#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ATP13A2	23400	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	17318334	17318334	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr1:17318334G>T	ENST00000326735.8	-	20	2179	c.2146C>A	c.(2146-2148)Ctg>Atg	p.L716M	RP1-37C10.3_ENST00000446261.1_RNA|ATP13A2_ENST00000341676.5_Missense_Mutation_p.L711M|ATP13A2_ENST00000452699.1_Missense_Mutation_p.L711M			Q9NQ11	AT132_HUMAN	ATPase type 13A2	716					cell death (GO:0008219)|cellular response to manganese ion (GO:0071287)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(11)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		Colorectal(325;0.000147)|Breast(348;0.00104)|Renal(390;0.00145)|Lung NSC(340;0.00566)|all_lung(284;0.00797)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|COAD - Colon adenocarcinoma(227;1.11e-05)|BRCA - Breast invasive adenocarcinoma(304;1.99e-05)|Kidney(64;0.000171)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.182)		AGGAGGCTCAGGTCTCCTTCC	0.632																																					p.L716M		.											.	ATP13A2-93	0			c.C2146A						.						68.0	65.0	66.0					1																	17318334		2203	4300	6503	SO:0001583	missense	23400	exon20			GGCTCAGGTCTCC	AL354615	CCDS175.1, CCDS44072.1, CCDS44073.1	1p36	2014-09-17			ENSG00000159363	ENSG00000159363		"""ATPases / P-type"", ""Parkinson disease"""	30213	protein-coding gene	gene with protein product		610513	"""Parkinson disease (autosomal recessive) 9 (Kufor-Rakeb syndrome)"""	PARK9		15381061, 16964263	Standard	XM_005245809		Approved	HSA9947, CLN12	uc001baa.2	Q9NQ11	OTTHUMG00000002293	ENST00000326735.8:c.2146C>A	1.37:g.17318334G>T	ENSP00000327214:p.Leu716Met	91	0		64	18	NM_022089	0	0	24	45	21	O75700|Q5JXY1|Q5JXY2|Q6S9Z9	Missense_Mutation	SNP	ENST00000326735.8	37	CCDS175.1	.	.	.	.	.	.	.	.	.	.	G	11.38	1.621251	0.28889	.	.	ENSG00000159363	ENST00000326735;ENST00000341676;ENST00000452699;ENST00000503552	T;T;T;T	0.76839	-1.05;-1.05;-1.05;-1.05	4.7	2.82	0.32997	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.199920	0.45606	D	0.000358	T	0.81451	0.4825	L	0.47190	1.495	0.37079	D	0.898894	D;D;D	0.69078	0.995;0.966;0.997	D;P;D	0.75020	0.985;0.756;0.971	T	0.80919	-0.1167	10	0.39692	T	0.17	-15.6307	9.9597	0.41688	0.1542:0.0:0.8458:0.0	.	711;711;716	Q5JXY1;Q6S9Z9;Q9NQ11	.;.;AT132_HUMAN	M	716;711;711;186	ENSP00000327214:L716M;ENSP00000341115:L711M;ENSP00000413307:L711M;ENSP00000421126:L186M	ENSP00000327214:L716M	L	-	1	2	ATP13A2	17190921	0.553000	0.26513	0.638000	0.29380	0.383000	0.30230	0.854000	0.27791	0.590000	0.29694	0.491000	0.48974	CTG	.		0.632	ATP13A2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000006617.1	NM_022089	
RAP1GAP	5909	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	21936724	21936724	+	Silent	SNP	G	G	C			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr1:21936724G>C	ENST00000374765.4	-	14	1088	c.888C>G	c.(886-888)gtC>gtG	p.V296V	RAP1GAP_ENST00000374757.3_5'Flank|RAP1GAP_ENST00000290101.4_Silent_p.V360V|RAP1GAP_ENST00000542643.2_Silent_p.V296V|RAP1GAP_ENST00000374763.2_Silent_p.V296V|RAP1GAP_ENST00000374761.2_Silent_p.V327V	NM_002885.2	NP_002876.2	P47736	RPGP1_HUMAN	RAP1 GTPase activating protein	296	Rap-GAP. {ECO:0000255|PROSITE- ProRule:PRU00165}.				GTP catabolic process (GO:0006184)|positive regulation of Rap GTPase activity (GO:0032854)|regulation of Ras GTPase activity (GO:0032318)|signal transduction (GO:0007165)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|protein homodimerization activity (GO:0042803)|Rap GTPase activator activity (GO:0046582)|Ras GTPase binding (GO:0017016)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(2)|skin(1)	17		Colorectal(325;0.000147)|Renal(390;0.000734)|Lung NSC(340;0.000861)|all_lung(284;0.000901)|Breast(348;0.012)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0192)|OV - Ovarian serous cystadenocarcinoma(117;2.3e-26)|COAD - Colon adenocarcinoma(152;1.59e-05)|GBM - Glioblastoma multiforme(114;2.7e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000354)|STAD - Stomach adenocarcinoma(196;0.00645)|KIRC - Kidney renal clear cell carcinoma(1967;0.00862)|READ - Rectum adenocarcinoma(331;0.0625)|Lung(427;0.146)		CATCCTGGAAGACCACAGCCA	0.637																																					p.V360V		.											.	RAP1GAP-245	0			c.C1080G						.						112.0	87.0	96.0					1																	21936724		2203	4300	6503	SO:0001819	synonymous_variant	5909	exon14			CTGGAAGACCACA	BC054490	CCDS218.1, CCDS53276.1, CCDS53277.1	1p36.1-p35	2009-09-14	2006-04-12	2006-04-12	ENSG00000076864	ENSG00000076864			9858	protein-coding gene	gene with protein product		600278	"""RAP1, GTPase activating protein 1"""	RAP1GA1		1904317	Standard	NM_001145657		Approved	KIAA0474, RAP1GAP1, RAP1GAPII	uc001bew.3	P47736	OTTHUMG00000007513	ENST00000374765.4:c.888C>G	1.37:g.21936724G>C		156	0		191	52	NM_001145658	0	0	40	81	41	J3QSS6|O75062|Q5T3S9|Q5T3T4|Q7Z5S8|Q9UQ51	Silent	SNP	ENST00000374765.4	37	CCDS218.1																																																																																			.		0.637	RAP1GAP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000019759.2	NM_002885	
RPS8	6202	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	45242407	45242407	+	Missense_Mutation	SNP	C	C	G			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr1:45242407C>G	ENST00000396651.3	+	3	332	c.172C>G	c.(172-174)Ctg>Gtg	p.L58V	RPS8_ENST00000485390.1_3'UTR|SNORD38B_ENST00000384690.1_RNA|SNORD55_ENST00000581525.1_RNA|SNORD46_ENST00000364043.1_RNA|RP11-269F19.2_ENST00000428791.1_RNA|SNORD38A_ENST00000365161.1_RNA|RPS8_ENST00000372209.3_Intron			P62241	RS8_HUMAN	ribosomal protein S8	58					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000462)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			central_nervous_system(2)|large_intestine(1)|lung(4)|ovary(2)|prostate(1)	10	Acute lymphoblastic leukemia(166;0.155)					ATACCGTGCCCTGAGGTTGGA	0.547																																					p.L58V		.											.	RPS8-91	0			c.C172G						.						73.0	64.0	67.0					1																	45242407		2203	4300	6503	SO:0001583	missense	6202	exon3			CGTGCCCTGAGGT	BC070875	CCDS513.1	1p34.1-p32	2011-04-05			ENSG00000142937	ENSG00000142937		"""S ribosomal proteins"""	10441	protein-coding gene	gene with protein product		600357				8432552	Standard	NM_001012		Approved	S8	uc001cmi.3	P62241	OTTHUMG00000008494	ENST00000396651.3:c.172C>G	1.37:g.45242407C>G	ENSP00000379888:p.Leu58Val	38	0		30	13	NM_001012	0	4	1158	2119	957	P09058|Q6IRL7	Missense_Mutation	SNP	ENST00000396651.3	37	CCDS513.1	.	.	.	.	.	.	.	.	.	.	C	15.76	2.927456	0.52759	.	.	ENSG00000142937	ENST00000396651	T	0.37915	1.17	4.8	1.74	0.24563	.	0.000000	0.64402	D	0.000001	T	0.41003	0.1140	M	0.86953	2.85	0.80722	D	1	B	0.32101	0.356	B	0.31547	0.132	T	0.37619	-0.9698	10	0.87932	D	0	-24.8377	8.7594	0.34665	0.0:0.7558:0.0:0.2442	.	58	P62241	RS8_HUMAN	V	58	ENSP00000379888:L58V	ENSP00000379888:L58V	L	+	1	2	RPS8	45014994	1.000000	0.71417	0.998000	0.56505	0.991000	0.79684	2.400000	0.44504	0.166000	0.19597	0.655000	0.94253	CTG	.		0.547	RPS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023439.1	NM_001012	
SSBP3	23648	bcgsc.ca	37	1	54707864	54707864	+	Silent	SNP	G	G	T			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr1:54707864G>T	ENST00000371320.3	-	11	1148	c.738C>A	c.(736-738)ccC>ccA	p.P246P	SSBP3_ENST00000371319.3_Silent_p.P219P|SSBP3_ENST00000326956.7_5'UTR|SSBP3_ENST00000357475.4_Silent_p.P226P|SSBP3_ENST00000417664.2_Silent_p.P136P	NM_145716.2	NP_663768.1	Q9BWW4	SSBP3_HUMAN	single stranded DNA binding protein 3	246	Gly-rich.|Pro-rich.				head morphogenesis (GO:0060323)|hematopoietic progenitor cell differentiation (GO:0002244)|midbrain-hindbrain boundary initiation (GO:0021547)|positive regulation of anterior head development (GO:2000744)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prechordal plate formation (GO:0021501)|protein complex assembly (GO:0006461)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|protein complex (GO:0043234)	single-stranded DNA binding (GO:0003697)			central_nervous_system(2)|endometrium(3)|large_intestine(1)|lung(3)|ovary(1)|urinary_tract(1)	11						GATTGGGCCAGGGTCTGCCAG	0.602																																					p.P246P													.	SSBP3-90	0			c.C738A						.						109.0	120.0	116.0					1																	54707864		2203	4300	6503	SO:0001819	synonymous_variant	23648	exon11			GGGCCAGGGTCTG		CCDS590.1, CCDS591.1, CCDS30726.1	1p32.3	2008-02-05	2001-11-28		ENSG00000157216	ENSG00000157216			15674	protein-coding gene	gene with protein product		607390	"""single-stranded DNA-binding protein 3"""			12079286	Standard	NM_145716		Approved	CSDP, SSDP, FLJ10355, SSDP1	uc001cxe.4	Q9BWW4	OTTHUMG00000008264	ENST00000371320.3:c.738C>A	1.37:g.54707864G>T		62	0		49	4	NM_145716	0	0	17	17	0	A8K0A9|Q5T860|Q5T861|Q9BTM0|Q9BWW3	Silent	SNP	ENST00000371320.3	37	CCDS591.1																																																																																			.		0.602	SSBP3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022721.1	NM_018070	
C1orf180	439927	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	85097342	85097342	+	Missense_Mutation	SNP	G	G	A			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr1:85097342G>A	ENST00000370624.1	-	2	176	c.49C>T	c.(49-51)Ccc>Tcc	p.P17S	C1orf180_ENST00000327308.3_Missense_Mutation_p.P17S					chromosome 1 open reading frame 180																		AAATGGTCGGGTCCTGGCTGA	0.448																																					.													.	.	0			.						.																																			SO:0001583	missense	439927	.			GGTCGGGTCCTGG	AK092806		1p22.3	2013-01-15			ENSG00000180869	ENSG00000180869			26647	other	unknown							Standard	NR_027379		Approved	FLJ35487	uc010ory.1	Q8NAE3	OTTHUMG00000009923	ENST00000370624.1:c.49C>T	1.37:g.85097342G>A	ENSP00000359658:p.Pro17Ser	68	0		60	25	.	0	0	0	0	0		RNA	SNP	ENST00000370624.1	37		.	.	.	.	.	.	.	.	.	.	G	3.255	-0.152523	0.06585	.	.	ENSG00000180869	ENST00000370624;ENST00000327308	T;T	0.23147	1.92;1.92	1.23	1.23	0.21249	.	.	.	.	.	T	0.17066	0.0410	.	.	.	0.09310	N	1	D	0.65815	0.995	P	0.51945	0.685	T	0.05733	-1.0867	8	0.87932	D	0	.	5.8141	0.18481	0.0:0.0:1.0:0.0	.	17	Q8NAE3	CA180_HUMAN	S	17	ENSP00000359658:P17S;ENSP00000317943:P17S	ENSP00000317943:P17S	P	-	1	0	C1orf180	84869930	0.000000	0.05858	0.008000	0.14137	0.046000	0.14306	-0.251000	0.08818	0.957000	0.37930	0.514000	0.50259	CCC	.		0.448	C1orf180-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000027461.1	NR_027379	
AMPD1	270	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	115221050	115221050	+	Silent	SNP	A	A	G			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr1:115221050A>G	ENST00000520113.2	-	8	1110	c.1095T>C	c.(1093-1095)taT>taC	p.Y365Y	AMPD1_ENST00000369538.3_Silent_p.Y361Y|AMPD1_ENST00000353928.6_Silent_p.Y332Y			P23109	AMPD1_HUMAN	adenosine monophosphate deaminase 1	365					IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|response to organic substance (GO:0010033)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(3)|pancreas(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	45	all_epithelial(7;7.83e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	Adenosine monophosphate(DB00131)	CTTTGGTGCTATAGACCACTC	0.408																																					p.Y365Y		.											.	AMPD1-293	0			c.T1095C						.						160.0	155.0	157.0					1																	115221050		2203	4300	6503	SO:0001819	synonymous_variant	270	exon8			GGTGCTATAGACC	M60092	CCDS876.1, CCDS876.2, CCDS53349.1	1p13	2010-02-10	2010-02-10		ENSG00000116748	ENSG00000116748	3.5.4.6		468	protein-coding gene	gene with protein product	"""AMPD isoform M"", ""skeletal muscle AMPD"""	102770	"""adenosine monophosphate deaminase 1 (isoform M)"""			1400401	Standard	NM_001172626		Approved	MAD, MADA	uc001efe.2	P23109	OTTHUMG00000011892	ENST00000520113.2:c.1095T>C	1.37:g.115221050A>G		76	0		86	30	NM_000036	0	0	0	0	0	A8K5N4|B2RAM1|F2Z3B3|Q5TF00|Q5TF02	Silent	SNP	ENST00000520113.2	37	CCDS876.2																																																																																			.		0.408	AMPD1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000032860.4		
RPTN	126638	broad.mit.edu	37	1	152128065	152128065	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr1:152128065C>T	ENST00000316073.3	-	3	1574	c.1510G>A	c.(1510-1512)Gga>Aga	p.G504R		NM_001122965.1	NP_001116437.1	Q6XPR3	RPTN_HUMAN	repetin	504	Gln-rich.					cornified envelope (GO:0001533)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|endometrium(14)|kidney(2)|large_intestine(1)|lung(32)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	59						TGGCCTTGTCCGTCTGGCTGA	0.502																																					p.G504R													.	RPTN-68	0			c.G1510A						.						825.0	713.0	747.0					1																	152128065		1568	3582	5150	SO:0001583	missense	126638	exon3			CTTGTCCGTCTGG	AK096436	CCDS41397.1	1q21.3	2013-01-10			ENSG00000215853	ENSG00000215853		"""EF-hand domain containing"""	26809	protein-coding gene	gene with protein product		613259				15854042	Standard	NM_001122965		Approved	FLJ39117	uc001ezs.1	Q6XPR3	OTTHUMG00000154095	ENST00000316073.3:c.1510G>A	1.37:g.152128065C>T	ENSP00000317895:p.Gly504Arg	98	0		90	5	NM_001122965	0	0	0	0	0	B7ZBZ3	Missense_Mutation	SNP	ENST00000316073.3	37	CCDS41397.1	.	.	.	.	.	.	.	.	.	.	T	0.095	-1.161467	0.01673	.	.	ENSG00000215853	ENST00000316073;ENST00000541545	T	0.10382	2.88	4.98	1.4	0.22301	.	0.464392	0.15779	N	0.245016	T	0.00524	0.0017	N	0.00227	-1.8	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.42447	-0.9451	10	0.13108	T	0.6	3.9809	4.2204	0.10554	0.1642:0.3864:0.0:0.4494	.	504	Q6XPR3	RPTN_HUMAN	R	504;159	ENSP00000317895:G504R	ENSP00000317895:G504R	G	-	1	0	RPTN	150394689	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	0.186000	0.16978	-0.024000	0.13941	-0.769000	0.03391	GGA	.		0.502	RPTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333867.1	XM_371312	
DDR2	4921	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	162724591	162724591	+	Missense_Mutation	SNP	T	T	G			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr1:162724591T>G	ENST00000367922.3	+	6	801	c.363T>G	c.(361-363)aaT>aaG	p.N121K	DDR2_ENST00000367921.3_Missense_Mutation_p.N121K	NM_001014796.1	NP_001014796.1	Q16832	DDR2_HUMAN	discoidin domain receptor tyrosine kinase 2	121	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|chondrocyte proliferation (GO:0035988)|collagen fibril organization (GO:0030199)|collagen-activated tyrosine kinase receptor signaling pathway (GO:0038063)|endochondral bone growth (GO:0003416)|extracellular matrix organization (GO:0030198)|ossification (GO:0001503)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of extracellular matrix disassembly (GO:0090091)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein autophosphorylation (GO:0046777)|regulation of bone mineralization (GO:0030500)|regulation of extracellular matrix disassembly (GO:0010715)|signal transduction (GO:0007165)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|collagen binding (GO:0005518)|protein tyrosine kinase collagen receptor activity (GO:0038062)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(2)|kidney(1)|lung(2)|ovary(1)|skin(1)	7	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.113)		Regorafenib(DB08896)	ACAAGATCAATTACAGTCGGG	0.522																																					p.N121K	NSCLC(161;314 2006 8283 19651 23192)												.	DDR2-1464	0			c.T363G						.						109.0	88.0	96.0					1																	162724591		2203	4300	6503	SO:0001583	missense	4921	exon6			GATCAATTACAGT	AK095975	CCDS1241.1	1q12-q23	2009-07-10	2008-01-23		ENSG00000162733	ENSG00000162733	2.7.10.1		2731	protein-coding gene	gene with protein product		191311	"""discoidin domain receptor family, member 2"""	TYRO10, NTRKR3		9659899	Standard	XM_005245221		Approved	TKT	uc001gcg.3	Q16832	OTTHUMG00000034423	ENST00000367922.3:c.363T>G	1.37:g.162724591T>G	ENSP00000356899:p.Asn121Lys	95	1		78	28	NM_001014796	0	0	1	1	0	Q7Z730	Missense_Mutation	SNP	ENST00000367922.3	37	CCDS1241.1	.	.	.	.	.	.	.	.	.	.	T	13.46	2.244051	0.39697	.	.	ENSG00000162733	ENST00000446985;ENST00000415555;ENST00000542391;ENST00000367922;ENST00000367921	D;D;D;D	0.98135	-4.74;-4.74;-4.74;-4.74	5.68	-4.29	0.03721	Coagulation factor 5/8 C-terminal type domain (3);Galactose-binding domain-like (1);	0.091829	0.64402	D	0.000001	D	0.83751	0.5322	N	0.02129	-0.67	0.41489	D	0.988210	B	0.17667	0.023	B	0.14578	0.011	T	0.56956	-0.7893	9	0.41790	T	0.15	.	15.6753	0.77311	0.0:0.6384:0.0:0.3616	.	121	Q16832	DDR2_HUMAN	K	121	ENSP00000400309:N121K;ENSP00000391310:N121K;ENSP00000356899:N121K;ENSP00000356898:N121K	ENSP00000356898:N121K	N	+	3	2	DDR2	160991215	0.984000	0.35163	0.938000	0.37757	0.991000	0.79684	0.091000	0.15046	-0.872000	0.04037	-0.280000	0.10049	AAT	.		0.522	DDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083213.2	NM_006182	
HMCN1	83872	broad.mit.edu	37	1	185953350	185953350	+	Missense_Mutation	SNP	T	T	G			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr1:185953350T>G	ENST00000271588.4	+	19	3069	c.2840T>G	c.(2839-2841)aTt>aGt	p.I947S	HMCN1_ENST00000367492.2_Missense_Mutation_p.I947S|HMCN1_ENST00000485744.1_3'UTR	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	947	Ig-like C2-type 6.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						AGCCTCCATATTGAAAGAGTT	0.398																																					p.I947S													.	HMCN1-113	0			c.T2840G						.						172.0	170.0	171.0					1																	185953350		2203	4300	6503	SO:0001583	missense	83872	exon19			TCCATATTGAAAG	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.2840T>G	1.37:g.185953350T>G	ENSP00000271588:p.Ile947Ser	87	0		67	3	NM_031935	0	0	0	0	0	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	T	24.4	4.530857	0.85706	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.79749	-1.3;-1.3	5.81	5.81	0.92471	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.162686	0.53938	D	0.000051	D	0.92270	0.7548	M	0.93763	3.455	0.54753	D	0.999987	D;D	0.67145	0.976;0.996	P;D	0.77004	0.908;0.989	D	0.94126	0.7384	10	0.87932	D	0	.	16.1501	0.81611	0.0:0.0:0.0:1.0	.	331;947	Q96RW7-3;Q96RW7	.;HMCN1_HUMAN	S	947	ENSP00000271588:I947S;ENSP00000356462:I947S	ENSP00000271588:I947S	I	+	2	0	HMCN1	184219973	1.000000	0.71417	0.996000	0.52242	0.994000	0.84299	7.083000	0.76859	2.219000	0.72066	0.533000	0.62120	ATT	.		0.398	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
GJD4	219770	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	35896876	35896876	+	Silent	SNP	C	C	A			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr10:35896876C>A	ENST00000321660.1	+	2	593	c.435C>A	c.(433-435)atC>atA	p.I145I	RP11-425A6.5_ENST00000609313.1_RNA	NM_153368.2	NP_699199.2	Q96KN9	CXD4_HUMAN	gap junction protein, delta 4, 40.1kDa	145					cell communication (GO:0007154)|regulation of satellite cell activation involved in skeletal muscle regeneration (GO:0014717)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	16						GCTACATCATCCACCTCCTCC	0.692																																					p.I145I		.											.	GJD4-155	0			c.C435A						.						17.0	18.0	18.0					10																	35896876		2196	4293	6489	SO:0001819	synonymous_variant	219770	exon2			CATCATCCACCTC	AJ414564	CCDS7191.1	10p11.22	2007-11-27			ENSG00000177291	ENSG00000177291		"""Ion channels / Gap junction proteins (connexins)"""	23296	protein-coding gene	gene with protein product	"""connexin 40.1"""	611922				12477932	Standard	NM_153368		Approved	CX40.1, FLJ90023	uc001iyy.1	Q96KN9	OTTHUMG00000017957	ENST00000321660.1:c.435C>A	10.37:g.35896876C>A		19	0		23	8	NM_153368	0	0	0	0	0	Q8N2R7	Silent	SNP	ENST00000321660.1	37	CCDS7191.1																																																																																			.		0.692	GJD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047576.1	NM_153368	
ADAMTS14	140766	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	72513573	72513573	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr10:72513573G>T	ENST00000373207.1	+	19	2747	c.2747G>T	c.(2746-2748)tGg>tTg	p.W916L	ADAMTS14_ENST00000373208.1_Missense_Mutation_p.W919L	NM_080722.3	NP_542453.2	Q8WXS8	ATS14_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 14	916	TSP type-1 3. {ECO:0000255|PROSITE- ProRule:PRU00210}.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(15)|ovary(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50						ACGGAGGAGTGGGGTGCCTGC	0.622																																					p.W919L		.											.	ADAMTS14-232	0			c.G2756T						.						16.0	12.0	14.0					10																	72513573		2194	4295	6489	SO:0001583	missense	140766	exon19			AGGAGTGGGGTGC	AF358666	CCDS7306.1, CCDS7307.1	10q21	2008-08-01	2005-08-19		ENSG00000138316	ENSG00000138316		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14899	protein-coding gene	gene with protein product		607506	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 14"""			11779638	Standard	NM_139155		Approved		uc001jrg.3	Q8WXS8	OTTHUMG00000018414	ENST00000373207.1:c.2747G>T	10.37:g.72513573G>T	ENSP00000362303:p.Trp916Leu	43	0		39	8	NM_139155	0	0	0	0	0	Q5T4G0|Q5T4G1|Q8TE55|Q8TEY8	Missense_Mutation	SNP	ENST00000373207.1	37	CCDS7306.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.956346	0.73902	.	.	ENSG00000138316	ENST00000373208;ENST00000373207	T;T	0.74315	-0.83;-0.83	4.58	4.58	0.56647	.	0.000000	0.64402	D	0.000001	D	0.92195	0.7525	H	0.99325	4.515	0.58432	D	0.999995	D;D	0.89917	0.967;1.0	P;D	0.80764	0.897;0.994	D	0.95625	0.8684	10	0.87932	D	0	.	17.1757	0.86841	0.0:0.0:1.0:0.0	.	916;919	Q8WXS8;Q5T4G1	ATS14_HUMAN;.	L	919;916	ENSP00000362304:W919L;ENSP00000362303:W916L	ENSP00000362303:W916L	W	+	2	0	ADAMTS14	72183579	1.000000	0.71417	0.963000	0.40424	0.270000	0.26580	9.601000	0.98297	2.378000	0.81104	0.563000	0.77884	TGG	.		0.622	ADAMTS14-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000048522.1	NM_080722	
C10orf11	83938	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	77818509	77818509	+	Missense_Mutation	SNP	A	A	G			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr10:77818509A>G	ENST00000372499.1	+	4	615	c.400A>G	c.(400-402)Aga>Gga	p.R134G	C10orf11_ENST00000593699.1_3'UTR	NM_032024.3	NP_114413.1	Q9H2I8	CJ011_HUMAN	chromosome 10 open reading frame 11	134	LRRCT.				melanocyte differentiation (GO:0030318)					endometrium(1)|large_intestine(4)|lung(4)|stomach(1)	10	Prostate(51;0.0095)|all_epithelial(25;0.0221)					GGCGTTGGTCAGAGGAGTCTT	0.488																																					p.R134G		.											.	C10orf11-90	0			c.A400G						.						148.0	136.0	140.0					10																	77818509		2203	4300	6503	SO:0001583	missense	83938	exon4			TTGGTCAGAGGAG	AF267860	CCDS7351.1	10q22.3	2013-08-22			ENSG00000148655	ENSG00000148655			23405	protein-coding gene	gene with protein product	"""oculocutaneous albinism 7, autosomal recessive"""	614537				23395477	Standard	NM_032024		Approved	CDA017, OCA7	uc001jxi.3	Q9H2I8	OTTHUMG00000018532	ENST00000372499.1:c.400A>G	10.37:g.77818509A>G	ENSP00000361577:p.Arg134Gly	105	0		89	13	NM_032024	0	0	24	49	25	B1AVW6	Missense_Mutation	SNP	ENST00000372499.1	37	CCDS7351.1	.	.	.	.	.	.	.	.	.	.	A	18.82	3.704846	0.68615	.	.	ENSG00000148655	ENST00000354343;ENST00000372499	T	0.37235	1.21	5.66	4.46	0.54185	.	0.000000	0.85682	D	0.000000	T	0.51702	0.1690	M	0.83012	2.62	0.41798	D	0.989901	P	0.41313	0.745	P	0.49226	0.603	T	0.56974	-0.7890	10	0.46703	T	0.11	-22.7506	12.4457	0.55649	0.8601:0.1398:0.0:0.0	.	134	Q9H2I8	CJ011_HUMAN	G	162;134	ENSP00000361577:R134G	ENSP00000346310:R162G	R	+	1	2	C10orf11	77488515	0.984000	0.35163	1.000000	0.80357	0.977000	0.68977	2.280000	0.43443	2.164000	0.68074	0.533000	0.62120	AGA	.		0.488	C10orf11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048839.1	NM_032024	
C10orf12	26148	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	98744160	98744160	+	Missense_Mutation	SNP	A	A	C			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr10:98744160A>C	ENST00000286067.2	+	1	3120	c.3013A>C	c.(3013-3015)Aat>Cat	p.N1005H		NM_015652.2	NP_056467.2	Q8N655	CJ012_HUMAN	chromosome 10 open reading frame 12	1005										NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(19)|ovary(3)|prostate(2)|skin(2)|stomach(4)	45		Colorectal(252;0.172)		Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)		AAAATATTCCAATATTCGAGG	0.453																																					p.N1005H		.											.	C10orf12-92	0			c.A3013C						.						50.0	56.0	54.0					10																	98744160		2203	4300	6503	SO:0001583	missense	26148	exon1			TATTCCAATATTC	BC024315	CCDS7452.1	10q24.2	2014-03-11			ENSG00000155640	ENSG00000155640			23420	protein-coding gene	gene with protein product						24550272	Standard	NM_015652		Approved	DKFZP564P1916, FLJ13022	uc001kmv.3	Q8N655	OTTHUMG00000018840	ENST00000286067.2:c.3013A>C	10.37:g.98744160A>C	ENSP00000286067:p.Asn1005His	49	0		60	21	NM_015652	0	0	1	3	2	Q9H945|Q9Y457	Missense_Mutation	SNP	ENST00000286067.2	37	CCDS7452.1	.	.	.	.	.	.	.	.	.	.	A	14.01	2.409208	0.42715	.	.	ENSG00000155640	ENST00000286067;ENST00000539886	T	0.11169	2.8	5.71	4.57	0.56435	.	0.273469	0.25106	U	0.033088	T	0.19005	0.0456	L	0.47716	1.5	0.34487	D	0.70458	D	0.55385	0.971	P	0.53224	0.721	T	0.18777	-1.0326	10	0.72032	D	0.01	-16.6286	12.7429	0.57264	0.7424:0.2576:0.0:0.0	.	1005	Q8N655	CJ012_HUMAN	H	1005;839	ENSP00000286067:N1005H	ENSP00000286067:N1005H	N	+	1	0	C10orf12	98734150	1.000000	0.71417	1.000000	0.80357	0.738000	0.42128	5.768000	0.68858	0.989000	0.38761	-0.313000	0.08912	AAT	.		0.453	C10orf12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049627.1	NM_015652	
ERLIN1	10613	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	101935785	101935785	+	Missense_Mutation	SNP	G	G	C	rs369477049		TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr10:101935785G>C	ENST00000421367.2	-	5	3054	c.347C>G	c.(346-348)aCc>aGc	p.T116S	ERLIN1_ENST00000407654.3_Missense_Mutation_p.T116S	NM_001100626.1|NM_006459.3	NP_001094096.1|NP_006450.2	O75477	ERLN1_HUMAN	ER lipid raft associated 1	114					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|protein complex (GO:0043234)							Colorectal(252;0.234)		Epithelial(162;3.85e-10)|all cancers(201;3.25e-08)		GAAGATTAAGGTCTTGTCATA	0.393																																					p.T116S		.											.	.	0			c.C347G						.						161.0	145.0	150.0					10																	101935785		2203	4300	6503	SO:0001583	missense	10613	exon5			ATTAAGGTCTTGT	AF064093	CCDS7487.2	10q24.31	2014-03-03	2007-01-26	2007-01-26	ENSG00000107566	ENSG00000107566			16947	protein-coding gene	gene with protein product	"""Band_7 23-211 Keo4 (Interim) similar to C.elegans protein C42C1.9"""	611604	"""chromosome 10 open reading frame 69"", ""SPFH domain family, member 1"""	C10orf69, SPFH1		11118313, 16835267, 24482476	Standard	NM_006459		Approved	KE04, Erlin-1, SPG62	uc001kqo.4	O75477	OTTHUMG00000018900	ENST00000421367.2:c.347C>G	10.37:g.101935785G>C	ENSP00000410964:p.Thr116Ser	95	0		97	35	NM_006459	0	0	13	26	13	B0QZ42|Q53HV0	Missense_Mutation	SNP	ENST00000421367.2	37	CCDS7487.2	.	.	.	.	.	.	.	.	.	.	G	16.19	3.053929	0.55218	.	.	ENSG00000107566	ENST00000421367;ENST00000407654;ENST00000370410;ENST00000370408	D;D;D	0.94417	-3.42;-3.42;-3.42	4.96	4.96	0.65561	.	0.114986	0.64402	U	0.000019	D	0.95020	0.8388	M	0.78456	2.415	0.58432	D	0.999999	B;B	0.29270	0.24;0.24	B;B	0.42959	0.403;0.403	D	0.92339	0.5880	10	0.09590	T	0.72	-17.5613	16.0678	0.80897	0.0:0.0:1.0:0.0	.	114;116	O75477;D3DR65	ERLN1_HUMAN;.	S	116;116;32;116	ENSP00000410964:T116S;ENSP00000384900:T116S;ENSP00000359436:T116S	ENSP00000359436:T116S	T	-	2	0	ERLIN1	101925775	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	9.771000	0.98977	2.456000	0.83038	0.561000	0.74099	ACC	.		0.393	ERLIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049840.2	NM_006459	
FANK1	92565	bcgsc.ca	37	10	127585212	127585212	+	Start_Codon_SNP	SNP	A	A	T	rs145156460		TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr10:127585212A>T	ENST00000368693.1	+	1	105	c.1A>T	c.(1-3)Atg>Ttg	p.M1L	FANK1_ENST00000368695.1_De_novo_Start_InFrame|FANK1_ENST00000449042.2_De_novo_Start_InFrame			Q8TC84	FANK1_HUMAN	fibronectin type III and ankyrin repeat domains 1	1						cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.M1L(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(10)|ovary(1)|urinary_tract(1)	21		all_lung(145;0.00752)|Lung NSC(174;0.0115)|Colorectal(57;0.0847)|all_neural(114;0.0936)				GCAGCCGACCATGGAGCCCCA	0.761																																					p.M1L													.	FANK1-91	1	Substitution - Missense(1)	central_nervous_system(1)	c.A1T						.						9.0	12.0	11.0					10																	127585212		2172	4263	6435	SO:0001582	initiator_codon_variant	92565	exon1			CCGACCATGGAGC	BC024189	CCDS31309.1	10q26.2	2013-02-11	2005-03-01		ENSG00000203780	ENSG00000203780		"""Ankyrin repeat domain containing"", ""Fibronectin type III domain containing"""	23527	protein-coding gene	gene with protein product		611640	"""fibronectin type 3 and ankyrin repeat domains 1"""			12477932	Standard	NM_145235		Approved		uc001ljh.4	Q8TC84	OTTHUMG00000019241	ENST00000368693.1:c.1A>T	10.37:g.127585212A>T	ENSP00000357682:p.Met1Leu	144	1		150	9	NM_145235	0	0	0	0	0	Q6UXY9|Q6X7T6	Missense_Mutation	SNP	ENST00000368693.1	37	CCDS31309.1	.	.	.	.	.	.	.	.	.	.	A	7.904	0.735016	0.15574	.	.	ENSG00000203780	ENST00000368693	T	0.36520	1.25	2.62	2.62	0.31277	.	.	.	.	.	T	0.21801	0.0525	.	.	.	0.80722	D	1	B;B	0.06786	0.0;0.001	B;B	0.06405	0.0;0.002	T	0.05886	-1.0858	8	0.25751	T	0.34	.	7.1163	0.25418	1.0:0.0:0.0:0.0	.	1;1	Q8TC84-3;Q8TC84	.;FANK1_HUMAN	L	1	ENSP00000357682:M1L	ENSP00000357682:M1L	M	+	1	0	FANK1	127575202	0.921000	0.31238	0.955000	0.39395	0.220000	0.24768	1.121000	0.31283	1.433000	0.47394	0.379000	0.24179	ATG	.		0.761	FANK1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_145235	Missense_Mutation
DOCK1	1793	broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	128830577	128830577	+	Silent	SNP	T	T	A			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr10:128830577T>A	ENST00000280333.6	+	18	1951	c.1842T>A	c.(1840-1842)acT>acA	p.T614T		NM_001380.3	NP_001371.1	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1	614					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|hematopoietic progenitor cell differentiation (GO:0002244)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|phagocytosis, engulfment (GO:0006911)|positive regulation of GTPase activity (GO:0043547)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			NS(2)|breast(1)|central_nervous_system(7)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(10)|lung(15)|ovary(4)|prostate(3)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	72		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)		CCAAACTGACTCAGAACGGTG	0.582																																					p.T614T													.	DOCK1-698	0			c.T1842A						.						20.0	20.0	20.0					10																	128830577		2118	4225	6343	SO:0001819	synonymous_variant	1793	exon18			ACTGACTCAGAAC	D50857	CCDS73222.1	10q26.13-q26.3	2009-10-28			ENSG00000150760	ENSG00000150760			2987	protein-coding gene	gene with protein product	"""DOwnstream of CrK"""	601403	"""dedicator of cyto-kinesis 1"""			8657152, 8661160	Standard	XM_006717681		Approved	DOCK180, ced5	uc001ljt.3	Q14185	OTTHUMG00000019249	ENST00000280333.6:c.1842T>A	10.37:g.128830577T>A		98	1		96	36	NM_001380	0	0	0	0	0	A9Z1Z5	Silent	SNP	ENST00000280333.6	37																																																																																				.		0.582	DOCK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050979.2	NM_001380	
CFAP46	54777	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	134733640	134733640	+	Silent	SNP	C	C	T			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr10:134733640C>T	ENST00000368586.5	-	14	1753	c.1653G>A	c.(1651-1653)aaG>aaA	p.K551K	TTC40_ENST00000368582.2_Silent_p.K551K	NM_001200049.2	NP_001186978.2														breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						GGTGCCACGCCTTCGCACAGA	0.637																																					p.K551K		.											.	.	0			c.G1653A						.																																			SO:0001819	synonymous_variant	54777	exon14			CCACGCCTTCGCA																												ENST00000368586.5:c.1653G>A	10.37:g.134733640C>T		43	0		54	18	NM_001200049	0	0	0	1	1		Silent	SNP	ENST00000368586.5	37	CCDS58101.1																																																																																			.		0.637	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000051095.3		
MUC2	4583	broad.mit.edu	37	11	1092973	1092973	+	Missense_Mutation	SNP	C	C	T	rs55847666		TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr11:1092973C>T	ENST00000441003.2	+	30	4819	c.4792C>T	c.(4792-4794)Ccc>Tcc	p.P1598S	MUC2_ENST00000361558.6_Intron|MUC2_ENST00000359061.5_Intron|MUC2_ENST00000333592.6_5'Flank	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.P1598S(1)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	aaccccaacacccaccggcac	0.637																																					p.P1598S													.	MUC2-90	1	Substitution - Missense(1)	endometrium(1)	c.C4792T						.						47.0	83.0	70.0					11																	1092973		1782	3238	5020	SO:0001583	missense	4583	exon30			CCAACACCCACCG	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4792C>T	11.37:g.1092973C>T	ENSP00000415183:p.Pro1598Ser	55	2		74	4	NM_002457	0	0	0	0	0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	3.622	-0.077443	0.07184	.	.	ENSG00000198788	ENST00000441003	T	0.13778	2.56	1.75	-2.88	0.05682	.	.	.	.	.	T	0.04363	0.0120	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.43686	-0.9376	8	0.07482	T	0.82	.	3.4241	0.07403	0.4105:0.429:0.0:0.1605	rs55847666	1598	E7EUV1	.	S	1598	ENSP00000415183:P1598S	ENSP00000415183:P1598S	P	+	1	0	MUC2	1082973	0.007000	0.16637	0.000000	0.03702	0.120000	0.20174	0.230000	0.17852	-0.314000	0.08716	0.121000	0.15741	CCC	.		0.637	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
KRTAP5-5	439915	bcgsc.ca	37	11	1651127	1651127	+	Silent	SNP	C	C	T			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr11:1651127C>T	ENST00000399676.2	+	1	95	c.57C>T	c.(55-57)tcC>tcT	p.S19S		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	19						keratin filament (GO:0045095)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		gccgtggctccggctgtgggg	0.697																																					p.S19S													.	KRTAP5-5-23	0			c.C57T						.																																			SO:0001819	synonymous_variant	439915	exon1			TGGCTCCGGCTGT	AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	ENST00000399676.2:c.57C>T	11.37:g.1651127C>T		172	3		217	14	NM_001001480	0	0	0	0	0	A8MWN2	Silent	SNP	ENST00000399676.2	37	CCDS41592.1																																																																																			.		0.697	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127919.1		
HIPK3	10114	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	33374883	33374883	+	Silent	SNP	T	T	C			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr11:33374883T>C	ENST00000303296.4	+	17	3722	c.3417T>C	c.(3415-3417)tcT>tcC	p.S1139S	HIPK3_ENST00000456517.1_Silent_p.S1118S|HIPK3_ENST00000525975.1_Silent_p.S1118S|HIPK3_ENST00000379016.3_Silent_p.S1118S|AL122015.1_ENST00000411202.1_RNA	NM_005734.3	NP_005725.3	Q9H422	HIPK3_HUMAN	homeodomain interacting protein kinase 3	1139					apoptotic process (GO:0006915)|mRNA transcription (GO:0009299)|negative regulation of apoptotic process (GO:0043066)|negative regulation of JUN kinase activity (GO:0043508)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			endometrium(3)|kidney(3)|large_intestine(9)|liver(4)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	39						TGTTAGCCTCTCCGTGTACCT	0.517																																					p.S1139S		.											.	HIPK3-336	0			c.T3417C						.						216.0	178.0	191.0					11																	33374883		2202	4298	6500	SO:0001819	synonymous_variant	10114	exon17			AGCCTCTCCGTGT	AF004849	CCDS7884.1, CCDS41634.1	11p13	2008-07-18	2001-11-29		ENSG00000110422	ENSG00000110422			4915	protein-coding gene	gene with protein product		604424	"""homeodomain-interacting protein kinase 3"""			9373137, 9748262	Standard	NM_005734		Approved	PKY, DYRK6, YAK1, FIST3	uc031pzm.1	Q9H422	OTTHUMG00000132269	ENST00000303296.4:c.3417T>C	11.37:g.33374883T>C		125	0		112	31	NM_005734	0	0	34	66	32	O14632|Q2PBG4|Q2PBG5|Q92632|Q9HAS2	Silent	SNP	ENST00000303296.4	37	CCDS7884.1																																																																																			.		0.517	HIPK3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255358.1	NM_005734	
ATG13	9776	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	46666907	46666907	+	Nonsense_Mutation	SNP	C	C	T			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr11:46666907C>T	ENST00000434074.1	+	3	777	c.88C>T	c.(88-90)Cag>Tag	p.Q30*	ATG13_ENST00000529655.1_Nonsense_Mutation_p.Q30*|ATG13_ENST00000530500.1_5'UTR|ATG13_ENST00000524625.1_Nonsense_Mutation_p.Q30*|ATG13_ENST00000526508.1_Nonsense_Mutation_p.Q30*|ATG13_ENST00000312040.4_Nonsense_Mutation_p.Q30*|ATG13_ENST00000528494.1_Nonsense_Mutation_p.Q30*|ATG13_ENST00000359513.4_Nonsense_Mutation_p.Q30*|ATG13_ENST00000451945.1_Nonsense_Mutation_p.Q30*	NM_001205120.1	NP_001192049.1	O75143	ATG13_HUMAN	autophagy related 13	30					autophagic vacuole assembly (GO:0000045)	ATG1/UKL1 signaling complex (GO:0034273)|cytosol (GO:0005829)|pre-autophagosomal structure (GO:0000407)|ULK1-ATG13-FIP200 complex (GO:0070969)	protein kinase binding (GO:0019901)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(5)|prostate(1)|skin(1)	15						AGTGATTGTCCAGGCTCGGCT	0.373																																					p.Q30X		.											.	ATG13-68	0			c.C88T						.						95.0	90.0	91.0					11																	46666907		2201	4299	6500	SO:0001587	stop_gained	9776	exon4			ATTGTCCAGGCTC	AB014552	CCDS7921.1, CCDS44582.1, CCDS55760.1, CCDS55761.1	11p11.2	2014-02-12	2012-06-06	2010-06-29	ENSG00000175224	ENSG00000175224			29091	protein-coding gene	gene with protein product		615088	"""KIAA0652"", ""ATG13 autophagy related 13 homolog (S. cerevisiae)"""	KIAA0652		15169610, 18339812, 17204848	Standard	NM_001205120		Approved		uc001nda.3	O75143	OTTHUMG00000166538	ENST00000434074.1:c.88C>T	11.37:g.46666907C>T	ENSP00000400642:p.Gln30*	78	0		91	5	NM_001142673	0	0	45	47	2	B4DFI4|D3DQQ1|D3DQQ2|E9PQZ8|Q53EN6|Q9BRL3|Q9H8B0	Nonsense_Mutation	SNP	ENST00000434074.1	37	CCDS44582.1	.	.	.	.	.	.	.	.	.	.	C	37	6.442003	0.97568	.	.	ENSG00000175224	ENST00000395549;ENST00000434074;ENST00000312040;ENST00000451945;ENST00000529655;ENST00000533325;ENST00000526508;ENST00000524625;ENST00000359513;ENST00000528494;ENST00000526078	.	.	.	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-10.2057	19.4568	0.94895	0.0:1.0:0.0:0.0	.	.	.	.	X	30	.	ENSP00000310321:Q30X	Q	+	1	0	ATG13	46623483	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.103000	0.77014	2.832000	0.97577	0.655000	0.94253	CAG	.		0.373	ATG13-202	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000390300.2	NM_014741	
PCNXL3	399909	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	65397996	65397996	+	Missense_Mutation	SNP	A	A	C			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr11:65397996A>C	ENST00000355703.3	+	27	4930	c.4391A>C	c.(4390-4392)tAt>tCt	p.Y1464S	PCNXL3_ENST00000531280.1_3'UTR	NM_032223.2	NP_115599.2	Q9H6A9	PCX3_HUMAN	pecanex-like 3 (Drosophila)	1464						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)	13						CTGGAGGGCTATAGCATTAGT	0.572																																					p.Y1464S		.											.	PCNXL3-46	0			c.A4391C						.						86.0	92.0	90.0					11																	65397996		2116	4217	6333	SO:0001583	missense	399909	exon27			AGGGCTATAGCAT	BX640978	CCDS44650.1	11q12.1	2008-07-21			ENSG00000197136	ENSG00000197136			18760	protein-coding gene	gene with protein product						15146197	Standard	NM_032223		Approved	FLJ22427	uc001oey.2	Q9H6A9	OTTHUMG00000166539	ENST00000355703.3:c.4391A>C	11.37:g.65397996A>C	ENSP00000347931:p.Tyr1464Ser	135	0		122	41	NM_032223	0	0	10	17	7	Q6MZN8	Missense_Mutation	SNP	ENST00000355703.3	37	CCDS44650.1	.	.	.	.	.	.	.	.	.	.	A	24.7	4.559339	0.86335	.	.	ENSG00000197136	ENST00000355703	T	0.23552	1.9	5.02	5.02	0.67125	.	0.072055	0.56097	D	0.000021	T	0.55657	0.1934	M	0.88450	2.955	0.51767	D	0.999931	D;D	0.71674	0.982;0.998	D;D	0.73708	0.967;0.981	T	0.64516	-0.6389	10	0.87932	D	0	.	12.7937	0.57549	1.0:0.0:0.0:0.0	.	351;1464	Q9H6A9-3;Q9H6A9	.;PCX3_HUMAN	S	1464	ENSP00000347931:Y1464S	ENSP00000347931:Y1464S	Y	+	2	0	PCNXL3	65154572	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.753000	0.91637	2.131000	0.65755	0.529000	0.55759	TAT	.		0.572	PCNXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390321.1	NM_032223	
MRE11A	4361	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	11	94225958	94225958	+	Missense_Mutation	SNP	C	C	A			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr11:94225958C>A	ENST00000323929.3	-	2	232	c.10G>T	c.(10-12)Gca>Tca	p.A4S	MRE11A_ENST00000536144.1_5'UTR|ANKRD49_ENST00000540349.1_5'Flank|ANKRD49_ENST00000544612.1_5'Flank|MRE11A_ENST00000393241.4_Missense_Mutation_p.A4S|MRE11A_ENST00000540013.1_Missense_Mutation_p.A4S|MRE11A_ENST00000323977.3_Missense_Mutation_p.A4S|ANKRD49_ENST00000544253.1_5'Flank|MRE11A_ENST00000407439.3_5'UTR	NM_005591.3	NP_005582.1	P49959	MRE11_HUMAN	MRE11 meiotic recombination 11 homolog A (S. cerevisiae)	4					base-excision repair (GO:0006284)|cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|double-strand break repair via nonhomologous end joining (GO:0006303)|innate immune response (GO:0045087)|intra-S DNA damage checkpoint (GO:0031573)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of DNA endoreduplication (GO:0032876)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair (GO:0006289)|positive regulation of kinase activity (GO:0033674)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of type I interferon production (GO:0032481)|reciprocal meiotic recombination (GO:0007131)|regulation of mitotic recombination (GO:0000019)|sister chromatid cohesion (GO:0007062)|synapsis (GO:0007129)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	chromatin (GO:0000785)|cytosol (GO:0005829)|Mre11 complex (GO:0030870)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	3'-5' exonuclease activity (GO:0008408)|double-stranded DNA binding (GO:0003690)|endodeoxyribonuclease activity (GO:0004520)|endonuclease activity (GO:0004519)|manganese ion binding (GO:0030145)|nuclease activity (GO:0004518)|protein C-terminus binding (GO:0008022)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)			breast(5)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	29		Acute lymphoblastic leukemia(157;2.37e-05)|all_hematologic(158;0.00824)				AGTGCATCTGCAGTACTCATT	0.423								Homologous recombination	Ataxia-Telangiectasia-Like Disorder																												p.A4S		.											.	MRE11A-722	0			c.G10T						.						113.0	103.0	107.0					11																	94225958		2201	4298	6499	SO:0001583	missense	4361	exon2	Familial Cancer Database	ATLD	CATCTGCAGTACT	BC063458	CCDS8298.1, CCDS8299.1	11q21	2014-09-17	2001-11-28		ENSG00000020922	ENSG00000020922			7230	protein-coding gene	gene with protein product	"""AT-like disease"""	600814	"""meiotic recombination (S. cerevisiae) 11 homolog A"""	MRE11		8530104	Standard	XM_005274007		Approved	ATLD	uc001peu.2	P49959	OTTHUMG00000167780	ENST00000323929.3:c.10G>T	11.37:g.94225958C>A	ENSP00000325863:p.Ala4Ser	57	0		72	7	NM_005591	0	0	1	1	0	O43475	Missense_Mutation	SNP	ENST00000323929.3	37	CCDS8299.1	.	.	.	.	.	.	.	.	.	.	C	7.672	0.687277	0.14973	.	.	ENSG00000020922	ENST00000323929;ENST00000323977;ENST00000393241;ENST00000540013;ENST00000536754;ENST00000538923	T;T;T;T;T	0.76709	-0.84;-0.82;-0.84;-1.03;-1.04	5.01	-0.599	0.11645	.	0.961041	0.08657	N	0.913092	T	0.51109	0.1655	N	0.11255	0.115	0.23572	N	0.997382	B;B	0.06786	0.001;0.0	B;B	0.10450	0.005;0.002	T	0.30416	-0.9979	10	0.09843	T	0.71	.	2.2535	0.04049	0.1419:0.4157:0.2764:0.1661	.	4;4	P49959-2;P49959	.;MRE11_HUMAN	S	4	ENSP00000325863:A4S;ENSP00000326094:A4S;ENSP00000376933:A4S;ENSP00000440986:A4S;ENSP00000439511:A4S	ENSP00000325863:A4S	A	-	1	0	MRE11A	93865606	0.867000	0.29959	0.427000	0.26684	0.159000	0.22180	-0.223000	0.09177	-0.420000	0.07427	0.561000	0.74099	GCA	.		0.423	MRE11A-001	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396237.3	NM_005591	
ASB8	140461	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	48543736	48543736	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr12:48543736C>T	ENST00000317697.3	-	4	449	c.280G>A	c.(280-282)Gca>Aca	p.A94T	ASB8_ENST00000539528.1_3'UTR|ASB8_ENST00000536071.1_3'UTR|ASB8_ENST00000535055.1_3'UTR|ASB8_ENST00000537754.1_5'UTR|ASB8_ENST00000536953.1_3'UTR|ASB8_ENST00000536549.1_Missense_Mutation_p.A94T	NM_024095.3	NP_077000.1	Q9H765	ASB8_HUMAN	ankyrin repeat and SOCS box containing 8	94					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				breast(1)|kidney(2)|large_intestine(2)|lung(5)|soft_tissue(1)	11						TCTTTCTCTGCTGCATAGTGG	0.498																																					p.A94T		.											.	ASB8-226	0			c.G280A						.						67.0	62.0	64.0					12																	48543736		2203	4300	6503	SO:0001583	missense	140461	exon4			TCTCTGCTGCATA	AK024908	CCDS8761.1	12q13.12	2013-01-10	2011-01-25			ENSG00000177981		"""Ankyrin repeat domain containing"""	17183	protein-coding gene	gene with protein product		615053	"""ankyrin repeat and SOCS box-containing 8"""			12076535	Standard	NM_024095		Approved	MGC5540, FLJ21255	uc001rrh.3	Q9H765		ENST00000317697.3:c.280G>A	12.37:g.48543736C>T	ENSP00000320893:p.Ala94Thr	59	0		83	26	NM_024095	0	0	30	52	22	A8K1P2|Q547Q2	Missense_Mutation	SNP	ENST00000317697.3	37	CCDS8761.1	.	.	.	.	.	.	.	.	.	.	C	32	5.172801	0.94807	.	.	ENSG00000177981	ENST00000317697;ENST00000536549;ENST00000446549;ENST00000539503;ENST00000545791;ENST00000540212	T;T;T;T;T	0.71934	-0.61;-0.61;-0.6;-0.37;-0.37	5.3	5.3	0.74995	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	T	0.81269	0.4787	L	0.49126	1.545	0.80722	D	1	D	0.71674	0.998	D	0.79108	0.992	T	0.81008	-0.1127	10	0.51188	T	0.08	-9.6125	18.938	0.92594	0.0:1.0:0.0:0.0	.	94	Q9H765	ASB8_HUMAN	T	94	ENSP00000320893:A94T;ENSP00000445622:A94T;ENSP00000444093:A94T;ENSP00000437769:A94T;ENSP00000442639:A94T	ENSP00000320893:A94T	A	-	1	0	ASB8	46830003	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.227000	0.78070	2.648000	0.89879	0.563000	0.77884	GCA	.		0.498	ASB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396497.1		
FAM186A	121006	broad.mit.edu	37	12	50747256	50747256	+	Missense_Mutation	SNP	T	T	C			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr12:50747256T>C	ENST00000327337.5	-	4	3358	c.3359A>G	c.(3358-3360)gAg>gGg	p.E1120G	FAM186A_ENST00000543111.1_Missense_Mutation_p.E1120G|FAM186A_ENST00000543096.1_5'Flank	NM_001145475.1	NP_001138947.1	A6NE01	F186A_HUMAN	family with sequence similarity 186, member A	1120																	GAAAAGGATCTCCAGGGCCTG	0.647																																					p.E1120G	NSCLC(138;1796 1887 12511 19463 37884)												.	FAM186A-68	0			c.A3359G						.						30.0	27.0	28.0					12																	50747256		692	1591	2283	SO:0001583	missense	121006	exon4			AGGATCTCCAGGG		CCDS44878.1	12q13.13	2009-04-22			ENSG00000185958	ENSG00000185958			26980	protein-coding gene	gene with protein product							Standard	NM_001145475		Approved	LOC121006	uc001rwl.2	A6NE01	OTTHUMG00000167889	ENST00000327337.5:c.3359A>G	12.37:g.50747256T>C	ENSP00000329995:p.Glu1120Gly	52	4		64	5	NM_001145475	0	0	0	0	0		Missense_Mutation	SNP	ENST00000327337.5	37	CCDS44878.1	.	.	.	.	.	.	.	.	.	.	T	8.655	0.899275	0.17686	.	.	ENSG00000185958	ENST00000543111;ENST00000327337	T;T	0.04234	3.67;3.67	4.18	1.15	0.20763	.	.	.	.	.	T	0.02970	0.0088	N	0.19112	0.55	0.09310	N	0.999999	B;B	0.09022	0.002;0.0	B;B	0.06405	0.002;0.0	T	0.49153	-0.8969	9	0.13108	T	0.6	.	6.542	0.22385	0.0:0.679:0.0:0.321	.	1120;1120	F5GYN0;A6NE01	.;F186A_HUMAN	G	1120	ENSP00000441337:E1120G;ENSP00000329995:E1120G	ENSP00000329995:E1120G	E	-	2	0	FAM186A	49033523	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-0.956000	0.03865	0.170000	0.19704	-0.573000	0.04149	GAG	.		0.647	FAM186A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396838.1	XM_001718353	
PARP4	143	ucsc.edu	37	13	25020900	25020900	+	Splice_Site	SNP	C	C	T			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr13:25020900C>T	ENST00000381989.3	-	27	3391		c.e27-1			NM_006437.3	NP_006428.2	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4						cell death (GO:0008219)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|inflammatory response (GO:0006954)|protein ADP-ribosylation (GO:0006471)|response to drug (GO:0042493)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spindle microtubule (GO:0005876)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(14)|lung(18)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)		ACAGAGTTGCCTGAAATGGGG	0.373																																					.													.	PARP4-94	0			c.3286-1G>A						.						62.0	56.0	58.0					13																	25020900		2202	4300	6502	SO:0001630	splice_region_variant	143	exon28			AGTTGCCTGAAAT	AF057160	CCDS9307.1	13q11	2010-09-29	2004-08-20	2004-08-26	ENSG00000102699	ENSG00000102699		"""Poly (ADP-ribose) polymerases"""	271	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 5C"""	607519	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 1"""	ADPRTL1		10644454	Standard	NM_006437		Approved	VAULT3, p193, VPARP, VWA5C	uc001upl.3	Q9UKK3	OTTHUMG00000016582	ENST00000381989.3:c.3286-1G>A	13.37:g.25020900C>T		170	0		133	1	NM_006437	0	0	0	0	0	O75903|Q14682|Q5QNZ9|Q9H1M6	Splice_Site	SNP	ENST00000381989.3	37	CCDS9307.1	.	.	.	.	.	.	.	.	.	.	C	14.86	2.660048	0.47572	.	.	ENSG00000102699	ENST00000381989	.	.	.	4.71	4.71	0.59529	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.593	0.76554	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PARP4	23918900	1.000000	0.71417	1.000000	0.80357	0.482000	0.33219	6.055000	0.71103	2.615000	0.88500	0.644000	0.83932	.	.		0.373	PARP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044189.1	NM_006437	Intron
UPF3A	65110	broad.mit.edu	37	13	115047559	115047559	+	Silent	SNP	C	C	T			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr13:115047559C>T	ENST00000375299.3	+	2	327	c.271C>T	c.(271-273)Ctg>Ttg	p.L91L	UPF3A_ENST00000351487.5_Silent_p.L91L	NM_023011.3	NP_075387.1	Q9H1J1	REN3A_HUMAN	UPF3 regulator of nonsense transcripts homolog A (yeast)	91	Required for interaction with UPF2.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA transport (GO:0051028)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nucleocytoplasmic transport (GO:0006913)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.L91L(8)		autonomic_ganglia(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	16	Lung NSC(43;0.00299)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0191)|all_epithelial(44;0.00716)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.238)	BRCA - Breast invasive adenocarcinoma(86;0.0886)	OV - Ovarian serous cystadenocarcinoma(48;0.195)|Epithelial(10;0.2)		GCTGCGCCCGCTGCCAGCACA	0.731																																					p.L91L													.	UPF3A-91	8	Substitution - coding silent(8)	lung(2)|prostate(2)|kidney(2)|central_nervous_system(2)	c.C271T						.						4.0	4.0	4.0					13																	115047559		1902	3804	5706	SO:0001819	synonymous_variant	65110	exon2			CGCCCGCTGCCAG	AF318575	CCDS9543.1, CCDS9544.1	13q34	2010-04-30			ENSG00000169062	ENSG00000169062			20332	protein-coding gene	gene with protein product		605530				11113196, 11163187	Standard	NM_023011		Approved	RENT3A, UPF3, HUPF3A	uc001vup.3	Q9H1J1	OTTHUMG00000017403	ENST00000375299.3:c.271C>T	13.37:g.115047559C>T		35	0		24	3	NM_080687	0	0	15	15	0	A2A366|Q5T8C3|Q5T8C9|Q7Z6N3|Q86YK1|Q9BZI8	Silent	SNP	ENST00000375299.3	37	CCDS9543.1																																																																																			.		0.731	UPF3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045968.2		
SERPINA12	145264	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	94964196	94964196	+	Missense_Mutation	SNP	A	A	C			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr14:94964196A>C	ENST00000341228.2	-	3	1334	c.539T>G	c.(538-540)tTt>tGt	p.F180C	SERPINA12_ENST00000556881.1_Missense_Mutation_p.F180C	NM_173850.2	NP_776249.1	Q8IW75	SPA12_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12	180					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	33				COAD - Colon adenocarcinoma(157;0.235)		TTGACTGATAAAGTCATTGAT	0.393																																					p.F180C		.											.	SERPINA12-310	0			c.T539G						.						93.0	91.0	92.0					14																	94964196		2203	4300	6503	SO:0001583	missense	145264	exon3			CTGATAAAGTCAT	AY177692	CCDS9926.1	14q32.13	2014-02-21	2005-08-18		ENSG00000165953	ENSG00000165953		"""Serine (or cysteine) peptidase inhibitors"""	18359	protein-coding gene	gene with protein product			"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12"""			24172014	Standard	NM_173850		Approved	OL-64, Vaspin	uc001ydj.3	Q8IW75	OTTHUMG00000171349	ENST00000341228.2:c.539T>G	14.37:g.94964196A>C	ENSP00000342109:p.Phe180Cys	130	0		82	39	NM_173850	0	0	0	0	0		Missense_Mutation	SNP	ENST00000341228.2	37	CCDS9926.1	.	.	.	.	.	.	.	.	.	.	A	10.99	1.508445	0.27036	.	.	ENSG00000165953	ENST00000556881;ENST00000341228	D;D	0.84589	-1.87;-1.87	5.49	4.34	0.51931	Serpin domain (3);	0.119433	0.38111	N	0.001802	D	0.87692	0.6241	L	0.46819	1.47	0.20196	N	0.99993	D	0.71674	0.998	P	0.61275	0.886	T	0.80627	-0.1298	10	0.87932	D	0	.	11.607	0.51037	0.1385:0.0:0.0:0.8615	.	180	Q8IW75	SPA12_HUMAN	C	180	ENSP00000451738:F180C;ENSP00000342109:F180C	ENSP00000342109:F180C	F	-	2	0	SERPINA12	94033949	0.995000	0.38212	0.009000	0.14445	0.037000	0.13140	3.607000	0.54102	0.903000	0.36546	-0.339000	0.08088	TTT	.		0.393	SERPINA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413097.1	NM_173850	
RASGRP1	10125	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	38798102	38798102	+	Missense_Mutation	SNP	T	T	C			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr15:38798102T>C	ENST00000310803.5	-	10	1439	c.1262A>G	c.(1261-1263)tAc>tGc	p.Y421C	RP11-102L12.2_ENST00000560231.1_RNA|RASGRP1_ENST00000539159.1_Missense_Mutation_p.Y373C|RASGRP1_ENST00000559830.1_Missense_Mutation_p.Y421C|RASGRP1_ENST00000558164.1_Missense_Mutation_p.Y421C|RASGRP1_ENST00000450598.2_Missense_Mutation_p.Y421C|RASGRP1_ENST00000561180.1_Missense_Mutation_p.Y472C	NM_001128602.1|NM_005739.3	NP_001122074.1|NP_005730.2	O95267	GRP1_HUMAN	RAS guanyl releasing protein 1 (calcium and DAG-regulated)	421	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				activation of Rho GTPase activity (GO:0032862)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|inflammatory response to antigenic stimulus (GO:0002437)|innate immune response (GO:0045087)|mast cell degranulation (GO:0043303)|platelet activation (GO:0030168)|Ras protein signal transduction (GO:0007265)|regulation of phosphatidylinositol 3-kinase signaling (GO:0014066)|secretory granule localization (GO:0032252)|signal transduction (GO:0007165)|vesicle transport along microtubule (GO:0047496)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mast cell granule (GO:0042629)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|guanyl-nucleotide exchange factor activity (GO:0005085)|lipid binding (GO:0008289)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	20		all_cancers(109;6.38e-17)|all_epithelial(112;5.51e-15)|Lung NSC(122;2.12e-11)|all_lung(180;5.63e-10)|Melanoma(134;0.0574)		GBM - Glioblastoma multiforme(113;1.97e-07)|BRCA - Breast invasive adenocarcinoma(123;0.00248)		ATCCTCAGTGTAGTAAAGATC	0.448																																					p.Y421C		.											.	RASGRP1-697	0			c.A1262G						.						75.0	74.0	74.0					15																	38798102		1892	4109	6001	SO:0001583	missense	10125	exon10			TCAGTGTAGTAAA	AF106071	CCDS45221.1, CCDS45222.1	15q15	2013-01-10				ENSG00000172575		"""EF-hand domain containing"""	9878	protein-coding gene	gene with protein product		603962				10087292, 9789079	Standard	NM_005739		Approved	CalDAG-GEFII, RASGRP	uc001zke.4	O95267		ENST00000310803.5:c.1262A>G	15.37:g.38798102T>C	ENSP00000310244:p.Tyr421Cys	68	0		68	25	NM_001128602	0	0	3	7	4	Q56CZ0|Q58G75|Q59HB1|Q5I3A8|Q6GV31|Q6NX39|Q7LDG6|Q9UI94|Q9UNN9	Missense_Mutation	SNP	ENST00000310803.5	37	CCDS45222.1	.	.	.	.	.	.	.	.	.	.	T	18.55	3.649116	0.67358	.	.	ENSG00000172575	ENST00000310803;ENST00000450598;ENST00000415523;ENST00000431814;ENST00000539159;ENST00000414708;ENST00000541438	T;T;T;T	0.50277	0.75;0.75;0.75;0.75	4.6	4.6	0.57074	Guanine-nucleotide dissociation stimulator CDC25 (3);Ras guanine nucleotide exchange factor, domain (1);	0.000000	0.85682	D	0.000000	T	0.69351	0.3101	M	0.79805	2.47	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;0.999;1.0	D;D;D;D	0.91635	0.999;0.976;0.989;0.995	T	0.74278	-0.3717	10	0.62326	D	0.03	-19.3572	14.1614	0.65450	0.0:0.0:0.0:1.0	.	421;421;421;421	C9JM27;C9JCE5;O95267;O95267-2	.;.;GRP1_HUMAN;.	C	421;421;421;421;373;421;421	ENSP00000310244:Y421C;ENSP00000388540:Y421C;ENSP00000444762:Y373C;ENSP00000413105:Y421C	ENSP00000310244:Y421C	Y	-	2	0	RASGRP1	36585394	1.000000	0.71417	0.998000	0.56505	0.724000	0.41520	7.525000	0.81892	1.909000	0.55274	0.533000	0.62120	TAC	.		0.448	RASGRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418223.1	NM_005739	
DISP2	85455	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	40660678	40660678	+	Missense_Mutation	SNP	C	C	G	rs375551948		TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr15:40660678C>G	ENST00000267889.3	+	8	2452	c.2365C>G	c.(2365-2367)Cct>Gct	p.P789A	RP11-64K12.4_ENST00000558421.1_RNA	NM_033510.1	NP_277045.1	A7MBM2	DISP2_HUMAN	dispatched homolog 2 (Drosophila)	789					smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)				breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(12)|ovary(4)	30		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.39e-06)|Colorectal(105;0.0114)|READ - Rectum adenocarcinoma(2;0.0649)|BRCA - Breast invasive adenocarcinoma(123;0.0798)|Lung(196;0.15)|LUAD - Lung adenocarcinoma(183;0.247)		CCCTCTGGACCCTCGTAGCAA	0.687																																					p.P789A		.											.	DISP2-92	0			c.C2365G						.						76.0	84.0	81.0					15																	40660678		2203	4300	6503	SO:0001583	missense	85455	exon8			CTGGACCCTCGTA	AB051529	CCDS10056.1	15q14	2004-01-15			ENSG00000140323	ENSG00000140323			19712	protein-coding gene	gene with protein product		607503				11214970, 10619433	Standard	NM_033510		Approved	DISPB, KIAA1742, HsT16908	uc001zlk.1	A7MBM2	OTTHUMG00000129983	ENST00000267889.3:c.2365C>G	15.37:g.40660678C>G	ENSP00000267889:p.Pro789Ala	59	0		66	19	NM_033510	0	0	0	0	0	Q6AHW3|Q9C0C1	Missense_Mutation	SNP	ENST00000267889.3	37	CCDS10056.1	.	.	.	.	.	.	.	.	.	.	C	16.57	3.158992	0.57368	.	.	ENSG00000140323	ENST00000267889	T	0.30981	1.51	5.14	4.2	0.49525	.	0.052280	0.85682	D	0.000000	T	0.58119	0.2100	M	0.83483	2.645	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.63651	-0.6589	10	0.48119	T	0.1	-12.1506	14.8747	0.70485	0.1445:0.8555:0.0:0.0	.	789	A7MBM2	DISP2_HUMAN	A	789	ENSP00000267889:P789A	ENSP00000267889:P789A	P	+	1	0	DISP2	38447970	1.000000	0.71417	1.000000	0.80357	0.561000	0.35649	7.645000	0.83430	1.343000	0.45638	0.561000	0.74099	CCT	.		0.687	DISP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252249.1	NM_033510	
MGA	23269	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	42005518	42005518	+	Missense_Mutation	SNP	G	G	C			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr15:42005518G>C	ENST00000570161.1	+	8	3254	c.3254G>C	c.(3253-3255)aGa>aCa	p.R1085T	MGA_ENST00000545763.1_Missense_Mutation_p.R1085T|MGA_ENST00000389936.4_Missense_Mutation_p.R1085T|MGA_ENST00000219905.7_Missense_Mutation_p.R1085T|MGA_ENST00000566586.1_Missense_Mutation_p.R1085T			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0	Glucoamylase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	TGTTTGAAAAGAAAAGTTGTA	0.458																																					p.R1085T		.											.	MGA-522	0			c.G3254C						.						98.0	94.0	96.0					15																	42005518		1937	4124	6061	SO:0001583	missense	23269	exon9			TGAAAAGAAAAGT	AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.3254G>C	15.37:g.42005518G>C	ENSP00000457035:p.Arg1085Thr	106	0		80	24	NM_001080541	0	0	1	2	1	Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	ENST00000570161.1	37	CCDS55959.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.245765	0.80024	.	.	ENSG00000174197	ENST00000219905;ENST00000389936;ENST00000545763	T;T;T	0.17370	2.28;2.28;2.28	5.75	5.75	0.90469	.	0.177622	0.46758	D	0.000265	T	0.28433	0.0703	L	0.27053	0.805	0.35184	D	0.772759	D;D	0.76494	0.997;0.999	D;D	0.73708	0.981;0.931	T	0.25779	-1.0122	10	0.87932	D	0	.	13.1821	0.59660	0.0727:0.0:0.9273:0.0	.	1085;1085	F5H7K2;E7ENI0	.;.	T	1085	ENSP00000219905:R1085T;ENSP00000374586:R1085T;ENSP00000442467:R1085T	ENSP00000219905:R1085T	R	+	2	0	MGA	39792810	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.511000	0.53400	2.716000	0.92895	0.655000	0.94253	AGA	.		0.458	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420229.1	NM_001164273.1	
ALPK3	57538	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	85400827	85400827	+	Missense_Mutation	SNP	A	A	T			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr15:85400827A>T	ENST00000258888.5	+	6	3631	c.3464A>T	c.(3463-3465)gAc>gTc	p.D1155V		NM_020778.4	NP_065829.3	Q96L96	ALPK3_HUMAN	alpha-kinase 3	1155					heart development (GO:0007507)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(3)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(4)|large_intestine(9)|lung(27)|ovary(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	81			BRCA - Breast invasive adenocarcinoma(143;0.0587)			CGGAGCTGTGACCCTGGCCTC	0.627																																					p.D1155V		.											.	ALPK3-337	0			c.A3464T						.						42.0	49.0	47.0					15																	85400827		2203	4299	6502	SO:0001583	missense	57538	exon6			GCTGTGACCCTGG	AY044449	CCDS10333.1	15q25.2	2013-01-29			ENSG00000136383	ENSG00000136383		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17574	protein-coding gene	gene with protein product	"""myocyte induction differentiation originator"", ""muscle alpha-kinase"""					10021370	Standard	NM_020778		Approved	MAK, KIAA1330, Midori	uc002ble.3	Q96L96	OTTHUMG00000148667	ENST00000258888.5:c.3464A>T	15.37:g.85400827A>T	ENSP00000258888:p.Asp1155Val	64	0		62	19	NM_020778	0	0	26	49	23	Q9P2L6	Missense_Mutation	SNP	ENST00000258888.5	37	CCDS10333.1	.	.	.	.	.	.	.	.	.	.	A	19.25	3.792367	0.70452	.	.	ENSG00000136383	ENST00000258888	T	0.68624	-0.34	5.17	5.17	0.71159	.	0.513935	0.19872	N	0.104179	T	0.72590	0.3479	L	0.32530	0.975	0.54753	D	0.999988	D	0.89917	1.0	D	0.85130	0.997	T	0.74607	-0.3609	10	0.72032	D	0.01	-24.6636	11.4077	0.49908	1.0:0.0:0.0:0.0	.	1155	Q96L96	ALPK3_HUMAN	V	1155	ENSP00000258888:D1155V	ENSP00000258888:D1155V	D	+	2	0	ALPK3	83201831	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	2.636000	0.46545	1.958000	0.56883	0.460000	0.39030	GAC	.		0.627	ALPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000308997.1	NM_020778	
CACNA1H	8912	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	1268594	1268594	+	Missense_Mutation	SNP	C	C	A			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr16:1268594C>A	ENST00000348261.5	+	33	6078	c.5830C>A	c.(5830-5832)Cac>Aac	p.H1944N	CACNA1H_ENST00000358590.4_Missense_Mutation_p.H1938N|CACNA1H_ENST00000565831.1_Missense_Mutation_p.H1938N	NM_021098.2	NP_066921.2	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type, alpha 1H subunit	1944					aldosterone biosynthetic process (GO:0032342)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|positive regulation of acrosome reaction (GO:2000344)|regulation of heart contraction (GO:0008016)|regulation of membrane potential (GO:0042391)|transport (GO:0006810)	caveola (GO:0005901)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)			breast(4)|endometrium(5)|kidney(2)|lung(23)	34		Hepatocellular(780;0.00369)			Amiodarone(DB01118)|Bepridil(DB01244)|Cinnarizine(DB00568)|Felodipine(DB01023)|Flunarizine(DB04841)|Isradipine(DB00270)|Nifedipine(DB01115)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Zonisamide(DB00909)	CTCGGCGCCCCACCCCCGCCC	0.662																																					p.H1944N		.											.	CACNA1H-67	0			c.C5830A						.						14.0	17.0	16.0					16																	1268594		1988	4120	6108	SO:0001583	missense	8912	exon33			GCGCCCCACCCCC	AL031703	CCDS45375.1, CCDS45376.1	16p13.3	2012-03-07	2007-02-16					"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1395	protein-coding gene	gene with protein product		607904				9670923, 16382099	Standard	NM_021098		Approved	Cav3.2	uc002cks.3	O95180		ENST00000348261.5:c.5830C>A	16.37:g.1268594C>A	ENSP00000334198:p.His1944Asn	87	0		91	28	NM_021098	0	0	2	2	0	B5ME00|F8WFD1|O95802|Q8WWI6|Q96QI6|Q96RZ9|Q9NYY4|Q9NYY5	Missense_Mutation	SNP	ENST00000348261.5	37	CCDS45375.1	.	.	.	.	.	.	.	.	.	.	C	7.903	0.734914	0.15574	.	.	ENSG00000196557	ENST00000348261;ENST00000358590	D;D	0.96554	-4.05;-3.99	3.75	1.55	0.23275	.	3.133360	0.01371	N	0.012566	D	0.90823	0.7118	N	0.22421	0.69	0.09310	N	1	B;B;B;B;B	0.30973	0.034;0.029;0.0;0.302;0.039	B;B;B;B;B	0.24006	0.023;0.021;0.0;0.05;0.015	D	0.84424	0.0573	10	0.27082	T	0.32	.	2.7944	0.05397	0.2401:0.5032:0.0:0.2567	.	690;679;685;1938;1944	A2SX38;A2SX35;A2SX37;O95180-2;O95180	.;.;.;.;CAC1H_HUMAN	N	1944;1938	ENSP00000334198:H1944N;ENSP00000351401:H1938N	ENSP00000334198:H1944N	H	+	1	0	CACNA1H	1208595	0.947000	0.32204	0.001000	0.08648	0.001000	0.01503	0.399000	0.20916	0.806000	0.34183	0.563000	0.77884	CAC	.		0.662	CACNA1H-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000421601.1	NM_001005407	
BFAR	51283	broad.mit.edu	37	16	14738464	14738464	+	Silent	SNP	C	C	T			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr16:14738464C>T	ENST00000261658.2	+	2	538	c.261C>T	c.(259-261)ctC>ctT	p.L87L	BFAR_ENST00000563971.1_Silent_p.L87L|BFAR_ENST00000426842.2_Nonsense_Mutation_p.Q28*|RNU7-125P_ENST00000458760.1_RNA	NM_016561.2	NP_057645.1	Q9NZS9	BFAR_HUMAN	bifunctional apoptosis regulator	87					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	structural molecule activity (GO:0005198)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|skin(1)	11						GTATTCTCCTCAGGTAATGTT	0.408																																					p.L87L													.	BFAR-92	0			c.C261T						.						80.0	77.0	78.0					16																	14738464		2197	4300	6497	SO:0001819	synonymous_variant	51283	exon2			TCTCCTCAGGTAA	AF173003	CCDS10554.1	16p13.2	2013-01-10			ENSG00000103429	ENSG00000103429		"""RING-type (C3HC4) zinc fingers"", ""Sterile alpha motif (SAM) domain containing"""	17613	protein-coding gene	gene with protein product						10716992	Standard	NM_016561		Approved	BAR, RNF47	uc002dco.3	Q9NZS9	OTTHUMG00000129848	ENST00000261658.2:c.261C>T	16.37:g.14738464C>T		33	0		32	10	NM_016561	0	0	0	0	0	A8K4Z9|B4DUT0|D3DUG8	Silent	SNP	ENST00000261658.2	37	CCDS10554.1	.	.	.	.	.	.	.	.	.	.	C	37	6.614637	0.97705	.	.	ENSG00000103429	ENST00000426842	.	.	.	5.51	5.51	0.81932	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	.	12.1377	0.53981	0.0:0.9215:0.0:0.0785	.	.	.	.	X	28	.	ENSP00000400634:Q28X	Q	+	1	0	BFAR	14645965	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	1.254000	0.32897	2.745000	0.94114	0.655000	0.94253	CAG	.		0.408	BFAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252088.1	NM_016561	
CLEC19A	728276	hgsc.bcm.edu;bcgsc.ca	37	16	19320374	19320374	+	Intron	SNP	T	T	C			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr16:19320374T>C	ENST00000493231.1	+	2	367				AC003003.5_ENST00000468219.1_RNA			Q6UXS0	CL19A_HUMAN	C-type lectin domain family 19, member A							extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)										TTCCCCTTTGTCTGCAAAATC	0.453																																					p.V177A		.											.	.	0			c.T530C						.																																			SO:0001627	intron_variant	728276	exon5			CCTTTGTCTGCAA			16p12.3	2013-01-07			ENSG00000261210	ENSG00000261210		"""C-type lectin domain containing"""	34522	protein-coding gene	gene with protein product							Standard	NM_001256720		Approved		uc031qvg.1	Q6UXS0	OTTHUMG00000177218	ENST00000493231.1:c.254+10214T>C	16.37:g.19320374T>C		55	0		51	6	NM_001256720	0	0	0	0	0	Q0VF32	Missense_Mutation	SNP	ENST00000493231.1	37																																																																																				.		0.453	CLEC19A-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000438114.1	NM_00125672	
ZKSCAN2	342357	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	25266603	25266603	+	Missense_Mutation	SNP	C	C	G			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr16:25266603C>G	ENST00000328086.7	-	2	1313	c.510G>C	c.(508-510)gaG>gaC	p.E170D		NM_001012981.4	NP_001012999.3	Q63HK3	ZKSC2_HUMAN	zinc finger with KRAB and SCAN domains 2	170					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(15)|ovary(3)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)	36				GBM - Glioblastoma multiforme(48;0.0378)		TTCCAGGTTCCTCCCGAGACA	0.622																																					p.E170D		.											.	ZKSCAN2-138	0			c.G510C						.						88.0	78.0	82.0					16																	25266603		2197	4300	6497	SO:0001583	missense	342357	exon2			AGGTTCCTCCCGA	AK026852	CCDS32410.1	16p12.1	2013-01-09	2007-02-20	2007-02-20		ENSG00000155592		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	25677	protein-coding gene	gene with protein product			"""zinc finger protein 694"""	ZNF694			Standard	NM_001012981		Approved	FLJ23199, ZSCAN34	uc002dod.4	Q63HK3		ENST00000328086.7:c.510G>C	16.37:g.25266603C>G	ENSP00000331626:p.Glu170Asp	43	0		46	12	NM_001012981	0	0	0	0	0	A1L3B4|Q6ZN77	Missense_Mutation	SNP	ENST00000328086.7	37	CCDS32410.1	.	.	.	.	.	.	.	.	.	.	C	14.86	2.660995	0.47572	.	.	ENSG00000155592	ENST00000328086;ENST00000536768	T	0.14766	2.48	5.3	-2.75	0.05914	.	0.376195	0.25654	N	0.029181	T	0.11495	0.0280	L	0.55743	1.74	0.29398	N	0.862144	B;B	0.20550	0.046;0.003	B;B	0.27608	0.081;0.005	T	0.11251	-1.0595	10	0.52906	T	0.07	-11.4516	6.0464	0.19762	0.0:0.4411:0.1273:0.4316	.	170;170	Q63HK3-2;Q63HK3	.;ZKSC2_HUMAN	D	170	ENSP00000331626:E170D	ENSP00000331626:E170D	E	-	3	2	ZKSCAN2	25174104	0.027000	0.19231	0.445000	0.26908	0.501000	0.33797	-1.330000	0.02675	-0.703000	0.05049	0.555000	0.69702	GAG	.		0.622	ZKSCAN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435739.1	NM_001012981	
CCDC79	283847	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	66804098	66804098	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr16:66804098C>T	ENST00000558713.2	-	13	1459	c.1387G>A	c.(1387-1389)Gat>Aat	p.D463N	CCDC79_ENST00000561333.1_5'UTR|CCDC79_ENST00000415744.1_Missense_Mutation_p.D421N|CCDC79_ENST00000432602.1_Missense_Mutation_p.D463N|CCDC79_ENST00000433574.1_Missense_Mutation_p.D463N|CCDC79_ENST00000433154.1_Missense_Mutation_p.D463N			Q8NA31	TERB1_HUMAN	coiled-coil domain containing 79	463					meiotic telomere clustering (GO:0045141)|synapsis (GO:0007129)	chromosome, telomeric region (GO:0000781)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(1)|endometrium(2)|kidney(1)|large_intestine(1)|skin(2)	7						TTATCCTCATCTTCTGCTTTG	0.368																																					p.D463N		.											.	.	0			c.G1387A						.						261.0	198.0	217.0					16																	66804098		692	1591	2283	SO:0001583	missense	283847	exon14			CCTCATCTTCTGC	AK093213		16q22.1	2012-10-03			ENSG00000249961	ENSG00000249961			26675	protein-coding gene	gene with protein product							Standard	NM_001136505		Approved	FLJ35894	uc010viv.2	Q8NA31	OTTHUMG00000133562	ENST00000558713.2:c.1387G>A	16.37:g.66804098C>T	ENSP00000462883:p.Asp463Asn	100	0		107	40	NM_001136505	0	0	0	0	0	A0AUW1	Missense_Mutation	SNP	ENST00000558713.2	37		.	.	.	.	.	.	.	.	.	.	C	6.946	0.544308	0.13312	.	.	ENSG00000177461	ENST00000433154;ENST00000432602;ENST00000433574;ENST00000415744	T;T;T	0.21191	2.02;2.02;2.02	5.01	-1.62	0.08372	.	0.457877	0.20987	N	0.082105	T	0.16599	0.0399	L	0.57536	1.79	0.19575	N	0.999961	B;B	0.12630	0.006;0.004	B;B	0.11329	0.004;0.006	T	0.17745	-1.0359	10	0.56958	D	0.05	-11.2096	5.1151	0.14831	0.0:0.3293:0.1598:0.5109	.	463;463	Q8NA31;Q8NA31-2	CCD79_HUMAN;.	N	463;463;463;421	ENSP00000463762:D463N;ENSP00000462977:D463N;ENSP00000462037:D463N	ENSP00000440822:D421N	D	-	1	0	CCDC79	65361599	0.034000	0.19679	0.560000	0.28344	0.145000	0.21501	-0.197000	0.09518	-0.106000	0.12110	0.563000	0.77884	GAT	.		0.368	CCDC79-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000418864.2		
PKD1L3	342372	broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	71969289	71969289	+	RNA	SNP	T	T	C			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr16:71969289T>C	ENST00000534738.1	-	0	4580							Q7Z443	PK1L3_HUMAN	polycystic kidney disease 1-like 3						cation transport (GO:0006812)|cellular response to acidic pH (GO:0071468)|detection of chemical stimulus involved in sensory perception of sour taste (GO:0001581)|neuropeptide signaling pathway (GO:0007218)|sensory perception of sour taste (GO:0050915)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)			autonomic_ganglia(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|lung(3)|skin(2)	22						TATCGTGCCATGTTTTTCTTA	0.433																																					.													.	PKD1L3-68	0			.						.						174.0	142.0	152.0					16																	71969289		692	1591	2283			342372	.			GTGCCATGTTTTT	AY164485	CCDS73912.1	16q22.2	2008-02-05				ENSG00000277481			21716	protein-coding gene	gene with protein product		607895				12782129	Standard	NM_181536		Approved		uc010vmm.2	Q7Z443			16.37:g.71969289T>C		82	0		86	34	.	0	0	0	0	0		Missense_Mutation	SNP	ENST00000534738.1	37																																																																																				.		0.433	PKD1L3-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000387876.1	NM_181536	
CHMP1A	5119	ucsc.edu	37	16	89713674	89713674	+	Missense_Mutation	SNP	C	C	A			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr16:89713674C>A	ENST00000397901.3	-	5	574	c.318G>T	c.(316-318)caG>caT	p.Q106H	CHMP1A_ENST00000253475.5_Nonsense_Mutation_p.E100*|CHMP1A_ENST00000550102.1_Missense_Mutation_p.Q97H|CHMP1A_ENST00000535997.2_Missense_Mutation_p.Q42H|CHMP1A_ENST00000547614.1_5'UTR	NM_002768.3	NP_002759.2	Q9HD42	CHM1A_HUMAN	charged multivesicular body protein 1A	106					cytokinesis (GO:0000910)|gene silencing (GO:0016458)|mitotic chromosome condensation (GO:0007076)|negative regulation of transcription by glucose (GO:0045014)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|proteolysis (GO:0006508)|transcription, DNA-templated (GO:0006351)|vesicle-mediated transport (GO:0016192)	condensed nuclear chromosome (GO:0000794)|early endosome (GO:0005769)|endomembrane system (GO:0012505)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|nuclear matrix (GO:0016363)	metallopeptidase activity (GO:0008237)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(1)|ovary(1)	3		all_lung(18;3.07e-05)|all_hematologic(23;0.0256)		BRCA - Breast invasive adenocarcinoma(80;0.048)		AGGAGACCTTCTGCAGGTCCA	0.597																																					p.E100X													.	.	0			c.G298T						.						81.0	87.0	85.0					16																	89713674		2051	4196	6247	SO:0001583	missense	5119	exon4			GACCTTCTGCAGG	U58048	CCDS45552.1	16q24.3	2011-09-21	2011-09-21	2007-03-20	ENSG00000131165	ENSG00000131165		"""Charged multivesicular body proteins"""	8740	protein-coding gene	gene with protein product		164010	"""procollagen (type III) N-endopeptidase"", ""chromatin modifying protein 1A"""	PRSM1, PCOLN3		11559748, 11559747	Standard	NM_002768		Approved	KIAA0047, CHMP1, Vps46A	uc002fnu.4	Q9HD42	OTTHUMG00000169521	ENST00000397901.3:c.318G>T	16.37:g.89713674C>A	ENSP00000380998:p.Gln106His	42	0		51	2	NM_001083314	0	0	120	138	18	A2RU09|Q14468|Q15779|Q96G31	Nonsense_Mutation	SNP	ENST00000397901.3	37	CCDS45552.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	29.7|29.7	5.028081|5.028081	0.93518|0.93518	.|.	.|.	ENSG00000131165|ENSG00000131165	ENST00000253475|ENST00000397901;ENST00000535997;ENST00000550102	.|T;T;T	.|0.72615	.|-0.67;-0.67;-0.67	5.58|5.58	4.64|4.64	0.57946|0.57946	.|.	0.000000|.	0.38720|.	N|.	0.001586|.	.|D	.|0.82513	.|0.5053	M|M	0.79258|0.79258	2.445|2.445	0.80722|0.80722	A|A	1|1	.|D	.|0.71674	.|0.998	.|D	.|0.68943	.|0.961	.|D	.|0.87324	.|0.2320	.|8	0.87932|0.66056	D|D	0|0.02	-7.7945|-7.7945	12.6883|12.6883	0.56960|0.56960	0.0:0.8628:0.0:0.1372|0.0:0.8628:0.0:0.1372	.|.	.|106	.|Q9HD42	.|CHM1A_HUMAN	X|H	100|106;42;97	.|ENSP00000380998:Q106H;ENSP00000442120:Q42H;ENSP00000449243:Q97H	ENSP00000253475:E100X|ENSP00000380998:Q106H	E|Q	-|-	1|3	0|2	CHMP1A|CHMP1A	88241175|88241175	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.618000|0.618000	0.37518|0.37518	2.915000|2.915000	0.48805|0.48805	1.375000|1.375000	0.46248|0.46248	-0.119000|-0.119000	0.15052|0.15052	GAA|CAG	.		0.597	CHMP1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404581.1	NM_002768	
TP53	7157	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	7578271	7578271	+	Missense_Mutation	SNP	T	T	G			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr17:7578271T>G	ENST00000269305.4	-	6	767	c.578A>C	c.(577-579)cAt>cCt	p.H193P	TP53_ENST00000455263.2_Missense_Mutation_p.H193P|TP53_ENST00000413465.2_Missense_Mutation_p.H193P|TP53_ENST00000574684.1_Intron|TP53_ENST00000420246.2_Missense_Mutation_p.H193P|TP53_ENST00000445888.2_Missense_Mutation_p.H193P|TP53_ENST00000359597.4_Missense_Mutation_p.H193P	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	193	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		H -> D (in sporadic cancers; somatic mutation).|H -> L (in sporadic cancers; somatic mutation).|H -> N (in sporadic cancers; somatic mutation).|H -> P (in sporadic cancers; somatic mutation).|H -> Q (in sporadic cancers; somatic mutation).|H -> R (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7887414}.|H -> Y (in sporadic cancers; somatic mutation).|QH -> HN (in a sporadic cancer; somatic mutation).|QH -> HY (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.H193R(80)|p.H193L(42)|p.H193P(18)|p.0?(8)|p.?(6)|p.H61R(4)|p.H100R(4)|p.H100L(4)|p.H61L(4)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.H193fs*16(3)|p.P191fs*53(2)|p.H61P(2)|p.H100P(2)|p.A189fs*53(1)|p.P191fs*6(1)|p.H193_I195delHLI(1)|p.P59_E66>Q(1)|p.P191fs*15(1)|p.P98_E105>Q(1)|p.H193_I195>AP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCGGATAAGATGCTGAGGAGG	0.562		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.H193P	Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	.	TP53-70225	193	Substitution - Missense(160)|Whole gene deletion(8)|Complex - deletion inframe(6)|Unknown(6)|Deletion - In frame(5)|Deletion - Frameshift(4)|Insertion - Frameshift(3)|Complex - frameshift(1)	lung(36)|upper_aerodigestive_tract(26)|ovary(20)|breast(18)|oesophagus(14)|haematopoietic_and_lymphoid_tissue(12)|endometrium(12)|biliary_tract(10)|liver(9)|stomach(7)|central_nervous_system(6)|large_intestine(6)|urinary_tract(5)|skin(5)|bone(4)|pancreas(2)|prostate(1)	c.A578C	GRCh37	CM083194|CM951225	TP53	M		.						97.0	87.0	90.0					17																	7578271		2203	4300	6503	SO:0001583	missense	7157	exon6	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	ATAAGATGCTGAG	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.578A>C	17.37:g.7578271T>G	ENSP00000269305:p.His193Pro	120	1		123	29	NM_000546	0	1	8	18	9	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	T	13.91	2.377907	0.42105	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99855	-7.2;-7.2;-7.2;-7.2;-7.2;-7.2;-7.2;-7.2	5.41	4.33	0.51752	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99840	0.9927	M	0.88906	2.99	0.58432	D	0.999998	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D	0.97320	0.9943	10	0.87932	D	0	-29.0766	9.707	0.40222	0.0:0.0827:0.0:0.9173	.	154;193;193;100;193;193;193	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	P	193;193;193;193;193;193;182;100;61;100;61	ENSP00000410739:H193P;ENSP00000352610:H193P;ENSP00000269305:H193P;ENSP00000398846:H193P;ENSP00000391127:H193P;ENSP00000391478:H193P;ENSP00000425104:H61P;ENSP00000423862:H100P	ENSP00000269305:H193P	H	-	2	0	TP53	7518996	1.000000	0.71417	0.814000	0.32528	0.023000	0.10783	7.996000	0.88334	1.001000	0.39076	-0.256000	0.11100	CAT	.		0.562	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
KRTAP4-7	100132476	broad.mit.edu	37	17	39240627	39240627	+	Missense_Mutation	SNP	T	T	C	rs189343211		TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr17:39240627T>C	ENST00000391417.4	+	1	169	c.169T>C	c.(169-171)Tct>Cct	p.S57P		NM_033061.3	NP_149050.3	Q9BYR0	KRA47_HUMAN	keratin associated protein 4-7	57	31 X 5 AA repeats of C-C-[GIKRQVHEML]- [SPTRV]-[STVQRCP].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)		p.S57P(4)		NS(1)|endometrium(3)|kidney(1)|lung(1)|prostate(2)|urinary_tract(1)	9						GTGCTGCCAGTCTGTGTGCTG	0.667																																					p.S57P													.	.	4	Substitution - Missense(4)	urinary_tract(2)|kidney(2)	c.T169C						.						18.0	28.0	25.0					17																	39240627		691	1590	2281	SO:0001583	missense	100132476	exon1			TGCCAGTCTGTGT	AJ406939	CCDS45673.1	17q21.2	2013-06-25			ENSG00000240871	ENSG00000240871		"""Keratin associated proteins"""	18898	protein-coding gene	gene with protein product						11279113	Standard	NM_033061		Approved	KAP4.7	uc010wfn.2	Q9BYR0	OTTHUMG00000133582	ENST00000391417.4:c.169T>C	17.37:g.39240627T>C	ENSP00000375236:p.Ser57Pro	40	1		67	9	NM_033061	0	0	0	0	0	A0AVM6|A8MQ08|A8MTL4	Missense_Mutation	SNP	ENST00000391417.4	37	CCDS45673.1	.	.	.	.	.	.	.	.	.	.	.	0.387	-0.925721	0.02377	.	.	ENSG00000240871;ENSG00000212722	ENST00000391417;ENST00000377734	T	0.01272	5.07	3.6	-0.386	0.12466	.	1.254490	0.05892	N	0.628448	T	0.00695	0.0023	.	.	.	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.43572	-0.9383	9	0.02654	T	1	.	4.4551	0.11639	0.0:0.4346:0.1731:0.3923	.	57	Q9BYR0	KRA47_HUMAN	P	57	ENSP00000375236:S57P	ENSP00000375236:S57P	S	+	1	0	KRTAP4-9;KRTAP4-7	36494153	0.000000	0.05858	0.033000	0.17914	0.157000	0.22087	-0.806000	0.04525	0.004000	0.14682	0.374000	0.22700	TCT	.		0.667	KRTAP4-7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257686.1		
BRCA1	672	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	41203099	41203099	+	Silent	SNP	G	G	A	rs273901762		TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr17:41203099G>A	ENST00000357654.3	-	20	5431	c.5313C>T	c.(5311-5313)ccC>ccT	p.P1771P	BRCA1_ENST00000346315.3_Silent_p.P1532P|BRCA1_ENST00000491747.2_Silent_p.P667P|BRCA1_ENST00000354071.3_Silent_p.P1506P|BRCA1_ENST00000591534.1_Silent_p.P262P|BRCA1_ENST00000351666.3_Silent_p.P588P|BRCA1_ENST00000352993.3_Silent_p.P629P|BRCA1_ENST00000471181.2_Silent_p.P1792P|BRCA1_ENST00000468300.1_Silent_p.P667P|BRCA1_ENST00000591849.1_Intron|BRCA1_ENST00000309486.4_Silent_p.P1475P|BRCA1_ENST00000586385.1_Silent_p.P81P|BRCA1_ENST00000493795.1_Silent_p.P1724P	NM_007294.3	NP_009225.1	P38398	BRCA1_HUMAN	breast cancer 1, early onset	1771	BRCT 2. {ECO:0000255|PROSITE- ProRule:PRU00033}.				androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to indole-3-methanol (GO:0071681)|cellular response to tumor necrosis factor (GO:0071356)|chromosome segregation (GO:0007059)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|fatty acid biosynthetic process (GO:0006633)|G2 DNA damage checkpoint (GO:0031572)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of centriole replication (GO:0046600)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of DNA repair (GO:0045739)|positive regulation of gene expression (GO:0010628)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of histone H4-K16 acetylation (GO:2000620)|positive regulation of histone H4-K20 methylation (GO:0070512)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|postreplication repair (GO:0006301)|protein autoubiquitination (GO:0051865)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to estrogen (GO:0043627)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|gamma-tubulin ring complex (GO:0008274)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(30)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(28)|ovary(36)|skin(2)|stomach(4)|urinary_tract(2)	120		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		TGTTGGTGAAGGGCCCATAGC	0.478			"""D, Mis, N, F, S"""		ovarian	"""breast, ovarian"""		Homologous recombination	Hereditary Breast-Ovarian Cancer, BRCA1 type	TCGA Ovarian(2;0.000030)																											p.P1792P		.	yes	Rec	yes	Hereditary breast/ovarian cancer	17	17q21	672	familial breast/ovarian cancer gene 1		E	.	BRCA1-3415	0			c.C5376T						.						70.0	69.0	69.0					17																	41203099		2203	4300	6503	SO:0001819	synonymous_variant	672	exon21	Familial Cancer Database		GGTGAAGGGCCCA	U14680	CCDS11453.1, CCDS11454.1, CCDS11455.1, CCDS11456.1, CCDS11459.1, CCDS11455.2, CCDS11456.2, CCDS11459.2, CCDS11454.2	17q21.31	2014-09-17			ENSG00000012048	ENSG00000012048		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1100	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 1"", ""protein phosphatase 1, regulatory subunit 53"""	113705				1676470	Standard	NM_007300		Approved	RNF53, BRCC1, PPP1R53	uc002ict.3	P38398	OTTHUMG00000157426	ENST00000357654.3:c.5313C>T	17.37:g.41203099G>A		53	0		63	24	NM_007300	0	0	2	4	2	O15129|Q1RMC1|Q3LRJ0|Q3LRJ6|Q6IN79|Q7KYU9	Silent	SNP	ENST00000357654.3	37	CCDS11453.1																																																																																			.		0.478	BRCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348798.2	NM_007294	
HEATR6	63897	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	58121036	58121036	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr17:58121036G>T	ENST00000184956.6	-	20	3450	c.3434C>A	c.(3433-3435)cCa>cAa	p.P1145Q	AC005702.2_ENST00000577558.1_RNA|MIR4737_ENST00000583979.1_RNA|AC005702.3_ENST00000582298.1_RNA|AC005702.1_ENST00000581326.1_RNA|HEATR6_ENST00000585976.1_Missense_Mutation_p.P1033Q|AC005702.4_ENST00000583144.1_RNA	NM_022070.4	NP_071353.4	Q6AI08	HEAT6_HUMAN	HEAT repeat containing 6	1145							poly(A) RNA binding (GO:0044822)			NS(1)|breast(4)|endometrium(5)|kidney(2)|large_intestine(4)|lung(7)|ovary(2)|pancreas(1)|prostate(4)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	44	all_cancers(5;2.25e-13)|Breast(5;4.84e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		BRCA - Breast invasive adenocarcinoma(1;5.93e-19)|Epithelial(12;7.59e-12)|all cancers(12;1.26e-10)			GTCTCCAGTTGGTGCCTGGAT	0.542																																					p.P1145Q		.											.	HEATR6-227	0			c.C3434A						.						129.0	115.0	120.0					17																	58121036		2203	4300	6503	SO:0001583	missense	63897	exon20			CCAGTTGGTGCCT	BX640819	CCDS11623.1	17q23.2	2007-05-01				ENSG00000068097			24076	protein-coding gene	gene with protein product	"""amplified in breast cancer 1"""					12755490	Standard	NM_022070		Approved	ABC1, FLJ22087	uc002iyk.1	Q6AI08		ENST00000184956.6:c.3434C>A	17.37:g.58121036G>T	ENSP00000184956:p.Pro1145Gln	130	0		207	49	NM_022070	0	0	15	18	3	B3KXP3|Q6MZX1|Q6MZY2|Q8TDM9|Q9H6B3|Q9H6M7	Missense_Mutation	SNP	ENST00000184956.6	37	CCDS11623.1	.	.	.	.	.	.	.	.	.	.	G	0.083	-1.180886	0.01633	.	.	ENSG00000068097	ENST00000184956;ENST00000393017	T	0.64438	-0.1	4.96	0.0386	0.14201	Armadillo-type fold (1);	1.078860	0.07032	N	0.828585	T	0.32941	0.0846	N	0.03608	-0.345	0.09310	N	1	B;B	0.17268	0.021;0.0	B;B	0.13407	0.009;0.001	T	0.19451	-1.0305	10	0.20519	T	0.43	0.0678	3.9945	0.09551	0.5137:0.0:0.2773:0.209	.	880;1145	E7ESB9;Q6AI08	.;HEAT6_HUMAN	Q	1145;880	ENSP00000184956:P1145Q	ENSP00000184956:P1145Q	P	-	2	0	HEATR6	55475818	0.000000	0.05858	0.002000	0.10522	0.010000	0.07245	-0.029000	0.12329	0.348000	0.23949	-0.312000	0.09012	CCA	.		0.542	HEATR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449165.1	NM_022070	
HELZ	9931	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	65162707	65162707	+	Silent	SNP	T	T	C			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr17:65162707T>C	ENST00000358691.5	-	15	1948	c.1782A>G	c.(1780-1782)caA>caG	p.Q594Q	HELZ_ENST00000580168.1_Silent_p.Q594Q	NM_014877.3	NP_055692	P42694	HELZ_HUMAN	helicase with zinc finger	594						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(5)|endometrium(9)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					ATCGATTTAATTGAAACTGAA	0.393																																					p.Q594Q		.											.	HELZ-92	0			c.A1782G						.						104.0	96.0	98.0					17																	65162707		1858	4110	5968	SO:0001819	synonymous_variant	9931	exon15			ATTTAATTGAAAC	D29677	CCDS42374.1	17q24.2	2013-01-18			ENSG00000198265	ENSG00000198265		"""Zinc fingers, CCCH-type domain containing"""	16878	protein-coding gene	gene with protein product	"""down-regulated in human cancers"""	606699				10471385, 12691822	Standard	NM_014877		Approved	KIAA0054, HUMORF5, DHRC	uc002jfx.4	P42694	OTTHUMG00000179555	ENST00000358691.5:c.1782A>G	17.37:g.65162707T>C		85	0		117	9	NM_014877	0	0	9	12	3	I6L9H4	Silent	SNP	ENST00000358691.5	37	CCDS42374.1																																																																																			.		0.393	HELZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000447068.1	NM_014877	
FSCN2	25794	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	79496379	79496379	+	Silent	SNP	G	G	A			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr17:79496379G>A	ENST00000417245.2	+	1	958	c.822G>A	c.(820-822)cgG>cgA	p.R274R	RP13-766D20.2_ENST00000442532.1_RNA|RP13-766D20.2_ENST00000430912.1_RNA|FSCN2_ENST00000334850.7_Silent_p.R274R	NM_001077182.2|NM_012418.3	NP_001070650.1|NP_036550.1	O14926	FSCN2_HUMAN	fascin actin-bundling protein 2, retinal	274					actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|anatomical structure morphogenesis (GO:0009653)|eye photoreceptor cell development (GO:0042462)|visual perception (GO:0007601)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|stereocilium (GO:0032420)	actin binding (GO:0003779)|actin filament binding (GO:0051015)			endometrium(1)|lung(1)|prostate(1)|urinary_tract(1)	4	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0371)			TCTCTGTGCGGCAAGGTAGGG	0.647																																					p.R274R		.											.	.	0			c.G822A						.						9.0	10.0	10.0					17																	79496379		2169	4246	6415	SO:0001819	synonymous_variant	25794	exon1			TGTGCGGCAAGGT	AF030165	CCDS45810.1, CCDS45811.1	17q25	2014-02-03	2014-02-03		ENSG00000186765	ENSG00000186765		"""Fascins"""	3960	protein-coding gene	gene with protein product		607643	"""fascin (Strongylocentrotus purpuratus) homolog 2 (actin-bundling protein, retinal)"", ""fascin homolog 2, actin-bundling protein, retinal (Strongylocentrotus purpuratus)"""			10234509	Standard	NM_012418		Approved	RP30, RFSN	uc010wuo.2	O14926	OTTHUMG00000167477	ENST00000417245.2:c.822G>A	17.37:g.79496379G>A		83	0		123	73	NM_001077182	0	0	0	0	0	A0AVC4|A8MRA6	Silent	SNP	ENST00000417245.2	37	CCDS45811.1																																																																																			.		0.647	FSCN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394746.1	NM_012418	
PCYT2	5833	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	79865647	79865647	+	Splice_Site	SNP	A	A	G			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr17:79865647A>G	ENST00000538936.2	-	5	601		c.e5+1		PCYT2_ENST00000571105.1_Splice_Site|PCYT2_ENST00000331285.3_Splice_Site|PCYT2_ENST00000570388.1_Splice_Site|PCYT2_ENST00000570391.1_Splice_Site|PCYT2_ENST00000538721.2_Splice_Site	NM_001256435.1|NM_002861.3	NP_001243364.1|NP_002852.1	Q99447	PCY2_HUMAN	phosphate cytidylyltransferase 2, ethanolamine						glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)	ethanolamine-phosphate cytidylyltransferase activity (GO:0004306)			breast(2)|endometrium(1)|lung(4)|ovary(1)	8	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.013)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)		Lamivudine(DB00709)	CCGCCGACTCACCTGGCTGCT	0.667																																					.		.											.	PCYT2-68	0			c.258+2T>C						.						55.0	45.0	49.0					17																	79865647		2203	4300	6503	SO:0001630	splice_region_variant	5833	exon6			CGACTCACCTGGC	D84307	CCDS11791.1, CCDS54178.1, CCDS58610.1, CCDS62364.1	17q25.3	2008-07-18				ENSG00000185813			8756	protein-coding gene	gene with protein product		602679				9083101	Standard	XM_005256386		Approved	ET	uc002kch.2	Q99447		ENST00000538936.2:c.492+1T>C	17.37:g.79865647A>G		46	0		52	14	NM_001256435	0	0	0	0	0	B7Z7A5|B7ZAS0|F5H8B1|Q6IBM3|Q96G08	Splice_Site	SNP	ENST00000538936.2	37	CCDS11791.1	.	.	.	.	.	.	.	.	.	.	A	15.43	2.829822	0.50845	.	.	ENSG00000185813	ENST00000538721;ENST00000538936;ENST00000331285	.	.	.	4.34	4.34	0.51931	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.2492	0.54589	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PCYT2	77458939	1.000000	0.71417	1.000000	0.80357	0.632000	0.37999	8.242000	0.89818	1.812000	0.52913	0.459000	0.35465	.	.		0.667	PCYT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439939.1	NM_002861	Intron
TXNDC2	84203	broad.mit.edu	37	18	9887670	9887670	+	Silent	SNP	A	A	G			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr18:9887670A>G	ENST00000306084.6	+	2	1393	c.1194A>G	c.(1192-1194)ccA>ccG	p.P398P	TXNDC2_ENST00000536353.2_3'UTR|TXNDC2_ENST00000357775.5_Silent_p.P331P	NM_001098529.1	NP_001091999.1	Q86VQ3	TXND2_HUMAN	thioredoxin domain containing 2 (spermatozoa)	398	22 X 15 AA approximate tandem repeat of Q-P-K-X-G-D-I-P-K-S-[PS]-E-[KE]-X-I.				cell differentiation (GO:0030154)|cell redox homeostasis (GO:0045454)|glycerol ether metabolic process (GO:0006662)|multicellular organismal development (GO:0007275)|oxidation-reduction process (GO:0055114)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|motile cilium (GO:0031514)|nucleolus (GO:0005730)|nucleus (GO:0005634)|outer dense fiber (GO:0001520)	nutrient reservoir activity (GO:0045735)|protein disulfide isomerase activity (GO:0003756)|protein disulfide oxidoreductase activity (GO:0015035)|thioredoxin-disulfide reductase activity (GO:0004791)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|skin(7)|urinary_tract(1)	31						AAGCCATCCCACCCAAGGAGA	0.562																																					p.P398P													.	TXNDC2-92	0			c.A1194G						.						118.0	106.0	110.0					18																	9887670		2203	4300	6503	SO:0001819	synonymous_variant	84203	exon2			CATCCCACCCAAG	AF080095	CCDS11846.1, CCDS42414.1	18p11.31-p11.2	2009-03-11	2009-03-11	2007-08-16	ENSG00000168454	ENSG00000168454			16470	protein-coding gene	gene with protein product	"""sperm-specific thioredoxin 1"""					11230166, 11399755	Standard	NM_001098529		Approved	SPTRX1	uc002koi.4	Q86VQ3	OTTHUMG00000131602	ENST00000306084.6:c.1194A>G	18.37:g.9887670A>G		122	4		128	9	NM_001098529	0	0	0	0	0	A5YM73|Q8N7U4|Q96RX3|Q9H0L8	Silent	SNP	ENST00000306084.6	37	CCDS42414.1																																																																																			.		0.562	TXNDC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254487.1		
TXNDC2	84203	broad.mit.edu	37	18	9887681	9887681	+	Missense_Mutation	SNP	T	T	G	rs553374563		TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr18:9887681T>G	ENST00000306084.6	+	2	1404	c.1205T>G	c.(1204-1206)aTt>aGt	p.I402S	TXNDC2_ENST00000536353.2_3'UTR|TXNDC2_ENST00000357775.5_Missense_Mutation_p.I335S	NM_001098529.1	NP_001091999.1	Q86VQ3	TXND2_HUMAN	thioredoxin domain containing 2 (spermatozoa)	402	22 X 15 AA approximate tandem repeat of Q-P-K-X-G-D-I-P-K-S-[PS]-E-[KE]-X-I.				cell differentiation (GO:0030154)|cell redox homeostasis (GO:0045454)|glycerol ether metabolic process (GO:0006662)|multicellular organismal development (GO:0007275)|oxidation-reduction process (GO:0055114)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|motile cilium (GO:0031514)|nucleolus (GO:0005730)|nucleus (GO:0005634)|outer dense fiber (GO:0001520)	nutrient reservoir activity (GO:0045735)|protein disulfide isomerase activity (GO:0003756)|protein disulfide oxidoreductase activity (GO:0015035)|thioredoxin-disulfide reductase activity (GO:0004791)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|skin(7)|urinary_tract(1)	31						CCCAAGGAGATTGACATCCCC	0.557																																					p.I402S													.	TXNDC2-92	0			c.T1205G						.						116.0	104.0	108.0					18																	9887681		2203	4300	6503	SO:0001583	missense	84203	exon2			AGGAGATTGACAT	AF080095	CCDS11846.1, CCDS42414.1	18p11.31-p11.2	2009-03-11	2009-03-11	2007-08-16	ENSG00000168454	ENSG00000168454			16470	protein-coding gene	gene with protein product	"""sperm-specific thioredoxin 1"""					11230166, 11399755	Standard	NM_001098529		Approved	SPTRX1	uc002koi.4	Q86VQ3	OTTHUMG00000131602	ENST00000306084.6:c.1205T>G	18.37:g.9887681T>G	ENSP00000304908:p.Ile402Ser	118	2		121	4	NM_001098529	0	0	0	0	0	A5YM73|Q8N7U4|Q96RX3|Q9H0L8	Missense_Mutation	SNP	ENST00000306084.6	37	CCDS42414.1	.	.	.	.	.	.	.	.	.	.	t	0.023	-1.405408	0.01155	.	.	ENSG00000168454	ENST00000536353;ENST00000357775;ENST00000306084;ENST00000426718	T;T	0.03772	3.81;3.81	3.43	-2.0	0.07433	.	7.730320	0.00481	N	0.000131	T	0.02888	0.0086	N	0.11427	0.14	0.09310	N	1	B	0.18741	0.03	B	0.21708	0.036	T	0.39375	-0.9617	9	.	.	.	.	3.3024	0.06988	0.2924:0.0:0.2459:0.4617	.	402	Q86VQ3	TXND2_HUMAN	S	200;335;402;387	ENSP00000350419:I335S;ENSP00000304908:I402S	.	I	+	2	0	TXNDC2	9877681	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.047000	0.03521	-0.479000	0.06813	-1.354000	0.01226	ATT	.		0.557	TXNDC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254487.1		
KCNG2	26251	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	18	77659162	77659162	+	Silent	SNP	G	G	A	rs140841838		TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr18:77659162G>A	ENST00000316249.3	+	2	747	c.747G>A	c.(745-747)gcG>gcA	p.A249A	KCNG2_ENST00000590307.1_3'UTR	NM_012283.1	NP_036415.1	Q9UJ96	KCNG2_HUMAN	potassium voltage-gated channel, subfamily G, member 2	249					energy reserve metabolic process (GO:0006112)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of heart contraction (GO:0008016)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			breast(2)|endometrium(4)|lung(7)|skin(1)|upper_aerodigestive_tract(4)	18		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;6.92e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0244)		TCCTGCGCGCGCCACTCAACA	0.677																																					p.A249A		.											.	KCNG2-90	0			c.G747A						.	G		0,4404		0,0,2202	43.0	39.0	40.0		747	-3.4	0.0	18	dbSNP_134	40	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	KCNG2	NM_012283.1		0,1,6501	AA,AG,GG		0.0116,0.0,0.0077		249/467	77659162	1,13003	2202	4300	6502	SO:0001819	synonymous_variant	26251	exon2			GCGCGCGCCACTC	AJ011021	CCDS12019.1	18q23	2011-07-05			ENSG00000178342	ENSG00000178342		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6249	protein-coding gene	gene with protein product		605696				10551266, 16382104	Standard	NM_012283		Approved	Kv6.2, KCNF2	uc010xfl.2	Q9UJ96	OTTHUMG00000044541	ENST00000316249.3:c.747G>A	18.37:g.77659162G>A		32	0		26	6	NM_012283	0	0	0	0	0		Silent	SNP	ENST00000316249.3	37	CCDS12019.1																																																																																			G|1.000;A|0.000		0.677	KCNG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103906.1	NM_012283	
ICAM1	3383	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	10395839	10395839	+	Missense_Mutation	SNP	T	T	A			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr19:10395839T>A	ENST00000264832.3	+	7	1800	c.1475T>A	c.(1474-1476)aTa>aAa	p.I492K	ICAM4_ENST00000380770.3_5'Flank|ICAM4_ENST00000340992.4_5'Flank|CTD-2369P2.8_ENST00000589379.1_RNA|ICAM1_ENST00000423829.2_Missense_Mutation_p.I270K|ICAM4_ENST00000393717.2_5'Flank|CTD-2369P2.5_ENST00000592893.1_RNA	NM_000201.2	NP_000192.2	P05362	ICAM1_HUMAN	intercellular adhesion molecule 1	492					adhesion of symbiont to host (GO:0044406)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell aging (GO:0007569)|cellular response to alkaloid (GO:0071312)|cellular response to glucose stimulus (GO:0071333)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to nutrient levels (GO:0031669)|cellular response to tumor necrosis factor (GO:0071356)|cytokine-mediated signaling pathway (GO:0019221)|establishment of endothelial barrier (GO:0061028)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|membrane to membrane docking (GO:0022614)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|ovarian follicle development (GO:0001541)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cellular extravasation (GO:0002693)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of vasoconstriction (GO:0045907)|receptor-mediated virion attachment to host cell (GO:0046813)|regulation of cell adhesion (GO:0030155)|regulation of cell shape (GO:0008360)|regulation of immune response (GO:0050776)|regulation of leukocyte mediated cytotoxicity (GO:0001910)|regulation of ruffle assembly (GO:1900027)|response to amino acid (GO:0043200)|response to amphetamine (GO:0001975)|response to copper ion (GO:0046688)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to gonadotropin (GO:0034698)|response to ionizing radiation (GO:0010212)|response to organic cyclic compound (GO:0014070)|response to sulfur dioxide (GO:0010477)|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:0002291)|T cell antigen processing and presentation (GO:0002457)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|immunological synapse (GO:0001772)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)|virus receptor activity (GO:0001618)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(20;1.39e-09)|Epithelial(33;2.81e-06)|all cancers(31;6.56e-06)		Hyaluronan(DB08818)|Natalizumab(DB00108)	GCCGCAGTCATAATGGGCACT	0.547																																					p.I492K		.											.	ICAM1-91	0			c.T1475A						.						103.0	105.0	104.0					19																	10395839		2203	4300	6503	SO:0001583	missense	3383	exon7			CAGTCATAATGGG		CCDS12231.1	19p13.3-p13.2	2014-01-30	2008-07-18			ENSG00000090339		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Endogenous ligands"""	5344	protein-coding gene	gene with protein product	"""human rhinovirus receptor"""	147840				2453850, 3871395	Standard	NM_000201		Approved	BB2, CD54	uc002mnq.2	P05362		ENST00000264832.3:c.1475T>A	19.37:g.10395839T>A	ENSP00000264832:p.Ile492Lys	67	0		83	29	NM_000201	0	0	59	108	49	B2R6M3|Q5NKV7|Q96B50	Missense_Mutation	SNP	ENST00000264832.3	37	CCDS12231.1	.	.	.	.	.	.	.	.	.	.	T	12.45	1.941110	0.34283	.	.	ENSG00000090339	ENST00000264832;ENST00000423829	T;T	0.05199	4.24;3.48	5.22	3.07	0.35406	.	4.242400	0.00744	N	0.001020	T	0.05593	0.0147	N	0.19112	0.55	0.09310	N	0.999997	B;B	0.27286	0.142;0.174	B;B	0.22880	0.042;0.028	T	0.29305	-1.0016	10	0.42905	T	0.14	-14.6127	4.9491	0.14004	0.1651:0.0921:0.0:0.7428	.	270;492	E7ESS4;P05362	.;ICAM1_HUMAN	K	492;270	ENSP00000264832:I492K;ENSP00000413124:I270K	ENSP00000264832:I492K	I	+	2	0	ICAM1	10256839	0.000000	0.05858	0.006000	0.13384	0.011000	0.07611	0.007000	0.13174	0.909000	0.36697	0.459000	0.35465	ATA	.		0.547	ICAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451207.1		
PLEKHG2	64857	hgsc.bcm.edu;broad.mit.edu	37	19	39913652	39913652	+	Missense_Mutation	SNP	G	G	A			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr19:39913652G>A	ENST00000409794.3	+	18	2808	c.1958G>A	c.(1957-1959)gGt>gAt	p.G653D	PLEKHG2_ENST00000425673.1_Missense_Mutation_p.G624D|PLEKHG2_ENST00000378550.1_Intron|PLEKHG2_ENST00000458508.2_Missense_Mutation_p.G594D|CTB-60E11.4_ENST00000601124.1_lincRNA|PLEKHG2_ENST00000409797.2_Intron	NM_022835.2	NP_073746.2	Q9H7P9	PKHG2_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 2	653					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(2)|liver(1)|lung(13)|pancreas(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	40	all_cancers(60;3.08e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;6.57e-07)|Ovarian(47;0.0569)		Epithelial(26;2.92e-26)|all cancers(26;2.01e-23)|Lung(45;0.000499)|LUSC - Lung squamous cell carcinoma(53;0.000657)			ATTCCCGAAGGTTCTCGCCTT	0.517																																					p.G653D		.											.	PLEKHG2-274	0			c.G1958A						.						95.0	100.0	98.0					19																	39913652		2203	4300	6503	SO:0001583	missense	64857	exon18			CCGAAGGTTCTCG	AK024429	CCDS33022.2	19q13.2	2013-01-11			ENSG00000090924	ENSG00000090924		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	29515	protein-coding gene	gene with protein product		611893				11839748, 18045877	Standard	NM_022835		Approved	CLG, FLJ00018, ARHGEF42	uc010xuz.2	Q9H7P9	OTTHUMG00000152570	ENST00000409794.3:c.1958G>A	19.37:g.39913652G>A	ENSP00000386733:p.Gly653Asp	80	0		87	5	NM_022835	0	0	3	3	0	B8ZZK6|C9J0Y4|Q6DHV6|Q96BU2|Q96D18|Q9H699	Missense_Mutation	SNP	ENST00000409794.3	37	CCDS33022.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	2.825|2.825	-0.243916|-0.243916	0.05906|0.05906	.|.	.|.	ENSG00000090924|ENSG00000090924	ENST00000409794;ENST00000425673;ENST00000458508|ENST00000205135	T;T;T|.	0.69040|.	-0.25;-0.25;-0.37|.	3.44|3.44	0.133|0.133	0.14766|0.14766	.|.	1.062390|.	0.07458|.	N|.	0.900138|.	T|T	0.14830|0.14830	0.0358|0.0358	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B;B;B|.	0.30361|.	0.263;0.261;0.277|.	B;B;B|.	0.25987|.	0.065;0.044;0.043|.	T|T	0.26121|0.26121	-1.0112|-1.0112	10|5	0.46703|.	T|.	0.11|.	.|.	4.0591|4.0591	0.09831|0.09831	0.0:0.2305:0.195:0.5745|0.0:0.2305:0.195:0.5745	.|.	624;653;594|.	Q9H7P9-3;Q9H7P9;E7ESZ3|.	.;PKHG2_HUMAN;.|.	D|I	653;624;594|521	ENSP00000386733:G653D;ENSP00000392906:G624D;ENSP00000408857:G594D|.	ENSP00000386733:G653D|.	G|V	+|+	2|1	0|0	PLEKHG2|PLEKHG2	44605492|44605492	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.010000|0.010000	0.07245|0.07245	-0.226000|-0.226000	0.09139|0.09139	-0.034000|-0.034000	0.13713|0.13713	-0.467000|-0.467000	0.05162|0.05162	GGT|GTT	.		0.517	PLEKHG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326802.1	NM_022835	
CLASRP	11129	broad.mit.edu	37	19	45571284	45571284	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr19:45571284C>T	ENST00000221455.3	+	15	1777	c.1679C>T	c.(1678-1680)gCc>gTc	p.A560V	CLASRP_ENST00000544944.2_Missense_Mutation_p.A560V|CLASRP_ENST00000391953.4_Missense_Mutation_p.A498V	NM_007056.2	NP_008987	Q8N2M8	CLASR_HUMAN	CLK4-associating serine/arginine rich protein	560	Arg-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|pancreas(2)|prostate(1)	16						ACCGAACCTGCCGCTGGTAAA	0.632																																					p.A560V													.	CLASRP-154	0			c.C1679T						.						33.0	36.0	35.0					19																	45571284		2203	4300	6503	SO:0001583	missense	11129	exon15			AACCTGCCGCTGG	AF042800	CCDS12652.2, CCDS62710.1	19q13.3	2010-09-21	2010-09-21	2010-09-21	ENSG00000104859	ENSG00000104859			17731	protein-coding gene	gene with protein product	"""Clk4 associating SR-related protein"""		"""splicing factor, arginine/serine-rich 16"""	SFRS16		12169693	Standard	NM_007056		Approved	SWAP2, CLASP	uc002pak.3	Q8N2M8	OTTHUMG00000150189	ENST00000221455.3:c.1679C>T	19.37:g.45571284C>T	ENSP00000221455:p.Ala560Val	193	0		193	4	NM_007056	0	0	0	0	0	B4DDT8|F8WAG9|O96026|Q6UW71|Q96DX2	Missense_Mutation	SNP	ENST00000221455.3	37	CCDS12652.2	.	.	.	.	.	.	.	.	.	.	C	24.1	4.495983	0.85069	.	.	ENSG00000104859	ENST00000221455;ENST00000391952;ENST00000391953;ENST00000544944	T;T;T;T	0.34667	2.01;1.35;2.01;1.46	5.07	4.04	0.47022	.	0.000000	0.36002	U	0.002849	T	0.22166	0.0534	N	0.22421	0.69	0.43508	D	0.995761	P;P;P	0.41450	0.75;0.597;0.462	B;B;B	0.36335	0.222;0.133;0.063	T	0.03296	-1.1051	10	0.42905	T	0.14	-20.215	10.5428	0.45043	0.0:0.906:0.0:0.094	.	498;560;560	F8WAG9;F5H0Q6;Q8N2M8	.;.;CLASR_HUMAN	V	560;560;498;560	ENSP00000221455:A560V;ENSP00000375814:A560V;ENSP00000375815:A498V;ENSP00000438702:A560V	ENSP00000221455:A560V	A	+	2	0	CLASRP	50263124	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.030000	0.57260	2.370000	0.80446	0.313000	0.20887	GCC	.		0.632	CLASRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316749.1	NM_007056	
TRPM4	54795	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	49674876	49674876	+	Silent	SNP	C	C	T			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr19:49674876C>T	ENST00000252826.5	+	8	1026	c.900C>T	c.(898-900)ctC>ctT	p.L300L	TRPM4_ENST00000427978.2_Silent_p.L300L|TRPM4_ENST00000601347.1_3'UTR|TRPM4_ENST00000355712.5_Silent_p.L17L	NM_017636.3	NP_060106.2	Q8TD43	TRPM4_HUMAN	transient receptor potential cation channel, subfamily M, member 4	300					calcium ion transmembrane transport (GO:0070588)|cardiac conduction (GO:0061337)|dendritic cell chemotaxis (GO:0002407)|ion transmembrane transport (GO:0034220)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell proliferation (GO:0008284)|protein sumoylation (GO:0016925)|regulation of membrane potential (GO:0042391)|regulation of T cell cytokine production (GO:0002724)|transmembrane transport (GO:0055085)|vasoconstriction (GO:0042310)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)			breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(18)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	49		all_lung(116;8.54e-05)|Lung NSC(112;0.000139)|all_neural(266;0.0506)|Ovarian(192;0.15)		all cancers(93;2.88e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000222)|GBM - Glioblastoma multiforme(486;0.00339)|Epithelial(262;0.00751)		CATGTCTCCTCGTGGCTGGCT	0.592																																					p.L300L		.											.	TRPM4-91	0			c.C900T						.						37.0	42.0	41.0					19																	49674876		2202	4300	6502	SO:0001819	synonymous_variant	54795	exon8			TCTCCTCGTGGCT	AK000048	CCDS33073.1, CCDS56098.1	19q13.3	2011-12-14				ENSG00000130529		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17993	protein-coding gene	gene with protein product		606936				11535825, 16382100	Standard	NM_017636		Approved	FLJ20041	uc002pmw.3	Q8TD43		ENST00000252826.5:c.900C>T	19.37:g.49674876C>T		66	0		72	23	NM_001195227	0	0	19	40	21	A2RU25|Q7Z5D9|Q96L84|Q9NXV1	Silent	SNP	ENST00000252826.5	37	CCDS33073.1																																																																																			.		0.592	TRPM4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465543.2	NM_017636	
ZNF175	7728	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	52091298	52091298	+	Missense_Mutation	SNP	T	T	C			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr19:52091298T>C	ENST00000262259.2	+	5	2072	c.1714T>C	c.(1714-1716)Tct>Cct	p.S572P	ZNF175_ENST00000436511.2_Intron	NM_007147.2	NP_009078.1	Q9Y473	ZN175_HUMAN	zinc finger protein 175	572					defense response to virus (GO:0051607)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24		all_neural(266;0.0299)		GBM - Glioblastoma multiforme(134;0.000426)|OV - Ovarian serous cystadenocarcinoma(262;0.0257)		CACTTCTAAGTCTCAATTCAA	0.453																																					p.S572P		.											.	ZNF175-90	0			c.T1714C						.						87.0	85.0	86.0					19																	52091298		2203	4300	6503	SO:0001583	missense	7728	exon5			TCTAAGTCTCAAT	D50419	CCDS12837.1	19q13.4	2013-01-08			ENSG00000105497	ENSG00000105497		"""Zinc fingers, C2H2-type"", ""-"""	12964	protein-coding gene	gene with protein product		601139				8838321	Standard	NM_007147		Approved	OTK18	uc002pxb.3	Q9Y473	OTTHUMG00000167771	ENST00000262259.2:c.1714T>C	19.37:g.52091298T>C	ENSP00000262259:p.Ser572Pro	63	0		68	20	NM_007147	0	0	3	4	1	A8K9H2	Missense_Mutation	SNP	ENST00000262259.2	37	CCDS12837.1	.	.	.	.	.	.	.	.	.	.	T	13.83	2.354614	0.41700	.	.	ENSG00000105497	ENST00000262259	T	0.18657	2.2	2.18	1.09	0.20402	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.36963	0.0986	M	0.78344	2.41	0.09310	N	0.999999	D	0.65815	0.995	P	0.57911	0.829	T	0.13255	-1.0516	9	0.72032	D	0.01	.	6.4454	0.21873	0.0:0.0:0.2498:0.7502	.	572	Q9Y473	ZN175_HUMAN	P	572	ENSP00000262259:S572P	ENSP00000262259:S572P	S	+	1	0	ZNF175	56783110	0.000000	0.05858	0.703000	0.30354	0.992000	0.81027	-0.482000	0.06544	0.258000	0.21686	0.533000	0.62120	TCT	.		0.453	ZNF175-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396205.1	NM_007147	
MYT1L	23040	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	1805513	1805513	+	Silent	SNP	T	T	C			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr2:1805513T>C	ENST00000399161.2	-	23	3978	c.3231A>G	c.(3229-3231)gaA>gaG	p.E1077E	MYT1L_ENST00000428368.2_Silent_p.E1075E|MYT1L_ENST00000407844.1_Silent_p.E73E	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	1077					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		GGGAATTGGATTCATTTAGCT	0.333																																					p.E1075E		.											.	MYT1L-95	0			c.A3225G						.						232.0	228.0	229.0					2																	1805513		1805	4085	5890	SO:0001819	synonymous_variant	23040	exon23			ATTGGATTCATTT	AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.3231A>G	2.37:g.1805513T>C		69	0		76	22	NM_015025	0	0	0	0	0	A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Silent	SNP	ENST00000399161.2	37																																																																																				.		0.333	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000322493.1	NM_015025	
SMC6	79677	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	17896324	17896324	+	Missense_Mutation	SNP	T	T	A			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr2:17896324T>A	ENST00000448223.2	-	16	1803	c.1534A>T	c.(1534-1536)Att>Ttt	p.I512F	SMC6_ENST00000402989.1_Missense_Mutation_p.I512F|SMC6_ENST00000351948.4_Missense_Mutation_p.I512F|SMC6_ENST00000381272.4_Missense_Mutation_p.I538F	NM_001142286.1	NP_001135758.1	Q96SB8	SMC6_HUMAN	structural maintenance of chromosomes 6	512	Flexible hinge.				cellular senescence (GO:0090398)|double-strand break repair via homologous recombination (GO:0000724)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|intracellular (GO:0005622)|nucleolus (GO:0005730)|nucleus (GO:0005634)|PML body (GO:0016605)|Smc5-Smc6 complex (GO:0030915)	ATP binding (GO:0005524)			NS(1)|biliary_tract(1)|breast(6)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(3)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	43	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					CGAAGATGAATGCAAGCTCCT	0.368																																					p.I512F		.											.	SMC6-292	0			c.A1534T						.						71.0	74.0	73.0					2																	17896324		2203	4300	6503	SO:0001583	missense	79677	exon16			GATGAATGCAAGC	AJ310551	CCDS1690.1	2p24.3	2008-02-05	2006-07-06	2006-07-06	ENSG00000163029	ENSG00000163029		"""Structural maintenance of chromosomes proteins"""	20466	protein-coding gene	gene with protein product		609387	"""SMC6 structural maintenance of chromosomes 6-like 1 (yeast)"""	SMC6L1		11230166	Standard	NM_024624		Approved	FLJ22116	uc002rcn.3	Q96SB8	OTTHUMG00000090675	ENST00000448223.2:c.1534A>T	2.37:g.17896324T>A	ENSP00000404092:p.Ile512Phe	70	0		66	28	NM_001142286	0	0	0	0	0	A8K8Q6|D6W518|Q05BV4|Q9H0X3|Q9H6M0	Missense_Mutation	SNP	ENST00000448223.2	37	CCDS1690.1	.	.	.	.	.	.	.	.	.	.	T	22.9	4.349589	0.82132	.	.	ENSG00000163029	ENST00000448223;ENST00000351948;ENST00000381272;ENST00000402989;ENST00000446852	T;T;T;T;T	0.31247	2.1;2.1;1.62;2.1;1.5	6.16	6.16	0.99307	RecF/RecN/SMC (1);	0.000000	0.85682	D	0.000000	T	0.54967	0.1891	M	0.74647	2.275	0.80722	D	1	D;D;D	0.71674	0.997;0.998;0.997	D;D;D	0.74674	0.961;0.984;0.977	T	0.57860	-0.7738	10	0.62326	D	0.03	.	13.2153	0.59856	0.0:0.0:0.1324:0.8676	.	538;538;512	C9JMN1;Q96SB8-2;Q96SB8	.;.;SMC6_HUMAN	F	512;512;538;512;538	ENSP00000404092:I512F;ENSP00000323439:I512F;ENSP00000370672:I538F;ENSP00000384539:I512F;ENSP00000408644:I538F	ENSP00000323439:I512F	I	-	1	0	SMC6	17759805	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.172000	0.65003	2.367000	0.80283	0.528000	0.53228	ATT	.		0.368	SMC6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207359.1	NM_024624	
RHOB	388	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	20647312	20647312	+	Missense_Mutation	SNP	A	A	G			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr2:20647312A>G	ENST00000272233.4	+	1	478	c.86A>G	c.(85-87)gAg>gGg	p.E29G		NM_004040.2	NP_004031.1	P62745	RHOB_HUMAN	ras homolog family member B	29					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to ionizing radiation (GO:0071479)|cytokinesis (GO:0000910)|endosome to lysosome transport (GO:0008333)|GTP catabolic process (GO:0006184)|negative regulation of cell cycle (GO:0045786)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic process (GO:0043065)|protein transport (GO:0015031)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)|transformed cell apoptotic process (GO:0006927)	cleavage furrow (GO:0032154)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|kidney(1)|lung(2)|ovary(1)|urinary_tract(2)	7	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)	all_epithelial(98;4.19e-09)|Lung NSC(108;0.00452)|Ovarian(717;0.0164)		OV - Ovarian serous cystadenocarcinoma(76;1.14e-22)|Epithelial(75;7.84e-19)	Botulinum Toxin Type A(DB00083)	AGTAAGGACGAGTTCCCCGAG	0.662																																					p.E29G		.											.	RHOB-848	0			c.A86G						.						121.0	120.0	120.0					2																	20647312		2203	4300	6503	SO:0001583	missense	388	exon1			AGGACGAGTTCCC		CCDS1699.1	2p24	2012-02-27	2012-02-27	2004-03-24	ENSG00000143878	ENSG00000143878			668	protein-coding gene	gene with protein product	"""oncogene RHO H6"""	165370	"""ras homolog gene family, member B"""	ARH6, ARHB		3283705, 16278215	Standard	NM_004040		Approved	RhoB, RHOH6, MST081	uc002rdv.3	P62745	OTTHUMG00000090755	ENST00000272233.4:c.86A>G	2.37:g.20647312A>G	ENSP00000272233:p.Glu29Gly	66	0		85	26	NM_004040	0	0	92	135	43	B2R692|P01121|Q5U0H6|Q7RTN5|Q7RTR9|Q9CUV7	Missense_Mutation	SNP	ENST00000272233.4	37	CCDS1699.1	.	.	.	.	.	.	.	.	.	.	A	13.04	2.117942	0.37339	.	.	ENSG00000143878	ENST00000272233	T	0.78246	-1.16	5.74	4.56	0.56223	Small GTP-binding protein domain (1);	0.000000	0.85682	U	0.000000	T	0.76471	0.3992	L	0.58810	1.83	0.53688	D	0.999978	B	0.29716	0.255	B	0.35727	0.209	T	0.74559	-0.3625	10	0.56958	D	0.05	-19.0458	12.9321	0.58292	0.8645:0.1355:0.0:0.0	.	29	P62745	RHOB_HUMAN	G	29	ENSP00000272233:E29G	ENSP00000272233:E29G	E	+	2	0	RHOB	20510793	1.000000	0.71417	1.000000	0.80357	0.018000	0.09664	9.156000	0.94705	0.963000	0.38082	0.533000	0.62120	GAG	.		0.662	RHOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207500.1	NM_004040	
SLC5A6	8884	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	27427730	27427730	+	Silent	SNP	G	G	C	rs376306193		TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr2:27427730G>C	ENST00000310574.3	-	8	1277	c.804C>G	c.(802-804)ctC>ctG	p.L268L	SLC5A6_ENST00000461319.1_5'Flank|SLC5A6_ENST00000408041.1_Silent_p.L268L	NM_021095.2	NP_066918.2	Q9Y289	SC5A6_HUMAN	solute carrier family 5 (sodium/multivitamin and iodide cotransporter), member 6	268					biotin metabolic process (GO:0006768)|biotin transport (GO:0015878)|pantothenate metabolic process (GO:0015939)|pantothenate transmembrane transport (GO:0015887)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	sodium-dependent multivitamin transmembrane transporter activity (GO:0008523)			endometrium(2)|kidney(2)|large_intestine(3)|lung(8)|ovary(3)|prostate(1)|skin(1)	20	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Biotin(DB00121)|gabapentin enacarbil(DB08872)|Lipoic Acid(DB00166)	CGTATAAGGAGAGCATCATGA	0.587																																					p.L268L		.											.	SLC5A6-92	0			c.C804G						.	G		0,4406		0,0,2203	103.0	95.0	98.0		804	-2.5	1.0	2		98	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	SLC5A6	NM_021095.2		0,1,6502	CC,CG,GG		0.0116,0.0,0.0077		268/636	27427730	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	8884	exon8			TAAGGAGAGCATC	AF069307	CCDS1740.1	2p23	2013-07-19	2013-07-19		ENSG00000138074	ENSG00000138074		"""Solute carriers"""	11041	protein-coding gene	gene with protein product		604024	"""solute carrier family 5 (sodium-dependent vitamin transporter), member 6"""			9516450, 10329687	Standard	NM_021095		Approved	SMVT	uc002rjd.3	Q9Y289	OTTHUMG00000097075	ENST00000310574.3:c.804C>G	2.37:g.27427730G>C		24	0		30	10	NM_021095	0	0	19	25	6	B2RB85|D6W549|Q969Y5	Silent	SNP	ENST00000310574.3	37	CCDS1740.1																																																																																			.		0.587	SLC5A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214194.1	NM_021095	
INO80B	83444	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	74684908	74684908	+	Missense_Mutation	SNP	T	T	A			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr2:74684908T>A	ENST00000233331.7	+	5	1082	c.988T>A	c.(988-990)Tgt>Agt	p.C330S	WBP1_ENST00000233615.2_5'Flank|WBP1_ENST00000409737.1_5'Flank|WBP1_ENST00000393972.3_5'Flank	NM_031288.3	NP_112578.2	Q9C086	IN80B_HUMAN	INO80 complex subunit B	330					chromatin remodeling (GO:0006338)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Ino80 complex (GO:0031011)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			endometrium(1)|large_intestine(2)|lung(5)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	13						CCAGGCACTCTGTAGTCTTCA	0.682																																					p.C330S		.											.	INO80B-226	0			c.T988A						.						18.0	20.0	19.0					2																	74684908		2117	4148	6265	SO:0001583	missense	83444	exon5			GCACTCTGTAGTC	AB054538	CCDS1942.2	2p13.1	2011-07-06	2008-08-07	2008-08-07	ENSG00000115274	ENSG00000115274		"""Zinc fingers, HIT-type"", ""INO80 complex subunits"""	13324	protein-coding gene	gene with protein product	"""PAP-1 binding protein"", ""IES2 homolog (S. cerevisiae)"""		"""high mobility group AT-hook 1-like 4"", ""zinc finger, HIT type 4"""	HMGA1L4, ZNHIT4		16230350	Standard	NM_031288		Approved	HMGIYL4, PAPA-1, hIes2, PAP-1BP, IES2	uc002slg.3	Q9C086	OTTHUMG00000129959	ENST00000233331.7:c.988T>A	2.37:g.74684908T>A	ENSP00000233331:p.Cys330Ser	21	0		25	8	NM_031288	0	0	6	10	4		Missense_Mutation	SNP	ENST00000233331.7	37	CCDS1942.2	.	.	.	.	.	.	.	.	.	.	T	27.9	4.869691	0.91587	.	.	ENSG00000115274	ENST00000233331	D	0.99042	-5.36	5.27	5.27	0.74061	Zinc finger, HIT-type (1);	0.000000	0.85682	D	0.000000	D	0.98927	0.9636	L	0.58354	1.805	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.87578	0.998;0.995;0.995	D	0.99671	1.0996	10	0.87932	D	0	-20.6182	13.1927	0.59719	0.0:0.0:0.0:1.0	.	348;315;330	B4DJ31;B4DJ22;Q9C086	.;.;IN80B_HUMAN	S	330	ENSP00000233331:C330S	ENSP00000233331:C330S	C	+	1	0	INO80B	74538416	1.000000	0.71417	0.996000	0.52242	0.864000	0.49448	5.346000	0.65992	2.211000	0.71520	0.459000	0.35465	TGT	.		0.682	INO80B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252223.2	NM_031288	
RPIA	22934	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	89037541	89037541	+	Missense_Mutation	SNP	T	T	G			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr2:89037541T>G	ENST00000283646.4	+	8	841	c.786T>G	c.(784-786)ttT>ttG	p.F262L		NM_144563.2	NP_653164.2	P49247	RPIA_HUMAN	ribose 5-phosphate isomerase A	262					carbohydrate metabolic process (GO:0005975)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, non-oxidative branch (GO:0009052)|ribose phosphate metabolic process (GO:0019693)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)	monosaccharide binding (GO:0048029)|ribose-5-phosphate isomerase activity (GO:0004751)			breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)|skin(1)	18		Acute lymphoblastic leukemia(2;0.000456)|all_hematologic(2;0.00287)				ACTGGAAGTTTGACCGGGTAC	0.438																																					p.F262L		.											.	RPIA-91	0			c.T786G						.						154.0	143.0	146.0					2																	89037541		1889	4125	6014	SO:0001583	missense	22934	exon8			GAAGTTTGACCGG	L35035	CCDS2004.2	2p11.2	2008-07-31	2008-07-31		ENSG00000153574	ENSG00000153574	5.3.1.6		10297	protein-coding gene	gene with protein product	"""ribose 5-phosphate epimerase"""	180430				7758956	Standard	NM_144563		Approved		uc002ste.3	P49247	OTTHUMG00000130333	ENST00000283646.4:c.786T>G	2.37:g.89037541T>G	ENSP00000283646:p.Phe262Leu	92	0		114	9	NM_144563	0	0	19	21	2	Q541P9|Q96BJ6	Missense_Mutation	SNP	ENST00000283646.4	37	CCDS2004.2	.	.	.	.	.	.	.	.	.	.	T	23.9	4.473758	0.84640	.	.	ENSG00000153574	ENST00000283646;ENST00000543560	T	0.76186	-1.0	5.55	1.74	0.24563	.	0.000000	0.85682	D	0.000000	T	0.82144	0.4973	M	0.70842	2.15	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.78321	-0.2249	10	0.42905	T	0.14	-10.0604	9.4754	0.38869	0.0:0.2052:0.0:0.7948	.	262	P49247	RPIA_HUMAN	L	262;128	ENSP00000283646:F262L	ENSP00000283646:F262L	F	+	3	2	RPIA	88818656	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.082000	0.30803	0.056000	0.16144	0.383000	0.25322	TTT	.		0.438	RPIA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252683.2		
FER1L5	90342	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	97368368	97368368	+	RNA	SNP	A	A	C			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr2:97368368A>C	ENST00000457909.1	+	0	4790							A0AVI2	FR1L5_HUMAN	fer-1-like family member 5							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(9)|large_intestine(9)|lung(6)|ovary(2)|prostate(2)|skin(1)|urinary_tract(2)	38						GGACATGCAGAAGACAGACAT	0.602																																					p.K1799Q		.											.	FER1L5-23	0			c.A5395C						.						39.0	45.0	43.0					2																	97368368		2131	4257	6388			90342	exon47			ATGCAGAAGACAG	BC126368		2q11.2	2014-06-27	2014-06-27		ENSG00000249715	ENSG00000249715			19044	protein-coding gene	gene with protein product			"""fer-1-like 5 (C. elegans)"""				Standard	XM_006712826		Approved	DKFZp434I0121	uc010fia.3	A0AVI2	OTTHUMG00000154929		2.37:g.97368368A>C		56	0		64	24	NM_001113382	0	0	0	0	0	Q17RH2|Q6ZU24	Missense_Mutation	SNP	ENST00000457909.1	37		.	.	.	.	.	.	.	.	.	.	A	12.29	1.894586	0.33442	.	.	ENSG00000214272	ENST00000414152;ENST00000436930;ENST00000397978	.	.	.	5.29	4.14	0.48551	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	0.139522	0.32068	U	0.006626	T	0.71256	0.3318	M	0.72576	2.205	.	.	.	D;D;D	0.71674	0.981;0.998;0.989	P;D;P	0.69479	0.77;0.964;0.885	T	0.79436	-0.1804	8	0.87932	D	0	-9.4277	10.0645	0.42295	0.9196:0.0:0.0804:0.0	.	507;1799;508	B7ZLI3;A0AVI2;A0AVI2-2	.;FR1L5_HUMAN;.	Q	1799;1803;508	.	ENSP00000442027:K508Q	K	+	1	0	FER1L5	96732095	0.999000	0.42202	1.000000	0.80357	0.680000	0.39746	2.466000	0.45084	0.865000	0.35603	0.459000	0.35465	AAG	.		0.602	FER1L5-001	KNOWN	basic|exp_conf	retained_intron	pseudogene	OTTHUMT00000339030.1	NM_001077400	
LONRF2	164832	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	100903452	100903452	+	Missense_Mutation	SNP	G	G	A	rs182810197		TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr2:100903452G>A	ENST00000393437.3	-	11	2633	c.1994C>T	c.(1993-1995)gCg>gTg	p.A665V	LONRF2_ENST00000409647.1_Missense_Mutation_p.A422V	NM_198461.3	NP_940863.3	Q1L5Z9	LONF2_HUMAN	LON peptidase N-terminal domain and ring finger 2	665	Lon.						ATP-dependent peptidase activity (GO:0004176)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	34						CTGGAGAGACGCGAACCAGGA	0.488													G|||	1	0.000199681	0.0	0.0014	5008	,	,		21822	0.0		0.0	False		,,,				2504	0.0				p.A665V		.											.	LONRF2-154	0			c.C1994T						.						124.0	103.0	110.0					2																	100903452		2203	4300	6503	SO:0001583	missense	164832	exon11			AGAGACGCGAACC	AK127206	CCDS2046.2	2q11.2	2013-01-09			ENSG00000170500	ENSG00000170500		"""RING-type (C3HC4) zinc fingers"""	24788	protein-coding gene	gene with protein product							Standard	NM_198461		Approved	FLJ45273, RNF192	uc002tal.4	Q1L5Z9	OTTHUMG00000130668	ENST00000393437.3:c.1994C>T	2.37:g.100903452G>A	ENSP00000377086:p.Ala665Val	113	0		112	8	NM_198461	0	0	0	0	0	B9A006|Q6ZSR4	Missense_Mutation	SNP	ENST00000393437.3	37	CCDS2046.2	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	10.42	1.345572	0.24426	.	.	ENSG00000170500	ENST00000393437;ENST00000409647	T;T	0.43688	0.94;0.94	4.95	3.1	0.35709	Peptidase S16, lon N-terminal (1);PUA-like domain (1);	0.358147	0.30901	N	0.008647	T	0.17023	0.0409	N	0.02011	-0.69	0.18873	N	0.999981	B	0.21071	0.051	B	0.18561	0.022	T	0.18366	-1.0339	10	0.30078	T	0.28	-0.2116	10.2149	0.43162	0.0749:0.1365:0.7885:0.0	.	665	Q1L5Z9	LONF2_HUMAN	V	665;422	ENSP00000377086:A665V;ENSP00000386823:A422V	ENSP00000377086:A665V	A	-	2	0	LONRF2	100269884	1.000000	0.71417	0.001000	0.08648	0.826000	0.46750	5.277000	0.65586	0.462000	0.27095	0.655000	0.94253	GCG	G|0.999;A|0.000		0.488	LONRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253161.2	NM_198461	
AMER3	205147	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	131520234	131520234	+	Nonsense_Mutation	SNP	C	C	T			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr2:131520234C>T	ENST00000423981.1	+	2	699	c.589C>T	c.(589-591)Cga>Tga	p.R197*	AMER3_ENST00000321420.4_Nonsense_Mutation_p.R197*	NM_001105193.1|NM_001105194.1|NM_001105195.1|NM_152698.2	NP_001098663.1|NP_001098664.1|NP_001098665.1|NP_689911.2	Q8N944	AMER3_HUMAN	APC membrane recruitment protein 3	197					Wnt signaling pathway (GO:0016055)	plasma membrane (GO:0005886)	lipid binding (GO:0008289)	p.R197*(1)									TGGGGGGCGGCGAAGCAAAGC	0.667																																					p.R197X													.	.	1	Substitution - Nonsense(1)	prostate(1)	c.C589T						.						25.0	31.0	29.0					2																	131520234		2198	4286	6484	SO:0001587	stop_gained	205147	exon2			GGGCGGCGAAGCA	AK095696	CCDS2164.1	2q21.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000178171	ENSG00000178171		"""-"""	26771	protein-coding gene	gene with protein product			"""family with sequence similarity 123C"""	FAM123C		20843316	Standard	NM_001105195		Approved	FLJ38377	uc002trw.2	Q8N944	OTTHUMG00000131637	ENST00000423981.1:c.589C>T	2.37:g.131520234C>T	ENSP00000392700:p.Arg197*	33	0		34	4	NM_152698	0	0	0	0	0	B7ZLH6	Nonsense_Mutation	SNP	ENST00000423981.1	37	CCDS2164.1	.	.	.	.	.	.	.	.	.	.	C	16.15	3.042473	0.55003	.	.	ENSG00000178171	ENST00000321420;ENST00000423981	.	.	.	5.1	3.13	0.36017	.	1.133320	0.06645	N	0.761843	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.09590	T	0.72	.	7.8953	0.29702	0.1839:0.6383:0.1778:0.0	.	.	.	.	X	197	.	ENSP00000314914:R197X	R	+	1	2	FAM123C	131236704	0.000000	0.05858	0.002000	0.10522	0.007000	0.05969	0.129000	0.15830	1.247000	0.43917	0.561000	0.74099	CGA	.		0.667	AMER3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254531.3	NM_152698	
XIRP2	129446	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	168108259	168108259	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr2:168108259C>T	ENST00000409195.1	+	9	10446	c.10357C>T	c.(10357-10359)Cat>Tat	p.H3453Y	XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000295237.9_Missense_Mutation_p.H3453Y|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409273.1_Missense_Mutation_p.H3231Y	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	3278					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						TGACTTCAAGCATGCCCCACC	0.408																																					p.H3453Y		.											.	XIRP2-104	0			c.C10357T						.						61.0	61.0	61.0					2																	168108259		1916	4139	6055	SO:0001583	missense	129446	exon9			TTCAAGCATGCCC	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.10357C>T	2.37:g.168108259C>T	ENSP00000386840:p.His3453Tyr	158	0		148	59	NM_152381	0	0	0	0	0	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409195.1	37	CCDS42769.1	.	.	.	.	.	.	.	.	.	.	C	17.42	3.385682	0.61956	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273;ENST00000413534	T;T;T	0.02916	4.12;4.12;4.11	6.16	5.29	0.74685	.	0.224814	0.46145	N	0.000309	T	0.14141	0.0342	M	0.71581	2.175	0.49483	D	0.99979	D;D;B	0.76494	0.999;0.999;0.368	D;D;B	0.80764	0.986;0.994;0.15	T	0.00213	-1.1913	10	0.87932	D	0	-12.9779	14.5412	0.67997	0.0:0.9292:0.0:0.0708	.	3278;3278;3231	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	Y	3453;3453;3231;867	ENSP00000386840:H3453Y;ENSP00000295237:H3453Y;ENSP00000387255:H3231Y	ENSP00000295237:H3453Y	H	+	1	0	XIRP2	167816505	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.228000	0.51270	1.628000	0.50416	-0.145000	0.13849	CAT	.		0.408	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381	
TTN	7273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	179577514	179577514	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr2:179577514C>T	ENST00000591111.1	-	92	26511	c.26287G>A	c.(26287-26289)Gat>Aat	p.D8763N	TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.D9080N|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000431752.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.D7836N|TTN_ENST00000342175.6_Intron|TTN_ENST00000460472.2_Intron			Q8WZ42	TITIN_HUMAN	titin	12916	Ig-like 70.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTATCTACATCGAACAACTCC	0.418																																					p.D9080N		.											.	TTN-636	0			c.G27238A						.						88.0	84.0	85.0					2																	179577514		1928	4120	6048	SO:0001583	missense	7273	exon94			CTACATCGAACAA	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.26287G>A	2.37:g.179577514C>T	ENSP00000465570:p.Asp8763Asn	56	0		74	20	NM_001267550	0	0	0	0	0	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	C	13.16	2.153386	0.38021	.	.	ENSG00000155657	ENST00000342992	T	0.38560	1.13	5.48	5.48	0.80851	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.23094	0.0558	N	0.03304	-0.355	0.80722	D	1	B	0.02656	0.0	B	0.06405	0.002	T	0.08146	-1.0736	9	0.87932	D	0	.	12.9963	0.58648	0.0:0.9258:0.0:0.0742	.	8763	Q8WZ42	TITIN_HUMAN	N	7836	ENSP00000343764:D7836N	ENSP00000343764:D7836N	D	-	1	0	TTN	179285759	0.999000	0.42202	1.000000	0.80357	0.992000	0.81027	1.843000	0.39259	2.722000	0.93159	0.655000	0.94253	GAT	.		0.418	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
FASTKD2	22868	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	207655323	207655323	+	Silent	SNP	T	T	C			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr2:207655323T>C	ENST00000236980.6	+	11	2274	c.1926T>C	c.(1924-1926)tcT>tcC	p.S642S	FASTKD2_ENST00000402774.3_Silent_p.S642S|FASTKD2_ENST00000403094.3_Silent_p.S642S	NM_014929.3	NP_055744.2	Q9NYY8	FAKD2_HUMAN	FAST kinase domains 2	642	RAP. {ECO:0000255|PROSITE- ProRule:PRU00619}.				cellular respiration (GO:0045333)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)			breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(2)	21				LUSC - Lung squamous cell carcinoma(261;0.0718)|Epithelial(149;0.119)|Lung(261;0.138)		TTTCCAGATCTGCTTATTGTT	0.363																																					p.S642S		.											.	FASTKD2-118	0			c.T1926C						.						159.0	159.0	159.0					2																	207655323		2203	4300	6503	SO:0001819	synonymous_variant	22868	exon11			CAGATCTGCTTAT	BC001544	CCDS2371.1	2q33.3	2008-02-05	2006-07-07	2006-07-07	ENSG00000118246	ENSG00000118246			29160	protein-coding gene	gene with protein product		612322	"""KIAA0971"""	KIAA0971			Standard	NM_014929		Approved		uc002vbx.3	Q9NYY8	OTTHUMG00000132917	ENST00000236980.6:c.1926T>C	2.37:g.207655323T>C		64	0		43	14	NM_001136193	0	0	38	76	38	Q9NVX6|Q9Y2H7	Silent	SNP	ENST00000236980.6	37	CCDS2371.1																																																																																			.		0.363	FASTKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256428.2	NM_014929	
LRRFIP1	9208	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	2	238666100	238666100	+	Intron	SNP	A	A	T			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr2:238666100A>T	ENST00000392000.4	+	9	864				LRRFIP1_ENST00000308482.9_Splice_Site_p.E378V|LRRFIP1_ENST00000289175.6_Intron|LRRFIP1_ENST00000244815.5_Intron	NM_001137552.1	NP_001131024.1	Q32MZ4	LRRF1_HUMAN	leucine rich repeat (in FLII) interacting protein 1						innate immune response (GO:0045087)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|protein homodimerization activity (GO:0042803)			NS(1)|breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	29		Breast(86;0.00257)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;9.75e-23)|OV - Ovarian serous cystadenocarcinoma(60;1.01e-10)|Kidney(56;4.85e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.31e-07)|BRCA - Breast invasive adenocarcinoma(100;0.000151)|Lung(119;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0325)|COAD - Colon adenocarcinoma(134;0.228)		TTTCCTCAGGAAATCCGACAG	0.473																																					p.E378V		.											.	LRRFIP1-153	0			c.A1133T						.						32.0	29.0	30.0					2																	238666100		1567	3579	5146	SO:0001627	intron_variant	9208	exon17			CTCAGGAAATCCG	AJ223075	CCDS2521.1, CCDS46551.1, CCDS46552.1, CCDS46553.1	2q37.3	2010-09-30			ENSG00000124831	ENSG00000124831			6702	protein-coding gene	gene with protein product	"""GC-binding factor 2"""	603256				9705290, 9525888, 16199883	Standard	NM_004735		Approved	FLAP-1, FLIIAP1, TRIP, GCF-2, HUFI-1	uc002vxe.3	Q32MZ4	OTTHUMG00000133339	ENST00000392000.4:c.747+1270A>T	2.37:g.238666100A>T		270	0		221	66	NM_001137550	0	0	0	0	0	E9PGZ2|O75766|O75799|Q32MZ5|Q53T49|Q6PKG2|Q9Y607	Missense_Mutation	SNP	ENST00000392000.4	37	CCDS46552.1	.	.	.	.	.	.	.	.	.	.	A	18.72	3.683862	0.68157	.	.	ENSG00000124831	ENST00000308482;ENST00000391999	T	0.53640	0.61	5.51	5.51	0.81932	.	.	.	.	.	T	0.51109	0.1655	M	0.75085	2.285	0.80722	D	1	B	0.32604	0.377	B	0.32465	0.146	T	0.57207	-0.7851	9	0.87932	D	0	.	14.8382	0.70201	1.0:0.0:0.0:0.0	.	378	E9PGZ2	.	V	378;368	ENSP00000310109:E378V	ENSP00000310109:E378V	E	+	2	0	LRRFIP1	238330839	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.546000	0.90661	2.097000	0.63578	0.533000	0.62120	GAA	.		0.473	LRRFIP1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000317198.1	NM_004735	
BRWD1	54014	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	40665927	40665927	+	Nonsense_Mutation	SNP	G	G	T			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr21:40665927G>T	ENST00000333229.2	-	8	968	c.641C>A	c.(640-642)tCa>tAa	p.S214*	BRWD1_ENST00000342449.3_Nonsense_Mutation_p.S214*|BRWD1_ENST00000380800.3_Nonsense_Mutation_p.S214*	NM_018963.4	NP_061836.2	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1	214					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(2)|endometrium(6)|kidney(8)|large_intestine(14)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(7)|urinary_tract(2)	58		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				ATTATGTGTTGACCAAATCTT	0.328																																					p.S214X	Melanoma(170;988 1986 4794 16843 39731)	.											.	BRWD1-94	0			c.C641A						.						82.0	77.0	79.0					21																	40665927		2203	4300	6503	SO:0001587	stop_gained	54014	exon8			TGTGTTGACCAAA	AJ002572	CCDS13662.1, CCDS13663.1, CCDS33557.1	21q22.2	2013-05-21	2005-05-13	2005-05-13	ENSG00000185658	ENSG00000185658		"""WD repeat domain containing"""	12760	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 107"", ""WD repeat domain 9"""	C21orf107, WDR9			Standard	NM_033656		Approved	FLJ11315, N143	uc002yxk.2	Q9NSI6	OTTHUMG00000066030	ENST00000333229.2:c.641C>A	21.37:g.40665927G>T	ENSP00000330753:p.Ser214*	104	0		90	32	NM_018963	0	0	0	0	0	C9JK25|O43721|Q5R2V0|Q5R2V1|Q6P2D1|Q8TCV3|Q96QG9|Q96QH0|Q9NUK1	Nonsense_Mutation	SNP	ENST00000333229.2	37	CCDS13662.1	.	.	.	.	.	.	.	.	.	.	G	37	6.060061	0.97246	.	.	ENSG00000185658	ENST00000333229;ENST00000342449;ENST00000380800	.	.	.	5.12	4.18	0.49190	.	0.110931	0.39985	N	0.001212	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.83	15.0594	0.71939	0.0:0.1423:0.8577:0.0	.	.	.	.	X	214	.	ENSP00000330753:S214X	S	-	2	0	BRWD1	39587797	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.477000	0.73591	2.388000	0.81334	0.655000	0.94253	TCA	.		0.328	BRWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141398.3	NM_033656	
COL18A1	80781	hgsc.bcm.edu	37	21	46924434	46924434	+	Silent	SNP	A	A	C	rs28696990|rs149296338|rs201180574|rs78227997	byFrequency	TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr21:46924434A>C	ENST00000359759.4	+	33	4098	c.4077A>C	c.(4075-4077)ccA>ccC	p.P1359P	COL18A1_ENST00000400337.2_Silent_p.P944P|COL18A1_ENST00000355480.5_Silent_p.P1124P|SLC19A1_ENST00000567670.1_Intron			P39060	COIA1_HUMAN	collagen, type XVIII, alpha 1	1359	Triple-helical region 9 (COL9).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endothelial cell morphogenesis (GO:0001886)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|response to drug (GO:0042493)|response to hydrostatic pressure (GO:0051599)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		ccggccccccaggccccccag	0.706																																					.		.											.	COL18A1-90	0			c.2825-2A>C						.						1.0	2.0	2.0					21																	46924434		1040	2663	3703	SO:0001819	synonymous_variant	80781	exon35			CCCCCCAGGCCCC		CCDS42971.1, CCDS42972.1	21q22.3	2013-01-16			ENSG00000182871	ENSG00000182871		"""Collagens"""	2195	protein-coding gene	gene with protein product	"""endostatin"""	120328	"""Knobloch syndrome, type 1"""	KNO		8188291, 8776601, 10942434, 17546652	Standard	NM_130445		Approved	KS, KNO1	uc002zhi.3	P39060	OTTHUMG00000090407	ENST00000359759.4:c.4077A>C	21.37:g.46924434A>C		7	0		29	12	NM_130445	0	0	0	0	0	A8MVI4|Q58EX6|Q6RZ39|Q6RZ40|Q6RZ41|Q8N4S4|Q8WXI5|Q96T70|Q9UK38|Q9Y6Q7|Q9Y6Q8	Splice_Site	SNP	ENST00000359759.4	37																																																																																				.		0.706	COL18A1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000206827.1		
SSTR3	6753	broad.mit.edu	37	22	37602594	37602594	+	Missense_Mutation	SNP	A	A	G			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr22:37602594A>G	ENST00000328544.3	-	2	1782	c.1249T>C	c.(1249-1251)Tac>Cac	p.Y417H	SSTR3_ENST00000402501.1_Missense_Mutation_p.Y417H	NM_001051.3	NP_001042.1	P32745	SSR3_HUMAN	somatostatin receptor 3	417					cell-cell signaling (GO:0007267)|cellular response to estradiol stimulus (GO:0071392)|cellular response to glucocorticoid stimulus (GO:0071385)|cerebellum development (GO:0021549)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|hormone-mediated apoptotic signaling pathway (GO:0008628)|negative regulation of cell proliferation (GO:0008285)|response to starvation (GO:0042594)|somatostatin signaling pathway (GO:0038170)|spermatogenesis (GO:0007283)	ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)			NS(1)|breast(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)	14					Pasireotide(DB06663)	CCCTACAGGTAGCTGATGCGC	0.652																																					p.Y417H													.	SSTR3-522	0			c.T1249C						.						46.0	50.0	49.0					22																	37602594		2202	4299	6501	SO:0001583	missense	6753	exon2			ACAGGTAGCTGAT		CCDS13944.1	22q13.1	2012-08-08			ENSG00000183473	ENSG00000278195		"""GPCR / Class A : Somatostatin receptors"""	11332	protein-coding gene	gene with protein product		182453				8449518	Standard	XM_006724311		Approved		uc003arb.3	P32745	OTTHUMG00000150537	ENST00000328544.3:c.1249T>C	22.37:g.37602594A>G	ENSP00000330138:p.Tyr417His	20	0		16	3	NM_001051	0	0	0	0	0	A8K550|Q53ZR7	Missense_Mutation	SNP	ENST00000328544.3	37	CCDS13944.1	.	.	.	.	.	.	.	.	.	.	A	11.90	1.775902	0.31411	.	.	ENSG00000183473	ENST00000328544;ENST00000402501	T;T	0.72505	-0.66;-0.66	5.36	3.24	0.37175	.	2.384000	0.01954	U	0.042879	T	0.64080	0.2566	L	0.29908	0.895	0.25200	N	0.990069	B	0.09022	0.002	B	0.08055	0.003	T	0.52019	-0.8631	10	0.87932	D	0	.	9.3495	0.38129	0.8722:0.0:0.1278:0.0	.	417	P32745	SSR3_HUMAN	H	417	ENSP00000330138:Y417H;ENSP00000384904:Y417H	ENSP00000330138:Y417H	Y	-	1	0	SSTR3	35932540	0.997000	0.39634	0.983000	0.44433	0.131000	0.20780	2.509000	0.45459	0.373000	0.24621	0.402000	0.26972	TAC	.		0.652	SSTR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318802.1		
ZKSCAN7	55888	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	44612087	44612087	+	Silent	SNP	T	T	C			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr3:44612087T>C	ENST00000273320.3	+	6	1914	c.1485T>C	c.(1483-1485)taT>taC	p.Y495Y	ZKSCAN7_ENST00000431636.1_Intron|RP11-944L7.4_ENST00000457331.1_RNA|ZKSCAN7_ENST00000426540.1_Silent_p.Y495Y|ZKSCAN7_ENST00000341840.3_Intron|RP11-944L7.5_ENST00000419137.1_Intron	NM_018651.2	NP_061121.2	Q9P0L1	ZKSC7_HUMAN	zinc finger with KRAB and SCAN domains 7	495					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)										AGAAACCTTATGAATGCAATG	0.448																																					p.Y495Y		.											.	.	0			c.T1485C						.						116.0	118.0	117.0					3																	44612087		2203	4300	6503	SO:0001819	synonymous_variant	55888	exon6			ACCTTATGAATGC	L32164, AY280798	CCDS2714.1, CCDS2715.1, CCDS74924.1	3p21.32	2013-01-09	2013-01-09	2013-01-09	ENSG00000196345	ENSG00000196345		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12955	protein-coding gene	gene with protein product			"""zinc finger protein 64"", ""zinc finger protein 448"", ""zinc finger protein 167"""	ZNF64, ZNF448, ZNF167		7814019, 1505991	Standard	XM_005265323		Approved	FLJ12738, ZSCAN39	uc003cnj.3	Q9P0L1	OTTHUMG00000133094	ENST00000273320.3:c.1485T>C	3.37:g.44612087T>C		88	0		91	9	NM_018651	0	0	3	3	0	A0PJV3|A8K5H0|Q6WL09|Q96FQ2	Silent	SNP	ENST00000273320.3	37	CCDS2715.1																																																																																			.		0.448	ZKSCAN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256752.4	NM_018651	
VPRBP	9730	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	51452313	51452313	+	Splice_Site	SNP	T	T	G			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr3:51452313T>G	ENST00000335891.5	-	11	2266		c.e11-2					Q9Y4B6	VPRBP_HUMAN	Vpr (HIV-1) binding protein						B cell differentiation (GO:0030183)|cell competition in a multicellular organism (GO:0035212)|histone H2A-T120 phosphorylation (GO:1990245)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein ubiquitination (GO:0016567)|transcription, DNA-templated (GO:0006351)|V(D)J recombination (GO:0033151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|histone kinase activity (H2A-T120 specific) (GO:1990244)			breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	41				BRCA - Breast invasive adenocarcinoma(193;0.000272)|Kidney(197;0.000729)|KIRC - Kidney renal clear cell carcinoma(197;0.000875)		ATCATAAATCTTTAGAGAAGA	0.373																																					.		.											.	VPRBP-92	0			c.3442-2A>C						.						58.0	51.0	53.0					3																	51452313		1852	4108	5960	SO:0001630	splice_region_variant	9730	exon18			TAAATCTTTAGAG	AB018343	CCDS74943.1, CCDS74944.1	3p21.2	2011-06-17			ENSG00000145041	ENSG00000145041		"""DDB1 and CUL4 associated factors"""	30911	protein-coding gene	gene with protein product	"""DDB1 and CUL4 associated factor 1"""					8195203, 11223251	Standard	NM_014703		Approved	KIAA0800, MGC102804, DCAF1	uc003dbe.2	Q9Y4B6	OTTHUMG00000156895	ENST00000335891.5:c.2257-2A>C	3.37:g.51452313T>G		82	0		70	6	NM_001171904	0	0	0	0	0	Q2YD74|Q8TBD9|Q9HCA1|Q9UG37	Splice_Site	SNP	ENST00000335891.5	37		.	.	.	.	.	.	.	.	.	.	T	25.0	4.587425	0.86851	.	.	ENSG00000145041	ENST00000423656;ENST00000335891	.	.	.	5.88	5.88	0.94601	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.2997	0.82804	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	VPRBP	51427353	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.422000	0.80217	2.250000	0.74265	0.528000	0.53228	.	.		0.373	VPRBP-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_014703	Intron
FLNB	2317	broad.mit.edu	37	3	58121740	58121740	+	Missense_Mutation	SNP	A	A	G			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr3:58121740A>G	ENST00000295956.4	+	28	4871	c.4706A>G	c.(4705-4707)cAt>cGt	p.H1569R	FLNB_ENST00000358537.3_Missense_Mutation_p.H1569R|FLNB_ENST00000357272.4_Missense_Mutation_p.H1569R|FLNB_ENST00000348383.5_Missense_Mutation_p.H1569R|FLNB_ENST00000490882.1_Missense_Mutation_p.H1600R|FLNB_ENST00000429972.2_Missense_Mutation_p.H1569R|FLNB_ENST00000493452.1_Missense_Mutation_p.H1400R|FLNB_ENST00000419752.2_Missense_Mutation_p.H1400R	NM_001457.3	NP_001448.2	O75369	FLNB_HUMAN	filamin B, beta	1569					actin cytoskeleton organization (GO:0030036)|cell differentiation (GO:0030154)|cytokine-mediated signaling pathway (GO:0019221)|cytoskeletal anchoring at plasma membrane (GO:0007016)|signal transduction (GO:0007165)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	actin binding (GO:0003779)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)	p.H1569R(1)		NS(1)|breast(13)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(23)|liver(2)|lung(38)|ovary(6)|prostate(3)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(5)	120				BRCA - Breast invasive adenocarcinoma(55;0.000335)|KIRC - Kidney renal clear cell carcinoma(284;0.0726)|Kidney(284;0.0898)		GCCATTGTCCATGACAATAAA	0.453																																					p.H1600R													.	FLNB-593	1	Substitution - Missense(1)	large_intestine(1)	c.A4799G						.						87.0	76.0	80.0					3																	58121740		2203	4300	6503	SO:0001583	missense	2317	exon29			TTGTCCATGACAA	AF043045	CCDS2885.1, CCDS54599.1, CCDS54600.1, CCDS54601.1	3p14.3	2011-02-11	2009-07-23		ENSG00000136068	ENSG00000136068			3755	protein-coding gene	gene with protein product	"""actin binding protein 278"""	603381	"""filamin B, beta (actin binding protein 278)"", ""Larsen syndrome 1 (autosomal dominant)"""	FLN1L, LRS1		8327473, 10449914, 14991055, 16801345	Standard	NM_001457		Approved	TAP, TABP, ABP-278, FH1	uc010hne.2	O75369	OTTHUMG00000159158	ENST00000295956.4:c.4706A>G	3.37:g.58121740A>G	ENSP00000295956:p.His1569Arg	175	0		139	4	NM_001164317	0	0	152	165	13	B2ZZ83|B2ZZ84|B2ZZ85|C9JKE6|C9JMC4|Q13706|Q59EC2|Q60FE7|Q6MZJ1|Q8WXS9|Q8WXT0|Q8WXT1|Q8WXT2|Q8WXT3|Q9NRB5|Q9NT26|Q9UEV9	Missense_Mutation	SNP	ENST00000295956.4	37	CCDS2885.1	.	.	.	.	.	.	.	.	.	.	A	6.109	0.388346	0.11581	.	.	ENSG00000136068	ENST00000295956;ENST00000490882;ENST00000358537;ENST00000429972;ENST00000348383;ENST00000357272;ENST00000493452;ENST00000419752	D;D;D;D;D;D;D;D	0.84298	-1.83;-1.83;-1.83;-1.83;-1.83;-1.83;-1.83;-1.83	5.99	5.99	0.97316	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.437415	0.30168	N	0.010247	T	0.73164	0.3552	N	0.03967	-0.31	0.44880	D	0.997891	B;B;B;B;B;B	0.34061	0.382;0.002;0.272;0.0;0.436;0.436	B;B;B;B;B;B	0.43155	0.287;0.02;0.268;0.001;0.41;0.41	T	0.72070	-0.4401	10	0.02654	T	1	.	16.4791	0.84152	1.0:0.0:0.0:0.0	.	1569;1600;1400;1400;1569;1569	O75369-2;B2ZZ83;E7EN95;O75369-7;Q60FE7;O75369	.;.;.;.;.;FLNB_HUMAN	R	1569;1600;1569;1569;1569;1569;1400;1400	ENSP00000295956:H1569R;ENSP00000420213:H1600R;ENSP00000351339:H1569R;ENSP00000415599:H1569R;ENSP00000232447:H1569R;ENSP00000349819:H1569R;ENSP00000418510:H1400R;ENSP00000414532:H1400R	ENSP00000295956:H1569R	H	+	2	0	FLNB	58096780	0.998000	0.40836	0.824000	0.32777	0.986000	0.74619	4.078000	0.57606	2.284000	0.76573	0.528000	0.53228	CAT	.		0.453	FLNB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000353569.1	NM_001457	
MME	4311	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	154858036	154858036	+	Silent	SNP	A	A	G			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr3:154858036A>G	ENST00000460393.1	+	10	1032	c.912A>G	c.(910-912)acA>acG	p.T304T	MME_ENST00000462745.1_Silent_p.T304T|MME_ENST00000492661.1_Silent_p.T304T|MME_ENST00000493237.1_Silent_p.T304T|MME_ENST00000360490.2_Silent_p.T304T	NM_000902.3|NM_007287.2	NP_000893.2|NP_009218.2	P08473	NEP_HUMAN	membrane metallo-endopeptidase	304				T -> R (in Ref. 4; AAA51915). {ECO:0000305}.	angiotensin maturation (GO:0002003)|beta-amyloid metabolic process (GO:0050435)|cellular protein metabolic process (GO:0044267)|cellular response to cytokine stimulus (GO:0071345)|cellular response to UV-A (GO:0071492)|cellular response to UV-B (GO:0071493)|creatinine metabolic process (GO:0046449)|kidney development (GO:0001822)|peptide metabolic process (GO:0006518)|proteolysis (GO:0006508)|replicative senescence (GO:0090399)|sensory perception of pain (GO:0019233)	axon (GO:0030424)|brush border (GO:0005903)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuron projection terminus (GO:0044306)|plasma membrane (GO:0005886)|synapse (GO:0045202)|synaptic vesicle (GO:0008021)	endopeptidase activity (GO:0004175)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(31)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	64		all_neural(597;0.00391)|Myeloproliferative disorder(1037;0.0122)	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.135)		Candoxatril(DB00616)|Liraglutide(DB06655)	ACAAGATGACATTGGCCCAGA	0.323																																					p.T304T		.											.	MME-516	0			c.A912G						.						74.0	69.0	71.0					3																	154858036		2203	4298	6501	SO:0001819	synonymous_variant	4311	exon10			GATGACATTGGCC		CCDS3172.1	3q25.2	2012-01-31	2007-02-21		ENSG00000196549	ENSG00000196549	3.4.24.11	"""CD molecules"""	7154	protein-coding gene	gene with protein product	"""neutral endopeptidase"", ""enkephalinase"", ""neprilysin"""	120520					Standard	NM_007287		Approved	CALLA, CD10, NEP	uc003fad.1	P08473	OTTHUMG00000158455	ENST00000460393.1:c.912A>G	3.37:g.154858036A>G		293	0		324	109	NM_007287	0	0	10	20	10	A8K6U6|D3DNJ9|Q3MIX4	Silent	SNP	ENST00000460393.1	37	CCDS3172.1																																																																																			.		0.323	MME-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351076.1	NM_000902	
MUC4	4585	broad.mit.edu	37	3	195511694	195511694	+	Missense_Mutation	SNP	C	C	G	rs571610910	byFrequency	TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr3:195511694C>G	ENST00000463781.3	-	2	7216	c.6757G>C	c.(6757-6759)Gac>Cac	p.D2253H	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.D2253H	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGGGTGGTGTCACCTGTGGAT	0.582																																					p.D2253H													.	MUC4-90	0			c.G6757C						.						31.0	29.0	30.0					3																	195511694		687	1587	2274	SO:0001583	missense	4585	exon2			TGGTGTCACCTGT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.6757G>C	3.37:g.195511694C>G	ENSP00000417498:p.Asp2253His	124	0		160	5	NM_018406	0	0	0	0	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	C	2.779	-0.253833	0.05829	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.35421	1.38;1.31	.	.	.	.	.	.	.	.	T	0.16085	0.0387	N	0.19112	0.55	0.09310	N	1	B	0.31077	0.307	B	0.12156	0.007	T	0.16424	-1.0403	6	.	.	.	.	.	.	.	.	2253	E7ESK3	.	H	2253	ENSP00000417498:D2253H;ENSP00000420243:D2253H	.	D	-	1	0	MUC4	196996089	0.000000	0.05858	0.002000	0.10522	0.092000	0.18411	-0.026000	0.12392	-0.417000	0.07461	0.064000	0.15345	GAC	C|1.000;|0.000		0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
AFAP1	60312	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	7811366	7811366	+	Silent	SNP	T	T	C			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr4:7811366T>C	ENST00000360265.4	-	8	1263	c.1029A>G	c.(1027-1029)tcA>tcG	p.S343S	AFAP1_ENST00000382543.3_Silent_p.S343S|AFAP1_ENST00000420658.1_Silent_p.S343S|AFAP1_ENST00000358461.2_Silent_p.S343S			Q8N556	AFAP1_HUMAN	actin filament associated protein 1	343						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|skin(4)|stomach(2)	32						CTTCCTCAGCTGAGGAGGTCT	0.537																																					p.S343S		.											.	AFAP1-90	0			c.A1029G						.						145.0	115.0	125.0					4																	7811366		2203	4300	6503	SO:0001819	synonymous_variant	60312	exon9			CTCAGCTGAGGAG	AB209676	CCDS3397.1, CCDS47010.1	4p16	2014-02-12	2007-02-07		ENSG00000196526	ENSG00000196526		"""Pleckstrin homology (PH) domain containing"""	24017	protein-coding gene	gene with protein product		608252				14755689, 11641786, 11607843	Standard	NM_198595		Approved	AFAP-110, AFAP	uc011bwk.1	Q8N556	OTTHUMG00000125515	ENST00000360265.4:c.1029A>G	4.37:g.7811366T>C		50	0		55	18	NM_001134647	0	0	10	24	14	A8K442|B4DMU2|E9PDT7|Q59EY5|Q9HBY1	Silent	SNP	ENST00000360265.4	37	CCDS3397.1																																																																																			.		0.537	AFAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246842.2	NM_021638	
GUF1	60558	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	44688034	44688034	+	Missense_Mutation	SNP	T	T	C			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr4:44688034T>C	ENST00000281543.5	+	7	922	c.728T>C	c.(727-729)aTc>aCc	p.I243T	GUF1_ENST00000506793.1_3'UTR	NM_021927.2	NP_068746.2			GUF1 GTPase homolog (S. cerevisiae)											breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	19						ATTGAAAGAATCCCCCCGTGA	0.318																																					p.I243T		.											.	GUF1-91	0			c.T728C						.						139.0	141.0	140.0					4																	44688034		2203	4298	6501	SO:0001583	missense	60558	exon7			AAAGAATCCCCCC		CCDS3468.1	4p13	2006-02-16			ENSG00000151806	ENSG00000151806			25799	protein-coding gene	gene with protein product						8553703	Standard	NM_021927		Approved	FLJ13220	uc003gww.4	Q8N442	OTTHUMG00000128608	ENST00000281543.5:c.728T>C	4.37:g.44688034T>C	ENSP00000281543:p.Ile243Thr	40	0		42	11	NM_021927	0	0	0	0	0		Missense_Mutation	SNP	ENST00000281543.5	37	CCDS3468.1	.	.	.	.	.	.	.	.	.	.	T	19.13	3.768731	0.69878	.	.	ENSG00000151806	ENST00000281543	T	0.72615	-0.67	5.72	5.72	0.89469	Protein synthesis factor, GTP-binding (1);	0.045776	0.85682	D	0.000000	T	0.79082	0.4386	M	0.73430	2.235	0.80722	D	1	P	0.48834	0.916	P	0.51701	0.677	T	0.82159	-0.0595	10	0.87932	D	0	-21.9459	15.1683	0.72846	0.0:0.0:0.0:1.0	.	243	Q8N442	GUF1_HUMAN	T	243	ENSP00000281543:I243T	ENSP00000281543:I243T	I	+	2	0	GUF1	44382791	1.000000	0.71417	1.000000	0.80357	0.482000	0.33219	7.594000	0.82698	2.169000	0.68431	0.460000	0.39030	ATC	.		0.318	GUF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250469.3	NM_021927	
PKD2	5311	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	88996109	88996109	+	Missense_Mutation	SNP	G	G	C			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr4:88996109G>C	ENST00000508588.1	+	9	1317	c.922G>C	c.(922-924)Gag>Cag	p.E308Q	PKD2_ENST00000502363.1_Missense_Mutation_p.E308Q|PKD2_ENST00000237596.2_Missense_Mutation_p.E890Q|PKD2_ENST00000511337.1_3'UTR			Q9BZL6	KPCD2_HUMAN	polycystic kidney disease 2 (autosomal dominant)	0					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial tube morphogenesis (GO:0061154)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell receptor signaling pathway (GO:0050862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|liver(2)|lung(15)|skin(4)|upper_aerodigestive_tract(1)	36		Hepatocellular(203;0.114)|Acute lymphoblastic leukemia(40;0.221)		OV - Ovarian serous cystadenocarcinoma(123;9.98e-10)|COAD - Colon adenocarcinoma(81;0.0237)		TGGGGTGGCCGAGGTCAGTAG	0.468																																					p.E890Q		.											.	PKD2-91	0			c.G2668C						.						138.0	108.0	118.0					4																	88996109		2203	4300	6503	SO:0001583	missense	5311	exon14			GTGGCCGAGGTCA	U50928	CCDS3627.1	4q22.1	2014-01-28			ENSG00000118762	ENSG00000118762		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""EF-hand domain containing"""	9009	protein-coding gene	gene with protein product	"""transient receptor potential cation channel, subfamily P, member 2"""	173910				8298643	Standard	NM_000297		Approved	PKD4, PC2, Pc-2, TRPP2	uc003hre.3	Q13563	OTTHUMG00000160982	ENST00000508588.1:c.922G>C	4.37:g.88996109G>C	ENSP00000427131:p.Glu308Gln	113	0		87	18	NM_000297	0	0	0	0	0	Q8TB08|Q9P0T6|Q9Y3X8	Missense_Mutation	SNP	ENST00000508588.1	37		.	.	.	.	.	.	.	.	.	.	G	23.9	4.473075	0.84640	.	.	ENSG00000118762	ENST00000237596;ENST00000508588;ENST00000502363	T;D;D	0.92752	-0.39;-3.1;-3.1	5.01	5.01	0.66863	.	0.000000	0.85682	D	0.000000	D	0.95007	0.8384	L	0.54323	1.7	0.80722	D	1	D	0.76494	0.999	D	0.79108	0.992	D	0.95429	0.8514	10	0.66056	D	0.02	-21.5133	18.3522	0.90342	0.0:0.0:1.0:0.0	.	890	Q13563	PKD2_HUMAN	Q	890;308;308	ENSP00000237596:E890Q;ENSP00000427131:E308Q;ENSP00000425289:E308Q	ENSP00000237596:E890Q	E	+	1	0	PKD2	89215133	1.000000	0.71417	0.985000	0.45067	0.635000	0.38103	9.576000	0.98192	2.318000	0.78349	0.650000	0.86243	GAG	.		0.468	PKD2-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000363253.2	NM_000297	
DNAH5	1767	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	13839483	13839483	+	Missense_Mutation	SNP	A	A	C			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr5:13839483A>C	ENST00000265104.4	-	35	5968	c.5864T>G	c.(5863-5865)aTa>aGa	p.I1955R		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	1955	AAA 1. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					AAGTGGAGTTATTACAAGCCT	0.418									Kartagener syndrome																												p.I1955R		.											.	DNAH5-182	0			c.T5864G						.						126.0	129.0	128.0					5																	13839483		2203	4300	6503	SO:0001583	missense	1767	exon35	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	GGAGTTATTACAA	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.5864T>G	5.37:g.13839483A>C	ENSP00000265104:p.Ile1955Arg	60	0		55	19	NM_001369	0	0	1	2	1	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	37	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	A	21.4	4.138855	0.77775	.	.	ENSG00000039139	ENST00000265104	T	0.14391	2.51	4.94	4.94	0.65067	.	0.000000	0.85682	D	0.000000	T	0.43678	0.1258	M	0.89163	3.01	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.53236	-0.8467	10	0.87932	D	0	.	13.8028	0.63212	1.0:0.0:0.0:0.0	.	1955	Q8TE73	DYH5_HUMAN	R	1955	ENSP00000265104:I1955R	ENSP00000265104:I1955R	I	-	2	0	DNAH5	13892483	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.307000	0.96226	1.870000	0.54199	0.533000	0.62120	ATA	.		0.418	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
AMACR	23600	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	33998825	33998825	+	Silent	SNP	A	A	G			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr5:33998825A>G	ENST00000335606.6	-	4	748	c.660T>C	c.(658-660)taT>taC	p.Y220Y	AMACR_ENST00000502637.1_Silent_p.Y205Y|AMACR_ENST00000382085.3_Silent_p.Y220Y|AMACR_ENST00000512079.1_Silent_p.Y220Y|AMACR_ENST00000426255.2_Silent_p.Y220Y|AMACR_ENST00000514195.1_5'UTR|AMACR_ENST00000441713.2_Missense_Mutation_p.Y167H|AMACR_ENST00000382068.3_Missense_Mutation_p.Y167H|RP11-1084J3.4_ENST00000382079.3_3'UTR|AMACR_ENST00000382072.2_Missense_Mutation_p.Y167H	NM_001167595.1|NM_014324.5	NP_001161067.1|NP_055139.4	Q9UHK6	AMACR_HUMAN	alpha-methylacyl-CoA racemase	220					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	alpha-methylacyl-CoA racemase activity (GO:0008111)|receptor binding (GO:0005102)			endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|stomach(1)|urinary_tract(1)	19						TGTAAGTCGTATAGAAAGGTG	0.458																																					p.Y167H		.											.	AMACR-90	0			c.T499C						.						150.0	134.0	139.0					5																	33998825		2203	4300	6503	SO:0001819	synonymous_variant	23600	exon3			AGTCGTATAGAAA	AF047020	CCDS3902.1, CCDS3903.1, CCDS54836.1	5p13.2	2012-05-16			ENSG00000242110	ENSG00000242110	5.1.99.4		451	protein-coding gene	gene with protein product		604489				9307041	Standard	NM_014324		Approved	RACE	uc003jij.3	Q9UHK6	OTTHUMG00000090734	ENST00000335606.6:c.660T>C	5.37:g.33998825A>G		135	0		106	34	NM_203382	0	0	147	331	184	A5YM47|B8Y916|B8Y918|F8W9N1|O43673|Q3KT79|Q96GH1|Q9Y3Q1	Missense_Mutation	SNP	ENST00000335606.6	37	CCDS3902.1	.	.	.	.	.	.	.	.	.	.	A	11.20	1.568213	0.28003	.	.	ENSG00000242110	ENST00000382072;ENST00000441713	T;T	0.70164	-0.36;-0.46	5.34	0.947	0.19555	.	0.056699	0.64402	D	0.000001	T	0.45756	0.1358	.	.	.	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.14755	-1.0461	9	0.15499	T	0.54	-10.3866	8.1708	0.31254	0.5779:0.0:0.4221:0.0	.	167;167	Q6VRU4;Q9UHK6-4	.;.	H	167	ENSP00000371504:Y167H;ENSP00000403800:Y167H	ENSP00000371504:Y167H	Y	-	1	0	AMACR	34034582	0.996000	0.38824	0.997000	0.53966	0.411000	0.31082	0.457000	0.21875	0.241000	0.21283	-0.468000	0.05107	TAC	.		0.458	AMACR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207467.1	NM_014324	
ADAMTS6	11174	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	64766709	64766709	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr5:64766709C>T	ENST00000536360.1	-	3	1171	c.358G>A	c.(358-360)Gga>Aga	p.G120R				Q9UKP5	ATS6_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 6	120						proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|pancreas(1)|prostate(1)|skin(3)	18		Lung NSC(167;2.44e-06)|Prostate(74;0.014)|Ovarian(174;0.0549)|Breast(144;0.111)|Colorectal(97;0.235)		Lung(70;0.00942)		CACTGGGGTCCATCTTTCCCC	0.373																																					p.G120R		.											.	ADAMTS6-226	0			c.G358A						.						110.0	109.0	109.0					5																	64766709		2203	4300	6503	SO:0001583	missense	11174	exon3			GGGGTCCATCTTT	AF140674	CCDS3983.2	5q13	2008-07-18	2005-08-19		ENSG00000049192	ENSG00000049192		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	222	protein-coding gene	gene with protein product	"""a disintegrin and metalloproteinase with thrombospondin motifs 6"""	605008	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 6"""			10464288	Standard	NM_197941		Approved	ADAM-TS6	uc003jtp.3	Q9UKP5	OTTHUMG00000074079	ENST00000536360.1:c.358G>A	5.37:g.64766709C>T	ENSP00000440995:p.Gly120Arg	77	0		84	22	NM_197941	0	0	0	0	0	Q59EX6|Q5IR87|Q5IR88|Q5IR89|Q68DL1	Missense_Mutation	SNP	ENST00000536360.1	37		.	.	.	.	.	.	.	.	.	.	C	25.7	4.664354	0.88251	.	.	ENSG00000049192	ENST00000381055;ENST00000261306;ENST00000464680;ENST00000536360	T;T;T	0.12039	2.72;2.72;2.72	5.78	5.78	0.91487	Peptidase M12B, propeptide (1);	0.000000	0.85682	D	0.000000	T	0.28830	0.0715	L	0.60455	1.87	0.80722	D	1	B	0.33857	0.429	P	0.47134	0.539	T	0.00599	-1.1651	10	0.28530	T	0.3	.	20.3754	0.98918	0.0:1.0:0.0:0.0	.	120	Q9UKP5	ATS6_HUMAN	R	120	ENSP00000370443:G120R;ENSP00000423551:G120R;ENSP00000440995:G120R	ENSP00000261306:G120R	G	-	1	0	ADAMTS6	64802465	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.112000	0.77086	2.894000	0.99253	0.591000	0.81541	GGA	.		0.373	ADAMTS6-201	KNOWN	basic	protein_coding	protein_coding		NM_197941	
PCDHGA5	56110	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	140745640	140745640	+	Silent	SNP	C	C	T			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr5:140745640C>T	ENST00000518069.1	+	1	1743	c.1743C>T	c.(1741-1743)tcC>tcT	p.S581S	PCDHGA3_ENST00000253812.6_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB2_ENST00000522605.1_Intron	NM_018918.2|NM_032054.1	NP_061741.1|NP_114443.1	Q9Y5G8	PCDG5_HUMAN	protocadherin gamma subfamily A, 5	581	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(5)|upper_aerodigestive_tract(3)	18			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGCCTCGCTCCGCAGAACCTG	0.627																																					p.S581S		.											.	PCDHGA5-35	0			c.C1743T						.						97.0	108.0	105.0					5																	140745640		2203	4300	6503	SO:0001819	synonymous_variant	56110	exon1			TCGCTCCGCAGAA	AF152512	CCDS54925.1, CCDS75333.1	5q31	2010-01-26				ENSG00000253485		"""Cadherins / Protocadherins : Clustered"""	8703	other	protocadherin	"""cadherin ME3"""	606292				10380929	Standard	NM_018918		Approved	CDH-GAMMA-A5, ME3, PCDH-GAMMA-A5		Q9Y5G8		ENST00000518069.1:c.1743C>T	5.37:g.140745640C>T		96	0		104	35	NM_032054	0	0	0	0	0	Q2M3F5|Q9Y5D2	Silent	SNP	ENST00000518069.1	37	CCDS54925.1																																																																																			.		0.627	PCDHGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374742.1	NM_018918	
UBTD2	92181	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	171661228	171661228	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr5:171661228C>T	ENST00000393792.2	-	2	610	c.205G>A	c.(205-207)Gag>Aag	p.E69K		NM_152277.2	NP_689490.2	Q8WUN7	UBTD2_HUMAN	ubiquitin domain containing 2	69						cytoplasm (GO:0005737)				cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(1)|prostate(1)|skin(1)	10	Renal(175;0.000159)|Lung NSC(126;0.00976)|all_lung(126;0.0156)	Medulloblastoma(196;0.00853)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			TCCCAAATCTCTTTCCGGCCT	0.438																																					p.E69K		.											.	UBTD2-90	0			c.G205A						.						165.0	142.0	150.0					5																	171661228		2203	4300	6503	SO:0001583	missense	92181	exon2			AAATCTCTTTCCG	AF251700	CCDS4379.2	5q35.1	2008-10-30			ENSG00000168246	ENSG00000168246			24463	protein-coding gene	gene with protein product	"""dendritic cell derived ubiquitin like protein"""	610174				12507522	Standard	NM_152277		Approved	DC-UbP, MGC30022	uc003mbp.1	Q8WUN7	OTTHUMG00000130519	ENST00000393792.2:c.205G>A	5.37:g.171661228C>T	ENSP00000377381:p.Glu69Lys	100	0		93	32	NM_152277	0	0	12	24	12	Q8TDQ3	Missense_Mutation	SNP	ENST00000393792.2	37	CCDS4379.2	.	.	.	.	.	.	.	.	.	.	C	29.8	5.035386	0.93630	.	.	ENSG00000168246	ENST00000393792	T	0.64260	-0.09	5.51	5.51	0.81932	.	0.047322	0.85682	D	0.000000	D	0.84014	0.5379	M	0.93328	3.405	0.80722	D	1	D	0.54772	0.968	D	0.66847	0.947	D	0.87994	0.2751	10	0.87932	D	0	.	16.9267	0.86178	0.0:1.0:0.0:0.0	.	69	Q8WUN7	UBTD2_HUMAN	K	69	ENSP00000377381:E69K	ENSP00000377381:E69K	E	-	1	0	UBTD2	171593833	1.000000	0.71417	1.000000	0.80357	0.653000	0.38743	7.640000	0.83355	2.584000	0.87258	0.563000	0.77884	GAG	.		0.438	UBTD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252936.1	NM_152277	
RGS14	10636	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	176798989	176798989	+	Silent	SNP	C	C	T			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr5:176798989C>T	ENST00000408923.3	+	15	1802	c.1614C>T	c.(1612-1614)ccC>ccT	p.P538P	RGS14_ENST00000506944.1_3'UTR	NM_006480.4	NP_006471.2	O43566	RGS14_HUMAN	regulator of G-protein signaling 14	538					cell division (GO:0051301)|chromosome segregation (GO:0007059)|intracellular signal transduction (GO:0035556)|learning (GO:0007612)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|mitotic nuclear division (GO:0007067)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of synaptic plasticity (GO:0031914)|nucleocytoplasmic transport (GO:0006913)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of GTPase activity (GO:0043547)|positive regulation of neurogenesis (GO:0050769)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|response to oxidative stress (GO:0006979)|spindle organization (GO:0007051)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|visual learning (GO:0008542)|zygote asymmetric cell division (GO:0010070)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|microtubule (GO:0005874)|nuclear body (GO:0016604)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|spindle (GO:0005819)|spindle pole (GO:0000922)	GDP-dissociation inhibitor activity (GO:0005092)|GTPase activator activity (GO:0005096)|microtubule binding (GO:0008017)|receptor signaling complex scaffold activity (GO:0030159)|receptor signaling protein activity (GO:0005057)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(3)|skin(3)|upper_aerodigestive_tract(1)	12	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CCCAAGGGCCCAGCTCCGAGG	0.627																																					p.P538P	NSCLC(47;353 1896 28036)	.											.	RGS14-226	0			c.C1614T						.						108.0	130.0	123.0					5																	176798989		2003	4169	6172	SO:0001819	synonymous_variant	10636	exon15			AGGGCCCAGCTCC	AF037195	CCDS43405.1	5q35.3	2008-02-05	2007-08-14		ENSG00000169220	ENSG00000169220		"""Regulators of G-protein signaling"""	9996	protein-coding gene	gene with protein product		602513	"""regulator of G-protein signalling 14"""				Standard	NM_006480		Approved		uc003mgf.3	O43566	OTTHUMG00000163324	ENST00000408923.3:c.1614C>T	5.37:g.176798989C>T		60	0		44	18	NM_006480	0	1	92	209	116	O43565|Q506M1|Q6ZWA4|Q8TD62	Silent	SNP	ENST00000408923.3	37	CCDS43405.1	.	.	.	.	.	.	.	.	.	.	C	2.400	-0.337801	0.05278	.	.	ENSG00000169220	ENST00000511890	T	0.45276	0.9	4.52	1.21	0.21127	.	0.378652	0.25866	N	0.027786	T	0.45975	0.1369	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	T	0.44922	-0.9296	7	0.87932	D	0	-6.9952	11.7553	0.51872	0.4686:0.5314:0.0:0.0	.	.	.	.	L	409	ENSP00000422329:P409L	ENSP00000422329:P409L	P	+	2	0	RGS14	176731595	0.000000	0.05858	0.363000	0.25875	0.442000	0.32017	-0.925000	0.03992	0.463000	0.27118	0.644000	0.83932	CCA	.		0.627	RGS14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372676.1	NM_006480	
HIST1H2BJ	8970	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	27100264	27100264	+	Missense_Mutation	SNP	G	G	A			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr6:27100264G>A	ENST00000607124.1	-	1	265	c.266C>T	c.(265-267)aCc>aTc	p.T89I	HIST1H2AG_ENST00000359193.2_5'Flank|HIST1H2BJ_ENST00000339812.2_Missense_Mutation_p.T89I|HIST1H2BJ_ENST00000541790.1_Missense_Mutation_p.T89I			P06899	H2B1J_HUMAN	histone cluster 1, H2bj	89					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|kidney(2)|lung(5)|ovary(1)|prostate(1)	10						GGAGGTGATGGTCGAGCGCTT	0.602																																					p.T89I		.											.	HIST1H2BJ-90	0			c.C266T						.						93.0	94.0	94.0					6																	27100264		2203	4297	6500	SO:0001583	missense	8970	exon1			GTGATGGTCGAGC	X00088	CCDS4618.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000124635	ENSG00000124635		"""Histones / Replication-dependent"""	4761	protein-coding gene	gene with protein product		615044	"""H2B histone family, member R"", ""histone 1, H2bj"""	H2BFR		6647026, 12408966	Standard	NM_021058		Approved	H2B/r	uc003niv.3	P06899	OTTHUMG00000014470	ENST00000607124.1:c.266C>T	6.37:g.27100264G>A	ENSP00000476136:p.Thr89Ile	62	0		33	12	NM_021058	0	0	51	51	0	B2R4J4|O60816	Missense_Mutation	SNP	ENST00000607124.1	37	CCDS4618.1	.	.	.	.	.	.	.	.	.	.	G	31	5.078432	0.94000	.	.	ENSG00000124635	ENST00000541790;ENST00000339812	T;T	0.41758	0.99;0.99	4.16	4.16	0.48862	Histone-fold (2);Histone core (1);	0.000000	0.44097	U	0.000487	T	0.67590	0.2909	M	0.93241	3.395	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.77512	-0.2560	10	0.87932	D	0	.	14.7851	0.69796	0.0:0.0:1.0:0.0	.	89	P06899	H2B1J_HUMAN	I	89	ENSP00000445633:T89I;ENSP00000342886:T89I	ENSP00000342886:T89I	T	-	2	0	HIST1H2BJ	27208243	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	8.903000	0.92573	2.268000	0.75426	0.585000	0.79938	ACC	.		0.602	HIST1H2BJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040138.2	NM_021058	
KCNK16	83795	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	39285639	39285639	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr6:39285639G>T	ENST00000373229.5	-	3	431	c.418C>A	c.(418-420)Ctc>Atc	p.L140I	KCNK16_ENST00000507712.1_Missense_Mutation_p.L75I|KCNK16_ENST00000425054.2_Missense_Mutation_p.L140I|KCNK16_ENST00000437525.2_Missense_Mutation_p.L140I|KCNK16_ENST00000373227.4_Missense_Mutation_p.L140I	NM_032115.3	NP_115491.1	Q96T55	KCNKG_HUMAN	potassium channel, subfamily K, member 16	140					potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			large_intestine(1)|lung(7)|ovary(2)|prostate(1)|skin(2)	13						AGGTGGTTGAGGAAGATCACG	0.592																																					p.L140I		.											.	KCNK16-229	0			c.C418A						.						63.0	52.0	56.0					6																	39285639		2203	4300	6503	SO:0001583	missense	83795	exon3			GGTTGAGGAAGAT	AF358909	CCDS4843.1, CCDS47420.1, CCDS47421.1, CCDS47422.1	6p21.2-p21.1	2012-03-07			ENSG00000095981	ENSG00000095981		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	14464	protein-coding gene	gene with protein product		607369				11263999, 16382106	Standard	NM_032115		Approved	K2p16.1, TALK-1, TALK1	uc003ooq.3	Q96T55	OTTHUMG00000014645	ENST00000373229.5:c.418C>A	6.37:g.39285639G>T	ENSP00000362326:p.Leu140Ile	67	0		60	7	NM_001135106	0	0	0	0	0	B5TJL9|Q2M2N9|Q5TCF3|Q6X6Z3|Q6X6Z4|Q6X6Z5|Q9H591	Missense_Mutation	SNP	ENST00000373229.5	37	CCDS4843.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.504087	0.85176	.	.	ENSG00000095981	ENST00000373229;ENST00000425054;ENST00000507712;ENST00000373227;ENST00000437525	T;T;T;T;T	0.21734	1.99;1.99;1.99;1.99;1.99	5.65	4.78	0.61160	Ion transport 2 (1);	0.065126	0.64402	D	0.000007	T	0.26702	0.0653	L	0.41632	1.29	0.45979	D	0.998796	P;P;D;D	0.76494	0.939;0.707;0.986;0.999	P;P;P;D	0.77557	0.589;0.624;0.793;0.99	T	0.00599	-1.1651	10	0.39692	T	0.17	.	14.537	0.67969	0.0721:0.0:0.9279:0.0	.	140;140;140;140	B5TJL9;Q96T55-5;Q96T55-4;Q96T55	.;.;.;KCNKG_HUMAN	I	140;140;75;140;140	ENSP00000362326:L140I;ENSP00000391498:L140I;ENSP00000423842:L75I;ENSP00000362324:L140I;ENSP00000415375:L140I	ENSP00000362324:L140I	L	-	1	0	KCNK16	39393617	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	5.106000	0.64597	2.667000	0.90743	0.561000	0.74099	CTC	.		0.592	KCNK16-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000040452.2	NM_032115	
PRIM2	5558	broad.mit.edu;bcgsc.ca	37	6	57467163	57467163	+	3'UTR	SNP	G	G	C			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr6:57467163G>C	ENST00000389488.2	+	0	1191				PRIM2_ENST00000607273.1_3'UTR			P49643	PRI2_HUMAN	primase, DNA, polypeptide 2 (58kDa)						DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	nucleoplasm (GO:0005654)|primosome complex (GO:1990077)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA primase activity (GO:0003896)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(34)|prostate(6)|stomach(4)|upper_aerodigestive_tract(1)	59				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		TCAGTTGCCTGAAGATTATTC	0.438																																					.													.	PRIM2-227	0			.						.						136.0	129.0	131.0					6																	57467163		1989	4189	6178	SO:0001624	3_prime_UTR_variant	5558	.			TTGCCTGAAGATT		CCDS75476.1, CCDS75477.1	6p12-p11.1	2013-01-31	2007-06-19	2007-06-19	ENSG00000146143	ENSG00000146143			9370	protein-coding gene	gene with protein product		176636	"""primase, polypeptide 2A (58kD)"", ""primase, polypeptide 2A, 58kDa"""	PRIM2A		8530050, 20675616	Standard	NM_001282487		Approved		uc003pdx.3	P49643	OTTHUMG00000016190	ENST00000389488.2:c.*1188G>C	6.37:g.57467163G>C		123	0		146	6	.	0	0	0	0	0	Q53FJ8|Q6P1Q7|Q8WVL2|Q9H413	Silent	SNP	ENST00000389488.2	37																																																																																				.		0.438	PRIM2-001	KNOWN	sequence_error|basic	processed_transcript	protein_coding	OTTHUMT00000043468.3	NM_000947	
PRSS35	167681	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	84233613	84233613	+	Silent	SNP	C	C	T			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr6:84233613C>T	ENST00000369700.3	+	2	630	c.453C>T	c.(451-453)tcC>tcT	p.S151S	PRSS35_ENST00000536636.1_Silent_p.S151S	NM_153362.2	NP_699193.2	Q8N3Z0	PRS35_HUMAN	protease, serine, 35	151	Peptidase S1.					extracellular region (GO:0005576)|mitochondrion (GO:0005739)	serine-type endopeptidase activity (GO:0004252)			breast(2)|endometrium(2)|large_intestine(12)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	32		all_cancers(76;0.000113)|Acute lymphoblastic leukemia(125;1.09e-08)|all_hematologic(105;3.12e-05)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0768)		TGAAGCTTTCCACGGGCTGTA	0.463																																					p.S151S		.											.	PRSS35-91	0			c.C453T						.						101.0	100.0	101.0					6																	84233613		2203	4300	6503	SO:0001819	synonymous_variant	167681	exon2			GCTTTCCACGGGC	BC037170	CCDS4999.1	6q14.2	2010-05-12	2004-07-09	2004-07-09	ENSG00000146250	ENSG00000146250		"""Serine peptidases / Serine peptidases"""	21387	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 158"""	C6orf158			Standard	NM_153362		Approved	MGC46520, dJ223E3.1	uc003pjz.3	Q8N3Z0	OTTHUMG00000015113	ENST00000369700.3:c.453C>T	6.37:g.84233613C>T		129	0		115	40	NM_153362	0	0	0	0	0	A8K7B3|Q9BQP6	Silent	SNP	ENST00000369700.3	37	CCDS4999.1																																																																																			.		0.463	PRSS35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041352.1	NM_153362	
ENPP3	5169	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	132059234	132059234	+	Missense_Mutation	SNP	A	A	C			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr6:132059234A>C	ENST00000414305.1	+	24	2559	c.2231A>C	c.(2230-2232)aAt>aCt	p.N744T	ENPP3_ENST00000358229.5_3'UTR|ENPP3_ENST00000357639.3_Missense_Mutation_p.N744T			O14638	ENPP3_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 3	744	Nuclease.		N -> H (in dbSNP:rs36094194).		immune response (GO:0006955)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleoside triphosphate catabolic process (GO:0009143)|phosphate-containing compound metabolic process (GO:0006796)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)	metal ion binding (GO:0046872)|NADH pyrophosphatase activity (GO:0035529)|nucleic acid binding (GO:0003676)|nucleoside-triphosphate diphosphatase activity (GO:0047429)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(1)|breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	53	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0252)|OV - Ovarian serous cystadenocarcinoma(155;0.0511)		AATGGAGTAAATGTGGTTAGT	0.303																																					p.N744T		.											.	ENPP3-95	0			c.A2231C						.						114.0	125.0	121.0					6																	132059234		2203	4297	6500	SO:0001583	missense	5169	exon23			GAGTAAATGTGGT	AF005632	CCDS5148.1	6q22	2010-06-23			ENSG00000154269	ENSG00000154269	3.1.4.1, 3.6.1.9	"""CD molecules"""	3358	protein-coding gene	gene with protein product		602182		PDNP3		9344668	Standard	NM_005021		Approved	PD-IBETA, gp130RB13-6, B10, CD203c	uc003qcv.3	O14638	OTTHUMG00000016292	ENST00000414305.1:c.2231A>C	6.37:g.132059234A>C	ENSP00000406261:p.Asn744Thr	91	0		78	29	NM_005021	0	0	7	12	5	Q5JTL3	Missense_Mutation	SNP	ENST00000414305.1	37	CCDS5148.1	.	.	.	.	.	.	.	.	.	.	A	22.4	4.286561	0.80803	.	.	ENSG00000154269	ENST00000414305;ENST00000357639	T;T	0.69040	-0.37;-0.37	6.08	6.08	0.98989	DNA/RNA non-specific endonuclease (2);Extracellular Endonuclease, subunit A (2);	0.196594	0.45867	D	0.000330	D	0.83036	0.5167	M	0.89534	3.04	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.86746	0.1957	10	0.87932	D	0	-31.3676	16.6512	0.85203	1.0:0.0:0.0:0.0	.	744	O14638	ENPP3_HUMAN	T	744	ENSP00000406261:N744T;ENSP00000350265:N744T	ENSP00000350265:N744T	N	+	2	0	ENPP3	132100927	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.974000	0.88039	2.333000	0.79357	0.482000	0.46254	AAT	.		0.303	ENPP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043627.2		
SNX9	51429	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	158358486	158358486	+	Missense_Mutation	SNP	C	C	A	rs532553158		TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr6:158358486C>A	ENST00000392185.3	+	15	1635	c.1464C>A	c.(1462-1464)ttC>ttA	p.F488L		NM_016224.3	NP_057308.1	Q9Y5X1	SNX9_HUMAN	sorting nexin 9	488	BAR.				cleavage furrow formation (GO:0036089)|endocytosis (GO:0006897)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|lipid tube assembly (GO:0060988)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|positive regulation of GTPase activity (GO:0043547)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of protein oligomerization (GO:0032461)|receptor-mediated endocytosis (GO:0006898)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic vesicle membrane (GO:0030659)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	1-phosphatidylinositol binding (GO:0005545)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)	p.F488F(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(10)|skin(1)|upper_aerodigestive_tract(1)	20		Breast(66;0.000776)|Ovarian(120;0.0303)|Prostate(117;0.167)		OV - Ovarian serous cystadenocarcinoma(65;8.06e-18)|BRCA - Breast invasive adenocarcinoma(81;4.48e-05)		ATCTCCATTTCCTGATGGAAT	0.378																																					p.F488L		.											.	SNX9-226	1	Substitution - coding silent(1)	skin(1)	c.C1464A						.						149.0	143.0	145.0					6																	158358486		2203	4300	6503	SO:0001583	missense	51429	exon15			CCATTTCCTGATG	AF121859	CCDS5253.1	6q25.1-q26	2008-05-22			ENSG00000130340	ENSG00000130340		"""Sorting nexins"""	14973	protein-coding gene	gene with protein product		605952				10531379, 17609109	Standard	NM_016224		Approved	SH3PX1, SDP1, SH3PXD3A	uc003qqv.1	Q9Y5X1	OTTHUMG00000015903	ENST00000392185.3:c.1464C>A	6.37:g.158358486C>A	ENSP00000376024:p.Phe488Leu	79	0		80	20	NM_016224	0	1	54	101	46	Q9BSI7|Q9BVM1|Q9UJH6|Q9UP20	Missense_Mutation	SNP	ENST00000392185.3	37	CCDS5253.1	.	.	.	.	.	.	.	.	.	.	C	18.01	3.528865	0.64860	.	.	ENSG00000130340	ENST00000539592;ENST00000392185;ENST00000252631	T	0.40476	1.03	5.39	2.61	0.31194	Sorting nexin protein, WASP-binding domain (1);	0.045544	0.85682	D	0.000000	T	0.20292	0.0488	L	0.43152	1.355	0.80722	D	1	P	0.52842	0.956	B	0.41619	0.361	T	0.03344	-1.1046	10	0.48119	T	0.1	-10.3916	8.3841	0.32491	0.0:0.6569:0.0:0.3431	.	488	Q9Y5X1	SNX9_HUMAN	L	488;488;288	ENSP00000376024:F488L	ENSP00000252631:F288L	F	+	3	2	SNX9	158278474	0.996000	0.38824	1.000000	0.80357	0.985000	0.73830	0.455000	0.21843	2.673000	0.90976	0.563000	0.77884	TTC	.		0.378	SNX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042856.1		
GCK	2645	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	44185276	44185276	+	Missense_Mutation	SNP	C	C	G			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr7:44185276C>G	ENST00000403799.3	-	9	1542	c.1073G>C	c.(1072-1074)cGa>cCa	p.R358P	GCK_ENST00000437084.1_Missense_Mutation_p.R341P|GCK_ENST00000345378.2_Missense_Mutation_p.R359P|GCK_ENST00000395796.3_Missense_Mutation_p.R357P	NM_000162.3	NP_000153.1	P35557	HXK4_HUMAN	glucokinase (hexokinase 4)	358	Hexokinase type-2.				calcium ion import (GO:0070509)|carbohydrate metabolic process (GO:0005975)|cellular glucose homeostasis (GO:0001678)|cellular response to glucose starvation (GO:0042149)|cellular response to insulin stimulus (GO:0032869)|cellular response to leptin stimulus (GO:0044320)|detection of glucose (GO:0051594)|endocrine pancreas development (GO:0031018)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glucose transport (GO:0015758)|glycogen biosynthetic process (GO:0005978)|glycolytic process (GO:0006096)|hexose transport (GO:0008645)|NADP metabolic process (GO:0006739)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of gluconeogenesis (GO:0045721)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of glycolytic process (GO:0045821)|positive regulation of insulin secretion (GO:0032024)|positive regulation of phosphorylation (GO:0042327)|regulation of glucose transport (GO:0010827)|regulation of glycolytic process (GO:0006110)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transport (GO:0043266)|second-messenger-mediated signaling (GO:0019932)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|secretory granule (GO:0030141)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|glucokinase activity (GO:0004340)|glucose binding (GO:0005536)|magnesium ion binding (GO:0000287)			central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(17)|prostate(2)|skin(7)|stomach(1)|urinary_tract(1)	37						GGTCGAGGGTCGCAGCCCCAG	0.697																																					p.R359P		.											.	GCK-416	0			c.G1076C						.						30.0	34.0	33.0					7																	44185276		2203	4299	6502	SO:0001583	missense	2645	exon9			GAGGGTCGCAGCC	AF041014	CCDS5479.1, CCDS5480.1, CCDS5481.1	7p15.3-p15.1	2008-02-07	2008-02-07		ENSG00000106633	ENSG00000106633	2.7.1.2, 2.7.1.1		4195	protein-coding gene	gene with protein product		138079	"""maturity onset diabetes of the young 2"""	MODY2		1740341, 1502186	Standard	NM_033507		Approved	HK4	uc003tkk.1	P35557	OTTHUMG00000022903	ENST00000403799.3:c.1073G>C	7.37:g.44185276C>G	ENSP00000384247:p.Arg358Pro	60	0		70	27	NM_033507	0	0	0	0	0	A4D2J2|A4D2J3|Q05810	Missense_Mutation	SNP	ENST00000403799.3	37	CCDS5479.1	.	.	.	.	.	.	.	.	.	.	C	11.13	1.547708	0.27652	.	.	ENSG00000106633	ENST00000336642;ENST00000403799;ENST00000395796;ENST00000345378;ENST00000437084	D;D;D;D;D	0.98044	-4.68;-4.68;-4.68;-4.68;-4.68	5.2	4.22	0.49857	Hexokinase, C-terminal (1);	0.488216	0.21760	N	0.069537	D	0.92961	0.7760	N	0.17248	0.465	0.36805	D	0.885564	B;B;B;B;B	0.32128	0.357;0.0;0.308;0.0;0.357	B;B;B;B;B	0.34536	0.094;0.001;0.185;0.003;0.094	D	0.91899	0.5530	10	0.34782	T	0.22	-12.1896	7.8212	0.29288	0.2196:0.6875:0.0:0.0928	.	358;359;357;341;358	P35557;P35557-2;P35557-3;C9JQD1;A7LFL1	HXK4_HUMAN;.;.;.;.	P	42;358;357;359;341	ENSP00000338009:R42P;ENSP00000384247:R358P;ENSP00000379142:R357P;ENSP00000223366:R359P;ENSP00000402840:R341P	ENSP00000338009:R42P	R	-	2	0	GCK	44151801	0.070000	0.21116	0.955000	0.39395	0.307000	0.27823	1.831000	0.39141	2.403000	0.81681	0.462000	0.41574	CGA	.		0.697	GCK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251069.2		
POM121C	100101267	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	75070316	75070316	+	Missense_Mutation	SNP	A	A	C			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr7:75070316A>C	ENST00000257665.5	-	3	868	c.869T>G	c.(868-870)cTg>cGg	p.L290R	POM121C_ENST00000453279.2_Missense_Mutation_p.L48R			A8CG34	P121C_HUMAN	POM121 transmembrane nucleoporin C	290	Pore side. {ECO:0000255}.|Required for targeting to the nucleus and nuclear pore complex.				mRNA transport (GO:0051028)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|nuclear pore (GO:0005643)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|skin(1)|urinary_tract(1)	14						GAGGGCACTCAGTACAGTCTC	0.438																																					p.L48R		.											.	.	0			c.T143G						.						141.0	153.0	149.0					7																	75070316		2203	4298	6501	SO:0001583	missense	100101267	exon5			GCACTCAGTACAG		CCDS47617.1	7q11.23	2012-03-13	2012-03-13		ENSG00000135213	ENSG00000272391			34005	protein-coding gene	gene with protein product		615754	"""POM121 membrane glycoprotein C"""			17900573	Standard	NM_001099415		Approved		uc003udk.4	A8CG34	OTTHUMG00000156238	ENST00000257665.5:c.869T>G	7.37:g.75070316A>C	ENSP00000257665:p.Leu290Arg	146	0		138	33	NM_001099415	0	0	30	46	16	O75115|Q9Y2N3|Q9Y4S7	Missense_Mutation	SNP	ENST00000257665.5	37		.	.	.	.	.	.	.	.	.	.	A	13.49	2.253891	0.39896	.	.	ENSG00000135213	ENST00000257665;ENST00000453279	T;T	0.39229	2.64;1.09	4.27	3.09	0.35607	.	0.499492	0.14888	N	0.292593	T	0.62233	0.2411	M	0.81497	2.545	0.44142	D	0.996934	D	0.89917	1.0	D	0.74674	0.984	T	0.60767	-0.7198	10	0.87932	D	0	.	8.0021	0.30304	0.8181:0.0:0.0:0.1819	.	290	A8CG34	P121C_HUMAN	R	290;48	ENSP00000257665:L290R;ENSP00000414208:L48R	ENSP00000257665:L290R	L	-	2	0	POM121C	74908252	1.000000	0.71417	0.998000	0.56505	0.211000	0.24417	6.656000	0.74396	0.601000	0.29879	-0.676000	0.03789	CTG	.		0.438	POM121C-003	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000343919.2	NM_001099415	
ZAN	7455	ucsc.edu	37	7	100349991	100349991	+	RNA	SNP	T	T	C	rs560599163	byFrequency	TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr7:100349991T>C	ENST00000348028.3	+	0	2428				ZAN_ENST00000427578.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000421100.1_RNA|ZAN_ENST00000349350.6_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.S755P(5)		NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			ACCCACCATCTCCCCAGAAAA	0.517													t|||	35	0.00698882	0.0038	0.0101	5008	,	,		14901	0.005		0.0129	False		,,,				2504	0.0051				.													.	ZAN-142	5	Substitution - Missense(5)	endometrium(4)|NS(1)	.						.						122.0	136.0	131.0					7																	100349991		1816	4060	5876			7455	.			ACCATCTCCCCAG	U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100349991T>C		149	27		142	34	.	0	0	0	0	0	A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Missense_Mutation	SNP	ENST00000348028.3	37		.	.	.	.	.	.	.	.	.	.	t	5.435	0.265377	0.10294	.	.	ENSG00000146839	ENST00000546292;ENST00000538115;ENST00000542585	T;T;T	0.63255	-0.03;0.11;-0.03	4.24	0.21	0.15231	.	.	.	.	.	T	0.29716	0.0742	N	0.01140	-0.99	0.09310	N	0.999997	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.20571	-1.0271	9	0.33940	T	0.23	.	7.9077	0.29771	0.0:0.5221:0.0:0.4779	.	755;755	F5H0T8;Q9Y493	.;ZAN_HUMAN	P	755	ENSP00000445943:S755P;ENSP00000445091:S755P;ENSP00000444427:S755P	ENSP00000423579:S755P	S	+	1	0	ZAN	100187927	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.770000	0.00371	-0.086000	0.12550	-0.766000	0.03442	TCC	.		0.517	ZAN-006	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000347214.1	NM_003386	
ATP6V0A4	50617	broad.mit.edu	37	7	138394418	138394418	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr7:138394418G>T	ENST00000310018.2	-	21	2662	c.2380C>A	c.(2380-2382)Ctg>Atg	p.L794M	ATP6V0A4_ENST00000393054.1_Missense_Mutation_p.L794M|ATP6V0A4_ENST00000353492.4_Missense_Mutation_p.L794M	NM_020632.2|NM_130840.2	NP_065683.2|NP_570855.2	Q9HBG4	VPP4_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a4	794					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|excretion (GO:0007588)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|ossification (GO:0001503)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|regulation of pH (GO:0006885)|sensory perception of sound (GO:0007605)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	ATPase binding (GO:0051117)|hydrogen ion transmembrane transporter activity (GO:0015078)			NS(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(15)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36						TCCATGATCAGAAGGATGGCT	0.537																																					p.L794M													.	ATP6V0A4-91	0			c.C2380A						.						176.0	173.0	174.0					7																	138394418		2203	4300	6503	SO:0001583	missense	50617	exon20			TGATCAGAAGGAT	AF245517	CCDS5849.1	7q34	2011-06-09	2006-01-20	2002-05-10	ENSG00000105929	ENSG00000105929		"""ATPases / V-type"""	866	protein-coding gene	gene with protein product		605239	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) non-catalytic accessory protein 1B"", ""ATPase, H+ transporting, lysosomal V0 subunit a isoform 4"", ""ATPase, H+ transporting, lysosomal V0 subunit A4"""	ATP6N1B, ATP6N2, RTA1C		10577919, 10973252	Standard	XM_005250393		Approved	RDRTA2, VPP2, RTADR, a4, Vph1, Stv1	uc003vuf.3	Q9HBG4	OTTHUMG00000157122	ENST00000310018.2:c.2380C>A	7.37:g.138394418G>T	ENSP00000308122:p.Leu794Met	155	0		163	6	NM_130841	0	0	0	0	0	A4D1R4|A8KA80|Q32M47	Missense_Mutation	SNP	ENST00000310018.2	37	CCDS5849.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.301168	0.81136	.	.	ENSG00000105929	ENST00000310018;ENST00000393054;ENST00000353492	D;D;D	0.87179	-2.22;-2.22;-2.22	5.71	4.82	0.62117	.	0.000000	0.64402	D	0.000009	D	0.91700	0.7376	L	0.57130	1.785	0.53005	D	0.999968	D	0.89917	1.0	D	0.87578	0.998	D	0.91877	0.5512	10	0.62326	D	0.03	-24.8445	14.9831	0.71327	0.0693:0.0:0.9307:0.0	.	794	Q9HBG4	VPP4_HUMAN	M	794	ENSP00000308122:L794M;ENSP00000376774:L794M;ENSP00000253856:L794M	ENSP00000308122:L794M	L	-	1	2	ATP6V0A4	138044958	1.000000	0.71417	0.344000	0.25628	0.995000	0.86356	6.461000	0.73522	2.694000	0.91930	0.655000	0.94253	CTG	.		0.537	ATP6V0A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347514.1	NM_020632	
DPP6	1804	broad.mit.edu	37	7	153750140	153750140	+	Missense_Mutation	SNP	G	G	A			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr7:153750140G>A	ENST00000377770.3	+	1	376	c.235G>A	c.(235-237)Gag>Aag	p.E79K	AC006019.3_ENST00000425591.1_RNA|DPP6_ENST00000404039.1_Intron|DPP6_ENST00000406326.1_Missense_Mutation_p.E79K			P42658	DPP6_HUMAN	dipeptidyl-peptidase 6	79					cell death (GO:0008219)|neuronal action potential (GO:0019228)|positive regulation of potassium ion transmembrane transport (GO:1901381)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)			NS(3)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(35)|pancreas(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	71	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			CGATGGTGACGAGGAGGACGT	0.776																																					p.E79K	NSCLC(125;1384 1783 2490 7422 34254)												.	DPP6-652	0			c.G235A						.						1.0	2.0	2.0					7																	153750140		201	467	668	SO:0001583	missense	1804	exon1			GGTGACGAGGAGG	M96859	CCDS75682.1, CCDS75683.1, CCDS75684.1	7q36.2	2006-08-07	2006-01-12		ENSG00000130226	ENSG00000130226			3010	protein-coding gene	gene with protein product		126141	"""dipeptidylpeptidase VI"", ""dipeptidylpeptidase 6"""			1729689	Standard	XM_006715871		Approved	DPPX	uc003wlk.3	P42658	OTTHUMG00000151511	ENST00000377770.3:c.235G>A	7.37:g.153750140G>A	ENSP00000367001:p.Glu79Lys	23	0		19	5	NM_130797	0	0	0	0	0		Missense_Mutation	SNP	ENST00000377770.3	37		.	.	.	.	.	.	.	.	.	.	g	12.16	1.855547	0.32791	.	.	ENSG00000130226	ENST00000406326;ENST00000377770	T;T	0.41065	1.01;1.01	3.42	3.42	0.39159	.	4.209170	0.00883	N	0.002150	T	0.29321	0.0730	.	.	.	0.80722	D	1	B;P	0.38745	0.003;0.645	B;B	0.26614	0.001;0.071	T	0.26467	-1.0102	9	0.18710	T	0.47	-8.5179	14.2438	0.65975	0.0:0.0:1.0:0.0	.	79;79	P42658;Q8IYG9	DPP6_HUMAN;.	K	79	ENSP00000384393:E79K;ENSP00000367001:E79K	ENSP00000367001:E79K	E	+	1	0	DPP6	153381073	1.000000	0.71417	0.993000	0.49108	0.028000	0.11728	5.170000	0.64990	1.635000	0.50512	0.549000	0.68633	GAG	.		0.776	DPP6-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000322932.1	NM_130797	
MYOM2	9172	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	2020508	2020508	+	Missense_Mutation	SNP	G	G	C			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr8:2020508G>C	ENST00000262113.4	+	9	1018	c.877G>C	c.(877-879)Gag>Cag	p.E293Q	MYOM2_ENST00000523438.1_Intron	NM_003970.2	NP_003961.2	P54296	MYOM2_HUMAN	myomesin 2	293	Ig-like C2-type 2.				muscle contraction (GO:0006936)	M band (GO:0031430)|mitochondrion (GO:0005739)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			autonomic_ganglia(2)|breast(4)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(11)|kidney(2)|large_intestine(17)|lung(39)|ovary(5)|prostate(1)|skin(10)|upper_aerodigestive_tract(3)	104		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		GAGGGAAGGCGAGACGGTCAC	0.602																																					p.E293Q		.											.	MYOM2-95	0			c.G877C						.						85.0	70.0	75.0					8																	2020508		2203	4300	6503	SO:0001583	missense	9172	exon9			GAAGGCGAGACGG		CCDS5957.1	8p23.3	2014-06-06	2012-10-17		ENSG00000036448	ENSG00000036448		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7614	protein-coding gene	gene with protein product		603509	"""myomesin (M-protein) 2 (165kD)"", ""myomesin (M-protein) 2, 165kDa"""				Standard	XM_006716237		Approved		uc003wpx.4	P54296	OTTHUMG00000129175	ENST00000262113.4:c.877G>C	8.37:g.2020508G>C	ENSP00000262113:p.Glu293Gln	37	0		29	9	NM_003970	0	0	0	0	0	Q7Z3Y2	Missense_Mutation	SNP	ENST00000262113.4	37	CCDS5957.1	.	.	.	.	.	.	.	.	.	.	G	17.83	3.485155	0.63962	.	.	ENSG00000036448	ENST00000262113	T	0.46063	0.88	5.13	4.25	0.50352	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.208574	0.40818	N	0.001006	T	0.46308	0.1386	M	0.63843	1.955	0.80722	D	1	B	0.29136	0.234	B	0.34180	0.177	T	0.50206	-0.8855	10	0.72032	D	0.01	.	15.6628	0.77203	0.0:0.1376:0.8624:0.0	.	293	P54296	MYOM2_HUMAN	Q	293	ENSP00000262113:E293Q	ENSP00000262113:E293Q	E	+	1	0	MYOM2	2007915	1.000000	0.71417	0.800000	0.32199	0.700000	0.40528	4.275000	0.58927	1.132000	0.42129	0.655000	0.94253	GAG	.		0.602	MYOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251249.1	NM_003970	
LOXL2	4017	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	23198538	23198538	+	Missense_Mutation	SNP	G	G	A			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr8:23198538G>A	ENST00000389131.3	-	4	1079	c.710C>T	c.(709-711)cCt>cTt	p.P237L	RP11-177H13.2_ENST00000519692.1_RNA	NM_002318.2	NP_002309.1	Q9Y4K0	LOXL2_HUMAN	lysyl oxidase-like 2	237	SRCR 2. {ECO:0000255|PROSITE- ProRule:PRU00196}.				aging (GO:0007568)|cell adhesion (GO:0007155)|cellular protein modification process (GO:0006464)|collagen fibril organization (GO:0030199)|endothelial cell migration (GO:0043542)|endothelial cell proliferation (GO:0001935)|epithelial to mesenchymal transition (GO:0001837)|histone modification (GO:0016570)|negative regulation of transcription, DNA-templated (GO:0045892)|oxidation-reduction process (GO:0055114)|positive regulation of chondrocyte differentiation (GO:0032332)|protein deamination (GO:0018277)|response to copper ion (GO:0046688)|response to hypoxia (GO:0001666)|sprouting angiogenesis (GO:0002040)|transcription, DNA-templated (GO:0006351)	basement membrane (GO:0005604)|chromosome (GO:0005694)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|electron carrier activity (GO:0009055)|methylated histone binding (GO:0035064)|oligosaccharide binding (GO:0070492)|protein-lysine 6-oxidase activity (GO:0004720)|scavenger receptor activity (GO:0005044)|transcription corepressor activity (GO:0003714)			breast(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(5)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		Prostate(55;0.0453)|Breast(100;0.143)		Colorectal(74;0.0288)|COAD - Colon adenocarcinoma(73;0.096)		CCTCTCCCCAGGGAAGCCAAA	0.537																																					p.P237L		.											.	LOXL2-272	0			c.C710T						.						163.0	132.0	142.0					8																	23198538		2203	4300	6503	SO:0001583	missense	4017	exon4			TCCCCAGGGAAGC	U89942	CCDS34864.1	8p21.3	2008-05-15				ENSG00000134013			6666	protein-coding gene	gene with protein product		606663				9722957	Standard	NM_002318		Approved	WS9-14	uc003xdh.1	Q9Y4K0		ENST00000389131.3:c.710C>T	8.37:g.23198538G>A	ENSP00000373783:p.Pro237Leu	45	0		45	15	NM_002318	0	0	0	0	0	B2R5Q0|Q53HV3|Q9BW70|Q9Y5Y8	Missense_Mutation	SNP	ENST00000389131.3	37	CCDS34864.1	.	.	.	.	.	.	.	.	.	.	G	19.94	3.920583	0.73213	.	.	ENSG00000134013	ENST00000389131	T	0.60424	0.19	5.83	5.83	0.93111	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	0.047123	0.85682	D	0.000000	T	0.78381	0.4274	M	0.83118	2.625	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	T	0.80636	-0.1294	10	0.72032	D	0.01	.	16.8345	0.85953	0.0:0.0:1.0:0.0	.	237	Q9Y4K0	LOXL2_HUMAN	L	237	ENSP00000373783:P237L	ENSP00000373783:P237L	P	-	2	0	LOXL2	23254483	1.000000	0.71417	0.975000	0.42487	0.192000	0.23643	9.751000	0.98889	2.750000	0.94351	0.655000	0.94253	CCT	.		0.537	LOXL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375603.1		
EXOSC4	54512	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	145134932	145134932	+	Silent	SNP	C	C	T			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr8:145134932C>T	ENST00000316052.5	+	2	361	c.258C>T	c.(256-258)cgC>cgT	p.R86R	GPAA1_ENST00000361036.6_5'Flank|EXOSC4_ENST00000525936.1_Intron|GPAA1_ENST00000355091.4_5'Flank|CTD-3065J16.9_ENST00000524499.1_RNA	NM_019037.2	NP_061910.1	Q9NPD3	EXOS4_HUMAN	exosome component 4	86					defense response to virus (GO:0051607)|DNA deamination (GO:0045006)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|maturation of 5.8S rRNA (GO:0000460)|mRNA metabolic process (GO:0016071)|nuclear mRNA surveillance (GO:0071028)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|positive regulation of cell growth (GO:0030307)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	3'-5'-exoribonuclease activity (GO:0000175)|AU-rich element binding (GO:0017091)			lung(4)|prostate(1)|upper_aerodigestive_tract(2)	7	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;3.48e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CAGGTGAGCGCAAGCGACGGC	0.627																																					p.R86R		.											.	EXOSC4-90	0			c.C258T						.						84.0	83.0	83.0					8																	145134932		2203	4300	6503	SO:0001819	synonymous_variant	54512	exon2			TGAGCGCAAGCGA	AF281133	CCDS6414.1	8q24.3	2004-03-26			ENSG00000178896	ENSG00000178896			18189	protein-coding gene	gene with protein product	"""exosome component Rrp41"""	606491				11110791	Standard	NM_019037		Approved	hRrp41p, FLJ20591, Rrp41p, RRP41, RRP41A, Ski6p, SKI6, p12A	uc003zau.3	Q9NPD3	OTTHUMG00000165437	ENST00000316052.5:c.258C>T	8.37:g.145134932C>T		86	0		118	40	NM_019037	0	0	17	33	16		Silent	SNP	ENST00000316052.5	37	CCDS6414.1																																																																																			.		0.627	EXOSC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384065.1	NM_019037	
SLC39A4	55630	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	145640398	145640398	+	Missense_Mutation	SNP	G	G	T	rs200044971		TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr8:145640398G>T	ENST00000301305.3	-	4	869	c.764C>A	c.(763-765)cCc>cAc	p.P255H	SLC39A4_ENST00000276833.5_Missense_Mutation_p.P230H|SLC39A4_ENST00000531013.1_5'Flank	NM_130849.2	NP_570901	Q6P5W5	S39A4_HUMAN	solute carrier family 39 (zinc transporter), member 4	255					cellular response to zinc ion starvation (GO:0034224)|cellular zinc ion homeostasis (GO:0006882)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	zinc ion transmembrane transporter activity (GO:0005385)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	14	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;1.12e-40)|all cancers(56;8.17e-36)|BRCA - Breast invasive adenocarcinoma(115;0.0407)|Colorectal(110;0.055)			GCTGATGAGGGGCACAGGGTC	0.672																																					p.P255H		.											.	SLC39A4-90	0			c.C764A						.						40.0	45.0	43.0					8																	145640398		2203	4300	6503	SO:0001583	missense	55630	exon4			ATGAGGGGCACAG	AK025537	CCDS6424.1, CCDS43782.1	8q24.3	2013-05-22			ENSG00000147804	ENSG00000147804		"""Solute carriers"""	17129	protein-coding gene	gene with protein product		607059	"""acrodermatitis enteropathica, zinc-deficiency type"""	AEZ		12801924, 12659941, 14709598	Standard	NM_017767		Approved	ZIP4, AWMS2	uc003zcq.3	Q6P5W5		ENST00000301305.3:c.764C>A	8.37:g.145640398G>T	ENSP00000301305:p.Pro255His	32	0		38	15	NM_130849	0	0	0	0	0	Q7L5S5|Q9H6T8|Q9NXC4	Missense_Mutation	SNP	ENST00000301305.3	37	CCDS6424.1	.	.	.	.	.	.	.	.	.	.	G	15.50	2.850768	0.51270	.	.	ENSG00000147804	ENST00000276833;ENST00000301305;ENST00000526658	T;T;T	0.57436	0.4;0.4;0.4	5.0	-4.46	0.03536	.	3.799390	0.00575	N	0.000304	T	0.39989	0.1099	L	0.47716	1.5	0.09310	N	1	B;B	0.18461	0.028;0.028	B;B	0.16722	0.016;0.016	T	0.09662	-1.0664	10	0.38643	T	0.18	-5.3671	0.812	0.01095	0.3985:0.1207:0.2362:0.2446	.	255;230	Q6P5W5;A6NDY5	S39A4_HUMAN;.	H	230;255;161	ENSP00000276833:P230H;ENSP00000301305:P255H;ENSP00000434512:P161H	ENSP00000276833:P230H	P	-	2	0	SLC39A4	145611206	0.002000	0.14202	0.000000	0.03702	0.037000	0.13140	-0.570000	0.05895	-0.723000	0.04915	-0.320000	0.08662	CCC	G|0.998;A|0.002		0.672	SLC39A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382688.1		
TTC39B	158219	broad.mit.edu	37	9	15190552	15190552	+	Splice_Site	SNP	C	C	G			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr9:15190552C>G	ENST00000512701.2	-	11	1141	c.1105G>C	c.(1105-1107)Ggt>Cgt	p.G369R	TTC39B_ENST00000541445.1_Intron|TTC39B_ENST00000355694.2_Splice_Site_p.G303R|TTC39B_ENST00000380850.4_Splice_Site_p.G369R|TTC39B_ENST00000297615.5_Splice_Site_p.G300R|TTC39B_ENST00000507285.1_Splice_Site_p.G204R|TTC39B_ENST00000507993.1_Splice_Site_p.G204R			Q5VTQ0	TT39B_HUMAN	tetratricopeptide repeat domain 39B	369										NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)	21						CAGATCTTACCAAGTATTAGG	0.453																																					p.G369R													.	TTC39B-187	0			c.G1105C						.						86.0	80.0	82.0					9																	15190552		2203	4300	6503	SO:0001630	splice_region_variant	158219	exon11			TCTTACCAAGTAT	AK091187	CCDS6477.1, CCDS6477.2, CCDS55294.1, CCDS55295.1, CCDS55296.1	9p22.2	2013-01-11	2008-06-23	2008-06-23	ENSG00000155158	ENSG00000155158		"""Tetratricopeptide (TTC) repeat domain containing"""	23704	protein-coding gene	gene with protein product		613574	"""chromosome 9 open reading frame 52"""	C9orf52			Standard	NM_001168339		Approved	FLJ33868	uc003zlr.2	Q5VTQ0	OTTHUMG00000019581	ENST00000512701.2:c.1105+1G>C	9.37:g.15190552C>G		73	0		64	5	NM_001168340	0	0	0	0	0	A5PLN1|B4DQ10|B4DQX4|B4DW93|Q8IVR7|Q8IXZ6|Q8N267	Missense_Mutation	SNP	ENST00000512701.2	37	CCDS6477.2	.	.	.	.	.	.	.	.	.	.	C	33	5.210679	0.95069	.	.	ENSG00000155158	ENST00000380850;ENST00000297615;ENST00000355694;ENST00000512701;ENST00000507285;ENST00000507993	T;T;T;T;T;T	0.48201	0.82;0.82;0.82;0.82;0.82;0.82	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	T	0.74419	0.3714	M	0.86097	2.795	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;0.996;0.996	T	0.74850	-0.3524	9	.	.	.	-12.0584	20.5666	0.99351	0.0:1.0:0.0:0.0	.	300;369;369;301;303	F5H705;E9PAQ9;E9PE60;A5PLN1;Q5VTQ0	.;.;.;.;TT39B_HUMAN	R	369;300;303;369;204;204	ENSP00000370231:G369R;ENSP00000297615:G300R;ENSP00000347920:G303R;ENSP00000422496:G369R;ENSP00000426539:G204R;ENSP00000423392:G204R	.	G	-	1	0	TTC39B	15180552	1.000000	0.71417	0.997000	0.53966	0.841000	0.47740	7.359000	0.79477	2.854000	0.98071	0.655000	0.94253	GGT	.		0.453	TTC39B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051758.3	NM_152574	Missense_Mutation
CCDC171	203238	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	15729747	15729747	+	Missense_Mutation	SNP	T	T	C			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr9:15729747T>C	ENST00000380701.3	+	16	2328	c.2000T>C	c.(1999-2001)cTa>cCa	p.L667P	CCDC171_ENST00000297641.3_Missense_Mutation_p.L667P	NM_173550.2	NP_775821.2	Q6TFL3	CC171_HUMAN	coiled-coil domain containing 171	667																	AAGAAGGAACTAGAGCTGCAG	0.463																																					p.L667P		.											.	.	0			c.T2000C						.						96.0	99.0	98.0					9																	15729747		2203	4299	6502	SO:0001583	missense	203238	exon16			AGGAACTAGAGCT	AY422473	CCDS6481.1	9p22.2	2012-03-26	2012-03-26	2012-03-26	ENSG00000164989	ENSG00000164989			29828	protein-coding gene	gene with protein product	"""myosin tail domain containing protein"""		"""chromosome 9 open reading frame 93"""	C9orf93		14702039	Standard	NM_173550		Approved	FLJ39267, FLJ46740, Em:AL513423.1, bA778P13.1, bA536D16.1	uc003zmd.3	Q6TFL3	OTTHUMG00000019584	ENST00000380701.3:c.2000T>C	9.37:g.15729747T>C	ENSP00000370077:p.Leu667Pro	101	0		120	35	NM_173550	0	0	1	1	0	B7ZM22|Q5SU58|Q6P1W1|Q6ZR13|Q8N1Z4|Q8N8L3|Q8TBR2	Missense_Mutation	SNP	ENST00000380701.3	37	CCDS6481.1	.	.	.	.	.	.	.	.	.	.	T	16.14	3.037598	0.54896	.	.	ENSG00000164989	ENST00000297641;ENST00000380701	T;T	0.25912	1.77;1.77	5.61	5.61	0.85477	.	0.250009	0.33650	N	0.004693	T	0.39253	0.1071	L	0.27053	0.805	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.76575	0.988;0.982;0.982	T	0.30563	-0.9974	10	0.72032	D	0.01	-6.1701	15.7924	0.78376	0.0:0.0:0.0:1.0	.	675;667;667	B7ZM22;Q6TFL3-3;Q6TFL3	.;.;CI093_HUMAN	P	667	ENSP00000297641:L667P;ENSP00000370077:L667P	ENSP00000297641:L667P	L	+	2	0	C9orf93	15719747	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	5.833000	0.69349	2.130000	0.65690	0.477000	0.44152	CTA	.		0.463	CCDC171-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051768.4	NM_173550	
TLN1	7094	broad.mit.edu;bcgsc.ca	37	9	35698339	35698339	+	Missense_Mutation	SNP	T	T	G			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr9:35698339T>G	ENST00000314888.9	-	55	7705	c.7352A>C	c.(7351-7353)gAg>gCg	p.E2451A	TLN1_ENST00000540444.1_Missense_Mutation_p.E2339A	NM_006289.3	NP_006280.3	Q9Y490	TLN1_HUMAN	talin 1	2451	I/LWEQ. {ECO:0000255|PROSITE- ProRule:PRU00292}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-cell junction assembly (GO:0007043)|cell-substrate junction assembly (GO:0007044)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|cortical actin cytoskeleton organization (GO:0030866)|cytoskeletal anchoring at plasma membrane (GO:0007016)|endoplasmic reticulum unfolded protein response (GO:0030968)|muscle contraction (GO:0006936)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	integrin binding (GO:0005178)|LIM domain binding (GO:0030274)|structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)			NS(2)|breast(8)|central_nervous_system(2)|endometrium(10)|kidney(5)|large_intestine(9)|lung(32)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(6)	85	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			TTTCATTGCCTCCGAGTCCTG	0.542																																					p.E2451A													.	TLN1-609	0			c.A7352C						.						89.0	67.0	74.0					9																	35698339		2203	4300	6503	SO:0001583	missense	7094	exon55			ATTGCCTCCGAGT	AB028950	CCDS35009.1	9p23-p21	2008-02-05			ENSG00000137076	ENSG00000137076			11845	protein-coding gene	gene with protein product		186745		TLN		7635475, 10610730	Standard	NM_006289		Approved	ILWEQ	uc003zxt.2	Q9Y490	OTTHUMG00000019874	ENST00000314888.9:c.7352A>C	9.37:g.35698339T>G	ENSP00000316029:p.Glu2451Ala	50	0		48	4	NM_006289	0	0	162	174	12	A6NMY0|Q86YD0|Q9NZQ2|Q9UHH8|Q9UPX3	Missense_Mutation	SNP	ENST00000314888.9	37	CCDS35009.1	.	.	.	.	.	.	.	.	.	.	T	14.90	2.673464	0.47781	.	.	ENSG00000137076	ENST00000314888;ENST00000540444	T;T	0.44083	0.93;0.93	4.94	4.94	0.65067	I/LWEQ (4);	0.307466	0.35555	N	0.003124	T	0.37598	0.1009	L	0.42245	1.32	0.48341	D	0.999636	B	0.14805	0.011	B	0.22880	0.042	T	0.15263	-1.0443	10	0.34782	T	0.22	-25.864	14.4791	0.67567	0.0:0.0:0.0:1.0	.	2451	Q9Y490	TLN1_HUMAN	A	2451;2339	ENSP00000316029:E2451A;ENSP00000442981:E2339A	ENSP00000316029:E2451A	E	-	2	0	TLN1	35688339	1.000000	0.71417	0.996000	0.52242	0.930000	0.56654	7.802000	0.85969	2.087000	0.62958	0.529000	0.55759	GAG	.		0.542	TLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052353.2	NM_006289	
NPR2	4882	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	35792786	35792786	+	Silent	SNP	T	T	C			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr9:35792786T>C	ENST00000342694.2	+	1	636	c.381T>C	c.(379-381)tcT>tcC	p.S127S		NM_003995.3	NP_003986.2	P20594	ANPRB_HUMAN	natriuretic peptide receptor 2	127					bone development (GO:0060348)|cell surface receptor signaling pathway (GO:0007166)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cGMP biosynthetic process (GO:0006182)|intracellular signal transduction (GO:0035556)|negative regulation of meiotic cell cycle (GO:0051447)|negative regulation of oocyte maturation (GO:1900194)|ossification (GO:0001503)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|signal transduction (GO:0007165)|single organism reproductive process (GO:0044702)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(2)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)		Erythrityl Tetranitrate(DB01613)|Nesiritide(DB04899)	CTGTGGCCTCTGGTTTTTCGG	0.602																																					p.S127S		.											.	NPR2-335	0			c.T381C						.						125.0	106.0	112.0					9																	35792786		2203	4300	6503	SO:0001819	synonymous_variant	4882	exon1			GGCCTCTGGTTTT	AJ005282	CCDS6590.1	9p21-p12	2014-03-03	2014-03-03		ENSG00000159899	ENSG00000159899			7944	protein-coding gene	gene with protein product	"""guanylate cyclase B"""	108961	"""acromesomelic dysplasia, Maroteaux type"", ""atrionatriuretic peptide receptor B"", ""natriuretic peptide receptor B"""	ANPRB, NPRB, AMDM		9634515, 15146390	Standard	XM_005251478		Approved	GUCY2B, ANPb	uc003zyd.3	P20594	OTTHUMG00000019871	ENST00000342694.2:c.381T>C	9.37:g.35792786T>C		67	0		70	14	NM_003995	0	0	8	13	5	B0ZBF2|B0ZBF3|D3DRP3|D3DRP4|O60871|Q4VAK7|Q5TCV2|Q8TA93|Q9UQ50	Silent	SNP	ENST00000342694.2	37	CCDS6590.1																																																																																			.		0.602	NPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052345.1		
OR1N2	138882	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	125315955	125315955	+	Silent	SNP	C	C	T			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr9:125315955C>T	ENST00000373688.2	+	1	565	c.507C>T	c.(505-507)acC>acT	p.T169T		NM_001004457.1	NP_001004457.1	Q8NGR9	OR1N2_HUMAN	olfactory receptor, family 1, subfamily N, member 2	169						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|large_intestine(6)|lung(10)|ovary(2)|skin(3)|stomach(3)	26						GGGTGCTAACCAACTGTCCTG	0.532																																					p.T169T		.											.	OR1N2-72	0			c.C507T						.						141.0	123.0	129.0					9																	125315955		2203	4300	6503	SO:0001819	synonymous_variant	138882	exon1			GCTAACCAACTGT		CCDS35123.1	9q33.2	2013-09-20			ENSG00000171501	ENSG00000171501		"""GPCR / Class A : Olfactory receptors"""	15111	protein-coding gene	gene with protein product							Standard	NM_001004457		Approved		uc011lyx.2	Q8NGR9	OTTHUMG00000020607	ENST00000373688.2:c.507C>T	9.37:g.125315955C>T		44	0		48	19	NM_001004457	0	0	0	0	0	A3KFM2|B2RNY4|Q6IF17|Q96RA3	Silent	SNP	ENST00000373688.2	37	CCDS35123.1																																																																																			.		0.532	OR1N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053937.2		
MED27	9442	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	134889753	134889753	+	Silent	SNP	A	A	G			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr9:134889753A>G	ENST00000292035.5	-	3	513	c.450T>C	c.(448-450)gcT>gcC	p.A150A	MED27_ENST00000357028.2_Silent_p.A150A	NM_004269.3	NP_004260.2	Q6P2C8	MED27_HUMAN	mediator complex subunit 27	150					gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|mediator complex (GO:0016592)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	transcription coactivator activity (GO:0003713)			breast(1)|endometrium(4)|kidney(3)|large_intestine(3)|lung(5)|skin(1)|urinary_tract(1)	18		Myeloproliferative disorder(178;0.206)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000193)		TTGTGGGCTGAGCCTTTGGTC	0.428																																					p.A150A	Colon(41;784 923 6932 42329 52483)	.											.	MED27-69	0			c.T450C						.						152.0	129.0	137.0					9																	134889753		2203	4300	6503	SO:0001819	synonymous_variant	9442	exon3			GGGCTGAGCCTTT	AF104252	CCDS6945.1, CCDS59153.1, CCDS69689.1	9q34.13	2008-02-05	2007-07-30	2007-07-30	ENSG00000160563	ENSG00000160563			2377	protein-coding gene	gene with protein product		605044	"""cofactor required for Sp1 transcriptional activation, subunit 8, 34kDa"""	CRSP8		9989412	Standard	NM_004269		Approved	TRAP37, CRSP34	uc004cbe.2	Q6P2C8	OTTHUMG00000020833	ENST00000292035.5:c.450T>C	9.37:g.134889753A>G		134	0		80	12	NM_001253881	0	0	6	14	8	O95401|Q4F964|Q5VTA4|Q5VTA5|Q9BU57|Q9NYR4|V9GYV9	Silent	SNP	ENST00000292035.5	37	CCDS6945.1																																																																																			.		0.428	MED27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054770.2	NM_004269	
IL1RAPL1	11141	broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	29973429	29973429	+	Missense_Mutation	SNP	A	A	C			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chrX:29973429A>C	ENST00000378993.1	+	11	2256	c.1583A>C	c.(1582-1584)aAg>aCg	p.K528T	IL1RAPL1_ENST00000302196.4_Missense_Mutation_p.K528T	NM_014271.3	NP_055086.1	Q9NZN1	IRPL1_HUMAN	interleukin 1 receptor accessory protein-like 1	528	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				calcium ion transmembrane transport (GO:0070588)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of exocytosis (GO:0045920)|neuron differentiation (GO:0030182)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor binding (GO:0005102)|voltage-gated calcium channel activity (GO:0005245)			biliary_tract(1)|breast(1)|endometrium(5)|large_intestine(9)|lung(38)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62						GAGGCCCTGAAGCACACCATC	0.413																																					p.K528T													.	IL1RAPL1-134	0			c.A1583C						.						61.0	57.0	59.0					X																	29973429		2202	4300	6502	SO:0001583	missense	11141	exon11			CCCTGAAGCACAC	AJ243874	CCDS14218.1	Xp22.1-p21.3	2013-01-29	2004-02-13		ENSG00000169306	ENSG00000169306		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5996	protein-coding gene	gene with protein product		300206	"""mental retardation, X-linked 34"", ""mental retardation, X-linked 21"", ""mental retardation, X-linked 10"""	IL1RAPL, MRX34, MRX21, MRX10		10471494, 10757639	Standard	NM_014271		Approved	OPHN4, TIGIRR-2, IL1R8	uc004dby.2	Q9NZN1	OTTHUMG00000021317	ENST00000378993.1:c.1583A>C	X.37:g.29973429A>C	ENSP00000368278:p.Lys528Thr	192	1		127	61	NM_014271	0	0	0	0	0	A0AVG4|Q9UJ53	Missense_Mutation	SNP	ENST00000378993.1	37	CCDS14218.1	.	.	.	.	.	.	.	.	.	.	A	16.50	3.139991	0.56936	.	.	ENSG00000169306	ENST00000378993;ENST00000302196	T;T	0.09723	2.95;2.95	5.69	5.69	0.88448	Toll/interleukin-1 receptor homology (TIR) domain (4);	0.000000	0.85682	D	0.000000	T	0.37972	0.1023	M	0.86028	2.79	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	T	0.31392	-0.9945	9	.	.	.	.	14.9698	0.71223	1.0:0.0:0.0:0.0	.	528	Q9NZN1	IRPL1_HUMAN	T	528	ENSP00000368278:K528T;ENSP00000305200:K528T	.	K	+	2	0	IL1RAPL1	29883350	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.962000	0.93254	1.918000	0.55548	0.486000	0.48141	AAG	.		0.413	IL1RAPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056155.1	NM_014271	
ERCC6L	54821	broad.mit.edu;bcgsc.ca	37	X	71427693	71427693	+	Silent	SNP	G	G	T			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chrX:71427693G>T	ENST00000334463.3	-	2	1059	c.924C>A	c.(922-924)gcC>gcA	p.A308A	PIN4_ENST00000423432.2_Intron|ERCC6L_ENST00000373657.1_Silent_p.A185A	NM_017669.2	NP_060139.2	Q2NKX8	ERC6L_HUMAN	excision repair cross-complementation group 6-like	308					mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			breast(2)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(9)|lung(9)|ovary(3)|skin(1)	38	Renal(35;0.156)					TAAATCCCAAGGCTTTTTCTC	0.388																																					p.A308A													.	ERCC6L-93	0			c.C924A						.						80.0	82.0	81.0					X																	71427693		2203	4299	6502	SO:0001819	synonymous_variant	54821	exon2			TCCCAAGGCTTTT	AK000112	CCDS35329.1	Xq13.1	2014-03-07	2014-03-07		ENSG00000186871	ENSG00000186871			20794	protein-coding gene	gene with protein product	"""PLK1-interacting checkpoint helicase"""	300687	"""excision repair cross-complementing rodent repair deficiency, complementation group 6-like"""			17218258	Standard	NM_017669		Approved	FLJ20105, PICH, RAD26L	uc004eaq.1	Q2NKX8	OTTHUMG00000021810	ENST00000334463.3:c.924C>A	X.37:g.71427693G>T		222	0		149	6	NM_017669	0	0	0	0	0	Q8NCI1|Q96H93|Q9NXQ8	Silent	SNP	ENST00000334463.3	37	CCDS35329.1																																																																																			.		0.388	ERCC6L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057174.2	NM_017669	
TCEAL4	79921	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	102841991	102841991	+	Missense_Mutation	SNP	A	A	G			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chrX:102841991A>G	ENST00000472745.1	+	3	940	c.388A>G	c.(388-390)Act>Gct	p.T130A	TCEAL4_ENST00000468024.1_Missense_Mutation_p.T130A|TCEAL4_ENST00000472484.1_Missense_Mutation_p.T130A|TCEAL4_ENST00000372629.4_Missense_Mutation_p.T273A|TCEAL4_ENST00000415568.2_Missense_Mutation_p.T130A|TCEAL4_ENST00000494801.1_Missense_Mutation_p.T130A			Q96EI5	TCAL4_HUMAN	transcription elongation factor A (SII)-like 4	130					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(2)|skin(2)	6						CAAAAGAAAAACTAATAAGGG	0.458																																					p.T130A		.											.	TCEAL4-130	0			c.A388G						.						103.0	105.0	104.0					X																	102841991		2203	4300	6503	SO:0001583	missense	79921	exon3			AGAAAAACTAATA	AF314542	CCDS14510.2, CCDS76004.1	Xq22.2	2014-03-21			ENSG00000133142	ENSG00000133142			26121	protein-coding gene	gene with protein product						14702039, 16221301	Standard	XM_005262192		Approved	FLJ21174, WEX7	uc004ekn.3	Q96EI5	OTTHUMG00000022103	ENST00000472745.1:c.388A>G	X.37:g.102841991A>G	ENSP00000424314:p.Thr130Ala	259	0		166	74	NM_001006935	0	0	18	163	145	Q8WY12|Q9H2H1|Q9H775	Missense_Mutation	SNP	ENST00000472745.1	37	CCDS14510.2	.	.	.	.	.	.	.	.	.	.	A	16.75	3.208774	0.58343	.	.	ENSG00000133142	ENST00000372629;ENST00000468024;ENST00000472484;ENST00000415568;ENST00000414064;ENST00000472745;ENST00000494801	T;T;T;T;T;T	0.10288	2.89;2.89;2.89;2.89;2.89;2.89	3.99	2.8	0.32819	.	0.000000	0.48767	D	0.000161	T	0.24812	0.0602	M	0.74258	2.255	0.24242	N	0.995359	D	0.67145	0.996	P	0.62649	0.905	T	0.03296	-1.1051	10	0.56958	D	0.05	.	6.7545	0.23505	0.7622:0.2378:0.0:0.0	.	130	Q96EI5	TCAL4_HUMAN	A	273;130;130;130;101;130;130	ENSP00000361712:T273A;ENSP00000421857:T130A;ENSP00000421156:T130A;ENSP00000415564:T130A;ENSP00000424314:T130A;ENSP00000427494:T130A	ENSP00000361712:T273A	T	+	1	0	TCEAL4	102728647	1.000000	0.71417	0.931000	0.37212	0.715000	0.41141	1.685000	0.37659	0.692000	0.31613	0.352000	0.21897	ACT	.		0.458	TCEAL4-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252339.2	NM_024863	
H2BFM	286436	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	103294650	103294650	+	Missense_Mutation	SNP	A	A	T			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chrX:103294650A>T	ENST00000355016.3	+	1	135	c.107A>T	c.(106-108)cAg>cTg	p.Q36L	H2BFM_ENST00000243297.5_Missense_Mutation_p.Q139L	NM_001164416.1	NP_001157888.1	P0C1H6	H2BFM_HUMAN	H2B histone family, member M	36						nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|lung(1)|ovary(1)	3						GCCCAGAAGCAGAAGAGGCGA	0.657																																					p.Q36L		.											.	H2BFM-109	0			c.A107T						.						21.0	25.0	24.0					X																	103294650		692	1591	2283	SO:0001583	missense	286436	exon1			AGAAGCAGAAGAG	AK093522	CCDS55468.1	Xq22.2	2011-01-27			ENSG00000101812	ENSG00000101812		"""Histones / Replication-independent"""	27867	protein-coding gene	gene with protein product							Standard	NM_001164416		Approved		uc004els.2	P0C1H6	OTTHUMG00000022122	ENST00000355016.3:c.107A>T	X.37:g.103294650A>T	ENSP00000347119:p.Gln36Leu	131	0		92	44	NM_001164416	0	0	0	0	0	A6NP82	Missense_Mutation	SNP	ENST00000355016.3	37	CCDS55468.1	.	.	.	.	.	.	.	.	.	.	.	16.73	3.204807	0.58234	.	.	ENSG00000101812	ENST00000243297;ENST00000355016	T;T	0.22743	1.94;1.94	2.65	1.44	0.22558	Histone-fold (2);	.	.	.	.	T	0.23926	0.0579	N	0.24115	0.695	0.28820	N	0.897758	D	0.54601	0.967	P	0.62382	0.901	T	0.11470	-1.0586	9	0.72032	D	0.01	.	4.4197	0.11474	0.6716:0.0:0.3284:0.0	.	139	P0C1H6	H2BFM_HUMAN	L	139;36	ENSP00000243297:Q139L;ENSP00000347119:Q36L	ENSP00000243297:Q139L	Q	+	2	0	H2BFM	103181306	0.002000	0.14202	0.678000	0.29963	0.081000	0.17604	0.010000	0.13242	0.191000	0.20236	0.412000	0.27726	CAG	.		0.657	H2BFM-001	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057758.2	XM_210048	
DDX26B	203522	broad.mit.edu	37	X	134706893	134706893	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chrX:134706893G>T	ENST00000370752.4	+	11	1775	c.1441G>T	c.(1441-1443)Gca>Tca	p.A481S	DDX26B_ENST00000481908.1_3'UTR	NM_182540.4	NP_872346.3	Q5JSJ4	DX26B_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 26B	481										large_intestine(1)|lung(8)	9	Acute lymphoblastic leukemia(192;6.56e-05)					AGGGGAAACTGCACTTAGACT	0.338																																					p.A481S													.	DDX26B-226	0			c.G1441T						.						72.0	74.0	74.0					X																	134706893		2203	4300	6503	SO:0001583	missense	203522	exon11			GAAACTGCACTTA	AK096544	CCDS35401.1	Xq26	2008-02-05			ENSG00000165359	ENSG00000165359		"""DEAD-boxes"""	27334	protein-coding gene	gene with protein product							Standard	NM_182540		Approved	FLJ41215	uc004eyw.4	Q5JSJ4	OTTHUMG00000022484	ENST00000370752.4:c.1441G>T	X.37:g.134706893G>T	ENSP00000359788:p.Ala481Ser	354	0		218	4	NM_182540	0	0	8	8	0	Q5CZA2|Q6IPS3|Q6ZTU5|Q6ZWE4	Missense_Mutation	SNP	ENST00000370752.4	37	CCDS35401.1	.	.	.	.	.	.	.	.	.	.	G	5.243	0.230241	0.09969	.	.	ENSG00000165359	ENST00000370752	T	0.32023	1.47	5.35	2.23	0.28157	.	0.306915	0.40728	N	0.001032	T	0.07818	0.0196	N	0.02011	-0.69	0.30065	N	0.810556	B;B	0.11235	0.004;0.001	B;B	0.06405	0.002;0.001	T	0.22138	-1.0225	10	0.07482	T	0.82	-1.5046	1.9908	0.03446	0.1032:0.2478:0.364:0.2849	.	481;481	B9EIK3;Q5JSJ4	.;DX26B_HUMAN	S	481	ENSP00000359788:A481S	ENSP00000359788:A481S	A	+	1	0	DDX26B	134534559	1.000000	0.71417	0.529000	0.27951	0.164000	0.22412	1.954000	0.40362	0.507000	0.28148	-0.199000	0.12753	GCA	.		0.338	DDX26B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058420.1	NM_182540	
F8	2157	broad.mit.edu	37	X	154159037	154159037	+	Missense_Mutation	SNP	A	A	C			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chrX:154159037A>C	ENST00000360256.4	-	14	3228	c.3028T>G	c.(3028-3030)Ttc>Gtc	p.F1010V		NM_000132.3	NP_000123.1	P00451	FA8_HUMAN	coagulation factor VIII, procoagulant component	1010	B.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	copper ion binding (GO:0005507)|oxidoreductase activity (GO:0016491)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(27)|liver(1)|lung(47)|ovary(5)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(5)|urinary_tract(2)	120	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	CTAACTTTGAATAAGGCATTA	0.343																																					p.F1010V													.	F8-182	0			c.T3028G						.						78.0	75.0	76.0					X																	154159037		2203	4297	6500	SO:0001583	missense	2157	exon14			CTTTGAATAAGGC	M90707	CCDS35457.1, CCDS44026.1	Xq28	2014-09-17	2008-07-29		ENSG00000185010	ENSG00000185010			3546	protein-coding gene	gene with protein product	"""Factor VIIIF8B"", ""hemophilia A"""	300841		F8C		6438528, 3935400	Standard	NM_000132		Approved	FVIII, DXS1253E, HEMA	uc004fmt.3	P00451	OTTHUMG00000022688	ENST00000360256.4:c.3028T>G	X.37:g.154159037A>C	ENSP00000353393:p.Phe1010Val	115	0		75	4	NM_000132	0	0	0	0	0	Q14286|Q5HY69	Missense_Mutation	SNP	ENST00000360256.4	37	CCDS35457.1	.	.	.	.	.	.	.	.	.	.	A	7.261	0.605220	0.14002	.	.	ENSG00000185010	ENST00000360256	D	0.99270	-5.66	5.33	2.89	0.33648	.	0.800309	0.11930	N	0.515829	D	0.97105	0.9054	M	0.62723	1.935	0.09310	N	1	P	0.39282	0.666	B	0.30179	0.112	D	0.93758	0.7064	10	0.33141	T	0.24	-1.944	4.1394	0.10186	0.6844:0.2081:0.1075:0.0	.	1010	P00451	FA8_HUMAN	V	1010	ENSP00000353393:F1010V	ENSP00000353393:F1010V	F	-	1	0	F8	153812231	0.371000	0.25056	0.045000	0.18777	0.247000	0.25773	1.497000	0.35649	0.646000	0.30693	0.451000	0.29950	TTC	.		0.343	F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058869.4		
CYP4X1	260293	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	47489659	47489659	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr1:47489659delA	ENST00000371901.3	+	1	420	c.170delA	c.(169-171)cacfs	p.H57fs	CYP4X1_ENST00000538609.1_Intron	NM_178033.1	NP_828847.1	Q8N118	CP4X1_HUMAN	cytochrome P450, family 4, subfamily X, polypeptide 1	57						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			endometrium(1)|kidney(2)|large_intestine(1)|lung(7)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	17						TTCCTTGGGCACCagaaggta	0.682																																					p.H57fs		.											.	CYP4X1-92	0			c.170delA						.						13.0	15.0	14.0					1																	47489659		2197	4293	6490	SO:0001589	frameshift_variant	260293	exon1			.	AK091806	CCDS544.1	1p33	2008-02-05			ENSG00000186377	ENSG00000186377		"""Cytochrome P450s"""	20244	protein-coding gene	gene with protein product		614999				12176035	Standard	NM_178033		Approved	MGC40051	uc001cqt.3	Q8N118	OTTHUMG00000008017	ENST00000371901.3:c.170delA	1.37:g.47489659delA	ENSP00000360968:p.His57fs	77	0		79	25	NM_178033	0	0	0	0	0	G3V1U1|Q5VVE5|Q6ZN67|Q8NAZ3	Frame_Shift_Del	DEL	ENST00000371901.3	37	CCDS544.1																																																																																			.		0.682	CYP4X1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022017.1	NM_178033	
PVRL1	5818	broad.mit.edu	37	11	119545966	119545968	+	In_Frame_Del	DEL	GAA	GAA	-			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	GAA	GAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr11:119545966_119545968delGAA	ENST00000264025.3	-	5	1434_1436	c.904_906delTTC	c.(904-906)ttcdel	p.F302del	PVRL1_ENST00000341398.2_In_Frame_Del_p.F302del|PVRL1_ENST00000340882.2_In_Frame_Del_p.F302del|PVRL1_ENST00000524510.1_5'Flank	NM_002855.4	NP_002846.3	Q15223	PVRL1_HUMAN	poliovirus receptor-related 1 (herpesvirus entry mediator C)	302	Ig-like C2-type 2.				adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|desmosome organization (GO:0002934)|enamel mineralization (GO:0070166)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|immune response (GO:0006955)|iron ion transport (GO:0006826)|lens morphogenesis in camera-type eye (GO:0002089)|regulation of synapse assembly (GO:0051963)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|viral entry into host cell (GO:0046718)	adherens junction (GO:0005912)|axon (GO:0030424)|cell-cell adherens junction (GO:0005913)|extracellular region (GO:0005576)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)|synapse (GO:0045202)	carbohydrate binding (GO:0030246)|cell adhesion molecule binding (GO:0050839)|coreceptor activity (GO:0015026)|protein homodimerization activity (GO:0042803)|virion binding (GO:0046790)|virus receptor activity (GO:0001618)			breast(1)|endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		Breast(348;0.037)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.29e-05)		TGGGTCCCTTGAAGAAGAGGGTT	0.567																																					p.302_302del													.	PVRL1-90	0			c.904_906del						.																																			SO:0001651	inframe_deletion	5818	exon5			TCCCTTGAAGAAG	X76400	CCDS8425.1, CCDS8426.1, CCDS8427.1	11q23-q24	2013-01-29	2007-06-07		ENSG00000110400	ENSG00000110400		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9706	protein-coding gene	gene with protein product	"""nectin"""	600644		HVEC, ED4		7721102, 9616127	Standard	NM_203285		Approved	PRR, PRR1, PVRR1, SK-12, HIgR, CLPED1, CD111, OFC7	uc001pwv.3	Q15223	OTTHUMG00000166177	ENST00000264025.3:c.904_906delTTC	11.37:g.119545969_119545971delGAA	ENSP00000264025:p.Phe302del	99	0		113	7	NM_002855	0	0	0	0	0	O75465|Q2M3D3|Q9HBE6|Q9HBW2	In_Frame_Del	DEL	ENST00000264025.3	37	CCDS8426.1																																																																																			.		0.567	PVRL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388231.1		
GALNT6	11226	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	51758036	51758036	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr12:51758036delA	ENST00000543196.2	-	5	1123	c.918delT	c.(916-918)tttfs	p.F306fs	GALNT6_ENST00000356317.3_Frame_Shift_Del_p.F306fs			Q8NCL4	GALT6_HUMAN	polypeptide N-acetylgalactosaminyltransferase 6	306					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			endometrium(2)|large_intestine(6)|lung(7)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						TGGCGAACTCAAAAGTATTAA	0.577																																					p.F306fs		.											.	GALNT6-92	0			c.918delT						.						91.0	85.0	87.0					12																	51758036		2203	4300	6503	SO:0001589	frameshift_variant	11226	exon6			.	Y08565	CCDS8813.1	12q13	2014-03-13	2014-03-13		ENSG00000139629	ENSG00000139629		"""Glycosyltransferase family 2 domain containing"""	4128	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 6"""	605148	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 6 (GalNAc-T6)"""			10464263	Standard	NM_007210		Approved	GalNAc-T6	uc001ryl.1	Q8NCL4		ENST00000543196.2:c.918delT	12.37:g.51758036delA	ENSP00000444171:p.Phe306fs	98	0		110	35	NM_007210	0	0	0	0	0	Q8IYH4|Q9H6G2|Q9UIV5	Frame_Shift_Del	DEL	ENST00000543196.2	37	CCDS8813.1																																																																																			.		0.577	GALNT6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469735.1	NM_007210	
ARHGAP5	394	hgsc.bcm.edu;bcgsc.ca	37	14	32560648	32560648	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr14:32560648delA	ENST00000345122.3	+	2	1088	c.773delA	c.(772-774)tatfs	p.Y258fs	ARHGAP5_ENST00000433497.1_Intron|ARHGAP5_ENST00000396582.2_Intron|ARHGAP5_ENST00000539826.2_Frame_Shift_Del_p.Y258fs|ARHGAP5_ENST00000432921.1_Frame_Shift_Del_p.Y258fs|ARHGAP5_ENST00000556611.1_Frame_Shift_Del_p.Y258fs	NM_001030055.1	NP_001025226.1	Q13017	RHG05_HUMAN	Rho GTPase activating protein 5	258					cell adhesion (GO:0007155)|GTP catabolic process (GO:0006184)|mammary gland development (GO:0030879)|positive regulation of cell migration (GO:0030335)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell size (GO:0008361)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(10)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(12)|ovary(4)|skin(1)|stomach(1)|urinary_tract(4)	55	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)		ATTATTCCCTATTTGGATGCT	0.358																																					p.Y258fs	NSCLC(9;77 350 3443 29227 41353)	.											.	ARHGAP5-94	0			c.773delA						.						115.0	131.0	125.0					14																	32560648		2203	4299	6502	SO:0001589	frameshift_variant	394	exon2			.	U17032	CCDS32062.1, CCDS45095.1	14q12	2010-02-05						"""Rho GTPase activating proteins"""	675	protein-coding gene	gene with protein product		602680	"""growth factor independent 2"""	GFI2		8537347	Standard	XM_005267635		Approved	RhoGAP5, p190-B, p190BRhoGAP	uc001wrn.3	Q13017		ENST00000345122.3:c.773delA	14.37:g.32560648delA	ENSP00000371897:p.Tyr258fs	279	0		167	85	NM_001173	0	0	0	0	0	A1L375|A1L376|A8KAA1|D3DS89|D3DS90|Q05BE8|Q05BU8|Q59ER0|Q6DHZ3	Frame_Shift_Del	DEL	ENST00000345122.3	37	CCDS32062.1																																																																																			.		0.358	ARHGAP5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409735.1	NM_001030055	
RGS6	9628	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	72939649	72939649	+	Frame_Shift_Del	DEL	C	C	-			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr14:72939649delC	ENST00000553530.1	+	9	813	c.606delC	c.(604-606)gtcfs	p.V202fs	RGS6_ENST00000434263.2_Frame_Shift_Del_p.V133fs|RGS6_ENST00000355512.6_Frame_Shift_Del_p.V202fs|RGS6_ENST00000555571.1_Frame_Shift_Del_p.V202fs|RGS6_ENST00000407322.4_Frame_Shift_Del_p.V202fs|RGS6_ENST00000404301.2_Frame_Shift_Del_p.V202fs|RGS6_ENST00000553525.1_Frame_Shift_Del_p.V202fs|RGS6_ENST00000402788.2_Frame_Shift_Del_p.V202fs|RGS6_ENST00000343854.6_Frame_Shift_Del_p.V202fs|RGS6_ENST00000406236.4_Frame_Shift_Del_p.V202fs|RGS6_ENST00000556437.1_Frame_Shift_Del_p.V202fs|RGS6_ENST00000554782.1_Frame_Shift_Del_p.V63fs|RGS6_ENST00000553690.1_3'UTR	NM_001204417.1|NM_001204418.1|NM_001204420.1|NM_001204421.1|NM_001204422.1|NM_004296.5	NP_001191346.1|NP_001191347.1|NP_001191349.1|NP_001191350.1|NP_001191351.1|NP_004287.3	P49758	RGS6_HUMAN	regulator of G-protein signaling 6	202					G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of neuron differentiation (GO:0045666)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)			endometrium(2)|kidney(3)|large_intestine(6)|lung(14)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33				all cancers(60;0.00309)|BRCA - Breast invasive adenocarcinoma(234;0.0281)|STAD - Stomach adenocarcinoma(64;0.0302)|OV - Ovarian serous cystadenocarcinoma(108;0.0476)		TTTGGGATGTCCACAGGCCTG	0.373																																					p.V202fs	Ovarian(143;1926 2468 21071 48641)	.											.	RGS6-227	0			c.606delC						.						137.0	153.0	148.0					14																	72939649		2203	4300	6503	SO:0001589	frameshift_variant	9628	exon9			.	AF073920	CCDS9808.1, CCDS55924.1, CCDS73655.1	14q24.3	2008-07-28	2007-08-14			ENSG00000182732		"""Regulators of G-protein signaling"""	10002	protein-coding gene	gene with protein product		603894	"""regulator of G-protein signalling 6"""			10083744, 14734556	Standard	NM_004296		Approved		uc010ttn.2	P49758		ENST00000553530.1:c.606delC	14.37:g.72939649delC	ENSP00000452331:p.Val202fs	197	0		150	70	NM_001204424	0	0	0	0	0	C9JE95|F8W7W5|O75576|O75577|Q7Z4K3|Q7Z4K4|Q7Z4K5|Q7Z4K6|Q8TE13|Q8TE14|Q8TE15|Q8TE16|Q8TE17|Q8TE18|Q8TE19|Q8TE20|Q8TE21|Q8TE22|Q9UDS8|Q9UDT0|Q9Y245|Q9Y647	Frame_Shift_Del	DEL	ENST00000553530.1	37	CCDS9808.1																																																																																			.		0.373	RGS6-003	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000413033.2		
CEP152	22995	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	49074426	49074426	+	Splice_Site	DEL	C	C	-			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr15:49074426delC	ENST00000380950.2	-	11	1510	c.1323delG	c.(1321-1323)ggg>gg	p.G441fs	RP11-485O10.2_ENST00000558304.1_RNA|CEP152_ENST00000325747.5_Splice_Site_p.G348fs|CEP152_ENST00000399334.3_Splice_Site_p.G441fs	NM_001194998.1|NM_014985.3	NP_001181927.1|NP_055800.2	O94986	CE152_HUMAN	centrosomal protein 152kDa	441					cell projection organization (GO:0030030)|centriole replication (GO:0007099)|centrosome duplication (GO:0051298)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)			breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(16)|lung(30)|ovary(1)|prostate(2)|skin(2)	63		all_lung(180;0.0428)		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)		CTTGTACTGACCCTGCAGAGG	0.443																																					p.G441fs		.											.	CEP152-70	0			c.1323delG						.						86.0	82.0	83.0					15																	49074426		1973	4175	6148	SO:0001630	splice_region_variant	22995	exon11			.	AB020719	CCDS42033.1, CCDS58361.1	15q21.1	2014-02-20							29298	protein-coding gene	gene with protein product	"""asterless"""	613529	"""microcephaly, primary autosomal recessive 4"""	MCPH4		14654843, 21131973	Standard	NM_014985		Approved	KIAA0912, SCKL5	uc001zwz.3	O94986		ENST00000380950.2:c.1322-1G>-	15.37:g.49074426delC		27	0		30	10	NM_014985	0	0	0	0	0	E7ER66|Q17RV1|Q6NTA0	Frame_Shift_Del	DEL	ENST00000380950.2	37	CCDS58361.1																																																																																			.		0.443	CEP152-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417365.1	NM_014985	Frame_Shift_Del
STARD3	10948	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	37814678	37814685	+	Frame_Shift_Del	DEL	TGGCTACC	TGGCTACC	-			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	TGGCTACC	TGGCTACC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr17:37814678_37814685delTGGCTACC	ENST00000336308.5	+	6	668_675	c.450_457delTGGCTACC	c.(448-459)tttggctacctgfs	p.GYL151fs	STARD3_ENST00000578232.1_3'UTR|STARD3_ENST00000544210.2_Frame_Shift_Del_p.LAT146fs|STARD3_ENST00000394250.4_Frame_Shift_Del_p.GYL133fs|STARD3_ENST00000580611.1_Frame_Shift_Del_p.GYL125fs	NM_001165937.1|NM_006804.3	NP_001159409.1|NP_006795.3	Q14849	STAR3_HUMAN	StAR-related lipid transfer (START) domain containing 3	151	MENTAL. {ECO:0000255|PROSITE- ProRule:PRU00770}.				cholesterol metabolic process (GO:0008203)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|mitochondrial transport (GO:0006839)|progesterone biosynthetic process (GO:0006701)|steroid metabolic process (GO:0008202)	cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)	cholesterol binding (GO:0015485)			endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|pancreas(1)|prostate(2)|stomach(1)	14	Lung NSC(9;1.15e-09)|all_lung(9;6.24e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|BRCA - Breast invasive adenocarcinoma(8;1.04e-44)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			AAGGGGCATTTGGCTACCTGCTCCCCAT	0.582																																					p.150_153del		.											.	STARD3-90	0			c.450_457del						.																																			SO:0001589	frameshift_variant	10948	exon6			.		CCDS11341.1, CCDS54117.1, CCDS54118.1	17q11-q12	2011-09-12	2007-08-16		ENSG00000131748	ENSG00000131748		"""StAR-related lipid transfer (START) domain containing"""	17579	protein-coding gene	gene with protein product		607048	"""START domain containing 3"""				Standard	NM_006804		Approved	es64, MLN64	uc002hsd.3	Q14849	OTTHUMG00000133213	ENST00000336308.5:c.450_457delTGGCTACC	17.37:g.37814678_37814685delTGGCTACC	ENSP00000337446:p.Gly151fs	46	0		50	14	NM_006804	0	0	0	0	0	A8MXA4|B4DUY1|F5H0G2|Q53Y53|Q96HM9	Frame_Shift_Del	DEL	ENST00000336308.5	37	CCDS11341.1																																																																																			.		0.582	STARD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256933.1		
CACNA1A	773	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	13418985	13418985	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr19:13418985delA	ENST00000360228.5	-	14	1861	c.1862delT	c.(1861-1863)ttcfs	p.F621fs	CACNA1A_ENST00000573710.2_Frame_Shift_Del_p.F622fs	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	622					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	AATGAACAGGAAAAGGAGAAA	0.542																																					p.F622fs		.											.	CACNA1A-67	0			c.1865delT						.						95.0	98.0	97.0					19																	13418985		2088	4230	6318	SO:0001589	frameshift_variant	773	exon14			.	U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.1862delT	19.37:g.13418985delA	ENSP00000353362:p.Phe621fs	137	0		126	42	NM_001127221	0	0	0	0	0	J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Frame_Shift_Del	DEL	ENST00000360228.5	37	CCDS45998.1																																																																																			.		0.542	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104062.2	NM_000068	
ZNF826P	664701	hgsc.bcm.edu	37	19	20578766	20578768	+	RNA	DEL	TGA	TGA	-			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	TGA	TGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr19:20578766_20578768delTGA	ENST00000502675.1	-	0	484_486				MIR1270-2_ENST00000408220.1_RNA	NR_036455.1		Q6ZT77	ZN826_HUMAN	zinc finger protein 826, pseudogene						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(4)	4						ATTTGAAAATTGATGAAAGACTT	0.33																																					.		.											.	.	0			.						.																																					664701	.			.	BC016785		19p12	2010-08-03	2010-08-03	2010-08-03	ENSG00000231205	ENSG00000231205			33875	pseudogene	pseudogene			"""zinc finger protein 826"""	ZNF826			Standard	NR_036455		Approved	FLJ44894	uc021urn.2	Q6ZT77	OTTHUMG00000162773		19.37:g.20578769_20578771delTGA		77	0		78	15	.	0	0	0	0	0		RNA	DEL	ENST00000502675.1	37																																																																																				.		0.330	ZNF826P-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000370365.1	NM_001039884	
SMEK2	57223	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	55806886	55806886	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr2:55806886delA	ENST00000345102.5	-	9	1698	c.1397delT	c.(1396-1398)ttcfs	p.F466fs	SMEK2_ENST00000272313.5_Frame_Shift_Del_p.F466fs|SMEK2_ENST00000407823.3_Frame_Shift_Del_p.F466fs	NM_001122964.1	NP_001116436	Q5MIZ7	P4R3B_HUMAN	SMEK homolog 2, suppressor of mek1 (Dictyostelium)	466					positive regulation of gluconeogenesis (GO:0045722)|protein dephosphorylation (GO:0006470)|regulation of lipid metabolic process (GO:0019216)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|protein phosphatase 4 complex (GO:0030289)				kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(1)	16			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			ATGGTTGTAGAAAAAATTTAG	0.303																																					p.F466fs		.											.	SMEK2-228	0			c.1397delT						.						76.0	80.0	79.0					2																	55806886		2203	4298	6501	SO:0001589	frameshift_variant	57223	exon9			.	AB037808	CCDS1855.1, CCDS46289.1, CCDS62913.1	2p16.1	2008-09-15			ENSG00000138041				29267	protein-coding gene	gene with protein product		610352				16085932, 18614045	Standard	NM_001122964		Approved	PSY2, FLFL2, KIAA1387, FLJ31474	uc002rzc.3	Q5MIZ7	OTTHUMG00000129336	ENST00000345102.5:c.1397delT	2.37:g.55806886delA	ENSP00000339769:p.Phe466fs	78	0		67	21	NM_001122964	0	0	0	0	0	Q6P9B0|Q86XB8|Q9BQJ0|Q9BRK2|Q9H913|Q9P2G0	Frame_Shift_Del	DEL	ENST00000345102.5	37	CCDS46289.1																																																																																			.		0.303	SMEK2-002	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251483.1	NM_020463	
SLC25A12	8604	broad.mit.edu;bcgsc.ca	37	2	172700922	172700937	+	Frame_Shift_Del	DEL	CGGTTATGCCCAAAAT	CGGTTATGCCCAAAAT	-			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	CGGTTATGCCCAAAAT	CGGTTATGCCCAAAAT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr2:172700922_172700937delCGGTTATGCCCAAAAT	ENST00000422440.2	-	5	444_459	c.407_422delATTTTGGGCATAACCG	c.(406-423)cattttgggcataaccggfs	p.HFGHNR136fs	SLC25A12_ENST00000472748.1_5'UTR|SLC25A12_ENST00000392592.4_Frame_Shift_Del_p.HFGHNR29fs	NM_003705.4	NP_003696.2	O75746	CMC1_HUMAN	solute carrier family 25 (aspartate/glutamate carrier), member 12	136	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				aspartate transport (GO:0015810)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|L-glutamate transport (GO:0015813)|malate-aspartate shuttle (GO:0043490)|response to calcium ion (GO:0051592)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(10)|upper_aerodigestive_tract(1)	23			OV - Ovarian serous cystadenocarcinoma(117;0.216)		L-Aspartic Acid(DB00128)	ATGCTTCTTCCGGTTATGCCCAAAATGCAGTCGGAT	0.352																																					p.136_141del													.	SLC25A12-90	0			c.407_422del						.																																			SO:0001589	frameshift_variant	8604	exon5			TTCTTCCGGTTAT	Y14494	CCDS33327.1	2q24	2013-05-22	2012-03-29		ENSG00000115840	ENSG00000115840		"""Solute carriers"", ""EF-hand domain containing"""	10982	protein-coding gene	gene with protein product		603667	"""solute carrier family 25 (mitochondrial carrier, Aralar), member 12"""			9722566, 10702666, 11566871	Standard	NM_003705		Approved	Aralar	uc002uhh.3	O75746	OTTHUMG00000134290	ENST00000422440.2:c.407_422delATTTTGGGCATAACCG	2.37:g.172700922_172700937delCGGTTATGCCCAAAAT	ENSP00000388658:p.His136fs	111	0		105	13	NM_003705	0	0	0	0	0	B3KR64|Q96AM8	Frame_Shift_Del	DEL	ENST00000422440.2	37	CCDS33327.1																																																																																			.		0.352	SLC25A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259010.2	NM_003705	
NFATC2	4773	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	50051812	50051813	+	Frame_Shift_Del	DEL	GC	GC	-			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	GC	GC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr20:50051812_50051813delGC	ENST00000396009.3	-	8	2163_2164	c.1944_1945delGC	c.(1942-1947)aagcatfs	p.H649fs	NFATC2_ENST00000609943.1_Frame_Shift_Del_p.H629fs|NFATC2_ENST00000610033.1_Frame_Shift_Del_p.H430fs|NFATC2_ENST00000371564.3_Frame_Shift_Del_p.H649fs|NFATC2_ENST00000414705.1_Frame_Shift_Del_p.H629fs|NFATC2_ENST00000609507.1_Frame_Shift_Del_p.H430fs	NM_001258297.1|NM_173091.3	NP_001245226.1|NP_775114.1	Q13469	NFAC2_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2	649					B cell receptor signaling pathway (GO:0050853)|cell migration (GO:0016477)|cellular response to DNA damage stimulus (GO:0006974)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear transcription factor complex (GO:0044798)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)		EWSR1/NFATC2(9)	breast(2)|endometrium(7)|kidney(1)|large_intestine(7)|lung(25)|ovary(2)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	53	Hepatocellular(150;0.248)					GTGCGGATATGCTTGTTCCGAT	0.436																																					p.648_649del		.											.	NFATC2-92	0			c.1944_1945del						.																																			SO:0001589	frameshift_variant	4773	exon8			.	U43342, U43341	CCDS13437.1, CCDS33488.1, CCDS46614.1, CCDS68156.1, CCDS68157.1	20q13.2	2009-11-24			ENSG00000101096	ENSG00000101096		"""Nuclear factor of activated T-cells"""	7776	protein-coding gene	gene with protein product		600490				8202141	Standard	NM_012340		Approved	NF-ATP, NFATp, NFAT1	uc002xwd.4	Q13469	OTTHUMG00000032747	ENST00000396009.3:c.1944_1945delGC	20.37:g.50051812_50051813delGC	ENSP00000379330:p.His649fs	69	0		84	25	NM_012340	0	0	0	0	0	B5B2N8|B5B2N9|B5B2P0|B5B2P2|B5B2P3|Q13468|Q5TFW7|Q5TFW8|Q9NPX6|Q9NQH3|Q9UJR2	Frame_Shift_Del	DEL	ENST00000396009.3	37	CCDS13437.1																																																																																			.		0.436	NFATC2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079730.2	NM_012340	
SCIN	85477	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	12680013	12680013	+	Frame_Shift_Del	DEL	T	T	-			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr7:12680013delT	ENST00000297029.5	+	11	1553	c.1452delT	c.(1450-1452)agtfs	p.S484fs	SCIN_ENST00000445618.2_Frame_Shift_Del_p.S237fs|SCIN_ENST00000519209.1_Frame_Shift_Del_p.S237fs	NM_001112706.2	NP_001106177.1	Q9Y6U3	ADSV_HUMAN	scinderin	484	Ca(2+)-dependent actin binding.				actin filament capping (GO:0051693)|actin filament severing (GO:0051014)|actin nucleation (GO:0045010)|calcium ion-dependent exocytosis (GO:0017156)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of secretion (GO:0051047)|regulation of chondrocyte differentiation (GO:0032330)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	1-phosphatidylinositol binding (GO:0005545)|actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)			endometrium(3)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)	17				UCEC - Uterine corpus endometrioid carcinoma (126;0.195)		ACCTACTGAGTTTGTTCAAAG	0.453																																					p.S484fs		.											.	SCIN-24	0			c.1452delT						.						58.0	56.0	57.0					7																	12680013		1863	4100	5963	SO:0001589	frameshift_variant	85477	exon11			.	AF276507	CCDS47545.1, CCDS47546.1	7p21.3	2006-04-25			ENSG00000006747	ENSG00000006747			21695	protein-coding gene	gene with protein product		613416					Standard	NM_033128		Approved	adseverin, KIAA1905	uc003ssn.4	Q9Y6U3	OTTHUMG00000152385	ENST00000297029.5:c.1452delT	7.37:g.12680013delT	ENSP00000297029:p.Ser484fs	59	0		51	17	NM_001112706	0	0	0	0	0	A8K2U8|Q8NBZ6|Q8WU97|Q96JC7|Q96PY2	Frame_Shift_Del	DEL	ENST00000297029.5	37	CCDS47545.1																																																																																			.		0.453	SCIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326041.1	NM_033128	
POU6F2	11281	broad.mit.edu;bcgsc.ca	37	7	39504216	39504216	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr7:39504216delA	ENST00000403058.1	+	11	2161	c.2007delA	c.(2005-2007)ttafs	p.L669fs	POU6F2_ENST00000559001.1_Frame_Shift_Del_p.L614fs|POU6F2_ENST00000518318.2_Frame_Shift_Del_p.L633fs	NM_001166018.1|NM_007252.3	NP_001159490.1|NP_009183.3	P78424	PO6F2_HUMAN	POU class 6 homeobox 2	669					central nervous system development (GO:0007417)|ganglion mother cell fate determination (GO:0007402)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|visual perception (GO:0007601)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(16)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	42						TTAAACGCTTAAAACAGCACG	0.453																																					p.L669fs													.	POU6F2-90	0			c.2007delA						.						31.0	31.0	31.0					7																	39504216		2203	4300	6503	SO:0001589	frameshift_variant	11281	exon11			ACGCTTAAAACAG	U91934	CCDS34620.2, CCDS55103.1	7p14.1	2011-06-20	2007-07-13		ENSG00000106536	ENSG00000106536		"""Homeoboxes / POU class"""	21694	protein-coding gene	gene with protein product	"""Retina-derived POU-domain factor-1"""	609062	"""POU domain, class 6, transcription factor 2"""			8601806	Standard	NM_007252		Approved	RPF-1	uc003thb.2	P78424	OTTHUMG00000150803	ENST00000403058.1:c.2007delA	7.37:g.39504216delA	ENSP00000384004:p.Leu669fs	72	0		42	9	NM_007252	0	0	0	0	0	A4D1W2|C4AMB9|P78425|Q75ME8|Q86UM6|Q9UDS7	Frame_Shift_Del	DEL	ENST00000403058.1	37	CCDS34620.2																																																																																			.		0.453	POU6F2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000320146.3	NM_007252	
NPR2	4882	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	35800822	35800822	+	Frame_Shift_Del	DEL	C	C	-			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr9:35800822delC	ENST00000342694.2	+	6	1590	c.1335delC	c.(1333-1335)gacfs	p.D445fs		NM_003995.3	NP_003986.2	P20594	ANPRB_HUMAN	natriuretic peptide receptor 2	445					bone development (GO:0060348)|cell surface receptor signaling pathway (GO:0007166)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cGMP biosynthetic process (GO:0006182)|intracellular signal transduction (GO:0035556)|negative regulation of meiotic cell cycle (GO:0051447)|negative regulation of oocyte maturation (GO:1900194)|ossification (GO:0001503)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|signal transduction (GO:0007165)|single organism reproductive process (GO:0044702)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(2)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)		Erythrityl Tetranitrate(DB01613)|Nesiritide(DB04899)	ACTTGGACGACCCATCCTGTG	0.582																																					p.D445fs		.											.	NPR2-335	0			c.1335delC						.						126.0	103.0	111.0					9																	35800822		2203	4300	6503	SO:0001589	frameshift_variant	4882	exon6			.	AJ005282	CCDS6590.1	9p21-p12	2014-03-03	2014-03-03		ENSG00000159899	ENSG00000159899			7944	protein-coding gene	gene with protein product	"""guanylate cyclase B"""	108961	"""acromesomelic dysplasia, Maroteaux type"", ""atrionatriuretic peptide receptor B"", ""natriuretic peptide receptor B"""	ANPRB, NPRB, AMDM		9634515, 15146390	Standard	XM_005251478		Approved	GUCY2B, ANPb	uc003zyd.3	P20594	OTTHUMG00000019871	ENST00000342694.2:c.1335delC	9.37:g.35800822delC	ENSP00000341083:p.Asp445fs	60	0		82	21	NM_003995	0	0	0	0	0	B0ZBF2|B0ZBF3|D3DRP3|D3DRP4|O60871|Q4VAK7|Q5TCV2|Q8TA93|Q9UQ50	Frame_Shift_Del	DEL	ENST00000342694.2	37	CCDS6590.1																																																																																			.		0.582	NPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052345.1		
CSF3R	1441	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	36939407	36939408	+	In_Frame_Ins	INS	-	-	GTC	rs145989033		TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr1:36939407_36939408insGTC	ENST00000373106.1	-	5	989_990	c.442_443insGAC	c.(442-444)cct>cGACct	p.147_148insR	CSF3R_ENST00000373104.1_In_Frame_Ins_p.147_148insR|CSF3R_ENST00000487540.2_5'Flank|CSF3R_ENST00000440588.2_In_Frame_Ins_p.147_148insR|CSF3R_ENST00000361632.4_In_Frame_Ins_p.147_148insR|CSF3R_ENST00000331941.5_In_Frame_Ins_p.147_148insR|CSF3R_ENST00000418048.2_In_Frame_Ins_p.147_148insR|CSF3R_ENST00000338937.5_In_Frame_Ins_p.147_148insR|CSF3R_ENST00000373103.1_In_Frame_Ins_p.147_148insR	NM_000760.3	NP_000751.1	Q99062	CSF3R_HUMAN	colony stimulating factor 3 receptor (granulocyte)	147	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|defense response (GO:0006952)|neutrophil chemotaxis (GO:0030593)|odontogenesis of dentin-containing tooth (GO:0042475)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)			central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)			Filgrastim(DB00099)|Pegfilgrastim(DB00019)	GTGGGTCTCAGGTCCTGGCTCC	0.599																																					p.P148delinsRP		.											.	CSF3R-515	0			c.443_444insGAC						.																																			SO:0001652	inframe_insertion	1441	exon5			.	M59820	CCDS412.1, CCDS413.1, CCDS414.1	1p35-p34.3	2014-09-17			ENSG00000119535	ENSG00000119535		"""CD molecules"", ""Fibronectin type III domain containing"""	2439	protein-coding gene	gene with protein product		138971		CD114		1371413	Standard	NM_000760		Approved	GCSFR	uc001cax.2	Q99062	OTTHUMG00000008010	ENST00000373106.1:c.440_442dupGAC	1.37:g.36939408_36939410dupGTC	ENSP00000362198:p.Gly147_Pro148insArg	79	0		76	25	NM_156039	0	0	0	0	0		In_Frame_Ins	INS	ENST00000373106.1	37	CCDS413.1																																																																																			.		0.599	CSF3R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021997.2	NM_156039	
RFPL3	10738	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	32754194	32754195	+	Missense_Mutation	DNP	TA	TA	AT			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	TA	TA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr22:32754194_32754195TA>AT	ENST00000249007.4	+	1	341_342	c.136_137TA>AT	c.(136-138)TAt>ATt	p.Y46I	RFPL3_ENST00000382088.3_Missense_Mutation_p.Y17I|RFPL3_ENST00000397468.1_Missense_Mutation_p.Y17I|RFPL3S_ENST00000461833.1_5'Flank	NM_001098535.1	NP_001092005.1	O75679	RFPL3_HUMAN	ret finger protein-like 3	46							zinc ion binding (GO:0008270)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|skin(2)|stomach(1)	15						CTGCTCAGACTATCTGGAAAAA	0.52																																					p.Y46I		.											.	RFPL3-91	0			c.A50T						.																																			SO:0001583	missense	10738	exon2			CAGACTATCTGGA	AJ010232	CCDS13904.1, CCDS43011.1	22q12	2006-04-25			ENSG00000128276	ENSG00000128276			9980	protein-coding gene	gene with protein product		605970				10508838	Standard	NM_006604		Approved		uc010gwn.3	O75679	OTTHUMG00000030290	Exception_encountered	22.37:g.32754194_32754195delinsAT	ENSP00000249007:p.Tyr46Ile	134.0	0.0		150.0	40.0	NM_006604	0	0	0	0	0	A2A279|Q6IC03|Q6IC04|Q6NSX3|Q8N5R4	Missense_Mutation	DNP	ENST00000249007.4	37	CCDS43011.1																																																																																			.		0.520	RFPL3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000075172.3	NM_006604	
