#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ZMYM1	79830	broad.mit.edu	37	1	35579564	35579564	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7055-01A-11D-1961-08	TCGA-BQ-7055-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	69910e4a-5f3a-49c8-9c58-5f5fc0b4625a	1a7e89d4-822a-4ca2-b6e3-e3114990152b	g.chr1:35579564A>G	ENST00000373330.1	+	11	2307	c.2133A>G	c.(2131-2133)atA>atG	p.I711M	ZMYM1_ENST00000359858.4_Missense_Mutation_p.I711M|ZMYM1_ENST00000373329.1_3'UTR			Q5SVZ6	ZMYM1_HUMAN	zinc finger, MYM-type 1	711						nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(5)|lung(8)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				TGGATAAAATACATGGCCAGG	0.353																																					p.I711M													.	ZMYM1-90	0			c.A2133G						.						69.0	66.0	67.0					1																	35579564		1840	4090	5930	SO:0001583	missense	79830	exon10			TAAAATACATGGC	AK096206	CCDS41302.1	1p34.3	2008-05-02	2005-09-12		ENSG00000197056	ENSG00000197056		"""Zinc fingers, MYM type"""	26253	protein-coding gene	gene with protein product			"""zinc finger, MYM domain containing 1"""			12477932	Standard	XM_005271216		Approved	FLJ23151, MYM	uc001bym.3	Q5SVZ6	OTTHUMG00000004374	ENST00000373330.1:c.2133A>G	1.37:g.35579564A>G	ENSP00000362427:p.Ile711Met	64	0		27	3	NM_024772	0	0	2	2	0	D3DPR7|Q7Z3Q4	Missense_Mutation	SNP	ENST00000373330.1	37	CCDS41302.1	.	.	.	.	.	.	.	.	.	.	A	5.170	0.216892	0.09810	.	.	ENSG00000197056	ENST00000359858;ENST00000373329;ENST00000373330	T;T;T	0.26518	1.73;1.73;1.73	4.24	1.87	0.25490	Ribonuclease H-like (1);	0.336982	0.25836	N	0.027985	T	0.39989	0.1099	L	0.61387	1.9	0.09310	N	1	D;D	0.76494	0.999;0.997	D;D	0.87578	0.998;0.996	T	0.10359	-1.0633	9	.	.	.	-8.2445	4.7047	0.12844	0.7354:0.0:0.096:0.1686	.	692;711	B4DSJ9;Q5SVZ6	.;ZMYM1_HUMAN	M	711;636;711	ENSP00000352920:I711M;ENSP00000362426:I636M;ENSP00000362427:I711M	.	I	+	3	3	ZMYM1	35352151	0.031000	0.19500	0.031000	0.17742	0.009000	0.06853	0.443000	0.21644	0.395000	0.25257	0.455000	0.32223	ATA	.		0.353	ZMYM1-001	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012705.1	NM_024772	
CPSF7	79869	broad.mit.edu	37	11	61183647	61183647	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-7055-01A-11D-1961-08	TCGA-BQ-7055-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	69910e4a-5f3a-49c8-9c58-5f5fc0b4625a	1a7e89d4-822a-4ca2-b6e3-e3114990152b	g.chr11:61183647G>T	ENST00000394888.4	-	6	1067	c.895C>A	c.(895-897)Cca>Aca	p.P299T	CPSF7_ENST00000439958.3_Missense_Mutation_p.P290T|CPSF7_ENST00000448745.1_Missense_Mutation_p.P290T|CPSF7_ENST00000340437.4_Missense_Mutation_p.P342T	NM_001136040.2	NP_001129512.1	Q8N684	CPSF7_HUMAN	cleavage and polyadenylation specific factor 7, 59kDa	299	Pro-rich.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA splicing, via spliceosome (GO:0000398)|protein tetramerization (GO:0051262)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)|mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(5)|skin(2)|upper_aerodigestive_tract(1)	22						GTAGCGTTTGGTGGGGGGAAG	0.557																																					p.P342T													.	CPSF7-90	0			c.C1024A						.						59.0	65.0	63.0					11																	61183647		2202	4298	6500	SO:0001583	missense	79869	exon6			CGTTTGGTGGGGG		CCDS8006.2, CCDS44619.1, CCDS44620.1	11q12.2	2013-06-18			ENSG00000149532	ENSG00000149532		"""RNA binding motif (RRM) containing"""	30098	protein-coding gene	gene with protein product	"""pre mRNA cleavage factor I, 59 kDa subunit"", ""cleavage factor Im complex 59 kDa subunit"""					12477932	Standard	NM_024811		Approved	FLJ12529	uc001nrp.3	Q8N684	OTTHUMG00000168198	ENST00000394888.4:c.895C>A	11.37:g.61183647G>T	ENSP00000378352:p.Pro299Thr	173	0		168	6	NM_024811	0	0	27	28	1	B3KU04|C9K0Q4|Q7Z3H9|Q9H025|Q9H9V1	Missense_Mutation	SNP	ENST00000394888.4	37	CCDS44619.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.551345	0.86127	.	.	ENSG00000149532	ENST00000340437;ENST00000394888;ENST00000439958;ENST00000448745;ENST00000544147	D;D;D;D	0.87334	-2.24;-2.24;-2.24;-2.24	5.71	5.71	0.89125	.	0.287486	0.32819	N	0.005601	D	0.86810	0.6022	N	0.25890	0.77	0.80722	D	1	B;B;P;P	0.36438	0.418;0.418;0.553;0.553	B;B;P;P	0.48334	0.301;0.301;0.574;0.496	D	0.84301	0.0505	10	0.32370	T	0.25	-2.2755	19.4877	0.95037	0.0:0.0:1.0:0.0	.	290;299;342;290	B4DGF8;Q8N684;Q8N684-3;Q8N684-2	.;CPSF7_HUMAN;.;.	T	342;299;290;290;65	ENSP00000345412:P342T;ENSP00000378352:P299T;ENSP00000397203:P290T;ENSP00000407394:P290T	ENSP00000345412:P342T	P	-	1	0	CPSF7	60940223	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.408000	0.90221	2.686000	0.91538	0.650000	0.86243	CCA	.		0.557	CPSF7-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347835.2	NM_024811	
PYGM	5837	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	64522811	64522811	+	Silent	SNP	G	G	A			TCGA-BQ-7055-01A-11D-1961-08	TCGA-BQ-7055-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	69910e4a-5f3a-49c8-9c58-5f5fc0b4625a	1a7e89d4-822a-4ca2-b6e3-e3114990152b	g.chr11:64522811G>A	ENST00000164139.3	-	7	1187	c.789C>T	c.(787-789)taC>taT	p.Y263Y	PYGM_ENST00000377432.3_Silent_p.Y175Y	NM_005609.2	NP_005600.1	P11217	PYGM_HUMAN	phosphorylase, glycogen, muscle	263					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	glycogen phosphorylase activity (GO:0008184)|nucleotide binding (GO:0000166)|pyridoxal phosphate binding (GO:0030170)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(21)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						CAGCCTGGATGTAGCCACCGA	0.617																																					p.Y263Y		.											.	PYGM-92	0			c.C789T						.						119.0	118.0	118.0					11																	64522811		2201	4297	6498	SO:0001819	synonymous_variant	5837	exon7			CTGGATGTAGCCA		CCDS8079.1, CCDS53659.1	11q12-q13.2	2013-03-01	2008-07-31		ENSG00000068976	ENSG00000068976	2.4.1.1	"""Glycogen phosphorylases"""	9726	protein-coding gene	gene with protein product	"""McArdle syndrome"", ""glycogen storage disease type V"", ""glycogen phosphorylase, muscle form"""	608455	"""phosphorylase, glycogen; muscle"""				Standard	NM_005609		Approved		uc001oax.4	P11217	OTTHUMG00000066835	ENST00000164139.3:c.789C>T	11.37:g.64522811G>A		216	1		211	11	NM_005609	0	0	2	2	0	A0AVK1|A6NDY6	Silent	SNP	ENST00000164139.3	37	CCDS8079.1																																																																																			.		0.617	PYGM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143254.2	NM_005609	
CRY1	1407	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	107399011	107399011	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7055-01A-11D-1961-08	TCGA-BQ-7055-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	69910e4a-5f3a-49c8-9c58-5f5fc0b4625a	1a7e89d4-822a-4ca2-b6e3-e3114990152b	g.chr12:107399011T>C	ENST00000008527.5	-	3	1150	c.283A>G	c.(283-285)Aaa>Gaa	p.K95E		NM_004075.4	NP_004066.1	Q16526	CRY1_HUMAN	cryptochrome circadian clock 1	95	Photolyase/cryptochrome alpha/beta.				blue light signaling pathway (GO:0009785)|circadian regulation of gene expression (GO:0032922)|DNA damage induced protein phosphorylation (GO:0006975)|DNA repair (GO:0006281)|entrainment of circadian clock by photoperiod (GO:0043153)|gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|lipid storage (GO:0019915)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of glucocorticoid secretion (GO:2000850)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein-chromophore linkage (GO:0018298)|regulation of circadian rhythm (GO:0042752)|regulation of DNA damage checkpoint (GO:2000001)|response to glucagon (GO:0033762)|response to insulin (GO:0032868)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	blue light photoreceptor activity (GO:0009882)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|DNA photolyase activity (GO:0003913)|double-stranded DNA binding (GO:0003690)|nuclear hormone receptor binding (GO:0035257)|nucleotide binding (GO:0000166)|phosphatase binding (GO:0019902)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin binding (GO:0043130)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(3)|skin(1)	29						ATTGAAAGTTTAGTAATGTTC	0.343																																					p.K95E		.											.	CRY1-93	0			c.A283G						.						137.0	132.0	134.0					12																	107399011		2203	4300	6503	SO:0001583	missense	1407	exon3			AAAGTTTAGTAAT	BC030519	CCDS9112.1	12q23-q24.1	2014-01-17	2014-01-17		ENSG00000008405	ENSG00000008405			2384	protein-coding gene	gene with protein product		601933	"""cryptochrome 1 (photolyase-like)"""	PHLL1		8921389	Standard	NM_004075		Approved		uc001tmi.4	Q16526	OTTHUMG00000170005	ENST00000008527.5:c.283A>G	12.37:g.107399011T>C	ENSP00000008527:p.Lys95Glu	149	0		167	64	NM_004075	0	0	2	4	2		Missense_Mutation	SNP	ENST00000008527.5	37	CCDS9112.1	.	.	.	.	.	.	.	.	.	.	T	15.48	2.847284	0.51164	.	.	ENSG00000008405	ENST00000008527	.	.	.	5.61	5.61	0.85477	Rossmann-like alpha/beta/alpha sandwich fold (1);DNA photolyase, N-terminal (2);	0.160218	0.53938	D	0.000048	T	0.54319	0.1851	L	0.49640	1.575	0.41632	D	0.989029	B	0.19073	0.033	B	0.19666	0.026	T	0.52472	-0.8571	9	0.06757	T	0.87	-12.0027	15.8086	0.78538	0.0:0.0:0.0:1.0	.	95	Q16526	CRY1_HUMAN	E	95	.	ENSP00000008527:K95E	K	-	1	0	CRY1	105923141	1.000000	0.71417	0.996000	0.52242	0.955000	0.61496	5.296000	0.65698	2.147000	0.66899	0.477000	0.44152	AAA	.		0.343	CRY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406827.1	NM_004075	
HNRNPM	4670	ucsc.edu	37	19	8527467	8527467	+	Splice_Site	SNP	T	T	G			TCGA-BQ-7055-01A-11D-1961-08	TCGA-BQ-7055-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	69910e4a-5f3a-49c8-9c58-5f5fc0b4625a	1a7e89d4-822a-4ca2-b6e3-e3114990152b	g.chr19:8527467T>G	ENST00000325495.4	+	3	377		c.e3+2		HNRNPM_ENST00000348943.3_Splice_Site	NM_005968.4	NP_005959.2	P52272	HNRPM_HUMAN	heterogeneous nuclear ribonucleoprotein M						alternative mRNA splicing, via spliceosome (GO:0000380)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|paraspeckles (GO:0042382)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|RNA binding (GO:0003723)			endometrium(5)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)	25						AAGTCAAGGGTAAGTGTCTGA	0.428																																					.													.	HNRNPM-68	0			c.336+2T>G						.						241.0	220.0	227.0					19																	8527467		2203	4300	6503	SO:0001630	splice_region_variant	4670	exon3			CAAGGGTAAGTGT	L03532	CCDS12203.1, CCDS12204.1	19p13.2	2013-06-12		2008-04-18	ENSG00000099783	ENSG00000099783		"""RNA binding motif (RRM) containing"""	5046	protein-coding gene	gene with protein product	"""CEA receptor"""	160994		NAGR1, HNRPM		8441656, 7558047	Standard	NM_005968		Approved	HTGR1, HNRNPM4, HNRPM4, CEAR	uc010dwe.3	P52272	OTTHUMG00000182383	ENST00000325495.4:c.336+2T>G	19.37:g.8527467T>G		159	2		145	2	NM_031203	0	0	1	1	0	Q15584|Q8WZ44|Q96H56|Q9BWL9|Q9Y492	Splice_Site	SNP	ENST00000325495.4	37	CCDS12203.1	.	.	.	.	.	.	.	.	.	.	T	18.24	3.580056	0.65992	.	.	ENSG00000099783	ENST00000325495;ENST00000348943	.	.	.	5.82	5.82	0.92795	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.0018	0.71479	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	HNRNPM	8433467	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.698000	0.84413	2.225000	0.72522	0.459000	0.35465	.	.		0.428	HNRNPM-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460894.1		Intron
ZNF181	339318	hgsc.bcm.edu	37	19	35232372	35232372	+	Silent	SNP	A	A	G	rs2607244		TCGA-BQ-7055-01A-11D-1961-08	TCGA-BQ-7055-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	69910e4a-5f3a-49c8-9c58-5f5fc0b4625a	1a7e89d4-822a-4ca2-b6e3-e3114990152b	g.chr19:35232372A>G	ENST00000492450.1	+	4	1175	c.1086A>G	c.(1084-1086)tcA>tcG	p.S362S	ZNF181_ENST00000392232.3_Silent_p.S406S|ZNF181_ENST00000459757.2_Silent_p.S361S			Q2M3W8	ZN181_HUMAN	zinc finger protein 181	362					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(6)|kidney(2)|large_intestine(1)|lung(7)|ovary(2)|prostate(3)|skin(1)	22	all_lung(56;1.13e-07)|Lung NSC(56;1.81e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.138)			TTCATAGGTCATCTCTCATTC	0.398																																					p.S362S		.											.	ZNF181-91	0			c.A1086G						.						58.0	57.0	57.0					19																	35232372		2203	4300	6503	SO:0001819	synonymous_variant	339318	exon4			TAGGTCATCTCTC	BC104759, H54888	CCDS32990.2, CCDS46043.1	19q13.13	2013-01-08	2006-04-27		ENSG00000197841	ENSG00000197841		"""Zinc fingers, C2H2-type"", ""-"""	12971	protein-coding gene	gene with protein product		606741	"""zinc finger protein 181 (HHZ181)"""				Standard	NM_001029997		Approved	HHZ181, MGC44316	uc002nvu.3	Q2M3W8	OTTHUMG00000157508	ENST00000492450.1:c.1086A>G	19.37:g.35232372A>G		56	2		49	5	NM_001029997	0	0	11	11	0	B7ZKX3|Q49A75	Silent	SNP	ENST00000492450.1	37	CCDS32990.2																																																																																			A|1.000;|0.000		0.398	ZNF181-002	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349005.3	NM_001029997	
SYT3	84258	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	51135675	51135675	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7055-01A-11D-1961-08	TCGA-BQ-7055-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	69910e4a-5f3a-49c8-9c58-5f5fc0b4625a	1a7e89d4-822a-4ca2-b6e3-e3114990152b	g.chr19:51135675G>A	ENST00000338916.4	-	2	1175	c.542C>T	c.(541-543)cCg>cTg	p.P181L	SYT3_ENST00000544769.1_Missense_Mutation_p.P181L|SYT3_ENST00000600079.1_Missense_Mutation_p.P181L|SYT3_ENST00000593901.1_Missense_Mutation_p.P181L	NM_032298.2	NP_115674.1	Q9BQG1	SYT3_HUMAN	synaptotagmin III	181					calcium ion-dependent exocytosis (GO:0017156)|positive regulation of vesicle fusion (GO:0031340)|response to calcium ion (GO:0051592)	cell junction (GO:0030054)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	calcium-dependent phospholipid binding (GO:0005544)|metal ion binding (GO:0046872)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(2)|prostate(2)|skin(3)|urinary_tract(2)	35		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00462)|GBM - Glioblastoma multiforme(134;0.0188)		TGTTTGGCTCGGTTTGACCCC	0.657																																					p.P181L		.											.	SYT3-155	0			c.C542T						.						33.0	34.0	34.0					19																	51135675		2203	4300	6503	SO:0001583	missense	84258	exon2			TGGCTCGGTTTGA	AL136594	CCDS12798.1	19q13.33	2014-07-02			ENSG00000213023	ENSG00000213023		"""Synaptotagmins"""	11511	protein-coding gene	gene with protein product		600327				7749232	Standard	NM_032298		Approved		uc002psv.3	Q9BQG1	OTTHUMG00000183064	ENST00000338916.4:c.542C>T	19.37:g.51135675G>A	ENSP00000340914:p.Pro181Leu	71	0		74	23	NM_032298	0	0	0	0	0	Q8N5Z1|Q8N640	Missense_Mutation	SNP	ENST00000338916.4	37	CCDS12798.1	.	.	.	.	.	.	.	.	.	.	G	12.34	1.907284	0.33628	.	.	ENSG00000213023	ENST00000338916;ENST00000544769	T;T	0.54479	0.57;0.57	5.24	5.24	0.73138	.	0.715640	0.12228	U	0.487701	T	0.29355	0.0731	N	0.03608	-0.345	0.09310	N	0.999994	B	0.09022	0.002	B	0.04013	0.001	T	0.06110	-1.0845	10	0.49607	T	0.09	.	8.4467	0.32847	0.169:0.0:0.831:0.0	.	181	Q9BQG1	SYT3_HUMAN	L	181	ENSP00000340914:P181L;ENSP00000438883:P181L	ENSP00000340914:P181L	P	-	2	0	SYT3	55827487	0.978000	0.34361	0.974000	0.42286	0.996000	0.88848	3.207000	0.51106	2.605000	0.88082	0.655000	0.94253	CCG	.		0.657	SYT3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464910.1	NM_032298	
ZNF304	57343	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	57869057	57869057	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7055-01A-11D-1961-08	TCGA-BQ-7055-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	69910e4a-5f3a-49c8-9c58-5f5fc0b4625a	1a7e89d4-822a-4ca2-b6e3-e3114990152b	g.chr19:57869057G>A	ENST00000282286.5	+	3	1993	c.1820G>A	c.(1819-1821)aGg>aAg	p.R607K	ZNF304_ENST00000598744.1_Missense_Mutation_p.R565K|ZNF304_ENST00000443917.2_Missense_Mutation_p.R654K|ZNF304_ENST00000391705.3_Missense_Mutation_p.R607K			Q9HCX3	ZN304_HUMAN	zinc finger protein 304	607					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(1)	26		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0265)		CTGCACCAGAGGGTTCACACT	0.478																																					p.R607K		.											.	ZNF304-91	0			c.G1820A						.						84.0	81.0	82.0					19																	57869057		2203	4300	6503	SO:0001583	missense	57343	exon3			ACCAGAGGGTTCA	AJ276316	CCDS12950.1, CCDS74462.1	19q13.4	2013-01-08				ENSG00000131845		"""Zinc fingers, C2H2-type"", ""-"""	13505	protein-coding gene	gene with protein product		613840					Standard	XM_005259090		Approved		uc010ygw.2	Q9HCX3		ENST00000282286.5:c.1820G>A	19.37:g.57869057G>A	ENSP00000282286:p.Arg607Lys	90	0		106	23	NM_020657	0	0	4	5	1		Missense_Mutation	SNP	ENST00000282286.5	37	CCDS12950.1	.	.	.	.	.	.	.	.	.	.	G	19.37	3.814001	0.70912	.	.	ENSG00000131845	ENST00000282286;ENST00000391705;ENST00000443917	T;T;T	0.18338	2.22;2.22;2.22	3.89	1.75	0.24633	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.29126	0.0724	L	0.42744	1.35	0.23056	N	0.998366	P;D	0.58970	0.898;0.984	P;D	0.69142	0.483;0.962	T	0.07462	-1.0771	9	0.45353	T	0.12	.	9.2462	0.37527	0.1894:0.0:0.8106:0.0	.	607;654	Q9HCX3;E7EQD3	ZN304_HUMAN;.	K	607;607;654	ENSP00000282286:R607K;ENSP00000375586:R607K;ENSP00000401642:R654K	ENSP00000282286:R607K	R	+	2	0	ZNF304	62560869	0.892000	0.30473	0.763000	0.31416	0.981000	0.71138	5.266000	0.65525	0.600000	0.29862	0.650000	0.86243	AGG	.		0.478	ZNF304-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000465785.1		
TGFBRAP1	9392	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	105886051	105886051	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7055-01A-11D-1961-08	TCGA-BQ-7055-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	69910e4a-5f3a-49c8-9c58-5f5fc0b4625a	1a7e89d4-822a-4ca2-b6e3-e3114990152b	g.chr2:105886051G>A	ENST00000393359.2	-	11	2510	c.2084C>T	c.(2083-2085)gCg>gTg	p.A695V	TGFBRAP1_ENST00000258449.1_Missense_Mutation_p.A695V			Q8WUH2	TGFA1_HUMAN	transforming growth factor, beta receptor associated protein 1	695					intracellular protein transport (GO:0006886)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|membrane (GO:0016020)	SMAD binding (GO:0046332)|small GTPase regulator activity (GO:0005083)|transforming growth factor beta receptor binding (GO:0005160)			central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(11)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	31						GTCCTCGGCCGCTGCAAAGTC	0.657																																					p.A695V	Esophageal Squamous(183;794 2019 9730 21801 48859)	.											.	TGFBRAP1-91	0			c.C2084T						.						26.0	27.0	27.0					2																	105886051		2203	4300	6503	SO:0001583	missense	9392	exon11			TCGGCCGCTGCAA	AF022795	CCDS2067.1	2q12.1	2008-02-05			ENSG00000135966	ENSG00000135966			16836	protein-coding gene	gene with protein product		606237				9545258, 11278302	Standard	NM_001142621		Approved	TRAP-1, TRAP1	uc002tcr.4	Q8WUH2	OTTHUMG00000130809	ENST00000393359.2:c.2084C>T	2.37:g.105886051G>A	ENSP00000377027:p.Ala695Val	45	0		35	6	NM_004257	0	0	5	6	1	A8K5R7|D3DVJ8|O60466	Missense_Mutation	SNP	ENST00000393359.2	37	CCDS2067.1	.	.	.	.	.	.	.	.	.	.	G	18.44	3.625045	0.66901	.	.	ENSG00000135966	ENST00000393359;ENST00000258449;ENST00000543724	T;T	0.19806	2.12;2.12	5.54	4.64	0.57946	.	0.053015	0.85682	D	0.000000	T	0.49406	0.1555	M	0.86178	2.8	0.54753	D	0.999985	D;D	0.89917	1.0;0.992	D;D	0.68039	0.955;0.909	T	0.56098	-0.8035	10	0.46703	T	0.11	-29.6428	15.5761	0.76387	0.0:0.0:0.8611:0.1389	.	150;695	B3KMM9;Q8WUH2	.;TGFA1_HUMAN	V	695;695;150	ENSP00000377027:A695V;ENSP00000258449:A695V	ENSP00000258449:A695V	A	-	2	0	TGFBRAP1	105252483	1.000000	0.71417	0.404000	0.26397	0.158000	0.22134	9.470000	0.97683	1.293000	0.44690	0.462000	0.41574	GCG	.		0.657	TGFBRAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253354.2	NM_004257	
TTN	7273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	179659659	179659659	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-7055-01A-11D-1961-08	TCGA-BQ-7055-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	69910e4a-5f3a-49c8-9c58-5f5fc0b4625a	1a7e89d4-822a-4ca2-b6e3-e3114990152b	g.chr2:179659659C>T	ENST00000591111.1	-	7	1459	c.1235G>A	c.(1234-1236)gGt>gAt	p.G412D	TTN_ENST00000360870.5_Missense_Mutation_p.G412D|TTN_ENST00000342992.6_Missense_Mutation_p.G412D|TTN_ENST00000460472.2_Missense_Mutation_p.G412D|TTN_ENST00000359218.5_Missense_Mutation_p.G412D|TTN_ENST00000589042.1_Missense_Mutation_p.G412D|TTN_ENST00000342175.6_Missense_Mutation_p.G412D			Q8WZ42	TITIN_HUMAN	titin	0	Ala-rich.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTCTTTAGCACCAGTGGCAAC	0.493																																					p.G412D		.											.	TTN-636	0			c.G1235A						.						88.0	89.0	89.0					2																	179659659		2203	4300	6503	SO:0001583	missense	7273	exon7			TTAGCACCAGTGG	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.1235G>A	2.37:g.179659659C>T	ENSP00000465570:p.Gly412Asp	114	1		114	43	NM_001267550	0	0	0	0	0	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	C	11.70	1.717780	0.30413	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870;ENST00000436599	T;T;T;T;T;T	0.63580	-0.05;0.15;0.14;0.13;0.28;0.56	5.87	4.99	0.66335	.	.	.	.	.	T	0.60689	0.2288	M	0.66939	2.045	0.24546	N	0.994045	B;B;B;B;P	0.35628	0.049;0.049;0.049;0.049;0.513	B;B;B;B;B	0.29598	0.018;0.018;0.018;0.018;0.104	T	0.58912	-0.7552	9	0.87932	D	0	.	15.3811	0.74658	0.0:0.8613:0.1387:0.0	.	412;412;412;412;412	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	D	412;412;412;412;412;412;8	ENSP00000343764:G412D;ENSP00000434586:G412D;ENSP00000340554:G412D;ENSP00000352154:G412D;ENSP00000354117:G412D;ENSP00000405517:G8D	ENSP00000340554:G412D	G	-	2	0	TTN	179367904	0.004000	0.15560	0.087000	0.20705	0.026000	0.11368	-0.064000	0.11636	1.456000	0.47831	0.655000	0.94253	GGT	.		0.493	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
FRG1B	284802	broad.mit.edu	37	20	29628263	29628263	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7055-01A-11D-1961-08	TCGA-BQ-7055-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	69910e4a-5f3a-49c8-9c58-5f5fc0b4625a	1a7e89d4-822a-4ca2-b6e3-e3114990152b	g.chr20:29628263A>G	ENST00000278882.3	+	6	645	c.265A>G	c.(265-267)Att>Gtt	p.I89V	FRG1B_ENST00000439954.2_Missense_Mutation_p.I94V|FRG1B_ENST00000358464.4_Missense_Mutation_p.I89V			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	89								p.I89V(4)		endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						TAGCTGCTTTATTAGATGCAA	0.363																																					.													.	FRG1B-22	4	Substitution - Missense(4)	prostate(2)|kidney(2)	.						.																																			SO:0001583	missense	284802	.			TGCTTTATTAGAT			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.265A>G	20.37:g.29628263A>G	ENSP00000278882:p.Ile89Val	129	1		161	5	.	0	0	90	90	0	C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	a	8.196	0.797144	0.16327	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.44482	0.92	2.08	2.08	0.27032	Actin cross-linking (1);	0.052017	0.85682	D	0.000000	T	0.22666	0.0547	.	.	.	0.33862	D	0.633895	B;B	0.06786	0.0;0.001	B;B	0.20767	0.018;0.031	T	0.12041	-1.0563	9	0.22706	T	0.39	.	3.8663	0.09018	0.8139:0.0:0.1861:0.0	.	94;89	F5H5R5;Q9BZ01	.;FRG1B_HUMAN	V	89;94;89	ENSP00000408863:I94V	ENSP00000278882:I89V	I	+	1	0	FRG1B	28241924	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	4.345000	0.59360	1.208000	0.43306	0.347000	0.21830	ATT	.		0.363	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
MUC13	56667	broad.mit.edu	37	3	124632011	124632011	+	Silent	SNP	A	A	G			TCGA-BQ-7055-01A-11D-1961-08	TCGA-BQ-7055-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	69910e4a-5f3a-49c8-9c58-5f5fc0b4625a	1a7e89d4-822a-4ca2-b6e3-e3114990152b	g.chr3:124632011A>G	ENST00000311075.3	-	8	1196	c.1158T>C	c.(1156-1158)ccT>ccC	p.P386P		NM_033049.3	NP_149038	Q9H3R2	MUC13_HUMAN	mucin 13, cell surface associated	387	EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(6)|lung(5)|prostate(1)|skin(1)|stomach(1)	18						ACGCACACTCAGGGGCCCCAC	0.488																																					p.P386P													.	MUC13-90	0			c.T1158C						.						69.0	70.0	70.0					3																	124632011		2203	4300	6503	SO:0001819	synonymous_variant	56667	exon8			ACACTCAGGGGCC	AF286113		3q21.2	2007-01-17	2006-03-14		ENSG00000173702	ENSG00000173702		"""Mucins"""	7511	protein-coding gene	gene with protein product		612181	"""down-regulated in colon cancer 1"", ""mucin 13, epithelial transmembrane"""	DRCC1		11278439	Standard	NM_033049		Approved		uc003ehq.2	Q9H3R2	OTTHUMG00000159484	ENST00000311075.3:c.1158T>C	3.37:g.124632011A>G		84	1		81	4	NM_033049	0	0	0	0	0	Q6UWD9|Q9NXT5	Silent	SNP	ENST00000311075.3	37																																																																																				.		0.488	MUC13-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000355714.1	NM_033049	
DEFB114	245928	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	49931770	49931770	+	Silent	SNP	G	G	A			TCGA-BQ-7055-01A-11D-1961-08	TCGA-BQ-7055-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	69910e4a-5f3a-49c8-9c58-5f5fc0b4625a	1a7e89d4-822a-4ca2-b6e3-e3114990152b	g.chr6:49931770G>A	ENST00000322066.3	-	1	48	c.49C>T	c.(49-51)Cta>Tta	p.L17L		NM_001037499.1	NP_001032588.1	Q30KQ6	DB114_HUMAN	defensin, beta 114	17					defense response to bacterium (GO:0042742)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)	extracellular region (GO:0005576)	lipopolysaccharide binding (GO:0001530)			kidney(1)|large_intestine(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	8	Lung NSC(77;0.042)					TTACCTGGTAGAATGAAGGTC	0.284																																					p.L17L		.											.	DEFB114-91	0			c.C49T						.						69.0	68.0	68.0					6																	49931770		2202	4293	6495	SO:0001819	synonymous_variant	245928	exon1			CTGGTAGAATGAA	DQ012018	CCDS34474.1	6p12.3	2010-03-30			ENSG00000177684	ENSG00000177684		"""Defensins, beta"""	18095	protein-coding gene	gene with protein product		615243				11854508, 16033865	Standard	NM_001037499		Approved	DEFB-14	uc011dwp.2	Q30KQ6	OTTHUMG00000160209	ENST00000322066.3:c.49C>T	6.37:g.49931770G>A		71	0		60	11	NM_001037499	0	0	0	0	0	Q8NES9	Silent	SNP	ENST00000322066.3	37	CCDS34474.1																																																																																			.		0.284	DEFB114-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359665.1	NM_001037499	
SEPT7	989	hgsc.bcm.edu	37	7	35930362	35930362	+	Silent	SNP	T	T	C	rs530929455	byFrequency	TCGA-BQ-7055-01A-11D-1961-08	TCGA-BQ-7055-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	69910e4a-5f3a-49c8-9c58-5f5fc0b4625a	1a7e89d4-822a-4ca2-b6e3-e3114990152b	g.chr7:35930362T>C	ENST00000435235.1	+	10	1230	c.798T>C	c.(796-798)taT>taC	p.Y266Y	SEPT7_ENST00000494488.2_Silent_p.Y305Y|SEPT7_ENST00000399035.3_Silent_p.Y318Y|SEPT7_ENST00000432293.2_Intron|SEPT7_ENST00000399034.2_Silent_p.Y320Y|SEPT7_ENST00000350320.6_Silent_p.Y318Y			Q16181	SEPT7_HUMAN	septin 7	319	Septin-type G.				cilium morphogenesis (GO:0060271)|cytokinesis (GO:0000910)|mitotic nuclear division (GO:0007067)|protein heterooligomerization (GO:0051291)|regulation of embryonic cell shape (GO:0016476)	actin cytoskeleton (GO:0015629)|axoneme (GO:0005930)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|septin complex (GO:0031105)|stress fiber (GO:0001725)	GTP binding (GO:0005525)|identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)	p.Y320Y(3)		central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|prostate(1)	14						CTGTGACTTATAATGGAGTTG	0.323													T|||	6	0.00119808	0.0	0.0	5008	,	,		16353	0.005		0.0	False		,,,				2504	0.001				p.Y318Y		.											.	.	3	Substitution - coding silent(3)	kidney(2)|prostate(1)	c.T954C						.						47.0	41.0	43.0					7																	35930362		1836	4080	5916	SO:0001819	synonymous_variant	989	exon10			GACTTATAATGGA	S72008	CCDS75582.1	7p14.2	2013-01-21	2005-01-11	2005-01-12	ENSG00000122545	ENSG00000122545		"""Septins"""	1717	protein-coding gene	gene with protein product		603151	"""CDC10 cell division cycle 10 homolog (S. cerevisiae)"""	CDC10		8037772	Standard	NM_001788		Approved	CDC3, SEPT7A	uc011kau.2	Q16181	OTTHUMG00000155063	ENST00000435235.1:c.798T>C	7.37:g.35930362T>C		29	1		48	3	NM_001011553	0	0	119	119	0	Q52M76|Q6NX50	Silent	SNP	ENST00000435235.1	37																																																																																				.		0.323	SEPT7-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000338285.1	NM_001788	
MPDZ	8777	hgsc.bcm.edu	37	9	13183483	13183483	+	Silent	SNP	A	A	G			TCGA-BQ-7055-01A-11D-1961-08	TCGA-BQ-7055-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	69910e4a-5f3a-49c8-9c58-5f5fc0b4625a	1a7e89d4-822a-4ca2-b6e3-e3114990152b	g.chr9:13183483A>G	ENST00000319217.7	-	19	2830	c.2583T>C	c.(2581-2583)tcT>tcC	p.S861S	MPDZ_ENST00000536827.1_Silent_p.S861S|MPDZ_ENST00000546205.1_Silent_p.S861S|MPDZ_ENST00000381022.2_Silent_p.S861S|MPDZ_ENST00000447879.1_Silent_p.S861S|MPDZ_ENST00000541718.1_Silent_p.S861S|MPDZ_ENST00000381015.4_Silent_p.S861S	NM_001261406.1	NP_001248335.1	O75970	MPDZ_HUMAN	multiple PDZ domain protein	861					cell adhesion (GO:0007155)|myelination (GO:0042552)|viral process (GO:0016032)	apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|neuron projection (GO:0043005)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	protein C-terminus binding (GO:0008022)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(15)|ovary(5)|prostate(7)|stomach(1)|urinary_tract(2)	61				GBM - Glioblastoma multiforme(50;2.03e-06)		TGCCATGAAGAGATAAAATAG	0.408																																					p.S861S		.											.	MPDZ-231	0			c.T2583C						.						95.0	92.0	93.0					9																	13183483		1893	4126	6019	SO:0001819	synonymous_variant	8777	exon19			ATGAAGAGATAAA	AF093419	CCDS47951.1, CCDS59119.1, CCDS59120.1	9p23	2008-05-15			ENSG00000107186	ENSG00000107186			7208	protein-coding gene	gene with protein product		603785					Standard	NM_003829		Approved	MUPP1	uc003zlb.4	O75970	OTTHUMG00000021031	ENST00000319217.7:c.2583T>C	9.37:g.13183483A>G		44	0		48	3	NM_003829	0	0	15	15	0	A6NLC2|B2RTS3|B7ZMI4|O43798|Q4LE30|Q5CZ80|Q5JTX3|Q5JTX6|Q5JTX7|Q5JUC3|Q5JUC4|Q5VZ62|Q8N790	Silent	SNP	ENST00000319217.7	37																																																																																				.		0.408	MPDZ-001	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000055485.2	NM_003829	
XPNPEP2	7512	bcgsc.ca	37	X	128895980	128895980	+	Splice_Site	SNP	A	A	G			TCGA-BQ-7055-01A-11D-1961-08	TCGA-BQ-7055-11A-01D-1961-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	69910e4a-5f3a-49c8-9c58-5f5fc0b4625a	1a7e89d4-822a-4ca2-b6e3-e3114990152b	g.chrX:128895980A>G	ENST00000371106.3	+	18	1795		c.e18-1			NM_003399.5	NP_003390.4	O43895	XPP2_HUMAN	X-prolyl aminopeptidase (aminopeptidase P) 2, membrane-bound							anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			endometrium(3)|kidney(3)|large_intestine(5)|liver(1)|lung(20)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	37						CTTCCTTTCTAGGGCCAGTGG	0.522																																					.													.	XPNPEP2-130	0			c.1604-2A>G						.						274.0	199.0	225.0					X																	128895980		2203	4300	6503	SO:0001630	splice_region_variant	7512	exon18			CTTTCTAGGGCCA	U90724	CCDS14613.1	Xq25	2008-02-05			ENSG00000122121	ENSG00000122121	3.4.11.9		12823	protein-coding gene	gene with protein product		300145				9375790, 9628831	Standard	NM_003399		Approved		uc004eut.1	O43895	OTTHUMG00000022373	ENST00000371106.3:c.1604-1A>G	X.37:g.128895980A>G		73	0		63	4	NM_003399	0	0	0	0	0	A0AV16|O75994	Splice_Site	SNP	ENST00000371106.3	37	CCDS14613.1	.	.	.	.	.	.	.	.	.	.	A	13.08	2.129036	0.37533	.	.	ENSG00000122121	ENST00000371106	.	.	.	5.32	5.32	0.75619	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.2853	0.60239	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	XPNPEP2	128723661	1.000000	0.71417	0.963000	0.40424	0.321000	0.28281	6.894000	0.75655	1.779000	0.52309	0.350000	0.21858	.	.		0.522	XPNPEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058210.1	NM_003399	Intron
MAGEA6	4105	broad.mit.edu	37	X	151870045	151870045	+	Silent	SNP	G	G	A			TCGA-BQ-7055-01A-11D-1961-08	TCGA-BQ-7055-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	69910e4a-5f3a-49c8-9c58-5f5fc0b4625a	1a7e89d4-822a-4ca2-b6e3-e3114990152b	g.chrX:151870045G>A	ENST00000329342.5	+	3	960	c.735G>A	c.(733-735)ctG>ctA	p.L245L		NM_005363.2	NP_005354.1	P43360	MAGA6_HUMAN	melanoma antigen family A, 6	245	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									breast(1)|endometrium(3)|large_intestine(3)|lung(16)|prostate(3)|skin(1)|urinary_tract(1)	28	Acute lymphoblastic leukemia(192;6.56e-05)					CCAAGAAGCTGCTCACCCAAT	0.562																																					p.L245L													.	MAGEA6-90	0			c.G735A						.						152.0	147.0	149.0					X																	151870045		2203	4299	6502	SO:0001819	synonymous_variant	4105	exon3			GAAGCTGCTCACC		CCDS76050.1	Xq28	2009-03-13			ENSG00000197172	ENSG00000197172			6804	protein-coding gene	gene with protein product	"""MAGE-6 antigen"", ""melanoma-associated antigen 6"", ""melanoma antigen family A 6"", ""cancer/testis antigen family 1, member 6"""	300176		MAGE6		8575766	Standard	NM_005363		Approved	CT1.6	uc004ffq.1	P43360	OTTHUMG00000022642	ENST00000329342.5:c.735G>A	X.37:g.151870045G>A		193	0		214	7	NM_005363	0	0	0	0	0	A8IF93|Q6NW44	Silent	SNP	ENST00000329342.5	37	CCDS14708.1																																																																																			.		0.562	MAGEA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058747.2	NM_005363	
CCDC71	64925	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	49200861	49200862	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-BQ-7055-01A-11D-1961-08	TCGA-BQ-7055-11A-01D-1961-08	CT	CT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	69910e4a-5f3a-49c8-9c58-5f5fc0b4625a	1a7e89d4-822a-4ca2-b6e3-e3114990152b	g.chr3:49200861_49200862delCT	ENST00000321895.6	-	2	886_887	c.780_781delAG	c.(778-783)agagccfs	p.RA260fs		NM_022903.3	NP_075054.3	Q8IV32	CCD71_HUMAN	coiled-coil domain containing 71	260										endometrium(1)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)	10				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00217)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		GACCCAGTGGCTCTGTTGGTTT	0.624																																					p.260_261del		.											.	CCDC71-91	0			c.780_781del						.																																			SO:0001589	frameshift_variant	64925	exon2			.	AK022862	CCDS2790.1	3p21.31	2014-02-12			ENSG00000177352	ENSG00000177352			25760	protein-coding gene	gene with protein product						12477932	Standard	NM_022903		Approved	FLJ12800	uc003cwg.4	Q8IV32	OTTHUMG00000156815	ENST00000321895.6:c.780_781delAG	3.37:g.49200863_49200864delCT	ENSP00000319006:p.Arg260fs	194	0		152	43	NM_022903	0	0	0	0	0	Q6IPE2|Q9H8H4|Q9H9F1	Frame_Shift_Del	DEL	ENST00000321895.6	37	CCDS2790.1																																																																																			.		0.624	CCDC71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345980.1	NM_022903	
KRTAP1-3	81850	hgsc.bcm.edu	37	17	39190845	39190846	+	Missense_Mutation	DNP	GG	GG	CA			TCGA-BQ-7055-01A-11D-1961-08	TCGA-BQ-7055-11A-01D-1961-08	GG	GG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	69910e4a-5f3a-49c8-9c58-5f5fc0b4625a	1a7e89d4-822a-4ca2-b6e3-e3114990152b	g.chr17:39190845_39190846GG>CA	ENST00000344363.5	-	1	261_262	c.228_229CC>TG	c.(226-231)tgCCag>tgTGag	p.Q77E		NM_030966.1	NP_112228.1	Q8IUG1	KRA13_HUMAN	keratin associated protein 1-3	87			Missing (in allele KAP1.9). {ECO:0000269|PubMed:12228244}.			keratin filament (GO:0045095)	structural constituent of epidermis (GO:0030280)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(6)	12		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			GAGCTGGTCTGGCAGCAGCTTG	0.614																																					p.Q77E		.											.	.	0			c.C228T						.																																			SO:0001583	missense	81850	exon1			GGTCTGGCAGCAG	AJ406927	CCDS42323.1	17q21.2	2013-06-20			ENSG00000221880	ENSG00000221880		"""Keratin associated proteins"""	16771	protein-coding gene	gene with protein product		608820				11279113	Standard	NM_030966		Approved	KAP1.3	uc002hvv.3	Q8IUG1	OTTHUMG00000133583	ENST00000344363.5:c.228_229delinsCA	17.37:g.39190845_39190846delinsCA	ENSP00000344420:p.Gln77Glu	101.0	2.0		128.0	8.0		0	0	0	0	0	Q07628|Q8IUG0|Q9BYS2	Missense_Mutation	DNP	ENST00000344363.5	37	CCDS42323.1																																																																																			.		0.614	KRTAP1-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257687.1		
