CCDS9875.1, CCDS58332.1	14q31.1	2007-08-01				ENSG00000140022			30652	protein-coding gene	gene with protein product	"""stoned B homolog 2 (Drosophila)"""	608467				11381094, 11454741	Standard	NM_033104		Approved	STNB2, STN2	uc001xvk.2	Q8WXE9		ENST00000267540.2:c.1184A>G	14.37:g.81744471T>C	ENSP00000267540:p.His395Arg		G3V2T7|Q17R24|Q59H11|Q6NT47|Q96RI7|Q96RU6	Missense_Mutation	SNP	ENST00000267540.2	37	CCDS9875.1	.	.	.	.	.	.	.	.	.	.	T	0.296	-0.977016	0.02197	.	.	ENSG00000140022	ENST00000555447;ENST00000546306;ENST00000267540	T;T	0.10763	2.84;2.84	6.17	-1.7	0.08159	.	0.585291	0.18243	N	0.147199	T	0.06188	0.0160	L	0.34521	1.04	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.43376	-0.9395	10	0.13108	T	0.6	-5.3835	7.4564	0.27270	0.0:0.3603:0.218:0.4217	.	395;395	Q8WXE9;G3V2T7	STON2_HUMAN;.	R	395;407;395	ENSP00000450857:H395R;ENSP00000267540:H395R	ENSP00000267540:H395R	H	-	2	0	STON2	80814224	0.000000	0.05858	0.157000	0.22605	0.869000	0.49853	-0.505000	0.06367	-0.266000	0.09339	-0.250000	0.11733	CAC		0.493	STON2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000413317.1		NM_033104	
SUPT6H	6830	hgsc.bcm.edu;ucsc.edu	37	17	27011637	27011637	+	Missense_Mutation	SNP	G	G	A	rs377756550		TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr17:27011637G>A	ENST00000314616.6	+	18	2546	c.2263G>A	c.(2263-2265)Gtg>Atg	p.V755M	SUPT6H_ENST00000347486.4_Missense_Mutation_p.V755M	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)	755	Interaction with KDM6A. {ECO:0000250}.|Interaction with PAAF1.				chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					TTGGTTGAGAGTGGCACCCTA	0.493																																																	0								G	MET/VAL	1,4405	2.1+/-5.4	0,1,2202	176.0	148.0	157.0		2263	5.8	1.0	17		157	0,8600		0,0,4300	no	missense	SUPT6H	NM_003170.3	21	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	755/1727	27011637	1,13005	2203	4300	6503	SO:0001583	missense	6830			U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85		ENST00000314616.6:c.2263G>A	17.37:g.27011637G>A	ENSP00000319104:p.Val755Met		A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Missense_Mutation	SNP	ENST00000314616.6	37	CCDS32596.1	.	.	.	.	.	.	.	.	.	.	G	27.8	4.865565	0.91511	2.27E-4	0.0	ENSG00000109111	ENST00000314616	T	0.44881	0.91	5.8	5.8	0.92144	Tex-like domain (1);	0.000000	0.85682	D	0.000000	T	0.61375	0.2342	M	0.71036	2.16	0.80722	D	1	D	0.56968	0.978	P	0.58391	0.838	T	0.61441	-0.7062	10	0.54805	T	0.06	-17.5945	18.2272	0.89921	0.0:0.0:1.0:0.0	.	755	Q7KZ85	SPT6H_HUMAN	M	755	ENSP00000319104:V755M	ENSP00000319104:V755M	V	+	1	0	SUPT6H	24035764	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.545000	0.82128	2.749000	0.94314	0.655000	0.94253	GTG		0.493	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446422.2		NM_003170	
THSD1	55901	hgsc.bcm.edu	37	13	52952681	52952681	+	Missense_Mutation	SNP	C	C	A	rs564794340		TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr13:52952681C>A	ENST00000258613.4	-	5	1602	c.1424G>T	c.(1423-1425)cGc>cTc	p.R475L	THSD1_ENST00000349258.4_Missense_Mutation_p.R422L|THSD1_ENST00000544466.1_Missense_Mutation_p.R96L	NM_018676.3	NP_061146.1	Q9NS62	THSD1_HUMAN	thrombospondin, type I, domain containing 1	475					hematopoietic progenitor cell differentiation (GO:0002244)	cell periphery (GO:0071944)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)				breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Breast(56;0.000207)|Lung NSC(96;0.00145)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.8e-08)		GAAGCTCCCGCGCTGCTCGCT	0.652																																																	0													44.0	50.0	48.0					13																	52952681		2203	4300	6503	SO:0001583	missense	55901			AK096289	CCDS9432.1, CCDS9433.1	13q14.13	2010-04-20	2004-03-11		ENSG00000136114	ENSG00000136114			17754	protein-coding gene	gene with protein product			"""thrombospondin, type I, domain 1"""				Standard	NM_018676		Approved	TMTSP	uc001vgo.3	Q9NS62	OTTHUMG00000016963	ENST00000258613.4:c.1424G>T	13.37:g.52952681C>A	ENSP00000258613:p.Arg475Leu		A2A3J3|B2RCF5|Q6P3U1|Q6UXZ2	Missense_Mutation	SNP	ENST00000258613.4	37	CCDS9432.1	.	.	.	.	.	.	.	.	.	.	c	10.07	1.250143	0.22880	.	.	ENSG00000136114	ENST00000349258;ENST00000544466;ENST00000258613	T;T;T	0.46063	1.54;0.88;1.75	6.06	2.38	0.29361	.	0.056490	0.64402	D	0.000003	T	0.51244	0.1663	M	0.72894	2.215	0.09310	N	0.999998	D;P	0.62365	0.991;0.661	P;B	0.55615	0.78;0.282	T	0.45556	-0.9253	10	0.87932	D	0	-9.1935	7.2606	0.26201	0.0:0.5997:0.2602:0.1401	.	422;475	Q9NS62-2;Q9NS62	.;THSD1_HUMAN	L	422;96;475	ENSP00000340650:R422L;ENSP00000438512:R96L;ENSP00000258613:R475L	ENSP00000258613:R475L	R	-	2	0	THSD1	51850682	0.849000	0.29639	0.001000	0.08648	0.031000	0.12232	5.060000	0.64312	0.138000	0.18790	-0.142000	0.14014	CGC		0.652	THSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045058.3			
TANGO6	79613	hgsc.bcm.edu	37	16	68877598	68877598	+	Silent	SNP	G	G	T			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr16:68877598G>T	ENST00000261778.1	+	1	90	c.78G>T	c.(76-78)ctG>ctT	p.L26L		NM_024562.1	NP_078838.1	Q9C0B7	TNG6_HUMAN	transport and golgi organization 6 homolog (Drosophila)	26						integral component of membrane (GO:0016021)											CATTGAAGCTGCTGCTGAGCC	0.692																																																	0													65.0	77.0	73.0					16																	68877598		1956	4148	6104	SO:0001819	synonymous_variant	0				CCDS45516.1	16q22.1	2012-12-13	2012-12-13	2012-12-13	ENSG00000103047	ENSG00000103047			25749	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 7"""	TMCO7		11214970	Standard	NM_024562		Approved	FLJ12688, KIAA1746	uc002ewi.4	Q9C0B7	OTTHUMG00000176743	ENST00000261778.1:c.78G>T	16.37:g.68877598G>T			Q569F9|Q9H9K1	Silent	SNP	ENST00000261778.1	37	CCDS45516.1																																																																																				0.692	TANGO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433471.2		XM_928235.2	
TMEM31	203562	hgsc.bcm.edu	37	X	102968789	102968789	+	Missense_Mutation	SNP	A	A	T			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chrX:102968789A>T	ENST00000319560.6	+	3	561	c.370A>T	c.(370-372)Ata>Tta	p.I124L	GLRA4_ENST00000372617.4_Intron	NM_182541.2	NP_872347.2	Q5JXX7	TMM31_HUMAN	transmembrane protein 31	124						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(1)|large_intestine(3)	7						ACTGCCCATCATACTCCACCT	0.408																																																	0													174.0	125.0	142.0					X																	102968789		2203	4300	6503	SO:0001583	missense	203562			BC029575	CCDS35359.1	Xq22.2	2008-02-05			ENSG00000179363	ENSG00000179363			28601	protein-coding gene	gene with protein product						12477932	Standard	NM_182541		Approved	MGC39655	uc004elh.3	Q5JXX7	OTTHUMG00000022109	ENST00000319560.6:c.370A>T	X.37:g.102968789A>T	ENSP00000316940:p.Ile124Leu		Q8NHR4	Missense_Mutation	SNP	ENST00000319560.6	37	CCDS35359.1	.	.	.	.	.	.	.	.	.	.	A	2.325	-0.354660	0.05138	.	.	ENSG00000179363	ENST00000319560	.	.	.	4.04	0.199	0.15175	.	1.699660	0.04162	N	0.323227	T	0.18299	0.0439	N	0.08118	0	0.09310	N	1	B	0.13594	0.008	B	0.13407	0.009	T	0.26292	-1.0107	9	0.87932	D	0	.	0.5156	0.00603	0.4459:0.1925:0.1255:0.2361	.	124	Q5JXX7	TMM31_HUMAN	L	124	.	ENSP00000316940:I124L	I	+	1	0	TMEM31	102855445	0.003000	0.15002	0.001000	0.08648	0.002000	0.02628	0.122000	0.15687	-0.066000	0.12998	-0.386000	0.06593	ATA		0.408	TMEM31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057741.1		NM_182541	
TMEM70	54968	hgsc.bcm.edu	37	8	74893388	74893388	+	Splice_Site	SNP	A	A	G	rs183973249		TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr8:74893388A>G	ENST00000312184.5	+	3	389		c.e3-1		TMEM70_ENST00000517439.1_Splice_Site|Y_RNA_ENST00000365350.1_RNA	NM_001040613.2|NM_017866.5	NP_001035703.1|NP_060336.3	Q9BUB7	TMM70_HUMAN	transmembrane protein 70						mitochondrial proton-transporting ATP synthase complex assembly (GO:0033615)	integral component of mitochondrial membrane (GO:0032592)|mitochondrial inner membrane (GO:0005743)				breast(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|skin(1)	8	Breast(64;0.0311)		Epithelial(68;0.0186)|BRCA - Breast invasive adenocarcinoma(89;0.0499)|all cancers(69;0.0564)			TTTCCCATTTAGGTGTGAAAT	0.323													A|||	1	0.000199681	0.0	0.0014	5008	,	,		19275	0.0		0.0	False		,,,				2504	0.0																0			GRCh37	CS084884	TMEM70	S	rs183973249						74.0	72.0	73.0					8																	74893388		2203	4299	6502	SO:0001630	splice_region_variant	54968			BC002748	CCDS6215.1, CCDS47876.1	8q21.11	2013-05-23				ENSG00000175606			26050	protein-coding gene	gene with protein product		612418				21945727, 22986587	Standard	NM_017866		Approved	FLJ20533	uc003yab.3	Q9BUB7		ENST00000312184.5:c.317-1A>G	8.37:g.74893388A>G			E9PDY9|Q9NWY5	Splice_Site	SNP	ENST00000312184.5	37	CCDS6215.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	A	18.55	3.649294	0.67358	.	.	ENSG00000175606	ENST00000312184	.	.	.	5.35	5.35	0.76521	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.499	0.75680	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TMEM70	75055942	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	8.579000	0.90781	2.244000	0.73946	0.533000	0.62120	.		0.323	TMEM70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379028.1		NM_017866	Intron
TNFAIP1	7126	hgsc.bcm.edu;ucsc.edu	37	17	26669383	26669383	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr17:26669383G>A	ENST00000226225.2	+	6	896	c.629G>A	c.(628-630)tGc>tAc	p.C210Y	TNFAIP1_ENST00000544907.2_Missense_Mutation_p.C106Y|TNFAIP1_ENST00000583213.1_3'UTR	NM_021137.4	NP_066960.1	Q13829	BACD2_HUMAN	tumor necrosis factor, alpha-induced protein 1 (endothelial)	210					apoptotic process (GO:0006915)|cell migration (GO:0016477)|DNA replication (GO:0006260)|embryo development (GO:0009790)|immune response (GO:0006955)|negative regulation of Rho protein signal transduction (GO:0035024)|positive regulation of DNA replication (GO:0045740)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein homooligomerization (GO:0051260)|protein ubiquitination (GO:0016567)|stress fiber assembly (GO:0043149)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endosome (GO:0005768)|nucleolus (GO:0005730)	GTP-Rho binding (GO:0017049)			endometrium(3)|kidney(1)|large_intestine(4)|lung(3)|prostate(1)	12	all_lung(13;0.000294)|Lung NSC(42;0.000964)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)		GAGATCTGCTGCTGGTCCTTT	0.557																																																	0													139.0	107.0	118.0					17																	26669383		2203	4300	6503	SO:0001583	missense	7126				CCDS11227.1	17q22-q23	2013-01-09			ENSG00000109079	ENSG00000109079		"""BTB/POZ domain containing"""	11894	protein-coding gene	gene with protein product		191161		EDP1		2406243, 2233719	Standard	NM_021137		Approved	B61, B12, MGC2317, BTBD34	uc002hay.3	Q13829	OTTHUMG00000132501	ENST00000226225.2:c.629G>A	17.37:g.26669383G>A	ENSP00000226225:p.Cys210Tyr		B7Z6M4|Q5TZQ1	Missense_Mutation	SNP	ENST00000226225.2	37	CCDS11227.1	.	.	.	.	.	.	.	.	.	.	G	27.5	4.836014	0.91117	.	.	ENSG00000109079	ENST00000226225;ENST00000544907	T	0.53640	0.61	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.66819	0.2828	M	0.82056	2.57	0.80722	D	1	D	0.54772	0.968	P	0.55303	0.773	T	0.67624	-0.5623	10	0.49607	T	0.09	-30.3684	19.3095	0.94179	0.0:0.0:1.0:0.0	.	210	Q13829	BACD2_HUMAN	Y	210;106	ENSP00000226225:C210Y	ENSP00000226225:C210Y	C	+	2	0	TNFAIP1	23693510	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	9.869000	0.99810	2.804000	0.96469	0.655000	0.94253	TGC		0.557	TNFAIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255681.2		NM_021137	
TRIM29	23650	hgsc.bcm.edu	37	11	119996570	119996570	+	Missense_Mutation	SNP	A	A	G			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr11:119996570A>G	ENST00000341846.5	-	4	1583	c.1162T>C	c.(1162-1164)Tct>Cct	p.S388P	TRIM29_ENST00000524816.3_5'Flank|TRIM29_ENST00000541857.1_Missense_Mutation_p.S121P|TRIM29_ENST00000528870.1_5'Flank|TRIM29_ENST00000529044.1_Missense_Mutation_p.S127P	NM_012101.3	NP_036233.2	Q14134	TRI29_HUMAN	tripartite motif containing 29	388					negative regulation of protein localization to nucleus (GO:1900181)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)	sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.S388T(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(17)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(1)	30		Breast(109;0.00117)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.37e-06)		GGGGGGAGAGAGTAATTGCTC	0.532																																																	1	Substitution - Missense(1)	ovary(1)											63.0	59.0	60.0					11																	119996570		2199	4295	6494	SO:0001583	missense	23650			AF230388	CCDS8428.1	11q23.3	2011-04-20	2011-01-25		ENSG00000137699	ENSG00000137699		"""Tripartite motif containing / Tripartite motif containing"""	17274	protein-coding gene	gene with protein product	"""tripartite motif protein TRIM29"", ""ataxia-telangiectasia group D-associated protein"""	610658	"""tripartite motif-containing 29"""			11331580	Standard	NM_012101		Approved	ATDC, FLJ36085	uc001pwz.3	Q14134	OTTHUMG00000140377	ENST00000341846.5:c.1162T>C	11.37:g.119996570A>G	ENSP00000343129:p.Ser388Pro		Q96AA9|Q9BZY7	Missense_Mutation	SNP	ENST00000341846.5	37	CCDS8428.1	.	.	.	.	.	.	.	.	.	.	A	9.580	1.123225	0.20959	.	.	ENSG00000137699	ENST00000341846;ENST00000541857;ENST00000529044	T	0.39787	1.06	4.09	4.09	0.47781	.	0.556436	0.17301	N	0.179254	T	0.29061	0.0722	N	0.08118	0	0.30207	N	0.798075	B;D;B	0.56968	0.003;0.978;0.0	B;P;B	0.53146	0.006;0.719;0.001	T	0.07046	-1.0793	9	.	.	.	.	5.1569	0.15040	0.6308:0.2021:0.0:0.1671	.	121;127;388	B7Z8U9;E9PRL4;Q14134	.;.;TRI29_HUMAN	P	388;121;127	ENSP00000343129:S388P	.	S	-	1	0	TRIM29	119501780	0.935000	0.31712	1.000000	0.80357	0.986000	0.74619	1.658000	0.37376	1.858000	0.53909	0.533000	0.62120	TCT		0.532	TRIM29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277108.2		NM_012101	
USP6	9098	hgsc.bcm.edu	37	17	5038559	5038559	+	Silent	SNP	C	C	A	rs117996405	byFrequency	TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr17:5038559C>A	ENST00000574788.1	+	16	2755	c.525C>A	c.(523-525)gcC>gcA	p.A175A	USP6_ENST00000250066.6_Silent_p.A175A|USP6_ENST00000332776.4_Silent_p.A175A|USP6_ENST00000304328.5_5'UTR			P35125	UBP6_HUMAN	ubiquitin specific peptidase 6	175	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				cellular protein modification process (GO:0006464)|protein deubiquitination (GO:0016579)|regulation of vesicle-mediated transport (GO:0060627)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	calmodulin binding (GO:0005516)|cysteine-type endopeptidase activity (GO:0004197)|nucleic acid binding (GO:0003676)|Rab GTPase activator activity (GO:0005097)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	34						TCCTCCTGGCCTATTCGGAGT	0.493			T	"""COL1A1, CDH11, ZNF9, OMD"""	aneurysmal bone cysts																																			Dom	yes		17	17p13	9098	ubiquitin specific peptidase 6 (Tre-2 oncogene)		M	0													120.0	117.0	118.0					17																	5038559		2203	4300	6503	SO:0001819	synonymous_variant	9098			X63547	CCDS11069.2	17p13	2014-06-12	2014-06-12		ENSG00000129204	ENSG00000129204	3.4.19.12	"""Ubiquitin-specific peptidases"""	12629	protein-coding gene	gene with protein product	"""ubiquitin carboxyl-terminal hydrolase 6"", ""TBC1D3 and USP32 fusion"", ""Tre-2 oncogene"""	604334	"""ubiquitin specific protease 6 (Tre-2 oncogene)"", ""TRE oncogene, Smith Magenis syndrome chromosome region"", ""ubiquitin specific peptidase 6 (Tre-2 oncogene)"""	HRP1, TRESMCR		12838346, 1349106	Standard	NM_004505		Approved	Tre-2, TRE17, Tre2	uc002gav.1	P35125	OTTHUMG00000099449	ENST00000574788.1:c.525C>A	17.37:g.5038559C>A			Q15634|Q86WP6|Q8IWT4	Silent	SNP	ENST00000574788.1	37	CCDS11069.2																																																																																				0.493	USP6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438990.1		NM_004505	
ZBP1	81030	hgsc.bcm.edu	37	20	56195329	56195329	+	Missense_Mutation	SNP	G	G	T			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr20:56195329G>T	ENST00000371173.3	-	1	200	c.23C>A	c.(22-24)cCg>cAg	p.P8Q	ZBP1_ENST00000340462.4_Missense_Mutation_p.P8Q|ZBP1_ENST00000541799.1_Missense_Mutation_p.P8Q|ZBP1_ENST00000538947.1_5'UTR|ZBP1_ENST00000343535.4_Missense_Mutation_p.P8Q|ZBP1_ENST00000395822.3_Missense_Mutation_p.P8Q	NM_001160417.1|NM_030776.2	NP_001153889.1|NP_110403.2	Q9H171	ZBP1_HUMAN	Z-DNA binding protein 1	8					innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded RNA adenosine deaminase activity (GO:0003726)|left-handed Z-DNA binding (GO:0003692)|RNA binding (GO:0003723)			large_intestine(11)|lung(8)|ovary(4)|prostate(1)|skin(2)|urinary_tract(1)	27	Lung NSC(12;0.000545)|all_lung(29;0.00195)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;7.87e-13)|Epithelial(14;3.26e-09)|all cancers(14;3.62e-08)			TTCTCTGCCCGGGTCAGCAGG	0.587																																																	0													35.0	31.0	32.0					20																	56195329		2200	4298	6498	SO:0001583	missense	81030			AJ300575	CCDS13461.1, CCDS54477.1, CCDS54478.1	20q13.31	2009-08-21	2002-07-25	2002-07-26	ENSG00000124256	ENSG00000124256			16176	protein-coding gene	gene with protein product	"""DNA-dependent activator of IRFs"""	606750	"""chromosome 20 open reading frame 183"""	C20orf183		11842111	Standard	NM_030776		Approved	dJ718J7.3, DLM1, DLM-1, DAI	uc002xyo.3	Q9H171	OTTHUMG00000032824	ENST00000371173.3:c.23C>A	20.37:g.56195329G>T	ENSP00000360215:p.Pro8Gln		A2A2F7|B3KVA1|F5GYT1|Q5JY39|Q9BYW4	Missense_Mutation	SNP	ENST00000371173.3	37	CCDS13461.1	.	.	.	.	.	.	.	.	.	.	G	11.90	1.777050	0.31411	.	.	ENSG00000124256	ENST00000371173;ENST00000395822;ENST00000340462;ENST00000357677;ENST00000343535;ENST00000541799	T;T;T;T;T	0.17528	3.04;2.27;3.05;3.0;2.69	3.23	-2.64	0.06114	Winged helix-turn-helix transcription repressor DNA-binding (1);	1.393840	0.04956	N	0.461273	T	0.25644	0.0624	L	0.29908	0.895	0.09310	N	1	D;D;D;D	0.76494	0.999;0.979;0.993;0.979	D;P;P;P	0.66351	0.943;0.599;0.737;0.599	T	0.36261	-0.9755	10	0.54805	T	0.06	-0.6611	8.1512	0.31141	0.7008:0.0:0.2992:0.0	.	8;8;8;8	F5GYT1;A2RRL9;A2A2F7;Q9H171	.;.;.;ZBP1_HUMAN	Q	8	ENSP00000360215:P8Q;ENSP00000379167:P8Q;ENSP00000344954:P8Q;ENSP00000340584:P8Q;ENSP00000440552:P8Q	ENSP00000344954:P8Q	P	-	2	0	ZBP1	55628735	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.330000	0.07925	-0.567000	0.06046	-1.141000	0.01876	CCG		0.587	ZBP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079849.1		NM_030776	
ZNF30	90075	hgsc.bcm.edu	37	19	35435241	35435241	+	Silent	SNP	G	G	A			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr19:35435241G>A	ENST00000601142.1	+	5	1608	c.1371G>A	c.(1369-1371)gaG>gaA	p.E457E	ZNF30_ENST00000439785.1_Silent_p.E458E|ZNF30_ENST00000303586.7_Silent_p.E458E|ZNF30_ENST00000426813.2_Silent_p.E376E|ZNF30_ENST00000601957.1_3'UTR			P17039	ZNF30_HUMAN	zinc finger protein 30	457					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)	16	all_lung(56;8.38e-08)|Lung NSC(56;1.31e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)	GBM - Glioblastoma multiforme(1328;0.0265)		AACCCTATGAGTGTAAGGAAT	0.438																																																	0													63.0	64.0	64.0					19																	35435241		2203	4299	6502	SO:0001819	synonymous_variant	90075			X52359	CCDS46044.1, CCDS46045.1	19q13.13	2013-01-08	2006-05-10			ENSG00000168661		"""Zinc fingers, C2H2-type"", ""-"""	13090	protein-coding gene	gene with protein product			"""zinc finger protein 30 (KOX 28)"""				Standard	NM_001099437		Approved	KOX28, DKFZp686N19164, FLJ20562	uc010edq.1	P17039		ENST00000601142.1:c.1371G>A	19.37:g.35435241G>A			A5PLP1|A8K320|B4DIC0|Q6N068	Silent	SNP	ENST00000601142.1	37	CCDS46045.1																																																																																				0.438	ZNF30-003	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464432.1		NM_194325	
ZC3H4	23211	hgsc.bcm.edu	37	19	47575279	47575279	+	Silent	SNP	G	G	C	rs76187449	byFrequency	TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr19:47575279G>C	ENST00000253048.5	-	13	1939	c.1902C>G	c.(1900-1902)ccC>ccG	p.P634P	ZC3H4_ENST00000594019.1_Intron	NM_015168.1	NP_055983.1	Q9UPT8	ZC3H4_HUMAN	zinc finger CCCH-type containing 4	634	Pro-rich.						metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(13)|ovary(4)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)	41		all_cancers(25;3.3e-08)|all_epithelial(76;2.28e-06)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|all_neural(266;0.026)|Ovarian(192;0.0392)|Breast(70;0.0889)		OV - Ovarian serous cystadenocarcinoma(262;5.76e-05)|all cancers(93;7.69e-05)|Epithelial(262;0.00354)|GBM - Glioblastoma multiforme(486;0.0372)		ggtgcatgtcggggtgcatgt	0.672													g|||	134	0.0267572	0.0938	0.0115	5008	,	,		17976	0.0		0.002	False		,,,				2504	0.0																0													31.0	36.0	35.0					19																	47575279		2097	4223	6320	SO:0001819	synonymous_variant	23211			AB028987	CCDS42582.1	19q13.33	2012-07-05	2007-10-18	2007-10-18		ENSG00000130749		"""Zinc fingers, CCCH-type domain containing"""	17808	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 7"""	C19orf7			Standard	NM_015168		Approved	KIAA1064	uc002pga.4	Q9UPT8		ENST00000253048.5:c.1902C>G	19.37:g.47575279G>C			Q9Y420	Silent	SNP	ENST00000253048.5	37	CCDS42582.1																																																																																				0.672	ZC3H4-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466667.1			
ZNF83	55769	hgsc.bcm.edu	37	19	53117118	53117118	+	Missense_Mutation	SNP	C	C	T			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr19:53117118C>T	ENST00000597597.1	-	2	2953	c.700G>A	c.(700-702)Gaa>Aaa	p.E234K	ZNF83_ENST00000545872.1_Missense_Mutation_p.E234K|ZNF83_ENST00000594682.2_3'UTR|ZNF83_ENST00000544146.1_Missense_Mutation_p.E234K|ZNF83_ENST00000601257.1_Intron|ZNF83_ENST00000536937.1_Missense_Mutation_p.E234K|ZNF83_ENST00000541777.2_Missense_Mutation_p.E234K|ZNF83_ENST00000391789.4_Missense_Mutation_p.E234K|ZNF83_ENST00000301096.3_Missense_Mutation_p.E234K|ZNF83_ENST00000600714.1_Intron			P51522	ZNF83_HUMAN	zinc finger protein 83	234					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E234K(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	18				OV - Ovarian serous cystadenocarcinoma(262;0.00841)|GBM - Glioblastoma multiforme(134;0.0244)		TTGTTACATTCGTAAGGTTTT	0.388																																																	1	Substitution - Missense(1)	large_intestine(1)											85.0	77.0	80.0					19																	53117118		2203	4300	6503	SO:0001583	missense	55769			M27877	CCDS12854.1	19q13.3	2013-01-08	2006-05-12			ENSG00000167766		"""Zinc fingers, C2H2-type"""	13158	protein-coding gene	gene with protein product		194558	"""zinc finger protein 83 (HPF1)"", ""zinc finger protein 816B"""	ZNF816B		8088807	Standard	NM_018300		Approved	FLJ11015, HPF1	uc010epy.3	P51522		ENST00000597597.1:c.700G>A	19.37:g.53117118C>T	ENSP00000472619:p.Glu234Lys		A8MT75|Q3ZCX0|Q6PI08	Missense_Mutation	SNP	ENST00000597597.1	37	CCDS12854.1	.	.	.	.	.	.	.	.	.	.	N	0.009	-1.857421	0.00558	.	.	ENSG00000167766	ENST00000536937;ENST00000301096;ENST00000544146;ENST00000434535;ENST00000545872;ENST00000541777;ENST00000391789	T;T;T;T;T;T	0.19250	2.16;2.16;2.16;2.16;2.16;3.28	1.7	0.653	0.17828	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06005	0.0156	N	0.03224	-0.385	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.06405	0.0;0.002	T	0.39231	-0.9624	9	0.02654	T	1	.	2.6726	0.05071	0.2252:0.1504:0.0:0.6244	.	234;234	P51522-2;P51522	.;ZNF83_HUMAN	K	234	ENSP00000445993:E234K;ENSP00000301096:E234K;ENSP00000445470:E234K;ENSP00000440713:E234K;ENSP00000439681:E234K;ENSP00000375666:E234K	ENSP00000301096:E234K	E	-	1	0	ZNF83	57808930	0.000000	0.05858	0.077000	0.20336	0.020000	0.10135	-1.889000	0.01614	0.111000	0.17947	-0.600000	0.04104	GAA		0.388	ZNF83-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463700.1		NM_018300	
PBRM1	55193	ucsc.edu	37	3	52620685	52620685	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-4854-01A-01D-1373-10	TCGA-CZ-4854-11A-01D-1373-10	G	G	G	A	G	G	Unknown	Valid	Somatic	.	WXS	PGM	.		SOLID	7016e136-5c55-4ac9-b262-51529391aa79	09f66e4a-abaf-4331-ad1e-ed63263bb35e	g.chr3:52620685G>A	ENST00000296302.7	-	20	3144	c.3143C>T	c.(3142-3144)cCa>cTa	p.P1048L	PBRM1_ENST00000337303.4_Missense_Mutation_p.P1048L|PBRM1_ENST00000410007.1_Missense_Mutation_p.P1023L|PBRM1_ENST00000394830.3_Missense_Mutation_p.P1023L|PBRM1_ENST00000409057.1_Missense_Mutation_p.P1048L|PBRM1_ENST00000356770.4_Missense_Mutation_p.P1016L|PBRM1_ENST00000409114.3_Missense_Mutation_p.P1063L|PBRM1_ENST00000409767.1_Missense_Mutation_p.P1063L			Q86U86	PB1_HUMAN	polybromo 1	1048	BAH 1. {ECO:0000255|PROSITE- ProRule:PRU00370}.				chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.P1048R(2)|p.P1016R(1)		breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		GAAGTTTTCTGGGCATAACTT	0.363			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																	.		Rec	yes		3	3p21	55193	polybromo 1		E	3	Substitution - Missense(3)	kidney(3)											55.0	60.0	58.0					3																	52620685		2203	4300	6503	SO:0001583	missense	55193			BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.3143C>T	3.37:g.52620685G>A	ENSP00000296302:p.Pro1048Leu		A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Missense_Mutation	SNP	ENST00000296302.7	37		.	.	.	.	.	.	.	.	.	.	G	20.7	4.034976	0.75617	.	.	ENSG00000163939	ENST00000356770;ENST00000394830;ENST00000296302;ENST00000337303;ENST00000409057;ENST00000410007;ENST00000409114;ENST00000409767;ENST00000423351;ENST00000446103	D;D;D;D;D;D;D;D;D;D	0.86230	-2.09;-2.09;-2.09;-2.09;-2.09;-2.09;-2.09;-2.09;-2.09;-2.09	5.24	5.24	0.73138	Bromo adjacent homology (BAH) domain (3);	0.000000	0.85682	D	0.000000	D	0.94095	0.8107	M	0.83774	2.66	0.80722	D	1	D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D	0.97110	0.999;1.0;0.996;1.0;1.0;1.0;1.0;1.0;1.0	D	0.94775	0.7948	10	0.87932	D	0	.	18.8065	0.92040	0.0:0.0:1.0:0.0	.	1023;1047;1023;1048;1063;1063;1048;1016;1048	Q86U86-9;E7EVG2;Q86U86-4;Q86U86-2;Q86U86-8;Q86U86-7;Q86U86;Q86U86-3;Q86U86-5	.;.;.;.;.;.;PB1_HUMAN;.;.	L	1016;1023;1048;1048;1048;1023;1063;1063;1047;1006	ENSP00000349213:P1016L;ENSP00000378307:P1023L;ENSP00000296302:P1048L;ENSP00000338302:P1048L;ENSP00000386593:P1048L;ENSP00000386529:P1023L;ENSP00000386643:P1063L;ENSP00000386601:P1063L;ENSP00000387775:P1047L;ENSP00000397662:P1006L	ENSP00000296302:P1048L	P	-	2	0	PBRM1	52595725	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.410000	0.97335	2.435000	0.82474	0.555000	0.69702	CCA		0.363	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1		NM_018165	
