#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
LRIG2	9860	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	113616165	113616165	+	Missense_Mutation	SNP	C	C	A			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr1:113616165C>A	ENST00000361127.5	+	1	335	c.137C>A	c.(136-138)cCc>cAc	p.P46H	RP11-31F15.2_ENST00000421157.1_lincRNA	NM_014813.1	NP_055628.1	O94898	LRIG2_HUMAN	leucine-rich repeats and immunoglobulin-like domains 2	46	LRRNT.				innervation (GO:0060384)|regulation of platelet-derived growth factor receptor signaling pathway (GO:0010640)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(10)|ovary(4)|prostate(2)|stomach(1)|urinary_tract(1)	31	Lung SC(450;0.246)	all_cancers(81;1.56e-05)|all_epithelial(167;2.62e-05)|all_lung(203;0.000665)|Lung NSC(69;0.000986)		Lung(183;0.0279)|Colorectal(144;0.0885)|COAD - Colon adenocarcinoma(174;0.134)|all cancers(265;0.139)|Epithelial(280;0.143)|LUSC - Lung squamous cell carcinoma(189;0.15)		TGCCCCGCGCCCTGCTCCTGC	0.652											OREG0013684	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P46H		.											.	LRIG2-229	0			c.C137A						.						86.0	99.0	95.0					1																	113616165		2203	4299	6502	SO:0001583	missense	9860	exon1			CCGCGCCCTGCTC	AB018349	CCDS30808.1	1p13.1	2013-01-11			ENSG00000198799	ENSG00000198799		"""Immunoglobulin superfamily / I-set domain containing"""	20889	protein-coding gene	gene with protein product		608869					Standard	XM_005271369		Approved	KIAA0806	uc001edf.1	O94898	OTTHUMG00000012133	ENST00000361127.5:c.137C>A	1.37:g.113616165C>A	ENSP00000355396:p.Pro46His	354	1	1451	360	69	NM_014813	0	0	1	2	1	Q9NSN2	Missense_Mutation	SNP	ENST00000361127.5	37	CCDS30808.1	.	.	.	.	.	.	.	.	.	.	C	12.17	1.858502	0.32791	.	.	ENSG00000198799	ENST00000361127	T	0.61859	0.07	5.05	-1.12	0.09808	.	0.293082	0.31760	N	0.007115	T	0.24547	0.0595	L	0.52573	1.65	0.36317	D	0.857988	B	0.02656	0.0	B	0.01281	0.0	T	0.02885	-1.1098	10	0.45353	T	0.12	.	4.1545	0.10254	0.159:0.3987:0.0:0.4423	.	46	O94898	LRIG2_HUMAN	H	46	ENSP00000355396:P46H	ENSP00000355396:P46H	P	+	2	0	LRIG2	113417688	0.631000	0.27164	0.487000	0.27428	0.620000	0.37586	-0.116000	0.10724	-0.400000	0.07656	-0.137000	0.14449	CCC	.		0.652	LRIG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033549.2	NM_014813	
ATP1A1	476	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	116941400	116941400	+	Missense_Mutation	SNP	G	G	C	rs11540954		TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr1:116941400G>C	ENST00000295598.5	+	16	2534	c.2282G>C	c.(2281-2283)gGa>gCa	p.G761A	ATP1A1_ENST00000369496.4_Missense_Mutation_p.G730A|ATP1A1_ENST00000537345.1_Missense_Mutation_p.G761A	NM_000701.7	NP_000692.2	P05023	AT1A1_HUMAN	ATPase, Na+/K+ transporting, alpha 1 polypeptide	761					ATP biosynthetic process (GO:0006754)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|membrane hyperpolarization (GO:0060081)|membrane repolarization (GO:0086009)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of glucocorticoid biosynthetic process (GO:0031947)|negative regulation of heart contraction (GO:0045822)|positive regulation of heart contraction (GO:0045823)|positive regulation of striated muscle contraction (GO:0045989)|potassium ion import (GO:0010107)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of sodium ion transport (GO:0002028)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|response to drug (GO:0042493)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|sodium:potassium-exchanging ATPase complex (GO:0005890)|T-tubule (GO:0030315)|vesicle (GO:0031982)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|chaperone binding (GO:0051087)|phosphatase activity (GO:0016791)|potassium ion binding (GO:0030955)|sodium ion binding (GO:0031402)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(2)|breast(2)|cervix(3)|endometrium(2)|kidney(5)|large_intestine(9)|lung(17)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	47	Lung SC(450;0.225)	all_cancers(81;1.28e-06)|all_epithelial(167;3.48e-07)|all_lung(203;2.64e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0164)|LUSC - Lung squamous cell carcinoma(189;0.0548)|Colorectal(144;0.0825)|COAD - Colon adenocarcinoma(174;0.127)|all cancers(265;0.24)	Acetyldigitoxin(DB00511)|Almitrine(DB01430)|Aluminium(DB01370)|Bepridil(DB01244)|Bretylium(DB01158)|Ciclopirox(DB01188)|Deslanoside(DB01078)|Diazoxide(DB01119)|Digitoxin(DB01396)|Digoxin(DB00390)|Ethacrynic acid(DB00903)|Hydroflumethiazide(DB00774)|Ouabain(DB01092)|Trichlormethiazide(DB01021)	ATTGTGACTGGAGTAGAGGAA	0.438																																					p.G761A		.											.	ATP1A1-91	0			c.G2282C						.						138.0	136.0	136.0					1																	116941400		2203	4300	6503	SO:0001583	missense	476	exon16			TGACTGGAGTAGA	D00099	CCDS887.1, CCDS53351.1, CCDS53352.1	1p13	2012-10-22			ENSG00000163399	ENSG00000163399	3.6.3.9	"""ATPases / P-type"""	799	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-1"", ""sodium pump subunit alpha-1"", ""sodium-potassium ATPase catalytic subunit alpha-1"""	182310					Standard	NM_000701		Approved		uc001ege.3	P05023	OTTHUMG00000012109	ENST00000295598.5:c.2282G>C	1.37:g.116941400G>C	ENSP00000295598:p.Gly761Ala	180	0		178	56	NM_000701	0	0	0	0	0	B2RBR6|B7Z2T5|B7Z3U6|F5H3A1|Q16689|Q6LDM4|Q9UCN1|Q9UJ20|Q9UJ21	Missense_Mutation	SNP	ENST00000295598.5	37	CCDS887.1	.	.	.	.	.	.	.	.	.	.	G	29.2	4.988230	0.93106	.	.	ENSG00000163399	ENST00000295598;ENST00000537345;ENST00000369496	D;D;D	0.91577	-2.87;-2.87;-2.86	5.23	5.23	0.72850	HAD-like domain (1);ATPase, P-type,  transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.88937	0.6573	N	0.11106	0.095	0.80722	D	1	D;D	0.65815	0.995;0.992	D;D	0.70227	0.968;0.929	D	0.91640	0.5326	10	0.66056	D	0.02	.	19.0012	0.92834	0.0:0.0:1.0:0.0	rs11540954	761;761	F5H3A1;P05023	.;AT1A1_HUMAN	A	761;761;730	ENSP00000295598:G761A;ENSP00000445306:G761A;ENSP00000358508:G730A	ENSP00000295598:G761A	G	+	2	0	ATP1A1	116742923	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.657000	0.98554	2.718000	0.92993	0.655000	0.94253	GGA	.		0.438	ATP1A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000033481.5	NM_001160233	
ATP1B1	481	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	169096584	169096584	+	Missense_Mutation	SNP	T	T	C			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr1:169096584T>C	ENST00000367816.1	+	5	1034	c.505T>C	c.(505-507)Tac>Cac	p.Y169H	ATP1B1_ENST00000499679.3_Missense_Mutation_p.Y113H|ATP1B1_ENST00000367813.3_Missense_Mutation_p.Y161H|ATP1B1_ENST00000367815.4_Missense_Mutation_p.Y169H			P05026	AT1B1_HUMAN	ATPase, Na+/K+ transporting, beta 1 polypeptide	169					blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cell adhesion (GO:0007155)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular potassium ion homeostasis (GO:0030007)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|leukocyte migration (GO:0050900)|membrane repolarization (GO:0086009)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|positive regulation of ATP catabolic process (GO:1903291)|positive regulation of ATPase activity (GO:0032781)|positive regulation of calcium:sodium antiporter activity (GO:1903281)|positive regulation of potassium ion import (GO:1903288)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of sodium ion export from cell (GO:1903278)|potassium ion import (GO:0010107)|protein localization to plasma membrane (GO:0072659)|protein stabilization (GO:0050821)|protein transport into plasma membrane raft (GO:0044861)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of gene expression (GO:0010468)|relaxation of cardiac muscle (GO:0055119)|response to hypoxia (GO:0001666)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sodium:potassium-exchanging ATPase complex (GO:0005890)|vesicle (GO:0031982)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|MHC class II protein complex binding (GO:0023026)|sodium:potassium-exchanging ATPase activity (GO:0005391)			breast(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	14	all_hematologic(923;0.208)					AACTTATGGCTACAAAGAGGG	0.388																																					p.Y169H		.											.	ATP1B1-540	0			c.T505C						.						104.0	101.0	102.0					1																	169096584		2203	4300	6503	SO:0001583	missense	481	exon4			TATGGCTACAAAG	U16799	CCDS1276.1	1q24.2	2012-10-22			ENSG00000143153	ENSG00000143153		"""ATPases / P-type"""	804	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit beta-1"", ""sodium pump subunit beta-1"", ""sodium-potassium ATPase subunit beta 1 (non-catalytic)"""	182330		ATP1B			Standard	NM_001677		Approved		uc001gfr.1	P05026	OTTHUMG00000034590	ENST00000367816.1:c.505T>C	1.37:g.169096584T>C	ENSP00000356790:p.Tyr169His	167	0		188	58	NM_001677	0	0	339	912	573	Q5TGZ3	Missense_Mutation	SNP	ENST00000367816.1	37	CCDS1276.1	.	.	.	.	.	.	.	.	.	.	T	24.8	4.574319	0.86542	.	.	ENSG00000143153	ENST00000367816;ENST00000367815;ENST00000499679;ENST00000367813	T;T;T;T	0.48201	0.82;0.82;0.82;0.82	6.02	6.02	0.97574	.	0.049448	0.85682	D	0.000000	T	0.72087	0.3417	M	0.92738	3.34	0.42584	D	0.993227	D	0.76494	0.999	D	0.76071	0.987	T	0.80130	-0.1511	9	0.87932	D	0	-19.3541	16.5446	0.84426	0.0:0.0:0.0:1.0	.	169	P05026	AT1B1_HUMAN	H	169;169;113;161	ENSP00000356790:Y169H;ENSP00000356789:Y169H;ENSP00000423450:Y113H;ENSP00000356787:Y161H	ENSP00000356787:Y161H	Y	+	1	0	ATP1B1	167363208	1.000000	0.71417	1.000000	0.80357	0.643000	0.38383	7.388000	0.79795	2.311000	0.77944	0.533000	0.62120	TAC	.		0.388	ATP1B1-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083696.1		
GOLT1A	127845	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	204183026	204183026	+	Silent	SNP	G	G	T			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr1:204183026G>T	ENST00000308302.3	-	1	194	c.9C>A	c.(7-9)tcC>tcA	p.S3S		NM_198447.1	NP_940849.1			golgi transport 1A											kidney(1)|lung(2)|urinary_tract(1)	4	all_cancers(21;0.0165)|Breast(84;0.179)|all_epithelial(62;0.242)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.244)			ATTCGGTGATGGAGATCATGC	0.642																																					p.S3S		.											.	GOLT1A-514	0			c.C9A						.						68.0	53.0	58.0					1																	204183026		2203	4300	6503	SO:0001819	synonymous_variant	127845	exon1			GGTGATGGAGATC	BC058832	CCDS1443.1	1q32.1	2010-06-24	2010-06-24		ENSG00000174567	ENSG00000174567			24766	protein-coding gene	gene with protein product			"""golgi transport 1 homolog A (S. cerevisiae)"""			12477932	Standard	NM_198447		Approved	FLJ42654, CGI-141, YMR292W, GOT1, MGC62027	uc001has.1	Q6ZVE7	OTTHUMG00000036056	ENST00000308302.3:c.9C>A	1.37:g.204183026G>T		42	0		50	11	NM_198447	0	0	0	2	2		Silent	SNP	ENST00000308302.3	37	CCDS1443.1																																																																																			.		0.642	GOLT1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087887.1	NM_198447	
FAM188A	80013	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	15879212	15879212	+	Missense_Mutation	SNP	T	T	A			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr10:15879212T>A	ENST00000277632.3	-	6	787	c.567A>T	c.(565-567)ttA>ttT	p.L189F	FAM188A_ENST00000477891.1_5'UTR	NM_024948.2	NP_079224.1	Q9H8M7	F188A_HUMAN	family with sequence similarity 188, member A	189					apoptotic process (GO:0006915)	nucleus (GO:0005634)	calcium ion binding (GO:0005509)			breast(2)|endometrium(5)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|skin(2)	22						CCTTTGTCAGTAATACAGAAT	0.353																																					p.L189F	Pancreas(159;946 1953 2111 4475 22008)	.											.	FAM188A-228	0			c.A567T						.						131.0	131.0	131.0					10																	15879212		2203	4296	6499	SO:0001583	missense	80013	exon6			TGTCAGTAATACA	AK023459	CCDS7110.1	10p13	2009-07-14	2009-07-14	2009-07-14	ENSG00000148481	ENSG00000148481			23578	protein-coding gene	gene with protein product	"""caspase recruitment domain containing pro-apoptotic protein"", ""CARD-containing protein"""	611649	"""chromosome 10 open reading frame 97"""	C10orf97		12054670, 17652099	Standard	XM_005252600		Approved	FLJ13397, CARP, my042, DERP5	uc001iod.1	Q9H8M7	OTTHUMG00000017734	ENST00000277632.3:c.567A>T	10.37:g.15879212T>A	ENSP00000277632:p.Leu189Phe	228	1		278	79	NM_024948	0	0	0	0	0	Q5SZ68|Q5SZ69|Q5SZ70|Q6IA40|Q6P7P0|Q7Z2S1|Q8WUF1|Q9H3I4	Missense_Mutation	SNP	ENST00000277632.3	37	CCDS7110.1	.	.	.	.	.	.	.	.	.	.	T	12.63	1.995741	0.35226	.	.	ENSG00000148481	ENST00000277632;ENST00000418767;ENST00000436829	T;T;T	0.35973	1.28;1.28;1.28	5.82	4.62	0.57501	.	0.100055	0.64402	D	0.000004	T	0.25082	0.0609	N	0.17379	0.485	0.80722	D	1	P	0.37101	0.582	B	0.40444	0.329	T	0.05468	-1.0883	10	0.39692	T	0.17	-10.9766	10.0517	0.42219	0.2595:0.0:0.0:0.7405	.	189	Q9H8M7	F188A_HUMAN	F	189;29;42	ENSP00000277632:L189F;ENSP00000388661:L29F;ENSP00000389883:L42F	ENSP00000277632:L189F	L	-	3	2	FAM188A	15919218	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	2.047000	0.41269	2.217000	0.71921	0.482000	0.46254	TTA	.		0.353	FAM188A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046990.2	NM_024948	
TNKS2	80351	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	93593686	93593686	+	Missense_Mutation	SNP	T	T	C			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr10:93593686T>C	ENST00000371627.4	+	12	1731	c.1352T>C	c.(1351-1353)cTa>cCa	p.L451P		NM_025235.3	NP_079511.1	Q9H2K2	TNKS2_HUMAN	tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2	451					multicellular organism growth (GO:0035264)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of telomere maintenance via telomerase (GO:0032212)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein localization to chromosome, telomeric region (GO:0070198)|protein polyubiquitination (GO:0000209)|regulation of multicellular organism growth (GO:0040014)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nuclear chromosome, telomeric region (GO:0000784)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)|perinuclear region of cytoplasm (GO:0048471)	enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			biliary_tract(1)|breast(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(11)|lung(14)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	48		Colorectal(252;0.162)				ACCTGCCGCCTACTCCTGAGC	0.413																																					p.L451P		.											.	TNKS2-541	0			c.T1352C						.						148.0	131.0	137.0					10																	93593686		2203	4300	6503	SO:0001583	missense	80351	exon12			GCCGCCTACTCCT	AF342982	CCDS7417.1	10q23.3	2013-01-10			ENSG00000107854	ENSG00000107854		"""Poly (ADP-ribose) polymerases"", ""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15677	protein-coding gene	gene with protein product		607128					Standard	NM_025235		Approved	TNKL, TANK2, PARP-5b, PARP-5c, PARP5B, PARP5C, pART6	uc001khp.3	Q9H2K2	OTTHUMG00000018747	ENST00000371627.4:c.1352T>C	10.37:g.93593686T>C	ENSP00000360689:p.Leu451Pro	225	0		240	79	NM_025235	0	0	8	11	3	B2RBD3|Q9H8F2|Q9HAS4	Missense_Mutation	SNP	ENST00000371627.4	37	CCDS7417.1	.	.	.	.	.	.	.	.	.	.	T	26.2	4.715685	0.89112	.	.	ENSG00000107854	ENST00000371627	T	0.70164	-0.46	5.83	5.83	0.93111	Ankyrin repeat-containing domain (3);	0.000000	0.47093	D	0.000247	D	0.86489	0.5945	M	0.94142	3.5	0.80722	D	1	D	0.69078	0.997	D	0.70227	0.968	D	0.89940	0.4072	10	0.62326	D	0.03	.	16.1968	0.82036	0.0:0.0:0.0:1.0	.	451	Q9H2K2	TNKS2_HUMAN	P	451	ENSP00000360689:L451P	ENSP00000360689:L451P	L	+	2	0	TNKS2	93583666	1.000000	0.71417	0.975000	0.42487	0.983000	0.72400	8.040000	0.89188	2.225000	0.72522	0.533000	0.62120	CTA	.		0.413	TNKS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049374.1	NM_025235	
ITPRIP	85450	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	106075425	106075425	+	Missense_Mutation	SNP	C	C	T			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr10:106075425C>T	ENST00000337478.1	-	2	556	c.385G>A	c.(385-387)Gcc>Acc	p.A129T	ITPRIP_ENST00000358187.2_Missense_Mutation_p.A129T|RP11-127L20.5_ENST00000472915.2_RNA|ITPRIP_ENST00000278071.2_Missense_Mutation_p.A129T	NM_001272013.1	NP_001258942.1	Q8IWB1	IPRI_HUMAN	inositol 1,4,5-trisphosphate receptor interacting protein	129						membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|large_intestine(5)|liver(1)|lung(9)|upper_aerodigestive_tract(1)	20						TGCAAGGGGGCGCCCCCCAGC	0.692																																					p.A129T		.											.	ITPRIP-90	0			c.G385A						.						35.0	41.0	39.0					10																	106075425		2203	4298	6501	SO:0001583	missense	85450	exon2			AGGGGGCGCCCCC	AB051541	CCDS7557.1	10q25.1	2011-04-28	2011-04-28	2008-08-11	ENSG00000148841	ENSG00000148841			29370	protein-coding gene	gene with protein product			"""KIAA1754"", ""inositol 1,4,5-triphosphate receptor interacting protein"""	KIAA1754		11214970, 16990268	Standard	NM_001272012		Approved	bA127L20.2, DANGER	uc001kye.4	Q8IWB1	OTTHUMG00000019003	ENST00000337478.1:c.385G>A	10.37:g.106075425C>T	ENSP00000337178:p.Ala129Thr	167	0		179	76	NM_001272013	0	0	6	9	3	D3DRA5|Q5JU17|Q96MS8|Q9C0A9	Missense_Mutation	SNP	ENST00000337478.1	37	CCDS7557.1	.	.	.	.	.	.	.	.	.	.	C	0.011	-1.730767	0.00687	.	.	ENSG00000148841	ENST00000337478;ENST00000278071;ENST00000358187	T;T;T	0.22134	1.97;1.97;1.97	5.68	-5.02	0.02982	.	1.189030	0.05773	N	0.607175	T	0.10551	0.0258	N	0.13043	0.29	0.09310	N	1	B	0.11235	0.004	B	0.04013	0.001	T	0.39563	-0.9608	10	0.12430	T	0.62	-5.7595	10.1192	0.42609	0.0857:0.426:0.0:0.4883	.	129	Q8IWB1	IPRI_HUMAN	T	129	ENSP00000337178:A129T;ENSP00000278071:A129T;ENSP00000350915:A129T	ENSP00000278071:A129T	A	-	1	0	ITPRIP	106065415	0.000000	0.05858	0.000000	0.03702	0.029000	0.11900	-0.312000	0.08113	-1.181000	0.02730	-1.119000	0.02030	GCC	.		0.692	ITPRIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050204.1	NM_033397	
WDR11	55717	ucsc.edu	37	10	122622314	122622314	+	Silent	SNP	G	G	A			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr10:122622314G>A	ENST00000263461.6	+	5	840	c.594G>A	c.(592-594)ggG>ggA	p.G198G		NM_018117.11	NP_060587.8	Q8WWQ0	PHIP_HUMAN	WD repeat domain 11	0					cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(9)|prostate(2)|skin(2)|stomach(5)	38						CAGGCCCTGGGAAAAAAGTTT	0.433																																					p.G198G													.	WDR11-226	0			c.G594A						.						122.0	136.0	131.0					10																	122622314		2203	4300	6503	SO:0001819	synonymous_variant	55717	exon5			CCCTGGGAAAAAA	AF320223	CCDS7619.1	10q26	2013-01-21	2010-01-06	2010-01-06	ENSG00000120008	ENSG00000120008		"""WD repeat domain containing"""	13831	protein-coding gene	gene with protein product		606417	"""bromodomain and WD repeat domain containing 2"""	BRWD2		10718198, 11536051	Standard	NM_018117		Approved	KIAA1351, FLJ10506, WDR15, HH14, DR11	uc021pzt.1	Q9BZH6	OTTHUMG00000019171	ENST00000263461.6:c.594G>A	10.37:g.122622314G>A		346	0		357	3	NM_018117	0	0	39	43	4	A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	Silent	SNP	ENST00000263461.6	37	CCDS7619.1																																																																																			.		0.433	WDR11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050707.2		
MUC2	4583	hgsc.bcm.edu	37	11	1093502	1093502	+	Missense_Mutation	SNP	C	C	G	rs529542452		TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr11:1093502C>G	ENST00000441003.2	+	30	5348	c.5321C>G	c.(5320-5322)aCt>aGt	p.T1774S	MUC2_ENST00000333592.6_Missense_Mutation_p.T62S|MUC2_ENST00000359061.5_Intron|MUC2_ENST00000361558.6_Intron	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	accaccaccactacgatgacc	0.617													N|||	1	0.000199681	0.0	0.0	5008	,	,		28151	0.0		0.001	False		,,,				2504	0.0				p.T1774S		.											.	MUC2-90	0			c.C5321G						.																																			SO:0001583	missense	4583	exon30			CCACCACTACGAT	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5321C>G	11.37:g.1093502C>G	ENSP00000415183:p.Thr1774Ser	5	0		13	6	NM_002457	0	0	0	0	0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	0.027	-1.361543	0.01235	.	.	ENSG00000198788	ENST00000441003;ENST00000333592	T;T	0.10668	2.85;2.86	1.82	-1.79	0.07932	.	.	.	.	.	T	0.06234	0.0161	.	.	.	0.09310	N	1	B	0.09022	0.002	B	0.10450	0.005	T	0.39563	-0.9608	8	0.33940	T	0.23	.	5.1534	0.15021	0.0:0.449:0.4024:0.1486	.	1774	E7EUV1	.	S	1774;62	ENSP00000415183:T1774S;ENSP00000331373:T62S	ENSP00000331373:T62S	T	+	2	0	MUC2	1083502	0.000000	0.05858	0.002000	0.10522	0.015000	0.08874	-0.389000	0.07342	-0.316000	0.08690	-1.112000	0.02068	ACT	.		0.617	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MUC2	4583	hgsc.bcm.edu	37	11	1093507	1093507	+	Missense_Mutation	SNP	A	A	G	rs56189540		TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr11:1093507A>G	ENST00000441003.2	+	30	5353	c.5326A>G	c.(5326-5328)Atg>Gtg	p.M1776V	MUC2_ENST00000333592.6_Missense_Mutation_p.M64V|MUC2_ENST00000359061.5_Intron|MUC2_ENST00000361558.6_Intron	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	caccactacgatgaccccaac	0.607																																					p.M1776V		.											.	MUC2-90	0			c.A5326G						.						94.0	120.0	111.0					11																	1093507		2159	4225	6384	SO:0001583	missense	4583	exon30			ACTACGATGACCC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5326A>G	11.37:g.1093507A>G	ENSP00000415183:p.Met1776Val	5	0		14	10	NM_002457	0	0	0	0	0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	G	4.089	0.014464	0.07959	.	.	ENSG00000198788	ENST00000441003;ENST00000333592	T;T	0.06687	3.27;3.89	1.82	0.848	0.18966	.	.	.	.	.	T	0.04724	0.0128	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.44726	-0.9309	8	0.24483	T	0.36	.	4.4625	0.11673	0.5672:0.0:0.4328:0.0	rs56189540	1776	E7EUV1	.	V	1776;64	ENSP00000415183:M1776V;ENSP00000331373:M64V	ENSP00000331373:M64V	M	+	1	0	MUC2	1083507	0.000000	0.05858	0.001000	0.08648	0.010000	0.07245	-0.412000	0.07132	0.113000	0.18004	-1.063000	0.02288	ATG	.		0.607	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
SMPD1	6609	hgsc.bcm.edu	37	11	6411941	6411941	+	Missense_Mutation	SNP	C	C	T	rs550365194|rs550067660|rs71467507|rs78250081|rs558809956|rs3838786	byFrequency	TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr11:6411941C>T	ENST00000342245.4	+	1	281	c.113C>T	c.(112-114)gCg>gTg	p.A38V	SMPD1_ENST00000527275.1_Missense_Mutation_p.A38V|SMPD1_ENST00000356761.2_Missense_Mutation_p.A38V|SMPD1_ENST00000299397.3_Missense_Mutation_p.A38V|SMPD1_ENST00000533196.1_3'UTR	NM_000543.4|NM_001007593.2	NP_000534.3|NP_001007594.2	P17405	ASM_HUMAN	sphingomyelin phosphodiesterase 1, acid lysosomal	38					cell death (GO:0008219)|ceramide biosynthetic process (GO:0046513)|glycosphingolipid metabolic process (GO:0006687)|negative regulation of MAP kinase activity (GO:0043407)|nervous system development (GO:0007399)|positive regulation of apoptotic process (GO:0043065)|positive regulation of protein dephosphorylation (GO:0035307)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin catabolic process (GO:0006685)|sphingomyelin metabolic process (GO:0006684)|termination of signal transduction (GO:0023021)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lamellar body (GO:0042599)|lysosomal lumen (GO:0043202)	hydrolase activity, acting on glycosyl bonds (GO:0016798)|sphingomyelin phosphodiesterase activity (GO:0004767)			breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(3)	23		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;4.9e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)	Amlodipine(DB00381)|Chlorpromazine(DB00477)|Desipramine(DB01151)	ctggtgctggcgctggcgctg	0.711																																					p.A38V		.											.	SMPD1-90	0			c.C113T						.						11.0	14.0	13.0					11																	6411941		2185	4258	6443	SO:0001583	missense	6609	exon1			TGCTGGCGCTGGC	AB209775	CCDS31409.1, CCDS44531.1, CCDS31409.2	11p15.4-p15.1	2010-04-28	2008-02-04		ENSG00000166311	ENSG00000166311	3.1.4.12		11120	protein-coding gene	gene with protein product	"""acid sphingomyelinase"""	607608				1711683	Standard	NM_000543		Approved	ASM	uc001mcw.3	P17405	OTTHUMG00000165453	ENST00000342245.4:c.113C>T	11.37:g.6411941C>T	ENSP00000340409:p.Ala38Val	33	1		53	7	NM_000543	0	0	21	21	0	A8K8M3|E9PKS3|P17406|Q13811|Q16837|Q16841	Missense_Mutation	SNP	ENST00000342245.4	37	CCDS44531.1	.	.	.	.	.	.	.	.	.	.	C	13.43	2.234305	0.39498	.	.	ENSG00000166311	ENST00000299397;ENST00000356761;ENST00000342245;ENST00000527275	T;T;T;T	0.09723	2.95;2.95;2.95;2.95	4.54	-1.08	0.09936	.	.	.	.	.	T	0.04363	0.0120	N	0.08118	0	0.09310	N	1	B;B	0.15473	0.002;0.013	B;B	0.10450	0.002;0.005	T	0.47275	-0.9130	9	0.12103	T	0.63	.	6.8659	0.24093	0.0:0.5614:0.262:0.1766	.	38;38	E9PKS3;G3XAB5	.;.	V	38	ENSP00000299397:A38V;ENSP00000349203:A38V;ENSP00000340409:A38V;ENSP00000435350:A38V	ENSP00000299397:A38V	A	+	2	0	SMPD1	6368517	0.000000	0.05858	0.130000	0.21974	0.033000	0.12548	-2.110000	0.01334	-0.479000	0.06813	-1.305000	0.01319	GCG	.		0.711	SMPD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384205.1	NM_000543	
MRGPRX1	259249	broad.mit.edu;bcgsc.ca	37	11	18955994	18955994	+	Missense_Mutation	SNP	A	A	T			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr11:18955994A>T	ENST00000302797.3	-	1	562	c.338T>A	c.(337-339)cTg>cAg	p.L113Q	RP11-583F24.8_ENST00000528646.1_RNA|MRGPRX1_ENST00000526914.1_5'UTR	NM_147199.3	NP_671732.3	Q96LB2	MRGX1_HUMAN	MAS-related GPR, member X1	113					acute-phase response (GO:0006953)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(12)|pancreas(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	36						CACGGCACTCAGAAAGCTCAG	0.542																																					p.L113Q													.	MRGPRX1-92	0			c.T338A						.						100.0	96.0	98.0					11																	18955994		2194	4286	6480	SO:0001583	missense	259249	exon1			GCACTCAGAAAGC		CCDS7846.1	11p15.1	2013-10-10			ENSG00000170255	ENSG00000170255		"""GPCR / Class A : Orphans"""	17962	protein-coding gene	gene with protein product		607227				11551509	Standard	NM_147199		Approved	MRGX1	uc001mpg.3	Q96LB2	OTTHUMG00000162655	ENST00000302797.3:c.338T>A	11.37:g.18955994A>T	ENSP00000305766:p.Leu113Gln	144	0		141	6	NM_147199	0	0	0	0	0	Q4V9L2|Q8TDD8|Q8TDD9	Missense_Mutation	SNP	ENST00000302797.3	37	CCDS7846.1	.	.	.	.	.	.	.	.	.	.	.	16.41	3.114997	0.56505	.	.	ENSG00000170255	ENST00000302797	D	0.81579	-1.51	2.28	2.28	0.28536	GPCR, rhodopsin-like superfamily (1);	0.000000	0.52532	D	0.000078	D	0.91199	0.7227	H	0.95982	3.75	0.29298	N	0.868908	D	0.89917	1.0	D	0.91635	0.999	D	0.85057	0.0932	10	0.87932	D	0	.	8.4333	0.32771	1.0:0.0:0.0:0.0	.	113	Q96LB2	MRGX1_HUMAN	Q	113	ENSP00000305766:L113Q	ENSP00000305766:L113Q	L	-	2	0	MRGPRX1	18912570	0.996000	0.38824	0.008000	0.14137	0.026000	0.11368	7.327000	0.79147	1.292000	0.44672	0.402000	0.26972	CTG	.		0.542	MRGPRX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369913.1	NM_147199	
ABCG4	64137	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	119027678	119027678	+	Missense_Mutation	SNP	G	G	T			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr11:119027678G>T	ENST00000449422.2	+	9	1210	c.1022G>T	c.(1021-1023)aGc>aTc	p.S341I	ABCG4_ENST00000531739.1_Missense_Mutation_p.S341I|AP002956.1_ENST00000599663.1_Intron|ABCG4_ENST00000307417.3_Missense_Mutation_p.S341I	NM_001142505.1	NP_001135977.1	Q9H172	ABCG4_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 4	341					cholesterol efflux (GO:0033344)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|cholesterol transporter activity (GO:0017127)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(28)|ovary(2)|prostate(1)|skin(1)	44	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)		AAGAAGAGCAGCCCTGAGAAG	0.607																																					p.S341I		.											.	ABCG4-92	0			c.G1022T						.						180.0	164.0	170.0					11																	119027678		2200	4295	6495	SO:0001583	missense	64137	exon9			AGAGCAGCCCTGA	AJ300465	CCDS8415.1	11q23	2012-03-14			ENSG00000172350	ENSG00000172350		"""ATP binding cassette transporters / subfamily G"""	13884	protein-coding gene	gene with protein product	"""putative ABC transporter"", ""ATP-binding cassette, subfamily G, member 4"""	607784				11435397	Standard	NM_022169		Approved	WHITE2	uc001pvs.3	Q9H172	OTTHUMG00000166169	ENST00000449422.2:c.1022G>T	11.37:g.119027678G>T	ENSP00000406874:p.Ser341Ile	253	0		220	75	NM_022169	0	0	0	0	0	A8K1B5|Q8WWH0|Q8WWH1|Q8WWH2	Missense_Mutation	SNP	ENST00000449422.2	37	CCDS8415.1	.	.	.	.	.	.	.	.	.	.	G	16.00	2.998773	0.54147	.	.	ENSG00000172350	ENST00000307417;ENST00000449422;ENST00000531739;ENST00000534402	D;D;D;T	0.87412	-2.25;-2.25;-2.25;0.85	5.65	3.69	0.42338	.	0.573919	0.21547	N	0.072794	T	0.78660	0.4318	L	0.35854	1.095	0.36220	D	0.851913	B	0.13594	0.008	B	0.13407	0.009	T	0.75360	-0.3345	10	0.38643	T	0.18	-8.3485	6.2254	0.20706	0.071:0.1345:0.6546:0.1398	.	341	Q9H172	ABCG4_HUMAN	I	341;341;341;19	ENSP00000304111:S341I;ENSP00000406874:S341I;ENSP00000434318:S341I;ENSP00000434571:S19I	ENSP00000304111:S341I	S	+	2	0	ABCG4	118532888	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.327000	0.43858	1.359000	0.45940	0.655000	0.94253	AGC	.		0.607	ABCG4-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388215.1	NM_022169	
TXNRD1	7296	bcgsc.ca	37	12	104705164	104705164	+	Missense_Mutation	SNP	G	G	A			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr12:104705164G>A	ENST00000525566.1	+	5	535	c.511G>A	c.(511-513)Ggc>Agc	p.G171S	TXNRD1_ENST00000529546.1_Intron|TXNRD1_ENST00000427956.1_Missense_Mutation_p.G136S|TXNRD1_ENST00000526390.1_Missense_Mutation_p.G65S|TXNRD1_ENST00000524698.1_Missense_Mutation_p.G21S|TXNRD1_ENST00000503506.2_Missense_Mutation_p.G21S|TXNRD1_ENST00000378070.4_Missense_Mutation_p.G120S|TXNRD1_ENST00000388854.3_Missense_Mutation_p.G73S|TXNRD1_ENST00000542918.1_Missense_Mutation_p.G71S|TXNRD1_ENST00000540716.1_Intron|TXNRD1_ENST00000429002.2_Missense_Mutation_p.G171S|TXNRD1_ENST00000526691.1_Missense_Mutation_p.G73S|TXNRD1_ENST00000397736.2_Missense_Mutation_p.G65S|TXNRD1_ENST00000354940.6_Missense_Mutation_p.G21S|TXNRD1_ENST00000526950.1_Missense_Mutation_p.G90S	NM_001093771.2	NP_001087240.1	Q16881	TRXR1_HUMAN	thioredoxin reductase 1	171					cell proliferation (GO:0008283)|cell redox homeostasis (GO:0045454)|cellular lipid metabolic process (GO:0044255)|mesoderm formation (GO:0001707)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|NADP binding (GO:0050661)|protein disulfide oxidoreductase activity (GO:0015035)|thioredoxin-disulfide reductase activity (GO:0004791)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(5)|skin(1)|stomach(1)|urinary_tract(1)	16					Arsenic trioxide(DB01169)|Flavin adenine dinucleotide(DB03147)	CATTGGAGGTGGCTCAGGAGG	0.468																																					.	Ovarian(139;555 1836 9186 9946 10884)												.	TXNRD1-90	0			.						.						107.0	99.0	102.0					12																	104705164		1967	4147	6114	SO:0001583	missense	7296	.			GGAGGTGGCTCAG		CCDS53820.1, CCDS53821.1, CCDS53823.1, CCDS58274.1	12q23-q24.1	2012-03-01							12437	protein-coding gene	gene with protein product		601112				7589432	Standard	NM_001093771		Approved	TXNR, GRIM-12, Trxr1	uc021rcx.2	Q16881		ENST00000525566.1:c.511G>A	12.37:g.104705164G>A	ENSP00000434516:p.Gly171Ser	56	0		77	5	.	0	0	48	48	0	B7Z1F4|B7Z3Y8|B7Z904|E9PMY9|F5H780|Q6FI31|Q6VB40|Q6VB41|Q6VB42|Q6VBP2|Q6VBP3|Q6VBP4|Q6VBP5|Q6VBP9|Q6VBQ0|Q6YNQ1|Q76P53|Q7LA96|Q8WVC8|Q99475|Q9UES8|Q9UH79	Missense_Mutation	SNP	ENST00000525566.1	37	CCDS53820.1	.	.	.	.	.	.	.	.	.	.	G	35	5.445208	0.96187	.	.	ENSG00000198431	ENST00000525566;ENST00000429002;ENST00000526266;ENST00000503506;ENST00000526691;ENST00000531691;ENST00000388854;ENST00000354940;ENST00000526390;ENST00000531689;ENST00000528079;ENST00000526580;ENST00000529784;ENST00000524698;ENST00000542918;ENST00000378070;ENST00000527335;ENST00000397736;ENST00000427956;ENST00000526950	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;T;D;D;D	0.99060	-5.38;-5.38;-2.29;-5.38;-5.38;-2.29;-5.38;-5.38;-5.38;-2.29;-2.29;-4.7;-5.38;-5.38;-5.38;-1.08;-5.38;-5.38;-5.38	5.75	5.75	0.90469	Pyridine nucleotide-disulphide oxidoreductase, FAD/NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99750	0.9900	H	0.99900	4.915	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;0.999;1.0;0.999;0.999;1.0;1.0	D;D;D;D;D;D;D	0.87578	0.996;0.997;0.998;0.996;0.997;0.998;0.998	D	0.96754	0.9556	10	0.87932	D	0	-18.1178	19.9889	0.97359	0.0:0.0:1.0:0.0	.	71;65;171;73;21;171;136	B7Z2S5;E2QRB9;B7Z904;Q16881-4;B2R5P6;Q16881;E7EW10	.;.;.;.;.;TRXR1_HUMAN;.	S	171;171;21;21;73;65;73;21;65;21;90;21;21;21;71;120;21;65;136;90	ENSP00000434516:G171S;ENSP00000412045:G171S;ENSP00000431294:G21S;ENSP00000421934:G21S;ENSP00000435929:G73S;ENSP00000431925:G65S;ENSP00000373506:G73S;ENSP00000347020:G21S;ENSP00000435123:G65S;ENSP00000433507:G21S;ENSP00000433887:G21S;ENSP00000436229:G21S;ENSP00000433425:G21S;ENSP00000440978:G71S;ENSP00000367310:G120S;ENSP00000433599:G21S;ENSP00000380844:G65S;ENSP00000393328:G136S;ENSP00000432812:G90S	ENSP00000347020:G21S	G	+	1	0	TXNRD1	103229294	1.000000	0.71417	0.960000	0.40013	0.770000	0.43624	9.015000	0.93640	2.727000	0.93392	0.650000	0.86243	GGC	.		0.468	TXNRD1-001	KNOWN	basic|appris_candidate_longest|CCDS|seleno	protein_coding	protein_coding	OTTHUMT00000389960.1	NM_003330	
WDR66	144406	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	122413567	122413567	+	Silent	SNP	T	T	C			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr12:122413567T>C	ENST00000288912.4	+	19	3836	c.2982T>C	c.(2980-2982)atT>atC	p.I994I		NM_144668.5	NP_653269.3	Q8TBY9	WDR66_HUMAN	WD repeat domain 66	994							calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(13)|ovary(2)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	all_neural(191;0.0496)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000155)|Epithelial(86;0.000634)|BRCA - Breast invasive adenocarcinoma(302;0.248)		TGAGAGCAATTGGCTTTTACC	0.438																																					p.I994I	Esophageal Squamous(85;849 1794 49757 52143)	.											.	WDR66-92	0			c.T2982C						.						119.0	111.0	113.0					12																	122413567		1915	4145	6060	SO:0001819	synonymous_variant	144406	exon19			AGCAATTGGCTTT	AL833930	CCDS41853.1, CCDS53840.1	12q24.31	2014-07-31			ENSG00000158023	ENSG00000158023		"""WD repeat domain containing"""	28506	protein-coding gene	gene with protein product						17967944	Standard	NM_001178003		Approved	MGC33630, CaM-IP4	uc009zxk.3	Q8TBY9	OTTHUMG00000168948	ENST00000288912.4:c.2982T>C	12.37:g.122413567T>C		184	0		141	49	NM_144668	0	0	2	2	0	C9J1W2|Q8IYA3|Q8N898|Q8NDE7	Silent	SNP	ENST00000288912.4	37	CCDS41853.1																																																																																			.		0.438	WDR66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401700.1	NM_144668	
RDH12	145226	broad.mit.edu	37	14	68191259	68191259	+	Silent	SNP	C	C	T	rs140371232	byFrequency	TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr14:68191259C>T	ENST00000551171.1	+	4	462	c.138C>T	c.(136-138)ggC>ggT	p.G46G	RDH12_ENST00000539142.1_Silent_p.G46G|RDH12_ENST00000267502.3_Silent_p.G46G	NM_152443.2	NP_689656.2	Q96NR8	RDH12_HUMAN	retinol dehydrogenase 12 (all-trans/9-cis/11-cis)	46					photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|visual perception (GO:0007601)	intracellular (GO:0005622)|photoreceptor inner segment membrane (GO:0060342)	retinol dehydrogenase activity (GO:0004745)	p.G46G(1)		large_intestine(3)|lung(3)|ovary(1)|prostate(1)|skin(4)	12				all cancers(60;0.000704)|OV - Ovarian serous cystadenocarcinoma(108;0.00161)|BRCA - Breast invasive adenocarcinoma(234;0.00953)	Vitamin A(DB00162)	TGATCACTGGCGCCAACACGG	0.542													C|||	3	0.000599042	0.0	0.0	5008	,	,		18362	0.0		0.0	False		,,,				2504	0.0031				p.G46G													.	RDH12-91	1	Substitution - coding silent(1)	prostate(1)	c.C138T						.	C		0,4406		0,0,2203	252.0	206.0	222.0		138	-2.8	1.0	14	dbSNP_134	222	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	RDH12	NM_152443.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		46/317	68191259	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	145226	exon4			CACTGGCGCCAAC	AK054835	CCDS9787.1	14q24.1	2013-02-14	2006-05-09		ENSG00000139988	ENSG00000139988	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	19977	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 7C, member 2"""	608830	"""retinol dehydrogenase 12 (all-trans and 9-cis)"""			12226107, 19027726	Standard	NM_152443		Approved	FLJ30273, SDR7C2, LCA13, RP53	uc001xjz.4	Q96NR8		ENST00000551171.1:c.138C>T	14.37:g.68191259C>T		154	0		170	6	NM_152443	0	0	3	3	0	B2RDA2|Q8TAW6	Silent	SNP	ENST00000551171.1	37	CCDS9787.1																																																																																			C|1.000;T|0.000		0.542	RDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406918.1		
JAG2	3714	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	105622266	105622266	+	Missense_Mutation	SNP	T	T	C			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr14:105622266T>C	ENST00000331782.3	-	4	939	c.536A>G	c.(535-537)aAg>aGg	p.K179R	RP11-44N21.4_ENST00000548203.1_RNA|JAG2_ENST00000347004.2_Missense_Mutation_p.K179R	NM_002226.4	NP_002217.3	Q9Y219	JAG2_HUMAN	jagged 2	179					auditory receptor cell fate commitment (GO:0009912)|cell cycle (GO:0007049)|cell differentiation (GO:0030154)|epithelial cell apoptotic process involved in palatal shelf morphogenesis (GO:1990134)|gamma-delta T cell differentiation (GO:0042492)|in utero embryonic development (GO:0001701)|morphogenesis of embryonic epithelium (GO:0016331)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|respiratory system process (GO:0003016)|skeletal system development (GO:0001501)|spermatogenesis (GO:0007283)|T cell differentiation (GO:0030217)|thymic T cell selection (GO:0045061)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|growth factor activity (GO:0008083)|Notch binding (GO:0005112)			breast(2)|endometrium(2)|kidney(3)|large_intestine(1)|lung(7)|prostate(2)|skin(5)	22		all_cancers(154;0.0336)|all_epithelial(191;0.0729)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00989)|all cancers(16;0.0114)|Epithelial(46;0.0272)	Epithelial(152;0.047)|OV - Ovarian serous cystadenocarcinoma(161;0.148)|all cancers(159;0.208)		GTGCAGGCTCTTCCAGCGGTC	0.632																																					p.K179R		.											.	JAG2-846	0			c.A536G						.						44.0	36.0	39.0					14																	105622266		2199	4294	6493	SO:0001583	missense	3714	exon4			AGGCTCTTCCAGC	AF020201	CCDS9998.1, CCDS9999.1	14q32	2008-08-01			ENSG00000184916	ENSG00000184916			6189	protein-coding gene	gene with protein product		602570				9315665, 10662552	Standard	NM_002226		Approved		uc001yqg.4	Q9Y219	OTTHUMG00000140172	ENST00000331782.3:c.536A>G	14.37:g.105622266T>C	ENSP00000328169:p.Lys179Arg	51	1		55	14	NM_145159	0	0	1	3	2	Q9UE17|Q9UE99|Q9UNK8|Q9Y6P9|Q9Y6Q0	Missense_Mutation	SNP	ENST00000331782.3	37	CCDS9998.1	.	.	.	.	.	.	.	.	.	.	T	17.54	3.415310	0.62511	.	.	ENSG00000184916	ENST00000331782;ENST00000347004	D;D	0.96168	-3.93;-3.93	4.48	4.48	0.54585	Delta/Serrate/lag-2 (DSL) protein (2);	0.067676	0.64402	U	0.000011	D	0.94417	0.8204	L	0.49126	1.545	0.38795	D	0.95507	D;P	0.54772	0.968;0.947	P;P	0.51615	0.625;0.675	D	0.93846	0.7141	10	0.45353	T	0.12	.	9.3373	0.38058	0.0:0.0:0.1806:0.8194	.	179;179	Q9Y219-2;Q9Y219	.;JAG2_HUMAN	R	179	ENSP00000328169:K179R;ENSP00000328566:K179R	ENSP00000328169:K179R	K	-	2	0	JAG2	104693311	1.000000	0.71417	1.000000	0.80357	0.542000	0.35054	5.935000	0.70145	1.649000	0.50652	0.460000	0.39030	AAG	.		0.632	JAG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276506.2		
TMC3	342125	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	81648105	81648105	+	Missense_Mutation	SNP	G	G	A			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr15:81648105G>A	ENST00000359440.5	-	9	1031	c.896C>T	c.(895-897)gCt>gTt	p.A299V	TMC3_ENST00000558726.1_Missense_Mutation_p.A299V|RP11-761I4.3_ENST00000560851.1_RNA|RP11-761I4.3_ENST00000559781.1_RNA	NM_001080532.1	NP_001074001.1			transmembrane channel-like 3											autonomic_ganglia(2)|breast(1)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	34						TTCCAATATAGCTTCCTTTAA	0.284																																					p.A299V		.											.	TMC3-70	0			c.C896T						.						120.0	114.0	116.0					15																	81648105		1789	4056	5845	SO:0001583	missense	342125	exon9			AATATAGCTTCCT	AY263163	CCDS45324.1	15q24.3	2006-11-24				ENSG00000188869			22995	protein-coding gene	gene with protein product						12906855, 12812529	Standard	NM_001080532		Approved		uc021ssk.1	Q7Z5M5		ENST00000359440.5:c.896C>T	15.37:g.81648105G>A	ENSP00000352413:p.Ala299Val	89	0		112	35	NM_001080532	0	0	0	0	0		Missense_Mutation	SNP	ENST00000359440.5	37	CCDS45324.1	.	.	.	.	.	.	.	.	.	.	G	15.67	2.901887	0.52227	.	.	ENSG00000188869	ENST00000359440	T	0.21191	2.02	4.86	4.86	0.63082	.	0.000000	0.85682	D	0.000000	T	0.37183	0.0994	L	0.54965	1.715	0.58432	D	0.999997	D;D	0.58970	0.984;0.973	P;P	0.56514	0.785;0.8	T	0.15037	-1.0451	10	0.72032	D	0.01	-13.4261	16.9402	0.86216	0.0:0.0:1.0:0.0	.	299;299	Q7Z5M5-2;Q7Z5M5	.;TMC3_HUMAN	V	299	ENSP00000352413:A299V	ENSP00000352413:A299V	A	-	2	0	TMC3	79435160	1.000000	0.71417	0.925000	0.36789	0.111000	0.19643	6.165000	0.71891	2.408000	0.81797	0.555000	0.69702	GCT	.		0.284	TMC3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417795.3	NM_181841	
ADAMTS17	170691	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	100657190	100657190	+	Missense_Mutation	SNP	C	C	T			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr15:100657190C>T	ENST00000268070.4	-	13	1855	c.1750G>A	c.(1750-1752)Ggt>Agt	p.G584S		NM_139057.2	NP_620688.2	Q8TE56	ATS17_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 17	584	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(24)|ovary(3)|prostate(2)	50	Lung NSC(78;0.00299)|all_lung(78;0.00457)|Melanoma(26;0.00571)		OV - Ovarian serous cystadenocarcinoma(32;0.0013)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)	COAD - Colon adenocarcinoma(1;0.111)|all cancers(203;0.219)		ACACTGGCACCCGGGCAGTGT	0.632																																					p.G584S		.											.	ADAMTS17-228	0			c.G1750A						.						39.0	33.0	35.0					15																	100657190		2203	4300	6503	SO:0001583	missense	170691	exon13			TGGCACCCGGGCA	AJ315735	CCDS10383.1	15q24	2014-01-28	2005-08-19		ENSG00000140470	ENSG00000140470		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17109	protein-coding gene	gene with protein product		607511	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 17"""			11867212	Standard	NM_139057		Approved	FLJ32769, FLJ16363	uc002bvv.1	Q8TE56	OTTHUMG00000149867	ENST00000268070.4:c.1750G>A	15.37:g.100657190C>T	ENSP00000268070:p.Gly584Ser	65	0		50	20	NM_139057	0	0	0	0	0	Q2I7G4|Q6ZN75	Missense_Mutation	SNP	ENST00000268070.4	37	CCDS10383.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.259132	0.80246	.	.	ENSG00000140470	ENST00000268070;ENST00000378898	T	0.60672	0.17	5.18	5.18	0.71444	.	0.141210	0.47852	D	0.000203	T	0.69459	0.3113	M	0.88450	2.955	0.54753	D	0.999987	P;B	0.38473	0.633;0.251	B;B	0.40375	0.327;0.108	T	0.77120	-0.2705	10	0.87932	D	0	.	18.7048	0.91633	0.0:1.0:0.0:0.0	.	341;584	Q8TE56-2;Q8TE56	.;ATS17_HUMAN	S	584;341	ENSP00000268070:G584S	ENSP00000268070:G584S	G	-	1	0	ADAMTS17	98474713	0.870000	0.30015	0.451000	0.26982	0.858000	0.48976	2.708000	0.47152	2.419000	0.82065	0.655000	0.94253	GGT	.		0.632	ADAMTS17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313595.1	NM_139057	
IFT140	9742	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	1608090	1608090	+	Missense_Mutation	SNP	G	G	T			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr16:1608090G>T	ENST00000426508.2	-	19	2608	c.2245C>A	c.(2245-2247)Cac>Aac	p.H749N	IFT140_ENST00000439987.2_5'UTR	NM_014714.3	NP_055529.2	Q96RY7	IF140_HUMAN	intraflagellar transport 140	749					cilium assembly (GO:0042384)|intraciliary retrograde transport (GO:0035721)|protein localization to cilium (GO:0061512)|regulation of cilium assembly (GO:1902017)|renal system development (GO:0072001)|retina development in camera-type eye (GO:0060041)|skeletal system morphogenesis (GO:0048705)	axoneme (GO:0005930)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|intraciliary transport particle A (GO:0030991)|photoreceptor connecting cilium (GO:0032391)				breast(1)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(12)|lung(10)|ovary(5)|pancreas(1)|prostate(4)|skin(4)|stomach(2)|urinary_tract(1)	53		Hepatocellular(780;0.219)				TGAGGGATGTGGTGGCACCCA	0.552																																					p.H749N		.											.	IFT140-95	0			c.C2245A						.						149.0	145.0	146.0					16																	1608090		2199	4300	6499	SO:0001583	missense	9742	exon19			GGATGTGGTGGCA	AB011162	CCDS10439.1	16p13.3	2014-07-03	2014-07-03	2005-11-02	ENSG00000187535	ENSG00000187535		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	29077	protein-coding gene	gene with protein product		614620	"""WD and tetratricopeptide repeats 2"", ""intraflagellar transport 140 homolog (Chlamydomonas)"""	WDTC2		9628581	Standard	NM_014714		Approved	gs114, KIAA0590	uc002cmb.3	Q96RY7	OTTHUMG00000128585	ENST00000426508.2:c.2245C>A	16.37:g.1608090G>T	ENSP00000406012:p.His749Asn	421	1		568	163	NM_014714	0	0	17	24	7	A2A2A8|D3DU75|O60332|Q9UG52	Missense_Mutation	SNP	ENST00000426508.2	37	CCDS10439.1	.	.	.	.	.	.	.	.	.	.	G	9.526	1.109524	0.20714	.	.	ENSG00000187535	ENST00000397417;ENST00000426508;ENST00000439987	T	0.41400	1.0	5.0	-3.73	0.04398	.	0.869820	0.10298	N	0.691510	T	0.15912	0.0383	N	0.08118	0	0.09310	N	1	B;B	0.23735	0.017;0.09	B;B	0.26416	0.021;0.069	T	0.23048	-1.0199	10	0.17832	T	0.49	.	1.4862	0.02447	0.393:0.097:0.2946:0.2155	.	749;474	Q96RY7;B4DR58	IF140_HUMAN;.	N	749	ENSP00000406012:H749N	ENSP00000380562:H749N	H	-	1	0	IFT140	1548091	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	-0.055000	0.11807	-1.123000	0.02940	0.563000	0.77884	CAC	.		0.552	IFT140-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250438.2	NM_014714	
CASKIN1	57524	hgsc.bcm.edu	37	16	2230812	2230812	+	Missense_Mutation	SNP	G	G	A	rs185628064	byFrequency	TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr16:2230812G>A	ENST00000343516.6	-	18	2649	c.2557C>T	c.(2557-2559)Ccc>Tcc	p.P853S	CASKIN1_ENST00000564289.1_5'Flank	NM_020764.3	NP_065815.1	Q8WXD9	CSKI1_HUMAN	CASK interacting protein 1	853	Pro-rich.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|liver(1)|lung(7)|ovary(4)|prostate(5)|skin(3)	28						ACGGGTGGGGGCGCAGGCCCC	0.756													G|||	36	0.0071885	0.0	0.0187	5008	,	,		9211	0.0		0.0229	False		,,,				2504	0.0				p.P853S		.											.	CASKIN1-92	0			c.C2557T						.	G	SER/PRO	8,2372		0,8,1182	2.0	3.0	3.0		2557	1.0	0.0	16		3	100,5436		0,100,2668	no	missense	CASKIN1	NM_020764.3	74	0,108,3850	AA,AG,GG		1.8064,0.3361,1.3643	possibly-damaging	853/1432	2230812	108,7808	1190	2768	3958	SO:0001583	missense	57524	exon18			GTGGGGGCGCAGG	AF451977	CCDS42103.1	16p13.3	2013-01-10				ENSG00000167971		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	20879	protein-coding gene	gene with protein product		612184				12040031	Standard	NM_020764		Approved	KIAA1306, ANKS5A	uc010bsg.1	Q8WXD9		ENST00000343516.6:c.2557C>T	16.37:g.2230812G>A	ENSP00000345436:p.Pro853Ser	3	1		13	10	NM_020764	0	0	0	0	0	Q9P2P0	Missense_Mutation	SNP	ENST00000343516.6	37	CCDS42103.1	33	0.01510989010989011	6	0.012195121951219513	8	0.022099447513812154	0	0.0	19	0.025065963060686015	G	2.762	-0.257580	0.05791	0.003361	0.018064	ENSG00000167971	ENST00000343516	T	0.65916	-0.18	3.14	0.956	0.19608	.	.	.	.	.	T	0.19208	0.0461	L	0.29908	0.895	0.09310	N	1	P	0.42827	0.791	B	0.35413	0.202	T	0.13872	-1.0493	9	0.46703	T	0.11	-12.2106	5.9751	0.19373	0.0:0.4472:0.3781:0.1747	.	853	Q8WXD9	CSKI1_HUMAN	S	853	ENSP00000345436:P853S	ENSP00000345436:P853S	P	-	1	0	CASKIN1	2170813	0.022000	0.18835	0.037000	0.18230	0.056000	0.15407	0.672000	0.25187	1.568000	0.49683	0.407000	0.27541	CCC	G|0.985;A|0.015		0.756	CASKIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435055.1	NM_020764	
HCFC1R1	54985	broad.mit.edu;bcgsc.ca	37	16	3073346	3073346	+	Missense_Mutation	SNP	G	G	C			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr16:3073346G>C	ENST00000248089.3	-	3	473	c.169C>G	c.(169-171)Cag>Gag	p.Q57E	HCFC1R1_ENST00000354679.3_Missense_Mutation_p.Q55E|HCFC1R1_ENST00000396916.1_Missense_Mutation_p.Q57E|HCFC1R1_ENST00000574980.1_Missense_Mutation_p.Q57E|THOC6_ENST00000575576.1_5'Flank|THOC6_ENST00000574549.1_5'Flank|HCFC1R1_ENST00000574151.1_Missense_Mutation_p.Q38E|THOC6_ENST00000253952.9_5'Flank|THOC6_ENST00000326266.8_5'Flank|HCFC1R1_ENST00000572355.1_Missense_Mutation_p.Q17E	NM_017885.2	NP_060355.1	Q9NWW0	HPIP_HUMAN	host cell factor C1 regulator 1 (XPO1 dependent)	57						cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|large_intestine(1)|upper_aerodigestive_tract(1)	3						GACAGAAACTGCTTGCGCAGA	0.592																																					p.Q57E													.	HCFC1R1-90	0			c.C169G						.						99.0	105.0	103.0					16																	3073346		2198	4300	6498	SO:0001583	missense	54985	exon3			GAAACTGCTTGCG	AK000575	CCDS10490.1, CCDS32375.1, CCDS73815.1	16p13.3	2008-02-05	2005-12-01			ENSG00000103145			21198	protein-coding gene	gene with protein product			"""host cell factor C1 regulator 1 (XPO1 dependant)"""			12235138	Standard	NM_001002018		Approved	HPIP, FLJ20568	uc002csy.1	Q9NWW0		ENST00000248089.3:c.169C>G	16.37:g.3073346G>C	ENSP00000248089:p.Gln57Glu	166	0		284	9	NM_017885	0	1	380	388	7	D3DUA7|Q68EN7	Missense_Mutation	SNP	ENST00000248089.3	37	CCDS10490.1	.	.	.	.	.	.	.	.	.	.	G	9.580	1.123400	0.20959	.	.	ENSG00000103145	ENST00000248089;ENST00000354679;ENST00000396916	T;T	0.46819	0.86;0.86	5.69	4.74	0.60224	.	0.869784	0.09802	N	0.753977	T	0.34919	0.0914	N	0.19112	0.55	0.33679	D	0.611854	B;B	0.31817	0.341;0.049	B;B	0.31101	0.124;0.018	T	0.43877	-0.9364	10	0.51188	T	0.08	-8.8739	10.4168	0.44327	0.0893:0.0:0.9107:0.0	.	38;57	Q9NWW0-2;Q9NWW0	.;HPIP_HUMAN	E	57;38;57	ENSP00000248089:Q57E;ENSP00000380123:Q57E	ENSP00000248089:Q57E	Q	-	1	0	HCFC1R1	3013347	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	3.551000	0.53698	1.421000	0.47157	0.655000	0.94253	CAG	.		0.592	HCFC1R1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000436969.1	NM_017885	
RBBP6	5930	broad.mit.edu	37	16	24551952	24551952	+	Missense_Mutation	SNP	C	C	G			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr16:24551952C>G	ENST00000319715.4	+	1	437	c.5C>G	c.(4-6)tCc>tGc	p.S2C	RBBP6_ENST00000381039.3_Missense_Mutation_p.S2C|RBBP6_ENST00000348022.2_Missense_Mutation_p.S2C|RBBP6_ENST00000452655.2_Missense_Mutation_p.S2C	NM_006910.4	NP_008841.2	Q7Z6E9	RBBP6_HUMAN	retinoblastoma binding protein 6	2					embryonic organ development (GO:0048568)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|somite development (GO:0061053)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(4)|pancreas(1)|prostate(2)|urinary_tract(1)	46				GBM - Glioblastoma multiforme(48;0.0518)		GGCACCATGTCCTGTGTGCAT	0.408																																					p.S2C													.	RBBP6-230	0			c.C5G						.						114.0	101.0	106.0					16																	24551952		2197	4300	6497	SO:0001583	missense	5930	exon1			CCATGTCCTGTGT		CCDS10621.1, CCDS10622.1, CCDS45444.1	16p12.2	2008-08-04	2001-11-28		ENSG00000122257	ENSG00000122257			9889	protein-coding gene	gene with protein product	"""proliferation potential-related protein"""	600938	"""retinoblastoma-binding protein 6"""			8595913, 16396680	Standard	NM_006910		Approved	P2P-R, PACT, SNAMA	uc002dmh.3	Q7Z6E9	OTTHUMG00000096991	ENST00000319715.4:c.5C>G	16.37:g.24551952C>G	ENSP00000317872:p.Ser2Cys	128	0		213	6	NM_018703	0	0	10	12	2	Q147T5|Q15290|Q6DKH4|Q6P4C2|Q6YNC9|Q7Z6E8|Q8N0V2|Q96PH3|Q9H3I8|Q9H5M5|Q9NPX4	Missense_Mutation	SNP	ENST00000319715.4	37	CCDS10621.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.578787	0.86645	.	.	ENSG00000122257	ENST00000381039;ENST00000452655;ENST00000319715;ENST00000348022	T;T;T;T	0.64085	0.85;-0.08;0.97;1.08	5.26	5.26	0.73747	.	0.060916	0.64402	D	0.000002	T	0.81795	0.4898	M	0.86651	2.83	0.58432	D	0.999998	D;P;P;D	0.89917	0.999;0.956;0.927;1.0	D;P;P;D	0.80764	0.994;0.74;0.554;0.971	D	0.83673	0.0167	10	0.48119	T	0.1	-8.0E-4	17.4217	0.87517	0.0:1.0:0.0:0.0	.	2;2;2;2	Q7Z6E9-4;Q7Z6E9-2;Q7Z6E9;Q7Z6E9-3	.;.;RBBP6_HUMAN;.	C	2	ENSP00000370427:S2C;ENSP00000390537:S2C;ENSP00000317872:S2C;ENSP00000316291:S2C	ENSP00000317872:S2C	S	+	2	0	RBBP6	24459453	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.190000	0.77755	2.449000	0.82847	0.655000	0.94253	TCC	.		0.408	RBBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214067.2	NM_006910	
CLUH	23277	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	2604434	2604434	+	Splice_Site	SNP	C	C	T			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr17:2604434C>T	ENST00000570628.2	-	7	1016	c.911G>A	c.(910-912)aGg>aAg	p.R304K	CLUH_ENST00000435359.1_Splice_Site_p.R304K|CLUH_ENST00000538975.1_Splice_Site_p.R304K			O75153	CLU_HUMAN	clustered mitochondria (cluA/CLU1) homolog	304					intracellular distribution of mitochondria (GO:0048312)	cytoplasm (GO:0005737)											AAGGCACTACCTTTTCTTCTG	0.602																																					p.R304K		.											.	.	0			c.G911A						.						37.0	38.0	38.0					17																	2604434		2030	4170	6200	SO:0001630	splice_region_variant	23277	exon7			CACTACCTTTTCT	AB014564	CCDS45572.1	17p13.3	2012-12-18	2012-11-30	2012-11-30	ENSG00000132361	ENSG00000132361			29094	protein-coding gene	gene with protein product			"""KIAA0664"""	KIAA0664			Standard	XM_005256567		Approved	CLU1	uc002fuy.1	O75153	OTTHUMG00000177575	ENST00000570628.2:c.911+1G>A	17.37:g.2604434C>T		63	1		73	39	NM_015229	0	0	1	7	6	Q6AHY2|Q6P3X7|Q6ZUG8|Q8N4U7|Q9BTA3|Q9H979	Missense_Mutation	SNP	ENST00000570628.2	37	CCDS45572.1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.490254	0.84962	.	.	ENSG00000132361	ENST00000435359;ENST00000322335;ENST00000538975	T;T	0.80909	-1.43;-1.43	5.18	5.18	0.71444	GSKIP/TIF31 domain (1);	0.000000	0.85682	D	0.000000	T	0.76919	0.4055	L	0.43598	1.365	0.80722	D	1	P;B	0.36412	0.552;0.35	B;B	0.38500	0.275;0.188	T	0.74842	-0.3527	9	.	.	.	.	17.6956	0.88281	0.0:1.0:0.0:0.0	.	304;304	O75153;C9J6D7	K0664_HUMAN;.	K	304	ENSP00000388872:R304K;ENSP00000439628:R304K	.	R	-	2	0	KIAA0664	2551184	1.000000	0.71417	1.000000	0.80357	0.813000	0.45954	5.780000	0.68956	2.409000	0.81822	0.655000	0.94253	AGG	.		0.602	CLUH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437807.2	NM_015229	Missense_Mutation
ANKFY1	51479	broad.mit.edu;bcgsc.ca	37	17	4084580	4084580	+	Missense_Mutation	SNP	T	T	C			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr17:4084580T>C	ENST00000341657.4	-	16	2244	c.2209A>G	c.(2209-2211)Aac>Gac	p.N737D	ANKFY1_ENST00000570535.1_Missense_Mutation_p.N779D|ANKFY1_ENST00000574367.1_Missense_Mutation_p.N738D|CYB5D2_ENST00000573984.1_Intron	NM_016376.3	NP_057460.3	Q9P2R3	ANFY1_HUMAN	ankyrin repeat and FYVE domain containing 1	737	Interaction with RHOD and RAB5A. {ECO:0000269|PubMed:24102721}.				endosomal vesicle fusion (GO:0034058)|endosome localization (GO:0032439)|Golgi to lysosome transport (GO:0090160)|positive regulation of pinocytosis (GO:0048549)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|macropinosome (GO:0044354)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phosphatidylinositol phosphate binding (GO:1901981)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(11)|liver(1)|lung(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32						GTGGGCTCGTTGTTTTCATCA	0.522																																					p.N779D													.	ANKFY1-93	0			c.A2335G						.						60.0	60.0	60.0					17																	4084580		1933	4142	6075	SO:0001583	missense	51479	exon16			GCTCGTTGTTTTC	AB033081	CCDS42236.1, CCDS58502.1	17p13.3	2013-01-10			ENSG00000185722	ENSG00000185722		"""Zinc fingers, FYVE domain containing"", ""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	20763	protein-coding gene	gene with protein product		607927				10940552, 17273843	Standard	NM_016376		Approved	ANKHZN, KIAA1255, ZFYVE14, BTBD23	uc002fxn.3	Q9P2R3	OTTHUMG00000177727	ENST00000341657.4:c.2209A>G	17.37:g.4084580T>C	ENSP00000343362:p.Asn737Asp	121	0		212	7	NM_001257999	0	0	31	31	0	A8KA65|Q5RKV4|Q9ULG5	Missense_Mutation	SNP	ENST00000341657.4	37		.	.	.	.	.	.	.	.	.	.	T	10.77	1.445290	0.25987	.	.	ENSG00000185722	ENST00000341657;ENST00000535427	.	.	.	5.43	3.05	0.35203	Ankyrin repeat-containing domain (4);	0.153953	0.56097	D	0.000024	T	0.41673	0.1169	L	0.31294	0.92	0.80722	D	1	B;B;B;B	0.15473	0.001;0.006;0.005;0.013	B;B;B;B	0.15052	0.003;0.011;0.007;0.012	T	0.28364	-1.0046	9	0.49607	T	0.09	-14.4722	7.4956	0.27487	0.0:0.0754:0.1418:0.7828	.	679;737;738;779	F5H754;Q9P2R3;Q9P2R3-2;Q9P2R3-4	.;ANFY1_HUMAN;.;.	D	738;679	.	ENSP00000343362:N738D	N	-	1	0	ANKFY1	4031329	1.000000	0.71417	0.953000	0.39169	0.282000	0.26991	5.095000	0.64529	0.870000	0.35726	0.459000	0.35465	AAC	.		0.522	ANKFY1-008	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000438702.1	NM_016376	
ASGR1	432	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	7081872	7081872	+	Missense_Mutation	SNP	T	T	G			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr17:7081872T>G	ENST00000269299.3	-	2	410	c.11A>C	c.(10-12)gAg>gCg	p.E4A	ASGR1_ENST00000572879.1_5'Flank|ASGR1_ENST00000574388.1_Missense_Mutation_p.E4A|ASGR1_ENST00000380920.4_5'Flank	NM_001197216.2|NM_001671.4	NP_001184145.1|NP_001662.1	P07306	ASGR1_HUMAN	asialoglycoprotein receptor 1	4					cellular response to extracellular stimulus (GO:0031668)|receptor-mediated endocytosis (GO:0006898)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	asialoglycoprotein receptor activity (GO:0004873)|carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(3)|skin(1)|urinary_tract(1)	10						GTCTTGATACTCCTTGGTCAT	0.577																																					p.E4A		.											.	ASGR1-153	0			c.A11C						.						129.0	90.0	103.0					17																	7081872		2203	4300	6503	SO:0001583	missense	432	exon2			TGATACTCCTTGG		CCDS11089.1, CCDS56017.1	17p13-p11	2011-08-30			ENSG00000141505	ENSG00000141505		"""C-type lectin domain containing"""	742	protein-coding gene	gene with protein product		108360					Standard	NM_001671		Approved	CLEC4H1	uc002ges.4	P07306	OTTHUMG00000102159	ENST00000269299.3:c.11A>C	17.37:g.7081872T>G	ENSP00000269299:p.Glu4Ala	92	0		124	60	NM_001671	0	0	0	0	0	I3L1X1	Missense_Mutation	SNP	ENST00000269299.3	37	CCDS11089.1	.	.	.	.	.	.	.	.	.	.	T	14.43	2.533519	0.45073	.	.	ENSG00000141505	ENST00000269299;ENST00000380920	T	0.01015	5.44	4.43	4.43	0.53597	.	0.332135	0.21660	N	0.071026	T	0.00724	0.0024	N	0.14661	0.345	0.80722	D	1	B	0.30741	0.293	B	0.22386	0.039	T	0.73212	-0.4054	10	0.32370	T	0.25	.	10.0445	0.42177	0.0:0.0:0.0:1.0	.	4	P07306	ASGR1_HUMAN	A	4	ENSP00000269299:E4A	ENSP00000269299:E4A	E	-	2	0	ASGR1	7022596	0.996000	0.38824	0.991000	0.47740	0.852000	0.48524	3.429000	0.52800	1.875000	0.54330	0.449000	0.29647	GAG	.		0.577	ASGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220004.3	NM_001671	
PFAS	5198	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	8170542	8170542	+	Missense_Mutation	SNP	C	C	T			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr17:8170542C>T	ENST00000314666.6	+	24	3297	c.3164C>T	c.(3163-3165)cCc>cTc	p.P1055L	PFAS_ENST00000545834.1_Missense_Mutation_p.P631L	NM_012393.2	NP_036525.1	O15067	PUR4_HUMAN	phosphoribosylformylglycinamidine synthase	1055					'de novo' IMP biosynthetic process (GO:0006189)|glutamine metabolic process (GO:0006541)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|phosphoribosylformylglycinamidine synthase activity (GO:0004642)			central_nervous_system(3)|endometrium(8)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	35					L-Glutamine(DB00130)	GCCTCCGTGCCCCGTGAGCCT	0.677																																					p.P1055L		.											.	PFAS-94	0			c.C3164T						.						18.0	17.0	17.0					17																	8170542		2201	4299	6500	SO:0001583	missense	5198	exon24			CCGTGCCCCGTGA	AB002359	CCDS11136.1	17p13.1	2008-07-31	2008-07-31		ENSG00000178921	ENSG00000178921	6.3.5.3		8863	protein-coding gene	gene with protein product	"""FGAR amidotransferase"""	602133				8110788	Standard	NM_012393		Approved	PURL, FGARAT, KIAA0361	uc002gkr.3	O15067	OTTHUMG00000108188	ENST00000314666.6:c.3164C>T	17.37:g.8170542C>T	ENSP00000313490:p.Pro1055Leu	21	0		44	13	NM_012393	0	0	1	1	0	A6H8V8	Missense_Mutation	SNP	ENST00000314666.6	37	CCDS11136.1	.	.	.	.	.	.	.	.	.	.	C	6.971	0.549059	0.13312	.	.	ENSG00000178921	ENST00000545834;ENST00000314666;ENST00000546020	T;T	0.33216	1.42;2.17	5.57	4.6	0.57074	AIR synthase-related protein, C-terminal (1);	0.289920	0.33959	N	0.004381	T	0.20495	0.0493	N	0.22421	0.69	0.48452	D	0.999654	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.04509	-1.0946	10	0.87932	D	0	-5.7605	8.6639	0.34110	0.0:0.8278:0.0:0.1722	.	1055;1055	A8K8N7;O15067	.;PUR4_HUMAN	L	631;1055;464	ENSP00000441706:P631L;ENSP00000313490:P1055L	ENSP00000313490:P1055L	P	+	2	0	PFAS	8111267	0.561000	0.26578	0.827000	0.32855	0.173000	0.22820	1.670000	0.37502	1.368000	0.46115	0.655000	0.94253	CCC	.		0.677	PFAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226994.2		
MAP3K14	9020	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	43364549	43364549	+	RNA	SNP	C	C	T			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr17:43364549C>T	ENST00000344686.2	-	0	616							Q99558	M3K14_HUMAN	mitogen-activated protein kinase kinase kinase 14						cellular response to mechanical stimulus (GO:0071260)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|immune response (GO:0006955)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|T cell costimulation (GO:0031295)	cytosol (GO:0005829)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|NF-kappaB-inducing kinase activity (GO:0004704)|protein kinase activity (GO:0004672)			breast(3)|central_nervous_system(4)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	27						CTCTCCTGCTCAGGGGTCCTG	0.617																																					.													.	MAP3K14-1453	0			.						.						43.0	44.0	44.0					17																	43364549		1988	4161	6149			9020	.			CCTGCTCAGGGGT	Y10256	CCDS74079.1	17q21.31	2014-06-16			ENSG00000006062	ENSG00000006062	2.7.11.25	"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6853	protein-coding gene	gene with protein product	"""serine/threonine protein-kinase"""	604655				9020361	Standard	NM_003954		Approved	NIK, HSNIK, FTDCR1B, HS	uc002iiw.1	Q99558	OTTHUMG00000180364		17.37:g.43364549C>T		60	0		87	20	.	0	0	2	5	3	A8K2D8|D3DX67|Q8IYN1	Missense_Mutation	SNP	ENST00000344686.2	37		.	.	.	.	.	.	.	.	.	.	C	25.5	4.647380	0.87958	.	.	ENSG00000006062	ENST00000344686	.	.	.	5.26	5.26	0.73747	.	0.000000	0.64402	D	0.000005	T	0.79347	0.4430	.	.	.	0.34884	D	0.744823	D	0.63880	0.993	D	0.72625	0.978	T	0.82985	-0.0185	7	0.87932	D	0	.	16.0168	0.80445	0.0:1.0:0.0:0.0	.	170	Q99558	M3K14_HUMAN	K	170	.	ENSP00000342059:E170K	E	-	1	0	MAP3K14	40720332	0.997000	0.39634	0.983000	0.44433	0.963000	0.63663	4.708000	0.61859	2.451000	0.82905	0.563000	0.77884	GAG	.		0.617	MAP3K14-201	KNOWN	basic	processed_transcript	processed_transcript		NM_003954	
ACE	1636	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	61562641	61562641	+	Missense_Mutation	SNP	T	T	C			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr17:61562641T>C	ENST00000290866.4	+	13	1990	c.1966T>C	c.(1966-1968)Tat>Cat	p.Y656H	ACE_ENST00000421982.2_5'UTR|ACE_ENST00000490216.2_Missense_Mutation_p.Y82H|ACE_ENST00000428043.1_Missense_Mutation_p.Y656H|ACE_ENST00000413513.3_Missense_Mutation_p.Y82H|ACE_ENST00000577647.1_Missense_Mutation_p.Y82H|ACE_ENST00000290863.6_Missense_Mutation_p.Y82H	NM_000789.3	NP_000780.1	P12821	ACE_HUMAN	angiotensin I converting enzyme	656	Peptidase M2 2.				angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|arachidonic acid secretion (GO:0050482)|blood vessel remodeling (GO:0001974)|cellular protein metabolic process (GO:0044267)|hematopoietic stem cell differentiation (GO:0060218)|hormone catabolic process (GO:0042447)|kidney development (GO:0001822)|mononuclear cell proliferation (GO:0032943)|peptide catabolic process (GO:0043171)|regulation of blood pressure (GO:0008217)|regulation of renal output by angiotensin (GO:0002019)|regulation of smooth muscle cell migration (GO:0014910)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|regulation of vasoconstriction (GO:0019229)|regulation of vasodilation (GO:0042312)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|bradykinin receptor binding (GO:0031711)|carboxypeptidase activity (GO:0004180)|chloride ion binding (GO:0031404)|drug binding (GO:0008144)|endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|peptidyl-dipeptidase activity (GO:0008241)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(5)|kidney(3)|large_intestine(3)|lung(22)|ovary(6)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	51					Benazepril(DB00542)|Candoxatril(DB00616)|Captopril(DB01197)|Cilazapril(DB01340)|Enalapril(DB00584)|Fosinopril(DB00492)|Lisinopril(DB00722)|Moexipril(DB00691)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Rescinnamine(DB01180)|Spirapril(DB01348)|Trandolapril(DB00519)	TGTGGAGGAATATGACCGGAC	0.552																																					p.Y656H		.											.	ACE-94	0			c.T1966C						.						165.0	123.0	137.0					17																	61562641		2203	4300	6503	SO:0001583	missense	1636	exon13			GAGGAATATGACC	J04144	CCDS11637.1, CCDS45755.1, CCDS54155.1	17q23.3	2013-06-12	2013-06-12		ENSG00000159640	ENSG00000159640	3.4.15.1	"""CD molecules"""	2707	protein-coding gene	gene with protein product	"""peptidyl-dipeptidase A"""	106180	"""angiotensin I converting enzyme (peptidyl-dipeptidase A) 1"""	DCP1		2554286, 10319862	Standard	NM_001178057		Approved	ACE1, CD143	uc002jau.2	P12821	OTTHUMG00000154927	ENST00000290866.4:c.1966T>C	17.37:g.61562641T>C	ENSP00000290866:p.Tyr656His	91	0		111	52	NM_000789	0	0	4	14	10	B0LPF0|B4DXI3|E7EU16|P22966|Q53YX9|Q59GY8|Q7M4L4	Missense_Mutation	SNP	ENST00000290866.4	37	CCDS11637.1	.	.	.	.	.	.	.	.	.	.	T	14.19	2.460662	0.43736	.	.	ENSG00000159640	ENST00000290866;ENST00000428043;ENST00000290863;ENST00000413513	T;T;T;T	0.48836	0.8;0.8;0.8;0.8	5.09	5.09	0.68999	.	0.060975	0.64402	D	0.000002	T	0.71031	0.3292	M	0.86864	2.845	0.80722	D	1	D;D;P;D	0.76494	0.971;0.998;0.881;0.999	P;D;P;D	0.85130	0.887;0.997;0.843;0.994	T	0.75584	-0.3267	10	0.54805	T	0.06	-20.9481	12.3936	0.55373	0.0:0.0:0.0:1.0	.	82;656;82;656	B4DXI3;P12821-2;P12821-3;P12821	.;.;.;ACE_HUMAN	H	656;656;82;82	ENSP00000290866:Y656H;ENSP00000397593:Y656H;ENSP00000290863:Y82H;ENSP00000392247:Y82H	ENSP00000290863:Y82H	Y	+	1	0	ACE	58916373	1.000000	0.71417	1.000000	0.80357	0.861000	0.49209	4.885000	0.63142	1.919000	0.55581	0.379000	0.24179	TAT	.		0.552	ACE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337675.2		
MYOM1	8736	broad.mit.edu	37	18	3188900	3188900	+	Missense_Mutation	SNP	T	T	C	rs548278691		TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr18:3188900T>C	ENST00000356443.4	-	4	950	c.617A>G	c.(616-618)aAg>aGg	p.K206R	MYOM1_ENST00000261606.7_Missense_Mutation_p.K206R|RP13-270P17.2_ENST00000580139.1_RNA|MYOM1_ENST00000400569.3_Missense_Mutation_p.K206R	NM_003803.3|NM_019856.1	NP_003794.3|NP_062830.1	P52179	MYOM1_HUMAN	myomesin 1	206	6 X 6 AA tandem repeats.				muscle contraction (GO:0006936)	M band (GO:0031430)|striated muscle myosin thick filament (GO:0005863)	identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|structural constituent of muscle (GO:0008307)	p.K206R(1)		NS(2)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(20)|ovary(4)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						CGTGGACTGCTTGGATGCTGT	0.532													T|||	1	0.000199681	0.0	0.0014	5008	,	,		15575	0.0		0.0	False		,,,				2504	0.0				p.K206R													.	MYOM1-94	1	Substitution - Missense(1)	endometrium(1)	c.A617G						.						289.0	273.0	279.0					18																	3188900		2064	4189	6253	SO:0001583	missense	8736	exon4			GACTGCTTGGATG	AF185573	CCDS45823.1, CCDS45824.1	18p11.31	2014-09-17	2012-10-17		ENSG00000101605	ENSG00000101605		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7613	protein-coding gene	gene with protein product	"""skelemin"""	603508	"""myomesin 1 (skelemin) (185kD)"", ""myomesin 1 (skelemin) 185kDa"", ""myomesin 1, 185kDa"""			9806852	Standard	NM_019856		Approved		uc002klp.3	P52179	OTTHUMG00000178209	ENST00000356443.4:c.617A>G	18.37:g.3188900T>C	ENSP00000348821:p.Lys206Arg	185	0		237	4	NM_003803	0	0	3	3	0	Q14BD6|Q6H969|Q6ZUU0	Missense_Mutation	SNP	ENST00000356443.4	37	CCDS45824.1	.	.	.	.	.	.	.	.	.	.	T	1.883	-0.457460	0.04508	.	.	ENSG00000101605	ENST00000356443;ENST00000400569;ENST00000261606	T;T;T	0.48522	0.97;0.97;0.81	3.06	0.613	0.17597	.	1.261730	0.06568	N	0.747992	T	0.24851	0.0603	N	0.08118	0	0.09310	N	1	B;B	0.26195	0.144;0.089	B;B	0.19391	0.025;0.011	T	0.19582	-1.0301	10	0.20519	T	0.43	.	6.672	0.23074	0.0:0.167:0.0:0.833	.	206;206	P52179-2;P52179	.;MYOM1_HUMAN	R	206	ENSP00000348821:K206R;ENSP00000383413:K206R;ENSP00000261606:K206R	ENSP00000261606:K206R	K	-	2	0	MYOM1	3178900	0.978000	0.34361	0.001000	0.08648	0.000000	0.00434	1.274000	0.33132	0.017000	0.15025	-1.273000	0.01405	AAG	.		0.532	MYOM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441037.2	NM_003803	
VPS4B	9525	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	61058289	61058289	+	Silent	SNP	T	T	C	rs200045966		TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr18:61058289T>C	ENST00000238497.5	-	11	1457	c.1254A>G	c.(1252-1254)ctA>ctG	p.L418L		NM_004869.3	NP_004860.2	O75351	VPS4B_HUMAN	vacuolar protein sorting 4 homolog B (S. cerevisiae)	418					ATP catabolic process (GO:0006200)|cell cycle (GO:0007049)|cell division (GO:0051301)|endosomal transport (GO:0016197)|endosome organization (GO:0007032)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|intracellular cholesterol transport (GO:0032367)|membrane organization (GO:0061024)|positive regulation of viral release from host cell (GO:1902188)|potassium ion transport (GO:0006813)|protein transport (GO:0015031)|regulation of viral process (GO:0050792)|response to lipid (GO:0033993)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|nucleus (GO:0005634)|vacuolar membrane (GO:0005774)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)			breast(1)|large_intestine(3)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	13						TTGTGTTAGATAGTGACCGCA	0.348													T|||	1	0.000199681	0.0	0.0	5008	,	,		17931	0.001		0.0	False		,,,				2504	0.0				p.L418L		.											.	VPS4B-91	0			c.A1254G						.						121.0	112.0	115.0					18																	61058289		2203	4300	6503	SO:0001819	synonymous_variant	9525	exon11			GTTAGATAGTGAC	AF038960	CCDS11983.1	18q21.33	2010-04-21	2006-04-04	2002-06-14	ENSG00000119541	ENSG00000119541		"""ATPases / AAA-type"""	10895	protein-coding gene	gene with protein product		609983	"""suppressor of K+ transport defect 1"", ""vacuolar protein sorting 4B (yeast)"""	SKD1		11563910	Standard	XM_006722582		Approved	VPS4-2, SKD1B	uc002lix.3	O75351	OTTHUMG00000132790	ENST00000238497.5:c.1254A>G	18.37:g.61058289T>C		134	0		136	17	NM_004869	0	0	37	44	7	Q69HW4|Q9GZS7	Silent	SNP	ENST00000238497.5	37	CCDS11983.1																																																																																			T|0.999;C|0.000		0.348	VPS4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256198.2	NM_004869	
DAZAP1	26528	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	1428875	1428875	+	Missense_Mutation	SNP	A	A	G			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr19:1428875A>G	ENST00000233078.4	+	8	742	c.581A>G	c.(580-582)aAg>aGg	p.K194R	DAZAP1_ENST00000586579.1_3'UTR|DAZAP1_ENST00000336761.6_Missense_Mutation_p.K194R	NM_018959.2	NP_061832.2	Q96EP5	DAZP1_HUMAN	DAZ associated protein 1	194					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|maternal placenta development (GO:0001893)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA stem-loop binding (GO:0035613)			breast(2)|endometrium(2)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)	9		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGGGACAGCAAGAGCCAAGCG	0.657																																					p.K194R		.											.	DAZAP1-153	0			c.A581G						.						37.0	46.0	43.0					19																	1428875		2203	4300	6503	SO:0001583	missense	26528	exon8			ACAGCAAGAGCCA		CCDS12065.1, CCDS12066.1	19p13.3	2013-07-16			ENSG00000071626	ENSG00000071626		"""RNA binding motif (RRM) containing"""	2683	protein-coding gene	gene with protein product	"""deleted in azoospermia associated protein 1"""	607430				10857750, 23658607	Standard	XM_005259530		Approved	MGC19907	uc002lsn.3	Q96EP5		ENST00000233078.4:c.581A>G	19.37:g.1428875A>G	ENSP00000233078:p.Lys194Arg	80	0		87	26	NM_018959	0	0	61	134	73	Q96MJ3|Q9NRR9	Missense_Mutation	SNP	ENST00000233078.4	37	CCDS12065.1	.	.	.	.	.	.	.	.	.	.	A	15.03	2.711305	0.48517	.	.	ENSG00000071626	ENST00000233078;ENST00000336761	T;T	0.73363	-0.74;-0.74	5.03	5.03	0.67393	Nucleotide-binding, alpha-beta plait (1);	0.000000	0.85682	D	0.000000	T	0.74891	0.3776	N	0.24115	0.695	0.80722	D	1	P;B;B	0.46578	0.88;0.073;0.119	P;B;B	0.62184	0.899;0.014;0.031	T	0.71573	-0.4552	10	0.22109	T	0.4	.	13.948	0.64099	1.0:0.0:0.0:0.0	.	261;194;194	Q5IRN4;Q96EP5;Q96EP5-2	.;DAZP1_HUMAN;.	R	194	ENSP00000233078:K194R;ENSP00000337132:K194R	ENSP00000233078:K194R	K	+	2	0	DAZAP1	1379875	1.000000	0.71417	0.983000	0.44433	0.941000	0.58515	6.547000	0.73892	1.906000	0.55180	0.459000	0.35465	AAG	.		0.657	DAZAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449522.3	NM_170711	
EEF2	1938	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	3979985	3979985	+	Missense_Mutation	SNP	C	C	T			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr19:3979985C>T	ENST00000309311.6	-	10	1514	c.1426G>A	c.(1426-1428)Gac>Aac	p.D476N	SNORD37_ENST00000384048.1_RNA	NM_001961.3	NP_001952.1	P13639	EF2_HUMAN	eukaryotic translation elongation factor 2	476					cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|hematopoietic progenitor cell differentiation (GO:0002244)|positive regulation of gene expression (GO:0010628)|positive regulation of translation (GO:0045727)|translation (GO:0006412)|translational elongation (GO:0006414)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|translation activator activity (GO:0008494)|translation elongation factor activity (GO:0003746)			endometrium(4)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	21		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|GBM - Glioblastoma multiforme(1328;0.0223)|STAD - Stomach adenocarcinoma(1328;0.18)		AGGAACTGGTCCACGCCCACG	0.592																																					p.D476N	Colon(165;1804 1908 4071 6587 18799)	.											.	EEF2-90	0			c.G1426A						.						69.0	57.0	61.0					19																	3979985		2203	4300	6503	SO:0001583	missense	1938	exon10			ACTGGTCCACGCC	Z11692	CCDS12117.1	19p13.3	2012-09-20			ENSG00000167658	ENSG00000167658			3214	protein-coding gene	gene with protein product	"""polypeptidyl-tRNA translocase"""	130610		EF2		2610926, 6427766	Standard	NM_001961		Approved	EEF-2	uc002lze.3	P13639		ENST00000309311.6:c.1426G>A	19.37:g.3979985C>T	ENSP00000307940:p.Asp476Asn	85	0		76	23	NM_001961	1	1	765	1429	662	B2RMP5|D6W618|Q58J86	Missense_Mutation	SNP	ENST00000309311.6	37	CCDS12117.1	.	.	.	.	.	.	.	.	.	.	C	35	5.492373	0.96339	.	.	ENSG00000167658	ENST00000543343;ENST00000309311	D	0.82255	-1.59	5.45	5.45	0.79879	Translation elongation factor EFTu/EF1A, domain 2 (1);Translation elongation/initiation factor/Ribosomal, beta-barrel (1);	0.000000	0.85682	D	0.000000	D	0.95239	0.8456	H	0.98965	4.385	0.80722	D	1	D	0.69078	0.997	D	0.83275	0.996	D	0.97201	0.9864	10	0.87932	D	0	-55.7781	18.2479	0.89993	0.0:1.0:0.0:0.0	.	476	P13639	EF2_HUMAN	N	476	ENSP00000307940:D476N	ENSP00000307940:D476N	D	-	1	0	EEF2	3930985	1.000000	0.71417	0.999000	0.59377	0.932000	0.56968	7.773000	0.85462	2.555000	0.86185	0.561000	0.74099	GAC	.		0.592	EEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457615.2	NM_001961	
EIF3G	8666	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	10230530	10230530	+	Silent	SNP	A	A	G			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr19:10230530A>G	ENST00000253108.4	-	1	48	c.6T>C	c.(4-6)ccT>ccC	p.P2P	EIF3G_ENST00000587168.1_5'Flank	NM_003755.3	NP_003746.2			eukaryotic translation initiation factor 3, subunit G											central_nervous_system(1)|lung(1)	2			OV - Ovarian serous cystadenocarcinoma(20;3.53e-09)|Epithelial(33;4.91e-06)|all cancers(31;1.1e-05)			AGTCTCCAGTAGGCATCGCAA	0.642											OREG0025231	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P2P	Colon(124;1100 1638 3822 4510 4876)	.											.	EIF3G-68	0			c.T6C						.						57.0	60.0	59.0					19																	10230530		2203	4300	6503	SO:0001819	synonymous_variant	8666	exon1			TCCAGTAGGCATC	U96074	CCDS12227.1	19p13.2	2013-02-12	2007-07-27	2007-07-27		ENSG00000130811		"""RNA binding motif (RRM) containing"""	3274	protein-coding gene	gene with protein product		603913	"""eukaryotic translation initiation factor 3, subunit 4 delta, 44kDa"""	EIF3S4		9822659	Standard	NM_003755		Approved	eIF3-delta, eIF3-p44, eIF3g	uc002mnd.3	O75821		ENST00000253108.4:c.6T>C	19.37:g.10230530A>G		120	0	663	114	27	NM_003755	0	0	0	0	0		Silent	SNP	ENST00000253108.4	37	CCDS12227.1																																																																																			.		0.642	EIF3G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451144.1		
ZNF627	199692	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	11728624	11728624	+	Missense_Mutation	SNP	G	G	T			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr19:11728624G>T	ENST00000361113.5	+	4	1514	c.1306G>T	c.(1306-1308)Gta>Tta	p.V436L	ZNF627_ENST00000588174.1_3'UTR	NM_145295.3	NP_660338.1	Q7L945	ZN627_HUMAN	zinc finger protein 627	436					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	14						TTACTTTCGAGTACATGAAAA	0.423																																					p.V436L	Melanoma(112;173 1614 10731 17751 23322)	.											.	ZNF627-91	0			c.G1306T						.						55.0	59.0	57.0					19																	11728624		2198	4297	6495	SO:0001583	missense	199692	exon4			TTTCGAGTACATG	AK074846	CCDS42502.1	19p13.2	2013-01-08				ENSG00000198551		"""Zinc fingers, C2H2-type"", ""-"""	30570	protein-coding gene	gene with protein product		612248				12477932	Standard	NM_145295		Approved	FLJ90365	uc002msk.2	Q7L945		ENST00000361113.5:c.1306G>T	19.37:g.11728624G>T	ENSP00000354414:p.Val436Leu	186	0		149	38	NM_145295	0	0	12	21	9	O14846|Q4KMP9|Q6NT81|Q9BRG4	Missense_Mutation	SNP	ENST00000361113.5	37	CCDS42502.1	.	.	.	.	.	.	.	.	.	.	g	3.954	-0.011756	0.07727	.	.	ENSG00000198551	ENST00000361113	T	0.07908	3.15	1.43	-2.1	0.07210	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04588	0.0125	N	0.25825	0.765	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.44345	-0.9334	9	0.23302	T	0.38	.	3.0288	0.06099	0.5661:0.2481:0.1857:0.0	.	436	Q7L945	ZN627_HUMAN	L	436	ENSP00000354414:V436L	ENSP00000354414:V436L	V	+	1	0	ZNF627	11589624	0.000000	0.05858	0.000000	0.03702	0.781000	0.44180	-2.946000	0.00680	-0.450000	0.07107	-0.670000	0.03821	GTA	.		0.423	ZNF627-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458875.1	NM_145295	
NXNL1	115861	broad.mit.edu	37	19	17571478	17571478	+	Silent	SNP	T	T	G			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr19:17571478T>G	ENST00000301944.2	-	1	285	c.201A>C	c.(199-201)gtA>gtC	p.V67V	CTD-2521M24.10_ENST00000594663.1_5'UTR	NM_138454.1	NP_612463.1	Q96CM4	NXNL1_HUMAN	nucleoredoxin-like 1	67	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.				photoreceptor cell maintenance (GO:0045494)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(1)|large_intestine(1)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)	6						CCGCCCGCAGTACATAGAACT	0.582																																					p.V67V													.	NXNL1-46	0			c.A201C						.						76.0	71.0	73.0					19																	17571478		2203	4300	6503	SO:0001819	synonymous_variant	115861	exon1			CCGCAGTACATAG	BC014127	CCDS12360.1	19p13.11	2014-05-21	2007-08-16	2007-08-16	ENSG00000171773	ENSG00000171773			25179	protein-coding gene	gene with protein product		608791	"""thioredoxin-like 6"""	TXNL6		12477932	Standard	NM_138454		Approved	RDCVF	uc002ngs.3	Q96CM4	OTTHUMG00000182798	ENST00000301944.2:c.201A>C	19.37:g.17571478T>G		156	0		154	4	NM_138454	0	0	0	0	0	Q0QD37	Silent	SNP	ENST00000301944.2	37	CCDS12360.1																																																																																			.		0.582	NXNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463803.1	NM_138454	
BCKDHA	593	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	41928188	41928188	+	Missense_Mutation	SNP	C	C	G			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr19:41928188C>G	ENST00000269980.2	+	6	1134	c.766C>G	c.(766-768)Ctt>Gtt	p.L256V	CTC-435M10.3_ENST00000540732.1_Missense_Mutation_p.L290V|BCKDHA_ENST00000457836.2_Missense_Mutation_p.L234V|BCKDHA_ENST00000535632.1_3'UTR|BCKDHA_ENST00000595085.1_Missense_Mutation_p.L290V	NM_000709.3|NM_001164783.1	NP_000700.1|NP_001158255.1	P12694	ODBA_HUMAN	branched chain keto acid dehydrogenase E1, alpha polypeptide	256					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)	mitochondrial alpha-ketoglutarate dehydrogenase complex (GO:0005947)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) activity (GO:0003863)|alpha-ketoacid dehydrogenase activity (GO:0003826)|carboxy-lyase activity (GO:0016831)|metal ion binding (GO:0046872)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)	10						CGCTGCCACACTTGAGTGCCC	0.612																																					p.L256V		.											.	BCKDHA-90	0			c.C766G						.						114.0	100.0	104.0					19																	41928188		2203	4300	6503	SO:0001583	missense	593	exon6			GCCACACTTGAGT	J04474	CCDS12581.1	19q13.1-q13.2	2008-07-09	2005-11-29		ENSG00000248098	ENSG00000248098			986	protein-coding gene	gene with protein product	"""maple syrup urine disease"""	608348	"""branched chain keto acid dehydrogenase E1, alpha polypeptide (maple syrup urine disease)"", ""2-oxoisovalerate dehydrogenase (lipoamide)"""	OVD1A			Standard	NM_000709		Approved	MSU	uc002oqq.3	P12694	OTTHUMG00000168128	ENST00000269980.2:c.766C>G	19.37:g.41928188C>G	ENSP00000269980:p.Leu256Val	200	1		173	38	NM_000709	0	0	25	50	25	B4DP47|E7EW46|Q16034|Q16472	Missense_Mutation	SNP	ENST00000269980.2	37	CCDS12581.1	.	.	.	.	.	.	.	.	.	.	C	16.92	3.256185	0.59321	.	.	ENSG00000255730;ENSG00000248098;ENSG00000248098;ENSG00000248098;ENSG00000248098	ENST00000540732;ENST00000269980;ENST00000542943;ENST00000457836;ENST00000378196	D;D;D;D	0.95756	-3.8;-3.8;-3.8;-3.8	4.77	2.48	0.30137	Dehydrogenase, E1 component (1);	0.072118	0.53938	D	0.000049	D	0.96543	0.8872	M	0.81802	2.56	0.54753	D	0.999983	D;B;P;B	0.59767	0.986;0.407;0.88;0.193	P;B;P;B	0.59012	0.85;0.219;0.71;0.132	D	0.95960	0.8961	10	0.59425	D	0.04	-34.1699	10.718	0.46023	0.0:0.812:0.0:0.188	.	234;256;256;290	B4DP47;Q59EI3;P12694;F5H5P2	.;.;ODBA_HUMAN;.	V	290;256;227;234;256	ENSP00000443246:L290V;ENSP00000269980:L256V;ENSP00000440345:L227V;ENSP00000416000:L234V	ENSP00000269980:L256V	L	+	1	0	BCKDHA;CTC-435M10.3	46620028	0.863000	0.29885	0.621000	0.29145	0.908000	0.53690	1.593000	0.36686	1.209000	0.43321	0.563000	0.77884	CTT	.		0.612	BCKDHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398313.3	NM_000709	
GRHL1	29841	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	10101557	10101557	+	Missense_Mutation	SNP	G	G	A	rs140278187		TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr2:10101557G>A	ENST00000324907.9	+	4	797	c.661G>A	c.(661-663)Gtt>Att	p.V221I	GRHL1_ENST00000405379.2_Missense_Mutation_p.V221I|GRHL1_ENST00000324883.5_Silent_p.A57A	NM_198182.2	NP_937825.2	Q9NZI5	GRHL1_HUMAN	grainyhead-like 1 (Drosophila)	221					cellular lipid metabolic process (GO:0044255)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(1)|large_intestine(2)|lung(8)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	17	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.172)|OV - Ovarian serous cystadenocarcinoma(76;0.246)		CAAGGAAGGCGTTCAGGAGGT	0.463													G|||	1	0.000199681	0.0	0.0	5008	,	,		19940	0.0		0.001	False		,,,				2504	0.0				p.V221I		.											.	GRHL1-92	0			c.G661A						.	G	ILE/VAL	0,4406		0,0,2203	77.0	76.0	76.0		661	4.6	1.0	2	dbSNP_134	76	6,8594	5.0+/-18.6	0,6,4294	yes	missense	GRHL1	NM_198182.2	29	0,6,6497	AA,AG,GG		0.0698,0.0,0.0461	benign	221/619	10101557	6,13000	2203	4300	6503	SO:0001583	missense	29841	exon4			GAAGGCGTTCAGG	AF198489	CCDS33144.1, CCDS33144.2	2p25.2	2008-02-05	2005-07-11	2005-07-11	ENSG00000134317	ENSG00000134317			17923	protein-coding gene	gene with protein product		609786	"""transcription factor CP2-like 2"""	TFCP2L2		10644752, 12393799	Standard	NM_198182		Approved	LBP-32, MGR	uc002raa.3	Q9NZI5	OTTHUMG00000151704	ENST00000324907.9:c.661G>A	2.37:g.10101557G>A	ENSP00000324693:p.Val221Ile	154	0		170	54	NM_198182	0	0	0	0	0	A6NLA4|B2R7E4|B5MEC2|Q53T93|Q6NWN7|Q6NWN8|Q6NWN9|Q8NI33	Missense_Mutation	SNP	ENST00000324907.9	37	CCDS33144.2	.	.	.	.	.	.	.	.	.	.	G	13.48	2.248540	0.39797	0.0	6.98E-4	ENSG00000134317	ENST00000405379;ENST00000324907	T;T	0.11604	2.76;2.76	5.5	4.63	0.57726	.	0.205183	0.45361	D	0.000378	T	0.07369	0.0186	N	0.08118	0	0.80722	D	1	P	0.39520	0.676	B	0.41666	0.363	T	0.47394	-0.9121	10	0.23302	T	0.38	.	14.5094	0.67774	0.0707:0.0:0.9293:0.0	.	221	Q9NZI5	GRHL1_HUMAN	I	221	ENSP00000384209:V221I;ENSP00000324693:V221I	ENSP00000324693:V221I	V	+	1	0	GRHL1	10019008	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.852000	0.55934	1.337000	0.45525	-0.244000	0.11960	GTT	G|1.000;A|0.000		0.463	GRHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323543.2	NM_014552	
BRE	9577	broad.mit.edu	37	2	28550286	28550286	+	Missense_Mutation	SNP	A	A	G			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr2:28550286A>G	ENST00000344773.2	+	12	1372	c.1234A>G	c.(1234-1236)Aga>Gga	p.R412G	BRE_ENST00000379632.2_Intron|BRE_ENST00000342045.2_Intron|BRE_ENST00000379624.1_Intron|BRE_ENST00000361704.2_Intron	NM_004899.4	NP_004890.2			brain and reproductive organ-expressed (TNFRSF1A modulator)											NS(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(11)|prostate(2)|skin(2)	23	Acute lymphoblastic leukemia(172;0.155)					AGAGGGAGAGAGAACTGCTCA	0.478																																					p.R412G													.	BRE-228	0			c.A1234G						.						68.0	79.0	75.0					2																	28550286		2203	4300	6503	SO:0001583	missense	9577	exon12			GGAGAGAGAACTG	AF015767	CCDS1763.1, CCDS1764.1, CCDS1765.1	2p23	2008-02-05			ENSG00000158019	ENSG00000158019			1106	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 4"""	610497				9737713, 7826398	Standard	NM_004899		Approved	BRCC45, BRCC4	uc002rls.3	Q9NXR7	OTTHUMG00000097831	ENST00000344773.2:c.1234A>G	2.37:g.28550286A>G	ENSP00000343412:p.Arg412Gly	301	0		307	7	NM_004899	0	0	15	15	0		Missense_Mutation	SNP	ENST00000344773.2	37	CCDS1764.1	.	.	.	.	.	.	.	.	.	.	A	12.29	1.893537	0.33442	.	.	ENSG00000158019	ENST00000344773	.	.	.	3.24	0.643	0.17770	.	.	.	.	.	T	0.40347	0.1113	.	.	.	0.33502	D	0.590076	B	0.20780	0.048	B	0.18263	0.021	T	0.45249	-0.9274	7	0.87932	D	0	0.1143	7.4919	0.27466	0.537:0.463:0.0:0.0	.	412	Q9NXR7-1	.	G	412	.	ENSP00000343412:R412G	R	+	1	2	BRE	28403790	0.042000	0.20092	0.519000	0.27824	0.987000	0.75469	0.226000	0.17776	0.125000	0.18397	0.379000	0.24179	AGA	.		0.478	BRE-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000215111.1		
SCTR	6344	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	120194829	120194829	+	IGR	SNP	T	T	C			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr2:120194829T>C	ENST00000019103.5	-	0	1865				TMEM37_ENST00000409826.1_Missense_Mutation_p.I141T|TMEM37_ENST00000465296.1_3'UTR|TMEM37_ENST00000306406.4_Missense_Mutation_p.I129T	NM_002980.2	NP_002971.2	P47872	SCTR_HUMAN	secretin receptor						digestion (GO:0007586)|excretion (GO:0007588)|G-protein coupled receptor signaling pathway (GO:0007186)	cytoplasmic microtubule (GO:0005881)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	secretin receptor activity (GO:0015055)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(3)	19					Secretin(DB00021)	ATGGGTTCCATCCTCCTCCTG	0.567																																					p.I129T		.											.	TMEM37-135	0			c.T386C						.						178.0	170.0	172.0					2																	120194829		2203	4300	6503	SO:0001628	intergenic_variant	140738	exon2			GTTCCATCCTCCT		CCDS2127.1	2q14.1	2012-08-10			ENSG00000080293	ENSG00000080293		"""GPCR / Class B : Glucagon receptors"""	10608	protein-coding gene	gene with protein product		182098				1646711	Standard	NM_002980		Approved		uc002tma.3	P47872	OTTHUMG00000131407		2.37:g.120194829T>C		464	0		471	126	NM_183240	0	0	31	58	27	Q12961|Q13213|Q53T00	Missense_Mutation	SNP	ENST00000019103.5	37	CCDS2127.1	.	.	.	.	.	.	.	.	.	.	T	0.231	-1.020958	0.02061	.	.	ENSG00000171227	ENST00000409826;ENST00000306406	.	.	.	4.97	-0.356	0.12583	.	1.570890	0.03832	N	0.269166	T	0.20129	0.0484	N	0.16478	0.41	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.11542	-1.0583	9	0.28530	T	0.3	-15.3671	1.4103	0.02290	0.1454:0.1645:0.1419:0.5481	.	129	Q8WXS4	CCGL_HUMAN	T	141;129	.	ENSP00000303148:I129T	I	+	2	0	TMEM37	119911299	0.156000	0.22821	0.071000	0.20095	0.017000	0.09413	0.523000	0.22925	-0.194000	0.10399	0.533000	0.62120	ATC	.		0.567	SCTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254198.2		
NEB	4703	broad.mit.edu	37	2	152484285	152484285	+	Missense_Mutation	SNP	C	C	A			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr2:152484285C>A	ENST00000172853.10	-	65	9313	c.9166G>T	c.(9166-9168)Gat>Tat	p.D3056Y	NEB_ENST00000427231.2_Missense_Mutation_p.D3299Y|NEB_ENST00000409198.1_Missense_Mutation_p.D3056Y|NEB_ENST00000397345.3_Missense_Mutation_p.D3299Y|NEB_ENST00000603639.1_Missense_Mutation_p.D3299Y|NEB_ENST00000604864.1_Missense_Mutation_p.D3299Y			P20929	NEBU_HUMAN	nebulin	3056					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		TTGGGGTCATCTTCAATGTTC	0.453																																					p.D3299Y													.	NEB-145	0			c.G9895T						.						263.0	247.0	252.0					2																	152484285		1915	4130	6045	SO:0001583	missense	4703	exon69			GGTCATCTTCAAT	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.9166G>T	2.37:g.152484285C>A	ENSP00000172853:p.Asp3056Tyr	538	3		517	7	NM_001271208	0	0	0	0	0	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	ENST00000172853.10	37		.	.	.	.	.	.	.	.	.	.	C	26.9	4.780183	0.90195	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000172853	T;T;T;T	0.69306	-0.39;-0.39;-0.39;-0.39	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	D	0.85106	0.5621	M	0.87900	2.915	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.87186	0.2231	10	0.87932	D	0	.	19.5796	0.95461	0.0:1.0:0.0:0.0	.	3056	P20929	NEBU_HUMAN	Y	3056;3299;3299;3056	ENSP00000386259:D3056Y;ENSP00000380505:D3299Y;ENSP00000416578:D3299Y;ENSP00000172853:D3056Y	ENSP00000172853:D3056Y	D	-	1	0	NEB	152192531	1.000000	0.71417	0.948000	0.38648	0.941000	0.58515	7.683000	0.84093	2.624000	0.88883	0.655000	0.94253	GAT	.		0.453	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543	
KCNH7	90134	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	163241347	163241347	+	Missense_Mutation	SNP	A	A	G			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr2:163241347A>G	ENST00000332142.5	-	13	2912	c.2813T>C	c.(2812-2814)aTc>aCc	p.I938T		NM_033272.3	NP_150375.2	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 7	938					circadian rhythm (GO:0007623)|potassium ion transmembrane transport (GO:0071805)|protein heterooligomerization (GO:0051291)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)|signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(22)|lung(53)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	108					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	AATGGAGGAGATGAAAGATGA	0.408																																					p.I938T	GBM(196;1492 2208 17507 24132 45496)	.											.	KCNH7-95	0			c.T2813C						.						242.0	233.0	236.0					2																	163241347		2203	4300	6503	SO:0001583	missense	90134	exon13			GAGGAGATGAAAG	AF032897	CCDS2219.1, CCDS2220.1	2q24.3	2012-07-05			ENSG00000184611	ENSG00000184611		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18863	protein-coding gene	gene with protein product		608169				16382104	Standard	NM_173162		Approved	Kv11.3, HERG3, erg3	uc002uch.2	Q9NS40	OTTHUMG00000132069	ENST00000332142.5:c.2813T>C	2.37:g.163241347A>G	ENSP00000331727:p.Ile938Thr	459	1		437	141	NM_033272	0	0	0	0	0	Q53QU4|Q53TB7|Q53TP9|Q8IV15	Missense_Mutation	SNP	ENST00000332142.5	37	CCDS2219.1	.	.	.	.	.	.	.	.	.	.	A	8.070	0.770061	0.15983	.	.	ENSG00000184611	ENST00000332142	D	0.98474	-4.95	5.6	4.45	0.53987	.	0.526834	0.21408	N	0.075025	D	0.92446	0.7602	N	0.08118	0	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	D	0.88732	0.3237	10	0.10636	T	0.68	.	9.6489	0.39886	0.9219:0.0:0.0781:0.0	.	938	Q9NS40	KCNH7_HUMAN	T	938	ENSP00000331727:I938T	ENSP00000331727:I938T	I	-	2	0	KCNH7	162949593	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.587000	0.53957	2.141000	0.66446	0.533000	0.62120	ATC	.		0.408	KCNH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255093.1	NM_033272	
SLC5A3	6526	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	35467607	35467607	+	Missense_Mutation	SNP	G	G	A			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr21:35467607G>A	ENST00000381151.3	+	2	622	c.110G>A	c.(109-111)aGt>aAt	p.S37N	AP000320.7_ENST00000362077.4_RNA|SLC5A3_ENST00000608209.1_Missense_Mutation_p.S37N|MRPS6_ENST00000399312.2_Intron			P53794	SC5A3_HUMAN	solute carrier family 5 (sodium/myo-inositol cotransporter), member 3	37					inositol metabolic process (GO:0006020)|peripheral nervous system development (GO:0007422)|regulation of respiratory gaseous exchange (GO:0043576)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	myo-inositol:sodium symporter activity (GO:0005367)			breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	20						AGCACCGTGAGTGGATACTTC	0.488																																					p.S37N		.											.	SLC5A3-92	0			c.G110A						.						169.0	168.0	169.0					21																	35467607		2203	4300	6503	SO:0001583	missense	6526	exon2			CCGTGAGTGGATA		CCDS33549.1	21q22.11	2013-05-22	2008-09-02		ENSG00000198743	ENSG00000198743		"""Solute carriers"""	11038	protein-coding gene	gene with protein product		600444	"""solute carrier family 5 (inositol transporter), member 3"""			7789985	Standard	NM_006933		Approved	SMIT, SMIT1	uc002yto.3	P53794	OTTHUMG00000065821	ENST00000381151.3:c.110G>A	21.37:g.35467607G>A	ENSP00000370543:p.Ser37Asn	265	0		308	107	NM_006933	0	0	2	5	3	O43489	Missense_Mutation	SNP	ENST00000381151.3	37	CCDS33549.1	.	.	.	.	.	.	.	.	.	.	G	14.33	2.502590	0.44455	.	.	ENSG00000198743	ENST00000381151	D	0.86497	-2.13	6.09	6.09	0.99107	.	0.000000	0.85682	D	0.000000	D	0.84252	0.5431	L	0.42487	1.325	0.52099	D	0.999947	B	0.27286	0.174	B	0.20767	0.031	T	0.80355	-0.1417	10	0.56958	D	0.05	.	19.2541	0.93938	0.0:0.0:1.0:0.0	.	37	P53794	SC5A3_HUMAN	N	37	ENSP00000370543:S37N	ENSP00000370543:S37N	S	+	2	0	SLC5A3	34389477	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.594000	0.98254	2.898000	0.99336	0.596000	0.82720	AGT	.		0.488	SLC5A3-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000141037.1		
SUSD2	56241	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	24581140	24581140	+	Silent	SNP	C	C	A			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr22:24581140C>A	ENST00000358321.3	+	6	1122	c.861C>A	c.(859-861)gcC>gcA	p.A287A		NM_019601.3	NP_062547.1	Q9UGT4	SUSD2_HUMAN	sushi domain containing 2	287	AMOP. {ECO:0000255|PROSITE- ProRule:PRU00347}.				immune response (GO:0006955)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	26						ACCCTGTGGCCTGGGCACGAA	0.662																																					p.A287A		.											.	SUSD2-91	0			c.C861A						.						29.0	30.0	30.0					22																	24581140		2203	4299	6502	SO:0001819	synonymous_variant	56241	exon6			TGTGGCCTGGGCA	AK026431	CCDS13824.1	22q11-q12	2005-08-16			ENSG00000099994	ENSG00000099994			30667	protein-coding gene	gene with protein product		615825				12477932	Standard	NM_019601		Approved	BK65A6.2, FLJ22778	uc002zzn.1	Q9UGT4	OTTHUMG00000150792	ENST00000358321.3:c.861C>A	22.37:g.24581140C>A		79	0		69	21	NM_019601	0	0	15	17	2	Q9H5Y6	Silent	SNP	ENST00000358321.3	37	CCDS13824.1																																																																																			.		0.662	SUSD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320088.1	NM_019601	
BAIAP2L2	80115	ucsc.edu	37	22	38483204	38483204	+	Missense_Mutation	SNP	C	C	T	rs201090429	byFrequency	TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr22:38483204C>T	ENST00000381669.3	-	11	1330	c.1186G>A	c.(1186-1188)Gtg>Atg	p.V396M	CTA-228A9.3_ENST00000609162.1_lincRNA	NM_025045.4	NP_079321.3	Q6UXY1	BI2L2_HUMAN	BAI1-associated protein 2-like 2	396					filopodium assembly (GO:0046847)|membrane organization (GO:0061024)|regulation of actin cytoskeleton organization (GO:0032956)|signal transduction (GO:0007165)	cell-cell contact zone (GO:0044291)|cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	phospholipid binding (GO:0005543)			large_intestine(2)|lung(1)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)	8	Melanoma(58;0.045)					atgggggtcacgggggtcatg	0.627													C|||	25	0.00499201	0.0068	0.0	5008	,	,		13610	0.003		0.005	False		,,,				2504	0.0082				p.V396M													.	BAIAP2L2-91	0			c.G1186A						.						37.0	45.0	42.0					22																	38483204		1928	4122	6050	SO:0001583	missense	80115	exon11			GGGTCACGGGGGT	BC015619	CCDS43018.1	22q13.1	2005-02-09			ENSG00000128298	ENSG00000128298			26203	protein-coding gene	gene with protein product							Standard	NM_025045		Approved	FLJ22582	uc003auw.3	Q6UXY1	OTTHUMG00000151197	ENST00000381669.3:c.1186G>A	22.37:g.38483204C>T	ENSP00000371085:p.Val396Met	60	2		90	4	NM_025045	0	0	17	17	0	B0QYE2|Q96BG7	Missense_Mutation	SNP	ENST00000381669.3	37	CCDS43018.1	.	.	.	.	.	.	.	.	.	.	C	7.609	0.674489	0.14841	.	.	ENSG00000128298	ENST00000381669;ENST00000402500;ENST00000428572	T;T	0.21932	1.98;1.98	3.32	-3.36	0.04913	.	1.502590	0.04754	N	0.425150	T	0.11110	0.0271	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.33240	-0.9876	10	0.45353	T	0.12	-10.8299	4.4703	0.11708	0.2523:0.4451:0.0:0.3026	.	396	Q6UXY1	BI2L2_HUMAN	M	396;396;87	ENSP00000371085:V396M;ENSP00000410074:V87M	ENSP00000371085:V396M	V	-	1	0	BAIAP2L2	36813150	.	.	0.275000	0.24674	0.069000	0.16628	.	.	-0.339000	0.08401	-1.449000	0.01048	GTG	C|0.997;T|0.003		0.627	BAIAP2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321727.1	NM_025045	
TTLL1	25809	broad.mit.edu;bcgsc.ca	37	22	43442517	43442517	+	Silent	SNP	C	C	G			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr22:43442517C>G	ENST00000266254.7	-	10	1281	c.1041G>C	c.(1039-1041)ctG>ctC	p.L347L	AL022476.2_ENST00000443063.1_RNA|TTLL1_ENST00000331018.7_Silent_p.L318L	NM_012263.4	NP_036395.1	O95922	TTLL1_HUMAN	tubulin tyrosine ligase-like family, member 1	347	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				axoneme assembly (GO:0035082)|epithelial cilium movement (GO:0003351)|protein polyglutamylation (GO:0018095)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	tubulin-glutamic acid ligase activity (GO:0070740)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|skin(2)|stomach(1)	23		Ovarian(80;0.0694)		BRCA - Breast invasive adenocarcinoma(115;0.00461)		TGTCATTAATCAGGTTGTACT	0.512																																					p.L347L													.	TTLL1-92	0			c.G1041C						.						365.0	313.0	331.0					22																	43442517		2203	4300	6503	SO:0001819	synonymous_variant	25809	exon10			ATTAATCAGGTTG	AL096886	CCDS14043.1	22q13.1	2013-02-14			ENSG00000100271	ENSG00000100271		"""Tubulin tyrosine ligase-like family"""	1312	protein-coding gene	gene with protein product		608955	"""tubulin tyrosine ligase-like 1"""	C22orf7		10591208, 11054573	Standard	NM_012263		Approved		uc003bdi.3	O95922	OTTHUMG00000150699	ENST00000266254.7:c.1041G>C	22.37:g.43442517C>G		305	0		290	13	NM_012263	0	0	19	19	0	B2RDS7|Q9BR27|Q9NRS9|Q9UMU0	Silent	SNP	ENST00000266254.7	37	CCDS14043.1	.	.	.	.	.	.	.	.	.	.	C	3.860	-0.030135	0.07543	.	.	ENSG00000100271	ENST00000495814	.	.	.	5.41	0.463	0.16700	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.2216	0.15371	0.1717:0.307:0.4416:0.0796	.	.	.	.	S	273	.	.	X	-	2	2	TTLL1	41772461	0.997000	0.39634	0.466000	0.27168	0.403000	0.30841	0.331000	0.19733	0.219000	0.20840	0.555000	0.69702	TGA	.		0.512	TTLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319659.1	NM_012263	
GRM2	2912	broad.mit.edu	37	3	51746862	51746862	+	Missense_Mutation	SNP	C	C	T			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr3:51746862C>T	ENST00000395052.3	+	3	1058	c.824C>T	c.(823-825)gCc>gTc	p.A275V	GRM2_ENST00000475478.1_Intron|GRM2_ENST00000442933.2_Missense_Mutation_p.A275V	NM_000839.3	NP_000830.2	Q14416	GRM2_HUMAN	glutamate receptor, metabotropic 2	275					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|glutamate secretion (GO:0014047)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(1)|lung(11)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		TCTGAGGATGCCCGGGAGCTG	0.677																																					p.A275V													.	GRM2-522	0			c.C824T						.						27.0	28.0	28.0					3																	51746862		2202	4295	6497	SO:0001583	missense	2912	exon3			AGGATGCCCGGGA	L35318	CCDS2834.1	3p21.2	2013-09-20			ENSG00000164082	ENSG00000164082		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4594	protein-coding gene	gene with protein product		604099				7620613	Standard	NM_000839		Approved	GPRC1B, mGlu2, MGLUR2	uc010hlv.3	Q14416	OTTHUMG00000156902	ENST00000395052.3:c.824C>T	3.37:g.51746862C>T	ENSP00000378492:p.Ala275Val	61	0		116	4	NM_000839	0	0	0	0	0	B0M0K7|Q14CU5|Q52MC6|Q9H3N6	Missense_Mutation	SNP	ENST00000395052.3	37	CCDS2834.1	.	.	.	.	.	.	.	.	.	.	c	15.79	2.937342	0.52972	.	.	ENSG00000164082	ENST00000395052;ENST00000442933	D;D	0.83506	-1.73;-1.73	5.23	5.23	0.72850	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	T	0.74535	0.3729	N	0.26042	0.785	0.80722	D	1	P	0.36438	0.553	B	0.37692	0.256	T	0.71307	-0.4632	10	0.07813	T	0.8	.	19.2131	0.93765	0.0:1.0:0.0:0.0	.	275	Q14416	GRM2_HUMAN	V	275	ENSP00000378492:A275V;ENSP00000408906:A275V	ENSP00000296479:A275V	A	+	2	0	GRM2	51721902	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.804000	0.85993	2.633000	0.89246	0.645000	0.84053	GCC	.		0.677	GRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346542.1		
MFN1	55669	ucsc.edu	37	3	179094914	179094914	+	Silent	SNP	T	T	G			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr3:179094914T>G	ENST00000471841.1	+	11	1308	c.1182T>G	c.(1180-1182)gtT>gtG	p.V394V	MFN1_ENST00000280653.7_Silent_p.V394V|MFN1_ENST00000263969.5_Silent_p.V394V	NM_033540.2	NP_284941	Q8IWA4	MFN1_HUMAN	mitofusin 1	394					mitochondrial fusion (GO:0008053)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(14)|ovary(3)|prostate(1)|urinary_tract(1)	31	all_cancers(143;1.67e-16)|Ovarian(172;0.0172)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;5.78e-26)|GBM - Glioblastoma multiforme(14;0.00225)|BRCA - Breast invasive adenocarcinoma(182;0.0923)			CACTGGATGTTAAGAAAAAAA	0.358																																					p.V394V													.	MFN1-155	0			c.T1182G						.						66.0	65.0	65.0					3																	179094914		2203	4300	6503	SO:0001819	synonymous_variant	55669	exon11			GGATGTTAAGAAA	AF054986	CCDS3228.1	3q26.32	2006-12-13			ENSG00000171109	ENSG00000171109			18262	protein-coding gene	gene with protein product		608506				8358434, 11181170	Standard	NM_033540		Approved	FLJ20693	uc003fjs.3	Q8IWA4	OTTHUMG00000157385	ENST00000471841.1:c.1182T>G	3.37:g.179094914T>G		99	0		151	1	NM_033540	0	0	69	81	12	B2RAR1|D3DNR6|O15323|O60639|Q9BZB5|Q9NWQ2	Silent	SNP	ENST00000471841.1	37	CCDS3228.1																																																																																			.		0.358	MFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348654.2	NM_017927	
PCYT1A	5130	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	195974373	195974373	+	Silent	SNP	G	G	A			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr3:195974373G>A	ENST00000292823.2	-	6	523	c.351C>T	c.(349-351)ctC>ctT	p.L117L	PCYT1A_ENST00000431016.1_Silent_p.L117L|PCYT1A_ENST00000419333.1_Silent_p.L117L|PCYT1A_ENST00000491544.1_5'UTR	NM_005017.2	NP_005008.2	P49585	PCY1A_HUMAN	phosphate cytidylyltransferase 1, choline, alpha	117					CDP-choline pathway (GO:0006657)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|glycogen granule (GO:0042587)	choline-phosphate cytidylyltransferase activity (GO:0004105)|lipid binding (GO:0008289)			cervix(1)|endometrium(3)|large_intestine(8)|lung(5)|ovary(1)	18	all_cancers(143;1.19e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;1.28e-24)|all cancers(36;1.01e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00259)	Choline(DB00122)|Lamivudine(DB00709)	AGTTGTGTGTGAGCTCATCAC	0.527																																					p.L117L		.											.	PCYT1A-90	0			c.C351T						.						171.0	138.0	149.0					3																	195974373		2203	4300	6503	SO:0001819	synonymous_variant	5130	exon6			GTGTGTGAGCTCA	L28957	CCDS3315.1	3q29	2010-07-19	2005-09-05		ENSG00000161217	ENSG00000161217	2.7.7.15		8754	protein-coding gene	gene with protein product	"""phosphate cytidylyltransferase 1, choline, alpha isoform"""	123695	"""phosphate cytidylyltransferase 1, choline, alpha isoform"""	PCYT1		7918629	Standard	NM_005017		Approved	CT, CTPCT	uc003fwg.3	P49585	OTTHUMG00000155670	ENST00000292823.2:c.351C>T	3.37:g.195974373G>A		170	0		245	63	NM_005017	0	0	27	37	10	A9LYK9|D3DXB1|Q86Y88	Silent	SNP	ENST00000292823.2	37	CCDS3315.1																																																																																			.		0.527	PCYT1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341147.1	NM_005017	
NRROS	375387	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	196387840	196387840	+	Silent	SNP	C	C	T			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr3:196387840C>T	ENST00000328557.4	+	3	1529	c.1326C>T	c.(1324-1326)ccC>ccT	p.P442P		NM_198565.1	NP_940967.1	Q86YC3	NRROS_HUMAN	negative regulator of reactive oxygen species	442					immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|superoxide metabolic process (GO:0006801)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)											CACTTTGTCCCCTGCCAGCTG	0.592																																					p.P442P		.											.	LRRC33-92	0			c.C1326T						.						144.0	148.0	147.0					3																	196387840		2203	4300	6503	SO:0001819	synonymous_variant	375387	exon3			TTGTCCCCTGCCA	AY358322	CCDS3319.1	3q29	2013-07-02	2013-07-02	2013-07-02	ENSG00000174004	ENSG00000174004			24613	protein-coding gene	gene with protein product		615322	"""leucine rich repeat containing 33"""	LRRC33		12975309	Standard	NM_198565		Approved	UNQ3030, ELLP3030, MGC50789, GARPL1	uc003fwv.3	Q86YC3	OTTHUMG00000155569	ENST00000328557.4:c.1326C>T	3.37:g.196387840C>T		439	1		489	202	NM_198565	0	0	9	9	0		Silent	SNP	ENST00000328557.4	37	CCDS3319.1																																																																																			.		0.592	NRROS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340676.1	NM_198565	
CLOCK	9575	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	56301654	56301654	+	Silent	SNP	A	A	T			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr4:56301654A>T	ENST00000309964.4	-	22	2719	c.2469T>A	c.(2467-2469)tcT>tcA	p.S823S	CLOCK_ENST00000513440.1_Silent_p.S823S|CLOCK_ENST00000381322.1_Silent_p.S823S	NM_004898.3	NP_004889.1	O15516	CLOCK_HUMAN	clock circadian regulator	823	Interaction with NR3C1. {ECO:0000250|UniProtKB:O08785}.|Poly-Gln.				cellular response to ionizing radiation (GO:0071479)|chromatin organization (GO:0006325)|circadian regulation of gene expression (GO:0032922)|circadian rhythm (GO:0007623)|DNA damage checkpoint (GO:0000077)|histone acetylation (GO:0016573)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of transcription, DNA-templated (GO:0045892)|photoperiodism (GO:0009648)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of hair cycle (GO:0042634)|regulation of insulin secretion (GO:0050796)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of type B pancreatic cell development (GO:2000074)|response to redox state (GO:0051775)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|chromosome (GO:0005694)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|histone acetyltransferase activity (GO:0004402)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(8)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38	Lung NSC(11;0.00335)|Glioma(25;0.08)|all_epithelial(27;0.0992)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(4;1.62e-07)|Lung(4;1.34e-06)|Epithelial(7;0.0107)			GCTGTTGCTGAGACTGATGTT	0.527																																					p.S823S		.											.	CLOCK-515	0			c.T2469A						.						273.0	230.0	244.0					4																	56301654		2203	4300	6503	SO:0001819	synonymous_variant	9575	exon23			TTGCTGAGACTGA	AF011568	CCDS3500.1	4q12	2012-12-07	2012-12-07		ENSG00000134852	ENSG00000134852		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	2082	protein-coding gene	gene with protein product		601851	"""clock (mouse) homolog"", ""clock homolog (mouse)"""			10198158	Standard	NM_001267843		Approved	KIAA0334, KAT13D, bHLHe8	uc003hba.2	O15516	OTTHUMG00000102141	ENST00000309964.4:c.2469T>A	4.37:g.56301654A>T		205	0		195	62	NM_004898	0	0	5	11	6	A0AV01|A2I2N9|O14516|Q9UIT8	Silent	SNP	ENST00000309964.4	37	CCDS3500.1																																																																																			.		0.527	CLOCK-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361993.2	NM_004898	
UGT2B7	7364	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	69978199	69978199	+	Silent	SNP	A	A	G			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr4:69978199A>G	ENST00000305231.7	+	6	1381	c.1335A>G	c.(1333-1335)ttA>ttG	p.L445L	UGT2B7_ENST00000509763.1_3'UTR|UGT2B7_ENST00000508661.1_3'UTR	NM_001074.2	NP_001065.2	P16662	UD2B7_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B7	445					androgen metabolic process (GO:0008209)|cellular glucuronidation (GO:0052695)|lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucuronosyltransferase activity (GO:0015020)			autonomic_ganglia(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(16)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	38					Atorvastatin(DB01076)|Carbamazepine(DB00564)|Chenodeoxycholic acid(DB06777)|Codeine(DB00318)|Dabigatran etexilate(DB06695)|Dapagliflozin(DB06292)|Diclofenac(DB00586)|Epirubicin(DB00445)|Etodolac(DB00749)|Ezetimibe(DB00973)|Flunitrazepam(DB01544)|Flurbiprofen(DB00712)|Fluvastatin(DB01095)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Losartan(DB00678)|Lovastatin(DB00227)|Mitiglinide(DB01252)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Naproxen(DB00788)|Oxazepam(DB00842)|Pitavastatin(DB08860)|Silodosin(DB06207)|Simvastatin(DB00641)|Suprofen(DB00870)|Tapentadol(DB06204)|Valproic Acid(DB00313)|Zidovudine(DB00495)	TTATGAAATTATCAAGAATTC	0.393																																					p.L445L		.											.	UGT2B7-92	0			c.A1335G						.						66.0	70.0	69.0					4																	69978199		2203	4300	6503	SO:0001819	synonymous_variant	7364	exon6			GAAATTATCAAGA	BC030974	CCDS3526.1	4q13	2008-02-05	2005-07-20		ENSG00000171234	ENSG00000171234		"""UDP glucuronosyltransferases"""	12554	protein-coding gene	gene with protein product		600068	"""UDP glycosyltransferase 2 family, polypeptide B7"""			2159463, 7835904	Standard	NM_001074		Approved	UGT2B9	uc003heg.4	P16662	OTTHUMG00000129404	ENST00000305231.7:c.1335A>G	4.37:g.69978199A>G		203	0		252	66	NM_001074	0	0	8	40	32	B2R810|Q6GTW0	Silent	SNP	ENST00000305231.7	37	CCDS3526.1																																																																																			.		0.393	UGT2B7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251560.1	NM_001074	
ARHGAP24	83478	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	86921691	86921691	+	Missense_Mutation	SNP	A	A	G			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr4:86921691A>G	ENST00000395184.1	+	10	2529	c.2063A>G	c.(2062-2064)gAt>gGt	p.D688G	ARHGAP24_ENST00000264343.4_Missense_Mutation_p.D595G|RP13-514E23.2_ENST00000610225.1_RNA|ARHGAP24_ENST00000395183.2_Missense_Mutation_p.D593G	NM_001025616.2	NP_001020787.2	Q8N264	RHG24_HUMAN	Rho GTPase activating protein 24	688					activation of Rac GTPase activity (GO:0032863)|angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of ruffle assembly (GO:1900028)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|wound healing, spreading of epidermal cells (GO:0035313)	cell projection (GO:0042995)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)	Rac GTPase activator activity (GO:0030675)			breast(3)|cervix(1)|endometrium(3)|large_intestine(4)|lung(10)|skin(1)|stomach(1)|urinary_tract(1)	24		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000571)		GATGAACTGGATCAGGAGAGG	0.448																																					p.D688G		.											.	ARHGAP24-227	0			c.A2063G						.						71.0	73.0	72.0					4																	86921691		2203	4300	6503	SO:0001583	missense	83478	exon10			AACTGGATCAGGA	AK091196	CCDS3611.1, CCDS34025.1, CCDS43246.1	4q22.1	2013-01-10			ENSG00000138639	ENSG00000138639		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	25361	protein-coding gene	gene with protein product		610586				11230166, 15254788	Standard	NM_001042669		Approved	DKFZP564B1162, FLJ33877, FilGAP	uc003hpk.3	Q8N264	OTTHUMG00000130427	ENST00000395184.1:c.2063A>G	4.37:g.86921691A>G	ENSP00000378611:p.Asp688Gly	151	0		129	53	NM_001025616	0	0	23	34	11	Q4KMG1|Q6ZNV3|Q86TI5|Q86WE4|Q9H0T6	Missense_Mutation	SNP	ENST00000395184.1	37	CCDS34025.1	.	.	.	.	.	.	.	.	.	.	A	27.8	4.865537	0.91511	.	.	ENSG00000138639	ENST00000395184;ENST00000395183;ENST00000514229;ENST00000264343	T;T;T;T	0.43688	0.94;0.94;0.94;0.94	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.57095	0.2030	L	0.54323	1.7	0.80722	D	1	D;D;P	0.69078	0.959;0.997;0.877	P;P;B	0.60117	0.637;0.869;0.339	T	0.60439	-0.7263	10	0.87932	D	0	.	16.002	0.80301	1.0:0.0:0.0:0.0	.	593;595;688	Q8N264-3;Q8N264-2;Q8N264	.;.;RHG24_HUMAN	G	688;593;603;595	ENSP00000378611:D688G;ENSP00000378610:D593G;ENSP00000425589:D603G;ENSP00000264343:D595G	ENSP00000264343:D595G	D	+	2	0	ARHGAP24	87140715	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.248000	0.95456	2.241000	0.73720	0.533000	0.62120	GAT	.		0.448	ARHGAP24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252815.2	NM_031305	
BMPR1B	658	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	96025660	96025660	+	Missense_Mutation	SNP	G	G	A			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr4:96025660G>A	ENST00000515059.1	+	4	368	c.85G>A	c.(85-87)Gtc>Atc	p.V29I	BMPR1B_ENST00000440890.2_Missense_Mutation_p.V59I|BMPR1B_ENST00000502683.1_Missense_Mutation_p.V29I|BMPR1B_ENST00000264568.4_Missense_Mutation_p.V29I|BMPR1B_ENST00000394931.1_Missense_Mutation_p.V29I	NM_001203.2	NP_001194.1	O00238	BMR1B_HUMAN	bone morphogenetic protein receptor, type IB	29					BMP signaling pathway (GO:0030509)|cartilage condensation (GO:0001502)|chondrocyte differentiation (GO:0002062)|dorsal/ventral pattern formation (GO:0009953)|eye development (GO:0001654)|inflammatory response (GO:0006954)|limb morphogenesis (GO:0035108)|ovarian cumulus expansion (GO:0001550)|ovulation cycle (GO:0042698)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cell differentiation (GO:0045597)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of osteoblast differentiation (GO:0045669)|protein phosphorylation (GO:0006468)|retina development in camera-type eye (GO:0060041)|retinal ganglion cell axon guidance (GO:0031290)|skeletal system development (GO:0001501)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta receptor activity, type I (GO:0005025)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)			breast(3)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(11)|lung(8)|ovary(1)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.51e-07)		CCGTCCAAAGGTCTTGCGTTG	0.423																																					p.V59I		.											.	BMPR1B-1378	0			c.G175A						.						118.0	113.0	115.0					4																	96025660		2203	4300	6503	SO:0001583	missense	658	exon2			CCAAAGGTCTTGC	D89675	CCDS3642.1, CCDS58919.1	4q23-q24	2008-02-05			ENSG00000138696	ENSG00000138696		"""CD molecules"""	1077	protein-coding gene	gene with protein product		603248				8140412, 9730621	Standard	NM_001203		Approved	ALK6, CDw293	uc031sgn.1	O00238	OTTHUMG00000130991	ENST00000515059.1:c.85G>A	4.37:g.96025660G>A	ENSP00000426617:p.Val29Ile	140	1		171	54	NM_001256793	0	0	2	2	0	B2R953|B4DSV1|P78366	Missense_Mutation	SNP	ENST00000515059.1	37	CCDS3642.1	.	.	.	.	.	.	.	.	.	.	G	8.620	0.891209	0.17613	.	.	ENSG00000138696	ENST00000515059;ENST00000506363;ENST00000512312;ENST00000509540;ENST00000440890;ENST00000502683;ENST00000264568;ENST00000394931	D;D;D;D;D;D;D;D	0.93426	-1.56;-3.22;-1.56;-1.56;-1.53;-2.65;-1.56;-1.56	5.68	-1.03	0.10102	.	0.948531	0.08708	N	0.905412	D	0.84982	0.5593	N	0.14661	0.345	0.20196	N	0.999927	B	0.02656	0.0	B	0.01281	0.0	T	0.69072	-0.5242	10	0.21540	T	0.41	.	10.8392	0.46704	0.5928:0.0:0.4072:0.0	.	29	O00238	BMR1B_HUMAN	I	29;29;29;29;59;29;29;29	ENSP00000426617:V29I;ENSP00000421144:V29I;ENSP00000425444:V29I;ENSP00000421671:V29I;ENSP00000401907:V59I;ENSP00000424693:V29I;ENSP00000264568:V29I;ENSP00000378389:V29I	ENSP00000264568:V29I	V	+	1	0	BMPR1B	96244683	0.981000	0.34729	0.995000	0.50966	0.773000	0.43773	0.118000	0.15605	-0.111000	0.12001	-0.312000	0.09012	GTC	.		0.423	BMPR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253609.3	NM_001203	
SEMA5A	9037	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	9226981	9226981	+	Splice_Site	SNP	C	C	T	rs141767878		TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr5:9226981C>T	ENST00000382496.5	-	7	1097	c.432G>A	c.(430-432)tcG>tcA	p.S144S		NM_003966.2	NP_003957.2	Q13591	SEM5A_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A	144	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|diencephalon development (GO:0021536)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|nervous system development (GO:0007399)|patterning of blood vessels (GO:0001569)|positive chemotaxis (GO:0050918)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of angiogenesis (GO:0045766)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein kinase B signaling (GO:0051897)|signal clustering (GO:1990256)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|chondroitin sulfate proteoglycan binding (GO:0035373)|heparan sulfate proteoglycan binding (GO:0043395)|semaphorin receptor binding (GO:0030215)|syndecan binding (GO:0045545)			biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(13)|lung(40)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	81						GAAGCCATACCGAGCGGTTGG	0.438																																					p.S144S		.											.	SEMA5A-91	0			c.G432A						.	C		0,4406		0,0,2203	56.0	60.0	58.0		432	4.1	1.0	5	dbSNP_134	58	1,8599	1.2+/-3.3	0,1,4299	yes	coding-synonymous-near-splice	SEMA5A	NM_003966.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		144/1075	9226981	1,13005	2203	4300	6503	SO:0001630	splice_region_variant	9037	exon7			CCATACCGAGCGG	U52840	CCDS3875.1	5p15.2	2008-05-15			ENSG00000112902	ENSG00000112902		"""Semaphorins"""	10736	protein-coding gene	gene with protein product		609297		SEMAF		8817451, 9464278	Standard	NM_003966		Approved	semF	uc003jek.2	Q13591	OTTHUMG00000090501	ENST00000382496.5:c.432+1G>A	5.37:g.9226981C>T		161	0		117	6	NM_003966	0	0	0	0	0	D3DTC6|O60408|Q1RLL9	Silent	SNP	ENST00000382496.5	37	CCDS3875.1	.	.	.	.	.	.	.	.	.	.	C	13.82	2.352056	0.41700	0.0	1.16E-4	ENSG00000112902	ENST00000514923	.	.	.	4.93	4.05	0.47172	.	.	.	.	.	T	0.62708	0.2450	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.60826	-0.7186	4	.	.	.	.	11.7678	0.51941	0.0:0.823:0.177:0.0	.	.	.	.	I	92	.	.	V	-	1	0	SEMA5A	9279981	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	3.490000	0.53245	1.185000	0.42971	0.655000	0.94253	GTT	C|1.000;T|0.000		0.438	SEMA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206989.2		Silent
ADAMTS19	171019	broad.mit.edu;bcgsc.ca	37	5	128956361	128956361	+	Missense_Mutation	SNP	A	A	G			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr5:128956361A>G	ENST00000274487.4	+	9	1656	c.1511A>G	c.(1510-1512)cAt>cGt	p.H504R	CTC-575N7.1_ENST00000503616.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	504	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		GATGGTCTTCATATCATGTCT	0.373																																					p.H504R													.	ADAMTS19-295	0			c.A1511G						.						167.0	153.0	157.0					5																	128956361		2203	4300	6503	SO:0001583	missense	171019	exon9			GTCTTCATATCAT	AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.1511A>G	5.37:g.128956361A>G	ENSP00000274487:p.His504Arg	225	0		276	11	NM_133638	0	0	0	0	0		Missense_Mutation	SNP	ENST00000274487.4	37	CCDS4146.1	.	.	.	.	.	.	.	.	.	.	A	19.79	3.893486	0.72639	.	.	ENSG00000145808	ENST00000274487	T	0.62639	0.01	4.51	4.51	0.55191	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.64402	D	0.000001	T	0.73140	0.3549	L	0.49126	1.545	0.58432	D	0.999997	D	0.89917	1.0	D	0.91635	0.999	T	0.72459	-0.4287	9	.	.	.	.	14.8814	0.70537	1.0:0.0:0.0:0.0	.	504	Q8TE59	ATS19_HUMAN	R	504	ENSP00000274487:H504R	.	H	+	2	0	ADAMTS19	128984260	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.916000	0.87491	2.246000	0.74042	0.533000	0.62120	CAT	.		0.373	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250979.2	NM_133638	
GABRG2	2566	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	161576298	161576298	+	Missense_Mutation	SNP	A	A	T			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr5:161576298A>T	ENST00000361925.4	+	8	1327	c.1107A>T	c.(1105-1107)aaA>aaT	p.K369N	GABRG2_ENST00000393933.4_Missense_Mutation_p.K274N|GABRG2_ENST00000414552.2_Missense_Mutation_p.K409N|GABRG2_ENST00000356592.3_Missense_Mutation_p.K369N			P18507	GBRG2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 2	369					adult behavior (GO:0030534)|cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|post-embryonic development (GO:0009791)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell junction (GO:0030054)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|GABA-A receptor complex (GO:1902711)|inhibitory synapse (GO:0060077)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(15)|lung(24)|ovary(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	62	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	GCAAGGACAAAGATAAAAAGA	0.373																																					p.K409N		.											.	GABRG2-95	0			c.A1227T						.						118.0	102.0	107.0					5																	161576298		2203	4300	6503	SO:0001583	missense	2566	exon9			GGACAAAGATAAA		CCDS4358.1, CCDS4359.1, CCDS47333.1	5q34	2012-06-22			ENSG00000113327	ENSG00000113327		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4087	protein-coding gene	gene with protein product	"""GABA(A) receptor, gamma 2"""	137164					Standard	NM_198904		Approved		uc010jjc.3	P18507	OTTHUMG00000130350	ENST00000361925.4:c.1107A>T	5.37:g.161576298A>T	ENSP00000354651:p.Lys369Asn	158	0		178	57	NM_198903	0	0	0	0	0	F5HB82|Q6GRL6|Q6PCC3|Q9UDB3|Q9UN15	Missense_Mutation	SNP	ENST00000361925.4	37	CCDS4358.1	.	.	.	.	.	.	.	.	.	.	A	14.77	2.633505	0.47049	.	.	ENSG00000113327	ENST00000356592;ENST00000414552;ENST00000361925;ENST00000393933	D;D;D;D	0.86865	-2.18;-2.18;-2.15;-2.15	5.61	0.527	0.17084	Neurotransmitter-gated ion-channel transmembrane domain (2);	1.305790	0.04797	N	0.432698	D	0.85535	0.5719	M	0.68317	2.08	0.48511	D	0.999667	B;B;B	0.14438	0.01;0.007;0.01	B;B;B	0.23852	0.02;0.049;0.049	T	0.70916	-0.4742	10	0.56958	D	0.05	.	5.4602	0.16612	0.5861:0.1356:0.2784:0.0	.	409;369;369	F5HB82;P18507;P18507-2	.;GBRG2_HUMAN;.	N	369;409;369;274	ENSP00000349000:K369N;ENSP00000410732:K409N;ENSP00000354651:K369N;ENSP00000377510:K274N	ENSP00000349000:K369N	K	+	3	2	GABRG2	161508876	1.000000	0.71417	0.996000	0.52242	0.970000	0.65996	3.143000	0.50608	-0.128000	0.11641	-0.263000	0.10527	AAA	.		0.373	GABRG2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252706.1		
VARS	7407	broad.mit.edu	37	6	31753451	31753451	+	Missense_Mutation	SNP	G	G	A			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr6:31753451G>A	ENST00000375663.3	-	9	1600	c.1160C>T	c.(1159-1161)gCc>gTc	p.A387V	VARS_ENST00000444930.2_Missense_Mutation_p.A92V	NM_006295.2	NP_006286.1	P26640	SYVC_HUMAN	valyl-tRNA synthetase	387					gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)|valyl-tRNA aminoacylation (GO:0006438)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|valine-tRNA ligase activity (GO:0004832)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(18)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	30					L-Valine(DB00161)	CACCTGGGTGGCAATACCTGC	0.632																																					p.A387V													.	VARS-93	0			c.C1160T						.						79.0	71.0	74.0					6																	31753451		1510	2708	4218	SO:0001583	missense	7407	exon9			TGGGTGGCAATAC	BC012808	CCDS34412.1	6p21.3	2011-07-01		2005-07-05	ENSG00000204394	ENSG00000204394	6.1.1.9	"""Aminoacyl tRNA synthetases / Class I"""	12651	protein-coding gene	gene with protein product	"""valine tRNA ligase 1, cytoplasmic"""	192150	"""valyl-tRNA synthetase 2"""	VARS2		15779907	Standard	XM_005249362		Approved		uc003nxe.3	P26640	OTTHUMG00000031286	ENST00000375663.3:c.1160C>T	6.37:g.31753451G>A	ENSP00000364815:p.Ala387Val	131	0		142	4	NM_006295	0	0	10	10	0	B0V1N1|B4DZ61|Q5JQ90|Q96E77|Q9UQM2	Missense_Mutation	SNP	ENST00000375663.3	37	CCDS34412.1	.	.	.	.	.	.	.	.	.	.	G	34	5.408749	0.96072	.	.	ENSG00000204394	ENST00000375663;ENST00000444930	T;T	0.25085	1.82;1.82	5.29	5.29	0.74685	Rossmann-like alpha/beta/alpha sandwich fold (1);Aminoacyl-tRNA synthetase, class Ia (1);	0.126292	0.53938	D	0.000054	T	0.67618	0.2912	H	0.99689	4.705	0.54753	D	0.999984	D	0.89917	1.0	D	0.80764	0.994	D	0.83482	0.0065	10	0.87932	D	0	-8.9805	16.4619	0.84059	0.0:0.0:1.0:0.0	.	387	P26640	SYVC_HUMAN	V	387;92	ENSP00000364815:A387V;ENSP00000398317:A92V	ENSP00000364815:A387V	A	-	2	0	VARS	31861430	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	8.678000	0.91211	2.489000	0.83994	0.655000	0.94253	GCC	.		0.632	VARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076619.2	NM_006295	
DST	667	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	56499603	56499603	+	Missense_Mutation	SNP	A	A	C	rs374149298		TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr6:56499603A>C	ENST00000361203.3	-	21	2709	c.2702T>G	c.(2701-2703)aTt>aGt	p.I901S	DST_ENST00000370788.2_Missense_Mutation_p.I901S|DST_ENST00000518935.1_Missense_Mutation_p.I575S|DST_ENST00000244364.6_Missense_Mutation_p.I575S|DST_ENST00000370765.6_Missense_Mutation_p.I575S|DST_ENST00000370754.5_Missense_Mutation_p.I1079S|DST_ENST00000370769.4_Missense_Mutation_p.I901S|DST_ENST00000312431.6_Missense_Mutation_p.I901S|DST_ENST00000421834.2_Missense_Mutation_p.I901S|DST_ENST00000446842.2_Missense_Mutation_p.I575S			Q03001	DYST_HUMAN	dystonin	901	SH3.				axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			AAGTACCTCAATTTGTCTGTA	0.358																																					p.I575S		.											.	DST-523	0			c.T1724G						.						192.0	193.0	192.0					6																	56499603		2203	4300	6503	SO:0001583	missense	667	exon11			ACCTCAATTTGTC	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.2702T>G	6.37:g.56499603A>C	ENSP00000354508:p.Ile901Ser	316	2		332	105	NM_001723	0	0	0	0	0	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	ENST00000361203.3	37		.	.	.	.	.	.	.	.	.	.	A	23.5	4.426398	0.83667	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000312431;ENST00000370788;ENST00000361203;ENST00000439203;ENST00000520645;ENST00000370765;ENST00000518935	T;T;T;T;T;T;T;T;T;T;T;T	0.80033	-0.13;-0.13;-0.13;-0.13;-0.13;-1.33;-0.13;-0.13;-1.33;-1.33;-0.13;-1.33	5.28	5.28	0.74379	.	0.000000	0.49305	D	0.000147	D	0.84156	0.5410	M	0.63428	1.95	0.37034	D	0.896819	D;D;D;D;D;P;D;D	0.89917	0.999;0.998;0.999;0.991;1.0;0.839;0.999;1.0	D;D;D;D;D;P;D;D	0.87578	0.915;0.986;0.915;0.955;0.998;0.872;0.915;0.996	T	0.82149	-0.0600	9	0.25751	T	0.34	.	15.3783	0.74630	1.0:0.0:0.0:0.0	.	901;901;1079;575;575;575;901;575	Q5TBT1;E7ERU2;E9PEB9;Q6P0N6;Q03001-3;Q03001-9;Q03001;Q03001-8	.;.;.;.;.;.;DYST_HUMAN;.	S	575;1079;901;901;575;901;901;901;575;941;575;575	ENSP00000244364:I575S;ENSP00000359790:I1079S;ENSP00000359805:I901S;ENSP00000400883:I901S;ENSP00000393645:I575S;ENSP00000307959:I901S;ENSP00000359824:I901S;ENSP00000354508:I901S;ENSP00000404924:I575S;ENSP00000431030:I941S;ENSP00000359801:I575S;ENSP00000431003:I575S	ENSP00000244364:I575S	I	-	2	0	DST	56607562	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	9.139000	0.94554	2.227000	0.72691	0.460000	0.39030	ATT	.		0.358	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723	
FAM135A	57579	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	71234676	71234676	+	Missense_Mutation	SNP	T	T	A			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr6:71234676T>A	ENST00000418814.2	+	15	2503	c.1889T>A	c.(1888-1890)aTg>aAg	p.M630K	FAM135A_ENST00000505868.1_Missense_Mutation_p.M630K|FAM135A_ENST00000505769.1_Missense_Mutation_p.M434K|FAM135A_ENST00000370479.3_Missense_Mutation_p.M417K|FAM135A_ENST00000361499.3_Missense_Mutation_p.M434K|FAM135A_ENST00000457062.2_Missense_Mutation_p.M417K	NM_001105531.2|NM_001162529.1	NP_001099001.1|NP_001156001.1	Q9P2D6	F135A_HUMAN	family with sequence similarity 135, member A	630										breast(2)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	38						ATTACACAAATGGAACACAAT	0.393																																					p.M630K		.											.	FAM135A-90	0			c.T1889A						.						70.0	64.0	66.0					6																	71234676		2203	4299	6502	SO:0001583	missense	57579	exon13			CACAAATGGAACA	AK000183	CCDS34481.1, CCDS47448.1, CCDS55028.1	6q13	2008-10-30	2007-05-11	2007-05-11	ENSG00000082269	ENSG00000082269			21084	protein-coding gene	gene with protein product			"""KIAA1411"""	KIAA1411		10718198	Standard	NM_001105531		Approved	FLJ20176	uc003pfj.3	Q9P2D6	OTTHUMG00000014991	ENST00000418814.2:c.1889T>A	6.37:g.71234676T>A	ENSP00000410768:p.Met630Lys	143	0		127	52	NM_001162529	0	0	7	10	3	A2RRQ5|Q3C0H3|Q5JXK0|Q5JXK1|Q68DW0|Q6P081|Q9H0F2|Q9NU48|Q9NUQ5|Q9NXL5	Missense_Mutation	SNP	ENST00000418814.2	37	CCDS55028.1	.	.	.	.	.	.	.	.	.	.	T	10.84	1.464055	0.26335	.	.	ENSG00000082269	ENST00000418814;ENST00000370479;ENST00000505769;ENST00000457062;ENST00000361499;ENST00000505868	T;T;T;T;T;T	0.78246	-1.16;-1.16;-1.16;-1.16;-1.16;-1.16	5.87	3.5	0.40072	.	0.419502	0.28453	N	0.015293	T	0.28928	0.0718	N	0.08118	0	0.27751	N	0.944159	B;B;B;B	0.15473	0.013;0.008;0.011;0.013	B;B;B;B	0.20577	0.03;0.008;0.019;0.03	T	0.27571	-1.0070	10	0.06494	T	0.89	.	8.0899	0.30795	0.0:0.2862:0.0:0.7138	.	630;630;434;417	Q9P2D6-4;Q9P2D6;Q9P2D6-2;Q9P2D6-3	.;F135A_HUMAN;.;.	K	630;417;434;417;434;630	ENSP00000410768:M630K;ENSP00000359510:M417K;ENSP00000423785:M434K;ENSP00000409201:M417K;ENSP00000354913:M434K;ENSP00000423307:M630K	ENSP00000354913:M434K	M	+	2	0	FAM135A	71291397	0.983000	0.35010	0.999000	0.59377	0.962000	0.63368	0.518000	0.22847	0.576000	0.29452	0.533000	0.62120	ATG	.		0.393	FAM135A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000041137.2	NM_020819	
CCDC132	55610	broad.mit.edu	37	7	92882045	92882045	+	Missense_Mutation	SNP	A	A	G			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr7:92882045A>G	ENST00000305866.5	+	3	310	c.182A>G	c.(181-183)tAt>tGt	p.Y61C	CCDC132_ENST00000251739.5_Missense_Mutation_p.Y61C|CCDC132_ENST00000541136.1_Intron|CCDC132_ENST00000535481.1_Intron|CCDC132_ENST00000544910.1_Missense_Mutation_p.Y31C|CCDC132_ENST00000317751.6_5'UTR	NM_017667.3	NP_060137.2	Q96JG6	CC132_HUMAN	coiled-coil domain containing 132	61						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				endometrium(1)|large_intestine(2)|lung(5)	8	all_cancers(62;2.64e-11)|all_epithelial(64;1.4e-10)|Breast(17;0.000675)|Lung NSC(181;0.0618)|all_lung(186;0.0837)		STAD - Stomach adenocarcinoma(171;0.000302)			GAACAAGTATATTTTTCTGTG	0.323																																					p.Y61C													.	CCDC132-90	0			c.A182G						.						90.0	98.0	95.0					7																	92882045		2203	4300	6503	SO:0001583	missense	55610	exon3			AAGTATATTTTTC	AL833112, AK055965, AL832393	CCDS5630.1, CCDS43617.1, CCDS59065.1	7q21.3	2007-07-23			ENSG00000004766	ENSG00000004766			25956	protein-coding gene	gene with protein product						11347906	Standard	NM_024553		Approved	KIAA1861, FLJ20097, DKFZp313I2429	uc003umo.4	Q96JG6	OTTHUMG00000131733	ENST00000305866.5:c.182A>G	7.37:g.92882045A>G	ENSP00000307666:p.Tyr61Cys	160	0		219	4	NM_024553	0	0	4	4	0	B3KX22|D1MQ00|F5H5U7|Q75N07|Q8WVK3|Q9H5C6	Missense_Mutation	SNP	ENST00000305866.5	37	CCDS43617.1	.	.	.	.	.	.	.	.	.	.	A	22.8	4.331798	0.81801	.	.	ENSG00000004766	ENST00000251739;ENST00000305866;ENST00000544910;ENST00000458530	.	.	.	5.42	5.42	0.78866	Vacuolar protein sorting-associated protein 54 (1);	0.000000	0.85682	D	0.000000	T	0.78426	0.4281	M	0.71206	2.165	0.80722	D	1	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.85130	0.995;0.997;0.996	T	0.81104	-0.1084	9	0.87932	D	0	-33.2209	15.7673	0.78138	1.0:0.0:0.0:0.0	.	31;61;61	F5H5U7;Q96JG6;Q96JG6-2	.;CC132_HUMAN;.	C	61;61;31;61	.	ENSP00000251739:Y61C	Y	+	2	0	CCDC132	92719981	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.400000	0.90200	2.198000	0.70561	0.482000	0.46254	TAT	.		0.323	CCDC132-019	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341687.1	NM_017667	
AP4M1	9179	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	99700326	99700326	+	Missense_Mutation	SNP	T	T	C			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr7:99700326T>C	ENST00000359593.4	+	3	334	c.176T>C	c.(175-177)aTc>aCc	p.I59T	MCM7_ENST00000303887.5_5'Flank|AP4M1_ENST00000421755.1_Missense_Mutation_p.I59T|MCM7_ENST00000343023.6_5'Flank|AP4M1_ENST00000422582.1_5'UTR|AP4M1_ENST00000429084.1_Missense_Mutation_p.I66T|MCM7_ENST00000354230.3_5'Flank|AP4M1_ENST00000478501.1_3'UTR	NM_004722.3	NP_004713.2	O00189	AP4M1_HUMAN	adaptor-related protein complex 4, mu 1 subunit	59					Golgi to endosome transport (GO:0006895)|intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	AP-type membrane coat adaptor complex (GO:0030119)|clathrin adaptor complex (GO:0030131)|coated pit (GO:0005905)|extracellular vesicular exosome (GO:0070062)|Golgi trans cisterna (GO:0000138)|trans-Golgi network (GO:0005802)	transporter activity (GO:0005215)			breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|skin(1)	17	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TTCATTCACATCAGACACAGC	0.527																																					p.I59T	Pancreas(174;1182 2812 29595 49511)	.											.	AP4M1-90	0			c.T176C						.						142.0	129.0	134.0					7																	99700326		2203	4300	6503	SO:0001583	missense	9179	exon3			TTCACATCAGACA	Y08387	CCDS5685.1	7q22.1	2012-06-29			ENSG00000221838	ENSG00000221838			574	protein-coding gene	gene with protein product	"""mu-adaptin-related protein-2"", ""mu subunit of AP-4"", ""AP-4 adapter complex mu subunit"", ""adaptor-related protein complex AP-4 mu4 subunit"""	602296				9013859, 10066790, 21620353	Standard	NM_004722		Approved	MU-ARP2, MU-4, SPG50	uc003utb.4	O00189	OTTHUMG00000154722	ENST00000359593.4:c.176T>C	7.37:g.99700326T>C	ENSP00000352603:p.Ile59Thr	186	1		266	56	NM_004722	0	0	15	19	4	D6W5U1|Q8WV65|Q9UHK9	Missense_Mutation	SNP	ENST00000359593.4	37	CCDS5685.1	.	.	.	.	.	.	.	.	.	.	T	16.27	3.075789	0.55646	.	.	ENSG00000221838	ENST00000429084;ENST00000359593;ENST00000439416;ENST00000421755	T;T;D;T	0.81579	-1.36;-1.36;-1.51;-1.36	5.48	5.48	0.80851	Longin-like (1);AP complex, mu/sigma subunit (1);	0.294221	0.37623	N	0.002007	D	0.84732	0.5537	L	0.56769	1.78	0.80722	D	1	P;B;P;P	0.51449	0.816;0.049;0.905;0.945	B;B;P;P	0.57468	0.177;0.084;0.637;0.821	D	0.85571	0.1234	10	0.56958	D	0.05	-5.926	11.9735	0.53078	0.0:0.0:0.0:1.0	.	59;11;66;59	C9JMG3;B4DKN7;C9JC87;O00189	.;.;.;AP4M1_HUMAN	T	66;59;59;59	ENSP00000403663:I66T;ENSP00000352603:I59T;ENSP00000414286:I59T;ENSP00000412185:I59T	ENSP00000352603:I59T	I	+	2	0	AP4M1	99538262	1.000000	0.71417	1.000000	0.80357	0.014000	0.08584	6.448000	0.73469	2.068000	0.61886	0.459000	0.35465	ATC	.		0.527	AP4M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336772.4	NM_004722	
CTTNBP2	83992	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	117364734	117364734	+	Silent	SNP	T	T	A			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr7:117364734T>A	ENST00000160373.3	-	19	4405	c.4314A>T	c.(4312-4314)atA>atT	p.I1438I		NM_033427.2	NP_219499.1	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	1438					brain development (GO:0007420)	cell projection (GO:0042995)|synaptic vesicle (GO:0008021)				breast(3)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(36)|ovary(4)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		AACTGGAAACTATGGATAAAG	0.438																																					p.I1438I		.											.	CTTNBP2-94	0			c.A4314T						.						106.0	96.0	100.0					7																	117364734		2203	4300	6503	SO:0001819	synonymous_variant	83992	exon19			GGAAACTATGGAT		CCDS5774.1	7q31	2013-01-10	2004-06-08	2004-06-09	ENSG00000077063	ENSG00000077063		"""Ankyrin repeat domain containing"""	15679	protein-coding gene	gene with protein product		609772	"""cortactin binding protein 2"""	CORTBP2, C7orf8		11707066	Standard	XM_005250635		Approved	KIAA1758, Orf4	uc003vjf.3	Q8WZ74	OTTHUMG00000022880	ENST00000160373.3:c.4314A>T	7.37:g.117364734T>A		147	0		187	53	NM_033427	0	0	7	8	1	O43389|Q7LG11|Q9C0A5	Silent	SNP	ENST00000160373.3	37	CCDS5774.1	.	.	.	.	.	.	.	.	.	.	T	2.995	-0.207314	0.06180	.	.	ENSG00000077063	ENST00000446636	.	.	.	5.45	-4.08	0.03963	.	.	.	.	.	T	0.38532	0.1044	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.37934	-0.9684	4	.	.	.	-1.618	1.9951	0.03455	0.2862:0.4031:0.1445:0.1662	.	.	.	.	C	926	.	.	S	-	1	0	CTTNBP2	117151970	0.378000	0.25114	0.285000	0.24819	0.253000	0.25986	-0.307000	0.08167	-0.488000	0.06726	-0.408000	0.06270	AGT	.		0.438	CTTNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059201.4	NM_033427	
CTTNBP2	83992	broad.mit.edu;bcgsc.ca	37	7	117396642	117396642	+	Silent	SNP	G	G	A			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr7:117396642G>A	ENST00000160373.3	-	12	3406	c.3315C>T	c.(3313-3315)atC>atT	p.I1105I		NM_033427.2	NP_219499.1	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	1105					brain development (GO:0007420)	cell projection (GO:0042995)|synaptic vesicle (GO:0008021)				breast(3)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(36)|ovary(4)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		TCTGGAGAGGGATCATGGAGG	0.498																																					p.I1105I													.	CTTNBP2-94	0			c.C3315T						.						199.0	168.0	179.0					7																	117396642		2203	4300	6503	SO:0001819	synonymous_variant	83992	exon12			GAGAGGGATCATG		CCDS5774.1	7q31	2013-01-10	2004-06-08	2004-06-09	ENSG00000077063	ENSG00000077063		"""Ankyrin repeat domain containing"""	15679	protein-coding gene	gene with protein product		609772	"""cortactin binding protein 2"""	CORTBP2, C7orf8		11707066	Standard	XM_005250635		Approved	KIAA1758, Orf4	uc003vjf.3	Q8WZ74	OTTHUMG00000022880	ENST00000160373.3:c.3315C>T	7.37:g.117396642G>A		192	0		236	9	NM_033427	0	0	21	21	0	O43389|Q7LG11|Q9C0A5	Silent	SNP	ENST00000160373.3	37	CCDS5774.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.822|9.822	1.185943|1.185943	0.21870|0.21870	.|.	.|.	ENSG00000077063|ENSG00000077063	ENST00000446636|ENST00000435233;ENST00000416239	.|.	.|.	.|.	5.43|5.43	1.59|1.59	0.23543|0.23543	.|.	.|.	.|.	.|.	.|.	T|T	0.57710|0.57710	0.2072|0.2072	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.49418|0.49418	-0.8942|-0.8942	4|4	.|.	.|.	.|.	-5.5934|-5.5934	9.2734|9.2734	0.37686|0.37686	0.2853:0.0:0.7147:0.0|0.2853:0.0:0.7147:0.0	.|.	.|.	.|.	.|.	S|F	593|119;101	.|.	.|.	P|S	-|-	1|2	0|0	CTTNBP2|CTTNBP2	117183878|117183878	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.980000|0.980000	0.70556|0.70556	1.199000|1.199000	0.32235|0.32235	0.075000|0.075000	0.16796|0.16796	0.591000|0.591000	0.81541|0.81541	CCC|TCC	.		0.498	CTTNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059201.4	NM_033427	
ARF5	381	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	127229193	127229193	+	Missense_Mutation	SNP	A	A	G			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr7:127229193A>G	ENST00000000233.5	+	2	278	c.124A>G	c.(124-126)Att>Gtt	p.I42V	ARF5_ENST00000467281.1_3'UTR|GCC1_ENST00000497650.1_Intron	NM_001662.3	NP_001653.1	P84085	ARF5_HUMAN	ADP-ribosylation factor 5	42					GTP catabolic process (GO:0006184)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			cervix(2)|kidney(1)|lung(10)|ovary(1)	14						GTTGGGGGAGATTGTCACCAC	0.632											OREG0018287	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.I42V		.											.	ARF5-228	0			c.A124G						.						84.0	77.0	79.0					7																	127229193		2203	4300	6503	SO:0001583	missense	381	exon2			GGGGAGATTGTCA		CCDS34745.1	7q31.3	2008-07-18			ENSG00000004059	ENSG00000004059		"""ADP-ribosylation factors"""	658	protein-coding gene	gene with protein product		103188				1993656	Standard	NM_001662		Approved		uc003vmb.2	P84085	OTTHUMG00000023246	ENST00000000233.5:c.124A>G	7.37:g.127229193A>G	ENSP00000000233:p.Ile42Val	99	0	1555	117	46	NM_001662	0	0	92	240	148	P26437	Missense_Mutation	SNP	ENST00000000233.5	37	CCDS34745.1	.	.	.	.	.	.	.	.	.	.	a	17.35	3.367076	0.61513	.	.	ENSG00000004059	ENST00000000233;ENST00000415666	D;D	0.81821	-1.54;-1.54	5.19	3.96	0.45880	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	T	0.56572	0.1994	N	0.03050	-0.425	0.44635	D	0.997619	B;B	0.10296	0.003;0.003	B;B	0.16289	0.015;0.015	T	0.53746	-0.8395	10	0.29301	T	0.29	-8.2547	9.1237	0.36801	0.8363:0.0:0.0:0.1636	.	42;42	A4D0Z3;P84085	.;ARF5_HUMAN	V	42	ENSP00000000233:I42V;ENSP00000412701:I42V	ENSP00000000233:I42V	I	+	1	0	ARF5	127016429	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.106000	0.77039	1.962000	0.57031	0.444000	0.29173	ATT	.		0.632	ARF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059567.2	NM_001662	
KRBA1	84626	broad.mit.edu	37	7	149422542	149422542	+	Missense_Mutation	SNP	G	G	C			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr7:149422542G>C	ENST00000485033.2	+	9	1263	c.1263G>C	c.(1261-1263)caG>caC	p.Q421H	KRBA1_ENST00000479560.1_3'UTR|KRBA1_ENST00000255992.10_Missense_Mutation_p.Q421H|KRBA1_ENST00000319551.8_Missense_Mutation_p.Q421H			A5PL33	KRBA1_HUMAN	KRAB-A domain containing 1	433										breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(17)|ovary(1)|prostate(1)	27	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			CTAGGTCTCAGAAGCCTGAAC	0.597																																					.													.	KRBA1-91	0			.						.						36.0	39.0	38.0					7																	149422542		2050	4209	6259	SO:0001583	missense	84626	.			GTCTCAGAAGCCT	AB058765	CCDS75674.1	7q36	2014-02-12	2006-08-15		ENSG00000133619	ENSG00000133619		"""-"""	22228	protein-coding gene	gene with protein product			"""KRAB A domain containing 1"""				Standard	NM_001290187		Approved	KIAA1862	uc003wfz.3	A5PL33	OTTHUMG00000157886	ENST00000485033.2:c.1263G>C	7.37:g.149422542G>C	ENSP00000420112:p.Gln421His	49	0		45	4	.	0	0	5	5	0	A7E2F5|E7ENE9|Q8N4X0|Q96JG5	Missense_Mutation	SNP	ENST00000485033.2	37		.	.	.	.	.	.	.	.	.	.	G	13.83	2.354201	0.41700	.	.	ENSG00000133619	ENST00000255992;ENST00000319551;ENST00000485033	T;T;T	0.35421	1.31;1.31;1.31	4.65	-0.91	0.10511	.	1.054700	0.07500	N	0.907072	T	0.25568	0.0622	L	0.34521	1.04	0.09310	N	1	B;B	0.23249	0.037;0.082	B;B	0.19946	0.012;0.027	T	0.31586	-0.9938	10	0.52906	T	0.07	-1.5465	6.0403	0.19730	0.1922:0.4524:0.3554:0.0	.	421;421	E7ENE9;A5PL33	.;KRBA1_HUMAN	H	421	ENSP00000255992:Q421H;ENSP00000317165:Q421H;ENSP00000420112:Q421H	ENSP00000255992:Q421H	Q	+	3	2	KRBA1	149053475	0.001000	0.12720	0.002000	0.10522	0.022000	0.10575	0.008000	0.13197	-0.094000	0.12374	0.655000	0.94253	CAG	.		0.597	KRBA1-004	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000349841.3	NM_032534	
SLC26A7	115111	broad.mit.edu	37	8	92330447	92330447	+	Missense_Mutation	SNP	G	G	A			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr8:92330447G>A	ENST00000276609.3	+	5	720	c.481G>A	c.(481-483)Gcc>Acc	p.A161T	SLC26A7_ENST00000523719.1_Missense_Mutation_p.A161T|SLC26A7_ENST00000309536.2_Missense_Mutation_p.A161T	NM_001282356.1|NM_052832.2	NP_001269285.1|NP_439897.1			solute carrier family 26 (anion exchanger), member 7											breast(1)|cervix(1)|endometrium(4)|large_intestine(10)|lung(26)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	50			BRCA - Breast invasive adenocarcinoma(11;0.00802)			CTCTTAGGTGGCCATGTTTGT	0.478																																					p.A161T													.	SLC26A7-92	0			c.G481A						.						104.0	95.0	98.0					8																	92330447		2203	4300	6503	SO:0001583	missense	115111	exon5			TAGGTGGCCATGT	AF331521	CCDS6254.1, CCDS6255.1, CCDS75765.1	8q23	2013-07-18	2013-07-18		ENSG00000147606	ENSG00000147606		"""Solute carriers"""	14467	protein-coding gene	gene with protein product		608479	"""solute carrier family 26, member 7"""			11834742, 11829495, 16524946	Standard	NM_134266		Approved	SUT2	uc003yez.3	Q8TE54	OTTHUMG00000164062	ENST00000276609.3:c.481G>A	8.37:g.92330447G>A	ENSP00000276609:p.Ala161Thr	254	1		278	4	NM_134266	0	0	0	0	0		Missense_Mutation	SNP	ENST00000276609.3	37	CCDS6254.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.35|14.35	2.510420|2.510420	0.44660|0.44660	.|.	.|.	ENSG00000147606|ENSG00000147606	ENST00000522862;ENST00000523719;ENST00000276609;ENST00000309536|ENST00000520818	D;D;D;D|.	0.93366|.	-2.96;-3.21;-3.21;-3.21|.	5.95|5.95	4.17|4.17	0.49024|0.49024	.|.	0.566027|.	0.18096|.	N|.	0.151846|.	T|.	0.46073|.	0.1374|.	M|M	0.62723|0.62723	1.935|1.935	0.26123|0.26123	N|N	0.980525|0.980525	B;B|.	0.09022|.	0.001;0.002|.	B;B|.	0.09377|.	0.004;0.002|.	T|.	0.36648|.	-0.9739|.	10|.	0.26408|.	T|.	0.33|.	.|.	7.5583|7.5583	0.27837|0.27837	0.1364:0.0:0.7295:0.134|0.1364:0.0:0.7295:0.134	.|.	161;161|.	Q8TE54-2;Q8TE54|.	.;S26A7_HUMAN|.	T|X	161|28	ENSP00000428881:A161T;ENSP00000428849:A161T;ENSP00000276609:A161T;ENSP00000309504:A161T|.	ENSP00000276609:A161T|.	A|W	+|+	1|3	0|0	SLC26A7|SLC26A7	92399623|92399623	0.997000|0.997000	0.39634|0.39634	0.998000|0.998000	0.56505|0.56505	0.572000|0.572000	0.35998|0.35998	2.809000|2.809000	0.47971|0.47971	0.858000|0.858000	0.35431|0.35431	0.650000|0.650000	0.86243|0.86243	GCC|TGG	.		0.478	SLC26A7-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377011.1		
RBM12B	389677	broad.mit.edu	37	8	94746263	94746263	+	Missense_Mutation	SNP	C	C	A			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr8:94746263C>A	ENST00000399300.2	-	3	2589	c.2376G>T	c.(2374-2376)caG>caT	p.Q792H	RBM12B_ENST00000517700.1_Missense_Mutation_p.Q672H|RBM12B_ENST00000520961.1_Intron|RP11-10N23.4_ENST00000517998.1_RNA	NM_203390.2	NP_976324.2	Q8IXT5	RB12B_HUMAN	RNA binding motif protein 12B	792							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(7)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	30	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.0168)			TGAAATGCTCCTGAGGCGGCC	0.637																																					p.Q792H													.	RBM12B-90	0			c.G2376T						.						43.0	46.0	45.0					8																	94746263		1808	4066	5874	SO:0001583	missense	389677	exon3			ATGCTCCTGAGGC		CCDS43755.1	8q22	2014-05-20			ENSG00000183808	ENSG00000183808		"""RNA binding motif (RRM) containing"""	32310	protein-coding gene	gene with protein product							Standard	NM_203390		Approved		uc003yfz.3	Q8IXT5	OTTHUMG00000164317	ENST00000399300.2:c.2376G>T	8.37:g.94746263C>A	ENSP00000382239:p.Gln792His	121	0		136	4	NM_203390	0	0	9	9	0	A8MYB5	Missense_Mutation	SNP	ENST00000399300.2	37	CCDS43755.1	.	.	.	.	.	.	.	.	.	.	C	13.73	2.322943	0.41096	.	.	ENSG00000183808	ENST00000399300;ENST00000517700	T;T	0.07688	3.17;3.25	4.17	-3.89	0.04193	.	1.818140	0.03196	N	0.174075	T	0.05090	0.0136	N	0.12182	0.205	0.09310	N	0.999993	B	0.23442	0.085	B	0.17098	0.017	T	0.41161	-0.9524	10	0.72032	D	0.01	-0.1022	6.4362	0.21825	0.1265:0.3175:0.0:0.556	.	792	Q8IXT5	RB12B_HUMAN	H	792;672	ENSP00000382239:Q792H;ENSP00000427729:Q672H	ENSP00000382239:Q792H	Q	-	3	2	RBM12B	94815439	0.005000	0.15991	0.014000	0.15608	0.432000	0.31715	-0.419000	0.07071	-0.985000	0.03503	-0.251000	0.11542	CAG	.		0.637	RBM12B-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383603.1	NM_203390	
KIAA1429	25962	broad.mit.edu	37	8	95507107	95507107	+	Missense_Mutation	SNP	A	A	G			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr8:95507107A>G	ENST00000297591.5	-	20	4697	c.4622T>C	c.(4621-4623)aTa>aCa	p.I1541T	KIAA1429_ENST00000437199.1_3'UTR	NM_015496.4	NP_056311.2	Q69YN4	VIR_HUMAN	KIAA1429	1541					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(16)|lung(28)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	66	Breast(36;3.29e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00185)			ATCTGTATCTATCTCTTCAGC	0.318																																					p.I1541T													.	KIAA1429-92	0			c.T4622C						.						131.0	141.0	137.0					8																	95507107		2203	4300	6503	SO:0001583	missense	25962	exon20			GTATCTATCTCTT	AB037850	CCDS34923.1, CCDS47894.1	8q22.1	2008-11-25			ENSG00000164944	ENSG00000164944			24500	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 121"""					10718198	Standard	NM_015496		Approved	DKFZP434I116, fSAP121	uc003ygo.2	Q69YN4	OTTHUMG00000164426	ENST00000297591.5:c.4622T>C	8.37:g.95507107A>G	ENSP00000297591:p.Ile1541Thr	341	0		365	6	NM_015496	0	0	13	13	0	Q2M1N0|Q6AHX9|Q6NT78|Q7Z6C7|Q8IXH4|Q9BTH4|Q9H9C9|Q9NWR3|Q9P2B8|Q9UFW1	Missense_Mutation	SNP	ENST00000297591.5	37	CCDS34923.1	.	.	.	.	.	.	.	.	.	.	A	15.18	2.758289	0.49468	.	.	ENSG00000164944	ENST00000297591	T	0.47177	0.85	5.16	5.16	0.70880	.	0.156815	0.53938	N	0.000043	T	0.29389	0.0732	L	0.27053	0.805	0.80722	D	1	P	0.36535	0.557	B	0.33750	0.169	T	0.08994	-1.0695	10	0.11182	T	0.66	-15.6722	9.7797	0.40640	0.9225:0.0:0.0775:0.0	.	1541	Q69YN4	VIR_HUMAN	T	1541	ENSP00000297591:I1541T	ENSP00000297591:I1541T	I	-	2	0	KIAA1429	95576283	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.939000	0.75911	2.085000	0.62840	0.528000	0.53228	ATA	.		0.318	KIAA1429-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378720.2	NM_015496	
ABRA	137735	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	107782408	107782408	+	Missense_Mutation	SNP	C	C	A			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr8:107782408C>A	ENST00000311955.3	-	1	65	c.11G>T	c.(10-12)gGc>gTc	p.G4V		NM_139166.4	NP_631905.1			actin-binding Rho activating protein											breast(1)|kidney(4)|large_intestine(7)|lung(11)|ovary(2)|prostate(2)	27			OV - Ovarian serous cystadenocarcinoma(57;3.83e-09)			TTCCTTTTCGCCCGGAGCCAT	0.597																																					p.G4V		.											.	ABRA-92	0			c.G11T						.						33.0	37.0	35.0					8																	107782408		2202	4295	6497	SO:0001583	missense	137735	exon1			TTTTCGCCCGGAG	AF503617	CCDS6305.1	8q23.1	2012-02-06			ENSG00000174429	ENSG00000174429			30655	protein-coding gene	gene with protein product	"""striated muscle activator of Rho-dependent signaling"""	609747				11983702	Standard	NM_139166		Approved	STARS	uc003ymm.4	Q8N0Z2	OTTHUMG00000164809	ENST00000311955.3:c.11G>T	8.37:g.107782408C>A	ENSP00000311436:p.Gly4Val	110	0		125	27	NM_139166	0	0	0	0	0		Missense_Mutation	SNP	ENST00000311955.3	37	CCDS6305.1	.	.	.	.	.	.	.	.	.	.	C	13.23	2.174542	0.38413	.	.	ENSG00000174429	ENST00000311955	.	.	.	5.66	3.63	0.41609	.	0.510379	0.22113	N	0.064446	T	0.45796	0.1360	L	0.44542	1.39	0.53005	D	0.999964	P	0.42203	0.773	P	0.45712	0.491	T	0.45948	-0.9226	9	0.59425	D	0.04	-3.5289	4.2762	0.10809	0.0:0.5455:0.0:0.4545	.	4	Q8N0Z2	ABRA_HUMAN	V	4	.	ENSP00000311436:G4V	G	-	2	0	ABRA	107851584	1.000000	0.71417	0.870000	0.34147	0.314000	0.28054	1.867000	0.39499	1.377000	0.46286	0.655000	0.94253	GGC	.		0.597	ABRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380416.1	NM_139166	
MRPL13	28998	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	121455496	121455496	+	Missense_Mutation	SNP	G	G	A			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr8:121455496G>A	ENST00000306185.3	-	2	371	c.80C>T	c.(79-81)cCa>cTa	p.P27L	MTBP_ENST00000305949.1_5'Flank	NM_014078.5	NP_054797.2	Q9BYD1	RM13_HUMAN	mitochondrial ribosomal protein L13	27					translation (GO:0006412)	mitochondrial large ribosomal subunit (GO:0005762)|mitochondrial ribosome (GO:0005761)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(1)|ovary(1)	6	Lung NSC(37;1.69e-07)|Ovarian(258;0.00769)|all_neural(195;0.0804)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00503)			TTTGCCAGGTGGCTGCATTTT	0.373																																					p.P27L		.											.	MRPL13-226	0			c.C80T						.						123.0	118.0	120.0					8																	121455496		2203	4300	6503	SO:0001583	missense	28998	exon2			CCAGGTGGCTGCA	AB049640	CCDS6332.1	8q22.1-q22.3	2012-09-13			ENSG00000172172	ENSG00000172172		"""Mitochondrial ribosomal proteins / large subunits"""	14278	protein-coding gene	gene with protein product		610200				11543634	Standard	NM_014078		Approved	L13, RPL13, L13mt, RPML13, L13A	uc003ypa.3	Q9BYD1	OTTHUMG00000165039	ENST00000306185.3:c.80C>T	8.37:g.121455496G>A	ENSP00000306548:p.Pro27Leu	178	0		194	62	NM_014078	0	0	31	46	15	B2R4R8|Q9UI04	Missense_Mutation	SNP	ENST00000306185.3	37	CCDS6332.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.607489	0.87157	.	.	ENSG00000172172	ENST00000306185;ENST00000518918	.	.	.	5.65	5.65	0.86999	Ribosomal protein L13 domain (2);	0.000000	0.85682	D	0.000000	D	0.83280	0.5220	M	0.80508	2.5	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82942	-0.0207	9	0.45353	T	0.12	-0.4573	19.3324	0.94297	0.0:0.0:1.0:0.0	.	27	Q9BYD1	RM13_HUMAN	L	27;3	.	ENSP00000306548:P27L	P	-	2	0	MRPL13	121524677	1.000000	0.71417	0.998000	0.56505	0.884000	0.51177	9.102000	0.94226	2.663000	0.90544	0.542000	0.68232	CCA	.		0.373	MRPL13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381523.1	NM_014078	
CYHR1	50626	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	145690192	145690192	+	Splice_Site	SNP	C	C	G			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr8:145690192C>G	ENST00000438911.2	-	1	226	c.93G>C	c.(91-93)gaG>gaC	p.E31D	CYHR1_ENST00000403000.2_Splice_Site_p.E31D|CYHR1_ENST00000424149.2_Splice_Site_p.E31D|CYHR1_ENST00000306145.5_Splice_Site_p.E31D|KIFC2_ENST00000301332.2_5'Flank|CTD-2517M22.16_ENST00000525461.1_RNA|KIFC2_ENST00000301331.5_5'Flank|CYHR1_ENST00000530374.1_5'Flank	NM_138496.1	NP_612505.1	Q6ZMK1	CYHR1_HUMAN	cysteine/histidine-rich 1	31						cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)	zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(2)|lung(3)|ovary(2)	7	all_cancers(97;4.61e-11)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.1e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)			GTGTACTCACCTCGGCTGTGC	0.627																																					p.E31D		.											.	CYHR1-90	0			c.G93C						.						37.0	38.0	38.0					8																	145690192		2197	4298	6495	SO:0001630	splice_region_variant	50626	exon2			ACTCACCTCGGCT	AB007965	CCDS6426.1, CCDS47943.1	8q24	2004-12-07	2005-07-24		ENSG00000187954	ENSG00000187954			17806	protein-coding gene	gene with protein product			"""cysteine and histidine rich 1"""			10745073	Standard	NM_138496		Approved	CHRP, KIAA0496, MGC13010	uc003zcv.2	Q6ZMK1	OTTHUMG00000165171	ENST00000438911.2:c.93+1G>C	8.37:g.145690192C>G		38	0		51	18	NM_032687	0	0	0	4	4	B3KSX0|D3DWM3|Q9BSF6|Q9BSU6	Missense_Mutation	SNP	ENST00000438911.2	37	CCDS47943.1	.	.	.	.	.	.	.	.	.	.	c	17.42	3.385251	0.61956	.	.	ENSG00000187954	ENST00000438911;ENST00000526887;ENST00000403000;ENST00000424149;ENST00000306145;ENST00000533764;ENST00000530637	T;T;T;T;T;T;T	0.43688	0.94;1.65;0.94;0.94;0.94;0.94;0.94	4.22	4.22	0.49857	.	0.251507	0.25386	U	0.031059	T	0.24736	0.0600	N	0.08118	0	0.09310	N	0.999991	B;B	0.21606	0.058;0.0	B;B	0.19391	0.025;0.001	T	0.27297	-1.0078	10	0.72032	D	0.01	.	12.4423	0.55631	0.0:1.0:0.0:0.0	.	31;31	Q6ZMK1-3;Q6ZMK1	.;CYHR1_HUMAN	D	31	ENSP00000387426:E31D;ENSP00000434470:E31D;ENSP00000385962:E31D;ENSP00000414647:E31D;ENSP00000304826:E31D;ENSP00000432902:E31D;ENSP00000434642:E31D	ENSP00000304826:E31D	E	-	3	2	CYHR1	145661000	1.000000	0.71417	1.000000	0.80357	0.853000	0.48598	2.359000	0.44142	2.074000	0.62210	0.556000	0.70494	GAG	.		0.627	CYHR1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000382438.1	NM_032687	Missense_Mutation
FREM1	158326	hgsc.bcm.edu;broad.mit.edu	37	9	14824065	14824065	+	Silent	SNP	T	T	G	rs200760404		TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr9:14824065T>G	ENST00000380880.3	-	12	2910	c.2127A>C	c.(2125-2127)gtA>gtC	p.V709V	FREM1_ENST00000380881.4_Silent_p.V710V|FREM1_ENST00000422223.2_Silent_p.V709V			Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1	709					cell communication (GO:0007154)|cell-matrix adhesion (GO:0007160)|craniofacial suture morphogenesis (GO:0097094)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(40)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	100				GBM - Glioblastoma multiforme(50;3.53e-06)		GATTCTTAACTACTTTTGGTA	0.408																																					p.V709V		.											.	FREM1-138	0			c.A2127C						.						70.0	69.0	69.0					9																	14824065		1929	4143	6072	SO:0001819	synonymous_variant	158326	exon13			CTTAACTACTTTT	AK058190	CCDS47952.1, CCDS55293.1	9p22.3	2010-06-04	2004-12-15	2004-12-15	ENSG00000164946	ENSG00000164946			23399	protein-coding gene	gene with protein product		608944	"""chromosome 9 open reading frame 154"""	C9orf154		12838346, 15345741	Standard	NM_144966		Approved	FLJ25461, C9orf145, C9orf143, DKFZp686M16108, TILRR	uc003zlm.3	Q5H8C1	OTTHUMG00000019575	ENST00000380880.3:c.2127A>C	9.37:g.14824065T>G		26	0		25	5	NM_144966	0	0	2	2	0	B7ZBX4|Q5VV00|Q5VV01|Q6MZI4|Q8NEG9|Q96LI3	Silent	SNP	ENST00000380880.3	37	CCDS47952.1																																																																																			T|1.000;C|0.000		0.408	FREM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339474.2	NM_144966	
TNFSF8	944	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	117666220	117666220	+	Missense_Mutation	SNP	A	A	C			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr9:117666220A>C	ENST00000223795.2	-	4	809	c.696T>G	c.(694-696)aaT>aaG	p.N232K	TNFSF8_ENST00000474301.1_Intron	NM_001244.3	NP_001235.1	P32971	TNFL8_HUMAN	tumor necrosis factor (ligand) superfamily, member 8	232					apoptotic process (GO:0006915)|CD8-positive, alpha-beta T cell differentiation (GO:0043374)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|defense response to Gram-positive bacterium (GO:0050830)|immune response (GO:0006955)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	receptor binding (GO:0005102)			endometrium(1)|large_intestine(2)|lung(4)|ovary(1)|skin(3)|urinary_tract(1)	12						TTCAGTCTGAATTACTGTATA	0.408																																					p.N232K		.											.	TNFSF8-655	0			c.T696G						.						165.0	157.0	159.0					9																	117666220		2203	4300	6503	SO:0001583	missense	944	exon4			GTCTGAATTACTG	L09753	CCDS6810.1, CCDS75884.1	9q33	2008-02-05			ENSG00000106952	ENSG00000106952		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"""	11938	protein-coding gene	gene with protein product		603875		CD30LG		8391931, 9349718	Standard	NM_001244		Approved	CD153	uc004bji.2	P32971	OTTHUMG00000021025	ENST00000223795.2:c.696T>G	9.37:g.117666220A>C	ENSP00000223795:p.Asn232Lys	266	0		273	82	NM_001244	0	0	0	0	0	O43404	Missense_Mutation	SNP	ENST00000223795.2	37	CCDS6810.1	.	.	.	.	.	.	.	.	.	.	A	10.09	1.255547	0.22965	.	.	ENSG00000106952	ENST00000223795	.	.	.	5.78	2.21	0.28008	.	0.916415	0.09426	N	0.803692	T	0.18130	0.0435	N	0.08118	0	0.09310	N	1	B	0.12013	0.005	B	0.09377	0.004	T	0.23048	-1.0199	9	0.48119	T	0.1	-0.0101	4.7061	0.12849	0.6059:0.1526:0.2415:0.0	.	232	P32971	TNFL8_HUMAN	K	232	.	ENSP00000223795:N232K	N	-	3	2	TNFSF8	116706041	0.167000	0.22975	0.531000	0.27976	0.664000	0.39144	0.394000	0.20834	0.135000	0.18707	-0.256000	0.11100	AAT	.		0.408	TNFSF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055464.1		
TOR1A	1861	broad.mit.edu	37	9	132584984	132584984	+	Missense_Mutation	SNP	C	C	T			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr9:132584984C>T	ENST00000351698.4	-	2	368	c.320G>A	c.(319-321)gGc>gAc	p.G107D	TOR1A_ENST00000473084.1_5'UTR	NM_000113.2	NP_000104.1	O14656	TOR1A_HUMAN	torsin family 1, member A (torsin A)	107	Interaction with SNAPIN.				ATP catabolic process (GO:0006200)|cell adhesion (GO:0007155)|chaperone mediated protein folding requiring cofactor (GO:0051085)|chaperone-mediated protein folding (GO:0061077)|chaperone-mediated protein transport (GO:0072321)|ER-associated misfolded protein catabolic process (GO:0071712)|intermediate filament cytoskeleton organization (GO:0045104)|neuron projection development (GO:0031175)|nuclear envelope organization (GO:0006998)|nuclear membrane organization (GO:0071763)|organelle organization (GO:0006996)|positive regulation of synaptic vesicle endocytosis (GO:1900244)|protein deneddylation (GO:0000338)|protein homooligomerization (GO:0051260)|protein localization to nucleus (GO:0034504)|regulation of dopamine uptake involved in synaptic transmission (GO:0051584)|regulation of protein localization to cell surface (GO:2000008)|response to oxidative stress (GO:0006979)|synaptic vesicle transport (GO:0048489)|wound healing, spreading of cells (GO:0044319)	cell junction (GO:0030054)|cytoplasmic vesicle membrane (GO:0030659)|cytoskeleton (GO:0005856)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|extrinsic component of endoplasmic reticulum membrane (GO:0042406)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|secretory granule (GO:0030141)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|cytoskeletal protein binding (GO:0008092)|kinesin binding (GO:0019894)|unfolded protein binding (GO:0051082)	p.G107D(4)		central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(5)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	20		Ovarian(14;0.00556)				GAAATTTTTGCCGGTGCCTGT	0.468																																					p.G107D													.	TOR1A-90	4	Substitution - Missense(4)	kidney(3)|lung(1)	c.G320A						.						226.0	200.0	209.0					9																	132584984		2203	4300	6503	SO:0001583	missense	1861	exon2			TTTTTGCCGGTGC	AF007871	CCDS6930.1	9q32-q34	2008-07-21	2004-11-24	2004-11-26	ENSG00000136827	ENSG00000136827			3098	protein-coding gene	gene with protein product		605204	"""dystonia 1, torsion (autosomal dominant; torsin A)"""	DYT1		10644435	Standard	NM_000113		Approved	DQ2	uc004byl.3	O14656	OTTHUMG00000020794	ENST00000351698.4:c.320G>A	9.37:g.132584984C>T	ENSP00000345719:p.Gly107Asp	459	0		420	7	NM_000113	0	0	54	54	0	B2RB58|Q53Y64|Q96CA0	Missense_Mutation	SNP	ENST00000351698.4	37	CCDS6930.1	.	.	.	.	.	.	.	.	.	.	C	19.49	3.838232	0.71373	.	.	ENSG00000136827	ENST00000351698	D	0.92099	-2.97	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	D	0.97281	0.9111	H	0.94462	3.54	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98397	1.0566	10	0.87932	D	0	-8.4354	17.7332	0.88384	0.0:1.0:0.0:0.0	.	107;107	O14656-2;O14656	.;TOR1A_HUMAN	D	107	ENSP00000345719:G107D	ENSP00000345719:G107D	G	-	2	0	TOR1A	131624805	1.000000	0.71417	0.995000	0.50966	0.072000	0.16883	7.484000	0.81180	2.439000	0.82584	0.561000	0.74099	GGC	.		0.468	TOR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054611.1	NM_000113	
SELE	6401	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	169698749	169698749	+	Frame_Shift_Del	DEL	T	T	-			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr1:169698749delT	ENST00000333360.7	-	6	920	c.781delA	c.(781-783)agcfs	p.S261fs	SELE_ENST00000367777.1_Frame_Shift_Del_p.S261fs|SELE_ENST00000367776.1_Frame_Shift_Del_p.S261fs|SELE_ENST00000367782.4_Frame_Shift_Del_p.S261fs|SELE_ENST00000367779.4_Frame_Shift_Del_p.S261fs|SELE_ENST00000367781.4_Frame_Shift_Del_p.S261fs|SELE_ENST00000367774.1_Frame_Shift_Del_p.S261fs|C1orf112_ENST00000498289.1_Intron|SELE_ENST00000367780.4_Frame_Shift_Del_p.S199fs|SELE_ENST00000367775.1_Frame_Shift_Del_p.S199fs	NM_000450.2	NP_000441.2	P16581	LYAM2_HUMAN	selectin E	261	Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.				actin filament-based process (GO:0030029)|activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|leukocyte tethering or rolling (GO:0050901)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of receptor internalization (GO:0002092)|regulation of inflammatory response (GO:0050727)|response to interleukin-1 (GO:0070555)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)	caveola (GO:0005901)|coated pit (GO:0005905)|cortical cytoskeleton (GO:0030863)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	oligosaccharide binding (GO:0070492)|phospholipase binding (GO:0043274)|sialic acid binding (GO:0033691)|transmembrane signaling receptor activity (GO:0004888)	p.S261G(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(3)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	32	all_hematologic(923;0.208)				Carvedilol(DB01136)	CATGGGAAGCTTCCAGGGTTT	0.448																																					p.S261fs		.											.	SELE-95	1	Substitution - Missense(1)	lung(1)	c.781delA						.						137.0	130.0	132.0					1																	169698749		2203	4300	6503	SO:0001589	frameshift_variant	6401	exon6			.	M30640	CCDS1283.1	1q22-q25	2008-07-31	2008-07-31		ENSG00000007908	ENSG00000007908		"""CD molecules"""	10718	protein-coding gene	gene with protein product		131210	"""endothelial adhesion molecule 1"""	ELAM1, ELAM		1375831	Standard	NM_000450		Approved	ESEL, CD62E	uc001ggm.4	P16581	OTTHUMG00000034851	ENST00000333360.7:c.781delA	1.37:g.169698749delT	ENSP00000331736:p.Ser261fs	235	0		250	97	NM_000450	0	0	0	0	0	A2RRD6|P16111	Frame_Shift_Del	DEL	ENST00000333360.7	37	CCDS1283.1																																																																																			.		0.448	SELE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084333.1	NM_000450	
CEP350	9857	hgsc.bcm.edu;broad.mit.edu	37	1	179965912	179965912	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr1:179965912delA	ENST00000367607.3	+	6	1038	c.620delA	c.(619-621)caafs	p.Q207fs		NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	207					microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						GATGCATTGCAAAATTCTGAA	0.378																																					p.Q207fs		.											.	CEP350-26	0			c.620delA						.						78.0	73.0	75.0					1																	179965912		2203	4300	6503	SO:0001589	frameshift_variant	9857	exon6			.	AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.620delA	1.37:g.179965912delA	ENSP00000356579:p.Gln207fs	44	0		55	12	NM_014810	0	0	0	0	0	O75068|Q8TDK3|Q8WY20	Frame_Shift_Del	DEL	ENST00000367607.3	37	CCDS1336.1																																																																																			.		0.378	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085315.2	NM_014810	
ELF3	1999	broad.mit.edu;bcgsc.ca	37	1	201981806	201981814	+	In_Frame_Del	DEL	GGTCAGCAA	GGTCAGCAA	-			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	GGTCAGCAA	GGTCAGCAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr1:201981806_201981814delGGTCAGCAA	ENST00000359651.3	+	4	3709_3717	c.517_525delGGTCAGCAA	c.(517-525)ggtcagcaadel	p.GQQ173del	ELF3_ENST00000367284.5_In_Frame_Del_p.GQQ173del|RP11-510N19.5_ENST00000504773.1_RNA|ELF3_ENST00000367283.3_In_Frame_Del_p.GQQ173del|RP11-465N4.4_ENST00000419190.1_RNA					E74-like factor 3 (ets domain transcription factor, epithelial-specific )											breast(2)|endometrium(2)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	20						GCTGGACGACGGTCAGCAAGCCAGCCCCT	0.66																																					p.173_175del													.	ELF3-226	0			c.517_525del						.																																			SO:0001651	inframe_deletion	1999	exon5			GACGACGGTCAGC	AF016295	CCDS1419.1	1q32.2	2008-02-05			ENSG00000163435	ENSG00000163435			3318	protein-coding gene	gene with protein product		602191		ESX		9395241, 9129154	Standard	NM_001114309		Approved	EPR-1, ESE-1, ERT	uc001gxh.4	P78545	OTTHUMG00000035867	ENST00000359651.3:c.517_525delGGTCAGCAA	1.37:g.201981806_201981814delGGTCAGCAA	ENSP00000352673:p.Gly173_Gln175del	104	0		72	9	NM_001114309	0	0	0	0	0		In_Frame_Del	DEL	ENST00000359651.3	37	CCDS1419.1																																																																																			.		0.660	ELF3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087360.1	NM_004433	
ANGEL1	23357	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	77274402	77274411	+	Frame_Shift_Del	DEL	GAGTGAACTG	GAGTGAACTG	-	rs138394702	byFrequency	TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	GAGTGAACTG	GAGTGAACTG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr14:77274402_77274411delGAGTGAACTG	ENST00000251089.2	-	3	842_851	c.730_739delCAGTTCACTC	c.(730-741)cagttcactctgfs	p.QFTL244fs	ANGEL1_ENST00000554941.1_5'Flank	NM_015305.3	NP_056120.2	Q9UNK9	ANGE1_HUMAN	angel homolog 1 (Drosophila)	244										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(2)|lung(9)|ovary(2)|skin(1)|stomach(1)|urinary_tract(1)	22			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0285)		TAAGACATCAGAGTGAACTGGAACTGAGGG	0.505																																					p.244_247del		.											.	ANGEL1-93	0			c.730_739del						.																																			SO:0001589	frameshift_variant	23357	exon3			.	AF111169	CCDS9852.1	14q24.3	2014-06-17		2005-08-04	ENSG00000013523	ENSG00000013523			19961	protein-coding gene	gene with protein product				KIAA0759		11943475	Standard	NM_015305		Approved	Ccr4e	uc001xsv.3	Q9UNK9	OTTHUMG00000171494	ENST00000251089.2:c.730_739delCAGTTCACTC	14.37:g.77274402_77274411delGAGTGAACTG	ENSP00000251089:p.Gln244fs	121	0		121	26	NM_015305	0	0	0	0	0	B4DWL7|O94859|Q8NCS9	Frame_Shift_Del	DEL	ENST00000251089.2	37	CCDS9852.1																																																																																			.		0.505	ANGEL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413712.2	NM_015305	
FBN3	84467	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	8182139	8182139	+	Frame_Shift_Del	DEL	T	T	-			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr19:8182139delT	ENST00000600128.1	-	28	3914	c.3500delA	c.(3499-3501)gacfs	p.D1167fs	FBN3_ENST00000601739.1_Frame_Shift_Del_p.D1167fs|FBN3_ENST00000270509.2_Frame_Shift_Del_p.D1167fs			Q75N90	FBN3_HUMAN	fibrillin 3	1167	EGF-like 16; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						ACAGTGCACGTCACACCCACC	0.637																																					p.D1167fs		.											.	FBN3-100	0			c.3500delA						.						82.0	67.0	72.0					19																	8182139		2203	4300	6503	SO:0001589	frameshift_variant	84467	exon27			.		CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.3500delA	19.37:g.8182139delT	ENSP00000470498:p.Asp1167fs	86	0		62	14	NM_032447	0	0	0	0	0	Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Frame_Shift_Del	DEL	ENST00000600128.1	37	CCDS12196.1																																																																																			.		0.637	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461428.2	NM_032447	
EP300	2033	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	22	41574679	41574681	+	In_Frame_Del	DEL	CCC	CCC	-			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	CCC	CCC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr22:41574679_41574681delCCC	ENST00000263253.7	+	31	8183_8185	c.6964_6966delCCC	c.(6964-6966)cccdel	p.P2323del	RP1-85F18.6_ENST00000415054.1_RNA|RP1-85F18.5_ENST00000420537.1_RNA	NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300	2323					apoptotic process (GO:0006915)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|circadian rhythm (GO:0007623)|G2/M transition of mitotic cell cycle (GO:0000086)|heart development (GO:0007507)|histone H2B acetylation (GO:0043969)|histone H4 acetylation (GO:0043967)|innate immune response (GO:0045087)|internal peptidyl-lysine acetylation (GO:0018393)|internal protein amino acid acetylation (GO:0006475)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|lung development (GO:0030324)|mitotic cell cycle (GO:0000278)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of protein binding (GO:0032092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tubulin deacetylation (GO:0090043)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|activating transcription factor binding (GO:0033613)|androgen receptor binding (GO:0050681)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|nuclear hormone receptor binding (GO:0035257)|pre-mRNA intronic binding (GO:0097157)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transferase activity, transferring acyl groups (GO:0016746)|zinc ion binding (GO:0008270)			NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171						ACAGTCCCAGCCCCCCCACTCCA	0.616			"""T,  N, F, Mis, O"""	"""MLL, RUNXBP2"""	"""colorectal, breast, pancreatic, AML, ALL, DLBCL"""				Rubinstein-Taybi syndrome																												p.2322_2322del		.		Rec	yes		22	22q13	2033	300 kd E1A-Binding protein gene		"""L, E"""	.	EP300-2011	0			c.6964_6966del						.																																			SO:0001651	inframe_deletion	2033	exon31	Familial Cancer Database	Broad Thumb-Hallux syndrome	.	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393		"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700				7523245	Standard	NM_001429		Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	ENST00000263253.7:c.6964_6966delCCC	22.37:g.41574682_41574684delCCC	ENSP00000263253:p.Pro2323del	135	0		146	38	NM_001429	0	0	0	0	0	B1AKC2	In_Frame_Del	DEL	ENST00000263253.7	37	CCDS14010.1																																																																																			.		0.616	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320600.1	NM_001429	
PIPOX	51268	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	27370356	27370357	+	Splice_Site	INS	-	-	G			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr17:27370356_27370357insG	ENST00000323372.4	+	1	439_440	c.113_114insG	c.(112-117)cagttc>caGgttc	p.F39fs	PIPOX_ENST00000583215.1_Intron	NM_016518.2	NP_057602.2	Q9P0Z9	SOX_HUMAN	pipecolic acid oxidase	39					L-lysine catabolic process to acetyl-CoA via L-pipecolate (GO:0033514)|oxidation-reduction process (GO:0055114)|tetrahydrofolate metabolic process (GO:0046653)	peroxisome (GO:0005777)	L-pipecolate oxidase activity (GO:0050031)|receptor binding (GO:0005102)|sarcosine oxidase activity (GO:0008115)			endometrium(2)|large_intestine(4)|lung(1)|prostate(1)|skin(1)|urinary_tract(1)	10	Lung NSC(42;0.015)		Epithelial(11;9.87e-06)|BRCA - Breast invasive adenocarcinoma(11;3.92e-05)|all cancers(11;5.59e-05)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)		Glycine(DB00145)	CTGCTGGAGCAGGTACTGTGTC	0.584																																					p.Q38fs		.											.	PIPOX-90	0			c.113_114insG						.																																			SO:0001630	splice_region_variant	51268	exon1			.	AF134593	CCDS11248.1	17p13.2	2008-07-18			ENSG00000179761	ENSG00000179761			17804	protein-coding gene	gene with protein product	"""L-pipecolic acid oxidase"""					10772957, 10642506	Standard	NM_016518		Approved	LPIPOX	uc002hdr.1	Q9P0Z9	OTTHUMG00000132679	ENST00000323372.4:c.114+1->G	17.37:g.27370358_27370358dupG		91	0		156	78	NM_016518	0	0	0	0	0	B3KNH0|Q96H28|Q9C070	Frame_Shift_Ins	INS	ENST00000323372.4	37	CCDS11248.1																																																																																			.		0.584	PIPOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255954.1	NM_016518	Frame_Shift_Ins
ITGB5	3693	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	124515613	124515614	+	Nonsense_Mutation	DNP	CC	CC	AT			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	CC	CC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr3:124515613_124515614CC>AT	ENST00000296181.4	-	10	1610_1611	c.1314_1315GG>AT	c.(1312-1317)acGGag>acATag	p.E439*		NM_002213.3	NP_002204.2	P18084	ITB5_HUMAN	integrin, beta 5	439					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|epithelial cell-cell adhesion (GO:0090136)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle contraction (GO:0006936)|stress fiber assembly (GO:0043149)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alphav-beta5 complex (GO:0034684)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	30				GBM - Glioblastoma multiforme(114;0.163)		AACACATGCTCCGTGTGTCTGC	0.609																																					p.E439*		.											.	ITGB5	0			c.G1314A						.																																			SO:0001587	stop_gained	3693	exon10			ATGCTCCGTGTGT	J05633	CCDS3030.1	3q21.2	2010-03-23			ENSG00000082781	ENSG00000082781		"""Integrins"""	6160	protein-coding gene	gene with protein product		147561				2211615	Standard	NM_002213		Approved		uc003eho.3	P18084	OTTHUMG00000159432	ENST00000296181.4:c.1314_1315delinsAT	3.37:g.124515613_124515614delinsAT	ENSP00000296181:p.Glu439*	73.0	0.0		91.0	24.0		0	0	0	0	0	B0LPF8|B2RD70	Nonsense_Mutation	DNP	ENST00000296181.4	37	CCDS3030.1																																																																																			.		0.609	ITGB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355286.3	NM_002213	
