#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
RPL22	6146	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	6246873	6246873	+	Nonsense_Mutation	SNP	A	A	T			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr1:6246873A>T	ENST00000234875.4	-	4	284	c.246T>A	c.(244-246)taT>taA	p.Y82*	RPL22_ENST00000484532.1_Intron|RPL22_ENST00000497965.1_Nonsense_Mutation_p.Y49*	NM_000983.3	NP_000974.1	P35268	RL22_HUMAN	ribosomal protein L22	82					alpha-beta T cell differentiation (GO:0046632)|cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	heparin binding (GO:0008201)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			kidney(1)|large_intestine(2)|lung(2)|skin(1)	6	Ovarian(185;0.0634)	all_cancers(23;2.78e-38)|all_epithelial(116;8.88e-22)|all_lung(118;7.95e-08)|Lung NSC(185;1.6e-06)|all_neural(13;3.18e-06)|all_hematologic(16;8.99e-06)|Acute lymphoblastic leukemia(12;0.000365)|Breast(487;0.000496)|Renal(390;0.0007)|Colorectal(325;0.00104)|Glioma(11;0.00203)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0392)|Medulloblastoma(700;0.211)		Epithelial(90;4.53e-38)|GBM - Glioblastoma multiforme(13;3.33e-32)|OV - Ovarian serous cystadenocarcinoma(86;2.8e-19)|Colorectal(212;6.8e-08)|COAD - Colon adenocarcinoma(227;8.04e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|BRCA - Breast invasive adenocarcinoma(365;0.00107)|STAD - Stomach adenocarcinoma(132;0.00311)|READ - Rectum adenocarcinoma(331;0.0642)|Lung(427;0.182)		GATATTTCAAATACCTGCAGA	0.358			T	RUNX1	"""AML, CML"""																																p.Y82X		.		Dom	yes		1	1p36.31	6146	ribosomal protein L22 (EAP)		L	.	RPL22-650	0			c.T246A						.						46.0	47.0	46.0					1																	6246873		2202	4300	6502	SO:0001587	stop_gained	6146	exon4			TTTCAAATACCTG	BC058887	CCDS58.1	1p36.31	2011-04-06			ENSG00000116251	ENSG00000116251		"""L ribosomal proteins"""	10315	protein-coding gene	gene with protein product		180474				8395054	Standard	NM_000983		Approved	EAP, L22	uc001amd.3	P35268	OTTHUMG00000000953	ENST00000234875.4:c.246T>A	1.37:g.6246873A>T	ENSP00000346088:p.Tyr82*	69	0		81	17	NM_000983	0	0	3	6	3	B2R495|Q6IBD1	Nonsense_Mutation	SNP	ENST00000234875.4	37	CCDS58.1	.	.	.	.	.	.	.	.	.	.	A	22.4	4.279556	0.80692	.	.	ENSG00000116251	ENST00000234875	.	.	.	5.43	4.31	0.51392	.	0.122602	0.56097	D	0.000023	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	2.2758	7.3535	0.26706	0.7815:0.0:0.2185:0.0	.	.	.	.	X	82	.	ENSP00000346088:Y82X	Y	-	3	2	RPL22	6169460	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.692000	0.47018	0.906000	0.36621	0.379000	0.24179	TAT	.		0.358	RPL22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002830.1	NM_000983	
KIF1B	23095	broad.mit.edu	37	1	10352150	10352150	+	Silent	SNP	A	A	G			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr1:10352150A>G	ENST00000377086.1	+	17	1762	c.1560A>G	c.(1558-1560)ggA>ggG	p.G520G	KIF1B_ENST00000377081.1_Silent_p.G520G|KIF1B_ENST00000377083.1_Silent_p.G474G|KIF1B_ENST00000263934.6_Silent_p.G474G|KIF1B_ENST00000377093.4_Silent_p.G474G			O60333	KIF1B_HUMAN	kinesin family member 1B	520					anterograde axon cargo transport (GO:0008089)|apoptotic process (GO:0006915)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|mitochondrion transport along microtubule (GO:0047497)|neuromuscular synaptic transmission (GO:0007274)|neuron-neuron synaptic transmission (GO:0007270)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|endometrium(7)|kidney(8)|large_intestine(9)|lung(29)|ovary(3)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(2)	71	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		GGGAAGATGGAGGAACCCTAG	0.408																																					p.G474G													.	KIF1B-93	0			c.A1422G						.						126.0	134.0	131.0					1																	10352150		2203	4300	6503	SO:0001819	synonymous_variant	23095	exon15			AGATGGAGGAACC	AF257176	CCDS111.1, CCDS112.1	1p36.22	2014-09-17			ENSG00000054523	ENSG00000054523		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	16636	protein-coding gene	gene with protein product		605995		CMT2A, CMT2		11389829, 10762626	Standard	NM_015074		Approved	KIAA0591, KLP, HMSNII	uc001aqw.4	O60333	OTTHUMG00000001817	ENST00000377086.1:c.1560A>G	1.37:g.10352150A>G		155	0		197	4	NM_183416	0	0	0	0	0	A6NFS8|A6NKQ4|Q4VXC3|Q4VXC4|Q4VXC5|Q4VXC6|Q96Q94|Q9BV80|Q9P280	Silent	SNP	ENST00000377086.1	37																																																																																				.		0.408	KIF1B-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000005102.1		
ARID1A	8289	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	27094329	27094329	+	Missense_Mutation	SNP	G	G	A			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr1:27094329G>A	ENST00000324856.7	+	11	3408	c.3037G>A	c.(3037-3039)Gag>Aag	p.E1013K	ARID1A_ENST00000374152.2_Missense_Mutation_p.E630K|ARID1A_ENST00000457599.2_Missense_Mutation_p.E1013K	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	1013					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)		ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		CAAGTTGTATGAGCTGGGTGG	0.488			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.E1013K		.		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	.	ARID1A-584	0			c.G3037A						.						146.0	122.0	130.0					1																	27094329		2203	4300	6503	SO:0001583	missense	8289	exon11			TTGTATGAGCTGG	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.3037G>A	1.37:g.27094329G>A	ENSP00000320485:p.Glu1013Lys	159	0		142	32	NM_006015	0	0	0	0	0	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Missense_Mutation	SNP	ENST00000324856.7	37	CCDS285.1	.	.	.	.	.	.	.	.	.	.	G	36	5.703514	0.96812	.	.	ENSG00000117713	ENST00000324856;ENST00000457599;ENST00000374152	T;T;T	0.46819	0.86;0.86;0.86	5.17	5.17	0.71159	ARID/BRIGHT DNA-binding domain (2);	0.049842	0.85682	D	0.000000	T	0.64886	0.2639	L	0.59436	1.845	0.80722	D	1	D;D;D	0.67145	0.995;0.996;0.993	D;D;P	0.65323	0.909;0.934;0.861	T	0.64601	-0.6369	10	0.51188	T	0.08	-14.8758	18.8566	0.92255	0.0:0.0:1.0:0.0	.	1013;1013;667	O14497;O14497-2;Q4LE49	ARI1A_HUMAN;.;.	K	1013;1013;630	ENSP00000320485:E1013K;ENSP00000387636:E1013K;ENSP00000363267:E630K	ENSP00000320485:E1013K	E	+	1	0	ARID1A	26966916	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.657000	0.98554	2.678000	0.91216	0.655000	0.94253	GAG	.		0.488	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	
PDE4DIP	9659	hgsc.bcm.edu;broad.mit.edu	37	1	144856892	144856892	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr1:144856892T>C	ENST00000369354.3	-	40	6782	c.6593A>G	c.(6592-6594)aAg>aGg	p.K2198R	PDE4DIP_ENST00000313382.9_Missense_Mutation_p.K2092R|PDE4DIP_ENST00000530740.1_Missense_Mutation_p.K2283R|PDE4DIP_ENST00000524974.1_5'UTR|RP4-791M13.4_ENST00000532137.1_RNA|PDE4DIP_ENST00000369359.4_Missense_Mutation_p.K2334R|PDE4DIP_ENST00000369356.4_Missense_Mutation_p.K2198R			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	2198					cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		GACCAGCAGCTTGCCCTCCGC	0.517			T	PDGFRB	MPD																																p.K2198R		.		Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	.	PDE4DIP-663	0			c.A6593G						.						38.0	34.0	35.0					1																	144856892		2193	4248	6441	SO:0001583	missense	9659	exon40			AGCAGCTTGCCCT	AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.6593A>G	1.37:g.144856892T>C	ENSP00000358360:p.Lys2198Arg	126	1		124	8	NM_014644	0	0	0	0	0	A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Missense_Mutation	SNP	ENST00000369354.3	37	CCDS30824.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	6.042|6.042	0.376140|0.376140	0.11466|0.11466	.|.	.|.	ENSG00000178104|ENSG00000178104	ENST00000313382;ENST00000369354;ENST00000369356;ENST00000530740;ENST00000369359|ENST00000530130	T;T;T;T;T|.	0.01430|.	4.9;5.03;5.06;4.99;5.01|.	4.52|4.52	-2.16|-2.16	0.07080|0.07080	.|.	.|.	.|.	.|.	.|.	T|T	0.12220|0.12220	0.0297|0.0297	L|L	0.33339|0.33339	1.005|1.005	0.09310|0.09310	N|N	1|1	B;B|.	0.13594|.	0.001;0.008|.	B;B|.	0.11329|.	0.003;0.006|.	T|T	0.33879|0.33879	-0.9851|-0.9851	8|5	.|.	.|.	.|.	.|.	5.6438|5.6438	0.17579|0.17579	0.0:0.2482:0.1388:0.613|0.0:0.2482:0.1388:0.613	.|.	2092;2198|.	Q5VU43-3;Q5VU43|.	.;MYOME_HUMAN|.	R|G	2092;2198;2198;2283;2334|275	ENSP00000327209:K2092R;ENSP00000358360:K2198R;ENSP00000358363:K2198R;ENSP00000435654:K2283R;ENSP00000358366:K2334R|.	.|.	K|S	-|-	2|1	0|0	PDE4DIP|PDE4DIP	143568249|143568249	0.003000|0.003000	0.15002|0.15002	0.837000|0.837000	0.33122|0.33122	0.007000|0.007000	0.05969|0.05969	0.773000|0.773000	0.26661|0.26661	-0.611000|-0.611000	0.05709|0.05709	-0.475000|-0.475000	0.04921|0.04921	AAG|AGC	.		0.517	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000038858.2	NM_022359	
SEC22B	9554	broad.mit.edu	37	1	145112418	145112418	+	RNA	SNP	C	C	G			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr1:145112418C>G	ENST00000453618.1	+	0	719							O75396	SC22B_HUMAN	SEC22 vesicle trafficking protein homolog B (S. cerevisiae) (gene/pseudogene)						ER to Golgi vesicle-mediated transport (GO:0006888)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)											GACAGTTGTGCTCGAAGAAAC	0.418																																					.													.	.	0			.						.						155.0	139.0	144.0					1																	145112418		2068	4212	6280			9554	.			GTTGTGCTCGAAG	AF047442		1q21.1	2012-04-20	2010-03-12	2006-04-25	ENSG00000223380				10700	protein-coding gene	gene with protein product		604029	"""SEC22, vesicle trafficking protein (S. cerevisiae)-like 1"", ""SEC22 vesicle trafficking protein-like 1 (S. cerevisiae)"", ""SEC22 vesicle trafficking protein homolog B (S. cerevisiae)"""	SEC22L1		9094723, 16354670	Standard	NM_004892		Approved	sec22b, ERS-24	uc031poa.1	O75396	OTTHUMG00000013745		1.37:g.145112418C>G		76	1		87	8	.	0	0	0	0	0	A8K1G0	Missense_Mutation	SNP	ENST00000453618.1	37																																																																																				.		0.418	SEC22B-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000038523.5	NM_004892	
ADAR	103	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	154574720	154574720	+	Missense_Mutation	SNP	A	A	T			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr1:154574720A>T	ENST00000368474.4	-	2	597	c.398T>A	c.(397-399)cTg>cAg	p.L133Q	ADAR_ENST00000471068.1_5'UTR|ADAR_ENST00000368471.3_5'UTR|ADAR_ENST00000292205.5_Missense_Mutation_p.L176Q	NM_001111.4|NM_015840.3|NM_015841.3	NP_001102|NP_056655.2|NP_056656.2	P55265	DSRAD_HUMAN	adenosine deaminase, RNA-specific	133					adenosine to inosine editing (GO:0006382)|base conversion or substitution editing (GO:0016553)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|miRNA loading onto RISC involved in gene silencing by miRNA (GO:0035280)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|negative regulation of viral genome replication (GO:0045071)|positive regulation of viral genome replication (GO:0045070)|pre-miRNA processing (GO:0031054)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|supraspliceosomal complex (GO:0044530)	DNA binding (GO:0003677)|double-stranded RNA adenosine deaminase activity (GO:0003726)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|lung(20)|ovary(4)|prostate(2)|skin(2)	51	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.0997)		LUSC - Lung squamous cell carcinoma(543;0.185)	Colorectal(1306;0.115)		GTAGATACTCAGTTCCTGGAA	0.517																																					p.L133Q		.											.	ADAR-157	0			c.T398A						.						65.0	67.0	66.0					1																	154574720		2203	4300	6503	SO:0001583	missense	103	exon2			ATACTCAGTTCCT	BC038227	CCDS1071.1, CCDS30879.1	1q21.3	2012-03-22			ENSG00000160710	ENSG00000160710	3.5.4.-		225	protein-coding gene	gene with protein product		146920	"""interferon-induced protein 4"""	IFI4, G1P1		7972084	Standard	NM_001111		Approved	ADAR1	uc001ffh.3	P55265	OTTHUMG00000037261	ENST00000368474.4:c.398T>A	1.37:g.154574720A>T	ENSP00000357459:p.Leu133Gln	150	0		102	25	NM_001111	0	0	3	4	1	B1AQQ9|B1AQR0|D3DV76|O15223|O43859|O43860|Q9BYM3|Q9BYM4	Missense_Mutation	SNP	ENST00000368474.4	37	CCDS1071.1	.	.	.	.	.	.	.	.	.	.	A	18.97	3.736498	0.69304	.	.	ENSG00000160710	ENST00000292205;ENST00000368474;ENST00000529168	T;T;T	0.79749	-1.3;-1.3;-1.3	4.47	4.47	0.54385	Winged helix-turn-helix transcription repressor DNA-binding (1);Double-stranded RNA-specific adenosine deaminase (DRADA) (2);	0.910334	0.09504	N	0.793175	D	0.86008	0.5830	M	0.63843	1.955	0.53688	D	0.999979	D;D;D	0.89917	0.998;1.0;0.999	D;D;D	0.85130	0.972;0.992;0.997	D	0.83933	0.0307	10	0.87932	D	0	-11.1093	13.8697	0.63610	1.0:0.0:0.0:0.0	.	133;133;133	P55265-3;P55265-2;P55265	.;.;DSRAD_HUMAN	Q	176;133;128	ENSP00000292205:L176Q;ENSP00000357459:L133Q;ENSP00000431794:L128Q	ENSP00000292205:L176Q	L	-	2	0	ADAR	152841344	1.000000	0.71417	0.166000	0.22797	0.666000	0.39218	6.906000	0.75719	1.992000	0.58205	0.402000	0.26972	CTG	.		0.517	ADAR-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000090691.2	NM_001111	
FCRL4	83417	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	157559028	157559028	+	Silent	SNP	T	T	C			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr1:157559028T>C	ENST00000271532.1	-	3	408	c.273A>G	c.(271-273)ccA>ccG	p.P91P	FCRL4_ENST00000448509.2_5'UTR	NM_031282.2	NP_112572.1	Q96PJ5	FCRL4_HUMAN	Fc receptor-like 4	91	Ig-like C2-type 1.				immune system process (GO:0002376)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(5)|lung(20)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	40	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.245)				GGTTACTTCGTGGGGAGCCCC	0.498																																					p.P91P		.											.	FCRL4-229	0			c.A273G						.						74.0	79.0	77.0					1																	157559028		2203	4300	6503	SO:0001819	synonymous_variant	83417	exon3			ACTTCGTGGGGAG	AF343661	CCDS1166.1	1q21	2013-01-14			ENSG00000163518	ENSG00000163518		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18507	protein-coding gene	gene with protein product		605876				11290337, 11493702	Standard	NM_031282		Approved	FCRH4, IRTA1, IGFP2, CD307d	uc001fqw.3	Q96PJ5	OTTHUMG00000035488	ENST00000271532.1:c.273A>G	1.37:g.157559028T>C		154	0		165	32	NM_031282	0	0	0	0	0	Q96PJ3|Q96RE0	Silent	SNP	ENST00000271532.1	37	CCDS1166.1																																																																																			.		0.498	FCRL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086180.1	NM_031282	
MPZL1	9019	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	167745333	167745333	+	Missense_Mutation	SNP	A	A	C			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr1:167745333A>C	ENST00000359523.2	+	5	840	c.638A>C	c.(637-639)aAg>aCg	p.K213T	MPZL1_ENST00000474859.1_Intron|MPZL1_ENST00000403379.3_3'UTR|MPZL1_ENST00000392121.3_Intron	NM_003953.5|NM_024569.4	NP_003944.1|NP_078845.3	O95297	MPZL1_HUMAN	myelin protein zero-like 1	213					cell-cell signaling (GO:0007267)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)	structural molecule activity (GO:0005198)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(2)	15	all_hematologic(923;0.215)					TCACCAGTTAAGCAGGCTCCT	0.413																																					p.K213T		.											.	MPZL1-516	0			c.A638C						.						76.0	74.0	75.0					1																	167745333		2203	4300	6503	SO:0001583	missense	9019	exon5			CAGTTAAGCAGGC	AF087020	CCDS1264.1, CCDS44273.1, CCDS53425.1	1q24.2	2013-01-11			ENSG00000197965	ENSG00000197965		"""Immunoglobulin superfamily / V-set domain containing"""	7226	protein-coding gene	gene with protein product		604376				9792637	Standard	NM_003953		Approved	PZR, FLJ21047	uc001geo.3	O95297	OTTHUMG00000034571	ENST00000359523.2:c.638A>C	1.37:g.167745333A>C	ENSP00000352513:p.Lys213Thr	99	0		93	12	NM_003953	0	0	6	16	10	B2REB9|B2REC0|Q5R332|Q8IX11|Q9BWZ3|Q9NYK4|Q9UL20	Missense_Mutation	SNP	ENST00000359523.2	37	CCDS1264.1	.	.	.	.	.	.	.	.	.	.	A	22.6	4.313200	0.81358	.	.	ENSG00000197965	ENST00000359523	D	0.96365	-3.99	5.28	5.28	0.74379	.	.	.	.	.	D	0.95370	0.8497	L	0.29908	0.895	0.33196	D	0.551469	D	0.71674	0.998	D	0.78314	0.991	D	0.94904	0.8059	8	0.33141	T	0.24	.	14.4968	0.67694	1.0:0.0:0.0:0.0	.	213	O95297	MPZL1_HUMAN	T	213	ENSP00000352513:K213T	ENSP00000352513:K213T	K	+	2	0	MPZL1	166011957	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.562000	0.53777	2.307000	0.77673	0.528000	0.53228	AAG	.		0.413	MPZL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083655.2	NM_024569	
CACYBP	27101	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	174979129	174979129	+	Missense_Mutation	SNP	G	G	T			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr1:174979129G>T	ENST00000367679.2	+	6	1049	c.601G>T	c.(601-603)Gat>Tat	p.D201Y	MRPS14_ENST00000498253.1_5'Flank|CACYBP_ENST00000405362.1_Missense_Mutation_p.D158Y|CACYBP_ENST00000367681.2_Missense_Mutation_p.D158Y	NM_014412.2	NP_055227.1	Q9HB71	CYBP_HUMAN	calcyclin binding protein	201	Interaction with S100A6. {ECO:0000250}.|Interaction with SKP1.|SGS. {ECO:0000255|PROSITE- ProRule:PRU00386}.				aging (GO:0007568)|cardiac muscle cell differentiation (GO:0055007)|cellular response to calcium ion (GO:0071277)|negative regulation of cell death (GO:0060548)|positive regulation of DNA replication (GO:0045740)|response to growth hormone (GO:0060416)	beta-catenin destruction complex (GO:0030877)|cell body (GO:0044297)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|nuclear envelope lumen (GO:0005641)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)			NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(1)|prostate(1)	11						AATTTATGAAGATGGAGACGA	0.383																																					p.D201Y		.											.	CACYBP-90	0			c.G601T						.						86.0	85.0	85.0					1																	174979129		2203	4300	6503	SO:0001583	missense	27101	exon6			TATGAAGATGGAG	BC022352	CCDS1315.1, CCDS30942.1	1q24-q25	2008-02-05			ENSG00000116161	ENSG00000116161			30423	protein-coding gene	gene with protein product		606186				11389839, 12421809	Standard	XM_005245092		Approved	SIP, S100A6BP	uc001gkj.1	Q9HB71	OTTHUMG00000034941	ENST00000367679.2:c.601G>T	1.37:g.174979129G>T	ENSP00000356652:p.Asp201Tyr	60	0		68	17	NM_014412	0	0	36	61	25	B2ZWH2|B3KSF1|O60666|Q5R370|Q5R371	Missense_Mutation	SNP	ENST00000367679.2	37	CCDS1315.1	.	.	.	.	.	.	.	.	.	.	G	28.1	4.891415	0.91889	.	.	ENSG00000116161	ENST00000367681;ENST00000450101;ENST00000367679;ENST00000405362	T;T	0.58060	0.36;0.36	5.89	5.89	0.94794	SGS (2);HSP20-like chaperone (1);	0.132069	0.64402	D	0.000002	T	0.68091	0.2963	M	0.79258	2.445	0.80722	D	1	P	0.48589	0.912	P	0.50791	0.65	T	0.71031	-0.4710	10	0.72032	D	0.01	-24.1569	20.2561	0.98419	0.0:0.0:1.0:0.0	.	201	Q9HB71	CYBP_HUMAN	Y	158;174;201;158	ENSP00000356654:D158Y;ENSP00000385771:D158Y	ENSP00000356652:D201Y	D	+	1	0	CACYBP	173245752	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.296000	0.96104	2.797000	0.96272	0.563000	0.77884	GAT	.		0.383	CACYBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084583.3	NM_014412	
RGS16	6004	ucsc.edu	37	1	182569597	182569597	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr1:182569597C>T	ENST00000367558.5	-	5	587	c.439G>A	c.(439-441)Gcc>Acc	p.A147T		NM_002928.3	NP_002919.3	O15492	RGS16_HUMAN	regulator of G-protein signaling 16	147	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				positive regulation of GTPase activity (GO:0043547)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)			NS(1)|endometrium(3)|large_intestine(2)|lung(4)|ovary(1)	11						GTGGCTGTGGCAGTCTGCAGG	0.587																																					p.A147T													.	RGS16-227	0			c.G439A						.						143.0	111.0	121.0					1																	182569597		2203	4300	6503	SO:0001583	missense	6004	exon5			CTGTGGCAGTCTG	U70426	CCDS1348.1	1q25-q31	2008-02-05	2007-08-14		ENSG00000143333	ENSG00000143333		"""Regulators of G-protein signaling"""	9997	protein-coding gene	gene with protein product		602514	"""regulator of G-protein signalling 16"""			9469939	Standard	NM_002928		Approved	A28-RGS14, RGS-r	uc001gpl.4	O15492	OTTHUMG00000035212	ENST00000367558.5:c.439G>A	1.37:g.182569597C>T	ENSP00000356529:p.Ala147Thr	130	0		126	1	NM_002928	0	0	4	4	0	B2R4M4|Q5VYN9|Q99701	Missense_Mutation	SNP	ENST00000367558.5	37	CCDS1348.1	.	.	.	.	.	.	.	.	.	.	C	9.805	1.181561	0.21787	.	.	ENSG00000143333	ENST00000367558	T	0.29655	1.56	5.38	3.51	0.40186	Regulator of G protein signalling (3);Regulator of G protein signalling superfamily (1);	0.156624	0.56097	N	0.000025	T	0.34716	0.0907	M	0.75615	2.305	0.19300	N	0.99998	B	0.33940	0.433	B	0.38156	0.266	T	0.17471	-1.0368	10	0.32370	T	0.25	.	9.3651	0.38219	0.0:0.6543:0.2723:0.0734	.	147	O15492	RGS16_HUMAN	T	147	ENSP00000356529:A147T	ENSP00000356529:A147T	A	-	1	0	RGS16	180836220	0.000000	0.05858	0.022000	0.16811	0.002000	0.02628	0.321000	0.19558	0.655000	0.30866	0.555000	0.69702	GCC	.		0.587	RGS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085188.1	NM_002928	
NAV1	89796	hgsc.bcm.edu	37	1	201762968	201762968	+	Missense_Mutation	SNP	C	C	G			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr1:201762968C>G	ENST00000367296.4	+	14	3790	c.3370C>G	c.(3370-3372)Cgc>Ggc	p.R1124G	NAV1_ENST00000367300.3_Missense_Mutation_p.R1067G|NAV1_ENST00000367297.4_Missense_Mutation_p.R1116G|IPO9-AS1_ENST00000413035.1_RNA|NAV1_ENST00000367295.1_Missense_Mutation_p.R733G|NAV1_ENST00000469130.1_3'UTR|NAV1_ENST00000367302.1_Missense_Mutation_p.R1080G|NAV1_ENST00000295624.6_Missense_Mutation_p.R1124G	NM_020443.4	NP_065176.3	Q8NEY1	NAV1_HUMAN	neuron navigator 1	1124					microtubule bundle formation (GO:0001578)|neuron migration (GO:0001764)	cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(5)|central_nervous_system(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(29)|ovary(4)|prostate(3)|skin(1)|stomach(2)	70						TATGACATCCCGCCTGCGACA	0.582																																					p.R1124G		.											.	NAV1-228	0			c.C3370G						.						70.0	66.0	67.0					1																	201762968		2203	4300	6503	SO:0001583	missense	89796	exon14			ACATCCCGCCTGC	AF086348	CCDS1414.1, CCDS1414.2, CCDS53456.1	1q32.3	2008-07-18			ENSG00000134369	ENSG00000134369			15989	protein-coding gene	gene with protein product	"""neuron navigator-1"", ""pore membrane and/or filament interacting like protein 3"""	611628				12079279, 12062803	Standard	NM_020443		Approved	FLJ12560, FLJ14203, KIAA1151, MGC14961, POMFIL3, steerin-1, DKFZp781D0314	uc001gwu.3	Q8NEY1	OTTHUMG00000035766	ENST00000367296.4:c.3370C>G	1.37:g.201762968C>G	ENSP00000356265:p.Arg1124Gly	88	0		99	5	NM_020443	0	0	0	0	0	A8MS88|Q5SVH1|Q5SVH2|Q5SVH3|Q5SVH7|Q5VUY9|Q8IVL2|Q96II1|Q9H7V9|Q9H9S9|Q9H9T5|Q9UGI1|Q9ULK7|Q9ULR9	Missense_Mutation	SNP	ENST00000367296.4	37	CCDS1414.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	27.5|27.5	4.841219|4.841219	0.91197|0.91197	.|.	.|.	ENSG00000134369|ENSG00000134369	ENST00000430015|ENST00000367302;ENST00000367296;ENST00000295624;ENST00000367297;ENST00000367300;ENST00000391966;ENST00000367295	.|D;D;D;D;D;D	.|0.94497	.|-3.44;-3.44;-3.44;-3.44;-3.44;-3.44	4.95|4.95	4.95|4.95	0.65309|0.65309	.|.	.|0.058638	.|0.64402	.|D	.|0.000002	D|D	0.97037|0.97037	0.9032|0.9032	M|M	0.73598|0.73598	2.24|2.24	0.58432|0.58432	D|D	0.999991|0.999991	.|D;D;D;D;D	.|0.89917	.|1.0;0.997;0.996;0.998;1.0	.|D;D;D;D;D	.|0.87578	.|0.998;0.932;0.948;0.991;0.998	D|D	0.97499|0.97499	1.0059|1.0059	5|10	.|0.72032	.|D	.|0.01	-24.902|-24.902	17.9873|17.9873	0.89159|0.89159	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|1116;733;1124;624;1124	.|Q8NEY1-6;Q8NEY1-5;Q8NEY1;A8MYI2;Q8NEY1-3	.|.;.;NAV1_HUMAN;.;.	R|G	673|1080;1124;1124;1116;1067;624;733	.|ENSP00000356271:R1080G;ENSP00000356265:R1124G;ENSP00000295624:R1124G;ENSP00000356266:R1116G;ENSP00000356269:R1067G;ENSP00000356264:R733G	.|ENSP00000295624:R1124G	P|R	+|+	2|1	0|0	NAV1|NAV1	200029591|200029591	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.939000|0.939000	0.58152|0.58152	5.512000|5.512000	0.67030|0.67030	2.557000|2.557000	0.86248|0.86248	0.462000|0.462000	0.41574|0.41574	CCG|CGC	.		0.582	NAV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000087013.1	NM_020443	
KIN	22944	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	7825098	7825098	+	Missense_Mutation	SNP	C	C	G			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr10:7825098C>G	ENST00000379562.4	-	2	202	c.155G>C	c.(154-156)aGa>aCa	p.R52T	KIN_ENST00000535925.1_Missense_Mutation_p.R52T|KIN_ENST00000543003.1_Intron	NM_012311.3	NP_036443.1			Kin17 DNA and RNA binding protein											endometrium(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|pancreas(1)|skin(2)	19						CAATAGTTGTCTCTGATGAGA	0.328																																					p.R52T		.											.	KIN-230	0			c.G155C						.						61.0	60.0	60.0					10																	7825098		2203	4298	6501	SO:0001583	missense	22944	exon2			AGTTGTCTCTGAT	AJ005273	CCDS7080.1	10p15-p14	2014-07-15	2014-07-15		ENSG00000151657	ENSG00000151657			6327	protein-coding gene	gene with protein product		601720	"""antigenic determinant of recA protein (mouse) homolog"", ""KIN, antigenic determinant of recA protein homolog (mouse)"""			1923796, 24140279	Standard	NM_012311		Approved	KIN17, Rts2	uc001ijt.3	O60870	OTTHUMG00000017634	ENST00000379562.4:c.155G>C	10.37:g.7825098C>G	ENSP00000368881:p.Arg52Thr	49	0		61	8	NM_012311	0	0	4	6	2		Missense_Mutation	SNP	ENST00000379562.4	37	CCDS7080.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.266664	0.80358	.	.	ENSG00000151657	ENST00000535925;ENST00000379562	.	.	.	6.06	4.18	0.49190	DNA/RNA-binding protein Kin17, conserved domain (1);	0.132739	0.64402	D	0.000002	T	0.81331	0.4800	H	0.95114	3.625	0.80722	D	1	B;B	0.22146	0.065;0.065	B;B	0.35470	0.203;0.203	T	0.80384	-0.1405	9	0.87932	D	0	-35.5448	10.9911	0.47549	0.13:0.8027:0.0:0.0672	.	52;52	B4DX32;O60870	.;KIN17_HUMAN	T	52	.	ENSP00000368881:R52T	R	-	2	0	KIN	7865104	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.693000	0.84214	0.846000	0.35142	0.650000	0.86243	AGA	.		0.328	KIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046683.2	NM_012311	
PLCE1	51196	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	10	95849076	95849076	+	Intron	SNP	A	A	G			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr10:95849076A>G	ENST00000371380.3	+	2	1441				PLCE1_ENST00000371385.3_Silent_p.V75V|RP11-429H9.4_ENST00000438899.1_RNA|PLCE1_ENST00000260766.3_Intron|PLCE1_ENST00000371375.1_Silent_p.V75V			Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1						activation of MAPK activity (GO:0000187)|calcium-mediated signaling (GO:0019722)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|diacylglycerol biosynthetic process (GO:0006651)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerulus development (GO:0032835)|heart development (GO:0007507)|inositol phosphate metabolic process (GO:0043647)|inositol phosphate-mediated signaling (GO:0048016)|lipid catabolic process (GO:0016042)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipid metabolic process (GO:0006644)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of GTPase activity (GO:0043547)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|Ras protein signal transduction (GO:0007265)|regulation of cell growth (GO:0001558)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of protein kinase activity (GO:0045859)|regulation of Ras protein signal transduction (GO:0046578)|regulation of smooth muscle contraction (GO:0006940)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)|guanyl-nucleotide exchange factor activity (GO:0005085)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|Ras GTPase binding (GO:0017016)|receptor signaling protein activity (GO:0005057)			liver(1)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	8		Colorectal(252;0.0458)				TCTCTGAGGTACCCAATTTTA	0.502																																					p.V75V		.											.	PLCE1-229	0			c.A225G						.						142.0	126.0	131.0					10																	95849076		1568	3582	5150	SO:0001627	intron_variant	51196	exon1			TGAGGTACCCAAT		CCDS41552.1, CCDS53555.1	10q23	2010-02-22			ENSG00000138193	ENSG00000138193	3.1.4.11		17175	protein-coding gene	gene with protein product	"""nephrosis type 3"""	608414				11022047, 11022048	Standard	NM_016341		Approved	KIAA1516, PLCE, NPHS3	uc001kjk.3	Q9P212	OTTHUMG00000018789	ENST00000371380.3:c.1207-42855A>G	10.37:g.95849076A>G		198	0		169	66	NM_001165979	0	0	0	0	0	A6NGW0|A6NLA1|A7MBN7|A8K1D7|B9EIJ6|Q1X6H8|Q5VWL4|Q5VWL5|Q9H9X8|Q9HBX6|Q9HC53|Q9UHV3	Silent	SNP	ENST00000371380.3	37	CCDS41552.1																																																																																			.		0.502	PLCE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049469.3	NM_016341	
BEST1	7439	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	61730354	61730354	+	Silent	SNP	C	C	T			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr11:61730354C>T	ENST00000378043.4	+	10	2371	c.1728C>T	c.(1726-1728)gcC>gcT	p.A576A	BEST1_ENST00000534553.1_3'UTR|BEST1_ENST00000301774.9_Silent_p.A204A|FTH1_ENST00000529191.1_Intron|BEST1_ENST00000378042.3_Silent_p.A489A|FTH1_ENST00000529631.1_Intron|BEST1_ENST00000449131.2_Silent_p.A516A	NM_004183.3	NP_004174.1	O76090	BEST1_HUMAN	bestrophin 1	576					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|detection of light stimulus involved in visual perception (GO:0050908)|ion transmembrane transport (GO:0034220)|regulation of calcium ion transport (GO:0051924)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	basolateral plasma membrane (GO:0016323)|chloride channel complex (GO:0034707)|cytosol (GO:0005829)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(9)|prostate(1)|skin(2)|urinary_tract(2)	25						CTTATTGGGCCTTGGAAAACA	0.507																																					p.A576A		.											.	BEST1-90	0			c.C1728T						.						120.0	130.0	126.0					11																	61730354		2202	4299	6501	SO:0001819	synonymous_variant	7439	exon10			TTGGGCCTTGGAA	AF057170	CCDS31580.1, CCDS44623.1	11q12	2013-02-14	2006-10-18	2006-10-18	ENSG00000167995	ENSG00000167995		"""Ion channels / Chloride channels : Calcium activated : Bestrophins"""	12703	protein-coding gene	gene with protein product	"""Best disease"""	607854	"""vitelliform macular dystrophy 2"""	VMD2		1302019, 17003041	Standard	NM_004183		Approved	BMD, BEST, RP50	uc001nsr.2	O76090	OTTHUMG00000167469	ENST00000378043.4:c.1728C>T	11.37:g.61730354C>T		103	0		91	13	NM_004183	0	0	0	0	0	A8K0W6|B7Z3J8|B7Z736|O75904|Q53YQ9|Q8IUR9|Q8IZ80	Silent	SNP	ENST00000378043.4	37	CCDS31580.1																																																																																			.		0.507	BEST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394715.1	NM_004183	
MAML2	84441	hgsc.bcm.edu	37	11	95825431	95825431	+	Silent	SNP	T	T	C			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr11:95825431T>C	ENST00000524717.1	-	2	3048	c.1764A>G	c.(1762-1764)caA>caG	p.Q588Q		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	588					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)		CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				gctgttgctgTTGGGTGTAGT	0.522			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid																																p.Q588Q		.		Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	.	MAML2-850	0			c.A1764G						.																																			SO:0001819	synonymous_variant	84441	exon2			TTGCTGTTGGGTG	AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.1764A>G	11.37:g.95825431T>C		5	0		6	3	NM_032427	0	0	2	2	0	A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Silent	SNP	ENST00000524717.1	37	CCDS44714.1																																																																																			.		0.522	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395540.1		
C12orf57	113246	broad.mit.edu;ucsc.edu	37	12	7055012	7055012	+	Missense_Mutation	SNP	A	A	G			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr12:7055012A>G	ENST00000229281.5	+	3	407	c.308A>G	c.(307-309)aAg>aGg	p.K103R	C12orf57_ENST00000540506.2_Missense_Mutation_p.K68R|C12orf57_ENST00000537087.1_Missense_Mutation_p.K74R|PTPN6_ENST00000399448.1_5'Flank|PTPN6_ENST00000447931.2_5'Flank|C12orf57_ENST00000542222.1_3'UTR|RNU7-1_ENST00000458811.1_RNA|U47924.31_ENST00000607421.1_RNA	NM_138425.2	NP_612434.1	Q99622	C10_HUMAN	chromosome 12 open reading frame 57	103						cytoplasm (GO:0005737)				kidney(1)|large_intestine(1)	2						GGCAAGCTGAAGGCGCTGTTT	0.627																																					p.K103R													.	C12orf57-90	0			c.A308G						.						70.0	55.0	60.0					12																	7055012		2203	4300	6503	SO:0001583	missense	113246	exon3			AGCTGAAGGCGCT	U47924	CCDS8571.1	12p13.31	2012-05-30			ENSG00000111678	ENSG00000111678			29521	protein-coding gene	gene with protein product		615140				9445485	Standard	NM_138425		Approved	GRCC10, C10	uc009zfj.2	Q99622	OTTHUMG00000169017	ENST00000229281.5:c.308A>G	12.37:g.7055012A>G	ENSP00000229281:p.Lys103Arg	30	0		36	4	NM_138425	0	0	156	218	62	B2R4Q6	Missense_Mutation	SNP	ENST00000229281.5	37	CCDS8571.1	.	.	.	.	.	.	.	.	.	.	A	10.83	1.459836	0.26248	.	.	ENSG00000111678	ENST00000545581;ENST00000537087;ENST00000229281	T;T;T	0.78364	-0.89;-1.17;-0.89	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	T	0.58352	0.2116	N	0.13198	0.31	0.80722	D	1	B	0.23128	0.08	B	0.19946	0.027	T	0.56372	-0.7990	10	0.02654	T	1	-18.3011	13.8505	0.63494	1.0:0.0:0.0:0.0	.	103	Q99622	C10_HUMAN	R	103;74;103	ENSP00000440602:K103R;ENSP00000440937:K74R;ENSP00000229281:K103R	ENSP00000229281:K103R	K	+	2	0	C12orf57	6925273	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	9.092000	0.94157	2.075000	0.62263	0.379000	0.24179	AAG	.		0.627	C12orf57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401959.1	NM_138425	
ABCC9	10060	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	21962862	21962862	+	Silent	SNP	G	G	A			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr12:21962862G>A	ENST00000261201.4	-	35	4238	c.4239C>T	c.(4237-4239)tgC>tgT	p.C1413C	ABCC9_ENST00000261200.4_Silent_p.C1413C|ABCC9_ENST00000345162.2_Silent_p.C1377C	NM_005691.2	NP_005682.2	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 9	1413	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				defense response to virus (GO:0051607)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	ATP-sensitive potassium channel complex (GO:0008282)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcomere (GO:0030017)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|sulfonylurea receptor activity (GO:0008281)|transporter activity (GO:0005215)			NS(2)|breast(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|lung(56)|ovary(4)|pancreas(1)|prostate(4)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(5)	118					Adenosine triphosphate(DB00171)|Glyburide(DB01016)	TGTCATCTGTGCATTTGCACT	0.323																																					p.C1413C		.											.	ABCC9-96	0			c.C4239T						.						83.0	85.0	84.0					12																	21962862		2203	4300	6503	SO:0001819	synonymous_variant	10060	exon35			ATCTGTGCATTTG	AF061323	CCDS8693.1, CCDS8694.1	12p12.1	2014-09-17			ENSG00000069431	ENSG00000069431		"""ATP binding cassette transporters / subfamily C"""	60	protein-coding gene	gene with protein product	"""sulfonylurea receptor 2"""	601439				9457174, 15034580	Standard	NM_020297		Approved	SUR2, CMD1O	uc001rfh.3	O60706	OTTHUMG00000169094	ENST00000261201.4:c.4239C>T	12.37:g.21962862G>A		94	0		127	24	NM_005691	0	0	2	2	0	O60707	Silent	SNP	ENST00000261201.4	37	CCDS8694.1																																																																																			.		0.323	ABCC9-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402230.1	NM_005691	
C2CD5	9847	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	22666235	22666235	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr12:22666235T>C	ENST00000333957.4	-	9	1286	c.1031A>G	c.(1030-1032)gAa>gGa	p.E344G	C2CD5_ENST00000542676.1_Missense_Mutation_p.E344G|C2CD5_ENST00000545552.1_Missense_Mutation_p.E335G|C2CD5_ENST00000536386.1_Missense_Mutation_p.E335G|C2CD5_ENST00000544930.1_Missense_Mutation_p.E137G|C2CD5_ENST00000446597.1_Missense_Mutation_p.E344G|C2CD5_ENST00000396028.2_Missense_Mutation_p.E335G	NM_014802.1	NP_055617.1	Q86YS7	C2CD5_HUMAN	C2 calcium-dependent domain containing 5	344					cellular response to insulin stimulus (GO:0032869)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|intracellular protein transmembrane transport (GO:0065002)|positive regulation of glucose transport (GO:0010828)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of vesicle fusion (GO:0031340)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)										TACCCTCTGTTCCAACGCTGA	0.378																																					p.E344G		.											.	.	0			c.A1031G						.						149.0	131.0	137.0					12																	22666235		2203	4300	6503	SO:0001583	missense	9847	exon9			CTCTGTTCCAACG	AB011100	CCDS31758.1, CCDS66337.1, CCDS66338.1, CCDS66339.1, CCDS66340.1	12p12.1	2012-12-13	2012-12-13	2012-12-13	ENSG00000111731	ENSG00000111731			29062	protein-coding gene	gene with protein product	"""138 kDa C2 domain-containing phosphoprotein"""		"""KIAA0528"""	KIAA0528		21907143	Standard	XM_005253538		Approved	CDP138	uc001rfq.3	Q86YS7	OTTHUMG00000169100	ENST00000333957.4:c.1031A>G	12.37:g.22666235T>C	ENSP00000334229:p.Glu344Gly	163	0		187	31	NM_014802	0	0	0	0	0	B4DJ03|B4DRN7|B7ZLL0|F5H2A1|F5H5R1|O60280|Q17RY7|Q7Z619|Q86SU3	Missense_Mutation	SNP	ENST00000333957.4	37	CCDS31758.1	.	.	.	.	.	.	.	.	.	.	T	19.42	3.824771	0.71143	.	.	ENSG00000111731	ENST00000333957;ENST00000446597;ENST00000536386;ENST00000396028;ENST00000542676;ENST00000545552;ENST00000544930;ENST00000544281	T;T;T;T;T;T;T;T	0.55234	0.53;0.53;0.53;0.53;0.53;0.53;0.53;0.53	5.0	3.85	0.44370	.	0.062767	0.64402	N	0.000006	T	0.65144	0.2663	L	0.57536	1.79	0.49915	D	0.999836	D;D;D;D;D;D	0.89917	0.999;0.992;1.0;0.992;1.0;0.979	D;P;D;P;D;P	0.85130	0.973;0.784;0.996;0.864;0.997;0.628	T	0.64045	-0.6499	10	0.51188	T	0.08	-22.0629	9.2812	0.37729	0.0:0.0816:0.0:0.9184	.	335;344;137;335;335;344	F5H2A1;B4DRN7;F5H3N1;B7ZLL0;Q86YS7-2;Q86YS7	.;.;.;.;.;K0528_HUMAN	G	344;344;335;335;344;335;137;96	ENSP00000334229:E344G;ENSP00000388756:E344G;ENSP00000439392:E335G;ENSP00000379345:E335G;ENSP00000441951:E344G;ENSP00000443204:E335G;ENSP00000445288:E137G;ENSP00000443479:E96G	ENSP00000334229:E344G	E	-	2	0	KIAA0528	22557502	1.000000	0.71417	0.988000	0.46212	0.978000	0.69477	7.272000	0.78516	0.920000	0.36970	0.528000	0.53228	GAA	.		0.378	C2CD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402257.1	NM_014802	
CAPRIN2	65981	hgsc.bcm.edu;bcgsc.ca	37	12	30886574	30886574	+	Missense_Mutation	SNP	A	A	G			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr12:30886574A>G	ENST00000395805.2	-	5	1428	c.881T>C	c.(880-882)gTa>gCa	p.V294A	CAPRIN2_ENST00000251071.5_Missense_Mutation_p.V294A|CAPRIN2_ENST00000298892.5_Missense_Mutation_p.V294A|CAPRIN2_ENST00000308433.5_Intron|CAPRIN2_ENST00000417045.1_Missense_Mutation_p.V294A|CAPRIN2_ENST00000538387.1_Intron	NM_001206856.1	NP_001193785.1			caprin family member 2											breast(1)|central_nervous_system(1)|endometrium(8)|kidney(4)|large_intestine(13)|lung(16)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	48	all_lung(12;1.13e-09)|Lung NSC(12;7.98e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					TGTCGTTCCTACCACTGCTTT	0.398																																					p.V294A		.											.	CAPRIN2-92	0			c.T881C						.						164.0	143.0	150.0					12																	30886574		2203	4300	6503	SO:0001583	missense	65981	exon5			GTTCCTACCACTG	AY074491	CCDS8720.1, CCDS41766.1, CCDS41766.2, CCDS55816.1	12p11	2010-08-03	2007-03-27	2007-03-27	ENSG00000110888	ENSG00000110888			21259	protein-coding gene	gene with protein product		610375	"""C1q domain containing 1"""	C1QDC1		11347906, 14764709	Standard	NM_001002259		Approved	EEG1, FLJ22569, FLJ11391, caprin-2, RNG140	uc001rji.1	Q6IMN6	OTTHUMG00000169185	ENST00000395805.2:c.881T>C	12.37:g.30886574A>G	ENSP00000379150:p.Val294Ala	200	0		219	13	NM_023925	0	0	0	0	0		Missense_Mutation	SNP	ENST00000395805.2	37	CCDS55816.1	.	.	.	.	.	.	.	.	.	.	A	12.15	1.850529	0.32699	.	.	ENSG00000110888	ENST00000433722;ENST00000298892;ENST00000395805;ENST00000251071;ENST00000417045;ENST00000438006;ENST00000537108	T;T;T;T;T;T	0.21031	2.47;2.03;2.03;2.03;2.03;2.03	4.96	4.96	0.65561	.	0.276479	0.34460	N	0.003948	T	0.09730	0.0239	N	0.11201	0.11	0.80722	D	1	B;B;B;B;B	0.28783	0.142;0.222;0.029;0.049;0.013	B;B;B;B;B	0.28011	0.043;0.085;0.006;0.013;0.008	T	0.24977	-1.0145	10	0.15066	T	0.55	-12.678	7.5105	0.27571	0.8402:0.0:0.1598:0.0	.	294;294;294;294;294	Q149P6;Q6IMN6-3;Q6IMN6;Q6IMN6-2;E4NKG2	.;.;CAPR2_HUMAN;.;.	A	40;294;294;294;294;20;213	ENSP00000415407:V40A;ENSP00000298892:V294A;ENSP00000379150:V294A;ENSP00000251071:V294A;ENSP00000391479:V294A;ENSP00000438010:V213A	ENSP00000251071:V294A	V	-	2	0	CAPRIN2	30777841	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.311000	0.51919	2.069000	0.61940	0.533000	0.62120	GTA	.		0.398	CAPRIN2-004	PUTATIVE	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000403322.2	NM_023925	
KRT85	3891	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	52761009	52761009	+	Missense_Mutation	SNP	A	A	G			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr12:52761009A>G	ENST00000257901.3	-	1	256	c.181T>C	c.(181-183)Tcc>Ccc	p.S61P	KRT85_ENST00000544265.1_5'Flank	NM_002283.3	NP_002274.1	P78386	KRT85_HUMAN	keratin 85	61	Head.				epidermis development (GO:0008544)	extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(6)|kidney(1)|large_intestine(7)|liver(1)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	36	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)			BRCA - Breast invasive adenocarcinoma(357;0.189)		GGCCCGCAGGAGCCCAGGTTG	0.716																																					p.S61P		.											.	KRT85-91	0			c.T181C						.						18.0	23.0	21.0					12																	52761009		2197	4295	6492	SO:0001583	missense	3891	exon1			CGCAGGAGCCCAG	X99140	CCDS8824.1, CCDS73472.1	12q13.13	2013-06-20	2006-07-17	2006-07-17	ENSG00000135443	ENSG00000135443		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6462	protein-coding gene	gene with protein product	"""hard keratin type II"""	602767	"""keratin, hair, basic, 5"""	KRTHB5		9084137, 16831889	Standard	NM_002283		Approved	Hb-5	uc001sag.3	P78386	OTTHUMG00000169633	ENST00000257901.3:c.181T>C	12.37:g.52761009A>G	ENSP00000257901:p.Ser61Pro	79	0		58	11	NM_002283	0	0	0	0	0	Q9NSB1	Missense_Mutation	SNP	ENST00000257901.3	37	CCDS8824.1	.	.	.	.	.	.	.	.	.	.	A	5.873	0.345197	0.11126	.	.	ENSG00000135443	ENST00000257901	T	0.77877	-1.13	4.66	-2.96	0.05547	.	0.601870	0.15091	N	0.281064	T	0.51261	0.1664	N	0.12182	0.205	0.23563	N	0.997407	B	0.06786	0.001	B	0.10450	0.005	T	0.29488	-1.0010	10	0.40728	T	0.16	.	2.3992	0.04397	0.2911:0.4181:0.1687:0.1221	.	61	P78386	KRT85_HUMAN	P	61	ENSP00000257901:S61P	ENSP00000257901:S61P	S	-	1	0	KRT85	51047276	0.000000	0.05858	0.660000	0.29694	0.354000	0.29330	-0.238000	0.08977	-0.599000	0.05798	-0.366000	0.07423	TCC	.		0.716	KRT85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405184.1	NM_002283	
SYCP3	50511	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	102127436	102127436	+	Missense_Mutation	SNP	C	C	G			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr12:102127436C>G	ENST00000392927.3	-	6	501	c.370G>C	c.(370-372)Gaa>Caa	p.E124Q	SYCP3_ENST00000392924.1_Missense_Mutation_p.E124Q|SYCP3_ENST00000266743.2_Missense_Mutation_p.E124Q	NM_001177948.1|NM_001177949.1|NM_153694.4	NP_001171419.1|NP_001171420.1|NP_710161.1	Q8IZU3	SYCP3_HUMAN	synaptonemal complex protein 3	124	Gln-rich.				male meiosis I (GO:0007141)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)	chromosome (GO:0005694)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(2)|kidney(2)|large_intestine(1)|lung(5)|skin(1)	11						TGAGAATATTCTTGGTTAAGC	0.308																																					p.E124Q		.											.	SYCP3-90	0			c.G370C						.						110.0	102.0	105.0					12																	102127436		2203	4300	6503	SO:0001583	missense	50511	exon6			AATATTCTTGGTT	AF492003, AI075991	CCDS9087.1	12q23.2	2007-02-05			ENSG00000139351	ENSG00000139351			18130	protein-coding gene	gene with protein product		604759				12213195, 10854409	Standard	NM_153694		Approved		uc001tis.3	Q8IZU3	OTTHUMG00000150132	ENST00000392927.3:c.370G>C	12.37:g.102127436C>G	ENSP00000376658:p.Glu124Gln	73	0		89	12	NM_001177949	0	0	0	0	0		Missense_Mutation	SNP	ENST00000392927.3	37	CCDS9087.1	.	.	.	.	.	.	.	.	.	.	C	13.30	2.197243	0.38806	.	.	ENSG00000139351	ENST00000266743;ENST00000392927;ENST00000392924	.	.	.	5.95	5.01	0.66863	.	0.115967	0.64402	D	0.000019	T	0.72078	0.3416	M	0.67953	2.075	0.44247	D	0.997095	D	0.54397	0.966	P	0.56343	0.796	T	0.69698	-0.5075	9	0.34782	T	0.22	1.5322	15.6276	0.76874	0.1381:0.8619:0.0:0.0	.	124	Q8IZU3	SYCP3_HUMAN	Q	124	.	ENSP00000266743:E124Q	E	-	1	0	SYCP3	100651567	1.000000	0.71417	0.797000	0.32132	0.043000	0.13939	4.291000	0.59025	2.817000	0.96982	0.563000	0.77884	GAA	.		0.308	SYCP3-001	KNOWN	alternative_5_UTR|upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316478.2	NM_153694	
USPL1	10208	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	31233386	31233386	+	Missense_Mutation	SNP	A	A	C			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr13:31233386A>C	ENST00000255304.4	+	9	3514	c.3172A>C	c.(3172-3174)Aag>Cag	p.K1058Q		NM_005800.4	NP_005791.3	Q5W0Q7	USPL1_HUMAN	ubiquitin specific peptidase like 1	1058					Cajal body organization (GO:0030576)|cell proliferation (GO:0008283)|protein desumoylation (GO:0016926)	Cajal body (GO:0015030)|extracellular space (GO:0005615)	SUMO binding (GO:0032183)|SUMO-specific isopeptidase activity (GO:0070140)			breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(15)|pancreas(3)|skin(3)	34		Lung SC(185;0.0257)|Breast(139;0.203)		all cancers(112;0.0306)|Epithelial(112;0.131)|OV - Ovarian serous cystadenocarcinoma(117;0.134)		GAGTCCGATGAAGACTGATAT	0.373																																					p.K1058Q	Ovarian(60;318 1180 1554 28110 31601)	.											.	USPL1-524	0			c.A3172C						.						93.0	94.0	93.0					13																	31233386		2202	4300	6502	SO:0001583	missense	10208	exon9			CCGATGAAGACTG	X59131	CCDS9336.1	13q12-q14	2012-11-14	2005-11-24	2005-11-24	ENSG00000132952	ENSG00000132952			20294	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 22"""	C13orf22		22878415	Standard	NM_005800		Approved	bA121O19.1, D13S106E	uc001utc.2	Q5W0Q7	OTTHUMG00000016675	ENST00000255304.4:c.3172A>C	13.37:g.31233386A>C	ENSP00000255304:p.Lys1058Gln	92	0		110	20	NM_005800	0	0	15	25	10	Q14109|Q6AI45|Q8IY30|Q8IYE8	Missense_Mutation	SNP	ENST00000255304.4	37	CCDS9336.1	.	.	.	.	.	.	.	.	.	.	A	18.68	3.675070	0.67928	.	.	ENSG00000132952	ENST00000255304	T	0.26518	1.73	5.62	5.62	0.85841	.	0.083251	0.51477	D	0.000089	T	0.46870	0.1415	M	0.64997	1.995	0.25803	N	0.984481	D	0.67145	0.996	D	0.66497	0.944	T	0.43589	-0.9382	10	0.72032	D	0.01	-19.9681	14.3888	0.66963	1.0:0.0:0.0:0.0	.	1058	Q5W0Q7	USPL1_HUMAN	Q	1058	ENSP00000255304:K1058Q	ENSP00000255304:K1058Q	K	+	1	0	USPL1	30131386	0.983000	0.35010	0.930000	0.37139	0.675000	0.39556	4.229000	0.58625	2.143000	0.66587	0.455000	0.32223	AAG	.		0.373	USPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044369.1	NM_005800	
ITM2B	9445	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	48833064	48833064	+	Silent	SNP	A	A	G			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr13:48833064A>G	ENST00000378565.5	+	5	899	c.696A>G	c.(694-696)caA>caG	p.Q232Q	ITM2B_ENST00000378549.5_Silent_p.Q126Q	NM_021999.4	NP_068839.1	Q9Y287	ITM2B_HUMAN	integral membrane protein 2B	232					extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|nervous system development (GO:0007399)	endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi-associated vesicle membrane (GO:0030660)|integral component of organelle membrane (GO:0031301)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|beta-amyloid binding (GO:0001540)			endometrium(1)|large_intestine(2)|lung(3)	6		all_cancers(8;2.2e-31)|all_epithelial(8;6.77e-15)|all_lung(13;9.67e-07)|all_hematologic(8;9.72e-06)|Lung NSC(96;8.3e-05)|Breast(56;0.000141)|Acute lymphoblastic leukemia(8;0.00045)|Prostate(109;0.000669)|Myeloproliferative disorder(33;0.039)|Hepatocellular(98;0.0556)|Lung SC(185;0.102)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(144;1.97e-06)		ACAAACTGCAACGCAGAGAAA	0.338																																					p.Q232Q		.											.	ITM2B-90	0			c.A696G						.						85.0	78.0	81.0					13																	48833064		2203	4300	6503	SO:0001819	synonymous_variant	9445	exon5			ACTGCAACGCAGA	AF092128	CCDS9409.1	13q14.2	2012-10-10			ENSG00000136156	ENSG00000136156		"""BRICHOS domain containing"""	6174	protein-coding gene	gene with protein product	"""BRICHOS domain containing 2B"""	603904				9795190	Standard	NM_021999		Approved	BRI, E25B, E3-16, BRICD2B	uc001vbz.3	Q9Y287	OTTHUMG00000016894	ENST00000378565.5:c.696A>G	13.37:g.48833064A>G		54	0		83	13	NM_021999	4	3	3938	5724	1779	Q5W0A3|Q96B24|Q9NYH1	Silent	SNP	ENST00000378565.5	37	CCDS9409.1																																																																																			.		0.338	ITM2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044870.3	NM_021999	
RYR3	6263	ucsc.edu	37	15	34152846	34152846	+	Nonsense_Mutation	SNP	C	C	T			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr15:34152846C>T	ENST00000389232.4	+	101	14420	c.14350C>T	c.(14350-14352)Cga>Tga	p.R4784*	RP11-3D4.2_ENST00000560268.1_RNA|RYR3_ENST00000415757.3_Nonsense_Mutation_p.R4779*	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	4784					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GGAACAAGTACGAGAAGATAT	0.358																																					p.R4784X													.	RYR3-520	0			c.C14350T						.						96.0	88.0	91.0					15																	34152846		1847	4094	5941	SO:0001587	stop_gained	6263	exon101			CAAGTACGAGAAG		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.14350C>T	15.37:g.34152846C>T	ENSP00000373884:p.Arg4784*	25	0		17	4	NM_001036	0	0	0	0	0	O15175|Q15412	Nonsense_Mutation	SNP	ENST00000389232.4	37	CCDS45210.1	.	.	.	.	.	.	.	.	.	.	C	55	24.234413	0.99959	.	.	ENSG00000198838	ENST00000389232;ENST00000361728	.	.	.	5.2	-0.603	0.11630	.	0.061993	0.64402	D	0.000006	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	.	16.9174	0.86155	0.7997:0.2003:0.0:0.0	.	.	.	.	X	4784;4780	.	ENSP00000354735:R4780X	R	+	1	2	RYR3	31940138	0.972000	0.33761	0.215000	0.23724	0.886000	0.51366	2.413000	0.44618	0.085000	0.17107	-0.182000	0.12963	CGA	.		0.358	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1		
ZP2	7783	hgsc.bcm.edu	37	16	21213523	21213523	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr16:21213523T>C	ENST00000574002.1	-	12	1671	c.1189A>G	c.(1189-1191)Agg>Ggg	p.R397G	ZP2_ENST00000219593.4_Missense_Mutation_p.R397G|ZP2_ENST00000574091.1_Missense_Mutation_p.R397G|AF001550.7_ENST00000572747.1_RNA			Q05996	ZP2_HUMAN	zona pellucida glycoprotein 2 (sperm receptor)	397	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				binding of sperm to zona pellucida (GO:0007339)|intracellular protein transport (GO:0006886)|multicellular organism reproduction (GO:0032504)|prevention of polyspermy (GO:0060468)|signal transduction (GO:0007165)|single fertilization (GO:0007338)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|secretory granule (GO:0030141)	acrosin binding (GO:0032190)|coreceptor activity (GO:0015026)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(16)|ovary(1)|prostate(1)|stomach(1)	41				GBM - Glioblastoma multiforme(48;0.0573)		TTTCCCACCCTCAGAGTACCC	0.542																																					p.R397G		.											.	ZP2-91	0			c.A1189G						.						85.0	79.0	81.0					16																	21213523		2200	4300	6500	SO:0001583	missense	7783	exon11			CCACCCTCAGAGT	M90366	CCDS10596.1, CCDS73843.1	16p12	2014-07-04			ENSG00000103310	ENSG00000103310		"""Zona pellucida glycoproteins"""	13188	protein-coding gene	gene with protein product		182888				8385033	Standard	XM_005255562		Approved	ZPA	uc002dii.2	Q05996	OTTHUMG00000090681	ENST00000574002.1:c.1189A>G	16.37:g.21213523T>C	ENSP00000460971:p.Arg397Gly	44	0		60	3	NM_003460	0	0	0	0	0	B2R7J2|Q4VAN9|Q4VAP0|Q4VAP1	Missense_Mutation	SNP	ENST00000574002.1	37	CCDS10596.1	.	.	.	.	.	.	.	.	.	.	T	16.47	3.133085	0.56828	.	.	ENSG00000103310	ENST00000219593	D	0.82984	-1.67	6.08	3.62	0.41486	Endoglin/CD105 antigen subgroup (1);Zona pellucida sperm-binding protein (3);	0.366291	0.29028	N	0.013373	D	0.88858	0.6551	M	0.84846	2.72	0.09310	N	1	P;P	0.49696	0.927;0.927	P;P	0.54174	0.744;0.744	T	0.82629	-0.0363	10	0.59425	D	0.04	-2.6547	13.5127	0.61522	0.0:0.0:0.2565:0.7435	.	397;397	Q4VAP1;Q05996	.;ZP2_HUMAN	G	397	ENSP00000219593:R397G	ENSP00000219593:R397G	R	-	1	2	ZP2	21121024	0.048000	0.20356	0.203000	0.23512	0.821000	0.46438	0.850000	0.27737	1.073000	0.40885	0.533000	0.62120	AGG	.		0.542	ZP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207365.2		
EDC4	23644	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	67910484	67910484	+	Silent	SNP	G	G	A			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr16:67910484G>A	ENST00000358933.5	+	3	572	c.333G>A	c.(331-333)aaG>aaA	p.K111K	AC040162.1_ENST00000408599.1_RNA|EDC4_ENST00000574770.1_3'UTR	NM_014329.4	NP_055144.3	Q6P2E9	EDC4_HUMAN	enhancer of mRNA decapping 4	111					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(4)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	41		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)		TTTCAAGCAAGGCCCGGGGAA	0.537																																					p.K111K		.											.	EDC4-92	0			c.G333A						.						76.0	65.0	69.0					16																	67910484		2198	4300	6498	SO:0001819	synonymous_variant	23644	exon3			AAGCAAGGCCCGG	U17474	CCDS10849.1	16q22.1	2008-02-05			ENSG00000038358	ENSG00000038358			17157	protein-coding gene	gene with protein product		606030				9067524	Standard	NM_014329		Approved	RCD-8, Ge-1, HEDLS	uc002eur.3	Q6P2E9	OTTHUMG00000137543	ENST00000358933.5:c.333G>A	16.37:g.67910484G>A		71	0		78	15	NM_014329	0	0	0	0	0	A6NGM1|A8K4T4|Q13025|Q13826|Q6ZR12|Q7Z6H7	Silent	SNP	ENST00000358933.5	37	CCDS10849.1																																																																																			.		0.537	EDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268874.2	NM_014329	
C17orf97	400566	hgsc.bcm.edu	37	17	263688	263688	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr17:263688C>T	ENST00000360127.6	+	2	1070	c.1054C>T	c.(1054-1056)Ctc>Ttc	p.L352F	AC108004.3_ENST00000466740.2_RNA|C17orf97_ENST00000571106.1_Intron	NM_001013672.4	NP_001013694.4	Q6ZQX7	CQ097_HUMAN	chromosome 17 open reading frame 97	382	20 X 10 AA approximative tandem repeat of A-L-K-G-F-H-P-D-P-E.									breast(1)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(1)	14						CCCCGAGGCCCTCAAGGGCTT	0.682																																					p.L352F		.											.	C17orf97-91	0			c.C1054T						.						16.0	22.0	20.0					17																	263688		2145	4197	6342	SO:0001583	missense	400566	exon2			GAGGCCCTCAAGG	AK128660, BC057385	CCDS32519.2	17p13.3	2008-08-15			ENSG00000187624	ENSG00000187624			33800	protein-coding gene	gene with protein product						12477932	Standard	NM_001013672		Approved	LOC400566	uc021tna.1	Q6ZQX7	OTTHUMG00000132479	ENST00000360127.6:c.1054C>T	17.37:g.263688C>T	ENSP00000353245:p.Leu352Phe	125	2		127	12	NM_001013672	0	0	227	244	17	A5D8T6|Q6NSI2|Q6PFW9	Missense_Mutation	SNP	ENST00000360127.6	37	CCDS32519.2	.	.	.	.	.	.	.	.	.	.	C	10.21	1.286990	0.23478	.	.	ENSG00000187624	ENST00000360127	T	0.34275	1.37	2.05	-0.756	0.11057	.	.	.	.	.	T	0.30479	0.0766	N	0.19112	0.55	0.09310	N	1	D	0.65815	0.995	P	0.55011	0.766	T	0.15954	-1.0419	9	0.52906	T	0.07	.	4.6265	0.12481	0.0:0.412:0.4285:0.1594	.	352	Q6ZQX7-4	.	F	352	ENSP00000353245:L352F	ENSP00000353245:L352F	L	+	1	0	C17orf97	264034	0.001000	0.12720	0.000000	0.03702	0.015000	0.08874	0.141000	0.16076	-0.356000	0.08187	0.205000	0.17691	CTC	.		0.682	C17orf97-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255648.4	NM_001013672	
ALKBH5	54890	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	18111630	18111630	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr17:18111630C>T	ENST00000399138.4	+	4	1110	c.1105C>T	c.(1105-1107)Cgc>Tgc	p.R369C	ALKBH5_ENST00000541285.1_Missense_Mutation_p.R28C	NM_017758.3	NP_060228.3	Q6P6C2	ALKB5_HUMAN	AlkB family member 5, RNA demethylase	369					cell differentiation (GO:0030154)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|oxidative single-stranded RNA demethylation (GO:0035553)|response to hypoxia (GO:0001666)|spermatogenesis (GO:0007283)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|oxidative RNA demethylase activity (GO:0035515)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|liver(2)|lung(2)|ovary(1)|skin(1)	10	all_neural(463;0.228)					GAACTACTGGCGCAAGTCATA	0.637																																					p.R369C	Ovarian(166;154 1953 40235 46283 46309)												.	ALKBH5-90	0			c.C1105T						.						52.0	59.0	57.0					17																	18111630		1995	4150	6145	SO:0001583	missense	54890	exon4			TACTGGCGCAAGT	AK000315	CCDS42272.1	17p11.2	2014-07-23	2014-07-23	2006-02-09	ENSG00000091542	ENSG00000091542	1.14.11.-	"""Alkylation repair homologs"""	25996	protein-coding gene	gene with protein product		613303	"""oxoglutarate and iron-dependent oxygenase domain containing"", ""alkB, alkylation repair homolog 5 (E. coli)"""	OFOXD1		11997338, 24778178	Standard	NM_017758		Approved	FLJ20308	uc010cpw.3	Q6P6C2	OTTHUMG00000059397	ENST00000399138.4:c.1105C>T	17.37:g.18111630C>T	ENSP00000382091:p.Arg369Cys	144	1		160	15	NM_017758	0	0	17	18	1	B4DVJ4|D3DXC6|Q9NXD6	Missense_Mutation	SNP	ENST00000399138.4	37	CCDS42272.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.487415	0.84854	.	.	ENSG00000091542	ENST00000261650;ENST00000500385;ENST00000399138	.	.	.	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.72350	0.3449	L	0.29908	0.895	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.74103	-0.3773	9	0.87932	D	0	-9.4349	20.2963	0.98556	0.0:1.0:0.0:0.0	.	369	Q6P6C2-2	.	C	369;358;369	.	ENSP00000261650:R369C	R	+	1	0	ALKBH5	18052355	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.540000	0.60664	2.813000	0.96785	0.655000	0.94253	CGC	.		0.637	ALKBH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132069.3	NM_017758	
ADAP2	55803	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	29261209	29261209	+	Missense_Mutation	SNP	G	G	A			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr17:29261209G>A	ENST00000330889.3	+	5	739	c.404G>A	c.(403-405)cGa>cAa	p.R135Q	ADAP2_ENST00000580525.1_Missense_Mutation_p.R141Q	NM_018404.2	NP_060874.1	Q9NPF8	ADAP2_HUMAN	ArfGAP with dual PH domains 2	135	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				heart development (GO:0007507)|regulation of ARF GTPase activity (GO:0032312)	cytoplasm (GO:0005737)|mitochondrial envelope (GO:0005740)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein binding, bridging (GO:0030674)|zinc ion binding (GO:0008270)	p.?(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	13						TAAGGTAACCGAGAAGGATTC	0.483																																					p.R135Q													.	ADAP2-91	1	Unknown(1)	central_nervous_system(1)	c.G404A						.						96.0	80.0	85.0					17																	29261209		2203	4300	6503	SO:0001583	missense	55803	exon5			GTAACCGAGAAGG	AJ238994	CCDS11261.1	17q11.2	2013-01-10	2008-09-22	2008-09-22	ENSG00000184060	ENSG00000184060		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	16487	protein-coding gene	gene with protein product		608635	"""centaurin, alpha 2"""	CENTA2			Standard	XM_005258008		Approved		uc002hfx.3	Q9NPF8	OTTHUMG00000132868	ENST00000330889.3:c.404G>A	17.37:g.29261209G>A	ENSP00000329468:p.Arg135Gln	53	0		73	16	NM_018404	0	0	0	0	0	Q8N4Q6|Q96SD5	Missense_Mutation	SNP	ENST00000330889.3	37	CCDS11261.1	.	.	.	.	.	.	.	.	.	.	G	12.58	1.981099	0.34942	.	.	ENSG00000184060	ENST00000330889	T	0.23754	1.89	5.72	5.72	0.89469	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.309320	0.36778	N	0.002418	T	0.55049	0.1896	M	0.86953	2.85	0.40187	D	0.977363	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.71414	0.973;0.93;0.972	T	0.57464	-0.7807	10	0.36615	T	0.2	.	15.3693	0.74551	0.0:0.0:1.0:0.0	.	141;135;135	Q2V6Q1;Q9NPF8-2;Q9NPF8	.;.;ADAP2_HUMAN	Q	135	ENSP00000329468:R135Q	ENSP00000329468:R135Q	R	+	2	0	ADAP2	26285335	0.988000	0.35896	0.995000	0.50966	0.291000	0.27294	4.038000	0.57318	2.705000	0.92388	0.655000	0.94253	CGA	.		0.483	ADAP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000256346.1	NM_018404	
BRCA1	672	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	41244817	41244817	+	Missense_Mutation	SNP	C	C	T	rs80357712|rs397509003|rs80357605|rs80357917		TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr17:41244817C>T	ENST00000357654.3	-	10	2849	c.2731G>A	c.(2731-2733)Gga>Aga	p.G911R	BRCA1_ENST00000351666.3_Intron|BRCA1_ENST00000471181.2_Missense_Mutation_p.G911R|BRCA1_ENST00000591849.1_Intron|BRCA1_ENST00000586385.1_Intron|BRCA1_ENST00000493795.1_Missense_Mutation_p.G864R|BRCA1_ENST00000309486.4_Missense_Mutation_p.G615R|BRCA1_ENST00000354071.3_Missense_Mutation_p.G911R|BRCA1_ENST00000352993.3_Intron|BRCA1_ENST00000491747.2_Intron|BRCA1_ENST00000468300.1_Intron|BRCA1_ENST00000591534.1_Intron|BRCA1_ENST00000346315.3_Missense_Mutation_p.G911R	NM_007294.3	NP_009225.1	P38398	BRCA1_HUMAN	breast cancer 1, early onset	911					androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to indole-3-methanol (GO:0071681)|cellular response to tumor necrosis factor (GO:0071356)|chromosome segregation (GO:0007059)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|fatty acid biosynthetic process (GO:0006633)|G2 DNA damage checkpoint (GO:0031572)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of centriole replication (GO:0046600)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of DNA repair (GO:0045739)|positive regulation of gene expression (GO:0010628)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of histone H4-K16 acetylation (GO:2000620)|positive regulation of histone H4-K20 methylation (GO:0070512)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|postreplication repair (GO:0006301)|protein autoubiquitination (GO:0051865)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to estrogen (GO:0043627)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|gamma-tubulin ring complex (GO:0008274)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(30)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(28)|ovary(36)|skin(2)|stomach(4)|urinary_tract(2)	120		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		TCATTCTTTCCTTGATTTTCT	0.398			"""D, Mis, N, F, S"""		ovarian	"""breast, ovarian"""		Homologous recombination	Hereditary Breast-Ovarian Cancer, BRCA1 type	TCGA Ovarian(2;0.000030)																											p.G911R		.	yes	Rec	yes	Hereditary breast/ovarian cancer	17	17q21	672	familial breast/ovarian cancer gene 1		E	.	BRCA1-3415	0			c.G2731A						.						132.0	130.0	131.0					17																	41244817		2203	4300	6503	SO:0001583	missense	672	exon10	Familial Cancer Database		TCTTTCCTTGATT	U14680	CCDS11453.1, CCDS11454.1, CCDS11455.1, CCDS11456.1, CCDS11459.1, CCDS11455.2, CCDS11456.2, CCDS11459.2, CCDS11454.2	17q21.31	2014-09-17			ENSG00000012048	ENSG00000012048		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1100	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 1"", ""protein phosphatase 1, regulatory subunit 53"""	113705				1676470	Standard	NM_007300		Approved	RNF53, BRCC1, PPP1R53	uc002ict.3	P38398	OTTHUMG00000157426	ENST00000357654.3:c.2731G>A	17.37:g.41244817C>T	ENSP00000350283:p.Gly911Arg	145	0		146	24	NM_007300	0	0	0	0	0	O15129|Q1RMC1|Q3LRJ0|Q3LRJ6|Q6IN79|Q7KYU9	Missense_Mutation	SNP	ENST00000357654.3	37	CCDS11453.1	.	.	.	.	.	.	.	.	.	.	C	12.57	1.977264	0.34848	.	.	ENSG00000012048	ENST00000357654;ENST00000412061;ENST00000354071;ENST00000346315;ENST00000309486;ENST00000471181;ENST00000493795	T;T;T;T;T;T	0.80566	-1.39;-1.39;-1.39;-1.39;-1.39;-1.39	4.85	2.8	0.32819	.	0.776431	0.11349	N	0.573162	D	0.84188	0.5417	M	0.65320	2	0.09310	N	1	B;B;B;B;D;B	0.59357	0.024;0.065;0.132;0.12;0.985;0.036	B;B;B;B;P;B	0.57371	0.046;0.046;0.261;0.22;0.819;0.043	T	0.71461	-0.4586	10	0.56958	D	0.05	.	8.2084	0.31469	0.0:0.7274:0.0:0.2726	.	911;870;911;911;911;911	E7EMP0;E7ERL4;Q5YLB2;E9PFC7;P38398;P38398-2	.;.;.;.;BRCA1_HUMAN;.	R	911;911;911;911;615;911;864	ENSP00000350283:G911R;ENSP00000326002:G911R;ENSP00000246907:G911R;ENSP00000310938:G615R;ENSP00000418960:G911R;ENSP00000418775:G864R	ENSP00000310938:G615R	G	-	1	0	BRCA1	38498343	0.001000	0.12720	0.001000	0.08648	0.134000	0.20937	0.961000	0.29267	0.582000	0.29556	0.484000	0.47621	GGA	.		0.398	BRCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348798.2	NM_007294	
NPEPPS	9520	hgsc.bcm.edu;broad.mit.edu	37	17	45668145	45668145	+	Silent	SNP	A	A	G			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr17:45668145A>G	ENST00000322157.4	+	10	1395	c.1158A>G	c.(1156-1158)gtA>gtG	p.V386V	NPEPPS_ENST00000530173.1_Silent_p.V382V|NPEPPS_ENST00000544660.1_Silent_p.V306V|NPEPPS_ENST00000525037.1_3'UTR	NM_006310.3	NP_006301.3	P55786	PSA_HUMAN	aminopeptidase puromycin sensitive	386					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular response to hypoxia (GO:0071456)|protein polyubiquitination (GO:0000209)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(6)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	27						ATCTGTGTGTAGACCACTGCT	0.393																																					p.V386V		.											.	NPEPPS-90	0			c.A1158G						.						62.0	55.0	57.0					17																	45668145		1791	4055	5846	SO:0001819	synonymous_variant	9520	exon10			GTGTGTAGACCAC	Y07701	CCDS45721.1	17q12-q21	2008-07-18			ENSG00000141279	ENSG00000141279	3.4.11.2		7900	protein-coding gene	gene with protein product	"""puromycin-sensitive aminopeptidase"", ""metalloproteinase MP100"""	606793				9048733, 10329370	Standard	NM_006310		Approved	PSA, MP100	uc002ilr.4	P55786	OTTHUMG00000165471	ENST00000322157.4:c.1158A>G	17.37:g.45668145A>G		266	0		329	33	NM_006310	0	0	65	71	6	B7Z463|Q6P145|Q9NP16|Q9UEM2	Silent	SNP	ENST00000322157.4	37	CCDS45721.1																																																																																			.		0.393	NPEPPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384269.1	NM_006310	
MSI2	124540	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	55754379	55754379	+	Missense_Mutation	SNP	G	G	A			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr17:55754379G>A	ENST00000284073.2	+	13	1186	c.977G>A	c.(976-978)gGa>gAa	p.G326E	MSI2_ENST00000416426.2_Missense_Mutation_p.G322E|MSI2_ENST00000442934.2_Missense_Mutation_p.G265E	NM_138962.2	NP_620412.1	Q96DH6	MSI2H_HUMAN	musashi RNA-binding protein 2	326						cytoplasm (GO:0005737)|polysome (GO:0005844)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(1)|pancreas(1)|skin(1)	7	Breast(9;1.78e-08)			GBM - Glioblastoma multiforme(1;0.0025)		TTTACAAATGGATACCATTGA	0.458			T	HOXA9	CML																																p.G326E		.		Dom	yes		17	17q23.2	124540	musashi homolog 2 (Drosophila)		L	.	MSI2-658	0			c.G977A						.						234.0	195.0	208.0					17																	55754379		2203	4300	6503	SO:0001583	missense	124540	exon13			CAAATGGATACCA	BC001526	CCDS11596.1, CCDS11597.1	17q23.2	2013-07-16	2012-12-13					"""RNA binding motif (RRM) containing"""	18585	protein-coding gene	gene with protein product		607897	"""musashi homolog 2 (Drosophila)"""			11588182	Standard	NM_138962		Approved		uc002iuz.1	Q96DH6		ENST00000284073.2:c.977G>A	17.37:g.55754379G>A	ENSP00000284073:p.Gly326Glu	173	0		252	80	NM_138962	0	0	0	0	0	Q7Z6M7|Q8N9T4	Missense_Mutation	SNP	ENST00000284073.2	37	CCDS11596.1	.	.	.	.	.	.	.	.	.	.	G	26.5	4.739690	0.89573	.	.	ENSG00000153944	ENST00000416426;ENST00000284073;ENST00000442934	D;T;T	0.89050	-2.46;0.62;1.01	4.87	4.87	0.63330	.	0.052819	0.85682	D	0.000000	D	0.93605	0.7958	M	0.64997	1.995	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.996;1.0	D	0.94391	0.7614	10	0.87932	D	0	.	18.0345	0.89296	0.0:0.0:1.0:0.0	.	322;326	B4DHE8;Q96DH6	.;MSI2H_HUMAN	E	322;326;265	ENSP00000414671:G322E;ENSP00000284073:G326E;ENSP00000392607:G265E	ENSP00000284073:G326E	G	+	2	0	MSI2	53109378	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.430000	0.97488	2.260000	0.74910	0.462000	0.41574	GGA	.		0.458	MSI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441813.1		
NACA2	342538	ucsc.edu	37	17	59668146	59668146	+	Silent	SNP	A	A	G			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr17:59668146A>G	ENST00000521764.1	-	1	417	c.396T>C	c.(394-396)tcT>tcC	p.S132S		NM_199290.3	NP_954984.1	Q9H009	NACA2_HUMAN	nascent polypeptide-associated complex alpha subunit 2	132	NAC-A/B. {ECO:0000255|PROSITE- ProRule:PRU00507}.				myoblast migration (GO:0051451)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	12	all_epithelial(1;3.12e-14)					GTGCTTGCTGAGATAAATCTT	0.443																																					p.S132S													.	NACA2-91	0			c.T396C						.						164.0	162.0	163.0					17																	59668146		2203	4300	6503	SO:0001819	synonymous_variant	342538	exon1			TTGCTGAGATAAA	BC062710	CCDS11630.1	17q23.3	2014-01-28	2007-04-20	2007-04-20		ENSG00000253506			23290	protein-coding gene	gene with protein product	"""alpha-NAC protein"""	609274	"""nascent-polypeptide-associated complex alpha polypeptide-like"""	NACAL		12406326	Standard	NM_199290		Approved	MGC71999	uc002izj.2	Q9H009		ENST00000521764.1:c.396T>C	17.37:g.59668146A>G		264	0		297	2	NM_199290	0	0	0	0	0	Q2VIR9	Silent	SNP	ENST00000521764.1	37	CCDS11630.1																																																																																			.		0.443	NACA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255437.2	NM_199290	
EXOC7	23265	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	74081426	74081426	+	Missense_Mutation	SNP	T	T	A			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr17:74081426T>A	ENST00000335146.7	-	16	1887	c.1834A>T	c.(1834-1836)Att>Ttt	p.I612F	EXOC7_ENST00000332065.5_Missense_Mutation_p.I530F|EXOC7_ENST00000411744.2_Missense_Mutation_p.I553F|EXOC7_ENST00000591724.1_5'Flank|EXOC7_ENST00000467929.2_Missense_Mutation_p.I533F|EXOC7_ENST00000405575.4_Missense_Mutation_p.I584F|EXOC7_ENST00000607838.1_Missense_Mutation_p.I584F|EXOC7_ENST00000589210.1_Missense_Mutation_p.I561F			Q9UPT5	EXOC7_HUMAN	exocyst complex component 7	612					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|protein transport (GO:0015031)	centriolar satellite (GO:0034451)|exocyst (GO:0000145)|growth cone membrane (GO:0032584)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)				NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|skin(1)	14			LUSC - Lung squamous cell carcinoma(166;0.187)			TGCTGCTCAATGTGCTCCCGG	0.632																																					p.I612F		.											.	EXOC7-90	0			c.A1834T						.						57.0	47.0	50.0					17																	74081426		2202	4300	6502	SO:0001583	missense	23265	exon16			GCTCAATGTGCTC	BC029432	CCDS11741.1, CCDS32738.1, CCDS45781.1, CCDS45782.1, CCDS45784.1, CCDS74164.1	17q25.3	2013-01-22			ENSG00000182473	ENSG00000182473			23214	protein-coding gene	gene with protein product		608163				12477932	Standard	NM_001013839		Approved	EXO70, KIAA1067, YJL085W, Exo70p	uc010wsw.2	Q9UPT5	OTTHUMG00000150720	ENST00000335146.7:c.1834A>T	17.37:g.74081426T>A	ENSP00000334100:p.Ile612Phe	30	0		40	14	NM_001145297	0	0	42	101	59	B5MC69|B8XXP2|Q8ND93|Q8WV91|Q96FF0|Q9H8C3|Q9H9X3|Q9HA32	Missense_Mutation	SNP	ENST00000335146.7	37	CCDS45782.1	.	.	.	.	.	.	.	.	.	.	t	27.2	4.809754	0.90707	.	.	ENSG00000182473	ENST00000332065;ENST00000351709;ENST00000405575;ENST00000335146;ENST00000357231;ENST00000425372;ENST00000411744	.	.	.	4.43	4.43	0.53597	Cullin repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.76097	0.3940	M	0.78637	2.42	0.80722	D	1	B;B;P;P;D;B;P	0.58268	0.143;0.014;0.851;0.874;0.982;0.029;0.925	B;B;P;P;D;B;P	0.66497	0.109;0.109;0.635;0.731;0.944;0.043;0.803	T	0.75204	-0.3400	9	0.27082	T	0.32	-17.3693	13.7322	0.62794	0.0:0.0:0.0:1.0	.	553;584;533;498;612;530;561	Q9UPT5-5;Q9UPT5-6;B4DJ07;F5H1P1;Q9UPT5;Q9UPT5-2;Q9UPT5-1	.;.;.;.;EXOC7_HUMAN;.;.	F	530;450;584;612;561;498;553	.	ENSP00000333806:I530F	I	-	1	0	EXOC7	71593021	1.000000	0.71417	0.998000	0.56505	0.947000	0.59692	8.037000	0.88933	1.656000	0.50722	0.392000	0.25879	ATT	.		0.632	EXOC7-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000319768.2	NM_015219	
APCDD1	147495	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	10487626	10487626	+	Missense_Mutation	SNP	C	C	G			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr18:10487626C>G	ENST00000355285.5	+	5	1490	c.1136C>G	c.(1135-1137)gCc>gGc	p.A379G	APCDD1_ENST00000578882.1_Missense_Mutation_p.S175R	NM_153000.4	NP_694545.1			adenomatosis polyposis coli down-regulated 1											NS(1)|breast(1)|endometrium(3)|large_intestine(5)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22				READ - Rectum adenocarcinoma(15;0.08)		GCGGCCACAGCCTCACTGCTC	0.597																																					p.A379G		.											.	APCDD1-90	0			c.C1136G						.						75.0	69.0	71.0					18																	10487626		2203	4300	6503	SO:0001583	missense	147495	exon5			CCACAGCCTCACT	AB056722	CCDS11849.1	18p11.21	2006-07-07			ENSG00000154856	ENSG00000154856			15718	protein-coding gene	gene with protein product		607479				12384519	Standard	NM_153000		Approved	B7323	uc002kom.4	Q8J025	OTTHUMG00000131635	ENST00000355285.5:c.1136C>G	18.37:g.10487626C>G	ENSP00000347433:p.Ala379Gly	135	0		95	15	NM_153000	0	0	0	0	0		Missense_Mutation	SNP	ENST00000355285.5	37	CCDS11849.1	.	.	.	.	.	.	.	.	.	.	C	13.22	2.172736	0.38413	.	.	ENSG00000154856	ENST00000355285;ENST00000423585	T	0.18502	2.21	5.06	5.06	0.68205	.	0.162880	0.56097	D	0.000037	T	0.29288	0.0729	M	0.63843	1.955	0.29806	N	0.832069	P	0.46952	0.887	P	0.47044	0.535	T	0.12656	-1.0539	10	0.87932	D	0	-34.4277	18.7893	0.91966	0.0:1.0:0.0:0.0	.	379	Q8J025	APCD1_HUMAN	G	379;430	ENSP00000347433:A379G	ENSP00000347433:A379G	A	+	2	0	APCDD1	10477626	1.000000	0.71417	0.981000	0.43875	0.968000	0.65278	5.655000	0.67981	2.496000	0.84212	0.561000	0.74099	GCC	.		0.597	APCDD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254529.2	NM_153000	
VAV1	7409	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	6833546	6833546	+	Missense_Mutation	SNP	T	T	G			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr19:6833546T>G	ENST00000602142.1	+	17	1700	c.1618T>G	c.(1618-1620)Ttc>Gtc	p.F540V	VAV1_ENST00000304076.2_Missense_Mutation_p.F540V|VAV1_ENST00000596764.1_Missense_Mutation_p.F508V|VAV1_ENST00000539284.1_Missense_Mutation_p.F443V|VAV1_ENST00000599806.1_Missense_Mutation_p.F485V	NM_005428.3	NP_005419.2	P15498	VAV_HUMAN	vav 1 guanine nucleotide exchange factor	540					apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|reactive oxygen species metabolic process (GO:0072593)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription, DNA-templated (GO:0006355)|small GTPase mediated signal transduction (GO:0007264)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(16)|lung(18)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	62						CAGAGGTACCTTCTATCAGGG	0.542																																					p.F540V		.											.	VAV1-1276	0			c.T1618G						.						94.0	96.0	95.0					19																	6833546		2203	4300	6503	SO:0001583	missense	7409	exon17			GGTACCTTCTATC		CCDS12174.1, CCDS59341.1, CCDS59342.1	19p13.2	2013-02-14	2007-07-25			ENSG00000141968		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12657	protein-coding gene	gene with protein product		164875	"""vav 1 oncogene"""	VAV		9438848	Standard	NM_005428		Approved		uc010xjh.2	P15498		ENST00000602142.1:c.1618T>G	19.37:g.6833546T>G	ENSP00000472929:p.Phe540Val	167	0		203	25	NM_005428	0	0	0	0	0	B4DVK9|M0QXX6|Q15860	Missense_Mutation	SNP	ENST00000602142.1	37	CCDS12174.1	.	.	.	.	.	.	.	.	.	.	T	17.11	3.306485	0.60305	.	.	ENSG00000141968	ENST00000304076;ENST00000539284	D;D	0.92647	-3.08;-3.08	4.73	4.73	0.59995	Protein kinase C-like, phorbol ester/diacylglycerol binding (4);	0.055969	0.64402	D	0.000001	D	0.92954	0.7758	L	0.32530	0.975	0.58432	D	0.999999	D;D;D;D	0.89917	0.995;0.998;1.0;0.999	D;D;D;D	0.87578	0.94;0.982;0.998;0.996	D	0.93330	0.6700	10	0.62326	D	0.03	.	12.1658	0.54129	0.0:0.0:0.0:1.0	.	443;540;485;540	F5H5P4;B2R8B5;Q96D37;P15498	.;.;.;VAV_HUMAN	V	540;443	ENSP00000302269:F540V;ENSP00000443242:F443V	ENSP00000302269:F540V	F	+	1	0	VAV1	6784546	1.000000	0.71417	0.998000	0.56505	0.416000	0.31233	5.489000	0.66875	1.784000	0.52394	0.402000	0.26972	TTC	.		0.542	VAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458475.1		
RBM42	79171	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	36128157	36128157	+	Silent	SNP	G	G	A			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr19:36128157G>A	ENST00000262633.4	+	9	1338	c.1233G>A	c.(1231-1233)aaG>aaA	p.K411K	RBM42_ENST00000589871.1_Silent_p.K389K|RBM42_ENST00000592202.1_Silent_p.K357K|RBM42_ENST00000589559.1_Intron|RBM42_ENST00000360475.4_Silent_p.K382K|RBM42_ENST00000586618.1_Silent_p.K115K|RBM42_ENST00000588161.1_Silent_p.K381K	NM_024321.3	NP_077297.2	Q9BTD8	RBM42_HUMAN	RNA binding motif protein 42	411	Necessary for interaction with HNRNPK. {ECO:0000250}.|RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|large_intestine(7)|lung(9)|prostate(1)	21	all_lung(56;1.58e-07)|Lung NSC(56;2.43e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			TTAAGGCCAAGGTGATCCGTG	0.577																																					p.K411K		.											.	RBM42-90	0			c.G1233A						.						108.0	81.0	90.0					19																	36128157		2203	4300	6503	SO:0001819	synonymous_variant	79171	exon9			GGCCAAGGTGATC	BC004204	CCDS12468.1	19q13.12	2013-02-12				ENSG00000126254		"""RNA binding motif (RRM) containing"""	28117	protein-coding gene	gene with protein product		613232				12477932	Standard	NM_024321		Approved	MGC10433	uc002oan.3	Q9BTD8		ENST00000262633.4:c.1233G>A	19.37:g.36128157G>A		79	1		88	14	NM_024321	0	0	103	213	110	O00320|Q8N5R7|Q9BU66	Silent	SNP	ENST00000262633.4	37	CCDS12468.1																																																																																			.		0.577	RBM42-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459057.2	NM_024321	
HNRNPUL1	11100	bcgsc.ca	37	19	41807610	41807610	+	Splice_Site	SNP	G	G	C			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr19:41807610G>C	ENST00000392006.3	+	11	1860		c.e11+1		HNRNPUL1_ENST00000593587.1_Splice_Site|HNRNPUL1_ENST00000263367.3_Splice_Site|HNRNPUL1_ENST00000378215.4_Splice_Site|HNRNPUL1_ENST00000602130.1_Splice_Site|HNRNPUL1_ENST00000595018.1_Splice_Site|HNRNPUL1_ENST00000352456.3_Splice_Site	NM_007040.3	NP_008971.2	Q9BUJ2	HNRL1_HUMAN	heterogeneous nuclear ribonucleoprotein U-like 1						gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(8)|prostate(1)|skin(1)|urinary_tract(1)	29						GAAATGAAAGGTAGGAAATGA	0.483																																					.													.	HNRNPUL1-69	0			c.1387+1G>C						.						85.0	71.0	76.0					19																	41807610		2203	4300	6503	SO:0001630	splice_region_variant	11100	exon11			TGAAAGGTAGGAA	AJ007509	CCDS12576.1, CCDS12577.1	19q13.2	2013-06-12		2008-04-18	ENSG00000105323	ENSG00000105323			17011	protein-coding gene	gene with protein product	"""E1B 55kDa associated protein 5"""	605800		HNRPUL1		9733834, 12489984	Standard	XM_005258459		Approved	E1B-AP5, E1BAP5, FLJ12944	uc002oqb.4	Q9BUJ2	OTTHUMG00000182740	ENST00000392006.3:c.1687+1G>C	19.37:g.41807610G>C		62	0		61	8	NM_144732	0	0	2	2	0	B3KMW7|O76022|Q6ZSZ0|Q7L8P4|Q8N6Z4|Q96G37|Q9HAL3|Q9UG75	Splice_Site	SNP	ENST00000392006.3	37	CCDS12576.1	.	.	.	.	.	.	.	.	.	.	G	29.0	4.968359	0.92855	.	.	ENSG00000105323	ENST00000352456;ENST00000392006;ENST00000378215;ENST00000263367	.	.	.	5.44	5.44	0.79542	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.1835	0.89786	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	HNRNPUL1	46499450	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.596000	0.98267	2.833000	0.97629	0.650000	0.86243	.	.		0.483	HNRNPUL1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463406.1	NM_144732, NM_007040	Intron
IRGC	56269	hgsc.bcm.edu	37	19	44223048	44223048	+	Missense_Mutation	SNP	C	C	G			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr19:44223048C>G	ENST00000244314.5	+	2	537	c.338C>G	c.(337-339)cCa>cGa	p.P113R		NM_019612.3	NP_062558.1	Q6NXR0	IIGP5_HUMAN	immunity-related GTPase family, cinema	113	IRG-type G.					membrane (GO:0016020)	GTP binding (GO:0005525)|hydrolase activity, acting on acid anhydrides (GO:0016817)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|skin(2)	25		Prostate(69;0.0435)				TGGGACCTGCCAGGAGCCGGC	0.652																																					p.P113R	Colon(189;350 2037 11447 13433 38914)	.											.	IRGC-70	0			c.C338G						.						22.0	21.0	21.0					19																	44223048		2194	4288	6482	SO:0001583	missense	56269	exon2			ACCTGCCAGGAGC	BC066939	CCDS12629.1	19q13.32	2008-02-05	2005-10-31	2005-10-31	ENSG00000124449	ENSG00000124449			28835	protein-coding gene	gene with protein product			"""immunity-related GTPase family, cinema 1"""	IRGC1		12477932	Standard	NM_019612		Approved	Iigp5, CINEMA	uc002oxh.3	Q6NXR0	OTTHUMG00000154587	ENST00000244314.5:c.338C>G	19.37:g.44223048C>G	ENSP00000244314:p.Pro113Arg	50	2		38	2	NM_019612	0	0	0	0	0	Q05BR8	Missense_Mutation	SNP	ENST00000244314.5	37	CCDS12629.1	.	.	.	.	.	.	.	.	.	.	C	19.22	3.785694	0.70337	.	.	ENSG00000124449	ENST00000244314	T	0.56275	0.47	5.71	4.68	0.58851	.	0.067487	0.64402	D	0.000013	T	0.75347	0.3837	M	0.88704	2.975	0.54753	D	0.999988	D	0.89917	1.0	D	0.91635	0.999	T	0.80185	-0.1487	10	0.87932	D	0	.	12.2899	0.54812	0.0:0.9182:0.0:0.0818	.	113	Q6NXR0	IIGP5_HUMAN	R	113	ENSP00000244314:P113R	ENSP00000244314:P113R	P	+	2	0	IRGC	48914888	1.000000	0.71417	0.878000	0.34440	0.920000	0.55202	6.892000	0.75644	1.421000	0.47157	0.555000	0.69702	CCA	.		0.652	IRGC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336191.1	NM_019612	
ERCC1	2067	hgsc.bcm.edu	37	19	45926544	45926544	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr19:45926544T>C	ENST00000300853.3	-	2	680	c.89A>G	c.(88-90)gAg>gGg	p.E30G	ERCC1_ENST00000340192.7_Missense_Mutation_p.E30G|ERCC1_ENST00000013807.5_Missense_Mutation_p.E30G|ERCC1_ENST00000423698.2_Missense_Mutation_p.E30G|ERCC1_ENST00000589165.1_Missense_Mutation_p.E30G|ERCC1_ENST00000591636.1_Missense_Mutation_p.E30G	NM_001983.3	NP_001974.1	P07992	ERCC1_HUMAN	excision repair cross-complementation group 1	30					cell proliferation (GO:0008283)|chromosome organization (GO:0051276)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|interstrand cross-link repair (GO:0036297)|isotype switching (GO:0045190)|male gonad development (GO:0008584)|mitotic recombination (GO:0006312)|multicellular organism growth (GO:0035264)|multicellular organismal aging (GO:0010259)|negative regulation of telomere maintenance (GO:0032205)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision, 3'-to lesion (GO:0006295)|nucleotide-excision repair, DNA incision, 5'-to lesion (GO:0006296)|oogenesis (GO:0048477)|post-embryonic hemopoiesis (GO:0035166)|pyrimidine dimer repair by nucleotide-excision repair (GO:0000720)|replicative cell aging (GO:0001302)|response to nutrient (GO:0007584)|response to oxidative stress (GO:0006979)|response to sucrose (GO:0009744)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)|syncytium formation (GO:0006949)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)	cytoplasm (GO:0005737)|nuclear chromosome, telomeric region (GO:0000784)|nucleoplasm (GO:0005654)|nucleotide-excision repair complex (GO:0000109)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	damaged DNA binding (GO:0003684)|endonuclease activity (GO:0004519)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|single-stranded DNA binding (GO:0003697)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(2)|ovary(2)|skin(1)	15		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0247)		AGGAGGGACCTCATCCTCGTC	0.627								Nucleotide excision repair (NER)																													p.E30G		.											.	ERCC1-659	0			c.A89G						.						64.0	57.0	60.0					19																	45926544		2203	4300	6503	SO:0001583	missense	2067	exon2			GGGACCTCATCCT		CCDS12662.1, CCDS12663.1, CCDS54279.1	19q13.32	2014-03-07	2014-03-07			ENSG00000012061			3433	protein-coding gene	gene with protein product		126380	"""excision repair cross-complementing rodent repair deficiency, complementation group 1 (includes overlapping antisense sequence)"""			6462228	Standard	NM_001983		Approved	RAD10	uc002pbs.2	P07992		ENST00000300853.3:c.89A>G	19.37:g.45926544T>C	ENSP00000300853:p.Glu30Gly	37	0		41	3	NM_001983	0	0	18	18	0	B2RC01|B3KRR0|Q7Z7F5|Q96S40	Missense_Mutation	SNP	ENST00000300853.3	37	CCDS12662.1	.	.	.	.	.	.	.	.	.	.	T	7.316	0.615930	0.14129	.	.	ENSG00000012061	ENST00000300853;ENST00000340192;ENST00000423698;ENST00000013807;ENST00000428893	T;T;T;T	0.50277	0.79;0.77;0.8;0.75	4.82	0.105	0.14535	.	0.649699	0.14042	N	0.345379	T	0.28566	0.0707	N	0.24115	0.695	0.09310	N	1	B;B;B;B	0.27823	0.164;0.041;0.099;0.19	B;B;B;B	0.24155	0.04;0.023;0.037;0.051	T	0.12604	-1.0541	10	0.39692	T	0.17	-19.7324	7.1713	0.25721	0.1454:0.0:0.4523:0.4023	.	30;30;30;30	Q7Z7F5;B3KRR0;Q96S40;P07992	.;.;.;ERCC1_HUMAN	G	30	ENSP00000300853:E30G;ENSP00000345203:E30G;ENSP00000394875:E30G;ENSP00000013807:E30G	ENSP00000013807:E30G	E	-	2	0	ERCC1	50618384	0.005000	0.15991	0.003000	0.11579	0.311000	0.27955	-0.194000	0.09559	-0.182000	0.10602	-0.680000	0.03767	GAG	.		0.627	ERCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459542.1	NM_001983	
PPP2R1A	5518	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	52724382	52724382	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr19:52724382T>C	ENST00000322088.6	+	12	1572	c.1514T>C	c.(1513-1515)aTc>aCc	p.I505T	CTD-2525I3.3_ENST00000593857.1_RNA|PPP2R1A_ENST00000444322.2_Missense_Mutation_p.I450T|PPP2R1A_ENST00000462990.1_Missense_Mutation_p.I326T	NM_014225.5	NP_055040.2	P30153	2AAA_HUMAN	protein phosphatase 2, regulatory subunit A, alpha	505	PP2A subunit C binding.				apoptotic process (GO:0006915)|ceramide metabolic process (GO:0006672)|chromosome segregation (GO:0007059)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|inactivation of MAPK activity (GO:0000188)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope reassembly (GO:0007084)|mRNA metabolic process (GO:0016071)|negative regulation of cell growth (GO:0030308)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine dephosphorylation (GO:0070262)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|protein complex assembly (GO:0006461)|protein dephosphorylation (GO:0006470)|regulation of cell adhesion (GO:0030155)|regulation of cell differentiation (GO:0045595)|regulation of DNA replication (GO:0006275)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|response to organic substance (GO:0010033)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|second-messenger-mediated signaling (GO:0019932)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	antigen binding (GO:0003823)|protein heterodimerization activity (GO:0046982)|protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine phosphatase activity (GO:0004722)			NS(1)|breast(4)|cervix(2)|endometrium(62)|kidney(1)|large_intestine(7)|lung(21)|ovary(32)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	135				GBM - Glioblastoma multiforme(134;0.00456)|OV - Ovarian serous cystadenocarcinoma(262;0.015)		CTCTTCTGCATCAATGTGAGC	0.597			Mis		clear cell ovarian carcinoma																																p.I505T		.		Dom?	yes		19	19q13.41	5518	"""protein phosphatase 2, regulatory subunit A, alpha"""		E	.	PPP2R1A-1666	0			c.T1514C						.						150.0	125.0	133.0					19																	52724382		2203	4300	6503	SO:0001583	missense	5518	exon12			TCTGCATCAATGT		CCDS12849.1	19q13	2010-06-18	2010-04-14		ENSG00000105568	ENSG00000105568	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9302	protein-coding gene	gene with protein product	"""protein phosphatase 2A, regulatory subunit A, alpha isoform"", ""protein phosphatase 2, 65kDa regulatory subunit A"""	605983	"""protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), alpha isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit A, alpha isoform"""				Standard	NR_033500		Approved	PR65A, PP2A-Aalpha	uc002pyp.3	P30153	OTTHUMG00000137367	ENST00000322088.6:c.1514T>C	19.37:g.52724382T>C	ENSP00000324804:p.Ile505Thr	211	2		180	43	NM_014225	0	0	0	0	0	Q13773|Q6ICQ3|Q96DH3	Missense_Mutation	SNP	ENST00000322088.6	37	CCDS12849.1	.	.	.	.	.	.	.	.	.	.	T	20.7	4.028431	0.75390	.	.	ENSG00000105568	ENST00000423369;ENST00000391791;ENST00000322088;ENST00000436460;ENST00000444322	T;T	0.37235	1.21;2.1	4.67	4.67	0.58626	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.64402	D	0.000014	T	0.66954	0.2842	M	0.92555	3.32	0.80722	D	1	D;P	0.57899	0.981;0.93	D;P	0.78314	0.991;0.88	T	0.75314	-0.3361	10	0.87932	D	0	-30.8602	12.4016	0.55416	0.0:0.0:0.0:1.0	.	450;505	F5H3X9;P30153	.;2AAA_HUMAN	T	495;425;505;72;450	ENSP00000324804:I505T;ENSP00000415067:I450T	ENSP00000324804:I505T	I	+	2	0	PPP2R1A	57416194	1.000000	0.71417	1.000000	0.80357	0.864000	0.49448	7.226000	0.78060	2.091000	0.63221	0.533000	0.62120	ATC	.		0.597	PPP2R1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000267967.2	NM_014225	
ZNF132	7691	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	58945194	58945194	+	Silent	SNP	T	T	A			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr19:58945194T>A	ENST00000254166.3	-	3	2017	c.1617A>T	c.(1615-1617)ggA>ggT	p.G539G	CTD-2619J13.17_ENST00000594816.1_lincRNA	NM_003433.3	NP_003424.3	P52740	ZN132_HUMAN	zinc finger protein 132	539					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(1)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	19		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0171)|Lung(386;0.182)		AAGGCTTTTCTCCAGTGTGAA	0.478																																					p.G539G		.											.	ZNF132-92	0			c.A1617T						.						81.0	83.0	82.0					19																	58945194		2203	4300	6503	SO:0001819	synonymous_variant	7691	exon3			CTTTTCTCCAGTG	U09411	CCDS12980.1	19q13.4	2013-01-08	2006-06-13			ENSG00000131849		"""Zinc fingers, C2H2-type"", ""-"""	12916	protein-coding gene	gene with protein product		604074	"""zinc finger protein 132 (clone pHZ-12)"""			7557990	Standard	NM_003433		Approved	pHZ-12	uc002qst.4	P52740		ENST00000254166.3:c.1617A>T	19.37:g.58945194T>A		107	0		112	22	NM_003433	0	0	0	0	0	Q32MI9	Silent	SNP	ENST00000254166.3	37	CCDS12980.1																																																																																			.		0.478	ZNF132-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467035.1	NM_003433	
ABCA12	26154	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	215865500	215865500	+	Missense_Mutation	SNP	T	T	G			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr2:215865500T>G	ENST00000272895.7	-	22	3327	c.3108A>C	c.(3106-3108)caA>caC	p.Q1036H	ABCA12_ENST00000389661.4_Missense_Mutation_p.Q718H	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	1036					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		TCCTTCCAGTTTGCAATTCAA	0.428																																					p.Q1036H	Ovarian(66;664 1488 5121 34295)	.											.	ABCA12-99	0			c.A3108C						.						125.0	130.0	128.0					2																	215865500		2203	4300	6503	SO:0001583	missense	26154	exon22			TCCAGTTTGCAAT	AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.3108A>C	2.37:g.215865500T>G	ENSP00000272895:p.Gln1036His	166	0		183	41	NM_173076	0	0	0	0	0	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	ENST00000272895.7	37	CCDS33372.1	.	.	.	.	.	.	.	.	.	.	T	14.43	2.533445	0.45073	.	.	ENSG00000144452	ENST00000272895;ENST00000389661	D;D	0.95656	-3.77;-3.77	5.73	2.68	0.31781	.	0.087482	0.49916	D	0.000121	D	0.92456	0.7605	L	0.43152	1.355	0.80722	D	1	B;B	0.32467	0.136;0.372	B;B	0.38156	0.152;0.266	D	0.89343	0.3655	10	0.66056	D	0.02	.	8.1984	0.31411	0.0:0.731:0.0:0.269	.	1036;718	Q86UK0;Q86UK0-2	ABCAC_HUMAN;.	H	1036;718	ENSP00000272895:Q1036H;ENSP00000374312:Q718H	ENSP00000272895:Q1036H	Q	-	3	2	ABCA12	215573745	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.506000	0.45433	0.612000	0.30071	0.454000	0.30748	CAA	.		0.428	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076	
CATIP	375307	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	219222364	219222364	+	Nonsense_Mutation	SNP	C	C	T			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr2:219222364C>T	ENST00000289388.3	+	3	255	c.226C>T	c.(226-228)Cag>Tag	p.Q76*	AC021016.8_ENST00000411433.1_RNA	NM_198559.1	NP_940961.1	Q7Z7H3	CATIP_HUMAN		76					actin filament polymerization (GO:0030041)|cilium organization (GO:0044782)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(4)|kidney(2)|large_intestine(4)|lung(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	16		Renal(207;0.0915)		Epithelial(149;8.08e-07)|all cancers(144;0.000146)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AGGGAAATACCAGGAAAAACT	0.552																																					p.Q76X		.											.	C2orf62-68	0			c.C226T						.						72.0	63.0	66.0					2																	219222364		2203	4300	6503	SO:0001587	stop_gained	375307	exon3			AAATACCAGGAAA																												ENST00000289388.3:c.226C>T	2.37:g.219222364C>T	ENSP00000289388:p.Gln76*	103	0		93	16	NM_198559	0	0	8	8	0		Nonsense_Mutation	SNP	ENST00000289388.3	37	CCDS2414.1	.	.	.	.	.	.	.	.	.	.	C	12.60	1.987633	0.35036	.	.	ENSG00000158428	ENST00000289388	.	.	.	4.56	-4.72	0.03269	.	1.478090	0.03845	N	0.271323	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-27.2458	4.8866	0.13706	0.2205:0.5606:0.0905:0.1283	.	.	.	.	X	76	.	ENSP00000289388:Q76X	Q	+	1	0	C2orf62	218930608	0.000000	0.05858	0.000000	0.03702	0.051000	0.14879	0.212000	0.17497	-0.542000	0.06249	-0.457000	0.05445	CAG	.		0.552	C2orf62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256771.1		
ZNF142	7701	hgsc.bcm.edu;bcgsc.ca	37	2	219509115	219509115	+	Silent	SNP	A	A	T			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr2:219509115A>T	ENST00000449707.1	-	8	2545	c.2124T>A	c.(2122-2124)acT>acA	p.T708T	ZNF142_ENST00000411696.2_Silent_p.T708T	NM_001105537.1	NP_001099007.1	P52746	ZN142_HUMAN	zinc finger protein 142	708					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(7)|endometrium(7)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38		Renal(207;0.0474)		Epithelial(149;5.21e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)		GGGGTGGCTCAGTCACAGACT	0.612																																					p.T708T	Colon(170;867 1942 8995 15834 18053)	.											.	ZNF142-137	0			c.T2124A						.						42.0	44.0	43.0					2																	219509115		1959	4152	6111	SO:0001819	synonymous_variant	7701	exon8			TGGCTCAGTCACA	U09849	CCDS42817.1	2q35	2013-01-08	2006-06-13		ENSG00000115568	ENSG00000115568		"""Zinc fingers, C2H2-type"""	12927	protein-coding gene	gene with protein product		604083	"""zinc finger protein 142 (clone pHZ-49)"""				Standard	NM_001105537		Approved	KIAA0236, pHZ-49	uc002vin.4	P52746	OTTHUMG00000154736	ENST00000449707.1:c.2124T>A	2.37:g.219509115A>T		91	0		65	12	NM_001105537	0	0	1	1	0	Q92510	Silent	SNP	ENST00000449707.1	37	CCDS42817.1																																																																																			.		0.612	ZNF142-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336833.1	NM_005081	
SEC23B	10483	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	18496315	18496315	+	Missense_Mutation	SNP	A	A	T			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr20:18496315A>T	ENST00000336714.3	+	4	733	c.301A>T	c.(301-303)Ata>Tta	p.I101L	SEC23B_ENST00000262544.2_Missense_Mutation_p.I101L|SEC23B_ENST00000377465.1_Missense_Mutation_p.I101L|SEC23B_ENST00000377475.3_Missense_Mutation_p.I101L|SEC23B_ENST00000494645.1_3'UTR	NM_006363.4|NM_032985.4|NM_032986.3	NP_006354.2|NP_116780.1|NP_116781.1	Q15437	SC23B_HUMAN	Sec23 homolog B (S. cerevisiae)	101					ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	32						TTATGGAGGCATATCTGAGGT	0.348																																					p.I101L		.											.	SEC23B-91	0			c.A301T						.						155.0	118.0	130.0					20																	18496315		2203	4300	6503	SO:0001583	missense	10483	exon4			GGAGGCATATCTG	X97065	CCDS13137.1	20p11.23	2010-02-09	2001-11-28		ENSG00000101310	ENSG00000101310			10702	protein-coding gene	gene with protein product		610512	"""Sec23 (S. cerevisiae) homolog B"", ""congenital dyserythropoietic anemia, type II"""	CDAN2		8898360, 10329445, 19621418	Standard	NM_032985		Approved	CDA-II, CDAII, HEMPAS	uc002wrb.2	Q15437	OTTHUMG00000031976	ENST00000336714.3:c.301A>T	20.37:g.18496315A>T	ENSP00000338844:p.Ile101Leu	103	0		102	14	NM_032985	0	0	2	4	2	D3DW33|Q503A9|Q5W183|Q9BS15|Q9BSI2|Q9H1D7	Missense_Mutation	SNP	ENST00000336714.3	37	CCDS13137.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.215314	0.79352	.	.	ENSG00000101310	ENST00000450074;ENST00000336714;ENST00000262544;ENST00000377475;ENST00000377465	D;D;D;D;D	0.82619	-1.63;-1.63;-1.63;-1.63;-1.63	5.04	5.04	0.67666	Zinc finger, Sec23/Sec24-type (1);	0.000000	0.85682	D	0.000000	D	0.86347	0.5911	M	0.81112	2.525	0.80722	D	1	P;P	0.41041	0.736;0.643	P;B	0.45577	0.486;0.271	D	0.87381	0.2357	10	0.49607	T	0.09	-22.3484	14.4009	0.67044	1.0:0.0:0.0:0.0	.	101;101	B4DJW8;Q15437	.;SC23B_HUMAN	L	101	ENSP00000403971:I101L;ENSP00000338844:I101L;ENSP00000262544:I101L;ENSP00000366695:I101L;ENSP00000366685:I101L	ENSP00000262544:I101L	I	+	1	0	SEC23B	18444315	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	8.929000	0.92859	2.241000	0.73720	0.528000	0.53228	ATA	.		0.348	SEC23B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078184.5		
RPL3	6122	ucsc.edu	37	22	39711372	39711372	+	Splice_Site	SNP	A	A	C			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr22:39711372A>C	ENST00000216146.4	-	5	862		c.e5+1		SNORD83A_ENST00000386747.1_RNA|RPL3_ENST00000465618.1_Splice_Site|RPL3_ENST00000401609.1_Splice_Site|SNORD83B_ENST00000386745.1_RNA	NM_000967.3|NM_001033853.1	NP_000958.1|NP_001029025.1	P39023	RL3_HUMAN	ribosomal protein L3						cellular protein metabolic process (GO:0044267)|cellular response to interleukin-4 (GO:0071353)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			breast(1)|kidney(4)|large_intestine(2)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	12	Melanoma(58;0.04)				Homoharringtonine(DB04865)	CGCAAAGCTCACCTTTGTAGC	0.572																																					.													.	RPL3-154	0			c.541+2T>G						.						115.0	104.0	108.0					22																	39711372		2203	4300	6503	SO:0001630	splice_region_variant	6122	exon6			AAGCTCACCTTTG	AB007166	CCDS13988.1	22q13	2011-04-06			ENSG00000100316	ENSG00000100316		"""L ribosomal proteins"""	10332	protein-coding gene	gene with protein product		604163				2891103, 9582194	Standard	NM_000967		Approved	L3	uc003axi.3	P39023	OTTHUMG00000151079	ENST00000216146.4:c.688+1T>G	22.37:g.39711372A>C		171	0		138	1	NM_001033853	0	0	0	0	0	B2RDV9|Q15548|Q5I0G0	Splice_Site	SNP	ENST00000216146.4	37	CCDS13988.1	.	.	.	.	.	.	.	.	.	.	A	22.1	4.240605	0.79912	.	.	ENSG00000100316	ENST00000401609;ENST00000216146;ENST00000402527;ENST00000453303	.	.	.	5.39	5.39	0.77823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.4065	0.74884	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	RPL3	38041318	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	7.163000	0.77524	2.051000	0.60960	0.379000	0.24179	.	.		0.572	RPL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321196.1	NM_000967	Intron
SLC25A38	54977	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	39431018	39431018	+	Silent	SNP	C	C	T			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr3:39431018C>T	ENST00000273158.4	+	2	479	c.102C>T	c.(100-102)ggC>ggT	p.G34G		NM_017875.2	NP_060345.2			solute carrier family 25, member 38									p.G34G(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(6)|skin(1)|stomach(1)	11				KIRC - Kidney renal clear cell carcinoma(284;0.0525)|Kidney(284;0.0661)		TCCTGTGTGGCTCCATCAGTG	0.522																																					p.G34G		.											.	SLC25A38-90	1	Substitution - coding silent(1)	large_intestine(1)	c.C102T						.						209.0	174.0	186.0					3																	39431018		2203	4300	6503	SO:0001819	synonymous_variant	54977	exon2			GTGTGGCTCCATC	BC013194	CCDS2685.1	3p22.1	2013-05-22			ENSG00000144659	ENSG00000144659		"""Solute carriers"""	26054	protein-coding gene	gene with protein product		610819				16949250	Standard	NM_017875		Approved	FLJ20551	uc003cjo.2	Q96DW6	OTTHUMG00000131289	ENST00000273158.4:c.102C>T	3.37:g.39431018C>T		126	0		116	27	NM_017875	0	0	9	12	3		Silent	SNP	ENST00000273158.4	37	CCDS2685.1																																																																																			.		0.522	SLC25A38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254057.3	NM_017875	
TNFSF10	8743	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	172232704	172232704	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr3:172232704T>C	ENST00000241261.2	-	2	339	c.217A>G	c.(217-219)Atg>Gtg	p.M73V	TNFSF10_ENST00000420541.2_Missense_Mutation_p.M73V	NM_003810.3	NP_003801.1	P50591	TNF10_HUMAN	tumor necrosis factor (ligand) superfamily, member 10	73					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell-cell signaling (GO:0007267)|immune response (GO:0006955)|male gonad development (GO:0008584)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|response to insulin (GO:0032868)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	metal ion binding (GO:0046872)|receptor binding (GO:0005102)			breast(2)|cervix(1)|large_intestine(1)|lung(6)|ovary(1)|skin(4)	15	Ovarian(172;0.00197)|Breast(254;0.158)		Lung(28;1.67e-15)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)|STAD - Stomach adenocarcinoma(35;0.235)			GGGCTGTTCATACTCTCTTCG	0.502																																					p.M73V		.											.	TNFSF10-662	0			c.A217G						.						144.0	137.0	140.0					3																	172232704		2203	4300	6503	SO:0001583	missense	8743	exon2			TGTTCATACTCTC	U37518	CCDS3219.1, CCDS54680.1	3q26	2006-09-20			ENSG00000121858	ENSG00000121858		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"""	11925	protein-coding gene	gene with protein product		603598				8777713, 8663110	Standard	NM_003810		Approved	TRAIL, Apo-2L, TL2, CD253	uc003fid.3	P50591	OTTHUMG00000156917	ENST00000241261.2:c.217A>G	3.37:g.172232704T>C	ENSP00000241261:p.Met73Val	130	0		176	41	NM_003810	0	0	141	225	84	A1Y9B3	Missense_Mutation	SNP	ENST00000241261.2	37	CCDS3219.1	.	.	.	.	.	.	.	.	.	.	T	0.003	-2.547137	0.00140	.	.	ENSG00000121858	ENST00000241261;ENST00000420541	D;T	0.86366	-2.11;1.59	5.61	-1.89	0.07689	.	0.989409	0.08265	N	0.972345	T	0.71804	0.3383	L	0.34521	1.04	0.09310	N	1	B;B	0.12630	0.006;0.001	B;B	0.11329	0.006;0.001	T	0.57136	-0.7863	10	0.05351	T	0.99	-3.1928	0.8408	0.01149	0.3634:0.1464:0.1187:0.3715	.	73;73	A1Y9B3;P50591	.;TNF10_HUMAN	V	73	ENSP00000241261:M73V;ENSP00000389931:M73V	ENSP00000241261:M73V	M	-	1	0	TNFSF10	173715398	0.001000	0.12720	0.000000	0.03702	0.003000	0.03518	0.552000	0.23376	-0.567000	0.06046	-0.256000	0.11100	ATG	.		0.502	TNFSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346601.1		
ACOX3	8310	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	4	8372681	8372681	+	Missense_Mutation	SNP	G	G	A			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr4:8372681G>A	ENST00000356406.5	-	17	2014	c.1937C>T	c.(1936-1938)cCt>cTt	p.P646L	ACOX3_ENST00000413009.2_Silent_p.S623S|ACOX3_ENST00000503233.1_Missense_Mutation_p.P646L|ACOX3_ENST00000515797.1_5'UTR	NM_003501.2	NP_003492.2	O15254	ACOX3_HUMAN	acyl-CoA oxidase 3, pristanoyl	646					cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)	membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|pristanoyl-CoA oxidase activity (GO:0016402)|receptor binding (GO:0005102)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(9)|lung(17)|prostate(1)|skin(3)|stomach(1)	42						AAAGTCAGGAGGAGCGATCAC	0.562																																					p.P646L		.											.	ACOX3-90	0			c.C1937T						.						120.0	104.0	109.0					4																	8372681		2203	4300	6503	SO:0001583	missense	8310	exon17			TCAGGAGGAGCGA	Y11411	CCDS3401.1, CCDS47017.1	4p15.3	2010-04-30	2010-04-30		ENSG00000087008	ENSG00000087008	1.3.3.6		121	protein-coding gene	gene with protein product		603402	"""acyl-Coenzyme A oxidase 3, pristanoyl"""			9271077	Standard	NM_003501		Approved		uc003glc.4	O15254	OTTHUMG00000090509	ENST00000356406.5:c.1937C>T	4.37:g.8372681G>A	ENSP00000348775:p.Pro646Leu	68	0		59	12	NM_003501	0	0	4	16	12	Q96AJ8	Missense_Mutation	SNP	ENST00000356406.5	37	CCDS3401.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.577015	0.86645	.	.	ENSG00000087008	ENST00000356406;ENST00000503233	T;T	0.38401	1.14;1.14	4.88	4.88	0.63580	Acyl-CoA oxidase, C-terminal (1);Acyl-CoA dehydrogenase/oxidase C-terminal (1);	0.069225	0.64402	N	0.000015	T	0.50718	0.1632	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.38628	-0.9652	9	0.11182	T	0.66	-18.1485	15.4924	0.75619	0.0:0.0:1.0:0.0	.	646	O15254	ACOX3_HUMAN	L	646	ENSP00000348775:P646L;ENSP00000421625:P646L	ENSP00000348775:P646L	P	-	2	0	ACOX3	8423581	1.000000	0.71417	0.995000	0.50966	0.992000	0.81027	6.945000	0.75947	2.226000	0.72624	0.549000	0.68633	CCT	.		0.562	ACOX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206997.4		
BOD1L1	259282	broad.mit.edu	37	4	13616069	13616069	+	Missense_Mutation	SNP	G	G	T			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr4:13616069G>T	ENST00000040738.5	-	4	1060	c.925C>A	c.(925-927)Cag>Aag	p.Q309K		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	309						nucleus (GO:0005634)	DNA binding (GO:0003677)										CTGCTTTCCTGTTGAACATCC	0.353																																					p.Q309K													.	.	0			c.C925A						.						72.0	65.0	68.0					4																	13616069		2203	4300	6503	SO:0001583	missense	259282	exon4			TTTCCTGTTGAAC	AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.925C>A	4.37:g.13616069G>T	ENSP00000040738:p.Gln309Lys	30	0		34	7	NM_148894	0	0	0	1	1	Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Missense_Mutation	SNP	ENST00000040738.5	37	CCDS3411.2	.	.	.	.	.	.	.	.	.	.	G	17.96	3.515408	0.64634	.	.	ENSG00000038219	ENST00000040738	T	0.08720	3.06	5.75	5.75	0.90469	.	0.169210	0.28515	N	0.015067	T	0.16385	0.0394	M	0.64997	1.995	0.29521	N	0.853525	D	0.56521	0.976	P	0.50109	0.631	T	0.03761	-1.1006	10	0.32370	T	0.25	-5.5179	14.3952	0.67005	0.0:0.0:0.852:0.148	.	309	Q8NFC6	BOD1L_HUMAN	K	309	ENSP00000040738:Q309K	ENSP00000040738:Q309K	Q	-	1	0	BOD1L	13225167	0.980000	0.34600	0.997000	0.53966	0.941000	0.58515	3.862000	0.56009	2.709000	0.92574	0.591000	0.81541	CAG	.		0.353	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207321.1	NM_148894	
CENPC	1060	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	68385012	68385012	+	Missense_Mutation	SNP	C	C	G			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr4:68385012C>G	ENST00000273853.6	-	6	790	c.540G>C	c.(538-540)aaG>aaC	p.K180N		NM_001812.2	NP_001803.2	Q03188	CENPC_HUMAN	centromere protein C	180					chromosome segregation (GO:0007059)|kinetochore assembly (GO:0051382)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	condensed nuclear chromosome, centromeric region (GO:0000780)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	centromeric DNA binding (GO:0019237)|DNA binding (GO:0003677)										AAGTCTCTCTCTTTTGGGCAC	0.323																																					p.K180N		.											.	CENPC1-205	0			c.G540C						.						88.0	83.0	84.0					4																	68385012		1809	4078	5887	SO:0001583	missense	1060	exon6			CTCTCTCTTTTGG	M95724	CCDS47063.1	4q13.2	2013-11-05	2013-07-03	2013-07-03	ENSG00000145241	ENSG00000145241			1854	protein-coding gene	gene with protein product		117141	"""centromere protein C 1"""	CENPC1		7959789	Standard	XR_245245		Approved	CENP-C, hcp-4, MIF2	uc003hdd.1	Q03188	OTTHUMG00000160735	ENST00000273853.6:c.540G>C	4.37:g.68385012C>G	ENSP00000273853:p.Lys180Asn	106	0		138	36	NM_001812	0	0	0	0	0	Q8IW27|Q9P0M5	Missense_Mutation	SNP	ENST00000273853.6	37	CCDS47063.1	.	.	.	.	.	.	.	.	.	.	C	10.84	1.463886	0.26335	.	.	ENSG00000145241	ENST00000273853	.	.	.	4.75	0.447	0.16608	.	0.626565	0.15039	N	0.283991	T	0.39226	0.1070	L	0.59436	1.845	0.28032	N	0.9341	D;D	0.65815	0.995;0.995	P;P	0.53954	0.738;0.738	T	0.30592	-0.9973	9	0.72032	D	0.01	-2.2885	2.5395	0.04722	0.3496:0.401:0.1533:0.0961	.	180;180	Q8IW27;Q03188	.;CENPC_HUMAN	N	180	.	ENSP00000273853:K180N	K	-	3	2	CENPC1	68067607	0.030000	0.19436	0.952000	0.39060	0.104000	0.19210	-0.627000	0.05521	0.173000	0.19788	-0.293000	0.09583	AAG	.		0.323	CENPC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362001.2		
RNF150	57484	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	141832440	141832440	+	Missense_Mutation	SNP	G	G	C			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr4:141832440G>C	ENST00000515673.2	-	6	1089	c.1056C>G	c.(1054-1056)aaC>aaG	p.N352K	RNF150_ENST00000306799.3_Missense_Mutation_p.N310K|RNF150_ENST00000420921.2_Missense_Mutation_p.N211K|RNF150_ENST00000379512.2_Missense_Mutation_p.N211K|RNF150_ENST00000507500.1_Missense_Mutation_p.N352K			Q9ULK6	RN150_HUMAN	ring finger protein 150	352						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			breast(1)|large_intestine(10)|lung(7)|ovary(1)	19	all_hematologic(180;0.162)					CTGTGATCTGGTTGGTGGGTG	0.557																																					p.N352K		.											.	RNF150-227	0			c.C1056G						.						100.0	93.0	95.0					4																	141832440		2203	4300	6503	SO:0001583	missense	57484	exon6			GATCTGGTTGGTG	AB033040	CCDS34065.1	4q31.1	2013-01-09			ENSG00000170153	ENSG00000170153		"""RING-type (C3HC4) zinc fingers"""	23138	protein-coding gene	gene with protein product						10574462	Standard	XM_005263150		Approved	KIAA1214	uc003iio.1	Q9ULK6	OTTHUMG00000161380	ENST00000515673.2:c.1056C>G	4.37:g.141832440G>C	ENSP00000425840:p.Asn352Lys	105	0		111	14	NM_020724	0	0	0	0	0	Q3T1D0|Q6ZNW6	Missense_Mutation	SNP	ENST00000515673.2	37	CCDS34065.1	.	.	.	.	.	.	.	.	.	.	G	17.78	3.474491	0.63737	.	.	ENSG00000170153	ENST00000379512;ENST00000420921;ENST00000306799;ENST00000515673;ENST00000507500;ENST00000506101	T;T;T;T;T;T	0.15139	2.45;2.45;2.49;3.47;3.48;2.51	5.74	0.749	0.18381	.	0.472179	0.23614	N	0.046304	T	0.16257	0.0391	L	0.29908	0.895	0.51767	D	0.999932	P;B;B	0.40970	0.734;0.294;0.415	P;B;B	0.47528	0.549;0.299;0.334	T	0.03103	-1.1072	10	0.46703	T	0.11	.	9.3149	0.37928	0.5802:0.0:0.4198:0.0	.	310;352;352	Q9ULK6-2;Q9ULK6-3;Q9ULK6	.;.;RN150_HUMAN	K	211;211;310;352;352;183	ENSP00000368827:N211K;ENSP00000394581:N211K;ENSP00000304321:N310K;ENSP00000425840:N352K;ENSP00000425568:N352K;ENSP00000425947:N183K	ENSP00000304321:N310K	N	-	3	2	RNF150	142051890	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	0.973000	0.29422	0.180000	0.19960	0.655000	0.94253	AAC	.		0.557	RNF150-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364739.2	XM_291090	
DNAH5	1767	broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	13928214	13928214	+	Missense_Mutation	SNP	T	T	A			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr5:13928214T>A	ENST00000265104.4	-	3	370	c.266A>T	c.(265-267)gAa>gTa	p.E89V		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	89	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					TGTTTCTGCTTCCTCCACATC	0.378									Kartagener syndrome																												p.E89V													.	DNAH5-182	0			c.A266T						.						114.0	112.0	113.0					5																	13928214		2203	4300	6503	SO:0001583	missense	1767	exon3	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	TCTGCTTCCTCCA	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.266A>T	5.37:g.13928214T>A	ENSP00000265104:p.Glu89Val	84	0		102	18	NM_001369	0	0	0	0	0	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	37	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	T	11.28	1.592955	0.28357	.	.	ENSG00000039139	ENST00000265104	T	0.24723	1.84	5.32	1.09	0.20402	.	0.308380	0.34652	N	0.003789	T	0.04861	0.0131	N	0.00413	-1.525	0.25592	N	0.986686	B	0.02656	0.0	B	0.01281	0.0	T	0.29274	-1.0017	10	0.28530	T	0.3	.	1.1003	0.01682	0.3742:0.3113:0.1656:0.1488	.	89	Q8TE73	DYH5_HUMAN	V	89	ENSP00000265104:E89V	ENSP00000265104:E89V	E	-	2	0	DNAH5	13981214	0.142000	0.22610	0.967000	0.41034	0.969000	0.65631	1.040000	0.30278	0.391000	0.25143	-0.302000	0.09304	GAA	.		0.378	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
PCDHGA8	9708	broad.mit.edu	37	5	140772927	140772927	+	Nonsense_Mutation	SNP	C	C	T			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr5:140772927C>T	ENST00000398604.2	+	1	547	c.547C>T	c.(547-549)Cag>Tag	p.Q183*	PCDHGB3_ENST00000576222.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGB4_ENST00000519479.1_Intron	NM_032088.1	NP_114477.1	Q9Y5G5	PCDG8_HUMAN	protocadherin gamma subfamily A, 8	183	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(6)|kidney(6)|large_intestine(6)|lung(30)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	51			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCTGGACGTGCAGACTGGAGA	0.612																																					p.Q183X													.	.	0			c.C547T						.						52.0	58.0	56.0					5																	140772927		2147	4282	6429	SO:0001587	stop_gained	9708	exon1			GACGTGCAGACTG	AF152515	CCDS47291.1, CCDS75338.1	5q31	2010-01-26			ENSG00000253767	ENSG00000253767		"""Cadherins / Protocadherins : Clustered"""	8706	other	protocadherin		606295				10380929	Standard	NM_014004		Approved	KIAA0327, PCDH-GAMMA-A8		Q9Y5G5	OTTHUMG00000164053	ENST00000398604.2:c.547C>T	5.37:g.140772927C>T	ENSP00000381605:p.Gln183*	80	0		74	8	NM_014004	0	0	0	0	0	A7MCZ4|O15039	Nonsense_Mutation	SNP	ENST00000398604.2	37	CCDS47291.1	.	.	.	.	.	.	.	.	.	.	.	17.30	3.354337	0.61293	.	.	ENSG00000253767	ENST00000398604	.	.	.	5.41	5.41	0.78517	.	0.000000	0.30118	U	0.010368	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15066	T	0.55	.	13.7424	0.62855	0.1539:0.8461:0.0:0.0	.	.	.	.	X	183	.	ENSP00000381605:Q183X	Q	+	1	0	PCDHGA8	140753111	0.000000	0.05858	0.859000	0.33776	0.662000	0.39071	-0.042000	0.12063	2.552000	0.86080	0.655000	0.94253	CAG	.		0.612	PCDHGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376972.1	NM_032088	
LRRC16A	55604	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	25600730	25600730	+	Missense_Mutation	SNP	C	C	A			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr6:25600730C>A	ENST00000329474.6	+	33	3676	c.3308C>A	c.(3307-3309)cCt>cAt	p.P1103H		NM_001173977.1|NM_017640.5	NP_001167448.1|NP_060110.4	Q5VZK9	LR16A_HUMAN	leucine rich repeat containing 16A	1103					actin filament organization (GO:0007015)|barbed-end actin filament uncapping (GO:0051638)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|lamellipodium assembly (GO:0030032)|negative regulation of barbed-end actin filament capping (GO:2000813)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell migration (GO:0030335)|positive regulation of lamellipodium organization (GO:1902745)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|ruffle organization (GO:0031529)|urate metabolic process (GO:0046415)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|lamellipodium (GO:0030027)|nucleus (GO:0005634)	protein complex binding (GO:0032403)			breast(4)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	50						AGAAGTCCACCTGTGGACTGT	0.488																																					p.P1103H		.											.	LRRC16A-137	0			c.C3308A						.						64.0	64.0	64.0					6																	25600730		1925	4128	6053	SO:0001583	missense	55604	exon33			GTCCACCTGTGGA	AK000055	CCDS54973.1	6p22.1	2010-09-10	2008-02-12	2008-02-12	ENSG00000079691	ENSG00000079691			21581	protein-coding gene	gene with protein product	"""capping protein, Arp2/3, and Myosin-I Linker homolog 1 (Dictyostelium)"""	609593	"""leucine rich repeat containing 16"""	LRRC16		19846667	Standard	NM_017640		Approved	dJ501N12.1, FLJ20048, CARMIL, CARMIL1	uc011djw.2	Q5VZK9	OTTHUMG00000014393	ENST00000329474.6:c.3308C>A	6.37:g.25600730C>A	ENSP00000331983:p.Pro1103His	113	2		85	25	NM_001173977	0	0	2	3	1	B8X1J0|Q6ZUH5|Q6ZW07|Q9NXU7	Missense_Mutation	SNP	ENST00000329474.6	37	CCDS54973.1	.	.	.	.	.	.	.	.	.	.	C	12.44	1.939309	0.34189	.	.	ENSG00000079691	ENST00000329474;ENST00000399313	T	0.41758	0.99	5.2	4.33	0.51752	.	0.466121	0.23528	N	0.047208	T	0.26593	0.0650	L	0.29908	0.895	0.80722	D	1	P;P;P	0.50272	0.621;0.933;0.917	P;B;P	0.48166	0.471;0.315;0.569	T	0.06373	-1.0830	10	0.56958	D	0.05	-1.9805	13.6423	0.62257	0.0:0.925:0.0:0.075	.	1103;1103;1103	Q5VZK9;B2RTQ5;Q5VZK9-2	LR16A_HUMAN;.;.	H	1103	ENSP00000331983:P1103H	ENSP00000331983:P1103H	P	+	2	0	LRRC16A	25708709	0.971000	0.33674	0.029000	0.17559	0.016000	0.09150	2.953000	0.49105	1.165000	0.42670	0.455000	0.32223	CCT	.		0.488	LRRC16A-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000040045.2	NM_017640	
HLA-F	3134	ucsc.edu	37	6	29692860	29692860	+	Silent	SNP	C	C	T			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr6:29692860C>T	ENST00000376861.1	+	5	1047	c.663C>T	c.(661-663)acC>acT	p.T221T	HLA-F_ENST00000259951.7_Silent_p.T221T|HLA-F_ENST00000334668.4_Silent_p.T221T|HLA-F_ENST00000440587.2_Silent_p.T103T|HLA-F_ENST00000434407.2_Intron			P30511	HLAF_HUMAN	major histocompatibility complex, class I, F	221	Alpha-3.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)	early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|membrane (GO:0016020)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)|TAP1 binding (GO:0046978)|TAP2 binding (GO:0046979)			cervix(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	8						ATGAGGCCACCCTGAGGTGCT	0.587																																					p.T221T													.	HLA-F-22	0			c.C663T						.						55.0	54.0	54.0					6																	29692860		2203	4300	6503	SO:0001819	synonymous_variant	3134	exon4			GGCCACCCTGAGG	AY253269	CCDS43437.1, CCDS43438.1, CCDS43439.1	6p21.3	2013-01-11			ENSG00000204642	ENSG00000204642		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4963	protein-coding gene	gene with protein product		143110				1688605	Standard	NM_018950		Approved		uc003nno.4	P30511	OTTHUMG00000031156	ENST00000376861.1:c.663C>T	6.37:g.29692860C>T		87	0		70	1	NM_001098479	6	3	6913	6928	6	Q5JQI8|Q5JQJ1|Q5SPT5|Q860R0|Q8MGQ1|Q8WLP5|Q95HC0|Q9TP68	Silent	SNP	ENST00000376861.1	37	CCDS43438.1	.	.	.	.	.	.	.	.	.	.	.	9.704	1.155158	0.21371	.	.	ENSG00000204642	ENST00000429294	.	.	.	1.92	1.92	0.25849	.	.	.	.	.	T	0.41673	0.1169	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.33471	-0.9867	4	.	.	.	.	7.2321	0.26049	0.0:1.0:0.0:0.0	.	.	.	.	L	100	.	.	P	+	2	0	HLA-F	29800839	0.995000	0.38212	0.970000	0.41538	0.982000	0.71751	1.737000	0.38197	1.046000	0.40249	0.436000	0.28706	CCC	.		0.587	HLA-F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195083.1	NM_018950	
HLA-F	3134	ucsc.edu	37	6	29692866	29692866	+	Silent	SNP	G	G	A			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr6:29692866G>A	ENST00000376861.1	+	5	1053	c.669G>A	c.(667-669)agG>agA	p.R223R	HLA-F_ENST00000259951.7_Silent_p.R223R|HLA-F_ENST00000334668.4_Silent_p.R223R|HLA-F_ENST00000440587.2_Silent_p.R105R|HLA-F_ENST00000434407.2_Intron			P30511	HLAF_HUMAN	major histocompatibility complex, class I, F	223	Alpha-3.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)	early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|membrane (GO:0016020)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)|TAP1 binding (GO:0046978)|TAP2 binding (GO:0046979)			cervix(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	8						CCACCCTGAGGTGCTGGGCCC	0.597																																					p.R223R													.	HLA-F-22	0			c.G669A						.						54.0	53.0	53.0					6																	29692866		2203	4300	6503	SO:0001819	synonymous_variant	3134	exon4			CCTGAGGTGCTGG	AY253269	CCDS43437.1, CCDS43438.1, CCDS43439.1	6p21.3	2013-01-11			ENSG00000204642	ENSG00000204642		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4963	protein-coding gene	gene with protein product		143110				1688605	Standard	NM_018950		Approved		uc003nno.4	P30511	OTTHUMG00000031156	ENST00000376861.1:c.669G>A	6.37:g.29692866G>A		89	0		70	1	NM_001098479	4	4	6368	6379	3	Q5JQI8|Q5JQJ1|Q5SPT5|Q860R0|Q8MGQ1|Q8WLP5|Q95HC0|Q9TP68	Silent	SNP	ENST00000376861.1	37	CCDS43438.1	.	.	.	.	.	.	.	.	.	.	.	10.18	1.278060	0.23307	.	.	ENSG00000204642	ENST00000429294	.	.	.	1.92	1.92	0.25849	.	.	.	.	.	T	0.41673	0.1169	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.33471	-0.9867	4	.	.	.	.	7.2321	0.26049	0.0:0.0:1.0:0.0	.	.	.	.	D	102	.	.	G	+	2	0	HLA-F	29800845	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	1.835000	0.39181	1.046000	0.40249	0.436000	0.28706	GGT	.		0.597	HLA-F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195083.1	NM_018950	
KLC4	89953	broad.mit.edu;ucsc.edu	37	6	43042368	43042368	+	Silent	SNP	G	G	T			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr6:43042368G>T	ENST00000394056.2	+	17	2313	c.1818G>T	c.(1816-1818)cgG>cgT	p.R606R	KLC4_ENST00000394058.1_Silent_p.R606R|RP11-387M24.5_ENST00000606123.1_RNA|KLC4_ENST00000347162.5_Silent_p.R606R|KLC4_ENST00000453940.2_Silent_p.R529R|KLC4_ENST00000479388.1_Silent_p.R606R|PTK7_ENST00000471863.1_5'Flank|PTK7_ENST00000481273.1_5'Flank|PTK7_ENST00000345201.2_5'Flank|PTK7_ENST00000476760.1_5'Flank|PTK7_ENST00000349241.2_5'Flank|PTK7_ENST00000230419.4_5'Flank|PTK7_ENST00000352931.2_5'Flank|KLC4_ENST00000259708.3_Silent_p.R624R			Q9NSK0	KLC4_HUMAN	kinesin light chain 4	606						cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	microtubule motor activity (GO:0003777)			endometrium(2)|large_intestine(7)|lung(5)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(4)	23			all cancers(41;0.00169)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0376)|KIRC - Kidney renal clear cell carcinoma(2;0.0453)			AGGTCTCCCGGGGCCTCAGTG	0.607																																					p.R624R													.	KLC4-94	0			c.G1872T						.						117.0	103.0	108.0					6																	43042368		2203	4300	6503	SO:0001819	synonymous_variant	89953	exon16			CTCCCGGGGCCTC	AK055293	CCDS4882.1, CCDS4883.1, CCDS47429.1, CCDS75459.1	6p21.1	2013-01-10	2005-09-13	2005-09-13	ENSG00000137171	ENSG00000137171		"""Tetratricopeptide (TTC) repeat domain containing"""	21624	protein-coding gene	gene with protein product			"""kinesin-like 8"""	KNSL8			Standard	NM_001289034		Approved	bA387M24.3	uc003otw.1	Q9NSK0	OTTHUMG00000014720	ENST00000394056.2:c.1818G>T	6.37:g.43042368G>T		108	2		80	10	NM_201523	0	0	0	0	0	B3KNY4|B3KPI3|B3KSQ3|B4DME9|Q66K28|Q96EG6	Silent	SNP	ENST00000394056.2	37	CCDS4883.1																																																																																			.		0.607	KLC4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040579.2	NM_138343	
LMBRD1	55788	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	70462182	70462182	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr6:70462182T>C	ENST00000370577.3	-	4	603	c.374A>G	c.(373-375)gAa>gGa	p.E125G	LMBRD1_ENST00000370570.1_Missense_Mutation_p.E52G	NM_018368.3	NP_060838.3	Q9NUN5	LMBD1_HUMAN	LMBR1 domain containing 1	125					cobalamin metabolic process (GO:0009235)|insulin receptor internalization (GO:0038016)|negative regulation of glucose import (GO:0046325)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of protein kinase B signaling (GO:0051898)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	clathrin-coated endocytic vesicle (GO:0045334)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cobalamin binding (GO:0031419)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(11)|ovary(2)|upper_aerodigestive_tract(1)	31						ATCATCCTTTTCTTCATAATA	0.294																																					p.E125G		.											.	LMBRD1-91	0			c.A374G						.						54.0	56.0	56.0					6																	70462182		2197	4278	6475	SO:0001583	missense	55788	exon4			TCCTTTTCTTCAT	AF113224	CCDS4969.1	6q13	2011-05-12	2005-07-25	2005-07-25	ENSG00000168216	ENSG00000168216			23038	protein-coding gene	gene with protein product		612625	"""chromosome 6 open reading frame 209"""	C6orf209		19136951	Standard	NM_018368		Approved	FLJ11240, bA810I22.1, cblF	uc003pfa.3	Q9NUN5	OTTHUMG00000014985	ENST00000370577.3:c.374A>G	6.37:g.70462182T>C	ENSP00000359609:p.Glu125Gly	71	0		77	16	NM_018368	0	0	3	6	3	A8K204|E1P531|Q5VUN6|Q86Y70|Q96FW4|Q9BY56|Q9NZD6	Missense_Mutation	SNP	ENST00000370577.3	37	CCDS4969.1	.	.	.	.	.	.	.	.	.	.	T	16.36	3.102734	0.56183	.	.	ENSG00000168216	ENST00000370577;ENST00000370570	T;T	0.26067	1.76;1.76	5.33	4.15	0.48705	LMBR1-like membrane protein (1);	0.051951	0.85682	D	0.000000	T	0.19805	0.0476	M	0.85462	2.755	0.58432	D	0.999998	B	0.18968	0.032	B	0.22880	0.042	T	0.09487	-1.0672	10	0.39692	T	0.17	-12.1431	10.4775	0.44674	0.0:0.0797:0.0:0.9203	.	125	Q9NUN5	LMBD1_HUMAN	G	125;52	ENSP00000359609:E125G;ENSP00000359602:E52G	ENSP00000359602:E52G	E	-	2	0	LMBRD1	70518903	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.495000	0.66912	2.022000	0.59522	0.455000	0.32223	GAA	.		0.294	LMBRD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041124.1	NM_018368	
SYNE1	23345	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	152673335	152673335	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr6:152673335T>C	ENST00000367255.5	-	70	12008	c.11407A>G	c.(11407-11409)Act>Gct	p.T3803A	SYNE1_ENST00000341594.5_Missense_Mutation_p.T3774A|SYNE1_ENST00000265368.4_Missense_Mutation_p.T3803A|SYNE1_ENST00000423061.1_Missense_Mutation_p.T3788A|SYNE1_ENST00000448038.1_Missense_Mutation_p.T3788A	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	3803					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TTCCGGACAGTGCTGGTCAGT	0.448										HNSCC(10;0.0054)																											p.T3803A		.											.	SYNE1-607	0			c.A11407G						.						251.0	230.0	237.0					6																	152673335		2203	4300	6503	SO:0001583	missense	23345	exon70			GGACAGTGCTGGT	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.11407A>G	6.37:g.152673335T>C	ENSP00000356224:p.Thr3803Ala	217	0		261	44	NM_182961	0	0	0	0	0	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	T	9.518	1.107572	0.20714	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	T;T;T;T;T	0.34072	1.45;1.45;1.45;1.45;1.38	6.04	2.28	0.28536	.	0.339507	0.25194	N	0.032438	T	0.07638	0.0192	L	0.43152	1.355	0.09310	N	0.999998	B;B;B;B	0.09022	0.002;0.002;0.002;0.001	B;B;B;B	0.06405	0.001;0.001;0.001;0.002	T	0.39603	-0.9606	10	0.08837	T	0.75	.	4.3779	0.11279	0.2094:0.2204:0.0:0.5702	.	3803;3803;3803;3788	B7ZBC3;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	A	3803;3788;3803;3788;3774	ENSP00000356224:T3803A;ENSP00000396024:T3788A;ENSP00000265368:T3803A;ENSP00000390975:T3788A;ENSP00000341887:T3774A	ENSP00000265368:T3803A	T	-	1	0	SYNE1	152715028	0.076000	0.21285	0.602000	0.28890	0.876000	0.50452	0.615000	0.24329	0.155000	0.19261	0.460000	0.39030	ACT	.		0.448	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
TMEM248	55069	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	66410208	66410208	+	Silent	SNP	T	T	C			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr7:66410208T>C	ENST00000341567.4	+	3	660	c.405T>C	c.(403-405)caT>caC	p.H135H		NM_017994.4	NP_060464.1	Q9NWD8	TM248_HUMAN	transmembrane protein 248	135						integral component of membrane (GO:0016021)											ACGTCACCCATCTGTACTCAA	0.527																																					p.H135H		.											.	.	0			c.T405C						.						107.0	105.0	106.0					7																	66410208		2203	4300	6503	SO:0001819	synonymous_variant	55069	exon3			CACCCATCTGTAC		CCDS5536.1	7q11.21	2012-05-30	2012-05-30	2012-05-30	ENSG00000106609	ENSG00000106609			25476	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 42"""	C7orf42		12477932	Standard	XM_005250482		Approved	FLJ10099, FLJ13090	uc003tvk.3	Q9NWD8	OTTHUMG00000129553	ENST00000341567.4:c.405T>C	7.37:g.66410208T>C		244	0		247	43	NM_017994	0	0	11	22	11	Q53H07|Q96FR2	Silent	SNP	ENST00000341567.4	37	CCDS5536.1																																																																																			.		0.527	TMEM248-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251745.2	NM_017994	
DOCK4	9732	hgsc.bcm.edu	37	7	111387432	111387432	+	Missense_Mutation	SNP	A	A	G			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr7:111387432A>G	ENST00000437633.1	-	42	4713	c.4457T>C	c.(4456-4458)cTg>cCg	p.L1486P	DOCK4_ENST00000428084.1_Missense_Mutation_p.L1495P|DOCK4_ENST00000494651.2_Missense_Mutation_p.L369P	NM_014705.3	NP_055520.3	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4	1486	DHR-2.				cell chemotaxis (GO:0060326)|positive regulation of Rac GTPase activity (GO:0032855)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|stereocilium (GO:0032420)|stereocilium bundle (GO:0032421)	guanyl-nucleotide exchange factor activity (GO:0005085)|PDZ domain binding (GO:0030165)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)|receptor tyrosine kinase binding (GO:0030971)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(13)|lung(31)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(4)	72		Acute lymphoblastic leukemia(1;0.0441)				CTGACTAATCAGAGTCTTCAG	0.388																																					p.L1486P		.											.	DOCK4-26	0			c.T4457C						.						92.0	90.0	91.0					7																	111387432		1929	4134	6063	SO:0001583	missense	9732	exon42			CTAATCAGAGTCT		CCDS47688.1	7q31.1	2007-08-07			ENSG00000128512	ENSG00000128512			19192	protein-coding gene	gene with protein product		607679				12432077, 12628187	Standard	XM_006716188		Approved	FLJ34238, KIAA0716	uc003vfx.3	Q8N1I0	OTTHUMG00000155077	ENST00000437633.1:c.4457T>C	7.37:g.111387432A>G	ENSP00000404179:p.Leu1486Pro	53	0		40	2	NM_014705	0	0	0	0	0	O14584|O94824|Q8NB45	Missense_Mutation	SNP	ENST00000437633.1	37	CCDS47688.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	22.7|22.7	4.330553|4.330553	0.81690|0.81690	.|.	.|.	ENSG00000128512|ENSG00000128512	ENST00000352877;ENST00000428084;ENST00000494651;ENST00000437633;ENST00000342288|ENST00000423057;ENST00000445943	T;T;T|.	0.19669|.	2.13;2.13;2.13|.	5.27|5.27	5.27|5.27	0.74061|0.74061	.|.	0.143240|.	0.48767|.	D|.	0.000170|.	T|.	0.80597|.	0.4653|.	M|M	0.89095|0.89095	3.005|3.005	0.80722|0.80722	D|D	1|1	D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0|.	D;D;D;D;D|.	0.97110|.	0.999;0.997;1.0;1.0;0.998|.	D|.	0.84237|.	0.0470|.	10|.	0.87932|.	D|.	0|.	.|.	15.3585|15.3585	0.74448|0.74448	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	393;369;1531;1486;1495|.	B7Z2K9;F5GXW1;Q149N5;Q8N1I0;Q8N1I0-2|.	.;.;.;DOCK4_HUMAN;.|.	P|R	1474;1495;369;1486;1483|947;1519	ENSP00000410746:L1495P;ENSP00000440944:L369P;ENSP00000404179:L1486P|.	ENSP00000345432:L1483P|.	L|X	-|-	2|1	0|0	DOCK4|DOCK4	111174668|111174668	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.990000|0.990000	0.78478|0.78478	9.139000|9.139000	0.94554|0.94554	2.218000|2.218000	0.71995|0.71995	0.533000|0.533000	0.62120|0.62120	CTG|TGA	.		0.388	DOCK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338369.4	NM_014705	
ING3	54556	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	120595620	120595620	+	Missense_Mutation	SNP	A	A	G			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr7:120595620A>G	ENST00000315870.5	+	4	357	c.209A>G	c.(208-210)tAt>tGt	p.Y70C	ING3_ENST00000339121.5_Missense_Mutation_p.Y70C|ING3_ENST00000431467.1_Missense_Mutation_p.Y55C|ING3_ENST00000445699.1_Missense_Mutation_p.Y70C	NM_019071.2	NP_061944.2	Q9NXR8	ING3_HUMAN	inhibitor of growth family, member 3	70					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|positive regulation of apoptotic process (GO:0043065)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Piccolo NuA4 histone acetyltransferase complex (GO:0032777)|Swr1 complex (GO:0000812)	methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(2)|lung(7)|ovary(1)|urinary_tract(1)	12	all_neural(327;0.117)					CAGGACTACTATAAAGCTTTG	0.303																																					p.Y70C		.											.	ING3-515	0			c.A209G						.						78.0	79.0	78.0					7																	120595620		2203	4300	6503	SO:0001583	missense	54556	exon4			ACTACTATAAAGC	AF074968	CCDS5778.1, CCDS35497.1	7q31	2013-01-28			ENSG00000071243	ENSG00000071243		"""Zinc fingers, PHD-type"""	14587	protein-coding gene	gene with protein product		607493				12080476	Standard	NM_019071		Approved	p47ING3, FLJ20089, Eaf4, MEAF4	uc003vjn.3	Q9NXR8	OTTHUMG00000141270	ENST00000315870.5:c.209A>G	7.37:g.120595620A>G	ENSP00000320566:p.Tyr70Cys	30	0		36	5	NM_019071	0	0	0	0	0	A8K790|O60394|Q567P3|Q6GMT3|Q7Z762|Q969G0|Q96DT4|Q9HC99|Q9P081	Missense_Mutation	SNP	ENST00000315870.5	37	CCDS5778.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.990024	0.74589	.	.	ENSG00000071243	ENST00000315870;ENST00000339121;ENST00000445699;ENST00000431467	D;D	0.95518	-3.7;-3.73	5.54	5.54	0.83059	Inhibitor of growth protein, N-terminal (1);	0.059163	0.64402	D	0.000001	D	0.96765	0.8944	M	0.73598	2.24	0.80722	D	1	D;D;D;D;D	0.76494	0.999;0.975;0.988;0.999;0.999	D;P;P;D;D	0.67900	0.911;0.739;0.811;0.912;0.954	D	0.95906	0.8919	10	0.38643	T	0.18	-21.6296	10.2439	0.43330	0.852:0.0:0.0:0.148	.	70;70;70;70;70	B7ZKQ7;Q5GRH6;Q9NXR8;Q9NXR8-2;C9JUT0	.;.;ING3_HUMAN;.;.	C	70;70;70;55	ENSP00000320566:Y70C;ENSP00000388506:Y55C	ENSP00000320566:Y70C	Y	+	2	0	ING3	120382856	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.966000	0.76073	2.230000	0.72887	0.528000	0.53228	TAT	.		0.303	ING3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280453.2	NM_019071	
MCPH1	79648	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	6302006	6302006	+	Missense_Mutation	SNP	A	A	T			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr8:6302006A>T	ENST00000344683.5	+	8	839	c.763A>T	c.(763-765)Att>Ttt	p.I255F	MCPH1_ENST00000522905.1_Missense_Mutation_p.I207F|MCPH1_ENST00000519480.1_Missense_Mutation_p.I255F	NM_024596.3	NP_078872	Q8NEM0	MCPH1_HUMAN	microcephalin 1	255					cerebral cortex development (GO:0021987)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleoplasm (GO:0005654)	identical protein binding (GO:0042802)		AGPAT5/MCPH1(2)	central_nervous_system(1)|large_intestine(4)|skin(1)	6		Hepatocellular(245;0.0663)		Colorectal(4;0.0505)		GGAAGGATCCATTAATGACAT	0.358																																					p.I255F	Colon(95;1448 1467 8277 34473 35819)	.											.	MCPH1-229	0			c.A763T						.						129.0	122.0	124.0					8																	6302006		1883	4107	5990	SO:0001583	missense	79648	exon8			GGATCCATTAATG	AK022909	CCDS43689.1, CCDS55190.1, CCDS55191.1	8p23.1	2012-11-26	2007-11-26		ENSG00000147316	ENSG00000147316			6954	protein-coding gene	gene with protein product	"""BRCT-repeat inhibitor of TERT expression 1"""	607117	"""microcephaly, primary autosomal recessive 1"""			9683597, 17925396	Standard	NM_024596		Approved	FLJ12847, BRIT1	uc003wqi.3	Q8NEM0	OTTHUMG00000163618	ENST00000344683.5:c.763A>T	8.37:g.6302006A>T	ENSP00000342924:p.Ile255Phe	89	0		89	23	NM_001172574	0	0	2	2	0	B4DWW2|E9PGU5|E9PH63|Q66GU1|Q9H9C7	Missense_Mutation	SNP	ENST00000344683.5	37	CCDS43689.1	.	.	.	.	.	.	.	.	.	.	A	24.9	4.579572	0.86645	.	.	ENSG00000147316	ENST00000344683;ENST00000519480;ENST00000522905	T;T;T	0.13778	2.56;2.56;2.56	5.26	-7.74	0.01241	.	1.774350	0.02525	N	0.092983	T	0.17492	0.0420	L	0.53249	1.67	0.09310	N	1	P;P;P	0.46784	0.884;0.867;0.884	P;P;P	0.52267	0.522;0.694;0.522	T	0.40289	-0.9571	10	0.32370	T	0.25	0.0924	3.4052	0.07338	0.3624:0.1106:0.4182:0.1088	.	207;255;255	E9PH63;Q8NEM0;E9PGU5	.;MCPH1_HUMAN;.	F	255;255;207	ENSP00000342924:I255F;ENSP00000430962:I255F;ENSP00000430768:I207F	ENSP00000342924:I255F	I	+	1	0	MCPH1	6289414	0.000000	0.05858	0.000000	0.03702	0.857000	0.48899	-0.113000	0.10774	-1.605000	0.01593	0.533000	0.62120	ATT	.		0.358	MCPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374532.2	NM_024596	
IKBKB	3551	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	42173753	42173753	+	Missense_Mutation	SNP	T	T	A			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr8:42173753T>A	ENST00000520810.1	+	10	1012	c.826T>A	c.(826-828)Tgg>Agg	p.W276R	IKBKB_ENST00000522147.1_Intron|IKBKB_ENST00000416505.2_Missense_Mutation_p.W217R|IKBKB_ENST00000520835.1_Missense_Mutation_p.W274R|IKBKB_ENST00000379708.3_Missense_Mutation_p.W53R	NM_001556.2	NP_001547.1	O14920	IKKB_HUMAN	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta	276	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				B cell homeostasis (GO:0001782)|cellular response to tumor necrosis factor (GO:0071356)|Fc-epsilon receptor signaling pathway (GO:0038095)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of cation channel activity (GO:2001259)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sodium ion transport (GO:0010765)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)|serine phosphorylation of STAT protein (GO:0042501)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|IkappaB kinase complex (GO:0008385)|nucleus (GO:0005634)	ATP binding (GO:0005524)|IkappaB kinase activity (GO:0008384)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|scaffold protein binding (GO:0097110)			breast(4)|lung(1)|ovary(2)|skin(1)	8	all_cancers(6;1.42e-24)|all_epithelial(6;1.02e-25)|all_lung(13;6.21e-12)|Lung NSC(13;1.04e-10)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Colorectal(14;0.0468)|Lung SC(25;0.211)	all_lung(54;0.000434)|Lung NSC(58;0.00161)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	BRCA - Breast invasive adenocarcinoma(8;1.37e-10)|Colorectal(10;0.00102)|OV - Ovarian serous cystadenocarcinoma(14;0.00168)|Lung(22;0.00467)|LUSC - Lung squamous cell carcinoma(45;0.024)|COAD - Colon adenocarcinoma(11;0.0264)		Acetylcysteine(DB06151)|Acetylsalicylic acid(DB00945)|Arsenic trioxide(DB01169)|Auranofin(DB00995)|Mesalazine(DB00244)|Sulfasalazine(DB00795)	ACTGGAGAAGTGGCTGCAACT	0.562																																					p.W276R		.											.	IKBKB-1164	0			c.T826A						.						66.0	58.0	61.0					8																	42173753		2203	4300	6503	SO:0001583	missense	3551	exon10			GAGAAGTGGCTGC	AF029684	CCDS6128.1, CCDS55228.1, CCDS56535.1	8p11.2	2008-08-18			ENSG00000104365	ENSG00000104365			5960	protein-coding gene	gene with protein product		603258				9878263, 9763654	Standard	NM_001556		Approved	IKK2, NFKBIKB, IKK-beta, IKKB	uc003xow.2	O14920	OTTHUMG00000164092	ENST00000520810.1:c.826T>A	8.37:g.42173753T>A	ENSP00000430684:p.Trp276Arg	68	0		48	10	NM_001556	0	0	2	2	0	B4DZ30|B4E0U4|O75327	Missense_Mutation	SNP	ENST00000520810.1	37	CCDS6128.1	.	.	.	.	.	.	.	.	.	.	T	25.2	4.617138	0.87359	.	.	ENSG00000104365	ENST00000520810;ENST00000416505;ENST00000520835;ENST00000379708	T;T;T;T	0.64803	-0.12;-0.12;-0.12;1.78	5.27	5.27	0.74061	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.057892	0.85682	D	0.000000	T	0.78780	0.4337	M	0.75264	2.295	0.80722	D	1	P;D;P;D;D;D	0.89917	0.879;0.998;0.836;0.999;0.995;1.0	P;D;B;D;D;D	0.97110	0.745;0.987;0.425;0.987;0.988;1.0	T	0.81621	-0.0850	10	0.72032	D	0.01	.	15.1947	0.73078	0.0:0.0:0.0:1.0	.	217;274;53;227;276;276	B4E0U4;O14920-2;B3KRB7;Q59GL9;O14920;Q32ND9	.;.;.;.;IKKB_HUMAN;.	R	276;217;274;53	ENSP00000430684:W276R;ENSP00000404920:W217R;ENSP00000430868:W274R;ENSP00000369030:W53R	ENSP00000369030:W53R	W	+	1	0	IKBKB	42292910	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	6.228000	0.72288	1.994000	0.58287	0.460000	0.39030	TGG	.		0.562	IKBKB-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377214.1		
FBXL6	26233	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	145579793	145579793	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr8:145579793T>C	ENST00000331890.5	-	8	1371	c.1307A>G	c.(1306-1308)cAg>cGg	p.Q436R	SLC52A2_ENST00000329994.2_5'Flank|FBXL6_ENST00000526524.1_Intron|SLC52A2_ENST00000532887.1_5'Flank|SLC52A2_ENST00000540505.1_5'Flank|SLC52A2_ENST00000527078.1_5'Flank|TMEM249_ENST00000398633.3_5'Flank|SLC52A2_ENST00000402965.1_5'Flank|FBXL6_ENST00000455319.2_Missense_Mutation_p.Q430R|SLC52A2_ENST00000530047.1_5'Flank|TMEM249_ENST00000531225.1_5'Flank	NM_012162.2	NP_036294.2	Q8N531	FBXL6_HUMAN	F-box and leucine-rich repeat protein 6	436					protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)		ubiquitin-protein transferase activity (GO:0004842)			endometrium(1)|lung(3)|ovary(1)	5	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;4.43e-40)|Epithelial(56;1.48e-39)|all cancers(56;1.49e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0441)|Colorectal(110;0.055)			GCACCACTTCTGGGTCAAAAA	0.592																																					p.Q436R		.											.	FBXL6-658	0			c.A1307G						.						70.0	77.0	74.0					8																	145579793		2203	4299	6502	SO:0001583	missense	26233	exon8			CACTTCTGGGTCA	AF174592	CCDS6422.1, CCDS47942.1	8q24.3	2011-06-09			ENSG00000182325	ENSG00000182325		"""F-boxes / Leucine-rich repeats"""	13603	protein-coding gene	gene with protein product		609076				10531035, 10531037	Standard	NM_012162		Approved	FBL6	uc003zcb.3	Q8N531	OTTHUMG00000165169	ENST00000331890.5:c.1307A>G	8.37:g.145579793T>C	ENSP00000330098:p.Gln436Arg	181	0		156	30	NM_012162	0	0	16	27	11	Q53G43|Q9H5W9|Q9UKC7	Missense_Mutation	SNP	ENST00000331890.5	37	CCDS6422.1	.	.	.	.	.	.	.	.	.	.	T	10.23	1.292836	0.23564	.	.	ENSG00000182325	ENST00000455319;ENST00000331890	T;T	0.24538	1.85;1.85	5.13	1.23	0.21249	.	0.612082	0.16879	N	0.195799	T	0.14141	0.0342	L	0.31207	0.915	0.22803	N	0.998711	B;B	0.14438	0.006;0.01	B;B	0.11329	0.003;0.006	T	0.32955	-0.9887	10	0.12766	T	0.61	-2.0714	6.0415	0.19736	0.0:0.403:0.0:0.597	.	436;430	Q8N531;Q8N531-2	FBXL6_HUMAN;.	R	430;436	ENSP00000403873:Q430R;ENSP00000330098:Q436R	ENSP00000330098:Q436R	Q	-	2	0	FBXL6	145550601	0.622000	0.27085	0.991000	0.47740	0.810000	0.45777	0.327000	0.19663	0.240000	0.21263	0.460000	0.39030	CAG	.		0.592	FBXL6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382413.1	NM_024555	
SVEP1	79987	broad.mit.edu	37	9	113198779	113198779	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr9:113198779C>T	ENST00000401783.2	-	28	4981	c.4645G>A	c.(4645-4647)Ggt>Agt	p.G1549S	SVEP1_ENST00000374469.1_Missense_Mutation_p.G1526S	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	1549	Pentaxin.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						ACTAACGCACCACCACCTAAG	0.453																																					p.G1549S													.	SVEP1-75	0			c.G4645A						.						56.0	54.0	55.0					9																	113198779		1865	4103	5968	SO:0001583	missense	79987	exon28			ACGCACCACCACC	AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.4645G>A	9.37:g.113198779C>T	ENSP00000384917:p.Gly1549Ser	47	0		24	6	NM_153366	0	0	0	0	0	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	ENST00000401783.2	37	CCDS48004.1	.	.	.	.	.	.	.	.	.	.	C	35	5.491525	0.96339	.	.	ENSG00000165124	ENST00000401783;ENST00000374469	T;T	0.06068	3.35;3.35	6.03	6.03	0.97812	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.000000	0.85682	D	0.000000	T	0.39172	0.1068	H	0.94222	3.51	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.44787	-0.9305	10	0.46703	T	0.11	.	20.5568	0.99304	0.0:1.0:0.0:0.0	.	1549	Q4LDE5	SVEP1_HUMAN	S	1549;1526	ENSP00000384917:G1549S;ENSP00000363593:G1526S	ENSP00000363593:G1526S	G	-	1	0	SVEP1	112238600	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	7.464000	0.80887	2.861000	0.98227	0.655000	0.94253	GGT	.		0.453	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
PEAK1	79834	broad.mit.edu;bcgsc.ca	37	15	77406883	77406886	+	Frame_Shift_Del	DEL	TCCC	TCCC	-			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	TCCC	TCCC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr15:77406883_77406886delTCCC	ENST00000560626.2	-	7	5328_5331	c.4853_4856delGGGA	c.(4852-4857)agggaafs	p.RE1618fs	PEAK1_ENST00000312493.4_Frame_Shift_Del_p.RE1618fs			Q9H792	PEAK1_HUMAN	pseudopodium-enriched atypical kinase 1	1618	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell migration (GO:0016477)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|substrate adhesion-dependent cell spreading (GO:0034446)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)										TCGTGTGTATTCCCTCTCCTTCAG	0.559																																					p.1618_1619del													.	.	0			c.4853_4856del						.																																			SO:0001589	frameshift_variant	0	exon8			GTGTATTCCCTCT		CCDS42062.1	15q24.3	2013-09-27			ENSG00000173517	ENSG00000173517			29431	protein-coding gene	gene with protein product		614248				16879967, 20534451	Standard	NM_024776		Approved	KIAA2002, sgk269		Q9H792	OTTHUMG00000172618	ENST00000560626.2:c.4853_4856delGGGA	15.37:g.77406883_77406886delTCCC	ENSP00000452796:p.Arg1618fs	49	0		31	9	NM_024776	0	0	0	0	0	Q6ZS78|Q8NAZ4|Q8NCM3|Q8TEG7	Frame_Shift_Del	DEL	ENST00000560626.2	37	CCDS42062.1																																																																																			.		0.559	PEAK1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419483.3		
SP100	6672	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	231338157	231338157	+	Splice_Site	DEL	T	T	-			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr2:231338157delT	ENST00000264052.5	+	16	1901		c.e16+2		SP100_ENST00000409112.1_Splice_Site|SP100_ENST00000340126.4_Splice_Site	NM_003113.3	NP_003104.2	P23497	SP100_HUMAN	SP100 nuclear antigen						cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of cellular component movement (GO:0051271)|negative regulation of DNA binding (GO:0043392)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of protein export from nucleus (GO:0046826)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral transcription (GO:0032897)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of angiogenesis (GO:0045765)|regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902041)|regulation of Fas signaling pathway (GO:1902044)|response to cytokine (GO:0034097)|response to interferon-gamma (GO:0034341)|response to retinoic acid (GO:0032526)|response to type I interferon (GO:0034340)|retinoic acid receptor signaling pathway (GO:0048384)|telomere maintenance (GO:0000723)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear periphery (GO:0034399)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(4)|upper_aerodigestive_tract(1)	25		Renal(207;0.0112)|all_lung(227;0.0335)|all_hematologic(139;0.0749)|Lung NSC(271;0.142)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		ACATGATGGGTAAGGCTACCC	0.468																																					.		.											.	SP100-94	0			c.1546+2T>-						.						164.0	152.0	156.0					2																	231338157		2203	4300	6503	SO:0001630	splice_region_variant	6672	exon16			.	AF056322	CCDS2477.1, CCDS42832.1, CCDS56170.1, CCDS56171.1, CCDS56172.1, CCDS56173.1	2q37.1	2013-01-28	2005-11-30		ENSG00000067066	ENSG00000067066		"""Zinc fingers, PHD-type"""	11206	protein-coding gene	gene with protein product		604585	"""nuclear antigen Sp100"""			2258622, 8695863	Standard	NM_001080391		Approved		uc002vqu.1	P23497	OTTHUMG00000133203	ENST00000264052.5:c.1546+2T>-	2.37:g.231338157delT		126	0		135	23	NM_003113	0	0	0	0	0	B4DDX5|B8ZZD8|E7EUA7|E9PH61|F8WFE2|O75450|Q13343|Q8TE34|Q96F70|Q96T24|Q96T95|Q9NP33|Q9UE32	Splice_Site	DEL	ENST00000264052.5	37	CCDS2477.1																																																																																			.		0.468	SP100-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256914.2	NM_003113	Intron
LNP1	348801	broad.mit.edu	37	3	100148586	100148588	+	In_Frame_Del	DEL	GAT	GAT	-			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	GAT	GAT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr3:100148586_100148588delGAT	ENST00000383693.3	+	2	1293_1295	c.13_15delGAT	c.(13-15)gatdel	p.D10del	LNP1_ENST00000489752.1_In_Frame_Del_p.D10del	NM_001085451.1	NP_001078920.1	A1A4G5	LNP1_HUMAN	leukemia NUP98 fusion partner 1	10	Poly-Asp.									cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)	6						GGAGCACAAAGATGATGATGATG	0.507																																					p.5_5del													.	LNP1-22	0			c.13_15del						.																																			SO:0001651	inframe_deletion	348801	exon2			CACAAAGATGATG		CCDS43120.1	3q12.2	2014-05-12			ENSG00000206535	ENSG00000206535			28014	protein-coding gene	gene with protein product						16467868	Standard	NM_001085451		Approved	NP3	uc003dtx.4	A1A4G5	OTTHUMG00000159082	ENST00000383693.3:c.13_15delGAT	3.37:g.100148595_100148597delGAT	ENSP00000373191:p.Asp10del	659	0		830	8	NM_001085451	0	0	0	0	0	B7ZLT3	In_Frame_Del	DEL	ENST00000383693.3	37	CCDS43120.1																																																																																			.		0.507	LNP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353232.1		
DNAH8	1769	broad.mit.edu;bcgsc.ca	37	6	38843585	38843585	+	Frame_Shift_Del	DEL	G	G	-			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr6:38843585delG	ENST00000359357.3	+	51	7442	c.7188delG	c.(7186-7188)gagfs	p.E2396fs	DNAH8_ENST00000449981.2_Frame_Shift_Del_p.E2613fs|DNAH8_ENST00000441566.1_Frame_Shift_Del_p.E2360fs			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	2396					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						CCATGTATGAGTTTTATGTTA	0.338																																					p.E2613fs													.	DNAH8-615	0			c.7839delG						.						82.0	82.0	82.0					6																	38843585		2203	4300	6503	SO:0001589	frameshift_variant	1769	exon53			GTATGAGTTTTAT	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.7188delG	6.37:g.38843585delG	ENSP00000352312:p.Glu2396fs	67	0		48	7	NM_001206927	0	0	0	0	0	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Frame_Shift_Del	DEL	ENST00000359357.3	37																																																																																				.		0.338	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927	
TRAF5	7188	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	211545951	211545952	+	Frame_Shift_Ins	INS	-	-	C			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr1:211545951_211545952insC	ENST00000261464.5	+	11	1635_1636	c.1581_1582insC	c.(1582-1584)tctfs	p.S528fs	TRAF5_ENST00000367004.3_Frame_Shift_Ins_p.S528fs|TRAF5_ENST00000427925.2_Frame_Shift_Ins_p.S422fs|TRAF5_ENST00000336184.2_Frame_Shift_Ins_p.S528fs	NM_001033910.2	NP_001029082.1	O00463	TRAF5_HUMAN	TNF receptor-associated factor 5	528	Interaction with EIF2AK2/PKR.|MATH. {ECO:0000255|PROSITE- ProRule:PRU00129}.				apoptotic process (GO:0006915)|positive regulation of cell proliferation (GO:0008284)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	CD40 receptor complex (GO:0035631)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)	signal transducer activity (GO:0004871)|thioesterase binding (GO:0031996)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				OV - Ovarian serous cystadenocarcinoma(81;0.00946)|all cancers(67;0.0808)|Epithelial(68;0.144)		TTGTGGCTCATTCTGTTTTGGA	0.465																																					p.H527fs		.											.	TRAF5-661	0			c.1581_1582insC						.																																			SO:0001589	frameshift_variant	7188	exon11			.	AB000509	CCDS1497.1	1q32	2008-02-05			ENSG00000082512	ENSG00000082512		"""RING-type (C3HC4) zinc fingers"""	12035	protein-coding gene	gene with protein product		602356				9126477	Standard	NM_001033910		Approved	RNF84	uc001hii.3	O00463	OTTHUMG00000036997	Exception_encountered	1.37:g.211545951_211545952insC	ENSP00000261464:p.Ser528fs	118	0		118	20	NM_145759	0	0	0	0	0	B4DIS9|B4E0A2|Q6FHY1	Frame_Shift_Ins	INS	ENST00000261464.5	37	CCDS1497.1																																																																																			.		0.465	TRAF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089825.1	NM_004619	
TEKT1	83659	broad.mit.edu;bcgsc.ca	37	17	6718552	6718553	+	Frame_Shift_Ins	INS	-	-	A			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr17:6718552_6718553insA	ENST00000338694.2	-	5	687_688	c.558_559insT	c.(556-561)gatatcfs	p.I187fs	TEKT1_ENST00000535086.1_Frame_Shift_Ins_p.I41fs	NM_053285.1	NP_444515.1	Q969V4	TEKT1_HUMAN	tektin 1	187						cilium (GO:0005929)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)				NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)	20		Myeloproliferative disorder(207;0.0255)				GAGAAGCAGATATCATCTATGG	0.48																																					p.I187fs													.	TEKT1-92	0			c.559_560insT						.																																			SO:0001589	frameshift_variant	83659	exon5			AGCAGATATCATC		CCDS11083.1	17p13.2	2011-05-23			ENSG00000167858	ENSG00000167858			15534	protein-coding gene	gene with protein product		609002				11606253	Standard	NM_053285		Approved		uc002gdt.3	Q969V4	OTTHUMG00000102063	ENST00000338694.2:c.559dupT	17.37:g.6718553_6718553dupA	ENSP00000341346:p.Ile187fs	195	0		249	36	NM_053285	0	0	0	0	0	D3DTM7	Frame_Shift_Ins	INS	ENST00000338694.2	37	CCDS11083.1																																																																																			.		0.480	TEKT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219867.2	NM_053285	
CPNE9	151835	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	9758767	9758768	+	Frame_Shift_Ins	INS	-	-	T			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr3:9758767_9758768insT	ENST00000383832.3	+	15	1100_1101	c.910_911insT	c.(910-912)attfs	p.I304fs	CPNE9_ENST00000383831.3_Frame_Shift_Ins_p.I304fs	NM_153635.2	NP_705899.2	Q8IYJ1	CPNE9_HUMAN	copine family member IX	304	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(2)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	16	Medulloblastoma(99;0.227)					CACAGTAGCCATTGACTTCACG	0.45																																					.		.											.	CPNE9-70	0			.						.																																			SO:0001589	frameshift_variant	151835	.			.		CCDS2574.2	3p25.3	2008-10-30			ENSG00000144550	ENSG00000144550			24336	protein-coding gene	gene with protein product						9430674	Standard	XM_006712990		Approved	KIAA4217	uc003bsd.3	Q8IYJ1	OTTHUMG00000128418	ENST00000383832.3:c.912dupT	3.37:g.9758769_9758769dupT	ENSP00000373343:p.Ile304fs	95	0		102	21	.	0	0	0	0	0	A1L430|A6NDX6|A8MSP8	Targeted_Region	INS	ENST00000383832.3	37	CCDS2574.2																																																																																			.		0.450	CPNE9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250205.4	NM_001033755	
SLC22A13	9390	broad.mit.edu;bcgsc.ca	37	3	38307615	38307616	+	Frame_Shift_Ins	INS	-	-	C			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr3:38307615_38307616insC	ENST00000311856.4	+	1	313_314	c.264_265insC	c.(265-267)cccfs	p.P89fs	SLC22A13_ENST00000450935.2_Frame_Shift_Ins_p.P48fs	NM_004256.3	NP_004247.2	Q9Y226	S22AD_HUMAN	solute carrier family 22 (organic anion/urate transporter), member 13	89					nicotinate transport (GO:2001142)|organic cation transport (GO:0015695)|urate transport (GO:0015747)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	nicotinate transporter activity (GO:0090416)|organic cation transmembrane transporter activity (GO:0015101)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(7)|skin(1)|urinary_tract(1)	20				KIRC - Kidney renal clear cell carcinoma(284;0.0533)|Kidney(284;0.067)		TGTTCCGGCCACCCCCCGCCAA	0.589																																					p.P88fs													.	SLC22A13-91	0			c.264_265insC						.																																			SO:0001589	frameshift_variant	9390	exon1			CCGGCCACCCCCC	AB010438	CCDS2676.1	3p22.2	2013-07-18	2013-07-18	2003-10-15	ENSG00000172940	ENSG00000172940		"""Solute carriers"""	8494	protein-coding gene	gene with protein product		604047	"""organic cationic transporter-like 3"", ""solute carrier family 22 (organic anion transporter), member 13"""	ORCTL3		10072596, 18411268	Standard	NM_004256		Approved	OCTL1, OCTL3, OAT10	uc003chz.3	Q9Y226	OTTHUMG00000131086	ENST00000311856.4:c.270dupC	3.37:g.38307621_38307621dupC	ENSP00000310241:p.Pro89fs	66	0		48	7	NM_004256	0	0	0	0	0	B2RCV9|Q8IYG1	Frame_Shift_Ins	INS	ENST00000311856.4	37	CCDS2676.1																																																																																			.		0.589	SLC22A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253746.2	NM_004256	
