#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PEX10	5192	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	2341814	2341814	+	Silent	SNP	A	A	C			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr1:2341814A>C	ENST00000447513.2	-	2	257	c.189T>G	c.(187-189)ctT>ctG	p.L63L	PEX10_ENST00000507596.1_Silent_p.L63L|PEX10_ENST00000288774.3_Silent_p.L63L|PEX10_ENST00000515760.1_5'Flank	NM_002617.3	NP_002608.1	O60683	PEX10_HUMAN	peroxisomal biogenesis factor 10	63					peroxisome organization (GO:0007031)|protein import into peroxisome matrix (GO:0016558)	integral component of peroxisomal membrane (GO:0005779)|intracellular (GO:0005622)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	protein C-terminus binding (GO:0008022)|zinc ion binding (GO:0008270)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|skin(2)	7	all_cancers(77;0.000247)|all_epithelial(69;9.96e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;5.35e-20)|all_lung(118;2.78e-08)|Lung NSC(185;2.69e-06)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;1.1e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.02e-23)|GBM - Glioblastoma multiforme(42;9e-08)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00102)|BRCA - Breast invasive adenocarcinoma(365;0.00435)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0169)|Lung(427;0.199)		TTCTACCTGCAAGTGTGGTGA	0.597																																					p.L63L	GBM(12;9 508 1649 13619)	.											.	PEX10-90	0			c.T189G						.						99.0	86.0	91.0					1																	2341814		2203	4300	6503	SO:0001819	synonymous_variant	5192	exon2			ACCTGCAAGTGTG	AF060502	CCDS41.1, CCDS44045.1	1p36.32	2013-01-09	2008-08-26		ENSG00000157911	ENSG00000157911		"""RING-type (C3HC4) zinc fingers"""	8851	protein-coding gene	gene with protein product		602859	"""peroxisome biogenesis factor 10"""			9683594	Standard	NM_002617		Approved	RNF69	uc001ajg.3	O60683	OTTHUMG00000001637	ENST00000447513.2:c.189T>G	1.37:g.2341814A>C		47	0		61	25	NM_002617	0	0	1	1	0	B3KWD8|Q5T095|Q9BW90	Silent	SNP	ENST00000447513.2	37	CCDS44045.1																																																																																			.		0.597	PEX10-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367454.1	NM_153818	
KIF1B	23095	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	10431203	10431203	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr1:10431203C>T	ENST00000377086.1	+	45	5031	c.4829C>T	c.(4828-4830)tCt>tTt	p.S1610F	KIF1B_ENST00000263934.6_Missense_Mutation_p.S1564F|KIF1B_ENST00000377081.1_Missense_Mutation_p.S1610F			O60333	KIF1B_HUMAN	kinesin family member 1B	1610					anterograde axon cargo transport (GO:0008089)|apoptotic process (GO:0006915)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|mitochondrion transport along microtubule (GO:0047497)|neuromuscular synaptic transmission (GO:0007274)|neuron-neuron synaptic transmission (GO:0007270)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|endometrium(7)|kidney(8)|large_intestine(9)|lung(29)|ovary(3)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(2)	71	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		TTCCAGTTGTCTGATATCTCT	0.488																																					p.S1564F		.											.	KIF1B-93	0			c.C4691T						.						139.0	121.0	127.0					1																	10431203		2203	4300	6503	SO:0001583	missense	23095	exon43			AGTTGTCTGATAT	AF257176	CCDS111.1, CCDS112.1	1p36.22	2014-09-17			ENSG00000054523	ENSG00000054523		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	16636	protein-coding gene	gene with protein product		605995		CMT2A, CMT2		11389829, 10762626	Standard	NM_015074		Approved	KIAA0591, KLP, HMSNII	uc001aqw.4	O60333	OTTHUMG00000001817	ENST00000377086.1:c.4829C>T	1.37:g.10431203C>T	ENSP00000366290:p.Ser1610Phe	101	0		180	45	NM_015074	0	0	0	0	0	A6NFS8|A6NKQ4|Q4VXC3|Q4VXC4|Q4VXC5|Q4VXC6|Q96Q94|Q9BV80|Q9P280	Missense_Mutation	SNP	ENST00000377086.1	37		.	.	.	.	.	.	.	.	.	.	C	26.3	4.719966	0.89205	.	.	ENSG00000054523	ENST00000355249;ENST00000263934;ENST00000377086;ENST00000377081	T;T;T	0.11712	2.75;2.75;2.75	5.53	5.53	0.82687	.	0.060274	0.64402	D	0.000002	T	0.22126	0.0533	N	0.19112	0.55	0.80722	D	1	D;P;D;D;P;D	0.76494	0.966;0.744;0.999;0.972;0.952;0.994	P;B;D;P;B;D	0.74348	0.641;0.289;0.959;0.845;0.288;0.983	T	0.02868	-1.1100	10	0.72032	D	0.01	.	19.8228	0.96604	0.0:1.0:0.0:0.0	.	1596;1570;1610;1584;1610;1564	Q4R9M9;Q4R9M7;Q4VXC4;Q4R9M8;O60333;O60333-2	.;.;.;.;KIF1B_HUMAN;.	F	1610;1564;1610;1610	ENSP00000263934:S1564F;ENSP00000366290:S1610F;ENSP00000366284:S1610F	ENSP00000263934:S1564F	S	+	2	0	KIF1B	10353790	1.000000	0.71417	1.000000	0.80357	0.816000	0.46133	7.445000	0.80570	2.759000	0.94783	0.650000	0.86243	TCT	.		0.488	KIF1B-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000005102.1		
DRAXIN	374946	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	11775243	11775243	+	Silent	SNP	C	C	T			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr1:11775243C>T	ENST00000294485.5	+	6	1050	c.915C>T	c.(913-915)ttC>ttT	p.F305F		NM_198545.3	NP_940947.3			dorsal inhibitory axon guidance protein																		ACAAATGCTTCGATGACTGCA	0.582																																					p.F305F		.											.	.	0			c.C915T						.						180.0	135.0	150.0					1																	11775243		2203	4300	6503	SO:0001819	synonymous_variant	374946	exon6			ATGCTTCGATGAC	AY358750	CCDS135.1	1p36.22	2012-08-20	2012-08-14	2012-08-14	ENSG00000162490	ENSG00000162490			25054	protein-coding gene	gene with protein product	"""dorsal repulsive axon guidance protein"", ""neural tissue-specific cysteine-rich protein"""	612682	"""chromosome 1 open reading frame 187"""	C1orf187		19150847	Standard	NM_198545		Approved	FLJ34999, Draxin, Neucrin	uc001asr.1	Q8NBI3	OTTHUMG00000002227	ENST00000294485.5:c.915C>T	1.37:g.11775243C>T		126	0		171	29	NM_198545	0	0	2	2	0		Silent	SNP	ENST00000294485.5	37	CCDS135.1																																																																																			.		0.582	DRAXIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006325.1	NM_198545	
Unknown	0	bcgsc.ca	37	1	13183615	13183615	+	IGR	SNP	T	T	C	rs200176197		TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr1:13183615T>C								RP13-221M14.3 (19147 upstream) : PRAMEF26 (32740 downstream)																							CTTTTGGCTCTGCAGCCAGGT	0.493																																					p.A86A													.	.	0			c.A258G						.						62.0	49.0	53.0					1																	13183615		692	1591	2283	SO:0001628	intergenic_variant	0	exon2			TGGCTCTGCAGCC																													1.37:g.13183615T>C		94	9		50	17	NM_001136561	0	0	406	406	0		Silent	SNP		37																																																																																				T|0.998;C|0.002	0	0.493								
CASP9	842	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	15844625	15844625	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr1:15844625G>A	ENST00000333868.5	-	2	492	c.398C>T	c.(397-399)tCt>tTt	p.S133F	CASP9_ENST00000348549.5_Missense_Mutation_p.S133F|CASP9_ENST00000375890.4_Missense_Mutation_p.S50F|CASP9_ENST00000469637.1_5'Flank|CASP9_ENST00000546424.1_Missense_Mutation_p.S133F	NM_001229.3	NP_001220.2	P55211	CASP9_HUMAN	caspase 9, apoptosis-related cysteine peptidase	133					activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|aging (GO:0007568)|apoptotic process (GO:0006915)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell apoptotic process (GO:0034349)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet formation (GO:0030220)|positive regulation of apoptotic process (GO:0043065)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of apoptotic process (GO:0042981)|regulation of response to DNA damage stimulus (GO:2001020)|response to antibiotic (GO:0046677)|response to cobalt ion (GO:0032025)|response to estradiol (GO:0032355)|response to lipopolysaccharide (GO:0032496)|signal transduction in response to DNA damage (GO:0042770)	apoptosome (GO:0043293)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|enzyme activator activity (GO:0008047)|peptidase activity (GO:0008233)|protein kinase binding (GO:0019901)|SH3 domain binding (GO:0017124)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|stomach(1)	18		Breast(348;0.000207)|all_lung(284;0.000211)|Colorectal(325;0.000259)|Lung NSC(340;0.000269)|Renal(390;0.000518)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;8.49e-07)|COAD - Colon adenocarcinoma(227;4.36e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00013)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00763)|READ - Rectum adenocarcinoma(331;0.0655)		AAATCCTCCAGAACCAATGTC	0.517																																					p.S133F		.											.	CASP9-1083	0			c.C398T						.						114.0	100.0	105.0					1																	15844625		2203	4300	6503	SO:0001583	missense	842	exon2			CCTCCAGAACCAA	U60521	CCDS158.1, CCDS159.1, CCDS159.2, CCDS59995.1	1p36.21	2012-04-17	2005-08-17		ENSG00000132906	ENSG00000132906		"""Caspases"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1511	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 56"""	602234	"""caspase 9, apoptosis-related cysteine protease"""			8663294, 9390557	Standard	NM_001229		Approved	MCH6, ICE-LAP6, APAF-3, PPP1R56	uc001awn.4	P55211	OTTHUMG00000002256	ENST00000333868.5:c.398C>T	1.37:g.15844625G>A	ENSP00000330237:p.Ser133Phe	128	0		203	36	NM_001229	0	0	43	55	12	B4E1A3|O95348|Q53Y70|Q5JRU9|Q5UGI1|Q92852|Q9BQ62|Q9UEQ3|Q9UIJ8	Missense_Mutation	SNP	ENST00000333868.5	37	CCDS158.1	.	.	.	.	.	.	.	.	.	.	G	8.539	0.872713	0.17322	.	.	ENSG00000132906	ENST00000546424;ENST00000333868;ENST00000348549;ENST00000375890;ENST00000447522;ENST00000440484	T;T;T;T;T;T	0.09445	4.56;4.58;2.98;4.47;3.81;3.51	4.77	3.83	0.44106	.	1.470630	0.03659	N	0.242280	T	0.24586	0.0596	L	0.50333	1.59	0.09310	N	1	D;P;B	0.54207	0.965;0.695;0.137	P;B;B	0.54312	0.748;0.231;0.087	T	0.20042	-1.0287	10	0.66056	D	0.02	.	10.9008	0.47051	0.0:0.1903:0.8097:0.0	.	133;133;133	P55211-2;P55211;F8VVS7	.;CASP9_HUMAN;.	F	133;133;133;50;50;133	ENSP00000449584:S133F;ENSP00000330237:S133F;ENSP00000255256:S133F;ENSP00000365051:S50F;ENSP00000396540:S50F;ENSP00000411304:S133F	ENSP00000330237:S133F	S	-	2	0	CASP9	15717212	0.022000	0.18835	0.150000	0.22450	0.099000	0.18886	1.320000	0.33666	1.330000	0.45394	0.563000	0.77884	TCT	.		0.517	CASP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006438.1	NM_032996	
EIF4G3	8672	hgsc.bcm.edu;broad.mit.edu	37	1	21188793	21188793	+	Missense_Mutation	SNP	C	C	G			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr1:21188793C>G	ENST00000264211.8	-	17	3065	c.2871G>C	c.(2869-2871)gaG>gaC	p.E957D	EIF4G3_ENST00000374935.3_Missense_Mutation_p.E677D|EIF4G3_ENST00000400422.1_Missense_Mutation_p.E957D|EIF4G3_ENST00000602326.1_Missense_Mutation_p.E963D|EIF4G3_ENST00000374937.3_Missense_Mutation_p.E963D|EIF4G3_ENST00000537738.1_Missense_Mutation_p.E447D|EIF4G3_ENST00000536266.1_Missense_Mutation_p.E561D	NM_003760.4	NP_003751.2	O43432	IF4G3_HUMAN	eukaryotic translation initiation factor 4 gamma, 3	957	MIF4G. {ECO:0000255|PROSITE- ProRule:PRU00698}.|eIF3/EIF4A-binding. {ECO:0000250}.				cytokine-mediated signaling pathway (GO:0019221)|positive regulation of meiosis I (GO:0060903)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of translation (GO:0045727)|regulation of translational initiation (GO:0006446)|spermatogenesis (GO:0007283)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(18)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(1)|urinary_tract(3)	70		all_lung(284;2.61e-06)|Lung NSC(340;2.81e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00149)|Ovarian(437;0.00338)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|COAD - Colon adenocarcinoma(152;5.42e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000327)|GBM - Glioblastoma multiforme(114;0.000696)|Kidney(64;0.0018)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(64;0.0185)|READ - Rectum adenocarcinoma(331;0.124)|Lung(427;0.191)		TCACAATTTTCTCCATCTGAT	0.353																																					p.E993D		.											.	EIF4G3-91	0			c.G2979C						.						123.0	119.0	121.0					1																	21188793		2203	4300	6503	SO:0001583	missense	8672	exon21			AATTTTCTCCATC	AF012072	CCDS214.1, CCDS55580.1, CCDS59192.1, CCDS72723.1	1p36.12	2008-02-05			ENSG00000075151	ENSG00000075151			3298	protein-coding gene	gene with protein product		603929				9418880	Standard	NM_001198801		Approved	eIF4GII	uc001bef.3	O43432	OTTHUMG00000002624	ENST00000264211.8:c.2871G>C	1.37:g.21188793C>G	ENSP00000264211:p.Glu957Asp	82	0		83	6	NM_001198801	0	0	21	22	1	B9EGQ7|Q15597|Q504Z1|Q5SWC3|Q8NEN1	Missense_Mutation	SNP	ENST00000264211.8	37	CCDS214.1	.	.	.	.	.	.	.	.	.	.	C	16.86	3.240150	0.58995	.	.	ENSG00000075151	ENST00000264211;ENST00000400415;ENST00000400422;ENST00000374935;ENST00000537738;ENST00000374937;ENST00000536266	T;T;T;T;T;T	0.25250	1.81;1.81;1.81;1.81;1.81;1.81	5.56	1.54	0.23209	MIF4G-like, type 3 (2);Armadillo-type fold (1);MIF4-like, type 1/2/3 (1);	0.122140	0.56097	D	0.000022	T	0.34454	0.0898	L	0.37561	1.115	0.80722	D	1	D;B;B;D;B	0.89917	1.0;0.035;0.0;0.999;0.392	D;B;B;D;B	0.85130	0.997;0.05;0.011;0.994;0.173	T	0.01484	-1.1343	10	0.27785	T	0.31	-16.9367	9.6933	0.40143	0.0:0.7145:0.0:0.2855	.	1152;677;561;963;957	Q59GJ0;Q504Z1;F5H564;B9EGQ7;O43432	.;.;.;.;IF4G3_HUMAN	D	957;1153;957;677;447;963;561	ENSP00000264211:E957D;ENSP00000383274:E957D;ENSP00000364071:E677D;ENSP00000442010:E447D;ENSP00000364073:E963D;ENSP00000444693:E561D	ENSP00000264211:E957D	E	-	3	2	EIF4G3	21061380	0.678000	0.27586	0.998000	0.56505	0.983000	0.72400	-0.070000	0.11523	0.025000	0.15241	-0.808000	0.03180	GAG	.		0.353	EIF4G3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000007467.3	NM_003760	
EIF4G3	8672	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	21226358	21226358	+	Nonsense_Mutation	SNP	C	C	A			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr1:21226358C>A	ENST00000264211.8	-	10	1857	c.1663G>T	c.(1663-1665)Gaa>Taa	p.E555*	EIF4G3_ENST00000374933.3_5'UTR|EIF4G3_ENST00000374935.3_Nonsense_Mutation_p.E275*|EIF4G3_ENST00000400422.1_Nonsense_Mutation_p.E555*|EIF4G3_ENST00000602326.1_Nonsense_Mutation_p.E561*|EIF4G3_ENST00000374937.3_Nonsense_Mutation_p.E561*|EIF4G3_ENST00000537738.1_Nonsense_Mutation_p.E8*|EIF4G3_ENST00000544689.1_Nonsense_Mutation_p.E98*|EIF4G3_ENST00000536266.1_Nonsense_Mutation_p.E159*	NM_003760.4	NP_003751.2	O43432	IF4G3_HUMAN	eukaryotic translation initiation factor 4 gamma, 3	555					cytokine-mediated signaling pathway (GO:0019221)|positive regulation of meiosis I (GO:0060903)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of translation (GO:0045727)|regulation of translational initiation (GO:0006446)|spermatogenesis (GO:0007283)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(18)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(1)|urinary_tract(3)	70		all_lung(284;2.61e-06)|Lung NSC(340;2.81e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00149)|Ovarian(437;0.00338)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|COAD - Colon adenocarcinoma(152;5.42e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000327)|GBM - Glioblastoma multiforme(114;0.000696)|Kidney(64;0.0018)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(64;0.0185)|READ - Rectum adenocarcinoma(331;0.124)|Lung(427;0.191)		GGGTCTCTTTCAGGATGAAAC	0.403																																					p.E561X		.											.	EIF4G3-91	0			c.G1681T						.						163.0	174.0	170.0					1																	21226358		2203	4300	6503	SO:0001587	stop_gained	8672	exon14			CTCTTTCAGGATG	AF012072	CCDS214.1, CCDS55580.1, CCDS59192.1, CCDS72723.1	1p36.12	2008-02-05			ENSG00000075151	ENSG00000075151			3298	protein-coding gene	gene with protein product		603929				9418880	Standard	NM_001198801		Approved	eIF4GII	uc001bef.3	O43432	OTTHUMG00000002624	ENST00000264211.8:c.1663G>T	1.37:g.21226358C>A	ENSP00000264211:p.Glu555*	300	1		212	50	NM_001198802	0	0	17	17	0	B9EGQ7|Q15597|Q504Z1|Q5SWC3|Q8NEN1	Nonsense_Mutation	SNP	ENST00000264211.8	37	CCDS214.1	.	.	.	.	.	.	.	.	.	.	C	37	6.423410	0.97555	.	.	ENSG00000075151	ENST00000264211;ENST00000400415;ENST00000400422;ENST00000374935;ENST00000537738;ENST00000374937;ENST00000536266;ENST00000374933;ENST00000544689	.	.	.	5.72	5.72	0.89469	.	0.733486	0.13569	N	0.378186	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	-6.563	12.2565	0.54627	0.0:0.9228:0.0:0.0772	.	.	.	.	X	555;751;555;275;8;561;159;98;98	.	ENSP00000264211:E555X	E	-	1	0	EIF4G3	21098945	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	5.084000	0.64462	2.711000	0.92665	0.644000	0.83932	GAA	.		0.403	EIF4G3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000007467.3	NM_003760	
EIF4G3	8672	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	21226427	21226427	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr1:21226427C>T	ENST00000264211.8	-	10	1788	c.1594G>A	c.(1594-1596)Gaa>Aaa	p.E532K	EIF4G3_ENST00000374933.3_5'UTR|EIF4G3_ENST00000374935.3_Missense_Mutation_p.E252K|EIF4G3_ENST00000400422.1_Missense_Mutation_p.E532K|EIF4G3_ENST00000602326.1_Missense_Mutation_p.E538K|EIF4G3_ENST00000374937.3_Missense_Mutation_p.E538K|EIF4G3_ENST00000537738.1_5'Flank|EIF4G3_ENST00000544689.1_Missense_Mutation_p.E75K|EIF4G3_ENST00000536266.1_Missense_Mutation_p.E136K	NM_003760.4	NP_003751.2	O43432	IF4G3_HUMAN	eukaryotic translation initiation factor 4 gamma, 3	532					cytokine-mediated signaling pathway (GO:0019221)|positive regulation of meiosis I (GO:0060903)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of translation (GO:0045727)|regulation of translational initiation (GO:0006446)|spermatogenesis (GO:0007283)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(18)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(1)|urinary_tract(3)	70		all_lung(284;2.61e-06)|Lung NSC(340;2.81e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00149)|Ovarian(437;0.00338)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|COAD - Colon adenocarcinoma(152;5.42e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000327)|GBM - Glioblastoma multiforme(114;0.000696)|Kidney(64;0.0018)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(64;0.0185)|READ - Rectum adenocarcinoma(331;0.124)|Lung(427;0.191)		AGCTCCTCTTCAGCTTTAAGC	0.358																																					p.E538K		.											.	EIF4G3-91	0			c.G1612A						.						95.0	103.0	100.0					1																	21226427		2202	4300	6502	SO:0001583	missense	8672	exon14			CCTCTTCAGCTTT	AF012072	CCDS214.1, CCDS55580.1, CCDS59192.1, CCDS72723.1	1p36.12	2008-02-05			ENSG00000075151	ENSG00000075151			3298	protein-coding gene	gene with protein product		603929				9418880	Standard	NM_001198801		Approved	eIF4GII	uc001bef.3	O43432	OTTHUMG00000002624	ENST00000264211.8:c.1594G>A	1.37:g.21226427C>T	ENSP00000264211:p.Glu532Lys	206	0		164	38	NM_001198802	0	0	0	0	0	B9EGQ7|Q15597|Q504Z1|Q5SWC3|Q8NEN1	Missense_Mutation	SNP	ENST00000264211.8	37	CCDS214.1	.	.	.	.	.	.	.	.	.	.	C	15.51	2.854237	0.51270	.	.	ENSG00000075151	ENST00000264211;ENST00000400415;ENST00000400422;ENST00000374935;ENST00000374937;ENST00000536266;ENST00000374933;ENST00000544689	T;T;T;T;T;D	0.87412	2.05;2.05;1.94;2.05;2.05;-2.25	4.98	4.06	0.47325	.	0.426295	0.27143	N	0.020740	T	0.74809	0.3765	N	0.08118	0	0.80722	D	1	P;P;B;P;B	0.47762	0.9;0.651;0.007;0.546;0.376	B;B;B;B;B	0.40285	0.325;0.115;0.006;0.049;0.099	T	0.78458	-0.2196	10	0.52906	T	0.07	-18.3664	13.2326	0.59951	0.0:0.9233:0.0:0.0767	.	727;252;136;538;532	Q59GJ0;Q504Z1;F5H564;B9EGQ7;O43432	.;.;.;.;IF4G3_HUMAN	K	532;728;532;252;538;136;75;75	ENSP00000264211:E532K;ENSP00000383274:E532K;ENSP00000364071:E252K;ENSP00000364073:E538K;ENSP00000444693:E136K;ENSP00000444401:E75K	ENSP00000264211:E532K	E	-	1	0	EIF4G3	21099014	0.999000	0.42202	0.967000	0.41034	0.284000	0.27059	5.276000	0.65580	1.325000	0.45301	0.644000	0.83932	GAA	.		0.358	EIF4G3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000007467.3	NM_003760	
CDC42	998	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	22413230	22413230	+	Silent	SNP	C	C	G	rs143448220		TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr1:22413230C>G	ENST00000344548.3	+	6	608	c.357C>G	c.(355-357)ctC>ctG	p.L119L	CDC42_ENST00000498236.1_3'UTR|CDC42_ENST00000315554.8_Silent_p.L119L|CDC42_ENST00000421089.2_Silent_p.L161L|CDC42_ENST00000400259.1_Silent_p.L119L	NM_001039802.1	NP_001034891.1	P60953	CDC42_HUMAN	cell division cycle 42	119					actin cytoskeleton organization (GO:0030036)|actin filament branching (GO:0090135)|actin filament bundle assembly (GO:0051017)|adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|canonical Wnt signaling pathway (GO:0060070)|cardiac conduction system development (GO:0003161)|cellular protein localization (GO:0034613)|dendritic cell migration (GO:0036336)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell-cell adhesion (GO:0090136)|epithelial-mesenchymal cell signaling (GO:0060684)|establishment of Golgi localization (GO:0051683)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|establishment or maintenance of cell polarity (GO:0007163)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|filopodium assembly (GO:0046847)|Golgi organization (GO:0007030)|GTP catabolic process (GO:0006184)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|heart contraction (GO:0060047)|innate immune response (GO:0045087)|keratinization (GO:0031424)|keratinocyte development (GO:0003334)|macrophage differentiation (GO:0030225)|multicellular organism growth (GO:0035264)|muscle cell differentiation (GO:0042692)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of gene expression (GO:0010629)|negative regulation of protein complex assembly (GO:0031333)|neuron fate determination (GO:0048664)|nuclear migration (GO:0007097)|nucleus localization (GO:0051647)|organelle transport along microtubule (GO:0072384)|positive regulation of cytokinesis (GO:0032467)|positive regulation of DNA replication (GO:0045740)|positive regulation of gene expression (GO:0010628)|positive regulation of hair follicle cell proliferation (GO:0071338)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of JNK cascade (GO:0046330)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of synapse structural plasticity (GO:0051835)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of filopodium assembly (GO:0051489)|regulation of mitosis (GO:0007088)|regulation of protein catabolic process (GO:0042176)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein kinase activity (GO:0045859)|regulation of protein stability (GO:0031647)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|sprouting angiogenesis (GO:0002040)|submandibular salivary gland formation (GO:0060661)|substantia nigra development (GO:0021762)|T cell costimulation (GO:0031295)	apical part of cell (GO:0045177)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|Golgi membrane (GO:0000139)|leading edge membrane (GO:0031256)|membrane (GO:0016020)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|spindle midzone (GO:0051233)	apolipoprotein A-I receptor binding (GO:0034191)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|protein kinase binding (GO:0019901)|thioesterase binding (GO:0031996)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(1)|lung(4)	12		Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;6.55e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)|Prostate(1639;0.0792)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0452)|OV - Ovarian serous cystadenocarcinoma(117;7.32e-26)|Colorectal(126;1.35e-07)|COAD - Colon adenocarcinoma(152;7.73e-06)|GBM - Glioblastoma multiforme(114;8.62e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000649)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(1967;0.00767)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.207)		AAATTGATCTCAGAGATGACC	0.438																																					p.L119L		.											.	CDC42-1084	0			c.C357G						.						167.0	181.0	177.0					1																	22413230		2203	4300	6503	SO:0001819	synonymous_variant	998	exon6			TGATCTCAGAGAT	BC018266	CCDS221.1, CCDS222.1	1p36.1	2013-01-17	2013-01-17		ENSG00000070831	ENSG00000070831			1736	protein-coding gene	gene with protein product	"""GTP binding protein, 25kDa"""	116952	"""cell division cycle 42 (GTP-binding protein, 25kD)"", ""cell division cycle 42 (GTP binding protein, 25kDa)"""			2124704, 2122236	Standard	NM_001039802		Approved	G25K, CDC42Hs	uc001bfr.3	P60953	OTTHUMG00000002753	ENST00000344548.3:c.357C>G	1.37:g.22413230C>G		383	0		285	72	NM_001039802	0	0	207	304	97	P21181|P25763|Q7L8R5|Q9UDI2	Silent	SNP	ENST00000344548.3	37	CCDS221.1																																																																																			C|1.000;T|0.000		0.438	CDC42-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000007787.1	NM_001791	
CDC42	998	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	22413329	22413329	+	Silent	SNP	C	C	G			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr1:22413329C>G	ENST00000344548.3	+	6	707	c.456C>G	c.(454-456)gtC>gtG	p.V152V	CDC42_ENST00000498236.1_3'UTR|CDC42_ENST00000315554.8_Silent_p.V152V|CDC42_ENST00000421089.2_Silent_p.V194V|CDC42_ENST00000400259.1_Silent_p.V152V	NM_001039802.1	NP_001034891.1	P60953	CDC42_HUMAN	cell division cycle 42	152					actin cytoskeleton organization (GO:0030036)|actin filament branching (GO:0090135)|actin filament bundle assembly (GO:0051017)|adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|canonical Wnt signaling pathway (GO:0060070)|cardiac conduction system development (GO:0003161)|cellular protein localization (GO:0034613)|dendritic cell migration (GO:0036336)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell-cell adhesion (GO:0090136)|epithelial-mesenchymal cell signaling (GO:0060684)|establishment of Golgi localization (GO:0051683)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|establishment or maintenance of cell polarity (GO:0007163)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|filopodium assembly (GO:0046847)|Golgi organization (GO:0007030)|GTP catabolic process (GO:0006184)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|heart contraction (GO:0060047)|innate immune response (GO:0045087)|keratinization (GO:0031424)|keratinocyte development (GO:0003334)|macrophage differentiation (GO:0030225)|multicellular organism growth (GO:0035264)|muscle cell differentiation (GO:0042692)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of gene expression (GO:0010629)|negative regulation of protein complex assembly (GO:0031333)|neuron fate determination (GO:0048664)|nuclear migration (GO:0007097)|nucleus localization (GO:0051647)|organelle transport along microtubule (GO:0072384)|positive regulation of cytokinesis (GO:0032467)|positive regulation of DNA replication (GO:0045740)|positive regulation of gene expression (GO:0010628)|positive regulation of hair follicle cell proliferation (GO:0071338)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of JNK cascade (GO:0046330)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of synapse structural plasticity (GO:0051835)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of filopodium assembly (GO:0051489)|regulation of mitosis (GO:0007088)|regulation of protein catabolic process (GO:0042176)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein kinase activity (GO:0045859)|regulation of protein stability (GO:0031647)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|sprouting angiogenesis (GO:0002040)|submandibular salivary gland formation (GO:0060661)|substantia nigra development (GO:0021762)|T cell costimulation (GO:0031295)	apical part of cell (GO:0045177)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|Golgi membrane (GO:0000139)|leading edge membrane (GO:0031256)|membrane (GO:0016020)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|spindle midzone (GO:0051233)	apolipoprotein A-I receptor binding (GO:0034191)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|protein kinase binding (GO:0019901)|thioesterase binding (GO:0031996)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(1)|lung(4)	12		Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;6.55e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)|Prostate(1639;0.0792)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0452)|OV - Ovarian serous cystadenocarcinoma(117;7.32e-26)|Colorectal(126;1.35e-07)|COAD - Colon adenocarcinoma(152;7.73e-06)|GBM - Glioblastoma multiforme(114;8.62e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000649)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(1967;0.00767)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.207)		TGAAGGCTGTCAAGTATGTGG	0.448																																					p.V152V		.											.	CDC42-1084	0			c.C456G						.						148.0	150.0	149.0					1																	22413329		2203	4300	6503	SO:0001819	synonymous_variant	998	exon6			GGCTGTCAAGTAT	BC018266	CCDS221.1, CCDS222.1	1p36.1	2013-01-17	2013-01-17		ENSG00000070831	ENSG00000070831			1736	protein-coding gene	gene with protein product	"""GTP binding protein, 25kDa"""	116952	"""cell division cycle 42 (GTP-binding protein, 25kD)"", ""cell division cycle 42 (GTP binding protein, 25kDa)"""			2124704, 2122236	Standard	NM_001039802		Approved	G25K, CDC42Hs	uc001bfr.3	P60953	OTTHUMG00000002753	ENST00000344548.3:c.456C>G	1.37:g.22413329C>G		306	0		245	62	NM_001039802	0	0	173	236	63	P21181|P25763|Q7L8R5|Q9UDI2	Silent	SNP	ENST00000344548.3	37	CCDS221.1																																																																																			.		0.448	CDC42-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000007787.1	NM_001791	
INPP5B	3633	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	38328025	38328025	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr1:38328025G>C	ENST00000373026.1	-	23	2944	c.2944C>G	c.(2944-2946)Caa>Gaa	p.Q982E	MTF1_ENST00000373036.4_5'Flank|INPP5B_ENST00000373027.1_Missense_Mutation_p.Q738E|RP11-109P14.10_ENST00000419993.1_RNA|INPP5B_ENST00000373024.3_Missense_Mutation_p.Q902E|INPP5B_ENST00000373023.2_Missense_Mutation_p.Q982E			P32019	I5P2_HUMAN	inositol polyphosphate-5-phosphatase, 75kDa	982	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				in utero embryonic development (GO:0001701)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol dephosphorylation (GO:0046856)|regulation of protein processing (GO:0070613)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)	inositol-1,4,5-trisphosphate 5-phosphatase activity (GO:0052658)|metal ion binding (GO:0046872)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)			breast(1)|endometrium(2)|large_intestine(1)|liver(1)|lung(9)|urinary_tract(1)	15	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				ATAAATTCTTGAGCCTTCTTC	0.453																																					p.Q902E		.											.	INPP5B-227	0			c.C2704G						.						121.0	118.0	119.0					1																	38328025		1860	4104	5964	SO:0001583	missense	3633	exon24			ATTCTTGAGCCTT	M74161	CCDS41306.1, CCDS72760.1	1p34	2008-02-05	2002-08-29		ENSG00000204084	ENSG00000204084	3.1.3.56		6077	protein-coding gene	gene with protein product		147264	"""inositol polyphosphate-5-phosphatase, 75kD"""			1718960	Standard	NM_005540		Approved		uc001ccg.1	P32019	OTTHUMG00000004436	ENST00000373026.1:c.2944C>G	1.37:g.38328025G>C	ENSP00000362117:p.Gln982Glu	134	0		131	19	NM_005540	0	0	6	10	4	C9J6U5|Q5VSG9|Q5VSH0|Q5VSH1|Q658Q5|Q6P6D4|Q6PD53|Q86YE1	Missense_Mutation	SNP	ENST00000373026.1	37		.	.	.	.	.	.	.	.	.	.	G	14.26	2.482316	0.44147	.	.	ENSG00000204084	ENST00000373027;ENST00000373023;ENST00000373026;ENST00000373024	T;T;T;T	0.42900	0.96;0.96;0.96;0.96	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.45637	0.1352	L	0.56769	1.78	0.80722	D	1	P	0.44241	0.829	B	0.43274	0.414	T	0.23368	-1.0190	10	0.17832	T	0.49	.	20.054	0.97641	0.0:0.0:1.0:0.0	.	902	P32019-2	.	E	738;982;982;902	ENSP00000362118:Q738E;ENSP00000362114:Q982E;ENSP00000362117:Q982E;ENSP00000362115:Q902E	ENSP00000362114:Q982E	Q	-	1	0	INPP5B	38100612	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	8.101000	0.89546	2.808000	0.96608	0.655000	0.94253	CAA	.		0.453	INPP5B-003	KNOWN	non_canonical_conserved|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000012968.1	NM_005540	
INPP5B	3633	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	38338748	38338748	+	Silent	SNP	G	G	A			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr1:38338748G>A	ENST00000373026.1	-	18	2281	c.2281C>T	c.(2281-2283)Ctg>Ttg	p.L761L	INPP5B_ENST00000373027.1_Silent_p.L517L|INPP5B_ENST00000373024.3_Silent_p.L681L|INPP5B_ENST00000373023.2_Silent_p.L761L			P32019	I5P2_HUMAN	inositol polyphosphate-5-phosphatase, 75kDa	761	ASH. {ECO:0000250}.				in utero embryonic development (GO:0001701)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol dephosphorylation (GO:0046856)|regulation of protein processing (GO:0070613)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)	inositol-1,4,5-trisphosphate 5-phosphatase activity (GO:0052658)|metal ion binding (GO:0046872)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)			breast(1)|endometrium(2)|large_intestine(1)|liver(1)|lung(9)|urinary_tract(1)	15	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				TGCAGAACCAGAATGTCCTCA	0.438																																					p.L681L		.											.	INPP5B-227	0			c.C2041T						.						207.0	193.0	198.0					1																	38338748		1876	4120	5996	SO:0001819	synonymous_variant	3633	exon19			GAACCAGAATGTC	M74161	CCDS41306.1, CCDS72760.1	1p34	2008-02-05	2002-08-29		ENSG00000204084	ENSG00000204084	3.1.3.56		6077	protein-coding gene	gene with protein product		147264	"""inositol polyphosphate-5-phosphatase, 75kD"""			1718960	Standard	NM_005540		Approved		uc001ccg.1	P32019	OTTHUMG00000004436	ENST00000373026.1:c.2281C>T	1.37:g.38338748G>A		207	0		188	31	NM_005540	0	0	8	9	1	C9J6U5|Q5VSG9|Q5VSH0|Q5VSH1|Q658Q5|Q6P6D4|Q6PD53|Q86YE1	Silent	SNP	ENST00000373026.1	37																																																																																				.		0.438	INPP5B-003	KNOWN	non_canonical_conserved|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000012968.1	NM_005540	
PTPRF	5792	broad.mit.edu;bcgsc.ca	37	1	44063474	44063474	+	Silent	SNP	C	C	T			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr1:44063474C>T	ENST00000359947.4	+	12	2209	c.1869C>T	c.(1867-1869)gtC>gtT	p.V623V	PTPRF_ENST00000422171.2_Intron|PTPRF_ENST00000438120.1_Silent_p.V623V|PTPRF_ENST00000372413.3_Silent_p.V623V|PTPRF_ENST00000372414.3_Silent_p.V623V	NM_002840.3	NP_002831.2	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F	623	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|negative regulation of receptor binding (GO:1900121)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	heparin binding (GO:0008201)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(2)|breast(4)|central_nervous_system(3)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(24)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)	72	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				CCACCACGGTCCGGGTAAGTT	0.687																																					p.V623V													.	PTPRF-232	0			c.C1869T						.						23.0	23.0	23.0					1																	44063474		2203	4299	6502	SO:0001819	synonymous_variant	5792	exon12			CACGGTCCGGGTA	Y00815	CCDS489.2, CCDS490.2	1p34	2013-02-11			ENSG00000142949	ENSG00000142949		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9670	protein-coding gene	gene with protein product		179590		LAR		7558042	Standard	NM_130440		Approved		uc001cjr.3	P10586	OTTHUMG00000007501	ENST00000359947.4:c.1869C>T	1.37:g.44063474C>T		25	0		27	15	NM_002840	0	0	159	348	189	D3DPX6|D3DPX7|Q5T021|Q5T022|Q5W9G2|Q86WS0	Silent	SNP	ENST00000359947.4	37	CCDS489.2	.	.	.	.	.	.	.	.	.	.	C	9.661	1.144186	0.21205	.	.	ENSG00000142949	ENST00000429895	.	.	.	3.36	2.43	0.29744	.	.	.	.	.	T	0.59649	0.2209	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54403	-0.8299	4	.	.	.	.	10.5636	0.45161	0.0:0.9017:0.0:0.0983	.	.	.	.	F	280	.	.	S	+	2	0	PTPRF	43836061	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	1.537000	0.36083	0.544000	0.28883	0.313000	0.20887	TCC	.		0.687	PTPRF-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000019710.1		
PTPRF	5792	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	44063522	44063522	+	Silent	SNP	C	C	T			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr1:44063522C>T	ENST00000359947.4	+	12	2257	c.1917C>T	c.(1915-1917)atC>atT	p.I639I	PTPRF_ENST00000422171.2_Intron|PTPRF_ENST00000438120.1_Silent_p.I639I|PTPRF_ENST00000372413.3_Silent_p.I639I|PTPRF_ENST00000372414.3_Silent_p.I639I	NM_002840.3	NP_002831.2	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F	639	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|negative regulation of receptor binding (GO:1900121)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	heparin binding (GO:0008201)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(2)|breast(4)|central_nervous_system(3)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(24)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)	72	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				ACGGCGTTATCACCCAGTACT	0.682																																					p.I639I		.											.	PTPRF-232	0			c.C1917T						.						36.0	35.0	35.0					1																	44063522		2203	4299	6502	SO:0001819	synonymous_variant	5792	exon12			CGTTATCACCCAG	Y00815	CCDS489.2, CCDS490.2	1p34	2013-02-11			ENSG00000142949	ENSG00000142949		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9670	protein-coding gene	gene with protein product		179590		LAR		7558042	Standard	NM_130440		Approved		uc001cjr.3	P10586	OTTHUMG00000007501	ENST00000359947.4:c.1917C>T	1.37:g.44063522C>T		27	0		30	17	NM_002840	0	1	193	428	234	D3DPX6|D3DPX7|Q5T021|Q5T022|Q5W9G2|Q86WS0	Silent	SNP	ENST00000359947.4	37	CCDS489.2	.	.	.	.	.	.	.	.	.	.	C	6.416	0.444943	0.12164	.	.	ENSG00000142949	ENST00000429895	.	.	.	3.36	2.39	0.29439	.	.	.	.	.	T	0.53965	0.1829	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50101	-0.8867	4	.	.	.	.	6.7821	0.23652	0.1746:0.725:0.0:0.1004	.	.	.	.	L	296	.	.	S	+	2	0	PTPRF	43836109	0.931000	0.31567	0.996000	0.52242	0.537000	0.34900	0.201000	0.17276	1.613000	0.50231	0.313000	0.20887	TCA	.		0.682	PTPRF-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000019710.1		
CCDC18	343099	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	93705376	93705376	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr1:93705376G>C	ENST00000343253.7	+	21	3403	c.2901G>C	c.(2899-2901)ttG>ttC	p.L967F	CCDC18_ENST00000557479.1_Missense_Mutation_p.L1086F|CCDC18_ENST00000334652.5_Missense_Mutation_p.E261Q|CCDC18_ENST00000338949.4_Missense_Mutation_p.L723F|CCDC18_ENST00000401026.3_Missense_Mutation_p.L968F			Q5T9S5	CCD18_HUMAN	coiled-coil domain containing 18	967										breast(5)|endometrium(3)|kidney(1)|large_intestine(6)|lung(19)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	42		all_lung(203;0.00196)|Lung NSC(277;0.00903)|Melanoma(281;0.099)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00166)|GBM - Glioblastoma multiforme(16;0.00551)|Epithelial(280;0.0967)		TCCAGGAATTGAGAGATGTAC	0.343																																					p.L968F		.											.	CCDC18-138	0			c.G2904C						.						100.0	91.0	94.0					1																	93705376		1815	4083	5898	SO:0001583	missense	343099	exon21			GGAATTGAGAGAT			1p22.1	2008-02-05			ENSG00000122483	ENSG00000122483			30370	protein-coding gene	gene with protein product						12601173	Standard	XM_006710609		Approved	NY-SAR-41	uc021opx.1	Q5T9S5	OTTHUMG00000010598	ENST00000343253.7:c.2901G>C	1.37:g.93705376G>C	ENSP00000343377:p.Leu967Phe	62	0		53	8	NM_206886	0	0	3	3	0	Q6ZU17	Missense_Mutation	SNP	ENST00000343253.7	37		.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	17.75|17.75|17.75	3.466942|3.466942|3.466942	0.63625|0.63625|0.63625	.|.|.	.|.|.	ENSG00000122483|ENSG00000122483|ENSG00000122483	ENST00000334652|ENST00000343253;ENST00000401026;ENST00000557479;ENST00000338949;ENST00000455267|ENST00000370276	.|T;T|.	.|0.78707|.	.|-1.2;-1.2|.	5.83|5.83|5.83	5.83|5.83|5.83	0.93111|0.93111|0.93111	.|.|.	.|0.000000|.	.|0.64402|.	.|D|.	.|0.000002|.	T|T|.	0.41534|0.41534|.	0.1163|0.1163|.	L|L|L	0.58101|0.58101|0.58101	1.795|1.795|1.795	0.22066|0.22066|0.22066	N|N|N	0.999385|0.999385|0.999385	.|D;D|.	.|0.89917|.	.|1.0;1.0|.	.|D;D|.	.|0.91635|.	.|0.999;0.999|.	T|T|.	0.36986|0.36986|.	-0.9725|-0.9725|.	6|10|.	0.87932|0.62326|.	D|D|.	0|0.03|.	.|.|.	13.3361|13.3361|13.3361	0.60518|0.60518|0.60518	0.0719:0.0:0.9281:0.0|0.0719:0.0:0.9281:0.0|0.0719:0.0:0.9281:0.0	.|.|.	.|967;1086|.	.|Q5T9S5;G3V388|.	.|CCD18_HUMAN;.|.	Q|F|S	261|967;968;1086;723;643|1021	.|ENSP00000383808:L968F;ENSP00000451099:L1086F|.	ENSP00000334084:E261Q|ENSP00000344380:L723F|.	E|L|X	+|+|+	1|3|2	0|2|2	CCDC18|CCDC18|CCDC18	93477964|93477964|93477964	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.996000|0.996000|0.996000	0.88848|0.88848|0.88848	1.479000|1.479000|1.479000	0.35453|0.35453|0.35453	2.749000|2.749000|2.749000	0.94314|0.94314|0.94314	0.650000|0.650000|0.650000	0.86243|0.86243|0.86243	GAG|TTG|TGA	.		0.343	CCDC18-008	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000382327.1	NM_206886	
DDX20	11218	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	112309171	112309171	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr1:112309171G>A	ENST00000369702.4	+	11	2745	c.2125G>A	c.(2125-2127)Gag>Aag	p.E709K	DDX20_ENST00000475700.1_Missense_Mutation_p.E317K	NM_007204.4	NP_009135.4	Q9UHI6	DDX20_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 20	709					ATP catabolic process (GO:0006200)|gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oogenesis (GO:0048477)|positive regulation of apoptotic process (GO:0043065)|regulation of steroid biosynthetic process (GO:0050810)|RNA metabolic process (GO:0016070)|RNA processing (GO:0006396)|spliceosomal snRNP assembly (GO:0000387)|spliceosomal tri-snRNP complex assembly (GO:0000244)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)|transcriptional repressor complex (GO:0017053)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)			endometrium(3)|kidney(7)|large_intestine(6)|lung(3)|pancreas(1)|prostate(1)	21		all_cancers(81;1.06e-05)|all_epithelial(167;7.36e-06)|all_lung(203;2.44e-05)|Lung NSC(69;4.15e-05)		Lung(183;0.0234)|Colorectal(144;0.0282)|all cancers(265;0.0614)|Epithelial(280;0.0999)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CCCCAATCCAGAGAAATATCA	0.478																																					p.E709K		.											.	DDX20-227	0			c.G2125A						.						68.0	71.0	70.0					1																	112309171		2203	4299	6502	SO:0001583	missense	11218	exon11			AATCCAGAGAAAT	AF106019	CCDS842.1	1p21.1-p13.2	2008-02-05	2003-06-13		ENSG00000064703	ENSG00000064703		"""DEAD-boxes"""	2743	protein-coding gene	gene with protein product		606168	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 20, 103kD"""			10383418	Standard	NM_007204		Approved	DP103, GEMIN3	uc001ebs.3	Q9UHI6	OTTHUMG00000011956	ENST00000369702.4:c.2125G>A	1.37:g.112309171G>A	ENSP00000358716:p.Glu709Lys	85	0		123	38	NM_007204	0	0	6	8	2	B4DWV7|Q96F72|Q9NVM3|Q9UF59|Q9UIY0|Q9Y659	Missense_Mutation	SNP	ENST00000369702.4	37	CCDS842.1	.	.	.	.	.	.	.	.	.	.	G	4.428	0.079164	0.08533	.	.	ENSG00000064703	ENST00000369702;ENST00000475700	T;T	0.35048	1.33;1.89	5.71	5.71	0.89125	.	1.938660	0.01863	N	0.036737	T	0.13457	0.0326	N	0.19112	0.55	0.23893	N	0.996542	B;B	0.30973	0.302;0.09	B;B	0.33620	0.167;0.016	T	0.19289	-1.0310	9	.	.	.	0.764	8.6694	0.34140	0.0762:0.0:0.7714:0.1524	.	317;709	E9PJ60;Q9UHI6	.;DDX20_HUMAN	K	709;317	ENSP00000358716:E709K;ENSP00000435660:E317K	.	E	+	1	0	DDX20	112110694	0.080000	0.21391	0.034000	0.17996	0.052000	0.14988	2.490000	0.45294	2.703000	0.92315	0.655000	0.94253	GAG	.		0.478	DDX20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033063.2	NM_007204	
DDX20	11218	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	112309315	112309315	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr1:112309315G>A	ENST00000369702.4	+	11	2889	c.2269G>A	c.(2269-2271)Gac>Aac	p.D757N	DDX20_ENST00000475700.1_Missense_Mutation_p.D365N	NM_007204.4	NP_009135.4	Q9UHI6	DDX20_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 20	757					ATP catabolic process (GO:0006200)|gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oogenesis (GO:0048477)|positive regulation of apoptotic process (GO:0043065)|regulation of steroid biosynthetic process (GO:0050810)|RNA metabolic process (GO:0016070)|RNA processing (GO:0006396)|spliceosomal snRNP assembly (GO:0000387)|spliceosomal tri-snRNP complex assembly (GO:0000244)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)|transcriptional repressor complex (GO:0017053)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)			endometrium(3)|kidney(7)|large_intestine(6)|lung(3)|pancreas(1)|prostate(1)	21		all_cancers(81;1.06e-05)|all_epithelial(167;7.36e-06)|all_lung(203;2.44e-05)|Lung NSC(69;4.15e-05)		Lung(183;0.0234)|Colorectal(144;0.0282)|all cancers(265;0.0614)|Epithelial(280;0.0999)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TGATTGGTATGACTGTCATAG	0.478																																					p.D757N		.											.	DDX20-227	0			c.G2269A						.						101.0	100.0	100.0					1																	112309315		2203	4300	6503	SO:0001583	missense	11218	exon11			TGGTATGACTGTC	AF106019	CCDS842.1	1p21.1-p13.2	2008-02-05	2003-06-13		ENSG00000064703	ENSG00000064703		"""DEAD-boxes"""	2743	protein-coding gene	gene with protein product		606168	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 20, 103kD"""			10383418	Standard	NM_007204		Approved	DP103, GEMIN3	uc001ebs.3	Q9UHI6	OTTHUMG00000011956	ENST00000369702.4:c.2269G>A	1.37:g.112309315G>A	ENSP00000358716:p.Asp757Asn	70	2		132	39	NM_007204	0	0	10	10	0	B4DWV7|Q96F72|Q9NVM3|Q9UF59|Q9UIY0|Q9Y659	Missense_Mutation	SNP	ENST00000369702.4	37	CCDS842.1	.	.	.	.	.	.	.	.	.	.	G	14.36	2.512691	0.44660	.	.	ENSG00000064703	ENST00000369702;ENST00000475700	T;T	0.35789	1.29;1.76	5.6	3.73	0.42828	.	0.820184	0.11606	N	0.547319	T	0.17238	0.0414	L	0.56769	1.78	0.44694	D	0.997688	B;B	0.29085	0.232;0.028	B;B	0.29176	0.099;0.018	T	0.04678	-1.0934	9	.	.	.	-7.2593	7.781	0.29064	0.144:0.1328:0.7233:0.0	.	365;757	E9PJ60;Q9UHI6	.;DDX20_HUMAN	N	757;365	ENSP00000358716:D757N;ENSP00000435660:D365N	.	D	+	1	0	DDX20	112110838	0.454000	0.25728	0.673000	0.29887	0.131000	0.20780	1.414000	0.34736	0.738000	0.32606	0.655000	0.94253	GAC	.		0.478	DDX20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033063.2	NM_007204	
ST7L	54879	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	113124686	113124686	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr1:113124686C>T	ENST00000358039.4	-	9	1301	c.997G>A	c.(997-999)Gaa>Aaa	p.E333K	ST7L_ENST00000463235.1_5'UTR|ST7L_ENST00000369669.1_Missense_Mutation_p.E150K|ST7L_ENST00000369666.1_Missense_Mutation_p.E316K|ST7L_ENST00000543570.1_Missense_Mutation_p.E316K|ST7L_ENST00000490067.1_Missense_Mutation_p.E316K|ST7L_ENST00000369668.2_Missense_Mutation_p.E333K|ST7L_ENST00000544629.1_Missense_Mutation_p.E268K|ST7L_ENST00000343210.7_Missense_Mutation_p.E333K|ST7L_ENST00000538187.1_Missense_Mutation_p.E277K|ST7L_ENST00000360743.4_Missense_Mutation_p.E333K	NM_017744.4|NM_138727.3	NP_060214.2|NP_620055.1	Q8TDW4	ST7L_HUMAN	suppression of tumorigenicity 7 like	333					negative regulation of cell growth (GO:0030308)	integral component of membrane (GO:0016021)				endometrium(1)|kidney(4)|large_intestine(3)|lung(1)|prostate(2)|stomach(1)|urinary_tract(3)	15	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		AAGAGATTTTCATGGATGTTC	0.343																																					p.E333K		.											.	ST7L-90	0			c.G997A						.						107.0	107.0	107.0					1																	113124686		2203	4299	6502	SO:0001583	missense	54879	exon9			GATTTTCATGGAT	AB081317	CCDS848.1, CCDS849.1, CCDS850.1, CCDS852.1	1p13.1	2008-06-06			ENSG00000007341	ENSG00000007341			18441	protein-coding gene	gene with protein product						12012006	Standard	NM_138729		Approved	FLJ20284, STLR, ST7R, FAM4B	uc001ecd.3	Q8TDW4	OTTHUMG00000011753	ENST00000358039.4:c.997G>A	1.37:g.113124686C>T	ENSP00000350734:p.Glu333Lys	84	1		129	35	NM_138728	0	0	2	2	0	A8K4S7|Q49AH6|Q5TEI4|Q5U5K6|Q6N067|Q7Z2Z0|Q7Z3C2|Q8N7P8|Q8TDW1|Q8TDW2|Q8TDW3|Q9NXF3	Missense_Mutation	SNP	ENST00000358039.4	37	CCDS848.1	.	.	.	.	.	.	.	.	.	.	C	34	5.381617	0.95967	.	.	ENSG00000007341	ENST00000358039;ENST00000360743;ENST00000544629;ENST00000369669;ENST00000490067;ENST00000369668;ENST00000343210;ENST00000369666;ENST00000538187;ENST00000543570;ENST00000369665	T;T;T;T;T;T;T;T;T;T	0.21932	1.98;1.98;1.98;1.98;1.98;1.98;1.98;1.98;1.98;1.98	5.56	5.56	0.83823	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.45895	0.1365	M	0.82630	2.6	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.97110	1.0;0.997;0.999;0.996;0.996;0.996;0.997;0.999	T	0.48980	-0.8986	10	0.62326	D	0.03	-13.6675	19.1265	0.93386	0.0:1.0:0.0:0.0	.	316;277;268;333;316;316;333;333	B7Z8V6;B7Z7D4;F5H2P3;Q8TDW4-5;Q8TDW4-6;Q8TDW4-3;Q8TDW4-2;Q8TDW4	.;.;.;.;.;.;.;ST7L_HUMAN	K	333;333;268;150;316;333;333;316;277;316;211	ENSP00000350734:E333K;ENSP00000353972:E333K;ENSP00000445499:E268K;ENSP00000358683:E150K;ENSP00000417140:E316K;ENSP00000358682:E333K;ENSP00000345312:E333K;ENSP00000358680:E316K;ENSP00000444021:E277K;ENSP00000444088:E316K	ENSP00000345312:E333K	E	-	1	0	ST7L	112926209	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.487000	0.81328	2.618000	0.88619	0.462000	0.41574	GAA	.		0.343	ST7L-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000032504.3		
POGZ	23126	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	151377387	151377387	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr1:151377387G>A	ENST00000271715.2	-	19	4438	c.4124C>T	c.(4123-4125)cCt>cTt	p.P1375L	POGZ_ENST00000531094.1_Missense_Mutation_p.P1313L|POGZ_ENST00000368863.2_Missense_Mutation_p.P1280L|POGZ_ENST00000392723.1_Missense_Mutation_p.P1322L|POGZ_ENST00000361398.3_Missense_Mutation_p.P1322L|POGZ_ENST00000409503.1_Missense_Mutation_p.P1366L|POGZ_ENST00000540984.1_Missense_Mutation_p.P737L|POGZ_ENST00000491586.1_Missense_Mutation_p.P1331L	NM_001194937.1|NM_015100.3	NP_001181866.1|NP_055915.2	Q7Z3K3	POGZ_HUMAN	pogo transposable element with ZNF domain	1375					kinetochore assembly (GO:0051382)|mitotic sister chromatid cohesion (GO:0007064)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(10)|kidney(3)|large_intestine(10)|liver(2)|lung(11)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	47	Lung SC(34;0.00471)|Ovarian(49;0.00672)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			TGTCTCTTCAGGAGATGATCT	0.488											OREG0003905	type=REGULATORY REGION|Gene=POGZ|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.P1375L		.											.	POGZ-93	0			c.C4124T						.						101.0	96.0	98.0					1																	151377387		2203	4300	6503	SO:0001583	missense	23126	exon19			TCTTCAGGAGATG	AB007930	CCDS997.1, CCDS998.1, CCDS44222.1, CCDS44222.2, CCDS53365.1, CCDS53366.1	1q21.1	2013-07-22			ENSG00000143442	ENSG00000143442			18801	protein-coding gene	gene with protein product	"""zinc finger protein 280E"", ""putative protein product of Nbla00003"""	614787				10976766	Standard	NM_015100		Approved	KIAA0461, ZNF635m, ZNF280E	uc001eyd.2	Q7Z3K3	OTTHUMG00000012499	ENST00000271715.2:c.4124C>T	1.37:g.151377387G>A	ENSP00000271715:p.Pro1375Leu	144	0	1739	190	44	NM_015100	0	0	19	30	11	B4DTP8|B4DYL9|B7ZBY5|E9PM80|O75049|Q3LIC4|Q5SZS1|Q5SZS2|Q5SZS3|Q5SZS4|Q8TDZ7|Q9Y4X7	Missense_Mutation	SNP	ENST00000271715.2	37	CCDS997.1	.	.	.	.	.	.	.	.	.	.	G	14.68	2.607106	0.46527	.	.	ENSG00000143442	ENST00000392723;ENST00000271715;ENST00000361398;ENST00000368863;ENST00000409503;ENST00000531094;ENST00000540984;ENST00000491586	T;T;T;T;T;T;T;T	0.24908	5.79;5.82;5.79;5.76;5.8;5.8;1.83;5.28	5.05	5.05	0.67936	.	0.000000	0.64402	D	0.000003	T	0.20007	0.0481	N	0.19112	0.55	0.58432	D	0.999999	B;D;P;P;B;B	0.58268	0.164;0.982;0.763;0.465;0.253;0.267	B;P;B;B;B;B	0.53006	0.04;0.715;0.173;0.124;0.087;0.058	T	0.02098	-1.1214	10	0.66056	D	0.02	-14.1248	17.4919	0.87707	0.0:0.0:1.0:0.0	.	1313;1366;1280;1331;1322;1375	E9PM80;B7ZBY5;Q7Z3K3-5;Q7Z3K3-3;Q7Z3K3-2;Q7Z3K3	.;.;.;.;.;POGZ_HUMAN	L	1322;1375;1322;1280;1366;1313;737;1331	ENSP00000376484:P1322L;ENSP00000271715:P1375L;ENSP00000354467:P1322L;ENSP00000357856:P1280L;ENSP00000386836:P1366L;ENSP00000431259:P1313L;ENSP00000443547:P737L;ENSP00000418408:P1331L	ENSP00000271715:P1375L	P	-	2	0	POGZ	149644011	1.000000	0.71417	0.999000	0.59377	0.935000	0.57460	6.397000	0.73239	2.780000	0.95670	0.655000	0.94253	CCT	.		0.488	POGZ-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000034915.2	NM_207171	
FLG	2312	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	152281276	152281276	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr1:152281276G>C	ENST00000368799.1	-	3	6121	c.6086C>G	c.(6085-6087)tCt>tGt	p.S2029C	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2029	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCTGACTGCAGATGAAGCTTG	0.542									Ichthyosis																												p.S2029C		.											.	FLG-106	0			c.C6086G						.						601.0	507.0	539.0					1																	152281276		2203	4298	6501	SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	ACTGCAGATGAAG	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.6086C>G	1.37:g.152281276G>C	ENSP00000357789:p.Ser2029Cys	1055	0		1229	541	NM_002016	0	0	0	0	0	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	g	5.168	0.216596	0.09810	.	.	ENSG00000143631	ENST00000368799	T	0.04083	3.71	3.44	2.51	0.30379	.	.	.	.	.	T	0.07052	0.0179	M	0.61703	1.905	0.09310	N	1	D	0.76494	0.999	D	0.65684	0.937	T	0.17440	-1.0369	9	0.56958	D	0.05	.	8.6711	0.34152	0.0:0.2608:0.7392:0.0	.	2029	P20930	FILA_HUMAN	C	2029	ENSP00000357789:S2029C	ENSP00000357789:S2029C	S	-	2	0	FLG	150547900	0.000000	0.05858	0.001000	0.08648	0.017000	0.09413	-0.118000	0.10692	0.748000	0.32831	0.485000	0.47835	TCT	.		0.542	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
CHRNB2	1141	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	154544111	154544111	+	Nonsense_Mutation	SNP	C	C	A			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr1:154544111C>A	ENST00000368476.3	+	5	1076	c.812C>A	c.(811-813)tCa>tAa	p.S271*		NM_000748.2	NP_000739.1	P17787	ACHB2_HUMAN	cholinergic receptor, nicotinic, beta 2 (neuronal)	271					action potential (GO:0001508)|associative learning (GO:0008306)|B cell activation (GO:0042113)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|central nervous system projection neuron axonogenesis (GO:0021952)|cognition (GO:0050890)|conditioned taste aversion (GO:0001661)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|lateral geniculate nucleus development (GO:0021771)|learning (GO:0007612)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|memory (GO:0007613)|negative regulation of action potential (GO:0045759)|neurological system process (GO:0050877)|optic nerve morphogenesis (GO:0021631)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of synaptic transmission, dopaminergic (GO:0032226)|protein heterooligomerization (GO:0051291)|regulation of circadian sleep/wake cycle, non-REM sleep (GO:0045188)|regulation of circadian sleep/wake cycle, REM sleep (GO:0042320)|regulation of dendrite morphogenesis (GO:0048814)|regulation of dopamine metabolic process (GO:0042053)|regulation of dopamine secretion (GO:0014059)|regulation of synapse assembly (GO:0051963)|regulation of synaptic transmission, dopaminergic (GO:0032225)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|sensory perception of pain (GO:0019233)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)|social behavior (GO:0035176)|synaptic transmission (GO:0007268)|synaptic transmission involved in micturition (GO:0060084)|synaptic transmission, cholinergic (GO:0007271)|vestibulocochlear nerve development (GO:0021562)|visual learning (GO:0008542)|visual perception (GO:0007601)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|drug binding (GO:0008144)|ligand-gated ion channel activity (GO:0015276)	p.S271*(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(12)|skin(1)|urinary_tract(3)	28	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)		Dextromethorphan(DB00514)|Galantamine(DB00674)|Nicotine(DB00184)	TTGTGCATCTCAGTGCTGCTG	0.577																																					p.S271X		.											.	CHRNB2-90	1	Substitution - Nonsense(1)	lung(1)	c.C812A						.						280.0	208.0	233.0					1																	154544111		2203	4300	6503	SO:0001587	stop_gained	1141	exon5			GCATCTCAGTGCT	U62437	CCDS1070.1	1q21.3	2012-02-11	2006-02-01		ENSG00000160716	ENSG00000160716		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1962	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, beta 2 (neuronal)"""	118507	"""cholinergic receptor, nicotinic, beta polypeptide 2 (neuronal)"""			1505988	Standard	NM_000748		Approved		uc001ffg.3	P17787	OTTHUMG00000037262	ENST00000368476.3:c.812C>A	1.37:g.154544111C>A	ENSP00000357461:p.Ser271*	225	1		281	167	NM_000748	0	0	0	0	0	Q9UEH9	Nonsense_Mutation	SNP	ENST00000368476.3	37	CCDS1070.1	.	.	.	.	.	.	.	.	.	.	C	39	7.470747	0.98306	.	.	ENSG00000160716	ENST00000368476	.	.	.	4.1	4.1	0.47936	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.1089	0.81244	0.0:1.0:0.0:0.0	.	.	.	.	X	271	.	ENSP00000357461:S271X	S	+	2	0	CHRNB2	152810735	1.000000	0.71417	0.999000	0.59377	0.985000	0.73830	7.608000	0.82898	2.095000	0.63458	0.467000	0.42956	TCA	.		0.577	CHRNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090697.1	NM_000748	
GON4L	54856	broad.mit.edu;bcgsc.ca	37	1	155723185	155723185	+	Silent	SNP	G	G	A			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr1:155723185G>A	ENST00000368331.1	-	29	5700	c.5652C>T	c.(5650-5652)taC>taT	p.Y1884Y	GON4L_ENST00000271883.5_Silent_p.Y1884Y|GON4L_ENST00000437809.1_Silent_p.Y1884Y	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)	1884					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					CCTTGCTCTTGTAGGATTTGC	0.572																																					p.Y1884Y													.	GON4L-93	0			c.C5652T						.						111.0	109.0	110.0					1																	155723185		1934	4136	6070	SO:0001819	synonymous_variant	54856	exon29			GCTCTTGTAGGAT	AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106	ENST00000368331.1:c.5652C>T	1.37:g.155723185G>A		239	0		278	13	NM_001037533	0	0	12	12	0	B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	Silent	SNP	ENST00000368331.1	37																																																																																				.		0.572	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_032292	
GON4L	54856	broad.mit.edu;bcgsc.ca	37	1	155723194	155723194	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr1:155723194G>C	ENST00000368331.1	-	29	5691	c.5643C>G	c.(5641-5643)agC>agG	p.S1881R	GON4L_ENST00000271883.5_Missense_Mutation_p.S1881R|GON4L_ENST00000437809.1_Missense_Mutation_p.S1881R	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)	1881					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					TGTAGGATTTGCTGTCACAGA	0.582																																					p.S1881R													.	GON4L-93	0			c.C5643G						.						107.0	105.0	106.0					1																	155723194		1950	4137	6087	SO:0001583	missense	54856	exon29			GGATTTGCTGTCA	AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106	ENST00000368331.1:c.5643C>G	1.37:g.155723194G>C	ENSP00000357315:p.Ser1881Arg	233	0		251	13	NM_001037533	0	0	0	0	0	B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	Missense_Mutation	SNP	ENST00000368331.1	37		.	.	.	.	.	.	.	.	.	.	G	15.41	2.824139	0.50739	.	.	ENSG00000116580	ENST00000437809;ENST00000368331;ENST00000271883	T;T;T	0.10668	2.85;2.85;2.85	5.15	4.23	0.50019	.	0.195098	0.45867	D	0.000333	T	0.04770	0.0129	L	0.44542	1.39	0.34449	D	0.70051	P;P	0.38048	0.481;0.616	B;B	0.35312	0.098;0.2	T	0.23655	-1.0182	10	0.45353	T	0.12	.	13.8128	0.63273	0.0753:0.0:0.9247:0.0	.	1881;1881	Q3T8J9;Q3T8J9-3	GON4L_HUMAN;.	R	1881	ENSP00000396117:S1881R;ENSP00000357315:S1881R;ENSP00000271883:S1881R	ENSP00000271883:S1881R	S	-	3	2	GON4L	153989818	1.000000	0.71417	1.000000	0.80357	0.855000	0.48748	4.844000	0.62846	1.377000	0.46286	0.455000	0.32223	AGC	.		0.582	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_032292	
OR10Z1	128368	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	158576303	158576303	+	Silent	SNP	C	C	T			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr1:158576303C>T	ENST00000361284.1	+	1	75	c.75C>T	c.(73-75)ctC>ctT	p.L25L		NM_001004478.1	NP_001004478.1	Q8NGY1	O10Z1_HUMAN	olfactory receptor, family 10, subfamily Z, member 1	25						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(6)|lung(21)|pancreas(1)|prostate(3)|skin(4)	37	all_hematologic(112;0.0378)					AGTTGCAGCTCCTTCTCTTTG	0.498																																					p.L25L		.											.	OR10Z1-70	0			c.C75T						.						179.0	173.0	175.0					1																	158576303		2203	4300	6503	SO:0001819	synonymous_variant	128368	exon1			GCAGCTCCTTCTC	AB065635	CCDS30901.1	1q23.1	2012-08-23			ENSG00000198967	ENSG00000198967		"""GPCR / Class A : Olfactory receptors"""	14996	protein-coding gene	gene with protein product							Standard	NM_001004478		Approved		uc010pio.2	Q8NGY1	OTTHUMG00000019637	ENST00000361284.1:c.75C>T	1.37:g.158576303C>T		171	0		239	34	NM_001004478	0	0	0	0	0	Q5VYL0|Q6IFR7	Silent	SNP	ENST00000361284.1	37	CCDS30901.1																																																																																			.		0.498	OR10Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051853.1	NM_001004478	
OR6N1	128372	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	158735810	158735810	+	Silent	SNP	G	G	A			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr1:158735810G>A	ENST00000335094.2	-	1	682	c.663C>T	c.(661-663)atC>atT	p.I221I		NM_001005185.1	NP_001005185.1	Q8NGY5	OR6N1_HUMAN	olfactory receptor, family 6, subfamily N, member 1	221						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(22)|ovary(1)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	54	all_hematologic(112;0.0378)					CTGTGCAGATGATCTGCACAT	0.488																																					p.I221I		.											.	OR6N1-69	0			c.C663T						.						125.0	124.0	125.0					1																	158735810		2203	4300	6503	SO:0001819	synonymous_variant	128372	exon1			GCAGATGATCTGC	BK004199	CCDS30905.1	1q23.1	2012-08-09			ENSG00000197403	ENSG00000197403		"""GPCR / Class A : Olfactory receptors"""	15034	protein-coding gene	gene with protein product							Standard	NM_001005185		Approved		uc010piq.2	Q8NGY5	OTTHUMG00000022774	ENST00000335094.2:c.663C>T	1.37:g.158735810G>A		185	0		231	119	NM_001005185	0	0	0	0	0	Q5VUU8|Q96R35	Silent	SNP	ENST00000335094.2	37	CCDS30905.1																																																																																			.		0.488	OR6N1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059067.1	NM_001005185	
PYHIN1	149628	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	158943473	158943473	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr1:158943473G>A	ENST00000368140.1	+	8	1641	c.1396G>A	c.(1396-1398)Gca>Aca	p.A466T	PYHIN1_ENST00000392254.2_Intron|PYHIN1_ENST00000392252.3_Intron|PYHIN1_ENST00000368138.3_Missense_Mutation_p.A457T	NM_152501.4|NM_198928.4|NM_198929.4	NP_689714.2|NP_945146.1|NP_945147.1	Q6K0P9	IFIX_HUMAN	pyrin and HIN domain family, member 1	466					cell cycle (GO:0007049)	nucleus (GO:0005634)				breast(2)|endometrium(3)|large_intestine(10)|lung(32)|ovary(3)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_hematologic(112;0.0378)					GTCATCGCCTGCAAACTTTAG	0.448																																					p.A466T		.											.	PYHIN1-94	0			c.G1396A						.						162.0	144.0	150.0					1																	158943473		2203	4300	6503	SO:0001583	missense	149628	exon8			TCGCCTGCAAACT	AY185344	CCDS1178.1, CCDS1179.1, CCDS30907.1, CCDS30908.1	1q23.1	2008-02-05			ENSG00000163564	ENSG00000163564			28894	protein-coding gene	gene with protein product		612677				15122330	Standard	NM_152501		Approved	IFIX, MGC23885	uc001ftb.3	Q6K0P9	OTTHUMG00000037109	ENST00000368140.1:c.1396G>A	1.37:g.158943473G>A	ENSP00000357122:p.Ala466Thr	67	0		105	54	NM_152501	0	0	0	0	0	Q5T3W6|Q6K0P6|Q6K0P7|Q6K0P8|Q8WW65	Missense_Mutation	SNP	ENST00000368140.1	37	CCDS1178.1	.	.	.	.	.	.	.	.	.	.	G	1.474	-0.558987	0.03967	.	.	ENSG00000163564	ENST00000368140;ENST00000368138	T;T	0.06294	3.33;3.32	1.95	-2.27	0.06846	.	.	.	.	.	T	0.00724	0.0024	N	0.08118	0	0.09310	N	1	B;B	0.22604	0.072;0.043	B;B	0.16289	0.015;0.007	T	0.46512	-0.9186	9	0.16420	T	0.52	.	6.2156	0.20653	0.668:0.0:0.332:0.0	.	457;466	Q6K0P9-2;Q6K0P9	.;IFIX_HUMAN	T	466;457	ENSP00000357122:A466T;ENSP00000357120:A457T	ENSP00000357120:A457T	A	+	1	0	PYHIN1	157210097	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.349000	0.02627	-0.729000	0.04875	-0.143000	0.13931	GCA	.		0.448	PYHIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000090110.1	NM_152501	
F5	2153	broad.mit.edu	37	1	169493136	169493136	+	Missense_Mutation	SNP	C	C	A			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr1:169493136C>A	ENST00000367797.3	-	20	5996	c.5795G>T	c.(5794-5796)tGg>tTg	p.W1932L	F5_ENST00000367796.3_Missense_Mutation_p.W1937L	NM_000130.4	NP_000121	P12259	FA5_HUMAN	coagulation factor V (proaccelerin, labile factor)	1932	F5/8 type C 1. {ECO:0000255|PROSITE- ProRule:PRU00081}.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	copper ion binding (GO:0005507)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(55)|ovary(3)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(1)	128	all_hematologic(923;0.208)				ART-123(DB05777)|Drotrecogin alfa(DB00055)	TCTGGGCTCCCAGTAACCTAA	0.373																																					p.W1932L													.	F5-157	0			c.G5795T						.						110.0	117.0	114.0					1																	169493136		2203	4300	6503	SO:0001583	missense	2153	exon20			GGCTCCCAGTAAC	M14335	CCDS1281.1	1q23	2012-10-02			ENSG00000198734	ENSG00000198734			3542	protein-coding gene	gene with protein product		612309					Standard	NM_000130		Approved		uc001ggg.1	P12259	OTTHUMG00000034595	ENST00000367797.3:c.5795G>T	1.37:g.169493136C>A	ENSP00000356771:p.Trp1932Leu	135	0		254	9	NM_000130	0	0	0	0	0	A8K6E8|Q14285|Q2EHR5|Q5R346|Q5R347|Q6UPU6|Q8WWQ6	Missense_Mutation	SNP	ENST00000367797.3	37	CCDS1281.1	.	.	.	.	.	.	.	.	.	.	C	17.63	3.436127	0.62955	.	.	ENSG00000198734	ENST00000367797;ENST00000367796	D;D	0.98937	-5.25;-5.25	5.81	5.81	0.92471	Coagulation factor 5/8 C-terminal type domain (3);Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	D	0.98551	0.9516	M	0.67517	2.055	0.45554	D	0.998506	P	0.49307	0.922	P	0.54060	0.741	D	0.99150	1.0858	9	0.59425	D	0.04	-6.5618	20.0826	0.97783	0.0:1.0:0.0:0.0	.	1932	P12259	FA5_HUMAN	L	1932;1937	ENSP00000356771:W1932L;ENSP00000356770:W1937L	ENSP00000356770:W1937L	W	-	2	0	F5	167759760	1.000000	0.71417	1.000000	0.80357	0.753000	0.42808	6.987000	0.76206	2.746000	0.94184	0.655000	0.94253	TGG	.		0.373	F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083712.1	NM_000130	
FASLG	356	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	172634825	172634825	+	Missense_Mutation	SNP	C	C	T	rs80358236		TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr1:172634825C>T	ENST00000367721.2	+	4	699	c.515C>T	c.(514-516)tCt>tTt	p.S172F	FASLG_ENST00000340030.3_3'UTR	NM_000639.1	NP_000630.1	P48023	TNFL6_HUMAN	Fas ligand (TNF superfamily, member 6)	172					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell-cell signaling (GO:0007267)|cellular chloride ion homeostasis (GO:0030644)|endosomal lumen acidification (GO:0048388)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|immune response (GO:0006955)|inflammatory cell apoptotic process (GO:0006925)|necroptotic process (GO:0070266)|necroptotic signaling pathway (GO:0097527)|negative regulation of angiogenesis (GO:0016525)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|response to growth factor (GO:0070848)|response to lipopolysaccharide (GO:0032496)|retinal cell programmed cell death (GO:0046666)|signal transduction (GO:0007165)|T cell apoptotic process (GO:0070231)|transcription, DNA-templated (GO:0006351)	caveola (GO:0005901)|cytoplasmic membrane-bounded vesicle (GO:0016023)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	receptor binding (GO:0005102)			breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(12)|prostate(1)|skin(1)	19						GTCCTGCTTTCTGGAGTGAAG	0.433																																					p.S172F	Ovarian(28;486 876 30334 44033)	.											.	FASLG-618	0			c.C515T						.						136.0	120.0	126.0					1																	172634825		2203	4300	6503	SO:0001583	missense	356	exon4			TGCTTTCTGGAGT	U11821	CCDS1304.1	1q23	2014-09-17	2005-01-07	2005-01-07	ENSG00000117560	ENSG00000117560		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"", ""Endogenous ligands"""	11936	protein-coding gene	gene with protein product		134638	"""tumor necrosis factor (ligand) superfamily, member 6"""	APT1LG1, TNFSF6		7826947, 9022072	Standard	NM_000639		Approved	FasL, CD178	uc001gis.3	P48023	OTTHUMG00000034841	ENST00000367721.2:c.515C>T	1.37:g.172634825C>T	ENSP00000356694:p.Ser172Phe	81	0		139	11	NM_000639	0	0	0	0	0	Q9BZP9	Missense_Mutation	SNP	ENST00000367721.2	37	CCDS1304.1	.	.	.	.	.	.	.	.	.	.	C	17.38	3.374699	0.61735	.	.	ENSG00000117560	ENST00000367721	T	0.65732	-0.17	5.24	5.24	0.73138	Tumour necrosis factor (3);Tumour necrosis factor-like (2);	0.277042	0.34046	N	0.004302	T	0.74496	0.3724	M	0.78456	2.415	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.78064	-0.2350	10	0.72032	D	0.01	-19.152	13.9766	0.64277	0.0:0.8471:0.1529:0.0	.	172	P48023	TNFL6_HUMAN	F	172	ENSP00000356694:S172F	ENSP00000356694:S172F	S	+	2	0	FASLG	170901448	0.930000	0.31532	0.910000	0.35882	0.880000	0.50808	2.041000	0.41213	2.455000	0.83008	0.650000	0.86243	TCT	.		0.433	FASLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084276.1		
CEP350	9857	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	180044161	180044161	+	Silent	SNP	C	C	T			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr1:180044161C>T	ENST00000367607.3	+	28	5990	c.5572C>T	c.(5572-5574)Ctg>Ttg	p.L1858L		NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	1858					microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						CCATAGGTTTCTGACAAAGCG	0.438																																					p.L1858L													.	CEP350-26	0			c.C5572T						.						47.0	42.0	44.0					1																	180044161		2203	4300	6503	SO:0001819	synonymous_variant	9857	exon28			AGGTTTCTGACAA	AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.5572C>T	1.37:g.180044161C>T		21	0		34	8	NM_014810	0	0	0	0	0	O75068|Q8TDK3|Q8WY20	Silent	SNP	ENST00000367607.3	37	CCDS1336.1	.	.	.	.	.	.	.	.	.	.	C	9.568	1.120365	0.20877	.	.	ENSG00000135837	ENST00000429851	.	.	.	5.81	3.95	0.45737	.	.	.	.	.	T	0.60405	0.2266	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.58177	-0.7682	4	.	.	.	.	10.2361	0.43284	0.0:0.7933:0.0:0.2067	.	.	.	.	F	32	.	.	S	+	2	0	CEP350	178310784	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	0.989000	0.29629	1.467000	0.48044	0.591000	0.81541	TCT	.		0.438	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085315.2	NM_014810	
OR2L8	391190	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	248112585	248112585	+	Silent	SNP	G	G	A			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr1:248112585G>A	ENST00000357191.3	+	1	426	c.426G>A	c.(424-426)ctG>ctA	p.L142L	OR2L13_ENST00000366478.2_Intron	NM_001001963.1	NP_001001963.1	Q8NGY9	OR2L8_HUMAN	olfactory receptor, family 2, subfamily L, member 8 (gene/pseudogene)	142						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(3)|large_intestine(3)|lung(30)|ovary(1)|prostate(1)|skin(3)	42	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0152)			TGTGTGTGCTGATGATAACAG	0.438																																					p.L142L		.											.	OR2L8-70	0			c.G426A						.						295.0	240.0	258.0					1																	248112585		2203	4300	6503	SO:0001819	synonymous_variant	391190	exon1			TGTGCTGATGATA	BK004459	CCDS31101.1	1q44	2013-10-10	2013-10-10		ENSG00000196936	ENSG00000196936		"""GPCR / Class A : Olfactory receptors"""	15014	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily L, member 8"""				Standard	NM_001001963		Approved		uc001idt.1	Q8NGY9	OTTHUMG00000040196	ENST00000357191.3:c.426G>A	1.37:g.248112585G>A		253	0		270	24	NM_001001963	0	0	0	0	0	Q6IF03	Silent	SNP	ENST00000357191.3	37	CCDS31101.1																																																																																			.		0.438	OR2L8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096853.2		
FAM171A1	221061	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	15256140	15256140	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr10:15256140C>T	ENST00000378116.4	-	8	1453	c.1447G>A	c.(1447-1449)Gat>Aat	p.D483N	FAM171A1_ENST00000477161.1_5'Flank	NM_001010924.1	NP_001010924.1	Q5VUB5	F1711_HUMAN	family with sequence similarity 171, member A1	483						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(6)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	52						CTGTAGTCATCATTGCCCGAG	0.483																																					p.D483N		.											.	FAM171A1-138	0			c.G1447A						.						126.0	107.0	113.0					10																	15256140		2203	4300	6503	SO:0001583	missense	221061	exon8			AGTCATCATTGCC	AK022946	CCDS31154.1	10p13	2008-06-16	2008-06-16	2008-06-16	ENSG00000148468	ENSG00000148468			23522	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 38"""	C10orf38			Standard	NM_001010924		Approved	FLJ12884	uc001iob.3	Q5VUB5	OTTHUMG00000017732	ENST00000378116.4:c.1447G>A	10.37:g.15256140C>T	ENSP00000367356:p.Asp483Asn	177	0		244	27	NM_001010924	0	0	3	3	0	D3DRT9|Q32M49|Q8N4I0	Missense_Mutation	SNP	ENST00000378116.4	37	CCDS31154.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	1.660|1.660	-0.511725|-0.511725	0.04200|0.04200	.|.	.|.	ENSG00000148468|ENSG00000148468	ENST00000378116|ENST00000396781	T|.	0.33438|.	1.41|.	5.25|5.25	2.22|2.22	0.28083|0.28083	.|.	0.813268|.	0.11427|.	N|.	0.565243|.	T|T	0.38161|0.38161	0.1030|0.1030	L|L	0.54323|0.54323	1.7|1.7	0.09310|0.09310	N|N	1|1	B|.	0.02656|.	0.0|.	B|.	0.06405|.	0.002|.	T|T	0.26467|0.26467	-1.0102|-1.0102	10|6	0.32370|0.18276	T|T	0.25|0.48	-0.8277|-0.8277	7.3007|7.3007	0.26418|0.26418	0.0:0.692:0.0:0.308|0.0:0.692:0.0:0.308	.|.	483|.	Q5VUB5|.	F1711_HUMAN|.	N|I	483|482	ENSP00000367356:D483N|.	ENSP00000367356:D483N|ENSP00000380001:M482I	D|M	-|-	1|3	0|0	FAM171A1|FAM171A1	15296146|15296146	0.000000|0.000000	0.05858|0.05858	0.006000|0.006000	0.13384|0.13384	0.058000|0.058000	0.15608|0.15608	-0.109000|-0.109000	0.10840|0.10840	0.272000|0.272000	0.22027|0.22027	0.563000|0.563000	0.77884|0.77884	GAT|ATG	.		0.483	FAM171A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046984.1	XM_167709	
ANKRD30A	91074	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	37451603	37451603	+	Missense_Mutation	SNP	G	G	A	rs376283553		TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr10:37451603G>A	ENST00000602533.1	+	16	1858	c.1759G>A	c.(1759-1761)Gag>Aag	p.E587K	ANKRD30A_ENST00000361713.1_Missense_Mutation_p.E587K|ANKRD30A_ENST00000374660.1_Missense_Mutation_p.E587K			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	643					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						ATCTGCCTTCGAGGTATTTAG	0.333													.|||	1	0.000199681	0.0008	0.0	5008	,	,		17442	0.0		0.0	False		,,,				2504	0.0				p.E587K		.											.	ANKRD30A-161	0			c.G1759A						.	G	LYS/GLU	1,3617		0,1,1808	162.0	135.0	143.0		1759	-1.0	0.0	10		143	0,8130		0,0,4065	no	missense	ANKRD30A	NM_052997.2	56	0,1,5873	AA,AG,GG		0.0,0.0276,0.0085	benign	587/1342	37451603	1,11747	1809	4065	5874	SO:0001583	missense	91074	exon16			GCCTTCGAGGTAT	AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.1759G>A	10.37:g.37451603G>A	ENSP00000473551:p.Glu587Lys	164	1		254	51	NM_052997	0	0	0	0	0	Q5W025	Missense_Mutation	SNP	ENST00000602533.1	37		.	.	.	.	.	.	.	.	.	.	.	0.014	-1.579776	0.00879	2.76E-4	0.0	ENSG00000148513	ENST00000361713;ENST00000374660	T;T	0.05139	3.49;3.49	0.731	-1.01	0.10169	.	.	.	.	.	T	0.01189	0.0039	N	0.00413	-1.525	0.09310	N	1	B	0.13594	0.008	B	0.04013	0.001	T	0.44528	-0.9322	9	0.02654	T	1	.	2.925	0.05781	0.6458:0.0:0.3542:0.0	.	643	Q9BXX3	AN30A_HUMAN	K	587	ENSP00000354432:E587K;ENSP00000363792:E587K	ENSP00000354432:E587K	E	+	1	0	ANKRD30A	37491609	0.071000	0.21146	0.009000	0.14445	0.199000	0.23934	-0.207000	0.09384	-0.240000	0.09696	0.089000	0.15464	GAG	.		0.333	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000047588.2	NM_052997	
CSGALNACT2	55454	broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	43654255	43654255	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr10:43654255C>T	ENST00000374466.3	+	3	1089	c.754C>T	c.(754-756)Cgc>Tgc	p.R252C	CSGALNACT2_ENST00000374464.1_Missense_Mutation_p.R252C	NM_018590.3	NP_061060.3	Q8N6G5	CGAT2_HUMAN	chondroitin sulfate N-acetylgalactosaminyltransferase 2	252					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|chondroitin sulfate proteoglycan biosynthetic process (GO:0050650)|chondroitin sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050653)|dermatan sulfate proteoglycan biosynthetic process (GO:0050651)|dermatan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050652)|glycosaminoglycan metabolic process (GO:0030203)|proteoglycan biosynthetic process (GO:0030166)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)	acetylgalactosaminyltransferase activity (GO:0008376)|glucuronylgalactosylproteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047237)|metal ion binding (GO:0046872)			endometrium(12)|kidney(3)|large_intestine(5)|lung(16)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						GACCCTCTTCCGCCCTTTTGG	0.393																																					p.R252C													.	CSGALNACT2-69	0			c.C754T						.						98.0	93.0	95.0					10																	43654255		2203	4300	6503	SO:0001583	missense	55454	exon3			CTCTTCCGCCCTT	AF116646	CCDS7201.1	10q11.21	2013-02-19			ENSG00000169826	ENSG00000169826		"""Beta 4-glycosyltransferases"""	24292	protein-coding gene	gene with protein product	"""chondroitin beta1,4 N-acetylgalactosaminyltransferase 2"""					12446672	Standard	NM_018590		Approved	GALNACT2, MGC40204, PRO0082, GALNACT-2	uc001jan.4	Q8N6G5	OTTHUMG00000018023	ENST00000374466.3:c.754C>T	10.37:g.43654255C>T	ENSP00000363590:p.Arg252Cys	75	0		67	10	NM_018590	0	0	9	14	5	B3KWL7|Q6MZJ5|Q6MZP6|Q8TCH4|Q9P1I6	Missense_Mutation	SNP	ENST00000374466.3	37	CCDS7201.1	.	.	.	.	.	.	.	.	.	.	C	16.19	3.053268	0.55218	.	.	ENSG00000169826	ENST00000374466;ENST00000374464	T;T	0.23950	1.88;1.88	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	T	0.39226	0.1070	M	0.85630	2.765	0.80722	D	1	B;B	0.26081	0.141;0.108	B;B	0.20184	0.028;0.016	T	0.39921	-0.9590	10	0.87932	D	0	-9.3537	19.5366	0.95255	0.0:1.0:0.0:0.0	.	252;252	Q8N6G5;Q8N6G5-2	CGAT2_HUMAN;.	C	252	ENSP00000363590:R252C;ENSP00000363588:R252C	ENSP00000363588:R252C	R	+	1	0	CSGALNACT2	42974261	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.581000	0.60949	2.622000	0.88805	0.591000	0.81541	CGC	.		0.393	CSGALNACT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047693.1	NM_018590	
C10orf10	11067	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	45472882	45472882	+	Silent	SNP	G	G	A			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr10:45472882G>A	ENST00000298295.3	-	2	814	c.597C>T	c.(595-597)ctC>ctT	p.L199L	RASSF4_ENST00000472561.1_Intron|RASSF4_ENST00000340258.5_Intron|C10orf10_ENST00000496638.1_Intron|RASSF4_ENST00000334940.6_Intron|RASSF4_ENST00000374417.2_Intron	NM_007021.3	NP_008952.1	Q9NTK1	DEPP_HUMAN	chromosome 10 open reading frame 10	199						mitochondrion (GO:0005739)				lung(1)	1						AGAGTGTTCTGAGGACACTGC	0.607																																					p.L199L		.											.	C10orf10-90	0			c.C597T						.						59.0	71.0	67.0					10																	45472882		2197	4298	6495	SO:0001819	synonymous_variant	11067	exon2			TGTTCTGAGGACA	AB022718	CCDS7210.1	10q11.21	2014-07-31			ENSG00000165507	ENSG00000165507			23355	protein-coding gene	gene with protein product	"""decidual protein induced by progesterone"", ""fasting induced"", ""fat-specific expressed gene"""	611309				24530860, 19937567, 16123073	Standard	NM_007021		Approved	DEPP, FIG, Fseg	uc001jbr.4	Q9NTK1	OTTHUMG00000018063	ENST00000298295.3:c.597C>T	10.37:g.45472882G>A		153	0		100	24	NM_007021	0	0	70	92	22	B2R6A1|O94997|Q5T735|Q76MX8	Silent	SNP	ENST00000298295.3	37	CCDS7210.1																																																																																			.		0.607	C10orf10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047758.1	NM_007021	
ANK3	288	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	61830133	61830133	+	Silent	SNP	G	G	A			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr10:61830133G>A	ENST00000280772.2	-	37	10697	c.10506C>T	c.(10504-10506)ttC>ttT	p.F3502F	ANK3_ENST00000503366.1_Intron|ANK3_ENST00000355288.2_Intron|ANK3_ENST00000373827.2_Intron	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	3502					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						CCAGTGTGAAGAACTGGGCCC	0.438																																					p.F3502F		.											.	ANK3-107	0			c.C10506T						.						85.0	84.0	84.0					10																	61830133		2203	4300	6503	SO:0001819	synonymous_variant	288	exon37			TGTGAAGAACTGG	U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.10506C>T	10.37:g.61830133G>A		97	0		65	16	NM_020987	0	0	0	0	0	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Silent	SNP	ENST00000280772.2	37	CCDS7258.1																																																																																			.		0.438	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048201.4	NM_020987	
ANK3	288	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	61830689	61830689	+	Nonsense_Mutation	SNP	G	G	C			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr10:61830689G>C	ENST00000280772.2	-	37	10141	c.9950C>G	c.(9949-9951)tCa>tGa	p.S3317*	ANK3_ENST00000503366.1_Intron|ANK3_ENST00000355288.2_Intron|ANK3_ENST00000373827.2_Intron	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	3317					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						GTCATCGCTTGAATCACTGAC	0.443																																					p.S3317X		.											.	ANK3-107	0			c.C9950G						.						130.0	132.0	131.0					10																	61830689		2203	4300	6503	SO:0001587	stop_gained	288	exon37			TCGCTTGAATCAC	U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.9950C>G	10.37:g.61830689G>C	ENSP00000280772:p.Ser3317*	193	0		157	41	NM_020987	0	0	0	0	0	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Nonsense_Mutation	SNP	ENST00000280772.2	37	CCDS7258.1	.	.	.	.	.	.	.	.	.	.	G	51	17.357246	0.99884	.	.	ENSG00000151150	ENST00000280772	.	.	.	5.48	5.48	0.80851	.	0.000000	0.38326	N	0.001738	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.359	0.94428	0.0:0.0:1.0:0.0	.	.	.	.	X	3317	.	ENSP00000280772:S3317X	S	-	2	0	ANK3	61500695	1.000000	0.71417	0.256000	0.24389	0.293000	0.27360	7.876000	0.87215	2.584000	0.87258	0.561000	0.74099	TCA	.		0.443	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048201.4	NM_020987	
PRF1	5551	ucsc.edu;bcgsc.ca	37	10	72360284	72360284	+	Silent	SNP	G	G	A			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr10:72360284G>A	ENST00000441259.1	-	2	535	c.375C>T	c.(373-375)atC>atT	p.I125I	PRF1_ENST00000373209.2_Silent_p.I125I	NM_001083116.1|NM_005041.4	NP_001076585.1|NP_005032.2	P14222	PERF_HUMAN	perforin 1 (pore forming protein)	125	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				apoptotic process (GO:0006915)|cellular defense response (GO:0006968)|cytolysis (GO:0019835)|defense response to tumor cell (GO:0002357)|defense response to virus (GO:0051607)|immune response to tumor cell (GO:0002418)|protein homooligomerization (GO:0051260)|transmembrane transport (GO:0055085)	cytolytic granule (GO:0044194)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|wide pore channel activity (GO:0022829)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(1)|prostate(3)|urinary_tract(3)	23						AGTCGTTGCGGATGCTACGAG	0.627			M			"""various leukaemia, lymphoma"""	Type 2 familial hemophagocytic lymphohistiocytosis		Familial Hemophagocytic Lymphohistiocytosis																												p.I125I			yes	Rec			10	10q22	5551	perforin 1 (pore forming protein)		L	.	PRF1-578	0			c.C375T						.						48.0	45.0	46.0					10																	72360284		2203	4300	6503	SO:0001819	synonymous_variant	5551	exon2	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	GTTGCGGATGCTA	BC047695	CCDS7305.1	10q22	2014-09-17			ENSG00000180644	ENSG00000180644			9360	protein-coding gene	gene with protein product	"""Perforin"", ""perforin 1 (preforming protein)"""	170280				1505959, 2592021	Standard	NM_005041		Approved	PFP, P1, HPLH2	uc001jrf.4	P14222	OTTHUMG00000018412	ENST00000441259.1:c.375C>T	10.37:g.72360284G>A		38	0		39	6	NM_001083116	0	0	0	0	0	B2R6X4|Q59F57|Q86WX7	Silent	SNP	ENST00000441259.1	37	CCDS7305.1																																																																																			.		0.627	PRF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048517.2	NM_005041	
CHST3	9469	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	73765714	73765714	+	Missense_Mutation	SNP	C	C	G	rs374590185		TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr10:73765714C>G	ENST00000373115.4	+	2	551	c.114C>G	c.(112-114)atC>atG	p.I38M		NM_004273.4	NP_004264.2	Q7LGC8	CHST3_HUMAN	carbohydrate (chondroitin 6) sulfotransferase 3	38					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)|T cell homeostasis (GO:0043029)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	chondroitin 6-sulfotransferase activity (GO:0008459)|proteoglycan sulfotransferase activity (GO:0050698)|sulfotransferase activity (GO:0008146)			endometrium(1)|lung(5)	6						TTGTCTTCATCGAAAAGGAAA	0.478																																					p.I38M		.											.	CHST3-90	0			c.C114G						.						182.0	168.0	173.0					10																	73765714		2203	4300	6503	SO:0001583	missense	9469	exon2			CTTCATCGAAAAG	AB017915	CCDS7312.1	10q22.1	2007-03-14			ENSG00000122863	ENSG00000122863		"""Sulfotransferases, membrane-bound"""	1971	protein-coding gene	gene with protein product		603799				9883891, 9714738	Standard	NM_004273		Approved	C6ST, C6ST1	uc001jsn.3	Q7LGC8	OTTHUMG00000018431	ENST00000373115.4:c.114C>G	10.37:g.73765714C>G	ENSP00000362207:p.Ile38Met	175	0		147	9	NM_004273	0	0	3	3	0	O75099|Q52M30	Missense_Mutation	SNP	ENST00000373115.4	37	CCDS7312.1	.	.	.	.	.	.	.	.	.	.	C	16.26	3.072133	0.55646	.	.	ENSG00000122863	ENST00000373115	D	0.98044	-4.68	5.66	0.325	0.15903	.	0.000000	0.85682	D	0.000000	D	0.97445	0.9164	L	0.59436	1.845	0.47214	D	0.999359	D	0.89917	1.0	D	0.87578	0.998	D	0.95229	0.8341	10	0.87932	D	0	-10.7332	5.8588	0.18734	0.1406:0.4405:0.0:0.4189	.	38	Q7LGC8	CHST3_HUMAN	M	38	ENSP00000362207:I38M	ENSP00000362207:I38M	I	+	3	3	CHST3	73435720	0.992000	0.36948	0.997000	0.53966	0.982000	0.71751	0.179000	0.16840	-0.128000	0.11641	-1.202000	0.01658	ATC	.		0.478	CHST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048563.1	NM_004273	
CDHR1	92211	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	85956359	85956359	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr10:85956359G>A	ENST00000372117.3	+	3	353	c.250G>A	c.(250-252)Gac>Aac	p.D84N	CDHR1_ENST00000332904.3_Missense_Mutation_p.D84N	NM_033100.2	NP_149091.1	Q96JP9	CDHR1_HUMAN	cadherin-related family member 1	84	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cellular process (GO:0009987)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(21)|ovary(1)|prostate(1)|skin(1)	36						CTTTTCTGTTGACCCCACTTT	0.562																																					p.D84N		.											.	CDHR1-91	0			c.G250A						.						138.0	124.0	129.0					10																	85956359		2203	4300	6503	SO:0001583	missense	92211	exon3			TCTGTTGACCCCA	AB053448	CCDS7372.1, CCDS53548.1	10q23.1	2014-01-28	2010-01-25	2010-01-25	ENSG00000148600	ENSG00000148600		"""Cadherins / Cadherin-related"""	14550	protein-coding gene	gene with protein product		609502	"""protocadherin 21"""	PCDH21		11597768	Standard	NM_001171971		Approved	KIAA1775, CORD15, RP65	uc001kcv.3	Q96JP9	OTTHUMG00000018634	ENST00000372117.3:c.250G>A	10.37:g.85956359G>A	ENSP00000361189:p.Asp84Asn	155	0		109	66	NM_001171971	0	0	0	0	0	Q69YZ8|Q8IXY5	Missense_Mutation	SNP	ENST00000372117.3	37	CCDS7372.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.237685	0.79800	.	.	ENSG00000148600	ENST00000332904;ENST00000372117	T;T	0.62788	-0.0;-0.0	5.57	5.57	0.84162	Cadherin (5);Cadherin-like (1);	0.095350	0.64402	D	0.000001	T	0.54191	0.1843	L	0.37630	1.12	0.80722	D	1	B;B	0.30542	0.284;0.148	B;B	0.34722	0.188;0.186	T	0.53215	-0.8470	10	0.39692	T	0.17	-36.6578	12.4369	0.55604	0.0811:0.0:0.9189:0.0	.	84;84	Q96JP9-2;Q96JP9	.;CDHR1_HUMAN	N	84	ENSP00000331063:D84N;ENSP00000361189:D84N	ENSP00000331063:D84N	D	+	1	0	CDHR1	85946339	1.000000	0.71417	0.770000	0.31555	0.782000	0.44232	5.695000	0.68279	2.630000	0.89119	0.561000	0.74099	GAC	.		0.562	CDHR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049111.1	NM_033100	
CALHM1	255022	broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	105215149	105215149	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr10:105215149G>A	ENST00000329905.5	-	2	1047	c.911C>T	c.(910-912)aCg>aTg	p.T304M	CALHM2_ENST00000369788.3_5'Flank|RP11-225H22.4_ENST00000411906.1_RNA|CALHM2_ENST00000393235.1_5'Flank	NM_001001412.3	NP_001001412.3	Q8IU99	CAHM1_HUMAN	calcium homeostasis modulator 1	304					ATP transport (GO:0015867)|cation transport (GO:0006812)|protein homooligomerization (GO:0051260)|regulation of ion transmembrane transport (GO:0034765)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|identical protein binding (GO:0042802)|voltage-gated ion channel activity (GO:0005244)			large_intestine(2)|liver(1)|lung(5)|ovary(1)	9						GTGCCAGCTCGTGAGCAGCCT	0.677																																					p.T304M													.	CALHM1-91	0			c.C911T						.						67.0	52.0	57.0					10																	105215149		2203	4300	6503	SO:0001583	missense	255022	exon2			CAGCTCGTGAGCA	BC036208	CCDS7550.1	10q24.33	2008-07-02	2008-07-02	2008-07-02	ENSG00000185933	ENSG00000185933			23494	protein-coding gene	gene with protein product		612234	"""family with sequence similarity 26, member C"""	FAM26C		18585350	Standard	NM_001001412		Approved		uc001kxe.2	Q8IU99	OTTHUMG00000018991	ENST00000329905.5:c.911C>T	10.37:g.105215149G>A	ENSP00000329926:p.Thr304Met	69	0		54	18	NM_001001412	0	0	0	0	0	Q5W091	Missense_Mutation	SNP	ENST00000329905.5	37	CCDS7550.1	.	.	.	.	.	.	.	.	.	.	G	9.572	1.121186	0.20877	.	.	ENSG00000185933	ENST00000329905	T	0.18016	2.24	4.8	1.28	0.21552	.	0.231983	0.45867	D	0.000331	T	0.07728	0.0194	N	0.14661	0.345	0.26966	N	0.96569	B	0.06786	0.001	B	0.04013	0.001	T	0.18681	-1.0329	10	0.48119	T	0.1	-15.6045	2.9522	0.05865	0.0963:0.1134:0.4129:0.3775	.	304	Q8IU99	CAHM1_HUMAN	M	304	ENSP00000329926:T304M	ENSP00000329926:T304M	T	-	2	0	CALHM1	105205139	0.405000	0.25336	0.635000	0.29338	0.188000	0.23474	1.119000	0.31258	0.546000	0.28920	0.462000	0.41574	ACG	.		0.677	CALHM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050165.1	NM_001001412	
TRUB1	142940	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	116734920	116734920	+	Missense_Mutation	SNP	A	A	G			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr10:116734920A>G	ENST00000298746.3	+	8	893	c.832A>G	c.(832-834)Acc>Gcc	p.T278A		NM_139169.4	NP_631908.1	Q8WWH5	TRUB1_HUMAN	TruB pseudouridine (psi) synthase family member 1	278					pseudouridine synthesis (GO:0001522)|tRNA processing (GO:0008033)		pseudouridine synthase activity (GO:0009982)|RNA binding (GO:0003723)			breast(2)|kidney(2)|large_intestine(1)|lung(5)|urinary_tract(2)	12		Colorectal(252;0.09)|Breast(234;0.174)|Lung NSC(174;0.245)		Epithelial(162;0.00879)|all cancers(201;0.0243)		GCTGACCCGAACCAAACAGGG	0.408																																					p.T278A		.											.	TRUB1-90	0			c.A832G						.						157.0	145.0	149.0					10																	116734920		2203	4300	6503	SO:0001583	missense	142940	exon8			ACCCGAACCAAAC	AF448144	CCDS7591.1	10q25.3	2013-09-02	2013-09-02		ENSG00000165832	ENSG00000165832			16060	protein-coding gene	gene with protein product		610726	"""TruB pseudouridine (psi) synthase homolog 1 (E. coli)"""			12736709	Standard	NM_139169		Approved	PUS4	uc001lcd.3	Q8WWH5	OTTHUMG00000019094	ENST00000298746.3:c.832A>G	10.37:g.116734920A>G	ENSP00000298746:p.Thr278Ala	120	0		112	24	NM_139169	0	0	15	18	3	B2R716|Q53ES2	Missense_Mutation	SNP	ENST00000298746.3	37	CCDS7591.1	.	.	.	.	.	.	.	.	.	.	A	26.0	4.696609	0.88830	.	.	ENSG00000165832	ENST00000298746	T	0.16196	2.36	5.7	5.7	0.88788	Pseudouridine synthase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.49558	0.1564	M	0.93062	3.375	0.80722	D	1	D	0.55605	0.972	P	0.62740	0.906	T	0.61048	-0.7141	10	0.66056	D	0.02	-16.4514	14.82	0.70065	1.0:0.0:0.0:0.0	.	278	Q8WWH5	TRUB1_HUMAN	A	278	ENSP00000298746:T278A	ENSP00000298746:T278A	T	+	1	0	TRUB1	116724910	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.785000	0.85724	2.287000	0.76781	0.533000	0.62120	ACC	.		0.408	TRUB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050504.1	NM_139169	
MKI67	4288	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	129910532	129910532	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr10:129910532C>T	ENST00000368654.3	-	9	2209	c.1834G>A	c.(1834-1836)Gag>Aag	p.E612K	MKI67_ENST00000484853.1_5'UTR|MKI67_ENST00000368653.3_Missense_Mutation_p.E252K	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	612					cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				TTAGGAACCTCTGTCTGAGAT	0.488																																					p.E612K		.											.	MKI67-519	0			c.G1834A						.						111.0	102.0	105.0					10																	129910532		2203	4300	6503	SO:0001583	missense	4288	exon9			GAACCTCTGTCTG	X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.1834G>A	10.37:g.129910532C>T	ENSP00000357643:p.Glu612Lys	159	0		84	11	NM_002417	0	0	21	22	1	Q5VWH2	Missense_Mutation	SNP	ENST00000368654.3	37	CCDS7659.1	.	.	.	.	.	.	.	.	.	.	C	13.04	2.117442	0.37339	.	.	ENSG00000148773	ENST00000368654;ENST00000368653;ENST00000537609;ENST00000368652	T;T	0.01335	5.04;5.0	3.15	2.24	0.28232	.	0.534998	0.18473	N	0.140147	T	0.01592	0.0051	N	0.22421	0.69	0.09310	N	1	P;P;P	0.50528	0.73;0.936;0.61	B;P;B	0.47673	0.205;0.554;0.101	T	0.55276	-0.8166	10	0.33141	T	0.24	.	8.3147	0.32093	0.0:0.8808:0.0:0.1192	.	612;252;612	F5H4V4;P46013-2;P46013	.;.;KI67_HUMAN	K	612;252;612;187	ENSP00000357643:E612K;ENSP00000357642:E252K	ENSP00000357641:E187K	E	-	1	0	MKI67	129800522	0.000000	0.05858	0.031000	0.17742	0.069000	0.16628	0.316000	0.19469	0.889000	0.36185	0.655000	0.94253	GAG	.		0.488	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050999.1	NM_002417	
CFAP46	54777	broad.mit.edu	37	10	134648258	134648258	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr10:134648258C>T	ENST00000368586.5	-	48	6866	c.6766G>A	c.(6766-6768)Gaa>Aaa	p.E2256K	TTC40_ENST00000263170.5_Missense_Mutation_p.E417K	NM_001200049.2	NP_001186978.2														breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						TCCTTCTCTTCCACCTGCAGG	0.652																																					p.E2256K													.	.	0			c.G6766A						.						35.0	37.0	37.0					10																	134648258		2203	4300	6503	SO:0001583	missense	54777	exon48			TCTCTTCCACCTG																												ENST00000368586.5:c.6766G>A	10.37:g.134648258C>T	ENSP00000357575:p.Glu2256Lys	48	0		19	4	NM_001200049	0	0	0	0	0		Missense_Mutation	SNP	ENST00000368586.5	37	CCDS58101.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.35|10.35	1.326918|1.326918	0.24080|0.24080	.|.	.|.	ENSG00000171811|ENSG00000171811	ENST00000368586;ENST00000263170|ENST00000448925	T;T|.	0.12569|.	2.89;2.67|.	3.06|3.06	-3.77|-3.77	0.04346|0.04346	.|.	1.746980|.	0.03485|.	N|.	0.215692|.	T|.	0.32436|.	0.0829|.	L|L	0.44542|0.44542	1.39|1.39	0.09310|0.09310	N|N	1|1	B|.	0.20550|.	0.046|.	B|.	0.10450|.	0.005|.	T|.	0.34329|.	-0.9833|.	10|.	0.06494|.	T|.	0.89|.	.|.	5.7402|5.7402	0.18089|0.18089	0.0:0.2641:0.5039:0.2319|0.0:0.2641:0.5039:0.2319	.|.	417|.	Q8IYW2|.	CJ092_HUMAN|.	K|X	2256;417|24	ENSP00000357575:E2256K;ENSP00000263170:E417K|.	ENSP00000263170:E417K|.	E|W	-|-	1|3	0|0	C10orf93|C10orf93	134498248|134498248	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.008000|0.008000	0.06430|0.06430	-2.460000|-2.460000	0.00999|0.00999	-1.044000|-1.044000	0.03254|0.03254	0.313000|0.313000	0.20887|0.20887	GAA|TGG	.		0.652	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000051095.3		
MTG1	92170	broad.mit.edu;bcgsc.ca	37	10	135209677	135209677	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr10:135209677C>T	ENST00000317502.6	+	3	238	c.188C>T	c.(187-189)tCa>tTa	p.S63L	MTG1_ENST00000477902.2_Missense_Mutation_p.S22L|RP11-108K14.8_ENST00000468317.2_Missense_Mutation_p.S68L	NM_138384.2	NP_612393.2	Q9BT17	MTG1_HUMAN	mitochondrial ribosome-associated GTPase 1	63	CP-type G. {ECO:0000255|PROSITE- ProRule:PRU01058}.				GTP catabolic process (GO:0006184)|regulation of mitochondrial translation (GO:0070129)|regulation of respiratory system process (GO:0044065)|ribosome biogenesis (GO:0042254)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial ribosome (GO:0005761)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|large_intestine(5)|lung(5)|ovary(2)|skin(1)|urinary_tract(1)	15		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;1.21e-06)|all cancers(32;1.69e-06)|Epithelial(32;1.94e-06)		ATCCCACTTTCAGGCCGCAAC	0.468																																					p.S63L													.	MTG1-91	0			c.C188T						.						199.0	209.0	205.0					10																	135209677		2203	4300	6503	SO:0001583	missense	92170	exon3			CACTTTCAGGCCG		CCDS31320.1	10q26.3	2013-05-24	2013-05-24	2006-01-09	ENSG00000148824	ENSG00000148824			32159	protein-coding gene	gene with protein product			"""GTP-binding protein 7"", ""GTP-binding protein 7 (putative)"", ""mitochondrial GTPase 1 homolog (S. cerevisiae)"""	GTPBP7		12808030, 23396448	Standard	NM_138384		Approved		uc001lnd.3	Q9BT17	OTTHUMG00000166564	ENST00000317502.6:c.188C>T	10.37:g.135209677C>T	ENSP00000323047:p.Ser63Leu	368	0		233	15	NM_138384	0	0	0	0	0	Q5VWX8|Q6PIY9|Q8IYJ4|Q8NC48|Q9BVU8	Missense_Mutation	SNP	ENST00000317502.6	37	CCDS31320.1	.	.	.	.	.	.	.	.	.	.	c	29.2	4.990134	0.93106	.	.	ENSG00000254536;ENSG00000148824;ENSG00000148824;ENSG00000148824	ENST00000468317;ENST00000317502;ENST00000432508;ENST00000537620	T;T;T	0.12984	2.63;2.63;2.63	5.4	5.4	0.78164	.	4.888220	0.00424	N	0.000066	T	0.38825	0.1055	M	0.88181	2.935	0.58432	D	0.999999	P	0.36577	0.558	B	0.41723	0.365	T	0.46965	-0.9153	10	0.87932	D	0	-1.9895	16.6591	0.85236	0.0:1.0:0.0:0.0	.	63	Q9BT17	MTG1_HUMAN	L	68;63;63;22	ENSP00000436767:S68L;ENSP00000323047:S63L;ENSP00000393480:S63L	ENSP00000323047:S63L	S	+	2	0	AL360181.1;MTG1	135059667	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	6.217000	0.72218	2.535000	0.85469	0.478000	0.44815	TCA	.		0.468	MTG1-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051166.1	NM_138384	
OR51G2	81282	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	4936273	4936273	+	Silent	SNP	G	G	A			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr11:4936273G>A	ENST00000322013.3	-	1	649	c.621C>T	c.(619-621)gtC>gtT	p.V207V	MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron	NM_001005238.1	NP_001005238.1	Q8NGK0	O51G2_HUMAN	olfactory receptor, family 51, subfamily G, member 2	207						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|endometrium(1)|large_intestine(9)|lung(12)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)		TAGAGACGATGACAAACATGC	0.512																																					p.V207V													.	OR51G2-70	0			c.C621T						.						133.0	108.0	117.0					11																	4936273		2201	4298	6499	SO:0001819	synonymous_variant	81282	exon1			GACGATGACAAAC	AB065794	CCDS31365.1	11p15.4	2012-08-09			ENSG00000176893	ENSG00000176893		"""GPCR / Class A : Olfactory receptors"""	15198	protein-coding gene	gene with protein product							Standard	NM_001005238		Approved		uc001lzr.1	Q8NGK0	OTTHUMG00000066501	ENST00000322013.3:c.621C>T	11.37:g.4936273G>A		50	0		27	11	NM_001005238	0	0	0	0	0	Q6IFH7	Silent	SNP	ENST00000322013.3	37	CCDS31365.1																																																																																			.		0.512	OR51G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142174.1	NM_001005238	
IPO7	10527	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	9451343	9451343	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr11:9451343G>A	ENST00000379719.3	+	15	1856	c.1714G>A	c.(1714-1716)Gaa>Aaa	p.E572K	CTD-2371O3.2_ENST00000531111.1_RNA|SNORA23_ENST00000365128.1_RNA	NM_006391.2	NP_006382.1	O95373	IPO7_HUMAN	importin 7	572					innate immune response (GO:0045087)|protein import into nucleus (GO:0006606)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear pore (GO:0005643)	Ran GTPase binding (GO:0008536)|small GTPase regulator activity (GO:0005083)|transporter activity (GO:0005215)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(12)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				all cancers(16;8.29e-09)|Epithelial(150;4.76e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0217)		ATATAGTGAAGAAGTTACTCC	0.353																																					p.E572K		.											.	IPO7-271	0			c.G1714A						.						71.0	61.0	65.0					11																	9451343		2201	4294	6495	SO:0001583	missense	10527	exon15			AGTGAAGAAGTTA	AF098799	CCDS31425.1	11p15.3	2010-12-02	2003-03-11	2003-03-14	ENSG00000205339	ENSG00000205339		"""Importins"""	9852	protein-coding gene	gene with protein product		605586	"""RAN binding protein 7"""	RANBP7		9214382	Standard	NM_006391		Approved	Imp7	uc001mho.3	O95373	OTTHUMG00000165753	ENST00000379719.3:c.1714G>A	11.37:g.9451343G>A	ENSP00000369042:p.Glu572Lys	51	0		26	12	NM_006391	0	0	7	19	12	A6NNM5|B2R786|Q1RMF7|Q9H177|Q9NTE3	Missense_Mutation	SNP	ENST00000379719.3	37	CCDS31425.1	.	.	.	.	.	.	.	.	.	.	G	26.5	4.743031	0.89663	.	.	ENSG00000205339	ENST00000379719	T	0.44881	0.91	5.86	5.86	0.93980	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.53948	0.1828	M	0.80183	2.485	0.80722	D	1	B	0.31989	0.35	B	0.36335	0.222	T	0.55049	-0.8201	10	0.51188	T	0.08	.	20.1772	0.98182	0.0:0.0:1.0:0.0	.	572	O95373	IPO7_HUMAN	K	572	ENSP00000369042:E572K	ENSP00000369042:E572K	E	+	1	0	IPO7	9407919	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.778000	0.95560	0.655000	0.94253	GAA	.		0.353	IPO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386022.1	NM_006391	
COPB1	1315	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	14501121	14501121	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr11:14501121G>C	ENST00000249923.3	-	11	1652	c.1352C>G	c.(1351-1353)tCt>tGt	p.S451C	COPB1_ENST00000439561.2_Missense_Mutation_p.S451C|RNU7-49P_ENST00000516182.1_RNA	NM_016451.4	NP_057535.1	P53618	COPB_HUMAN	coatomer protein complex, subunit beta 1	451					COPI coating of Golgi vesicle (GO:0048205)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|viral process (GO:0016032)	COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle (GO:0005798)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	36						CTACTTGACAGATTTAATAGC	0.343																																					p.S451C		.											.	COPB1-91	0			c.C1352G						.						76.0	78.0	77.0					11																	14501121		2200	4293	6493	SO:0001583	missense	1315	exon11			TTGACAGATTTAA	BC037280	CCDS7815.1	11p15.2	2011-05-20	2006-06-30	2006-06-30	ENSG00000129083	ENSG00000129083			2231	protein-coding gene	gene with protein product		600959	"""coatomer protein complex, subunit beta"""	COPB		7982906	Standard	NM_016451		Approved		uc001mlg.2	P53618	OTTHUMG00000165824	ENST00000249923.3:c.1352C>G	11.37:g.14501121G>C	ENSP00000249923:p.Ser451Cys	134	0		100	73	NM_001144062	0	0	0	0	0	D3DQX0|Q6GTT7|Q9NTK2|Q9UNW7	Missense_Mutation	SNP	ENST00000249923.3	37	CCDS7815.1	.	.	.	.	.	.	.	.	.	.	G	31	5.070302	0.93950	.	.	ENSG00000129083	ENST00000249923;ENST00000439561;ENST00000534234	T;T;T	0.14893	2.47;2.47;2.47	5.83	5.83	0.93111	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.049398	0.85682	D	0.000000	T	0.48589	0.1508	M	0.87971	2.92	0.80722	D	1	P	0.45768	0.866	P	0.60117	0.869	T	0.47302	-0.9128	10	0.56958	D	0.05	-0.5739	20.127	0.97984	0.0:0.0:1.0:0.0	.	451	P53618	COPB_HUMAN	C	451	ENSP00000249923:S451C;ENSP00000397873:S451C;ENSP00000436383:S451C	ENSP00000249923:S451C	S	-	2	0	COPB1	14457697	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.869000	0.99810	2.775000	0.95449	0.585000	0.79938	TCT	.		0.343	COPB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386410.1	NM_016451	
RAG2	5897	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	36614896	36614896	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr11:36614896C>T	ENST00000311485.3	-	2	984	c.823G>A	c.(823-825)Ggt>Agt	p.G275S	C11orf74_ENST00000347206.4_5'Flank|C11orf74_ENST00000446510.2_5'Flank|C11orf74_ENST00000334307.5_5'Flank|RAG2_ENST00000528428.1_5'Flank|C11orf74_ENST00000534635.1_5'Flank	NM_000536.3|NM_001243785.1|NM_001243786.1	NP_000527.2|NP_001230714.1|NP_001230715.1	P55895	RAG2_HUMAN	recombination activating gene 2	275					B cell differentiation (GO:0030183)|chromatin modification (GO:0016568)|pre-B cell allelic exclusion (GO:0002331)|T cell differentiation in thymus (GO:0033077)|V(D)J recombination (GO:0033151)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(18)|ovary(1)|pancreas(2)|prostate(1)|skin(4)	32	all_lung(20;0.226)	all_hematologic(20;0.00756)				TGATAGCCACCAACAATAACA	0.428									Familial Hemophagocytic Lymphohistiocytosis																												p.G275S		.											.	RAG2-95	0			c.G823A						.						86.0	87.0	86.0					11																	36614896		2202	4298	6500	SO:0001583	missense	5897	exon3	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	AGCCACCAACAAT	AF080577	CCDS7903.1	11p13	2014-09-17				ENSG00000175097			9832	protein-coding gene	gene with protein product		179616				1283330	Standard	NM_000536		Approved		uc001mwv.4	P55895		ENST00000311485.3:c.823G>A	11.37:g.36614896C>T	ENSP00000308620:p.Gly275Ser	98	0		44	22	NM_001243785	0	0	0	0	0	A8K9E9|Q8TBL4	Missense_Mutation	SNP	ENST00000311485.3	37	CCDS7903.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.473990	0.84640	.	.	ENSG00000175097	ENST00000311485	D	0.93906	-3.31	5.69	5.69	0.88448	Galactose oxidase/kelch, beta-propeller (1);	0.000000	0.85682	D	0.000000	D	0.98027	0.9350	H	0.96048	3.76	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98794	1.0737	10	0.87932	D	0	-12.4322	19.8052	0.96529	0.0:1.0:0.0:0.0	.	275	P55895	RAG2_HUMAN	S	275	ENSP00000308620:G275S	ENSP00000308620:G275S	G	-	1	0	RAG2	36571472	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.487000	0.81328	2.692000	0.91855	0.650000	0.86243	GGT	.		0.428	RAG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389536.1	NM_000536	
OR9G1	390174	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	56468116	56468116	+	Missense_Mutation	SNP	A	A	G			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr11:56468116A>G	ENST00000312153.1	+	1	253	c.253A>G	c.(253-255)Atc>Gtc	p.I85V		NM_001005213.1	NP_001005213.1	Q8NH87	OR9G1_HUMAN	olfactory receptor, family 9, subfamily G, member 1	85						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|kidney(1)|lung(25)|stomach(2)|upper_aerodigestive_tract(1)	31						AGTGACCTGCATCTCTGAAGA	0.507																																					p.I85V		.											.	.	0			c.A253G						.						127.0	124.0	125.0					11																	56468116		2201	4293	6494	SO:0001583	missense	504191	exon1			ACCTGCATCTCTG	AB065500	CCDS31536.1	11q11	2012-08-09			ENSG00000174914	ENSG00000174914		"""GPCR / Class A : Olfactory receptors"""	15319	protein-coding gene	gene with protein product				OR9G5			Standard	NM_001005213		Approved			Q8NH87	OTTHUMG00000167112	ENST00000312153.1:c.253A>G	11.37:g.56468116A>G	ENSP00000309012:p.Ile85Val	191	0		174	22	NM_001013358	0	0	0	0	0	Q6IEU9|Q8NGQ0	Missense_Mutation	SNP	ENST00000312153.1	37	CCDS31536.1	.	.	.	.	.	.	.	.	.	.	A	0.852	-0.738253	0.03111	.	.	ENSG00000174914	ENST00000312153	T	0.02236	4.38	4.54	4.54	0.55810	GPCR, rhodopsin-like superfamily (1);	0.251802	0.29178	N	0.012920	T	0.01661	0.0053	N	0.15975	0.35	0.24579	N	0.993886	B	0.06786	0.001	B	0.10450	0.005	T	0.48592	-0.9022	10	0.19590	T	0.45	-19.0486	10.2627	0.43436	0.721:0.279:0.0:0.0	.	85	Q8NH87	OR9G1_HUMAN	V	85	ENSP00000309012:I85V	ENSP00000309012:I85V	I	+	1	0	OR9G1	56224692	0.000000	0.05858	0.995000	0.50966	0.171000	0.22731	-0.467000	0.06664	2.013000	0.59113	0.477000	0.44152	ATC	.		0.507	OR9G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393253.1	NM_001005213	
LPXN	9404	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	58295114	58295114	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr11:58295114C>T	ENST00000395074.2	-	9	1062	c.974G>A	c.(973-975)cGg>cAg	p.R325Q	LPXN_ENST00000528954.1_Missense_Mutation_p.R330Q|LPXN_ENST00000528489.1_Missense_Mutation_p.R305Q	NM_004811.2	NP_004802.1	O60711	LPXN_HUMAN	leupaxin	325	LIM zinc-binding 3. {ECO:0000255|PROSITE- ProRule:PRU00125}.				cell adhesion (GO:0007155)|negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of cell adhesion (GO:0007162)|protein complex assembly (GO:0006461)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|podosome (GO:0002102)	transcription cofactor activity (GO:0003712)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14		Breast(21;0.00725)|all_epithelial(135;0.0101)|all_lung(304;0.24)				GAGCGTTCCCCGGCGGTGATG	0.542																																					p.R330Q													.	LPXN-91	0			c.G989A						.						77.0	67.0	70.0					11																	58295114		2201	4295	6496	SO:0001583	missense	9404	exon9			GTTCCCCGGCGGT	AF062075	CCDS7969.1, CCDS53635.1	11q12.1	2013-09-20			ENSG00000110031	ENSG00000110031			14061	protein-coding gene	gene with protein product		605390				9565592	Standard	NM_004811		Approved	LDPL	uc001nmw.3	O60711	OTTHUMG00000167466	ENST00000395074.2:c.974G>A	11.37:g.58295114C>T	ENSP00000378512:p.Arg325Gln	68	0		38	6	NM_001143995	0	0	3	4	1	B2R8B4|B4DV71|Q53FW6|Q6FI07	Missense_Mutation	SNP	ENST00000395074.2	37	CCDS7969.1	.	.	.	.	.	.	.	.	.	.	C	19.74	3.883091	0.72410	.	.	ENSG00000110031	ENST00000528954;ENST00000395074	D;D	0.87029	-2.2;-2.2	6.03	2.1	0.27182	Zinc finger, LIM-type (2);	0.221957	0.39274	N	0.001420	T	0.70842	0.3270	N	0.02973	-0.45	0.44042	D	0.996771	P;B;B	0.36990	0.577;0.097;0.25	B;B;B	0.40038	0.317;0.013;0.089	T	0.68750	-0.5326	10	0.38643	T	0.18	.	9.295	0.37811	0.0:0.6642:0.0:0.3358	.	305;330;325	B7Z5P7;B4DV71;O60711	.;.;LPXN_HUMAN	Q	330;325	ENSP00000431284:R330Q;ENSP00000378512:R325Q	ENSP00000378512:R325Q	R	-	2	0	LPXN	58051690	0.002000	0.14202	0.998000	0.56505	0.756000	0.42949	0.015000	0.13355	0.885000	0.36088	0.557000	0.71058	CGG	.		0.542	LPXN-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000394709.1	NM_004811	
OR4D11	219986	hgsc.bcm.edu;broad.mit.edu	37	11	59271133	59271133	+	Missense_Mutation	SNP	C	C	G			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr11:59271133C>G	ENST00000313253.1	+	1	85	c.85C>G	c.(85-87)Ctt>Gtt	p.L29V		NM_001004706.1	NP_001004706.1	Q8NGI4	OR4DB_HUMAN	olfactory receptor, family 4, subfamily D, member 11	29						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(3)|liver(2)|lung(17)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	29						GGTCTTGTTTCTTTTTTTATG	0.433																																					p.L29V		.											.	OR4D11-70	0			c.C85G						.						103.0	96.0	98.0					11																	59271133		2201	4295	6496	SO:0001583	missense	219986	exon1			TTGTTTCTTTTTT	AB065810	CCDS31563.1	11q12.1	2012-08-09		2004-03-10	ENSG00000176200	ENSG00000176200		"""GPCR / Class A : Olfactory receptors"""	15174	protein-coding gene	gene with protein product				OR4D11P			Standard	NM_001004706		Approved		uc001noa.1	Q8NGI4	OTTHUMG00000167342	ENST00000313253.1:c.85C>G	11.37:g.59271133C>G	ENSP00000320077:p.Leu29Val	181	0		99	5	NM_001004706	0	0	0	0	0		Missense_Mutation	SNP	ENST00000313253.1	37	CCDS31563.1	.	.	.	.	.	.	.	.	.	.	C	0	-2.816889	0.00072	.	.	ENSG00000176200	ENST00000313253	T	0.00418	7.49	5.45	-1.74	0.08056	.	0.332667	0.21503	N	0.073498	T	0.00144	0.0004	N	0.16233	0.39	0.20638	N	0.999875	B	0.02656	0.0	B	0.06405	0.002	T	0.46176	-0.9210	10	0.02654	T	1	-9.7981	2.6212	0.04917	0.2091:0.3651:0.287:0.1389	.	29	Q8NGI4	OR4DB_HUMAN	V	29	ENSP00000320077:L29V	ENSP00000320077:L29V	L	+	1	0	OR4D11	59027709	0.000000	0.05858	0.184000	0.23157	0.091000	0.18340	-1.215000	0.02985	-0.006000	0.14370	-0.311000	0.09066	CTT	.		0.433	OR4D11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394236.1	NM_001004706	
GSTP1	2950	ucsc.edu	37	11	67352042	67352042	+	Splice_Site	SNP	G	G	C			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr11:67352042G>C	ENST00000398606.3	+	3	393		c.e3+1		GSTP1_ENST00000498765.1_Splice_Site|GSTP1_ENST00000398603.1_Splice_Site	NM_000852.3	NP_000843.1	P09211	GSTP1_HUMAN	glutathione S-transferase pi 1						cellular response to lipopolysaccharide (GO:0071222)|central nervous system development (GO:0007417)|common myeloid progenitor cell proliferation (GO:0035726)|glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of apoptotic process (GO:0043066)|negative regulation of biosynthetic process (GO:0009890)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of leukocyte proliferation (GO:0070664)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of monocyte chemotactic protein-1 production (GO:0071638)|negative regulation of nitric-oxide synthase biosynthetic process (GO:0051771)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|nitric oxide storage (GO:0035732)|positive regulation of superoxide anion generation (GO:0032930)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of stress-activated MAPK cascade (GO:0032872)|response to reactive oxygen species (GO:0000302)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|TRAF2-GSTP1 complex (GO:0097057)|vesicle (GO:0031982)	dinitrosyl-iron complex binding (GO:0035731)|glutathione transferase activity (GO:0004364)|JUN kinase binding (GO:0008432)|kinase regulator activity (GO:0019207)|nitric oxide binding (GO:0070026)|S-nitrosoglutathione binding (GO:0035730)			central_nervous_system(1)|cervix(1)|endometrium(4)|lung(2)|ovary(1)	9					Busulfan(DB01008)|Carboplatin(DB00958)|Chlorambucil(DB00291)|Cisplatin(DB00515)|Clomipramine(DB01242)|Etoposide(DB00773)|Glutathione(DB00143)|Oxaliplatin(DB00526)|Vitamin E(DB00163)	AGCCTCCTGCGTAAGTGACCA	0.672																																					.													.	GSTP1-91	0			c.144+1G>C						.						14.0	18.0	17.0					11																	67352042		1959	4140	6099	SO:0001630	splice_region_variant	2950	exon3			TCCTGCGTAAGTG	U12472	CCDS41679.1	11q13.2	2014-09-17	2008-07-18		ENSG00000084207	ENSG00000084207	2.5.1.18	"""Glutathione S-transferases / Soluble"""	4638	protein-coding gene	gene with protein product		134660		FAEES3, GST3		1885604, 7587384, 19915149	Standard	NM_000852		Approved	GSTP	uc001omf.3	P09211	OTTHUMG00000137430	ENST00000398606.3:c.144+1G>C	11.37:g.67352042G>C		43	0		61	1	NM_000852	0	0	12	12	0	O00460|Q15690|Q5TZY3	Splice_Site	SNP	ENST00000398606.3	37	CCDS41679.1	.	.	.	.	.	.	.	.	.	.	G	15.36	2.811907	0.50527	.	.	ENSG00000084207	ENST00000398606;ENST00000398603	.	.	.	5.35	5.35	0.76521	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.5527	0.68078	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GSTP1	67108618	1.000000	0.71417	0.998000	0.56505	0.369000	0.29798	4.707000	0.61852	2.505000	0.84491	0.561000	0.74099	.	.		0.672	GSTP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268504.1	NM_000852	Intron
LRP5	4041	broad.mit.edu;bcgsc.ca	37	11	68197137	68197137	+	Silent	SNP	C	C	T	rs556919142		TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr11:68197137C>T	ENST00000294304.7	+	17	3838	c.3732C>T	c.(3730-3732)ctC>ctT	p.L1244L		NM_002335.2	NP_002326.2	O75197	LRP5_HUMAN	low density lipoprotein receptor-related protein 5	1244	EGF-like 4.				adipose tissue development (GO:0060612)|anatomical structure regression (GO:0060033)|anterior/posterior pattern specification (GO:0009952)|apoptotic process involved in patterning of blood vessels (GO:1902262)|bone marrow development (GO:0048539)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|cell migration involved in gastrulation (GO:0042074)|cell-cell signaling involved in mammary gland development (GO:0060764)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic limb morphogenesis (GO:0030326)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocytosis (GO:0006897)|extracellular matrix-cell signaling (GO:0035426)|gastrulation with mouth forming second (GO:0001702)|glucose catabolic process (GO:0006007)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|osteoblast development (GO:0002076)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of mitosis (GO:0045840)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of bone remodeling (GO:0046850)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|response to peptide hormone (GO:0043434)|retina morphogenesis in camera-type eye (GO:0060042)|retinal blood vessel morphogenesis (GO:0061304)|somatic stem cell maintenance (GO:0035019)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	coreceptor activity (GO:0015026)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			autonomic_ganglia(1)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(24)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						CAGTCCACCTCGTGCTCCTGC	0.592													C|||	1	0.000199681	0.0	0.0	5008	,	,		21123	0.0		0.0	False		,,,				2504	0.001				p.L1244L													.	LRP5-661	0			c.C3732T						.						147.0	108.0	122.0					11																	68197137		2200	4294	6494	SO:0001819	synonymous_variant	4041	exon17			CCACCTCGTGCTC	AF064548	CCDS8181.1	11q13.4	2014-01-28	2003-03-12		ENSG00000162337	ENSG00000162337		"""Low density lipoprotein receptors"""	6697	protein-coding gene	gene with protein product		603506	"""osteoporosis pseudoglioma syndrome"", ""exudative vitreoretinopathy 1"""	LRP7, OPPG, EVR1		9714764, 10049586	Standard	XM_005273994		Approved	LR3, BMND1, HBM, OPS, OPTA1, VBCH2, EVR4	uc001ont.3	O75197	OTTHUMG00000167570	ENST00000294304.7:c.3732C>T	11.37:g.68197137C>T		128	0		502	19	NM_002335	0	0	333	340	7	Q96TD6|Q9UES7|Q9UP66	Silent	SNP	ENST00000294304.7	37	CCDS8181.1																																																																																			.		0.592	LRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395088.1	NM_002335	
NARS2	79731	hgsc.bcm.edu	37	11	78154732	78154732	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr11:78154732G>C	ENST00000281038.5	-	12	1612	c.1237C>G	c.(1237-1239)Cat>Gat	p.H413D	NARS2_ENST00000528850.1_Missense_Mutation_p.H186D|RP11-452H21.1_ENST00000534168.1_RNA	NM_001243251.1|NM_024678.5	NP_001230180.1|NP_078954.4	Q96I59	SYNM_HUMAN	asparaginyl-tRNA synthetase 2, mitochondrial (putative)	413					asparaginyl-tRNA aminoacylation (GO:0006421)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrion (GO:0005739)	asparagine-tRNA ligase activity (GO:0004816)|ATP binding (GO:0005524)|nucleic acid binding (GO:0003676)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(9)|ovary(2)|prostate(2)|skin(1)	27	all_cancers(14;2.63e-17)|all_epithelial(13;1.85e-19)				L-Asparagine(DB00174)	TCTAAGAAATGGTATCGTTCT	0.423																																					p.H413D		.											.	NARS2-92	0			c.C1237G						.						96.0	91.0	93.0					11																	78154732		2200	4292	6492	SO:0001583	missense	79731	exon12			AGAAATGGTATCG	BC007800	CCDS8261.1, CCDS58164.1	11q14.1	2011-07-01	2007-02-23		ENSG00000137513	ENSG00000137513	6.1.1.22	"""Aminoacyl tRNA synthetases / Class II"""	26274	protein-coding gene	gene with protein product	"""asparagine tRNA ligase 2, mitochondrial (putative)"""	612803				15779907	Standard	NM_024678		Approved	FLJ23441, SLM5	uc001ozi.3	Q96I59	OTTHUMG00000166702	ENST00000281038.5:c.1237C>G	11.37:g.78154732G>C	ENSP00000281038:p.His413Asp	81	0		73	4	NM_024678	0	0	7	7	0	G3V178	Missense_Mutation	SNP	ENST00000281038.5	37	CCDS8261.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.65|15.65	2.895206|2.895206	0.52121|0.52121	.|.	.|.	ENSG00000137513|ENSG00000137513	ENST00000281038;ENST00000528850|ENST00000529771	T;T|.	0.77229|.	-1.08;-1.08|.	4.96|4.96	4.96|4.96	0.65561|0.65561	Aminoacyl-tRNA synthetase, class II (1);Aminoacyl-tRNA synthetase, class II (D/K/N) (1);|.	0.189082|.	0.56097|.	D|.	0.000031|.	T|T	0.10551|0.10551	0.0258|0.0258	N|N	0.00106|0.00106	-2.12|-2.12	0.35491|0.35491	D|D	0.798978|0.798978	B|.	0.06786|.	0.001|.	B|.	0.10450|.	0.005|.	T|T	0.29579|0.29579	-1.0007|-1.0007	10|5	0.02654|.	T|.	1|.	-6.0659|-6.0659	15.1595|15.1595	0.72771|0.72771	0.0:0.1415:0.8585:0.0|0.0:0.1415:0.8585:0.0	.|.	413|.	Q96I59|.	SYNM_HUMAN|.	D|R	413;186|25	ENSP00000281038:H413D;ENSP00000432635:H186D|.	ENSP00000281038:H413D|.	H|P	-|-	1|2	0|0	NARS2|NARS2	77832380|77832380	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.992000|0.992000	0.81027|0.81027	2.432000|2.432000	0.44784|0.44784	2.734000|2.734000	0.93682|0.93682	0.591000|0.591000	0.81541|0.81541	CAT|CCA	.		0.423	NARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391138.2	NM_024678	
FAM181B	220382	broad.mit.edu	37	11	82444012	82444012	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr11:82444012C>T	ENST00000329203.3	-	1	894	c.760G>A	c.(760-762)Gac>Aac	p.D254N		NM_175885.3	NP_787081.2	A6NEQ2	F181B_HUMAN	family with sequence similarity 181, member B	254	Gly-rich.									large_intestine(1)|lung(2)|prostate(1)	4						TTCTCCAGGTCGCCCAAGCTC	0.731																																					p.D254N													.	FAM181B-135	0			c.G760A						.						5.0	6.0	5.0					11																	82444012		1957	3912	5869	SO:0001583	missense	220382	exon1			CCAGGTCGCCCAA	AK095054, BC039262	CCDS31648.1	11q14.1	2011-11-30			ENSG00000182103	ENSG00000182103			28512	protein-coding gene	gene with protein product						12477932	Standard	NM_175885		Approved	LOC220382, MGC33846	uc001ozp.3	A6NEQ2	OTTHUMG00000166869	ENST00000329203.3:c.760G>A	11.37:g.82444012C>T	ENSP00000365295:p.Asp254Asn	19	0		10	4	NM_175885	0	0	1	1	0	B2RWP1	Missense_Mutation	SNP	ENST00000329203.3	37	CCDS31648.1	.	.	.	.	.	.	.	.	.	.	C	31	5.087202	0.94100	.	.	ENSG00000182103	ENST00000329203	T	0.33654	1.4	4.36	4.36	0.52297	.	0.175158	0.37906	U	0.001900	T	0.42177	0.1191	L	0.29908	0.895	0.43885	D	0.996506	D	0.71674	0.998	P	0.57548	0.823	T	0.23655	-1.0182	9	.	.	.	.	16.4743	0.84128	0.0:1.0:0.0:0.0	.	254	A6NEQ2	F181B_HUMAN	N	254	ENSP00000365295:D254N	.	D	-	1	0	FAM181B	82121660	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	4.269000	0.58890	1.969000	0.57287	0.462000	0.41574	GAC	.		0.731	FAM181B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391626.1	NM_175885	
CREBZF	58487	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	85375684	85375684	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr11:85375684G>A	ENST00000527447.1	-	1	462	c.236C>T	c.(235-237)tCc>tTc	p.S79F	CREBZF_ENST00000398294.2_5'UTR|CREBZF_ENST00000534224.1_Intron|CREBZF_ENST00000531515.1_Intron	NM_001039618.2	NP_001034707.1	Q9NS37	ZHANG_HUMAN	CREB/ATF bZIP transcription factor	79					negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|response to virus (GO:0009615)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	9		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)				CTCCTCGGGGGAGGGCGCGCG	0.701																																					p.S79F	NSCLC(172;674 2044 9050 18334 41735)	.											.	CREBZF-91	0			c.C236T						.						35.0	42.0	40.0					11																	85375684		1861	4083	5944	SO:0001583	missense	58487	exon1			TCGGGGGAGGGCG	AF039942	CCDS41697.1	11q14.1	2013-01-10			ENSG00000137504	ENSG00000137504		"""basic leucine zipper proteins"""	24905	protein-coding gene	gene with protein product	"""Zhangfei"""	606444				10871379	Standard	NM_001039618		Approved	ZF	uc001pas.2	Q9NS37	OTTHUMG00000133648	ENST00000527447.1:c.236C>T	11.37:g.85375684G>A	ENSP00000433459:p.Ser79Phe	151	0		78	41	NM_001039618	0	0	4	14	10	B2R8Q9|Q0P5U9|Q52LT3	Missense_Mutation	SNP	ENST00000527447.1	37	CCDS41697.1	.	.	.	.	.	.	.	.	.	.	G	14.77	2.635626	0.47049	.	.	ENSG00000137504	ENST00000527447	.	.	.	3.72	3.72	0.42706	.	0.000000	0.33217	U	0.005143	T	0.29749	0.0743	N	0.08118	0	0.80722	D	1	B	0.31910	0.346	B	0.35550	0.205	T	0.09443	-1.0674	8	.	.	.	-19.421	8.7689	0.34719	0.0:0.0:0.7748:0.2252	.	79	Q9NS37	ZHANG_HUMAN	F	79	.	.	S	-	2	0	CREBZF	85053332	0.998000	0.40836	0.998000	0.56505	0.982000	0.71751	2.082000	0.41605	2.068000	0.61886	0.561000	0.74099	TCC	.		0.701	CREBZF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390191.2	NM_001039618	
MTMR2	8898	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	95621408	95621408	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr11:95621408G>A	ENST00000346299.5	-	2	438	c.98C>T	c.(97-99)tCa>tTa	p.S33L	MTMR2_ENST00000409459.1_5'UTR|MTMR2_ENST00000484818.1_5'UTR|MTMR2_ENST00000352297.7_5'UTR|MTMR2_ENST00000393223.3_5'UTR	NM_016156.5	NP_057240.3	Q13614	MTMR2_HUMAN	myotubularin related protein 2	33	Ser-rich.				cell death (GO:0008219)|dendritic spine maintenance (GO:0097062)|inositol phosphate dephosphorylation (GO:0046855)|myelin assembly (GO:0032288)|negative regulation of endocytosis (GO:0045806)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of myelination (GO:0031642)|negative regulation of receptor catabolic process (GO:2000645)|negative regulation of receptor internalization (GO:0002091)|neuron development (GO:0048666)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of early endosome to late endosome transport (GO:2000643)|protein dephosphorylation (GO:0006470)|protein tetramerization (GO:0051262)|small molecule metabolic process (GO:0044281)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endosome (GO:0005768)|neuronal postsynaptic density (GO:0097481)|nucleus (GO:0005634)|synaptic membrane (GO:0097060)|synaptic vesicle (GO:0008021)|vacuolar membrane (GO:0005774)	phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity (GO:0052629)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	19		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				TGAATTCTCTGAATGAGAAGT	0.358																																					p.S33L													.	MTMR2-91	0			c.C98T						.						75.0	71.0	72.0					11																	95621408		2201	4298	6499	SO:0001583	missense	8898	exon2			TTCTCTGAATGAG	U58033	CCDS8305.1, CCDS8306.1	11q22	2014-09-17			ENSG00000087053	ENSG00000087053		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7450	protein-coding gene	gene with protein product		603557		CMT4B		8640223, 9736772	Standard	NM_016156		Approved	KIAA1073	uc001pfu.3	Q13614	OTTHUMG00000153837	ENST00000346299.5:c.98C>T	11.37:g.95621408G>A	ENSP00000345752:p.Ser33Leu	29	0		19	7	NM_016156	0	0	3	7	4	A6NN98|Q9UPS9	Missense_Mutation	SNP	ENST00000346299.5	37	CCDS8305.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.348120	0.82132	.	.	ENSG00000087053	ENST00000346299;ENST00000546018	D	0.95069	-3.6	5.81	5.81	0.92471	.	0.282561	0.35291	N	0.003307	D	0.94185	0.8134	L	0.32530	0.975	0.80722	D	1	P;D	0.54601	0.791;0.967	B;P	0.60789	0.15;0.879	D	0.91270	0.5043	10	0.12103	T	0.63	.	16.9897	0.86350	0.0:0.0:1.0:0.0	.	33;33	A8K5G2;Q13614	.;MTMR2_HUMAN	L	33;16	ENSP00000345752:S33L	ENSP00000345752:S33L	S	-	2	0	MTMR2	95261056	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	5.703000	0.68340	2.750000	0.94351	0.655000	0.94253	TCA	.		0.358	MTMR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332620.1	NM_016156	
YAP1	10413	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	102080284	102080284	+	Missense_Mutation	SNP	C	C	G			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr11:102080284C>G	ENST00000282441.5	+	6	1409	c.1021C>G	c.(1021-1023)Cca>Gca	p.P341A	YAP1_ENST00000531439.1_Intron|YAP1_ENST00000526343.1_Intron|YAP1_ENST00000537274.1_Intron|YAP1_ENST00000524575.1_Missense_Mutation_p.P163A|YAP1_ENST00000345877.2_Intron	NM_001130145.2|NM_001282101.1	NP_001123617.1|NP_001269030.1	P46937	YAP1_HUMAN	Yes-associated protein 1	341	Transactivation domain.				cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|contact inhibition (GO:0060242)|embryonic heart tube morphogenesis (GO:0003143)|gene expression (GO:0010467)|hippo signaling (GO:0035329)|keratinocyte differentiation (GO:0030216)|lateral mesoderm development (GO:0048368)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|notochord development (GO:0030903)|paraxial mesoderm development (GO:0048339)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell proliferation (GO:0008284)|positive regulation of organ growth (GO:0046622)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of keratinocyte proliferation (GO:0010837)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)|regulation of stem cell proliferation (GO:0072091)|somatic stem cell maintenance (GO:0035019)|transcription initiation from RNA polymerase II promoter (GO:0006367)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|large_intestine(1)|lung(1)|ovary(1)	4	all_cancers(8;0.000575)|all_epithelial(12;0.00564)	Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.00936)	Lung(13;0.245)	BRCA - Breast invasive adenocarcinoma(274;0.0189)		AGCAAATTCTCCAAAATGTCA	0.368																																					p.P341A	Colon(50;247 1103 7861 28956)	.											.	YAP1-659	0			c.C1021G						.						142.0	126.0	131.0					11																	102080284		1568	3581	5149	SO:0001583	missense	10413	exon6			AATTCTCCAAAAT		CCDS8314.1, CCDS44716.1, CCDS8314.2, CCDS53699.1, CCDS53700.1, CCDS60944.1, CCDS73373.1, CCDS73374.1	11q13	2010-03-19	2010-03-19		ENSG00000137693	ENSG00000137693			16262	protein-coding gene	gene with protein product		606608	"""Yes-associated protein 1, 65kDa"""			7782338	Standard	NM_001130145		Approved	YAP65	uc001pgt.3	P46937	OTTHUMG00000167322	ENST00000282441.5:c.1021C>G	11.37:g.102080284C>G	ENSP00000282441:p.Pro341Ala	139	0		114	62	NM_001130145	0	0	0	2	2	B4DTY1|B7ZA01|E3WEB5|E3WEB6|E9PRV2|F5H202|K0KQ18|K0KYZ8|K0L195|K0L1G3|Q7Z574|Q8IUY9	Missense_Mutation	SNP	ENST00000282441.5	37	CCDS44716.1	.	.	.	.	.	.	.	.	.	.	C	16.49	3.138326	0.56936	.	.	ENSG00000137693	ENST00000282441;ENST00000445250;ENST00000524575	T	0.39592	1.07	6.17	6.17	0.99709	.	0.226095	0.38720	N	0.001598	T	0.46386	0.1390	N	0.08118	0	0.80722	D	1	D;D;D	0.69078	0.993;0.996;0.997	D;D;D	0.73708	0.956;0.981;0.98	T	0.49399	-0.8944	10	0.35671	T	0.21	.	19.0599	0.93085	0.0:1.0:0.0:0.0	.	163;258;341	B4DTY1;F5GWC5;P46937	.;.;YAP1_HUMAN	A	341;258;163	ENSP00000435602:P163A	ENSP00000282441:P341A	P	+	1	0	YAP1	101585494	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.770000	0.62309	2.941000	0.99782	0.655000	0.94253	CCA	.		0.368	YAP1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000394151.1	NM_006106	
YAP1	10413	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	102098224	102098224	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr11:102098224G>C	ENST00000282441.5	+	8	1576	c.1188G>C	c.(1186-1188)gaG>gaC	p.E396D	YAP1_ENST00000531439.1_Missense_Mutation_p.E380D|YAP1_ENST00000526343.1_Missense_Mutation_p.E342D|YAP1_ENST00000537274.1_Missense_Mutation_p.E384D|YAP1_ENST00000524575.1_Missense_Mutation_p.E218D|YAP1_ENST00000528834.1_3'UTR|YAP1_ENST00000345877.2_Missense_Mutation_p.E346D|RP11-864G5.3_ENST00000526310.1_RNA	NM_001130145.2|NM_001282101.1	NP_001123617.1|NP_001269030.1	P46937	YAP1_HUMAN	Yes-associated protein 1	396	Transactivation domain.				cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|contact inhibition (GO:0060242)|embryonic heart tube morphogenesis (GO:0003143)|gene expression (GO:0010467)|hippo signaling (GO:0035329)|keratinocyte differentiation (GO:0030216)|lateral mesoderm development (GO:0048368)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|notochord development (GO:0030903)|paraxial mesoderm development (GO:0048339)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell proliferation (GO:0008284)|positive regulation of organ growth (GO:0046622)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of keratinocyte proliferation (GO:0010837)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)|regulation of stem cell proliferation (GO:0072091)|somatic stem cell maintenance (GO:0035019)|transcription initiation from RNA polymerase II promoter (GO:0006367)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|large_intestine(1)|lung(1)|ovary(1)	4	all_cancers(8;0.000575)|all_epithelial(12;0.00564)	Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.00936)	Lung(13;0.245)	BRCA - Breast invasive adenocarcinoma(274;0.0189)		CTCGAGATGAGAGTACAGACA	0.408																																					p.E396D	Colon(50;247 1103 7861 28956)	.											.	YAP1-659	0			c.G1188C						.						155.0	119.0	131.0					11																	102098224		2203	4299	6502	SO:0001583	missense	10413	exon8			AGATGAGAGTACA		CCDS8314.1, CCDS44716.1, CCDS8314.2, CCDS53699.1, CCDS53700.1, CCDS60944.1, CCDS73373.1, CCDS73374.1	11q13	2010-03-19	2010-03-19		ENSG00000137693	ENSG00000137693			16262	protein-coding gene	gene with protein product		606608	"""Yes-associated protein 1, 65kDa"""			7782338	Standard	NM_001130145		Approved	YAP65	uc001pgt.3	P46937	OTTHUMG00000167322	ENST00000282441.5:c.1188G>C	11.37:g.102098224G>C	ENSP00000282441:p.Glu396Asp	60	0		50	12	NM_001130145	0	0	46	62	16	B4DTY1|B7ZA01|E3WEB5|E3WEB6|E9PRV2|F5H202|K0KQ18|K0KYZ8|K0L195|K0L1G3|Q7Z574|Q8IUY9	Missense_Mutation	SNP	ENST00000282441.5	37	CCDS44716.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.43|19.43	3.825846|3.825846	0.71143|0.71143	.|.	.|.	ENSG00000137693|ENSG00000137693	ENST00000526343;ENST00000282441;ENST00000537274;ENST00000345877;ENST00000445250;ENST00000531439;ENST00000524575|ENST00000529029	T;T;T|.	0.56103|.	0.48;0.5;0.6|.	5.28|5.28	1.34|1.34	0.21922|0.21922	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.61527|0.61527	0.2354|0.2354	M|M	0.65975|0.65975	2.015|2.015	0.48632|0.48632	D|D	0.999686|0.999686	P;D;D;D;D;D|.	0.71674|.	0.956;0.998;0.991;0.97;0.991;0.998|.	D;D;P;P;P;P|.	0.68353|.	0.931;0.957;0.82;0.774;0.82;0.875|.	T|T	0.55354|0.55354	-0.8154|-0.8154	10|5	0.32370|.	T|.	0.25|.	.|.	9.06|9.06	0.36429|0.36429	0.4715:0.0:0.5285:0.0|0.4715:0.0:0.5285:0.0	.|.	218;313;342;380;396;346|.	B4DTY1;F5GWC5;E9PRV2;P46937-2;P46937;P46937-3|.	.;.;.;.;YAP1_HUMAN;.|.	D|T	342;396;384;346;313;380;218|150	ENSP00000434134:E342D;ENSP00000331023:E346D;ENSP00000435602:E218D|.	ENSP00000282441:E396D|.	E|R	+|+	3|2	2|0	YAP1|YAP1	101603434|101603434	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.980000|0.980000	0.70556|0.70556	2.046000|2.046000	0.41260|0.41260	-0.001000|-0.001000	0.14495|0.14495	0.650000|0.650000	0.86243|0.86243	GAG|AGA	.		0.408	YAP1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000394151.1	NM_006106	
HTR3A	3359	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	113856896	113856896	+	Splice_Site	SNP	A	A	G			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr11:113856896A>G	ENST00000504030.2	+	6	1149	c.704A>G	c.(703-705)tAt>tGt	p.Y235C	HTR3A_ENST00000535865.1_Intron|HTR3A_ENST00000375498.2_Splice_Site_p.Y241C|HTR3A_ENST00000355556.2_Splice_Site_p.Y241C|HTR3A_ENST00000299961.5_Splice_Site_p.Y220C|HTR3A_ENST00000506841.2_Splice_Site_p.Y235C			P46098	5HT3A_HUMAN	5-hydroxytryptamine (serotonin) receptor 3A, ionotropic	235					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|cellular response to growth factor stimulus (GO:0071363)|digestion (GO:0007586)|ion transmembrane transport (GO:0034220)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor activity (GO:0004872)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)|serotonin-activated cation-selective channel activity (GO:0005232)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(14)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	36		all_cancers(61;2.31e-17)|all_epithelial(67;2.1e-10)|all_hematologic(158;4.64e-05)|Melanoma(852;0.000312)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0294)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.71e-06)|Epithelial(105;2.58e-05)|all cancers(92;0.000238)|OV - Ovarian serous cystadenocarcinoma(223;0.191)	Alosetron(DB00969)|Amoxapine(DB00543)|Aripiprazole(DB01238)|Chloroprocaine(DB01161)|Cisapride(DB00604)|Clozapine(DB00363)|Dolasetron(DB00757)|Ergoloid mesylate(DB01049)|Granisetron(DB00889)|Loxapine(DB00408)|Memantine(DB01043)|Methadone(DB00333)|Metoclopramide(DB01233)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Ondansetron(DB00904)|Palonosetron(DB00377)|Procaine(DB00721)|Quetiapine(DB01224)|Rocuronium(DB00728)|Tapentadol(DB06204)|Trimipramine(DB00726)|Tubocurarine(DB01199)|Ziprasidone(DB00246)	ATGAAGTTCTATGTGAGTGGG	0.463																																					p.Y241C		.											.	HTR3A-90	0			c.A722G						.						127.0	129.0	128.0					11																	113856896		2201	4296	6497	SO:0001630	splice_region_variant	3359	exon6			AGTTCTATGTGAG	D49394	CCDS8365.1, CCDS8366.1, CCDS8365.2, CCDS8366.2, CCDS53710.1	11q23.1-q23.2	2012-05-22	2012-02-03					"""5-HT (serotonin) receptors"", ""Ligand-gated ion channels / 5-HT (serotonin) receptors, ionotropic"""	5297	protein-coding gene	gene with protein product		182139	"""5-hydroxytryptamine (serotonin) receptor 3A"""	HTR3		8530095, 12867984	Standard	NM_000869		Approved	5-HT3R, 5-HT3A	uc010rxb.2	P46098		ENST00000504030.2:c.705+1A>G	11.37:g.113856896A>G		217	1		132	82	NM_000869	0	0	0	0	0	B4DSY6|G5E986|O60854|Q7KZM7|Q99918|Q9BSZ9	Missense_Mutation	SNP	ENST00000504030.2	37		.	.	.	.	.	.	.	.	.	.	A	14.92	2.678107	0.47886	.	.	ENSG00000166736	ENST00000504030;ENST00000355556;ENST00000375498;ENST00000506841;ENST00000299961	T;T;T;T;T	0.80033	-1.33;-1.33;-1.33;-1.33;-1.33	5.19	5.19	0.71726	.	0.238980	0.43579	D	0.000549	D	0.87390	0.6165	M	0.73598	2.24	0.80722	D	1	D;D;D	0.71674	0.996;0.998;0.998	P;P;D	0.66351	0.905;0.887;0.943	D	0.87931	0.2710	10	0.54805	T	0.06	-11.3278	11.1542	0.48478	0.8621:0.0:0.0:0.1379	.	220;241;241	B4DSY6;G5E986;Q7KZM7	.;.;.	C	235;241;241;235;220	ENSP00000424189:Y235C;ENSP00000347754:Y241C;ENSP00000364648:Y241C;ENSP00000424776:Y235C;ENSP00000299961:Y220C	ENSP00000299961:Y220C	Y	+	2	0	HTR3A	113362106	1.000000	0.71417	0.987000	0.45799	0.454000	0.32378	4.949000	0.63596	2.079000	0.62486	0.533000	0.62120	TAT	.		0.463	HTR3A-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000360822.2	NM_000869	Missense_Mutation
PCSK7	9159	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	117097976	117097976	+	Silent	SNP	C	C	A			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr11:117097976C>A	ENST00000320934.3	-	5	1296	c.666G>T	c.(664-666)gtG>gtT	p.V222V		NM_004716.2	NP_004707.2	Q16549	PCSK7_HUMAN	proprotein convertase subtilisin/kexin type 7	222	Peptidase S8.				peptide hormone processing (GO:0016486)|protein processing (GO:0016485)	integral component of Golgi membrane (GO:0030173)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			NS(1)|endometrium(3)|large_intestine(2)|lung(8)|ovary(1)|skin(1)	16	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.72e-06)|Epithelial(105;6.71e-05)|all cancers(92;0.000537)		TGCCATTCTCCACATCCGGGT	0.582			T	IGH@	MLCLS																																p.V222V		.		Dom	yes		11	11q23.3	9159	proprotein convertase subtilisin/kexin type 7		L	.	PCSK7-658	0			c.G666T						.						117.0	108.0	111.0					11																	117097976		2201	4296	6497	SO:0001819	synonymous_variant	9159	exon5			ATTCTCCACATCC	U40623	CCDS8382.1	11q23-q24	2008-02-01			ENSG00000160613	ENSG00000160613			8748	protein-coding gene	gene with protein product		604872				8615762, 9820811	Standard	XM_006718938		Approved	PC7, PC8, LPC, SPC7	uc001pqr.3	Q16549	OTTHUMG00000165640	ENST00000320934.3:c.666G>T	11.37:g.117097976C>A		231	2		138	41	NM_004716	0	0	11	16	5	B0YJ60|Q3C1X1|Q53GM4|Q96FK8|Q9UL57	Silent	SNP	ENST00000320934.3	37	CCDS8382.1																																																																																			.		0.582	PCSK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385529.2	NM_004716	
VWF	7450	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	6167128	6167128	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr12:6167128G>C	ENST00000261405.5	-	14	1870	c.1616C>G	c.(1615-1617)tCt>tGt	p.S539C		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	539	VWFD 2. {ECO:0000255|PROSITE- ProRule:PRU00580}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	CGCCAGCCCAGAGGGGGTAAG	0.662																																					p.S539C		.											.	VWF-163	0			c.C1616G						.						56.0	59.0	58.0					12																	6167128		2203	4299	6502	SO:0001583	missense	7450	exon14			AGCCCAGAGGGGG		CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.1616C>G	12.37:g.6167128G>C	ENSP00000261405:p.Ser539Cys	176	0		105	31	NM_000552	0	0	42	44	2	Q8TCE8|Q99806	Missense_Mutation	SNP	ENST00000261405.5	37	CCDS8539.1	.	.	.	.	.	.	.	.	.	.	G	12.35	1.911404	0.33721	.	.	ENSG00000110799	ENST00000261405	T	0.62498	0.02	4.94	4.03	0.46877	von Willebrand factor, type D domain (3);	0.650601	0.12694	N	0.446915	T	0.80889	0.4710	M	0.87617	2.895	0.47214	D	0.999357	D;P	0.64830	0.994;0.794	D;P	0.64687	0.928;0.694	T	0.82458	-0.0447	10	0.87932	D	0	.	14.3887	0.66963	0.0:0.1485:0.8515:0.0	.	539;539	B4DNX0;P04275	.;VWF_HUMAN	C	539	ENSP00000261405:S539C	ENSP00000261405:S539C	S	-	2	0	VWF	6037389	0.891000	0.30450	0.007000	0.13788	0.010000	0.07245	4.866000	0.63005	1.267000	0.44247	0.491000	0.48974	TCT	.		0.662	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399020.1	NM_000552	
CAPRIN2	65981	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	30906661	30906661	+	Missense_Mutation	SNP	C	C	G			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr12:30906661C>G	ENST00000395805.2	-	1	584	c.37G>C	c.(37-39)Gag>Cag	p.E13Q	CAPRIN2_ENST00000298892.5_Missense_Mutation_p.E13Q|CAPRIN2_ENST00000308433.5_5'UTR|RP11-77I22.2_ENST00000500076.2_lincRNA|CAPRIN2_ENST00000251071.5_Missense_Mutation_p.E13Q|CAPRIN2_ENST00000417045.1_Missense_Mutation_p.E13Q	NM_001206856.1	NP_001193785.1			caprin family member 2									p.E13K(2)		breast(1)|central_nervous_system(1)|endometrium(8)|kidney(4)|large_intestine(13)|lung(16)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	48	all_lung(12;1.13e-09)|Lung NSC(12;7.98e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					GAAGTGAGCTCGAAACCCAAT	0.408											OREG0021723	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E13Q		.											.	CAPRIN2-92	2	Substitution - Missense(2)	large_intestine(2)	c.G37C						.						103.0	104.0	104.0					12																	30906661		2202	4299	6501	SO:0001583	missense	65981	exon1			TGAGCTCGAAACC	AY074491	CCDS8720.1, CCDS41766.1, CCDS41766.2, CCDS55816.1	12p11	2010-08-03	2007-03-27	2007-03-27	ENSG00000110888	ENSG00000110888			21259	protein-coding gene	gene with protein product		610375	"""C1q domain containing 1"""	C1QDC1		11347906, 14764709	Standard	NM_001002259		Approved	EEG1, FLJ22569, FLJ11391, caprin-2, RNG140	uc001rji.1	Q6IMN6	OTTHUMG00000169185	ENST00000395805.2:c.37G>C	12.37:g.30906661C>G	ENSP00000379150:p.Glu13Gln	179	0	820	169	15	NM_023925	0	0	1	1	0		Missense_Mutation	SNP	ENST00000395805.2	37	CCDS55816.1	.	.	.	.	.	.	.	.	.	.	C	16.59	3.165966	0.57476	.	.	ENSG00000110888	ENST00000298892;ENST00000395805;ENST00000251071;ENST00000417045	T;T;T;T	0.73363	-0.74;2.74;-0.69;2.74	3.72	2.83	0.33086	.	.	.	.	.	T	0.48978	0.1530	N	0.08118	0	0.19575	N	0.999963	B;P;B;B	0.35226	0.358;0.491;0.218;0.325	B;B;B;B	0.32805	0.073;0.153;0.03;0.067	T	0.31833	-0.9929	8	.	.	.	0.5218	5.7801	0.18301	0.0:0.7584:0.0:0.2416	.	13;13;13;13	Q149P6;Q6IMN6-3;Q6IMN6;Q6IMN6-2	.;.;CAPR2_HUMAN;.	Q	13	ENSP00000298892:E13Q;ENSP00000379150:E13Q;ENSP00000251071:E13Q;ENSP00000391479:E13Q	.	E	-	1	0	CAPRIN2	30797928	0.001000	0.12720	0.056000	0.19401	0.500000	0.33767	0.235000	0.17948	0.783000	0.33636	0.563000	0.77884	GAG	.		0.408	CAPRIN2-004	PUTATIVE	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000403322.2	NM_023925	
SLC2A13	114134	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	40422219	40422219	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr12:40422219C>T	ENST00000280871.4	-	3	859	c.809G>A	c.(808-810)gGa>gAa	p.G270E	SLC2A13_ENST00000380858.1_Missense_Mutation_p.G270E	NM_052885.3	NP_443117.3	Q96QE2	MYCT_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 13	270					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	substrate-specific transmembrane transporter activity (GO:0022891)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	29		Lung NSC(34;0.105)|all_lung(34;0.123)				CTGAGTCTGTCCTTTCTGAAT	0.438										HNSCC(50;0.14)																											p.G270E		.											.	SLC2A13-515	0			c.G809A						.						101.0	106.0	104.0					12																	40422219		2203	4300	6503	SO:0001583	missense	114134	exon3			GTCTGTCCTTTCT	AJ315644	CCDS8736.2	12q12	2013-05-22			ENSG00000151229	ENSG00000151229		"""Solute carriers"""	15956	protein-coding gene	gene with protein product	"""H(+)-myo-inositol symporter"""	611036				11500374	Standard	NM_052885		Approved	HMIT	uc010skm.2	Q96QE2	OTTHUMG00000059743	ENST00000280871.4:c.809G>A	12.37:g.40422219C>T	ENSP00000280871:p.Gly270Glu	166	0		184	39	NM_052885	0	0	2	2	0	Q17S07	Missense_Mutation	SNP	ENST00000280871.4	37	CCDS8736.2	.	.	.	.	.	.	.	.	.	.	C	26.9	4.781378	0.90282	.	.	ENSG00000151229	ENST00000280871;ENST00000380858	T;T	0.76839	-1.05;-1.05	5.54	5.54	0.83059	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.099482	0.64402	D	0.000001	D	0.88403	0.6427	M	0.82323	2.585	0.80722	D	1	P;D	0.60575	0.933;0.988	P;P	0.61722	0.838;0.893	D	0.88848	0.3317	10	0.59425	D	0.04	-17.57	19.8499	0.96734	0.0:1.0:0.0:0.0	.	270;270	Q96QE2;E9PE47	MYCT_HUMAN;.	E	270	ENSP00000280871:G270E;ENSP00000370239:G270E	ENSP00000280871:G270E	G	-	2	0	SLC2A13	38708486	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.290000	0.78711	2.779000	0.95612	0.591000	0.81541	GGA	.		0.438	SLC2A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132849.2		
DDX23	9416	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	49231830	49231830	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr12:49231830C>T	ENST00000308025.3	-	6	593	c.514G>A	c.(514-516)Gaa>Aaa	p.E172K	DDX23_ENST00000553182.1_5'UTR	NM_004818.2	NP_004809.2	Q9BUQ8	DDX23_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 23	172	Glu-rich.				ATP catabolic process (GO:0006200)|cis assembly of pre-catalytic spliceosome (GO:0000354)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|U5 snRNP (GO:0005682)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|kidney(4)|large_intestine(6)|lung(17)|ovary(1)|prostate(1)|skin(2)|urinary_tract(3)	36						TTTAGAGCTTCAGCCTCTCGT	0.498																																					p.E172K		.											.	DDX23-539	0			c.G514A						.						149.0	140.0	143.0					12																	49231830		2203	4300	6503	SO:0001583	missense	9416	exon6			GAGCTTCAGCCTC	AF026402	CCDS8770.1	12q13.11	2013-07-16				ENSG00000174243		"""DEAD-boxes"""	17347	protein-coding gene	gene with protein product		612172	"""PRP28 homolog, yeast"""			9409622, 9539711	Standard	NM_004818		Approved	prp28, U5-100K, PRPF28, SNRNP100	uc001rsm.3	Q9BUQ8		ENST00000308025.3:c.514G>A	12.37:g.49231830C>T	ENSP00000310723:p.Glu172Lys	241	0		232	92	NM_004818	0	0	42	86	44	B2R600|B4DH15|O43188	Missense_Mutation	SNP	ENST00000308025.3	37	CCDS8770.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.450245	0.84101	.	.	ENSG00000174243	ENST00000550834;ENST00000308025;ENST00000552512	T	0.22945	1.93	5.15	5.15	0.70609	.	0.055638	0.64402	D	0.000001	T	0.20333	0.0489	L	0.36672	1.1	0.58432	D	0.999999	P	0.39480	0.675	B	0.34093	0.175	T	0.03231	-1.1058	10	0.21014	T	0.42	-10.372	17.5534	0.87884	0.0:1.0:0.0:0.0	.	172	Q9BUQ8	DDX23_HUMAN	K	16;172;172	ENSP00000310723:E172K	ENSP00000310723:E172K	E	-	1	0	DDX23	47518097	1.000000	0.71417	0.999000	0.59377	0.954000	0.61252	7.411000	0.80078	2.676000	0.91093	0.563000	0.77884	GAA	.		0.498	DDX23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408897.2	NM_004818	
SPATS2	65244	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	49916614	49916614	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr12:49916614G>C	ENST00000553127.1	+	13	1602	c.1089G>C	c.(1087-1089)aaG>aaC	p.K363N	SPATS2_ENST00000321898.6_Missense_Mutation_p.K363N|SPATS2_ENST00000552918.1_Missense_Mutation_p.K363N			Q86XZ4	SPAS2_HUMAN	spermatogenesis associated, serine-rich 2	363						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(4)|kidney(1)|large_intestine(7)|lung(1)|prostate(1)|urinary_tract(4)	21						CCCTAAAGAAGAGCATTGATT	0.448																																					p.K363N		.											.	SPATS2-135	0			c.G1089C						.						145.0	125.0	132.0					12																	49916614		2203	4300	6503	SO:0001583	missense	65244	exon12			AAAGAAGAGCATT	AK023179	CCDS31794.1	12q13.12	2009-06-12							18650	protein-coding gene	gene with protein product		611667				11944913, 17989879	Standard	NM_023071		Approved	SPATA10, SCR59, FLJ13117	uc001rud.2	Q86XZ4		ENST00000553127.1:c.1089G>C	12.37:g.49916614G>C	ENSP00000448228:p.Lys363Asn	65	0		80	37	NM_023071	0	0	10	18	8	A8K8G9|Q9H7D4|Q9H8Y7|Q9H8Z8	Missense_Mutation	SNP	ENST00000553127.1	37	CCDS31794.1	.	.	.	.	.	.	.	.	.	.	G	18.92	3.725778	0.69074	.	.	ENSG00000123352	ENST00000553127;ENST00000321898;ENST00000552918;ENST00000395063	.	.	.	5.84	5.84	0.93424	.	0.215681	0.51477	D	0.000085	T	0.62097	0.2400	L	0.56769	1.78	0.80722	D	1	P	0.42161	0.772	P	0.49528	0.614	T	0.59139	-0.7510	9	0.38643	T	0.18	-13.4976	11.3109	0.49364	0.0822:0.0:0.9178:0.0	.	363	Q86XZ4	SPAS2_HUMAN	N	363	.	ENSP00000326841:K363N	K	+	3	2	SPATS2	48202881	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.162000	0.42367	2.937000	0.99478	0.650000	0.86243	AAG	.		0.448	SPATS2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404023.1	NM_023071	
RARG	5916	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	53607847	53607847	+	Missense_Mutation	SNP	A	A	G			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr12:53607847A>G	ENST00000425354.2	-	7	1296	c.809T>C	c.(808-810)aTc>aCc	p.I270T	RARG_ENST00000543726.1_Missense_Mutation_p.I248T|RARG_ENST00000394426.1_Missense_Mutation_p.I270T|RARG_ENST00000543762.1_5'UTR|RARG_ENST00000338561.5_Missense_Mutation_p.I259T|RARG_ENST00000327550.3_Missense_Mutation_p.I198T	NM_000966.5	NP_000957.1	P13631	RARG_HUMAN	retinoic acid receptor, gamma	270	Ligand-binding.				anterior/posterior pattern specification (GO:0009952)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|embryonic camera-type eye development (GO:0031076)|embryonic eye morphogenesis (GO:0048048)|embryonic hindlimb morphogenesis (GO:0035116)|face development (GO:0060324)|gene expression (GO:0010467)|glandular epithelial cell development (GO:0002068)|growth plate cartilage chondrocyte growth (GO:0003430)|Harderian gland development (GO:0070384)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of programmed cell death (GO:0043068)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland epithelium morphogenesis (GO:0060740)|regulation of cell size (GO:0008361)|regulation of myelination (GO:0031641)|response to retinoic acid (GO:0032526)|retinal pigment epithelium development (GO:0003406)|retinoic acid receptor signaling pathway (GO:0048384)|trachea cartilage development (GO:0060534)|transcription initiation from RNA polymerase II promoter (GO:0006367)	integral component of membrane (GO:0016021)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|retinoic acid receptor activity (GO:0003708)|retinoid X receptor binding (GO:0046965)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(3)|endometrium(3)|kidney(1)|large_intestine(6)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Tazarotene(DB00799)|Tretinoin(DB00755)	ACTTACCAGGATATCTAGGCA	0.532											OREG0021862	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.I270T		.											.	RARG-722	0			c.T809C						.						185.0	185.0	185.0					12																	53607847		2203	4300	6503	SO:0001583	missense	5916	exon7			ACCAGGATATCTA	M57707	CCDS8850.1, CCDS41790.1, CCDS58236.1, CCDS58237.1	12q13	2013-01-16			ENSG00000172819	ENSG00000172819		"""Nuclear hormone receptors"""	9866	protein-coding gene	gene with protein product		180190				1849262	Standard	NM_001042728		Approved	RARC, NR1B3	uc001scf.3	P13631	OTTHUMG00000048077	ENST00000425354.2:c.809T>C	12.37:g.53607847A>G	ENSP00000388510:p.Ile270Thr	412	0	993	365	139	NM_000966	0	0	2	2	0	B7Z492|B7Z4F1|B7ZAE4|J3KNP6|P22932|Q15281|Q52LZ8|Q9BYX8|Q9H1I3|Q9UJ38	Missense_Mutation	SNP	ENST00000425354.2	37	CCDS8850.1	.	.	.	.	.	.	.	.	.	.	A	19.87	3.906612	0.72868	.	.	ENSG00000172819	ENST00000425354;ENST00000394426;ENST00000538479;ENST00000327550;ENST00000338561;ENST00000543726;ENST00000550265	T;T;T;T;T	0.42131	0.98;0.98;0.98;0.98;0.98	5.37	5.37	0.77165	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.000000	0.85682	D	0.000000	T	0.65657	0.2712	M	0.79258	2.445	0.80722	D	1	D;D;D;D	0.89917	1.0;0.996;1.0;1.0	D;D;D;D	0.97110	1.0;0.993;1.0;0.999	T	0.70447	-0.4869	10	0.87932	D	0	.	14.6593	0.68858	1.0:0.0:0.0:0.0	.	307;248;270;259	F8VR45;B7Z4F1;P13631;F1D8P1	.;.;RARG_HUMAN;.	T	270;270;32;198;259;248;307	ENSP00000388510:I270T;ENSP00000377947:I270T;ENSP00000332695:I198T;ENSP00000343698:I259T;ENSP00000444335:I248T	ENSP00000332695:I198T	I	-	2	0	RARG	51894114	1.000000	0.71417	1.000000	0.80357	0.827000	0.46813	9.034000	0.93747	2.171000	0.68590	0.460000	0.39030	ATC	.		0.532	RARG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000109404.2	NM_000966	
DPY19L2	283417	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	64061939	64061939	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr12:64061939G>A	ENST00000324472.4	-	1	418	c.235C>T	c.(235-237)Ctc>Ttc	p.L79F	RP11-415I12.3_ENST00000509615.2_RNA	NM_173812.4	NP_776173.3	Q6NUT2	D19L2_HUMAN	dpy-19-like 2 (C. elegans)	79					multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|nuclear inner membrane (GO:0005637)|nucleus (GO:0005634)	transferase activity, transferring glycosyl groups (GO:0016757)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(19)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	45			GBM - Glioblastoma multiforme(1;2.77e-05)	GBM - Glioblastoma multiforme(28;0.044)		AAGGGGCCGAGAAGAAAGGTC	0.602																																					p.L79F		.											.	DPY19L2-515	0			c.C235T						.						74.0	80.0	78.0					12																	64061939		2203	4300	6503	SO:0001583	missense	283417	exon1			GGCCGAGAAGAAA		CCDS31851.1	12q14.2	2012-11-14			ENSG00000177990	ENSG00000177990			19414	protein-coding gene	gene with protein product	"""spermatogenesis associated 34"""	613893				12975309	Standard	XM_006719348		Approved	FLJ32949, SPATA34	uc001srp.1	Q6NUT2	OTTHUMG00000168712	ENST00000324472.4:c.235C>T	12.37:g.64061939G>A	ENSP00000315988:p.Leu79Phe	167	0		133	22	NM_173812	0	0	0	0	0	A4FVC1|B4E191|Q3ZCX2|Q6UWG8|Q96LZ9	Missense_Mutation	SNP	ENST00000324472.4	37	CCDS31851.1	.	.	.	.	.	.	.	.	.	.	G	3.843	-0.033397	0.07543	.	.	ENSG00000177990	ENST00000324472;ENST00000542209	T;T	0.45668	0.95;0.89	1.61	0.631	0.17699	.	.	.	.	.	T	0.26231	0.0640	L	0.32530	0.975	0.09310	N	0.999999	B	0.32653	0.379	B	0.30029	0.11	T	0.14643	-1.0465	8	.	.	.	.	5.6322	0.17516	0.0:0.3487:0.6513:0.0	.	79	Q6NUT2	D19L2_HUMAN	F	79	ENSP00000315988:L79F;ENSP00000444932:L79F	.	L	-	1	0	DPY19L2	62348206	0.000000	0.05858	0.010000	0.14722	0.121000	0.20230	0.247000	0.18179	0.202000	0.20498	0.195000	0.17529	CTC	.		0.602	DPY19L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400689.2	NM_173812	
LLPH	84298	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	66522754	66522754	+	Nonsense_Mutation	SNP	G	G	A			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr12:66522754G>A	ENST00000266604.2	-	2	203	c.133C>T	c.(133-135)Caa>Taa	p.Q45*	RP11-745O10.2_ENST00000510317.2_RNA|TMBIM4_ENST00000556010.1_3'UTR|TMBIM4_ENST00000539652.1_3'UTR|LLPH_ENST00000446587.2_Nonsense_Mutation_p.Q45*	NM_032338.3	NP_115714.1	Q9BRT6	LLPH_HUMAN	LLP homolog, long-term synaptic facilitation (Aplysia)	45	Lys-rich.						poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(1)|skin(1)	5						GCTATCTCTTGAACATCTTTC	0.403																																					p.Q45X		.											.	LLPH-514	0			c.C133T						.						122.0	112.0	115.0					12																	66522754		2203	4297	6500	SO:0001587	stop_gained	84298	exon2			TCTCTTGAACATC	AK057947	CCDS8974.1	12q14.3	2014-05-09	2008-10-02	2008-10-02	ENSG00000139233	ENSG00000139233			28229	protein-coding gene	gene with protein product	"""human LAPS18-like protein"""		"""chromosome 12 open reading frame 31"""	C12orf31		12477932	Standard	NM_032338		Approved	MGC14817, hLLP	uc010ssw.2	Q9BRT6	OTTHUMG00000168959	ENST00000266604.2:c.133C>T	12.37:g.66522754G>A	ENSP00000266604:p.Gln45*	175	0		228	34	NM_032338	0	0	47	51	4	Q3B766	Nonsense_Mutation	SNP	ENST00000266604.2	37	CCDS8974.1	.	.	.	.	.	.	.	.	.	.	G	32	5.127434	0.94473	.	.	ENSG00000139233	ENST00000266604;ENST00000446587	.	.	.	4.13	-0.482	0.12078	.	0.626869	0.17801	N	0.161575	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-5.9384	6.7866	0.23677	0.0:0.1983:0.3284:0.4734	.	.	.	.	X	45	.	.	Q	-	1	0	LLPH	64809021	0.974000	0.33945	0.987000	0.45799	0.865000	0.49528	0.701000	0.25616	0.090000	0.17273	0.467000	0.42956	CAA	.		0.403	LLPH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401752.1	NM_032338	
AMDHD1	144193	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	96354342	96354342	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr12:96354342G>C	ENST00000266736.2	+	5	860	c.754G>C	c.(754-756)Gat>Cat	p.D252H		NM_152435.2	NP_689648.2	Q96NU7	HUTI_HUMAN	amidohydrolase domain containing 1	252					cellular nitrogen compound metabolic process (GO:0034641)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	imidazolonepropionase activity (GO:0050480)|metal ion binding (GO:0046872)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|skin(1)	22						ACGTGGAAAAGATATAGGGTT	0.428																																					p.D252H		.											.	AMDHD1-90	0			c.G754C						.						122.0	117.0	118.0					12																	96354342		2203	4300	6503	SO:0001583	missense	144193	exon5			GGAAAAGATATAG	AB075878	CCDS9057.1	12q23.1	2006-02-02				ENSG00000139344			28577	protein-coding gene	gene with protein product							Standard	NM_152435		Approved	MGC35366	uc001tel.2	Q96NU7	OTTHUMG00000170353	ENST00000266736.2:c.754G>C	12.37:g.96354342G>C	ENSP00000266736:p.Asp252His	157	0		178	65	NM_152435	0	0	0	0	0	A8K463|Q68CI8	Missense_Mutation	SNP	ENST00000266736.2	37	CCDS9057.1	.	.	.	.	.	.	.	.	.	.	G	14.46	2.540809	0.45280	.	.	ENSG00000139344	ENST00000266736	T	0.46063	0.88	5.55	4.65	0.58169	Metal-dependent hydrolase, composite domain (1);	0.384940	0.33235	N	0.005136	T	0.49660	0.1570	L	0.60957	1.885	0.34446	D	0.700188	P	0.40107	0.703	P	0.47528	0.549	T	0.65340	-0.6192	10	0.54805	T	0.06	-0.0155	13.7543	0.62926	0.0749:0.0:0.9251:0.0	.	252	Q96NU7	HUTI_HUMAN	H	252	ENSP00000266736:D252H	ENSP00000266736:D252H	D	+	1	0	AMDHD1	94878473	1.000000	0.71417	0.605000	0.28930	0.004000	0.04260	4.953000	0.63624	1.447000	0.47661	0.655000	0.94253	GAT	.		0.428	AMDHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408640.1	NM_152435	
C12orf42	374470	broad.mit.edu	37	12	103699754	103699754	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr12:103699754G>A	ENST00000378113.2	-	5	854	c.629C>T	c.(628-630)tCt>tTt	p.S210F	C12orf42_ENST00000548883.1_Missense_Mutation_p.S210F|C12orf42_ENST00000548789.1_5'UTR|C12orf42_ENST00000315192.8_Intron|C12orf42_ENST00000548048.1_Missense_Mutation_p.S143F	NM_001099336.1	NP_001092806.1	Q96LP6	CL042_HUMAN	chromosome 12 open reading frame 42	210										NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)	22						ATACTTACCAGAATTTTTCTT	0.418																																					p.S210F													.	C12orf42-91	0			c.C629T						.						166.0	160.0	162.0					12																	103699754		1885	4107	5992	SO:0001583	missense	374470	exon5			TTACCAGAATTTT	AK058052	CCDS44963.1	12q23.2	2012-05-30			ENSG00000179088	ENSG00000179088			24729	protein-coding gene	gene with protein product							Standard	NM_001099336		Approved	FLJ25323	uc001tjt.2	Q96LP6	OTTHUMG00000169988	ENST00000378113.2:c.629C>T	12.37:g.103699754G>A	ENSP00000367353:p.Ser210Phe	286	0		358	7	NM_001099336	0	0	0	0	0	Q49A64|Q4G0S2	Missense_Mutation	SNP	ENST00000378113.2	37	CCDS44963.1	.	.	.	.	.	.	.	.	.	.	G	14.12	2.441683	0.43326	.	.	ENSG00000179088	ENST00000548883;ENST00000548048;ENST00000378113	T;T;T	0.59083	0.29;0.29;0.29	4.02	2.18	0.27775	.	0.916854	0.08987	N	0.864952	T	0.43144	0.1234	L	0.32530	0.975	0.09310	N	1	B	0.32031	0.352	B	0.29176	0.099	T	0.40117	-0.9580	10	0.87932	D	0	-2.6865	5.0246	0.14378	0.1071:0.0:0.6868:0.2061	.	210	Q96LP6	CL042_HUMAN	F	210;143;210	ENSP00000447908:S210F;ENSP00000449362:S143F;ENSP00000367353:S210F	ENSP00000367353:S210F	S	-	2	0	C12orf42	102223884	0.055000	0.20627	0.009000	0.14445	0.065000	0.16274	0.795000	0.26972	0.653000	0.30826	0.555000	0.69702	TCT	.		0.418	C12orf42-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406754.1	NM_198521	
KSR2	283455	broad.mit.edu	37	12	118293234	118293234	+	Splice_Site	SNP	T	T	C			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr12:118293234T>C	ENST00000339824.5	-	3	1198	c.471A>G	c.(469-471)tcA>tcG	p.S157S	KSR2_ENST00000425217.1_Splice_Site_p.S128S			Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2	157					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(25)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CCTGCTCACCTGACATGTGGA	0.652																																					p.S128S													.	KSR2-1449	0			c.A384G						.						66.0	75.0	72.0					12																	118293234		2058	4195	6253	SO:0001630	splice_region_variant	283455	exon3			CTCACCTGACATG	AY345972	CCDS61250.1	12q24.22-q24.23	2014-08-12			ENSG00000171435	ENSG00000171435			18610	protein-coding gene	gene with protein product		610737				12471243	Standard	NM_173598		Approved	FLJ25965	uc001two.2	Q6VAB6	OTTHUMG00000169020	ENST00000339824.5:c.472+1A>G	12.37:g.118293234T>C		106	0		100	3	NM_173598	0	0	1	1	0	A0PJT2|Q3B828|Q8N775	Silent	SNP	ENST00000339824.5	37																																																																																				.		0.652	KSR2-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000401987.2	NM_173598	Silent
P2RX4	5025	broad.mit.edu;bcgsc.ca	37	12	121648006	121648006	+	Silent	SNP	C	C	T			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr12:121648006C>T	ENST00000337233.4	+	1	347	c.39C>T	c.(37-39)ttC>ttT	p.F13F	P2RX4_ENST00000359949.7_Silent_p.F13F|P2RX4_ENST00000543171.1_5'UTR|P2RX4_ENST00000540930.1_3'UTR|P2RX4_ENST00000541532.1_Silent_p.F13F	NM_001261397.1|NM_001261398.1|NM_002560.2	NP_001248326.1|NP_001248327.1|NP_002551.2	Q99571	P2RX4_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 4	13					apoptotic signaling pathway (GO:0097190)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|cellular response to ATP (GO:0071318)|endothelial cell activation (GO:0042118)|ion transmembrane transport (GO:0034220)|membrane depolarization (GO:0051899)|negative regulation of cardiac muscle hypertrophy (GO:0010614)|neuronal action potential (GO:0019228)|nitric oxide biosynthetic process (GO:0006809)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of prostaglandin secretion (GO:0032308)|protein homooligomerization (GO:0051260)|purinergic nucleotide receptor signaling pathway (GO:0035590)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction (GO:0055117)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sodium ion transport (GO:0002028)|relaxation of cardiac muscle (GO:0055119)|response to ATP (GO:0033198)|response to fluid shear stress (GO:0034405)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|tissue homeostasis (GO:0001894)|transport (GO:0006810)|vasodilation (GO:0042311)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|cadherin binding (GO:0045296)|copper ion binding (GO:0005507)|drug binding (GO:0008144)|extracellular ATP-gated cation channel activity (GO:0004931)|protein homodimerization activity (GO:0042803)|purinergic nucleotide receptor activity (GO:0001614)|receptor binding (GO:0005102)|zinc ion binding (GO:0008270)			breast(1)|kidney(4)|large_intestine(4)|lung(7)|prostate(1)	17	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					CCTTCCTGTTCGAGTACGACA	0.706																																					p.F13F													.	P2RX4-68	0			c.C39T						.						16.0	16.0	16.0					12																	121648006		2195	4290	6485	SO:0001819	synonymous_variant	5025	exon1			CCTGTTCGAGTAC	Y07684	CCDS9214.1, CCDS58282.1	12q24.32	2012-01-17			ENSG00000135124	ENSG00000135124		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	8535	protein-coding gene	gene with protein product		600846				9016352	Standard	NM_002560		Approved	P2X4	uc031qjt.1	Q99571	OTTHUMG00000169155	ENST00000337233.4:c.39C>T	12.37:g.121648006C>T		19	0		23	9	NM_001261398	0	0	4	4	0	E7EPF7|F6RU17|O00450|O14722|Q5U089|Q5U090|Q8N4N1|Q9UBG9	Silent	SNP	ENST00000337233.4	37	CCDS9214.1																																																																																			.		0.706	P2RX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402545.1	NM_175567	
UTP14C	9724	hgsc.bcm.edu;broad.mit.edu	37	13	52603705	52603705	+	Silent	SNP	G	G	C			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr13:52603705G>C	ENST00000521776.2	+	2	1498	c.765G>C	c.(763-765)gtG>gtC	p.V255V	ALG11_ENST00000523764.1_3'UTR|ALG11_ENST00000521508.1_3'UTR	NM_021645.5	NP_067677.4	Q5TAP6	UT14C_HUMAN	UTP14, U3 small nucleolar ribonucleoprotein, homolog C (yeast)	255					cell differentiation (GO:0030154)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|rRNA processing (GO:0006364)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)				breast(4)|cervix(1)|endometrium(1)|large_intestine(10)|lung(10)|ovary(3)|skin(1)|stomach(1)|urinary_tract(1)	32		Breast(56;0.00173)|Lung NSC(96;0.0108)|Prostate(109;0.0412)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;2.3e-08)		ACAAAGTCGTGAAGAAAGGAA	0.433																																					p.V255V		.											.	UTP14C-138	0			c.G765C						.						89.0	88.0	88.0					13																	52603705		2203	4300	6503	SO:0001819	synonymous_variant	9724	exon2			AGTCGTGAAGAAA	D87455	CCDS31978.1	13q12.2-q13.3	2010-11-23	2004-06-15	2004-06-16	ENSG00000253797	ENSG00000253797			20321	protein-coding gene	gene with protein product		608969	"""KIAA0266"""	KIAA0266		9039502, 16354793	Standard	NM_021645		Approved	2700066J21Rik	uc021rjw.1	Q5TAP6	OTTHUMG00000164353	ENST00000521776.2:c.765G>C	13.37:g.52603705G>C		77	0		83	5	NM_021645	0	0	25	25	0	Q5FWG3|Q92555	Silent	SNP	ENST00000521776.2	37	CCDS31978.1																																																																																			.		0.433	UTP14C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045049.2	NM_021645	
OLFM4	10562	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	53624805	53624805	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr13:53624805G>C	ENST00000219022.2	+	5	1510	c.1432G>C	c.(1432-1434)Gtg>Ctg	p.V478L		NM_006418.4	NP_006409.3	Q6UX06	OLFM4_HUMAN	olfactomedin 4	478	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				cell adhesion (GO:0007155)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of immune response (GO:0050777)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|protein homooligomerization (GO:0051260)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|specific granule (GO:0042581)	cadherin binding (GO:0045296)|catalytic activity (GO:0003824)|protein homodimerization activity (GO:0042803)			breast(2)|endometrium(4)|kidney(4)|large_intestine(5)|lung(20)|skin(3)|urinary_tract(1)	39		Breast(56;0.000776)|Lung NSC(96;0.000814)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.13e-08)		GCAGGAAAAAGTGCAGAGCAT	0.368																																					p.V478L		.											.	OLFM4-69	0			c.G1432C						.						108.0	108.0	108.0					13																	53624805		2203	4300	6503	SO:0001583	missense	10562	exon5			GAAAAAGTGCAGA	AY358567	CCDS9440.1	13q14	2004-06-25			ENSG00000102837	ENSG00000102837			17190	protein-coding gene	gene with protein product		614061					Standard	NM_006418		Approved	OlfD, GW112, GC1	uc001vhl.3	Q6UX06	OTTHUMG00000016981	ENST00000219022.2:c.1432G>C	13.37:g.53624805G>C	ENSP00000219022:p.Val478Leu	84	0		129	18	NM_006418	0	0	0	0	0	O95362|Q5VWG0|Q86T22	Missense_Mutation	SNP	ENST00000219022.2	37	CCDS9440.1	.	.	.	.	.	.	.	.	.	.	G	10.48	1.362917	0.24684	.	.	ENSG00000102837	ENST00000219022	T	0.14022	2.54	5.64	-2.23	0.06930	Olfactomedin-like (3);	0.818724	0.11361	N	0.571904	T	0.03959	0.0111	N	0.03268	-0.37	0.18873	N	0.999988	B	0.06786	0.001	B	0.15484	0.013	T	0.43426	-0.9392	10	0.15499	T	0.54	.	2.2285	0.03991	0.2383:0.3579:0.2837:0.1201	.	478	Q6UX06	OLFM4_HUMAN	L	478	ENSP00000219022:V478L	ENSP00000219022:V478L	V	+	1	0	OLFM4	52522806	0.000000	0.05858	0.030000	0.17652	0.978000	0.69477	-0.374000	0.07484	-0.094000	0.12374	0.585000	0.79938	GTG	.		0.368	OLFM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045112.2	NM_006418	
RBM26	64062	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	79945132	79945132	+	Silent	SNP	C	C	T	rs199797508		TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr13:79945132C>T	ENST00000438737.2	-	5	1022	c.582G>A	c.(580-582)gaG>gaA	p.E194E	RBM26_ENST00000438724.1_Silent_p.E194E|RBM26_ENST00000267229.7_Silent_p.E194E			Q5T8P6	RBM26_HUMAN	RNA binding motif protein 26	194	Arg-rich.				mRNA processing (GO:0006397)|negative regulation of phosphatase activity (GO:0010923)		metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(6)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	33		Acute lymphoblastic leukemia(28;0.0279)		GBM - Glioblastoma multiforme(99;0.0188)		CTCTGTCCCTCTCACGAAGCC	0.428													C|||	1	0.000199681	0.0	0.0	5008	,	,		15718	0.001		0.0	False		,,,				2504	0.0				p.E194E		.											.	RBM26-91	0			c.G582A						.						167.0	171.0	170.0					13																	79945132		2203	4300	6503	SO:0001819	synonymous_variant	64062	exon5			GTCCCTCTCACGA	AF116667	CCDS9462.1, CCDS66566.1, CCDS73591.1	13q31.1	2014-06-13	2006-06-22	2006-06-22	ENSG00000139746	ENSG00000139746		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	20327	protein-coding gene	gene with protein product	"""acidic rich RS domain containing 2"", ""protein phosphatase 1, regulatory 132"""		"""chromosome 13 open reading frame 10"""	C13orf10		11149944, 15741184	Standard	XM_005266497		Approved	PRO1777, SE70-2, FLJ20957, ZC3H17, ARRS2, PPP1R132	uc001vky.2	Q5T8P6	OTTHUMG00000017133	ENST00000438737.2:c.582G>A	13.37:g.79945132C>T		266	0		352	47	NM_022118	0	0	31	34	3	B4DZE0|Q2NKM2|Q2NKQ2|Q5CZH8|Q5T8P5|Q5T8P8|Q5U5P5|Q5W0G7|Q8N3H5|Q96K92|Q96SZ3|Q9H2F8|Q9H7F9|Q9P1G7	Silent	SNP	ENST00000438737.2	37																																																																																				C|0.999;T|0.000		0.428	RBM26-004	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000045373.4	NM_022118	
CIDEB	27141	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	24775203	24775203	+	Silent	SNP	G	G	C			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr14:24775203G>C	ENST00000336557.5	-	7	1779	c.477C>G	c.(475-477)ctC>ctG	p.L159L	NOP9_ENST00000267425.3_3'UTR|CIDEB_ENST00000554411.1_Silent_p.L159L|CIDEB_ENST00000258807.5_Silent_p.L159L|LTB4R2_ENST00000528054.1_5'Flank			Q9UHD4	CIDEB_HUMAN	cell death-inducing DFFA-like effector b	159					apoptotic process (GO:0006915)|execution phase of apoptosis (GO:0097194)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|regulation of apoptotic process (GO:0042981)	cytosol (GO:0005829)|lipid particle (GO:0005811)	identical protein binding (GO:0042802)			NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|urinary_tract(1)	7				GBM - Glioblastoma multiforme(265;0.0181)		TCATAGAGTAGAGCCCGTAGA	0.488																																					p.L159L		.											.	CIDEB-90	0			c.C477G						.						141.0	134.0	136.0					14																	24775203		2203	4300	6503	SO:0001819	synonymous_variant	27141	exon6			AGAGTAGAGCCCG	AF190901	CCDS32056.1	14q12	2012-09-20			ENSG00000136305	ENSG00000136305			1977	protein-coding gene	gene with protein product		604441				10619428, 10837461	Standard	XM_005267540		Approved		uc001woo.3	Q9UHD4	OTTHUMG00000171555	ENST00000336557.5:c.477C>G	14.37:g.24775203G>C		127	0		104	24	NM_014430	0	0	29	33	4	D3DS73|Q546V8|Q9NNW9	Silent	SNP	ENST00000336557.5	37	CCDS32056.1																																																																																			.		0.488	CIDEB-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414120.1		
FANCM	57697	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	45642339	45642339	+	Missense_Mutation	SNP	C	C	G			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr14:45642339C>G	ENST00000267430.5	+	13	2327	c.2242C>G	c.(2242-2244)Caa>Gaa	p.Q748E	FANCM_ENST00000542564.2_Missense_Mutation_p.Q722E	NM_020937.2	NP_065988.1	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	748					DNA repair (GO:0006281)|replication fork processing (GO:0031297)|resolution of meiotic recombination intermediates (GO:0000712)	FANCM-MHF complex (GO:0071821)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nuclease activity (GO:0004518)			breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(31)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	85						GCCTACACATCAAGTTGATCA	0.398								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.Q748E		.											.	FANCM-569	0			c.C2242G						.						160.0	144.0	150.0					14																	45642339		2203	4300	6503	SO:0001583	missense	57697	exon13	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	ACACATCAAGTTG	AK001672	CCDS32070.1	14q21.3	2014-09-17	2005-09-01	2005-09-01		ENSG00000187790		"""Fanconi anemia, complementation groups"""	23168	protein-coding gene	gene with protein product		609644	"""KIAA1596"""	KIAA1596		10997877, 16116422	Standard	NM_020937		Approved	FAAP250	uc001wwd.4	Q8IYD8		ENST00000267430.5:c.2242C>G	14.37:g.45642339C>G	ENSP00000267430:p.Gln748Glu	108	0		88	55	NM_020937	0	0	1	1	0	B2RTQ9|Q3YFH9|Q8N9X6|Q9HCH6	Missense_Mutation	SNP	ENST00000267430.5	37	CCDS32070.1	.	.	.	.	.	.	.	.	.	.	C	2.703	-0.270591	0.05716	.	.	ENSG00000187790	ENST00000267430;ENST00000542564;ENST00000556250	T;T;T	0.18338	2.83;2.83;2.22	5.79	5.79	0.91817	.	1.031910	0.07642	N	0.930388	T	0.18841	0.0452	L	0.60455	1.87	0.09310	N	1	B;B	0.28233	0.204;0.204	B;B	0.21708	0.036;0.033	T	0.21999	-1.0229	10	0.23302	T	0.38	.	9.037	0.36293	0.1484:0.7768:0.0:0.0748	.	722;748	B2RTQ9;Q8IYD8	.;FANCM_HUMAN	E	748;722;264	ENSP00000267430:Q748E;ENSP00000442493:Q722E;ENSP00000452033:Q264E	ENSP00000267430:Q748E	Q	+	1	0	FANCM	44712089	0.001000	0.12720	0.103000	0.21229	0.402000	0.30811	1.154000	0.31688	2.746000	0.94184	0.561000	0.74099	CAA	.		0.398	FANCM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410474.1	XM_048128	
ZBTB1	22890	hgsc.bcm.edu	37	14	64989477	64989477	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr14:64989477G>C	ENST00000554015.1	+	4	1686	c.1255G>C	c.(1255-1257)Gaa>Caa	p.E419Q	RP11-973N13.4_ENST00000554918.1_RNA|ZBTB1_ENST00000358738.3_Missense_Mutation_p.E419Q|ZBTB1_ENST00000394712.2_Missense_Mutation_p.E419Q			Q9Y2K1	ZBTB1_HUMAN	zinc finger and BTB domain containing 1	419					B cell differentiation (GO:0030183)|innate immune response (GO:0045087)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of pro-T cell differentiation (GO:2000176)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of T cell mediated immunity (GO:0002711)|protein homooligomerization (GO:0051260)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)	nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			kidney(1)|large_intestine(3)|lung(7)|prostate(1)|skin(1)	13		all_lung(585;0.000567)|Myeloproliferative disorder(585;0.0255)|all_neural(303;0.0294)		UCEC - Uterine corpus endometrioid carcinoma (185;0.0182)|all cancers(60;3.78e-43)|OV - Ovarian serous cystadenocarcinoma(108;1.22e-20)|BRCA - Breast invasive adenocarcinoma(234;6.75e-06)|KIRC - Kidney renal clear cell carcinoma(182;0.00269)|STAD - Stomach adenocarcinoma(64;0.012)		AGAGGATGCTGAAAATGCATC	0.423																																					p.E419Q		.											.	ZBTB1-91	0			c.G1255C						.						61.0	59.0	60.0					14																	64989477		2203	4300	6503	SO:0001583	missense	22890	exon2			GATGCTGAAAATG	AB023214	CCDS32097.1, CCDS45126.1	14q23.3	2013-01-09			ENSG00000126804	ENSG00000126804		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	20259	protein-coding gene	gene with protein product						10231032	Standard	NM_014950		Approved	KIAA0997, ZNF909	uc010aqg.3	Q9Y2K1		ENST00000554015.1:c.1255G>C	14.37:g.64989477G>C	ENSP00000451000:p.Glu419Gln	24	0		38	3	NM_014950	0	0	39	39	0	A8K6S8|Q86SW8	Missense_Mutation	SNP	ENST00000554015.1	37	CCDS45126.1	.	.	.	.	.	.	.	.	.	.	G	11.69	1.714837	0.30413	.	.	ENSG00000126804	ENST00000554015;ENST00000358738;ENST00000394712	T;T;T	0.10960	2.82;3.36;2.82	6.17	6.17	0.99709	.	0.000000	0.43110	D	0.000615	T	0.15003	0.0362	N	0.24115	0.695	0.21822	N	0.999521	D;P	0.52996	0.957;0.818	P;B	0.48454	0.578;0.255	T	0.02758	-1.1114	10	0.87932	D	0	-29.409	20.8794	0.99867	0.0:0.0:1.0:0.0	.	419;419	Q9Y2K1-2;Q9Y2K1	.;ZBTB1_HUMAN	Q	419	ENSP00000451000:E419Q;ENSP00000351587:E419Q;ENSP00000378201:E419Q	ENSP00000351587:E419Q	E	+	1	0	ZBTB1	64059230	1.000000	0.71417	0.278000	0.24718	0.995000	0.86356	5.210000	0.65214	2.941000	0.99782	0.655000	0.94253	GAA	.		0.423	ZBTB1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411912.1		
SLC8A3	6547	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	70633987	70633987	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr14:70633987C>T	ENST00000381269.2	-	2	1906	c.1153G>A	c.(1153-1155)Gag>Aag	p.E385K	SLC8A3_ENST00000357887.3_Missense_Mutation_p.E385K|SLC8A3_ENST00000534137.1_Missense_Mutation_p.E385K|SLC8A3_ENST00000528359.1_Missense_Mutation_p.E385K|SLC8A3_ENST00000356921.2_Missense_Mutation_p.E385K	NM_058240.2|NM_183002.1	NP_489479.1|NP_892114.1	P57103	NAC3_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 3	385					blood coagulation (GO:0007596)|calcium ion export from cell (GO:1990034)|calcium ion import into cell (GO:1990035)|calcium ion transport into cytosol (GO:0060402)|cell communication (GO:0007154)|cellular response to cAMP (GO:0071320)|hematopoietic progenitor cell differentiation (GO:0002244)|ion transport (GO:0006811)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	calcium:sodium antiporter activity (GO:0005432)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(18)|ovary(2)|pancreas(2)|prostate(3)|skin(6)	54				BRCA - Breast invasive adenocarcinoma(234;0.0079)|all cancers(60;0.0102)|OV - Ovarian serous cystadenocarcinoma(108;0.0555)		GTGTGCACCTCGCTCATGCTG	0.512																																					p.E385K		.											.	SLC8A3-225	0			c.G1153A						.						126.0	116.0	119.0					14																	70633987		2203	4300	6503	SO:0001583	missense	6547	exon2			GCACCTCGCTCAT	AJ304852	CCDS9799.1, CCDS9800.1, CCDS35498.1, CCDS41967.1, CCDS45131.1, CCDS53904.1	14q24.1	2013-05-22	2008-09-02		ENSG00000100678	ENSG00000100678		"""Solute carriers"""	11070	protein-coding gene	gene with protein product		607991				8798769	Standard	XM_005268017		Approved	NCX3	uc001xly.3	P57103	OTTHUMG00000152342	ENST00000381269.2:c.1153G>A	14.37:g.70633987C>T	ENSP00000370669:p.Glu385Lys	205	2		149	87	NM_183002	0	0	0	1	1	Q5K3P6|Q5K3P7|Q8IUE9|Q8IUF0|Q8NFI7|Q96QG1|Q96QG2	Missense_Mutation	SNP	ENST00000381269.2	37	CCDS35498.1	.	.	.	.	.	.	.	.	.	.	C	11.86	1.764362	0.31228	.	.	ENSG00000100678	ENST00000356921;ENST00000381269;ENST00000357887;ENST00000534137;ENST00000528359	T;T;T;T;T	0.36699	1.33;1.24;1.38;1.33;1.38	5.83	5.83	0.93111	Na-Ca exchanger/integrin-beta4 (1);	0.054654	0.64402	D	0.000001	T	0.55386	0.1917	L	0.55990	1.75	0.80722	D	1	P;P;D;D	0.61080	0.811;0.843;0.989;0.989	B;B;P;P	0.62740	0.146;0.228;0.906;0.874	T	0.44143	-0.9347	10	0.37606	T	0.19	.	20.1242	0.97973	0.0:1.0:0.0:0.0	.	385;385;385;385	P57103-2;P57103;Q96QG2;Q96QG1	.;NAC3_HUMAN;.;.	K	385	ENSP00000349392:E385K;ENSP00000370669:E385K;ENSP00000350560:E385K;ENSP00000436688:E385K;ENSP00000433531:E385K	ENSP00000349392:E385K	E	-	1	0	SLC8A3	69703740	1.000000	0.71417	0.979000	0.43373	0.631000	0.37964	4.942000	0.63547	2.744000	0.94065	0.643000	0.83706	GAG	.		0.512	SLC8A3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390736.1		
PAPLN	89932	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	73720491	73720491	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr14:73720491C>T	ENST00000554301.1	+	11	1287	c.1124C>T	c.(1123-1125)tCa>tTa	p.S375L	PAPLN_ENST00000427855.1_Missense_Mutation_p.S375L|PAPLN_ENST00000555445.1_Missense_Mutation_p.S375L|PAPLN_ENST00000340738.5_Missense_Mutation_p.S348L|PAPLN_ENST00000381166.3_Missense_Mutation_p.S375L			O95428	PPN_HUMAN	papilin, proteoglycan-like sulfated glycoprotein	375	TSP type-1 3. {ECO:0000255|PROSITE- ProRule:PRU00210}.					basement membrane (GO:0005604)	metalloendopeptidase activity (GO:0004222)|serine-type endopeptidase inhibitor activity (GO:0004867)|zinc ion binding (GO:0008270)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(11)|ovary(3)|pancreas(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(3)	42				BRCA - Breast invasive adenocarcinoma(234;0.00394)|OV - Ovarian serous cystadenocarcinoma(108;0.0468)		GCACCCTGCTCAGCCTCCTGT	0.672																																					p.S348L		.											.	PAPLN-70	0			c.C1043T						.						44.0	47.0	46.0					14																	73720491		2202	4299	6501	SO:0001583	missense	89932	exon11			CCTGCTCAGCCTC	BC042057	CCDS32114.1	14q24.2	2013-01-11				ENSG00000100767		"""Immunoglobulin superfamily / I-set domain containing"""	19262	protein-coding gene	gene with protein product						11076767, 19734141	Standard	NM_173462		Approved	MGC50452	uc001xnw.4	O95428		ENST00000554301.1:c.1124C>T	14.37:g.73720491C>T	ENSP00000451803:p.Ser375Leu	157	1		135	30	NM_173462	0	0	1	1	0	B4DES8|B4DGE6|Q659F2|Q6UXJ4|Q6ZNM1|Q6ZUJ0|Q7Z681|Q8IVU0	Missense_Mutation	SNP	ENST00000554301.1	37		.	.	.	.	.	.	.	.	.	.	C	17.90	3.503048	0.64298	.	.	ENSG00000100767	ENST00000340738;ENST00000427855;ENST00000381166;ENST00000554301;ENST00000555445	T;T;T;T;T	0.68479	-0.33;-0.33;-0.33;-0.33;-0.33	4.57	4.57	0.56435	.	.	.	.	.	D	0.89111	0.6622	H	0.98351	4.21	0.53005	D	0.999967	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.994	D	0.93625	0.6951	9	0.87932	D	0	.	17.5437	0.87855	0.0:1.0:0.0:0.0	.	375;375;348	O95428-5;O95428;O95428-6	.;PPN_HUMAN;.	L	348;375;375;375;375	ENSP00000345395:S348L;ENSP00000403403:S375L;ENSP00000370558:S375L;ENSP00000451803:S375L;ENSP00000451729:S375L	ENSP00000216658:S375L	S	+	2	0	PAPLN	72790244	1.000000	0.71417	0.939000	0.37840	0.046000	0.14306	7.385000	0.79763	2.385000	0.81259	0.462000	0.41574	TCA	.		0.672	PAPLN-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000413182.1	NM_173462	
FLRT2	23768	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	86088747	86088747	+	Missense_Mutation	SNP	G	G	C	rs199966508		TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr14:86088747G>C	ENST00000330753.4	+	2	1656	c.889G>C	c.(889-891)Gat>Cat	p.D297H	FLRT2_ENST00000554746.1_Missense_Mutation_p.D297H	NM_013231.4	NP_037363.1	O43155	FLRT2_HUMAN	fibronectin leucine rich transmembrane protein 2	297					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)|regulation of neuron migration (GO:2001222)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	chemorepellent activity (GO:0045499)|protein binding, bridging (GO:0030674)|receptor signaling protein activity (GO:0005057)			NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(21)|lung(27)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	73				BRCA - Breast invasive adenocarcinoma(234;0.0319)		AGGGGTTTTTGATAATCTCTC	0.448																																					p.D297H		.											.	FLRT2-94	0			c.G889C						.						169.0	178.0	175.0					14																	86088747		2203	4300	6503	SO:0001583	missense	23768	exon2			GTTTTTGATAATC	AF169676	CCDS9877.1	14q24-q32	2013-02-11				ENSG00000185070		"""Fibronectin type III domain containing"""	3761	protein-coding gene	gene with protein product		604807				10644439, 16872596	Standard	XM_005267490		Approved		uc001xvr.3	O43155		ENST00000330753.4:c.889G>C	14.37:g.86088747G>C	ENSP00000332879:p.Asp297His	367	1		405	57	NM_013231	0	0	0	0	0	A0AV84|B7ZLP3	Missense_Mutation	SNP	ENST00000330753.4	37	CCDS9877.1	.	.	.	.	.	.	.	.	.	.	G	17.30	3.355620	0.61293	.	.	ENSG00000185070	ENST00000330753;ENST00000554746	T;T	0.58210	0.35;0.35	5.97	5.97	0.96955	.	0.048069	0.85682	D	0.000000	T	0.64316	0.2587	L	0.32530	0.975	0.80722	D	1	D	0.65815	0.995	D	0.65233	0.933	T	0.63747	-0.6567	10	0.59425	D	0.04	-19.3382	20.4238	0.99064	0.0:0.0:1.0:0.0	.	297	O43155	FLRT2_HUMAN	H	297	ENSP00000332879:D297H;ENSP00000451050:D297H	ENSP00000332879:D297H	D	+	1	0	FLRT2	85158500	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	8.061000	0.89467	2.828000	0.97474	0.655000	0.94253	GAT	G|0.999;T|0.000		0.448	FLRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413193.1		
EML5	161436	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	89161727	89161727	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr14:89161727C>T	ENST00000380664.5	-	16	2415	c.2416G>A	c.(2416-2418)Gga>Aga	p.G806R	EML5_ENST00000352093.5_Missense_Mutation_p.G806R|EML5_ENST00000554922.1_Missense_Mutation_p.G806R			Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like 5	806						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	catalytic activity (GO:0003824)			breast(1)|endometrium(3)|kidney(4)|large_intestine(17)|lung(14)|ovary(3)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						AGTTTCTCTCCTTTCTTCCAG	0.338																																					p.G806R		.											.	EML5-93	0			c.G2416A						.						88.0	79.0	82.0					14																	89161727		1843	4083	5926	SO:0001583	missense	161436	exon16			TCTCTCCTTTCTT	AY357725	CCDS45148.1	14q31.3	2013-01-10				ENSG00000165521		"""WD repeat domain containing"""	18197	protein-coding gene	gene with protein product							Standard	NM_183387		Approved	HuEMAP-2, EMAP-2	uc021ryf.1	Q05BV3		ENST00000380664.5:c.2416G>A	14.37:g.89161727C>T	ENSP00000370039:p.Gly806Arg	44	0		77	17	NM_183387	0	0	1	1	0	B9EK59|Q5H9N6|Q6UYC9|Q6ZRP3|Q6ZT03	Missense_Mutation	SNP	ENST00000380664.5	37	CCDS45148.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.718501	0.89205	.	.	ENSG00000165521	ENST00000554922;ENST00000352093;ENST00000380664	T;T;T	0.65916	-0.18;1.86;-0.18	4.86	4.86	0.63082	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.80391	0.4614	M	0.81239	2.535	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.81899	-0.0721	10	0.51188	T	0.08	-15.3073	17.7789	0.88517	0.0:1.0:0.0:0.0	.	806	Q05BV3	EMAL5_HUMAN	R	806	ENSP00000451998:G806R;ENSP00000298315:G806R;ENSP00000370039:G806R	ENSP00000298315:G806R	G	-	1	0	EML5	88231480	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	7.320000	0.79064	2.526000	0.85167	0.467000	0.42956	GGA	.		0.338	EML5-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000410491.1		
MARK3	4140	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	103932113	103932113	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr14:103932113G>C	ENST00000429436.2	+	8	1270	c.760G>C	c.(760-762)Gat>Cat	p.D254H	MARK3_ENST00000561071.1_Intron|MARK3_ENST00000416682.2_Missense_Mutation_p.D277H|MARK3_ENST00000440884.3_Intron|MARK3_ENST00000335102.5_Missense_Mutation_p.D277H|MARK3_ENST00000553942.1_Missense_Mutation_p.D254H|MARK3_ENST00000303622.9_Missense_Mutation_p.D254H|MARK3_ENST00000216288.7_Missense_Mutation_p.D254H	NM_001128918.1|NM_001128919.1	NP_001122390.1|NP_001122391.1	P27448	MARK3_HUMAN	MAP/microtubule affinity-regulating kinase 3	254	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30		Melanoma(154;0.155)	Epithelial(46;0.241)			ACTTCCCTTTGATGGGCAAAA	0.403																																					p.D254H		.											.	MARK3-360	0			c.G760C						.						64.0	65.0	65.0					14																	103932113		1975	4183	6158	SO:0001583	missense	4140	exon8			CCCTTTGATGGGC	M80359	CCDS41993.1, CCDS45165.1, CCDS45166.1, CCDS45167.1, CCDS55947.1	14q32.32	2014-04-07			ENSG00000075413	ENSG00000075413			6897	protein-coding gene	gene with protein product		602678				9533022	Standard	NM_002376		Approved	CTAK1, KP78, PAR-1A	uc001ymz.4	P27448	OTTHUMG00000171789	ENST00000429436.2:c.760G>C	14.37:g.103932113G>C	ENSP00000411397:p.Asp254His	94	0		56	9	NM_001128919	0	0	23	31	8	O60219|Q86TT8|Q8TB41|Q8WX83|Q96RG1|Q9UMY9|Q9UN34	Missense_Mutation	SNP	ENST00000429436.2	37	CCDS45165.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.1|26.1	4.702752|4.702752	0.88924|0.88924	.|.	.|.	ENSG00000075413|ENSG00000075413	ENST00000335102;ENST00000416682;ENST00000429436;ENST00000303622;ENST00000216288;ENST00000553942|ENST00000554627	T;T;T;T;T;T|.	0.66280|.	-0.2;-0.2;-0.2;-0.2;-0.2;-0.2|.	5.84|5.84	5.84|5.84	0.93424|0.93424	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.61185|0.61185	0.2327|0.2327	L|L	0.33189|0.33189	0.99|0.99	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0;1.0|.	D;D;D;D;D;D|.	0.97110|.	0.997;0.996;0.999;0.998;1.0;0.995|.	T|T	0.53208|0.53208	-0.8471|-0.8471	10|5	0.87932|.	D|.	0|.	.|.	20.1454|20.1454	0.98074|0.98074	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	277;277;254;254;254;254|.	P27448-7;P27448-2;P27448-6;P27448;P27448-4;P27448-3|.	.;.;.;MARK3_HUMAN;.;.|.	H|F	277;277;254;254;254;254|21	ENSP00000335347:D277H;ENSP00000408092:D277H;ENSP00000411397:D254H;ENSP00000303698:D254H;ENSP00000216288:D254H;ENSP00000450772:D254H|.	ENSP00000216288:D254H|.	D|L	+|+	1|3	0|2	MARK3|MARK3	103001866|103001866	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.996000|0.996000	0.88848|0.88848	9.807000|9.807000	0.99171|0.99171	2.748000|2.748000	0.94277|0.94277	0.650000|0.650000	0.86243|0.86243	GAT|TTG	.		0.403	MARK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415144.1	NM_001128918	
MARK3	4140	ucsc.edu	37	14	103932725	103932725	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr14:103932725G>A	ENST00000429436.2	+	10	1453	c.943G>A	c.(943-945)Gaa>Aaa	p.E315K	MARK3_ENST00000561071.1_Intron|MARK3_ENST00000416682.2_Missense_Mutation_p.E338K|MARK3_ENST00000440884.3_Missense_Mutation_p.E236K|MARK3_ENST00000335102.5_Missense_Mutation_p.E338K|MARK3_ENST00000553942.1_Missense_Mutation_p.E315K|MARK3_ENST00000303622.9_Missense_Mutation_p.E315K|MARK3_ENST00000216288.7_Missense_Mutation_p.E315K	NM_001128918.1|NM_001128919.1	NP_001122390.1|NP_001122391.1	P27448	MARK3_HUMAN	MAP/microtubule affinity-regulating kinase 3	315						plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30		Melanoma(154;0.155)	Epithelial(46;0.241)			TGAAGAAGATGAACTCAAACC	0.373																																					p.E315K													.	MARK3-360	0			c.G943A						.						109.0	97.0	101.0					14																	103932725		1910	4129	6039	SO:0001583	missense	4140	exon10			GAAGATGAACTCA	M80359	CCDS41993.1, CCDS45165.1, CCDS45166.1, CCDS45167.1, CCDS55947.1	14q32.32	2014-04-07			ENSG00000075413	ENSG00000075413			6897	protein-coding gene	gene with protein product		602678				9533022	Standard	NM_002376		Approved	CTAK1, KP78, PAR-1A	uc001ymz.4	P27448	OTTHUMG00000171789	ENST00000429436.2:c.943G>A	14.37:g.103932725G>A	ENSP00000411397:p.Glu315Lys	46	0		19	3	NM_001128919	0	0	38	50	12	O60219|Q86TT8|Q8TB41|Q8WX83|Q96RG1|Q9UMY9|Q9UN34	Missense_Mutation	SNP	ENST00000429436.2	37	CCDS45165.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	36|36	5.634428|5.634428	0.96682|0.96682	.|.	.|.	ENSG00000075413|ENSG00000075413	ENST00000335102;ENST00000440884;ENST00000416682;ENST00000429436;ENST00000303622;ENST00000216288;ENST00000553942|ENST00000554627	T;T;T;T;T;T;T|.	0.74002|.	-0.8;3.14;-0.74;-0.76;-0.75;1.85;-0.76|.	5.69|5.69	5.69|5.69	0.88448|0.88448	Protein kinase-like domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.66567|0.66567	0.2802|0.2802	L|L	0.38838|0.38838	1.175|1.175	0.80722|0.80722	D|D	1|1	P;D;P;B;D;D;B|.	0.63046|.	0.749;0.981;0.849;0.446;0.986;0.992;0.392|.	P;P;B;B;D;P;B|.	0.64776|.	0.511;0.876;0.375;0.138;0.929;0.868;0.058|.	T|T	0.60777|0.60777	-0.7196|-0.7196	10|5	0.41790|.	T|.	0.15|.	.|.	19.8215|19.8215	0.96599|0.96599	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	338;338;315;315;236;315;315|.	P27448-7;P27448-2;P27448-6;P27448;Q86TT8;P27448-4;P27448-3|.	.;.;.;MARK3_HUMAN;.;.;.|.	K|I	338;236;338;315;315;315;315|82	ENSP00000335347:E338K;ENSP00000402104:E236K;ENSP00000408092:E338K;ENSP00000411397:E315K;ENSP00000303698:E315K;ENSP00000216288:E315K;ENSP00000450772:E315K|.	ENSP00000216288:E315K|.	E|M	+|+	1|3	0|0	MARK3|MARK3	103002478|103002478	1.000000|1.000000	0.71417|0.71417	0.927000|0.927000	0.36925|0.36925	0.971000|0.971000	0.66376|0.66376	7.645000|7.645000	0.83430|0.83430	2.679000|2.679000	0.91253|0.91253	0.650000|0.650000	0.86243|0.86243	GAA|ATG	.		0.373	MARK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415144.1	NM_001128918	
AHNAK2	113146	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	105409722	105409722	+	Silent	SNP	G	G	A	rs372712364	byFrequency	TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr14:105409722G>A	ENST00000333244.5	-	7	12185	c.12066C>T	c.(12064-12066)tcC>tcT	p.S4022S	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	4022						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CCAGGTCAGCGGAAGGGGGCT	0.657													.|||	2	0.000399361	0.0008	0.0014	5008	,	,		17513	0.0		0.0	False		,,,				2504	0.0				p.S4022S		.											.	AHNAK2-47	0			c.C12066T						.						109.0	115.0	113.0					14																	105409722		1954	4133	6087	SO:0001819	synonymous_variant	113146	exon7			GTCAGCGGAAGGG	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.12066C>T	14.37:g.105409722G>A		333	0		126	88	NM_138420	0	0	4	4	0	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Silent	SNP	ENST00000333244.5	37	CCDS45177.1																																																																																			.		0.657	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
ZFYVE19	84936	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	41099974	41099974	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr15:41099974G>A	ENST00000355341.4	+	1	688	c.187G>A	c.(187-189)Gat>Aat	p.D63N	ZFYVE19_ENST00000564258.1_Intron|ZFYVE19_ENST00000299173.10_Missense_Mutation_p.D63N|ZFYVE19_ENST00000336455.5_Intron|ZFYVE19_ENST00000570108.1_Intron|ZFYVE19_ENST00000563530.1_3'UTR|DNAJC17_ENST00000220496.4_5'Flank	NM_001077268.1	NP_001070736.1	Q96K21	ANCHR_HUMAN	zinc finger, FYVE domain containing 19	63					abscission (GO:0009838)|cell division (GO:0051301)|cytokinesis checkpoint (GO:0031565)|negative regulation of cytokinesis (GO:0032466)	centrosome (GO:0005813)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|midbody (GO:0030496)	phosphatidylinositol-3-phosphate binding (GO:0032266)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	9		all_cancers(109;3.31e-18)|all_epithelial(112;2.33e-15)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;2.76e-05)|COAD - Colon adenocarcinoma(120;0.151)|BRCA - Breast invasive adenocarcinoma(123;0.164)		TGGCCGGCGTGATCTCAGCTC	0.672																																					p.D63N		.											.	ZFYVE19-91	0			c.G187A						.						36.0	46.0	42.0					15																	41099974		2053	4206	6259	SO:0001583	missense	84936	exon1			CGGCGTGATCTCA	AK027746	CCDS42025.1, CCDS58353.1, CCDS58354.1, CCDS58355.1	15q14	2008-05-02				ENSG00000166140		"""Zinc fingers, FYVE domain containing"""	20758	protein-coding gene	gene with protein product							Standard	NM_001077268		Approved	FLJ14840	uc031qrk.1	Q96K21		ENST00000355341.4:c.187G>A	15.37:g.41099974G>A	ENSP00000347498:p.Asp63Asn	43	0		30	18	NM_001077268	0	0	8	15	7	B3KVB2|C9JNF4|H3BUF9|Q86WC2|Q8WU96	Missense_Mutation	SNP	ENST00000355341.4	37	CCDS42025.1	.	.	.	.	.	.	.	.	.	.	G	15.18	2.756051	0.49362	.	.	ENSG00000166140	ENST00000355341;ENST00000299173	T;T	0.37058	1.23;1.22	4.57	1.69	0.24217	.	1.328960	0.05087	N	0.484506	T	0.25680	0.0625	N	0.19112	0.55	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.08055	0.003;0.001	T	0.29610	-1.0006	10	0.72032	D	0.01	1.3232	6.5318	0.22332	0.2972:0.0:0.7028:0.0	.	63;63	Q96K21-3;Q96K21	.;ZFY19_HUMAN	N	63	ENSP00000347498:D63N;ENSP00000299173:D63N	ENSP00000299173:D63N	D	+	1	0	ZFYVE19	38887266	0.001000	0.12720	0.000000	0.03702	0.004000	0.04260	1.012000	0.29924	0.425000	0.26087	0.603000	0.83216	GAT	.		0.672	ZFYVE19-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000418996.1	NM_032850	
ZFYVE19	84936	broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	41100015	41100015	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr15:41100015G>A	ENST00000355341.4	+	1	729	c.228G>A	c.(226-228)atG>atA	p.M76I	ZFYVE19_ENST00000564258.1_Intron|ZFYVE19_ENST00000299173.10_Missense_Mutation_p.M76I|ZFYVE19_ENST00000336455.5_Intron|ZFYVE19_ENST00000570108.1_Missense_Mutation_p.M53I|ZFYVE19_ENST00000563530.1_3'UTR|DNAJC17_ENST00000220496.4_5'Flank	NM_001077268.1	NP_001070736.1	Q96K21	ANCHR_HUMAN	zinc finger, FYVE domain containing 19	76					abscission (GO:0009838)|cell division (GO:0051301)|cytokinesis checkpoint (GO:0031565)|negative regulation of cytokinesis (GO:0032466)	centrosome (GO:0005813)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|midbody (GO:0030496)	phosphatidylinositol-3-phosphate binding (GO:0032266)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	9		all_cancers(109;3.31e-18)|all_epithelial(112;2.33e-15)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;2.76e-05)|COAD - Colon adenocarcinoma(120;0.151)|BRCA - Breast invasive adenocarcinoma(123;0.164)		GAGCCACCATGGAGAGTAGGT	0.657																																					p.M76I													.	ZFYVE19-91	0			c.G228A						.						40.0	49.0	46.0					15																	41100015		2070	4201	6271	SO:0001583	missense	84936	exon1			CACCATGGAGAGT	AK027746	CCDS42025.1, CCDS58353.1, CCDS58354.1, CCDS58355.1	15q14	2008-05-02				ENSG00000166140		"""Zinc fingers, FYVE domain containing"""	20758	protein-coding gene	gene with protein product							Standard	NM_001077268		Approved	FLJ14840	uc031qrk.1	Q96K21		ENST00000355341.4:c.228G>A	15.37:g.41100015G>A	ENSP00000347498:p.Met76Ile	39	0		37	10	NM_001077268	0	0	2	5	3	B3KVB2|C9JNF4|H3BUF9|Q86WC2|Q8WU96	Missense_Mutation	SNP	ENST00000355341.4	37	CCDS42025.1	.	.	.	.	.	.	.	.	.	.	G	33	5.220228	0.95139	.	.	ENSG00000166140	ENST00000355341;ENST00000299173	T;T	0.41065	1.01;1.01	5.5	5.5	0.81552	Zinc finger, FYVE-type (1);Zinc finger, FYVE/PHD-type (1);	171.812000	0.00166	N	0.000000	T	0.72827	0.3509	M	0.77486	2.375	0.54753	D	0.999986	D;D	0.71674	0.998;0.998	D;D	0.80764	0.991;0.994	T	0.54860	-0.8230	10	0.45353	T	0.12	-2.0204	18.3837	0.90459	0.0:0.0:1.0:0.0	.	76;76	Q96K21-3;Q96K21	.;ZFY19_HUMAN	I	76	ENSP00000347498:M76I;ENSP00000299173:M76I	ENSP00000299173:M76I	M	+	3	0	ZFYVE19	38887307	1.000000	0.71417	1.000000	0.80357	0.689000	0.40095	8.435000	0.90297	2.866000	0.98385	0.650000	0.86243	ATG	.		0.657	ZFYVE19-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000418996.1	NM_032850	
INO80	54617	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	41384347	41384347	+	Missense_Mutation	SNP	C	C	A			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr15:41384347C>A	ENST00000361937.3	-	5	839	c.415G>T	c.(415-417)Gat>Tat	p.D139Y	INO80_ENST00000401393.3_Missense_Mutation_p.D139Y			Q9ULG1	INO80_HUMAN	INO80 complex subunit	139	Assembles INO80 complex module with putative regulatory components INO80E, INO80F, UCHL5, NFRKB, MCRS1 and IN80D.				ATP catabolic process (GO:0006200)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|mitotic sister chromatid segregation (GO:0000070)|positive regulation of cell growth (GO:0030307)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|spindle assembly (GO:0051225)|UV-damage excision repair (GO:0070914)	Ino80 complex (GO:0031011)|microtubule (GO:0005874)|nucleus (GO:0005634)	alpha-tubulin binding (GO:0043014)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			NS(1)|breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						CTCTGAGAATCAGCCTCGCTG	0.378																																					p.D139Y		.											.	INO80-72	0			c.G415T						.						123.0	114.0	117.0					15																	41384347		2203	4300	6503	SO:0001583	missense	54617	exon5			GAGAATCAGCCTC	AB033085	CCDS10071.1	15q15.1	2013-08-21	2013-08-21	2008-08-07	ENSG00000128908	ENSG00000128908	3.6.1.3	"""INO80 complex subunits"""	26956	protein-coding gene	gene with protein product	"""INO80 complex subunit A"""	610169	"""INO80 complex homolog 1 (S. cerevisiae)"", ""INO80 homolog (S. cerevisiae)"""	INOC1		16298340, 16230350, 20237820	Standard	NM_017553		Approved	KIAA1259, Ino80, hINO80, INO80A	uc001zni.3	Q9ULG1	OTTHUMG00000130209	ENST00000361937.3:c.415G>T	15.37:g.41384347C>A	ENSP00000355205:p.Asp139Tyr	65	0		42	19	NM_017553	0	0	2	8	6	A6H8X4|Q9NTG6	Missense_Mutation	SNP	ENST00000361937.3	37	CCDS10071.1	.	.	.	.	.	.	.	.	.	.	C	16.39	3.111190	0.56398	.	.	ENSG00000128908	ENST00000361937;ENST00000401393	D;D	0.92752	-3.1;-3.1	5.37	5.37	0.77165	.	0.099076	0.64402	D	0.000002	D	0.92612	0.7653	L	0.59436	1.845	0.80722	D	1	P	0.51791	0.948	P	0.47626	0.552	D	0.93222	0.6609	10	0.72032	D	0.01	.	19.3098	0.94182	0.0:1.0:0.0:0.0	.	139	Q9ULG1	INO80_HUMAN	Y	139	ENSP00000355205:D139Y;ENSP00000384686:D139Y	ENSP00000355205:D139Y	D	-	1	0	INO80	39171639	1.000000	0.71417	1.000000	0.80357	0.070000	0.16714	6.847000	0.75404	2.800000	0.96347	0.455000	0.32223	GAT	.		0.378	INO80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252527.2	NM_017553	
TRPM7	54822	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	50906430	50906430	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr15:50906430G>C	ENST00000313478.7	-	14	1806	c.1525C>G	c.(1525-1527)Ctg>Gtg	p.L509V	TRPM7_ENST00000560955.1_Missense_Mutation_p.L509V	NM_017672.4	NP_060142.3	Q96QT4	TRPM7_HUMAN	transient receptor potential cation channel, subfamily M, member 7	509					actomyosin structure organization (GO:0031032)|calcium ion transmembrane transport (GO:0070588)|calcium-dependent cell-matrix adhesion (GO:0016340)|cellular magnesium ion homeostasis (GO:0010961)|ion transmembrane transport (GO:0034220)|necroptotic process (GO:0070266)|protein autophosphorylation (GO:0046777)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(17)|lung(13)|ovary(4)|pancreas(1)|skin(4)|stomach(3)	52				all cancers(107;0.000819)|GBM - Glioblastoma multiforme(94;0.0045)		ATATCAATCAGAGTGATCTTA	0.363																																					p.L509V		.											.	TRPM7-392	0			c.C1525G						.						77.0	73.0	74.0					15																	50906430		1819	4082	5901	SO:0001583	missense	54822	exon14			CAATCAGAGTGAT	AF346629	CCDS42035.1, CCDS73725.1	15q21	2011-12-14				ENSG00000092439		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17994	protein-coding gene	gene with protein product		605692				11161216, 11385574, 16382100	Standard	XM_005254486		Approved	CHAK1, LTRPC7, TRP-PLIK	uc001zyt.4	Q96QT4		ENST00000313478.7:c.1525C>G	15.37:g.50906430G>C	ENSP00000320239:p.Leu509Val	80	2		50	24	NM_017672	0	0	5	13	8	Q6ZMF5|Q86VJ4|Q8NBW2|Q9BXB2|Q9NXQ2	Missense_Mutation	SNP	ENST00000313478.7	37	CCDS42035.1	.	.	.	.	.	.	.	.	.	.	G	16.53	3.149746	0.57151	.	.	ENSG00000092439	ENST00000313478	T	0.69685	-0.42	4.99	3.08	0.35506	.	0.079472	0.51477	D	0.000082	T	0.71091	0.3299	M	0.77712	2.385	0.47511	D	0.999449	D	0.58620	0.983	P	0.51016	0.656	T	0.70615	-0.4823	10	0.49607	T	0.09	-10.3651	8.4541	0.32888	0.3035:0.0:0.6965:0.0	.	509	Q96QT4	TRPM7_HUMAN	V	509	ENSP00000320239:L509V	ENSP00000320239:L509V	L	-	1	2	TRPM7	48693722	0.997000	0.39634	1.000000	0.80357	0.995000	0.86356	2.080000	0.41586	0.667000	0.31107	0.563000	0.77884	CTG	.		0.363	TRPM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000418604.1	NM_017672	
DMXL2	23312	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	51773559	51773559	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr15:51773559G>A	ENST00000251076.5	-	24	6031	c.5744C>T	c.(5743-5745)tCt>tTt	p.S1915F	RP11-707P17.1_ENST00000561007.1_RNA|DMXL2_ENST00000449909.3_Missense_Mutation_p.S1279F|DMXL2_ENST00000543779.2_Missense_Mutation_p.S1915F	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	1915						cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		AGATAAGGCAGATGTTTTGGT	0.383																																					p.S1915F		.											.	DMXL2-99	0			c.C5744T						.						190.0	183.0	185.0					15																	51773559		2196	4293	6489	SO:0001583	missense	23312	exon24			AAGGCAGATGTTT	AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.5744C>T	15.37:g.51773559G>A	ENSP00000251076:p.Ser1915Phe	195	1		185	88	NM_001174116	0	0	1	4	3	B2RTR3|B7ZMH3|F5GWF1|O94938	Missense_Mutation	SNP	ENST00000251076.5	37	CCDS10141.1	.	.	.	.	.	.	.	.	.	.	G	11.80	1.745636	0.30955	.	.	ENSG00000104093	ENST00000251076;ENST00000543779;ENST00000449909	T;T;T	0.26660	1.85;1.85;1.72	5.65	4.68	0.58851	.	0.408961	0.29624	N	0.011623	T	0.23289	0.0563	L	0.48986	1.54	0.30040	N	0.812686	B;B;B	0.18863	0.001;0.031;0.0	B;B;B	0.10450	0.004;0.005;0.002	T	0.08806	-1.0704	10	0.56958	D	0.05	.	9.5634	0.39383	0.0741:0.1436:0.7824:0.0	.	1915;1279;1915	F5GWF1;B2RTR3;Q8TDJ6	.;.;DMXL2_HUMAN	F	1915;1915;1279	ENSP00000251076:S1915F;ENSP00000441858:S1915F;ENSP00000400855:S1279F	ENSP00000251076:S1915F	S	-	2	0	DMXL2	49560851	0.996000	0.38824	0.872000	0.34217	0.993000	0.82548	3.716000	0.54904	2.665000	0.90641	0.650000	0.86243	TCT	.		0.383	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254671.2	NM_015263	
AKAP13	11214	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	86269660	86269660	+	Silent	SNP	C	C	G			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr15:86269660C>G	ENST00000394518.2	+	27	6860	c.6765C>G	c.(6763-6765)ctC>ctG	p.L2255L	AKAP13_ENST00000394510.2_Silent_p.L500L|RP11-158M2.2_ENST00000561417.1_RNA|AKAP13_ENST00000560579.1_3'UTR|AKAP13_ENST00000361243.2_Silent_p.L2259L	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	Q12802	AKP13_HUMAN	A kinase (PRKA) anchor protein 13	2255	Interaction with ESR1.|PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nuclear export (GO:0051168)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle hypertrophy (GO:0010611)|regulation of glucocorticoid mediated signaling pathway (GO:1900169)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cAMP-dependent protein kinase activity (GO:0004691)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|central_nervous_system(4)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(13)|liver(1)|lung(43)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	98						CAGTTCTTCTCACTGACATTT	0.338																																					p.L2259L	Melanoma(94;603 1453 3280 32295 32951)	.											.	AKAP13-258	0			c.C6777G						.						184.0	186.0	186.0					15																	86269660		2202	4298	6500	SO:0001819	synonymous_variant	11214	exon27			TCTTCTCACTGAC	M90360	CCDS32319.1, CCDS32320.1, CCDS73778.1	15q24-q25	2013-01-10	2002-06-13			ENSG00000170776		"""A-kinase anchor proteins"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	371	protein-coding gene	gene with protein product		604686	"""lymphoid blast crisis oncogene"""	LBC		9627117, 1860836	Standard	NM_007200		Approved	Ht31, BRX, AKAP-Lbc, c-lbc, PROTO-LB, HA-3, ARHGEF13	uc002blu.2	Q12802		ENST00000394518.2:c.6765C>G	15.37:g.86269660C>G		143	0		130	31	NM_006738	0	0	18	23	5	Q14572|Q59FP6|Q86W90|Q8WXQ6|Q96JP6|Q96P79|Q9Y5T0|Q9Y5T6	Silent	SNP	ENST00000394518.2	37	CCDS32319.1																																																																																			.		0.338	AKAP13-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417318.1	NM_007200	
PRC1	9055	broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	91524227	91524227	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr15:91524227C>T	ENST00000361188.5	-	6	1920	c.709G>A	c.(709-711)Gag>Aag	p.E237K	PRC1_ENST00000361919.3_Missense_Mutation_p.E237K|PRC1_ENST00000442656.2_Missense_Mutation_p.E196K|PRC1_ENST00000394249.3_Missense_Mutation_p.E237K|PRC1-AS1_ENST00000554388.1_RNA					protein regulator of cytokinesis 1									p.E237Q(1)		endometrium(1)|kidney(2)|large_intestine(7)|lung(9)|ovary(3)|prostate(1)|skin(2)	25	Lung NSC(78;0.0987)|all_lung(78;0.175)					CGCAGCCCCTCACACACTGCT	0.507																																					p.E237K													.	PRC1-92	1	Substitution - Missense(1)	ovary(1)	c.G709A						.						110.0	107.0	108.0					15																	91524227		2198	4298	6496	SO:0001583	missense	9055	exon6			GCCCCTCACACAC	AF044588	CCDS32334.1, CCDS45352.1, CCDS45353.1, CCDS45353.2	15q26.1	2013-05-29		2006-07-07	ENSG00000198901	ENSG00000198901			9341	protein-coding gene	gene with protein product	"""anaphase spindle elongation 1 homolog (S. cerevisiae)"""	603484				9885575	Standard	NM_003981		Approved	ASE1	uc002bqm.4	O43663	OTTHUMG00000171685	ENST00000361188.5:c.709G>A	15.37:g.91524227C>T	ENSP00000354679:p.Glu237Lys	161	0		125	15	NM_199413	0	0	41	54	13		Missense_Mutation	SNP	ENST00000361188.5	37	CCDS45352.1	.	.	.	.	.	.	.	.	.	.	C	13.49	2.253520	0.39797	.	.	ENSG00000198901	ENST00000394249;ENST00000361919;ENST00000361188;ENST00000442656;ENST00000556982	T;T;T;T	0.28666	1.6;1.6;1.6;1.6	5.19	5.19	0.71726	.	0.240235	0.41605	D	0.000850	T	0.49012	0.1532	M	0.74258	2.255	0.41448	D	0.987967	P;P;P;P	0.51933	0.936;0.936;0.936;0.949	P;P;P;P	0.57960	0.738;0.811;0.738;0.83	T	0.42085	-0.9472	10	0.08381	T	0.77	.	18.5027	0.90888	0.0:1.0:0.0:0.0	.	196;237;237;237	O43663-3;F8W9B5;O43663-2;O43663	.;.;.;PRC1_HUMAN	K	237;237;237;196;11	ENSP00000377793:E237K;ENSP00000354618:E237K;ENSP00000354679:E237K;ENSP00000409549:E196K	ENSP00000354679:E237K	E	-	1	0	PRC1	89325231	0.608000	0.26966	0.998000	0.56505	0.023000	0.10783	1.659000	0.37387	2.711000	0.92665	0.655000	0.94253	GAG	.		0.507	PRC1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414760.1	NM_003981	
ZNF689	115509	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	30616559	30616559	+	Missense_Mutation	SNP	A	A	G			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr16:30616559A>G	ENST00000287461.3	-	3	866	c.529T>C	c.(529-531)Tac>Cac	p.Y177H	ZNF689_ENST00000566673.1_5'UTR|RP11-146F11.5_ENST00000563540.1_RNA	NM_138447.1	NP_612456.1	Q96CS4	ZN689_HUMAN	zinc finger protein 689	177					regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|prostate(1)|urinary_tract(1)	14			Colorectal(24;0.198)			GGGCAAGGGTAAGGCTTTTTT	0.617																																					p.Y177H		.											.	ZNF689-68	0			c.T529C						.						73.0	78.0	77.0					16																	30616559		2197	4300	6497	SO:0001583	missense	115509	exon3			AAGGGTAAGGCTT	BC014000	CCDS10686.1	16p11.2	2013-01-08			ENSG00000156853	ENSG00000156853		"""Zinc fingers, C2H2-type"", ""-"""	25173	protein-coding gene	gene with protein product							Standard	NM_138447		Approved	FLJ90415	uc031qvq.1	Q96CS4	OTTHUMG00000132415	ENST00000287461.3:c.529T>C	16.37:g.30616559A>G	ENSP00000287461:p.Tyr177His	153	0		70	19	NM_138447	0	0	7	9	2	Q658J5	Missense_Mutation	SNP	ENST00000287461.3	37	CCDS10686.1	.	.	.	.	.	.	.	.	.	.	a	10.15	1.270760	0.23221	.	.	ENSG00000156853	ENST00000287461;ENST00000443190	T	0.60040	0.22	4.94	3.8	0.43715	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.35495	N	0.003162	T	0.43567	0.1253	N	0.25332	0.735	0.32189	N	0.579329	B	0.18166	0.026	B	0.25614	0.062	T	0.54227	-0.8325	10	0.62326	D	0.03	-23.399	9.3707	0.38252	0.8409:0.0:0.0:0.159	.	177	Q96CS4	ZN689_HUMAN	H	177	ENSP00000287461:Y177H	ENSP00000287461:Y177H	Y	-	1	0	ZNF689	30524060	0.355000	0.24921	0.997000	0.53966	0.194000	0.23727	2.424000	0.44714	2.074000	0.62210	0.455000	0.32223	TAC	.		0.617	ZNF689-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255552.1	NM_138447	
SRCAP	10847	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	30749163	30749163	+	Missense_Mutation	SNP	C	C	G			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr16:30749163C>G	ENST00000262518.4	+	34	8187	c.7802C>G	c.(7801-7803)tCt>tGt	p.S2601C	SRCAP_ENST00000344771.4_Missense_Mutation_p.S2443C|RP11-2C24.4_ENST00000483578.1_lincRNA|SRCAP_ENST00000395059.2_Missense_Mutation_p.S2539C	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	2601	Pro-rich.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			AAGAACCTTTCTCTCACCCCT	0.552																																					p.S2601C		.											.	SRCAP-94	0			c.C7802G						.						79.0	68.0	72.0					16																	30749163		2197	4300	6497	SO:0001583	missense	10847	exon34			ACCTTTCTCTCAC	AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.7802C>G	16.37:g.30749163C>G	ENSP00000262518:p.Ser2601Cys	136	0		84	24	NM_006662	0	0	15	24	9	B0JZA6|O15026|Q7Z744|Q9Y5L9	Missense_Mutation	SNP	ENST00000262518.4	37	CCDS10689.2	.	.	.	.	.	.	.	.	.	.	C	7.548	0.662079	0.14645	.	.	ENSG00000080603	ENST00000262518;ENST00000395059;ENST00000344771	D;D;D	0.91792	-2.9;-2.91;-2.91	4.88	3.85	0.44370	.	0.294453	0.24843	N	0.035160	D	0.83594	0.5288	N	0.08118	0	0.22728	N	0.9988	P;P	0.50156	0.932;0.758	P;B	0.46479	0.518;0.319	T	0.76427	-0.2963	10	0.62326	D	0.03	-9.0E-4	7.2792	0.26302	0.0:0.8786:0.0:0.1214	.	2539;2601	Q6ZRS2-2;Q6ZRS2	.;SRCAP_HUMAN	C	2601;2539;2443	ENSP00000262518:S2601C;ENSP00000378499:S2539C;ENSP00000343042:S2443C	ENSP00000262518:S2601C	S	+	2	0	SRCAP	30656664	0.483000	0.25956	0.998000	0.56505	0.666000	0.39218	0.172000	0.16704	2.543000	0.85770	0.467000	0.42956	TCT	.		0.552	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255523.1	NM_006662	
BBS2	583	broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	56518732	56518732	+	Nonsense_Mutation	SNP	G	G	A	rs567573386		TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr16:56518732G>A	ENST00000245157.5	-	17	2527	c.2107C>T	c.(2107-2109)Cga>Tga	p.R703*	BBS2_ENST00000568104.1_Nonsense_Mutation_p.R657*	NM_031885.3	NP_114091	Q9BXC9	BBS2_HUMAN	Bardet-Biedl syndrome 2	703					adult behavior (GO:0030534)|artery smooth muscle contraction (GO:0014824)|brain morphogenesis (GO:0048854)|cartilage development (GO:0051216)|cerebral cortex development (GO:0021987)|cilium morphogenesis (GO:0060271)|fat cell differentiation (GO:0045444)|Golgi to plasma membrane protein transport (GO:0043001)|hippocampus development (GO:0021766)|melanosome transport (GO:0032402)|negative regulation of appetite by leptin-mediated signaling pathway (GO:0038108)|negative regulation of gene expression (GO:0010629)|negative regulation of multicellular organism growth (GO:0040015)|nonmotile primary cilium assembly (GO:0035058)|photoreceptor cell maintenance (GO:0045494)|positive regulation of multicellular organism growth (GO:0040018)|protein localization (GO:0008104)|protein localization to organelle (GO:0033365)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|sperm axoneme assembly (GO:0007288)|striatum development (GO:0021756)|vasodilation (GO:0042311)|visual perception (GO:0007601)	BBSome (GO:0034464)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	RNA polymerase II repressing transcription factor binding (GO:0001103)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|skin(3)	26						TTATTGCTTCGAATTGCATCC	0.398									Bardet-Biedl syndrome				G|||	1	0.000199681	0.0	0.0	5008	,	,		18568	0.001		0.0	False		,,,				2504	0.0				p.R703X													.	BBS2-91	0			c.C2107T						.						154.0	123.0	133.0					16																	56518732		2198	4300	6498	SO:0001587	stop_gained	583	exon17	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	TGCTTCGAATTGC	AF342736	CCDS32451.1	16q21	2013-01-08				ENSG00000125124			967	protein-coding gene	gene with protein product		606151		BBS		11285252	Standard	NM_031885		Approved		uc002ejd.2	Q9BXC9		ENST00000245157.5:c.2107C>T	16.37:g.56518732G>A	ENSP00000245157:p.Arg703*	78	0		75	19	NM_031885	0	0	5	7	2	Q96CM0|Q96SN9	Nonsense_Mutation	SNP	ENST00000245157.5	37	CCDS32451.1	.	.	.	.	.	.	.	.	.	.	G	43	9.864671	0.99283	.	.	ENSG00000125124	ENST00000245157	.	.	.	5.3	5.3	0.74995	.	0.126809	0.49305	D	0.000144	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.21540	T	0.41	-6.8024	14.1321	0.65260	0.0:0.0:0.8135:0.1864	.	.	.	.	X	703	.	ENSP00000245157:R703X	R	-	1	2	BBS2	55076233	1.000000	0.71417	0.992000	0.48379	0.991000	0.79684	5.120000	0.64685	2.629000	0.89072	0.591000	0.81541	CGA	.		0.398	BBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434386.2	NM_031885	
CMTM2	146225	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	66614056	66614056	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr16:66614056G>C	ENST00000268595.2	+	2	564	c.413G>C	c.(412-414)aGa>aCa	p.R138T	RP11-403P17.2_ENST00000568430.1_RNA|CMTM2_ENST00000379486.2_Intron	NM_144673.2	NP_653274.1	Q8TAZ6	CKLF2_HUMAN	CKLF-like MARVEL transmembrane domain containing 2	138	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				chemotaxis (GO:0006935)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	17		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.068)|Epithelial(162;0.212)		GCCATTCATAGATACATACCC	0.483																																					p.R138T		.											.	CMTM2-91	0			c.G413C						.						258.0	204.0	223.0					16																	66614056		2201	4300	6501	SO:0001583	missense	146225	exon2			TTCATAGATACAT	BC025354	CCDS10814.1, CCDS56001.1	16q22.1-q22.3	2008-02-05	2005-11-08	2005-11-08	ENSG00000140932	ENSG00000140932			19173	protein-coding gene	gene with protein product		607885	"""chemokine-like factor super family 2"", ""chemokine-like factor superfamily 2"""	CKLFSF2			Standard	NM_001199317		Approved	MGC39436, FLJ25732	uc002ept.3	Q8TAZ6	OTTHUMG00000137501	ENST00000268595.2:c.413G>C	16.37:g.66614056G>C	ENSP00000268595:p.Arg138Thr	164	0		114	8	NM_144673	0	0	0	0	0	Q5I2A4|Q8N7E5	Missense_Mutation	SNP	ENST00000268595.2	37	CCDS10814.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.416443	0.83449	.	.	ENSG00000140932	ENST00000268595	T	0.35605	1.3	4.51	4.51	0.55191	Marvel (1);	0.000000	0.56097	D	0.000029	T	0.52661	0.1748	L	0.54323	1.7	0.35958	D	0.834422	D	0.89917	1.0	D	0.87578	0.998	T	0.57219	-0.7849	10	0.40728	T	0.16	20.5482	13.0353	0.58867	0.0:0.0:1.0:0.0	.	138	Q8TAZ6	CKLF2_HUMAN	T	138	ENSP00000268595:R138T	ENSP00000268595:R138T	R	+	2	0	CMTM2	65171557	1.000000	0.71417	0.997000	0.53966	0.404000	0.30871	2.341000	0.43983	2.786000	0.95864	0.561000	0.74099	AGA	.		0.483	CMTM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268808.1		
AARS	16	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	70316659	70316659	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr16:70316659G>C	ENST00000261772.8	-	2	151	c.8C>G	c.(7-9)tCt>tGt	p.S3C		NM_001605.2	NP_001596.2			alanyl-tRNA synthetase											breast(3)|cervix(2)|endometrium(5)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|prostate(1)	27		Ovarian(137;0.0365)		BRCA - Breast invasive adenocarcinoma(221;0.161)		TGTTAGAGTAGAGTCCATCTT	0.388																																					p.S3C		.											.	AARS-91	0			c.C8G						.						119.0	117.0	118.0					16																	70316659		2198	4300	6498	SO:0001583	missense	16	exon2			AGAGTAGAGTCCA	D32050	CCDS32474.1	16q22.1	2014-09-17			ENSG00000090861	ENSG00000090861	6.1.1.7	"""Aminoacyl tRNA synthetases / Class II"""	20	protein-coding gene	gene with protein product	"""alanine tRNA ligase 1, cytoplasmic"""	601065				8595897	Standard	NM_001605		Approved		uc002eyn.1	P49588	OTTHUMG00000177042	ENST00000261772.8:c.8C>G	16.37:g.70316659G>C	ENSP00000261772:p.Ser3Cys	202	0		141	76	NM_001605	0	0	9	22	13		Missense_Mutation	SNP	ENST00000261772.8	37	CCDS32474.1	.	.	.	.	.	.	.	.	.	.	G	16.98	3.270776	0.59540	.	.	ENSG00000090861	ENST00000261772	T	0.64991	-0.13	5.56	1.06	0.20224	.	0.309320	0.37012	N	0.002288	T	0.54334	0.1852	L	0.39898	1.24	0.30179	N	0.800544	B	0.29085	0.232	B	0.38921	0.285	T	0.57353	-0.7826	10	0.66056	D	0.02	0.0292	8.518	0.33257	0.3543:0.0:0.6457:0.0	.	3	P49588	SYAC_HUMAN	C	3	ENSP00000261772:S3C	ENSP00000261772:S3C	S	-	2	0	AARS	68874160	0.401000	0.25303	0.169000	0.22859	0.874000	0.50279	3.302000	0.51849	0.212000	0.20703	0.591000	0.81541	TCT	.		0.388	AARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435021.2	NM_001605	
HYDIN	54768	broad.mit.edu;bcgsc.ca	37	16	70896078	70896078	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr16:70896078C>T	ENST00000393567.2	-	69	11800	c.11650G>A	c.(11650-11652)Gag>Aag	p.E3884K		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	3884					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				GGGGAACCCTCGGCCCAGTGG	0.562																																					p.E3884K													.	HYDIN-92	0			c.G11650A						.						37.0	39.0	39.0					16																	70896078		1932	4139	6071	SO:0001583	missense	54768	exon69			AACCCTCGGCCCA	AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.11650G>A	16.37:g.70896078C>T	ENSP00000377197:p.Glu3884Lys	46	0		34	9	NM_001270974	0	0	0	0	0	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	ENST00000393567.2	37	CCDS59269.1	.	.	.	.	.	.	.	.	.	.	C	13.28	2.189687	0.38707	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.00912	5.55	5.97	5.97	0.96955	.	1.190440	0.06746	U	0.779107	T	0.01222	0.0040	L	0.34521	1.04	0.80722	D	1	B	0.33964	0.434	B	0.28916	0.096	T	0.63301	-0.6668	10	0.06365	T	0.9	.	17.1497	0.86774	0.0:1.0:0.0:0.0	.	3883	F8WD23	.	K	3884;3883	ENSP00000377197:E3884K	ENSP00000313052:E3883K	E	-	1	0	HYDIN	69453579	0.003000	0.15002	0.315000	0.25238	0.202000	0.24057	1.389000	0.34453	2.838000	0.97847	0.511000	0.50034	GAG	.		0.562	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3		
PRPF8	10594	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	1586885	1586885	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr17:1586885G>C	ENST00000572621.1	-	2	476	c.211C>G	c.(211-213)Cga>Gga	p.R71G	PRPF8_ENST00000304992.6_Missense_Mutation_p.R71G			Q6P2Q9	PRP8_HUMAN	pre-mRNA processing factor 8	71					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U5 snRNP (GO:0005682)	poly(A) RNA binding (GO:0044822)|U5 snRNA binding (GO:0030623)|U6 snRNA binding (GO:0017070)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(13)|lung(24)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	77				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		CCATGGTCTCGAATGATCTTC	0.478																																					p.R71G		.											.	PRPF8-525	0			c.C211G						.						210.0	180.0	190.0					17																	1586885		2203	4300	6503	SO:0001583	missense	10594	exon3			GGTCTCGAATGAT	AB007510	CCDS11010.1	17p13.3	2013-07-16	2013-06-10		ENSG00000174231	ENSG00000174231			17340	protein-coding gene	gene with protein product		607300	"""PRP8 pre-mRNA processing factor 8 homolog (yeast)"", ""PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae)"""	RP13		11468273, 10411133	Standard	NM_006445		Approved	PRPC8, Prp8, hPrp8, SNRNP220	uc002fte.3	Q6P2Q9	OTTHUMG00000090553	ENST00000572621.1:c.211C>G	17.37:g.1586885G>C	ENSP00000460348:p.Arg71Gly	138	0		79	5	NM_006445	0	0	55	60	5	O14547|O75965	Missense_Mutation	SNP	ENST00000572621.1	37	CCDS11010.1	.	.	.	.	.	.	.	.	.	.	G	19.91	3.914983	0.72983	.	.	ENSG00000174231	ENST00000304992	T	0.44881	0.91	5.41	4.42	0.53409	Pre-mRNA-processing-splicing factor 8 (2);	0.000000	0.85682	D	0.000000	T	0.48295	0.1492	L	0.61218	1.895	0.80722	D	1	P	0.44241	0.829	P	0.45310	0.476	T	0.54510	-0.8283	10	0.72032	D	0.01	.	15.2921	0.73872	0.0:0.0:0.8586:0.1413	.	71	Q6P2Q9	PRP8_HUMAN	G	71	ENSP00000304350:R71G	ENSP00000304350:R71G	R	-	1	2	PRPF8	1533635	1.000000	0.71417	0.998000	0.56505	0.954000	0.61252	4.592000	0.61027	1.237000	0.43756	0.467000	0.42956	CGA	.		0.478	PRPF8-002	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438412.2		
ZZEF1	23140	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	3926086	3926086	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr17:3926086G>C	ENST00000381638.2	-	44	7253	c.7129C>G	c.(7129-7131)Cag>Gag	p.Q2377E		NM_015113.3	NP_055928.3	O43149	ZZEF1_HUMAN	zinc finger, ZZ-type with EF-hand domain 1	2377							calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	84						AAATCGGTCTGAAGGAAAGTA	0.498																																					p.Q2377E		.											.	ZZEF1-93	0			c.C7129G						.						95.0	85.0	88.0					17																	3926086		2203	4300	6503	SO:0001583	missense	23140	exon44			CGGTCTGAAGGAA	BC035319	CCDS11043.1	17p13.3	2013-01-10	2004-11-03		ENSG00000074755	ENSG00000074755		"""Zinc fingers, ZZ-type"", ""EF-hand domain containing"""	29027	protein-coding gene	gene with protein product			"""zinc finger, ZZ-type with EF hand domain 1"""			9455477	Standard	XM_005256560		Approved	KIAA0399, ZZZ4, FLJ10821	uc002fxe.3	O43149	OTTHUMG00000090741	ENST00000381638.2:c.7129C>G	17.37:g.3926086G>C	ENSP00000371051:p.Gln2377Glu	79	0		40	12	NM_015113	0	0	7	14	7	A7MBM5|Q6NXG0|Q6ZRA1|Q6ZSF4|Q9NVB9	Missense_Mutation	SNP	ENST00000381638.2	37	CCDS11043.1	.	.	.	.	.	.	.	.	.	.	G	7.212	0.595598	0.13875	.	.	ENSG00000074755	ENST00000381638	T	0.19938	2.11	5.96	4.94	0.65067	.	0.473334	0.24301	N	0.039721	T	0.09598	0.0236	N	0.08118	0	0.27680	N	0.946471	B	0.02656	0.0	B	0.01281	0.0	T	0.15896	-1.0421	10	0.02654	T	1	-4.1226	13.6249	0.62159	0.0:0.1251:0.7598:0.1151	.	2377	O43149	ZZEF1_HUMAN	E	2377	ENSP00000371051:Q2377E	ENSP00000371051:Q2377E	Q	-	1	0	ZZEF1	3872835	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.220000	0.51207	2.832000	0.97577	0.655000	0.94253	CAG	.		0.498	ZZEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207480.1	NM_015113	
TRPV2	51393	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	16330054	16330054	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr17:16330054G>A	ENST00000338560.7	+	7	1513	c.1114G>A	c.(1114-1116)Gtt>Att	p.V372I	AC093484.4_ENST00000441875.1_RNA|TRPV2_ENST00000577397.1_Intron	NM_016113.4	NP_057197.2	Q9Y5S1	TRPV2_HUMAN	transient receptor potential cation channel, subfamily V, member 2	372	Required for interaction with SLC50A1. {ECO:0000250}.				calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|positive regulation of axon extension (GO:0045773)|positive regulation of calcium ion import (GO:0090280)|response to heat (GO:0009408)|response to temperature stimulus (GO:0009266)|sensory perception (GO:0007600)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axonal growth cone (GO:0044295)|cell body (GO:0044297)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endomembrane system (GO:0012505)|growth cone membrane (GO:0032584)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|ion channel activity (GO:0005216)|ion transmembrane transporter activity (GO:0015075)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|stomach(3)	28				UCEC - Uterine corpus endometrioid carcinoma (92;0.0837)		CCGAATGGTCGTTTTGGAGCC	0.507																																					p.V372I													.	TRPV2-91	0			c.G1114A						.						89.0	74.0	79.0					17																	16330054		2203	4300	6503	SO:0001583	missense	51393	exon7			ATGGTCGTTTTGG	AF129112	CCDS32576.1	17p11.2	2013-01-10			ENSG00000187688	ENSG00000187688		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18082	protein-coding gene	gene with protein product		606676				10201375, 16382100	Standard	NM_016113		Approved	VRL, VRL-1, VRL1	uc002gpy.3	Q9Y5S1	OTTHUMG00000058989	ENST00000338560.7:c.1114G>A	17.37:g.16330054G>A	ENSP00000342222:p.Val372Ile	110	0		40	14	NM_016113	0	0	3	3	0	A6NML2|A8K0Z0|Q9Y670	Missense_Mutation	SNP	ENST00000338560.7	37	CCDS32576.1	.	.	.	.	.	.	.	.	.	.	G	16.38	3.105678	0.56291	.	.	ENSG00000187688	ENST00000338560	D	0.89617	-2.54	5.29	2.95	0.34219	.	0.314085	0.34133	N	0.004239	D	0.83418	0.5250	M	0.72479	2.2	0.28997	N	0.887687	P	0.48694	0.914	B	0.29785	0.107	T	0.79077	-0.1951	10	0.37606	T	0.19	-30.5063	12.2162	0.54408	0.1653:0.0:0.8347:0.0	.	372	Q9Y5S1	TRPV2_HUMAN	I	372	ENSP00000342222:V372I	ENSP00000342222:V372I	V	+	1	0	TRPV2	16270779	0.014000	0.17966	1.000000	0.80357	0.953000	0.61014	0.888000	0.28268	1.248000	0.43934	-0.232000	0.12228	GTT	.		0.507	TRPV2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130464.2	NM_016113	
ZNF286B	729288	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	18565401	18565401	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr17:18565401C>T	ENST00000545289.1	-	5	1668	c.1418G>A	c.(1417-1419)gGa>gAa	p.G473E	ZNF286B_ENST00000285274.5_3'UTR	NM_001145045.1	NP_001138517.1	P0CG31	Z286B_HUMAN	zinc finger protein 286B	473					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|lung(1)	2						GAAGGCTTTTCCACACTCACT	0.393																																					p.G473E													.	.	0			c.G1418A						.						171.0	159.0	162.0					17																	18565401		692	1591	2283	SO:0001583	missense	729288	exon5			GCTTTTCCACACT		CCDS58523.1	17p11.2	2013-01-08			ENSG00000249459	ENSG00000249459		"""Zinc fingers, C2H2-type"""	33241	protein-coding gene	gene with protein product	"""zinc finger protein 590"""		"""zinc finger protein 286-like"", ""zinc finger 286C pseudogene"""	ZNF286L, ZNF286C			Standard	NM_001145045		Approved	ZNF590	uc010vyd.1	P0CG31	OTTHUMG00000178136	ENST00000545289.1:c.1418G>A	17.37:g.18565401C>T	ENSP00000461413:p.Gly473Glu	37	0		16	5	NM_001145045	0	0	0	0	0		Missense_Mutation	SNP	ENST00000545289.1	37	CCDS58523.1																																																																																			.		0.393	ZNF286B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		XM_001723047	
ZNF286B	729288	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	18565413	18565413	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr17:18565413C>T	ENST00000545289.1	-	5	1656	c.1406G>A	c.(1405-1407)tGt>tAt	p.C469Y	ZNF286B_ENST00000285274.5_3'UTR	NM_001145045.1	NP_001138517.1	P0CG31	Z286B_HUMAN	zinc finger protein 286B	469					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|lung(1)	2						ACACTCACTACATTTGTACGG	0.393																																					p.C469Y													.	.	0			c.G1406A						.						154.0	144.0	147.0					17																	18565413		692	1591	2283	SO:0001583	missense	729288	exon5			TCACTACATTTGT		CCDS58523.1	17p11.2	2013-01-08			ENSG00000249459	ENSG00000249459		"""Zinc fingers, C2H2-type"""	33241	protein-coding gene	gene with protein product	"""zinc finger protein 590"""		"""zinc finger protein 286-like"", ""zinc finger 286C pseudogene"""	ZNF286L, ZNF286C			Standard	NM_001145045		Approved	ZNF590	uc010vyd.1	P0CG31	OTTHUMG00000178136	ENST00000545289.1:c.1406G>A	17.37:g.18565413C>T	ENSP00000461413:p.Cys469Tyr	35	1		14	6	NM_001145045	0	0	0	0	0		Missense_Mutation	SNP	ENST00000545289.1	37	CCDS58523.1																																																																																			.		0.393	ZNF286B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		XM_001723047	
IKZF3	22806	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	37949078	37949078	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr17:37949078C>T	ENST00000346872.3	-	4	333	c.272G>A	c.(271-273)aGa>aAa	p.R91K	IKZF3_ENST00000377944.3_Intron|IKZF3_ENST00000346243.3_Missense_Mutation_p.R91K|IKZF3_ENST00000439167.2_Missense_Mutation_p.R57K|IKZF3_ENST00000535189.1_Missense_Mutation_p.R57K|IKZF3_ENST00000350532.3_Missense_Mutation_p.R91K|IKZF3_ENST00000377952.2_Intron|IKZF3_ENST00000377945.3_Missense_Mutation_p.R91K|IKZF3_ENST00000439016.2_Missense_Mutation_p.R91K|IKZF3_ENST00000351680.3_Missense_Mutation_p.R91K|IKZF3_ENST00000467757.1_Missense_Mutation_p.R91K|IKZF3_ENST00000394189.2_Intron|IKZF3_ENST00000377958.2_Intron	NM_012481.4	NP_036613.2	Q9UKT9	IKZF3_HUMAN	IKAROS family zinc finger 3 (Aiolos)	91					B cell activation (GO:0042113)|mesoderm development (GO:0007498)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of B cell proliferation (GO:0030888)|regulation of lymphocyte differentiation (GO:0045619)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E92fs*29(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(6)|large_intestine(4)|liver(1)|lung(13)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	42	Breast(7;4.5e-103)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			ATTATATTCTCTTGAATAGCT	0.383																																					p.R91K		.											.	IKZF3-971	1	Insertion - Frameshift(1)	haematopoietic_and_lymphoid_tissue(1)	c.G272A						.						127.0	118.0	121.0					17																	37949078		2203	4300	6503	SO:0001583	missense	22806	exon4			TATTCTCTTGAAT	AF129512	CCDS11346.1, CCDS11347.1, CCDS11348.1, CCDS11349.1, CCDS11350.1, CCDS11351.1, CCDS58539.1, CCDS58540.1, CCDS58541.1, CCDS58542.1, CCDS58543.1, CCDS58544.1, CCDS58545.1, CCDS74055.1	17q11.2	2013-01-08	2006-08-25	2006-08-25	ENSG00000161405	ENSG00000161405		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	13178	protein-coding gene	gene with protein product		606221	"""zinc finger protein, subfamily 1A, 3 (Aiolos)"""	ZNFN1A3		9155026, 10552935	Standard	NM_012481		Approved	Aiolos	uc002hsu.4	Q9UKT9	OTTHUMG00000133250	ENST00000346872.3:c.272G>A	17.37:g.37949078C>T	ENSP00000344544:p.Arg91Lys	86	0		88	12	NM_012481	0	0	2	4	2	B4DVV5|Q69BL6|Q69BL7|Q69BL8|Q69BL9|Q69BM0|Q69BM1|Q69BM2|Q69BM3|Q69BM5|Q8N574|Q8WWQ9|Q8WWR0|Q8WWR1|Q8WWR2|Q8WWR3	Missense_Mutation	SNP	ENST00000346872.3	37	CCDS11346.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.24|18.24	3.579420|3.579420	0.65878|0.65878	.|.	.|.	ENSG00000161405|ENSG00000161405	ENST00000439167;ENST00000439016|ENST00000488188;ENST00000346872;ENST00000377945;ENST00000535189;ENST00000351680;ENST00000346243;ENST00000350532;ENST00000467757	.|T;T;T;T;T;T;T	.|0.05855	.|3.45;3.52;3.43;3.48;3.52;3.38;4.4	5.96|5.96	5.96|5.96	0.96718|0.96718	.|.	.|0.000000	.|0.64402	.|D	.|0.000004	T|T	0.10594|0.10594	0.0259|0.0259	L|L	0.29908|0.29908	0.895|0.895	0.09310|0.09310	N|N	0.999992|0.999992	.|P;B;P;D;P;P;P;P;P	.|0.59357	.|0.794;0.317;0.864;0.985;0.57;0.93;0.864;0.798;0.786	.|B;B;P;D;B;P;P;B;B	.|0.70716	.|0.31;0.228;0.523;0.97;0.341;0.798;0.523;0.384;0.323	T|T	0.22661|0.22661	-1.0210|-1.0210	5|10	.|0.02654	.|T	.|1	-18.7806|-18.7806	10.1431|10.1431	0.42747|0.42747	0.0:0.7917:0.1376:0.0707|0.0:0.7917:0.1376:0.0707	.|.	.|91;57;91;91;91;91;91;57;91	.|Q9UKT9-13;Q9UKT9-7;Q9UKT9-6;Q9UKT9-5;Q9UKT9-4;Q9UKT9-2;Q9UKT9-3;Q9UKT9-8;Q9UKT9	.|.;.;.;.;.;.;.;.;IKZF3_HUMAN	K|K	45|91;91;91;57;91;91;91;91	.|ENSP00000344544:R91K;ENSP00000367180:R91K;ENSP00000438972:R57K;ENSP00000345622:R91K;ENSP00000341977:R91K;ENSP00000344471:R91K;ENSP00000420463:R91K	.|ENSP00000341977:R91K	E|R	-|-	1|2	0|0	IKZF3|IKZF3	35202604|35202604	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	1.918000|1.918000	0.40006|0.40006	2.832000|2.832000	0.97577|0.97577	0.655000|0.655000	0.94253|0.94253	GAG|AGA	.		0.383	IKZF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257004.2	NM_012481	
HAP1	9001	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	39887800	39887800	+	Silent	SNP	G	G	A			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr17:39887800G>A	ENST00000310778.5	-	6	1023	c.1014C>T	c.(1012-1014)ctC>ctT	p.L338L	HAP1_ENST00000393939.2_Silent_p.L338L|RN7SL399P_ENST00000471648.2_RNA|JUP_ENST00000540235.1_Intron|HAP1_ENST00000347901.4_Silent_p.L338L|HAP1_ENST00000341193.5_Silent_p.L346L			P54257	HAP1_HUMAN	huntingtin-associated protein 1	338	Glu-rich.|HAP1 N-terminal.				anterograde axon cargo transport (GO:0008089)|autophagy (GO:0006914)|brain development (GO:0007420)|cell projection organization (GO:0030030)|exocytosis (GO:0006887)|negative regulation of beta-amyloid formation (GO:1902430)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|positive regulation of neurotrophin production (GO:0032901)|positive regulation of nonmotile primary cilium assembly (GO:1902857)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|protein localization (GO:0008104)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)|regulation of organelle transport along microtubule (GO:1902513)|retrograde axon cargo transport (GO:0008090)|synaptic transmission (GO:0007268)|vesicle transport along microtubule (GO:0047496)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|inclusion body (GO:0016234)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|synapse (GO:0045202)	brain-derived neurotrophic factor binding (GO:0048403)|ion channel binding (GO:0044325)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(4)|skin(1)	21		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.0677)			CAAGAGTGTCGAGTTGAGAGG	0.557																																					p.L346L		.											.	HAP1-92	0			c.C1038T						.						142.0	116.0	125.0					17																	39887800		2203	4300	6503	SO:0001819	synonymous_variant	9001	exon6			AGTGTCGAGTTGA	AF040723	CCDS11406.1, CCDS42338.1, CCDS42339.1	17q21.2-q21.3	2008-04-23	2008-04-23		ENSG00000173805	ENSG00000173805			4812	protein-coding gene	gene with protein product	"""neuroan 1"""	600947		HAP2		7477378, 9668110	Standard	NM_177977		Approved	HLP, hHLP1, HIP5	uc002hxn.1	P54257	OTTHUMG00000133498	ENST00000310778.5:c.1014C>T	17.37:g.39887800G>A		151	0		103	66	NM_001079870	0	0	0	0	0	A8MQB5|O75358|Q59GK4|Q9H4G3|Q9HA98|Q9NY90	Silent	SNP	ENST00000310778.5	37																																																																																				.		0.557	HAP1-006	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000389619.1	NM_003949	
UBTF	7343	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	42293042	42293042	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr17:42293042C>T	ENST00000302904.4	-	5	946	c.454G>A	c.(454-456)Gag>Aag	p.E152K	UBTF_ENST00000393606.3_Missense_Mutation_p.E152K|UBTF_ENST00000436088.1_Missense_Mutation_p.E152K|UBTF_ENST00000526094.1_Missense_Mutation_p.E152K|UBTF_ENST00000343638.5_Missense_Mutation_p.E152K|CTB-175E5.7_ENST00000586560.1_RNA|UBTF_ENST00000529383.1_Missense_Mutation_p.E152K|UBTF_ENST00000527034.1_Missense_Mutation_p.E152K|UBTF_ENST00000537550.1_5'UTR|UBTF_ENST00000533177.1_Missense_Mutation_p.E152K			P17480	UBF1_HUMAN	upstream binding transcription factor, RNA polymerase I	152					chromatin silencing at rDNA (GO:0000183)|gene expression (GO:0010467)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(9)|lung(10)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Breast(137;0.00765)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.114)		TCCGGAAGCTCCTTGTATTTC	0.547																																					p.E152K													.	UBTF-90	0			c.G454A						.						112.0	116.0	115.0					17																	42293042		2203	4300	6503	SO:0001583	missense	7343	exon5			GAAGCTCCTTGTA	BC042297	CCDS11480.1, CCDS42346.1	17q21.31	2014-03-25			ENSG00000108312	ENSG00000108312			12511	protein-coding gene	gene with protein product		600673				9126496	Standard	NM_001076683		Approved	UBF, NOR-90, UBF1, UBF2	uc010czs.3	P17480	OTTHUMG00000167585	ENST00000302904.4:c.454G>A	17.37:g.42293042C>T	ENSP00000302640:p.Glu152Lys	205	0		120	13	NM_014233	0	0	41	46	5	A8K6R8	Missense_Mutation	SNP	ENST00000302904.4	37	CCDS11480.1	.	.	.	.	.	.	.	.	.	.	c	26.9	4.784023	0.90282	.	.	ENSG00000108312	ENST00000343638;ENST00000302904;ENST00000527034;ENST00000533177;ENST00000436088;ENST00000393606;ENST00000526094;ENST00000529383;ENST00000530828	D;D;D;D;D;D;D;D;D	0.98060	-4.69;-4.69;-4.69;-4.69;-4.69;-4.69;-4.69;-4.69;-4.69	4.27	4.27	0.50696	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (4);	0.000000	0.85682	D	0.000000	D	0.97539	0.9194	L	0.35854	1.095	0.80722	D	1	D;P;D	0.76494	0.999;0.553;0.999	D;B;D	0.91635	0.998;0.331;0.999	D	0.96841	0.9618	10	0.26408	T	0.33	-30.3629	16.6665	0.85254	0.0:1.0:0.0:0.0	.	152;152;152	E9PKP7;P17480-2;P17480	.;.;UBF1_HUMAN	K	152;152;152;152;152;152;152;152;124	ENSP00000345297:E152K;ENSP00000302640:E152K;ENSP00000431539:E152K;ENSP00000437180:E152K;ENSP00000390669:E152K;ENSP00000377231:E152K;ENSP00000432925:E152K;ENSP00000435708:E152K;ENSP00000433046:E124K	ENSP00000302640:E152K	E	-	1	0	UBTF	39648568	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.713000	0.84693	2.082000	0.62665	0.467000	0.42956	GAG	.		0.547	UBTF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395205.1	NM_014233	
EFCAB13	124989	ucsc.edu	37	17	45452155	45452155	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr17:45452155G>A	ENST00000331493.2	+	12	1606	c.1195G>A	c.(1195-1197)Gaa>Aaa	p.E399K	EFCAB13_ENST00000517484.1_Missense_Mutation_p.E303K	NM_152347.4	NP_689560.3	Q8IY85	EFC13_HUMAN	EF-hand calcium binding domain 13	399						cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)										AGAGAAGGGTGAAATTCATGA	0.363																																					p.E399K													.	.	0			c.G1195A						.						60.0	63.0	62.0					17																	45452155		2203	4300	6503	SO:0001583	missense	124989	exon12			AAGGGTGAAATTC	BC036407	CCDS11512.1, CCDS56034.1	17q21.32	2013-01-11	2012-07-20	2012-07-20	ENSG00000178852	ENSG00000178852		"""EF-hand domain containing"""	26864	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 57"""	C17orf57			Standard	NM_152347		Approved	FLJ40342	uc002iln.3	Q8IY85	OTTHUMG00000164767	ENST00000331493.2:c.1195G>A	17.37:g.45452155G>A	ENSP00000332111:p.Glu399Lys	39	0		44	5	NM_152347	0	0	0	0	0	G3V128|Q49AG9	Missense_Mutation	SNP	ENST00000331493.2	37	CCDS11512.1	.	.	.	.	.	.	.	.	.	.	G	19.14	3.769226	0.69992	.	.	ENSG00000178852	ENST00000331493;ENST00000517484;ENST00000344176	T;T	0.68025	0.06;-0.3	3.69	3.69	0.42338	.	0.488035	0.20086	N	0.099559	T	0.70107	0.3186	L	0.42245	1.32	0.09310	N	1	D;D;D	0.64830	0.994;0.994;0.994	P;P;P	0.60173	0.82;0.87;0.87	T	0.59783	-0.7389	9	.	.	.	5.8359	11.0933	0.48130	0.0:0.0:1.0:0.0	.	351;399;303	Q8N7U2;Q8IY85;G3V128	.;CQ057_HUMAN;.	K	399;303;351	ENSP00000332111:E399K;ENSP00000430048:E303K	.	E	+	1	0	C17orf57	42807154	0.622000	0.27085	0.114000	0.21550	0.916000	0.54674	2.027000	0.41078	2.045000	0.60652	0.585000	0.79938	GAA	.		0.363	EFCAB13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380147.4	NM_152347	
SKAP1	8631	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	46239837	46239837	+	Silent	SNP	C	C	G			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr17:46239837C>G	ENST00000336915.6	-	11	1041	c.972G>C	c.(970-972)ctG>ctC	p.L324L	SKAP1_ENST00000584924.1_Silent_p.L324L	NM_001075099.1|NM_003726.3	NP_001068567.1|NP_003717.3	Q86WV1	SKAP1_HUMAN	src kinase associated phosphoprotein 1	324	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				positive regulation of signal transduction (GO:0009967)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|SH2 domain binding (GO:0042169)|SH3 domain binding (GO:0017124)|SH3/SH2 adaptor activity (GO:0005070)	p.L324L(1)		large_intestine(1)|lung(10)|prostate(2)|skin(4)|urinary_tract(1)	18						TTACCTTGCTCAGAATACGGA	0.433																																					p.L324L		.											.	SKAP1-90	1	Substitution - coding silent(1)	urinary_tract(1)	c.G972C						.						93.0	79.0	84.0					17																	46239837		2203	4300	6503	SO:0001819	synonymous_variant	8631	exon11			CTTGCTCAGAATA	Y11215	CCDS32674.1	17q21.32	2013-01-10	2006-09-28	2006-09-28		ENSG00000141293		"""Pleckstrin homology (PH) domain containing"""	15605	protein-coding gene	gene with protein product		604969	"""src family associated phosphoprotein 1"""	SCAP1		9195899	Standard	NM_003726		Approved	SKAP55	uc002ini.1	Q86WV1		ENST00000336915.6:c.972G>C	17.37:g.46239837C>G		58	0		70	6	NM_003726	0	0	0	0	0	D3DTV1|O15268	Silent	SNP	ENST00000336915.6	37	CCDS32674.1																																																																																			.		0.433	SKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443432.1	NM_003726	
KIF19	124602	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	72338804	72338804	+	Missense_Mutation	SNP	C	C	G	rs368432623		TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr17:72338804C>G	ENST00000389916.4	+	4	405	c.267C>G	c.(265-267)atC>atG	p.I89M		NM_153209.3	NP_694941.2	Q2TAC6	KIF19_HUMAN	kinesin family member 19	89	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|axonemal microtubule depolymerization (GO:0060404)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end specific microtubule depolymerization (GO:0070462)	cilium (GO:0005929)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	41						AGAGCCTCATCGAGGGCGTCA	0.622																																					p.I89M		.											.	KIF19-90	0			c.C267G						.						140.0	112.0	121.0					17																	72338804		2203	4300	6503	SO:0001583	missense	124602	exon4			CCTCATCGAGGGC	AK094619	CCDS32718.2	17q25	2007-02-13			ENSG00000196169	ENSG00000196169		"""Kinesins"""	26735	protein-coding gene	gene with protein product						11416179	Standard	NM_153209		Approved	FLJ37300, KIF19A	uc031rei.1	Q2TAC6	OTTHUMG00000150694	ENST00000389916.4:c.267C>G	17.37:g.72338804C>G	ENSP00000374566:p.Ile89Met	113	0		81	41	NM_153209	0	0	0	0	0	A6NLG2|B7ZKR1|Q52M87|Q8N1X8|Q8TAB6	Missense_Mutation	SNP	ENST00000389916.4	37	CCDS32718.2	.	.	.	.	.	.	.	.	.	.	C	18.38	3.611793	0.66558	.	.	ENSG00000196169	ENST00000551294;ENST00000389916	T;T	0.75821	-0.97;-0.97	5.5	-11.0	0.00169	Kinesin, motor domain (4);	.	.	.	.	T	0.77916	0.4202	M	0.79805	2.47	0.28548	N	0.91179	D;D;P;D	0.64830	0.99;0.981;0.93;0.994	D;D;P;D	0.67382	0.932;0.916;0.803;0.951	T	0.72581	-0.4250	9	0.87932	D	0	.	2.1205	0.03724	0.1636:0.208:0.163:0.4655	.	89;89;89;89	Q2TAC6;F8VW50;Q2TAC6-3;Q2TAC6-2	KIF19_HUMAN;.;.;.	M	89	ENSP00000449134:I89M;ENSP00000374566:I89M	ENSP00000374566:I89M	I	+	3	3	KIF19	69850399	0.000000	0.05858	0.008000	0.14137	0.981000	0.71138	-2.329000	0.01111	-1.540000	0.01730	0.456000	0.33151	ATC	.		0.622	KIF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319644.2	NM_153209	
EIF4A3	9775	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	78120725	78120725	+	Silent	SNP	C	C	G			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr17:78120725C>G	ENST00000269349.3	-	1	257	c.36G>C	c.(34-36)tcG>tcC	p.S12S		NM_014740.3	NP_055555.1	P38919	IF4A3_HUMAN	eukaryotic translation initiation factor 4A3	12					ATP catabolic process (GO:0006200)|cytokine-mediated signaling pathway (GO:0019221)|embryonic cranial skeleton morphogenesis (GO:0048701)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|mRNA transport (GO:0051028)|negative regulation of translation (GO:0017148)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|mRNA binding (GO:0003729)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	10	all_neural(118;0.117)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.139)			GCTTTCGCGCCGAGCCCGAGG	0.652																																					p.S12S		.											.	EIF4A3-227	0			c.G36C						.						33.0	28.0	30.0					17																	78120725		2203	4292	6495	SO:0001819	synonymous_variant	9775	exon1			TCGCGCCGAGCCC	BC004386	CCDS11767.1	17q25.3	2010-02-10	2010-02-10	2006-11-27		ENSG00000141543		"""DEAD-boxes"""	18683	protein-coding gene	gene with protein product		608546	"""DEAD (Asp-Glu-Ala-Asp) box polypeptide 48"", ""eukaryotic translation initiation factor 4A, isoform 3"""	DDX48		10623621, 14730019	Standard	NM_014740		Approved	KIAA0111, EIF4AIII	uc002jxs.3	P38919		ENST00000269349.3:c.36G>C	17.37:g.78120725C>G		55	1		42	9	NM_014740	0	0	47	59	12	Q15033|Q6IBQ2|Q96A18	Silent	SNP	ENST00000269349.3	37	CCDS11767.1																																																																																			.		0.652	EIF4A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437446.1	NM_014740	
MIB1	57534	broad.mit.edu;bcgsc.ca	37	18	19399507	19399507	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr18:19399507G>A	ENST00000261537.6	+	12	1993	c.1729G>A	c.(1729-1731)Gat>Aat	p.D577N	MIB1_ENST00000578646.1_3'UTR|SNORA73_ENST00000363107.1_RNA	NM_020774.2	NP_065825.1	Q86YT6	MIB1_HUMAN	mindbomb E3 ubiquitin protein ligase 1	577					blood vessel development (GO:0001568)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|negative regulation of neuron differentiation (GO:0045665)|neural tube formation (GO:0001841)|Notch signaling pathway (GO:0007219)|positive regulation of endocytosis (GO:0045807)|somitogenesis (GO:0001756)	centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(13)|ovary(5)	27			STAD - Stomach adenocarcinoma(5;0.212)			GAAACGTGATGATATCCTAGC	0.368																																					p.D577N													.	MIB1-526	0			c.G1729A						.						151.0	143.0	145.0					18																	19399507		2203	4300	6503	SO:0001583	missense	57534	exon12			CGTGATGATATCC	AB037744	CCDS11871.1	18q11.2	2014-09-17	2012-02-23		ENSG00000101752	ENSG00000101752		"""Zinc fingers, ZZ-type"", ""Ankyrin repeat domain containing"""	21086	protein-coding gene	gene with protein product		608677	"""mindbomb homolog 1 (Drosophila)"""				Standard	NM_020774		Approved	DIP-1, MIB, KIAA1323, ZZANK2, ZZZ6	uc002ktq.3	Q86YT6	OTTHUMG00000131753	ENST00000261537.6:c.1729G>A	18.37:g.19399507G>A	ENSP00000261537:p.Asp577Asn	152	0		218	13	NM_020774	0	0	20	20	0	B0YJ38|Q2TB37|Q68D01|Q6YI51|Q8NBY0|Q8TCB5|Q8TCL7|Q9P2M3	Missense_Mutation	SNP	ENST00000261537.6	37	CCDS11871.1	.	.	.	.	.	.	.	.	.	.	G	31	5.088114	0.94100	.	.	ENSG00000101752	ENST00000261537	T	0.67171	-0.25	5.1	5.1	0.69264	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.74884	0.3775	L	0.37630	1.12	0.80722	D	1	D	0.53885	0.963	D	0.68621	0.959	T	0.72717	-0.4209	10	0.35671	T	0.21	-20.3959	18.8792	0.92350	0.0:0.0:1.0:0.0	.	577	Q86YT6	MIB1_HUMAN	N	577	ENSP00000261537:D577N	ENSP00000261537:D577N	D	+	1	0	MIB1	17653505	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.813000	0.99286	2.544000	0.85801	0.563000	0.77884	GAT	.		0.368	MIB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254675.1	NM_020774	
HRH4	59340	broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	22048831	22048831	+	Silent	SNP	C	C	T			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr18:22048831C>T	ENST00000256906.4	+	2	373	c.273C>T	c.(271-273)ctC>ctT	p.L91L	HRH4_ENST00000426880.2_Intron	NM_001160166.1|NM_021624.3	NP_001153638.1|NP_067637.2	Q9H3N8	HRH4_HUMAN	histamine receptor H4	91					inflammatory response (GO:0006954)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of MAPK cascade (GO:0043408)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	histamine receptor activity (GO:0004969)			endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22	all_cancers(21;0.000545)|all_epithelial(16;6.56e-06)|Lung NSC(20;0.0027)|all_lung(20;0.0085)|Colorectal(14;0.0361)|Ovarian(20;0.0991)				Amitriptyline(DB00321)|Amoxapine(DB00543)|Chlorpromazine(DB00477)|Clozapine(DB00363)|Doxepin(DB01142)|Histamine Phosphate(DB00667)|Loxapine(DB00408)|Mianserin(DB06148)|Olanzapine(DB00334)	TATTTTGGCTCACTACTGACT	0.403																																					p.L91L													.	HRH4-92	0			c.C273T						.						228.0	186.0	200.0					18																	22048831		2203	4300	6503	SO:0001819	synonymous_variant	59340	exon2			TTGGCTCACTACT	AF312230	CCDS11887.1, CCDS45841.1	18q11.2	2012-08-08			ENSG00000134489	ENSG00000134489		"""GPCR / Class A : Histamine receptors"""	17383	protein-coding gene	gene with protein product		606792				11118334, 10973974	Standard	NM_021624		Approved	H4R, HH4R, AXOR35, GPCR105, GPRv53	uc002kvi.3	Q9H3N8	OTTHUMG00000131945	ENST00000256906.4:c.273C>T	18.37:g.22048831C>T		66	0		105	12	NM_021624	0	0	0	0	0	B0YJ19|B2KJ48|Q4G0I6|Q9GZQ0	Silent	SNP	ENST00000256906.4	37	CCDS11887.1																																																																																			.		0.403	HRH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254904.1		
TAF4B	6875	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	23866009	23866009	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr18:23866009C>T	ENST00000269142.5	+	7	2134	c.1136C>T	c.(1135-1137)tCa>tTa	p.S379L	TAF4B_ENST00000578121.1_Missense_Mutation_p.S379L|TAF4B_ENST00000400466.2_Missense_Mutation_p.S379L	NM_005640.1	NP_005631.1	Q92750	TAF4B_HUMAN	TAF4b RNA polymerase II, TATA box binding protein (TBP)-associated factor, 105kDa	379					gene expression (GO:0010467)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|NF-kappaB binding (GO:0051059)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(13)|prostate(1)|skin(1)	29	all_cancers(21;0.00151)|Lung NSC(5;0.000401)|all_lung(6;0.00115)|Ovarian(20;0.124)		Epithelial(2;9.57e-07)|all cancers(3;5.15e-06)|OV - Ovarian serous cystadenocarcinoma(3;1.96e-05)|LUSC - Lung squamous cell carcinoma(2;0.00594)|Lung(2;0.0267)			TCTGAAAAGTCAATTATTGTT	0.463																																					p.S379L		.											.	TAF4B-71	0			c.C1136T						.						100.0	97.0	98.0					18																	23866009		1925	4142	6067	SO:0001583	missense	6875	exon7			AAAAGTCAATTAT	Y09321	CCDS42421.1	18q11.1	2008-08-01	2002-08-29	2001-12-07		ENSG00000141384			11538	protein-coding gene	gene with protein product	"""TATA box binding protein (TBP)-associated factor 4B"""	601689	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, C2, 105kD"""	TAF2C2		8858156, 10849440	Standard	XM_005258339		Approved	TAFII105	uc002kvu.4	Q92750		ENST00000269142.5:c.1136C>T	18.37:g.23866009C>T	ENSP00000269142:p.Ser379Leu	146	0		82	64	NM_005640	0	0	1	2	1	Q29YA4|Q29YA5	Missense_Mutation	SNP	ENST00000269142.5	37	CCDS42421.1	.	.	.	.	.	.	.	.	.	.	c	2.722	-0.266371	0.05754	.	.	ENSG00000141384	ENST00000418698;ENST00000269142;ENST00000400466	T;T;T	0.22945	1.93;1.93;1.93	5.35	4.47	0.54385	.	1.607940	0.03022	N	0.150849	T	0.16685	0.0401	N	0.08118	0	0.09310	N	1	B;B	0.13594	0.001;0.008	B;B	0.14578	0.001;0.011	T	0.23797	-1.0178	10	0.20519	T	0.43	0.3248	9.9174	0.41444	0.1569:0.6917:0.1514:0.0	.	379;379	Q92750;A4PBF7	TAF4B_HUMAN;.	L	379	ENSP00000389365:S379L;ENSP00000269142:S379L;ENSP00000383314:S379L	ENSP00000269142:S379L	S	+	2	0	TAF4B	22120007	0.028000	0.19301	0.092000	0.20876	0.014000	0.08584	2.845000	0.48254	1.228000	0.43614	0.558000	0.71614	TCA	.		0.463	TAF4B-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000446260.3	NM_005640	
DOK6	220164	hgsc.bcm.edu;broad.mit.edu	37	18	67266711	67266711	+	Missense_Mutation	SNP	C	C	G			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr18:67266711C>G	ENST00000382713.5	+	3	456	c.266C>G	c.(265-267)tCg>tGg	p.S89W	RP11-465I4.2_ENST00000583991.1_RNA	NM_152721.5	NP_689934.2	Q6PKX4	DOK6_HUMAN	docking protein 6	89	PH.									central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	20		Colorectal(73;0.083)|Esophageal squamous(42;0.131)				GATGAAACATCGAAGACATTT	0.448																																					p.S89W		.											.	DOK6-92	0			c.C266G						.						101.0	78.0	86.0					18																	67266711		2203	4300	6503	SO:0001583	missense	220164	exon3			AAACATCGAAGAC	AK057795	CCDS32841.1	18q22.2	2013-01-10	2005-01-18	2005-01-18		ENSG00000206052		"""Pleckstrin homology (PH) domain containing"""	28301	protein-coding gene	gene with protein product		611402	"""docking protein 5-like"""	DOK5L		15286081	Standard	NM_152721		Approved	MGC20785, HsT3226	uc002lkl.3	Q6PKX4		ENST00000382713.5:c.266C>G	18.37:g.67266711C>G	ENSP00000372160:p.Ser89Trp	41	0		25	3	NM_152721	0	0	0	0	0	A6NNG3|Q4V9S3|Q8WUZ8|Q96HI2|Q96LU2	Missense_Mutation	SNP	ENST00000382713.5	37	CCDS32841.1	.	.	.	.	.	.	.	.	.	.	C	17.07	3.295543	0.60086	.	.	ENSG00000206052	ENST00000382713	T	0.79352	-1.26	5.91	5.91	0.95273	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.000000	0.85682	D	0.000000	D	0.85548	0.5722	L	0.47716	1.5	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.85609	0.1257	10	0.66056	D	0.02	-2.6428	19.2865	0.94077	0.0:1.0:0.0:0.0	.	89	Q6PKX4	DOK6_HUMAN	W	89	ENSP00000372160:S89W	ENSP00000372160:S89W	S	+	2	0	DOK6	65417691	1.000000	0.71417	0.262000	0.24481	0.116000	0.19942	7.786000	0.85741	2.802000	0.96397	0.655000	0.94253	TCG	.		0.448	DOK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442969.1	NM_152721	
MED16	10025	hgsc.bcm.edu	37	19	879943	879943	+	Missense_Mutation	SNP	G	G	C	rs201392672|rs76403059	byFrequency	TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr19:879943G>C	ENST00000589119.1	-	7	1346	c.1347C>G	c.(1345-1347)caC>caG	p.H449Q	MED16_ENST00000312090.6_Missense_Mutation_p.H449Q|MED16_ENST00000395808.3_Missense_Mutation_p.H449Q|MED16_ENST00000606828.1_Intron|MED16_ENST00000269814.4_Missense_Mutation_p.H449Q|MED16_ENST00000325464.1_Missense_Mutation_p.H449Q			Q9Y2X0	MED16_HUMAN	mediator complex subunit 16	449					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of receptor activity (GO:2000273)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|receptor activity (GO:0004872)|thyroid hormone receptor binding (GO:0046966)|thyroid hormone receptor coactivator activity (GO:0030375)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	21		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCACCTTCCCGTGGCTGTCAA	0.672																																					p.H449Q		.											.	MED16-186	0			c.C1347G						.						13.0	11.0	12.0					19																	879943		2152	4247	6399	SO:0001583	missense	10025	exon8			CTTCCCGTGGCTG	AF121228	CCDS12047.1	19p13.3	2013-01-10	2007-07-30	2007-07-30		ENSG00000175221		"""WD repeat domain containing"""	17556	protein-coding gene	gene with protein product		604062	"""thyroid hormone receptor associated protein 5"""	THRAP5		10235266, 10198638	Standard	NM_005481		Approved	DRIP92, TRAP95	uc002lqd.1	Q9Y2X0		ENST00000589119.1:c.1347C>G	19.37:g.879943G>C	ENSP00000464810:p.His449Gln	36	1		25	3	NM_005481	0	0	1	1	0	Q6PJT2|Q96AD4|Q96I35|Q9Y652	Missense_Mutation	SNP	ENST00000589119.1	37	CCDS12047.1	.	.	.	.	.	.	.	.	.	.	C	3.376	-0.127462	0.06753	.	.	ENSG00000175221	ENST00000325464;ENST00000312090;ENST00000395808;ENST00000269814;ENST00000534906;ENST00000537596;ENST00000540679;ENST00000538572;ENST00000424039	T;T;T;T	0.42131	0.98;0.98;0.98;0.98	4.21	-7.89	0.01174	WD40 repeat-like-containing domain (1);	0.323237	0.32357	N	0.006220	T	0.21307	0.0513	L	0.37850	1.14	0.37741	D	0.925623	B;B;B;B;B	0.13145	0.006;0.007;0.002;0.001;0.001	B;B;B;B;B	0.14023	0.006;0.006;0.003;0.006;0.01	T	0.20009	-1.0288	10	0.15066	T	0.55	-14.2411	8.1092	0.30905	0.4704:0.1904:0.3392:0.0	.	449;449;449;449;449	Q9Y2X0-2;E7ETV0;Q9Y2X0-4;Q9Y2X0-3;Q9Y2X0	.;.;.;.;MED16_HUMAN	Q	449;449;449;449;449;305;210;208;449	ENSP00000325612:H449Q;ENSP00000308528:H449Q;ENSP00000379153:H449Q;ENSP00000269814:H449Q	ENSP00000269814:H449Q	H	-	3	2	MED16	830943	0.000000	0.05858	0.886000	0.34754	0.057000	0.15508	-3.404000	0.00482	-1.779000	0.01280	-2.326000	0.00250	CAC	.		0.672	MED16-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457902.3	NM_005481	
ATP8B3	148229	ucsc.edu;bcgsc.ca	37	19	1811677	1811677	+	Missense_Mutation	SNP	G	G	T			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr19:1811677G>T	ENST00000310127.6	-	2	297	c.59C>A	c.(58-60)cCt>cAt	p.P20H	ATP8B3_ENST00000526092.2_Intron|ATP8B3_ENST00000525591.1_Intron|ATP8B3_ENST00000539485.1_Missense_Mutation_p.P20H	NM_138813.3	NP_620168.1	O60423	AT8B3_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 3	20					binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(9)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	23		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGTGGGGCAGGGCTTGGCTC	0.647																																					p.P20H													.	.	0			c.C59A						.						31.0	35.0	34.0					19																	1811677		2002	4160	6162	SO:0001583	missense	148229	exon2			GGGGCAGGGCTTG	AA827939	CCDS45901.1, CCDS54196.1	19p13.3	2010-04-28	2010-04-28		ENSG00000130270	ENSG00000130270		"""ATPases / P-type"""	13535	protein-coding gene	gene with protein product	"""aminophospholipid translocase ATP8B3"", ""potential phospholipid-transporting ATPase IK"""	605866	"""ATPase, Class I, type 8B, member 3"", ""ATPase, class I, type 8B, member 3"""			11015572	Standard	NM_138813		Approved	ATPIK	uc002ltw.4	O60423	OTTHUMG00000166189	ENST00000310127.6:c.59C>A	19.37:g.1811677G>T	ENSP00000311336:p.Pro20His	36	0		29	10	NM_138813	0	0	0	0	0	Q7Z485|Q8IVB8|Q8N4Y8|Q96M22	Missense_Mutation	SNP	ENST00000310127.6	37	CCDS45901.1	.	.	.	.	.	.	.	.	.	.	c	3.042	-0.197318	0.06259	.	.	ENSG00000130270	ENST00000310127;ENST00000539485	T;T	0.75477	-0.94;-0.94	1.78	-3.56	0.04626	.	.	.	.	.	T	0.45637	0.1352	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.13308	-1.0514	9	0.39692	T	0.17	.	1.204	0.01891	0.1366:0.3313:0.1985:0.3336	.	20	O60423	AT8B3_HUMAN	H	20	ENSP00000311336:P20H;ENSP00000443574:P20H	ENSP00000311336:P20H	P	-	2	0	ATP8B3	1762677	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.066000	0.03454	-1.603000	0.01597	-0.465000	0.05216	CCT	.		0.647	ATP8B3-002	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388279.1	NM_138813	
NFIC	4782	ucsc.edu	37	19	3435161	3435161	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr19:3435161C>T	ENST00000443272.2	+	6	965	c.914C>T	c.(913-915)tCg>tTg	p.S305L	NFIC_ENST00000395111.3_Missense_Mutation_p.S296L|NFIC_ENST00000590282.1_Missense_Mutation_p.S305L|NFIC_ENST00000589123.1_Missense_Mutation_p.S296L|NFIC_ENST00000586919.1_Missense_Mutation_p.S272L|NFIC_ENST00000346156.5_Missense_Mutation_p.S272L|NFIC_ENST00000341919.3_Missense_Mutation_p.S305L	NM_001245002.1	NP_001231931.1	P08651	NFIC_HUMAN	nuclear factor I/C (CCAAT-binding transcription factor)	305					DNA replication (GO:0006260)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	nucleolus (GO:0005730)|nucleus (GO:0005634)	core promoter proximal region DNA binding (GO:0001159)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;7.8e-05)|Epithelial(107;2.94e-108)|BRCA - Breast invasive adenocarcinoma(158;0.00154)|STAD - Stomach adenocarcinoma(1328;0.191)		TCGCCCAGCTCGCCCACGAGT	0.662																																					p.S305L													.	NFIC-226	0			c.C914T						.						28.0	24.0	25.0					19																	3435161		2200	4298	6498	SO:0001583	missense	4782	exon6			CCAGCTCGCCCAC	X12492	CCDS12107.1, CCDS45914.1, CCDS58640.1, CCDS59330.1, CCDS59331.1	19p13.3	2008-02-05				ENSG00000141905			7786	protein-coding gene	gene with protein product		600729		NFI		3398920, 7590749	Standard	NM_205843		Approved	CTF, NF-I, CTF5	uc010xhi.2	P08651		ENST00000443272.2:c.914C>T	19.37:g.3435161C>T	ENSP00000396843:p.Ser305Leu	40	0		29	4	NM_001245004	0	0	42	42	0	A8K1H0|B7Z4U5|B7Z9C3|K7EMU1|P08652|Q14932|Q9UPJ3|Q9UPJ9|Q9UPK0|Q9UPK1	Missense_Mutation	SNP	ENST00000443272.2	37	CCDS59330.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.159672	0.78226	.	.	ENSG00000141905	ENST00000443272;ENST00000395111;ENST00000346156;ENST00000341919;ENST00000343825;ENST00000269778	T;T;T	0.58506	0.33;0.33;0.33	4.69	3.64	0.41730	.	0.287773	0.33813	N	0.004531	T	0.46308	0.1386	L	0.50333	1.59	0.44402	D	0.997317	P;P;P;P;P	0.49862	0.716;0.929;0.668;0.531;0.531	B;B;B;B;B	0.37267	0.092;0.245;0.055;0.055;0.055	T	0.51616	-0.8683	10	0.40728	T	0.16	.	11.87	0.52515	0.0:0.9119:0.0:0.0881	.	305;305;296;305;296	B7Z4U5;P08651;P08651-3;P08651-5;P08651-2	.;NFIC_HUMAN;.;.;.	L	296;296;272;305;305;305	ENSP00000378543:S296L;ENSP00000301935:S272L;ENSP00000342194:S305L	ENSP00000269778:S305L	S	+	2	0	NFIC	3386161	0.999000	0.42202	0.990000	0.47175	0.984000	0.73092	4.572000	0.60886	2.152000	0.67230	0.561000	0.74099	TCG	.		0.662	NFIC-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452834.1	NM_005597	
TRIP10	9322	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	6743264	6743264	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr19:6743264G>C	ENST00000313244.9	+	5	440	c.405G>C	c.(403-405)gaG>gaC	p.E135D	TRIP10_ENST00000600428.1_Missense_Mutation_p.E27D|TRIP10_ENST00000596758.1_Missense_Mutation_p.E135D|TRIP10_ENST00000313285.8_Missense_Mutation_p.E135D			Q15642	CIP4_HUMAN	thyroid hormone receptor interactor 10	135	F-BAR domain.				actin cytoskeleton organization (GO:0030036)|cell communication (GO:0007154)|endocytosis (GO:0006897)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)			NS(1)|breast(1)|endometrium(1)|large_intestine(1)|liver(2)|lung(7)|ovary(1)|prostate(1)|urinary_tract(1)	16						AACAGCTGGAGAATGTGAGTT	0.582																																					p.E135D		.											.	TRIP10-228	0			c.G405C						.						53.0	55.0	54.0					19																	6743264		2203	4300	6503	SO:0001583	missense	9322	exon5			GCTGGAGAATGTG	AB072596	CCDS12172.1, CCDS74271.1, CCDS74272.1	19p13.3	2008-02-05			ENSG00000125733	ENSG00000125733			12304	protein-coding gene	gene with protein product	"""Cdc42-interacting protein"""	604504	"""salt tolerator"""	STOT		7776974, 9210375, 11294612	Standard	XM_005259683		Approved	STP, HSTP, CIP4	uc002mfr.3	Q15642	OTTHUMG00000150255	ENST00000313244.9:c.405G>C	19.37:g.6743264G>C	ENSP00000320117:p.Glu135Asp	59	1		39	4	NM_004240	0	0	0	0	0	B2R8A6|B7WP22|D6W645|O15184|Q53G22|Q5TZN1|Q6FI24|Q8NFL1|Q8TCY1|Q8TDX3|Q96RJ1	Missense_Mutation	SNP	ENST00000313244.9	37		.	.	.	.	.	.	.	.	.	.	G	5.067	0.198081	0.09652	.	.	ENSG00000125733	ENST00000313285;ENST00000313244;ENST00000420690	T;T	0.17528	2.27;2.27	3.97	1.76	0.24704	.	0.279702	0.33309	N	0.005060	T	0.05914	0.0154	N	0.10760	0.04	0.37681	D	0.9235	B;P;B	0.39424	0.003;0.673;0.008	B;B;B	0.34536	0.019;0.185;0.012	T	0.43523	-0.9386	10	0.12103	T	0.63	-23.3165	6.6451	0.22931	0.2321:0.0:0.7679:0.0	.	135;135;135	G5E9U1;Q15642;Q15642-2	.;CIP4_HUMAN;.	D	135	ENSP00000320493:E135D;ENSP00000320117:E135D	ENSP00000320117:E135D	E	+	3	2	TRIP10	6694264	1.000000	0.71417	0.999000	0.59377	0.854000	0.48673	0.793000	0.26944	0.174000	0.19809	0.462000	0.41574	GAG	.		0.582	TRIP10-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000317129.2		
NR2F6	2063	broad.mit.edu	37	19	17355929	17355929	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr19:17355929G>A	ENST00000291442.3	-	1	820	c.101C>T	c.(100-102)tCg>tTg	p.S34L	AC010646.3_ENST00000594059.1_Intron	NM_005234.3	NP_005225.2	P10588	NR2F6_HUMAN	nuclear receptor subfamily 2, group F, member 6	34					detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|entrainment of circadian clock by photoperiod (GO:0043153)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron development (GO:0048666)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|thyroid hormone receptor activity (GO:0004887)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(1)|lung(1)	5						ACCGGGGGGCGAGGCCGAGTC	0.771																																					p.S34L													.	NR2F6-186	0			c.C101T						.						6.0	7.0	6.0					19																	17355929		1976	3706	5682	SO:0001583	missense	2063	exon1			GGGGGCGAGGCCG	X12794	CCDS12352.1	19p13.11	2013-09-20			ENSG00000160113	ENSG00000160113		"""Nuclear hormone receptors"""	7977	protein-coding gene	gene with protein product		132880		ERBAL2		2905047	Standard	NM_005234		Approved	EAR-2	uc002nfq.3	P10588	OTTHUMG00000182728	ENST00000291442.3:c.101C>T	19.37:g.17355929G>A	ENSP00000291442:p.Ser34Leu	9	0		9	4	NM_005234	0	0	0	0	0	B2RC68|Q5XGA0|Q6P586|Q9BUE8	Missense_Mutation	SNP	ENST00000291442.3	37	CCDS12352.1	.	.	.	.	.	.	.	.	.	.	G	16.51	3.144482	0.57044	.	.	ENSG00000160113	ENST00000291442	D	0.93307	-3.2	2.97	2.97	0.34412	.	0.363501	0.24793	N	0.035544	D	0.86397	0.5923	L	0.46157	1.445	0.80722	D	1	P	0.49253	0.921	B	0.24974	0.057	D	0.87361	0.2344	10	0.59425	D	0.04	.	11.8123	0.52189	0.0:0.0:1.0:0.0	.	34	P10588	NR2F6_HUMAN	L	34	ENSP00000291442:S34L	ENSP00000291442:S34L	S	-	2	0	NR2F6	17216929	1.000000	0.71417	0.966000	0.40874	0.092000	0.18411	3.656000	0.54467	1.686000	0.51046	0.298000	0.19748	TCG	.		0.771	NR2F6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463325.1		
WDR88	126248	hgsc.bcm.edu	37	19	33635808	33635808	+	Missense_Mutation	SNP	T	T	C			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr19:33635808T>C	ENST00000355868.3	+	3	522	c.446T>C	c.(445-447)gTa>gCa	p.V149A	WDR88_ENST00000361680.2_Missense_Mutation_p.V149A|WDR88_ENST00000592765.1_Missense_Mutation_p.V149A	NM_173479.3	NP_775750.3	Q6ZMY6	WDR88_HUMAN	WD repeat domain 88	149										breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	25	Esophageal squamous(110;0.137)					GCTCCTGTTGTAGAGTGCAGC	0.552																																					p.V149A		.											.	WDR88-154	0			c.T446C						.						117.0	91.0	100.0					19																	33635808		2203	4300	6503	SO:0001583	missense	126248	exon3			CTGTTGTAGAGTG	BC031227	CCDS12429.1	19q13.11	2013-01-09	2007-04-04	2007-04-04		ENSG00000166359		"""WD repeat domain containing"""	26999	protein-coding gene	gene with protein product			"""PQQ repeat and WD repeat domain containing"""	PQWD		12477932	Standard	NM_173479		Approved		uc002nui.3	Q6ZMY6		ENST00000355868.3:c.446T>C	19.37:g.33635808T>C	ENSP00000348129:p.Val149Ala	37	0		30	2	NM_173479	0	0	0	0	0	Q8NEF8	Missense_Mutation	SNP	ENST00000355868.3	37	CCDS12429.1	.	.	.	.	.	.	.	.	.	.	T	2.527	-0.309490	0.05458	.	.	ENSG00000166359	ENST00000355868;ENST00000361680	T;T	0.39406	1.08;1.08	5.09	1.36	0.22044	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	44.246300	0.00166	N	0.000000	T	0.28928	0.0718	N	0.24115	0.695	0.09310	N	1	B	0.22480	0.07	B	0.16722	0.016	T	0.11891	-1.0569	10	0.16896	T	0.51	.	5.9601	0.19295	0.0:0.4463:0.0:0.5537	.	149	Q6ZMY6	WDR88_HUMAN	A	149	ENSP00000348129:V149A;ENSP00000355148:V149A	ENSP00000348129:V149A	V	+	2	0	WDR88	38327648	0.001000	0.12720	0.026000	0.17262	0.171000	0.22731	0.476000	0.22180	0.366000	0.24427	0.459000	0.35465	GTA	.		0.552	WDR88-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450840.1	NM_173479	
NCCRP1	342897	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	39691364	39691364	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr19:39691364G>A	ENST00000339852.4	+	6	818	c.796G>A	c.(796-798)Gac>Aac	p.D266N		NM_001001414.1	NP_001001414.1	Q6ZVX7	FBX50_HUMAN	non-specific cytotoxic cell receptor protein 1 homolog (zebrafish)	266	FBA. {ECO:0000255|PROSITE- ProRule:PRU00482}.				positive regulation of cell proliferation (GO:0008284)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				kidney(1)|large_intestine(2)|liver(1)|lung(4)|ovary(1)|urinary_tract(1)	10						ACGGGTGACCGACTCCTCCGT	0.617																																					p.D266N	Melanoma(107;1207 1556 14956 29427 52130)	.											.	NCCRP1-91	0			c.G796A						.						152.0	148.0	149.0					19																	39691364		2203	4300	6503	SO:0001583	missense	342897	exon6			GTGACCGACTCCT	AK123941, BC067874	CCDS12529.1	19q13.2	2013-07-31	2008-11-19		ENSG00000188505	ENSG00000188505			33739	protein-coding gene	gene with protein product		615901					Standard	NM_001001414		Approved	LOC342897, NCCRP-1, FBXO50	uc002okq.1	Q6ZVX7		ENST00000339852.4:c.796G>A	19.37:g.39691364G>A	ENSP00000342137:p.Asp266Asn	385	0		303	60	NM_001001414	0	0	442	553	111	Q6NVV5	Missense_Mutation	SNP	ENST00000339852.4	37	CCDS12529.1	.	.	.	.	.	.	.	.	.	.	G	9.500	1.103019	0.20632	.	.	ENSG00000188505	ENST00000339852	T	0.24350	1.86	4.96	4.96	0.65561	Galactose-binding domain-like (1);F-box associated (FBA) domain (2);	0.050217	0.85682	D	0.000000	T	0.22898	0.0553	N	0.11201	0.11	0.50313	D	0.999862	D	0.61697	0.99	P	0.57057	0.812	T	0.02728	-1.1118	10	0.07030	T	0.85	-30.2767	15.693	0.77469	0.0:0.0:1.0:0.0	.	266	Q6ZVX7	NCRP1_HUMAN	N	266	ENSP00000342137:D266N	ENSP00000342137:D266N	D	+	1	0	NCCRP1	44383204	1.000000	0.71417	0.955000	0.39395	0.144000	0.21451	4.099000	0.57755	2.319000	0.78375	0.484000	0.47621	GAC	.		0.617	NCCRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463829.1	NM_001001414	
AKT2	208	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	40741033	40741033	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr19:40741033G>C	ENST00000392038.2	-	13	1583	c.1285C>G	c.(1285-1287)Cag>Gag	p.Q429E	AKT2_ENST00000579047.1_Missense_Mutation_p.Q367E|AKT2_ENST00000311278.6_Missense_Mutation_p.Q386E|AKT2_ENST00000424901.1_Missense_Mutation_p.Q429E	NM_001243027.1|NM_001243028.1|NM_001626.4	NP_001229956.1|NP_001229957.1|NP_001617.1	P31751	AKT2_HUMAN	v-akt murine thymoma viral oncogene homolog 2	429	AGC-kinase C-terminal.				activation of Ral GTPase activity (GO:0032859)|apoptotic process (GO:0006915)|carbohydrate transport (GO:0008643)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|fat cell differentiation (GO:0045444)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|insulin receptor signaling pathway (GO:0008286)|intracellular protein transmembrane transport (GO:0065002)|mammary gland epithelial cell differentiation (GO:0060644)|membrane organization (GO:0061024)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|peripheral nervous system myelin maintenance (GO:0032287)|positive regulation of cell motility (GO:2000147)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of vesicle fusion (GO:0031340)|protein localization to plasma membrane (GO:0072659)|regulation of cell cycle arrest (GO:0071156)|regulation of cell migration (GO:0030334)|regulation of translation (GO:0006417)|signal transduction (GO:0007165)	cell cortex (GO:0005938)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|cervix(1)|kidney(3)|large_intestine(9)|lung(10)|prostate(2)|skin(1)	27			Lung(22;0.000499)			GACGTGACCTGAGGTTTGAAG	0.617			A		"""ovarian, pancreatic """																																p.Q429E		.		Dom	yes		19	19q13.1-q13.2	208	v-akt murine thymoma viral oncogene homolog 2		E	.	AKT2-978	0			c.C1285G						.						131.0	117.0	122.0					19																	40741033		2203	4300	6503	SO:0001583	missense	208	exon13			TGACCTGAGGTTT	M77198	CCDS12552.1	19q13.1-q13.2	2013-01-10			ENSG00000105221	ENSG00000105221	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	392	protein-coding gene	gene with protein product		164731				1409633	Standard	NM_001626		Approved		uc002onf.3	P31751	OTTHUMG00000137375	ENST00000392038.2:c.1285C>G	19.37:g.40741033G>C	ENSP00000375892:p.Gln429Glu	108	1		82	38	NM_001626	0	0	71	154	83	B2RBD8|Q05BV0|Q0VAN0|Q0VAN1|Q68GC0	Missense_Mutation	SNP	ENST00000392038.2	37	CCDS12552.1	.	.	.	.	.	.	.	.	.	.	G	15.06	2.720332	0.48728	.	.	ENSG00000105221	ENST00000392038;ENST00000391844;ENST00000424901;ENST00000311278	T;T;T	0.56611	0.45;0.45;0.45	5.39	4.36	0.52297	Protein kinase, C-terminal (1);AGC-kinase, C-terminal (2);Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.51941	0.1704	M	0.69823	2.125	0.80722	D	1	B;B;B	0.10296	0.0;0.003;0.001	B;B;B	0.15870	0.001;0.014;0.006	T	0.52162	-0.8612	10	0.41790	T	0.15	.	12.9122	0.58187	0.0788:0.0:0.9212:0.0	.	367;386;429	B4DG79;Q0VAN0;P31751	.;.;AKT2_HUMAN	E	429;330;429;386	ENSP00000375892:Q429E;ENSP00000399532:Q429E;ENSP00000309428:Q386E	ENSP00000309428:Q386E	Q	-	1	0	AKT2	45432873	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.329000	0.96413	1.513000	0.48852	0.655000	0.94253	CAG	.		0.617	AKT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268029.1	NM_001626	
C19orf47	126526	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	40832303	40832303	+	Missense_Mutation	SNP	T	T	C			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr19:40832303T>C	ENST00000582783.1	-	7	653	c.641A>G	c.(640-642)aAc>aGc	p.N214S	C19orf47_ENST00000392035.2_Missense_Mutation_p.N147S	NM_001256440.1	NP_001243369.1	Q8N9M1	CS047_HUMAN	chromosome 19 open reading frame 47	214						nucleus (GO:0005634)				endometrium(5)|kidney(2)|lung(7)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	20			Lung(22;0.000636)			TTTGGGCATGTTGATGACGTA	0.662																																					p.N214S		.											.	C19orf47-92	0			c.A641G						.						132.0	102.0	112.0					19																	40832303		2203	4300	6503	SO:0001583	missense	126526	exon7			GGCATGTTGATGA	AL834131	CCDS58662.1	19q13.2	2012-07-20			ENSG00000160392	ENSG00000160392			26723	protein-coding gene	gene with protein product						12477932	Standard	NM_001256440		Approved	FLJ36888	uc002oni.5	Q8N9M1	OTTHUMG00000179028	ENST00000582783.1:c.641A>G	19.37:g.40832303T>C	ENSP00000463159:p.Asn214Ser	84	0		55	26	NM_001256440	0	0	7	12	5	Q8IZ33|Q8N0V9	Missense_Mutation	SNP	ENST00000582783.1	37	CCDS58662.1	.	.	.	.	.	.	.	.	.	.	T	17.31	3.356248	0.61293	.	.	ENSG00000160392	ENST00000357884;ENST00000392035	.	.	.	5.54	4.44	0.53790	.	0.086607	0.85682	D	0.000000	T	0.51329	0.1668	L	0.59436	1.845	0.50632	D	0.999884	B	0.32753	0.383	B	0.33521	0.165	T	0.46803	-0.9165	9	0.14656	T	0.56	1.1855	13.0399	0.58893	0.0:0.0:0.1429:0.8571	.	214	Q8N9M1	CS047_HUMAN	S	214;147	.	ENSP00000350556:N214S	N	-	2	0	C19orf47	45524143	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.596000	0.54024	2.115000	0.64714	0.379000	0.24179	AAC	.		0.662	C19orf47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444488.1	NM_178830	
LYPD3	27076	hgsc.bcm.edu	37	19	43967362	43967362	+	Missense_Mutation	SNP	T	T	C			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr19:43967362T>C	ENST00000244333.3	-	4	548	c.460A>G	c.(460-462)Aca>Gca	p.T154A		NM_014400.2	NP_055215.2	O95274	LYPD3_HUMAN	LY6/PLAUR domain containing 3	154	UPAR/Ly6 2.				cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)	anchored component of plasma membrane (GO:0046658)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(1)|pancreas(1)|upper_aerodigestive_tract(2)	11		Prostate(69;0.0153)				GGCGGCGATGTACCCTGGCAC	0.647																																					p.T154A		.											.	LYPD3-91	0			c.A460G						.						73.0	65.0	68.0					19																	43967362		2203	4300	6503	SO:0001583	missense	27076	exon4			GCGATGTACCCTG	AF082889	CCDS12620.1	19q13.31	2008-02-05				ENSG00000124466			24880	protein-coding gene	gene with protein product		609484				11179665, 11245483	Standard	NM_014400		Approved	C4.4A	uc002owl.1	O95274		ENST00000244333.3:c.460A>G	19.37:g.43967362T>C	ENSP00000244333:p.Thr154Ala	110	0		99	7	NM_014400	1	1	832	834	0	Q9UJ74	Missense_Mutation	SNP	ENST00000244333.3	37	CCDS12620.1	.	.	.	.	.	.	.	.	.	.	T	4.370	0.068265	0.08436	.	.	ENSG00000124466	ENST00000244333	T	0.69435	-0.4	4.67	-1.43	0.08884	CD59 antigen (1);	1.302740	0.05157	N	0.497038	T	0.32763	0.0840	N	0.02011	-0.69	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.12400	-1.0549	10	0.10636	T	0.68	.	3.1389	0.06448	0.4169:0.1813:0.0:0.4018	.	154	O95274	LYPD3_HUMAN	A	154	ENSP00000244333:T154A	ENSP00000244333:T154A	T	-	1	0	LYPD3	48659202	0.000000	0.05858	0.000000	0.03702	0.485000	0.33311	-0.246000	0.08878	-0.637000	0.05516	0.374000	0.22700	ACA	.		0.647	LYPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463177.1	NM_014400	
ALDH16A1	126133	ucsc.edu	37	19	49969068	49969068	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr19:49969068C>T	ENST00000293350.4	+	13	1805	c.1642C>T	c.(1642-1644)Cgg>Tgg	p.R548W	ALDH16A1_ENST00000540132.1_Missense_Mutation_p.R385W|ALDH16A1_ENST00000455361.2_Missense_Mutation_p.R497W|ALDH16A1_ENST00000433981.2_Missense_Mutation_p.R383W|CTD-3148I10.9_ENST00000599536.1_Intron	NM_153329.3	NP_699160.2	Q8IZ83	A16A1_HUMAN	aldehyde dehydrogenase 16 family, member A1	548						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)			cervix(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(5)|skin(2)|urinary_tract(3)	20		all_lung(116;5.39e-06)|Lung NSC(112;1.97e-05)|all_neural(266;0.0966)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00156)|GBM - Glioblastoma multiforme(486;0.0251)		CAGGCCCATCCGGGATTCGTC	0.652																																					p.R548W													.	ALDH16A1-91	0			c.C1642T						.						38.0	41.0	40.0					19																	49969068		2203	4300	6503	SO:0001583	missense	126133	exon13			CCCATCCGGGATT	AY007096	CCDS12766.1, CCDS46141.1	19q13.33	2014-08-12			ENSG00000161618	ENSG00000161618		"""Aldehyde dehydrogenases"""	28114	protein-coding gene	gene with protein product		613358					Standard	NM_153329		Approved	MGC10204	uc002pnt.3	Q8IZ83	OTTHUMG00000183163	ENST00000293350.4:c.1642C>T	19.37:g.49969068C>T	ENSP00000293350:p.Arg548Trp	57	0		33	4	NM_153329	0	0	23	23	0	B4DLQ1|C9JBH6|Q86YF0|Q8IYL4|Q8TEI8	Missense_Mutation	SNP	ENST00000293350.4	37	CCDS12766.1	.	.	.	.	.	.	.	.	.	.	C	4.227	0.041032	0.08196	.	.	ENSG00000161618	ENST00000293350;ENST00000455361;ENST00000540132;ENST00000433981	T;T;T;T	0.30182	1.54;1.54;1.54;1.54	4.77	-1.69	0.08186	Aldehyde dehydrogenase, N-terminal (1);Aldehyde/histidinol dehydrogenase (1);	1.480900	0.04153	N	0.321619	T	0.21962	0.0529	L	0.37800	1.135	0.09310	N	1	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.06405	0.002;0.0;0.0	T	0.20940	-1.0260	10	0.36615	T	0.2	-21.3384	3.6231	0.08103	0.2686:0.3861:0.0:0.3453	.	385;497;548	F5H4B6;B4DLQ1;Q8IZ83	.;.;A16A1_HUMAN	W	548;497;385;383	ENSP00000293350:R548W;ENSP00000410142:R497W;ENSP00000445088:R385W;ENSP00000398675:R383W	ENSP00000293350:R548W	R	+	1	2	ALDH16A1	54660880	0.000000	0.05858	0.070000	0.20053	0.014000	0.08584	-1.814000	0.01723	-0.156000	0.11079	-0.254000	0.11334	CGG	.		0.652	ALDH16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465358.1	NM_153329	
KLK10	5655	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	51518766	51518766	+	Silent	SNP	G	G	T			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr19:51518766G>T	ENST00000309958.3	-	5	803	c.585C>A	c.(583-585)atC>atA	p.I195I	KLK10_ENST00000358789.3_Silent_p.I195I|CTC-518B2.12_ENST00000596286.1_RNA|KLK10_ENST00000391805.1_Silent_p.I195I	NM_002776.4	NP_002767.2	O43240	KLK10_HUMAN	kallikrein-related peptidase 10	195	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cell cycle (GO:0007049)	extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)	13		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00328)|GBM - Glioblastoma multiforme(134;0.00885)		TAGGGCTCAGGATAGTGATGC	0.567																																					p.I195I		.											.	KLK10-650	0			c.C585A						.						273.0	256.0	262.0					19																	51518766		2203	4300	6503	SO:0001819	synonymous_variant	5655	exon5			GCTCAGGATAGTG	AF024605	CCDS12817.1	19q13	2011-03-07	2006-10-27			ENSG00000129451		"""Kallikreins"""	6358	protein-coding gene	gene with protein product		602673	"""kallikrein 10"""	PRSSL1		8764136, 9533035, 16800724, 16800723, 10675891	Standard	NM_145888		Approved	NES1	uc002pva.3	O43240		ENST00000309958.3:c.585C>A	19.37:g.51518766G>T		468	0		385	66	NM_145888	0	0	0	0	0	A6NC12|Q53YL3|Q99920|Q9GZW9	Silent	SNP	ENST00000309958.3	37	CCDS12817.1																																																																																			.		0.567	KLK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464337.2	NM_002776	
ZNF347	84671	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	53643875	53643875	+	Missense_Mutation	SNP	G	G	T			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr19:53643875G>T	ENST00000334197.7	-	5	2274	c.2206C>A	c.(2206-2208)Cct>Act	p.P736T	ZNF347_ENST00000452676.2_Missense_Mutation_p.P737T|ZNF347_ENST00000601469.2_Missense_Mutation_p.P737T|ZNF347_ENST00000601804.1_Intron	NM_032584.2	NP_115973.2	Q96SE7	ZN347_HUMAN	zinc finger protein 347	736					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|prostate(3)|skin(1)	23				GBM - Glioblastoma multiforme(134;0.0179)		CATTTGTAAGGTTTTTTTCCA	0.423																																					p.P737T	Melanoma(64;205 1597 17324 45721)	.											.	ZNF347-90	0			c.C2209A						.						167.0	155.0	159.0					19																	53643875		2203	4300	6503	SO:0001583	missense	84671	exon5			TGTAAGGTTTTTT	AY029765	CCDS33097.1, CCDS54314.1	19q13.3	2013-01-08				ENSG00000197937		"""Zinc fingers, C2H2-type"", ""-"""	16447	protein-coding gene	gene with protein product							Standard	NM_032584		Approved	ZNF1111	uc010eql.2	Q96SE7		ENST00000334197.7:c.2206C>A	19.37:g.53643875G>T	ENSP00000334146:p.Pro736Thr	232	0		172	28	NM_001172675	0	0	5	5	0	B3KU77|B9EG59|G5E9N4|Q8TCN1	Missense_Mutation	SNP	ENST00000334197.7	37	CCDS33097.1	.	.	.	.	.	.	.	.	.	.	G	14.27	2.486058	0.44147	.	.	ENSG00000197937	ENST00000334197;ENST00000452676	T;T	0.16897	2.31;2.31	2.64	-0.0406	0.13871	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.36054	0.0953	M	0.76574	2.34	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.981	T	0.11036	-1.0604	9	0.87932	D	0	.	6.5531	0.22446	0.3119:0.0:0.6881:0.0	.	737;736	G5E9N4;Q96SE7	.;ZN347_HUMAN	T	736;737	ENSP00000334146:P736T;ENSP00000405218:P737T	ENSP00000334146:P736T	P	-	1	0	ZNF347	58335687	0.348000	0.24861	0.000000	0.03702	0.251000	0.25915	1.732000	0.38146	-0.074000	0.12820	0.655000	0.94253	CCT	.		0.423	ZNF347-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464170.1	NM_032584	
MYADM	91663	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	54377552	54377552	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr19:54377552C>T	ENST00000391769.2	+	3	1049	c.769C>T	c.(769-771)Ctc>Ttc	p.L257F	MYADM_ENST00000391768.2_Missense_Mutation_p.L257F|AC008440.5_ENST00000413496.2_RNA|MYADM_ENST00000391770.4_Missense_Mutation_p.L257F|MYADM_ENST00000336967.3_Missense_Mutation_p.L257F|MYADM_ENST00000391771.1_Missense_Mutation_p.L257F	NM_001020821.1	NP_001018657.1	Q96S97	MYADM_HUMAN	myeloid-associated differentiation marker	257	MARVEL 2. {ECO:0000255|PROSITE- ProRule:PRU00581}.				establishment of endothelial barrier (GO:0061028)|membrane raft organization (GO:0031579)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of gene expression (GO:0010629)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of protein kinase C signaling (GO:0090038)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of cell migration (GO:0030335)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|protein targeting to plasma membrane (GO:0072661)	cell-cell junction (GO:0005911)|cortical actin cytoskeleton (GO:0030864)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|ruffle (GO:0001726)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	12	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.0488)		CGCCCTTGTTCTCTGGCCCCT	0.622																																					p.L257F		.											.	MYADM-91	0			c.C769T						.						84.0	77.0	79.0					19																	54377552		2203	4300	6503	SO:0001583	missense	91663	exon3			CTTGTTCTCTGGC	AF087882	CCDS12866.1	19q13.33-q13.4	2004-07-23			ENSG00000179820	ENSG00000179820			7544	protein-coding gene	gene with protein product		609959				10733104, 12075932	Standard	NM_001020818		Approved		uc002qcl.3	Q96S97	OTTHUMG00000060775	ENST00000391769.2:c.769C>T	19.37:g.54377552C>T	ENSP00000375649:p.Leu257Phe	146	1		103	23	NM_138373	0	0	4	4	0	B2RE58|Q542Z1|Q7Z507|Q8N9R4|Q96CS6|Q96SK9	Missense_Mutation	SNP	ENST00000391769.2	37	CCDS12866.1	.	.	.	.	.	.	.	.	.	.	C	12.50	1.957420	0.34565	.	.	ENSG00000179820	ENST00000336967;ENST00000391770;ENST00000439000;ENST00000391771;ENST00000415619;ENST00000391769;ENST00000391768	T;T;T;T;T;T	0.25912	1.77;1.77;1.77;1.77;1.77;1.77	4.3	0.655	0.17839	Marvel (1);MARVEL-like domain (1);	0.516121	0.18617	N	0.135981	T	0.48187	0.1486	M	0.85542	2.76	0.44447	D	0.997374	D	0.71674	0.998	D	0.71656	0.974	T	0.45527	-0.9255	10	0.87932	D	0	-12.2374	7.6235	0.28200	0.472:0.3744:0.1536:0.0	.	257	Q96S97	MYADM_HUMAN	F	257;257;257;257;220;257;257	ENSP00000337222:L257F;ENSP00000375650:L257F;ENSP00000416919:L257F;ENSP00000375651:L257F;ENSP00000375649:L257F;ENSP00000375648:L257F	ENSP00000337222:L257F	L	+	1	0	MYADM	59069364	0.029000	0.19370	0.419000	0.26584	0.201000	0.24016	-0.708000	0.05035	0.027000	0.15297	0.305000	0.20034	CTC	.		0.622	MYADM-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134337.1	NM_138373	
NLRP7	199713	broad.mit.edu	37	19	55450843	55450843	+	Silent	SNP	G	G	A			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr19:55450843G>A	ENST00000590030.1	-	3	1384	c.1344C>T	c.(1342-1344)ttC>ttT	p.F448F	NLRP7_ENST00000446217.1_Silent_p.F476F|NLRP7_ENST00000328092.5_Silent_p.F448F|NLRP7_ENST00000592784.1_Silent_p.F448F|NLRP7_ENST00000340844.2_Silent_p.F448F|NLRP7_ENST00000588756.1_Silent_p.F448F|NLRP7_ENST00000448121.2_Silent_p.F448F			Q8WX94	NALP7_HUMAN	NLR family, pyrin domain containing 7	448	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.						ATP binding (GO:0005524)			autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(17)|liver(1)|lung(33)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	73				GBM - Glioblastoma multiforme(193;0.0325)		CTCCGTCCAGGAACAGACGGA	0.627																																					p.F448F													.	NLRP7-291	0			c.C1344T						.						35.0	32.0	33.0					19																	55450843		2203	4298	6501	SO:0001819	synonymous_variant	199713	exon4			GTCCAGGAACAGA	AF464765	CCDS12912.1, CCDS33109.1, CCDS46183.1	19q13.42	2008-02-05	2006-12-08	2006-12-08		ENSG00000167634		"""Nucleotide-binding domain and leucine rich repeat containing"""	22947	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 7"""	609661	"""NACHT, leucine rich repeat and PYD containing 7"""	NALP7		12563287, 12019269	Standard	NM_139176		Approved	PYPAF3, NOD12, PAN7, CLR19.4	uc002qii.4	Q8WX94		ENST00000590030.1:c.1344C>T	19.37:g.55450843G>A		93	0		46	6	NM_001127255	0	0	2	2	0	E9PE16|Q32MH8|Q7RTR1	Silent	SNP	ENST00000590030.1	37	CCDS33109.1																																																																																			.		0.627	NLRP7-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000451396.1	NM_139176	
GALP	85569	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	56694579	56694579	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr19:56694579G>C	ENST00000357330.2	+	5	375	c.293G>C	c.(292-294)gGa>gCa	p.G98A	GALP_ENST00000440823.1_3'UTR	NM_033106.3	NP_149097.1	Q9UBC7	GALP_HUMAN	galanin-like peptide	98					behavioral response to starvation (GO:0042595)|defense response to bacterium (GO:0042742)|neuropeptide signaling pathway (GO:0007218)|regulation of appetite (GO:0032098)|response to insulin (GO:0032868)	extracellular region (GO:0005576)				lung(4)	4		Colorectal(82;0.000147)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0507)		CCAGAGATTGGAGGTAAAGCC	0.507																																					p.G98A		.											.	GALP-90	0			c.G293C						.						94.0	88.0	90.0					19																	56694579		2203	4300	6503	SO:0001583	missense	85569	exon5			AGATTGGAGGTAA	AF188493	CCDS12940.1, CCDS46202.1	19q13.42	2013-02-26	2007-08-24			ENSG00000197487		"""Endogenous ligands"""	24840	protein-coding gene	gene with protein product		611178				10601261	Standard	NM_033106		Approved		uc002qmo.1	Q9UBC7		ENST00000357330.2:c.293G>C	19.37:g.56694579G>C	ENSP00000349884:p.Gly98Ala	130	0		96	32	NM_033106	0	0	0	0	0	A1KXL3	Missense_Mutation	SNP	ENST00000357330.2	37	CCDS12940.1	.	.	.	.	.	.	.	.	.	.	G	11.60	1.687848	0.29962	.	.	ENSG00000197487	ENST00000357330	T	0.60797	0.16	2.07	0.986	0.19784	.	.	.	.	.	T	0.35508	0.0934	L	0.32530	0.975	0.80722	D	1	B	0.33266	0.404	B	0.18561	0.022	T	0.07597	-1.0764	9	0.25106	T	0.35	-6.1554	6.4753	0.22033	0.0:0.3481:0.6519:0.0	.	98	Q9UBC7	GALP_HUMAN	A	98	ENSP00000349884:G98A	ENSP00000349884:G98A	G	+	2	0	GALP	61386391	0.945000	0.32115	0.166000	0.22797	0.024000	0.10985	0.450000	0.21762	0.410000	0.25675	0.591000	0.81541	GGA	.		0.507	GALP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457832.1	NM_033106	
USP29	57663	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	57641187	57641187	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr19:57641187G>C	ENST00000254181.4	+	4	1598	c.1144G>C	c.(1144-1146)Gac>Cac	p.D382H	USP29_ENST00000598197.1_Missense_Mutation_p.D382H	NM_020903.2	NP_065954.1	Q9HBJ7	UBP29_HUMAN	ubiquitin specific peptidase 29	382	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)			breast(3)|endometrium(4)|kidney(3)|large_intestine(15)|lung(47)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TCAGTGTTTAGACCAGCTGAA	0.368																																					p.D382H		.											.	USP29-661	0			c.G1144C						.						58.0	58.0	58.0					19																	57641187		2203	4298	6501	SO:0001583	missense	57663	exon4			TGTTTAGACCAGC		CCDS33124.1	19q13.4	2008-06-23	2005-08-08			ENSG00000131864		"""Ubiquitin-specific peptidases"""	18563	protein-coding gene	gene with protein product		609546	"""ubiquitin specific protease 29"""			12838346	Standard	NM_020903		Approved		uc002qny.3	Q9HBJ7		ENST00000254181.4:c.1144G>C	19.37:g.57641187G>C	ENSP00000254181:p.Asp382His	102	0		106	42	NM_020903	0	0	0	0	0		Missense_Mutation	SNP	ENST00000254181.4	37	CCDS33124.1	.	.	.	.	.	.	.	.	.	.	G	14.62	2.588551	0.46110	.	.	ENSG00000131864	ENST00000254181	T	0.78595	-1.19	2.44	2.44	0.29823	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.617223	0.13416	U	0.389500	D	0.87688	0.6240	M	0.85630	2.765	0.29467	N	0.857365	D	0.89917	1.0	D	0.76575	0.988	T	0.80843	-0.1201	10	0.87932	D	0	-5.0112	11.0121	0.47669	0.0:0.0:1.0:0.0	.	382	Q9HBJ7	UBP29_HUMAN	H	382	ENSP00000254181:D382H	ENSP00000254181:D382H	D	+	1	0	USP29	62332999	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	3.330000	0.52068	1.646000	0.50622	0.591000	0.81541	GAC	.		0.368	USP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465075.1		
CAPN13	92291	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	30976059	30976059	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr2:30976059G>A	ENST00000295055.8	-	10	1123	c.947C>T	c.(946-948)tCg>tTg	p.S316L	CAPN13_ENST00000534090.2_Missense_Mutation_p.S316L	NM_144575.2	NP_653176.2	Q6MZZ7	CAN13_HUMAN	calpain 13	316	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(1)	30	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.155)					ATCTTGACACGACATCCTGTT	0.473																																					p.S316L		.											.	CAPN13-136	0			c.C947T						.						146.0	131.0	136.0					2																	30976059		1917	4122	6039	SO:0001583	missense	92291	exon10			TGACACGACATCC		CCDS46252.1	2p22-p21	2008-02-05			ENSG00000162949	ENSG00000162949			16663	protein-coding gene	gene with protein product		610228				11675017	Standard	NM_144575		Approved	FLJ23523	uc021vfm.1	Q6MZZ7	OTTHUMG00000152053	ENST00000295055.8:c.947C>T	2.37:g.30976059G>A	ENSP00000295055:p.Ser316Leu	106	2		102	32	NM_144575	0	0	0	0	0	Q17RF0|Q580X1|Q8TE80	Missense_Mutation	SNP	ENST00000295055.8	37	CCDS46252.1	.	.	.	.	.	.	.	.	.	.	G	19.31	3.802500	0.70682	.	.	ENSG00000162949	ENST00000295055;ENST00000534090	D;D	0.91843	-2.92;-2.92	5.27	5.27	0.74061	Peptidase C2, calpain, catalytic domain (3);	0.325611	0.33364	N	0.004988	D	0.97483	0.9176	H	0.97340	3.985	0.58432	D	0.999994	D	0.89917	1.0	D	0.85130	0.997	D	0.98552	1.0637	10	0.87932	D	0	.	14.3858	0.66942	0.0:0.0:1.0:0.0	.	316	Q6MZZ7	CAN13_HUMAN	L	316	ENSP00000295055:S316L;ENSP00000431298:S316L	ENSP00000295055:S316L	S	-	2	0	CAPN13	30829563	1.000000	0.71417	0.999000	0.59377	0.588000	0.36517	5.259000	0.65485	2.462000	0.83206	0.561000	0.74099	TCG	.		0.473	CAPN13-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325101.2	NM_144575	
BIRC6	57448	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	32626579	32626579	+	Nonsense_Mutation	SNP	C	C	T			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr2:32626579C>T	ENST00000421745.2	+	8	1440	c.1306C>T	c.(1306-1308)Cag>Tag	p.Q436*		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	436					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					AATTGTACAACAGCTTATTCT	0.378																																					p.Q436X	Pancreas(94;175 1509 16028 18060 45422)	.											.	BIRC6-233	0			c.C1306T						.						105.0	107.0	106.0					2																	32626579		2203	4300	6503	SO:0001587	stop_gained	57448	exon8			GTACAACAGCTTA	AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.1306C>T	2.37:g.32626579C>T	ENSP00000393596:p.Gln436*	111	0		106	38	NM_016252	0	0	6	7	1	Q9ULD1	Nonsense_Mutation	SNP	ENST00000421745.2	37	CCDS33175.2	.	.	.	.	.	.	.	.	.	.	C	36	5.679441	0.96774	.	.	ENSG00000115760	ENST00000421745	.	.	.	5.92	5.92	0.95590	.	0.157867	0.40908	D	0.000998	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08599	T	0.76	.	13.5098	0.61504	0.0:0.929:0.0:0.071	.	.	.	.	X	436	.	ENSP00000393596:Q436X	Q	+	1	0	BIRC6	32480083	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.615000	0.61190	2.813000	0.96785	0.561000	0.74099	CAG	.		0.378	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3	NM_016252	
SOS1	6654	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	39281894	39281894	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr2:39281894G>A	ENST00000426016.1	-	6	667	c.581C>T	c.(580-582)tCc>tTc	p.S194F	SOS1_ENST00000395038.2_Missense_Mutation_p.S194F|SOS1_ENST00000428721.2_Missense_Mutation_p.S137F|SOS1_ENST00000402219.2_Missense_Mutation_p.S194F			Q07889	SOS1_HUMAN	son of sevenless homolog 1 (Drosophila)	194					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|Ras protein signal transduction (GO:0007265)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	DNA binding (GO:0003677)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|liver(1)|lung(29)|ovary(4)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	75		all_hematologic(82;0.21)				TCCTGAGGTGGAAGGCTCTTC	0.284									Noonan syndrome																												p.S194F		.											.	SOS1-851	0			c.C581T						.						86.0	99.0	94.0					2																	39281894		2203	4297	6500	SO:0001583	missense	6654	exon5	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	GAGGTGGAAGGCT	L13857	CCDS1802.1	2p21	2014-09-17	2002-11-05		ENSG00000115904	ENSG00000115904		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11187	protein-coding gene	gene with protein product		182530	"""gingival fibromatosis, hereditary, 1"""	GINGF		8276400, 10995566	Standard	NM_005633		Approved	HGF, GF1	uc002rrk.4	Q07889	OTTHUMG00000102109	ENST00000426016.1:c.581C>T	2.37:g.39281894G>A	ENSP00000387784:p.Ser194Phe	213	0		166	68	NM_005633	0	0	5	8	3	A8K2G3|B4DXG2	Missense_Mutation	SNP	ENST00000426016.1	37	CCDS1802.1	.	.	.	.	.	.	.	.	.	.	G	15.74	2.921771	0.52653	.	.	ENSG00000115904	ENST00000426016;ENST00000402219;ENST00000395038;ENST00000263879;ENST00000428721	T;T;T;D	0.96334	-1.08;-1.08;-1.21;-3.98	5.88	5.88	0.94601	.	0.063359	0.64402	D	0.000004	D	0.93575	0.7949	L	0.27053	0.805	0.58432	D	0.999995	B	0.12013	0.005	B	0.15484	0.013	D	0.88675	0.3198	10	0.59425	D	0.04	.	20.2187	0.98312	0.0:0.0:1.0:0.0	.	194	Q07889	SOS1_HUMAN	F	194;194;194;194;137	ENSP00000387784:S194F;ENSP00000384675:S194F;ENSP00000378479:S194F;ENSP00000399992:S137F	ENSP00000263879:S194F	S	-	2	0	SOS1	39135398	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.200000	0.51051	2.780000	0.95670	0.655000	0.94253	TCC	.		0.284	SOS1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219948.3	NM_005633	
MDH1	4190	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	63826356	63826356	+	Nonsense_Mutation	SNP	C	C	G			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr2:63826356C>G	ENST00000233114.8	+	5	863	c.428C>G	c.(427-429)tCa>tGa	p.S143*	MDH1_ENST00000409908.1_Intron|MDH1_ENST00000539945.1_Nonsense_Mutation_p.S161*|MDH1_ENST00000544381.1_Nonsense_Mutation_p.S54*|MDH1_ENST00000409476.1_Nonsense_Mutation_p.S19*|MDH1_ENST00000394423.1_Nonsense_Mutation_p.S143*	NM_005917.3	NP_005908.1	P40925	MDHC_HUMAN	malate dehydrogenase 1, NAD (soluble)	143					carbohydrate metabolic process (GO:0005975)|cellular carbohydrate metabolic process (GO:0044262)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|malate metabolic process (GO:0006108)|NADH metabolic process (GO:0006734)|oxaloacetate metabolic process (GO:0006107)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	diiodophenylpyruvate reductase activity (GO:0047860)|L-malate dehydrogenase activity (GO:0030060)|malic enzyme activity (GO:0004470)|NAD binding (GO:0051287)			endometrium(2)|kidney(4)|large_intestine(1)|liver(2)|lung(4)	13						GCTTCCAAGTCAGCTCCATCC	0.418																																					p.S161X		.											.	MDH1-537	0			c.C482G						.						103.0	95.0	97.0					2																	63826356		2203	4300	6503	SO:0001587	stop_gained	4190	exon5			CCAAGTCAGCTCC		CCDS1874.1, CCDS56121.1, CCDS56122.1	2p23	2012-10-02			ENSG00000014641	ENSG00000014641	1.1.1.37		6970	protein-coding gene	gene with protein product		154200					Standard	NM_005917		Approved		uc010ypv.2	P40925	OTTHUMG00000129512	ENST00000233114.8:c.428C>G	2.37:g.63826356C>G	ENSP00000233114:p.Ser143*	85	1		93	11	NM_001199111	0	0	170	172	2	B2R5V5|B4DUN2|B7Z3I7|F5H098|Q6I9V0	Nonsense_Mutation	SNP	ENST00000233114.8	37	CCDS1874.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.291876	0.80914	.	.	ENSG00000014641	ENST00000233114;ENST00000409476;ENST00000436321;ENST00000432309;ENST00000539945;ENST00000544381;ENST00000394423	.	.	.	5.2	4.31	0.51392	.	0.267927	0.38837	N	0.001542	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15499	T	0.54	-0.539	12.967	0.58490	0.0:0.9202:0.0:0.0798	.	.	.	.	X	143;19;98;161;161;54;143	.	ENSP00000233114:S143X	S	+	2	0	MDH1	63679860	1.000000	0.71417	0.958000	0.39756	0.942000	0.58702	4.937000	0.63513	2.564000	0.86499	0.585000	0.79938	TCA	.		0.418	MDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251687.1		
ACTR2	10097	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	65492181	65492181	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr2:65492181G>A	ENST00000260641.5	+	8	1043	c.886G>A	c.(886-888)Gaa>Aaa	p.E296K	ACTR2_ENST00000377982.4_Missense_Mutation_p.E301K|ACTR2_ENST00000542850.1_Missense_Mutation_p.E241K	NM_005722.3	NP_005713.1	P61160	ARP2_HUMAN	ARP2 actin-related protein 2 homolog (yeast)	296					Arp2/3 complex-mediated actin nucleation (GO:0034314)|asymmetric cell division (GO:0008356)|cellular component movement (GO:0006928)|cilium assembly (GO:0042384)|cytoplasmic transport (GO:0016482)|establishment or maintenance of cell polarity (GO:0007163)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|meiotic chromosome movement towards spindle pole (GO:0016344)|meiotic cytokinesis (GO:0033206)|spindle localization (GO:0051653)	actin cap (GO:0030478)|actin cytoskeleton (GO:0015629)|Arp2/3 protein complex (GO:0005885)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)	ATP binding (GO:0005524)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(3)|lung(1)|prostate(1)	12						TTCTAGATCTGAATTCTACAA	0.428																																					p.E301K		.											.	ACTR2-278	0			c.G901A						.						179.0	168.0	171.0					2																	65492181		2203	4300	6503	SO:0001583	missense	10097	exon9			AGATCTGAATTCT	AF006082	CCDS1881.1, CCDS46307.1	2p14	2008-05-20	2001-11-28		ENSG00000138071	ENSG00000138071			169	protein-coding gene	gene with protein product		604221	"""ARP2 (actin-related protein 2, yeast) homolog"""			9230079	Standard	NM_001005386		Approved	ARP2	uc002sdp.3	P61160	OTTHUMG00000129540	ENST00000260641.5:c.886G>A	2.37:g.65492181G>A	ENSP00000260641:p.Glu296Lys	169	0		176	70	NM_001005386	0	0	0	0	0	B2RCP5|D6W5F4|E9PF41|O15142|Q96C82	Missense_Mutation	SNP	ENST00000260641.5	37	CCDS1881.1	.	.	.	.	.	.	.	.	.	.	G	18.95	3.731091	0.69189	.	.	ENSG00000138071	ENST00000260641;ENST00000542850;ENST00000377982;ENST00000535303	D;D;D	0.94576	-3.46;-3.46;-3.46	5.98	5.1	0.69264	.	0.120167	0.53938	U	0.000057	D	0.93841	0.8030	M	0.70275	2.135	0.58432	D	0.999999	B;B;B	0.13594	0.005;0.008;0.004	B;B;B	0.13407	0.009;0.007;0.007	D	0.91169	0.4967	10	0.62326	D	0.03	-23.7201	17.2991	0.87177	0.0:0.1254:0.8746:0.0	.	241;296;301	F5H6T1;P61160;E9PF41	.;ARP2_HUMAN;.	K	296;241;301;241	ENSP00000260641:E296K;ENSP00000437383:E241K;ENSP00000367220:E301K	ENSP00000260641:E296K	E	+	1	0	ACTR2	65345685	1.000000	0.71417	1.000000	0.80357	0.880000	0.50808	9.476000	0.97823	1.525000	0.49052	0.591000	0.81541	GAA	.		0.428	ACTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251730.1	NM_001005386	
CLEC4F	165530	broad.mit.edu;bcgsc.ca	37	2	71043525	71043525	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr2:71043525C>T	ENST00000272367.2	-	4	1064	c.988G>A	c.(988-990)Gaa>Aaa	p.E330K	CLEC4F_ENST00000426626.1_Missense_Mutation_p.E330K	NM_001258027.1|NM_173535.2	NP_001244956.1|NP_775806.2	Q8N1N0	CLC4F_HUMAN	C-type lectin domain family 4, member F	330					endocytosis (GO:0006897)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			endometrium(1)|large_intestine(5)|lung(18)|ovary(5)|prostate(5)|skin(1)|upper_aerodigestive_tract(2)	37						ACGTGAATTTCATCACCAGCT	0.423																																					p.E330K	Colon(107;10 2157 6841 26035)												.	CLEC4F-95	0			c.G988A						.						93.0	90.0	91.0					2																	71043525		2203	4300	6503	SO:0001583	missense	165530	exon4			GAATTTCATCACC	AK096429	CCDS1910.1	2p13.3	2008-02-05	2005-02-09	2005-02-11	ENSG00000152672	ENSG00000152672		"""C-type lectin domain containing"""	25357	protein-coding gene	gene with protein product			"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 13"""	CLECSF13		8889548, 1846367	Standard	NM_001258027		Approved	FLJ39110, KCLR	uc002shf.3	Q8N1N0	OTTHUMG00000129713	ENST00000272367.2:c.988G>A	2.37:g.71043525C>T	ENSP00000272367:p.Glu330Lys	128	0		128	10	NM_173535	0	0	0	0	0	A4QPA5	Missense_Mutation	SNP	ENST00000272367.2	37	CCDS1910.1	.	.	.	.	.	.	.	.	.	.	C	11.23	1.576506	0.28092	.	.	ENSG00000152672	ENST00000272367;ENST00000426626	T;T	0.78246	-1.16;-1.16	3.99	3.1	0.35709	.	0.390460	0.18739	N	0.132519	T	0.69233	0.3088	L	0.55481	1.735	0.09310	N	1	B;B	0.22541	0.071;0.071	B;B	0.21360	0.034;0.034	T	0.56768	-0.7924	10	0.30078	T	0.28	.	8.148	0.31124	0.0:0.8884:0.0:0.1116	.	330;330	B7ZMM1;Q8N1N0	.;CLC4F_HUMAN	K	330	ENSP00000272367:E330K;ENSP00000390581:E330K	ENSP00000272367:E330K	E	-	1	0	CLEC4F	70897033	0.004000	0.15560	0.004000	0.12327	0.012000	0.07955	0.746000	0.26275	1.234000	0.43709	0.467000	0.42956	GAA	.		0.423	CLEC4F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251922.1	NM_173535	
SULT1C2	6819	broad.mit.edu;ucsc.edu	37	2	108921890	108921890	+	Missense_Mutation	SNP	G	G	T			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr2:108921890G>T	ENST00000437390.2	+	7	836	c.659G>T	c.(658-660)cGg>cTg	p.R220L	SULT1C2_ENST00000251481.6_Missense_Mutation_p.R206L|SULT1C2_ENST00000326853.5_Missense_Mutation_p.R217L|SULT1C2_ENST00000409880.1_Missense_Mutation_p.R169L			O75897	ST1C4_HUMAN	sulfotransferase family, cytosolic, 1C, member 2	212					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|small molecule metabolic process (GO:0044281)|sulfation (GO:0051923)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	sulfotransferase activity (GO:0008146)			NS(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	20						CATGAAATTCGGAAGGTGATG	0.403																																					p.R217L													.	SULT1C2-91	0			c.G650T						.						93.0	92.0	93.0					2																	108921890		2203	4300	6503	SO:0001583	missense	6819	exon8			AAATTCGGAAGGT	U66036, AF186255	CCDS2075.1, CCDS2076.1	2q12.3	2010-09-30	2007-03-16	2007-03-16	ENSG00000198203	ENSG00000198203		"""Sulfotransferases, cytosolic"""	11456	protein-coding gene	gene with protein product		602385	"""sulfotransferase family, cytosolic, 1C, member 1"""	SULT1C1		9169148, 10783263	Standard	NM_001056		Approved	ST1C1	uc002tdx.3	O00338	OTTHUMG00000153215	ENST00000437390.2:c.659G>T	2.37:g.108921890G>T	ENSP00000399651:p.Arg220Leu	60	0		50	5	NM_176825	0	0	0	0	0	Q069I8|Q08AS5|Q53S63	Missense_Mutation	SNP	ENST00000437390.2	37		.	.	.	.	.	.	.	.	.	.	G	12.27	1.888899	0.33348	.	.	ENSG00000198203	ENST00000251481;ENST00000326853;ENST00000409880;ENST00000437390	D;D;D;D	0.82619	-1.63;-1.63;-1.63;-1.63	4.66	-4.12	0.03916	Sulfotransferase domain (1);	0.750429	0.12255	N	0.485245	T	0.69913	0.3164	L	0.27053	0.805	0.22330	N	0.9992	B;B;B;B	0.15473	0.004;0.006;0.013;0.01	B;B;B;B	0.25759	0.038;0.003;0.063;0.037	T	0.54708	-0.8253	10	0.30078	T	0.28	.	11.0503	0.47882	0.6167:0.0:0.3833:0.0	.	220;121;206;217	B4DLP0;B4DPE8;O00338;O00338-2	.;.;ST1C2_HUMAN;.	L	206;217;169;220	ENSP00000251481:R206L;ENSP00000319622:R217L;ENSP00000387054:R169L;ENSP00000399651:R220L	ENSP00000251481:R206L	R	+	2	0	SULT1C2	108288322	0.001000	0.12720	0.945000	0.38365	0.789000	0.44602	0.233000	0.17911	-0.811000	0.04369	-1.044000	0.02363	CGG	.		0.403	SULT1C2-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000329969.2	NM_176825	
FSIP2	401024	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	186678413	186678413	+	Missense_Mutation	SNP	A	A	T			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr2:186678413A>T	ENST00000424728.1	+	18	19969	c.19969A>T	c.(19969-19971)Ata>Tta	p.I6657L	FSIP2_ENST00000343098.5_Missense_Mutation_p.I6746L			Q5CZC0	FSIP2_HUMAN	fibrous sheath interacting protein 2	6657										NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(11)|lung(46)|pancreas(1)|urinary_tract(2)	69						GGAAAATTACATAAAAGAGGA	0.308																																					p.I6746L		.											.	FSIP2-90	0			c.A20236T						.						60.0	58.0	59.0					2																	186678413		1815	4082	5897	SO:0001583	missense	401024	exon18			AATTACATAAAAG	AK092099	CCDS54426.1	2q32.1	2010-06-18			ENSG00000188738	ENSG00000188738			21675	protein-coding gene	gene with protein product		615796				14702039	Standard	NM_173651		Approved	FLJ34780	uc002upl.3	Q5CZC0	OTTHUMG00000153874	ENST00000424728.1:c.19969A>T	2.37:g.186678413A>T	ENSP00000401306:p.Ile6657Leu	41	0		40	11	NM_173651	0	0	0	0	0	Q53TL3|Q53TN5|Q5HYH2|Q6ZTZ5|Q6ZU14|Q6ZU21	Missense_Mutation	SNP	ENST00000424728.1	37		.	.	.	.	.	.	.	.	.	.	A	8.432	0.848829	0.17034	.	.	ENSG00000188738	ENST00000343098;ENST00000424728	T;T	0.39787	1.06;1.07	4.74	-6.09	0.02145	.	2.291920	0.01415	N	0.014178	T	0.16557	0.0398	N	0.03608	-0.345	0.09310	N	1	.	.	.	.	.	.	T	0.11567	-1.0582	8	0.17369	T	0.5	.	5.0483	0.14496	0.3028:0.0:0.4212:0.2761	.	.	.	.	L	6746;6657	ENSP00000344403:I6746L;ENSP00000401306:I6657L	ENSP00000344403:I6746L	I	+	1	0	FSIP2	186386658	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.003000	0.13083	-1.474000	0.01879	-1.412000	0.01120	ATA	.		0.308	FSIP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000332778.3	NM_173651	
MSTN	2660	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	190922196	190922196	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr2:190922196C>T	ENST00000260950.4	-	3	1048	c.916G>A	c.(916-918)Gcc>Acc	p.A306T	C2orf88_ENST00000478197.1_Intron	NM_005259.2	NP_005250.1	O14793	GDF8_HUMAN	myostatin	306					cellular response to dexamethasone stimulus (GO:0071549)|muscle organ development (GO:0007517)|negative regulation of muscle hypertrophy (GO:0014741)|negative regulation of skeletal muscle tissue growth (GO:0048632)|ovulation cycle process (GO:0022602)|positive regulation of transcription, DNA-templated (GO:0045893)|response to electrical stimulus (GO:0051602)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gravity (GO:0009629)|response to heat (GO:0009408)|response to muscle activity (GO:0014850)|response to testosterone (GO:0033574)|skeletal muscle atrophy (GO:0014732)|skeletal muscle tissue regeneration (GO:0043403)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	growth factor activity (GO:0008083)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|receptor binding (GO:0005102)			endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|skin(1)	12			OV - Ovarian serous cystadenocarcinoma(117;0.000742)|Epithelial(96;0.0121)|all cancers(119;0.0395)			CAGTAATTGGCCTTATATCTT	0.423																																					p.A306T		.											.	MSTN-650	0			c.G916A						.						85.0	83.0	84.0					2																	190922196		2203	4300	6503	SO:0001583	missense	2660	exon3			AATTGGCCTTATA	AF019627	CCDS2303.1	2q32.1	2014-09-17	2007-06-21	2007-06-21	ENSG00000138379	ENSG00000138379			4223	protein-coding gene	gene with protein product		601788	"""growth differentiation factor 8"""	GDF8		9288100, 10610713, 17003236	Standard	NM_005259		Approved		uc002urp.3	O14793	OTTHUMG00000132663	ENST00000260950.4:c.916G>A	2.37:g.190922196C>T	ENSP00000260950:p.Ala306Thr	60	0		69	34	NM_005259	0	0	0	0	0	A1C2J7|A1C2K0|Q6B0H2	Missense_Mutation	SNP	ENST00000260950.4	37	CCDS2303.1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.497799	0.85069	.	.	ENSG00000138379	ENST00000260950	D	0.86497	-2.13	5.79	5.79	0.91817	Transforming growth factor beta, conserved site (1);Transforming growth factor-beta, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.95604	0.8571	H	0.94886	3.595	0.80722	D	1	P	0.48089	0.905	D	0.65140	0.932	D	0.96037	0.9021	10	0.87932	D	0	-9.1744	20.0308	0.97536	0.0:1.0:0.0:0.0	.	306	O14793	GDF8_HUMAN	T	306	ENSP00000260950:A306T	ENSP00000260950:A306T	A	-	1	0	MSTN	190630441	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.818000	0.86416	2.732000	0.93576	0.585000	0.79938	GCC	.		0.423	MSTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255917.2	NM_005259	
ALS2CR12	130540	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	202172265	202172265	+	Missense_Mutation	SNP	C	C	G			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr2:202172265C>G	ENST00000286190.5	-	10	902	c.856G>C	c.(856-858)Gag>Cag	p.E286Q	ALS2CR12_ENST00000439709.1_Missense_Mutation_p.E286Q|ALS2CR12_ENST00000405148.2_Missense_Mutation_p.E286Q|ALS2CR12_ENST00000448967.1_5'Flank|ALS2CR12_ENST00000392257.3_Missense_Mutation_p.E286Q			Q96Q35	AL2SB_HUMAN	amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 12	286					regulation of GTPase activity (GO:0043087)	outer dense fiber (GO:0001520)|sperm fibrous sheath (GO:0035686)|sperm flagellum (GO:0036126)				NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)	21						ATGAAGTTCTCAAAGACAGCA	0.438																																					p.E286Q		.											.	ALS2CR12-154	0			c.G856C						.						223.0	220.0	221.0					2																	202172265		2203	4299	6502	SO:0001583	missense	130540	exon11			AGTTCTCAAAGAC	AB053314	CCDS2346.1, CCDS46488.1	2q33.1	2009-10-06			ENSG00000155749	ENSG00000155749			14439	protein-coding gene	gene with protein product							Standard	XM_006712272		Approved		uc002uya.4	Q96Q35	OTTHUMG00000132824	ENST00000286190.5:c.856G>C	2.37:g.202172265C>G	ENSP00000286190:p.Glu286Gln	265	1		275	53	NM_001127391	0	0	0	0	0	G5E9S3|Q53TT6|Q8N1B6	Missense_Mutation	SNP	ENST00000286190.5	37	CCDS2346.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	33|33	5.237379|5.237379	0.95240|0.95240	.|.	.|.	ENSG00000155749|ENSG00000155749	ENST00000286190;ENST00000405148;ENST00000392257;ENST00000439709|ENST00000415745	T;T;T;T|.	0.44482|.	0.92;0.92;0.92;0.92|.	5.53|5.53	5.53|5.53	0.82687|0.82687	.|.	0.216156|.	0.32970|.	N|.	0.005435|.	T|T	0.57873|0.57873	0.2083|0.2083	L|L	0.60455|0.60455	1.87|1.87	0.26519|0.26519	N|N	0.974462|0.974462	D;D|.	0.67145|.	0.996;0.996|.	P;P|.	0.62298|.	0.9;0.9|.	T|T	0.52756|0.52756	-0.8533|-0.8533	10|5	0.33141|.	T|.	0.24|.	-10.1129|-10.1129	16.749|16.749	0.85480|0.85480	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	286;286|.	Q96Q35;G5E9S3|.	AL2SB_HUMAN;.|.	Q|F	286|60	ENSP00000286190:E286Q;ENSP00000385098:E286Q;ENSP00000376086:E286Q;ENSP00000412073:E286Q|.	ENSP00000286190:E286Q|.	E|L	-|-	1|3	0|2	ALS2CR12|ALS2CR12	201880510|201880510	0.991000|0.991000	0.36638|0.36638	0.738000|0.738000	0.30950|0.30950	0.804000|0.804000	0.45430|0.45430	3.681000|3.681000	0.54648|0.54648	2.773000|2.773000	0.95371|0.95371	0.650000|0.650000	0.86243|0.86243	GAG|TTG	.		0.438	ALS2CR12-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256286.1	NM_139163	
KIF1A	547	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	241661280	241661280	+	Missense_Mutation	SNP	T	T	C			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr2:241661280T>C	ENST00000320389.7	-	42	4542	c.4384A>G	c.(4384-4386)Aca>Gca	p.T1462A	KIF1A_ENST00000498729.2_Missense_Mutation_p.T1563A	NM_004321.6	NP_004312.2	Q12756	KIF1A_HUMAN	kinesin family member 1A	1462					anterograde axon cargo transport (GO:0008089)|ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			NS(1)|central_nervous_system(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(25)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	66		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		CTGTTGAATGTGTGCGTGAGC	0.657																																					p.T1563A		.											.	KIF1A-91	0			c.A4687G						.						75.0	81.0	79.0					2																	241661280		2148	4248	6396	SO:0001583	missense	547	exon44			TGAATGTGTGCGT	AF004425	CCDS46561.1, CCDS58757.1	2q37.2	2014-09-17	2004-01-09	2004-01-14	ENSG00000130294	ENSG00000130294		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	888	protein-coding gene	gene with protein product		601255	"""axonal transport of synaptic vesicles"", ""chromosome 2 open reading frame 20"", ""spastic paraplegia 30 (autosomal recessive)"""	ATSV, C2orf20, SPG30		7539720, 10323250, 22258533	Standard	NM_001244008		Approved	UNC104	uc010fzk.3	Q12756	OTTHUMG00000151940	ENST00000320389.7:c.4384A>G	2.37:g.241661280T>C	ENSP00000322791:p.Thr1462Ala	32	0		11	8	NM_001244008	0	0	0	2	2	B0I1S5|F5H045|O95068|Q13355|Q14752|Q2NKJ6|Q4LE42|Q53T78|Q59GH1|Q63Z40|Q6P1R9|Q7KZ57	Missense_Mutation	SNP	ENST00000320389.7	37	CCDS46561.1	.	.	.	.	.	.	.	.	.	.	T	14.75	2.630002	0.46944	.	.	ENSG00000130294	ENST00000320389;ENST00000498729;ENST00000373308	T;T	0.72167	-0.55;-0.63	4.33	3.14	0.36123	.	0.120608	0.53938	U	0.000050	T	0.64483	0.2602	L	0.46157	1.445	0.41290	D	0.986977	P;B	0.39737	0.685;0.032	P;B	0.46299	0.511;0.014	T	0.57159	-0.7859	10	0.08599	T	0.76	.	9.5613	0.39371	0.165:0.0:0.0:0.835	.	1563;1462	F5H045;Q12756	.;KIF1A_HUMAN	A	1462;1563;1571	ENSP00000322791:T1462A;ENSP00000438388:T1563A	ENSP00000322791:T1462A	T	-	1	0	KIF1A	241309953	1.000000	0.71417	0.997000	0.53966	0.980000	0.70556	1.446000	0.35090	0.517000	0.28361	0.528000	0.53228	ACA	.		0.657	KIF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324536.3	NM_138483	
TMEM74B	55321	broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	1161561	1161561	+	Silent	SNP	C	C	T			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr20:1161561C>T	ENST00000381894.3	-	2	1373	c.702G>A	c.(700-702)ggG>ggA	p.G234G	TMEM74B_ENST00000481747.1_5'Flank	NM_018354.1	NP_060824.1	Q9NUR3	TM74B_HUMAN	transmembrane protein 74B	234						integral component of membrane (GO:0016021)											GGGCCTGGCCCCCATCCCCAT	0.592																																					p.G234G													.	.	0			c.G702A						.						80.0	73.0	75.0					20																	1161561		2203	4300	6503	SO:0001819	synonymous_variant	55321	exon2			CTGGCCCCCATCC	AK002052	CCDS13011.1	20p13	2011-11-23	2011-11-23	2011-11-23	ENSG00000125895	ENSG00000125895			15893	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 46"""	C20orf46			Standard	XM_005260748		Approved	FLJ11190	uc002weq.1	Q9NUR3	OTTHUMG00000031655	ENST00000381894.3:c.702G>A	20.37:g.1161561C>T		116	0		99	12	NM_018354	0	0	6	12	6	D3DVW5	Silent	SNP	ENST00000381894.3	37	CCDS13011.1																																																																																			.		0.592	TMEM74B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077496.2	NM_018354	
CHD6	84181	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	40033767	40033767	+	Silent	SNP	G	G	A	rs559201396		TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr20:40033767G>A	ENST00000373233.3	-	37	7791	c.7614C>T	c.(7612-7614)ctC>ctT	p.L2538L	CHD6_ENST00000480022.1_5'UTR	NM_032221.3	NP_115597.3	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	2538					ATP catabolic process (GO:0006200)|chromatin modification (GO:0016568)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|transcription cofactor binding (GO:0001221)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(24)|lung(53)|ovary(8)|prostate(5)|skin(8)|stomach(1)|urinary_tract(9)	129		Myeloproliferative disorder(115;0.00425)				TGGGTGGACTGAGGAGTCCCC	0.557																																					p.L2538L		.											.	CHD6-238	0			c.C7614T						.						90.0	83.0	85.0					20																	40033767		2203	4300	6503	SO:0001819	synonymous_variant	84181	exon37			TGGACTGAGGAGT	AF525085	CCDS13317.1	20q12	2003-03-07			ENSG00000124177	ENSG00000124177			19057	protein-coding gene	gene with protein product						11889561	Standard	NM_032221		Approved	KIAA1335, FLJ22369, dJ620E11.1, CHD5, RIGB	uc002xka.1	Q8TD26	OTTHUMG00000032487	ENST00000373233.3:c.7614C>T	20.37:g.40033767G>A		170	0		156	23	NM_032221	0	0	19	19	0	Q5JYQ0|Q5TGZ9|Q5TH00|Q5TH01|Q8IZR2|Q8WTY0|Q9H4H6|Q9H6D4|Q9NTT7|Q9P2L1	Silent	SNP	ENST00000373233.3	37	CCDS13317.1																																																																																			.		0.557	CHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079270.1		
CHD6	84181	broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	40050320	40050320	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr20:40050320G>A	ENST00000373233.3	-	31	5132	c.4955C>T	c.(4954-4956)tCa>tTa	p.S1652L		NM_032221.3	NP_115597.3	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	1652					ATP catabolic process (GO:0006200)|chromatin modification (GO:0016568)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|transcription cofactor binding (GO:0001221)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(24)|lung(53)|ovary(8)|prostate(5)|skin(8)|stomach(1)|urinary_tract(9)	129		Myeloproliferative disorder(115;0.00425)				AAGGGACTCTGAAGTCCTACT	0.398																																					p.S1652L													.	CHD6-238	0			c.C4955T						.						59.0	61.0	60.0					20																	40050320		2203	4300	6503	SO:0001583	missense	84181	exon31			GACTCTGAAGTCC	AF525085	CCDS13317.1	20q12	2003-03-07			ENSG00000124177	ENSG00000124177			19057	protein-coding gene	gene with protein product						11889561	Standard	NM_032221		Approved	KIAA1335, FLJ22369, dJ620E11.1, CHD5, RIGB	uc002xka.1	Q8TD26	OTTHUMG00000032487	ENST00000373233.3:c.4955C>T	20.37:g.40050320G>A	ENSP00000362330:p.Ser1652Leu	68	0		75	16	NM_032221	0	0	7	7	0	Q5JYQ0|Q5TGZ9|Q5TH00|Q5TH01|Q8IZR2|Q8WTY0|Q9H4H6|Q9H6D4|Q9NTT7|Q9P2L1	Missense_Mutation	SNP	ENST00000373233.3	37	CCDS13317.1	.	.	.	.	.	.	.	.	.	.	G	11.57	1.677648	0.29783	.	.	ENSG00000124177	ENST00000373233	T	0.70164	-0.46	6.17	4.2	0.49525	.	0.656538	0.13852	N	0.358262	T	0.48003	0.1476	L	0.27053	0.805	0.58432	D	0.999999	B	0.02656	0.0	B	0.08055	0.003	T	0.41070	-0.9529	10	0.23891	T	0.37	-2.5172	4.8034	0.13308	0.0851:0.301:0.5012:0.1128	.	1652	Q8TD26	CHD6_HUMAN	L	1652	ENSP00000362330:S1652L	ENSP00000362330:S1652L	S	-	2	0	CHD6	39483734	0.819000	0.29175	1.000000	0.80357	0.984000	0.73092	1.588000	0.36633	1.633000	0.50488	0.655000	0.94253	TCA	.		0.398	CHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079270.1		
PTPN1	5770	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	49195155	49195155	+	Missense_Mutation	SNP	T	T	G			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr20:49195155T>G	ENST00000371621.3	+	6	865	c.691T>G	c.(691-693)Tgc>Ggc	p.C231G	RP4-530I15.9_ENST00000431019.1_RNA|PTPN1_ENST00000541713.1_Missense_Mutation_p.C158G	NM_001278618.1|NM_002827.2	NP_001265547.1|NP_002818.1	P18031	PTN1_HUMAN	protein tyrosine phosphatase, non-receptor type 1	231	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				actin cytoskeleton reorganization (GO:0031532)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|endoplasmic reticulum unfolded protein response (GO:0030968)|insulin receptor signaling pathway (GO:0008286)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|peptidyl-tyrosine dephosphorylation (GO:0035335)|peptidyl-tyrosine dephosphorylation involved in inactivation of protein kinase activity (GO:1990264)|platelet activation (GO:0030168)|platelet-derived growth factor receptor-beta signaling pathway (GO:0035791)|regulation of endocytosis (GO:0030100)|regulation of hepatocyte growth factor receptor signaling pathway (GO:1902202)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of signal transduction (GO:0009966)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|sorting endosome (GO:0097443)	enzyme binding (GO:0019899)|ephrin receptor binding (GO:0046875)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|skin(2)	16		Lung NSC(126;0.163)			Tiludronate(DB01133)	GGCTGATACCTGCCTCTTGCT	0.597																																					p.C231G		.											.	PTPN1-1082	0			c.T691G						.						47.0	48.0	48.0					20																	49195155		2203	4300	6503	SO:0001583	missense	5770	exon6			GATACCTGCCTCT		CCDS13430.1, CCDS63309.1	20q13.1-q13.2	2011-06-09			ENSG00000196396	ENSG00000196396		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9642	protein-coding gene	gene with protein product		176885		PTP1B		2164224	Standard	NM_002827		Approved		uc002xvl.3	P18031	OTTHUMG00000032729	ENST00000371621.3:c.691T>G	20.37:g.49195155T>G	ENSP00000360683:p.Cys231Gly	77	0		56	18	NM_002827	0	0	0	0	0	Q5TGD8|Q9BQV9|Q9NQQ4	Missense_Mutation	SNP	ENST00000371621.3	37	CCDS13430.1	.	.	.	.	.	.	.	.	.	.	T	23.8	4.457273	0.84317	.	.	ENSG00000196396	ENST00000371621;ENST00000541713	D;D	0.83250	-1.7;-1.7	5.24	5.24	0.73138	Protein-tyrosine phosphatase, receptor/non-receptor type (3);Protein-tyrosine/Dual-specificity phosphatase (1);	0.000000	0.85682	D	0.000000	D	0.91408	0.7289	M	0.84082	2.675	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.92757	0.6221	10	0.87932	D	0	.	15.139	0.72595	0.0:0.0:0.0:1.0	.	231	P18031	PTN1_HUMAN	G	231;158	ENSP00000360683:C231G;ENSP00000437732:C158G	ENSP00000360683:C231G	C	+	1	0	PTPN1	48628562	1.000000	0.71417	0.997000	0.53966	0.975000	0.68041	7.977000	0.88081	1.979000	0.57680	0.379000	0.24179	TGC	.		0.597	PTPN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079694.2		
HRH3	11255	broad.mit.edu	37	20	60791561	60791561	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr20:60791561G>A	ENST00000340177.5	-	3	1123	c.839C>T	c.(838-840)gCg>gTg	p.A280V	HRH3_ENST00000317393.6_Missense_Mutation_p.A280V	NM_007232.2	NP_009163.2	Q9Y5N1	HRH3_HUMAN	histamine receptor H3	280			A -> V (in one Shy-Drager syndrome patient; rare variant with unknown pathological significance). {ECO:0000269|PubMed:11956964}.		brain development (GO:0007420)|drinking behavior (GO:0042756)|eating behavior (GO:0042755)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|learning (GO:0007612)|memory (GO:0007613)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of blood pressure (GO:0045776)|negative regulation of gamma-aminobutyric acid secretion (GO:0014053)|negative regulation of glutamate secretion (GO:0014050)|negative regulation of serotonin secretion (GO:0014063)|neurotransmitter secretion (GO:0007269)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of epithelial cell proliferation (GO:0050679)|regulation of norepinephrine secretion (GO:0014061)|response to organic cyclic compound (GO:0014070)	integral component of plasma membrane (GO:0005887)|myelin sheath (GO:0043209)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|histamine receptor activity (GO:0004969)			breast(1)|endometrium(1)|lung(4)|skin(2)|upper_aerodigestive_tract(1)	9	Breast(26;7.76e-09)		BRCA - Breast invasive adenocarcinoma(19;7.08e-07)		Betahistine(DB06698)|Histamine Phosphate(DB00667)|Mirtazapine(DB00370)	GCCTACGGCCGCCTCACCCAC	0.756																																					p.A280V													.	HRH3-90	0			c.C839T						.						4.0	5.0	5.0					20																	60791561		1932	3885	5817	SO:0001583	missense	11255	exon3			ACGGCCGCCTCAC	AF140538	CCDS13493.1	20q13.33	2013-09-19			ENSG00000101180	ENSG00000101180		"""GPCR / Class A : Histamine receptors"""	5184	protein-coding gene	gene with protein product		604525				10347254	Standard	NM_007232		Approved	GPCR97	uc002ycf.2	Q9Y5N1	OTTHUMG00000032899	ENST00000340177.5:c.839C>T	20.37:g.60791561G>A	ENSP00000342560:p.Ala280Val	8	0		11	7	NM_007232	0	0	0	0	0	Q4QRI7|Q9GZX2|Q9H4K8	Missense_Mutation	SNP	ENST00000340177.5	37	CCDS13493.1	.	.	.	.	.	.	.	.	.	.	G	2.089	-0.408938	0.04799	.	.	ENSG00000101180	ENST00000340177;ENST00000317393;ENST00000370797	T;T	0.67171	-0.22;-0.25	3.29	-2.86	0.05717	GPCR, rhodopsin-like superfamily (1);	0.819050	0.10671	U	0.647521	T	0.51958	0.1705	L	0.54323	1.7	0.09310	N	1	B;B	0.13594	0.007;0.008	B;B	0.10450	0.003;0.005	T	0.37126	-0.9719	10	0.28530	T	0.3	-9.5065	3.3454	0.07133	0.2806:0.0:0.4203:0.2991	.	280;280	Q9Y5N1-2;Q9Y5N1	.;HRH3_HUMAN	V	280;280;250	ENSP00000342560:A280V;ENSP00000321482:A280V	ENSP00000321482:A280V	A	-	2	0	HRH3	60224956	0.000000	0.05858	0.005000	0.12908	0.076000	0.17211	-0.457000	0.06745	-0.559000	0.06110	0.205000	0.17691	GCG	.		0.756	HRH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079994.1	NM_007232	
HELZ2	85441	ucsc.edu	37	20	62203597	62203597	+	Missense_Mutation	SNP	T	T	G	rs200635909		TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr20:62203597T>G	ENST00000467148.1	-	1	211	c.142A>C	c.(142-144)Acc>Ccc	p.T48P	HELZ2_ENST00000479540.1_5'UTR	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator	48					cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										GAGTGGCAGGTGACCAAGCAG	0.711																																					p.T48P													.	.	0			c.A142C						.						24.0	20.0	21.0					20																	62203597		2170	4284	6454	SO:0001583	missense	85441	exon2			GGCAGGTGACCAA	AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.142A>C	20.37:g.62203597T>G	ENSP00000417401:p.Thr48Pro	21	3		18	3	NM_001037335	0	0	16	18	2	Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	Missense_Mutation	SNP	ENST00000467148.1	37	CCDS33508.1	.	.	.	.	.	.	.	.	.	.	T	16.81	3.225046	0.58668	.	.	ENSG00000130589	ENST00000467148	T	0.02472	4.28	4.12	2.98	0.34508	Zinc finger, C2H2-like (1);	0.810801	0.11350	N	0.573055	T	0.13329	0.0323	M	0.73598	2.24	0.25366	N	0.988748	D;P	0.76494	0.999;0.465	D;B	0.71656	0.974;0.219	T	0.07868	-1.0750	10	0.72032	D	0.01	-14.8166	10.4392	0.44455	0.0:0.0:0.1644:0.8356	.	48;48	Q4VXQ0;Q9BYK8	.;PR285_HUMAN	P	48	ENSP00000417401:T48P	ENSP00000417401:T48P	T	-	1	0	RP4-697K14.7	61674041	1.000000	0.71417	0.997000	0.53966	0.794000	0.44872	0.845000	0.27668	0.447000	0.26695	0.533000	0.62120	ACC	.		0.711	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354127.1	NM_001037335	
DIP2A	23181	broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	47978259	47978259	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr21:47978259G>A	ENST00000417564.2	+	32	3943	c.3922G>A	c.(3922-3924)Gta>Ata	p.V1308I	DIP2A_ENST00000400274.1_Missense_Mutation_p.V1304I|DIP2A_ENST00000318711.7_Missense_Mutation_p.V1309I			Q14689	DIP2A_HUMAN	DIP2 disco-interacting protein 2 homolog A (Drosophila)	1308					multicellular organismal development (GO:0007275)|negative regulation of gene expression (GO:0010629)|regulation of apoptotic process (GO:0042981)	cell surface (GO:0009986)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(22)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(49;0.0933)			Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)		GGCCCGCGCCGTAAGCACCAC	0.657																																					p.V1308I													.	DIP2A-24	0			c.G3922A						.						14.0	19.0	17.0					21																	47978259		2050	4184	6234	SO:0001583	missense	23181	exon32			CGCGCCGTAAGCA	AF490768	CCDS46655.1, CCDS46656.1, CCDS46657.1, CCDS54490.1, CCDS54491.1	21q22.3	2010-08-20	2006-01-13	2006-01-13	ENSG00000160305	ENSG00000160305			17217	protein-coding gene	gene with protein product		607711	"""chromosome 21 open reading frame 106"""	C21orf106			Standard	NM_015151		Approved	Dip2, KIAA0184	uc002zjo.2	Q14689	OTTHUMG00000090717	ENST00000417564.2:c.3922G>A	21.37:g.47978259G>A	ENSP00000392066:p.Val1308Ile	21	0		24	7	NM_015151	0	0	8	12	4	A6P4T3|B4E0F0|E7EMA5|Q8IVA3|Q8N4S2|Q8TD89|Q96ML9	Missense_Mutation	SNP	ENST00000417564.2	37	CCDS46655.1	.	.	.	.	.	.	.	.	.	.	G	27.5	4.832722	0.91036	.	.	ENSG00000160305	ENST00000400274;ENST00000318711;ENST00000417564	T;T;T	0.38887	1.11;1.11;1.11	5.2	5.2	0.72013	AMP-dependent synthetase/ligase (1);	0.000000	0.64402	D	0.000001	T	0.56202	0.1969	L	0.52011	1.625	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.984	D;D;D	0.87578	0.998;0.993;0.938	T	0.47649	-0.9101	10	0.08599	T	0.76	-22.8966	17.7235	0.88359	0.0:0.0:1.0:0.0	.	1309;99;1308	E9PER1;Q9NSX6;Q14689	.;.;DIP2A_HUMAN	I	1304;1309;1308	ENSP00000383133:V1304I;ENSP00000323633:V1309I;ENSP00000392066:V1308I	ENSP00000323633:V1309I	V	+	1	0	DIP2A	46802687	1.000000	0.71417	0.986000	0.45419	0.838000	0.47535	9.680000	0.98651	2.430000	0.82344	0.557000	0.71058	GTA	.		0.657	DIP2A-012	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376736.1	NM_015151	
SERPIND1	3053	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	21140297	21140297	+	Missense_Mutation	SNP	G	G	A	rs368023291		TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr22:21140297G>A	ENST00000215727.5	+	4	1452	c.1169G>A	c.(1168-1170)cGa>cAa	p.R390Q	SERPIND1_ENST00000406799.1_Missense_Mutation_p.R390Q|PI4KA_ENST00000572273.1_Intron|PI4KA_ENST00000466162.1_Intron|PI4KA_ENST00000255882.6_Intron	NM_000185.3	NP_000176.2	P05546	HEP2_HUMAN	serpin peptidase inhibitor, clade D (heparin cofactor), member 1	390					blood coagulation (GO:0007596)|chemotaxis (GO:0006935)|negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|heparin binding (GO:0008201)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_cancers(11;6.16e-25)|all_epithelial(7;1.02e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)		Ardeparin(DB00407)|Sulodexide(DB06271)	TCTAGAACTCGAGAAGTGCTT	0.423																																					p.R390Q		.											.	SERPIND1-414	0			c.G1169A						.	G	GLN/ARG,	0,4406		0,0,2203	130.0	134.0	132.0		1169,	5.3	1.0	22		132	1,8599	1.2+/-3.3	0,1,4299	no	missense,intron	SERPIND1,PI4KA	NM_000185.3,NM_058004.3	43,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,	390/500,	21140297	1,13005	2203	4300	6503	SO:0001583	missense	3053	exon4			GAACTCGAGAAGT	M12849	CCDS13783.1	22q11.21	2014-02-18	2005-08-18		ENSG00000099937	ENSG00000099937		"""Serine (or cysteine) peptidase inhibitors"""	4838	protein-coding gene	gene with protein product	"""heparin cofactor II"""	142360	"""serine (or cysteine) proteinase inhibitor, clade D (heparin cofactor), member 1"""	HCF2		1671335, 24172014	Standard	XM_005261597		Approved	HC-II, HLS2, HC2, D22S673	uc002ztb.1	P05546	OTTHUMG00000150755	ENST00000215727.5:c.1169G>A	22.37:g.21140297G>A	ENSP00000215727:p.Arg390Gln	249	0		187	20	NM_000185	0	0	0	0	0	B2RAI1|D3DX34|Q6IBZ5	Missense_Mutation	SNP	ENST00000215727.5	37	CCDS13783.1	.	.	.	.	.	.	.	.	.	.	G	32	5.164332	0.94727	0.0	1.16E-4	ENSG00000099937	ENST00000215727;ENST00000406799	D;D	0.87650	-2.28;-2.28	5.28	5.28	0.74379	Serpin domain (3);	0.000000	0.85682	D	0.000000	D	0.93032	0.7782	M	0.73962	2.25	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.66979	0.948;0.948	D	0.92954	0.6383	10	0.56958	D	0.05	.	19.0957	0.93249	0.0:0.0:1.0:0.0	.	390;390	Q8IVC0;P05546	.;HEP2_HUMAN	Q	390	ENSP00000215727:R390Q;ENSP00000384050:R390Q	ENSP00000215727:R390Q	R	+	2	0	SERPIND1	19470297	1.000000	0.71417	0.988000	0.46212	0.855000	0.48748	8.835000	0.92100	2.755000	0.94549	0.655000	0.94253	CGA	.		0.423	SERPIND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319961.1	NM_000185	
SERPIND1	3053	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	21140328	21140328	+	Silent	SNP	G	G	A			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr22:21140328G>A	ENST00000215727.5	+	4	1483	c.1200G>A	c.(1198-1200)gaG>gaA	p.E400E	SERPIND1_ENST00000406799.1_Silent_p.E400E|PI4KA_ENST00000572273.1_Intron|PI4KA_ENST00000466162.1_Intron|PI4KA_ENST00000255882.6_Intron	NM_000185.3	NP_000176.2	P05546	HEP2_HUMAN	serpin peptidase inhibitor, clade D (heparin cofactor), member 1	400					blood coagulation (GO:0007596)|chemotaxis (GO:0006935)|negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|heparin binding (GO:0008201)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_cancers(11;6.16e-25)|all_epithelial(7;1.02e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)		Ardeparin(DB00407)|Sulodexide(DB06271)	TCAAGCTGGAGAAGAACTACA	0.448																																					p.E400E		.											.	SERPIND1-414	0			c.G1200A						.						171.0	164.0	166.0					22																	21140328		2203	4300	6503	SO:0001819	synonymous_variant	3053	exon4			GCTGGAGAAGAAC	M12849	CCDS13783.1	22q11.21	2014-02-18	2005-08-18		ENSG00000099937	ENSG00000099937		"""Serine (or cysteine) peptidase inhibitors"""	4838	protein-coding gene	gene with protein product	"""heparin cofactor II"""	142360	"""serine (or cysteine) proteinase inhibitor, clade D (heparin cofactor), member 1"""	HCF2		1671335, 24172014	Standard	XM_005261597		Approved	HC-II, HLS2, HC2, D22S673	uc002ztb.1	P05546	OTTHUMG00000150755	ENST00000215727.5:c.1200G>A	22.37:g.21140328G>A		254	0		199	24	NM_000185	0	0	1	2	1	B2RAI1|D3DX34|Q6IBZ5	Silent	SNP	ENST00000215727.5	37	CCDS13783.1																																																																																			.		0.448	SERPIND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319961.1	NM_000185	
SEZ6L	23544	broad.mit.edu	37	22	26702084	26702084	+	Silent	SNP	G	G	A			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr22:26702084G>A	ENST00000248933.6	+	6	1583	c.1488G>A	c.(1486-1488)gaG>gaA	p.E496E	SEZ6L_ENST00000360929.3_Silent_p.E496E|SEZ6L_ENST00000402979.1_Silent_p.E269E|SEZ6L_ENST00000343706.4_Silent_p.E496E|SEZ6L_ENST00000403121.1_Silent_p.E269E|SEZ6L_ENST00000404234.3_Silent_p.E496E|SEZ6L_ENST00000529632.2_Silent_p.E496E			Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like	496	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)				breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(35)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	80						TGCACTTTGAGAGGCTGTTGC	0.517																																					p.E496E													.	SEZ6L-95	0			c.G1488A						.						58.0	56.0	57.0					22																	26702084		2203	4300	6503	SO:0001819	synonymous_variant	23544	exon6			CTTTGAGAGGCTG	AL050253	CCDS13833.1, CCDS54508.1, CCDS54510.1, CCDS54511.1, CCDS74837.1	22q12.1	2008-05-14	2001-11-28		ENSG00000100095	ENSG00000100095			10763	protein-coding gene	gene with protein product		607021	"""seizure related gene 6 (mouse)-like"""				Standard	NM_021115		Approved		uc003acb.3	Q9BYH1	OTTHUMG00000150870	ENST00000248933.6:c.1488G>A	22.37:g.26702084G>A		84	0		81	5	NM_021115	0	0	0	0	0	A0AUW7|B0QYG4|B0QYG5|B7ZLJ6|G8JLP3|O95917|Q5THY5|Q6IBZ4|Q6UXD4|Q9NUI3|Q9NUI4|Q9NUI5|Q9Y2E1|Q9Y3J6	Silent	SNP	ENST00000248933.6	37	CCDS13833.1																																																																																			.		0.517	SEZ6L-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320359.3		
MCM5	4174	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	35806777	35806777	+	Missense_Mutation	SNP	A	A	G			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr22:35806777A>G	ENST00000216122.4	+	7	947	c.793A>G	c.(793-795)Atc>Gtc	p.I265V	MCM5_ENST00000382011.5_Missense_Mutation_p.I222V	NM_006739.3	NP_006730.2	P33992	MCM5_HUMAN	minichromosome maintenance complex component 5	265					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	29						CAGGGTTACCATCATGGGCAT	0.557																																					p.I265V		.											.	MCM5-228	0			c.A793G						.						166.0	144.0	151.0					22																	35806777		2203	4300	6503	SO:0001583	missense	4174	exon7			GTTACCATCATGG		CCDS13915.1	22q13.1-q13.2	2007-04-04	2007-04-04		ENSG00000100297	ENSG00000100297			6948	protein-coding gene	gene with protein product		602696	"""minichromosome maintenance deficient (S. cerevisiae) 5 (cell division cycle 46)"", ""MCM5 minichromosome maintenance deficient 5, cell division cycle 46 (S. cerevisiae)"""	CDC46		8751386, 10591208	Standard	NM_006739		Approved		uc003anu.4	P33992	OTTHUMG00000150961	ENST00000216122.4:c.793A>G	22.37:g.35806777A>G	ENSP00000216122:p.Ile265Val	209	0		176	54	NM_006739	0	0	24	50	26	O60785|Q14578|Q9BTJ4|Q9BWL8	Missense_Mutation	SNP	ENST00000216122.4	37	CCDS13915.1	.	.	.	.	.	.	.	.	.	.	A	7.703	0.693600	0.15039	.	.	ENSG00000100297	ENST00000216122;ENST00000382011;ENST00000444582;ENST00000444778	T;T;T	0.03413	3.94;3.94;3.94	5.32	5.32	0.75619	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);	0.046124	0.85682	D	0.000000	T	0.02727	0.0082	N	0.11789	0.175	0.58432	D	0.999999	B;B;B;B	0.11235	0.004;0.004;0.004;0.004	B;B;B;B	0.17979	0.009;0.009;0.02;0.009	T	0.48115	-0.9063	10	0.08837	T	0.75	-32.0355	15.5601	0.76237	1.0:0.0:0.0:0.0	.	265;265;222;265	B1AHB0;Q53FG5;B1AHB1;P33992	.;.;.;MCM5_HUMAN	V	265;222;174;122	ENSP00000216122:I265V;ENSP00000371441:I222V;ENSP00000408705:I122V	ENSP00000216122:I265V	I	+	1	0	MCM5	34136777	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.001000	0.57046	2.142000	0.66516	0.459000	0.35465	ATC	.		0.557	MCM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320661.3		
MYH9	4627	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	36696256	36696256	+	Missense_Mutation	SNP	C	C	G			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr22:36696256C>G	ENST00000216181.5	-	23	3123	c.2893G>C	c.(2893-2895)Gag>Cag	p.E965Q		NM_002473.4	NP_002464.1	P35579	MYH9_HUMAN	myosin, heavy chain 9, non-muscle	965					actin cytoskeleton reorganization (GO:0031532)|actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|angiogenesis (GO:0001525)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood vessel endothelial cell migration (GO:0043534)|cytokinesis (GO:0000910)|establishment of meiotic spindle localization (GO:0051295)|establishment of T cell polarity (GO:0001768)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|meiotic spindle organization (GO:0000212)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte differentiation (GO:0030224)|myoblast fusion (GO:0007520)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of cell shape (GO:0008360)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|uropod organization (GO:0032796)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|actomyosin contractile ring (GO:0005826)|cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|cleavage furrow (GO:0032154)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|spindle (GO:0005819)|stress fiber (GO:0001725)|uropod (GO:0001931)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)			NS(1)|breast(8)|central_nervous_system(3)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(16)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(3)	86						GTCACCTTCTCCAGCTGCAGC	0.632			T	ALK	ALCL		"""Deafness, autosomal dominant 17, Epstein syndrome, Fechtner syndrome, May-Hegglin anomaly, Sebastian syndrome"""		Hereditary Macrothrombocytopenia, MYH9-associated																												p.E965Q		.		Dom	yes		22	22q13.1	4627	"""myosin, heavy polypeptide 9, non-muscle"""	yes	L	.	MYH9-292	0			c.G2893C						.						76.0	71.0	73.0					22																	36696256		2203	4300	6503	SO:0001583	missense	4627	exon23	Familial Cancer Database	MYHIIA syndrome, incl. Fechtner Syndrome, FTNS, and May-Hegglin Anomaly, MHA	CCTTCTCCAGCTG		CCDS13927.1	22q13.1	2014-09-17	2006-09-29		ENSG00000100345	ENSG00000100345		"""Myosins / Myosin superfamily : Class II"""	7579	protein-coding gene	gene with protein product	"""nonmuscle myosin heavy chain II-A"""	160775	"""myosin, heavy polypeptide 9, non-muscle"""	DFNA17		1860190, 11023810	Standard	NM_002473		Approved	NMMHCA, NMHC-II-A, MHA, FTNS, EPSTS	uc003apg.3	P35579	OTTHUMG00000030429	ENST00000216181.5:c.2893G>C	22.37:g.36696256C>G	ENSP00000216181:p.Glu965Gln	131	0		113	50	NM_002473	0	0	253	445	192	A8K6E4|O60805|Q60FE2|Q86T83	Missense_Mutation	SNP	ENST00000216181.5	37	CCDS13927.1	.	.	.	.	.	.	.	.	.	.	C	35	5.458931	0.96240	.	.	ENSG00000100345	ENST00000337818;ENST00000216181	D	0.92911	-3.13	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	D	0.97517	0.9187	H	0.96889	3.9	0.80722	D	1	D	0.62365	0.991	D	0.65773	0.938	D	0.98548	1.0635	10	0.87932	D	0	.	19.3857	0.94555	0.0:1.0:0.0:0.0	.	965	P35579	MYH9_HUMAN	Q	829;965	ENSP00000216181:E965Q	ENSP00000216181:E965Q	E	-	1	0	MYH9	35026202	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.781000	0.85668	2.665000	0.90641	0.655000	0.94253	GAG	.		0.632	MYH9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000259110.3	NM_002473	
HDAC10	83933	hgsc.bcm.edu;broad.mit.edu	37	22	50687534	50687534	+	Missense_Mutation	SNP	C	C	G			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr22:50687534C>G	ENST00000216271.5	-	8	1106	c.754G>C	c.(754-756)Gag>Cag	p.E252Q	HDAC10_ENST00000498366.1_5'UTR|HDAC10_ENST00000349505.4_Missense_Mutation_p.E252Q|HDAC10_ENST00000448072.1_Missense_Mutation_p.E252Q|MAPK12_ENST00000497036.1_5'UTR	NM_001159286.1|NM_032019.5	NP_001152758.1|NP_114408.3	Q969S8	HDA10_HUMAN	histone deacetylase 10	252	Histone deacetylase.				chromatin modification (GO:0016568)|histone deacetylation (GO:0016575)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|oligodendrocyte development (GO:0014003)|protein deacetylation (GO:0006476)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein deacetylase activity (GO:0033558)			endometrium(2)|kidney(2)|lung(1)|prostate(1)|skin(1)|urinary_tract(1)	8		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		GCAGTCACCTCAAAGGCCAGT	0.642																																					p.E252Q		.											.	HDAC10-226	0			c.G754C						.						41.0	26.0	31.0					22																	50687534		2190	4291	6481	SO:0001583	missense	83933	exon8			TCACCTCAAAGGC	AF393962	CCDS14088.1, CCDS54545.1	22q13.31	2008-06-10			ENSG00000100429	ENSG00000100429			18128	protein-coding gene	gene with protein product		608544				11677242, 11726666	Standard	NM_032019		Approved	DKFZP761B039	uc003bkg.3	Q969S8	OTTHUMG00000044647	ENST00000216271.5:c.754G>C	22.37:g.50687534C>G	ENSP00000216271:p.Glu252Gln	19	1		19	9	NM_032019	0	0	1	2	1	Q08AP4|Q6STF9|Q96P77|Q96P78|Q9H028|Q9UGX1|Q9UGX2	Missense_Mutation	SNP	ENST00000216271.5	37	CCDS14088.1	.	.	.	.	.	.	.	.	.	.	C	27.6	4.847077	0.91277	.	.	ENSG00000100429	ENST00000216271;ENST00000448072;ENST00000349505	T;T;T	0.69685	-0.42;-0.23;0.57	4.54	4.54	0.55810	Histone deacetylase domain (2);	0.062472	0.64402	D	0.000005	T	0.78033	0.4220	L	0.49455	1.56	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.96	D;D;P	0.85130	0.97;0.997;0.856	T	0.80369	-0.1411	10	0.66056	D	0.02	-26.0078	17.069	0.86568	0.0:1.0:0.0:0.0	.	252;252;252	Q969S8-2;C9J8B8;Q969S8	.;.;HDA10_HUMAN	Q	252	ENSP00000216271:E252Q;ENSP00000397542:E252Q;ENSP00000343540:E252Q	ENSP00000216271:E252Q	E	-	1	0	HDAC10	49029661	1.000000	0.71417	0.997000	0.53966	0.899000	0.52679	5.208000	0.65203	2.342000	0.79632	0.561000	0.74099	GAG	.		0.642	HDAC10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104141.4	NM_032019	
SEMA3F	6405	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	50220896	50220896	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr3:50220896G>C	ENST00000002829.3	+	12	1616	c.1132G>C	c.(1132-1134)Gat>Cat	p.D378H	SEMA3F_ENST00000434342.1_Missense_Mutation_p.D347H|SEMA3F_ENST00000413852.1_Missense_Mutation_p.D279H	NM_004186.3	NP_004177.3	Q13275	SEM3F_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F	378	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branchiomotor neuron axon guidance (GO:0021785)|facial nerve structural organization (GO:0021612)|negative regulation of axon extension involved in axon guidance (GO:0048843)|nerve development (GO:0021675)|neural crest cell migration (GO:0001755)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sympathetic ganglion development (GO:0061549)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	extracellular space (GO:0005615)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|receptor activity (GO:0004872)			central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|skin(2)	17				BRCA - Breast invasive adenocarcinoma(193;0.00013)|KIRC - Kidney renal clear cell carcinoma(197;0.00599)|Kidney(197;0.00688)		CTCCATGGCTGATATTCGCAT	0.632																																					p.D378H		.											.	SEMA3F-279	0			c.G1132C						.						86.0	74.0	78.0					3																	50220896		2203	4300	6503	SO:0001583	missense	6405	exon12			ATGGCTGATATTC	U33920	CCDS2811.1	3p21.3	2013-01-11			ENSG00000001617	ENSG00000001617		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10728	protein-coding gene	gene with protein product	"""sema IV"""	601124				8786119, 8649831	Standard	NM_004186		Approved	SEMAK, Sema4	uc003cyj.3	Q13275	OTTHUMG00000156806	ENST00000002829.3:c.1132G>C	3.37:g.50220896G>C	ENSP00000002829:p.Asp378His	85	0		71	7	NM_004186	0	0	157	180	23	C9JQ85|Q13274|Q13372|Q15704|Q6GTR4	Missense_Mutation	SNP	ENST00000002829.3	37	CCDS2811.1	.	.	.	.	.	.	.	.	.	.	G	32	5.151596	0.94645	.	.	ENSG00000001617	ENST00000450338;ENST00000413852;ENST00000002829;ENST00000434342	T;T;T;T	0.27720	1.65;1.65;1.65;1.65	5.45	5.45	0.79879	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	T	0.67590	0.2909	M	0.93720	3.45	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.81914	0.995;0.981	T	0.77096	-0.2714	10	0.87932	D	0	.	18.8886	0.92389	0.0:0.0:1.0:0.0	.	347;378	C9JQ85;Q13275	.;SEM3F_HUMAN	H	347;279;378;347	ENSP00000398399:D347H;ENSP00000388931:D279H;ENSP00000002829:D378H;ENSP00000409859:D347H	ENSP00000002829:D378H	D	+	1	0	SEMA3F	50195900	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	9.651000	0.98493	2.542000	0.85734	0.511000	0.50034	GAT	.		0.632	SEMA3F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345929.1	NM_004186	
CCDC80	151887	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	112324296	112324296	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr3:112324296G>A	ENST00000206423.3	-	8	3774	c.2821C>T	c.(2821-2823)Cat>Tat	p.H941Y	CCDC80_ENST00000439685.2_Missense_Mutation_p.H941Y	NM_199511.1|NM_199512.1	NP_955805.1|NP_955806.1	Q76M96	CCD80_HUMAN	coiled-coil domain containing 80	941					extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|interstitial matrix (GO:0005614)	heparin binding (GO:0008201)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(21)|ovary(3)|pancreas(2)|prostate(4)	51						TAACTCTCATGATGACGGTAG	0.483																																					p.H941Y		.											.	CCDC80-92	0			c.C2821T						.						97.0	89.0	92.0					3																	112324296		2203	4300	6503	SO:0001583	missense	151887	exon8			TCTCATGATGACG	AY333429	CCDS2968.1	3q13.2	2010-12-24			ENSG00000091986	ENSG00000091986			30649	protein-coding gene	gene with protein product	"""steroid sensitive gene 1"""	608298				15325258, 18178152	Standard	XM_005247135		Approved	URB, SSG1, DRO1	uc003dzf.3	Q76M96	OTTHUMG00000159265	ENST00000206423.3:c.2821C>T	3.37:g.112324296G>A	ENSP00000206423:p.His941Tyr	100	0		99	27	NM_199511	0	0	0	0	0	D3DN67|Q5PR20|Q6GPG9|Q8IVT6|Q8NBV1|Q8NHY8	Missense_Mutation	SNP	ENST00000206423.3	37	CCDS2968.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.211797	0.79240	.	.	ENSG00000091986	ENST00000206423;ENST00000439685;ENST00000444594	T;T	0.52754	0.65;0.65	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	T	0.37571	0.1008	N	0.19112	0.55	0.46317	D	0.998989	B;B	0.31931	0.347;0.236	B;B	0.26416	0.069;0.031	T	0.29058	-1.0024	10	0.87932	D	0	-20.2625	20.4324	0.99085	0.0:0.0:1.0:0.0	.	952;941	Q76M96-2;Q76M96	.;CCD80_HUMAN	Y	941;941;542	ENSP00000206423:H941Y;ENSP00000411814:H941Y	ENSP00000206423:H941Y	H	-	1	0	CCDC80	113806986	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.764000	0.74960	2.833000	0.97629	0.585000	0.79938	CAT	.		0.483	CCDC80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354219.1	NM_199511	
KALRN	8997	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	124103778	124103778	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr3:124103778G>C	ENST00000240874.3	+	11	2008	c.1851G>C	c.(1849-1851)aaG>aaC	p.K617N	KALRN_ENST00000360013.3_Missense_Mutation_p.K617N|KALRN_ENST00000460856.1_Missense_Mutation_p.K617N	NM_003947.4	NP_003938.1	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase	617					apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						AGATCTACAAGGCAGCTCGAC	0.567																																					p.K617N		.											.	KALRN-738	0			c.G1851C						.						108.0	88.0	95.0					3																	124103778		2203	4300	6503	SO:0001583	missense	8997	exon11			CTACAAGGCAGCT	U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000240874.3:c.1851G>C	3.37:g.124103778G>C	ENSP00000240874:p.Lys617Asn	96	0		84	38	NM_003947	0	0	1	1	0	A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Missense_Mutation	SNP	ENST00000240874.3	37	CCDS3027.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.01|15.01	2.706440|2.706440	0.48412|0.48412	.|.	.|.	ENSG00000160145|ENSG00000160145	ENST00000460856;ENST00000240874;ENST00000360013;ENST00000439170|ENST00000354186	T;T;T;T|.	0.41758|.	0.99;0.99;0.99;0.99|.	5.0|5.0	4.09|4.09	0.47781|0.47781	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.38214|0.38214	0.1032|0.1032	N|N	0.21373|0.21373	0.66|0.66	0.80722|0.80722	D|D	1|1	P;P;P|.	0.48089|.	0.542;0.905;0.486|.	B;P;B|.	0.50314|.	0.388;0.637;0.268|.	T|T	0.15065|0.15065	-1.0450|-1.0450	10|5	0.18276|.	T|.	0.48|.	.|.	5.048|5.048	0.14494|0.14494	0.4066:0.0:0.5934:0.0|0.4066:0.0:0.5934:0.0	.|.	617;617;617|.	C9IZQ6;O60229;O60229-2|.	.;KALRN_HUMAN;.|.	N|T	617;617;617;93|595	ENSP00000418611:K617N;ENSP00000240874:K617N;ENSP00000353109:K617N;ENSP00000402950:K93N|.	ENSP00000240874:K617N|.	K|R	+|+	3|2	2|0	KALRN|KALRN	125586468|125586468	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	1.890000|1.890000	0.39728|0.39728	1.232000|1.232000	0.43678|0.43678	0.563000|0.563000	0.77884|0.77884	AAG|AGG	.		0.567	KALRN-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000258843.4	NM_003947	
KY	339855	ucsc.edu	37	3	134322978	134322978	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr3:134322978C>T	ENST00000423778.2	-	11	1490	c.1429G>A	c.(1429-1431)Gac>Aac	p.D477N	KY_ENST00000503669.1_3'UTR|KY_ENST00000508956.1_Missense_Mutation_p.D456N	NM_178554.4	NP_848649.3	Q8NBH2	KY_HUMAN	kyphoscoliosis peptidase	477					muscle organ development (GO:0007517)|neuromuscular junction development (GO:0007528)	cytoskeleton (GO:0005856)|Z disc (GO:0030018)	peptidase activity (GO:0008233)			central_nervous_system(1)|endometrium(3)|kidney(1)|lung(12)|ovary(2)|upper_aerodigestive_tract(2)	21						CAGCGCCCGTCGCTGGTGTGG	0.637																																					p.D477N													.	KY-24	0			c.G1429A						.						24.0	26.0	25.0					3																	134322978		2064	4179	6243	SO:0001583	missense	339855	exon11			GCCCGTCGCTGGT	AK090526	CCDS46920.1	3q22.1	2010-11-23			ENSG00000174611	ENSG00000174611			26576	protein-coding gene	gene with protein product		605739					Standard	NM_178554		Approved	FLJ33207	uc010hty.3	Q8NBH2	OTTHUMG00000159788	ENST00000423778.2:c.1429G>A	3.37:g.134322978C>T	ENSP00000397598:p.Asp477Asn	18	0		13	4	NM_178554	0	0	0	0	0	B7Z1S4|Q6ZT15	Missense_Mutation	SNP	ENST00000423778.2	37	CCDS46920.1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.506252	0.85282	.	.	ENSG00000174611	ENST00000508956;ENST00000423778;ENST00000310263	.	.	.	5.63	5.63	0.86233	.	0.272187	0.36101	N	0.002796	T	0.79329	0.4427	M	0.67953	2.075	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.978;0.999	T	0.80434	-0.1384	9	0.87932	D	0	-5.6797	19.6704	0.95910	0.0:1.0:0.0:0.0	.	456;477	Q8NBH2-3;Q8NBH2-4	.;.	N	456;477;477	.	ENSP00000309520:D477N	D	-	1	0	KY	135805668	0.999000	0.42202	0.876000	0.34364	0.985000	0.73830	5.677000	0.68142	2.659000	0.90383	0.561000	0.74099	GAC	.		0.637	KY-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357320.1	NM_178554	
TTC14	151613	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	180324303	180324303	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr3:180324303G>C	ENST00000296015.4	+	9	1216	c.1084G>C	c.(1084-1086)Gaa>Caa	p.E362Q	TTC14_ENST00000382584.4_Missense_Mutation_p.E362Q|TTC14_ENST00000412756.2_Missense_Mutation_p.E362Q	NM_133462.3	NP_597719.1	Q96N46	TTC14_HUMAN	tetratricopeptide repeat domain 14	362							RNA binding (GO:0003723)			endometrium(3)|kidney(5)|large_intestine(9)|lung(24)|ovary(2)|pancreas(1)|skin(1)	45	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			CAAAGCAATAGAAGATTTTGA	0.383																																					p.E362Q		.											.	TTC14-91	0			c.G1084C						.						117.0	124.0	121.0					3																	180324303		2203	4300	6503	SO:0001583	missense	151613	exon9			GCAATAGAAGATT	AB075860	CCDS3237.1, CCDS46963.1, CCDS75055.1	3q27.2	2013-01-10			ENSG00000163728	ENSG00000163728		"""Tetratricopeptide (TTC) repeat domain containing"""	24697	protein-coding gene	gene with protein product						11853319	Standard	NM_001042601		Approved	FLJ00166, KIAA1980	uc003fkk.3	Q96N46	OTTHUMG00000157859	ENST00000296015.4:c.1084G>C	3.37:g.180324303G>C	ENSP00000296015:p.Glu362Gln	111	0		214	119	NM_001042601	0	0	6	11	5	G5E9X0|Q6UWJ7|Q8TF22	Missense_Mutation	SNP	ENST00000296015.4	37	CCDS3237.1	.	.	.	.	.	.	.	.	.	.	G	17.46	3.396059	0.62177	.	.	ENSG00000163728	ENST00000296015;ENST00000412756;ENST00000382584	T;T;T	0.62232	0.04;0.04;0.04	5.93	5.93	0.95920	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.482695	0.24828	N	0.035263	T	0.64778	0.2629	L	0.42529	1.33	0.33985	D	0.648465	D;P;P	0.71674	0.998;0.787;0.912	P;B;P	0.55615	0.78;0.419;0.575	T	0.70063	-0.4975	10	0.30854	T	0.27	-20.8298	11.6377	0.51213	0.1367:0.0:0.8633:0.0	.	362;362;362	Q96N46-2;G5E9X0;Q96N46	.;.;TTC14_HUMAN	Q	362	ENSP00000296015:E362Q;ENSP00000413743:E362Q;ENSP00000372027:E362Q	ENSP00000296015:E362Q	E	+	1	0	TTC14	181806997	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.915000	0.48805	2.798000	0.96311	0.655000	0.94253	GAA	.		0.383	TTC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349786.1	NM_133462	
CCDC39	339829	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	180337752	180337752	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr3:180337752G>C	ENST00000442201.2	-	15	2124	c.2005C>G	c.(2005-2007)Caa>Gaa	p.Q669E	CCDC39_ENST00000273654.4_Intron	NM_181426.1	NP_852091.1	Q9UFE4	CCD39_HUMAN	coiled-coil domain containing 39	669					axonemal dynein complex assembly (GO:0070286)|cilium-dependent cell motility (GO:0060285)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)				NS(1)|breast(1)|endometrium(4)|large_intestine(9)|lung(22)|ovary(6)|prostate(2)	45	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			TCTTTTTCTTGAGCAGCCTAT	0.383																																					p.Q669E		.											.	CCDC39-72	0			c.C2005G						.						64.0	53.0	57.0					3																	180337752		1829	4079	5908	SO:0001583	missense	339829	exon15			TTTCTTGAGCAGC	BC047103	CCDS46964.1	3q26.33	2012-07-27			ENSG00000145075	ENSG00000145075			25244	protein-coding gene	gene with protein product		613798				21131972	Standard	NM_181426		Approved	DKFZp434A128, CILD14, FAP59	uc010hxe.3	Q9UFE4	OTTHUMG00000157857	ENST00000442201.2:c.2005C>G	3.37:g.180337752G>C	ENSP00000405708:p.Gln669Glu	22	0		55	9	NM_181426	0	0	0	0	0	B4E2H1	Missense_Mutation	SNP	ENST00000442201.2	37	CCDS46964.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.263405	0.80358	.	.	ENSG00000145075	ENST00000442201	T	0.77620	-1.11	5.25	5.25	0.73442	.	.	.	.	.	D	0.87446	0.6179	M	0.83953	2.67	0.80722	D	1	D	0.71674	0.998	D	0.66602	0.945	D	0.84150	0.0422	9	0.13108	T	0.6	.	19.205	0.93726	0.0:0.0:1.0:0.0	.	669	Q9UFE4	CCD39_HUMAN	E	669	ENSP00000405708:Q669E	ENSP00000405708:Q669E	Q	-	1	0	CCDC39	181820446	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.762000	0.91711	2.596000	0.87737	0.563000	0.77884	CAA	.		0.383	CCDC39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349783.3	XM_291028	
MB21D2	151963	broad.mit.edu	37	3	192516239	192516239	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr3:192516239G>C	ENST00000392452.2	-	2	1732	c.1412C>G	c.(1411-1413)tCt>tGt	p.S471C		NM_178496.3	NP_848591.2	Q8IYB1	M21D2_HUMAN	Mab-21 domain containing 2	471							protein complex binding (GO:0032403)			endometrium(3)|kidney(1)|large_intestine(4)|lung(17)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)	31						GATAAAGACAGAGATTGACTT	0.453																																					p.S471C													.	MB21D2-70	0			c.C1412G						.						106.0	112.0	110.0					3																	192516239		2203	4300	6503	SO:0001583	missense	151963	exon2			AAGACAGAGATTG	AK056276	CCDS3302.2	3q28-q29	2011-02-23	2011-02-23	2011-02-23	ENSG00000180611	ENSG00000180611			30438	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 59"""	C3orf59		12477932	Standard	NM_178496		Approved		uc011bsp.2	Q8IYB1	OTTHUMG00000155768	ENST00000392452.2:c.1412C>G	3.37:g.192516239G>C	ENSP00000376246:p.Ser471Cys	151	0		210	5	NM_178496	0	0	4	4	0	Q86VD8	Missense_Mutation	SNP	ENST00000392452.2	37	CCDS3302.2	.	.	.	.	.	.	.	.	.	.	G	17.93	3.508051	0.64410	.	.	ENSG00000180611	ENST00000392452	T	0.61742	0.08	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	T	0.69115	0.3075	L	0.36672	1.1	0.80722	D	1	D	0.76494	0.999	D	0.77557	0.99	T	0.71932	-0.4443	10	0.87932	D	0	-6.8519	18.2207	0.89901	0.0:0.0:1.0:0.0	.	471	Q8IYB1	M21D2_HUMAN	C	471	ENSP00000376246:S471C	ENSP00000376246:S471C	S	-	2	0	MB21D2	193998933	1.000000	0.71417	0.994000	0.49952	0.921000	0.55340	9.567000	0.98161	2.538000	0.85594	0.650000	0.86243	TCT	.		0.453	MB21D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341543.1	NM_178496	
PDE6B	5158	broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	619524	619524	+	Missense_Mutation	SNP	G	G	A	rs376908835		TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr4:619524G>A	ENST00000496514.1	+	1	130	c.109G>A	c.(109-111)Gag>Aag	p.E37K	PDE6B_ENST00000255622.6_Missense_Mutation_p.E37K			P35913	PDE6B_HUMAN	phosphodiesterase 6B, cGMP-specific, rod, beta	37					cytosolic calcium ion homeostasis (GO:0051480)|GMP metabolic process (GO:0046037)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|metal ion binding (GO:0046872)			NS(1)|breast(3)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(2)|prostate(2)|urinary_tract(1)	30					Caffeine(DB00201)	CGCGGCCTGCGAGGACGGGTG	0.647																																					p.E37K	GBM(71;463 1194 9848 25922 46834)												.	PDE6B-90	0			c.G109A						.	G	LYS/GLU,LYS/GLU	0,4406		0,0,2203	46.0	49.0	48.0		109,109	5.0	0.0	4		48	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	PDE6B	NM_000283.3,NM_001145291.1	56,56	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign	37/855,37/854	619524	1,13005	2203	4300	6503	SO:0001583	missense	5158	exon1			GCCTGCGAGGACG	BC000249	CCDS33932.1, CCDS46993.1, CCDS54703.1	4p16.3	2014-01-28	2008-07-31		ENSG00000133256	ENSG00000133256	3.1.4.17	"""Phosphodiesterases"""	8786	protein-coding gene	gene with protein product	"""congenital stationary night blindness 3, autosomal dominant"""	180072		PDEB		1313787	Standard	NM_001145292		Approved	CSNB3, rd1, RP40, CSNBAD2	uc003gap.3	P35913	OTTHUMG00000159909	ENST00000496514.1:c.109G>A	4.37:g.619524G>A	ENSP00000420295:p.Glu37Lys	76	0		62	15	NM_001145291	0	0	0	0	0	B7Z9T9|E7ETT3|Q53XN5|Q9BWH5|Q9UD49	Missense_Mutation	SNP	ENST00000496514.1	37	CCDS33932.1	.	.	.	.	.	.	.	.	.	.	G	4.307	0.056193	0.08291	0.0	1.16E-4	ENSG00000133256	ENST00000255622;ENST00000496514	T;T	0.62639	0.01;0.01	4.98	4.98	0.66077	.	0.434210	0.23720	N	0.045237	T	0.49150	0.1540	L	0.38531	1.155	0.80722	D	1	B;B	0.13145	0.007;0.005	B;B	0.08055	0.001;0.003	T	0.44574	-0.9319	10	0.06494	T	0.89	.	15.7244	0.77743	0.0:0.0:1.0:0.0	.	37;37	P35913;P35913-2	PDE6B_HUMAN;.	K	37	ENSP00000255622:E37K;ENSP00000420295:E37K	ENSP00000255622:E37K	E	+	1	0	PDE6B	609524	0.010000	0.17322	0.010000	0.14722	0.110000	0.19582	1.168000	0.31859	2.326000	0.78906	0.561000	0.74099	GAG	.		0.647	PDE6B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000358109.1	NM_000283	
FGFR3	2261	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	1806099	1806099	+	Missense_Mutation	SNP	A	A	G	rs121913485		TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr4:1806099A>G	ENST00000260795.2	+	8	1220	c.1118A>G	c.(1117-1119)tAt>tGt	p.Y373C	FGFR3_ENST00000440486.2_Missense_Mutation_p.Y373C|FGFR3_ENST00000412135.2_Intron|FGFR3_ENST00000481110.2_Missense_Mutation_p.Y373C|FGFR3_ENST00000340107.4_Missense_Mutation_p.Y375C|FGFR3_ENST00000352904.1_Intron			P22607	FGFR3_HUMAN	fibroblast growth factor receptor 3	373			Y -> C (in KERSEB and TD1; disulfide- linked dimer with constitutive kinase activation). {ECO:0000269|PubMed:10360402, ECO:0000269|PubMed:15772091, ECO:0000269|PubMed:8845844, ECO:0000269|PubMed:9207791}.		alveolar secondary septum development (GO:0061144)|axonogenesis involved in innervation (GO:0060385)|bone maturation (GO:0070977)|bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|cell-cell signaling (GO:0007267)|central nervous system myelination (GO:0022010)|chondrocyte differentiation (GO:0002062)|chondrocyte proliferation (GO:0035988)|cochlea development (GO:0090102)|digestive tract morphogenesis (GO:0048546)|endochondral bone growth (GO:0003416)|endochondral ossification (GO:0001958)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell fate commitment (GO:0072148)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor apoptotic signaling pathway (GO:1902178)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inner ear receptor cell differentiation (GO:0060113)|insulin receptor signaling pathway (GO:0008286)|JAK-STAT cascade (GO:0007259)|lens fiber cell development (GO:0070307)|lens morphogenesis in camera-type eye (GO:0002089)|MAPK cascade (GO:0000165)|morphogenesis of an epithelium (GO:0002009)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of developmental growth (GO:0048640)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitosis (GO:0045839)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|skeletal system development (GO:0001501)|somatic stem cell maintenance (GO:0035019)|substantia nigra development (GO:0021762)	cell surface (GO:0009986)|cytoplasmic side of plasma membrane (GO:0009898)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|protein tyrosine kinase activity (GO:0004713)	p.Y373C(395)		NS(1)|central_nervous_system(5)|cervix(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(40)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|pancreas(2)|prostate(9)|skin(339)|soft_tissue(4)|testis(2)|upper_aerodigestive_tract(58)|urinary_tract(2607)	3091		Breast(71;0.212)|all_epithelial(65;0.241)	all cancers(2;0.000145)|OV - Ovarian serous cystadenocarcinoma(23;0.0019)|Epithelial(3;0.00221)|GBM - Glioblastoma multiforme(2;0.234)		Palifermin(DB00039)|Pazopanib(DB06589)|Ponatinib(DB08901)	GGCAGTGTGTATGCAGGCATC	0.682	Y373C(KMS11_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	1	"""Mis, T"""	"""IGH@, ETV6"""	"""bladder, MM, T-cell lymphoma"""		"""Hypochondroplasia, Thanatophoric dysplasia"""		Saethre-Chotzen syndrome;Muenke syndrome																												p.Y375C		.		Dom	yes		4	4p16.3	2261	fibroblast growth factor receptor 3	yes	"""L, E"""	.	FGFR3-9542	395	Substitution - Missense(395)	urinary_tract(371)|skin(16)|haematopoietic_and_lymphoid_tissue(8)	c.A1124G	GRCh37	CM960657	FGFR3	M	rs121913485	.						141.0	134.0	137.0					4																	1806099		2203	4300	6503	SO:0001583	missense	2261	exon9	Familial Cancer Database	Acrocephalosyndactyly type III;Muenke Nonsyndromic Coronal Craniosynostosis, FGFR3-related Craniosynostosis	GTGTGTATGCAGG	M64347	CCDS3353.1, CCDS3354.1, CCDS54706.1	4p16.3	2013-01-11	2008-08-01		ENSG00000068078	ENSG00000068078		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3690	protein-coding gene	gene with protein product		134934	"""achondroplasia, thanatophoric dwarfism"""	ACH		1847508	Standard	NM_000142		Approved	CEK2, JTK4, CD333	uc003gdu.2	P22607	OTTHUMG00000121148	ENST00000260795.2:c.1118A>G	4.37:g.1806099A>G	ENSP00000260795:p.Tyr373Cys	304	1		201	172	NM_001163213	0	0	0	406	406	D3DVP9|D3DVQ0|Q14308|Q16294|Q16608|Q59FL9	Missense_Mutation	SNP	ENST00000260795.2	37	CCDS3353.1	.	.	.	.	.	.	.	.	.	.	a	12.61	1.990190	0.35131	.	.	ENSG00000068078	ENST00000481110;ENST00000340107;ENST00000440486;ENST00000260795	D;D;D;D	0.88201	-2.35;-2.35;-2.35;-2.35	4.68	1.93	0.25924	.	0.343855	0.31061	N	0.008340	D	0.93148	0.7818	M	0.82517	2.595	0.80722	A	1	D;D;D	0.76494	0.992;0.994;0.999	D;P;D	0.72625	0.94;0.896;0.978	D	0.94049	0.7316	9	0.72032	D	0.01	.	8.9873	0.36001	0.7079:0.0:0.0:0.2921	.	375;373;373	P22607-2;P22607;F8W9L4	.;FGFR3_HUMAN;.	C	373;375;373;373	ENSP00000420533:Y373C;ENSP00000339824:Y375C;ENSP00000414914:Y373C;ENSP00000260795:Y373C	ENSP00000260795:Y373C	Y	+	2	0	FGFR3	1775897	0.999000	0.42202	0.495000	0.27527	0.084000	0.17831	4.274000	0.58921	0.715000	0.32103	0.379000	0.24179	TAT	.		0.682	FGFR3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000241632.2	NM_000142	
FGFR3	2261	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	1807891	1807891	+	Missense_Mutation	SNP	G	G	C	rs28928868		TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr4:1807891G>C	ENST00000260795.2	+	13	2052	c.1950G>C	c.(1948-1950)aaG>aaC	p.K650N	FGFR3_ENST00000440486.2_Missense_Mutation_p.K650N|FGFR3_ENST00000412135.2_Missense_Mutation_p.K538N|FGFR3_ENST00000481110.2_Missense_Mutation_p.K651N|FGFR3_ENST00000340107.4_Missense_Mutation_p.K652N|FGFR3_ENST00000352904.1_Missense_Mutation_p.K538N			P22607	FGFR3_HUMAN	fibroblast growth factor receptor 3	650	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		K -> E (in KERSEB, TD2, TGCT and bladder cancer samples; bladder transitional cell carcinoma; somatic mutation; constitutively activated kinase with impaired internalization and degradation, resulting in prolonged FGFR3 signaling). {ECO:0000269|PubMed:10471491, ECO:0000269|PubMed:15772091, ECO:0000269|PubMed:17344846, ECO:0000269|PubMed:19855393, ECO:0000269|PubMed:7773297, ECO:0000269|PubMed:9207791}.|K -> M (in KERSEB, ACH and TD1; constitutively activated kinase with impaired internalization and degradation, resulting in prolonged FGFR3 signaling). {ECO:0000269|PubMed:10671061, ECO:0000269|PubMed:15772091, ECO:0000269|PubMed:9207791}.|K -> Q (in hypochondroplasia and bladder cancer; in hypochondroplasia the form is milder than that seen in individuals with the K-540 or M-650 mutations; constitutively activated kinase). {ECO:0000269|PubMed:11055896, ECO:0000269|PubMed:11314002}.		alveolar secondary septum development (GO:0061144)|axonogenesis involved in innervation (GO:0060385)|bone maturation (GO:0070977)|bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|cell-cell signaling (GO:0007267)|central nervous system myelination (GO:0022010)|chondrocyte differentiation (GO:0002062)|chondrocyte proliferation (GO:0035988)|cochlea development (GO:0090102)|digestive tract morphogenesis (GO:0048546)|endochondral bone growth (GO:0003416)|endochondral ossification (GO:0001958)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell fate commitment (GO:0072148)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor apoptotic signaling pathway (GO:1902178)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inner ear receptor cell differentiation (GO:0060113)|insulin receptor signaling pathway (GO:0008286)|JAK-STAT cascade (GO:0007259)|lens fiber cell development (GO:0070307)|lens morphogenesis in camera-type eye (GO:0002089)|MAPK cascade (GO:0000165)|morphogenesis of an epithelium (GO:0002009)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of developmental growth (GO:0048640)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitosis (GO:0045839)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|skeletal system development (GO:0001501)|somatic stem cell maintenance (GO:0035019)|substantia nigra development (GO:0021762)	cell surface (GO:0009986)|cytoplasmic side of plasma membrane (GO:0009898)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|protein tyrosine kinase activity (GO:0004713)			NS(1)|central_nervous_system(5)|cervix(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(40)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|pancreas(2)|prostate(9)|skin(339)|soft_tissue(4)|testis(2)|upper_aerodigestive_tract(58)|urinary_tract(2607)	3091		Breast(71;0.212)|all_epithelial(65;0.241)	all cancers(2;0.000145)|OV - Ovarian serous cystadenocarcinoma(23;0.0019)|Epithelial(3;0.00221)|GBM - Glioblastoma multiforme(2;0.234)		Palifermin(DB00039)|Pazopanib(DB06589)|Ponatinib(DB08901)	ACTACAAGAAGACGACCAACG	0.662		1	"""Mis, T"""	"""IGH@, ETV6"""	"""bladder, MM, T-cell lymphoma"""		"""Hypochondroplasia, Thanatophoric dysplasia"""		Saethre-Chotzen syndrome;Muenke syndrome																												p.K652N		.		Dom	yes		4	4p16.3	2261	fibroblast growth factor receptor 3	yes	"""L, E"""	.	FGFR3-9542	0			c.G1956C	GRCh37	CM002965|CM002966	FGFR3	M	rs28928868	.						31.0	32.0	31.0					4																	1807891		2203	4299	6502	SO:0001583	missense	2261	exon14	Familial Cancer Database	Acrocephalosyndactyly type III;Muenke Nonsyndromic Coronal Craniosynostosis, FGFR3-related Craniosynostosis	CAAGAAGACGACC	M64347	CCDS3353.1, CCDS3354.1, CCDS54706.1	4p16.3	2013-01-11	2008-08-01		ENSG00000068078	ENSG00000068078		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3690	protein-coding gene	gene with protein product		134934	"""achondroplasia, thanatophoric dwarfism"""	ACH		1847508	Standard	NM_000142		Approved	CEK2, JTK4, CD333	uc003gdu.2	P22607	OTTHUMG00000121148	ENST00000260795.2:c.1950G>C	4.37:g.1807891G>C	ENSP00000260795:p.Lys650Asn	50	1		18	16	NM_001163213	0	0	0	0	0	D3DVP9|D3DVQ0|Q14308|Q16294|Q16608|Q59FL9	Missense_Mutation	SNP	ENST00000260795.2	37	CCDS3353.1	.	.	.	.	.	.	.	.	.	.	g	13.74	2.328521	0.41197	.	.	ENSG00000068078	ENST00000481110;ENST00000340107;ENST00000440486;ENST00000412135;ENST00000260795;ENST00000352904	D;D;D;D;D;D	0.83506	-1.73;-1.73;-1.73;-1.73;-1.73;-1.73	4.35	3.48	0.39840	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.86100	0.5852	L	0.53671	1.685	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.97110	1.0;0.98;1.0;1.0	D	0.85665	0.1291	10	0.87932	D	0	.	5.6966	0.17859	0.3256:0.0:0.6744:0.0	.	652;538;650;651	P22607-2;P22607-3;P22607;F8W9L4	.;.;FGFR3_HUMAN;.	N	651;652;650;538;650;538	ENSP00000420533:K651N;ENSP00000339824:K652N;ENSP00000414914:K650N;ENSP00000412903:K538N;ENSP00000260795:K650N;ENSP00000231803:K538N	ENSP00000260795:K650N	K	+	3	2	FGFR3	1777689	1.000000	0.71417	1.000000	0.80357	0.396000	0.30629	2.106000	0.41835	2.127000	0.65507	0.448000	0.29417	AAG	G|1.000		0.662	FGFR3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000241632.2	NM_000142	
FGFR3	2261	broad.mit.edu;bcgsc.ca	37	4	1808562	1808562	+	Missense_Mutation	SNP	G	G	A	rs377402598		TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr4:1808562G>A	ENST00000260795.2	+	16	2277	c.2175G>A	c.(2173-2175)atG>atA	p.M725I	FGFR3_ENST00000440486.2_Missense_Mutation_p.M725I|FGFR3_ENST00000412135.2_Missense_Mutation_p.M613I|FGFR3_ENST00000481110.2_Missense_Mutation_p.D703N|FGFR3_ENST00000340107.4_Missense_Mutation_p.M727I|FGFR3_ENST00000352904.1_Missense_Mutation_p.M613I			P22607	FGFR3_HUMAN	fibroblast growth factor receptor 3	725	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				alveolar secondary septum development (GO:0061144)|axonogenesis involved in innervation (GO:0060385)|bone maturation (GO:0070977)|bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|cell-cell signaling (GO:0007267)|central nervous system myelination (GO:0022010)|chondrocyte differentiation (GO:0002062)|chondrocyte proliferation (GO:0035988)|cochlea development (GO:0090102)|digestive tract morphogenesis (GO:0048546)|endochondral bone growth (GO:0003416)|endochondral ossification (GO:0001958)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell fate commitment (GO:0072148)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor apoptotic signaling pathway (GO:1902178)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inner ear receptor cell differentiation (GO:0060113)|insulin receptor signaling pathway (GO:0008286)|JAK-STAT cascade (GO:0007259)|lens fiber cell development (GO:0070307)|lens morphogenesis in camera-type eye (GO:0002089)|MAPK cascade (GO:0000165)|morphogenesis of an epithelium (GO:0002009)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of developmental growth (GO:0048640)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitosis (GO:0045839)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|skeletal system development (GO:0001501)|somatic stem cell maintenance (GO:0035019)|substantia nigra development (GO:0021762)	cell surface (GO:0009986)|cytoplasmic side of plasma membrane (GO:0009898)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|protein tyrosine kinase activity (GO:0004713)			NS(1)|central_nervous_system(5)|cervix(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(40)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|pancreas(2)|prostate(9)|skin(339)|soft_tissue(4)|testis(2)|upper_aerodigestive_tract(58)|urinary_tract(2607)	3091		Breast(71;0.212)|all_epithelial(65;0.241)	all cancers(2;0.000145)|OV - Ovarian serous cystadenocarcinoma(23;0.0019)|Epithelial(3;0.00221)|GBM - Glioblastoma multiforme(2;0.234)		Palifermin(DB00039)|Pazopanib(DB06589)|Ponatinib(DB08901)	GCAGGTACATGATCATGCGGG	0.687		1	"""Mis, T"""	"""IGH@, ETV6"""	"""bladder, MM, T-cell lymphoma"""		"""Hypochondroplasia, Thanatophoric dysplasia"""		Saethre-Chotzen syndrome;Muenke syndrome																												p.M727I				Dom	yes		4	4p16.3	2261	fibroblast growth factor receptor 3	yes	"""L, E"""	.	FGFR3-9542	0			c.G2181A						.	G	ILE/MET,ILE/MET,ILE/MET	1,4395		0,1,2197	23.0	25.0	24.0		2175,2181,1839	3.9	1.0	4		24	0,8598		0,0,4299	no	missense,missense,missense	FGFR3	NM_000142.4,NM_001163213.1,NM_022965.3	10,10,10	0,1,6496	AA,AG,GG		0.0,0.0227,0.0077	benign,benign,benign	725/807,727/809,613/695	1808562	1,12993	2198	4299	6497	SO:0001583	missense	2261	exon17	Familial Cancer Database	Acrocephalosyndactyly type III;Muenke Nonsyndromic Coronal Craniosynostosis, FGFR3-related Craniosynostosis	GTACATGATCATG	M64347	CCDS3353.1, CCDS3354.1, CCDS54706.1	4p16.3	2013-01-11	2008-08-01		ENSG00000068078	ENSG00000068078		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3690	protein-coding gene	gene with protein product		134934	"""achondroplasia, thanatophoric dwarfism"""	ACH		1847508	Standard	NM_000142		Approved	CEK2, JTK4, CD333	uc003gdu.2	P22607	OTTHUMG00000121148	ENST00000260795.2:c.2175G>A	4.37:g.1808562G>A	ENSP00000260795:p.Met725Ile	22	0		13	10	NM_001163213	0	0	0	1	1	D3DVP9|D3DVQ0|Q14308|Q16294|Q16608|Q59FL9	Missense_Mutation	SNP	ENST00000260795.2	37	CCDS3353.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	20.8|20.8	4.049321|4.049321	0.75846|0.75846	2.27E-4|2.27E-4	0.0|0.0	ENSG00000068078|ENSG00000068078	ENST00000481110|ENST00000340107;ENST00000440486;ENST00000412135;ENST00000260795;ENST00000352904	T|D;D;D;D;D	0.80738|0.91180	-1.41|-2.8;-2.8;-2.8;-2.8;-2.8	4.88|4.88	3.88|3.88	0.44766|0.44766	.|Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.213818|.	0.46758|.	D|.	0.000263|.	D|D	0.83381|0.83381	0.5242|0.5242	N|N	0.20685|0.20685	0.6|0.6	0.80722|0.80722	D|D	1|1	B|B;P;B	0.25007|0.42409	0.116|0.015;0.779;0.354	B|B;B;B	0.24155|0.40165	0.051|0.047;0.313;0.321	T|T	0.83259|0.83259	-0.0049|-0.0049	10|9	0.87932|0.72032	D|D	0|0.01	.|.	11.1768|11.1768	0.48603|0.48603	0.1118:0.0:0.8882:0.0|0.1118:0.0:0.8882:0.0	.|.	703|727;613;725	F8W9L4|P22607-2;P22607-3;P22607	.|.;.;FGFR3_HUMAN	N|I	703|727;725;613;725;613	ENSP00000420533:D703N|ENSP00000339824:M727I;ENSP00000414914:M725I;ENSP00000412903:M613I;ENSP00000260795:M725I;ENSP00000231803:M613I	ENSP00000420533:D703N|ENSP00000260795:M725I	D|M	+|+	1|3	0|0	FGFR3|FGFR3	1778360|1778360	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.964000|0.964000	0.63967|0.63967	6.445000|6.445000	0.73456|0.73456	0.925000|0.925000	0.37094|0.37094	0.561000|0.561000	0.74099|0.74099	GAT|ATG	.		0.687	FGFR3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000241632.2	NM_000142	
JAKMIP1	152789	broad.mit.edu;ucsc.edu	37	4	6052355	6052355	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr4:6052355C>T	ENST00000409021.3	-	14	2307	c.1858G>A	c.(1858-1860)Gag>Aag	p.E620K	JAKMIP1_ENST00000409371.3_Missense_Mutation_p.E435K	NM_001099433.1	NP_001092903.1	Q96N16	JKIP1_HUMAN	janus kinase and microtubule interacting protein 1	0	Mediates interaction with TYK2 and GABBR1.				cognition (GO:0050890)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|microtubule (GO:0005874)|ribonucleoprotein complex (GO:0030529)	GABA receptor binding (GO:0050811)|RNA binding (GO:0003723)			NS(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						CTGTGGTTCTCGGGGAAGGTG	0.542																																					p.E620K													.	JAKMIP1-292	0			c.G1858A						.						91.0	99.0	96.0					4																	6052355		2026	4154	6180	SO:0001583	missense	152789	exon14			GGTTCTCGGGGAA	AK056126	CCDS3385.1, CCDS47005.1	4p16.1	2013-10-11	2009-08-13		ENSG00000152969	ENSG00000152969			26460	protein-coding gene	gene with protein product		611195				18941173	Standard	NM_144720		Approved	MARLIN1, JAMIP1, Gababrbp, FLJ31564	uc010idb.1	Q96N16	OTTHUMG00000125491	ENST00000409021.3:c.1858G>A	4.37:g.6052355C>T	ENSP00000386711:p.Glu620Lys	12	0		11	7	NM_001099433	0	0	0	0	0	A6H2J2|A6H2J3|A6H2J4|A6H2J5|A8MTK6|B4DHZ8|B8ZZR7|D3DVT0|Q86Y69|Q8N7G3	Missense_Mutation	SNP	ENST00000409021.3	37	CCDS47005.1	.	.	.	.	.	.	.	.	.	.	C	18.32	3.598874	0.66332	.	.	ENSG00000152969	ENST00000409021;ENST00000409371	T;T	0.36157	1.7;1.27	5.1	5.1	0.69264	.	.	.	.	.	T	0.27731	0.0682	.	.	.	0.80722	D	1	P;D	0.56287	0.899;0.975	B;B	0.38225	0.268;0.206	T	0.04976	-1.0914	8	0.35671	T	0.21	.	13.3054	0.60349	0.0:0.8416:0.1584:0.0	.	435;620	Q96N16-5;Q96N16-2	.;.	K	620;435	ENSP00000386711:E620K;ENSP00000387042:E435K	ENSP00000386711:E620K	E	-	1	0	JAKMIP1	6103256	1.000000	0.71417	0.998000	0.56505	0.876000	0.50452	6.374000	0.73132	2.375000	0.81037	0.555000	0.69702	GAG	.		0.542	JAKMIP1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000329747.1	NM_144720	
PPARGC1A	10891	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	23830149	23830149	+	Missense_Mutation	SNP	G	G	T			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr4:23830149G>T	ENST00000264867.2	-	5	750	c.631C>A	c.(631-633)Ctc>Atc	p.L211I	PPARGC1A_ENST00000509702.1_5'UTR	NM_013261.3	NP_037393.1	Q9UBK2	PRGC1_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator 1 alpha	211					androgen metabolic process (GO:0008209)|androgen receptor signaling pathway (GO:0030521)|brown fat cell differentiation (GO:0050873)|cellular glucose homeostasis (GO:0001678)|cellular respiration (GO:0045333)|cellular response to fatty acid (GO:0071398)|cellular response to hypoxia (GO:0071456)|cellular response to nitrite (GO:0071250)|cellular response to oxidative stress (GO:0034599)|cellular response to thyroid hormone stimulus (GO:0097067)|cellular response to tumor necrosis factor (GO:0071356)|circadian regulation of gene expression (GO:0032922)|digestion (GO:0007586)|fatty acid oxidation (GO:0019395)|flavone metabolic process (GO:0051552)|galactose metabolic process (GO:0006012)|gluconeogenesis (GO:0006094)|mitochondrion organization (GO:0007005)|mRNA processing (GO:0006397)|negative regulation of glycolytic process (GO:0045820)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron death (GO:1901215)|negative regulation of receptor activity (GO:2000272)|positive regulation of ATP biosynthetic process (GO:2001171)|positive regulation of cellular respiration (GO:1901857)|positive regulation of energy homeostasis (GO:2000507)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of histone acetylation (GO:0035066)|positive regulation of mitochondrial DNA metabolic process (GO:1901860)|positive regulation of mitochondrion organization (GO:0010822)|positive regulation of muscle tissue development (GO:1901863)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein stabilization (GO:0050821)|regulation of circadian rhythm (GO:0042752)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of transcription, DNA-templated (GO:0006355)|respiratory electron transport chain (GO:0022904)|response to cold (GO:0009409)|response to epinephrine (GO:0071871)|response to leucine (GO:0043201)|response to muscle activity (GO:0014850)|response to norepinephrine (GO:0071873)|response to starvation (GO:0042594)|response to statin (GO:0036273)|RNA splicing (GO:0008380)|temperature homeostasis (GO:0001659)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytosol (GO:0005829)|DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|liver(1)|lung(24)|ovary(3)|skin(5)	51		Breast(46;0.0503)				AGATATTTGAGAAGCTCCGAG	0.443																																					p.L211I	Esophageal Squamous(29;694 744 13796 34866 44181)	.											.	PPARGC1A-230	0			c.C631A						.						373.0	340.0	351.0					4																	23830149		2203	4300	6503	SO:0001583	missense	10891	exon5			ATTTGAGAAGCTC	AF106698	CCDS3429.1	4p15.1	2013-02-12	2006-10-17	2004-02-04	ENSG00000109819	ENSG00000109819		"""RNA binding motif (RRM) containing"""	9237	protein-coding gene	gene with protein product		604517	"""peroxisome proliferative activated receptor, gamma, coactivator 1"", ""peroxisome proliferative activated receptor, gamma, coactivator 1, alpha"""	PPARGC1		10585775	Standard	NM_013261		Approved	PGC1, PGC1A	uc003gqs.3	Q9UBK2	OTTHUMG00000097747	ENST00000264867.2:c.631C>A	4.37:g.23830149G>T	ENSP00000264867:p.Leu211Ile	210	1		198	70	NM_013261	0	0	0	0	0	B7Z406|G8DM16|I3RTT5|I3RTT6|I3RTT7|I3RTT8|I3RTT9|Q3LIG1|Q4W5M7|Q9UN32	Missense_Mutation	SNP	ENST00000264867.2	37	CCDS3429.1	.	.	.	.	.	.	.	.	.	.	G	16.75	3.209026	0.58343	.	.	ENSG00000109819	ENST00000264867	T	0.27104	1.69	6.17	5.33	0.75918	.	0.000000	0.85682	D	0.000000	T	0.52789	0.1756	M	0.79475	2.455	0.80722	D	1	D	0.69078	0.997	D	0.72625	0.978	T	0.58487	-0.7628	10	0.66056	D	0.02	-1.9376	15.7894	0.78343	0.065:0.0:0.935:0.0	.	211	Q9UBK2	PRGC1_HUMAN	I	211	ENSP00000264867:L211I	ENSP00000264867:L211I	L	-	1	0	PPARGC1A	23439247	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.637000	0.91014	1.626000	0.50381	0.655000	0.94253	CTC	.		0.443	PPARGC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214976.1	NM_013261	
HOPX	84525	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	4	57514941	57514941	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr4:57514941G>A	ENST00000337881.7	-	3	823	c.167C>T	c.(166-168)gCa>gTa	p.A56V	HOPX_ENST00000556614.2_Missense_Mutation_p.A56V|HOPX_ENST00000420433.1_Missense_Mutation_p.A74V|HOPX_ENST00000381260.3_3'UTR|HOPX_ENST00000508121.1_Missense_Mutation_p.A74V|HOPX_ENST00000381255.3_Missense_Mutation_p.A56V|HOPX_ENST00000556376.2_Missense_Mutation_p.A56V|HOPX_ENST00000555760.2_Missense_Mutation_p.A56V|HOPX_ENST00000503639.3_Missense_Mutation_p.A56V|HOPX_ENST00000553379.2_Missense_Mutation_p.A56V|HOPX_ENST00000554144.1_3'UTR|HOPX_ENST00000317745.7_Missense_Mutation_p.A56V	NM_139212.3	NP_631958.1	Q9BPY8	HOP_HUMAN	HOP homeobox	56					heart development (GO:0007507)|histone deacetylation (GO:0016575)|lung alveolus development (GO:0048286)|negative regulation of cell differentiation (GO:0045596)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of skeletal muscle tissue regeneration (GO:0043415)|positive regulation of striated muscle cell differentiation (GO:0051155)|regulation of heart contraction (GO:0008016)|regulation of protein binding (GO:0043393)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	nucleus (GO:0005634)	DNA binding (GO:0003677)			large_intestine(2)|lung(5)|skin(1)	8	Glioma(25;0.08)|all_neural(26;0.101)					CCGCCACTTTGCCAGGCGCTG	0.478																																					p.A74V		.											.	HOPX-22	0			c.C221T						.						78.0	77.0	77.0					4																	57514941		2203	4300	6503	SO:0001583	missense	84525	exon4			CACTTTGCCAGGC		CCDS3507.1, CCDS47062.1, CCDS54767.1	4q12	2011-06-20			ENSG00000171476	ENSG00000171476		"""Homeoboxes / PRD class"""	24961	protein-coding gene	gene with protein product	"""homeobox only domain"""	607275				12297045	Standard	NM_032495		Approved	LAGY, HOP, OB1, NECC1, SMAP31	uc003hbz.2	Q9BPY8	OTTHUMG00000128768	ENST00000337881.7:c.167C>T	4.37:g.57514941G>A	ENSP00000337330:p.Ala56Val	172	0		145	61	NM_032495	0	0	178	321	143	A8K0Z2|E9PB55|G3V294|Q8N0V6|Q96CI1	Missense_Mutation	SNP	ENST00000337881.7	37	CCDS3507.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.103343	0.76983	.	.	ENSG00000171476	ENST00000420433;ENST00000508121;ENST00000556376;ENST00000553379;ENST00000381255;ENST00000317745;ENST00000503639;ENST00000337881;ENST00000555760;ENST00000556614;ENST00000514890;ENST00000506661	D;D;D;D;D;D;D;D;D;D	0.97161	-4.27;-4.27;-4.27;-4.27;-4.27;-4.27;-4.27;-4.27;-4.27;-4.27	5.93	5.93	0.95920	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	.	.	.	.	D	0.98298	0.9436	.	.	.	0.80722	D	1	D;D	0.76494	0.999;0.995	D;D	0.69824	0.966;0.927	D	0.98808	1.0742	8	0.87932	D	0	.	15.8335	0.78778	0.0:0.0:1.0:0.0	.	74;56	E9PB55;Q9BPY8	.;HOP_HUMAN	V	74;74;56;56;56;56;56;56;56;56;56;56	ENSP00000396275:A74V;ENSP00000422175:A74V;ENSP00000451794:A56V;ENSP00000452340:A56V;ENSP00000370654:A56V;ENSP00000315198:A56V;ENSP00000424101:A56V;ENSP00000337330:A56V;ENSP00000452098:A56V;ENSP00000452003:A56V	ENSP00000315198:A56V	A	-	2	0	HOPX	57209698	1.000000	0.71417	0.996000	0.52242	0.528000	0.34623	5.302000	0.65733	2.818000	0.97014	0.591000	0.81541	GCA	.		0.478	HOPX-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250689.4		
PLK4	10733	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	128813651	128813651	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr4:128813651G>C	ENST00000270861.5	+	10	2444	c.2170G>C	c.(2170-2172)Gag>Cag	p.E724Q	PLK4_ENST00000514379.1_Missense_Mutation_p.E683Q|PLK4_ENST00000513090.1_Missense_Mutation_p.E692Q|PLK4_ENST00000515069.1_Missense_Mutation_p.E646Q|PLK4_ENST00000507249.1_Missense_Mutation_p.E663Q|RNU6-583P_ENST00000516012.1_RNA	NM_014264.4	NP_055079.3	O00444	PLK4_HUMAN	polo-like kinase 4	724					centriole replication (GO:0007099)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of centriole replication (GO:0046601)|protein phosphorylation (GO:0006468)|trophoblast giant cell differentiation (GO:0060707)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)	31						TGCTGATTTTGAGGTTTGGTT	0.318																																					p.E724Q	Colon(135;508 1718 19061 31832 42879)	.											.	PLK4-333	0			c.G2170C						.						145.0	132.0	137.0					4																	128813651		2202	4300	6502	SO:0001583	missense	10733	exon10			GATTTTGAGGTTT	Y13115	CCDS3735.1, CCDS54803.1, CCDS54804.1	4q27-q28	2013-01-18	2010-06-24	2004-01-28	ENSG00000142731	ENSG00000142731			11397	protein-coding gene	gene with protein product		605031	"""serine/threonine kinase 18"", ""polo-like kinase 4 (Drosophila)"""	STK18			Standard	NM_014264		Approved	Sak	uc003ifo.3	O00444	OTTHUMG00000133301	ENST00000270861.5:c.2170G>C	4.37:g.128813651G>C	ENSP00000270861:p.Glu724Gln	94	0		53	7	NM_014264	0	0	2	4	2	B2RAL0|B7Z837|B7Z8G7|Q8IYF0|Q96Q95|Q9UD84|Q9UDE2	Missense_Mutation	SNP	ENST00000270861.5	37	CCDS3735.1	.	.	.	.	.	.	.	.	.	.	G	24.7	4.561758	0.86335	.	.	ENSG00000142731	ENST00000270861;ENST00000515069;ENST00000513090;ENST00000507249;ENST00000514379	T;T;T;T;T	0.37058	1.22;1.22;1.22;1.22;1.22	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.66723	0.2818	M	0.86178	2.8	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.72239	-0.4351	10	0.87932	D	0	-7.7549	19.2043	0.93723	0.0:0.0:1.0:0.0	.	692;724	O00444-2;O00444	.;PLK4_HUMAN	Q	724;646;692;663;683	ENSP00000270861:E724Q;ENSP00000421774:E646Q;ENSP00000427554:E692Q;ENSP00000423412:E663Q;ENSP00000423582:E683Q	ENSP00000270861:E724Q	E	+	1	0	PLK4	129033101	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	9.502000	0.97981	2.536000	0.85505	0.313000	0.20887	GAG	.		0.318	PLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257095.3		
MAP3K1	4214	ucsc.edu	37	5	56155606	56155606	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr5:56155606C>T	ENST00000399503.3	+	3	698	c.698C>T	c.(697-699)cCa>cTa	p.P233L	AC008937.2_ENST00000415589.1_RNA|snoU13_ENST00000459264.1_RNA	NM_005921.1	NP_005912.1	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase	233					activation of MAPKK activity (GO:0000186)|apoptotic mitochondrial changes (GO:0008637)|cellular response to mechanical stimulus (GO:0071260)|epithelial cell morphogenesis (GO:0003382)|eyelid development in camera-type eye (GO:0061029)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of actin filament polymerization (GO:0030838)|protein phosphorylation (GO:0006468)|regulation of cell migration (GO:0030334)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	cytosol (GO:0005829)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)			NS(1)|breast(19)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(11)|ovary(1)|skin(3)|urinary_tract(1)	57		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		GCTGAGTCTCCAGGAGAGGTC	0.463																																					p.P233L													.	MAP3K1-956	0			c.C698T						.						43.0	43.0	43.0					5																	56155606		1915	4137	6052	SO:0001583	missense	4214	exon3			AGTCTCCAGGAGA	U29671, AF042838	CCDS43318.1	5q11.2	2012-02-23	2012-02-23		ENSG00000095015	ENSG00000095015		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6848	protein-coding gene	gene with protein product		600982	"""mitogen-activated protein kinase kinase kinase 1"""	MEKK1		8597633	Standard	NM_005921		Approved	MEKK, MAPKKK1	uc003jqw.4	Q13233	OTTHUMG00000059486	ENST00000399503.3:c.698C>T	5.37:g.56155606C>T	ENSP00000382423:p.Pro233Leu	37	0		35	4	NM_005921	0	0	10	10	0		Missense_Mutation	SNP	ENST00000399503.3	37	CCDS43318.1	.	.	.	.	.	.	.	.	.	.	C	8.286	0.816620	0.16607	.	.	ENSG00000095015	ENST00000399503	T	0.66099	-0.19	5.72	-1.09	0.09904	.	0.679571	0.15209	N	0.274585	T	0.38374	0.1038	N	0.08118	0	0.18873	N	0.999986	B	0.02656	0.0	B	0.01281	0.0	T	0.18209	-1.0344	10	0.35671	T	0.21	.	12.3505	0.55144	0.2871:0.6121:0.0:0.1008	.	233	Q13233	M3K1_HUMAN	L	233	ENSP00000382423:P233L	ENSP00000382423:P233L	P	+	2	0	MAP3K1	56191363	0.348000	0.24861	0.010000	0.14722	0.155000	0.21991	0.666000	0.25097	-0.319000	0.08652	-0.150000	0.13652	CCA	.		0.463	MAP3K1-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000132309.2	XM_042066	
MAP1B	4131	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	71495628	71495628	+	Nonsense_Mutation	SNP	C	C	G			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr5:71495628C>G	ENST00000296755.7	+	5	6744	c.6446C>G	c.(6445-6447)tCa>tGa	p.S2149*		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	2149					axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		CCTCCCACCTCAGTCAGCGAG	0.587																																					p.S2149X	Melanoma(17;367 822 11631 31730 47712)	.											.	MAP1B-155	0			c.C6446G						.						90.0	81.0	84.0					5																	71495628		2203	4300	6503	SO:0001587	stop_gained	4131	exon5			CCACCTCAGTCAG	L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.6446C>G	5.37:g.71495628C>G	ENSP00000296755:p.Ser2149*	141	1		73	8	NM_005909	0	0	3	3	0	A2BDK5	Nonsense_Mutation	SNP	ENST00000296755.7	37	CCDS4012.1	.	.	.	.	.	.	.	.	.	.	C	48	14.809369	0.99811	.	.	ENSG00000131711	ENST00000296755	.	.	.	5.82	5.82	0.92795	.	0.000000	0.52532	D	0.000072	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-12.7908	20.0953	0.97838	0.0:1.0:0.0:0.0	.	.	.	.	X	2149	.	ENSP00000296755:S2149X	S	+	2	0	MAP1B	71531384	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.818000	0.86416	2.767000	0.95098	0.655000	0.94253	TCA	.		0.587	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218561.6	NM_005909	
CMYA5	202333	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	79027353	79027353	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr5:79027353C>T	ENST00000446378.2	+	2	2796	c.2765C>T	c.(2764-2766)tCt>tTt	p.S922F		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	922					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		GTCCATAGATCTCTAAATCTA	0.413																																					p.S922F		.											.	CMYA5-77	0			c.C2765T						.						103.0	100.0	101.0					5																	79027353		1924	4135	6059	SO:0001583	missense	202333	exon2			ATAGATCTCTAAA	AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.2765C>T	5.37:g.79027353C>T	ENSP00000394770:p.Ser922Phe	114	0		94	51	NM_153610	0	0	4	15	11	A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Missense_Mutation	SNP	ENST00000446378.2	37	CCDS47238.1	.	.	.	.	.	.	.	.	.	.	C	7.587	0.669858	0.14776	.	.	ENSG00000164309	ENST00000446378	T	0.59502	0.26	5.54	2.7	0.31948	.	1.759930	0.02782	N	0.121104	T	0.67239	0.2872	M	0.78456	2.415	0.09310	N	1	D	0.56035	0.974	P	0.49752	0.621	T	0.40813	-0.9543	10	0.72032	D	0.01	.	4.9024	0.13781	0.178:0.5938:0.0:0.2282	.	922	Q8N3K9	CMYA5_HUMAN	F	922	ENSP00000394770:S922F	ENSP00000394770:S922F	S	+	2	0	CMYA5	79063109	0.035000	0.19736	0.003000	0.11579	0.048000	0.14542	0.437000	0.21543	0.358000	0.24211	-0.302000	0.09304	TCT	.		0.413	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369497.1	NM_153610	
CMYA5	202333	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	79030983	79030983	+	Missense_Mutation	SNP	G	G	C	rs79193094	byFrequency	TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr5:79030983G>C	ENST00000446378.2	+	2	6426	c.6395G>C	c.(6394-6396)aGa>aCa	p.R2132T		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	2132					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		CCCACACAAAGAAAACCCATC	0.448																																					p.R2132T		.											.	CMYA5-77	0			c.G6395C						.						84.0	81.0	82.0					5																	79030983		1882	4113	5995	SO:0001583	missense	202333	exon2			CACAAAGAAAACC	AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.6395G>C	5.37:g.79030983G>C	ENSP00000394770:p.Arg2132Thr	122	1		84	38	NM_153610	0	0	9	24	15	A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Missense_Mutation	SNP	ENST00000446378.2	37	CCDS47238.1	.	.	.	.	.	.	.	.	.	.	G	6.577	0.474842	0.12521	.	.	ENSG00000164309	ENST00000446378	T	0.04015	3.73	5.96	1.21	0.21127	.	1.390360	0.04325	N	0.351334	T	0.02047	0.0064	N	0.03608	-0.345	0.09310	N	1	B	0.14805	0.011	B	0.11329	0.006	T	0.44877	-0.9299	10	0.13108	T	0.6	.	0.325	0.00309	0.2677:0.1408:0.3029:0.2886	.	2132	Q8N3K9	CMYA5_HUMAN	T	2132	ENSP00000394770:R2132T	ENSP00000394770:R2132T	R	+	2	0	CMYA5	79066739	0.001000	0.12720	0.000000	0.03702	0.005000	0.04900	0.548000	0.23314	0.297000	0.22615	0.650000	0.86243	AGA	G|0.999;A|0.001		0.448	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369497.1	NM_153610	
CMYA5	202333	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	79031337	79031337	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr5:79031337G>A	ENST00000446378.2	+	2	6780	c.6749G>A	c.(6748-6750)aGa>aAa	p.R2250K		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	2250					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		GATGAACCCAGAGGTACTTTA	0.343																																					p.R2250K		.											.	CMYA5-77	0			c.G6749A						.						84.0	86.0	85.0					5																	79031337		1802	4075	5877	SO:0001583	missense	202333	exon2			AACCCAGAGGTAC	AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.6749G>A	5.37:g.79031337G>A	ENSP00000394770:p.Arg2250Lys	176	0		140	75	NM_153610	0	0	11	24	13	A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Missense_Mutation	SNP	ENST00000446378.2	37	CCDS47238.1	.	.	.	.	.	.	.	.	.	.	G	4.593	0.110236	0.08780	.	.	ENSG00000164309	ENST00000446378	T	0.15718	2.4	5.74	-0.131	0.13494	.	1.286200	0.05079	N	0.483194	T	0.15046	0.0363	L	0.48362	1.52	0.09310	N	1	B	0.14805	0.011	B	0.10450	0.005	T	0.33599	-0.9862	10	0.33940	T	0.23	.	4.6556	0.12615	0.2976:0.3196:0.3827:0.0	.	2250	Q8N3K9	CMYA5_HUMAN	K	2250	ENSP00000394770:R2250K	ENSP00000394770:R2250K	R	+	2	0	CMYA5	79067093	0.000000	0.05858	0.001000	0.08648	0.014000	0.08584	-0.363000	0.07593	0.328000	0.23435	0.650000	0.86243	AGA	.		0.343	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369497.1	NM_153610	
CMYA5	202333	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	79031882	79031882	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr5:79031882G>C	ENST00000446378.2	+	2	7325	c.7294G>C	c.(7294-7296)Gaa>Caa	p.E2432Q		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	2432					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		ACTCAAGAAAGAAATGCAAAA	0.333																																					p.E2432Q		.											.	CMYA5-77	0			c.G7294C						.						38.0	38.0	38.0					5																	79031882		1818	4082	5900	SO:0001583	missense	202333	exon2			AAGAAAGAAATGC	AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.7294G>C	5.37:g.79031882G>C	ENSP00000394770:p.Glu2432Gln	66	0		58	24	NM_153610	0	0	3	9	6	A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Missense_Mutation	SNP	ENST00000446378.2	37	CCDS47238.1	.	.	.	.	.	.	.	.	.	.	G	17.82	3.484254	0.63962	.	.	ENSG00000164309	ENST00000446378	T	0.24723	1.84	5.87	4.09	0.47781	.	0.121012	0.37483	N	0.002068	T	0.37100	0.0991	M	0.71581	2.175	0.28279	N	0.924047	D	0.59767	0.986	P	0.53954	0.738	T	0.32877	-0.9890	10	0.66056	D	0.02	.	6.9428	0.24502	0.2444:0.0:0.7556:0.0	.	2432	Q8N3K9	CMYA5_HUMAN	Q	2432	ENSP00000394770:E2432Q	ENSP00000394770:E2432Q	E	+	1	0	CMYA5	79067638	0.992000	0.36948	0.963000	0.40424	0.963000	0.63663	1.287000	0.33284	1.493000	0.48517	0.655000	0.94253	GAA	.		0.333	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369497.1	NM_153610	
CMYA5	202333	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	79032579	79032579	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr5:79032579G>A	ENST00000446378.2	+	2	8022	c.7991G>A	c.(7990-7992)aGa>aAa	p.R2664K		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	2664					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		AAGTCAAGCAGAGATATGCCA	0.403																																					p.R2664K		.											.	CMYA5-77	0			c.G7991A						.						49.0	49.0	49.0					5																	79032579		1848	4092	5940	SO:0001583	missense	202333	exon2			CAAGCAGAGATAT	AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.7991G>A	5.37:g.79032579G>A	ENSP00000394770:p.Arg2664Lys	68	0		50	25	NM_153610	0	0	19	35	16	A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Missense_Mutation	SNP	ENST00000446378.2	37	CCDS47238.1	.	.	.	.	.	.	.	.	.	.	G	10.79	1.448897	0.26074	.	.	ENSG00000164309	ENST00000446378	T	0.36340	1.26	3.85	2.95	0.34219	.	.	.	.	.	T	0.25419	0.0618	L	0.34521	1.04	0.09310	N	1	B	0.26483	0.15	B	0.23419	0.046	T	0.17349	-1.0372	9	0.39692	T	0.17	.	6.834	0.23925	0.1396:0.0:0.8604:0.0	.	2664	Q8N3K9	CMYA5_HUMAN	K	2664	ENSP00000394770:R2664K	ENSP00000394770:R2664K	R	+	2	0	CMYA5	79068335	0.000000	0.05858	0.016000	0.15963	0.089000	0.18198	0.577000	0.23758	0.699000	0.31761	0.393000	0.25936	AGA	.		0.403	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369497.1	NM_153610	
MTX3	345778	hgsc.bcm.edu	37	5	79284404	79284404	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr5:79284404G>C	ENST00000512528.1	-	5	405	c.385C>G	c.(385-387)Caa>Gaa	p.Q129E	MTX3_ENST00000512560.1_Missense_Mutation_p.Q68E|MTX3_ENST00000509852.1_Missense_Mutation_p.Q129E			Q5HYI7	MTX3_HUMAN	metaxin 3	129					protein targeting to mitochondrion (GO:0006626)	mitochondrial outer membrane (GO:0005741)				endometrium(1)|large_intestine(3)|lung(2)|urinary_tract(1)	7		Lung NSC(167;0.00428)|all_lung(232;0.00455)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;1.63e-45)|Epithelial(54;2.9e-40)|all cancers(79;4.68e-35)		AAAGGAATTTGTGAAGCAAAC	0.438																																					p.Q129E		.											.	.	0			c.C385G						.						52.0	48.0	49.0					5																	79284404		1886	4117	6003	SO:0001583	missense	345778	exon5			GAATTTGTGAAGC	BX538064	CCDS47239.1, CCDS47239.2, CCDS54872.1	5q14.1	2004-08-18				ENSG00000177034			24812	protein-coding gene	gene with protein product						15087125	Standard	NM_001010891		Approved		uc010jah.3	Q5HYI7		ENST00000512528.1:c.385C>G	5.37:g.79284404G>C	ENSP00000424798:p.Gln129Glu	26	0		18	2	NM_001010891	0	0	3	3	0	B4DL65|E9PB57|Q7Z380|Q8NB92	Missense_Mutation	SNP	ENST00000512528.1	37		.	.	.	.	.	.	.	.	.	.	G	12.57	1.978410	0.34942	.	.	ENSG00000177034	ENST00000512560;ENST00000328496;ENST00000509852;ENST00000512528;ENST00000418095	T;T;T	0.40476	1.05;1.03;1.03	5.58	5.58	0.84498	.	0.238382	0.42548	D	0.000688	T	0.26376	0.0644	N	0.19112	0.55	0.23386	N	0.997788	B;B	0.13594	0.004;0.008	B;B	0.23275	0.009;0.045	T	0.14699	-1.0463	10	0.02654	T	1	-2.1197	14.3221	0.66493	0.0:0.0:0.8155:0.1845	.	129;129	Q5HYI7-4;Q5HYI7	.;MTX3_HUMAN	E	68;129;129;129;129	ENSP00000423600:Q68E;ENSP00000423302:Q129E;ENSP00000424798:Q129E	ENSP00000331672:Q129E	Q	-	1	0	MTX3	79320160	1.000000	0.71417	0.994000	0.49952	0.988000	0.76386	4.897000	0.63231	2.627000	0.88993	0.655000	0.94253	CAA	.		0.438	MTX3-005	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000372567.1	XM_293971	
VCAN	1462	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	82786054	82786054	+	Nonsense_Mutation	SNP	G	G	T			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr5:82786054G>T	ENST00000265077.3	+	3	773	c.208G>T	c.(208-210)Gaa>Taa	p.E70*	VCAN_ENST00000513984.1_Nonsense_Mutation_p.E70*|VCAN_ENST00000342785.4_Nonsense_Mutation_p.E70*|VCAN_ENST00000512590.2_Nonsense_Mutation_p.E22*|VCAN_ENST00000343200.5_Nonsense_Mutation_p.E70*|VCAN_ENST00000502527.2_Nonsense_Mutation_p.E70*	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	70	Ig-like V-type.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	GTCTAAGATTGAAGTGGACAA	0.418																																					p.E70X		.											.	VCAN-238	0			c.G208T						.						104.0	102.0	103.0					5																	82786054		2203	4300	6503	SO:0001587	stop_gained	1462	exon3			AAGATTGAAGTGG	X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.208G>T	5.37:g.82786054G>T	ENSP00000265077:p.Glu70*	126	1		99	23	NM_004385	0	0	8	8	0	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Nonsense_Mutation	SNP	ENST00000265077.3	37	CCDS4060.1	.	.	.	.	.	.	.	.	.	.	G	40	8.125073	0.98665	.	.	ENSG00000038427	ENST00000265077;ENST00000343200;ENST00000342785;ENST00000512590;ENST00000513960;ENST00000513984;ENST00000502527	.	.	.	5.78	5.78	0.91487	.	0.000000	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.44086	T	0.13	.	19.9898	0.97362	0.0:0.0:1.0:0.0	.	.	.	.	X	70;70;70;22;70;70;70	.	ENSP00000265077:E70X	E	+	1	0	VCAN	82821810	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.034000	0.64152	2.733000	0.93635	0.655000	0.94253	GAA	.		0.418	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385	
VCAN	1462	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	82817031	82817031	+	Missense_Mutation	SNP	C	C	G			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr5:82817031C>G	ENST00000265077.3	+	7	3471	c.2906C>G	c.(2905-2907)tCt>tGt	p.S969C	VCAN_ENST00000342785.4_Missense_Mutation_p.S969C|VCAN_ENST00000512590.2_Missense_Mutation_p.S921C|VCAN_ENST00000343200.5_Intron|VCAN_ENST00000502527.2_Intron	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	969	GAG-alpha (glucosaminoglycan attachment domain).				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	TATGTAGACTCTTCCCATACC	0.433																																					p.S969C		.											.	VCAN-238	0			c.C2906G						.						113.0	112.0	112.0					5																	82817031		2203	4300	6503	SO:0001583	missense	1462	exon7			TAGACTCTTCCCA	X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.2906C>G	5.37:g.82817031C>G	ENSP00000265077:p.Ser969Cys	116	0		105	9	NM_004385	0	0	0	0	0	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	ENST00000265077.3	37	CCDS4060.1	.	.	.	.	.	.	.	.	.	.	C	10.39	1.337475	0.24253	.	.	ENSG00000038427	ENST00000265077;ENST00000342785;ENST00000512590	T;T;T	0.20332	2.08;2.08;2.08	5.26	-0.324	0.12706	.	1.069220	0.07230	N	0.862281	T	0.21718	0.0523	L	0.44542	1.39	0.09310	N	1	P;P	0.51653	0.904;0.947	P;P	0.47981	0.563;0.453	T	0.19257	-1.0311	10	0.62326	D	0.03	.	4.5464	0.12083	0.0:0.4105:0.2996:0.29	.	969;969	P13611-3;P13611	.;CSPG2_HUMAN	C	969;969;921	ENSP00000265077:S969C;ENSP00000342768:S969C;ENSP00000425959:S921C	ENSP00000265077:S969C	S	+	2	0	VCAN	82852787	0.000000	0.05858	0.022000	0.16811	0.689000	0.40095	-0.838000	0.04372	-0.249000	0.09569	0.591000	0.81541	TCT	.		0.433	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385	
APBB3	10307	hgsc.bcm.edu	37	5	139940335	139940335	+	Missense_Mutation	SNP	C	C	G			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr5:139940335C>G	ENST00000357560.4	-	11	1364	c.921G>C	c.(919-921)atG>atC	p.M307I	SRA1_ENST00000336283.6_5'Flank|APBB3_ENST00000412920.3_Missense_Mutation_p.M305I|APBB3_ENST00000511201.2_Intron|APBB3_ENST00000508496.2_Missense_Mutation_p.M84I|APBB3_ENST00000358580.5_Intron|APBB3_ENST00000356738.2_Missense_Mutation_p.M312I|APBB3_ENST00000507279.1_5'Flank|APBB3_ENST00000354402.5_Missense_Mutation_p.M314I	NM_006051.3|NM_133173.2	NP_006042.3|NP_573419.2	O95704	APBB3_HUMAN	amyloid beta (A4) precursor protein-binding, family B, member 3	307	PID 2. {ECO:0000255|PROSITE- ProRule:PRU00148}.					actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|prostate(1)	11			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCAGCACATCCATGCCTGGGG	0.572																																					p.M314I		.											.	APBB3-92	0			c.G942C						.						43.0	44.0	44.0					5																	139940335		2203	4300	6503	SO:0001583	missense	10307	exon10			CACATCCATGCCT	AB018247	CCDS4227.1, CCDS4228.1, CCDS4229.1, CCDS47279.1	5q31	2008-02-05			ENSG00000113108	ENSG00000113108			20708	protein-coding gene	gene with protein product		602711				9407065	Standard	NM_133172		Approved	FE65L2	uc003lgd.1	O95704	OTTHUMG00000129504	ENST00000357560.4:c.921G>C	5.37:g.139940335C>G	ENSP00000350171:p.Met307Ile	71	0		25	2	NM_006051	0	0	0	0	0	B3KQN9|Q08AG4|Q96Q18|Q9BYD4|Q9NYX6|Q9NYX7|Q9NYX8	Missense_Mutation	SNP	ENST00000357560.4	37	CCDS4229.1	.	.	.	.	.	.	.	.	.	.	C	16.64	3.180314	0.57800	.	.	ENSG00000113108	ENST00000356738;ENST00000354402;ENST00000357560;ENST00000508496;ENST00000412920	T;T;T;T;T	0.22539	1.95;1.95;1.95;1.95;1.95	4.96	4.96	0.65561	.	0.000000	0.85682	D	0.000000	T	0.22666	0.0547	L	0.38175	1.15	0.80722	D	1	D;P	0.54601	0.967;0.803	P;B	0.46940	0.532;0.27	T	0.00822	-1.1552	9	.	.	.	-17.4445	15.5267	0.75915	0.0:0.862:0.138:0.0	.	305;312	O95704-2;O95704-3	.;.	I	312;314;307;84;305	ENSP00000349177:M312I;ENSP00000346378:M314I;ENSP00000350171:M307I;ENSP00000444013:M84I;ENSP00000402591:M305I	.	M	-	3	0	APBB3	139920519	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.658000	0.61497	2.579000	0.87056	0.655000	0.94253	ATG	.		0.572	APBB3-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251677.2	NM_006051	
PCDHGC3	5098	broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	140856910	140856910	+	Silent	SNP	G	G	A			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr5:140856910G>A	ENST00000308177.3	+	1	1331	c.1227G>A	c.(1225-1227)ttG>ttA	p.L409L	PCDHGA11_ENST00000518882.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA12_ENST00000252085.3_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA10_ENST00000398610.2_Intron|RN7SL68P_ENST00000488078.2_RNA|PCDHGB2_ENST00000522605.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA7_ENST00000518325.1_Intron	NM_002588.2|NM_032402.1	NP_002579.2|NP_115778.1	Q9UN70	PCDGK_HUMAN	protocadherin gamma subfamily C, 3	409	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|skin(2)|urinary_tract(1)	29			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACTTCACTTTGAAAACCAGTG	0.552																																					p.L409L													.	PCDHGC3-24	0			c.G1227A						.						55.0	56.0	56.0					5																	140856910		2203	4300	6503	SO:0001819	synonymous_variant	5098	exon1			CACTTTGAAAACC	AF152337	CCDS4261.1, CCDS75347.1, CCDS75348.1	5q31	2010-01-26			ENSG00000240184	ENSG00000240184		"""Cadherins / Protocadherins : Clustered"""	8716	other	protocadherin	"""cadherin-like 2"", ""protocadherin 2"", ""protocadherin 43"""	603627		PCDH2		9360932, 8508762	Standard	NM_032402		Approved	PC-43, PC43, PCDH-GAMMA-C3		Q9UN70	OTTHUMG00000129613	ENST00000308177.3:c.1227G>A	5.37:g.140856910G>A		97	0		59	14	NM_032402	0	0	3	6	3	O60622|Q08192|Q9Y5C4	Silent	SNP	ENST00000308177.3	37	CCDS4261.1																																																																																			.		0.552	PCDHGC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251808.2	NM_002588	
GRIA1	2890	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	153078520	153078520	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr5:153078520G>C	ENST00000285900.5	+	10	1682	c.1339G>C	c.(1339-1341)Gcc>Ccc	p.A447P	GRIA1_ENST00000340592.5_Missense_Mutation_p.A447P|GRIA1_ENST00000518783.1_Missense_Mutation_p.A457P|GRIA1_ENST00000518142.1_Missense_Mutation_p.A367P|GRIA1_ENST00000448073.4_Missense_Mutation_p.A457P|GRIA1_ENST00000521843.2_Missense_Mutation_p.A378P	NM_000827.3|NM_001258019.1	NP_000818.2|NP_001244948.1	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1	447					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|axonal spine (GO:0044308)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|neuron spine (GO:0044309)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|PDZ domain binding (GO:0030165)			NS(1)|breast(4)|endometrium(7)|kidney(3)|large_intestine(24)|liver(2)|lung(23)|ovary(4)|pancreas(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	81		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Perampanel(DB08883)|Sevoflurane(DB01236)	GGCAGAGATTGCCAAGCACGT	0.537																																					p.A457P		.											.	GRIA1-96	0			c.G1369C						.						115.0	102.0	106.0					5																	153078520		2203	4300	6503	SO:0001583	missense	2890	exon10			GAGATTGCCAAGC		CCDS4322.1, CCDS47318.1, CCDS58986.1, CCDS58987.1, CCDS58988.1, CCDS58989.1	5q33	2012-08-29			ENSG00000155511	ENSG00000155511		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4571	protein-coding gene	gene with protein product		138248		GLUR1		1652753, 1319477	Standard	NM_000827		Approved	GluA1, GLURA	uc011dcy.2	P42261	OTTHUMG00000130148	ENST00000285900.5:c.1339G>C	5.37:g.153078520G>C	ENSP00000285900:p.Ala447Pro	135	0		82	19	NM_001258021	0	0	0	0	0	B7Z2S0|B7Z2W8|B7Z3F6|B7Z9G9|D3DQI4|E7ESV8|Q2NKM6	Missense_Mutation	SNP	ENST00000285900.5	37	CCDS4322.1	.	.	.	.	.	.	.	.	.	.	G	34	5.344853	0.95807	.	.	ENSG00000155511	ENST00000285900;ENST00000544403;ENST00000518142;ENST00000537037;ENST00000340592;ENST00000521843;ENST00000544794;ENST00000518783;ENST00000448073	T;T;D;T;T;T;D	0.81821	1.03;1.03;-1.54;1.03;1.03;1.03;-1.54	5.44	5.44	0.79542	Glutamate receptor, L-glutamate/glycine-binding (2);Ionotropic glutamate receptor (1);	0.000000	0.85682	D	0.000000	D	0.93514	0.7930	H	0.96996	3.92	0.80722	D	1	D;D;D;D;D;D	0.71674	0.987;0.987;0.998;0.987;0.984;0.998	D;D;D;D;P;D	0.91635	0.931;0.931;0.999;0.931;0.887;0.984	D	0.95457	0.8539	10	0.87932	D	0	.	18.2393	0.89961	0.0:0.0:1.0:0.0	.	457;457;367;457;447;447	E7ESV8;B7Z9G9;B7Z3F6;B7Z2W8;P42261-2;P42261	.;.;.;.;.;GRIA1_HUMAN	P	447;447;367;401;447;378;378;457;457	ENSP00000285900:A447P;ENSP00000427920:A367P;ENSP00000339343:A447P;ENSP00000427864:A378P;ENSP00000442108:A378P;ENSP00000428994:A457P;ENSP00000415569:A457P	ENSP00000285900:A447P	A	+	1	0	GRIA1	153058713	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.640000	0.98453	2.548000	0.85928	0.655000	0.94253	GCC	.		0.537	GRIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252456.3		
SGCD	6444	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	156186311	156186311	+	Silent	SNP	C	C	T			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr5:156186311C>T	ENST00000435422.3	+	8	1267	c.780C>T	c.(778-780)ttC>ttT	p.F260F	SGCD_ENST00000337851.4_Silent_p.F261F	NM_001128209.1	NP_001121681.1	Q92629	SGCD_HUMAN	sarcoglycan, delta (35kDa dystrophin-associated glycoprotein)	260					muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcoglycan complex (GO:0016012)|sarcolemma (GO:0042383)		p.F261L(1)		breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(16)|prostate(1)	24	Renal(175;0.00488)	Medulloblastoma(196;0.0378)|all_neural(177;0.106)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			AGAAGGTCTTCGAGATCTGCG	0.488																																					p.F261F		.											.	.	1	Substitution - Missense(1)	lung(1)	c.C783T						.						130.0	125.0	127.0					5																	156186311		1968	4175	6143	SO:0001819	synonymous_variant	6444	exon9			GGTCTTCGAGATC	BX537948	CCDS47325.1, CCDS47326.1, CCDS47327.1	5q33-q34	2014-09-17	2002-08-29						10807	protein-coding gene	gene with protein product		601411	"""sarcoglycan, delta (35kD dystrophin-associated glycoprotein)"""			8776597, 8841194, 10974018	Standard	NM_000337		Approved	DAGD, LGMD2F, CMD1L	uc003lwd.4	Q92629		ENST00000435422.3:c.780C>T	5.37:g.156186311C>T		171	1		131	44	NM_000337	0	0	0	0	0	A8K9S9|Q53XA5|Q99644	Silent	SNP	ENST00000435422.3	37	CCDS47327.1																																																																																			.		0.488	SGCD-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000373469.3		
HLA-B	3106	broad.mit.edu	37	6	31324628	31324628	+	Silent	SNP	G	G	A	rs151341114		TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr6:31324628G>A	ENST00000412585.2	-	2	208	c.180C>T	c.(178-180)ttC>ttT	p.F60F		NM_005514.6	NP_005505.2	P30486	1B48_HUMAN	major histocompatibility complex, class I, B	60	Alpha-1.				antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|viral process (GO:0016032)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|MHC class I protein complex (GO:0042612)	peptide antigen binding (GO:0042605)			endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(4)|lung(4)|prostate(1)|upper_aerodigestive_tract(2)	27						CGTCGCTGTCGAACCTCACGA	0.652									Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of																												p.F60F													.	HLA-B-90	0			c.C180T						.						39.0	33.0	35.0					6																	31324628		2158	4201	6359	SO:0001819	synonymous_variant	3106	exon2	Familial Cancer Database	;Lichen Sclerosis, Familial	GCTGTCGAACCTC	M15470	CCDS34394.1	6p21.3	2013-01-11			ENSG00000234745	ENSG00000234745		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4932	protein-coding gene	gene with protein product		142830	"""ankylosing spondylitis"""	AS		3459708	Standard	NM_005514		Approved		uc011imz.2	P01889	OTTHUMG00000031153	ENST00000412585.2:c.180C>T	6.37:g.31324628G>A		21	0		12	7	NM_005514	1	0	164	871	705	Q29764	Silent	SNP	ENST00000412585.2	37	CCDS34394.1																																																																																			.		0.652	HLA-B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076280.4	NM_005514	
FOXP4	116113	bcgsc.ca	37	6	41533574	41533574	+	Missense_Mutation	SNP	C	C	A			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr6:41533574C>A	ENST00000307972.4	+	1	88	c.76C>A	c.(76-78)Caa>Aaa	p.Q26K	FOXP4_ENST00000373063.3_Missense_Mutation_p.Q26K|FOXP4_ENST00000373060.1_Missense_Mutation_p.Q26K|FOXP4_ENST00000409208.1_Missense_Mutation_p.Q26K|FOXP4_ENST00000373057.3_Missense_Mutation_p.Q26K			Q8IVH2	FOXP4_HUMAN	forkhead box P4	26					embryonic foregut morphogenesis (GO:0048617)|heart development (GO:0007507)|lung secretory cell differentiation (GO:0061140)|negative regulation of lung goblet cell differentiation (GO:1901250)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	16	Ovarian(28;0.0327)|Colorectal(47;0.196)					CCTCTCTGGGCAAGCCGATGG	0.627																																					p.Q26K													.	FOXP4-289	0			c.C76A						.						83.0	84.0	84.0					6																	41533574		2201	4292	6493	SO:0001583	missense	116113	exon2			TCTGGGCAAGCCG	AB080747	CCDS4856.1, CCDS34447.1, CCDS34448.1	6p21.1	2008-02-05			ENSG00000137166	ENSG00000137166		"""Forkhead boxes"""	20842	protein-coding gene	gene with protein product		608924					Standard	XM_006714991		Approved	FLJ40908	uc003oql.3	Q8IVH2	OTTHUMG00000014679	ENST00000307972.4:c.76C>A	6.37:g.41533574C>A	ENSP00000309823:p.Gln26Lys	170	16		81	18	NM_001012427	0	0	6	6	0	Q5W098|Q7Z7F8|Q8IW55|Q96E19	Missense_Mutation	SNP	ENST00000307972.4	37	CCDS34447.1	.	.	.	.	.	.	.	.	.	.	C	14.48	2.547854	0.45383	.	.	ENSG00000137166	ENST00000373060;ENST00000373063;ENST00000409208;ENST00000373057;ENST00000307972	D;D;D;D;D	0.91464	-2.85;-2.81;-2.81;-2.8;-2.85	5.35	5.35	0.76521	.	0.000000	0.50627	D	0.000103	D	0.82715	0.5097	M	0.70595	2.14	0.58432	D	0.999996	B;B;B	0.29037	0.231;0.231;0.231	B;B;B	0.24848	0.056;0.056;0.056	T	0.82694	-0.0330	10	0.02654	T	1	.	19.0777	0.93169	0.0:1.0:0.0:0.0	.	26;26;26	Q8IW55;Q7Z7F8;Q8IVH2	.;.;FOXP4_HUMAN	K	26	ENSP00000362151:Q26K;ENSP00000362154:Q26K;ENSP00000386958:Q26K;ENSP00000362148:Q26K;ENSP00000309823:Q26K	ENSP00000309823:Q26K	Q	+	1	0	FOXP4	41641552	1.000000	0.71417	0.999000	0.59377	0.155000	0.21991	7.077000	0.76814	2.529000	0.85273	0.655000	0.94253	CAA	.		0.627	FOXP4-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000106767.1	NM_138457	
CUL7	9820	broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	43008726	43008726	+	Silent	SNP	G	G	A			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr6:43008726G>A	ENST00000265348.3	-	20	3818	c.3733C>T	c.(3733-3735)Ctg>Ttg	p.L1245L	CUL7_ENST00000535468.1_Silent_p.L1329L			Q14999	CUL7_HUMAN	cullin 7	1245					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|epithelial to mesenchymal transition (GO:0001837)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|mitotic cytokinesis (GO:0000281)|placenta development (GO:0001890)|positive regulation of dendrite morphogenesis (GO:0050775)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	3M complex (GO:1990393)|anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|Cul7-RING ubiquitin ligase complex (GO:0031467)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(8)|liver(1)|lung(11)|ovary(3)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	49			all cancers(41;0.00231)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0442)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			CATTGCTGCAGCTGTGCCAGC	0.572																																					p.L1329L													.	CUL7-229	0			c.C3985T						.						40.0	31.0	34.0					6																	43008726		2203	4300	6503	SO:0001819	synonymous_variant	9820	exon20			GCTGCAGCTGTGC	BC033647	CCDS4881.1, CCDS55003.1	6p21.1	2011-05-24	2004-03-22	2004-03-22	ENSG00000044090	ENSG00000044090			21024	protein-coding gene	gene with protein product		609577	"""KIAA0076"""	KIAA0076		12481031, 12904573	Standard	NM_014780		Approved	dJ20C7.5	uc011dvb.2	Q14999	OTTHUMG00000014718	ENST00000265348.3:c.3733C>T	6.37:g.43008726G>A		30	0		12	4	NM_001168370	0	0	4	7	3	B4DYZ0|F5H0L1|Q5T654	Silent	SNP	ENST00000265348.3	37	CCDS4881.1																																																																																			.		0.572	CUL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040575.1	NM_014780	
CUL9	23113	hgsc.bcm.edu	37	6	43181268	43181268	+	Silent	SNP	T	T	C			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr6:43181268T>C	ENST00000252050.4	+	28	5535	c.5451T>C	c.(5449-5451)ccT>ccC	p.P1817P	CUL9_ENST00000372647.2_Silent_p.P1817P|CUL9_ENST00000354495.3_Silent_p.P1707P|CUL9_ENST00000502937.1_3'UTR|RP3-330M21.5_ENST00000500590.1_RNA	NM_015089.2	NP_055904.1	Q8IWT3	CUL9_HUMAN	cullin 9	1817					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|liver(1)|lung(30)|ovary(5)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(4)	92						GGAATGGCCCTTTGACCCTGC	0.632																																					p.P1817P		.											.	CUL9-529	0			c.T5451C						.						50.0	51.0	51.0					6																	43181268		2203	4300	6503	SO:0001819	synonymous_variant	23113	exon28			TGGCCCTTTGACC	AB014608	CCDS4890.1	6p21.1	2011-05-24			ENSG00000112659	ENSG00000112659			15982	protein-coding gene	gene with protein product	"""parkin-like cytoplasmic p53 binding protein"", ""p53-associated parkin-like cytoplasmic protein"""	607489				17332328, 10521492, 12526791	Standard	NM_015089		Approved	H7AP1, KIAA0708, PARC	uc003ouk.3	Q8IWT3	OTTHUMG00000014723	ENST00000252050.4:c.5451T>C	6.37:g.43181268T>C		111	0		43	3	NM_015089	0	0	4	4	0	O75188|Q5TCY3|Q68CP2|Q68D92|Q8N3W9|Q9BU56	Silent	SNP	ENST00000252050.4	37	CCDS4890.1																																																																																			.		0.632	CUL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040582.2	NM_015089	
TJAP1	93643	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	43468508	43468508	+	Missense_Mutation	SNP	G	G	T			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr6:43468508G>T	ENST00000372445.5	+	5	502	c.126G>T	c.(124-126)atG>atT	p.M42I	TJAP1_ENST00000259751.1_Missense_Mutation_p.M42I|TJAP1_ENST00000436109.2_Missense_Mutation_p.M42I|TJAP1_ENST00000372444.2_Missense_Mutation_p.M42I|TJAP1_ENST00000372452.1_Missense_Mutation_p.M42I|TJAP1_ENST00000483640.1_3'UTR|TJAP1_ENST00000372449.1_Missense_Mutation_p.M42I|TJAP1_ENST00000438588.2_Missense_Mutation_p.M42I	NM_001146016.1	NP_001139488.1	Q5JTD0	TJAP1_HUMAN	tight junction associated protein 1 (peripheral)	42					Golgi organization (GO:0007030)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)|trans-Golgi network (GO:0005802)				cervix(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|urinary_tract(2)	21	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0122)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)			CAGAAAGGATGAAGTGAGTAT	0.537																																					p.M42I		.											.	TJAP1-90	0			c.G126T						.						170.0	152.0	158.0					6																	43468508		2203	4300	6503	SO:0001583	missense	93643	exon5			AAGGATGAAGTGA	AK024269	CCDS4898.1, CCDS55004.1	6p21.1	2008-02-05	2005-07-05	2005-07-05	ENSG00000137221	ENSG00000137221			17949	protein-coding gene	gene with protein product		612658	"""tight junction protein 4 (peripheral)"""	TJP4		11602598	Standard	NM_001146016		Approved	PILT	uc011dvh.1	Q5JTD0	OTTHUMG00000014736	ENST00000372445.5:c.126G>T	6.37:g.43468508G>T	ENSP00000361522:p.Met42Ile	170	2		82	59	NM_080604	0	0	0	1	1	Q05BH9|Q5JTD1|Q5JWW1|Q68DB2|Q6P2P3|Q9H7V7	Missense_Mutation	SNP	ENST00000372445.5	37	CCDS55004.1	.	.	.	.	.	.	.	.	.	.	G	19.37	3.814511	0.70912	.	.	ENSG00000137221	ENST00000372444;ENST00000372445;ENST00000436109;ENST00000442878;ENST00000259751;ENST00000372454;ENST00000372452;ENST00000372449;ENST00000438588	T;T;T;T;T;T;T;T	0.77877	-1.13;-1.13;-1.13;-1.13;-1.13;-1.13;-1.13;-1.13	5.9	5.9	0.94986	.	0.048207	0.85682	D	0.000000	T	0.71134	0.3304	N	0.17082	0.46	0.37379	D	0.911945	B;D;P	0.53745	0.001;0.962;0.664	B;D;B	0.66716	0.003;0.946;0.203	T	0.68017	-0.5520	10	0.15066	T	0.55	-26.5245	17.4349	0.87548	0.0:0.0:1.0:0.0	.	42;42;42	E2QRK7;Q5JTD0;Q5JTD0-2	.;TJAP1_HUMAN;.	I	42	ENSP00000361521:M42I;ENSP00000361522:M42I;ENSP00000407080:M42I;ENSP00000390981:M42I;ENSP00000259751:M42I;ENSP00000361530:M42I;ENSP00000361527:M42I;ENSP00000408769:M42I	ENSP00000259751:M42I	M	+	3	0	TJAP1	43576486	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	4.402000	0.59722	2.788000	0.95919	0.650000	0.86243	ATG	.		0.537	TJAP1-202	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000040629.1	NM_080604	
SYNE1	23345	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	152557320	152557320	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr6:152557320C>T	ENST00000367255.5	-	110	20919	c.20318G>A	c.(20317-20319)gGa>gAa	p.G6773E	SYNE1_ENST00000423061.1_Missense_Mutation_p.G6702E|SYNE1_ENST00000341594.5_Missense_Mutation_p.G6385E|SYNE1_ENST00000356820.4_Missense_Mutation_p.G1297E|SYNE1_ENST00000448038.1_Missense_Mutation_p.G6702E|SYNE1_ENST00000265368.4_Missense_Mutation_p.G6773E	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	6773					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CCAGCACTCTCCAAGTTGATT	0.373										HNSCC(10;0.0054)																											p.G6773E		.											.	SYNE1-607	0			c.G20318A						.						170.0	166.0	167.0					6																	152557320		2203	4300	6503	SO:0001583	missense	23345	exon110			CACTCTCCAAGTT	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.20318G>A	6.37:g.152557320C>T	ENSP00000356224:p.Gly6773Glu	159	0		81	58	NM_182961	0	0	2	2	0	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	C	12.94	2.087720	0.36855	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820	T;T;T;T;T;T	0.50548	0.83;0.81;0.74;0.82;0.92;2.82	5.56	5.56	0.83823	.	0.000000	0.56097	D	0.000029	T	0.53498	0.1800	L	0.33710	1.025	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.55147	-0.8186	10	0.54805	T	0.06	.	19.5353	0.95251	0.0:1.0:0.0:0.0	.	6773;6773;6702	Q8NF91;E7EQI5;Q8NF91-4	SYNE1_HUMAN;.;.	E	6773;6702;6773;6702;6385;1297	ENSP00000356224:G6773E;ENSP00000396024:G6702E;ENSP00000265368:G6773E;ENSP00000390975:G6702E;ENSP00000341887:G6385E;ENSP00000349276:G1297E	ENSP00000265368:G6773E	G	-	2	0	SYNE1	152599013	1.000000	0.71417	1.000000	0.80357	0.816000	0.46133	6.073000	0.71245	2.607000	0.88179	0.655000	0.94253	GGA	.		0.373	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
SYNE1	23345	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	152560730	152560730	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr6:152560730G>C	ENST00000367255.5	-	108	20606	c.20005C>G	c.(20005-20007)Cag>Gag	p.Q6669E	SYNE1_ENST00000423061.1_Missense_Mutation_p.Q6598E|SYNE1_ENST00000341594.5_Missense_Mutation_p.Q6281E|SYNE1_ENST00000356820.4_Missense_Mutation_p.Q1193E|SYNE1_ENST00000448038.1_Missense_Mutation_p.Q6598E|SYNE1_ENST00000265368.4_Missense_Mutation_p.Q6669E	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	6669					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GCAGAAGCCTGAGCCATCAGC	0.468										HNSCC(10;0.0054)																											p.Q6669E		.											.	SYNE1-607	0			c.C20005G						.						136.0	112.0	120.0					6																	152560730		2203	4300	6503	SO:0001583	missense	23345	exon108			AAGCCTGAGCCAT	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.20005C>G	6.37:g.152560730G>C	ENSP00000356224:p.Gln6669Glu	101	0		61	47	NM_182961	0	0	0	1	1	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	G	2.493	-0.316916	0.05386	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820	T;T;T;T;T;T	0.34859	1.34;1.34;1.34;1.34;1.34;1.34	5.7	4.81	0.61882	.	0.210406	0.33438	N	0.004910	T	0.14787	0.0357	L	0.36672	1.1	0.30220	N	0.796918	B;B;B	0.26876	0.101;0.101;0.162	B;B;B	0.22386	0.017;0.017;0.039	T	0.10428	-1.0630	10	0.66056	D	0.02	.	12.7363	0.57225	0.0:0.1256:0.7439:0.1305	.	6669;6669;6598	Q8NF91;E7EQI5;Q8NF91-4	SYNE1_HUMAN;.;.	E	6669;6598;6669;6598;6281;1193	ENSP00000356224:Q6669E;ENSP00000396024:Q6598E;ENSP00000265368:Q6669E;ENSP00000390975:Q6598E;ENSP00000341887:Q6281E;ENSP00000349276:Q1193E	ENSP00000265368:Q6669E	Q	-	1	0	SYNE1	152602423	0.999000	0.42202	0.997000	0.53966	0.994000	0.84299	2.850000	0.48294	1.368000	0.46115	0.655000	0.94253	CAG	.		0.468	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
SYNE1	23345	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	152730280	152730280	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr6:152730280C>T	ENST00000367255.5	-	44	7064	c.6463G>A	c.(6463-6465)Gag>Aag	p.E2155K	RNA5SP223_ENST00000365174.1_RNA|SYNE1_ENST00000423061.1_Missense_Mutation_p.E2162K|SYNE1_ENST00000341594.5_Missense_Mutation_p.E2192K|SYNE1_ENST00000448038.1_Missense_Mutation_p.E2162K|SYNE1_ENST00000265368.4_Missense_Mutation_p.E2155K	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	2155					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TTCTTCAGCTCAGATAACAAG	0.383										HNSCC(10;0.0054)																											p.E2162K		.											.	SYNE1-607	0			c.G6484A						.						147.0	142.0	143.0					6																	152730280		2203	4300	6503	SO:0001583	missense	23345	exon44			TCAGCTCAGATAA	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.6463G>A	6.37:g.152730280C>T	ENSP00000356224:p.Glu2155Lys	99	0		55	45	NM_033071	0	0	0	1	1	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	C	18.72	3.684114	0.68157	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	T;T;T;T;T	0.52295	1.38;1.38;1.38;1.38;0.67	5.57	5.57	0.84162	.	0.000000	0.64402	D	0.000013	T	0.49115	0.1538	M	0.61703	1.905	0.80722	D	1	D;D;D;D	0.58620	0.982;0.983;0.983;0.978	P;P;P;P	0.59424	0.791;0.678;0.678;0.857	T	0.46582	-0.9181	10	0.06891	T	0.86	.	19.5527	0.95328	0.0:1.0:0.0:0.0	.	2138;2155;2155;2162	B3W695;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	K	2155;2162;2155;2162;2192	ENSP00000356224:E2155K;ENSP00000396024:E2162K;ENSP00000265368:E2155K;ENSP00000390975:E2162K;ENSP00000341887:E2192K	ENSP00000265368:E2155K	E	-	1	0	SYNE1	152771973	1.000000	0.71417	0.991000	0.47740	0.194000	0.23727	7.794000	0.85869	2.630000	0.89119	0.655000	0.94253	GAG	.		0.383	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
MLLT4	4301	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	168347543	168347543	+	Missense_Mutation	SNP	A	A	C			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr6:168347543A>C	ENST00000447894.2	+	26	3494	c.3494A>C	c.(3493-3495)aAa>aCa	p.K1165T	MLLT4_ENST00000392108.3_Missense_Mutation_p.K1165T|MLLT4_ENST00000366806.2_Missense_Mutation_p.K1165T|MLLT4_ENST00000392112.1_Missense_Mutation_p.K1148T|MLLT4_ENST00000351017.4_Missense_Mutation_p.K1172T|MLLT4_ENST00000400822.3_Missense_Mutation_p.K1164T|MLLT4_ENST00000344191.4_Missense_Mutation_p.K1165T|MLLT4_ENST00000507679.1_3'UTR			P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4	1165					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein C-terminus binding (GO:0008022)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(13)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	65		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)		AGACTGATGAAAAATAGAGCT	0.433			T	MLL	AL																																p.K1165T		.		Dom	yes		6	6q27	4301	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 (AF6)"""		L	.	MLLT4-685	0			c.A3494C						.						115.0	116.0	116.0					6																	168347543		2203	4300	6503	SO:0001583	missense	4301	exon26			TGATGAAAAATAG	AB011399	CCDS47517.1, CCDS75553.1	6q27	2008-02-05	2001-11-28		ENSG00000130396	ENSG00000130396			7137	protein-coding gene	gene with protein product		159559	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 4"""			8242616	Standard	NM_001040000		Approved	AF-6, AF6	uc021zij.1	P55196	OTTHUMG00000016031	ENST00000447894.2:c.3494A>C	6.37:g.168347543A>C	ENSP00000404595:p.Lys1165Thr	160	0		77	60	NM_001040000	0	0	0	18	18	O75087|O75088|O75089|Q59FP0|Q5TIG6|Q5TIG7|Q9NSN7|Q9NU92	Missense_Mutation	SNP	ENST00000447894.2	37		.	.	.	.	.	.	.	.	.	.	A	22.4	4.286695	0.80803	.	.	ENSG00000130396	ENST00000344191;ENST00000351017;ENST00000392108;ENST00000366806;ENST00000392112;ENST00000341575;ENST00000400822;ENST00000447894	T;T;T;T;T;T;T	0.04970	3.73;3.62;3.72;3.71;3.52;3.62;3.62	5.36	4.19	0.49359	.	0.000000	0.85682	D	0.000000	T	0.12347	0.0300	M	0.73962	2.25	0.52501	D	0.999956	P;D;P;P	0.67145	0.586;0.996;0.817;0.843	B;D;B;P	0.63703	0.263;0.917;0.345;0.63	T	0.00800	-1.1561	10	0.59425	D	0.04	-31.0185	11.4921	0.50387	0.929:0.0:0.071:0.0	.	1165;1164;1165;1149	P55196;P55196-5;P55196-6;P55196-2	AFAD_HUMAN;.;.;.	T	1165;1172;1165;1165;1148;1165;1164;1165	ENSP00000341118:K1165T;ENSP00000252692:K1172T;ENSP00000375956:K1165T;ENSP00000355771:K1165T;ENSP00000375960:K1148T;ENSP00000383623:K1164T;ENSP00000404595:K1165T	ENSP00000345834:K1165T	K	+	2	0	MLLT4	168090392	1.000000	0.71417	0.812000	0.32479	0.904000	0.53231	8.548000	0.90669	0.965000	0.38133	0.533000	0.62120	AAA	.		0.433	MLLT4-013	PUTATIVE	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000372077.1	NM_005936	
FRMD1	79981	hgsc.bcm.edu;broad.mit.edu	37	6	168457843	168457843	+	Missense_Mutation	SNP	C	C	G			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr6:168457843C>G	ENST00000283309.6	-	11	1648	c.1584G>C	c.(1582-1584)aaG>aaC	p.K528N	FRMD1_ENST00000537786.1_Missense_Mutation_p.K299N|FRMD1_ENST00000440994.2_Missense_Mutation_p.K460N|FRMD1_ENST00000432403.1_5'UTR	NM_024919.3	NP_079195.3	Q8N878	FRMD1_HUMAN	FERM domain containing 1	528						cytoskeleton (GO:0005856)				endometrium(3)|kidney(2)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|urinary_tract(1)	19		Breast(66;1.07e-05)|Ovarian(120;0.0728)		Epithelial(4;7.7e-30)|OV - Ovarian serous cystadenocarcinoma(33;5.82e-22)|BRCA - Breast invasive adenocarcinoma(4;1.38e-10)|GBM - Glioblastoma multiforme(31;0.000756)		TGCTGGACCTCTTGCTGGGGA	0.672																																					p.K528N	GBM(50;8 1094 9538 34399)|Ovarian(80;676 1857 8675 49015)	.											.	FRMD1-91	0			c.G1584C						.						42.0	35.0	37.0					6																	168457843		2201	4298	6499	SO:0001583	missense	79981	exon11			GGACCTCTTGCTG		CCDS5306.1, CCDS47518.1	6q27	2008-10-23			ENSG00000153303	ENSG00000153303			21240	protein-coding gene	gene with protein product							Standard	NM_001122841		Approved	FLJ00181, DKFZp434O0117, FLJ40260, FLJ22615, bA164L23.1	uc003qwo.4	Q8N878	OTTHUMG00000016037	ENST00000283309.6:c.1584G>C	6.37:g.168457843C>G	ENSP00000283309:p.Lys528Asn	10	0		10	8	NM_024919	0	0	0	0	0	B2RNV8|B3KUM6|Q5SZU7|Q9UFB0	Missense_Mutation	SNP	ENST00000283309.6	37	CCDS5306.1	.	.	.	.	.	.	.	.	.	.	C	9.261	1.043138	0.19748	.	.	ENSG00000153303	ENST00000283309;ENST00000440994;ENST00000537786	T;T;T	0.46451	0.87;0.87;0.87	3.29	-0.146	0.13432	.	0.376195	0.16637	U	0.205782	T	0.10078	0.0247	L	0.28115	0.83	0.22280	N	0.999235	B;B;B;B	0.20261	0.043;0.043;0.04;0.043	B;B;B;B	0.23419	0.02;0.02;0.046;0.03	T	0.20438	-1.0275	10	0.72032	D	0.01	.	2.0231	0.03513	0.1548:0.5026:0.152:0.1906	.	463;528;460;423	B7Z8G9;Q8N878;Q8N878-2;Q5SZU5	.;FRMD1_HUMAN;.;.	N	528;460;299	ENSP00000283309:K528N;ENSP00000414115:K460N;ENSP00000440078:K299N	ENSP00000283309:K528N	K	-	3	2	FRMD1	168200692	0.001000	0.12720	0.000000	0.03702	0.002000	0.02628	-0.243000	0.08915	0.339000	0.23719	-0.463000	0.05309	AAG	.		0.672	FRMD1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362513.2	NM_024919	
SBDS	51119	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	66456129	66456129	+	Missense_Mutation	SNP	C	C	G			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr7:66456129C>G	ENST00000246868.2	-	4	802	c.619G>C	c.(619-621)Gaa>Caa	p.E207Q		NM_016038.2	NP_057122.2	Q9Y3A5	SBDS_HUMAN	Shwachman-Bodian-Diamond syndrome	207					bone marrow development (GO:0048539)|bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|inner cell mass cell proliferation (GO:0001833)|leukocyte chemotaxis (GO:0030595)|mature ribosome assembly (GO:0042256)|mitotic spindle stabilization (GO:0043148)|ribosomal large subunit biogenesis (GO:0042273)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|spindle pole (GO:0000922)	microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|ribosome binding (GO:0043022)|rRNA binding (GO:0019843)			cervix(1)|endometrium(1)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	7						CTTACGATTTCTAACTGTTGG	0.353			Gene Conversion			"""AML, MDS"""			Shwachman-Diamond syndrome																												p.E207Q		.	yes	Rec		Schwachman-Diamond syndrome	7	7q11	51119	Shwachman-Bodian-Diamond syndrome protein		L	.	SBDS-523	0			c.G619C						.						150.0	125.0	133.0					7																	66456129		2203	4300	6503	SO:0001583	missense	51119	exon4	Familial Cancer Database	Shwachman syndrome, Shwachman-Bodian syndrome, Congenital Lipomatosis of the Pancreas	CGATTTCTAACTG	AF151855	CCDS5537.1	7q11.22	2014-09-17			ENSG00000126524	ENSG00000126524			19440	protein-coding gene	gene with protein product		607444				12496757	Standard	NM_016038		Approved	CGI-97, FLJ10917, SDS, SWDS	uc003tvm.1	Q9Y3A5	OTTHUMG00000023165	ENST00000246868.2:c.619G>C	7.37:g.66456129C>G	ENSP00000246868:p.Glu207Gln	65	0		84	33	NM_016038	0	0	0	0	0	A8K0P4|Q96FX0|Q9NV53	Missense_Mutation	SNP	ENST00000246868.2	37	CCDS5537.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.189067	0.78789	.	.	ENSG00000126524	ENST00000246868	D	0.96745	-4.11	5.04	5.04	0.67666	Ribosome maturation protein SBDS, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.96929	0.8997	M	0.87381	2.88	0.80722	D	1	P	0.37594	0.601	P	0.44394	0.448	D	0.96222	0.9161	10	0.30854	T	0.27	-19.3899	15.9306	0.79656	0.0:1.0:0.0:0.0	.	207	Q9Y3A5	SBDS_HUMAN	Q	207	ENSP00000246868:E207Q	ENSP00000246868:E207Q	E	-	1	0	SBDS	66093564	1.000000	0.71417	1.000000	0.80357	0.839000	0.47603	6.965000	0.76067	2.641000	0.89580	0.555000	0.69702	GAA	.		0.353	SBDS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251746.2	NM_016038	
PHTF2	57157	hgsc.bcm.edu;broad.mit.edu	37	7	77539715	77539715	+	Missense_Mutation	SNP	C	C	G			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr7:77539715C>G	ENST00000248550.7	+	8	841	c.765C>G	c.(763-765)ttC>ttG	p.F255L	PHTF2_ENST00000422959.2_Missense_Mutation_p.F221L|PHTF2_ENST00000307305.8_Missense_Mutation_p.F217L|PHTF2_ENST00000416283.2_Missense_Mutation_p.F221L|PHTF2_ENST00000424760.1_Missense_Mutation_p.F217L|PHTF2_ENST00000275575.7_Missense_Mutation_p.F217L|PHTF2_ENST00000450574.1_Missense_Mutation_p.F221L|PHTF2_ENST00000415251.2_Missense_Mutation_p.F217L|PHTF2_ENST00000454592.1_3'UTR			Q8N3S3	PHTF2_HUMAN	putative homeodomain transcription factor 2	255					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(2)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)	19						ATGCTGCTTTCTTTTTATCAG	0.413																																					p.F221L		.											.	PHTF2-23	0			c.C663G						.						82.0	78.0	79.0					7																	77539715		1912	4141	6053	SO:0001583	missense	57157	exon7			TGCTTTCTTTTTA	AL136883	CCDS47621.1, CCDS47622.1, CCDS47623.1, CCDS47624.1	7q11.23-q21	2008-02-01			ENSG00000006576	ENSG00000006576			13411	protein-coding gene	gene with protein product						10729229	Standard	NM_020432		Approved	DKFZp434D166	uc003ugq.4	Q8N3S3	OTTHUMG00000155557	ENST00000248550.7:c.765C>G	7.37:g.77539715C>G	ENSP00000248550:p.Phe255Leu	47	0		51	7	NM_001127359	0	0	0	0	0	A0JP04|A0JP05|A4D1C2|E9PEE3|G5E9H7|Q6NW35|Q8TBW4|Q9H099	Missense_Mutation	SNP	ENST00000248550.7	37		.	.	.	.	.	.	.	.	.	.	C	13.99	2.400678	0.42613	.	.	ENSG00000006576	ENST00000427986;ENST00000422959;ENST00000307305;ENST00000424760;ENST00000415251;ENST00000275575;ENST00000450574;ENST00000416283;ENST00000248550	.	.	.	5.5	5.5	0.81552	.	0.050270	0.85682	D	0.000000	T	0.53238	0.1784	N	0.24115	0.695	0.50313	D	0.999866	P;B;B;B;B;B;B;B;B	0.46859	0.885;0.114;0.105;0.066;0.105;0.447;0.141;0.172;0.172	P;B;B;B;B;B;B;B;B	0.48189	0.57;0.022;0.03;0.008;0.03;0.067;0.045;0.045;0.02	T	0.46247	-0.9205	9	0.23302	T	0.38	-12.6236	19.4005	0.94627	0.0:1.0:0.0:0.0	.	59;217;80;221;255;221;217;217;217	Q8WVD6;Q8N3S3-4;Q8N5I6;Q8N3S3-2;Q8N3S3;G5E9H7;Q8N3S3-3;B3KQZ2;E9PEE3	.;.;.;.;PHTF2_HUMAN;.;.;.;.	L	221;221;217;217;217;217;221;221;255	.	ENSP00000248550:F255L	F	+	3	2	PHTF2	77377651	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.493000	0.66899	2.591000	0.87537	0.655000	0.94253	TTC	.		0.413	PHTF2-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000340638.2	NM_020432	
MAGI2	9863	hgsc.bcm.edu;broad.mit.edu	37	7	77885410	77885410	+	Missense_Mutation	SNP	C	C	G			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr7:77885410C>G	ENST00000354212.4	-	10	2150	c.1897G>C	c.(1897-1899)Gac>Cac	p.D633H	MAGI2_ENST00000522391.1_Missense_Mutation_p.D633H|MAGI2_ENST00000419488.1_Missense_Mutation_p.D633H|MAGI2_ENST00000535697.1_Missense_Mutation_p.D470H|MAGI2_ENST00000536571.1_Missense_Mutation_p.D465H	NM_012301.3	NP_036433.2	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 2	633	PDZ 3. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|glomerular visceral epithelial cell development (GO:0072015)|mitotic cell cycle arrest (GO:0071850)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase B signaling (GO:0051898)|nerve growth factor signaling pathway (GO:0038180)|planar cell polarity pathway involved in axis elongation (GO:0003402)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of receptor internalization (GO:0002092)|protein heterooligomerization (GO:0051291)|receptor clustering (GO:0043113)|SMAD protein signal transduction (GO:0060395)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|late endosome (GO:0005770)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)|synapse (GO:0045202)|tight junction (GO:0005923)	beta-1 adrenergic receptor binding (GO:0031697)|phosphatase binding (GO:0019902)|receptor signaling complex scaffold activity (GO:0030159)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|type II activin receptor binding (GO:0070699)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(37)|ovary(5)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(3)	84		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				CCCTGAATGTCAAGTATTTGT	0.488																																					p.D633H		.											.	MAGI2-461	0			c.G1897C						.						71.0	60.0	64.0					7																	77885410		2203	4300	6503	SO:0001583	missense	9863	exon10			GAATGTCAAGTAT	AB014605	CCDS5594.1, CCDS75623.1	7q21	2005-08-09			ENSG00000187391	ENSG00000187391			18957	protein-coding gene	gene with protein product		606382				10681527, 9734811	Standard	XM_005250725		Approved	AIP1, ARIP1, KIAA0705, ACVRIP1, MAGI-2	uc003ugx.3	Q86UL8	OTTHUMG00000130697	ENST00000354212.4:c.1897G>C	7.37:g.77885410C>G	ENSP00000346151:p.Asp633His	34	0		41	6	NM_012301	0	0	0	0	0	A4D1C1|A7E2C3|O60434|O60510|Q86UI7|Q9NP44|Q9UDQ5|Q9UDU1	Missense_Mutation	SNP	ENST00000354212.4	37	CCDS5594.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.198609	0.79015	.	.	ENSG00000187391	ENST00000419488;ENST00000354212;ENST00000536298;ENST00000522391;ENST00000536571;ENST00000535697	T;T;T;T;T	0.26810	1.71;1.71;1.71;1.71;1.71	5.74	5.74	0.90152	PDZ/DHR/GLGF (4);	0.000000	0.38381	U	0.001709	T	0.58133	0.2101	M	0.85710	2.77	0.80722	D	1	D;D;D;D;D;D	0.89917	0.999;0.961;0.987;0.987;1.0;0.998	D;D;D;D;D;D	0.76575	0.979;0.94;0.93;0.93;0.988;0.944	T	0.63152	-0.6701	10	0.87932	D	0	.	18.9145	0.92499	0.0:1.0:0.0:0.0	.	470;465;633;633;633;633	F5GWH1;F5GWK7;B7Z4H4;E7EWI0;Q86UL8-2;Q86UL8	.;.;.;.;.;MAGI2_HUMAN	H	633;633;633;633;465;470	ENSP00000405766:D633H;ENSP00000346151:D633H;ENSP00000428389:D633H;ENSP00000441584:D465H;ENSP00000441603:D470H	ENSP00000346151:D633H	D	-	1	0	MAGI2	77723346	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.550000	0.82173	2.700000	0.92200	0.561000	0.74099	GAC	.		0.488	MAGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253197.3	NM_012301	
COL1A2	1278	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	94035021	94035021	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr7:94035021G>A	ENST00000297268.6	+	11	994	c.523G>A	c.(523-525)Ggc>Agc	p.G175S		NM_000089.3	NP_000080.2	P08123	CO1A2_HUMAN	collagen, type I, alpha 2	175					blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|odontogenesis (GO:0042476)|platelet activation (GO:0030168)|protein heterotrimerization (GO:0070208)|regulation of blood pressure (GO:0008217)|Rho protein signal transduction (GO:0007266)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|transforming growth factor beta receptor signaling pathway (GO:0007179)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|protein binding, bridging (GO:0030674)		COL1A2/PLAG1(3)	NS(2)|breast(2)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(21)|lung(51)|ovary(2)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	115	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	TGGACTTCCTGGCTTCAAAGG	0.373										HNSCC(75;0.22)																											p.G175S		.											.	COL1A2-521	0			c.G523A						.						158.0	155.0	156.0					7																	94035021		2203	4299	6502	SO:0001583	missense	1278	exon11			CTTCCTGGCTTCA	Z74616	CCDS34682.1	7q21.3	2014-09-17	2002-02-13		ENSG00000164692	ENSG00000164692		"""Collagens"""	2198	protein-coding gene	gene with protein product	"""alpha 2(I)-collagen"", ""alpha-2 collagen type I"", ""type I procollagen"", ""collagen I, alpha-2 polypeptide"", ""collagen of skin, tendon and bone, alpha-2 chain"""	120160	"""osteogenesis imperfecta type IV"""	OI4		3857213, 2897363	Standard	NM_000089		Approved		uc003ung.1	P08123	OTTHUMG00000148675	ENST00000297268.6:c.523G>A	7.37:g.94035021G>A	ENSP00000297268:p.Gly175Ser	204	0		264	56	NM_000089	0	0	50	50	0	P02464|Q13897|Q13997|Q13998|Q14038|Q14057|Q15177|Q15947|Q16480|Q16511|Q7Z5S6|Q9UEB6|Q9UEF9|Q9UM83|Q9UMI1|Q9UML5|Q9UMM6|Q9UPH0	Missense_Mutation	SNP	ENST00000297268.6	37	CCDS34682.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.343237	0.82022	.	.	ENSG00000164692	ENST00000297268;ENST00000545487	D	0.93659	-3.26	4.99	4.99	0.66335	.	0.000000	0.85682	D	0.000000	D	0.98330	0.9446	H	0.98833	4.345	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99501	1.0953	10	0.87932	D	0	.	19.1584	0.93520	0.0:0.0:1.0:0.0	.	175	P08123	CO1A2_HUMAN	S	175;176	ENSP00000297268:G175S	ENSP00000297268:G175S	G	+	1	0	COL1A2	93872957	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	9.420000	0.97426	2.697000	0.92050	0.591000	0.81541	GGC	.		0.373	COL1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309045.2	NM_000089	
TFR2	7036	broad.mit.edu	37	7	100239125	100239125	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr7:100239125C>T	ENST00000462107.1	-	2	295	c.8G>A	c.(7-9)cGg>cAg	p.R3Q	TFR2_ENST00000223051.3_Missense_Mutation_p.R3Q|TFR2_ENST00000431692.1_Missense_Mutation_p.R3Q			Q9UP52	TFR2_HUMAN	transferrin receptor 2	3					cellular iron ion homeostasis (GO:0006879)|iron ion transport (GO:0006826)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	transferrin receptor activity (GO:0004998)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(1)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	23	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)				Gallium nitrate(DB05260)	ACCCCAAAGCCGCTCCATGCT	0.587																																					p.R3Q													.	TFR2-92	0			c.G8A						.						83.0	73.0	76.0					7																	100239125		2203	4300	6503	SO:0001583	missense	7036	exon1			CAAAGCCGCTCCA	AF053356	CCDS34707.1	7q22	2003-01-27			ENSG00000106327	ENSG00000106327			11762	protein-coding gene	gene with protein product		604720				9799793, 12130528	Standard	NM_003227		Approved	HFE3, TFRC2	uc003uvv.1	Q9UP52	OTTHUMG00000159598	ENST00000462107.1:c.8G>A	7.37:g.100239125C>T	ENSP00000420525:p.Arg3Gln	47	0		40	5	NM_003227	0	0	0	0	0	A6NGM7|O75422|Q1HE13|Q9HA99|Q9NX67	Missense_Mutation	SNP	ENST00000462107.1	37	CCDS34707.1	.	.	.	.	.	.	.	.	.	.	C	12.68	2.010438	0.35511	.	.	ENSG00000106327	ENST00000223051;ENST00000431692;ENST00000462107	T;T;T	0.56444	0.55;0.46;0.55	4.63	-1.77	0.07982	.	0.842939	0.09703	N	0.766751	T	0.25606	0.0623	N	0.12182	0.205	0.22710	N	0.998822	B	0.13145	0.007	B	0.04013	0.001	T	0.22661	-1.0210	10	0.09338	T	0.73	-4.8853	5.2345	0.15439	0.0:0.3478:0.167:0.4852	.	3	Q9UP52	TFR2_HUMAN	Q	3	ENSP00000223051:R3Q;ENSP00000413905:R3Q;ENSP00000420525:R3Q	ENSP00000223051:R3Q	R	-	2	0	TFR2	100077061	0.937000	0.31787	0.826000	0.32828	0.792000	0.44763	-0.050000	0.11904	-0.621000	0.05633	-0.327000	0.08410	CGG	.		0.587	TFR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356392.3	NM_003227	
TAS2R41	259287	broad.mit.edu;bcgsc.ca	37	7	143175820	143175820	+	Silent	SNP	C	C	T			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr7:143175820C>T	ENST00000408916.1	+	1	855	c.855C>T	c.(853-855)ttC>ttT	p.F285F	EPHA1-AS1_ENST00000429289.1_RNA	NM_176883.2	NP_795364.2	P59536	T2R41_HUMAN	taste receptor, type 2, member 41	285					sensory perception of taste (GO:0050909)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.F285F(1)		endometrium(2)|large_intestine(2)|lung(10)|pancreas(1)|prostate(2)|skin(1)	18	Melanoma(164;0.15)					TCCTCATCTTCAGCAACCTCA	0.502																																					p.F285F													.	TAS2R41-92	1	Substitution - coding silent(1)	lung(1)	c.C855T						.						135.0	124.0	128.0					7																	143175820		2068	4201	6269	SO:0001819	synonymous_variant	259287	exon1			CATCTTCAGCAAC	AF494232	CCDS43663.1	7q34	2012-08-22			ENSG00000221855	ENSG00000221855		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18883	protein-coding gene	gene with protein product		613965				12379855	Standard	NM_176883		Approved	T2R59	uc003wdc.1	P59536	OTTHUMG00000155892	ENST00000408916.1:c.855C>T	7.37:g.143175820C>T		95	0		85	14	NM_176883	0	0	0	0	0	P59550|Q495I2|Q50KJ5|Q50KJ6|Q50KJ7|Q645W7	Silent	SNP	ENST00000408916.1	37	CCDS43663.1																																																																																			.		0.502	TAS2R41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342149.1		
ATG9B	285973	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	150720230	150720230	+	Silent	SNP	G	G	A			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr7:150720230G>A	ENST00000377974.2	-	4	798	c.723C>T	c.(721-723)ctC>ctT	p.L241L	ATG9B_ENST00000494791.1_5'UTR|ATG9B_ENST00000605938.1_Silent_p.L241L|ATG9B_ENST00000444312.1_5'UTR|ATG9B_ENST00000605952.1_Silent_p.L241L			Q674R7	ATG9B_HUMAN	autophagy related 9B	241					autophagic vacuole assembly (GO:0000045)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(1)|ovary(4)|prostate(1)	14	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GGTTGGCAAAGAGAACATTGT	0.532																																					.													.	ATG9B-91	0			.						.						266.0	270.0	269.0					7																	150720230		2036	4201	6237	SO:0001819	synonymous_variant	285973	.			GGCAAAGAGAACA	AK027791		7q36	2014-02-12	2012-06-06	2005-09-11	ENSG00000181652	ENSG00000181652			21899	protein-coding gene	gene with protein product		612205	"""nitric oxide synthase 3 antisense"", ""ATG9 autophagy related 9 homolog B (S. cerevisiae)"""	NOS3AS		15234981, 15755735	Standard	NM_173681		Approved	FLJ14885, APG9L2, SONE	uc011kvc.2	Q674R7	OTTHUMG00000158634	ENST00000377974.2:c.723C>T	7.37:g.150720230G>A		369	0		349	66	.	0	0	5	5	0	A1A5D3|Q6JRW5|Q8N8I8	Silent	SNP	ENST00000377974.2	37																																																																																				.		0.532	ATG9B-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_173681	
RP1L1	94137	hgsc.bcm.edu;broad.mit.edu	37	8	10468873	10468873	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr8:10468873C>T	ENST00000382483.3	-	4	2958	c.2735G>A	c.(2734-2736)aGt>aAt	p.S912N		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	912					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		CTGGCTGGCACTGCTTCTCCT	0.716																																					p.S912N		.											.	RP1L1-139	0			c.G2735A						.						12.0	16.0	15.0					8																	10468873		1930	4102	6032	SO:0001583	missense	94137	exon4			CTGGCACTGCTTC	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.2735G>A	8.37:g.10468873C>T	ENSP00000371923:p.Ser912Asn	36	0		17	5	NM_178857	0	0	0	0	0	Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	ENST00000382483.3	37	CCDS43708.1	.	.	.	.	.	.	.	.	.	.	C	6.313	0.425815	0.11987	.	.	ENSG00000183638	ENST00000382483	T	0.04156	3.69	4.6	2.64	0.31445	.	.	.	.	.	T	0.02970	0.0088	N	0.08118	0	0.09310	N	1	P	0.49961	0.93	P	0.44860	0.462	T	0.42949	-0.9421	9	0.38643	T	0.18	0.111	4.4393	0.11566	0.1583:0.6002:0.1536:0.0879	.	912	A6NKC6	.	N	912	ENSP00000371923:S912N	ENSP00000371923:S912N	S	-	2	0	RP1L1	10506283	0.001000	0.12720	0.001000	0.08648	0.060000	0.15804	1.033000	0.30191	1.107000	0.41642	0.313000	0.20887	AGT	.		0.716	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1		
PCM1	5108	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	17885162	17885162	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr8:17885162G>C	ENST00000519253.1	+	39	6293	c.6042G>C	c.(6040-6042)caG>caC	p.Q2014H	PCM1_ENST00000524226.1_Missense_Mutation_p.Q1858H|PCM1_ENST00000327578.8_Missense_Mutation_p.Q721H|PCM1_ENST00000325083.8_Missense_Mutation_p.Q2022H			Q15154	PCM1_HUMAN	pericentriolar material 1	2022	Interaction with BBS4.				centrosome organization (GO:0051297)|cilium assembly (GO:0042384)|cytoplasmic microtubule organization (GO:0031122)|G2/M transition of mitotic cell cycle (GO:0000086)|interkinetic nuclear migration (GO:0022027)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|microtubule anchoring (GO:0034453)|microtubule anchoring at centrosome (GO:0034454)|mitotic cell cycle (GO:0000278)|negative regulation of neurogenesis (GO:0050768)|neuronal stem cell maintenance (GO:0097150)|positive regulation of intracellular protein transport (GO:0090316)|protein localization to centrosome (GO:0071539)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|pericentriolar material (GO:0000242)|protein complex (GO:0043234)	identical protein binding (GO:0042802)		PCM1/JAK2(30)	breast(4)|endometrium(8)|kidney(5)|large_intestine(16)|lung(11)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	48				Colorectal(111;0.0789)		TGGGAGCCCAGAGTATATGAG	0.303			T	"""RET, JAK2"""	"""papillary thyroid, CML, MPD"""																																p.Q2022H		.		Dom	yes		8	8p22-p21.3	5108	pericentriolar material 1  (PTC4)		"""E, L"""	.	PCM1-742	0			c.G6066C						.						52.0	51.0	51.0					8																	17885162		1794	4062	5856	SO:0001583	missense	5108	exon39			AGCCCAGAGTATA		CCDS47812.1	8p22-p21.3	2008-08-08			ENSG00000078674	ENSG00000078674			8727	protein-coding gene	gene with protein product		600299				8120099, 15659651	Standard	NM_006197		Approved	PTC4	uc003wyi.4	Q15154	OTTHUMG00000163699	ENST00000519253.1:c.6042G>C	8.37:g.17885162G>C	ENSP00000431099:p.Gln2014His	63	0		62	10	NM_006197	0	0	15	22	7	Q58F13|Q6P1K7|Q8NB85|Q9BWC1|Q9H4A2	Missense_Mutation	SNP	ENST00000519253.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.24|10.24	1.296731|1.296731	0.23650|0.23650	.|.	.|.	ENSG00000078674|ENSG00000078674	ENST00000325083;ENST00000519253;ENST00000524226;ENST00000327578|ENST00000522275	T;T;T;T|.	0.22945|.	3.3;3.3;3.0;1.93|.	5.51|5.51	-6.77|-6.77	0.01727|0.01727	.|.	0.261946|.	0.40302|.	N|.	0.001133|.	T|T	0.25195|0.25195	0.0612|0.0612	N|N	0.20986|0.20986	0.625|0.625	0.29276|0.29276	N|N	0.870346|0.870346	B;B;B;B;B;B;B|.	0.06786|.	0.001;0.001;0.001;0.001;0.001;0.001;0.001|.	B;B;B;B;B;B;B|.	0.08055|.	0.003;0.003;0.003;0.003;0.003;0.003;0.003|.	T|T	0.35101|0.35101	-0.9802|-0.9802	10|5	0.87932|.	D|.	0|.	-2.5298|-2.5298	8.8371|8.8371	0.35119|0.35119	0.2748:0.2274:0.4978:0.0|0.2748:0.2274:0.4978:0.0	.|.	2014;2022;821;2014;1967;1858;2022|.	B9EIS5;D3DSQ0;B4DJ00;E7ETA6;Q15154-2;E7EV56;Q15154|.	.;.;.;.;.;.;PCM1_HUMAN|.	H|T	2022;2014;1858;721|762	ENSP00000327077:Q2022H;ENSP00000431099:Q2014H;ENSP00000430521:Q1858H;ENSP00000328332:Q721H|.	ENSP00000327077:Q2022H|.	Q|R	+|+	3|2	2|0	PCM1|PCM1	17929442|17929442	0.944000|0.944000	0.32072|0.32072	0.012000|0.012000	0.15200|0.15200	0.629000|0.629000	0.37895|0.37895	-0.012000|-0.012000	0.12699|0.12699	-1.249000|-1.249000	0.02500|0.02500	-0.302000|-0.302000	0.09304|0.09304	CAG|AGA	.		0.303	PCM1-003	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000374800.1	NM_006197	
EBF2	64641	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	25890622	25890622	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr8:25890622G>C	ENST00000520164.1	-	6	1067	c.530C>G	c.(529-531)tCg>tGg	p.S177W	EBF2_ENST00000408929.3_Missense_Mutation_p.S29W	NM_022659.3	NP_073150.2	Q9HAK2	COE2_HUMAN	early B-cell factor 2	177					adipose tissue development (GO:0060612)|brown fat cell differentiation (GO:0050873)|cell fate determination (GO:0001709)|positive regulation of chromatin binding (GO:0035563)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|large_intestine(3)|lung(22)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	39		all_cancers(63;0.0989)|Ovarian(32;2.74e-05)|all_epithelial(46;0.0608)|Prostate(55;0.0845)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0277)|Epithelial(17;3.29e-10)|Colorectal(74;0.00383)|COAD - Colon adenocarcinoma(73;0.00738)		GACTGGGTCCGATGGAGTCTC	0.388																																					p.S177W	Esophageal Squamous(166;1018 1046 3854 8328 13429 13634 14071 26624 32918)	.											.	EBF2-26	0			c.C530G						.						139.0	138.0	138.0					8																	25890622		1949	4188	6137	SO:0001583	missense	64641	exon6			GGGTCCGATGGAG	AK021562, AK001144	CCDS43726.1	8p21.1	2007-07-26			ENSG00000221818	ENSG00000221818			19090	protein-coding gene	gene with protein product		609934				9151732	Standard	NM_022659		Approved	FLJ11500, COE2	uc003xes.2	Q9HAK2	OTTHUMG00000163838	ENST00000520164.1:c.530C>G	8.37:g.25890622G>C	ENSP00000430241:p.Ser177Trp	144	0		155	20	NM_022659	0	0	0	0	0	A0PJM4|A6NMF7|F5H645|Q66VZ3|Q6DK36|Q6IS86|Q6ISA4	Missense_Mutation	SNP	ENST00000520164.1	37	CCDS43726.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.281973	0.80692	.	.	ENSG00000221818	ENST00000520164;ENST00000408929	T;T	0.57273	0.47;0.41	6.17	5.27	0.74061	.	0.000000	0.64402	U	0.000001	T	0.76234	0.3959	M	0.84948	2.725	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.79232	-0.1888	10	0.87932	D	0	-4.121	17.6654	0.88201	0.0:0.1224:0.8776:0.0	.	177	Q9HAK2	COE2_HUMAN	W	177;29	ENSP00000430241:S177W;ENSP00000386178:S29W	ENSP00000386178:S29W	S	-	2	0	EBF2	25946539	1.000000	0.71417	0.917000	0.36280	0.772000	0.43724	7.624000	0.83124	2.941000	0.99782	0.655000	0.94253	TCG	.		0.388	EBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375886.2	NM_022659	
MATN2	4147	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	99019720	99019720	+	Silent	SNP	C	C	T			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr8:99019720C>T	ENST00000520016.1	+	9	1588	c.1464C>T	c.(1462-1464)tgC>tgT	p.C488C	MATN2_ENST00000254898.5_Silent_p.C488C|MATN2_ENST00000521689.1_Silent_p.C488C|MATN2_ENST00000522025.2_Silent_p.C204C|MATN2_ENST00000524308.1_Silent_p.C447C			O00339	MATN2_HUMAN	matrilin 2	488	EGF-like 7. {ECO:0000255|PROSITE- ProRule:PRU00076}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(17)|ovary(2)|urinary_tract(1)	31	Breast(36;1.43e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.244)			TGGATTACTGCCTGCTGAGTG	0.547																																					p.C488C		.											.	MATN2-24	0			c.C1464T						.						131.0	130.0	131.0					8																	99019720		2069	4211	6280	SO:0001819	synonymous_variant	4147	exon10			TTACTGCCTGCTG	U69263	CCDS55264.1, CCDS55265.1	8q22.1-q22.2	2008-05-15							6908	protein-coding gene	gene with protein product		602108				9083061, 11852232	Standard	XM_005250920		Approved		uc003yic.3	O00339		ENST00000520016.1:c.1464C>T	8.37:g.99019720C>T		85	0		72	30	NM_002380	0	0	0	0	0	A8K106|E7EW74|E9PD48|E9PGL2|Q6UWA5|Q7Z5X1|Q8NDE6|Q96FT5|Q9NSZ1	Silent	SNP	ENST00000520016.1	37	CCDS55264.1	.	.	.	.	.	.	.	.	.	.	C	9.120	1.008646	0.19199	.	.	ENSG00000132561	ENST00000518154	.	.	.	5.65	4.77	0.60923	.	.	.	.	.	T	0.63827	0.2544	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.62407	-0.6861	4	.	.	.	-23.2752	12.1976	0.54307	0.0:0.9189:0.0:0.0811	.	.	.	.	S	271	.	.	P	+	1	0	MATN2	99088896	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	1.602000	0.36783	1.393000	0.46605	0.655000	0.94253	CCT	.		0.547	MATN2-004	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000380332.1		
TG	7038	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	133945814	133945814	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr8:133945814G>A	ENST00000220616.4	+	24	4865	c.4825G>A	c.(4825-4827)Gag>Aag	p.E1609K	TG_ENST00000542445.1_Missense_Mutation_p.E43K|TG_ENST00000377869.1_Missense_Mutation_p.E1552K	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	1609					hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		AGATTGCACAGAGGACGAGGC	0.582																																					p.E1609K		.											.	TG-145	0			c.G4825A						.						237.0	176.0	197.0					8																	133945814		2203	4300	6503	SO:0001583	missense	7038	exon24			TGCACAGAGGACG	AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.4825G>A	8.37:g.133945814G>A	ENSP00000220616:p.Glu1609Lys	138	0		113	12	NM_003235	0	0	0	0	0	O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Missense_Mutation	SNP	ENST00000220616.4	37	CCDS34944.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.015|0.015	-1.564449|-1.564449	0.00903|0.00903	.|.	.|.	ENSG00000042832|ENSG00000042832	ENST00000377869;ENST00000543313;ENST00000220616;ENST00000542445|ENST00000519178	T;T;T|.	0.63417|.	-0.04;-0.04;-0.04|.	5.3|5.3	-6.81|-6.81	0.01704|0.01704	.|.	2.263600|.	0.01555|.	N|.	0.019854|.	T|T	0.14056|0.14056	0.0340|0.0340	N|N	0.14661|0.14661	0.345|0.345	0.09310|0.09310	N|N	1|1	B;B|.	0.06786|.	0.001;0.001|.	B;B|.	0.04013|.	0.001;0.001|.	T|T	0.24764|0.24764	-1.0151|-1.0151	10|5	0.06099|.	T|.	0.92|.	.|.	1.784|1.784	0.03038|0.03038	0.3015:0.2787:0.305:0.1148|0.3015:0.2787:0.305:0.1148	.|.	43;1609|.	F5GWW5;P01266|.	.;THYG_HUMAN|.	K|K	1552;415;1609;43|128	ENSP00000367100:E1552K;ENSP00000220616:E1609K;ENSP00000441693:E43K|.	ENSP00000220616:E1609K|.	E|R	+|+	1|2	0|0	TG|TG	134014996|134014996	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.002000|0.002000	0.02628|0.02628	-0.841000|-0.841000	0.04359|0.04359	-0.900000|-0.900000	0.03896|0.03896	-0.154000|-0.154000	0.13518|0.13518	GAG|AGA	.		0.582	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379606.1	NM_003235	
BAI1	575	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	143603450	143603450	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr8:143603450G>A	ENST00000517894.1	+	21	4043	c.3149G>A	c.(3148-3150)cGc>cAc	p.R1050H	BAI1_ENST00000323289.5_Missense_Mutation_p.R1050H			O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	1050					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(28)|ovary(4)|pancreas(1)|prostate(7)	57	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					CGCCTCATCCGCAAGCGCTTC	0.652																																					p.R1050H		.											.	BAI1-1129	0			c.G3149A						.						30.0	40.0	37.0					8																	143603450		2200	4299	6499	SO:0001583	missense	575	exon20			TCATCCGCAAGCG	AB005297	CCDS64985.1	8q24.3	2014-08-08			ENSG00000181790	ENSG00000181790		"""-"", ""GPCR / Class B : Orphans"""	943	protein-coding gene	gene with protein product		602682				9533023	Standard	NM_001702		Approved		uc003ywm.3	O14514	OTTHUMG00000164732	ENST00000517894.1:c.3149G>A	8.37:g.143603450G>A	ENSP00000430945:p.Arg1050His	54	0		78	30	NM_001702	0	0	0	0	0		Missense_Mutation	SNP	ENST00000517894.1	37		.	.	.	.	.	.	.	.	.	.	G	28.6	4.933063	0.92458	.	.	ENSG00000181790	ENST00000517894;ENST00000323289	T;T	0.39787	1.06;1.06	3.78	3.78	0.43462	.	0.156800	0.43110	U	0.000612	T	0.51024	0.1650	L	0.46947	1.48	0.58432	D	0.999997	D	0.60160	0.987	P	0.56648	0.803	T	0.57493	-0.7802	10	0.87932	D	0	.	14.6053	0.68475	0.0:0.0:1.0:0.0	.	1050	E9PBK0	.	H	1050	ENSP00000430945:R1050H;ENSP00000313046:R1050H	ENSP00000313046:R1050H	R	+	2	0	BAI1	143600452	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	7.618000	0.83043	1.641000	0.50575	0.305000	0.20034	CGC	.		0.652	BAI1-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000379963.3	NM_001702	
FRMPD1	22844	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	37729833	37729833	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr9:37729833G>A	ENST00000539465.1	+	8	1314	c.721G>A	c.(721-723)Gag>Aag	p.E241K	FRMPD1_ENST00000377765.3_Missense_Mutation_p.E241K|FRMPD1_ENST00000541302.1_Missense_Mutation_p.E110K|FRMPD1_ENST00000536622.1_Missense_Mutation_p.E63K|RP11-613M10.9_ENST00000540557.1_Intron			Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	241	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				NS(3)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(34)|ovary(5)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	93				GBM - Glioblastoma multiforme(29;0.00655)		GCTGCACGAAGAGGAACTCAT	0.602																																					p.E241K		.											.	FRMPD1-159	0			c.G721A						.						93.0	75.0	81.0					9																	37729833		2203	4300	6503	SO:0001583	missense	22844	exon8			CACGAAGAGGAAC	AB023184	CCDS6612.1	9p13.1	2008-02-05			ENSG00000070601	ENSG00000070601			29159	protein-coding gene	gene with protein product						10231032	Standard	NM_014907		Approved	KIAA0967, FRMD2	uc004aag.1	Q5SYB0	OTTHUMG00000019927	ENST00000539465.1:c.721G>A	9.37:g.37729833G>A	ENSP00000444411:p.Glu241Lys	102	2		44	34	NM_014907	0	0	0	0	0	B4DZC8|B7Z807|D3DRQ3|Q14C73|Q5HY96|Q9Y2H3	Missense_Mutation	SNP	ENST00000539465.1	37	CCDS6612.1	.	.	.	.	.	.	.	.	.	.	G	29.6	5.020484	0.93462	.	.	ENSG00000070601	ENST00000377765;ENST00000539465;ENST00000536622;ENST00000541302	D;D;D;D	0.85955	-2.05;-2.05;-2.05;-2.05	5.64	5.64	0.86602	FERM, N-terminal (1);Band 4.1 domain (1);FERM domain (1);	0.105447	0.64402	D	0.000005	D	0.88973	0.6583	L	0.39898	1.24	0.80722	D	1	D;D	0.71674	0.982;0.998	P;D	0.71870	0.871;0.975	D	0.88259	0.2922	10	0.44086	T	0.13	-21.3858	17.1917	0.86881	0.0:0.0:1.0:0.0	.	110;241	B4DZC8;Q5SYB0	.;FRPD1_HUMAN	K	241;241;63;110	ENSP00000366995:E241K;ENSP00000444411:E241K;ENSP00000437762:E63K;ENSP00000444804:E110K	ENSP00000366995:E241K	E	+	1	0	FRMPD1	37719833	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	9.301000	0.96167	2.666000	0.90696	0.655000	0.94253	GAG	.		0.602	FRMPD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402969.1	NM_014907	
TRPM3	80036	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	73151243	73151243	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr9:73151243G>C	ENST00000377110.3	-	25	4993	c.4750C>G	c.(4750-4752)Cca>Gca	p.P1584A	TRPM3_ENST00000377111.2_Intron|TRPM3_ENST00000396292.4_Missense_Mutation_p.P1456A|TRPM3_ENST00000358082.3_Missense_Mutation_p.P1446A|TRPM3_ENST00000360823.2_Missense_Mutation_p.P1446A|TRPM3_ENST00000408909.2_Missense_Mutation_p.P1443A|TRPM3_ENST00000377105.1_Missense_Mutation_p.P1443A|TRPM3_ENST00000357533.2_Missense_Mutation_p.P1588A|TRPM3_ENST00000396280.5_Missense_Mutation_p.P1433A|TRPM3_ENST00000423814.3_Missense_Mutation_p.P1611A|TRPM3_ENST00000396285.1_Missense_Mutation_p.P1443A|TRPM3_ENST00000377106.1_Missense_Mutation_p.P1456A			Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3	1609					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						TCTCGCTCTGGATGGCAGCAA	0.542																																					p.P1584A		.											.	TRPM3-521	0			c.C4750G						.						128.0	119.0	122.0					9																	73151243		2203	4300	6503	SO:0001583	missense	80036	exon25			GCTCTGGATGGCA	AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000377110.3:c.4750C>G	9.37:g.73151243G>C	ENSP00000366314:p.Pro1584Ala	189	2		91	65	NM_001007471	0	0	0	0	0	A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Missense_Mutation	SNP	ENST00000377110.3	37	CCDS43835.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.42|13.42	2.233192|2.233192	0.39498|0.39498	.|.	.|.	ENSG00000083067|ENSG00000083067	ENST00000377110;ENST00000377106;ENST00000360823;ENST00000377105;ENST00000357533;ENST00000408909;ENST00000396285;ENST00000396292;ENST00000358082;ENST00000423814|ENST00000396280	T;T;T;T;T;T;T;T;T;T|.	0.57107|.	0.54;0.45;0.44;0.43;0.54;0.43;0.42;0.45;0.44;0.54|.	5.87|5.87	5.87|5.87	0.94306|0.94306	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.61236|0.61236	0.2331|0.2331	L|L	0.32530|0.32530	0.975|0.975	0.58432|0.58432	D|D	0.999999|0.999999	D;B;D;D;D;D;D|.	0.76494|.	0.999;0.311;0.999;0.999;0.999;0.999;0.999|.	D;B;D;D;D;D;D|.	0.83275|.	0.996;0.147;0.991;0.991;0.996;0.996;0.991|.	T|T	0.52909|0.52909	-0.8512|-0.8512	10|5	0.10636|.	T|.	0.68|.	-14.3964|-14.3964	20.2181|20.2181	0.98305|0.98305	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1584;1574;1588;1446;1443;1556;1443|.	Q9HCF6-2;Q9HCF6-4;A2A3F7;A2A3F4;G5E9G1;Q9HCF6-8;A2A3F3|.	.;.;.;.;.;.;.|.	A|C	1584;1456;1446;1443;1588;1443;1443;1456;1446;1611|1432	ENSP00000366314:P1584A;ENSP00000366310:P1456A;ENSP00000354066:P1446A;ENSP00000366309:P1443A;ENSP00000350140:P1588A;ENSP00000386127:P1443A;ENSP00000379581:P1443A;ENSP00000379587:P1456A;ENSP00000350791:P1446A;ENSP00000389542:P1611A|.	ENSP00000350140:P1588A|.	P|S	-|-	1|2	0|0	TRPM3|TRPM3	72341063|72341063	1.000000|1.000000	0.71417|0.71417	0.970000|0.970000	0.41538|0.41538	0.972000|0.972000	0.66771|0.66771	9.230000|9.230000	0.95299|0.95299	2.785000|2.785000	0.95823|0.95823	0.655000|0.655000	0.94253|0.94253	CCA|TCC	.		0.542	TRPM3-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214158.3	NM_206945	
C5	727	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	123783919	123783919	+	Silent	SNP	C	C	G			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr9:123783919C>G	ENST00000223642.1	-	11	1199	c.1170G>C	c.(1168-1170)ctG>ctC	p.L390L		NM_001735.2	NP_001726.2	P01031	CO5_HUMAN	complement component 5	390					activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cell surface receptor signaling pathway (GO:0007166)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|in utero embryonic development (GO:0001701)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|leukocyte migration involved in inflammatory response (GO:0002523)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of macrophage chemotaxis (GO:0010760)|negative regulation of norepinephrine secretion (GO:0010700)|positive regulation of angiogenesis (GO:0045766)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of chemotaxis (GO:0050921)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|response to stress (GO:0006950)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)	chemokine activity (GO:0008009)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(14)|lung(5)|ovary(2)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	46				OV - Ovarian serous cystadenocarcinoma(323;4.98e-53)|GBM - Glioblastoma multiforme(294;0.0242)	Eculizumab(DB01257)|Intravenous Immunoglobulin(DB00028)	TTTGTGCATTCAGTGTTACTG	0.403																																					p.L390L		.											.	C5-92	0			c.G1170C						.						201.0	182.0	188.0					9																	123783919		2203	4300	6503	SO:0001819	synonymous_variant	727	exon11			TGCATTCAGTGTT	M57729	CCDS6826.1	9q33-q34	2014-09-17			ENSG00000106804	ENSG00000106804		"""Complement system"", ""Endogenous ligands"""	1331	protein-coding gene	gene with protein product	"""prepro-C5"", ""C5a anaphylatoxin"""	120900					Standard	NM_001735		Approved	CPAMD4, C5a, C5b	uc004bkv.3	P01031	OTTHUMG00000020579	ENST00000223642.1:c.1170G>C	9.37:g.123783919C>G		141	0		61	6	NM_001735	0	0	0	0	0	Q14CJ0|Q27I61	Silent	SNP	ENST00000223642.1	37	CCDS6826.1																																																																																			.		0.403	C5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053844.1	NM_001735	
DDX31	64794	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	135545615	135545615	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr9:135545615G>C	ENST00000372159.3	-	1	173	c.22C>G	c.(22-24)Cag>Gag	p.Q8E	DDX31_ENST00000544003.1_5'Flank|GTF3C4_ENST00000372146.4_5'UTR|GTF3C4_ENST00000483873.2_5'UTR|DDX31_ENST00000372153.1_Missense_Mutation_p.Q8E|DDX31_ENST00000480876.1_5'UTR|DDX31_ENST00000310532.2_Missense_Mutation_p.Q8E	NM_022779.7	NP_073616.6	Q9H8H2	DDX31_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 31	8						nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(4)|lung(10)|prostate(1)|skin(1)|urinary_tract(1)	27				OV - Ovarian serous cystadenocarcinoma(145;2.67e-06)|Epithelial(140;7.61e-05)		GAATGCCTCTGAGAAGCGAGA	0.622																																					p.Q8E		.											.	DDX31-226	0			c.C22G						.						24.0	22.0	23.0					9																	135545615		2163	4206	6369	SO:0001583	missense	64794	exon1			GCCTCTGAGAAGC	AF427339	CCDS6951.1, CCDS6952.1	9q34.2	2012-04-17	2003-06-13		ENSG00000125485	ENSG00000125485		"""DEAD-boxes"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	16715	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 25"""		"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 31"""				Standard	NM_022779		Approved	FLJ13633, FLJ23349, FLJ14578, PPP1R25	uc004cbq.1	Q9H8H2	OTTHUMG00000020843	ENST00000372159.3:c.22C>G	9.37:g.135545615G>C	ENSP00000361232:p.Gln8Glu	47	1		24	17	NM_022779	0	0	1	1	0	Q5K6N2|Q5K6N3|Q5K6N4|Q5VZJ4|Q5VZJ9|Q96E91|Q96NY2|Q96SX5|Q9H5K6	Missense_Mutation	SNP	ENST00000372159.3	37	CCDS6951.1	.	.	.	.	.	.	.	.	.	.	G	11.25	1.582024	0.28180	.	.	ENSG00000125485	ENST00000372159;ENST00000372155;ENST00000372153;ENST00000310532	T;T;T	0.05199	4.34;3.88;3.48	3.16	-1.78	0.07957	.	.	.	.	.	T	0.03220	0.0094	N	0.14661	0.345	0.20638	N	0.999874	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.001;0.0	T	0.43637	-0.9379	9	0.34782	T	0.22	.	3.7708	0.08640	0.2994:0.3994:0.3012:0.0	.	8;8;8	Q9H8H2-2;Q9H8H2-3;Q9H8H2	.;.;DDX31_HUMAN	E	8	ENSP00000361232:Q8E;ENSP00000361226:Q8E;ENSP00000310539:Q8E	ENSP00000310539:Q8E	Q	-	1	0	DDX31	134535436	0.000000	0.05858	0.000000	0.03702	0.045000	0.14185	0.320000	0.19540	-0.347000	0.08299	0.462000	0.41574	CAG	.		0.622	DDX31-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054794.1	NM_138620	
SOHLH1	402381	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	138594186	138594186	+	5'Flank	SNP	G	G	C			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr9:138594186G>C	ENST00000298466.5	-	0	0				KCNT1_ENST00000298480.5_Missense_Mutation_p.E28Q|SOHLH1_ENST00000425225.1_5'Flank|KCNT1_ENST00000487664.1_Missense_Mutation_p.E28Q|KCNT1_ENST00000371757.2_Missense_Mutation_p.E28Q	NM_001012415.2	NP_001012415	Q5JUK2	SOLH1_HUMAN	spermatogenesis and oogenesis specific basic helix-loop-helix 1						oogenesis (GO:0048477)|ovarian follicle development (GO:0001541)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(1)|lung(5)|prostate(1)	12		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.66e-07)|Epithelial(140;1.11e-06)|all cancers(34;6.45e-05)		CCGGACCTTCGAGTTTGACGA	0.726																																					p.E28Q		.											.	KCNT1-137	0			c.G82C						.						22.0	27.0	25.0					9																	138594186		2200	4297	6497	SO:0001631	upstream_gene_variant	57582	exon1			ACCTTCGAGTTTG	BC031861	CCDS35174.1, CCDS48054.1	9q34.3	2013-05-21	2006-03-16	2006-03-16	ENSG00000165643	ENSG00000165643		"""Basic helix-loop-helix proteins"""	27845	protein-coding gene	gene with protein product	"""spermatogenesis associated 27"""	610224	"""chromosome 9 open reading frame 157"""	C9orf157		12477932	Standard	NM_001012415		Approved	NOHLH, TEB2, bA100C15.3, bHLHe80, SPATA27	uc010nbe.3	Q5JUK2	OTTHUMG00000020915		9.37:g.138594186G>C	Exception_encountered	61	0		19	9	NM_001272003	0	0	0	0	0	C9JG81|Q5EE14|Q5EGC2|Q8NEE3	Missense_Mutation	SNP	ENST00000298466.5	37	CCDS35174.1	.	.	.	.	.	.	.	.	.	.	G	10.15	1.270987	0.23221	.	.	ENSG00000107147	ENST00000487664;ENST00000298480;ENST00000371757	T;T;T	0.22336	1.98;1.96;1.96	2.17	2.17	0.27698	.	.	.	.	.	T	0.08582	0.0213	N	0.08118	0	0.80722	D	1	B;P	0.34757	0.315;0.467	B;B	0.26517	0.049;0.07	T	0.21861	-1.0233	9	0.41790	T	0.15	.	7.9137	0.29806	0.0:0.0:1.0:0.0	.	28;28	B9EGP2;G5E9V0	.;.	Q	28	ENSP00000417851:E28Q;ENSP00000298480:E28Q;ENSP00000360822:E28Q	ENSP00000298480:E28Q	E	+	1	0	KCNT1	137734007	0.552000	0.26505	0.891000	0.34965	0.007000	0.05969	1.839000	0.39220	1.514000	0.48869	0.650000	0.86243	GAG	.		0.726	SOHLH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055018.2	NM_001012415	
CLIC3	9022	broad.mit.edu;bcgsc.ca	37	9	139890192	139890192	+	Missense_Mutation	SNP	C	C	G			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr9:139890192C>G	ENST00000494426.1	-	2	310	c.51G>C	c.(49-51)gaG>gaC	p.E17D	CLIC3_ENST00000480181.1_5'UTR	NM_004669.2	NP_004660.2	O95833	CLIC3_HUMAN	chloride intracellular channel 3	17	GST N-terminal.|Required for insertion into the membrane. {ECO:0000250}.				chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|signal transduction (GO:0007165)	chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			lung(1)|skin(1)	2	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		GACCCACGCTCTCCCCGTCCT	0.706																																					p.E17D													.	CLIC3-90	0			c.G51C						.						37.0	32.0	33.0					9																	139890192		2179	4283	6462	SO:0001583	missense	9022	exon2			CACGCTCTCCCCG	AF102166	CCDS7021.1	9q34.3	2012-09-26			ENSG00000169583	ENSG00000169583		"""Ion channels / Chloride channels : Intracellular"""	2064	protein-coding gene	gene with protein product		606533				9880541	Standard	NM_004669		Approved		uc004ckj.1	O95833	OTTHUMG00000020954	ENST00000494426.1:c.51G>C	9.37:g.139890192C>G	ENSP00000419378:p.Glu17Asp	17	0		7	4	NM_004669	0	0	66	91	25	Q5SPZ7	Missense_Mutation	SNP	ENST00000494426.1	37	CCDS7021.1	.	.	.	.	.	.	.	.	.	.	C	14.46	2.541433	0.45280	.	.	ENSG00000169583	ENST00000494426	T	0.25749	1.78	3.99	3.99	0.46301	Thioredoxin-like fold (2);	0.052675	0.64402	D	0.000001	T	0.29061	0.0722	M	0.63428	1.95	0.45676	D	0.998592	B	0.10296	0.003	B	0.06405	0.002	T	0.19484	-1.0304	10	0.66056	D	0.02	.	15.014	0.71570	0.0:1.0:0.0:0.0	.	17	O95833	CLIC3_HUMAN	D	17	ENSP00000419378:E17D	ENSP00000419378:E17D	E	-	3	2	CLIC3	139010013	0.995000	0.38212	1.000000	0.80357	0.969000	0.65631	0.393000	0.20817	2.045000	0.60652	0.561000	0.74099	GAG	.		0.706	CLIC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055173.2	NM_004669	
MAOB	4129	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	43655117	43655117	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chrX:43655117C>T	ENST00000378069.4	-	7	784	c.637G>A	c.(637-639)Gga>Aga	p.G213R	MAOB_ENST00000487544.1_5'Flank|MAOB_ENST00000536181.1_Missense_Mutation_p.G197R|MAOB_ENST00000538942.1_Missense_Mutation_p.G197R	NM_000898.4	NP_000889.3	P27338	AOFB_HUMAN	monoamine oxidase B	213					negative regulation of serotonin secretion (GO:0014063)|positive regulation of dopamine metabolic process (GO:0045964)|response to aluminum ion (GO:0010044)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)|xenobiotic metabolic process (GO:0006805)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial envelope (GO:0005740)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|primary amine oxidase activity (GO:0008131)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|prostate(2)|skin(5)	21					Amantadine(DB00915)|Amphetamine(DB00182)|Dopamine(DB00988)|Ephedra(DB01363)|Flavin adenine dinucleotide(DB03147)|Furazolidone(DB00614)|Isocarboxazid(DB01247)|Linezolid(DB00601)|Methamphetamine(DB01577)|Moclobemide(DB01171)|Nandrolone decanoate(DB08804)|Nicotine(DB00184)|Pargyline(DB01626)|Phenelzine(DB00780)|Phentermine(DB00191)|Procaine(DB00721)|Rasagiline(DB01367)|Selegiline(DB01037)|Sertraline(DB01104)|Tranylcypromine(DB00752)|Zonisamide(DB00909)	TGACCAGATCCGCCCACAAAT	0.458																																					p.G213R		.											.	MAOB-555	0			c.G637A						.						82.0	69.0	74.0					X																	43655117		2203	4300	6503	SO:0001583	missense	4129	exon7			CAGATCCGCCCAC		CCDS14261.1	Xp11.4-p11.3	2008-02-05			ENSG00000069535	ENSG00000069535	1.4.3.4		6834	protein-coding gene	gene with protein product		309860					Standard	NM_000898		Approved		uc004dfz.4	P27338	OTTHUMG00000021388	ENST00000378069.4:c.637G>A	X.37:g.43655117C>T	ENSP00000367309:p.Gly213Arg	138	0		125	46	NM_000898	0	0	0	4	4	B2R6R3|B7Z5H3|D3DWC3|Q7Z6S2	Missense_Mutation	SNP	ENST00000378069.4	37	CCDS14261.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.778441	0.90195	.	.	ENSG00000069535	ENST00000378069;ENST00000536181;ENST00000538942	T;T;T	0.25085	1.82;1.82;1.82	5.42	5.42	0.78866	Amine oxidase (1);	0.000000	0.85682	D	0.000000	T	0.67306	0.2879	H	0.96861	3.895	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.80054	-0.1543	10	0.87932	D	0	-15.4168	18.5254	0.90969	0.0:1.0:0.0:0.0	.	197;213	B7Z5H3;P27338	.;AOFB_HUMAN	R	213;197;197	ENSP00000367309:G213R;ENSP00000441613:G197R;ENSP00000442240:G197R	ENSP00000367309:G213R	G	-	1	0	MAOB	43540061	1.000000	0.71417	0.991000	0.47740	0.950000	0.60333	7.104000	0.77024	2.404000	0.81709	0.600000	0.82982	GGA	.		0.458	MAOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056303.1	NM_000898	
KDM6A	7403	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	44870205	44870205	+	Splice_Site	SNP	G	G	C			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chrX:44870205G>C	ENST00000377967.4	+	5	425		c.e5-1		KDM6A_ENST00000543216.1_Splice_Site|KDM6A_ENST00000536777.1_Splice_Site|KDM6A_ENST00000382899.4_Splice_Site	NM_021140.2	NP_066963.2	O15550	KDM6A_HUMAN	lysine (K)-specific demethylase 6A						canonical Wnt signaling pathway (GO:0060070)|heart morphogenesis (GO:0003007)|histone H3-K4 methylation (GO:0051568)|in utero embryonic development (GO:0001701)|mesodermal cell differentiation (GO:0048333)|multicellular organism growth (GO:0035264)|neural tube closure (GO:0001843)|notochord morphogenesis (GO:0048570)|regulation of gene expression (GO:0010468)|respiratory system process (GO:0003016)|somite rostral/caudal axis specification (GO:0032525)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)	p.0(10)|p.0?(6)|p.?(1)		NS(1)|breast(7)|central_nervous_system(27)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(24)|kidney(24)|large_intestine(9)|liver(1)|lung(21)|oesophagus(11)|pancreas(2)|prostate(5)|skin(1)|soft_tissue(1)|urinary_tract(29)	170						TTCCTTTACAGAATGCTGCCT	0.299			"""D, N, F, S"""		"""renal, oesophageal SCC, MM"""																																.	Colon(129;1273 1667 15230 27352 52914)	.		Rec	yes		X	Xp11.2	7403	"""lysine (K)-specific demethylase 6A, UTX"""		"""E, L"""	.	KDM6A-2748	17	No detectable mRNA/protein(10)|Whole gene deletion(6)|Unknown(1)	haematopoietic_and_lymphoid_tissue(11)|oesophagus(2)|breast(2)|pancreas(2)	c.385-1G>C						.						121.0	102.0	108.0					X																	44870205		2203	4299	6502	SO:0001630	splice_region_variant	7403	exon5			TTTACAGAATGCT	AF000992	CCDS14265.1	Xp11.2	2014-09-17	2009-04-17	2009-04-17	ENSG00000147050	ENSG00000147050		"""Chromatin-modifying enzymes / K-demethylases"", ""Tetratricopeptide (TTC) repeat domain containing"""	12637	protein-coding gene	gene with protein product		300128	"""ubiquitously transcribed tetratricopeptide repeat, X chromosome"""	UTX		9499428, 9381176	Standard	XM_005272655		Approved		uc004dge.4	O15550	OTTHUMG00000021402	ENST00000377967.4:c.385-1G>C	X.37:g.44870205G>C		60	0		67	30	NM_021140	0	0	0	0	0	Q52LL9|Q5JVQ7	Splice_Site	SNP	ENST00000377967.4	37	CCDS14265.1	.	.	.	.	.	.	.	.	.	.	G	12.63	1.994801	0.35226	.	.	ENSG00000147050	ENST00000377967;ENST00000536777;ENST00000382899;ENST00000543216;ENST00000542299	.	.	.	5.43	5.43	0.79202	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.2912	0.90131	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	KDM6A	44755149	1.000000	0.71417	0.995000	0.50966	0.078000	0.17371	9.225000	0.95219	2.258000	0.74832	0.506000	0.49869	.	.		0.299	KDM6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056324.1	NM_021140	Intron
HUWE1	10075	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	53641559	53641559	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chrX:53641559C>T	ENST00000342160.3	-	22	2654	c.2197G>A	c.(2197-2199)Gag>Aag	p.E733K	HUWE1_ENST00000262854.6_Missense_Mutation_p.E733K|HUWE1_ENST00000218328.8_Missense_Mutation_p.E733K			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	733					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						TGTACTTCCTCTTCCTCCTCA	0.473																																					p.E733K		.											.	HUWE1-280	0			c.G2197A						.						246.0	208.0	221.0					X																	53641559		2203	4300	6503	SO:0001583	missense	10075	exon23			CTTCCTCTTCCTC	AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.2197G>A	X.37:g.53641559C>T	ENSP00000340648:p.Glu733Lys	251	1		337	116	NM_031407	0	0	4	41	37	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	ENST00000342160.3	37	CCDS35301.1	.	.	.	.	.	.	.	.	.	.	C	34	5.381036	0.95945	.	.	ENSG00000086758	ENST00000342160;ENST00000262854;ENST00000218328	T;T;T	0.42900	0.96;0.96;0.96	5.46	5.46	0.80206	E3 ubiquitin ligase, domain of unknown function DUF913 (1);	0.137022	0.48286	D	0.000191	T	0.49047	0.1534	L	0.41236	1.265	0.80722	D	1	D	0.53619	0.961	P	0.54544	0.755	T	0.33904	-0.9850	10	0.29301	T	0.29	.	16.9953	0.86366	0.0:1.0:0.0:0.0	.	733	Q7Z6Z7	HUWE1_HUMAN	K	733	ENSP00000340648:E733K;ENSP00000262854:E733K;ENSP00000218328:E733K	ENSP00000218328:E733K	E	-	1	0	HUWE1	53658284	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.068000	0.76748	2.275000	0.75901	0.600000	0.82982	GAG	.		0.473	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1	XM_497119	
ERCC6L	54821	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	71426809	71426809	+	Nonsense_Mutation	SNP	G	G	C			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chrX:71426809G>C	ENST00000334463.3	-	2	1943	c.1808C>G	c.(1807-1809)tCa>tGa	p.S603*	PIN4_ENST00000423432.2_Intron|ERCC6L_ENST00000373657.1_Nonsense_Mutation_p.S480*	NM_017669.2	NP_060139.2	Q2NKX8	ERC6L_HUMAN	excision repair cross-complementation group 6-like	603	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			breast(2)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(9)|lung(9)|ovary(3)|skin(1)	38	Renal(35;0.156)					TCTTATTAATGAGTCCTTGAA	0.348																																					p.S603X		.											.	ERCC6L-93	0			c.C1808G						.						101.0	99.0	99.0					X																	71426809		2203	4300	6503	SO:0001587	stop_gained	54821	exon2			ATTAATGAGTCCT	AK000112	CCDS35329.1	Xq13.1	2014-03-07	2014-03-07		ENSG00000186871	ENSG00000186871			20794	protein-coding gene	gene with protein product	"""PLK1-interacting checkpoint helicase"""	300687	"""excision repair cross-complementing rodent repair deficiency, complementation group 6-like"""			17218258	Standard	NM_017669		Approved	FLJ20105, PICH, RAD26L	uc004eaq.1	Q2NKX8	OTTHUMG00000021810	ENST00000334463.3:c.1808C>G	X.37:g.71426809G>C	ENSP00000334675:p.Ser603*	122	0		175	12	NM_017669	0	0	2	3	1	Q8NCI1|Q96H93|Q9NXQ8	Nonsense_Mutation	SNP	ENST00000334463.3	37	CCDS35329.1	.	.	.	.	.	.	.	.	.	.	G	42	9.316536	0.99135	.	.	ENSG00000186871	ENST00000373657;ENST00000334463	.	.	.	5.46	5.46	0.80206	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	-9.103	15.597	0.76590	0.0:0.0:1.0:0.0	.	.	.	.	X	480;603	.	ENSP00000334675:S603X	S	-	2	0	ERCC6L	71343534	1.000000	0.71417	0.937000	0.37676	0.994000	0.84299	7.739000	0.84976	2.279000	0.76181	0.594000	0.82650	TCA	.		0.348	ERCC6L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057174.2	NM_017669	
PHKA1	5255	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	71886083	71886083	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chrX:71886083G>A	ENST00000373542.4	-	8	941	c.782C>T	c.(781-783)tCa>tTa	p.S261L	PHKA1_ENST00000373539.3_Missense_Mutation_p.S261L|PHKA1_ENST00000541944.1_Missense_Mutation_p.S261L|PHKA1_ENST00000373545.3_Missense_Mutation_p.S261L|PHKA1_ENST00000339490.3_Missense_Mutation_p.S261L	NM_002637.3	NP_002628.2	P46020	KPB1_HUMAN	phosphorylase kinase, alpha 1 (muscle)	261					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(2)|lung(18)|ovary(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	52	Renal(35;0.156)					GGAAACCACTGAGAGTAGACT	0.423																																					p.S261L		.											.	PHKA1-134	0			c.C782T						.						109.0	91.0	97.0					X																	71886083		2203	4300	6503	SO:0001583	missense	5255	exon8			ACCACTGAGAGTA		CCDS14421.1, CCDS48137.1, CCDS55453.1	Xq12-q13	2009-07-10			ENSG00000067177	ENSG00000067177	2.7.11.19		8925	protein-coding gene	gene with protein product		311870		PHKA			Standard	NM_002637		Approved		uc004eax.4	P46020	OTTHUMG00000022696	ENST00000373542.4:c.782C>T	X.37:g.71886083G>A	ENSP00000362643:p.Ser261Leu	60	0		92	48	NM_001172436	0	0	3	3	0	B7ZL05|B7ZL07|Q2M3D7	Missense_Mutation	SNP	ENST00000373542.4	37	CCDS14421.1	.	.	.	.	.	.	.	.	.	.	G	35	5.514712	0.96402	.	.	ENSG00000067177	ENST00000373545;ENST00000373542;ENST00000541944;ENST00000339490;ENST00000373539	D;D;D;D;D	0.93811	-3.29;-3.29;-3.29;-3.29;-3.29	5.78	5.78	0.91487	Six-hairpin glycosidase (1);Six-hairpin glycosidase-like (1);Glycoside hydrolase 15-related (1);	0.059029	0.64402	D	0.000002	D	0.96349	0.8809	M	0.80746	2.51	0.58432	D	0.999999	P;D;D	0.67145	0.916;0.989;0.996	P;P;D	0.65773	0.515;0.897;0.938	D	0.95897	0.8912	10	0.42905	T	0.14	-12.5655	16.1536	0.81640	0.0:0.0:1.0:0.0	.	261;261;261	B7ZL07;P46020-2;P46020	.;.;KPB1_HUMAN	L	261	ENSP00000362646:S261L;ENSP00000362643:S261L;ENSP00000441251:S261L;ENSP00000342469:S261L;ENSP00000362640:S261L	ENSP00000342469:S261L	S	-	2	0	PHKA1	71802808	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.296000	0.96104	2.417000	0.82017	0.600000	0.82982	TCA	.		0.423	PHKA1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058896.1		
GPRASP2	114928	broad.mit.edu;bcgsc.ca	37	X	101971025	101971025	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chrX:101971025G>C	ENST00000535209.1	+	4	2059	c.1228G>C	c.(1228-1230)Gag>Cag	p.E410Q	GPRASP2_ENST00000332262.5_Missense_Mutation_p.E410Q|GPRASP2_ENST00000543253.1_Missense_Mutation_p.E410Q			Q96D09	GASP2_HUMAN	G protein-coupled receptor associated sorting protein 2	410						cytoplasm (GO:0005737)	beta-amyloid binding (GO:0001540)			breast(3)|endometrium(5)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	30						CTGTGAATCTGAGCCAGGAAC	0.562																																					p.E410Q													.	GPRASP2-131	0			c.G1228C						.						60.0	64.0	62.0					X																	101971025		2203	4300	6503	SO:0001583	missense	114928	exon4			GAATCTGAGCCAG	AK094646	CCDS14501.1	Xq22.1	2014-03-21			ENSG00000158301	ENSG00000158301		"""Armadillo repeat containing"""	25169	protein-coding gene	gene with protein product						15086532, 16221301	Standard	NM_138437		Approved	GASP2, FLJ37327		Q96D09	OTTHUMG00000022059	ENST00000535209.1:c.1228G>C	X.37:g.101971025G>C	ENSP00000437394:p.Glu410Gln	143	0		176	7	NM_138437	0	0	4	4	0	D3DXA0|Q8NAB4	Missense_Mutation	SNP	ENST00000535209.1	37	CCDS14501.1	.	.	.	.	.	.	.	.	.	.	G	3.485	-0.105101	0.06967	.	.	ENSG00000158301	ENST00000543253;ENST00000535209;ENST00000332262	T;T;T	0.07021	3.23;3.23;3.23	4.44	0.0818	0.14426	.	1.880220	0.02612	N	0.102273	T	0.08714	0.0216	L	0.44542	1.39	0.09310	N	1	B	0.28128	0.201	B	0.22386	0.039	T	0.38520	-0.9657	10	0.21014	T	0.42	.	8.4458	0.32841	0.345:0.0:0.655:0.0	.	410	Q96D09	GASP2_HUMAN	Q	410	ENSP00000437872:E410Q;ENSP00000437394:E410Q;ENSP00000339057:E410Q	ENSP00000339057:E410Q	E	+	1	0	GPRASP2	101857681	0.000000	0.05858	0.000000	0.03702	0.968000	0.65278	0.558000	0.23469	-0.104000	0.12154	0.600000	0.82982	GAG	.		0.562	GPRASP2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057626.2	NM_138437	
PGRMC1	10857	broad.mit.edu;bcgsc.ca	37	X	118370497	118370497	+	Silent	SNP	C	C	T			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chrX:118370497C>T	ENST00000217971.7	+	1	282	c.171C>T	c.(169-171)agC>agT	p.S57S	PGRMC1_ENST00000535419.1_Silent_p.S57S	NM_006667.3	NP_006658.1	O00264	PGRC1_HUMAN	progesterone receptor membrane component 1	57					axon guidance (GO:0007411)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleolus (GO:0005730)	heme binding (GO:0020037)|steroid binding (GO:0005496)			lung(6)	6					Dextromethorphan(DB00514)|Nortriptyline(DB00540)	GCGGCGACAGCGACGACGACG	0.692																																					p.S57S													.	PGRMC1-130	0			c.C171T						.						18.0	14.0	16.0					X																	118370497		2148	4187	6335	SO:0001819	synonymous_variant	10857	exon1			CGACAGCGACGAC		CCDS14576.1, CCDS65313.1	Xq22-q24	2005-11-29			ENSG00000101856	ENSG00000101856			16090	protein-coding gene	gene with protein product		300435				9705155	Standard	NM_006667		Approved	HPR6.6	uc004erb.3	O00264	OTTHUMG00000022268	ENST00000217971.7:c.171C>T	X.37:g.118370497C>T		40	0		52	9	NM_006667	0	0	50	50	0	B7Z1L3|Q9UGJ9	Silent	SNP	ENST00000217971.7	37	CCDS14576.1																																																																																			.		0.692	PGRMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058024.1	NM_006667	
STAG2	10735	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	123202456	123202456	+	Nonsense_Mutation	SNP	C	C	T			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chrX:123202456C>T	ENST00000371160.1	+	24	2598	c.2308C>T	c.(2308-2310)Cag>Tag	p.Q770*	STAG2_ENST00000371157.3_Nonsense_Mutation_p.Q770*|STAG2_ENST00000371144.3_Nonsense_Mutation_p.Q770*|STAG2_ENST00000371145.3_Nonsense_Mutation_p.Q770*|STAG2_ENST00000354548.5_Nonsense_Mutation_p.Q701*|STAG2_ENST00000469481.1_Intron|STAG2_ENST00000218089.9_Nonsense_Mutation_p.Q770*	NM_001282418.1	NP_001269347.1	Q8N3U4	STAG2_HUMAN	stromal antigen 2	770					meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of DNA endoreduplication (GO:0032876)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	actin cytoskeleton (GO:0015629)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(9)|lung(21)|ovary(5)|prostate(2)|skin(5)|urinary_tract(4)	78						AGTATTTTGTCAGATATGTCA	0.284																																					p.Q770X		.											.	STAG2-134	0			c.C2308T						.						75.0	70.0	72.0					X																	123202456		2203	4285	6488	SO:0001587	stop_gained	10735	exon24			TTTTGTCAGATAT	Z75331	CCDS14607.1, CCDS43990.1	Xq25	2014-09-17			ENSG00000101972	ENSG00000101972			11355	protein-coding gene	gene with protein product		300826				9305759	Standard	NM_001042750		Approved	SA-2, SCC3B	uc004eua.3	Q8N3U4	OTTHUMG00000022725	ENST00000371160.1:c.2308C>T	X.37:g.123202456C>T	ENSP00000360202:p.Gln770*	122	0		183	57	NM_001042749	0	0	1	4	3	B1AMT5|D3DTF5|O00540|Q5JTI6|Q68DE9|Q9H1N8	Nonsense_Mutation	SNP	ENST00000371160.1	37	CCDS14607.1	.	.	.	.	.	.	.	.	.	.	C	41	8.670079	0.98908	.	.	ENSG00000101972	ENST00000218089;ENST00000354548;ENST00000371160;ENST00000371157;ENST00000371145;ENST00000371144	.	.	.	5.19	5.19	0.71726	.	0.185733	0.49305	D	0.000159	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12766	T	0.61	-2.5759	18.1116	0.89538	0.0:1.0:0.0:0.0	.	.	.	.	X	770;701;770;770;770;770	.	ENSP00000218089:Q770X	Q	+	1	0	STAG2	123030137	1.000000	0.71417	1.000000	0.80357	0.671000	0.39405	3.356000	0.52269	2.301000	0.77427	0.534000	0.68092	CAG	.		0.284	STAG2-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000156159.2	NM_006603	
TENM1	10178	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	123680889	123680889	+	Missense_Mutation	SNP	T	T	A			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chrX:123680889T>A	ENST00000371130.3	-	15	2549	c.2486A>T	c.(2485-2487)tAt>tTt	p.Y829F	TENM1_ENST00000422452.2_Missense_Mutation_p.Y829F	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	829					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										AGGACTTATATAACAGTTGCT	0.403																																					p.Y829F		.											.	.	0			c.A2486T						.						119.0	102.0	108.0					X																	123680889		2203	4300	6503	SO:0001583	missense	10178	exon15			CTTATATAACAGT	AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.2486A>T	X.37:g.123680889T>A	ENSP00000360171:p.Tyr829Phe	132	0		201	112	NM_001163278	0	0	0	0	0	B2RTR5|Q5JZ17	Missense_Mutation	SNP	ENST00000371130.3	37	CCDS14609.1	.	.	.	.	.	.	.	.	.	.	T	11.45	1.641329	0.29157	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	T;T	0.11169	2.8;2.8	5.32	5.32	0.75619	.	0.304797	0.31772	N	0.007082	T	0.05090	0.0136	N	0.08118	0	0.32290	N	0.566467	B;B;B	0.06786	0.001;0.001;0.0	B;B;B	0.08055	0.003;0.001;0.002	T	0.23332	-1.0191	10	0.10902	T	0.67	.	9.7127	0.40256	0.1566:0.0:0.0:0.8434	.	828;829;829	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	F	829	ENSP00000360171:Y829F;ENSP00000403954:Y829F	ENSP00000360171:Y829F	Y	-	2	0	ODZ1	123508570	1.000000	0.71417	0.954000	0.39281	0.787000	0.44495	3.654000	0.54453	1.955000	0.56771	0.481000	0.45027	TAT	.		0.403	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058985.1	NM_014253	
BMP8A	353500	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	39991443	39991443	+	Frame_Shift_Del	DEL	G	G	-			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr1:39991443delG	ENST00000331593.5	+	7	1528	c.1182delG	c.(1180-1182)atgfs	p.M394fs	RP11-69E11.4_ENST00000331856.2_RNA|RP11-69E11.4_ENST00000458207.1_RNA|RP11-69E11.4_ENST00000441741.1_RNA|RP11-69E11.4_ENST00000431553.1_RNA|RP11-69E11.4_ENST00000417869.1_RNA|RP11-69E11.4_ENST00000440190.1_RNA|RP11-69E11.4_ENST00000450157.1_RNA	NM_181809.3	NP_861525.2	Q7Z5Y6	BMP8A_HUMAN	bone morphogenetic protein 8a	394					cartilage development (GO:0051216)|cell differentiation (GO:0030154)|diet induced thermogenesis (GO:0002024)|growth (GO:0040007)|negative regulation of insulin secretion (GO:0046676)|ossification (GO:0001503)|regulation of energy homeostasis (GO:2000505)	extracellular space (GO:0005615)				kidney(1)|large_intestine(2)|lung(1)|skin(1)	5	Lung NSC(20;2.08e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;9.69e-19)|Epithelial(16;9.34e-17)|all cancers(16;1.73e-15)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			ACCGCAACATGGTGGTCAAGG	0.612																																					p.M394fs		.											.	BMP8A-90	0			c.1182delG						.						135.0	111.0	119.0					1																	39991443		2203	4300	6503	SO:0001589	frameshift_variant	353500	exon7			.	AY303954	CCDS437.1	1p35-p32	2014-01-30			ENSG00000183682	ENSG00000183682		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	21650	protein-coding gene	gene with protein product							Standard	NM_181809		Approved		uc001cdi.3	Q7Z5Y6	OTTHUMG00000008394	ENST00000331593.5:c.1182delG	1.37:g.39991443delG	ENSP00000327440:p.Met394fs	220	0		171	35	NM_181809	0	0	0	0	0	Q5T3A5	Frame_Shift_Del	DEL	ENST00000331593.5	37	CCDS437.1																																																																																			.		0.612	BMP8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023079.1	NM_181809	
NDC1	55706	broad.mit.edu	37	1	54298190	54298192	+	In_Frame_Del	DEL	TTA	TTA	-	rs577226450		TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	TTA	TTA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr1:54298190_54298192delTTA	ENST00000371429.3	-	3	849_851	c.251_253delTAA	c.(250-255)ataagt>agt	p.I84del	NDC1_ENST00000537333.1_5'UTR|NDC1_ENST00000540001.1_In_Frame_Del_p.I84del|NDC1_ENST00000480952.1_5'UTR|NDC1_ENST00000234725.8_5'UTR	NM_001168551.1|NM_018087.4	NP_001162023.1|NP_060557.3	Q9BTX1	NDC1_HUMAN	NDC1 transmembrane nucleoporin	84					mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nuclear pore distribution (GO:0031081)|protein transport (GO:0015031)|spermatogenesis (GO:0007283)|synapsis (GO:0007129)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)										TTGAAAATACTTATTATTATTAT	0.305																																					p.84_85del													.	TMEM48-92	0			c.251_253del						.		,	223,4033		40,143,1945					,	4.0	1.0			44	436,7808		95,246,3781	no	coding,coding	TMEM48	NM_018087.4,NM_001168551.1	,	135,389,5726	A1A1,A1R,RR		5.2887,5.2397,5.272	,	,		659,11841				SO:0001651	inframe_deletion	55706	exon3			AAATACTTATTAT	AL354613	CCDS583.1	1p32.3	2014-01-28	2013-05-23	2013-05-23	ENSG00000058804	ENSG00000058804			25525	protein-coding gene	gene with protein product	"""nuclear division cycle 1 homolog (S. cerevisiae)"""	610115	"""transmembrane protein 48"""	TMEM48		16779818, 12958361	Standard	NR_033142		Approved	FLJ10407, NET3		Q9BTX1	OTTHUMG00000008073	ENST00000371429.3:c.251_253delTAA	1.37:g.54298199_54298201delTTA	ENSP00000360483:p.Ile84del	58	0		156	5	NM_018087	0	0	0	0	0	B4DHA3|B4DQQ5|G3XA81|Q8NB76|Q9H9T6|Q9NSG3|Q9NSG4|Q9NVZ7	In_Frame_Del	DEL	ENST00000371429.3	37	CCDS583.1																																																																																			.		0.305	NDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022101.1	NM_018087	
TXNIP	10628	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	145440057	145440059	+	In_Frame_Del	DEL	AAG	AAG	-			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	AAG	AAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr1:145440057_145440059delAAG	ENST00000369317.4	+	4	825_827	c.491_493delAAG	c.(490-495)aaagaa>aaa	p.E165del	TXNIP_ENST00000475171.1_Intron	NM_006472.3	NP_006463.3	Q9H3M7	TXNIP_HUMAN	thioredoxin interacting protein	165					cell cycle (GO:0007049)|cellular response to tumor cell (GO:0071228)|innate immune response (GO:0045087)|keratinocyte differentiation (GO:0030216)|negative regulation of cell division (GO:0051782)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|protein import into nucleus (GO:0006606)|regulation of cell proliferation (GO:0042127)|response to calcium ion (GO:0051592)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to glucose (GO:0009749)|response to hydrogen peroxide (GO:0042542)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial intermembrane space (GO:0005758)|nucleus (GO:0005634)	enzyme inhibitor activity (GO:0004857)|ubiquitin protein ligase binding (GO:0031625)			breast(3)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(1)|lung(5)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	21	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					TCTGCTAAAAAAGAAAAGAAAGT	0.414																																					p.164_165del		.											.	TXNIP-92	0			c.491_493del						.																																			SO:0001651	inframe_deletion	10628	exon4			.	S73591	CCDS72876.1	1q11	2008-07-18			ENSG00000117289	ENSG00000265972			16952	protein-coding gene	gene with protein product	"""upregulated by 1,25-dihydroxyvitamin D-3"", ""thioredoxin binding protein 2"""	606599				8086474	Standard	NM_006472		Approved	VDUP1, EST01027, HHCPA78, THIF	uc001enn.4	Q9H3M7	OTTHUMG00000013755	ENST00000369317.4:c.491_493delAAG	1.37:g.145440057_145440059delAAG	ENSP00000358323:p.Glu165del	453	0		684	383	NM_006472	0	0	0	0	0	B4E3D3|Q16226|Q6PML0|Q9BXG9	In_Frame_Del	DEL	ENST00000369317.4	37	CCDS913.1																																																																																			.		0.414	TXNIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038547.1	NM_006472	
MPRIP	23164	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	17046031	17046031	+	Frame_Shift_Del	DEL	C	C	-	rs146439071		TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr17:17046031delC	ENST00000341712.4	+	8	987	c.987delC	c.(985-987)agcfs	p.S329fs	MPRIP_ENST00000444976.1_Frame_Shift_Del_p.S329fs|MPRIP_ENST00000395811.5_Frame_Shift_Del_p.S329fs|MPRIP_ENST00000395804.3_Frame_Shift_Del_p.S329fs			Q6WCQ1	MPRIP_HUMAN	myosin phosphatase Rho interacting protein	329	Interaction with F-actin. {ECO:0000250}.					actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)				biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	31						CACCATCCAGCGACACACGCC	0.632																																					p.S329fs		.											.	MPRIP-90	0			c.987delC						.						85.0	77.0	80.0					17																	17046031		2203	4300	6503	SO:0001589	frameshift_variant	23164	exon8			.	BC014102	CCDS32578.1, CCDS42268.1	17p11.2	2013-01-10			ENSG00000133030	ENSG00000133030		"""Pleckstrin homology (PH) domain containing"""	30321	protein-coding gene	gene with protein product	"""Rho interacting protein 3"""	612935				10048485	Standard	NM_201274		Approved	RHOIP3, M-RIP, p116Rip	uc002gqy.2	Q6WCQ1	OTTHUMG00000059276	ENST00000341712.4:c.987delC	17.37:g.17046031delC	ENSP00000342379:p.Ser329fs	106	0		55	16	NM_015134	0	0	0	0	0	Q3KQZ5|Q5FB94|Q6DHW2|Q7Z5Y2|Q8N390|Q96G40	Frame_Shift_Del	DEL	ENST00000341712.4	37	CCDS32578.1																																																																																			.		0.632	MPRIP-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000131587.1	NM_015134	
KANSL1	284058	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	44248974	44248974	+	Frame_Shift_Del	DEL	C	C	-			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr17:44248974delC	ENST00000262419.6	-	2	1006	c.536delG	c.(535-537)ggafs	p.G179fs	KANSL1_ENST00000572904.1_Frame_Shift_Del_p.G179fs|KANSL1_ENST00000432791.1_Frame_Shift_Del_p.G179fs|KANSL1_ENST00000393476.3_5'UTR|KANSL1_ENST00000574590.1_Frame_Shift_Del_p.G179fs|KANSL1_ENST00000575318.1_Frame_Shift_Del_p.G179fs|KANSL1_ENST00000576248.1_5'Flank	NM_001193466.1	NP_001180395	Q7Z3B3	KANL1_HUMAN	KAT8 regulatory NSL complex subunit 1	179					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)	histone acetyltransferase complex (GO:0000123)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)											AGCCCGTTTTCCCCCATTGAG	0.473																																					p.G179fs		.											.	.	0			c.536delG						.						104.0	138.0	127.0					17																	44248974		2203	4300	6503	SO:0001589	frameshift_variant	284058	exon2			.	BX538006	CCDS11503.1, CCDS11503.2, CCDS74084.1	17q21.31	2012-02-20	2012-02-20	2012-02-20	ENSG00000120071	ENSG00000120071			24565	protein-coding gene	gene with protein product	"""centromere protein 36"""	612452	"""KIAA1267"""	KIAA1267		10574462	Standard	NM_015443		Approved	DKFZP727C091, MSL1v1, CENP-36, NSL1	uc002ikd.3	Q7Z3B3		ENST00000262419.6:c.536delG	17.37:g.44248974delC	ENSP00000262419:p.Gly179fs	304	0		277	119	NM_001193466	0	0	0	0	0	A8K5E4|Q6AW85|Q8IYH1|Q9BRH0|Q9NTE7|Q9UFT0|Q9ULF3	Frame_Shift_Del	DEL	ENST00000262419.6	37	CCDS11503.1																																																																																			.		0.473	KANSL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440274.1	NM_015443	
OXSM	54995	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	25833175	25833175	+	Frame_Shift_Del	DEL	T	T	-			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr3:25833175delT	ENST00000280701.3	+	2	763	c.664delT	c.(664-666)tttfs	p.F222fs	OXSM_ENST00000449808.1_Intron|NGLY1_ENST00000417874.2_5'Flank|OXSM_ENST00000420173.2_Frame_Shift_Del_p.F222fs	NM_017897.2	NP_060367.1	Q9NWU1	OXSM_HUMAN	3-oxoacyl-ACP synthase, mitochondrial	222					acyl-CoA metabolic process (GO:0006637)|medium-chain fatty acid biosynthetic process (GO:0051792)|short-chain fatty acid biosynthetic process (GO:0051790)	mitochondrion (GO:0005739)	3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)			breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	25						CTCATTTAGATTTATAGCCCA	0.498																																					p.F222fs		.											.	OXSM-132	0			c.664delT						.						121.0	119.0	120.0					3																	25833175		2203	4300	6503	SO:0001589	frameshift_variant	54995	exon2			.	BC008202	CCDS2643.1, CCDS46780.1	3p24.2	2010-03-19			ENSG00000151093	ENSG00000151093	2.3.1.41		26063	protein-coding gene	gene with protein product	"""beta-ketoacyl synthase"""	610324				12477932	Standard	NM_017897		Approved	KS, FLJ20604, FASN2D	uc003cdn.3	Q9NWU1	OTTHUMG00000130477	ENST00000280701.3:c.664delT	3.37:g.25833175delT	ENSP00000280701:p.Phe222fs	176	0		178	86	NM_017897	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000280701.3	37	CCDS2643.1																																																																																			.		0.498	OXSM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252876.2	NM_017897	
KDM6A	7403	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	44969446	44969447	+	Frame_Shift_Del	DEL	AC	AC	-			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	AC	AC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chrX:44969446_44969447delAC	ENST00000377967.4	+	28	4169_4170	c.4128_4129delAC	c.(4126-4131)gaacagfs	p.Q1377fs	KDM6A_ENST00000479423.1_3'UTR|KDM6A_ENST00000543216.1_Frame_Shift_Del_p.Q1298fs|KDM6A_ENST00000536777.1_Frame_Shift_Del_p.Q1332fs|KDM6A_ENST00000382899.4_Frame_Shift_Del_p.Q1384fs	NM_021140.2	NP_066963.2	O15550	KDM6A_HUMAN	lysine (K)-specific demethylase 6A	1377					canonical Wnt signaling pathway (GO:0060070)|heart morphogenesis (GO:0003007)|histone H3-K4 methylation (GO:0051568)|in utero embryonic development (GO:0001701)|mesodermal cell differentiation (GO:0048333)|multicellular organism growth (GO:0035264)|neural tube closure (GO:0001843)|notochord morphogenesis (GO:0048570)|regulation of gene expression (GO:0010468)|respiratory system process (GO:0003016)|somite rostral/caudal axis specification (GO:0032525)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)	p.0?(6)|p.Q1377*(1)		NS(1)|breast(7)|central_nervous_system(27)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(24)|kidney(24)|large_intestine(9)|liver(1)|lung(21)|oesophagus(11)|pancreas(2)|prostate(5)|skin(1)|soft_tissue(1)|urinary_tract(29)	170						TGGTGCTAGAACAGTACAAAAT	0.386			"""D, N, F, S"""		"""renal, oesophageal SCC, MM"""																																p.1376_1377del	Colon(129;1273 1667 15230 27352 52914)	.		Rec	yes		X	Xp11.2	7403	"""lysine (K)-specific demethylase 6A, UTX"""		"""E, L"""	.	KDM6A-2748	7	Whole gene deletion(6)|Substitution - Nonsense(1)	oesophagus(2)|breast(2)|pancreas(2)|urinary_tract(1)	c.4128_4129del						.																																			SO:0001589	frameshift_variant	7403	exon28			.	AF000992	CCDS14265.1	Xp11.2	2014-09-17	2009-04-17	2009-04-17	ENSG00000147050	ENSG00000147050		"""Chromatin-modifying enzymes / K-demethylases"", ""Tetratricopeptide (TTC) repeat domain containing"""	12637	protein-coding gene	gene with protein product		300128	"""ubiquitously transcribed tetratricopeptide repeat, X chromosome"""	UTX		9499428, 9381176	Standard	XM_005272655		Approved		uc004dge.4	O15550	OTTHUMG00000021402	ENST00000377967.4:c.4128_4129delAC	X.37:g.44969446_44969447delAC	ENSP00000367203:p.Gln1377fs	79	0		106	36	NM_021140	0	0	0	0	0	Q52LL9|Q5JVQ7	Frame_Shift_Del	DEL	ENST00000377967.4	37	CCDS14265.1																																																																																			.		0.386	KDM6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056324.1	NM_021140	
HSPA8	3312	bcgsc.ca	37	11	122929378	122929379	+	In_Frame_Ins	INS	-	-	TACTCT			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr11:122929378_122929379insTACTCT	ENST00000532636.1	-	7	1602_1603	c.1483_1484insAGAGTA	c.(1483-1485)acg>aAGAGTAcg	p.494_495insKS	SNORD14D_ENST00000384390.1_RNA|HSPA8_ENST00000533540.1_In_Frame_Ins_p.348_349insKS|SNORD14E_ENST00000364009.1_RNA|HSPA8_ENST00000534319.1_In_Frame_Ins_p.258_259insKS|HSPA8_ENST00000453788.2_Intron|HSPA8_ENST00000526862.1_5'Flank|HSPA8_ENST00000534624.1_In_Frame_Ins_p.494_495insKS|SNORD14C_ENST00000365382.1_RNA|HSPA8_ENST00000227378.3_In_Frame_Ins_p.494_495insKS|HSPA8_ENST00000526110.1_In_Frame_Ins_p.475_476insKS			P11142	HSP7C_HUMAN	heat shock 70kDa protein 8	494					ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|chaperone mediated protein folding requiring cofactor (GO:0051085)|clathrin coat disassembly (GO:0072318)|gene expression (GO:0010467)|membrane organization (GO:0061024)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|negative regulation of fibril organization (GO:1902904)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotransmitter secretion (GO:0007269)|post-Golgi vesicle-mediated transport (GO:0006892)|protein folding (GO:0006457)|protein refolding (GO:0042026)|regulation of cell cycle (GO:0051726)|response to unfolded protein (GO:0006986)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|synaptic transmission (GO:0007268)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	blood microparticle (GO:0072562)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Prp19 complex (GO:0000974)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|enzyme binding (GO:0019899)|G-protein coupled receptor binding (GO:0001664)|heat shock protein binding (GO:0031072)|MHC class II protein complex binding (GO:0023026)|poly(A) RNA binding (GO:0044822)|ubiquitin protein ligase binding (GO:0031625)|unfolded protein binding (GO:0051082)			breast(1)|central_nervous_system(7)|endometrium(1)|kidney(9)|large_intestine(4)|lung(13)|upper_aerodigestive_tract(1)	36		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		CTCTTTTCCCGTACTCTTGTCC	0.446																																					p.T495delinsKST	Colon(21;486 594 5900 6733 14272)												.	HSPA8-654	0			c.1484_1485insAGAGTA						.																																			SO:0001652	inframe_insertion	3312	exon7			TTTCCCGTACTCT	Y00371	CCDS8440.1, CCDS44754.1	11q24.1	2011-09-02	2002-08-29		ENSG00000109971	ENSG00000109971		"""Heat shock proteins / HSP70"""	5241	protein-coding gene	gene with protein product		600816	"""heat shock 70kD protein 8"""	HSPA10		8530083, 3037489	Standard	NM_006597		Approved	HSC71, HSC70, HSP73	uc001pyo.3	P11142	OTTHUMG00000166030	ENST00000532636.1:c.1478_1483dupAGAGTA	11.37:g.122929379_122929384dupTACTCT	ENSP00000437125:p.Lys493_Ser494dup	121	0		88	6	NM_006597	0	0	0	0	0	Q9H3R6	In_Frame_Ins	INS	ENST00000532636.1	37	CCDS8440.1																																																																																			.		0.446	HSPA8-004	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387515.1		
CNGA3	1261	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	99012521	99012522	+	Frame_Shift_Ins	INS	-	-	GT			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr2:99012521_99012522insGT	ENST00000272602.2	+	7	927_928	c.888_889insGT	c.(889-891)tacfs	p.Y297fs	CNGA3_ENST00000393504.1_Frame_Shift_Ins_p.Y297fs|CNGA3_ENST00000409937.1_Frame_Shift_Ins_p.Y301fs|CNGA3_ENST00000436404.2_Frame_Shift_Ins_p.Y279fs			Q16281	CNGA3_HUMAN	cyclic nucleotide gated channel alpha 3	297					cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to magnesium ion (GO:0032026)|retinal cone cell development (GO:0046549)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|photoreceptor outer segment membrane (GO:0042622)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|ligand-gated ion channel activity (GO:0015276)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(17)|ovary(5)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	49						CAAGGACCAACTACCCCAATAT	0.45																																					p.N296fs		.											.	CNGA3-96	0			c.888_889insGT						.																																			SO:0001589	frameshift_variant	1261	exon8			.	S76069	CCDS2034.1, CCDS42719.1	2q11.2	2013-01-08			ENSG00000144191	ENSG00000144191		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2150	protein-coding gene	gene with protein product		600053		CNCG3, ACHM2		7532814, 9517456, 16382102	Standard	NM_001298		Approved	CCNC1, CCNCa, CNG3	uc002syt.3	Q16281	OTTHUMG00000130561	Exception_encountered	2.37:g.99012521_99012522insGT	ENSP00000272602:p.Tyr297fs	99	0		92	20	NM_001298	0	0	0	0	0	E9PF93|Q4VAP7|Q53RD2|Q6ZNA7|Q9UP64	Frame_Shift_Ins	INS	ENST00000272602.2	37	CCDS2034.1																																																																																			.		0.450	CNGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252986.1	NM_001298	
BRD8	10902	hgsc.bcm.edu;bcgsc.ca	37	5	137505020	137505021	+	Frame_Shift_Ins	INS	-	-	G	rs150525307|rs141690527	byFrequency	TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr5:137505020_137505021insG	ENST00000254900.5	-	8	903_904	c.532_533insC	c.(532-534)cggfs	p.R178fs	BRD8_ENST00000230901.5_Frame_Shift_Ins_p.R178fs|BRD8_ENST00000455658.2_Frame_Shift_Ins_p.R137fs|BRD8_ENST00000411594.2_Frame_Shift_Ins_p.R178fs|BRD8_ENST00000402931.1_Frame_Shift_Ins_p.R178fs	NM_139199.1	NP_631938	Q9H0E9	BRD8_HUMAN	bromodomain containing 8	178					cell surface receptor signaling pathway (GO:0007166)|chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|intracellular receptor signaling pathway (GO:0030522)|regulation of growth (GO:0040008)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	mitochondrion (GO:0005739)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Swr1 complex (GO:0000812)	sequence-specific DNA binding transcription factor activity (GO:0003700)|thyroid hormone receptor activity (GO:0004887)	p.R178Q(1)|p.R178fs*20(1)		breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(9)|ovary(1)|prostate(1)|skin(1)|stomach(3)|urinary_tract(1)	35			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			GGGTAACCTCCGGGGGGGTGTT	0.441																																					p.R178fs		.											.	BRD8-91	2	Substitution - Missense(1)|Insertion - Frameshift(1)	lung(1)|central_nervous_system(1)	c.533_534insC						.																																			SO:0001589	frameshift_variant	10902	exon8			.	AF016270	CCDS4198.1, CCDS34241.1, CCDS54907.1	5q31	2008-02-05			ENSG00000112983	ENSG00000112983			19874	protein-coding gene	gene with protein product		602848				8611617, 9368056	Standard	NM_001164326		Approved	SMAP, p120	uc003lcf.1	Q9H0E9	OTTHUMG00000129204	ENST00000254900.5:c.533dupC	5.37:g.137505027_137505027dupG	ENSP00000254900:p.Arg178fs	159	0		113	27	NM_001164326	0	0	0	0	0	O43178|Q15355|Q58AB0|Q59GN0|Q969M9	Frame_Shift_Ins	INS	ENST00000254900.5	37	CCDS4198.1																																																																																			.		0.441	BRD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251282.3	NM_006696	
PCDH20	64881	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	61986466	61986467	+	Missense_Mutation	DNP	CC	CC	TT			TCGA-HE-7130-01A-11D-1961-08	TCGA-HE-7130-10A-01D-1962-08	CC	CC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0f6da78c-86f4-41ec-b368-485fe4865ddb	e08a90e3-a3ba-48a4-9d47-d6d40602f0e1	g.chr13:61986466_61986467CC>TT	ENST00000409186.1	-	5	3870_3871	c.1765_1766GG>AA	c.(1765-1767)GGa>AAa	p.G589K	PCDH20_ENST00000409204.4_Missense_Mutation_p.G589K			Q8N6Y1	PCD20_HUMAN	protocadherin 20	589	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(14)|liver(1)|lung(23)|ovary(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	58		Breast(118;0.195)|Prostate(109;0.229)		GBM - Glioblastoma multiforme(99;0.000118)		TGTCAGAATTCCTGTGACACTG	0.455																																					p.G589K		.											.	PCDH20	0			c.G1765A						.																																			SO:0001583	missense	64881	exon2			GAATTCCTGTGAC	AF169693	CCDS9442.2	13q21	2010-01-26			ENSG00000197991	ENSG00000197991		"""Cadherins / Protocadherins : Non-clustered"""	14257	protein-coding gene	gene with protein product		614449					Standard	NM_022843		Approved	PCDH13, FLJ22218	uc001vid.4	Q8N6Y1	OTTHUMG00000017012	ENST00000409186.1:c.1765_1766delinsTT	13.37:g.61986466_61986467delinsTT	ENSP00000386653:p.Gly589Lys	128.0	0.0		121.0	25.0		0	0	0	0	0	A8K1K9|B1AQU2|Q8NDN4|Q9NRT9	Missense_Mutation	DNP	ENST00000409186.1	37	CCDS9442.2																																																																																			.		0.455	PCDH20-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333054.2	NM_022843	
