#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PRDM16	63976	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	3334451	3334451	+	Silent	SNP	C	C	T			TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr1:3334451C>T	ENST00000270722.5	+	11	2800	c.2751C>T	c.(2749-2751)gaC>gaT	p.D917D	PRDM16_ENST00000512462.1_3'UTR|PRDM16_ENST00000378391.2_Silent_p.D917D|PRDM16_ENST00000442529.2_Silent_p.D916D|PRDM16_ENST00000511072.1_Silent_p.D918D|PRDM16_ENST00000441472.2_Silent_p.D916D|PRDM16_ENST00000378398.3_Silent_p.D917D|PRDM16_ENST00000514189.1_Silent_p.D917D			Q9HAZ2	PRD16_HUMAN	PR domain containing 16	917	Interaction with CTBP1 and CTBP2. {ECO:0000250}.|Mediates interaction with SKI and regulation of TGF-beta signaling.				brown fat cell differentiation (GO:0050873)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neurogenesis (GO:0022008)|palate development (GO:0060021)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular respiration (GO:0043457)|somatic stem cell maintenance (GO:0035019)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)			breast(4)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(7)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(3)	59	all_cancers(77;0.00208)|all_epithelial(69;0.000732)|Ovarian(185;0.0634)|Lung NSC(156;0.109)|all_lung(157;0.111)	all_epithelial(116;2.03e-21)|all_lung(118;7.55e-09)|Lung NSC(185;1.28e-06)|Breast(487;0.000792)|Renal(390;0.00137)|Hepatocellular(190;0.00515)|Myeloproliferative disorder(586;0.0267)|Ovarian(437;0.0365)|Lung SC(97;0.114)|Medulloblastoma(700;0.134)		Epithelial(90;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.99e-20)|GBM - Glioblastoma multiforme(42;3.72e-11)|Colorectal(212;0.000425)|BRCA - Breast invasive adenocarcinoma(365;0.000946)|COAD - Colon adenocarcinoma(227;0.000968)|Kidney(185;0.00155)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0175)|Lung(427;0.137)		TGAAGGCGGACTCGGGCAGCT	0.602			T	EVI1	"""MDS, AML"""																																p.D917D		.		Dom	yes		1	1p36.23-p33	63976	PR domain containing 16		L	.	PRDM16-660	0			c.C2751T						.						97.0	108.0	104.0					1																	3334451		2039	4191	6230	SO:0001819	synonymous_variant	63976	exon11			GGCGGACTCGGGC	AF294278	CCDS41236.1, CCDS44048.1, CCDS41236.2, CCDS44048.2	1p36.23-p33	2013-01-08			ENSG00000142611	ENSG00000142611		"""Zinc fingers, C2H2-type"""	14000	protein-coding gene	gene with protein product	"""MDS1/EVI1-like"", ""PR-domain zinc finger protein 16"", ""transcription factor MEL1"""	605557				11050005	Standard	NM_199454		Approved	MEL1, PFM13, KIAA1675, MGC166915	uc001akf.3	Q9HAZ2	OTTHUMG00000000581	ENST00000270722.5:c.2751C>T	1.37:g.3334451C>T		178	0		311	80	NM_022114	0	0	0	0	0	A6NHQ8|B1AJP7|B1AJP8|B1AJP9|B1WB48|Q8WYJ9|Q9C0I8	Silent	SNP	ENST00000270722.5	37	CCDS41236.2																																																																																			.		0.602	PRDM16-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000001382.3	NM_022114	
PRAMEF16	654348	hgsc.bcm.edu	37	1	13497726	13497726	+	Silent	SNP	A	A	C			TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr1:13497726A>C	ENST00000376121.3	+	3	1053	c.1023A>C	c.(1021-1023)ggA>ggC	p.G341G		NM_001045480.1	NP_001038945.1	Q5VWM1	PRA16_HUMAN	PRAME family member 16	341					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)							Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		AGCCCCTTGGAGCTCTGCTAG	0.527																																					p.G341G		.											.	.	0			c.A1023C						.						75.0	55.0	62.0					1																	13497726		1972	3482	5454	SO:0001819	synonymous_variant	654348	exon3			CCTTGGAGCTCTG			1p36.21	2013-01-17			ENSG00000204488			"""-"""	25767	protein-coding gene	gene with protein product							Standard	NM_001045480		Approved	OTTHUMG00000002933	uc001aux.3	Q5VWM1	OTTHUMG00000002933	ENST00000376121.3:c.1023A>C	1.37:g.13497726A>C		48	1		48	4	NM_001045480	0	0	0	0	0		Silent	SNP	ENST00000376121.3	37	CCDS41259.1																																																																																			.		0.527	PRAMEF16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008178.1	NM_001045480	
TAS1R2	80834	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	19176018	19176018	+	Missense_Mutation	SNP	G	G	T			TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr1:19176018G>T	ENST00000375371.3	-	4	1305	c.1284C>A	c.(1282-1284)aaC>aaA	p.N428K	RP13-279N23.2_ENST00000494072.3_3'UTR	NM_152232.2	NP_689418.2	Q8TE23	TS1R2_HUMAN	taste receptor, type 1, member 2	428					detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|sensory perception of sweet taste (GO:0050916)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(10)|lung(14)|ovary(1)|pancreas(3)|prostate(1)|skin(3)|stomach(1)	45		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Aspartame(DB00168)	GGAGAGTGAAGTTGACCTTCC	0.552																																					p.N428K		.											.	TAS1R2-93	0			c.C1284A						.						64.0	59.0	61.0					1																	19176018		2203	4300	6503	SO:0001583	missense	80834	exon4			AGTGAAGTTGACC		CCDS187.1	1p36.13	2012-08-22	2003-03-07		ENSG00000179002	ENSG00000179002		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14905	protein-coding gene	gene with protein product		606226	"""G protein-coupled receptor 71"""	GPR71			Standard	NM_152232		Approved	T1R2, TR2	uc001bba.1	Q8TE23	OTTHUMG00000002442	ENST00000375371.3:c.1284C>A	1.37:g.19176018G>T	ENSP00000364520:p.Asn428Lys	79	0		121	30	NM_152232	0	0	0	0	0	Q5TZ19	Missense_Mutation	SNP	ENST00000375371.3	37	CCDS187.1	.	.	.	.	.	.	.	.	.	.	G	16.45	3.127587	0.56721	.	.	ENSG00000179002	ENST00000375371	D	0.86497	-2.13	5.16	2.1	0.27182	Extracellular ligand-binding receptor (1);	0.344112	0.24479	N	0.038174	D	0.87908	0.6296	L	0.48935	1.535	0.28764	N	0.900721	D	0.71674	0.998	D	0.66979	0.948	T	0.79815	-0.1644	10	0.52906	T	0.07	.	5.3671	0.16119	0.194:0.1632:0.6428:0.0	.	428	Q8TE23	TS1R2_HUMAN	K	428	ENSP00000364520:N428K	ENSP00000364520:N428K	N	-	3	2	TAS1R2	19048605	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	0.985000	0.29578	0.518000	0.28383	0.561000	0.74099	AAC	.		0.552	TAS1R2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000006953.1		
ALDH4A1	8659	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	19201049	19201049	+	Missense_Mutation	SNP	A	A	G			TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr1:19201049A>G	ENST00000375341.3	-	14	1744	c.1487T>C	c.(1486-1488)gTg>gCg	p.V496A	ALDH4A1_ENST00000538839.1_Missense_Mutation_p.V445A|RP13-279N23.2_ENST00000494072.3_3'UTR|ALDH4A1_ENST00000538309.1_Missense_Mutation_p.V436A|ALDH4A1_ENST00000290597.5_Missense_Mutation_p.V496A	NM_003748.3	NP_003739.2	P30038	AL4A1_HUMAN	aldehyde dehydrogenase 4 family, member A1	496					4-hydroxyproline catabolic process (GO:0019470)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate biosynthetic process (GO:0006537)|proline biosynthetic process (GO:0006561)|proline catabolic process (GO:0006562)|proline catabolic process to glutamate (GO:0010133)|proline metabolic process (GO:0006560)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	1-pyrroline-5-carboxylate dehydrogenase activity (GO:0003842)|aldehyde dehydrogenase (NAD) activity (GO:0004029)|electron carrier activity (GO:0009055)|identical protein binding (GO:0042802)			cervix(2)|endometrium(1)|large_intestine(3)|lung(8)|prostate(1)	15		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00479)|BRCA - Breast invasive adenocarcinoma(304;3.67e-05)|Kidney(64;0.000182)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		ATTCCTCAGCACCTTTGTGGC	0.617																																					p.V496A		.											.	ALDH4A1-226	0			c.T1487C						.						183.0	149.0	160.0					1																	19201049		2203	4300	6503	SO:0001583	missense	8659	exon14			CTCAGCACCTTTG	U24266	CCDS188.1, CCDS53272.1	1p36	2008-02-05			ENSG00000159423	ENSG00000159423	1.5.1.12	"""Aldehyde dehydrogenases"""	406	protein-coding gene	gene with protein product		606811		ALDH4		8621661	Standard	NM_003748		Approved	P5CDh	uc001bbc.3	P30038	OTTHUMG00000002443	ENST00000375341.3:c.1487T>C	1.37:g.19201049A>G	ENSP00000364490:p.Val496Ala	177	0		290	67	NM_003748	0	0	3	102	99	A8K1Q7|B4DGE4|D2D4A3|Q16882|Q53HU4|Q5JNV6|Q8IZ38|Q96IF0|Q9UDI6	Missense_Mutation	SNP	ENST00000375341.3	37	CCDS188.1	.	.	.	.	.	.	.	.	.	.	A	0.577	-0.838870	0.02692	.	.	ENSG00000159423	ENST00000290597;ENST00000375341;ENST00000538839;ENST00000538309	T;T;T;T	0.74632	-0.86;-0.86;1.68;-0.86	5.36	4.24	0.50183	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, C-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.644592	0.17853	N	0.159761	T	0.42471	0.1204	N	0.02697	-0.525	0.23113	N	0.998271	B	0.02656	0.0	B	0.06405	0.002	T	0.33574	-0.9863	10	0.07644	T	0.81	-25.7928	5.0242	0.14376	0.7201:0.1868:0.0931:0.0	.	496	P30038	AL4A1_HUMAN	A	496;496;445;436	ENSP00000290597:V496A;ENSP00000364490:V496A;ENSP00000446071:V445A;ENSP00000442988:V436A	ENSP00000290597:V496A	V	-	2	0	ALDH4A1	19073636	0.387000	0.25188	0.907000	0.35723	0.356000	0.29392	3.436000	0.52856	2.025000	0.59659	0.459000	0.35465	GTG	.		0.617	ALDH4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006954.1		
ARID1A	8289	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	27106580	27106580	+	Missense_Mutation	SNP	T	T	C			TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr1:27106580T>C	ENST00000324856.7	+	20	6562	c.6191T>C	c.(6190-6192)cTc>cCc	p.L2064P	ARID1A_ENST00000374152.2_Missense_Mutation_p.L1681P|ARID1A_ENST00000457599.2_Missense_Mutation_p.L1847P|ARID1A_ENST00000540690.1_Missense_Mutation_p.L392P	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	2064					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)		ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		TTGGTTACACTCGCCAACATC	0.557			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.L2064P		.		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	.	ARID1A-584	0			c.T6191C						.						136.0	137.0	137.0					1																	27106580		2203	4300	6503	SO:0001583	missense	8289	exon20			TTACACTCGCCAA	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.6191T>C	1.37:g.27106580T>C	ENSP00000320485:p.Leu2064Pro	194	0		238	58	NM_006015	0	0	10	17	7	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Missense_Mutation	SNP	ENST00000324856.7	37	CCDS285.1	.	.	.	.	.	.	.	.	.	.	T	19.26	3.793741	0.70452	.	.	ENSG00000117713	ENST00000324856;ENST00000457599;ENST00000374152;ENST00000540690	T;T;T;T	0.71698	0.88;0.88;0.88;-0.59	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	D	0.84447	0.5474	M	0.81239	2.535	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.997;0.999;0.999	D	0.86848	0.2021	10	0.87932	D	0	-10.1896	15.3414	0.74300	0.0:0.0:0.0:1.0	.	1681;2064;1847	O14497-3;O14497;O14497-2	.;ARI1A_HUMAN;.	P	2064;1847;1681;392	ENSP00000320485:L2064P;ENSP00000387636:L1847P;ENSP00000363267:L1681P;ENSP00000442437:L392P	ENSP00000320485:L2064P	L	+	2	0	ARID1A	26979167	1.000000	0.71417	0.585000	0.28666	0.975000	0.68041	7.676000	0.84012	2.273000	0.75805	0.482000	0.46254	CTC	.		0.557	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	
MAP7D1	55700	hgsc.bcm.edu	37	1	36642065	36642065	+	Silent	SNP	G	G	A	rs139644057	byFrequency	TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr1:36642065G>A	ENST00000373151.2	+	7	1332	c.1116G>A	c.(1114-1116)ccG>ccA	p.P372P	MAP7D1_ENST00000474796.1_3'UTR|MAP7D1_ENST00000373150.4_Silent_p.P340P|MAP7D1_ENST00000316156.4_Silent_p.P335P|MAP7D1_ENST00000373148.4_5'Flank	NM_018067.3	NP_060537.3	Q3KQU3	MA7D1_HUMAN	MAP7 domain containing 1	372					microtubule cytoskeleton organization (GO:0000226)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)				breast(2)|cervix(1)|endometrium(2)|large_intestine(3)|lung(3)|ovary(3)|prostate(3)|skin(1)|urinary_tract(1)	19		Myeloproliferative disorder(586;0.0393)				CCCTGACGCCGTGCAGCGTCA	0.801													G|||	234	0.0467252	0.0053	0.0533	5008	,	,		5421	0.1736		0.007	False		,,,				2504	0.0082				p.P372P		.											.	MAP7D1-138	0			c.G1116A						.	G		20,2340		0,20,1160	2.0	2.0	2.0		1116	-1.3	0.7	1	dbSNP_134	2	9,4939		0,9,2465	no	coding-synonymous	MAP7D1	NM_018067.3		0,29,3625	AA,AG,GG		0.1819,0.8475,0.3968		372/842	36642065	29,7279	1180	2474	3654	SO:0001819	synonymous_variant	55700	exon7			GACGCCGTGCAGC	AK096341	CCDS30673.1, CCDS65492.1, CCDS65493.1	1p34.3	2008-02-05	2007-02-08	2007-02-08	ENSG00000116871	ENSG00000116871			25514	protein-coding gene	gene with protein product			"""proline arginine rich coiled coil 1"", ""arginine/proline rich coiled-coil 1"""	PARCC1, RPRC1		10574461	Standard	XM_005271024		Approved	FLJ10350, FLJ39022	uc001bzz.3	Q3KQU3	OTTHUMG00000007714	ENST00000373151.2:c.1116G>A	1.37:g.36642065G>A		3	1		9	5	NM_018067	0	0	1	2	1	D3DPS4|Q7L8J5|Q8N905|Q8TAK0|Q9HBQ2|Q9NW29|Q9ULN3	Silent	SNP	ENST00000373151.2	37	CCDS30673.1																																																																																			G|0.952;A|0.048		0.801	MAP7D1-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382095.1	NM_018067	
HIVEP3	59269	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	42047804	42047804	+	Missense_Mutation	SNP	G	G	A			TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr1:42047804G>A	ENST00000372583.1	-	4	3550	c.2665C>T	c.(2665-2667)Cgc>Tgc	p.R889C	HIVEP3_ENST00000372584.1_Missense_Mutation_p.R889C|HIVEP3_ENST00000460604.1_5'Flank|HIVEP3_ENST00000247584.5_Missense_Mutation_p.R889C|HIVEP3_ENST00000429157.2_Missense_Mutation_p.R889C	NM_024503.4	NP_078779.2	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer binding protein 3	889	No DNA binding activity or transactivation activity, but complete prevention of TRAF-dependent NF-Kappa-B activation; associates with TRAF2 and JUN. {ECO:0000250}.				positive regulation of transcription, DNA-templated (GO:0045893)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R889C(1)		NS(2)|breast(3)|central_nervous_system(5)|endometrium(13)|kidney(3)|large_intestine(13)|lung(33)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	85	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				GTCTGGCTGCGCTGGGGCCAT	0.597																																					p.R889C		.											.	HIVEP3-157	1	Substitution - Missense(1)	large_intestine(1)	c.C2665T						.						54.0	63.0	60.0					1																	42047804		2203	4300	6503	SO:0001583	missense	59269	exon4			GGCTGCGCTGGGG	AF278765	CCDS463.1, CCDS44124.1	1p34	2013-01-08	2001-11-28		ENSG00000127124	ENSG00000127124		"""Zinc fingers, C2H2-type"""	13561	protein-coding gene	gene with protein product	"""kappabinding protein-1"""	606649	"""human immunodeficiency virus type I enhancer-binding protein 3"""			11161801	Standard	NR_038260		Approved	KRC, KBP1, KBP-1, SHN3, FLJ16752, KIAA1555, ZAS3, Schnurri-3, ZNF40C	uc001cha.4	Q5T1R4	OTTHUMG00000006361	ENST00000372583.1:c.2665C>T	1.37:g.42047804G>A	ENSP00000361664:p.Arg889Cys	159	0		299	70	NM_024503	0	0	1	1	0	A7YY91|Q5T1R5|Q9BZS0|Q9HCL7	Missense_Mutation	SNP	ENST00000372583.1	37	CCDS463.1	.	.	.	.	.	.	.	.	.	.	G	18.70	3.679130	0.68042	.	.	ENSG00000127124	ENST00000372584;ENST00000372583;ENST00000247584;ENST00000429157	T;T;T;T	0.61859	0.07;0.07;0.07;0.07	4.95	4.95	0.65309	.	0.000000	0.53938	D	0.000060	T	0.73466	0.3590	M	0.76727	2.345	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	T	0.76107	-0.3080	10	0.87932	D	0	2.8066	11.1037	0.48190	0.0:0.0:0.6936:0.3063	.	889;889	Q5T1R4-2;Q5T1R4	.;ZEP3_HUMAN	C	889	ENSP00000361665:R889C;ENSP00000361664:R889C;ENSP00000247584:R889C;ENSP00000410828:R889C	ENSP00000247584:R889C	R	-	1	0	HIVEP3	41820391	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	5.841000	0.69409	2.562000	0.86427	0.462000	0.41574	CGC	.		0.597	HIVEP3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000016978.1	NM_024503	
YBX1	4904	hgsc.bcm.edu	37	1	43166460	43166460	+	Missense_Mutation	SNP	C	C	T			TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr1:43166460C>T	ENST00000321358.7	+	7	888	c.749C>T	c.(748-750)cCt>cTt	p.P250L		NM_004559.3	NP_004550.2	P67809	YBOX1_HUMAN	Y box binding protein 1	250					CRD-mediated mRNA stabilization (GO:0070934)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of striated muscle cell differentiation (GO:0051154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell division (GO:0051781)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|extracellular vesicular exosome (GO:0070062)|histone pre-mRNA 3'end processing complex (GO:0071204)|intracellular membrane-bounded organelle (GO:0043231)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|U12-type spliceosomal complex (GO:0005689)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)			large_intestine(2)|lung(4)|ovary(4)|prostate(4)|upper_aerodigestive_tract(2)	16	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				AGGGGCCCTCCTCGCCAAAGA	0.498																																					p.P250L		.											.	YBX1-95	0			c.C749T						.						28.0	25.0	26.0					1																	43166460		2203	4300	6503	SO:0001583	missense	4904	exon7			GCCCTCCTCGCCA	BC013838	CCDS470.1	1p34	2008-02-05	2005-08-11	2005-08-11	ENSG00000065978	ENSG00000065978			8014	protein-coding gene	gene with protein product		154030	"""nuclease sensitive element binding protein 1"""	NSEP1		1891370, 3174636	Standard	NM_004559		Approved	YB-1, YB1, DBPB, NSEP-1, MDR-NF1, BP-8, CSDB, CSDA2	uc001chs.3	P67809	OTTHUMG00000007523	ENST00000321358.7:c.749C>T	1.37:g.43166460C>T	ENSP00000361626:p.Pro250Leu	30	1		82	6	NM_004559	0	0	2	2	0	P16990|P16991|Q14972|Q15325|Q5FVF0	Missense_Mutation	SNP	ENST00000321358.7	37	CCDS470.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.49|17.49	3.403460|3.403460	0.62288|0.62288	.|.	.|.	ENSG00000065978|ENSG00000065978	ENST00000318612;ENST00000436427|ENST00000321358	.|T	.|0.36340	.|1.26	5.35|5.35	5.35|5.35	0.76521|0.76521	.|.	.|0.148105	.|0.64402	.|D	.|0.000006	T|T	0.41050|0.41050	0.1142|0.1142	M|M	0.65975|0.65975	2.015|2.015	0.80722|0.80722	D|D	1|1	.|B	.|0.29862	.|0.259	.|B	.|0.30179	.|0.112	T|T	0.36817|0.36817	-0.9732|-0.9732	6|10	0.30078|0.56958	T|D	0.28|0.05	-2.6639|-2.6639	16.6288|16.6288	0.85011|0.85011	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|250	.|P67809	.|YBOX1_HUMAN	F|L	241;300|250	.|ENSP00000361626:P250L	ENSP00000361621:L241F|ENSP00000361626:P250L	L|P	+|+	1|2	0|0	YBX1|YBX1	42939047|42939047	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	7.152000|7.152000	0.77419|0.77419	2.501000|2.501000	0.84356|0.84356	0.552000|0.552000	0.68991|0.68991	CTC|CCT	.		0.498	YBX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019786.2	NM_004559	
FNBP1L	54874	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	94009756	94009756	+	Silent	SNP	G	G	A			TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr1:94009756G>A	ENST00000271234.7	+	12	1408	c.1257G>A	c.(1255-1257)caG>caA	p.Q419Q	FNBP1L_ENST00000370253.2_Silent_p.Q361Q|FNBP1L_ENST00000604705.1_Silent_p.Q419Q|FNBP1L_ENST00000260506.8_Silent_p.Q361Q|FNBP1L_ENST00000370256.4_Silent_p.Q414Q	NM_001164473.2	NP_001157945.1	Q5T0N5	FBP1L_HUMAN	formin binding protein 1-like	419	Interaction with CDC42.				autophagy (GO:0006914)|clathrin-mediated endocytosis (GO:0072583)|membrane budding (GO:0006900)|membrane invagination (GO:0010324)|membrane tubulation (GO:0097320)|positive regulation of filopodium assembly (GO:0051491)|vesicle organization (GO:0016050)|vesicle transport along actin filament (GO:0030050)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)			breast(2)|kidney(2)|large_intestine(4)|lung(2)|urinary_tract(1)	11		all_lung(203;0.00206)|Lung NSC(277;0.00902)|Melanoma(281;0.155)		all cancers(265;0.00666)|GBM - Glioblastoma multiforme(16;0.0378)|Epithelial(280;0.111)		GAGAACTACAGAAAGAATCAG	0.373																																					p.Q419Q		.											.	FNBP1L-227	0			c.G1257A						.						71.0	67.0	68.0					1																	94009756		1827	4080	5907	SO:0001819	synonymous_variant	54874	exon12			ACTACAGAAAGAA		CCDS53343.1, CCDS53344.1, CCDS60192.1	1p22.1	2008-02-05	2004-11-16	2004-11-17	ENSG00000137942	ENSG00000137942			20851	protein-coding gene	gene with protein product		608848	"""chromosome 1 open reading frame 39"""	C1orf39		14654988	Standard	NM_017737		Approved	TOCA1, FLJ20275	uc010otk.2	Q5T0N5	OTTHUMG00000010863	ENST00000271234.7:c.1257G>A	1.37:g.94009756G>A		58	0		59	17	NM_001164473	0	0	20	39	19	J3QSS4|Q5T0N6|Q6B097|Q6P653|Q6R4Q4|Q9NXG1	Silent	SNP	ENST00000271234.7	37	CCDS53343.1																																																																																			.		0.373	FNBP1L-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_017737	
KCNC4	3749	bcgsc.ca	37	1	110754159	110754159	+	Missense_Mutation	SNP	G	G	A			TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr1:110754159G>A	ENST00000369787.3	+	1	65	c.38G>A	c.(37-39)cGc>cAc	p.R13H	KCNC4_ENST00000413138.3_Missense_Mutation_p.R13H|KCNC4_ENST00000438661.2_Missense_Mutation_p.R13H|KCNC4-AS1_ENST00000455967.1_RNA	NM_004978.4	NP_004969.2	Q03721	KCNC4_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 4	13	Inactivation gate.				potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of neurotransmitter secretion (GO:0046928)|synaptic transmission (GO:0007268)	axon terminus (GO:0043679)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|liver(2)|lung(11)|ovary(1)|skin(2)	32		all_cancers(81;9.88e-06)|all_epithelial(167;3.23e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0238)|all cancers(265;0.0693)|Epithelial(280;0.0748)|Colorectal(144;0.112)|LUSC - Lung squamous cell carcinoma(189;0.135)		TACCGCGGGCGCAAGTCGGGG	0.637																																					p.R13H													.	KCNC4-154	0			c.G38A						.						42.0	44.0	43.0					1																	110754159		2202	4300	6502	SO:0001583	missense	3749	exon1			GCGGGCGCAAGTC	BC101769	CCDS821.1, CCDS44193.1	1p21	2012-07-05			ENSG00000116396	ENSG00000116396		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6236	protein-coding gene	gene with protein product		176265	"""chromosome 1 open reading frame 30"""	C1orf30		1920536, 1740329, 16382104	Standard	NM_004978		Approved	Kv3.4, HKSHIIIC	uc001dzh.3	Q03721	OTTHUMG00000011037	ENST00000369787.3:c.38G>A	1.37:g.110754159G>A	ENSP00000358802:p.Arg13His	45	0		108	5	NM_001039574	0	0	7	7	0	Q3MIM4|Q5TBI6	Missense_Mutation	SNP	ENST00000369787.3	37	CCDS821.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.441799	0.83993	.	.	ENSG00000116396	ENST00000369787;ENST00000413138;ENST00000438661	D;D;D	0.97710	-4.5;-4.49;-4.5	3.53	3.53	0.40419	Potassium channel, voltage dependent, Kv3, inactivation domain (1);	.	.	.	.	D	0.95661	0.8589	N	0.08118	0	0.58432	D	0.999995	D;D;D	0.76494	0.988;0.986;0.999	P;B;D	0.80764	0.611;0.36;0.994	D	0.97118	0.9809	9	0.62326	D	0.03	.	14.8461	0.70261	0.0:0.0:1.0:0.0	.	13;13;13	Q03721;Q03721-3;Q03721-2	KCNC4_HUMAN;.;.	H	13	ENSP00000358802:R13H;ENSP00000388029:R13H;ENSP00000393655:R13H	ENSP00000358802:R13H	R	+	2	0	KCNC4	110555682	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.313000	0.78978	1.812000	0.52913	0.462000	0.41574	CGC	.		0.637	KCNC4-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052146.2	NM_001039574	
FLG	2312	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	152277075	152277075	+	Missense_Mutation	SNP	C	C	A			TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr1:152277075C>A	ENST00000368799.1	-	3	10322	c.10287G>T	c.(10285-10287)gaG>gaT	p.E3429D	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	3429	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGTCCTGACCCTCTTGGGACG	0.612									Ichthyosis																												p.E3429D		.											.	FLG-106	0			c.G10287T						.						245.0	252.0	250.0					1																	152277075		2203	4299	6502	SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	CTGACCCTCTTGG	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.10287G>T	1.37:g.152277075C>A	ENSP00000357789:p.Glu3429Asp	584	1		1349	247	NM_002016	0	0	2	2	0	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	C	13.64	2.296547	0.40594	.	.	ENSG00000143631	ENST00000368799	T	0.01705	4.68	4.17	-5.64	0.02466	.	.	.	.	.	T	0.00754	0.0025	L	0.41824	1.3	0.09310	N	1	P	0.44478	0.836	P	0.54499	0.754	T	0.31943	-0.9925	9	0.20046	T	0.44	.	0.6472	0.00820	0.3782:0.2562:0.1242:0.2414	.	3429	P20930	FILA_HUMAN	D	3429	ENSP00000357789:E3429D	ENSP00000357789:E3429D	E	-	3	2	FLG	150543699	0.000000	0.05858	0.000000	0.03702	0.031000	0.12232	-6.083000	0.00082	-1.572000	0.01661	0.454000	0.30748	GAG	.		0.612	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
CEP350	9857	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	180047678	180047678	+	Missense_Mutation	SNP	A	A	T			TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr1:180047678A>T	ENST00000367607.3	+	29	6266	c.5848A>T	c.(5848-5850)Agc>Tgc	p.S1950C		NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	1950					microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						AGAATTAGGCAGCCCTGCTGT	0.433																																					p.S1950C		.											.	CEP350-26	0			c.A5848T						.						65.0	63.0	63.0					1																	180047678		2203	4300	6503	SO:0001583	missense	9857	exon29			TTAGGCAGCCCTG	AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.5848A>T	1.37:g.180047678A>T	ENSP00000356579:p.Ser1950Cys	44	0		55	10	NM_014810	0	0	2	2	0	O75068|Q8TDK3|Q8WY20	Missense_Mutation	SNP	ENST00000367607.3	37	CCDS1336.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	21.0|21.0	4.087658|4.087658	0.76642|0.76642	.|.	.|.	ENSG00000135837|ENSG00000135837	ENST00000429851|ENST00000367607	.|T	.|0.57907	.|0.37	5.31|5.31	5.31|5.31	0.75309|0.75309	.|.	.|0.000000	.|0.53938	.|D	.|0.000045	T|T	0.70254|0.70254	0.3203|0.3203	M|M	0.71581|0.71581	2.175|2.175	0.49299|0.49299	D|D	0.999774|0.999774	.|D;D	.|0.76494	.|0.999;0.999	.|D;D	.|0.79784	.|0.993;0.988	T|T	0.71573|0.71573	-0.4552|-0.4552	5|9	.|.	.|.	.|.	.|.	14.1282|14.1282	0.65235|0.65235	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|1950;1950	.|E7EU22;Q5VT06	.|.;CE350_HUMAN	L|C	124|1950	.|ENSP00000356579:S1950C	.|.	Q|S	+|+	2|1	0|0	CEP350|CEP350	178314301|178314301	1.000000|1.000000	0.71417|0.71417	0.993000|0.993000	0.49108|0.49108	0.777000|0.777000	0.43975|0.43975	4.336000|4.336000	0.59304|0.59304	2.140000|2.140000	0.66376|0.66376	0.482000|0.482000	0.46254|0.46254	CAG|AGC	.		0.433	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085315.2	NM_014810	
DHX9	1660	broad.mit.edu	37	1	182812436	182812436	+	Missense_Mutation	SNP	T	T	G			TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr1:182812436T>G	ENST00000367549.3	+	3	229	c.119T>G	c.(118-120)gTg>gGg	p.V40G		NM_001357.4	NP_001348.2	Q08211	DHX9_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 9	40	DRBM 1. {ECO:0000255|PROSITE- ProRule:PRU00266}.|Interaction with CREBBP.				ATP catabolic process (GO:0006200)|cellular response to heat (GO:0034605)|circadian rhythm (GO:0007623)|CRD-mediated mRNA stabilization (GO:0070934)|DNA duplex unwinding (GO:0032508)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|positive regulation of type I interferon production (GO:0032481)|RNA splicing (GO:0008380)	centrosome (GO:0005813)|CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)|RNA polymerase II transcription factor binding (GO:0001085)	p.V40G(8)		NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(10)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	49						AAGGTTCAGGTGGAAGGTTAT	0.333																																					p.V40G	Colon(69;210 1162 3697 13559 39565)												.	DHX9-92	8	Substitution - Missense(8)	lung(5)|endometrium(1)|kidney(1)|central_nervous_system(1)	c.T119G						.						54.0	51.0	52.0					1																	182812436		1803	4059	5862	SO:0001583	missense	1660	exon3			TTCAGGTGGAAGG	L13848	CCDS41444.1	1q25	2013-05-13	2013-05-13	2003-06-20	ENSG00000135829	ENSG00000135829		"""DEAH-boxes"""	2750	protein-coding gene	gene with protein product	"""NDH II"", ""RNA helicase A"""	603115	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 9 (RNA helicase A, nuclear DNA helicase II; leukophysin)"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 9"""	LKP, DDX9		8344961, 9111062	Standard	NM_001357		Approved	RHA	uc001gpr.3	Q08211	OTTHUMG00000035337	ENST00000367549.3:c.119T>G	1.37:g.182812436T>G	ENSP00000356520:p.Val40Gly	25	2		53	11	NM_001357	0	0	0	0	0	B2RNV4|Q05CI5|Q12803|Q32Q22|Q5VY62|Q6PD69|Q99556	Missense_Mutation	SNP	ENST00000367549.3	37	CCDS41444.1	.	.	.	.	.	.	.	.	.	.	T	22.5	4.303744	0.81136	.	.	ENSG00000135829	ENST00000399175;ENST00000367549	D	0.81996	-1.56	5.63	5.63	0.86233	Double-stranded RNA-binding (3);Double-stranded RNA-binding-like (1);	0.000000	0.85682	D	0.000000	D	0.93255	0.7851	M	0.94142	3.5	0.80722	D	1	D	0.67145	0.996	D	0.70716	0.97	D	0.94934	0.8085	10	0.87932	D	0	.	15.1117	0.72362	0.0:0.0:0.0:1.0	.	40	Q08211	DHX9_HUMAN	G	40	ENSP00000356520:V40G	ENSP00000356520:V40G	V	+	2	0	DHX9	181079059	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	7.285000	0.78660	2.263000	0.75096	0.533000	0.62120	GTG	.		0.333	DHX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085522.2	NM_030588	
RYR2	6262	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	237617770	237617770	+	Missense_Mutation	SNP	G	G	T			TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr1:237617770G>T	ENST00000366574.2	+	15	1689	c.1372G>T	c.(1372-1374)Gat>Tat	p.D458Y	RYR2_ENST00000360064.6_Missense_Mutation_p.D456Y|RYR2_ENST00000542537.1_Missense_Mutation_p.D442Y	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	458					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AAGTCTGCAGGATCTCATTGG	0.463																																					p.D458Y		.											.	RYR2-158	0			c.G1372T						.						84.0	82.0	82.0					1																	237617770		1919	4125	6044	SO:0001583	missense	6262	exon15			CTGCAGGATCTCA	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.1372G>T	1.37:g.237617770G>T	ENSP00000355533:p.Asp458Tyr	70	0		104	22	NM_001035	0	0	0	0	0	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	G	17.49	3.403612	0.62288	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.91180	-2.8;-2.8;-2.8	5.8	5.8	0.92144	Intracellular calcium-release channel (1);	0.000000	0.64402	U	0.000006	D	0.96131	0.8739	M	0.87180	2.865	0.80722	D	1	D	0.76494	0.999	D	0.72982	0.979	D	0.96166	0.9119	10	0.87932	D	0	.	20.0679	0.97707	0.0:0.0:1.0:0.0	.	458	Q92736	RYR2_HUMAN	Y	458;456;442	ENSP00000355533:D458Y;ENSP00000353174:D456Y;ENSP00000443798:D442Y	ENSP00000353174:D456Y	D	+	1	0	RYR2	235684393	1.000000	0.71417	1.000000	0.80357	0.023000	0.10783	9.804000	0.99143	2.747000	0.94245	0.551000	0.68910	GAT	.		0.463	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
OR2L3	391192	hgsc.bcm.edu	37	1	248224850	248224850	+	Nonsense_Mutation	SNP	T	T	A			TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr1:248224850T>A	ENST00000359959.3	+	1	867	c.867T>A	c.(865-867)taT>taA	p.Y289*	OR2L13_ENST00000366478.2_Intron	NM_001004687.1	NP_001004687.1	Q8NG85	OR2L3_HUMAN	olfactory receptor, family 2, subfamily L, member 3	289						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(2)|large_intestine(7)|lung(28)|prostate(1)|skin(1)|urinary_tract(1)	41	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			CCATCATCTATAGCCTGAGGA	0.498																																					p.Y289X		.											.	OR2L3-68	0			c.T867A						.						66.0	66.0	66.0					1																	248224850		2203	4300	6503	SO:0001587	stop_gained	391192	exon1			CATCTATAGCCTG	AB065950	CCDS31104.1	1q44	2012-08-09			ENSG00000198128	ENSG00000198128		"""GPCR / Class A : Olfactory receptors"""	15009	protein-coding gene	gene with protein product							Standard	NM_001004687		Approved		uc001idx.1	Q8NG85	OTTHUMG00000040195	ENST00000359959.3:c.867T>A	1.37:g.248224850T>A	ENSP00000353044:p.Tyr289*	130	2		277	20	NM_001004687	0	0	0	0	0	B9EH44	Nonsense_Mutation	SNP	ENST00000359959.3	37	CCDS31104.1	.	.	.	.	.	.	.	.	.	.	T	12.03	1.815659	0.32145	.	.	ENSG00000198128	ENST00000359959	.	.	.	2.01	-0.163	0.13363	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.7163	0.23304	0.0:0.6214:0.0:0.3786	.	.	.	.	X	289	.	ENSP00000353044:Y289X	Y	+	3	2	OR2L3	246291473	0.000000	0.05858	0.943000	0.38184	0.320000	0.28249	-1.628000	0.02031	-0.181000	0.10619	-0.404000	0.06349	TAT	.		0.498	OR2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096852.1	NM_001004687	
OR2L3	391192	hgsc.bcm.edu	37	1	248224864	248224864	+	Missense_Mutation	SNP	A	A	G	rs543066146		TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr1:248224864A>G	ENST00000359959.3	+	1	881	c.881A>G	c.(880-882)aAg>aGg	p.K294R	OR2L13_ENST00000366478.2_Intron	NM_001004687.1	NP_001004687.1	Q8NG85	OR2L3_HUMAN	olfactory receptor, family 2, subfamily L, member 3	294						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(2)|large_intestine(7)|lung(28)|prostate(1)|skin(1)|urinary_tract(1)	41	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			CTGAGGAACAAGGAGGTGATG	0.502													a|||	1	0.000199681	0.0	0.0	5008	,	,		18589	0.001		0.0	False		,,,				2504	0.0				p.K294R		.											.	OR2L3-68	0			c.A881G						.						56.0	57.0	57.0					1																	248224864		2203	4300	6503	SO:0001583	missense	391192	exon1			GGAACAAGGAGGT	AB065950	CCDS31104.1	1q44	2012-08-09			ENSG00000198128	ENSG00000198128		"""GPCR / Class A : Olfactory receptors"""	15009	protein-coding gene	gene with protein product							Standard	NM_001004687		Approved		uc001idx.1	Q8NG85	OTTHUMG00000040195	ENST00000359959.3:c.881A>G	1.37:g.248224864A>G	ENSP00000353044:p.Lys294Arg	121	2		251	16	NM_001004687	0	0	0	0	0	B9EH44	Missense_Mutation	SNP	ENST00000359959.3	37	CCDS31104.1	.	.	.	.	.	.	.	.	.	.	A	9.463	1.093601	0.20471	.	.	ENSG00000198128	ENST00000359959	T	0.41065	1.01	2.01	-0.867	0.10655	.	.	.	.	.	T	0.36054	0.0953	M	0.63169	1.94	0.23762	N	0.996914	B	0.21821	0.061	B	0.23852	0.049	T	0.32348	-0.9910	9	0.37606	T	0.19	.	6.329	0.21259	0.7597:0.0:0.2403:0.0	.	294	Q8NG85	OR2L3_HUMAN	R	294	ENSP00000353044:K294R	ENSP00000353044:K294R	K	+	2	0	OR2L3	246291487	0.000000	0.05858	0.908000	0.35775	0.606000	0.37113	0.414000	0.21164	-0.373000	0.07979	-0.475000	0.04921	AAG	.		0.502	OR2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096852.1	NM_001004687	
ST8SIA6	338596	hgsc.bcm.edu;broad.mit.edu	37	10	17495608	17495608	+	Silent	SNP	C	C	T			TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr10:17495608C>T	ENST00000377602.4	-	2	224	c.150G>A	c.(148-150)gcG>gcA	p.A50A		NM_001004470.1	NP_001004470.1	P61647	SIA8F_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 6	50					carbohydrate biosynthetic process (GO:0016051)|cellular protein metabolic process (GO:0044267)|ganglioside biosynthetic process (GO:0001574)|glycolipid biosynthetic process (GO:0009247)|glycoprotein metabolic process (GO:0009100)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|protein O-linked glycosylation (GO:0006493)|sialylation (GO:0097503)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	sialyltransferase activity (GO:0008373)			endometrium(3)|kidney(3)|large_intestine(4)|liver(1)|lung(24)|ovary(1)|skin(1)	37						GCGTCCTCAGCGCTGCGGGGG	0.706																																					p.A50A		.											.	ST8SIA6-91	0			c.G150A						.						8.0	10.0	9.0					10																	17495608		2170	4271	6441	SO:0001819	synonymous_variant	338596	exon2			CCTCAGCGCTGCG		CCDS31158.1	10p13	2013-03-01	2005-02-07	2005-02-07	ENSG00000148488	ENSG00000148488		"""Sialyltransferases"""	23317	protein-coding gene	gene with protein product	"""ST8Sia VI"""	610139	"""sialyltransferase 8F (alpha-2, 8-sialyltransferase)"""	SIAT8F		11980897	Standard	XR_242697		Approved		uc001ipd.3	P61647	OTTHUMG00000017748	ENST00000377602.4:c.150G>A	10.37:g.17495608C>T		17	0		25	9	NM_001004470	0	0	0	0	0	B0YJ97|B9EH72|Q5VZH4	Silent	SNP	ENST00000377602.4	37	CCDS31158.1																																																																																			.		0.706	ST8SIA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047036.1	NM_001004470	
DMBT1	1755	hgsc.bcm.edu	37	10	124361509	124361509	+	Silent	SNP	T	T	C	rs547823770	byFrequency	TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr10:124361509T>C	ENST00000338354.3	+	29	3646	c.3540T>C	c.(3538-3540)ggT>ggC	p.G1180G	DMBT1_ENST00000344338.3_Silent_p.G1170G|DMBT1_ENST00000359586.6_Intron|DMBT1_ENST00000368955.3_Silent_p.G1170G|DMBT1_ENST00000330163.4_Silent_p.G681G|DMBT1_ENST00000368909.3_Silent_p.G1180G|DMBT1_ENST00000368956.2_Silent_p.G681G			Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1	1180	SRCR 9. {ECO:0000255|PROSITE- ProRule:PRU00196}.				defense response to virus (GO:0051607)|epithelial cell differentiation (GO:0030855)|induction of bacterial agglutination (GO:0043152)|innate immune response (GO:0045087)|inner cell mass cell proliferation (GO:0001833)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of epithelial cell differentiation (GO:0030858)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|phagocytic vesicle membrane (GO:0030670)|proteinaceous extracellular matrix (GO:0005578)|zymogen granule membrane (GO:0042589)	calcium-dependent protein binding (GO:0048306)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|zymogen binding (GO:0035375)			breast(2)|central_nervous_system(7)|cervix(3)|endometrium(8)|kidney(1)|large_intestine(1)|lung(46)|prostate(1)|urinary_tract(3)	72		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				TTGGCCAGGGTTCAGGACCCA	0.587													C|||	130	0.0259585	0.0378	0.0086	5008	,	,		10270	0.0635		0.001	False		,,,				2504	0.0092				p.G1180G	Ovarian(182;93 2026 18125 22222 38972)	.											.	DMBT1-494	0			c.T3540C						.						10.0	15.0	14.0					10																	124361509		507	2121	2628	SO:0001819	synonymous_variant	1755	exon29			CCAGGGTTCAGGA		CCDS44490.1, CCDS44491.1, CCDS44492.1	10q25.3-q26.1	2008-08-01			ENSG00000187908	ENSG00000187908			2926	protein-coding gene	gene with protein product		601969				9288095, 17548659	Standard	NM_004406		Approved	GP340, muclin	uc001lgk.1	Q9UGM3	OTTHUMG00000019185	ENST00000338354.3:c.3540T>C	10.37:g.124361509T>C		29	1		35	9	NM_007329	0	0	0	0	0	A6NDG4|A6NDJ5|A8E4R5|B1ARE7|B1ARE8|B1ARE9|B1ARF0|B7Z8Y2|F8WEF7|Q59EX0|Q5JR26|Q6MZN4|Q96DU4|Q9UGM2|Q9UJ57|Q9UKJ4|Q9Y211|Q9Y4V9	Silent	SNP	ENST00000338354.3	37																																																																																				.		0.587	DMBT1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050792.2	NM_004406	
MKI67	4288	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	129910454	129910454	+	Missense_Mutation	SNP	T	T	G			TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr10:129910454T>G	ENST00000368654.3	-	9	2287	c.1912A>C	c.(1912-1914)Att>Ctt	p.I638L	MKI67_ENST00000368653.3_Missense_Mutation_p.I278L|MKI67_ENST00000484853.1_5'UTR	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	638					cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				ATCTGTAAAATATCATGTTGA	0.398																																					p.I638L		.											.	MKI67-519	0			c.A1912C						.						96.0	89.0	91.0					10																	129910454		2203	4300	6503	SO:0001583	missense	4288	exon9			GTAAAATATCATG	X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.1912A>C	10.37:g.129910454T>G	ENSP00000357643:p.Ile638Leu	152	0		175	39	NM_002417	0	0	4	6	2	Q5VWH2	Missense_Mutation	SNP	ENST00000368654.3	37	CCDS7659.1	.	.	.	.	.	.	.	.	.	.	T	15.38	2.815996	0.50527	.	.	ENSG00000148773	ENST00000368654;ENST00000368653;ENST00000537609;ENST00000368652	T;T	0.01369	5.0;4.97	4.47	2.03	0.26663	.	0.382408	0.22081	N	0.064888	T	0.01765	0.0056	M	0.63428	1.95	0.09310	N	1	B;B;B	0.32573	0.376;0.376;0.259	B;B;B	0.36418	0.224;0.224;0.112	T	0.42137	-0.9469	10	0.35671	T	0.21	.	0.8729	0.01218	0.167:0.161:0.1731:0.4989	.	637;278;638	F5H4V4;P46013-2;P46013	.;.;KI67_HUMAN	L	638;278;637;213	ENSP00000357643:I638L;ENSP00000357642:I278L	ENSP00000357641:I213L	I	-	1	0	MKI67	129800444	0.000000	0.05858	0.002000	0.10522	0.491000	0.33493	-0.129000	0.10515	0.725000	0.32318	0.533000	0.62120	ATT	.		0.398	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050999.1	NM_002417	
INCENP	3619	hgsc.bcm.edu	37	11	61914245	61914245	+	Missense_Mutation	SNP	G	G	A	rs570082372	byFrequency	TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr11:61914245G>A	ENST00000394818.3	+	15	2277	c.2075G>A	c.(2074-2076)cGg>cAg	p.R692Q	INCENP_ENST00000278849.4_Missense_Mutation_p.R688Q	NM_001040694.1	NP_001035784.1	Q9NQS7	INCE_HUMAN	inner centromere protein antigens 135/155kDa	692					chromosome segregation (GO:0007059)|cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	central element (GO:0000801)|chromocenter (GO:0010369)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lateral element (GO:0000800)|microtubule (GO:0005874)|midbody (GO:0030496)|pericentric heterochromatin (GO:0005721)|protein complex (GO:0043234)|spindle (GO:0005819)				breast(1)|endometrium(1)|kidney(6)|large_intestine(2)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19						gagcaggagcggcgggagcag	0.721													G|||	6	0.00119808	0.0008	0.0014	5008	,	,		11645	0.003		0.0	False		,,,				2504	0.001				p.R692Q		.											.	INCENP-227	0			c.G2075A						.						5.0	6.0	6.0					11																	61914245		1771	3489	5260	SO:0001583	missense	3619	exon15			AGGAGCGGCGGGA	AF282265	CCDS31582.1, CCDS44624.1	11q12.3	2013-01-17	2002-08-29		ENSG00000149503	ENSG00000149503			6058	protein-coding gene	gene with protein product		604411	"""inner centromere protein antigens (135kD, 155kD)"""			1860899, 11453556	Standard	NM_001040694		Approved	FLJ31633	uc001nsw.1	Q9NQS7	OTTHUMG00000167470	ENST00000394818.3:c.2075G>A	11.37:g.61914245G>A	ENSP00000378295:p.Arg692Gln	4	1		6	3	NM_001040694	0	0	1	1	0	A8MQD2|Q5Y192	Missense_Mutation	SNP	ENST00000394818.3	37	CCDS44624.1	.	.	.	.	.	.	.	.	.	.	G	8.011	0.757448	0.15846	.	.	ENSG00000149503	ENST00000394818;ENST00000278849	T;T	0.15487	2.42;2.43	2.39	2.39	0.29439	.	0.179764	0.25894	N	0.027616	T	0.31231	0.0790	M	0.63843	1.955	0.32643	N	0.520424	D;D;D	0.64830	0.99;0.994;0.99	D;D;D	0.72982	0.953;0.979;0.953	T	0.26950	-1.0088	10	0.25106	T	0.35	.	8.5503	0.33447	0.0:0.0:1.0:0.0	.	688;688;692	B3KPD3;Q9NQS7-2;Q9NQS7	.;.;INCE_HUMAN	Q	692;688	ENSP00000378295:R692Q;ENSP00000278849:R688Q	ENSP00000278849:R688Q	R	+	2	0	INCENP	61670821	1.000000	0.71417	0.995000	0.50966	0.588000	0.36517	1.743000	0.38258	1.695000	0.51148	0.064000	0.15345	CGG	.		0.721	INCENP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000394723.2	NM_020238	
CADM1	23705	hgsc.bcm.edu;broad.mit.edu	37	11	115080343	115080343	+	Silent	SNP	G	G	T			TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr11:115080343G>T	ENST00000452722.3	-	8	1049	c.1029C>A	c.(1027-1029)acC>acA	p.T343T	CADM1_ENST00000537058.1_Silent_p.T343T|CADM1_ENST00000542447.2_Intron|CADM1_ENST00000331581.6_Silent_p.T343T|CADM1_ENST00000536727.1_Intron|CADM1_ENST00000537140.1_Intron	NM_014333.3	NP_055148.3			cell adhesion molecule 1									p.T343T(5)		cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(9)|ovary(2)|skin(1)	32	all_hematologic(175;0.0628)	all_cancers(61;2.98e-14)|all_epithelial(67;2.64e-08)|all_hematologic(158;0.000154)|Melanoma(852;0.000952)|Acute lymphoblastic leukemia(157;0.00101)|Breast(348;0.0102)|Medulloblastoma(222;0.0429)|Prostate(24;0.145)|all_neural(223;0.237)		BRCA - Breast invasive adenocarcinoma(274;5.01e-06)|Epithelial(105;0.000305)|all cancers(92;0.00303)		tggtggtggtggttgttgtgg	0.433																																					p.T343T		.											.	CADM1-92	5	Substitution - coding silent(5)	kidney(3)|lung(2)	c.C1029A						.						45.0	50.0	49.0					11																	115080343		2201	4296	6497	SO:0001819	synonymous_variant	23705	exon8			GGTGGTGGTTGTT	AB017563	CCDS8373.1, CCDS53711.1, CCDS73397.1, CCDS73398.1, CCDS73399.1	11q23.2	2013-01-29	2007-02-07	2007-02-07	ENSG00000182985	ENSG00000182985		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5951	protein-coding gene	gene with protein product	"""nectin-like 2"""	605686	"""tumor suppressor in lung cancer 1"", ""immunoglobulin superfamily, member 4"""	TSLC1, IGSF4		10610705	Standard	NM_014333		Approved	NECL2, ST17, BL2, SYNCAM, IGSF4A, Necl-2, SYNCAM1, RA175	uc001ppi.4	Q9BY67	OTTHUMG00000168202	ENST00000452722.3:c.1029C>A	11.37:g.115080343G>T		94	0		120	6	NM_014333	0	0	28	28	0		Silent	SNP	ENST00000452722.3	37	CCDS8373.1																																																																																			.		0.433	CADM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000398753.2	NM_014333	
PUS7L	83448	hgsc.bcm.edu	37	12	44149019	44149019	+	Missense_Mutation	SNP	C	C	A	rs148928799		TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr12:44149019C>A	ENST00000416848.2	-	2	518	c.30G>T	c.(28-30)agG>agT	p.R10S	PUS7L_ENST00000431332.3_Intron|PUS7L_ENST00000553166.1_Missense_Mutation_p.R10S|PUS7L_ENST00000551923.1_Missense_Mutation_p.R10S|PUS7L_ENST00000344862.5_Missense_Mutation_p.R10S	NM_001098615.1|NM_001271826.1	NP_001092085.1|NP_001258755.1	Q9H0K6	PUS7L_HUMAN	pseudouridylate synthase 7 homolog (S. cerevisiae)-like	10					pseudouridine synthesis (GO:0001522)|tRNA processing (GO:0008033)		pseudouridine synthase activity (GO:0009982)|RNA binding (GO:0003723)			NS(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(15)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	all_cancers(12;0.00027)	Lung NSC(34;0.114)|all_lung(34;0.24)		GBM - Glioblastoma multiforme(48;0.0402)		AAGAACTAAACCTGATTCTAT	0.338																																					p.R10S		.											.	PUS7L-91	0			c.G30T						.						30.0	32.0	31.0					12																	44149019		2196	4283	6479	SO:0001583	missense	83448	exon2			ACTAAACCTGATT	BX647494	CCDS8743.1, CCDS61104.1	12q12	2006-02-07				ENSG00000129317			25276	protein-coding gene	gene with protein product						11230166	Standard	NM_001098615		Approved	DKFZP434G1415	uc001rnr.5	Q9H0K6	OTTHUMG00000169423	ENST00000416848.2:c.30G>T	12.37:g.44149019C>A	ENSP00000415899:p.Arg10Ser	51	0		61	4	NM_001098614	0	0	0	0	0	B3KUJ1|Q05CU0|Q6AHZ3|Q6NUP2	Missense_Mutation	SNP	ENST00000416848.2	37	CCDS8743.1	.	.	.	.	.	.	.	.	.	.	C	8.447	0.852287	0.17106	.	.	ENSG00000129317	ENST00000416848;ENST00000344862;ENST00000551923;ENST00000553166;ENST00000549868	T;T;T;T;T	0.22134	1.97;1.97;1.97;1.97;1.97	5.03	-1.34	0.09143	Pseudouridine synthase, catalytic domain (1);	0.482336	0.21493	N	0.073657	T	0.15739	0.0379	M	0.63428	1.95	0.09310	N	0.999995	B	0.23128	0.08	B	0.22601	0.04	T	0.17653	-1.0362	10	0.42905	T	0.14	-4.2765	1.7427	0.02955	0.1104:0.3295:0.217:0.343	.	10	Q9H0K6	PUS7L_HUMAN	S	10	ENSP00000415899:R10S;ENSP00000343081:R10S;ENSP00000447706:R10S;ENSP00000446865:R10S;ENSP00000449502:R10S	ENSP00000343081:R10S	R	-	3	2	PUS7L	42435286	0.005000	0.15991	0.063000	0.19743	0.732000	0.41865	-0.177000	0.09796	-0.362000	0.08113	0.561000	0.74099	AGG	C|1.000;T|0.000		0.338	PUS7L-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403931.1	NM_031292	
MCF2L	23263	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	113741757	113741757	+	Missense_Mutation	SNP	A	A	G			TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr13:113741757A>G	ENST00000375608.3	+	23	2730	c.2672A>G	c.(2671-2673)aAg>aGg	p.K891R	MCF2L_ENST00000397030.1_Missense_Mutation_p.K894R|MCF2L_ENST00000442652.2_Missense_Mutation_p.K891R|MCF2L_ENST00000375601.3_Missense_Mutation_p.K865R|MCF2L_ENST00000434480.2_Missense_Mutation_p.K867R|MCF2L_ENST00000423482.2_Missense_Mutation_p.K859R|MCF2L_ENST00000375597.4_Missense_Mutation_p.K859R|MCF2L_ENST00000375604.2_Missense_Mutation_p.K918R|MCF2L_ENST00000421756.1_Missense_Mutation_p.K865R|MCF2L_ENST00000535094.2_Missense_Mutation_p.K861R			O15068	MCF2L_HUMAN	MCF.2 cell line derived transforming sequence-like	891	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular space (GO:0005615)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			kidney(1)|large_intestine(5)|ovary(1)|stomach(1)	8	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0368)|all_epithelial(44;0.0396)|Lung NSC(25;0.129)|Breast(118;0.188)				TACAGCTACAAGCAGTCCTTA	0.592																																					p.K861R		.											.	MCF2L-228	0			c.A2582G						.						45.0	39.0	41.0					13																	113741757		2202	4299	6501	SO:0001583	missense	23263	exon22			GCTACAAGCAGTC	AB002360	CCDS9527.2, CCDS45070.1, CCDS9527.3, CCDS45070.2	13q34	2013-01-10			ENSG00000126217	ENSG00000126217		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	14576	protein-coding gene	gene with protein product		609499				9205841	Standard	NM_001112732		Approved	KIAA0362, DBS, OST, ARHGEF14	uc010tjr.2	O15068	OTTHUMG00000017377	ENST00000375608.3:c.2672A>G	13.37:g.113741757A>G	ENSP00000364758:p.Lys891Arg	22	0		56	12	NM_001112732	0	0	0	0	0	A2A2X1|A2A2X2|A2A3G6|A2A3G8|B4DHD6|B4DIL6|E9PDN8|Q5JU56|Q5VXT1|Q6ZWD4|Q765G8|Q765G9|Q8N679	Missense_Mutation	SNP	ENST00000375608.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	19.93|19.93	3.918654|3.918654	0.73098|0.73098	.|.	.|.	ENSG00000126217|ENSG00000126217	ENST00000375608;ENST00000442652;ENST00000375604;ENST00000397030;ENST00000535094;ENST00000421756;ENST00000375601;ENST00000434480;ENST00000423482;ENST00000375597;ENST00000440749|ENST00000413354;ENST00000261963	T;T;T;T;T;T;T;T;T;T|.	0.21543|.	2.0;2.0;2.0;2.0;2.0;2.0;2.0;2.0;2.0;2.0|.	5.08|5.08	5.08|5.08	0.68730|0.68730	Pleckstrin homology-type (1);Pleckstrin homology domain (3);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.84678|0.84678	0.5525|0.5525	M|M	0.92367|0.92367	3.3|3.3	0.58432|0.58432	D|D	0.999999|0.999999	D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;0.999;1.0|.	D;D;D;D;D|.	0.91635|.	0.998;0.998;0.998;0.996;0.999|.	D|D	0.88684|0.88684	0.3204|0.3204	10|5	0.87932|.	D|.	0|.	.|.	14.8626|14.8626	0.70392|0.70392	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	859;861;918;859;891|.	E9PDN8;O15068-9;G5E9A1;O15068-4;O15068|.	.;.;.;.;MCF2L_HUMAN|.	R|G	891;891;918;894;861;865;865;867;859;859;702|91;32	ENSP00000364758:K891R;ENSP00000401422:K891R;ENSP00000364754:K918R;ENSP00000380225:K894R;ENSP00000440374:K861R;ENSP00000397285:K865R;ENSP00000364751:K865R;ENSP00000407722:K867R;ENSP00000405639:K859R;ENSP00000364747:K859R|.	ENSP00000364747:K859R|.	K|S	+|+	2|1	0|0	MCF2L|MCF2L	112789758|112789758	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.524000|0.524000	0.34500|0.34500	9.084000|9.084000	0.94076|0.94076	1.902000|1.902000	0.55061|0.55061	0.533000|0.533000	0.62120|0.62120	AAG|AGC	.		0.592	MCF2L-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000045849.4		
UPF3A	65110	hgsc.bcm.edu	37	13	115047559	115047559	+	Silent	SNP	C	C	T			TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr13:115047559C>T	ENST00000375299.3	+	2	327	c.271C>T	c.(271-273)Ctg>Ttg	p.L91L	UPF3A_ENST00000351487.5_Silent_p.L91L	NM_023011.3	NP_075387.1	Q9H1J1	REN3A_HUMAN	UPF3 regulator of nonsense transcripts homolog A (yeast)	91	Required for interaction with UPF2.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA transport (GO:0051028)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nucleocytoplasmic transport (GO:0006913)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.L91L(8)		autonomic_ganglia(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	16	Lung NSC(43;0.00299)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0191)|all_epithelial(44;0.00716)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.238)	BRCA - Breast invasive adenocarcinoma(86;0.0886)	OV - Ovarian serous cystadenocarcinoma(48;0.195)|Epithelial(10;0.2)		GCTGCGCCCGCTGCCAGCACA	0.731																																					p.L91L		.											.	UPF3A-91	8	Substitution - coding silent(8)	lung(2)|prostate(2)|kidney(2)|central_nervous_system(2)	c.C271T						.						4.0	4.0	4.0					13																	115047559		1902	3804	5706	SO:0001819	synonymous_variant	65110	exon2			CGCCCGCTGCCAG	AF318575	CCDS9543.1, CCDS9544.1	13q34	2010-04-30			ENSG00000169062	ENSG00000169062			20332	protein-coding gene	gene with protein product		605530				11113196, 11163187	Standard	NM_023011		Approved	RENT3A, UPF3, HUPF3A	uc001vup.3	Q9H1J1	OTTHUMG00000017403	ENST00000375299.3:c.271C>T	13.37:g.115047559C>T		19	1		27	6	NM_080687	0	0	8	8	0	A2A366|Q5T8C3|Q5T8C9|Q7Z6N3|Q86YK1|Q9BZI8	Silent	SNP	ENST00000375299.3	37	CCDS9543.1																																																																																			.		0.731	UPF3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045968.2		
BAZ1A	11177	hgsc.bcm.edu	37	14	35269498	35269498	+	Nonsense_Mutation	SNP	T	T	A			TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr14:35269498T>A	ENST00000382422.2	-	8	1387	c.1060A>T	c.(1060-1062)Aaa>Taa	p.K354*	BAZ1A_ENST00000360310.1_Nonsense_Mutation_p.K354*|AL355885.1_ENST00000581314.1_RNA|BAZ1A_ENST00000358716.4_Nonsense_Mutation_p.K354*			Q9NRL2	BAZ1A_HUMAN	bromodomain adjacent to zinc finger domain, 1A	354					chromatin remodeling (GO:0006338)|DNA-dependent DNA replication (GO:0006261)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	ACF complex (GO:0016590)|CHRAC (GO:0008623)|nuclear chromosome (GO:0000228)	zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(6)|kidney(2)|large_intestine(7)|lung(19)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	48	Breast(36;0.0388)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;7.23e-05)|Lung(238;0.00019)|Epithelial(34;0.0793)|all cancers(34;0.175)	GBM - Glioblastoma multiforme(112;0.0659)		tcaacaatttttttcaattct	0.299																																					p.K354X		.											.	BAZ1A-291	0			c.A1060T						.						29.0	27.0	28.0					14																	35269498		2174	4241	6415	SO:0001587	stop_gained	11177	exon9			CAATTTTTTTCAA	AB032252	CCDS9651.1, CCDS41943.1	14q13.2	2013-01-28			ENSG00000198604	ENSG00000198604		"""Zinc fingers, PHD-type"""	960	protein-coding gene	gene with protein product		605680				10662543	Standard	NM_013448		Approved	hACF1, ACF1, WALp1, WCRF180	uc001wsk.3	Q9NRL2	OTTHUMG00000140216	ENST00000382422.2:c.1060A>T	14.37:g.35269498T>A	ENSP00000371859:p.Lys354*	18	0		29	3	NM_182648	0	0	21	21	0	Q9NZ15|Q9P065|Q9UIG1|Q9Y3V3	Nonsense_Mutation	SNP	ENST00000382422.2	37	CCDS9651.1	.	.	.	.	.	.	.	.	.	.	T	42	9.525045	0.99195	.	.	ENSG00000198604	ENST00000358716;ENST00000382422;ENST00000360310;ENST00000543083	.	.	.	4.96	4.96	0.65561	.	0.419939	0.27986	N	0.017055	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.5831	0.50902	0.0:0.0:0.0:1.0	.	.	.	.	X	354;354;354;38	.	ENSP00000351555:K354X	K	-	1	0	BAZ1A	34339249	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	3.925000	0.56484	2.168000	0.68352	0.482000	0.46254	AAA	.		0.299	BAZ1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276646.1		
HSPA2	3306	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	65009419	65009419	+	Missense_Mutation	SNP	C	C	A			TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr14:65009419C>A	ENST00000394709.1	+	2	1928	c.1852C>A	c.(1852-1854)Cct>Act	p.P618T	RP11-973N13.4_ENST00000554918.1_RNA|HSPA2_ENST00000247207.6_Missense_Mutation_p.P618T			P54652	HSP72_HUMAN	heat shock 70kDa protein 2	618					male meiosis (GO:0007140)|male meiosis I (GO:0007141)|negative regulation of inclusion body assembly (GO:0090084)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G2/M transition of mitotic cell cycle (GO:0031662)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)|spermatid development (GO:0007286)|synaptonemal complex disassembly (GO:0070194)	blood microparticle (GO:0072562)|CatSper complex (GO:0036128)|cell surface (GO:0009986)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|male germ cell nucleus (GO:0001673)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|glycolipid binding (GO:0051861)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(4)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	22				all cancers(60;0.00515)|OV - Ovarian serous cystadenocarcinoma(108;0.00584)|BRCA - Breast invasive adenocarcinoma(234;0.045)		CCAAGGTGGTCCTggcggcgg	0.552																																					p.P618T	Pancreas(136;1211 1835 24894 31984 38227)	.											.	HSPA2-226	0			c.C1852A						.						48.0	50.0	50.0					14																	65009419		2203	4300	6503	SO:0001583	missense	3306	exon1			GGTGGTCCTGGCG	L26336, BC001752	CCDS9766.1	14q23	2012-10-02	2002-08-29		ENSG00000126803	ENSG00000126803		"""Heat shock proteins / HSP70"""	5235	protein-coding gene	gene with protein product		140560	"""heat shock 70kD protein 2"""				Standard	NM_021979		Approved		uc001xhk.4	P54652	OTTHUMG00000141311	ENST00000394709.1:c.1852C>A	14.37:g.65009419C>A	ENSP00000378199:p.Pro618Thr	59	0		106	30	NM_021979	0	0	6	6	0	Q15508|Q53XM3|Q9UE78	Missense_Mutation	SNP	ENST00000394709.1	37	CCDS9766.1	.	.	.	.	.	.	.	.	.	.	C	3.079	-0.189353	0.06299	.	.	ENSG00000126803	ENST00000394709;ENST00000247207;ENST00000545222	T;T	0.13538	2.58;2.58	5.43	2.55	0.30701	.	1.329050	0.05831	U	0.617584	T	0.08447	0.0210	N	0.11201	0.11	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.40365	-0.9567	10	0.29301	T	0.29	0.1445	7.9468	0.29991	0.0:0.6354:0.2799:0.0847	.	618	P54652	HSP72_HUMAN	T	618;618;392	ENSP00000378199:P618T;ENSP00000247207:P618T	ENSP00000247207:P618T	P	+	1	0	HSPA2	64079172	1.000000	0.71417	0.954000	0.39281	0.732000	0.41865	2.213000	0.42844	0.254000	0.21573	-0.230000	0.12252	CCT	.		0.552	HSPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280651.1		
EIF2AK4	440275	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	40324962	40324962	+	Missense_Mutation	SNP	A	A	G			TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr15:40324962A>G	ENST00000263791.5	+	37	4776	c.4733A>G	c.(4732-4734)gAt>gGt	p.D1578G	EIF2AK4_ENST00000382727.2_Missense_Mutation_p.D1550G	NM_001013703.2	NP_001013725.2	Q9P2K8	E2AK4_HUMAN	eukaryotic translation initiation factor 2 alpha kinase 4	1578					cellular response to starvation (GO:0009267)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of translation (GO:0017148)|protein phosphorylation (GO:0006468)|regulation of translational initiation (GO:0006446)|regulation of translational initiation in response to stress (GO:0043558)	cytosolic ribosome (GO:0022626)	ATP binding (GO:0005524)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(18)|ovary(1)|prostate(3)|skin(2)|stomach(1)	40		all_cancers(109;1.05e-19)|all_epithelial(112;4.38e-17)|Lung NSC(122;1.09e-12)|all_lung(180;3.56e-11)|Melanoma(134;0.0575)|Ovarian(310;0.0826)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;5.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0616)		TCACAGGTGGATCTACCCAAA	0.388																																					p.D1578G		.											.	EIF2AK4-757	0			c.A4733G						.						110.0	106.0	107.0					15																	40324962		1929	4132	6061	SO:0001583	missense	440275	exon37			AGGTGGATCTACC	AB037759	CCDS42016.1	15q13.3	2008-08-18				ENSG00000128829			19687	protein-coding gene	gene with protein product		609280				10504407	Standard	XM_005254392		Approved	GCN2, KIAA1338	uc001zkm.1	Q9P2K8		ENST00000263791.5:c.4733A>G	15.37:g.40324962A>G	ENSP00000263791:p.Asp1578Gly	87	0		78	16	NM_001013703	0	0	0	0	0	C9JEC4|Q69YL7|Q6DC97|Q96GN6|Q9H5K1|Q9NSQ3|Q9NSZ5|Q9UJ56	Missense_Mutation	SNP	ENST00000263791.5	37	CCDS42016.1	.	.	.	.	.	.	.	.	.	.	A	20.7	4.042322	0.75732	.	.	ENSG00000128829	ENST00000263791;ENST00000382727	T;T	0.61742	0.08;0.08	5.89	5.89	0.94794	Serine/threonine-protein kinase GCN2, anticodon binding domain (1);	0.000000	0.85682	D	0.000000	T	0.65238	0.2672	N	0.24115	0.695	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.69577	-0.5108	10	0.72032	D	0.01	-24.8288	15.9741	0.80044	1.0:0.0:0.0:0.0	.	1550;1578	Q9P2K8-2;Q9P2K8	.;E2AK4_HUMAN	G	1578;1550	ENSP00000263791:D1578G;ENSP00000372174:D1550G	ENSP00000263791:D1578G	D	+	2	0	EIF2AK4	38112254	1.000000	0.71417	1.000000	0.80357	0.848000	0.48234	5.973000	0.70456	2.246000	0.74042	0.533000	0.62120	GAT	.		0.388	EIF2AK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418395.1		
TMC7	79905	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	19051691	19051691	+	Silent	SNP	C	C	A			TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr16:19051691C>A	ENST00000304381.5	+	9	1390	c.1260C>A	c.(1258-1260)atC>atA	p.I420I	TMC7_ENST00000421369.3_Silent_p.I310I|TMC7_ENST00000569532.1_Silent_p.I420I	NM_024847.3	NP_079123.3	Q7Z402	TMC7_HUMAN	transmembrane channel-like 7	420					ion transport (GO:0006811)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	28						CCAATTTTATCACCCCAATGA	0.418																																					p.I420I		.											.	TMC7-93	0			c.C1260A						.						142.0	121.0	128.0					16																	19051691		2197	4300	6497	SO:0001819	synonymous_variant	79905	exon9			TTTTATCACCCCA	AY263165	CCDS10573.1, CCDS53992.1, CCDS73837.1	16p13.11	2008-02-05			ENSG00000170537	ENSG00000170537			23000	protein-coding gene	gene with protein product						12812529, 12906855	Standard	XM_005255597		Approved	FLJ21240	uc002dfq.3	Q7Z402	OTTHUMG00000131456	ENST00000304381.5:c.1260C>A	16.37:g.19051691C>A		157	0		184	37	NM_024847	0	0	3	5	2	E7ERB6|Q5H9Q8|Q7Z5M4|Q86WX0|Q9H766	Silent	SNP	ENST00000304381.5	37	CCDS10573.1																																																																																			.		0.418	TMC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254276.3	NM_024847	
NETO2	81831	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	47117430	47117430	+	Missense_Mutation	SNP	C	C	T	rs372424394		TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr16:47117430C>T	ENST00000562435.1	-	9	1664	c.1280G>A	c.(1279-1281)cGc>cAc	p.R427H	NETO2_ENST00000303155.5_Missense_Mutation_p.R420H	NM_018092.4	NP_060562.3	Q8NC67	NETO2_HUMAN	neuropilin (NRP) and tolloid (TLL)-like 2	427					regulation of kainate selective glutamate receptor activity (GO:2000312)	kainate selective glutamate receptor complex (GO:0032983)|postsynaptic density (GO:0014069)				breast(1)|cervix(1)|endometrium(1)|large_intestine(8)|lung(11)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	29		all_cancers(37;0.00114)|all_lung(18;0.00432)|Lung NSC(13;0.0384)|Breast(268;0.174)				GGTGGAGGAGCGCCGCATCTT	0.537										HNSCC(25;0.065)			C|||	1	0.000199681	0.0	0.0014	5008	,	,		16407	0.0		0.0	False		,,,				2504	0.0				p.R427H		.											.	NETO2-90	0			c.G1280A						.	C	HIS/ARG,HIS/ARG	0,4406		0,0,2203	92.0	85.0	87.0		1280,1259	3.8	1.0	16		87	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	NETO2	NM_018092.4,NM_001201477.1	29,29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign	427/526,420/519	47117430	1,13005	2203	4300	6503	SO:0001583	missense	81831	exon9			GAGGAGCGCCGCA	AK001292	CCDS10727.1, CCDS58460.1	16q11.2	2008-08-04			ENSG00000171208	ENSG00000171208			14644	protein-coding gene	gene with protein product		607974				11943477	Standard	NM_018092		Approved	FLJ10430, NEOT2	uc002eer.2	Q8NC67	OTTHUMG00000133101	ENST00000562435.1:c.1280G>A	16.37:g.47117430C>T	ENSP00000455169:p.Arg427His	154	0		372	78	NM_018092	0	0	15	29	14	J3KNF1|Q7Z381|Q8ND51|Q96SP4|Q9NVY8	Missense_Mutation	SNP	ENST00000562435.1	37	CCDS10727.1	.	.	.	.	.	.	.	.	.	.	C	18.06	3.539890	0.65085	0.0	1.16E-4	ENSG00000171208	ENST00000303155	.	.	.	5.78	3.83	0.44106	.	0.048904	0.85682	N	0.000000	T	0.48677	0.1513	L	0.52126	1.63	0.53005	D	0.999961	P;B;B	0.37914	0.611;0.244;0.357	B;B;B	0.32022	0.139;0.033;0.072	T	0.51268	-0.8727	9	0.66056	D	0.02	.	12.2767	0.54739	0.0:0.8634:0.0:0.1366	.	284;427;103	B7Z4I7;Q8NC67;Q8NC67-2	.;NETO2_HUMAN;.	H	427	.	ENSP00000306726:R427H	R	-	2	0	NETO2	45674931	1.000000	0.71417	1.000000	0.80357	0.800000	0.45204	4.088000	0.57678	0.801000	0.34066	0.655000	0.94253	CGC	.		0.537	NETO2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256766.2	NM_018092	
GLG1	2734	broad.mit.edu	37	16	74640687	74640687	+	Silent	SNP	T	T	C			TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr16:74640687T>C	ENST00000422840.2	-	1	305	c.306A>G	c.(304-306)ggA>ggG	p.G102G	GLG1_ENST00000447066.2_Silent_p.G102G|GLG1_ENST00000205061.5_Silent_p.G102G	NM_001145667.1	NP_001139139.1	Q92896	GSLG1_HUMAN	golgi glycoprotein 1	102					blood coagulation (GO:0007596)|bone morphogenesis (GO:0060349)|leukocyte migration (GO:0050900)|negative regulation of protein processing (GO:0010955)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of chondrocyte differentiation (GO:0032330)	extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(2)|cervix(2)|endometrium(6)|kidney(8)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(1)	57						CCCCCGCTCCTCCCCGCCGGG	0.697																																					p.G102G													.	GLG1-136	0			c.A306G						.						7.0	8.0	8.0					16																	74640687		2133	4196	6329	SO:0001819	synonymous_variant	2734	exon1			CGCTCCTCCCCGC		CCDS32485.1, CCDS45526.1, CCDS45527.1	16q22-q23	2010-02-12	2010-02-12			ENSG00000090863			4316	protein-coding gene	gene with protein product		600753	"""golgi apparatus protein 1"""			8530051, 7531823	Standard	NM_012201		Approved	MG-160, ESL-1, CFR-1	uc002fcx.3	Q92896		ENST00000422840.2:c.306A>G	16.37:g.74640687T>C		22	1		44	14	NM_001145667	0	0	1	1	0	B7Z8Y4|D3DUJ7|Q13221|Q6P9D1	Silent	SNP	ENST00000422840.2	37	CCDS45527.1																																																																																			.		0.697	GLG1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000435750.1	NM_012201	
EIF4A1	1973	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	7478578	7478578	+	Splice_Site	SNP	T	T	G			TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr17:7478578T>G	ENST00000293831.8	+	4	361		c.e4+2		SNORA48_ENST00000386847.1_RNA|SNORA67_ENST00000384423.1_RNA|EIF4A1_ENST00000582746.1_Splice_Site|SNORD10_ENST00000459579.1_RNA|EIF4A1_ENST00000577269.1_Splice_Site|EIF4A1_ENST00000380512.5_Missense_Mutation_p.V100G|SENP3-EIF4A1_ENST00000579777.1_RNA	NM_001416.3	NP_001407.1	P60842	IF4A1_HUMAN	eukaryotic translation initiation factor 4A1						cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|organ regeneration (GO:0031100)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			NS(1)|breast(2)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(8)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	22						GCTCAGCAGGTAAGAGTGGCT	0.488																																					.	Melanoma(120;278 1668 15796 27423 46368)	.											.	EIF4A1-227	0			c.345+2T>G						.						73.0	70.0	71.0					17																	7478578		2203	4300	6503	SO:0001630	splice_region_variant	1973	exon4			AGCAGGTAAGAGT	D13748	CCDS11113.1, CCDS58511.1	17p13	2012-02-23	2010-02-10		ENSG00000161960	ENSG00000161960		"""DEAD-boxes"""	3282	protein-coding gene	gene with protein product		602641	"""eukaryotic translation initiation factor 4A, isoform 1"""	EIF4A		8493113, 9790779	Standard	NM_001416		Approved	DDX2A, EIF-4A		P60842	OTTHUMG00000108149	ENST00000293831.8:c.345+2T>G	17.37:g.7478578T>G		134	0		190	41	NM_001204510	0	0	1	1	0	B2R6L8|D3DTP9|J3QLC4|P04765|Q5U018|Q61516	Splice_Site	SNP	ENST00000293831.8	37	CCDS11113.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	20.7|20.7	4.031827|4.031827	0.75504|0.75504	.|.	.|.	ENSG00000161960|ENSG00000161960	ENST00000293831|ENST00000380512	.|T	.|0.17213	.|2.29	5.43|5.43	5.43|5.43	0.79202|0.79202	.|.	.|.	.|.	.|.	.|.	.|T	.|0.29749	.|0.0743	.|.	.|.	.|.	0.48511|0.48511	D|D	0.999669|0.999669	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.01195	.|-1.1422	.|5	.|.	.|.	.|.	.|.	13.4334|13.4334	0.61068|0.61068	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|.	.|.	.|.	.|G	-1|100	.|ENSP00000369881:V100G	.|.	.|V	+|+	.|2	.|0	EIF4A1|EIF4A1	7419302|7419302	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.957000|0.957000	0.61999|0.61999	7.698000|7.698000	0.84413|0.84413	2.077000|2.077000	0.62373|0.62373	0.459000|0.459000	0.35465|0.35465	.|GTA	.		0.488	EIF4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226952.6	NM_001416	Intron
MED24	9862	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	38187790	38187790	+	Splice_Site	SNP	C	C	G			TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr17:38187790C>G	ENST00000394128.2	-	11	1149		c.e11+1		MED24_ENST00000479829.1_5'Flank|MED24_ENST00000501516.3_Splice_Site|MED24_ENST00000394126.1_Splice_Site|MED24_ENST00000356271.3_Splice_Site|MED24_ENST00000394127.2_Splice_Site	NM_014815.3	NP_055630.2	O75448	MED24_HUMAN	mediator complex subunit 24						androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterooligomerization (GO:0051291)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			autonomic_ganglia(1)|breast(2)|endometrium(9)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	41	Colorectal(19;0.000442)					GGAGCTCATACTTGCAGCGCT	0.557																																					.		.											.	MED24-187	0			c.1028+1G>C						.						84.0	82.0	82.0					17																	38187790		2203	4300	6503	SO:0001630	splice_region_variant	9862	exon11			CTCATACTTGCAG	AF055995	CCDS11359.1, CCDS42315.1	17q21.2	2007-07-30	2007-07-30	2007-07-30	ENSG00000008838	ENSG00000008838			22963	protein-coding gene	gene with protein product		607000	"""thyroid hormone receptor associated protein 4"", ""cofactor required for Sp1 transcriptional activation, subunit 4, 100kDa"""	THRAP4, CRSP4			Standard	NM_001079518		Approved	TRAP100, KIAA0130, DRIP100, CRSP100	uc002htt.3	O75448	OTTHUMG00000133329	ENST00000394128.2:c.1067+1G>C	17.37:g.38187790C>G		156	0		356	55	NM_001079518	0	0	0	7	7	A8K4S5|B3KMR9|Q14143|Q9NNY5	Splice_Site	SNP	ENST00000394128.2	37	CCDS11359.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.948640	0.73787	.	.	ENSG00000008838	ENST00000394126;ENST00000356271;ENST00000394128;ENST00000535071;ENST00000394127;ENST00000536318;ENST00000431269	.	.	.	4.56	4.56	0.56223	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.4676	0.87638	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MED24	35441316	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	3.743000	0.55104	2.533000	0.85409	0.561000	0.74099	.	.		0.557	MED24-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257147.2	NM_014815	Intron
NPEPPS	9520	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	45669357	45669357	+	Silent	SNP	A	A	T			TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr17:45669357A>T	ENST00000322157.4	+	11	1533	c.1296A>T	c.(1294-1296)atA>atT	p.I432I	NPEPPS_ENST00000530173.1_Silent_p.I428I|NPEPPS_ENST00000525037.1_3'UTR|NPEPPS_ENST00000544660.1_Silent_p.I352I	NM_006310.3	NP_006301.3	P55786	PSA_HUMAN	aminopeptidase puromycin sensitive	432					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular response to hypoxia (GO:0071456)|protein polyubiquitination (GO:0000209)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(6)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	27						TTGATGAGATATTTGATGCTA	0.383																																					p.I432I		.											.	NPEPPS-90	0			c.A1296T						.						123.0	78.0	93.0					17																	45669357		2021	4151	6172	SO:0001819	synonymous_variant	9520	exon11			TGAGATATTTGAT	Y07701	CCDS45721.1	17q12-q21	2008-07-18			ENSG00000141279	ENSG00000141279	3.4.11.2		7900	protein-coding gene	gene with protein product	"""puromycin-sensitive aminopeptidase"", ""metalloproteinase MP100"""	606793				9048733, 10329370	Standard	NM_006310		Approved	PSA, MP100	uc002ilr.4	P55786	OTTHUMG00000165471	ENST00000322157.4:c.1296A>T	17.37:g.45669357A>T		76	0		133	17	NM_006310	0	0	54	123	69	B7Z463|Q6P145|Q9NP16|Q9UEM2	Silent	SNP	ENST00000322157.4	37	CCDS45721.1																																																																																			.		0.383	NPEPPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384269.1	NM_006310	
CEP95	90799	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	62532827	62532827	+	Missense_Mutation	SNP	G	G	C			TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr17:62532827G>C	ENST00000556440.2	+	18	2688	c.2178G>C	c.(2176-2178)caG>caC	p.Q726H	CEP95_ENST00000553412.1_Missense_Mutation_p.Q562H	NM_138363.1	NP_612372.1	Q96GE4	CEP95_HUMAN	centrosomal protein 95kDa	726						centrosome (GO:0005813)|cytoplasm (GO:0005737)|spindle pole (GO:0000922)				endometrium(1)|kidney(3)|large_intestine(5)|lung(3)|ovary(1)	13						GACGCCACCAGGATGAACTGG	0.458																																					p.Q726H		.											.	CEP95-23	0			c.G2178C						.						78.0	82.0	81.0					17																	62532827		2022	4184	6206	SO:0001583	missense	90799	exon18			CCACCAGGATGAA	AL832822	CCDS45763.1	17q24.1	2014-02-20	2011-05-06	2011-05-06	ENSG00000258890	ENSG00000258890			25141	protein-coding gene	gene with protein product			"""coiled-coil domain containing 45"""	CCDC45		21399614	Standard	NM_138363		Approved	DKFZp667E1824	uc002jem.3	Q96GE4	OTTHUMG00000179174	ENST00000556440.2:c.2178G>C	17.37:g.62532827G>C	ENSP00000450461:p.Gln726His	62	0		155	47	NM_138363	0	0	7	17	10	B4DMD2|Q96M81	Missense_Mutation	SNP	ENST00000556440.2	37	CCDS45763.1	.	.	.	.	.	.	.	.	.	.	G	16.52	3.146995	0.57151	.	.	ENSG00000258890	ENST00000553956;ENST00000556440;ENST00000553412	T;T	0.37411	1.25;1.2	5.48	3.5	0.40072	.	0.125921	0.53938	D	0.000047	T	0.51839	0.1698	L	0.59436	1.845	0.35792	D	0.822454	D	0.89917	1.0	D	0.73380	0.98	T	0.61964	-0.6954	10	0.72032	D	0.01	-13.7497	9.6268	0.39754	0.275:0.0:0.725:0.0	.	726	Q96GE4	CEP95_HUMAN	H	661;726;562	ENSP00000450461:Q726H;ENSP00000450906:Q562H	ENSP00000438458:Q661H	Q	+	3	2	CEP95	59963289	1.000000	0.71417	1.000000	0.80357	0.728000	0.41692	0.926000	0.28804	0.805000	0.34159	0.650000	0.86243	CAG	.		0.458	CEP95-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445100.2	NM_138363	
LINGO3	645191	hgsc.bcm.edu	37	19	2290499	2290499	+	Missense_Mutation	SNP	C	C	T	rs7258841	byFrequency	TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr19:2290499C>T	ENST00000585527.1	-	1	1524	c.1277G>A	c.(1276-1278)cGc>cAc	p.R426H	LINGO3_ENST00000404279.1_Missense_Mutation_p.R426H			P0C6S8	LIGO3_HUMAN	leucine rich repeat and Ig domain containing 3	426	Ig-like C2-type.		R -> H (in dbSNP:rs7258841).			integral component of membrane (GO:0016021)				lung(1)|urinary_tract(1)	2						GCAGAGGAAGCGGACGTCTTC	0.756													C|||	1440	0.28754	0.4017	0.2536	5008	,	,		9136	0.3363		0.1292	False		,,,				2504	0.2699				p.R426H		.											.	.	0			c.G1277A						.						1.0	2.0	2.0					19																	2290499		1143	2693	3836	SO:0001583	missense	645191	exon2			AGGAAGCGGACGT	AK091795	CCDS45905.1	19p13.3	2013-01-11	2007-02-01	2007-02-01		ENSG00000220008		"""Immunoglobulin superfamily / I-set domain containing"""	21206	protein-coding gene	gene with protein product		609792	"""leucine rich repeat neuronal 6B"""	LRRN6B		14686891	Standard	NM_001101391		Approved	LERN2	uc010dsx.1	P0C6S8		ENST00000585527.1:c.1277G>A	19.37:g.2290499C>T	ENSP00000467753:p.Arg426His	1	1		7	7	NM_001101391	0	0	0	0	0		Missense_Mutation	SNP	ENST00000585527.1	37	CCDS45905.1	581	0.266025641025641	199	0.40447154471544716	83	0.2292817679558011	203	0.3548951048951049	96	0.1266490765171504	c	8.925	0.961929	0.18583	.	.	ENSG00000220008	ENST00000404279	T	0.68624	-0.34	4.12	2.99	0.34606	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.00012	0.0000	N	0.12527	0.23	0.37498	P	0.08333100000000004	B	0.12013	0.005	B	0.12156	0.007	T	0.28744	-1.0034	8	0.10902	T	0.67	.	10.7018	0.45931	0.0:0.5797:0.4203:0.0	rs7258841	426	P0C6S8	LIGO3_HUMAN	H	426	ENSP00000384979:R426H	ENSP00000384979:R426H	R	-	2	0	LINGO3	2241499	0.985000	0.35326	1.000000	0.80357	0.779000	0.44077	0.931000	0.28871	1.852000	0.53769	0.462000	0.41574	CGC	C|0.734;T|0.266		0.756	LINGO3-001	KNOWN	upstream_ATG|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000451291.2	NM_001101391	
ZNF682	91120	hgsc.bcm.edu	37	19	20117835	20117835	+	Missense_Mutation	SNP	T	T	C			TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr19:20117835T>C	ENST00000397165.2	-	4	636	c.476A>G	c.(475-477)aAt>aGt	p.N159S	ZNF682_ENST00000596019.1_Intron|ZNF682_ENST00000597972.1_Missense_Mutation_p.N165S|ZNF682_ENST00000358523.5_Missense_Mutation_p.N127S|ZNF682_ENST00000397162.1_Missense_Mutation_p.N127S|ZNF682_ENST00000595736.1_Missense_Mutation_p.N83S	NM_033196.2	NP_149973.1	O95780	ZN682_HUMAN	zinc finger protein 682	159					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(1)	14						TCTATTTAGATTTGATGATTT	0.294																																					p.N159S		.											.	ZNF682-92	0			c.A476G						.						67.0	62.0	64.0					19																	20117835		1813	4079	5892	SO:0001583	missense	91120	exon4			TTTAGATTTGATG	AC006539	CCDS42533.1, CCDS42534.1	19p12	2014-02-13			ENSG00000197124	ENSG00000197124		"""Zinc fingers, C2H2-type"", ""-"""	28857	protein-coding gene	gene with protein product							Standard	NM_033196		Approved	BC39498_3	uc002noq.3	O95780	OTTHUMG00000182650	ENST00000397165.2:c.476A>G	19.37:g.20117835T>C	ENSP00000380351:p.Asn159Ser	50	0		42	3	NM_033196	0	0	0	0	0	B3KU64|E9PFJ5|Q96JV9	Missense_Mutation	SNP	ENST00000397165.2	37	CCDS42533.1	.	.	.	.	.	.	.	.	.	.	T	2.164	-0.391440	0.04932	.	.	ENSG00000197124	ENST00000397165;ENST00000397162;ENST00000358523	T;T;T	0.35973	1.28;1.28;1.28	1.23	-2.47	0.06442	Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.21962	0.0529	L	0.33245	0.995	0.09310	N	1	B	0.12630	0.006	B	0.18871	0.023	T	0.20571	-1.0271	9	0.39692	T	0.17	.	3.5569	0.07867	0.0:0.2275:0.2188:0.5538	.	159	O95780	ZN682_HUMAN	S	159;127;127	ENSP00000380351:N159S;ENSP00000380348:N127S;ENSP00000351324:N127S	ENSP00000351324:N127S	N	-	2	0	ZNF682	19978835	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.780000	0.04654	-0.909000	0.03852	-0.483000	0.04790	AAT	.		0.294	ZNF682-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462888.1	NM_033196	
CDC42EP5	148170	hgsc.bcm.edu	37	19	54976502	54976502	+	Missense_Mutation	SNP	G	G	A			TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr19:54976502G>A	ENST00000301200.2	-	3	571	c.230C>T	c.(229-231)cCg>cTg	p.P77L	LENG9_ENST00000333834.4_5'Flank	NM_145057.2	NP_659494.2	Q6NZY7	BORG3_HUMAN	CDC42 effector protein (Rho GTPase binding) 5	77	Pro-rich.				JNK cascade (GO:0007254)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of pseudopodium assembly (GO:0031274)|regulation of cell shape (GO:0008360)|Rho protein signal transduction (GO:0007266)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTP-Rho binding (GO:0017049)			lung(1)|skin(1)	2	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.138)		TGCGGACTGCGGGAcggcggg	0.811																																					p.P77L		.											.	CDC42EP5-90	0			c.C230T						.						2.0	2.0	2.0					19																	54976502		1328	2853	4181	SO:0001583	missense	148170	exon3			GACTGCGGGACGG	BC024327	CCDS12896.1	19q13.42	2008-02-05			ENSG00000167617	ENSG00000167617			17408	protein-coding gene	gene with protein product		609171					Standard	NM_145057		Approved	CEP5, Borg3	uc002qfz.1	Q6NZY7	OTTHUMG00000065699	ENST00000301200.2:c.230C>T	19.37:g.54976502G>A	ENSP00000301200:p.Pro77Leu	1	0		6	3	NM_145057	0	0	0	0	0	B0VJZ2|Q8TB51	Missense_Mutation	SNP	ENST00000301200.2	37	CCDS12896.1	.	.	.	.	.	.	.	.	.	.	G	16.71	3.198258	0.58126	.	.	ENSG00000167617	ENST00000301200	T	0.30448	1.53	2.86	2.86	0.33363	.	1.101450	0.07500	U	0.907023	T	0.43033	0.1229	L	0.36672	1.1	0.44745	D	0.997744	D	0.89917	1.0	D	0.66084	0.941	T	0.25537	-1.0129	10	0.46703	T	0.11	-9.2729	9.3908	0.38372	0.0:0.0:1.0:0.0	.	77	Q6NZY7	BORG3_HUMAN	L	77	ENSP00000301200:P77L	ENSP00000301200:P77L	P	-	2	0	CDC42EP5	59668314	0.644000	0.27277	0.018000	0.16275	0.208000	0.24298	4.789000	0.62446	1.628000	0.50416	0.555000	0.69702	CCG	.		0.811	CDC42EP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140804.1	NM_145057	
ZNF419	79744	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	58005060	58005060	+	Missense_Mutation	SNP	T	T	G			TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr19:58005060T>G	ENST00000221735.7	+	5	1321	c.1135T>G	c.(1135-1137)Ttt>Gtt	p.F379V	ZNF419_ENST00000415379.2_Missense_Mutation_p.F333V|ZNF419_ENST00000424930.2_Missense_Mutation_p.F380V|ZNF419_ENST00000442920.2_Missense_Mutation_p.F366V|AC003005.4_ENST00000601674.1_Intron|ZNF419_ENST00000426954.2_Missense_Mutation_p.F367V|ZNF419_ENST00000354197.4_Missense_Mutation_p.F367V|ZNF419_ENST00000347466.6_Missense_Mutation_p.F347V			Q96HQ0	ZN419_HUMAN	zinc finger protein 419	379					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	26		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Breast(46;0.0848)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0252)|Lung(386;0.171)		CTGTGGGAAATTTTTTACCCA	0.408																																					p.F380V		.											.	ZNF419-90	0			c.T1138G						.						81.0	85.0	84.0					19																	58005060		2200	4297	6497	SO:0001583	missense	79744	exon5			GGGAAATTTTTTA	AK026886	CCDS42637.1, CCDS46211.1, CCDS54325.1, CCDS54326.1, CCDS54327.1, CCDS54328.1	19q13.43	2013-01-08	2006-12-15	2006-12-15	ENSG00000105136	ENSG00000105136		"""Zinc fingers, C2H2-type"", ""-"""	20648	protein-coding gene	gene with protein product			"""zinc finger protein 419A"""	ZNF419A			Standard	NM_001098492		Approved		uc010ety.1	Q96HQ0	OTTHUMG00000037073	ENST00000221735.7:c.1135T>G	19.37:g.58005060T>G	ENSP00000221735:p.Phe379Val	178	0		227	42	NM_001098491	0	0	6	6	0	B4DXU7|B4E348|B7ZA41|E9PCP4|E9PED0|E9PET3|E9PFX9|Q9H5P0	Missense_Mutation	SNP	ENST00000221735.7	37	CCDS54326.1	.	.	.	.	.	.	.	.	.	.	T	10.63	1.405079	0.25378	.	.	ENSG00000105136	ENST00000284020;ENST00000424930;ENST00000426954;ENST00000354197;ENST00000442920;ENST00000517598;ENST00000347466;ENST00000415379;ENST00000221735	T;T;T;T;T;T;T	0.16743	3.25;3.25;3.25;3.25;3.25;2.32;3.25	2.26	1.16	0.20824	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.14614	0.0353	N	0.02539	-0.55	0.23454	N	0.997643	D;D;D;D;B;D;B	0.69078	0.985;0.991;0.997;0.991;0.292;0.996;0.292	D;D;D;D;B;D;B	0.79108	0.966;0.982;0.992;0.988;0.071;0.986;0.071	T	0.25222	-1.0138	9	0.38643	T	0.18	.	7.3178	0.26511	0.0:0.0:0.2246:0.7754	.	333;333;366;367;380;347;379	E9PFX9;B4DXU7;E9PCP4;E9PET3;E9PED0;Q96HQ0-2;Q96HQ0	.;.;.;.;.;.;ZN419_HUMAN	V	354;380;367;367;366;380;347;333;379	ENSP00000388864:F380V;ENSP00000390916:F367V;ENSP00000346136:F367V;ENSP00000414709:F366V;ENSP00000299860:F347V;ENSP00000392129:F333V;ENSP00000221735:F379V	ENSP00000221735:F379V	F	+	1	0	ZNF419	62696872	0.000000	0.05858	0.044000	0.18714	0.111000	0.19643	-1.253000	0.02877	0.101000	0.17610	0.260000	0.18958	TTT	.		0.408	ZNF419-006	KNOWN	NAGNAG_splice_site|non_canonical_polymorphism|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000378506.1	NM_024691	
GEN1	348654	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	17962008	17962008	+	Missense_Mutation	SNP	G	G	A			TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr2:17962008G>A	ENST00000381254.2	+	14	1743	c.1529G>A	c.(1528-1530)gGg>gAg	p.G510E	GEN1_ENST00000317402.7_Missense_Mutation_p.G510E|SMC6_ENST00000402989.1_Intron	NM_001130009.1	NP_001123481.1	Q17RS7	GEN_HUMAN	GEN1 Holliday junction 5' flap endonuclease	510					DNA catabolic process, endonucleolytic (GO:0000737)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|regulation of centrosome duplication (GO:0010824)|resolution of mitotic recombination intermediates (GO:0071140)|resolution of recombination intermediates (GO:0071139)	centrosome (GO:0005813)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	crossover junction endodeoxyribonuclease activity (GO:0008821)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(6)|central_nervous_system(1)|kidney(1)|large_intestine(3)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	16	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					TTAAATTCGGGGATTTCCCCT	0.373								Homologous recombination																													p.G510E		.											.	GEN1-359	0			c.G1529A						.						82.0	80.0	80.0					2																	17962008		2203	4300	6503	SO:0001583	missense	348654	exon14			ATTCGGGGATTTC	AK098188	CCDS1691.1	2p24.2	2013-06-04	2013-06-04		ENSG00000178295	ENSG00000178295			26881	protein-coding gene	gene with protein product	"""Holliday junction resolvase"""	612449	"""Gen endonuclease homolog 1 (Drosophila)"""			15576351	Standard	NM_182625		Approved	FLJ40869, Gen	uc002rct.2	Q17RS7	OTTHUMG00000121173	ENST00000381254.2:c.1529G>A	2.37:g.17962008G>A	ENSP00000370653:p.Gly510Glu	97	0		98	15	NM_182625	0	0	0	0	0	Q17RS9|Q6ZN37	Missense_Mutation	SNP	ENST00000381254.2	37	CCDS1691.1	.	.	.	.	.	.	.	.	.	.	G	0.005	-2.178672	0.00308	.	.	ENSG00000178295	ENST00000317402;ENST00000381254;ENST00000528873;ENST00000536097	T;T;T	0.38560	1.96;1.96;1.13	5.46	1.86	0.25419	.	0.276329	0.30742	N	0.008968	T	0.11196	0.0273	N	0.01048	-1.04	0.09310	N	0.999996	B	0.02656	0.0	B	0.01281	0.0	T	0.36939	-0.9727	10	0.02654	T	1	-9.6119	7.6912	0.28569	0.7505:0.0:0.2495:0.0	.	510	Q17RS7	GEN_HUMAN	E	510;510;281;147	ENSP00000318977:G510E;ENSP00000370653:G510E;ENSP00000431542:G281E	ENSP00000318977:G510E	G	+	2	0	GEN1	17825489	0.204000	0.23447	0.429000	0.26710	0.003000	0.03518	1.257000	0.32932	0.473000	0.27368	-0.469000	0.05056	GGG	.		0.373	GEN1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241661.2	NM_182625	
APOB	338	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	21238283	21238283	+	Missense_Mutation	SNP	G	G	A			TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr2:21238283G>A	ENST00000233242.1	-	22	3594	c.3467C>T	c.(3466-3468)gCt>gTt	p.A1156V		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	1156					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGAGCCATAAGCTGTAGCAGA	0.507																																					p.A1156V		.											.	APOB-175	0			c.C3467T						.						140.0	121.0	128.0					2																	21238283		2203	4300	6503	SO:0001583	missense	338	exon22			CCATAAGCTGTAG	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.3467C>T	2.37:g.21238283G>A	ENSP00000233242:p.Ala1156Val	96	0		201	35	NM_000384	0	0	0	0	0	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	37	CCDS1703.1	.	.	.	.	.	.	.	.	.	.	G	15.43	2.830038	0.50845	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.00686	5.85	5.49	5.49	0.81192	.	0.100022	0.44483	D	0.000457	T	0.01870	0.0059	M	0.67953	2.075	0.80722	D	1	D	0.58620	0.983	P	0.53313	0.723	T	0.63216	-0.6687	10	0.06099	T	0.92	.	13.2457	0.60022	0.0756:0.0:0.9244:0.0	.	1156	P04114	APOB_HUMAN	V	1156	ENSP00000233242:A1156V	ENSP00000233242:A1156V	A	-	2	0	APOB	21091788	0.822000	0.29219	0.991000	0.47740	0.903000	0.53119	1.269000	0.33074	2.767000	0.95098	0.655000	0.94253	GCT	.		0.507	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
RNF103	7844	hgsc.bcm.edu	37	2	86832538	86832538	+	Nonsense_Mutation	SNP	A	A	C	rs373749370		TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr2:86832538A>C	ENST00000237455.4	-	4	1454	c.486T>G	c.(484-486)taT>taG	p.Y162*	CHMP3_ENST00000439940.2_Intron|AC015971.2_ENST00000439077.1_RNA|AC015971.2_ENST00000424788.1_RNA|AC015971.2_ENST00000426549.1_RNA|RNF103-CHMP3_ENST00000604011.1_Intron|RNF103_ENST00000477307.1_5'UTR|AC015971.2_ENST00000597638.1_RNA	NM_001198951.1|NM_005667.3	NP_001185880.1|NP_005658.1	O00237	RN103_HUMAN	ring finger protein 103	162					central nervous system development (GO:0007417)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|protein ubiquitination (GO:0016567)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(7)|skin(2)	25						TTCTCCTGCAATATCTACAAG	0.408																																					p.Y162X		.											.	RNF103-226	0			c.T486G						.						69.0	67.0	68.0					2																	86832538		2203	4300	6503	SO:0001587	stop_gained	7844	exon4			CCTGCAATATCTA	D76444	CCDS33237.1	2p11.2	2013-01-09	2003-05-14	2003-05-16	ENSG00000239305	ENSG00000239305		"""RING-type (C3HC4) zinc fingers"""	12859	protein-coding gene	gene with protein product		602507	"""zinc finger protein 103 homolog (mouse)"""	ZFP103		9070305	Standard	NM_005667		Approved	hkf-1, KF1	uc021vkg.1	O00237	OTTHUMG00000153197	ENST00000237455.4:c.486T>G	2.37:g.86832538A>C	ENSP00000237455:p.Tyr162*	97	0		111	8	NM_005667	0	0	0	0	0	A6NFV6|B2RAG4|Q53SU6|Q8IVB9	Nonsense_Mutation	SNP	ENST00000237455.4	37	CCDS33237.1	.	.	.	.	.	.	.	.	.	.	A	44	11.057122	0.99509	.	.	ENSG00000239305	ENST00000237455	.	.	.	5.64	2.81	0.32909	.	0.059364	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.5564	10.5449	0.45054	0.2165:0.0:0.7835:0.0	.	.	.	.	X	162	.	ENSP00000237455:Y162X	Y	-	3	2	RNF103	86686049	1.000000	0.71417	1.000000	0.80357	0.768000	0.43524	1.451000	0.35145	0.714000	0.32081	-0.468000	0.05107	TAT	.		0.408	RNF103-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330041.2	NM_005667	
LRP1B	53353	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	141607702	141607702	+	Silent	SNP	G	G	A	rs368565366		TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr2:141607702G>A	ENST00000389484.3	-	29	5879	c.4908C>T	c.(4906-4908)aaC>aaT	p.N1636N		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	1636					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		ACCCAGTTCCGTTAATAAAAG	0.318										TSP Lung(27;0.18)																											p.N1636N	Colon(99;50 2074 2507 20106)	.											.	LRP1B-311	0			c.C4908T						.	A		1,4405	4.2+/-10.8	0,1,2202	162.0	169.0	167.0		4908	0.2	1.0	2		167	0,8600		0,0,4300	no	coding-synonymous	LRP1B	NM_018557.2		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		1636/4600	141607702	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	53353	exon29			AGTTCCGTTAATA	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.4908C>T	2.37:g.141607702G>A		123	0		123	25	NM_018557	0	0	0	0	0	Q8WY29|Q8WY30|Q8WY31	Silent	SNP	ENST00000389484.3	37	CCDS2182.1																																																																																			.		0.318	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
NDUFAF5	79133	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	13775537	13775537	+	Missense_Mutation	SNP	A	A	T			TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr20:13775537A>T	ENST00000378106.5	+	5	548	c.429A>T	c.(427-429)gaA>gaT	p.E143D	NDUFAF5_ENST00000475968.1_Intron|NDUFAF5_ENST00000463598.1_Intron	NM_024120.4	NP_077025.2	Q5TEU4	NDUF5_HUMAN	NADH dehydrogenase (ubiquinone) complex I, assembly factor 5	143					mitochondrial respiratory chain complex I assembly (GO:0032981)	extrinsic component of mitochondrial inner membrane (GO:0031314)	methyltransferase activity (GO:0008168)										CTGATGAAGAATTCCTTCCCT	0.318																																					p.E143D		.											.	.	0			c.A429T						.						105.0	105.0	105.0					20																	13775537		2203	4300	6503	SO:0001583	missense	79133	exon5			TGAAGAATTCCTT		CCDS13118.1, CCDS33441.1	20p12.1	2012-10-12	2012-05-08	2012-05-08	ENSG00000101247	ENSG00000101247		"""Mitochondrial respiratory chain complex assembly factors"""	15899	protein-coding gene	gene with protein product		612360	"""chromosome 20 open reading frame 7"""	C20orf7		18940309, 21607760	Standard	NM_024120		Approved	dJ842G6.1	uc002wom.3	Q5TEU4	OTTHUMG00000031909	ENST00000378106.5:c.429A>T	20.37:g.13775537A>T	ENSP00000367346:p.Glu143Asp	45	0		48	6	NM_024120	0	0	10	19	9	A8K166|Q6GPH3|Q9H6F4	Missense_Mutation	SNP	ENST00000378106.5	37	CCDS13118.1	.	.	.	.	.	.	.	.	.	.	A	22.4	4.282700	0.80692	.	.	ENSG00000101247	ENST00000378106;ENST00000536501	D	0.85484	-1.99	5.93	2.37	0.29283	Methyltransferase type 11 (1);	0.000000	0.85682	D	0.000000	D	0.88362	0.6416	L	0.49513	1.565	0.80722	D	1	D;D	0.89917	1.0;0.985	D;D	0.81914	0.995;0.951	D	0.86347	0.1708	10	0.72032	D	0.01	-15.2415	9.9234	0.41478	0.7238:0.0:0.2762:0.0	.	143;143	Q5TEU4;B3KR61	CT007_HUMAN;.	D	143	ENSP00000367346:E143D	ENSP00000437325:E143D	E	+	3	2	C20orf7	13723537	1.000000	0.71417	0.999000	0.59377	0.991000	0.79684	2.111000	0.41883	0.126000	0.18424	-0.408000	0.06270	GAA	.		0.318	NDUFAF5-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078057.2	NM_001039375	
FAM83D	81610	hgsc.bcm.edu	37	20	37555364	37555364	+	Silent	SNP	G	G	A			TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr20:37555364G>A	ENST00000217429.4	+	1	410	c.369G>A	c.(367-369)tcG>tcA	p.S123S		NM_030919.2	NP_112181.2	Q9H4H8	FA83D_HUMAN	family with sequence similarity 83, member D	93					mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				endometrium(2)|kidney(2)|large_intestine(7)|lung(12)|ovary(4)|stomach(1)	28		Myeloproliferative disorder(115;0.00878)				TCGGCTCCTCGCACGACTGCT	0.721																																					p.S123S		.											.	FAM83D-93	0			c.G369A						.						3.0	4.0	4.0					20																	37555364		1771	3831	5602	SO:0001819	synonymous_variant	81610	exon1			CTCCTCGCACGAC	AL023803	CCDS42872.1	20q11.23	2014-03-13	2006-03-23	2006-03-23	ENSG00000101447	ENSG00000101447			16122	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 129"""	C20orf129		23205133	Standard	NM_030919		Approved	dJ616B8.3	uc002xjg.3	Q9H4H8	OTTHUMG00000032462	ENST00000217429.4:c.369G>A	20.37:g.37555364G>A		6	1		10	5	NM_030919	0	0	4	7	3	B4E1I7|Q5THR2|Q68EN1|Q6P457|Q7Z6H0|Q96DF5|Q96N89|Q9BVM8	Silent	SNP	ENST00000217429.4	37	CCDS42872.1																																																																																			.		0.721	FAM83D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079211.1		
GART	2618	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	34904710	34904710	+	Missense_Mutation	SNP	C	C	T			TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr21:34904710C>T	ENST00000381831.3	-	5	732	c.469G>A	c.(469-471)Ggg>Agg	p.G157R	GART_ENST00000381839.3_Missense_Mutation_p.G157R|GART_ENST00000361093.5_Missense_Mutation_p.G157R|GART_ENST00000497313.1_5'UTR|GART_ENST00000381815.4_Missense_Mutation_p.G157R	NM_001136005.1	NP_001129477.1	P22102	PUR2_HUMAN	phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase	157	ATP-grasp.				'de novo' IMP biosynthetic process (GO:0006189)|brainstem development (GO:0003360)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|glycine metabolic process (GO:0006544)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase biosynthetic process (GO:0009113)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to inorganic substance (GO:0010035)|response to organic substance (GO:0010033)|small molecule metabolic process (GO:0044281)|tetrahydrofolate biosynthetic process (GO:0046654)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|phosphoribosylamine-glycine ligase activity (GO:0004637)|phosphoribosylformylglycinamidine cyclo-ligase activity (GO:0004641)|phosphoribosylglycinamide formyltransferase activity (GO:0004644)			NS(2)|breast(1)|endometrium(3)|large_intestine(3)|lung(13)|ovary(3)|prostate(5)|urinary_tract(1)	31					Pemetrexed(DB00642)	ACAATCACCCCTTTTCCAGCT	0.428																																					p.G157R		.											.	GART-91	0			c.G469A						.						213.0	227.0	222.0					21																	34904710		2203	4300	6503	SO:0001583	missense	2618	exon5			TCACCCCTTTTCC	M32082	CCDS13627.1, CCDS13628.1	21q22.11	2012-10-02			ENSG00000159131	ENSG00000159131	2.1.2.2, 6.3.3.1, 6.3.4.13		4163	protein-coding gene	gene with protein product		138440		PRGS, PGFT		2050105	Standard	NM_001136005		Approved		uc002yrx.3	P22102	OTTHUMG00000065628	ENST00000381831.3:c.469G>A	21.37:g.34904710C>T	ENSP00000371253:p.Gly157Arg	402	0		627	130	NM_001136005	0	0	49	84	35	A8K945|A8KA32|D3DSF3|D3DSF4|O14659|Q52M77	Missense_Mutation	SNP	ENST00000381831.3	37	CCDS13627.1	.	.	.	.	.	.	.	.	.	.	C	35	5.450836	0.96205	.	.	ENSG00000159131	ENST00000381815;ENST00000381831;ENST00000381839;ENST00000361093;ENST00000430874;ENST00000426819	T;T;T;T;T;T	0.67698	0.46;0.46;0.46;0.38;-0.15;-0.28	6.07	6.07	0.98685	ATP-grasp fold (1);ATP-grasp fold, subdomain 1 (1);Phosphoribosylglycinamide synthetase, ATP-grasp (A) domain (1);	0.000000	0.85682	D	0.000000	D	0.87787	0.6265	H	0.94542	3.55	0.80722	D	1	D	0.89917	1.0	D	0.72625	0.978	D	0.89842	0.4003	10	0.87932	D	0	-20.8496	20.6593	0.99626	0.0:1.0:0.0:0.0	.	157	P22102	PUR2_HUMAN	R	157	ENSP00000371236:G157R;ENSP00000371253:G157R;ENSP00000371261:G157R;ENSP00000354388:G157R;ENSP00000413040:G157R;ENSP00000398631:G157R	ENSP00000354388:G157R	G	-	1	0	GART	33826580	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	7.487000	0.81328	2.885000	0.99019	0.655000	0.94253	GGG	.		0.428	GART-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140626.3	NM_000819	
ADORA2A	135	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	24837246	24837246	+	Missense_Mutation	SNP	C	C	T			TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr22:24837246C>T	ENST00000337539.7	+	3	1487	c.1028C>T	c.(1027-1029)cCa>cTa	p.P343L	ADORA2A-AS1_ENST00000326341.4_RNA|ADORA2A-AS1_ENST00000427813.2_RNA|ADORA2A-AS1_ENST00000543438.1_RNA|SPECC1L-ADORA2A_ENST00000358654.2_3'UTR	NM_000675.4|NM_001278497.1|NM_001278498.1|NM_001278499.1|NM_001278500.1	NP_000666.2|NP_001265426.1|NP_001265427.1|NP_001265428.1|NP_001265429.1	P29274	AA2AR_HUMAN	adenosine A2a receptor	343					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|apoptotic process (GO:0006915)|blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cAMP biosynthetic process (GO:0006171)|cell-cell signaling (GO:0007267)|cellular defense response (GO:0006968)|central nervous system development (GO:0007417)|inflammatory response (GO:0006954)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phagocytosis (GO:0006909)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|sensory perception (GO:0007600)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|G-protein coupled adenosine receptor activity (GO:0001609)|identical protein binding (GO:0042802)			breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|liver(1)|lung(7)|skin(1)	21	Colorectal(2;0.196)				Adenosine(DB00640)|Caffeine(DB00201)|Defibrotide(DB04932)|Dyphylline(DB00651)|Enprofylline(DB00824)|Mefloquine(DB00358)|Oxtriphylline(DB01303)|Pentoxifylline(DB00806)|Regadenoson(DB06213)|Theobromine(DB01412)|Theophylline(DB00277)	GGCCACCCGCCAGGAGTGTGG	0.662																																					p.P343L		.											.	ADORA2A-90	0			c.C1028T						.						25.0	22.0	23.0					22																	24837246		2202	4299	6501	SO:0001583	missense	135	exon3			ACCCGCCAGGAGT	X68486	CCDS13826.1	22q11.23	2012-08-08			ENSG00000128271	ENSG00000128271		"""GPCR / Class A : Adenosine receptors"""	263	protein-coding gene	gene with protein product		102776		ADORA2		1662665, 2541503	Standard	NM_001278497		Approved	RDC8	uc002zzy.4	P29274	OTTHUMG00000150761	ENST00000337539.7:c.1028C>T	22.37:g.24837246C>T	ENSP00000336630:p.Pro343Leu	41	0		71	17	NM_000675	0	0	14	14	0	B2R7E0	Missense_Mutation	SNP	ENST00000337539.7	37	CCDS13826.1	.	.	.	.	.	.	.	.	.	.	C	1.893	-0.454933	0.04540	.	.	ENSG00000128271	ENST00000444262;ENST00000541988;ENST00000337539;ENST00000417596	T;T	0.62941	0.01;-0.01	4.95	0.288	0.15719	.	0.374401	0.24291	N	0.039802	T	0.37972	0.1023	N	0.24115	0.695	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.08722	-1.0708	10	0.26408	T	0.33	-1.5144	3.3452	0.07132	0.1839:0.3375:0.0:0.4785	.	343	P29274	AA2AR_HUMAN	L	343	ENSP00000414802:P343L;ENSP00000336630:P343L	ENSP00000336630:P343L	P	+	2	0	ADORA2A	23167246	0.000000	0.05858	0.000000	0.03702	0.511000	0.34104	0.577000	0.23758	0.177000	0.19895	0.462000	0.41574	CCA	.		0.662	ADORA2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319971.2	NM_000675	
IGSF10	285313	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	151161388	151161388	+	Missense_Mutation	SNP	T	T	A			TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr3:151161388T>A	ENST00000282466.3	-	5	5346	c.5347A>T	c.(5347-5349)Aac>Tac	p.N1783Y	IGSF10_ENST00000495443.1_5'Flank	NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	1783	Ig-like C2-type 4.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			ACTGTTTGGTTTGCAAGAATC	0.498																																					p.N1783Y		.											.	IGSF10-102	0			c.A5347T						.						125.0	112.0	116.0					3																	151161388		2203	4300	6503	SO:0001583	missense	285313	exon5			TTTGGTTTGCAAG	AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.5347A>T	3.37:g.151161388T>A	ENSP00000282466:p.Asn1783Tyr	98	0		170	45	NM_178822	0	0	0	0	0	Q86YJ9|Q8N772|Q8NA84	Missense_Mutation	SNP	ENST00000282466.3	37	CCDS3160.1	.	.	.	.	.	.	.	.	.	.	T	18.09	3.546893	0.65198	.	.	ENSG00000152580	ENST00000282466;ENST00000544042	T	0.80909	-1.43	5.25	5.25	0.73442	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.52532	D	0.000074	D	0.89522	0.6739	M	0.85099	2.735	0.58432	D	0.999991	D	0.89917	1.0	D	0.97110	1.0	D	0.90304	0.4332	9	.	.	.	.	11.1386	0.48390	0.0:0.0747:0.0:0.9253	.	1783	Q6WRI0	IGS10_HUMAN	Y	1783;410	ENSP00000282466:N1783Y	.	N	-	1	0	IGSF10	152644078	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	4.209000	0.58493	1.989000	0.58080	0.477000	0.44152	AAC	.		0.498	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357782.1	NM_178822	
GOLIM4	27333	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	167742778	167742778	+	Missense_Mutation	SNP	T	T	C			TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr3:167742778T>C	ENST00000470487.1	-	13	2418	c.1729A>G	c.(1729-1731)Aat>Gat	p.N577D	GOLIM4_ENST00000309027.4_Missense_Mutation_p.N549D	NM_014498.3	NP_055313.1	O00461	GOLI4_HUMAN	golgi integral membrane protein 4	577	Glu-rich.				transport (GO:0006810)	cis-Golgi network (GO:0005801)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(5)|endometrium(2)|large_intestine(8)|lung(26)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						TGCTCTTCATTTTCATCTGGC	0.408																																					p.N577D		.											.	GOLIM4-291	0			c.A1729G						.						220.0	192.0	202.0					3																	167742778		2203	4300	6503	SO:0001583	missense	27333	exon13			CTTCATTTTCATC	U55853	CCDS3204.1	3q26	2007-07-30	2007-07-30	2007-07-30	ENSG00000173905	ENSG00000173905			15448	protein-coding gene	gene with protein product		606805	"""golgi phosphoprotein 4"""	GOLPH4		9201717, 15004235	Standard	NM_014498		Approved	GPP130, GIMPC, P138	uc003ffe.2	O00461	OTTHUMG00000158554	ENST00000470487.1:c.1729A>G	3.37:g.167742778T>C	ENSP00000417354:p.Asn577Asp	156	0		194	36	NM_014498	0	0	52	88	36		Missense_Mutation	SNP	ENST00000470487.1	37	CCDS3204.1	.	.	.	.	.	.	.	.	.	.	T	18.56	3.649660	0.67358	.	.	ENSG00000173905	ENST00000470487;ENST00000309027	.	.	.	6.0	6.0	0.97389	.	0.224151	0.53938	D	0.000046	T	0.55577	0.1929	M	0.69823	2.125	0.35647	D	0.811481	P;P	0.40875	0.731;0.731	B;B	0.36845	0.234;0.234	T	0.63937	-0.6524	9	0.15499	T	0.54	-6.4985	16.56	0.84537	0.0:0.0:0.0:1.0	.	549;577	F8W785;O00461	.;GOLI4_HUMAN	D	577;549	.	ENSP00000309893:N549D	N	-	1	0	GOLIM4	169225472	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.450000	0.60041	2.313000	0.78055	0.454000	0.30748	AAT	.		0.408	GOLIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351278.2		
BST1	683	hgsc.bcm.edu	37	4	15704874	15704874	+	Missense_Mutation	SNP	G	G	C	rs2302468	byFrequency	TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr4:15704874G>C	ENST00000265016.4	+	1	302	c.107G>C	c.(106-108)gGg>gCg	p.G36A	BST1_ENST00000382346.3_Missense_Mutation_p.G36A	NM_004334.2	NP_004325.2	Q10588	BST1_HUMAN	bone marrow stromal cell antigen 1	36				G -> A (in Ref. 1; BAA04885). {ECO:0000305}.	humoral immune response (GO:0006959)|multicellular organismal development (GO:0007275)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	NAD(P)+ nucleosidase activity (GO:0050135)|NAD+ nucleosidase activity (GO:0003953)|transferase activity (GO:0016740)			central_nervous_system(1)|large_intestine(1)|lung(2)|stomach(3)|urinary_tract(1)	8						cggtggcgcggggAGGGCACC	0.736													G|||	381	0.0760783	0.0212	0.0389	5008	,	,		9714	0.2103		0.008	False		,,,				2504	0.1084				p.G36A		.											.	BST1-90	0			c.G107C						.	G	ALA/GLY	23,3787		0,23,1882	3.0	4.0	4.0		107	3.4	1.0	4	dbSNP_100	4	19,7693		0,19,3837	no	missense	BST1	NM_004334.2	60	0,42,5719	CC,CG,GG		0.2464,0.6037,0.3645	possibly-damaging	36/319	15704874	42,11480	1905	3856	5761	SO:0001583	missense	683	exon1			GGCGCGGGGAGGG	D21878	CCDS3416.1	4p15	2010-05-04			ENSG00000109743	ENSG00000109743	3.2.2.5	"""CD molecules"""	1118	protein-coding gene	gene with protein product	"""NAD(+) nucleosidase"", ""ADP-ribosyl cyclase 2"""	600387				8202488	Standard	NM_004334		Approved	CD157	uc003goh.4	Q10588	OTTHUMG00000097739	ENST00000265016.4:c.107G>C	4.37:g.15704874G>C	ENSP00000265016:p.Gly36Ala	2	0		10	6	NM_004334	0	0	0	0	0	B2R6A2|Q1XII0|Q5U0K0|Q96EN3	Missense_Mutation	SNP	ENST00000265016.4	37	CCDS3416.1	141	0.06456043956043957	13	0.026422764227642278	10	0.027624309392265192	112	0.1958041958041958	6	0.0079155672823219	G	14.40	2.524166	0.44866	0.006037	0.002464	ENSG00000109743	ENST00000265016;ENST00000382346	T;T	0.17370	2.28;2.28	3.39	3.39	0.38822	.	0.510528	0.20699	N	0.087320	T	0.00039	0.0001	M	0.63843	1.955	0.36618	P	0.12441999999999998	D	0.76494	0.999	D	0.80764	0.994	T	0.04005	-1.0985	9	0.62326	D	0.03	-9.3919	10.4016	0.44233	0.0:0.0:1.0:0.0	rs2302468	36	Q10588	BST1_HUMAN	A	36	ENSP00000265016:G36A;ENSP00000371783:G36A	ENSP00000265016:G36A	G	+	2	0	BST1	15313972	0.859000	0.29813	0.955000	0.39395	0.020000	0.10135	2.992000	0.49417	1.879000	0.54435	0.462000	0.41574	GGG	G|0.084;C|0.916		0.736	BST1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000214968.2	NM_004334	
CENPE	1062	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	104117119	104117119	+	Silent	SNP	A	A	C			TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr4:104117119A>C	ENST00000265148.3	-	4	404	c.315T>G	c.(313-315)gtT>gtG	p.V105V	CENPE_ENST00000380026.3_Silent_p.V105V	NM_001813.2	NP_001804.2	Q02224	CENPE_HUMAN	centromere protein E, 312kDa	105	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|kinetochore assembly (GO:0051382)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic chromosome movement towards spindle pole (GO:0007079)|mitotic metaphase plate congression (GO:0007080)|multicellular organismal development (GO:0007275)|positive regulation of protein kinase activity (GO:0045860)|regulation of mitotic metaphase/anaphase transition (GO:0030071)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinetochore binding (GO:0043515)|microtubule motor activity (GO:0003777)			NS(3)|breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(20)|lung(34)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(5)|urinary_tract(3)	101				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		CCCTGGGTATAACTCCCAAAT	0.358																																					p.V105V		.											.	CENPE-277	0			c.T315G						.						106.0	101.0	103.0					4																	104117119		2202	4300	6502	SO:0001819	synonymous_variant	1062	exon4			GGGTATAACTCCC	Z15005	CCDS34042.1, CCDS68768.1	4q24-q25	2013-11-05	2002-08-29			ENSG00000138778		"""Kinesins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1856	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 61"""	117143	"""centromere protein E (312kD)"""			7851898	Standard	NM_001286734		Approved	KIF10, PPP1R61	uc003hxb.1	Q02224		ENST00000265148.3:c.315T>G	4.37:g.104117119A>C		54	0		49	10	NM_001813	0	0	0	0	0	A6NKY9|A8K2U7|Q4LE75	Silent	SNP	ENST00000265148.3	37	CCDS34042.1																																																																																			.		0.358	CENPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
TPPP	11076	hgsc.bcm.edu	37	5	678087	678087	+	Missense_Mutation	SNP	C	C	T	rs570878136	byFrequency	TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr5:678087C>T	ENST00000360578.5	-	2	210	c.89G>A	c.(88-90)aGg>aAg	p.R30K	CTD-2589H19.6_ENST00000607068.1_RNA	NM_007030.2	NP_008961.1	O94811	TPPP_HUMAN	tubulin polymerization promoting protein	30	Mediates interaction with LIMK1.				microtubule bundle formation (GO:0001578)|microtubule polymerization (GO:0046785)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein polymerization (GO:0032273)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	microtubule binding (GO:0008017)|tubulin binding (GO:0015631)	p.R30K(1)		kidney(1)|large_intestine(1)|lung(2)|prostate(1)	5		Ovarian(839;0.0563)	Epithelial(17;0.000445)|all cancers(22;0.00176)|OV - Ovarian serous cystadenocarcinoma(19;0.00227)|Lung(60;0.0863)	GBM - Glioblastoma multiforme(108;0.0191)		CAGCGACAGCCTCTTGGCTGC	0.677													C|||	15	0.00299521	0.0061	0.0	5008	,	,		16462	0.0069		0.0	False		,,,				2504	0.0				p.R30K		.											.	TPPP-90	1	Substitution - Missense(1)	prostate(1)	c.G89A						.						14.0	17.0	16.0					5																	678087		2199	4295	6494	SO:0001583	missense	11076	exon2			GACAGCCTCTTGG	AB017016	CCDS3856.1	5p15.33	2008-02-05			ENSG00000171368	ENSG00000171368			24164	protein-coding gene	gene with protein product	"""brain specific protein p25 alpha"""	608773				10083737, 12093283, 15590652, 17105200	Standard	NM_007030		Approved	p25alpha, TPPP1, p25, TPPP/p25	uc003jbh.4	O94811	OTTHUMG00000131011	ENST00000360578.5:c.89G>A	5.37:g.678087C>T	ENSP00000353785:p.Arg30Lys	29	0		73	5	NM_007030	0	0	3	3	0		Missense_Mutation	SNP	ENST00000360578.5	37	CCDS3856.1	.	.	.	.	.	.	.	.	.	.	c	14.67	2.605282	0.46423	.	.	ENSG00000171368	ENST00000360578	T	0.45276	0.9	5.23	5.23	0.72850	.	0.149935	0.44902	D	0.000407	T	0.29588	0.0738	L	0.29908	0.895	0.44635	D	0.997618	B	0.15141	0.012	B	0.13407	0.009	T	0.11867	-1.0570	10	0.05436	T	0.98	-54.1656	16.5545	0.84482	0.0:1.0:0.0:0.0	.	30	O94811	TPPP_HUMAN	K	30	ENSP00000353785:R30K	ENSP00000353785:R30K	R	-	2	0	TPPP	731087	1.000000	0.71417	0.998000	0.56505	0.405000	0.30901	4.081000	0.57627	2.437000	0.82529	0.491000	0.48974	AGG	.		0.677	TPPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253645.3	NM_007030	
IL6ST	3572	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	55247844	55247844	+	Missense_Mutation	SNP	C	C	G			TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr5:55247844C>G	ENST00000381298.2	-	13	1924	c.1612G>C	c.(1612-1614)Gag>Cag	p.E538Q	IL6ST_ENST00000536319.1_3'UTR|IL6ST_ENST00000522633.2_3'UTR|IL6ST_ENST00000381287.4_3'UTR|IL6ST_ENST00000336909.5_Missense_Mutation_p.E538Q|IL6ST_ENST00000381293.2_Intron|IL6ST_ENST00000381286.3_Intron|IL6ST_ENST00000381294.3_Missense_Mutation_p.E477Q|IL6ST_ENST00000502326.3_Missense_Mutation_p.E538Q	NM_001190981.1|NM_002184.3|NM_175767.2	NP_001177910.1|NP_002175.2|NP_786943.1	P40189	IL6RB_HUMAN	interleukin 6 signal transducer	538	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|glycogen metabolic process (GO:0005977)|interleukin-27-mediated signaling pathway (GO:0070106)|interleukin-6-mediated signaling pathway (GO:0070102)|leukemia inhibitory factor signaling pathway (GO:0048861)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-6-mediated signaling pathway (GO:0070104)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of adaptive immune response (GO:0002821)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation (GO:0008284)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of Notch signaling pathway (GO:0008593)|response to cytokine (GO:0034097)|viral process (GO:0016032)	ciliary neurotrophic factor receptor complex (GO:0070110)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|interleukin-6 receptor complex (GO:0005896)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|oncostatin-M receptor complex (GO:0005900)|plasma membrane (GO:0005886)	ciliary neurotrophic factor receptor activity (GO:0004897)|ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|interleukin-11 receptor activity (GO:0004921)|interleukin-27 receptor activity (GO:0045509)|protein homodimerization activity (GO:0042803)			breast(2)|endometrium(5)|kidney(5)|large_intestine(4)|liver(2)|lung(1)|ovary(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	26		Lung NSC(810;8.69e-05)|Prostate(74;0.00308)|Breast(144;0.0544)|Ovarian(174;0.223)				TGGTCCCACTCTAAGACAGCT	0.348			O		hepatocellular ca																																p.E538Q		.		Dom	yes		5	5q11	3572	"""interleukin 6 signal transducer (gp130, oncostatin M receptor)"""		E	.	IL6ST-290	0			c.G1612C						.						75.0	64.0	68.0					5																	55247844		2203	4300	6503	SO:0001583	missense	3572	exon13			CCCACTCTAAGAC	M57230	CCDS3971.1, CCDS47209.1, CCDS54856.1	5q11.2	2014-04-04	2014-04-04		ENSG00000134352	ENSG00000134352		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	6021	protein-coding gene	gene with protein product	"""gp130, oncostatin M receptor"""	600694	"""interleukin 6 signal transducer (gp130, oncostatin M receptor)"""			2261637	Standard	NM_002184		Approved	GP130, CD130	uc003jqq.3	P40189	OTTHUMG00000097043	ENST00000381298.2:c.1612G>C	5.37:g.55247844C>G	ENSP00000370698:p.Glu538Gln	70	0		64	6	NM_002184	0	0	25	44	19	A0N0L4|Q5FC04|Q9UQ41	Missense_Mutation	SNP	ENST00000381298.2	37	CCDS3971.1	.	.	.	.	.	.	.	.	.	.	C	12.30	1.897415	0.33535	.	.	ENSG00000134352	ENST00000381298;ENST00000336909;ENST00000381294	T;T;T	0.57273	0.41;0.41;0.41	5.83	5.83	0.93111	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.455228	0.26089	N	0.026407	T	0.22085	0.0532	N	0.01352	-0.895	0.80722	D	1	B;B;B	0.18610	0.008;0.029;0.008	B;B;B	0.21151	0.011;0.033;0.011	T	0.29181	-1.0020	10	0.13853	T	0.58	.	9.4221	0.38557	0.0:0.7741:0.1461:0.0799	.	538;477;538	Q17RA0;Q5FC04;P40189	.;.;IL6RB_HUMAN	Q	538;538;477	ENSP00000370698:E538Q;ENSP00000338799:E538Q;ENSP00000370694:E477Q	ENSP00000338799:E538Q	E	-	1	0	IL6ST	55283601	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	0.907000	0.28531	2.770000	0.95276	0.655000	0.94253	GAG	.		0.348	IL6ST-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000214146.3	NM_002184	
PCDHGA1	56114	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	140712677	140712677	+	Intron	SNP	A	A	G			TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr5:140712677A>G	ENST00000517417.1	+	1	2421				PCDHGA1_ENST00000378105.3_Missense_Mutation_p.N809S	NM_018912.2	NP_061735.1	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1						homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|lung(32)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCTCAGGTAAACTTTTGTGAT	0.388																																					p.N809S		.											.	PCDHGA1-137	0			c.A2426G						.						50.0	53.0	52.0					5																	140712677		2203	4300	6503	SO:0001627	intron_variant	56114	exon1			AGGTAAACTTTTG	AF152318	CCDS54922.1	5q31	2010-01-26				ENSG00000204956		"""Cadherins / Protocadherins : Clustered"""	8696	other	protocadherin		606288				10380929	Standard	NM_018912		Approved	PCDH-GAMMA-A1		Q9Y5H4		ENST00000517417.1:c.2421+5A>G	5.37:g.140712677A>G		104	0		173	34	NM_031993	0	0	4	4	0	Q2M273|Q9Y5D6	Missense_Mutation	SNP	ENST00000517417.1	37	CCDS54922.1	.	.	.	.	.	.	.	.	.	.	.	2.192	-0.385092	0.04966	.	.	ENSG00000204956	ENST00000378105	T	0.47869	0.83	4.15	0.129	0.14739	.	0.924660	0.08888	U	0.879068	T	0.21427	0.0516	N	0.08118	0	0.09310	N	0.999996	B	0.13145	0.007	B	0.09377	0.004	T	0.20174	-1.0283	9	.	.	.	.	2.5439	0.04732	0.462:0.0:0.194:0.344	.	809	Q9Y5H4-2	.	S	809	ENSP00000367345:N809S	.	N	+	2	0	PCDHGA1	140692861	0.001000	0.12720	0.351000	0.25721	0.671000	0.39405	-0.689000	0.05144	-0.058000	0.13177	-0.468000	0.05107	AAC	.		0.388	PCDHGA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374737.1	NM_018912	
CSF1R	1436	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	149433707	149433707	+	Missense_Mutation	SNP	A	A	T			TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr5:149433707A>T	ENST00000286301.3	-	22	3135	c.2844T>A	c.(2842-2844)agT>agA	p.S948R		NM_005211.3	NP_005202.2	P07333	CSF1R_HUMAN	colony stimulating factor 1 receptor	948					cell proliferation (GO:0008283)|cell-cell junction maintenance (GO:0045217)|cellular response to cytokine stimulus (GO:0071345)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cytokine-mediated signaling pathway (GO:0019221)|hemopoiesis (GO:0030097)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|macrophage differentiation (GO:0030225)|mammary gland duct morphogenesis (GO:0060603)|monocyte differentiation (GO:0030224)|multicellular organismal development (GO:0007275)|osteoclast differentiation (GO:0030316)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol metabolic process (GO:0046488)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell motility (GO:2000147)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of bone resorption (GO:0045124)|regulation of cell shape (GO:0008360)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|macrophage colony-stimulating factor receptor activity (GO:0005011)|protein homodimerization activity (GO:0042803)			NS(2)|breast(2)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(38)|kidney(2)|large_intestine(6)|liver(3)|lung(23)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	93			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		Imatinib(DB00619)|Sunitinib(DB01268)	TCAGGTGCTCACTAGAGCTCT	0.602																																					p.S948R		.											.	CSF1R-2640	0			c.T2844A						.						38.0	35.0	36.0					5																	149433707		2203	4300	6503	SO:0001583	missense	1436	exon22			GTGCTCACTAGAG	U63963	CCDS4302.1	5q32	2013-01-11	2008-08-01		ENSG00000182578	ENSG00000182578		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	2433	protein-coding gene	gene with protein product		164770	"""McDonough feline sarcoma viral (v-fms) oncogene homolog"""	FMS		1611909	Standard	NM_005211		Approved	C-FMS, CSFR, CD115	uc003lrm.3	P07333	OTTHUMG00000130050	ENST00000286301.3:c.2844T>A	5.37:g.149433707A>T	ENSP00000286301:p.Ser948Arg	28	0		67	14	NM_005211	0	0	71	71	0	B5A955|D3DQG2|Q6LDW5|Q6LDY4|Q86VW7	Missense_Mutation	SNP	ENST00000286301.3	37	CCDS4302.1	.	.	.	.	.	.	.	.	.	.	A	9.983	1.228611	0.22542	.	.	ENSG00000182578	ENST00000286301	T	0.30182	1.54	5.25	-4.77	0.03219	.	0.092077	0.47852	D	0.000212	T	0.23133	0.0559	L	0.50333	1.59	0.54753	D	0.999989	D	0.54397	0.966	B	0.44315	0.446	T	0.11792	-1.0573	10	0.51188	T	0.08	.	7.9653	0.30095	0.2777:0.0:0.6023:0.12	.	948	P07333	CSF1R_HUMAN	R	948	ENSP00000286301:S948R	ENSP00000286301:S948R	S	-	3	2	CSF1R	149413900	0.078000	0.21339	0.618000	0.29105	0.009000	0.06853	-0.609000	0.05635	-0.866000	0.04068	-0.490000	0.04691	AGT	.		0.602	CSF1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252329.2	NM_005211	
HLA-G	3135	ucsc.edu	37	6	29797253	29797253	+	Silent	SNP	G	G	A			TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr6:29797253G>A	ENST00000360323.6	+	4	702	c.678G>A	c.(676-678)agG>agA	p.R226R	HLA-G_ENST00000428701.1_Silent_p.R226R|HLA-G_ENST00000376815.3_Intron|HLA-G_ENST00000376828.2_Silent_p.R231R|HLA-G_ENST00000376818.3_Silent_p.R134R			P17693	HLAG_HUMAN	major histocompatibility complex, class I, G	226	Alpha-3.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular defense response (GO:0006968)|cytokine-mediated signaling pathway (GO:0019221)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T cell tolerance induction (GO:0002666)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)	early endosome membrane (GO:0031901)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|membrane (GO:0016020)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.R226S(1)		central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(4)|ovary(3)|pancreas(1)|prostate(5)|skin(1)	21						CCACCCTGAGGTGCTGGGCCC	0.592																																					p.R226R													.	HLA-G-517	1	Substitution - Missense(1)	lung(1)	c.G678A						.						92.0	96.0	94.0					6																	29797253		2203	4300	6503	SO:0001819	synonymous_variant	3135	exon5			CCTGAGGTGCTGG		CCDS4668.1	6p21.3	2013-01-11	2007-12-12		ENSG00000204632	ENSG00000204632		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4964	protein-coding gene	gene with protein product	"""b2 microglobulin"""	142871	"""HLA-G histocompatibility antigen, class I, G"""				Standard	NM_002127		Approved		uc003nnw.2	P17693	OTTHUMG00000031157	ENST00000360323.6:c.678G>A	6.37:g.29797253G>A		229	0		542	2	NM_002127	1	2	7214	7221	4		Silent	SNP	ENST00000360323.6	37	CCDS4668.1																																																																																			.		0.592	HLA-G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076286.2	NM_002127	
VARS	7407	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	31762754	31762754	+	Missense_Mutation	SNP	G	G	T			TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr6:31762754G>T	ENST00000375663.3	-	2	681	c.241C>A	c.(241-243)Cca>Aca	p.P81T	LSM2_ENST00000491421.1_5'Flank|VARS_ENST00000444930.2_Intron	NM_006295.2	NP_006286.1	P26640	SYVC_HUMAN	valyl-tRNA synthetase	81					gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)|valyl-tRNA aminoacylation (GO:0006438)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|valine-tRNA ligase activity (GO:0004832)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(18)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	30					L-Valine(DB00161)	AGGCCTGCTGGCCACAGCAGC	0.711																																					p.P81T		.											.	VARS-93	0			c.C241A						.						13.0	19.0	16.0					6																	31762754		1478	2637	4115	SO:0001583	missense	7407	exon2			CTGCTGGCCACAG	BC012808	CCDS34412.1	6p21.3	2011-07-01		2005-07-05	ENSG00000204394	ENSG00000204394	6.1.1.9	"""Aminoacyl tRNA synthetases / Class I"""	12651	protein-coding gene	gene with protein product	"""valine tRNA ligase 1, cytoplasmic"""	192150	"""valyl-tRNA synthetase 2"""	VARS2		15779907	Standard	XM_005249362		Approved		uc003nxe.3	P26640	OTTHUMG00000031286	ENST00000375663.3:c.241C>A	6.37:g.31762754G>T	ENSP00000364815:p.Pro81Thr	59	0		86	15	NM_006295	0	0	14	21	7	B0V1N1|B4DZ61|Q5JQ90|Q96E77|Q9UQM2	Missense_Mutation	SNP	ENST00000375663.3	37	CCDS34412.1	.	.	.	.	.	.	.	.	.	.	G	14.34	2.505254	0.44558	.	.	ENSG00000204394	ENST00000375663;ENST00000440048	T;T	0.06849	3.25;3.25	5.24	5.24	0.73138	Glutathione S-transferase, N-terminal (1);	0.142308	0.47455	D	0.000231	T	0.04003	0.0112	N	0.24115	0.695	0.80722	D	1	P	0.44139	0.827	P	0.45276	0.475	T	0.29366	-1.0014	10	0.87932	D	0	-2.2071	9.8609	0.41114	0.0931:0.0:0.9069:0.0	.	81	P26640	SYVC_HUMAN	T	81	ENSP00000364815:P81T;ENSP00000413925:P81T	ENSP00000364815:P81T	P	-	1	0	VARS	31870733	1.000000	0.71417	0.999000	0.59377	0.392000	0.30506	2.707000	0.47143	2.461000	0.83175	0.462000	0.41574	CCA	.		0.711	VARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076619.2	NM_006295	
AARS2	57505	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	44272835	44272835	+	Missense_Mutation	SNP	T	T	A			TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr6:44272835T>A	ENST00000244571.4	-	11	1537	c.1535A>T	c.(1534-1536)gAc>gTc	p.D512V	TMEM151B_ENST00000438774.2_Intron|RP11-444E17.6_ENST00000505802.1_Intron	NM_020745.3	NP_065796			alanyl-tRNA synthetase 2, mitochondrial											breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(3)|skin(2)|stomach(1)	34	Hepatocellular(11;0.00908)|all_lung(25;0.0101)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			CTTGGGGCTGTCGTCAGTTGG	0.607											OREG0017473	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.D512V		.											.	AARS2-91	0			c.A1535T						.						128.0	121.0	123.0					6																	44272835		2203	4300	6503	SO:0001583	missense	57505	exon11			GGGCTGTCGTCAG	AB033096	CCDS34464.1	6p21.1	2012-10-26	2012-10-26	2007-02-23	ENSG00000124608	ENSG00000124608	6.1.1.7	"""Aminoacyl tRNA synthetases / Class II"""	21022	protein-coding gene	gene with protein product	"""alanine tRNA ligase 2, mitochondrial"""	612035	"""alanyl-tRNA synthetase like"", ""alanyl-tRNA synthetase 2, mitochondrial (putative)"""	AARSL		15779907, 21549344	Standard	NM_020745		Approved	KIAA1270, bA444E17.1	uc010jza.1	Q5JTZ9	OTTHUMG00000014766	ENST00000244571.4:c.1535A>T	6.37:g.44272835T>A	ENSP00000244571:p.Asp512Val	179	0	922	370	34	NM_020745	0	0	14	17	3		Missense_Mutation	SNP	ENST00000244571.4	37	CCDS34464.1	.	.	.	.	.	.	.	.	.	.	T	13.94	2.385639	0.42308	.	.	ENSG00000124608	ENST00000244571	T	0.72725	-0.68	5.01	3.83	0.44106	Alanyl-tRNA synthetase, class IIc, anti-codon-binding domain (1);Alanyl-tRNA synthetase, class IIc, core domain (1);Alanyl-tRNA synthetase, class IIc, N-terminal (1);	0.096640	0.64402	D	0.000001	T	0.77478	0.4136	M	0.73598	2.24	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.79962	-0.1582	10	0.87932	D	0	-17.649	12.7414	0.57255	0.0:0.0715:0.0:0.9285	.	512	Q5JTZ9	SYAM_HUMAN	V	512	ENSP00000244571:D512V	ENSP00000244571:D512V	D	-	2	0	AARS2	44380813	1.000000	0.71417	0.925000	0.36789	0.052000	0.14988	5.622000	0.67750	0.272000	0.22027	-1.186000	0.01703	GAC	.		0.607	AARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040741.2	NM_020745	
PUS7	54517	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	105099624	105099624	+	Missense_Mutation	SNP	A	A	G			TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr7:105099624A>G	ENST00000356362.2	-	15	2054	c.1840T>C	c.(1840-1842)Ttt>Ctt	p.F614L	PUS7_ENST00000469408.1_Missense_Mutation_p.F614L	NM_019042.3	NP_061915.2	Q96PZ0	PUS7_HUMAN	pseudouridylate synthase 7 (putative)	614					pseudouridine synthesis (GO:0001522)|tRNA processing (GO:0008033)		enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|pseudouridine synthase activity (GO:0009982)			breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(8)|pancreas(1)|skin(1)	23						CCAGAAGCAAAAACTGGTGGT	0.353																																					p.F614L	Colon(138;2387 3051 17860)	.											.	PUS7-90	0			c.T1840C						.						136.0	115.0	122.0					7																	105099624		2203	4300	6503	SO:0001583	missense	54517	exon15			AAGCAAAAACTGG	AK128629	CCDS34725.1	7q22.3	2014-02-14	2014-02-14		ENSG00000091127	ENSG00000091127			26033	protein-coding gene	gene with protein product			"""pseudouridylate synthase 7 homolog (S. cerevisiae)"""			11572484	Standard	NM_019042		Approved	FLJ20485	uc003vcx.3	Q96PZ0	OTTHUMG00000157399	ENST00000356362.2:c.1840T>C	7.37:g.105099624A>G	ENSP00000348722:p.Phe614Leu	100	0		85	16	NM_019042	0	0	0	0	0	Q75MG4|Q9NX19	Missense_Mutation	SNP	ENST00000356362.2	37	CCDS34725.1	.	.	.	.	.	.	.	.	.	.	A	10.52	1.372308	0.24857	.	.	ENSG00000091127	ENST00000356362;ENST00000544995;ENST00000469408	T;T	0.40756	1.02;1.02	5.28	5.28	0.74379	Pseudouridine synthase, catalytic domain (1);	0.171422	0.52532	N	0.000075	T	0.17831	0.0428	N	0.03608	-0.345	0.40339	D	0.979018	B;B	0.11235	0.004;0.004	B;B	0.14023	0.01;0.005	T	0.14699	-1.0463	10	0.10377	T	0.69	-1.6592	8.8965	0.35467	0.9072:0.0:0.0928:0.0	.	614;614	B3KY42;Q96PZ0	.;PUS7_HUMAN	L	614	ENSP00000348722:F614L;ENSP00000417402:F614L	ENSP00000348722:F614L	F	-	1	0	PUS7	104886860	1.000000	0.71417	0.993000	0.49108	0.860000	0.49131	5.995000	0.70631	1.995000	0.58328	0.460000	0.39030	TTT	.		0.353	PUS7-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348681.1	NM_019042	
RINT1	60561	hgsc.bcm.edu	37	7	105177143	105177143	+	Missense_Mutation	SNP	C	C	A			TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr7:105177143C>A	ENST00000257700.2	+	3	451	c.220C>A	c.(220-222)Ctt>Att	p.L74I		NM_021930.4	NP_068749.3	Q6NUQ1	RINT1_HUMAN	RAD50 interactor 1	74					G2 DNA damage checkpoint (GO:0031572)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(9)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22						TTTAAAGAAACTTGATAAACT	0.323																																					p.L74I		.											.	RINT1-517	0			c.C220A						.						91.0	91.0	91.0					7																	105177143		2203	4300	6503	SO:0001583	missense	60561	exon3			AAGAAACTTGATA	AF317622	CCDS34726.1	7q22.2	2007-05-03			ENSG00000135249	ENSG00000135249			21876	protein-coding gene	gene with protein product		610089				11096100, 15029241	Standard	NM_021930		Approved	FLJ11785, RINT-1	uc003vda.1	Q6NUQ1	OTTHUMG00000157400	ENST00000257700.2:c.220C>A	7.37:g.105177143C>A	ENSP00000257700:p.Leu74Ile	93	0		85	5	NM_021930	0	0	10	10	0	Q75MG9|Q75MH0|Q96IW8|Q9H229|Q9HAD9	Missense_Mutation	SNP	ENST00000257700.2	37	CCDS34726.1	.	.	.	.	.	.	.	.	.	.	C	19.32	3.804297	0.70682	.	.	ENSG00000135249	ENST00000257700;ENST00000493041	T	0.25579	1.79	5.2	5.2	0.72013	.	0.130682	0.50627	D	0.000108	T	0.24699	0.0599	L	0.53249	1.67	0.38375	D	0.944982	B	0.26975	0.165	B	0.19391	0.025	T	0.07539	-1.0767	10	0.26408	T	0.33	-14.7993	13.9955	0.64397	0.0:0.8482:0.1518:0.0	.	74	Q6NUQ1	RINT1_HUMAN	I	74;43	ENSP00000257700:L74I	ENSP00000257700:L74I	L	+	1	0	RINT1	104964379	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.435000	0.52849	2.412000	0.81896	0.491000	0.48974	CTT	.		0.323	RINT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348686.1	NM_021930	
KIAA1456	57604	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	12879058	12879058	+	Silent	SNP	T	T	C			TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr8:12879058T>C	ENST00000524591.2	+	5	1359	c.870T>C	c.(868-870)tcT>tcC	p.S290S	KIAA1456_ENST00000447063.2_Intron	NM_001099677.1|NM_020844.2	NP_001093147.1|NP_065895.2	Q9P272	K1456_HUMAN	KIAA1456	290							methyltransferase activity (GO:0008168)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)	7						CCAGACACTCTAGTTTAGACT	0.423																																					p.S290S		.											.	KIAA1456-90	0			c.T870C						.						79.0	77.0	78.0					8																	12879058		1869	4097	5966	SO:0001819	synonymous_variant	57604	exon5			ACACTCTAGTTTA	BC035082	CCDS47808.1	8p22	2013-10-04	2011-02-23	2011-02-23	ENSG00000250305	ENSG00000250305			26725	protein-coding gene	gene with protein product		615666	"""chromosome 8 open reading frame 79"""	C8orf79		23381944	Standard	NM_020844		Approved	FLJ36980	uc010lsq.3	Q8N9K7	OTTHUMG00000165477	ENST00000524591.2:c.870T>C	8.37:g.12879058T>C		64	0		110	26	NM_020844	0	0	0	0	0	Q96AW6	Silent	SNP	ENST00000524591.2	37	CCDS47808.1																																																																																			.		0.423	KIAA1456-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383262.2	NM_001099677	
RP2	6102	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	46713306	46713306	+	Missense_Mutation	SNP	C	C	G			TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chrX:46713306C>G	ENST00000218340.3	+	2	659	c.498C>G	c.(496-498)atC>atG	p.I166M		NM_006915.2	NP_008846.2	O75695	XRP2_HUMAN	retinitis pigmentosa 2 (X-linked recessive)	166	C-CAP/cofactor C-like. {ECO:0000255|PROSITE-ProRule:PRU00659}.				cell morphogenesis (GO:0000902)|CTP biosynthetic process (GO:0006241)|cytoskeleton organization (GO:0007010)|GTP biosynthetic process (GO:0006183)|positive regulation of GTPase activity (GO:0043547)|post-Golgi vesicle-mediated transport (GO:0006892)|protein folding (GO:0006457)|protein transport (GO:0015031)|UTP biosynthetic process (GO:0006228)|visual perception (GO:0007601)	centriole (GO:0005814)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|periciliary membrane compartment (GO:1990075)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|GTPase activator activity (GO:0005096)|nucleoside diphosphate kinase activity (GO:0004550)|unfolded protein binding (GO:0051082)			NS(1)|large_intestine(4)|lung(5)|stomach(1)	11						GGCTAAGTATCTTCAACAATA	0.403																																					p.I166M		.											.	RP2-130	0			c.C498G						.						111.0	97.0	101.0					X																	46713306		2203	4300	6503	SO:0001583	missense	6102	exon2			AAGTATCTTCAAC	AJ007590	CCDS14270.1	Xp11.3	2013-01-08			ENSG00000102218	ENSG00000102218			10274	protein-coding gene	gene with protein product		300757				6325945, 9697692, 19852809	Standard	NM_006915		Approved	TBCCD2, NME10, NM23-H10	uc004dgw.4	O75695	OTTHUMG00000021430	ENST00000218340.3:c.498C>G	X.37:g.46713306C>G	ENSP00000218340:p.Ile166Met	193	0		229	34	NM_006915	0	0	1	9	8	Q86XJ7|Q9NU67	Missense_Mutation	SNP	ENST00000218340.3	37	CCDS14270.1	.	.	.	.	.	.	.	.	.	.	C	14.78	2.637203	0.47049	.	.	ENSG00000102218	ENST00000218340	D	0.86627	-2.15	5.64	3.89	0.44902	Tubulin binding cofactor C (1);C-CAP/cofactor C-like domain (1);	0.093345	0.64402	D	0.000001	D	0.89646	0.6775	M	0.65975	2.015	0.48632	D	0.999683	P	0.52316	0.952	P	0.57324	0.818	D	0.87427	0.2386	10	0.48119	T	0.1	-23.7323	9.0313	0.36260	0.0:0.7697:0.0:0.2303	.	166	O75695	XRP2_HUMAN	M	166	ENSP00000218340:I166M	ENSP00000218340:I166M	I	+	3	3	RP2	46598250	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	1.459000	0.35234	0.558000	0.29135	-0.191000	0.12829	ATC	.		0.403	RP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056375.1	NM_006915	
SLITRK2	84631	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	144904238	144904238	+	Nonsense_Mutation	SNP	C	C	T			TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chrX:144904238C>T	ENST00000370490.1	+	1	4550	c.295C>T	c.(295-297)Cag>Tag	p.Q99*	SLITRK2_ENST00000447897.2_Nonsense_Mutation_p.Q99*|SLITRK2_ENST00000428560.2_Nonsense_Mutation_p.Q99*|SLITRK2_ENST00000434188.2_Nonsense_Mutation_p.Q99*|SLITRK2_ENST00000413937.2_Nonsense_Mutation_p.Q99*			Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2	99					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(17)|lung(40)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	86	Acute lymphoblastic leukemia(192;6.56e-05)					CAACGGGTTACAGGAGATCCG	0.458																																					p.Q99X		.											.	SLITRK2-136	0			c.C295T						.						77.0	69.0	72.0					X																	144904238		2203	4300	6503	SO:0001587	stop_gained	84631	exon5			GGGTTACAGGAGA	Y19205	CCDS14680.1	Xq27.3	2008-02-05	2004-03-11		ENSG00000185985	ENSG00000185985			13449	protein-coding gene	gene with protein product		300561	"""slit-like 1 (Drosophila)"""	SLITL1		11347906, 14557068	Standard	NM_032539		Approved	KIAA1854, CXorf2	uc011mwr.2	Q9H156	OTTHUMG00000022595	ENST00000370490.1:c.295C>T	X.37:g.144904238C>T	ENSP00000359521:p.Gln99*	155	0		243	48	NM_001144005	0	0	0	0	0	A8K117|Q2KHN3|Q5JXB1|Q8NBC7|Q96JH3	Nonsense_Mutation	SNP	ENST00000370490.1	37	CCDS14680.1	.	.	.	.	.	.	.	.	.	.	C	59	34.326611	0.99982	.	.	ENSG00000185985	ENST00000335565;ENST00000447897;ENST00000370490;ENST00000434188;ENST00000413937;ENST00000428560	.	.	.	4.88	4.01	0.46588	.	0.066024	0.64402	U	0.000007	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.27082	T	0.32	-7.1777	12.0035	0.53246	0.0:0.8284:0.1716:0.0	.	.	.	.	X	99	.	ENSP00000334374:Q99X	Q	+	1	0	SLITRK2	144711930	1.000000	0.71417	0.996000	0.52242	0.494000	0.33585	7.818000	0.86416	0.832000	0.34804	-0.218000	0.12543	CAG	.		0.458	SLITRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058633.1	NM_032539	
IPP	3652	broad.mit.edu	37	1	46184897	46184898	+	Frame_Shift_Del	DEL	AC	AC	-	rs144663569		TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	AC	AC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr1:46184897_46184898delAC	ENST00000396478.3	-	6	1265_1266	c.1163_1164delGT	c.(1162-1164)tgtfs	p.C388fs		NM_005897.2	NP_005888.1	Q9Y573	IPP_HUMAN	intracisternal A particle-promoted polypeptide	388						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	actin binding (GO:0003779)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(6)|lung(5)|ovary(1)|stomach(2)	20	Acute lymphoblastic leukemia(166;0.155)					TAGCCCCATAACACACACACAC	0.347																																					p.388_388del													.	IPP-91	0			c.1163_1164del						.																																			SO:0001589	frameshift_variant	3652	exon6			CCCATAACACACA	BC032544	CCDS30702.1, CCDS44132.1	1p34-p32	2013-01-30			ENSG00000197429	ENSG00000197429		"""Kelch-like"", ""BTB/POZ domain containing"""	6108	protein-coding gene	gene with protein product	"""kelch-like family member 27"""	147485				1905535, 8432546	Standard	NM_005897		Approved	KLHL27	uc001cou.3	Q9Y573	OTTHUMG00000008004	ENST00000396478.3:c.1163_1164delGT	1.37:g.46184907_46184908delAC	ENSP00000379739:p.Cys388fs	73	0		118	7	NM_001145349	0	0	0	0	0	A2A6V4|D3DQ11|Q8N5C3	Frame_Shift_Del	DEL	ENST00000396478.3	37	CCDS30702.1																																																																																			.		0.347	IPP-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021974.3	NM_005897	
TSG101	7251	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	18541141	18541142	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	TG	TG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr11:18541141_18541142delTG	ENST00000251968.3	-	2	466_467	c.51_52delCA	c.(49-54)tacagafs	p.YR17fs	TSG101_ENST00000357193.3_Intron|TSG101_ENST00000536719.1_Frame_Shift_Del_p.YR17fs	NM_006292.3	NP_006283.1	Q99816	TS101_HUMAN	tumor susceptibility 101	17	UEV. {ECO:0000255|PROSITE- ProRule:PRU00652}.				cell cycle arrest (GO:0007050)|cell division (GO:0051301)|cellular protein modification process (GO:0006464)|endosomal transport (GO:0016197)|intracellular transport of virus (GO:0075733)|keratinocyte differentiation (GO:0030216)|membrane organization (GO:0061024)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell growth (GO:0001558)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)|viral budding (GO:0046755)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|endosome membrane (GO:0010008)|ESCRT I complex (GO:0000813)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|multivesicular body (GO:0005771)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	calcium-dependent protein binding (GO:0048306)|DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|transcription corepressor activity (GO:0003714)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)			kidney(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	22						GTTAGGTCTCTGTATTTGTACT	0.307																																					p.17_18del	GBM(99;1348 1396 8611 26475 50572)	.											.	TSG101-90	0			c.51_52del						.																																			SO:0001589	frameshift_variant	7251	exon2			.	U82130	CCDS7842.1	11p15	2013-08-22	2013-08-22		ENSG00000074319	ENSG00000074319			15971	protein-coding gene	gene with protein product		601387	"""tumor susceptibility gene 10"", ""tumor susceptibility gene 101"""	TSG10		9019400, 9241264	Standard	NM_006292		Approved	VPS23	uc001mor.3	Q99816	OTTHUMG00000167725	ENST00000251968.3:c.51_52delCA	11.37:g.18541141_18541142delTG	ENSP00000251968:p.Tyr17fs	161	0		136	24	NM_006292	0	0	0	0	0	Q9BUM5	Frame_Shift_Del	DEL	ENST00000251968.3	37	CCDS7842.1																																																																																			.		0.307	TSG101-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395906.1	NM_006292	
PRB2	653247	broad.mit.edu	37	12	11546506	11546508	+	In_Frame_Del	DEL	TTG	TTG	-			TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	TTG	TTG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr12:11546506_11546508delTTG	ENST00000389362.4	-	3	539_541	c.504_506delCAA	c.(502-507)aacaag>aag	p.N168del	PRB2_ENST00000545829.1_5'Flank|PRB1_ENST00000546254.1_Intron	NM_006248.3	NP_006239.3	P02812	PRB2_HUMAN	proline-rich protein BstNI subfamily 2	168	15 X 20 AA approximate tandem repeats of P-P-G-K-P-Q-G-P-P-P-Q-G-[GD]-[NKS]-[KSQ]- [PRS]-[QRS] [GPS]-[PSAR]-[PSR].					extracellular region (GO:0005576)				NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(5)|skin(4)|stomach(2)|urinary_tract(1)	37		all_cancers(2;0.00558)|Acute lymphoblastic leukemia(2;3.94e-11)|all_hematologic(2;3.6e-09)	OV - Ovarian serous cystadenocarcinoma(49;0.185)			ACTTCGGGACTTGTTGTCTCCTT	0.596																																					p.168_169del													.	PRB2-22	0			c.504_506del						.																																			SO:0001651	inframe_deletion	653247	exon3			CGGGACTTGTTGT	K03208	CCDS41757.2	12p13.2	2012-10-02			ENSG00000121335	ENSG00000121335			9338	protein-coding gene	gene with protein product		168810				8554050	Standard	NM_006248		Approved	PRPPRB1, Ps, cP7	uc010shk.1	P02812	OTTHUMG00000156975	ENST00000389362.4:c.504_506delCAA	12.37:g.11546509_11546511delTTG	ENSP00000374013:p.Asn168del	807	2		1866	9	NM_006248	0	0	0	0	0	O00599|P02811|P04281	In_Frame_Del	DEL	ENST00000389362.4	37	CCDS41757.2																																																																																			.		0.596	PRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346925.2	NM_006248	
SIPA1L1	26037	broad.mit.edu	37	14	72190482	72190484	+	In_Frame_Del	DEL	TCC	TCC	-			TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	TCC	TCC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr14:72190482_72190484delTCC	ENST00000555818.1	+	16	4738_4740	c.4390_4392delTCC	c.(4390-4392)tccdel	p.S1468del	SIPA1L1_ENST00000381232.3_In_Frame_Del_p.S1447del|SIPA1L1_ENST00000537413.1_In_Frame_Del_p.S922del|SIPA1L1_ENST00000358550.2_In_Frame_Del_p.S1447del|SIPA1L1_ENST00000554874.1_3'UTR	NM_001284247.1|NM_015556.1	NP_001271176.1|NP_056371.1	O43166	SI1L1_HUMAN	signal-induced proliferation-associated 1 like 1	1468	Ser-rich.				actin cytoskeleton reorganization (GO:0031532)|activation of Rap GTPase activity (GO:0032861)|ephrin receptor signaling pathway (GO:0048013)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rap GTPase activity (GO:0032317)|regulation of synaptic plasticity (GO:0048167)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(1)|large_intestine(22)|liver(2)|lung(25)|ovary(3)|prostate(3)|skin(3)|stomach(1)	78				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)		ctcctcctcttcctcctcctcct	0.552																																					p.1464_1464del													.	SIPA1L1-156	0			c.4390_4392del						.																																			SO:0001651	inframe_deletion	26037	exon16			TCCTCTTCCTCCT	AB007900	CCDS9807.1, CCDS61490.1, CCDS61491.1	14q24.1	2003-12-11				ENSG00000197555			20284	protein-coding gene	gene with protein product						9858596	Standard	XM_005267514		Approved	KIAA0440, E6TP1	uc001xmr.1	O43166		ENST00000555818.1:c.4390_4392delTCC	14.37:g.72190491_72190493delTCC	ENSP00000450832:p.Ser1468del	158	0		308	9	NM_015556	0	0	0	0	0	J3KP19|O95321|Q9UDU4|Q9UNU4	In_Frame_Del	DEL	ENST00000555818.1	37	CCDS9807.1																																																																																			.		0.552	SIPA1L1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412806.1	NM_015556	
MPP3	4356	broad.mit.edu	37	17	41888202	41888203	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	TT	TT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr17:41888202_41888203delTT	ENST00000398389.4	-	18	1595_1596	c.1430_1431delAA	c.(1429-1431)aaafs	p.K477fs	MPP3_ENST00000398393.1_Frame_Shift_Del_p.K502fs	NM_001932.4	NP_001923.2	Q13368	MPP3_HUMAN	membrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3)	477	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.				nucleotide phosphorylation (GO:0046939)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)	guanylate kinase activity (GO:0004385)			endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	26		Breast(137;0.00394)		BRCA - Breast invasive adenocarcinoma(366;0.119)		CCAAACAAACTTTGTTTTTGGC	0.45																																					p.477_477del													.	MPP3-91	0			c.1430_1431del						.																																			SO:0001589	frameshift_variant	4356	exon18			ACAAACTTTGTTT		CCDS42344.1	17q12-q21	2008-07-18			ENSG00000161647	ENSG00000161647			7221	protein-coding gene	gene with protein product	"""MAGUK p55 subfamily member 3"", ""discs, large (Drosophila) homolog 3"", ""membrane protein palmitoylated 3"""	601114		DLG3		8824795	Standard	NR_003562		Approved		uc002iei.4	Q13368	OTTHUMG00000133838	ENST00000398389.4:c.1430_1431delAA	17.37:g.41888202_41888203delTT	ENSP00000381425:p.Lys477fs	260	0		505	8	NM_001932	0	0	0	0	0	B2R7N0|D3DX47|Q4GX05|Q6PGR3|Q86SV1	Frame_Shift_Del	DEL	ENST00000398389.4	37	CCDS42344.1																																																																																			.		0.450	MPP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258371.1	NM_001932	
HAMP	57817	broad.mit.edu	37	19	35773520	35773522	+	In_Frame_Del	DEL	CTC	CTC	-	rs373178250		TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	CTC	CTC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr19:35773520_35773522delCTC	ENST00000598398.1	+	2	336_338	c.40_42delCTC	c.(40-42)ctcdel	p.L18del	HAMP_ENST00000222304.3_In_Frame_Del_p.L18del	NM_021175.2	NP_066998.1	P81172	HEPC_HUMAN	hepcidin antimicrobial peptide	18					cellular iron ion homeostasis (GO:0006879)|defense response to bacterium (GO:0042742)|defense response to fungus (GO:0050832)|immune response (GO:0006955)|killing of cells of other organism (GO:0031640)	apical cortex (GO:0045179)|extracellular region (GO:0005576)				breast(1)|central_nervous_system(1)|large_intestine(1)|lung(1)	4	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)		Epithelial(14;7.4e-20)|OV - Ovarian serous cystadenocarcinoma(14;6.47e-19)|all cancers(14;4.17e-17)|LUSC - Lung squamous cell carcinoma(66;0.0417)			TTGCCTCCTGCTCCTCCTCCTCC	0.64																																					p.14_14del													.	HAMP-90	0			c.40_42del						.																																			SO:0001651	inframe_deletion	57817	exon1			CTCCTGCTCCTCC	AF309489	CCDS12454.1	19q13.1	2014-09-17				ENSG00000105697			15598	protein-coding gene	gene with protein product		606464				11034317, 11113132	Standard	NM_021175		Approved	LEAP-1, HEPC, HFE2B, LEAP1	uc002nyw.3	P81172		ENST00000598398.1:c.40_42delCTC	19.37:g.35773529_35773531delCTC	ENSP00000471894:p.Leu18del	243	0		481	9	NM_021175	0	0	0	0	0	Q1HE14|Q9BY68	In_Frame_Del	DEL	ENST00000598398.1	37	CCDS12454.1																																																																																			.		0.640	HAMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466067.1	NM_021175	
ORC2	4999	bcgsc.ca	37	2	201791481	201791490	+	Splice_Site	DEL	TGAAACTTAC	TGAAACTTAC	-			TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	TGAAACTTAC	TGAAACTTAC	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr2:201791481_201791490delTGAAACTTAC	ENST00000234296.2	-	12	1300		c.e12+1		RN7SL694P_ENST00000584245.1_RNA	NM_006190.4	NP_006181.1	Q13416	ORC2_HUMAN	origin recognition complex, subunit 2						DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	condensed chromosome inner kinetochore (GO:0000939)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|origin recognition complex (GO:0000808)|plasma membrane (GO:0005886)	DNA replication origin binding (GO:0003688)			breast(1)|endometrium(1)|large_intestine(2)|lung(10)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	20						TTAACATTTTTGAAACTTACTGATTTCACA	0.367																																					.													.	ORC2-209	0			.						.																																			SO:0001630	splice_region_variant	4999	.			CATTTTTGAAACT		CCDS2334.1	2q33	2010-10-12	2010-10-12	2010-10-12	ENSG00000115942	ENSG00000115942			8488	protein-coding gene	gene with protein product		601182	"""origin recognition complex, subunit 2 (yeast homolog)-like"", ""origin recognition complex, subunit 2-like (yeast)"", ""origin recognition complex, subunit 2 homolog (yeast)"""	ORC2L		8808289	Standard	NM_006190		Approved		uc002uwr.3	Q13416	OTTHUMG00000132783	ENST00000234296.2:c.1050+1GTAAGTTTCA>-	2.37:g.201791481_201791490delTGAAACTTAC		124	0		132	6	.	0	0	0	0	0	Q13204|Q53TX5	Splice_Site	DEL	ENST00000234296.2	37	CCDS2334.1																																																																																			.		0.367	ORC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256191.2	NM_006190	Intron
MAML3	55534	broad.mit.edu	37	4	140810639	140810641	+	In_Frame_Del	DEL	GCT	GCT	-	rs372496848		TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	GCT	GCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr4:140810639_140810641delGCT	ENST00000509479.2	-	2	2805_2807	c.1949_1951delAGC	c.(1948-1953)cagccg>ccg	p.Q650del	MAML3_ENST00000327122.5_In_Frame_Del_p.Q494del|MAML3_ENST00000398940.1_In_Frame_Del_p.Q178del	NM_018717.4	NP_061187			mastermind-like 3 (Drosophila)											breast(1)|endometrium(7)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	25	all_hematologic(180;0.162)					GGAGGTGGCGgctgctgctgctg	0.586																																					p.646_647del													.	MAML3-455	0			c.1937_1939del						.																																			SO:0001651	inframe_deletion	55534	exon3			GTGGCGGCTGCTG	AB058719	CCDS54805.1	4q31.1	2014-08-12	2003-09-24		ENSG00000196782	ENSG00000196782			16272	protein-coding gene	gene with protein product	"""mastermind (drosophila)-like 3"""	608991	"""trinucleotide repeat containing 3"""	TNRC3		12370315, 12386158	Standard	NM_018717		Approved	KIAA1816, MAM2, CAGH3, GDN	uc021xsg.1	Q96JK9	OTTHUMG00000161441	ENST00000509479.2:c.1949_1951delAGC	4.37:g.140810648_140810650delGCT	ENSP00000421180:p.Gln650del	93	0		173	11	NM_018717	0	0	0	0	0		In_Frame_Del	DEL	ENST00000509479.2	37	CCDS54805.1																																																																																			.		0.586	MAML3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364934.2		
FAT1	2195	broad.mit.edu	37	4	187539365	187539365	+	Frame_Shift_Del	DEL	G	G	-			TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr4:187539365delG	ENST00000441802.2	-	10	8584	c.8375delC	c.(8374-8376)tctfs	p.S2792fs		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	2792	Cadherin 25. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						AACATCTACAGAAGCCACCAT	0.443										HNSCC(5;0.00058)																											p.S2792fs	Colon(197;1040 2055 4143 4984 49344)												.	FAT1-34	0			c.8375delC						.						197.0	193.0	194.0					4																	187539365		1966	4163	6129	SO:0001589	frameshift_variant	2195	exon10			TCTACAGAAGCCA	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.8375delC	4.37:g.187539365delG	ENSP00000406229:p.Ser2792fs	314	0		371	9	NM_005245	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000441802.2	37	CCDS47177.1																																																																																			.		0.443	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245	
ZNF184	7738	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	27420221	27420223	+	In_Frame_Del	DEL	TGG	TGG	-			TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	TGG	TGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr6:27420221_27420223delTGG	ENST00000211936.6	-	6	1399_1401	c.1115_1117delCCA	c.(1114-1119)accagg>agg	p.T372del	ZNF184_ENST00000377419.1_In_Frame_Del_p.T372del	NM_007149.2	NP_009080.2	Q99676	ZN184_HUMAN	zinc finger protein 184	372					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(4)|kidney(9)|large_intestine(13)|lung(14)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	48						TGTGTGCTCCTGGTGAAGGTTTT	0.379																																					p.372_373del		.											.	ZNF184-91	0			c.1115_1117del						.																																			SO:0001651	inframe_deletion	7738	exon6			.	U66561	CCDS4624.1	6p21.3	2013-01-08	2006-06-28		ENSG00000096654	ENSG00000096654		"""Zinc fingers, C2H2-type"", ""-"""	12975	protein-coding gene	gene with protein product		602277	"""zinc finger protein 184 (Kruppel-like)"""				Standard	NM_007149		Approved		uc003nji.3	Q99676	OTTHUMG00000014478	ENST00000211936.6:c.1115_1117delCCA	6.37:g.27420221_27420223delTGG	ENSP00000211936:p.Thr372del	89	0		103	20	NM_007149	0	0	0	0	0	B2R715|O60792|Q8TBA9	In_Frame_Del	DEL	ENST00000211936.6	37	CCDS4624.1																																																																																			.		0.379	ZNF184-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040146.1	NM_007149	
FOXK1	221937	broad.mit.edu	37	7	4802068	4802068	+	Frame_Shift_Del	DEL	C	C	-			TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr7:4802068delC	ENST00000328914.4	+	9	2175	c.2175delC	c.(2173-2175)ggcfs	p.G725fs	FOXK1_ENST00000446823.1_Frame_Shift_Del_p.G562fs	NM_001037165.1	NP_001032242.1			forkhead box K1											breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(7)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	29		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;7.43e-15)		CAGCTGCCGGCCCCCAGGGGC	0.706																																					p.G725fs													.	FOXK1-516	0			c.2175delC						.						6.0	8.0	8.0					7																	4802068		2034	3968	6002	SO:0001589	frameshift_variant	221937	exon9			TGCCGGCCCCCAG	BK004104	CCDS34591.1	7p22	2006-12-15			ENSG00000164916	ENSG00000164916		"""Forkhead boxes"""	23480	protein-coding gene	gene with protein product						15202027	Standard	NM_001037165		Approved	IMAGE:5164497	uc003snc.1	P85037	OTTHUMG00000151739	ENST00000328914.4:c.2175delC	7.37:g.4802068delC	ENSP00000328720:p.Gly725fs	5	0		6	2	NM_001037165	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000328914.4	37	CCDS34591.1																																																																																			.		0.706	FOXK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323729.2		
CNKSR2	22866	broad.mit.edu	37	X	21627678	21627680	+	In_Frame_Del	DEL	GAG	GAG	-			TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	GAG	GAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chrX:21627678_21627680delGAG	ENST00000379510.3	+	20	2671_2673	c.2635_2637delGAG	c.(2635-2637)gagdel	p.E886del	CNKSR2_ENST00000543067.1_In_Frame_Del_p.E837del|CNKSR2_ENST00000425654.2_In_Frame_Del_p.E856del|CNKSR2_ENST00000279451.4_In_Frame_Del_p.E886del	NM_014927.3	NP_055742.2	Q8WXI2	CNKR2_HUMAN	connector enhancer of kinase suppressor of Ras 2	886	Poly-Glu.				regulation of signal transduction (GO:0009966)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)				breast(3)|endometrium(8)|kidney(2)|large_intestine(15)|lung(28)|prostate(2)|upper_aerodigestive_tract(3)	61						ggtggaggaagaggaggaggagg	0.517																																					p.879_879del													.	CNKSR2-625	0			c.2635_2637del						.																																			SO:0001651	inframe_deletion	22866	exon20			GAGGAAGAGGAGG	AB020709	CCDS14198.1, CCDS55387.1, CCDS55388.1, CCDS55389.1	Xp22.12	2013-01-10			ENSG00000149970	ENSG00000149970		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	19701	protein-coding gene	gene with protein product		300724					Standard	NM_014927		Approved	KIAA0902, CNK2, KSR2	uc004czx.2	Q8WXI2	OTTHUMG00000021233	ENST00000379510.3:c.2635_2637delGAG	X.37:g.21627687_21627689delGAG	ENSP00000368824:p.Glu886del	45	0		140	9	NM_014927	0	0	0	0	0	B4DGR4|B7ZLJ1|B9EG83|E7ESA4|O94976|Q5JPK4|Q5JPN0|Q8WXI1	In_Frame_Del	DEL	ENST00000379510.3	37	CCDS14198.1																																																																																			.		0.517	CNKSR2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056019.1	NM_014927	
LATS2	26524	broad.mit.edu	37	13	21562482	21562483	+	In_Frame_Ins	INS	-	-	GGGGCG	rs56252009|rs550642106	byFrequency	TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr13:21562482_21562483insGGGGCG	ENST00000382592.4	-	4	1841_1842	c.1436_1437insCGCCCC	c.(1435-1437)ccg>ccCGCCCCg	p.479_479P>PAP	LATS2_ENST00000542899.1_In_Frame_Ins_p.479_479P>PAP|LATS2_ENST00000472754.1_5'Flank	NM_014572.2	NP_055387.2			large tumor suppressor kinase 2									p.P473_A480delPAPAPAPA(2)|p.P479_A480insGR(1)		breast(4)|central_nervous_system(3)|endometrium(2)|kidney(2)|large_intestine(7)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|urinary_tract(2)	45		all_cancers(29;4.74e-22)|all_epithelial(30;1.45e-18)|all_lung(29;4.69e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000781)|Epithelial(112;0.00144)|OV - Ovarian serous cystadenocarcinoma(117;0.0183)|Lung(94;0.0375)|LUSC - Lung squamous cell carcinoma(192;0.104)		CCTCCGCAgccggggcgggggc	0.787														1274	0.254393	0.1566	0.3429	5008	,	,		6446	0.2133		0.338	False		,,,				2504	0.2802				p.P479delinsPAP													.	LATS2-1404	3	Deletion - In frame(2)|Insertion - In frame(1)	breast(2)|pancreas(1)	c.1437_1438insCGCCCC						.			22,194		10,2,96						-10.2	0.0		dbSNP_119	2	119,543		56,7,268	no	coding	LATS2	NM_014572.2		66,9,364	A1A1,A1R,RR		17.9758,10.1852,16.0592				141,737				SO:0001652	inframe_insertion	26524	exon4			CGCAGCCGGGGCG	AB028019	CCDS9294.1	13q11-q12	2013-04-25	2013-04-25		ENSG00000150457	ENSG00000150457			6515	protein-coding gene	gene with protein product		604861	"""LATS (large tumor suppressor, Drosophila) homolog 2"", ""LATS, large tumor suppressor, homolog 2 (Drosophila)"""			10673337	Standard	NM_014572		Approved		uc001unr.4	Q9NRM7	OTTHUMG00000016531	ENST00000382592.4:c.1431_1436dupCGCCCC	13.37:g.21562483_21562488dupGGGGCG	ENSP00000372035:p.AlaPro479dup	7	0		15	4	NM_014572	0	0	0	0	0		In_Frame_Ins	INS	ENST00000382592.4	37	CCDS9294.1																																																																																			.		0.787	LATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044102.1		
GRPR	2925	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	16168549	16168550	+	Frame_Shift_Ins	INS	-	-	C			TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chrX:16168549_16168550insC	ENST00000380289.2	+	2	933_934	c.535_536insC	c.(535-537)tctfs	p.S179fs	RP11-431J24.2_ENST00000422438.1_RNA|RP11-431J24.2_ENST00000454712.2_RNA|RP11-431J24.2_ENST00000435789.1_RNA	NM_005314.2	NP_005305.1	P30550	GRPR_HUMAN	gastrin-releasing peptide receptor	179					cell proliferation (GO:0008283)|G-protein coupled receptor signaling pathway (GO:0007186)|regulation of cell proliferation (GO:0042127)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	bombesin receptor activity (GO:0004946)|G-protein coupled peptide receptor activity (GO:0008528)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(12)|ovary(3)|stomach(1)|upper_aerodigestive_tract(3)	25	Hepatocellular(33;0.183)					GGCCGTGTTTTCTGACCTCCAT	0.505																																					p.S179fs		.											.	GRPR-565	0			c.535_536insC						.																																			SO:0001589	frameshift_variant	2925	exon2			.		CCDS14174.1	Xp22.2	2014-02-21			ENSG00000126010	ENSG00000126010		"""GPCR / Class A : Bombesin receptors"""	4609	protein-coding gene	gene with protein product	"""bombesin receptor 2"""	305670					Standard	NM_005314		Approved	BB2	uc004cxj.3	P30550	OTTHUMG00000021189	ENST00000380289.2:c.536dupC	X.37:g.16168550_16168550dupC	ENSP00000369643:p.Ser179fs	158	0		376	68	NM_005314	0	0	0	0	0	B2R910	Frame_Shift_Ins	INS	ENST00000380289.2	37	CCDS14174.1																																																																																			.		0.505	GRPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055901.1	NM_005314	
ANAPC5	51433	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	121766167	121766168	+	Missense_Mutation	DNP	TC	TC	CA			TCGA-J7-8537-01A-11D-2396-08	TCGA-J7-8537-10A-01D-2396-08	TC	TC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	3cf4b130-0aa3-407e-9fea-bd8ddd8b7d5b	56af51d5-45a7-4a64-ba3e-f810d95407f8	g.chr12:121766167_121766168TC>CA	ENST00000261819.3	-	10	1376_1377	c.1255_1256GA>TG	c.(1255-1257)GAt>TGt	p.D419C	ANAPC5_ENST00000541887.1_Missense_Mutation_p.D406C|ANAPC5_ENST00000535482.1_Missense_Mutation_p.D85C|ANAPC5_ENST00000544314.1_5'UTR|ANAPC5_ENST00000344395.4_Missense_Mutation_p.D307C|ANAPC5_ENST00000441917.2_Missense_Mutation_p.D307C	NM_016237.4	NP_057321.2	Q9UJX4	APC5_HUMAN	anaphase promoting complex subunit 5	419					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)			breast(6)|endometrium(3)|kidney(3)|large_intestine(5)|lung(10)|prostate(1)|skin(3)	31	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					GATGCTGATATCGATGAGCTCT	0.545																																					p.D419C		.											.	ANAPC5	0			c.G1255T						.																																			SO:0001583	missense	51433	exon10			TGATATCGATGAG	AF191339	CCDS9220.1, CCDS45000.1	12q24.31	2014-08-12			ENSG00000089053	ENSG00000089053		"""Anaphase promoting complex subunits"""	15713	protein-coding gene	gene with protein product		606948				9469815	Standard	NM_016237		Approved	APC5	uc001uag.3	Q9UJX4	OTTHUMG00000169157	ENST00000261819.3:c.1255_1256delinsCA	12.37:g.121766167_121766168delinsCA	ENSP00000261819:p.Asp419Cys	76.0	0.0		121.0	18.0		0	0	0	0	0	E9PFB2|Q8N4H7|Q9BQD4	Missense_Mutation	DNP	ENST00000261819.3	37	CCDS9220.1																																																																																			.		0.545	ANAPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402582.1		
