#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ATAD3A	55210	hgsc.bcm.edu	37	1	1458174	1458174	+	Silent	SNP	C	C	G			TCGA-BQ-7050-01A-11D-1961-08	TCGA-BQ-7050-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b6b349c-fb1d-44a6-abcf-da2951066a9b	ecae3b13-cf72-4058-8385-cb3bf34bec83	g.chr1:1458174C>G	ENST00000378755.5	+	8	1039	c.945C>G	c.(943-945)gcC>gcG	p.A315A	ATAD3A_ENST00000536055.1_Silent_p.A188A|ATAD3A_ENST00000378756.3_Silent_p.A267A	NM_018188.3	NP_060658.3	Q9NVI7	ATD3A_HUMAN	ATPase family, AAA domain containing 3A	315					cell growth (GO:0016049)|negative regulation of apoptotic process (GO:0043066)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)			endometrium(4)|kidney(6)|large_intestine(1)|lung(5)|prostate(1)|skin(2)|urinary_tract(1)	20	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;1.12e-36)|OV - Ovarian serous cystadenocarcinoma(86;2.18e-22)|Colorectal(212;0.000164)|COAD - Colon adenocarcinoma(227;0.000195)|Kidney(185;0.00233)|BRCA - Breast invasive adenocarcinoma(365;0.00469)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0347)|Lung(427;0.147)		CCAAGAATGCCACGCTTGTCG	0.687																																					p.A315A		.											.	ATAD3A-91	0			c.C945G						.						41.0	52.0	49.0					1																	1458174		2195	4300	6495	SO:0001819	synonymous_variant	55210	exon8			GAATGCCACGCTT	AK025865	CCDS31.1, CCDS53259.1, CCDS53260.1	1p36.33	2010-04-21		2007-02-08	ENSG00000197785	ENSG00000197785		"""ATPases / AAA-type"""	25567	protein-coding gene	gene with protein product		612316				12477932	Standard	NM_018188		Approved	FLJ10709	uc001afz.2	Q9NVI7	OTTHUMG00000000575	ENST00000378755.5:c.945C>G	1.37:g.1458174C>G		28	2		40	2	NM_018188	0	0	8	8	0	B3KPB3|D2K8Q1|G3V1I6|Q5SV23|Q8N275|Q96A50	Silent	SNP	ENST00000378755.5	37	CCDS31.1	.	.	.	.	.	.	.	.	.	.	c	1.378	-0.584146	0.03827	.	.	ENSG00000197785	ENST00000339113	.	.	.	5.11	-5.52	0.02560	.	.	.	.	.	T	0.38665	0.1049	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.37596	-0.9699	4	.	.	.	.	3.4	0.07320	0.0896:0.4395:0.1791:0.2918	.	.	.	.	D	253	.	.	H	+	1	0	ATAD3A	1448037	0.811000	0.29063	0.062000	0.19696	0.001000	0.01503	-0.076000	0.11412	-1.066000	0.03164	-1.938000	0.00498	CAC	.		0.687	ATAD3A-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000001365.1	NM_018188	
ASH1L	55870	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	155317614	155317614	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7050-01A-11D-1961-08	TCGA-BQ-7050-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b6b349c-fb1d-44a6-abcf-da2951066a9b	ecae3b13-cf72-4058-8385-cb3bf34bec83	g.chr1:155317614A>G	ENST00000368346.3	-	20	8290	c.7651T>C	c.(7651-7653)Tca>Cca	p.S2551P	MIR555_ENST00000384987.1_RNA|ASH1L_ENST00000392403.3_Missense_Mutation_p.S2546P			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)	2551					cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			ATCTGGGCTGATGCCTCATGC	0.488																																					p.S2546P		.											.	ASH1L-234	0			c.T7636C						.						197.0	160.0	173.0					1																	155317614		2203	4300	6503	SO:0001583	missense	55870	exon20			GGGCTGATGCCTC	AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.7651T>C	1.37:g.155317614A>G	ENSP00000357330:p.Ser2551Pro	146	0		137	59	NM_018489	0	0	5	13	8	Q59GP1|Q5T714|Q5T715|Q9P2C7	Missense_Mutation	SNP	ENST00000368346.3	37		.	.	.	.	.	.	.	.	.	.	A	17.35	3.367145	0.61513	.	.	ENSG00000116539	ENST00000368346;ENST00000392403	T;T	0.16743	2.32;2.32	5.4	5.4	0.78164	Bromodomain (3);	0.058282	0.64402	D	0.000002	T	0.07007	0.0178	N	0.08118	0	0.80722	D	1	P;P	0.50272	0.89;0.933	B;P	0.49752	0.417;0.621	T	0.21177	-1.0253	10	0.45353	T	0.12	.	10.9753	0.47463	0.7253:0.2747:0.0:0.0	.	2551;2546	Q9NR48;Q9NR48-2	ASH1L_HUMAN;.	P	2551;2546	ENSP00000357330:S2551P;ENSP00000376204:S2546P	ENSP00000357330:S2551P	S	-	1	0	ASH1L	153584238	0.923000	0.31300	1.000000	0.80357	0.998000	0.95712	2.017000	0.40981	2.266000	0.75297	0.533000	0.62120	TCA	.		0.488	ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000039400.1	NM_018489	
NEK7	140609	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	198231718	198231718	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-7050-01A-11D-1961-08	TCGA-BQ-7050-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b6b349c-fb1d-44a6-abcf-da2951066a9b	ecae3b13-cf72-4058-8385-cb3bf34bec83	g.chr1:198231718T>G	ENST00000367385.4	+	4	554	c.212T>G	c.(211-213)aTg>aGg	p.M71R	NEK7_ENST00000538004.1_Missense_Mutation_p.M71R	NM_133494.2	NP_598001.1	Q8TDX7	NEK7_HUMAN	NIMA-related kinase 7	71	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cytokinesis (GO:0000910)|protein phosphorylation (GO:0006468)|regulation of mitotic cell cycle (GO:0007346)|spindle assembly (GO:0051225)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			endometrium(3)|kidney(2)|large_intestine(5)|lung(2)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	21						TTTGATTTAATGGATGCCAAA	0.289																																					p.M71R		.											.	NEK7-358	0			c.T212G						.						125.0	134.0	131.0					1																	198231718		2203	4292	6495	SO:0001583	missense	140609	exon4			ATTTAATGGATGC	AB062450	CCDS1394.1	1q31.3	2012-11-15	2012-11-15		ENSG00000151414	ENSG00000151414			13386	protein-coding gene	gene with protein product		606848	"""NIMA (never in mitosis gene a)-related kinase 7"""			11701951	Standard	NM_133494		Approved		uc001gun.4	Q8TDX7	OTTHUMG00000035658	ENST00000367385.4:c.212T>G	1.37:g.198231718T>G	ENSP00000356355:p.Met71Arg	208	0		173	28	NM_133494	0	0	9	11	2	A6NGT8	Missense_Mutation	SNP	ENST00000367385.4	37	CCDS1394.1	.	.	.	.	.	.	.	.	.	.	T	23.3	4.394506	0.83011	.	.	ENSG00000151414	ENST00000367385;ENST00000538004;ENST00000391974	T;T;T	0.63913	-0.07;-0.07;3.21	5.46	5.46	0.80206	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.67924	0.2945	L	0.28192	0.835	0.80722	D	1	D	0.57257	0.979	D	0.65573	0.936	T	0.71751	-0.4498	10	0.66056	D	0.02	.	15.4982	0.75673	0.0:0.0:0.0:1.0	.	71	Q8TDX7	NEK7_HUMAN	R	71	ENSP00000356355:M71R;ENSP00000444621:M71R;ENSP00000375835:M71R	ENSP00000356355:M71R	M	+	2	0	NEK7	196498341	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.506000	0.81665	2.198000	0.70561	0.528000	0.53228	ATG	.		0.289	NEK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086550.2	NM_133494	
PCF11	51585	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	82875304	82875304	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-7050-01A-11D-1961-08	TCGA-BQ-7050-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b6b349c-fb1d-44a6-abcf-da2951066a9b	ecae3b13-cf72-4058-8385-cb3bf34bec83	g.chr11:82875304C>T	ENST00000298281.4	+	4	1015	c.563C>T	c.(562-564)cCt>cTt	p.P188L		NM_015885.3	NP_056969.2	O94913	PCF11_HUMAN	PCF11 cleavage and polyadenylation factor subunit	188					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)				cervix(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(22)|ovary(1)|urinary_tract(1)	33						ATCTCCACTCCTCCAATTGTT	0.393																																					p.P188L		.											.	PCF11-23	0			c.C563T						.						64.0	59.0	60.0					11																	82875304		1868	4092	5960	SO:0001583	missense	51585	exon4			CCACTCCTCCAAT	AB020631	CCDS44689.1	11q13	2013-07-02	2013-07-02		ENSG00000165494	ENSG00000165494			30097	protein-coding gene	gene with protein product		608876	"""PCF11, cleavage and polyadenylation factor II subunit, homolog (S. cerevisiae)"", ""PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae)"""			11060040	Standard	NM_015885		Approved	KIAA0824	uc001ozx.4	O94913	OTTHUMG00000167031	ENST00000298281.4:c.563C>T	11.37:g.82875304C>T	ENSP00000298281:p.Pro188Leu	57	0		53	14	NM_015885	0	0	5	6	1	A6H8W7|O43671|Q6P0X8	Missense_Mutation	SNP	ENST00000298281.4	37	CCDS44689.1	.	.	.	.	.	.	.	.	.	.	C	17.74	3.462969	0.63513	.	.	ENSG00000165494	ENST00000298281;ENST00000530660;ENST00000530304	T;T;T	0.49432	1.74;0.78;0.79	5.73	5.73	0.89815	.	0.118143	0.39687	N	0.001292	T	0.36580	0.0972	L	0.36672	1.1	0.80722	D	1	P;B	0.35328	0.495;0.421	B;B	0.28849	0.095;0.058	T	0.13176	-1.0519	9	.	.	.	.	15.3998	0.74830	0.0:0.8614:0.1386:0.0	.	188;188	E9PQ01;O94913	.;PCF11_HUMAN	L	188	ENSP00000298281:P188L;ENSP00000434540:P188L;ENSP00000431567:P188L	.	P	+	2	0	PCF11	82552952	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.304000	0.65744	2.710000	0.92621	0.650000	0.86243	CCT	.		0.393	PCF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392548.2	NM_015885	
RDX	5962	hgsc.bcm.edu;broad.mit.edu	37	11	110134893	110134893	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-7050-01A-11D-1961-08	TCGA-BQ-7050-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b6b349c-fb1d-44a6-abcf-da2951066a9b	ecae3b13-cf72-4058-8385-cb3bf34bec83	g.chr11:110134893C>T	ENST00000343115.4	-	5	578	c.259G>A	c.(259-261)Gaa>Aaa	p.E87K	RDX_ENST00000528900.1_Intron|RDX_ENST00000528498.1_Missense_Mutation_p.E87K|RDX_ENST00000544551.1_Intron|RDX_ENST00000530301.1_Missense_Mutation_p.E55K|RDX_ENST00000405097.1_Missense_Mutation_p.E87K	NM_001260494.1|NM_002906.3	NP_001247423.1|NP_002897.1	P35241	RADI_HUMAN	radixin	87	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				actin filament capping (GO:0051693)|apical protein localization (GO:0045176)|establishment of endothelial barrier (GO:0061028)|microvillus assembly (GO:0030033)|positive regulation of gene expression (GO:0010628)	apical part of cell (GO:0045177)|cell tip (GO:0051286)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|stereocilium (GO:0032420)|T-tubule (GO:0030315)	poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(2)|large_intestine(3)|lung(8)|skin(1)|urinary_tract(1)	18		all_cancers(61;7.18e-13)|all_epithelial(67;2.61e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;1.13e-06)|BRCA - Breast invasive adenocarcinoma(274;9.75e-06)|all cancers(92;5.9e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0248)		GAAACATCTTCAGGAAAGAAT	0.328																																					p.E87K	Esophageal Squamous(55;25 1062 11040 28755 44273)	.											.	RDX-90	0			c.G259A						.						39.0	40.0	40.0					11																	110134893		2201	4297	6498	SO:0001583	missense	5962	exon5			CATCTTCAGGAAA	BC020751	CCDS8343.1, CCDS58171.1, CCDS58172.1, CCDS58173.1, CCDS58174.1	11q23	2008-03-17				ENSG00000137710			9944	protein-coding gene	gene with protein product		179410	"""deafness, autosomal recessive 24"""	DFNB24		8486357, 17226784	Standard	NM_001260492		Approved		uc031qdy.1	P35241		ENST00000343115.4:c.259G>A	11.37:g.110134893C>T	ENSP00000342830:p.Glu87Lys	50	0		55	11	NM_001260493	0	0	11	12	1	A7YIJ8|A7YIK0|A7YIK3|B7Z9U6|F5H1A7|Q86Y61	Missense_Mutation	SNP	ENST00000343115.4	37	CCDS8343.1	.	.	.	.	.	.	.	.	.	.	C	26.4	4.729873	0.89390	.	.	ENSG00000137710	ENST00000528498;ENST00000429481;ENST00000405097;ENST00000530301;ENST00000343115;ENST00000532118;ENST00000533991	T;T;T;T;D;D	0.89681	-1.21;-1.21;-1.21;-1.21;-2.55;-2.55	4.99	4.99	0.66335	Band 4.1 domain (1);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);FERM conserved site (1);	0.000000	0.85682	D	0.000000	D	0.96374	0.8817	H	0.95437	3.67	0.80722	D	1	P;D;P	0.89917	0.516;1.0;0.938	P;D;P	0.85130	0.533;0.997;0.537	D	0.97615	1.0132	10	0.87932	D	0	.	18.6342	0.91371	0.0:1.0:0.0:0.0	.	55;87;87	A7YIK0;A7YIJ8;P35241	.;.;RADI_HUMAN	K	87;87;87;55;87;76;76	ENSP00000432112:E87K;ENSP00000384136:E87K;ENSP00000436277:E55K;ENSP00000342830:E87K;ENSP00000437140:E76K;ENSP00000432572:E76K	ENSP00000342830:E87K	E	-	1	0	RDX	109640103	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.776000	0.85560	2.454000	0.82982	0.650000	0.86243	GAA	.		0.328	RDX-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000390535.2	NM_002906	
PAN2	9924	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	56720460	56720460	+	Silent	SNP	T	T	C			TCGA-BQ-7050-01A-11D-1961-08	TCGA-BQ-7050-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b6b349c-fb1d-44a6-abcf-da2951066a9b	ecae3b13-cf72-4058-8385-cb3bf34bec83	g.chr12:56720460T>C	ENST00000425394.2	-	7	1579	c.1203A>G	c.(1201-1203)ccA>ccG	p.P401P	PAN2_ENST00000257931.5_Silent_p.P401P|PAN2_ENST00000548043.1_Silent_p.P401P|PAN2_ENST00000440411.3_Silent_p.P401P	NM_001127460.2	NP_001120932	Q9HBH5	RDH14_HUMAN	PAN2 poly(A) specific ribonuclease subunit	0					osteoblast differentiation (GO:0001649)	endoplasmic reticulum (GO:0005783)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	oxidoreductase activity (GO:0016491)			NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|liver(1)|lung(18)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	41					Vitamin A(DB00162)	CAGTGGTGAGTGGGACAGGGA	0.597																																					p.P401P		.											.	PAN2-702	0			c.A1203G						.						70.0	61.0	64.0					12																	56720460		2203	4300	6503	SO:0001819	synonymous_variant	9924	exon7			GGTGAGTGGGACA	AB014610	CCDS8915.1, CCDS44922.1, CCDS53802.1	12q13.2	2014-03-27	2014-03-27	2008-01-08		ENSG00000135473		"""Ubiquitin-specific peptidases"""	20074	protein-coding gene	gene with protein product	"""PAN2 homolog, PABP1 dependent poly A specific ribonuclease subunit (S. cerevisiae)"""		"""ubiquitin specific protease 52"", ""ubiquitin specific peptidase 52"", ""PAN2 poly(A) specific ribonuclease subunit homolog (S. cerevisiae)"""	USP52		12838346, 14583602	Standard	NM_014871		Approved	KIAA0710, hPAN2	uc001skx.3	Q504Q3	OTTHUMG00000170412	ENST00000425394.2:c.1203A>G	12.37:g.56720460T>C		51	0		47	22	NM_014871	0	0	5	13	8		Silent	SNP	ENST00000425394.2	37	CCDS44922.1																																																																																			.		0.597	PAN2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409024.1	NM_014871	
ZFC3H1	196441	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	72017888	72017888	+	Nonsense_Mutation	SNP	A	A	T			TCGA-BQ-7050-01A-11D-1961-08	TCGA-BQ-7050-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b6b349c-fb1d-44a6-abcf-da2951066a9b	ecae3b13-cf72-4058-8385-cb3bf34bec83	g.chr12:72017888A>T	ENST00000378743.3	-	23	4860	c.4502T>A	c.(4501-4503)tTa>tAa	p.L1501*		NM_144982.4	NP_659419.3	O60293	ZC3H1_HUMAN	zinc finger, C3H1-type containing	1501					RNA processing (GO:0006396)	extracellular space (GO:0005615)|intracellular (GO:0005622)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(31)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						GCTTACCTGTAAAATTGCCAG	0.358																																					p.L1501X		.											.	ZFC3H1-138	0			c.T4502A						.						153.0	145.0	147.0					12																	72017888		1838	4095	5933	SO:0001587	stop_gained	196441	exon23			ACCTGTAAAATTG	AB011118	CCDS41813.1	12q21.1	2013-01-25	2008-10-01	2008-10-01		ENSG00000133858		"""Zinc finger, C3H1-type containing"""	28328	protein-coding gene	gene with protein product			"""proline/serine-rich coiled-coil 2"", ""coiled-coil domain containing 131"""	PSRC2, CCDC131		9628581	Standard	NM_144982		Approved	MGC23401, KIAA0546	uc001swo.2	O60293	OTTHUMG00000169545	ENST00000378743.3:c.4502T>A	12.37:g.72017888A>T	ENSP00000368017:p.Leu1501*	243	0		218	40	NM_144982	0	0	0	0	0	Q6GMU1|Q6P2S9|Q6ZV36|Q96BE7	Nonsense_Mutation	SNP	ENST00000378743.3	37	CCDS41813.1	.	.	.	.	.	.	.	.	.	.	A	45	11.914642	0.99617	.	.	ENSG00000133858	ENST00000378743	.	.	.	5.39	5.39	0.77823	.	0.000000	0.64402	D	0.000013	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.4122	0.74937	1.0:0.0:0.0:0.0	.	.	.	.	X	1501	.	ENSP00000368017:L1501X	L	-	2	0	ZFC3H1	70304155	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	8.262000	0.89862	2.038000	0.60285	0.533000	0.62120	TTA	.		0.358	ZFC3H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404751.1	NM_144982	
PCCA	5095	ucsc.edu	37	13	100925449	100925449	+	Splice_Site	SNP	G	G	A	rs367615795		TCGA-BQ-7050-01A-11D-1961-08	TCGA-BQ-7050-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	4b6b349c-fb1d-44a6-abcf-da2951066a9b	ecae3b13-cf72-4058-8385-cb3bf34bec83	g.chr13:100925449G>A	ENST00000376285.1	+	12	952		c.e12-1		PCCA_ENST00000376286.4_Splice_Site|PCCA_ENST00000376279.3_Splice_Site	NM_000282.3	NP_000273.2	P05165	PCCA_HUMAN	propionyl CoA carboxylase, alpha polypeptide						biotin metabolic process (GO:0006768)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|propionyl-CoA carboxylase activity (GO:0004658)			breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(8)|prostate(1)|skin(2)	26	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Biotin(DB00121)	TGTATATGTAGCATTTTTTTG	0.373																																					.													.	PCCA-227	0			c.915-1G>A						.	G	,,	1,4405		0,1,2202	62.0	64.0	64.0		,,	5.6	1.0	13		64	0,8600		0,0,4300	no	splice-3,splice-3,splice-3	PCCA	NM_000282.3,NM_001127692.2,NM_001178004.1	,,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,,	,,	100925449	1,13005	2203	4300	6503	SO:0001630	splice_region_variant	5095	exon12			TATGTAGCATTTT	X14608	CCDS9496.2, CCDS45065.1, CCDS53878.1	13q32	2011-01-14	2010-04-30		ENSG00000175198	ENSG00000175198	6.4.1.3		8653	protein-coding gene	gene with protein product		232000	"""propionyl Coenzyme A carboxylase, alpha polypeptide"""			1427880	Standard	NM_000282		Approved		uc001voo.3	P05165	OTTHUMG00000017284	ENST00000376285.1:c.915-1G>A	13.37:g.100925449G>A		41	0		42	3	NM_001178004	0	0	0	21	21	B4DKY8|B4DPF9|C9JPQ8|Q15979|Q8WXQ7	Splice_Site	SNP	ENST00000376285.1	37	CCDS9496.2	.	.	.	.	.	.	.	.	.	.	G	18.50	3.637486	0.67130	2.27E-4	0.0	ENSG00000175198	ENST00000376286;ENST00000376279;ENST00000376285	.	.	.	5.56	5.56	0.83823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.8818	0.96901	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PCCA	99723450	1.000000	0.71417	0.983000	0.44433	0.497000	0.33675	9.710000	0.98732	2.773000	0.95371	0.655000	0.94253	.	.		0.373	PCCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045627.2		Intron
TTC8	123016	bcgsc.ca	37	14	89338026	89338026	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BQ-7050-01A-11D-1961-08	TCGA-BQ-7050-11A-01D-1961-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	4b6b349c-fb1d-44a6-abcf-da2951066a9b	ecae3b13-cf72-4058-8385-cb3bf34bec83	g.chr14:89338026G>T	ENST00000345383.5	+	11	1237	c.1153G>T	c.(1153-1155)Gag>Tag	p.E385*	TTC8_ENST00000380656.2_Nonsense_Mutation_p.E395*|TTC8_ENST00000354441.6_Nonsense_Mutation_p.E130*|TTC8_ENST00000338104.6_Nonsense_Mutation_p.E411*|TTC8_ENST00000358622.5_Nonsense_Mutation_p.E197*|TTC8_ENST00000536576.1_Nonsense_Mutation_p.E156*|TTC8_ENST00000346301.4_Nonsense_Mutation_p.E355*	NM_198309.2	NP_938051.1	Q8TAM2	TTC8_HUMAN	tetratricopeptide repeat domain 8	421					axon guidance (GO:0007411)|camera-type eye photoreceptor cell differentiation (GO:0060219)|cilium assembly (GO:0042384)|establishment of anatomical structure orientation (GO:0048560)|fat cell differentiation (GO:0045444)|multicellular organism growth (GO:0035264)|nonmotile primary cilium assembly (GO:0035058)|olfactory bulb development (GO:0021772)|protein transport (GO:0015031)|regulation of protein localization (GO:0032880)|renal tubule development (GO:0061326)|sensory perception of smell (GO:0007608)|sensory processing (GO:0050893)	BBSome (GO:0034464)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|photoreceptor connecting cilium (GO:0032391)|plasma membrane (GO:0005886)	RNA polymerase II repressing transcription factor binding (GO:0001103)			endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|prostate(1)	15						AAATGAAGAAGAGGCAGCTGA	0.423																																					p.E395X													.	TTC8-90	0			c.G1183T						.						144.0	132.0	136.0					14																	89338026		2203	4300	6503	SO:0001587	stop_gained	123016	exon12			GAAGAAGAGGCAG	AK093891	CCDS9885.1, CCDS9886.1, CCDS32137.1, CCDS73674.1, CCDS73675.1	14q31.3	2013-02-14				ENSG00000165533		"""Tetratricopeptide (TTC) repeat domain containing"""	20087	protein-coding gene	gene with protein product		608132				14520415, 20451172	Standard	NM_144596		Approved	BBS8, RP51	uc001xxi.3	Q8TAM2		ENST00000345383.5:c.1153G>T	14.37:g.89338026G>T	ENSP00000339486:p.Glu385*	132	0		133	9	NM_144596	0	0	22	22	0	A6NFG2|B3KWA5|Q67B97|Q86SY0|Q86TV9|Q86U26|Q8NDH9|Q96DG8	Nonsense_Mutation	SNP	ENST00000345383.5	37	CCDS9885.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	32|32|32	5.179614|5.179614|5.179614	0.94846|0.94846|0.94846	.|.|.	.|.|.	ENSG00000165533|ENSG00000165533|ENSG00000165533	ENST00000345383;ENST00000536576;ENST00000346301;ENST00000338104;ENST00000354441;ENST00000380656;ENST00000358622|ENST00000554686|ENST00000557580	.|.|.	.|.|.	.|.|.	5.73|5.73|5.73	5.73|5.73|5.73	0.89815|0.89815|0.89815	.|.|.	0.047433|.|.	0.85682|.|.	D|.|.	0.000000|.|.	.|T|T	.|0.79834|0.79834	.|0.4514|0.4514	.|.|.	.|.|.	.|.|.	0.80722|0.80722|0.80722	A|A|A	1|1|1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|T|T	.|0.77699|0.77699	.|-0.2490|-0.2490	.|3|3	0.10636|.|.	T|.|.	0.68|.|.	-20.9321|-20.9321|-20.9321	19.8984|19.8984|19.8984	0.96975|0.96975|0.96975	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.|.	.|.|.	.|.|.	.|.|.	X|N|I	385;156;355;411;130;395;197|344|183	.|.|.	ENSP00000337653:E411X|.|.	E|K|R	+|+|+	1|3|2	0|2|0	TTC8|TTC8|TTC8	88407779|88407779|88407779	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.995000|0.995000|0.995000	0.86356|0.86356|0.86356	9.474000|9.474000|9.474000	0.97718|0.97718|0.97718	2.712000|2.712000|2.712000	0.92718|0.92718|0.92718	0.555000|0.555000|0.555000	0.69702|0.69702|0.69702	GAG|AAG|AGA	.		0.423	TTC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410861.1	NM_144596	
THBS1	7057	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	39882095	39882095	+	Silent	SNP	C	C	G			TCGA-BQ-7050-01A-11D-1961-08	TCGA-BQ-7050-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b6b349c-fb1d-44a6-abcf-da2951066a9b	ecae3b13-cf72-4058-8385-cb3bf34bec83	g.chr15:39882095C>G	ENST00000260356.5	+	13	2181	c.2016C>G	c.(2014-2016)ccC>ccG	p.P672P		NM_003246.2	NP_003237.2	P07996	TSP1_HUMAN	thrombospondin 1	672	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				activation of MAPK activity (GO:0000187)|behavioral response to pain (GO:0048266)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heat (GO:0034605)|cellular response to tumor necrosis factor (GO:0071356)|chronic inflammatory response (GO:0002544)|endocardial cushion development (GO:0003197)|engulfment of apoptotic cell (GO:0043652)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|immune response (GO:0006955)|negative regulation of angiogenesis (GO:0016525)|negative regulation of antigen processing and presentation of peptide or polysaccharide antigen via MHC class II (GO:0002581)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cGMP-mediated signaling (GO:0010754)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dendritic cell antigen processing and presentation (GO:0002605)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|negative regulation of plasminogen activation (GO:0010757)|outflow tract morphogenesis (GO:0003151)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood coagulation (GO:0030194)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of chemotaxis (GO:0050921)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of macrophage activation (GO:0043032)|positive regulation of macrophage chemotaxis (GO:0010759)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of transforming growth factor beta1 production (GO:0032914)|positive regulation of translation (GO:0045727)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|response to calcium ion (GO:0051592)|response to drug (GO:0042493)|response to endoplasmic reticulum stress (GO:0034976)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to magnesium ion (GO:0032026)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|response to testosterone (GO:0033574)|response to unfolded protein (GO:0006986)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|sarcoplasmic reticulum (GO:0016529)|secretory granule (GO:0030141)	calcium ion binding (GO:0005509)|collagen V binding (GO:0070052)|fibrinogen binding (GO:0070051)|fibroblast growth factor binding (GO:0017134)|fibronectin binding (GO:0001968)|glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|laminin binding (GO:0043236)|low-density lipoprotein particle binding (GO:0030169)|phosphatidylserine binding (GO:0001786)|proteoglycan binding (GO:0043394)|transforming growth factor beta binding (GO:0050431)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(5)|large_intestine(15)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	53		all_cancers(109;1.35e-17)|all_epithelial(112;2.07e-15)|Lung NSC(122;4.44e-11)|all_lung(180;1.11e-09)|Melanoma(134;0.0574)|Colorectal(260;0.117)|Ovarian(310;0.223)		GBM - Glioblastoma multiforme(113;2.77e-06)|BRCA - Breast invasive adenocarcinoma(123;0.105)		ATAGCGACCCCATGTACCGCT	0.607																																					p.P672P		.											.	THBS1-653	0			c.C2016G						.						111.0	92.0	99.0					15																	39882095		2200	4297	6497	SO:0001819	synonymous_variant	7057	exon13			CGACCCCATGTAC		CCDS32194.1	15q15	2009-04-08			ENSG00000137801	ENSG00000137801			11785	protein-coding gene	gene with protein product	"""thrombospondin-1p180"""	188060				2341158, 2335352	Standard	NM_003246		Approved	TSP1, THBS, TSP, THBS-1, TSP-1	uc001zkh.3	P07996	OTTHUMG00000133665	ENST00000260356.5:c.2016C>G	15.37:g.39882095C>G		48	0		48	9	NM_003246	0	0	145	176	31	A8K6H4|B4E3J7|B9EGH6|Q15667|Q59E99	Silent	SNP	ENST00000260356.5	37	CCDS32194.1																																																																																			.		0.607	THBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257831.2	NM_003246	
MYO9A	4649	broad.mit.edu	37	15	72146822	72146822	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7050-01A-11D-1961-08	TCGA-BQ-7050-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4b6b349c-fb1d-44a6-abcf-da2951066a9b	ecae3b13-cf72-4058-8385-cb3bf34bec83	g.chr15:72146822T>C	ENST00000356056.5	-	35	6714	c.6242A>G	c.(6241-6243)aAg>aGg	p.K2081R	MYO9A_ENST00000444904.1_Missense_Mutation_p.K2062R|MYO9A_ENST00000564571.1_Missense_Mutation_p.K2081R|MYO9A_ENST00000424560.1_Missense_Mutation_p.K2152R	NM_006901.3	NP_008832.2	B2RTY4	MYO9A_HUMAN	myosin IXA	2081	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.|Tail.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|visual perception (GO:0007601)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|motor activity (GO:0003774)			NS(4)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(29)|lung(27)|ovary(1)|pancreas(1)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						GTTTATGAGCTTTTCCACTAC	0.408																																					p.K2081R													.	MYO9A-93	0			c.A6242G						.						148.0	134.0	138.0					15																	72146822		2199	4297	6496	SO:0001583	missense	4649	exon35			ATGAGCTTTTCCA	AF117888	CCDS10239.1	15q22-q23	2011-09-27			ENSG00000066933	ENSG00000066933		"""Myosins / Myosin superfamily : Class IX"""	7608	protein-coding gene	gene with protein product		604875				10409426	Standard	NM_006901		Approved	FLJ11061, FLJ13244, MGC71859	uc002atl.5	B2RTY4	OTTHUMG00000133440	ENST00000356056.5:c.6242A>G	15.37:g.72146822T>C	ENSP00000348349:p.Lys2081Arg	115	0		122	3	NM_006901	0	0	19	19	0	B0I1T5|C9IYB3|C9JA86|Q14787|Q3YLD7|Q3YLD8|Q6P986|Q9H8T5|Q9NTG2|Q9NUY2|Q9UEP3|Q9UNJ2	Missense_Mutation	SNP	ENST00000356056.5	37	CCDS10239.1	.	.	.	.	.	.	.	.	.	.	T	27.0	4.787450	0.90367	.	.	ENSG00000066933	ENST00000356056;ENST00000424560;ENST00000444904	T;T;T	0.21031	2.03;2.03;2.03	5.99	5.99	0.97316	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	.	.	.	.	T	0.30039	0.0752	N	0.17278	0.47	0.58432	D	0.999996	D	0.76494	0.999	D	0.85130	0.997	T	0.11108	-1.0601	9	0.19147	T	0.46	.	16.4719	0.84113	0.0:0.0:0.0:1.0	.	2081	B2RTY4	MYO9A_HUMAN	R	2081;2152;2062	ENSP00000348349:K2081R;ENSP00000399162:K2152R;ENSP00000398250:K2062R	ENSP00000348349:K2081R	K	-	2	0	MYO9A	69933876	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.013000	0.88655	2.292000	0.77174	0.482000	0.46254	AAG	.		0.408	MYO9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257308.1	NM_006901	
ZNF532	55205	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	56586514	56586514	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-7050-01A-11D-1961-08	TCGA-BQ-7050-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b6b349c-fb1d-44a6-abcf-da2951066a9b	ecae3b13-cf72-4058-8385-cb3bf34bec83	g.chr18:56586514C>T	ENST00000336078.4	+	4	1771	c.995C>T	c.(994-996)cCg>cTg	p.P332L	ZNF532_ENST00000591083.1_Missense_Mutation_p.P332L|ZNF532_ENST00000591230.1_Missense_Mutation_p.P332L|ZNF532_ENST00000589288.1_Missense_Mutation_p.P332L|ZNF532_ENST00000591808.1_Missense_Mutation_p.P332L	NM_018181.4	NP_060651.2	Q9HCE3	ZN532_HUMAN	zinc finger protein 532	332					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(14)|kidney(1)|large_intestine(9)|lung(14)|prostate(1)|skin(4)|urinary_tract(1)	52						CTGAAGCAACCGGATAGTCCC	0.522																																					p.P332L		.											.	ZNF532-154	0			c.C995T						.						97.0	100.0	99.0					18																	56586514		2203	4300	6503	SO:0001583	missense	55205	exon4			AGCAACCGGATAG	AB046849	CCDS11969.1	18q21.32	2005-08-22			ENSG00000074657	ENSG00000074657		"""Zinc fingers, C2H2-type"""	30940	protein-coding gene	gene with protein product						10997877	Standard	XM_005266723		Approved	FLJ10697	uc002lho.3	Q9HCE3	OTTHUMG00000132759	ENST00000336078.4:c.995C>T	18.37:g.56586514C>T	ENSP00000338217:p.Pro332Leu	139	0		152	61	NM_018181	0	0	2	6	4	Q4G0V6|Q7L7Z7|Q96QR7|Q9NVJ6	Missense_Mutation	SNP	ENST00000336078.4	37	CCDS11969.1	.	.	.	.	.	.	.	.	.	.	c	14.64	2.595026	0.46318	.	.	ENSG00000074657	ENST00000336078	T	0.02158	4.42	4.97	4.97	0.65823	.	0.114354	0.64402	N	0.000009	T	0.05456	0.0144	M	0.76574	2.34	0.80722	D	1	D	0.58620	0.983	B	0.41135	0.348	T	0.24657	-1.0154	10	0.87932	D	0	-11.3748	17.8864	0.88856	0.0:1.0:0.0:0.0	.	332	Q9HCE3	ZN532_HUMAN	L	332	ENSP00000338217:P332L	ENSP00000338217:P332L	P	+	2	0	ZNF532	54737494	1.000000	0.71417	0.494000	0.27515	0.027000	0.11550	7.737000	0.84957	2.320000	0.78422	0.550000	0.68814	CCG	.		0.522	ZNF532-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256130.1	NM_018181	
ZFP36	7538	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	39898403	39898403	+	Silent	SNP	T	T	C			TCGA-BQ-7050-01A-11D-1961-08	TCGA-BQ-7050-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b6b349c-fb1d-44a6-abcf-da2951066a9b	ecae3b13-cf72-4058-8385-cb3bf34bec83	g.chr19:39898403T>C	ENST00000248673.3	+	2	103	c.45T>C	c.(43-45)ccT>ccC	p.P15P	MIR4530_ENST00000581459.1_RNA|ZFP36_ENST00000597629.1_Silent_p.P21P|ZFP36_ENST00000594045.1_3'UTR	NM_003407.3	NP_003398.2	P26651	TTP_HUMAN	ZFP36 ring finger protein	15					3'-UTR-mediated mRNA stabilization (GO:0070935)|gene expression (GO:0010467)|intracellular signal transduction (GO:0035556)|mRNA catabolic process (GO:0006402)|mRNA metabolic process (GO:0016071)|negative regulation of inflammatory response (GO:0050728)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of tumor necrosis factor production (GO:0032680)|response to starvation (GO:0042594)|RNA destabilization (GO:0050779)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|nucleus (GO:0005634)	14-3-3 protein binding (GO:0071889)|AU-rich element binding (GO:0017091)|C-C chemokine binding (GO:0019957)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|mRNA 3'-UTR AU-rich region binding (GO:0035925)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|single-stranded RNA binding (GO:0003727)			large_intestine(1)|lung(5)|pancreas(1)	7	all_cancers(60;6.54e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;1.53e-06)|Ovarian(47;0.0512)		Epithelial(26;2.92e-26)|all cancers(26;2.01e-23)|Lung(45;0.000499)|LUSC - Lung squamous cell carcinoma(53;0.000657)			CGCTGAGCCCTGACGTGCCCG	0.667																																					p.P21P	NSCLC(67;1164 1324 12056 21056 30097)	.											.	ZFP36-227	0			c.T63C						.						102.0	114.0	110.0					19																	39898403		2202	4298	6500	SO:0001819	synonymous_variant	7538	exon2			GAGCCCTGACGTG	M63625	CCDS12534.1, CCDS12534.2	19q13.1	2012-11-27	2012-11-27			ENSG00000128016		"""RING-type (C3HC4) zinc fingers"""	12862	protein-coding gene	gene with protein product		190700	"""zinc finger protein 36, C3H type, homolog (mouse)"""			1699942	Standard	NM_003407		Approved	RNF162A, TIS11, G0S24, TTP, NUP475, tristetraprolin	uc002olh.2	P26651		ENST00000248673.3:c.45T>C	19.37:g.39898403T>C		331	0		295	105	NM_003407	0	0	24	49	25	B2RA54	Silent	SNP	ENST00000248673.3	37																																																																																				.		0.667	ZFP36-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding			
ZNF615	284370	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	52497088	52497088	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-7050-01A-11D-1961-08	TCGA-BQ-7050-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b6b349c-fb1d-44a6-abcf-da2951066a9b	ecae3b13-cf72-4058-8385-cb3bf34bec83	g.chr19:52497088C>A	ENST00000602063.1	-	6	1590	c.1241G>T	c.(1240-1242)tGt>tTt	p.C414F	ZNF615_ENST00000391795.3_Missense_Mutation_p.C419F|ZNF615_ENST00000594083.1_Missense_Mutation_p.C425F|ZNF615_ENST00000376716.5_Missense_Mutation_p.C414F|ZNF615_ENST00000598071.1_Missense_Mutation_p.C425F			Q8N8J6	ZN615_HUMAN	zinc finger protein 615	414					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(5)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)	42		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.00142)|OV - Ovarian serous cystadenocarcinoma(262;0.019)		TACCATGAGACAGTGCTTCAT	0.403																																					p.C425F		.											.	ZNF615-95	0			c.G1274T						.						93.0	84.0	87.0					19																	52497088		2203	4300	6503	SO:0001583	missense	284370	exon7			ATGAGACAGTGCT	AK096691	CCDS12846.1, CCDS59418.1	19q13.41	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	24740	protein-coding gene	gene with protein product						12477932	Standard	NM_001199324		Approved	FLJ33710	uc002pyf.2	Q8N8J6		ENST00000602063.1:c.1241G>T	19.37:g.52497088C>A	ENSP00000473089:p.Cys414Phe	64	1		78	29	NM_001199324	0	0	2	5	3	B7ZKW9|Q2M2Y6|Q5CZB0|Q6ZMT7|Q6ZRB3	Missense_Mutation	SNP	ENST00000602063.1	37	CCDS12846.1	.	.	.	.	.	.	.	.	.	.	C	3.261	-0.151138	0.06585	.	.	ENSG00000197619	ENST00000376716;ENST00000354939;ENST00000391795;ENST00000391793	T;T	0.06933	3.24;3.24	2.99	0.551	0.17225	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04861	0.0131	N	0.21142	0.635	0.09310	N	1	B;B;B;B	0.31318	0.213;0.319;0.319;0.213	B;B;B;B	0.28638	0.029;0.092;0.092;0.029	T	0.38672	-0.9650	9	0.52906	T	0.07	.	2.961	0.05893	0.0:0.3825:0.2294:0.3881	.	419;421;425;414	B4DH87;Q8N8J6-3;Q8N8J6-2;Q8N8J6	.;.;.;ZN615_HUMAN	F	414;424;419;424	ENSP00000365906:C414F;ENSP00000375672:C419F	ENSP00000347019:C424F	C	-	2	0	ZNF615	57188900	0.000000	0.05858	0.024000	0.17045	0.986000	0.74619	-3.101000	0.00604	0.570000	0.29347	0.585000	0.79938	TGT	.		0.403	ZNF615-009	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462391.1	NM_198480	
IL36G	56300	bcgsc.ca	37	2	113736864	113736864	+	Missense_Mutation	SNP	A	A	G	rs575481711		TCGA-BQ-7050-01A-11D-1961-08	TCGA-BQ-7050-11A-01D-1961-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	4b6b349c-fb1d-44a6-abcf-da2951066a9b	ecae3b13-cf72-4058-8385-cb3bf34bec83	g.chr2:113736864A>G	ENST00000259205.4	+	3	191	c.122A>G	c.(121-123)aAc>aGc	p.N41S	IL36G_ENST00000376489.2_Intron	NM_019618.2	NP_062564.1	Q9NZH8	IL36G_HUMAN	interleukin 36, gamma	41					cell-cell signaling (GO:0007267)|immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of interleukin-6 production (GO:0032755)	extracellular space (GO:0005615)				breast(1)|central_nervous_system(1)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)|skin(1)	14						CAGGGTCAGAACCTTGTGGCA	0.473																																					p.N41S													.	IL36G-91	0			c.A122G						.						71.0	68.0	69.0					2																	113736864		2203	4300	6503	SO:0001583	missense	56300	exon3			GTCAGAACCTTGT	AF200492	CCDS2108.1, CCDS62992.1	2q12-q21	2011-07-14	2011-06-06	2011-06-06	ENSG00000136688	ENSG00000136688		"""Interleukins and interleukin receptors"""	15741	protein-coding gene	gene with protein product	"""interleukin-1 homolog 1"", ""interleukin 1-related protein 2"", ""interleukin-1 epsilon"""	605542	"""interleukin 1 family, member 9"""	IL1F9		10860666, 10744718, 11991722, 11991723	Standard	NM_019618		Approved	IL-1H1, IL-1RP2, IL-1F9, IL1H1, IL1E	uc002tio.1	Q9NZH8	OTTHUMG00000131336	ENST00000259205.4:c.122A>G	2.37:g.113736864A>G	ENSP00000259205:p.Asn41Ser	88	0		74	4	NM_019618	0	0	0	0	0	Q56B91|Q6UVX7|Q7RTZ9	Missense_Mutation	SNP	ENST00000259205.4	37	CCDS2108.1	.	.	.	.	.	.	.	.	.	.	A	11.82	1.753551	0.31046	.	.	ENSG00000136688	ENST00000259205	T	0.59083	0.29	5.09	-7.34	0.01427	.	0.781468	0.11761	N	0.532067	T	0.19886	0.0478	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.19844	-1.0293	9	.	.	.	-2.993	0.7823	0.01043	0.3063:0.183:0.3003:0.2104	.	41	Q9NZH8	IL36G_HUMAN	S	41	ENSP00000259205:N41S	.	N	+	2	0	IL36G	113453335	0.000000	0.05858	0.000000	0.03702	0.067000	0.16453	-1.905000	0.01591	-1.386000	0.02098	-0.869000	0.02991	AAC	.		0.473	IL36G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330713.2	NM_019618	
ITPR1	3708	ucsc.edu	37	3	4725969	4725969	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7050-01A-11D-1961-08	TCGA-BQ-7050-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	4b6b349c-fb1d-44a6-abcf-da2951066a9b	ecae3b13-cf72-4058-8385-cb3bf34bec83	g.chr3:4725969G>A	ENST00000443694.2	+	26	3458	c.3458G>A	c.(3457-3459)gGa>gAa	p.G1153E	ITPR1_ENST00000544951.1_Intron|ITPR1_ENST00000357086.4_Missense_Mutation_p.G1159E|ITPR1_ENST00000302640.8_Missense_Mutation_p.G1153E|ITPR1_ENST00000456211.2_Missense_Mutation_p.G1144E|ITPR1_ENST00000354582.6_Missense_Mutation_p.G1168E|ITPR1_ENST00000423119.2_Missense_Mutation_p.G1159E			Q14643	ITPR1_HUMAN	inositol 1,4,5-trisphosphate receptor, type 1	1168					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of calcium-mediated signaling (GO:0050849)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|post-embryonic development (GO:0009791)|regulation of insulin secretion (GO:0050796)|release of sequestered calcium ion into cytosol (GO:0051209)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|voluntary musculoskeletal movement (GO:0050882)	calcineurin complex (GO:0005955)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|platelet dense granule membrane (GO:0031088)|platelet dense tubular network (GO:0031094)|platelet dense tubular network membrane (GO:0031095)|postsynaptic density (GO:0014069)|sarcoplasmic reticulum (GO:0016529)	calcium channel inhibitor activity (GO:0019855)|calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|autonomic_ganglia(1)|breast(10)|endometrium(15)|kidney(6)|large_intestine(27)|liver(1)|lung(27)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(2)	106				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)	Caffeine(DB00201)	TTCTAGGAGGGAAATAACAAG	0.433																																					p.G1159E													.	ITPR1-710	0			c.G3476A						.						98.0	112.0	108.0					3																	4725969		1940	4142	6082	SO:0001583	missense	3708	exon29			AGGAGGGAAATAA	D26070	CCDS46740.1, CCDS46740.2, CCDS54550.1, CCDS54551.1	3p26.1	2014-06-12	2011-04-28			ENSG00000150995		"""Ion channels / Inositol triphosphate receptors"""	6180	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 94"""	147265	"""spinocerebellar ataxia 15"", ""spinocerebellar ataxia 16"", ""spinocerebellar ataxia 29"""	SCA15, SCA16, SCA29		7945203, 7500840, 17590087, 17932120, 22986007	Standard	NM_001099952		Approved	Insp3r1, IP3R1, ACV, PPP1R94	uc003bqc.3	Q14643		ENST00000443694.2:c.3458G>A	3.37:g.4725969G>A	ENSP00000401671:p.Gly1153Glu	18	2		22	7	NM_001099952	0	0	0	0	0	E7EPX7|E9PDE9|Q14660|Q99897	Missense_Mutation	SNP	ENST00000443694.2	37	CCDS54551.1	.	.	.	.	.	.	.	.	.	.	G	11.20	1.567242	0.28003	.	.	ENSG00000150995	ENST00000356617;ENST00000302640;ENST00000354582;ENST00000423119;ENST00000357086;ENST00000456211;ENST00000443694	D;D;D;D;D;D	0.88586	-2.4;-2.4;-2.4;-2.4;-2.4;-2.4	5.05	5.05	0.67936	.	0.589779	0.18685	N	0.134045	T	0.81361	0.4806	L	0.32530	0.975	0.80722	D	1	B;B	0.17465	0.004;0.022	B;B	0.17722	0.003;0.019	T	0.73084	-0.4094	10	0.02654	T	1	.	14.4133	0.67132	0.0:0.1474:0.8526:0.0	.	1168;1159	Q14643;G5E9P1	ITPR1_HUMAN;.	E	1168;1153;1168;1159;1159;1144;1153	ENSP00000306253:G1153E;ENSP00000346595:G1168E;ENSP00000405934:G1159E;ENSP00000349597:G1159E;ENSP00000397885:G1144E;ENSP00000401671:G1153E	ENSP00000306253:G1153E	G	+	2	0	ITPR1	4700969	1.000000	0.71417	0.970000	0.41538	0.257000	0.26127	6.277000	0.72608	2.491000	0.84063	0.557000	0.71058	GGA	.		0.433	ITPR1-004	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337982.3	NM_002222	
DNAJC13	23317	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	132184844	132184844	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7050-01A-11D-1961-08	TCGA-BQ-7050-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b6b349c-fb1d-44a6-abcf-da2951066a9b	ecae3b13-cf72-4058-8385-cb3bf34bec83	g.chr3:132184844T>C	ENST00000260818.6	+	18	2146	c.1898T>C	c.(1897-1899)cTa>cCa	p.L633P	DNAJC13_ENST00000486798.1_3'UTR	NM_015268.3	NP_056083.3	O75165	DJC13_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 13	633					osteoblast differentiation (GO:0001649)	extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)				breast(4)|endometrium(2)|kidney(2)|large_intestine(5)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|urinary_tract(1)	34						TTCAGACAGCTAAGTAGACAT	0.338																																					p.L633P		.											.	DNAJC13-272	0			c.T1898C						.						72.0	70.0	70.0					3																	132184844		2203	4300	6503	SO:0001583	missense	23317	exon18			GACAGCTAAGTAG	AB014578	CCDS33857.1	3q22.1	2011-09-02			ENSG00000138246	ENSG00000138246		"""Heat shock proteins / DNAJ (HSP40)"""	30343	protein-coding gene	gene with protein product		614334				12438707	Standard	NM_015268		Approved	RME8, KIAA0678	uc003eor.3	O75165	OTTHUMG00000159674	ENST00000260818.6:c.1898T>C	3.37:g.132184844T>C	ENSP00000260818:p.Leu633Pro	38	0		42	12	NM_015268	0	0	0	0	0	Q3L0T1|Q6PI82|Q6UJ77|Q6ZSW1|Q6ZUT5|Q86XG3|Q96DC1|Q9BWK9	Missense_Mutation	SNP	ENST00000260818.6	37	CCDS33857.1	.	.	.	.	.	.	.	.	.	.	T	23.5	4.419736	0.83559	.	.	ENSG00000138246	ENST00000260818	T	0.34859	1.34	5.53	5.53	0.82687	Armadillo-type fold (1);	0.000000	0.64402	D	0.000007	T	0.64159	0.2573	M	0.82193	2.58	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.997	T	0.70226	-0.4930	10	0.87932	D	0	.	15.6649	0.77221	0.0:0.0:0.0:1.0	.	633;633	A7E2Y5;O75165	.;DJC13_HUMAN	P	633	ENSP00000260818:L633P	ENSP00000260818:L633P	L	+	2	0	DNAJC13	133667534	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.813000	0.86123	2.103000	0.63969	0.528000	0.53228	CTA	.		0.338	DNAJC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356807.2	NM_015268	
XRN1	54464	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	142141468	142141468	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-7050-01A-11D-1961-08	TCGA-BQ-7050-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b6b349c-fb1d-44a6-abcf-da2951066a9b	ecae3b13-cf72-4058-8385-cb3bf34bec83	g.chr3:142141468G>C	ENST00000264951.4	-	8	1040	c.923C>G	c.(922-924)cCt>cGt	p.P308R	RNU1-100P_ENST00000365255.1_RNA|XRN1_ENST00000544157.1_Missense_Mutation_p.P98R|XRN1_ENST00000392981.2_Missense_Mutation_p.P308R|XRN1_ENST00000463916.1_Missense_Mutation_p.P308R	NM_019001.3	NP_061874.3	Q8IZH2	XRN1_HUMAN	5'-3' exoribonuclease 1	308					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA metabolic process (GO:0016071)|nuclear mRNA surveillance (GO:0071028)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|rRNA catabolic process (GO:0016075)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)	5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(6)|kidney(12)|large_intestine(11)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	61						ATAAAGAAGAGGCAGTGCATC	0.358																																					p.P308R		.											.	XRN1-93	0			c.C923G						.						84.0	86.0	85.0					3																	142141468		2203	4298	6501	SO:0001583	missense	54464	exon8			AGAAGAGGCAGTG	AY137776	CCDS3123.1, CCDS63801.1, CCDS75028.1	3q23	2008-02-05			ENSG00000114127	ENSG00000114127			30654	protein-coding gene	gene with protein product		607994				12515382	Standard	XM_005247544		Approved	SEP1	uc003eus.3	Q8IZH2	OTTHUMG00000159251	ENST00000264951.4:c.923C>G	3.37:g.142141468G>C	ENSP00000264951:p.Pro308Arg	99	0		118	10	NM_001042604	0	0	0	0	0	Q4G0S3|Q68D88|Q6AI24|Q6MZS8|Q86WS7|Q8N8U4|Q9UF39	Missense_Mutation	SNP	ENST00000264951.4	37	CCDS3123.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.716498	0.89205	.	.	ENSG00000114127	ENST00000264951;ENST00000392981;ENST00000463916;ENST00000544157	T;T	0.30448	1.53;1.53	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	T	0.63534	0.2519	M	0.87682	2.9	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;0.997;0.997;0.994	D;D;P;D;D	0.87578	0.998;0.998;0.887;0.984;0.963	T	0.68659	-0.5350	10	0.59425	D	0.04	-9.0623	19.3082	0.94173	0.0:0.0:1.0:0.0	.	98;308;169;308;308	B4E2K3;Q8IZH2-3;B3KW17;Q8IZH2-2;Q8IZH2	.;.;.;.;XRN1_HUMAN	R	308;308;308;98	ENSP00000264951:P308R;ENSP00000376707:P308R	ENSP00000264951:P308R	P	-	2	0	XRN1	143624158	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.363000	0.97131	2.572000	0.86782	0.650000	0.86243	CCT	.		0.358	XRN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354087.2	NM_019001	
PDE5A	8654	broad.mit.edu	37	4	120463679	120463679	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7050-01A-11D-1961-08	TCGA-BQ-7050-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4b6b349c-fb1d-44a6-abcf-da2951066a9b	ecae3b13-cf72-4058-8385-cb3bf34bec83	g.chr4:120463679T>C	ENST00000354960.3	-	10	1826	c.1507A>G	c.(1507-1509)Atc>Gtc	p.I503V	PDE5A_ENST00000264805.5_Missense_Mutation_p.I461V|PDE5A_ENST00000512739.1_5'UTR|PDE5A_ENST00000394439.1_Missense_Mutation_p.I451V|RP11-33B1.1_ENST00000498873.1_RNA	NM_001083.3	NP_001074.2	O76074	PDE5A_HUMAN	phosphodiesterase 5A, cGMP-specific	503	GAF 2.				blood coagulation (GO:0007596)|cGMP catabolic process (GO:0046069)|negative regulation of cardiac muscle contraction (GO:0055118)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of oocyte development (GO:0060282)|relaxation of cardiac muscle (GO:0055119)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cGMP binding (GO:0030553)|metal ion binding (GO:0046872)			breast(4)|endometrium(2)|kidney(3)|large_intestine(8)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	27					Avanafil(DB06237)|Caffeine(DB00201)|Dipyridamole(DB00975)|Pentoxifylline(DB00806)|Sildenafil(DB00203)|Tadalafil(DB00820)|Theophylline(DB00277)|Udenafil(DB06267)|Vardenafil(DB00862)	GTGTTCTGGATCCCCAAGCCA	0.463																																					p.I503V													.	PDE5A-90	0			c.A1507G						.						119.0	109.0	112.0					4																	120463679		2203	4300	6503	SO:0001583	missense	8654	exon10			TCTGGATCCCCAA	D89094	CCDS3713.1, CCDS34055.1	4q27	2008-05-15			ENSG00000138735	ENSG00000138735	3.1.4.17	"""Phosphodiesterases"""	8784	protein-coding gene	gene with protein product		603310				9714779, 9642111	Standard	NM_033437		Approved		uc003idh.3	O76074	OTTHUMG00000132971	ENST00000354960.3:c.1507A>G	4.37:g.120463679T>C	ENSP00000347046:p.Ile503Val	98	6		85	10	NM_001083	0	0	7	8	1	A0AV69|A8K2C4|O75026|O75887|Q86UI0|Q86V66|Q9Y6Z6	Missense_Mutation	SNP	ENST00000354960.3	37	CCDS3713.1	.	.	.	.	.	.	.	.	.	.	T	24.8	4.567004	0.86439	.	.	ENSG00000138735	ENST00000354960;ENST00000394439;ENST00000264805	T;T;T	0.71103	-0.54;-0.54;-0.54	5.11	5.11	0.69529	GAF (2);	0.050190	0.85682	D	0.000000	D	0.85199	0.5642	M	0.87381	2.88	0.80722	D	1	D;B	0.65815	0.995;0.335	D;B	0.75484	0.986;0.19	D	0.85789	0.1366	10	0.36615	T	0.2	.	15.1994	0.73122	0.0:0.0:0.0:1.0	.	503;461	O76074;O76074-2	PDE5A_HUMAN;.	V	503;451;461	ENSP00000347046:I503V;ENSP00000377957:I451V;ENSP00000264805:I461V	ENSP00000264805:I461V	I	-	1	0	PDE5A	120683127	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.242000	0.72376	2.062000	0.61559	0.528000	0.53228	ATC	.		0.463	PDE5A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256529.1	NM_001083	
TCERG1	10915	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	145836845	145836845	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7050-01A-11D-1961-08	TCGA-BQ-7050-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b6b349c-fb1d-44a6-abcf-da2951066a9b	ecae3b13-cf72-4058-8385-cb3bf34bec83	g.chr5:145836845G>A	ENST00000296702.5	+	3	423	c.385G>A	c.(385-387)Gca>Aca	p.A129T	TCERG1_ENST00000394421.2_Missense_Mutation_p.A129T	NM_006706.3	NP_006697.2	O14776	TCRG1_HUMAN	transcription elongation regulator 1	129	Pro-rich.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(18)|lung(9)|ovary(2)|prostate(3)|skin(1)	46		Lung NSC(249;0.00188)|all_lung(500;0.00307)|all_neural(839;0.0424)|Breast(839;0.0743)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TGGTACTCCAGCACTACCTCC	0.458																																					p.A129T		.											.	TCERG1-92	0			c.G385A						.						101.0	95.0	97.0					5																	145836845		2203	4300	6503	SO:0001583	missense	10915	exon3			ACTCCAGCACTAC	AF017789	CCDS4282.1, CCDS43379.1	5q31	2010-01-25	2002-01-24	2002-01-25	ENSG00000113649	ENSG00000113649			15630	protein-coding gene	gene with protein product	"""transcription factor CA150"", ""co-activator of 150 kDa"", ""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"", ""TATA box-binding protein-associated factor 2S"""	605409	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"""	TAF2S		9315662, 11003711	Standard	XM_005268365		Approved	CA150, Urn1	uc003lob.3	O14776	OTTHUMG00000129683	ENST00000296702.5:c.385G>A	5.37:g.145836845G>A	ENSP00000296702:p.Ala129Thr	145	0		120	41	NM_006706	0	0	4	6	2	Q2NKN2|Q59EA1	Missense_Mutation	SNP	ENST00000296702.5	37	CCDS4282.1	.	.	.	.	.	.	.	.	.	.	G	15.13	2.742261	0.49151	.	.	ENSG00000113649	ENST00000296702;ENST00000394421	T;T	0.25912	1.77;1.77	5.28	4.29	0.51040	.	0.308756	0.35124	N	0.003438	T	0.15392	0.0371	N	0.21282	0.65	0.33542	D	0.595008	B;B;B	0.17038	0.02;0.003;0.001	B;B;B	0.09377	0.004;0.004;0.002	T	0.11324	-1.0592	10	0.27082	T	0.32	-18.8301	9.1164	0.36760	0.1984:0.0:0.8016:0.0	.	129;129;129	B7Z921;O14776-2;O14776	.;.;TCRG1_HUMAN	T	129	ENSP00000296702:A129T;ENSP00000377943:A129T	ENSP00000296702:A129T	A	+	1	0	TCERG1	145817038	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	1.771000	0.38542	2.463000	0.83235	0.491000	0.48974	GCA	.		0.458	TCERG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251886.1	NM_001040006	
RSPH3	83861	hgsc.bcm.edu;broad.mit.edu	37	6	159414935	159414935	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-7050-01A-11D-1961-08	TCGA-BQ-7050-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b6b349c-fb1d-44a6-abcf-da2951066a9b	ecae3b13-cf72-4058-8385-cb3bf34bec83	g.chr6:159414935C>T	ENST00000252655.1	-	2	755	c.566G>A	c.(565-567)gGa>gAa	p.G189E	RSPH3_ENST00000367069.2_Missense_Mutation_p.G47E|RP1-111C20.4_ENST00000607391.1_RNA|RSPH3_ENST00000297262.3_Missense_Mutation_p.G189E|RSPH3_ENST00000449822.1_Missense_Mutation_p.G47E	NM_031924.4	NP_114130.3	Q86UC2	RSPH3_HUMAN	radial spoke 3 homolog (Chlamydomonas)	189										endometrium(3)|kidney(2)|large_intestine(1)|lung(7)|ovary(2)|skin(1)|stomach(7)	23		Breast(66;0.00519)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;2.36e-16)|BRCA - Breast invasive adenocarcinoma(81;5.92e-06)		CATTATGTTTCCATAATGCAT	0.358																																					p.G189E		.											.	RSPH3-92	0			c.G566A						.						177.0	137.0	151.0					6																	159414935		2203	4300	6503	SO:0001583	missense	83861	exon2			ATGTTTCCATAAT	AF353618	CCDS5260.1	6q25.3	2014-05-16	2008-07-04	2007-06-26	ENSG00000130363	ENSG00000130363			21054	protein-coding gene	gene with protein product		615876	"""radial spokehead-like 2"""	RSHL2		12477932	Standard	NM_031924		Approved	dJ111C20.1, RSP3	uc003qrx.3	Q86UC2	OTTHUMG00000015924	ENST00000252655.1:c.566G>A	6.37:g.159414935C>T	ENSP00000252655:p.Gly189Glu	47	0		58	8	NM_031924	0	0	8	9	1	Q96LQ5|Q96LX2|Q9BX75	Missense_Mutation	SNP	ENST00000252655.1	37	CCDS5260.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.613112	0.87258	.	.	ENSG00000130363	ENST00000367069;ENST00000449822;ENST00000252655;ENST00000297262	T;T;T;T	0.18657	2.26;2.27;2.26;2.2	5.67	5.67	0.87782	.	0.057536	0.64402	D	0.000002	T	0.41650	0.1168	M	0.85373	2.75	0.28855	N	0.895835	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.995	T	0.38178	-0.9673	10	0.39692	T	0.17	-36.5398	17.2674	0.87090	0.0:1.0:0.0:0.0	.	189;189	Q86UC2-2;Q86UC2	.;RSPH3_HUMAN	E	47;47;189;189	ENSP00000356036:G47E;ENSP00000393195:G47E;ENSP00000252655:G189E;ENSP00000297262:G189E	ENSP00000252655:G189E	G	-	2	0	RSPH3	159334923	1.000000	0.71417	0.887000	0.34795	0.897000	0.52465	2.936000	0.48971	2.668000	0.90789	0.655000	0.94253	GGA	.		0.358	RSPH3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_031924	
CAV1	857	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	116166677	116166677	+	Silent	SNP	C	C	T	rs201261029	byFrequency	TCGA-BQ-7050-01A-11D-1961-08	TCGA-BQ-7050-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4b6b349c-fb1d-44a6-abcf-da2951066a9b	ecae3b13-cf72-4058-8385-cb3bf34bec83	g.chr7:116166677C>T	ENST00000341049.2	+	2	407	c.129C>T	c.(127-129)gaC>gaT	p.D43D	CAV1_ENST00000405348.1_Silent_p.D12D|CAV1_ENST00000393470.1_Silent_p.D32D|CAV1_ENST00000393468.1_Silent_p.D12D|CAV1_ENST00000393467.1_Silent_p.D12D	NM_001753.4	NP_001744.2	Q03135	CAV1_HUMAN	caveolin 1, caveolae protein, 22kDa	43					angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|calcium ion homeostasis (GO:0055074)|calcium ion transport (GO:0006816)|caveola assembly (GO:0070836)|caveolin-mediated endocytosis (GO:0072584)|cellular calcium ion homeostasis (GO:0006874)|cellular response to hyperoxia (GO:0071455)|cellular response to starvation (GO:0009267)|cholesterol homeostasis (GO:0042632)|cholesterol transport (GO:0030301)|cytosolic calcium ion homeostasis (GO:0051480)|inactivation of MAPK activity (GO:0000188)|lactation (GO:0007595)|leukocyte migration (GO:0050900)|lipid storage (GO:0019915)|maintenance of protein location in cell (GO:0032507)|mammary gland development (GO:0030879)|mammary gland involution (GO:0060056)|MAPK cascade (GO:0000165)|membrane depolarization (GO:0051899)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of pinocytosis (GO:0048550)|negative regulation of protein binding (GO:0032091)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of tyrosine phosphorylation of Stat5 protein (GO:0042524)|nitric oxide homeostasis (GO:0033484)|nitric oxide metabolic process (GO:0046209)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of vasoconstriction (GO:0045907)|protein homooligomerization (GO:0051260)|protein localization (GO:0008104)|receptor internalization involved in canonical Wnt signaling pathway (GO:2000286)|regulation of blood coagulation (GO:0030193)|regulation of fatty acid metabolic process (GO:0019217)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidase activity (GO:0052547)|regulation of smooth muscle contraction (GO:0006940)|regulation of the force of heart contraction by chemical signal (GO:0003057)|response to calcium ion (GO:0051592)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|response to ischemia (GO:0002931)|response to progesterone (GO:0032570)|skeletal muscle tissue development (GO:0007519)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|triglyceride metabolic process (GO:0006641)|vasculogenesis (GO:0001570)|vasoconstriction (GO:0042310)|vesicle organization (GO:0016050)|viral process (GO:0016032)	acrosomal membrane (GO:0002080)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|cell cortex (GO:0005938)|cilium (GO:0005929)|cytoplasmic vesicle (GO:0031410)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|focal adhesion (GO:0005925)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lipid particle (GO:0005811)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	cholesterol binding (GO:0015485)|enzyme binding (GO:0019899)|nitric-oxide synthase binding (GO:0050998)|patched binding (GO:0005113)|peptidase activator activity (GO:0016504)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)|structural molecule activity (GO:0005198)			endometrium(1)|large_intestine(1)|lung(1)|urinary_tract(1)	4	all_epithelial(6;1.42e-06)|Lung NSC(10;0.0056)|all_lung(10;0.00609)		STAD - Stomach adenocarcinoma(10;0.00878)			AAGTGTACGACGCGCACACCA	0.572											OREG0018273	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	C|||	3	0.000599042	0.0	0.0	5008	,	,		16976	0.0		0.0	False		,,,				2504	0.0031				p.D43D													.	CAV1-946	0			c.C129T						.	C	,,,	0,4406		0,0,2203	239.0	163.0	189.0		36,36,36,129	4.5	1.0	7		189	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	CAV1	NM_001172895.1,NM_001172896.1,NM_001172897.1,NM_001753.4	,,,	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	,,,	12/148,12/148,12/148,43/179	116166677	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	857	exon2			GTACGACGCGCAC	AF125348	CCDS5767.1, CCDS55156.1	7q31	2006-02-09	2002-08-29		ENSG00000105974	ENSG00000105974			1527	protein-coding gene	gene with protein product		601047	"""caveolin 1, caveolae protein, 22kD"""	CAV		10087206	Standard	NM_001753		Approved		uc003vif.2	Q03135	OTTHUMG00000023413	ENST00000341049.2:c.129C>T	7.37:g.116166677C>T		69	0	1471	76	9	NM_001753	0	0	6	7	1	Q9UGP1|Q9UNG1|Q9UQH6	Silent	SNP	ENST00000341049.2	37	CCDS5767.1																																																																																			C|0.999;T|0.001		0.572	CAV1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000059734.4	NM_001753	
EPHB6	2051	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	142568111	142568111	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7050-01A-11D-1961-08	TCGA-BQ-7050-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b6b349c-fb1d-44a6-abcf-da2951066a9b	ecae3b13-cf72-4058-8385-cb3bf34bec83	g.chr7:142568111A>G	ENST00000392957.2	+	18	3539	c.2752A>G	c.(2752-2754)Atg>Gtg	p.M918V	EPHB6_ENST00000442129.1_Missense_Mutation_p.M918V|EPHB6_ENST00000476059.1_3'UTR|EPHB6_ENST00000411471.2_Missense_Mutation_p.M641V	NM_004445.3	NP_004436.3	O15197	EPHB6_HUMAN	EPH receptor B6	918	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(46)|ovary(2)|pancreas(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	87	Melanoma(164;0.059)					ATTTGACAAGATGATCCGCAA	0.577																																					p.M918V		.											.	EPHB6-1489	0			c.A2752G						.						65.0	75.0	72.0					7																	142568111		2203	4300	6503	SO:0001583	missense	2051	exon18			GACAAGATGATCC	D83492	CCDS5873.2, CCDS75672.1	7q33-q35	2013-02-11	2004-10-28		ENSG00000106123	ENSG00000106123		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3396	protein-coding gene	gene with protein product		602757	"""EphB6"""				Standard	XM_006715881		Approved	HEP	uc011kst.2	O15197	OTTHUMG00000155707	ENST00000392957.2:c.2752A>G	7.37:g.142568111A>G	ENSP00000376684:p.Met918Val	190	0		190	19	NM_004445	0	0	14	14	0	A4D2I7|A8CDT5|D3DXD3|Q2TB23|Q2TB24	Missense_Mutation	SNP	ENST00000392957.2	37	CCDS5873.2	.	.	.	.	.	.	.	.	.	.	A	16.64	3.180826	0.57800	.	.	ENSG00000106123	ENST00000392957;ENST00000442129;ENST00000411471	T;T;T	0.61392	0.11;0.11;0.11	5.58	5.58	0.84498	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000016	T	0.60625	0.2283	L	0.49126	1.545	0.42496	D	0.992913	P;P	0.52463	0.953;0.946	P;P	0.51101	0.458;0.659	T	0.65561	-0.6138	10	0.87932	D	0	.	11.0016	0.47609	0.8441:0.1559:0.0:0.0	.	918;641	O15197;O15197-2	EPHB6_HUMAN;.	V	918;918;641	ENSP00000376684:M918V;ENSP00000410789:M918V;ENSP00000409061:M641V	ENSP00000376684:M918V	M	+	1	0	EPHB6	142278233	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.307000	0.33516	2.107000	0.64212	0.533000	0.62120	ATG	.		0.577	EPHB6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341329.1		
ATP6V0E2	155066	hgsc.bcm.edu	37	7	149571035	149571035	+	5'Flank	SNP	A	A	C	rs145697964	byFrequency	TCGA-BQ-7050-01A-11D-1961-08	TCGA-BQ-7050-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b6b349c-fb1d-44a6-abcf-da2951066a9b	ecae3b13-cf72-4058-8385-cb3bf34bec83	g.chr7:149571035A>C	ENST00000425642.2	+	0	0				ATP6V0E2_ENST00000479613.1_5'Flank|ATP6V0E2-AS1_ENST00000464939.1_RNA|ATP6V0E2-AS1_ENST00000461019.1_RNA|ATP6V0E2_ENST00000456496.2_Missense_Mutation_p.I10L|ATP6V0E2_ENST00000606024.1_5'Flank|ATP6V0E2_ENST00000421974.2_Missense_Mutation_p.I10L|ATP6V0E2_ENST00000464662.1_5'Flank|ATP6V0E2-AS1_ENST00000488315.1_RNA			Q8NHE4	VA0E2_HUMAN	ATPase, H+ transporting V0 subunit e2						ATP hydrolysis coupled proton transport (GO:0015991)|cell growth (GO:0016049)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)|vacuolar acidification (GO:0007035)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|phagocytic vesicle membrane (GO:0030670)|proton-transporting V-type ATPase, V0 domain (GO:0033179)	ATPase activity, coupled to transmembrane movement of ions (GO:0042625)|hydrogen ion transmembrane transporter activity (GO:0015078)			lung(1)	1			OV - Ovarian serous cystadenocarcinoma(82;0.00256)			GGCCCGGCTGATCGCTTCGGG	0.721													A|||	78	0.0155751	0.0575	0.0029	5008	,	,		12043	0.0		0.0	False		,,,				2504	0.0				p.I10L		.											.	.	0			c.A28C						.	A	LEU/ILE,LEU/ILE	108,3620		0,108,1756	3.0	5.0	4.0		28,28	-4.7	0.0	7	dbSNP_134	4	2,7856		0,2,3927	yes	missense,missense	ATP6V0E2	NM_145230.2,NM_001100592.1	5,5	0,110,5683	CC,CA,AA		0.0255,2.897,0.9494	benign,benign	10/131,10/214	149571035	110,11476	1864	3929	5793	SO:0001631	upstream_gene_variant	155066	exon1			CGGCTGATCGCTT	AK057700	CCDS47742.1, CCDS55181.1	7q36.1	2010-04-21	2006-10-12	2006-10-12	ENSG00000171130	ENSG00000171130		"""ATPases / V-type"""	21723	protein-coding gene	gene with protein product		611019	"""chromosome 7 open reading frame 32"", ""ATPase, H+ transporting V0 subunit E isoform 2-like (rat)"""	C7orf32, ATP6V0E2L			Standard	XM_005249958		Approved		uc003wgs.3	Q8NHE4	OTTHUMG00000158094		7.37:g.149571035A>C	Exception_encountered	5	2		9	4	NM_001100592	0	0	0	0	0	A2T863|A2T8L7|B5MDP5|J3KQW7|Q6MZW1|Q75L47|Q7Z4R7|Q8N7I8	Missense_Mutation	SNP	ENST00000425642.2	37		30	0.013736263736263736	28	0.056910569105691054	2	0.0055248618784530384	0	0.0	0	0.0	A	14.71	2.615378	0.46631	0.02897	2.55E-4	ENSG00000171130	ENST00000421974;ENST00000456496	.	.	.	3.25	-4.66	0.03329	.	.	.	.	.	T	0.01353	0.0044	N	0.08118	0	0.20638	N	0.999877	B	0.02656	0.0	B	0.01281	0.0	T	0.18116	-1.0347	8	0.87932	D	0	.	0.853	0.01176	0.2739:0.3374:0.2233:0.1654	.	10	E9PAS2	.	L	10	.	ENSP00000411672:I10L	I	+	1	0	ATP6V0E2	149201968	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.210000	0.02999	-0.957000	0.03627	-0.376000	0.06991	ATC	A|0.986;C|0.014		0.721	ATP6V0E2-010	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000470874.1	NM_145230	
EPPK1	83481	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	144940482	144940482	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7050-01A-11D-1961-08	TCGA-BQ-7050-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b6b349c-fb1d-44a6-abcf-da2951066a9b	ecae3b13-cf72-4058-8385-cb3bf34bec83	g.chr8:144940482A>G	ENST00000525985.1	-	2	7011	c.6940T>C	c.(6940-6942)Tac>Cac	p.Y2314H				P58107	EPIPL_HUMAN	epiplakin 1	2314						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			TGCCCGGTGTAGGGGTCGGTG	0.711																																					p.Y2314H		.											.	EPPK1-25	0			c.T6940C						.						190.0	184.0	186.0					8																	144940482		2184	4264	6448	SO:0001583	missense	83481	exon1			CGGTGTAGGGGTC	AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.6940T>C	8.37:g.144940482A>G	ENSP00000436337:p.Tyr2314His	352	0		336	27	NM_031308	0	0	4	4	0	Q76E58|Q9NSU9	Missense_Mutation	SNP	ENST00000525985.1	37		.	.	.	.	.	.	.	.	.	.	A	19.61	3.860098	0.71834	.	.	ENSG00000227184	ENST00000525985	T	0.69040	-0.37	4.63	4.63	0.57726	.	.	.	.	.	T	0.78666	0.4319	M	0.74881	2.28	0.27571	N	0.949888	D	0.60575	0.988	D	0.74674	0.984	T	0.69289	-0.5184	9	0.20046	T	0.44	.	12.1078	0.53821	1.0:0.0:0.0:0.0	.	2314	E9PPU0	.	H	2314	ENSP00000436337:Y2314H	ENSP00000436337:Y2314H	Y	-	1	0	EPPK1	145012470	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.597000	0.54031	1.957000	0.56846	0.477000	0.44152	TAC	.		0.711	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382675.1	NM_031308	
NTRK2	4915	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	87342656	87342656	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7050-01A-11D-1961-08	TCGA-BQ-7050-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b6b349c-fb1d-44a6-abcf-da2951066a9b	ecae3b13-cf72-4058-8385-cb3bf34bec83	g.chr9:87342656C>G	ENST00000323115.4	+	8	1294	c.941C>G	c.(940-942)gCg>gGg	p.A314G	NTRK2_ENST00000376208.1_Missense_Mutation_p.A314G|NTRK2_ENST00000395882.1_Missense_Mutation_p.A314G|NTRK2_ENST00000359847.3_Missense_Mutation_p.A314G|NTRK2_ENST00000277120.3_Missense_Mutation_p.A314G|NTRK2_ENST00000376213.1_Missense_Mutation_p.A314G|NTRK2_ENST00000304053.6_Missense_Mutation_p.A314G|NTRK2_ENST00000395866.2_Missense_Mutation_p.A158G|NTRK2_ENST00000376214.1_Missense_Mutation_p.A314G			Q16620	NTRK2_HUMAN	neurotrophic tyrosine kinase, receptor, type 2	314	Ig-like C2-type 2.				activation of adenylate cyclase activity (GO:0007190)|aging (GO:0007568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|central nervous system neuron development (GO:0021954)|cerebral cortex development (GO:0021987)|circadian rhythm (GO:0007623)|feeding behavior (GO:0007631)|glutamate secretion (GO:0014047)|learning (GO:0007612)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|mechanoreceptor differentiation (GO:0042490)|negative regulation of anoikis (GO:2000811)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular junction development (GO:0007528)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peripheral nervous system neuron development (GO:0048935)|positive regulation of axonogenesis (GO:0050772)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein autophosphorylation (GO:0046777)|regulation of dendrite development (GO:0050773)|regulation of neurotransmitter secretion (GO:0046928)|regulation of protein kinase B signaling (GO:0051896)|regulation of Rac GTPase activity (GO:0032314)|response to auditory stimulus (GO:0010996)|retinal rod cell development (GO:0046548)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vasculogenesis (GO:0001570)	cell surface (GO:0009986)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|endosome (GO:0005768)|excitatory synapse (GO:0060076)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|receptor complex (GO:0043235)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|brain-derived neurotrophic factor binding (GO:0048403)|brain-derived neurotrophic factor-activated receptor activity (GO:0060175)|neurotrophin binding (GO:0043121)|protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(1)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	46					Amitriptyline(DB00321)	CCCAAACCAGCGCTTCAGTGG	0.443										TSP Lung(25;0.17)																											p.A314G		.											.	NTRK2-1404	0			c.C941G						.						94.0	96.0	95.0					9																	87342656		2203	4300	6503	SO:0001583	missense	4915	exon9			AACCAGCGCTTCA	AF410902	CCDS6671.1, CCDS35050.1, CCDS35051.1, CCDS35052.1, CCDS35053.1	9q22.1	2013-01-11			ENSG00000148053	ENSG00000148053	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8032	protein-coding gene	gene with protein product		600456				7789988	Standard	NM_001018065		Approved	TRKB	uc004anz.1	Q16620	OTTHUMG00000020120	ENST00000323115.4:c.941C>G	9.37:g.87342656C>G	ENSP00000314586:p.Ala314Gly	94	0		87	33	NM_001018065	0	0	25	35	10	B1ANZ4|B4DFV9|Q16675|Q59GJ1|Q8WXJ5|Q8WXJ6|Q8WXJ7	Missense_Mutation	SNP	ENST00000323115.4	37	CCDS35050.1	.	.	.	.	.	.	.	.	.	.	C	17.17	3.321558	0.60634	.	.	ENSG00000148053	ENST00000376214;ENST00000376213;ENST00000395882;ENST00000376208;ENST00000304053;ENST00000277120;ENST00000323115;ENST00000359847;ENST00000395866	T;T;T;T;T;T;T;T;T	0.67523	-0.27;-0.27;-0.27;-0.27;-0.27;-0.27;-0.27;-0.27;-0.27	5.91	5.91	0.95273	Immunoglobulin I-set (1);Immunoglobulin-like fold (1);	0.385251	0.29900	N	0.010905	T	0.58090	0.2098	N	0.14661	0.345	0.30052	N	0.811719	B;B;B;B;B;B;B;B	0.27316	0.045;0.009;0.009;0.011;0.11;0.011;0.175;0.009	B;B;B;B;B;B;B;B	0.36766	0.064;0.022;0.022;0.039;0.232;0.043;0.148;0.023	T	0.52351	-0.8587	10	0.23891	T	0.37	.	20.2873	0.98536	0.0:1.0:0.0:0.0	.	158;314;314;314;314;314;360;314	B4DFV9;Q16620-3;Q16620-5;Q5VWE5;Q16620;Q16620-4;Q59GJ1;Q16620-2	.;.;.;.;NTRK2_HUMAN;.;.;.	G	314;314;314;314;314;314;314;314;158	ENSP00000365387:A314G;ENSP00000365386:A314G;ENSP00000379221:A314G;ENSP00000365381:A314G;ENSP00000306167:A314G;ENSP00000277120:A314G;ENSP00000314586:A314G;ENSP00000352906:A314G;ENSP00000379207:A158G	ENSP00000277120:A314G	A	+	2	0	NTRK2	86532476	0.561000	0.26578	1.000000	0.80357	0.998000	0.95712	2.910000	0.48766	2.799000	0.96334	0.585000	0.79938	GCG	.		0.443	NTRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052882.1		
CYLC2	1539	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	9	105767702	105767702	+	Missense_Mutation	SNP	T	T	A	rs2298052	byFrequency	TCGA-BQ-7050-01A-11D-1961-08	TCGA-BQ-7050-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b6b349c-fb1d-44a6-abcf-da2951066a9b	ecae3b13-cf72-4058-8385-cb3bf34bec83	g.chr9:105767702T>A	ENST00000374798.3	+	5	859	c.789T>A	c.(787-789)gaT>gaA	p.D263E	CYLC2_ENST00000487798.1_Missense_Mutation_p.D263E	NM_001340.3	NP_001331.1	Q14093	CYLC2_HUMAN	cylicin, basic protein of sperm head cytoskeleton 2	263	31 X 3 AA repeats of K-K-X.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)	p.D263D(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(14)|ovary(1)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)	41		all_hematologic(171;0.125)				CCAAGAAAGATGCAAAGGAGA	0.388																																					p.D263E		.											.	CYLC2-91	1	Substitution - coding silent(1)	stomach(1)	c.T789A						.						117.0	112.0	114.0					9																	105767702		2203	4300	6503	SO:0001583	missense	1539	exon5			GAAAGATGCAAAG	Z46788	CCDS35085.1	9q31.2	2008-07-21			ENSG00000155833	ENSG00000155833			2583	protein-coding gene	gene with protein product		604035				7737358	Standard	NM_001340		Approved		uc004bbs.2	Q14093	OTTHUMG00000020396	ENST00000374798.3:c.789T>A	9.37:g.105767702T>A	ENSP00000420256:p.Asp263Glu	71	0		70	14	NM_001340	0	0	0	0	0	B2R8F4|Q5VVJ9	Missense_Mutation	SNP	ENST00000374798.3	37	CCDS35085.1	.	.	.	.	.	.	.	.	.	.	T	2.261	-0.369199	0.05069	.	.	ENSG00000155833	ENST00000374798;ENST00000487798	T;T	0.14022	2.54;2.54	4.21	-5.98	0.02220	.	1.421110	0.04878	N	0.447237	T	0.06050	0.0157	L	0.29908	0.895	0.80722	P	0.0	B	0.23891	0.093	B	0.23574	0.047	T	0.37244	-0.9714	9	0.02654	T	1	-0.742	0.3139	0.00292	0.3842:0.1819:0.2128:0.221	.	263	Q14093	CYLC2_HUMAN	E	263	ENSP00000420256:D263E;ENSP00000417674:D263E	ENSP00000420256:D263E	D	+	3	2	CYLC2	104807523	0.000000	0.05858	0.000000	0.03702	0.104000	0.19210	-0.647000	0.05397	-0.974000	0.03550	0.477000	0.44152	GAT	T|0.972;C|0.028		0.388	CYLC2-001	KNOWN	alternative_3_UTR|NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000053463.3	NM_001340	
FBXW5	54461	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	139837319	139837319	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-7050-01A-11D-1961-08	TCGA-BQ-7050-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b6b349c-fb1d-44a6-abcf-da2951066a9b	ecae3b13-cf72-4058-8385-cb3bf34bec83	g.chr9:139837319A>C	ENST00000325285.3	-	4	507	c.428T>G	c.(427-429)tTc>tGc	p.F143C	C8G_ENST00000224181.3_5'Flank|FBXW5_ENST00000483559.1_5'UTR	NM_018998.3	NP_061871.1	Q969U6	FBXW5_HUMAN	F-box and WD repeat domain containing 5	143					centrosome duplication (GO:0051298)|mitotic nuclear division (GO:0007067)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)	protein kinase binding (GO:0019901)			breast(1)|endometrium(2)|large_intestine(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	12	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.19)	OV - Ovarian serous cystadenocarcinoma(145;7.8e-06)|Epithelial(140;0.000106)		GAACTGGGAGAACTGGGTGTA	0.612																																					p.F143C		.											.	FBXW5-226	0			c.T428G						.						116.0	112.0	113.0					9																	139837319		2203	4300	6503	SO:0001583	missense	54461	exon4			TGGGAGAACTGGG	BC014130	CCDS7014.1	9q34.3	2013-01-09	2007-02-08		ENSG00000159069	ENSG00000159069		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	13613	protein-coding gene	gene with protein product		609072	"""F-box and WD-40 domain protein 5"""				Standard	NM_018998		Approved	DKFZP434B205, MGC20962, Fbw5	uc004cjx.3	Q969U6	OTTHUMG00000020967	ENST00000325285.3:c.428T>G	9.37:g.139837319A>C	ENSP00000313034:p.Phe143Cys	197	1		186	22	NM_018998	0	0	67	96	29	B2RDZ6|Q59ET5|Q5SPZ8|Q5SPZ9|Q5SQ00|Q5SQ02|Q5SQ03|Q5SQ04|Q8WY79|Q96GJ6|Q9BSU8|Q9H6A8|Q9HBQ6|Q9NSZ3	Missense_Mutation	SNP	ENST00000325285.3	37	CCDS7014.1	.	.	.	.	.	.	.	.	.	.	A	22.5	4.303923	0.81136	.	.	ENSG00000159069	ENST00000325285;ENST00000428398	T;T	0.62498	0.02;1.73	4.16	4.16	0.48862	WD40/YVTN repeat-like-containing domain (1);Soluble quinoprotein glucose/sorbosone dehydrogenase (1);	0.000000	0.85682	D	0.000000	T	0.78735	0.4330	M	0.80183	2.485	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.81640	-0.0841	10	0.59425	D	0.04	0.5774	13.3962	0.60853	1.0:0.0:0.0:0.0	.	143	Q969U6	FBXW5_HUMAN	C	143;153	ENSP00000313034:F143C;ENSP00000404829:F153C	ENSP00000313034:F143C	F	-	2	0	FBXW5	138957140	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.563000	0.90723	1.751000	0.51876	0.454000	0.30748	TTC	.		0.612	FBXW5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055227.1	NM_018998	
EXD3	54932	hgsc.bcm.edu	37	9	140247165	140247165	+	Missense_Mutation	SNP	G	G	C	rs370293169		TCGA-BQ-7050-01A-11D-1961-08	TCGA-BQ-7050-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b6b349c-fb1d-44a6-abcf-da2951066a9b	ecae3b13-cf72-4058-8385-cb3bf34bec83	g.chr9:140247165G>C	ENST00000340951.4	-	11	1139	c.944C>G	c.(943-945)aCg>aGg	p.T315R	EXD3_ENST00000342129.4_5'UTR	NM_017820.3	NP_060290.3	Q9NX53	MUT7B_HUMAN	exonuclease 3'-5' domain containing 3	0										NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(2)	12						CTGGGCGGCCGTGACTGGGTC	0.687																																					p.T315R		.											.	EXD3-90	0			c.C944G						.	G	ARG/THR	3,4051		0,3,2024	10.0	13.0	12.0		944	-2.2	0.0	9		12	0,8302		0,0,4151	no	missense	EXD3	NM_017820.3	71	0,3,6175	CC,CG,GG		0.0,0.074,0.0243	possibly-damaging	315/877	140247165	3,12353	2027	4151	6178	SO:0001583	missense	54932	exon11			GCGGCCGTGACTG		CCDS48066.1, CCDS75942.1	9q34.3	2009-03-04			ENSG00000187609	ENSG00000187609			26023	protein-coding gene	gene with protein product							Standard	XM_005266093		Approved	LOC54932, FLJ20433, mut-7	uc004cmp.2	Q8N9H8	OTTHUMG00000156149	ENST00000340951.4:c.944C>G	9.37:g.140247165G>C	ENSP00000340474:p.Thr315Arg	7	2		15	7	NM_017820	0	0	1	4	3	Q6P1M1|Q8IXT8	Missense_Mutation	SNP	ENST00000340951.4	37	CCDS48066.1	.	.	.	.	.	.	.	.	.	.	G	10.93	1.488891	0.26686	7.4E-4	0.0	ENSG00000187609	ENST00000340951	T	0.51325	0.71	3.61	-2.19	0.07015	.	0.331027	0.30859	N	0.008729	T	0.36413	0.0966	L	0.43152	1.355	0.09310	N	0.999998	P	0.50710	0.938	P	0.46320	0.512	T	0.44967	-0.9293	10	0.21540	T	0.41	.	8.8151	0.34991	0.414:0.0:0.586:0.0	.	315	Q8N9H8	MUT7_HUMAN	R	315	ENSP00000340474:T315R	ENSP00000340474:T315R	T	-	2	0	EXD3	139366986	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.751000	0.04803	-0.882000	0.03987	-0.678000	0.03780	ACG	.		0.687	EXD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000343182.1	NM_017820	
ATP1B1	481	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	169076130	169076130	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BQ-7050-01A-11D-1961-08	TCGA-BQ-7050-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b6b349c-fb1d-44a6-abcf-da2951066a9b	ecae3b13-cf72-4058-8385-cb3bf34bec83	g.chr1:169076130delG	ENST00000367816.1	+	2	592	c.63delG	c.(61-63)aagfs	p.K22fs	ATP1B1_ENST00000499679.3_5'Flank|ATP1B1_ENST00000367815.4_Frame_Shift_Del_p.K22fs|RP5-1018K9.1_ENST00000415637.1_RNA			P05026	AT1B1_HUMAN	ATPase, Na+/K+ transporting, beta 1 polypeptide	22					blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cell adhesion (GO:0007155)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular potassium ion homeostasis (GO:0030007)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|leukocyte migration (GO:0050900)|membrane repolarization (GO:0086009)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|positive regulation of ATP catabolic process (GO:1903291)|positive regulation of ATPase activity (GO:0032781)|positive regulation of calcium:sodium antiporter activity (GO:1903281)|positive regulation of potassium ion import (GO:1903288)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of sodium ion export from cell (GO:1903278)|potassium ion import (GO:0010107)|protein localization to plasma membrane (GO:0072659)|protein stabilization (GO:0050821)|protein transport into plasma membrane raft (GO:0044861)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of gene expression (GO:0010468)|relaxation of cardiac muscle (GO:0055119)|response to hypoxia (GO:0001666)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sodium:potassium-exchanging ATPase complex (GO:0005890)|vesicle (GO:0031982)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|MHC class II protein complex binding (GO:0023026)|sodium:potassium-exchanging ATPase activity (GO:0005391)			breast(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	14	all_hematologic(923;0.208)					ACTCAGAGAAGAAGGAGTTTC	0.657																																					p.K21fs		.											.	ATP1B1-540	0			c.63delG						.						51.0	57.0	55.0					1																	169076130		2203	4300	6503	SO:0001589	frameshift_variant	481	exon1			.	U16799	CCDS1276.1	1q24.2	2012-10-22			ENSG00000143153	ENSG00000143153		"""ATPases / P-type"""	804	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit beta-1"", ""sodium pump subunit beta-1"", ""sodium-potassium ATPase subunit beta 1 (non-catalytic)"""	182330		ATP1B			Standard	NM_001677		Approved		uc001gfr.1	P05026	OTTHUMG00000034590	ENST00000367816.1:c.63delG	1.37:g.169076130delG	ENSP00000356790:p.Lys22fs	44	0		42	10	NM_001677	0	0	0	0	0	Q5TGZ3	Frame_Shift_Del	DEL	ENST00000367816.1	37	CCDS1276.1																																																																																			.		0.657	ATP1B1-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083696.1		
NOB1	28987	broad.mit.edu	37	16	69782978	69782980	+	In_Frame_Del	DEL	TCC	TCC	-	rs528891272	byFrequency	TCGA-BQ-7050-01A-11D-1961-08	TCGA-BQ-7050-11A-01D-1961-08	TCC	TCC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4b6b349c-fb1d-44a6-abcf-da2951066a9b	ecae3b13-cf72-4058-8385-cb3bf34bec83	g.chr16:69782978_69782980delTCC	ENST00000268802.5	-	6	596_598	c.567_569delGGA	c.(565-570)gaggaa>gaa	p.189_190EE>E		NM_014062.1	NP_054781.1	Q9ULX3	NOB1_HUMAN	NIN1/RPN12 binding protein 1 homolog (S. cerevisiae)	189	Poly-Glu.				visual perception (GO:0007601)	nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(2)|cervix(1)|endometrium(1)|large_intestine(1)|lung(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						CCCGTTTTCTTCCTCCTCCTCCT	0.522																																					p.189_190del													.	NOB1-90	0			c.567_569del						.																																			SO:0001651	inframe_deletion	28987	exon6			TTTTCTTCCTCCT	AB026125	CCDS10884.1	16q22.1	2008-02-05	2006-04-20	2006-04-20	ENSG00000141101	ENSG00000141101			29540	protein-coding gene	gene with protein product	"""nin one binding protein"""	613586	"""PSMD8 binding protein 1"""	PSMD8BP1		16172919	Standard	NM_014062		Approved	NOB1P, ART-4, MST158	uc002exs.4	Q9ULX3	OTTHUMG00000137576	ENST00000268802.5:c.567_569delGGA	16.37:g.69782987_69782989delTCC	ENSP00000268802:p.Glu191del	175	0		158	5	NM_014062	0	0	0	0	0	Q7L6B7|Q7M4M4|Q7Z4B5|Q9NWB0	In_Frame_Del	DEL	ENST00000268802.5	37	CCDS10884.1																																																																																			.		0.522	NOB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268958.2	NM_014062	
ZNF440	126070	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	11943483	11943485	+	In_Frame_Del	DEL	GTT	GTT	-			TCGA-BQ-7050-01A-11D-1961-08	TCGA-BQ-7050-11A-01D-1961-08	GTT	GTT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b6b349c-fb1d-44a6-abcf-da2951066a9b	ecae3b13-cf72-4058-8385-cb3bf34bec83	g.chr19:11943483_11943485delGTT	ENST00000304060.5	+	4	1656_1658	c.1492_1494delGTT	c.(1492-1494)gttdel	p.V498del		NM_152357.2	NP_689570.2	Q8IYI8	ZN440_HUMAN	zinc finger protein 440	498					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(4)|kidney(1)|large_intestine(7)|lung(9)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27						TCCTTCAGTAGTTCCAGTTCCTT	0.404																																					p.498_498del		.											.	ZNF440-68	0			c.1492_1494del						.																																			SO:0001651	inframe_deletion	126070	exon4			.	AK095252	CCDS42503.1	19p13.13	2013-01-08	2006-08-14	2006-08-14	ENSG00000171295	ENSG00000171295		"""Zinc fingers, C2H2-type"", ""-"""	20874	protein-coding gene	gene with protein product							Standard	NM_152357		Approved	FLJ37933	uc002msp.1	Q8IYI8	OTTHUMG00000156403	ENST00000304060.5:c.1492_1494delGTT	19.37:g.11943483_11943485delGTT	ENSP00000305373:p.Val498del	81	0		45	18	NM_152357	0	0	0	0	0	Q8N1R9	In_Frame_Del	DEL	ENST00000304060.5	37	CCDS42503.1																																																																																			.		0.404	ZNF440-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344508.1	NM_152357	
KCNG2	26251	broad.mit.edu	37	18	77623691	77623692	+	In_Frame_Ins	INS	-	-	GGC	rs71338073	byFrequency	TCGA-BQ-7050-01A-11D-1961-08	TCGA-BQ-7050-11A-01D-1961-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4b6b349c-fb1d-44a6-abcf-da2951066a9b	ecae3b13-cf72-4058-8385-cb3bf34bec83	g.chr18:77623691_77623692insGGC	ENST00000316249.3	+	1	24_25	c.24_25insGGC	c.(25-27)ggc>GGCggc	p.9_9G>GG		NM_012283.1	NP_036415.1	Q9UJ96	KCNG2_HUMAN	potassium voltage-gated channel, subfamily G, member 2	9	Poly-Gly.				energy reserve metabolic process (GO:0006112)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of heart contraction (GO:0008016)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)	p.P8_G9insG(2)		breast(2)|endometrium(4)|lung(7)|skin(1)|upper_aerodigestive_tract(4)	18		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;6.92e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0244)		CCTGCTccccgggcggcggcgg	0.772														1448	0.289137	0.0772	0.3199	5008	,	,		6733	0.3968		0.4165	False		,,,				2504	0.3119				p.P8delinsPG													.	KCNG2-90	2	Insertion - In frame(2)	upper_aerodigestive_tract(2)	c.24_25insGGC						.																																			SO:0001652	inframe_insertion	26251	exon1			CTCCCCGGGCGGC	AJ011021	CCDS12019.1	18q23	2011-07-05			ENSG00000178342	ENSG00000178342		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6249	protein-coding gene	gene with protein product		605696				10551266, 16382104	Standard	NM_012283		Approved	Kv6.2, KCNF2	uc010xfl.2	Q9UJ96	OTTHUMG00000044541	ENST00000316249.3:c.34_36dupGGC	18.37:g.77623698_77623700dupGGC	ENSP00000315654:p.Gly13dup	10	0		10	6	NM_012283	0	0	0	0	0		In_Frame_Ins	INS	ENST00000316249.3	37	CCDS12019.1																																																																																			-|0.657;GGC|0.343		0.772	KCNG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103906.1	NM_012283	
MSH3	4437	broad.mit.edu	37	5	79950727	79950728	+	In_Frame_Ins	INS	-	-	CAGCGCCCC	rs1574197|rs60484572	byFrequency	TCGA-BQ-7050-01A-11D-1961-08	TCGA-BQ-7050-11A-01D-1961-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4b6b349c-fb1d-44a6-abcf-da2951066a9b	ecae3b13-cf72-4058-8385-cb3bf34bec83	g.chr5:79950727_79950728insCAGCGCCCC	ENST00000265081.6	+	1	261_262	c.181_182insCAGCGCCCC	c.(181-183)gca>gCAGCGCCCCca	p.67_68insAPP	DHFR_ENST00000505337.1_5'Flank|DHFR_ENST00000439211.2_5'UTR|DHFR_ENST00000513048.1_5'Flank|DHFR_ENST00000511032.1_5'Flank|DHFR_ENST00000504396.1_5'Flank	NM_002439.4	NP_002430.3	P20585	MSH3_HUMAN	mutS homolog 3	67					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|maintenance of DNA repeat elements (GO:0043570)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|heteroduplex DNA loop binding (GO:0000404)|Y-form DNA binding (GO:0000403)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)		cgcagcggccgcagcgCCCCCA	0.723								Mismatch excision repair (MMR)																													p.A61delinsAAPP	Melanoma(88;1010 1399 13793 26548 36275)												.	MSH3-661	0			c.181_182insCAGCGCCCC						.																																			SO:0001652	inframe_insertion	4437	exon1			GCGGCCGCAGCGC	U61981	CCDS34195.1	5q11-q12	2013-09-12	2013-09-12		ENSG00000113318	ENSG00000113318			7326	protein-coding gene	gene with protein product	"""Divergent upstream protein"", ""Mismatch repair protein 1"""	600887	"""mutS (E. coli) homolog 3"", ""mutS homolog 3 (E. coli)"""				Standard	NM_002439		Approved	DUP, MRP1	uc003kgz.4	P20585	OTTHUMG00000162540	ENST00000265081.6:c.191_199dupCAGCGCCCC	5.37:g.79950728_79950736dupCAGCGCCCC	ENSP00000265081:p.Ala65_Pro67dup	10	0		10	5	NM_002439	0	0	0	0	0	A1L480|A1L482|A6NMM6|Q6PJT5|Q86UQ6|Q92867	In_Frame_Ins	INS	ENST00000265081.6	37	CCDS34195.1																																																																																			.		0.723	MSH3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369471.1	NM_002439	
