#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ELTD1	64123	hgsc.bcm.edu;broad.mit.edu	37	1	79402059	79402059	+	Silent	SNP	T	T	C			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr1:79402059T>C	ENST00000370742.3	-	7	861	c.798A>G	c.(796-798)aaA>aaG	p.K266K		NM_022159.3	NP_071442.2	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain containing 1	266					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(45)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	69				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)		GATGAATATGTTTCATGTTAT	0.259																																					p.K266K		.											.	ELTD1-24	0			c.A798G						.						61.0	63.0	62.0					1																	79402059		1789	4015	5804	SO:0001819	synonymous_variant	64123	exon7			AATATGTTTCATG	AF192403	CCDS41352.1	1p33-p32	2014-08-08			ENSG00000162618	ENSG00000162618		"""-"", ""GPCR / Class B : Orphans"""	20822	protein-coding gene	gene with protein product						11050079	Standard	NM_022159		Approved	ETL	uc001diq.4	Q9HBW9	OTTHUMG00000009738	ENST00000370742.3:c.798A>G	1.37:g.79402059T>C		95	0		164	23	NM_022159	0	0	3	3	0	B1AR71|Q5KU34	Silent	SNP	ENST00000370742.3	37	CCDS41352.1																																																																																			.		0.259	ELTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026859.1	NM_022159	
AMY2B	280	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	104122036	104122036	+	Missense_Mutation	SNP	G	G	A	rs143243690	byFrequency	TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr1:104122036G>A	ENST00000361355.4	+	12	2066	c.1450G>A	c.(1450-1452)Gtt>Att	p.V484I	AMY2B_ENST00000491397.1_3'UTR	NM_020978.3	NP_066188.1	P19961	AMY2B_HUMAN	amylase, alpha 2B (pancreatic)	484					carbohydrate metabolic process (GO:0005975)|digestion (GO:0007586)	extracellular vesicular exosome (GO:0070062)	alpha-amylase activity (GO:0004556)|metal ion binding (GO:0046872)			breast(1)|endometrium(7)|kidney(4)|large_intestine(1)|lung(30)|prostate(1)|skin(1)|urinary_tract(1)	46		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0669)|all cancers(265;0.083)|Epithelial(280;0.094)|Lung(183;0.112)		TAAAATCTACGTTTCTGACGA	0.323													.|||	2	0.000399361	0.0	0.0	5008	,	,		17291	0.0		0.001	False		,,,				2504	0.001				p.V484I		.											.	AMY2B-90	0			c.G1450A						.	G	ILE/VAL	0,4406		0,0,2203	227.0	235.0	232.0		1450	2.2	0.2	1	dbSNP_134	232	1,8599	1.2+/-3.3	0,1,4299	no	missense	AMY2B	NM_020978.3	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	484/512	104122036	1,13005	2203	4300	6503	SO:0001583	missense	280	exon12			ATCTACGTTTCTG	M24895	CCDS782.1	1p21	2010-08-02	2006-04-27		ENSG00000240038	ENSG00000240038	3.2.1.1		478	protein-coding gene	gene with protein product		104660	"""amylase, alpha 2B; pancreatic"""	AMY2		8268204	Standard	NM_020978		Approved		uc001duq.3	P19961	OTTHUMG00000011024	ENST00000361355.4:c.1450G>A	1.37:g.104122036G>A	ENSP00000354610:p.Val484Ile	735	1		1115	198	NM_020978	0	0	10	15	5	B3KTI1|B3KXB7|D3DT76|Q9UBH3	Missense_Mutation	SNP	ENST00000361355.4	37	CCDS782.1	.	.	.	.	.	.	.	.	.	.	G	8.662	0.900711	0.17686	0.0	1.16E-4	ENSG00000240038	ENST00000361355	T	0.78595	-1.19	4.14	2.25	0.28309	Alpha-amylase, C-terminal all beta (2);Glycosyl hydrolase, family 13, all-beta (1);	0.067775	0.64402	N	0.000017	T	0.74168	0.3681	H	0.95884	3.735	0.48040	D	0.999579	B	0.22346	0.068	B	0.20184	0.028	T	0.72577	-0.4251	10	0.56958	D	0.05	.	8.6944	0.34287	0.2605:0.0:0.7395:0.0	.	484	P19961	AMY2B_HUMAN	I	484	ENSP00000354610:V484I	ENSP00000354610:V484I	V	+	1	0	AMY2B	103923559	1.000000	0.71417	0.165000	0.22776	0.168000	0.22595	4.103000	0.57783	0.339000	0.23719	-0.224000	0.12420	GTT	G|1.000;A|0.000		0.323	AMY2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030318.1	NM_020978	
LRIG2	9860	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	113616063	113616063	+	Missense_Mutation	SNP	A	A	T			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr1:113616063A>T	ENST00000361127.5	+	1	233	c.35A>T	c.(34-36)cAg>cTg	p.Q12L	RP11-31F15.2_ENST00000421157.1_lincRNA	NM_014813.1	NP_055628.1	O94898	LRIG2_HUMAN	leucine-rich repeats and immunoglobulin-like domains 2	12					innervation (GO:0060384)|regulation of platelet-derived growth factor receptor signaling pathway (GO:0010640)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(10)|ovary(4)|prostate(2)|stomach(1)|urinary_tract(1)	31	Lung SC(450;0.246)	all_cancers(81;1.56e-05)|all_epithelial(167;2.62e-05)|all_lung(203;0.000665)|Lung NSC(69;0.000986)		Lung(183;0.0279)|Colorectal(144;0.0885)|COAD - Colon adenocarcinoma(174;0.134)|all cancers(265;0.139)|Epithelial(280;0.143)|LUSC - Lung squamous cell carcinoma(189;0.15)		CCGGAGGAGCAGTTGCTGGGG	0.642											OREG0013684	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q12L		.											.	LRIG2-229	0			c.A35T						.						109.0	125.0	120.0					1																	113616063		2203	4300	6503	SO:0001583	missense	9860	exon1			AGGAGCAGTTGCT	AB018349	CCDS30808.1	1p13.1	2013-01-11			ENSG00000198799	ENSG00000198799		"""Immunoglobulin superfamily / I-set domain containing"""	20889	protein-coding gene	gene with protein product		608869					Standard	XM_005271369		Approved	KIAA0806	uc001edf.1	O94898	OTTHUMG00000012133	ENST00000361127.5:c.35A>T	1.37:g.113616063A>T	ENSP00000355396:p.Gln12Leu	320	0	1451	352	123	NM_014813	0	0	0	0	0	Q9NSN2	Missense_Mutation	SNP	ENST00000361127.5	37	CCDS30808.1	.	.	.	.	.	.	.	.	.	.	A	9.612	1.131598	0.21041	.	.	ENSG00000198799	ENST00000361127	T	0.60920	0.15	4.86	-2.01	0.07410	.	0.866104	0.09769	N	0.758205	T	0.10637	0.0260	N	0.08118	0	0.21220	N	0.99976	B	0.02656	0.0	B	0.01281	0.0	T	0.18335	-1.0340	10	0.35671	T	0.21	.	0.3463	0.00342	0.1887:0.2563:0.2382:0.3168	.	12	O94898	LRIG2_HUMAN	L	12	ENSP00000355396:Q12L	ENSP00000355396:Q12L	Q	+	2	0	LRIG2	113417586	0.910000	0.30920	0.987000	0.45799	0.031000	0.12232	-0.515000	0.06290	-0.294000	0.08973	-0.290000	0.09829	CAG	.		0.642	LRIG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033549.2	NM_014813	
CERS2	29956	ucsc.edu	37	1	150940937	150940937	+	Silent	SNP	C	C	T			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr1:150940937C>T	ENST00000271688.6	-	3	611	c.225G>A	c.(223-225)cgG>cgA	p.R75R	RP11-316M1.12_ENST00000560481.1_RNA|RP11-316M1.12_ENST00000561111.1_RNA|CERS2_ENST00000345896.4_5'UTR|CERS2_ENST00000368954.5_Silent_p.R75R|CERS2_ENST00000561294.1_Silent_p.R75R	NM_181746.3	NP_859530.1	Q96G23	CERS2_HUMAN	ceramide synthase 2	75					ceramide biosynthetic process (GO:0046513)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear membrane (GO:0031965)	DNA binding (GO:0003677)|sphingosine N-acyltransferase activity (GO:0050291)										GTGCCCGCAGCCGAGTTTTCT	0.557																																					p.R75R													.	.	0			c.G225A						.						79.0	76.0	77.0					1																	150940937		2203	4300	6503	SO:0001819	synonymous_variant	29956	exon3			CCGCAGCCGAGTT	AF189062	CCDS973.1	1q21.3	2012-09-20	2011-07-08	2011-07-08	ENSG00000143418	ENSG00000143418		"""Homeoboxes / CERS class"""	14076	protein-coding gene	gene with protein product		606920	"""longevity assurance (LAG1, S. cerevisiae) homolog 2"", ""LAG1 longevity assurance homolog 2 (S. cerevisiae)"", ""LAG1 homolog, ceramide synthase 2"""	LASS2		11543633	Standard	NM_181746		Approved	SP260, FLJ10243	uc001evz.3	Q96G23	OTTHUMG00000035064	ENST00000271688.6:c.225G>A	1.37:g.150940937C>T		53	0		71	4	NM_022075	0	0	281	375	94	D3DV06|Q5SZE5|Q9HD96|Q9NW79	Silent	SNP	ENST00000271688.6	37	CCDS973.1																																																																																			.		0.557	CERS2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084897.2	NM_022075	
KIAA0907	22889	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	155899153	155899153	+	Missense_Mutation	SNP	C	C	G			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr1:155899153C>G	ENST00000368321.3	-	4	421	c.398G>C	c.(397-399)aGt>aCt	p.S133T	KIAA0907_ENST00000482337.1_5'UTR|KIAA0907_ENST00000368320.3_Missense_Mutation_p.S133T|KIAA0907_ENST00000368319.3_Missense_Mutation_p.S133T	NM_014949.2	NP_055764.2	Q7Z7F0	K0907_HUMAN	KIAA0907	133							RNA binding (GO:0003723)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|urinary_tract(1)	21	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		OV - Ovarian serous cystadenocarcinoma(3;8.82e-06)			TGCAGCCCCACTAAGTCGGCT	0.408																																					p.S133T		.											.	KIAA0907-90	0			c.G398C						.						126.0	119.0	122.0					1																	155899153		2203	4300	6503	SO:0001583	missense	22889	exon4			GCCCCACTAAGTC	BC062637	CCDS30885.1	1q22	2012-11-30			ENSG00000132680	ENSG00000132680			29145	protein-coding gene	gene with protein product						10048485	Standard	NM_014949		Approved	BLOM7	uc001fmi.1	Q7Z7F0	OTTHUMG00000014103	ENST00000368321.3:c.398G>C	1.37:g.155899153C>G	ENSP00000357304:p.Ser133Thr	88	0		139	52	NM_014949	0	0	22	49	27	O94981|Q7L7Q2|Q7Z7E9|Q8TBQ0	Missense_Mutation	SNP	ENST00000368321.3	37	CCDS30885.1	.	.	.	.	.	.	.	.	.	.	C	18.00	3.524402	0.64747	.	.	ENSG00000132680	ENST00000368321;ENST00000368320;ENST00000368319	T;T;T	0.34859	1.34;1.34;1.34	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.20129	0.0484	N	0.16790	0.44	0.80722	D	1	P;P;P;P;P;B	0.50819	0.873;0.939;0.873;0.884;0.682;0.336	P;P;B;P;B;B	0.52646	0.541;0.699;0.439;0.705;0.303;0.395	T	0.01720	-1.1288	10	0.08179	T	0.78	-11.4646	17.2104	0.86929	0.0:1.0:0.0:0.0	.	133;133;133;133;133;133	D3DVA4;Q7Z7F0-4;A8K1I7;Q7Z7F0-3;Q7Z7F0-2;Q7Z7F0	.;.;.;.;.;K0907_HUMAN	T	133	ENSP00000357304:S133T;ENSP00000357303:S133T;ENSP00000357302:S133T	ENSP00000357302:S133T	S	-	2	0	KIAA0907	154165777	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.105000	0.77031	2.831000	0.97527	0.650000	0.86243	AGT	.		0.408	KIAA0907-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039583.1	NM_014949	
USF1	7391	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	161011569	161011569	+	Missense_Mutation	SNP	T	T	C			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr1:161011569T>C	ENST00000368021.3	-	6	548	c.344A>G	c.(343-345)cAc>cGc	p.H115R	TSTD1_ENST00000368024.1_5'Flank|USF1_ENST00000368020.1_Missense_Mutation_p.H115R|F11R_ENST00000289779.3_5'Flank|TSTD1_ENST00000368023.3_5'Flank|TSTD1_ENST00000423014.2_5'Flank|USF1_ENST00000435396.1_Missense_Mutation_p.H56R|TSTD1_ENST00000318289.10_5'Flank|USF1_ENST00000368019.1_Missense_Mutation_p.H115R	NM_007122.3	NP_009053.1	P22415	USF1_HUMAN	upstream transcription factor 1	115					carbon catabolite regulation of transcription (GO:0045990)|cellular response to insulin stimulus (GO:0032869)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|late viral transcription (GO:0019086)|lipid homeostasis (GO:0055088)|negative regulation of fibrinolysis (GO:0051918)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter by glucose (GO:0000432)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter by glucose (GO:0000430)|response to hypoxia (GO:0001666)|response to UV (GO:0009411)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	bHLH transcription factor binding (GO:0043425)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|large_intestine(3)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	9	all_cancers(52;6.73e-18)|Breast(13;0.012)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00122)			GTAAGTATAGTGCGTCTCAGC	0.572											OREG0013936	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.H115R		.											.	USF1-516	0			c.A344G						.						95.0	87.0	90.0					1																	161011569		2203	4300	6503	SO:0001583	missense	7391	exon6			GTATAGTGCGTCT	BC035505	CCDS1214.1	1q22-q23	2013-05-21			ENSG00000158773	ENSG00000158773		"""Basic helix-loop-helix proteins"""	12593	protein-coding gene	gene with protein product		191523				8486371	Standard	NM_007122		Approved	UEF, MLTFI, bHLHb11	uc031pqv.1	P22415	OTTHUMG00000031472	ENST00000368021.3:c.344A>G	1.37:g.161011569T>C	ENSP00000357000:p.His115Arg	123	0	1813	141	13	NM_001276373	0	0	33	39	6	B2RBZ4|Q5SY46|Q7Z5Y1	Missense_Mutation	SNP	ENST00000368021.3	37	CCDS1214.1	.	.	.	.	.	.	.	.	.	.	T	5.051	0.195050	0.09599	.	.	ENSG00000158773	ENST00000368020;ENST00000368021;ENST00000435396;ENST00000368019;ENST00000534633	D;D;D;D	0.91740	-2.9;-2.9;-2.85;-2.89	5.23	5.23	0.72850	.	0.048337	0.85682	D	0.000000	T	0.72614	0.3482	N	0.19112	0.55	0.42447	D	0.992738	B	0.11235	0.004	B	0.09377	0.004	T	0.67480	-0.5660	10	0.02654	T	1	-18.6648	13.1223	0.59334	0.0:0.0:0.0:1.0	.	115	P22415	USF1_HUMAN	R	115;115;56;115;56	ENSP00000356999:H115R;ENSP00000357000:H115R;ENSP00000390109:H56R;ENSP00000356998:H115R	ENSP00000356998:H115R	H	-	2	0	USF1	159278193	0.992000	0.36948	0.993000	0.49108	0.996000	0.88848	1.041000	0.30291	2.194000	0.70268	0.533000	0.62120	CAC	.		0.572	USF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077050.1	NM_007122	
TMCC2	9911	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	1	205238546	205238546	+	Missense_Mutation	SNP	G	G	T			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr1:205238546G>T	ENST00000358024.3	+	3	1605	c.1216G>T	c.(1216-1218)Gtc>Ttc	p.V406F	TMCC2_ENST00000329800.7_Missense_Mutation_p.V166F|TMCC2_ENST00000545499.1_Missense_Mutation_p.V328F|TMCC2_ENST00000330675.7_Missense_Mutation_p.V181F|TMCC2_ENST00000495538.1_3'UTR	NM_014858.3	NP_055673.2	O75069	TMCC2_HUMAN	transmembrane and coiled-coil domain family 2	406						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(2)|lung(3)|pancreas(1)|skin(1)|urinary_tract(1)	20	Breast(84;0.0871)		BRCA - Breast invasive adenocarcinoma(75;0.117)			GGTGGAGGGCGTCAAGGGCAG	0.682																																					p.V406F		.											.	TMCC2-91	0			c.G1216T						.						32.0	35.0	34.0					1																	205238546		2202	4299	6501	SO:0001583	missense	9911	exon3			GAGGGCGTCAAGG	AB001596	CCDS30984.1, CCDS55676.1, CCDS73010.1	1q32.1	2008-02-05	2005-07-13		ENSG00000133069	ENSG00000133069		"""Transmembrane and coiled-coil domain containing"""	24239	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 2"""			9455484	Standard	NM_014858		Approved	HUCEP11, FLJ38497	uc021pia.1	O75069	OTTHUMG00000037195	ENST00000358024.3:c.1216G>T	1.37:g.205238546G>T	ENSP00000350718:p.Val406Phe	92	2		114	36	NM_014858	0	0	0	0	0	A2RRH3|B7Z1P7|Q6ZN09	Missense_Mutation	SNP	ENST00000358024.3	37	CCDS30984.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.035722	0.75617	.	.	ENSG00000133069	ENST00000358024;ENST00000545499;ENST00000367159;ENST00000330675;ENST00000329800	T;T;T;T;T	0.54071	0.59;0.59;0.59;0.59;0.59	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.75148	0.3810	M	0.79475	2.455	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.998	D;D;D;D	0.97110	1.0;1.0;1.0;0.974	T	0.75841	-0.3175	10	0.59425	D	0.04	.	19.6803	0.95960	0.0:0.0:1.0:0.0	.	202;166;181;406	Q8IW47;G5E963;B2RAX5;O75069	.;.;.;TMCC2_HUMAN	F	406;328;210;181;166	ENSP00000350718:V406F;ENSP00000437943:V328F;ENSP00000356127:V210F;ENSP00000331842:V181F;ENSP00000329436:V166F	ENSP00000329436:V166F	V	+	1	0	TMCC2	203505169	1.000000	0.71417	0.998000	0.56505	0.361000	0.29550	8.004000	0.88535	2.756000	0.94617	0.561000	0.74099	GTC	.		0.682	TMCC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000090383.1	NM_014858	
PYROXD2	84795	broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	100167696	100167696	+	Missense_Mutation	SNP	A	A	G			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr10:100167696A>G	ENST00000370575.4	-	3	254	c.206T>C	c.(205-207)aTc>aCc	p.I69T	PYROXD2_ENST00000483923.1_5'UTR	NM_032709.2	NP_116098.2	Q8N2H3	PYRD2_HUMAN	pyridine nucleotide-disulphide oxidoreductase domain 2	69							oxidoreductase activity (GO:0016491)			central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	12						TGCACCCCCGATCACATGGCG	0.627																																					p.I69T													.	PYROXD2-90	0			c.T206C						.						77.0	56.0	63.0					10																	100167696		2203	4300	6503	SO:0001583	missense	84795	exon3			CCCCCGATCACAT	AK074429	CCDS7474.1	10q24.2	2009-04-22	2009-04-22	2009-04-22	ENSG00000119943	ENSG00000119943			23517	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 33"""	C10orf33			Standard	NM_032709		Approved	FLJ23849	uc001kpc.3	Q8N2H3	OTTHUMG00000018877	ENST00000370575.4:c.206T>C	10.37:g.100167696A>G	ENSP00000359607:p.Ile69Thr	17	0		17	4	NM_032709	0	0	6	7	1	D3DR61|Q5TAA9|Q9BRQ1	Missense_Mutation	SNP	ENST00000370575.4	37	CCDS7474.1	.	.	.	.	.	.	.	.	.	.	A	14.52	2.558944	0.45590	.	.	ENSG00000119943	ENST00000370575	D	0.82433	-1.61	5.18	4.04	0.47022	.	0.244484	0.41938	N	0.000785	T	0.78438	0.4283	L	0.55103	1.725	0.47905	D	0.999546	B	0.09022	0.002	B	0.17979	0.02	T	0.72243	-0.4350	10	0.42905	T	0.14	-17.704	10.6458	0.45619	0.9233:0.0:0.0767:0.0	.	69	Q8N2H3	PYRD2_HUMAN	T	69	ENSP00000359607:I69T	ENSP00000359607:I69T	I	-	2	0	PYROXD2	100157686	1.000000	0.71417	0.955000	0.39395	0.932000	0.56968	7.281000	0.78621	0.816000	0.34421	0.460000	0.39030	ATC	.		0.627	PYROXD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049782.2	NM_032709	
COL17A1	1308	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	105793764	105793764	+	Silent	SNP	A	A	G			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr10:105793764A>G	ENST00000353479.5	-	52	4385	c.4095T>C	c.(4093-4095)gcT>gcC	p.A1365A	COL17A1_ENST00000369733.3_Silent_p.A1283A	NM_000494.3	NP_000485.3	Q9UMD9	COHA1_HUMAN	collagen, type XVII, alpha 1	1365	Triple-helical region.				cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|hemidesmosome (GO:0030056)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				NS(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|liver(1)|lung(22)|ovary(5)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	62		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		CAGCAAAGTCAGCTCCCAATA	0.587																																					p.A1365A		.											.	COL17A1-95	0			c.T4095C						.						109.0	106.0	107.0					10																	105793764		2203	4300	6503	SO:0001819	synonymous_variant	1308	exon52			AAAGTCAGCTCCC	M91669	CCDS7554.1	10q24.3	2013-01-16			ENSG00000065618	ENSG00000065618		"""Collagens"""	2194	protein-coding gene	gene with protein product		113811		BPAG2		7916703	Standard	NM_000494		Approved	BP180	uc001kxr.3	Q9UMD9	OTTHUMG00000018998	ENST00000353479.5:c.4095T>C	10.37:g.105793764A>G		122	0		140	42	NM_000494	0	0	0	1	1	Q02802|Q5JV36|Q99018|Q9NQK9|Q9UC14	Silent	SNP	ENST00000353479.5	37	CCDS7554.1																																																																																			.		0.587	COL17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050181.1	NM_130778, NM_000494	
PTPRE	5791	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	129859261	129859261	+	Silent	SNP	C	C	A			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr10:129859261C>A	ENST00000254667.3	+	8	849	c.570C>A	c.(568-570)atC>atA	p.I190I	PTPRE_ENST00000430713.2_3'UTR|PTPRE_ENST00000306042.5_Silent_p.I132I|PTPRE_ENST00000419012.2_Silent_p.I190I	NM_006504.4	NP_006495.1	P23469	PTPRE_HUMAN	protein tyrosine phosphatase, receptor type, E	190	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				negative regulation of insulin receptor signaling pathway (GO:0046627)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of mast cell activation (GO:0033003)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	22		all_epithelial(44;1.66e-05)|all_lung(145;0.00456)|Lung NSC(174;0.0066)|all_neural(114;0.0936)|Colorectal(57;0.141)|Breast(234;0.166)|Melanoma(40;0.203)			Alendronate(DB00630)	CAGACTACATCAATGCTTCCT	0.483																																					p.I190I	Colon(52;977 1184 20575 41685)	.											.	PTPRE-227	0			c.C570A						.						175.0	160.0	165.0					10																	129859261		2203	4300	6503	SO:0001819	synonymous_variant	5791	exon8			CTACATCAATGCT	AF406557	CCDS7657.1, CCDS7658.1	10q26	2011-06-09			ENSG00000132334	ENSG00000132334		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9669	protein-coding gene	gene with protein product		600926				8595895	Standard	NM_130435		Approved	PTPE	uc001lkb.3	P23469	OTTHUMG00000019254	ENST00000254667.3:c.570C>A	10.37:g.129859261C>A		87	0		109	38	NM_006504	0	0	4	8	4	Q13345|Q5VWH3|Q5VWH4|Q96KQ6	Silent	SNP	ENST00000254667.3	37	CCDS7657.1																																																																																			.		0.483	PTPRE-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050990.1		
PAOX	196743	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	135193909	135193909	+	Silent	SNP	C	C	T			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr10:135193909C>T	ENST00000278060.5	+	2	671	c.588C>T	c.(586-588)ggC>ggT	p.G196G	PAOX_ENST00000357296.3_Silent_p.G196G|AL360181.1_ENST00000597657.1_5'Flank|PAOX_ENST00000480071.2_Silent_p.G196G|PAOX_ENST00000368539.4_Intron|PAOX_ENST00000368535.2_3'UTR	NM_152911.2	NP_690875.1	Q6QHF9	PAOX_HUMAN	polyamine oxidase (exo-N4-amino)	334					cellular nitrogen compound metabolic process (GO:0034641)|oxidation-reduction process (GO:0055114)|polyamine biosynthetic process (GO:0006596)|polyamine catabolic process (GO:0006598)|polyamine metabolic process (GO:0006595)|positive regulation of spermidine biosynthetic process (GO:1901307)|putrescine biosynthetic process (GO:0009446)|putrescine catabolic process (GO:0009447)|small molecule metabolic process (GO:0044281)|spermidine catabolic process (GO:0046203)|spermine catabolic process (GO:0046208)|xenobiotic metabolic process (GO:0006805)	peroxisomal matrix (GO:0005782)	N(1),N(12)-diacetylspermine:oxygen oxidoreductase (3-acetamidopropanal-forming) activity (GO:0052899)|N1-acetylspermidine:oxygen oxidoreductase (3-acetamidopropanal-forming) activity (GO:0052904)|N1-acetylspermine:oxygen oxidoreductase (3-acetamidopropanal-forming) activity (GO:0052903)|polyamine oxidase activity (GO:0046592)|receptor binding (GO:0005102)|spermidine:oxygen oxidoreductase (3-aminopropanal-forming) activity (GO:0052902)|spermine:oxygen oxidoreductase (spermidine-forming) activity (GO:0052901)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(13)|ovary(1)|urinary_tract(2)	23		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		all cancers(32;4.39e-07)|OV - Ovarian serous cystadenocarcinoma(35;1.21e-06)|Epithelial(32;1.94e-06)		GTGTGAGCGGCACCCACAGCA	0.622																																					p.G196G		.											.	PAOX-131	0			c.C588T						.						33.0	36.0	35.0					10																	135193909		2202	4299	6501	SO:0001819	synonymous_variant	196743	exon2			GAGCGGCACCCAC	BC032778	CCDS7682.1, CCDS7683.1, CCDS7684.1	10q26.3	2003-11-13			ENSG00000148832	ENSG00000148832			20837	protein-coding gene	gene with protein product		615853				12660232	Standard	NM_207127		Approved	PAO	uc001lmv.3	Q6QHF9	OTTHUMG00000019318	ENST00000278060.5:c.588C>T	10.37:g.135193909C>T		73	0		83	7	NM_207128	0	0	12	13	1	D3DXI6|Q5VWY0|Q6QHF5|Q6QHF6|Q6QHF7|Q6QHF8|Q6QHG0|Q6QHG1|Q6QHG2|Q6QHG3|Q6QHG4|Q6QHG5|Q6QHG6|Q86WP9|Q8N555|Q8NCX3	Silent	SNP	ENST00000278060.5	37	CCDS7683.1																																																																																			.		0.622	PAOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051146.2	NM_152911	
HPX	3263	ucsc.edu;bcgsc.ca	37	11	6453151	6453151	+	Missense_Mutation	SNP	G	G	C			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr11:6453151G>C	ENST00000265983.3	-	8	1032	c.932C>G	c.(931-933)gCc>gGc	p.A311G		NM_000613.2	NP_000604.1	P02790	HEMO_HUMAN	hemopexin	311					cellular iron ion homeostasis (GO:0006879)|heme metabolic process (GO:0042168)|heme transport (GO:0015886)|hemoglobin metabolic process (GO:0020027)|positive regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002925)|positive regulation of immunoglobulin production (GO:0002639)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|viral process (GO:0016032)	blood microparticle (GO:0072562)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heme transporter activity (GO:0015232)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(2)|lung(11)|prostate(1)	15		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;5.46e-08)|BRCA - Breast invasive adenocarcinoma(625;0.19)		CCAGGAAAAGGCAGCATCCAC	0.542																																					p.A311G													.	HPX-90	0			c.C932G						.						138.0	142.0	140.0					11																	6453151		2201	4296	6497	SO:0001583	missense	3263	exon8			GAAAAGGCAGCAT	J03048	CCDS7763.1	11p15.5-p15.4	2012-10-02			ENSG00000110169	ENSG00000110169			5171	protein-coding gene	gene with protein product		142290				2989777, 2842511	Standard	NM_000613		Approved		uc001mdg.2	P02790	OTTHUMG00000133399	ENST00000265983.3:c.932C>G	11.37:g.6453151G>C	ENSP00000265983:p.Ala311Gly	224	6		295	100	NM_000613	0	0	0	0	0	B2R957	Missense_Mutation	SNP	ENST00000265983.3	37	CCDS7763.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.375067	0.82682	.	.	ENSG00000110169	ENST00000265983	T	0.06687	3.27	5.72	5.72	0.89469	Hemopexin/matrixin, conserved site (1);Hemopexin/matrixin (2);	0.047287	0.85682	D	0.000000	T	0.27454	0.0674	M	0.64404	1.975	0.54753	D	0.99998	D	0.76494	0.999	D	0.70487	0.969	T	0.00113	-1.2042	10	0.87932	D	0	-20.1039	17.3732	0.87384	0.0:0.0:1.0:0.0	.	311	P02790	HEMO_HUMAN	G	311	ENSP00000265983:A311G	ENSP00000265983:A311G	A	-	2	0	HPX	6409727	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.858000	0.62947	2.715000	0.92844	0.561000	0.74099	GCC	.		0.542	HPX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257256.1	NM_000613	
GYS2	2998	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	21757442	21757442	+	Missense_Mutation	SNP	G	G	T			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr12:21757442G>T	ENST00000261195.2	-	1	339	c.85C>A	c.(85-87)Ctg>Atg	p.L29M		NM_021957.3	NP_068776.2	P54840	GYS2_HUMAN	glycogen synthase 2 (liver)	29					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)	cell cortex (GO:0005938)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|ectoplasm (GO:0043265)	glycogen (starch) synthase activity (GO:0004373)|glycogen synthase activity, transferring glucose-1-phosphate (GO:0061547)|protein homodimerization activity (GO:0042803)			NS(1)|breast(2)|endometrium(5)|kidney(1)|large_intestine(14)|lung(14)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						TCAAAGAGCAGTAACTCCTCC	0.493																																					p.L29M	Colon(149;9 1820 3690 10544 50424)	.											.	GYS2-523	0			c.C85A						.						117.0	114.0	115.0					12																	21757442		2203	4299	6502	SO:0001583	missense	2998	exon1			AGAGCAGTAACTC		CCDS8690.1	12p12.2-p11.2	2013-02-22			ENSG00000111713	ENSG00000111713	2.4.1.11	"""Glycosyltransferase group 1 domain containing"""	4707	protein-coding gene	gene with protein product		138571					Standard	NM_021957		Approved		uc001rfb.3	P54840	OTTHUMG00000169135	ENST00000261195.2:c.85C>A	12.37:g.21757442G>T	ENSP00000261195:p.Leu29Met	207	0		346	175	NM_021957	0	0	0	0	0	A0AVD8	Missense_Mutation	SNP	ENST00000261195.2	37	CCDS8690.1	.	.	.	.	.	.	.	.	.	.	G	15.54	2.864428	0.51482	.	.	ENSG00000111713	ENST00000261195	T	0.66638	-0.22	5.28	2.44	0.29823	.	0.076400	0.53938	D	0.000050	T	0.52964	0.1767	N	0.19112	0.55	0.34049	D	0.655926	P	0.52577	0.954	P	0.48166	0.569	T	0.61584	-0.7033	10	0.46703	T	0.11	-15.2558	7.1986	0.25868	0.35:0.0:0.65:0.0	.	29	P54840	GYS2_HUMAN	M	29	ENSP00000261195:L29M	ENSP00000261195:L29M	L	-	1	2	GYS2	21648709	0.646000	0.27295	0.229000	0.23960	0.989000	0.77384	0.796000	0.26986	0.361000	0.24292	0.655000	0.94253	CTG	.		0.493	GYS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402396.1	NM_021957	
ALG10	84920	ucsc.edu	37	12	34179835	34179835	+	Silent	SNP	A	A	G			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	A	A	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr12:34179835A>G	ENST00000266483.2	+	3	1726	c.1407A>G	c.(1405-1407)caA>caG	p.Q469Q	ALG10_ENST00000538927.1_Intron|AC046130.1_ENST00000401300.2_RNA|RP11-847H18.2_ENST00000501954.2_RNA	NM_032834.3	NP_116223.3	Q5BKT4	AG10A_HUMAN	ALG10, alpha-1,2-glucosyltransferase	469					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	transferase activity, transferring hexosyl groups (GO:0016758)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	26	Lung NSC(5;3.82e-05)|Acute lymphoblastic leukemia(23;0.0142)|all_hematologic(23;0.0429)	Lung NSC(34;0.204)|all_lung(34;0.235)				AGGACATTCAAAGGTTTATGT	0.338																																					p.Q469Q													.	ALG10-91	0			c.A1407G						.						120.0	125.0	123.0					12																	34179835		2203	4295	6498	SO:0001819	synonymous_variant	84920	exon3			CATTCAAAGGTTT	AJ312278	CCDS41769.1	12p11.21	2013-03-04	2013-03-04		ENSG00000139133	ENSG00000139133	2.4.1.256		23162	protein-coding gene	gene with protein product	"""derepression of ITR1 expression 2 homolog (S. cerevisiae)"", ""dolichyl-P-Glc:Glc(2)Man(9)GlcNAc(2)-PP-dolichol alpha-1,2- glucosyltransferase"""	603313	"""asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog (yeast)"", ""asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog (S. pombe)"""				Standard	NM_032834		Approved	FLJ14751, DIE2, ALG10A	uc001rlm.3	Q5BKT4	OTTHUMG00000169285	ENST00000266483.2:c.1407A>G	12.37:g.34179835A>G		248	0		506	2	NM_032834	0	0	10	14	4	Q6NS98|Q96DU0|Q96SM6	Silent	SNP	ENST00000266483.2	37	CCDS41769.1																																																																																			.		0.338	ALG10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403309.1	NM_032834	
METTL21B	25895	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	58177005	58177005	+	IGR	SNP	C	C	T			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr12:58177005C>T	ENST00000300209.8	+	0	2563				TSFM_ENST00000543727.1_Missense_Mutation_p.T57I|TSFM_ENST00000540550.1_Missense_Mutation_p.T57I|TSFM_ENST00000550559.1_Missense_Mutation_p.T57I|TSFM_ENST00000454289.3_Missense_Mutation_p.T57I|TSFM_ENST00000497617.1_3'UTR|TSFM_ENST00000350762.5_5'UTR|TSFM_ENST00000323833.8_Missense_Mutation_p.T57I|RP11-571M6.15_ENST00000553083.1_3'UTR|RP11-571M6.15_ENST00000471530.1_Nonsense_Mutation_p.Q72*|TSFM_ENST00000548851.1_Missense_Mutation_p.T57I	NM_015433.2	NP_056248.2	Q96AZ1	MT21B_HUMAN	methyltransferase like 21B							cytoplasm (GO:0005737)|intracellular (GO:0005622)	methyltransferase activity (GO:0008168)			endometrium(1)|lung(1)	2						CGGCGGAAAACAGGCTACTCC	0.582											OREG0021954	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T57I		.											.	TSFM-492	0			c.C170T						.						100.0	110.0	107.0					12																	58177005		2203	4300	6503	SO:0001628	intergenic_variant	10102	exon2			GGAAAACAGGCTA	AL050100, AF455816	CCDS8957.1, CCDS31848.1	12q14.1	2011-03-03	2011-03-03	2011-03-03	ENSG00000123427	ENSG00000123427			24936	protein-coding gene	gene with protein product		615258	"""family with sequence similarity 119, member B"""	FAM119B		12477932	Standard	NM_015433		Approved	DKFZP586D0919	uc001sqg.3	Q96AZ1	OTTHUMG00000170459		12.37:g.58177005C>T		215	0	1028	337	96	NM_005726	0	0	26	28	2	Q9H749|Q9Y3W2	Missense_Mutation	SNP	ENST00000300209.8	37	CCDS8957.1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.599184	0.87055	.	.	ENSG00000123297	ENST00000454289;ENST00000543727;ENST00000540550;ENST00000323833;ENST00000550559;ENST00000548851;ENST00000434359;ENST00000457189	.	.	.	5.29	5.29	0.74685	Translation elongation factor Ts, conserved site (1);Ubiquitin-associated/translation elongation factor EF1B, N-terminal (1);UBA-like (1);	0.000000	0.85682	D	0.000000	D	0.89784	0.6815	H	0.97103	3.94	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	D	0.92805	0.6259	9	0.87932	D	0	.	17.8551	0.88760	0.0:1.0:0.0:0.0	.	57;57;57	B4E391;P43897;P43897-2	.;EFTS_HUMAN;.	I	57;57;57;57;57;57;7;7	.	ENSP00000313877:T57I	T	+	2	0	TSFM	56463272	1.000000	0.71417	0.991000	0.47740	0.509000	0.34042	6.612000	0.74187	2.753000	0.94483	0.462000	0.41574	ACA	.		0.582	METTL21B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409268.1	NM_015433	
CCDC63	160762	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	111321841	111321841	+	Missense_Mutation	SNP	G	G	C			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr12:111321841G>C	ENST00000308208.5	+	8	1103	c.861G>C	c.(859-861)aaG>aaC	p.K287N	CCDC63_ENST00000545036.1_Missense_Mutation_p.K247N|CCDC63_ENST00000552694.1_Missense_Mutation_p.K208N	NM_152591.1	NP_689804.1	Q8NA47	CCD63_HUMAN	coiled-coil domain containing 63	287										NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(15)|ovary(1)|pancreas(1)|prostate(2)|skin(7)|urinary_tract(1)	39						TAGCTCTCAAGGCAAAGAAGC	0.502																																					p.K287N		.											.	CCDC63-134	0			c.G861C						.						129.0	129.0	129.0					12																	111321841		2203	4300	6503	SO:0001583	missense	160762	exon8			TCTCAAGGCAAAG	AK093162	CCDS9151.1, CCDS66470.1, CCDS73528.1	12q24.11	2013-02-19				ENSG00000173093			26669	protein-coding gene	gene with protein product	"""outer row dynein assembly 5 homolog (Chlamydomonas)"""						Standard	NM_001286243		Approved	ODA5, FLJ35843	uc001trv.1	Q8NA47	OTTHUMG00000169534	ENST00000308208.5:c.861G>C	12.37:g.111321841G>C	ENSP00000312399:p.Lys287Asn	170	0		296	144	NM_152591	0	0	0	0	0	B4DY03|Q0P603|Q6P2E1	Missense_Mutation	SNP	ENST00000308208.5	37	CCDS9151.1	.	.	.	.	.	.	.	.	.	.	G	13.24	2.177145	0.38413	.	.	ENSG00000173093	ENST00000545036;ENST00000308208;ENST00000552694	T;T;T	0.21734	1.99;1.99;1.99	5.68	4.78	0.61160	.	0.332758	0.32357	N	0.006214	T	0.45836	0.1362	M	0.83012	2.62	0.33081	D	0.536687	D	0.71674	0.998	D	0.66351	0.943	T	0.64296	-0.6441	10	0.66056	D	0.02	.	10.8325	0.46669	0.089:0.0:0.911:0.0	.	287	Q8NA47	CCD63_HUMAN	N	247;287;208	ENSP00000445881:K247N;ENSP00000312399:K287N;ENSP00000450217:K208N	ENSP00000312399:K287N	K	+	3	2	CCDC63	109806224	0.905000	0.30787	0.841000	0.33234	0.034000	0.12701	1.260000	0.32968	1.383000	0.46405	0.655000	0.94253	AAG	.		0.502	CCDC63-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000404673.2	NM_152591	
KDM2B	84678	broad.mit.edu	37	12	121880611	121880611	+	Missense_Mutation	SNP	C	C	T			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr12:121880611C>T	ENST00000377071.4	-	19	2705	c.2633G>A	c.(2632-2634)cGc>cAc	p.R878H	KDM2B_ENST00000377069.4_Missense_Mutation_p.R809H|KDM2B_ENST00000536437.1_Intron|KDM2B_ENST00000542973.1_Missense_Mutation_p.R246H	NM_032590.4	NP_115979.3	Q8NHM5	KDM2B_HUMAN	lysine (K)-specific demethylase 2B	878					embryonic camera-type eye morphogenesis (GO:0048596)|forebrain development (GO:0030900)|fourth ventricle development (GO:0021592)|hindbrain development (GO:0030902)|histone demethylation (GO:0016577)|histone H2A monoubiquitination (GO:0035518)|initiation of neural tube closure (GO:0021993)|lateral ventricle development (GO:0021670)|midbrain development (GO:0030901)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|spermatogenesis (GO:0007283)|third ventricle development (GO:0021678)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-K36 specific) (GO:0051864)|rRNA binding (GO:0019843)|zinc ion binding (GO:0008270)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	19						CAGCGCCATGCGGTCCTCGGC	0.731																																					p.R878H													.	KDM2B-638	0			c.G2633A						.						8.0	10.0	9.0					12																	121880611		1880	4090	5970	SO:0001583	missense	84678	exon19			GCCATGCGGTCCT	AJ459424	CCDS41849.1, CCDS41850.1	12q24.31	2014-02-18	2009-04-06	2009-04-06	ENSG00000089094	ENSG00000089094		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13610	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1B"""	609078	"""F-box and leucine-rich repeat protein 10"""	FBXL10		10799292	Standard	NM_032590		Approved	PCCX2, CXXC2, Fbl10, JHDM1B	uc001uat.3	Q8NHM5	OTTHUMG00000169071	ENST00000377071.4:c.2633G>A	12.37:g.121880611C>T	ENSP00000366271:p.Arg878His	19	0		37	3	NM_032590	0	0	21	21	0	A8MRS1|Q8NCI2|Q96HC7|Q96SL0|Q96T03|Q9NS96|Q9UF75	Missense_Mutation	SNP	ENST00000377071.4	37	CCDS41850.1	.	.	.	.	.	.	.	.	.	.	C	32	5.183689	0.94885	.	.	ENSG00000089094	ENST00000397480;ENST00000542973;ENST00000377069;ENST00000377071;ENST00000540043;ENST00000261824	T;T;T	0.25579	2.14;2.49;1.79	5.73	5.73	0.89815	.	0.272823	0.26556	N	0.023710	T	0.39545	0.1082	L	0.53249	1.67	0.80722	D	1	D;D;D;D	0.67145	0.996;0.996;0.991;0.996	P;P;P;P	0.51806	0.586;0.68;0.511;0.68	T	0.03739	-1.1008	10	0.41790	T	0.15	-19.7174	19.8984	0.96975	0.0:1.0:0.0:0.0	.	318;878;809;321	B7ZB05;Q8NHM5;A8MRS1;B4DSN4	.;KDM2B_HUMAN;.;.	H	866;246;809;878;321;881	ENSP00000437821:R246H;ENSP00000366269:R809H;ENSP00000366271:R878H	ENSP00000261824:R881H	R	-	2	0	KDM2B	120364994	0.998000	0.40836	0.671000	0.29857	0.953000	0.61014	4.082000	0.57635	2.713000	0.92767	0.655000	0.94253	CGC	.		0.731	KDM2B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402132.2	NM_032590	
KNTC1	9735	hgsc.bcm.edu	37	12	123073262	123073262	+	Missense_Mutation	SNP	T	T	C			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr12:123073262T>C	ENST00000333479.7	+	40	4075	c.3898T>C	c.(3898-3900)Ttt>Ctt	p.F1300L	KNTC1_ENST00000450485.2_Intron	NM_014708.4	NP_055523.1	P50748	KNTC1_HUMAN	kinetochore associated 1	1300					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|protein complex assembly (GO:0006461)|regulation of exit from mitosis (GO:0007096)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)				breast(1)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(8)|large_intestine(12)|lung(20)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	72	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		CTAAAAGTTATTTGGAGAGAC	0.269																																					p.F1300L		.											.	KNTC1-543	0			c.T3898C						.						23.0	22.0	22.0					12																	123073262		1781	4037	5818	SO:0001583	missense	9735	exon40			AAGTTATTTGGAG		CCDS45002.1	12q24.31	2013-01-17			ENSG00000184445	ENSG00000184445			17255	protein-coding gene	gene with protein product	"""rough deal homolog (Drosophila)"""	607363				11146660, 11590237	Standard	NM_014708		Approved	KIAA0166, ROD	uc001ucv.3	P50748	OTTHUMG00000168861	ENST00000333479.7:c.3898T>C	12.37:g.123073262T>C	ENSP00000328236:p.Phe1300Leu	3	0		7	4	NM_014708	0	0	0	0	0	A7E2C4|B3KSG2	Missense_Mutation	SNP	ENST00000333479.7	37	CCDS45002.1	.	.	.	.	.	.	.	.	.	.	T	11.48	1.650570	0.29336	.	.	ENSG00000184445	ENST00000333479	T	0.13196	2.61	5.55	3.18	0.36537	.	0.329620	0.32719	N	0.005728	T	0.06781	0.0173	N	0.19112	0.55	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.32107	-0.9919	10	0.12430	T	0.62	-6.5911	4.9227	0.13878	0.0:0.1133:0.1847:0.7019	.	1300	P50748	KNTC1_HUMAN	L	1300	ENSP00000328236:F1300L	ENSP00000328236:F1300L	F	+	1	0	KNTC1	121639215	1.000000	0.71417	0.861000	0.33841	0.748000	0.42578	1.230000	0.32612	0.386000	0.24997	0.383000	0.25322	TTT	.		0.269	KNTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396110.2		
POSTN	10631	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	38154716	38154716	+	Missense_Mutation	SNP	T	T	G			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr13:38154716T>G	ENST00000379747.4	-	11	1628	c.1511A>C	c.(1510-1512)aAa>aCa	p.K504T	POSTN_ENST00000379742.4_Missense_Mutation_p.K504T|POSTN_ENST00000379749.4_Missense_Mutation_p.K504T|POSTN_ENST00000379743.4_Missense_Mutation_p.K504T|POSTN_ENST00000541179.1_Missense_Mutation_p.K504T|POSTN_ENST00000541481.1_Missense_Mutation_p.K504T	NM_006475.2	NP_006466.2	Q15063	POSTN_HUMAN	periostin, osteoblast specific factor	504	FAS1 4. {ECO:0000255|PROSITE- ProRule:PRU00082, ECO:0000305}.				cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of Notch signaling pathway (GO:0008593)|skeletal system development (GO:0001501)|tissue development (GO:0009888)	proteinaceous extracellular matrix (GO:0005578)|trans-Golgi network (GO:0005802)	heparin binding (GO:0008201)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(16)|lung(22)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	59		Lung NSC(96;2.09e-05)|Prostate(109;0.0513)|Breast(139;0.0538)|Lung SC(185;0.0743)		all cancers(112;2.48e-08)|Epithelial(112;2.78e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000853)|BRCA - Breast invasive adenocarcinoma(63;0.013)|GBM - Glioblastoma multiforme(144;0.0154)		CTTATCTTGTTTTAACTTTTC	0.438																																					p.K504T		.											.	POSTN-516	0			c.A1511C						.						285.0	273.0	277.0					13																	38154716		2203	4300	6503	SO:0001583	missense	10631	exon11			TCTTGTTTTAACT	D13665	CCDS9364.1, CCDS45034.1, CCDS53864.1, CCDS66530.1, CCDS66531.1	13q13.3	2008-02-05			ENSG00000133110	ENSG00000133110			16953	protein-coding gene	gene with protein product		608777				8363580, 12235007	Standard	NM_006475		Approved	OSF-2, PN, periostin	uc001uwo.4	Q15063	OTTHUMG00000016751	ENST00000379747.4:c.1511A>C	13.37:g.38154716T>G	ENSP00000369071:p.Lys504Thr	262	2		411	141	NM_006475	0	0	2	2	0	B1ALD8|C0IMJ1|C0IMJ2|C0IMJ4|D2KRH7|F5H628|Q15064|Q29XZ0|Q3KPJ5|Q5VSY5|Q8IZF9	Missense_Mutation	SNP	ENST00000379747.4	37	CCDS9364.1	.	.	.	.	.	.	.	.	.	.	T	9.783	1.175925	0.21704	.	.	ENSG00000133110	ENST00000541179;ENST00000379749;ENST00000379747;ENST00000379743;ENST00000379742;ENST00000541481	D;D;D;D;D;D	0.91521	-2.86;-2.86;-2.86;-2.86;-2.86;-2.86	5.02	2.15	0.27550	FAS1 domain (3);	0.424660	0.27971	N	0.017111	T	0.77618	0.4157	N	0.12443	0.215	0.09310	N	1	B;B;B;B;B;B;B	0.31054	0.306;0.141;0.002;0.231;0.043;0.01;0.002	B;B;B;B;B;B;B	0.26310	0.05;0.068;0.002;0.068;0.049;0.006;0.002	T	0.64702	-0.6345	10	0.25751	T	0.34	-14.9201	8.1022	0.30863	0.0:0.4967:0.0:0.5033	.	504;504;504;504;504;504;504	C0IMJ4;F5H628;B1ALD8;Q15063-3;Q15063-4;Q15063-2;Q15063	.;.;.;.;.;.;POSTN_HUMAN	T	504	ENSP00000437959:K504T;ENSP00000369073:K504T;ENSP00000369071:K504T;ENSP00000369067:K504T;ENSP00000369066:K504T;ENSP00000437953:K504T	ENSP00000369066:K504T	K	-	2	0	POSTN	37052716	0.009000	0.17119	0.326000	0.25389	0.966000	0.64601	0.133000	0.15912	0.196000	0.20367	-0.410000	0.06199	AAA	.		0.438	POSTN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044566.2	NM_006475	
PCDH20	64881	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	13	61987658	61987658	+	Missense_Mutation	SNP	A	A	G			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr13:61987658A>G	ENST00000409186.1	-	5	2679	c.574T>C	c.(574-576)Ttt>Ctt	p.F192L	PCDH20_ENST00000409204.4_Missense_Mutation_p.F192L			Q8N6Y1	PCD20_HUMAN	protocadherin 20	192	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(14)|liver(1)|lung(23)|ovary(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	58		Breast(118;0.195)|Prostate(109;0.229)		GBM - Glioblastoma multiforme(99;0.000118)		ACCTTCACAAACCTGAAGTAT	0.532																																					p.F192L		.											.	PCDH20-581	0			c.T574C						.						98.0	83.0	89.0					13																	61987658		2203	4300	6503	SO:0001583	missense	64881	exon2			TCACAAACCTGAA	AF169693	CCDS9442.2	13q21	2010-01-26			ENSG00000197991	ENSG00000197991		"""Cadherins / Protocadherins : Non-clustered"""	14257	protein-coding gene	gene with protein product		614449					Standard	NM_022843		Approved	PCDH13, FLJ22218	uc001vid.4	Q8N6Y1	OTTHUMG00000017012	ENST00000409186.1:c.574T>C	13.37:g.61987658A>G	ENSP00000386653:p.Phe192Leu	141	1		193	20	NM_022843	0	0	4	5	1	A8K1K9|B1AQU2|Q8NDN4|Q9NRT9	Missense_Mutation	SNP	ENST00000409186.1	37	CCDS9442.2	.	.	.	.	.	.	.	.	.	.	a	8.597	0.886017	0.17540	.	.	ENSG00000197991	ENST00000409204;ENST00000409186	T;T	0.49432	0.78;0.78	5.65	5.65	0.86999	.	0.091594	0.48286	D	0.000189	T	0.17662	0.0424	N	0.02842	-0.48	0.38070	D	0.936352	B	0.02656	0.0	B	0.01281	0.0	T	0.26430	-1.0103	10	0.02654	T	1	.	6.0665	0.19866	0.8001:0.0:0.1999:0.0	.	192	A8K1K9	.	L	192	ENSP00000387250:F192L;ENSP00000386653:F192L	ENSP00000386653:F192L	F	-	1	0	PCDH20	60885659	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	6.222000	0.72249	2.152000	0.67230	0.529000	0.55759	TTT	.		0.532	PCDH20-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333054.2	NM_022843	
MYH7	4625	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	23886422	23886422	+	Missense_Mutation	SNP	C	C	T			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr14:23886422C>T	ENST00000355349.3	-	32	4621	c.4459G>A	c.(4459-4461)Gcc>Acc	p.A1487T	CTD-2201G16.1_ENST00000557368.1_RNA|MIR208B_ENST00000401172.1_RNA	NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	1487					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		TCCTCATAGGCGTTCTTGAGT	0.597																																					p.A1487T		.											.	MYH7-94	0			c.G4459A						.						118.0	124.0	122.0					14																	23886422		2203	4300	6503	SO:0001583	missense	4625	exon32			CATAGGCGTTCTT	M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.4459G>A	14.37:g.23886422C>T	ENSP00000347507:p.Ala1487Thr	234	0		257	77	NM_000257	0	0	0	0	0	A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Missense_Mutation	SNP	ENST00000355349.3	37	CCDS9601.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.374149	0.82573	.	.	ENSG00000092054	ENST00000355349;ENST00000544444	T	0.78364	-1.17	5.27	5.27	0.74061	Myosin tail (1);	.	.	.	.	D	0.84000	0.5376	M	0.81942	2.565	0.39473	D	0.967754	P	0.43662	0.814	P	0.50440	0.641	D	0.86199	0.1617	9	0.59425	D	0.04	.	13.987	0.64341	0.1513:0.8487:0.0:0.0	.	1487	P12883	MYH7_HUMAN	T	1487;1492	ENSP00000347507:A1487T	ENSP00000347507:A1487T	A	-	1	0	MYH7	22956262	0.987000	0.35691	0.998000	0.56505	0.982000	0.71751	2.764000	0.47613	2.746000	0.94184	0.591000	0.81541	GCC	.		0.597	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071798.3	NM_000257	
PLCB2	5330	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	40594160	40594160	+	Nonsense_Mutation	SNP	T	T	A			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr15:40594160T>A	ENST00000260402.3	-	7	829	c.580A>T	c.(580-582)Aaa>Taa	p.K194*	PLCB2_ENST00000557821.1_Nonsense_Mutation_p.K194*|PLCB2_ENST00000456256.2_Nonsense_Mutation_p.K194*|PLCB2-AS1_ENST00000559520.1_RNA|PLCB2_ENST00000543785.2_Nonsense_Mutation_p.K194*	NM_001284297.1|NM_004573.2	NP_001271226.1|NP_004564.2	Q00722	PLCB2_HUMAN	phospholipase C, beta 2	194					activation of phospholipase C activity (GO:0007202)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)|sensory perception of bitter taste (GO:0050913)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(4)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(3)	39		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;9.38e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0508)		CCACTCACTTTGCCTTTGGGG	0.582																																					p.K194X		.											.	PLCB2-275	0			c.A580T						.						43.0	46.0	45.0					15																	40594160		2018	4185	6203	SO:0001587	stop_gained	5330	exon7			TCACTTTGCCTTT		CCDS42020.1, CCDS61591.1, CCDS61592.1, CCDS73704.1	15q15.1	2012-01-23			ENSG00000137841	ENSG00000137841	3.1.4.11		9055	protein-coding gene	gene with protein product		604114				1644792, 9925923	Standard	XM_005254448		Approved	FLJ38135	uc001zld.3	Q00722	OTTHUMG00000172412	ENST00000260402.3:c.580A>T	15.37:g.40594160T>A	ENSP00000260402:p.Lys194*	99	0		72	21	NM_004573	0	0	0	0	0	A8K6J2|B9EGH5	Nonsense_Mutation	SNP	ENST00000260402.3	37	CCDS42020.1	.	.	.	.	.	.	.	.	.	.	T	37	6.183272	0.97357	.	.	ENSG00000137841	ENST00000260402;ENST00000456256;ENST00000543785	.	.	.	4.86	4.86	0.63082	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.9216	0.70843	0.0:0.0:0.0:1.0	.	.	.	.	X	194	.	ENSP00000260402:K194X	K	-	1	0	PLCB2	38381452	1.000000	0.71417	1.000000	0.80357	0.792000	0.44763	4.795000	0.62489	2.185000	0.69588	0.454000	0.30748	AAA	.		0.582	PLCB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000418430.1		
GLDN	342035	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	51693835	51693835	+	Missense_Mutation	SNP	G	G	A			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr15:51693835G>A	ENST00000335449.6	+	9	1129	c.1073G>A	c.(1072-1074)gGc>gAc	p.G358D	GLDN_ENST00000396399.2_Missense_Mutation_p.G234D	NM_181789.2	NP_861454.2	Q6ZMI3	GLDN_HUMAN	gliomedin	358	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|microvillus organization (GO:0032528)	collagen trimer (GO:0005581)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				central_nervous_system(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	19				all cancers(107;0.00194)|GBM - Glioblastoma multiforme(94;0.00942)		CTTCTGAATGGCAGTTACACG	0.483											OREG0023125	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G358D		.											.	GLDN-92	0			c.G1073A						.						267.0	204.0	226.0					15																	51693835		2196	4293	6489	SO:0001583	missense	342035	exon9			TGAATGGCAGTTA	AY358144	CCDS10140.2	15q15.3	2008-02-05	2005-10-06	2005-10-06	ENSG00000186417	ENSG00000186417			29514	protein-coding gene	gene with protein product		608603	"""collomin"""	COLM		16039564, 12642876	Standard	XM_005254338		Approved	CRG-L2, CLOM, colmedin, UNC-112	uc002aba.3	Q6ZMI3	OTTHUMG00000131746	ENST00000335449.6:c.1073G>A	15.37:g.51693835G>A	ENSP00000335196:p.Gly358Asp	176	0	979	197	76	NM_181789	0	0	3	3	0	Q6UXZ7|Q7Z359	Missense_Mutation	SNP	ENST00000335449.6	37	CCDS10140.2	.	.	.	.	.	.	.	.	.	.	G	4.101	0.016804	0.07959	.	.	ENSG00000186417	ENST00000335449;ENST00000396399;ENST00000537339	D;D	0.88431	-2.38;-2.38	5.71	3.4	0.38934	Olfactomedin-like (3);	0.890672	0.09441	N	0.801780	T	0.77274	0.4106	N	0.14661	0.345	0.20638	N	0.999872	B	0.13594	0.008	B	0.16289	0.015	T	0.61855	-0.6977	10	0.12103	T	0.63	.	7.3269	0.26560	0.359:0.0:0.641:0.0	.	358	Q6ZMI3	GLDN_HUMAN	D	358;234;234	ENSP00000335196:G358D;ENSP00000379681:G234D	ENSP00000335196:G358D	G	+	2	0	GLDN	49481127	0.992000	0.36948	0.561000	0.28357	0.921000	0.55340	1.691000	0.37721	1.316000	0.45131	0.655000	0.94253	GGC	.		0.483	GLDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254667.2	NM_181789	
VPS13C	54832	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	62221845	62221845	+	Missense_Mutation	SNP	C	C	G			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr15:62221845C>G	ENST00000261517.5	-	51	6214	c.6141G>C	c.(6139-6141)aaG>aaC	p.K2047N	VPS13C_ENST00000249837.3_Missense_Mutation_p.K2004N|VPS13C_ENST00000395898.3_Missense_Mutation_p.K2004N|VPS13C_ENST00000395896.4_Missense_Mutation_p.K2047N	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)											NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						ATACATACAGCTTGTCAAGAA	0.368																																					p.K2047N		.											.	VPS13C-92	0			c.G6141C						.						192.0	162.0	172.0					15																	62221845		2203	4300	6503	SO:0001583	missense	54832	exon51			ATACAGCTTGTCA	AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.6141G>C	15.37:g.62221845C>G	ENSP00000261517:p.Lys2047Asn	76	0		82	30	NM_020821	0	0	11	16	5		Missense_Mutation	SNP	ENST00000261517.5	37	CCDS32257.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.069131	0.76301	.	.	ENSG00000129003	ENST00000249837;ENST00000261517;ENST00000395896;ENST00000395898	T;T;T;T	0.46451	0.87;0.87;1.04;1.03	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.51449	0.1675	M	0.71581	2.175	0.80722	D	1	P;P;P;B	0.40794	0.544;0.729;0.544;0.409	B;B;B;B	0.44044	0.176;0.439;0.34;0.336	T	0.51601	-0.8685	10	0.37606	T	0.19	.	18.867	0.92296	0.0:1.0:0.0:0.0	.	2004;2047;2004;2047	Q709C8-4;Q709C8-2;Q709C8-3;Q709C8	.;.;.;VP13C_HUMAN	N	2004;2047;2047;2047	ENSP00000249837:K2004N;ENSP00000261517:K2047N;ENSP00000379233:K2047N;ENSP00000379235:K2047N	ENSP00000249837:K2004N	K	-	3	2	VPS13C	60009137	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	2.197000	0.42696	2.442000	0.82660	0.655000	0.94253	AAG	.		0.368	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000415997.1	NM_017684	
CALML4	91860	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	68497600	68497600	+	Missense_Mutation	SNP	T	T	G			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr15:68497600T>G	ENST00000467889.1	-	1	299	c.115A>C	c.(115-117)Agc>Cgc	p.S39R	CALML4_ENST00000395465.3_Missense_Mutation_p.S39R|RP11-315D16.2_ENST00000562767.1_Intron|CALML4_ENST00000540479.1_5'UTR|CALML4_ENST00000448060.2_Missense_Mutation_p.S39R	NM_033429.2	NP_219501.2	Q96GE6	CALL4_HUMAN	calmodulin-like 4	39							calcium ion binding (GO:0005509)			large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	4						GGGCCTCGGCTGCTACCCGTG	0.612																																					p.S39R		.											.	CALML4-90	0			c.A115C						.						69.0	66.0	67.0					15																	68497600		2200	4298	6498	SO:0001583	missense	91860	exon1			CTCGGCTGCTACC	AF308287	CCDS10226.2, CCDS42052.1, CCDS66808.1	15q22.31	2013-01-10			ENSG00000129007	ENSG00000129007		"""EF-hand domain containing"""	18445	protein-coding gene	gene with protein product							Standard	NM_033429		Approved	MGC4809, NY-BR-20	uc002arb.3	Q96GE6	OTTHUMG00000133287	ENST00000467889.1:c.115A>C	15.37:g.68497600T>G	ENSP00000419081:p.Ser39Arg	106	1		121	41	NM_033429	0	0	16	26	10	B4DL15|F8W6Y4|Q6MZY3|Q6N048|Q9H286	Missense_Mutation	SNP	ENST00000467889.1	37	CCDS10226.2	.	.	.	.	.	.	.	.	.	.	T	10.48	1.362660	0.24684	.	.	ENSG00000129007	ENST00000395465;ENST00000448060;ENST00000467889	T;T;T	0.71934	1.94;-0.44;-0.61	3.41	1.98	0.26296	.	.	.	.	.	T	0.67627	0.2913	N	0.19112	0.55	0.19300	N	0.99998	D;B	0.69078	0.997;0.02	D;B	0.75484	0.986;0.012	T	0.54866	-0.8229	9	0.72032	D	0.01	2.9936	2.4394	0.04490	0.0:0.2172:0.2897:0.4931	.	39;39	F8W6Y4;Q96GE6	.;CALL4_HUMAN	R	39	ENSP00000378848:S39R;ENSP00000400755:S39R;ENSP00000419081:S39R	ENSP00000378848:S39R	S	-	1	0	CALML4	66284654	0.001000	0.12720	0.013000	0.15412	0.013000	0.08279	0.068000	0.14531	1.306000	0.44926	0.459000	0.35465	AGC	.		0.612	CALML4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257067.3	NM_033429	
MYO9A	4649	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	72192125	72192125	+	Silent	SNP	T	T	G			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr15:72192125T>G	ENST00000356056.5	-	24	3845	c.3373A>C	c.(3373-3375)Aga>Cga	p.R1125R	MYO9A_ENST00000563542.1_5'UTR|MYO9A_ENST00000566885.1_Silent_p.R745R|MYO9A_ENST00000424560.1_Silent_p.R1125R|MYO9A_ENST00000444904.1_Silent_p.R1106R|MYO9A_ENST00000564571.1_Silent_p.R1125R	NM_006901.3	NP_008832.2	B2RTY4	MYO9A_HUMAN	myosin IXA	1125	IQ 4. {ECO:0000255|PROSITE- ProRule:PRU00116}.|Neck or regulatory domain.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|visual perception (GO:0007601)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|motor activity (GO:0003774)			NS(4)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(29)|lung(27)|ovary(1)|pancreas(1)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						GCTTTCCATCTTGCTTGTATG	0.438																																					p.R1125R		.											.	MYO9A-93	0			c.A3373C						.						85.0	81.0	82.0					15																	72192125		2199	4297	6496	SO:0001819	synonymous_variant	4649	exon24			TCCATCTTGCTTG	AF117888	CCDS10239.1	15q22-q23	2011-09-27			ENSG00000066933	ENSG00000066933		"""Myosins / Myosin superfamily : Class IX"""	7608	protein-coding gene	gene with protein product		604875				10409426	Standard	NM_006901		Approved	FLJ11061, FLJ13244, MGC71859	uc002atl.5	B2RTY4	OTTHUMG00000133440	ENST00000356056.5:c.3373A>C	15.37:g.72192125T>G		97	0		123	46	NM_006901	0	0	10	26	16	B0I1T5|C9IYB3|C9JA86|Q14787|Q3YLD7|Q3YLD8|Q6P986|Q9H8T5|Q9NTG2|Q9NUY2|Q9UEP3|Q9UNJ2	Silent	SNP	ENST00000356056.5	37	CCDS10239.1																																																																																			.		0.438	MYO9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257308.1	NM_006901	
ADAMTSL3	57188	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	84581896	84581896	+	Nonsense_Mutation	SNP	C	C	T	rs202011681	byFrequency	TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr15:84581896C>T	ENST00000286744.5	+	16	1977	c.1753C>T	c.(1753-1755)Cag>Tag	p.Q585*	ADAMTSL3_ENST00000567476.1_Nonsense_Mutation_p.Q585*	NM_207517.2	NP_997400.2	P82987	ATL3_HUMAN	ADAMTS-like 3	585	TSP type-1 4. {ECO:0000255|PROSITE- ProRule:PRU00210}.					proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|breast(7)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(24)|lung(51)|ovary(7)|pancreas(2)|prostate(2)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	130			BRCA - Breast invasive adenocarcinoma(143;0.211)			GCCGGGTGTGCAGGTCCGTGA	0.582																																					p.Q585X		.											.	ADAMTSL3-1153	0			c.C1753T						.						89.0	81.0	84.0					15																	84581896		2203	4300	6503	SO:0001587	stop_gained	57188	exon16			GGTGTGCAGGTCC	AF237652	CCDS10326.1, CCDS73773.1	15q25.2	2013-01-29			ENSG00000156218	ENSG00000156218		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14633	protein-coding gene	gene with protein product		609199				9628581, 10574462	Standard	NM_207517		Approved	KIAA1233, punctin-2	uc002bjz.4	P82987	OTTHUMG00000147363	ENST00000286744.5:c.1753C>T	15.37:g.84581896C>T	ENSP00000286744:p.Gln585*	176	1		198	52	NM_207517	0	0	0	0	0	A1A566|A1A567|Q9ULI7	Nonsense_Mutation	SNP	ENST00000286744.5	37	CCDS10326.1	.	.	.	.	.	.	.	.	.	.	C	38	7.094589	0.98059	.	.	ENSG00000156218	ENST00000286744	.	.	.	4.9	4.9	0.64082	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	18.1118	0.89538	0.0:1.0:0.0:0.0	.	.	.	.	X	585	.	ENSP00000286744:Q585X	Q	+	1	0	ADAMTSL3	82372900	1.000000	0.71417	0.186000	0.23195	0.277000	0.26821	7.180000	0.77674	2.246000	0.74042	0.563000	0.77884	CAG	C|0.999;G|0.001		0.582	ADAMTSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304007.2	NM_207517	
DNM1P46	196968	bcgsc.ca	37	15	100332761	100332761	+	RNA	SNP	C	C	A			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr15:100332761C>A	ENST00000341853.1	-	0	1430				RN7SL484P_ENST00000462651.2_RNA|AC090825.1_ENST00000408584.1_RNA	NR_003260.1		Q6ZS02	DMP46_HUMAN	DNM1 pseudogene 46							microtubule (GO:0005874)	GTPase activity (GO:0003924)										CAGCTGAGCACCCCTCCCTCC	0.607																																					.													.	.	0			.						.						81.0	84.0	83.0					15																	100332761		876	1991	2867			196968	.			TGAGCACCCCTCC	AJ576275		15q26.3	2013-04-25			ENSG00000182397	ENSG00000182397			35199	pseudogene	pseudogene			"""chromosome 15 open reading frame 51"""	DNM1DN14@, C15orf51			Standard	NR_003260		Approved	DNM1DN14.2, FLJ45937, DKFZp434I1020	uc021sxl.1	Q6ZS02	OTTHUMG00000149852		15.37:g.100332761C>A		105	0		115	15	.	0	0	0	1	1	Q3ZCN3	RNA	SNP	ENST00000341853.1	37																																																																																				.		0.607	DNM1P46-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000313543.1	NR_003260	
SLX4	84464	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	3641173	3641173	+	Missense_Mutation	SNP	C	C	G			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr16:3641173C>G	ENST00000294008.3	-	12	3106	c.2466G>C	c.(2464-2466)atG>atC	p.M822I		NM_032444.2	NP_115820.2	Q8IY92	SLX4_HUMAN	SLX4 structure-specific endonuclease subunit	822	Glu-rich.|Interaction with PLK1 and TERF2-TERF2IP.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing involved in repair via single-strand annealing (GO:0010792)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|nucleotide-excision repair (GO:0006289)|positive regulation of catalytic activity (GO:0043085)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|Slx1-Slx4 complex (GO:0033557)	5'-flap endonuclease activity (GO:0017108)|enzyme activator activity (GO:0008047)			breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	76						CATCTGCCCACATTGACCTCA	0.468								Direct reversal of damage																													p.M822I		.											.	SLX4-94	0			c.G2466C						.						165.0	176.0	172.0					16																	3641173		2197	4300	6497	SO:0001583	missense	84464	exon12			TGCCCACATTGAC	AB058687	CCDS10506.2	16p13.3	2014-09-17	2013-06-05	2010-09-13	ENSG00000188827	ENSG00000188827		"""Fanconi anemia, complementation groups"", ""BTB/POZ domain containing"""	23845	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group P"""	613278	"""BTB (POZ) domain containing 12"", ""SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)"""	BTBD12		11347906, 19595721	Standard	NM_032444		Approved	KIAA1784, KIAA1987, FANCP	uc002cvp.2	Q8IY92	OTTHUMG00000074089	ENST00000294008.3:c.2466G>C	16.37:g.3641173C>G	ENSP00000294008:p.Met822Ile	247	0		291	79	NM_032444	0	0	6	9	3	Q69YT8|Q8TF15|Q96JP1	Missense_Mutation	SNP	ENST00000294008.3	37	CCDS10506.2	.	.	.	.	.	.	.	.	.	.	C	18.93	3.727924	0.69074	.	.	ENSG00000188827	ENST00000294008	T	0.01347	4.99	5.57	5.57	0.84162	.	0.430257	0.24894	N	0.034741	T	0.02304	0.0071	L	0.47190	1.495	0.28137	N	0.92995	B	0.30406	0.278	B	0.24155	0.051	T	0.37267	-0.9713	10	0.45353	T	0.12	.	18.5351	0.91008	0.0:1.0:0.0:0.0	.	822	Q8IY92	SLX4_HUMAN	I	822	ENSP00000294008:M822I	ENSP00000294008:M822I	M	-	3	0	SLX4	3581174	1.000000	0.71417	0.995000	0.50966	0.993000	0.82548	3.184000	0.50926	2.619000	0.88677	0.561000	0.74099	ATG	.		0.468	SLX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157301.3	NM_032444	
SMG1	23049	hgsc.bcm.edu;broad.mit.edu	37	16	18844471	18844471	+	Silent	SNP	G	G	A			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr16:18844471G>A	ENST00000446231.2	-	51	8995	c.8583C>T	c.(8581-8583)ttC>ttT	p.F2861F	SMG1_ENST00000389467.3_Silent_p.F2861F			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	2861					DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						TGATTTGCCGGAAATTCGAAT	0.338																																					p.F2861F		.											.	SMG1-1160	0			c.C8583T						.						57.0	54.0	55.0					16																	18844471		1826	4082	5908	SO:0001819	synonymous_variant	23049	exon51			TTGCCGGAAATTC	AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.8583C>T	16.37:g.18844471G>A		89	0		97	28	NM_015092	0	0	14	31	17	O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Silent	SNP	ENST00000446231.2	37	CCDS45430.1																																																																																			.		0.338	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391817.1	NM_015092	
CORO1A	11151	ucsc.edu	37	16	30198806	30198806	+	Missense_Mutation	SNP	T	T	G			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr16:30198806T>G	ENST00000219150.5	+	6	1045	c.740T>G	c.(739-741)gTg>gGg	p.V247G	RP11-455F5.5_ENST00000567153.1_RNA|CORO1A_ENST00000570045.1_Missense_Mutation_p.V247G|CORO1A_ENST00000565497.1_Missense_Mutation_p.V247G|RP11-455F5.5_ENST00000568506.1_RNA|RP11-455F5.5_ENST00000566144.1_RNA	NM_001193333.2|NM_007074.3	NP_001180262.1|NP_009005.1	P31146	COR1A_HUMAN	coronin, actin binding protein, 1A	247					actin cytoskeleton organization (GO:0030036)|actin filament organization (GO:0007015)|calcium ion transport (GO:0006816)|cell-substrate adhesion (GO:0031589)|cellular component movement (GO:0006928)|cellular response to interleukin-4 (GO:0071353)|homeostasis of number of cells within a tissue (GO:0048873)|innate immune response (GO:0045087)|leukocyte chemotaxis (GO:0030595)|negative regulation of actin nucleation (GO:0051126)|phagocytosis (GO:0006909)|phagolysosome assembly (GO:0001845)|positive chemotaxis (GO:0050918)|positive regulation of cell migration (GO:0030335)|positive regulation of T cell proliferation (GO:0042102)|regulation of actin filament polymerization (GO:0030833)|regulation of cell shape (GO:0008360)|T cell homeostasis (GO:0043029)|uropod organization (GO:0032796)	actin filament (GO:0005884)|cell-cell junction (GO:0005911)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|lamellipodium (GO:0030027)|membrane (GO:0016020)|phagocytic cup (GO:0001891)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	actin filament binding (GO:0051015)|cytoskeletal protein binding (GO:0008092)|phosphatidylinositol 3-kinase binding (GO:0043548)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	9						GAGCGGCAGGTGGCGCTGTGG	0.672																																					p.V247G													.	CORO1A-226	0			c.T740G						.						23.0	24.0	24.0					16																	30198806		2196	4299	6495	SO:0001583	missense	11151	exon7			GGCAGGTGGCGCT	X89109	CCDS10673.1	16p11.2	2014-09-17	2001-11-28		ENSG00000102879	ENSG00000102879		"""Coronins"", ""WD repeat domain containing"""	2252	protein-coding gene	gene with protein product	"""Clabp TACO"""	605000	"""coronin, actin-binding protein, 1A"""			9778037	Standard	NM_007074		Approved	HCORO1, p57, coronin-1	uc002dww.3	P31146	OTTHUMG00000132148	ENST00000219150.5:c.740T>G	16.37:g.30198806T>G	ENSP00000219150:p.Val247Gly	60	5		37	3	NM_001193333	0	0	30	41	11	B2RBL1|Q2YD73	Missense_Mutation	SNP	ENST00000219150.5	37	CCDS10673.1	.	.	.	.	.	.	.	.	.	.	.	17.74	3.464028	0.63513	.	.	ENSG00000102879	ENST00000219150	T	0.01838	4.61	5.44	5.44	0.79542	WD40/YVTN repeat-like-containing domain (1);	0.058879	0.64402	D	0.000002	T	0.07548	0.0190	M	0.85630	2.765	0.80722	D	1	P;B	0.50710	0.938;0.077	P;B	0.45474	0.482;0.069	T	0.01914	-1.1248	10	0.87932	D	0	-15.8268	14.4786	0.67564	0.0:0.0:0.0:1.0	.	303;247	Q59G88;P31146	.;COR1A_HUMAN	G	247	ENSP00000219150:V247G	ENSP00000219150:V247G	V	+	2	0	CORO1A	30106307	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.943000	0.87716	2.082000	0.62665	0.459000	0.35465	GTG	.		0.672	CORO1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255195.2	NM_007074	
SRCAP	10847	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	30732089	30732089	+	Missense_Mutation	SNP	C	C	A			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr16:30732089C>A	ENST00000262518.4	+	20	3428	c.3043C>A	c.(3043-3045)Cca>Aca	p.P1015T	SRCAP_ENST00000344771.4_Missense_Mutation_p.P1015T|SRCAP_ENST00000395059.2_Missense_Mutation_p.P1015T	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	1015	Pro-rich.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			GGTGAACAACCCACGGGCGCC	0.602																																					p.P1015T		.											.	SRCAP-94	0			c.C3043A						.						65.0	74.0	71.0					16																	30732089		2197	4300	6497	SO:0001583	missense	10847	exon20			AACAACCCACGGG	AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.3043C>A	16.37:g.30732089C>A	ENSP00000262518:p.Pro1015Thr	223	0		275	93	NM_006662	0	0	11	14	3	B0JZA6|O15026|Q7Z744|Q9Y5L9	Missense_Mutation	SNP	ENST00000262518.4	37	CCDS10689.2	.	.	.	.	.	.	.	.	.	.	C	15.07	2.724931	0.48833	.	.	ENSG00000080603	ENST00000262518;ENST00000395059;ENST00000344771	D;D;D	0.91631	-2.88;-2.81;-2.85	5.25	5.25	0.73442	.	0.000000	0.50627	D	0.000110	D	0.90219	0.6942	N	0.14661	0.345	0.41912	D	0.990471	D;D;D	0.76494	0.999;0.999;0.997	D;D;P	0.67382	0.934;0.951;0.895	D	0.87595	0.2493	10	0.25106	T	0.35	-10.7491	11.2203	0.48851	0.0:0.9156:0.0:0.0844	.	1015;1015;1015	Q6ZRS2-3;Q6ZRS2-2;Q6ZRS2	.;.;SRCAP_HUMAN	T	1015	ENSP00000262518:P1015T;ENSP00000378499:P1015T;ENSP00000343042:P1015T	ENSP00000262518:P1015T	P	+	1	0	SRCAP	30639590	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	4.640000	0.61368	2.729000	0.93468	0.557000	0.71058	CCA	.		0.602	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255523.1	NM_006662	
ZZEF1	23140	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	3953114	3953114	+	Missense_Mutation	SNP	C	C	T			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr17:3953114C>T	ENST00000381638.2	-	37	6027	c.5903G>A	c.(5902-5904)gGg>gAg	p.G1968E		NM_015113.3	NP_055928.3	O43149	ZZEF1_HUMAN	zinc finger, ZZ-type with EF-hand domain 1	1968							calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	84						GCTCGAGTCCCCATCTGGCAA	0.498																																					p.G1968E		.											.	ZZEF1-93	0			c.G5903A						.						97.0	92.0	94.0					17																	3953114		2203	4300	6503	SO:0001583	missense	23140	exon37			GAGTCCCCATCTG	BC035319	CCDS11043.1	17p13.3	2013-01-10	2004-11-03		ENSG00000074755	ENSG00000074755		"""Zinc fingers, ZZ-type"", ""EF-hand domain containing"""	29027	protein-coding gene	gene with protein product			"""zinc finger, ZZ-type with EF hand domain 1"""			9455477	Standard	XM_005256560		Approved	KIAA0399, ZZZ4, FLJ10821	uc002fxe.3	O43149	OTTHUMG00000090741	ENST00000381638.2:c.5903G>A	17.37:g.3953114C>T	ENSP00000371051:p.Gly1968Glu	111	0		170	54	NM_015113	0	0	8	8	0	A7MBM5|Q6NXG0|Q6ZRA1|Q6ZSF4|Q9NVB9	Missense_Mutation	SNP	ENST00000381638.2	37	CCDS11043.1	.	.	.	.	.	.	.	.	.	.	C	16.80	3.222545	0.58668	.	.	ENSG00000074755	ENST00000381638	T	0.20881	2.04	5.33	4.35	0.52113	.	0.334072	0.36555	N	0.002540	T	0.21427	0.0516	N	0.19112	0.55	0.40921	D	0.984313	D;D	0.59767	0.962;0.986	P;P	0.54174	0.744;0.738	T	0.00888	-1.1526	10	0.49607	T	0.09	-17.7018	10.7443	0.46170	0.0:0.9108:0.0:0.0892	.	1968;1968	O43149-2;O43149	.;ZZEF1_HUMAN	E	1968	ENSP00000371051:G1968E	ENSP00000371051:G1968E	G	-	2	0	ZZEF1	3899863	0.864000	0.29904	0.970000	0.41538	0.425000	0.31504	1.732000	0.38146	2.672000	0.90937	0.508000	0.49915	GGG	.		0.498	ZZEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207480.1	NM_015113	
TVP23C	201158	ucsc.edu	37	17	15457087	15457087	+	Missense_Mutation	SNP	C	C	T			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr17:15457087C>T	ENST00000225576.3	-	3	247	c.152G>A	c.(151-153)tGt>tAt	p.C51Y	TVP23C_ENST00000584811.1_5'UTR|TVP23C_ENST00000519970.1_Intron|TVP23C_ENST00000438826.3_Missense_Mutation_p.C51Y|TVP23C_ENST00000428082.2_Missense_Mutation_p.C51Y|TVP23C-CDRT4_ENST00000522212.2_Missense_Mutation_p.C51Y|TVP23C_ENST00000518321.1_Missense_Mutation_p.C51Y	NM_145301.2	NP_660344.2	Q96ET8	TV23C_HUMAN	trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)	51						integral component of membrane (GO:0016021)											ACAGAGAAGACAGACGATGAT	0.373																																					p.C51Y													.	.	0			c.G152A						.						274.0	265.0	268.0					17																	15457087		2203	4300	6503	SO:0001583	missense	201158	exon3			AGAAGACAGACGA	BC011952	CCDS11170.1, CCDS45617.1	17p12	2012-11-29	2012-11-29	2012-11-29	ENSG00000175106	ENSG00000175106			30453	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B2"""	FAM18B2			Standard	NM_001135036		Approved	MGC8763	uc002goq.2	Q96ET8	OTTHUMG00000171461	ENST00000225576.3:c.152G>A	17.37:g.15457087C>T	ENSP00000225576:p.Cys51Tyr	362	19		787	74	NM_145301	0	0	4	30	26	Q3LIC7	Missense_Mutation	SNP	ENST00000225576.3	37	CCDS11170.1	.	.	.	.	.	.	.	.	.	.	.	2.368	-0.344949	0.05208	.	.	ENSG00000259024;ENSG00000175106;ENSG00000175106;ENSG00000175106	ENST00000522212;ENST00000225576;ENST00000428082;ENST00000438826	T;T;T;T	0.25749	1.78;1.78;1.78;1.78	4.47	4.47	0.54385	.	0.000000	0.85682	N	0.000000	T	0.02571	0.0078	N	0.00004	-3.335	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.0;0.0;0.002	T	0.38457	-0.9660	10	0.02654	T	1	-3.8701	9.492	0.38965	0.0:0.0877:0.0:0.9123	.	51;51;51	Q96ET8-2;Q96ET8-3;Q96ET8	.;.;F18B2_HUMAN	Y	51	ENSP00000429865:C51Y;ENSP00000225576:C51Y;ENSP00000406387:C51Y;ENSP00000413355:C51Y	ENSP00000225576:C51Y	C	-	2	0	RP11-726O12.1;FAM18B2	15397812	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	6.178000	0.71968	0.670000	0.31165	-0.442000	0.05670	TGT	.		0.373	TVP23C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000130705.2	NM_145301	
RAB34	83871	broad.mit.edu	37	17	27045260	27045260	+	5'UTR	SNP	A	A	C			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr17:27045260A>C	ENST00000301043.6	-	0	173				RAB34_ENST00000395243.3_5'Flank|RAB34_ENST00000415040.2_5'Flank|RPL23A_ENST00000472628.1_5'Flank|RAB34_ENST00000450529.1_5'Flank|RAB34_ENST00000395245.3_5'Flank|RAB34_ENST00000453384.3_Missense_Mutation_p.L9W|SNORD42B_ENST00000458893.1_RNA|RAB34_ENST00000447716.1_Missense_Mutation_p.L9W|RPL23A_ENST00000422514.2_5'Flank|RAB34_ENST00000395242.2_5'Flank|RPL23A_ENST00000394938.4_5'Flank|RPL23A_ENST00000496182.1_5'Flank|RAB34_ENST00000436730.3_5'Flank	NM_001256277.1	NP_001243206.1	Q9BZG1	RAB34_HUMAN	RAB34, member RAS oncogene family						antigen processing and presentation (GO:0019882)|Golgi to plasma membrane protein transport (GO:0043001)|lysosome localization (GO:0032418)|phagosome maturation (GO:0090382)|phagosome-lysosome fusion (GO:0090385)|protein localization to plasma membrane (GO:0072659)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|Golgi stack (GO:0005795)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|vesicle (GO:0031982)	GTP binding (GO:0005525)			endometrium(1)|kidney(1)|large_intestine(1)|liver(1)|lung(8)|skin(2)	14	Lung NSC(42;0.00431)					TTCCCTCCTCAACTCCAGGCC	0.662																																					p.L9W	Pancreas(175;216 2049 29940 32498 41589)												.	RAB34-227	0			c.T26G						.						35.0	46.0	43.0					17																	27045260		692	1591	2283	SO:0001623	5_prime_UTR_variant	83871	exon1			CTCCTCAACTCCA	AF322067	CCDS11240.1, CCDS45636.1, CCDS54101.1, CCDS58536.1	17q11.2	2008-07-18			ENSG00000109113	ENSG00000109113		"""RAB, member RAS oncogene"""	16519	protein-coding gene	gene with protein product		610917				12446704	Standard	NM_031934		Approved	RAB39, RAH	uc010was.1	P0DI83	OTTHUMG00000132680	ENST00000301043.6:c.-280T>G	17.37:g.27045260A>C		21	0		23	6	NM_001142624	0	0	0	0	0	B4E3A0|E9PEJ9|Q5BJE6|Q8NCJ8|Q96AR4	Missense_Mutation	SNP	ENST00000301043.6	37	CCDS11240.1	.	.	.	.	.	.	.	.	.	.	A	12.92	2.083287	0.36758	.	.	ENSG00000109113	ENST00000453384;ENST00000447716;ENST00000430132	T;T;T	0.72835	-0.69;-0.4;-0.2	5.53	-0.792	0.10925	.	.	.	.	.	T	0.45438	0.1342	N	0.08118	0	.	.	.	B	0.02656	0.0	B	0.01281	0.0	T	0.38308	-0.9667	8	0.87932	D	0	.	4.8613	0.13585	0.477:0.3112:0.2119:0.0	.	9	E7ES60	.	W	9	ENSP00000413156:L9W;ENSP00000410403:L9W;ENSP00000407953:L9W	ENSP00000407953:L9W	L	-	2	0	RAB34	24069387	0.101000	0.21875	0.983000	0.44433	0.894000	0.52154	-0.002000	0.12924	-0.072000	0.12864	-0.468000	0.05107	TTG	.		0.662	RAB34-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255959.4	NM_031934	
QRICH2	84074	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	74283337	74283337	+	Missense_Mutation	SNP	T	T	A			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr17:74283337T>A	ENST00000262765.5	-	7	3628	c.3449A>T	c.(3448-3450)cAa>cTa	p.Q1150L		NM_032134.1	NP_115510.1	Q9H0J4	QRIC2_HUMAN	glutamine rich 2	1150										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(2)|stomach(4)	62						GCCCCTGTCTTGGCTCTCCCT	0.567																																					p.Q1150L		.											.	QRICH2-94	0			c.A3449T						.						128.0	104.0	112.0					17																	74283337		2203	4300	6503	SO:0001583	missense	84074	exon7			CTGTCTTGGCTCT	AK058102	CCDS32741.1	17q25.1	2009-03-19			ENSG00000129646	ENSG00000129646			25326	protein-coding gene	gene with protein product							Standard	NM_032134		Approved	DKFZP434P0316	uc002jrd.1	Q9H0J4	OTTHUMG00000167578	ENST00000262765.5:c.3449A>T	17.37:g.74283337T>A	ENSP00000262765:p.Gln1150Leu	74	0		118	31	NM_032134	0	0	1	1	0	A2RRE1|Q96LM3	Missense_Mutation	SNP	ENST00000262765.5	37	CCDS32741.1	.	.	.	.	.	.	.	.	.	.	T	23.5	4.420700	0.83559	.	.	ENSG00000129646	ENST00000262765;ENST00000447564;ENST00000301613	T;T	0.63580	1.79;-0.05	4.89	4.89	0.63831	.	.	.	.	.	T	0.67906	0.2943	L	0.34521	1.04	0.32374	N	0.555436	D;D	0.71674	0.998;0.998	D;D	0.66351	0.943;0.943	T	0.73704	-0.3899	9	0.52906	T	0.07	-7.7869	12.7966	0.57562	0.0:0.0:0.0:1.0	.	1150;1150	B5MD94;Q9H0J4	.;QRIC2_HUMAN	L	1150;158;1150	ENSP00000262765:Q1150L;ENSP00000394461:Q158L	ENSP00000262765:Q1150L	Q	-	2	0	QRICH2	71794932	1.000000	0.71417	0.985000	0.45067	0.931000	0.56810	4.519000	0.60517	1.836000	0.53414	0.454000	0.30748	CAA	.		0.567	QRICH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395140.1	NM_032134	
TBCD	6904	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	80888515	80888515	+	Missense_Mutation	SNP	G	G	C			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr17:80888515G>C	ENST00000355528.4	+	33	3239	c.3109G>C	c.(3109-3111)Gag>Cag	p.E1037Q	TBCD_ENST00000539345.2_Missense_Mutation_p.E1037Q	NM_005993.4	NP_005984.3	Q9BTW9	TBCD_HUMAN	tubulin folding cofactor D	1037					'de novo' posttranslational protein folding (GO:0051084)|adherens junction assembly (GO:0034333)|cellular protein metabolic process (GO:0044267)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of microtubule polymerization (GO:0031115)|positive regulation of GTPase activity (GO:0043547)|post-chaperonin tubulin folding pathway (GO:0007023)|protein folding (GO:0006457)|tight junction assembly (GO:0070830)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)|microtubule (GO:0005874)|tight junction (GO:0005923)	beta-tubulin binding (GO:0048487)|chaperone binding (GO:0051087)|GTPase activator activity (GO:0005096)					Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0266)|all_epithelial(8;0.0696)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.18)			CCTTCTGAATGAGAGGTGAGT	0.597																																					p.E1037Q		.											.	TBCD-22	0			c.G3109C						.						92.0	89.0	90.0					17																	80888515		2024	4185	6209	SO:0001583	missense	6904	exon33			CTGAATGAGAGGT	BC003094	CCDS45818.1	17q25.3	2006-11-21	2006-11-21			ENSG00000141556			11581	protein-coding gene	gene with protein product		604649	"""tubulin-specific chaperone d"""				Standard	NM_005993		Approved		uc002kfz.3	Q9BTW9		ENST00000355528.4:c.3109G>C	17.37:g.80888515G>C	ENSP00000347719:p.Glu1037Gln	60	0		106	27	NM_005993	0	0	0	0	0	O95458|Q7L8K1|Q8IXP6|Q8NAX0|Q8WYH4|Q96E74|Q9UF82|Q9UG46|Q9Y2J3	Missense_Mutation	SNP	ENST00000355528.4	37	CCDS45818.1	.	.	.	.	.	.	.	.	.	.	G	11.82	1.751852	0.31046	.	.	ENSG00000141556	ENST00000355528;ENST00000334614;ENST00000539345	T	0.35236	1.32	4.63	2.48	0.30137	Armadillo-like helical (1);Armadillo-type fold (1);Tubulin-specific chaperone D, C-terminal (1);	0.128907	0.50627	D	0.000107	T	0.27731	0.0682	L	0.42245	1.32	0.80722	D	1	P;P;P	0.41313	0.745;0.601;0.709	B;B;B	0.41946	0.27;0.307;0.371	T	0.02632	-1.1131	9	.	.	.	.	5.3369	0.15963	0.113:0.2093:0.6777:0.0	.	814;1037;1037	F8WC00;Q9BTW9;Q9BTW9-4	.;TBCD_HUMAN;.	Q	1037;788;29	ENSP00000347719:E1037Q	.	E	+	1	0	TBCD	78481804	1.000000	0.71417	0.852000	0.33557	0.360000	0.29518	3.799000	0.55529	0.939000	0.37446	0.591000	0.81541	GAG	.		0.597	TBCD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439415.1	NM_005993	
HDHD2	84064	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	44662721	44662721	+	Silent	SNP	T	T	C			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr18:44662721T>C	ENST00000300605.6	-	2	242	c.90A>G	c.(88-90)gaA>gaG	p.E30E	IER3IP1_ENST00000588705.1_3'UTR|HDHD2_ENST00000587841.1_Intron	NM_032124.4	NP_115500.1	Q9H0R4	HDHD2_HUMAN	haloacid dehalogenase-like hydrolase domain containing 2	30						extracellular vesicular exosome (GO:0070062)	enzyme binding (GO:0019899)|metal ion binding (GO:0046872)			kidney(2)|large_intestine(2)|lung(1)|skin(1)	6						TTTTAAGAGCTTCCTGTGCGC	0.463																																					p.E30E		.											.	HDHD2-90	0			c.A90G						.						99.0	82.0	88.0					18																	44662721		2203	4300	6503	SO:0001819	synonymous_variant	84064	exon2			AAGAGCTTCCTGT	AL136681	CCDS32829.1	18q21.1	2008-02-05				ENSG00000167220			25364	protein-coding gene	gene with protein product						11230166	Standard	NM_032124		Approved	DKFZP564D1378	uc002lcs.3	Q9H0R4		ENST00000300605.6:c.90A>G	18.37:g.44662721T>C		159	0		221	83	NM_032124	0	0	4	7	3	A8K7T3|Q96NV4	Silent	SNP	ENST00000300605.6	37	CCDS32829.1																																																																																			.		0.463	HDHD2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450668.2	NM_032124	
MYO5B	4645	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	47500737	47500737	+	Silent	SNP	C	C	T			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr18:47500737C>T	ENST00000285039.7	-	10	1604	c.1305G>A	c.(1303-1305)ggG>ggA	p.G435G		NM_001080467.2	NP_001073936.1	Q9ULV0	MYO5B_HUMAN	myosin VB	435	Myosin motor.		G -> R (in DIAR2). {ECO:0000269|PubMed:20186687}.		endosome localization (GO:0032439)|metabolic process (GO:0008152)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)|vesicle-mediated transport (GO:0016192)|water transport (GO:0006833)	apical cortex (GO:0045179)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|protein complex (GO:0043234)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|Rab GTPase binding (GO:0017137)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(4)	87				READ - Rectum adenocarcinoma(32;0.103)		TGTCCAGGACCCCGATGAAGG	0.582																																					p.G435G		.											.	MYO5B-72	0			c.G1305A						.						98.0	108.0	104.0					18																	47500737		2136	4239	6375	SO:0001819	synonymous_variant	4645	exon10			CAGGACCCCGATG	AB032945	CCDS42436.1	18q	2011-09-27			ENSG00000167306	ENSG00000167306		"""Myosins / Myosin superfamily : Class V"""	7603	protein-coding gene	gene with protein product		606540				8884266, 17462998	Standard	NM_001080467		Approved	KIAA1119	uc002leb.2	Q9ULV0		ENST00000285039.7:c.1305G>A	18.37:g.47500737C>T		108	0		92	35	NM_001080467	0	0	34	89	55	B0I1R3|Q0P656|Q9H6Y6	Silent	SNP	ENST00000285039.7	37	CCDS42436.1																																																																																			.		0.582	MYO5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448515.2		
RFX2	5990	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	6013026	6013026	+	Missense_Mutation	SNP	C	C	T			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr19:6013026C>T	ENST00000303657.5	-	8	1019	c.870G>A	c.(868-870)atG>atA	p.M290I	CTC-232P5.1_ENST00000587836.1_RNA|RFX2_ENST00000592546.1_Missense_Mutation_p.M265I|RFX2_ENST00000359161.3_Missense_Mutation_p.M290I	NM_000635.3	NP_000626.2	P48378	RFX2_HUMAN	regulatory factor X, 2 (influences HLA class II expression)	290					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(4)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	21						GCTGCTGCCGCATGGCCATGT	0.617																																					p.M290I	Colon(38;171 817 19800 47433 48051)	.											.	RFX2-156	0			c.G870A						.						104.0	104.0	104.0					19																	6013026		2203	4300	6503	SO:0001583	missense	5990	exon8			CTGCCGCATGGCC		CCDS12157.1, CCDS12158.1	19p13.3	2011-11-23			ENSG00000087903	ENSG00000087903			9983	protein-coding gene	gene with protein product	"""trans-acting regulatory factor 2"", ""DNA binding protein RFX2"", ""HLA class II regulatory factor RFX2"""	142765				1505960	Standard	NM_000635		Approved	FLJ14226	uc002meb.3	P48378		ENST00000303657.5:c.870G>A	19.37:g.6013026C>T	ENSP00000306335:p.Met290Ile	279	0		320	119	NM_000635	0	0	4	9	5	A8K581|B3KNC4|Q6IQ44|Q8SNA2	Missense_Mutation	SNP	ENST00000303657.5	37	CCDS12157.1	.	.	.	.	.	.	.	.	.	.	C	17.54	3.414320	0.62511	.	.	ENSG00000087903	ENST00000303657;ENST00000359161;ENST00000537791	T	0.65364	-0.15	4.99	4.99	0.66335	.	0.038993	0.85682	D	0.000000	T	0.57359	0.2048	L	0.60845	1.875	0.80722	D	1	B;B	0.13594	0.008;0.005	B;B	0.17722	0.019;0.013	T	0.57341	-0.7828	10	0.51188	T	0.08	-34.5934	10.8416	0.46720	0.0:0.9125:0.0:0.0875	.	265;290	P48378-2;P48378	.;RFX2_HUMAN	I	290;265;77	ENSP00000306335:M290I	ENSP00000306335:M290I	M	-	3	0	RFX2	5964026	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.796000	0.62496	2.473000	0.83533	0.557000	0.71058	ATG	.		0.617	RFX2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452687.1	NM_000635	
ZNF99	7652	hgsc.bcm.edu	37	19	22940806	22940806	+	Silent	SNP	G	G	A			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr19:22940806G>A	ENST00000596209.1	-	4	1995	c.1905C>T	c.(1903-1905)acC>acT	p.T635T	ZNF99_ENST00000397104.3_Silent_p.T544T	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99	635					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T544T(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				GTTTTCTAAGGGTTGAGGACT	0.378																																					p.T635T		.											.	ZNF99-24	1	Substitution - coding silent(1)	prostate(1)	c.C1905T						.						37.0	39.0	38.0					19																	22940806		1989	4186	6175	SO:0001819	synonymous_variant	7652	exon4			TCTAAGGGTTGAG	BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4		ENST00000596209.1:c.1905C>T	19.37:g.22940806G>A		95	1		118	6	NM_001080409	0	0	0	0	0	M0R335	Silent	SNP	ENST00000596209.1	37	CCDS59369.1																																																																																			.		0.378	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000464591.1	XM_065124	
PSMC4	5704	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	40486339	40486339	+	Silent	SNP	T	T	C			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr19:40486339T>C	ENST00000157812.2	+	9	1263	c.1065T>C	c.(1063-1065)tcT>tcC	p.S355S	PSMC4_ENST00000455878.2_Silent_p.S324S	NM_006503.3|NM_153001.2	NP_006494.1|NP_694546.1	P43686	PRS6B_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 4	355					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|blastocyst development (GO:0001824)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic proteasome complex (GO:0031597)|inclusion body (GO:0016234)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(7)|ovary(1)|prostate(2)|urinary_tract(1)	19	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					TGAACCTCTCTGAGGAGGTTG	0.517																																					p.S355S	Colon(105;1478 1543 4034 6132 38638)	.											.	PSMC4-91	0			c.T1065C						.						115.0	120.0	118.0					19																	40486339		2203	4300	6503	SO:0001819	synonymous_variant	5704	exon9			CCTCTCTGAGGAG	U27515	CCDS12547.1, CCDS46076.1	19q13.11-q13.13	2010-04-21			ENSG00000013275	ENSG00000013275		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9551	protein-coding gene	gene with protein product	"""protease 26S subunit 6"", ""Tat-binding protein 7"", ""MB67 interacting protein"""	602707		MIP224		9473509, 8603043	Standard	NM_006503		Approved	TBP7, S6, MGC8570, MGC13687, MGC23214, TBP-7	uc002omq.4	P43686		ENST00000157812.2:c.1065T>C	19.37:g.40486339T>C		251	2		299	103	NM_006503	0	0	36	73	37	Q96FV5|Q9UBM3|Q9UEX3	Silent	SNP	ENST00000157812.2	37	CCDS12547.1																																																																																			.		0.517	PSMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462485.1	NM_006503	
GIPR	2696	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	46184876	46184876	+	Missense_Mutation	SNP	C	C	G	rs529800464		TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr19:46184876C>G	ENST00000590918.1	+	13	1266	c.1167C>G	c.(1165-1167)agC>agG	p.S389R	GIPR_ENST00000263281.3_Missense_Mutation_p.S389R|GIPR_ENST00000304207.8_Missense_Mutation_p.S353R	NM_000164.2	NP_000155.1	P48546	GIPR_HUMAN	gastric inhibitory polypeptide receptor	389					activation of adenylate cyclase activity (GO:0007190)|cell surface receptor signaling pathway (GO:0007166)|desensitization of G-protein coupled receptor protein signaling pathway (GO:0002029)|endocrine pancreas development (GO:0031018)|generation of precursor metabolites and energy (GO:0006091)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of insulin secretion (GO:0032024)|response to axon injury (GO:0048678)|response to calcium ion (GO:0051592)|response to fatty acid (GO:0070542)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gastric inhibitory peptide receptor activity (GO:0016519)|peptide hormone binding (GO:0017046)|transmembrane signaling receptor activity (GO:0004888)			endometrium(1)|kidney(2)|lung(5)|prostate(1)|skin(2)|urinary_tract(1)	12		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0056)|GBM - Glioblastoma multiforme(486;0.0832)|Epithelial(262;0.199)		TCCTGGTCAGCGTCCTCTACT	0.677																																					p.S389R		.											.	GIPR-523	0			c.C1167G						.						35.0	40.0	38.0					19																	46184876		2203	4300	6503	SO:0001583	missense	2696	exon13			GGTCAGCGTCCTC		CCDS12671.1	19q13.2-q13.3	2012-08-10				ENSG00000010310		"""GPCR / Class B : Glucagon receptors"""	4271	protein-coding gene	gene with protein product		137241				7490109	Standard	NM_000164		Approved		uc002pcu.1	P48546		ENST00000590918.1:c.1167C>G	19.37:g.46184876C>G	ENSP00000467494:p.Ser389Arg	96	0		99	30	NM_000164	0	0	1	1	0	B7WP14|B7ZKQ0|Q14401|Q16400|Q52M04|Q9UPI1	Missense_Mutation	SNP	ENST00000590918.1	37	CCDS12671.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.160957	0.78226	.	.	ENSG00000010310	ENST00000263281;ENST00000304207	T;T	0.58940	0.3;1.18	4.81	2.65	0.31530	GPCR, family 2-like (1);GPCR, family 2, secretin-like, conserved site (1);	0.209202	0.33959	N	0.004388	T	0.68842	0.3045	M	0.65677	2.01	0.35843	D	0.826177	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.73380	0.98;0.953;0.971	T	0.73898	-0.3837	10	0.87932	D	0	.	7.5841	0.27982	0.0:0.8105:0.0:0.1895	.	353;389;389	B7WP14;P48546;P48546-2	.;GIPR_HUMAN;.	R	389;353	ENSP00000263281:S389R;ENSP00000305321:S353R	ENSP00000263281:S389R	S	+	3	2	GIPR	50876716	0.911000	0.30947	0.991000	0.47740	0.988000	0.76386	0.947000	0.29082	0.609000	0.30018	0.561000	0.74099	AGC	.		0.677	GIPR-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000459640.1		
FGF21	26291	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	49261265	49261265	+	Missense_Mutation	SNP	C	C	A			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr19:49261265C>A	ENST00000593756.1	+	4	990	c.418C>A	c.(418-420)Cac>Aac	p.H140N	FGF21_ENST00000222157.3_Missense_Mutation_p.H140N|FUT1_ENST00000310160.3_5'Flank			Q9NSA1	FGF21_HUMAN	fibroblast growth factor 21	140					cell-cell signaling (GO:0007267)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of glucose import (GO:0046326)|positive regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045716)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|regulation of low-density lipoprotein particle clearance (GO:0010988)|signal transduction (GO:0007165)	extracellular region (GO:0005576)				breast(1)|cervix(2)|kidney(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	8		all_lung(116;1.7e-06)|all_epithelial(76;3.52e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000134)|all cancers(93;0.000348)|Epithelial(262;0.019)|GBM - Glioblastoma multiforme(486;0.022)		GTCCGAAGCCCACGGCCTCCC	0.632																																					p.H140N		.											.	FGF21-522	0			c.C418A						.						81.0	88.0	86.0					19																	49261265		2203	4299	6502	SO:0001583	missense	26291	exon3			GAAGCCCACGGCC	AB021975	CCDS12734.1	19q13.33	2012-09-20			ENSG00000105550	ENSG00000105550			3678	protein-coding gene	gene with protein product		609436				10858549	Standard	XM_005258731		Approved		uc002pko.1	Q9NSA1		ENST00000593756.1:c.418C>A	19.37:g.49261265C>A	ENSP00000471477:p.His140Asn	241	1		218	78	NM_019113	0	0	0	0	0	Q8N683	Missense_Mutation	SNP	ENST00000593756.1	37	CCDS12734.1	.	.	.	.	.	.	.	.	.	.	C	11.47	1.647950	0.29336	.	.	ENSG00000105550	ENST00000222157	D	0.86497	-2.13	4.44	3.35	0.38373	.	1.000120	0.08080	N	1.000000	D	0.84293	0.5440	L	0.54908	1.71	0.09310	N	1	B	0.17268	0.021	B	0.19391	0.025	T	0.73905	-0.3835	10	0.66056	D	0.02	2.4195	7.726	0.28761	0.0:0.8737:0.0:0.1263	.	140	Q9NSA1	FGF21_HUMAN	N	140	ENSP00000222157:H140N	ENSP00000222157:H140N	H	+	1	0	FGF21	53953077	0.000000	0.05858	0.010000	0.14722	0.013000	0.08279	0.607000	0.24209	1.123000	0.41961	-0.424000	0.05967	CAC	.		0.632	FGF21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466200.1		
SIGLEC9	27180	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	19	51633170	51633170	+	Missense_Mutation	SNP	C	C	G			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr19:51633170C>G	ENST00000250360.3	+	7	1293	c.1226C>G	c.(1225-1227)gCa>gGa	p.A409G	SIGLEC9_ENST00000440804.3_Intron	NM_014441.2	NP_055256.1	Q9Y336	SIGL9_HUMAN	sialic acid binding Ig-like lectin 9	409					cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|liver(3)|lung(25)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	45		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.000826)|OV - Ovarian serous cystadenocarcinoma(262;0.00295)		GAACCTTGGGCAGAAGACAGT	0.602																																					p.A409G		.											.	SIGLEC9-91	0			c.C1226G						.						72.0	77.0	75.0					19																	51633170		2203	4300	6503	SO:0001583	missense	27180	exon7			CTTGGGCAGAAGA	AF135027	CCDS12825.1, CCDS56100.1	19q13.3-q13.4	2013-01-29			ENSG00000129450	ENSG00000129450		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10878	protein-coding gene	gene with protein product		605640				10903842	Standard	NM_014441		Approved	CD329	uc002pvu.3	Q9Y336		ENST00000250360.3:c.1226C>G	19.37:g.51633170C>G	ENSP00000250360:p.Ala409Gly	141	0		142	38	NM_014441	0	0	7	7	0	Q6GTU4|Q9BYI9	Missense_Mutation	SNP	ENST00000250360.3	37	CCDS12825.1	.	.	.	.	.	.	.	.	.	.	.	2.098	-0.406818	0.04832	.	.	ENSG00000129450	ENST00000250360	T	0.11277	2.79	1.96	-1.87	0.07737	.	.	.	.	.	T	0.08403	0.0209	M	0.63843	1.955	0.09310	N	1	P	0.35174	0.488	B	0.32211	0.142	T	0.31916	-0.9926	9	0.22109	T	0.4	.	2.1117	0.03704	0.2511:0.4132:0.0:0.3357	.	409	Q9Y336	SIGL9_HUMAN	G	409	ENSP00000250360:A409G	ENSP00000250360:A409G	A	+	2	0	SIGLEC9	56324982	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.824000	0.01708	-0.341000	0.08376	-0.346000	0.07831	GCA	.		0.602	SIGLEC9-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464224.1	NM_014441	
FBXO11	80204	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	48050458	48050458	+	Silent	SNP	T	T	G			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr2:48050458T>G	ENST00000403359.3	-	12	1512	c.1440A>C	c.(1438-1440)gcA>gcC	p.A480A	FBXO11_ENST00000316377.4_Silent_p.A396A|FBXO11_ENST00000434523.2_5'UTR|FBXO11_ENST00000402508.1_Silent_p.A396A	NM_001190274.1	NP_001177203.1	Q86XK2	FBX11_HUMAN	F-box protein 11	480					cellular protein modification process (GO:0006464)|peptidyl-arginine N-methylation (GO:0035246)|protein ubiquitination (GO:0016567)|sensory perception of sound (GO:0007605)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	protein-arginine N-methyltransferase activity (GO:0016274)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.0?(2)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	26		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			CTTCAAAGCCTGCTATCCTAT	0.373			"""Mis, F, D"""		DLBCL																																p.A480A		.		Rec	yes		2	2p16.3	80204	F-box protein 11		L	.	FBXO11-659	2	Whole gene deletion(2)	haematopoietic_and_lymphoid_tissue(2)	c.A1440C						.						82.0	77.0	78.0					2																	48050458		2203	4300	6503	SO:0001819	synonymous_variant	80204	exon12			AAAGCCTGCTATC	AF174599	CCDS1837.1, CCDS54357.1	2p16.3	2014-01-29	2008-06-23	2008-06-23	ENSG00000138081	ENSG00000138081		"""Ubiquitin protein ligase E3 component n-recognins"", ""F-boxes /  ""other"""""	13590	protein-coding gene	gene with protein product	"""ubiquitin protein ligase E3 component n-recognin 6"""	607871	"""F-box only protein 11"""			10531035, 16487488, 18162545	Standard	NM_025133		Approved	FBX11, UBR6	uc002rwe.3	Q86XK2	OTTHUMG00000129130	ENST00000403359.3:c.1440A>C	2.37:g.48050458T>G		71	1		89	30	NM_001190274	0	0	13	26	13	A1L491|Q52ZP1|Q53EP7|Q53RT5|Q8IXG3|Q96E90|Q9H6V8|Q9H9L1|Q9NR14|Q9UFK1|Q9UHI1|Q9UKC2	Silent	SNP	ENST00000403359.3	37	CCDS54357.1																																																																																			.		0.373	FBXO11-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251181.3	NM_012167, NM_018693, NM_025133	
STON1	11037	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	48808956	48808956	+	Missense_Mutation	SNP	A	A	G			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr2:48808956A>G	ENST00000406226.1	+	3	1379	c.1184A>G	c.(1183-1185)gAg>gGg	p.E395G	STON1-GTF2A1L_ENST00000402114.2_Missense_Mutation_p.E395G|STON1-GTF2A1L_ENST00000309827.2_Missense_Mutation_p.E395G|STON1-GTF2A1L_ENST00000405008.1_Missense_Mutation_p.E395G|STON1_ENST00000404752.1_Missense_Mutation_p.E395G|STON1-GTF2A1L_ENST00000394754.1_Missense_Mutation_p.E395G|STON1-GTF2A1L_ENST00000394751.3_Missense_Mutation_p.E395G|STON1_ENST00000309835.3_Missense_Mutation_p.E395G	NM_001198595.1	NP_001185524.1	Q9Y6Q2	STON1_HUMAN	stonin 1	395	SHD. {ECO:0000255|PROSITE- ProRule:PRU00403}.				endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)|regulation of endocytosis (GO:0030100)	clathrin adaptor complex (GO:0030131)				NS(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(19)|prostate(3)|skin(2)	37		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			ACTGTGGAGGAGGAGCTGATG	0.433																																					p.E395G		.											.	STON1-91	0			c.A1184G						.						75.0	74.0	74.0					2																	48808956		2203	4300	6503	SO:0001583	missense	11037	exon3			TGGAGGAGGAGCT	AF026169	CCDS1841.1	2p16.3	2008-02-05			ENSG00000243244	ENSG00000243244			17003	protein-coding gene	gene with protein product	"""stoned B homolog 1 (Drosophila)"""	605357				14504226, 10364255	Standard	NM_001198595		Approved	SBLF, stoned-b1		Q9Y6Q2	OTTHUMG00000129169	ENST00000406226.1:c.1184A>G	2.37:g.48808956A>G	ENSP00000384615:p.Glu395Gly	96	1		134	40	NM_001198595	0	0	3	4	1	A8MXJ1|B5MCF5|B7ZL16|Q96JE3|Q9BYX3	Missense_Mutation	SNP	ENST00000406226.1	37	CCDS1841.1	.	.	.	.	.	.	.	.	.	.	A	20.3	3.961262	0.74016	.	.	ENSG00000243244;ENSG00000243244;ENSG00000243244;ENSG00000068781;ENSG00000068781;ENSG00000068781;ENSG00000068781;ENSG00000068781	ENST00000404752;ENST00000406226;ENST00000309835;ENST00000405008;ENST00000402114;ENST00000394754;ENST00000309827;ENST00000394751	T;T;T;T;T;T;T;T	0.14893	2.52;2.52;2.52;2.49;2.47;2.49;2.49;2.67	5.27	5.27	0.74061	Stonin homology (1);	0.000000	0.85682	D	0.000000	T	0.43233	0.1238	M	0.75264	2.295	0.58432	D	0.99999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.996;0.963;0.998	T	0.41305	-0.9516	10	0.87932	D	0	.	15.3726	0.74577	1.0:0.0:0.0:0.0	.	395;395;395	A8MXJ1;Q53S48;Q9Y6Q2	.;.;STON1_HUMAN	G	395	ENSP00000385273:E395G;ENSP00000384615:E395G;ENSP00000310969:E395G;ENSP00000385499:E395G;ENSP00000385701:E395G;ENSP00000378236:E395G;ENSP00000311493:E395G;ENSP00000378234:E395G	ENSP00000310969:E395G	E	+	2	0	STON1-GTF2A1L;STON1	48662460	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	9.128000	0.94424	2.209000	0.71365	0.533000	0.62120	GAG	.		0.433	STON1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323848.2	NM_006873	
IMMT	10989	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	86371415	86371415	+	Silent	SNP	T	T	G			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr2:86371415T>G	ENST00000410111.3	-	15	2640	c.2253A>C	c.(2251-2253)ggA>ggC	p.G751G	IMMT_ENST00000442664.2_Silent_p.G750G|IMMT_ENST00000409051.2_Silent_p.G704G|IMMT_ENST00000449247.2_Silent_p.G740G|IMMT_ENST00000254636.5_Silent_p.G652G	NM_001100169.1|NM_001100170.1|NM_006839.2	NP_001093639.1|NP_001093640.1|NP_006830.2	Q16891	MIC60_HUMAN	inner membrane protein, mitochondrial	751					mitochondrial calcium ion homeostasis (GO:0051560)|response to cold (GO:0009409)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						CCTGAGTGGTTCCTATTCCTA	0.478																																					p.G751G		.											.	IMMT-91	0			c.A2253C						.						68.0	66.0	67.0					2																	86371415		1922	4128	6050	SO:0001819	synonymous_variant	10989	exon15			AGTGGTTCCTATT	D21094	CCDS46355.1, CCDS46356.1, CCDS46357.1	2p11.2	2011-10-04	2010-04-29		ENSG00000132305	ENSG00000132305			6047	protein-coding gene	gene with protein product	"""mitofilin"", ""mitochondrial inner membrane organizing system 2"""	600378	"""inner membrane protein, mitochondrial (mitofilin)"""			9168817, 8039717	Standard	NM_001100169		Approved	P87, P89, HMP, MINOS2	uc002sqz.4	Q16891	OTTHUMG00000153170	ENST00000410111.3:c.2253A>C	2.37:g.86371415T>G		94	0		101	40	NM_006839	0	0	52	115	63	B1H0U5|B2R5N6|Q14539|Q15092|Q68D41|Q69HW5|Q6IBL0|Q7Z3X1|Q8TAJ5|Q9P0V2	Silent	SNP	ENST00000410111.3	37	CCDS46355.1	.	.	.	.	.	.	.	.	.	.	T	7.004	0.555382	0.13436	.	.	ENSG00000132305	ENST00000419070	.	.	.	5.3	-1.19	0.09585	.	.	.	.	.	T	0.52058	0.1711	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.44329	-0.9335	4	.	.	.	-22.8427	7.6657	0.28430	0.0:0.4268:0.1243:0.4489	.	.	.	.	H	606	.	.	N	-	1	0	IMMT	86224926	0.864000	0.29904	0.998000	0.56505	0.905000	0.53344	-0.251000	0.08818	-0.076000	0.12775	-0.256000	0.11100	AAC	.		0.478	IMMT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000329909.2	NM_006839	
VWC2L	402117	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	215440518	215440518	+	Nonsense_Mutation	SNP	G	G	T			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr2:215440518G>T	ENST00000312504.5	+	4	1445	c.643G>T	c.(643-645)Gaa>Taa	p.E215*	VWC2L_ENST00000427124.1_3'UTR|AC107218.3_ENST00000437883.1_RNA|AC107218.3_ENST00000412896.1_RNA	NM_001080500.2	NP_001073969.1	B2RUY7	VWC2L_HUMAN	von Willebrand factor C domain containing protein 2-like	215					negative regulation of BMP signaling pathway (GO:0030514)|positive regulation of neuron differentiation (GO:0045666)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular space (GO:0005615)|synapse (GO:0045202)				breast(1)|endometrium(1)|large_intestine(3)|lung(10)|prostate(1)	16						TTCGAAACGTGAATGCCAAGG	0.458																																					p.E215X		.											.	.	0			c.G643T						.						225.0	220.0	221.0					2																	215440518		2026	4199	6225	SO:0001587	stop_gained	402117	exon4			AAACGTGAATGCC	AB374231	CCDS46509.1	2q34-q35	2011-01-25	2011-01-25		ENSG00000174453	ENSG00000174453			37203	protein-coding gene	gene with protein product			"""von Willebrand factor C domain-containing protein 2-like"""				Standard	NM_001080500		Approved		uc002vet.2	B2RUY7	OTTHUMG00000154811	ENST00000312504.5:c.643G>T	2.37:g.215440518G>T	ENSP00000308976:p.Glu215*	211	0		305	93	NM_001080500	0	0	0	0	0	A6NC69|B2RUW7|B7X8X1	Nonsense_Mutation	SNP	ENST00000312504.5	37	CCDS46509.1	.	.	.	.	.	.	.	.	.	.	G	44	10.583132	0.99432	.	.	ENSG00000174453	ENST00000312504	.	.	.	5.58	5.58	0.84498	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.30078	T	0.28	-3.3711	19.5796	0.95461	0.0:0.0:1.0:0.0	.	.	.	.	X	215	.	ENSP00000308976:E215X	E	+	1	0	VWC2L	215148763	1.000000	0.71417	0.997000	0.53966	0.999000	0.98932	9.476000	0.97823	2.624000	0.88883	0.655000	0.94253	GAA	.		0.458	VWC2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337175.1	NM_001080500	
GIGYF2	26058	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	233681744	233681744	+	Splice_Site	SNP	T	T	A			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr2:233681744T>A	ENST00000409547.1	+	22	2681		c.e22+2		GIGYF2_ENST00000373566.3_Splice_Site|GIGYF2_ENST00000373563.4_Splice_Site|GIGYF2_ENST00000409196.3_Splice_Site|GIGYF2_ENST00000452341.2_Splice_Site|GIGYF2_ENST00000409480.1_Splice_Site|GIGYF2_ENST00000409451.3_Splice_Site	NM_015575.3	NP_056390.2	Q6Y7W6	PERQ2_HUMAN	GRB10 interacting GYF protein 2						adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|feeding behavior (GO:0007631)|homeostasis of number of cells within a tissue (GO:0048873)|insulin-like growth factor receptor signaling pathway (GO:0048009)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|musculoskeletal movement (GO:0050881)|negative regulation of translation (GO:0017148)|neuromuscular process controlling balance (GO:0050885)|post-embryonic development (GO:0009791)|spinal cord motor neuron differentiation (GO:0021522)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(17)|lung(11)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	63		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;7.37e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000472)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(119;0.0118)|GBM - Glioblastoma multiforme(43;0.0145)		AGGAAACAGGTATGTATCTGG	0.468																																					.		.											.	GIGYF2-28	0			c.2352+2T>A						.						239.0	230.0	233.0					2																	233681744		2203	4300	6503	SO:0001630	splice_region_variant	26058	exon19			AACAGGTATGTAT	U80751	CCDS33401.1, CCDS46542.1, CCDS46543.1	2q37.1	2011-07-06	2008-02-11	2008-02-11	ENSG00000204120	ENSG00000204120		"""Trinucleotide (CAG) repeat containing"""	11960	protein-coding gene	gene with protein product	"""GYF domain containing 2"""	612003	"""PERQ amino acid rich, with GYF domain 2"", ""PERQ amino acid rich, with GYF domain 3"", ""trinucleotide repeat containing 15"", ""Parkinson disease (autosomal recessive, early onset) 11"""	PERQ2, PERQ3, TNRC15, PARK11		9225980, 9734811, 12771153, 18358451, 19279319	Standard	NM_015575		Approved	KIAA0642, GYF2	uc002vtk.4	Q6Y7W6	OTTHUMG00000153237	ENST00000409547.1:c.2370+2T>A	2.37:g.233681744T>A		278	1		344	93	NM_001103148	0	0	0	0	0	A6H8W4|B9EG55|E9PBB0|O75137|Q7Z2Z8|Q7Z3I2|Q96HU4|Q9NV82	Splice_Site	SNP	ENST00000409547.1	37	CCDS33401.1	.	.	.	.	.	.	.	.	.	.	T	12.93	2.085687	0.36758	.	.	ENSG00000204120	ENST00000373566;ENST00000373563;ENST00000409480;ENST00000409547;ENST00000409196;ENST00000409451;ENST00000440945;ENST00000452341	.	.	.	3.76	3.76	0.43208	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.9462	0.58373	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	GIGYF2	233389988	1.000000	0.71417	0.938000	0.37757	0.311000	0.27955	5.934000	0.70138	1.709000	0.51313	0.379000	0.24179	.	.		0.468	GIGYF2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000330316.2	NM_001103146	Intron
DZANK1	55184	hgsc.bcm.edu;broad.mit.edu	37	20	18433281	18433281	+	Missense_Mutation	SNP	C	C	G			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr20:18433281C>G	ENST00000358866.6	-	5	543	c.521G>C	c.(520-522)aGa>aCa	p.R174T	DZANK1_ENST00000262547.5_Missense_Mutation_p.R174T|DZANK1_ENST00000329494.5_Missense_Mutation_p.R176T|DZANK1_ENST00000357236.4_Missense_Mutation_p.D24H|DZANK1_ENST00000487128.1_5'UTR			Q9NVP4	DZAN1_HUMAN	double zinc ribbon and ankyrin repeat domains 1	174							zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(2)|large_intestine(5)|lung(10)	19						GGTGGGTGGTCTAGAACCTGA	0.423																																					p.R174T		.											.	.	0			c.G521C						.						49.0	50.0	50.0					20																	18433281		1839	4074	5913	SO:0001583	missense	55184	exon6			GGTGGTCTAGAAC	AK001462	CCDS46582.1	20p11.23	2013-01-11	2011-10-03	2011-10-03	ENSG00000089091	ENSG00000089091		"""Ankyrin repeat domain containing"""	15858	protein-coding gene	gene with protein product	"""ankyrin repeat domain 64"""		"""chromosome 20 open reading frame 12"""	C20orf84, C20orf12			Standard	NM_001099407		Approved	FLJ10600, dJ568F9.2, FLJ30892, bA189K21.8, ANKRD64	uc002wqq.4	Q9NVP4	OTTHUMG00000031968	ENST00000358866.6:c.521G>C	20.37:g.18433281C>G	ENSP00000351734:p.Arg174Thr	14	0		35	8	NM_001099407	0	0	1	2	1	B7ZLZ4|Q4F7X1|Q5QPD9|Q5QPE0|Q68DN8|Q6ZMX9|Q96NF0|Q9H1E0|Q9H442	Missense_Mutation	SNP	ENST00000358866.6	37	CCDS46582.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.147|9.147	1.015323|1.015323	0.19355|0.19355	.|.	.|.	ENSG00000089091|ENSG00000089091	ENST00000357236|ENST00000262547;ENST00000329494	D|T;T	0.85556|0.63913	-2.0|-0.07;0.61	5.3|5.3	4.33|4.33	0.51752|0.51752	.|.	.|3.465350	.|0.00919	.|U	.|0.002568	T|T	0.57257|0.57257	0.2041|0.2041	L|L	0.43152|0.43152	1.355|1.355	0.09310|0.09310	N|N	1|1	B|B;B	0.11235|0.21606	0.004|0.005;0.058	B|B;B	0.15052|0.17979	0.012|0.003;0.02	T|T	0.41324|0.41324	-0.9515|-0.9515	9|10	0.87932|0.14656	D|T	0|0.56	-0.0767|-0.0767	11.2055|11.2055	0.48767|0.48767	0.0:0.6648:0.3352:0.0|0.0:0.6648:0.3352:0.0	.|.	24|193;174	Q9NVP4-4|B7Z631;Q9NVP4	.|.;DZAN1_HUMAN	H|T	24|174;176	ENSP00000349774:D24H|ENSP00000262547:R174T;ENSP00000328866:R176T	ENSP00000349774:D24H|ENSP00000262547:R174T	D|R	-|-	1|2	0|0	C20orf12|C20orf12	18381281|18381281	0.008000|0.008000	0.16893|0.16893	0.007000|0.007000	0.13788|0.13788	0.202000|0.202000	0.24057|0.24057	2.031000|2.031000	0.41117|0.41117	2.498000|2.498000	0.84270|0.84270	0.455000|0.455000	0.32223|0.32223	GAC|AGA	.		0.423	DZANK1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000471926.1	NM_001099407	
FRG1B	284802	bcgsc.ca	37	20	29632680	29632680	+	Silent	SNP	G	G	A	rs4892355		TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr20:29632680G>A	ENST00000278882.3	+	8	875	c.495G>A	c.(493-495)aaG>aaA	p.K165K	FRG1B_ENST00000358464.4_Silent_p.K165K			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	165										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						TTCTTAAAAAGGCTCAGAAAG	0.313																																					.													.	FRG1B-22	0			.						.																																			SO:0001819	synonymous_variant	284802	.			TAAAAAGGCTCAG			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.495G>A	20.37:g.29632680G>A		583	31		1026	75	.	0	0	79	79	0	C4AME5	RNA	SNP	ENST00000278882.3	37																																																																																				G|0.500;A|0.500		0.313	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
CD40	958	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	44757638	44757638	+	Missense_Mutation	SNP	G	G	C			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr20:44757638G>C	ENST00000372285.3	+	9	865	c.793G>C	c.(793-795)Gat>Cat	p.D265H	CD40_ENST00000489304.1_3'UTR|CD40_ENST00000372276.3_3'UTR	NM_001250.4	NP_001241.1	P25942	TNR5_HUMAN	CD40 molecule, TNF receptor superfamily member 5	265					B cell proliferation (GO:0042100)|cellular calcium ion homeostasis (GO:0006874)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|immune response-regulating cell surface receptor signaling pathway (GO:0002768)|inflammatory response (GO:0006954)|platelet activation (GO:0030168)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of isotype switching to IgG isotypes (GO:0048304)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|protein complex assembly (GO:0006461)|regulation of immune response (GO:0050776)|regulation of immunoglobulin secretion (GO:0051023)	CD40 receptor complex (GO:0035631)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|enzyme binding (GO:0019899)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)|ubiquitin protein ligase binding (GO:0031625)			endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10		Myeloproliferative disorder(115;0.0122)				CACCCAGGAGGATGGCAAAGA	0.582									Immune Deficiency with Hyper-IgM																												p.D265H		.											.	CD40-659	0			c.G793C						.						94.0	86.0	89.0					20																	44757638		2203	4300	6503	SO:0001583	missense	958	exon9	Familial Cancer Database	Hypogammaglobulinemia with Hyper-IgM, HIGM type I-V, XLHIGM	CAGGAGGATGGCA	X60592	CCDS13393.1, CCDS13394.1	20q12-q13.2	2014-09-17	2006-03-28	2005-01-14	ENSG00000101017	ENSG00000101017		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11919	protein-coding gene	gene with protein product		109535	"""tumor necrosis factor receptor superfamily, member 5"""	TNFRSF5		7687385, 2998589	Standard	XM_005260617		Approved	p50, Bp50	uc002xrg.1	P25942	OTTHUMG00000033053	ENST00000372285.3:c.793G>C	20.37:g.44757638G>C	ENSP00000361359:p.Asp265His	120	0		208	43	NM_001250	0	0	34	42	8	E1P5S9|Q53GN5|Q5JY15|Q5U007|Q7M4Q8|Q86YK5|Q9BYU0	Missense_Mutation	SNP	ENST00000372285.3	37	CCDS13393.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.14|19.14	3.769455|3.769455	0.69992|0.69992	.|.	.|.	ENSG00000101017|ENSG00000101017	ENST00000372285|ENST00000372278	T|.	0.75050|.	-0.9|.	4.61|4.61	4.61|4.61	0.57282|0.57282	.|.	2.083250|.	0.02069|.	N|.	0.051393|.	T|T	0.72078|0.72078	0.3416|0.3416	L|L	0.61218|0.61218	1.895|1.895	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.91635|.	0.999|.	T|T	0.75792|0.75792	-0.3193|-0.3193	10|6	0.48119|0.87932	T|D	0.1|0	-17.99|-17.99	14.7536|14.7536	0.69546|0.69546	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	265|.	P25942|.	TNR5_HUMAN|.	H|S	265|214	ENSP00000361359:D265H|.	ENSP00000361359:D265H|ENSP00000361352:R214S	D|R	+|+	1|3	0|2	CD40|CD40	44191045|44191045	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.759000|0.759000	0.43091|0.43091	5.327000|5.327000	0.65881|0.65881	2.375000|2.375000	0.81037|0.81037	0.491000|0.491000	0.48974|0.48974	GAT|AGG	.		0.582	CD40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080376.1	NM_001250	
ZNFX1	57169	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	47887763	47887763	+	Missense_Mutation	SNP	T	T	C			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr20:47887763T>C	ENST00000396105.1	-	3	832	c.586A>G	c.(586-588)Agc>Ggc	p.S196G	ZNFX1_ENST00000371752.1_Missense_Mutation_p.S196G|ZNFX1_ENST00000371754.4_Missense_Mutation_p.S196G	NM_021035.2	NP_066363.1	Q9P2E3	ZNFX1_HUMAN	zinc finger, NFX1-type containing 1	196							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(8)|kidney(7)|large_intestine(15)|liver(1)|lung(17)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	60			BRCA - Breast invasive adenocarcinoma(12;0.00173)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			ATTTTGGAGCTACAAGCCTTC	0.448																																					p.S196G		.											.	ZNFX1-24	0			c.A586G						.						122.0	125.0	124.0					20																	47887763		2203	4300	6503	SO:0001583	missense	57169	exon3			TGGAGCTACAAGC	AK022641	CCDS13417.1	20q13.13	2014-02-12			ENSG00000124201	ENSG00000124201			29271	protein-coding gene	gene with protein product						10718198	Standard	NM_021035		Approved	KIAA1404, FLJ11277	uc002xui.3	Q9P2E3	OTTHUMG00000032696	ENST00000396105.1:c.586A>G	20.37:g.47887763T>C	ENSP00000379412:p.Ser196Gly	183	0		306	151	NM_021035	0	0	17	37	20	Q9BQM7|Q9BQM8|Q9H8C1|Q9H9S2|Q9NUM1|Q9NWW1	Missense_Mutation	SNP	ENST00000396105.1	37	CCDS13417.1	.	.	.	.	.	.	.	.	.	.	T	9.975	1.226419	0.22542	.	.	ENSG00000124201	ENST00000396106;ENST00000371754;ENST00000371752;ENST00000396105;ENST00000371744	D;D;D;T	0.86865	-1.89;-2.18;-2.18;-0.82	5.86	5.86	0.93980	.	0.260907	0.49916	D	0.000128	T	0.81564	0.4849	L	0.45581	1.43	0.25150	N	0.990437	B	0.13145	0.007	B	0.10450	0.005	T	0.66590	-0.5885	10	0.21540	T	0.41	-21.586	10.261	0.43427	0.0:0.0774:0.0:0.9226	.	196	Q9P2E3	ZNFX1_HUMAN	G	196	ENSP00000360819:S196G;ENSP00000360817:S196G;ENSP00000379412:S196G;ENSP00000360809:S196G	ENSP00000360809:S196G	S	-	1	0	ZNFX1	47321170	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	1.608000	0.36847	2.241000	0.73720	0.533000	0.62120	AGC	.		0.448	ZNFX1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079647.2	NM_021035	
COL18A1	80781	ucsc.edu;bcgsc.ca	37	21	46842430	46842430	+	Intron	SNP	C	C	T			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr21:46842430C>T	ENST00000400337.2	+	2	200				COL18A1-AS1_ENST00000397787.1_RNA|COL18A1-AS1_ENST00000485206.1_RNA	NM_130445.2	NP_569712	P39060	COIA1_HUMAN	collagen, type XVIII, alpha 1						angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endothelial cell morphogenesis (GO:0001886)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|response to drug (GO:0042493)|response to hydrostatic pressure (GO:0051599)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		GCTGCCTGGCCTGACGCACCT	0.647																																					.													.	.	0			.						.						15.0	19.0	17.0					21																	46842430		2196	4295	6491	SO:0001627	intron_variant	378832	.			CCTGGCCTGACGC		CCDS42971.1, CCDS42972.1	21q22.3	2013-01-16			ENSG00000182871	ENSG00000182871		"""Collagens"""	2195	protein-coding gene	gene with protein product	"""endostatin"""	120328	"""Knobloch syndrome, type 1"""	KNO		8188291, 8776601, 10942434, 17546652	Standard	NM_130445		Approved	KS, KNO1	uc002zhi.3	P39060	OTTHUMG00000090407	ENST00000400337.2:c.106+17042C>T	21.37:g.46842430C>T		20	0		11	8	.	0	0	0	0	0	A8MVI4|Q58EX6|Q6RZ39|Q6RZ40|Q6RZ41|Q8N4S4|Q8WXI5|Q96T70|Q9UK38|Q9Y6Q7|Q9Y6Q8	RNA	SNP	ENST00000400337.2	37	CCDS42971.1																																																																																			.		0.647	COL18A1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000206828.1		
GNAZ	2781	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	23438484	23438484	+	Missense_Mutation	SNP	A	A	G			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr22:23438484A>G	ENST00000248996.4	+	2	1268	c.602A>G	c.(601-603)gAc>gGc	p.D201G	RTDR1_ENST00000216036.4_Intron	NM_002073.2	NP_002064.1	P19086	GNAZ_HUMAN	guanine nucleotide binding protein (G protein), alpha z polypeptide	201					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled serotonin receptor binding (GO:0031821)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|receptor signaling protein activity (GO:0005057)|signal transducer activity (GO:0004871)			endometrium(3)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|skin(5)|urinary_tract(1)	19	all_hematologic(9;0.0197)|Acute lymphoblastic leukemia(84;0.181)			READ - Rectum adenocarcinoma(21;0.166)		AAGATGGTGGACGTGGGGGGG	0.567																																					p.D201G		.											.	GNAZ-963	0			c.A602G						.						131.0	136.0	135.0					22																	23438484		2203	4300	6503	SO:0001583	missense	2781	exon2			TGGTGGACGTGGG		CCDS13804.1	22q11.1-q11.2	2008-06-10			ENSG00000128266	ENSG00000128266			4395	protein-coding gene	gene with protein product		139160				2115889	Standard	NM_002073		Approved		uc002zwu.1	P19086	OTTHUMG00000150611	ENST00000248996.4:c.602A>G	22.37:g.23438484A>G	ENSP00000248996:p.Asp201Gly	247	1		228	69	NM_002073	0	0	3	7	4	B2R6C1|Q4QRJ6	Missense_Mutation	SNP	ENST00000248996.4	37	CCDS13804.1	.	.	.	.	.	.	.	.	.	.	A	13.88	2.367786	0.42003	.	.	ENSG00000128266	ENST00000248996;ENST00000456059	D	0.95656	-3.77	4.7	2.53	0.30540	.	0.000000	0.85682	D	0.000000	D	0.96386	0.8821	H	0.98577	4.27	0.80722	D	1	B	0.10296	0.003	B	0.08055	0.003	D	0.92468	0.5983	10	0.87932	D	0	.	6.794	0.23715	0.7665:0.1527:0.0808:0.0	.	201	P19086	GNAZ_HUMAN	G	201;149	ENSP00000248996:D201G	ENSP00000248996:D201G	D	+	2	0	GNAZ	21768484	1.000000	0.71417	0.650000	0.29550	0.158000	0.22134	9.084000	0.94076	0.268000	0.21939	-0.313000	0.08912	GAC	.		0.567	GNAZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319073.1	NM_002073	
CABIN1	23523	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	24447425	24447425	+	Silent	SNP	T	T	A			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr22:24447425T>A	ENST00000398319.2	+	8	1180	c.795T>A	c.(793-795)atT>atA	p.I265I	CABIN1_ENST00000405822.2_Intron|CABIN1_ENST00000263119.5_Silent_p.I265I	NM_001199281.1	NP_001186210.1	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1	265					cell surface receptor signaling pathway (GO:0007166)|chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of catalytic activity (GO:0043086)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)			breast(2)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(13)|liver(1)|lung(18)|ovary(5)|pancreas(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						TGCAGCCCATTCCTTTCTTCA	0.577																																					p.I265I		.											.	CABIN1-94	0			c.T795A						.						100.0	85.0	90.0					22																	24447425		2203	4300	6503	SO:0001819	synonymous_variant	23523	exon8			GCCCATTCCTTTC	AF072441	CCDS13823.1, CCDS74830.1	22q11.23	2008-09-16			ENSG00000099991	ENSG00000099991			24187	protein-coding gene	gene with protein product		604251				9655484, 9205841	Standard	NM_001199281		Approved	KIAA0330, PPP3IN	uc002zzi.1	Q9Y6J0	OTTHUMG00000150797	ENST00000398319.2:c.795T>A	22.37:g.24447425T>A		58	0		56	24	NM_001199281	0	0	0	0	0	G5E9F3|Q6PHY0|Q9Y460	Silent	SNP	ENST00000398319.2	37	CCDS13823.1																																																																																			.		0.577	CABIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320161.2	NM_012295	
DEPDC5	9681	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	32193641	32193641	+	Nonsense_Mutation	SNP	A	A	T			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr22:32193641A>T	ENST00000382112.3	+	12	893	c.823A>T	c.(823-825)Aaa>Taa	p.K275*	DEPDC5_ENST00000382111.2_Nonsense_Mutation_p.K275*|DEPDC5_ENST00000400242.3_Nonsense_Mutation_p.K275*|DEPDC5_ENST00000536766.1_Nonsense_Mutation_p.K247*|DEPDC5_ENST00000382105.2_Nonsense_Mutation_p.K275*|DEPDC5_ENST00000266091.3_Nonsense_Mutation_p.K275*|DEPDC5_ENST00000400249.2_Nonsense_Mutation_p.K275*|DEPDC5_ENST00000400246.1_Nonsense_Mutation_p.K275*|DEPDC5_ENST00000400248.2_Nonsense_Mutation_p.K275*|DEPDC5_ENST00000535622.1_Nonsense_Mutation_p.K275*	NM_001136029.2|NM_001242896.1	NP_001129501.1|NP_001229825.1	O75140	DEPD5_HUMAN	DEP domain containing 5	275					intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|perinuclear region of cytoplasm (GO:0048471)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(24)|ovary(5)|pancreas(2)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						CGTAACCATTAAAAAACTCTT	0.438																																					p.K275X		.											.	DEPDC5-519	0			c.A823T						.						83.0	84.0	84.0					22																	32193641		1902	4127	6029	SO:0001587	stop_gained	9681	exon13			ACCATTAAAAAAC	AB014545	CCDS43006.1, CCDS43007.1, CCDS46692.1, CCDS56229.1, CCDS74849.1	22q12.3	2013-04-29			ENSG00000100150	ENSG00000100150			18423	protein-coding gene	gene with protein product		614191				23542697, 23542701	Standard	NM_001242896		Approved	KIAA0645, DEP.5	uc011alu.2	O75140	OTTHUMG00000030926	ENST00000382112.3:c.823A>T	22.37:g.32193641A>T	ENSP00000371546:p.Lys275*	58	0		69	28	NM_001242897	0	0	0	0	0	A6H8V6|A8MPX9|B4DH93|B9EGN9|Q5K3V5|Q5THY9|Q5THZ0|Q5THZ1|Q5THZ3|Q68DR1|Q6MZX3|Q6PEZ1|Q9UGV8|Q9UH13	Nonsense_Mutation	SNP	ENST00000382112.3	37	CCDS46692.1	.	.	.	.	.	.	.	.	.	.	A	38	6.793795	0.97841	.	.	ENSG00000100150	ENST00000535622;ENST00000536766;ENST00000400242;ENST00000266091;ENST00000400249;ENST00000382109;ENST00000400246;ENST00000382105;ENST00000382112;ENST00000382111;ENST00000400248	.	.	.	5.05	5.05	0.67936	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.9647	0.64202	1.0:0.0:0.0:0.0	.	.	.	.	X	275;247;275;275;275;275;275;275;275;275;275	.	ENSP00000266091:K275X	K	+	1	0	DEPDC5	30523641	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.097000	0.94193	1.921000	0.55644	0.443000	0.29094	AAA	.		0.438	DEPDC5-006	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129087.1	NM_014662	
SOX10	6663	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	38374016	38374016	+	Silent	SNP	C	C	T			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr22:38374016C>T	ENST00000396884.2	-	3	837	c.555G>A	c.(553-555)caG>caA	p.Q185Q	POLR2F_ENST00000405557.1_Intron|POLR2F_ENST00000407936.1_Intron|SOX10_ENST00000470555.1_5'Flank|SOX10_ENST00000360880.2_Silent_p.Q185Q	NM_006941.3	NP_008872.1	P56693	SOX10_HUMAN	SRY (sex determining region Y)-box 10	185					anatomical structure morphogenesis (GO:0009653)|cell maturation (GO:0048469)|developmental growth (GO:0048589)|digestive tract morphogenesis (GO:0048546)|enteric nervous system development (GO:0048484)|in utero embryonic development (GO:0001701)|melanocyte differentiation (GO:0030318)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell migration (GO:0001755)|oligodendrocyte differentiation (GO:0048709)|peripheral nervous system development (GO:0007422)|positive regulation of gliogenesis (GO:0014015)|positive regulation of neuroblast proliferation (GO:0002052)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	extrinsic component of mitochondrial outer membrane (GO:0031315)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|transcription coactivator activity (GO:0003713)			NS(6)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(4)|skin(2)	20	Melanoma(58;0.045)					CCGCCTCGCCCTGGGCGGCCT	0.682																																					p.Q185Q	Melanoma(39;342 1098 6220 32775 40068)|GBM(21;140 497 5227 16059 19275)	.											.	SOX10-650	0			c.G555A						.						30.0	30.0	30.0					22																	38374016		2202	4300	6502	SO:0001819	synonymous_variant	6663	exon3			CTCGCCCTGGGCG		CCDS13964.1	22q13.1	2014-09-17			ENSG00000100146	ENSG00000100146		"""SRY (sex determining region Y)-boxes"""	11190	protein-coding gene	gene with protein product	"""dominant megacolon, mouse, human homolog of"""	602229				9462749, 10441344, 12944398	Standard	NM_006941		Approved	DOM, WS4, WS2E	uc003aun.1	P56693	OTTHUMG00000149913	ENST00000396884.2:c.555G>A	22.37:g.38374016C>T		65	0		67	19	NM_006941	0	0	0	0	0	B4DV62|Q6FHW7	Silent	SNP	ENST00000396884.2	37	CCDS13964.1	.	.	.	.	.	.	.	.	.	.	C	0.065	-1.215656	0.01542	.	.	ENSG00000100146	ENST00000446929	.	.	.	4.24	0.707	0.18139	.	.	.	.	.	T	0.50531	0.1621	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.34329	-0.9833	4	.	.	.	.	4.6565	0.12620	0.1228:0.6075:0.12:0.1497	.	.	.	.	K	62	.	.	R	-	2	0	SOX10	36703962	1.000000	0.71417	0.997000	0.53966	0.009000	0.06853	2.108000	0.41854	-0.014000	0.14175	-1.644000	0.00765	AGG	.		0.682	SOX10-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313875.1	NM_006941	
UPK3A	7380	broad.mit.edu	37	22	45683306	45683306	+	Silent	SNP	A	A	C	rs559806046	byFrequency	TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr22:45683306A>C	ENST00000216211.4	+	3	494	c.462A>C	c.(460-462)gcA>gcC	p.A154A	UPK3A_ENST00000396082.2_Intron	NM_006953.3	NP_008884.1	O75631	UPK3A_HUMAN	uroplakin 3A	154			A -> P (in dbSNP:rs1057353). {ECO:0000269|PubMed:9818021}.		cell morphogenesis (GO:0000902)|epithelial cell differentiation (GO:0030855)|kidney development (GO:0001822)|potassium ion homeostasis (GO:0055075)|sodium ion homeostasis (GO:0055078)|urea transport (GO:0015840)|urinary bladder development (GO:0060157)|water transport (GO:0006833)	apical plasma membrane (GO:0016324)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.A154A(1)		kidney(1)|large_intestine(1)|lung(2)|skin(1)	5		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)		TCTGTAACGCACCCCTGTCGG	0.602													A|||	27	0.00539137	0.0023	0.0043	5008	,	,		15928	0.0169		0.004	False		,,,				2504	0.0				p.A154A													.	UPK3A-90	1	Substitution - coding silent(1)	kidney(1)	c.A462C						.						21.0	16.0	18.0					22																	45683306		2132	4127	6259	SO:0001819	synonymous_variant	7380	exon3			TAACGCACCCCTG	AB010637	CCDS14064.1, CCDS54539.1	22q13.31	2005-11-14	2003-07-29	2003-07-30	ENSG00000100373	ENSG00000100373			12580	protein-coding gene	gene with protein product		611559	"""uroplakin 3"""	UPK3		9818021	Standard	NM_006953		Approved		uc003bfy.3	O75631	OTTHUMG00000151339	ENST00000216211.4:c.462A>C	22.37:g.45683306A>C		21	5		18	7	NM_006953	0	0	0	0	0	B0QY25|O60261|Q32N05|Q5TII6	Silent	SNP	ENST00000216211.4	37	CCDS14064.1																																																																																			.		0.602	UPK3A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000322276.1	NM_006953	
OGG1	4968	hgsc.bcm.edu;bcgsc.ca	37	3	9798228	9798228	+	Missense_Mutation	SNP	T	T	A			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr3:9798228T>A	ENST00000344629.7	+	5	1164	c.821T>A	c.(820-822)aTt>aAt	p.I274N	OGG1_ENST00000302008.8_Missense_Mutation_p.I274N|OGG1_ENST00000383826.5_Intron|OGG1_ENST00000302036.7_Missense_Mutation_p.I274N|OGG1_ENST00000339511.5_Missense_Mutation_p.I274N|OGG1_ENST00000349503.5_Intron|OGG1_ENST00000302003.7_Missense_Mutation_p.I274N|OGG1_ENST00000449570.2_Missense_Mutation_p.I274N			O15527	OGG1_HUMAN	8-oxoguanine DNA glycosylase	274					acute inflammatory response (GO:0002526)|base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|cellular response to cadmium ion (GO:0071276)|depurination (GO:0045007)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair (GO:0006289)|regulation of protein import into nucleus, translocation (GO:0033158)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to folic acid (GO:0051593)|response to oxidative stress (GO:0006979)|response to radiation (GO:0009314)	mitochondrion (GO:0005739)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	8-oxo-7,8-dihydroguanine DNA N-glycosylase activity (GO:0034039)|damaged DNA binding (GO:0003684)|endonuclease activity (GO:0004519)|oxidized purine nucleobase lesion DNA N-glycosylase activity (GO:0008534)			kidney(2)|large_intestine(2)|lung(2)|skin(1)|urinary_tract(1)	8	Medulloblastoma(99;0.227)					ATGTGGCACATTGCCCAACGT	0.602								Base excision repair (BER), DNA glycosylases																													p.I274N		.											.	OGG1-660	0			c.T821A						.						81.0	78.0	79.0					3																	9798228		2203	4300	6503	SO:0001583	missense	4968	exon5			GGCACATTGCCCA	U96710	CCDS2576.1, CCDS2577.1, CCDS2578.1, CCDS2579.1, CCDS2580.1, CCDS2581.1, CCDS43046.1, CCDS46742.1	3p26	2010-11-23			ENSG00000114026	ENSG00000114026	3.2.2.-, 4.2.99.18		8125	protein-coding gene	gene with protein product	"""8-hydroxyguanine DNA glycosylase"", ""OGG1 type 1e"", ""OGG1 type 1d"", ""OGG1 type 1g"", ""OGG1 type 1h"""	601982				9207108, 10449904	Standard	NM_002542		Approved	HMMH, HOGG1, OGH1, MUTM	uc003bsj.3	O15527	OTTHUMG00000097091	ENST00000344629.7:c.821T>A	3.37:g.9798228T>A	ENSP00000342851:p.Ile274Asn	77	0		79	31	NM_016819	0	0	13	13	0	A8K1E3|O00390|O00670|O00705|O14876|O95488|P78554|Q9BW42|Q9UIK0|Q9UIK1|Q9UIK2|Q9UL34|Q9Y2C0|Q9Y2C1|Q9Y6C3|Q9Y6C4	Missense_Mutation	SNP	ENST00000344629.7	37	CCDS2581.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.74|17.74	3.464569|3.464569	0.63513|0.63513	.|.	.|.	ENSG00000114026|ENSG00000114026	ENST00000302003;ENST00000344629;ENST00000302036;ENST00000339511;ENST00000449570;ENST00000302008|ENST00000441094;ENST00000416333	D;D;D;D;D;D|.	0.88046|.	-2.33;-2.33;-2.33;-2.33;-2.33;-2.33|.	5.43|5.43	5.43|5.43	0.79202|0.79202	HhH-GPD domain (2);DNA glycosylase (1);Helix-turn-helix, base-excision DNA repair, C-terminal (1);|.	0.044994|.	0.85682|.	D|.	0.000000|.	D|D	0.87124|0.87124	0.6099|0.6099	H|H	0.95745|0.95745	3.715|3.715	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0|.	D;D;D;D;D;D;D;D|.	0.97110|.	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0|.	D|D	0.91042|0.91042	0.4872|0.4872	10|5	0.87932|.	D|.	0|.	-15.1918|-15.1918	15.7624|15.7624	0.78096|0.78096	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	274;274;274;274;274;274;274;274|.	E5KPN1;O15527-3;E5KPM5;E5KPM7;E5KPM9;E5KPN0;O15527;O15527-2|.	.;.;.;.;.;.;OGG1_HUMAN;.|.	N|M	274|172;41	ENSP00000305584:I274N;ENSP00000342851:I274N;ENSP00000306561:I274N;ENSP00000345520:I274N;ENSP00000403598:I274N;ENSP00000305527:I274N|.	ENSP00000305584:I274N|.	I|L	+|+	2|1	0|2	OGG1|OGG1	9773228|9773228	1.000000|1.000000	0.71417|0.71417	0.970000|0.970000	0.41538|0.41538	0.135000|0.135000	0.20990|0.20990	7.054000|7.054000	0.76649|0.76649	2.176000|2.176000	0.68965|0.68965	0.533000|0.533000	0.62120|0.62120	ATT|TTG	.		0.602	OGG1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214223.2	NM_016821	
RAF1	5894	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	12633229	12633229	+	Missense_Mutation	SNP	T	T	A	rs368807126		TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr3:12633229T>A	ENST00000251849.4	-	11	1610	c.1171A>T	c.(1171-1173)Agg>Tgg	p.R391W	RAF1_ENST00000542177.1_Missense_Mutation_p.R310W|RAF1_ENST00000534997.1_Missense_Mutation_p.R176W|RAF1_ENST00000442415.2_Missense_Mutation_p.R411W	NM_002880.3	NP_002871.1	P04049	RAF1_HUMAN	Raf-1 proto-oncogene, serine/threonine kinase	391	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of adenylate cyclase activity (GO:0007190)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|death-inducing signaling complex assembly (GO:0071550)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|intermediate filament cytoskeleton organization (GO:0045104)|ion transmembrane transport (GO:0034220)|MAPK cascade (GO:0000165)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of protein complex assembly (GO:0031333)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of cell differentiation (GO:0045595)|regulation of cell motility (GO:2000145)|regulation of Rho protein signal transduction (GO:0035023)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|somatic stem cell maintenance (GO:0035019)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|pseudopodium (GO:0031143)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)		ESRP1/RAF1(4)|RAF1/DAZL(2)|SRGAP3/RAF1(6)	biliary_tract(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)	32					Dabrafenib(DB08912)|Regorafenib(DB08896)|Sorafenib(DB00398)	ACCTCATTCCTGAAGGCCTGG	0.507			T	SRGAP3	pilocytic astrocytoma				Noonan syndrome																												p.R391W		.		Dom	yes		3	3p25	5894	v-raf-1 murine leukemia viral oncogene homolog 1		M	.	RAF1-1404	0			c.A1171T						.	T	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	110.0	99.0	103.0		1171	4.0	1.0	3		103	0,8600		0,0,4300	no	missense	RAF1	NM_002880.3	101	0,1,6502	AA,AT,TT		0.0,0.0227,0.0077	probably-damaging	391/649	12633229	1,13005	2203	4300	6503	SO:0001583	missense	5894	exon11	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	CATTCCTGAAGGC	X03484	CCDS2612.1	3p25	2014-09-17	2014-06-26		ENSG00000132155	ENSG00000132155			9829	protein-coding gene	gene with protein product	"""C-Raf proto-oncogene, serine/threonine kinase"""	164760	"""v-raf-1 murine leukemia viral oncogene homolog 1"""			1611909	Standard	NM_002880		Approved	Raf-1, c-Raf, CRAF	uc003bxf.4	P04049	OTTHUMG00000129789	ENST00000251849.4:c.1171A>T	3.37:g.12633229T>A	ENSP00000251849:p.Arg391Trp	77	0		102	31	NM_002880	0	0	57	92	35	B0LPH8|B2R5N3|Q15278|Q9UC20	Missense_Mutation	SNP	ENST00000251849.4	37	CCDS2612.1	.	.	.	.	.	.	.	.	.	.	T	21.9	4.216060	0.79352	2.27E-4	0.0	ENSG00000132155	ENST00000251849;ENST00000442415;ENST00000432427;ENST00000534997;ENST00000542177	D;D;D;D;D	0.82893	-1.66;-1.66;-1.66;-1.66;-1.66	5.15	3.96	0.45880	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.84419	0.5468	L	0.28192	0.835	0.80722	D	1	D;D;D	0.71674	0.994;0.994;0.998	D;D;D	0.77557	0.99;0.985;0.99	D	0.85467	0.1170	10	0.87932	D	0	.	11.796	0.52100	0.0:0.0:0.2774:0.7226	.	310;176;391	B4E0X2;B4E1N6;P04049	.;.;RAF1_HUMAN	W	391;411;270;176;310	ENSP00000251849:R391W;ENSP00000401888:R411W;ENSP00000398591:R270W;ENSP00000441186:R176W;ENSP00000443567:R310W	ENSP00000251849:R391W	R	-	1	2	RAF1	12608229	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.865000	0.56033	1.047000	0.40274	0.533000	0.62120	AGG	.		0.507	RAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252015.2	NM_002880	
TOP2B	7155	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	25646332	25646332	+	Missense_Mutation	SNP	C	C	A			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr3:25646332C>A	ENST00000264331.4	-	33	4407	c.4408G>T	c.(4408-4410)Gat>Tat	p.D1470Y	TOP2B_ENST00000542520.1_Missense_Mutation_p.D322Y|TOP2B_ENST00000435706.2_Missense_Mutation_p.D1465Y|TOP2B_ENST00000540199.1_Missense_Mutation_p.D322Y	NM_001068.2	NP_001059.2	Q02880	TOP2B_HUMAN	topoisomerase (DNA) II beta 180kDa	1470					ATP catabolic process (GO:0006200)|axonogenesis (GO:0007409)|DNA topological change (GO:0006265)|DNA unwinding involved in DNA replication (GO:0006268)|forebrain development (GO:0030900)|mitotic DNA integrity checkpoint (GO:0044774)|mitotic recombination (GO:0006312)|neuron migration (GO:0001764)|resolution of meiotic recombination intermediates (GO:0000712)|sister chromatid segregation (GO:0000819)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|DNA topoisomerase complex (ATP-hydrolyzing) (GO:0009330)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein kinase C binding (GO:0005080)	p.D1465Y(1)		breast(2)|endometrium(5)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|skin(2)|stomach(1)	36					Dactinomycin(DB00970)|Daunorubicin(DB00694)|Dexrazoxane(DB00380)|Etoposide(DB00773)	GAAGCAGAATCTTCTTCATTA	0.313																																					p.D1465Y		.											.	TOP2B-273	1	Substitution - Missense(1)	large_intestine(1)	c.G4393T						.						118.0	110.0	112.0					3																	25646332		1811	4068	5879	SO:0001583	missense	7155	exon33			CAGAATCTTCTTC	X68060	CCDS46776.1	3p24.2	2012-08-30	2002-08-29		ENSG00000077097	ENSG00000077097	5.99.1.3		11990	protein-coding gene	gene with protein product		126431	"""topoisomerase (DNA) II beta (180kD)"""			1309226, 1333583	Standard	NM_001068		Approved		uc003cdj.3	Q02880	OTTHUMG00000155596	ENST00000264331.4:c.4408G>T	3.37:g.25646332C>A	ENSP00000264331:p.Asp1470Tyr	82	1		142	54	NM_001068	0	0	54	74	20	Q13600|Q9UMG8|Q9UQP8	Missense_Mutation	SNP	ENST00000264331.4	37		.	.	.	.	.	.	.	.	.	.	C	19.71	3.878740	0.72294	.	.	ENSG00000077097	ENST00000542520;ENST00000435706;ENST00000264331;ENST00000540199	T;T;T;T	0.49720	0.77;0.85;0.85;0.77	5.48	5.48	0.80851	.	0.262894	0.42964	D	0.000636	T	0.51261	0.1664	N	0.08118	0	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.83275	0.995;0.996	T	0.61744	-0.7000	10	0.66056	D	0.02	-20.2424	17.9046	0.88914	0.0:1.0:0.0:0.0	.	1470;1465	Q02880;Q02880-2	TOP2B_HUMAN;.	Y	322;1465;1470;322	ENSP00000446023:D322Y;ENSP00000396704:D1465Y;ENSP00000264331:D1470Y;ENSP00000437352:D322Y	ENSP00000264331:D1470Y	D	-	1	0	TOP2B	25621336	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.225000	0.65294	2.722000	0.93159	0.563000	0.77884	GAT	.		0.313	TOP2B-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding			
SCN10A	6336	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	38835251	38835251	+	Missense_Mutation	SNP	G	G	A	rs140609990		TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr3:38835251G>A	ENST00000449082.2	-	1	250	c.251C>T	c.(250-252)cCg>cTg	p.P84L		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	84					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	GCTGTAGAACGGATCTAGATC	0.572													G|||	1	0.000199681	0.0008	0.0	5008	,	,		12896	0.0		0.0	False		,,,				2504	0.0				p.P84L		.											.	SCN10A-99	0			c.C251T						.	G	LEU/PRO	6,4400	9.9+/-24.2	0,6,2197	154.0	158.0	157.0		251	5.2	1.0	3	dbSNP_134	157	0,8600		0,0,4300	yes	missense	SCN10A	NM_006514.2	98	0,6,6497	AA,AG,GG		0.0,0.1362,0.0461	possibly-damaging	84/1957	38835251	6,13000	2203	4300	6503	SO:0001583	missense	6336	exon1			TAGAACGGATCTA	AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.251C>T	3.37:g.38835251G>A	ENSP00000390600:p.Pro84Leu	212	0		316	94	NM_006514	0	0	0	0	0	A6NDQ1	Missense_Mutation	SNP	ENST00000449082.2	37	CCDS33736.1	.	.	.	.	.	.	.	.	.	.	G	14.95	2.689442	0.48097	0.001362	0.0	ENSG00000185313	ENST00000449082	D	0.96856	-4.15	5.19	5.19	0.71726	.	0.170309	0.52532	D	0.000066	D	0.96842	0.8969	M	0.91612	3.225	0.52501	D	0.999956	D	0.54601	0.967	B	0.41135	0.348	D	0.98036	1.0379	10	0.87932	D	0	.	18.9136	0.92496	0.0:0.0:1.0:0.0	.	84	Q9Y5Y9	SCNAA_HUMAN	L	84	ENSP00000390600:P84L	ENSP00000390600:P84L	P	-	2	0	SCN10A	38810255	1.000000	0.71417	0.997000	0.53966	0.163000	0.22366	9.575000	0.98187	2.704000	0.92352	0.563000	0.77884	CCG	G|1.000;A|0.000		0.572	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109745.3	NM_006514	
RNF123	63891	hgsc.bcm.edu	37	3	49725253	49725253	+	5'Flank	SNP	C	C	T			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr3:49725253C>T	ENST00000327697.6	+	0	0				MST1_ENST00000449682.2_Missense_Mutation_p.G58R|AC099668.5_ENST00000563780.1_RNA|MST1_ENST00000545762.1_Missense_Mutation_p.G44R|RNF123_ENST00000432042.1_5'Flank|MST1_ENST00000383728.3_Intron|MST1_ENST00000494828.2_Intron	NM_022064.3	NP_071347.2	Q5XPI4	RN123_HUMAN	ring finger protein 123						protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|Kidney(197;0.00227)|KIRC - Kidney renal clear cell carcinoma(197;0.00255)		TGCCAAGGCCCGGGCACCACC	0.607																																					p.G58R		.											.	MST1-278	0			c.G172A						.						28.0	27.0	27.0					3																	49725253		2203	4295	6498	SO:0001631	upstream_gene_variant	4485	exon2			AAGGCCCGGGCAC	AK022627	CCDS33758.1	3p24.3	2008-02-05			ENSG00000164068	ENSG00000164068		"""RING-type (C3HC4) zinc fingers"""	21148	protein-coding gene	gene with protein product		614472					Standard	NM_022064		Approved	FLJ12565	uc003cxh.4	Q5XPI4	OTTHUMG00000156891		3.37:g.49725253C>T	Exception_encountered	95	1		96	5	NM_020998	0	0	16	16	0	A1L4Q3|A6NLS5|Q5I022|Q6PFW4|Q71RH0|Q8IW18|Q9H0M8|Q9H5L8|Q9H9T2	Missense_Mutation	SNP	ENST00000327697.6	37	CCDS33758.1	.	.	.	.	.	.	.	.	.	.	C	2.518	-0.311453	0.05422	.	.	ENSG00000173531	ENST00000449682;ENST00000545762	T;T	0.63580	-0.05;-0.05	5.3	-5.56	0.02529	.	1.093190	0.07160	N	0.850623	T	0.40932	0.1137	L	0.36672	1.1	0.09310	N	1	P;B	0.38642	0.641;0.067	B;B	0.33521	0.165;0.037	T	0.31558	-0.9939	10	0.10902	T	0.67	.	8.1541	0.31158	0.104:0.3551:0.0:0.5409	.	44;58	B7Z538;G3XAK1	.;.	R	58;44	ENSP00000414287:G58R;ENSP00000437535:G44R	ENSP00000411117:G58R	G	-	1	0	MST1	49700257	0.000000	0.05858	0.001000	0.08648	0.396000	0.30629	-0.844000	0.04345	-0.784000	0.04528	-0.218000	0.12543	GGG	.		0.607	RNF123-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346475.2	NM_022064	
ATP6V1A	523	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	113503595	113503595	+	Missense_Mutation	SNP	C	C	G			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr3:113503595C>G	ENST00000273398.3	+	5	587	c.479C>G	c.(478-480)tCg>tGg	p.S160W	ATP6V1A_ENST00000538620.1_Missense_Mutation_p.S127W	NM_001690.3	NP_001681.2	P38606	VATA_HUMAN	ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A	160					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|microvillus (GO:0005902)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|proton-transporting two-sector ATPase complex (GO:0016469)|proton-transporting V-type ATPase, V1 domain (GO:0033180)	ATP binding (GO:0005524)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34					Alendronate(DB00630)|Etidronic acid(DB01077)|Tiludronate(DB01133)	AGTGAGAACTCGCTTATCAAA	0.368																																					p.S160W		.											.	ATP6V1A-93	0			c.C479G						.						121.0	116.0	118.0					3																	113503595		2203	4300	6503	SO:0001583	missense	523	exon5			AGAACTCGCTTAT	L09235	CCDS2976.1	3q13.31	2010-04-21	2002-08-29	2003-04-25	ENSG00000114573	ENSG00000114573	3.6.3.14	"""ATPases / V-type"""	851	protein-coding gene	gene with protein product		607027	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump), alpha polypeptide, 70kD, isoform 1"""	VPP2, ATP6A1, ATP6V1A1		8463241	Standard	NM_001690		Approved	Vma1, VA68	uc003eao.3	P38606	OTTHUMG00000159295	ENST00000273398.3:c.479C>G	3.37:g.113503595C>G	ENSP00000273398:p.Ser160Trp	125	0		171	58	NM_001690	0	0	27	46	19	B2RBR8|B7Z1R5|D3DN75|Q53YD9|Q96DY6|Q9UHY3	Missense_Mutation	SNP	ENST00000273398.3	37	CCDS2976.1	.	.	.	.	.	.	.	.	.	.	C	18.49	3.634753	0.67130	.	.	ENSG00000114573	ENST00000273398;ENST00000538620;ENST00000496747;ENST00000475322	D;T	0.86956	-2.19;-1.41	6.07	5.2	0.72013	.	0.000000	0.85682	D	0.000000	D	0.92502	0.7619	M	0.78916	2.43	0.80722	D	1	D	0.64830	0.994	P	0.61397	0.888	D	0.93432	0.6786	10	0.87932	D	0	-10.5657	15.5979	0.76602	0.0:0.9341:0.0:0.0659	.	160	P38606	VATA_HUMAN	W	160;127;127;160	ENSP00000273398:S160W;ENSP00000439874:S127W	ENSP00000273398:S160W	S	+	2	0	ATP6V1A	114986285	1.000000	0.71417	0.905000	0.35620	0.616000	0.37450	7.253000	0.78320	1.578000	0.49821	0.655000	0.94253	TCG	.		0.368	ATP6V1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354457.1	NM_001690	
RUFY3	22902	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	71659564	71659564	+	IGR	SNP	A	A	G			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr4:71659564A>G	ENST00000226328.4	+	0	4233				RUFY3_ENST00000381006.3_Missense_Mutation_p.D467G|RUFY3_ENST00000502653.1_Missense_Mutation_p.D414G	NM_014961.3	NP_055776.1	Q7L099	RUFY3_HUMAN	RUN and FYVE domain containing 3						negative regulation of axonogenesis (GO:0050771)	filopodium (GO:0030175)|growth cone (GO:0030426)				endometrium(1)|kidney(3)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)	16		all_hematologic(202;0.248)	Lung(101;0.235)			TTCAAACAGGACTTTGGAGAC	0.527																																					p.D467G		.											.	RUFY3-90	0			c.A1400G						.						52.0	48.0	50.0					4																	71659564		2203	4300	6503	SO:0001628	intergenic_variant	22902	exon13			AACAGGACTTTGG	AF112221	CCDS3547.1, CCDS34001.1, CCDS47068.1, CCDS75138.1	4q13.3	2009-05-29			ENSG00000018189	ENSG00000018189		"""Zinc fingers, FYVE domain containing"""	30285	protein-coding gene	gene with protein product	"""single axon-related 1"""	611194				17439943	Standard	NM_001130709		Approved	RIPx, KIAA0871, Singar1	uc003hfr.3	Q7L099	OTTHUMG00000129910		4.37:g.71659564A>G		83	0		99	34	NM_001037442	0	0	5	11	6	B3KM25|B4DYW7|D9N163|O94948|Q9UI00	Missense_Mutation	SNP	ENST00000226328.4	37	CCDS3547.1	.	.	.	.	.	.	.	.	.	.	A	18.32	3.597113	0.66332	.	.	ENSG00000018189	ENST00000381006;ENST00000502653	T;T	0.08720	3.06;3.06	5.87	5.87	0.94306	.	0.237818	0.42294	D	0.000726	T	0.10508	0.0257	.	.	.	0.80722	D	1	B	0.31548	0.328	B	0.31101	0.124	T	0.04900	-1.0919	9	0.51188	T	0.08	-8.0298	16.2631	0.82557	1.0:0.0:0.0:0.0	.	467	Q7L099-3	.	G	467;414	ENSP00000370394:D467G;ENSP00000425400:D414G	ENSP00000370394:D467G	D	+	2	0	RUFY3	71878428	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	8.930000	0.92872	2.239000	0.73571	0.528000	0.53228	GAC	.		0.527	RUFY3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252161.2	NM_014961	
CDKL2	8999	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	76532405	76532405	+	Silent	SNP	T	T	C			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr4:76532405T>C	ENST00000429927.2	-	4	1207	c.504A>G	c.(502-504)agA>agG	p.R168R	CDKL2_ENST00000307465.4_Silent_p.R168R	NM_003948.3	NP_003939.1	Q92772	CDKL2_HUMAN	cyclin-dependent kinase-like 2 (CDC2-related kinase)	168	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				sex differentiation (GO:0007548)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)			breast(3)|endometrium(1)|large_intestine(4)|lung(6)|ovary(2)|prostate(2)|skin(2)|stomach(2)	22			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			GTTCTGGAGCTCTGTACCATC	0.453																																					p.R168R		.											.	CDKL2-454	0			c.A504G						.						98.0	93.0	95.0					4																	76532405		2203	4300	6503	SO:0001819	synonymous_variant	8999	exon4			TGGAGCTCTGTAC	U35146	CCDS3570.1	4q21.21	2011-11-04			ENSG00000138769	ENSG00000138769		"""Cyclin-dependent kinases"""	1782	protein-coding gene	gene with protein product		603442				9000130	Standard	NM_003948		Approved	P56, KKIAMRE	uc003hiq.3	Q92772	OTTHUMG00000130103	ENST00000429927.2:c.504A>G	4.37:g.76532405T>C		98	1		124	44	NM_003948	0	0	2	3	1	B2R695	Silent	SNP	ENST00000429927.2	37	CCDS3570.1																																																																																			.		0.453	CDKL2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252409.2	NM_003948	
TIGD2	166815	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	90035227	90035227	+	Nonsense_Mutation	SNP	G	G	T			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr4:90035227G>T	ENST00000317005.2	+	1	1260	c.1102G>T	c.(1102-1104)Gaa>Taa	p.E368*	RP11-84C13.1_ENST00000603357.1_lincRNA|FAM13A_ENST00000502459.1_5'Flank	NM_145715.2	NP_663761.1	Q4W5G0	TIGD2_HUMAN	tigger transposable element derived 2	368	DDE.					nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	14		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;3.86e-05)		TGCAATTTATGAAGTGTCAAG	0.363																																					p.E368X		.											.	TIGD2-90	0			c.G1102T						.						81.0	80.0	80.0					4																	90035227		2203	4300	6503	SO:0001587	stop_gained	166815	exon1			ATTTATGAAGTGT	AK027653	CCDS3633.1	4q21.3	2013-02-21			ENSG00000180346	ENSG00000180346			18333	protein-coding gene	gene with protein product		612973					Standard	NM_145715		Approved		uc003hsk.3	Q4W5G0	OTTHUMG00000130946	ENST00000317005.2:c.1102G>T	4.37:g.90035227G>T	ENSP00000317170:p.Glu368*	54	0		103	31	NM_145715	0	0	9	11	2		Nonsense_Mutation	SNP	ENST00000317005.2	37	CCDS3633.1	.	.	.	.	.	.	.	.	.	.	G	35	5.519555	0.96416	.	.	ENSG00000180346	ENST00000317005	.	.	.	4.36	3.47	0.39725	.	0.000000	0.43110	D	0.000607	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	-9.209	6.0713	0.19891	0.1044:0.193:0.7026:0.0	.	.	.	.	X	368	.	ENSP00000317170:E368X	E	+	1	0	TIGD2	90254250	1.000000	0.71417	0.996000	0.52242	0.956000	0.61745	2.543000	0.45752	2.264000	0.75181	0.460000	0.39030	GAA	.		0.363	TIGD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253545.2	NM_145715	
PCDH18	54510	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	138450855	138450855	+	Silent	SNP	G	G	A			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr4:138450855G>A	ENST00000344876.4	-	1	2774	c.2388C>T	c.(2386-2388)caC>caT	p.H796H	PCDH18_ENST00000511115.1_Intron|PCDH18_ENST00000412923.2_Silent_p.H796H|PCDH18_ENST00000507846.1_Silent_p.H576H|PCDH18_ENST00000510305.1_Silent_p.H7H	NM_019035.3	NP_061908.1	Q9HCL0	PCD18_HUMAN	protocadherin 18	796					brain development (GO:0007420)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(27)|lung(21)|ovary(2)|pancreas(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86	all_hematologic(180;0.24)					GGTGACTGTTGTGACTCTGCC	0.498																																					p.H796H		.											.	PCDH18-185	0			c.C2388T						.						125.0	109.0	114.0					4																	138450855		2203	4300	6503	SO:0001819	synonymous_variant	54510	exon1			ACTGTTGTGACTC	AL137471	CCDS34064.1, CCDS75193.1	4q28.3	2010-01-26			ENSG00000189184	ENSG00000189184		"""Cadherins / Protocadherins : Non-clustered"""	14268	protein-coding gene	gene with protein product		608287				10835267, 11549318	Standard	XM_005263070		Approved	KIAA1562, PCDH68L	uc003ihe.4	Q9HCL0	OTTHUMG00000161348	ENST00000344876.4:c.2388C>T	4.37:g.138450855G>A		69	0		97	44	NM_019035	0	0	1	1	0	A8K7K3|B7ZKT1|Q52LS2	Silent	SNP	ENST00000344876.4	37	CCDS34064.1																																																																																			.		0.498	PCDH18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364614.1	NM_019035	
ABCE1	6059	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	146041306	146041306	+	Splice_Site	SNP	G	G	A			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr4:146041306G>A	ENST00000296577.4	+	11	1659		c.e11+1		ABCE1_ENST00000502803.1_Splice_Site|OTUD4_ENST00000455611.2_Intron	NM_001040876.1|NM_002940.2	NP_001035809.1|NP_002931.2	P61221	ABCE1_HUMAN	ATP-binding cassette, sub-family E (OABP), member 1						negative regulation of catalytic activity (GO:0043086)|response to virus (GO:0009615)|RNA catabolic process (GO:0006401)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|iron-sulfur cluster binding (GO:0051536)|ribonuclease inhibitor activity (GO:0008428)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|lung(5)|prostate(2)|skin(3)	18	all_hematologic(180;0.151)					GGGGAAAATGGTAAGTTTTCT	0.313																																					.		.											.	ABCE1-91	0			c.1144+1G>A						.						66.0	72.0	70.0					4																	146041306		2203	4296	6499	SO:0001630	splice_region_variant	6059	exon11			AAAATGGTAAGTT	X74987	CCDS34071.1	4q31	2012-03-14			ENSG00000164163	ENSG00000164163		"""ATP binding cassette transporters / subfamily E"""	69	protein-coding gene	gene with protein product		601213		RNASEL1, RNASELI, RNS4I		7539425	Standard	NM_002940		Approved	RLI, OABP	uc003ijy.3	P61221	OTTHUMG00000161478	ENST00000296577.4:c.1144+1G>A	4.37:g.146041306G>A		62	0		95	33	NM_002940	0	0	0	2	2	O88793|Q13181|Q13864|Q6NR76|Q96AL0|Q96B10|Q99K66	Splice_Site	SNP	ENST00000296577.4	37	CCDS34071.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.276838	0.80580	.	.	ENSG00000164163	ENST00000296577	.	.	.	5.31	5.31	0.75309	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.3284	0.94273	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ABCE1	146260756	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	9.869000	0.99810	2.623000	0.88846	0.555000	0.69702	.	.		0.313	ABCE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365104.1	NM_002940	Intron
DDR1	780	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	30857025	30857025	+	Missense_Mutation	SNP	G	G	A			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr6:30857025G>A	ENST00000324771.8	+	6	783	c.235G>A	c.(235-237)Gtg>Atg	p.V79M	DDR1_ENST00000513240.1_Missense_Mutation_p.V79M|DDR1_ENST00000508312.1_Missense_Mutation_p.V97M|MIR4640_ENST00000581824.1_RNA|DDR1_ENST00000376575.3_Missense_Mutation_p.V79M|DDR1_ENST00000376567.2_Missense_Mutation_p.V79M|DDR1_ENST00000376570.4_Missense_Mutation_p.V79M|DDR1_ENST00000446312.1_Missense_Mutation_p.V79M|DDR1_ENST00000361741.4_5'Flank|DDR1_ENST00000376569.3_Missense_Mutation_p.V79M|DDR1_ENST00000454612.2_Missense_Mutation_p.V79M|DDR1_ENST00000452441.1_Missense_Mutation_p.V79M|DDR1_ENST00000418800.2_Missense_Mutation_p.V79M|DDR1_ENST00000376568.3_Missense_Mutation_p.V79M			Q08345	DDR1_HUMAN	discoidin domain receptor tyrosine kinase 1	79	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				branching involved in mammary gland duct morphogenesis (GO:0060444)|cell adhesion (GO:0007155)|collagen-activated tyrosine kinase receptor signaling pathway (GO:0038063)|ear development (GO:0043583)|embryo implantation (GO:0007566)|extracellular matrix organization (GO:0030198)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine autophosphorylation (GO:0038083)|protein autophosphorylation (GO:0046777)|regulation of cell growth (GO:0001558)|regulation of cell-matrix adhesion (GO:0001952)|regulation of extracellular matrix disassembly (GO:0010715)|smooth muscle cell migration (GO:0014909)|smooth muscle cell-matrix adhesion (GO:0061302)|wound healing, spreading of cells (GO:0044319)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|collagen binding (GO:0005518)|metal ion binding (GO:0046872)|protein tyrosine kinase collagen receptor activity (GO:0038062)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(14)|ovary(1)|prostate(1)|skin(1)	29					Imatinib(DB00619)	CGCAGGGTCGGTGTTTCCCAA	0.647																																					p.V97M		.											.	DDR1-1403	0			c.G289A						.						174.0	186.0	181.0					6																	30857025		1511	2709	4220	SO:0001583	missense	780	exon4			GGGTCGGTGTTTC	X99031	CCDS4690.1, CCDS34385.1, CCDS47396.1, CCDS56411.1, CCDS75419.1	6p21.33	2010-02-17	2008-01-23		ENSG00000204580	ENSG00000204580	2.7.10.1	"""CD molecules"""	2730	protein-coding gene	gene with protein product		600408	"""discoidin domain receptor family, member 1"""	NTRK4, PTK3A, NEP, CAK, EDDR1		7789998	Standard	NM_001954		Approved	RTK6, CD167	uc003nrv.3	Q08345	OTTHUMG00000031236	ENST00000324771.8:c.235G>A	6.37:g.30857025G>A	ENSP00000318217:p.Val79Met	384	0		482	150	NM_001202523	0	0	124	270	146	B5A975|B5A976|B7Z2K0|Q14196|Q16562|Q2L6H3|Q4LE50|Q5ST11|Q5ST12|Q6NSK4|Q9UD35|Q9UD36|Q9UD37|Q9UD86|Q9UDL2	Missense_Mutation	SNP	ENST00000324771.8	37	CCDS34385.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.45|16.45	3.125934|3.125934	0.56721|0.56721	.|.	.|.	ENSG00000204580|ENSG00000204580	ENST00000424544|ENST00000505066;ENST00000460944;ENST00000324771;ENST00000505534;ENST00000508317;ENST00000418800;ENST00000509639;ENST00000454612;ENST00000437124;ENST00000396342;ENST00000512694;ENST00000515233;ENST00000515881;ENST00000376569;ENST00000511510;ENST00000376575;ENST00000376570;ENST00000446312;ENST00000504927;ENST00000428153;ENST00000376568;ENST00000452441;ENST00000508312;ENST00000512336;ENST00000421124;ENST00000512725;ENST00000504679;ENST00000503495;ENST00000376567;ENST00000513240	.|D;D;D;D;D;D;D;D;D;D;D;D;T;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	.|0.98987	.|-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;0.66;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3	4.84|4.84	4.84|4.84	0.62591|0.62591	.|Coagulation factor 5/8 C-terminal type domain (4);Galactose-binding domain-like (1);	.|0.156961	.|0.41396	.|D	.|0.000884	D|D	0.98729|0.98729	0.9573|0.9573	M|M	0.67517|0.67517	2.055|2.055	0.20563|0.20563	N|N	0.99989|0.99989	.|D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0;1.0	.|D;D;D;D;D	.|0.97110	.|0.973;0.984;0.998;0.976;1.0	D|D	0.95690|0.95690	0.8739|0.8739	5|10	.|0.87932	.|D	.|0	.|.	11.2046|11.2046	0.48762|0.48762	0.0:0.1855:0.8145:0.0|0.0:0.1855:0.8145:0.0	.|.	.|79;105;97;79;79	.|Q08345-4;B7Z3A2;B7Z2K0;Q08345-5;Q08345	.|.;.;.;.;DDR1_HUMAN	D|M	62|79;79;79;79;79;79;79;79;79;79;79;79;79;79;79;79;79;79;79;79;79;79;97;79;79;79;79;105;79;79	.|ENSP00000421189:V79M;ENSP00000426420:V79M;ENSP00000318217:V79M;ENSP00000420833:V79M;ENSP00000427369:V79M;ENSP00000407699:V79M;ENSP00000422331:V79M;ENSP00000406091:V79M;ENSP00000394273:V79M;ENSP00000379631:V79M;ENSP00000426229:V79M;ENSP00000422467:V79M;ENSP00000423492:V79M;ENSP00000365753:V79M;ENSP00000425113:V79M;ENSP00000365759:V79M;ENSP00000365754:V79M;ENSP00000405998:V79M;ENSP00000427597:V79M;ENSP00000390593:V79M;ENSP00000365752:V79M;ENSP00000405039:V79M;ENSP00000422442:V97M;ENSP00000421719:V79M;ENSP00000409682:V79M;ENSP00000422108:V79M;ENSP00000423906:V79M;ENSP00000423749:V105M;ENSP00000365751:V79M;ENSP00000427552:V79M	.|ENSP00000318217:V79M	G|V	+|+	2|1	0|0	DDR1|DDR1	30965004|30965004	1.000000|1.000000	0.71417|0.71417	0.415000|0.415000	0.26534|0.26534	0.938000|0.938000	0.57974|0.57974	4.107000|4.107000	0.57811|0.57811	2.509000|2.509000	0.84616|0.84616	0.305000|0.305000	0.20034|0.20034	GGT|GTG	.		0.647	DDR1-005	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076494.3	NM_013994	
PREP	5550	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	105825364	105825364	+	Missense_Mutation	SNP	C	C	G			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr6:105825364C>G	ENST00000369110.3	-	3	343	c.151G>C	c.(151-153)Gtg>Ctg	p.V51L		NM_002726.4	NP_002717.3	P48147	PPCE_HUMAN	prolyl endopeptidase	51					proteolysis (GO:0006508)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)|serine-type peptidase activity (GO:0008236)	p.V51L(1)		breast(1)|endometrium(2)|large_intestine(7)|lung(12)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	29		all_cancers(87;0.000128)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0344)|Lung NSC(302;0.191)|Colorectal(196;0.202)			Oxytocin(DB00107)	AGAAATGGCACAGTAATCTTA	0.353																																					p.V51L		.											.	PREP-93	1	Substitution - Missense(1)	lung(1)	c.G151C						.						95.0	93.0	94.0					6																	105825364		2203	4300	6503	SO:0001583	missense	5550	exon3			ATGGCACAGTAAT		CCDS5053.1	6q22	2008-02-05			ENSG00000085377	ENSG00000085377	3.4.21.26		9358	protein-coding gene	gene with protein product		600400				7959018	Standard	NM_002726		Approved		uc003prc.3	P48147	OTTHUMG00000015297	ENST00000369110.3:c.151G>C	6.37:g.105825364C>G	ENSP00000358106:p.Val51Leu	100	0		173	62	NM_002726	0	0	9	15	6	Q8N6D4	Missense_Mutation	SNP	ENST00000369110.3	37	CCDS5053.1	.	.	.	.	.	.	.	.	.	.	C	12.02	1.812019	0.32053	.	.	ENSG00000085377	ENST00000369110	T	0.44881	0.91	5.76	4.89	0.63831	Peptidase S9A/B/C, oligopeptidase, N-terminal beta-propeller (2);	0.241940	0.41823	D	0.000804	T	0.07098	0.0180	N	0.01352	-0.895	0.39317	D	0.965174	B	0.02656	0.0	B	0.01281	0.0	T	0.15065	-1.0450	10	0.25751	T	0.34	-16.8555	10.4377	0.44445	0.0:0.8553:0.0:0.1447	.	51	P48147	PPCE_HUMAN	L	51	ENSP00000358106:V51L	ENSP00000358106:V51L	V	-	1	0	PREP	105932057	0.730000	0.28100	0.982000	0.44146	0.979000	0.70002	1.374000	0.34283	2.700000	0.92200	0.650000	0.86243	GTG	.		0.353	PREP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041658.1		
ROS1	6098	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	117622147	117622147	+	Missense_Mutation	SNP	T	T	G			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr6:117622147T>G	ENST00000368508.3	-	42	6921	c.6723A>C	c.(6721-6723)gaA>gaC	p.E2241D	RN7SKP51_ENST00000410781.1_RNA|RN7SKP18_ENST00000516005.1_RNA|ROS1_ENST00000368507.3_Missense_Mutation_p.E2235D	NM_002944.2	NP_002935.2	P08922	ROS1_HUMAN	ROS proto-oncogene 1 , receptor tyrosine kinase	2241					cell differentiation (GO:0030154)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|columnar/cuboidal epithelial cell development (GO:0002066)|negative regulation of gene expression (GO:0010629)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of phosphate transport (GO:0010966)|regulation of TOR signaling (GO:0032006)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		TPM3_ENST00000368530/ROS1(4)|LRIG3/ROS1(2)|CD74_ENST00000009530/ROS1(32)|SLC34A2/ROS1(14)|EZR/ROS1(4)|GOPC/ROS1(14)|SDC4/ROS1(7)	NS(2)|breast(7)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(28)|lung(56)|ovary(8)|prostate(5)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	162		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		CTTCAAAGCTTTCATTTATGA	0.333			T	"""GOPC, SDC4, SLC34A2, EZR, LRIG3"""	"""glioblastoma, NSCLC"""																																p.E2241D		.		Dom	yes		6	6q22	6098	v-ros UR2 sarcoma virus oncogene homolog 1 (avian)		"""O, E"""	.	ROS1-1353	0			c.A6723C						.						77.0	74.0	75.0					6																	117622147		2203	4300	6503	SO:0001583	missense	6098	exon42			AAAGCTTTCATTT	M13599	CCDS5116.1	6q21-q22	2014-06-26	2014-06-26		ENSG00000047936	ENSG00000047936		"""Fibronectin type III domain containing"""	10261	protein-coding gene	gene with protein product		165020	"""v-ros avian UR2 sarcoma virus oncogene homolog 1"", ""v-ros UR2 sarcoma virus oncogene homolog 1 (avian)"", ""c-ros oncogene 1 , receptor tyrosine kinase"""			1611909	Standard	NM_002944		Approved	MCF3, ROS, c-ros-1	uc003pxp.1	P08922	OTTHUMG00000016188	ENST00000368508.3:c.6723A>C	6.37:g.117622147T>G	ENSP00000357494:p.Glu2241Asp	76	0		109	38	NM_002944	0	0	0	0	0	Q15368|Q5TDB5	Missense_Mutation	SNP	ENST00000368508.3	37	CCDS5116.1	.	.	.	.	.	.	.	.	.	.	T	11.69	1.713310	0.30413	.	.	ENSG00000047936	ENST00000368508;ENST00000368507	T;T	0.71341	-0.56;-0.56	4.98	1.37	0.22104	.	0.267889	0.32190	N	0.006450	T	0.30823	0.0777	L	0.27053	0.805	0.23174	N	0.998172	B	0.24963	0.115	B	0.20577	0.03	T	0.18871	-1.0323	10	0.30854	T	0.27	.	7.4549	0.27261	0.0:0.2549:0.0:0.7451	.	2241	P08922	ROS1_HUMAN	D	2241;2235	ENSP00000357494:E2241D;ENSP00000357493:E2235D	ENSP00000357493:E2235D	E	-	3	2	ROS1	117728840	0.999000	0.42202	0.996000	0.52242	0.448000	0.32197	0.295000	0.19065	0.439000	0.26476	0.459000	0.35465	GAA	.		0.333	ROS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043464.1		
RAET1L	154064	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	150342042	150342042	+	Splice_Site	SNP	T	T	A			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr6:150342042T>A	ENST00000367341.1	-	3	629	c.630A>T	c.(628-630)ggA>ggT	p.G210G	RAET1L_ENST00000286380.2_Splice_Site_p.G210G			Q5VY80	RET1L_HUMAN	retinoic acid early transcript 1L	210	MHC class I alpha-2 like. {ECO:0000250}.				antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				endometrium(1)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	5		Ovarian(120;0.028)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;2.4e-12)		TCCTGTTACCTCCTGCACTTG	0.468																																					p.G210G		.											.	RAET1L-90	0			c.A630T						.						129.0	129.0	129.0					6																	150342042		2203	4300	6503	SO:0001630	splice_region_variant	154064	exon3			GTTACCTCCTGCA	AY039682	CCDS5224.1	6q24.1-25.1	2008-02-05			ENSG00000155918	ENSG00000155918			16798	protein-coding gene	gene with protein product		611047				11827464	Standard	NM_130900		Approved		uc011eei.2	Q5VY80	OTTHUMG00000015809	ENST00000367341.1:c.631+1A>T	6.37:g.150342042T>A		182	1		235	84	NM_130900	0	0	0	0	0	A3KME4|Q8TE74	Silent	SNP	ENST00000367341.1	37	CCDS5224.1																																																																																			.		0.468	RAET1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042676.1	NM_130900	Silent
POM121C	100101267	broad.mit.edu;bcgsc.ca	37	7	75045841	75045841	+	IGR	SNP	A	A	G			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr7:75045841A>G	ENST00000257665.5	-	0	5700				NSUN5P1_ENST00000393633.2_RNA			A8CG34	P121C_HUMAN	POM121 transmembrane nucleoporin C						mRNA transport (GO:0051028)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|nuclear pore (GO:0005643)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|skin(1)|urinary_tract(1)	14						GAGACAGCAAAGAGCCGCAGC	0.572																																					.													.	NSUN5P1-22	0			.						.						64.0	63.0	64.0					7																	75045841		2203	4298	6501	SO:0001628	intergenic_variant	155400	.			CAGCAAAGAGCCG		CCDS47617.1	7q11.23	2012-03-13	2012-03-13		ENSG00000135213	ENSG00000272391			34005	protein-coding gene	gene with protein product		615754	"""POM121 membrane glycoprotein C"""			17900573	Standard	NM_001099415		Approved		uc003udk.4	A8CG34	OTTHUMG00000156238		7.37:g.75045841A>G		136	0		203	88	.	0	0	44	62	18	O75115|Q9Y2N3|Q9Y4S7	RNA	SNP	ENST00000257665.5	37																																																																																				.		0.572	POM121C-003	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000343919.2	NM_001099415	
ZAN	7455	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	100383746	100383746	+	RNA	SNP	G	G	T			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr7:100383746G>T	ENST00000348028.3	+	0	7126				ZAN_ENST00000449052.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000421100.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000427578.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			AACAGCAACAGCAATTGTGTC	0.632																																					.													.	ZAN-142	0			.						.						102.0	105.0	104.0					7																	100383746		1978	4178	6156			7455	.			GCAACAGCAATTG	U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100383746G>T		202	1		282	138	.	0	0	0	0	0	A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Missense_Mutation	SNP	ENST00000348028.3	37		.	.	.	.	.	.	.	.	.	.	G	10.27	1.303037	0.23736	.	.	ENSG00000146839	ENST00000546292;ENST00000538115;ENST00000542585;ENST00000546213	T;T;T;T	0.05925	3.37;3.37;3.37;3.37	4.59	0.255	0.15561	von Willebrand factor, type C (1);von Willebrand factor, type D domain (1);	1.390360	0.04747	N	0.423915	T	0.11239	0.0274	.	.	.	0.09310	N	1	D;D;D	0.61697	0.987;0.987;0.99	P;P;P	0.62298	0.838;0.838;0.9	T	0.35101	-0.9802	9	0.16896	T	0.51	.	3.5726	0.07922	0.3486:0.1924:0.459:0.0	.	794;2320;2321	F5GX59;F5H0T8;Q9Y493	.;.;ZAN_HUMAN	I	2320;2320;2320;794	ENSP00000445943:S2320I;ENSP00000445091:S2320I;ENSP00000444427:S2320I;ENSP00000441117:S794I	ENSP00000445091:S2320I	S	+	2	0	ZAN	100221682	0.000000	0.05858	0.000000	0.03702	0.025000	0.11179	-0.036000	0.12185	0.212000	0.20703	0.655000	0.94253	AGC	.		0.632	ZAN-006	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000347214.1	NM_003386	
MUC17	140453	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	100692247	100692247	+	Silent	SNP	G	G	A	rs200175178		TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr7:100692247G>A	ENST00000306151.4	+	5	12721	c.12657G>A	c.(12655-12657)acG>acA	p.T4219T		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	4219	SEA. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					AGACATTCACGGAACAGGTAA	0.507													G|||	1	0.000199681	0.0	0.0	5008	,	,		18356	0.001		0.0	False		,,,				2504	0.0				p.T4219T		.											.	MUC17-95	0			c.G12657A						.	G		1,4405	2.1+/-5.4	0,1,2202	74.0	66.0	68.0		12657	-8.8	0.0	7		68	0,8600		0,0,4300	no	coding-synonymous	MUC17	NM_001040105.1		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		4219/4494	100692247	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	140453	exon5			ATTCACGGAACAG	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.12657G>A	7.37:g.100692247G>A		73	0		135	47	NM_001040105	0	0	0	0	0	O14761|Q685J2|Q8TDH7	Silent	SNP	ENST00000306151.4	37	CCDS34711.1																																																																																			G|0.999;A|0.000		0.507	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
ASB15	142685	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	123264837	123264837	+	Missense_Mutation	SNP	C	C	A			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr7:123264837C>A	ENST00000451558.1	+	10	1187	c.666C>A	c.(664-666)caC>caA	p.H222Q	ASB15_ENST00000451215.1_Missense_Mutation_p.H222Q|RP11-390E23.3_ENST00000451016.1_RNA|RP11-390E23.3_ENST00000429396.1_RNA|ASB15_ENST00000540573.1_Missense_Mutation_p.H222Q|ASB15_ENST00000275699.3_Missense_Mutation_p.H222Q|RP11-390E23.3_ENST00000440504.1_RNA|RP11-390E23.3_ENST00000418409.1_RNA|RP11-390E23.3_ENST00000422401.1_RNA|ASB15_ENST00000434204.1_Missense_Mutation_p.H222Q			Q8WXK1	ASB15_HUMAN	ankyrin repeat and SOCS box containing 15	222					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					breast(1)|kidney(1)|large_intestine(1)|lung(6)|skin(3)	12						AGTATGGTCACTGTGACGTGT	0.468											OREG0018282	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.H222Q		.											.	ASB15-228	0			c.C666A						.						132.0	95.0	107.0					7																	123264837		2203	4300	6503	SO:0001583	missense	142685	exon6			TGGTCACTGTGAC	AF403033	CCDS34742.1	7q31.31	2013-01-10	2011-01-25		ENSG00000146809	ENSG00000146809		"""Ankyrin repeat domain containing"""	19767	protein-coding gene	gene with protein product			"""ankyrin repeat and SOCS box-containing 15"""			12076535	Standard	XM_005250149		Approved	FLJ43370	uc003vkw.1	Q8WXK1	OTTHUMG00000157114	ENST00000451558.1:c.666C>A	7.37:g.123264837C>A	ENSP00000397655:p.His222Gln	61	0	1525	83	35	NM_080928	0	0	0	0	0	Q3ZCP3|Q3ZCP5|Q68D37	Missense_Mutation	SNP	ENST00000451558.1	37	CCDS34742.1	.	.	.	.	.	.	.	.	.	.	C	12.02	1.811718	0.32053	.	.	ENSG00000146809	ENST00000451558;ENST00000434204;ENST00000451215;ENST00000540573;ENST00000542545;ENST00000447789;ENST00000275699	T;T;T;T;T;T	0.65549	-0.1;-0.1;-0.1;-0.1;-0.16;-0.1	5.36	5.36	0.76844	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.67154	0.2863	L	0.33792	1.035	0.58432	D	0.999999	D	0.54601	0.967	P	0.58391	0.838	T	0.60924	-0.7166	10	0.22706	T	0.39	-7.5108	19.4438	0.94838	0.0:1.0:0.0:0.0	.	222	Q8WXK1	ASB15_HUMAN	Q	222;222;222;222;11;222;222	ENSP00000397655:H222Q;ENSP00000390963:H222Q;ENSP00000416433:H222Q;ENSP00000438643:H222Q;ENSP00000401166:H222Q;ENSP00000275699:H222Q	ENSP00000275699:H222Q	H	+	3	2	ASB15	123052073	0.988000	0.35896	1.000000	0.80357	0.235000	0.25334	1.161000	0.31773	2.674000	0.91012	0.491000	0.48974	CAC	.		0.468	ASB15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347493.1		
MGAM	8972	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	141800677	141800677	+	Missense_Mutation	SNP	T	T	G			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr7:141800677T>G	ENST00000549489.2	+	45	5357	c.5262T>G	c.(5260-5262)gaT>gaG	p.D1754E	MGAM_ENST00000475668.2_Missense_Mutation_p.D2650E	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	1754	Glucoamylase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	TCTGGGATGATGGGCAAAGCA	0.502																																					p.D1754E		.											.	MGAM-70	0			c.T5262G						.						86.0	86.0	86.0					7																	141800677		1981	4153	6134	SO:0001583	missense	8972	exon45			GGATGATGGGCAA	AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.5262T>G	7.37:g.141800677T>G	ENSP00000447378:p.Asp1754Glu	32	0		52	26	NM_004668	0	0	0	0	0	Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	ENST00000549489.2	37	CCDS47727.1	.	.	.	.	.	.	.	.	.	.	T	18.11	3.550375	0.65311	.	.	ENSG00000257335	ENST00000549489;ENST00000475668	D	0.96265	-3.96	4.83	1.2	0.21068	.	.	.	.	.	D	0.97343	0.9131	M	0.89414	3.03	0.24431	N	0.994574	D	0.55172	0.97	P	0.56823	0.807	D	0.92205	0.5771	9	0.87932	D	0	.	7.7862	0.29093	0.0:0.3312:0.0:0.6688	.	1754	O43451	MGA_HUMAN	E	1754;2651	ENSP00000447378:D1754E	ENSP00000373973:D1754E	D	+	3	2	MGAM	141447146	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	0.614000	0.24314	0.058000	0.16222	-0.269000	0.10298	GAT	.		0.502	MGAM-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351244.3		
BMP1	649	broad.mit.edu;bcgsc.ca	37	8	22022973	22022973	+	Missense_Mutation	SNP	C	C	A			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr8:22022973C>A	ENST00000306385.5	+	1	725	c.55C>A	c.(55-57)Ccc>Acc	p.P19T	BMP1_ENST00000306349.8_Missense_Mutation_p.P19T|BMP1_ENST00000354870.5_Missense_Mutation_p.P19T|BMP1_ENST00000397814.3_Missense_Mutation_p.P19T|BMP1_ENST00000397816.3_Missense_Mutation_p.P19T	NM_006129.4	NP_006120.1	P13497	BMP1_HUMAN	bone morphogenetic protein 1	19					cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|lipoprotein metabolic process (GO:0042157)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|positive regulation of cartilage development (GO:0061036)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane-bounded vesicle (GO:0031988)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)|zinc ion binding (GO:0008270)			breast(1)|endometrium(7)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|prostate(1)|skin(3)	30				Colorectal(74;0.00229)|COAD - Colon adenocarcinoma(73;0.0661)|READ - Rectum adenocarcinoma(644;0.11)		GCTCCCGCGTCCCGGCCGGCC	0.736																																					p.P19T													.	BMP1-155	0			c.C55A						.						10.0	12.0	12.0					8																	22022973		2117	4160	6277	SO:0001583	missense	649	exon1			CCGCGTCCCGGCC		CCDS6026.1, CCDS34856.1	8p21	2013-02-06	2004-08-09		ENSG00000168487	ENSG00000168487	3.4.24.19	"""Bone morphogenetic proteins"""	1067	protein-coding gene	gene with protein product	"""procollagen C-endopeptidase"""	112264	"""procollagen C-endopeptidase"""	PCOLC		2004778	Standard	NM_006129		Approved		uc003xbg.3	P13497	OTTHUMG00000097761	ENST00000306385.5:c.55C>A	8.37:g.22022973C>A	ENSP00000305714:p.Pro19Thr	21	0		27	7	NM_001199	0	0	3	7	4	A8K6F5|B2RN46|D3DSR0|Q13292|Q13872|Q14874|Q99421|Q99422|Q99423|Q9UL38	Missense_Mutation	SNP	ENST00000306385.5	37	CCDS6026.1	.	.	.	.	.	.	.	.	.	.	C	16.17	3.048783	0.55110	.	.	ENSG00000168487	ENST00000306385;ENST00000354870;ENST00000397816;ENST00000306349;ENST00000397814	T;T;T;T;T	0.81247	0.17;-1.47;-0.11;0.03;1.11	3.84	2.92	0.33932	.	.	.	.	.	T	0.66694	0.2815	N	0.14661	0.345	0.22479	N	0.999063	B;B;B	0.24092	0.001;0.001;0.097	B;B;B	0.28709	0.005;0.01;0.093	T	0.57602	-0.7783	9	0.49607	T	0.09	.	8.9784	0.35950	0.0:0.7582:0.2418:0.0	.	19;19;19	P13497;P13497-2;P13497-6	BMP1_HUMAN;.;.	T	19	ENSP00000305714:P19T;ENSP00000346941:P19T;ENSP00000380917:P19T;ENSP00000306121:P19T;ENSP00000380915:P19T	ENSP00000306121:P19T	P	+	1	0	BMP1	22078918	0.998000	0.40836	0.998000	0.56505	0.989000	0.77384	2.517000	0.45529	0.551000	0.29008	0.561000	0.74099	CCC	.		0.736	BMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214995.2	NM_006132	
SNTB1	6641	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	121587444	121587444	+	Nonsense_Mutation	SNP	G	G	A			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr8:121587444G>A	ENST00000395601.3	-	5	1432	c.1018C>T	c.(1018-1020)Cag>Tag	p.Q340*	SNTB1_ENST00000519177.1_5'UTR|SNTB1_ENST00000517992.1_Nonsense_Mutation_p.Q340*	NM_021021.3	NP_066301.1	Q13884	SNTB1_HUMAN	syntrophin, beta 1 (dystrophin-associated protein A1, 59kDa, basic component 1)	340	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.				muscle contraction (GO:0006936)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|focal adhesion (GO:0005925)|protein complex (GO:0043234)|synapse (GO:0045202)				NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(10)|prostate(2)|skin(6)	24	Lung NSC(37;4.46e-09)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)		STAD - Stomach adenocarcinoma(47;0.00503)			GGTTTCCACTGTTTCTTGCTC	0.483																																					p.Q340X		.											.	SNTB1-228	0			c.C1018T						.						149.0	139.0	142.0					8																	121587444		2203	4300	6503	SO:0001587	stop_gained	6641	exon4			TCCACTGTTTCTT	AF028828	CCDS6334.1	8q23-q24	2013-01-10	2002-08-29		ENSG00000172164	ENSG00000172164		"""Pleckstrin homology (PH) domain containing"""	11168	protein-coding gene	gene with protein product	"""tax interaction protein 43"""	600026	"""syntrophin, beta 1 (dystrophin-associated protein A1, 59kD, basic component 1)"""	SNT2B1		8183929, 9482110	Standard	NM_021021		Approved	59-DAP, A1B, BSYN2, TIP-43, SNT2	uc010mdg.3	Q13884	OTTHUMG00000165041	ENST00000395601.3:c.1018C>T	8.37:g.121587444G>A	ENSP00000378965:p.Gln340*	170	0		219	62	NM_021021	0	0	6	6	0	A8K9E0|O14912|Q4KMG8	Nonsense_Mutation	SNP	ENST00000395601.3	37	CCDS6334.1	.	.	.	.	.	.	.	.	.	.	G	40	8.420009	0.98803	.	.	ENSG00000172164	ENST00000395601;ENST00000517992	.	.	.	6.01	5.11	0.69529	.	0.476872	0.25380	N	0.031082	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.7345	0.85444	0.0:0.0:0.8703:0.1297	.	.	.	.	X	340	.	ENSP00000378965:Q340X	Q	-	1	0	SNTB1	121656625	1.000000	0.71417	0.999000	0.59377	0.901000	0.52897	6.995000	0.76257	2.861000	0.98227	0.650000	0.86243	CAG	.		0.483	SNTB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381535.1	NM_021021	
ZFP41	286128	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	144332048	144332048	+	Missense_Mutation	SNP	C	C	T			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr8:144332048C>T	ENST00000330701.4	+	2	404	c.35C>T	c.(34-36)cCg>cTg	p.P12L	ZFP41_ENST00000520584.1_Missense_Mutation_p.P12L|ZFP41_ENST00000522452.1_Missense_Mutation_p.P12L	NM_173832.4	NP_776193.1	Q8N8Y5	ZFP41_HUMAN	ZFP41 zinc finger protein	12					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|lung(4)|ovary(1)	8	all_cancers(97;1.01e-10)|all_epithelial(106;4.6e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)			AAGAAGACGCCGACCCCAAGG	0.592																																					p.P12L		.											.	ZFP41-91	0			c.C35T						.						26.0	30.0	29.0					8																	144332048		2200	4299	6499	SO:0001583	missense	286128	exon2			AGACGCCGACCCC		CCDS6397.1	8q24.3	2013-01-08	2012-11-27		ENSG00000181638	ENSG00000181638		"""Zinc fingers, C2H2-type"""	26786	protein-coding gene	gene with protein product			"""zinc finger protein 41 homolog (mouse)"""			11214971	Standard	NM_173832		Approved	FLJ38705, FLJ00028, ZNF753	uc003yxw.4	Q8N8Y5	OTTHUMG00000164951	ENST00000330701.4:c.35C>T	8.37:g.144332048C>T	ENSP00000327427:p.Pro12Leu	40	1		44	12	NM_173832	0	0	2	2	0	D3DWJ5	Missense_Mutation	SNP	ENST00000330701.4	37	CCDS6397.1	.	.	.	.	.	.	.	.	.	.	C	9.918	1.211334	0.22289	.	.	ENSG00000181638	ENST00000520584;ENST00000330701;ENST00000522452	T;T;T	0.05855	3.38;3.38;3.38	2.5	0.0503	0.14293	.	.	.	.	.	T	0.02807	0.0084	N	0.08118	0	0.09310	N	1	B	0.27971	0.196	B	0.17433	0.018	T	0.42189	-0.9466	9	0.66056	D	0.02	-3.2814	3.4146	0.07371	0.4823:0.3537:0.164:0.0	.	12	Q8N8Y5	ZFP41_HUMAN	L	12	ENSP00000430465:P12L;ENSP00000327427:P12L;ENSP00000428966:P12L	ENSP00000327427:P12L	P	+	2	0	ZFP41	144403423	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.038000	0.12144	-0.010000	0.14271	0.491000	0.48974	CCG	.		0.592	ZFP41-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381114.2	NM_173832	
SPATA31D1	389763	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	84608132	84608132	+	Nonsense_Mutation	SNP	G	G	A			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr9:84608132G>A	ENST00000344803.2	+	4	2794	c.2747G>A	c.(2746-2748)tGg>tAg	p.W916*		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	916					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											AGGATGCTGTGGGGCCTTCCC	0.463																																					p.W916X		.											.	.	0			c.G2747A						.						53.0	49.0	50.0					9																	84608132		1870	4093	5963	SO:0001587	stop_gained	389763	exon4			TGCTGTGGGGCCT		CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.2747G>A	9.37:g.84608132G>A	ENSP00000341988:p.Trp916*	71	1		89	34	NM_001001670	0	0	0	0	0		Nonsense_Mutation	SNP	ENST00000344803.2	37	CCDS47986.1	.	.	.	.	.	.	.	.	.	.	G	31	5.080052	0.94050	.	.	ENSG00000214929	ENST00000344803	.	.	.	3.09	-0.249	0.13011	.	1.642750	0.03466	N	0.213012	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	6.5839	5.1689	0.15099	0.1287:0.4109:0.4603:0.0	.	.	.	.	X	916	.	ENSP00000341988:W916X	W	+	2	0	FAM75D1	83797952	0.969000	0.33509	0.000000	0.03702	0.018000	0.09664	1.347000	0.33975	-0.147000	0.11254	0.558000	0.71614	TGG	.		0.463	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402325.1	NM_001001670	
MXRA5	25878	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	3238719	3238719	+	Silent	SNP	A	A	G			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chrX:3238719A>G	ENST00000217939.6	-	5	5161	c.5007T>C	c.(5005-5007)agT>agC	p.S1669S		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	1669						extracellular vesicular exosome (GO:0070062)				NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				GAATTGTTGTACTTGATAATC	0.438																																					p.S1669S		.											.	MXRA5-136	0			c.T5007C						.						171.0	162.0	165.0					X																	3238719		2203	4300	6503	SO:0001819	synonymous_variant	25878	exon5			TGTTGTACTTGAT	AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.5007T>C	X.37:g.3238719A>G		221	0		292	220	NM_015419	0	0	1	13	12	Q6P1M7|Q9Y3Y8	Silent	SNP	ENST00000217939.6	37	CCDS14124.1																																																																																			.		0.438	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055655.2	NM_015419	
CTPS2	56474	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	16685795	16685795	+	Silent	SNP	A	A	C			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chrX:16685795A>C	ENST00000443824.1	-	12	1985	c.1242T>G	c.(1240-1242)ctT>ctG	p.L414L	CTPS2_ENST00000380241.3_Silent_p.L414L|CTPS2_ENST00000359276.4_Silent_p.L414L	NM_001144002.1	NP_001137474.1	Q9NRF8	PYRG2_HUMAN	CTP synthase 2	414	Glutamine amidotransferase type-1. {ECO:0000255|PROSITE-ProRule:PRU00605}.				'de novo' CTP biosynthetic process (GO:0044210)|glutamine metabolic process (GO:0006541)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleotide metabolic process (GO:0006220)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|CTP synthase activity (GO:0003883)			breast(1)|endometrium(3)|large_intestine(4)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	Hepatocellular(33;0.0997)					CTTTCAAGTTAAGGCAGTTTC	0.323																																					p.L414L		.											.	CTPS2-228	0			c.T1242G						.						104.0	95.0	98.0					X																	16685795		2203	4300	6503	SO:0001819	synonymous_variant	56474	exon12			CAAGTTAAGGCAG	AF086422	CCDS14175.1	Xp22	2012-05-02	2012-05-02		ENSG00000047230	ENSG00000047230	6.3.4.2		2520	protein-coding gene	gene with protein product		300380	"""CTP synthase II"""			10899599	Standard	NM_001144002		Approved		uc004cxm.3	Q9NRF8	OTTHUMG00000021193	ENST00000443824.1:c.1242T>G	X.37:g.16685795A>C		67	0		85	58	NM_001144002	0	0	0	0	0	B3KWM2|Q9BRI0|Q9H809|Q9H8K9	Silent	SNP	ENST00000443824.1	37	CCDS14175.1	.	.	.	.	.	.	.	.	.	.	A	8.285	0.816447	0.16607	.	.	ENSG00000047230	ENST00000455276	.	.	.	5.47	-4.64	0.03349	.	0.000000	0.64402	D	0.000015	.	.	.	.	.	.	0.44862	D	0.997874	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-19.4425	9.4054	0.38457	0.1945:0.5966:0.0:0.2089	.	.	.	.	X	36	.	ENSP00000400431:L36X	L	-	2	0	CTPS2	16595716	0.000000	0.05858	0.699000	0.30290	0.941000	0.58515	-1.673000	0.01951	-0.843000	0.04189	0.486000	0.48141	TTA	.		0.323	CTPS2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055906.1	NM_019857	
C10orf12	26148	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	98741324	98741326	+	In_Frame_Del	DEL	TTT	TTT	-			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	TTT	TTT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr10:98741324_98741326delTTT	ENST00000286067.2	+	1	284_286	c.177_179delTTT	c.(175-180)acttta>aca	p.L60del		NM_015652.2	NP_056467.2	Q8N655	CJ012_HUMAN	chromosome 10 open reading frame 12	60										NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(19)|ovary(3)|prostate(2)|skin(2)|stomach(4)	45		Colorectal(252;0.172)		Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)		AAGAGAATACTTTACAGTGTCCA	0.404																																					p.59_60del		.											.	C10orf12-92	0			c.177_179del						.																																			SO:0001651	inframe_deletion	26148	exon1			.	BC024315	CCDS7452.1	10q24.2	2014-03-11			ENSG00000155640	ENSG00000155640			23420	protein-coding gene	gene with protein product						24550272	Standard	NM_015652		Approved	DKFZP564P1916, FLJ13022	uc001kmv.3	Q8N655	OTTHUMG00000018840	ENST00000286067.2:c.177_179delTTT	10.37:g.98741324_98741326delTTT	ENSP00000286067:p.Leu60del	79	0		108	37	NM_015652	0	0	0	0	0	Q9H945|Q9Y457	In_Frame_Del	DEL	ENST00000286067.2	37	CCDS7452.1																																																																																			.		0.404	C10orf12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049627.1	NM_015652	
ARHGAP32	9743	hgsc.bcm.edu;bcgsc.ca	37	11	128839901	128839901	+	Frame_Shift_Del	DEL	T	T	-	rs141030632	byFrequency	TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr11:128839901delT	ENST00000310343.9	-	22	5164	c.5165delA	c.(5164-5166)aacfs	p.N1722fs	ARHGAP32_ENST00000392657.3_Frame_Shift_Del_p.N1373fs|ARHGAP32_ENST00000524655.1_3'UTR|ARHGAP32_ENST00000527272.1_Frame_Shift_Del_p.N1373fs	NM_001142685.1	NP_001136157.1	A7KAX9	RHG32_HUMAN	Rho GTPase activating protein 32	1722	Interaction with FYN.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)|phosphatidylinositol binding (GO:0035091)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(28)|ovary(3)|prostate(6)|urinary_tract(3)	60						ATTATGGTCGTTGGGAGAGAA	0.507																																					p.N1722fs		.											.	ARHGAP32-231	0			c.5165delA						.						95.0	85.0	89.0					11																	128839901		2201	4297	6498	SO:0001589	frameshift_variant	9743	exon22			.	AB018255	CCDS31718.1, CCDS44769.1	11q24.3	2011-06-29			ENSG00000134909	ENSG00000134909		"""Rho GTPase activating proteins"""	17399	protein-coding gene	gene with protein product		608541				12446789, 12819203, 17663722	Standard	NM_014715		Approved	GRIT, KIAA0712, MGC1892, RICS, GC-GAP	uc009zcp.3	A7KAX9	OTTHUMG00000165774	ENST00000310343.9:c.5165delA	11.37:g.128839901delT	ENSP00000310561:p.Asn1722fs	161	0		198	44	NM_001142685	0	0	0	0	0	I7H0B0|O94820|Q86YL6|Q8IUG4|Q9BWG3	Frame_Shift_Del	DEL	ENST00000310343.9	37	CCDS44769.1																																																																																			.		0.507	ARHGAP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386151.3	NM_014715	
ANAPC5	51433	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	121746455	121746458	+	Frame_Shift_Del	DEL	TTCT	TTCT	-	rs146935401		TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	TTCT	TTCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr12:121746455_121746458delTTCT	ENST00000261819.3	-	17	2214_2217	c.2093_2096delAGAA	c.(2092-2097)aagaacfs	p.KN698fs	ANAPC5_ENST00000344395.4_Frame_Shift_Del_p.KN586fs|ANAPC5_ENST00000441917.2_Frame_Shift_Del_p.KN586fs|ANAPC5_ENST00000535482.1_Frame_Shift_Del_p.KN364fs|ANAPC5_ENST00000544314.1_5'UTR|ANAPC5_ENST00000541887.1_Frame_Shift_Del_p.KN685fs	NM_016237.4	NP_057321.2	Q9UJX4	APC5_HUMAN	anaphase promoting complex subunit 5	698					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)			breast(6)|endometrium(3)|kidney(3)|large_intestine(5)|lung(10)|prostate(1)|skin(3)	31	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					TGCAAAATAGTTCTTGGCTTCATT	0.49																																					p.698_699del		.											.	ANAPC5-290	0			c.2093_2096del						.																																			SO:0001589	frameshift_variant	51433	exon17			.	AF191339	CCDS9220.1, CCDS45000.1	12q24.31	2014-08-12			ENSG00000089053	ENSG00000089053		"""Anaphase promoting complex subunits"""	15713	protein-coding gene	gene with protein product		606948				9469815	Standard	NM_016237		Approved	APC5	uc001uag.3	Q9UJX4	OTTHUMG00000169157	ENST00000261819.3:c.2093_2096delAGAA	12.37:g.121746455_121746458delTTCT	ENSP00000261819:p.Lys698fs	220	0		299	132	NM_016237	0	0	0	0	0	E9PFB2|Q8N4H7|Q9BQD4	Frame_Shift_Del	DEL	ENST00000261819.3	37	CCDS9220.1																																																																																			.		0.490	ANAPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402582.1		
C15orf52	388115	broad.mit.edu	37	15	40633079	40633079	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr15:40633079delA	ENST00000559313.1	-	1	89	c.74delT	c.(73-75)ttcfs	p.F25fs	C15orf52_ENST00000557973.1_5'UTR|C15orf52_ENST00000397536.2_5'Flank	NM_207380.2	NP_997263.2	Q6ZUT6	CO052_HUMAN	chromosome 15 open reading frame 52	25							poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|urinary_tract(1)	19		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;9.06e-06)|Colorectal(105;0.0107)|BRCA - Breast invasive adenocarcinoma(123;0.0505)|READ - Rectum adenocarcinoma(2;0.0649)|Lung(196;0.0781)|LUAD - Lung adenocarcinoma(183;0.0841)		GAGTGGGAGGAAAGCTGGAGC	0.642																																					p.F25fs													.	C15orf52-153	0			c.74delT						.						11.0	17.0	15.0					15																	40633079		1859	4102	5961	SO:0001589	frameshift_variant	388115	exon1			GGGAGGAAAGCTG	AK124643	CCDS10055.2	15q15.1	2007-06-14			ENSG00000188549	ENSG00000188549			33488	protein-coding gene	gene with protein product							Standard	NM_207380		Approved	FLJ43339	uc001zlh.4	Q6ZUT6	OTTHUMG00000129981	ENST00000559313.1:c.74delT	15.37:g.40633079delA	ENSP00000453969:p.Phe25fs	17	0		28	9	NM_207380	0	0	0	0	0	B9EIQ8|Q68DG9|Q6ZTM3|Q6ZU22	Frame_Shift_Del	DEL	ENST00000559313.1	37	CCDS10055.2																																																																																			.		0.642	C15orf52-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319567.2	NM_207380	
RAB27B	5874	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	18	52555227	52555230	+	Splice_Site	DEL	CCAA	CCAA	-			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	CCAA	CCAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr18:52555227_52555230delCCAA	ENST00000262094.5	+	5	866_869	c.345_348delCCAA	c.(343-348)agccaa>ag	p.SQ115fs	RAB27B_ENST00000586594.1_3'UTR|RP11-839G9.1_ENST00000588466.1_RNA	NM_004163.4	NP_004154.2	O00194	RB27B_HUMAN	RAB27B, member RAS oncogene family	115					multivesicular body sorting pathway (GO:0071985)|positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|Golgi stack (GO:0005795)|multivesicular body membrane (GO:0032585)|trans-Golgi network transport vesicle (GO:0030140)|zymogen granule membrane (GO:0042589)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|protein domain specific binding (GO:0019904)			large_intestine(3)|lung(3)|skin(1)	7				Colorectal(16;0.0273)|READ - Rectum adenocarcinoma(59;0.219)		CTTTTCAAGGCCAACTGCAAGCAA	0.402																																					p.115_116del		.											.	RAB27B-227	0			c.345_348del						.																																			SO:0001630	splice_region_variant	5874	exon5			.	U57093	CCDS11958.1	18q21.2	2006-12-18			ENSG00000041353	ENSG00000041353		"""RAB, member RAS oncogene"""	9767	protein-coding gene	gene with protein product		603869				9066979	Standard	NM_004163		Approved		uc002lfr.3	O00194	OTTHUMG00000132710	ENST00000262094.5:c.344-1CCAA>-	18.37:g.52555227_52555230delCCAA		131	0		199	39	NM_004163	0	0	0	0	0	B2RAB0|Q9BZB6	Frame_Shift_Del	DEL	ENST00000262094.5	37	CCDS11958.1																																																																																			.		0.402	RAB27B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256008.3	NM_004163	Frame_Shift_Del
CD2AP	23607	bcgsc.ca	37	6	47591945	47591953	+	In_Frame_Del	DEL	AGCTGTCCT	AGCTGTCCT	-	rs201892753		TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	AGCTGTCCT	AGCTGTCCT	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr6:47591945_47591953delAGCTGTCCT	ENST00000359314.5	+	18	2358_2366	c.1902_1910delAGCTGTCCT	c.(1900-1911)aaagctgtcctg>aag	p.AVL635del		NM_012120.2	NP_036252.1	Q9Y5K6	CD2AP_HUMAN	CD2-associated protein	635					mitotic nuclear division (GO:0007067)|negative regulation of transforming growth factor beta1 production (GO:0032911)|positive regulation of protein localization to nucleus (GO:1900182)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein complex assembly (GO:0006461)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of receptor-mediated endocytosis (GO:0048259)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|substrate-dependent cell migration, cell extension (GO:0006930)|vesicle organization (GO:0016050)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	SH3 domain binding (GO:0017124)|structural constituent of cytoskeleton (GO:0005200)			kidney(1)|large_intestine(9)|lung(5)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	20			Lung(136;0.105)|LUSC - Lung squamous cell carcinoma(51;0.138)			AGCTGAAAAAAGCTGTCCTGTCTTCTTGA	0.335																																					p.634_637del													.	CD2AP-92	0			c.1902_1910del						.																																			SO:0001651	inframe_deletion	23607	exon18			GAAAAAAGCTGTC	AF146277	CCDS34472.1	6p12	2008-02-05			ENSG00000198087	ENSG00000198087			14258	protein-coding gene	gene with protein product		604241				10339567	Standard	NM_012120		Approved	CMS	uc003oyw.3	Q9Y5K6	OTTHUMG00000014799	ENST00000359314.5:c.1902_1910delAGCTGTCCT	6.37:g.47591945_47591953delAGCTGTCCT	ENSP00000352264:p.Ala635_Leu637del	73	0		74	6	NM_012120	0	0	0	0	0	A6NL34|Q5VYA3|Q9UG97	In_Frame_Del	DEL	ENST00000359314.5	37	CCDS34472.1																																																																																			.		0.335	CD2AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040817.2		
GIGYF2	26058	broad.mit.edu;bcgsc.ca	37	2	233681733	233681734	+	Frame_Shift_Ins	INS	-	-	AGGAAAC			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr2:233681733_233681734insAGGAAAC	ENST00000409547.1	+	22	2672_2673	c.2361_2362insAGGAAAC	c.(2362-2364)aggfs	p.-790fs	GIGYF2_ENST00000373566.3_Frame_Shift_Ins_p.-812fs|GIGYF2_ENST00000373563.4_Frame_Shift_Ins_p.-790fs|GIGYF2_ENST00000409196.3_Frame_Shift_Ins_p.-784fs|GIGYF2_ENST00000452341.2_Frame_Shift_Ins_p.-621fs|GIGYF2_ENST00000409480.1_Frame_Shift_Ins_p.-812fs|GIGYF2_ENST00000409451.3_Frame_Shift_Ins_p.-811fs	NM_015575.3	NP_056390.2	Q6Y7W6	PERQ2_HUMAN	GRB10 interacting GYF protein 2						adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|feeding behavior (GO:0007631)|homeostasis of number of cells within a tissue (GO:0048873)|insulin-like growth factor receptor signaling pathway (GO:0048009)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|musculoskeletal movement (GO:0050881)|negative regulation of translation (GO:0017148)|neuromuscular process controlling balance (GO:0050885)|post-embryonic development (GO:0009791)|spinal cord motor neuron differentiation (GO:0021522)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(17)|lung(11)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	63		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;7.37e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000472)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(119;0.0118)|GBM - Glioblastoma multiforme(43;0.0145)		AACTTGCCCGAAGGAAACAGGT	0.47																																					p.R808fs													.	GIGYF2-28	0			c.2424_2425insAGGAAAC						.																																			SO:0001589	frameshift_variant	26058	exon22			TGCCCGAAGGAAA	U80751	CCDS33401.1, CCDS46542.1, CCDS46543.1	2q37.1	2011-07-06	2008-02-11	2008-02-11	ENSG00000204120	ENSG00000204120		"""Trinucleotide (CAG) repeat containing"""	11960	protein-coding gene	gene with protein product	"""GYF domain containing 2"""	612003	"""PERQ amino acid rich, with GYF domain 2"", ""PERQ amino acid rich, with GYF domain 3"", ""trinucleotide repeat containing 15"", ""Parkinson disease (autosomal recessive, early onset) 11"""	PERQ2, PERQ3, TNRC15, PARK11		9225980, 9734811, 12771153, 18358451, 19279319	Standard	NM_015575		Approved	KIAA0642, GYF2	uc002vtk.4	Q6Y7W6	OTTHUMG00000153237	ENST00000409547.1:c.2362_2368dupAGGAAAC	2.37:g.233681734_233681740dupAGGAAAC	ENSP00000386537:p.Gln790fs	246	0		300	45	NM_001103147	0	0	0	0	0	A6H8W4|B9EG55|E9PBB0|O75137|Q7Z2Z8|Q7Z3I2|Q96HU4|Q9NV82	Frame_Shift_Ins	INS	ENST00000409547.1	37	CCDS33401.1																																																																																			.		0.470	GIGYF2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000330316.2	NM_001103146	
OGG1	4968	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	9798226	9798227	+	Frame_Shift_Ins	INS	-	-	AA			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr3:9798226_9798227insAA	ENST00000344629.7	+	5	1162_1163	c.819_820insAA	c.(820-822)attfs	p.I274fs	OGG1_ENST00000302008.8_Frame_Shift_Ins_p.I274fs|OGG1_ENST00000383826.5_Intron|OGG1_ENST00000302036.7_Frame_Shift_Ins_p.I274fs|OGG1_ENST00000339511.5_Frame_Shift_Ins_p.I274fs|OGG1_ENST00000349503.5_Intron|OGG1_ENST00000302003.7_Frame_Shift_Ins_p.I274fs|OGG1_ENST00000449570.2_Frame_Shift_Ins_p.I274fs			O15527	OGG1_HUMAN	8-oxoguanine DNA glycosylase	274					acute inflammatory response (GO:0002526)|base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|cellular response to cadmium ion (GO:0071276)|depurination (GO:0045007)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair (GO:0006289)|regulation of protein import into nucleus, translocation (GO:0033158)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to folic acid (GO:0051593)|response to oxidative stress (GO:0006979)|response to radiation (GO:0009314)	mitochondrion (GO:0005739)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	8-oxo-7,8-dihydroguanine DNA N-glycosylase activity (GO:0034039)|damaged DNA binding (GO:0003684)|endonuclease activity (GO:0004519)|oxidized purine nucleobase lesion DNA N-glycosylase activity (GO:0008534)			kidney(2)|large_intestine(2)|lung(2)|skin(1)|urinary_tract(1)	8	Medulloblastoma(99;0.227)					ATATGTGGCACATTGCCCAACG	0.599								Base excision repair (BER), DNA glycosylases																													p.H273fs		.											.	OGG1-660	0			c.819_820insAA						.																																			SO:0001589	frameshift_variant	4968	exon5			.	U96710	CCDS2576.1, CCDS2577.1, CCDS2578.1, CCDS2579.1, CCDS2580.1, CCDS2581.1, CCDS43046.1, CCDS46742.1	3p26	2010-11-23			ENSG00000114026	ENSG00000114026	3.2.2.-, 4.2.99.18		8125	protein-coding gene	gene with protein product	"""8-hydroxyguanine DNA glycosylase"", ""OGG1 type 1e"", ""OGG1 type 1d"", ""OGG1 type 1g"", ""OGG1 type 1h"""	601982				9207108, 10449904	Standard	NM_002542		Approved	HMMH, HOGG1, OGH1, MUTM	uc003bsj.3	O15527	OTTHUMG00000097091	Exception_encountered	3.37:g.9798226_9798227insAA	ENSP00000342851:p.Ile274fs	80	0		86	28	NM_016819	0	0	0	0	0	A8K1E3|O00390|O00670|O00705|O14876|O95488|P78554|Q9BW42|Q9UIK0|Q9UIK1|Q9UIK2|Q9UL34|Q9Y2C0|Q9Y2C1|Q9Y6C3|Q9Y6C4	Frame_Shift_Ins	INS	ENST00000344629.7	37	CCDS2581.1																																																																																			.		0.599	OGG1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214223.2	NM_016821	
