#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
RER1	11079	broad.mit.edu	37	1	2332308	2332308	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5891-01A-11D-1589-08	TCGA-BQ-5891-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37d4ff42-0161-4f83-bd6f-13eb19d4eabf	28824279-2be9-45db-867a-b165d8191d0c	g.chr1:2332308C>G	ENST00000605895.1	+	5	432	c.299C>G	c.(298-300)tCg>tGg	p.S100W	RER1_ENST00000378512.1_Missense_Mutation_p.S100W|RER1_ENST00000378518.1_Missense_Mutation_p.R67G|RER1_ENST00000488353.1_Missense_Mutation_p.S100W|RER1_ENST00000378513.3_Missense_Mutation_p.R67G	NM_007033.4	NP_008964.3	O15258	RER1_HUMAN	retention in endoplasmic reticulum sorting receptor 1	100					positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)	cell surface (GO:0009986)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of Golgi membrane (GO:0030173)				endometrium(3)|kidney(1)	4	all_cancers(77;0.000247)|all_epithelial(69;9.96e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;5.35e-20)|all_lung(118;2.78e-08)|Lung NSC(185;2.69e-06)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;2.28e-37)|OV - Ovarian serous cystadenocarcinoma(86;8.29e-23)|GBM - Glioblastoma multiforme(42;4.71e-08)|Colorectal(212;4.73e-05)|COAD - Colon adenocarcinoma(227;0.00021)|Kidney(185;0.00116)|BRCA - Breast invasive adenocarcinoma(365;0.00459)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0182)|Lung(427;0.204)		GACGGTCCTTCGCTACCCACC	0.478																																					p.S100W													.	RER1-90	0			c.C299G						.						182.0	181.0	182.0					1																	2332308		1923	4127	6050	SO:0001583	missense	11079	exon5			GTCCTTCGCTACC	AF157324	CCDS41232.1	1p36	2013-10-18	2013-10-18		ENSG00000157916	ENSG00000157916			30309	protein-coding gene	gene with protein product			"""RER1 retention in endoplasmic reticulum 1 homolog (S. cerevisiae)"""			9309388, 17668005	Standard	NM_007033		Approved		uc001aje.2	O15258	OTTHUMG00000001403	ENST00000605895.1:c.299C>G	1.37:g.2332308C>G	ENSP00000475168:p.Ser100Trp	184	0		183	4	NM_007033	0	0	354	354	0	O95322	Missense_Mutation	SNP	ENST00000605895.1	37	CCDS41232.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.29|12.29	1.893876|1.893876	0.33442|0.33442	.|.	.|.	ENSG00000157916|ENSG00000157916	ENST00000378518;ENST00000378513|ENST00000306256;ENST00000434662;ENST00000378512;ENST00000443438	.|.	.|.	.|.	5.67|5.67	5.67|5.67	0.87782|0.87782	.|.	.|0.352313	.|0.30003	.|N	.|0.010644	T|T	0.77110|0.77110	0.4082|0.4082	M|M	0.75884|0.75884	2.315|2.315	0.32657|0.32657	N|N	0.51866|0.51866	.|D;D	.|0.76494	.|0.999;0.983	.|D;P	.|0.75484	.|0.986;0.881	T|T	0.81965|0.81965	-0.0691|-0.0691	6|9	0.14656|0.72032	T|D	0.56|0.01	.|.	18.7441|18.7441	0.91785|0.91785	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|100;100	.|Q5T091;O15258	.|.;RER1_HUMAN	G|W	67|100	.|.	ENSP00000367774:R67G|ENSP00000302088:S100W	R|S	+|+	1|2	0|0	RER1|RER1	2322168|2322168	1.000000|1.000000	0.71417|0.71417	0.354000|0.354000	0.25760|0.25760	0.011000|0.011000	0.07611|0.07611	6.983000|6.983000	0.76180|0.76180	2.661000|2.661000	0.90470|0.90470	0.643000|0.643000	0.83706|0.83706	CGC|TCG	.		0.478	RER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004061.2		
NFIA	4774	broad.mit.edu	37	1	61554264	61554264	+	Silent	SNP	T	T	C			TCGA-BQ-5891-01A-11D-1589-08	TCGA-BQ-5891-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37d4ff42-0161-4f83-bd6f-13eb19d4eabf	28824279-2be9-45db-867a-b165d8191d0c	g.chr1:61554264T>C	ENST00000403491.3	+	2	955	c.471T>C	c.(469-471)tcT>tcC	p.S157S	NFIA_ENST00000407417.3_Silent_p.S149S|NFIA_ENST00000371191.1_Silent_p.S180S|NFIA_ENST00000371189.4_Silent_p.S202S|NFIA_ENST00000371187.3_Silent_p.S157S|NFIA_ENST00000371185.2_Silent_p.S157S|NFIA_ENST00000479364.1_Intron|NFIA_ENST00000485903.2_Silent_p.S157S|NFIA_ENST00000371184.2_Silent_p.S157S	NM_001134673.3|NM_005595.4	NP_001128145.1|NP_005586.1	Q12857	NFIA_HUMAN	nuclear factor I/A	157					DNA replication (GO:0006260)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to organic cyclic compound (GO:0014070)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)		NFIA/EHF(2)	endometrium(1)|kidney(2)|large_intestine(8)|lung(20)|pancreas(1)|prostate(1)|skin(1)	34						CACAATGCTCTAATCCAGGGC	0.453																																					p.S202S													.	NFIA-92	0			c.T606C						.						79.0	86.0	84.0					1																	61554264		2203	4300	6503	SO:0001819	synonymous_variant	4774	exon3			ATGCTCTAATCCA	U07809	CCDS615.1, CCDS44156.1, CCDS53322.1, CCDS53321.1	1p31.3-p31.2	2008-02-05			ENSG00000162599	ENSG00000162599			7784	protein-coding gene	gene with protein product		600727				7590749	Standard	NM_001134673		Approved	NFI-L, KIAA1439	uc010oos.2	Q12857	OTTHUMG00000008618	ENST00000403491.3:c.471T>C	1.37:g.61554264T>C		135	0		108	3	NM_001145512	0	0	17	17	0	B4DRJ3|B4DS53|F5H0R0|F8W8W3|Q8TA97|Q9H3X9|Q9P2A9	Silent	SNP	ENST00000403491.3	37	CCDS44156.1																																																																																			.		0.453	NFIA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023799.3	NM_005595	
TMED5	50999	ucsc.edu	37	1	93620447	93620447	+	Splice_Site	SNP	T	T	A			TCGA-BQ-5891-01A-11D-1589-08	TCGA-BQ-5891-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	37d4ff42-0161-4f83-bd6f-13eb19d4eabf	28824279-2be9-45db-867a-b165d8191d0c	g.chr1:93620447T>A	ENST00000370282.3	-	4	957		c.e4-2		TMED5_ENST00000479918.1_Splice_Site|TMED5_ENST00000483033.1_Splice_Site	NM_016040.4	NP_057124.3	Q9Y3A6	TMED5_HUMAN	transmembrane emp24 protein transport domain containing 5						Golgi ribbon formation (GO:0090161)|protein transport (GO:0015031)	cis-Golgi network (GO:0005801)|endoplasmic reticulum exit site (GO:0070971)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|large_intestine(2)|lung(1)|ovary(1)	6		all_lung(203;0.0223)|Lung NSC(277;0.071)|Melanoma(281;0.147)|Glioma(108;0.188)		all cancers(265;0.00108)|GBM - Glioblastoma multiforme(16;0.00407)|Epithelial(280;0.0797)		GATGGATTCCTGGAGataaat	0.363																																					.													.	TMED5-91	0			c.472-2A>T						.						89.0	85.0	86.0					1																	93620447		2203	4300	6503	SO:0001630	splice_region_variant	50999	exon5			GATTCCTGGAGAT	BC070051	CCDS743.1, CCDS53342.1	1p22.1	2013-09-19			ENSG00000117500	ENSG00000117500			24251	protein-coding gene	gene with protein product						10810093	Standard	NM_016040		Approved	CGI-100	uc001dpn.3	Q9Y3A6	OTTHUMG00000010162	ENST00000370282.3:c.472-2A>T	1.37:g.93620447T>A		165	0		123	1	NM_016040	0	0	0	0	0	B1AKT4|B2R703|D3DT38|Q96AX8	Splice_Site	SNP	ENST00000370282.3	37	CCDS743.1	.	.	.	.	.	.	.	.	.	.	T	20.5	4.001138	0.74818	.	.	ENSG00000117500	ENST00000370282;ENST00000479918;ENST00000535517	.	.	.	5.92	4.78	0.61160	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.5287	0.56102	0.125:0.0:0.0:0.875	.	.	.	.	.	-1	.	.	.	-	.	.	TMED5	93393035	1.000000	0.71417	0.998000	0.56505	0.964000	0.63967	7.977000	0.88081	1.044000	0.40200	0.533000	0.62120	.	.		0.363	TMED5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028076.3	NM_016040	Intron
ANKRD35	148741	bcgsc.ca	37	1	145555716	145555716	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5891-01A-11D-1589-08	TCGA-BQ-5891-11A-01D-1589-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	37d4ff42-0161-4f83-bd6f-13eb19d4eabf	28824279-2be9-45db-867a-b165d8191d0c	g.chr1:145555716C>A	ENST00000355594.4	+	2	151	c.64C>A	c.(64-66)Cag>Aag	p.Q22K	ANKRD35_ENST00000544626.1_Missense_Mutation_p.Q22K	NM_144698.3	NP_653299.4	Q8N283	ANR35_HUMAN	ankyrin repeat domain 35	22										NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(9)|lung(16)|ovary(4)|prostate(3)|skin(2)|urinary_tract(1)	47	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					CCGCCATGATCAGAAGCTGCT	0.577																																					p.Q22K	Melanoma(9;127 754 22988 51047)												.	ANKRD35-95	0			c.C64A						.						63.0	61.0	61.0					1																	145555716		2203	4300	6503	SO:0001583	missense	148741	exon2			CATGATCAGAAGC	AK091120	CCDS72867.1, CCDS72868.1	1q21.1	2013-01-10			ENSG00000198483	ENSG00000198483		"""Ankyrin repeat domain containing"""	26323	protein-coding gene	gene with protein product							Standard	NM_144698		Approved	FLJ25124	uc001eob.1	Q8N283	OTTHUMG00000013743	ENST00000355594.4:c.64C>A	1.37:g.145555716C>A	ENSP00000347802:p.Gln22Lys	62	0		102	6	NM_144698	0	0	0	0	0	A6NEU0|B4DL62|Q3MJ10|Q96LS3	Missense_Mutation	SNP	ENST00000355594.4	37	CCDS919.1	.	.	.	.	.	.	.	.	.	.	C	18.42	3.620476	0.66787	.	.	ENSG00000198483	ENST00000355594;ENST00000544626	T;T	0.52295	0.67;1.44	5.99	5.99	0.97316	Ankyrin repeat-containing domain (2);	0.000000	0.46758	D	0.000272	T	0.23846	0.0577	L	0.29908	0.895	0.35906	D	0.830723	P	0.39665	0.682	B	0.35182	0.197	T	0.09997	-1.0649	10	0.38643	T	0.18	-27.8271	15.9778	0.80083	0.0:1.0:0.0:0.0	.	22	Q8N283	ANR35_HUMAN	K	22	ENSP00000347802:Q22K;ENSP00000442671:Q22K	ENSP00000347802:Q22K	Q	+	1	0	ANKRD35	144267073	0.997000	0.39634	0.997000	0.53966	0.938000	0.57974	2.958000	0.49145	2.840000	0.97914	0.655000	0.94253	CAG	.		0.577	ANKRD35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038515.1	NM_144698	
FMOD	2331	broad.mit.edu	37	1	203311609	203311609	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5891-01A-11D-1589-08	TCGA-BQ-5891-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37d4ff42-0161-4f83-bd6f-13eb19d4eabf	28824279-2be9-45db-867a-b165d8191d0c	g.chr1:203311609G>T	ENST00000354955.4	-	3	1456	c.993C>A	c.(991-993)agC>agA	p.S331R	FMOD_ENST00000493296.1_5'UTR	NM_002023.4	NP_002014.2	Q06828	FMOD_HUMAN	fibromodulin	331					carbohydrate metabolic process (GO:0005975)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)|transforming growth factor beta receptor complex assembly (GO:0007181)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)		p.S331R(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(4)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	17			BRCA - Breast invasive adenocarcinoma(75;0.171)			TGCAGAAGCTGCTGATGGAGA	0.597											OREG0014119	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S331R													.	FMOD-137	1	Substitution - Missense(1)	prostate(1)	c.C993A						.						36.0	34.0	34.0					1																	203311609		2203	4300	6503	SO:0001583	missense	2331	exon3			GAAGCTGCTGATG	U05291	CCDS30976.1	1q32	2008-02-05			ENSG00000122176	ENSG00000122176		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	3774	protein-coding gene	gene with protein product	"""fibromodulin proteoglycan"""	600245				7851907	Standard	NM_002023		Approved	SLRR2E	uc001gzr.3	Q06828	OTTHUMG00000035910	ENST00000354955.4:c.993C>A	1.37:g.203311609G>T	ENSP00000347041:p.Ser331Arg	38	0	2136	58	6	NM_002023	0	0	0	0	0	Q15331|Q8IV47	Missense_Mutation	SNP	ENST00000354955.4	37	CCDS30976.1	.	.	.	.	.	.	.	.	.	.	G	18.01	3.527763	0.64860	.	.	ENSG00000122176	ENST00000435105;ENST00000354955	T	0.04603	3.59	5.42	3.17	0.36434	.	0.193950	0.53938	N	0.000041	T	0.08268	0.0206	L	0.42686	1.345	0.43047	D	0.99464	P	0.52463	0.953	P	0.52109	0.69	T	0.10636	-1.0621	10	0.66056	D	0.02	-8.0803	7.9269	0.29880	0.0856:0.0:0.6317:0.2827	.	331	Q06828	FMOD_HUMAN	R	318;331	ENSP00000347041:S331R	ENSP00000347041:S331R	S	-	3	2	FMOD	201578232	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.007000	0.49536	1.259000	0.44117	-0.182000	0.12963	AGC	.		0.597	FMOD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087472.1	NM_002023	
SORCS1	114815	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	108427534	108427534	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5891-01A-11D-1589-08	TCGA-BQ-5891-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	37d4ff42-0161-4f83-bd6f-13eb19d4eabf	28824279-2be9-45db-867a-b165d8191d0c	g.chr10:108427534T>C	ENST00000263054.6	-	17	2223	c.2216A>G	c.(2215-2217)aAt>aGt	p.N739S	SORCS1_ENST00000369698.1_Missense_Mutation_p.N274S|SORCS1_ENST00000344440.6_Missense_Mutation_p.N739S	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1	739					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		GCACTGGCCATTGCTGTGTCG	0.458																																					p.N739S		.											.	SORCS1-153	0			c.A2216G						.						69.0	62.0	65.0					10																	108427534		2203	4300	6503	SO:0001583	missense	114815	exon17			TGGCCATTGCTGT	AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.2216A>G	10.37:g.108427534T>C	ENSP00000263054:p.Asn739Ser	36	0		34	31	NM_001206572	0	0	0	0	0	A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Missense_Mutation	SNP	ENST00000263054.6	37	CCDS7559.1	.	.	.	.	.	.	.	.	.	.	T	7.105	0.574795	0.13623	.	.	ENSG00000108018	ENST00000369698;ENST00000263054;ENST00000344440	T;T;T	0.23348	1.91;2.47;2.47	5.49	4.33	0.51752	VPS10 (1);	0.111999	0.64402	N	0.000012	T	0.12433	0.0302	N	0.05031	-0.125	0.39169	D	0.962557	B;B;B;B;B	0.25206	0.073;0.054;0.12;0.073;0.007	B;B;B;B;B	0.25506	0.028;0.061;0.061;0.028;0.02	T	0.13548	-1.0505	9	.	.	.	-18.7721	11.8351	0.52319	0.0:0.0698:0.0:0.9302	.	739;739;739;739;739	A8K182;Q8WY21-4;Q8WY21-3;Q8WY21;Q8WY21-2	.;.;.;SORC1_HUMAN;.	S	274;739;739	ENSP00000358712:N274S;ENSP00000263054:N739S;ENSP00000345964:N739S	.	N	-	2	0	SORCS1	108417524	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	3.928000	0.56506	0.982000	0.38575	0.379000	0.24179	AAT	.		0.458	SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050232.4	NM_052918	
OR52J3	119679	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	5068288	5068288	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-5891-01A-11D-1589-08	TCGA-BQ-5891-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	37d4ff42-0161-4f83-bd6f-13eb19d4eabf	28824279-2be9-45db-867a-b165d8191d0c	g.chr11:5068288A>T	ENST00000380370.1	+	1	533	c.533A>T	c.(532-534)cAt>cTt	p.H178L		NM_001001916.2	NP_001001916.2	Q8NH60	O52J3_HUMAN	olfactory receptor, family 52, subfamily J, member 3	178						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|kidney(6)|large_intestine(6)|lung(19)|ovary(1)|skin(2)	36		Medulloblastoma(188;0.00131)|all_neural(188;0.0189)|Breast(177;0.0204)		Epithelial(150;9.29e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.19)		ATAATAGCCCATTCCTACTGT	0.418																																					p.H178L		.											.	OR52J3-71	0			c.A533T						.						191.0	162.0	172.0					11																	5068288		2201	4298	6499	SO:0001583	missense	119679	exon1			TAGCCCATTCCTA	AB065530	CCDS31370.1	11p15.4	2012-08-09			ENSG00000205495	ENSG00000205495		"""GPCR / Class A : Olfactory receptors"""	14799	protein-coding gene	gene with protein product							Standard	NM_001001916		Approved		uc010qyv.2	Q8NH60	OTTHUMG00000066600	ENST00000380370.1:c.533A>T	11.37:g.5068288A>T	ENSP00000369728:p.His178Leu	163	0		117	112	NM_001001916	0	0	0	0	0	Q6IFE4	Missense_Mutation	SNP	ENST00000380370.1	37	CCDS31370.1	.	.	.	.	.	.	.	.	.	.	A	17.43	3.387131	0.61956	.	.	ENSG00000205495	ENST00000380370	T	0.00183	8.6	3.89	3.89	0.44902	GPCR, rhodopsin-like superfamily (1);	0.000000	0.48286	D	0.000183	T	0.01061	0.0035	H	0.98769	4.325	0.37287	D	0.908099	D	0.89917	1.0	D	0.97110	1.0	T	0.13019	-1.0525	10	0.87932	D	0	.	11.9816	0.53123	1.0:0.0:0.0:0.0	.	178	Q8NH60	O52J3_HUMAN	L	178	ENSP00000369728:H178L	ENSP00000369728:H178L	H	+	2	0	OR52J3	5024864	0.235000	0.23794	0.989000	0.46669	0.817000	0.46193	3.921000	0.56454	1.742000	0.51746	0.533000	0.62120	CAT	.		0.418	OR52J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142807.1	NM_001001916	
IL10RA	3587	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	117866403	117866403	+	Missense_Mutation	SNP	G	G	A	rs145975996		TCGA-BQ-5891-01A-11D-1589-08	TCGA-BQ-5891-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	37d4ff42-0161-4f83-bd6f-13eb19d4eabf	28824279-2be9-45db-867a-b165d8191d0c	g.chr11:117866403G>A	ENST00000227752.3	+	6	908	c.788G>A	c.(787-789)cGa>cAa	p.R263Q	IL10RA_ENST00000545409.1_Missense_Mutation_p.R114Q|IL10RA_ENST00000533700.1_3'UTR|IL10RA_ENST00000541785.1_Missense_Mutation_p.R243Q	NM_001558.3	NP_001549.2	Q13651	I10R1_HUMAN	interleukin 10 receptor, alpha	263					cytokine-mediated signaling pathway (GO:0019221)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-10 receptor activity (GO:0004920)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(10)|ovary(2)|prostate(1)	19	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.07e-05)|Epithelial(105;0.00108)		GTGCGGCGCCGAAAGAAGCTA	0.602																																					p.R263Q		.											.	IL10RA-91	0			c.G788A						.	G	GLN/ARG	0,4400		0,0,2200	96.0	76.0	83.0		788	-1.2	0.0	11	dbSNP_134	83	2,8590	2.2+/-6.3	0,2,4294	yes	missense	IL10RA	NM_001558.3	43	0,2,6494	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging	263/579	117866403	2,12990	2200	4296	6496	SO:0001583	missense	3587	exon6			GGCGCCGAAAGAA	U00672	CCDS8388.1	11q23	2014-09-17			ENSG00000110324	ENSG00000110324		"""Interleukins and interleukin receptors"", ""CD molecules"""	5964	protein-coding gene	gene with protein product		146933		IL10R		8120391	Standard	NR_026691		Approved	HIL-10R, CDW210A, CD210a, CD210	uc001prv.3	Q13651	OTTHUMG00000166523	ENST00000227752.3:c.788G>A	11.37:g.117866403G>A	ENSP00000227752:p.Arg263Gln	43	0		42	20	NM_001558	0	0	9	9	0	A8K6I0|B0YJ27	Missense_Mutation	SNP	ENST00000227752.3	37	CCDS8388.1	.	.	.	.	.	.	.	.	.	.	G	16.24	3.066789	0.55539	0.0	2.33E-4	ENSG00000110324	ENST00000227752;ENST00000541785;ENST00000545409;ENST00000536858	T;T;T	0.56941	0.43;0.43;1.15	5.16	-1.2	0.09554	.	0.427526	0.16007	N	0.233988	T	0.52757	0.1754	M	0.63428	1.95	0.09310	N	1	D;D	0.69078	0.997;0.995	P;P	0.51945	0.685;0.639	T	0.47420	-0.9119	10	0.45353	T	0.12	-4.5989	7.1947	0.25845	0.1825:0.5157:0.3019:0.0	.	243;263	F5GYV8;Q13651	.;I10R1_HUMAN	Q	263;243;114;243	ENSP00000227752:R263Q;ENSP00000441397:R243Q;ENSP00000443019:R114Q	ENSP00000227752:R263Q	R	+	2	0	IL10RA	117371613	0.000000	0.05858	0.024000	0.17045	0.667000	0.39255	-0.002000	0.12924	0.003000	0.14656	0.563000	0.77884	CGA	G|1.000;A|0.000		0.602	IL10RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390167.1		
ART4	420	broad.mit.edu	37	12	14993941	14993941	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BQ-5891-01A-11D-1589-08	TCGA-BQ-5891-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37d4ff42-0161-4f83-bd6f-13eb19d4eabf	28824279-2be9-45db-867a-b165d8191d0c	g.chr12:14993941C>T	ENST00000228936.4	-	2	672	c.291G>A	c.(289-291)tgG>tgA	p.W97*	RP11-233G1.4_ENST00000444324.2_RNA|C12orf60_ENST00000527783.1_Intron	NM_021071.2	NP_066549.2	Q93070	NAR4_HUMAN	ADP-ribosyltransferase 4 (Dombrock blood group)	97					arginine metabolic process (GO:0006525)|protein ADP-ribosylation (GO:0006471)	anchored component of membrane (GO:0031225)|membrane (GO:0016020)|plasma membrane (GO:0005886)	NAD(P)+-protein-arginine ADP-ribosyltransferase activity (GO:0003956)			large_intestine(5)|liver(1)|lung(3)|prostate(1)|skin(2)|stomach(3)	15						GGGCTTTTTGCCACATCCTAA	0.408																																					p.W97X													.	ART4-90	0			c.G291A						.						136.0	132.0	133.0					12																	14993941		2203	4300	6503	SO:0001587	stop_gained	420	exon2			TTTTTGCCACATC	X95826	CCDS8668.1	12q13.2-q13.3	2014-07-18	2014-01-02	2006-01-12	ENSG00000111339	ENSG00000111339		"""CD molecules"", ""Blood group antigens"""	726	protein-coding gene	gene with protein product		110600	"""Dombrock blood group"", ""ADP-ribosyltransferase 4 (DO blood group)"", ""ADP-ribosyltransferase 4"""	DO		9119374	Standard	NM_021071		Approved	DOK1, CD297	uc001rcl.1	Q93070	OTTHUMG00000168738	ENST00000228936.4:c.291G>A	12.37:g.14993941C>T	ENSP00000228936:p.Trp97*	311	1		439	6	NM_021071	0	0	0	0	0	Q9BZ50|Q9BZ51|Q9HB06	Nonsense_Mutation	SNP	ENST00000228936.4	37	CCDS8668.1	.	.	.	.	.	.	.	.	.	.	C	14.33	2.504628	0.44558	.	.	ENSG00000111339	ENST00000228936;ENST00000420600	.	.	.	4.35	4.35	0.52113	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.0835	15.1953	0.73081	0.0:1.0:0.0:0.0	.	.	.	.	X	97;80	.	ENSP00000228936:W97X	W	-	3	0	ART4	14885208	1.000000	0.71417	0.761000	0.31378	0.138000	0.21146	4.059000	0.57470	2.716000	0.92895	0.563000	0.77884	TGG	.		0.408	ART4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400859.1	NM_021071	
TDG	6996	hgsc.bcm.edu	37	12	104378526	104378526	+	Splice_Site	SNP	G	G	T			TCGA-BQ-5891-01A-11D-1589-08	TCGA-BQ-5891-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	37d4ff42-0161-4f83-bd6f-13eb19d4eabf	28824279-2be9-45db-867a-b165d8191d0c	g.chr12:104378526G>T	ENST00000392872.3	+	8	1026		c.e8-1		TDG_ENST00000266775.9_Splice_Site|TDG_ENST00000542036.1_Splice_Site|AC078819.1_ENST00000401157.1_RNA|TDG_ENST00000544861.1_Splice_Site	NM_003211.4	NP_003202.3	Q13569	TDG_HUMAN	thymine-DNA glycosylase						base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|chromatin modification (GO:0016568)|depyrimidination (GO:0045008)|DNA demethylation (GO:0080111)|DNA repair (GO:0006281)|embryo development (GO:0009790)|mismatch repair (GO:0006298)|negative regulation of chromatin binding (GO:0035562)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of gene expression, epigenetic (GO:0040029)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)	damaged DNA binding (GO:0003684)|DNA N-glycosylase activity (GO:0019104)|double-stranded DNA binding (GO:0003690)|mismatched DNA binding (GO:0030983)|protein homodimerization activity (GO:0042803)|pyrimidine-specific mismatch base pair DNA N-glycosylase activity (GO:0008263)|RNA polymerase II transcription cofactor activity (GO:0001104)|structure-specific DNA binding (GO:0043566)			large_intestine(2)|lung(14)|ovary(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	24				BRCA - Breast invasive adenocarcinoma(302;0.00114)		TGTGATTCTAGCTCTGCTATG	0.323								Base excision repair (BER), DNA glycosylases																													.		.											.	TDG-661	0			c.793-1G>T						.						45.0	42.0	43.0					12																	104378526		2203	4300	6503	SO:0001630	splice_region_variant	6996	exon8			ATTCTAGCTCTGC	U51166	CCDS9095.1	12q24.1	2014-05-14			ENSG00000139372	ENSG00000139372	3.2.2.29		11700	protein-coding gene	gene with protein product	"""G/T mismatch-specific thymine DNA glycosylase"""	601423				8662714, 9299239	Standard	NM_003211		Approved		uc001tkg.3	Q13569	OTTHUMG00000168418	ENST00000392872.3:c.793-1G>T	12.37:g.104378526G>T		50	0		76	4	NM_003211	0	0	0	0	0	Q8IUZ6|Q8IZM3	Splice_Site	SNP	ENST00000392872.3	37	CCDS9095.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.099218	0.76983	.	.	ENSG00000139372	ENST00000392872;ENST00000266775;ENST00000544861;ENST00000542036	.	.	.	5.99	5.99	0.97316	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.4777	0.99188	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TDG	102902656	1.000000	0.71417	1.000000	0.80357	0.785000	0.44390	9.869000	0.99810	2.840000	0.97914	0.655000	0.94253	.	.		0.323	TDG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399673.2		Intron
ATXN2	6311	hgsc.bcm.edu	37	12	112036797	112036797	+	Silent	SNP	C	C	T	rs4098854	byFrequency	TCGA-BQ-5891-01A-11D-1589-08	TCGA-BQ-5891-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	37d4ff42-0161-4f83-bd6f-13eb19d4eabf	28824279-2be9-45db-867a-b165d8191d0c	g.chr12:112036797C>T	ENST00000377617.3	-	1	683	c.522G>A	c.(520-522)caG>caA	p.Q174Q	ATXN2_ENST00000535949.1_Intron|ATXN2_ENST00000389153.4_5'Flank|ATXN2_ENST00000542287.2_Intron|ATXN2_ENST00000550104.1_Silent_p.Q174Q|RP11-686G8.2_ENST00000547021.1_RNA|ATXN2_ENST00000549455.1_5'UTR|ATXN2_ENST00000608853.1_Silent_p.Q14Q	NM_002973.3	NP_002964.3	Q99700	ATX2_HUMAN	ataxin 2	174	Poly-Gln.				cell death (GO:0008219)|cerebellar Purkinje cell differentiation (GO:0021702)|cytoplasmic mRNA processing body assembly (GO:0033962)|homeostasis of number of cells (GO:0048872)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of receptor internalization (GO:0002091)|neuromuscular process (GO:0050905)|neuron projection morphogenesis (GO:0048812)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA transport (GO:0050658)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|trans-Golgi network (GO:0005802)	epidermal growth factor receptor binding (GO:0005154)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	37						gctgctgctgctgctgctgct	0.731													C|||	3289	0.656749	0.5734	0.6787	5008	,	,		4944	0.622		0.7167	False		,,,				2504	0.728				p.Q174Q		.											.	ATXN2-136	0			c.G522A						.						1.0	1.0	1.0					12																	112036797		720	1770	2490	SO:0001819	synonymous_variant	6311	exon1			CTGCTGCTGCTGC	U80749	CCDS31902.1	12q23-q24.1	2014-09-17	2004-08-12	2004-08-13	ENSG00000204842	ENSG00000204842		"""Ataxins"""	10555	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 13"""	601517	"""spinocerebellar ataxia 2 (olivopontocerebellar ataxia 2, autosomal dominant, ataxin 2)"""	SCA2, TNRC13		8358438, 9225980	Standard	NM_002973		Approved	ATX2	uc001tsj.3	Q99700	OTTHUMG00000133475	ENST00000377617.3:c.522G>A	12.37:g.112036797C>T		2	1		5	3	NM_002973	1	0	379	421	41	A6NLD4|Q6ZQZ7|Q99493	Silent	SNP	ENST00000377617.3	37	CCDS31902.1																																																																																			C|0.429;T|0.571		0.731	ATXN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257351.3	NM_002973	
MICU2	221154	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	13	22088516	22088516	+	Silent	SNP	C	C	T			TCGA-BQ-5891-01A-11D-1589-08	TCGA-BQ-5891-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	37d4ff42-0161-4f83-bd6f-13eb19d4eabf	28824279-2be9-45db-867a-b165d8191d0c	g.chr13:22088516C>T	ENST00000382374.4	-	7	704	c.639G>A	c.(637-639)gtG>gtA	p.V213V		NM_152726.2	NP_689939.1	Q8IYU8	MICU2_HUMAN	mitochondrial calcium uptake 2	213					mitochondrial calcium ion transport (GO:0006851)|negative regulation of mitochondrial calcium ion concentration (GO:0051562)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)	calcium channel complex (GO:0034704)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|uniplex complex (GO:1990246)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)										CATTAGTTTTCACTGTCATCA	0.318																																					p.V213V		.											.	EFHA1-90	0			c.G639A						.						184.0	177.0	179.0					13																	22088516		2202	4300	6502	SO:0001819	synonymous_variant	221154	exon7			AGTTTTCACTGTC	AK091907	CCDS9297.1	13q12.11	2013-03-13	2013-03-13	2013-03-13	ENSG00000165487	ENSG00000165487		"""EF-hand domain containing"""	31830	protein-coding gene	gene with protein product		610632	"""EF hand domain family A1"", ""EF-hand domain family, member A1"""	EFHA1		23409044	Standard	NM_152726		Approved		uc001uof.3	Q8IYU8	OTTHUMG00000067414	ENST00000382374.4:c.639G>A	13.37:g.22088516C>T		98	0		93	9	NM_152726	0	0	94	97	3	Q8N0T6|Q8NAX8	Silent	SNP	ENST00000382374.4	37	CCDS9297.1																																																																																			.		0.318	MICU2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000144355.1	NM_152726	
KL	9365	hgsc.bcm.edu;broad.mit.edu	37	13	33591068	33591068	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5891-01A-11D-1589-08	TCGA-BQ-5891-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	37d4ff42-0161-4f83-bd6f-13eb19d4eabf	28824279-2be9-45db-867a-b165d8191d0c	g.chr13:33591068G>C	ENST00000380099.3	+	1	498	c.490G>C	c.(490-492)Gtc>Ctc	p.V164L	KL_ENST00000487852.1_3'UTR|KL_ENST00000426690.2_Intron	NM_004795.3	NP_004786.2	Q9UEF7	KLOT_HUMAN	klotho	164	Glycosyl hydrolase-1 1.				acute inflammatory response (GO:0002526)|aging (GO:0007568)|calcium ion homeostasis (GO:0055074)|carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of bone mineralization (GO:0030501)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-glucosidase activity (GO:0008422)|beta-glucuronidase activity (GO:0004566)|fibroblast growth factor binding (GO:0017134)|signal transducer activity (GO:0004871)|vitamin D binding (GO:0005499)			breast(2)|endometrium(5)|kidney(3)|large_intestine(10)|lung(14)|ovary(2)|skin(5)	41	all_epithelial(80;0.133)	Ovarian(182;1.78e-06)|Breast(139;4.08e-05)|Hepatocellular(188;0.00886)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;7.13e-230)|all cancers(112;1.33e-165)|OV - Ovarian serous cystadenocarcinoma(117;1.09e-113)|Epithelial(112;3.79e-112)|Lung(94;8.52e-27)|LUSC - Lung squamous cell carcinoma(192;1.4e-13)|Kidney(163;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(186;5.63e-08)|BRCA - Breast invasive adenocarcinoma(63;1.41e-05)		CAGCGCGGGCGTCCCCAACCG	0.711																																					p.V164L		.											.	KL-155	0			c.G490C						.						12.0	12.0	12.0					13																	33591068		2147	4218	6365	SO:0001583	missense	9365	exon1			GCGGGCGTCCCCA	AB005142	CCDS9347.1	13q12	2008-02-05			ENSG00000133116	ENSG00000133116			6344	protein-coding gene	gene with protein product		604824				9464267	Standard	NM_004795		Approved		uc001uus.3	Q9UEF7	OTTHUMG00000017408	ENST00000380099.3:c.490G>C	13.37:g.33591068G>C	ENSP00000369442:p.Val164Leu	24	0		24	10	NM_004795	0	0	1	53	52	Q5VZ95|Q96KV5|Q96KW5|Q9UEI9|Q9Y4F0	Missense_Mutation	SNP	ENST00000380099.3	37	CCDS9347.1	.	.	.	.	.	.	.	.	.	.	G	13.26	2.183306	0.38511	.	.	ENSG00000133116	ENST00000380099	T	0.29397	1.57	4.05	1.25	0.21368	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.545315	0.20635	N	0.088517	T	0.23727	0.0574	L	0.38175	1.15	0.25597	N	0.98663	B	0.21606	0.058	B	0.30401	0.115	T	0.22138	-1.0225	10	0.39692	T	0.17	-7.2429	8.2462	0.31691	0.2774:0.0:0.7226:0.0	.	164	Q9UEF7	KLOT_HUMAN	L	164	ENSP00000369442:V164L	ENSP00000369442:V164L	V	+	1	0	KL	32489068	0.000000	0.05858	0.989000	0.46669	0.909000	0.53808	0.077000	0.14738	0.029000	0.15352	0.462000	0.41574	GTC	.		0.711	KL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045987.1		
COX8C	341947	hgsc.bcm.edu	37	14	93813725	93813725	+	Silent	SNP	G	G	T	rs201840112	byFrequency	TCGA-BQ-5891-01A-11D-1589-08	TCGA-BQ-5891-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	37d4ff42-0161-4f83-bd6f-13eb19d4eabf	28824279-2be9-45db-867a-b165d8191d0c	g.chr14:93813725G>T	ENST00000342144.2	+	1	189	c.111G>T	c.(109-111)cgG>cgT	p.R37R	UNC79_ENST00000256339.4_Intron	NM_182971.2	NP_892016.1	Q7Z4L0	COX8C_HUMAN	cytochrome c oxidase subunit VIIIC	37						integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	cytochrome-c oxidase activity (GO:0004129)			large_intestine(1)|lung(1)|prostate(2)|skin(1)	5		all_cancers(154;0.083)		Epithelial(152;0.176)|all cancers(159;0.197)|COAD - Colon adenocarcinoma(157;0.202)		CGCGCCAGCGGCCCCTGTCTG	0.771													G|||	28	0.00559105	0.0061	0.0	5008	,	,		9861	0.0		0.004	False		,,,				2504	0.0164				p.R37R	GBM(134;630 1800 8342 13106 15419)	.											.	COX8C-226	0			c.G111T						.						4.0	5.0	5.0					14																	93813725		1483	3126	4609	SO:0001819	synonymous_variant	341947	exon1			CCAGCGGCCCCTG	AY161004	CCDS9910.1	14q32.13	2011-07-04	2011-05-25			ENSG00000187581		"""Mitochondrial respiratory chain complex / Complex IV"""	24382	protein-coding gene	gene with protein product	"""cytochrome c oxidase subunit VIII isoform 3"""		"""cytochrome c oxidase subunit 8C"""			12909344	Standard	NM_182971		Approved	COX8-3	uc001ybt.1	Q7Z4L0		ENST00000342144.2:c.111G>T	14.37:g.93813725G>T		4	2		13	12	NM_182971	0	0	0	0	0	Q495K7	Silent	SNP	ENST00000342144.2	37	CCDS9910.1																																																																																			G|0.996;T|0.004		0.771	COX8C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412769.1	NM_182971	
AKT1	207	hgsc.bcm.edu	37	14	105237141	105237141	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5891-01A-11D-1589-08	TCGA-BQ-5891-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	37d4ff42-0161-4f83-bd6f-13eb19d4eabf	28824279-2be9-45db-867a-b165d8191d0c	g.chr14:105237141G>C	ENST00000554581.1	-	12	2784	c.1304C>G	c.(1303-1305)aCc>aGc	p.T435S	AKT1_ENST00000349310.3_Missense_Mutation_p.T435S|RP11-982M15.2_ENST00000557223.1_RNA|AKT1_ENST00000544168.1_Missense_Mutation_p.T373S|AKT1_ENST00000554585.1_5'UTR|AKT1_ENST00000402615.2_Missense_Mutation_p.T435S|AKT1_ENST00000554192.1_Missense_Mutation_p.T122S|AKT1_ENST00000554848.1_Missense_Mutation_p.T435S|AKT1_ENST00000407796.2_Missense_Mutation_p.T435S|AKT1_ENST00000555528.1_Missense_Mutation_p.T435S|AKT1_ENST00000555458.1_Missense_Mutation_p.T130S			P31749	AKT1_HUMAN	v-akt murine thymoma viral oncogene homolog 1	435	AGC-kinase C-terminal.		T -> P (in CWD6). {ECO:0000269|PubMed:23246288}.		activation-induced cell death of T cells (GO:0006924)|aging (GO:0007568)|anagen (GO:0042640)|apoptotic mitochondrial changes (GO:0008637)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cell projection organization (GO:0030030)|cell proliferation (GO:0008283)|cellular protein modification process (GO:0006464)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cellular response to hypoxia (GO:0071456)|cellular response to insulin stimulus (GO:0032869)|cellular response to mechanical stimulus (GO:0071260)|endocrine pancreas development (GO:0031018)|epidermal growth factor receptor signaling pathway (GO:0007173)|execution phase of apoptosis (GO:0097194)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|gene expression (GO:0010467)|germ cell development (GO:0007281)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glucose transport (GO:0015758)|glycogen biosynthetic process (GO:0005978)|glycogen cell differentiation involved in embryonic placenta development (GO:0060709)|hyaluronan metabolic process (GO:0030212)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway (GO:0097193)|labyrinthine layer blood vessel development (GO:0060716)|mammary gland epithelial cell differentiation (GO:0060644)|maternal placenta development (GO:0001893)|membrane organization (GO:0061024)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of fatty acid beta-oxidation (GO:0031999)|negative regulation of JNK cascade (GO:0046329)|negative regulation of neuron death (GO:1901215)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of proteolysis (GO:0045861)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide metabolic process (GO:0046209)|osteoblast differentiation (GO:0001649)|peptidyl-serine phosphorylation (GO:0018105)|peripheral nervous system myelin maintenance (GO:0032287)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell growth (GO:0030307)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of sodium ion transport (GO:0010765)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein import into nucleus, translocation (GO:0000060)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell cycle checkpoint (GO:1901976)|regulation of cell migration (GO:0030334)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of neuron projection development (GO:0010975)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of translation (GO:0006417)|response to fluid shear stress (GO:0034405)|response to food (GO:0032094)|response to heat (GO:0009408)|response to UV-A (GO:0070141)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|striated muscle cell differentiation (GO:0051146)|T cell costimulation (GO:0031295)|translation (GO:0006412)	cell-cell junction (GO:0005911)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle (GO:0005819)	14-3-3 protein binding (GO:0071889)|ATP binding (GO:0005524)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|kinase activity (GO:0016301)|nitric-oxide synthase regulator activity (GO:0030235)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)			NS(3)|breast(97)|central_nervous_system(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(7)|lung(10)|ovary(2)|pancreas(1)|prostate(6)|skin(5)|thyroid(10)|urinary_tract(15)	176		all_cancers(154;3.77e-06)|all_lung(585;3.24e-07)|all_epithelial(191;3.45e-05)|all_neural(303;0.0459)|Melanoma(154;0.155)	all cancers(16;0.000486)|OV - Ovarian serous cystadenocarcinoma(23;0.00647)|Epithelial(46;0.0153)|GBM - Glioblastoma multiforme(11;0.116)	all cancers(159;0.0107)|OV - Ovarian serous cystadenocarcinoma(161;0.0132)|Epithelial(152;0.243)	Adenosine triphosphate(DB00171)|Arsenic trioxide(DB01169)	AAAATACCTGGTGTCAGTCTC	0.612		1	Mis		"""breast, colorectal, ovarian, NSCLC"""						OREG0022961	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T435S		.		Dom	yes		14	14q32.32	207	v-akt murine thymoma viral oncogene homolog 1		E	.	AKT1-9189	0			c.C1304G						.						123.0	103.0	110.0					14																	105237141		2203	4300	6503	SO:0001583	missense	207	exon13			TACCTGGTGTCAG	M63167	CCDS9994.1	14q32.33	2014-09-17			ENSG00000142208	ENSG00000142208	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	391	protein-coding gene	gene with protein product		164730					Standard	XM_005267401		Approved	RAC, PKB, PRKBA, AKT	uc001ypn.3	P31749	OTTHUMG00000170795	ENST00000554581.1:c.1304C>G	14.37:g.105237141G>C	ENSP00000451828:p.Thr435Ser	44	0	1387	36	2	NM_005163	0	0	144	144	0	B2RAM5|B7Z5R1|Q9BWB6	Missense_Mutation	SNP	ENST00000554581.1	37	CCDS9994.1	.	.	.	.	.	.	.	.	.	.	G	26.4	4.732571	0.89482	.	.	ENSG00000142208	ENST00000554581;ENST00000407796;ENST00000349310;ENST00000402615;ENST00000555528;ENST00000555458;ENST00000554192;ENST00000544168;ENST00000554848	T;T;T;T;T;T;T;T;T	0.68903	-0.36;-0.36;-0.36;-0.36;-0.36;-0.36;-0.36;-0.36;-0.36	4.01	4.01	0.46588	Protein kinase, C-terminal (1);AGC-kinase, C-terminal (2);Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	D	0.84615	0.5511	M	0.93062	3.375	0.80722	D	1	D	0.65815	0.995	D	0.67382	0.951	D	0.89048	0.3453	10	0.87932	D	0	.	15.4048	0.74868	0.0:0.0:1.0:0.0	.	435	P31749	AKT1_HUMAN	S	435;435;435;435;435;130;122;373;435	ENSP00000451828:T435S;ENSP00000384293:T435S;ENSP00000270202:T435S;ENSP00000385326:T435S;ENSP00000450688:T435S;ENSP00000451470:T130S;ENSP00000450681:T122S;ENSP00000443897:T373S;ENSP00000451166:T435S	ENSP00000270202:T435S	T	-	2	0	AKT1	104308186	1.000000	0.71417	1.000000	0.80357	0.834000	0.47266	5.101000	0.64566	2.215000	0.71742	0.467000	0.42956	ACC	.		0.612	AKT1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410418.1	NM_005163	
PKD1	5310	hgsc.bcm.edu	37	16	2168405	2168405	+	Silent	SNP	G	G	A			TCGA-BQ-5891-01A-11D-1589-08	TCGA-BQ-5891-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	37d4ff42-0161-4f83-bd6f-13eb19d4eabf	28824279-2be9-45db-867a-b165d8191d0c	g.chr16:2168405G>A	ENST00000262304.4	-	5	796	c.588C>T	c.(586-588)tcC>tcT	p.S196S	PKD1_ENST00000423118.1_Silent_p.S196S|RP11-304L19.2_ENST00000562027.1_RNA	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	196	WSC. {ECO:0000255|PROSITE- ProRule:PRU00558}.				anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						CAGCTGAAAAGGACACTGCTG	0.652																																					p.S196S		.											.	PKD1-91	0			c.C588T						.						1.0	2.0	2.0					16																	2168405		867	1809	2676	SO:0001819	synonymous_variant	5310	exon5			TGAAAAGGACACT	L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.588C>T	16.37:g.2168405G>A		27	0		37	8	NM_000296	0	0	48	51	3	Q15140|Q15141	Silent	SNP	ENST00000262304.4	37	CCDS32369.1																																																																																			.		0.652	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341688.1		
RANBP10	57610	hgsc.bcm.edu;broad.mit.edu	37	16	67840335	67840335	+	Silent	SNP	C	C	T			TCGA-BQ-5891-01A-11D-1589-08	TCGA-BQ-5891-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	37d4ff42-0161-4f83-bd6f-13eb19d4eabf	28824279-2be9-45db-867a-b165d8191d0c	g.chr16:67840335C>T	ENST00000317506.3	-	1	220	c.105G>A	c.(103-105)ctG>ctA	p.L35L	RANBP10_ENST00000536251.1_5'UTR|RANBP10_ENST00000411657.2_5'UTR|RANBP10_ENST00000448631.2_Silent_p.L35L|RANBP10_ENST00000602887.1_5'UTR|TSNAXIP1_ENST00000415766.3_5'Flank|TSNAXIP1_ENST00000388833.3_5'Flank|RANBP10_ENST00000425512.2_5'UTR|TSNAXIP1_ENST00000561639.1_5'Flank|RANBP10_ENST00000602677.1_Silent_p.L35L	NM_020850.1	NP_065901.1	Q6VN20	RBP10_HUMAN	RAN binding protein 10	35	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				microtubule cytoskeleton organization (GO:0000226)	cytoplasmic microtubule (GO:0005881)|nucleus (GO:0005634)	Ran guanyl-nucleotide exchange factor activity (GO:0005087)			endometrium(5)|kidney(2)|large_intestine(3)|lung(10)|ovary(2)|skin(1)	23		Acute lymphoblastic leukemia(13;4.34e-06)|all_hematologic(13;0.000643)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.00522)|Epithelial(162;0.025)|all cancers(182;0.157)		AGCGCCGGCTCAGCTCCTGCT	0.701																																					p.L35L		.											.	RANBP10-227	0			c.G105A						.						14.0	15.0	15.0					16																	67840335		2183	4253	6436	SO:0001819	synonymous_variant	57610	exon1			CCGGCTCAGCTCC	AB040897	CCDS32469.1	16q22	2008-02-05				ENSG00000141084			29285	protein-coding gene	gene with protein product		614031				14684163	Standard	NM_020850		Approved	KIAA1464	uc002eud.3	Q6VN20		ENST00000317506.3:c.105G>A	16.37:g.67840335C>T		14	0		18	6	NM_020850	0	0	9	15	6	A4FTY2|B4DID0|B4DQH9|E7EW27|Q9P264	Silent	SNP	ENST00000317506.3	37	CCDS32469.1																																																																																			.		0.701	RANBP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467896.1	NM_020850	
ZFHX3	463	broad.mit.edu	37	16	72984648	72984648	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-5891-01A-11D-1589-08	TCGA-BQ-5891-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37d4ff42-0161-4f83-bd6f-13eb19d4eabf	28824279-2be9-45db-867a-b165d8191d0c	g.chr16:72984648A>C	ENST00000268489.5	-	3	3608	c.2936T>G	c.(2935-2937)gTg>gGg	p.V979G	ZFHX3_ENST00000397992.5_Missense_Mutation_p.V65G	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	979					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				GTCCCCCATCACCGCCTTCCA	0.592																																					p.V979G													.	ZFHX3-72	0			c.T2936G						.						128.0	112.0	117.0					16																	72984648		2198	4300	6498	SO:0001583	missense	463	exon3			CCCATCACCGCCT	D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.2936T>G	16.37:g.72984648A>C	ENSP00000268489:p.Val979Gly	69	1		113	8	NM_006885	0	1	6	7	0	D3DWS8|O15101|Q13719	Missense_Mutation	SNP	ENST00000268489.5	37	CCDS10908.1	.	.	.	.	.	.	.	.	.	.	A	12.34	1.908930	0.33721	.	.	ENSG00000140836	ENST00000268489;ENST00000397992	T;T	0.53857	0.6;0.6	5.22	5.22	0.72569	.	0.000000	0.45126	D	0.000397	T	0.61986	0.2391	M	0.70595	2.14	0.80722	D	1	P	0.52316	0.952	P	0.52957	0.714	T	0.66972	-0.5788	10	0.87932	D	0	.	10.3495	0.43927	0.9231:0.0:0.0769:0.0	.	979	Q15911	ZFHX3_HUMAN	G	979;65	ENSP00000268489:V979G;ENSP00000438926:V65G	ENSP00000268489:V979G	V	-	2	0	ZFHX3	71542149	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.334000	0.72944	1.959000	0.56917	0.533000	0.62120	GTG	.		0.592	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269008.1	NM_006885	
TVP23C	201158	ucsc.edu	37	17	15457087	15457087	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5891-01A-11D-1589-08	TCGA-BQ-5891-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	37d4ff42-0161-4f83-bd6f-13eb19d4eabf	28824279-2be9-45db-867a-b165d8191d0c	g.chr17:15457087C>T	ENST00000225576.3	-	3	247	c.152G>A	c.(151-153)tGt>tAt	p.C51Y	TVP23C_ENST00000519970.1_Intron|TVP23C-CDRT4_ENST00000522212.2_Missense_Mutation_p.C51Y|TVP23C_ENST00000584811.1_5'UTR|TVP23C_ENST00000438826.3_Missense_Mutation_p.C51Y|TVP23C_ENST00000518321.1_Missense_Mutation_p.C51Y|TVP23C_ENST00000428082.2_Missense_Mutation_p.C51Y	NM_145301.2	NP_660344.2	Q96ET8	TV23C_HUMAN	trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)	51						integral component of membrane (GO:0016021)											ACAGAGAAGACAGACGATGAT	0.373																																					p.C51Y													.	.	0			c.G152A						.						274.0	265.0	268.0					17																	15457087		2203	4300	6503	SO:0001583	missense	201158	exon3			AGAAGACAGACGA	BC011952	CCDS11170.1, CCDS45617.1	17p12	2012-11-29	2012-11-29	2012-11-29	ENSG00000175106	ENSG00000175106			30453	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B2"""	FAM18B2			Standard	NM_001135036		Approved	MGC8763	uc002goq.2	Q96ET8	OTTHUMG00000171461	ENST00000225576.3:c.152G>A	17.37:g.15457087C>T	ENSP00000225576:p.Cys51Tyr	496	71		793	114	NM_145301	0	0	12	97	85	Q3LIC7	Missense_Mutation	SNP	ENST00000225576.3	37	CCDS11170.1	.	.	.	.	.	.	.	.	.	.	.	2.368	-0.344949	0.05208	.	.	ENSG00000259024;ENSG00000175106;ENSG00000175106;ENSG00000175106	ENST00000522212;ENST00000225576;ENST00000428082;ENST00000438826	T;T;T;T	0.25749	1.78;1.78;1.78;1.78	4.47	4.47	0.54385	.	0.000000	0.85682	N	0.000000	T	0.02571	0.0078	N	0.00004	-3.335	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.0;0.0;0.002	T	0.38457	-0.9660	10	0.02654	T	1	-3.8701	9.492	0.38965	0.0:0.0877:0.0:0.9123	.	51;51;51	Q96ET8-2;Q96ET8-3;Q96ET8	.;.;F18B2_HUMAN	Y	51	ENSP00000429865:C51Y;ENSP00000225576:C51Y;ENSP00000406387:C51Y;ENSP00000413355:C51Y	ENSP00000225576:C51Y	C	-	2	0	RP11-726O12.1;FAM18B2	15397812	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	6.178000	0.71968	0.670000	0.31165	-0.442000	0.05670	TGT	.		0.373	TVP23C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000130705.2	NM_145301	
AKAP10	11216	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	19861611	19861611	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5891-01A-11D-1589-08	TCGA-BQ-5891-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	37d4ff42-0161-4f83-bd6f-13eb19d4eabf	28824279-2be9-45db-867a-b165d8191d0c	g.chr17:19861611A>G	ENST00000225737.6	-	4	750	c.593T>C	c.(592-594)tTt>tCt	p.F198S	AKAP10_ENST00000572155.1_5'Flank|AKAP10_ENST00000395536.3_Missense_Mutation_p.F198S	NM_007202.3	NP_009133.2	O43572	AKA10_HUMAN	A kinase (PRKA) anchor protein 10	198	RGS 1. {ECO:0000255|PROSITE- ProRule:PRU00171}.				blood coagulation (GO:0007596)|protein localization (GO:0008104)|signal transduction (GO:0007165)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)				NS(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(3)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(2)	21	all_cancers(12;2.08e-05)|all_epithelial(12;0.00158)|Breast(13;0.165)					ATCAGTTAAAAAAGACGCTGT	0.418																																					p.F198S		.											.	AKAP10-226	0			c.T593C						.						65.0	65.0	65.0					17																	19861611		2203	4300	6503	SO:0001583	missense	11216	exon4			GTTAAAAAAGACG	AF037439	CCDS11214.1	17p11.1	2008-07-18			ENSG00000108599	ENSG00000108599		"""A-kinase anchor proteins"""	368	protein-coding gene	gene with protein product	"""dual-specificity A-kinase anchoring protein 2"", ""protein kinase A anchoring protein 10"", ""mitochondrial A kinase PPKA anchor protein 10"""	604694				9326583	Standard	NM_007202		Approved	D-AKAP2, PRKA10, MGC9414	uc002gwo.4	O43572	OTTHUMG00000059515	ENST00000225737.6:c.593T>C	17.37:g.19861611A>G	ENSP00000225737:p.Phe198Ser	73	0		99	49	NM_007202	0	0	17	26	9	B2R650|Q96AJ7	Missense_Mutation	SNP	ENST00000225737.6	37	CCDS11214.1	.	.	.	.	.	.	.	.	.	.	A	5.074	0.199347	0.09652	.	.	ENSG00000108599	ENST00000225737;ENST00000395536	T	0.17054	2.3	5.98	3.72	0.42706	Regulator of G protein signalling (2);Regulator of G protein signalling superfamily (1);	0.607188	0.19356	N	0.116264	T	0.05914	0.0154	N	0.03115	-0.41	0.24009	N	0.996183	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.08055	0.003;0.0;0.0	T	0.42068	-0.9473	10	0.06236	T	0.91	-3.1154	7.7403	0.28837	0.6869:0.0:0.3131:0.0	.	198;198;198	E7EMD6;Q2XPN4;O43572	.;.;AKA10_HUMAN	S	198	ENSP00000225737:F198S	ENSP00000225737:F198S	F	-	2	0	AKAP10	19802203	1.000000	0.71417	0.995000	0.50966	0.345000	0.29048	1.891000	0.39738	0.471000	0.27319	0.482000	0.46254	TTT	.		0.418	AKAP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132380.2	NM_007202	
SLC14A1	6563	bcgsc.ca	37	18	43319599	43319599	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BQ-5891-01A-11D-1589-08	TCGA-BQ-5891-11A-01D-1589-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	37d4ff42-0161-4f83-bd6f-13eb19d4eabf	28824279-2be9-45db-867a-b165d8191d0c	g.chr18:43319599G>A	ENST00000321925.4	+	8	1150	c.918G>A	c.(916-918)tgG>tgA	p.W306*	SLC14A1_ENST00000502059.2_Nonsense_Mutation_p.W198*|SLC14A1_ENST00000535474.1_Nonsense_Mutation_p.W174*|SLC14A1_ENST00000415427.3_Nonsense_Mutation_p.W362*|SLC14A1_ENST00000591541.1_Nonsense_Mutation_p.W10*|RP11-116O18.3_ENST00000589510.1_RNA|SLC14A1_ENST00000589700.1_Missense_Mutation_p.G257D|SLC14A1_ENST00000402943.2_Nonsense_Mutation_p.W201*|SLC14A1_ENST00000586142.1_Nonsense_Mutation_p.W306*|SLC14A1_ENST00000436407.3_Nonsense_Mutation_p.W362*|RP11-116O18.3_ENST00000586213.1_RNA	NM_001128588.3|NM_001146036.2|NM_015865.6	NP_001122060.3|NP_001139508.2|NP_056949.4	Q13336	UT1_HUMAN	solute carrier family 14 (urea transporter), member 1 (Kidd blood group)	306					transmembrane transport (GO:0055085)|urea transmembrane transport (GO:0071918)|urea transport (GO:0015840)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	urea channel activity (GO:0015265)|urea transmembrane transporter activity (GO:0015204)|water transmembrane transporter activity (GO:0005372)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(11)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	21						CGCTCACCTGGCAAACCCACC	0.537																																					p.W362X													.	SLC14A1-515	0			c.G1086A						.						100.0	86.0	91.0					18																	43319599		2203	4300	6503	SO:0001587	stop_gained	6563	exon7			CACCTGGCAAACC	BC040128	CCDS11925.1, CCDS45860.1	18q11-q12	2014-07-19	2014-01-02		ENSG00000141469	ENSG00000141469		"""Blood group antigens"", ""Solute carriers"""	10918	protein-coding gene	gene with protein product		613868	"""Kidd blood group"", ""solute carrier family 14 (urea transporter), member 1"""	JK		7797558	Standard	NM_001146037		Approved	HsT1341, RACH1, RACH2	uc010dnk.3	Q13336	OTTHUMG00000132617	ENST00000321925.4:c.918G>A	18.37:g.43319599G>A	ENSP00000318546:p.Trp306*	124	0		91	5	NM_001146037	0	0	0	0	0	A8K0P3|B3KR62|B3KVX3|C9EHF2|Q86VM5	Nonsense_Mutation	SNP	ENST00000321925.4	37	CCDS11925.1	.	.	.	.	.	.	.	.	.	.	G	41	8.740906	0.98935	.	.	ENSG00000141469	ENST00000321925;ENST00000415427;ENST00000502059;ENST00000402943;ENST00000535474;ENST00000436407	.	.	.	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.6308	18.6387	0.91387	0.0:0.0:1.0:0.0	.	.	.	.	X	306;362;198;201;174;362	.	ENSP00000318546:W306X	W	+	3	0	SLC14A1	41573597	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.159000	0.94728	2.640000	0.89533	0.591000	0.81541	TGG	.		0.537	SLC14A1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255860.2	NM_015865	
MUC16	94025	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	9065718	9065718	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5891-01A-11D-1589-08	TCGA-BQ-5891-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	37d4ff42-0161-4f83-bd6f-13eb19d4eabf	28824279-2be9-45db-867a-b165d8191d0c	g.chr19:9065718G>T	ENST00000397910.4	-	3	21931	c.21728C>A	c.(21727-21729)tCc>tAc	p.S7243Y		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	7245	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AGGGCTCAGGGAGGAAATTGA	0.468																																					p.S7243Y		.											.	MUC16-566	0			c.C21728A						.						169.0	161.0	164.0					19																	9065718		1979	4157	6136	SO:0001583	missense	94025	exon3			CTCAGGGAGGAAA	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.21728C>A	19.37:g.9065718G>T	ENSP00000381008:p.Ser7243Tyr	198	0		220	16	NM_024690	0	0	0	0	0	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	3.932	-0.016036	0.07681	.	.	ENSG00000181143	ENST00000397910	T	0.02737	4.18	2.75	-0.661	0.11417	.	.	.	.	.	T	0.06962	0.0177	L	0.42245	1.32	.	.	.	D	0.65815	0.995	D	0.68943	0.961	T	0.29274	-1.0017	8	0.87932	D	0	.	5.0419	0.14463	0.4634:0.0:0.5366:0.0	.	7243	B5ME49	.	Y	7243	ENSP00000381008:S7243Y	ENSP00000381008:S7243Y	S	-	2	0	MUC16	8926718	0.015000	0.18098	0.000000	0.03702	0.007000	0.05969	2.004000	0.40854	-0.046000	0.13446	0.195000	0.17529	TCC	.		0.468	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
ZNF761	388561	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	53958709	53958709	+	RNA	SNP	T	T	A			TCGA-BQ-5891-01A-11D-1589-08	TCGA-BQ-5891-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	37d4ff42-0161-4f83-bd6f-13eb19d4eabf	28824279-2be9-45db-867a-b165d8191d0c	g.chr19:53958709T>A	ENST00000454407.1	+	0	1401							Q86XN6	ZN761_HUMAN	zinc finger protein 761						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	30				GBM - Glioblastoma multiforme(134;0.00786)		TTGAAAGACATAGGATAATTC	0.383																																					p.H316Q		.											.	ZNF761-91	0			c.T948A						.						83.0	85.0	85.0					19																	53958709		2203	4300	6503			388561	exon7			AAGACATAGGATA	AB107355		19q13.42	2007-10-05	2006-08-11	2006-08-11	ENSG00000160336	ENSG00000160336		"""Zinc fingers, C2H2-type"""	23179	protein-coding gene	gene with protein product							Standard	NM_001008401		Approved	KIAA2033, FLJ16231, FLJ35333	uc010eqp.3	Q86XN6	OTTHUMG00000156999		19.37:g.53958709T>A		114	0		114	97	NM_001008401	0	0	0	0	0	Q6ZNB9	Missense_Mutation	SNP	ENST00000454407.1	37																																																																																				.		0.383	ZNF761-203	KNOWN	basic	processed_transcript	processed_transcript		NM_001008401	
ZNF761	388561	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	53958711	53958711	+	RNA	SNP	G	G	A			TCGA-BQ-5891-01A-11D-1589-08	TCGA-BQ-5891-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	37d4ff42-0161-4f83-bd6f-13eb19d4eabf	28824279-2be9-45db-867a-b165d8191d0c	g.chr19:53958711G>A	ENST00000454407.1	+	0	1403							Q86XN6	ZN761_HUMAN	zinc finger protein 761						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	30				GBM - Glioblastoma multiforme(134;0.00786)		GAAAGACATAGGATAATTCAT	0.383																																					p.R317K		.											.	ZNF761-91	0			c.G950A						.						84.0	85.0	85.0					19																	53958711		2203	4300	6503			388561	exon7			GACATAGGATAAT	AB107355		19q13.42	2007-10-05	2006-08-11	2006-08-11	ENSG00000160336	ENSG00000160336		"""Zinc fingers, C2H2-type"""	23179	protein-coding gene	gene with protein product							Standard	NM_001008401		Approved	KIAA2033, FLJ16231, FLJ35333	uc010eqp.3	Q86XN6	OTTHUMG00000156999		19.37:g.53958711G>A		115	0		114	98	NM_001008401	0	0	0	0	0	Q6ZNB9	Missense_Mutation	SNP	ENST00000454407.1	37																																																																																				.		0.383	ZNF761-203	KNOWN	basic	processed_transcript	processed_transcript		NM_001008401	
XPO1	7514	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	61709536	61709536	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5891-01A-11D-1589-08	TCGA-BQ-5891-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	37d4ff42-0161-4f83-bd6f-13eb19d4eabf	28824279-2be9-45db-867a-b165d8191d0c	g.chr2:61709536G>A	ENST00000401558.2	-	23	3678	c.2951C>T	c.(2950-2952)tCg>tTg	p.S984L	RP11-355B11.2_ENST00000603028.1_RNA|RP11-355B11.2_ENST00000578974.2_RNA|RP11-355B11.2_ENST00000603652.1_RNA|RP11-355B11.2_ENST00000603199.1_RNA|XPO1_ENST00000404992.2_Missense_Mutation_p.S984L|XPO1_ENST00000406957.1_Missense_Mutation_p.S984L|RP11-355B11.2_ENST00000605437.1_RNA	NM_003400.3	NP_003391.1	O14980	XPO1_HUMAN	exportin 1	984					gene expression (GO:0010467)|intracellular transport of virus (GO:0075733)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|mRNA transport (GO:0051028)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein export from nucleus (GO:0006611)|protein localization to nucleus (GO:0034504)|regulation of centrosome duplication (GO:0010824)|regulation of protein catabolic process (GO:0042176)|regulation of protein export from nucleus (GO:0046825)|response to drug (GO:0042493)|ribosomal large subunit export from nucleus (GO:0000055)|ribosomal small subunit export from nucleus (GO:0000056)|RNA metabolic process (GO:0016070)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral life cycle (GO:0019058)|viral process (GO:0016032)	annulate lamellae (GO:0005642)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleocytoplasmic transporter activity (GO:0005487)|protein transporter activity (GO:0008565)|RNA binding (GO:0003723)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(5)|lung(5)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	39			LUSC - Lung squamous cell carcinoma(7;5.71e-05)|Epithelial(17;0.0662)|all cancers(80;0.226)			AGGGAAGGCCGACTTAAGGAG	0.398			Mis		CLL																																p.S984L		.	-'	Dom	yes		2	2p15	7514	"""exportin 1 (CRM1 homolog, yeast)"""		L	.	XPO1-229	0			c.C2951T						.						129.0	130.0	129.0					2																	61709536		2203	4300	6503	SO:0001583	missense	7514	exon23			AAGGCCGACTTAA	Y08614	CCDS33205.1	2p15	2014-02-19	2014-02-19		ENSG00000082898	ENSG00000082898		"""Exportins"""	12825	protein-coding gene	gene with protein product	"""chromosome region maintenance 1 homolog (yeast)"""	602559	"""exportin 1 (CRM1, yeast, homolog)"", ""exportin 1 (CRM1 homolog, yeast)"""			9205132, 9368044	Standard	XM_005264544		Approved	CRM1, emb	uc002sbj.3	O14980	OTTHUMG00000152316	ENST00000401558.2:c.2951C>T	2.37:g.61709536G>A	ENSP00000384863:p.Ser984Leu	156	0		128	12	NM_003400	0	0	107	123	16	A6NL14|A8K1K5|D6W5E2|Q63HP8|Q68CP3|Q99433	Missense_Mutation	SNP	ENST00000401558.2	37	CCDS33205.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.953001	0.73902	.	.	ENSG00000082898	ENST00000401558;ENST00000404992;ENST00000406957	T;T;T	0.68025	-0.3;-0.3;-0.3	5.46	5.46	0.80206	Armadillo-like helical (1);Armadillo-type fold (2);Exportin 1, C-terminal (1);	0.055426	0.85682	D	0.000000	T	0.68366	0.2993	M	0.75615	2.305	0.58432	D	0.999998	B;B	0.31752	0.338;0.233	B;B	0.24848	0.034;0.056	T	0.70883	-0.4751	10	0.66056	D	0.02	-16.6961	19.6691	0.95903	0.0:0.0:1.0:0.0	.	631;984	B3KWD0;O14980	.;XPO1_HUMAN	L	984	ENSP00000384863:S984L;ENSP00000385942:S984L;ENSP00000385559:S984L	ENSP00000384863:S984L	S	-	2	0	XPO1	61563040	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	7.529000	0.81952	2.721000	0.93114	0.591000	0.81541	TCG	.		0.398	XPO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325872.3	NM_003400	
LRP1B	53353	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	141643776	141643776	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5891-01A-11D-1589-08	TCGA-BQ-5891-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	37d4ff42-0161-4f83-bd6f-13eb19d4eabf	28824279-2be9-45db-867a-b165d8191d0c	g.chr2:141643776G>C	ENST00000389484.3	-	24	4866	c.3895C>G	c.(3895-3897)Caa>Gaa	p.Q1299E		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	1299					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.Q1299K(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		AGTAAACTTTGATTGAAGTGA	0.328										TSP Lung(27;0.18)																											p.Q1299E	Colon(99;50 2074 2507 20106)	.											.	LRP1B-311	1	Substitution - Missense(1)	endometrium(1)	c.C3895G						.						77.0	79.0	78.0					2																	141643776		2202	4299	6501	SO:0001583	missense	53353	exon24			AACTTTGATTGAA	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.3895C>G	2.37:g.141643776G>C	ENSP00000374135:p.Gln1299Glu	97	0		97	80	NM_018557	0	0	0	0	0	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	G	16.51	3.144239	0.57044	.	.	ENSG00000168702	ENST00000389484;ENST00000544579;ENST00000434794	D;D	0.90620	-2.7;-2.7	5.68	5.68	0.88126	Six-bladed beta-propeller, TolB-like (1);	0.140025	0.48767	D	0.000173	T	0.81597	0.4856	N	0.13043	0.29	0.42707	D	0.993639	B;B	0.34015	0.009;0.435	B;B	0.24974	0.009;0.057	T	0.79825	-0.1640	10	0.12430	T	0.62	.	19.7974	0.96491	0.0:0.0:1.0:0.0	.	482;1299	Q96NT6;Q9NZR2	.;LRP1B_HUMAN	E	1299;1237;444	ENSP00000374135:Q1299E;ENSP00000413239:Q444E	ENSP00000374135:Q1299E	Q	-	1	0	LRP1B	141360246	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.640000	0.98453	2.673000	0.90976	0.650000	0.86243	CAA	.		0.328	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
ARL6IP6	151188	broad.mit.edu	37	2	153591621	153591621	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5891-01A-11D-1589-08	TCGA-BQ-5891-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37d4ff42-0161-4f83-bd6f-13eb19d4eabf	28824279-2be9-45db-867a-b165d8191d0c	g.chr2:153591621C>T	ENST00000326446.5	+	3	1279	c.568C>T	c.(568-570)Ctt>Ttt	p.L190F	ARL6IP6_ENST00000463690.1_3'UTR	NM_152522.5	NP_689735.1	Q8N6S5	AR6P6_HUMAN	ADP-ribosylation factor-like 6 interacting protein 6	190						integral component of membrane (GO:0016021)				kidney(1)|large_intestine(1)|lung(2)|pancreas(1)	5						TCCTACTCCTCTTTCACCTGC	0.378																																					p.L190F													.	ARL6IP6-90	0			c.C568T						.						121.0	117.0	118.0					2																	153591621		2202	4300	6502	SO:0001583	missense	151188	exon3			ACTCCTCTTTCAC	AK023109	CCDS2197.1	2q23	2014-05-12	2014-05-12		ENSG00000177917	ENSG00000177917			24048	protein-coding gene	gene with protein product							Standard	NM_152522		Approved	MGC33864	uc002tyn.3	Q8N6S5	OTTHUMG00000131901	ENST00000326446.5:c.568C>T	2.37:g.153591621C>T	ENSP00000315357:p.Leu190Phe	179	0		134	5	NM_152522	0	0	33	34	1	B2RDS6|Q7Z4G7	Missense_Mutation	SNP	ENST00000326446.5	37	CCDS2197.1	.	.	.	.	.	.	.	.	.	.	C	20.5	3.996919	0.74818	.	.	ENSG00000177917	ENST00000326446	.	.	.	5.87	5.0	0.66597	.	0.180871	0.36134	N	0.002768	T	0.64216	0.2578	M	0.69823	2.125	0.54753	D	0.999986	B;P	0.50272	0.197;0.933	B;P	0.47786	0.09;0.557	T	0.69935	-0.5010	9	0.87932	D	0	-18.2762	13.9229	0.63942	0.0:0.9261:0.0:0.0739	.	190;190	B3KMZ5;Q8N6S5	.;AR6P6_HUMAN	F	190	.	ENSP00000315357:L190F	L	+	1	0	ARL6IP6	153299867	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.883000	0.69721	1.498000	0.48600	-0.136000	0.14681	CTT	.		0.378	ARL6IP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254852.3	NM_152522	
FSIP2	401024	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	186671400	186671400	+	Silent	SNP	T	T	C			TCGA-BQ-5891-01A-11D-1589-08	TCGA-BQ-5891-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	37d4ff42-0161-4f83-bd6f-13eb19d4eabf	28824279-2be9-45db-867a-b165d8191d0c	g.chr2:186671400T>C	ENST00000424728.1	+	17	17367	c.17367T>C	c.(17365-17367)gaT>gaC	p.D5789D	FSIP2_ENST00000343098.5_Silent_p.D5878D			Q5CZC0	FSIP2_HUMAN	fibrous sheath interacting protein 2	5789										NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(11)|lung(46)|pancreas(1)|urinary_tract(2)	69						TTTTAGAAGATGTTATTACTG	0.333																																					p.D5878D		.											.	FSIP2-90	0			c.T17634C						.						74.0	70.0	71.0					2																	186671400		1805	4076	5881	SO:0001819	synonymous_variant	401024	exon17			AGAAGATGTTATT	AK092099	CCDS54426.1	2q32.1	2010-06-18			ENSG00000188738	ENSG00000188738			21675	protein-coding gene	gene with protein product		615796				14702039	Standard	NM_173651		Approved	FLJ34780	uc002upl.3	Q5CZC0	OTTHUMG00000153874	ENST00000424728.1:c.17367T>C	2.37:g.186671400T>C		89	1		62	60	NM_173651	0	0	0	0	0	Q53TL3|Q53TN5|Q5HYH2|Q6ZTZ5|Q6ZU14|Q6ZU21	Silent	SNP	ENST00000424728.1	37																																																																																				.		0.333	FSIP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000332778.3	NM_173651	
ACADL	33	bcgsc.ca	37	2	211057527	211057527	+	Splice_Site	SNP	C	C	G			TCGA-BQ-5891-01A-11D-1589-08	TCGA-BQ-5891-11A-01D-1589-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	37d4ff42-0161-4f83-bd6f-13eb19d4eabf	28824279-2be9-45db-867a-b165d8191d0c	g.chr2:211057527C>G	ENST00000233710.3	-	10	1427		c.e10+1		AC006994.2_ENST00000412065.1_RNA	NM_001608.3	NP_001599.1	P28330	ACADL_HUMAN	acyl-CoA dehydrogenase, long chain						carnitine catabolic process (GO:0042413)|carnitine metabolic process, CoA-linked (GO:0019254)|cellular lipid catabolic process (GO:0044242)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)|long-chain fatty acid catabolic process (GO:0042758)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of fatty acid oxidation (GO:0046322)|oxidation-reduction process (GO:0055114)|protein homotetramerization (GO:0051289)|regulation of cholesterol metabolic process (GO:0090181)|small molecule metabolic process (GO:0044281)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrion (GO:0005739)	acyl-CoA dehydrogenase activity (GO:0003995)|fatty-acyl-CoA binding (GO:0000062)|flavin adenine dinucleotide binding (GO:0050660)|long-chain-acyl-CoA dehydrogenase activity (GO:0004466)|palmitoyl-CoA oxidase activity (GO:0016401)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	14		Renal(323;0.202)		Epithelial(149;0.00631)|Lung(261;0.0438)|LUSC - Lung squamous cell carcinoma(261;0.0466)|all cancers(144;0.0621)		ACTATACTTACTTTGCAATTG	0.383																																					.													.	ACADL-90	0			c.1199+1G>C						.						78.0	73.0	74.0					2																	211057527		2203	4300	6503	SO:0001630	splice_region_variant	33	exon11			TACTTACTTTGCA	M74096	CCDS2389.1	2q34	2012-07-13	2010-04-30		ENSG00000115361	ENSG00000115361	1.3.99.13		88	protein-coding gene	gene with protein product		609576	"""acyl-Coenzyme A dehydrogenase, long chain"""			1774065	Standard	NM_001608		Approved	LCAD, ACAD4	uc002vdz.4	P28330	OTTHUMG00000132989	ENST00000233710.3:c.1199+1G>C	2.37:g.211057527C>G		63	0		67	63	NM_001608	0	0	0	0	0	B2R8T3|Q8IUN8	Splice_Site	SNP	ENST00000233710.3	37	CCDS2389.1	.	.	.	.	.	.	.	.	.	.	C	19.13	3.767632	0.69878	.	.	ENSG00000115361	ENST00000233710	.	.	.	6.03	6.03	0.97812	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.1672	0.98154	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ACADL	210765772	1.000000	0.71417	1.000000	0.80357	0.623000	0.37688	6.963000	0.76055	2.861000	0.98227	0.655000	0.94253	.	.		0.383	ACADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256561.2	NM_001608	Intron
GGTLC1	92086	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	23967129	23967129	+	Silent	SNP	C	C	T			TCGA-BQ-5891-01A-11D-1589-08	TCGA-BQ-5891-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	37d4ff42-0161-4f83-bd6f-13eb19d4eabf	28824279-2be9-45db-867a-b165d8191d0c	g.chr20:23967129C>T	ENST00000335694.4	-	2	324	c.120G>A	c.(118-120)ctG>ctA	p.L40L	GGTLC1_ENST00000286890.4_Silent_p.L40L|GGTLC1_ENST00000278765.4_Silent_p.L40L	NM_178311.2	NP_842563.1	Q9BX51	GGTL1_HUMAN	gamma-glutamyltransferase light chain 1	40					glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)	anchored component of external side of plasma membrane (GO:0031362)	gamma-glutamyltransferase activity (GO:0003840)			NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	15						CGACCACAGACAGGTGAGCAG	0.647																																					p.L40L		.											.	GGTLC1-23	0			c.G120A						.						51.0	45.0	47.0					20																	23967129		2203	4300	6503	SO:0001819	synonymous_variant	92086	exon2			CACAGACAGGTGA	AL133466	CCDS13163.1	20p11.21	2010-07-14	2008-03-10	2008-03-10	ENSG00000149435	ENSG00000149435		"""Gamma-glutamyltransferases"""	16437	protein-coding gene	gene with protein product		612338	"""gamma-glutamyltransferase-like activity 4"", ""gamma-glutamyltransferase-like activity 3"""	GGTLA4, GGTLA3		10843999, 18357469	Standard	NM_178311		Approved	dJ831C21.2, dJ831C21.1	uc002wtu.3	Q9BX51	OTTHUMG00000032095	ENST00000335694.4:c.120G>A	20.37:g.23967129C>T		56	0		101	56	NM_178311	0	0	0	0	0	D3DW43|Q08246	Silent	SNP	ENST00000335694.4	37	CCDS13163.1																																																																																			.		0.647	GGTLC1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078366.2	NM_178311.2	
MATN4	8785	broad.mit.edu	37	20	43927153	43927153	+	Silent	SNP	G	G	A			TCGA-BQ-5891-01A-11D-1589-08	TCGA-BQ-5891-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37d4ff42-0161-4f83-bd6f-13eb19d4eabf	28824279-2be9-45db-867a-b165d8191d0c	g.chr20:43927153G>A	ENST00000372754.1	-	7	1214	c.1206C>T	c.(1204-1206)ttC>ttT	p.F402F	MATN4_ENST00000353917.5_Silent_p.F279F|MATN4_ENST00000537548.1_Silent_p.F361F|MATN4_ENST00000372756.1_Silent_p.F361F|MATN4_ENST00000342716.4_Silent_p.F361F|MATN4_ENST00000360607.6_Silent_p.F320F|MATN4_ENST00000372751.4_Silent_p.F212F			O95460	MATN4_HUMAN	matrilin 4	402	VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				extracellular matrix organization (GO:0030198)|response to axon injury (GO:0048678)	extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	27		Myeloproliferative disorder(115;0.0122)				TCACTAGCTCGAAGTTTTGTG	0.597																																					p.F361F													.	MATN4-90	0			c.C1083T						.						82.0	69.0	73.0					20																	43927153		2203	4300	6503	SO:0001819	synonymous_variant	8785	exon7			TAGCTCGAAGTTT	AJ007581	CCDS13348.1, CCDS46607.1	20q13.1-q13.2	2008-07-07			ENSG00000124159	ENSG00000124159			6910	protein-coding gene	gene with protein product		603897				9827539, 9027493	Standard	NM_003833		Approved		uc002xnn.2	O95460	OTTHUMG00000033043	ENST00000372754.1:c.1206C>T	20.37:g.43927153G>A		83	0		236	7	NM_003833	0	0	0	0	0	A6NH94|A6NKN5|Q5QPU2|Q5QPU3|Q5QPU4|Q8N2M5|Q8N2M7|Q9H1F8|Q9H1F9	Silent	SNP	ENST00000372754.1	37																																																																																				.		0.597	MATN4-002	KNOWN	non_canonical_conserved|non_canonical_U12|not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000080335.1		
OGFR	11054	hgsc.bcm.edu	37	20	61443716	61443716	+	Missense_Mutation	SNP	G	G	A	rs41309371	byFrequency	TCGA-BQ-5891-01A-11D-1589-08	TCGA-BQ-5891-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	37d4ff42-0161-4f83-bd6f-13eb19d4eabf	28824279-2be9-45db-867a-b165d8191d0c	g.chr20:61443716G>A	ENST00000290291.6	+	7	774	c.749G>A	c.(748-750)cGg>cAg	p.R250Q	OGFR_ENST00000370461.1_Missense_Mutation_p.R198Q	NM_007346.2	NP_031372.2	Q9NZT2	OGFR_HUMAN	opioid growth factor receptor	250					opioid receptor signaling pathway (GO:0038003)|regulation of cell growth (GO:0001558)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	opioid receptor activity (GO:0004985)			endometrium(2)|kidney(1)|lung(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	17	Breast(26;3.65e-08)					CCGGGGGTGCGGCAGAGTGCC	0.697													G|||	77	0.0153754	0.0	0.0072	5008	,	,		10012	0.0099		0.0109	False		,,,				2504	0.0521				p.R250Q		.											.	OGFR-68	0			c.G749A						.	G	GLN/ARG	13,4267		0,13,2127	12.0	12.0	12.0		749	3.5	1.0	20	dbSNP_127	12	167,8295		0,167,4064	yes	missense	OGFR	NM_007346.2	43	0,180,6191	AA,AG,GG		1.9735,0.3037,1.4127	probably-damaging	250/678	61443716	180,12562	2140	4231	6371	SO:0001583	missense	11054	exon7			GGGTGCGGCAGAG	AF109134	CCDS13504.1	20q13.3	2008-05-02			ENSG00000060491	ENSG00000060491			15768	protein-coding gene	gene with protein product		606459				10677613	Standard	NM_007346		Approved	7-60	uc002ydj.3	Q9NZT2	OTTHUMG00000032937	ENST00000290291.6:c.749G>A	20.37:g.61443716G>A	ENSP00000290291:p.Arg250Gln	6	2		18	10	NM_007346	0	0	76	112	36	O96029|Q4VXW5|Q96CM2|Q9BQW1|Q9H4H0|Q9H7J5|Q9NZT3|Q9NZT4	Missense_Mutation	SNP	ENST00000290291.6	37	CCDS13504.1	23	0.010531135531135532	2	0.0040650406504065045	3	0.008287292817679558	9	0.015734265734265736	9	0.011873350923482849	G	23.7	4.446822	0.84101	0.003037	0.019735	ENSG00000060491	ENST00000290291;ENST00000370468;ENST00000357163;ENST00000370469;ENST00000370461	T;T;T	0.50001	1.69;0.76;1.15	4.57	3.5	0.40072	Opioid growth factor receptor (OGFr) conserved domain (1);	0.311886	0.29059	N	0.013267	T	0.36138	0.0956	L	0.52206	1.635	0.25470	N	0.987836	D;D;D	0.89917	1.0;0.999;0.999	D;P;P	0.63957	0.92;0.875;0.875	T	0.31943	-0.9925	10	0.51188	T	0.08	-25.1591	3.8836	0.09088	0.182:0.0:0.5777:0.2402	rs41309371	250;233;250	B3KMQ6;Q05BV5;Q9NZT2	.;.;OGFR_HUMAN	Q	250;250;250;105;198	ENSP00000290291:R250Q;ENSP00000359499:R250Q;ENSP00000359491:R198Q	ENSP00000290291:R250Q	R	+	2	0	OGFR	60914161	1.000000	0.71417	0.966000	0.40874	0.818000	0.46254	4.169000	0.58223	2.047000	0.60756	0.561000	0.74099	CGG	G|0.989;A|0.011		0.697	OGFR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080067.1		
TMPRSS15	5651	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	19685347	19685347	+	Silent	SNP	T	T	G	rs111276490		TCGA-BQ-5891-01A-11D-1589-08	TCGA-BQ-5891-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	37d4ff42-0161-4f83-bd6f-13eb19d4eabf	28824279-2be9-45db-867a-b165d8191d0c	g.chr21:19685347T>G	ENST00000284885.3	-	18	2113	c.2080A>C	c.(2080-2082)Aga>Cga	p.R694R		NM_002772.2	NP_002763	P98073	ENTK_HUMAN	transmembrane protease, serine 15	694	SRCR. {ECO:0000255|PROSITE- ProRule:PRU00196}.					brush border (GO:0005903)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(19)|lung(36)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	85						CTCTGGATTCTGAACCGCACT	0.443																																					p.R694R		.											.	TMPRSS15-160	0			c.A2080C						.						149.0	133.0	138.0					21																	19685347		2203	4300	6503	SO:0001819	synonymous_variant	5651	exon18			GGATTCTGAACCG		CCDS13571.1	21q21	2010-12-09	2010-04-21	2010-04-21	ENSG00000154646	ENSG00000154646		"""Serine peptidases / Transmembrane"""	9490	protein-coding gene	gene with protein product	"""proenterokinase"", ""enteropeptidase"""	606635	"""protease, serine, 7 (enterokinase)"""	PRSS7		8052624	Standard	NM_002772		Approved	ENTK, MGC133046	uc002ykw.3	P98073	OTTHUMG00000074518	ENST00000284885.3:c.2080A>C	21.37:g.19685347T>G		119	0		114	107	NM_002772	0	0	0	0	0	Q2NKL7	Silent	SNP	ENST00000284885.3	37	CCDS13571.1																																																																																			T|0.500;C|0.500		0.443	TMPRSS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000158231.2	NM_002772	
TXNRD2	10587	broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	19870863	19870863	+	Silent	SNP	A	A	T			TCGA-BQ-5891-01A-11D-1589-08	TCGA-BQ-5891-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37d4ff42-0161-4f83-bd6f-13eb19d4eabf	28824279-2be9-45db-867a-b165d8191d0c	g.chr22:19870863A>T	ENST00000400521.1	-	12	1077	c.1071T>A	c.(1069-1071)atT>atA	p.I357I	TXNRD2_ENST00000535882.1_Silent_p.I356I|TXNRD2_ENST00000542719.1_Silent_p.I327I|TXNRD2_ENST00000400518.1_Silent_p.I327I|TXNRD2_ENST00000400519.1_Silent_p.I356I	NM_006440.3	NP_006431.2	Q9NNW7	TRXR2_HUMAN	thioredoxin reductase 2	357					cell redox homeostasis (GO:0045454)|heart development (GO:0007507)|hemopoiesis (GO:0030097)|response to oxygen radical (GO:0000305)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|NADP binding (GO:0050661)|thioredoxin-disulfide reductase activity (GO:0004791)			breast(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(12)|ovary(3)|urinary_tract(2)	30	Colorectal(54;0.0993)					CCACGTCACCAATGGCGTAGA	0.652																																					.													.	TXNRD2-92	0			.						.						90.0	102.0	98.0					22																	19870863		2059	4207	6266	SO:0001819	synonymous_variant	10587	.			GTCACCAATGGCG	AF106697	CCDS42981.1, CCDS63402.1	22q11.21	2014-09-17			ENSG00000184470	ENSG00000184470			18155	protein-coding gene	gene with protein product	"""thioredoxin reductase beta"", ""selenoprotein Z"""	606448				9923614, 10215850, 11012661	Standard	NM_006440		Approved	TR, TRXR2, TR3	uc021wlj.1	Q9NNW7	OTTHUMG00000149975	ENST00000400521.1:c.1071T>A	22.37:g.19870863A>T		102	0		85	74	.	0	0	1	52	51	O95840|Q96IJ2|Q9H2Z5|Q9NZV3|Q9NZV4|Q9P2Y0|Q9P2Y1|Q9UQU8	Silent	SNP	ENST00000400521.1	37	CCDS42981.1																																																																																			.		0.652	TXNRD2-003	KNOWN	NMD_exception|basic|appris_candidate_longest|CCDS|seleno	protein_coding	protein_coding	OTTHUMT00000314903.3	NM_006440	
CCDC116	164592	broad.mit.edu;bcgsc.ca	37	22	21989095	21989095	+	Nonsense_Mutation	SNP	C	C	G			TCGA-BQ-5891-01A-11D-1589-08	TCGA-BQ-5891-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37d4ff42-0161-4f83-bd6f-13eb19d4eabf	28824279-2be9-45db-867a-b165d8191d0c	g.chr22:21989095C>G	ENST00000292779.3	+	4	904	c.743C>G	c.(742-744)tCa>tGa	p.S248*	CCDC116_ENST00000607942.1_Nonsense_Mutation_p.S248*	NM_152612.2	NP_689825.2	Q8IYX3	CC116_HUMAN	coiled-coil domain containing 116	248										endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)|skin(5)	22	Colorectal(54;0.105)					CTGCTGGGCTCAAGCTCTGGC	0.577																																					p.S248X													.	CCDC116-92	0			c.C743G						.						85.0	90.0	88.0					22																	21989095		2203	4300	6503	SO:0001587	stop_gained	164592	exon4			TGGGCTCAAGCTC	BC033499	CCDS13791.1	22q11.21	2006-06-27			ENSG00000161180	ENSG00000161180			26688	protein-coding gene	gene with protein product						12477932	Standard	NM_152612		Approved	FLJ36046	uc002zve.3	Q8IYX3	OTTHUMG00000150821	ENST00000292779.3:c.743C>G	22.37:g.21989095C>G	ENSP00000292779:p.Ser248*	160	0		165	7	NM_152612	0	0	0	0	0	Q8N9Y9	Nonsense_Mutation	SNP	ENST00000292779.3	37	CCDS13791.1	.	.	.	.	.	.	.	.	.	.	C	18.73	3.687235	0.68157	.	.	ENSG00000161180	ENST00000292779	.	.	.	4.56	4.56	0.56223	.	0.269330	0.27035	N	0.021260	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-55.3163	13.0826	0.59121	0.0:1.0:0.0:0.0	.	.	.	.	X	248	.	ENSP00000292779:S248X	S	+	2	0	CCDC116	20319095	0.644000	0.27277	0.178000	0.23040	0.062000	0.15995	3.279000	0.51670	2.554000	0.86153	0.485000	0.47835	TCA	.		0.577	CCDC116-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320199.1	NM_152612	
SH3BP1	23616	hgsc.bcm.edu	37	22	38051328	38051328	+	Silent	SNP	C	C	A	rs61678571	byFrequency	TCGA-BQ-5891-01A-11D-1589-08	TCGA-BQ-5891-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	37d4ff42-0161-4f83-bd6f-13eb19d4eabf	28824279-2be9-45db-867a-b165d8191d0c	g.chr22:38051328C>A	ENST00000357436.4	+	18	2056	c.1743C>A	c.(1741-1743)tcC>tcA	p.S581S	SH3BP1_ENST00000599616.1_Intron|Z83844.1_ENST00000456099.1_RNA	NM_018957.3	NP_061830.3	Q9Y3L3	3BP1_HUMAN	SH3-domain binding protein 1	581					signal transduction (GO:0007165)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	Melanoma(58;0.0574)					CCCAGGTCTCCGGCTCCCGCT	0.736																																					p.S581S		.											.	SH3BP1-90	0			c.C1743A						.						5.0	7.0	6.0					22																	38051328		1747	3534	5281	SO:0001819	synonymous_variant	23616	exon18			GGTCTCCGGCTCC		CCDS13952.2	22q13.1	2011-07-04			ENSG00000100092	ENSG00000100092		"""Rho GTPase activating proteins"""	10824	protein-coding gene	gene with protein product						10591208, 12029088	Standard	NM_018957		Approved	ARHGAP43	uc003ati.3	Q9Y3L3	OTTHUMG00000030996	ENST00000357436.4:c.1743C>A	22.37:g.38051328C>A		16	0		25	2	NM_018957	0	0	3	3	0	Q5R3N0|Q6IBZ2|Q6ZVL9|Q96HQ5|Q9NSQ9	Silent	SNP	ENST00000357436.4	37	CCDS13952.2																																																																																			C|0.984;T|0.016		0.736	SH3BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075884.4	NM_018957	
OXTR	5021	ucsc.edu;bcgsc.ca	37	3	8809676	8809676	+	Silent	SNP	G	G	A	rs534029823		TCGA-BQ-5891-01A-11D-1589-08	TCGA-BQ-5891-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	37d4ff42-0161-4f83-bd6f-13eb19d4eabf	28824279-2be9-45db-867a-b165d8191d0c	g.chr3:8809676G>A	ENST00000316793.3	-	3	822	c.198C>T	c.(196-198)acC>acT	p.T66T	CAV3_ENST00000472766.1_Intron	NM_000916.3	NP_000907.2	P30559	OXYR_HUMAN	oxytocin receptor	66					cell surface receptor signaling pathway (GO:0007166)|digestive tract development (GO:0048565)|eating behavior (GO:0042755)|ERK1 and ERK2 cascade (GO:0070371)|estrous cycle phase (GO:0060206)|female pregnancy (GO:0007565)|heart development (GO:0007507)|lactation (GO:0007595)|maternal behavior (GO:0042711)|maternal process involved in parturition (GO:0060137)|memory (GO:0007613)|muscle contraction (GO:0006936)|negative regulation of gastric acid secretion (GO:0060455)|positive regulation of blood pressure (GO:0045777)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of norepinephrine secretion (GO:0010701)|positive regulation of penile erection (GO:0060406)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of uterine smooth muscle contraction (GO:0070474)|response to amphetamine (GO:0001975)|response to anoxia (GO:0034059)|response to cocaine (GO:0042220)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to peptide hormone (GO:0043434)|response to progesterone (GO:0032570)|sleep (GO:0030431)|social behavior (GO:0035176)|sperm ejaculation (GO:0042713)|suckling behavior (GO:0001967)|telencephalon development (GO:0021537)	apical plasma membrane (GO:0016324)|cell-cell adherens junction (GO:0005913)|integral component of plasma membrane (GO:0005887)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	oxytocin receptor activity (GO:0004990)|peptide hormone binding (GO:0017046)|vasopressin receptor activity (GO:0005000)			NS(1)|endometrium(2)|large_intestine(4)|lung(5)|urinary_tract(1)	13				OV - Ovarian serous cystadenocarcinoma(96;0.15)	Carbetocin(DB01282)|Oxytocin(DB00107)	TCTGGCGTGTGGTGCGCAGCG	0.657																																					p.T66T													.	OXTR-68	0			c.C198T						.						35.0	32.0	33.0					3																	8809676		2197	4295	6492	SO:0001819	synonymous_variant	5021	exon3			GCGTGTGGTGCGC		CCDS2570.1	3p25	2012-08-08			ENSG00000180914	ENSG00000180914		"""GPCR / Class A : Vasopressin and oxytocin receptors"""	8529	protein-coding gene	gene with protein product		167055				1313946	Standard	NM_000916		Approved		uc003brc.3	P30559	OTTHUMG00000090537	ENST00000316793.3:c.198C>T	3.37:g.8809676G>A		22	0		20	4	NM_000916	0	0	0	0	0	Q15071	Silent	SNP	ENST00000316793.3	37	CCDS2570.1																																																																																			.		0.657	OXTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207061.2		
CCR5	1234	broad.mit.edu;bcgsc.ca	37	3	46415326	46415326	+	Silent	SNP	C	C	T			TCGA-BQ-5891-01A-11D-1589-08	TCGA-BQ-5891-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37d4ff42-0161-4f83-bd6f-13eb19d4eabf	28824279-2be9-45db-867a-b165d8191d0c	g.chr3:46415326C>T	ENST00000292303.4	+	2	1079	c.933C>T	c.(931-933)ttC>ttT	p.F311F	CCR5_ENST00000343801.4_Silent_p.F311F|RP11-24F11.2_ENST00000451485.1_RNA|CCR5_ENST00000445772.1_Silent_p.F311F	NM_001100168.1	NP_001093638.1	P51681	CCR5_HUMAN	chemokine (C-C motif) receptor 5 (gene/pseudogene)	311					calcium ion transport (GO:0006816)|calcium-mediated signaling (GO:0019722)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular defense response (GO:0006968)|cellular response to lipopolysaccharide (GO:0071222)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|dendritic cell chemotaxis (GO:0002407)|entry into host cell (GO:0030260)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|MAPK cascade (GO:0000165)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to cholesterol (GO:0070723)|signaling (GO:0023052)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|C-C chemokine binding (GO:0019957)|C-C chemokine receptor activity (GO:0016493)|chemokine (C-C motif) ligand 5 binding (GO:0071791)|chemokine receptor activity (GO:0004950)|coreceptor activity (GO:0015026)|phosphatidylinositol phospholipase C activity (GO:0004435)			central_nervous_system(1)|large_intestine(2)|lung(13)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	20				BRCA - Breast invasive adenocarcinoma(193;0.00112)|KIRC - Kidney renal clear cell carcinoma(197;0.017)|Kidney(197;0.02)	Maraviroc(DB04835)	TCTTAGTCTTCTTCCAAAAGC	0.502																																					p.F311F													.	CCR5-993	0			c.C933T						.						168.0	163.0	164.0					3																	46415326		2203	4296	6499	SO:0001819	synonymous_variant	1234	exon3			AGTCTTCTTCCAA		CCDS2739.1	3p21	2012-08-08	2012-01-23		ENSG00000160791	ENSG00000160791		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1606	protein-coding gene	gene with protein product		601373	"""chemokine (C-C motif) receptor 5"""	CMKBR5		8639485	Standard	NM_001100168		Approved	CKR-5, CC-CKR-5, CKR5, CD195, IDDM22	uc003cpo.4	P51681	OTTHUMG00000133481	ENST00000292303.4:c.933C>T	3.37:g.46415326C>T		300	0		283	8	NM_000579	0	0	3	3	0	O14692|O14693|O14695|O14696|O14697|O14698|O14699|O14700|O14701|O14702|O14703|O14704|O14705|O14706|O14707|O14708|O15538|Q9UPA4	Silent	SNP	ENST00000292303.4	37	CCDS2739.1																																																																																			.		0.502	CCR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257377.2	NM_000579	
ACTL6A	86	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	179304341	179304341	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5891-01A-11D-1589-08	TCGA-BQ-5891-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	37d4ff42-0161-4f83-bd6f-13eb19d4eabf	28824279-2be9-45db-867a-b165d8191d0c	g.chr3:179304341G>A	ENST00000429709.2	+	13	1343	c.1130G>A	c.(1129-1131)cGg>cAg	p.R377Q	RP11-145M9.6_ENST00000610007.1_RNA|ACTL6A_ENST00000392662.1_Missense_Mutation_p.R335Q|RP11-15L13.4_ENST00000608818.1_RNA|ACTL6A_ENST00000450518.2_Missense_Mutation_p.R335Q	NM_004301.3	NP_004292.1	O96019	ACL6A_HUMAN	actin-like 6A	377					ATP-dependent chromatin remodeling (GO:0043044)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|nervous system development (GO:0007399)|neural retina development (GO:0003407)|regulation of growth (GO:0040008)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	Ino80 complex (GO:0031011)|npBAF complex (GO:0071564)|NuA4 histone acetyltransferase complex (GO:0035267)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	chromatin binding (GO:0003682)|transcription coactivator activity (GO:0003713)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|urinary_tract(1)	21	all_cancers(143;3.94e-16)|Ovarian(172;0.0172)|Breast(254;0.191)		OV - Ovarian serous cystadenocarcinoma(80;5.98e-26)|GBM - Glioblastoma multiforme(14;0.0169)			CAGAGTATGCGGTTGAAATTG	0.348																																					p.R377Q		.											.	ACTL6A-91	0			c.G1130A						.						88.0	88.0	88.0					3																	179304341		2203	4300	6503	SO:0001583	missense	86	exon13			GTATGCGGTTGAA	AK098691	CCDS3231.1, CCDS43174.1	3q26.33	2011-07-06			ENSG00000136518	ENSG00000136518		"""INO80 complex subunits"""	24124	protein-coding gene	gene with protein product	"""BAF complex 53 kDa subunit"", ""BRG1-associated factor"", ""actin-related protein 4"", ""INO80 complex subunit K"""	604958				9845365, 10380635	Standard	NM_004301		Approved	Actl6, BAF53A, Arp4, Baf53a, INO80K	uc003fjw.3	O96019	OTTHUMG00000157782	ENST00000429709.2:c.1130G>A	3.37:g.179304341G>A	ENSP00000397552:p.Arg377Gln	75	0		61	53	NM_004301	0	0	0	2	2	B3KMN1|D3DNR9|Q8TAE5|Q9BVS8|Q9H0W6	Missense_Mutation	SNP	ENST00000429709.2	37	CCDS3231.1	.	.	.	.	.	.	.	.	.	.	G	32	5.140591	0.94560	.	.	ENSG00000136518	ENST00000429709;ENST00000450518;ENST00000392662	D;D;D	0.94687	-3.49;-3.49;-3.49	5.91	4.07	0.47477	.	0.049963	0.85682	D	0.000000	D	0.95984	0.8692	L	0.59436	1.845	0.58432	D	0.999997	D	0.76494	0.999	D	0.64321	0.924	D	0.95826	0.8854	10	0.87932	D	0	.	15.2754	0.73737	0.0:0.0:0.7438:0.2562	.	377	O96019	ACL6A_HUMAN	Q	377;335;335	ENSP00000397552:R377Q;ENSP00000394014:R335Q;ENSP00000376430:R335Q	ENSP00000376430:R335Q	R	+	2	0	ACTL6A	180787035	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	9.371000	0.97162	0.789000	0.33779	0.655000	0.94253	CGG	.		0.348	ACTL6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349599.1	NM_004301	
SH3BP2	6452	hgsc.bcm.edu	37	4	2824707	2824707	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5891-01A-11D-1589-08	TCGA-BQ-5891-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	37d4ff42-0161-4f83-bd6f-13eb19d4eabf	28824279-2be9-45db-867a-b165d8191d0c	g.chr4:2824707T>C	ENST00000356331.5	+	3	443	c.182T>C	c.(181-183)tTc>tCc	p.F61S	SH3BP2_ENST00000435136.2_Missense_Mutation_p.F61S|SH3BP2_ENST00000511747.1_Missense_Mutation_p.F61S|SH3BP2_ENST00000442312.2_Missense_Mutation_p.F89S|SH3BP2_ENST00000503393.2_Missense_Mutation_p.F118S|SH3BP2_ENST00000452765.2_Missense_Mutation_p.F61S|SH3BP2_ENST00000389838.2_Missense_Mutation_p.F61S	NM_003023.4	NP_003014.3	P78314	3BP2_HUMAN	SH3-domain binding protein 2	61	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)		SH3/SH2 adaptor activity (GO:0005070)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	20				UCEC - Uterine corpus endometrioid carcinoma (64;0.164)		GTCTACTACTTCAAGAGTAGC	0.637									Cherubism																												p.F118S		.											.	SH3BP2-514	0			c.T353C						.						76.0	65.0	69.0					4																	2824707		2203	4300	6503	SO:0001583	missense	6452	exon3	Familial Cancer Database	Familial Benign Giant-cell Tumor of the Jaw, Familial Multilocular Cystic Disease	ACTACTTCAAGAG	BC022996	CCDS33944.1, CCDS54715.1, CCDS54716.1	4p16.3	2013-02-14				ENSG00000087266		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	10825	protein-coding gene	gene with protein product		602104	"""Cherubism"""			9299232, 11381256	Standard	NM_003023		Approved	RES4-23, CRBM	uc003gfj.4	P78314		ENST00000356331.5:c.182T>C	4.37:g.2824707T>C	ENSP00000348685:p.Phe61Ser	26	0		34	2	NM_001145856	0	0	5	5	0	A6NNC2|B2R5R6|B4DT04|D3DVR0|D6R919|O00500|O15373|P78315	Missense_Mutation	SNP	ENST00000356331.5	37	CCDS33944.1	.	.	.	.	.	.	.	.	.	.	T	18.06	3.538605	0.65085	.	.	ENSG00000087266	ENST00000452765;ENST00000389838;ENST00000503219;ENST00000504294;ENST00000508385;ENST00000512014;ENST00000513095;ENST00000442312;ENST00000502260;ENST00000435136;ENST00000511747;ENST00000503393;ENST00000356331	T;T;T;T;T;T;T;T;T;T;T;T;T	0.14640	2.49;2.49;2.49;2.49;2.49;2.49;2.49;2.49;2.49;2.49;2.49;2.49;2.49	4.24	4.24	0.50183	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	T	0.34250	0.0891	M	0.70108	2.13	0.53005	D	0.999965	D;D;P;P	0.69078	0.99;0.997;0.93;0.939	D;D;P;P	0.68621	0.932;0.959;0.462;0.697	T	0.13926	-1.0491	10	0.87932	D	0	-16.0505	12.9914	0.58620	0.0:0.0:0.0:1.0	.	89;89;118;61	B4DT04;B7Z9B6;D6R919;P78314	.;.;.;3BP2_HUMAN	S	61;61;61;61;61;61;61;89;61;61;61;118;61	ENSP00000409746:F61S;ENSP00000374488:F61S;ENSP00000422796:F61S;ENSP00000423275:F61S;ENSP00000424917:F61S;ENSP00000424105:F61S;ENSP00000423823:F61S;ENSP00000388152:F89S;ENSP00000425537:F61S;ENSP00000403231:F61S;ENSP00000424846:F61S;ENSP00000422168:F118S;ENSP00000348685:F61S	ENSP00000348685:F61S	F	+	2	0	SH3BP2	2794505	1.000000	0.71417	1.000000	0.80357	0.756000	0.42949	7.106000	0.77039	1.568000	0.49683	0.402000	0.26972	TTC	.		0.637	SH3BP2-007	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000362406.2	NM_003023	
MAML3	55534	hgsc.bcm.edu	37	4	140811129	140811129	+	Silent	SNP	T	T	C	rs62344941		TCGA-BQ-5891-01A-11D-1589-08	TCGA-BQ-5891-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	37d4ff42-0161-4f83-bd6f-13eb19d4eabf	28824279-2be9-45db-867a-b165d8191d0c	g.chr4:140811129T>C	ENST00000509479.2	-	2	2317	c.1461A>G	c.(1459-1461)caA>caG	p.Q487Q	MAML3_ENST00000398940.1_Silent_p.Q26Q|MAML3_ENST00000327122.5_Silent_p.Q331Q	NM_018717.4	NP_061187			mastermind-like 3 (Drosophila)											breast(1)|endometrium(7)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	25	all_hematologic(180;0.162)					gctgttgctgttgctgtttct	0.552																																					p.Q487Q		.											.	MAML3-455	0			c.A1461G						.						18.0	21.0	20.0					4																	140811129		2197	4294	6491	SO:0001819	synonymous_variant	55534	exon2			TTGCTGTTGCTGT	AB058719	CCDS54805.1	4q31.1	2014-08-12	2003-09-24		ENSG00000196782	ENSG00000196782			16272	protein-coding gene	gene with protein product	"""mastermind (drosophila)-like 3"""	608991	"""trinucleotide repeat containing 3"""	TNRC3		12370315, 12386158	Standard	NM_018717		Approved	KIAA1816, MAM2, CAGH3, GDN	uc021xsg.1	Q96JK9	OTTHUMG00000161441	ENST00000509479.2:c.1461A>G	4.37:g.140811129T>C		27	1		18	3	NM_018717	0	0	2	2	0		Silent	SNP	ENST00000509479.2	37	CCDS54805.1																																																																																			.		0.552	MAML3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364934.2		
HAND2	9464	broad.mit.edu	37	4	174449979	174449979	+	Silent	SNP	C	C	T			TCGA-BQ-5891-01A-11D-1589-08	TCGA-BQ-5891-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37d4ff42-0161-4f83-bd6f-13eb19d4eabf	28824279-2be9-45db-867a-b165d8191d0c	g.chr4:174449979C>T	ENST00000359562.4	-	1	1401	c.462G>A	c.(460-462)ctG>ctA	p.L154L	HAND2-AS1_ENST00000510339.1_RNA|HAND2-AS1_ENST00000515741.1_RNA|HAND2-AS1_ENST00000507062.1_RNA|HAND2-AS1_ENST00000504429.1_RNA|HAND2-AS1_ENST00000505032.1_RNA|HAND2-AS1_ENST00000503474.1_RNA|HAND2-AS1_ENST00000512209.2_RNA|HAND2_ENST00000505300.1_5'UTR|HAND2-AS1_ENST00000510221.1_RNA|HAND2-AS1_ENST00000515310.1_RNA|HAND2-AS1_ENST00000503198.1_RNA|HAND2-AS1_ENST00000502896.1_RNA|HAND2-AS1_ENST00000515350.1_RNA|HAND2-AS1_ENST00000507322.1_RNA|HAND2-AS1_ENST00000508534.1_RNA|HAND2-AS1_ENST00000507636.1_RNA|HAND2-AS1_ENST00000507571.1_RNA|HAND2-AS1_ENST00000504740.1_RNA|HAND2-AS1_ENST00000505817.1_RNA|HAND2-AS1_ENST00000502941.1_RNA|HAND2-AS1_ENST00000512099.1_RNA|HAND2-AS1_ENST00000511196.1_RNA|HAND2-AS1_ENST00000509866.1_RNA|HAND2-AS1_ENST00000510268.1_RNA|HAND2-AS1_ENST00000511728.1_RNA|HAND2-AS1_ENST00000515345.1_RNA|HAND2-AS1_ENST00000514673.1_RNA|HAND2-AS1_ENST00000508887.1_RNA|HAND2-AS1_ENST00000503309.1_RNA|HAND2-AS1_ENST00000512943.1_RNA|HAND2-AS1_ENST00000505621.1_RNA|HAND2-AS1_ENST00000515376.1_RNA|HAND2-AS1_ENST00000514431.1_RNA|HAND2-AS1_ENST00000512246.1_RNA|HAND2-AS1_ENST00000512929.1_RNA|HAND2-AS1_ENST00000509640.1_RNA|HAND2-AS1_ENST00000502334.1_RNA	NM_021973.2	NP_068808.1	P61296	HAND2_HUMAN	heart and neural crest derivatives expressed 2	154					adult heart development (GO:0007512)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|apoptotic process involved in heart morphogenesis (GO:0003278)|cardiac neural crest cell development involved in outflow tract morphogenesis (GO:0061309)|cardiac neural crest cell migration involved in outflow tract morphogenesis (GO:0003253)|cardiac right ventricle formation (GO:0003219)|cartilage morphogenesis (GO:0060536)|cell proliferation involved in outflow tract morphogenesis (GO:0061325)|coronary artery morphogenesis (GO:0060982)|embryonic digit morphogenesis (GO:0042733)|heart development (GO:0007507)|heart looping (GO:0001947)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|mesenchymal cell proliferation (GO:0010463)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of DNA binding (GO:0043392)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|neural crest cell development (GO:0014032)|noradrenergic neuron differentiation (GO:0003357)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|peripheral nervous system neuron development (GO:0048935)|positive regulation of semaphorin-plexin signaling pathway involved in outflow tract morphogenesis (GO:2000764)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in norepinephrine biosynthetic process (GO:2000763)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of transcription, DNA-templated (GO:0006355)|suckling behavior (GO:0001967)|sympathetic nervous system development (GO:0048485)|thymus development (GO:0048538)|tongue development (GO:0043586)|visceral serous pericardium development (GO:0061032)	nuclear chromatin (GO:0000790)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	activating transcription factor binding (GO:0033613)|AT DNA binding (GO:0003680)|E-box binding (GO:0070888)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			endometrium(1)|large_intestine(4)|lung(6)|prostate(1)|skin(1)	13		Prostate(90;0.00601)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_neural(102;0.0837)|all_hematologic(60;0.107)		all cancers(43;1.37e-18)|Epithelial(43;5.5e-17)|OV - Ovarian serous cystadenocarcinoma(60;3.3e-10)|STAD - Stomach adenocarcinoma(60;0.00273)|GBM - Glioblastoma multiforme(59;0.0064)|LUSC - Lung squamous cell carcinoma(193;0.0903)|Kidney(143;0.249)		CCTTGGCCAGCAGGTCCATGA	0.577																																					p.L154L													.	HAND2-91	0			c.G462A						.						145.0	128.0	134.0					4																	174449979		2203	4300	6503	SO:0001819	synonymous_variant	9464	exon1			GGCCAGCAGGTCC	AF087941	CCDS3819.1	4q34.1	2014-08-12			ENSG00000164107	ENSG00000164107		"""Basic helix-loop-helix proteins"""	4808	protein-coding gene	gene with protein product		602407				9878849	Standard	NM_021973		Approved	dHand, Thing2, Hed, bHLHa26	uc003ith.1	P61296	OTTHUMG00000160775	ENST00000359562.4:c.462G>A	4.37:g.174449979C>T		102	0		86	4	NM_021973	0	0	0	0	0	B6ECG9|O95300|O95301|P97833|Q494T1	Silent	SNP	ENST00000359562.4	37	CCDS3819.1																																																																																			.		0.577	HAND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362241.3		
KLHL3	26249	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	136963990	136963990	+	Silent	SNP	G	G	A	rs562736621		TCGA-BQ-5891-01A-11D-1589-08	TCGA-BQ-5891-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	37d4ff42-0161-4f83-bd6f-13eb19d4eabf	28824279-2be9-45db-867a-b165d8191d0c	g.chr5:136963990G>A	ENST00000309755.4	-	13	2030	c.1587C>T	c.(1585-1587)aaC>aaT	p.N529N	KLHL3_ENST00000541417.1_3'UTR|KLHL3_ENST00000506491.1_Silent_p.N447N|KLHL3_ENST00000508657.1_Silent_p.N497N|KLHL3_ENST00000506873.1_5'UTR	NM_017415.2	NP_059111.2	Q9UH77	KLHL3_HUMAN	kelch-like family member 3	529			N -> K (in PHA2D; impaired interaction with WNK1). {ECO:0000269|PubMed:22406640}.		distal tubule morphogenesis (GO:0072156)|ion homeostasis (GO:0050801)|protein K48-linked ubiquitination (GO:0070936)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|renal sodium ion absorption (GO:0070294)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)	structural molecule activity (GO:0005198)			breast(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|stomach(1)|upper_aerodigestive_tract(1)	21		all_hematologic(541;3.67e-07)|Breast(839;7.61e-05)|Prostate(281;0.000825)|Ovarian(839;0.0481)|all_lung(232;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)	GBM - Glioblastoma multiforme(465;0.0223)		CATTACCTGCGTTGCGCCGGC	0.537																																					p.N529N		.											.	KLHL3-90	0			c.C1587T						.						219.0	189.0	199.0					5																	136963990		2203	4300	6503	SO:0001819	synonymous_variant	26249	exon13			ACCTGCGTTGCGC	AB032955	CCDS4192.1, CCDS58969.1, CCDS58970.1	5q31	2013-01-30	2013-01-30		ENSG00000146021	ENSG00000146021		"""Kelch-like"", ""BTB/POZ domain containing"""	6354	protein-coding gene	gene with protein product		605775	"""kelch (Drosophila)-like 3"", ""kelch-like 3 (Drosophila)"""			10843806	Standard	NM_017415		Approved	KIAA1129	uc010jek.3	Q9UH77	OTTHUMG00000129155	ENST00000309755.4:c.1587C>T	5.37:g.136963990G>A		145	0		260	90	NM_017415	0	0	0	0	0	B2RBK7|Q9UH75|Q9UH76|Q9ULU0|Q9Y6V6	Silent	SNP	ENST00000309755.4	37	CCDS4192.1																																																																																			.		0.537	KLHL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251220.2		
PCDHGA1	56114	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	140711928	140711928	+	Silent	SNP	G	G	A			TCGA-BQ-5891-01A-11D-1589-08	TCGA-BQ-5891-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	37d4ff42-0161-4f83-bd6f-13eb19d4eabf	28824279-2be9-45db-867a-b165d8191d0c	g.chr5:140711928G>A	ENST00000517417.1	+	1	1677	c.1677G>A	c.(1675-1677)gcG>gcA	p.A559A	PCDHGA1_ENST00000378105.3_Silent_p.A559A	NM_018912.2	NP_061735.1	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1	559	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|lung(32)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACGACAACGCGCCCGAGATCC	0.647																																					p.A559A		.											.	PCDHGA1-137	0			c.G1677A						.						130.0	144.0	140.0					5																	140711928		2203	4300	6503	SO:0001819	synonymous_variant	56114	exon1			CAACGCGCCCGAG	AF152318	CCDS54922.1	5q31	2010-01-26				ENSG00000204956		"""Cadherins / Protocadherins : Clustered"""	8696	other	protocadherin		606288				10380929	Standard	NM_018912		Approved	PCDH-GAMMA-A1		Q9Y5H4		ENST00000517417.1:c.1677G>A	5.37:g.140711928G>A		320	0		431	204	NM_018912	0	0	4	6	2	Q2M273|Q9Y5D6	Silent	SNP	ENST00000517417.1	37	CCDS54922.1																																																																																			.		0.647	PCDHGA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374737.1	NM_018912	
DRD1	1812	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	174870046	174870046	+	Silent	SNP	G	G	A			TCGA-BQ-5891-01A-11D-1589-08	TCGA-BQ-5891-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	37d4ff42-0161-4f83-bd6f-13eb19d4eabf	28824279-2be9-45db-867a-b165d8191d0c	g.chr5:174870046G>A	ENST00000393752.2	-	2	1049	c.57C>T	c.(55-57)gaC>gaT	p.D19D		NM_000794.3	NP_000785.1	P21728	DRD1_HUMAN	dopamine receptor D1	19					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adult walking behavior (GO:0007628)|astrocyte development (GO:0014002)|behavioral fear response (GO:0001662)|behavioral response to cocaine (GO:0048148)|cellular response to catecholamine stimulus (GO:0071870)|cerebral cortex GABAergic interneuron migration (GO:0021853)|conditioned taste aversion (GO:0001661)|dentate gyrus development (GO:0021542)|dopamine metabolic process (GO:0042417)|dopamine transport (GO:0015872)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glucose import (GO:0046323)|grooming behavior (GO:0007625)|habituation (GO:0046959)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|maternal behavior (GO:0042711)|mating behavior (GO:0007617)|memory (GO:0007613)|neuronal action potential (GO:0019228)|operant conditioning (GO:0035106)|peristalsis (GO:0030432)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell migration (GO:0030335)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of potassium ion transport (GO:0043268)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|prepulse inhibition (GO:0060134)|protein import into nucleus (GO:0006606)|regulation of dopamine metabolic process (GO:0042053)|regulation of dopamine uptake involved in synaptic transmission (GO:0051584)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|sensitization (GO:0046960)|striatum development (GO:0021756)|synapse assembly (GO:0007416)|synaptic transmission, dopaminergic (GO:0001963)|temperature homeostasis (GO:0001659)|transmission of nerve impulse (GO:0019226)|vasodilation (GO:0042311)|visual learning (GO:0008542)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity (GO:0004952)|dopamine neurotransmitter receptor activity, coupled via Gs (GO:0001588)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	23	all_cancers(89;0.00895)|Renal(175;0.000159)|Lung NSC(126;0.00625)|all_lung(126;0.0104)	Medulloblastoma(196;0.0208)|all_neural(177;0.0277)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)		Acepromazine(DB01614)|Acetophenazine(DB01063)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Dopamine(DB00988)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Flupentixol(DB00875)|Fluphenazine(DB00623)|Haloperidol(DB00502)|Iloperidone(DB04946)|Imipramine(DB00458)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methotrimeprazine(DB01403)|Methylergometrine(DB00353)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Perphenazine(DB00850)|Phenylpropanolamine(DB00397)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Promazine(DB00420)|Propericiazine(DB01608)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Thioproperazine(DB01622)|Thioridazine(DB00679)|Thiothixene(DB01623)|Triflupromazine(DB00508)|Trimipramine(DB00726)|Ziprasidone(DB00246)	GAACAGAGAAGTCCCTCTCCA	0.572																																					p.D19D		.											.	DRD1-93	0			c.C57T						.						106.0	108.0	107.0					5																	174870046		2203	4300	6503	SO:0001819	synonymous_variant	1812	exon2			AGAGAAGTCCCTC	X55760	CCDS4393.1	5q34-q35	2012-08-08			ENSG00000184845	ENSG00000184845		"""GPCR / Class A : Dopamine receptors"""	3020	protein-coding gene	gene with protein product		126449					Standard	NM_000794		Approved		uc003mcz.3	P21728	OTTHUMG00000130557	ENST00000393752.2:c.57C>T	5.37:g.174870046G>A		122	0		190	77	NM_000794	0	0	0	0	0	B2RA44|Q4QRJ0	Silent	SNP	ENST00000393752.2	37	CCDS4393.1																																																																																			.		0.572	DRD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252982.2	NM_000794	
UBR2	23304	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	42657391	42657391	+	Silent	SNP	G	G	A			TCGA-BQ-5891-01A-11D-1589-08	TCGA-BQ-5891-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	37d4ff42-0161-4f83-bd6f-13eb19d4eabf	28824279-2be9-45db-867a-b165d8191d0c	g.chr6:42657391G>A	ENST00000372899.1	+	46	5367	c.5109G>A	c.(5107-5109)gaG>gaA	p.E1703E	UBR2_ENST00000372901.1_Silent_p.E1703E|UBR2_ENST00000372883.3_3'UTR	NM_015255.2	NP_056070.1	Q8IWV8	UBR2_HUMAN	ubiquitin protein ligase E3 component n-recognin 2	1703					cellular response to leucine (GO:0071233)|chromatin silencing (GO:0006342)|histone H2A ubiquitination (GO:0033522)|male meiosis I (GO:0007141)|negative regulation of TOR signaling (GO:0032007)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromatin (GO:0000785)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(10)|kidney(7)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|skin(5)	64	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.004)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.196)			ACTATGGGGAGACCGACCAGG	0.517																																					p.E1703E		.											.	UBR2-94	0			c.G5109A						.						254.0	259.0	257.0					6																	42657391		2203	4300	6503	SO:0001819	synonymous_variant	23304	exon46			TGGGGAGACCGAC	BC024217	CCDS4870.1, CCDS55001.1	6p21.1	2008-06-23	2005-01-10	2005-01-12	ENSG00000024048	ENSG00000024048		"""Ubiquitin protein ligase E3 component n-recognins"""	21289	protein-coding gene	gene with protein product		609134	"""chromosome 6 open reading frame 133"""	C6orf133			Standard	NM_015255		Approved	bA49A4.1, dJ392M17.3, KIAA0349	uc011dur.2	Q8IWV8	OTTHUMG00000014703	ENST00000372899.1:c.5109G>A	6.37:g.42657391G>A		495	0		393	351	NM_015255	0	0	0	48	48	O15057|Q4VXK2|Q5TFH6|Q6P2I2|Q6ZUD0	Silent	SNP	ENST00000372899.1	37	CCDS4870.1																																																																																			.		0.517	UBR2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040558.2	NM_015255	
DOPEY1	23033	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	83862077	83862077	+	Silent	SNP	A	A	G			TCGA-BQ-5891-01A-11D-1589-08	TCGA-BQ-5891-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	37d4ff42-0161-4f83-bd6f-13eb19d4eabf	28824279-2be9-45db-867a-b165d8191d0c	g.chr6:83862077A>G	ENST00000349129.2	+	30	6380	c.6120A>G	c.(6118-6120)ttA>ttG	p.L2040L	DOPEY1_ENST00000369739.3_Silent_p.L2031L|DOPEY1_ENST00000237163.5_Intron|DOPEY1_ENST00000484282.1_3'UTR	NM_015018.3	NP_055833.2	Q5JWR5	DOP1_HUMAN	dopey family member 1	2040					protein transport (GO:0015031)					breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(16)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	67		all_cancers(76;2.29e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00203)		BRCA - Breast invasive adenocarcinoma(397;0.053)		CATTGACATTACTCTCTGAGG	0.294																																					p.L2040L		.											.	DOPEY1-155	0			c.A6120G						.						62.0	63.0	63.0					6																	83862077		2203	4291	6494	SO:0001819	synonymous_variant	23033	exon30			GACATTACTCTCT	AK027030	CCDS4996.1, CCDS64467.1	6q15	2013-03-05	2006-02-02	2006-02-02	ENSG00000083097	ENSG00000083097			21194	protein-coding gene	gene with protein product			"""KIAA1117"""	KIAA1117		16301316, 16303751, 10931277	Standard	NM_015018		Approved	dJ202D23.2	uc011dyy.2	Q5JWR5	OTTHUMG00000016365	ENST00000349129.2:c.6120A>G	6.37:g.83862077A>G		62	0		66	4	NM_015018	0	0	0	0	0	Q86XV1|Q9H5J5|Q9NSL4|Q9UPN5|Q9Y414	Silent	SNP	ENST00000349129.2	37	CCDS4996.1																																																																																			.		0.294	DOPEY1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043785.2	NM_015018	
USP45	85015	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	99930682	99930682	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5891-01A-11D-1589-08	TCGA-BQ-5891-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	37d4ff42-0161-4f83-bd6f-13eb19d4eabf	28824279-2be9-45db-867a-b165d8191d0c	g.chr6:99930682C>A	ENST00000327681.6	-	8	1324	c.792G>T	c.(790-792)gaG>gaT	p.E264D	USP45_ENST00000369233.2_Missense_Mutation_p.E264D|USP45_ENST00000329966.6_Missense_Mutation_p.E264D|USP45_ENST00000472914.2_Missense_Mutation_p.E264D|USP45_ENST00000500704.2_Missense_Mutation_p.E264D|USP45_ENST00000392738.2_Intron	NM_001080481.1	NP_001073950.1	Q70EL2	UBP45_HUMAN	ubiquitin specific peptidase 45	264	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|large_intestine(6)|lung(2)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	22		all_cancers(76;0.000208)|Acute lymphoblastic leukemia(125;8.41e-11)|all_hematologic(75;2.56e-07)|all_epithelial(107;0.122)|Colorectal(196;0.133)		BRCA - Breast invasive adenocarcinoma(108;0.0718)		CTTTTTCAGTCTCCTTCATGC	0.383																																					p.E264D		.											.	USP45-637	0			c.G792T						.						82.0	85.0	84.0					6																	99930682		2203	4300	6503	SO:0001583	missense	85015	exon8			TTCAGTCTCCTTC	AL832030	CCDS34501.1	6q16.2	2008-02-05	2005-08-08		ENSG00000123552	ENSG00000123552		"""Ubiquitin-specific peptidases"""	20080	protein-coding gene	gene with protein product			"""ubiquitin specific protease 45"""			12838346	Standard	NM_001080481		Approved	MGC14793	uc003ppx.2	Q70EL2	OTTHUMG00000015267	ENST00000327681.6:c.792G>T	6.37:g.99930682C>A	ENSP00000333376:p.Glu264Asp	100	0		86	80	NM_001080481	0	0	0	2	2	B2RXG0|Q5T062|Q86T44|Q86TC0|Q9BRU1	Missense_Mutation	SNP	ENST00000327681.6	37	CCDS34501.1	.	.	.	.	.	.	.	.	.	.	C	13.19	2.164251	0.38217	.	.	ENSG00000123552	ENST00000500704;ENST00000327681;ENST00000369233;ENST00000511403;ENST00000329966;ENST00000472914	T;T;T;T;T;T	0.32023	1.47;1.47;1.47;1.47;1.47;1.47	5.32	3.4	0.38934	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	T	0.16257	0.0391	L	0.41961	1.31	0.80722	D	1	B;B	0.30482	0.039;0.281	B;B	0.39185	0.039;0.293	T	0.03630	-1.1018	10	0.42905	T	0.14	.	9.9212	0.41466	0.0:0.7614:0.0:0.2386	.	264;264	D6RBV3;Q70EL2	.;UBP45_HUMAN	D	264;264;264;20;264;264	ENSP00000424372:E264D;ENSP00000333376:E264D;ENSP00000358236:E264D;ENSP00000423374:E20D;ENSP00000330540:E264D;ENSP00000423993:E264D	ENSP00000333376:E264D	E	-	3	2	USP45	100037403	0.155000	0.22806	0.998000	0.56505	0.743000	0.42351	-0.128000	0.10531	0.616000	0.30141	0.557000	0.71058	GAG	.		0.383	USP45-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041609.2	NM_032929	
HOXA5	3202	broad.mit.edu	37	7	27182685	27182685	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5891-01A-11D-1589-08	TCGA-BQ-5891-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37d4ff42-0161-4f83-bd6f-13eb19d4eabf	28824279-2be9-45db-867a-b165d8191d0c	g.chr7:27182685C>T	ENST00000222726.3	-	1	602	c.542G>A	c.(541-543)cGc>cAc	p.R181H	HOXA6_ENST00000521478.1_5'Flank|HOXA-AS3_ENST00000521197.1_RNA|HOXA5_ENST00000520854.1_5'Flank|RP1-170O19.22_ENST00000467897.2_RNA|HOXA-AS3_ENST00000518848.1_RNA|HOXA3_ENST00000521401.1_5'Flank	NM_019102.3	NP_061975.2	P20719	HXA5_HUMAN	homeobox A5	181					anterior/posterior pattern specification (GO:0009952)|bronchiole development (GO:0060435)|cell migration (GO:0016477)|cell-cell signaling involved in mammary gland development (GO:0060764)|embryonic skeletal system morphogenesis (GO:0048704)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|intestinal epithelial cell maturation (GO:0060574)|lung alveolus development (GO:0048286)|lung goblet cell differentiation (GO:0060480)|lung-associated mesenchyme development (GO:0060484)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mesenchymal-epithelial cell signaling (GO:0060638)|multicellular organism growth (GO:0035264)|negative regulation of angiogenesis (GO:0016525)|negative regulation of erythrocyte differentiation (GO:0045647)|positive regulation of apoptotic process (GO:0043065)|positive regulation of myeloid cell differentiation (GO:0045639)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of mammary gland epithelial cell proliferation (GO:0033599)|respiratory system process (GO:0003016)|thyroid gland development (GO:0030878)|trachea cartilage morphogenesis (GO:0060535)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(2)|lung(12)|skin(1)	16						GTGCAGCTTGCGCATCCAGGG	0.677																																					p.R181H	Colon(119;75 2200 7557 42868)												.	HOXA5-514	0			c.G542A						.						92.0	114.0	107.0					7																	27182685		2203	4300	6503	SO:0001583	missense	3202	exon1			AGCTTGCGCATCC		CCDS5406.1	7p15.2	2011-06-20	2005-12-22		ENSG00000106004	ENSG00000106004		"""Homeoboxes / ANTP class : HOXL subclass"""	5106	protein-coding gene	gene with protein product		142952	"""homeo box A5"""	HOX1C, HOX1		1973146, 1358459	Standard	NM_019102		Approved		uc003syn.2	P20719	OTTHUMG00000023214	ENST00000222726.3:c.542G>A	7.37:g.27182685C>T	ENSP00000222726:p.Arg181His	275	0		459	5	NM_019102	0	0	18	18	0	A4D179|O43367|Q96CY6	Missense_Mutation	SNP	ENST00000222726.3	37	CCDS5406.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.948206	0.73787	.	.	ENSG00000106004	ENST00000222726	D	0.95656	-3.77	5.53	5.53	0.82687	Homeodomain-like (1);Homeobox protein, antennapedia type, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.97898	0.9309	M	0.85462	2.755	0.80722	D	1	D	0.89917	1.0	D	0.71870	0.975	D	0.98528	1.0626	10	0.87932	D	0	.	19.0547	0.93058	0.0:1.0:0.0:0.0	.	181	P20719	HXA5_HUMAN	H	181	ENSP00000222726:R181H	ENSP00000222726:R181H	R	-	2	0	HOXA5	27149210	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.448000	0.80631	2.606000	0.88127	0.591000	0.81541	CGC	.		0.677	HOXA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358705.1		
MTURN	222166	broad.mit.edu	37	7	30197075	30197075	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5891-01A-11D-1589-08	TCGA-BQ-5891-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37d4ff42-0161-4f83-bd6f-13eb19d4eabf	28824279-2be9-45db-867a-b165d8191d0c	g.chr7:30197075G>A	ENST00000324453.8	+	3	634	c.307G>A	c.(307-309)Gat>Aat	p.D103N	AC007036.5_ENST00000511893.1_RNA|C7orf41_ENST00000324489.5_Missense_Mutation_p.D70N|C7orf41_ENST00000409688.1_Missense_Mutation_p.D62N|C7orf41_ENST00000455738.1_Missense_Mutation_p.D70N|C7orf41_ENST00000415604.1_Missense_Mutation_p.D103N	NM_152793.2	NP_690006.2	Q8N3F0	MTURN_HUMAN		103					multicellular organismal development (GO:0007275)					NS(1)|large_intestine(2)	3						TCCGGATGCAGATGACGATGC	0.562																																					p.D103N													.	C7orf41-90	0			c.G307A						.						157.0	167.0	163.0					7																	30197075		2203	4300	6503	SO:0001583	missense	222166	exon3			GATGCAGATGACG																												ENST00000324453.8:c.307G>A	7.37:g.30197075G>A	ENSP00000324204:p.Asp103Asn	297	0		492	7	NM_152793	0	1	38	39	0	B8ZZW9|Q8N791|Q8N8M4|Q8NEX2	Missense_Mutation	SNP	ENST00000324453.8	37	CCDS5425.2	.	.	.	.	.	.	.	.	.	.	G	19.61	3.860130	0.71834	.	.	ENSG00000180354	ENST00000324453;ENST00000409688;ENST00000415604;ENST00000324489;ENST00000455738	.	.	.	6.17	6.17	0.99709	.	0.119080	0.56097	D	0.000038	T	0.55609	0.1931	N	0.24115	0.695	0.49299	D	0.999771	B	0.25809	0.135	B	0.30855	0.121	T	0.53085	-0.8488	9	0.66056	D	0.02	-9.1856	19.8676	0.96824	0.0:0.0:1.0:0.0	.	103	Q8N3F0	CG041_HUMAN	N	103;62;103;70;70	.	ENSP00000324204:D103N	D	+	1	0	C7orf41	30163600	1.000000	0.71417	0.985000	0.45067	0.614000	0.37383	8.028000	0.88798	2.941000	0.99782	0.655000	0.94253	GAT	.		0.562	C7orf41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250409.1		
IRF5	3663	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	128587532	128587532	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5891-01A-11D-1589-08	TCGA-BQ-5891-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	37d4ff42-0161-4f83-bd6f-13eb19d4eabf	28824279-2be9-45db-867a-b165d8191d0c	g.chr7:128587532C>T	ENST00000402030.2	+	6	754	c.682C>T	c.(682-684)Ccc>Tcc	p.P228S	IRF5_ENST00000357234.5_Missense_Mutation_p.P244S|IRF5_ENST00000249375.4_Missense_Mutation_p.P228S|IRF5_ENST00000473745.1_Missense_Mutation_p.P228S|IRF5_ENST00000477535.1_Intron	NM_001098629.1|NM_001098630.1	NP_001092099.1|NP_001092100.1	Q13568	IRF5_HUMAN	interferon regulatory factor 5	228					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of apoptotic process (GO:0043065)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to muramyl dipeptide (GO:0032495)|response to peptidoglycan (GO:0032494)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(1)|prostate(1)	15						TGCCAGCCTGCCCCCTGCAGG	0.682																																					p.P244S		.											.	IRF5-226	0			c.C730T						.						15.0	18.0	17.0					7																	128587532		2120	4170	6290	SO:0001583	missense	3663	exon6			AGCCTGCCCCCTG		CCDS5808.1, CCDS43645.1, CCDS56512.1	7q32	2008-07-18			ENSG00000128604	ENSG00000128604			6120	protein-coding gene	gene with protein product		607218					Standard	XM_005250317		Approved		uc003vog.3	Q13568	OTTHUMG00000158410	ENST00000402030.2:c.682C>T	7.37:g.128587532C>T	ENSP00000385352:p.Pro228Ser	40	0		54	23	NM_001098629	0	0	47	84	37	A4D1J8|A8DUA8|A8DUA9|E7EQ16|E7EW54|Q1A7B4|Q64GA9|Q64GB1|Q64GB2|Q6RCM8|Q9BQF0	Missense_Mutation	SNP	ENST00000402030.2	37	CCDS5808.1	.	.	.	.	.	.	.	.	.	.	C	18.47	3.630932	0.67015	.	.	ENSG00000128604	ENST00000357234;ENST00000402030;ENST00000249375;ENST00000473745;ENST00000412326	D;D;D;D	0.97529	-4.4;-4.42;-4.42;-4.42	5.26	2.02	0.26589	.	0.848323	0.10423	N	0.676477	D	0.95175	0.8436	L	0.53249	1.67	0.36808	D	0.885713	B;B	0.30634	0.043;0.288	B;B	0.35413	0.027;0.202	D	0.93066	0.6478	10	0.56958	D	0.05	-11.2851	8.0991	0.30846	0.1597:0.4338:0.4065:0.0	.	228;244	Q13568;Q13568-2	IRF5_HUMAN;.	S	244;228;228;228;218	ENSP00000349770:P244S;ENSP00000385352:P228S;ENSP00000249375:P228S;ENSP00000419149:P228S	ENSP00000249375:P228S	P	+	1	0	IRF5	128374768	0.309000	0.24518	0.269000	0.24586	0.935000	0.57460	0.974000	0.29436	0.667000	0.31107	0.561000	0.74099	CCC	.		0.682	IRF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350934.1	NM_001098627	
PODXL	5420	hgsc.bcm.edu	37	7	131241029	131241029	+	Silent	SNP	G	G	C	rs11277659|rs547816245|rs532078953|rs79759078|rs571821675	byFrequency	TCGA-BQ-5891-01A-11D-1589-08	TCGA-BQ-5891-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	37d4ff42-0161-4f83-bd6f-13eb19d4eabf	28824279-2be9-45db-867a-b165d8191d0c	g.chr7:131241029G>C	ENST00000378555.3	-	1	337	c.90C>G	c.(88-90)ccC>ccG	p.P30P	PODXL_ENST00000537928.1_Silent_p.P30P|PODXL_ENST00000322985.9_Silent_p.P30P|PODXL_ENST00000541194.1_Silent_p.P30P|PODXL_ENST00000465001.1_Intron			O00592	PODXL_HUMAN	podocalyxin-like	30					cell adhesion (GO:0007155)|cell migration (GO:0016477)|epithelial tube formation (GO:0072175)|glomerular visceral epithelial cell development (GO:0072015)|leukocyte migration (GO:0050900)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-cell adhesion (GO:0022408)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|regulation of microvillus assembly (GO:0032534)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|slit diaphragm (GO:0036057)				NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24	Melanoma(18;0.162)					CATTCTGGGAGggcgacggcg	0.751																																					p.P30P		.											.	PODXL-136	0			c.C90G						.						5.0	7.0	6.0					7																	131241029		1981	3946	5927	SO:0001819	synonymous_variant	5420	exon1			CTGGGAGGGCGAC		CCDS34755.1, CCDS47714.1	7q32-q33	2008-07-18			ENSG00000128567	ENSG00000128567			9171	protein-coding gene	gene with protein product		602632					Standard	NM_001018111		Approved	PCLP, Gp200, PC	uc003vqx.4	O00592	OTTHUMG00000154918	ENST00000378555.3:c.90C>G	7.37:g.131241029G>C		5	0		7	3	NM_001018111	0	0	0	0	0	A6NHX8|Q52LZ7|Q53ER6	Silent	SNP	ENST00000378555.3	37	CCDS34755.1																																																																																			.		0.751	PODXL-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000337627.2	NM_001018111	
KIAA1429	25962	broad.mit.edu	37	8	95503873	95503873	+	Silent	SNP	T	T	C			TCGA-BQ-5891-01A-11D-1589-08	TCGA-BQ-5891-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37d4ff42-0161-4f83-bd6f-13eb19d4eabf	28824279-2be9-45db-867a-b165d8191d0c	g.chr8:95503873T>C	ENST00000297591.5	-	22	5148	c.5073A>G	c.(5071-5073)tcA>tcG	p.S1691S	KIAA1429_ENST00000437199.1_3'UTR	NM_015496.4	NP_056311.2	Q69YN4	VIR_HUMAN	KIAA1429	1691					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(16)|lung(28)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	66	Breast(36;3.29e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00185)			CTCTATTGCCTGAAAACCCAC	0.428																																					p.S1691S													.	KIAA1429-92	0			c.A5073G						.						135.0	126.0	129.0					8																	95503873		2203	4300	6503	SO:0001819	synonymous_variant	25962	exon22			ATTGCCTGAAAAC	AB037850	CCDS34923.1, CCDS47894.1	8q22.1	2008-11-25			ENSG00000164944	ENSG00000164944			24500	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 121"""					10718198	Standard	NM_015496		Approved	DKFZP434I116, fSAP121	uc003ygo.2	Q69YN4	OTTHUMG00000164426	ENST00000297591.5:c.5073A>G	8.37:g.95503873T>C		153	0		142	3	NM_015496	0	0	38	39	1	Q2M1N0|Q6AHX9|Q6NT78|Q7Z6C7|Q8IXH4|Q9BTH4|Q9H9C9|Q9NWR3|Q9P2B8|Q9UFW1	Silent	SNP	ENST00000297591.5	37	CCDS34923.1																																																																																			.		0.428	KIAA1429-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378720.2	NM_015496	
BAAT	570	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	104125282	104125282	+	Missense_Mutation	SNP	C	C	T	rs141722672	byFrequency	TCGA-BQ-5891-01A-11D-1589-08	TCGA-BQ-5891-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	37d4ff42-0161-4f83-bd6f-13eb19d4eabf	28824279-2be9-45db-867a-b165d8191d0c	g.chr9:104125282C>T	ENST00000395051.3	-	3	755	c.685G>A	c.(685-687)Gtt>Att	p.V229I	BAAT_ENST00000259407.2_Missense_Mutation_p.V229I			Q14032	BAAT_HUMAN	bile acid CoA:amino acid N-acyltransferase	229					acyl-CoA metabolic process (GO:0006637)|bile acid and bile salt transport (GO:0015721)|bile acid biosynthetic process (GO:0006699)|bile acid conjugation (GO:0002152)|bile acid metabolic process (GO:0008206)|fatty acid metabolic process (GO:0006631)|glycine metabolic process (GO:0006544)|liver development (GO:0001889)|organ regeneration (GO:0031100)|small molecule metabolic process (GO:0044281)|taurine metabolic process (GO:0019530)	cytosol (GO:0005829)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	carboxylic ester hydrolase activity (GO:0052689)|glycine N-choloyltransferase activity (GO:0047963)|long-chain acyl-CoA hydrolase activity (GO:0052816)|medium-chain acyl-CoA hydrolase activity (GO:0052815)|N-acyltransferase activity (GO:0016410)|palmitoyl-CoA hydrolase activity (GO:0016290)|receptor binding (GO:0005102)|very long chain acyl-CoA hydrolase activity (GO:0052817)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)	23		Acute lymphoblastic leukemia(62;0.0559)			Glycine(DB00145)	ACTACCCCAACGCCTGAGCCA	0.388													C|||	4	0.000798722	0.0015	0.0	5008	,	,		18562	0.002		0.0	False		,,,				2504	0.0				p.V229I		.											.	BAAT-228	0			c.G685A						.	C	ILE/VAL,ILE/VAL	7,4393	11.4+/-27.6	0,7,2193	61.0	63.0	62.0		685,685	-0.3	0.5	9	dbSNP_134	62	0,8598		0,0,4299	yes	missense,missense	BAAT	NM_001127610.1,NM_001701.3	29,29	0,7,6492	TT,TC,CC		0.0,0.1591,0.0539	benign,benign	229/419,229/419	104125282	7,12991	2200	4299	6499	SO:0001583	missense	570	exon4			CCCCAACGCCTGA	L34081	CCDS6752.1	9q22.3	2014-06-24	2014-06-24		ENSG00000136881	ENSG00000136881	2.3.1.65		932	protein-coding gene	gene with protein product	"""glycine N-choloyltransferase"""	602938	"""bile acid Coenzyme A:amino acid N-acyltransferase (glycine N-choloyltransferase)"", ""bile acid CoA: amino acid N-acyltransferase (glycine N-choloyltransferase)"""				Standard	NM_001701		Approved	BAT	uc010mtd.3	Q14032	OTTHUMG00000020377	ENST00000395051.3:c.685G>A	9.37:g.104125282C>T	ENSP00000378491:p.Val229Ile	91	0		71	26	NM_001127610	0	0	1	1	0	Q3B7W9|Q96L31	Missense_Mutation	SNP	ENST00000395051.3	37	CCDS6752.1	3	0.0013736263736263737	1	0.0020325203252032522	0	0.0	2	0.0034965034965034965	0	0.0	C	0.007	-1.950142	0.00475	0.001591	0.0	ENSG00000136881	ENST00000259407;ENST00000395051	T;T	0.21734	1.99;1.99	4.96	-0.299	0.12808	BAAT/Acyl-CoA thioester hydrolase C-terminal (1);	0.391226	0.24879	N	0.034863	T	0.06416	0.0165	N	0.03238	-0.38	0.27280	N	0.95812	B	0.15930	0.015	B	0.14578	0.011	T	0.41610	-0.9499	10	0.02654	T	1	-10.6106	8.7705	0.34728	0.0:0.4737:0.0:0.5263	.	229	Q14032	BAAT_HUMAN	I	229	ENSP00000259407:V229I;ENSP00000378491:V229I	ENSP00000259407:V229I	V	-	1	0	BAAT	103165103	0.000000	0.05858	0.529000	0.27951	0.057000	0.15508	-1.997000	0.01470	-0.160000	0.11002	-0.290000	0.09829	GTT	C|0.999;T|0.001		0.388	BAAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053433.1		
ADAMTSL2	9719	hgsc.bcm.edu	37	9	136419613	136419613	+	Silent	SNP	C	C	T	rs370480318	byFrequency	TCGA-BQ-5891-01A-11D-1589-08	TCGA-BQ-5891-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	37d4ff42-0161-4f83-bd6f-13eb19d4eabf	28824279-2be9-45db-867a-b165d8191d0c	g.chr9:136419613C>T	ENST00000354484.4	+	10	1631	c.1074C>T	c.(1072-1074)gcC>gcT	p.A358A	ADAMTSL2_ENST00000393060.1_Silent_p.A358A|ADAMTSL2_ENST00000393061.3_Silent_p.A467A	NM_001145320.1	NP_001138792.1	Q86TH1	ATL2_HUMAN	ADAMTS-like 2	358					negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			kidney(2)|large_intestine(2)|lung(7)|ovary(2)|urinary_tract(1)	14				OV - Ovarian serous cystadenocarcinoma(145;9.31e-08)|Epithelial(140;6.62e-07)|all cancers(34;7.74e-06)		TGGACGGGGCCGGGCTGATGG	0.701																																					p.A358A		.											.	ADAMTSL2-91	0			c.C1074T						.	C	,	0,3798		0,0,1899	6.0	7.0	7.0		1074,1074	-8.1	0.0	9		7	2,7310		0,2,3654	no	coding-synonymous,coding-synonymous	ADAMTSL2	NM_001145320.1,NM_014694.3	,	0,2,5553	TT,TC,CC		0.0274,0.0,0.018	,	358/952,358/952	136419613	2,11108	1899	3656	5555	SO:0001819	synonymous_variant	9719	exon10			CGGGGCCGGGCTG	AB011177	CCDS6976.1	9q34.3	2005-01-12			ENSG00000197859	ENSG00000197859			14631	protein-coding gene	gene with protein product		612277				9628581, 14667842	Standard	NM_014694		Approved	KIAA0605	uc004cei.3	Q86TH1	OTTHUMG00000131706	ENST00000354484.4:c.1074C>T	9.37:g.136419613C>T		5	0		4	4	NM_014694	0	0	0	2	2	B1B0D5|O60345	Silent	SNP	ENST00000354484.4	37	CCDS6976.1																																																																																			.		0.701	ADAMTSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254619.1	NM_014694	
SHROOM4	57477	hgsc.bcm.edu	37	X	50350698	50350698	+	Silent	SNP	C	C	T			TCGA-BQ-5891-01A-11D-1589-08	TCGA-BQ-5891-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	37d4ff42-0161-4f83-bd6f-13eb19d4eabf	28824279-2be9-45db-867a-b165d8191d0c	g.chrX:50350698C>T	ENST00000289292.7	-	6	3727	c.3444G>A	c.(3442-3444)gaG>gaA	p.E1148E	SHROOM4_ENST00000376020.2_Silent_p.E1148E|SHROOM4_ENST00000460112.3_Silent_p.E1032E			Q9ULL8	SHRM4_HUMAN	shroom family member 4	1148	Glu-rich.				actin cytoskeleton organization (GO:0030036)|actin filament organization (GO:0007015)|brain development (GO:0007420)|cognition (GO:0050890)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|myosin II complex (GO:0016460)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(6)|liver(1)|lung(20)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	52	Ovarian(276;0.236)					cctcctcctcctcctcttcct	0.557													C|||	1	0.000264901	0.0	0.0014	3775	,	,		12007	0.0		0.0	False		,,,				2504	0.0				p.E1148E		.											.	SHROOM4-131	0			c.G3444A						.						22.0	20.0	21.0					X																	50350698		2203	4298	6501	SO:0001819	synonymous_variant	57477	exon6			CTCCTCCTCCTCT	AB033028	CCDS35277.1	Xp11.22	2008-02-05			ENSG00000158352	ENSG00000158352			29215	protein-coding gene	gene with protein product		300579				10574462, 16615870	Standard	NR_027121		Approved	KIAA1202	uc004dpe.2	Q9ULL8	OTTHUMG00000021521	ENST00000289292.7:c.3444G>A	X.37:g.50350698C>T		15	1		23	6	NM_020717	0	0	11	11	0	A7E2X9|D6RFW0|Q96LA0	Silent	SNP	ENST00000289292.7	37	CCDS35277.1																																																																																			.		0.557	SHROOM4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056564.4	NM_020717	
COL4A6	1288	broad.mit.edu	37	X	107434729	107434729	+	Silent	SNP	T	T	C			TCGA-BQ-5891-01A-11D-1589-08	TCGA-BQ-5891-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37d4ff42-0161-4f83-bd6f-13eb19d4eabf	28824279-2be9-45db-867a-b165d8191d0c	g.chrX:107434729T>C	ENST00000372216.4	-	19	1318	c.1218A>G	c.(1216-1218)ccA>ccG	p.P406P	COL4A6_ENST00000538570.1_Silent_p.P405P|COL4A6_ENST00000394872.2_Silent_p.P406P|COL4A6_ENST00000545689.1_Silent_p.P405P|COL4A6_ENST00000334504.7_Silent_p.P405P	NM_001847.2	NP_001838.2	Q14031	CO4A6_HUMAN	collagen, type IV, alpha 6	406	Triple-helical region.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(41)|ovary(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	92						CCTTCAGCCCTGGAAATCCCT	0.567									Alport syndrome with Diffuse Leiomyomatosis																												p.P406P	Melanoma(87;1895 1945 2589 7165)												.	COL4A6-199	0			c.A1218G						.						112.0	106.0	108.0					X																	107434729		2203	4300	6503	SO:0001819	synonymous_variant	1288	exon19	Familial Cancer Database		CAGCCCTGGAAAT	U04845	CCDS14541.1, CCDS14542.1, CCDS76008.1, CCDS76009.1, CCDS76010.1	Xq22	2014-09-17			ENSG00000197565	ENSG00000197565		"""Collagens"""	2208	protein-coding gene	gene with protein product		303631				8356449	Standard	NM_033641		Approved		uc004env.4	Q14031	OTTHUMG00000022179	ENST00000372216.4:c.1218A>G	X.37:g.107434729T>C		242	0		218	5	NM_001847	0	0	0	0	0	Q12823|Q14053|Q5JYH6|Q5JYH8|Q9NQM5|Q9NTX3|Q9UJ76|Q9UMG6|Q9Y4L4	Silent	SNP	ENST00000372216.4	37	CCDS14541.1																																																																																			.		0.567	COL4A6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057875.2		
SCAF11	9169	broad.mit.edu	37	12	46320707	46320708	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-BQ-5891-01A-11D-1589-08	TCGA-BQ-5891-11A-01D-1589-08	TC	TC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37d4ff42-0161-4f83-bd6f-13eb19d4eabf	28824279-2be9-45db-867a-b165d8191d0c	g.chr12:46320707_46320708delTC	ENST00000369367.3	-	11	3009_3010	c.2776_2777delGA	c.(2776-2778)gaafs	p.E926fs	SCAF11_ENST00000419565.2_Frame_Shift_Del_p.E926fs|SCAF11_ENST00000550629.1_5'Flank|SCAF11_ENST00000465950.1_Frame_Shift_Del_p.E611fs|SCAF11_ENST00000549162.1_Frame_Shift_Del_p.E734fs	NM_004719.2	NP_004710.2	Q99590	SCAFB_HUMAN	SR-related CTD-associated factor 11	926	Arg-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|spliceosomal complex assembly (GO:0000245)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(8)|large_intestine(17)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	69						GGTTCTCCTTTCTCTCTCTCTC	0.446																																					p.926_926del													.	SCAF11-93	0			c.2776_2777del						.																																			SO:0001589	frameshift_variant	9169	exon11			CTCCTTTCTCTCT	Y11251	CCDS8748.2	12q13.11	2013-01-09	2011-01-10	2011-01-10	ENSG00000139218	ENSG00000139218		"""RING-type (C3HC4) zinc fingers"""	10784	protein-coding gene	gene with protein product		603668	"""splicing factor, arginine/serine-rich 2, interacting protein"", ""serine/arginine-rich splicing factor 2, interacting protein"""	SFRS2IP, SRSF2IP		9224939, 9447963	Standard	NM_004719		Approved	SIP1, SRRP129, CASP11	uc001rox.3	Q99590	OTTHUMG00000149930	ENST00000369367.3:c.2776_2777delGA	12.37:g.46320717_46320718delTC	ENSP00000358374:p.Glu926fs	272	0		498	11	NM_004719	0	0	0	0	0	A6NEU9|A6NLW5|Q8IW59	Frame_Shift_Del	DEL	ENST00000369367.3	37	CCDS8748.2																																																																																			.		0.446	SCAF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313992.2	NM_004719	
ACADL	33	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	211057526	211057526	+	Splice_Site	DEL	A	A	-			TCGA-BQ-5891-01A-11D-1589-08	TCGA-BQ-5891-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	37d4ff42-0161-4f83-bd6f-13eb19d4eabf	28824279-2be9-45db-867a-b165d8191d0c	g.chr2:211057526delA	ENST00000233710.3	-	10	1427		c.e10+1		AC006994.2_ENST00000412065.1_RNA	NM_001608.3	NP_001599.1	P28330	ACADL_HUMAN	acyl-CoA dehydrogenase, long chain						carnitine catabolic process (GO:0042413)|carnitine metabolic process, CoA-linked (GO:0019254)|cellular lipid catabolic process (GO:0044242)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)|long-chain fatty acid catabolic process (GO:0042758)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of fatty acid oxidation (GO:0046322)|oxidation-reduction process (GO:0055114)|protein homotetramerization (GO:0051289)|regulation of cholesterol metabolic process (GO:0090181)|small molecule metabolic process (GO:0044281)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrion (GO:0005739)	acyl-CoA dehydrogenase activity (GO:0003995)|fatty-acyl-CoA binding (GO:0000062)|flavin adenine dinucleotide binding (GO:0050660)|long-chain-acyl-CoA dehydrogenase activity (GO:0004466)|palmitoyl-CoA oxidase activity (GO:0016401)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	14		Renal(323;0.202)		Epithelial(149;0.00631)|Lung(261;0.0438)|LUSC - Lung squamous cell carcinoma(261;0.0466)|all cancers(144;0.0621)		AACTATACTTACTTTGCAATT	0.383																																					.		.											.	ACADL-90	0			c.1199+2T>-						.						77.0	72.0	74.0					2																	211057526		2203	4300	6503	SO:0001630	splice_region_variant	33	exon11			.	M74096	CCDS2389.1	2q34	2012-07-13	2010-04-30		ENSG00000115361	ENSG00000115361	1.3.99.13		88	protein-coding gene	gene with protein product		609576	"""acyl-Coenzyme A dehydrogenase, long chain"""			1774065	Standard	NM_001608		Approved	LCAD, ACAD4	uc002vdz.4	P28330	OTTHUMG00000132989	ENST00000233710.3:c.1199+1T>-	2.37:g.211057526delA		65	0		66	63	NM_001608	0	0	0	0	0	B2R8T3|Q8IUN8	Splice_Site	DEL	ENST00000233710.3	37	CCDS2389.1																																																																																			.		0.383	ACADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256561.2	NM_001608	Intron
ACADL	33	hgsc.bcm.edu	37	2	211057526	211057527	+	Splice_Site	DEL	AC	AC	-			TCGA-BQ-5891-01A-11D-1589-08	TCGA-BQ-5891-11A-01D-1589-08	AC	AC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	37d4ff42-0161-4f83-bd6f-13eb19d4eabf	28824279-2be9-45db-867a-b165d8191d0c	g.chr2:211057526_211057527delAC	ENST00000233710.3	-	10	1427		c.e10+1		AC006994.2_ENST00000412065.1_RNA	NM_001608.3	NP_001599.1	P28330	ACADL_HUMAN	acyl-CoA dehydrogenase, long chain						carnitine catabolic process (GO:0042413)|carnitine metabolic process, CoA-linked (GO:0019254)|cellular lipid catabolic process (GO:0044242)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)|long-chain fatty acid catabolic process (GO:0042758)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of fatty acid oxidation (GO:0046322)|oxidation-reduction process (GO:0055114)|protein homotetramerization (GO:0051289)|regulation of cholesterol metabolic process (GO:0090181)|small molecule metabolic process (GO:0044281)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrion (GO:0005739)	acyl-CoA dehydrogenase activity (GO:0003995)|fatty-acyl-CoA binding (GO:0000062)|flavin adenine dinucleotide binding (GO:0050660)|long-chain-acyl-CoA dehydrogenase activity (GO:0004466)|palmitoyl-CoA oxidase activity (GO:0016401)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	14		Renal(323;0.202)		Epithelial(149;0.00631)|Lung(261;0.0438)|LUSC - Lung squamous cell carcinoma(261;0.0466)|all cancers(144;0.0621)		AACTATACTTACTTTGCAATTG	0.381																																					.		.											.	ACADL-90	0			.						.																																			SO:0001630	splice_region_variant	33	.			.	M74096	CCDS2389.1	2q34	2012-07-13	2010-04-30		ENSG00000115361	ENSG00000115361	1.3.99.13		88	protein-coding gene	gene with protein product		609576	"""acyl-Coenzyme A dehydrogenase, long chain"""			1774065	Standard	NM_001608		Approved	LCAD, ACAD4	uc002vdz.4	P28330	OTTHUMG00000132989	ENST00000233710.3:c.1199+1GT>-	2.37:g.211057526_211057527delAC		67	0		67	34	.	0	0	0	0	0	B2R8T3|Q8IUN8	Splice_Site	DEL	ENST00000233710.3	37	CCDS2389.1																																																																																			.		0.381	ACADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256561.2	NM_001608	Intron
SETD2	29072	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	47162849	47162850	+	Frame_Shift_Del	DEL	TT	TT	-	rs114327122		TCGA-BQ-5891-01A-11D-1589-08	TCGA-BQ-5891-11A-01D-1589-08	TT	TT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	37d4ff42-0161-4f83-bd6f-13eb19d4eabf	28824279-2be9-45db-867a-b165d8191d0c	g.chr3:47162849_47162850delTT	ENST00000409792.3	-	3	3318_3319	c.3276_3277delAA	c.(3274-3279)caaagtfs	p.S1093fs		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1093					angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)	p.S1093R(1)|p.S590R(1)		breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		TGTCTATAACTTTGACTGCTCC	0.416			"""N, F, S, Mis"""		clear cell renal carcinoma																																p.1092_1093del		.		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	.	SETD2-1273	2	Substitution - Missense(2)	large_intestine(2)	c.3276_3277del						.																																			SO:0001589	frameshift_variant	29072	exon3			.	AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.3276_3277delAA	3.37:g.47162849_47162850delTT	ENSP00000386759:p.Ser1093fs	167	0		141	121	NM_014159	0	0	0	0	0	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Frame_Shift_Del	DEL	ENST00000409792.3	37	CCDS2749.2																																																																																			.		0.416	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159	
KL	9365	bcgsc.ca	37	13	33591076	33591077	+	Missense_Mutation	DNP	CC	CC	TG			TCGA-BQ-5891-01A-11D-1589-08	TCGA-BQ-5891-11A-01D-1589-08	CC	CC	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	37d4ff42-0161-4f83-bd6f-13eb19d4eabf	28824279-2be9-45db-867a-b165d8191d0c	g.chr13:33591076_33591077CC>TG	ENST00000380099.3	+	1	506_507	c.498_499CC>TG	c.(496-501)aaCCgc>aaTGgc	p.R167G	KL_ENST00000487852.1_3'UTR|KL_ENST00000426690.2_Intron	NM_004795.3	NP_004786.2	Q9UEF7	KLOT_HUMAN	klotho	167	Glycosyl hydrolase-1 1.				acute inflammatory response (GO:0002526)|aging (GO:0007568)|calcium ion homeostasis (GO:0055074)|carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of bone mineralization (GO:0030501)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-glucosidase activity (GO:0008422)|beta-glucuronidase activity (GO:0004566)|fibroblast growth factor binding (GO:0017134)|signal transducer activity (GO:0004871)|vitamin D binding (GO:0005499)			breast(2)|endometrium(5)|kidney(3)|large_intestine(10)|lung(14)|ovary(2)|skin(5)	41	all_epithelial(80;0.133)	Ovarian(182;1.78e-06)|Breast(139;4.08e-05)|Hepatocellular(188;0.00886)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;7.13e-230)|all cancers(112;1.33e-165)|OV - Ovarian serous cystadenocarcinoma(117;1.09e-113)|Epithelial(112;3.79e-112)|Lung(94;8.52e-27)|LUSC - Lung squamous cell carcinoma(192;1.4e-13)|Kidney(163;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(186;5.63e-08)|BRCA - Breast invasive adenocarcinoma(63;1.41e-05)		GCGTCCCCAACCGCGAGGGGCT	0.723																																					p.R167G													.	KL-155	0			c.C499G						.																																			SO:0001583	missense	9365	exon1			CCCAACCGCGAGG	AB005142	CCDS9347.1	13q12	2008-02-05			ENSG00000133116	ENSG00000133116			6344	protein-coding gene	gene with protein product		604824				9464267	Standard	NM_004795		Approved		uc001uus.3	Q9UEF7	OTTHUMG00000017408	Exception_encountered	13.37:g.33591076_33591077delinsTG	ENSP00000369442:p.Arg167Gly	21	0		15	4	NM_004795	0	0	0	0	0	Q5VZ95|Q96KV5|Q96KW5|Q9UEI9|Q9Y4F0	Missense_Mutation	DNP	ENST00000380099.3	37	CCDS9347.1																																																																																			.		0.723	KL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045987.1		
