#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
RERE	473	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	8415616	8415616	+	Silent	SNP	G	G	T			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr1:8415616G>T	ENST00000337907.3	-	23	5164	c.4530C>A	c.(4528-4530)ccC>ccA	p.P1510P	RERE_ENST00000400908.2_Silent_p.P1510P|RERE_ENST00000377464.1_Silent_p.P1242P|RERE_ENST00000400907.2_Silent_p.P528P|RERE_ENST00000476556.1_Silent_p.P956P	NM_012102.3	NP_036234.3	Q9P2R6	RERE_HUMAN	arginine-glutamic acid dipeptide (RE) repeats	1510	Pro-rich.				chromatin remodeling (GO:0006338)|multicellular organismal development (GO:0007275)|NLS-bearing protein import into nucleus (GO:0006607)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|poly-glutamine tract binding (GO:0008267)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(16)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	49	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)		CTGCTGACATGGGGGGTGGGA	0.642																																					p.P1510P		.											.	RERE-515	0			c.C4530A						.						16.0	17.0	17.0					1																	8415616		2201	4295	6496	SO:0001819	synonymous_variant	473	exon23			TGACATGGGGGGT	AF016005	CCDS95.1, CCDS41243.1	1p36.23	2013-01-25			ENSG00000142599	ENSG00000142599		"""GATA zinc finger domain containing"""	9965	protein-coding gene	gene with protein product		605226		ATN1L		10814707, 10729226	Standard	NM_012102		Approved	KIAA0458, ARP, ARG, DNB1	uc001apf.3	Q9P2R6	OTTHUMG00000001765	ENST00000337907.3:c.4530C>A	1.37:g.8415616G>T		39	0		36	9	NM_012102	0	0	6	11	5	O43393|O75046|O75359|Q5VXL9|Q6P6B9|Q9Y2W4	Silent	SNP	ENST00000337907.3	37	CCDS95.1																																																																																			.		0.642	RERE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004916.1		
TSPAN2	10100	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	115601516	115601516	+	Silent	SNP	G	G	A			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr1:115601516G>A	ENST00000369516.2	-	5	463	c.432C>T	c.(430-432)acC>acT	p.T144T	TSPAN2_ENST00000369515.2_Silent_p.T119T|TSPAN2_ENST00000369514.2_Silent_p.T144T|TSPAN2_ENST00000491992.1_5'Flank	NM_005725.4	NP_005716.2	O60636	TSN2_HUMAN	tetraspanin 2	144					astrocyte development (GO:0014002)|axon development (GO:0061564)|brain development (GO:0007420)|inflammatory response (GO:0006954)|microglia development (GO:0014005)|myelination (GO:0042552)|oligodendrocyte differentiation (GO:0048709)	integral component of membrane (GO:0016021)|myelin sheath (GO:0043209)|plasma membrane (GO:0005886)				central_nervous_system(1)|large_intestine(4)|lung(3)|pancreas(1)|prostate(1)	10	Lung SC(450;0.211)	all_cancers(81;2.9e-07)|all_epithelial(167;1.42e-06)|all_lung(203;6.72e-06)|Lung NSC(69;1.13e-05)|Acute lymphoblastic leukemia(138;0.191)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)|all cancers(265;0.159)|Epithelial(280;0.179)		TTGAGTGGAAGGTGATGAGTG	0.398																																					p.T144T		.											.	TSPAN2-226	0			c.C432T						.						256.0	232.0	240.0					1																	115601516		2203	4300	6503	SO:0001819	synonymous_variant	10100	exon5			GTGGAAGGTGATG	AF054839	CCDS881.1	1p13.1	2013-02-14			ENSG00000134198	ENSG00000134198		"""Tetraspanins"""	20659	protein-coding gene	gene with protein product		613133				9714763, 11739647	Standard	NM_005725		Approved	TSPAN-2, TSN2, FLJ12082	uc001eft.3	O60636	OTTHUMG00000011878	ENST00000369516.2:c.432C>T	1.37:g.115601516G>A		203	0		167	40	NM_005725	0	0	0	0	0	D6PTH4|Q5TET2|Q8WU05	Silent	SNP	ENST00000369516.2	37	CCDS881.1																																																																																			.		0.398	TSPAN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032828.1	NM_005725	
RGL1	23179	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	183885638	183885638	+	Missense_Mutation	SNP	G	G	C			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr1:183885638G>C	ENST00000360851.3	+	16	1985	c.1807G>C	c.(1807-1809)Ggg>Cgg	p.G603R	RGL1_ENST00000304685.4_Missense_Mutation_p.G638R|RGL1_ENST00000536277.1_Missense_Mutation_p.G601R|RGL1_ENST00000539189.1_Missense_Mutation_p.G574R			Q9NZL6	RGL1_HUMAN	ral guanine nucleotide dissociation stimulator-like 1	603	Ser-rich.				cellular lipid metabolic process (GO:0044255)|positive regulation of Ral GTPase activity (GO:0032852)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	Ral guanyl-nucleotide exchange factor activity (GO:0008321)			breast(5)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(17)|ovary(4)|prostate(3)|stomach(1)	51						AAATTCCTCAGGGATGTCTTC	0.502																																					p.G638R		.											.	RGL1-725	0			c.G1912C						.						186.0	182.0	183.0					1																	183885638		2203	4300	6503	SO:0001583	missense	23179	exon17			TCCTCAGGGATGT	AF186780	CCDS1359.1, CCDS72992.1	1q25.2	2008-02-05			ENSG00000143344	ENSG00000143344			30281	protein-coding gene	gene with protein product		605667				10760592, 10231032	Standard	XM_005245010		Approved	RGL	uc001gqm.3	Q9NZL6	OTTHUMG00000035328	ENST00000360851.3:c.1807G>C	1.37:g.183885638G>C	ENSP00000354097:p.Gly603Arg	153	0		169	47	NM_015149	0	0	1	4	3	Q5SXQ2|Q5SXQ6|Q9HBY3|Q9HBY4|Q9NZL5|Q9UG43|Q9Y2G6	Missense_Mutation	SNP	ENST00000360851.3	37		.	.	.	.	.	.	.	.	.	.	G	16.32	3.090748	0.55968	.	.	ENSG00000143344	ENST00000304685;ENST00000367531;ENST00000536277;ENST00000360851;ENST00000539189	T;T;T;T;T	0.50548	0.76;0.76;0.79;0.78;0.74	5.05	5.05	0.67936	.	0.057165	0.64402	D	0.000001	T	0.48502	0.1503	L	0.40543	1.245	0.47245	D	0.999364	D;D;D;D	0.58268	0.982;0.969;0.969;0.969	P;P;B;P	0.51866	0.682;0.585;0.348;0.585	T	0.48670	-0.9015	10	0.54805	T	0.06	.	11.5322	0.50616	0.0831:0.0:0.9169:0.0	.	574;601;603;638	F5H6U6;B7Z2W5;Q9NZL6;Q5SXQ6	.;.;RGL1_HUMAN;.	R	638;638;601;603;574	ENSP00000303192:G638R;ENSP00000356501:G638R;ENSP00000438662:G601R;ENSP00000354097:G603R;ENSP00000437355:G574R	ENSP00000303192:G638R	G	+	1	0	RGL1	182152261	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.475000	0.53136	2.345000	0.79718	0.650000	0.86243	GGG	.		0.502	RGL1-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000085742.1	NM_015149	
C10orf55	414236	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	75672687	75672687	+	Intron	SNP	T	T	A			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr10:75672687T>A	ENST00000409178.1	-	3	301				C10orf55_ENST00000412307.2_Intron|PLAU_ENST00000372764.3_Missense_Mutation_p.S67T|PLAU_ENST00000446342.1_Missense_Mutation_p.S50T|PLAU_ENST00000494287.1_3'UTR|PLAU_ENST00000372762.4_Missense_Mutation_p.S31T	NM_001001791.2	NP_001001791.2	Q5SWW7	CJ055_HUMAN	chromosome 10 open reading frame 55											endometrium(1)	1	Prostate(51;0.0112)					TGTAGATAAGTCAAAAACCTG	0.468																																					p.S67T		.											.	PLAU-118	0			c.T199A						.						50.0	49.0	49.0					10																	75672687		2203	4300	6503	SO:0001627	intron_variant	5328	exon5			GATAAGTCAAAAA		CCDS53541.1	10q22.2	2012-05-24			ENSG00000222047	ENSG00000222047			31008	protein-coding gene	gene with protein product							Standard	NM_001001791		Approved	bA417O11.3	uc001jvz.2	Q5SWW7	OTTHUMG00000018496	ENST00000409178.1:c.39+113A>T	10.37:g.75672687T>A		75	0		62	6	NM_002658	0	0	0	0	0	Q3KRG4|Q8NAK4	Missense_Mutation	SNP	ENST00000409178.1	37	CCDS53541.1	.	.	.	.	.	.	.	.	.	.	T	10.76	1.440884	0.25900	.	.	ENSG00000122861	ENST00000446342;ENST00000372764;ENST00000372762;ENST00000372761	T;T;T	0.62364	0.03;0.03;0.03	5.78	3.47	0.39725	Kringle-like fold (1);	0.659026	0.14635	N	0.307599	T	0.47875	0.1469	L	0.38692	1.165	0.09310	N	0.999999	B;B;B;B	0.24823	0.022;0.112;0.022;0.027	B;B;B;B	0.26864	0.026;0.074;0.014;0.018	T	0.34428	-0.9829	10	0.33141	T	0.24	.	5.3638	0.16103	0.0:0.0896:0.1988:0.7116	.	50;31;67;67	E7ET40;E7ESM2;B2R7F2;P00749	.;.;.;UROK_HUMAN	T	50;67;31;31	ENSP00000388474:S50T;ENSP00000361850:S67T;ENSP00000361848:S31T	ENSP00000361847:S31T	S	+	1	0	PLAU	75342693	0.000000	0.05858	0.022000	0.16811	0.143000	0.21401	0.117000	0.15583	1.009000	0.39289	-0.340000	0.08031	TCA	.		0.468	C10orf55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048746.1	NM_001001791	
RRP8	23378	ucsc.edu	37	11	6622569	6622569	+	Missense_Mutation	SNP	C	C	T			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr11:6622569C>T	ENST00000254605.6	-	3	844	c.727G>A	c.(727-729)Gca>Aca	p.A243T	ILK_ENST00000420936.2_5'Flank|RP11-732A19.8_ENST00000527191.1_RNA|ILK_ENST00000299421.4_5'Flank|ILK_ENST00000537806.1_5'Flank|RRP8_ENST00000534343.1_Intron|ILK_ENST00000528995.1_5'Flank|ILK_ENST00000396751.2_5'Flank	NM_015324.3	NP_056139.1	O43159	RRP8_HUMAN	ribosomal RNA processing 8, methyltransferase, homolog (yeast)	243					cellular response to glucose starvation (GO:0042149)|chromatin modification (GO:0016568)|chromatin silencing at rDNA (GO:0000183)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|positive regulation of cell cycle arrest (GO:0071158)|regulation of transcription by glucose (GO:0046015)|rRNA processing (GO:0006364)|transcription, DNA-templated (GO:0006351)	chromatin silencing complex (GO:0005677)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|rDNA heterochromatin (GO:0033553)	methylated histone binding (GO:0035064)|poly(A) RNA binding (GO:0044822)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)	13						AGCCGCTGTGCCATGCGGGCT	0.632																																					p.A243T													.	RRP8-90	0			c.G727A						.						29.0	29.0	29.0					11																	6622569		2201	4296	6497	SO:0001583	missense	23378	exon3			GCTGTGCCATGCG	AB007869	CCDS31411.1	11p15.4	2009-02-23	2009-02-23	2009-02-23	ENSG00000132275	ENSG00000132275			29030	protein-coding gene	gene with protein product	RRP8 methyltransferase homolog (S. cerevisiae)	615818	"""KIAA0409"""	KIAA0409		9455477	Standard	NM_015324		Approved		uc001med.3	O43159		ENST00000254605.6:c.727G>A	11.37:g.6622569C>T	ENSP00000254605:p.Ala243Thr	26	0		40	4	NM_015324	0	0	11	11	0	Q7KZ78|Q9BVM6	Missense_Mutation	SNP	ENST00000254605.6	37	CCDS31411.1	.	.	.	.	.	.	.	.	.	.	C	11.56	1.674043	0.29693	.	.	ENSG00000132275	ENST00000254605;ENST00000533907	T;T	0.42131	0.98;0.98	5.85	0.654	0.17833	.	0.282817	0.38058	N	0.001840	T	0.20536	0.0494	N	0.12746	0.255	0.80722	D	1	B	0.17038	0.02	B	0.14578	0.011	T	0.07751	-1.0756	10	0.14252	T	0.57	-4.6887	10.3863	0.44143	0.0:0.6184:0.0:0.3816	.	243	O43159	RRP8_HUMAN	T	243	ENSP00000254605:A243T;ENSP00000436246:A243T	ENSP00000254605:A243T	A	-	1	0	RRP8	6579145	1.000000	0.71417	0.947000	0.38551	0.957000	0.61999	2.543000	0.45752	0.210000	0.20664	0.650000	0.86243	GCA	.		0.632	RRP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384505.1	NM_015324	
WDR74	54663	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	62606983	62606983	+	Missense_Mutation	SNP	C	C	G			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr11:62606983C>G	ENST00000525239.1	-	2	597	c.60G>C	c.(58-60)ttG>ttC	p.L20F	RNU2-2P_ENST00000410396.1_RNA|WDR74_ENST00000311713.7_Missense_Mutation_p.L20F|WDR74_ENST00000529106.1_Missense_Mutation_p.L20F|WDR74_ENST00000278856.4_Missense_Mutation_p.L20F|WDR74_ENST00000525752.1_Intron|WDR74_ENST00000540620.1_5'UTR			Q6RFH5	WDR74_HUMAN	WD repeat domain 74	20					blastocyst formation (GO:0001825)|RNA metabolic process (GO:0016070)	nucleolus (GO:0005730)|nucleus (GO:0005634)				kidney(2)|large_intestine(1)|liver(1)|lung(3)|ovary(1)	8						ACCCACCTTTCAAGATCCCAG	0.632																																					p.L20F		.											.	WDR74-23	0			c.G60C						.						39.0	45.0	43.0					11																	62606983		2086	4226	6312	SO:0001583	missense	54663	exon2			ACCTTTCAAGATC		CCDS44630.1	11q12.3	2013-01-09				ENSG00000133316		"""WD repeat domain containing"""	25529	protein-coding gene	gene with protein product							Standard	NM_018093		Approved	FLJ10439	uc001nvm.2	Q6RFH5		ENST00000525239.1:c.60G>C	11.37:g.62606983C>G	ENSP00000432119:p.Leu20Phe	104	0		97	26	NM_018093	0	0	0	0	0	A8K8G5|Q9BRC9|Q9H6X8|Q9NVY2	Missense_Mutation	SNP	ENST00000525239.1	37	CCDS44630.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.49|18.49	3.634308|3.634308	0.67130|0.67130	.|.	.|.	ENSG00000133316|ENSG00000133316	ENST00000535048|ENST00000311713;ENST00000529106;ENST00000525239;ENST00000278856;ENST00000538098	.|T;T;T;T;T	.|0.39406	.|1.35;1.35;1.35;1.35;1.08	4.28|4.28	1.21|1.21	0.21127|0.21127	.|.	.|0.000000	.|0.64402	.|D	.|0.000007	T|T	0.48502|0.48502	0.1503|0.1503	L|L	0.43554|0.43554	1.36|1.36	0.48632|0.48632	D|D	0.999681|0.999681	.|D;D;D	.|0.89917	.|1.0;0.999;1.0	.|D;D;D	.|0.97110	.|0.997;0.953;1.0	T|T	0.39057|0.39057	-0.9632|-0.9632	5|10	.|0.48119	.|T	.|0.1	-8.5329|-8.5329	5.8248|5.8248	0.18548|0.18548	0.0:0.6468:0.161:0.1922|0.0:0.6468:0.161:0.1922	.|.	.|20;20;20	.|B4E018;Q6RFH5;Q6RFH5-2	.|.;WDR74_HUMAN;.	Q|F	12|20	.|ENSP00000308931:L20F;ENSP00000435726:L20F;ENSP00000432119:L20F;ENSP00000278856:L20F;ENSP00000440612:L20F	.|ENSP00000278856:L20F	E|L	-|-	1|3	0|2	WDR74|WDR74	62363559|62363559	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.936000|0.936000	0.57629|0.57629	1.056000|1.056000	0.30480|0.30480	0.415000|0.415000	0.25817|0.25817	0.655000|0.655000	0.94253|0.94253	GAA|TTG	.		0.632	WDR74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395678.1	NM_018093	
ESRRA	2101	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	64074935	64074935	+	Missense_Mutation	SNP	C	C	A			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr11:64074935C>A	ENST00000405666.1	+	2	518	c.284C>A	c.(283-285)tCc>tAc	p.S95Y	ESRRA_ENST00000406310.1_Missense_Mutation_p.S95Y|ESRRA_ENST00000000442.6_Missense_Mutation_p.S95Y|RP11-783K16.10_ENST00000539086.1_RNA	NM_001282450.1	NP_001269379.1	P11474	ERR1_HUMAN	estrogen-related receptor alpha	95					cartilage development (GO:0051216)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell proliferation (GO:0042127)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(4)|lung(8)	14						GGTGTGGCATCCTGTGAGGCC	0.657																																					p.S95Y													.	ESRRA-90	0			c.C284A						.						18.0	20.0	19.0					11																	64074935		2070	4214	6284	SO:0001583	missense	2101	exon2			TGGCATCCTGTGA	X51416, L38487	CCDS41667.1, CCDS60830.1	11q12	2013-01-16			ENSG00000173153	ENSG00000173153		"""Nuclear hormone receptors"""	3471	protein-coding gene	gene with protein product		601998		ESRL1		3267207	Standard	NM_004451		Approved	ERR1, ERRalpha, NR3B1, ERRa	uc001nzq.1	P11474	OTTHUMG00000150641	ENST00000405666.1:c.284C>A	11.37:g.64074935C>A	ENSP00000384851:p.Ser95Tyr	33	0		45	6	NM_004451	0	0	15	25	10	Q14514	Missense_Mutation	SNP	ENST00000405666.1	37	CCDS41667.1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.522137	0.85600	.	.	ENSG00000173153	ENST00000406310;ENST00000000442;ENST00000405666;ENST00000468670	D;D;D;D	0.97710	-4.5;-4.5;-4.5;-4.5	4.3	4.3	0.51218	Zinc finger, NHR/GATA-type (1);Zinc finger, nuclear hormone receptor-type (6);	0.065007	0.64402	D	0.000005	D	0.99269	0.9745	H	0.98738	4.315	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.98316	1.0526	10	0.87932	D	0	.	14.6596	0.68861	0.0:1.0:0.0:0.0	.	95;95	P11474-2;P11474	.;ERR1_HUMAN	Y	95	ENSP00000385971:S95Y;ENSP00000000442:S95Y;ENSP00000384851:S95Y;ENSP00000441970:S95Y	ENSP00000000442:S95Y	S	+	2	0	ESRRA	63831511	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.329000	0.79170	2.399000	0.81585	0.462000	0.41574	TCC	.		0.657	ESRRA-003	KNOWN	alternative_5_UTR|NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319304.1	NM_004451	
SLCO2B1	11309	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	74915493	74915493	+	Silent	SNP	C	C	T	rs192050675		TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr11:74915493C>T	ENST00000289575.5	+	14	2393	c.1998C>T	c.(1996-1998)ttC>ttT	p.F666F	SLCO2B1_ENST00000532236.1_Silent_p.F550F|SLCO2B1_ENST00000428359.2_Silent_p.F644F|SLCO2B1_ENST00000525650.1_Silent_p.F522F|SLCO2B1_ENST00000454962.2_Silent_p.F439F|SLCO2B1_ENST00000341411.4_Silent_p.F439F	NM_007256.4	NP_009187	O94956	SO2B1_HUMAN	solute carrier organic anion transporter family, member 2B1	666					liver development (GO:0001889)|sodium-independent icosanoid transport (GO:0071718)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bile acid transmembrane transporter activity (GO:0015125)|organic anion transmembrane transporter activity (GO:0008514)|sodium-independent organic anion transmembrane transporter activity (GO:0015347)			breast(2)|endometrium(1)|large_intestine(7)|lung(20)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	39					Acetic acid(DB03166)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Digoxin(DB00390)|Dinoprostone(DB00917)|Ergoloid mesylate(DB01049)|Estradiol(DB00783)|Estrone(DB00655)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Glyburide(DB01016)|Ibuprofen(DB01050)|Iloprost(DB01088)|Latanoprost(DB00654)|Montelukast(DB00471)|Niacin(DB00627)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rifampicin(DB01045)|Rosuvastatin(DB01098)|Salicylic acid(DB00936)|Tolbutamide(DB01124)	TGATCTGCTTCGCCTTAGTTT	0.552																																					p.F666F		.											.	SLCO2B1-154	0			c.C1998T						.	T	,,	1,4399	2.1+/-5.4	0,1,2199	139.0	119.0	126.0		1932,1566,1998	-3.0	0.1	11		126	1,8585	1.2+/-3.3	0,1,4292	no	coding-synonymous,coding-synonymous,coding-synonymous	SLCO2B1	NM_001145211.2,NM_001145212.2,NM_007256.4	,,	0,2,6491	TT,TC,CC		0.0116,0.0227,0.0154	,,	644/688,522/566,666/710	74915493	2,12984	2200	4293	6493	SO:0001819	synonymous_variant	11309	exon14			CTGCTTCGCCTTA	AB026256	CCDS8235.1, CCDS44683.1, CCDS53679.1	11q13	2013-05-22	2003-11-25	2003-11-26				"""Solute carriers"""	10962	protein-coding gene	gene with protein product		604988	"""solute carrier family 21 (organic anion transporter), member 9"""	SLC21A9			Standard	NM_007256		Approved	OATP-B, OATP2B1	uc001owb.3	O94956		ENST00000289575.5:c.1998C>T	11.37:g.74915493C>T		128	0		130	27	NM_007256	0	0	5	5	0	A8K2G9|B4DGA9|B4DTB0|E7ERN5|E9PPU8|Q9H2Z0|Q9UFU1	Silent	SNP	ENST00000289575.5	37	CCDS8235.1																																																																																			A|0.000;C|0.999		0.552	SLCO2B1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000383933.1	NM_007256	
MMP13	4322	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	102822873	102822873	+	Missense_Mutation	SNP	C	C	G			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr11:102822873C>G	ENST00000260302.3	-	5	695	c.667G>C	c.(667-669)Gag>Cag	p.E223Q	MMP13_ENST00000340273.4_Missense_Mutation_p.E223Q	NM_002427.3	NP_002418.1	P45452	MMP13_HUMAN	matrix metallopeptidase 13 (collagenase 3)	223	Interaction with TIMP2.				bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|cartilage development (GO:0051216)|cellular protein metabolic process (GO:0044267)|collagen catabolic process (GO:0030574)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.E223K(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|skin(1)|stomach(1)	27		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.0144)	Marimastat(DB00786)	TGGCCGAACTCATGCGCAGCA	0.433																																					p.E223Q		.											.	MMP13-229	1	Substitution - Missense(1)	NS(1)	c.G667C						.						160.0	152.0	154.0					11																	102822873		2202	4299	6501	SO:0001583	missense	4322	exon5			CGAACTCATGCGC	X75308	CCDS8324.1	11q22.3	2014-01-30	2005-08-08		ENSG00000137745	ENSG00000137745		"""Endogenous ligands"""	7159	protein-coding gene	gene with protein product	"""collagenase 3"""	600108	"""matrix metalloproteinase 13 (collagenase 3)"""			8207000	Standard	NM_002427		Approved	CLG3	uc001phl.3	P45452	OTTHUMG00000165850	ENST00000260302.3:c.667G>C	11.37:g.102822873C>G	ENSP00000260302:p.Glu223Gln	175	0		179	32	NM_002427	0	0	0	0	0	A8K846|B2RCZ3|Q6NWN6	Missense_Mutation	SNP	ENST00000260302.3	37	CCDS8324.1	.	.	.	.	.	.	.	.	.	.	C	34	5.305406	0.95601	.	.	ENSG00000137745	ENST00000260302;ENST00000546012;ENST00000340273	D;D	0.83075	-1.68;-1.68	5.75	5.75	0.90469	Peptidase M10, metallopeptidase (1);Peptidase, metallopeptidase (1);Metallopeptidase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.94355	0.8185	H	0.95365	3.66	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95140	0.8263	10	0.87932	D	0	.	20.312	0.98644	0.0:1.0:0.0:0.0	.	223	P45452	MMP13_HUMAN	Q	223	ENSP00000260302:E223Q;ENSP00000339672:E223Q	ENSP00000260302:E223Q	E	-	1	0	MMP13	102328083	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.772000	0.85439	2.866000	0.98385	0.650000	0.86243	GAG	.		0.433	MMP13-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000386648.1	NM_002427	
FKBP4	2288	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	2910328	2910328	+	Missense_Mutation	SNP	G	G	A			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr12:2910328G>A	ENST00000001008.4	+	9	1265	c.1078G>A	c.(1078-1080)Gga>Aga	p.G360R	RP4-816N1.7_ENST00000547042.1_RNA|RP4-816N1.6_ENST00000547834.1_RNA	NM_002014.3	NP_002005.1	Q02790	FKBP4_HUMAN	FK506 binding protein 4, 59kDa	360	Interaction with tubulin. {ECO:0000250}.				androgen receptor signaling pathway (GO:0030521)|chaperone-mediated protein folding (GO:0061077)|copper ion transport (GO:0006825)|embryo implantation (GO:0007566)|male sex differentiation (GO:0046661)|negative regulation of microtubule polymerization (GO:0031115)|negative regulation of microtubule polymerization or depolymerization (GO:0031111)|negative regulation of neuron projection development (GO:0010977)|prostate gland development (GO:0030850)|protein complex localization (GO:0031503)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)|steroid hormone receptor complex assembly (GO:0006463)	axonal growth cone (GO:0044295)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|FK506 binding (GO:0005528)|GTP binding (GO:0005525)|heat shock protein binding (GO:0031072)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(3)|prostate(2)|skin(1)	14			OV - Ovarian serous cystadenocarcinoma(31;0.00105)			CTTCCGCCGGGGAGAGGCCCA	0.572																																					p.G360R		.											.	FKBP4-226	0			c.G1078A						.						56.0	61.0	59.0					12																	2910328		2203	4300	6503	SO:0001583	missense	2288	exon9			CGCCGGGGAGAGG	M88279	CCDS8512.1	12p13.33	2013-01-10	2002-08-29		ENSG00000004478	ENSG00000004478		"""Tetratricopeptide (TTC) repeat domain containing"""	3720	protein-coding gene	gene with protein product		600611	"""FK506-binding protein 4 (59kD)"""			1279700	Standard	NM_002014		Approved	FKBP59, FKBP52	uc001qkz.3	Q02790	OTTHUMG00000090429	ENST00000001008.4:c.1078G>A	12.37:g.2910328G>A	ENSP00000001008:p.Gly360Arg	115	0		150	33	NM_002014	0	0	52	83	31	D3DUQ1|Q9UCP1|Q9UCV7	Missense_Mutation	SNP	ENST00000001008.4	37	CCDS8512.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.166076	0.78339	.	.	ENSG00000004478	ENST00000001008	T	0.66995	-0.24	5.57	4.68	0.58851	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.047223	0.85682	N	0.000000	D	0.87577	0.6212	H	0.97564	4.03	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91165	0.4964	10	0.72032	D	0.01	-18.3148	13.2702	0.60155	0.0758:0.0:0.9242:0.0	.	360	Q02790	FKBP4_HUMAN	R	360	ENSP00000001008:G360R	ENSP00000001008:G360R	G	+	1	0	FKBP4	2780589	1.000000	0.71417	0.913000	0.36048	0.591000	0.36615	9.383000	0.97214	1.355000	0.45865	0.561000	0.74099	GGA	.		0.572	FKBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206861.1		
LRRC23	10233	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	12	7023220	7023220	+	3'UTR	SNP	A	A	C			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr12:7023220A>C	ENST00000007969.8	+	0	1442				ENO2_ENST00000229277.1_5'Flank|ENO2_ENST00000545045.2_5'Flank|ENO2_ENST00000535366.1_5'Flank|LRRC23_ENST00000429740.1_3'UTR|ENO2_ENST00000541477.1_5'Flank|ENO2_ENST00000538763.1_5'Flank|LRRC23_ENST00000323702.5_Silent_p.A308A|ENO2_ENST00000544774.1_5'Flank|LRRC23_ENST00000443597.2_3'UTR	NM_001135217.1|NM_201650.2	NP_001128689.1|NP_964013.1	Q53EV4	LRC23_HUMAN	leucine rich repeat containing 23											NS(1)|breast(1)|endometrium(2)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|stomach(1)	13						TGTGGGGTGCAGAATGGGGTG	0.657																																					p.A308A		.											.	LRRC23-23	0			c.A924C						.						94.0	90.0	92.0					12																	7023220		2203	4300	6503	SO:0001624	3_prime_UTR_variant	10233	exon7			GGGTGCAGAATGG	BC014450	CCDS8568.1, CCDS8569.1	12p13	2006-02-02			ENSG00000010626	ENSG00000010626			19138	protein-coding gene	gene with protein product						11830501, 11826754	Standard	NM_201650		Approved	B7, LRPB7	uc001qrp.3	Q53EV4	OTTHUMG00000156668	ENST00000007969.8:c.*190A>C	12.37:g.7023220A>C		153	0		170	65	NM_006992	0	0	15	62	47	A8K8C6|D3DUT1|Q8N6K6|Q92977|Q99620	Silent	SNP	ENST00000007969.8	37	CCDS8569.1																																																																																			.		0.657	LRRC23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345214.1	NM_006992	
CD163	9332	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	7640255	7640255	+	Missense_Mutation	SNP	G	G	A	rs373039092		TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr12:7640255G>A	ENST00000359156.4	-	8	1952	c.1750C>T	c.(1750-1752)Cgc>Tgc	p.R584C	CD163_ENST00000396620.3_Missense_Mutation_p.R617C|CD163_ENST00000541972.1_Missense_Mutation_p.R572C|CD163_ENST00000432237.2_Missense_Mutation_p.R584C|CD163_ENST00000539632.1_5'Flank	NM_004244.5	NP_004235.4	Q86VB7	C163A_HUMAN	CD163 molecule	584	SRCR 6. {ECO:0000255|PROSITE- ProRule:PRU00196}.				acute-phase response (GO:0006953)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)	p.R584C(1)		breast(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(6)|pancreas(2)|prostate(1)|skin(5)|urinary_tract(4)	76					WF10(DB05389)	TTCACCAAGCGAATTTCTGTG	0.488																																					p.R584C		.											.	CD163-98	1	Substitution - Missense(1)	skin(1)	c.C1750T						.	G	CYS/ARG,CYS/ARG	0,4406		0,0,2203	70.0	71.0	71.0		1750,1750	5.2	0.9	12		71	1,8599		0,1,4299	no	missense,missense	CD163	NM_004244.5,NM_203416.3	180,180	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	584/1157,584/1122	7640255	1,13005	2203	4300	6503	SO:0001583	missense	9332	exon8			CCAAGCGAATTTC	Z22968	CCDS8578.1, CCDS53742.1	12p13	2006-03-28	2006-03-28		ENSG00000177575	ENSG00000177575		"""CD molecules"""	1631	protein-coding gene	gene with protein product		605545	"""CD163 antigen"""			10403791, 8370408	Standard	NM_004244		Approved	M130, MM130	uc001qsz.3	Q86VB7	OTTHUMG00000168353	ENST00000359156.4:c.1750C>T	12.37:g.7640255G>A	ENSP00000352071:p.Arg584Cys	114	0		166	9	NM_203416	0	0	0	0	0	C9JIG2|Q07898|Q07899|Q07900|Q07901|Q2VLH7	Missense_Mutation	SNP	ENST00000359156.4	37	CCDS8578.1	.	.	.	.	.	.	.	.	.	.	G	16.62	3.173313	0.57584	0.0	1.16E-4	ENSG00000177575	ENST00000359156;ENST00000541972;ENST00000396620;ENST00000432237	T;T;T;T	0.54479	0.57;0.57;0.57;0.57	5.21	5.21	0.72293	Speract/scavenger receptor (1);Speract/scavenger receptor-related (2);	0.076247	0.51477	D	0.000083	T	0.79627	0.4478	M	0.93763	3.455	0.26882	N	0.967512	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.76575	0.988;0.917;0.988	T	0.76509	-0.2933	10	0.87932	D	0	.	16.6253	0.84968	0.0:0.0:1.0:0.0	.	617;584;584	C9JHR8;Q86VB7-3;Q86VB7	.;.;C163A_HUMAN	C	584;572;617;584	ENSP00000352071:R584C;ENSP00000444071:R572C;ENSP00000379863:R617C;ENSP00000403885:R584C	ENSP00000352071:R584C	R	-	1	0	CD163	7531522	0.513000	0.26194	0.917000	0.36280	0.574000	0.36063	1.594000	0.36697	2.592000	0.87571	0.655000	0.94253	CGC	.		0.488	CD163-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000399396.2	NM_004244, NM_203416	
MARCH9	92979	hgsc.bcm.edu	37	12	58149446	58149446	+	Silent	SNP	C	C	T	rs1689582	byFrequency	TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr12:58149446C>T	ENST00000266643.5	+	1	566	c.135C>T	c.(133-135)ggC>ggT	p.G45G	MARCH9_ENST00000548358.1_5'Flank	NM_138396.5	NP_612405.2	Q86YJ5	MARH9_HUMAN	membrane-associated ring finger (C3HC4) 9	45					protein ubiquitination (GO:0016567)	Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|trans-Golgi network (GO:0005802)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|large_intestine(2)|lung(1)	4	all_cancers(7;4.96e-69)|Lung NSC(6;5.5e-25)|all_lung(6;3.87e-23)|all_epithelial(6;1.66e-15)|Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)		GBM - Glioblastoma multiforme(5;4.21e-120)|all cancers(5;3.75e-83)|BRCA - Breast invasive adenocarcinoma(9;0.0294)			ccTTCGCTGGCTGCTCCACCC	0.801													C|||	4639	0.926318	0.789	0.9755	5008	,	,		3828	0.998		0.999	False		,,,				2504	0.9284				p.G45G		.											.	MARCH9-492	0			c.C135T						.						1.0	1.0	1.0					12																	58149446		343	936	1279	SO:0001819	synonymous_variant	92979	exon1			CGCTGGCTGCTCC	BC009489	CCDS31847.1	12q14.1	2013-01-09				ENSG00000139266		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	25139	protein-coding gene	gene with protein product		613336				14722266	Standard	NM_138396		Approved	RNF179, FLJ36578	uc001spx.2	Q86YJ5		ENST00000266643.5:c.135C>T	12.37:g.58149446C>T		0	0		4	3	NM_138396	0	0	0	0	0	B2R9U9|Q86VN5|Q96GG2	Silent	SNP	ENST00000266643.5	37	CCDS31847.1																																																																																			T|0.004;G|0.064		0.801	MARCH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409244.1	NM_138396	
KERA	11081	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	91449805	91449805	+	Missense_Mutation	SNP	G	G	C			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr12:91449805G>C	ENST00000266719.3	-	2	501	c.254C>G	c.(253-255)aCc>aGc	p.T85S		NM_007035.3	NP_008966.1	O60938	KERA_HUMAN	keratocan	85					carbohydrate metabolic process (GO:0005975)|cornea development in camera-type eye (GO:0061303)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|response to stimulus (GO:0050896)|small molecule metabolic process (GO:0044281)|visual perception (GO:0007601)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)				breast(2)|large_intestine(8)|lung(5)|prostate(2)|skin(2)	19						TTCAGGAATGGTTTCTATCAG	0.353																																					p.T85S		.											.	KERA-91	0			c.C254G						.						119.0	112.0	115.0					12																	91449805		2202	4297	6499	SO:0001583	missense	11081	exon2			GGAATGGTTTCTA	AF063301	CCDS9037.1	12q21.3-q22	2014-09-17				ENSG00000139330		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	6309	protein-coding gene	gene with protein product	"""keratocan proteoglycan"""	603288		CNA2		10565548, 10802664	Standard	NM_007035		Approved	SLRR2B	uc001tbl.3	O60938		ENST00000266719.3:c.254C>G	12.37:g.91449805G>C	ENSP00000266719:p.Thr85Ser	116	0		115	19	NM_007035	0	0	0	0	0		Missense_Mutation	SNP	ENST00000266719.3	37	CCDS9037.1	.	.	.	.	.	.	.	.	.	.	G	8.585	0.883190	0.17467	.	.	ENSG00000139330	ENST00000266719	T	0.56444	0.46	6.04	6.04	0.98038	.	0.296558	0.42821	N	0.000642	T	0.28001	0.0690	N	0.02368	-0.58	0.25604	N	0.986567	B	0.10296	0.003	B	0.15870	0.014	T	0.04650	-1.0936	10	0.10111	T	0.7	-17.6051	16.8507	0.85993	0.0:0.0:0.8711:0.1289	.	85	O60938	KERA_HUMAN	S	85	ENSP00000266719:T85S	ENSP00000266719:T85S	T	-	2	0	KERA	89973936	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.631000	0.54280	2.890000	0.99128	0.650000	0.86243	ACC	.		0.353	KERA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407149.2	NM_007035	
SH2B3	10019	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	111885276	111885276	+	Silent	SNP	G	G	A			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr12:111885276G>A	ENST00000341259.2	+	6	1521	c.1164G>A	c.(1162-1164)gtG>gtA	p.V388V	SH2B3_ENST00000538307.1_Silent_p.V186V	NM_005475.2	NP_005466.1	Q9UQQ2	SH2B3_HUMAN	SH2B adaptor protein 3	388	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|embryonic hemopoiesis (GO:0035162)|intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)	phosphate ion binding (GO:0042301)|signal transducer activity (GO:0004871)			central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(2)|ovary(1)|skin(1)	10					Pazopanib(DB06589)	CTCATGGAGTGTTCCTGGTGC	0.617																																					p.V388V		.											.	SH2B3-91	0			c.G1164A						.						65.0	70.0	69.0					12																	111885276		2203	4300	6503	SO:0001819	synonymous_variant	10019	exon6			TGGAGTGTTCCTG	AF055581	CCDS9153.1	12q24.12	2014-09-17				ENSG00000111252		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	29605	protein-coding gene	gene with protein product	"""lymphocyte adaptor protein"""	605093				10799879	Standard	NM_005475		Approved	LNK, IDDM20	uc001tse.3	Q9UQQ2		ENST00000341259.2:c.1164G>A	12.37:g.111885276G>A		167	2		165	27	NM_005475	0	0	0	0	0	B9EGG5|O95184	Silent	SNP	ENST00000341259.2	37	CCDS9153.1																																																																																			.		0.617	SH2B3-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000404779.1	NM_005475	
DDX54	79039	hgsc.bcm.edu	37	12	113596868	113596868	+	Silent	SNP	G	G	C			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr12:113596868G>C	ENST00000306014.5	-	20	2487	c.2460C>G	c.(2458-2460)cgC>cgG	p.R820R	DDX54_ENST00000314045.7_Silent_p.R821R|Y_RNA_ENST00000363029.1_RNA|CCDC42B_ENST00000335621.6_3'UTR|DDX54_ENST00000549271.1_5'UTR	NM_024072.3	NP_076977.3	Q8TDD1	DDX54_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 54	820					ATP catabolic process (GO:0006200)|intracellular estrogen receptor signaling pathway (GO:0030520)|regulation of transcription, DNA-templated (GO:0006355)|RNA metabolic process (GO:0016070)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|receptor binding (GO:0005102)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	31						TGAGTTCCGGGCGGACTCGGC	0.667																																					p.R821R		.											.	DDX54-227	0			c.C2463G						.						17.0	19.0	18.0					12																	113596868		2203	4299	6502	SO:0001819	synonymous_variant	79039	exon20			TTCCGGGCGGACT	AF144056	CCDS31907.1, CCDS44984.1	12q24.11	2006-01-30				ENSG00000123064		"""DEAD-boxes"""	20084	protein-coding gene	gene with protein product		611665				12466272	Standard	NM_001111322		Approved	MGC2835, APR-5, DP97	uc001tuq.4	Q8TDD1	OTTHUMG00000169676	ENST00000306014.5:c.2460C>G	12.37:g.113596868G>C		26	0		31	2	NM_001111322	0	0	99	99	0	Q86YT8|Q9BRZ1	Silent	SNP	ENST00000306014.5	37	CCDS31907.1																																																																																			.		0.667	DDX54-002	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405435.1	NM_024072	
DDX54	79039	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	113610194	113610194	+	Missense_Mutation	SNP	A	A	G			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr12:113610194A>G	ENST00000306014.5	-	11	1270	c.1243T>C	c.(1243-1245)Ttc>Ctc	p.F415L	DDX54_ENST00000314045.7_Missense_Mutation_p.F415L	NM_024072.3	NP_076977.3	Q8TDD1	DDX54_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 54	415	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|intracellular estrogen receptor signaling pathway (GO:0030520)|regulation of transcription, DNA-templated (GO:0006355)|RNA metabolic process (GO:0016070)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|receptor binding (GO:0005102)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	31						TTGGCGGGGAAGCTGTAGTTG	0.637																																					p.F415L		.											.	DDX54-227	0			c.T1243C						.						80.0	65.0	70.0					12																	113610194		2203	4300	6503	SO:0001583	missense	79039	exon11			CGGGGAAGCTGTA	AF144056	CCDS31907.1, CCDS44984.1	12q24.11	2006-01-30				ENSG00000123064		"""DEAD-boxes"""	20084	protein-coding gene	gene with protein product		611665				12466272	Standard	NM_001111322		Approved	MGC2835, APR-5, DP97	uc001tuq.4	Q8TDD1	OTTHUMG00000169676	ENST00000306014.5:c.1243T>C	12.37:g.113610194A>G	ENSP00000304072:p.Phe415Leu	48	0		51	21	NM_024072	0	0	12	36	24	Q86YT8|Q9BRZ1	Missense_Mutation	SNP	ENST00000306014.5	37	CCDS31907.1	.	.	.	.	.	.	.	.	.	.	A	32	5.178425	0.94846	.	.	ENSG00000123064	ENST00000314045;ENST00000306014	T;T	0.72835	-0.69;-0.69	5.18	5.18	0.71444	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	T	0.75302	0.3831	L	0.28274	0.84	0.80722	D	1	D;D	0.71674	0.997;0.998	D;D	0.73380	0.966;0.98	T	0.79047	-0.1963	10	0.87932	D	0	.	14.7275	0.69354	1.0:0.0:0.0:0.0	.	415;415	Q8TDD1-2;Q8TDD1	.;DDX54_HUMAN	L	415	ENSP00000323858:F415L;ENSP00000304072:F415L	ENSP00000304072:F415L	F	-	1	0	DDX54	112094577	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.294000	0.96088	1.966000	0.57179	0.528000	0.53228	TTC	.		0.637	DDX54-002	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405435.1	NM_024072	
CDK8	1024	hgsc.bcm.edu;bcgsc.ca	37	13	26975738	26975738	+	Missense_Mutation	SNP	C	C	A			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr13:26975738C>A	ENST00000381527.3	+	12	1749	c.1246C>A	c.(1246-1248)Ctt>Att	p.L416I	CDK8_ENST00000536792.1_3'UTR|CDK8_ENST00000480323.1_3'UTR	NM_001260.1	NP_001251.1	P49336	CDK8_HUMAN	cyclin-dependent kinase 8	416					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|urinary_tract(1)	25	Colorectal(5;0.000442)	Lung SC(185;0.0156)|Breast(139;0.147)		all cancers(112;0.0384)|Epithelial(112;0.142)|OV - Ovarian serous cystadenocarcinoma(117;0.188)		CTCAGGTGGACTTATCATGAC	0.438																																					p.L416I		.											.	CDK8-1023	0			c.C1246A						.						144.0	125.0	131.0					13																	26975738		2203	4300	6503	SO:0001583	missense	1024	exon12			GGTGGACTTATCA	X85753	CCDS9317.1	13q12	2011-11-08			ENSG00000132964	ENSG00000132964		"""Cyclin-dependent kinases"""	1779	protein-coding gene	gene with protein product		603184				7568034	Standard	NM_001260		Approved	K35	uc001uqr.1	P49336	OTTHUMG00000016617	ENST00000381527.3:c.1246C>A	13.37:g.26975738C>A	ENSP00000370938:p.Leu416Ile	117	0		97	12	NM_001260	0	0	1	1	0	Q5VUF3|Q6ISB5	Missense_Mutation	SNP	ENST00000381527.3	37	CCDS9317.1	.	.	.	.	.	.	.	.	.	.	C	15.68	2.903879	0.52333	.	.	ENSG00000132964	ENST00000381527	T	0.68025	-0.3	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	T	0.49490	0.1560	N	0.08118	0	0.80722	D	1	P;P	0.39282	0.666;0.586	B;B	0.37833	0.259;0.146	T	0.51957	-0.8639	10	0.28530	T	0.3	-6.9656	18.9814	0.92756	0.0:1.0:0.0:0.0	.	415;416	P49336-2;P49336	.;CDK8_HUMAN	I	416	ENSP00000370938:L416I	ENSP00000370938:L416I	L	+	1	0	CDK8	25873738	1.000000	0.71417	0.995000	0.50966	0.993000	0.82548	7.440000	0.80464	2.491000	0.84063	0.655000	0.94253	CTT	.		0.438	CDK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044250.1		
DIAPH3	81624	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	60566699	60566699	+	Missense_Mutation	SNP	T	T	A			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr13:60566699T>A	ENST00000400324.4	-	10	1253	c.1033A>T	c.(1033-1035)Atc>Ttc	p.I345F	DIAPH3_ENST00000400330.1_Missense_Mutation_p.I345F|DIAPH3_ENST00000465066.1_5'UTR|DIAPH3_ENST00000400320.1_Missense_Mutation_p.I299F|DIAPH3_ENST00000377908.2_Missense_Mutation_p.I334F|DIAPH3_ENST00000400319.1_Missense_Mutation_p.I275F|DIAPH3_ENST00000267215.4_Missense_Mutation_p.I345F	NM_001042517.1|NM_001258366.1	NP_001035982.1|NP_001245295.1	Q9NSV4	DIAP3_HUMAN	diaphanous-related formin 3	345	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin cytoskeleton organization (GO:0030036)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|liver(1)|lung(20)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46		Breast(118;0.052)|Prostate(109;0.103)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;2.77e-05)		AGGGCATTGATGAGCTGCATA	0.393																																					p.I345F		.											.	DIAPH3-516	0			c.A1033T						.						65.0	60.0	62.0					13																	60566699		1908	4138	6046	SO:0001583	missense	81624	exon10			CATTGATGAGCTG	AL137718	CCDS41898.1, CCDS58294.1, CCDS58295.1, CCDS58296.1, CCDS58297.1, CCDS73579.1, CCDS73580.1	13q21.2	2013-05-24	2013-05-24		ENSG00000139734	ENSG00000139734			15480	protein-coding gene	gene with protein product		614567	"""diaphanous (Drosophila, homolog) 3"", ""auditory neuropathy, autosomal dominant 1"", ""diaphanous homolog 3 (Drosophila)"""	AUNA1		14767582, 20624953	Standard	NM_030932		Approved	DRF3, FLJ34705, AN, NSDAN	uc001vht.4	Q9NSV4	OTTHUMG00000017004	ENST00000400324.4:c.1033A>T	13.37:g.60566699T>A	ENSP00000383178:p.Ile345Phe	42	0		52	8	NM_001042517	0	0	0	0	0	A2A3B8|A2A3B9|A2A3C0|Q18P99|Q18PA0|Q18PA1|Q2KPB6|Q3ZK23|Q5JTP8|Q5T2S7|Q5XKF6|Q6MZF0|Q6NUP0|Q86VS4|Q8NAV4	Missense_Mutation	SNP	ENST00000400324.4	37	CCDS41898.1	.	.	.	.	.	.	.	.	.	.	T	24.1	4.490483	0.84962	.	.	ENSG00000139734	ENST00000400324;ENST00000400330;ENST00000400327;ENST00000413168;ENST00000400329;ENST00000377908;ENST00000400319;ENST00000400320;ENST00000267215;ENST00000267214;ENST00000453990	D;D;D;D;D;D	0.91894	-2.93;-2.93;-2.93;-2.93;-2.93;-2.93	5.77	5.77	0.91146	GTPase-binding/formin homology 3 (1);Diaphanous FH3 (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.97334	0.9128	H	0.95114	3.625	0.54753	D	0.999989	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.996	D;D;D;D;D	0.91635	0.999;0.999;0.999;0.999;0.98	D	0.98505	1.0616	10	0.87932	D	0	.	16.0865	0.81056	0.0:0.0:0.0:1.0	.	275;299;334;82;345	A8MYX0;C9JL55;C9JDG1;Q9NSV4-1;Q9NSV4	.;.;.;.;DIAP3_HUMAN	F	345;345;334;299;275;334;275;299;345;82;345	ENSP00000383178:I345F;ENSP00000383184:I345F;ENSP00000367141:I334F;ENSP00000383173:I275F;ENSP00000383174:I299F;ENSP00000267215:I345F	ENSP00000267214:I82F	I	-	1	0	DIAPH3	59464700	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.606000	0.82863	2.194000	0.70268	0.377000	0.23210	ATC	.		0.393	DIAPH3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045166.3	NM_001042517	
CPNE6	9362	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	24545747	24545747	+	Silent	SNP	G	G	A			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr14:24545747G>A	ENST00000397016.2	+	14	1457	c.1146G>A	c.(1144-1146)ccG>ccA	p.P382P	CPNE6_ENST00000216775.2_Silent_p.P382P|CPNE6_ENST00000537691.1_Silent_p.P437P	NM_001280558.1	NP_001267487.1	O95741	CPNE6_HUMAN	copine VI (neuronal)	382	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				lipid metabolic process (GO:0006629)|nervous system development (GO:0007399)|synaptic transmission (GO:0007268)|vesicle-mediated transport (GO:0016192)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			endometrium(4)|large_intestine(3)|liver(2)|lung(5)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	22				GBM - Glioblastoma multiforme(265;0.0184)		ACTTTGACCCGGAAAATCCTG	0.587																																					p.P382P		.											.	CPNE6-93	0			c.G1146A						.						100.0	103.0	102.0					14																	24545747		2203	4300	6503	SO:0001819	synonymous_variant	9362	exon13			TGACCCGGAAAAT	AB009288	CCDS9607.1, CCDS61413.1	14q11.2	2008-07-09			ENSG00000100884	ENSG00000100884			2319	protein-coding gene	gene with protein product		605688				9645480	Standard	NM_001280558		Approved		uc001wll.3	O95741	OTTHUMG00000028781	ENST00000397016.2:c.1146G>A	14.37:g.24545747G>A		139	0		94	30	NM_006032	0	0	0	0	0	B2RAG6|B7Z1M3|D3DS55|F5GXN1|Q53HA6|Q8WVG1	Silent	SNP	ENST00000397016.2	37	CCDS9607.1																																																																																			.		0.587	CPNE6-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071869.5		
PAK6	56924	hgsc.bcm.edu	37	15	40557188	40557188	+	Missense_Mutation	SNP	A	A	G			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr15:40557188A>G	ENST00000542403.2	+	2	313	c.202A>G	c.(202-204)Aag>Gag	p.K68E	PAK6_ENST00000260404.4_Missense_Mutation_p.K68E|PAK6_ENST00000455577.2_Missense_Mutation_p.K68E|RP11-133K1.2_ENST00000558658.1_Nonstop_Mutation_p.*161W|PAK6_ENST00000441369.1_Missense_Mutation_p.K68E|PAK6_ENST00000560346.1_Missense_Mutation_p.K68E|PAK6_ENST00000453867.1_Missense_Mutation_p.K68E	NM_001276717.1	NP_001263646.1	Q9NQU5	PAK6_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 6	68	Linker.				apoptotic process (GO:0006915)|cytoskeleton organization (GO:0007010)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|cervix(1)|endometrium(3)|large_intestine(2)|liver(1)|lung(11)|ovary(2)|prostate(1)|skin(2)	24		all_cancers(109;1.13e-18)|all_epithelial(112;1.62e-15)|Lung NSC(122;5.67e-11)|all_lung(180;1.41e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0823)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;1.51e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0544)		CCAGCCCATGAAGGTAAGAGG	0.622																																					p.K68E		.											.	PAK6-996	0			c.A202G						.						36.0	35.0	35.0					15																	40557188		2203	4300	6503	SO:0001583	missense	56924	exon3			CCCATGAAGGTAA	AF276893	CCDS10054.1, CCDS61590.1	15q14	2008-06-17	2008-06-17		ENSG00000137843	ENSG00000137843			16061	protein-coding gene	gene with protein product		608110	"""p21(CDKN1A)-activated kinase 6"""			11278661	Standard	NM_020168		Approved	PAK5	uc001zlb.3	Q9NQU5	OTTHUMG00000129921	ENST00000542403.2:c.202A>G	15.37:g.40557188A>G	ENSP00000439597:p.Lys68Glu	46	0		37	2	NM_001128629	0	0	0	0	0	A8K2G2|B3KYB0|G5E9R2	Missense_Mutation	SNP	ENST00000542403.2	37	CCDS10054.1	.	.	.	.	.	.	.	.	.	.	A	34	5.371985	0.95923	.	.	ENSG00000137843	ENST00000441369;ENST00000453867;ENST00000455577;ENST00000260404;ENST00000542403	D;D;D;D;D	0.86497	-1.97;-1.97;-2.13;-1.97;-1.97	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	D	0.86016	0.5832	M	0.63843	1.955	0.80722	D	1	B;B	0.33940	0.307;0.433	B;B	0.33454	0.079;0.164	D	0.86814	0.2000	10	0.87932	D	0	.	15.8022	0.78463	1.0:0.0:0.0:0.0	.	68;68	Q9NQU5;G5E9R2	PAK6_HUMAN;.	E	68	ENSP00000406873:K68E;ENSP00000401153:K68E;ENSP00000409465:K68E;ENSP00000260404:K68E;ENSP00000439597:K68E	ENSP00000260404:K68E	K	+	1	0	PAK6	38344480	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.309000	0.96252	2.202000	0.70862	0.533000	0.62120	AAG	.		0.622	PAK6-004	NOVEL	alternative_3_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000418355.1		
HMGN2P46	283651	ucsc.edu;bcgsc.ca	37	15	45847824	45847824	+	lincRNA	SNP	G	G	A	rs183934743	byFrequency	TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr15:45847824G>A	ENST00000557965.1	+	0	0				HMGN2P46_ENST00000409454.1_RNA																							GTGCTCCACTGCCCAGTGCCT	0.512																																					.													.	.	0			.						.						82.0	68.0	73.0					15																	45847824		2198	4298	6496			283651	.			TCCACTGCCCAGT																													15.37:g.45847824G>A		53	0		39	9	.	0	0	0	0	0		RNA	SNP	ENST00000557965.1	37																																																																																				G|0.999;T|0.001		0.512	RP11-96O20.2-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000416553.1		
SEMA7A	8482	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	74708932	74708932	+	Missense_Mutation	SNP	A	A	C			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr15:74708932A>C	ENST00000261918.4	-	7	1333	c.785T>G	c.(784-786)gTg>gGg	p.V262G	SEMA7A_ENST00000543145.2_Missense_Mutation_p.V248G|SEMA7A_ENST00000542748.1_Missense_Mutation_p.V97G	NM_003612.3	NP_003603.1	O75326	SEM7A_HUMAN	semaphorin 7A, GPI membrane anchor (John Milton Hagen blood group)	262	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon extension (GO:0048675)|axon guidance (GO:0007411)|immune response (GO:0006955)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|olfactory lobe development (GO:0021988)|osteoblast differentiation (GO:0001649)|positive regulation of axon extension (GO:0045773)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of protein phosphorylation (GO:0001934)|regulation of inflammatory response (GO:0050727)	anchored component of membrane (GO:0031225)|external side of plasma membrane (GO:0009897)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			breast(3)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(3)|lung(12)|upper_aerodigestive_tract(1)	30						CAACTGGGCCACACGGGACAC	0.552																																					p.V262G		.											.	SEMA7A-153	0			c.T785G						.						204.0	168.0	180.0					15																	74708932		2197	4296	6493	SO:0001583	missense	8482	exon7			TGGGCCACACGGG	AF069493	CCDS10262.1, CCDS53958.1, CCDS53959.1	15q22.3-q23	2014-07-18	2006-02-23		ENSG00000138623	ENSG00000138623		"""Semaphorins"", ""CD molecules"", ""Blood group antigens"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10741	protein-coding gene	gene with protein product	"""John Milton Hagen blood group"", ""H-Sema K1"""	607961	"""sema domain, immunoglobulin domain (Ig), and GPI membrane anchor, (semaphorin) 7A"", ""sema domain, immunoglobulin domain (Ig), and GPI membrane anchor, (semaphorin) 7A (JMH blood group)"""	SEMAL		9721204	Standard	NM_003612		Approved	H-Sema-L, CD108	uc002axv.3	O75326	OTTHUMG00000139000	ENST00000261918.4:c.785T>G	15.37:g.74708932A>C	ENSP00000261918:p.Val262Gly	68	0		63	18	NM_003612	0	0	0	0	0	B4DDP7|F5H1S0|Q1XE81|Q1XE82|Q1XE83|Q1XE84|Q3MIY5	Missense_Mutation	SNP	ENST00000261918.4	37	CCDS10262.1	.	.	.	.	.	.	.	.	.	.	A	16.84	3.235032	0.58886	.	.	ENSG00000138623	ENST00000261918;ENST00000543145;ENST00000542748	T;T;T	0.35789	1.29;1.29;1.29	5.39	5.39	0.77823	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.065645	0.64402	D	0.000009	T	0.67316	0.2880	M	0.91354	3.2	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.75622	-0.3254	10	0.87932	D	0	-18.6242	13.6573	0.62346	1.0:0.0:0.0:0.0	.	248;262	F5H1S0;O75326	.;SEM7A_HUMAN	G	262;248;97	ENSP00000261918:V262G;ENSP00000438966:V248G;ENSP00000441493:V97G	ENSP00000261918:V262G	V	-	2	0	SEMA7A	72495985	1.000000	0.71417	0.993000	0.49108	0.169000	0.22640	5.449000	0.66619	2.043000	0.60533	0.533000	0.62120	GTG	.		0.552	SEMA7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000272904.3	NM_003612	
PEAK1	79834	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	77406689	77406689	+	Silent	SNP	G	G	A			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr15:77406689G>A	ENST00000560626.2	-	7	5525	c.5050C>T	c.(5050-5052)Cta>Tta	p.L1684L	PEAK1_ENST00000312493.4_Silent_p.L1684L			Q9H792	PEAK1_HUMAN	pseudopodium-enriched atypical kinase 1	1684					cell migration (GO:0016477)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|substrate adhesion-dependent cell spreading (GO:0034446)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)										CTCTGTACTAGGCTAGGGCAG	0.542																																					p.L1684L		.											.	.	0			c.C5050T						.						93.0	96.0	95.0					15																	77406689		1943	4130	6073	SO:0001819	synonymous_variant	0	exon8			GTACTAGGCTAGG		CCDS42062.1	15q24.3	2013-09-27			ENSG00000173517	ENSG00000173517			29431	protein-coding gene	gene with protein product		614248				16879967, 20534451	Standard	NM_024776		Approved	KIAA2002, sgk269		Q9H792	OTTHUMG00000172618	ENST00000560626.2:c.5050C>T	15.37:g.77406689G>A		143	0		137	34	NM_024776	0	0	1	1	0	Q6ZS78|Q8NAZ4|Q8NCM3|Q8TEG7	Silent	SNP	ENST00000560626.2	37	CCDS42062.1																																																																																			.		0.542	PEAK1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419483.3		
ZNF423	23090	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	49670185	49670185	+	Missense_Mutation	SNP	T	T	C			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr16:49670185T>C	ENST00000561648.1	-	4	2931	c.2878A>G	c.(2878-2880)Atg>Gtg	p.M960V	ZNF423_ENST00000535559.1_Missense_Mutation_p.M843V|ZNF423_ENST00000567169.1_Missense_Mutation_p.M843V|ZNF423_ENST00000562871.1_Missense_Mutation_p.M900V|ZNF423_ENST00000262383.2_Missense_Mutation_p.M960V|ZNF423_ENST00000563137.2_Missense_Mutation_p.M900V|ZNF423_ENST00000562520.1_Missense_Mutation_p.M900V	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	960					cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				ATGGGACACATGTAGTGCTTG	0.602																																					p.M960V		.											.	ZNF423-228	0			c.A2878G						.						72.0	54.0	60.0					16																	49670185		2198	4300	6498	SO:0001583	missense	23090	exon4			GACACATGTAGTG	AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.2878A>G	16.37:g.49670185T>C	ENSP00000455426:p.Met960Val	61	0		62	12	NM_015069	0	0	1	1	0	O94860|Q76N04|Q9NZ13	Missense_Mutation	SNP	ENST00000561648.1	37	CCDS32445.1	.	.	.	.	.	.	.	.	.	.	T	19.12	3.766597	0.69878	.	.	ENSG00000102935	ENST00000262383;ENST00000535559	T;T	0.16897	2.31;2.31	4.81	4.81	0.61882	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.18551	0.0445	N	0.04043	-0.29	0.45648	D	0.998576	D	0.61697	0.99	D	0.67548	0.952	T	0.32375	-0.9909	9	.	.	.	-30.7346	14.3758	0.66874	0.0:0.0:0.0:1.0	.	960	Q2M1K9	ZN423_HUMAN	V	960;843	ENSP00000262383:M960V;ENSP00000442321:M843V	.	M	-	1	0	ZNF423	48227686	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.289000	0.72696	1.814000	0.52955	0.459000	0.35465	ATG	.		0.602	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000423258.1	NM_015069	
PER1	5187	broad.mit.edu	37	17	8047060	8047060	+	Missense_Mutation	SNP	T	T	G			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr17:8047060T>G	ENST00000317276.4	-	19	2833	c.2596A>C	c.(2596-2598)Acc>Ccc	p.T866P	PER1_ENST00000578089.1_5'UTR|PER1_ENST00000581082.1_Missense_Mutation_p.T843P	NM_002616.2	NP_002607.2	O15534	PER1_HUMAN	period circadian clock 1	866	Pro-rich.				circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|entrainment of circadian clock (GO:0009649)|entrainment of circadian clock by photoperiod (GO:0043153)|histone H3 acetylation (GO:0043966)|histone H3 deacetylation (GO:0070932)|histone H4 acetylation (GO:0043967)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|posttranscriptional regulation of gene expression (GO:0010608)|regulation of circadian rhythm (GO:0042752)|regulation of cytokine production involved in inflammatory response (GO:1900015)|regulation of hair cycle (GO:0042634)|regulation of p38MAPK cascade (GO:1900744)|regulation of sodium ion transport (GO:0002028)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|E-box binding (GO:0070888)|kinase binding (GO:0019900)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|signal transducer activity (GO:0004871)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin protein ligase binding (GO:0031625)	p.T866P(1)		breast(4)|central_nervous_system(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(15)|ovary(4)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						GGCCAGGGGGTGGAGGGTGGC	0.667			T	ETV6	"""AML, CMML"""			Other conserved DNA damage response genes																													p.T866P				Dom	yes		17	17p13.1-17p12	5187	period homolog 1 (Drosophila)		L	.	PER1-723	1	Substitution - Missense(1)	central_nervous_system(1)	c.A2596C						.																																			SO:0001583	missense	5187	exon19			AGGGGGTGGAGGG	AB002107	CCDS11131.1	17p13.1	2012-12-13	2012-12-13			ENSG00000179094			8845	protein-coding gene	gene with protein product		602260	"""period (Drosophila) homolog 1"", ""period homolog 1 (Drosophila)"""	PER		9323128	Standard	NM_002616		Approved	RIGUI	uc002gkd.3	O15534		ENST00000317276.4:c.2596A>C	17.37:g.8047060T>G	ENSP00000314420:p.Thr866Pro	23	7		28	6	NM_002616	0	0	12	12	0	B2RPA8|B4DI49|D3DTR3	Missense_Mutation	SNP	ENST00000317276.4	37	CCDS11131.1	.	.	.	.	.	.	.	.	.	.	T	7.008	0.556287	0.13436	.	.	ENSG00000179094	ENST00000317276	T	0.14893	2.47	5.42	1.94	0.25998	.	0.240541	0.41823	D	0.000811	T	0.12774	0.0310	L	0.58510	1.815	0.80722	D	1	B	0.21381	0.055	B	0.15052	0.012	T	0.19976	-1.0289	10	0.42905	T	0.14	-6.4874	0.9995	0.01474	0.1839:0.4226:0.1778:0.2157	.	866	O15534	PER1_HUMAN	P	866	ENSP00000314420:T866P	ENSP00000314420:T866P	T	-	1	0	PER1	7987785	0.361000	0.24972	1.000000	0.80357	0.452000	0.32318	-0.124000	0.10595	1.268000	0.44264	-0.468000	0.05107	ACC	.		0.667	PER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441481.2		
FLII	2314	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	18150655	18150655	+	Missense_Mutation	SNP	A	A	C			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr17:18150655A>C	ENST00000327031.4	-	21	2729	c.2504T>G	c.(2503-2505)tTc>tGc	p.F835C	FLII_ENST00000545457.2_Missense_Mutation_p.F780C|FLII_ENST00000379450.4_Missense_Mutation_p.F749C|FLII_ENST00000578558.1_Intron|FLII_ENST00000579294.1_Missense_Mutation_p.F824C	NM_002018.3	NP_002009.1	Q13045	FLII_HUMAN	flightless I homolog (Drosophila)	835					multicellular organismal development (GO:0007275)|muscle contraction (GO:0006936)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)	actin binding (GO:0003779)			central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32	all_neural(463;0.228)					CCAATTCTTGAACTTGGCCTT	0.602																																					p.F835C		.											.	FLII-91	0			c.T2504G						.						108.0	92.0	97.0					17																	18150655		2203	4300	6503	SO:0001583	missense	2314	exon21			TTCTTGAACTTGG	U01184	CCDS11192.1, CCDS58521.1, CCDS58522.1	17p11.2	2008-07-18	2001-11-28		ENSG00000177731	ENSG00000177731			3750	protein-coding gene	gene with protein product		600362	"""flightless I (Drosophila) homolog"""			7825574	Standard	NM_002018		Approved	FLI, FLIL, Fli1, MGC39265	uc002gsr.2	Q13045	OTTHUMG00000059389	ENST00000327031.4:c.2504T>G	17.37:g.18150655A>C	ENSP00000324573:p.Phe835Cys	119	0		109	18	NM_002018	0	0	20	37	17	B4DIL0|F5H407|J3QLG3	Missense_Mutation	SNP	ENST00000327031.4	37	CCDS11192.1	.	.	.	.	.	.	.	.	.	.	A	19.68	3.872270	0.72180	.	.	ENSG00000177731	ENST00000327031;ENST00000379450	T;T	0.45276	0.9;0.9	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	T	0.67785	0.2930	M	0.82323	2.585	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	D;D;D;D	0.97110	0.996;0.996;1.0;0.993	T	0.73685	-0.3905	10	0.87932	D	0	-23.7587	15.4271	0.75061	1.0:0.0:0.0:0.0	.	749;749;835;804	E7EPM0;B4DIL0;Q13045;B4DIX0	.;.;FLII_HUMAN;.	C	835;749	ENSP00000324573:F835C;ENSP00000368763:F749C	ENSP00000324573:F835C	F	-	2	0	FLII	18091380	1.000000	0.71417	1.000000	0.80357	0.553000	0.35397	8.532000	0.90613	2.045000	0.60652	0.460000	0.39030	TTC	.		0.602	FLII-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132032.2	NM_002018	
TAF15	8148	broad.mit.edu;bcgsc.ca	37	17	34149828	34149828	+	Missense_Mutation	SNP	C	C	T			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr17:34149828C>T	ENST00000588240.1	+	6	590	c.475C>T	c.(475-477)Cac>Tac	p.H159Y	AC015849.19_ENST00000588415.1_RNA|AC015849.13_ENST00000589356.1_RNA|TAF15_ENST00000592237.1_Missense_Mutation_p.H68Y|TAF15_ENST00000311979.3_Missense_Mutation_p.H156Y	NM_003487.3|NM_139215.2	NP_003478.1|NP_631961.1	Q16514	TAF12_HUMAN	TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa	0					chromatin organization (GO:0006325)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone H3 acetylation (GO:0043966)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of RNA biosynthetic process (GO:2001141)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)		TAF15/NR4A3(33)	lung(1)|ovary(1)|skin(2)|stomach(1)	5		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)		CTACAGCCACCACACACAAGG	0.373			T	"""TEC, CHN1, ZNF384"""	"""extraskeletal myxoid chondrosarcomas, ALL"""																																p.H159Y				Dom	yes		17	17q11.1-q11.2	8148	"""TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa"""		"""L, M"""	.	TAF15-723	0			c.C475T						.						108.0	100.0	102.0					17																	34149828		2203	4300	6503	SO:0001583	missense	8148	exon6			AGCCACCACACAC	U51334	CCDS32623.1, CCDS59279.1	17q11.1-q11.2	2013-02-12	2002-08-29	2001-12-07		ENSG00000270647		"""RNA binding motif (RRM) containing"""	11547	protein-coding gene	gene with protein product		601574	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, N, 68kD (RNA-binding protein 56)"""	TAF2N		8954779, 9795213	Standard	NM_003487		Approved	hTAFII68, RBP56, Npl3	uc002hkd.4	Q92804		ENST00000588240.1:c.475C>T	17.37:g.34149828C>T	ENSP00000466950:p.His159Tyr	120	0		90	6	NM_139215	0	0	1	1	0	D3DPM5|Q15775|Q5T077	Missense_Mutation	SNP	ENST00000588240.1	37	CCDS32623.1	.	.	.	.	.	.	.	.	.	.	C	12.56	1.973242	0.34848	.	.	ENSG00000172660	ENST00000311979	.	.	.	5.91	4.94	0.65067	.	.	.	.	.	T	0.36138	0.0956	L	0.38531	1.155	0.26742	N	0.970367	B;B	0.12013	0.003;0.005	B;B	0.08055	0.001;0.003	T	0.11060	-1.0603	8	0.15499	T	0.54	-9.2222	11.5059	0.50466	0.0:0.9153:0.0:0.0847	.	159;156	Q92804;Q92804-2	RBP56_HUMAN;.	Y	159	.	ENSP00000309558:H159Y	H	+	1	0	TAF15	31173941	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.295000	0.43576	2.791000	0.96007	0.655000	0.94253	CAC	.		0.373	TAF15-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449134.1	NM_139215	
ZPBP2	124626	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	38027753	38027753	+	Missense_Mutation	SNP	T	T	C			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr17:38027753T>C	ENST00000348931.4	+	4	472	c.281T>C	c.(280-282)cTg>cCg	p.L94P	ZPBP2_ENST00000584588.1_Missense_Mutation_p.L94P|ZPBP2_ENST00000377940.3_Missense_Mutation_p.L72P	NM_199321.2	NP_955353.1	Q6X784	ZPBP2_HUMAN	zona pellucida binding protein 2	94					acrosome assembly (GO:0001675)|binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|cell body (GO:0044297)|extracellular region (GO:0005576)|nucleus (GO:0005634)|zona pellucida receptor complex (GO:0002199)				kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	15	Colorectal(19;0.000442)		Lung(15;0.00849)|LUSC - Lung squamous cell carcinoma(15;0.171)			ACTGGACAGCTGATGGTGAAA	0.294																																					p.L94P		.											.	ZPBP2-91	0			c.T281C						.						93.0	98.0	96.0					17																	38027753		2203	4298	6501	SO:0001583	missense	124626	exon4			GACAGCTGATGGT	BC043152	CCDS11352.1, CCDS11353.2	17q21.1	2013-01-11			ENSG00000186075	ENSG00000186075		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	20678	protein-coding gene	gene with protein product		608499					Standard	XM_005257031		Approved	ZPBPL, MGC41930	uc002hte.3	Q6X784	OTTHUMG00000133022	ENST00000348931.4:c.281T>C	17.37:g.38027753T>C	ENSP00000335384:p.Leu94Pro	96	0		59	15	NM_199321	0	0	0	0	0	A8K8L8|Q6X783|Q86XL5	Missense_Mutation	SNP	ENST00000348931.4	37	CCDS11352.1	.	.	.	.	.	.	.	.	.	.	T	19.59	3.855999	0.71834	.	.	ENSG00000186075	ENST00000348931;ENST00000377940	D;D	0.92397	-3.03;-3.03	5.46	5.46	0.80206	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.49305	D	0.000158	D	0.95698	0.8601	M	0.78049	2.395	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.96132	0.9093	10	0.87932	D	0	-7.3583	13.7798	0.63077	0.0:0.0:0.0:1.0	.	72;94	Q6X784-2;Q6X784	.;ZPBP2_HUMAN	P	94;72	ENSP00000335384:L94P;ENSP00000367174:L72P	ENSP00000335384:L94P	L	+	2	0	ZPBP2	35281279	1.000000	0.71417	0.994000	0.49952	0.981000	0.71138	4.645000	0.61404	2.072000	0.62099	0.377000	0.23210	CTG	.		0.294	ZPBP2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256609.2	NM_198844	
PLVAP	83483	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	17476968	17476968	+	Missense_Mutation	SNP	T	T	C			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr19:17476968T>C	ENST00000252590.4	-	2	467	c.406A>G	c.(406-408)Atc>Gtc	p.I136V		NM_031310.1	NP_112600.1	Q9BX97	PLVAP_HUMAN	plasmalemma vesicle associated protein	136					MAPK cascade (GO:0000165)|positive regulation of cellular extravasation (GO:0002693)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	caveola (GO:0005901)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(14)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						CTCAAGATGATGGCAGCCATG	0.552																																					p.I136V		.											.	PLVAP-90	0			c.A406G						.						237.0	203.0	215.0					19																	17476968		2203	4300	6503	SO:0001583	missense	83483	exon2			AGATGATGGCAGC	AF326591	CCDS32952.1	19p13.2	2008-07-17				ENSG00000130300			13635	protein-coding gene	gene with protein product	"""fenestrated-endothelial linked structure protein; PV-1 protein"""	607647				11401446	Standard	NM_031310		Approved	gp68, PV-1, PV1, FELS	uc002ngk.1	Q9BX97		ENST00000252590.4:c.406A>G	19.37:g.17476968T>C	ENSP00000252590:p.Ile136Val	196	0		191	52	NM_031310	0	0	25	25	0	Q86VP0|Q8N8Y0|Q8ND68|Q8TER8|Q9BZD5	Missense_Mutation	SNP	ENST00000252590.4	37	CCDS32952.1	.	.	.	.	.	.	.	.	.	.	T	11.14	1.551302	0.27739	.	.	ENSG00000130300	ENST00000252590	T	0.31247	1.5	4.07	3.05	0.35203	.	0.289259	0.35708	N	0.003037	T	0.33818	0.0876	L	0.34521	1.04	0.26494	N	0.974888	D	0.69078	0.997	D	0.80764	0.994	T	0.15178	-1.0446	10	0.10111	T	0.7	-51.4771	6.1733	0.20429	0.0:0.114:0.0:0.886	.	136	Q9BX97	PLVAP_HUMAN	V	136	ENSP00000252590:I136V	ENSP00000252590:I136V	I	-	1	0	PLVAP	17337968	1.000000	0.71417	0.994000	0.49952	0.058000	0.15608	2.845000	0.48254	0.915000	0.36847	0.459000	0.35465	ATC	.		0.552	PLVAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463655.1	NM_031310	
APLP1	333	ucsc.edu	37	19	36361805	36361805	+	Missense_Mutation	SNP	C	C	T			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr19:36361805C>T	ENST00000221891.4	+	3	491	c.299C>T	c.(298-300)cCg>cTg	p.P100L	NPHS1_ENST00000591817.1_5'Flank|APLP1_ENST00000586861.1_Missense_Mutation_p.P94L|APLP1_ENST00000537454.2_Missense_Mutation_p.P61L	NM_001024807.1|NM_005166.3	NP_001019978.1|NP_005157.1	P51693	APLP1_HUMAN	amyloid beta (A4) precursor-like protein 1	100					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular response to norepinephrine stimulus (GO:0071874)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|mRNA polyadenylation (GO:0006378)|negative regulation of cAMP biosynthetic process (GO:0030818)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|regulation of translation (GO:0006417)	basement membrane (GO:0005604)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	alpha-2A adrenergic receptor binding (GO:0031694)|alpha-2B adrenergic receptor binding (GO:0031695)|alpha-2C adrenergic receptor binding (GO:0031696)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|transition metal ion binding (GO:0046914)			breast(4)|endometrium(2)|kidney(2)|large_intestine(12)|liver(1)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)	33	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CAGATGTACCCGGAGCTGCAG	0.662																																					p.P100L													.	APLP1-92	0			c.C299T						.						22.0	24.0	23.0					19																	36361805		2202	4299	6501	SO:0001583	missense	333	exon3			TGTACCCGGAGCT	U48437	CCDS32997.1	19q	2008-07-15							597	protein-coding gene	gene with protein product	"""amyloid-like protein 1"", ""amyloid precursor-like protein 1"""	104775				8432545	Standard	NM_001024807		Approved	APLP	uc002ocf.3	P51693		ENST00000221891.4:c.299C>T	19.37:g.36361805C>T	ENSP00000221891:p.Pro100Leu	13	0		13	4	NM_005166	0	0	0	0	0	O00113|Q96A92	Missense_Mutation	SNP	ENST00000221891.4	37	CCDS32997.1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.602174	0.87055	.	.	ENSG00000105290	ENST00000537454;ENST00000221891	D;D	0.95137	-3.49;-3.62	5.06	5.06	0.68205	Amyloidogenic glycoprotein, extracellular (1);Amyloidogenic glycoprotein, heparin-binding (3);	0.000000	0.48767	D	0.000170	D	0.96765	0.8944	M	0.75447	2.3	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.968;0.991;0.971	D	0.97163	0.9839	10	0.87932	D	0	-30.9183	13.913	0.63878	0.0:1.0:0.0:0.0	.	94;61;100;100	B7Z4G8;F5GZ08;P51693-2;P51693	.;.;.;APLP1_HUMAN	L	61;100	ENSP00000441501:P61L;ENSP00000221891:P100L	ENSP00000221891:P100L	P	+	2	0	APLP1	41053645	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	4.766000	0.62279	2.352000	0.79861	0.555000	0.69702	CCG	.		0.662	APLP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452564.1	NM_001024807	
ZNF780A	284323	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	40581903	40581903	+	Missense_Mutation	SNP	G	G	C			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr19:40581903G>C	ENST00000595687.2	-	6	655	c.446C>G	c.(445-447)cCt>cGt	p.P149R	ZNF780A_ENST00000340963.5_Missense_Mutation_p.P149R|AC005614.5_ENST00000595508.1_RNA|ZNF780A_ENST00000455521.1_Missense_Mutation_p.P150R|ZNF780A_ENST00000450241.2_Missense_Mutation_p.P115R|ZNF780A_ENST00000414720.2_Intron|ZNF780A_ENST00000594395.1_Missense_Mutation_p.P150R	NM_001010880.2	NP_001010880.2	O75290	Z780A_HUMAN	zinc finger protein 780A	149					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(16)|upper_aerodigestive_tract(3)|urinary_tract(1)	31	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					AGTATGAGTAGGCAGTTTTTC	0.333																																					p.P150R		.											.	ZNF780A-22	0			c.C449G						.						198.0	170.0	179.0					19																	40581903		2203	4300	6503	SO:0001583	missense	284323	exon6			TGAGTAGGCAGTT	AK091274	CCDS33026.2, CCDS46078.1, CCDS46079.1	19q13.2	2014-02-12	2006-08-15		ENSG00000197782	ENSG00000197782		"""Zinc fingers, C2H2-type"", ""-"""	27603	protein-coding gene	gene with protein product							Standard	NM_001142577		Approved	ZNF780	uc010xvh.2	O75290	OTTHUMG00000155119	ENST00000595687.2:c.446C>G	19.37:g.40581903G>C	ENSP00000472189:p.Pro149Arg	97	0		76	17	NM_001142577	0	0	0	0	0	E9PB48|Q6ZN87	Missense_Mutation	SNP	ENST00000595687.2	37	CCDS33026.2	.	.	.	.	.	.	.	.	.	.	G	0.101	-1.152082	0.01700	.	.	ENSG00000197782	ENST00000450241;ENST00000455521;ENST00000340963	T;T	0.05447	3.44;3.46	0.928	0.928	0.19443	.	.	.	.	.	T	0.07413	0.0187	M	0.64404	1.975	0.09310	N	1	P;P	0.48162	0.51;0.906	B;B	0.44163	0.099;0.443	T	0.27872	-1.0061	9	0.15499	T	0.54	.	4.8476	0.13521	0.0:0.3981:0.6019:0.0	.	150;149	E9PB48;O75290	.;Z780A_HUMAN	R	149;150;149	ENSP00000400997:P150R;ENSP00000341507:P149R	ENSP00000341507:P149R	P	-	2	0	ZNF780A	45273743	0.000000	0.05858	0.009000	0.14445	0.048000	0.14542	-1.367000	0.02583	0.796000	0.33947	0.305000	0.20034	CCT	.		0.333	ZNF780A-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000470066.1	NM_001010880	
NLRP7	199713	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	55449434	55449434	+	Missense_Mutation	SNP	T	T	A			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr19:55449434T>A	ENST00000590030.1	-	4	2147	c.2107A>T	c.(2107-2109)Acc>Tcc	p.T703S	NLRP7_ENST00000340844.2_Missense_Mutation_p.T703S|NLRP7_ENST00000588756.1_Missense_Mutation_p.T703S|NLRP7_ENST00000448121.2_Missense_Mutation_p.T675S|NLRP7_ENST00000446217.1_Missense_Mutation_p.T731S|NLRP7_ENST00000328092.5_Missense_Mutation_p.T675S|NLRP7_ENST00000592784.1_Missense_Mutation_p.T703S			Q8WX94	NALP7_HUMAN	NLR family, pyrin domain containing 7	703							ATP binding (GO:0005524)			autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(17)|liver(1)|lung(33)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	73				GBM - Glioblastoma multiforme(193;0.0325)		AGATGACAGGTGCTACGGGTT	0.428																																					p.T703S		.											.	NLRP7-291	0			c.A2107T						.						243.0	252.0	249.0					19																	55449434		2203	4300	6503	SO:0001583	missense	199713	exon5			GACAGGTGCTACG	AF464765	CCDS12912.1, CCDS33109.1, CCDS46183.1	19q13.42	2008-02-05	2006-12-08	2006-12-08		ENSG00000167634		"""Nucleotide-binding domain and leucine rich repeat containing"""	22947	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 7"""	609661	"""NACHT, leucine rich repeat and PYD containing 7"""	NALP7		12563287, 12019269	Standard	NM_139176		Approved	PYPAF3, NOD12, PAN7, CLR19.4	uc002qii.4	Q8WX94		ENST00000590030.1:c.2107A>T	19.37:g.55449434T>A	ENSP00000465520:p.Thr703Ser	421	0		418	101	NM_001127255	0	0	0	0	0	E9PE16|Q32MH8|Q7RTR1	Missense_Mutation	SNP	ENST00000590030.1	37	CCDS33109.1	.	.	.	.	.	.	.	.	.	.	T	3.493	-0.103411	0.06967	.	.	ENSG00000167634	ENST00000328092;ENST00000448121;ENST00000340844;ENST00000446217;ENST00000399724	T;T;T	0.51325	0.71;0.71;0.71	2.19	-1.51	0.08664	.	0.529447	0.14299	N	0.328408	T	0.26159	0.0638	L	0.40543	1.245	0.09310	N	1	B;B;B;B	0.32203	0.264;0.151;0.151;0.36	B;B;B;B	0.26416	0.057;0.032;0.032;0.069	T	0.16041	-1.0416	10	0.16896	T	0.51	.	2.3	0.04160	0.4111:0.2735:0.0:0.3154	.	731;703;703;675	E7EPM2;Q32MH9;Q8WX94;Q8WX94-2	.;.;NALP7_HUMAN;.	S	703;675;703;731;470	ENSP00000409137:T675S;ENSP00000339491:T703S;ENSP00000414273:T731S	ENSP00000329568:T703S	T	-	1	0	NLRP7	60141246	0.002000	0.14202	0.002000	0.10522	0.002000	0.02628	-0.473000	0.06615	-0.505000	0.06568	-1.288000	0.01363	ACC	.		0.428	NLRP7-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000451396.1	NM_139176	
TRAPPC12	51112	hgsc.bcm.edu	37	2	3461447	3461447	+	Missense_Mutation	SNP	C	C	G	rs142960119		TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr2:3461447C>G	ENST00000324266.5	+	7	1781	c.1586C>G	c.(1585-1587)aCt>aGt	p.T529S	TRAPPC12_ENST00000469147.1_3'UTR|TRAPPC12_ENST00000382110.2_Missense_Mutation_p.T529S	NM_016030.5	NP_057114.5	Q8WVT3	TPC12_HUMAN	trafficking protein particle complex 12	529					vesicle-mediated transport (GO:0016192)												AGCAGCGTGACTCAGGAGGGC	0.527																																					p.T529S		.											.	.	0			c.C1586G						.						99.0	90.0	93.0					2																	3461447		2203	4300	6503	SO:0001583	missense	51112	exon7			GCGTGACTCAGGA	BC017475	CCDS1652.1	2p25.3	2013-01-10	2011-12-12	2011-12-12	ENSG00000171853	ENSG00000171853		"""Trafficking protein particle complex"", ""Tetratricopeptide (TTC) repeat domain containing"""	24284	protein-coding gene	gene with protein product		614139	"""tetratricopeptide repeat domain 15"""	TTC15		10810093, 21525244, 20562859	Standard	NM_016030		Approved	CGI-87, TTC-15	uc002qxm.1	Q8WVT3	OTTHUMG00000090328	ENST00000324266.5:c.1586C>G	2.37:g.3461447C>G	ENSP00000324318:p.Thr529Ser	51	0		56	3	NM_016030	0	0	25	25	0	B3KV01|D6W4Y2|Q8WVW1|Q9Y395	Missense_Mutation	SNP	ENST00000324266.5	37	CCDS1652.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	5.619|5.619|5.619	0.298912|0.298912|0.298912	0.10622|0.10622|0.10622	.|.|.	.|.|.	ENSG00000171853|ENSG00000171853|ENSG00000171853	ENST00000433382|ENST00000441983|ENST00000382110;ENST00000304601;ENST00000324266;ENST00000415624	.|.|T;T	.|.|0.46451	.|.|0.87;0.87	5.1|5.1|5.1	5.1|5.1|5.1	0.69264|0.69264|0.69264	.|.|.	.|.|0.224065	.|.|0.45606	.|.|N	.|.|0.000346	T|T|T	0.24275|0.24275|0.24275	0.0588|0.0588|0.0588	N|N|N	0.04959|0.04959|0.04959	-0.14|-0.14|-0.14	0.35012|0.35012|0.35012	D|D|D	0.757003|0.757003|0.757003	.|.|B;B	.|.|0.15473	.|.|0.013;0.013	.|.|B;B	.|.|0.14023	.|.|0.01;0.007	T|T|T	0.16928|0.16928|0.16928	-1.0386|-1.0386|-1.0386	5|5|10	.|.|0.15952	.|.|T	.|.|0.53	.|.|.	17.6896|17.6896|17.6896	0.88266|0.88266|0.88266	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.|.	.|.|512;529	.|.|E7ENL7;Q8WVT3	.|.|.;TPC12_HUMAN	E|V|S	74|209|529;512;529;27	.|.|ENSP00000371544:T529S;ENSP00000324318:T529S	.|.|ENSP00000303612:T512S	D|L|T	+|+|+	3|1|2	2|0|0	TTC15|TTC15|TTC15	3440454|3440454|3440454	0.239000|0.239000|0.239000	0.23836|0.23836|0.23836	0.007000|0.007000|0.007000	0.13788|0.13788|0.13788	0.188000|0.188000|0.188000	0.23474|0.23474|0.23474	3.898000|3.898000|3.898000	0.56281|0.56281|0.56281	2.650000|2.650000|2.650000	0.89964|0.89964|0.89964	0.467000|0.467000|0.467000	0.42956|0.42956|0.42956	GAC|CTC|ACT	C|1.000;T|0.000		0.527	TRAPPC12-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206693.2	NM_016030	
TRAPPC12	51112	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	3483103	3483103	+	Silent	SNP	G	G	A			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr2:3483103G>A	ENST00000324266.5	+	12	2274	c.2079G>A	c.(2077-2079)gtG>gtA	p.V693V	TRAPPC12_ENST00000382110.2_Silent_p.V693V|TRAPPC12-AS1_ENST00000453806.1_RNA	NM_016030.5	NP_057114.5	Q8WVT3	TPC12_HUMAN	trafficking protein particle complex 12	693					vesicle-mediated transport (GO:0016192)												ACGAGAGCGTGCTCTTCAACC	0.632																																					p.V693V		.											.	.	0			c.G2079A						.						123.0	115.0	118.0					2																	3483103		2203	4300	6503	SO:0001819	synonymous_variant	51112	exon12			GAGCGTGCTCTTC	BC017475	CCDS1652.1	2p25.3	2013-01-10	2011-12-12	2011-12-12	ENSG00000171853	ENSG00000171853		"""Trafficking protein particle complex"", ""Tetratricopeptide (TTC) repeat domain containing"""	24284	protein-coding gene	gene with protein product		614139	"""tetratricopeptide repeat domain 15"""	TTC15		10810093, 21525244, 20562859	Standard	NM_016030		Approved	CGI-87, TTC-15	uc002qxm.1	Q8WVT3	OTTHUMG00000090328	ENST00000324266.5:c.2079G>A	2.37:g.3483103G>A		160	0		124	30	NM_016030	0	0	86	134	48	B3KV01|D6W4Y2|Q8WVW1|Q9Y395	Silent	SNP	ENST00000324266.5	37	CCDS1652.1	.	.	.	.	.	.	.	.	.	.	G	9.411	1.080605	0.20309	.	.	ENSG00000171853	ENST00000416918	.	.	.	4.55	-2.5	0.06384	.	.	.	.	.	T	0.50086	0.1595	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.44436	-0.9328	4	.	.	.	.	6.1178	0.20136	0.0754:0.4917:0.1948:0.2381	.	.	.	.	T	80	.	.	A	+	1	0	TTC15	3462110	0.943000	0.32029	0.965000	0.40720	0.990000	0.78478	-0.009000	0.12765	-0.267000	0.09325	-0.150000	0.13652	GCT	.		0.632	TRAPPC12-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206693.2	NM_016030	
BIRC6	57448	hgsc.bcm.edu	37	2	32664736	32664736	+	Silent	SNP	T	T	C			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr2:32664736T>C	ENST00000421745.2	+	16	3926	c.3792T>C	c.(3790-3792)gcT>gcC	p.A1264A		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	1264					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					CACTTTTGGCTAAAGTTGCAG	0.373																																					p.A1264A	Pancreas(94;175 1509 16028 18060 45422)	.											.	BIRC6-233	0			c.T3792C						.						91.0	74.0	80.0					2																	32664736		2203	4300	6503	SO:0001819	synonymous_variant	57448	exon16			TTTGGCTAAAGTT	AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.3792T>C	2.37:g.32664736T>C		37	0		39	2	NM_016252	0	0	0	0	0	Q9ULD1	Silent	SNP	ENST00000421745.2	37	CCDS33175.2																																																																																			.		0.373	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3	NM_016252	
ZFP36L2	678	hgsc.bcm.edu	37	2	43451957	43451957	+	Missense_Mutation	SNP	G	G	A	rs149290349	byFrequency	TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr2:43451957G>A	ENST00000282388.3	-	2	1279	c.986C>T	c.(985-987)gCt>gTt	p.A329V	THADA_ENST00000330266.7_Intron	NM_006887.4	NP_008818.3	P47974	TISD_HUMAN	ZFP36 ring finger protein-like 2	329	Poly-Ala.			AAAA -> LR (in Ref. 2; CAA55592). {ECO:0000305}.	cell proliferation (GO:0008283)|definitive hemopoiesis (GO:0060216)|hemopoiesis (GO:0030097)|mRNA catabolic process (GO:0006402)|negative regulation of stem cell differentiation (GO:2000737)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	AU-rich element binding (GO:0017091)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|mRNA 3'-UTR AU-rich region binding (GO:0035925)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	15		Acute lymphoblastic leukemia(82;0.00323)|all_hematologic(82;0.00824)				AGCGGCCGCAGCCGCGGCCGC	0.791													G|||	101	0.0201677	0.0015	0.0447	5008	,	,		7262	0.0		0.0586	False		,,,				2504	0.0092				p.A329V		.											.	ZFP36L2-226	0			c.C986T						.						2.0	5.0	4.0					2																	43451957		1011	2422	3433	SO:0001583	missense	678	exon2			GCCGCAGCCGCGG	X78992	CCDS1811.1	2p22.3-p21	2012-11-27	2012-11-27	2001-11-23	ENSG00000152518	ENSG00000152518		"""RING-type (C3HC4) zinc fingers"""	1108	protein-coding gene	gene with protein product		612053	"""zinc finger protein 36, C3H type-like 1"", ""zinc finger protein 36, C3H type-like 2"""	BRF2		7835719, 8545129, 14981510, 17172869	Standard	NM_006887		Approved	ERF2, RNF162C, TIS11D	uc002rsv.4	P47974	OTTHUMG00000128642	ENST00000282388.3:c.986C>T	2.37:g.43451957G>A	ENSP00000282388:p.Ala329Val	3	0		11	6	NM_006887	0	0	0	0	0	Q53TB4|Q9BSJ3	Missense_Mutation	SNP	ENST00000282388.3	37	CCDS1811.1	80	0.03663003663003663	16	0.032520325203252036	22	0.06077348066298342	0	0.0	42	0.055408970976253295	G	10.73	1.433956	0.25813	.	.	ENSG00000152518	ENST00000282388	T	0.55234	0.53	3.24	3.24	0.37175	.	0.790844	0.11374	N	0.570585	T	0.04363	0.0120	N	0.14661	0.345	0.80722	D	1	P	0.38504	0.634	B	0.30646	0.118	T	0.04078	-1.0979	10	0.33141	T	0.24	-18.8132	14.2289	0.65877	0.0:0.0:1.0:0.0	.	329	P47974	TISD_HUMAN	V	329	ENSP00000282388:A329V	ENSP00000282388:A329V	A	-	2	0	ZFP36L2	43305461	0.980000	0.34600	0.099000	0.21106	0.025000	0.11179	0.000000	0.12993	1.626000	0.50381	0.491000	0.48974	GCT	G|0.963;A|0.037		0.791	ZFP36L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250513.2	NM_006887	
ANKRD36B	57730	hgsc.bcm.edu	37	2	98177298	98177298	+	RNA	SNP	C	C	G			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr2:98177298C>G	ENST00000443455.1	-	0	899							Q8N2N9	AN36B_HUMAN	ankyrin repeat domain 36B																		TAATTACCTTCTCAGCTCGTT	0.303																																					p.E263D		.											.	.	0			c.G789C						.						21.0	17.0	18.0					2																	98177298		980	2031	3011			57730	exon7			TACCTTCTCAGCT	AK024934	CCDS74543.1	2q11.2	2013-01-11	2008-03-25	2008-03-25	ENSG00000196912	ENSG00000196912		"""Ankyrin repeat domain containing"""	29333	protein-coding gene	gene with protein product	"""melanoma-associated antigen"", ""CLL-associated antigen KW-1"""		"""KIAA1641"""	KIAA1641		10997877	Standard	NM_025190		Approved	FLJ21281	uc010yvc.1	Q8N2N9	OTTHUMG00000130547		2.37:g.98177298C>G		30	0		38	2	NM_025190	0	0	0	0	0	Q08AK5|Q6IPR0|Q6PI49|Q8IZM7|Q8TDH6|Q96N30|Q9H759	Missense_Mutation	SNP	ENST00000443455.1	37																																																																																				.		0.303	ANKRD36B-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000328967.2	NM_025190	
SESTD1	91404	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	180016091	180016091	+	Missense_Mutation	SNP	T	T	A			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr2:180016091T>A	ENST00000428443.3	-	6	713	c.397A>T	c.(397-399)Act>Tct	p.T133S		NM_178123.4	NP_835224.3	Q86VW0	SESD1_HUMAN	SEC14 and spectrin domains 1	133	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.						phosphatidic acid binding (GO:0070300)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)			breast(2)|endometrium(4)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|skin(3)	30			OV - Ovarian serous cystadenocarcinoma(117;0.0344)|Epithelial(96;0.0531)|all cancers(119;0.147)			ATATAACGAGTCAATTTGTTG	0.353																																					p.T133S		.											.	SESTD1-228	0			c.A397T						.						71.0	70.0	70.0					2																	180016091		2203	4300	6503	SO:0001583	missense	91404	exon6			AACGAGTCAATTT	AK096232	CCDS33338.1	2q31.3	2014-01-28			ENSG00000187231	ENSG00000187231			18379	protein-coding gene	gene with protein product						12837271	Standard	NM_178123		Approved	DKFZp434O0515, Solo	uc002uni.4	Q86VW0	OTTHUMG00000154554	ENST00000428443.3:c.397A>T	2.37:g.180016091T>A	ENSP00000415332:p.Thr133Ser	46	0		41	17	NM_178123	0	0	1	2	1	Q53R38|Q53SP3|Q5GM69|Q8N6M1|Q96LQ2	Missense_Mutation	SNP	ENST00000428443.3	37	CCDS33338.1	.	.	.	.	.	.	.	.	.	.	T	15.75	2.926704	0.52759	.	.	ENSG00000187231	ENST00000428443;ENST00000440010;ENST00000435047	T;T;T	0.21734	1.99;1.99;1.99	5.68	5.68	0.88126	Cellular retinaldehyde-binding/triple function, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.26412	0.0645	N	0.05383	-0.06	0.80722	D	1	D	0.69078	0.997	D	0.77004	0.989	T	0.26710	-1.0095	9	.	.	.	-17.9645	16.2237	0.82280	0.0:0.0:0.0:1.0	.	133	Q86VW0	SESD1_HUMAN	S	133	ENSP00000415332:T133S;ENSP00000416164:T133S;ENSP00000410286:T133S	.	T	-	1	0	SESTD1	179724336	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.962000	0.87912	2.289000	0.77006	0.482000	0.46254	ACT	.		0.353	SESTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335916.2	NM_178123	
CUL3	8452	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	225422410	225422410	+	Missense_Mutation	SNP	A	A	G			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr2:225422410A>G	ENST00000264414.4	-	2	568	c.230T>C	c.(229-231)cTa>cCa	p.L77P	CUL3_ENST00000409777.1_Missense_Mutation_p.L53P|CUL3_ENST00000344951.4_Intron|CUL3_ENST00000432260.2_5'UTR|CUL3_ENST00000409096.1_Missense_Mutation_p.L53P	NM_003590.4	NP_003581.1	Q13618	CUL3_HUMAN	cullin 3	77					cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|COPII vesicle coating (GO:0048208)|cyclin catabolic process (GO:0008054)|embryonic cleavage (GO:0040016)|ER to Golgi vesicle-mediated transport (GO:0006888)|G1/S transition of mitotic cell cycle (GO:0000082)|gastrulation (GO:0007369)|integrin-mediated signaling pathway (GO:0007229)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic metaphase plate congression (GO:0007080)|negative regulation of Rho protein signal transduction (GO:0035024)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|stem cell division (GO:0017145)|stress fiber assembly (GO:0043149)|trophectodermal cellular morphogenesis (GO:0001831)|Wnt signaling pathway (GO:0016055)	Cul3-RING ubiquitin ligase complex (GO:0031463)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|nucleus (GO:0005634)|polar microtubule (GO:0005827)	POZ domain binding (GO:0031208)			endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(2)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	46		all_lung(227;0.00877)|Lung NSC(271;0.011)|Renal(207;0.0112)|all_hematologic(139;0.138)		Epithelial(121;1.58e-11)|all cancers(144;1.43e-08)|Lung(261;0.00863)|LUSC - Lung squamous cell carcinoma(224;0.00902)		AACTTCTCTTAGTCCAGTGTA	0.333																																					p.L83P		.											.	CUL3-229	0			c.T248C						.						84.0	86.0	85.0					2																	225422410		2202	4299	6501	SO:0001583	missense	8452	exon2			TCTCTTAGTCCAG	U58089	CCDS2462.1, CCDS58751.1	2q36.2	2011-05-24			ENSG00000036257	ENSG00000036257			2553	protein-coding gene	gene with protein product		603136				8681378, 17192413	Standard	NM_003590		Approved		uc002vny.3	Q13618	OTTHUMG00000133167	ENST00000264414.4:c.230T>C	2.37:g.225422410A>G	ENSP00000264414:p.Leu77Pro	35	0		53	16	NM_001257198	0	0	2	6	4	A8K536|B8ZZC3|O75415|Q569L3|Q9UBI8|Q9UET7	Missense_Mutation	SNP	ENST00000264414.4	37	CCDS2462.1	.	.	.	.	.	.	.	.	.	.	A	19.94	3.920164	0.73098	.	.	ENSG00000036257	ENST00000264414;ENST00000409096;ENST00000409777	T;T;T	0.79940	-1.32;-1.32;-1.32	5.61	5.61	0.85477	Cullin, N-terminal (1);Cullin repeat-like-containing domain (1);	0.000000	0.64402	D	0.000001	D	0.92857	0.7728	H	0.96239	3.79	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.74348	0.983;0.983	D	0.95014	0.8154	10	0.87932	D	0	.	15.8142	0.78586	1.0:0.0:0.0:0.0	.	55;77	Q53S54;Q13618	.;CUL3_HUMAN	P	77;53;53	ENSP00000264414:L77P;ENSP00000387200:L53P;ENSP00000386525:L53P	ENSP00000264414:L77P	L	-	2	0	CUL3	225130654	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.194000	0.94962	2.143000	0.66587	0.533000	0.62120	CTA	.		0.333	CUL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256871.2		
CUL3	8452	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	225449722	225449722	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr2:225449722G>T	ENST00000264414.4	-	1	343	c.5C>A	c.(4-6)tCg>tAg	p.S2*	CUL3_ENST00000344951.4_Nonsense_Mutation_p.S2*	NM_003590.4	NP_003581.1	Q13618	CUL3_HUMAN	cullin 3	2					cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|COPII vesicle coating (GO:0048208)|cyclin catabolic process (GO:0008054)|embryonic cleavage (GO:0040016)|ER to Golgi vesicle-mediated transport (GO:0006888)|G1/S transition of mitotic cell cycle (GO:0000082)|gastrulation (GO:0007369)|integrin-mediated signaling pathway (GO:0007229)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic metaphase plate congression (GO:0007080)|negative regulation of Rho protein signal transduction (GO:0035024)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|stem cell division (GO:0017145)|stress fiber assembly (GO:0043149)|trophectodermal cellular morphogenesis (GO:0001831)|Wnt signaling pathway (GO:0016055)	Cul3-RING ubiquitin ligase complex (GO:0031463)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|nucleus (GO:0005634)|polar microtubule (GO:0005827)	POZ domain binding (GO:0031208)			endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(2)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	46		all_lung(227;0.00877)|Lung NSC(271;0.011)|Renal(207;0.0112)|all_hematologic(139;0.138)		Epithelial(121;1.58e-11)|all cancers(144;1.43e-08)|Lung(261;0.00863)|LUSC - Lung squamous cell carcinoma(224;0.00902)		GCTCAGATTCGACATGGTGCT	0.706																																					p.S2X		.											.	CUL3-229	0			c.C5A						.						34.0	31.0	32.0					2																	225449722		2199	4300	6499	SO:0001587	stop_gained	8452	exon1			AGATTCGACATGG	U58089	CCDS2462.1, CCDS58751.1	2q36.2	2011-05-24			ENSG00000036257	ENSG00000036257			2553	protein-coding gene	gene with protein product		603136				8681378, 17192413	Standard	NM_003590		Approved		uc002vny.3	Q13618	OTTHUMG00000133167	ENST00000264414.4:c.5C>A	2.37:g.225449722G>T	ENSP00000264414:p.Ser2*	39	0		33	8	NM_003590	0	0	1	1	0	A8K536|B8ZZC3|O75415|Q569L3|Q9UBI8|Q9UET7	Nonsense_Mutation	SNP	ENST00000264414.4	37	CCDS2462.1	.	.	.	.	.	.	.	.	.	.	G	40	8.107774	0.98657	.	.	ENSG00000036257	ENST00000264414;ENST00000344951	.	.	.	3.18	0.952	0.19584	.	0.432093	0.18593	U	0.136664	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.6371	0.45571	0.0:0.375:0.625:0.0	.	.	.	.	X	2	.	ENSP00000264414:S2X	S	-	2	0	CUL3	225157966	1.000000	0.71417	0.999000	0.59377	0.977000	0.68977	2.063000	0.41423	0.257000	0.21650	0.305000	0.20034	TCG	.		0.706	CUL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256871.2		
NCOA5	57727	bcgsc.ca	37	20	44697260	44697260	+	Missense_Mutation	SNP	T	T	C			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr20:44697260T>C	ENST00000290231.6	-	4	547	c.383A>G	c.(382-384)gAc>gGc	p.D128G		NM_020967.2	NP_066018.1	Q9HCD5	NCOA5_HUMAN	nuclear receptor coactivator 5	128	Arg/Asp-rich (mixed charge).|Transcription repression.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|extracellular space (GO:0005615)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(5)|liver(1)|lung(5)|ovary(1)|skin(2)|urinary_tract(1)	21		Myeloproliferative disorder(115;0.0122)				TAGGTATCGGTCATAAGAGCC	0.418																																					p.D128G													.	NCOA5-226	0			c.A383G						.						103.0	105.0	104.0					20																	44697260		2203	4300	6503	SO:0001583	missense	57727	exon4			TATCGGTCATAAG		CCDS13392.1	20q12-q13.12	2008-07-02			ENSG00000124160	ENSG00000124160			15909	protein-coding gene	gene with protein product	"""coactivator independent of AF-2"""					11780052, 11113208	Standard	XM_005260474		Approved	bA465L10.6, CIA	uc002xre.3	Q9HCD5	OTTHUMG00000032639	ENST00000290231.6:c.383A>G	20.37:g.44697260T>C	ENSP00000290231:p.Asp128Gly	123	1		101	4	NM_020967	0	0	0	0	0	B2RTV9|E1P5R0|Q6HA99|Q9H1F2|Q9H2T2|Q9H4Y9	Missense_Mutation	SNP	ENST00000290231.6	37	CCDS13392.1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.103262	0.76983	.	.	ENSG00000124160	ENST00000290231;ENST00000372291	T	0.55930	0.49	4.75	4.75	0.60458	.	0.044656	0.85682	D	0.000000	T	0.64349	0.2590	L	0.57536	1.79	0.58432	D	0.999998	D;D	0.64830	0.994;0.963	P;P	0.60886	0.88;0.797	T	0.65672	-0.6111	10	0.48119	T	0.1	-0.305	13.2648	0.60127	0.0:0.0:0.0:1.0	.	128;23	Q9HCD5;Q5JY17	NCOA5_HUMAN;.	G	128;23	ENSP00000290231:D128G	ENSP00000290231:D128G	D	-	2	0	NCOA5	44130667	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.739000	0.74827	2.005000	0.58758	0.528000	0.53228	GAC	.		0.418	NCOA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079559.1	NM_020967	
CHRNA4	1137	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	61982183	61982183	+	Missense_Mutation	SNP	T	T	C			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr20:61982183T>C	ENST00000370263.4	-	5	801	c.580A>G	c.(580-582)Atg>Gtg	p.M194V	CHRNA4_ENST00000463705.1_5'UTR	NM_000744.6|NM_001256573.1	NP_000735.1|NP_001243502.1	P43681	ACHA4_HUMAN	cholinergic receptor, nicotinic, alpha 4 (neuronal)	194					action potential (GO:0001508)|B cell activation (GO:0042113)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|cognition (GO:0050890)|DNA repair (GO:0006281)|exploration behavior (GO:0035640)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|neurological system process (GO:0050877)|regulation of dopamine secretion (GO:0014059)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of membrane potential (GO:0042391)|respiratory gaseous exchange (GO:0007585)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|response to oxidative stress (GO:0006979)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(19)|prostate(3)|skin(3)|soft_tissue(1)	33	all_cancers(38;1.71e-10)				Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Dextromethorphan(DB00514)|Galantamine(DB00674)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Nicotine(DB00184)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)|Varenicline(DB01273)	CGGCTGTGCATGTTCACCAGG	0.587																																					p.M194V		.											.	CHRNA4-91	0			c.A580G						.						138.0	114.0	122.0					20																	61982183		2203	4299	6502	SO:0001583	missense	1137	exon5			TGTGCATGTTCAC		CCDS13517.1	20q13.33	2013-09-20	2012-02-07		ENSG00000101204	ENSG00000101204		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1958	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 4 (neuronal)"""	118504	"""cholinergic receptor, nicotinic, alpha polypeptide 4"""	EBN, EBN1		1505988	Standard	NM_000744		Approved	BFNC	uc002yes.3	P43681	OTTHUMG00000033080	ENST00000370263.4:c.580A>G	20.37:g.61982183T>C	ENSP00000359285:p.Met194Val	97	0		96	25	NM_000744	0	0	0	0	0	Q4JGR7|Q4VAQ5|Q4VAQ6	Missense_Mutation	SNP	ENST00000370263.4	37	CCDS13517.1	.	.	.	.	.	.	.	.	.	.	T	12.02	1.814091	0.32053	.	.	ENSG00000101204	ENST00000370258;ENST00000370263;ENST00000539366	T	0.78707	-1.2	4.87	2.6	0.31112	Neurotransmitter-gated ion-channel ligand-binding (3);	0.074711	0.85682	N	0.000000	T	0.61527	0.2354	N	0.16233	0.39	0.58432	D	0.999998	B;B	0.31125	0.309;0.017	B;B	0.31946	0.138;0.052	T	0.57382	-0.7821	10	0.72032	D	0.01	.	8.8251	0.35050	0.0:0.1556:0.0:0.8444	.	123;194	Q4VAQ5;P43681	.;ACHA4_HUMAN	V	100;194;123	ENSP00000359285:M194V	ENSP00000359280:M100V	M	-	1	0	CHRNA4	61452627	1.000000	0.71417	0.980000	0.43619	0.625000	0.37756	4.841000	0.62824	0.225000	0.20959	-0.379000	0.06801	ATG	.		0.587	CHRNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080508.3		
ARFRP1	10139	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	62333531	62333531	+	Missense_Mutation	SNP	G	G	C			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr20:62333531G>C	ENST00000359715.5	-	4	869	c.303C>G	c.(301-303)gaC>gaG	p.D101E	ARFRP1_ENST00000607873.1_Missense_Mutation_p.D54E|ARFRP1_ENST00000324228.2_Missense_Mutation_p.D101E|ARFRP1_ENST00000485858.1_5'Flank|ARFRP1_ENST00000440854.1_Missense_Mutation_p.D101E|ARFRP1_ENST00000609142.1_Missense_Mutation_p.D101E			Q13795	ARFRP_HUMAN	ADP-ribosylation factor related protein 1	101					gastrulation (GO:0007369)|Golgi to plasma membrane protein transport (GO:0043001)|GTP catabolic process (GO:0006184)|protein localization to Golgi apparatus (GO:0034067)|retrograde transport, endosome to Golgi (GO:0042147)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|skin(1)	7	all_cancers(38;9.53e-13)|all_epithelial(29;2.64e-14)|Lung NSC(23;7e-10)|all_lung(23;2.53e-09)		Epithelial(9;4.09e-08)|all cancers(9;1.7e-07)|OV - Ovarian serous cystadenocarcinoma(5;0.0102)			CGTCGGTGGAGTCAATGACGT	0.632																																					p.D101E		.											.	ARFRP1-291	0			c.C303G						.						102.0	82.0	89.0					20																	62333531		2203	4297	6500	SO:0001583	missense	10139	exon5			GGTGGAGTCAATG	X91504	CCDS13533.1, CCDS46630.1, CCDS68172.1, CCDS68173.1	20q13.3	2014-05-09			ENSG00000101246	ENSG00000101246		"""ADP-ribosylation factors"""	662	protein-coding gene	gene with protein product		604699				8530503	Standard	NM_003224		Approved	ARP, Arp1, ARL18	uc031rup.1	Q13795	OTTHUMG00000032993	ENST00000359715.5:c.303C>G	20.37:g.62333531G>C	ENSP00000352746:p.Asp101Glu	75	0		69	20	NM_001134758	0	0	29	53	24	B7ZKX7|E1P5J9|Q6IBQ0	Missense_Mutation	SNP	ENST00000359715.5	37	CCDS13533.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.178823	0.78564	.	.	ENSG00000101246	ENST00000440854;ENST00000359715;ENST00000324228	T;T;T	0.79247	-1.25;-1.25;-1.25	5.53	-0.912	0.10504	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.91895	0.7434	H	0.99726	4.73	0.58432	D	0.999996	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.90445	0.4434	10	0.87932	D	0	-27.1276	9.796	0.40735	0.4997:0.0:0.5003:0.0	.	101;101	B3KTR4;Q13795	.;ARFRP_HUMAN	E	101	ENSP00000403942:D101E;ENSP00000352746:D101E;ENSP00000326884:D101E	ENSP00000326884:D101E	D	-	3	2	ARFRP1	61803975	1.000000	0.71417	0.998000	0.56505	0.751000	0.42716	1.177000	0.31969	-0.026000	0.13895	0.462000	0.41574	GAC	.		0.632	ARFRP1-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000472024.1		
ZDHHC8	29801	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	20130720	20130720	+	Missense_Mutation	SNP	C	C	T	rs532240635		TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr22:20130720C>T	ENST00000334554.7	+	10	1708	c.1567C>T	c.(1567-1569)Cgc>Tgc	p.R523C	ZDHHC8_ENST00000405930.3_Missense_Mutation_p.R523C|ZDHHC8_ENST00000320602.7_Missense_Mutation_p.R431C	NM_013373.3	NP_037505.1	Q9ULC8	ZDHC8_HUMAN	zinc finger, DHHC-type containing 8	523					locomotory behavior (GO:0007626)|protein palmitoylation (GO:0018345)	cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(3)|endometrium(1)|kidney(3)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)	20	Colorectal(54;0.0993)					GCCCCTACCCCGCAGCTTCAG	0.706																																					p.R523C		.											.	ZDHHC8-91	0			c.C1567T						.						17.0	21.0	19.0					22																	20130720		2173	4267	6440	SO:0001583	missense	29801	exon10			CTACCCCGCAGCT	AB033118	CCDS13776.1, CCDS54502.1	22q11.21	2009-10-06		2003-02-28	ENSG00000099904	ENSG00000099904		"""Zinc fingers, DHHC-type"""	18474	protein-coding gene	gene with protein product		608784				10574462, 15184899	Standard	NM_013373		Approved	ZNF378, KIAA1292	uc002zrr.2	Q9ULC8	OTTHUMG00000150499	ENST00000334554.7:c.1567C>T	22.37:g.20130720C>T	ENSP00000334490:p.Arg523Cys	74	0		56	14	NM_001185024	0	0	14	29	15	Q2TGE9|Q6ICL1|Q6ZNF5|Q7Z6L9	Missense_Mutation	SNP	ENST00000334554.7	37	CCDS13776.1	.	.	.	.	.	.	.	.	.	.	.	16.52	3.147388	0.57151	.	.	ENSG00000099904	ENST00000334554;ENST00000320602;ENST00000405930	T;T;T	0.74002	1.22;-0.8;1.19	4.79	3.77	0.43336	.	1.375280	0.04372	N	0.359278	T	0.79411	0.4441	L	0.29908	0.895	0.49213	D	0.999762	D;D;D	0.69078	0.981;0.996;0.997	P;P;P	0.59703	0.635;0.862;0.642	T	0.65302	-0.6201	10	0.56958	D	0.05	.	12.8482	0.57842	0.0:0.9203:0.0:0.0797	.	431;523;523	Q9ULC8-2;Q9ULC8-3;Q9ULC8	.;.;ZDHC8_HUMAN	C	523;431;523	ENSP00000334490:R523C;ENSP00000317804:R431C;ENSP00000384716:R523C	ENSP00000317804:R431C	R	+	1	0	ZDHHC8	18510720	0.996000	0.38824	1.000000	0.80357	0.387000	0.30353	3.788000	0.55446	1.025000	0.39708	-0.339000	0.08088	CGC	.		0.706	ZDHHC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318564.1	NM_013373	
PPIL2	23759	hgsc.bcm.edu	37	22	22039049	22039049	+	Missense_Mutation	SNP	G	G	C			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr22:22039049G>C	ENST00000335025.8	+	10	652	c.561G>C	c.(559-561)gaG>gaC	p.E187D	PPIL2_ENST00000406385.1_Missense_Mutation_p.E187D|PPIL2_ENST00000412327.1_Missense_Mutation_p.E187D|PPIL2_ENST00000456792.2_Missense_Mutation_p.E166D|PPIL2_ENST00000398831.3_Missense_Mutation_p.E187D|PPIL2_ENST00000492445.2_Missense_Mutation_p.E187D					peptidylprolyl isomerase (cyclophilin)-like 2											endometrium(4)|kidney(2)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	17	Colorectal(54;0.105)					TAGATGAAGAGAAGGCCAAAC	0.547																																					p.E187D		.											.	PPIL2-92	0			c.G561C						.						33.0	33.0	33.0					22																	22039049		2203	4300	6503	SO:0001583	missense	23759	exon10			TGAAGAGAAGGCC		CCDS13793.1	22q11.21	2013-01-29			ENSG00000100023	ENSG00000100023		"""U-box domain containing"""	9261	protein-coding gene	gene with protein product	"""U-box domain containing 7"""	607588				10591208	Standard	NM_014337		Approved	UBOX7, CYC4, Cyp-60	uc002zvh.4	Q13356	OTTHUMG00000030174	ENST00000335025.8:c.561G>C	22.37:g.22039049G>C	ENSP00000334553:p.Glu187Asp	35	0		39	7	NM_014337	0	0	0	0	0		Missense_Mutation	SNP	ENST00000335025.8	37	CCDS13793.1	.	.	.	.	.	.	.	.	.	.	G	15.66	2.898491	0.52227	.	.	ENSG00000100023	ENST00000412327;ENST00000335025;ENST00000398831;ENST00000492445;ENST00000406385;ENST00000456792	T;T;T;T;T;T	0.30182	1.54;1.54;1.54;1.54;1.54;1.54	4.36	-1.8	0.07907	.	0.000000	0.85682	D	0.000000	T	0.37517	0.1006	L	0.59436	1.845	0.51233	D	0.999914	P;P;P	0.51240	0.943;0.868;0.891	P;P;P	0.55508	0.698;0.494;0.777	T	0.19095	-1.0316	10	0.25106	T	0.35	.	11.6657	0.51372	0.4833:0.0:0.5167:0.0	.	166;187;187	E7EW80;Q13356-2;Q13356	.;.;PPIL2_HUMAN	D	187;187;187;187;187;166	ENSP00000390427:E187D;ENSP00000334553:E187D;ENSP00000381812:E187D;ENSP00000445312:E187D;ENSP00000384299:E187D;ENSP00000396228:E166D	ENSP00000334553:E187D	E	+	3	2	PPIL2	20369049	0.995000	0.38212	0.996000	0.52242	0.915000	0.54546	0.513000	0.22770	-0.235000	0.09767	0.591000	0.81541	GAG	.		0.547	PPIL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075028.4		
MGAT3	4248	hgsc.bcm.edu;broad.mit.edu	37	22	39883780	39883780	+	Missense_Mutation	SNP	C	C	G			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr22:39883780C>G	ENST00000341184.6	+	2	643	c.428C>G	c.(427-429)tCc>tGc	p.S143C		NM_001098270.1|NM_002409.4	NP_001091740.1|NP_002400.3	Q09327	MGAT3_HUMAN	mannosyl (beta-1,4-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase	143					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	beta-1,4-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity (GO:0003830)			endometrium(4)|kidney(1)|large_intestine(5)|lung(12)|prostate(1)|skin(1)	24	Melanoma(58;0.04)					GCCAACGGCTCCTCGGCCCGG	0.766																																					p.S143C		.											.	MGAT3-90	0			c.C428G						.						3.0	4.0	4.0					22																	39883780		1757	3560	5317	SO:0001583	missense	4248	exon2			ACGGCTCCTCGGC	D13789	CCDS13994.2	22q13.1	2013-02-25			ENSG00000128268	ENSG00000128268	2.4.1.144	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7046	protein-coding gene	gene with protein product		604621				8370666	Standard	NM_002409		Approved	GNT-III	uc010gxy.3	Q09327	OTTHUMG00000030185	ENST00000341184.6:c.428C>G	22.37:g.39883780C>G	ENSP00000345270:p.Ser143Cys	9	0		4	4	NM_002409	0	0	0	0	0	A6NGD0|Q14CK5|Q6IC49|Q9UH32	Missense_Mutation	SNP	ENST00000341184.6	37	CCDS13994.2	.	.	.	.	.	.	.	.	.	.	C	6.780	0.512956	0.12944	.	.	ENSG00000128268	ENST00000341184;ENST00000429402	.	.	.	5.03	4.02	0.46733	.	0.406546	0.20728	N	0.086767	T	0.32496	0.0831	N	0.24115	0.695	0.09310	N	1	B	0.26258	0.145	B	0.33196	0.159	T	0.29336	-1.0015	9	0.45353	T	0.12	.	11.7602	0.51898	0.0:0.9177:0.0:0.0823	.	143	Q09327	MGAT3_HUMAN	C	143	.	ENSP00000345270:S143C	S	+	2	0	MGAT3	38213726	0.245000	0.23899	0.011000	0.14972	0.179000	0.23085	2.329000	0.43876	1.126000	0.42016	0.467000	0.42956	TCC	.		0.766	MGAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075039.2	NM_002409	
ADSL	158	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	40745897	40745897	+	Missense_Mutation	SNP	T	T	A			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr22:40745897T>A	ENST00000216194.7	+	2	271	c.215T>A	c.(214-216)aTc>aAc	p.I72N	ADSL_ENST00000454266.2_Missense_Mutation_p.I72N|ADSL_ENST00000342312.6_Missense_Mutation_p.I72N	NM_000026.2	NP_000017.1	P30566	PUR8_HUMAN	adenylosuccinate lyase	72			I -> V (in ADSL deficiency; severe). {ECO:0000269|PubMed:10090474}.		'de novo' AMP biosynthetic process (GO:0044208)|'de novo' IMP biosynthetic process (GO:0006189)|aerobic respiration (GO:0009060)|AMP biosynthetic process (GO:0006167)|metabolic process (GO:0008152)|nucleobase-containing small molecule metabolic process (GO:0055086)|protein tetramerization (GO:0051262)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide biosynthetic process (GO:0006164)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to hypoxia (GO:0001666)|response to muscle activity (GO:0014850)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	(S)-2-(5-amino-1-(5-phospho-D-ribosyl)imidazole-4-carboxamido)succinate AMP-lyase (fumarate-forming) activity (GO:0070626)|N6-(1,2-dicarboxyethyl)AMP AMP-lyase (fumarate-forming) activity (GO:0004018)			breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(2)|ovary(1)|prostate(1)	19						CTGGAGAACATCGACTTCAAG	0.433																																					p.I72N	Colon(4;65 130 1097 1516)	.											.	ADSL-652	0			c.T215A						.						119.0	94.0	102.0					22																	40745897		2203	4300	6503	SO:0001583	missense	158	exon2			AGAACATCGACTT	X65867	CCDS14001.1, CCDS46714.1	22q13.1	2011-02-17			ENSG00000239900	ENSG00000239900	4.3.2.2		291	protein-coding gene	gene with protein product		608222				8404037	Standard	NM_000026		Approved		uc003ayp.4	P30566	OTTHUMG00000166425	ENST00000216194.7:c.215T>A	22.37:g.40745897T>A	ENSP00000216194:p.Ile72Asn	88	0		56	11	NM_001123378	0	0	9	18	9	B0QY76|O75495|Q5TI34	Missense_Mutation	SNP	ENST00000216194.7	37	CCDS14001.1	.	.	.	.	.	.	.	.	.	.	T	32	5.145835	0.94603	.	.	ENSG00000239900	ENST00000216194;ENST00000544206;ENST00000425605;ENST00000454266;ENST00000342312	D;D;D	0.95518	-3.73;-3.73;-3.64	5.59	5.59	0.84812	L-Aspartase-like (1);L-Aspartase-like, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.98273	0.9428	M	0.93638	3.44	0.80722	D	1	D;D;D;D	0.71674	0.978;0.983;0.998;0.998	P;D;D;D	0.76575	0.822;0.929;0.988;0.988	D	0.99433	1.0936	10	0.72032	D	0.01	-8.6026	15.8537	0.78956	0.0:0.0:0.0:1.0	.	72;72;72;72	E7ERF4;P30566-2;Q71UA4;P30566	.;.;.;PUR8_HUMAN	N	72	ENSP00000216194:I72N;ENSP00000390107:I72N;ENSP00000341429:I72N	ENSP00000216194:I72N	I	+	2	0	ADSL	39075843	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	7.757000	0.85209	2.141000	0.66446	0.529000	0.55759	ATC	.		0.433	ADSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321386.1	NM_000026	
PARVG	64098	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	44581694	44581694	+	Missense_Mutation	SNP	A	A	T			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr22:44581694A>T	ENST00000444313.3	+	4	570	c.86A>T	c.(85-87)aAg>aTg	p.K29M	PARVG_ENST00000422871.1_Missense_Mutation_p.K29M|PARVG_ENST00000415224.1_Missense_Mutation_p.K29M|PARVG_ENST00000453888.3_3'UTR	NM_022141.5	NP_071424.1	Q9HBI0	PARVG_HUMAN	parvin, gamma	29					actin cytoskeleton reorganization (GO:0031532)|cell-matrix adhesion (GO:0007160)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	actin binding (GO:0003779)			endometrium(2)|kidney(1)|large_intestine(4)|lung(10)	17		Ovarian(80;0.024)|all_neural(38;0.0299)				CCAGGAGGAAAGAAGAAATAC	0.577																																					p.K96M		.											.	PARVG-90	0			c.A287T						.						68.0	55.0	60.0					22																	44581694		2203	4300	6503	SO:0001583	missense	64098	exon3			GAGGAAAGAAGAA	AF237772	CCDS14057.1	22q13.31	2013-01-24			ENSG00000138964	ENSG00000138964		"""Parvins"""	14654	protein-coding gene	gene with protein product		608122				11171322	Standard	NM_022141		Approved		uc003bep.4	Q9HBI0	OTTHUMG00000150473	ENST00000444313.3:c.86A>T	22.37:g.44581694A>T	ENSP00000391583:p.Lys29Met	29	0		46	11	NM_001254742	0	0	0	0	0	B4DDW5|E7EVM6|Q9BQX5|Q9NSG1	Missense_Mutation	SNP	ENST00000444313.3	37	CCDS14057.1	.	.	.	.	.	.	.	.	.	.	A	16.30	3.083589	0.55861	.	.	ENSG00000138964	ENST00000422871;ENST00000453888;ENST00000444313;ENST00000415224	T;T;T;T	0.48201	0.82;0.82;0.82;0.82	4.79	4.79	0.61399	Calponin homology domain (1);	0.161867	0.39985	N	0.001210	T	0.63733	0.2536	M	0.70595	2.14	0.42735	D	0.993721	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.944	T	0.66945	-0.5795	10	0.66056	D	0.02	3.0E-4	7.9054	0.29759	0.8163:0.0:0.0:0.1837	.	96;29	B4DDW5;Q9HBI0	.;PARVG_HUMAN	M	29;96;29;29	ENSP00000391453:K29M;ENSP00000416104:K96M;ENSP00000391583:K29M;ENSP00000416761:K29M	ENSP00000349378:K29M	K	+	2	0	PARVG	42913027	1.000000	0.71417	0.994000	0.49952	0.692000	0.40212	3.551000	0.53698	1.781000	0.52344	0.533000	0.62120	AAG	.		0.577	PARVG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318238.4	NM_022141	
HDAC10	83933	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	22	50684494	50684494	+	Silent	SNP	A	A	G			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr22:50684494A>G	ENST00000216271.5	-	18	2030	c.1678T>C	c.(1678-1680)Ttg>Ctg	p.L560L	HDAC10_ENST00000448072.1_Silent_p.L510L|HDAC10_ENST00000349505.4_Silent_p.L540L|TUBGCP6_ENST00000439308.2_5'Flank|TUBGCP6_ENST00000248846.5_5'Flank|MAPK12_ENST00000497036.1_5'UTR|HDAC10_ENST00000498366.1_5'UTR	NM_001159286.1|NM_032019.5	NP_001152758.1|NP_114408.3	Q969S8	HDA10_HUMAN	histone deacetylase 10	560					chromatin modification (GO:0016568)|histone deacetylation (GO:0016575)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|oligodendrocyte development (GO:0014003)|protein deacetylation (GO:0006476)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein deacetylase activity (GO:0033558)			endometrium(2)|kidney(2)|lung(1)|prostate(1)|skin(1)|urinary_tract(1)	8		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		ACCAAGCCCAAGATGCAGCTC	0.657																																					p.L560L		.											.	HDAC10-226	0			c.T1678C						.						41.0	44.0	43.0					22																	50684494		2201	4300	6501	SO:0001819	synonymous_variant	83933	exon18			AGCCCAAGATGCA	AF393962	CCDS14088.1, CCDS54545.1	22q13.31	2008-06-10			ENSG00000100429	ENSG00000100429			18128	protein-coding gene	gene with protein product		608544				11677242, 11726666	Standard	NM_032019		Approved	DKFZP761B039	uc003bkg.3	Q969S8	OTTHUMG00000044647	ENST00000216271.5:c.1678T>C	22.37:g.50684494A>G		48	0		47	5	NM_032019	0	0	25	25	0	Q08AP4|Q6STF9|Q96P77|Q96P78|Q9H028|Q9UGX1|Q9UGX2	Silent	SNP	ENST00000216271.5	37	CCDS14088.1																																																																																			.		0.657	HDAC10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104141.4	NM_032019	
CRBN	51185	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	3209360	3209360	+	Silent	SNP	T	T	C			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr3:3209360T>C	ENST00000231948.4	-	5	667	c.645A>G	c.(643-645)agA>agG	p.R215R	CRBN_ENST00000432408.2_Silent_p.R214R	NM_016302.3	NP_057386.2	Q96SW2	CRBN_HUMAN	cereblon	215	Lon.				negative regulation of ion transmembrane transport (GO:0034766)|negative regulation of protein homooligomerization (GO:0032463)|positive regulation of protein homodimerization activity (GO:0090073)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)	Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP-dependent peptidase activity (GO:0004176)			endometrium(1)|kidney(1)|large_intestine(4)|lung(1)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	11				Epithelial(13;0.00244)|OV - Ovarian serous cystadenocarcinoma(96;0.00617)|all cancers(10;0.0079)	Lenalidomide(DB00480)|Pomalidomide(DB08910)|Thalidomide(DB01041)	ATTGGTCTTCTCTTGAGACAG	0.363																																					p.R215R		.											.	CRBN-91	0			c.A645G						.						134.0	139.0	137.0					3																	3209360		2203	4300	6503	SO:0001819	synonymous_variant	51185	exon5			GTCTTCTCTTGAG	BC017419	CCDS2562.1, CCDS54547.1	3p26.3	2014-05-27			ENSG00000113851	ENSG00000113851			30185	protein-coding gene	gene with protein product		609262	"""mental retardation, non-syndromic, autosomal recessive, 2A"""	MRT2A		15557513	Standard	NM_016302		Approved	MRT2	uc003bpq.3	Q96SW2	OTTHUMG00000090261	ENST00000231948.4:c.645A>G	3.37:g.3209360T>C		171	0		155	13	NM_016302	0	0	7	7	0	B2R6H4|C9IZA9|C9JAH6|Q6AI62|Q6NVZ0|Q9UHW4	Silent	SNP	ENST00000231948.4	37	CCDS2562.1	.	.	.	.	.	.	.	.	.	.	C	10.22	1.290994	0.23564	.	.	ENSG00000113851	ENST00000424814;ENST00000450014	.	.	.	5.1	4.22	0.49857	.	.	.	.	.	T	0.57198	0.2037	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52049	-0.8627	4	.	.	.	-0.4216	6.8828	0.24183	0.1419:0.7141:0.0:0.144	.	.	.	.	G	211	.	.	E	-	2	0	CRBN	3184360	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.276000	0.43408	0.666000	0.31087	-0.119000	0.15052	GAG	.		0.363	CRBN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206579.3	NM_016302	
CAPN7	23473	hgsc.bcm.edu	37	3	15288291	15288291	+	Missense_Mutation	SNP	T	T	C			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr3:15288291T>C	ENST00000253693.2	+	18	2316	c.2063T>C	c.(2062-2064)tTa>tCa	p.L688S		NM_014296.2	NP_055111.1	Q9Y6W3	CAN7_HUMAN	calpain 7	688	Domain III.				positive regulation of epithelial cell migration (GO:0010634)|self proteolysis (GO:0097264)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|endopeptidase activity (GO:0004175)|MIT domain binding (GO:0090541)			breast(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(5)|ovary(1)|skin(2)	22						CCATACACCTTATCAAAACGG	0.284																																					p.L688S		.											.	CAPN7-91	0			c.T2063C						.						74.0	73.0	73.0					3																	15288291		2202	4300	6502	SO:0001583	missense	23473	exon18			ACACCTTATCAAA	AB028639	CCDS2624.1	3p24	2008-07-18			ENSG00000131375	ENSG00000131375			1484	protein-coding gene	gene with protein product	"""calpain like protease"", ""homolog of Aspergillus Nidulans PALB"""	606400				8163008, 10051333	Standard	NM_014296		Approved	PalBH	uc003bzn.3	Q9Y6W3	OTTHUMG00000129863	ENST00000253693.2:c.2063T>C	3.37:g.15288291T>C	ENSP00000253693:p.Leu688Ser	39	0		37	2	NM_014296	0	0	0	0	0		Missense_Mutation	SNP	ENST00000253693.2	37	CCDS2624.1	.	.	.	.	.	.	.	.	.	.	T	11.57	1.677192	0.29783	.	.	ENSG00000131375	ENST00000253693	D	0.86627	-2.15	5.48	5.48	0.80851	Peptidase C2, calpain, large subunit, domain III (1);Peptidase C2, calpain, domain III (1);	0.998190	0.08112	N	0.996014	D	0.82641	0.5081	L	0.29908	0.895	0.33618	D	0.604407	B	0.15141	0.012	B	0.15052	0.012	T	0.74097	-0.3775	10	0.25751	T	0.34	-1.9331	15.2344	0.73416	0.0:0.0:0.0:1.0	.	688	Q9Y6W3	CAN7_HUMAN	S	688	ENSP00000253693:L688S	ENSP00000253693:L688S	L	+	2	0	CAPN7	15263295	0.999000	0.42202	1.000000	0.80357	0.969000	0.65631	2.913000	0.48790	2.092000	0.63282	0.533000	0.62120	TTA	.		0.284	CAPN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252105.2	NM_014296	
ACAD9	28976	hgsc.bcm.edu	37	3	128612493	128612493	+	Missense_Mutation	SNP	G	G	C			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr3:128612493G>C	ENST00000308982.7	+	3	421	c.340G>C	c.(340-342)Gaa>Caa	p.E114Q		NM_014049.4	NP_054768.2	Q9H845	ACAD9_HUMAN	acyl-CoA dehydrogenase family, member 9	114						dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)			central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	30						AGTCCCAGAAGAATATGGTAA	0.448																																					p.E114Q		.											.	ACAD9-92	0			c.G340C						.						40.0	45.0	43.0					3																	128612493		2203	4300	6503	SO:0001583	missense	28976	exon3			CCAGAAGAATATG	AF078854	CCDS3053.1	3q21.3	2013-05-24	2010-04-30		ENSG00000177646	ENSG00000177646		"""Mitochondrial respiratory chain complex assembly factors"""	21497	protein-coding gene	gene with protein product		611103	"""acyl-Coenzyme A dehydrogenase family, member 9"""			12359260, 21057504, 20816094	Standard	NM_014049		Approved	NPD002, MGC14452	uc003ela.4	Q9H845	OTTHUMG00000159942	ENST00000308982.7:c.340G>C	3.37:g.128612493G>C	ENSP00000312618:p.Glu114Gln	43	0		40	2	NM_014049	0	0	0	0	0	D3DNB8|Q8WXX3	Missense_Mutation	SNP	ENST00000308982.7	37	CCDS3053.1	.	.	.	.	.	.	.	.	.	.	G	18.91	3.723058	0.68959	.	.	ENSG00000177646	ENST00000308982;ENST00000514336	D;D	0.99809	-6.86;-6.86	5.94	5.94	0.96194	Acyl-CoA dehydrogenase/oxidase (1);Acyl-CoA dehydrogenase, N-terminal (1);Acyl-CoA dehydrogenase/oxidase, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.99124	0.9698	L	0.53249	1.67	0.80722	D	1	P	0.40970	0.734	B	0.37480	0.251	D	0.99909	1.1193	10	0.56958	D	0.05	.	17.8532	0.88754	0.0:0.0:1.0:0.0	.	114	Q9H845	ACAD9_HUMAN	Q	114;126	ENSP00000312618:E114Q;ENSP00000423758:E126Q	ENSP00000312618:E114Q	E	+	1	0	ACAD9	130095183	1.000000	0.71417	1.000000	0.80357	0.671000	0.39405	8.237000	0.89807	2.816000	0.96949	0.563000	0.77884	GAA	.		0.448	ACAD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358405.1	NM_014049	
COMMD2	51122	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	149468478	149468478	+	Missense_Mutation	SNP	C	C	T			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr3:149468478C>T	ENST00000473414.1	-	4	443	c.389G>A	c.(388-390)cGa>cAa	p.R130Q		NM_016094.3	NP_057178.2	Q86X83	COMD2_HUMAN	COMM domain containing 2	130	COMM. {ECO:0000255|PROSITE- ProRule:PRU00602}.									NS(1)|large_intestine(3)|lung(2)|prostate(1)|skin(1)|urinary_tract(1)	9			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			TACATCTAGTCGCCATTCAAG	0.333																																					p.R130Q		.											.	COMMD2-90	0			c.G389A						.						138.0	131.0	133.0					3																	149468478		2203	4300	6503	SO:0001583	missense	51122	exon4			TCTAGTCGCCATT	AY542158	CCDS3145.1	3q25.1	2004-02-20			ENSG00000114744	ENSG00000114744			24993	protein-coding gene	gene with protein product						15799966	Standard	NM_016094		Approved	HSPC042	uc003exj.2	Q86X83	OTTHUMG00000159616	ENST00000473414.1:c.389G>A	3.37:g.149468478C>T	ENSP00000419475:p.Arg130Gln	103	0		123	25	NM_016094	0	0	0	0	0	Q561V4|Q9H3L5|Q9Y5V1	Missense_Mutation	SNP	ENST00000473414.1	37	CCDS3145.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.480742	0.84747	.	.	ENSG00000114744	ENST00000473414	T	0.27104	1.69	5.36	4.49	0.54785	COMM domain (1);	0.000000	0.85682	D	0.000000	T	0.57858	0.2082	M	0.89715	3.055	0.58432	D	0.999991	D	0.89917	1.0	D	0.97110	1.0	T	0.68104	-0.5497	10	0.87932	D	0	-2.9867	13.9104	0.63864	0.0:0.9268:0.0:0.0732	.	130	Q86X83	COMD2_HUMAN	Q	130	ENSP00000419475:R130Q	ENSP00000419475:R130Q	R	-	2	0	COMMD2	150951168	1.000000	0.71417	0.996000	0.52242	0.823000	0.46562	6.402000	0.73260	1.397000	0.46682	0.650000	0.86243	CGA	.		0.333	COMMD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356515.1	NM_016094	
FETUB	26998	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	186362554	186362554	+	Missense_Mutation	SNP	A	A	G			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr3:186362554A>G	ENST00000265029.3	+	4	540	c.439A>G	c.(439-441)Att>Gtt	p.I147V	FETUB_ENST00000382136.3_Missense_Mutation_p.I110V|FETUB_ENST00000539949.1_5'UTR|RP11-134F2.2_ENST00000455926.1_RNA|RP11-134F2.2_ENST00000428501.1_RNA|FETUB_ENST00000382134.3_Missense_Mutation_p.I82V|FETUB_ENST00000450521.1_Missense_Mutation_p.I147V|FETUB_ENST00000488561.1_3'UTR	NM_014375.2	NP_055190.2	Q9UGM5	FETUB_HUMAN	fetuin B	147					binding of sperm to zona pellucida (GO:0007339)|negative regulation of endopeptidase activity (GO:0010951)|single fertilization (GO:0007338)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|metalloendopeptidase inhibitor activity (GO:0008191)			endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)	20	all_cancers(143;6.64e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;5.73e-20)	GBM - Glioblastoma multiforme(93;0.0479)		AAAAAAAAAGATTTACATGAC	0.408																																					p.I147V		.											.	FETUB-92	0			c.A439G						.						102.0	96.0	98.0					3																	186362554		2203	4300	6503	SO:0001583	missense	26998	exon4			AAAAAGATTTACA	AJ242928	CCDS3279.1	3q27.3	2008-05-15			ENSG00000090512	ENSG00000090512			3658	protein-coding gene	gene with protein product		605954				10947975	Standard	XM_005247350		Approved		uc003fqn.3	Q9UGM5	OTTHUMG00000156586	ENST00000265029.3:c.439A>G	3.37:g.186362554A>G	ENSP00000265029:p.Ile147Val	156	0		106	27	NM_014375	0	0	0	0	0	B2RCW6|E9PG06|Q1RMZ0|Q5J876|Q6DK58|Q6GRB6|Q9Y6Z0	Missense_Mutation	SNP	ENST00000265029.3	37	CCDS3279.1	.	.	.	.	.	.	.	.	.	.	A	5.125	0.208699	0.09757	.	.	ENSG00000090512	ENST00000450521;ENST00000265029;ENST00000382134;ENST00000382136	T;T;T;T	0.39406	3.17;3.17;1.08;3.14	5.29	-0.0385	0.13880	Proteinase inhibitor I25C, fetuin, conserved site (1);	0.418485	0.23250	N	0.050254	T	0.22085	0.0532	N	0.21583	0.68	0.19300	N	0.999976	B;B;B	0.13145	0.002;0.007;0.007	B;B;B	0.13407	0.004;0.009;0.004	T	0.11227	-1.0596	10	0.27785	T	0.31	-2.9015	4.6541	0.12610	0.592:0.1544:0.2537:0.0	.	110;82;147	E9PG06;E9PG08;Q9UGM5	.;.;FETUB_HUMAN	V	147;147;82;110	ENSP00000404288:I147V;ENSP00000265029:I147V;ENSP00000371569:I82V;ENSP00000371571:I110V	ENSP00000265029:I147V	I	+	1	0	FETUB	187845248	0.004000	0.15560	0.000000	0.03702	0.001000	0.01503	0.250000	0.18235	-0.155000	0.11098	-0.274000	0.10170	ATT	.		0.408	FETUB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344679.1	NM_014375	
EGF	1950	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	110865158	110865158	+	Missense_Mutation	SNP	A	A	T			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr4:110865158A>T	ENST00000265171.5	+	4	1115	c.670A>T	c.(670-672)Agc>Tgc	p.S224C	EGF_ENST00000509793.1_Missense_Mutation_p.S224C|EGF_ENST00000503392.1_Missense_Mutation_p.S224C	NM_001178130.1|NM_001963.4	NP_001171601.1|NP_001954.2	P01133	EGF_HUMAN	epidermal growth factor	224					activation of MAPKK activity (GO:0000186)|activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|branching morphogenesis of an epithelial tube (GO:0048754)|DNA replication (GO:0006260)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERK1 and ERK2 cascade (GO:0070371)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|mammary gland alveolus development (GO:0060749)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of secretion (GO:0051048)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cerebellar granule cell precursor proliferation (GO:0021940)|positive regulation of DNA binding (GO:0043388)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of hyaluronan biosynthetic process (GO:1900127)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of calcium ion import (GO:0090279)|regulation of protein localization to cell surface (GO:2000008)|signal transduction (GO:0007165)|STAT protein import into nucleus (GO:0007262)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|growth factor activity (GO:0008083)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(1)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Hepatocellular(203;0.0893)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-06)	Sucralfate(DB00364)	CAGAGAAGGAAGCAATTCTCT	0.388																																					p.S224C		.											.	EGF-524	0			c.A670T						.						140.0	143.0	142.0					4																	110865158		2203	4300	6503	SO:0001583	missense	1950	exon4			GAAGGAAGCAATT	X04571	CCDS3689.1, CCDS54794.1, CCDS54795.1	4q25	2012-10-02	2010-05-11		ENSG00000138798	ENSG00000138798			3229	protein-coding gene	gene with protein product		131530	"""epidermal growth factor (beta-urogastrone)"""				Standard	NM_001963		Approved		uc003hzy.4	P01133	OTTHUMG00000132044	ENST00000265171.5:c.670A>T	4.37:g.110865158A>T	ENSP00000265171:p.Ser224Cys	75	0		70	20	NM_001963	0	0	0	0	0	B4DRK7|E7EVD2|E9PBF0|Q52LZ6	Missense_Mutation	SNP	ENST00000265171.5	37	CCDS3689.1	.	.	.	.	.	.	.	.	.	.	A	17.66	3.444933	0.63178	.	.	ENSG00000138798	ENST00000509793;ENST00000265171;ENST00000503392	D;D;D	0.91464	-2.85;-2.85;-2.85	5.71	-0.638	0.11500	Six-bladed beta-propeller, TolB-like (1);	0.594017	0.19957	N	0.102292	D	0.91019	0.7175	L	0.57536	1.79	0.09310	N	1	D;D;D	0.64830	0.99;0.994;0.983	P;P;P	0.55999	0.619;0.789;0.619	D	0.85276	0.1059	10	0.72032	D	0.01	.	11.2107	0.48797	0.3476:0.0:0.6524:0.0	.	224;224;224	E7EVD2;P01133-2;P01133	.;.;EGF_HUMAN	C	224	ENSP00000424316:S224C;ENSP00000265171:S224C;ENSP00000421384:S224C	ENSP00000265171:S224C	S	+	1	0	EGF	111084607	0.211000	0.23529	0.001000	0.08648	0.160000	0.22226	0.879000	0.28146	-0.085000	0.12573	0.533000	0.62120	AGC	.		0.388	EGF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255065.1		
INPP4B	8821	hgsc.bcm.edu	37	4	143159034	143159034	+	Silent	SNP	A	A	G			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr4:143159034A>G	ENST00000513000.1	-	13	1252	c.819T>C	c.(817-819)atT>atC	p.I273I	INPP4B_ENST00000508116.1_Silent_p.I273I|INPP4B_ENST00000262992.4_Silent_p.I273I|INPP4B_ENST00000509777.1_Silent_p.I273I|INPP4B_ENST00000308502.4_Silent_p.I273I	NM_003866.2	NP_003857.2	O15327	INP4B_HUMAN	inositol polyphosphate-4-phosphatase, type II, 105kDa	273					cellular calcium ion homeostasis (GO:0006874)|inositol phosphate metabolic process (GO:0043647)|negative regulation of osteoclast differentiation (GO:0045671)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|regulation of bone remodeling (GO:0046850)|regulation of nucleocytoplasmic transport (GO:0046822)|regulation of protein kinase B signaling (GO:0051896)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)	lipid binding (GO:0008289)|phosphatidylinositol trisphosphate phosphatase activity (GO:0034594)|phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity (GO:0016316)|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity (GO:0034597)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(29)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	58	all_hematologic(180;0.158)					AATCTTCTTTAATGTGAAGGG	0.294																																					p.I273I		.											.	INPP4B-228	0			c.T819C						.						39.0	39.0	39.0					4																	143159034		2202	4298	6500	SO:0001819	synonymous_variant	8821	exon13			TTCTTTAATGTGA	U96922	CCDS3757.1	4q31.1	2008-02-05	2002-08-29			ENSG00000109452			6075	protein-coding gene	gene with protein product		607494	"""inositol polyphosphate-4-phosphatase, type II, 105kD"""			9295334	Standard	NM_003866		Approved		uc003iiw.4	O15327		ENST00000513000.1:c.819T>C	4.37:g.143159034A>G		38	0		37	2	NM_003866	0	0	1	1	0	Q2TAI2|Q5XLE7|Q6IN59|Q6PJB4	Silent	SNP	ENST00000513000.1	37	CCDS3757.1																																																																																			.		0.294	INPP4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364587.1	NM_003866	
C5orf42	65250	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	37187887	37187887	+	Missense_Mutation	SNP	G	G	C			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr5:37187887G>C	ENST00000508244.1	-	21	3962	c.3869C>G	c.(3868-3870)tCc>tGc	p.S1290C	C5orf42_ENST00000425232.2_Missense_Mutation_p.S1290C|C5orf42_ENST00000274258.7_Missense_Mutation_p.S171C			Q9H799	CE042_HUMAN	chromosome 5 open reading frame 42	1290						integral component of membrane (GO:0016021)				breast(5)|endometrium(3)|kidney(8)|large_intestine(24)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	79	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			GCAACTATAGGATAACTTATC	0.373																																					p.S1290C		.											.	C5orf42-94	0			c.C3869G						.						109.0	102.0	104.0					5																	37187887		2203	4300	6503	SO:0001583	missense	65250	exon22			CTATAGGATAACT		CCDS34146.1, CCDS34146.2	5p13.2	2014-01-28			ENSG00000197603	ENSG00000197603			25801	protein-coding gene	gene with protein product		614571				22264561	Standard	NM_023073		Approved	FLJ13231, JBTS17	uc011cpa.1	Q9H799	OTTHUMG00000160492	ENST00000508244.1:c.3869C>G	5.37:g.37187887G>C	ENSP00000421690:p.Ser1290Cys	56	0		26	5	NM_023073	0	0	1	1	0	A8MUB7|B7ZLV7|Q4G174|Q6DK46|Q8N8L4|Q9H5T1|Q9H8T9	Missense_Mutation	SNP	ENST00000508244.1	37	CCDS34146.2	.	.	.	.	.	.	.	.	.	.	G	19.65	3.867793	0.72065	.	.	ENSG00000197603	ENST00000508244;ENST00000425232;ENST00000274258;ENST00000514429;ENST00000388739	T;T;T;T	0.67698	-0.28;-0.28;-0.28;-0.28	5.49	5.49	0.81192	.	0.080123	0.49305	D	0.000159	T	0.75228	0.3821	L	0.29908	0.895	0.46701	D	0.999167	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.991	T	0.77525	-0.2555	10	0.87932	D	0	.	19.7365	0.96208	0.0:0.0:1.0:0.0	.	1290;171	E9PH94;Q9H799	.;CE042_HUMAN	C	1290;1290;171;338;171	ENSP00000421690:S1290C;ENSP00000389014:S1290C;ENSP00000274258:S171C;ENSP00000424223:S338C	ENSP00000274258:S171C	S	-	2	0	C5orf42	37223644	1.000000	0.71417	0.982000	0.44146	0.176000	0.22953	8.290000	0.89925	2.749000	0.94314	0.491000	0.48974	TCC	.		0.373	C5orf42-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360806.1	NM_023073	
C7	730	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	40964972	40964972	+	Missense_Mutation	SNP	C	C	G			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr5:40964972C>G	ENST00000313164.9	+	14	2238	c.1879C>G	c.(1879-1881)Cag>Gag	p.Q627E		NM_000587.2	NP_000578.2	P10643	CO7_HUMAN	complement component 7	627	CCP 2.|Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cellular sodium ion homeostasis (GO:0006883)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)							Ovarian(839;0.0112)				AATGCATTGTCAGAGTGAGTG	0.403																																					p.Q627E		.											.	C7-22	0			c.C1879G						.						147.0	147.0	147.0					5																	40964972		1988	4163	6151	SO:0001583	missense	730	exon14			CATTGTCAGAGTG	J03507	CCDS47201.1	5p13.1	2014-09-17			ENSG00000112936	ENSG00000112936		"""Complement system"""	1346	protein-coding gene	gene with protein product		217070					Standard	NM_000587		Approved		uc003jmh.3	P10643	OTTHUMG00000150340	ENST00000313164.9:c.1879C>G	5.37:g.40964972C>G	ENSP00000322061:p.Gln627Glu	180	0		159	8	NM_000587	0	0	0	0	0	Q6P3T5|Q92489	Missense_Mutation	SNP	ENST00000313164.9	37	CCDS47201.1	.	.	.	.	.	.	.	.	.	.	C	17.08	3.296653	0.60086	.	.	ENSG00000112936	ENST00000313164;ENST00000440677	T	0.44881	0.91	6.04	6.04	0.98038	Complement control module (2);Sushi/SCR/CCP (1);	0.184818	0.47455	D	0.000226	T	0.36276	0.0961	L	0.32530	0.975	0.49687	D	0.999811	P	0.46395	0.877	B	0.37480	0.251	T	0.21690	-1.0238	10	0.56958	D	0.05	-8.4484	20.5948	0.99439	0.0:1.0:0.0:0.0	.	627	P10643	CO7_HUMAN	E	627;467	ENSP00000322061:Q627E	ENSP00000322061:Q627E	Q	+	1	0	C7	41000729	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	2.443000	0.44881	2.873000	0.98535	0.563000	0.77884	CAG	.		0.403	C7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317680.1		
SPINK5	11005	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	147510840	147510840	+	Missense_Mutation	SNP	G	G	C			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr5:147510840G>C	ENST00000256084.7	+	31	3025	c.2983G>C	c.(2983-2985)Gac>Cac	p.D995H	SPINK5_ENST00000359874.3_Missense_Mutation_p.D1025H	NM_006846.3	NP_006837.2	Q9NQ38	ISK5_HUMAN	serine peptidase inhibitor, Kazal type 5	995	Kazal-like 15. {ECO:0000255|PROSITE- ProRule:PRU00798}.				anagen (GO:0042640)|epidermal cell differentiation (GO:0009913)|epithelial cell differentiation (GO:0030855)|extracellular matrix organization (GO:0030198)|hair cell differentiation (GO:0035315)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of immune response (GO:0050777)|negative regulation of proteolysis (GO:0045861)|negative regulation of serine-type peptidase activity (GO:1902572)|regulation of cell adhesion (GO:0030155)|regulation of T cell differentiation (GO:0045580)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|epidermal lamellar body (GO:0097209)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(16)|ovary(4)|prostate(1)|skin(5)|stomach(8)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GATGTGCAAAGACTACCGAGT	0.433																																					p.D1025H		.											.	SPINK5-138	0			c.G3073C						.						250.0	232.0	238.0					5																	147510840		1894	4123	6017	SO:0001583	missense	11005	exon32			TGCAAAGACTACC	AJ228139	CCDS43382.1, CCDS47300.1, CCDS47301.1	5q31-q32	2014-09-17	2005-08-17		ENSG00000133710	ENSG00000133710		"""Serine peptidase inhibitors, Kazal type"""	15464	protein-coding gene	gene with protein product	"""lymphoepithelial Kazal-type-related inhibitor"""	605010	"""serine protease inhibitor, Kazal type 5"""			10419450	Standard	NM_001127698		Approved	VAKTI, LEKTI, LETKI, NETS, NS, FLJ21544, FLJ97536, FLJ97596, FLJ99794, DKFZp686K19184	uc003loy.2	Q9NQ38	OTTHUMG00000134305	ENST00000256084.7:c.2983G>C	5.37:g.147510840G>C	ENSP00000256084:p.Asp995His	276	0		239	44	NM_001127698	0	0	0	0	0	A8MYE8|B7WPB7|D6REN5|O75770|Q3LX95|Q3LX96|Q3LX97|Q96PP2|Q96PP3	Missense_Mutation	SNP	ENST00000256084.7	37	CCDS43382.1	.	.	.	.	.	.	.	.	.	.	G	4.580	0.107817	0.08780	.	.	ENSG00000133710	ENST00000359874;ENST00000256084	T;T	0.75367	-0.93;-0.93	4.69	0.694	0.18062	Proteinase inhibitor I1, Kazal (1);	0.707951	0.13366	N	0.393281	T	0.44180	0.1281	N	0.02539	-0.55	0.24542	N	0.994066	B;B	0.10296	0.003;0.0	B;B	0.09377	0.003;0.004	T	0.29274	-1.0017	10	0.22109	T	0.4	-0.8408	7.0127	0.24871	0.2944:0.3745:0.3311:0.0	.	1025;995	Q9NQ38-3;Q9NQ38	.;ISK5_HUMAN	H	1025;995	ENSP00000352936:D1025H;ENSP00000256084:D995H	ENSP00000256084:D995H	D	+	1	0	SPINK5	147491033	0.961000	0.32948	0.962000	0.40283	0.816000	0.46133	-0.005000	0.12855	-0.016000	0.14127	-0.136000	0.14681	GAC	.		0.433	SPINK5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000259215.2	NM_001127698	
HOXA1	3198	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	27134334	27134334	+	Missense_Mutation	SNP	C	C	T			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr7:27134334C>T	ENST00000343060.4	-	2	794	c.733G>A	c.(733-735)Gag>Aag	p.E245K	HOXA1_ENST00000355633.5_3'UTR|HOTAIRM1_ENST00000434063.3_RNA|HOTAIRM1_ENST00000429611.3_RNA|HOTAIRM1_ENST00000425358.2_RNA|HOTAIRM1_ENST00000495032.1_RNA	NM_005522.4	NP_005513	P49639	HXA1_HUMAN	homeobox A1	245					abducens nerve formation (GO:0021599)|anatomical structure morphogenesis (GO:0009653)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|artery morphogenesis (GO:0048844)|central nervous system neuron differentiation (GO:0021953)|cochlea development (GO:0090102)|cochlea morphogenesis (GO:0090103)|cognition (GO:0050890)|embryonic neurocranium morphogenesis (GO:0048702)|facial nerve structural organization (GO:0021612)|facial nucleus development (GO:0021754)|inner ear development (GO:0048839)|motor neuron axon guidance (GO:0008045)|multicellular organismal development (GO:0007275)|neuromuscular process (GO:0050905)|optokinetic behavior (GO:0007634)|outer ear morphogenesis (GO:0042473)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of behavior (GO:0050795)|rhombomere 3 development (GO:0021569)|rhombomere 4 development (GO:0021570)|rhombomere 5 development (GO:0021571)|semicircular canal formation (GO:0060876)|sensory perception of sound (GO:0007605)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|kidney(2)|large_intestine(4)|liver(1)|lung(14)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						AACTCCTTCTCCAGTTCCGTG	0.582																																					p.E245K		.											.	HOXA1-93	0			c.G733A						.						120.0	109.0	113.0					7																	27134334		2203	4300	6503	SO:0001583	missense	3198	exon2			CCTTCTCCAGTTC		CCDS5401.1, CCDS5402.2	7p15.2	2011-06-20	2005-12-22		ENSG00000105991	ENSG00000105991		"""Homeoboxes / ANTP class : HOXL subclass"""	5099	protein-coding gene	gene with protein product		142955	"""homeo box A1"""	HOX1F, HOX1		1973146	Standard	NM_153620		Approved		uc003sye.3	P49639	OTTHUMG00000023207	ENST00000343060.4:c.733G>A	7.37:g.27134334C>T	ENSP00000343246:p.Glu245Lys	155	0		205	46	NM_005522	0	0	3	4	1	A4D184|B2R8U7|O43363	Missense_Mutation	SNP	ENST00000343060.4	37	CCDS5401.1	.	.	.	.	.	.	.	.	.	.	C	28.2	4.901126	0.92035	.	.	ENSG00000105991	ENST00000343060	D	0.97575	-4.44	5.31	5.31	0.75309	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.046170	0.85682	D	0.000000	D	0.98848	0.9611	M	0.92317	3.295	0.80722	D	1	D	0.69078	0.997	D	0.80764	0.994	D	0.99686	1.1000	10	0.87932	D	0	.	18.98	0.92752	0.0:1.0:0.0:0.0	.	245	P49639	HXA1_HUMAN	K	245	ENSP00000343246:E245K	ENSP00000343246:E245K	E	-	1	0	HOXA1	27100859	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.770000	0.85390	2.495000	0.84180	0.655000	0.94253	GAG	.		0.582	HOXA1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000358454.1		
GTF2I	2969	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	74146900	74146900	+	Missense_Mutation	SNP	G	G	C			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr7:74146900G>C	ENST00000324896.4	+	15	1590	c.1201G>C	c.(1201-1203)Gga>Cga	p.G401R	GTF2I_ENST00000416070.1_Missense_Mutation_p.G360R|GTF2I_ENST00000353920.4_Missense_Mutation_p.G381R|GTF2I_ENST00000346152.4_Missense_Mutation_p.G380R	NM_032999.2	NP_127492.1	P78347	GTF2I_HUMAN	general transcription factor IIi	401					negative regulation of angiogenesis (GO:0016525)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(7)|kidney(1)|large_intestine(1)|lung(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	19						TTATGTAGAAGGACTTCCTGA	0.418																																					p.G401R		.											.	GTF2I-90	0			c.G1201C						.						47.0	48.0	48.0					7																	74146900		2201	4299	6500	SO:0001583	missense	2969	exon15			GTAGAAGGACTTC	U77948	CCDS5573.1, CCDS5574.1, CCDS5575.1, CCDS47614.1, CCDS64680.1	7q11.23	2011-05-25	2009-07-23			ENSG00000263001		"""General transcription factors"""	4659	protein-coding gene	gene with protein product		601679	"""general transcription factor II, i"""	WBSCR6		9334314, 9012831	Standard	NM_032999		Approved	TFII-I, BAP-135, SPIN, BTKAP1, DIWS, IB291	uc003uau.3	P78347		ENST00000324896.4:c.1201G>C	7.37:g.74146900G>C	ENSP00000322542:p.Gly401Arg	107	0		125	36	NM_032999	0	0	12	18	6	O14743|O15359|O43546|O43588|O43589|Q75M85|Q75M86|Q75M87|Q75M88|Q86U51|Q9BSZ4	Missense_Mutation	SNP	ENST00000324896.4	37	CCDS5573.1	.	.	.	.	.	.	.	.	.	.	G	16.59	3.164966	0.57476	.	.	ENSG00000077809	ENST00000324896;ENST00000539339;ENST00000353920;ENST00000346152;ENST00000416070	T;T;T;T	0.78816	-1.21;-1.21;-1.21;-1.21	4.72	4.72	0.59763	.	0.000000	0.64402	D	0.000003	D	0.87289	0.6140	M	0.69823	2.125	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.998;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;0.972;0.999;1.0;1.0	D	0.89083	0.3477	10	0.87932	D	0	-20.2102	16.6643	0.85248	0.0:0.0:1.0:0.0	.	379;360;381;380;401	Q499G6;P78347-2;P78347-3;P78347-4;P78347	.;.;.;.;GTF2I_HUMAN	R	401;396;381;380;360	ENSP00000322542:G401R;ENSP00000322671:G381R;ENSP00000322599:G380R;ENSP00000387651:G360R	ENSP00000322542:G401R	G	+	1	0	GTF2I	73784836	1.000000	0.71417	0.998000	0.56505	0.359000	0.29487	6.620000	0.74224	2.159000	0.67721	0.585000	0.79938	GGA	.		0.418	GTF2I-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252708.1	NM_032999	
MAGI2	9863	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	78131031	78131031	+	Silent	SNP	C	C	A			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr7:78131031C>A	ENST00000354212.4	-	5	1081	c.828G>T	c.(826-828)gtG>gtT	p.V276V	MAGI2_ENST00000419488.1_Silent_p.V276V|MAGI2_ENST00000536571.1_Silent_p.V108V|MAGI2_ENST00000535697.1_Silent_p.V113V|MAGI2_ENST00000522391.1_Silent_p.V276V	NM_012301.3	NP_036433.2	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 2	276	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.				cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|glomerular visceral epithelial cell development (GO:0072015)|mitotic cell cycle arrest (GO:0071850)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase B signaling (GO:0051898)|nerve growth factor signaling pathway (GO:0038180)|planar cell polarity pathway involved in axis elongation (GO:0003402)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of receptor internalization (GO:0002092)|protein heterooligomerization (GO:0051291)|receptor clustering (GO:0043113)|SMAD protein signal transduction (GO:0060395)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|late endosome (GO:0005770)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)|synapse (GO:0045202)|tight junction (GO:0005923)	beta-1 adrenergic receptor binding (GO:0031697)|phosphatase binding (GO:0019902)|receptor signaling complex scaffold activity (GO:0030159)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|type II activin receptor binding (GO:0070699)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(37)|ovary(5)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(3)	84		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				GCTGACTGTACACTGGTGCAG	0.493																																					p.V276V		.											.	MAGI2-461	0			c.G828T						.						233.0	184.0	201.0					7																	78131031		2203	4300	6503	SO:0001819	synonymous_variant	9863	exon5			ACTGTACACTGGT	AB014605	CCDS5594.1, CCDS75623.1	7q21	2005-08-09			ENSG00000187391	ENSG00000187391			18957	protein-coding gene	gene with protein product		606382				10681527, 9734811	Standard	XM_005250725		Approved	AIP1, ARIP1, KIAA0705, ACVRIP1, MAGI-2	uc003ugx.3	Q86UL8	OTTHUMG00000130697	ENST00000354212.4:c.828G>T	7.37:g.78131031C>A		77	0		105	22	NM_012301	0	0	1	1	0	A4D1C1|A7E2C3|O60434|O60510|Q86UI7|Q9NP44|Q9UDQ5|Q9UDU1	Silent	SNP	ENST00000354212.4	37	CCDS5594.1																																																																																			.		0.493	MAGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253197.3	NM_012301	
PCLO	27445	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	82763823	82763823	+	Missense_Mutation	SNP	C	C	G			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr7:82763823C>G	ENST00000333891.9	-	3	3380	c.3043G>C	c.(3043-3045)Gct>Cct	p.A1015P	PCLO_ENST00000423517.2_Missense_Mutation_p.A1015P	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						ACTGTTGGAGCTTGTTCAGCT	0.428																																					p.A1015P		.											.	PCLO-29	0			c.G3043C						.						87.0	84.0	85.0					7																	82763823		1833	4087	5920	SO:0001583	missense	27445	exon3			TTGGAGCTTGTTC	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.3043G>C	7.37:g.82763823C>G	ENSP00000334319:p.Ala1015Pro	60	0		57	16	NM_014510	0	0	0	0	0		Missense_Mutation	SNP	ENST00000333891.9	37	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	C	7.239	0.600956	0.13939	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.76839	-1.05;-1.05	6.07	2.21	0.28008	.	.	.	.	.	T	0.66626	0.2808	L	0.36672	1.1	0.09310	N	0.999994	B;B	0.12630	0.006;0.006	B;B	0.10450	0.005;0.005	T	0.57659	-0.7773	9	0.87932	D	0	.	6.642	0.22914	0.1221:0.6245:0.0:0.2534	.	1015;1015	Q9Y6V0-5;Q9Y6V0-6	.;.	P	961;1015;1015	ENSP00000334319:A1015P;ENSP00000388393:A1015P	ENSP00000334319:A1015P	A	-	1	0	PCLO	82601759	0.000000	0.05858	0.011000	0.14972	0.864000	0.49448	0.079000	0.14782	0.126000	0.18424	-0.136000	0.14681	GCT	.		0.428	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
CYP3A7	1551	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	99328744	99328744	+	Nonsense_Mutation	SNP	T	T	A			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr7:99328744T>A	ENST00000336374.2	-	2	105	c.103A>T	c.(103-105)Aag>Tag	p.K35*		NM_000765.3	NP_000756.2	P24462	CP3A7_HUMAN	cytochrome P450, family 3, subfamily A, polypeptide 7	35					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxygen binding (GO:0019825)			autonomic_ganglia(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	32	Lung NSC(181;0.0144)|Esophageal squamous(72;0.0166)|all_lung(186;0.0228)				Alfentanil(DB00802)|Alprazolam(DB00404)|Aminophenazone(DB01424)|Amiodarone(DB01118)|Amlodipine(DB00381)|Aprepitant(DB00673)|Aripiprazole(DB01238)|Astemizole(DB00637)|Atorvastatin(DB01076)|Buprenorphine(DB00921)|Buspirone(DB00490)|Caffeine(DB00201)|Carbamazepine(DB00564)|Chloramphenicol(DB00446)|Chlorphenamine(DB01114)|Cilostazol(DB01166)|Cimetidine(DB00501)|Ciprofloxacin(DB00537)|Cisapride(DB00604)|Clarithromycin(DB01211)|Clotrimazole(DB00257)|Cocaine(DB00907)|Codeine(DB00318)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dapsone(DB00250)|Delavirdine(DB00705)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diazepam(DB00829)|Diltiazem(DB00343)|Docetaxel(DB01248)|Dolutegravir(DB08930)|Domperidone(DB01184)|Eplerenone(DB00700)|Erythromycin(DB00199)|Estradiol(DB00783)|Ethosuximide(DB00593)|Ethylmorphine(DB01466)|Felodipine(DB01023)|Fentanyl(DB00813)|Finasteride(DB01216)|Fluconazole(DB00196)|Fluticasone Propionate(DB00588)|Fluvoxamine(DB00176)|Gestodene(DB06730)|Haloperidol(DB00502)|Hydrocortisone(DB00741)|Ifosfamide(DB01181)|Iloperidone(DB04946)|Imatinib(DB00619)|Imipramine(DB00458)|Indinavir(DB00224)|Irinotecan(DB00762)|Itraconazole(DB01167)|Ketoconazole(DB01026)|Lercanidipine(DB00528)|Levomethadyl Acetate(DB01227)|Lidocaine(DB00281)|Lovastatin(DB00227)|Methadone(DB00333)|Midazolam(DB00683)|Mifepristone(DB00834)|Nateglinide(DB00731)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Nifedipine(DB01115)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Norethindrone(DB00717)|Norfloxacin(DB01059)|Ondansetron(DB00904)|Oxazepam(DB00842)|Oxycodone(DB00497)|Paclitaxel(DB01229)|Phenelzine(DB00780)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pimozide(DB01100)|Praziquantel(DB01058)|Progesterone(DB00396)|Propranolol(DB00571)|Quetiapine(DB01224)|Quinidine(DB00908)|Quinine(DB00468)|Rifampicin(DB01045)|Rifapentine(DB01201)|Risperidone(DB00734)|Ritonavir(DB00503)|Salmeterol(DB00938)|Saquinavir(DB01232)|Sildenafil(DB00203)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sorafenib(DB00398)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tamoxifen(DB00675)|Telithromycin(DB00976)|Temsirolimus(DB06287)|Testosterone(DB00624)|Trazodone(DB00656)|Tretinoin(DB00755)|Triazolam(DB00897)|Verapamil(DB00661)|Vincristine(DB00541)|Voriconazole(DB00582)|Zalcitabine(DB00943)|Zaleplon(DB00962)|Ziprasidone(DB00246)|Zolpidem(DB00425)	ATTCCAAGCTTCTTAAAAAGT	0.423																																					p.K35X		.											.	CYP3A7-91	0			c.A103T						.						105.0	98.0	100.0					7																	99328744		2203	4300	6503	SO:0001587	stop_gained	1551	exon2			CAAGCTTCTTAAA	AF315325	CCDS5673.1	7q21-q22.1	2007-12-14	2003-01-14		ENSG00000160870	ENSG00000160870		"""Cytochrome P450s"""	2640	protein-coding gene	gene with protein product		605340	"""cytochrome P450, subfamily IIIA, polypeptide 7"""			2722762	Standard	NM_000765		Approved	CP37, P450-HFLA		P24462	OTTHUMG00000156726	ENST00000336374.2:c.103A>T	7.37:g.99328744T>A	ENSP00000337450:p.Lys35*	104	0		152	56	NM_000765	0	0	0	0	0	A4D288|Q9H241	Nonsense_Mutation	SNP	ENST00000336374.2	37	CCDS5673.1	.	.	.	.	.	.	.	.	.	.	T	11.23	1.576557	0.28092	.	.	ENSG00000160870	ENST00000292414;ENST00000336374	.	.	.	3.52	3.52	0.40303	.	0.100727	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.5745	0.33590	0.0:0.0:0.0:1.0	.	.	.	.	X	35	.	ENSP00000292414:K35X	K	-	1	0	CYP3A7	99166680	1.000000	0.71417	0.974000	0.42286	0.205000	0.24178	4.328000	0.59253	1.598000	0.50083	0.418000	0.28097	AAG	.		0.423	CYP3A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345484.1		
CUX1	1523	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	101845410	101845410	+	Missense_Mutation	SNP	A	A	T			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr7:101845410A>T	ENST00000292535.7	+	18	2871	c.2833A>T	c.(2833-2835)Acc>Tcc	p.T945S	CUX1_ENST00000425244.2_Intron|CUX1_ENST00000556210.1_Missense_Mutation_p.T787S|CUX1_ENST00000437600.4_Intron|CUX1_ENST00000360264.3_Missense_Mutation_p.T956S|CUX1_ENST00000549414.2_Missense_Mutation_p.T923S|CUX1_ENST00000393824.3_Intron|CUX1_ENST00000550008.2_Missense_Mutation_p.T889S|CUX1_ENST00000560541.1_Intron|CUX1_ENST00000547394.2_Intron|CUX1_ENST00000546411.2_Missense_Mutation_p.T843S|CUX1_ENST00000292538.4_Intron	NM_181552.3	NP_853530.2	P39880	CUX1_HUMAN	cut-like homeobox 1	945					auditory receptor cell differentiation (GO:0042491)|kidney development (GO:0001822)|lung development (GO:0030324)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|retrograde transport, vesicle recycling within Golgi (GO:0000301)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(26)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|stomach(1)|urinary_tract(5)	70						GGAGGTGGACACCATCGAGCT	0.612																																					p.T956S		.											.	CUX1-160	0			c.A2866T						.						111.0	113.0	112.0					7																	101845410		2203	4300	6503	SO:0001583	missense	1523	exon18			GTGGACACCATCG	M74099	CCDS5720.1, CCDS5721.1, CCDS47672.1, CCDS56498.1, CCDS56499.1, CCDS56500.1, CCDS59071.1	7q22.1	2012-10-03	2007-11-07	2007-11-07	ENSG00000257923	ENSG00000257923		"""Homeoboxes / CUT class"""	2557	protein-coding gene	gene with protein product	"""golgi integral membrane protein 6"""	116896	"""cut (Drosophila)-like 1 (CCAAT displacement protein)"", ""cut-like 1, CCAAT displacement protein (Drosophila)"""	CUTL1		8468066, 9799793, 15004235	Standard	NM_001202543		Approved	CDP, CDP1, CUX, CUT, Clox, CDP/Cut, CDP/Cux, Cux/CDP, CASP, GOLIM6	uc003uyx.4	P39880	OTTHUMG00000157129	ENST00000292535.7:c.2833A>T	7.37:g.101845410A>T	ENSP00000292535:p.Thr945Ser	172	0		230	78	NM_001202543	0	0	1	3	2	B3KV79|J3KQV9|Q6NYH4|Q75LE5|Q75MT2|Q75MT3|Q86UJ7|Q9UEV5	Missense_Mutation	SNP	ENST00000292535.7	37	CCDS5721.1	.	.	.	.	.	.	.	.	.	.	A	33	5.209946	0.95069	.	.	ENSG00000257923	ENST00000360264;ENST00000292535;ENST00000549414;ENST00000550008;ENST00000546411;ENST00000556210	T;T;T;T;T;T	0.79845	-1.28;-1.28;-1.3;-1.31;-1.22;-1.23	5.29	5.29	0.74685	Homeodomain protein CUT (2);Lambda repressor-like, DNA-binding (2);	0.132166	0.51477	D	0.000092	D	0.89511	0.6736	M	0.82056	2.57	0.80722	D	1	D;D	0.71674	0.992;0.998	D;D	0.80764	0.987;0.994	D	0.90018	0.4126	10	0.48119	T	0.1	-33.7771	15.2336	0.73411	1.0:0.0:0.0:0.0	.	945;956	P39880;P39880-3	CUX1_HUMAN;.	S	956;945;923;889;843;787	ENSP00000353401:T956S;ENSP00000292535:T945S;ENSP00000446630:T923S;ENSP00000447373:T889S;ENSP00000450125:T843S;ENSP00000451558:T787S	ENSP00000292535:T945S	T	+	1	0	CUX1	101632130	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.962000	0.93254	2.010000	0.58986	0.533000	0.62120	ACC	.		0.612	CUX1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347535.1	NM_001913	
MET	4233	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	116417463	116417463	+	Missense_Mutation	SNP	C	C	T	rs121913244		TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr7:116417463C>T	ENST00000318493.6	+	16	3521	c.3334C>T	c.(3334-3336)Cat>Tat	p.H1112Y	MET_ENST00000539704.1_5'UTR|MET_ENST00000397752.3_Missense_Mutation_p.H1094Y			Q9NWH9	SLTM_HUMAN	MET proto-oncogene, receptor tyrosine kinase	0					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.H1112Y(1)		NS(10)|breast(4)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(25)|large_intestine(8)|liver(3)|lung(70)|ovary(10)|pleura(2)|prostate(4)|skin(5)|stomach(6)|testis(1)|thyroid(4)|upper_aerodigestive_tract(64)|urinary_tract(3)	233	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			TTGTGTATATCATGGGACTTT	0.343			Mis		"""papillary renal, head-neck squamous cell """	papillary renal			Hereditary Papillary Renal Carcinoma (type 1)																												p.H1112Y		.		Dom	yes	Familial Papillary Renal Cancer	7	7q31	4233	met proto-oncogene (hepatocyte growth factor receptor)		E	.	MET-5874	1	Substitution - Missense(1)	kidney(1)	c.C3334T	GRCh37	CM993668	MET	M	rs121913244	.						188.0	175.0	179.0					7																	116417463		1832	4086	5918	SO:0001583	missense	4233	exon16	Familial Cancer Database	HPRC, Hereditary Papillary Renal Cell Cancer	GTATATCATGGGA	M35073	CCDS43636.1, CCDS47689.1	7q31	2014-09-17	2014-06-26		ENSG00000105976	ENSG00000105976	2.7.10.1		7029	protein-coding gene	gene with protein product	"""hepatocyte growth factor receptor"""	164860	"""met proto-oncogene"""			1846706, 1611909	Standard	NM_001127500		Approved	HGFR, RCCP2	uc010lkh.3	P08581	OTTHUMG00000023299	ENST00000318493.6:c.3334C>T	7.37:g.116417463C>T	ENSP00000317272:p.His1112Tyr	161	0		181	62	NM_001127500	0	0	3	9	6	A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	ENST00000318493.6	37	CCDS47689.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.615896	0.87359	.	.	ENSG00000105976	ENST00000397752;ENST00000318493	T;T	0.33654	1.4;1.4	5.29	5.29	0.74685	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.43919	0.1269	N	0.11364	0.135	0.80722	D	1	P;D	0.89917	0.937;1.0	P;D	0.91635	0.854;0.999	T	0.52711	-0.8539	10	0.51188	T	0.08	-16.8984	19.2953	0.94119	0.0:1.0:0.0:0.0	.	1112;1094	P08581-2;P08581	.;MET_HUMAN	Y	1094;1112	ENSP00000380860:H1094Y;ENSP00000317272:H1112Y	ENSP00000317272:H1112Y	H	+	1	0	MET	116204699	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.776000	0.85560	2.628000	0.89032	0.655000	0.94253	CAT	.		0.343	MET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059620.3		
C7orf55	154791	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	139030365	139030365	+	Missense_Mutation	SNP	A	A	T			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr7:139030365A>T	ENST00000297534.6	+	2	510	c.257A>T	c.(256-258)aAg>aTg	p.K86M	C7orf55_ENST00000481123.1_3'UTR|C7orf55-LUC7L2_ENST00000541170.3_Intron|LUC7L2_ENST00000541515.3_Missense_Mutation_p.K86M	NM_197964.4	NP_932068.2	Q96HJ9	CG055_HUMAN	chromosome 7 open reading frame 55	86						mitochondrion (GO:0005739)				breast(1)|lung(2)	3						TTTCATGGCAAGGGTGAGCGC	0.562																																					p.K86M		.											.	.	0			c.A257T						.						76.0	68.0	71.0					7																	139030365		2203	4300	6503	SO:0001583	missense	100996928	exon2			ATGGCAAGGGTGA	AF161386	CCDS5853.1	7q34	2009-01-22	2009-01-22	2009-01-22	ENSG00000164898	ENSG00000164898			26946	protein-coding gene	gene with protein product	"""formation of mitochondrial complexes 1 homolog (S. cerevisiae)"""					12477932	Standard	NM_197964		Approved	HSPC268, FMC1		Q96HJ9	OTTHUMG00000151719	ENST00000297534.6:c.257A>T	7.37:g.139030365A>T	ENSP00000297534:p.Lys86Met	68	0		81	16	NM_001244584	0	0	54	96	42	B7Z4Q3|Q75M90|Q9P0B3	Missense_Mutation	SNP	ENST00000297534.6	37	CCDS5853.1	.	.	.	.	.	.	.	.	.	.	A	20.3	3.963741	0.74016	.	.	ENSG00000164898;ENSG00000146963	ENST00000297534;ENST00000541515	T;T	0.53423	0.62;1.33	5.62	3.25	0.37280	.	.	.	.	.	T	0.44244	0.1284	M	0.71581	2.175	0.32737	N	0.508162	B;B	0.10296	0.003;0.003	B;B	0.14578	0.011;0.011	T	0.53968	-0.8363	9	0.87932	D	0	-0.2264	5.3084	0.15817	0.7154:0.0:0.1316:0.1531	.	86;86	B7Z4Q3;Q96HJ9	.;CG055_HUMAN	M	86	ENSP00000297534:K86M;ENSP00000440222:K86M	ENSP00000297534:K86M	K	+	2	0	LUC7L2;C7orf55	138680905	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.533000	0.36040	0.928000	0.37168	0.455000	0.32223	AAG	.		0.562	C7orf55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323626.1	NM_197964	
KEL	3792	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	142658089	142658089	+	Missense_Mutation	SNP	C	C	A			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr7:142658089C>A	ENST00000355265.2	-	4	800	c.326G>T	c.(325-327)gGa>gTa	p.G109V	KEL_ENST00000479768.2_5'UTR	NM_000420.2	NP_000411.1	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase	109					vasoconstriction (GO:0042310)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(34)|ovary(3)|prostate(2)|skin(1)	60	Melanoma(164;0.059)					TTTGGCCCTTCCACAGGCAAA	0.512																																					p.G109V		.											.	KEL-93	0			c.G326T						.						133.0	133.0	133.0					7																	142658089		2203	4300	6503	SO:0001583	missense	3792	exon4			GCCCTTCCACAGG	BC003135	CCDS34766.1	7q33	2014-07-19	2006-10-10		ENSG00000197993	ENSG00000197993		"""CD molecules"", ""Blood group antigens"""	6308	protein-coding gene	gene with protein product		613883	"""Kell blood group"", ""Kell blood group, metalloendopeptidase"""			1712490, 7683930	Standard	NM_000420		Approved	ECE3, CD238	uc003wcb.3	P23276	OTTHUMG00000157159	ENST00000355265.2:c.326G>T	7.37:g.142658089C>A	ENSP00000347409:p.Gly109Val	191	0		208	40	NM_000420	0	0	0	0	0	B2RBV4|Q96RS8|Q99885	Missense_Mutation	SNP	ENST00000355265.2	37	CCDS34766.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.61|12.61	1.990455|1.990455	0.35131|0.35131	.|.	.|.	ENSG00000197993|ENSG00000197993	ENST00000355265;ENST00000476829;ENST00000467543|ENST00000460479	D;D;D|.	0.88741|.	-2.42;-2.42;-2.42|.	5.66|5.66	2.87|2.87	0.33458|0.33458	Peptidase M13 (1);|.	0.255042|.	0.27792|.	N|.	0.017836|.	T|T	0.71576|0.71576	0.3356|0.3356	M|M	0.83223|0.83223	2.63|2.63	0.45607|0.45607	D|D	0.998543|0.998543	D|.	0.89917|.	1.0|.	D|.	0.80764|.	0.994|.	T|T	0.68458|0.68458	-0.5403|-0.5403	10|5	0.87932|.	D|.	0|.	-14.3801|-14.3801	7.6264|7.6264	0.28214|0.28214	0.0:0.7371:0.0:0.2629|0.0:0.7371:0.0:0.2629	.|.	109|.	P23276|.	KELL_HUMAN|.	V|C	109;109;90|119	ENSP00000347409:G109V;ENSP00000419889:G109V;ENSP00000420011:G90V|.	ENSP00000347409:G109V|.	G|W	-|-	2|3	0|0	KEL|KEL	142368211|142368211	0.745000|0.745000	0.28261|0.28261	0.447000|0.447000	0.26932|0.26932	0.040000|0.040000	0.13550|0.13550	1.084000|1.084000	0.30828|0.30828	0.317000|0.317000	0.23160|0.23160	0.655000|0.655000	0.94253|0.94253	GGA|TGG	.		0.512	KEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347671.2	NM_000420	
OR2A7	401427	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	143956670	143956670	+	Missense_Mutation	SNP	C	C	T	rs531461622		TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr7:143956670C>T	ENST00000493325.1	-	1	145	c.52G>A	c.(52-54)Gtt>Att	p.V18I	OR2A1-AS1_ENST00000489488.1_RNA|OR2A1-AS1_ENST00000461843.1_RNA|ARHGEF35_ENST00000543357.1_Intron|OR2A1-AS1_ENST00000478806.1_RNA|OR2A1-AS1_ENST00000463561.1_RNA|OR2A1-AS1_ENST00000476560.1_RNA|RP4-545C24.1_ENST00000460955.1_RNA|OR2A1-AS1_ENST00000487102.1_RNA	NM_001005328.1	NP_001005328.1	Q96R45	OR2A7_HUMAN	olfactory receptor, family 2, subfamily A, member 7	18						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)	6	Melanoma(164;0.14)					CTTGGGCCAACGGGAAATCCC	0.498													c|||	1	0.000199681	0.0008	0.0	5008	,	,		31715	0.0		0.0	False		,,,				2504	0.0				p.V18I		.											.	OR2A7-23	0			c.G52A						.						100.0	128.0	118.0					7																	143956670		2201	4297	6498	SO:0001583	missense	401427	exon1			GGCCAACGGGAAA		CCDS55177.1	7q35	2013-09-20			ENSG00000243896	ENSG00000243896		"""GPCR / Class A : Olfactory receptors"""	8234	protein-coding gene	gene with protein product							Standard	NM_001005328		Approved	HSDJ0798C17	uc011kuc.2	Q96R45	OTTHUMG00000158002	ENST00000493325.1:c.52G>A	7.37:g.143956670C>T	ENSP00000420502:p.Val18Ile	407	2		432	31	NM_001005328	0	0	3	3	0	B2RN57|Q6IFP4	Missense_Mutation	SNP	ENST00000493325.1	37	CCDS55177.1	.	.	.	.	.	.	.	.	.	.	c	0.608	-0.826223	0.02734	.	.	ENSG00000243896	ENST00000493325	T	0.00433	7.43	3.21	-3.87	0.04218	.	.	.	.	.	T	0.00178	0.0005	N	0.04245	-0.25	0.09310	N	1	B	0.11235	0.004	B	0.04013	0.001	T	0.20273	-1.0280	9	0.39692	T	0.17	.	4.6601	0.12637	0.0891:0.4935:0.1752:0.2422	.	18	Q96R45	OR2A7_HUMAN	I	18	ENSP00000420502:V18I	ENSP00000420502:V18I	V	-	1	0	OR2A7	143587603	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-2.569000	0.00915	-0.991000	0.03476	-1.490000	0.00973	GTT	.		0.498	OR2A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349979.1		
FBXO43	286151	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	101152996	101152996	+	Missense_Mutation	SNP	C	C	G			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr8:101152996C>G	ENST00000428847.2	-	2	1802	c.1486G>C	c.(1486-1488)Gac>Cac	p.D496H		NM_001029860.3	NP_001025031.2	Q4G163	FBX43_HUMAN	F-box protein 43	496	F-box.				meiotic nuclear division (GO:0007126)|negative regulation of meiosis (GO:0045835)|negative regulation of protein catabolic process (GO:0042177)|protein ubiquitination (GO:0016567)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			endometrium(1)|kidney(4)|large_intestine(5)|lung(14)|prostate(1)|skin(5)|urinary_tract(1)	31	all_cancers(14;0.000139)|all_epithelial(15;2.84e-07)|Lung NSC(17;0.000274)|all_lung(17;0.000798)		Epithelial(11;1.17e-09)|all cancers(13;1.34e-07)|OV - Ovarian serous cystadenocarcinoma(57;3.82e-05)|STAD - Stomach adenocarcinoma(118;0.0957)			GTTAAGATGTCCAGTTTTTCT	0.388																																					p.D496H		.											.	FBXO43-226	0			c.G1486C						.						144.0	134.0	137.0					8																	101152996		1822	4082	5904	SO:0001583	missense	286151	exon2			AGATGTCCAGTTT	BC028709	CCDS47904.1	8q22.3	2004-08-24			ENSG00000156509	ENSG00000156509		"""F-boxes /  ""other"""""	28521	protein-coding gene	gene with protein product		609110					Standard	NR_036491		Approved	Fbx43	uc003yjd.3	Q4G163	OTTHUMG00000164803	ENST00000428847.2:c.1486G>C	8.37:g.101152996C>G	ENSP00000403293:p.Asp496His	167	0		160	36	NM_001029860	0	0	0	0	0		Missense_Mutation	SNP	ENST00000428847.2	37	CCDS47904.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.070318	0.76301	.	.	ENSG00000156509	ENST00000428847	T	0.64618	-0.11	4.86	4.86	0.63082	.	0.000000	0.85682	D	0.000000	T	0.81394	0.4813	M	0.83223	2.63	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.84731	0.0745	10	0.87932	D	0	-12.012	18.3634	0.90383	0.0:1.0:0.0:0.0	.	462;496	C9J908;Q4G163	.;FBX43_HUMAN	H	496	ENSP00000403293:D496H	ENSP00000403293:D496H	D	-	1	0	FBXO43	101222172	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.034000	0.76511	2.398000	0.81561	0.655000	0.94253	GAC	.		0.388	FBXO43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380380.1	XM_209918	
CPSF1	29894	hgsc.bcm.edu	37	8	145626922	145626922	+	Missense_Mutation	SNP	C	C	G			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr8:145626922C>G	ENST00000349769.3	-	4	302	c.208G>C	c.(208-210)Gcc>Ccc	p.A70P	MIR1234_ENST00000408875.1_RNA	NM_013291.2	NP_037423.2	Q10570	CPSF1_HUMAN	cleavage and polyadenylation specific factor 1, 160kDa	70					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)	mRNA 3'-UTR binding (GO:0003730)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.88e-41)|Epithelial(56;1.67e-40)|all cancers(56;1.2e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			GAGAAGGAGGCAGCAAGCTCG	0.647																																					p.A70P	NSCLC(133;1088 1848 27708 34777 35269)	.											.	CPSF1-91	0			c.G208C						.						78.0	77.0	77.0					8																	145626922		2202	4300	6502	SO:0001583	missense	29894	exon4			AGGAGGCAGCAAG	U37012	CCDS34966.1	8q24	2014-05-06	2002-08-29		ENSG00000071894	ENSG00000071894			2324	protein-coding gene	gene with protein product		606027	"""cleavage and polyadenylation specific factor 1, 160kD subunit"""			7651824, 7590244	Standard	NM_013291		Approved		uc003zcj.3	Q10570	OTTHUMG00000174612	ENST00000349769.3:c.208G>C	8.37:g.145626922C>G	ENSP00000339353:p.Ala70Pro	38	0		32	2	NM_013291	0	0	10	10	0	Q96AF0	Missense_Mutation	SNP	ENST00000349769.3	37	CCDS34966.1	.	.	.	.	.	.	.	.	.	.	C	14.17	2.454700	0.43634	.	.	ENSG00000071894	ENST00000349769;ENST00000531042	T	0.51574	0.7	4.31	3.42	0.39159	.	0.000000	0.85682	D	0.000000	T	0.58595	0.2133	M	0.79926	2.475	0.58432	D	0.999997	P;P	0.40398	0.659;0.716	P;B	0.49140	0.601;0.372	T	0.59989	-0.7350	10	0.42905	T	0.14	-1.831	11.1686	0.48558	0.1853:0.8146:0.0:0.0	.	70;70	B4DEF4;Q10570	.;CPSF1_HUMAN	P	70	ENSP00000339353:A70P	ENSP00000339353:A70P	A	-	1	0	CPSF1	145597730	1.000000	0.71417	0.992000	0.48379	0.443000	0.32047	5.033000	0.64146	1.010000	0.39314	0.561000	0.74099	GCC	.		0.647	CPSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382422.2	NM_013291	
FREM1	158326	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	14801824	14801824	+	Missense_Mutation	SNP	C	C	G			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr9:14801824C>G	ENST00000380880.3	-	20	4303	c.3520G>C	c.(3520-3522)Gtg>Ctg	p.V1174L	FREM1_ENST00000380881.4_Missense_Mutation_p.V1175L|FREM1_ENST00000422223.2_Missense_Mutation_p.V1174L			Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1	1174					cell communication (GO:0007154)|cell-matrix adhesion (GO:0007160)|craniofacial suture morphogenesis (GO:0097094)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(40)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	100				GBM - Glioblastoma multiforme(50;3.53e-06)		TCCAGGTCCACAGCGCTGATG	0.493																																					p.V1174L		.											.	FREM1-138	0			c.G3520C						.						150.0	147.0	148.0					9																	14801824		2053	4219	6272	SO:0001583	missense	158326	exon21			GGTCCACAGCGCT	AK058190	CCDS47952.1, CCDS55293.1	9p22.3	2010-06-04	2004-12-15	2004-12-15	ENSG00000164946	ENSG00000164946			23399	protein-coding gene	gene with protein product		608944	"""chromosome 9 open reading frame 154"""	C9orf154		12838346, 15345741	Standard	NM_144966		Approved	FLJ25461, C9orf145, C9orf143, DKFZp686M16108, TILRR	uc003zlm.3	Q5H8C1	OTTHUMG00000019575	ENST00000380880.3:c.3520G>C	9.37:g.14801824C>G	ENSP00000370262:p.Val1174Leu	227	0		160	36	NM_144966	0	0	0	0	0	B7ZBX4|Q5VV00|Q5VV01|Q6MZI4|Q8NEG9|Q96LI3	Missense_Mutation	SNP	ENST00000380880.3	37	CCDS47952.1	.	.	.	.	.	.	.	.	.	.	C	8.474	0.858155	0.17178	.	.	ENSG00000164946	ENST00000380881;ENST00000422223;ENST00000380880	T;T;T	0.49432	0.78;0.78;0.78	5.51	-0.193	0.13244	.	0.808695	0.12113	N	0.498353	T	0.32793	0.0841	L	0.33339	1.005	0.22017	N	0.999411	B	0.12013	0.005	B	0.09377	0.004	T	0.22556	-1.0213	10	0.21540	T	0.41	-0.3702	10.4355	0.44433	0.0:0.6222:0.0:0.3778	.	1174	Q5H8C1	FREM1_HUMAN	L	1175;1174;1174	ENSP00000370263:V1175L;ENSP00000412940:V1174L;ENSP00000370262:V1174L	ENSP00000370257:V1177L	V	-	1	0	FREM1	14791824	0.010000	0.17322	0.071000	0.20095	0.038000	0.13279	0.139000	0.16036	0.033000	0.15463	0.591000	0.81541	GTG	.		0.493	FREM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339474.2	NM_144966	
FCN1	2219	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	137801883	137801883	+	Missense_Mutation	SNP	G	G	C			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr9:137801883G>C	ENST00000371806.3	-	9	833	c.742C>G	c.(742-744)Cta>Gta	p.L248V		NM_002003.3	NP_001994.2	O00602	FCN1_HUMAN	ficolin (collagen/fibrinogen domain containing) 1	248	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				cell surface pattern recognition receptor signaling pathway (GO:0002752)|complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|opsonization (GO:0008228)|positive regulation of interleukin-8 secretion (GO:2000484)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|extrinsic component of external side of plasma membrane (GO:0031232)	antigen binding (GO:0003823)|calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|G-protein coupled receptor binding (GO:0001664)|signaling pattern recognition receptor activity (GO:0008329)			endometrium(3)|kidney(3)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	37		Myeloproliferative disorder(178;0.0333)		OV - Ovarian serous cystadenocarcinoma(145;3.46e-08)|Epithelial(140;6.01e-08)|all cancers(34;3.69e-07)		TGGCCCGTTAGAGAATTACCT	0.507																																					p.L248V		.											.	FCN1-154	0			c.C742G						.						170.0	177.0	175.0					9																	137801883		2203	4300	6503	SO:0001583	missense	2219	exon9			CCGTTAGAGAATT	D83920	CCDS6985.1	9q34	2013-02-06	2002-01-14		ENSG00000085265	ENSG00000085265		"""Fibrinogen C domain containing"""	3623	protein-coding gene	gene with protein product		601252	"""ficolin (collagen/fibrinogen domain-containing) 1"""			8573080, 8884275	Standard	NM_002003		Approved	FCNM	uc004cfi.3	O00602	OTTHUMG00000020895	ENST00000371806.3:c.742C>G	9.37:g.137801883G>C	ENSP00000360871:p.Leu248Val	283	0		253	53	NM_002003	0	0	0	0	0	Q5VYV5|Q92596	Missense_Mutation	SNP	ENST00000371806.3	37	CCDS6985.1	.	.	.	.	.	.	.	.	.	.	G	13.50	2.254797	0.39896	.	.	ENSG00000085265	ENST00000371806	T	0.78246	-1.16	3.29	1.19	0.21007	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);	.	.	.	.	D	0.88742	0.6519	H	0.96833	3.89	0.33292	D	0.56369	D	0.67145	0.996	D	0.68765	0.96	D	0.85951	0.1464	9	0.87932	D	0	.	2.548	0.04742	0.2654:0.0:0.5025:0.2321	.	248	O00602	FCN1_HUMAN	V	248	ENSP00000360871:L248V	ENSP00000360871:L248V	L	-	1	2	FCN1	136941704	0.980000	0.34600	0.042000	0.18584	0.143000	0.21401	2.020000	0.41010	0.705000	0.31890	0.643000	0.83706	CTA	.		0.507	FCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054963.1	NM_002003	
LHX3	8022	ucsc.edu	37	9	139091693	139091693	+	Silent	SNP	C	C	T			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr9:139091693C>T	ENST00000371748.5	-	3	381	c.285G>A	c.(283-285)ctG>ctA	p.L95L	LHX3_ENST00000371746.3_Silent_p.L100L	NM_178138.4	NP_835258.1	Q9UBR4	LHX3_HUMAN	LIM homeobox 3	95	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				inner ear development (GO:0048839)|lung development (GO:0030324)|medial motor column neuron differentiation (GO:0021526)|motor neuron axon guidance (GO:0008045)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|pituitary gland development (GO:0021983)|placenta development (GO:0001890)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|spinal cord association neuron differentiation (GO:0021527)|spinal cord motor neuron cell fate specification (GO:0021520)|ventral spinal cord interneuron specification (GO:0021521)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			large_intestine(2)|lung(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	8		Myeloproliferative disorder(178;0.0511)		Epithelial(140;8.43e-08)|OV - Ovarian serous cystadenocarcinoma(145;1.26e-07)		GCGGGATGCCCAGCTGGCACG	0.721																																					p.L100L													.	LHX3-91	0			c.G300A						.						13.0	12.0	12.0					9																	139091693		2185	4285	6470	SO:0001819	synonymous_variant	8022	exon3			GATGCCCAGCTGG	AF096169	CCDS6994.1, CCDS6995.1	9q34.3	2011-06-20			ENSG00000107187	ENSG00000107187		"""Homeoboxes / LIM class"""	6595	protein-coding gene	gene with protein product		600577				10598593, 10717474	Standard	NM_178138		Approved		uc004cgz.3	Q9UBR4	OTTHUMG00000020924	ENST00000371748.5:c.285G>A	9.37:g.139091693C>T		18	0		23	4	NM_014564	0	0	0	0	0	Q5TB39|Q5TB40|Q9NZB5|Q9P0I8|Q9P0I9	Silent	SNP	ENST00000371748.5	37	CCDS6994.1																																																																																			.		0.721	LHX3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055048.3		
PRKX	5613	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	3544550	3544550	+	Missense_Mutation	SNP	G	G	C			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chrX:3544550G>C	ENST00000262848.5	-	5	1079	c.725C>G	c.(724-726)cCt>cGt	p.P242R	PRKX_ENST00000425240.1_5'UTR	NM_005044.4	NP_005035.1	P51817	PRKX_HUMAN	protein kinase, X-linked	242	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|endothelial cell migration (GO:0043542)|endothelial cell proliferation (GO:0001935)|epithelial tube morphogenesis (GO:0060562)|kidney morphogenesis (GO:0060993)|myeloid cell differentiation (GO:0030099)|peptidyl-serine phosphorylation (GO:0018105)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of epithelial cell differentiation involved in kidney development (GO:2000696)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)			kidney(1)|large_intestine(2)|lung(6)|pancreas(1)|skin(2)	12		all_lung(23;0.000396)|Lung NSC(23;0.00123)				AAAAAACGGAGGAAACCTGTT	0.373																																					p.P242R		.											.	PRKX-540	0			c.C725G						.						108.0	93.0	98.0					X																	3544550		2203	4300	6503	SO:0001583	missense	5613	exon5			AACGGAGGAAACC		CCDS14125.1	Xp22.3	2008-08-01			ENSG00000183943	ENSG00000183943	2.7.11.1		9441	protein-coding gene	gene with protein product		300083				7633447	Standard	NM_005044		Approved	PKX1	uc010nde.3	P51817	OTTHUMG00000021087	ENST00000262848.5:c.725C>G	X.37:g.3544550G>C	ENSP00000262848:p.Pro242Arg	24	0		25	7	NM_005044	0	0	0	0	0		Missense_Mutation	SNP	ENST00000262848.5	37	CCDS14125.1	.	.	.	.	.	.	.	.	.	.	G	12.63	1.994637	0.35226	.	.	ENSG00000183943	ENST00000262848	T	0.09073	3.02	3.47	3.47	0.39725	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.19167	0.0460	L	0.39147	1.195	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.00909	-1.1518	10	0.87932	D	0	-3.9448	12.0899	0.53719	0.0:0.0:1.0:0.0	.	242	P51817	PRKX_HUMAN	R	242	ENSP00000262848:P242R	ENSP00000262848:P242R	P	-	2	0	PRKX	3554550	1.000000	0.71417	0.936000	0.37596	0.310000	0.27922	6.948000	0.75965	1.374000	0.46228	0.529000	0.55759	CCT	.		0.373	PRKX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055659.1	NM_005044	
KIAA2022	340533	broad.mit.edu	37	X	73961092	73961092	+	Silent	SNP	C	C	T			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chrX:73961092C>T	ENST00000055682.6	-	3	3911	c.3300G>A	c.(3298-3300)gaG>gaA	p.E1100E		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	1100					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						CTGGGACACCCTCTTGGAACC	0.478																																					p.E1100E													.	KIAA2022-183	0			c.G3300A						.						75.0	70.0	72.0					X																	73961092		2203	4300	6503	SO:0001819	synonymous_variant	340533	exon3			GACACCCTCTTGG		CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.3300G>A	X.37:g.73961092C>T		107	0		83	4	NM_001008537	0	0	0	0	0	A7YY87|Q5JUX9|Q8IVE9	Silent	SNP	ENST00000055682.6	37	CCDS35337.1																																																																																			.		0.478	KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057270.2	NM_001008537	
SYTL4	94121	hgsc.bcm.edu	37	X	99945081	99945081	+	Missense_Mutation	SNP	T	T	C			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chrX:99945081T>C	ENST00000372989.1	-	10	1130	c.799A>G	c.(799-801)Agg>Ggg	p.R267G	SYTL4_ENST00000263033.5_Missense_Mutation_p.R267G|SYTL4_ENST00000455616.1_Missense_Mutation_p.R267G|SYTL4_ENST00000372981.1_Missense_Mutation_p.R267G|SYTL4_ENST00000276141.6_Missense_Mutation_p.R267G|SYTL4_ENST00000454200.2_Missense_Mutation_p.R268G	NM_080737.2	NP_542775.2	Q96C24	SYTL4_HUMAN	synaptotagmin-like 4	267					exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)|multivesicular body sorting pathway (GO:0071985)|negative regulation of insulin secretion (GO:0046676)|positive regulation of exocytosis (GO:0045921)|positive regulation of protein secretion (GO:0050714)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|endosome (GO:0005768)|extrinsic component of membrane (GO:0019898)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|synaptic vesicle (GO:0008021)	neurexin family protein binding (GO:0042043)|phospholipid binding (GO:0005543)|transporter activity (GO:0005215)|zinc ion binding (GO:0008270)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|skin(2)	27					"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	CCTGAAGGCCTGAGGATTTTT	0.443																																					p.R267G		.											.	SYTL4-132	0			c.A799G						.						81.0	70.0	74.0					X																	99945081		2203	4300	6503	SO:0001583	missense	94121	exon9			AAGGCCTGAGGAT		CCDS14472.1	Xq21.33	2008-07-31	2008-07-31		ENSG00000102362	ENSG00000102362			15588	protein-coding gene	gene with protein product	"""granuphilin-a"", ""exophilin-2"""	300723					Standard	NM_080737		Approved		uc010nnc.3	Q96C24	OTTHUMG00000022004	ENST00000372989.1:c.799A>G	X.37:g.99945081T>C	ENSP00000362080:p.Arg267Gly	67	1		59	3	NM_001129896	0	0	0	0	0	Q5H9J3|Q5JPG8|Q8N9P4|Q9H4R0|Q9H4R1	Missense_Mutation	SNP	ENST00000372989.1	37	CCDS14472.1	.	.	.	.	.	.	.	.	.	.	t	16.96	3.267176	0.59540	.	.	ENSG00000102362	ENST00000372989;ENST00000455616;ENST00000454200;ENST00000276141;ENST00000263033;ENST00000372981	T;T;T;T;T;T	0.68624	1.85;1.85;1.85;1.85;1.85;-0.34	5.7	5.7	0.88788	.	0.136293	0.64402	D	0.000002	T	0.63177	0.2489	L	0.53249	1.67	0.35835	D	0.825602	P;P	0.47762	0.9;0.893	P;B	0.45610	0.487;0.4	T	0.71321	-0.4628	9	.	.	.	-16.6096	8.1118	0.30920	0.1328:0.0:0.1353:0.7319	.	267;267	Q96C24-2;Q96C24	.;SYTL4_HUMAN	G	267;267;268;267;267;267	ENSP00000362080:R267G;ENSP00000390252:R267G;ENSP00000403556:R268G;ENSP00000276141:R267G;ENSP00000263033:R267G;ENSP00000362072:R267G	.	R	-	1	2	SYTL4	99831737	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.828000	0.62730	1.915000	0.55452	0.478000	0.44815	AGG	.		0.443	SYTL4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057488.1	NM_080737	
CDK8	1024	broad.mit.edu;bcgsc.ca	37	13	26975735	26975736	+	Frame_Shift_Del	DEL	GG	GG	-			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	GG	GG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr13:26975735_26975736delGG	ENST00000381527.3	+	12	1746_1747	c.1243_1244delGG	c.(1243-1245)ggafs	p.G415fs	CDK8_ENST00000536792.1_3'UTR|CDK8_ENST00000480323.1_3'UTR	NM_001260.1	NP_001251.1	P49336	CDK8_HUMAN	cyclin-dependent kinase 8	415					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|urinary_tract(1)	25	Colorectal(5;0.000442)	Lung SC(185;0.0156)|Breast(139;0.147)		all cancers(112;0.0384)|Epithelial(112;0.142)|OV - Ovarian serous cystadenocarcinoma(117;0.188)		TACCTCAGGTGGACTTATCATG	0.446																																					p.415_415del													.	CDK8-1023	0			c.1243_1244del						.																																			SO:0001589	frameshift_variant	1024	exon12			TCAGGTGGACTTA	X85753	CCDS9317.1	13q12	2011-11-08			ENSG00000132964	ENSG00000132964		"""Cyclin-dependent kinases"""	1779	protein-coding gene	gene with protein product		603184				7568034	Standard	NM_001260		Approved	K35	uc001uqr.1	P49336	OTTHUMG00000016617	ENST00000381527.3:c.1243_1244delGG	13.37:g.26975735_26975736delGG	ENSP00000370938:p.Gly415fs	117	0		92	11	NM_001260	0	0	0	0	0	Q5VUF3|Q6ISB5	Frame_Shift_Del	DEL	ENST00000381527.3	37	CCDS9317.1																																																																																			.		0.446	CDK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044250.1		
ANKDD1A	348094	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	65214185	65214185	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr15:65214185delA	ENST00000380230.3	+	4	362	c.333delA	c.(331-333)gtafs	p.V111fs	AC069368.3_ENST00000437723.1_Frame_Shift_Del_p.V183fs|ANKDD1A_ENST00000357698.3_Frame_Shift_Del_p.V111fs|ANKDD1A_ENST00000319580.8_Frame_Shift_Del_p.K34fs|ANKDD1A_ENST00000395723.1_Frame_Shift_Del_p.V20fs|ANKDD1A_ENST00000395720.1_Frame_Shift_Del_p.V111fs|ANKDD1A_ENST00000491145.1_3'UTR|ANKDD1A_ENST00000496660.1_Frame_Shift_Del_p.V20fs	NM_182703.3	NP_874362.3	Q495B1	AKD1A_HUMAN	ankyrin repeat and death domain containing 1A	111					signal transduction (GO:0007165)					NS(1)|endometrium(1)|large_intestine(10)|liver(2)|lung(4)|ovary(1)|prostate(2)	21						AGATCTTGGTAAACTCAGGGG	0.577																																					p.V111fs		.											.	ANKDD1A-69	0			c.333delA						.						113.0	90.0	98.0					15																	65214185		2202	4299	6501	SO:0001589	frameshift_variant	348094	exon4			.		CCDS10197.2	15q22.31	2013-01-10	2006-02-16		ENSG00000166839	ENSG00000166839		"""Ankyrin repeat domain containing"""	28002	protein-coding gene	gene with protein product						12477932	Standard	NM_182703		Approved	FLJ25870	uc002aoa.3	Q495B1	OTTHUMG00000133051	ENST00000380230.3:c.333delA	15.37:g.65214185delA	ENSP00000369579:p.Val111fs	76	0		80	17	NM_182703	0	0	0	0	0	Q495B2|Q495B3|Q8N7A0|Q8NBS5	Frame_Shift_Del	DEL	ENST00000380230.3	37	CCDS10197.2																																																																																			.		0.577	ANKDD1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256705.2	NM_182703	
TIMP2	7077	broad.mit.edu;bcgsc.ca	37	17	76867041	76867047	+	Frame_Shift_Del	DEL	GGGGGCC	GGGGGCC	-	rs372752139		TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	GGGGGCC	GGGGGCC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr17:76867041_76867047delGGGGGCC	ENST00000262768.7	-	3	571_577	c.273_279delGGCCCCC	c.(271-279)acggcccccfs	p.TAP91fs	TIMP2_ENST00000586057.1_Frame_Shift_Del_p.TAP14fs|TIMP2_ENST00000536189.2_Frame_Shift_Del_p.TAP14fs|TIMP2_ENST00000585421.1_Frame_Shift_Del_p.TAP14fs	NM_003255.4	NP_003246.1	P16035	TIMP2_HUMAN	TIMP metallopeptidase inhibitor 2	91	NTR. {ECO:0000255|PROSITE- ProRule:PRU00295}.				aging (GO:0007568)|cellular response to organic substance (GO:0071310)|central nervous system development (GO:0007417)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of proteolysis (GO:0045861)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron differentiation (GO:0045666)|regulation of Rap protein signal transduction (GO:0032487)|response to cytokine (GO:0034097)|response to drug (GO:0042493)	basement membrane (GO:0005604)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)	enzyme activator activity (GO:0008047)|metal ion binding (GO:0046872)|metalloendopeptidase inhibitor activity (GO:0008191)	p.A92V(1)|p.S94fs*43(1)		central_nervous_system(2)	2			BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.194)			CTGCCGAGGAGGGGGCCGTGTAGATAA	0.541																																					p.91_93del													.	TIMP2-650	2	Substitution - Missense(1)|Deletion - Frameshift(1)	ovary(1)|prostate(1)	c.273_279del						.																																			SO:0001589	frameshift_variant	7077	exon3			CGAGGAGGGGGCC		CCDS11758.1	17q25	2008-07-18	2005-08-08		ENSG00000035862	ENSG00000035862			11821	protein-coding gene	gene with protein product		188825	"""tissue inhibitor of metalloproteinase 2"""			1427908	Standard	NM_003255		Approved	CSC-21K	uc002jwf.3	P16035	OTTHUMG00000154517	ENST00000262768.7:c.273_279delGGCCCCC	17.37:g.76867041_76867047delGGGGGCC	ENSP00000262768:p.Thr91fs	171	0		161	10	NM_003255	0	0	0	0	0	Q16121|Q93006|Q9UDF7	Frame_Shift_Del	DEL	ENST00000262768.7	37	CCDS11758.1																																																																																			.		0.541	TIMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335662.1	NM_003255	
ST6GAL1	6480	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	186790685	186790685	+	Frame_Shift_Del	DEL	G	G	-			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr3:186790685delG	ENST00000169298.3	+	6	1428	c.754delG	c.(754-756)ggafs	p.G252fs	ST6GAL1_ENST00000457772.2_Frame_Shift_Del_p.G21fs|ST6GAL1_ENST00000448044.1_Frame_Shift_Del_p.G252fs	NM_173216.2	NP_775323.1	P15907	SIAT1_HUMAN	ST6 beta-galactosamide alpha-2,6-sialyltranferase 1	252					cellular protein metabolic process (GO:0044267)|humoral immune response (GO:0006959)|N-acetylneuraminate metabolic process (GO:0006054)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|sialylation (GO:0097503)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	beta-galactoside alpha-2,6-sialyltransferase activity (GO:0003835)|sialyltransferase activity (GO:0008373)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	7	all_cancers(143;2.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;8.53e-19)	GBM - Glioblastoma multiforme(93;0.0939)		GTACAATGAAGGAATCCTAAT	0.433																																					p.G252fs		.											.	ST6GAL1-650	0			c.754delG						.						142.0	139.0	140.0					3																	186790685		2203	4300	6503	SO:0001589	frameshift_variant	6480	exon5			.	X62822	CCDS3285.1, CCDS46973.1	3q27-q28	2013-02-26	2003-01-14	2005-02-07	ENSG00000073849	ENSG00000073849	2.4.99.1		10860	protein-coding gene	gene with protein product	"""ST6Gal I"""	109675	"""sialyltransferase 1 (beta-galactoside alpha-2,6-sialytransferase)"""	SIAT1		2408023	Standard	NM_003032		Approved		uc003frd.3	P15907	OTTHUMG00000156500	ENST00000169298.3:c.754delG	3.37:g.186790685delG	ENSP00000169298:p.Gly252fs	145	0		142	29	NM_003032	0	0	0	0	0	A8KA14|B2R513|D3DNV3	Frame_Shift_Del	DEL	ENST00000169298.3	37	CCDS3285.1																																																																																			.		0.433	ST6GAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344399.1	NM_173216	
ITGA1	3672	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	52204750	52204750	+	Frame_Shift_Del	DEL	T	T	-			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr5:52204750delT	ENST00000282588.6	+	13	1936	c.1478delT	c.(1477-1479)attfs	p.I493fs		NM_181501.1	NP_852478.1	P56199	ITA1_HUMAN	integrin, alpha 1	493					activation of MAPK activity (GO:0000187)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cellular extravasation (GO:0045123)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle contraction (GO:0006936)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neutrophil chemotaxis (GO:0030593)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|vasodilation (GO:0042311)	acrosomal vesicle (GO:0001669)|basal part of cell (GO:0045178)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alpha1-beta1 complex (GO:0034665)|integrin complex (GO:0008305)|membrane (GO:0016020)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)|protein phosphatase binding (GO:0019903)			NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(19)|ovary(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Lung NSC(810;5.05e-05)|Breast(144;0.0851)				TTTGGCAGTATTTTAACAACA	0.383																																					p.I493fs		.											.	ITGA1-228	0			c.1478delT						.						154.0	149.0	151.0					5																	52204750		2203	4300	6503	SO:0001589	frameshift_variant	3672	exon13			.	X68742	CCDS3955.1	5q11.1	2010-03-23			ENSG00000213949	ENSG00000213949		"""CD molecules"", ""Integrins"""	6134	protein-coding gene	gene with protein product		192968				8428973, 11937138	Standard	NM_181501		Approved	VLA1, CD49a	uc003jou.3	P56199	OTTHUMG00000131163	ENST00000282588.6:c.1478delT	5.37:g.52204750delT	ENSP00000282588:p.Ile493fs	168	0		145	31	NM_181501	0	0	0	0	0	B2RNU0	Frame_Shift_Del	DEL	ENST00000282588.6	37	CCDS3955.1																																																																																			.		0.383	ITGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253855.3	NM_181501	
LARS	51520	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	145552256	145552256	+	Frame_Shift_Del	DEL	T	T	-			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr5:145552256delT	ENST00000394434.2	-	3	373	c.207delA	c.(205-207)aaafs	p.K69fs	LARS_ENST00000274562.9_Frame_Shift_Del_p.K69fs|LARS_ENST00000545646.1_Frame_Shift_Del_p.K69fs|LARS_ENST00000510191.1_Frame_Shift_Del_p.K15fs|LARS_ENST00000511505.1_5'UTR	NM_020117.9	NP_064502.9	Q9P2J5	SYLC_HUMAN	leucyl-tRNA synthetase	69					gene expression (GO:0010467)|leucyl-tRNA aminoacylation (GO:0006429)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|leucine-tRNA ligase activity (GO:0004823)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|prostate(1)|skin(2)|stomach(8)	34			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		L-Leucine(DB00149)	TTACCTCACATTTGGATAAAG	0.353																																					p.K69fs		.											.	LARS-90	0			c.207delA						.						94.0	87.0	90.0					5																	145552256		2203	4300	6503	SO:0001589	frameshift_variant	51520	exon3			.	AF151026	CCDS34265.1	5q32	2012-10-02			ENSG00000133706	ENSG00000133706	6.1.1.4	"""Aminoacyl tRNA synthetases / Class I"""	6512	protein-coding gene	gene with protein product	"""leucine tRNA ligase 1, cytoplasmic"""	151350				6933703	Standard	NM_020117		Approved	HSPC192, FLJ10595, FLJ21788, LARS1, LEUS, RNTLS	uc003lnx.1	Q9P2J5	OTTHUMG00000163429	ENST00000394434.2:c.207delA	5.37:g.145552256delT	ENSP00000377954:p.Lys69fs	48	0		62	23	NM_020117	0	0	0	0	0	A2RRR4|A7E266|B4DJ10|Q2TU79|Q9NSE1	Frame_Shift_Del	DEL	ENST00000394434.2	37	CCDS34265.1																																																																																			.		0.353	LARS-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000373367.1	NM_020117	
PRIM2	5558	broad.mit.edu;bcgsc.ca	37	6	57246849	57246850	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-AL-7173-01A-11D-2136-08	TCGA-AL-7173-10A-01D-2136-08	GG	GG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2fd86890-1842-4e9e-9100-f10814f8db6a	d279d1dd-cfd3-4527-8aaf-d880d7862c30	g.chr6:57246849_57246850GG>TT	ENST00000607273.1	+	7	663_664	c.576_577GG>TT	c.(574-579)ctGGat>ctTTat	p.D193Y	PRIM2_ENST00000389488.2_3'UTR	NM_000947.3	NP_000938.2	P49643	PRI2_HUMAN	primase, DNA, polypeptide 2 (58kDa)	193					DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	nucleoplasm (GO:0005654)|primosome complex (GO:1990077)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA primase activity (GO:0003896)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(34)|prostate(6)|stomach(4)|upper_aerodigestive_tract(1)	59				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		CTGATGCTCTGGATTTGTTTCG	0.366																																					.													.	PRIM2-227	0			.						.																																			SO:0001583	missense	5558	.			GCTCTGGATTTGT		CCDS75476.1, CCDS75477.1	6p12-p11.1	2013-01-31	2007-06-19	2007-06-19	ENSG00000146143	ENSG00000146143			9370	protein-coding gene	gene with protein product		176636	"""primase, polypeptide 2A (58kD)"", ""primase, polypeptide 2A, 58kDa"""	PRIM2A		8530050, 20675616	Standard	NM_001282487		Approved		uc003pdx.3	P49643	OTTHUMG00000016190	Exception_encountered	6.37:g.57246849_57246850delinsTT	ENSP00000475738:p.Asp193Tyr	45	0		35	9	.	0	0	0	0	0	Q53FJ8|Q6P1Q7|Q8WVL2|Q9H413	Missense_Mutation	DNP	ENST00000607273.1	37																																																																																				.		0.366	PRIM2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_000947	
