#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
KIF1B	23095	hgsc.bcm.edu	37	1	10336447	10336447	+	Missense_Mutation	SNP	A	A	G			TCGA-AL-3467-01A-01D-1252-08	TCGA-AL-3467-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a74ffd4b-fa89-49ae-aa1d-3052a5440fa2	2ab402fb-392f-4441-a979-713a602c9cd3	g.chr1:10336447A>G	ENST00000377086.1	+	12	1229	c.1027A>G	c.(1027-1029)Agc>Ggc	p.S343G	KIF1B_ENST00000377093.4_Missense_Mutation_p.S337G|KIF1B_ENST00000263934.6_Missense_Mutation_p.S337G|KIF1B_ENST00000377081.1_Missense_Mutation_p.S343G|KIF1B_ENST00000377083.1_Missense_Mutation_p.S337G			O60333	KIF1B_HUMAN	kinesin family member 1B	343	Interaction with KBP.|Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				anterograde axon cargo transport (GO:0008089)|apoptotic process (GO:0006915)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|mitochondrion transport along microtubule (GO:0047497)|neuromuscular synaptic transmission (GO:0007274)|neuron-neuron synaptic transmission (GO:0007270)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|endometrium(7)|kidney(8)|large_intestine(9)|lung(29)|ovary(3)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(2)	71	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		TGAGACTTTGAGCACTCTGAG	0.418																																					p.S337G		.											.	KIF1B-93	0			c.A1009G						.						103.0	88.0	93.0					1																	10336447		2203	4300	6503	SO:0001583	missense	23095	exon11			ACTTTGAGCACTC	AF257176	CCDS111.1, CCDS112.1	1p36.22	2014-09-17			ENSG00000054523	ENSG00000054523		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	16636	protein-coding gene	gene with protein product		605995		CMT2A, CMT2		11389829, 10762626	Standard	NM_015074		Approved	KIAA0591, KLP, HMSNII	uc001aqw.4	O60333	OTTHUMG00000001817	ENST00000377086.1:c.1027A>G	1.37:g.10336447A>G	ENSP00000366290:p.Ser343Gly	85	0		47	3	NM_183416	0	0	0	0	0	A6NFS8|A6NKQ4|Q4VXC3|Q4VXC4|Q4VXC5|Q4VXC6|Q96Q94|Q9BV80|Q9P280	Missense_Mutation	SNP	ENST00000377086.1	37		.	.	.	.	.	.	.	.	.	.	A	34	5.364189	0.95877	.	.	ENSG00000054523	ENST00000355249;ENST00000263934;ENST00000377093;ENST00000377086;ENST00000377083;ENST00000377081	D;D;D;D;D	0.89681	-2.55;-2.55;-2.55;-2.55;-2.55	5.86	5.86	0.93980	Kinesin, motor domain (3);	0.000000	0.85682	D	0.000000	D	0.94785	0.8316	M	0.87097	2.86	0.80722	D	1	D;P;D;P;D;D;P	0.64830	0.959;0.949;0.98;0.89;0.964;0.994;0.777	D;P;P;P;P;D;P	0.65010	0.929;0.508;0.85;0.477;0.484;0.931;0.55	D	0.95414	0.8501	10	0.72032	D	0.01	.	16.2652	0.82574	1.0:0.0:0.0:0.0	.	343;343;343;343;343;337;337	Q4R9M9;Q4R9M7;Q4VXC4;Q4R9M8;O60333;O60333-2;O60333-3	.;.;.;.;KIF1B_HUMAN;.;.	G	343;337;337;343;337;343	ENSP00000263934:S337G;ENSP00000366297:S337G;ENSP00000366290:S343G;ENSP00000366287:S337G;ENSP00000366284:S343G	ENSP00000263934:S337G	S	+	1	0	KIF1B	10259034	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	9.253000	0.95501	2.241000	0.73720	0.528000	0.53228	AGC	.		0.418	KIF1B-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000005102.1		
MIER1	57708	hgsc.bcm.edu	37	1	67394625	67394625	+	5'Flank	SNP	T	T	C			TCGA-AL-3467-01A-01D-1252-08	TCGA-AL-3467-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a74ffd4b-fa89-49ae-aa1d-3052a5440fa2	2ab402fb-392f-4441-a979-713a602c9cd3	g.chr1:67394625T>C	ENST00000355356.3	+	0	0				MIER1_ENST00000401041.1_Intron|MIER1_ENST00000357692.2_Silent_p.T13T|MIER1_ENST00000371012.2_Silent_p.T13T|MIER1_ENST00000355977.6_Intron|MIER1_ENST00000401042.3_5'Flank|MIER1_ENST00000371014.1_Intron|MIER1_ENST00000371016.1_Silent_p.T13T|MIER1_ENST00000371018.3_Silent_p.T13T	NM_001077701.2|NM_001077704.2	NP_001071169.1|NP_001071172.1	Q8N108	MIER1_HUMAN	mesoderm induction early response 1, transcriptional regulator						positive regulation of chromatin silencing (GO:0031937)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)|urinary_tract(3)	15						GTCTGTGGACTCTTTTCCTGT	0.338																																					p.T13T		.											.	MIER1-91	0			c.T39C						.						122.0	108.0	113.0					1																	67394625		1849	4088	5937	SO:0001631	upstream_gene_variant	57708	exon3			GTGGACTCTTTTC		CCDS41347.1, CCDS41348.1, CCDS53325.1, CCDS53326.1, CCDS53327.1, CCDS53328.1, CCDS53329.1, CCDS53330.1, CCDS60163.1	1p31.2	2013-07-23	2013-07-23		ENSG00000198160	ENSG00000198160			29657	protein-coding gene	gene with protein product			"""mesoderm induction early response 1 homolog (Xenopus laevis)"""			12242014, 12482978	Standard	NM_020948		Approved	hMI-ER1, MI-ER1, KIAA1610	uc001dde.2	Q8N108	OTTHUMG00000009194		1.37:g.67394625T>C	Exception_encountered	52	0		32	2	NM_001146111	0	0	1	1	0	C9JFD4|Q08AE0|Q32NC4|Q5T104|Q5TAD1|Q5TAD2|Q5TAD4|Q5TAD5|Q6AHY8|Q86TB4|Q8N156|Q8N161|Q8NC37|Q8NES4|Q8NES5|Q8NES6|Q8WWG2|Q9HCG2	Silent	SNP	ENST00000355356.3	37	CCDS41348.1	.	.	.	.	.	.	.	.	.	.	T	9.694	1.152565	0.21371	.	.	ENSG00000198160	ENST00000371017	.	.	.	4.73	4.73	0.59995	.	.	.	.	.	T	0.38054	0.1026	.	.	.	0.80722	D	1	P	0.51537	0.946	P	0.46825	0.528	T	0.22277	-1.0221	7	0.33141	T	0.24	.	11.1769	0.48606	0.0:0.0:0.0:1.0	.	20	Q6NXT7	.	P	17	.	ENSP00000360056:L17P	L	+	2	0	MIER1	67167213	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.367000	0.52350	2.073000	0.62155	0.454000	0.30748	CTC	.		0.338	MIER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025491.2	NM_020948	
PRRC2C	23215	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	171553162	171553162	+	Missense_Mutation	SNP	C	C	T			TCGA-AL-3467-01A-01D-1252-08	TCGA-AL-3467-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a74ffd4b-fa89-49ae-aa1d-3052a5440fa2	2ab402fb-392f-4441-a979-713a602c9cd3	g.chr1:171553162C>T	ENST00000338920.4	+	29	7708	c.7471C>T	c.(7471-7473)Cac>Tac	p.H2491Y	PRRC2C_ENST00000367742.3_Missense_Mutation_p.H2493Y|PRRC2C_ENST00000392078.3_Missense_Mutation_p.H2493Y|PRRC2C_ENST00000426496.2_Missense_Mutation_p.H2426Y	NM_015172.3	NP_055987.2	Q9Y520	PRC2C_HUMAN	proline-rich coiled-coil 2C	2491	Gln-rich.				hematopoietic progenitor cell differentiation (GO:0002244)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)										TACTGCTATTCACAACTTTCC	0.408																																					p.H2491Y		.											.	.	0			c.C7471T						.						140.0	131.0	134.0					1																	171553162		2203	4300	6503	SO:0001583	missense	23215	exon29			GCTATTCACAACT	AL096857	CCDS1296.2	1q24.3	2012-07-18	2010-12-09	2010-12-09	ENSG00000117523	ENSG00000117523			24903	protein-coding gene	gene with protein product			"""BAT2 domain containing 1"", ""HLA-B associated transcript 2-like 2"""	BAT2D1, BAT2L2		10470851, 12443540	Standard	NM_015172		Approved	KIAA1096, XTP2	uc010pmg.2	Q9Y520	OTTHUMG00000034665	ENST00000338920.4:c.7471C>T	1.37:g.171553162C>T	ENSP00000343629:p.His2491Tyr	232	1		213	75	NM_015172	0	0	44	68	24	Q05DM8|Q49A39|Q6PD54|Q9H2N2|Q9HA05|Q9NSM8|Q9NXL3|Q9UF29|Q9UPQ6	Missense_Mutation	SNP	ENST00000338920.4	37	CCDS1296.2	.	.	.	.	.	.	.	.	.	.	C	19.93	3.918545	0.73098	.	.	ENSG00000117523	ENST00000392078;ENST00000451306;ENST00000426496;ENST00000367742;ENST00000338920;ENST00000392080	T;T;T;T	0.02140	4.43;4.44;4.44;4.44	5.98	5.98	0.97165	.	0.000000	0.49305	D	0.000160	T	0.07052	0.0179	L	0.51422	1.61	0.80722	D	1	D;D	0.89917	0.981;1.0	D;D	0.85130	0.954;0.997	T	0.30149	-0.9988	10	0.59425	D	0.04	.	20.4581	0.99154	0.0:1.0:0.0:0.0	.	2426;2491	B7WNZ6;Q9Y520-4	.;.	Y	2493;2445;2426;2493;2491;2248	ENSP00000375928:H2493Y;ENSP00000410219:H2426Y;ENSP00000356716:H2493Y;ENSP00000343629:H2491Y	ENSP00000343629:H2491Y	H	+	1	0	PRRC2C	169819786	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.487000	0.81328	2.835000	0.97688	0.650000	0.86243	CAC	.		0.408	PRRC2C-010	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000314826.4	NM_015172	
INTS7	25896	broad.mit.edu	37	1	212148638	212148638	+	Missense_Mutation	SNP	A	A	G			TCGA-AL-3467-01A-01D-1252-08	TCGA-AL-3467-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a74ffd4b-fa89-49ae-aa1d-3052a5440fa2	2ab402fb-392f-4441-a979-713a602c9cd3	g.chr1:212148638A>G	ENST00000366994.3	-	13	1789	c.1685T>C	c.(1684-1686)cTa>cCa	p.L562P	INTS7_ENST00000366993.3_Missense_Mutation_p.L562P|INTS7_ENST00000366992.3_Missense_Mutation_p.L562P|INTS7_ENST00000440600.2_Missense_Mutation_p.L513P|INTS7_ENST00000469606.1_5'UTR	NM_001199811.1|NM_001199812.1|NM_015434.3	NP_001186740.1|NP_001186741.1|NP_056249.1	Q9NVH2	INT7_HUMAN	integrator complex subunit 7	562					cellular response to ionizing radiation (GO:0071479)|DNA damage checkpoint (GO:0000077)|snRNA processing (GO:0016180)	chromosome (GO:0005694)|integrator complex (GO:0032039)				NS(1)|breast(1)|kidney(1)|large_intestine(8)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20				OV - Ovarian serous cystadenocarcinoma(81;0.00584)|all cancers(67;0.0318)|Epithelial(68;0.0852)		CAAACTATTTAGCCAGAAGTA	0.368																																					p.L562P													.	INTS7-90	0			c.T1685C						.						89.0	96.0	94.0					1																	212148638		2203	4300	6503	SO:0001583	missense	25896	exon13			CTATTTAGCCAGA	AK022509	CCDS1501.1, CCDS55684.1, CCDS55683.1, CCDS55685.1	1q32.3	2008-02-05	2006-03-15	2006-03-15	ENSG00000143493	ENSG00000143493			24484	protein-coding gene	gene with protein product		611350	"""chromosome 1 open reading frame 73"""	C1orf73		16239144	Standard	NM_015434		Approved	DKFZP434B168, INT7	uc001hiw.2	Q9NVH2	OTTHUMG00000037119	ENST00000366994.3:c.1685T>C	1.37:g.212148638A>G	ENSP00000355961:p.Leu562Pro	194	1		203	4	NM_015434	0	0	2	2	0	B4DLZ6|B7WNP6|B7WPB6|Q8N4K7|Q8WUH5|Q9H9V3|Q9NVU5|Q9UFC6|Q9UFM3	Missense_Mutation	SNP	ENST00000366994.3	37	CCDS1501.1	.	.	.	.	.	.	.	.	.	.	A	24.7	4.554880	0.86231	.	.	ENSG00000143493	ENST00000366994;ENST00000366993;ENST00000366992;ENST00000440600	T;T;T;T	0.73575	-0.76;-0.69;-0.69;-0.17	6.06	6.06	0.98353	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.85809	0.5783	M	0.73217	2.22	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.87578	0.998;0.998;0.998;0.998	D	0.87097	0.2176	10	0.87932	D	0	-15.5011	16.6093	0.84858	1.0:0.0:0.0:0.0	.	513;562;562;562	B4DLZ6;Q9NVH2-3;Q9NVH2-2;Q9NVH2	.;.;.;INT7_HUMAN	P	562;562;562;513	ENSP00000355961:L562P;ENSP00000355960:L562P;ENSP00000355959:L562P;ENSP00000388908:L513P	ENSP00000355959:L562P	L	-	2	0	INTS7	210215261	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	8.999000	0.93557	2.324000	0.78689	0.533000	0.62120	CTA	.		0.368	INTS7-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090142.1	NM_015434	
GYLTL1B	120071	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	45948105	45948105	+	Missense_Mutation	SNP	A	A	C			TCGA-AL-3467-01A-01D-1252-08	TCGA-AL-3467-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a74ffd4b-fa89-49ae-aa1d-3052a5440fa2	2ab402fb-392f-4441-a979-713a602c9cd3	g.chr11:45948105A>C	ENST00000531526.1	+	9	1232	c.1121A>C	c.(1120-1122)gAg>gCg	p.E374A	GYLTL1B_ENST00000536139.1_Missense_Mutation_p.E343A|GYLTL1B_ENST00000401752.1_Missense_Mutation_p.E374A|GYLTL1B_ENST00000389968.3_Missense_Mutation_p.E101A|GYLTL1B_ENST00000529052.1_Missense_Mutation_p.E343A|GYLTL1B_ENST00000325468.5_Missense_Mutation_p.E374A	NM_152312.3	NP_689525.3	Q8N3Y3	LARG2_HUMAN	glycosyltransferase-like 1B	374					muscle cell cellular homeostasis (GO:0046716)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)			breast(2)|central_nervous_system(2)|endometrium(6)|large_intestine(4)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	22				GBM - Glioblastoma multiforme(35;0.226)		CTGCGGAGAGAGCTCTTTGTG	0.567																																					p.E374A		.											.	GYLTL1B-92	0			c.A1121C						.						72.0	74.0	74.0					11																	45948105		2203	4299	6502	SO:0001583	missense	120071	exon9			GGAGAGAGCTCTT		CCDS31473.1	11p11.12	2013-02-22			ENSG00000165905	ENSG00000165905		"""Glycosyltransferase family 8 domain containing"""	16522	protein-coding gene	gene with protein product		609709				15661757, 15958417	Standard	XM_005252785		Approved	PP5656, FLJ35207, LARGE2	uc001nbv.1	Q8N3Y3	OTTHUMG00000167037	ENST00000531526.1:c.1121A>C	11.37:g.45948105A>C	ENSP00000432869:p.Glu374Ala	92	0		104	35	NM_152312	0	0	17	46	29	A6NN75|Q8N8Y6|Q8NAK3|Q8WY62	Missense_Mutation	SNP	ENST00000531526.1	37	CCDS31473.1	.	.	.	.	.	.	.	.	.	.	A	16.53	3.148701	0.57151	.	.	ENSG00000165905	ENST00000529052;ENST00000531526;ENST00000401752;ENST00000389968;ENST00000325468;ENST00000536139;ENST00000534410	T;T;T;D;T;T	0.83419	0.88;0.87;0.87;-1.72;0.87;0.88	5.45	4.32	0.51571	.	0.000000	0.85682	D	0.000000	T	0.80854	0.4703	M	0.66939	2.045	0.80722	D	1	P;B;B	0.36027	0.533;0.204;0.102	B;B;B	0.36418	0.224;0.099;0.068	T	0.79135	-0.1928	10	0.52906	T	0.07	-26.8748	11.3948	0.49836	0.9288:0.0:0.0712:0.0	.	343;343;374	B3KP69;E9PIZ2;Q8N3Y3	.;.;LARG2_HUMAN	A	343;374;374;101;374;343;35	ENSP00000431932:E343A;ENSP00000432869:E374A;ENSP00000385235:E374A;ENSP00000374618:E101A;ENSP00000324570:E374A;ENSP00000445044:E343A	ENSP00000324570:E374A	E	+	2	0	GYLTL1B	45904681	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	7.158000	0.77470	0.909000	0.36697	-0.411000	0.06167	GAG	.		0.567	GYLTL1B-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000392572.1	NM_152312	
CORO1B	57175	broad.mit.edu	37	11	67206237	67206237	+	Missense_Mutation	SNP	G	G	C			TCGA-AL-3467-01A-01D-1252-08	TCGA-AL-3467-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a74ffd4b-fa89-49ae-aa1d-3052a5440fa2	2ab402fb-392f-4441-a979-713a602c9cd3	g.chr11:67206237G>C	ENST00000341356.5	-	10	1359	c.1249C>G	c.(1249-1251)Ccc>Gcc	p.P417A	PTPRCAP_ENST00000326294.3_5'Flank|CORO1B_ENST00000393893.1_Missense_Mutation_p.P417A|CORO1B_ENST00000539724.1_5'UTR	NM_020441.2	NP_065174.1	Q9BR76	COR1B_HUMAN	coronin, actin binding protein, 1B	417					actin cytoskeleton organization (GO:0030036)|actin filament branching (GO:0090135)|actin filament bundle assembly (GO:0051017)|cell migration (GO:0016477)|endothelial cell chemotaxis (GO:0035767)|negative regulation of Arp2/3 complex-mediated actin nucleation (GO:0034316)|positive regulation of lamellipodium morphogenesis (GO:2000394)|protein localization to cell leading edge (GO:1902463)|ruffle organization (GO:0031529)|wound healing (GO:0042060)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)|Arp2/3 complex binding (GO:0071933)|identical protein binding (GO:0042802)			cervix(1)|endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)	13			BRCA - Breast invasive adenocarcinoma(15;3.26e-06)			GCCATGGCGGGCCGGCTGTCA	0.701																																					p.P417A													.	CORO1B-108	0			c.C1249G						.						6.0	7.0	6.0					11																	67206237		1982	4000	5982	SO:0001583	missense	57175	exon10			TGGCGGGCCGGCT	AK000860	CCDS8164.1	11q13.1	2013-01-10	2001-11-28		ENSG00000172725	ENSG00000172725		"""Coronins"", ""WD repeat domain containing"""	2253	protein-coding gene	gene with protein product		609849	"""coronin, actin-binding protein, 1B"""			9778037	Standard	NM_001018070		Approved	coronin-2	uc001olk.1	Q9BR76	OTTHUMG00000167775	ENST00000341356.5:c.1249C>G	11.37:g.67206237G>C	ENSP00000340211:p.Pro417Ala	11	0		11	7	NM_020441	0	0	25	62	37	B2RD45	Missense_Mutation	SNP	ENST00000341356.5	37	CCDS8164.1	.	.	.	.	.	.	.	.	.	.	G	12.18	1.859741	0.32884	.	.	ENSG00000172725	ENST00000393893;ENST00000341356	T;T	0.60797	0.16;0.16	4.58	3.62	0.41486	.	0.177538	0.27677	N	0.018318	T	0.44561	0.1299	L	0.34521	1.04	0.35506	D	0.800214	B	0.09022	0.002	B	0.10450	0.005	T	0.50541	-0.8816	10	0.28530	T	0.3	-8.2658	12.449	0.55667	0.0:0.1843:0.8157:0.0	.	417	Q9BR76	COR1B_HUMAN	A	417	ENSP00000377471:P417A;ENSP00000340211:P417A	ENSP00000340211:P417A	P	-	1	0	CORO1B	66962813	1.000000	0.71417	0.988000	0.46212	0.649000	0.38597	3.372000	0.52387	2.379000	0.81126	0.555000	0.69702	CCC	.		0.701	CORO1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396220.1	NM_020441	
OR8D1	283159	hgsc.bcm.edu;broad.mit.edu	37	11	124180427	124180427	+	Missense_Mutation	SNP	G	G	A			TCGA-AL-3467-01A-01D-1252-08	TCGA-AL-3467-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a74ffd4b-fa89-49ae-aa1d-3052a5440fa2	2ab402fb-392f-4441-a979-713a602c9cd3	g.chr11:124180427G>A	ENST00000357821.2	-	1	306	c.236C>T	c.(235-237)cCc>cTc	p.P79L		NM_001002917.1	NP_001002917.1	Q8WZ84	OR8D1_HUMAN	olfactory receptor, family 8, subfamily D, member 1	79						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(1)|lung(7)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0528)		CAGCATTTTGGGAGTAATGAC	0.458																																					p.P79L		.											.	OR8D1-71	0			c.C236T						.						69.0	65.0	66.0					11																	124180427		2201	4299	6500	SO:0001583	missense	283159	exon1			ATTTTGGGAGTAA	AF238489	CCDS31706.1	11q25	2012-08-09			ENSG00000196341	ENSG00000196341		"""GPCR / Class A : Olfactory receptors"""	8481	protein-coding gene	gene with protein product				OR8D3			Standard	NM_001002917		Approved	OST004	uc010sag.2	Q8WZ84	OTTHUMG00000165977	ENST00000357821.2:c.236C>T	11.37:g.124180427G>A	ENSP00000350474:p.Pro79Leu	69	0		82	7	NM_001002917	0	0	0	0	0	B2RNL4|Q6IEW1|Q8NGH0	Missense_Mutation	SNP	ENST00000357821.2	37	CCDS31706.1	.	.	.	.	.	.	.	.	.	.	g	21.7	4.189733	0.78789	.	.	ENSG00000196341	ENST00000357821	T	0.01854	4.6	4.29	4.29	0.51040	GPCR, rhodopsin-like superfamily (1);	0.000000	0.36815	U	0.002395	T	0.22205	0.0535	H	0.97023	3.925	0.58432	D	0.999994	D	0.89917	1.0	D	0.97110	1.0	T	0.42832	-0.9428	10	0.87932	D	0	.	16.5818	0.84717	0.0:0.0:1.0:0.0	.	79	Q8WZ84	OR8D1_HUMAN	L	79	ENSP00000350474:P79L	ENSP00000350474:P79L	P	-	2	0	OR8D1	123685637	1.000000	0.71417	0.999000	0.59377	0.920000	0.55202	4.741000	0.62095	2.236000	0.73375	0.508000	0.49915	CCC	.		0.458	OR8D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387285.1	NM_001002917	
KLRB1	3820	broad.mit.edu	37	12	9754098	9754098	+	Splice_Site	SNP	T	T	C			TCGA-AL-3467-01A-01D-1252-08	TCGA-AL-3467-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a74ffd4b-fa89-49ae-aa1d-3052a5440fa2	2ab402fb-392f-4441-a979-713a602c9cd3	g.chr12:9754098T>C	ENST00000229402.3	-	2	229	c.183A>G	c.(181-183)tcA>tcG	p.S61S		NM_002258.2	NP_002249.1	Q12918	KLRB1_HUMAN	killer cell lectin-like receptor subfamily B, member 1	61					cell surface receptor signaling pathway (GO:0007166)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			endometrium(2)|large_intestine(6)|lung(4)	12						CCCACTTACCTGAAACACTCA	0.463																																					p.S61S													.	KLRB1-90	0			c.A183G						.						143.0	117.0	126.0					12																	9754098		2203	4300	6503	SO:0001630	splice_region_variant	3820	exon2			CTTACCTGAAACA	U11276	CCDS8601.1	12p13	2014-05-22			ENSG00000111796	ENSG00000111796		"""Killer cell lectin-like receptors"", ""CD molecules"", ""C-type lectin domain containing"""	6373	protein-coding gene	gene with protein product		602890		NKR		8077657	Standard	NM_002258		Approved	CD161, NKR-P1, NKR-P1A, hNKR-P1A, CLEC5B	uc010sgt.2	Q12918	OTTHUMG00000168581	ENST00000229402.3:c.184+1A>G	12.37:g.9754098T>C		72	0		55	3	NM_002258	0	0	0	0	0	Q24K24	Silent	SNP	ENST00000229402.3	37	CCDS8601.1																																																																																			.		0.463	KLRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400280.1	NM_002258	Silent
LDHB	3945	broad.mit.edu	37	12	21788543	21788543	+	Missense_Mutation	SNP	T	T	C			TCGA-AL-3467-01A-01D-1252-08	TCGA-AL-3467-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a74ffd4b-fa89-49ae-aa1d-3052a5440fa2	2ab402fb-392f-4441-a979-713a602c9cd3	g.chr12:21788543T>C	ENST00000396076.1	-	8	1270	c.938A>G	c.(937-939)gAg>gGg	p.E313G	LDHB_ENST00000350669.1_Missense_Mutation_p.E313G	NM_001174097.1	NP_001167568.1	P07195	LDHB_HUMAN	lactate dehydrogenase B	313					cellular carbohydrate metabolic process (GO:0044262)|cellular metabolic process (GO:0044237)|lactate metabolic process (GO:0006089)|NAD metabolic process (GO:0019674)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	L-lactate dehydrogenase activity (GO:0004459)|NAD binding (GO:0051287)			breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	26						CTGAGCAACCTCATCATCCTT	0.458																																					p.E313G													.	LDHB-290	0			c.A938G						.						185.0	158.0	167.0					12																	21788543		2203	4300	6503	SO:0001583	missense	3945	exon8			GCAACCTCATCAT		CCDS8691.1	12p12.2-p12.1	2012-10-02			ENSG00000111716	ENSG00000111716	1.1.1.27		6541	protein-coding gene	gene with protein product		150100					Standard	NM_002300		Approved		uc001rfe.3	P07195	OTTHUMG00000133760	ENST00000396076.1:c.938A>G	12.37:g.21788543T>C	ENSP00000379386:p.Glu313Gly	329	0		282	5	NM_002300	0	0	1953	1953	0		Missense_Mutation	SNP	ENST00000396076.1	37	CCDS8691.1	.	.	.	.	.	.	.	.	.	.	T	28.8	4.952417	0.92660	.	.	ENSG00000111716	ENST00000396076;ENST00000350669	T;T	0.73363	-0.74;-0.74	5.37	5.37	0.77165	Lactate/malate dehydrogenase, C-terminal (1);Lactate dehydrogenase/glycoside hydrolase, family 4, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.90239	0.6948	H	0.97874	4.095	0.80722	D	1	D	0.63046	0.992	P	0.59948	0.866	D	0.93858	0.7151	10	0.87932	D	0	.	15.4488	0.75257	0.0:0.0:0.0:1.0	.	313	P07195	LDHB_HUMAN	G	313	ENSP00000379386:E313G;ENSP00000229319:E313G	ENSP00000229319:E313G	E	-	2	0	LDHB	21679810	1.000000	0.71417	0.999000	0.59377	0.990000	0.78478	7.965000	0.87945	2.039000	0.60335	0.529000	0.55759	GAG	.		0.458	LDHB-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258220.2	NM_002300	
CPNE6	9362	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	24544466	24544466	+	Missense_Mutation	SNP	C	C	A			TCGA-AL-3467-01A-01D-1252-08	TCGA-AL-3467-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a74ffd4b-fa89-49ae-aa1d-3052a5440fa2	2ab402fb-392f-4441-a979-713a602c9cd3	g.chr14:24544466C>A	ENST00000397016.2	+	9	1069	c.758C>A	c.(757-759)aCg>aAg	p.T253K	CPNE6_ENST00000537691.1_Missense_Mutation_p.T308K|CPNE6_ENST00000216775.2_Missense_Mutation_p.T253K	NM_001280558.1	NP_001267487.1	O95741	CPNE6_HUMAN	copine VI (neuronal)	253					lipid metabolic process (GO:0006629)|nervous system development (GO:0007399)|synaptic transmission (GO:0007268)|vesicle-mediated transport (GO:0016192)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			endometrium(4)|large_intestine(3)|liver(2)|lung(5)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	22				GBM - Glioblastoma multiforme(265;0.0184)		CAGGAAGGGACGGCAAACCCT	0.567																																					p.T253K		.											.	CPNE6-93	0			c.C758A						.						111.0	106.0	107.0					14																	24544466		2203	4300	6503	SO:0001583	missense	9362	exon8			AAGGGACGGCAAA	AB009288	CCDS9607.1, CCDS61413.1	14q11.2	2008-07-09			ENSG00000100884	ENSG00000100884			2319	protein-coding gene	gene with protein product		605688				9645480	Standard	NM_001280558		Approved		uc001wll.3	O95741	OTTHUMG00000028781	ENST00000397016.2:c.758C>A	14.37:g.24544466C>A	ENSP00000380211:p.Thr253Lys	250	1		271	121	NM_006032	0	0	0	0	0	B2RAG6|B7Z1M3|D3DS55|F5GXN1|Q53HA6|Q8WVG1	Missense_Mutation	SNP	ENST00000397016.2	37	CCDS9607.1	.	.	.	.	.	.	.	.	.	.	C	3.945	-0.013372	0.07727	.	.	ENSG00000100884	ENST00000537691;ENST00000397016;ENST00000216775	T;T;T	0.06294	3.32;3.34;3.34	5.13	5.13	0.70059	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.64402	D	0.000007	T	0.03783	0.0107	N	0.05487	-0.04	0.21020	N	0.999808	P;B	0.39326	0.668;0.192	B;B	0.40901	0.343;0.122	T	0.39165	-0.9627	10	0.05721	T	0.95	-31.3802	13.9546	0.64140	0.0:1.0:0.0:0.0	.	308;253	F5GXN1;O95741	.;CPNE6_HUMAN	K	308;253;253	ENSP00000440077:T308K;ENSP00000380211:T253K;ENSP00000216775:T253K	ENSP00000216775:T253K	T	+	2	0	CPNE6	23614306	0.908000	0.30866	0.997000	0.53966	0.900000	0.52787	0.035000	0.13797	2.676000	0.91093	0.467000	0.42956	ACG	.		0.567	CPNE6-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071869.5		
NPAS3	64067	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	34263109	34263109	+	Missense_Mutation	SNP	A	A	G			TCGA-AL-3467-01A-01D-1252-08	TCGA-AL-3467-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a74ffd4b-fa89-49ae-aa1d-3052a5440fa2	2ab402fb-392f-4441-a979-713a602c9cd3	g.chr14:34263109A>G	ENST00000356141.4	+	10	1160	c.1160A>G	c.(1159-1161)aAt>aGt	p.N387S	NPAS3_ENST00000346562.2_Missense_Mutation_p.N355S|NPAS3_ENST00000548645.1_Missense_Mutation_p.N357S|NPAS3_ENST00000357798.5_Missense_Mutation_p.N374S|NPAS3_ENST00000551492.1_Missense_Mutation_p.N392S			Q8IXF0	NPAS3_HUMAN	neuronal PAS domain protein 3	387	PAC.|PAS 2. {ECO:0000255|PROSITE- ProRule:PRU00140}.				locomotory behavior (GO:0007626)|maternal behavior (GO:0042711)|positive regulation of transcription, DNA-templated (GO:0045893)|startle response (GO:0001964)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(4)|endometrium(3)|kidney(1)|large_intestine(6)|liver(2)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	40	Breast(36;0.0102)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	GBM - Glioblastoma multiforme(1;1.31e-09)|all cancers(1;0.000112)|OV - Ovarian serous cystadenocarcinoma(311;0.115)		CCAGTGCTGAATAAGGGTCAG	0.368																																					p.N387S		.											.	NPAS3-93	0			c.A1160G						.						107.0	102.0	103.0					14																	34263109		2203	4300	6503	SO:0001583	missense	64067	exon10			TGCTGAATAAGGG	AF164438	CCDS9645.1, CCDS53891.1, CCDS53892.1, CCDS55912.1	14q13.1	2013-08-23			ENSG00000151322	ENSG00000151322		"""Basic helix-loop-helix proteins"""	19311	protein-coding gene	gene with protein product		609430					Standard	NM_022123		Approved	MOP6, PASD6, bHLHe12	uc001wru.3	Q8IXF0	OTTHUMG00000140215	ENST00000356141.4:c.1160A>G	14.37:g.34263109A>G	ENSP00000348460:p.Asn387Ser	196	0		199	16	NM_001164749	0	0	2	2	0	Q86US6|Q86US7|Q8IXF2|Q9BY81|Q9H323|Q9Y4L8	Missense_Mutation	SNP	ENST00000356141.4	37	CCDS53891.1	.	.	.	.	.	.	.	.	.	.	A	12.93	2.085130	0.36758	.	.	ENSG00000151322	ENST00000551634;ENST00000551492;ENST00000346562;ENST00000548645;ENST00000356141;ENST00000357798	T;T;T;T;T;T	0.16743	2.32;2.32;2.32;2.32;2.32;2.32	5.79	5.79	0.91817	PAS fold-3 (1);PAS (2);	0.000000	0.85682	D	0.000000	T	0.10766	0.0263	N	0.04297	-0.235	0.80722	D	1	P;B;P;P	0.35542	0.508;0.351;0.508;0.508	B;B;B;B	0.37304	0.234;0.246;0.234;0.234	T	0.31696	-0.9934	10	0.39692	T	0.17	.	16.1299	0.81422	1.0:0.0:0.0:0.0	.	357;387;355;374	Q8IXF0-2;Q8IXF0;Q8IXF0-4;Q8IXF0-3	.;NPAS3_HUMAN;.;.	S	364;392;355;357;387;374	ENSP00000448373:N364S;ENSP00000450392:N392S;ENSP00000319610:N355S;ENSP00000448916:N357S;ENSP00000348460:N387S;ENSP00000350446:N374S	ENSP00000319610:N355S	N	+	2	0	NPAS3	33332860	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	6.292000	0.72725	2.213000	0.71641	0.455000	0.32223	AAT	.		0.368	NPAS3-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276645.1		
C14orf142	84520	broad.mit.edu	37	14	93670051	93670051	+	Silent	SNP	C	C	T			TCGA-AL-3467-01A-01D-1252-08	TCGA-AL-3467-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a74ffd4b-fa89-49ae-aa1d-3052a5440fa2	2ab402fb-392f-4441-a979-713a602c9cd3	g.chr14:93670051C>T	ENST00000306954.4	-	2	341	c.285G>A	c.(283-285)cgG>cgA	p.R95R	RP11-371E8.4_ENST00000557574.1_Intron|RP11-371E8.4_ENST00000557048.1_Intron	NM_032490.4	NP_115879.2	Q9BXV9	CN142_HUMAN	chromosome 14 open reading frame 142	95										endometrium(1)|skin(1)	2		all_cancers(154;0.00528)|Acute lymphoblastic leukemia(33;0.0497)|all_epithelial(191;0.125)|all_neural(303;0.13)		Epithelial(152;0.177)|all cancers(159;0.198)|COAD - Colon adenocarcinoma(157;0.203)		GTGTTTTTGGCCGTTTTGCAG	0.338																																					p.R95R													.	C14orf142-90	0			c.G285A						.						261.0	242.0	248.0					14																	93670051		1921	4145	6066	SO:0001819	synonymous_variant	84520	exon2			TTTTGGCCGTTTT	AF277185	CCDS41981.1	14q32.12	2012-09-25			ENSG00000170270	ENSG00000170270			20356	protein-coding gene	gene with protein product							Standard	NM_032490		Approved		uc001ybl.1	Q9BXV9	OTTHUMG00000171267	ENST00000306954.4:c.285G>A	14.37:g.93670051C>T		164	0		204	6	NM_032490	0	0	31	31	0	Q0D2N1|Q0P6C4|Q3B7W5	Silent	SNP	ENST00000306954.4	37	CCDS41981.1																																																																																			.		0.338	C14orf142-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412691.1	NM_032490	
PIGB	9488	hgsc.bcm.edu	37	15	55626159	55626159	+	Missense_Mutation	SNP	G	G	A			TCGA-AL-3467-01A-01D-1252-08	TCGA-AL-3467-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a74ffd4b-fa89-49ae-aa1d-3052a5440fa2	2ab402fb-392f-4441-a979-713a602c9cd3	g.chr15:55626159G>A	ENST00000164305.5	+	6	1039	c.748G>A	c.(748-750)Gaa>Aaa	p.E250K	PIGB_ENST00000539642.1_Missense_Mutation_p.E55K	NM_004855.4	NP_004846.4	Q92521	PIGB_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class B	250					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	mannosyltransferase activity (GO:0000030)			endometrium(3)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)	11				all cancers(107;0.0255)		TTTCTGTCAAGAACCAAGAAA	0.388																																					p.E250K		.											.	PIGB-226	0			c.G748A						.						114.0	105.0	108.0					15																	55626159		1838	4108	5946	SO:0001583	missense	9488	exon6			TGTCAAGAACCAA	D42138	CCDS61641.1	15q21.3	2013-02-26	2006-06-28		ENSG00000069943	ENSG00000069943		"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"", ""Phosphatidylinositol glycan anchor biosynthesis"""	8959	protein-coding gene	gene with protein product	"""GPI mannosyltransferase 3"", ""dol-P-Man dependent GPI mannosyltransferase"""	604122	"""phosphatidylinositol glycan, class B"""			8861954	Standard	NM_004855		Approved		uc002act.3	Q92521	OTTHUMG00000172654	ENST00000164305.5:c.748G>A	15.37:g.55626159G>A	ENSP00000164305:p.Glu250Lys	69	0		59	3	NM_004855	0	0	10	10	0	Q53FF9|Q8WVN7	Missense_Mutation	SNP	ENST00000164305.5	37		.	.	.	.	.	.	.	.	.	.	G	25.4	4.638508	0.87760	.	.	ENSG00000069943	ENST00000164305;ENST00000539642	T;T	0.63096	-0.02;-0.02	6.03	6.03	0.97812	.	0.143072	0.64402	D	0.000006	T	0.52354	0.1729	L	0.37630	1.12	0.58432	D	0.99999	B	0.16603	0.018	B	0.26310	0.068	T	0.47736	-0.9094	10	0.05620	T	0.96	-5.5916	17.7128	0.88326	0.0:0.0:1.0:0.0	.	250	Q92521	PIGB_HUMAN	K	250;55	ENSP00000164305:E250K;ENSP00000438963:E55K	ENSP00000164305:E250K	E	+	1	0	PIGB	53413451	1.000000	0.71417	0.958000	0.39756	0.988000	0.76386	9.087000	0.94110	2.861000	0.98227	0.655000	0.94253	GAA	.		0.388	PIGB-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000419687.1	NM_004855	
MYZAP	100820829	broad.mit.edu	37	15	57922023	57922023	+	Missense_Mutation	SNP	C	C	G			TCGA-AL-3467-01A-01D-1252-08	TCGA-AL-3467-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a74ffd4b-fa89-49ae-aa1d-3052a5440fa2	2ab402fb-392f-4441-a979-713a602c9cd3	g.chr15:57922023C>G	ENST00000267853.5	+	6	743	c.649C>G	c.(649-651)Caa>Gaa	p.Q217E	GCOM1_ENST00000574161.1_Missense_Mutation_p.Q217E|POLR2M_ENST00000380563.2_5'UTR|GCOM1_ENST00000380560.2_Missense_Mutation_p.Q148E|GCOM1_ENST00000587652.1_Missense_Mutation_p.Q217E|GCOM1_ENST00000380568.3_Missense_Mutation_p.Q217E|GCOM1_ENST00000396180.1_Missense_Mutation_p.Q186E|GCOM1_ENST00000380561.2_Missense_Mutation_p.Q186E|GCOM1_ENST00000380569.2_Missense_Mutation_p.Q217E|GCOM1_ENST00000572390.1_Missense_Mutation_p.Q217E|MYZAP_ENST00000380565.4_Missense_Mutation_p.Q217E			P0CAP1	MYZAP_HUMAN	myocardial zonula adherens protein	217					intracellular signal transduction (GO:0035556)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|I band (GO:0031674)											GGAGGTAGCGCAAGTTGAAAA	0.413																																					p.Q217E													.	GCOM1-91	0			c.C649G						.						95.0	90.0	92.0					15																	57922023		2192	4292	6484	SO:0001583	missense	145781	exon6			GTAGCGCAAGTTG	FJ970029		15q21.3	2012-10-05			ENSG00000263155	ENSG00000263155			43444	protein-coding gene	gene with protein product	"""myocardium-enriched zonula adherens protein"""	614071				20093627, 21992629, 22160502	Standard	NM_001018100		Approved	MYOZAP, Gup, Gup1, GCOM1		P0CAP1	OTTHUMG00000132453	ENST00000267853.5:c.649C>G	15.37:g.57922023C>G	ENSP00000267853:p.Gln217Glu	113	0		106	5	NM_001018090	0	0	0	0	0	D2E9U7|Q6EER8|Q6EES2|Q6EEV3|Q6EF00|Q6EF01|Q6EF02|Q6EF46|Q6EFN8|Q6EM48|Q6K046|Q6K050|Q6K051|Q6ZQZ3|Q8NC58|Q8NCF3|Q96DI5|Q96JB7|Q96NF5	Missense_Mutation	SNP	ENST00000267853.5	37	CCDS10162.1	.	.	.	.	.	.	.	.	.	.	C	8.397	0.841141	0.16891	.	.	ENSG00000137878	ENST00000380569;ENST00000380561;ENST00000396180;ENST00000380560;ENST00000267853;ENST00000380565;ENST00000380568	T;T;T;T;T;T;T	0.41065	1.01;1.01;1.01;1.01;1.01;1.01;1.01	5.43	3.54	0.40534	.	0.231577	0.44688	D	0.000424	T	0.37652	0.1011	L	0.56769	1.78	0.43326	D	0.995354	P;P;P;B	0.43024	0.544;0.798;0.544;0.402	B;B;B;B	0.44044	0.346;0.439;0.346;0.346	T	0.14172	-1.0482	10	0.13108	T	0.6	-7.7731	7.7864	0.29095	0.2881:0.6345:0.0:0.0774	.	217;217;217;217	P0CAP1-2;P0CAP1-11;P0CAP1-4;P0CAP1	.;.;.;GCOM1_HUMAN	E	217;186;186;148;217;217;217	ENSP00000369943:Q217E;ENSP00000369935:Q186E;ENSP00000379483:Q186E;ENSP00000369933:Q148E;ENSP00000267853:Q217E;ENSP00000369939:Q217E;ENSP00000369942:Q217E	ENSP00000267853:Q217E	Q	+	1	0	GCOM1	55709315	0.992000	0.36948	0.004000	0.12327	0.268000	0.26511	3.376000	0.52417	0.642000	0.30620	0.650000	0.86243	CAA	.		0.413	MYZAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255716.2	NM_001018100	
ZSCAN10	84891	hgsc.bcm.edu	37	16	3142579	3142579	+	Silent	SNP	C	C	T			TCGA-AL-3467-01A-01D-1252-08	TCGA-AL-3467-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a74ffd4b-fa89-49ae-aa1d-3052a5440fa2	2ab402fb-392f-4441-a979-713a602c9cd3	g.chr16:3142579C>T	ENST00000252463.2	-	1	282	c.195G>A	c.(193-195)gaG>gaA	p.E65E	ZSCAN10_ENST00000575108.1_Intron|ZSCAN10_ENST00000538082.2_Missense_Mutation_p.G73R|ZSCAN10_ENST00000572548.1_Intron	NM_032805.1	NP_116194.1	Q96SZ4	ZSC10_HUMAN	zinc finger and SCAN domain containing 10	65	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(3)|endometrium(3)|kidney(1)|lung(8)|ovary(2)|prostate(1)|skin(4)|urinary_tract(1)	24						GGTGGATGCCCTCGAGCAGCA	0.701																																					p.E65E		.											.	ZSCAN10-227	0			c.G195A						.						8.0	8.0	8.0					16																	3142579		2158	4257	6415	SO:0001819	synonymous_variant	84891	exon1			GATGCCCTCGAGC	AA206569	CCDS10493.1, CCDS61813.1, CCDS61814.1	16p13.3	2013-01-08	2007-02-20	2007-02-20		ENSG00000130182		"""-"", ""Zinc fingers, C2H2-type"""	12997	protein-coding gene	gene with protein product			"""zinc finger protein 206"""	ZNF206		9653642	Standard	NM_032805		Approved		uc002ctv.1	Q96SZ4		ENST00000252463.2:c.195G>A	16.37:g.3142579C>T		7	0		7	2	NM_032805	0	0	0	0	0	B3KQD3|H0YFS6|Q1WWM2	Silent	SNP	ENST00000252463.2	37	CCDS10493.1	.	.	.	.	.	.	.	.	.	.	C	11.85	1.761353	0.31228	.	.	ENSG00000130182	ENST00000538082	T	0.15372	2.43	5.4	4.45	0.53987	.	.	.	.	.	T	0.10852	0.0265	.	.	.	0.80722	D	1	B	0.22080	0.064	B	0.22880	0.042	T	0.13388	-1.0511	8	0.14252	T	0.57	-35.1187	10.1609	0.42851	0.0:0.9077:0.0:0.0923	.	88	Q1WWM2	.	R	88	ENSP00000440047:G88R	ENSP00000440047:G88R	G	-	1	0	ZSCAN10	3082580	0.002000	0.14202	0.999000	0.59377	0.059000	0.15707	0.052000	0.14163	1.286000	0.44565	0.561000	0.74099	GGG	.		0.701	ZSCAN10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437124.2	NM_032805	
SRCAP	10847	hgsc.bcm.edu	37	16	30745323	30745323	+	Missense_Mutation	SNP	C	C	G			TCGA-AL-3467-01A-01D-1252-08	TCGA-AL-3467-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a74ffd4b-fa89-49ae-aa1d-3052a5440fa2	2ab402fb-392f-4441-a979-713a602c9cd3	g.chr16:30745323C>G	ENST00000262518.4	+	30	6988	c.6603C>G	c.(6601-6603)ttC>ttG	p.F2201L	SRCAP_ENST00000344771.4_Missense_Mutation_p.F2043L|SRCAP_ENST00000395059.2_Missense_Mutation_p.F2139L	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	2201					histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			CAGCCTATTTCAAACAGGTAC	0.453																																					p.F2201L		.											.	SRCAP-94	0			c.C6603G						.						67.0	60.0	63.0					16																	30745323		2197	4300	6497	SO:0001583	missense	10847	exon30			CTATTTCAAACAG	AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.6603C>G	16.37:g.30745323C>G	ENSP00000262518:p.Phe2201Leu	27	0		34	2	NM_006662	0	0	2	2	0	B0JZA6|O15026|Q7Z744|Q9Y5L9	Missense_Mutation	SNP	ENST00000262518.4	37	CCDS10689.2	.	.	.	.	.	.	.	.	.	.	C	11.79	1.744801	0.30865	.	.	ENSG00000080603	ENST00000262518;ENST00000395059;ENST00000344771	T;T;T	0.07800	3.16;3.16;3.16	5.24	2.95	0.34219	.	0.380726	0.22784	N	0.055681	T	0.11367	0.0277	N	0.13003	0.285	0.31625	N	0.649832	D;D	0.71674	0.998;0.997	D;D	0.80764	0.994;0.985	T	0.11446	-1.0587	10	0.34782	T	0.22	-14.3882	7.2742	0.26275	0.0:0.329:0.0:0.671	.	2139;2201	Q6ZRS2-2;Q6ZRS2	.;SRCAP_HUMAN	L	2201;2139;2043	ENSP00000262518:F2201L;ENSP00000378499:F2139L;ENSP00000343042:F2043L	ENSP00000262518:F2201L	F	+	3	2	SRCAP	30652824	0.995000	0.38212	1.000000	0.80357	0.948000	0.59901	0.370000	0.20433	0.414000	0.25790	-0.414000	0.06135	TTC	.		0.453	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255523.1	NM_006662	
ZC3H18	124245	broad.mit.edu	37	16	88694029	88694029	+	Splice_Site	SNP	G	G	C			TCGA-AL-3467-01A-01D-1252-08	TCGA-AL-3467-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a74ffd4b-fa89-49ae-aa1d-3052a5440fa2	2ab402fb-392f-4441-a979-713a602c9cd3	g.chr16:88694029G>C	ENST00000301011.5	+	14	2308		c.e14-1		ZC3H18_ENST00000452588.2_Splice_Site	NM_144604.3	NP_653205.3	Q86VM9	ZCH18_HUMAN	zinc finger CCCH-type containing 18							nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(9)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	42				BRCA - Breast invasive adenocarcinoma(80;0.0542)		TGTGTGTCCAGGTCCCTGAGC	0.602																																					.	Ovarian(121;375 2276 20373 38669)												.	ZC3H18-69	0			c.2109-1G>C						.						139.0	99.0	113.0					16																	88694029		2198	4300	6498	SO:0001630	splice_region_variant	124245	exon14			TGTCCAGGTCCCT	BC001584	CCDS10967.1, CCDS73924.1	16q24.2-q24.3	2012-07-05			ENSG00000158545	ENSG00000158545		"""Zinc fingers, CCCH-type domain containing"""	25091	protein-coding gene	gene with protein product						17579712	Standard	NM_144604		Approved	NHN1	uc002fky.3	Q86VM9	OTTHUMG00000137679	ENST00000301011.5:c.2109-1G>C	16.37:g.88694029G>C		186	0		192	4	NM_144604	0	0	1	1	0	Q96DG4|Q96MP7	Splice_Site	SNP	ENST00000301011.5	37	CCDS10967.1	.	.	.	.	.	.	.	.	.	.	G	12.61	1.990257	0.35131	.	.	ENSG00000158545	ENST00000301011;ENST00000452588	.	.	.	4.69	4.69	0.59074	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.9725	0.89117	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ZC3H18	87221530	1.000000	0.71417	0.988000	0.46212	0.130000	0.20726	9.436000	0.97532	2.322000	0.78497	0.491000	0.48974	.	.		0.602	ZC3H18-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000269168.1	NM_144604	Intron
HIC1	3090	hgsc.bcm.edu	37	17	1960939	1960939	+	Missense_Mutation	SNP	C	C	G	rs373870177		TCGA-AL-3467-01A-01D-1252-08	TCGA-AL-3467-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a74ffd4b-fa89-49ae-aa1d-3052a5440fa2	2ab402fb-392f-4441-a979-713a602c9cd3	g.chr17:1960939C>G	ENST00000322941.3	+	2	1012	c.1012C>G	c.(1012-1014)Ctg>Gtg	p.L338V	SMG6_ENST00000573166.1_5'Flank|HIC1_ENST00000399849.3_Missense_Mutation_p.L319V	NM_001098202.1	NP_001091672.1	Q14526	HIC1_HUMAN	hypermethylated in cancer 1	338					intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(1)|lung(1)|prostate(1)	3				READ - Rectum adenocarcinoma(1115;0.236)		CGAGCCGGGCCTGGGTAGCTA	0.766																																					p.L338V		.											.	HIC1-135	0			c.C1012G						.		VAL/LEU,VAL/LEU	0,2492		0,0,1246	3.0	3.0	3.0		1012,955	2.1	1.0	17		3	2,6230		0,2,3114	no	missense,missense	HIC1	NM_001098202.1,NM_006497.3	32,32	0,2,4360	GG,GC,CC		0.0321,0.0,0.0229	benign,benign	338/734,319/715	1960939	2,8722	1246	3116	4362	SO:0001583	missense	3090	exon2			CCGGGCCTGGGTA		CCDS42229.1, CCDS42230.1	17p13.3	2013-01-09				ENSG00000177374		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	4909	protein-coding gene	gene with protein product		603825					Standard	NM_006497		Approved	ZBTB29, ZNF901	uc010cjy.3	Q14526		ENST00000322941.3:c.1012C>G	17.37:g.1960939C>G	ENSP00000314080:p.Leu338Val	8	2		10	6	NM_001098202	0	0	0	0	0	D3DTI4	Missense_Mutation	SNP	ENST00000322941.3	37	CCDS42229.1	.	.	.	.	.	.	.	.	.	.	c	11.22	1.575074	0.28092	0.0	3.21E-4	ENSG00000177374	ENST00000399849;ENST00000322941	T;T	0.06933	3.29;3.24	3.04	2.06	0.26882	.	.	.	.	.	T	0.04543	0.0124	L	0.29908	0.895	0.27607	N	0.948784	D	0.53885	0.963	B	0.34873	0.191	T	0.37888	-0.9686	9	0.19590	T	0.45	.	7.4577	0.27276	0.0:0.7749:0.0:0.2251	.	338	Q14526	HIC1_HUMAN	V	319;338	ENSP00000382742:L319V;ENSP00000314080:L338V	ENSP00000314080:L338V	L	+	1	2	HIC1	1907689	0.571000	0.26659	0.994000	0.49952	0.920000	0.55202	1.173000	0.31920	0.490000	0.27771	0.394000	0.25966	CTG	.		0.766	HIC1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438878.1	NM_006497	
ASIC2	40	hgsc.bcm.edu	37	17	31618997	31618997	+	Intron	SNP	C	C	A	rs112647385	byFrequency	TCGA-AL-3467-01A-01D-1252-08	TCGA-AL-3467-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a74ffd4b-fa89-49ae-aa1d-3052a5440fa2	2ab402fb-392f-4441-a979-713a602c9cd3	g.chr17:31618997C>A	ENST00000359872.6	-	2	1317				ASIC2_ENST00000448983.1_5'Flank|ASIC2_ENST00000225823.2_Missense_Mutation_p.R46L	NM_001094.4	NP_001085.2	Q16515	ASIC2_HUMAN	acid-sensing (proton-gated) ion channel 2						central nervous system development (GO:0007417)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|ion transmembrane transport (GO:0034220)|monovalent inorganic cation transport (GO:0015672)|negative regulation of apoptotic process (GO:0043066)|peripheral nervous system development (GO:0007422)|phototransduction (GO:0007602)|positive regulation of synapse assembly (GO:0051965)|protein localization to synapse (GO:0035418)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|regulation of membrane potential (GO:0042391)|regulation of systemic arterial blood pressure by aortic arch baroreceptor feedback (GO:0003026)|regulation of vasoconstriction (GO:0019229)|response to acid chemical (GO:0001101)|response to acidic pH (GO:0010447)|sensory perception of sound (GO:0007605)|sensory perception of sour taste (GO:0050915)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ion gated channel activity (GO:0022839)|ligand-gated sodium channel activity (GO:0015280)|voltage-gated sodium channel activity (GO:0005248)									Amiloride(DB00594)	CTGCAGCGCCCGCTCGCCGCC	0.806													C|||	1091	0.217851	0.112	0.1902	5008	,	,		5226	0.3194		0.2664	False		,,,				2504	0.226				p.R46L		.											.	.	0			c.G137T						.						1.0	2.0	2.0					17																	31618997		903	2226	3129	SO:0001627	intron_variant	40	exon1			AGCGCCCGCTCGC	AL834182	CCDS11276.1, CCDS42296.1	17q11.2-q12	2012-02-23	2012-02-22	2012-02-22	ENSG00000108684	ENSG00000108684		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	99	protein-coding gene	gene with protein product	"""degenerin"""	601784	"""amiloride-sensitive cation channel 1, neuronal"""	ACCN, ACCN1		8921408	Standard	NM_183377		Approved	ASIC2a, BNC1, BNaC1, hBNaC1, MDEG	uc002hhu.3	Q16515	OTTHUMG00000132885	ENST00000359872.6:c.556-179912G>T	17.37:g.31618997C>A		2	1		7	5	NM_183377	0	0	0	0	0	E9PBX2|Q13553|Q6DJU1|Q8N3E2	Missense_Mutation	SNP	ENST00000359872.6	37	CCDS42296.1	567	0.25961538461538464	84	0.17073170731707318	81	0.22375690607734808	197	0.34440559440559443	205	0.2704485488126649	C	13.69	2.313571	0.40996	.	.	ENSG00000108684	ENST00000225823	T	0.65178	-0.14	4.45	-0.0635	0.13776	.	1.386070	0.04769	N	0.427624	T	0.00012	0.0000	N	0.08118	0	0.58432	P	5.000000000032756E-6	B	0.17038	0.02	B	0.10450	0.005	T	0.17715	-1.0360	9	0.29301	T	0.29	-24.8125	4.0823	0.09932	0.0:0.3667:0.3479:0.2854	.	46	E9PBX2	.	L	46	ENSP00000225823:R46L	ENSP00000225823:R46L	R	-	2	0	ACCN1	28643110	0.458000	0.25760	0.926000	0.36857	0.865000	0.49528	1.119000	0.31258	0.274000	0.22072	0.306000	0.20318	CGG	C|0.740;A|0.260		0.806	ASIC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447552.1	NM_183377, NM_001094	
CDC27	996	hgsc.bcm.edu	37	17	45249350	45249350	+	Missense_Mutation	SNP	T	T	C			TCGA-AL-3467-01A-01D-1252-08	TCGA-AL-3467-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a74ffd4b-fa89-49ae-aa1d-3052a5440fa2	2ab402fb-392f-4441-a979-713a602c9cd3	g.chr17:45249350T>C	ENST00000066544.3	-	3	277	c.184A>G	c.(184-186)Aaa>Gaa	p.K62E	CDC27_ENST00000446365.2_Intron|RP5-867C24.5_ENST00000572193.1_RNA|CDC27_ENST00000528748.1_5'UTR|CDC27_ENST00000531206.1_Missense_Mutation_p.K62E|CDC27_ENST00000527547.1_Missense_Mutation_p.K62E	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	62					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						CTGTGTCCTTTCAAGAGTCTA	0.348																																					p.K62E		.											.	CDC27-291	0			c.A184G						.						42.0	41.0	41.0					17																	45249350		2202	4300	6502	SO:0001583	missense	996	exon3			GTCCTTTCAAGAG	U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.184A>G	17.37:g.45249350T>C	ENSP00000066544:p.Lys62Glu	99	2		80	4	NM_001114091	0	0	12	12	0	G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	ENST00000066544.3	37	CCDS11509.1	.	.	.	.	.	.	.	.	.	.	T	19.40	3.820387	0.71028	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000527547;ENST00000526866	T;T;T;T	0.73575	-0.76;-0.76;-0.76;-0.76	5.69	5.69	0.88448	Tetratricopeptide-like helical (1);	0.518646	0.23036	N	0.052667	T	0.70971	0.3285	L	0.39467	1.215	0.80722	D	1	B;P;P	0.46578	0.314;0.499;0.88	B;B;P	0.45099	0.082;0.112;0.469	T	0.74754	-0.3558	10	0.72032	D	0.01	-34.4674	13.8831	0.63693	0.0:0.0:0.0:1.0	.	62;62;62	G5EA36;G3V1C4;P30260	.;.;CDC27_HUMAN	E	62	ENSP00000066544:K62E;ENSP00000434614:K62E;ENSP00000437339:K62E;ENSP00000432105:K62E	ENSP00000066544:K62E	K	-	1	0	CDC27	42604349	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.803000	0.85983	2.173000	0.68751	0.482000	0.46254	AAA	.		0.348	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2		
TBX4	9496	hgsc.bcm.edu;broad.mit.edu	37	17	59560359	59560359	+	Missense_Mutation	SNP	G	G	A			TCGA-AL-3467-01A-01D-1252-08	TCGA-AL-3467-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a74ffd4b-fa89-49ae-aa1d-3052a5440fa2	2ab402fb-392f-4441-a979-713a602c9cd3	g.chr17:59560359G>A	ENST00000240335.1	+	8	1165	c.1120G>A	c.(1120-1122)Gac>Aac	p.D374N	TBX4_ENST00000393853.4_Missense_Mutation_p.D375N|TBX4_ENST00000589449.1_3'UTR	NM_018488.2	NP_060958.2	P57082	TBX4_HUMAN	T-box 4	374					angiogenesis (GO:0001525)|embryonic limb morphogenesis (GO:0030326)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|morphogenesis of an epithelium (GO:0002009)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(2)|lung(15)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	40						CCCTCCCTACGACCAGCAAAT	0.597																																					p.D374N		.											.	TBX4-227	0			c.G1120A						.						66.0	58.0	61.0					17																	59560359		2203	4300	6503	SO:0001583	missense	9496	exon8			CCCTACGACCAGC	AF188703	CCDS11629.1	17q21-q22	2005-10-11				ENSG00000121075		"""T-boxes"""	11603	protein-coding gene	gene with protein product		601719				10945475	Standard	NM_018488		Approved		uc002izi.3	P57082		ENST00000240335.1:c.1120G>A	17.37:g.59560359G>A	ENSP00000240335:p.Asp374Asn	91	0		91	6	NM_018488	0	0	0	0	0	A5PKU7|B2RMT1|B7ZLV3	Missense_Mutation	SNP	ENST00000240335.1	37	CCDS11629.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.231687	0.79688	.	.	ENSG00000121075	ENST00000393853;ENST00000240335	D;D	0.85702	-2.02;-2.02	5.51	5.51	0.81932	.	0.377447	0.27455	N	0.019283	T	0.78805	0.4341	L	0.40543	1.245	0.58432	D	0.999997	P;P	0.47545	0.896;0.897	B;B	0.35971	0.215;0.212	T	0.79127	-0.1931	9	.	.	.	.	18.4116	0.90554	0.0:0.0:1.0:0.0	.	375;374	A5PKU7;P57082	.;TBX4_HUMAN	N	375;374	ENSP00000377435:D375N;ENSP00000240335:D374N	.	D	+	1	0	TBX4	56915141	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.574000	0.82434	2.590000	0.87494	0.655000	0.94253	GAC	.		0.597	TBX4-002	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000449649.1	NM_018488	
ANKRD30B	374860	broad.mit.edu	37	18	14754902	14754902	+	Missense_Mutation	SNP	G	G	A			TCGA-AL-3467-01A-01D-1252-08	TCGA-AL-3467-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a74ffd4b-fa89-49ae-aa1d-3052a5440fa2	2ab402fb-392f-4441-a979-713a602c9cd3	g.chr18:14754902G>A	ENST00000358984.4	+	4	695	c.515G>A	c.(514-516)aGc>aAc	p.S172N	ANKRD30B_ENST00000579292.1_Intron|ANKRD30B_ENST00000447268.2_Missense_Mutation_p.S172N	NM_001145029.1	NP_001138501.1	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	172										breast(3)|endometrium(4)|kidney(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	22						TTACAGGCTAGCCTCACACCC	0.308																																					p.S172N													.	ANKRD30B-24	0			c.G515A						.						67.0	60.0	62.0					18																	14754902		692	1588	2280	SO:0001583	missense	374860	exon4			AGGCTAGCCTCAC	BC028407	CCDS54182.1	18p11.21	2013-01-10			ENSG00000180777	ENSG00000180777		"""Ankyrin repeat domain containing"""	24165	protein-coding gene	gene with protein product						11280766	Standard	NM_001145029		Approved	NY-BR-1.1	uc010dlo.2	Q9BXX2		ENST00000358984.4:c.515G>A	18.37:g.14754902G>A	ENSP00000351875:p.Ser172Asn	13	2		5	4	NM_001145029	0	0	0	0	0	B4DGP1|F8WAG3|Q4G175	Missense_Mutation	SNP	ENST00000358984.4	37	CCDS54182.1	.	.	.	.	.	.	.	.	.	.	N	0.090	-1.168457	0.01660	.	.	ENSG00000180777	ENST00000358984;ENST00000447268	T;T	0.52057	0.68;0.68	2.14	-4.28	0.03732	.	.	.	.	.	T	0.18173	0.0436	N	0.05177	-0.1	0.09310	N	1	B	0.28378	0.209	B	0.20577	0.03	T	0.18618	-1.0331	9	0.18276	T	0.48	.	5.2749	0.15643	0.2157:0.1866:0.5977:0.0	.	172	F8WAG3	.	N	172	ENSP00000351875:S172N;ENSP00000399031:S172N	ENSP00000351875:S172N	S	+	2	0	ANKRD30B	14744902	0.021000	0.18746	0.190000	0.23270	0.013000	0.08279	-0.082000	0.11304	-1.136000	0.02892	-0.869000	0.02991	AGC	.		0.308	ANKRD30B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443557.1	NM_001145029	
FBXO27	126433	broad.mit.edu	37	19	39521937	39521937	+	Missense_Mutation	SNP	G	G	C			TCGA-AL-3467-01A-01D-1252-08	TCGA-AL-3467-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a74ffd4b-fa89-49ae-aa1d-3052a5440fa2	2ab402fb-392f-4441-a979-713a602c9cd3	g.chr19:39521937G>C	ENST00000292853.4	-	3	507	c.388C>G	c.(388-390)Caa>Gaa	p.Q130E	FBXO27_ENST00000600828.1_Missense_Mutation_p.Q129E|FBXO27_ENST00000509137.2_Missense_Mutation_p.Q130E|CTB-189B5.3_ENST00000597303.1_RNA	NM_178820.3	NP_849142.1	Q8NI29	FBX27_HUMAN	F-box protein 27	130	FBA. {ECO:0000255|PROSITE- ProRule:PRU00482}.					SCF ubiquitin ligase complex (GO:0019005)	glycoprotein binding (GO:0001948)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(5)|ovary(1)|urinary_tract(2)	17	all_cancers(60;3.79e-07)|all_lung(34;1.26e-07)|Lung NSC(34;1.46e-07)|all_epithelial(25;4.69e-07)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			CCACCGTGTTGCACCATCCAC	0.587																																					p.Q130E													.	FBXO27-227	0			c.C388G						.						78.0	73.0	75.0					19																	39521937		2203	4300	6503	SO:0001583	missense	126433	exon3			CGTGTTGCACCAT	AF436061	CCDS12527.1	19q13.2	2008-02-05	2004-06-15			ENSG00000161243		"""F-boxes /  ""other"""""	18753	protein-coding gene	gene with protein product		609099	"""F-box only protein 27"""			126433	Standard	NM_178820		Approved	Fbg5, Fbx27	uc002okh.3	Q8NI29		ENST00000292853.4:c.388C>G	19.37:g.39521937G>C	ENSP00000292853:p.Gln130Glu	122	9		142	20	NM_178820	0	0	1	1	0	Q96C87	Missense_Mutation	SNP	ENST00000292853.4	37	CCDS12527.1	.	.	.	.	.	.	.	.	.	.	G	5.303	0.241265	0.10077	.	.	ENSG00000161243	ENST00000292853;ENST00000509137	T;T	0.27256	1.68;1.68	3.66	-6.55	0.01854	Galactose-binding domain-like (1);F-box associated (FBA) domain (2);	2.361880	0.01889	N	0.038431	T	0.05823	0.0152	N	0.00595	-1.35	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.45338	-0.9268	10	0.02654	T	1	-18.5204	8.9226	0.35621	0.0:0.4812:0.1868:0.3321	.	130	Q8NI29	FBX27_HUMAN	E	130	ENSP00000292853:Q130E;ENSP00000437662:Q130E	ENSP00000292853:Q130E	Q	-	1	0	FBXO27	44213777	0.000000	0.05858	0.000000	0.03702	0.526000	0.34562	-0.080000	0.11339	-0.660000	0.05352	0.479000	0.44913	CAA	.		0.587	FBXO27-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000463281.1		
THSD7B	80731	broad.mit.edu	37	2	138400116	138400116	+	Silent	SNP	C	C	T			TCGA-AL-3467-01A-01D-1252-08	TCGA-AL-3467-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a74ffd4b-fa89-49ae-aa1d-3052a5440fa2	2ab402fb-392f-4441-a979-713a602c9cd3	g.chr2:138400116C>T	ENST00000409968.1	+	21	4036	c.3858C>T	c.(3856-3858)tgC>tgT	p.C1286C	THSD7B_ENST00000413152.2_Silent_p.C1258C|THSD7B_ENST00000272643.3_Silent_p.C1289C|THSD7B_ENST00000543459.1_Intron			Q9C0I4	THS7B_HUMAN	thrombospondin, type I, domain containing 7B	1288	TSP type-1 16. {ECO:0000255|PROSITE- ProRule:PRU00210}.					integral component of membrane (GO:0016021)				NS(3)|breast(3)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(14)|lung(57)|ovary(4)|pancreas(3)|prostate(11)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	134				BRCA - Breast invasive adenocarcinoma(221;0.19)		GACGGCCATGCCCCACAGAGC	0.507																																					.													.	THSD7B-75	0			.						.						112.0	113.0	113.0					2																	138400116		1903	4114	6017	SO:0001819	synonymous_variant	80731	.			GCCATGCCCCACA			2q22.1	2006-11-24			ENSG00000144229	ENSG00000144229			29348	protein-coding gene	gene with protein product						11214970	Standard	NM_001080427		Approved	KIAA1679	uc002tva.1	Q9C0I4	OTTHUMG00000153590	ENST00000409968.1:c.3858C>T	2.37:g.138400116C>T		219	0		220	5	.	0	0	0	0	0		Silent	SNP	ENST00000409968.1	37																																																																																				.		0.507	THSD7B-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331769.2	XM_046570.9	
CACNB4	785	hgsc.bcm.edu	37	2	152727361	152727361	+	Missense_Mutation	SNP	T	T	C			TCGA-AL-3467-01A-01D-1252-08	TCGA-AL-3467-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a74ffd4b-fa89-49ae-aa1d-3052a5440fa2	2ab402fb-392f-4441-a979-713a602c9cd3	g.chr2:152727361T>C	ENST00000539935.1	-	7	680	c.613A>G	c.(613-615)Aaa>Gaa	p.K205E	CACNB4_ENST00000427385.1_Missense_Mutation_p.K187E|CACNB4_ENST00000201943.5_Missense_Mutation_p.K205E|CACNB4_ENST00000397327.2_Missense_Mutation_p.K158E|CACNB4_ENST00000534999.1_Missense_Mutation_p.K171E|CACNB4_ENST00000360283.6_Intron	NM_000726.3|NM_001145798.1	NP_000717.2|NP_001139270.1	O00305	CACB4_HUMAN	calcium channel, voltage-dependent, beta 4 subunit	205					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion transmembrane transport (GO:0070588)|cAMP metabolic process (GO:0046058)|cellular calcium ion homeostasis (GO:0006874)|detection of light stimulus involved in visual perception (GO:0050908)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|membrane depolarization (GO:0051899)|muscle fiber development (GO:0048747)|neuromuscular junction development (GO:0007528)|neuronal action potential propagation (GO:0019227)|Peyer's patch development (GO:0048541)|regulation of voltage-gated calcium channel activity (GO:1901385)|spleen development (GO:0048536)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|T cell receptor signaling pathway (GO:0050852)|thymus development (GO:0048538)|transport (GO:0006810)	cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|synapse (GO:0045202)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)	11				BRCA - Breast invasive adenocarcinoma(221;0.156)	Dronedarone(DB04855)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	CTTACCACTTTTTGCTTCTGT	0.343																																					p.K205E		.											.	CACNB4-24	0			c.A613G						.						83.0	75.0	77.0					2																	152727361		1856	4097	5953	SO:0001583	missense	785	exon7			CCACTTTTTGCTT	AF038852	CCDS46426.1, CCDS46427.1, CCDS46428.1, CCDS54409.1	2q22-q23	2009-09-04			ENSG00000182389	ENSG00000182389		"""Calcium channel subunits"""	1404	protein-coding gene	gene with protein product		601949				9628818	Standard	NM_000726		Approved	EJM4	uc002tya.3	O00305	OTTHUMG00000155091	ENST00000539935.1:c.613A>G	2.37:g.152727361T>C	ENSP00000438949:p.Lys205Glu	35	0		33	2	NM_001145798	0	0	0	0	0	A7BJ74|A8K1Y4|B4DG40|O60515|Q6B000|Q96L40	Missense_Mutation	SNP	ENST00000539935.1	37	CCDS46426.1	.	.	.	.	.	.	.	.	.	.	T	23.7	4.452993	0.84209	.	.	ENSG00000182389	ENST00000539935;ENST00000543269;ENST00000439467;ENST00000534999;ENST00000397327;ENST00000427385;ENST00000201943	D;D;D;D;D;D	0.84223	-1.82;-1.82;-1.82;-1.82;-1.82;-1.82	5.92	5.92	0.95590	Src homology-3 domain (1);	.	.	.	.	D	0.93106	0.7805	M	0.89414	3.03	0.80722	D	1	D;B;B;B;B	0.58268	0.982;0.196;0.387;0.111;0.177	D;B;B;B;B	0.67548	0.952;0.077;0.106;0.067;0.142	D	0.94194	0.7444	9	0.87932	D	0	14.7567	15.1766	0.72916	0.0:0.0:0.0:1.0	.	205;171;205;187;171	A7BJ74;E7DBM8;O00305;B4DG40;O00305-2	.;.;CACB4_HUMAN;.;.	E	205;162;200;171;158;187;205	ENSP00000438949:K205E;ENSP00000390161:K200E;ENSP00000443893:K171E;ENSP00000380490:K158E;ENSP00000410978:K187E;ENSP00000201943:K205E	ENSP00000201943:K205E	K	-	1	0	CACNB4	152435607	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.791000	0.75120	2.255000	0.74692	0.533000	0.62120	AAA	.		0.343	CACNB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000338385.4	NM_000726.3	
TMEFF2	23671	broad.mit.edu	37	2	193056717	193056717	+	Splice_Site	SNP	T	T	C			TCGA-AL-3467-01A-01D-1252-08	TCGA-AL-3467-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a74ffd4b-fa89-49ae-aa1d-3052a5440fa2	2ab402fb-392f-4441-a979-713a602c9cd3	g.chr2:193056717T>C	ENST00000272771.5	-	2	1357		c.e2-2		TMEFF2_ENST00000409056.3_Splice_Site|TMEFF2_ENST00000392314.1_Splice_Site	NM_016192.2	NP_057276.2	Q9UIK5	TEFF2_HUMAN	transmembrane protein with EGF-like and two follistatin-like domains 2							extracellular region (GO:0005576)|integral component of membrane (GO:0016021)				breast(2)|cervix(1)|kidney(2)|large_intestine(4)|liver(1)|lung(12)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27			OV - Ovarian serous cystadenocarcinoma(117;0.0835)			CATCATAACCTCAAATTCAAA	0.333																																					.	Pancreas(50;1277 1381 28487 47072)												.	TMEFF2-524	0			c.173-2A>G						.						73.0	70.0	71.0					2																	193056717		2203	4300	6503	SO:0001630	splice_region_variant	23671	exon3			ATAACCTCAAATT	AB017269	CCDS2314.1	2q32.3	2010-05-04			ENSG00000144339	ENSG00000144339			11867	protein-coding gene	gene with protein product	"""transmembrane protein TENB2"", ""tomoregulin"", ""cancer/testis antigen family 120, member 2"""	605734				10903839	Standard	NM_016192		Approved	TENB2, HPP1, TR, TPEF, CT120.2	uc002utc.3	Q9UIK5	OTTHUMG00000132723	ENST00000272771.5:c.173-2A>G	2.37:g.193056717T>C		88	0		85	3	NM_016192	0	0	0	0	0	Q2FA44|Q4ZFW4|Q53H90|Q53RE1|Q8N2R5|Q9NR15|Q9NSS5|Q9P2Y9|Q9UK65	Splice_Site	SNP	ENST00000272771.5	37	CCDS2314.1	.	.	.	.	.	.	.	.	.	.	T	21.7	4.193835	0.78902	.	.	ENSG00000144339	ENST00000392314;ENST00000272771;ENST00000409056	.	.	.	6.03	6.03	0.97812	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.5655	0.84588	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	TMEFF2	192764962	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.698000	0.84413	2.302000	0.77476	0.533000	0.62120	.	.		0.333	TMEFF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256065.2	NM_016192	Intron
CCDC108	255101	ucsc.edu	37	2	219868976	219868976	+	Silent	SNP	T	T	C			TCGA-AL-3467-01A-01D-1252-08	TCGA-AL-3467-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	a74ffd4b-fa89-49ae-aa1d-3052a5440fa2	2ab402fb-392f-4441-a979-713a602c9cd3	g.chr2:219868976T>C	ENST00000341552.5	-	33	5336	c.5253A>G	c.(5251-5253)ccA>ccG	p.P1751P	MIR375_ENST00000362103.2_RNA|CCDC108_ENST00000453220.1_Silent_p.P1751P|CCDC108_ENST00000441968.1_Silent_p.P1751P|AC097468.4_ENST00000441450.1_RNA	NM_194302.2	NP_919278.2	Q6ZU64	CC108_HUMAN	coiled-coil domain containing 108	1751						integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(1)|lung(34)|ovary(2)|pancreas(1)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Renal(207;0.0915)		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GATAGTGCTCTGGTCTGTCTT	0.537																																					p.P1751P													.	CCDC108-94	0			c.A5253G						.						167.0	157.0	161.0					2																	219868976		2203	4300	6503	SO:0001819	synonymous_variant	255101	exon33			GTGCTCTGGTCTG	NM_194302, AL833882, AK127189	CCDS2430.2, CCDS2431.2, CCDS63125.1, CCDS63126.1	2q35	2008-02-05			ENSG00000181378	ENSG00000181378			25325	protein-coding gene	gene with protein product		614270				12477932	Standard	NM_194302		Approved	DKFZp434O0527, MGC35338	uc002vjl.2	Q6ZU64	OTTHUMG00000133013	ENST00000341552.5:c.5253A>G	2.37:g.219868976T>C		315	0		332	2	NM_194302	0	0	4	4	0	A2BDD8|E9PCR1|E9PG25|E9PG72|Q6ZSR8|Q8N0T4|Q8NDJ3	Silent	SNP	ENST00000341552.5	37	CCDS2430.2																																																																																			.		0.537	CCDC108-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256598.4	NM_194302	
AGAP1	116987	ucsc.edu	37	2	237028963	237028963	+	Missense_Mutation	SNP	G	G	A			TCGA-AL-3467-01A-01D-1252-08	TCGA-AL-3467-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	a74ffd4b-fa89-49ae-aa1d-3052a5440fa2	2ab402fb-392f-4441-a979-713a602c9cd3	g.chr2:237028963G>A	ENST00000304032.8	+	17	2822	c.2242G>A	c.(2242-2244)Gcc>Acc	p.A748T	AGAP1_ENST00000336665.5_Missense_Mutation_p.A695T|AGAP1_ENST00000409538.1_Missense_Mutation_p.A960T|AGAP1_ENST00000428334.2_Missense_Mutation_p.A587T	NM_001037131.2	NP_001032208.1	Q9UPQ3	AGAP1_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 1	748					protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|phospholipid binding (GO:0005543)|zinc ion binding (GO:0008270)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(11)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41						CCTGCGGACGGCCATCCTGCT	0.711																																					p.A748T													.	AGAP1-93	0			c.G2242A						.						35.0	37.0	36.0					2																	237028963		2201	4293	6494	SO:0001583	missense	116987	exon17			CGGACGGCCATCC	AF413078	CCDS2514.1, CCDS33408.1, CCDS58756.1	2q37	2013-01-10	2008-09-22	2008-09-22	ENSG00000157985	ENSG00000157985		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16922	protein-coding gene	gene with protein product		608651	"""centaurin, gamma 2"""	CENTG2			Standard	NM_001037131		Approved	KIAA1099, GGAP1	uc002vvs.3	Q9UPQ3	OTTHUMG00000133293	ENST00000304032.8:c.2242G>A	2.37:g.237028963G>A	ENSP00000307634:p.Ala748Thr	109	0		93	4	NM_001037131	0	0	7	7	0	B2RTX7|Q541S5|Q6P9D7|Q9NV93	Missense_Mutation	SNP	ENST00000304032.8	37	CCDS33408.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.6|23.6	4.430315|4.430315	0.83776|0.83776	.|.	.|.	ENSG00000157985|ENSG00000157985	ENST00000304032;ENST00000336665;ENST00000409538;ENST00000428334|ENST00000453371	T;T;T;T|.	0.64991|.	-0.13;-0.13;-0.13;-0.13|.	4.47|4.47	4.47|4.47	0.54385|0.54385	Ankyrin repeat-containing domain (4);|.	0.202899|.	0.40728|.	N|.	0.001039|.	T|T	0.56232|0.56232	0.1971|0.1971	L|L	0.28694|0.28694	0.88|0.88	0.40528|0.40528	D|D	0.980901|0.980901	B;B|.	0.20052|.	0.001;0.041|.	B;B|.	0.30105|.	0.003;0.111|.	T|T	0.55010|0.55010	-0.8207|-0.8207	10|5	0.54805|.	T|.	0.06|.	.|.	17.1397|17.1397	0.86749|0.86749	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	695;748|.	Q9UPQ3-2;Q9UPQ3|.	.;AGAP1_HUMAN|.	T|D	748;695;960;587|149	ENSP00000307634:A748T;ENSP00000338378:A695T;ENSP00000386897:A960T;ENSP00000411824:A587T|.	ENSP00000307634:A748T|.	A|G	+|+	1|2	0|0	AGAP1|AGAP1	236693702|236693702	1.000000|1.000000	0.71417|0.71417	0.973000|0.973000	0.42090|0.42090	0.929000|0.929000	0.56500|0.56500	9.751000|9.751000	0.98889|0.98889	2.044000|2.044000	0.60594|0.60594	0.484000|0.484000	0.47621|0.47621	GCC|GGC	.		0.711	AGAP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257076.2	NM_014914	
FBLN1	2192	hgsc.bcm.edu;broad.mit.edu	37	22	45929662	45929662	+	Missense_Mutation	SNP	G	G	A			TCGA-AL-3467-01A-01D-1252-08	TCGA-AL-3467-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a74ffd4b-fa89-49ae-aa1d-3052a5440fa2	2ab402fb-392f-4441-a979-713a602c9cd3	g.chr22:45929662G>A	ENST00000327858.6	+	7	763	c.668G>A	c.(667-669)gGc>gAc	p.G223D	FBLN1_ENST00000348697.2_Missense_Mutation_p.G223D|FBLN1_ENST00000402984.3_Missense_Mutation_p.G261D|FBLN1_ENST00000262722.7_Missense_Mutation_p.G223D|FBLN1_ENST00000340923.5_Missense_Mutation_p.G223D|FBLN1_ENST00000442170.2_Missense_Mutation_p.G223D	NM_006486.2	NP_006477	P23142	FBLN1_HUMAN	fibulin 1	223	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				embryo implantation (GO:0007566)|extracellular matrix organization (GO:0030198)|viral process (GO:0016032)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)|peptidase activator activity (GO:0016504)			biliary_tract(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(1)	30		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		TGCATCACGGGCAGCCACAGC	0.567																																					p.G223D		.											.	FBLN1-515	0			c.G668A						.						75.0	79.0	78.0					22																	45929662		2203	4300	6503	SO:0001583	missense	2192	exon7			TCACGGGCAGCCA		CCDS14067.1, CCDS14068.1, CCDS14069.1, CCDS43028.1	22q13.31	2010-06-15			ENSG00000077942	ENSG00000077942		"""Fibulins"""	3600	protein-coding gene	gene with protein product		135820				2269669, 1400330	Standard	NM_006485		Approved	FBLN	uc003bgj.1	P23142	OTTHUMG00000151340	ENST00000327858.6:c.668G>A	22.37:g.45929662G>A	ENSP00000331544:p.Gly223Asp	236	2		268	17	NM_006487	0	0	3	3	0	B0QY42|B1AHL4|P23143|P23144|P37888|Q5TIC4|Q8TBH8|Q9HBQ5|Q9UC21|Q9UGR4|Q9UH41	Missense_Mutation	SNP	ENST00000327858.6	37	CCDS14067.1	.	.	.	.	.	.	.	.	.	.	G	14.83	2.652638	0.47362	.	.	ENSG00000077942	ENST00000348697;ENST00000402984;ENST00000262722;ENST00000327858;ENST00000442170;ENST00000340923;ENST00000451475	D;D;D;D;D;D;D	0.95588	-3.17;-3.75;-3.75;-3.75;-3.75;-3.75;-3.17	5.03	5.03	0.67393	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);	0.146280	0.64402	D	0.000008	D	0.95714	0.8606	L	0.41632	1.29	0.40342	D	0.979041	D;D;D;D	0.76494	0.999;0.999;0.981;0.993	D;D;P;D	0.74023	0.971;0.982;0.902;0.917	D	0.94005	0.7279	10	0.18276	T	0.48	.	14.8128	0.70008	0.0:0.1447:0.8553:0.0	.	261;223;223;223	B1AHL2;P23142;B1AHL4;P23142-4	.;FBLN1_HUMAN;.;.	D	223;261;223;223;223;223;143	ENSP00000262723:G223D;ENSP00000385521:G261D;ENSP00000262722:G223D;ENSP00000331544:G223D;ENSP00000393812:G223D;ENSP00000342212:G223D;ENSP00000415160:G143D	ENSP00000262722:G223D	G	+	2	0	FBLN1	44308326	0.999000	0.42202	0.484000	0.27391	0.505000	0.33919	3.001000	0.49488	2.335000	0.79485	0.305000	0.20034	GGC	.		0.567	FBLN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000322287.1	NM_006486	
CELSR1	9620	hgsc.bcm.edu;broad.mit.edu	37	22	46785299	46785299	+	Missense_Mutation	SNP	A	A	G			TCGA-AL-3467-01A-01D-1252-08	TCGA-AL-3467-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a74ffd4b-fa89-49ae-aa1d-3052a5440fa2	2ab402fb-392f-4441-a979-713a602c9cd3	g.chr22:46785299A>G	ENST00000262738.3	-	18	6442	c.6443T>C	c.(6442-6444)cTc>cCc	p.L2148P		NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	2148					anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)			breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		ATTGCCAAAGAGCGTGCCCGT	0.667																																					p.L2148P		.											.	CELSR1-525	0			c.T6443C						.						48.0	41.0	43.0					22																	46785299		2203	4300	6503	SO:0001583	missense	9620	exon18			CCAAAGAGCGTGC	AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.6443T>C	22.37:g.46785299A>G	ENSP00000262738:p.Leu2148Pro	93	0		107	6	NM_014246	0	0	28	28	0	O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Missense_Mutation	SNP	ENST00000262738.3	37	CCDS14076.1	.	.	.	.	.	.	.	.	.	.	A	8.527	0.870135	0.17322	.	.	ENSG00000075275	ENST00000262738	T	0.14516	2.5	4.99	3.96	0.45880	Domain of unknown function DUF3497 (1);	0.304522	0.25386	N	0.031042	T	0.20373	0.0490	M	0.68952	2.095	0.38634	D	0.951442	B;B	0.29136	0.234;0.097	B;B	0.37451	0.25;0.16	T	0.03728	-1.1009	10	0.66056	D	0.02	.	10.2827	0.43550	0.9208:0.0:0.0792:0.0	.	469;2148	B7Z7U7;Q9NYQ6	.;CELR1_HUMAN	P	2148	ENSP00000262738:L2148P	ENSP00000262738:L2148P	L	-	2	0	CELSR1	45163963	1.000000	0.71417	0.594000	0.28785	0.090000	0.18270	2.630000	0.46494	0.763000	0.33175	0.533000	0.62120	CTC	.		0.667	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318037.1	NM_014246	
PRRC1	133619	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	126860252	126860252	+	Missense_Mutation	SNP	G	G	T			TCGA-AL-3467-01A-01D-1252-08	TCGA-AL-3467-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a74ffd4b-fa89-49ae-aa1d-3052a5440fa2	2ab402fb-392f-4441-a979-713a602c9cd3	g.chr5:126860252G>T	ENST00000296666.8	+	3	321	c.133G>T	c.(133-135)Gta>Tta	p.V45L	PRRC1_ENST00000512635.2_Missense_Mutation_p.V45L|PRRC1_ENST00000442138.2_Missense_Mutation_p.V45L	NM_130809.3	NP_570721.1	Q96M27	PRRC1_HUMAN	proline-rich coiled-coil 1	45	Pro-rich.					Golgi apparatus (GO:0005794)				endometrium(1)|large_intestine(1)|lung(4)	6		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0851)|Epithelial(69;0.113)		TTCTCCAAATGTATCCTCCAT	0.443																																					p.V45L		.											.	PRRC1-68	0			c.G133T						.						151.0	153.0	152.0					5																	126860252		2203	4300	6503	SO:0001583	missense	133619	exon3			CCAAATGTATCCT	AJ515429	CCDS4143.1, CCDS68943.1	5q23.2	2008-02-05			ENSG00000164244	ENSG00000164244			28164	protein-coding gene	gene with protein product						15541471	Standard	NM_130809		Approved	FLJ32875	uc003kuk.3	Q96M27	OTTHUMG00000128982	ENST00000296666.8:c.133G>T	5.37:g.126860252G>T	ENSP00000296666:p.Val45Leu	429	1		408	28	NM_130809	0	0	50	50	0	Q69YM8|Q7L2U7|Q86Y42|Q8IVJ4|Q8IVL4|Q8NEZ7|Q96AJ3	Missense_Mutation	SNP	ENST00000296666.8	37	CCDS4143.1	.	.	.	.	.	.	.	.	.	.	G	11.23	1.576488	0.28092	.	.	ENSG00000164244	ENST00000296666;ENST00000442138;ENST00000330542;ENST00000414018;ENST00000512635;ENST00000512535	.	.	.	4.99	2.0	0.26442	.	1.090020	0.06908	N	0.807096	T	0.26231	0.0640	N	0.24115	0.695	0.09310	N	1	B;B	0.19073	0.003;0.033	B;B	0.18561	0.006;0.022	T	0.25187	-1.0139	9	0.27785	T	0.31	-3.6002	2.9579	0.05882	0.3558:0.0:0.4512:0.193	.	45;45	Q96M27;Q96M27-5	PRRC1_HUMAN;.	L	45	.	ENSP00000296666:V45L	V	+	1	0	PRRC1	126888151	0.006000	0.16342	0.001000	0.08648	0.002000	0.02628	1.215000	0.32431	0.683000	0.31428	-0.137000	0.14449	GTA	.		0.443	PRRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250971.3	NM_130809	
BRD8	10902	broad.mit.edu	37	5	137506598	137506598	+	Silent	SNP	C	C	T			TCGA-AL-3467-01A-01D-1252-08	TCGA-AL-3467-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a74ffd4b-fa89-49ae-aa1d-3052a5440fa2	2ab402fb-392f-4441-a979-713a602c9cd3	g.chr5:137506598C>T	ENST00000254900.5	-	6	734	c.363G>A	c.(361-363)cgG>cgA	p.R121R	BRD8_ENST00000411594.2_Silent_p.R121R|BRD8_ENST00000402931.1_Silent_p.R121R|BRD8_ENST00000230901.5_Silent_p.R121R|BRD8_ENST00000455658.2_Silent_p.R80R	NM_139199.1	NP_631938	Q9H0E9	BRD8_HUMAN	bromodomain containing 8	121					cell surface receptor signaling pathway (GO:0007166)|chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|intracellular receptor signaling pathway (GO:0030522)|regulation of growth (GO:0040008)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	mitochondrion (GO:0005739)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Swr1 complex (GO:0000812)	sequence-specific DNA binding transcription factor activity (GO:0003700)|thyroid hormone receptor activity (GO:0004887)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(9)|ovary(1)|prostate(1)|skin(1)|stomach(3)|urinary_tract(1)	35			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			CTCTCTTTAGCCGTCTATAGG	0.398																																					p.R121R													.	BRD8-91	0			c.G363A						.						138.0	135.0	136.0					5																	137506598		2203	4300	6503	SO:0001819	synonymous_variant	10902	exon6			CTTTAGCCGTCTA	AF016270	CCDS4198.1, CCDS34241.1, CCDS54907.1	5q31	2008-02-05			ENSG00000112983	ENSG00000112983			19874	protein-coding gene	gene with protein product		602848				8611617, 9368056	Standard	NM_001164326		Approved	SMAP, p120	uc003lcf.1	Q9H0E9	OTTHUMG00000129204	ENST00000254900.5:c.363G>A	5.37:g.137506598C>T		228	0		193	4	NM_001164326	0	0	0	0	0	O43178|Q15355|Q58AB0|Q59GN0|Q969M9	Silent	SNP	ENST00000254900.5	37	CCDS4198.1	.	.	.	.	.	.	.	.	.	.	C	10.17	1.276621	0.23307	.	.	ENSG00000112983	ENST00000441656	.	.	.	5.96	-7.56	0.01322	.	.	.	.	.	T	0.59142	0.2172	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.63998	-0.6510	4	.	.	.	-9.1007	13.5918	0.61964	0.0976:0.1111:0.0:0.7913	.	.	.	.	D	115	.	.	G	-	2	0	BRD8	137534497	0.001000	0.12720	0.453000	0.27007	0.989000	0.77384	-1.551000	0.02178	-1.591000	0.01621	0.655000	0.94253	GGC	.		0.398	BRD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251282.3	NM_006696	
PCDHA4	56144	broad.mit.edu	37	5	140187880	140187880	+	Missense_Mutation	SNP	G	G	A			TCGA-AL-3467-01A-01D-1252-08	TCGA-AL-3467-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a74ffd4b-fa89-49ae-aa1d-3052a5440fa2	2ab402fb-392f-4441-a979-713a602c9cd3	g.chr5:140187880G>A	ENST00000530339.1	+	1	1108	c.1108G>A	c.(1108-1110)Gcc>Acc	p.A370T	PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000356878.4_Missense_Mutation_p.A370T|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Missense_Mutation_p.A370T|PCDHA1_ENST00000504120.2_Intron	NM_018907.2	NP_061730.1	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4	370	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.A370S(2)		breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(6)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TACAGTCATCGCCCTGATCAG	0.493																																					p.A370T													.	PCDHA4-96	2	Substitution - Missense(2)	lung(2)	c.G1108A						.						97.0	94.0	95.0					5																	140187880		2203	4300	6503	SO:0001583	missense	56144	exon1			GTCATCGCCCTGA	AF152482	CCDS54916.1	5q31	2010-11-26				ENSG00000204967		"""Cadherins / Protocadherins : Clustered"""	8670	other	complex locus constituent	"""ortholog of mouse CNR1, KIAA0345-like 10"""	606310				10380929, 10662547	Standard	NM_018907		Approved	CNR1, CRNR1, PCDH-ALPHA4, CNRN1		Q9UN74		ENST00000530339.1:c.1108G>A	5.37:g.140187880G>A	ENSP00000435300:p.Ala370Thr	144	0		162	4	NM_031500	0	0	5	6	1	O75285|Q2M253	Missense_Mutation	SNP	ENST00000530339.1	37	CCDS54916.1	.	.	.	.	.	.	.	.	.	.	g	14.66	2.600395	0.46423	.	.	ENSG00000204967	ENST00000512229;ENST00000356878;ENST00000530339	T;T;T	0.52754	0.65;0.65;0.65	4.72	4.72	0.59763	Cadherin (3);Cadherin-like (1);	0.000000	0.40302	U	0.001121	T	0.59810	0.2221	M	0.64567	1.98	0.29498	N	0.855113	P;D;D	0.57257	0.853;0.963;0.979	B;P;P	0.53518	0.322;0.728;0.728	T	0.61787	-0.6991	10	0.59425	D	0.04	.	18.0295	0.89278	0.0:0.0:1.0:0.0	.	370;370;370	Q9UN74-2;Q9UN74;D6RA20	.;PCDA4_HUMAN;.	T	370	ENSP00000423470:A370T;ENSP00000349344:A370T;ENSP00000435300:A370T	ENSP00000349344:A370T	A	+	1	0	PCDHA4	140168064	1.000000	0.71417	0.553000	0.28255	0.264000	0.26372	4.379000	0.59575	2.341000	0.79615	0.591000	0.81541	GCC	.		0.493	PCDHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372864.2	NM_018907	
KIAA0141	9812	broad.mit.edu	37	5	141304998	141304998	+	Missense_Mutation	SNP	C	C	T	rs148625091		TCGA-AL-3467-01A-01D-1252-08	TCGA-AL-3467-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a74ffd4b-fa89-49ae-aa1d-3052a5440fa2	2ab402fb-392f-4441-a979-713a602c9cd3	g.chr5:141304998C>T	ENST00000432126.2	+	3	304	c.170C>T	c.(169-171)aCg>aTg	p.T57M	KIAA0141_ENST00000194118.4_Missense_Mutation_p.T57M	NM_001142603.1|NM_014773.3	NP_001136075.1|NP_055588.3	Q14154	DELE_HUMAN	KIAA0141	57					extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)	mitochondrion (GO:0005739)				endometrium(3)|large_intestine(4)|lung(5)|skin(1)|urinary_tract(3)	16		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGCCCAGGCACGAGCGGGGGT	0.567																																					p.T57M													.	KIAA0141-91	0			c.C170T						.	C	MET/THR,MET/THR	0,4406		0,0,2203	116.0	90.0	99.0		170,170	0.2	0.0	5	dbSNP_134	99	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	KIAA0141	NM_001142603.1,NM_014773.3	81,81	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging	57/516,57/516	141304998	1,13005	2203	4300	6503	SO:0001583	missense	9812	exon3			CAGGCACGAGCGG	BC011269	CCDS4268.1	5q31	2011-05-05			ENSG00000081791	ENSG00000081791			28969	protein-coding gene	gene with protein product	"""death ligand signal enhancer"""	615741				20563667	Standard	XM_005268549		Approved	DELE	uc003llt.3	Q14154	OTTHUMG00000129662	ENST00000432126.2:c.170C>T	5.37:g.141304998C>T	ENSP00000396225:p.Thr57Met	150	1		166	6	NM_001142603	0	0	37	37	0	Q969R4|Q96EU9	Missense_Mutation	SNP	ENST00000432126.2	37	CCDS4268.1	.	.	.	.	.	.	.	.	.	.	C	11.52	1.662032	0.29515	0.0	1.16E-4	ENSG00000081791	ENST00000432126;ENST00000194118;ENST00000508751	T;T;T	0.18338	2.71;2.71;2.22	4.85	0.193	0.15139	.	0.865109	0.09867	N	0.745459	T	0.14570	0.0352	L	0.51422	1.61	0.09310	N	1	P	0.42337	0.776	B	0.36885	0.235	T	0.17018	-1.0383	10	0.49607	T	0.09	-0.1808	8.2847	0.31922	0.0:0.457:0.4427:0.1003	.	57	Q14154	DELE_HUMAN	M	57	ENSP00000396225:T57M;ENSP00000194118:T57M;ENSP00000422686:T57M	ENSP00000194118:T57M	T	+	2	0	KIAA0141	141285182	0.007000	0.16637	0.014000	0.15608	0.123000	0.20343	0.446000	0.21694	0.100000	0.17581	-0.564000	0.04169	ACG	C|1.000;T|0.000		0.567	KIAA0141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251863.2	NM_014773	
AMD1	262	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	111208734	111208734	+	Missense_Mutation	SNP	A	A	G			TCGA-AL-3467-01A-01D-1252-08	TCGA-AL-3467-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a74ffd4b-fa89-49ae-aa1d-3052a5440fa2	2ab402fb-392f-4441-a979-713a602c9cd3	g.chr6:111208734A>G	ENST00000368885.3	+	2	473	c.137A>G	c.(136-138)gAt>gGt	p.D46G	AMD1_ENST00000451850.2_Intron|AMD1_ENST00000368877.5_Intron|AMD1_ENST00000368876.1_5'UTR|AMD1_ENST00000368882.3_Intron	NM_001634.4	NP_001625.2	P17707	DCAM_HUMAN	adenosylmethionine decarboxylase 1	46					cellular nitrogen compound metabolic process (GO:0034641)|polyamine metabolic process (GO:0006595)|S-adenosylmethioninamine biosynthetic process (GO:0006557)|small molecule metabolic process (GO:0044281)|spermidine biosynthetic process (GO:0008295)|spermine biosynthetic process (GO:0006597)	cytosol (GO:0005829)	adenosylmethionine decarboxylase activity (GO:0004014)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(2)	8		all_cancers(87;3.83e-05)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.00225)|Colorectal(196;0.0209)		OV - Ovarian serous cystadenocarcinoma(136;0.0522)|Epithelial(106;0.111)|all cancers(137;0.143)	S-Adenosylmethionine(DB00118)	CTTTTGAAGGATGTGCAATGT	0.353																																					p.D46G		.											.	AMD1-91	0			c.A137G						.						180.0	175.0	177.0					6																	111208734		2203	4300	6503	SO:0001583	missense	262	exon2			TGAAGGATGTGCA	M88006	CCDS5086.1, CCDS75504.1, CCDS75505.1	6q21	2014-05-13			ENSG00000123505	ENSG00000123505	4.1.1.50		457	protein-coding gene	gene with protein product		180980	"""S-adenosylmethionine decarboxylase 1"""				Standard	NM_001634		Approved	SAMDC	uc003puk.1	P17707	OTTHUMG00000015369	ENST00000368885.3:c.137A>G	6.37:g.111208734A>G	ENSP00000357880:p.Asp46Gly	271	0		305	53	NM_001634	0	0	24	30	6	E1P5F7|Q5VXN4|Q5VXN6|Q9BWK4	Missense_Mutation	SNP	ENST00000368885.3	37	CCDS5086.1	.	.	.	.	.	.	.	.	.	.	A	12.71	2.020888	0.35606	.	.	ENSG00000123505	ENST00000368885	.	.	.	5.46	4.31	0.51392	S-adenosylmethionine decarboxylase, core (2);	0.184022	0.56097	N	0.000026	T	0.18002	0.0432	N	0.08118	0	0.80722	D	1	B	0.06786	0.001	B	0.16722	0.016	T	0.06391	-1.0829	9	0.21014	T	0.42	.	11.2686	0.49124	0.9284:0.0:0.0716:0.0	.	46	P17707	DCAM_HUMAN	G	46	.	ENSP00000357880:D46G	D	+	2	0	AMD1	111315427	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	8.803000	0.91915	1.021000	0.39600	0.482000	0.46254	GAT	.		0.353	AMD1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041816.1		
SNX13	23161	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	17836512	17836512	+	Missense_Mutation	SNP	T	T	C			TCGA-AL-3467-01A-01D-1252-08	TCGA-AL-3467-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a74ffd4b-fa89-49ae-aa1d-3052a5440fa2	2ab402fb-392f-4441-a979-713a602c9cd3	g.chr7:17836512T>C	ENST00000409389.1	-	25	2769	c.2597A>G	c.(2596-2598)gAt>gGt	p.D866G	SNX13_ENST00000496855.1_5'UTR|SNX13_ENST00000428135.3_Missense_Mutation_p.D855G			Q9Y5W8	SNX13_HUMAN	sorting nexin 13	866					intracellular protein transport (GO:0006886)|positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	early endosome (GO:0005769)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(13)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	38	Lung NSC(10;0.0261)|all_lung(11;0.0521)					AATACTTTTATCTCTGCATGG	0.318																																					p.D855G		.											.	SNX13-650	0			c.A2564G						.						186.0	172.0	176.0					7																	17836512		1832	4093	5925	SO:0001583	missense	23161	exon25			CTTTTATCTCTGC	AF420470	CCDS47551.1	7p21.1	2008-03-11			ENSG00000071189	ENSG00000071189		"""Sorting nexins"""	21335	protein-coding gene	gene with protein product		606589				11485546, 11729322	Standard	NM_015132		Approved	RGS-PX1, KIAA0713	uc003stv.3	Q9Y5W8	OTTHUMG00000152730	ENST00000409389.1:c.2597A>G	7.37:g.17836512T>C	ENSP00000386705:p.Asp866Gly	288	0		149	14	NM_015132	0	0	43	43	0	B2RCI9|O94821|Q8WVZ2|Q8WXH8	Missense_Mutation	SNP	ENST00000409389.1	37		.	.	.	.	.	.	.	.	.	.	T	24.8	4.576015	0.86645	.	.	ENSG00000071189	ENST00000409389;ENST00000428135;ENST00000242044	T;T	0.30714	1.52;1.52	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	T	0.52901	0.1763	M	0.65498	2.005	0.80722	D	1	D;P;D	0.67145	0.996;0.943;0.995	D;P;D	0.67548	0.952;0.867;0.94	T	0.55509	-0.8130	10	0.59425	D	0.04	-15.4175	15.4601	0.75349	0.0:0.0:0.0:1.0	.	652;866;855	B3KN60;B8ZZT9;Q9Y5W8-2	.;.;.	G	866;855;903	ENSP00000386705:D866G;ENSP00000398789:D855G	ENSP00000242044:D903G	D	-	2	0	SNX13	17803037	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.698000	0.84413	2.046000	0.60703	0.455000	0.32223	GAT	.		0.318	SNX13-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000327608.1	NM_015132	
MUC17	140453	broad.mit.edu	37	7	100676555	100676555	+	Missense_Mutation	SNP	C	C	T			TCGA-AL-3467-01A-01D-1252-08	TCGA-AL-3467-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a74ffd4b-fa89-49ae-aa1d-3052a5440fa2	2ab402fb-392f-4441-a979-713a602c9cd3	g.chr7:100676555C>T	ENST00000306151.4	+	3	1922	c.1858C>T	c.(1858-1860)Cca>Tca	p.P620S		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	620	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)	p.P620A(1)		NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					TACCAGCATGCCAACCTCAAC	0.478																																					p.P620S													.	MUC17-95	1	Substitution - Missense(1)	kidney(1)	c.C1858T						.						254.0	255.0	255.0					7																	100676555		2203	4300	6503	SO:0001583	missense	140453	exon3			AGCATGCCAACCT	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.1858C>T	7.37:g.100676555C>T	ENSP00000302716:p.Pro620Ser	449	0		524	8	NM_001040105	0	0	0	0	0	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	C	1.052	-0.675519	0.03378	.	.	ENSG00000169876	ENST00000306151	T	0.03152	4.03	0.926	-0.13	0.13498	.	.	.	.	.	T	0.01287	0.0042	N	0.03608	-0.345	0.09310	N	1	B	0.14438	0.01	B	0.06405	0.002	T	0.46871	-0.9160	9	0.02654	T	1	.	3.2487	0.06806	0.0:0.6664:0.0:0.3336	.	620	Q685J3	MUC17_HUMAN	S	620	ENSP00000302716:P620S	ENSP00000302716:P620S	P	+	1	0	MUC17	100463275	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-4.977000	0.00164	-0.035000	0.13691	0.395000	0.25975	CCA	.		0.478	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
BRAF	673	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	140453136	140453136	+	Missense_Mutation	SNP	A	A	T	rs121913377|rs113488022|rs121913227|rs397516897		TCGA-AL-3467-01A-01D-1252-08	TCGA-AL-3467-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a74ffd4b-fa89-49ae-aa1d-3052a5440fa2	2ab402fb-392f-4441-a979-713a602c9cd3	g.chr7:140453136A>T	ENST00000288602.6	-	15	1859	c.1799T>A	c.(1798-1800)gTg>gAg	p.V600E		NM_004333.4	NP_004324.2	P15056	BRAF_HUMAN	B-Raf proto-oncogene, serine/threonine kinase	600	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		V -> D (in a melanoma cell line; requires 2 nucleotide substitutions). {ECO:0000269|PubMed:12068308}.|V -> E (in CRC; also found in sarcoma, metastatic melanoma, ovarian serous carcinoma, pilocytic astrocytoma; somatic mutation; most common mutation; constitutive and elevated kinase activity; efficiently induces cell transformation; suppression of mutation in melanoma causes growth arrest and promotes apoptosis; loss of regulation by PMRT5). {ECO:0000269|PubMed:12068308, ECO:0000269|PubMed:12198537, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:17344846, ECO:0000269|PubMed:23263490, ECO:0000269|PubMed:24455489}.		activation of MAPKK activity (GO:0000186)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|fibroblast growth factor receptor signaling pathway (GO:0008543)|long-term synaptic potentiation (GO:0060291)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fibroblast migration (GO:0010764)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic vesicle exocytosis (GO:2000301)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive T cell selection (GO:0043368)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell proliferation (GO:0042127)|response to cAMP (GO:0051591)|response to epidermal growth factor (GO:0070849)|response to peptide hormone (GO:0043434)|small GTPase mediated signal transduction (GO:0007264)|somatic stem cell maintenance (GO:0035019)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.V600E(15453)|p.V600K(252)|p.V600R(44)|p.V600D(16)|p.V600A(12)|p.V600_K601>E(12)|p.V600G(11)|p.T599_R603>I(2)|p.V600Q(2)|p.V600_S605>EK(1)|p.V600_S605>DV(1)|p.V600_S605>D(1)|p.T599_V600insDFGLAT(1)	SLC45A3/BRAF(2)|AGTRAP/BRAF(2)|FAM131B_ENST00000443739/BRAF(7)|AKAP9_ENST00000356239/BRAF(10)|KIAA1549/BRAF(703)|FCHSD1/BRAF(2)	NS(588)|adrenal_gland(3)|autonomic_ganglia(3)|biliary_tract(29)|bone(7)|breast(21)|central_nervous_system(99)|cervix(6)|endometrium(33)|eye(72)|gastrointestinal_tract_(site_indeterminate)(2)|genital_tract(4)|haematopoietic_and_lymphoid_tissue(436)|kidney(3)|large_intestine(6953)|liver(17)|lung(192)|oesophagus(4)|ovary(275)|pancreas(15)|pituitary(1)|prostate(25)|salivary_gland(1)|skin(6285)|small_intestine(12)|soft_tissue(40)|stomach(11)|testis(7)|thyroid(12220)|upper_aerodigestive_tract(13)|urinary_tract(3)	27380	Melanoma(164;0.00956)				Dabrafenib(DB08912)|Regorafenib(DB08896)|Sorafenib(DB00398)|Vemurafenib(DB08881)	TCGAGATTTCACTGTAGCTAG	0.368	V600D(K029AX_SKIN)|V600D(WM115_SKIN)|V600D(WM2664_SKIN)|V600E(8505C_THYROID)|V600E(A101D_SKIN)|V600E(A2058_SKIN)|V600E(A375_SKIN)|V600E(A673_BONE)|V600E(AM38_CENTRAL_NERVOUS_SYSTEM)|V600E(BCPAP_THYROID)|V600E(BHT101_THYROID)|V600E(BT474_BREAST)|V600E(C32_SKIN)|V600E(CL34_LARGE_INTESTINE)|V600E(COLO205_LARGE_INTESTINE)|V600E(COLO679_SKIN)|V600E(COLO741_SKIN)|V600E(COLO783_SKIN)|V600E(COLO800_SKIN)|V600E(COLO818_SKIN)|V600E(COLO829_SKIN)|V600E(COLO849_SKIN)|V600E(DBTRG05MG_CENTRAL_NERVOUS_SYSTEM)|V600E(DU4475_BREAST)|V600E(ES2_OVARY)|V600E(G361_SKIN)|V600E(GCT_SOFT_TISSUE)|V600E(HS294T_SKIN)|V600E(HS695T_SKIN)|V600E(HS939T_SKIN)|V600E(IGR1_SKIN)|V600E(IGR37_SKIN)|V600E(IGR39_SKIN)|V600E(K029AX_SKIN)|V600E(KG1C_CENTRAL_NERVOUS_SYSTEM)|V600E(LOXIMVI_SKIN)|V600E(MALME3M_SKIN)|V600E(MELHO_SKIN)|V600E(OUMS23_LARGE_INTESTINE)|V600E(RKO_LARGE_INTESTINE)|V600E(RPMI7951_SKIN)|V600E(RVH421_SKIN)|V600E(SH4_SKIN)|V600E(SIGM5_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|V600E(SKHEP1_LIVER)|V600E(SKMEL24_SKIN)|V600E(SKMEL28_SKIN)|V600E(SKMEL5_SKIN)|V600E(SW1417_LARGE_INTESTINE)|V600E(UACC257_SKIN)|V600E(UACC62_SKIN)|V600E(WM793_SKIN)|V600E(WM88_SKIN)|V600E(WM983B_SKIN)	61	"""Mis, T, O"""	"""AKAP9, KIAA1549"""	"""melanoma, colorectal, papillary thyroid, borderline ov, Non small-cell lung cancer (NSCLC), cholangiocarcinoma, pilocytic astrocytoma"""		Cardio-facio-cutaneous syndrome		Cardiofaciocutaneous syndrome																												p.V600E	Colon(40;35 892 2973 5743 27438)	.		Dom	yes		7	7q34	673	v-raf murine sarcoma viral oncogene homolog B1	yes	E	.	BRAF-92146	15808	Substitution - Missense(15790)|Complex - deletion inframe(17)|Insertion - In frame(1)	thyroid(7476)|skin(3822)|large_intestine(3288)|NS(360)|haematopoietic_and_lymphoid_tissue(336)|ovary(211)|lung(58)|eye(57)|central_nervous_system(53)|soft_tissue(30)|biliary_tract(18)|liver(17)|prostate(13)|breast(10)|upper_aerodigestive_tract(9)|endometrium(8)|pancreas(8)|testis(7)|small_intestine(7)|genital_tract(4)|stomach(4)|bone(3)|autonomic_ganglia(2)|oesophagus(2)|urinary_tract(2)|adrenal_gland(2)|pituitary(1)	c.T1799A						.						112.0	104.0	107.0					7																	140453136		2203	4300	6503	SO:0001583	missense	673	exon15	Familial Cancer Database	CFC, CFCS	GATTTCACTGTAG	M95712	CCDS5863.1	7q34	2014-09-17	2014-06-26		ENSG00000157764	ENSG00000157764			1097	protein-coding gene	gene with protein product		164757	"""v-raf murine sarcoma viral oncogene homolog B"""			2284096, 1565476	Standard	NM_004333		Approved	BRAF1	uc003vwc.4	P15056	OTTHUMG00000157457	ENST00000288602.6:c.1799T>A	7.37:g.140453136A>T	ENSP00000288602:p.Val600Glu	189	0		127	50	NM_004333	0	0	8	10	2	A4D1T4|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q13878|Q3MIN6|Q9UDP8|Q9Y6T3	Missense_Mutation	SNP	ENST00000288602.6	37	CCDS5863.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	24.0|24.0	4.486113|4.486113	0.84854|0.84854	.|.	.|.	ENSG00000157764|ENSG00000157764	ENST00000288602|ENST00000496384	D|.	0.81739|.	-1.53|.	5.65|5.65	5.65|5.65	0.86999|0.86999	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.61565|.	0.2357|.	L|L	0.42245|0.42245	1.32|1.32	0.80722|0.80722	D|D	1|1	D|.	0.55385|.	0.971|.	D|.	0.66351|.	0.943|.	T|.	0.58160|.	-0.7685|.	10|.	0.87932|.	D|.	0|.	.|.	15.9326|15.9326	0.79675|0.79675	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	600|.	P15056|.	BRAF_HUMAN|.	E|R	600|208	ENSP00000288602:V600E|.	ENSP00000288602:V600E|.	V|X	-|-	2|1	0|0	BRAF|BRAF	140099605|140099605	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.197000|9.197000	0.94985|0.94985	2.169000|2.169000	0.68431|0.68431	0.529000|0.529000	0.55759|0.55759	GTG|TGA	.		0.368	BRAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348886.1	NM_004333	
ARSF	416	broad.mit.edu;bcgsc.ca	37	X	3028196	3028196	+	Silent	SNP	C	C	T			TCGA-AL-3467-01A-01D-1252-08	TCGA-AL-3467-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a74ffd4b-fa89-49ae-aa1d-3052a5440fa2	2ab402fb-392f-4441-a979-713a602c9cd3	g.chrX:3028196C>T	ENST00000381127.1	+	10	1514	c.1293C>T	c.(1291-1293)ccC>ccT	p.P431P	ARSF_ENST00000359361.2_Silent_p.P431P|ARSF_ENST00000537104.1_Silent_p.P431P	NM_001201538.1|NM_001201539.1	NP_001188467.1|NP_001188468.1	P54793	ARSF_HUMAN	arylsulfatase F	431					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(2)|prostate(3)|skin(3)|urinary_tract(2)	38		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				ACCTCATGCCCTTGCTGCAGG	0.567																																					p.P431P													.	ARSF-132	0			c.C1293T						.						114.0	82.0	93.0					X																	3028196		2203	4300	6503	SO:0001819	synonymous_variant	416	exon10			CATGCCCTTGCTG	X97868	CCDS14123.1	Xp22.3	2013-02-14			ENSG00000062096	ENSG00000062096		"""Arylsulfatase family"""	721	protein-coding gene	gene with protein product		300003				7720070	Standard	NM_004042		Approved		uc022brz.1	P54793	OTTHUMG00000021081	ENST00000381127.1:c.1293C>T	X.37:g.3028196C>T		220	1		252	9	NM_004042	0	0	0	0	0	Q8TCC5	Silent	SNP	ENST00000381127.1	37	CCDS14123.1																																																																																			.		0.567	ARSF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055652.1		
LUZP4	51213	broad.mit.edu	37	X	114541171	114541171	+	Silent	SNP	T	T	A			TCGA-AL-3467-01A-01D-1252-08	TCGA-AL-3467-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a74ffd4b-fa89-49ae-aa1d-3052a5440fa2	2ab402fb-392f-4441-a979-713a602c9cd3	g.chrX:114541171T>A	ENST00000371920.3	+	4	751	c.744T>A	c.(742-744)acT>acA	p.T248T	LUZP4_ENST00000451986.2_Silent_p.T166T	NM_016383.3	NP_057467.1	Q9P127	LUZP4_HUMAN	leucine zipper protein 4	248						nucleus (GO:0005634)				endometrium(1)|large_intestine(2)|lung(4)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	14						TCATAGCCACTCAGAGAGATC	0.478																																					p.T248T													.	LUZP4-132	0			c.T744A						.						134.0	118.0	123.0					X																	114541171		2203	4300	6503	SO:0001819	synonymous_variant	51213	exon4			AGCCACTCAGAGA	AF124430	CCDS14567.1	Xq24	2009-03-25			ENSG00000102021	ENSG00000102021			24971	protein-coding gene	gene with protein product	"""cancer/testis antigen 28"""	300616				12032826, 11051238	Standard	XM_005268343		Approved	HOM-TES-85, CT-8, CT28	uc004eqa.3	Q9P127	OTTHUMG00000022234	ENST00000371920.3:c.744T>A	X.37:g.114541171T>A		293	0		201	7	NM_016383	0	0	0	0	0	B3KSD6	Silent	SNP	ENST00000371920.3	37	CCDS14567.1																																																																																			.		0.478	LUZP4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057972.1	NM_016383	
SFXN2	118980	broad.mit.edu	37	10	104503830	104503830	+	IGR	DEL	T	T	-			TCGA-AL-3467-01A-01D-1252-08	TCGA-AL-3467-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a74ffd4b-fa89-49ae-aa1d-3052a5440fa2	2ab402fb-392f-4441-a979-713a602c9cd3	g.chr10:104503830delT	ENST00000369893.5	+	0	6866				WBP1L_ENST00000448841.1_Frame_Shift_Del_p.L7fs	NM_178858.4	NP_849189.1	Q96NB2	SFXN2_HUMAN	sideroflexin 2						iron ion homeostasis (GO:0055072)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	cation transmembrane transporter activity (GO:0008324)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(2)|lung(3)|prostate(1)	13		Colorectal(252;0.207)		Epithelial(162;4.53e-09)|all cancers(201;1.2e-07)|BRCA - Breast invasive adenocarcinoma(275;0.218)		agaaggCTCCTGGGTGGCATG	0.692																																					p.L7fs													.	.	0			c.20delT						.						14.0	20.0	18.0					10																	104503830		2003	4117	6120	SO:0001628	intergenic_variant	54838	exon1			GGCTCCTGGGTGG	AF462052	CCDS7539.1	10q24.32	2006-03-13			ENSG00000156398	ENSG00000156398		"""Sideroflexins"""	16086	protein-coding gene	gene with protein product		615570					Standard	NM_178858		Approved		uc001kwb.2	Q96NB2	OTTHUMG00000018967		10.37:g.104503830delT		9	0		6	2	NM_001083913	0	0	0	0	0	Q5JSM6	Frame_Shift_Del	DEL	ENST00000369893.5	37	CCDS7539.1																																																																																			.		0.692	SFXN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050096.2	XM_058359	
ZMYND15	84225	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	4645266	4645266	+	Frame_Shift_Del	DEL	G	G	-	rs200238712		TCGA-AL-3467-01A-01D-1252-08	TCGA-AL-3467-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a74ffd4b-fa89-49ae-aa1d-3052a5440fa2	2ab402fb-392f-4441-a979-713a602c9cd3	g.chr17:4645266delG	ENST00000433935.1	+	4	941	c.884delG	c.(883-885)cggfs	p.R295fs	CXCL16_ENST00000293778.6_5'Flank|ZMYND15_ENST00000269289.6_Frame_Shift_Del_p.R295fs|CXCL16_ENST00000574412.1_5'Flank|ZMYND15_ENST00000573751.2_Frame_Shift_Del_p.R295fs|ZMYND15_ENST00000592813.1_Frame_Shift_Del_p.R295fs	NM_001136046.2|NM_001267822.1	NP_001129518.1|NP_001254751.1	Q9H091	ZMY15_HUMAN	zinc finger, MYND-type containing 15	295					negative regulation of transcription, DNA-templated (GO:0045892)|spermatid development (GO:0007286)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(5)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|skin(2)	18						ACCCCAATGCGGACATGGGGT	0.577																																					p.R295fs		.											.	ZMYND15-90	0			c.884delG						.						79.0	84.0	82.0					17																	4645266		2203	4300	6503	SO:0001589	frameshift_variant	84225	exon4			.	AL136893	CCDS11053.1, CCDS45584.1, CCDS58506.1	17p13.3	2008-05-02			ENSG00000141497	ENSG00000141497		"""Zinc fingers, MYND-type"""	20997	protein-coding gene	gene with protein product		614312				11230166	Standard	NM_001136046		Approved	DKFZp434N127	uc002fyu.3	Q9H091	OTTHUMG00000090760	ENST00000433935.1:c.884delG	17.37:g.4645266delG	ENSP00000391742:p.Arg295fs	222	0		224	83	NM_001136046	0	0	0	0	0	B4DXY5|I3L296	Frame_Shift_Del	DEL	ENST00000433935.1	37	CCDS45584.1																																																																																			.		0.577	ZMYND15-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439580.1	NM_032265	
ARHGAP29	9411	broad.mit.edu	37	1	94639430	94639431	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AL-3467-01A-01D-1252-08	TCGA-AL-3467-10A-01D-1252-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a74ffd4b-fa89-49ae-aa1d-3052a5440fa2	2ab402fb-392f-4441-a979-713a602c9cd3	g.chr1:94639430_94639431insA	ENST00000260526.6	-	23	3962_3963	c.3780_3781insT	c.(3778-3783)tttgtgfs	p.V1261fs	ARHGAP29_ENST00000482481.1_5'Flank	NM_004815.3	NP_004806.3	Q52LW3	RHG29_HUMAN	Rho GTPase activating protein 29	1261	Interaction with PTPN13/PTPL1.				positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|Rho GTPase activator activity (GO:0005100)			NS(1)|breast(5)|endometrium(6)|kidney(2)|large_intestine(9)|lung(19)|ovary(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	54		all_lung(203;0.000732)|Lung NSC(277;0.00328)		all cancers(265;0.0187)|Epithelial(280;0.159)		CATCCCTACACAAATTGTGGAA	0.401																																					p.V1261fs													.	ARHGAP29-296	0			c.3781_3782insT						.																																			SO:0001589	frameshift_variant	9411	exon23			CCTACACAAATTG		CCDS748.1	1p22.1	2011-06-29			ENSG00000137962	ENSG00000137962		"""Rho GTPase activating proteins"""	30207	protein-coding gene	gene with protein product		610496				9305890	Standard	NM_004815		Approved	PARG1	uc001dqj.4	Q52LW3	OTTHUMG00000010643	ENST00000260526.6:c.3781dupT	1.37:g.94639433_94639433dupA	ENSP00000260526:p.Val1261fs	335	0		340	17	NM_004815	0	0	0	0	0	O15463|Q59H86|Q5VYZ0|Q6NVX2|Q8TBI6	Frame_Shift_Ins	INS	ENST00000260526.6	37	CCDS748.1																																																																																			.		0.401	ARHGAP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029376.2	NM_004815	
CDH8	1006	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	61891030	61891031	+	Missense_Mutation	DNP	AG	AG	CT			TCGA-AL-3467-01A-01D-1252-08	TCGA-AL-3467-10A-01D-1252-08	AG	AG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a74ffd4b-fa89-49ae-aa1d-3052a5440fa2	2ab402fb-392f-4441-a979-713a602c9cd3	g.chr16:61891030_61891031AG>CT	ENST00000577390.1	-	4	1613_1614	c.659_660CT>AG	c.(658-660)cCT>cAG	p.P220Q	CDH8_ENST00000577730.1_Missense_Mutation_p.P220Q|CDH8_ENST00000299345.6_Missense_Mutation_p.P220Q|CDH8_ENST00000584337.1_Missense_Mutation_p.P220Q	NM_001796.4	NP_001787.2	P55286	CADH8_HUMAN	cadherin 8, type 2	220	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|response to cold (GO:0009409)|synaptic transmission, glutamatergic (GO:0035249)	axon terminus (GO:0043679)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(22)|liver(2)|lung(49)|ovary(6)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(4)	112		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		AACCTGTTTCAGGCTCAATGGA	0.391																																					p.P220Q		.											.	CDH8	0			c.C659A						.																																			SO:0001583	missense	1006	exon4			GTTTCAGGCTCAA	L34060	CCDS10802.1	16q22.1	2010-01-26			ENSG00000150394	ENSG00000150394		"""Cadherins / Major cadherins"""	1767	protein-coding gene	gene with protein product		603008				9615235, 2059658	Standard	NM_001796		Approved		uc002eog.2	P55286	OTTHUMG00000137493	ENST00000577390.1:c.659_660delinsCT	16.37:g.61891030_61891031delinsCT	ENSP00000462701:p.Pro220Gln	145.0	0.0		108.0	34.0		0	0	0	0	0	B3KWC1|Q14DC6|Q9ULB2	Missense_Mutation	DNP	ENST00000577390.1	37	CCDS10802.1																																																																																			.		0.391	CDH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268754.3	NM_001796	
