#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CELSR2	1952	hgsc.bcm.edu	37	1	109801211	109801211	+	Silent	SNP	G	G	C			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr1:109801211G>C	ENST00000271332.3	+	2	3529	c.3468G>C	c.(3466-3468)acG>acC	p.T1156T		NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	1156					cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		TGGCCGCCACGCTGGCCACGC	0.672																																					p.T1156T	NSCLC(158;1285 2011 34800 34852 42084)	.											.	CELSR2-526	0			c.G3468C						.						21.0	21.0	21.0					1																	109801211		2196	4293	6489	SO:0001819	synonymous_variant	1952	exon2			CGCCACGCTGGCC	D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.3468G>C	1.37:g.109801211G>C		12	0		11	2	NM_001408	0	0	16	16	0	Q5T2Y7|Q92566	Silent	SNP	ENST00000271332.3	37	CCDS796.1																																																																																			.		0.672	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033200.1	NM_001408	
PLXNA2	5362	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	208270156	208270156	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr1:208270156C>A	ENST00000367033.3	-	7	2561	c.1804G>T	c.(1804-1806)Gtg>Ttg	p.V602L		NM_025179.3	NP_079455.3	O75051	PLXA2_HUMAN	plexin A2	602					axon guidance (GO:0007411)|centrosome localization (GO:0051642)|cerebellar granule cell precursor tangential migration (GO:0021935)|limb bud formation (GO:0060174)|neural tube development (GO:0021915)|pharyngeal system development (GO:0060037)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|somitogenesis (GO:0001756)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)	80				OV - Ovarian serous cystadenocarcinoma(81;0.199)		TGCCCCTCCACCTCTGTCAGG	0.562																																					p.V602L		.											.	PLXNA2-92	0			c.G1804T						.						76.0	63.0	67.0					1																	208270156		2203	4300	6503	SO:0001583	missense	5362	exon7			CCTCCACCTCTGT	X87831	CCDS31013.1	1q32.2	2008-07-18			ENSG00000076356	ENSG00000076356		"""Plexins"""	9100	protein-coding gene	gene with protein product	"""plexin 2"", ""plexin-A2"", ""semaphorin receptor OCT"", ""transmembrane protein OCT"""	601054		PLXN2		8570614	Standard	NM_025179		Approved	OCT, FLJ11751, FLJ30634, KIAA0463	uc001hgz.3	O75051	OTTHUMG00000036564	ENST00000367033.3:c.1804G>T	1.37:g.208270156C>A	ENSP00000356000:p.Val602Leu	82	0		63	20	NM_025179	0	0	1	2	1	A2RTX9|B2RMX7|Q6UX61|Q96GN9|Q9BRL1|Q9UIW1	Missense_Mutation	SNP	ENST00000367033.3	37	CCDS31013.1	.	.	.	.	.	.	.	.	.	.	C	11.86	1.764098	0.31228	.	.	ENSG00000076356	ENST00000367033	T	0.00856	5.61	4.92	4.92	0.64577	.	0.309702	0.38837	N	0.001558	T	0.01695	0.0054	L	0.57536	1.79	0.58432	D	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.61272	-0.7096	10	0.22109	T	0.4	.	18.3153	0.90218	0.0:1.0:0.0:0.0	.	602	O75051	PLXA2_HUMAN	L	602	ENSP00000356000:V602L	ENSP00000356000:V602L	V	-	1	0	PLXNA2	206336779	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	5.321000	0.65846	2.563000	0.86464	0.655000	0.94253	GTG	.		0.562	PLXNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088932.6	NM_025179	
STAM	8027	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	17747670	17747670	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr10:17747670T>A	ENST00000377524.3	+	12	1354	c.1139T>A	c.(1138-1140)aTg>aAg	p.M380K	STAM_ENST00000540523.1_Missense_Mutation_p.M269K	NM_003473.3	NP_003464.1	Q92783	STAM1_HUMAN	signal transducing adaptor molecule (SH3 domain and ITAM motif) 1	380	ITAM.				endosomal transport (GO:0016197)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)	SH3/SH2 adaptor activity (GO:0005070)			breast(2)|endometrium(4)|kidney(2)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	26						GAAGATCCGATGTATTCCATG	0.368																																					p.M380K		.											.	STAM-154	0			c.T1139A						.						160.0	153.0	156.0					10																	17747670		2203	4300	6503	SO:0001583	missense	8027	exon12			ATCCGATGTATTC	U43899	CCDS7122.1	10p14-p13	2009-04-29			ENSG00000136738	ENSG00000136738			11357	protein-coding gene	gene with protein product	"""HSE1 homolog (S. cerevisiae)"""	601899				8780729	Standard	NM_003473		Approved	STAM1	uc001ipj.2	Q92783	OTTHUMG00000017749	ENST00000377524.3:c.1139T>A	10.37:g.17747670T>A	ENSP00000366746:p.Met380Lys	228	0		166	48	NM_003473	0	0	9	17	8	B0YJ99|D3DRU5|Q8N6D9	Missense_Mutation	SNP	ENST00000377524.3	37	CCDS7122.1	.	.	.	.	.	.	.	.	.	.	T	16.28	3.077571	0.55753	.	.	ENSG00000136738	ENST00000377524;ENST00000540523	T;T	0.38722	1.47;1.12	5.64	4.49	0.54785	.	0.132590	0.64402	D	0.000002	T	0.33089	0.0851	L	0.48642	1.525	0.52501	D	0.999957	P;B	0.36048	0.534;0.173	B;B	0.32211	0.142;0.031	T	0.11494	-1.0585	10	0.28530	T	0.3	-5.6897	11.8463	0.52387	0.0:0.0697:0.0:0.9303	.	269;380	B4DZT2;Q92783	.;STAM1_HUMAN	K	380;269	ENSP00000366746:M380K;ENSP00000438073:M269K	ENSP00000366746:M380K	M	+	2	0	STAM	17787676	1.000000	0.71417	0.968000	0.41197	0.992000	0.81027	7.698000	0.84413	2.152000	0.67230	0.533000	0.62120	ATG	.		0.368	STAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047039.1	NM_003473	
C10orf2	56652	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	102750271	102750271	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr10:102750271G>T	ENST00000311916.2	+	3	1748	c.1563G>T	c.(1561-1563)atG>atT	p.M521I	MRPL43_ENST00000477279.1_5'Flank|MRPL43_ENST00000342071.1_5'Flank|C10orf2_ENST00000370228.1_Missense_Mutation_p.M521I|MRPL43_ENST00000318364.8_5'Flank|C10orf2_ENST00000473656.1_3'UTR	NM_001163813.1|NM_021830.4	NP_001157285.1|NP_068602.2	Q96RR1	PEO1_HUMAN	chromosome 10 open reading frame 2	521	SF4 helicase. {ECO:0000255|PROSITE- ProRule:PRU00596}.				cell death (GO:0008219)|DNA unwinding involved in DNA replication (GO:0006268)|mitochondrial DNA replication (GO:0006264)|protein hexamerization (GO:0034214)|protein homooligomerization (GO:0051260)|transcription from mitochondrial promoter (GO:0006390)	mitochondrial nucleoid (GO:0042645)	5'-3' DNA helicase activity (GO:0043139)|ATP binding (GO:0005524)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|skin(1)|stomach(1)	24		Colorectal(252;0.122)|all_hematologic(284;0.152)		Epithelial(162;7.18e-11)|all cancers(201;8.75e-09)|BRCA - Breast invasive adenocarcinoma(275;0.224)		TGCAGTTCATGATGGGTCACG	0.493																																					p.M521I		.											.	C10orf2-69	0			c.G1563T						.						215.0	182.0	193.0					10																	102750271		2203	4300	6503	SO:0001583	missense	56652	exon3			GTTCATGATGGGT	AF292004	CCDS7506.1, CCDS53570.1	10q24	2013-05-13			ENSG00000107815	ENSG00000107815			1160	protein-coding gene	gene with protein product	"""twinkle"", ""T7 helicase-related protein with intramitochondrial nucleoid localization"""	606075	"""infantile onset spinocerebellar ataxia (autosomal recessive)"""	IOSCA		11431692, 10645945, 16135556	Standard	NM_021830		Approved	PEO, PEO1, TWINKLE, FLJ21832, TWINL	uc001ksf.2	Q96RR1	OTTHUMG00000018917	ENST00000311916.2:c.1563G>T	10.37:g.102750271G>T	ENSP00000309595:p.Met521Ile	250	1		230	76	NM_021830	0	0	9	26	17	B2CQL2|Q6MZX2|Q6PJP5|Q96RR0	Missense_Mutation	SNP	ENST00000311916.2	37	CCDS7506.1	.	.	.	.	.	.	.	.	.	.	G	34	5.341268	0.95783	.	.	ENSG00000107815	ENST00000311916;ENST00000370228	D;D	0.93547	-3.24;-3.24	5.73	5.73	0.89815	Circadian clock protein KaiC/DNA repair protein RadA (1);DNA helicase, DnaB-like, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.96436	0.8837	M	0.76574	2.34	0.80722	D	1	D;P	0.67145	0.996;0.587	D;P	0.75484	0.986;0.608	D	0.95117	0.8243	10	0.36615	T	0.2	-17.5845	18.8559	0.92252	0.0:0.0:1.0:0.0	.	521;521	Q96RR1-2;Q96RR1	.;PEO1_HUMAN	I	521	ENSP00000309595:M521I;ENSP00000359248:M521I	ENSP00000309595:M521I	M	+	3	0	C10orf2	102740261	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.813000	0.99286	2.868000	0.98415	0.557000	0.71058	ATG	.		0.493	C10orf2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049886.1	NM_021830	
MUC2	4583	hgsc.bcm.edu	37	11	1092813	1092813	+	Silent	SNP	C	C	T	rs12577898|rs199900755		TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr11:1092813C>T	ENST00000441003.2	+	30	4659	c.4632C>T	c.(4630-4632)acC>acT	p.T1544T	MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000359061.5_Silent_p.T1545T	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	ccaccaccaccacGGTGACCC	0.637																																					p.T1544T		.											.	MUC2-90	0			c.C4632T						.						47.0	95.0	78.0					11																	1092813		1759	3190	4949	SO:0001819	synonymous_variant	4583	exon30			CACCACCACGGTG	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4632C>T	11.37:g.1092813C>T		11	0		12	2	NM_002457	0	0	0	0	0	Q14878	Silent	SNP	ENST00000441003.2	37																																																																																				.		0.637	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
OR52N5	390075	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	5799428	5799428	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr11:5799428G>T	ENST00000317093.2	-	1	469	c.437C>A	c.(436-438)aCc>aAc	p.T146N	TRIM5_ENST00000380027.1_Intron	NM_001001922.2	NP_001001922.2	Q8NH56	O52N5_HUMAN	olfactory receptor, family 52, subfamily N, member 5	146						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(3)|liver(1)|lung(17)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	33		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.05e-11)|LUSC - Lung squamous cell carcinoma(625;0.112)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.195)		GATAGGGTTGGTGAGTGTGGT	0.507																																					p.T146N		.											.	OR52N5-70	0			c.C437A						.						146.0	115.0	126.0					11																	5799428		2125	4095	6220	SO:0001583	missense	390075	exon1			GGGTTGGTGAGTG	AB065535	CCDS31397.1	11p15.4	2012-08-09			ENSG00000181009	ENSG00000181009		"""GPCR / Class A : Olfactory receptors"""	15231	protein-coding gene	gene with protein product							Standard	NM_001001922		Approved	OR52N5Q	uc010qzn.2	Q8NH56	OTTHUMG00000168799	ENST00000317093.2:c.437C>A	11.37:g.5799428G>T	ENSP00000322866:p.Thr146Asn	54	0		34	11	NM_001001922	0	0	0	0	0	B9EH12|Q6IFG2	Missense_Mutation	SNP	ENST00000317093.2	37	CCDS31397.1	.	.	.	.	.	.	.	.	.	.	G	13.46	2.245082	0.39697	.	.	ENSG00000181009	ENST00000317093	T	0.01051	5.4	3.49	3.49	0.39957	GPCR, rhodopsin-like superfamily (1);	0.000000	0.31697	U	0.007215	T	0.04048	0.0113	L	0.50919	1.6	0.38487	D	0.947868	D	0.62365	0.991	D	0.65010	0.931	T	0.54715	-0.8252	10	0.51188	T	0.08	.	14.1011	0.65056	0.0:0.0:1.0:0.0	.	146	Q8NH56	O52N5_HUMAN	N	146	ENSP00000322866:T146N	ENSP00000322866:T146N	T	-	2	0	OR52N5	5756004	0.994000	0.37717	0.771000	0.31576	0.554000	0.35429	2.842000	0.48230	1.952000	0.56665	0.494000	0.49563	ACC	.		0.507	OR52N5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401141.1	NM_001001922	
ACCSL	390110	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	44073203	44073203	+	Splice_Site	SNP	G	G	T	rs200162550	byFrequency	TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr11:44073203G>T	ENST00000378832.1	+	5	762	c.706G>T	c.(706-708)Gtg>Ttg	p.V236L		NM_001031854.2	NP_001027025.2	Q4AC99	1A1L2_HUMAN	1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)-like	236					biosynthetic process (GO:0009058)		catalytic activity (GO:0003824)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|endometrium(6)|large_intestine(5)|lung(14)|ovary(5)|pancreas(1)|skin(2)	34						TTGTCTTCAGGTGGTGGTTCT	0.532																																					p.V236L		.											.	ACCSL-95	0			c.G706T						.						318.0	308.0	311.0					11																	44073203		2094	4207	6301	SO:0001630	splice_region_variant	390110	exon5			CTTCAGGTGGTGG		CCDS41636.1	11p11.2	2008-11-26			ENSG00000205126	ENSG00000205126			34391	protein-coding gene	gene with protein product							Standard	NM_001031854		Approved		uc001mxw.1	Q4AC99	OTTHUMG00000166426	ENST00000378832.1:c.706-1G>T	11.37:g.44073203G>T		476	1		415	54	NM_001031854	0	0	0	0	0		Missense_Mutation	SNP	ENST00000378832.1	37	CCDS41636.1	.	.	.	.	.	.	.	.	.	.	G	18.44	3.624524	0.66901	.	.	ENSG00000205126	ENST00000378832	D	0.92965	-3.14	4.62	4.62	0.57501	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	D	0.90710	0.7085	L	0.43554	1.36	0.80722	D	1	P	0.44946	0.846	P	0.47786	0.557	D	0.89650	0.3869	9	.	.	.	-22.261	15.014	0.71570	0.0:0.0:1.0:0.0	.	236	Q4AC99	1A1L2_HUMAN	L	236	ENSP00000368109:V236L	.	V	+	1	0	ACCSL	44029779	1.000000	0.71417	1.000000	0.80357	0.630000	0.37929	7.516000	0.81772	2.392000	0.81423	0.563000	0.77884	GTG	G|0.998;A|0.002		0.532	ACCSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389717.1	NM_001031854	Missense_Mutation
AP5B1	91056	hgsc.bcm.edu	37	11	65545368	65545368	+	Missense_Mutation	SNP	G	G	C	rs577605653	byFrequency	TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr11:65545368G>C	ENST00000532090.2	-	2	2806	c.2596C>G	c.(2596-2598)Ctg>Gtg	p.L866V		NM_138368.4	NP_612377.4	Q2VPB7	AP5B1_HUMAN	adaptor-related protein complex 5, beta 1 subunit	866					endosomal transport (GO:0016197)|protein transport (GO:0015031)	AP-type membrane coat adaptor complex (GO:0030119)|lysosomal membrane (GO:0005765)				lung(1)	1						TCCCCCGCCAGGGGCAGCACG	0.721													G|||	7	0.00139776	0.0	0.0101	5008	,	,		13832	0.0		0.0	False		,,,				2504	0.0				p.L866V		.											.	.	0			c.C2596G						.						6.0	7.0	7.0					11																	65545368		1919	4021	5940	SO:0001583	missense	91056	exon2			CCGCCAGGGGCAG	JQ313135	CCDS58146.1	11q13.1	2012-02-29			ENSG00000254470	ENSG00000254470			25104	protein-coding gene	gene with protein product		614367				22022230	Standard	NM_138368		Approved	PP1030, AP-5, DKFZp761E198	uc031qbm.1	Q2VPB7	OTTHUMG00000166593	ENST00000532090.2:c.2596C>G	11.37:g.65545368G>C	ENSP00000454303:p.Leu866Val	3	2		6	4	NM_138368	0	0	3	12	9	A1L0S6|H6WUK2|Q0D2Q2|Q8N3J7|Q8WYH6	Missense_Mutation	SNP	ENST00000532090.2	37	CCDS58146.1																																																																																			.		0.721	AP5B1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390636.2	NM_138368	
BUD13	84811	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	116633298	116633298	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr11:116633298A>G	ENST00000260210.4	-	4	1030	c.1007T>C	c.(1006-1008)tTt>tCt	p.F336S	BUD13_ENST00000375445.3_Intron	NM_032725.3	NP_116114.1	Q9BRD0	BUD13_HUMAN	BUD13 homolog (S. cerevisiae)	336					mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)	nucleus (GO:0005634)|RES complex (GO:0070274)	poly(A) RNA binding (GO:0044822)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(11)|pancreas(2)|skin(1)|urinary_tract(1)	22	all_hematologic(175;0.0487)	all_cancers(61;1.72e-06)|all_epithelial(67;0.000735)|Melanoma(852;0.022)|Acute lymphoblastic leukemia(157;0.0255)|Medulloblastoma(222;0.0523)|Breast(348;0.056)|all_hematologic(158;0.0588)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|Epithelial(105;5.81e-06)|all cancers(92;0.000144)|OV - Ovarian serous cystadenocarcinoma(223;0.154)		CTTGTCTCCAAAATGGGATTT	0.443																																					p.F336S		.											.	BUD13-154	0			c.T1007C						.						134.0	120.0	125.0					11																	116633298		2201	4296	6497	SO:0001583	missense	84811	exon4			TCTCCAAAATGGG	BC006350	CCDS8374.1, CCDS53712.1	11q23.3	2012-06-07	2007-01-12		ENSG00000137656	ENSG00000137656			28199	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 71"""		"""BUD13 homolog (yeast)"""			12477932	Standard	NM_032725		Approved	MGC13125, fSAP71, Cwc26	uc001ppn.3	Q9BRD0	OTTHUMG00000045136	ENST00000260210.4:c.1007T>C	11.37:g.116633298A>G	ENSP00000260210:p.Phe336Ser	267	0		213	66	NM_032725	0	0	6	20	14	A8K0S0|Q96LS7	Missense_Mutation	SNP	ENST00000260210.4	37	CCDS8374.1	.	.	.	.	.	.	.	.	.	.	A	14.33	2.503865	0.44558	.	.	ENSG00000137656	ENST00000260210	T	0.16597	2.33	4.83	-1.94	0.07571	.	1.189750	0.05897	N	0.629384	T	0.12008	0.0292	L	0.31926	0.97	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.002	T	0.41502	-0.9505	10	0.87932	D	0	-0.611	3.4276	0.07416	0.4025:0.0:0.1998:0.3978	.	336;336	A8K4Z6;Q9BRD0	.;BUD13_HUMAN	S	336	ENSP00000260210:F336S	ENSP00000260210:F336S	F	-	2	0	BUD13	116138508	0.000000	0.05858	0.276000	0.24689	0.974000	0.67602	0.121000	0.15667	0.010000	0.14839	0.533000	0.62120	TTT	.		0.443	BUD13-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000104864.1	NM_032725	
LPCAT3	10162	broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	7084424	7084424	+	IGR	SNP	G	G	A			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr12:7084424G>A	ENST00000261407.4	-	0	2268				EMG1_ENST00000261406.6_Missense_Mutation_p.V168I|EMG1_ENST00000546220.1_3'UTR|LPCAT3_ENST00000535021.1_5'Flank	NM_005768.5	NP_005759.4	Q6P1A2	MBOA5_HUMAN	lysophosphatidylcholine acyltransferase 3						glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|regulation of plasma lipoprotein particle levels (GO:0097006)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	1-acylglycerophosphocholine O-acyltransferase activity (GO:0047184)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(4)|ovary(1)|skin(2)	17						TCACTTTCCAGTTGGATGTAT	0.443																																					.													.	.	0			.						.						94.0	89.0	91.0					12																	7084424		1944	4152	6096	SO:0001628	intergenic_variant	10436	.			TTTCCAGTTGGAT	U72515	CCDS8572.1	12p13.31	2010-05-12	2008-06-24	2008-06-24	ENSG00000111684	ENSG00000111684			30244	protein-coding gene	gene with protein product		611950	"""O-acyltransferase (membrane bound) domain containing 5"", ""membrane bound O-acyltransferase domain containing 5"""	OACT5, MBOAT5		8723724, 9074930, 18195019	Standard	NM_005768		Approved	C3F, nessy	uc001qsi.3	Q6P1A2	OTTHUMG00000168970		12.37:g.7084424G>A		38	0		53	8	.	0	0	100	147	47	B2RDH0|B7Z3N3|Q7KZS1|Q92980|Q9BW40	Missense_Mutation	SNP	ENST00000261407.4	37	CCDS8572.1																																																																																			.		0.443	LPCAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401812.1	NM_005768	
HECTD4	283450	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	112694159	112694159	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr12:112694159C>T	ENST00000430131.2	-	20	3141	c.1996G>A	c.(1996-1998)Gat>Aat	p.D666N	HECTD4_ENST00000377560.5_Missense_Mutation_p.D916N|RP3-521E19.2_ENST00000547401.1_RNA|HECTD4_ENST00000550722.1_Missense_Mutation_p.D952N			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	666					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										CATCTGCTATCAAATCTAAGG	0.423																																					p.D954N		.											.	.	0			c.G2860A						.						126.0	129.0	128.0					12																	112694159		2203	4300	6503	SO:0001583	missense	283450	exon21			TGCTATCAAATCT	AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.1996G>A	12.37:g.112694159C>T	ENSP00000404379:p.Asp666Asn	191	0		177	55	NM_001109662	0	0	0	0	0	L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Missense_Mutation	SNP	ENST00000430131.2	37		.	.	.	.	.	.	.	.	.	.	C	36	5.948543	0.97134	.	.	ENSG00000173064	ENST00000377560;ENST00000430131;ENST00000550722	T;T;T	0.65178	-0.02;0.0;-0.14	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	T	0.70919	0.3279	L	0.27053	0.805	0.58432	D	0.999995	D;D;D	0.67145	0.996;0.993;0.996	D;D;D	0.73708	0.981;0.971;0.981	T	0.73202	-0.4057	10	0.87932	D	0	.	19.4096	0.94665	0.0:1.0:0.0:0.0	.	666;666;666	Q9Y4D8-2;Q9Y4D8;Q9Y4D8-3	.;K0614_HUMAN;.	N	916;666;952	ENSP00000366783:D916N;ENSP00000404379:D666N;ENSP00000449784:D952N	ENSP00000366783:D916N	D	-	1	0	C12orf51	111178542	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.298000	0.78815	2.820000	0.97059	0.655000	0.94253	GAT	.		0.423	HECTD4-202	KNOWN	basic	protein_coding	protein_coding		NM_173813	
TDRD3	81550	broad.mit.edu	37	13	61102844	61102844	+	Silent	SNP	T	T	C			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr13:61102844T>C	ENST00000196169.3	+	11	1994	c.1206T>C	c.(1204-1206)gcT>gcC	p.A402A	TDRD3_ENST00000377881.2_Silent_p.A402A|TDRD3_ENST00000535286.1_Silent_p.A495A|TDRD3_ENST00000377894.2_Silent_p.A402A	NM_001146071.1|NM_030794.2	NP_001139543.1|NP_110421.1	Q9H7E2	TDRD3_HUMAN	tudor domain containing 3	402					chromatin modification (GO:0016568)|regulation of RNA biosynthetic process (GO:2001141)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|methylated histone binding (GO:0035064)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)			breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|liver(1)|lung(16)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	40		Prostate(109;0.173)|Breast(118;0.174)		GBM - Glioblastoma multiforme(99;0.000291)		GTGATGGTGCTTTTAAAAAAA	0.373																																					p.A495A	Colon(36;164 906 35820 50723)												.	TDRD3-516	0			c.T1485C						.						72.0	79.0	76.0					13																	61102844		2203	4300	6503	SO:0001819	synonymous_variant	81550	exon11			TGGTGCTTTTAAA	AK023578	CCDS9441.1, CCDS53872.1	13q14.3	2013-01-23			ENSG00000083544	ENSG00000083544		"""Tudor domain containing"""	20612	protein-coding gene	gene with protein product		614392					Standard	NM_030794		Approved	FLJ21007	uc010aeg.3	Q9H7E2	OTTHUMG00000017007	ENST00000196169.3:c.1206T>C	13.37:g.61102844T>C		169	0		141	4	NM_001146070	0	0	2	2	0	B2MWP9|Q53XA6|Q6P992	Silent	SNP	ENST00000196169.3	37	CCDS9441.1																																																																																			.		0.373	TDRD3-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000045175.2	NM_030794	
ING1	3621	hgsc.bcm.edu	37	13	111371943	111371943	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr13:111371943C>G	ENST00000375774.3	+	2	1395	c.933C>G	c.(931-933)caC>caG	p.H311Q	ING1_ENST00000375775.3_Missense_Mutation_p.H99Q|ING1_ENST00000338450.7_Missense_Mutation_p.H124Q|ING1_ENST00000333219.7_Missense_Mutation_p.H168Q	NM_005537.4	NP_005528.3	Q9UK53	ING1_HUMAN	inhibitor of growth family, member 1	311					cell cycle (GO:0007049)|chromatin modification (GO:0016568)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell death (GO:0010941)	nucleus (GO:0005634)	methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(6)|lung(1)|ovary(1)	12	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.188)			ACCACGACCACGACGACGGCG	0.657																																					p.H311Q		.											.	ING1-515	0			c.C933G						.						63.0	50.0	54.0					13																	111371943		2202	4300	6502	SO:0001583	missense	3621	exon2			CGACCACGACGAC		CCDS9515.1, CCDS9516.1, CCDS9517.1, CCDS9518.1	13q34	2013-01-28			ENSG00000153487	ENSG00000153487		"""Zinc fingers, PHD-type"""	6062	protein-coding gene	gene with protein product	"""inhibitor of growth 1"", ""tumor suppressor ING1"", ""growth inhibitor ING1"", ""growth inhibitory protein ING1"""	601566				8944021, 9186514	Standard	NM_198219		Approved	p33ING1, p33ING1b, p24ING1c, p33, p47, p47ING1a	uc001vri.3	Q9UK53	OTTHUMG00000017346	ENST00000375774.3:c.933C>G	13.37:g.111371943C>G	ENSP00000364929:p.His311Gln	36	0		33	2	NM_005537	0	0	26	26	0	O00532|O43658|Q53ZR3|Q5T9G8|Q5T9G9|Q5T9H0|Q5T9H1|Q9H007|Q9HD98|Q9HD99|Q9NS83|Q9P0U6|Q9UBC6|Q9UIJ1|Q9UIJ2|Q9UIJ3|Q9UIJ4|Q9UK52	Missense_Mutation	SNP	ENST00000375774.3	37	CCDS9517.1	.	.	.	.	.	.	.	.	.	.	C	0.059	-1.229151	0.01518	.	.	ENSG00000153487	ENST00000338450;ENST00000333219;ENST00000375775;ENST00000375774	T;T;T;T	0.40225	1.04;1.04;1.04;1.04	5.26	-5.48	0.02592	.	0.354834	0.32258	N	0.006360	T	0.51244	0.1663	L	0.57536	1.79	0.27600	N	0.948993	D;P;D	0.67145	0.996;0.826;0.994	P;B;D	0.75484	0.826;0.415;0.986	T	0.54364	-0.8305	10	0.14252	T	0.57	-24.524	16.5209	0.84315	0.0:0.4147:0.0:0.5853	.	311;168;124	Q9UK53;Q5T9H0;Q9UK53-4	ING1_HUMAN;.;.	Q	124;168;99;311	ENSP00000345202:H124Q;ENSP00000328436:H168Q;ENSP00000364930:H99Q;ENSP00000364929:H311Q	ENSP00000328436:H168Q	H	+	3	2	ING1	110169944	0.000000	0.05858	0.379000	0.26080	0.180000	0.23129	-2.557000	0.00924	-1.139000	0.02881	0.491000	0.48974	CAC	.		0.657	ING1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000045770.2	NM_005537	
FITM1	161247	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	24601751	24601751	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr14:24601751G>C	ENST00000267426.5	+	2	887	c.598G>C	c.(598-600)Gaa>Caa	p.E200Q	FITM1_ENST00000559294.1_Missense_Mutation_p.E4Q	NM_203402.2	NP_981947.1	A5D6W6	FITM1_HUMAN	fat storage-inducing transmembrane protein 1	200					lipid particle organization (GO:0034389)|positive regulation of sequestering of triglyceride (GO:0010890)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)				breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	11						CATGGCAGAGGAAGCAGCTGT	0.652																																					p.E200Q		.											.	FITM1-68	0			c.G598C						.						64.0	56.0	58.0					14																	24601751		2203	4300	6503	SO:0001583	missense	161247	exon2			GCAGAGGAAGCAG		CCDS9611.1	14q12	2009-07-09			ENSG00000139914	ENSG00000139914			33714	protein-coding gene	gene with protein product	"""fat-inducing transcript 1"""	612028				18160536	Standard	NM_203402		Approved	FIT1	uc001wmf.2	A5D6W6	OTTHUMG00000133476	ENST00000267426.5:c.598G>C	14.37:g.24601751G>C	ENSP00000267426:p.Glu200Gln	135	1		93	37	NM_203402	0	0	0	2	2	Q8IUQ7	Missense_Mutation	SNP	ENST00000267426.5	37	CCDS9611.1	.	.	.	.	.	.	.	.	.	.	g	15.81	2.943666	0.53079	.	.	ENSG00000139914	ENST00000267426	.	.	.	5.03	5.03	0.67393	.	0.000000	0.85682	D	0.000000	T	0.79707	0.4492	M	0.80183	2.485	0.54753	D	0.999984	D	0.69078	0.997	D	0.74023	0.982	T	0.82820	-0.0268	9	0.72032	D	0.01	1.4737	15.8474	0.78903	0.0:0.0:1.0:0.0	.	200	A5D6W6	FITM1_HUMAN	Q	200	.	ENSP00000267426:E200Q	E	+	1	0	FITM1	23671591	1.000000	0.71417	0.998000	0.56505	0.817000	0.46193	8.341000	0.90046	2.324000	0.78689	0.462000	0.41574	GAA	.		0.652	FITM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257366.1	NM_203402	
ITGAL	3683	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	30507473	30507473	+	Missense_Mutation	SNP	G	G	A	rs199716730		TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr16:30507473G>A	ENST00000356798.6	+	14	1739	c.1559G>A	c.(1558-1560)cGg>cAg	p.R520Q	ITGAL_ENST00000358164.5_Missense_Mutation_p.R437Q|ITGAL_ENST00000433423.2_Intron|ITGAL_ENST00000568012.1_3'UTR|RP11-297C4.1_ENST00000563751.1_RNA	NM_002209.2	NP_002200.2	P20701	ITAL_HUMAN	integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide)	520					activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell proliferation (GO:0042102)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:0002291)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(10)|kidney(4)|large_intestine(12)|lung(32)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	76					Antithymocyte globulin(DB00098)|Efalizumab(DB00095)|Lovastatin(DB00227)	CCACTCGGGCGGTTTGGAGAA	0.597													G|||	1	0.000199681	0.0008	0.0	5008	,	,		15112	0.0		0.0	False		,,,				2504	0.0				p.R520Q	NSCLC(110;1462 1641 3311 33990 49495)	.											.	ITGAL-994	0			c.G1559A						.	G	GLN/ARG,GLN/ARG	1,4393	2.1+/-5.4	0,1,2196	78.0	85.0	83.0		1310,1559	2.9	0.2	16		83	0,8600		0,0,4300	no	missense,missense	ITGAL	NM_001114380.1,NM_002209.2	43,43	0,1,6496	AA,AG,GG		0.0,0.0228,0.0077	probably-damaging,probably-damaging	437/1087,520/1171	30507473	1,12993	2197	4300	6497	SO:0001583	missense	3683	exon14			TCGGGCGGTTTGG		CCDS32433.1, CCDS45461.1	16p13.1-p11	2010-03-23				ENSG00000005844		"""CD molecules"", ""Integrins"""	6148	protein-coding gene	gene with protein product		153370		CD11A		3284962	Standard	NM_002209		Approved	LFA-1	uc002dyi.4	P20701		ENST00000356798.6:c.1559G>A	16.37:g.30507473G>A	ENSP00000349252:p.Arg520Gln	209	1		244	31	NM_002209	0	0	7	7	0	O43746|Q45H73|Q96HB1|Q9UBC8	Missense_Mutation	SNP	ENST00000356798.6	37	CCDS32433.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	13.18	2.159140	0.38119	2.28E-4	0.0	ENSG00000005844	ENST00000356798;ENST00000358164	T;T	0.26067	1.76;1.76	5.94	2.88	0.33553	.	0.401626	0.21542	N	0.072880	T	0.30916	0.0780	M	0.91196	3.185	0.46631	D	0.999137	P;P	0.49559	0.925;0.746	B;B	0.36244	0.22;0.185	T	0.28586	-1.0039	10	0.87932	D	0	.	6.6609	0.23014	0.1387:0.0:0.7177:0.1437	.	437;520	Q96HB1;P20701	.;ITAL_HUMAN	Q	520;437	ENSP00000349252:R520Q;ENSP00000350886:R437Q	ENSP00000349252:R520Q	R	+	2	0	ITGAL	30414974	0.700000	0.27796	0.186000	0.23195	0.007000	0.05969	3.438000	0.52871	0.384000	0.24942	0.563000	0.77884	CGG	G|0.999;A|0.001		0.597	ITGAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434508.2		
SLC12A3	6559	broad.mit.edu	37	16	56906659	56906659	+	Silent	SNP	A	A	G			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr16:56906659A>G	ENST00000563236.1	+	8	1081	c.1056A>G	c.(1054-1056)acA>acG	p.T352T	SLC12A3_ENST00000566786.1_Silent_p.T351T|SLC12A3_ENST00000438926.2_Silent_p.T352T|SLC12A3_ENST00000262502.5_Silent_p.T351T			P55017	S12A3_HUMAN	solute carrier family 12 (sodium/chloride transporter), member 3	352					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium:chloride symporter activity (GO:0015378)|transporter activity (GO:0005215)			breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(28)|ovary(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50					Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Metolazone(DB00524)|Polythiazide(DB01324)|Quinethazone(DB01325)	CCTCGGCCACAGGCATCCTGG	0.562																																					p.T352T													.	SLC12A3-155	0			c.A1056G						.						77.0	69.0	72.0					16																	56906659		2198	4300	6498	SO:0001819	synonymous_variant	6559	exon8			GGCCACAGGCATC		CCDS10770.1, CCDS45491.1, CCDS58464.1	16q13	2013-07-18	2013-07-18		ENSG00000070915	ENSG00000070915		"""Solute carriers"""	10912	protein-coding gene	gene with protein product		600968				8812482	Standard	NM_000339		Approved	NCCT	uc002ekd.4	P55017	OTTHUMG00000133284	ENST00000563236.1:c.1056A>G	16.37:g.56906659A>G		112	0		98	3	NM_001126108	0	0	1	1	0	A8MSJ2|C9JNN9	Silent	SNP	ENST00000563236.1	37	CCDS58464.1																																																																																			.		0.562	SLC12A3-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000432337.1		
PMFBP1	83449	broad.mit.edu	37	16	72158703	72158703	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr16:72158703G>A	ENST00000537792.1	-	1	49	c.50C>T	c.(49-51)gCc>gTc	p.A17V	PMFBP1_ENST00000537465.1_Missense_Mutation_p.A856V|PMFBP1_ENST00000355636.6_Missense_Mutation_p.A706V|PMFBP1_ENST00000237353.10_Missense_Mutation_p.A851V			Q8TBY8	PMFBP_HUMAN	polyamine modulated factor 1 binding protein 1	856						cytoplasm (GO:0005737)				NS(1)|breast(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(25)|ovary(2)|skin(3)|urinary_tract(1)	45		Ovarian(137;0.179)				TTTTAAGGCGGCCATCTCCTC	0.572											OREG0023927	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A851V													.	PMFBP1-92	0			c.C2552T						.						161.0	147.0	152.0					16																	72158703		2198	4300	6498	SO:0001583	missense	83449	exon17			AAGGCGGCCATCT	AF239683	CCDS32483.1	16q23.1	2008-08-04			ENSG00000118557	ENSG00000118557			17728	protein-coding gene	gene with protein product						11468771	Standard	NM_031293		Approved		uc002fcd.3	Q8TBY8	OTTHUMG00000167827	ENST00000537792.1:c.50C>T	16.37:g.72158703G>A	ENSP00000443366:p.Ala17Val	240	1	1135	221	4	NM_031293	0	0	0	0	0	B3KVI9|H7BY07|Q8NA09|Q9BY16|Q9H0H4	Missense_Mutation	SNP	ENST00000537792.1	37		.	.	.	.	.	.	.	.	.	.	G	7.010	0.556590	0.13436	.	.	ENSG00000118557	ENST00000537792;ENST00000537465;ENST00000237353;ENST00000355636	T;T;T;T	0.50277	0.75;2.6;2.59;2.59	5.09	0.423	0.16463	.	1.675920	0.03139	N	0.166374	T	0.37128	0.0992	L	0.34521	1.04	0.09310	N	1	B;B;B	0.32829	0.386;0.253;0.386	B;B;B	0.31337	0.124;0.128;0.124	T	0.23868	-1.0176	10	0.28530	T	0.3	3.1154	8.0291	0.30454	0.0:0.1483:0.3945:0.4571	.	856;851;856	Q8TBY8;Q8TBY8-2;G3V1Q7	PMFBP_HUMAN;.;.	V	17;856;851;706	ENSP00000443366:A17V;ENSP00000443817:A856V;ENSP00000237353:A851V;ENSP00000347854:A706V	ENSP00000237353:A851V	A	-	2	0	PMFBP1	70716204	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	0.551000	0.23361	0.257000	0.21650	0.655000	0.94253	GCC	.		0.572	PMFBP1-011	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000396523.1	NM_031293	
TVP23C	201158	ucsc.edu	37	17	15457087	15457087	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr17:15457087C>T	ENST00000225576.3	-	3	247	c.152G>A	c.(151-153)tGt>tAt	p.C51Y	TVP23C_ENST00000519970.1_Intron|TVP23C_ENST00000518321.1_Missense_Mutation_p.C51Y|TVP23C_ENST00000428082.2_Missense_Mutation_p.C51Y|TVP23C_ENST00000438826.3_Missense_Mutation_p.C51Y|TVP23C_ENST00000584811.1_5'UTR|TVP23C-CDRT4_ENST00000522212.2_Missense_Mutation_p.C51Y	NM_145301.2	NP_660344.2	Q96ET8	TV23C_HUMAN	trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)	51						integral component of membrane (GO:0016021)											ACAGAGAAGACAGACGATGAT	0.373																																					p.C51Y													.	.	0			c.G152A						.						274.0	265.0	268.0					17																	15457087		2203	4300	6503	SO:0001583	missense	201158	exon3			AGAAGACAGACGA	BC011952	CCDS11170.1, CCDS45617.1	17p12	2012-11-29	2012-11-29	2012-11-29	ENSG00000175106	ENSG00000175106			30453	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B2"""	FAM18B2			Standard	NM_001135036		Approved	MGC8763	uc002goq.2	Q96ET8	OTTHUMG00000171461	ENST00000225576.3:c.152G>A	17.37:g.15457087C>T	ENSP00000225576:p.Cys51Tyr	623	94		530	91	NM_145301	0	0	4	41	37	Q3LIC7	Missense_Mutation	SNP	ENST00000225576.3	37	CCDS11170.1	.	.	.	.	.	.	.	.	.	.	.	2.368	-0.344949	0.05208	.	.	ENSG00000259024;ENSG00000175106;ENSG00000175106;ENSG00000175106	ENST00000522212;ENST00000225576;ENST00000428082;ENST00000438826	T;T;T;T	0.25749	1.78;1.78;1.78;1.78	4.47	4.47	0.54385	.	0.000000	0.85682	N	0.000000	T	0.02571	0.0078	N	0.00004	-3.335	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.0;0.0;0.002	T	0.38457	-0.9660	10	0.02654	T	1	-3.8701	9.492	0.38965	0.0:0.0877:0.0:0.9123	.	51;51;51	Q96ET8-2;Q96ET8-3;Q96ET8	.;.;F18B2_HUMAN	Y	51	ENSP00000429865:C51Y;ENSP00000225576:C51Y;ENSP00000406387:C51Y;ENSP00000413355:C51Y	ENSP00000225576:C51Y	C	-	2	0	RP11-726O12.1;FAM18B2	15397812	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	6.178000	0.71968	0.670000	0.31165	-0.442000	0.05670	TGT	.		0.373	TVP23C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000130705.2	NM_145301	
GPRC5C	55890	broad.mit.edu	37	17	72428210	72428210	+	Silent	SNP	C	C	G	rs138824950		TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr17:72428210C>G	ENST00000481232.1	+	1	544	c.33C>G	c.(31-33)ccC>ccG	p.P11P	GPRC5C_ENST00000342648.5_Intron|GPRC5C_ENST00000392627.1_Silent_p.P11P|GPRC5C_ENST00000392629.2_5'Flank			Q9NQ84	GPC5C_HUMAN	G protein-coupled receptor, class C, group 5, member C	0					G-protein coupled receptor signaling pathway (GO:0007186)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|receptor complex (GO:0043235)|vesicle (GO:0031982)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|large_intestine(3)|lung(9)|ovary(2)|pancreas(1)|prostate(1)	17						AGCAACAACCCACACGCCGGC	0.687																																					p.P11P													.	GPRC5C-525	0			c.C33G						.						42.0	41.0	41.0					17																	72428210		2201	4299	6500	SO:0001819	synonymous_variant	55890	exon1			ACAACCCACACGC	AF207989	CCDS11699.1, CCDS42378.1	17q25	2014-01-30	2014-01-30		ENSG00000170412	ENSG00000170412		"""GPCR / Class C : Orphans"""	13309	protein-coding gene	gene with protein product		605949	"""G protein-coupled receptor, family C, group 5, member C"""			10945465	Standard	NM_022036		Approved	RAIG-3	uc002jkr.3	Q9NQ84	OTTHUMG00000067613	ENST00000481232.1:c.33C>G	17.37:g.72428210C>G		36	0		34	3	NM_022036	0	0	32	49	17	B5BUN4|Q2NL85|Q9NZG5	Silent	SNP	ENST00000481232.1	37																																																																																				C|1.000;T|0.000		0.687	GPRC5C-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000145095.2		
WDR45B	56270	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	80579499	80579499	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr17:80579499T>C	ENST00000392325.4	-	6	798	c.604A>G	c.(604-606)Act>Gct	p.T202A	WDR45B_ENST00000571835.1_5'UTR	NM_019613.3	NP_062559.2	Q5MNZ6	WIPI3_HUMAN	WD repeat domain 45B	202																	TCGGATGCAGTTGCAATTCTT	0.542																																					p.T202A		.											.	.	0			c.A604G						.						127.0	97.0	107.0					17																	80579499		2203	4300	6503	SO:0001583	missense	56270	exon6			ATGCAGTTGCAAT	AF091083	CCDS11815.2	17q25.3	2013-01-11	2013-01-11	2013-01-11	ENSG00000141580	ENSG00000141580		"""WD repeat domain containing"""	25072	protein-coding gene	gene with protein product		609226	"""WDR45-like"""	WDR45L		12477932	Standard	NM_019613		Approved	WIPI3	uc002kfq.3	Q5MNZ6	OTTHUMG00000150146	ENST00000392325.4:c.604A>G	17.37:g.80579499T>C	ENSP00000376139:p.Thr202Ala	103	0		81	11	NM_019613	0	0	47	68	21	O95328|Q2MCP6|Q6IBN2	Missense_Mutation	SNP	ENST00000392325.4	37	CCDS11815.2	.	.	.	.	.	.	.	.	.	.	T	18.41	3.618375	0.66787	.	.	ENSG00000141580	ENST00000392325;ENST00000539012	T	0.57907	0.37	4.82	4.82	0.62117	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.81327	0.4799	H	0.96777	3.88	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87771	0.2605	10	0.72032	D	0.01	-25.7216	14.6708	0.68942	0.0:0.0:0.0:1.0	.	202	Q5MNZ6	WIPI3_HUMAN	A	202;174	ENSP00000376139:T202A	ENSP00000376139:T202A	T	-	1	0	WDR45L	78172788	1.000000	0.71417	0.910000	0.35882	0.534000	0.34807	7.503000	0.81632	1.935000	0.56089	0.460000	0.39030	ACT	.		0.542	WDR45B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316536.1	NM_019613	
TRAPPC5	126003	broad.mit.edu	37	19	7747477	7747477	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr19:7747477G>A	ENST00000317378.5	+	2	525	c.338G>A	c.(337-339)cGc>cAc	p.R113H	CTD-3214H19.16_ENST00000597959.1_3'UTR|TRAPPC5_ENST00000596148.1_Missense_Mutation_p.R113H|TRAPPC5_ENST00000426877.2_Missense_Mutation_p.R113H|TRAPPC5_ENST00000595985.1_Missense_Mutation_p.R46H	NM_174894.2	NP_777554.1	Q8IUR0	TPPC5_HUMAN	trafficking protein particle complex 5	113					vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|TRAPP complex (GO:0030008)		p.R113L(1)		NS(1)|lung(2)	3						GATGACGCGCGCACCTTCTAC	0.627																																					p.R113H													.	TRAPPC5-68	1	Substitution - Missense(1)	lung(1)	c.G338A						.						36.0	39.0	38.0					19																	7747477		2189	4280	6469	SO:0001583	missense	126003	exon2			ACGCGCGCACCTT	BC042161	CCDS42490.1	19p13.3	2011-10-10				ENSG00000181029		"""Trafficking protein particle complex"""	23067	protein-coding gene	gene with protein product							Standard	NM_001042462		Approved	MGC52424, TRS31	uc002mhj.2	Q8IUR0		ENST00000317378.5:c.338G>A	19.37:g.7747477G>A	ENSP00000316990:p.Arg113His	43	0		48	3	NM_001042461	0	0	228	228	0	A8K7I6	Missense_Mutation	SNP	ENST00000317378.5	37	CCDS42490.1	.	.	.	.	.	.	.	.	.	.	G	15.31	2.795911	0.50208	.	.	ENSG00000181029	ENST00000317378;ENST00000426877	T;T	0.43294	0.95;0.95	4.1	2.97	0.34412	NO signalling/Golgi transport  ligand-binding domain (1);	0.265289	0.28077	U	0.016682	T	0.28400	0.0702	L	0.41027	1.25	0.39601	D	0.969734	B	0.17038	0.02	B	0.12156	0.007	T	0.25293	-1.0136	10	0.48119	T	0.1	-0.0594	3.7045	0.08395	0.3578:0.0:0.6422:0.0	.	113	Q8IUR0	TPPC5_HUMAN	H	113	ENSP00000316990:R113H;ENSP00000399025:R113H	ENSP00000316990:R113H	R	+	2	0	TRAPPC5	7653477	1.000000	0.71417	0.997000	0.53966	0.628000	0.37860	4.743000	0.62110	1.846000	0.53633	0.485000	0.47835	CGC	.		0.627	TRAPPC5-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461252.1	XM_058961	
GRIN2D	2906	hgsc.bcm.edu	37	19	48945880	48945880	+	Silent	SNP	T	T	C	rs62130268	byFrequency	TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr19:48945880T>C	ENST00000263269.3	+	13	2785	c.2697T>C	c.(2695-2697)gcT>gcC	p.A899A		NM_000836.2	NP_000827.2	O15399	NMDE4_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2D	899					adult locomotory behavior (GO:0008344)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|regulation of sensory perception of pain (GO:0051930)|signal transduction (GO:0007165)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)			autonomic_ganglia(1)|breast(6)|endometrium(2)|large_intestine(9)|lung(12)|ovary(5)|pancreas(1)|prostate(1)	37		all_epithelial(76;1.11e-06)|all_lung(116;5.79e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		all cancers(93;0.00014)|OV - Ovarian serous cystadenocarcinoma(262;0.000233)|Epithelial(262;0.0112)|GBM - Glioblastoma multiforme(486;0.0161)	Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GCTGCAGCGCTGAGGCCGCCC	0.781													c|||	3742	0.747204	0.6188	0.8545	5008	,	,		4716	0.6548		0.8887	False		,,,				2504	0.7945				p.A899A		.											.	GRIN2D-156	0			c.T2697C						.			1689,437		638,413,12	1.0	1.0	1.0		2697	-3.3	1.0	19	dbSNP_129	1	3712,202		1757,198,2	no	coding-synonymous	GRIN2D	NM_000836.2		2395,611,14	CC,CT,TT		5.161,20.555,10.5795		899/1337	48945880	5401,639	1063	1957	3020	SO:0001819	synonymous_variant	2906	exon13			CAGCGCTGAGGCC	U77783	CCDS12719.1	19q13.33	2012-08-29			ENSG00000105464	ENSG00000105464		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4588	protein-coding gene	gene with protein product	"""N-methyl-d-aspartate receptor subunit 2D"""	602717		NMDAR2D		9480759, 9418891	Standard	NM_000836		Approved	GluN2D, EB11, NR2D	uc002pjc.4	O15399		ENST00000263269.3:c.2697T>C	19.37:g.48945880T>C		3	1		5	5	NM_000836	0	0	1	1	0		Silent	SNP	ENST00000263269.3	37	CCDS12719.1																																																																																			T|0.245;C|0.755		0.781	GRIN2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466121.1		
NTN5	126147	hgsc.bcm.edu	37	19	49174237	49174237	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr19:49174237C>G	ENST00000270235.4	-	2	102	c.7G>C	c.(7-9)Gtg>Ctg	p.V3L	SEC1P_ENST00000430145.2_RNA	NM_145807.1	NP_665806.1	Q8WTR8	NET5_HUMAN	netrin 5	3						extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|pancreas(1)|prostate(1)	10						GCAAAGGTCACGGGCATGGTC	0.657																																					p.V3L		.											.	NTN5-136	0			c.G7C						.						9.0	10.0	10.0					19																	49174237		2132	4184	6316	SO:0001583	missense	126147	exon2			AGGTCACGGGCAT		CCDS33068.1	19q13.33	2013-03-01			ENSG00000142233	ENSG00000142233		"""Netrins"""	25208	protein-coding gene	gene with protein product	"""Netrin-5"""					12477932	Standard	NM_145807		Approved		uc002pkb.3	Q8WTR8		ENST00000270235.4:c.7G>C	19.37:g.49174237C>G	ENSP00000270235:p.Val3Leu	31	0		22	2	NM_145807	0	0	1	1	0	Q8N4X9|Q8WU63	Missense_Mutation	SNP	ENST00000270235.4	37	CCDS33068.1	.	.	.	.	.	.	.	.	.	.	C	12.25	1.880307	0.33162	.	.	ENSG00000142233	ENST00000270235	T	0.27720	1.65	4.72	-1.6	0.08426	.	0.468333	0.21670	N	0.070883	T	0.15478	0.0373	L	0.41236	1.265	0.09310	N	1	B;P	0.37370	0.005;0.592	B;B	0.32677	0.008;0.15	T	0.09997	-1.0649	10	0.31617	T	0.26	.	2.2736	0.04096	0.3973:0.3507:0.1501:0.1019	.	3;3	Q8WTR8-2;Q8WTR8	.;NET5_HUMAN	L	3	ENSP00000270235:V3L	ENSP00000270235:V3L	V	-	1	0	NTN5	53866049	0.000000	0.05858	0.001000	0.08648	0.662000	0.39071	-0.664000	0.05292	0.091000	0.17302	0.455000	0.32223	GTG	.		0.657	NTN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466176.1	NM_145807	
KLK3	354	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	51359636	51359636	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr19:51359636G>T	ENST00000326003.2	+	2	228	c.187G>T	c.(187-189)Gct>Tct	p.A63S	KLK3_ENST00000595952.1_Missense_Mutation_p.A63S|KLK3_ENST00000593997.1_Missense_Mutation_p.A63S|KLK3_ENST00000360617.3_Missense_Mutation_p.A63S|KLK3_ENST00000597483.1_Missense_Mutation_p.A63S	NM_001030047.1|NM_001030048.1|NM_001648.2	NP_001025218.1|NP_001025219.1|NP_001639.1	P07288	KLK3_HUMAN	kallikrein-related peptidase 3	63	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cellular protein metabolic process (GO:0044267)|negative regulation of angiogenesis (GO:0016525)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(1)|cervix(2)|kidney(2)|large_intestine(1)|lung(10)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00763)|GBM - Glioblastoma multiforme(134;0.0144)		GGTCCTCACAGCTGCCCACTG	0.617																																					p.A63S	Colon(185;1767 2023 13025 30120 37630)	.											.	KLK3-228	0			c.G187T						.						76.0	77.0	77.0					19																	51359636		2203	4300	6503	SO:0001583	missense	354	exon2			CTCACAGCTGCCC	X14810	CCDS12807.1, CCDS33083.1, CCDS46155.1	19q13.41	2012-10-02	2006-10-27			ENSG00000142515		"""Kallikreins"""	6364	protein-coding gene	gene with protein product		176820	"""kallikrein 3, (prostate specific antigen)"""	APS		2456523, 2436946, 16800724, 16800723	Standard	NM_001648		Approved	PSA	uc021uyi.1	P07288		ENST00000326003.2:c.187G>T	19.37:g.51359636G>T	ENSP00000314151:p.Ala63Ser	172	0		144	42	NM_001030050	0	0	1	1	0	C9JXH3|G3V0H4|G3XAE3|Q15096|Q16272|Q86TG8|Q8IXI4	Missense_Mutation	SNP	ENST00000326003.2	37	CCDS12807.1	.	.	.	.	.	.	.	.	.	.	G	13.59	2.281163	0.40394	.	.	ENSG00000142515	ENST00000326003;ENST00000422986;ENST00000360617;ENST00000435152;ENST00000326052	D;D;D	0.95272	-3.66;-3.66;-3.66	2.91	1.81	0.25067	.	0.000000	0.32041	N	0.006661	D	0.96231	0.8771	M	0.77486	2.375	0.27490	N	0.952326	D;D;D;D	0.89917	0.998;0.987;0.999;1.0	D;D;D;D	0.91635	0.951;0.923;0.976;0.999	D	0.90785	0.4682	10	0.87932	D	0	.	8.8252	0.35050	0.0:0.0:0.7734:0.2266	.	63;63;63;63	Q8NCW4;G3XAE3;G3V0H4;C9JXH3	.;.;.;.	S	63	ENSP00000314151:A63S;ENSP00000393628:A63S;ENSP00000353829:A63S	ENSP00000314151:A63S	A	+	1	0	KLK3	56051448	0.999000	0.42202	0.987000	0.45799	0.256000	0.26092	6.780000	0.75063	0.516000	0.28340	0.436000	0.28706	GCT	.		0.617	KLK3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464067.1	NM_145864	
PNPT1	87178	broad.mit.edu	37	2	55900121	55900121	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr2:55900121C>T	ENST00000447944.2	-	9	859	c.773G>A	c.(772-774)gGc>gAc	p.G258D		NM_033109.3	NP_149100.2	Q8TCS8	PNPT1_HUMAN	polyribonucleotide nucleotidyltransferase 1	258					cellular response to interferon-beta (GO:0035458)|cellular response to oxidative stress (GO:0034599)|mitochondrial mRNA catabolic process (GO:0000958)|mitochondrial mRNA polyadenylation (GO:0097222)|mitochondrial RNA 3'-end processing (GO:0000965)|mitochondrial RNA 5'-end processing (GO:0000964)|mitochondrial RNA catabolic process (GO:0000957)|mitochondrion morphogenesis (GO:0070584)|mitotic cell cycle arrest (GO:0071850)|mRNA catabolic process (GO:0006402)|negative regulation of growth (GO:0045926)|nuclear polyadenylation-dependent mRNA catabolic process (GO:0071042)|positive regulation of miRNA catabolic process (GO:2000627)|positive regulation of mitochondrial RNA catabolic process (GO:0000962)|positive regulation of mRNA catabolic process (GO:0061014)|protein homooligomerization (GO:0051260)|protein homotrimerization (GO:0070207)|regulation of cellular respiration (GO:0043457)|regulation of cellular senescence (GO:2000772)|RNA catabolic process (GO:0006401)|RNA import into mitochondrion (GO:0035927)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|RNA polyadenylation (GO:0043631)|rRNA import into mitochondrion (GO:0035928)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrial degradosome (GO:0045025)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)	3'-5'-exoribonuclease activity (GO:0000175)|miRNA binding (GO:0035198)|poly(A) RNA binding (GO:0044822)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|polyribonucleotide nucleotidyltransferase activity (GO:0004654)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(9)|skin(2)|urinary_tract(1)	27			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			CTGCTGAATGCCCTGAATTAT	0.393																																					p.G258D													.	PNPT1-90	0			c.G773A						.						141.0	146.0	145.0					2																	55900121		2203	4300	6503	SO:0001583	missense	87178	exon9			TGAATGCCCTGAA	BC053660	CCDS1856.1	2p15	2013-01-08			ENSG00000138035	ENSG00000138035			23166	protein-coding gene	gene with protein product	"""polynucleotide phosphorylase"", ""3'-5' RNA exonuclease"""	610316	"""deafness, autosomal recessive 70"""	DFNB70		12419256	Standard	NM_033109		Approved	PNPase, OLD35, old-35	uc002rzf.3	Q8TCS8	OTTHUMG00000129335	ENST00000447944.2:c.773G>A	2.37:g.55900121C>T	ENSP00000400646:p.Gly258Asp	274	0		268	4	NM_033109	0	0	22	22	0	Q53SU0|Q68CN1|Q7Z7D1|Q8IWX1|Q96T05|Q9BRU3|Q9BVX0	Missense_Mutation	SNP	ENST00000447944.2	37	CCDS1856.1	.	.	.	.	.	.	.	.	.	.	C	14.09	2.432574	0.43224	.	.	ENSG00000138035	ENST00000447944	T	0.42131	0.98	5.67	5.67	0.87782	Exoribonuclease, phosphorolytic domain 2 (1);	0.118776	0.56097	D	0.000023	T	0.28300	0.0699	N	0.08118	0	0.58432	D	0.999993	B	0.19935	0.04	B	0.26094	0.066	T	0.07385	-1.0775	10	0.35671	T	0.21	-2.1503	17.0606	0.86547	0.0:0.8734:0.1266:0.0	.	258	Q8TCS8	PNPT1_HUMAN	D	258	ENSP00000400646:G258D	ENSP00000386075:G258D	G	-	2	0	PNPT1	55753625	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.827000	0.62723	2.828000	0.97474	0.655000	0.94253	GGC	.		0.393	PNPT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251481.2	NM_033109	
ANKRD23	200539	hgsc.bcm.edu;broad.mit.edu	37	2	97505559	97505559	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr2:97505559C>T	ENST00000318357.4	-	8	768	c.727G>A	c.(727-729)Ggg>Agg	p.G243R	ANKRD23_ENST00000476975.1_Intron|ANKRD23_ENST00000418232.1_Missense_Mutation_p.G243R|ANKRD23_ENST00000331001.2_Missense_Mutation_p.G201R	NM_144994.7	NP_659431.5	Q86SG2	ANR23_HUMAN	ankyrin repeat domain 23	243					fatty acid metabolic process (GO:0006631)|response to mechanical stimulus (GO:0009612)	I band (GO:0031674)|intercalated disc (GO:0014704)|nucleus (GO:0005634)	titin binding (GO:0031432)			endometrium(2)|kidney(1)|lung(4)|ovary(1)|prostate(1)	9						GCCGTGTCCCCTTCCTGCTGA	0.647																																					p.G243R		.											.	ANKRD23-91	0			c.G727A						.						29.0	26.0	27.0					2																	97505559		2203	4300	6503	SO:0001583	missense	200539	exon8			TGTCCCCTTCCTG		CCDS2027.1	2q11.2	2013-01-10			ENSG00000163126	ENSG00000163126		"""Ankyrin repeat domain containing"""	24470	protein-coding gene	gene with protein product	"""diabetes related ankyrin repeat protein"""	610736				12456686	Standard	NM_144994		Approved	DARP, FLJ32449, MARP3	uc002sxa.3	Q86SG2	OTTHUMG00000130534	ENST00000318357.4:c.727G>A	2.37:g.97505559C>T	ENSP00000321679:p.Gly243Arg	40	0		37	7	NM_144994	0	0	0	0	0	Q711K7|Q8NAJ7	Missense_Mutation	SNP	ENST00000318357.4	37	CCDS2027.1	.	.	.	.	.	.	.	.	.	.	C	28.9	4.964298	0.92791	.	.	ENSG00000163126	ENST00000318357;ENST00000418232;ENST00000331001	T;T;T	0.65732	-0.17;-0.17;-0.17	5.05	5.05	0.67936	Ankyrin repeat-containing domain (4);	0.000000	0.40064	N	0.001191	T	0.80924	0.4717	M	0.86953	2.85	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.83639	0.0149	10	0.66056	D	0.02	-30.8309	13.7706	0.63021	0.0:1.0:0.0:0.0	.	201;243	Q86SG2-2;Q86SG2	.;ANR23_HUMAN	R	243;243;201	ENSP00000321679:G243R;ENSP00000398987:G243R;ENSP00000333108:G201R	ENSP00000321679:G243R	G	-	1	0	ANKRD23	96869286	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.780000	0.68956	2.623000	0.88846	0.650000	0.86243	GGG	.		0.647	ANKRD23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252956.1	NM_144994	
RGPD8	727851	broad.mit.edu	37	2	113127775	113127775	+	Missense_Mutation	SNP	G	G	C	rs370761877		TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr2:113127775G>C	ENST00000302558.3	-	23	5469	c.5278C>G	c.(5278-5280)Cct>Gct	p.P1760A	RGPD8_ENST00000409750.1_Missense_Mutation_p.P1620A	NM_001164463.1	NP_001157935.1	O14715	RGPD8_HUMAN	RANBP2-like and GRIP domain containing 8	1760				P -> A (in Ref. 3; CAI56757). {ECO:0000305}.	protein targeting to Golgi (GO:0000042)	nuclear pore (GO:0005643)	Ran GTPase binding (GO:0008536)	p.P1760A(12)		endometrium(4)|kidney(1)|lung(1)|prostate(3)|urinary_tract(1)	10						GAACGGGAAGGATTTTCTTCC	0.308																																					p.P1760A													.	.	12	Substitution - Missense(12)	prostate(6)|urinary_tract(2)|endometrium(2)|kidney(2)	c.C5278G						.						235.0	168.0	189.0					2																	113127775		686	1558	2244	SO:0001583	missense	727851	exon23			GGGAAGGATTTTC	AF012086	CCDS46394.1	2q13	2013-01-10	2005-12-20	2005-12-20	ENSG00000169629	ENSG00000169629		"""Tetratricopeptide (TTC) repeat domain containing"""	9849	protein-coding gene	gene with protein product		602752	"""RAN binding protein 2-like 1"""	RANBP2L1		9480752	Standard	NM_001164463		Approved	RanBP2alpha	uc002ths.2	O14715	OTTHUMG00000153289	ENST00000302558.3:c.5278C>G	2.37:g.113127775G>C	ENSP00000306637:p.Pro1760Ala	125	0		133	3	NM_001164463	0	0	3	29	26	Q5CZA8	Missense_Mutation	SNP	ENST00000302558.3	37	CCDS46394.1	.	.	.	.	.	.	.	.	.	.	g	0.008	-1.892319	0.00522	.	.	ENSG00000169629	ENST00000302558;ENST00000409750	T;T	0.36520	1.25;1.25	0.719	0.719	0.18208	.	.	.	.	.	T	0.11239	0.0274	N	0.02011	-0.69	0.58432	D	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.18650	-1.0330	9	0.10902	T	0.67	-6.3628	6.3935	0.21599	0.0:0.6881:0.3119:0.0	.	1760	O14715	RGPD8_HUMAN	A	1760;1620	ENSP00000306637:P1760A;ENSP00000386511:P1620A	ENSP00000306637:P1760A	P	-	1	0	RGPD8	112844246	0.746000	0.28272	0.842000	0.33263	0.015000	0.08874	0.243000	0.18106	-0.105000	0.12132	-1.123000	0.02005	CCT	C|1.000;|0.000		0.308	RGPD8-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375951.1	XM_001722279	
MBD5	55777	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	149226038	149226038	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr2:149226038A>G	ENST00000407073.1	+	9	1523	c.526A>G	c.(526-528)Aat>Gat	p.N176D	MBD5_ENST00000404807.1_Missense_Mutation_p.N176D	NM_018328.4	NP_060798.2	Q9P267	MBD5_HUMAN	methyl-CpG binding domain protein 5	176					glucose homeostasis (GO:0042593)|nervous system development (GO:0007399)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|regulation of multicellular organism growth (GO:0040014)|single-organism behavior (GO:0044708)	chromocenter (GO:0010369)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(16)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	62				BRCA - Breast invasive adenocarcinoma(221;0.0569)		TGGATCATCAAATGCCATGGG	0.423																																					p.N176D		.											.	MBD5-95	0			c.A526G						.						77.0	73.0	74.0					2																	149226038		2203	4300	6503	SO:0001583	missense	55777	exon9			TCATCAAATGCCA	AB040894	CCDS33302.1	2q23.2	2009-04-17			ENSG00000204406	ENSG00000204406			20444	protein-coding gene	gene with protein product		611472				12529184	Standard	NM_018328		Approved	FLJ11113, KIAA1461	uc002twm.4	Q9P267	OTTHUMG00000150440	ENST00000407073.1:c.526A>G	2.37:g.149226038A>G	ENSP00000386049:p.Asn176Asp	94	0		99	24	NM_018328	0	0	1	2	1	A5HMQ4|A7E2B1|Q53SR1|Q9NUV6	Missense_Mutation	SNP	ENST00000407073.1	37	CCDS33302.1	.	.	.	.	.	.	.	.	.	.	A	16.82	3.227484	0.58668	.	.	ENSG00000204406	ENST00000407073;ENST00000404807	T;T	0.45668	0.89;0.89	5.16	5.16	0.70880	.	0.088275	0.49305	D	0.000155	T	0.30070	0.0753	N	0.08118	0	0.33054	D	0.533103	D	0.56968	0.978	P	0.47528	0.549	T	0.43015	-0.9417	10	0.40728	T	0.16	-3.4654	13.8586	0.63545	1.0:0.0:0.0:0.0	.	176	Q9P267	MBD5_HUMAN	D	176	ENSP00000386049:N176D;ENSP00000384672:N176D	ENSP00000384672:N176D	N	+	1	0	MBD5	148942508	1.000000	0.71417	0.909000	0.35828	0.972000	0.66771	4.483000	0.60264	2.079000	0.62486	0.482000	0.46254	AAT	.		0.423	MBD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318111.2		
CYTIP	9595	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	158287080	158287080	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr2:158287080T>C	ENST00000264192.3	-	5	588	c.467A>G	c.(466-468)aAc>aGc	p.N156S	CYTIP_ENST00000497432.1_5'Flank|CYTIP_ENST00000540637.1_Missense_Mutation_p.N50S	NM_004288.4	NP_004279.3	O60759	CYTIP_HUMAN	cytohesin 1 interacting protein	156	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				regulation of cell adhesion (GO:0030155)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|endosome (GO:0005768)|nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	15						CGTTAGCAGGTTTCCGGACGA	0.428																																					p.N156S		.											.	CYTIP-93	0			c.A467G						.						173.0	152.0	159.0					2																	158287080		2203	4300	6503	SO:0001583	missense	9595	exon5			AGCAGGTTTCCGG	L06633	CCDS2204.1	2q11.2	2011-09-08	2008-08-14	2008-08-19	ENSG00000115165	ENSG00000115165			9506	protein-coding gene	gene with protein product	"""cytohesin binding protein HE"", ""cytohesin binder and regulator"""	604448	"""pleckstrin homology, Sec7 and coiled-coil domains, binding protein"""	PSCDBP		18926288, 10343115, 11867758, 20530790, 21562043	Standard	NM_004288		Approved	B3-1, HE, CYBR, CASP, CYTHIP	uc002tzj.1	O60759	OTTHUMG00000154551	ENST00000264192.3:c.467A>G	2.37:g.158287080T>C	ENSP00000264192:p.Asn156Ser	78	0		87	17	NM_004288	0	0	0	0	0	B4DWH9|Q15630|Q8NE32	Missense_Mutation	SNP	ENST00000264192.3	37	CCDS2204.1	.	.	.	.	.	.	.	.	.	.	T	17.59	3.427467	0.62733	.	.	ENSG00000115165	ENST00000264192;ENST00000540637;ENST00000418920	T;T;T	0.24908	1.83;1.83;1.83	5.87	4.71	0.59529	PDZ/DHR/GLGF (4);	0.040138	0.85682	N	0.000000	T	0.34366	0.0895	N	0.26162	0.8	0.40568	D	0.981273	D	0.61080	0.989	D	0.77557	0.99	T	0.15838	-1.0423	10	0.59425	D	0.04	-24.1417	8.8383	0.35126	0.0:0.0847:0.0:0.9153	.	156	O60759	CYTIP_HUMAN	S	156;50;50	ENSP00000264192:N156S;ENSP00000440801:N50S;ENSP00000394308:N50S	ENSP00000264192:N156S	N	-	2	0	CYTIP	157995326	1.000000	0.71417	0.994000	0.49952	0.973000	0.67179	2.314000	0.43743	1.149000	0.42402	0.533000	0.62120	AAC	.		0.428	CYTIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254926.1	NM_004288	
SCN1A	6323	broad.mit.edu	37	2	166866330	166866330	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr2:166866330C>T	ENST00000303395.4	-	20	3900	c.3901G>A	c.(3901-3903)Gca>Aca	p.A1301T	AC010127.3_ENST00000595647.1_RNA|SCN1A_ENST00000375405.3_Missense_Mutation_p.A1290T|AC010127.3_ENST00000597623.1_RNA|SCN1A_ENST00000409050.1_Missense_Mutation_p.A1273T|SCN1A_ENST00000423058.2_Missense_Mutation_p.A1301T			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	1301					adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)			NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	AAGGCATTTGCTGTTAAACTG	0.368																																					p.A1301T													.	SCN1A-147	0			c.G3901A						.						86.0	85.0	85.0					2																	166866330		2203	4300	6503	SO:0001583	missense	6323	exon20			CATTTGCTGTTAA	AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.3901G>A	2.37:g.166866330C>T	ENSP00000303540:p.Ala1301Thr	105	0		109	4	NM_001165963	0	0	0	0	0	E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Missense_Mutation	SNP	ENST00000303395.4	37	CCDS54413.1	.	.	.	.	.	.	.	.	.	.	C	34	5.315144	0.95655	.	.	ENSG00000144285	ENST00000423058;ENST00000303395;ENST00000375405;ENST00000409050	D;D;D;D	0.98550	-4.99;-4.99;-4.99;-4.99	5.46	5.46	0.80206	Ion transport (1);	0.092549	0.47093	D	0.000250	D	0.99137	0.9702	M	0.88570	2.965	0.80722	D	1	D;D;D	0.89917	0.985;1.0;1.0	P;D;D	0.91635	0.801;0.999;0.998	D	0.99609	1.0980	10	0.87932	D	0	.	19.3188	0.94229	0.0:1.0:0.0:0.0	.	1290;1273;1301	P35498-2;E9PG49;P35498	.;.;SCN1A_HUMAN	T	1301;1301;1290;1273	ENSP00000407030:A1301T;ENSP00000303540:A1301T;ENSP00000364554:A1290T;ENSP00000386312:A1273T	ENSP00000303540:A1301T	A	-	1	0	SCN1A	166574576	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.621000	0.83083	2.569000	0.86673	0.650000	0.86243	GCA	.		0.368	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102661.1	NM_006920	
JAG1	182	hgsc.bcm.edu	37	20	10621489	10621489	+	Silent	SNP	C	C	A	rs202075581	byFrequency	TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr20:10621489C>A	ENST00000254958.5	-	25	3656	c.3141G>T	c.(3139-3141)tcG>tcT	p.S1047S	JAG1_ENST00000423891.2_Silent_p.S888S	NM_000214.2	NP_000205.1	P78504	JAG1_HUMAN	jagged 1	1047					angiogenesis (GO:0001525)|aorta morphogenesis (GO:0035909)|auditory receptor cell differentiation (GO:0042491)|blood vessel remodeling (GO:0001974)|cardiac neural crest cell development involved in outflow tract morphogenesis (GO:0061309)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac septum morphogenesis (GO:0060411)|cell fate determination (GO:0001709)|ciliary body morphogenesis (GO:0061073)|distal tubule development (GO:0072017)|endocardial cushion cell development (GO:0061444)|endothelial cell differentiation (GO:0045446)|hemopoiesis (GO:0030097)|keratinocyte differentiation (GO:0030216)|loop of Henle development (GO:0072070)|morphogenesis of an epithelial sheet (GO:0002011)|myoblast differentiation (GO:0045445)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of stem cell differentiation (GO:2000737)|nervous system development (GO:0007399)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|positive regulation of myeloid cell differentiation (GO:0045639)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pulmonary artery morphogenesis (GO:0061156)|pulmonary valve morphogenesis (GO:0003184)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|response to muramyl dipeptide (GO:0032495)|T cell mediated immunity (GO:0002456)	apical part of cell (GO:0045177)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|growth factor activity (GO:0008083)|Notch binding (GO:0005112)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(14)|ovary(2)|pancreas(1)|urinary_tract(1)	44						CAGCAATCAGCGAGCTGTTTC	0.448									Alagille Syndrome																												p.S1047S		.											.	JAG1-1273	0			c.G3141T						.						113.0	100.0	104.0					20																	10621489		2203	4300	6503	SO:0001819	synonymous_variant	182	exon25	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	AATCAGCGAGCTG	U61276	CCDS13112.1	20p12.1-p11.23	2011-05-12	2010-06-24		ENSG00000101384	ENSG00000101384		"""CD molecules"""	6188	protein-coding gene	gene with protein product		601920	"""Alagille syndrome"""	AGS, JAGL1		7697721, 9207788	Standard	NM_000214		Approved	AHD, AWS, HJ1, CD339	uc002wnw.2	P78504	OTTHUMG00000031872	ENST00000254958.5:c.3141G>T	20.37:g.10621489C>A		101	0		74	5	NM_000214	0	1	16	17	0	A0AV43|B4DYR1|E9PCF9|O14902|O15122|Q15816	Silent	SNP	ENST00000254958.5	37	CCDS13112.1																																																																																			C|0.999;T|0.001		0.448	JAG1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_000214	
FRG1B	284802	broad.mit.edu	37	20	29628243	29628243	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr20:29628243T>C	ENST00000278882.3	+	6	625	c.245T>C	c.(244-246)tTg>tCg	p.L82S	FRG1B_ENST00000358464.4_Missense_Mutation_p.L82S|FRG1B_ENST00000439954.2_Missense_Mutation_p.L87S			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	82								p.L82S(2)		endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						ATGGCTTTGTTGGCCTCAAAT	0.363																																					.													.	FRG1B-22	2	Substitution - Missense(2)	urinary_tract(2)	.						.																																			SO:0001583	missense	284802	.			CTTTGTTGGCCTC			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.245T>C	20.37:g.29628243T>C	ENSP00000278882:p.Leu82Ser	194	1		169	4	.	0	0	62	62	0	C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	t	12.14	1.848999	0.32699	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.49139	0.79	2.08	2.08	0.27032	Actin cross-linking (1);	0.147685	0.45361	D	0.000380	T	0.38665	0.1049	.	.	.	0.46185	D	0.99891	B;B	0.27656	0.03;0.184	B;B	0.35813	0.11;0.211	T	0.24548	-1.0157	9	0.38643	T	0.18	.	8.0833	0.30758	0.0:0.0:0.0:1.0	.	87;82	F5H5R5;Q9BZ01	.;FRG1B_HUMAN	S	82;87;82	ENSP00000408863:L87S	ENSP00000278882:L82S	L	+	2	0	FRG1B	28241904	1.000000	0.71417	0.998000	0.56505	0.541000	0.35023	6.955000	0.76007	1.208000	0.43306	0.347000	0.21830	TTG	.		0.363	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
FRG1B	284802	broad.mit.edu	37	20	29628245	29628245	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr20:29628245G>A	ENST00000278882.3	+	6	627	c.247G>A	c.(247-249)Gcc>Acc	p.A83T	FRG1B_ENST00000358464.4_Missense_Mutation_p.A83T|FRG1B_ENST00000439954.2_Missense_Mutation_p.A88T			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	83								p.A83T(2)		endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						GGCTTTGTTGGCCTCAAATAG	0.353																																					.													.	FRG1B-22	2	Substitution - Missense(2)	urinary_tract(2)	.						.																																			SO:0001583	missense	284802	.			TTGTTGGCCTCAA			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.247G>A	20.37:g.29628245G>A	ENSP00000278882:p.Ala83Thr	191	1		170	4	.	0	0	55	55	0	C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	g	18.80	3.700173	0.68501	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.50277	0.75	2.08	2.08	0.27032	Actin cross-linking (1);	0.055129	0.64402	D	0.000001	T	0.40473	0.1118	.	.	.	0.51482	D	0.99992	B;P	0.40875	0.016;0.731	B;P	0.45558	0.085;0.485	T	0.12502	-1.0545	9	0.21540	T	0.41	.	10.2211	0.43198	0.0:0.0:1.0:0.0	.	88;83	F5H5R5;Q9BZ01	.;FRG1B_HUMAN	T	83;88;83	ENSP00000408863:A88T	ENSP00000278882:A83T	A	+	1	0	FRG1B	28241906	1.000000	0.71417	1.000000	0.80357	0.609000	0.37215	8.494000	0.90477	1.475000	0.48197	0.423000	0.28283	GCC	.		0.353	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
MAFB	9935	hgsc.bcm.edu	37	20	39316754	39316754	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr20:39316754A>G	ENST00000373313.2	-	1	1126	c.737T>C	c.(736-738)cTg>cCg	p.L246P	MAFB_ENST00000396967.1_Missense_Mutation_p.L246P	NM_005461.3	NP_005452.2	Q9Y5Q3	MAFB_HUMAN	v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog B	246	Basic motif. {ECO:0000255|PROSITE- ProRule:PRU00978}.|bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				brain segmentation (GO:0035284)|inner ear morphogenesis (GO:0042472)|negative regulation of erythrocyte differentiation (GO:0045647)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|respiratory gaseous exchange (GO:0007585)|rhombomere 5 development (GO:0021571)|rhombomere 6 development (GO:0021572)|segment specification (GO:0007379)|sensory organ development (GO:0007423)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			kidney(1)|large_intestine(1)	2		Myeloproliferative disorder(115;0.00878)				CCGGTTCTTCAGGGTCCGCCG	0.617			T	IGH@	MM																																p.L246P		.		Dom	yes		20	20q11.2-q13.1	9935	v-maf musculoaponeurotic fibrosarcoma oncogene homolog B (avian)		L	.	MAFB-846	0			c.T737C						.						26.0	26.0	26.0					20																	39316754		2203	4300	6503	SO:0001583	missense	9935	exon1			TTCTTCAGGGTCC	AF134157	CCDS13311.1	20q11.1-q13.1	2013-07-09	2013-07-09	2001-11-30	ENSG00000204103	ENSG00000204103			6408	protein-coding gene	gene with protein product		608968	"""Kreisler (mouse) maf-related leucine zipper homolog"""	KRML		10444328	Standard	NM_005461		Approved		uc002xji.3	Q9Y5Q3	OTTHUMG00000033052	ENST00000373313.2:c.737T>C	20.37:g.39316754A>G	ENSP00000362410:p.Leu246Pro	34	1		33	2	NM_005461	0	0	23	23	0	B3KNE1|Q9H1F1	Missense_Mutation	SNP	ENST00000373313.2	37	CCDS13311.1	.	.	.	.	.	.	.	.	.	.	A	18.48	3.632371	0.67015	.	.	ENSG00000204103	ENST00000373313;ENST00000396967	D;D	0.93953	-3.32;-3.32	4.49	4.49	0.54785	Basic-leucine zipper (bZIP) transcription factor (2);Maf transcription factor (1);Eukaryotic transcription factor, Skn-1-like, DNA-binding (1);	0.000000	0.64402	D	0.000004	D	0.97349	0.9133	M	0.93328	3.405	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98183	1.0458	10	0.66056	D	0.02	-16.2256	13.9843	0.64324	1.0:0.0:0.0:0.0	.	246	Q9Y5Q3	MAFB_HUMAN	P	246	ENSP00000362410:L246P;ENSP00000380167:L246P	ENSP00000362410:L246P	L	-	2	0	MAFB	38750168	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.139000	0.94554	1.908000	0.55244	0.374000	0.22700	CTG	.		0.617	MAFB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080375.2		
PI3	5266	broad.mit.edu	37	20	43804649	43804649	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr20:43804649G>T	ENST00000243924.3	+	2	274	c.227G>T	c.(226-228)tGc>tTc	p.C76F		NM_002638.3	NP_002629.1	P19957	ELAF_HUMAN	peptidase inhibitor 3, skin-derived	76	WAP. {ECO:0000255|PROSITE- ProRule:PRU00722}.				copulation (GO:0007620)|negative regulation of endopeptidase activity (GO:0010951)	extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			large_intestine(1)|lung(5)|skin(1)	7		Myeloproliferative disorder(115;0.0122)				CCTGGCTCCTGCCCCATTATC	0.498																																					p.C76F													.	PI3-514	0			c.G227T						.						131.0	113.0	119.0					20																	43804649		2203	4300	6503	SO:0001583	missense	5266	exon2			GCTCCTGCCCCAT	D13156	CCDS13344.1	20q13.12	2013-01-21	2008-10-03		ENSG00000124102	ENSG00000124102		"""WAP four-disulfide core domain containing"""	8947	protein-coding gene	gene with protein product	"""skin-derived antileukoproteinase"", ""trappin-2"""	182257	"""protease inhibitor 3, skin-derived (SKALP)"""			8287685, 12206714	Standard	NM_002638		Approved	ESI, SKALP, ELAFIN, WAP3, WFDC14, cementoin	uc002xng.3	P19957	OTTHUMG00000032567	ENST00000243924.3:c.227G>T	20.37:g.43804649G>T	ENSP00000243924:p.Cys76Phe	94	2		125	6	NM_002638	4	2	3075	3109	28	E1P618|Q6FG74	Missense_Mutation	SNP	ENST00000243924.3	37	CCDS13344.1	.	.	.	.	.	.	.	.	.	.	G	17.54	3.414861	0.62511	.	.	ENSG00000124102	ENST00000243924	D	0.99239	-5.61	4.49	4.49	0.54785	Whey acidic protein, 4-disulphide core (5);4-disulphide core (1);	0.000000	0.47093	D	0.000255	D	0.99664	0.9875	H	0.98996	4.395	0.42882	D	0.994173	D	0.89917	1.0	D	0.97110	1.0	D	0.97354	0.9965	10	0.87932	D	0	.	13.4053	0.60908	0.0:0.0:1.0:0.0	.	76	P19957	ELAF_HUMAN	F	76	ENSP00000243924:C76F	ENSP00000243924:C76F	C	+	2	0	PI3	43238063	0.998000	0.40836	0.874000	0.34290	0.082000	0.17680	3.612000	0.54142	2.432000	0.82394	0.650000	0.86243	TGC	.		0.498	PI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079418.3	NM_002638	
C21orf91	54149	broad.mit.edu	37	21	19190580	19190580	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr21:19190580C>T	ENST00000400558.3	-	2	146	c.56G>A	c.(55-57)aGt>aAt	p.S19N	C21orf91_ENST00000493464.1_5'UTR|C21orf91_ENST00000284881.4_Missense_Mutation_p.S19N|C21orf91_ENST00000400559.3_Missense_Mutation_p.S19N	NM_001100421.1	NP_001093891.1			chromosome 21 open reading frame 91											endometrium(2)|large_intestine(2)|lung(4)|ovary(1)	9				Epithelial(23;8.76e-05)|all cancers(11;0.000422)|OV - Ovarian serous cystadenocarcinoma(11;0.0107)|Lung(58;0.0129)|COAD - Colon adenocarcinoma(22;0.0303)|LUSC - Lung squamous cell carcinoma(23;0.0381)|Colorectal(24;0.0929)		TTTACAAACACTGCAAATGTT	0.353																																					p.S19N													.	C21orf91-91	0			c.G56A						.						202.0	188.0	192.0					21																	19190580		1876	4110	5986	SO:0001583	missense	54149	exon2			CAAACACTGCAAA	AF239726	CCDS42907.1, CCDS42908.1, CCDS42909.1	21q21.1	2011-12-12	2003-07-22		ENSG00000154642	ENSG00000154642			16459	protein-coding gene	gene with protein product	"""cold sore susceptibility gene 1"", ""early undifferentiated retina and lens"""		"""chromosome 21 open reading frame 38"""	C21orf38, C21orf14		22039568	Standard	NM_001100421		Approved	YG81, EURL, CSSG1	uc002yko.4	Q9NYK6	OTTHUMG00000074509	ENST00000400558.3:c.56G>A	21.37:g.19190580C>T	ENSP00000383403:p.Ser19Asn	185	0		125	5	NM_017447	0	0	2	2	0		Missense_Mutation	SNP	ENST00000400558.3	37	CCDS42909.1	.	.	.	.	.	.	.	.	.	.	C	29.5	5.011286	0.93346	.	.	ENSG00000154642	ENST00000284881;ENST00000400559;ENST00000400558;ENST00000405964	T;T;T;T	0.23147	1.92;1.92;1.92;1.92	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	T	0.49609	0.1567	M	0.65498	2.005	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	T	0.41645	-0.9497	9	.	.	.	-6.9151	16.4282	0.83831	0.0:1.0:0.0:0.0	.	19;19	Q9NYK6-3;Q9NYK6	.;EURL_HUMAN	N	19	ENSP00000284881:S19N;ENSP00000383404:S19N;ENSP00000383403:S19N;ENSP00000385566:S19N	.	S	-	2	0	C21orf91	18112451	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.845000	0.75394	2.554000	0.86153	0.655000	0.94253	AGT	.		0.353	C21orf91-002	PUTATIVE	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000158214.1	NM_017447	
PRDM15	63977	hgsc.bcm.edu	37	21	43221684	43221684	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr21:43221684C>A	ENST00000269844.3	-	31	4350	c.4240G>T	c.(4240-4242)Gtc>Ttc	p.V1414F	PRDM15_ENST00000398548.1_Missense_Mutation_p.V1085F|PRDM15_ENST00000447207.2_Missense_Mutation_p.V1048F|PRDM15_ENST00000538201.1_Missense_Mutation_p.V1068F|PRDM15_ENST00000422911.1_Missense_Mutation_p.V1105F|PRDM15_ENST00000470586.1_5'UTR	NM_022115.3	NP_071398.3	P57071	PRD15_HUMAN	PR domain containing 15	1414					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(11)|ovary(3)|skin(2)|stomach(2)|urinary_tract(1)	43						GAGCCGCTGACGGTATCAAAG	0.572																																					p.V1414F		.											.	PRDM15-90	0			c.G4240T						.						68.0	60.0	63.0					21																	43221684		2203	4300	6503	SO:0001583	missense	63977	exon31			CGCTGACGGTATC	AF276513	CCDS13676.1, CCDS42932.1, CCDS63370.1	21q22.3	2013-01-08	2002-07-31		ENSG00000141956	ENSG00000141956		"""Zinc fingers, C2H2-type"""	13999	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 83"""	ZNF298, C21orf83		12036297, 12036298	Standard	NM_022115		Approved		uc002yzq.1	P57071	OTTHUMG00000086781	ENST00000269844.3:c.4240G>T	21.37:g.43221684C>A	ENSP00000269844:p.Val1414Phe	91	0		49	3	NM_022115	0	0	4	4	0	E9PDJ6|E9PF37|E9PGL3|Q4W8S0|Q4W8S3|Q4W8S4|Q4W8S5|Q8N0X3|Q8NEX0|Q9NQV3	Missense_Mutation	SNP	ENST00000269844.3	37	CCDS13676.1	.	.	.	.	.	.	.	.	.	.	c	19.42	3.824556	0.71143	.	.	ENSG00000141956	ENST00000422911;ENST00000398548;ENST00000538201;ENST00000447207;ENST00000269844	T;T;T;T;T	0.48201	0.82;0.82;0.82;0.82;0.82	4.29	4.29	0.51040	.	.	.	.	.	T	0.56499	0.1989	L	0.27053	0.805	0.58432	D	0.999995	D;D;D	0.89917	1.0;0.999;0.997	D;D;P	0.87578	0.998;0.995;0.902	T	0.63171	-0.6697	9	0.87932	D	0	-33.0293	15.7568	0.78037	0.0:1.0:0.0:0.0	.	1414;1105;1085	P57071;E9PDJ6;E9PF37	PRD15_HUMAN;.;.	F	1105;1085;1068;1048;1414	ENSP00000408592:V1105F;ENSP00000381556:V1085F;ENSP00000444044:V1068F;ENSP00000390245:V1048F;ENSP00000269844:V1414F	ENSP00000269844:V1414F	V	-	1	0	PRDM15	42094753	1.000000	0.71417	0.980000	0.43619	0.319000	0.28217	7.206000	0.77891	1.934000	0.56057	0.558000	0.71614	GTC	.		0.572	PRDM15-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_022115	
ARMC8	25852	hgsc.bcm.edu	37	3	137986077	137986077	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr3:137986077C>G	ENST00000469044.1	+	15	1651	c.1380C>G	c.(1378-1380)agC>agG	p.S460R	ARMC8_ENST00000491704.1_Missense_Mutation_p.S418R|NME9_ENST00000484930.1_Intron|NME9_ENST00000383180.2_Intron|ARMC8_ENST00000481646.1_Missense_Mutation_p.S446R|NME9_ENST00000536478.1_Intron|ARMC8_ENST00000538260.1_Missense_Mutation_p.S429R|ARMC8_ENST00000461822.1_Missense_Mutation_p.S393R|NME9_ENST00000341790.5_Intron|NME9_ENST00000317876.4_Intron|ARMC8_ENST00000485396.1_Missense_Mutation_p.S387R|ARMC8_ENST00000393058.3_Missense_Mutation_p.S450R	NM_001267041.1|NM_001267042.1	NP_001253970.1|NP_001253971.1	Q8IUR7	ARMC8_HUMAN	armadillo repeat containing 8	460										endometrium(2)|kidney(1)|large_intestine(7)|lung(5)|upper_aerodigestive_tract(1)	16						TTTCTCCAAGCAAAGAGGTTA	0.353																																					p.S446R		.											.	ARMC8-90	0			c.C1338G						.						93.0	81.0	85.0					3																	137986077		1818	4076	5894	SO:0001583	missense	25852	exon16			TCCAAGCAAAGAG		CCDS3098.1, CCDS54646.1, CCDS58853.1, CCDS58854.1, CCDS75020.1	3q22	2013-02-14			ENSG00000114098	ENSG00000114098		"""Armadillo repeat containing"""	24999	protein-coding gene	gene with protein product	"""GID complex subunit 5, VID28 homolog (S. cerevisiae)"""					11042152	Standard	NM_014154		Approved	HSPC056, DKFZP434A043, GID5, VID28	uc003esa.2	Q8IUR7	OTTHUMG00000159821	ENST00000469044.1:c.1380C>G	3.37:g.137986077C>G	ENSP00000419413:p.Ser460Arg	15	0		13	2	NM_015396	0	0	0	0	0	A8K0L2|B7Z441|B7Z453|D3DNE6|F5GWK4|Q6PIL2|Q96D19|Q96HZ5|Q9NV02|Q9NV94|Q9Y4R9	Missense_Mutation	SNP	ENST00000469044.1	37		.	.	.	.	.	.	.	.	.	.	C	18.37	3.609677	0.66558	.	.	ENSG00000114098	ENST00000481646;ENST00000469044;ENST00000491704;ENST00000461822;ENST00000485396;ENST00000538260;ENST00000393058;ENST00000539459	T;T;T;T;T;T;T	0.65916	-0.18;-0.18;-0.18;1.29;1.29;1.29;-0.18	5.84	3.09	0.35607	Armadillo-like helical (1);Armadillo-type fold (1);	0.038234	0.85682	N	0.000000	T	0.60104	0.2243	L	0.55481	1.735	0.80722	D	1	P;P;P;B;P	0.51240	0.905;0.651;0.886;0.281;0.943	B;B;P;B;P	0.50570	0.386;0.157;0.59;0.056;0.644	T	0.53457	-0.8436	10	0.25106	T	0.35	-31.5808	7.5339	0.27700	0.0:0.6608:0.0:0.3392	.	387;393;429;460;446	B7Z637;B7Z441;F5GWK4;Q8IUR7;Q8IUR7-2	.;.;.;ARMC8_HUMAN;.	R	446;460;418;393;387;429;450;317	ENSP00000420333:S446R;ENSP00000419413:S460R;ENSP00000417304:S418R;ENSP00000420706:S393R;ENSP00000417049:S387R;ENSP00000441592:S429R;ENSP00000376778:S450R	ENSP00000376778:S450R	S	+	3	2	ARMC8	139468767	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.543000	0.36147	0.382000	0.24878	0.561000	0.74099	AGC	.		0.353	ARMC8-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000357560.1	NM_015396	
MUC4	4585	hgsc.bcm.edu	37	3	195515493	195515493	+	Silent	SNP	G	G	A			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr3:195515493G>A	ENST00000463781.3	-	2	3417	c.2958C>T	c.(2956-2958)tcC>tcT	p.S986S	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Silent_p.S986S|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	991	Ser-rich.				cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGTGACCTGTGGATGCCGAGG	0.577																																					p.S986S		.											.	MUC4-90	0			c.C2958T						.						71.0	64.0	67.0					3																	195515493		2199	4280	6479	SO:0001819	synonymous_variant	4585	exon2			ACCTGTGGATGCC	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.2958C>T	3.37:g.195515493G>A		18	0		16	2	NM_018406	0	0	0	0	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																			.		0.577	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
KIAA1211	57482	hgsc.bcm.edu	37	4	57180739	57180739	+	Missense_Mutation	SNP	G	G	C	rs112530577	byFrequency	TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr4:57180739G>C	ENST00000504228.1	+	6	1176	c.1071G>C	c.(1069-1071)gaG>gaC	p.E357D	KIAA1211_ENST00000264229.6_Missense_Mutation_p.E357D|KIAA1211_ENST00000541073.1_Missense_Mutation_p.E350D			Q6ZU35	K1211_HUMAN	KIAA1211	357	Glu-rich.									endometrium(7)|large_intestine(10)|lung(39)|ovary(2)|prostate(3)|skin(3)|stomach(1)	65	Glioma(25;0.08)|all_neural(26;0.101)					gcgcggaggagctcaaaaggc	0.697													G|||	102	0.0203674	0.0749	0.0043	5008	,	,		12008	0.0		0.0	False		,,,				2504	0.0				p.E357D		.											.	KIAA1211-70	0			c.G1071C						.	G	ASP/GLU	150,3800		1,148,1826	7.0	9.0	9.0		1071	2.4	0.2	4	dbSNP_132	9	4,7840		0,4,3918	yes	missense	KIAA1211	NM_020722.1	45	1,152,5744	CC,CG,GG		0.051,3.7975,1.3057	probably-damaging	357/1234	57180739	154,11640	1975	3922	5897	SO:0001583	missense	57482	exon8			GGAGGAGCTCAAA	AB033037	CCDS43230.1	4q12	2012-08-03			ENSG00000109265	ENSG00000109265			29219	protein-coding gene	gene with protein product						10574462, 11230166	Standard	NM_020722		Approved		uc003hbk.2	Q6ZU35	OTTHUMG00000160749	ENST00000504228.1:c.1071G>C	4.37:g.57180739G>C	ENSP00000423366:p.Glu357Asp	5	2		4	4	NM_020722	0	0	0	0	0	Q9NTE2|Q9NTP8|Q9ULK9	Missense_Mutation	SNP	ENST00000504228.1	37	CCDS43230.1	35	0.016025641025641024	35	0.07113821138211382	0	0.0	0	0.0	0	0.0	G	14.25	2.480481	0.44044	0.037975	5.1E-4	ENSG00000109265	ENST00000264229;ENST00000504228;ENST00000541073;ENST00000546221	T;T;T	0.02050	4.48;4.48;4.48	5.09	2.39	0.29439	.	.	.	.	.	T	0.00328	0.0010	N	0.19112	0.55	0.23869	N	0.996617	D;D;D	0.64830	0.994;0.994;0.971	P;P;P	0.61800	0.894;0.894;0.832	T	0.52771	-0.8531	9	0.44086	T	0.13	-2.2251	7.8321	0.29349	0.4706:0.0:0.5294:0.0	.	350;350;357	B7ZVZ4;F5H1N7;Q6ZU35	.;.;K1211_HUMAN	D	357;357;350;267	ENSP00000264229:E357D;ENSP00000423366:E357D;ENSP00000444006:E350D	ENSP00000264229:E357D	E	+	3	2	KIAA1211	56875496	0.001000	0.12720	0.190000	0.23270	0.075000	0.17131	0.315000	0.19451	0.160000	0.19432	0.462000	0.41574	GAG	G|0.984;C|0.016		0.697	KIAA1211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362097.2	NM_020722	
FBXW7	55294	broad.mit.edu	37	4	153268165	153268165	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr4:153268165C>T	ENST00000281708.4	-	4	1872	c.643G>A	c.(643-645)Gcc>Acc	p.A215T	FBXW7_ENST00000393956.3_Missense_Mutation_p.A39T|FBXW7_ENST00000603841.1_Missense_Mutation_p.A215T|FBXW7_ENST00000296555.5_Missense_Mutation_p.A97T|FBXW7_ENST00000263981.5_Missense_Mutation_p.A135T|FBXW7_ENST00000603548.1_Missense_Mutation_p.A215T	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase	215					cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)	p.?(1)		NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				TGGCCATTGGCTGCTCTGAGG	0.443			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																p.A215T				Rec	yes		4	4q31.3	55294	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""		"""E, L"""	.	FBXW7-6296	1	Unknown(1)	haematopoietic_and_lymphoid_tissue(1)	c.G643A						.						164.0	151.0	156.0					4																	153268165		2203	4300	6503	SO:0001583	missense	55294	exon4			CATTGGCTGCTCT	AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.643G>A	4.37:g.153268165C>T	ENSP00000281708:p.Ala215Thr	162	0		122	3	NM_033632	0	0	5	5	0	B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Missense_Mutation	SNP	ENST00000281708.4	37	CCDS3777.1	.	.	.	.	.	.	.	.	.	.	C	17.29	3.351810	0.61183	.	.	ENSG00000109670	ENST00000281708;ENST00000296555;ENST00000263981;ENST00000393956	T;T;T;T	0.58797	0.31;0.36;0.31;0.59	5.83	5.83	0.93111	.	0.053021	0.85682	D	0.000000	T	0.44201	0.1282	N	0.14661	0.345	0.80722	D	1	B;P;B;B	0.34522	0.084;0.455;0.001;0.447	B;B;B;B	0.32342	0.026;0.068;0.001;0.144	T	0.38045	-0.9679	10	0.38643	T	0.18	-12.804	20.1162	0.97934	0.0:1.0:0.0:0.0	.	39;215;97;135	B7Z2C8;Q969H0;Q969H0-4;Q969H0-2	.;FBXW7_HUMAN;.;.	T	215;97;135;39	ENSP00000281708:A215T;ENSP00000296555:A97T;ENSP00000263981:A135T;ENSP00000377528:A39T	ENSP00000263981:A135T	A	-	1	0	FBXW7	153487615	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.487000	0.81328	2.757000	0.94681	0.563000	0.77884	GCC	.		0.443	FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469956.1		
PDZD2	23037	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	32108131	32108131	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr5:32108131A>G	ENST00000438447.1	+	25	8798	c.8410A>G	c.(8410-8412)Aat>Gat	p.N2804D	CTD-2152M20.2_ENST00000503441.1_RNA|PDZD2_ENST00000513490.1_3'UTR|PDZD2_ENST00000282493.3_Missense_Mutation_p.N2804D			O15018	PDZD2_HUMAN	PDZ domain containing 2	2804	PDZ 6. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)				NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						TCTTGCTATTAATGGGAAACC	0.403																																					p.N2804D		.											.	PDZD2-563	0			c.A8410G						.						134.0	139.0	137.0					5																	32108131		2203	4300	6503	SO:0001583	missense	23037	exon24			GCTATTAATGGGA	AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.8410A>G	5.37:g.32108131A>G	ENSP00000402033:p.Asn2804Asp	159	0		126	53	NM_178140	0	0	1	1	0	Q9BXD4	Missense_Mutation	SNP	ENST00000438447.1	37	CCDS34137.1	.	.	.	.	.	.	.	.	.	.	A	22.0	4.233379	0.79688	.	.	ENSG00000133401	ENST00000438447;ENST00000382161;ENST00000282493	T;T	0.56776	0.44;0.44	5.88	5.88	0.94601	PDZ/DHR/GLGF (4);	0.097034	0.45867	D	0.000337	T	0.59742	0.2216	L	0.41415	1.275	0.35013	D	0.757058	D	0.76494	0.999	D	0.71870	0.975	T	0.68269	-0.5453	10	0.39692	T	0.17	.	8.7229	0.34452	0.9164:0.0:0.0836:0.0	.	2804	O15018	PDZD2_HUMAN	D	2804;2605;2804	ENSP00000402033:N2804D;ENSP00000282493:N2804D	ENSP00000282493:N2804D	N	+	1	0	PDZD2	32143888	1.000000	0.71417	0.995000	0.50966	0.975000	0.68041	3.761000	0.55242	2.242000	0.73789	0.533000	0.62120	AAT	.		0.403	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366608.1		
SLIT3	6586	hgsc.bcm.edu	37	5	168098301	168098301	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr5:168098301G>C	ENST00000519560.1	-	34	4448	c.4029C>G	c.(4027-4029)tgC>tgG	p.C1343W	SLIT3_ENST00000404867.3_Missense_Mutation_p.C1343W|SLIT3_ENST00000332966.8_Missense_Mutation_p.C1350W	NM_001271946.1|NM_003062.2	NP_001258875.1|NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 (Drosophila)	1343	EGF-like 7. {ECO:0000255|PROSITE- ProRule:PRU00076}.				apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|cellular response to hormone stimulus (GO:0032870)|negative chemotaxis (GO:0050919)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of gene expression (GO:0010629)|organ morphogenesis (GO:0009887)|response to cortisol (GO:0051414)|Roundabout signaling pathway (GO:0035385)	extracellular space (GO:0005615)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)	p.C1343*(1)		endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(15)|liver(2)|lung(48)|ovary(4)|prostate(7)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	100	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CCACGGAGCGGCACAGGCCGT	0.677																																					p.C1350W	Ovarian(29;311 847 10864 17279 24903)	.											.	SLIT3-95	1	Substitution - Nonsense(1)	lung(1)	c.C4050G						.						43.0	35.0	37.0					5																	168098301		2203	4300	6503	SO:0001583	missense	6586	exon34			GGAGCGGCACAGG	AB011538	CCDS4369.1, CCDS64311.1	5q35	2008-07-18	2001-11-28		ENSG00000184347	ENSG00000184347			11087	protein-coding gene	gene with protein product		603745	"""slit (Drosophila) homolog 3"""	SLIL2		9693030, 9813312	Standard	NM_001271946		Approved	slit2, MEGF5, SLIT1, Slit-3	uc010jjg.4	O75094	OTTHUMG00000130409	ENST00000519560.1:c.4029C>G	5.37:g.168098301G>C	ENSP00000430333:p.Cys1343Trp	50	0		36	2	NM_001271946	0	0	20	20	0	A6H8U9|J3KNP3|O95804|Q9UFH5	Missense_Mutation	SNP	ENST00000519560.1	37	CCDS4369.1	.	.	.	.	.	.	.	.	.	.	G	14.96	2.692168	0.48202	.	.	ENSG00000184347	ENST00000519560;ENST00000332966;ENST00000404867	D;D;D	0.82433	-1.6;-1.61;-1.59	5.16	-3.59	0.04583	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.91952	0.7451	H	0.95004	3.61	0.80722	D	1	D	0.69078	0.997	D	0.75484	0.986	D	0.91550	0.5256	10	0.72032	D	0.01	.	15.2185	0.73288	0.6215:0.0:0.3785:0.0	.	1343	O75094	SLIT3_HUMAN	W	1343;1350;1343	ENSP00000430333:C1343W;ENSP00000332164:C1350W;ENSP00000384890:C1343W	ENSP00000332164:C1350W	C	-	3	2	SLIT3	168030879	0.999000	0.42202	0.356000	0.25785	0.910000	0.53928	0.533000	0.23082	-0.956000	0.03631	-1.598000	0.00824	TGC	.		0.677	SLIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252792.4	NM_003062	
GMDS	2762	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	1930387	1930387	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr6:1930387C>T	ENST00000380815.4	-	7	990	c.721G>A	c.(721-723)Gga>Aga	p.G241R	GMDS_ENST00000530927.1_Missense_Mutation_p.G211R	NM_001500.3	NP_001491.1	O60547	GMDS_HUMAN	GDP-mannose 4,6-dehydratase	241					'de novo' GDP-L-fucose biosynthetic process (GO:0042351)|GDP-mannose metabolic process (GO:0019673)|Notch signaling pathway (GO:0007219)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	GDP-mannose 4,6-dehydratase activity (GO:0008446)|NADP+ binding (GO:0070401)		GMDS/PDE8B(2)	breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(2)|lung(8)|prostate(1)	21	Ovarian(93;0.0733)	all_cancers(2;7.64e-19)|all_epithelial(2;3.05e-16)|Colorectal(2;0.00414)|all_hematologic(90;0.00997)|all_lung(73;0.0141)|Lung NSC(90;0.0802)		Epithelial(2;7.61e-06)|all cancers(2;0.000111)|STAD - Stomach adenocarcinoma(2;0.000231)|Colorectal(2;0.00445)|COAD - Colon adenocarcinoma(2;0.0125)|OV - Ovarian serous cystadenocarcinoma(45;0.0563)		TCCAGATTTCCCAAACTGAAA	0.408																																					p.G241R		.											.	GMDS-90	0			c.G721A						.						143.0	124.0	131.0					6																	1930387		2203	4300	6503	SO:0001583	missense	2762	exon7			GATTTCCCAAACT	AF042377	CCDS4474.1, CCDS58994.1	6p25	2011-09-14			ENSG00000112699	ENSG00000112699	4.2.1.47	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	4369	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 3E, member 1"""	602884				9525924, 19027726	Standard	NM_001500		Approved	GMD, SDR3E1	uc003mtq.3	O60547	OTTHUMG00000016143	ENST00000380815.4:c.721G>A	6.37:g.1930387C>T	ENSP00000370194:p.Gly241Arg	163	0		134	33	NM_001500	0	0	29	72	43	E9PI88|O75357|Q5T954|Q6FH09|Q9UGZ3|Q9UJK9	Missense_Mutation	SNP	ENST00000380815.4	37	CCDS4474.1	.	.	.	.	.	.	.	.	.	.	C	28.8	4.953109	0.92660	.	.	ENSG00000112699	ENST00000530927;ENST00000380815	D;D	0.95656	-3.77;-3.77	5.63	5.63	0.86233	NAD-dependent epimerase/dehydratase (1);	0.000000	0.85682	D	0.000000	D	0.99042	0.9672	H	0.99415	4.555	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99198	1.0872	10	0.87932	D	0	-19.5481	19.6914	0.96002	0.0:1.0:0.0:0.0	.	241	O60547	GMDS_HUMAN	R	211;241	ENSP00000436726:G211R;ENSP00000370194:G241R	ENSP00000370194:G241R	G	-	1	0	GMDS	1875386	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.487000	0.81328	2.644000	0.89710	0.563000	0.77884	GGA	.		0.408	GMDS-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000043380.3		
MEP1A	4224	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	46801054	46801054	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr6:46801054A>G	ENST00000230588.4	+	11	1397	c.1388A>G	c.(1387-1389)gAg>gGg	p.E463G		NM_005588.2	NP_005579.2	Q16819	MEP1A_HUMAN	meprin A, alpha (PABA peptide hydrolase)	463	MATH. {ECO:0000255|PROSITE- ProRule:PRU00129}.				digestion (GO:0007586)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|meprin A complex (GO:0017090)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(21)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42			Lung(136;0.192)			TACAATTCGGAGGGATATGGT	0.498																																					p.E463G		.											.	MEP1A-183	0			c.A1388G						.						74.0	76.0	75.0					6																	46801054		2203	4300	6503	SO:0001583	missense	4224	exon11			ATTCGGAGGGATA		CCDS4918.1	6p12-p11	2010-10-18			ENSG00000112818	ENSG00000112818	3.4.24.18		7015	protein-coding gene	gene with protein product		600388				7774936	Standard	NM_005588		Approved	PPHA	uc010jzh.1	Q16819	OTTHUMG00000014790	ENST00000230588.4:c.1388A>G	6.37:g.46801054A>G	ENSP00000230588:p.Glu463Gly	157	0		130	19	NM_005588	0	0	0	0	0	A2RRM4|B0AZP9|B2RCS2|Q8TDC9|Q9H1R1	Missense_Mutation	SNP	ENST00000230588.4	37	CCDS4918.1	.	.	.	.	.	.	.	.	.	.	A	15.89	2.965894	0.53507	.	.	ENSG00000112818	ENST00000230588	T	0.42900	0.96	5.72	5.72	0.89469	TRAF-type (1);TRAF-like (1);MATH (3);	0.000000	0.85682	D	0.000000	T	0.65059	0.2655	M	0.88906	2.99	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.73269	-0.4036	10	0.72032	D	0.01	-31.3608	15.9995	0.80280	1.0:0.0:0.0:0.0	.	491;463	B7ZL91;Q16819	.;MEP1A_HUMAN	G	463	ENSP00000230588:E463G	ENSP00000230588:E463G	E	+	2	0	MEP1A	46909013	1.000000	0.71417	0.998000	0.56505	0.073000	0.16967	9.339000	0.96797	2.186000	0.69663	0.528000	0.53228	GAG	.		0.498	MEP1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040803.1	NM_005588	
OPN5	221391	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	47754339	47754339	+	Silent	SNP	C	C	A			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr6:47754339C>A	ENST00000371211.2	+	2	247	c.219C>A	c.(217-219)atC>atA	p.I73I	OPN5_ENST00000393699.2_Silent_p.I73I|OPN5_ENST00000489301.2_Silent_p.I73I	NM_181744.3	NP_859528.1	Q6U736	OPN5_HUMAN	opsin 5	73					phototransduction (GO:0007602)|protein-chromophore linkage (GO:0018298)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)	G-protein coupled receptor activity (GO:0004930)|photoreceptor activity (GO:0009881)	p.I73I(1)		endometrium(1)|large_intestine(3)|lung(14)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(2)	29						TAATGACTATCAATTTAGCAG	0.403																																					p.I73I	Melanoma(28;740 973 10870 42660 45347)	.											.	OPN5-69	1	Substitution - coding silent(1)	lung(1)	c.C219A						.						139.0	128.0	132.0					6																	47754339		2203	4300	6503	SO:0001819	synonymous_variant	221391	exon2			GACTATCAATTTA	AY288419	CCDS4923.1	6p12.3	2012-08-08	2004-01-23		ENSG00000124818	ENSG00000124818		"""GPCR / Class A : Opsin receptors"""	19992	protein-coding gene	gene with protein product	"""neuropsin"""	609042	"""transmembrane protein 13"""	TMEM13		14623103, 14623098	Standard	NR_033806		Approved	neuropsin, dJ402H5.1	uc003ozc.3	Q6U736	OTTHUMG00000014803	ENST00000371211.2:c.219C>A	6.37:g.47754339C>A		137	1		123	43	NM_181744	0	0	0	0	0	A0AV33|Q5T5B9|Q5T886|Q7Z603|Q86SL5	Silent	SNP	ENST00000371211.2	37	CCDS4923.1																																																																																			.		0.403	OPN5-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359451.1	NM_181744	
KLHL31	401265	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	53517013	53517013	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr6:53517013C>T	ENST00000407079.1	-	2	1287	c.1288G>A	c.(1288-1290)Gaa>Aaa	p.E430K	KLHL31_ENST00000370905.3_Missense_Mutation_p.E430K			Q9H511	KLH31_HUMAN	kelch-like family member 31	430					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					autonomic_ganglia(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|prostate(3)	20	Lung NSC(77;0.0158)					AGGCTTCCTTCTGCGTTGCGG	0.662																																					p.E430K		.											.	KLHL31-23	0			c.G1288A						.						48.0	49.0	49.0					6																	53517013		2203	4299	6502	SO:0001583	missense	401265	exon3			TTCCTTCTGCGTT		CCDS34478.1	6p12.1	2013-09-27	2013-02-22	2007-01-09	ENSG00000124743	ENSG00000124743		"""Kelch-like"", ""BTB/POZ domain containing"""	21353	protein-coding gene	gene with protein product		610749	"""kelch repeat and BTB (POZ) domain containing 1"", ""kelch-like 31 (Drosophila)"""	KBTBD1			Standard	NM_001003760		Approved	bA345L23.2, BKLHD6	uc003pcb.4	Q9H511	OTTHUMG00000014882	ENST00000407079.1:c.1288G>A	6.37:g.53517013C>T	ENSP00000384644:p.Glu430Lys	141	1		96	35	NM_001003760	0	0	1	1	0	A6N9J2|B2RP49	Missense_Mutation	SNP	ENST00000407079.1	37	CCDS34478.1	.	.	.	.	.	.	.	.	.	.	C	14.78	2.636551	0.47049	.	.	ENSG00000124743	ENST00000370905;ENST00000407079	T;T	0.78924	-1.22;-1.22	5.69	4.81	0.61882	Galactose oxidase, beta-propeller (1);	0.045766	0.85682	D	0.000000	T	0.50480	0.1618	L	0.38531	1.155	0.53005	D	0.999961	B	0.17465	0.022	B	0.15870	0.014	T	0.54814	-0.8237	10	0.07030	T	0.85	.	16.5527	0.84476	0.0:0.8693:0.1307:0.0	.	430	Q9H511	KLH31_HUMAN	K	430	ENSP00000359942:E430K;ENSP00000384644:E430K	ENSP00000359942:E430K	E	-	1	0	KLHL31	53624972	0.999000	0.42202	0.077000	0.20336	0.797000	0.45037	7.800000	0.85949	1.367000	0.46095	0.650000	0.86243	GAA	.		0.662	KLHL31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040965.1	NM_001003760	
COL19A1	1310	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	70639518	70639518	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr6:70639518G>T	ENST00000322773.4	+	6	694	c.592G>T	c.(592-594)Gat>Tat	p.D198Y		NM_001858.4	NP_001849.2	Q14993	COJA1_HUMAN	collagen, type XIX, alpha 1	198	Laminin G-like.				cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|single organismal cell-cell adhesion (GO:0016337)|skeletal muscle tissue development (GO:0007519)|skeletal system development (GO:0001501)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|protein binding, bridging (GO:0030674)			breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(8)|lung(54)|ovary(3)|prostate(2)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	109						GAGGCAGACTGATGAAAAGGA	0.423																																					p.D198Y		.											.	COL19A1-156	0			c.G592T						.						111.0	106.0	108.0					6																	70639518		2203	4300	6503	SO:0001583	missense	1310	exon6			CAGACTGATGAAA		CCDS4970.1	6q12-q13	2013-01-16			ENSG00000082293	ENSG00000082293		"""Collagens"""	2196	protein-coding gene	gene with protein product		120165				7916703, 9143499	Standard	NM_001858		Approved		uc003pfc.1	Q14993	OTTHUMG00000014987	ENST00000322773.4:c.592G>T	6.37:g.70639518G>T	ENSP00000316030:p.Asp198Tyr	150	0		93	16	NM_001858	0	0	0	0	0	Q00559|Q05850|Q12885|Q13676|Q14DH1|Q5JUF0|Q5T424|Q9H572|Q9NPZ2|Q9NQP2	Missense_Mutation	SNP	ENST00000322773.4	37	CCDS4970.1	.	.	.	.	.	.	.	.	.	.	G	3.418	-0.118699	0.06838	.	.	ENSG00000082293	ENST00000322773	T	0.02525	4.26	5.64	3.86	0.44501	Concanavalin A-like lectin/glucanase (1);Laminin G, thrombospondin-type, N-terminal (1);	0.564051	0.17635	N	0.167232	T	0.01800	0.0057	L	0.50333	1.59	0.80722	D	1	P	0.52842	0.956	B	0.41723	0.365	T	0.57648	-0.7775	10	0.66056	D	0.02	.	11.8431	0.52366	0.1408:0.0:0.8592:0.0	.	198	Q14993	COJA1_HUMAN	Y	198	ENSP00000316030:D198Y	ENSP00000316030:D198Y	D	+	1	0	COL19A1	70696239	0.997000	0.39634	0.001000	0.08648	0.020000	0.10135	5.263000	0.65507	0.732000	0.32470	0.655000	0.94253	GAT	.		0.423	COL19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041127.1		
STX11	8676	broad.mit.edu	37	6	144507993	144507993	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr6:144507993C>T	ENST00000367568.4	+	2	412	c.229C>T	c.(229-231)Cgg>Tgg	p.R77W		NM_003764.3	NP_003755.2	O75558	STX11_HUMAN	syntaxin 11	77					cytotoxic T cell degranulation (GO:0043316)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|natural killer cell degranulation (GO:0043320)|neutrophil degranulation (GO:0043312)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)	SNAP receptor activity (GO:0005484)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(1)|skin(1)	12				OV - Ovarian serous cystadenocarcinoma(155;2.17e-06)|GBM - Glioblastoma multiforme(68;0.0492)		CACGTCCATGCGGCGCCTCAG	0.627									Familial Hemophagocytic Lymphohistiocytosis																												p.R77W													.	STX11-91	0			c.C229T						.						31.0	30.0	30.0					6																	144507993		2203	4300	6503	SO:0001583	missense	8676	exon2	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	TCCATGCGGCGCC	AF044309	CCDS5205.1	6q24.1	2014-09-17			ENSG00000135604	ENSG00000135604			11429	protein-coding gene	gene with protein product		605014				9553086	Standard	NM_003764		Approved		uc003qks.4	O75558	OTTHUMG00000015739	ENST00000367568.4:c.229C>T	6.37:g.144507993C>T	ENSP00000356540:p.Arg77Trp	43	0		34	4	NM_003764	0	0	8	8	0	E1P598|O75378|O95148|Q5TCL6	Missense_Mutation	SNP	ENST00000367568.4	37	CCDS5205.1	.	.	.	.	.	.	.	.	.	.	C	17.56	3.419397	0.62622	.	.	ENSG00000135604	ENST00000367568	T	0.17854	2.25	5.99	3.22	0.36961	t-SNARE (1);Syntaxin, N-terminal (2);	0.000000	0.85682	D	0.000000	T	0.35595	0.0937	M	0.84433	2.695	0.58432	D	0.999994	D	0.89917	1.0	D	0.87578	0.998	T	0.46992	-0.9151	10	0.87932	D	0	-35.3942	15.3757	0.74602	0.3632:0.6368:0.0:0.0	.	77	O75558	STX11_HUMAN	W	77	ENSP00000356540:R77W	ENSP00000356540:R77W	R	+	1	2	STX11	144549686	1.000000	0.71417	1.000000	0.80357	0.766000	0.43426	1.928000	0.40104	0.400000	0.25396	-0.181000	0.13052	CGG	.		0.627	STX11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042544.1		
SKAP2	8935	bcgsc.ca	37	7	26765601	26765601	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr7:26765601G>C	ENST00000345317.2	-	8	912	c.599C>G	c.(598-600)aCa>aGa	p.T200R	SKAP2_ENST00000489977.1_5'UTR|SKAP2_ENST00000539623.1_Missense_Mutation_p.T28R	NM_003930.3	NP_003921.2	O75563	SKAP2_HUMAN	src kinase associated phosphoprotein 2	200	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				B cell activation (GO:0042113)|negative regulation of cell proliferation (GO:0008285)|positive regulation of signal transduction (GO:0009967)|protein complex assembly (GO:0006461)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)			haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(7)|ovary(1)|pancreas(1)|skin(3)	17						AGAAGCTGCTGTAAACTAATA	0.318																																					p.T200R													.	SKAP2-91	0			c.C599G						.						68.0	67.0	67.0					7																	26765601		2203	4299	6502	SO:0001583	missense	8935	exon8			GCTGCTGTAAACT		CCDS5400.1	7p15.2	2013-01-10	2006-09-28	2006-09-28	ENSG00000005020	ENSG00000005020		"""Pleckstrin homology (PH) domain containing"""	15687	protein-coding gene	gene with protein product		605215	"""src family associated phosphoprotein 2"""	SCAP2		9837776, 9755858	Standard	NM_003930		Approved	RA70, SKAP-HOM, SKAP55R, SAPS	uc003syc.3	O75563	OTTHUMG00000023495	ENST00000345317.2:c.599C>G	7.37:g.26765601G>C	ENSP00000005587:p.Thr200Arg	57	0		75	4	NM_003930	0	0	0	0	0	A4D173|Q53GP6|Q75MK6|Q75MZ4|Q9UBZ3|Q9UED8	Missense_Mutation	SNP	ENST00000345317.2	37	CCDS5400.1	.	.	.	.	.	.	.	.	.	.	G	17.16	3.319068	0.60524	.	.	ENSG00000005020	ENST00000345317;ENST00000539623;ENST00000535331	T;T	0.11277	2.79;2.79	6.03	6.03	0.97812	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.141470	0.64402	D	0.000004	T	0.25158	0.0611	L	0.31804	0.96	0.46586	D	0.999119	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.996	T	0.00389	-1.1770	10	0.39692	T	0.17	-17.1783	20.5666	0.99351	0.0:0.0:1.0:0.0	.	185;200	B7Z5N4;O75563	.;SKAP2_HUMAN	R	200;28;185	ENSP00000005587:T200R;ENSP00000443593:T28R	ENSP00000005587:T200R	T	-	2	0	SKAP2	26732126	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	6.778000	0.75043	2.854000	0.98071	0.655000	0.94253	ACA	.		0.318	SKAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214128.1		
NME8	51314	broad.mit.edu	37	7	37927910	37927910	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr7:37927910C>T	ENST00000199447.4	+	15	1651	c.1279C>T	c.(1279-1281)Ccg>Tcg	p.P427S	EPDR1_ENST00000476620.1_Intron|NME8_ENST00000440017.1_Missense_Mutation_p.P427S	NM_016616.4	NP_057700.3	Q8N427	TXND3_HUMAN	NME/NM23 family member 8	427	NDK 2.				cell differentiation (GO:0030154)|cell redox homeostasis (GO:0045454)|CTP biosynthetic process (GO:0006241)|GTP biosynthetic process (GO:0006183)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)|UTP biosynthetic process (GO:0006228)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)										GGACAGTTTGCCGGTCAACCA	0.368																																					p.P427S													.	.	0			c.C1279T						.						98.0	96.0	96.0					7																	37927910		2203	4300	6503	SO:0001583	missense	51314	exon15			AGTTTGCCGGTCA	AF202051	CCDS5452.1	7p15.2	2012-05-18	2012-05-18	2012-05-18	ENSG00000086288	ENSG00000086288			16473	protein-coding gene	gene with protein product	"""sperm-specific thioredoxin 2"""	607421	"""thioredoxin domain containing 3 (spermatozoa)"""	TXNDC3		11737268, 11768308, 19852809	Standard	NM_016616		Approved	CILD6, SPTRX2, NM23-H8	uc003tfn.3	Q8N427	OTTHUMG00000023716	ENST00000199447.4:c.1279C>T	7.37:g.37927910C>T	ENSP00000199447:p.Pro427Ser	148	0		141	4	NM_016616	0	0	1	1	0	Q9NZH1	Missense_Mutation	SNP	ENST00000199447.4	37	CCDS5452.1	.	.	.	.	.	.	.	.	.	.	C	12.65	2.001785	0.35320	.	.	ENSG00000086288	ENST00000199447;ENST00000440017	T;T	0.52057	0.68;0.68	4.42	4.42	0.53409	.	0.957326	0.08619	N	0.918683	T	0.55721	0.1938	L	0.43554	1.36	0.32934	D	0.517549	P	0.38677	0.642	P	0.51550	0.673	T	0.54091	-0.8345	10	0.34782	T	0.22	-13.8286	12.7452	0.57278	0.0:0.8337:0.1663:0.0	.	427	Q8N427	TXND3_HUMAN	S	427	ENSP00000199447:P427S;ENSP00000397063:P427S	ENSP00000199447:P427S	P	+	1	0	TXNDC3	37894435	0.562000	0.26586	0.835000	0.33067	0.035000	0.12851	2.365000	0.44196	2.758000	0.94735	0.563000	0.77884	CCG	.		0.368	NME8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219946.1	NM_016616	
PTPRZ1	5803	broad.mit.edu	37	7	121652844	121652844	+	Silent	SNP	T	T	C			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr7:121652844T>C	ENST00000393386.2	+	12	4155	c.3744T>C	c.(3742-3744)ccT>ccC	p.P1248P	PTPRZ1_ENST00000483028.1_Intron|PTPRZ1_ENST00000449182.1_Intron	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	1248					axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						ATGTGTCGCCTACTTCTCATA	0.368																																					p.P1248P													.	PTPRZ1-699	0			c.T3744C						.						138.0	138.0	138.0					7																	121652844		2203	4300	6503	SO:0001819	synonymous_variant	5803	exon12			GTCGCCTACTTCT	M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.3744T>C	7.37:g.121652844T>C		331	0		274	4	NM_002851	0	0	0	0	0	A4D0W5|C9JFM0|O76043|Q9UDR6	Silent	SNP	ENST00000393386.2	37	CCDS34740.1																																																																																			.		0.368	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347288.1	NM_002851	
INSIG1	3638	hgsc.bcm.edu	37	7	155090012	155090012	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr7:155090012A>C	ENST00000340368.4	+	2	228	c.17A>C	c.(16-18)gAc>gCc	p.D6A	INSIG1_ENST00000344756.4_Missense_Mutation_p.D6A|AC144652.1_ENST00000609974.1_lincRNA|INSIG1_ENST00000342407.5_Missense_Mutation_p.D6A	NM_005542.4	NP_005533.2	O15503	INSI1_HUMAN	insulin induced gene 1	6					cell proliferation (GO:0008283)|cholesterol biosynthetic process (GO:0006695)|cranial suture morphogenesis (GO:0060363)|inner ear morphogenesis (GO:0042472)|metabolic process (GO:0008152)|middle ear morphogenesis (GO:0042474)|negative regulation of cargo loading into COPII-coated vesicle (GO:1901303)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of steroid biosynthetic process (GO:0010894)|palate development (GO:0060021)|small molecule metabolic process (GO:0044281)|SREBP signaling pathway (GO:0032933)|triglyceride metabolic process (GO:0006641)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|SREBP-SCAP-Insig complex (GO:0032937)				endometrium(2)|kidney(2)|large_intestine(1)|lung(11)|prostate(1)|upper_aerodigestive_tract(2)	19	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		AGATTGCACGACCACTTCTGG	0.652																																					p.D6A		.											.	INSIG1-90	0			c.A17C						.						8.0	10.0	9.0					7																	155090012		2175	4239	6414	SO:0001583	missense	3638	exon2			TGCACGACCACTT		CCDS5938.1, CCDS5939.1	7q36	2008-07-18			ENSG00000186480	ENSG00000186480			6083	protein-coding gene	gene with protein product	"""INSIG-1 membrane protein"""	602055				9268630	Standard	NM_005542		Approved	CL-6, MGC1405	uc003wly.3	O15503	OTTHUMG00000151330	ENST00000340368.4:c.17A>C	7.37:g.155090012A>C	ENSP00000344741:p.Asp6Ala	8	1		19	4	NM_198337	0	0	4	5	1	A4D2N1|A8K6L0|Q53XW8|Q9BUV5	Missense_Mutation	SNP	ENST00000340368.4	37	CCDS5938.1	.	.	.	.	.	.	.	.	.	.	A	16.55	3.154191	0.57259	.	.	ENSG00000186480	ENST00000340368;ENST00000344756;ENST00000425172;ENST00000342407	T;T;T;T	0.54479	0.64;0.57;0.71;0.67	4.16	3.0	0.34707	.	0.365887	0.29684	N	0.011466	T	0.40619	0.1124	L	0.46157	1.445	0.23747	N	0.996956	B;B;B	0.34103	0.419;0.437;0.075	B;B;B	0.30572	0.117;0.115;0.04	T	0.35525	-0.9785	10	0.66056	D	0.02	.	6.695	0.23193	0.7991:0.0:0.2009:0.0	.	6;6;6	F5H6P3;A4D2N1;O15503	.;.;INSI1_HUMAN	A	6	ENSP00000344741:D6A;ENSP00000340010:D6A;ENSP00000414691:D6A;ENSP00000344035:D6A	ENSP00000344741:D6A	D	+	2	0	INSIG1	154720945	0.986000	0.35501	0.996000	0.52242	0.790000	0.44656	2.698000	0.47068	0.483000	0.27608	0.397000	0.26171	GAC	.		0.652	INSIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322244.3	NM_198336	
EPPK1	83481	broad.mit.edu	37	8	144940741	144940741	+	Silent	SNP	C	C	T			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr8:144940741C>T	ENST00000525985.1	-	2	6752	c.6681G>A	c.(6679-6681)gcG>gcA	p.A2227A				P58107	EPIPL_HUMAN	epiplakin 1	2227						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CCAGGACGCCCGCGATGCAGC	0.677																																					p.A2227A													.	EPPK1-25	0			c.G6681A						.						76.0	80.0	78.0					8																	144940741		2150	4229	6379	SO:0001819	synonymous_variant	83481	exon1			GACGCCCGCGATG	AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.6681G>A	8.37:g.144940741C>T		146	0		133	4	NM_031308	0	0	2	2	0	Q76E58|Q9NSU9	Silent	SNP	ENST00000525985.1	37																																																																																				.		0.677	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382675.1	NM_031308	
KIAA2026	158358	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	5922386	5922386	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr9:5922386T>G	ENST00000399933.3	-	8	3609	c.3610A>C	c.(3610-3612)Agc>Cgc	p.S1204R	KIAA2026_ENST00000381461.2_Missense_Mutation_p.S1174R	NM_001017969.2	NP_001017969.2	Q5HYC2	K2026_HUMAN	KIAA2026	1204										breast(6)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(1)	46		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		TCACTCTGGCTAGTCTTAACT	0.453																																					p.S1204R		.											.	KIAA2026-92	0			c.A3610C						.						115.0	112.0	113.0					9																	5922386		2013	4183	6196	SO:0001583	missense	158358	exon8			TCTGGCTAGTCTT	AB095946		9p24.1	2014-01-10			ENSG00000183354	ENSG00000183354			23378	protein-coding gene	gene with protein product							Standard	NM_001017969		Approved	FLJ20375	uc003zjq.4	Q5HYC2	OTTHUMG00000019507	ENST00000399933.3:c.3610A>C	9.37:g.5922386T>G	ENSP00000382815:p.Ser1204Arg	115	0		97	32	NM_001017969	0	0	1	3	2	A8MTP2|B9EGW7|Q4VXA2|Q8IVE5	Missense_Mutation	SNP	ENST00000399933.3	37		.	.	.	.	.	.	.	.	.	.	T	14.67	2.603738	0.46423	.	.	ENSG00000183354	ENST00000399933;ENST00000381461	.	.	.	4.99	4.99	0.66335	.	0.365571	0.26975	N	0.021550	T	0.30665	0.0772	L	0.27053	0.805	0.28046	N	0.933557	P	0.35908	0.527	B	0.35470	0.203	T	0.32214	-0.9915	9	0.62326	D	0.03	-2.703	11.277	0.49172	0.1362:0.0:0.0:0.8638	.	1204	Q5HYC2	K2026_HUMAN	R	1204;1174	.	ENSP00000370870:S1174R	S	-	1	0	KIAA2026	5912386	0.984000	0.35163	0.997000	0.53966	0.663000	0.39108	3.354000	0.52254	2.102000	0.63906	0.454000	0.30748	AGC	.		0.453	KIAA2026-002	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051652.2	NM_001017969	
GTF3C5	9328	broad.mit.edu	37	9	135919313	135919313	+	Splice_Site	SNP	G	G	A			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr9:135919313G>A	ENST00000372097.5	+	3	895	c.572G>A	c.(571-573)cGg>cAg	p.R191Q	GTF3C5_ENST00000372095.5_Splice_Site_p.R66Q|GTF3C5_ENST00000485692.1_3'UTR|GTF3C5_ENST00000372108.5_Splice_Site_p.R191Q|GTF3C5_ENST00000342018.8_Splice_Site_p.R191Q|GTF3C5_ENST00000372099.6_Splice_Site_p.R182Q	NM_012087.3	NP_036219.2	Q9Y5Q8	TF3C5_HUMAN	general transcription factor IIIC, polypeptide 5, 63kDa	191					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	nucleoplasm (GO:0005654)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			endometrium(5)|kidney(1)|large_intestine(7)|lung(6)|pancreas(1)|prostate(1)	21				OV - Ovarian serous cystadenocarcinoma(145;4.01e-06)|Epithelial(140;4e-05)		ACCCAGCACCGGTAAGGCCCC	0.622																																					p.R191Q													.	GTF3C5-90	0			c.G572A						.						46.0	51.0	49.0					9																	135919313		2203	4300	6503	SO:0001630	splice_region_variant	9328	exon3			AGCACCGGTAAGG	AF133124	CCDS6958.1, CCDS48050.1, CCDS75927.1	9q34.13	2010-03-23	2002-08-29		ENSG00000148308	ENSG00000148308		"""General transcription factors"""	4668	protein-coding gene	gene with protein product	"""transcription factor IIIC, 63 kD"""	604890	"""general transcription factor IIIC, polypeptide 5 (63kD)"""			10373544	Standard	NM_012087		Approved	TFiiiC2-63, TFIIIC63, TFIIICepsilon	uc004ccj.4	Q9Y5Q8	OTTHUMG00000020856	ENST00000372097.5:c.572+1G>A	9.37:g.135919313G>A		116	0		124	3	NM_012087	0	0	1	1	0	A6NI44|A6NJB9|Q5T7U2|Q5T7U3|Q8N2U7|Q8N857|Q96GD9|Q9H4P2	Missense_Mutation	SNP	ENST00000372097.5	37	CCDS6958.1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.707924	0.89018	.	.	ENSG00000148308	ENST00000372097;ENST00000440319;ENST00000372099;ENST00000372095;ENST00000372089;ENST00000372108;ENST00000342018;ENST00000439697	T;T;T;T	0.45668	0.9;0.9;0.89;0.9	4.98	4.98	0.66077	.	0.262185	0.34314	N	0.004064	T	0.60314	0.2259	M	0.62723	1.935	0.47276	D	0.999371	D;D;D	0.76494	0.995;0.997;0.999	P;P;D	0.65874	0.828;0.809;0.939	T	0.58769	-0.7578	10	0.36615	T	0.2	0.7009	17.2419	0.87015	0.0:0.0:1.0:0.0	.	66;191;191	B7Z1V3;Q9Y5Q8-3;Q9Y5Q8	.;.;TF3C5_HUMAN	Q	191;144;182;66;41;191;191;66	ENSP00000361169:R191Q;ENSP00000361171:R182Q;ENSP00000361180:R191Q;ENSP00000339530:R191Q	ENSP00000339530:R191Q	R	+	2	0	GTF3C5	134909134	1.000000	0.71417	1.000000	0.80357	0.860000	0.49131	4.436000	0.59948	2.282000	0.76494	0.563000	0.77884	CGG	.		0.622	GTF3C5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054826.1	NM_001122823	Missense_Mutation
DUSP12	11266	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	161726704	161726704	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr1:161726704delG	ENST00000367943.4	+	6	1022	c.990delG	c.(988-990)ttgfs	p.L330fs		NM_007240.1	NP_009171.1	Q9UNI6	DUS12_HUMAN	dual specificity phosphatase 12	330					cellular protein modification process (GO:0006464)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of glucokinase activity (GO:0033133)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|lung(1)	5	all_hematologic(112;0.0359)		BRCA - Breast invasive adenocarcinoma(70;0.00634)			TGAAAATATTGCCTGTTTTGG	0.373																																					p.L330fs		.											.	DUSP12-226	0			c.990delG						.																																			SO:0001589	frameshift_variant	11266	exon6			.	AF119226	CCDS1234.1	1q21-q22	2011-06-09			ENSG00000081721	ENSG00000081721		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	3067	protein-coding gene	gene with protein product	"""serine/threonine specific protein phosphatase"", ""YVH1 protein-tyrosine phosphatase (S. cerevisiae) ortholog"""	604835				10446167	Standard	XM_005244862		Approved	YVH1, DUSP1	uc001gbo.3	Q9UNI6	OTTHUMG00000034540	ENST00000367943.4:c.990delG	1.37:g.161726704delG	ENSP00000356920:p.Leu330fs	82	0		68	23	NM_007240	0	0	0	0	0	Q5VXA8	Frame_Shift_Del	DEL	ENST00000367943.4	37	CCDS1234.1																																																																																			.		0.373	DUSP12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083588.1	NM_007240	
NF2	4771	broad.mit.edu	37	22	30000023	30000024	+	Frame_Shift_Del	DEL	CT	CT	-	rs371800843		TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	CT	CT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr22:30000023_30000024delCT	ENST00000338641.4	+	1	477_478	c.36_37delCT	c.(34-39)agctctfs	p.SS12fs	NF2_ENST00000403999.3_Frame_Shift_Del_p.SS12fs|NF2_ENST00000334961.7_Frame_Shift_Del_p.SS12fs|NF2_ENST00000361452.4_Frame_Shift_Del_p.SS12fs|NF2_ENST00000397789.3_Frame_Shift_Del_p.SS12fs|NF2_ENST00000413209.2_Frame_Shift_Del_p.SS12fs|NF2_ENST00000361166.4_Frame_Shift_Del_p.SS12fs|NF2_ENST00000347330.5_Frame_Shift_Del_p.SS12fs|NF2_ENST00000361676.4_Frame_Shift_Del_p.SS12fs|NF2_ENST00000353887.4_Frame_Shift_Del_p.SS12fs|NF2_ENST00000403435.1_Frame_Shift_Del_p.SS12fs	NM_000268.3|NM_016418.5|NM_181832.2	NP_000259.1|NP_057502.2|NP_861970.1	P35240	MERL_HUMAN	neurofibromin 2 (merlin)	12					actin cytoskeleton organization (GO:0030036)|cell-cell junction organization (GO:0045216)|ectoderm development (GO:0007398)|hippocampus development (GO:0021766)|lens fiber cell differentiation (GO:0070306)|mesoderm formation (GO:0001707)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of DNA replication (GO:0008156)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|negative regulation of tyrosine phosphorylation of Stat5 protein (GO:0042524)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of cell differentiation (GO:0045597)|positive regulation of stress fiber assembly (GO:0051496)|regulation of hippo signaling (GO:0035330)|regulation of neural precursor cell proliferation (GO:2000177)|regulation of protein localization to nucleus (GO:1900180)|regulation of protein stability (GO:0031647)|Schwann cell proliferation (GO:0014010)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|cleavage furrow (GO:0032154)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|early endosome (GO:0005769)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)		p.L14fs*34(2)|p.?(1)|p.S13fs*10(1)		NS(1)|bone(2)|breast(5)|central_nervous_system(21)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(17)|large_intestine(9)|liver(1)|lung(9)|meninges(372)|ovary(2)|pituitary(1)|pleura(9)|prostate(1)|skin(7)|soft_tissue(303)|stomach(2)|thyroid(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	776						TGAGCTTCAGCTCTCTCAAGAG	0.663			"""D, Mis, N, F, S, O"""		"""meningioma, acoustic neuroma, renal """	"""meningioma, acoustic neuroma"""			Neurofibromatosis, type 2																												p.12_13del			yes	Rec	yes	Neurofibromatosis type 2	22	22q12.2	4771	neurofibromatosis type 2 gene		O	.	NF2-4696	4	Deletion - Frameshift(3)|Unknown(1)	meninges(2)|lung(1)|soft_tissue(1)	c.36_37del						.																																			SO:0001589	frameshift_variant	4771	exon1	Familial Cancer Database	NF2, Central Neurofibromatosis, Bilateral Acoustic Neurofibromatosis	CTTCAGCTCTCTC	L11353	CCDS13861.1, CCDS13862.1, CCDS13863.1, CCDS13864.1, CCDS13865.1, CCDS54516.1	22q12.2	2014-09-17	2007-12-17		ENSG00000186575	ENSG00000186575		"""A-kinase anchor proteins"""	7773	protein-coding gene	gene with protein product	"""moesin-ezrin-radixin like"", ""schwannomin"""	607379	"""neurofibromin 2 (bilateral acoustic neuroma)"""			10591208	Standard	NM_000268		Approved	merlin	uc003age.4	P35240	OTTHUMG00000030727	ENST00000338641.4:c.36_37delCT	22.37:g.30000027_30000028delCT	ENSP00000344666:p.Ser12fs	16	0		11	5	NM_181831	0	0	0	0	0	O95683|Q8WUJ2|Q969N0|Q969Q3|Q96T30|Q96T31|Q96T32|Q96T33|Q9BTW3|Q9UNG9|Q9UNH3|Q9UNH4	Frame_Shift_Del	DEL	ENST00000338641.4	37	CCDS13861.1																																																																																			.		0.663	NF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075615.3	NM_000268	
KCNJ4	3761	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	22	38823432	38823433	+	In_Frame_Ins	INS	-	-	GGA			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr22:38823432_38823433insGGA	ENST00000303592.3	-	2	963_964	c.705_706insTCC	c.(703-708)ctgccc>ctgTCCccc	p.235_236LP>LSP	RP3-434P1.6_ENST00000433230.1_RNA	NM_004981.1|NM_152868.2	NP_004972.1|NP_690607.1	P48050	KCNJ4_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 4	235					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|voltage-gated potassium channel complex (GO:0008076)	inward rectifier potassium channel activity (GO:0005242)|PDZ domain binding (GO:0030165)			endometrium(7)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	23	Melanoma(58;0.0286)					TGGTCCAGGGGCAGGTACTCGC	0.629																																					p.P236delinsSP		.											.	KCNJ4-90	0			c.706_707insTCC						.																																			SO:0001652	inframe_insertion	3761	exon2			.	U07364	CCDS13971.1	22q13.1	2011-07-05			ENSG00000168135	ENSG00000168135		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6265	protein-coding gene	gene with protein product		600504				8016146, 16382105	Standard	NM_152868		Approved	Kir2.3, HIR, HRK1, hIRK2, IRK3	uc003avs.1	P48050	OTTHUMG00000151131	ENST00000303592.3:c.705_706insTCC	22.37:g.38823432_38823433insGGA	ENSP00000306497:p.Leu235_Pro236insSer	72	0		54	13	NM_004981	0	0	0	0	0	Q14D44	In_Frame_Ins	INS	ENST00000303592.3	37	CCDS13971.1																																																																																			.		0.629	KCNJ4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321447.1	NM_004981	
