#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SFN	2810	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	27189915	27189915	+	Missense_Mutation	SNP	A	A	G			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr1:27189915A>G	ENST00000339276.4	+	1	283	c.212A>G	c.(211-213)gAg>gGg	p.E71G		NM_006142.3	NP_006133.1	Q9Y3B8	ORN_HUMAN	stratifin	0	Exonuclease.				nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleobase-containing compound metabolic process (GO:0006139)|nucleotide metabolic process (GO:0009117)	focal adhesion (GO:0005925)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|nucleic acid binding (GO:0003676)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|skin(2)	9		all_cancers(24;1.23e-26)|all_epithelial(13;1.19e-23)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Breast(348;0.00017)|Renal(390;0.0007)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.1e-52)|Epithelial(14;2.31e-52)|OV - Ovarian serous cystadenocarcinoma(117;8.22e-30)|Colorectal(126;1.31e-09)|COAD - Colon adenocarcinoma(152;3.45e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000501)|STAD - Stomach adenocarcinoma(196;0.000588)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|READ - Rectum adenocarcinoma(331;0.0419)|GBM - Glioblastoma multiforme(114;0.0767)|Lung(427;0.215)		AAAAGCAACGAGGAGGGCTCG	0.627																																					p.E71G		.											.	SFN-658	0			c.A212G						.						69.0	74.0	72.0					1																	27189915		2203	4300	6503	SO:0001583	missense	2810	exon1			GCAACGAGGAGGG	BC023552	CCDS288.1	1p36.11	2008-02-05			ENSG00000175793	ENSG00000175793			10773	protein-coding gene	gene with protein product	"""14-3-3 sigma"""	601290				8515476	Standard	NM_006142		Approved	YWHAS	uc001bnc.1	P31947	OTTHUMG00000004093	ENST00000339276.4:c.212A>G	1.37:g.27189915A>G	ENSP00000340989:p.Glu71Gly	106	0		116	46	NM_006142	0	0	10	15	5	B2R532|Q32Q18|Q53FT1|Q6FIC6|Q9UFY7	Missense_Mutation	SNP	ENST00000339276.4	37	CCDS288.1	.	.	.	.	.	.	.	.	.	.	A	11.09	1.535187	0.27475	.	.	ENSG00000175793	ENST00000339276;ENST00000538651	T	0.39787	1.06	5.96	5.96	0.96718	14-3-3 domain (4);	0.106868	0.41396	D	0.000892	T	0.16938	0.0407	N	0.00873	-1.125	0.27459	N	0.9532	B	0.02656	0.0	B	0.04013	0.001	T	0.13818	-1.0495	10	0.54805	T	0.06	-27.1227	12.0125	0.53295	0.8558:0.1442:0.0:0.0	.	71	P31947	1433S_HUMAN	G	71	ENSP00000340989:E71G	ENSP00000340989:E71G	E	+	2	0	SFN	27062502	1.000000	0.71417	0.994000	0.49952	0.719000	0.41307	4.148000	0.58085	2.270000	0.75569	0.533000	0.62120	GAG	.		0.627	SFN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011709.1	NM_006142	
PIAS3	10401	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	145578967	145578967	+	Missense_Mutation	SNP	C	C	T			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr1:145578967C>T	ENST00000393045.2	+	4	635	c.545C>T	c.(544-546)gCc>gTc	p.A182V	PIAS3_ENST00000369298.1_Missense_Mutation_p.A147V|PIAS3_ENST00000369299.3_Missense_Mutation_p.A173V	NM_006099.3	NP_006090.2	Q9Y6X2	PIAS3_HUMAN	protein inhibitor of activated STAT, 3	182	PINIT. {ECO:0000255|PROSITE- ProRule:PRU00799}.				positive regulation of gene expression (GO:0010628)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein sumoylation (GO:0033235)|protein sumoylation (GO:0016925)|regulation of transcription, DNA-templated (GO:0006355)|response to hormone (GO:0009725)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|nucleus (GO:0005634)|synapse (GO:0045202)	enzyme binding (GO:0019899)|nucleic acid binding (GO:0003676)|potassium channel regulator activity (GO:0015459)|protein C-terminus binding (GO:0008022)|SUMO ligase activity (GO:0019789)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)	28	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					CTGCCAGGAGCCAAATGTGAT	0.527																																					p.A182V		.											.	PIAS3-658	0			c.C545T						.						109.0	97.0	101.0					1																	145578967		2203	4300	6503	SO:0001583	missense	10401	exon4			CAGGAGCCAAATG	AB021868	CCDS72866.1	1q21	2011-10-11			ENSG00000131788	ENSG00000131788		"""Zinc fingers, MIZ-type"""	16861	protein-coding gene	gene with protein product	"""zinc finger, MIZ-type containing 5"""	605987				10319586	Standard	NM_006099		Approved	FLJ14651, ZMIZ5	uc001eoc.1	Q9Y6X2	OTTHUMG00000013750	ENST00000393045.2:c.545C>T	1.37:g.145578967C>T	ENSP00000376765:p.Ala182Val	126	0		131	48	NM_006099	0	0	3	4	1	Q9UFI3	Missense_Mutation	SNP	ENST00000393045.2	37	CCDS920.2	.	.	.	.	.	.	.	.	.	.	C	14.25	2.478871	0.44044	.	.	ENSG00000131788	ENST00000393046;ENST00000369299;ENST00000393045;ENST00000369298	T;T;T;T	0.44881	0.93;0.91;1.54;1.51	4.33	4.33	0.51752	PINIT domain (1);	0.000000	0.49916	D	0.000123	T	0.13841	0.0335	N	0.17474	0.49	0.38130	D	0.938123	B;P	0.47841	0.024;0.901	B;B	0.41088	0.061;0.347	T	0.03240	-1.1057	10	0.13108	T	0.6	-12.7129	14.3972	0.67020	0.0:1.0:0.0:0.0	.	173;182	F8WA94;Q9Y6X2	.;PIAS3_HUMAN	V	173;173;182;147	ENSP00000376766:A173V;ENSP00000358305:A173V;ENSP00000376765:A182V;ENSP00000358304:A147V	ENSP00000358304:A147V	A	+	2	0	PIAS3	144290324	0.999000	0.42202	1.000000	0.80357	0.582000	0.36321	1.616000	0.36933	2.230000	0.72887	0.655000	0.94253	GCC	.		0.527	PIAS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038533.4	NM_006099	
TSACC	128229	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	156309583	156309583	+	Splice_Site	SNP	G	G	C	rs113369857		TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr1:156309583G>C	ENST00000368255.3	+	2	394		c.e2+1		TSACC_ENST00000368253.2_Splice_Site|TSACC_ENST00000368252.1_Splice_Site|CCT3_ENST00000472765.2_5'Flank|CCT3_ENST00000368259.2_5'Flank|CCT3_ENST00000368256.3_5'Flank|TSACC_ENST00000466306.1_Splice_Site|TSACC_ENST00000470342.1_Splice_Site|TSACC_ENST00000481479.1_Splice_Site|TSACC_ENST00000368254.1_Splice_Site|CCT3_ENST00000295688.3_5'Flank|CCT3_ENST00000368261.3_5'Flank|TSACC_ENST00000368251.1_Splice_Site	NM_144627.3	NP_653228.1	Q96A04	TSACC_HUMAN	TSSK6 activating co-chaperone							cytoplasm (GO:0005737)	chaperone binding (GO:0051087)										AACAGAAAAGGTGTGTGTTGG	0.483																																					.		.											.	.	0			c.34+1G>C						.						147.0	127.0	134.0					1																	156309583		2203	4300	6503	SO:0001630	splice_region_variant	128229	exon2			GAAAAGGTGTGTG	AY048672	CCDS1141.1	1q22	2012-08-16	2012-08-16	2012-08-16	ENSG00000163467	ENSG00000163467			30636	protein-coding gene	gene with protein product	"""SSTK-interacting protein"""		"""chromosome 1 open reading frame 182"""	C1orf182		20829357	Standard	NM_144627		Approved	SSTK-IP, SIP	uc001foo.3	Q96A04	OTTHUMG00000024060	ENST00000368255.3:c.34+1G>C	1.37:g.156309583G>C		68	0		59	17	NM_144627	0	0	0	0	0	D3DVB9	Splice_Site	SNP	ENST00000368255.3	37	CCDS1141.1	.	.	.	.	.	.	.	.	.	.	G	15.30	2.792835	0.50102	.	.	ENSG00000163467	ENST00000368255;ENST00000368254;ENST00000368253;ENST00000368252;ENST00000368251	.	.	.	2.76	2.76	0.32466	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.1866	0.37174	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C1orf182	154576207	1.000000	0.71417	0.995000	0.50966	0.965000	0.64279	2.090000	0.41682	1.852000	0.53769	0.467000	0.42956	.	.		0.483	TSACC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060594.1	NM_144627	Intron
HSPA6	3310	hgsc.bcm.edu	37	1	161495275	161495275	+	Missense_Mutation	SNP	T	T	C	rs200790521		TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr1:161495275T>C	ENST00000309758.4	+	1	1240	c.827T>C	c.(826-828)cTg>cCg	p.L276P	RP11-25K21.6_ENST00000537821.2_RNA	NM_002155.3	NP_002146.2	P17066	HSP76_HUMAN	heat shock 70kDa protein 6 (HSP70B')	276					ATP catabolic process (GO:0006200)|cellular response to heat (GO:0034605)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)	blood microparticle (GO:0072562)|centriole (GO:0005814)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|enzyme binding (GO:0019899)|heat shock protein binding (GO:0031072)|unfolded protein binding (GO:0051082)			endometrium(3)|large_intestine(5)|lung(9)|prostate(2)|skin(2)	21	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)			AAGCGCACCCTGTCCTCCAGC	0.622																																					p.L276P		.											.	HSPA6-226	0			c.T827C						.						25.0	27.0	26.0					1																	161495275		2201	4300	6501	SO:0001583	missense	3310	exon1			GCACCCTGTCCTC		CCDS1231.1	1q23.3	2011-09-02	2002-08-29		ENSG00000173110	ENSG00000173110		"""Heat shock proteins / HSP70"""	5239	protein-coding gene	gene with protein product		140555	"""heat shock 70kD protein 6 (HSP70B')"""			1346391	Standard	NM_002155		Approved		uc001gaq.3	P17066	OTTHUMG00000034461	ENST00000309758.4:c.827T>C	1.37:g.161495275T>C	ENSP00000310219:p.Leu276Pro	26	0		52	4	NM_002155	0	0	8	10	2	Q1HBA8|Q8IYK7|Q9BT95	Missense_Mutation	SNP	ENST00000309758.4	37	CCDS1231.1	.	.	.	.	.	.	.	.	.	.	.	16.96	3.266320	0.59540	.	.	ENSG00000173110	ENST00000309758;ENST00000545155	T	0.02177	4.41	3.12	3.12	0.35913	.	0.000000	0.30920	U	0.008619	T	0.21145	0.0509	H	0.99996	5.455	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.47100	-0.9143	10	0.87932	D	0	.	9.3095	0.37895	0.0:0.0:0.0:1.0	.	276	P17066	HSP76_HUMAN	P	276;252	ENSP00000310219:L276P	ENSP00000310219:L276P	L	+	2	0	HSPA6	159761899	1.000000	0.71417	0.918000	0.36340	0.903000	0.53119	4.067000	0.57527	1.264000	0.44198	0.443000	0.29094	CTG	.		0.622	HSPA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083308.1	NM_002155	
LBR	3930	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	225598057	225598057	+	Missense_Mutation	SNP	G	G	C			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr1:225598057G>C	ENST00000338179.2	-	10	1375	c.1250C>G	c.(1249-1251)tCc>tGc	p.S417C	AC092811.1_ENST00000366845.2_5'Flank|LBR_ENST00000272163.4_Missense_Mutation_p.S417C	NM_194442.2	NP_919424.1	Q14739	LBR_HUMAN	lamin B receptor	417					cholesterol biosynthetic process (GO:0006695)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|integral component of nuclear inner membrane (GO:0005639)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)	chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|lamin binding (GO:0005521)|oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor (GO:0016628)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	22	Breast(184;0.165)			GBM - Glioblastoma multiforme(131;0.117)		CATGGCCAAGGATGGAACAGC	0.423																																					p.S417C		.											.	LBR-228	0			c.C1250G						.						129.0	126.0	127.0					1																	225598057		2203	4300	6503	SO:0001583	missense	3930	exon10			GCCAAGGATGGAA	L25931	CCDS1545.1	1q42.1	2013-01-23			ENSG00000143815	ENSG00000143815		"""Tudor domain containing"""	6518	protein-coding gene	gene with protein product	"""tudor domain containing 18"""	600024				8157663, 9878250	Standard	NM_194442		Approved	DHCR14B, TDRD18	uc001hoy.3	Q14739	OTTHUMG00000037520	ENST00000338179.2:c.1250C>G	1.37:g.225598057G>C	ENSP00000339883:p.Ser417Cys	159	1		161	57	NM_194442	0	0	8	12	4	B2R5P3|Q14740|Q53GU7|Q59FE6	Missense_Mutation	SNP	ENST00000338179.2	37	CCDS1545.1	.	.	.	.	.	.	.	.	.	.	G	29.0	4.970100	0.92855	.	.	ENSG00000143815	ENST00000272163;ENST00000338179;ENST00000424022	D;D;D	0.98280	-4.84;-4.84;-4.84	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	D	0.99390	0.9785	H	0.96208	3.785	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.98628	1.0670	10	0.87932	D	0	-31.0258	20.5827	0.99408	0.0:0.0:1.0:0.0	.	417	Q14739	LBR_HUMAN	C	417;417;48	ENSP00000272163:S417C;ENSP00000339883:S417C;ENSP00000397817:S48C	ENSP00000272163:S417C	S	-	2	0	LBR	223664680	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	9.737000	0.98831	2.941000	0.99782	0.655000	0.94253	TCC	.		0.423	LBR-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091398.1	NM_002296	
COL13A1	1305	hgsc.bcm.edu	37	10	71582134	71582134	+	Missense_Mutation	SNP	C	C	T	rs200528707	byFrequency	TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr10:71582134C>T	ENST00000398978.3	+	2	796	c.304C>T	c.(304-306)Ctc>Ttc	p.L102F	COL13A1_ENST00000398966.3_Missense_Mutation_p.L102F|COL13A1_ENST00000398973.3_Missense_Mutation_p.L102F|COL13A1_ENST00000520267.1_Missense_Mutation_p.L102F|COL13A1_ENST00000517713.1_Missense_Mutation_p.L102F|COL13A1_ENST00000398971.3_Missense_Mutation_p.L102F|COL13A1_ENST00000398969.3_Missense_Mutation_p.L102F|COL13A1_ENST00000398972.3_Missense_Mutation_p.L102F|COL13A1_ENST00000398964.3_Missense_Mutation_p.L102F|COL13A1_ENST00000398974.3_Missense_Mutation_p.L102F|COL13A1_ENST00000354547.3_Missense_Mutation_p.L102F|COL13A1_ENST00000522165.1_Missense_Mutation_p.L102F|COL13A1_ENST00000357811.3_Missense_Mutation_p.L102F|COL13A1_ENST00000398968.3_Missense_Mutation_p.L102F|COL13A1_ENST00000356340.3_Missense_Mutation_p.L102F|COL13A1_ENST00000520133.1_Missense_Mutation_p.L102F	NM_001130103.1	NP_001123575.1			collagen, type XIII, alpha 1											endometrium(5)|large_intestine(3)|lung(15)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	28						GAAATGGAAGCTCCACTCAAG	0.572													C|||	20	0.00399361	0.0	0.0	5008	,	,		17666	0.0169		0.0	False		,,,				2504	0.0031				p.L102F		.											.	COL13A1-91	0			c.C304T						.						27.0	29.0	28.0					10																	71582134		1905	4130	6035	SO:0001583	missense	1305	exon2			TGGAAGCTCCACT	AJ293624	CCDS44419.1, CCDS44423.1, CCDS44424.1, CCDS44425.1, CCDS44427.1, CCDS44428.1, CCDS44423.2, CCDS44424.2, CCDS44425.2, CCDS44427.2, CCDS44428.2	10q22	2013-01-16			ENSG00000197467	ENSG00000197467		"""Collagens"""	2190	protein-coding gene	gene with protein product		120350					Standard	NM_001130103		Approved		uc001jql.3	Q5TAT6	OTTHUMG00000018394	ENST00000398978.3:c.304C>T	10.37:g.71582134C>T	ENSP00000381949:p.Leu102Phe	4	0		26	13	NM_080802	0	0	0	0	0		Missense_Mutation	SNP	ENST00000398978.3	37	CCDS44419.1	3	0.0013736263736263737	0	0.0	0	0.0	3	0.005244755244755245	0	0.0	C	11.24	1.578987	0.28180	.	.	ENSG00000197467	ENST00000398974;ENST00000398971;ENST00000398968;ENST00000398966;ENST00000398964;ENST00000398969;ENST00000356340;ENST00000398972;ENST00000398973;ENST00000398978;ENST00000354547;ENST00000357811;ENST00000520267;ENST00000517713;ENST00000522165;ENST00000520133	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.92595	-2.83;-2.86;-2.91;-2.94;-2.99;-2.85;-3.07;-2.86;-2.98;-2.99;-2.93;-2.94;-2.78;-2.84;-2.92;-2.79	5.56	4.65	0.58169	.	0.192295	0.25938	N	0.027325	T	0.72811	0.3507	N	0.02158	-0.66	0.24671	N	0.993418	B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.21606	0.004;0.058;0.002;0.001;0.001;0.001;0.001;0.001;0.001;0.003;0.002;0.002;0.016;0.002;0.002;0.002;0.001;0.002	B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.20184	0.005;0.028;0.011;0.005;0.005;0.005;0.005;0.005;0.005;0.005;0.011;0.011;0.011;0.011;0.011;0.011;0.005;0.011	T	0.67665	-0.5612	10	0.40728	T	0.16	-2.2423	9.5332	0.39207	0.0:0.9015:0.0:0.0985	.	102;102;102;102;102;102;102;102;102;102;102;102;102;102;102;102;102;102	Q5TAT6;Q5TAT6-5;Q5TAT6-6;E9PEG9;E7ES55;E7ES51;E7ES47;E7ES46;E7ES49;E7EWL8;Q5TAT6-3;Q5TAT6-4;E7EX21;Q5TAT6-7;Q5TAT6-8;Q5TAT6-2;E7ES56;G5E987	CODA1_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	F	102	ENSP00000381946:L102F;ENSP00000381943:L102F;ENSP00000381940:L102F;ENSP00000381938:L102F;ENSP00000381936:L102F;ENSP00000381941:L102F;ENSP00000348695:L102F;ENSP00000381944:L102F;ENSP00000381945:L102F;ENSP00000381949:L102F;ENSP00000346553:L102F;ENSP00000350463:L102F;ENSP00000428057:L102F;ENSP00000430061:L102F;ENSP00000428342:L102F;ENSP00000430173:L102F	ENSP00000346553:L102F	L	+	1	0	COL13A1	71252140	0.998000	0.40836	1.000000	0.80357	0.992000	0.81027	0.275000	0.18698	1.327000	0.45338	0.561000	0.74099	CTC	C|0.999;T|0.001		0.572	COL13A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048468.1	NM_005203	
SFRP5	6425	hgsc.bcm.edu	37	10	99531063	99531063	+	Splice_Site	SNP	T	T	C			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr10:99531063T>C	ENST00000266066.3	-	1	646	c.528A>G	c.(526-528)ccA>ccG	p.P176P		NM_003015.3	NP_003006.2	Q5T4F7	SFRP5_HUMAN	secreted frizzled-related protein 5	176					anatomical structure morphogenesis (GO:0009653)|apoptotic process (GO:0006915)|brain development (GO:0007420)|cell differentiation (GO:0030154)|convergent extension involved in axis elongation (GO:0060028)|digestive tract morphogenesis (GO:0048546)|establishment or maintenance of cell polarity (GO:0007163)|gonad development (GO:0008406)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell proliferation (GO:0008285)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of planar cell polarity pathway involved in axis elongation (GO:2000041)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of Wnt signaling pathway involved in digestive tract morphogenesis (GO:2000057)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|post-anal tail morphogenesis (GO:0036342)|signal transduction (GO:0007165)|vasculature development (GO:0001944)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			large_intestine(1)|lung(4)	5		Colorectal(252;0.234)		Epithelial(162;4.98e-10)|all cancers(201;3.58e-08)		CGGCGCTACCTGGAGGCGCGG	0.721																																					p.P176P		.											.	SFRP5-658	0			c.A528G						.						6.0	6.0	6.0					10																	99531063		1857	3775	5632	SO:0001630	splice_region_variant	6425	exon1			GCTACCTGGAGGC	AF017988	CCDS7472.1	10q24	2008-07-10			ENSG00000120057	ENSG00000120057		"""Secreted frizzled-related proteins"""	10779	protein-coding gene	gene with protein product	"""secreted apoptosis related protein 3"""	604158				9391078	Standard	NM_003015		Approved	SARP3	uc001kor.4	Q5T4F7	OTTHUMG00000018866	ENST00000266066.3:c.529+1A>G	10.37:g.99531063T>C		16	0		20	2	NM_003015	0	0	0	0	0	O14780|Q86TH7	Silent	SNP	ENST00000266066.3	37	CCDS7472.1																																																																																			.		0.721	SFRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049742.1	NM_003015	Silent
TCTN2	79867	bcgsc.ca	37	12	124171453	124171453	+	Missense_Mutation	SNP	A	A	G	rs139927033		TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr12:124171453A>G	ENST00000303372.5	+	6	763	c.635A>G	c.(634-636)aAt>aGt	p.N212S	TCTN2_ENST00000426174.2_Missense_Mutation_p.N211S	NM_001143850.2|NM_024809.4	NP_001137322.1|NP_079085.2	Q96GX1	TECT2_HUMAN	tectonic family member 2	212					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|TCTN-B9D complex (GO:0036038)				breast(2)|cervix(2)|endometrium(4)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	30	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000163)|Epithelial(86;0.000502)|all cancers(50;0.00451)		GGAGACGTCAATCCTCCTTTT	0.532																																					p.N212S													.	TCTN2-91	0			c.A635G						.	A	SER/ASN,SER/ASN	0,4406		0,0,2203	280.0	232.0	248.0		632,635	-2.3	0.0	12	dbSNP_134	248	4,8596	3.7+/-12.6	0,4,4296	yes	missense,missense	TCTN2	NM_001143850.1,NM_024809.3	46,46	0,4,6499	GG,GA,AA		0.0465,0.0,0.0308	benign,benign	211/697,212/698	124171453	4,13002	2203	4300	6503	SO:0001583	missense	79867	exon6			ACGTCAATCCTCC	AK056924	CCDS9253.1, CCDS45007.1	12q24.31	2011-04-12	2007-08-20	2007-08-20	ENSG00000168778	ENSG00000168778		"""Tectonic proteins"""	25774	protein-coding gene	gene with protein product	"""Meckel syndrome, type 8"""	613846	"""chromosome 12 open reading frame 38"""	C12orf38		21462283	Standard	NM_024809		Approved	FLJ12975, TECT2, MKS8	uc001ufp.3	Q96GX1	OTTHUMG00000168700	ENST00000303372.5:c.635A>G	12.37:g.124171453A>G	ENSP00000304941:p.Asn212Ser	241	0		278	7	NM_024809	0	0	18	20	2	A8K7Y8|B3KPW5|Q9H966	Missense_Mutation	SNP	ENST00000303372.5	37	CCDS9253.1	.	.	.	.	.	.	.	.	.	.	A	0.775	-0.764322	0.02996	0.0	4.65E-4	ENSG00000168778	ENST00000426174;ENST00000303372	D;D	0.82167	-1.58;-1.58	5.65	-2.33	0.06724	Domain of unknown function DUF1619 (1);	0.399950	0.26126	N	0.026184	T	0.62998	0.2474	N	0.21194	0.64	0.09310	N	1	B;B	0.10296	0.003;0.003	B;B	0.11329	0.006;0.006	T	0.52260	-0.8599	10	0.02654	T	1	-39.997	9.4511	0.38727	0.3983:0.1153:0.4864:0.0	.	211;212	A8K7Y8;Q96GX1	.;TECT2_HUMAN	S	211;212	ENSP00000395171:N211S;ENSP00000304941:N212S	ENSP00000304941:N212S	N	+	2	0	TCTN2	122737406	0.000000	0.05858	0.000000	0.03702	0.118000	0.20060	0.134000	0.15932	-0.787000	0.04510	-1.446000	0.01064	AAT	A|1.000;G|0.000		0.532	TCTN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400652.1	NM_024809	
RPGRIP1	57096	hgsc.bcm.edu	37	14	21769356	21769356	+	Silent	SNP	C	C	G	rs144585562	byFrequency	TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr14:21769356C>G	ENST00000400017.2	+	3	450	c.450C>G	c.(448-450)ctC>ctG	p.L150L	RPGRIP1_ENST00000556336.1_Silent_p.L150L|RPGRIP1_ENST00000206660.6_Silent_p.L150L|RPGRIP1_ENST00000557771.1_Silent_p.L150L	NM_020366.3	NP_065099.3	Q96KN7	RPGR1_HUMAN	retinitis pigmentosa GTPase regulator interacting protein 1	150					eye photoreceptor cell development (GO:0042462)|response to stimulus (GO:0050896)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	axoneme (GO:0005930)|nonmotile primary cilium (GO:0031513)				breast(3)|endometrium(2)|kidney(4)|large_intestine(11)|lung(10)|ovary(4)|pancreas(1)|prostate(3)|stomach(1)	39	all_cancers(95;0.0017)	all_cancers(140;0.0973)	Epithelial(56;6.24e-07)|all cancers(55;6.56e-06)	GBM - Glioblastoma multiforme(265;0.00888)		ACAGACAGCTCCACACAGCCG	0.642													c|||	38	0.00758786	0.0	0.0	5008	,	,		14975	0.0367		0.0	False		,,,				2504	0.001				p.L150L		.											.	RPGRIP1-140	0			c.C450G						.	C		1,4023		0,1,2011	14.0	19.0	17.0		450	-4.9	0.0	14	dbSNP_134	17	0,8274		0,0,4137	no	coding-synonymous	RPGRIP1	NM_020366.3		0,1,6148	GG,GC,CC		0.0,0.0249,0.0081		150/1287	21769356	1,12297	2012	4137	6149	SO:0001819	synonymous_variant	57096	exon3			ACAGCTCCACACA	AF227257	CCDS45080.1	14q11.2	2013-06-06			ENSG00000092200	ENSG00000092200			13436	protein-coding gene	gene with protein product		605446		RPGRIP		10958647, 10958648	Standard	NM_020366		Approved	RGI1, LCA6, CORD13	uc001wag.3	Q96KN7	OTTHUMG00000170758	ENST00000400017.2:c.450C>G	14.37:g.21769356C>G		10	2		12	8	NM_020366	0	0	0	0	0	Q7Z2W6|Q8IXV5|Q96QA8|Q9HB94|Q9HB95|Q9HBK6|Q9NR40	Silent	SNP	ENST00000400017.2	37	CCDS45080.1																																																																																			C|0.993;G|0.007		0.642	RPGRIP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410258.1	NM_020366	
HAUS4	54930	hgsc.bcm.edu;bcgsc.ca	37	14	23415759	23415759	+	Missense_Mutation	SNP	T	T	A			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr14:23415759T>A	ENST00000206474.7	-	10	1319	c.1067A>T	c.(1066-1068)cAg>cTg	p.Q356L	HAUS4_ENST00000347758.2_Missense_Mutation_p.Q230L|RP11-298I3.1_ENST00000548819.1_RNA|HAUS4_ENST00000555367.1_Missense_Mutation_p.Q311L|HAUS4_ENST00000554446.1_5'UTR|RP11-298I3.5_ENST00000555074.1_Silent_p.P185P|HAUS4_ENST00000397409.4_Missense_Mutation_p.Q230L|HAUS4_ENST00000490506.1_Missense_Mutation_p.Q232L|HAUS4_ENST00000555986.1_Missense_Mutation_p.Q311L|RP11-298I3.1_ENST00000548322.1_RNA|HAUS4_ENST00000541587.1_Missense_Mutation_p.Q356L|HAUS4_ENST00000342454.8_Missense_Mutation_p.Q311L			Q9H6D7	HAUS4_HUMAN	HAUS augmin-like complex, subunit 4	356					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)				breast(3)|cervix(1)|endometrium(2)|lung(6)|ovary(1)|skin(1)	14						GCTGAACTCCTGGAGGGCCCA	0.562																																					p.Q356L		.											.	HAUS4-91	0			c.A1067T						.						71.0	64.0	66.0					14																	23415759		2203	4300	6503	SO:0001583	missense	54930	exon10			AACTCCTGGAGGG	AK000431	CCDS9580.1, CCDS53886.1	14q11.1	2011-10-24	2009-04-20	2009-04-20	ENSG00000092036	ENSG00000092036		"""HAUS augmin-like complex subunits"""	20163	protein-coding gene	gene with protein product		613431	"""chromosome 14 open reading frame 94"""	C14orf94		19427217	Standard	NM_017815		Approved	FLJ20424	uc001wht.3	Q9H6D7	OTTHUMG00000028710	ENST00000206474.7:c.1067A>T	14.37:g.23415759T>A	ENSP00000206474:p.Gln356Leu	90	0		89	5	NM_001166269	0	0	83	83	0	B7WP17|D3DS34|Q86T15|Q86T16|Q86U43|Q9NX59	Missense_Mutation	SNP	ENST00000206474.7	37	CCDS9580.1	.	.	.	.	.	.	.	.	.	.	T	13.26	2.185415	0.38609	.	.	ENSG00000092036;ENSG00000092036;ENSG00000092036;ENSG00000092036;ENSG00000092036;ENSG00000092036;ENSG00000092036;ENSG00000092036;ENSG00000259132	ENST00000206474;ENST00000490506;ENST00000541587;ENST00000342454;ENST00000347758;ENST00000397409;ENST00000555367;ENST00000555986;ENST00000555074	.	.	.	5.8	3.46	0.39613	.	0.358284	0.32328	N	0.006245	T	0.33904	0.0879	L	0.50333	1.59	0.30627	N	0.757909	B;P;B	0.42518	0.0;0.782;0.001	B;B;B	0.40256	0.003;0.324;0.004	T	0.40136	-0.9579	9	0.52906	T	0.07	-10.115	5.9375	0.19173	0.1466:0.0786:0.0:0.7748	.	311;230;356	Q9H6D7-4;Q9H6D7-2;Q9H6D7	.;.;HAUS4_HUMAN	L	356;232;356;311;230;230;311;311;133	.	ENSP00000206474:Q356L	Q	-	2	0	RP11-298I3.5;HAUS4	22485599	1.000000	0.71417	1.000000	0.80357	0.718000	0.41266	0.712000	0.25779	1.014000	0.39417	-0.409000	0.06214	CAG	.		0.562	HAUS4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071680.3		
ACIN1	22985	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	23549776	23549776	+	Silent	SNP	T	T	C			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr14:23549776T>C	ENST00000262710.1	-	6	1269	c.942A>G	c.(940-942)gtA>gtG	p.V314V	ACIN1_ENST00000457657.1_Silent_p.V274V|ACIN1_ENST00000605057.1_Silent_p.V256V|ACIN1_ENST00000555352.1_5'Flank|ACIN1_ENST00000555053.1_Silent_p.V314V	NM_001164814.1|NM_014977.3	NP_001158286.1|NP_055792	Q9UKV3	ACINU_HUMAN	apoptotic chromatin condensation inducer 1	314	Glu-rich.				apoptotic chromosome condensation (GO:0030263)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|erythrocyte differentiation (GO:0030218)|mRNA processing (GO:0006397)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|positive regulation of apoptotic process (GO:0043065)|positive regulation of monocyte differentiation (GO:0045657)|RNA splicing (GO:0008380)	ASAP complex (GO:0061574)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATPase activity (GO:0016887)|enzyme binding (GO:0019899)|nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(6)|kidney(4)|large_intestine(9)|lung(10)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	37	all_cancers(95;1.36e-05)			GBM - Glioblastoma multiforme(265;0.00816)		CCTCTGGTTTTACTCTAGGTA	0.453																																					p.V314V		.											.	ACIN1-156	0			c.A942G						.						246.0	213.0	224.0					14																	23549776		2203	4300	6503	SO:0001819	synonymous_variant	22985	exon6			TGGTTTTACTCTA	AB014570	CCDS9587.1, CCDS53887.1, CCDS53888.1, CCDS53889.1, CCDS55905.1	14q11.2	2008-11-25	2004-03-31	2004-04-01	ENSG00000100813	ENSG00000100813			17066	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 152"""	604562	"""apoptotic chromatin condensation inducer in the nucleus"""	ACINUS		9734811, 10490026	Standard	NM_014977		Approved	KIAA0670, fSAP152	uc001wit.4	Q9UKV3	OTTHUMG00000028716	ENST00000262710.1:c.942A>G	14.37:g.23549776T>C		160	0		182	54	NM_001164814	0	0	10	10	0	B2RTT4|D3DS45|O75158|Q9UG91|Q9UKV1|Q9UKV2	Silent	SNP	ENST00000262710.1	37	CCDS9587.1																																																																																			.		0.453	ACIN1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000071707.3	NM_014977	
ADCY4	196883	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	24793367	24793367	+	Silent	SNP	C	C	A			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr14:24793367C>A	ENST00000310677.4	-	17	2060	c.1947G>T	c.(1945-1947)ctG>ctT	p.L649L	ADCY4_ENST00000554068.2_Silent_p.L649L|ADCY4_ENST00000396747.3_Silent_p.L342L|ADCY4_ENST00000418030.2_Silent_p.L649L	NM_001198568.1|NM_001198592.1|NM_139247.3	NP_001185497.1|NP_001185521.1|NP_640340.2	Q8NFM4	ADCY4_HUMAN	adenylate cyclase 4	649					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(265;0.0192)		ACAGTGCAGGCAGCCAGTGCA	0.612																																					p.L649L		.											.	ADCY4-93	0			c.G1947T						.						64.0	63.0	63.0					14																	24793367		2203	4300	6503	SO:0001819	synonymous_variant	196883	exon17			TGCAGGCAGCCAG	AF497516	CCDS9627.1	14q11.2	2013-02-04			ENSG00000129467	ENSG00000129467	4.6.1.1	"""Adenylate cyclases"""	235	protein-coding gene	gene with protein product		600292				7766992	Standard	NM_001198592		Approved	AC4	uc001woy.3	Q8NFM4	OTTHUMG00000029347	ENST00000310677.4:c.1947G>T	14.37:g.24793367C>A		66	0		80	6	NM_001198592	0	0	0	0	0	B3KV74|D3DS75|Q17R40|Q6ZTM6|Q96ML7	Silent	SNP	ENST00000310677.4	37	CCDS9627.1																																																																																			.		0.612	ADCY4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073200.4		
JKAMP	51528	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	59965574	59965574	+	Silent	SNP	T	T	C			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr14:59965574T>C	ENST00000261247.9	+	5	735	c.588T>C	c.(586-588)ctT>ctC	p.L196L	JKAMP_ENST00000356057.5_Silent_p.L204L|RP11-701B16.2_ENST00000554253.1_RNA|JKAMP_ENST00000425728.2_Silent_p.L190L|JKAMP_ENST00000554271.1_Silent_p.L210L	NM_001098625.1|NM_001284203.1|NM_016475.3	NP_001092095.1|NP_001271132.1|NP_057559.2	Q9P055	JKAMP_HUMAN	JNK1/MAPK8-associated membrane protein	211					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(1)|kidney(1)|lung(3)	6						ATGCTGCACTTTACTTCTTCC	0.373																																					p.L196L		.											.	JKAMP-67	0			c.T588C						.						125.0	113.0	117.0					14																	59965574		1831	4097	5928	SO:0001819	synonymous_variant	51528	exon5			TGCACTTTACTTC	AF212245	CCDS45116.1, CCDS45117.1, CCDS61462.1, CCDS61463.1	14q22.3	2014-02-14	2009-08-13	2009-08-13	ENSG00000050130	ENSG00000050130			20184	protein-coding gene	gene with protein product	"""Jun N-terminal kinase 1-associated membrane protein"""	611176	"""chromosome 14 open reading frame 100"""	C14orf100		16166642, 19269966	Standard	NM_001284202		Approved	HSPC213, JAMP, HSPC327, CDA06	uc001xef.4	Q9P055	OTTHUMG00000171054	ENST00000261247.9:c.588T>C	14.37:g.59965574T>C		19	0		31	12	NM_016475	0	0	29	59	30	B4DP67|Q6FIB6|Q6IAJ2|Q7Z5D4|Q86SY6|Q9H0Q6|Q9H2W0|Q9HAH5|Q9P0R3	Silent	SNP	ENST00000261247.9	37	CCDS45116.1																																																																																			.		0.373	JKAMP-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411430.1	NM_001098625	
VWA9	81556	bcgsc.ca	37	15	65871974	65871974	+	Silent	SNP	G	G	T			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr15:65871974G>T	ENST00000395644.4	-	12	1664	c.1329C>A	c.(1327-1329)gcC>gcA	p.A443A	VWA9_ENST00000442903.3_Silent_p.A407A|VWA9_ENST00000567744.1_Silent_p.A479A|VWA9_ENST00000431261.2_Silent_p.A364A|VWA9_ENST00000420799.2_Silent_p.A386A|VWA9_ENST00000313182.2_Silent_p.A443A|VWA9_ENST00000569491.1_Silent_p.A393A			Q96SY0	VWA9_HUMAN	von Willebrand factor A domain containing 9	443																	AGGCTAGAGCGGCCTTTCGCA	0.502																																					p.A425A													.	.	0			c.C1275A						.						53.0	47.0	49.0					15																	65871974		2201	4299	6500	SO:0001819	synonymous_variant	81556	exon12			TAGAGCGGCCTTT	AL136662	CCDS55969.1, CCDS45283.1	15q22.31	2012-09-27	2012-09-27	2012-09-27	ENSG00000138614	ENSG00000138614			25372	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 44"""	C15orf44		11230166	Standard	NM_001136043		Approved	DKFZP564O1664	uc010uja.2	Q96SY0	OTTHUMG00000133159	ENST00000395644.4:c.1329C>A	15.37:g.65871974G>T		59	0		59	5	NM_001207058	0	0	27	28	1	B4DDI6|B4DVD5|Q49AH8|Q96HX5|Q9H0S5	Silent	SNP	ENST00000395644.4	37																																																																																				.		0.502	VWA9-201	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000420604.3	NM_030800	
TBC1D2B	23102	ucsc.edu	37	15	78290635	78290635	+	Missense_Mutation	SNP	C	C	T	rs200408968		TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr15:78290635C>T	ENST00000300584.3	-	13	2758	c.2759G>A	c.(2758-2760)cGa>cAa	p.R920Q	TBC1D2B_ENST00000492078.1_5'UTR|TBC1D2B_ENST00000409931.3_Missense_Mutation_p.D903N	NM_015079.5|NM_144572.1	NP_055894.6|NP_653173.1	Q9UPU7	TBD2B_HUMAN	TBC1 domain family, member 2B	920							Rab GTPase activator activity (GO:0005097)	p.D903N(3)|p.R920Q(1)		breast(3)|cervix(2)|endometrium(4)|kidney(1)|large_intestine(7)|lung(2)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	26						GTAGGCGCGTCGGTTCCGGAT	0.617																																					p.R920Q													.	TBC1D2B-136	4	Substitution - Missense(4)	cervix(2)|upper_aerodigestive_tract(1)|ovary(1)	c.G2759A						.						39.0	33.0	35.0					15																	78290635		2196	4291	6487	SO:0001583	missense	23102	exon13			GCGCGTCGGTTCC	AB028978	CCDS32301.2, CCDS45314.1	15q24.3-q25.1	2005-11-29			ENSG00000167202	ENSG00000167202			29183	protein-coding gene	gene with protein product						10470851	Standard	NM_015079		Approved	KIAA1055	uc002bcy.4	Q9UPU7	OTTHUMG00000152885	ENST00000300584.3:c.2759G>A	15.37:g.78290635C>T	ENSP00000300584:p.Arg920Gln	15	2		33	4	NM_144572	0	0	9	9	0	A7MD42|Q8N1F9|Q9NXM0	Missense_Mutation	SNP	ENST00000300584.3	37	CCDS45314.1	88|88	0.040293040293040296|0.040293040293040296	2|2	0.0040650406504065045|0.0040650406504065045	10|10	0.027624309392265192|0.027624309392265192	8|8	0.013986013986013986|0.013986013986013986	68|68	0.08970976253298153|0.08970976253298153	c|c	22.6|22.6	4.311579|4.311579	0.81358|0.81358	.|.	.|.	ENSG00000167202|ENSG00000167202	ENST00000418039;ENST00000409931|ENST00000300584	T|T	0.11712|0.09445	2.75|2.98	4.48|4.48	4.48|4.48	0.54585|0.54585	.|.	0.787190|.	0.11177|.	N|.	0.591392|.	T|T	0.00608|0.00608	0.0020|0.0020	.|.	.|.	.|.	0.26703|0.26703	N|N	0.971136|0.971136	B|D	0.30193|0.57257	0.272|0.979	B|P	0.18561|0.51833	0.022|0.681	T|T	0.06807|0.06807	-1.0806|-1.0806	9|8	0.02654|0.23891	T|T	1|0.37	.|.	16.1645|16.1645	0.81745|0.81745	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	903|920	Q9UPU7-2|Q9UPU7	.|TBD2B_HUMAN	N|Q	802;903|920	ENSP00000387165:D903N|ENSP00000300584:R920Q	ENSP00000387165:D903N|ENSP00000300584:R920Q	D|R	-|-	1|2	0|0	TBC1D2B|TBC1D2B	76077690|76077690	1.000000|1.000000	0.71417|0.71417	0.990000|0.990000	0.47175|0.47175	0.855000|0.855000	0.48748|0.48748	6.002000|6.002000	0.70693|0.70693	2.033000|2.033000	0.60031|0.60031	0.479000|0.479000	0.44913|0.44913	GAC|CGA	C|0.960;T|0.040		0.617	TBC1D2B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000328369.3	NM_015079	
NLRC3	197358	bcgsc.ca	37	16	3594282	3594282	+	RNA	SNP	C	C	T	rs371668578		TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr16:3594282C>T	ENST00000301749.7	-	0	3224				LA16c-390H2.4_ENST00000573820.1_RNA|NLRC3_ENST00000448023.2_RNA|NLRC3_ENST00000419350.2_RNA|NLRC3_ENST00000359128.5_RNA|NLRC3_ENST00000603507.1_RNA	NM_178844.2	NP_849172.2	Q7RTR2	NLRC3_HUMAN	NLR family, CARD domain containing 3						I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|regulation of protein ubiquitination (GO:0031396)|response to lipopolysaccharide (GO:0032496)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(1)|liver(1)|lung(16)|ovary(2)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						CTTCAGTGCACGGGCCACCGC	0.572																																					p.R940H													.	NLRC3-96	0			c.G2819A						.	C	HIS/ARG	1,4171		0,1,2085	72.0	78.0	76.0		2820	2.2	0.0	16		76	3,8447		0,3,4222	no	missense	NLRC3	NM_178844.2	29	0,4,6307	TT,TC,CC		0.0355,0.024,0.0317	possibly-damaging	940/1066	3594282	4,12618	2086	4225	6311			197358	exon17			AGTGCACGGGCCA	BK001112	CCDS73817.1	16p13.3	2014-03-25			ENSG00000167984	ENSG00000167984		"""Nucleotide-binding domain and leucine rich repeat containing"""	29889	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 3"", ""NOD-like receptor C3"""	615648				15705585, 12766759	Standard	NM_178844		Approved	CLR16.2, FLJ00348, NOD3	uc010btn.3	Q7RTR2	OTTHUMG00000177561		16.37:g.3594282C>T		49	0		77	6	NM_178844	0	0	2	2	0	Q5EY36|Q8NF48|Q8NI01|Q8NI02|Q8TEL3	Missense_Mutation	SNP	ENST00000301749.7	37		.	.	.	.	.	.	.	.	.	.	C	9.068	0.996164	0.19043	2.4E-4	3.55E-4	ENSG00000167984	ENST00000301749;ENST00000359128;ENST00000448023	T;T;T	0.53206	0.63;0.63;0.63	5.28	2.24	0.28232	.	0.730148	0.13751	N	0.365282	T	0.28101	0.0693	N	0.16602	0.42	0.09310	N	1	B	0.20887	0.049	B	0.10450	0.005	T	0.16364	-1.0405	10	0.45353	T	0.12	.	5.9625	0.19307	0.0:0.677:0.1533:0.1697	.	986	C9JLH9	.	H	940;911;986	ENSP00000301749:R940H;ENSP00000352039:R911H;ENSP00000414415:R986H	ENSP00000301749:R940H	R	-	2	0	NLRC3	3534283	0.000000	0.05858	0.008000	0.14137	0.346000	0.29079	-0.547000	0.06055	0.351000	0.24027	-0.208000	0.12717	CGT	.		0.572	NLRC3-201	KNOWN	basic|appris_principal	protein_coding	polymorphic_pseudogene		NM_178844	
SBK1	388228	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	28330355	28330355	+	Missense_Mutation	SNP	C	C	T			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr16:28330355C>T	ENST00000341901.4	+	3	1055	c.266C>T	c.(265-267)aCc>aTc	p.T89I		NM_001024401.2	NP_001019572.1	Q52WX2	SBK1_HUMAN	SH3 domain binding kinase 1	89	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			kidney(1)|lung(3)|ovary(1)	5						AAGAGCAAAACCAAGCTGAAG	0.532																																					p.T89I		.											.	SBK1-311	0			c.C266T						.						170.0	156.0	161.0					16																	28330355		2197	4300	6497	SO:0001583	missense	388228	exon3			GCAAAACCAAGCT		CCDS32416.1	16p11.2	2013-09-27	2013-09-27			ENSG00000188322			17699	protein-coding gene	gene with protein product			"""SH3-binding domain kinase 1"""				Standard	XM_005255315		Approved	Sbk	uc002dpd.3	Q52WX2		ENST00000341901.4:c.266C>T	16.37:g.28330355C>T	ENSP00000343248:p.Thr89Ile	211	0		250	85	NM_001024401	0	0	0	2	2		Missense_Mutation	SNP	ENST00000341901.4	37	CCDS32416.1	.	.	.	.	.	.	.	.	.	.	c	20.4	3.991381	0.74703	.	.	ENSG00000188322	ENST00000341901	T	0.65549	-0.16	4.98	4.03	0.46877	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.62732	0.2452	L	0.33339	1.005	0.54753	D	0.999985	D	0.52996	0.957	P	0.57324	0.818	T	0.59958	-0.7356	10	0.35671	T	0.21	-23.5445	11.1208	0.48289	0.0:0.9084:0.0:0.0916	.	89	Q52WX2	SBK1_HUMAN	I	89	ENSP00000343248:T89I	ENSP00000343248:T89I	T	+	2	0	SBK1	28237856	1.000000	0.71417	0.989000	0.46669	0.901000	0.52897	7.769000	0.85360	1.089000	0.41292	-0.141000	0.14075	ACC	.		0.532	SBK1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387677.1	XM_370948	
GLG1	2734	broad.mit.edu	37	16	74640708	74640708	+	Silent	SNP	A	A	C			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr16:74640708A>C	ENST00000422840.2	-	1	284	c.285T>G	c.(283-285)ggT>ggG	p.G95G	GLG1_ENST00000205061.5_Silent_p.G95G|GLG1_ENST00000447066.2_Silent_p.G95G	NM_001145667.1	NP_001139139.1	Q92896	GSLG1_HUMAN	golgi glycoprotein 1	95					blood coagulation (GO:0007596)|bone morphogenesis (GO:0060349)|leukocyte migration (GO:0050900)|negative regulation of protein processing (GO:0010955)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of chondrocyte differentiation (GO:0032330)	extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(2)|cervix(2)|endometrium(6)|kidney(8)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(1)	57						CCGGAGGCCCACCCGCCGGGA	0.706																																					p.G95G													.	GLG1-136	0			c.T285G						.						4.0	6.0	6.0					16																	74640708		1890	3823	5713	SO:0001819	synonymous_variant	2734	exon1			AGGCCCACCCGCC		CCDS32485.1, CCDS45526.1, CCDS45527.1	16q22-q23	2010-02-12	2010-02-12			ENSG00000090863			4316	protein-coding gene	gene with protein product		600753	"""golgi apparatus protein 1"""			8530051, 7531823	Standard	NM_012201		Approved	MG-160, ESL-1, CFR-1	uc002fcx.3	Q92896		ENST00000422840.2:c.285T>G	16.37:g.74640708A>C		16	3		28	10	NM_001145667	0	0	1	1	0	B7Z8Y4|D3DUJ7|Q13221|Q6P9D1	Silent	SNP	ENST00000422840.2	37	CCDS45527.1																																																																																			.		0.706	GLG1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000435750.1	NM_012201	
KRTAP1-1	81851	hgsc.bcm.edu	37	17	39197304	39197304	+	Missense_Mutation	SNP	T	T	C			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr17:39197304T>C	ENST00000306271.4	-	1	409	c.346A>G	c.(346-348)Atc>Gtc	p.I116V		NM_030967.2	NP_112229.1	Q07627	KRA11_HUMAN	keratin associated protein 1-1	116						keratin filament (GO:0045095)		p.I116V(1)		NS(2)|endometrium(2)|kidney(5)|lung(4)|prostate(1)	14		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			CACCACCTGATACGGGTGCTC	0.662																																					p.I116V		.											.	.	1	Substitution - Missense(1)	NS(1)	c.A346G						.						22.0	27.0	25.0					17																	39197304		2019	4148	6167	SO:0001583	missense	81851	exon1			ACCTGATACGGGT	AJ406926	CCDS42324.1	17q21.2	2014-06-05			ENSG00000188581	ENSG00000188581		"""Keratin associated proteins"""	16772	protein-coding gene	gene with protein product		608819				11279113	Standard	NM_030967		Approved	KAP1.1B, HB2A, KAP1.1, KAP1.1A	uc002hvw.1	Q07627	OTTHUMG00000133592	ENST00000306271.4:c.346A>G	17.37:g.39197304T>C	ENSP00000305975:p.Ile116Val	39	0		79	6	NM_030967	0	0	0	0	0	A6NC32|Q96S60|Q96S67	Missense_Mutation	SNP	ENST00000306271.4	37	CCDS42324.1	.	.	.	.	.	.	.	.	.	.	T	8.173	0.792133	0.16258	.	.	ENSG00000188581	ENST00000306271;ENST00000543328	T	0.29655	1.56	4.28	-1.23	0.09465	.	.	.	.	.	T	0.12135	0.0295	N	0.03253	-0.375	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.34079	-0.9843	9	0.20046	T	0.44	.	9.4726	0.38851	0.0:0.573:0.0:0.427	.	116	Q07627	KRA11_HUMAN	V	116;106	ENSP00000305975:I116V	ENSP00000305975:I116V	I	-	1	0	KRTAP1-1	36450830	0.132000	0.22450	0.024000	0.17045	0.516000	0.34256	0.017000	0.13399	-0.199000	0.10317	0.529000	0.55759	ATC	.		0.662	KRTAP1-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257696.1	NM_030967	
FASN	2194	hgsc.bcm.edu	37	17	80041950	80041950	+	Missense_Mutation	SNP	G	G	A	rs45557233	byFrequency	TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr17:80041950G>A	ENST00000306749.2	-	29	5217	c.4999C>T	c.(4999-5001)Ccc>Tcc	p.P1667S	FASN_ENST00000579758.1_5'Flank	NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase	1667	Enoyl reductase. {ECO:0000250}.				acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	GTCTCCCCGGGGCGCACCCGC	0.726													.|||	142	0.0283546	0.0	0.0	5008	,	,		14181	0.1319		0.0	False		,,,				2504	0.0092				p.P1667S	Colon(59;314 1043 11189 28578 32273)	.											.	FASN-90	0			c.C4999T						.	G	SER/PRO	8,4182		0,8,2087	9.0	12.0	11.0		4999	2.4	0.0	17	dbSNP_127	11	0,8266		0,0,4133	yes	missense	FASN	NM_004104.4	74	0,8,6220	AA,AG,GG		0.0,0.1909,0.0642	benign	1667/2512	80041950	8,12448	2095	4133	6228	SO:0001583	missense	2194	exon29			CCCCGGGGCGCAC	U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.4999C>T	17.37:g.80041950G>A	ENSP00000304592:p.Pro1667Ser	1	0		8	6	NM_004104	0	0	1	3	2	Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Missense_Mutation	SNP	ENST00000306749.2	37	CCDS11801.1	65	0.02976190476190476	0	0.0	0	0.0	65	0.11363636363636363	0	0.0	G	1.339	-0.594657	0.03771	0.001909	0.0	ENSG00000169710	ENST00000306749;ENST00000545909	T	0.32023	1.47	4.57	2.39	0.29439	GroES-like (1);Polyketide synthase, enoylreductase (1);NAD(P)-binding domain (1);	1.149520	0.06390	N	0.716872	T	0.00524	0.0017	L	0.48986	1.54	0.09310	N	1	B	0.23185	0.081	B	0.24701	0.055	T	0.16541	-1.0399	10	0.27082	T	0.32	-1.4574	5.5522	0.17097	0.112:0.0:0.4323:0.4557	rs45557233	1667	P49327	FAS_HUMAN	S	1667;632	ENSP00000304592:P1667S	ENSP00000304592:P1667S	P	-	1	0	FASN	77635239	0.586000	0.26782	0.003000	0.11579	0.003000	0.03518	3.926000	0.56491	0.903000	0.36546	0.491000	0.48974	CCC	G|0.970;A|0.030		0.726	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442369.1	NM_004104	
PSG2	5670	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	43585217	43585217	+	Nonsense_Mutation	SNP	A	A	T			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr19:43585217A>T	ENST00000406487.1	-	2	344	c.246T>A	c.(244-246)taT>taA	p.Y82*	PSG2_ENST00000491995.1_5'Flank	NM_031246.3	NP_112536.2	P11465	PSG2_HUMAN	pregnancy specific beta-1-glycoprotein 2	82	Ig-like V-type.				cell migration (GO:0016477)|female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(24)|ovary(1)|pancreas(2)|prostate(6)|stomach(2)|urinary_tract(2)	49		Prostate(69;0.00682)				CGTCTACTACATATGATGTAA	0.438																																					p.Y82X		.											.	PSG2-90	0			c.T246A						.						170.0	174.0	173.0					19																	43585217		2203	4298	6501	SO:0001587	stop_gained	5670	exon2			TACTACATATGAT		CCDS12616.1	19q13.1-q13.2	2013-01-29			ENSG00000242221	ENSG00000242221		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9519	protein-coding gene	gene with protein product	"""pregnancy-specific beta-1 glycoprotein"", ""pregnancy-specific beta-1-glycoprotein 7"", ""carcinoembryonic antigen SG8"""	176391		PSBG2		2377620	Standard	NM_031246		Approved	PSGGB, PSG1, CEA	uc002ovr.3	P11465	OTTHUMG00000151547	ENST00000406487.1:c.246T>A	19.37:g.43585217A>T	ENSP00000385706:p.Tyr82*	456	0		513	141	NM_031246	0	0	2	2	0	Q8TCD9|Q9UEA4|Q9UQ78	Nonsense_Mutation	SNP	ENST00000406487.1	37	CCDS12616.1	.	.	.	.	.	.	.	.	.	.	N	10.75	1.438722	0.25900	.	.	ENSG00000242221	ENST00000406487;ENST00000329509;ENST00000401942;ENST00000406917	.	.	.	0.569	-0.723	0.11181	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	.	.	.	.	.	.	.	X	82	.	ENSP00000332984:Y82X	Y	-	3	2	PSG2	48277057	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.017000	0.12590	-0.394000	0.07727	0.155000	0.16302	TAT	.		0.438	PSG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323083.1	NM_031246	
PTGIR	5739	hgsc.bcm.edu	37	19	47126848	47126848	+	Missense_Mutation	SNP	C	C	T	rs2229131	byFrequency	TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr19:47126848C>T	ENST00000291294.2	-	2	768	c.635G>A	c.(634-636)cGc>cAc	p.R212H	PTGIR_ENST00000597185.1_Intron|PTGIR_ENST00000598865.1_5'UTR|PTGIR_ENST00000594275.1_Intron|PTGIR_ENST00000596260.1_Missense_Mutation_p.R212H	NM_000960.3	NP_000951.1	P43119	PI2R_HUMAN	prostaglandin I2 (prostacyclin) receptor (IP)	212					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of GTPase activity (GO:0043547)|response to lipopolysaccharide (GO:0032496)	cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	13		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000327)|all cancers(93;0.000641)|Epithelial(262;0.0174)|GBM - Glioblastoma multiforme(486;0.0331)	Dinoprost Tromethamine(DB01160)|Epoprostenol(DB01240)|Iloprost(DB01088)|Treprostinil(DB00374)	GCGGTACATGCGGCAGAGGCT	0.701													C|||	37	0.00738818	0.0	0.0	5008	,	,		14423	0.0367		0.0	False		,,,				2504	0.0				p.R212H		.											.	PTGIR-522	0			c.G635A						.						11.0	12.0	12.0					19																	47126848		2113	4132	6245	SO:0001583	missense	5739	exon2			TACATGCGGCAGA		CCDS12686.1	19q13.3	2012-08-08				ENSG00000160013		"""GPCR / Class A : Prostanoid receptors"""	9602	protein-coding gene	gene with protein product		600022				7759114	Standard	NM_000960		Approved	IP	uc002pex.3	P43119		ENST00000291294.2:c.635G>A	19.37:g.47126848C>T	ENSP00000291294:p.Arg212His	3	1		7	4	NM_000960	0	0	0	0	0		Missense_Mutation	SNP	ENST00000291294.2	37	CCDS12686.1	.	.	.	.	.	.	.	.	.	.	C	15.10	2.734063	0.48939	.	.	ENSG00000160013	ENST00000291294	T	0.43688	0.94	4.75	3.71	0.42584	GPCR, rhodopsin-like superfamily (1);	0.148074	0.46145	N	0.000314	T	0.30417	0.0764	L	0.33710	1.025	0.35614	D	0.808912	B	0.24533	0.105	B	0.21546	0.035	T	0.32295	-0.9912	10	0.39692	T	0.17	-13.5	9.867	0.41150	0.0:0.898:0.0:0.102	rs2229131	212	P43119	PI2R_HUMAN	H	212	ENSP00000291294:R212H	ENSP00000291294:R212H	R	-	2	0	PTGIR	51818688	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.343000	0.44001	1.184000	0.42957	0.563000	0.77884	CGC	C|1.000;|0.000		0.701	PTGIR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466581.1		
ZNF814	730051	broad.mit.edu	37	19	58385546	58385546	+	Missense_Mutation	SNP	G	G	T	rs201682072		TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr19:58385546G>T	ENST00000435989.2	-	3	1446	c.1212C>A	c.(1210-1212)gaC>gaA	p.D404E	ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000597832.1_Intron|ZNF814_ENST00000600634.1_Intron|ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000597342.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	404					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D404E(10)		NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						AATGTTTTTTGTCAGTGTGAA	0.393																																					p.D404E													.	.	10	Substitution - Missense(10)	urinary_tract(3)|kidney(3)|prostate(2)|NS(1)|skin(1)	c.C1212A						.						117.0	93.0	100.0					19																	58385546		692	1591	2283	SO:0001583	missense	730051	exon3			TTTTTTGTCAGTG		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.1212C>A	19.37:g.58385546G>T	ENSP00000410545:p.Asp404Glu	15	0		20	4	NM_001144989	0	0	0	0	0	A6NF35	Missense_Mutation	SNP	ENST00000435989.2	37	CCDS46212.1	.	.	.	.	.	.	.	.	.	.	.	11.12	1.545823	0.27652	.	.	ENSG00000204514	ENST00000435989;ENST00000376205	T	0.14640	2.49	2.33	-4.66	0.03329	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04363	0.0120	N	0.03177	-0.4	0.09310	N	1	B	0.13145	0.007	B	0.10450	0.005	T	0.33574	-0.9863	9	0.54805	T	0.06	.	1.2175	0.01917	0.3897:0.3041:0.1331:0.1731	.	404	B7Z6K7	ZN814_HUMAN	E	404;266	ENSP00000410545:D404E	ENSP00000365378:D266E	D	-	3	2	ZNF814	63077358	0.000000	0.05858	0.000000	0.03702	0.038000	0.13279	-1.489000	0.02306	-2.531000	0.00491	-1.292000	0.01352	GAC	.		0.393	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
Unknown	0	hgsc.bcm.edu	37	2	98156684	98156684	+	IGR	SNP	G	G	C			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr2:98156684G>C								AC159540.1 (65635 upstream) : ANKRD36B (7343 downstream)																							GGTCGTCTCTGAGAAGACACT	0.313																																					p.Q632E		.											.	.	0			c.C1894G						.						67.0	53.0	58.0					2																	98156684		1550	2478	4028	SO:0001628	intergenic_variant	57730	exon29			GTCTCTGAGAAGA																													2.37:g.98156684G>C		18	0		32	2	NM_025190	0	0	0	0	0		Missense_Mutation	SNP		37																																																																																				.	0	0.313								
CALCRL	10203	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	188245425	188245425	+	Missense_Mutation	SNP	A	A	G			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr2:188245425A>G	ENST00000409998.1	-	7	1055	c.274T>C	c.(274-276)Ttt>Ctt	p.F92L	CALCRL_ENST00000410068.1_Missense_Mutation_p.F92L|AC007319.1_ENST00000412276.1_RNA|CALCRL_ENST00000392370.3_Missense_Mutation_p.F92L|AC007319.1_ENST00000453517.1_RNA			Q16602	CALRL_HUMAN	calcitonin receptor-like	92					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|angiogenesis (GO:0001525)|calcium ion transport (GO:0006816)|cAMP biosynthetic process (GO:0006171)|cellular response to sucrose stimulus (GO:0071329)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|heart development (GO:0007507)|negative regulation of inflammatory response (GO:0050728)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein transport (GO:0015031)|receptor internalization (GO:0031623)|regulation of muscle contraction (GO:0006937)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	adrenomedullin receptor activity (GO:0001605)|calcitonin gene-related polypeptide receptor activity (GO:0001635)|calcitonin receptor activity (GO:0004948)|G-protein coupled receptor activity (GO:0004930)|protein transporter activity (GO:0008565)			endometrium(1)|large_intestine(7)|lung(21)|ovary(1)|prostate(1)|skin(1)	32			OV - Ovarian serous cystadenocarcinoma(117;0.0554)|Epithelial(96;0.227)			AAGTCCTGAAAGTAATCAGGG	0.418																																					p.F92L		.											.	CALCRL-523	0			c.T274C						.						68.0	66.0	67.0					2																	188245425		2203	4300	6503	SO:0001583	missense	10203	exon5			CCTGAAAGTAATC	U17473	CCDS2293.1	2q21.1-q21.3	2012-08-10			ENSG00000064989	ENSG00000064989		"""GPCR / Class B : Calcitonin receptors"""	16709	protein-coding gene	gene with protein product		114190				7818539, 8626685	Standard	NM_005795		Approved	CGRPR, CRLR	uc010frt.4	Q16602	OTTHUMG00000132636	ENST00000409998.1:c.274T>C	2.37:g.188245425A>G	ENSP00000386972:p.Phe92Leu	41	0		67	34	NM_001271751	0	0	2	3	1	A8K6G5|A8KAD3|Q53S02|Q53TS5	Missense_Mutation	SNP	ENST00000409998.1	37	CCDS2293.1	.	.	.	.	.	.	.	.	.	.	A	31	5.083990	0.94100	.	.	ENSG00000064989	ENST00000392370;ENST00000409998;ENST00000410068	T;T;T	0.64803	-0.12;-0.12;-0.12	5.29	5.29	0.74685	GPCR, family 2, extracellular hormone receptor domain (3);	0.000000	0.64402	D	0.000002	T	0.54886	0.1886	L	0.42008	1.315	0.80722	D	1	P	0.46220	0.874	B	0.42495	0.389	T	0.53041	-0.8494	10	0.25751	T	0.34	.	13.2254	0.59912	1.0:0.0:0.0:0.0	.	92	Q16602	CALRL_HUMAN	L	92	ENSP00000376177:F92L;ENSP00000386972:F92L;ENSP00000387190:F92L	ENSP00000376177:F92L	F	-	1	0	CALCRL	187953670	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	6.861000	0.75478	2.221000	0.72209	0.455000	0.32223	TTT	.		0.418	CALCRL-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334648.1	NM_005795	
WDR12	55759	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	203762106	203762106	+	Missense_Mutation	SNP	C	C	T			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr2:203762106C>T	ENST00000261015.4	-	5	1120	c.371G>A	c.(370-372)cGg>cAg	p.R124Q	WDR12_ENST00000477723.1_5'Flank	NM_018256.3	NP_060726.3			WD repeat domain 12											endometrium(3)|large_intestine(1)|liver(1)|lung(6)|prostate(1)|skin(1)	13						GGACCAGATCCGAGAAGTCTT	0.383																																					p.R124Q		.											.	WDR12-90	0			c.G371A						.						105.0	97.0	100.0					2																	203762106		2203	4300	6503	SO:0001583	missense	55759	exon5			CAGATCCGAGAAG	AF242546	CCDS2356.1	2q33.1	2013-01-09			ENSG00000138442	ENSG00000138442		"""WD repeat domain containing"""	14098	protein-coding gene	gene with protein product						16043514, 17353269	Standard	NM_018256		Approved	YTM1, FLJ10881	uc002uzl.3	Q9GZL7	OTTHUMG00000132855	ENST00000261015.4:c.371G>A	2.37:g.203762106C>T	ENSP00000261015:p.Arg124Gln	120	0		107	26	NM_018256	0	0	5	7	2		Missense_Mutation	SNP	ENST00000261015.4	37	CCDS2356.1	.	.	.	.	.	.	.	.	.	.	C	14.97	2.695498	0.48202	.	.	ENSG00000138442	ENST00000261015	T	0.67865	-0.29	5.33	4.45	0.53987	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.056455	0.64402	N	0.000001	T	0.70570	0.3239	M	0.87827	2.91	0.53688	D	0.999978	B;B	0.21753	0.06;0.06	B;B	0.13407	0.009;0.009	T	0.71034	-0.4709	10	0.56958	D	0.05	-7.5369	13.8674	0.63596	0.0:0.9263:0.0:0.0737	.	124;124	Q53T99;Q9GZL7	.;WDR12_HUMAN	Q	124	ENSP00000261015:R124Q	ENSP00000261015:R124Q	R	-	2	0	WDR12	203470351	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.869000	0.63028	1.229000	0.43630	-0.218000	0.12543	CGG	.		0.383	WDR12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256329.4	NM_018256	
COL4A3	1285	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	228145271	228145271	+	Missense_Mutation	SNP	G	G	T			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr2:228145271G>T	ENST00000396578.3	+	30	2501	c.2339G>T	c.(2338-2340)gGa>gTa	p.G780V	AC097662.2_ENST00000433324.1_RNA|AC097662.2_ENST00000396588.2_RNA|AC097662.2_ENST00000439598.2_RNA	NM_000091.4	NP_000082.2	Q01955	CO4A3_HUMAN	collagen, type IV, alpha 3 (Goodpasture antigen)	780	Triple-helical region.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|blood circulation (GO:0008015)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|collagen catabolic process (GO:0030574)|endothelial cell apoptotic process (GO:0072577)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|sensory perception of sound (GO:0007605)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metalloendopeptidase inhibitor activity (GO:0008191)|structural molecule activity (GO:0005198)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	55		all_lung(227;0.00101)|Lung NSC(271;0.00278)|Renal(207;0.0112)|Ovarian(221;0.0129)|all_hematologic(139;0.211)|Esophageal squamous(248;0.247)		Epithelial(121;1.17e-46)|all cancers(144;6.87e-42)|Lung(261;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0187)		GGTCTCCCTGGAACTCCAGGA	0.498																																					p.G780V		.											.	COL4A3-132	0			c.G2339T	GRCh37	CM034405	COL4A3	M		.						102.0	104.0	103.0					2																	228145271		1895	4117	6012	SO:0001583	missense	1285	exon30			TCCCTGGAACTCC		CCDS42829.1	2q36-q37	2014-09-17			ENSG00000169031	ENSG00000169031		"""Collagens"""	2204	protein-coding gene	gene with protein product	"""tumstatin"""	120070				1737849	Standard	NM_000091		Approved		uc002vom.2	Q01955	OTTHUMG00000149891	ENST00000396578.3:c.2339G>T	2.37:g.228145271G>T	ENSP00000379823:p.Gly780Val	175	0		198	66	NM_000091	0	0	2	3	1	Q53QQ1|Q53R14|Q53RW8|Q9BQT2|Q9NYC4|Q9UDJ9|Q9UDK9|Q9UDL0|Q9UDL1	Missense_Mutation	SNP	ENST00000396578.3	37	CCDS42829.1	.	.	.	.	.	.	.	.	.	.	G	16.90	3.249670	0.59212	.	.	ENSG00000169031	ENST00000396578;ENST00000328380;ENST00000335583;ENST00000396574;ENST00000315699	D	0.99353	-5.77	5.49	5.49	0.81192	.	0.000000	0.56097	D	0.000033	D	0.99542	0.9836	M	0.93016	3.37	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.98235	1.0485	10	0.87932	D	0	.	16.2931	0.82759	0.0:0.0:1.0:0.0	.	780;780;780;780	Q01955-5;Q01955-4;Q01955-2;Q01955	.;.;.;CO4A3_HUMAN	V	780	ENSP00000379823:G780V	ENSP00000323334:G780V	G	+	2	0	COL4A3	227853515	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.405000	0.66351	2.596000	0.87737	0.557000	0.71058	GGA	.		0.498	COL4A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331409.2	NM_000091	
FBXO36	130888	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	2	230875429	230875429	+	Silent	SNP	A	A	G			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr2:230875429A>G	ENST00000283946.3	+	4	414	c.396A>G	c.(394-396)aaA>aaG	p.K132K	FBXO36_ENST00000373652.3_Silent_p.K101K|FBXO36_ENST00000409992.1_Silent_p.K112K	NM_174899.4	NP_777559.3	Q8NEA4	FBX36_HUMAN	F-box protein 36	132	F-box. {ECO:0000255|PROSITE- ProRule:PRU00080}.									endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|ovary(1)	7		Renal(207;0.0112)|all_lung(227;0.0179)|Lung NSC(271;0.0804)|all_hematologic(139;0.103)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;7.56e-14)|all cancers(144;7.74e-11)|Lung(119;0.00488)|LUSC - Lung squamous cell carcinoma(224;0.008)		TGTCTGATAAACTGTGGGAAC	0.532																																					p.K132K		.											.	FBXO36-227	0			c.A396G						.						63.0	56.0	58.0					2																	230875429		2203	4300	6503	SO:0001819	synonymous_variant	130888	exon4			TGATAAACTGTGG	BC033935	CCDS2472.1	2q37.1	2008-02-05	2004-06-15		ENSG00000153832	ENSG00000153832		"""F-boxes /  ""other"""""	27020	protein-coding gene	gene with protein product		609105	"""F-box only protein 36"""			12477932	Standard	NM_174899		Approved	Fbx36, FLJ37592	uc002vqa.3	Q8NEA4	OTTHUMG00000133206	ENST00000283946.3:c.396A>G	2.37:g.230875429A>G		46	0		64	17	NM_174899	0	0	6	7	1	B3KVQ6|Q53TE6|Q8WWD4	Silent	SNP	ENST00000283946.3	37	CCDS2472.1																																																																																			.		0.532	FBXO36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256919.2	NM_174899	
TGM6	343641	broad.mit.edu;bcgsc.ca	37	20	2384361	2384361	+	Missense_Mutation	SNP	C	C	T			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr20:2384361C>T	ENST00000202625.2	+	9	1289	c.1228C>T	c.(1228-1230)Cgg>Tgg	p.R410W	TGM6_ENST00000381423.1_Missense_Mutation_p.R410W	NM_198994.2	NP_945345.2	O95932	TGM3L_HUMAN	transglutaminase 6	410					cell death (GO:0008219)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			breast(1)|endometrium(6)|kidney(2)|large_intestine(2)|lung(32)|ovary(4)|prostate(1)|skin(4)	52					L-Glutamine(DB00130)	GGATGAGAGCCGGGAGCGTGT	0.582																																					p.R410W													.	TGM6-94	0			c.C1228T						.						117.0	102.0	107.0					20																	2384361		2203	4300	6503	SO:0001583	missense	343641	exon9			GAGAGCCGGGAGC	AF540970	CCDS13025.1, CCDS58761.1	20p13	2010-12-19	2004-07-05	2004-07-07	ENSG00000166948	ENSG00000166948		"""Transglutaminases"""	16255	protein-coding gene	gene with protein product	"""spinocerebellar ataxia 35"""	613900	"""transglutaminase 3-like"""	TGM3L		11390390, 21106500	Standard	NM_198994		Approved	dJ734P14.3, TGY, SCA35	uc002wfy.1	O95932	OTTHUMG00000031692	ENST00000202625.2:c.1228C>T	20.37:g.2384361C>T	ENSP00000202625:p.Arg410Trp	103	0		124	6	NM_198994	0	0	0	0	0	Q5JXU4|Q5JXU5|Q719M2|Q719M3|Q9Y4U8	Missense_Mutation	SNP	ENST00000202625.2	37	CCDS13025.1	.	.	.	.	.	.	.	.	.	.	C	15.01	2.707089	0.48412	.	.	ENSG00000166948	ENST00000202625;ENST00000381423	T;T	0.74526	-0.85;-0.85	4.84	2.82	0.32997	.	0.503753	0.20705	N	0.087198	T	0.76905	0.4053	L	0.49126	1.545	0.25334	N	0.989007	D;D	0.71674	0.998;0.997	P;P	0.56916	0.809;0.628	T	0.67933	-0.5542	10	0.66056	D	0.02	-13.0667	10.1216	0.42623	0.3642:0.6358:0.0:0.0	.	410;410	O95932-2;O95932	.;TGM3L_HUMAN	W	410	ENSP00000202625:R410W;ENSP00000370831:R410W	ENSP00000202625:R410W	R	+	1	2	TGM6	2332361	0.001000	0.12720	0.983000	0.44433	0.361000	0.29550	0.639000	0.24690	0.711000	0.32018	0.549000	0.68633	CGG	.		0.582	TGM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077581.2	NM_198994	
NOP56	10528	bcgsc.ca	37	20	2633483	2633483	+	Intron	SNP	T	T	A			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr20:2633483T>A	ENST00000329276.5	+	2	519				SNORD110_ENST00000408189.1_RNA|MIR1292_ENST00000408135.1_RNA|SNORA51_ENST00000606420.1_RNA	NM_006392.3	NP_006383.2	O00567	NOP56_HUMAN	NOP56 ribonucleoprotein						cell death (GO:0008219)|rRNA processing (GO:0006364)	box C/D snoRNP complex (GO:0031428)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|pre-snoRNP complex (GO:0070761)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|snoRNA binding (GO:0030515)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	25						CGGCTCCCGTTCCAGGTGCTG	0.697																																					.													.	.	0			.						.						20.0	22.0	21.0					20																	2633483		2200	4296	6496	SO:0001627	intron_variant	100302138	.			TCCCGTTCCAGGT	Y12065	CCDS13030.1	20p13	2012-12-10	2012-12-10	2009-01-13	ENSG00000101361	ENSG00000101361			15911	protein-coding gene	gene with protein product	"""spinocerebellar ataxia 36"""	614154	"""nucleolar protein 5A (56kD with KKE/D repeat)"", ""nucleolar protein 5A (56kDa with KKE/D repeat)"", ""NOP56 ribonucleoprotein homolog (yeast)"""	NOL5A		9372940, 21683323	Standard	NR_027700		Approved	SCA36	uc002wgh.3	O00567	OTTHUMG00000031703	ENST00000329276.5:c.4-5T>A	20.37:g.2633483T>A		28	0		33	8	.	0	0	0	0	0	Q2M3T6|Q9NQ05	RNA	SNP	ENST00000329276.5	37	CCDS13030.1																																																																																			.		0.697	NOP56-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077631.2	NM_006392	
COL6A2	1292	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	47542788	47542788	+	Splice_Site	SNP	G	G	A			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr21:47542788G>A	ENST00000300527.4	+	21	1712		c.e21-1		COL6A2_ENST00000409416.1_Splice_Site|COL6A2_ENST00000397763.1_Splice_Site|COL6A2_ENST00000310645.5_Splice_Site|COL6A2_ENST00000357838.4_Splice_Site	NM_001849.3	NP_001840.3	P12110	CO6A2_HUMAN	collagen, type VI, alpha 2						axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|protein heterotrimerization (GO:0070208)|response to glucose (GO:0009749)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)				NS(1)|breast(1)|central_nervous_system(7)|endometrium(7)|kidney(5)|liver(1)|lung(15)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	43	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		CCCTGTCACAGGGAGGCCGAG	0.547																																					.		.											.	COL6A2-515	0			c.1609-1G>A						.						86.0	75.0	79.0					21																	47542788		2203	4298	6501	SO:0001630	splice_region_variant	1292	exon21			GTCACAGGGAGGC	M20777	CCDS13728.1, CCDS13729.1, CCDS13730.1	21q22.3	2014-09-17			ENSG00000142173	ENSG00000142173		"""Collagens"""	2212	protein-coding gene	gene with protein product		120240					Standard	NM_001849		Approved		uc002zia.1	P12110	OTTHUMG00000090489	ENST00000300527.4:c.1609-1G>A	21.37:g.47542788G>A		91	0		93	31	NM_058175	0	0	0	1	1	Q13909|Q13910|Q13911|Q14048|Q14049|Q16259|Q16597|Q6P0Q1|Q9UML3|Q9Y4S8	Splice_Site	SNP	ENST00000300527.4	37	CCDS13728.1	.	.	.	.	.	.	.	.	.	.	G	12.89	2.073193	0.36566	.	.	ENSG00000142173	ENST00000300527;ENST00000357838;ENST00000310645;ENST00000409416;ENST00000397763;ENST00000413758	.	.	.	3.54	3.54	0.40534	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.9711	0.80019	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	COL6A2	46367216	1.000000	0.71417	0.991000	0.47740	0.337000	0.28794	7.524000	0.81866	1.909000	0.55274	0.491000	0.48974	.	.		0.547	COL6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206971.1		Intron
PCNT	5116	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	47809247	47809247	+	Missense_Mutation	SNP	A	A	T			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr21:47809247A>T	ENST00000359568.5	+	19	3848	c.3741A>T	c.(3739-3741)gaA>gaT	p.E1247D	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	1247					brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)				NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					TGAGCCCAGAAAGTGTGCGGG	0.587																																					p.E1247D		.											.	PCNT-141	0			c.A3741T						.						95.0	94.0	94.0					21																	47809247		2203	4300	6503	SO:0001583	missense	5116	exon19			CCCAGAAAGTGTG	AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.3741A>T	21.37:g.47809247A>T	ENSP00000352572:p.Glu1247Asp	208	0		197	71	NM_006031	0	0	1	1	0	O43152|Q7Z7C9	Missense_Mutation	SNP	ENST00000359568.5	37	CCDS33592.1	.	.	.	.	.	.	.	.	.	.	A	15.19	2.761428	0.49468	.	.	ENSG00000160299	ENST00000359568	T	0.02032	4.49	5.44	-10.3	0.00346	.	.	.	.	.	T	0.07279	0.0184	M	0.70275	2.135	0.09310	N	1	B;D	0.76494	0.193;0.999	B;D	0.78314	0.08;0.991	T	0.02269	-1.1185	9	0.66056	D	0.02	.	8.9466	0.35762	0.6619:0.2264:0.1118:0.0	.	1129;1247	O95613-2;O95613	.;PCNT_HUMAN	D	1247	ENSP00000352572:E1247D	ENSP00000352572:E1247D	E	+	3	2	PCNT	46633675	0.000000	0.05858	0.000000	0.03702	0.169000	0.22640	-1.857000	0.01660	-1.903000	0.01093	-0.456000	0.05471	GAA	.		0.587	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207336.1	NM_006031	
OSBP2	23762	hgsc.bcm.edu	37	22	31137192	31137192	+	Missense_Mutation	SNP	T	T	A			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr22:31137192T>A	ENST00000332585.6	+	2	793	c.689T>A	c.(688-690)cTg>cAg	p.L230Q	OSBP2_ENST00000382310.3_Missense_Mutation_p.L230Q|OSBP2_ENST00000407373.1_Missense_Mutation_p.L57Q|OSBP2_ENST00000403222.3_Missense_Mutation_p.L65Q|OSBP2_ENST00000446658.2_Missense_Mutation_p.L230Q	NM_001282739.1|NM_001282740.1|NM_001282741.1|NM_001282742.1|NM_030758.3	NP_001269668.1|NP_001269669.1|NP_001269670.1|NP_001269671.1|NP_110385.1	Q969R2	OSBP2_HUMAN	oxysterol binding protein 2	230	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				lipid transport (GO:0006869)	membrane (GO:0016020)	cholesterol binding (GO:0015485)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(2)|lung(6)|ovary(1)|skin(3)|urinary_tract(1)	19						ACCATCAACCTGTCCACCGCG	0.567																																					p.L230Q		.											.	OSBP2-114	0			c.T689A						.						51.0	53.0	53.0					22																	31137192		2028	4163	6191	SO:0001583	missense	23762	exon2			TCAACCTGTCCAC		CCDS43002.1, CCDS63448.1, CCDS63449.1, CCDS63450.1, CCDS63451.1	22q12.2	2013-01-10			ENSG00000184792	ENSG00000184792		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	8504	protein-coding gene	gene with protein product		606729		OSBPL1		10591208, 11278871, 11802775	Standard	NM_001282738		Approved	KIAA1664, ORP-4, ORP4	uc003aiy.1	Q969R2	OTTHUMG00000151153	ENST00000332585.6:c.689T>A	22.37:g.31137192T>A	ENSP00000332576:p.Leu230Gln	71	0		79	4	NM_030758	0	0	0	0	0	B0QYG1|B4DK24|B4DKE4|B4DTR3|F5H2A3|O60396|Q0VF99|Q8NA37|Q9BY96|Q9BZF0	Missense_Mutation	SNP	ENST00000332585.6	37	CCDS43002.1	.	.	.	.	.	.	.	.	.	.	T	25.7	4.662468	0.88251	.	.	ENSG00000184792	ENST00000438716;ENST00000403222;ENST00000407373;ENST00000332585;ENST00000382310;ENST00000446658	T;T;D;D;D	0.84146	-0.42;-0.41;-1.81;-1.81;-1.81	5.38	5.38	0.77491	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.64402	D	0.000005	D	0.95943	0.8679	H	0.99516	4.605	0.80722	D	1	D;D;D;D;D	0.89917	0.998;1.0;1.0;0.999;1.0	D;D;D;D;D	0.81914	0.989;0.98;0.98;0.995;0.995	D	0.97875	1.0288	10	0.87932	D	0	-22.7415	15.0591	0.71939	0.0:0.0:0.0:1.0	.	230;65;57;230;230	B4DFA8;B4DKE4;Q6ZN50;Q0VF99;Q969R2	.;.;.;.;OSBP2_HUMAN	Q	65;65;57;230;230;230	ENSP00000384213:L65Q;ENSP00000385237:L57Q;ENSP00000332576:L230Q;ENSP00000371747:L230Q;ENSP00000392080:L230Q	ENSP00000332576:L230Q	L	+	2	0	OSBP2	29467192	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	8.040000	0.89188	2.040000	0.60383	0.379000	0.24179	CTG	.		0.567	OSBP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321547.2	NM_030758	
TWF2	11344	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	52269098	52269098	+	Missense_Mutation	SNP	A	A	G			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr3:52269098A>G	ENST00000305533.5	-	2	293	c.50T>C	c.(49-51)tTt>tCt	p.F17S	TWF2_ENST00000499914.2_Missense_Mutation_p.F17S|TLR9_ENST00000597542.1_5'UTR	NM_007284.3	NP_009215.1	Q6IBS0	TWF2_HUMAN	twinfilin actin-binding protein 2	17	ADF-H 1. {ECO:0000255|PROSITE- ProRule:PRU00599}.				barbed-end actin filament capping (GO:0051016)|cell projection organization (GO:0030030)|cellular response to growth factor stimulus (GO:0071363)|cellular response to retinoic acid (GO:0071300)|negative regulation of actin filament polymerization (GO:0030837)|positive regulation of axon extension (GO:0045773)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of microvillus length (GO:0032532)|sequestering of actin monomers (GO:0042989)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|myofibril (GO:0030016)|perinuclear region of cytoplasm (GO:0048471)|stereocilium (GO:0032420)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|poly(A) RNA binding (GO:0044822)|protein kinase C binding (GO:0005080)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|stomach(1)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(193;2.43e-05)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		TGCCTTGGCAAAGAATTCCTT	0.572																																					p.F17S		.											.	TWF2-757	0			c.T50C						.						112.0	98.0	103.0					3																	52269098		2203	4300	6503	SO:0001583	missense	11344	exon2			TTGGCAAAGAATT	Y17169	CCDS2849.1	3p21.1	2013-04-25	2013-04-25	2006-11-13	ENSG00000247596	ENSG00000247596			9621	protein-coding gene	gene with protein product		607433	"""protein tyrosine kinase 9-like (A6-related protein)"", ""PTK9L protein tyrosine kinase 9-like (A6-related protein)"", ""twinfilin, actin-binding protein, homolog 2 (Drosophila)"""	PTK9L		10406962, 12807912	Standard	NM_007284		Approved	A6RP, A6r		Q6IBS0	OTTHUMG00000158105	ENST00000305533.5:c.50T>C	3.37:g.52269098A>G	ENSP00000303908:p.Phe17Ser	80	0		103	33	NM_007284	0	0	22	28	6	Q9Y3F5	Missense_Mutation	SNP	ENST00000305533.5	37	CCDS2849.1	.	.	.	.	.	.	.	.	.	.	A	26.3	4.727062	0.89390	.	.	ENSG00000247596	ENST00000305533;ENST00000499914	T;T	0.46063	0.88;0.88	4.58	4.58	0.56647	Actin-binding, cofilin/tropomyosin type (2);	.	.	.	.	T	0.71863	0.3390	M	0.93375	3.41	0.48288	D	0.999623	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.80141	-0.1506	9	0.87932	D	0	.	13.2613	0.60106	1.0:0.0:0.0:0.0	.	17;17	D6RG15;Q6IBS0	.;TWF2_HUMAN	S	17	ENSP00000303908:F17S;ENSP00000426464:F17S	ENSP00000303908:F17S	F	-	2	0	TWF2	52244138	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.871000	0.92346	1.927000	0.55829	0.459000	0.35465	TTT	.		0.572	TWF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350199.2		
FNDC3B	64778	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	172025192	172025192	+	Silent	SNP	C	C	G	rs145255541		TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr3:172025192C>G	ENST00000336824.4	+	10	1200	c.1101C>G	c.(1099-1101)tcC>tcG	p.S367S	FNDC3B_ENST00000415807.2_Silent_p.S367S|FNDC3B_ENST00000416957.1_Silent_p.S367S	NM_001135095.1	NP_001128567.1	Q53EP0	FND3B_HUMAN	fibronectin type III domain containing 3B	367	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell migration (GO:0016477)|negative regulation of osteoblast differentiation (GO:0045668)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of fibroblast proliferation (GO:0048146)|substrate adhesion-dependent cell spreading (GO:0034446)|Type II pneumocyte differentiation (GO:0060510)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(12)|lung(26)|ovary(3)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	69	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	GBM - Glioblastoma multiforme(1;0.0494)		GATCCTGCTCCGAGCCTGTTA	0.502																																					p.S367S		.											.	FNDC3B-155	0			c.C1101G						.						154.0	129.0	138.0					3																	172025192		2203	4300	6503	SO:0001819	synonymous_variant	64778	exon10			CTGCTCCGAGCCT	AF543840	CCDS3217.1	3q26.31	2013-11-06			ENSG00000075420	ENSG00000075420		"""Fibronectin type III domain containing"""	24670	protein-coding gene	gene with protein product		611909				15527760	Standard	NM_022763		Approved	FAD104, DKFZp762K137, FLJ23399, PRO4979, YVTM2421	uc003fhy.3	Q53EP0	OTTHUMG00000156761	ENST00000336824.4:c.1101C>G	3.37:g.172025192C>G		106	0		131	39	NM_001135095	0	0	3	5	2	B2RB36|B3KXR8|D3DNQ7|Q5U5T8|Q6PIJ3|Q6UXG1|Q6UXZ5|Q8IXB2|Q8NBU7|Q96D78|Q9H5I7|Q9NSQ8	Silent	SNP	ENST00000336824.4	37	CCDS3217.1																																																																																			C|1.000;T|0.000		0.502	FNDC3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345618.2	NM_022763	
PPP2R2C	5522	hgsc.bcm.edu	37	4	6325301	6325301	+	Missense_Mutation	SNP	A	A	G			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr4:6325301A>G	ENST00000382599.4	-	9	1288	c.1072T>C	c.(1072-1074)Tac>Cac	p.Y358H	PPP2R2C_ENST00000507294.1_Missense_Mutation_p.Y351H|PPP2R2C_ENST00000515571.1_Missense_Mutation_p.Y341H|PPP2R2C_ENST00000335585.5_Missense_Mutation_p.Y358H|PPP2R2C_ENST00000506140.1_Missense_Mutation_p.Y351H			Q9Y2T4	2ABG_HUMAN	protein phosphatase 2, regulatory subunit B, gamma	358					regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	28						AAGTTGTTGTAGGCCCCGGTC	0.612																																					p.Y358H		.											.	PPP2R2C-1084	0			c.T1072C						.						49.0	43.0	45.0					4																	6325301		2201	4300	6501	SO:0001583	missense	5522	exon9			TGTTGTAGGCCCC	AF086924	CCDS3388.1, CCDS56304.1, CCDS56305.1, CCDS3387.1	4p16.1	2013-01-10	2010-04-14		ENSG00000074211	ENSG00000074211	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""WD repeat domain containing"""	9306	protein-coding gene	gene with protein product	"""PP2A subunit B isoform gamma"""	605997	"""protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), gamma isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B, gamma isoform"""			10574460, 10945473	Standard	NM_020416		Approved	PR52, IMYPNO, MGC33570, PR55G	uc003gja.3	Q9Y2T4	OTTHUMG00000090445	ENST00000382599.4:c.1072T>C	4.37:g.6325301A>G	ENSP00000372042:p.Tyr358His	27	0		40	2	NM_181876	0	0	0	0	0	A8MSY7|B7Z3Y1|Q7Z4V7|Q8NEC4|Q9H3G7	Missense_Mutation	SNP	ENST00000382599.4	37		.	.	.	.	.	.	.	.	.	.	A	20.8	4.055114	0.75960	.	.	ENSG00000074211	ENST00000335585;ENST00000506140;ENST00000515571;ENST00000382599;ENST00000507294	T;T;T;T;T	0.29142	1.58;1.58;1.58;1.58;1.58	4.31	4.31	0.51392	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.61350	0.2340	M	0.91038	3.17	0.80722	D	1	D;D;D;D	0.69078	0.997;0.997;0.997;0.968	D;D;D;D	0.70935	0.971;0.971;0.971;0.96	T	0.71328	-0.4626	10	0.87932	D	0	-55.5355	12.7994	0.57578	1.0:0.0:0.0:0.0	.	351;358;341;358	B7Z3Y1;Q9Y2T4;Q9Y2T4-3;Q9Y2T4-2	.;2ABG_HUMAN;.;.	H	358;351;341;358;351	ENSP00000335083:Y358H;ENSP00000423649:Y351H;ENSP00000422374:Y341H;ENSP00000372042:Y358H;ENSP00000425247:Y351H	ENSP00000335083:Y358H	Y	-	1	0	PPP2R2C	6376202	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	8.018000	0.88722	1.803000	0.52742	0.454000	0.30748	TAC	.		0.612	PPP2R2C-001	NOVEL	overlapping_uORF|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000206889.2	NM_181876	
TBC1D14	57533	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	7026865	7026865	+	Missense_Mutation	SNP	C	C	A			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr4:7026865C>A	ENST00000409757.4	+	13	2016	c.1892C>A	c.(1891-1893)aCc>aAc	p.T631N	TBC1D14_ENST00000448507.1_Missense_Mutation_p.T631N|TBC1D14_ENST00000446947.2_Missense_Mutation_p.T278N|TBC1D14_ENST00000410031.1_Missense_Mutation_p.T403N|TBC1D14_ENST00000451522.2_Missense_Mutation_p.T351N	NM_020773.2	NP_065824.2	Q9P2M4	TBC14_HUMAN	TBC1 domain family, member 14	631					negative regulation of autophagy (GO:0010507)|recycling endosome to Golgi transport (GO:0071955)|regulation of autophagic vacuole assembly (GO:2000785)	autophagic vacuole (GO:0005776)|Golgi apparatus (GO:0005794)|recycling endosome (GO:0055037)	protein kinase binding (GO:0019901)|Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(5)|large_intestine(4)|lung(9)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	22						GACATCCTGACCAAGATGGAC	0.612																																					p.T631N		.											.	TBC1D14-92	0			c.C1892A						.						145.0	117.0	127.0					4																	7026865		2203	4300	6503	SO:0001583	missense	57533	exon13			TCCTGACCAAGAT	AL833868	CCDS3394.2, CCDS47006.1, CCDS75104.1	4p16.1	2008-01-22			ENSG00000132405	ENSG00000132405			29246	protein-coding gene	gene with protein product		614855				10718198	Standard	NM_020773		Approved	KIAA1322	uc003gjs.4	Q9P2M4	OTTHUMG00000090493	ENST00000409757.4:c.1892C>A	4.37:g.7026865C>A	ENSP00000386921:p.Thr631Asn	134	0		168	45	NM_001113361	0	0	10	21	11	B9A6L5|D3DVT4|E9PAZ6|Q8IW15|Q8NDK3	Missense_Mutation	SNP	ENST00000409757.4	37	CCDS3394.2	.	.	.	.	.	.	.	.	.	.	C	14.93	2.681226	0.47886	.	.	ENSG00000132405	ENST00000448507;ENST00000409757;ENST00000410031;ENST00000451522;ENST00000446947	T;T;T;T;T	0.22134	1.97;1.97;1.97;1.97;1.97	5.15	5.15	0.70609	Rab-GAP/TBC domain (2);	0.162937	0.53938	D	0.000045	T	0.19287	0.0463	N	0.08118	0	0.58432	D	0.999994	B;B;B	0.34372	0.451;0.02;0.187	B;B;B	0.43838	0.242;0.104;0.433	T	0.25082	-1.0142	10	0.66056	D	0.02	-12.687	17.6366	0.88124	0.0:1.0:0.0:0.0	.	278;351;631	F5GXK4;Q9P2M4-2;Q9P2M4	.;.;TBC14_HUMAN	N	631;631;403;351;278	ENSP00000404041:T631N;ENSP00000386921:T631N;ENSP00000386343:T403N;ENSP00000388886:T351N;ENSP00000405875:T278N	ENSP00000386921:T631N	T	+	2	0	TBC1D14	7077766	0.256000	0.24012	1.000000	0.80357	0.994000	0.84299	1.090000	0.30902	2.409000	0.81822	0.561000	0.74099	ACC	.		0.612	TBC1D14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206981.3	NM_020773	
CEP135	9662	hgsc.bcm.edu	37	4	56832006	56832006	+	Missense_Mutation	SNP	A	A	G			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr4:56832006A>G	ENST00000257287.4	+	8	1149	c.1025A>G	c.(1024-1026)aAa>aGa	p.K342R		NM_025009.4	NP_079285.2	Q66GS9	CP135_HUMAN	centrosomal protein 135kDa	342					centriole replication (GO:0007099)|centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)	protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(9)|lung(26)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	50	Glioma(25;0.08)|all_neural(26;0.101)					ACTGCTGATAAAGAGCTTGGG	0.373																																					p.K342R		.											.	CEP135-94	0			c.A1025G						.						93.0	93.0	93.0					4																	56832006		2203	4300	6503	SO:0001583	missense	9662	exon8			CTGATAAAGAGCT	AB014535	CCDS33986.1	4q12	2014-02-20	2005-12-02	2005-12-02	ENSG00000174799	ENSG00000174799			29086	protein-coding gene	gene with protein product		611423	"""KIAA0635"", ""centrosomal protein 4"""	KIAA0635, CEP4		9734811, 14654843	Standard	NM_025009		Approved	FLJ13621	uc003hbi.4	Q66GS9	OTTHUMG00000160748	ENST00000257287.4:c.1025A>G	4.37:g.56832006A>G	ENSP00000257287:p.Lys342Arg	39	0		38	2	NM_025009	0	0	1	1	0	B2RMY0|O75130|Q58F25|Q9H8H7	Missense_Mutation	SNP	ENST00000257287.4	37	CCDS33986.1	.	.	.	.	.	.	.	.	.	.	A	12.94	2.089853	0.36855	.	.	ENSG00000174799	ENST00000257287	T	0.41065	1.01	5.67	4.45	0.53987	.	0.451804	0.27486	N	0.019155	T	0.36908	0.0984	M	0.67953	2.075	0.25303	N	0.989268	B	0.11235	0.004	B	0.13407	0.009	T	0.30238	-0.9985	10	0.16896	T	0.51	.	7.8125	0.29239	0.7915:0.138:0.0705:0.0	.	342	Q66GS9	CP135_HUMAN	R	342	ENSP00000257287:K342R	ENSP00000257287:K342R	K	+	2	0	CEP135	56526763	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	2.985000	0.49362	0.948000	0.37687	0.377000	0.23210	AAA	.		0.373	CEP135-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362092.2	NM_025009	
PDLIM5	10611	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	95496927	95496927	+	Missense_Mutation	SNP	C	C	G	rs200734812		TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr4:95496927C>G	ENST00000317968.4	+	5	588	c.452C>G	c.(451-453)aCc>aGc	p.T151S	PDLIM5_ENST00000542407.1_Missense_Mutation_p.T29S|PDLIM5_ENST00000514743.1_Intron|PDLIM5_ENST00000437932.1_Intron|PDLIM5_ENST00000380180.3_Intron|PDLIM5_ENST00000450793.1_Intron|PDLIM5_ENST00000508216.1_Intron|PDLIM5_ENST00000318007.5_Intron|PDLIM5_ENST00000538141.1_Intron	NM_001256428.1|NM_006457.4	NP_001243357.1|NP_006448	Q96HC4	PDLI5_HUMAN	PDZ and LIM domain 5	151					regulation of dendritic spine morphogenesis (GO:0061001)|regulation of synapse assembly (GO:0051963)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytosol (GO:0005829)|membrane (GO:0016020)|neuron projection (GO:0043005)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	actin binding (GO:0003779)|actinin binding (GO:0042805)|protein kinase C binding (GO:0005080)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	22		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.84e-09)		TCTGCCTTCACCCCAGCCCAT	0.542																																					p.T151S		.											.	PDLIM5-117	0			c.C452G						.						332.0	281.0	299.0					4																	95496927		2203	4300	6503	SO:0001583	missense	10611	exon5			CCTTCACCCCAGC	AF061258	CCDS3641.1, CCDS47103.1, CCDS47104.1, CCDS58915.1, CCDS58916.1, CCDS58917.1, CCDS75166.1	4q22	2006-04-12			ENSG00000163110	ENSG00000163110			17468	protein-coding gene	gene with protein product		605904				15346770	Standard	NM_006457		Approved	LIM, Enh	uc003htk.4	Q96HC4	OTTHUMG00000130973	ENST00000317968.4:c.452C>G	4.37:g.95496927C>G	ENSP00000321746:p.Thr151Ser	346	0		408	111	NM_006457	0	0	8	14	6	A8K6F9|D6RB78|E9PBF5|O60705|Q56VN4|Q5UW38|Q8WVK0	Missense_Mutation	SNP	ENST00000317968.4	37	CCDS3641.1	.	.	.	.	.	.	.	.	.	.	C	15.94	2.981800	0.53827	.	.	ENSG00000163110	ENST00000317968;ENST00000542407	T;T	0.58940	0.72;0.3	5.25	5.25	0.73442	.	0.106561	0.64402	D	0.000004	T	0.72566	0.3476	M	0.65975	2.015	0.80722	D	1	D	0.69078	0.997	D	0.70716	0.97	T	0.66337	-0.5949	10	0.13470	T	0.59	.	19.2104	0.93751	0.0:1.0:0.0:0.0	.	151	Q96HC4	PDLI5_HUMAN	S	151;29	ENSP00000321746:T151S;ENSP00000442187:T29S	ENSP00000321746:T151S	T	+	2	0	PDLIM5	95715950	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.993000	0.63895	2.590000	0.87494	0.655000	0.94253	ACC	C|0.999;T|0.001		0.542	PDLIM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253586.1		
SH3RF1	57630	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	170028338	170028338	+	Silent	SNP	A	A	G			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr4:170028338A>G	ENST00000284637.9	-	11	2499	c.2158T>C	c.(2158-2160)Ttg>Ctg	p.L720L		NM_020870.3	NP_065921.2	Q7Z6J0	SH3R1_HUMAN	SH3 domain containing ring finger 1	720					negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|protein ubiquitination (GO:0016567)|regulation of JNK cascade (GO:0046328)	cell projection (GO:0042995)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(10)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	31		Prostate(90;0.00267)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0287)		AGCAACTTCAACAAACCCTTT	0.468																																					p.L720L		.											.	SH3RF1-567	0			c.T2158C						.						26.0	30.0	29.0					4																	170028338		2196	4289	6485	SO:0001819	synonymous_variant	57630	exon11			ACTTCAACAAACC	BC033203	CCDS34099.1	4q32.3	2013-01-09	2006-02-13	2006-02-13	ENSG00000154447	ENSG00000154447		"""RING-type (C3HC4) zinc fingers"""	17650	protein-coding gene	gene with protein product	"""plenty of SH3 domains"""		"""SH3 multiple domains 2"""	SH3MD2		9482736	Standard	NM_020870		Approved	POSH, RNF142, KIAA1494	uc003isa.1	Q7Z6J0	OTTHUMG00000161010	ENST00000284637.9:c.2158T>C	4.37:g.170028338A>G		63	0		77	23	NM_020870	0	0	2	5	3	Q05BT2|Q8IW46|Q9HAM2|Q9P234	Silent	SNP	ENST00000284637.9	37	CCDS34099.1																																																																																			.		0.468	SH3RF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363382.3	NM_020870	
MYO10	4651	hgsc.bcm.edu	37	5	16877717	16877717	+	Splice_Site	SNP	C	C	G			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr5:16877717C>G	ENST00000513610.1	-	2	575		c.e2+1		MYO10_ENST00000507288.1_Splice_Site	NM_012334.2	NP_036466.2	Q9HD67	MYO10_HUMAN	myosin X						ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cytoskeleton-dependent intracellular transport (GO:0030705)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|regulation of cell shape (GO:0008360)|regulation of filopodium assembly (GO:0051489)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|plus-end directed microfilament motor activity (GO:0060002)|spectrin binding (GO:0030507)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|lung(28)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	86						CTTGTTCTCACCTGACCATAG	0.527																																					.		.											.	MYO10-3	0			c.120+1G>C						.						98.0	100.0	99.0					5																	16877717		2024	4184	6208	SO:0001630	splice_region_variant	4651	exon3			TTCTCACCTGACC	AF247457	CCDS54834.1	5p15.1-p14.3	2013-01-10				ENSG00000145555		"""Myosins / Myosin superfamily : Class X"", ""Pleckstrin homology (PH) domain containing"""	7593	protein-coding gene	gene with protein product		601481				8884266	Standard	NM_012334		Approved	KIAA0799	uc003jft.4	Q9HD67		ENST00000513610.1:c.120+1G>C	5.37:g.16877717C>G		26	0		35	2	NM_012334	0	0	0	0	0	A7E2D1|O94893|Q8IVX5|Q9NYM7|Q9P110|Q9P111|Q9UHF6	Splice_Site	SNP	ENST00000513610.1	37	CCDS54834.1	.	.	.	.	.	.	.	.	.	.	C	16.26	3.073138	0.55646	.	.	ENSG00000145555	ENST00000513610;ENST00000513882;ENST00000507288	.	.	.	5.12	5.12	0.69794	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.0413	0.80683	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MYO10	16930717	1.000000	0.71417	1.000000	0.80357	0.626000	0.37791	5.214000	0.65236	2.379000	0.81126	0.561000	0.74099	.	.		0.527	MYO10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366167.1	NM_012334	Intron
LOX	4015	hgsc.bcm.edu	37	5	121413456	121413456	+	Silent	SNP	G	G	C	rs2278226	byFrequency	TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr5:121413456G>C	ENST00000231004.4	-	1	524	c.225C>G	c.(223-225)gcC>gcG	p.A75A	LOX_ENST00000513319.1_5'Flank	NM_001178102.1|NM_002317.5	NP_001171573.1|NP_002308.2	P28300	LYOX_HUMAN	lysyl oxidase	75					blood vessel development (GO:0001568)|cellular protein modification process (GO:0006464)|collagen fibril organization (GO:0030199)|elastic fiber assembly (GO:0048251)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|response to drug (GO:0042493)|response to steroid hormone (GO:0048545)|wound healing (GO:0042060)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|nucleus (GO:0005634)|proteinaceous extracellular matrix (GO:0005578)	copper ion binding (GO:0005507)|protein-lysine 6-oxidase activity (GO:0004720)			endometrium(1)|lung(6)|prostate(1)	8		all_cancers(142;0.0124)|Prostate(80;0.0322)|Ovarian(225;0.0814)|Breast(839;0.143)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	Epithelial(69;2.14e-11)|OV - Ovarian serous cystadenocarcinoma(64;7.87e-10)|all cancers(49;2.49e-09)|COAD - Colon adenocarcinoma(49;0.02)		CACCAGGGACGGCGGCGCCCG	0.721													G|||	46	0.0091853	0.0008	0.0101	5008	,	,		11081	0.0367		0.0	False		,,,				2504	0.001				p.A75A		.											.	LOX-650	0			c.C225G						.						3.0	4.0	4.0					5																	121413456		1880	3759	5639	SO:0001819	synonymous_variant	4015	exon1			AGGGACGGCGGCG		CCDS4129.1	5q23.3-q31.2	2008-02-05			ENSG00000113083	ENSG00000113083	1.4.3.13		6664	protein-coding gene	gene with protein product		153455				1685472	Standard	NM_002317		Approved		uc003ksu.3	P28300	OTTHUMG00000128914	ENST00000231004.4:c.225C>G	5.37:g.121413456G>C		4	2		12	4	NM_002317	0	0	0	0	0	B2R5Q3|Q5FWF0	Silent	SNP	ENST00000231004.4	37	CCDS4129.1																																																																																			G|0.017;C|0.983		0.721	LOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250887.2		
HINT1	3094	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	130500845	130500845	+	Silent	SNP	G	G	T			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr5:130500845G>T	ENST00000304043.5	-	1	333	c.54C>A	c.(52-54)atC>atA	p.I18I	HINT1_ENST00000513012.1_Silent_p.I18I|HINT1_ENST00000506207.1_Intron|HINT1_ENST00000506908.1_Silent_p.I18I|HINT1_ENST00000508488.1_Silent_p.I18I	NM_005340.6	NP_005331.1	P49773	HINT1_HUMAN	histidine triad nucleotide binding protein 1	18	HIT. {ECO:0000255|PROSITE- ProRule:PRU00464}.				intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|purine ribonucleotide catabolic process (GO:0009154)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|nucleotide binding (GO:0000166)|protein kinase C binding (GO:0005080)			endometrium(1)|large_intestine(1)|lung(3)	5		all_cancers(142;0.0452)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		Adenosine monophosphate(DB00131)	TCTTCCCAAAGATCGTGTCGC	0.587																																					p.I18I		.											.	HINT1-90	0			c.C54A						.						83.0	74.0	77.0					5																	130500845		2203	4300	6503	SO:0001819	synonymous_variant	3094	exon1			CCCAAAGATCGTG	BC007090	CCDS4147.1	5q31.2	2010-03-30	2001-11-28	2002-03-08	ENSG00000169567	ENSG00000169567			4912	protein-coding gene	gene with protein product		601314	"""histidine triad nucleotide-binding protein"""	PRKCNH1, HINT		8812426	Standard	NM_005340		Approved	PKCI-1	uc003kve.4	P49773	OTTHUMG00000128995	ENST00000304043.5:c.54C>A	5.37:g.130500845G>T		70	0		107	40	NM_005340	1	0	297	538	240	Q9H5W8	Silent	SNP	ENST00000304043.5	37	CCDS4147.1																																																																																			.		0.587	HINT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250984.1	NM_005340	
TBC1D9B	23061	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	179326225	179326225	+	Silent	SNP	C	C	T			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr5:179326225C>T	ENST00000356834.3	-	3	349	c.312G>A	c.(310-312)gaG>gaA	p.E104E	TBC1D9B_ENST00000355235.3_Silent_p.E104E	NM_198868.2	NP_942568.2	Q66K14	TBC9B_HUMAN	TBC1 domain family, member 9B (with GRAM domain)	104						integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	28	all_cancers(89;0.000197)|all_epithelial(37;6.84e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0236)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TGATATCTTCCTCACTGTCGA	0.478																																					p.E104E		.											.	TBC1D9B-154	0			c.G312A						.						186.0	155.0	166.0					5																	179326225		2203	4300	6503	SO:0001819	synonymous_variant	23061	exon3			ATCTTCCTCACTG	AB014576	CCDS4450.1, CCDS43408.1	5q35.3	2013-01-10			ENSG00000197226	ENSG00000197226		"""EF-hand domain containing"""	29097	protein-coding gene	gene with protein product						9734811	Standard	NM_198868		Approved	KIAA0676	uc003mlh.3	Q66K14	OTTHUMG00000130911	ENST00000356834.3:c.312G>A	5.37:g.179326225C>T		45	0		59	19	NM_198868	0	0	10	17	7	D3DWQ5|D3DWQ6|O75163|Q53EY0|Q6MZI2|Q96H49	Silent	SNP	ENST00000356834.3	37	CCDS43408.1																																																																																			.		0.478	TBC1D9B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253501.3	NM_015043	
CDKAL1	54901	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	20846322	20846322	+	Missense_Mutation	SNP	A	A	G			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr6:20846322A>G	ENST00000378610.1	+	7	665	c.655A>G	c.(655-657)Acc>Gcc	p.T219A	CDKAL1_ENST00000274695.4_Missense_Mutation_p.T219A|CDKAL1_ENST00000378624.4_Missense_Mutation_p.T149A			Q5VV42	CDKAL_HUMAN	CDK5 regulatory subunit associated protein 1-like 1	219					maintenance of translational fidelity (GO:1990145)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|rough endoplasmic reticulum (GO:0005791)	4 iron, 4 sulfur cluster binding (GO:0051539)|metal ion binding (GO:0046872)|N6-threonylcarbomyladenosine methylthiotransferase activity (GO:0035598)			breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(14)|ovary(2)|stomach(1)	29	all_epithelial(95;0.0708)|Breast(50;0.131)|Ovarian(93;0.227)		OV - Ovarian serous cystadenocarcinoma(7;0.0241)|all cancers(50;0.123)|Epithelial(50;0.248)			CAATGCTTGTACCTACTGCAA	0.343																																					p.T219A		.											.	CDKAL1-92	0			c.A655G						.						75.0	75.0	75.0					6																	20846322		2203	4300	6503	SO:0001583	missense	54901	exon9			GCTTGTACCTACT	AK000349	CCDS4546.1	6p22.2	2008-02-05			ENSG00000145996	ENSG00000145996			21050	protein-coding gene	gene with protein product		611259					Standard	NM_017774		Approved	FLJ20342	uc003ndd.2	Q5VV42	OTTHUMG00000014340	ENST00000378610.1:c.655A>G	6.37:g.20846322A>G	ENSP00000367873:p.Thr219Ala	73	0		69	23	NM_017774	0	0	1	5	4	A8K6S0|Q6P385|Q6ZR27|Q9NXB3	Missense_Mutation	SNP	ENST00000378610.1	37	CCDS4546.1	.	.	.	.	.	.	.	.	.	.	A	25.2	4.612488	0.87258	.	.	ENSG00000145996	ENST00000274695;ENST00000378624;ENST00000378610	T;T;T	0.24151	1.87;1.87;1.87	5.81	5.81	0.92471	Elongator protein 3/MiaB/NifB (1);Radical SAM, alpha/beta horseshoe (1);Methylthiotransferase, conserved site (1);Radical SAM (1);	0.000000	0.85682	D	0.000000	T	0.42607	0.1210	M	0.66378	2.025	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.97110	1.0;0.951	T	0.42378	-0.9455	10	0.87932	D	0	.	16.1616	0.81721	1.0:0.0:0.0:0.0	.	149;219	Q5VV42-2;Q5VV42	.;CDKAL_HUMAN	A	219;149;219	ENSP00000274695:T219A;ENSP00000367889:T149A;ENSP00000367873:T219A	ENSP00000274695:T219A	T	+	1	0	CDKAL1	20954301	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.971000	0.76105	2.218000	0.71995	0.377000	0.23210	ACC	.		0.343	CDKAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039986.1	NM_017774	
TJAP1	93643	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	43472653	43472653	+	Missense_Mutation	SNP	A	A	G			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr6:43472653A>G	ENST00000372445.5	+	11	1110	c.734A>G	c.(733-735)aAt>aGt	p.N245S	TJAP1_ENST00000259751.1_Missense_Mutation_p.N235S|TJAP1_ENST00000372444.2_Missense_Mutation_p.N235S|TJAP1_ENST00000436109.2_Missense_Mutation_p.N235S|TJAP1_ENST00000372452.1_Missense_Mutation_p.N235S|TJAP1_ENST00000372449.1_Missense_Mutation_p.N245S|TJAP1_ENST00000483640.1_3'UTR|TJAP1_ENST00000438588.2_Missense_Mutation_p.N245S	NM_001146016.1	NP_001139488.1	Q5JTD0	TJAP1_HUMAN	tight junction associated protein 1 (peripheral)	245					Golgi organization (GO:0007030)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)|trans-Golgi network (GO:0005802)				cervix(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|urinary_tract(2)	21	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0122)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)			CTACTGCTCAATTCAGCCCAG	0.637																																					p.N245S		.											.	TJAP1-90	0			c.A734G						.						88.0	89.0	88.0					6																	43472653		2203	4300	6503	SO:0001583	missense	93643	exon11			TGCTCAATTCAGC	AK024269	CCDS4898.1, CCDS55004.1	6p21.1	2008-02-05	2005-07-05	2005-07-05	ENSG00000137221	ENSG00000137221			17949	protein-coding gene	gene with protein product		612658	"""tight junction protein 4 (peripheral)"""	TJP4		11602598	Standard	NM_001146016		Approved	PILT	uc011dvh.1	Q5JTD0	OTTHUMG00000014736	ENST00000372445.5:c.734A>G	6.37:g.43472653A>G	ENSP00000361522:p.Asn245Ser	161	0		182	20	NM_001146016	0	0	12	12	0	Q05BH9|Q5JTD1|Q5JWW1|Q68DB2|Q6P2P3|Q9H7V7	Missense_Mutation	SNP	ENST00000372445.5	37	CCDS55004.1	.	.	.	.	.	.	.	.	.	.	A	18.71	3.681816	0.68042	.	.	ENSG00000137221	ENST00000372444;ENST00000372445;ENST00000436109;ENST00000259751;ENST00000372454;ENST00000372452;ENST00000372449;ENST00000438588	T;T;T;T;T;T;T	0.20881	2.04;2.04;2.04;2.04;2.04;2.04;2.04	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	T	0.21022	0.0506	L	0.31664	0.95	0.58432	D	0.999999	D;D	0.89917	0.998;1.0	D;D	0.83275	0.987;0.996	T	0.05037	-1.0910	10	0.20046	T	0.44	-53.1615	14.9298	0.70906	1.0:0.0:0.0:0.0	.	245;235	Q5JTD0;Q5JTD0-2	TJAP1_HUMAN;.	S	235;245;235;235;235;235;245;245	ENSP00000361521:N235S;ENSP00000361522:N245S;ENSP00000407080:N235S;ENSP00000259751:N235S;ENSP00000361530:N235S;ENSP00000361527:N245S;ENSP00000408769:N245S	ENSP00000259751:N235S	N	+	2	0	TJAP1	43580631	1.000000	0.71417	0.995000	0.50966	0.806000	0.45545	8.900000	0.92551	1.912000	0.55364	0.459000	0.35465	AAT	.		0.637	TJAP1-202	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000040629.1	NM_080604	
THBS2	7058	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	169642014	169642014	+	Missense_Mutation	SNP	C	C	G			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr6:169642014C>G	ENST00000366787.3	-	6	983	c.734G>C	c.(733-735)cGc>cCc	p.R245P	XXyac-YX65C7_A.2_ENST00000444188.1_RNA	NM_003247.2	NP_003238.2	P35442	TSP2_HUMAN	thrombospondin 2	245					cell adhesion (GO:0007155)|negative regulation of angiogenesis (GO:0016525)|positive regulation of synapse assembly (GO:0051965)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|platelet alpha granule (GO:0031091)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			NS(3)|biliary_tract(1)|endometrium(8)|kidney(3)|large_intestine(23)|liver(1)|lung(56)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	111		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)		CGGACCCAGGCGCAGCGTCTC	0.647																																					p.R245P	Esophageal Squamous(91;219 1934 18562 44706)	.											.	THBS2-95	0			c.G734C						.						50.0	45.0	47.0					6																	169642014		2202	4300	6502	SO:0001583	missense	7058	exon6			CCCAGGCGCAGCG		CCDS34574.1	6q27	2008-07-28			ENSG00000186340	ENSG00000186340			11786	protein-coding gene	gene with protein product		188061				18455130	Standard	NM_003247		Approved	TSP2	uc003qwt.3	P35442	OTTHUMG00000045408	ENST00000366787.3:c.734G>C	6.37:g.169642014C>G	ENSP00000355751:p.Arg245Pro	92	0		91	34	NM_003247	0	0	11	13	2	A6H8N1|A7E232|Q5RI52	Missense_Mutation	SNP	ENST00000366787.3	37	CCDS34574.1	.	.	.	.	.	.	.	.	.	.	C	6.539	0.467797	0.12402	.	.	ENSG00000186340	ENST00000366787	T	0.80994	-1.44	4.75	0.174	0.15040	.	0.371764	0.19184	U	0.120604	T	0.47525	0.1450	N	0.22421	0.69	0.22412	N	0.999129	B	0.26845	0.161	B	0.25506	0.061	T	0.44922	-0.9296	10	0.46703	T	0.11	-42.5921	9.6944	0.40147	0.0:0.2486:0.0:0.7513	.	245	P35442	TSP2_HUMAN	P	245	ENSP00000355751:R245P	ENSP00000355751:R245P	R	-	2	0	THBS2	169383939	0.998000	0.40836	0.177000	0.23020	0.004000	0.04260	0.342000	0.19926	0.182000	0.20032	-0.658000	0.03865	CGC	.		0.647	THBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000105439.1	NM_003247	
ZNF679	168417	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	63726979	63726979	+	Missense_Mutation	SNP	C	C	G			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr7:63726979C>G	ENST00000421025.1	+	5	1237	c.968C>G	c.(967-969)cCc>cGc	p.P323R	ZNF679_ENST00000255746.4_Missense_Mutation_p.P323R	NM_001159524.1|NM_153363.2	NP_001152996.1|NP_699194.2	Q8IYX0	ZN679_HUMAN	zinc finger protein 679	323					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(3)|lung(11)|skin(1)|stomach(1)	18						GGAGAGAAACCCTACACATGT	0.398																																					p.P323R													.	ZNF679-1	0			c.C968G						.						26.0	27.0	27.0					7																	63726979		692	1591	2283	SO:0001583	missense	168417	exon5			AGAAACCCTACAC	BC033523	CCDS47592.1	7q11.21	2013-01-08			ENSG00000197123	ENSG00000197123		"""Zinc fingers, C2H2-type"", ""-"""	28650	protein-coding gene	gene with protein product	"""hypothetical protein MGC42415"""					12477932	Standard	NM_153363		Approved	MGC42415	uc003tsx.3	Q8IYX0	OTTHUMG00000156486	ENST00000421025.1:c.968C>G	7.37:g.63726979C>G	ENSP00000416809:p.Pro323Arg	35	0		97	33	NM_153363	0	0	40	40	0		Missense_Mutation	SNP	ENST00000421025.1	37	CCDS47592.1	.	.	.	.	.	.	.	.	.	.	C	11.23	1.576050	0.28092	.	.	ENSG00000197123	ENST00000421025;ENST00000255746	T;T	0.17213	2.29;2.29	0.81	0.81	0.18732	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.28962	0.0719	L	0.46819	1.47	0.37644	D	0.922144	D	0.89917	1.0	D	0.97110	1.0	T	0.11641	-1.0579	9	0.72032	D	0.01	.	6.9761	0.24677	0.0:1.0:0.0:0.0	.	323	Q8IYX0	ZN679_HUMAN	R	323	ENSP00000416809:P323R;ENSP00000255746:P323R	ENSP00000255746:P323R	P	+	2	0	ZNF679	63364414	0.775000	0.28604	0.437000	0.26809	0.440000	0.31957	3.755000	0.55197	0.181000	0.19994	0.184000	0.17185	CCC	.		0.398	ZNF679-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344317.2	NM_153363	
KCTD7	154881	hgsc.bcm.edu	37	7	66094155	66094155	+	Missense_Mutation	SNP	C	C	G			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr7:66094155C>G	ENST00000275532.3	+	1	288	c.104C>G	c.(103-105)gCc>gGc	p.A35G	KCTD7_ENST00000443322.1_Missense_Mutation_p.A35G	NM_001167961.2|NM_153033.4	NP_001161433.1|NP_694578.1	Q96MP8	KCTD7_HUMAN	potassium channel tetramerization domain containing 7	35					cell death (GO:0008219)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|urinary_tract(1)	16						ACGCCGACGGCCACGCAGGCG	0.761																																					p.A35G		.											.	KCTD7-92	0			c.C104G						.						11.0	12.0	11.0					7																	66094155		2154	4203	6357	SO:0001583	missense	154881	exon1			CGACGGCCACGCA	AK056631	CCDS5534.1, CCDS55117.1	7q11.21	2014-09-17	2013-06-20		ENSG00000243335	ENSG00000243335			21957	protein-coding gene	gene with protein product		611725	"""potassium channel tetramerisation domain containing 7"""			12477932	Standard	NM_001167961		Approved	FLJ32069, EPM3, CLN14	uc003tve.3	Q96MP8	OTTHUMG00000129543	ENST00000275532.3:c.104C>G	7.37:g.66094155C>G	ENSP00000275532:p.Ala35Gly	21	0		37	2	NM_001167961	0	0	0	0	0	A4D2M4|Q8IVR0	Missense_Mutation	SNP	ENST00000275532.3	37	CCDS5534.1	.	.	.	.	.	.	.	.	.	.	N	25.8	4.676338	0.88445	.	.	ENSG00000243335	ENST00000275532;ENST00000443322;ENST00000449064	T;T	0.65178	-0.14;-0.14	3.93	3.93	0.45458	.	.	.	.	.	T	0.47619	0.1455	N	0.19112	0.55	0.80722	D	1	B	0.25105	0.118	B	0.24006	0.05	T	0.44711	-0.9310	9	0.33940	T	0.23	.	15.2139	0.73247	0.0:1.0:0.0:0.0	.	35	Q96MP8	KCTD7_HUMAN	G	35	ENSP00000275532:A35G;ENSP00000411624:A35G	ENSP00000275532:A35G	A	+	2	0	KCTD7	65731590	1.000000	0.71417	1.000000	0.80357	0.499000	0.33736	5.266000	0.65525	2.056000	0.61249	0.154000	0.16183	GCC	.		0.761	KCTD7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251733.2	NM_153033	
RELN	5649	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	103292216	103292216	+	Missense_Mutation	SNP	G	G	C			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr7:103292216G>C	ENST00000428762.1	-	15	1943	c.1784C>G	c.(1783-1785)aCc>aGc	p.T595S	RELN_ENST00000343529.5_Missense_Mutation_p.T595S|RELN_ENST00000424685.2_Missense_Mutation_p.T595S	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	595					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		CCCATGGTTGGTAGAAAATTC	0.463																																					p.T595S	NSCLC(146;835 1944 15585 22231 52158)	.											.	RELN-574	0			c.C1784G						.						64.0	52.0	56.0					7																	103292216		2203	4300	6503	SO:0001583	missense	5649	exon15			TGGTTGGTAGAAA		CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.1784C>G	7.37:g.103292216G>C	ENSP00000392423:p.Thr595Ser	29	0		90	43	NM_173054	0	0	0	2	2	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	ENST00000428762.1	37	CCDS47680.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.770518	0.90108	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	T;T;T	0.25085	1.82;1.82;1.82	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.47801	0.1465	L	0.46157	1.445	0.58432	D	0.999998	D;D	0.76494	0.999;0.982	D;D	0.77557	0.99;0.952	T	0.34279	-0.9835	10	0.66056	D	0.02	.	20.0693	0.97712	0.0:0.0:1.0:0.0	.	595;595	P78509-2;P78509	.;RELN_HUMAN	S	595	ENSP00000392423:T595S;ENSP00000345694:T595S;ENSP00000388446:T595S	ENSP00000345694:T595S	T	-	2	0	RELN	103079452	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	9.476000	0.97823	2.758000	0.94735	0.563000	0.77884	ACC	.		0.463	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045	
JPH1	56704	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	75227665	75227665	+	Silent	SNP	G	G	A			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr8:75227665G>A	ENST00000342232.4	-	2	610	c.570C>T	c.(568-570)cgC>cgT	p.R190R		NM_020647.2	NP_065698.1	Q9HDC5	JPH1_HUMAN	junctophilin 1	190					calcium ion transport into cytosol (GO:0060402)|muscle organ development (GO:0007517)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	24	Breast(64;0.00576)		BRCA - Breast invasive adenocarcinoma(89;0.0499)|Epithelial(68;0.0728)|all cancers(69;0.176)			CGAAACCGCCGCGGGTGCCGG	0.682																																					p.R190R		.											.	JPH1-91	0			c.C570T						.						14.0	18.0	16.0					8																	75227665		2161	4223	6384	SO:0001819	synonymous_variant	56704	exon2			ACCGCCGCGGGTG	AB042634	CCDS6217.1	8q21	2008-07-03			ENSG00000104369	ENSG00000104369			14201	protein-coding gene	gene with protein product		605266				10891348, 10949023	Standard	XM_005251273		Approved	JP-1	uc003yae.3	Q9HDC5	OTTHUMG00000164524	ENST00000342232.4:c.570C>T	8.37:g.75227665G>A		54	0		73	24	NM_020647	0	0	0	0	0	B2RTZ0	Silent	SNP	ENST00000342232.4	37	CCDS6217.1																																																																																			.		0.682	JPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379102.1		
FAM135B	51059	broad.mit.edu;bcgsc.ca	37	8	139180285	139180285	+	Missense_Mutation	SNP	T	T	C			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr8:139180285T>C	ENST00000395297.1	-	12	1281	c.1111A>G	c.(1111-1113)Acg>Gcg	p.T371A		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	371										NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			TGGCTGTGCGTCTGTATCCTG	0.587										HNSCC(54;0.14)																											p.T371A													.	FAM135B-31	0			c.A1111G						.						84.0	91.0	89.0					8																	139180285		2108	4234	6342	SO:0001583	missense	51059	exon12			TGTGCGTCTGTAT	AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.1111A>G	8.37:g.139180285T>C	ENSP00000378710:p.Thr371Ala	111	0		161	7	NM_015912	0	0	0	0	0	B5MDB3|O95879|Q2WGJ7|Q3KP46	Missense_Mutation	SNP	ENST00000395297.1	37	CCDS6375.2	.	.	.	.	.	.	.	.	.	.	T	12.75	2.032813	0.35893	.	.	ENSG00000147724	ENST00000395297	D	0.88201	-2.35	5.66	3.16	0.36331	.	0.611892	0.17190	N	0.183555	D	0.85852	0.5793	M	0.63428	1.95	0.27501	N	0.951993	B	0.19817	0.039	B	0.16722	0.016	T	0.75422	-0.3323	10	0.38643	T	0.18	-6.9288	10.1146	0.42583	0.2674:0.0:0.0:0.7326	.	371	Q49AJ0	F135B_HUMAN	A	371	ENSP00000378710:T371A	ENSP00000276737:T371A	T	-	1	0	FAM135B	139249467	0.993000	0.37304	0.963000	0.40424	0.275000	0.26752	2.562000	0.45914	0.433000	0.26313	0.533000	0.62120	ACG	.		0.587	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313590.3	NM_015912	
CYP11B1	1584	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	143956729	143956729	+	Splice_Site	SNP	C	C	G			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr8:143956729C>G	ENST00000292427.4	-	7	1154		c.e7-1		CYP11B1_ENST00000517471.1_Splice_Site|CYP11B1_ENST00000377675.3_Splice_Site	NM_000497.3	NP_000488.3	P15538	C11B1_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 1						aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|glucocorticoid biosynthetic process (GO:0006704)|glucose homeostasis (GO:0042593)|immune response (GO:0006955)|mineralocorticoid biosynthetic process (GO:0006705)|regulation of blood pressure (GO:0008217)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)			central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|lung(36)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	67	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Cimetidine(DB00501)|Clotrimazole(DB00257)|Etomidate(DB00292)|Fluconazole(DB00196)|Hydrocortisone(DB00741)|Ketoconazole(DB01026)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Miconazole(DB01110)|Mitotane(DB00648)|Phenytoin(DB00252)|Spironolactone(DB00421)	AGGGTAGAGCCTGGAGGTGGG	0.602									Familial Hyperaldosteronism type I																												.		.											.	CYP11B1-94	0			c.1122-1G>C						.						39.0	43.0	41.0					8																	143956729		2203	4300	6503	SO:0001630	splice_region_variant	1584	exon8	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	TAGAGCCTGGAGG	D16153	CCDS6392.1, CCDS34953.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000160882	ENSG00000160882	1.14.15.4	"""Cytochrome P450s"""	2591	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	610613	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 1"""	CYP11B		1303253	Standard	XM_005250807		Approved	P450C11, FHI, CPN1	uc003yxi.3	P15538	OTTHUMG00000164637	ENST00000292427.4:c.1122-1G>C	8.37:g.143956729C>G		35	0		40	16	NM_001026213	0	0	0	0	0	Q14095|Q4VAQ8|Q4VAQ9|Q9UML2	Splice_Site	SNP	ENST00000292427.4	37	CCDS6392.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	13.78|13.78	2.338412|2.338412	0.41398|0.41398	.|.	.|.	ENSG00000160882|ENSG00000160882	ENST00000292427;ENST00000517471;ENST00000377675|ENST00000519285	.|D	.|0.97480	.|-4.4	3.12|3.12	3.12|3.12	0.35913|0.35913	.|.	.|.	.|.	.|.	.|.	.|D	.|0.96836	.|0.8967	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|D	.|0.95728	.|0.8772	.|5	.|.	.|.	.|.	.|.	12.4777|12.4777	0.55823|0.55823	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	.|T	-1|52	.|ENSP00000430144:R52T	.|.	.|R	-|-	.|2	.|0	CYP11B1|CYP11B1	143953731|143953731	1.000000|1.000000	0.71417|0.71417	0.985000|0.985000	0.45067|0.45067	0.194000|0.194000	0.23727|0.23727	4.120000|4.120000	0.57897|0.57897	2.055000|2.055000	0.61198|0.61198	0.555000|0.555000	0.69702|0.69702	.|AGG	.		0.602	CYP11B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379475.2		Intron
MLLT3	4300	hgsc.bcm.edu	37	9	20414373	20414373	+	Silent	SNP	G	G	A			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr9:20414373G>A	ENST00000380338.4	-	5	757	c.471C>T	c.(469-471)agC>agT	p.S157S	MLLT3_ENST00000355930.6_5'UTR|MLLT3_ENST00000475957.1_5'UTR|MLLT3_ENST00000429426.2_Silent_p.S154S	NM_004529.2	NP_004520.2	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3	157	Poly-Ser.				anterior/posterior pattern specification (GO:0009952)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of transcription, DNA-templated (GO:0006355)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)		p.S157S(5)		central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(6)|lung(24)|ovary(1)|prostate(4)|skin(1)|urinary_tract(7)	66				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		tgctgctgctgctactgctgc	0.527			T	MLL	ALL																																p.S157S		.		Dom	yes		9	9p22	4300	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (AF9)"""		L	.	MLLT3-660	5	Substitution - coding silent(5)	endometrium(3)|urinary_tract(1)|prostate(1)	c.C471T						.						9.0	14.0	12.0					9																	20414373		1757	3647	5404	SO:0001819	synonymous_variant	4300	exon5			GCTGCTGCTACTG	L13744	CCDS6494.1	9p22	2008-02-05	2001-11-28		ENSG00000171843	ENSG00000171843			7136	protein-coding gene	gene with protein product		159558	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 3"""			8506309, 8414510	Standard	NM_001286691		Approved	AF-9, AF9, YEATS3	uc003zoe.2	P42568	OTTHUMG00000019650	ENST00000380338.4:c.471C>T	9.37:g.20414373G>A		42	0		56	4	NM_004529	0	0	11	11	0	B1AMQ2|B2R7B3|B7Z755|D3DRJ8|Q8IVB0	Silent	SNP	ENST00000380338.4	37	CCDS6494.1																																																																																			.		0.527	MLLT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051872.1	NM_004529	
GPR3	2827	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	27720330	27720350	+	In_Frame_Del	DEL	GCCTGGCTCTCAGCTGGCTCA	GCCTGGCTCTCAGCTGGCTCA	-			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	GCCTGGCTCTCAGCTGGCTCA	GCCTGGCTCTCAGCTGGCTCA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr1:27720330_27720350delGCCTGGCTCTCAGCTGGCTCA	ENST00000374024.3	+	2	127_147	c.28_48delGCCTGGCTCTCAGCTGGCTCA	c.(28-48)gcctggctctcagctggctcadel	p.AWLSAGS10del		NM_005281.3	NP_005272.1	P46089	GPR3_HUMAN	G protein-coupled receptor 3	10					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|regulation of meiosis (GO:0040020)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			endometrium(3)|lung(3)|ovary(1)|skin(1)	8		Breast(348;1.53e-05)|Ovarian(437;0.0606)|all_lung(284;0.157)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0415)|OV - Ovarian serous cystadenocarcinoma(117;2.81e-26)|Colorectal(126;1.24e-08)|KIRC - Kidney renal clear cell carcinoma(1967;3.23e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;4.45e-06)|Lung(427;0.00163)|STAD - Stomach adenocarcinoma(196;0.00303)|LUSC - Lung squamous cell carcinoma(448;0.008)|READ - Rectum adenocarcinoma(331;0.0419)		CAGCCCTCTGGCCTGGCTCTCAGCTGGCTCAGGCAACGTGA	0.633																																					p.10_16del		.											.	GPR3-91	0			c.28_48del						.																																			SO:0001651	inframe_deletion	2827	exon2			.	BC032702	CCDS303.1	1p36.1-p35	2012-08-21			ENSG00000181773	ENSG00000181773		"""GPCR / Class A : Orphans"""	4484	protein-coding gene	gene with protein product		600241				7851889	Standard	NM_005281		Approved	ACCA	uc001bod.4	P46089	OTTHUMG00000003397	ENST00000374024.3:c.28_48delGCCTGGCTCTCAGCTGGCTCA	1.37:g.27720330_27720350delGCCTGGCTCTCAGCTGGCTCA	ENSP00000363136:p.Ala10_Ser16del	204	0		184	32	NM_005281	0	0	0	0	0	A8K570	In_Frame_Del	DEL	ENST00000374024.3	37	CCDS303.1																																																																																			.		0.633	GPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009522.1	NM_005281	
ING4	51147	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	6761549	6761549	+	Frame_Shift_Del	DEL	C	C	-			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr12:6761549delC	ENST00000396807.4	-	6	574	c.536delG	c.(535-537)ggcfs	p.G179fs	ING4_ENST00000341550.4_Frame_Shift_Del_p.G178fs|ING4_ENST00000486287.1_Intron|ING4_ENST00000446105.2_Frame_Shift_Del_p.G175fs|ING4_ENST00000444704.2_Frame_Shift_Del_p.G155fs|ING4_ENST00000412586.2_Frame_Shift_Del_p.G176fs|ING4_ENST00000423703.2_Intron	NM_001127582.1|NM_001127585.1|NM_001127586.1|NM_016162.3	NP_001121054.1|NP_001121057.1|NP_001121058.1|NP_057246.2	Q9UNL4	ING4_HUMAN	inhibitor of growth family, member 4	179					apoptotic process (GO:0006915)|cell cycle arrest (GO:0007050)|chromatin organization (GO:0006325)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA replication (GO:0006260)|histone H3 acetylation (GO:0043966)|histone H4-K12 acetylation (GO:0043983)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of cell proliferation (GO:0008285)|negative regulation of growth (GO:0045926)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|protein acetylation (GO:0006473)	histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	methylated histone binding (GO:0035064)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			central_nervous_system(3)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)	10						GTGGACACTGCCAAAGGTCAC	0.512																																					p.G179fs		.											.	ING4-515	0			c.536delG						.						186.0	161.0	169.0					12																	6761549		2203	4300	6503	SO:0001589	frameshift_variant	51147	exon6			.	AF063594	CCDS8555.1, CCDS44812.1, CCDS44813.1, CCDS44814.1, CCDS44815.1, CCDS44816.1	12p13.32	2013-01-28			ENSG00000111653	ENSG00000111653		"""Zinc fingers, PHD-type"""	19423	protein-coding gene	gene with protein product		608524				12750254	Standard	NM_001127582		Approved	p29ING4, my036	uc001qpw.4	Q9UNL4	OTTHUMG00000141274	ENST00000396807.4:c.536delG	12.37:g.6761549delC	ENSP00000380024:p.Gly179fs	189	0		169	49	NM_001127582	0	0	0	0	0	A4KYM4|A4KYM6|D3DUR8|Q0EF62|Q0EF63|Q4VBQ6|Q96E15|Q9H3J0	Frame_Shift_Del	DEL	ENST00000396807.4	37	CCDS44813.1																																																																																			.		0.512	ING4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000280467.2	NM_198287	
CEMIP	57214	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	81221510	81221511	+	Frame_Shift_Del	DEL	AG	AG	-	rs201251202		TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	AG	AG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr15:81221510_81221511delAG	ENST00000394685.3	+	21	3026_3027	c.2607_2608delAG	c.(2605-2610)ataggcfs	p.IG869fs	RP11-351M8.2_ENST00000560873.1_RNA|KIAA1199_ENST00000356249.5_Frame_Shift_Del_p.IG869fs|KIAA1199_ENST00000220244.3_Frame_Shift_Del_p.IG869fs			Q8WUJ3	CEMIP_HUMAN		869					hyaluronan catabolic process (GO:0030214)|positive regulation of cell migration (GO:0030335)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase C activity (GO:1900020)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|sensory perception of sound (GO:0007605)	clathrin-coated vesicle membrane (GO:0030665)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	clathrin heavy chain binding (GO:0032050)|ER retention sequence binding (GO:0046923)|hyaluronic acid binding (GO:0005540)|hyalurononglucosaminidase activity (GO:0004415)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(14)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						CCCTCCCTATAGGCCAGTAGGT	0.51																																					p.869_870del		.											.	KIAA1199-93	0			c.2607_2608del						.																																			SO:0001589	frameshift_variant	57214	exon20			.																												ENST00000394685.3:c.2607_2608delAG	15.37:g.81221510_81221511delAG	ENSP00000378177:p.Ile869fs	97	0		141	54	NM_018689	0	0	0	0	0	Q6L9J5|Q9H1K5|Q9NPN9|Q9ULM1	Frame_Shift_Del	DEL	ENST00000394685.3	37	CCDS10315.1																																																																																			.		0.510	KIAA1199-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000291389.1		
ZNF347	84671	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	53643573	53643575	+	In_Frame_Del	DEL	TGA	TGA	-			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	TGA	TGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr19:53643573_53643575delTGA	ENST00000334197.7	-	5	2574_2576	c.2506_2508delTCA	c.(2506-2508)tcadel	p.S836del	ZNF347_ENST00000601469.2_In_Frame_Del_p.S837del|ZNF347_ENST00000452676.2_In_Frame_Del_p.S837del|ZNF347_ENST00000601804.1_Intron	NM_032584.2	NP_115973.2	Q96SE7	ZN347_HUMAN	zinc finger protein 347	836					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|prostate(3)|skin(1)	23				GBM - Glioblastoma multiforme(134;0.0179)		ATGAATTCTGTGATGGCTTGCAA	0.394																																					p.837_837del	Melanoma(64;205 1597 17324 45721)	.											.	ZNF347-90	0			c.2509_2511del						.																																			SO:0001651	inframe_deletion	84671	exon5			.	AY029765	CCDS33097.1, CCDS54314.1	19q13.3	2013-01-08				ENSG00000197937		"""Zinc fingers, C2H2-type"", ""-"""	16447	protein-coding gene	gene with protein product							Standard	NM_032584		Approved	ZNF1111	uc010eql.2	Q96SE7		ENST00000334197.7:c.2506_2508delTCA	19.37:g.53643573_53643575delTGA	ENSP00000334146:p.Ser836del	193	0		170	46	NM_001172675	0	0	0	0	0	B3KU77|B9EG59|G5E9N4|Q8TCN1	In_Frame_Del	DEL	ENST00000334197.7	37	CCDS33097.1																																																																																			.		0.394	ZNF347-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464170.1	NM_032584	
TTLL12	23170	broad.mit.edu;bcgsc.ca	37	22	43579135	43579149	+	In_Frame_Del	DEL	CACTTCCCCAGCGTC	CACTTCCCCAGCGTC	-	rs146360108|rs571455195		TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	CACTTCCCCAGCGTC	CACTTCCCCAGCGTC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr22:43579135_43579149delCACTTCCCCAGCGTC	ENST00000216129.6	-	2	247_261	c.184_198delGACGCTGGGGAAGTG	c.(184-198)gacgctggggaagtgdel	p.DAGEV62del		NM_015140.3	NP_055955.1	Q14166	TTL12_HUMAN	tubulin tyrosine ligase-like family, member 12	62					cellular protein modification process (GO:0006464)			p.D62D(1)		central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)	13		Ovarian(80;0.221)|Glioma(61;0.222)				TGATCCCAAACACTTCCCCAGCGTCGAAAACCTGG	0.637																																					p.62_66del													.	TTLL12-90	1	Substitution - coding silent(1)	large_intestine(1)	c.184_198del						.																																			SO:0001651	inframe_deletion	23170	exon2			CCCAAACACTTCC	D63487	CCDS14047.1	22q13.31	2013-02-14	2006-02-02		ENSG00000100304	ENSG00000100304		"""Tubulin tyrosine ligase-like family"""	28974	protein-coding gene	gene with protein product						15890843	Standard	NM_015140		Approved	KIAA0153	uc003bdp.3	Q14166	OTTHUMG00000150682	ENST00000216129.6:c.184_198delGACGCTGGGGAAGTG	22.37:g.43579135_43579149delCACTTCCCCAGCGTC	ENSP00000216129:p.Asp62_Val66del	198	0		204	16	NM_015140	0	0	0	0	0	Q20WK5|Q9UGU3	In_Frame_Del	DEL	ENST00000216129.6	37	CCDS14047.1																																																																																			.		0.637	TTLL12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319611.1	NM_015140	
ACY1	95	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	52020519	52020519	+	Splice_Site	DEL	G	G	-			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr3:52020519delG	ENST00000404366.2	+	7	671	c.525delG	c.(523-525)gag>ga	p.E175fs	ABHD14A-ACY1_ENST00000463937.1_Splice_Site_p.E276fs|ACY1_ENST00000476351.1_Splice_Site_p.E140fs|ACY1_ENST00000458031.2_Splice_Site_p.E265fs|ACY1_ENST00000476854.1_Splice_Site_p.E175fs|ACY1_ENST00000494103.1_Intron	NM_000666.2|NM_001198895.1	NP_000657.1|NP_001185824.1	Q03154	ACY1_HUMAN	aminoacylase 1	175					cellular amino acid metabolic process (GO:0006520)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	aminoacylase activity (GO:0004046)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			breast(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	11				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000534)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	Acetylcysteine(DB06151)|L-Aspartic Acid(DB00128)	CCCTGGATGAGGGTGAGCAGG	0.612																																					p.E175fs		.											.	ACY1-154	0			c.525delG						.						60.0	60.0	60.0					3																	52020519		2203	4300	6503	SO:0001630	splice_region_variant	95	exon7			.	L07548	CCDS2844.1, CCDS56261.1, CCDS56262.1, CCDS56263.1	3p21.2	2006-02-02			ENSG00000243989	ENSG00000243989	3.5.1.14		177	protein-coding gene	gene with protein product		104620				1707030, 6948533	Standard	NM_000666		Approved		uc003dcq.3	Q03154	OTTHUMG00000157815	ENST00000404366.2:c.526+1G>-	3.37:g.52020519delG		72	0		85	37	NM_001198897	0	0	0	0	0	C9J6I6|C9J9D8|C9JWD4	Frame_Shift_Del	DEL	ENST00000404366.2	37	CCDS2844.1																																																																																			.		0.612	ACY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349657.1	NM_000666	Frame_Shift_Del
GIN1	54826	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	102444326	102444335	+	Frame_Shift_Del	DEL	AGTGTAGTTG	AGTGTAGTTG	-	rs371302288		TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	AGTGTAGTTG	AGTGTAGTTG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr5:102444326_102444335delAGTGTAGTTG	ENST00000399004.2	-	2	171_180	c.77_86delCAACTACACT	c.(76-87)tcaactacactgfs	p.STTL26fs	GIN1_ENST00000508629.1_Frame_Shift_Del_p.STTL26fs	NM_017676.2	NP_060146.2	Q9NXP7	GIN1_HUMAN	gypsy retrotransposon integrase 1	26					DNA integration (GO:0015074)		nucleic acid binding (GO:0003676)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_cancers(142;3.23e-07)|all_epithelial(76;3.64e-10)|Prostate(80;0.00914)|Ovarian(225;0.0139)|Lung NSC(167;0.0212)|Colorectal(57;0.0249)|all_lung(232;0.0283)		Epithelial(69;3.57e-14)|COAD - Colon adenocarcinoma(37;0.00794)		CTCACTTGGCAGTGTAGTTGAATGATATTC	0.343																																					p.26_29del		.											.	GIN1-92	0			c.77_86del						.																																			SO:0001589	frameshift_variant	54826	exon2			.	BC015325	CCDS43349.1	5q21.1	2008-02-11	2007-06-13	2007-06-13		ENSG00000145723			25959	protein-coding gene	gene with protein product	"""gypsy integrase 1"", ""Ty3/Gypsy integrase 1"""		"""zinc finger, H2C2 domain containing"""	ZH2C2		11470852	Standard	NM_017676		Approved	FLJ20125, GIN-1, TGIN1	uc003koa.1	Q9NXP7		ENST00000399004.2:c.77_86delCAACTACACT	5.37:g.102444326_102444335delAGTGTAGTTG	ENSP00000381970:p.Ser26fs	67	0		71	16	NM_017676	0	0	0	0	0	B2RXF7|B4DIV4|Q6AI03|Q96BR2	Frame_Shift_Del	DEL	ENST00000399004.2	37	CCDS43349.1																																																																																			.		0.343	GIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370478.3	NM_017676	
ZDHHC14	79683	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	158093775	158093785	+	Frame_Shift_Del	DEL	TTCAGAGCACC	TTCAGAGCACC	-			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	TTCAGAGCACC	TTCAGAGCACC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr6:158093775_158093785delTTCAGAGCACC	ENST00000359775.5	+	9	1977_1987	c.1088_1098delTTCAGAGCACC	c.(1087-1098)attcagagcaccfs	p.IQST363fs	ZDHHC14_ENST00000341375.8_3'UTR|ZDHHC14_ENST00000414563.2_Intron			Q8IZN3	ZDH14_HUMAN	zinc finger, DHHC-type containing 14	363					protein palmitoylation (GO:0018345)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(8)|ovary(1)|skin(1)	17		Breast(66;0.00586)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;2.9e-17)|BRCA - Breast invasive adenocarcinoma(81;5.8e-05)		GACCAGTGCATTCAGAGCACCAAATTCGTTT	0.664																																					p.363_366del		.											.	ZDHHC14-227	0			c.1088_1098del						.																																			SO:0001589	frameshift_variant	79683	exon9			.	AF542388	CCDS5252.1, CCDS47510.1	6q25.3	2008-05-02			ENSG00000175048	ENSG00000175048		"""Zinc fingers, DHHC-type"""	20341	protein-coding gene	gene with protein product							Standard	NM_024630		Approved	FLJ20984, NEW1CP	uc003qqt.3	Q8IZN3	OTTHUMG00000015896	ENST00000359775.5:c.1088_1098delTTCAGAGCACC	6.37:g.158093775_158093785delTTCAGAGCACC	ENSP00000352821:p.Ile363fs	63	0		71	11	NM_024630	0	0	0	0	0	A6NDB7|Q5JS07|Q5JS08|Q6PHS4|Q8IZN2|Q9H7F1	Frame_Shift_Del	DEL	ENST00000359775.5	37	CCDS5252.1																																																																																			.		0.664	ZDHHC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042841.2	NM_153746	
PURB	5814	broad.mit.edu	37	7	44924131	44924131	+	Frame_Shift_Del	DEL	A	A	-			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr7:44924131delA	ENST00000395699.2	-	1	829	c.817delT	c.(817-819)tgcfs	p.C273fs	MIR4657_ENST00000578157.1_RNA|RP4-673M15.1_ENST00000608450.1_RNA	NM_033224.3	NP_150093.1	Q96QR8	PURB_HUMAN	purine-rich element binding protein B	273					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of myeloid cell differentiation (GO:0045637)|transcription, DNA-templated (GO:0006351)	DNA replication factor A complex (GO:0005662)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription factor binding (GO:0008134)			large_intestine(2)|lung(3)|prostate(1)|skin(1)	7						GCATACCGGCAAAAGGCGCCT	0.582																																					p.C273fs													.	PURB-90	0			c.817delT						.						95.0	104.0	101.0					7																	44924131		2203	4300	6503	SO:0001589	frameshift_variant	5814	exon1			ACCGGCAAAAGGC		CCDS5499.1	7p13	2008-07-18			ENSG00000146676	ENSG00000146676			9702	protein-coding gene	gene with protein product		608887				1448097	Standard	NM_033224		Approved	PURBETA	uc003tme.3	Q96QR8	OTTHUMG00000023578	ENST00000395699.2:c.817delT	7.37:g.44924131delA	ENSP00000379051:p.Cys273fs	199	0		419	7	NM_033224	0	0	0	0	0	A4D2L7	Frame_Shift_Del	DEL	ENST00000395699.2	37	CCDS5499.1																																																																																			.		0.582	PURB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251332.2	NM_033224	
FGD4	121512	bcgsc.ca	37	12	32777967	32777968	+	In_Frame_Ins	INS	-	-	TTTTTT			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr12:32777967_32777968insTTTTTT	ENST00000427716.2	+	13	2024_2025	c.1600_1601insTTTTTT	c.(1600-1602)att>aTTTTTTtt	p.534_535insFF	FGD4_ENST00000266482.3_In_Frame_Ins_p.286_287insFF|FGD4_ENST00000525053.1_In_Frame_Ins_p.646_647insFF|FGD4_ENST00000546442.1_In_Frame_Ins_p.441_442insFF|FGD4_ENST00000531134.1_In_Frame_Ins_p.619_620insFF|FGD4_ENST00000534526.2_In_Frame_Ins_p.671_672insFF	NM_139241.2	NP_640334.2	Q96M96	FGD4_HUMAN	FYVE, RhoGEF and PH domain containing 4	534					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|microspike assembly (GO:0030035)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			breast(1)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	27	Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)					CAGAAATGCAATTGCAAAGGAT	0.347																																					p.I534delinsIFF													.	FGD4-229	0			c.1600_1601insTTTTTT						.																																			SO:0001652	inframe_insertion	121512	exon13			AATGCAATTGCAA	AK057294	CCDS8727.1	12p11.1	2014-09-17	2004-08-24		ENSG00000139132	ENSG00000139132		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	19125	protein-coding gene	gene with protein product		611104	"""FGD1 family, member 4"""			11527409	Standard	NM_139241		Approved	FRABP, frabin, ZFYVE6, CMT4H	uc001rkz.3	Q96M96	OTTHUMG00000137374	Exception_encountered	12.37:g.32777967_32777968insTTTTTT	ENSP00000394487:p.Ile534_Ala535insPhePhe	189	0		177	17	NM_139241	0	0	0	0	0	Q6ULS2|Q8TCP6	In_Frame_Ins	INS	ENST00000427716.2	37	CCDS8727.1																																																																																			.		0.347	FGD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268017.1	NM_139241	
DGKH	160851	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	42742631	42742632	+	Missense_Mutation	DNP	GG	GG	AT			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	GG	GG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr13:42742631_42742632GG>AT	ENST00000337343.4	+	10	1195_1196	c.1174_1175GG>AT	c.(1174-1176)GGa>ATa	p.G392I	DGKH_ENST00000538674.1_Missense_Mutation_p.G147I|DGKH_ENST00000379274.2_Missense_Mutation_p.G256I|DGKH_ENST00000536612.1_Missense_Mutation_p.G256I|DGKH_ENST00000540693.1_Missense_Mutation_p.G392I|DGKH_ENST00000498255.2_3'UTR|DGKH_ENST00000261491.5_Missense_Mutation_p.G392I	NM_178009.3	NP_821077.1	Q86XP1	DGKH_HUMAN	diacylglycerol kinase, eta	392	DAGKc. {ECO:0000255|PROSITE- ProRule:PRU00783}.				blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein oligomerization (GO:0051259)	cytoplasm (GO:0005737)|endosome (GO:0005768)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(2)|endometrium(3)|kidney(5)|large_intestine(11)|lung(9)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43		Lung NSC(96;1.02e-05)|Prostate(109;0.0168)|Lung SC(185;0.0262)|Breast(139;0.0709)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;5.88e-05)|GBM - Glioblastoma multiforme(144;0.000935)|BRCA - Breast invasive adenocarcinoma(63;0.109)		TGGAGGCGATGGAAGTGTAGGT	0.322																																					p.G392I		.											.	DGKH	0			c.G1175T						.																																			SO:0001583	missense	160851	exon11			GCGATGGAAGTGT	AB078967	CCDS9381.1, CCDS9382.1, CCDS55898.1	13q13.3	2013-01-10			ENSG00000102780	ENSG00000102780		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2854	protein-coding gene	gene with protein product		604071				8702685	Standard	XM_005266271		Approved	DGKeta	uc001uyl.2	Q86XP1	OTTHUMG00000016804	Exception_encountered	13.37:g.42742631_42742632delinsAT	ENSP00000337572:p.Gly392Ile	80.0	0.0		69.0	19.0		0	0	0	0	0	A2A2W7|A6NFX7|B4DZ34|Q5VZW0|Q6PI56|Q86XP2|Q8N3N0|Q8N7J9	Missense_Mutation	DNP	ENST00000337343.4	37	CCDS9381.1																																																																																			.		0.322	DGKH-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044699.2	NM_178009	
