#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ACIN1	22985	hgsc.bcm.edu	37	14	23549896	23549896	+	Silent	SNP	C	C	T	rs398102304		TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr14:23549896C>T	ENST00000262710.1	-	6	1149	c.822G>A	c.(820-822)gaG>gaA	p.E274E	ACIN1_ENST00000555352.1_5'Flank|ACIN1_ENST00000555053.1_Silent_p.E274E|ACIN1_ENST00000605057.1_Silent_p.E216E|ACIN1_ENST00000457657.1_Silent_p.E234E	NM_001164814.1|NM_014977.3	NP_001158286.1|NP_055792	Q9UKV3	ACINU_HUMAN	apoptotic chromatin condensation inducer 1	274	Glu-rich.				apoptotic chromosome condensation (GO:0030263)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|erythrocyte differentiation (GO:0030218)|mRNA processing (GO:0006397)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|positive regulation of apoptotic process (GO:0043065)|positive regulation of monocyte differentiation (GO:0045657)|RNA splicing (GO:0008380)	ASAP complex (GO:0061574)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATPase activity (GO:0016887)|enzyme binding (GO:0019899)|nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(6)|kidney(4)|large_intestine(9)|lung(10)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	37	all_cancers(95;1.36e-05)			GBM - Glioblastoma multiforme(265;0.00816)		cctcctcctcctcttcttcct	0.473																																																	0													126.0	121.0	123.0					14																	23549896		2203	4300	6503	SO:0001819	synonymous_variant	22985			AB014570	CCDS9587.1, CCDS53887.1, CCDS53888.1, CCDS53889.1, CCDS55905.1	14q11.2	2008-11-25	2004-03-31	2004-04-01	ENSG00000100813	ENSG00000100813			17066	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 152"""	604562	"""apoptotic chromatin condensation inducer in the nucleus"""	ACINUS		9734811, 10490026	Standard	NM_014977		Approved	KIAA0670, fSAP152	uc001wit.4	Q9UKV3	OTTHUMG00000028716	ENST00000262710.1:c.822G>A	14.37:g.23549896C>T			B2RTT4|D3DS45|O75158|Q9UG91|Q9UKV1|Q9UKV2	Silent	SNP	ENST00000262710.1	37	CCDS9587.1																																																																																				0.473	ACIN1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000071707.3		NM_014977	
AKAP8	10270	broad.mit.edu;ucsc.edu	37	19	15465831	15465831	+	Silent	SNP	T	T	C			TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr19:15465831T>C	ENST00000269701.2	-	14	2034	c.1974A>G	c.(1972-1974)gcA>gcG	p.A658A		NM_005858.3	NP_005849.1	O43823	AKAP8_HUMAN	A kinase (PRKA) anchor protein 8	658					mitotic chromosome condensation (GO:0007076)|mitotic nuclear division (GO:0007067)|signal transduction (GO:0007165)	condensed chromosome (GO:0000793)|female pronucleus (GO:0001939)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.A658A(1)		breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)	26						TTTCTGCCTCTGCTGCCATTG	0.587																																					GBM(190;1671 2163 3274 27186 30476)												1	Substitution - coding silent(1)	kidney(1)											74.0	66.0	68.0					19																	15465831		2203	4300	6503	SO:0001819	synonymous_variant	10270			Y11997	CCDS12329.1	19p13.12	2012-05-16			ENSG00000105127	ENSG00000105127		"""A-kinase anchor proteins"""	378	protein-coding gene	gene with protein product	"""A-kinase anchor protein, 95kDa"""	604692				9473338	Standard	NM_005858		Approved	AKAP95, DKFZp586B1222	uc002nav.3	O43823		ENST00000269701.2:c.1974A>G	19.37:g.15465831T>C				Silent	SNP	ENST00000269701.2	37	CCDS12329.1																																																																																				0.587	AKAP8-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461293.3		NM_005858	
ANAPC4	29945	hgsc.bcm.edu;ucsc.edu	37	4	25418164	25418164	+	Frame_Shift_Del	DEL	A	A	-	rs77845163	byFrequency	TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr4:25418164delA	ENST00000315368.3	+	27	2161	c.2019delA	c.(2017-2019)ttafs	p.L673fs	ANAPC4_ENST00000510092.1_Frame_Shift_Del_p.L674fs	NM_013367.2	NP_037499.2	Q9UJX5	APC4_HUMAN	anaphase promoting complex subunit 4	673					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(2)	27		Breast(46;0.0503)				CTTTGTCTTTAGTATATAACA	0.353																																																	0													109.0	105.0	106.0					4																	25418164		2203	4300	6503	SO:0001589	frameshift_variant	29945			AF191338	CCDS3434.1, CCDS68684.1	4p15.31	2011-06-15			ENSG00000053900	ENSG00000053900		"""Anaphase promoting complex subunits"""	19990	protein-coding gene	gene with protein product		606947				6180011	Standard	NM_013367		Approved	APC4	uc003gro.3	Q9UJX5	OTTHUMG00000097753	ENST00000315368.3:c.2019delA	4.37:g.25418164delA	ENSP00000318775:p.Leu673fs		A8K8H1|E9PCR4|Q6PCC6|Q9NSH6	Frame_Shift_Del	DEL	ENST00000315368.3	37	CCDS3434.1																																																																																				0.353	ANAPC4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000214986.1		NM_013367	
ANKRD31	256006	hgsc.bcm.edu;ucsc.edu	37	5	74441847	74441847	+	Missense_Mutation	SNP	C	C	G			TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr5:74441847C>G	ENST00000274361.3	-	14	3580	c.3389G>C	c.(3388-3390)aGt>aCt	p.S1130T	ANKRD31_ENST00000506364.2_Missense_Mutation_p.S1130T|ANKRD31_ENST00000504022.1_Intron	NM_001164443.1	NP_001157915.1	Q8N7Z5	ANR31_HUMAN	ankyrin repeat domain 31	1130										endometrium(1)|kidney(4)	5						TTCTCTTTGACTAAGTTTTGA	0.294																																																	0													140.0	113.0	121.0					5																	74441847		692	1588	2280	SO:0001583	missense	256006			AK097510	CCDS47233.1	5q13.3	2013-01-10			ENSG00000145700	ENSG00000145700		"""Ankyrin repeat domain containing"""	26853	protein-coding gene	gene with protein product							Standard	NM_001164443		Approved	FLJ40191	uc003kdo.2	Q8N7Z5	OTTHUMG00000162649	ENST00000274361.3:c.3389G>C	5.37:g.74441847C>G	ENSP00000274361:p.Ser1130Thr			Missense_Mutation	SNP	ENST00000274361.3	37		.	.	.	.	.	.	.	.	.	.	C	4.242	0.043793	0.08196	.	.	ENSG00000145700	ENST00000274361	T	0.60299	0.2	5.14	-5.15	0.02866	.	.	.	.	.	T	0.36220	0.0959	N	0.19112	0.55	0.09310	N	1	.	.	.	.	.	.	T	0.36089	-0.9762	7	0.36615	T	0.2	.	5.1078	0.14793	0.2609:0.1618:0.0:0.5773	.	.	.	.	T	1130	ENSP00000274361:S1130T	ENSP00000274361:S1130T	S	-	2	0	ANKRD31	74477603	0.000000	0.05858	0.005000	0.12908	0.030000	0.12068	-0.373000	0.07494	-0.476000	0.06842	-0.218000	0.12543	AGT		0.294	ANKRD31-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			NM_001164443	
ANKRD50	57182	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	125590855	125590855	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr4:125590855T>C	ENST00000504087.1	-	4	4614	c.3577A>G	c.(3577-3579)Aga>Gga	p.R1193G	ANKRD50_ENST00000515641.1_Missense_Mutation_p.R1014G	NM_020337.2	NP_065070.1	Q9ULJ7	ANR50_HUMAN	ankyrin repeat domain 50	1193	Ser-rich.							p.R1193G(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(14)|lung(18)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	55						GAAGTAGTTCTCAAAGATGAA	0.393																																																	1	Substitution - Missense(1)	kidney(1)											98.0	99.0	99.0					4																	125590855		2203	4300	6503	SO:0001583	missense	57182			AB033049	CCDS34060.1, CCDS54802.1	4q28.1	2013-01-10			ENSG00000151458	ENSG00000151458		"""Ankyrin repeat domain containing"""	29223	protein-coding gene	gene with protein product							Standard	NM_020337		Approved	KIAA1223	uc010inw.3	Q9ULJ7	OTTHUMG00000161398	ENST00000504087.1:c.3577A>G	4.37:g.125590855T>C	ENSP00000425658:p.Arg1193Gly		A8K4V3|B4DHJ6|E9PDW0|Q6N064|Q6ZSE6	Missense_Mutation	SNP	ENST00000504087.1	37	CCDS34060.1	.	.	.	.	.	.	.	.	.	.	T	13.48	2.248349	0.39797	.	.	ENSG00000151458	ENST00000504087;ENST00000515641	T;T	0.67865	-0.29;-0.25	5.29	4.07	0.47477	.	0.000000	0.85682	D	0.000000	T	0.44414	0.1292	N	0.08118	0	0.41794	D	0.989889	B	0.27498	0.18	B	0.26969	0.075	T	0.31586	-0.9938	10	0.27082	T	0.32	.	11.6138	0.51076	0.0:0.0:0.4845:0.5155	.	1193	Q9ULJ7	ANR50_HUMAN	G	1193;1014	ENSP00000425658:R1193G;ENSP00000425355:R1014G	ENSP00000425658:R1193G	R	-	1	2	ANKRD50	125810305	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.748000	0.55142	0.982000	0.38575	0.459000	0.35465	AGA		0.393	ANKRD50-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364775.1		NM_020337	
ARHGAP5	394	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	32560363	32560363	+	Missense_Mutation	SNP	T	T	G			TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr14:32560363T>G	ENST00000345122.3	+	2	803	c.488T>G	c.(487-489)aTt>aGt	p.I163S	ARHGAP5_ENST00000556611.1_Missense_Mutation_p.I163S|ARHGAP5_ENST00000433497.1_Intron|ARHGAP5_ENST00000396582.2_Intron|ARHGAP5_ENST00000432921.1_Missense_Mutation_p.I163S|ARHGAP5_ENST00000539826.2_Missense_Mutation_p.I163S	NM_001030055.1	NP_001025226.1	Q13017	RHG05_HUMAN	Rho GTPase activating protein 5	163					cell adhesion (GO:0007155)|GTP catabolic process (GO:0006184)|mammary gland development (GO:0030879)|positive regulation of cell migration (GO:0030335)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell size (GO:0008361)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)	p.I163S(1)		NS(2)|breast(10)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(12)|ovary(4)|skin(1)|stomach(1)|urinary_tract(4)	55	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)		TTATTATGCATTGATGTAAGT	0.333																																					NSCLC(9;77 350 3443 29227 41353)												1	Substitution - Missense(1)	kidney(1)											90.0	86.0	87.0					14																	32560363		2203	4296	6499	SO:0001583	missense	394			U17032	CCDS32062.1, CCDS45095.1	14q12	2010-02-05						"""Rho GTPase activating proteins"""	675	protein-coding gene	gene with protein product		602680	"""growth factor independent 2"""	GFI2		8537347	Standard	XM_005267635		Approved	RhoGAP5, p190-B, p190BRhoGAP	uc001wrn.3	Q13017		ENST00000345122.3:c.488T>G	14.37:g.32560363T>G	ENSP00000371897:p.Ile163Ser		A1L375|A1L376|A8KAA1|D3DS89|D3DS90|Q05BE8|Q05BU8|Q59ER0|Q6DHZ3	Missense_Mutation	SNP	ENST00000345122.3	37	CCDS32062.1	.	.	.	.	.	.	.	.	.	.	T	13.52	2.262773	0.39995	.	.	ENSG00000100852	ENST00000556611;ENST00000539826;ENST00000345122;ENST00000432921	T;T;T;T	0.76578	-1.03;-1.03;-1.03;-1.03	5.78	4.62	0.57501	.	0.151725	0.56097	D	0.000026	D	0.84079	0.5393	L	0.54323	1.7	0.51482	D	0.999929	D;D	0.71674	0.997;0.998	D;D	0.70487	0.948;0.969	D	0.84659	0.0705	10	0.72032	D	0.01	.	12.3398	0.55087	0.1266:0.0:0.0:0.8734	.	163;163	Q13017-2;Q13017	.;RHG05_HUMAN	S	163	ENSP00000452222:I163S;ENSP00000441692:I163S;ENSP00000371897:I163S;ENSP00000393307:I163S	ENSP00000371897:I163S	I	+	2	0	ARHGAP5	31630114	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.186000	0.72026	0.984000	0.38629	0.533000	0.62120	ATT		0.333	ARHGAP5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409735.1		NM_001030055	
ARHGAP5	394	hgsc.bcm.edu	37	14	32561296	32561296	+	Missense_Mutation	SNP	T	T	C	rs200111638		TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr14:32561296T>C	ENST00000345122.3	+	2	1736	c.1421T>C	c.(1420-1422)gTa>gCa	p.V474A	ARHGAP5_ENST00000556611.1_Missense_Mutation_p.V474A|ARHGAP5_ENST00000433497.1_Intron|ARHGAP5_ENST00000396582.2_Intron|ARHGAP5_ENST00000432921.1_Missense_Mutation_p.V474A|ARHGAP5_ENST00000539826.2_Missense_Mutation_p.V474A	NM_001030055.1	NP_001025226.1	Q13017	RHG05_HUMAN	Rho GTPase activating protein 5	474	FF 3.				cell adhesion (GO:0007155)|GTP catabolic process (GO:0006184)|mammary gland development (GO:0030879)|positive regulation of cell migration (GO:0030335)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell size (GO:0008361)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(10)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(12)|ovary(4)|skin(1)|stomach(1)|urinary_tract(4)	55	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)		AGCAAAGAGGTATATGGTAGG	0.368																																					NSCLC(9;77 350 3443 29227 41353)												0													74.0	77.0	76.0					14																	32561296		2203	4297	6500	SO:0001583	missense	394			U17032	CCDS32062.1, CCDS45095.1	14q12	2010-02-05						"""Rho GTPase activating proteins"""	675	protein-coding gene	gene with protein product		602680	"""growth factor independent 2"""	GFI2		8537347	Standard	XM_005267635		Approved	RhoGAP5, p190-B, p190BRhoGAP	uc001wrn.3	Q13017		ENST00000345122.3:c.1421T>C	14.37:g.32561296T>C	ENSP00000371897:p.Val474Ala		A1L375|A1L376|A8KAA1|D3DS89|D3DS90|Q05BE8|Q05BU8|Q59ER0|Q6DHZ3	Missense_Mutation	SNP	ENST00000345122.3	37	CCDS32062.1	.	.	.	.	.	.	.	.	.	.	T	17.13	3.311365	0.60414	.	.	ENSG00000100852	ENST00000556611;ENST00000539826;ENST00000345122;ENST00000432921	T;T;T;T	0.12039	2.72;2.72;2.72;2.72	6.02	6.02	0.97574	FF domain (1);	0.000000	0.85682	D	0.000000	T	0.25457	0.0619	L	0.40543	1.245	0.80722	D	1	P;P	0.49961	0.93;0.885	P;P	0.56042	0.79;0.622	T	0.00254	-1.1874	10	0.56958	D	0.05	.	16.5494	0.84464	0.0:0.0:0.0:1.0	.	474;474	Q13017-2;Q13017	.;RHG05_HUMAN	A	474	ENSP00000452222:V474A;ENSP00000441692:V474A;ENSP00000371897:V474A;ENSP00000393307:V474A	ENSP00000371897:V474A	V	+	2	0	ARHGAP5	31631047	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	8.040000	0.89188	2.299000	0.77371	0.528000	0.53228	GTA		0.368	ARHGAP5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409735.1		NM_001030055	
ART3	419	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	77003637	77003637	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr4:77003637C>T	ENST00000355810.4	+	3	849	c.730C>T	c.(730-732)Ctt>Ttt	p.L244F	ART3_ENST00000513494.1_3'UTR|ART3_ENST00000349321.3_Missense_Mutation_p.L244F|ART3_ENST00000341029.5_Missense_Mutation_p.L244F	NM_001130016.2	NP_001123488.1	Q13508	NAR3_HUMAN	ADP-ribosyltransferase 3	244					protein ADP-ribosylation (GO:0006471)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	NAD(P)+-protein-arginine ADP-ribosyltransferase activity (GO:0003956)|NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.L244F(1)		autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|stomach(1)	16			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			TAACCTTATCCTTCAAAGCAT	0.418																																																	1	Substitution - Missense(1)	kidney(1)											121.0	115.0	117.0					4																	77003637		2203	4300	6503	SO:0001583	missense	419			X95827	CCDS3575.1, CCDS47079.1, CCDS47080.1	4q21.1	2008-05-15			ENSG00000156219	ENSG00000156219			725	protein-coding gene	gene with protein product		603086				9119374	Standard	NM_001130017		Approved		uc003hjo.3	Q13508	OTTHUMG00000130110	ENST00000355810.4:c.730C>T	4.37:g.77003637C>T	ENSP00000348064:p.Leu244Phe		Q53XW3|Q6FHT7|Q8WVJ7|Q93069|Q96HL1	Missense_Mutation	SNP	ENST00000355810.4	37	CCDS47079.1	.	.	.	.	.	.	.	.	.	.	C	19.27	3.795416	0.70452	.	.	ENSG00000156219	ENST00000341029;ENST00000355810;ENST00000349321	T;T;T	0.27402	1.67;1.67;1.67	6.04	4.3	0.51218	.	0.422171	0.24447	N	0.038445	T	0.51686	0.1689	M	0.77486	2.375	0.33256	D	0.559143	D;P;D;P;D	0.67145	0.991;0.955;0.996;0.947;0.996	P;P;D;P;D	0.65573	0.905;0.841;0.936;0.779;0.919	T	0.62756	-0.6787	9	.	.	.	-2.5939	11.1414	0.48404	0.0:0.8696:0.0:0.1304	.	214;244;244;244;244	D6RBN3;B4DHX3;Q13508;Q13508-3;Q13508-2	.;.;NAR3_HUMAN;.;.	F	244	ENSP00000343843:L244F;ENSP00000348064:L244F;ENSP00000304313:L244F	.	L	+	1	0	ART3	77222661	0.907000	0.30839	1.000000	0.80357	0.841000	0.47740	2.320000	0.43797	2.873000	0.98535	0.563000	0.77884	CTT		0.418	ART3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252416.2		NM_001179	
ATP8A2	51761	broad.mit.edu;ucsc.edu	37	13	26125480	26125480	+	Nonsense_Mutation	SNP	C	C	A			TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr13:26125480C>A	ENST00000381655.2	+	11	1038	c.896C>A	c.(895-897)tCa>tAa	p.S299*	ATP8A2_ENST00000255283.8_Nonsense_Mutation_p.S259*	NM_016529.4	NP_057613.4	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8A, member 2	259					aging (GO:0007568)|axonogenesis (GO:0007409)|detection of light stimulus involved in visual perception (GO:0050908)|eating behavior (GO:0042755)|inner ear morphogenesis (GO:0042472)|involuntary skeletal muscle contraction (GO:0003011)|negative regulation of cell proliferation (GO:0008285)|neurofilament cytoskeleton organization (GO:0060052)|neuromuscular process controlling posture (GO:0050884)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phospholipid translocation (GO:0061092)|response to auditory stimulus (GO:0010996)|retina layer formation (GO:0010842)|skin development (GO:0043588)	cell projection (GO:0042995)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.S299*(1)		breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(17)|lung(31)|ovary(4)|skin(3)|stomach(1)|urinary_tract(1)	72		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		GTGTAGAATTCAACCAAAGCG	0.463																																																	1	Substitution - Nonsense(1)	kidney(1)											102.0	98.0	99.0					13																	26125480		1897	4118	6015	SO:0001587	stop_gained	51761			AL137256	CCDS41873.1	13q12	2010-04-20	2010-03-31		ENSG00000132932	ENSG00000132932	3.6.3.1	"""ATPases / P-type"""	13533	protein-coding gene	gene with protein product		605870	"""ATPase, aminophospholipid transporter-like, Class I, type 8A, member 2"", ""ATPase, aminophospholipid transporter-like, class I, type 8A, member 2"""			11015572, 19778899	Standard	NM_016529		Approved	ATPIB, ML-1	uc001uqk.3	Q9NTI2	OTTHUMG00000016611	ENST00000381655.2:c.896C>A	13.37:g.26125480C>A	ENSP00000371070:p.Ser299*		Q9H527|Q9NPU6|Q9NTL2|Q9NYM3	Nonsense_Mutation	SNP	ENST00000381655.2	37	CCDS41873.1	.	.	.	.	.	.	.	.	.	.	C	40	8.022192	0.98613	.	.	ENSG00000132932	ENST00000381655;ENST00000255283;ENST00000544544	.	.	.	5.91	5.07	0.68467	.	0.061993	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.1937	0.73067	0.0:0.9325:0.0:0.0675	.	.	.	.	X	299;259;79	.	ENSP00000255283:S259X	S	+	2	0	ATP8A2	25023480	1.000000	0.71417	0.990000	0.47175	0.477000	0.33069	7.776000	0.85560	1.514000	0.48869	0.549000	0.68633	TCA		0.463	ATP8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044236.2		NM_016529	
BMP2K	55589	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	79831928	79831928	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr4:79831928G>T	ENST00000335016.5	+	16	2393	c.2227G>T	c.(2227-2229)Gat>Tat	p.D743Y	PAQR3_ENST00000295462.3_Intron	NM_198892.1	NP_942595.1	Q9NSY1	BMP2K_HUMAN	BMP2 inducible kinase	743					regulation of bone mineralization (GO:0030500)	nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatase regulator activity (GO:0019208)|protein serine/threonine kinase activity (GO:0004674)	p.D743Y(1)		NS(1)|breast(1)|endometrium(4)|large_intestine(2)|lung(3)|prostate(1)|urinary_tract(1)	13						ATCTGAAAGTGATTTTGAATC	0.423																																																	1	Substitution - Missense(1)	kidney(1)											93.0	87.0	89.0					4																	79831928		1886	4102	5988	SO:0001583	missense	55589			AB015331	CCDS34019.1, CCDS47083.1	4q21.21	2008-05-15			ENSG00000138756	ENSG00000138756			18041	protein-coding gene	gene with protein product							Standard	NM_017593		Approved	DKFZp434K0614, BIKe	uc003hlk.3	Q9NSY1	OTTHUMG00000160900	ENST00000335016.5:c.2227G>T	4.37:g.79831928G>T	ENSP00000334836:p.Asp743Tyr		O94791|Q4W5H2|Q8IYF2|Q8N2G7|Q8NHG9|Q9NTG8	Missense_Mutation	SNP	ENST00000335016.5	37	CCDS47083.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.46|12.46	1.943796|1.943796	0.34283|0.34283	.|.	.|.	ENSG00000138756|ENSG00000138756	ENST00000335016|ENST00000502613	D|.	0.82433|.	-1.61|.	5.67|5.67	5.67|5.67	0.87782|0.87782	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.73361|.	0.3577|.	L|L	0.60455|0.60455	1.87|1.87	0.80722|0.80722	D|D	1|1	D|.	0.76494|.	0.999|.	D|.	0.69142|.	0.962|.	T|.	0.69680|.	-0.5080|.	10|.	0.72032|.	D|.	0.01|.	-15.5313|-15.5313	19.7695|19.7695	0.96357|0.96357	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	743|.	Q9NSY1|.	BMP2K_HUMAN|.	Y|L	743|435	ENSP00000334836:D743Y|.	ENSP00000334836:D743Y|.	D|X	+|+	1|2	0|2	BMP2K|BMP2K	80050952|80050952	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.070000|0.070000	0.16714|0.16714	9.231000|9.231000	0.95317|0.95317	2.688000|2.688000	0.91661|0.91661	0.555000|0.555000	0.69702|0.69702	GAT|TGA		0.423	BMP2K-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			NM_017593	
BMX	660	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	15540571	15540571	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chrX:15540571C>A	ENST00000357607.2	+	7	801	c.613C>A	c.(613-615)Cag>Aag	p.Q205K	BMX_ENST00000342014.6_Missense_Mutation_p.Q205K|BMX_ENST00000348343.6_Missense_Mutation_p.Q205K			P51813	BMX_HUMAN	BMX non-receptor tyrosine kinase	205					apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to stress (GO:0006950)|signal transduction (GO:0007165)	cytosol (GO:0005829)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|signal transducer activity (GO:0004871)	p.Q205K(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(14)|ovary(2)|urinary_tract(3)	30	Hepatocellular(33;0.183)					CTATGGCTCCCAGCCACCATC	0.443																																																	1	Substitution - Missense(1)	kidney(1)											138.0	118.0	125.0					X																	15540571		2203	4300	6503	SO:0001583	missense	660			AF045459	CCDS14168.1	Xp22.2	2013-05-14			ENSG00000102010	ENSG00000102010		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	1079	protein-coding gene	gene with protein product	"""BTK-like on X chromosome"""	300101				7970727	Standard	NM_203281		Approved	ETK, PSCTK3	uc004cwx.4	P51813	OTTHUMG00000021180	ENST00000357607.2:c.613C>A	X.37:g.15540571C>A	ENSP00000350224:p.Gln205Lys		A6NIH9|O60564|Q12871	Missense_Mutation	SNP	ENST00000357607.2	37	CCDS14168.1	.	.	.	.	.	.	.	.	.	.	C	0.016	-1.528779	0.00959	.	.	ENSG00000102010	ENST00000357607;ENST00000348343;ENST00000342014	T;T;T	0.75154	-0.91;-0.91;-0.91	0.226	0.226	0.15353	.	.	.	.	.	T	0.45657	0.1353	N	0.08118	0	0.09310	N	1	B	0.26041	0.14	B	0.22880	0.042	T	0.34428	-0.9829	8	0.06365	T	0.9	.	.	.	.	.	205	P51813	BMX_HUMAN	K	205	ENSP00000350224:Q205K;ENSP00000308774:Q205K;ENSP00000340082:Q205K	ENSP00000340082:Q205K	Q	+	1	0	BMX	15450492	0.004000	0.15560	0.025000	0.17156	0.034000	0.12701	0.302000	0.19192	0.283000	0.22279	0.287000	0.19450	CAG		0.443	BMX-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055877.1		NM_001721	
FAM208B	54906	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	5789390	5789390	+	Nonsense_Mutation	SNP	G	G	T			TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr10:5789390G>T	ENST00000328090.5	+	15	4631	c.4006G>T	c.(4006-4008)Gaa>Taa	p.E1336*		NM_017782.4	NP_060252	Q5VWN6	F208B_HUMAN	family with sequence similarity 208, member B	1336								p.E1336*(1)									AGAAAGCAGAGAAGTGAGTTC	0.423																																																	1	Substitution - Nonsense(1)	kidney(1)											113.0	115.0	115.0					10																	5789390		1872	4098	5970	SO:0001587	stop_gained	0			BX649177	CCDS41485.1	10p15.1	2011-09-14	2011-09-14	2011-09-14	ENSG00000108021	ENSG00000108021			23484	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 18"""	C10orf18		12477932	Standard	NM_017782		Approved	FLJ20360, bA318E3.2, KIAA2006	uc001iij.3	Q5VWN6	OTTHUMG00000017605	ENST00000328090.5:c.4006G>T	10.37:g.5789390G>T	ENSP00000328426:p.Glu1336*		Q2YD91|Q5VWN5|Q6ZRQ8|Q8IVG4|Q9BUZ7|Q9H5J9|Q9H7A4|Q9H996|Q9NXA1	Nonsense_Mutation	SNP	ENST00000328090.5	37	CCDS41485.1	.	.	.	.	.	.	.	.	.	.	G	44	10.668810	0.99447	.	.	ENSG00000108021	ENST00000328090;ENST00000442808	.	.	.	5.55	1.5	0.22942	.	0.754781	0.12379	N	0.474078	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	.	5.2888	0.15716	0.2611:0.1612:0.5777:0.0	.	.	.	.	X	1336;531	.	ENSP00000328426:E1336X	E	+	1	0	C10orf18	5829396	0.002000	0.14202	0.557000	0.28306	0.027000	0.11550	0.923000	0.28757	0.275000	0.22094	0.491000	0.48974	GAA		0.423	FAM208B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046571.2		NM_017782	
CCDC13	152206	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	42781196	42781196	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr3:42781196G>T	ENST00000310232.6	-	9	1177	c.1094C>A	c.(1093-1095)aCc>aAc	p.T365N	CCDC13-AS1_ENST00000418161.1_RNA|CCDC13-AS1_ENST00000446950.1_RNA	NM_144719.3	NP_653320.3	Q8IYE1	CCD13_HUMAN	coiled-coil domain containing 13	365								p.T365N(1)		endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(11)|ovary(1)|prostate(3)|skin(1)|urinary_tract(1)	25						ACTCTTGAGGGTCTTCATCTC	0.562																																																	1	Substitution - Missense(1)	kidney(1)											186.0	162.0	170.0					3																	42781196		2203	4300	6503	SO:0001583	missense	152206			AK058196	CCDS2705.1	3p22.1	2005-01-25			ENSG00000244607	ENSG00000244607			26358	protein-coding gene	gene with protein product						12477932	Standard	NM_144719		Approved	FLJ25467	uc003cly.4	Q8IYE1	OTTHUMG00000133046	ENST00000310232.6:c.1094C>A	3.37:g.42781196G>T	ENSP00000309836:p.Thr365Asn			Missense_Mutation	SNP	ENST00000310232.6	37	CCDS2705.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.290479	0.80914	.	.	ENSG00000244607	ENST00000310232	T	0.23950	1.88	5.42	5.42	0.78866	.	0.167744	0.52532	D	0.000078	T	0.48095	0.1481	M	0.73598	2.24	0.32491	N	0.540122	D	0.76494	0.999	D	0.71656	0.974	T	0.60052	-0.7338	10	0.48119	T	0.1	.	11.4761	0.50300	0.084:0.0:0.916:0.0	.	365	Q8IYE1	CCD13_HUMAN	N	365	ENSP00000309836:T365N	ENSP00000309836:T365N	T	-	2	0	CCDC13	42756200	1.000000	0.71417	1.000000	0.80357	0.826000	0.46750	4.264000	0.58859	2.553000	0.86117	0.561000	0.74099	ACC		0.562	CCDC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256652.1		NM_144719	
CCDC27	148870	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	3669160	3669160	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr1:3669160C>A	ENST00000294600.2	+	1	199	c.115C>A	c.(115-117)Ctt>Att	p.L39I		NM_152492.2	NP_689705.2	Q2M243	CCD27_HUMAN	coiled-coil domain containing 27	39								p.L39I(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(2)|lung(17)|prostate(1)|skin(2)|urinary_tract(2)	36	all_cancers(77;0.0385)|Ovarian(185;0.0634)|Lung NSC(156;0.21)|all_lung(157;0.218)	all_epithelial(116;5.52e-17)|all_lung(118;1.04e-06)|Lung NSC(185;0.000214)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Lung SC(97;0.0367)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.127)		Epithelial(90;1.11e-38)|OV - Ovarian serous cystadenocarcinoma(86;1.35e-22)|GBM - Glioblastoma multiforme(42;3.46e-16)|Colorectal(212;1.17e-05)|COAD - Colon adenocarcinoma(227;5.76e-05)|Kidney(185;0.00036)|BRCA - Breast invasive adenocarcinoma(365;0.000696)|KIRC - Kidney renal clear cell carcinoma(229;0.00558)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.203)		CTCACTTGGTCTTTGCATCCC	0.587																																																	1	Substitution - Missense(1)	kidney(1)											163.0	136.0	145.0					1																	3669160		2203	4300	6503	SO:0001583	missense	148870				CCDS50.1	1p36.32	2008-02-05			ENSG00000162592	ENSG00000162592			26546	protein-coding gene	gene with protein product							Standard	NM_152492		Approved	FLJ32825	uc001akv.2	Q2M243	OTTHUMG00000003504	ENST00000294600.2:c.115C>A	1.37:g.3669160C>A	ENSP00000294600:p.Leu39Ile		Q5TBV3|Q96M50	Missense_Mutation	SNP	ENST00000294600.2	37	CCDS50.1	.	.	.	.	.	.	.	.	.	.	C	4.287	0.052390	0.08291	.	.	ENSG00000162592	ENST00000294600	T	0.21361	2.01	2.84	-0.312	0.12758	.	2.851890	0.01697	N	0.026983	T	0.09774	0.0240	N	0.08118	0	0.09310	N	1	P	0.42518	0.782	B	0.37144	0.242	T	0.07271	-1.0781	10	0.31617	T	0.26	1.1614	2.4835	0.04593	0.2335:0.4889:0.0:0.2776	.	39	Q2M243	CCD27_HUMAN	I	39	ENSP00000294600:L39I	ENSP00000294600:L39I	L	+	1	0	CCDC27	3659020	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.374000	0.07484	-0.043000	0.13513	-0.145000	0.13849	CTT		0.587	CCDC27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009740.1		NM_152492	
CCDC73	493860	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	32635626	32635626	+	Missense_Mutation	SNP	T	T	G			TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr11:32635626T>G	ENST00000335185.5	-	16	2281	c.2238A>C	c.(2236-2238)aaA>aaC	p.K746N	CCDC73_ENST00000534415.1_5'Flank	NM_001008391.2	NP_001008392.2	Q6ZRK6	CCD73_HUMAN	coiled-coil domain containing 73	746								p.K746N(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	51	Breast(20;0.112)					TACACATAGTTTTTCCCCCAG	0.333																																																	1	Substitution - Missense(1)	kidney(1)											102.0	92.0	95.0					11																	32635626		1801	4068	5869	SO:0001583	missense	493860			AK128159	CCDS41630.1	11p13	2006-02-11			ENSG00000186714	ENSG00000186714			23261	protein-coding gene	gene with protein product		612328					Standard	NM_001008391		Approved	NY-SAR-79	uc001mtv.4	Q6ZRK6	OTTHUMG00000166279	ENST00000335185.5:c.2238A>C	11.37:g.32635626T>G	ENSP00000335325:p.Lys746Asn		Q6P5Q7|Q6ZMW0|Q86WE7	Missense_Mutation	SNP	ENST00000335185.5	37	CCDS41630.1	.	.	.	.	.	.	.	.	.	.	T	1.794	-0.478832	0.04414	.	.	ENSG00000186714	ENST00000335185	.	.	.	5.12	1.09	0.20402	.	1.017320	0.07834	N	0.961842	T	0.17280	0.0415	N	0.08118	0	0.09310	N	1	B	0.25169	0.119	B	0.26416	0.069	T	0.26916	-1.0089	9	0.41790	T	0.15	.	1.9704	0.03405	0.2414:0.0827:0.1367:0.5392	.	746	Q6ZRK6	CCD73_HUMAN	N	746	.	ENSP00000335325:K746N	K	-	3	2	CCDC73	32592202	0.002000	0.14202	0.001000	0.08648	0.002000	0.02628	1.206000	0.32321	0.324000	0.23333	0.482000	0.46254	AAA		0.333	CCDC73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388874.2		NM_001008391	
CHADL	150356	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	22	41632577	41632577	+	Silent	SNP	C	C	T			TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr22:41632577C>T	ENST00000216241.9	-	4	2026	c.1974G>A	c.(1972-1974)ctG>ctA	p.L658L		NM_138481.1	NP_612490.1	Q6NUI6	CHADL_HUMAN	chondroadherin-like	658						proteinaceous extracellular matrix (GO:0005578)		p.L658L(1)		breast(1)|endometrium(1)|kidney(1)|skin(1)	4						GCAGGGCAGGCAGGGCCCGAA	0.652																																																	1	Substitution - coding silent(1)	kidney(1)											26.0	33.0	31.0					22																	41632577		692	1591	2283	SO:0001819	synonymous_variant	150356			BC012882	CCDS46715.1	22q13.2	2008-10-31			ENSG00000100399	ENSG00000100399			25165	protein-coding gene	gene with protein product						12477932	Standard	NM_138481		Approved	SLRR4B	uc003azq.4	Q6NUI6	OTTHUMG00000150936	ENST00000216241.9:c.1974G>A	22.37:g.41632577C>T			Q05CY2|Q4G0S0|Q5JY13|Q86XY1|Q96E60	Silent	SNP	ENST00000216241.9	37	CCDS46715.1	.	.	.	.	.	.	.	.	.	.	C	9.436	1.086802	0.20390	.	.	ENSG00000100399	ENST00000417999	.	.	.	5.19	5.19	0.71726	.	.	.	.	.	T	0.56062	0.1960	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55398	-0.8147	4	.	.	.	.	5.8732	0.18814	0.1818:0.6969:0.0:0.1213	.	.	.	.	Y	656	.	.	C	-	2	0	CHADL	39962523	0.646000	0.27295	0.993000	0.49108	0.910000	0.53928	-0.110000	0.10824	2.598000	0.87819	0.650000	0.86243	TGC		0.652	CHADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320597.1		NM_138481	
CLK1	1195	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	201721415	201721415	+	Silent	SNP	T	T	C			TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr2:201721415T>C	ENST00000321356.4	-	9	1182	c.1047A>G	c.(1045-1047)gaA>gaG	p.E349E	CLK1_ENST00000434813.2_Silent_p.E391E|CLK1_ENST00000409769.2_Silent_p.E172E	NM_004071.3	NP_004062.2	P49759	CLK1_HUMAN	CDC-like kinase 1	349	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell proliferation (GO:0008283)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|regulation of RNA splicing (GO:0043484)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)	p.E391E(1)|p.E349E(1)		NS(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(12)|ovary(1)|pancreas(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	33						CTAAAATAACTTCAGGTGCTC	0.323																																																	2	Substitution - coding silent(2)	kidney(2)											123.0	120.0	121.0					2																	201721415		2202	4300	6502	SO:0001819	synonymous_variant	1195			L29219	CCDS2331.1, CCDS54427.1	2q33	2008-05-02			ENSG00000013441	ENSG00000013441		"""CDC-like kinases"""	2068	protein-coding gene	gene with protein product		601951				9856501	Standard	NM_004071		Approved		uc002uwe.2	P49759	OTTHUMG00000132784	ENST00000321356.4:c.1047A>G	2.37:g.201721415T>C			B4DFW7|Q0P694|Q8N5V8	Silent	SNP	ENST00000321356.4	37	CCDS2331.1																																																																																				0.323	CLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256192.2			
COL11A1	1301	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	103468818	103468818	+	Nonsense_Mutation	SNP	G	G	A			TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina HiSeq	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr1:103468818G>A	ENST00000370096.3	-	21	2263	c.1951C>T	c.(1951-1953)Cga>Tga	p.R651*	COL11A1_ENST00000461720.1_5'UTR|COL11A1_ENST00000353414.4_Nonsense_Mutation_p.R612*|COL11A1_ENST00000358392.2_Nonsense_Mutation_p.R663*|COL11A1_ENST00000512756.1_Nonsense_Mutation_p.R535*	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	651	Collagen-like 4.|Collagen-like 5.|Triple-helical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)	p.R663*(1)|p.R651*(1)		NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		AGCAAACCTCGTGGGCCCTAG	0.418																																																	2	Substitution - Nonsense(2)	kidney(2)											29.0	32.0	31.0					1																	103468818		2202	4300	6502	SO:0001587	stop_gained	1301			J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.1951C>T	1.37:g.103468818G>A	ENSP00000359114:p.Arg651*		B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Nonsense_Mutation	SNP	ENST00000370096.3	37	CCDS778.1	.	.	.	.	.	.	.	.	.	.	G	39	7.507290	0.98325	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000512756	.	.	.	5.81	0.354	0.16063	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.8276	0.85935	0.0:0.0:0.3043:0.6957	.	.	.	.	X	651;663;612;535	.	ENSP00000302551:R612X	R	-	1	2	COL11A1	103241406	0.552000	0.26505	0.813000	0.32504	0.595000	0.36748	0.746000	0.26275	-0.186000	0.10533	-0.230000	0.12252	CGA		0.418	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1		NM_080630	
COMT	1312	broad.mit.edu;ucsc.edu	37	22	19956115	19956115	+	Silent	SNP	A	A	G			TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr22:19956115A>G	ENST00000361682.6	+	6	1054	c.672A>G	c.(670-672)ccA>ccG	p.P224P	COMT_ENST00000407537.1_Silent_p.P174P|COMT_ENST00000449653.1_Silent_p.P174P|COMT_ENST00000406520.3_Silent_p.P224P|COMT_ENST00000403710.1_Silent_p.P224P	NM_000754.3	NP_000745.1	P21964	COMT_HUMAN	catechol-O-methyltransferase	224					cellular response to phosphate starvation (GO:0016036)|dopamine catabolic process (GO:0042420)|estrogen metabolic process (GO:0008210)|female pregnancy (GO:0007565)|learning (GO:0007612)|methylation (GO:0032259)|multicellular organismal reproductive process (GO:0048609)|negative regulation of dopamine metabolic process (GO:0045963)|negative regulation of smooth muscle cell proliferation (GO:0048662)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter catabolic process (GO:0042135)|positive regulation of homocysteine metabolic process (GO:0050668)|response to drug (GO:0042493)|response to lipopolysaccharide (GO:0032496)|response to organic cyclic compound (GO:0014070)|response to pain (GO:0048265)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	catechol O-methyltransferase activity (GO:0016206)|magnesium ion binding (GO:0000287)|O-methyltransferase activity (GO:0008171)	p.P224P(1)		kidney(1)|lung(1)|ovary(1)|prostate(1)|stomach(1)	5	Colorectal(54;0.0993)				Conjugated Estrogens(DB00286)|Diethylstilbestrol(DB00255)|Dobutamine(DB00841)|Dopamine(DB00988)|Entacapone(DB00494)|Methyldopa(DB00968)|Micafungin(DB01141)|S-Adenosylmethionine(DB00118)|Testosterone Propionate(DB01420)|Tolcapone(DB00323)	TGATCTGCCCAGGTGCGCCAG	0.622																																																	1	Substitution - coding silent(1)	kidney(1)											92.0	72.0	79.0					22																	19956115		2203	4300	6503	SO:0001819	synonymous_variant	1312				CCDS13770.1, CCDS46663.1	22q11.21	2012-10-02			ENSG00000093010	ENSG00000093010	2.1.1.6		2228	protein-coding gene	gene with protein product		116790				1572656	Standard	NM_000754		Approved		uc002zqu.3	P21964	OTTHUMG00000150529	ENST00000361682.6:c.672A>G	22.37:g.19956115A>G			A8MPV9|Q6IB07|Q6ICE6|Q9BWC7	Silent	SNP	ENST00000361682.6	37	CCDS13770.1																																																																																				0.622	COMT-011	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318936.2		NM_000754	
DENND5B	160518	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	31540556	31540556	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr12:31540556A>T	ENST00000389082.5	-	21	4070	c.3806T>A	c.(3805-3807)aTc>aAc	p.I1269N	DENND5B_ENST00000306833.6_Missense_Mutation_p.I1304N|DENND5B_ENST00000536562.1_Missense_Mutation_p.I1304N	NM_144973.3	NP_659410.3	Q6ZUT9	DEN5B_HUMAN	DENN/MADD domain containing 5B	1269					positive regulation of Rab GTPase activity (GO:0032851)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.I1269N(1)		NS(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(8)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38						CACTCCTTTGATGAGTGATCC	0.502																																																	1	Substitution - Missense(1)	kidney(1)											92.0	86.0	88.0					12																	31540556		1939	4140	6079	SO:0001583	missense	160518			AF086301	CCDS44857.1	12p11.21	2012-10-03			ENSG00000170456	ENSG00000170456		"""DENN/MADD domain containing"""	28338	protein-coding gene	gene with protein product						12477932	Standard	NM_144973		Approved	MGC24039	uc001rki.1	Q6ZUT9	OTTHUMG00000169034	ENST00000389082.5:c.3806T>A	12.37:g.31540556A>T	ENSP00000373734:p.Ile1269Asn		B5ME75|Q59FW8|Q68CZ7|Q6NUJ0|Q7Z3F9|Q8N973|Q8WUC8	Missense_Mutation	SNP	ENST00000389082.5	37	CCDS44857.1	.	.	.	.	.	.	.	.	.	.	A	14.79	2.640269	0.47153	.	.	ENSG00000170456	ENST00000389082;ENST00000306833;ENST00000536562	T;T;T	0.04275	3.66;3.77;3.77	4.98	3.85	0.44370	.	0.404056	0.24836	N	0.035220	T	0.05593	0.0147	N	0.22421	0.69	0.38027	D	0.935039	B;B	0.33345	0.286;0.409	B;B	0.40982	0.123;0.345	T	0.42531	-0.9446	10	0.72032	D	0.01	-16.6854	10.2458	0.43341	0.9225:0.0:0.0775:0.0	.	1269;1304	Q6ZUT9;G3V1S3	DEN5B_HUMAN;.	N	1269;1304;1304	ENSP00000373734:I1269N;ENSP00000306482:I1304N;ENSP00000444889:I1304N	ENSP00000306482:I1304N	I	-	2	0	DENND5B	31431823	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	5.912000	0.69948	0.948000	0.37687	0.482000	0.46254	ATC		0.502	DENND5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402040.1		NM_144973	
DSCC1	79075	broad.mit.edu;ucsc.edu	37	8	120865431	120865431	+	Missense_Mutation	SNP	G	G	T	rs374668937	byFrequency	TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr8:120865431G>T	ENST00000313655.4	-	2	421	c.207C>A	c.(205-207)gaC>gaA	p.D69E		NM_024094.2	NP_076999.2	Q9BVC3	DCC1_HUMAN	DNA replication and sister chromatid cohesion 1	69					DNA replication (GO:0006260)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|post-translational protein acetylation (GO:0034421)|regulation of DNA replication (GO:0006275)	chromatin (GO:0000785)|chromosome, centromeric region (GO:0000775)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)	p.D69E(2)		NS(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(1)|pancreas(1)	9	Lung NSC(37;9.35e-07)|Ovarian(258;0.011)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			CAGCTTGCTCGTCTTTATCAC	0.388																																																	2	Substitution - Missense(2)	kidney(2)											143.0	130.0	134.0					8																	120865431		2203	4300	6503	SO:0001583	missense	79075				CCDS6330.1	8q24.12	2013-05-24	2013-05-24		ENSG00000136982	ENSG00000136982			24453	protein-coding gene	gene with protein product	"""defective in sister chromatid cohesion homolog 1 (S. cerevisiae)"""	613203	"""defective in sister chromatid cohesion 1 homolog (S. cerevisiae)"""			12766176, 20826785	Standard	NM_024094		Approved	DCC1, hDCC1, MGC5528	uc003yov.3	Q9BVC3	OTTHUMG00000165010	ENST00000313655.4:c.207C>A	8.37:g.120865431G>T	ENSP00000322180:p.Asp69Glu		Q969N5	Missense_Mutation	SNP	ENST00000313655.4	37	CCDS6330.1	.	.	.	.	.	.	.	.	.	.	G	13.41	2.230255	0.39399	.	.	ENSG00000136982	ENST00000313655	T	0.44482	0.92	5.55	-6.05	0.02172	.	0.151172	0.56097	N	0.000021	T	0.18923	0.0454	L	0.28608	0.87	0.43499	D	0.995745	B	0.09022	0.002	B	0.12156	0.007	T	0.05937	-1.0855	10	0.19590	T	0.45	-13.5098	3.5565	0.07866	0.3345:0.1973:0.3717:0.0964	.	69	Q9BVC3	DCC1_HUMAN	E	69	ENSP00000322180:D69E	ENSP00000322180:D69E	D	-	3	2	DSCC1	120934612	0.435000	0.25577	0.947000	0.38551	0.848000	0.48234	-0.167000	0.09940	-0.867000	0.04063	-0.793000	0.03317	GAC		0.388	DSCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381443.1		NM_024094	
FAM114A2	10827	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	153390869	153390869	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr5:153390869A>T	ENST00000351797.4	-	9	1001	c.925T>A	c.(925-927)Ttt>Att	p.F309I	FAM114A2_ENST00000520313.1_Missense_Mutation_p.F239I|FAM114A2_ENST00000520667.1_Missense_Mutation_p.F309I|FAM114A2_ENST00000522858.1_Missense_Mutation_p.F309I	NM_018691.2	NP_061161.2	Q9NRY5	F1142_HUMAN	family with sequence similarity 114, member A2	309							purine nucleotide binding (GO:0017076)	p.F309I(1)		NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(9)|skin(1)|urinary_tract(1)	18						TCCTTGGTAAAATCTTCATCC	0.448																																																	1	Substitution - Missense(1)	kidney(1)											94.0	91.0	92.0					5																	153390869		2203	4300	6503	SO:0001583	missense	10827			AF159700	CCDS4323.1	5q31-q33	2008-06-13	2008-06-13	2008-06-13	ENSG00000055147	ENSG00000055147			1333	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 3"""	C5orf3		10843801	Standard	XM_005268359		Approved	133K02	uc003lvc.3	Q9NRY5	OTTHUMG00000130147	ENST00000351797.4:c.925T>A	5.37:g.153390869A>T	ENSP00000341597:p.Phe309Ile		B2R8D8|Q9H7E0	Missense_Mutation	SNP	ENST00000351797.4	37	CCDS4323.1	.	.	.	.	.	.	.	.	.	.	A	22.5	4.296041	0.81025	.	.	ENSG00000055147	ENST00000351797;ENST00000522858;ENST00000520667;ENST00000520313	T;T;T;T	0.23754	2.12;2.12;2.12;1.89	4.67	4.67	0.58626	.	0.000000	0.85682	D	0.000000	T	0.53818	0.1820	M	0.84948	2.725	0.52099	D	0.999947	D;D	0.89917	0.999;1.0	D;D	0.87578	0.996;0.998	T	0.61103	-0.7130	10	0.66056	D	0.02	-13.2382	12.6522	0.56768	1.0:0.0:0.0:0.0	.	239;309	E7ESJ7;Q9NRY5	.;F1142_HUMAN	I	309;309;309;239	ENSP00000341597:F309I;ENSP00000430489:F309I;ENSP00000430384:F309I;ENSP00000429088:F239I	ENSP00000341597:F309I	F	-	1	0	FAM114A2	153371062	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.405000	0.59741	1.873000	0.54277	0.460000	0.39030	TTT		0.448	FAM114A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252455.1		NM_018691	
FAM49A	81553	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	16742257	16742257	+	Splice_Site	SNP	C	C	T			TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr2:16742257C>T	ENST00000381323.3	-	9	931		c.e9+1		FAM49A_ENST00000406434.1_Splice_Site|FAM49A_ENST00000355549.2_Splice_Site	NM_030797.3	NP_110424.1	Q9H0Q0	FA49A_HUMAN	family with sequence similarity 49, member A							intracellular (GO:0005622)		p.?(1)		breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|skin(3)|upper_aerodigestive_tract(1)	23	Acute lymphoblastic leukemia(172;0.0734)|all_hematologic(175;0.088)		GBM - Glioblastoma multiforme(3;0.00969)			ATTTAACTTACGGAGTTTCCA	0.413																																																	1	Unknown(1)	kidney(1)											186.0	165.0	172.0					2																	16742257		2203	4300	6503	SO:0001630	splice_region_variant	81553			AK001942	CCDS1688.1	2p24.3	2008-02-05			ENSG00000197872	ENSG00000197872			25373	protein-coding gene	gene with protein product							Standard	NM_030797		Approved	DKFZP566A1524, FLJ11080	uc002rck.2	Q9H0Q0	OTTHUMG00000090615	ENST00000381323.3:c.710+1G>A	2.37:g.16742257C>T			B3KNZ1|Q53QW2	Splice_Site	SNP	ENST00000381323.3	37	CCDS1688.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.035503	0.75617	.	.	ENSG00000197872	ENST00000381323;ENST00000406434;ENST00000355549	.	.	.	5.38	4.51	0.55191	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.4246	0.61018	0.0:0.9243:0.0:0.0757	.	.	.	.	.	-1	.	.	.	-	.	.	FAM49A	16605738	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.818000	0.86416	1.424000	0.47217	0.655000	0.94253	.		0.413	FAM49A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207203.2		NM_030797	Intron
FAM9A	171482	broad.mit.edu;hgsc.bcm.edu	37	X	8763259	8763259	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chrX:8763259C>T	ENST00000543214.1	-	7	826	c.691G>A	c.(691-693)Gag>Aag	p.E231K	FAM9A_ENST00000381003.3_Missense_Mutation_p.E231K	NM_001171186.1	NP_001164657.1	Q8IZU1	FAM9A_HUMAN	family with sequence similarity 9, member A	231	Glu-rich.					nucleus (GO:0005634)		p.E231K(1)		endometrium(11)|kidney(2)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)	18		Hepatocellular(5;0.219)				tctttctcctcctcctcctcc	0.517																																																	1	Substitution - Missense(1)	kidney(1)											24.0	20.0	22.0					X																	8763259		2160	4211	6371	SO:0001583	missense	171482				CCDS14131.1	Xp22.32	2012-11-29			ENSG00000183304	ENSG00000183304			18403	protein-coding gene	gene with protein product	"""testis expressed 39A"""	300477					Standard	NM_174951		Approved	TEX39A	uc004csg.3	Q8IZU1	OTTHUMG00000021110	ENST00000543214.1:c.691G>A	X.37:g.8763259C>T	ENSP00000440163:p.Glu231Lys		B7ZLH5|Q2M2D1	Missense_Mutation	SNP	ENST00000543214.1	37	CCDS14131.1	.	.	.	.	.	.	.	.	.	.	c	7.892	0.732446	0.15507	.	.	ENSG00000183304	ENST00000381003;ENST00000543214	.	.	.	.	.	.	.	.	.	.	.	T	0.23249	0.0562	N	0.08118	0	0.09310	N	1	P	0.37398	0.593	P	0.45577	0.486	T	0.25152	-1.0140	6	0.46703	T	0.11	.	.	.	.	.	231	Q8IZU1	FAM9A_HUMAN	K	231	.	ENSP00000370391:E231K	E	-	1	0	FAM9A	8723259	0.011000	0.17503	0.053000	0.19242	0.053000	0.15095	0.276000	0.18716	0.099000	0.17552	0.100000	0.15512	GAG		0.517	FAM9A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055697.1		NM_174951	
FHOD1	29109	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	67264547	67264547	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr16:67264547G>T	ENST00000258201.4	-	18	3062	c.2815C>A	c.(2815-2817)Cgt>Agt	p.R939S		NM_013241.2	NP_037373.2	Q9Y613	FHOD1_HUMAN	formin homology 2 domain containing 1	939	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|nucleus (GO:0005634)	identical protein binding (GO:0042802)	p.R939S(1)		breast(4)|endometrium(3)|kidney(3)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	34		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000691)|Epithelial(162;0.00462)|all cancers(182;0.0434)		ATGGCAACACGGCGGGCACAC	0.652																																																	1	Substitution - Missense(1)	kidney(1)											140.0	142.0	142.0					16																	67264547		2198	4300	6498	SO:0001583	missense	29109			AF113615	CCDS10834.1	16q22	2008-02-22			ENSG00000135723	ENSG00000135723			17905	protein-coding gene	gene with protein product		606881				10352228, 16112087	Standard	NM_013241		Approved	FHOS	uc002esl.3	Q9Y613	OTTHUMG00000137521	ENST00000258201.4:c.2815C>A	16.37:g.67264547G>T	ENSP00000258201:p.Arg939Ser		Q59F76|Q6Y1F2|Q76MS8|Q8N521	Missense_Mutation	SNP	ENST00000258201.4	37	CCDS10834.1	.	.	.	.	.	.	.	.	.	.	G	19.31	3.803589	0.70682	.	.	ENSG00000135723	ENST00000258201	T	0.16196	2.36	5.61	5.61	0.85477	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.046268	0.85682	D	0.000000	T	0.44286	0.1286	M	0.82823	2.61	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.37798	-0.9690	10	0.52906	T	0.07	.	13.2058	0.59795	0.0:0.0:0.8407:0.1592	.	939	Q9Y613	FHOD1_HUMAN	S	939	ENSP00000258201:R939S	ENSP00000258201:R939S	R	-	1	0	FHOD1	65822048	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	3.832000	0.55783	2.644000	0.89710	0.561000	0.74099	CGT		0.652	FHOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268844.2			
GRM2	2912	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	51749554	51749555	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	TT	TT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr3:51749554_51749555delTT	ENST00000395052.3	+	4	1999_2000	c.1765_1766delTT	c.(1765-1767)tttfs	p.F589fs	GRM2_ENST00000475478.1_3'UTR|GRM2_ENST00000442933.2_Intron	NM_000839.3	NP_000830.2	Q14416	GRM2_HUMAN	glutamate receptor, metabotropic 2	589					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|glutamate secretion (GO:0014047)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(1)|lung(11)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		GCTGGGTGTCTTTGTGCGGCAC	0.619																																																	0																																										SO:0001589	frameshift_variant	2912			L35318	CCDS2834.1	3p21.2	2013-09-20			ENSG00000164082	ENSG00000164082		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4594	protein-coding gene	gene with protein product		604099				7620613	Standard	NM_000839		Approved	GPRC1B, mGlu2, MGLUR2	uc010hlv.3	Q14416	OTTHUMG00000156902	ENST00000395052.3:c.1765_1766delTT	3.37:g.51749554_51749555delTT	ENSP00000378492:p.Phe589fs		B0M0K7|Q14CU5|Q52MC6|Q9H3N6	Frame_Shift_Del	DEL	ENST00000395052.3	37	CCDS2834.1																																																																																				0.619	GRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346542.1			
IFNGR1	3459	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	137519168	137519168	+	Nonstop_Mutation	SNP	T	T	A			TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr6:137519168T>A	ENST00000367739.4	-	7	1591	c.1470A>T	c.(1468-1470)tgA>tgT	p.*490C	IFNGR1_ENST00000543628.1_Nonstop_Mutation_p.*462C	NM_000416.2	NP_000407.1	P15260	INGR1_HUMAN	interferon gamma receptor 1	0					cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|response to virus (GO:0009615)|signal transduction (GO:0007165)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|vesicle (GO:0031982)	interferon-gamma receptor activity (GO:0004906)	p.*490C(1)		central_nervous_system(1)|kidney(3)|large_intestine(3)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	18	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000829)|OV - Ovarian serous cystadenocarcinoma(155;0.00389)	Interferon gamma-1b(DB00033)	TTAGCTGATCTCATGAAAATT	0.353																																																	1	Nonstop extension(1)	kidney(1)											79.0	80.0	80.0					6																	137519168		2203	4300	6503	SO:0001578	stop_lost	3459				CCDS5185.1	6q23-q24	2014-09-17			ENSG00000027697	ENSG00000027697		"""Interferons"", ""CD molecules"""	5439	protein-coding gene	gene with protein product		107470		IFNGR			Standard	NM_000416		Approved	CD119	uc003qho.2	P15260	OTTHUMG00000015656	ENST00000367739.4:c.1470A>T	6.37:g.137519168T>A			B4DFT7|E1P587|Q53Y96	Missense_Mutation	SNP	ENST00000367739.4	37	CCDS5185.1	.	.	.	.	.	.	.	.	.	.	T	10.28	1.307048	0.23821	.	.	ENSG00000027697	ENST00000367739;ENST00000543628	.	.	.	5.58	2.64	0.31445	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.5825	0.22602	0.0:0.2721:0.0:0.7279	.	.	.	.	C	490;462	.	.	X	-	3	0	IFNGR1	137560861	0.001000	0.12720	0.003000	0.11579	0.119000	0.20118	0.964000	0.29306	0.825000	0.34637	0.533000	0.62120	TGA		0.353	IFNGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042401.1			
KCNMB4	27345	hgsc.bcm.edu	37	12	70760617	70760617	+	Frame_Shift_Del	DEL	T	T	-			TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr12:70760617delT	ENST00000258111.4	+	1	562	c.103delT	c.(103-105)ttcfs	p.F35fs		NM_014505.5	NP_055320.4	Q86W47	KCMB4_HUMAN	potassium large conductance calcium-activated channel, subfamily M, beta member 4	35					action potential (GO:0001508)|blood coagulation (GO:0007596)|detection of calcium ion (GO:0005513)|neuronal action potential (GO:0019228)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of neurotransmitter secretion (GO:0046928)|regulation of vasoconstriction (GO:0019229)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)			kidney(1)|large_intestine(4)|lung(5)	10	Renal(347;0.236)		Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00243)|STAD - Stomach adenocarcinoma(21;0.0118)		Miconazole(DB01110)|Procaine(DB00721)	GCTCTTCATCTTCGGCTTCTG	0.617																																																	0													54.0	44.0	47.0					12																	70760617		2203	4300	6503	SO:0001589	frameshift_variant	27345			AF207992	CCDS8997.1	12q15	2006-06-10			ENSG00000135643	ENSG00000135643		"""Potassium channels"""	6289	protein-coding gene	gene with protein product		605223				10692449, 10828459	Standard	NM_014505		Approved		uc001svx.3	Q86W47	OTTHUMG00000167586	ENST00000258111.4:c.103delT	12.37:g.70760617delT	ENSP00000258111:p.Phe35fs		Q8IVR3|Q9NPA4|Q9P0G5	Frame_Shift_Del	DEL	ENST00000258111.4	37	CCDS8997.1																																																																																				0.617	KCNMB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395208.1		NM_014505	
KCNMB4	27345	hgsc.bcm.edu	37	12	70760620	70760621	+	Frame_Shift_Del	DEL	GG	GG	-			TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	GG	GG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr12:70760620_70760621delGG	ENST00000258111.4	+	1	565_566	c.106_107delGG	c.(106-108)ggcfs	p.G36fs		NM_014505.5	NP_055320.4	Q86W47	KCMB4_HUMAN	potassium large conductance calcium-activated channel, subfamily M, beta member 4	36					action potential (GO:0001508)|blood coagulation (GO:0007596)|detection of calcium ion (GO:0005513)|neuronal action potential (GO:0019228)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of neurotransmitter secretion (GO:0046928)|regulation of vasoconstriction (GO:0019229)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)			kidney(1)|large_intestine(4)|lung(5)	10	Renal(347;0.236)		Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00243)|STAD - Stomach adenocarcinoma(21;0.0118)		Miconazole(DB01110)|Procaine(DB00721)	CTTCATCTTCGGCTTCTGCTGG	0.614																																																	0																																										SO:0001589	frameshift_variant	27345			AF207992	CCDS8997.1	12q15	2006-06-10			ENSG00000135643	ENSG00000135643		"""Potassium channels"""	6289	protein-coding gene	gene with protein product		605223				10692449, 10828459	Standard	NM_014505		Approved		uc001svx.3	Q86W47	OTTHUMG00000167586	ENST00000258111.4:c.106_107delGG	12.37:g.70760620_70760621delGG	ENSP00000258111:p.Gly36fs		Q8IVR3|Q9NPA4|Q9P0G5	Frame_Shift_Del	DEL	ENST00000258111.4	37	CCDS8997.1																																																																																				0.614	KCNMB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395208.1		NM_014505	
LRIG1	26018	hgsc.bcm.edu	37	3	66444578	66444579	+	Frame_Shift_Ins	INS	-	-	C			TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr3:66444578_66444579insC	ENST00000273261.3	-	12	1877_1878	c.1353_1354insG	c.(1351-1356)ctgcccfs	p.P452fs	LRIG1_ENST00000383703.3_Frame_Shift_Ins_p.P476fs|LRIG1_ENST00000496559.2_5'UTR	NM_015541.2	NP_056356.2	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like domains 1	452	LRRCT.				innervation (GO:0060384)|otolith morphogenesis (GO:0032474)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)				NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(4)|stomach(4)|urinary_tract(1)	42		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		AGCCACGGGGGCAGCCACTTCA	0.559																																																	0																																										SO:0001589	frameshift_variant	26018			AB050468	CCDS33783.1	3p14	2013-01-14			ENSG00000144749	ENSG00000144749		"""Immunoglobulin superfamily / I-set domain containing"""	17360	protein-coding gene	gene with protein product	"""ortholog of mouse integral membrane glycoprotein LIG-1"", ""leucine-rich repeat protein LRIG1"""	608868				11414704, 12234026	Standard	NM_015541		Approved	LIG-1, DKFZP586O1624, LIG1	uc003dmx.3	Q96JA1	OTTHUMG00000158727	ENST00000273261.3:c.1354dupG	3.37:g.66444579_66444579dupC	ENSP00000273261:p.Pro452fs		Q6IQ51|Q96CF9|Q9BYB8|Q9UFI4	Frame_Shift_Ins	INS	ENST00000273261.3	37	CCDS33783.1																																																																																				0.559	LRIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351930.1		NM_015541	
LRP1B	53353	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	141135789	141135789	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina HiSeq	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr2:141135789C>A	ENST00000389484.3	-	68	11569	c.10598G>T	c.(10597-10599)tGg>tTg	p.W3533L		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	3533	LDL-receptor class A 26. {ECO:0000255|PROSITE-ProRule:PRU00124}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.W3533L(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TCCATCACACCAAAACCTTGA	0.398										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)												1	Substitution - Missense(1)	kidney(1)											118.0	105.0	110.0					2																	141135789		2203	4300	6503	SO:0001583	missense	53353			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.10598G>T	2.37:g.141135789C>A	ENSP00000374135:p.Trp3533Leu		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.953496	0.73902	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.94966	-3.57	5.48	5.48	0.80851	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.079166	0.53938	D	0.000043	T	0.79405	0.4440	N	0.00462	-1.47	0.36165	D	0.848397	B	0.33777	0.425	B	0.34418	0.182	T	0.83287	-0.0035	10	0.09843	T	0.71	.	12.6699	0.56862	0.0:0.9244:0.0:0.0756	.	3533	Q9NZR2	LRP1B_HUMAN	L	3533;3471	ENSP00000374135:W3533L	ENSP00000374135:W3533L	W	-	2	0	LRP1B	140852259	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.640000	0.61368	2.571000	0.86741	0.591000	0.81541	TGG		0.398	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2		NM_018557	
LRP5	4041	broad.mit.edu;hgsc.bcm.edu	37	11	68216349	68216349	+	Silent	SNP	C	C	T	rs112415702		TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr11:68216349C>T	ENST00000294304.7	+	23	4765	c.4659C>T	c.(4657-4659)agC>agT	p.S1553S	LRP5_ENST00000529481.1_3'UTR	NM_002335.2	NP_002326.2	O75197	LRP5_HUMAN	low density lipoprotein receptor-related protein 5	1553	Pro-rich.				adipose tissue development (GO:0060612)|anatomical structure regression (GO:0060033)|anterior/posterior pattern specification (GO:0009952)|apoptotic process involved in patterning of blood vessels (GO:1902262)|bone marrow development (GO:0048539)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|cell migration involved in gastrulation (GO:0042074)|cell-cell signaling involved in mammary gland development (GO:0060764)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic limb morphogenesis (GO:0030326)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocytosis (GO:0006897)|extracellular matrix-cell signaling (GO:0035426)|gastrulation with mouth forming second (GO:0001702)|glucose catabolic process (GO:0006007)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|osteoblast development (GO:0002076)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of mitosis (GO:0045840)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of bone remodeling (GO:0046850)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|response to peptide hormone (GO:0043434)|retina morphogenesis in camera-type eye (GO:0060042)|retinal blood vessel morphogenesis (GO:0061304)|somatic stem cell maintenance (GO:0035019)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	coreceptor activity (GO:0015026)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.S1553S(1)		autonomic_ganglia(1)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(24)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						GCGACTACAGCGCCAGCCGCT	0.632																																																	1	Substitution - coding silent(1)	kidney(1)											77.0	59.0	65.0					11																	68216349		2200	4294	6494	SO:0001819	synonymous_variant	4041			AF064548	CCDS8181.1	11q13.4	2014-01-28	2003-03-12		ENSG00000162337	ENSG00000162337		"""Low density lipoprotein receptors"""	6697	protein-coding gene	gene with protein product		603506	"""osteoporosis pseudoglioma syndrome"", ""exudative vitreoretinopathy 1"""	LRP7, OPPG, EVR1		9714764, 10049586	Standard	XM_005273994		Approved	LR3, BMND1, HBM, OPS, OPTA1, VBCH2, EVR4	uc001ont.3	O75197	OTTHUMG00000167570	ENST00000294304.7:c.4659C>T	11.37:g.68216349C>T			Q96TD6|Q9UES7|Q9UP66	Silent	SNP	ENST00000294304.7	37	CCDS8181.1	.	.	.	.	.	.	.	.	.	.	C	0.073	-1.199318	0.01581	.	.	ENSG00000162337	ENST00000529702	.	.	.	4.73	-9.46	0.00597	.	.	.	.	.	T	0.47060	0.1425	.	.	.	0.44685	D	0.997673	.	.	.	.	.	.	T	0.56080	-0.8038	4	.	.	.	.	8.8015	0.34912	0.0698:0.2623:0.0694:0.5986	.	.	.	.	V	110	.	.	A	+	2	0	LRP5	67972925	0.000000	0.05858	0.304000	0.25085	0.008000	0.06430	-4.626000	0.00206	-1.995000	0.00971	-0.477000	0.04895	GCG		0.632	LRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395088.1		NM_002335	
MDGA2	161357	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	47613333	47613333	+	Nonsense_Mutation	SNP	A	A	T			TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr14:47613333A>T	ENST00000399232.2	-	4	897	c.533T>A	c.(532-534)tTg>tAg	p.L178*	MDGA2_ENST00000426342.1_5'UTR|MDGA2_ENST00000439988.3_Nonsense_Mutation_p.L247*|MDGA2_ENST00000357362.3_5'UTR	NM_001113498.2	NP_001106970.3	Q7Z553	MDGA2_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 2	178	Ig-like 2.				pattern specification process (GO:0007389)|spinal cord motor neuron differentiation (GO:0021522)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.L247*(1)		breast(3)|endometrium(4)|kidney(2)|large_intestine(14)|lung(41)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(5)	76						TCCTTGCAGCAAGACCTCCTG	0.433																																																	1	Substitution - Nonsense(1)	kidney(1)											137.0	120.0	125.0					14																	47613333		692	1591	2283	SO:0001587	stop_gained	161357			AI859192	CCDS41948.1, CCDS45098.1, CCDS45098.2, CCDS45098.3	14q21.2	2013-01-29	2007-04-03	2007-04-03	ENSG00000139915	ENSG00000139915		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19835	protein-coding gene	gene with protein product		611128	"""MAM domain containing 1"""	MAMDC1		15019943	Standard	NM_001113498		Approved		uc001wwj.4	Q7Z553	OTTHUMG00000029429	ENST00000399232.2:c.533T>A	14.37:g.47613333A>T	ENSP00000382178:p.Leu178*		F6W3S7|J3KPX6	Nonsense_Mutation	SNP	ENST00000399232.2	37		.	.	.	.	.	.	.	.	.	.	A	37	6.152945	0.97329	.	.	ENSG00000139915	ENST00000439988;ENST00000399232	.	.	.	5.73	5.73	0.89815	.	0.000000	0.40144	U	0.001165	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.8496	0.70286	1.0:0.0:0.0:0.0	.	.	.	.	X	178;247	.	ENSP00000382178:L247X	L	-	2	0	MDGA2	46683083	1.000000	0.71417	0.966000	0.40874	0.988000	0.76386	8.870000	0.92336	2.195000	0.70347	0.477000	0.44152	TTG		0.433	MDGA2-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000073352.5		NM_182830	
MED4	29079	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	13	48651403	48651403	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr13:48651403T>C	ENST00000258648.2	-	7	710	c.685A>G	c.(685-687)Atg>Gtg	p.M229V	MED4_ENST00000495013.1_5'UTR|MED4-AS1_ENST00000422483.1_RNA|MED4_ENST00000378586.1_Missense_Mutation_p.M183V	NM_014166.3	NP_054885.1	Q9NPJ6	MED4_HUMAN	mediator complex subunit 4	229					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)	p.M229V(1)		endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)	8		all_cancers(8;2.93e-25)|all_epithelial(8;4.38e-13)|all_lung(13;7.37e-06)|all_hematologic(8;8.61e-05)|Breast(56;0.000141)|Lung NSC(96;0.000518)|Prostate(109;0.00132)|Acute lymphoblastic leukemia(8;0.00559)|Myeloproliferative disorder(33;0.039)|Hepatocellular(98;0.0556)|Lung SC(185;0.102)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(144;5.18e-07)		AACATATTCATCGACATGTCA	0.373																																					Pancreas(38;399 1016 9170 13426 20145)												1	Substitution - Missense(1)	kidney(1)											97.0	89.0	92.0					13																	48651403		2203	4300	6503	SO:0001583	missense	29079			AF161475	CCDS9408.1, CCDS59241.1	13q14.12	2008-02-05	2007-07-30	2004-11-09	ENSG00000136146	ENSG00000136146			17903	protein-coding gene	gene with protein product		605718	"""vitamin D receptor interacting protein"", ""mediator of RNA polymerase II transcription, subunit 4 homolog (S. cerevisiae)"""	VDRIP		10235266, 11042152	Standard	NM_014166		Approved	HSPC126, DRIP36, TRAP36	uc001vby.2	Q9NPJ6	OTTHUMG00000016891	ENST00000258648.2:c.685A>G	13.37:g.48651403T>C	ENSP00000258648:p.Met229Val		B4DX67|Q53GB4|Q53H68|Q5T912|Q6FHC4|Q6IA79|Q9BS95|Q9NYR5	Missense_Mutation	SNP	ENST00000258648.2	37	CCDS9408.1	.	.	.	.	.	.	.	.	.	.	T	9.935	1.215816	0.22373	.	.	ENSG00000136146	ENST00000258648;ENST00000378594;ENST00000378586;ENST00000417167	.	.	.	5.72	-1.02	0.10135	.	0.313086	0.41712	N	0.000828	T	0.21509	0.0518	N	0.19112	0.55	0.28705	N	0.903847	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.09100	-1.0690	9	0.33940	T	0.23	-5.4152	6.4712	0.22009	0.0:0.3175:0.1269:0.5555	.	207;229	E9PDW1;Q9NPJ6	.;MED4_HUMAN	V	229;207;183;207	.	ENSP00000258648:M229V	M	-	1	0	MED4	47549404	0.877000	0.30153	0.636000	0.29352	0.642000	0.38348	1.371000	0.34250	0.131000	0.18576	-0.353000	0.07706	ATG		0.373	MED4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044863.1		NM_014166	
MGAT5	4249	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	135107382	135107382	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr2:135107382G>A	ENST00000409645.1	+	10	1371	c.1119G>A	c.(1117-1119)atG>atA	p.M373I	MGAT5_ENST00000281923.2_Missense_Mutation_p.M373I			Q09328	MGT5A_HUMAN	mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase	373					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase activity (GO:0030144)	p.M373I(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|liver(1)|lung(18)|ovary(3)|pancreas(1)|skin(3)	36				BRCA - Breast invasive adenocarcinoma(221;0.0964)		TCAGGTGCATGCTCCGAGTCC	0.408																																																	1	Substitution - Missense(1)	kidney(1)											144.0	133.0	136.0					2																	135107382		2203	4300	6503	SO:0001583	missense	4249			D17716	CCDS2171.1	2q21	2013-02-25			ENSG00000152127	ENSG00000152127	2.4.1.155	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7049	protein-coding gene	gene with protein product		601774				8292036	Standard	NM_002410		Approved	GNT-V	uc002ttw.4	Q09328	OTTHUMG00000131681	ENST00000409645.1:c.1119G>A	2.37:g.135107382G>A	ENSP00000386377:p.Met373Ile		D3DP70	Missense_Mutation	SNP	ENST00000409645.1	37	CCDS2171.1	.	.	.	.	.	.	.	.	.	.	G	14.48	2.547584	0.45383	.	.	ENSG00000152127	ENST00000409645;ENST00000281923	.	.	.	5.02	4.15	0.48705	.	0.037478	0.85682	D	0.000000	T	0.57666	0.2069	L	0.54323	1.7	0.80722	D	1	B	0.21520	0.057	B	0.18561	0.022	T	0.58278	-0.7664	9	0.59425	D	0.04	-34.2743	13.7427	0.62857	0.075:0.0:0.925:0.0	.	373	Q09328	MGT5A_HUMAN	I	373	.	ENSP00000281923:M373I	M	+	3	0	MGAT5	134823852	1.000000	0.71417	1.000000	0.80357	0.001000	0.01503	9.809000	0.99208	1.223000	0.43536	-0.140000	0.14226	ATG		0.408	MGAT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254584.3		NM_002410	
KMT2C	58508	hgsc.bcm.edu	37	7	151921164	151921167	+	Frame_Shift_Del	DEL	AGGA	AGGA	-			TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	AGGA	AGGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr7:151921164_151921167delAGGA	ENST00000262189.6	-	20	3474_3477	c.3256_3259delTCCT	c.(3256-3261)tcctgtfs	p.SC1086fs	KMT2C_ENST00000355193.2_Frame_Shift_Del_p.SC1086fs	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	1086					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										CAGACTGGACAGGAAGATAAGCTT	0.407																																																	0																																										SO:0001589	frameshift_variant	58508			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.3256_3259delTCCT	7.37:g.151921164_151921167delAGGA	ENSP00000262189:p.Ser1086fs		Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Frame_Shift_Del	DEL	ENST00000262189.6	37	CCDS5931.1																																																																																				0.407	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3			
MTOR	2475	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	11184589	11184589	+	Missense_Mutation	SNP	C	C	G			TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina HiSeq	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr1:11184589C>G	ENST00000361445.4	-	47	6704	c.6628G>C	c.(6628-6630)Gcc>Ccc	p.A2210P	MTOR_ENST00000376838.1_Missense_Mutation_p.A415P	NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	2210	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)	p.A2210P(1)		breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	GGGTCATTGGCCAGAAGGGTG	0.463																																																	1	Substitution - Missense(1)	kidney(1)											112.0	105.0	108.0					1																	11184589		2203	4300	6503	SO:0001583	missense	2475			L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.6628G>C	1.37:g.11184589C>G	ENSP00000354558:p.Ala2210Pro		Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Missense_Mutation	SNP	ENST00000361445.4	37	CCDS127.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.658527	0.88154	.	.	ENSG00000198793	ENST00000361445;ENST00000376838	T;T	0.78595	-1.19;-1.19	5.8	5.8	0.92144	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	D	0.84257	0.5432	M	0.84773	2.715	0.80722	D	1	D	0.57571	0.98	P	0.49047	0.599	D	0.83652	0.0156	10	0.30854	T	0.27	-15.1283	18.2956	0.90145	0.0:1.0:0.0:0.0	.	2210	P42345	MTOR_HUMAN	P	2210;415	ENSP00000354558:A2210P;ENSP00000366034:A415P	ENSP00000354558:A2210P	A	-	1	0	MTOR	11107176	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.401000	0.79962	2.761000	0.94854	0.650000	0.86243	GCC		0.463	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005558.1		NM_004958	
MUC16	94025	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	9085732	9085732	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina HiSeq	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr19:9085732G>A	ENST00000397910.4	-	1	6286	c.6083C>T	c.(6082-6084)tCt>tTt	p.S2028F		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	2028	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.S2028F(2)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GGAATATGGAGAGGATGTGCT	0.488																																																	2	Substitution - Missense(2)	kidney(2)											128.0	123.0	125.0					19																	9085732		2013	4178	6191	SO:0001583	missense	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.6083C>T	19.37:g.9085732G>A	ENSP00000381008:p.Ser2028Phe		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	0.007	-1.969420	0.00457	.	.	ENSG00000181143	ENST00000397910	T	0.02737	4.18	0.235	-0.47	0.12131	.	.	.	.	.	T	0.01489	0.0048	N	0.08118	0	.	.	.	B	0.21309	0.054	B	0.21151	0.033	T	0.48969	-0.8987	7	0.87932	D	0	.	.	.	.	.	2028	B5ME49	.	F	2028	ENSP00000381008:S2028F	ENSP00000381008:S2028F	S	-	2	0	MUC16	8946732	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.189000	0.03061	-1.808000	0.01234	-1.786000	0.00637	TCT		0.488	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1		NM_024690	
SLC9B2	133308	broad.mit.edu;ucsc.edu	37	4	103971409	103971409	+	Silent	SNP	A	A	G			TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr4:103971409A>G	ENST00000394785.3	-	5	1204	c.573T>C	c.(571-573)ggT>ggC	p.G191G	SLC9B2_ENST00000503103.1_Silent_p.G134G|SLC9B2_ENST00000503230.1_Silent_p.G134G|SLC9B2_ENST00000362026.3_Silent_p.G191G|SLC9B2_ENST00000339611.4_Silent_p.G191G	NM_178833.4	NP_849155.2	Q86UD5	SL9B2_HUMAN	solute carrier family 9, subfamily B (NHA2, cation proton antiporter 2), member 2	191					ion transmembrane transport (GO:0034220)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	solute:proton antiporter activity (GO:0015299)	p.G191G(2)									TTGAATCCAGACCAAGGCCAG	0.383																																																	2	Substitution - coding silent(2)	kidney(2)											102.0	87.0	92.0					4																	103971409		2203	4300	6503	SO:0001819	synonymous_variant	0			AK172823	CCDS3662.1, CCDS75173.1, CCDS75174.1	4q24	2013-05-22	2012-03-22	2011-08-03	ENSG00000164038	ENSG00000164038		"""Solute carriers"""	25143	protein-coding gene	gene with protein product		611789	"""Na+/H+ exchanger domain containing 2"", ""solute carrier family 9, subfamily B (cation proton antiporter 2), member 2"""	NHEDC2		18600791	Standard	XM_005262758		Approved	FLJ23984, NHA2	uc003hwy.3	Q86UD5	OTTHUMG00000131125	ENST00000394785.3:c.573T>C	4.37:g.103971409A>G			B5ME52|Q6ZMD8|Q96D95	Silent	SNP	ENST00000394785.3	37	CCDS3662.1																																																																																				0.383	SLC9B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253805.1		NM_178833	
NEK1	4750	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	170510619	170510619	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr4:170510619C>T	ENST00000439128.2	-	6	1083	c.443G>A	c.(442-444)gGa>gAa	p.G148E	NEK1_ENST00000507142.1_Missense_Mutation_p.G148E|NEK1_ENST00000512193.1_Missense_Mutation_p.G148E|NEK1_ENST00000511633.1_Missense_Mutation_p.G148E|NEK1_ENST00000510533.1_Missense_Mutation_p.G148E	NM_012224.2	NP_036356.1	Q96PY6	NEK1_HUMAN	NIMA-related kinase 1	148	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to DNA damage stimulus (GO:0006974)|cilium assembly (GO:0042384)|mitotic nuclear division (GO:0007067)|response to ionizing radiation (GO:0010212)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)	p.G148E(2)		NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|ovary(2)|prostate(2)|stomach(1)	45		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0287)|KIRC - Kidney renal clear cell carcinoma(143;0.0325)|Kidney(143;0.0385)|LUSC - Lung squamous cell carcinoma(193;0.14)		TCTAGCAATTCCAAAATCTCC	0.289																																																	2	Substitution - Missense(2)	kidney(2)											45.0	41.0	42.0					4																	170510619		1692	3896	5588	SO:0001583	missense	4750			AB067488	CCDS47162.1, CCDS56348.1, CCDS56349.1, CCDS56350.1, CCDS56351.1	4q32.3	2012-11-15	2012-11-15		ENSG00000137601	ENSG00000137601			7744	protein-coding gene	gene with protein product		604588	"""NIMA (never in mitosis gene a)-related kinase 1"""			1382974, 8274451	Standard	NM_012224		Approved	NY-REN-55, KIAA1901	uc003isd.2	Q96PY6	OTTHUMG00000160963	ENST00000439128.2:c.443G>A	4.37:g.170510619C>T	ENSP00000408020:p.Gly148Glu		G5E9Z3|Q05DG5|Q14CB7|Q5H9T1|Q6PIB8|Q96SS2|Q9H6P7|Q9Y594	Missense_Mutation	SNP	ENST00000439128.2	37	CCDS47162.1	.	.	.	.	.	.	.	.	.	.	C	34	5.345850	0.95807	.	.	ENSG00000137601	ENST00000439128;ENST00000511633;ENST00000510533;ENST00000507142;ENST00000512193	T;T;T;T;T	0.80123	-1.34;-1.34;-1.34;-1.34;-1.34	6.02	6.02	0.97574	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000004	D	0.94122	0.8115	H	0.97758	4.07	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.998;1.0;1.0;1.0;1.0;1.0	D	0.95261	0.8369	10	0.87932	D	0	.	20.5373	0.99239	0.0:1.0:0.0:0.0	.	148;148;148;148;148;148	Q96PY6-5;Q96PY6-4;G5E9Z3;Q96PY6-3;Q96PY6-2;Q96PY6	.;.;.;.;.;NEK1_HUMAN	E	148	ENSP00000408020:G148E;ENSP00000423332:G148E;ENSP00000427653:G148E;ENSP00000424757:G148E;ENSP00000424938:G148E	ENSP00000408020:G148E	G	-	2	0	NEK1	170747194	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.472000	0.80996	2.857000	0.98124	0.650000	0.86243	GGA		0.289	NEK1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000363157.3			
NLRP1	22861	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	5462474	5462474	+	Nonsense_Mutation	SNP	C	C	T			TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina HiSeq	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr17:5462474C>T	ENST00000572272.1	-	4	1541	c.1542G>A	c.(1540-1542)tgG>tgA	p.W514*	NLRP1_ENST00000577119.1_Nonsense_Mutation_p.W514*|NLRP1_ENST00000354411.3_Nonsense_Mutation_p.W514*|NLRP1_ENST00000571307.1_5'UTR|NLRP1_ENST00000262467.5_Nonsense_Mutation_p.W514*|NLRP1_ENST00000345221.3_Nonsense_Mutation_p.W514*|NLRP1_ENST00000269280.4_Nonsense_Mutation_p.W514*			Q9C000	NALP1_HUMAN	NLR family, pyrin domain containing 1	514	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|defense response to bacterium (GO:0042742)|innate immune response (GO:0045087)|neuron apoptotic process (GO:0051402)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of interleukin-1 beta secretion (GO:0050718)|regulation of inflammatory response (GO:0050727)|response to muramyl dipeptide (GO:0032495)	cytosol (GO:0005829)|intracellular (GO:0005622)|NLRP1 inflammasome complex (GO:0072558)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|enzyme binding (GO:0019899)|protein domain specific binding (GO:0019904)	p.W514*(3)|p.W514C(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(17)|liver(5)|lung(17)|ovary(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Colorectal(1115;3.48e-05)				GACACAGGGCCCAGAGCTCTT	0.488																																																	4	Substitution - Nonsense(3)|Substitution - Missense(1)	kidney(3)|large_intestine(1)											100.0	97.0	98.0					17																	5462474		2203	4300	6503	SO:0001587	stop_gained	22861			AB023143	CCDS32537.1, CCDS42244.1, CCDS42245.1, CCDS42246.1, CCDS58508.1	17p13	2014-01-29	2006-12-08	2006-12-08	ENSG00000091592	ENSG00000091592		"""Nucleotide-binding domain and leucine rich repeat containing"""	14374	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 1"""	606636	"""NACHT, leucine rich repeat and PYD (pyrin domain) containing 1"", ""systemic lupus erythematosus, vitiligo-related 1"""	NALP1, SLEV1		8781126, 12563287, 17377159	Standard	NM_033006		Approved	KIAA0926, DKFZp586O1822, CARD7, NAC, CLR17.1, DEFCAP, VAMAS1	uc002gci.3	Q9C000		ENST00000572272.1:c.1542G>A	17.37:g.5462474C>T	ENSP00000460475:p.Trp514*		E9PE50|I6L9D9|Q9BZZ8|Q9BZZ9|Q9H5Z7|Q9H5Z8|Q9HAV8|Q9UFT4|Q9Y2E0	Nonsense_Mutation	SNP	ENST00000572272.1	37	CCDS42246.1	.	.	.	.	.	.	.	.	.	.	C	39	7.788427	0.98489	.	.	ENSG00000091592	ENST00000544378;ENST00000262467;ENST00000269280;ENST00000354411;ENST00000345221	.	.	.	4.44	-0.224	0.13115	.	0.622916	0.12234	N	0.487136	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27785	T	0.31	.	4.5986	0.12341	0.0:0.4421:0.3541:0.2038	.	.	.	.	X	514	.	ENSP00000262467:W514X	W	-	3	0	NLRP1	5403198	0.000000	0.05858	0.002000	0.10522	0.048000	0.14542	-0.846000	0.04336	0.217000	0.20800	0.650000	0.86243	TGG		0.488	NLRP1-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439517.1		NM_033004	
NOS1	4842	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	117728169	117728169	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr12:117728169G>T	ENST00000338101.4	-	3	919	c.915C>A	c.(913-915)ttC>ttA	p.F305L	NOS1_ENST00000317775.6_Missense_Mutation_p.F305L|NOS1_ENST00000344089.3_Missense_Mutation_p.S324Y			Q8WY41	NANO1_HUMAN	nitric oxide synthase 1 (neuronal)	0					cell migration (GO:0016477)|epithelial cell migration (GO:0010631)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|translation repressor activity (GO:0030371)|zinc ion binding (GO:0008270)	p.F305L(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(21)|lung(43)|ovary(3)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	117	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)		TGACCTTGAGGAAGCGTGGAC	0.557																																					Esophageal Squamous(162;1748 2599 51982 52956)												1	Substitution - Missense(1)	kidney(1)											56.0	59.0	58.0					12																	117728169		2050	4195	6245	SO:0001583	missense	4842				CCDS41842.1, CCDS55890.1	12q24.22	2013-09-19			ENSG00000089250	ENSG00000089250	1.14.13.39		7872	protein-coding gene	gene with protein product		163731		NOS		1385308, 7682706	Standard	NM_001204213		Approved	nNOS	uc001twn.2	P29475	OTTHUMG00000137376	ENST00000338101.4:c.915C>A	12.37:g.117728169G>T	ENSP00000337459:p.Phe305Leu			Missense_Mutation	SNP	ENST00000338101.4	37	CCDS55890.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.94|15.94	2.981114|2.981114	0.53827|0.53827	.|.	.|.	ENSG00000089250|ENSG00000089250	ENST00000397605;ENST00000317775;ENST00000541241;ENST00000338101|ENST00000344089	T;T|T	0.39997|0.06068	1.05;1.05|3.35	5.13|5.13	3.16|3.16	0.36331|0.36331	Nitric oxide synthase, oxygenase domain (1);|.	0.272597|.	0.41938|.	D|.	0.000798|.	T|T	0.14570|0.14570	0.0352|0.0352	M|M	0.81239|0.81239	2.535|2.535	0.24347|0.24347	N|N	0.994935|0.994935	P|.	0.39535|.	0.677|.	B|.	0.28553|.	0.091|.	T|T	0.13575|0.13575	-1.0504|-1.0504	10|7	0.13108|0.87932	T|D	0.6|0	-25.4787|-25.4787	4.3721|4.3721	0.11253|0.11253	0.4214:0.0:0.5786:0.0|0.4214:0.0:0.5786:0.0	.|.	305|.	P29475|.	NOS1_HUMAN|.	L|Y	305|324	ENSP00000320758:F305L;ENSP00000337459:F305L|ENSP00000339862:S324Y	ENSP00000320758:F305L|ENSP00000339862:S324Y	F|S	-|-	3|2	2|0	NOS1|NOS1	116212552|116212552	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.982000|0.982000	0.71751|0.71751	0.654000|0.654000	0.24918|0.24918	1.409000|1.409000	0.46915|0.46915	0.467000|0.467000	0.42956|0.42956	TTC|TCC		0.557	NOS1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000268053.1			
NT5C3A	51251	broad.mit.edu;hgsc.bcm.edu	37	7	33054375	33054375	+	Missense_Mutation	SNP	T	T	G			TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr7:33054375T>G	ENST00000242210.7	-	9	1054	c.978A>C	c.(976-978)gaA>gaC	p.E326D	NT5C3A_ENST00000381626.2_Missense_Mutation_p.E275D|NT5C3A_ENST00000610140.1_Missense_Mutation_p.E321D|NT5C3A_ENST00000396152.2_Missense_Mutation_p.E287D|NT5C3A_ENST00000409467.1_Missense_Mutation_p.E275D|AVL9_ENST00000404479.1_Intron|NT5C3A_ENST00000405342.1_Missense_Mutation_p.E287D	NM_001002009.2|NM_001002010.2	NP_001002009.1|NP_001002010.1	Q9H0P0	5NT3A_HUMAN	5'-nucleotidase, cytosolic IIIA	326					dephosphorylation (GO:0016311)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide metabolic process (GO:0009117)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|pyrimidine nucleoside metabolic process (GO:0006213)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)	2'-phosphotransferase activity (GO:0008665)|5'-nucleotidase activity (GO:0008253)|magnesium ion binding (GO:0000287)|nucleotide binding (GO:0000166)	p.E326D(1)|p.E287D(1)									AGTTGGCTACTTCTAATGATT	0.348																																																	2	Substitution - Missense(2)	kidney(2)											104.0	105.0	105.0					7																	33054375		2203	4298	6501	SO:0001583	missense	51251			AF312735	CCDS34616.1, CCDS34617.1, CCDS55101.1	7p14.3	2013-03-06	2013-03-06	2013-03-06	ENSG00000122643	ENSG00000122643	3.1.3.5		17820	protein-coding gene	gene with protein product	"""lupin"""	606224	"""5'-nucleotidase, cytosolic III"""	NT5C3		11042152, 10942414	Standard	NM_001002010		Approved	UMPH1, PSN1, PN-I, UMPH, P5'N-1, cN-III, p36, POMP, hUMP1	uc003tdk.4	Q9H0P0	OTTHUMG00000152983	ENST00000242210.7:c.978A>C	7.37:g.33054375T>G	ENSP00000242210:p.Glu326Asp		A8K253|B2RAA5|B8ZZC4|Q6IPZ1|Q6NXS6|Q7L3G6|Q9P0P5|Q9UC42|Q9UC43|Q9UC44|Q9UC45	Missense_Mutation	SNP	ENST00000242210.7	37	CCDS34616.1	.	.	.	.	.	.	.	.	.	.	T	2.207	-0.381569	0.05000	.	.	ENSG00000122643	ENST00000381626;ENST00000396152;ENST00000242210;ENST00000405342;ENST00000409467	T;T;T;T;T	0.80123	-1.34;-1.34;-1.34;-1.34;-1.34	5.94	-7.24	0.01475	HAD-like domain (1);	0.211976	0.48286	N	0.000190	T	0.42086	0.1187	N	0.04387	-0.21	0.27569	N	0.949945	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.0	T	0.57093	-0.7870	10	0.02654	T	1	.	1.584	0.02640	0.3956:0.0963:0.1506:0.3575	.	326;287	Q9H0P0;Q9H0P0-1	5NT3_HUMAN;.	D	275;287;326;287;275	ENSP00000371039:E275D;ENSP00000379456:E287D;ENSP00000242210:E326D;ENSP00000385261:E287D;ENSP00000387166:E275D	ENSP00000242210:E326D	E	-	3	2	NT5C3	33020900	0.000000	0.05858	0.012000	0.15200	0.864000	0.49448	-2.230000	0.01207	-1.784000	0.01272	-0.248000	0.11899	GAA		0.348	NT5C3A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000328880.1		NM_016489	
OR4C6	219432	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	55432900	55432900	+	Missense_Mutation	SNP	G	G	T	rs199670684		TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr11:55432900G>T	ENST00000314259.3	+	1	287	c.258G>T	c.(256-258)aaG>aaT	p.K86N		NM_001004704.1	NP_001004704.1	Q8NH72	OR4C6_HUMAN	olfactory receptor, family 4, subfamily C, member 6	86						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.K86N(1)		breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(4)|lung(49)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	71						CCCTCTCCAAGAGCACTACCA	0.488																																																	1	Substitution - Missense(1)	kidney(1)											181.0	158.0	166.0					11																	55432900		2200	4296	6496	SO:0001583	missense	219432			CR593785	CCDS31506.1	11q11	2012-08-09			ENSG00000181903	ENSG00000181903		"""GPCR / Class A : Olfactory receptors"""	14743	protein-coding gene	gene with protein product							Standard	NM_001004704		Approved		uc010rik.2	Q8NH72	OTTHUMG00000166800	ENST00000314259.3:c.258G>T	11.37:g.55432900G>T	ENSP00000324769:p.Lys86Asn		B2RP11|Q6IFD2	Missense_Mutation	SNP	ENST00000314259.3	37	CCDS31506.1	.	.	.	.	.	.	.	.	.	.	G	9.649	1.140990	0.21205	.	.	ENSG00000181903	ENST00000314259	T	0.03004	4.08	3.83	0.775	0.18527	GPCR, rhodopsin-like superfamily (1);	0.398819	0.17999	N	0.154945	T	0.02888	0.0086	L	0.28054	0.825	0.09310	N	1	B	0.06786	0.001	B	0.09377	0.004	T	0.39881	-0.9592	10	0.56958	D	0.05	.	7.0553	0.25095	0.4074:0.0:0.5926:0.0	.	86	Q8NH72	OR4C6_HUMAN	N	86	ENSP00000324769:K86N	ENSP00000324769:K86N	K	+	3	2	OR4C6	55189476	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	-0.446000	0.06837	0.148000	0.19059	0.543000	0.68304	AAG		0.488	OR4C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391504.1		NM_001004704	
OR4D2	124538	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	56247641	56247641	+	Missense_Mutation	SNP	G	G	A	rs149114670		TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr17:56247641G>A	ENST00000545221.1	+	1	625	c.625G>A	c.(625-627)Gtc>Atc	p.V209I		NM_001004707.3	NP_001004707.1	P58180	OR4D2_HUMAN	olfactory receptor, family 4, subfamily D, member 2	209						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V209I(2)		breast(1)|kidney(1)|large_intestine(1)|lung(19)|ovary(1)|skin(2)|stomach(1)	26						GCTGGATGTCGTCTGGTTCTT	0.527																																																	2	Substitution - Missense(2)	ovary(1)|kidney(1)						A	ILE/VAL	2,4404	826.0+/-416.6	0,2,2201	174.0	130.0	145.0		625	4.6	0.9	17	dbSNP_134	145	0,8600		0,0,4300	yes	missense	OR4D2	NM_001004707.3	29	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	benign	209/308	56247641	2,13004	2203	4300	6503	SO:0001583	missense	124538				CCDS32688.1	17q22	2013-09-23			ENSG00000255713	ENSG00000255713		"""GPCR / Class A : Olfactory receptors"""	8294	protein-coding gene	gene with protein product							Standard	NM_001004707		Approved		uc010wnp.2	P58180	OTTHUMG00000178801	ENST00000545221.1:c.625G>A	17.37:g.56247641G>A	ENSP00000441354:p.Val209Ile		Q6IFN8|Q96R75	Missense_Mutation	SNP	ENST00000545221.1	37	CCDS32688.1	.	.	.	.	.	.	.	.	.	.	A	0.012	-1.670560	0.00758	4.54E-4	0.0	ENSG00000255713	ENST00000545221	T	0.35236	1.32	5.71	4.63	0.57726	GPCR, rhodopsin-like superfamily (1);	0.114355	0.39274	N	0.001415	T	0.17492	0.0420	N	0.16130	0.375	0.18873	N	0.999984	B	0.06786	0.001	B	0.09377	0.004	T	0.33574	-0.9863	10	0.02654	T	1	-40.4738	9.1704	0.37076	0.8488:0.0:0.1512:0.0	.	209	P58180	OR4D2_HUMAN	I	209	ENSP00000441354:V209I	ENSP00000441354:V209I	V	+	1	0	OR4D2	53602640	0.000000	0.05858	0.867000	0.34043	0.054000	0.15201	-0.064000	0.11636	0.516000	0.28340	-0.308000	0.09152	GTC		0.527	OR4D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443366.1			
PIK3R2	5296	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	18278085	18278085	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr19:18278085C>A	ENST00000593731.1	+	13	2265	c.1705C>A	c.(1705-1707)Cag>Aag	p.Q569K	PIK3R2_ENST00000222254.8_Missense_Mutation_p.Q569K			O00459	P85B_HUMAN	phosphoinositide-3-kinase, regulatory subunit 2 (beta)	569					blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)	phosphatidylinositol 3-kinase regulator activity (GO:0035014)|receptor tyrosine kinase binding (GO:0030971)	p.Q569K(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(3)|pancreas(1)|stomach(1)	24					Isoprenaline(DB01064)	GGACCTCATGCAGCTGCGCAA	0.622																																																	1	Substitution - Missense(1)	kidney(1)											76.0	81.0	80.0					19																	18278085		2203	4300	6503	SO:0001583	missense	5296				CCDS12371.1	19p13.11	2013-03-28	2008-02-04		ENSG00000105647	ENSG00000105647		"""SH2 domain containing"""	8980	protein-coding gene	gene with protein product		603157				1314371	Standard	NM_005027		Approved	P85B, p85	uc002nia.2	O00459	OTTHUMG00000183383	ENST00000593731.1:c.1705C>A	19.37:g.18278085C>A	ENSP00000471914:p.Gln569Lys		Q5EAT5|Q9UPH9	Missense_Mutation	SNP	ENST00000593731.1	37	CCDS12371.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.968675	0.74131	.	.	ENSG00000105647	ENST00000222254	T	0.29655	1.56	4.24	4.24	0.50183	.	0.000000	0.85682	D	0.000000	T	0.53433	0.1796	M	0.80028	2.48	0.80722	D	1	D	0.61080	0.989	P	0.58266	0.836	T	0.62455	-0.6851	10	0.66056	D	0.02	-36.2329	16.4813	0.84158	0.0:1.0:0.0:0.0	.	569	O00459	P85B_HUMAN	K	569	ENSP00000222254:Q569K	ENSP00000222254:Q569K	Q	+	1	0	PIK3R2	18139085	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.663000	0.83820	2.288000	0.76882	0.561000	0.74099	CAG		0.622	PIK3R2-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	protein_coding	OTTHUMT00000466386.2		NM_005027	
PRICKLE1	144165	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	42864091	42864091	+	Missense_Mutation	SNP	C	C	G			TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr12:42864091C>G	ENST00000455697.1	-	3	488	c.203G>C	c.(202-204)cGg>cCg	p.R68P	PRICKLE1_ENST00000552240.1_Missense_Mutation_p.R68P|PRICKLE1_ENST00000548696.1_Missense_Mutation_p.R68P|PRICKLE1_ENST00000345127.3_Missense_Mutation_p.R68P|PRICKLE1_ENST00000445766.2_Missense_Mutation_p.R68P	NM_001144882.1|NM_001144883.1	NP_001138354.1|NP_001138355.1	Q96MT3	PRIC1_HUMAN	prickle homolog 1 (Drosophila)	68	PET. {ECO:0000255|PROSITE- ProRule:PRU00636}.				negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell myoblast differentiation (GO:2000691)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.R68P(1)		NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|liver(1)|lung(13)|ovary(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	47	all_cancers(12;4.25e-05)|Breast(8;0.176)			GBM - Glioblastoma multiforme(48;0.2)		CTGTTTAATCCGATGCTTCTC	0.398																																																	1	Substitution - Missense(1)	kidney(1)											128.0	115.0	119.0					12																	42864091		2203	4300	6503	SO:0001583	missense	144165			AK056499	CCDS8742.1	12p11-q12	2010-08-13	2006-09-12			ENSG00000139174			17019	protein-coding gene	gene with protein product		608500	"""prickle-like 1 (Drosophila)"""			12525887, 18976727	Standard	NM_153026		Approved	FLJ31937, EPM1B	uc010skv.2	Q96MT3		ENST00000455697.1:c.203G>C	12.37:g.42864091C>G	ENSP00000401060:p.Arg68Pro		Q14C83|Q71QF8|Q96N00	Missense_Mutation	SNP	ENST00000455697.1	37	CCDS8742.1	.	.	.	.	.	.	.	.	.	.	C	29.6	5.021240	0.93462	.	.	ENSG00000139174	ENST00000455697;ENST00000445766;ENST00000548696;ENST00000345127;ENST00000552240;ENST00000552108;ENST00000551050;ENST00000547113	D;D;D;D;D;D;D;D	0.91464	-2.85;-2.85;-2.85;-2.85;-2.85;-2.85;-2.85;-2.85	5.38	5.38	0.77491	PET domain (2);	0.000000	0.85682	D	0.000000	D	0.97031	0.9030	H	0.95151	3.63	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.97815	1.0253	10	0.87932	D	0	-0.3777	19.5701	0.95409	0.0:1.0:0.0:0.0	.	68	Q96MT3	PRIC1_HUMAN	P	68	ENSP00000401060:R68P;ENSP00000398947:R68P;ENSP00000448359:R68P;ENSP00000345064:R68P;ENSP00000449819:R68P;ENSP00000447870:R68P;ENSP00000446970:R68P;ENSP00000446699:R68P	ENSP00000345064:R68P	R	-	2	0	PRICKLE1	41150358	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.773000	0.85462	2.702000	0.92279	0.556000	0.70494	CGG		0.398	PRICKLE1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404069.1			
PTEN	5728	broad.mit.edu;hgsc.bcm.edu	37	10	89725043	89725043	+	Splice_Site	SNP	G	G	A			TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina HiSeq	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr10:89725043G>A	ENST00000371953.3	+	9	2383		c.e9-1			NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog						activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.?(7)|p.R55fs*1(5)|p.N212fs*1(2)|p.Y27fs*1(2)|p.G165_*404del(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		TCTTTCTCTAGGTGAAGCTGT	0.333		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																													yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	54	Whole gene deletion(37)|Deletion - Frameshift(9)|Unknown(7)|Deletion - In frame(1)	prostate(16)|central_nervous_system(12)|skin(5)|endometrium(4)|lung(4)|haematopoietic_and_lymphoid_tissue(3)|breast(3)|ovary(3)|urinary_tract(2)|soft_tissue(1)|kidney(1)											42.0	39.0	40.0					10																	89725043		2203	4300	6503	SO:0001630	splice_region_variant	5728	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.1027-1G>A	10.37:g.89725043G>A			B2R904|F2YHV0|O00633|O02679|Q6ICT7	Splice_Site	SNP	ENST00000371953.3	37	CCDS31238.1	.	.	.	.	.	.	.	.	.	.	G	16.12	3.033253	0.54896	.	.	ENSG00000171862	ENST00000371953	.	.	.	5.31	5.31	0.75309	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.4116	0.94675	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PTEN	89715023	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.426000	0.97469	2.652000	0.90054	0.586000	0.80456	.		0.333	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049241.1		NM_000314	Intron
PYGM	5837	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	64527310	64527310	+	Missense_Mutation	SNP	C	C	T	rs145881639	byFrequency	TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr11:64527310C>T	ENST00000164139.3	-	1	459	c.61G>A	c.(61-63)Ggc>Agc	p.G21S	PYGM_ENST00000377432.3_Missense_Mutation_p.G21S	NM_005609.2	NP_005600.1	P11217	PYGM_HUMAN	phosphorylase, glycogen, muscle	21					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	glycogen phosphorylase activity (GO:0008184)|nucleotide binding (GO:0000166)|pyridoxal phosphate binding (GO:0030170)	p.G21S(1)		cervix(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(21)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						TTCTCCACGCCGGCCAGGCCA	0.572																																																	1	Substitution - Missense(1)	kidney(1)						C	SER/GLY,SER/GLY	0,4402		0,0,2201	168.0	156.0	160.0		61,61	5.4	1.0	11	dbSNP_134	160	7,8587	5.7+/-21.5	0,7,4290	yes	missense,missense	PYGM	NM_001164716.1,NM_005609.2	56,56	0,7,6491	TT,TC,CC		0.0815,0.0,0.0539	benign,benign	21/755,21/843	64527310	7,12989	2201	4297	6498	SO:0001583	missense	5837				CCDS8079.1, CCDS53659.1	11q12-q13.2	2013-03-01	2008-07-31		ENSG00000068976	ENSG00000068976	2.4.1.1	"""Glycogen phosphorylases"""	9726	protein-coding gene	gene with protein product	"""McArdle syndrome"", ""glycogen storage disease type V"", ""glycogen phosphorylase, muscle form"""	608455	"""phosphorylase, glycogen; muscle"""				Standard	NM_005609		Approved		uc001oax.4	P11217	OTTHUMG00000066835	ENST00000164139.3:c.61G>A	11.37:g.64527310C>T	ENSP00000164139:p.Gly21Ser		A0AVK1|A6NDY6	Missense_Mutation	SNP	ENST00000164139.3	37	CCDS8079.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.281070	0.80692	0.0	8.15E-4	ENSG00000068976	ENST00000377432;ENST00000164139;ENST00000540450	D;D	0.93307	-3.01;-3.2	5.41	5.41	0.78517	.	0.000000	0.64402	D	0.000014	D	0.95306	0.8477	L	0.53249	1.67	0.80722	D	1	D;B	0.89917	1.0;0.025	D;B	0.76071	0.987;0.004	D	0.93606	0.6934	10	0.25106	T	0.35	-26.1792	16.6868	0.85310	0.0:1.0:0.0:0.0	.	21;21	A6NDY6;P11217	.;PYGM_HUMAN	S	21	ENSP00000366650:G21S;ENSP00000164139:G21S	ENSP00000164139:G21S	G	-	1	0	PYGM	64283886	1.000000	0.71417	1.000000	0.80357	0.807000	0.45602	5.889000	0.69766	2.562000	0.86427	0.655000	0.94253	GGC		0.572	PYGM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143254.2		NM_005609	
RP1	6101	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	55542355	55542355	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr8:55542355C>A	ENST00000220676.1	+	4	6061	c.5913C>A	c.(5911-5913)aaC>aaA	p.N1971K		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	1971					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)	p.N1971K(1)		NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			GGGAAGAGAACAATAAAGCAA	0.299																																					Colon(91;1014 1389 7634 14542 40420)												1	Substitution - Missense(1)	kidney(1)											52.0	57.0	55.0					8																	55542355		2200	4296	6496	SO:0001583	missense	6101			AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.5913C>A	8.37:g.55542355C>A	ENSP00000220676:p.Asn1971Lys			Missense_Mutation	SNP	ENST00000220676.1	37	CCDS6160.1	.	.	.	.	.	.	.	.	.	.	C	6.411	0.443938	0.12164	.	.	ENSG00000104237	ENST00000220676	T	0.25085	1.82	5.77	2.61	0.31194	.	0.227321	0.30510	N	0.009480	T	0.19685	0.0473	L	0.59436	1.845	0.09310	N	1	B	0.24721	0.11	B	0.17979	0.02	T	0.35599	-0.9782	10	0.87932	D	0	.	1.1198	0.01722	0.1522:0.4052:0.148:0.2946	.	1971	P56715	RP1_HUMAN	K	1971	ENSP00000220676:N1971K	ENSP00000220676:N1971K	N	+	3	2	RP1	55704908	0.000000	0.05858	0.001000	0.08648	0.048000	0.14542	-0.883000	0.04170	0.200000	0.20447	0.655000	0.94253	AAC		0.299	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378532.2		NM_006269	
RPGR	6103	hgsc.bcm.edu	37	X	38145180	38145180	+	Intron	SNP	C	C	T	rs373542041|rs199896738		TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chrX:38145180C>T	ENST00000339363.3	-	14	2688				RPGR_ENST00000309513.3_Intron|RPGR_ENST00000318842.7_Intron|RPGR_ENST00000342811.3_Intron|TM4SF2_ENST00000465127.1_Intron|RPGR_ENST00000378505.2_Silent_p.E1024E|RPGR_ENST00000338898.3_Intron			Q92834	RPGR_HUMAN	retinitis pigmentosa GTPase regulator						cilium assembly (GO:0042384)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|intraciliary transport (GO:0042073)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|Golgi apparatus (GO:0005794)|photoreceptor outer segment (GO:0001750)|sperm flagellum (GO:0036126)	guanyl-nucleotide exchange factor activity (GO:0005085)|poly(A) RNA binding (GO:0044822)	p.E1024E(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	25						ccccttccacctccccttcca	0.562																																																	1	Substitution - coding silent(1)	endometrium(1)											60.0	41.0	48.0					X																	38145180		2177	4269	6446	SO:0001627	intron_variant	6103			U57629	CCDS14246.1, CCDS35229.1	Xp11.4	2013-06-06	2004-02-13		ENSG00000156313	ENSG00000156313			10295	protein-coding gene	gene with protein product		312610	"""retinitis pigmentosa 15"", ""cone dystrophy 1 (X-linked)"""	CRD, RP3, RP15, COD1		8673101, 8817343	Standard	XM_005272633		Approved	CORDX1	uc004ded.1	Q92834	OTTHUMG00000021361	ENST00000339363.3:c.2520+1166G>A	X.37:g.38145180C>T			B1ARN3|E9PE28|O00702|O00737|Q3KN84|Q8N5T6|Q93039|Q9HD29|Q9UMR1	Silent	SNP	ENST00000339363.3	37																																																																																					0.562	RPGR-203	KNOWN	basic|appris_candidate	protein_coding	protein_coding			NM_000328	
RPL18	6141	broad.mit.edu;hgsc.bcm.edu	37	19	49121088	49121088	+	Missense_Mutation	SNP	T	T	G			TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr19:49121088T>G	ENST00000549920.1	-	2	442	c.50A>C	c.(49-51)gAg>gCg	p.E17A	AC022154.7_ENST00000594850.1_RNA|AC022154.7_ENST00000600303.1_RNA|FAM83E_ENST00000595110.1_5'Flank|SPHK2_ENST00000601712.1_5'Flank|RPL18_ENST00000549273.1_Missense_Mutation_p.E17A|RPL18_ENST00000550645.1_Missense_Mutation_p.E17A|SPHK2_ENST00000245222.4_5'Flank|SPHK2_ENST00000598088.1_5'Flank|AC022154.7_ENST00000598735.1_RNA|SPHK2_ENST00000340932.3_5'Flank|SPHK2_ENST00000600537.1_5'Flank|RPL18_ENST00000552588.1_Intron	NM_000979.3	NP_000970.1	Q07020	RL18_HUMAN	ribosomal protein L18	17					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)	p.E17A(1)		cervix(1)|kidney(2)	3		all_epithelial(76;2.38e-06)|all_lung(116;4.89e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;9.89e-05)|all cancers(93;0.00011)|GBM - Glioblastoma multiforme(486;0.0061)|Epithelial(262;0.0154)		GCTCTTGGGCTCCTTGCGCCG	0.572																																																	1	Substitution - Missense(1)	kidney(1)											111.0	86.0	94.0					19																	49121088		2203	4300	6503	SO:0001583	missense	6141			L11566	CCDS12726.1, CCDS58669.1	19q13	2011-04-06				ENSG00000063177		"""L ribosomal proteins"""	10310	protein-coding gene	gene with protein product	"""60S ribosomal protein L18"""	604179				8218404	Standard	NM_000979		Approved	L18	uc002pjq.2	Q07020	OTTHUMG00000169760	ENST00000549920.1:c.50A>C	19.37:g.49121088T>G	ENSP00000447001:p.Glu17Ala		F8VWC5|Q8WTZ6	Missense_Mutation	SNP	ENST00000549920.1	37	CCDS12726.1	.	.	.	.	.	.	.	.	.	.	T	11.17	1.559884	0.27827	.	.	ENSG00000063177	ENST00000549920;ENST00000550645;ENST00000549273;ENST00000450952	.	.	.	4.86	4.86	0.63082	Ribosomal protein L18e/L15P (1);	0.052999	0.64402	D	0.000001	T	0.36853	0.0982	N	0.12471	0.22	0.80722	D	1	B;B	0.19200	0.034;0.001	B;B	0.24974	0.057;0.013	T	0.20174	-1.0283	9	0.07813	T	0.8	-37.0666	13.034	0.58859	0.0:0.0:0.0:1.0	.	17;17	B4DDY5;Q07020	.;RL18_HUMAN	A	17	.	ENSP00000407348:E17A	E	-	2	0	RPL18	53812900	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.947000	0.75959	2.131000	0.65755	0.533000	0.62120	GAG		0.572	RPL18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405732.2		NM_000979	
SHMT1	6470	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	18250958	18250958	+	Missense_Mutation	SNP	T	T	A			TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr17:18250958T>A	ENST00000316694.3	-	5	505	c.371A>T	c.(370-372)aAc>aTc	p.N124I	SHMT1_ENST00000354098.3_Missense_Mutation_p.N124I|SHMT1_ENST00000539052.1_5'UTR|SHMT1_ENST00000352886.6_Missense_Mutation_p.N124I	NM_004169.3	NP_004160.3	P34896	GLYC_HUMAN	serine hydroxymethyltransferase 1 (soluble)	124					carnitine biosynthetic process (GO:0045329)|cellular nitrogen compound metabolic process (GO:0034641)|folic acid metabolic process (GO:0046655)|glycine biosynthetic process from serine (GO:0019264)|L-serine catabolic process (GO:0006565)|protein homotetramerization (GO:0051289)|protein tetramerization (GO:0051262)|purine nucleobase biosynthetic process (GO:0009113)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	amino acid binding (GO:0016597)|glycine hydroxymethyltransferase activity (GO:0004372)|L-allo-threonine aldolase activity (GO:0008732)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)	p.N124I(1)		breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|ovary(1)	13					Glycine(DB00145)|Mimosine(DB01055)|Tetrahydrofolic acid(DB00116)	CACAGCAAAGTTTGCAGGGGA	0.567																																																	1	Substitution - Missense(1)	kidney(1)											69.0	72.0	71.0					17																	18250958		2203	4300	6503	SO:0001583	missense	6470				CCDS11196.1, CCDS11197.1, CCDS62112.1	17p11.2	2010-04-23			ENSG00000176974	ENSG00000176974	2.1.2.1		10850	protein-coding gene	gene with protein product	"""cytoplasmic serine hydroxymethyltransferase"", ""14 kDa protein"""	182144				8505317	Standard	NM_004169		Approved	CSHMT, SHMT, MGC15229, MGC24556	uc002gta.3	P34896	OTTHUMG00000059094	ENST00000316694.3:c.371A>T	17.37:g.18250958T>A	ENSP00000318868:p.Asn124Ile		B4DPM9|D3DXD0|Q96HY0|Q9UMD1|Q9UMD2	Missense_Mutation	SNP	ENST00000316694.3	37	CCDS11196.1	.	.	.	.	.	.	.	.	.	.	T	12.90	2.077700	0.36662	.	.	ENSG00000176974	ENST00000316694;ENST00000352886;ENST00000354098;ENST00000395685	T;T;T	0.58940	0.3;0.3;0.3	5.06	5.06	0.68205	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	D	0.86900	0.6044	H	0.99650	4.68	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.92797	0.6253	10	0.87932	D	0	-38.6122	15.1444	0.72637	0.0:0.0:0.0:1.0	.	124;124;124;124	B4DZB5;A8MYA6;P34896-2;P34896	.;.;.;GLYC_HUMAN	I	124	ENSP00000318868:N124I;ENSP00000345881:N124I;ENSP00000318805:N124I	ENSP00000318868:N124I	N	-	2	0	SHMT1	18191683	1.000000	0.71417	1.000000	0.80357	0.519000	0.34347	7.862000	0.87013	2.035000	0.60131	0.379000	0.24179	AAC		0.567	SHMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130831.2		NM_004169	
SHROOM1	134549	broad.mit.edu;ucsc.edu	37	5	132158628	132158629	+	Missense_Mutation	DNP	CC	CC	TA			TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr5:132158628_132158629CC>TA	ENST00000378679.3	-	10	3222_3223	c.2418_2419GG>TA	c.(2416-2421)ctGGac>ctTAac	p.D807N	SHROOM1_ENST00000378676.1_Missense_Mutation_p.D738N|SHROOM1_ENST00000488072.1_5'Flank|SHROOM1_ENST00000319854.3_Missense_Mutation_p.D802N	NM_001172700.1	NP_001166171.1	Q2M3G4	SHRM1_HUMAN	shroom family member 1	807	ASD2. {ECO:0000255|PROSITE- ProRule:PRU00638}.				actin filament bundle assembly (GO:0051017)|cell morphogenesis (GO:0000902)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|myosin II complex (GO:0016460)	actin filament binding (GO:0051015)	p.D802N(1)|p.L801L(1)		endometrium(1)|kidney(4)|large_intestine(2)|lung(4)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	17			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			ATGCGCTCGTCCAGGTTGCGCT	0.708																																																	2	Substitution - Missense(1)|Substitution - coding silent(1)	kidney(2)																																								SO:0001583	missense	134549			AF314142	CCDS4161.1, CCDS54902.1	5q31.1	2007-05-03			ENSG00000164403	ENSG00000164403			24084	protein-coding gene	gene with protein product		611179				11853319, 16615870	Standard	NM_133456		Approved	APXL2, KIAA1960	uc003kxy.2	Q2M3G4	OTTHUMG00000059835	ENST00000378679.3:c.2418_2419delinsTA	5.37:g.132158628_132158629delinsTA	ENSP00000367950:p.Asp807Asn		B7WP40|B7ZL01|Q8TDP0|Q8TF41	Missense_Mutation|Silent	SNP	ENST00000378679.3	37	CCDS54902.1																																																																																				0.708	SHROOM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000133033.1		NM_133456	
SLC4A1	6521	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	42335974	42335974	+	Frame_Shift_Del	DEL	G	G	-			TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr17:42335974delG	ENST00000262418.6	-	10	1049	c.894delC	c.(892-894)gccfs	p.A298fs	AC003043.1_ENST00000597382.1_Intron|SLC4A1_ENST00000471005.1_5'Flank	NM_000342.3	NP_000333.1	P02730	B3AT_HUMAN	solute carrier family 4 (anion exchanger), member 1 (Diego blood group)	298					anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|cellular ion homeostasis (GO:0006873)|chloride transport (GO:0006821)|ion transport (GO:0006811)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|blood microparticle (GO:0072562)|cortical cytoskeleton (GO:0030863)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	anion transmembrane transporter activity (GO:0008509)|anion:anion antiporter activity (GO:0015301)|ankyrin binding (GO:0030506)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride transmembrane transporter activity (GO:0015108)|inorganic anion exchanger activity (GO:0005452)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(16)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	40		Breast(137;0.014)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.115)		GAGCCATGTAGGCATCTATGC	0.657																																																	0													24.0	25.0	25.0					17																	42335974		2199	4297	6496	SO:0001589	frameshift_variant	6521				CCDS11481.1	17q21.31	2014-07-19	2014-01-02		ENSG00000004939	ENSG00000004939		"""CD molecules"", ""Blood group antigens"", ""Solute carriers"""	11027	protein-coding gene	gene with protein product	"""Froese blood group"", ""Swann blood group"", ""Wright blood group"""	109270	"""Waldner blood group"", ""erythrocyte membrane protein band 3"", ""Diego blood group"", ""solute carrier family 4, anion exchanger, member 1 (erythrocyte membrane protein band 3, Diego blood group)"", ""solute carrier family 4 (anion exchanger), member 1"""	EPB3, AE1, DI, WD		8434259	Standard	NM_000342		Approved	RTA1A, CD233, FR, SW, WR	uc002igf.4	P02730	OTTHUMG00000156843	ENST00000262418.6:c.894delC	17.37:g.42335974delG	ENSP00000262418:p.Ala298fs		G4V2I6|P78487|Q1ZZ45|Q4KKW9|Q4VB84|Q9UCY7|Q9UDJ1	Frame_Shift_Del	DEL	ENST00000262418.6	37	CCDS11481.1																																																																																				0.657	SLC4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346194.1		NM_000342	
SLC5A11	115584	broad.mit.edu;ucsc.edu	37	16	24918068	24918068	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr16:24918068T>C	ENST00000347898.3	+	11	1719	c.1097T>C	c.(1096-1098)cTg>cCg	p.L366P	SLC5A11_ENST00000567758.1_Missense_Mutation_p.L331P|SLC5A11_ENST00000424767.2_Missense_Mutation_p.L331P|SLC5A11_ENST00000568579.1_Missense_Mutation_p.L296P|SLC5A11_ENST00000539472.1_Missense_Mutation_p.L302P|SLC5A11_ENST00000569071.1_Silent_p.A233A|SLC5A11_ENST00000449109.2_Silent_p.A233A|SLC5A11_ENST00000545376.1_Missense_Mutation_p.L296P|SLC5A11_ENST00000565769.1_Missense_Mutation_p.L302P	NM_052944.3	NP_443176.2			solute carrier family 5 (sodium/inositol cotransporter), member 11									p.L366P(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(30)|ovary(2)|prostate(2)|urinary_tract(1)	49				GBM - Glioblastoma multiforme(48;0.0365)		AAACTCGTGCTGGAACTCCTG	0.557											OREG0023688	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					1	Substitution - Missense(1)	kidney(1)											96.0	78.0	84.0					16																	24918068		2197	4300	6497	SO:0001583	missense	115584			AF292385	CCDS10625.1, CCDS58437.1, CCDS58438.1, CCDS58439.1, CCDS58440.1	16p12.1	2013-07-19	2013-07-19		ENSG00000158865	ENSG00000158865		"""Solute carriers"""	23091	protein-coding gene	gene with protein product		610238	"""solute carrier family 5 (sodium/glucose cotransporter), member 11"""			12039040, 12133831	Standard	NM_001258414		Approved	KST1, SMIT2, SGLT6	uc002dmu.4	Q8WWX8	OTTHUMG00000097003	ENST00000347898.3:c.1097T>C	16.37:g.24918068T>C	ENSP00000289932:p.Leu366Pro	775		Missense_Mutation	SNP	ENST00000347898.3	37	CCDS10625.1	.	.	.	.	.	.	.	.	.	.	T	15.96	2.988080	0.53934	.	.	ENSG00000158865	ENST00000347898;ENST00000424767;ENST00000545376;ENST00000539472	D;D;D;D	0.88201	-2.35;-2.35;-2.35;-2.35	5.73	5.73	0.89815	.	0.166320	0.56097	D	0.000029	D	0.90827	0.7119	M	0.86268	2.805	0.58432	D	0.999999	B;B;B	0.30542	0.284;0.241;0.183	B;B;B	0.35312	0.2;0.126;0.166	D	0.90599	0.4543	10	0.87932	D	0	.	13.9636	0.64196	0.0:0.0:0.0:1.0	.	296;331;366	B7Z329;Q8WWX8-2;Q8WWX8	.;.;SC5AB_HUMAN	P	366;331;296;302	ENSP00000289932:L366P;ENSP00000416782:L331P;ENSP00000441384:L296P;ENSP00000441018:L302P	ENSP00000289932:L366P	L	+	2	0	SLC5A11	24825569	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.138000	0.71717	2.187000	0.69744	0.460000	0.39030	CTG		0.557	SLC5A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214091.3		NM_052944	
TCF4	6925	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	18	52937099	52937099	+	Silent	SNP	G	G	A			TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr18:52937099G>A	ENST00000356073.4	-	11	1496	c.885C>T	c.(883-885)tcC>tcT	p.S295S	TCF4_ENST00000537578.1_Silent_p.S271S|TCF4_ENST00000398339.1_Silent_p.S397S|TCF4_ENST00000570287.2_Silent_p.S135S|TCF4_ENST00000566279.1_Silent_p.S235S|TCF4_ENST00000568673.1_Silent_p.S271S|TCF4_ENST00000543082.1_Silent_p.S253S|TCF4_ENST00000564403.2_Silent_p.S301S|TCF4_ENST00000457482.3_Silent_p.S135S|TCF4_ENST00000568740.1_Silent_p.S270S|TCF4_ENST00000561831.3_Silent_p.S135S|TCF4_ENST00000563760.1_5'UTR|TCF4_ENST00000565018.2_Silent_p.S295S|TCF4_ENST00000564999.1_Silent_p.S295S|TCF4_ENST00000567880.1_Silent_p.S235S|TCF4_ENST00000354452.3_Silent_p.S295S|TCF4_ENST00000561992.1_Silent_p.S165S|TCF4_ENST00000544241.2_Silent_p.S224S|TCF4_ENST00000537856.3_Silent_p.S165S|TCF4_ENST00000570177.2_Silent_p.S165S|TCF4_ENST00000566286.1_Silent_p.S293S|TCF4_ENST00000564228.1_Silent_p.S224S|TCF4_ENST00000540999.1_Silent_p.S271S	NM_003199.2	NP_003190.1	P15884	ITF2_HUMAN	transcription factor 4	295					DNA-templated transcription, initiation (GO:0006352)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein-DNA complex assembly (GO:0065004)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase recruiting transcription factor activity (GO:0001011)|sequence-specific DNA binding transcription factor activity (GO:0003700)|TFIIB-class binding transcription factor activity (GO:0001087)|TFIIB-class transcription factor binding (GO:0001093)	p.S397S(1)|p.S295S(1)		breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(5)|urinary_tract(1)	41				Colorectal(16;0.00108)|READ - Rectum adenocarcinoma(59;0.0649)|COAD - Colon adenocarcinoma(17;0.0718)		GAGGCGTACAGGAAGAGGTGC	0.458																																																	2	Substitution - coding silent(2)	kidney(2)											177.0	144.0	155.0					18																	52937099		2203	4300	6503	SO:0001819	synonymous_variant	6925			M74719	CCDS11960.1, CCDS42438.1, CCDS58623.1, CCDS58624.1, CCDS58625.1, CCDS58626.1, CCDS58627.1, CCDS58628.1, CCDS58629.1, CCDS58630.1, CCDS58631.1, CCDS59321.1	18q21.1	2013-05-21			ENSG00000196628	ENSG00000196628		"""Basic helix-loop-helix proteins"""	11634	protein-coding gene	gene with protein product		602272				9302263, 2308860	Standard	NM_001083962		Approved	SEF2-1B, ITF2, bHLHb19, E2-2	uc002lga.3	P15884	OTTHUMG00000132713	ENST00000356073.4:c.885C>T	18.37:g.52937099G>A			B3KT62|B3KUC0|B4DT37|B4DUG3|B7Z5M6|B7Z6Y1|G0LNT9|G0LNU0|G0LNU1|G0LNU2|G0LNU4|G0LNU5|G0LNU8|G0LNU9|G0LNV0|G0LNV1|G0LNV2|H3BPQ1|Q08AP2|Q08AP3|Q15439|Q15440|Q15441	Silent	SNP	ENST00000356073.4	37	CCDS11960.1																																																																																				0.458	TCF4-002	KNOWN	upstream_uORF|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256014.1		NM_003199	
TMEM229A	730130	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	123672679	123672679	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr7:123672679A>T	ENST00000455783.1	-	1	844	c.379T>A	c.(379-381)Tcg>Acg	p.S127T	RP5-921G16.1_ENST00000484322.1_RNA	NM_001136002.1	NP_001129474.1	B2RXF0	T229A_HUMAN	transmembrane protein 229A	127						host cell nucleus (GO:0042025)|integral component of membrane (GO:0016021)	sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S127T(2)		endometrium(3)|kidney(3)	6						ACGTGGGCCGAGGGGTAGAGG	0.697																																																	2	Substitution - Missense(2)	kidney(2)											94.0	102.0	99.0					7																	123672679		692	1591	2283	SO:0001583	missense	730130			BC157828	CCDS47694.1	7q31.32	2009-09-22			ENSG00000234224	ENSG00000234224			37279	protein-coding gene	gene with protein product							Standard	NM_001136002		Approved		uc011kob.2	B2RXF0	OTTHUMG00000154762	ENST00000455783.1:c.379T>A	7.37:g.123672679A>T	ENSP00000395244:p.Ser127Thr		A4D0X6	Missense_Mutation	SNP	ENST00000455783.1	37	CCDS47694.1	.	.	.	.	.	.	.	.	.	.	A	14.48	2.549438	0.45383	.	.	ENSG00000234224	ENST00000455783	.	.	.	3.77	1.36	0.22044	.	.	.	.	.	T	0.23014	0.0556	L	0.29908	0.895	0.24550	N	0.994026	P	0.50819	0.939	P	0.45474	0.482	T	0.11567	-1.0582	8	0.72032	D	0.01	.	4.8652	0.13604	0.7285:0.0:0.2714:0.0	.	127	B2RXF0	T229A_HUMAN	T	127	.	ENSP00000395244:S127T	S	-	1	0	TMEM229A	123459915	1.000000	0.71417	0.993000	0.49108	0.123000	0.20343	3.624000	0.54231	0.357000	0.24183	0.374000	0.22700	TCG		0.697	TMEM229A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336960.3		NM_001136002	
VHL	7428	hgsc.bcm.edu;ucsc.edu	37	3	10188224	10188224	+	Frame_Shift_Del	DEL	G	G	-			TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr3:10188224delG	ENST00000256474.2	+	2	1207	c.367delG	c.(367-369)gggfs	p.G123fs	VHL_ENST00000477538.1_3'UTR|VHL_ENST00000345392.2_Intron	NM_000551.3	NP_000542.1	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase	123	Involved in binding to CCT complex.				cell morphogenesis (GO:0000902)|cellular response to hypoxia (GO:0071456)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|transcription factor binding (GO:0008134)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin-protein transferase activity (GO:0004842)	p.?(1)|p.G123W(1)|p.R120fs*34(1)|p.L118_G123>P(1)|p.G123fs*8(1)|p.A122fs*7(1)|p.D121fs*35(1)		adrenal_gland(25)|autonomic_ganglia(3)|central_nervous_system(2)|endometrium(6)|kidney(1662)|large_intestine(14)|lung(6)|pancreas(18)|paratesticular_tissues(1)|pleura(1)|skin(1)|soft_tissue(24)|thyroid(3)|upper_aerodigestive_tract(3)	1769				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		CAGAGATGCAGGGACACACGA	0.507		1	"""D, Mis, N, F, S"""		"""renal, hemangioma, pheochromocytoma"""	"""renal, hemangioma, pheochromocytoma"""			von Hippel-Lindau disease;Pheochromocytoma (Adrenal), Familial;Chuvash Polycythemia																														yes	Rec	yes	von Hippel-Lindau syndrome	3	3p25	7428	von Hippel-Lindau syndrome gene		"""E, M, O"""	7	Deletion - Frameshift(4)|Substitution - Missense(1)|Unknown(1)|Complex - deletion inframe(1)	kidney(6)|lung(1)											192.0	178.0	183.0					3																	10188224		2203	4300	6503	SO:0001589	frameshift_variant	7428	Familial Cancer Database	VHL; ;Erythrocytosis, Familial type 2	L15409	CCDS2597.1, CCDS2598.1	3p25.3	2014-09-17	2012-02-23		ENSG00000134086	ENSG00000134086			12687	protein-coding gene	gene with protein product		608537	"""von Hippel-Lindau syndrome"", ""von Hippel-Lindau tumor suppressor"""			9671762	Standard	NM_000551		Approved	VHL1	uc003bvc.3	P40337	OTTHUMG00000128668	ENST00000256474.2:c.367delG	3.37:g.10188224delG	ENSP00000256474:p.Gly123fs		B2RE45|Q13599|Q6PDA9	Frame_Shift_Del	DEL	ENST00000256474.2	37	CCDS2597.1																																																																																				0.507	VHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250559.1		NM_000551	
XKR6	286046	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	10782233	10782233	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr8:10782233C>T	ENST00000416569.2	-	2	898	c.872G>A	c.(871-873)cGc>cAc	p.R291H	XKR6_ENST00000304437.2_Missense_Mutation_p.R12H	NM_173683.3	NP_775954.2	Q5GH73	XKR6_HUMAN	XK, Kell blood group complex subunit-related family, member 6	291						integral component of membrane (GO:0016021)		p.R291H(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(8)|ovary(2)|prostate(1)|skin(3)	31				Lung(29;0.0407)|COAD - Colon adenocarcinoma(149;0.0555)		CTCCAGGAGGCGCAGCATGTT	0.592																																																	1	Substitution - Missense(1)	kidney(1)											109.0	100.0	103.0					8																	10782233		2203	4300	6503	SO:0001583	missense	286046			BC024146	CCDS5978.2	8p23.1	2009-05-27	2006-01-12	2005-07-28	ENSG00000171044	ENSG00000171044			27806	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 7"", ""chromosome 8 open reading frame 21"", ""X Kell blood group precursor-related family, member 6"", ""chromosome 8 open reading frame 5"""	C8orf7, C8orf21, C8orf5			Standard	NM_173683		Approved		uc003wtk.1	Q5GH73	OTTHUMG00000129351	ENST00000416569.2:c.872G>A	8.37:g.10782233C>T	ENSP00000416707:p.Arg291His		Q8TBA0	Missense_Mutation	SNP	ENST00000416569.2	37	CCDS5978.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	24.4|24.4	4.531591|4.531591	0.85706|0.85706	.|.	.|.	ENSG00000171044|ENSG00000171044	ENST00000382461|ENST00000304437;ENST00000416569	.|T;T	.|0.69926	.|-0.44;-0.44	4.84|4.84	4.84|4.84	0.62591|0.62591	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.73908|0.73908	0.3647|0.3647	L|L	0.31845|0.31845	0.965|0.965	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.87578	.|0.998	T|T	0.73959|0.73959	-0.3818|-0.3818	5|10	.|0.39692	.|T	.|0.17	-2.1414|-2.1414	16.9339|16.9339	0.86198|0.86198	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|291	.|Q5GH73	.|XKR6_HUMAN	T|H	68|12;291	.|ENSP00000307120:R12H;ENSP00000416707:R291H	.|ENSP00000307120:R12H	A|R	-|-	1|2	0|0	XKR6|XKR6	10819643|10819643	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	7.639000|7.639000	0.83342|0.83342	2.215000|2.215000	0.71742|0.71742	0.457000|0.457000	0.33378|0.33378	GCC|CGC		0.592	XKR6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383958.1		NM_173683	
VPS13B	157680	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	100711812	100711812	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina HiSeq	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr8:100711812G>T	ENST00000358544.2	+	36	6292	c.6181G>T	c.(6181-6183)Gat>Tat	p.D2061Y	VPS13B_ENST00000357162.2_Missense_Mutation_p.D2036Y|VPS13B_ENST00000395996.1_3'UTR	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	2061					protein transport (GO:0015031)			p.D2061Y(1)|p.D2036Y(1)		NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			CACCAAACTGGATCAGATAAA	0.348																																					Colon(161;2205 2542 7338 31318)												2	Substitution - Missense(2)	kidney(2)											53.0	57.0	56.0					8																	100711812		2203	4299	6502	SO:0001583	missense	157680			AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.6181G>T	8.37:g.100711812G>T	ENSP00000351346:p.Asp2061Tyr		C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	ENST00000358544.2	37	CCDS6280.1	.	.	.	.	.	.	.	.	.	.	G	15.13	2.740890	0.49151	.	.	ENSG00000132549	ENST00000357162;ENST00000358544	T;T	0.70516	-0.49;-0.49	5.58	4.7	0.59300	.	0.058865	0.64402	D	0.000004	T	0.69378	0.3104	L	0.38175	1.15	0.80722	D	1	P;P	0.37276	0.589;0.454	B;B	0.44108	0.441;0.256	T	0.72554	-0.4258	10	0.72032	D	0.01	.	16.6434	0.85138	0.0:0.1297:0.8703:0.0	.	2036;2061	Q7Z7G8-2;Q7Z7G8	.;VP13B_HUMAN	Y	2036;2061	ENSP00000349685:D2036Y;ENSP00000351346:D2061Y	ENSP00000349685:D2036Y	D	+	1	0	VPS13B	100780988	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	6.029000	0.70895	1.316000	0.45131	0.655000	0.94253	GAT		0.348	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1		NM_184042	
ZNF717	100131827	hgsc.bcm.edu	37	3	75790810	75790811	+	Frame_Shift_Ins	INS	-	-	T	rs199577560	byFrequency	TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr3:75790810_75790811insT	ENST00000477374.1	-	3	305_306	c.134_135insA	c.(133-135)accfs	p.T45fs	ZNF717_ENST00000491507.1_5'UTR|ZNF717_ENST00000478296.1_5'UTR|ZNF717_ENST00000400845.3_Frame_Shift_Ins_p.T38fs|ZNF717_ENST00000422325.1_Frame_Shift_Ins_p.T45fs			Q9BY31	ZN717_HUMAN	zinc finger protein 717	38	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(6)|endometrium(3)|lung(2)|ovary(1)|stomach(7)	19						CCCTGTACAGGGTCCTCTGAGC	0.51																																																	0																																										SO:0001589	frameshift_variant	100131827			AF226994		3p12.3	2013-01-08			ENSG00000227124	ENSG00000227124		"""Zinc fingers, C2H2-type"", ""-"""	29448	protein-coding gene	gene with protein product			"""zinc finger protein 838"""	ZNF838			Standard	NM_001128223		Approved	X17	uc011bgi.2	Q9BY31	OTTHUMG00000158965	ENST00000477374.1:c.134_135insA	3.37:g.75790810_75790811insT	ENSP00000417902:p.Thr45fs			Frame_Shift_Ins	INS	ENST00000477374.1	37																																																																																					0.510	ZNF717-005	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000352767.1		NM_001128223	
CDX2	1045	broad.mit.edu	37	13	28542693	28542693	+	Frame_Shift_Del	DEL	C	C	-			TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr13:28542693delC	ENST00000381020.7	-	1	2583	c.451delG	c.(451-453)gctfs	p.A153fs	CDX2_ENST00000548877.1_5'Flank	NM_001265.4	NP_001256.3	Q99626	CDX2_HUMAN	caudal type homeobox 2	153					anterior/posterior pattern specification (GO:0009952)|blood vessel development (GO:0001568)|endosome to lysosome transport (GO:0008333)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|labyrinthine layer development (GO:0060711)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ morphogenesis (GO:0009887)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription, DNA-templated (GO:0045893)|somatic stem cell maintenance (GO:0035019)|transcription from RNA polymerase II promoter (GO:0006366)|trophectodermal cell differentiation (GO:0001829)	condensed nuclear chromosome (GO:0000794)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			endometrium(2)|large_intestine(1)|lung(6)	9	all_cancers(110;0.191)|all_hematologic(3;0.0447)|Acute lymphoblastic leukemia(6;0.155)	Lung SC(185;0.0156)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	GBM - Glioblastoma multiforme(144;0.0407)|all cancers(112;0.0491)|OV - Ovarian serous cystadenocarcinoma(117;0.199)		TCGGCGGCAGCGGTGGCGGCG	0.736			T	ETV6	AML																																			Dom	yes		13	13q12.3	1045	caudal type homeo box transcription factor 2		L	0										66,3450		0,66,1692	8.0	12.0	10.0			4.7	0.0	13		10	77,6869		4,69,3400	no	frameshift	CDX2	NM_001265.3		4,135,5092	A1A1,A1R,RR		1.1086,1.8771,1.3669			28542693	143,10319	1852	3675	5527	SO:0001589	frameshift_variant	1045			Y13709	CCDS9328.1	13q12.2	2012-03-09	2007-07-09		ENSG00000165556	ENSG00000165556		"""Homeoboxes / ANTP class : HOXL subclass"""	1806	protein-coding gene	gene with protein product		600297	"""caudal type homeo box transcription factor 2"""	CDX3		7698771	Standard	NM_001265		Approved		uc001urv.4	Q99626	OTTHUMG00000016640	ENST00000381020.7:c.451delG	13.37:g.28542693delC	ENSP00000370408:p.Ala153fs		O00503|Q5VTU7|Q969L8|Q9UD92	Frame_Shift_Del	DEL	ENST00000381020.7	37	CCDS9328.1																																																																																				0.736	CDX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044312.5			
FAM86DP	692099	broad.mit.edu	37	3	75476735	75476735	+	RNA	SNP	C	C	T			TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr3:75476735C>T	ENST00000459803.1	-	0	621					NR_024241.1				family with sequence similarity 86, member D, pseudogene									p.E194E(3)									CTCGGAGCTGCTCGAGGACCC	0.602																																																	3	Substitution - coding silent(3)	kidney(2)|endometrium(1)																																										0			BC016686		3p12.3	2010-06-04	2010-06-04	2010-06-04	ENSG00000244026	ENSG00000244026			32659	pseudogene	pseudogene			"""family with sequence similarity 86, member D"""	FAM86D			Standard	NR_024241		Approved		uc003dpp.4		OTTHUMG00000158855		3.37:g.75476735C>T				Silent	SNP	ENST00000459803.1	37																																																																																					0.602	FAM86DP-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000352425.1		NR_024241	
KIAA1045	23349	broad.mit.edu	37	9	34971509	34971509	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr9:34971509A>G	ENST00000242315.3	+	2	296	c.214A>G	c.(214-216)Agt>Ggt	p.S72G	KIAA1045_ENST00000476115.2_Intron|KIAA1045_ENST00000544237.1_Missense_Mutation_p.S72G	NM_015297.1	NP_056112.1	Q9UPV7	K1045_HUMAN	KIAA1045	72							metal ion binding (GO:0046872)	p.S72G(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19			LUSC - Lung squamous cell carcinoma(32;0.00575)			CCAGGAAGAGAGTAGTGCCGG	0.642																																																	1	Substitution - Missense(1)	kidney(1)											64.0	77.0	72.0					9																	34971509		2028	4177	6205	SO:0001583	missense	23349			AB028968	CCDS43796.1	9p13.2	2008-02-05			ENSG00000122733	ENSG00000122733			29180	protein-coding gene	gene with protein product						10470851	Standard	NM_015297		Approved		uc003zvr.3	Q9UPV7	OTTHUMG00000019844	ENST00000242315.3:c.214A>G	9.37:g.34971509A>G	ENSP00000242315:p.Ser72Gly		B7Z253|Q58FE9|Q5T662	Missense_Mutation	SNP	ENST00000242315.3	37	CCDS43796.1	.	.	.	.	.	.	.	.	.	.	a	8.833	0.940340	0.18281	.	.	ENSG00000122733	ENST00000544237;ENST00000242315	.	.	.	5.8	4.68	0.58851	.	0.467701	0.25291	N	0.031727	T	0.14098	0.0341	N	0.02011	-0.69	0.23391	N	0.997775	B	0.06786	0.001	B	0.08055	0.003	T	0.13335	-1.0513	9	0.27785	T	0.31	-5.6363	9.455	0.38750	0.8641:0.0:0.1359:0.0	.	72	Q9UPV7	K1045_HUMAN	G	72	.	ENSP00000242315:S72G	S	+	1	0	KIAA1045	34961509	1.000000	0.71417	0.994000	0.49952	0.378000	0.30076	1.063000	0.30567	2.216000	0.71823	0.533000	0.62120	AGT		0.642	KIAA1045-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052256.2		XM_048592	
PTGER4P2	5736	broad.mit.edu	37	9	66499795	66499795	+	IGR	SNP	G	G	A	rs368767287		TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr9:66499795G>A								RP11-262H14.1 (30485 upstream) : RP11-262H14.7 (17410 downstream)																							TGCAAGTCGCGCAAGGAGCAG	0.592																																																	0																																										SO:0001628	intergenic_variant	0																															9.37:g.66499795G>A				Missense_Mutation	SNP		37																																																																																				0	0.592									
Unknown	0	broad.mit.edu	37	1	16974182	16974182	+	IGR	SNP	C	C	A	rs370176636	byFrequency	TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr1:16974182C>A								CROCCP2 (13128 upstream) : RNU1-3 (19097 downstream)																							GAGCATATCCCGTGGAGTACC	0.672													.|||	821	0.163938	0.2769	0.1297	5008	,	,		43125	0.1825		0.0924	False		,,,				2504	0.09																0																																										SO:0001628	intergenic_variant	11209																															1.37:g.16974182C>A				RNA	SNP		37																																																																																				0	0.672									
OR1I1	126370	broad.mit.edu	37	19	15198934	15198934	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr19:15198934A>G	ENST00000209540.2	+	1	1144	c.1058A>G	c.(1057-1059)gAc>gGc	p.D353G		NM_001004713.1	NP_001004713.1	O60431	OR1I1_HUMAN	olfactory receptor, family 1, subfamily I, member 1	353						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.D353G(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(3)|ovary(2)|stomach(2)	20						gggaacagagacatggaataa	0.458																																																	1	Substitution - Missense(1)	kidney(1)											35.0	26.0	29.0					19																	15198934		2194	4267	6461	SO:0001583	missense	126370			AC004794	CCDS32937.1	19p13.1	2012-08-09				ENSG00000094661		"""GPCR / Class A : Olfactory receptors"""	8207	protein-coding gene	gene with protein product							Standard	NM_001004713		Approved	OR1I1P, OR19-20, OR1I1Q	uc010xoe.2	O60431		ENST00000209540.2:c.1058A>G	19.37:g.15198934A>G	ENSP00000209540:p.Asp353Gly		Q96R92	Missense_Mutation	SNP	ENST00000209540.2	37	CCDS32937.1	.	.	.	.	.	.	.	.	.	.	A	12.32	1.901806	0.33535	.	.	ENSG00000094661	ENST00000209540	T	0.00631	6.09	2.46	-2.76	0.05896	.	.	.	.	.	T	0.00384	0.0012	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.47209	-0.9135	9	0.62326	D	0.03	.	0.3355	0.00325	0.3411:0.1992:0.2647:0.195	.	353	O60431	OR1I1_HUMAN	G	353	ENSP00000209540:D353G	ENSP00000209540:D353G	D	+	2	0	OR1I1	15059934	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.810000	0.04505	-0.827000	0.04278	-0.425000	0.05940	GAC		0.458	OR1I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465665.1			
PRB3	5544	broad.mit.edu	37	12	11420779	11420779	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr12:11420779G>A	ENST00000279573.7	-	3	539	c.404C>T	c.(403-405)cCg>cTg	p.P135L	PRB3_ENST00000381842.3_Missense_Mutation_p.P135L|PRB3_ENST00000440870.3_Intron|PRB3_ENST00000538488.1_Intron			Q04118	PRB3_HUMAN	proline-rich protein BstNI subfamily 3	135	10 X 21 AA tandem repeats of [RH]-P-G-K- P-[EQ]-G-[PQS]-P-[PS]-Q-[GE]-G-N-[QK]- [SP]-[QR]-[GR]-P-P-P.|Pro-rich.				defense response to Gram-negative bacterium (GO:0050829)	extracellular region (GO:0005576)		p.P135L(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(1)|lung(13)|ovary(1)|skin(5)	25			OV - Ovarian serous cystadenocarcinoma(49;0.201)			CGGACGAGGCGGGGGACCTTG	0.642																																																	1	Substitution - Missense(1)	kidney(1)											29.0	35.0	33.0					12																	11420779		1507	3449	4956	SO:0001583	missense	5544					12p13.2	2012-10-02				ENSG00000197870			9339	protein-coding gene	gene with protein product		168840				1894623	Standard	NM_006249		Approved	PRG	uc001qzs.3	Q04118		ENST00000279573.7:c.404C>T	12.37:g.11420779G>A	ENSP00000279573:p.Pro135Leu		Q15188|Q4VAY3|Q4VAY4|Q7M4M9|Q9UCT9	Missense_Mutation	SNP	ENST00000279573.7	37		.	.	.	.	.	.	.	.	.	.	.	7.301	0.613025	0.14066	.	.	ENSG00000197870	ENST00000381842	T	0.06371	3.31	0.707	0.707	0.18139	.	0.651352	0.10932	U	0.618237	T	0.13586	0.0329	.	.	.	0.09310	N	0.999993	D	0.89917	1.0	P	0.58873	0.847	T	0.18935	-1.0321	9	0.45353	T	0.12	.	7.3619	0.26752	0.0:0.0:1.0:0.0	.	135	Q04118	PRB3_HUMAN	L	135	ENSP00000371264:P135L	ENSP00000279573:P135L	P	-	2	0	PRB3	11312046	0.001000	0.12720	0.002000	0.10522	0.026000	0.11368	0.715000	0.25822	0.686000	0.31488	0.134000	0.15878	CCG		0.642	PRB3-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000402119.5		NM_006249	
SH3TC2	79628	broad.mit.edu	37	5	148334267	148334268	+	IGR	DEL	CT	CT	-	rs149492329		TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	CT	CT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr5:148334267_148334268delCT								ADRB2 (126071 upstream) : RP11-44B19.1 (15634 downstream)																							TCCTCATTACCTCTCTCTCTCT	0.48																																																	0																																										SO:0001628	intergenic_variant	79628																															5.37:g.148334277_148334278delCT				RNA	DEL		37																																																																																				0	0.480									
TNFSF14	8740	broad.mit.edu	37	19	6665221	6665221	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr19:6665221C>A	ENST00000599359.1	-	5	820	c.439G>T	c.(439-441)Gtg>Ttg	p.V147L	TNFSF14_ENST00000326176.9_Missense_Mutation_p.V111L|TNFSF14_ENST00000245912.3_Missense_Mutation_p.V111L			O43557	TNF14_HUMAN	tumor necrosis factor (ligand) superfamily, member 14	147					apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|immune response (GO:0006955)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of T cell chemotaxis (GO:0010820)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|signal transduction (GO:0007165)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)|T cell homeostasis (GO:0043029)|T cell proliferation (GO:0042098)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|receptor binding (GO:0005102)	p.V147L(1)		breast(1)|kidney(2)|large_intestine(4)|liver(1)|lung(4)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	18						CCCAGCTGCACCTTGGAGTAG	0.647																																																	1	Substitution - Missense(1)	kidney(1)											49.0	41.0	44.0					19																	6665221		2203	4299	6502	SO:0001583	missense	8740			AF036581	CCDS12171.1, CCDS45939.1	19p13.3	2008-02-05				ENSG00000125735		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"""	11930	protein-coding gene	gene with protein product		604520				9462508	Standard	NM_172014		Approved	LIGHT, LTg, HVEM-L, CD258	uc002mfk.2	O43557		ENST00000599359.1:c.439G>T	19.37:g.6665221C>A	ENSP00000469049:p.Val147Leu		A8K7M2|C9J5H4|O75476|Q6FHA1|Q8WVF8|Q96LD2	Missense_Mutation	SNP	ENST00000599359.1	37	CCDS12171.1	.	.	.	.	.	.	.	.	.	.	C	13.67	2.307819	0.40795	.	.	ENSG00000125735	ENST00000245912;ENST00000326176	T	0.48201	0.82	4.96	3.92	0.45320	Tumour necrosis factor (3);Tumour necrosis factor-like (2);	0.177879	0.35436	N	0.003202	T	0.40979	0.1139	L	0.49699	1.58	0.28051	N	0.933353	P;P	0.40197	0.706;0.657	B;B	0.39840	0.311;0.073	T	0.35943	-0.9768	10	0.46703	T	0.11	-7.3133	8.807	0.34943	0.1541:0.5622:0.2837:0.0	.	147;111	O43557;O43557-2	TNF14_HUMAN;.	L	147;111	ENSP00000326940:V111L	ENSP00000245912:V147L	V	-	1	0	TNFSF14	6616221	0.999000	0.42202	0.998000	0.56505	0.629000	0.37895	1.066000	0.30604	1.085000	0.41206	-0.310000	0.09108	GTG		0.647	TNFSF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457863.1			
HERC2P9	440248	broad.mit.edu	37	15	28929443	28929443	+	RNA	SNP	C	C	T	rs692165	byFrequency	TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr15:28929443C>T	ENST00000528584.1	+	0	1980					NR_036443.1				hect domain and RLD 2 pseudogene 9																		TTTTGGGCTCCCTGGGTGGTC	0.532													c|||	834	0.166534	0.2413	0.1124	5008	,	,		12247	0.3988		0.005	False		,,,				2504	0.0307																0																																												0			BC047911		15q13.1	2011-05-24			ENSG00000206149	ENSG00000206149			30495	pseudogene	pseudogene							Standard	NR_036443		Approved	FLJ59185	uc010azc.3		OTTHUMG00000167114		15.37:g.28929443C>T				RNA	SNP	ENST00000528584.1	37																																																																																					0.532	HERC2P9-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000393268.1		NR_036443	
USP17L16P	100287302	broad.mit.edu	37	4	9241928	9241928	+	IGR	SNP	G	G	C			TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr4:9241928G>C								USP17L15 (4228 upstream) : USP17L17 (3676 downstream)																							ACCGCCGCTAGCATCACTTCT	0.488																																																	0																																										SO:0001628	intergenic_variant	0																															4.37:g.9241928G>C				Missense_Mutation	SNP		37																																																																																				0	0.488									
TXNIP	10628	broad.mit.edu	37	1	145440928	145440928	+	Missense_Mutation	SNP	C	C	G			TCGA-B0-4810-01A-01D-1501-10	TCGA-B0-4810-11A-02D-1501-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	PGM	.		Illumina GAIIx	e014eeeb-c48e-42bb-a683-93299087a3cf	0ca418e3-1de1-40b8-bd40-cb8f47bc0658	g.chr1:145440928C>G	ENST00000369317.4	+	7	1349	c.1015C>G	c.(1015-1017)Cct>Gct	p.P339A	TXNIP_ENST00000475171.1_Intron	NM_006472.3	NP_006463.3	Q9H3M7	TXNIP_HUMAN	thioredoxin interacting protein	339					cell cycle (GO:0007049)|cellular response to tumor cell (GO:0071228)|innate immune response (GO:0045087)|keratinocyte differentiation (GO:0030216)|negative regulation of cell division (GO:0051782)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|protein import into nucleus (GO:0006606)|regulation of cell proliferation (GO:0042127)|response to calcium ion (GO:0051592)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to glucose (GO:0009749)|response to hydrogen peroxide (GO:0042542)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial intermembrane space (GO:0005758)|nucleus (GO:0005634)	enzyme inhibitor activity (GO:0004857)|ubiquitin protein ligase binding (GO:0031625)	p.P339A(1)		breast(3)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(1)|lung(5)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	21	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					GGATGTCATTCCTGAAGATCA	0.458																																						.											1	Substitution - Missense(1)	kidney(1)											151.0	149.0	150.0					1																	145440928		2203	4300	6503	SO:0001583	missense	10628			S73591	CCDS72876.1	1q11	2008-07-18			ENSG00000117289	ENSG00000265972			16952	protein-coding gene	gene with protein product	"""upregulated by 1,25-dihydroxyvitamin D-3"", ""thioredoxin binding protein 2"""	606599				8086474	Standard	NM_006472		Approved	VDUP1, EST01027, HHCPA78, THIF	uc001enn.4	Q9H3M7	OTTHUMG00000013755	ENST00000369317.4:c.1015C>G	1.37:g.145440928C>G	ENSP00000358323:p.Pro339Ala		B4E3D3|Q16226|Q6PML0|Q9BXG9	Missense_Mutation	SNP	ENST00000369317.4	37	CCDS913.1	.	.	.	.	.	.	.	.	.	.	C	10.56	1.385769	0.25031	.	.	ENSG00000117289	ENST00000369317;ENST00000425134	T;T	0.11385	3.11;2.78	5.05	3.15	0.36227	Immunoglobulin E-set (1);	0.212263	0.31685	N	0.007222	T	0.02848	0.0085	L	0.29908	0.895	0.36460	D	0.866625	B;B	0.22983	0.078;0.077	B;B	0.21917	0.037;0.013	T	0.33471	-0.9867	10	0.15499	T	0.54	-35.7427	13.4662	0.61256	0.0:0.7009:0.2991:0.0	.	284;339	B4E3D3;Q9H3M7	.;TXNIP_HUMAN	A	339;284	ENSP00000358323:P339A;ENSP00000396322:P284A	ENSP00000358323:P339A	P	+	1	0	TXNIP	144152285	0.047000	0.20315	1.000000	0.80357	0.958000	0.62258	0.205000	0.17356	0.708000	0.31955	0.563000	0.77884	CCT		0.458	TXNIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038547.1		NM_006472	
