#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
DDI2	84301	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	15956933	15956933	+	Missense_Mutation	SNP	T	T	G			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr1:15956933T>G	ENST00000480945.1	+	3	553	c.382T>G	c.(382-384)Tct>Gct	p.S128A		NM_032341.4	NP_115717.3	Q5TDH0	DDI2_HUMAN	DNA-damage inducible 1 homolog 2 (S. cerevisiae)	128							aspartic-type endopeptidase activity (GO:0004190)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(2)|lung(7)|pancreas(1)|prostate(1)|stomach(1)	17		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00327)|Lung NSC(340;0.00566)|all_lung(284;0.00831)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.03e-07)|COAD - Colon adenocarcinoma(227;4.48e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00773)|READ - Rectum adenocarcinoma(331;0.0656)		AATAACTTCATCTCCTCAGGG	0.552																																					p.S128A													.	DDI2-44	0			c.T382G						.						95.0	87.0	90.0					1																	15956933		2203	4300	6503	SO:0001583	missense	84301	exon3			ACTTCATCTCCTC		CCDS30607.1	1p36.13	2010-05-04	2010-05-04		ENSG00000197312	ENSG00000197312			24578	protein-coding gene	gene with protein product			"""DDI1, DNA-damage inducible 1, homolog 2 (S. cerevisiae)"""				Standard	NM_032341		Approved	MGC14844	uc001awx.2	Q5TDH0	OTTHUMG00000002381	ENST00000480945.1:c.382T>G	1.37:g.15956933T>G	ENSP00000417748:p.Ser128Ala	116	1		129	36	NM_032341	0	0	0	0	0	A8KAE1|Q7RTZ0|Q9BRT1	Missense_Mutation	SNP	ENST00000480945.1	37	CCDS30607.1	.	.	.	.	.	.	.	.	.	.	T	14.20	2.463776	0.43736	.	.	ENSG00000197312	ENST00000480945	T	0.23348	1.91	5.67	4.53	0.55603	.	0.259165	0.39341	U	0.001400	T	0.13030	0.0316	N	0.12182	0.205	0.31118	N	0.709206	B	0.02656	0.0	B	0.01281	0.0	T	0.17776	-1.0358	10	0.08381	T	0.77	-21.6366	11.9893	0.53166	0.1297:0.0:0.0:0.8703	.	128	Q5TDH0	DDI2_HUMAN	A	128	ENSP00000417748:S128A	ENSP00000449475:S13A	S	+	1	0	DDI2	15829520	1.000000	0.71417	0.774000	0.31636	0.995000	0.86356	4.722000	0.61958	0.949000	0.37715	0.528000	0.53228	TCT	.		0.552	DDI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006826.1	NM_032341	
ZNF436	80818	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	23696043	23696043	+	5'Flank	SNP	A	A	C			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr1:23696043A>C	ENST00000314011.4	-	0	0				C1orf213_ENST00000518821.1_Intron|C1orf213_ENST00000458053.1_Intron|C1orf213_ENST00000335648.3_Silent_p.R85R|C1orf213_ENST00000437367.2_Intron|C1orf213_ENST00000454117.1_Intron|ZNF436_ENST00000374608.3_5'Flank|Y_RNA_ENST00000364535.1_RNA	NM_001077195.1	NP_001070663.1	Q9C0F3	ZN436_HUMAN	zinc finger protein 436						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	19		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;6.44e-26)|Colorectal(126;5.5e-08)|COAD - Colon adenocarcinoma(152;3.09e-06)|GBM - Glioblastoma multiforme(114;5.97e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000977)|KIRC - Kidney renal clear cell carcinoma(1967;0.00336)|STAD - Stomach adenocarcinoma(196;0.0127)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0853)|LUSC - Lung squamous cell carcinoma(448;0.187)		GGCGAAGCCCAGATATCGTAG	0.562																																					.													.	C1orf213-68	0			.						.						66.0	67.0	67.0					1																	23696043		2203	4300	6503	SO:0001631	upstream_gene_variant	148898	.			AAGCCCAGATATC	AB051497	CCDS233.1	1p36	2013-01-08			ENSG00000125945	ENSG00000125945		"""Zinc fingers, C2H2-type"", ""-"""	20814	protein-coding gene	gene with protein product		611703				11214970	Standard	NM_001077195		Approved	KIAA1710, Zfp46	uc001bgt.3	Q9C0F3	OTTHUMG00000003232		1.37:g.23696043A>C	Exception_encountered	99	1		135	36	.	0	0	0	0	0	Q658I9	RNA	SNP	ENST00000314011.4	37	CCDS233.1																																																																																			.		0.562	ZNF436-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008908.1	NM_030634	
ERICH3	127254	broad.mit.edu	37	1	75038719	75038719	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr1:75038719G>A	ENST00000326665.5	-	14	2893	c.2675C>T	c.(2674-2676)gCt>gTt	p.A892V	C1orf173_ENST00000433746.2_5'UTR	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		892	Glu-rich.									NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						CCCTTCAGAAGCTGCTTTGTC	0.498																																					p.A892V													.	C1orf173-94	0			c.C2675T						.						248.0	246.0	247.0					1																	75038719		2203	4300	6503	SO:0001583	missense	127254	exon14			TCAGAAGCTGCTT																												ENST00000326665.5:c.2675C>T	1.37:g.75038719G>A	ENSP00000322609:p.Ala892Val	94	0		132	4	NM_001002912	0	0	0	0	0	Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Missense_Mutation	SNP	ENST00000326665.5	37	CCDS30755.1	.	.	.	.	.	.	.	.	.	.	G	10.66	1.413575	0.25465	.	.	ENSG00000178965	ENST00000326665	T	0.12984	2.63	5.37	-7.67	0.01272	.	.	.	.	.	T	0.01835	0.0058	L	0.36672	1.1	0.09310	N	1	B	0.13594	0.008	B	0.14578	0.011	T	0.44605	-0.9317	9	0.22109	T	0.4	-0.0472	0.526	0.00620	0.2864:0.2006:0.3108:0.2021	.	892	Q5RHP9	CA173_HUMAN	V	892	ENSP00000322609:A892V	ENSP00000322609:A892V	A	-	2	0	C1orf173	74811307	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-1.399000	0.02506	-1.229000	0.02564	0.563000	0.77884	GCT	.		0.498	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026516.1		
FUBP1	8880	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	78414969	78414969	+	Silent	SNP	A	A	G			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr1:78414969A>G	ENST00000370768.2	-	19	1878	c.1797T>C	c.(1795-1797)gcT>gcC	p.A599A	FUBP1_ENST00000370767.1_Silent_p.A599A|FUBP1_ENST00000436586.2_Silent_p.A620A|FUBP1_ENST00000489495.1_5'Flank	NM_003902.3	NP_003893.2	Q96AE4	FUBP1_HUMAN	far upstream element (FUSE) binding protein 1	599					positive regulation of gene expression (GO:0010628)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)			central_nervous_system(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(1)|upper_aerodigestive_tract(3)	17						CCCCAGTCGGAGCAGGAACTG	0.448			"""F, N"""		oligodendroglioma																																p.A599A		.		Rec	yes		1	1p13.1	8880	far upstream element (FUSE) binding protein 1		O	.	FUBP1-227	0			c.T1797C						.						64.0	69.0	67.0					1																	78414969		2203	4300	6503	SO:0001819	synonymous_variant	8880	exon19			AGTCGGAGCAGGA	U05040	CCDS683.1	1p31.1	2008-02-05			ENSG00000162613	ENSG00000162613			4004	protein-coding gene	gene with protein product		603444		FUBP		8125259	Standard	XM_005271309		Approved	FBP	uc001dii.3	Q96AE4	OTTHUMG00000040799	ENST00000370768.2:c.1797T>C	1.37:g.78414969A>G		64	0		69	14	NM_003902	0	0	5	26	21	Q12828	Silent	SNP	ENST00000370768.2	37	CCDS683.1																																																																																			.		0.448	FUBP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098030.3	NM_003902	
LRRC8C	84230	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	90179188	90179188	+	Silent	SNP	T	T	C			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr1:90179188T>C	ENST00000370454.4	+	3	1314	c.1059T>C	c.(1057-1059)taT>taC	p.Y353Y	RP11-302M6.4_ENST00000370453.5_Intron|LRRC8C_ENST00000479252.1_Intron	NM_032270.4	NP_115646	Q8TDW0	LRC8C_HUMAN	leucine rich repeat containing 8 family, member C	353					fat cell differentiation (GO:0045444)|ion transport (GO:0006811)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|large_intestine(5)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	28		all_lung(203;0.126)		all cancers(265;0.00756)|Epithelial(280;0.0313)		CCTTTGAGTATGTCCGTCAGG	0.388																																					p.Y353Y		.											.	LRRC8C-97	0			c.T1059C						.						54.0	50.0	51.0					1																	90179188		2203	4299	6502	SO:0001819	synonymous_variant	84230	exon3			TGAGTATGTCCGT		CCDS725.1	1p22.2	2011-02-10			ENSG00000171488	ENSG00000171488			25075	protein-coding gene	gene with protein product	"""hypothetical protein AD158"""	612889				11230166	Standard	NM_032270		Approved	AD158	uc001dnl.4	Q8TDW0	OTTHUMG00000010305	ENST00000370454.4:c.1059T>C	1.37:g.90179188T>C		142	0		146	36	NM_032270	0	0	0	0	0	B3KXS9|Q29RV6|Q9H075	Silent	SNP	ENST00000370454.4	37	CCDS725.1																																																																																			.		0.388	LRRC8C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028435.2	NM_032270	
LY9	4063	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	160786562	160786562	+	Missense_Mutation	SNP	A	A	C			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr1:160786562A>C	ENST00000263285.6	+	5	1281	c.1251A>C	c.(1249-1251)agA>agC	p.R417S	LY9_ENST00000368041.2_Intron|LY9_ENST00000392203.4_Intron|LY9_ENST00000341032.4_Intron|LY9_ENST00000368037.5_Missense_Mutation_p.R417S|LY9_ENST00000368040.1_Missense_Mutation_p.R69S			Q9HBG7	LY9_HUMAN	lymphocyte antigen 9	417	Ig-like C2-type 2.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			autonomic_ganglia(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36	all_cancers(52;2.72e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			TCTCATGGAGAAGCAGTGAAA	0.527																																					p.R417S													.	LY9-91	0			c.A1251C						.						159.0	138.0	145.0					1																	160786562		2203	4300	6503	SO:0001583	missense	4063	exon5			ATGGAGAAGCAGT	L42621	CCDS30916.1, CCDS30917.1, CCDS65695.1, CCDS65696.1	1q23.3	2013-01-11			ENSG00000122224	ENSG00000122224		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6730	protein-coding gene	gene with protein product		600684				8537117, 7797269	Standard	NM_001261457		Approved	CD229, mLY9, SLAMF3, hly9	uc001fwu.4	Q9HBG7	OTTHUMG00000024007	ENST00000263285.6:c.1251A>C	1.37:g.160786562A>C	ENSP00000263285:p.Arg417Ser	246	1		233	59	NM_001261456	0	0	1	1	0	A8K7N3|Q14775|Q5VYI3|Q6P2J4|Q9H4N5|Q9NQ24	Missense_Mutation	SNP	ENST00000263285.6	37	CCDS30916.1	.	.	.	.	.	.	.	.	.	.	A	10.24	1.295086	0.23564	.	.	ENSG00000122224	ENST00000368041;ENST00000368040;ENST00000263285;ENST00000368037;ENST00000368035	T;T;T	0.37235	1.21;1.21;1.21	4.75	-0.968	0.10313	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.07818	0.0196	L	0.41573	1.285	0.09310	N	1	B;B;B	0.22909	0.024;0.063;0.077	B;B;B	0.25405	0.06;0.022;0.038	T	0.37979	-0.9682	9	0.14252	T	0.57	-1.3404	2.8809	0.05647	0.461:0.0:0.1909:0.3481	.	69;417;417	Q5VYI1;Q9HBG7-2;Q9HBG7	.;.;LY9_HUMAN	S	417;69;417;377;69	ENSP00000357019:R69S;ENSP00000263285:R417S;ENSP00000357014:R69S	ENSP00000263285:R417S	R	+	3	2	LY9	159053186	0.000000	0.05858	0.003000	0.11579	0.128000	0.20619	0.088000	0.14979	-0.120000	0.11809	0.455000	0.32223	AGA	.		0.527	LY9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060457.3	NM_002348	
SLC19A2	10560	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	169446750	169446750	+	Silent	SNP	G	G	A			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr1:169446750G>A	ENST00000236137.5	-	2	686	c.450C>T	c.(448-450)gaC>gaT	p.D150D	SLC19A2_ENST00000367804.4_Intron	NM_006996.2	NP_008927.1	O60779	S19A2_HUMAN	solute carrier family 19 (thiamine transporter), member 2	150					folic acid transport (GO:0015884)|small molecule metabolic process (GO:0044281)|thiamine transport (GO:0015888)|thiamine-containing compound metabolic process (GO:0042723)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	folic acid transporter activity (GO:0008517)|thiamine transmembrane transporter activity (GO:0015234)|thiamine uptake transmembrane transporter activity (GO:0015403)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|upper_aerodigestive_tract(1)	11	all_hematologic(923;0.208)				Thiamine(DB00152)	ACATGCCCAGGTCCACCACAC	0.478																																					p.D150D		.											.	SLC19A2-90	0			c.C450T						.						93.0	96.0	95.0					1																	169446750		2203	4300	6503	SO:0001819	synonymous_variant	10560	exon2			GCCCAGGTCCACC	AF135488	CCDS1280.1	1q23.3	2013-05-22			ENSG00000117479	ENSG00000117479		"""Solute carriers"""	10938	protein-coding gene	gene with protein product		603941		TRMA		9399900, 10391221	Standard	NM_006996		Approved	THTR1	uc001gge.4	O60779	OTTHUMG00000035452	ENST00000236137.5:c.450C>T	1.37:g.169446750G>A		179	0		176	52	NM_006996	0	0	0	0	0	B2R9H0|B4E1X4|Q8WV87|Q9UBL7|Q9UKJ2|Q9UN31|Q9UN43	Silent	SNP	ENST00000236137.5	37	CCDS1280.1																																																																																			.		0.478	SLC19A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086106.1	NM_006996	
CACNA1E	777	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	181701628	181701628	+	Silent	SNP	G	G	A			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr1:181701628G>A	ENST00000367573.2	+	20	2406	c.2406G>A	c.(2404-2406)gcG>gcA	p.A802A	CACNA1E_ENST00000367570.1_Silent_p.A802A|CACNA1E_ENST00000360108.3_Silent_p.A783A|CACNA1E_ENST00000358338.5_Silent_p.A734A|CACNA1E_ENST00000526775.1_Silent_p.A783A|CACNA1E_ENST00000367567.4_Silent_p.A409A|CACNA1E_ENST00000357570.5_Silent_p.A753A	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	802					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						GAGAGGAGGCGCCGACCATGa	0.657																																					p.A802A		.											.	CACNA1E-95	0			c.G2406A						.						39.0	57.0	51.0					1																	181701628		1759	3301	5060	SO:0001819	synonymous_variant	777	exon20			GGAGGCGCCGACC	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.2406G>A	1.37:g.181701628G>A		328	0		380	44	NM_001205293	0	0	0	0	0	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Silent	SNP	ENST00000367573.2	37	CCDS55664.1																																																																																			.		0.657	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721	
ADCK3	56997	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	227172964	227172964	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr1:227172964G>A	ENST00000366779.1	+	19	4353	c.1582G>A	c.(1582-1584)Gct>Act	p.A528T	ADCK3_ENST00000478406.1_3'UTR|ADCK3_ENST00000366778.1_Missense_Mutation_p.A476T|ADCK3_ENST00000366777.3_Missense_Mutation_p.A528T|ADCK3_ENST00000433743.2_Missense_Mutation_p.A202T|ADCK3_ENST00000458507.2_Missense_Mutation_p.A249T			Q8NI60	ADCK3_HUMAN	aarF domain containing kinase 3	528					cell death (GO:0008219)|ubiquinone biosynthetic process (GO:0006744)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|kidney(2)|large_intestine(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	9						GATCATCAGGGCTGCTGCCGA	0.632																																					p.A528T		.											.	ADCK3-361	0			c.G1582A						.						119.0	116.0	117.0					1																	227172964		2203	4300	6503	SO:0001583	missense	56997	exon14			ATCAGGGCTGCTG	AJ278126	CCDS1557.1	1q42.11	2011-05-03	2010-10-01	2010-10-01	ENSG00000163050	ENSG00000163050			16812	protein-coding gene	gene with protein product	"""coenzyme Q8 homolog (yeast)"""	606980	"""chaperone-ABC1 (activity of bc1 complex, S.pombe)-like"", ""chaperone, ABC1 activity of bc1 complex like (S. pombe)"", ""chaperone, ABC1 activity of bc1 complex homolog (S. pombe)"""	CABC1			Standard	NM_020247		Approved	COQ8, SCAR9	uc001hqn.1	Q8NI60	OTTHUMG00000037621	ENST00000366779.1:c.1582G>A	1.37:g.227172964G>A	ENSP00000355741:p.Ala528Thr	62	0		62	17	NM_020247	0	0	0	0	0	Q5T7A5|Q63HK0|Q8NCJ6|Q9HBQ1|Q9NQ67	Missense_Mutation	SNP	ENST00000366779.1	37	CCDS1557.1	.	.	.	.	.	.	.	.	.	.	G	29.3	4.998025	0.93227	.	.	ENSG00000163050	ENST00000366779;ENST00000366778;ENST00000366777;ENST00000366776;ENST00000458507;ENST00000366775;ENST00000405743;ENST00000433743	T;T;T;T;T;T;T	0.61510	0.1;0.1;0.1;0.1;0.1;0.1;0.1	5.69	5.69	0.88448	.	0.105243	0.64402	D	0.000005	D	0.82554	0.5062	H	0.94847	3.59	0.58432	D	0.999995	D;D	0.64830	0.982;0.994	P;D	0.63033	0.796;0.91	D	0.87070	0.2159	10	0.87932	D	0	-11.9896	19.815	0.96564	0.0:0.0:1.0:0.0	.	202;528	E7EVZ8;Q8NI60	.;ADCK3_HUMAN	T	528;476;528;453;249;373;479;202	ENSP00000355741:A528T;ENSP00000355740:A476T;ENSP00000355739:A528T;ENSP00000355738:A453T;ENSP00000403704:A249T;ENSP00000355737:A373T;ENSP00000404550:A202T	ENSP00000355737:A373T	A	+	1	0	ADCK3	225239587	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	3.953000	0.56699	2.681000	0.91329	0.561000	0.74099	GCT	.		0.632	ADCK3-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091712.1	NM_020247	
FMN2	56776	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	240370577	240370577	+	Missense_Mutation	SNP	A	A	T			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr1:240370577A>T	ENST00000319653.9	+	5	2695	c.2465A>T	c.(2464-2466)cAa>cTa	p.Q822L		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	822	FH1.|Pro-rich.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			TCTGCTGGGCAAGGACAGCCT	0.537																																					p.Q822L		.											.	FMN2-145	0			c.A2465T						.						74.0	71.0	72.0					1																	240370577		2203	4300	6503	SO:0001583	missense	56776	exon5			CTGGGCAAGGACA	AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.2465A>T	1.37:g.240370577A>T	ENSP00000318884:p.Gln822Leu	128	0		121	32	NM_020066	0	0	0	0	0	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	ENST00000319653.9	37	CCDS31069.2	.	.	.	.	.	.	.	.	.	.	A	7.760	0.705185	0.15172	.	.	ENSG00000155816	ENST00000319653	T	0.31510	1.49	4.09	4.09	0.47781	Actin-binding FH2/DRF autoregulatory (1);	0.425372	0.19864	N	0.104352	T	0.30823	0.0777	L	0.57536	1.79	0.80722	D	1	B	0.30482	0.281	B	0.32533	0.147	T	0.07849	-1.0751	9	.	.	.	.	12.1017	0.53788	1.0:0.0:0.0:0.0	.	822	Q9NZ56	FMN2_HUMAN	L	822	ENSP00000318884:Q822L	.	Q	+	2	0	FMN2	238437200	0.247000	0.23920	0.447000	0.26932	0.071000	0.16799	1.728000	0.38105	1.842000	0.53543	0.454000	0.30748	CAA	.		0.537	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2	XM_371352	
CSGALNACT2	55454	broad.mit.edu	37	10	43659419	43659419	+	Missense_Mutation	SNP	G	G	T	rs79064394		TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr10:43659419G>T	ENST00000374466.3	+	5	1421	c.1086G>T	c.(1084-1086)ttG>ttT	p.L362F		NM_018590.3	NP_061060.3	Q8N6G5	CGAT2_HUMAN	chondroitin sulfate N-acetylgalactosaminyltransferase 2	362					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|chondroitin sulfate proteoglycan biosynthetic process (GO:0050650)|chondroitin sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050653)|dermatan sulfate proteoglycan biosynthetic process (GO:0050651)|dermatan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050652)|glycosaminoglycan metabolic process (GO:0030203)|proteoglycan biosynthetic process (GO:0030166)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)	acetylgalactosaminyltransferase activity (GO:0008376)|glucuronylgalactosylproteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047237)|metal ion binding (GO:0046872)	p.L362F(5)		endometrium(12)|kidney(3)|large_intestine(5)|lung(16)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						GAGAGGTCTTGATGTTTTTCT	0.433																																					p.L362F													.	CSGALNACT2-69	5	Substitution - Missense(5)	endometrium(4)|kidney(1)	c.G1086T						.						223.0	221.0	222.0					10																	43659419		2203	4300	6503	SO:0001583	missense	55454	exon5			GGTCTTGATGTTT	AF116646	CCDS7201.1	10q11.21	2013-02-19			ENSG00000169826	ENSG00000169826		"""Beta 4-glycosyltransferases"""	24292	protein-coding gene	gene with protein product	"""chondroitin beta1,4 N-acetylgalactosaminyltransferase 2"""					12446672	Standard	NM_018590		Approved	GALNACT2, MGC40204, PRO0082, GALNACT-2	uc001jan.4	Q8N6G5	OTTHUMG00000018023	ENST00000374466.3:c.1086G>T	10.37:g.43659419G>T	ENSP00000363590:p.Leu362Phe	166	0		173	6	NM_018590	0	0	3	3	0	B3KWL7|Q6MZJ5|Q6MZP6|Q8TCH4|Q9P1I6	Missense_Mutation	SNP	ENST00000374466.3	37	CCDS7201.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.499782	0.85176	.	.	ENSG00000169826	ENST00000374466	T	0.27256	1.68	6.08	5.17	0.71159	.	0.064535	0.64402	D	0.000004	T	0.57359	0.2048	M	0.89095	3.005	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.63721	-0.6573	10	0.87932	D	0	-11.7375	14.8306	0.70146	0.0683:0.0:0.9317:0.0	.	362	Q8N6G5	CGAT2_HUMAN	F	362	ENSP00000363590:L362F	ENSP00000363590:L362F	L	+	3	2	CSGALNACT2	42979425	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.683000	0.37638	2.894000	0.99253	0.591000	0.81541	TTG	.		0.433	CSGALNACT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047693.1	NM_018590	
NOLC1	9221	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	103917872	103917872	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr10:103917872G>A	ENST00000605788.1	+	5	743	c.508G>A	c.(508-510)Gat>Aat	p.D170N	NOLC1_ENST00000405356.1_Missense_Mutation_p.D170N|NOLC1_ENST00000488254.2_Missense_Mutation_p.D171N|NOLC1_ENST00000603742.1_5'UTR	NM_001284389.1|NM_004741.3	NP_001271318.1|NP_004732.2	Q14978	NOLC1_HUMAN	nucleolar and coiled-body phosphoprotein 1	170	11 X 12 AA approximate repeats of an acidic serine cluster.				cell cycle (GO:0007049)|mitotic nuclear division (GO:0007067)|nucleolus organization (GO:0007000)|rRNA processing (GO:0006364)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	31		Colorectal(252;0.122)		Epithelial(162;5.19e-08)|all cancers(201;9.43e-07)		CTCTGATTCTGATTCTGACTC	0.488																																					p.D170N		.											.	NOLC1-91	0			c.G508A						.						88.0	90.0	89.0					10																	103917872		2203	4300	6503	SO:0001583	missense	9221	exon5			GATTCTGATTCTG	Z34289	CCDS7530.1, CCDS65925.1, CCDS65926.1	10q24.32	2008-08-01			ENSG00000166197	ENSG00000166197			15608	protein-coding gene	gene with protein product		602394				7657714, 10567578	Standard	XM_005270273		Approved	P130, KIAA0035, NOPP140, NOPP130	uc001kuo.2	Q14978	OTTHUMG00000018944	ENST00000605788.1:c.508G>A	10.37:g.103917872G>A	ENSP00000474710:p.Asp170Asn	162	0		193	35	NM_004741	0	0	4	6	2	Q15030|Q5VV70|Q9BUV3	Missense_Mutation	SNP	ENST00000605788.1	37	CCDS7530.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.948000	0.73787	.	.	ENSG00000166197	ENST00000405356;ENST00000370007	T	0.52057	0.68	5.72	5.72	0.89469	.	0.256859	0.33834	N	0.004509	T	0.68796	0.3040	M	0.77313	2.365	0.80722	D	1	D;D;D	0.63046	0.992;0.992;0.986	P;P;P	0.61592	0.891;0.891;0.78	T	0.71341	-0.4622	10	0.66056	D	0.02	-7.6697	18.8652	0.92289	0.0:0.0:1.0:0.0	.	171;170;170	Q14978-3;Q14978-2;Q14978	.;.;NOLC1_HUMAN	N	170	ENSP00000385410:D170N	ENSP00000359024:D170N	D	+	1	0	NOLC1	103907862	1.000000	0.71417	0.959000	0.39883	0.796000	0.44982	6.775000	0.75018	2.709000	0.92574	0.561000	0.74099	GAT	.		0.488	NOLC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000050012.2	NM_004741	
MUC2	4583	bcgsc.ca	37	11	1093346	1093346	+	Missense_Mutation	SNP	C	C	T	rs371050870		TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr11:1093346C>T	ENST00000441003.2	+	30	5192	c.5165C>T	c.(5164-5166)aCa>aTa	p.T1722I	MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_Missense_Mutation_p.T10I|MUC2_ENST00000359061.5_Missense_Mutation_p.T1689I	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	ccaaccccgacacccatctcc	0.642																																					p.T1722I													.	MUC2-90	0			c.C5165T						.	C	ILE/THR	18,3940		0,18,1961	232.0	270.0	257.0		5162	1.4	0.0	11		257	110,7416		0,110,3653	no	missense	MUC2	NM_002457.2	89	0,128,5614	TT,TC,CC		1.4616,0.4548,1.1146	possibly-damaging	1721/2813	1093346	128,11356	1979	3763	5742	SO:0001583	missense	4583	exon30			CCCCGACACCCAT	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5165C>T	11.37:g.1093346C>T	ENSP00000415183:p.Thr1722Ile	191	4		298	15	NM_002457	0	0	0	0	0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	7.653	0.683278	0.14907	0.004548	0.014616	ENSG00000198788	ENST00000441003;ENST00000359061;ENST00000333592	T;T;T	0.11063	2.91;2.81;2.82	1.4	1.4	0.22301	.	0.000000	0.34959	U	0.003560	T	0.04497	0.0123	.	.	.	0.09310	N	1	P	0.34699	0.464	B	0.24269	0.052	T	0.30794	-0.9966	9	0.72032	D	0.01	.	8.2676	0.31824	0.0:1.0:0.0:0.0	.	1722	E7EUV1	.	I	1722;1689;10	ENSP00000415183:T1722I;ENSP00000351956:T1689I;ENSP00000331373:T10I	ENSP00000331373:T10I	T	+	2	0	MUC2	1083346	0.000000	0.05858	0.001000	0.08648	0.014000	0.08584	0.331000	0.19733	0.729000	0.32403	0.195000	0.17529	ACA	.		0.642	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
CNGA4	1262	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	6261868	6261868	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr11:6261868G>C	ENST00000379936.2	+	4	959	c.844G>C	c.(844-846)Gat>Cat	p.D282H	CNGA4_ENST00000533426.1_Splice_Site	NM_001037329.3	NP_001032406.1	Q8IV77	CNGA4_HUMAN	cyclic nucleotide gated channel alpha 4	282					phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sensory perception of smell (GO:0007608)	integral component of plasma membrane (GO:0005887)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)			endometrium(2)|kidney(1)|large_intestine(9)|lung(24)|prostate(3)|skin(1)	40		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;2.04e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TTTCTACCCAGATCATGCACT	0.552																																					p.D282H													.	CNGA4-91	0			c.G844C						.						100.0	89.0	93.0					11																	6261868		2201	4296	6497	SO:0001583	missense	1262	exon4			TACCCAGATCATG	AK122736	CCDS31408.1	11p15.4	2011-07-05		2002-01-18		ENSG00000132259		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2152	protein-coding gene	gene with protein product		609472	"""cyclic nucleotide gated channel beta 2"""	CNCA2, CNGB2		11764791, 16382102	Standard	NM_001037329		Approved	OCNC2, OCNCb, CNG5	uc001mco.3	Q8IV77		ENST00000379936.2:c.844G>C	11.37:g.6261868G>C	ENSP00000369268:p.Asp282His	187	0		292	49	NM_001037329	0	0	0	0	0		Missense_Mutation	SNP	ENST00000379936.2	37	CCDS31408.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.83|14.83	2.653921|2.653921	0.47362|0.47362	.|.	.|.	ENSG00000132259|ENSG00000132259	ENST00000533426|ENST00000379936	.|D	.|0.96716	.|-4.1	5.3|5.3	4.39|4.39	0.52855|0.52855	.|Cyclic nucleotide-binding-like (1);	.|0.138507	.|0.64402	.|D	.|0.000004	.|D	.|0.92084	.|0.7491	N|N	0.25647|0.25647	0.755|0.755	0.40621|0.40621	D|D	0.981768|0.981768	.|B;B	.|0.21147	.|0.044;0.052	.|B;B	.|0.25884	.|0.008;0.064	.|D	.|0.89286	.|0.3615	.|10	.|0.66056	.|D	.|0.02	.|.	9.3632|9.3632	0.38208|0.38208	0.1652:0.0:0.8348:0.0|0.1652:0.0:0.8348:0.0	.|.	.|282;242	.|Q8IV77;Q8IV77-2	.|CNGA4_HUMAN;.	.|H	-1|282	.|ENSP00000369268:D282H	.|ENSP00000369268:D282H	.|D	+|+	.|1	.|0	CNGA4|CNGA4	6218444|6218444	0.664000|0.664000	0.27457|0.27457	0.997000|0.997000	0.53966|0.53966	0.939000|0.939000	0.58152|0.58152	1.232000|1.232000	0.32636|0.32636	1.376000|1.376000	0.46267|0.46267	0.561000|0.561000	0.74099|0.74099	.|GAT	.		0.552	CNGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383765.2	NM_001037329	
OR2AG2	338755	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	6789370	6789370	+	Silent	SNP	G	G	T			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr11:6789370G>T	ENST00000338569.2	-	1	916	c.819C>A	c.(817-819)atC>atA	p.I273I		NM_001004490.1	NP_001004490.1	A6NM03	O2AG2_HUMAN	olfactory receptor, family 2, subfamily AG, member 2	273						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(13)|ovary(1)|skin(5)|stomach(1)|urinary_tract(1)	28		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)		Epithelial(150;2.15e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		AAACAGAGATGATGTTGTCTT	0.512																																					p.I273I		.											.	OR2AG2-71	0			c.C819A						.						151.0	138.0	142.0					11																	6789370		2201	4296	6497	SO:0001819	synonymous_variant	338755	exon1			AGAGATGATGTTG	AB065539	CCDS31413.1	11p15.4	2012-08-09		2004-03-10	ENSG00000188124	ENSG00000188124		"""GPCR / Class A : Olfactory receptors"""	15143	protein-coding gene	gene with protein product				OR2AG2P			Standard	NM_001004490		Approved		uc001meq.1	A6NM03	OTTHUMG00000165868	ENST00000338569.2:c.819C>A	11.37:g.6789370G>T		332	0		456	86	NM_001004490	0	0	0	0	0		Silent	SNP	ENST00000338569.2	37	CCDS31413.1																																																																																			.		0.512	OR2AG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386775.1	NM_001004490	
RBM14	10432	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	66384484	66384484	+	Missense_Mutation	SNP	T	T	C			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr11:66384484T>C	ENST00000310137.4	+	1	432	c.293T>C	c.(292-294)cTc>cCc	p.L98P	RBM4_ENST00000514361.3_Missense_Mutation_p.L98P|RBM4_ENST00000503028.2_5'UTR|RBM14_ENST00000443702.1_Missense_Mutation_p.L98P|RBM14_ENST00000409738.4_Missense_Mutation_p.L98P|RNU4-39P_ENST00000362455.1_RNA|RBM14-RBM4_ENST00000412278.2_Missense_Mutation_p.L98P|RBM14_ENST00000393979.3_Missense_Mutation_p.L98P|RBM14-RBM4_ENST00000500635.2_Missense_Mutation_p.L98P|RBM14_ENST00000409372.1_Missense_Mutation_p.L98P|RBM14-RBM4_ENST00000511114.1_3'UTR	NM_006328.3	NP_006319.1	Q96PK6	RBM14_HUMAN	RNA binding motif protein 14	98	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|glucocorticoid receptor signaling pathway (GO:0042921)|histone deacetylation (GO:0016575)|intracellular estrogen receptor signaling pathway (GO:0030520)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to hormone (GO:0009725)|transcription from RNA polymerase II promoter (GO:0006366)	mediator complex (GO:0016592)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor complex (GO:0005667)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)		RBM14/PACS1(2)	breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	17						CTGCGCAGCCTCTTCGAGCGC	0.647																																					p.L98P		.											.	RBM14-92	0			c.T293C						.						52.0	62.0	59.0					11																	66384484		2141	4173	6314	SO:0001583	missense	10432	exon1			GCAGCCTCTTCGA	AF080561	CCDS8147.1, CCDS55772.1, CCDS55773.1	11q13.2	2013-02-12			ENSG00000239306	ENSG00000239306		"""RNA binding motif (RRM) containing"""	14219	protein-coding gene	gene with protein product	"""coactivator activator"", ""SYT interacting protein"""	612409				9285794	Standard	NM_006328		Approved	SIP, SYTIP1, COAA, DKFZp779J0927	uc001oit.3	Q96PK6	OTTHUMG00000140380	ENST00000310137.4:c.293T>C	11.37:g.66384484T>C	ENSP00000311747:p.Leu98Pro	63	0		67	8	NM_001198837	0	0	2	3	1	B0LM41|B3KMN4|D6RGD8|O75932|Q2PYN1|Q53GV1|Q68DQ9|Q96PK5	Missense_Mutation	SNP	ENST00000310137.4	37	CCDS8147.1	.	.	.	.	.	.	.	.	.	.	T	19.10	3.761857	0.69763	.	.	ENSG00000239306;ENSG00000239306;ENSG00000239306;ENSG00000239306;ENSG00000239306;ENSG00000248643;ENSG00000248643	ENST00000310137;ENST00000393979;ENST00000409372;ENST00000443702;ENST00000409738;ENST00000412278;ENST00000500635	T;T;T;T;T;T;T	0.23754	1.89;1.89;1.89;1.89;1.89;1.89;1.89	5.19	4.01	0.46588	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.257070	0.27811	N	0.017747	T	0.58977	0.2160	H	0.94808	3.585	0.80722	D	1	D;D;D;B	0.89917	1.0;0.999;0.995;0.213	D;D;D;B	0.87578	0.998;0.964;0.974;0.398	T	0.68002	-0.5524	10	0.59425	D	0.04	-4.9687	10.4857	0.44719	0.0:0.0:0.1621:0.8379	.	98;98;98;98	B0LM41;Q96PK6-2;Q2PYN1;Q96PK6	.;.;.;RBM14_HUMAN	P	98	ENSP00000311747:L98P;ENSP00000377548:L98P;ENSP00000386518:L98P;ENSP00000414650:L98P;ENSP00000386995:L98P;ENSP00000388552:L98P;ENSP00000421279:L98P	ENSP00000311747:L98P	L	+	2	0	RBM14;RBM14-RBM4	66141060	0.914000	0.31030	1.000000	0.80357	0.966000	0.64601	1.791000	0.38744	1.971000	0.57363	0.459000	0.35465	CTC	.		0.647	RBM14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277128.1	NM_006328	
FGF3	2248	broad.mit.edu;bcgsc.ca	37	11	69625251	69625251	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr11:69625251C>T	ENST00000334134.2	-	3	632	c.542G>A	c.(541-543)cGc>cAc	p.R181H		NM_005247.2	NP_005238.1	P11487	FGF3_HUMAN	fibroblast growth factor 3	181					anatomical structure morphogenesis (GO:0009653)|cell-cell signaling (GO:0007267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of cardiac muscle tissue development (GO:0055026)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ induction (GO:0001759)|otic vesicle formation (GO:0030916)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|post-anal tail morphogenesis (GO:0036342)|semicircular canal morphogenesis (GO:0048752)|signal transduction (GO:0007165)|thymus development (GO:0048538)	extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)	growth factor activity (GO:0008083)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|urinary_tract(1)	13			LUSC - Lung squamous cell carcinoma(11;5.05e-15)|STAD - Stomach adenocarcinoma(18;0.0278)			GTCCAGCACGCGGGGCAGGAA	0.687																																					p.R181H													.	FGF3-847	0			c.G542A						.						22.0	24.0	23.0					11																	69625251		2190	4268	6458	SO:0001583	missense	2248	exon3			AGCACGCGGGGCA		CCDS8195.1	11q13	2010-06-25	2010-06-25		ENSG00000186895	ENSG00000186895			3681	protein-coding gene	gene with protein product	"""INT-2 proto-oncogene protein"", ""oncogene INT2"", ""V-INT2 murine mammary tumor virus integration site oncogene homolog"", ""murine mammary tumor virus integration site 2, mouse"""	164950	"""fibroblast growth factor 3 (murine mammary tumor virus integration site (v-int-2) oncogene homolog)"""	INT2			Standard	NM_005247		Approved	HBGF-3	uc001oph.3	P11487	OTTHUMG00000167888	ENST00000334134.2:c.542G>A	11.37:g.69625251C>T	ENSP00000334122:p.Arg181His	71	1		110	6	NM_005247	0	0	0	0	0	Q0VG69	Missense_Mutation	SNP	ENST00000334134.2	37	CCDS8195.1	.	.	.	.	.	.	.	.	.	.	C	27.6	4.849693	0.91277	.	.	ENSG00000186895	ENST00000334134	T	0.69435	-0.4	4.01	4.01	0.46588	.	0.055897	0.64402	D	0.000002	T	0.73713	0.3622	L	0.36672	1.1	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.73244	-0.4044	9	.	.	.	.	16.1475	0.81580	0.0:1.0:0.0:0.0	.	181	P11487	FGF3_HUMAN	H	181	ENSP00000334122:R181H	.	R	-	2	0	FGF3	69334432	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	5.414000	0.66405	1.763000	0.52060	0.462000	0.41574	CGC	C|1.000;T|0.000		0.687	FGF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396835.1	NM_005247	
AQP11	282679	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	77301546	77301546	+	Missense_Mutation	SNP	A	A	G			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr11:77301546A>G	ENST00000313578.3	+	1	867	c.509A>G	c.(508-510)gAg>gGg	p.E170G	AQP11_ENST00000528638.1_Intron	NM_173039.2	NP_766627.1	Q8NBQ7	AQP11_HUMAN	aquaporin 11	170					endosomal lumen acidification (GO:0048388)|protein homooligomerization (GO:0051260)|proximal tubule development (GO:0072014)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cell surface (GO:0009986)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			kidney(2)|large_intestine(1)|lung(5)	8	all_cancers(14;1.75e-17)|all_epithelial(13;4.7e-20)|Ovarian(111;0.249)		Epithelial(5;4.73e-49)|BRCA - Breast invasive adenocarcinoma(5;1.4e-30)			GTCATCACAGAGGCCGTCTGC	0.557																																					p.E170G													.	AQP11-90	0			c.A509G						.						119.0	115.0	117.0					11																	77301546		2200	4292	6492	SO:0001583	missense	282679	exon1			TCACAGAGGCCGT	AB028147	CCDS8251.1	11q13.5	2008-02-05			ENSG00000178301	ENSG00000178301		"""Ion channels / Aquaporins"""	19940	protein-coding gene	gene with protein product		609914				16107722	Standard	NM_173039		Approved		uc001oyj.3	Q8NBQ7	OTTHUMG00000165194	ENST00000313578.3:c.509A>G	11.37:g.77301546A>G	ENSP00000318770:p.Glu170Gly	155	1		197	39	NM_173039	0	0	0	1	1		Missense_Mutation	SNP	ENST00000313578.3	37	CCDS8251.1	.	.	.	.	.	.	.	.	.	.	A	24.9	4.576863	0.86645	.	.	ENSG00000178301	ENST00000313578	T	0.70399	-0.48	5.54	5.54	0.83059	Aquaporin-like (2);	0.000000	0.85682	D	0.000000	D	0.84737	0.5538	M	0.81497	2.545	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87033	0.2136	10	0.87932	D	0	-14.4732	15.6787	0.77349	1.0:0.0:0.0:0.0	.	170	Q8NBQ7	AQP11_HUMAN	G	170	ENSP00000318770:E170G	ENSP00000318770:E170G	E	+	2	0	AQP11	76979194	1.000000	0.71417	0.812000	0.32479	0.716000	0.41182	7.467000	0.80930	2.107000	0.64212	0.402000	0.26972	GAG	.		0.557	AQP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382582.1	NM_173039	
KIAA1377	57562	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	101832493	101832493	+	Missense_Mutation	SNP	C	C	G			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr11:101832493C>G	ENST00000263468.8	+	6	997	c.727C>G	c.(727-729)Cag>Gag	p.Q243E	KIAA1377_ENST00000537689.1_Missense_Mutation_p.Q44E	NM_020802.2	NP_065853.2	Q9P2H0	K1377_HUMAN	KIAA1377	243										breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(18)|ovary(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	53	all_epithelial(12;0.0104)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00931)		BRCA - Breast invasive adenocarcinoma(274;0.038)		TGAAGTTAATCAGATAACCAA	0.313																																					p.Q243E		.											.	KIAA1377-136	0			c.C727G						.						39.0	42.0	41.0					11																	101832493		2199	4295	6494	SO:0001583	missense	57562	exon6			GTTAATCAGATAA	AK095004	CCDS31658.1	11q22.2	2006-02-03			ENSG00000110318	ENSG00000110318			29264	protein-coding gene	gene with protein product		614634				10718198	Standard	XM_005271627		Approved		uc001pgm.3	Q9P2H0	OTTHUMG00000167319	ENST00000263468.8:c.727C>G	11.37:g.101832493C>G	ENSP00000263468:p.Gln243Glu	57	0		73	14	NM_020802	0	0	0	0	0	Q4G0U6	Missense_Mutation	SNP	ENST00000263468.8	37	CCDS31658.1	.	.	.	.	.	.	.	.	.	.	C	10.77	1.444976	0.25987	.	.	ENSG00000110318	ENST00000263468;ENST00000537689	T;T	0.07908	3.15;3.15	5.51	5.51	0.81932	.	0.475599	0.20115	N	0.098938	T	0.12860	0.0312	M	0.70595	2.14	0.22684	N	0.998852	B	0.24823	0.112	B	0.26094	0.066	T	0.07597	-1.0764	10	0.48119	T	0.1	0.0806	11.3463	0.49563	0.1257:0.6801:0.1941:0.0	.	243	Q9P2H0	K1377_HUMAN	E	243;44	ENSP00000263468:Q243E;ENSP00000443184:Q44E	ENSP00000263468:Q243E	Q	+	1	0	KIAA1377	101337703	0.999000	0.42202	0.995000	0.50966	0.907000	0.53573	1.559000	0.36320	2.595000	0.87683	0.561000	0.74099	CAG	.		0.313	KIAA1377-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394140.1	NM_020802	
CACNA1C	775	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	2763057	2763057	+	Silent	SNP	C	C	T			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr12:2763057C>T	ENST00000347598.4	+	35	4275	c.4275C>T	c.(4273-4275)atC>atT	p.I1425I	CACNA1C_ENST00000406454.3_Silent_p.I1377I|CACNA1C_ENST00000399638.1_Silent_p.I1405I|CACNA1C_ENST00000399655.1_Silent_p.I1377I|CACNA1C_ENST00000402845.3_Silent_p.I1377I|CACNA1C_ENST00000335762.5_Silent_p.I1402I|CACNA1C_ENST00000399597.1_Silent_p.I1377I|CACNA1C_ENST00000399601.1_Silent_p.I1377I|CACNA1C_ENST00000399621.1_Silent_p.I1377I|CACNA1C_ENST00000327702.7_Silent_p.I1377I|CACNA1C_ENST00000399634.1_Silent_p.I1377I|CACNA1C_ENST00000399641.1_Silent_p.I1377I|CACNA1C_ENST00000399606.1_Silent_p.I1397I|CACNA1C_ENST00000399591.1_Silent_p.I1366I|CACNA1C_ENST00000399637.1_Silent_p.I1377I|CACNA1C_ENST00000399617.1_Silent_p.I1377I|CACNA1C_ENST00000399644.1_Silent_p.I1377I|CACNA1C_ENST00000399649.1_Silent_p.I1364I|CACNA1C_ENST00000399595.1_Silent_p.I1366I|CACNA1C_ENST00000344100.3_Silent_p.I1399I|CACNA1C_ENST00000399603.1_Silent_p.I1377I|CACNA1C_ENST00000399629.1_Silent_p.I1394I	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	1425					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	ACGCGGTGATCGGGATGCAGG	0.627																																					p.I1425I		.											.	CACNA1C-34	0			c.C4275T						.						75.0	78.0	77.0					12																	2763057		2028	4203	6231	SO:0001819	synonymous_variant	775	exon35			GGTGATCGGGATG	AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.4275C>T	12.37:g.2763057C>T		69	0		109	27	NM_199460	0	0	0	0	0	B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Silent	SNP	ENST00000347598.4	37	CCDS44788.1																																																																																			.		0.627	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317035.1	NM_000719	
A2M	2	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	9242617	9242617	+	Missense_Mutation	SNP	T	T	A			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr12:9242617T>A	ENST00000318602.7	-	21	2906	c.2599A>T	c.(2599-2601)Aat>Tat	p.N867Y		NM_000014.4	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin	867					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of complement activation, lectin pathway (GO:0001869)|negative regulation of endopeptidase activity (GO:0010951)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|stem cell differentiation (GO:0048863)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule lumen (GO:0031093)	calcium-dependent protein binding (GO:0048306)|enzyme binding (GO:0019899)|growth factor binding (GO:0019838)|interleukin-1 binding (GO:0019966)|interleukin-8 binding (GO:0019959)|protease binding (GO:0002020)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)|tumor necrosis factor binding (GO:0043120)			breast(1)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(17)|lung(30)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	77					Bacitracin(DB00626)|Becaplermin(DB00102)|Ocriplasmin(DB08888)	AAATTCACATTTCCTGAAAAA	0.438																																					p.N867Y		.											.	A2M-515	0			c.A2599T						.						119.0	118.0	118.0					12																	9242617		1893	4112	6005	SO:0001583	missense	2	exon21			TCACATTTCCTGA	BX647329, X68728, M11313	CCDS44827.1	12p13.31	2010-02-24			ENSG00000175899	ENSG00000175899			7	protein-coding gene	gene with protein product		103950					Standard	XM_006719056		Approved	FWP007, S863-7, CPAMD5	uc001qvk.1	P01023	OTTHUMG00000150267	ENST00000318602.7:c.2599A>T	12.37:g.9242617T>A	ENSP00000323929:p.Asn867Tyr	144	0		171	35	NM_000014	0	0	0	0	0	Q13677|Q59F47|Q5QTS0|Q68DN2|Q6PIY3|Q6PN97	Missense_Mutation	SNP	ENST00000318602.7	37	CCDS44827.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	11.24|11.24	1.580426|1.580426	0.28180|0.28180	.|.	.|.	ENSG00000175899|ENSG00000175899	ENST00000543436|ENST00000318602;ENST00000540099	.|T	.|0.17054	.|2.3	5.68|5.68	3.33|3.33	0.38152|0.38152	.|.	.|0.737822	.|0.13068	.|N	.|0.416350	T|T	0.19327|0.19327	0.0464|0.0464	M|M	0.80028|0.80028	2.48|2.48	0.09310|0.09310	N|N	1|1	.|B	.|0.17465	.|0.022	.|B	.|0.15870	.|0.014	T|T	0.41998|0.41998	-0.9477|-0.9477	5|10	.|0.66056	.|D	.|0.02	.|.	0.9957|0.9957	0.01466|0.01466	0.1621:0.1524:0.1695:0.516|0.1621:0.1524:0.1695:0.516	.|.	.|867	.|P01023	.|A2MG_HUMAN	D|Y	114|867;882	.|ENSP00000323929:N867Y	.|ENSP00000323929:N867Y	E|N	-|-	3|1	2|0	A2M|A2M	9133884|9133884	0.000000|0.000000	0.05858|0.05858	0.405000|0.405000	0.26409|0.26409	0.850000|0.850000	0.48378|0.48378	0.257000|0.257000	0.18369|0.18369	0.955000|0.955000	0.37878|0.37878	-0.336000|-0.336000	0.08194|0.08194	GAA|AAT	.		0.438	A2M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317233.2	NM_000014	
PTPRB	5787	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	71002988	71002988	+	Silent	SNP	G	G	A			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr12:71002988G>A	ENST00000261266.5	-	2	215	c.186C>T	c.(184-186)acC>acT	p.T62T	PTPRB_ENST00000538174.2_5'UTR|PTPRB_ENST00000551525.1_Silent_p.T279T|PTPRB_ENST00000550857.1_Silent_p.T62T|PTPRB_ENST00000538708.1_Silent_p.T62T|PTPRB_ENST00000451516.2_Silent_p.T62T|PTPRB_ENST00000550358.1_Silent_p.T280T|PTPRB_ENST00000334414.6_Silent_p.T280T	NM_002837.4	NP_002828.3	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	62	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|dephosphorylation (GO:0016311)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|protein dephosphorylation (GO:0006470)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(46)|prostate(4)|skin(18)|upper_aerodigestive_tract(1)|urinary_tract(3)	107	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			CGGCCCCCAGGGTGTCACTGC	0.498																																					p.T280T		.											.	PTPRB-226	0			c.C840T						.						86.0	90.0	88.0					12																	71002988		1923	4116	6039	SO:0001819	synonymous_variant	5787	exon4			CCCCAGGGTGTCA	X54131	CCDS44943.1, CCDS44944.1, CCDS55845.1, CCDS55846.1	12q15-q21	2013-02-11						"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9665	protein-coding gene	gene with protein product		176882		PTPB		2169617	Standard	NM_001109754		Approved		uc001swc.4	P23467	OTTHUMG00000169499	ENST00000261266.5:c.186C>T	12.37:g.71002988G>A		275	0		372	77	NM_001109754	0	0	0	0	0	B7ZKS8|B7ZKT0|C9JX87|F5H3G6|Q14D85|Q3MIV7	Silent	SNP	ENST00000261266.5	37	CCDS44944.1	.	.	.	.	.	.	.	.	.	.	G	0.050	-1.252789	0.01469	.	.	ENSG00000127329	ENST00000547715	.	.	.	4.75	-4.0	0.04057	.	.	.	.	.	T	0.17023	0.0409	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.21930	-1.0231	4	.	.	.	.	0.6526	0.00829	0.3902:0.1252:0.1784:0.3062	.	.	.	.	S	54	.	.	P	-	1	0	PTPRB	69289255	0.707000	0.27866	0.000000	0.03702	0.051000	0.14879	-0.453000	0.06778	-1.290000	0.02372	-0.194000	0.12790	CCT	.		0.498	PTPRB-007	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000404439.1		
HIP1R	9026	broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	123342922	123342922	+	Missense_Mutation	SNP	G	G	A	rs375880257		TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr12:123342922G>A	ENST00000253083.4	+	20	2115	c.1990G>A	c.(1990-1992)Gcc>Acc	p.A664T		NM_003959.1	NP_003950.1	O75146	HIP1R_HUMAN	huntingtin interacting protein 1 related	664					receptor-mediated endocytosis (GO:0006898)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intracellular membrane-bounded organelle (GO:0043231)	phosphatidylinositol binding (GO:0035091)			breast(1)|endometrium(5)|kidney(6)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	26	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;4.6e-05)|Epithelial(86;0.000119)|BRCA - Breast invasive adenocarcinoma(302;0.2)		GGCCCAGGAGGCCTTGGATGC	0.687													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17393	0.0		0.0	False		,,,				2504	0.0				p.A664T													.	HIP1R-91	0			c.G1990A						.	G	THR/ALA	1,4405	2.1+/-5.4	0,1,2202	54.0	53.0	54.0		1990	5.2	0.9	12		54	0,8600		0,0,4300	no	missense	HIP1R	NM_003959.1	58	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	664/1069	123342922	1,13005	2203	4300	6503	SO:0001583	missense	9026	exon20			CAGGAGGCCTTGG	AB013384	CCDS31922.1	12q24	2007-12-07			ENSG00000130787	ENSG00000130787			18415	protein-coding gene	gene with protein product		605613				16415883	Standard	NM_003959		Approved	KIAA0655, HIP3, HIP12, FLJ14000, ILWEQ	uc001udj.1	O75146	OTTHUMG00000168765	ENST00000253083.4:c.1990G>A	12.37:g.123342922G>A	ENSP00000253083:p.Ala664Thr	198	1		259	60	NM_003959	0	0	2	5	3	A6NHQ6|Q6NXG8|Q9UED9	Missense_Mutation	SNP	ENST00000253083.4	37	CCDS31922.1	.	.	.	.	.	.	.	.	.	.	G	9.409	1.080136	0.20309	2.27E-4	0.0	ENSG00000130787	ENST00000253083	T	0.19105	2.17	5.24	5.24	0.73138	.	0.069873	0.56097	N	0.000030	T	0.19967	0.0480	L	0.49350	1.555	0.39383	D	0.966281	B	0.20550	0.046	B	0.14023	0.01	T	0.05566	-1.0877	10	0.17832	T	0.49	-27.4445	14.146	0.65351	0.0745:0.0:0.9255:0.0	.	664	O75146	HIP1R_HUMAN	T	664	ENSP00000253083:A664T	ENSP00000253083:A664T	A	+	1	0	HIP1R	121908875	1.000000	0.71417	0.941000	0.38009	0.429000	0.31625	5.185000	0.65076	2.436000	0.82500	0.561000	0.74099	GCC	.		0.687	HIP1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400935.1	NM_003959	
PGAM5	192111	hgsc.bcm.edu;bcgsc.ca	37	12	133294130	133294130	+	Missense_Mutation	SNP	T	T	C			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr12:133294130T>C	ENST00000498926.2	+	3	534	c.476T>C	c.(475-477)aTc>aCc	p.I159T	PGAM5_ENST00000543955.1_Missense_Mutation_p.I10T|PGAM5_ENST00000317555.2_Missense_Mutation_p.I159T|PGAM5_ENST00000454808.2_Missense_Mutation_p.I10T|PXMP2_ENST00000545677.1_3'UTR	NM_001170543.1|NM_001170544.1	NP_001164014.1|NP_001164015.1	Q96HS1	PGAM5_HUMAN	phosphoglycerate mutase family member 5	159					dephosphorylation (GO:0016311)|necroptotic process (GO:0070266)|positive regulation of GTPase activity (GO:0043547)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	GTPase activator activity (GO:0005096)|phosphatase activity (GO:0016791)|phosphoprotein phosphatase activity (GO:0004721)|protein complex binding (GO:0032403)			endometrium(1)|kidney(1)|large_intestine(1)|lung(2)	5	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.89e-08)|Epithelial(86;1.14e-07)|all cancers(50;3.57e-06)		ACCACCGATATCATCAGCCGG	0.632																																					p.I159T		.											.	PGAM5-90	0			c.T476C						.						49.0	55.0	53.0					12																	133294130		2203	4298	6501	SO:0001583	missense	192111	exon3			CCGATATCATCAG	BC008196	CCDS9280.1, CCDS53845.1	12q24.33	2011-07-28			ENSG00000247077	ENSG00000247077			28763	protein-coding gene	gene with protein product		614939				11283018	Standard	NM_001170543		Approved	MGC5352, BXLBv68	uc009zyv.3	Q96HS1	OTTHUMG00000168021	ENST00000498926.2:c.476T>C	12.37:g.133294130T>C	ENSP00000438465:p.Ile159Thr	29	0		43	4	NM_138575	0	0	8	8	0	A9LN06|C9IZY7|Q96JB0	Missense_Mutation	SNP	ENST00000498926.2	37	CCDS53845.1	.	.	.	.	.	.	.	.	.	.	T	19.44	3.827390	0.71143	.	.	ENSG00000247077	ENST00000317555;ENST00000498926;ENST00000543955;ENST00000454808	T;T	0.73681	1.36;-0.77	5.6	5.6	0.85130	Histidine phosphatase superfamily, clade-1 (2);	0.000000	0.85682	D	0.000000	D	0.86577	0.5966	M	0.79693	2.465	0.80722	D	1	D;D	0.76494	0.999;0.988	D;D	0.81914	0.995;0.962	D	0.88249	0.2915	10	0.66056	D	0.02	-3.8102	15.8035	0.78473	0.0:0.0:0.0:1.0	.	159;159	Q96HS1;Q96HS1-2	PGAM5_HUMAN;.	T	159;159;10;10	ENSP00000321503:I159T;ENSP00000438465:I159T	ENSP00000321503:I159T	I	+	2	0	PGAM5	131804203	1.000000	0.71417	1.000000	0.80357	0.267000	0.26476	7.459000	0.80802	2.130000	0.65690	0.482000	0.46254	ATC	.		0.632	PGAM5-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397562.1	NM_138575	
MTRF1	9617	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	41791352	41791352	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr13:41791352C>T	ENST00000379480.4	-	10	1337	c.1237G>A	c.(1237-1239)Ggt>Agt	p.G413S	MTRF1_ENST00000379477.1_Missense_Mutation_p.G413S|MTRF1_ENST00000430347.2_Silent_p.V461V	NM_004294.2	NP_004285.2	O75570	RF1M_HUMAN	mitochondrial translational release factor 1	413					regulation of translational termination (GO:0006449)	mitochondrion (GO:0005739)	translation release factor activity (GO:0003747)|translation release factor activity, codon specific (GO:0016149)			breast(1)|endometrium(4)|large_intestine(3)|lung(6)	14		Lung NSC(96;4.52e-06)|Breast(139;0.00123)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)|Ovarian(182;0.125)		OV - Ovarian serous cystadenocarcinoma(117;4.24e-10)|all cancers(112;2.05e-09)|Epithelial(112;2.48e-09)|GBM - Glioblastoma multiforme(144;0.00115)|BRCA - Breast invasive adenocarcinoma(63;0.0721)|KIRC - Kidney renal clear cell carcinoma(186;0.248)		CCCTTCCCACCACATAAAAAT	0.348																																					p.G413S		.											.	MTRF1-90	0			c.G1237A						.						56.0	61.0	59.0					13																	41791352		2203	4300	6503	SO:0001583	missense	9617	exon10			TCCCACCACATAA	AF072934	CCDS9378.1	13q14.1-q14.3	2008-07-18			ENSG00000120662	ENSG00000120662			7469	protein-coding gene	gene with protein product	"""mitochontrial peptide chain release factor 1"""	604601				9838146, 10773675	Standard	NM_004294		Approved	RF1, MTTRF1, MGC47721	uc001uxy.3	O75570	OTTHUMG00000016790	ENST00000379480.4:c.1237G>A	13.37:g.41791352C>T	ENSP00000368793:p.Gly413Ser	131	0		181	38	NM_004294	0	0	0	0	0	B4DG01|Q5T6Y5|Q8IUQ6	Missense_Mutation	SNP	ENST00000379480.4	37	CCDS9378.1	.	.	.	.	.	.	.	.	.	.	C	17.91	3.505562	0.64410	.	.	ENSG00000120662	ENST00000379480;ENST00000379477	T;T	0.58210	0.35;0.35	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.72334	0.3447	M	0.71036	2.16	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.75068	-0.3448	10	0.87932	D	0	-9.2822	16.8351	0.85955	0.0:1.0:0.0:0.0	.	413	O75570	RF1M_HUMAN	S	413	ENSP00000368793:G413S;ENSP00000368790:G413S	ENSP00000368790:G413S	G	-	1	0	MTRF1	40689352	1.000000	0.71417	1.000000	0.80357	0.228000	0.25075	4.053000	0.57427	2.583000	0.87209	0.655000	0.94253	GGT	.		0.348	MTRF1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044666.3	NM_004294	
BCL2L2	599	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	23776985	23776985	+	Silent	SNP	C	C	A			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr14:23776985C>A	ENST00000250405.5	+	3	238	c.9C>A	c.(7-9)acC>acA	p.T3T	BCL2L2-PABPN1_ENST00000557008.1_Silent_p.T3T|BCL2L2-PABPN1_ENST00000553781.1_Silent_p.T3T	NM_001199839.1|NM_004050.4	NP_001186768.1|NP_004041	Q92843	B2CL2_HUMAN	BCL2-like 2	3					extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of apoptotic process (GO:0043066)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|Sertoli cell proliferation (GO:0060011)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial outer membrane (GO:0005741)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|lung(4)|prostate(1)	6	all_cancers(95;5.54e-06)			GBM - Glioblastoma multiforme(265;0.00654)		GGATGGCGACCCCAGCCTCGG	0.562																																					p.T3T		.											.	.	0			c.C9A						.						53.0	63.0	60.0					14																	23776985		2203	4298	6501	SO:0001819	synonymous_variant	100529063	exon3			GGCGACCCCAGCC	D87461	CCDS9591.1	14q11.2-q12	2014-03-07			ENSG00000129473	ENSG00000129473		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	995	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 51"""	601931				8761287	Standard	NM_001199839		Approved	KIAA0271, BCL-W, PPP1R51		Q92843	OTTHUMG00000028738	ENST00000250405.5:c.9C>A	14.37:g.23776985C>A		80	0		83	26	NM_001199864	0	0	1	1	0	A8K0F4|Q2M3U0|Q5U0H4	Silent	SNP	ENST00000250405.5	37	CCDS9591.1																																																																																			.		0.562	BCL2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071763.3	NM_004050	
GOLGA6L1	283767	broad.mit.edu	37	15	22743221	22743221	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr15:22743221G>A	ENST00000560659.2	+	8	1456	c.1456G>A	c.(1456-1458)Gag>Aag	p.E486K	GOLGA6L1_ENST00000316397.3_Missense_Mutation_p.E536K			Q8N7Z2	GG6L1_HUMAN	golgin A6 family-like 1	530								p.E536K(1)		NS(1)|breast(2)|endometrium(5)|large_intestine(1)|lung(1)|skin(1)	11						acgggagcaggaggagaagat	0.542																																					p.E536K													.	.	1	Substitution - Missense(1)	skin(1)	c.G1606A						.						2.0	2.0	2.0					15																	22743221		710	975	1685	SO:0001583	missense	283767	exon8			GAGCAGGAGGAGA	AK097517	CCDS73699.1	15q11.2	2012-10-05	2010-02-12		ENSG00000197414	ENSG00000277865			37444	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6-like 1"""				Standard	NM_001001413		Approved		uc010tzx.1	Q8N7Z2	OTTHUMG00000171883	ENST00000560659.2:c.1456G>A	15.37:g.22743221G>A	ENSP00000452626:p.Glu486Lys	54	0		68	4	NM_001001413	0	0	0	0	0		Missense_Mutation	SNP	ENST00000560659.2	37		.	.	.	.	.	.	.	.	.	.	.	8.906	0.957451	0.18507	.	.	ENSG00000197414	ENST00000316397;ENST00000355145	T	0.11930	2.73	.	.	.	.	.	.	.	.	T	0.08447	0.0210	.	.	.	0.23113	N	0.99828	.	.	.	.	.	.	T	0.41574	-0.9501	5	0.22109	T	0.4	.	5.3901	0.16240	0.0:0.0:1.0:0.0	.	.	.	.	K	536	ENSP00000320207:E536K	ENSP00000320207:E536K	E	+	1	0	GOLGA6L1	20294585	0.973000	0.33851	0.112000	0.21494	0.112000	0.19704	0.290000	0.18975	0.149000	0.19098	0.152000	0.16155	GAG	.		0.542	GOLGA6L1-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000415616.2	NM_001001413	
MAP1A	4130	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	43817788	43817788	+	Missense_Mutation	SNP	A	A	G			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr15:43817788A>G	ENST00000300231.5	+	4	4567	c.4117A>G	c.(4117-4119)Act>Gct	p.T1373A	MAP1A_ENST00000399453.1_Missense_Mutation_p.T1373A|MAP1A_ENST00000382031.1_Missense_Mutation_p.T1611A			P78559	MAP1A_HUMAN	microtubule-associated protein 1A	1373					microtubule cytoskeleton organization (GO:0000226)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(5)|pancreas(3)|prostate(2)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	66		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	GAAAGACAAAACTCTGGAGCA	0.443																																					p.T1373A		.											.	MAP1A-141	0			c.A4117G						.						99.0	96.0	97.0					15																	43817788		1906	4125	6031	SO:0001583	missense	4130	exon4			GACAAAACTCTGG	U38292	CCDS42031.1	15q15.3	2006-06-15			ENSG00000166963	ENSG00000166963			6835	protein-coding gene	gene with protein product		600178		MAP1L		7806212, 7629894	Standard	XM_005254385		Approved		uc001zrt.3	P78559	OTTHUMG00000059756	ENST00000300231.5:c.4117A>G	15.37:g.43817788A>G	ENSP00000300231:p.Thr1373Ala	151	0		171	52	NM_002373	0	0	0	1	1	O95643|Q12973|Q15882|Q9UJT4	Missense_Mutation	SNP	ENST00000300231.5	37	CCDS42031.1	.	.	.	.	.	.	.	.	.	.	A	9.136	1.012745	0.19277	.	.	ENSG00000166963	ENST00000382031;ENST00000399453;ENST00000300231	T;T;T	0.02280	4.36;4.36;4.36	4.47	1.97	0.26223	.	.	.	.	.	T	0.02807	0.0084	M	0.63428	1.95	0.09310	N	0.999998	B	0.33549	0.417	B	0.30495	0.116	T	0.41431	-0.9509	9	0.27785	T	0.31	0.3065	5.6758	0.17747	0.7318:0.171:0.0972:0.0	.	1373	P78559	MAP1A_HUMAN	A	1611;1373;1373	ENSP00000371462:T1611A;ENSP00000382380:T1373A;ENSP00000300231:T1373A	ENSP00000300231:T1373A	T	+	1	0	MAP1A	41605080	0.004000	0.15560	0.999000	0.59377	0.716000	0.41182	1.917000	0.39996	0.866000	0.35629	0.460000	0.39030	ACT	.		0.443	MAP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000132894.5	NM_002373	
DNM1P46	196968	bcgsc.ca	37	15	100340002	100340002	+	RNA	SNP	C	C	T	rs200405906		TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr15:100340002C>T	ENST00000341853.1	-	0	924					NR_003260.1		Q6ZS02	DMP46_HUMAN	DNM1 pseudogene 46							microtubule (GO:0005874)	GTPase activity (GO:0003924)										TTCTCGTTCCCACGCGAGTGC	0.607																																					.													.	.	0			.						.						34.0	30.0	31.0					15																	100340002		875	1991	2866			196968	.			CGTTCCCACGCGA	AJ576275		15q26.3	2013-04-25			ENSG00000182397	ENSG00000182397			35199	pseudogene	pseudogene			"""chromosome 15 open reading frame 51"""	DNM1DN14@, C15orf51			Standard	NR_003260		Approved	DNM1DN14.2, FLJ45937, DKFZp434I1020	uc021sxl.1	Q6ZS02	OTTHUMG00000149852		15.37:g.100340002C>T		22	0		16	7	.	0	0	6	6	0	Q3ZCN3	RNA	SNP	ENST00000341853.1	37																																																																																				C|0.992;G|0.004;T|0.004		0.607	DNM1P46-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000313543.1	NR_003260	
CCP110	9738	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	19548820	19548820	+	Missense_Mutation	SNP	A	A	T			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr16:19548820A>T	ENST00000381396.5	+	4	2076	c.1829A>T	c.(1828-1830)gAa>gTa	p.E610V	CCP110_ENST00000396212.2_Missense_Mutation_p.E610V|CCP110_ENST00000396208.2_Missense_Mutation_p.E610V	NM_001199022.1	NP_001185951	O43303	CP110_HUMAN	centriolar coiled coil protein 110kDa	610					cell projection organization (GO:0030030)|centriole replication (GO:0007099)|centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of cytokinesis (GO:0032465)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|protein complex (GO:0043234)				breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(8)|stomach(3)|urinary_tract(1)	21						GGAATAACTGAACAAGAAAGG	0.348																																					p.E610V		.											.	CCP110-90	0			c.A1829T						.						67.0	72.0	70.0					16																	19548820		2197	4300	6497	SO:0001583	missense	9738	exon4			TAACTGAACAAGA	AB007879	CCDS10579.1, CCDS55992.1	16p12.3	2014-02-20	2011-05-27		ENSG00000103540	ENSG00000103540			24342	protein-coding gene	gene with protein product		609544				9455477, 12361598, 16760425	Standard	NM_014711		Approved	KIAA0419, CP110	uc002dgl.4	O43303	OTTHUMG00000131459	ENST00000381396.5:c.1829A>T	16.37:g.19548820A>T	ENSP00000370803:p.Glu610Val	184	0		235	40	NM_001199022	0	0	0	0	0	B7WP23|O43335|Q68DV9|Q8NE13	Missense_Mutation	SNP	ENST00000381396.5	37	CCDS55992.1	.	.	.	.	.	.	.	.	.	.	A	14.41	2.527464	0.44969	.	.	ENSG00000103540	ENST00000396212;ENST00000381396;ENST00000396208	T;T;T	0.16897	2.31;2.31;2.31	5.17	5.17	0.71159	.	0.139138	0.46145	D	0.000310	T	0.16557	0.0398	L	0.58101	1.795	0.30579	N	0.762718	P;P	0.45715	0.865;0.865	B;B	0.42555	0.391;0.391	T	0.30090	-0.9990	10	0.48119	T	0.1	-1.1381	3.1962	0.06634	0.6412:0.1436:0.0771:0.1382	.	610;610	O43303;O43303-2	CP110_HUMAN;.	V	610	ENSP00000379515:E610V;ENSP00000370803:E610V;ENSP00000379511:E610V	ENSP00000370803:E610V	E	+	2	0	CCP110	19456321	1.000000	0.71417	0.981000	0.43875	0.972000	0.66771	2.685000	0.46959	1.933000	0.56026	0.460000	0.39030	GAA	.		0.348	CCP110-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254284.2	NM_014711	
CCP110	9738	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	19548822	19548822	+	Missense_Mutation	SNP	C	C	A			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr16:19548822C>A	ENST00000381396.5	+	4	2078	c.1831C>A	c.(1831-1833)Caa>Aaa	p.Q611K	CCP110_ENST00000396212.2_Missense_Mutation_p.Q611K|CCP110_ENST00000396208.2_Missense_Mutation_p.Q611K	NM_001199022.1	NP_001185951	O43303	CP110_HUMAN	centriolar coiled coil protein 110kDa	611					cell projection organization (GO:0030030)|centriole replication (GO:0007099)|centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of cytokinesis (GO:0032465)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|protein complex (GO:0043234)				breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(8)|stomach(3)|urinary_tract(1)	21						AATAACTGAACAAGAAAGGCA	0.348																																					p.Q611K		.											.	CCP110-90	0			c.C1831A						.						66.0	71.0	69.0					16																	19548822		2197	4300	6497	SO:0001583	missense	9738	exon4			ACTGAACAAGAAA	AB007879	CCDS10579.1, CCDS55992.1	16p12.3	2014-02-20	2011-05-27		ENSG00000103540	ENSG00000103540			24342	protein-coding gene	gene with protein product		609544				9455477, 12361598, 16760425	Standard	NM_014711		Approved	KIAA0419, CP110	uc002dgl.4	O43303	OTTHUMG00000131459	ENST00000381396.5:c.1831C>A	16.37:g.19548822C>A	ENSP00000370803:p.Gln611Lys	181	0		234	40	NM_001199022	0	0	0	0	0	B7WP23|O43335|Q68DV9|Q8NE13	Missense_Mutation	SNP	ENST00000381396.5	37	CCDS55992.1	.	.	.	.	.	.	.	.	.	.	C	14.97	2.694577	0.48202	.	.	ENSG00000103540	ENST00000396212;ENST00000381396;ENST00000396208	T;T;T	0.19105	2.17;2.17;2.17	5.17	5.17	0.71159	.	0.260422	0.33127	N	0.005246	T	0.25005	0.0607	L	0.58101	1.795	0.35963	D	0.834752	P;P	0.41978	0.767;0.767	B;B	0.41510	0.359;0.359	T	0.33904	-0.9850	10	0.72032	D	0.01	-0.143	12.0805	0.53667	0.0:0.9211:0.0:0.0789	.	611;611	O43303;O43303-2	CP110_HUMAN;.	K	611	ENSP00000379515:Q611K;ENSP00000370803:Q611K;ENSP00000379511:Q611K	ENSP00000370803:Q611K	Q	+	1	0	CCP110	19456323	1.000000	0.71417	0.998000	0.56505	0.975000	0.68041	3.793000	0.55484	2.385000	0.81259	0.563000	0.77884	CAA	.		0.348	CCP110-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254284.2	NM_014711	
PRR14	78994	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	30666137	30666137	+	Silent	SNP	G	G	A			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr16:30666137G>A	ENST00000542965.2	+	7	1302	c.846G>A	c.(844-846)ctG>ctA	p.L282L	PRR14_ENST00000300835.4_Silent_p.L282L			Q9BWN1	PRR14_HUMAN	proline rich 14	282	Pro-rich.									breast(3)|endometrium(5)|kidney(1)|large_intestine(3)|lung(5)|skin(1)	18			Colorectal(24;0.103)			CAATGAAGCTGGAGTTGAAGA	0.637																																					p.L282L		.											.	PRR14-90	0			c.G846A						.						19.0	23.0	21.0					16																	30666137		2192	4295	6487	SO:0001819	synonymous_variant	78994	exon8			GAAGCTGGAGTTG	AK074783	CCDS10687.1	16p11.2	2008-02-05			ENSG00000156858	ENSG00000156858			28458	protein-coding gene	gene with protein product						12477932	Standard	NM_024031		Approved	MGC3121	uc002dyy.3	Q9BWN1	OTTHUMG00000132414	ENST00000542965.2:c.846G>A	16.37:g.30666137G>A		37	0		37	6	NM_024031	0	0	9	16	7	Q8WTX2	Silent	SNP	ENST00000542965.2	37	CCDS10687.1																																																																																			.		0.637	PRR14-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434433.1	NM_024031	
ITGAX	3687	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	31374006	31374006	+	Missense_Mutation	SNP	G	G	C	rs554674355		TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr16:31374006G>C	ENST00000268296.4	+	12	1412	c.1291G>C	c.(1291-1293)Ggg>Cgg	p.G431R	ITGAX_ENST00000562522.1_Missense_Mutation_p.G431R	NM_000887.3	NP_000878.2	P20702	ITAX_HUMAN	integrin, alpha X (complement component 3 receptor 4 subunit)	431					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|organ morphogenesis (GO:0009887)	cell surface (GO:0009986)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(42)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	77						CCAGCACACCGGGAAGGCTGT	0.647																																					p.G431R		.											.	ITGAX-229	0			c.G1291C						.						34.0	33.0	33.0					16																	31374006		2197	4300	6497	SO:0001583	missense	3687	exon12			CACACCGGGAAGG	BC038237	CCDS10711.1, CCDS67014.1	16p11.2	2010-03-23	2006-02-10		ENSG00000140678	ENSG00000140678		"""CD molecules"", ""Complement system"", ""Integrins"""	6152	protein-coding gene	gene with protein product		151510	"""integrin, alpha X (antigen CD11C (p150), alpha polypeptide)"""	CD11C		3284962, 2303426	Standard	NM_001286375		Approved	CD11c	uc002ebu.1	P20702	OTTHUMG00000132465	ENST00000268296.4:c.1291G>C	16.37:g.31374006G>C	ENSP00000268296:p.Gly431Arg	371	0		523	116	NM_000887	0	0	9	10	1	Q8IVA6	Missense_Mutation	SNP	ENST00000268296.4	37	CCDS10711.1	.	.	.	.	.	.	.	.	.	.	g	18.79	3.698354	0.68386	.	.	ENSG00000140678	ENST00000268296	T	0.54479	0.57	3.76	2.69	0.31865	.	.	.	.	.	T	0.80979	0.4728	H	0.98559	4.265	0.33798	D	0.62635	D	0.89917	1.0	D	0.87578	0.998	D	0.87513	0.2441	9	0.87932	D	0	.	10.1899	0.43019	0.0:0.2038:0.7962:0.0	.	431	P20702	ITAX_HUMAN	R	431	ENSP00000268296:G431R	ENSP00000268296:G431R	G	+	1	0	ITGAX	31281507	0.999000	0.42202	0.997000	0.53966	0.899000	0.52679	3.647000	0.54403	1.829000	0.53265	0.448000	0.29417	GGG	.		0.647	ITGAX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255628.2	NM_000887	
ALOX12B	242	ucsc.edu;bcgsc.ca	37	17	7990699	7990699	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr17:7990699G>C	ENST00000319144.4	-	1	322	c.62C>G	c.(61-63)tCc>tGc	p.S21C	MIR4314_ENST00000583321.1_RNA	NM_001139.2	NP_001130.1	O75342	LX12B_HUMAN	arachidonate 12-lipoxygenase, 12R type	21	PLAT. {ECO:0000255|PROSITE- ProRule:PRU00152}.				arachidonic acid metabolic process (GO:0019369)|ceramide biosynthetic process (GO:0046513)|establishment of skin barrier (GO:0061436)|hepoxilin biosynthetic process (GO:0051122)|linoleic acid metabolic process (GO:0043651)|lipoxygenase pathway (GO:0019372)|oxidation-reduction process (GO:0055114)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mucus secretion (GO:0070257)|protein lipidation (GO:0006497)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytosol (GO:0005829)	arachidonate 12-lipoxygenase activity (GO:0004052)|iron ion binding (GO:0005506)|linoleate 9S-lipoxygenase activity (GO:1990136)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)			endometrium(5)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)|stomach(1)	16						CAGTGAGATGGAGTCCCGTGT	0.577										Multiple Myeloma(8;0.094)																											p.S21C													.	ALOX12B-226	0			c.C62G						.						263.0	188.0	213.0					17																	7990699		2203	4300	6503	SO:0001583	missense	242	exon1			GAGATGGAGTCCC	AF038461	CCDS11129.1	17p13.1	2008-03-18			ENSG00000179477	ENSG00000179477	1.13.11.-	"""Arachidonate lipoxygenases"""	430	protein-coding gene	gene with protein product		603741				9618483	Standard	NM_001139		Approved	12R-LOX	uc002gjy.1	O75342	OTTHUMG00000108180	ENST00000319144.4:c.62C>G	17.37:g.7990699G>C	ENSP00000315167:p.Ser21Cys	329	2		389	82	NM_001139	0	0	0	0	0		Missense_Mutation	SNP	ENST00000319144.4	37	CCDS11129.1	.	.	.	.	.	.	.	.	.	.	G	6.255	0.415202	0.11870	.	.	ENSG00000179477	ENST00000319144	T	0.77750	-1.12	4.78	-3.77	0.04346	Lipoxygenase, LH2 (4);Lipase/lipooxygenase, PLAT/LH2 (1);	0.472031	0.23382	N	0.048781	T	0.64034	0.2562	L	0.35854	1.095	0.09310	N	0.999999	B	0.15719	0.014	B	0.24394	0.053	T	0.55140	-0.8187	10	0.40728	T	0.16	-16.6531	11.2422	0.48977	0.0:0.4855:0.3194:0.1951	.	21	O75342	LX12B_HUMAN	C	21	ENSP00000315167:S21C	ENSP00000315167:S21C	S	-	2	0	ALOX12B	7931424	0.993000	0.37304	0.042000	0.18584	0.279000	0.26890	0.479000	0.22228	-0.316000	0.08690	-0.314000	0.08810	TCC	.		0.577	ALOX12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226984.3		
KRTAP1-1	81851	broad.mit.edu	37	17	39197393	39197393	+	Missense_Mutation	SNP	T	T	C	rs201732142		TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr17:39197393T>C	ENST00000306271.4	-	1	320	c.257A>G	c.(256-258)tAc>tGc	p.Y86C		NM_030967.2	NP_112229.1	Q07627	KRA11_HUMAN	keratin associated protein 1-1	86			Missing (in allele KAP1.7). {ECO:0000269|PubMed:11841537}.			keratin filament (GO:0045095)		p.Y86C(4)		NS(2)|endometrium(2)|kidney(5)|lung(4)|prostate(1)	14		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			GCTGGTCTGGTAGCAGCTTGG	0.587																																					p.Y86C													.	.	4	Substitution - Missense(4)	lung(2)|kidney(1)|endometrium(1)	c.A257G						.						47.0	51.0	49.0					17																	39197393		2010	4190	6200	SO:0001583	missense	81851	exon1			GTCTGGTAGCAGC	AJ406926	CCDS42324.1	17q21.2	2014-06-05			ENSG00000188581	ENSG00000188581		"""Keratin associated proteins"""	16772	protein-coding gene	gene with protein product		608819				11279113	Standard	NM_030967		Approved	KAP1.1B, HB2A, KAP1.1, KAP1.1A	uc002hvw.1	Q07627	OTTHUMG00000133592	ENST00000306271.4:c.257A>G	17.37:g.39197393T>C	ENSP00000305975:p.Tyr86Cys	83	1		126	8	NM_030967	0	0	0	0	0	A6NC32|Q96S60|Q96S67	Missense_Mutation	SNP	ENST00000306271.4	37	CCDS42324.1	.	.	.	.	.	.	.	.	.	.	T	0.037	-1.304092	0.01353	.	.	ENSG00000188581	ENST00000306271;ENST00000543328	T	0.27557	1.66	4.0	-7.99	0.01131	.	.	.	.	.	T	0.01940	0.0061	N	0.00002	-3.6	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.42361	-0.9456	9	0.02654	T	1	.	3.8365	0.08896	0.3382:0.2456:0.3404:0.0759	.	86	Q07627	KRA11_HUMAN	C	86;76	ENSP00000305975:Y86C	ENSP00000305975:Y86C	Y	-	2	0	KRTAP1-1	36450919	0.001000	0.12720	0.000000	0.03702	0.075000	0.17131	-0.958000	0.03857	-1.490000	0.01842	-0.977000	0.02584	TAC	.		0.587	KRTAP1-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257696.1	NM_030967	
AOC3	8639	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	41004649	41004649	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr17:41004649G>A	ENST00000308423.2	+	1	1449	c.1289G>A	c.(1288-1290)tGt>tAt	p.C430Y	AOC3_ENST00000591562.1_5'Flank	NM_003734.2	NP_003725.1	Q16853	AOC3_HUMAN	amine oxidase, copper containing 3	430					amine metabolic process (GO:0009308)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|cell adhesion (GO:0007155)|inflammatory response (GO:0006954)|response to antibiotic (GO:0046677)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	aliphatic-amine oxidase activity (GO:0052595)|aminoacetone:oxygen oxidoreductase(deaminating) activity (GO:0052594)|calcium ion binding (GO:0005509)|cation channel activity (GO:0005261)|copper ion binding (GO:0005507)|phenethylamine:oxygen oxidoreductase (deaminating) activity (GO:0052596)|primary amine oxidase activity (GO:0008131)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|quinone binding (GO:0048038)|tryptamine:oxygen oxidoreductase (deaminating) activity (GO:0052593)			breast(1)|central_nervous_system(4)|endometrium(4)|kidney(1)|large_intestine(8)|lung(14)|ovary(1)|skin(8)	41		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.156)	Hydralazine(DB01275)|Phenelzine(DB00780)	GATGCCTTTTGTGTGTTTGAA	0.592																																					p.C430Y	NSCLC(3;192 220 10664 11501 16477)												.	AOC3-516	0			c.G1289A						.						96.0	85.0	89.0					17																	41004649		2203	4300	6503	SO:0001583	missense	8639	exon1			CCTTTTGTGTGTT	AF067406	CCDS11444.1, CCDS62198.1, CCDS74071.1	17q21	2013-05-08	2013-05-08			ENSG00000131471	1.4.3.21		550	protein-coding gene	gene with protein product	"""vascular adhesion protein 1"""	603735				9653080, 8972912	Standard	NM_003734		Approved	VAP1, HPAO, VAP-1	uc002ibv.4	Q16853		ENST00000308423.2:c.1289G>A	17.37:g.41004649G>A	ENSP00000312326:p.Cys430Tyr	397	1		489	78	NM_003734	0	0	0	0	0	B2RCI5|K7ESB3|L0L8N9|Q45F94	Missense_Mutation	SNP	ENST00000308423.2	37	CCDS11444.1	.	.	.	.	.	.	.	.	.	.	G	19.04	3.749416	0.69533	.	.	ENSG00000131471	ENST00000308423	T	0.11604	2.76	4.64	4.64	0.57946	Copper amine oxidase, C-terminal (3);	0.000000	0.85682	D	0.000000	T	0.45357	0.1338	M	0.93978	3.48	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.60850	-0.7181	10	0.87932	D	0	.	18.0666	0.89392	0.0:0.0:1.0:0.0	.	430	Q16853	AOC3_HUMAN	Y	430	ENSP00000312326:C430Y	ENSP00000312326:C430Y	C	+	2	0	AOC3	38258175	1.000000	0.71417	1.000000	0.80357	0.780000	0.44128	7.595000	0.82710	2.591000	0.87537	0.591000	0.81541	TGT	.		0.592	AOC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452444.1	NM_003734	
PPM1E	22843	hgsc.bcm.edu	37	17	56833490	56833490	+	Silent	SNP	G	G	A	rs59676153		TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr17:56833490G>A	ENST00000308249.2	+	1	261	c.132G>A	c.(130-132)gaG>gaA	p.E44E		NM_014906.4	NP_055721.3	Q96MI6	PPM1M_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1E	0	PP2C-like.				protein dephosphorylation (GO:0006470)	nucleus (GO:0005634)	CTD phosphatase activity (GO:0008420)|manganese ion binding (GO:0030145)			biliary_tract(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)	33	Medulloblastoma(34;0.127)|all_neural(34;0.237)		BRCA - Breast invasive adenocarcinoma(1;5.76e-11)			ccgaacccgagtccgagcccg	0.706																																					p.E44E		.											.	PPM1E-291	0			c.G132A						.																																			SO:0001819	synonymous_variant	22843	exon1			ACCCGAGTCCGAG	AB028995	CCDS11613.1	17q24.2	2012-04-17	2010-03-05		ENSG00000175175	ENSG00000175175		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	19322	protein-coding gene	gene with protein product	"""partner of PIX 1"", ""nuclear calmodulin-dependent protein kinase phosphatase"""		"""protein phosphatase 1E (PP2C domain containing)"""			11864573, 10470851	Standard	NR_048561		Approved	POPX1, KIAA1072, PP2CH, CaMKP-N	uc002iwx.4	Q8WY54		ENST00000308249.2:c.132G>A	17.37:g.56833490G>A		65	0		97	9	NM_014906	0	0	0	0	0	Q8N8J9|Q96DB8	Silent	SNP	ENST00000308249.2	37	CCDS11613.1																																																																																			.		0.706	PPM1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445458.1	NM_014906	
CLTC	1213	ucsc.edu	37	17	57746160	57746160	+	Silent	SNP	C	C	T			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr17:57746160C>T	ENST00000269122.3	+	14	2425	c.2151C>T	c.(2149-2151)tcC>tcT	p.S717S	CLTC_ENST00000393043.1_Silent_p.S717S|CLTC_ENST00000579456.1_Intron	NM_004859.3	NP_004850.1	Q00610	CLH1_HUMAN	clathrin, heavy chain (Hc)	717	Heavy chain arm.|Proximal segment.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|mitotic nuclear division (GO:0007067)|negative regulation of hyaluronan biosynthetic process (GO:1900126)|negative regulation of protein localization to plasma membrane (GO:1903077)|osteoblast differentiation (GO:0001649)|post-Golgi vesicle-mediated transport (GO:0006892)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)|transferrin transport (GO:0033572)	clathrin coat (GO:0030118)|clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin complex (GO:0071439)|clathrin-coated endocytic vesicle membrane (GO:0030669)|clathrin-coated vesicle (GO:0030136)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|trans-Golgi network membrane (GO:0032588)|vesicle (GO:0031982)	clathrin light chain binding (GO:0032051)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|structural molecule activity (GO:0005198)		CLTC/ALK(44)|CLTC/TFE3(2)	breast(2)|large_intestine(6)|ovary(1)	9	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					TTCTGGGATCCATTGTTAACT	0.328			T	"""ALK, TFE3"""	"""ALCL, renal """																																p.S717S				Dom	yes		17	17q11-qter	1213	"""clathrin, heavy polypeptide (Hc)"""		L	.	CLTC-835	0			c.C2151T						.						125.0	119.0	121.0					17																	57746160		2203	4300	6503	SO:0001819	synonymous_variant	1213	exon14			GGGATCCATTGTT	X55878	CCDS32696.1, CCDS74115.1	17q23.1	2013-09-19	2006-09-29		ENSG00000141367	ENSG00000141367			2092	protein-coding gene	gene with protein product		118955	"""clathrin, heavy polypeptide (Hc)"", ""clathrin, heavy chain"", ""clathrin, heavy polypeptide-like 2"""	CLTCL2		1765375, 7584026	Standard	NM_004859		Approved	Hc	uc002ixq.1	Q00610	OTTHUMG00000134279	ENST00000269122.3:c.2151C>T	17.37:g.57746160C>T		39	0		28	4	NM_004859	0	0	9	9	0	D3DU00|Q6N0A0|Q86TF2	Silent	SNP	ENST00000269122.3	37	CCDS32696.1																																																																																			.		0.328	CLTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258859.1	NM_004859	
KCNH6	81033	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	61616010	61616010	+	Silent	SNP	C	C	G			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr17:61616010C>G	ENST00000583023.1	+	8	1952	c.1941C>G	c.(1939-1941)gtC>gtG	p.V647V	KCNH6_ENST00000456941.2_Silent_p.V594V|KCNH6_ENST00000581784.1_Silent_p.V594V|KCNH6_ENST00000314672.5_Silent_p.V647V	NM_030779.2	NP_110406.1	Q9H252	KCNH6_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 6	647					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)			breast(2)|central_nervous_system(2)|endometrium(9)|kidney(4)|large_intestine(6)|lung(20)|ovary(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	54					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	ACGACGTGGTCGTGGCCATCC	0.662																																					p.V647V													.	KCNH6-91	0			c.C1941G						.						46.0	42.0	43.0					17																	61616010		2203	4300	6503	SO:0001819	synonymous_variant	81033	exon8			CGTGGTCGTGGCC	AF311913	CCDS11638.1, CCDS11639.1, CCDS62290.1	17q23.3	2012-07-05				ENSG00000173826		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18862	protein-coding gene	gene with protein product		608168				16382104	Standard	NM_030779		Approved	Kv11.2, erg2, HERG2	uc002jay.3	Q9H252		ENST00000583023.1:c.1941C>G	17.37:g.61616010C>G		264	2		331	67	NM_030779	0	0	0	0	0	Q9BRD7	Silent	SNP	ENST00000583023.1	37	CCDS11638.1																																																																																			.		0.662	KCNH6-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443853.1	NM_030779	
ZNF236	7776	hgsc.bcm.edu;bcgsc.ca	37	18	74680294	74680294	+	Nonstop_Mutation	SNP	G	G	T			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr18:74680294G>T	ENST00000253159.8	+	31	5735	c.5537G>T	c.(5536-5538)tGa>tTa	p.*1846L	ZNF236_ENST00000320610.9_Nonstop_Mutation_p.*1848L	NM_007345.3	NP_031371.3	Q9UL36	ZN236_HUMAN	zinc finger protein 236	0					cellular response to glucose stimulus (GO:0071333)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(43)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	94		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)		CACGTCTTCTGATGCGAGTTG	0.542																																					p.X1846L		.											.	ZNF236-94	0			c.G5537T						.						65.0	76.0	72.0					18																	74680294		1938	4135	6073	SO:0001578	stop_lost	7776	exon31			TCTTCTGATGCGA	AF085243	CCDS42447.1	18q22-q23	2013-01-08				ENSG00000130856		"""Zinc fingers, C2H2-type"""	13028	protein-coding gene	gene with protein product		604760				10458916	Standard	NM_007345		Approved		uc002lmi.3	Q9UL36		ENST00000253159.8:c.5537G>T	18.37:g.74680294G>T	ENSP00000253159:p.*1846Leuext*8	56	0		72	4	NM_007345	0	0	0	0	0	B2RTX9|Q9UL37	Missense_Mutation	SNP	ENST00000253159.8	37	CCDS42447.1	.	.	.	.	.	.	.	.	.	.	G	8.724	0.914980	0.17907	.	.	ENSG00000130856	ENST00000253159	.	.	.	4.91	4.04	0.47022	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.5206	0.61566	0.0765:0.0:0.9235:0.0	.	.	.	.	L	1846	.	.	X	+	2	2	ZNF236	72809282	1.000000	0.71417	0.888000	0.34837	0.039000	0.13416	5.969000	0.70422	1.207000	0.43291	0.557000	0.71058	TGA	.		0.542	ZNF236-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000445776.1		
DOT1L	84444	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	19	2210830	2210830	+	Nonsense_Mutation	SNP	C	C	T			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr19:2210830C>T	ENST00000398665.3	+	14	1363	c.1327C>T	c.(1327-1329)Cag>Tag	p.Q443*	AC004490.1_ENST00000585593.1_RNA	NM_032482.2	NP_115871.1	Q8TEK3	DOT1L_HUMAN	DOT1-like histone H3K79 methyltransferase	443					histone lysine methylation (GO:0034968)|regulation of JAK-STAT cascade (GO:0046425)|regulation of transcription regulatory region DNA binding (GO:2000677)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription factor binding (GO:0008134)			NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(2)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(9)	42		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GACCGTGTCTCAGACGGCGGC	0.692																																					p.Q443X		.											.	DOT1L-132	0			c.C1327T						.						26.0	34.0	31.0					19																	2210830		1991	4142	6133	SO:0001587	stop_gained	84444	exon14			GTGTCTCAGACGG	AF509504	CCDS42460.1	19p13.3	2013-05-21	2013-05-21		ENSG00000104885	ENSG00000104885	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"""	24948	protein-coding gene	gene with protein product	"""histone methyltransferase DOT1L"""	607375	"""DOT1-like, histone H3 methyltransferase (S. cerevisiae)"""			11347906, 12123582	Standard	NM_032482		Approved	KIAA1814, DOT1, KMT4	uc002lvb.4	Q8TEK3	OTTHUMG00000150431	ENST00000398665.3:c.1327C>T	19.37:g.2210830C>T	ENSP00000381657:p.Gln443*	98	0		151	35	NM_032482	0	0	0	0	0	O60379|Q96JL1	Nonsense_Mutation	SNP	ENST00000398665.3	37	CCDS42460.1	.	.	.	.	.	.	.	.	.	.	C	28.0	4.878112	0.91664	.	.	ENSG00000104885	ENST00000398665;ENST00000221482	.	.	.	4.84	4.84	0.62591	.	0.625695	0.16263	N	0.222122	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-7.1526	16.9353	0.86202	0.0:1.0:0.0:0.0	.	.	.	.	X	443	.	ENSP00000221482:Q443X	Q	+	1	0	DOT1L	2161830	0.963000	0.33076	0.020000	0.16555	0.076000	0.17211	4.755000	0.62198	2.222000	0.72286	0.561000	0.74099	CAG	.		0.692	DOT1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318066.1	NM_032482	
TSPAN16	26526	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	11408999	11408999	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr19:11408999G>A	ENST00000316737.1	+	2	401	c.251G>A	c.(250-252)aGa>aAa	p.R84K	TSPAN16_ENST00000590327.1_Missense_Mutation_p.R84K|TSPAN16_ENST00000592955.1_Missense_Mutation_p.R84K|CTC-510F12.4_ENST00000586356.1_RNA	NM_012466.2	NP_036598.1	Q9UKR8	TSN16_HUMAN	tetraspanin 16	84						integral component of membrane (GO:0016021)				breast(1)|endometrium(3)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|skin(2)|stomach(1)	12						AAAGAGAGCAGAGGCACGCTC	0.522																																					p.R84K													.	TSPAN16-91	0			c.G251A						.						96.0	73.0	81.0					19																	11408999		2203	4300	6503	SO:0001583	missense	26526	exon2			AGAGCAGAGGCAC	BC029908	CCDS12256.1, CCDS62549.1, CCDS62550.1	19p13.2	2013-02-14	2005-03-21	2005-03-21	ENSG00000130167	ENSG00000130167		"""Tetraspanins"""	30725	protein-coding gene	gene with protein product			"""transmembrane 4 superfamily member 16"""	TM4SF16		10500248	Standard	NM_012466		Approved	TM4-B, TM-8	uc002mqv.1	Q9UKR8	OTTHUMG00000180833	ENST00000316737.1:c.251G>A	19.37:g.11408999G>A	ENSP00000319486:p.Arg84Lys	178	1		218	44	NM_012466	0	0	0	0	0	K7EN22|K7EPD8|Q8N6J7	Missense_Mutation	SNP	ENST00000316737.1	37	CCDS12256.1	.	.	.	.	.	.	.	.	.	.	G	16.08	3.021270	0.54576	.	.	ENSG00000130167	ENST00000316737;ENST00000337994	T;T	0.77750	-1.12;-1.12	3.57	3.57	0.40892	.	0.000000	0.37530	N	0.002042	T	0.78130	0.4235	L	0.38692	1.165	0.09310	N	1	D	0.69078	0.997	D	0.79108	0.992	T	0.65467	-0.6161	10	0.09084	T	0.74	-17.1852	10.972	0.47444	0.0:0.0:1.0:0.0	.	84	Q9UKR8	TSN16_HUMAN	K	84	ENSP00000319486:R84K;ENSP00000338759:R84K	ENSP00000319486:R84K	R	+	2	0	TSPAN16	11269999	0.208000	0.23494	0.207000	0.23584	0.052000	0.14988	2.108000	0.41854	2.287000	0.76781	0.462000	0.41574	AGA	.		0.522	TSPAN16-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000453204.1	NM_012466	
ZNF653	115950	broad.mit.edu	37	19	11594521	11594521	+	Silent	SNP	G	G	A			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr19:11594521G>A	ENST00000293771.5	-	9	1960	c.1824C>T	c.(1822-1824)agC>agT	p.S608S	ELAVL3_ENST00000592218.1_5'Flank|CTC-398G3.6_ENST00000585656.1_Intron|ELAVL3_ENST00000359227.3_5'Flank	NM_138783.3	NP_620138.2	Q96CK0	ZN653_HUMAN	zinc finger protein 653	608					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(3)|large_intestine(2)|lung(8)|prostate(1)|skin(1)	17						GATCCGGGTGGCTTTTGAGCG	0.617																																					p.S608S	Pancreas(83;980 1446 4542 6441 43352)												.	ZNF653-90	0			c.C1824T						.						232.0	183.0	199.0					19																	11594521		2203	4300	6503	SO:0001819	synonymous_variant	115950	exon9			CGGGTGGCTTTTG	AY072704	CCDS12261.1	19p13.2	2013-01-08						"""Zinc fingers, C2H2-type"""	25196	protein-coding gene	gene with protein product		611371				12477932	Standard	NM_138783		Approved	Zip67	uc002mrz.2	Q96CK0		ENST00000293771.5:c.1824C>T	19.37:g.11594521G>A		97	1		162	7	NM_138783	0	0	8	9	1	Q96AS7	Silent	SNP	ENST00000293771.5	37	CCDS12261.1																																																																																			.		0.617	ZNF653-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458836.2	NM_138783	
HAPLN4	404037	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	19371725	19371725	+	Silent	SNP	G	G	A			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr19:19371725G>A	ENST00000291481.7	-	3	444	c.381C>T	c.(379-381)tcC>tcT	p.S127S	AC138430.4_ENST00000586064.2_RNA	NM_023002.2	NP_075378.1	Q86UW8	HPLN4_HUMAN	hyaluronan and proteoglycan link protein 4	127	Ig-like C2-type.				cell adhesion (GO:0007155)	proteinaceous extracellular matrix (GO:0005578)	hyaluronic acid binding (GO:0005540)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|pancreas(1)|prostate(1)	16			Epithelial(12;0.00575)		Hyaluronan(DB08818)	GGAGGACCAGGGAGGCATCCC	0.652																																					p.S127S		.											.	HAPLN4-91	0			c.C381T						.						66.0	61.0	63.0					19																	19371725		2203	4300	6503	SO:0001819	synonymous_variant	404037	exon3			GACCAGGGAGGCA	AB107883	CCDS12398.1	19p13.1	2013-01-11						"""Immunoglobulin superfamily / V-set domain containing"""	31357	protein-coding gene	gene with protein product	"""brain link protein 2"""					12663660	Standard	NM_023002		Approved	BRAL2, KIAA1926	uc002nmb.3	Q86UW8		ENST00000291481.7:c.381C>T	19.37:g.19371725G>A		64	0		50	12	NM_023002	0	0	0	0	0	A5PKW5|Q96PW2	Silent	SNP	ENST00000291481.7	37	CCDS12398.1																																																																																			.		0.652	HAPLN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460117.2	NM_023002	
GRAMD1A	57655	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	35500151	35500151	+	Missense_Mutation	SNP	A	A	C			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr19:35500151A>C	ENST00000317991.5	+	2	329	c.137A>C	c.(136-138)gAt>gCt	p.D46A	GRAMD1A_ENST00000599564.1_Missense_Mutation_p.D133A|GRAMD1A_ENST00000504615.2_5'UTR|GRAMD1A_ENST00000411896.2_Missense_Mutation_p.D46A|GRAMD1A_ENST00000424536.2_Missense_Mutation_p.D46A|GRAMD1A_ENST00000598073.1_3'UTR	NM_020895.3	NP_065946.2	Q96CP6	GRM1A_HUMAN	GRAM domain containing 1A	46						integral component of membrane (GO:0016021)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	19	all_lung(56;2.66e-08)|Lung NSC(56;4.13e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)			AAGGGATCAGATAGCTCCTCA	0.647																																					p.D46A		.											.	GRAMD1A-90	0			c.A137C						.						38.0	45.0	43.0					19																	35500151		1939	4128	6067	SO:0001583	missense	57655	exon2			GATCAGATAGCTC	AK074864	CCDS42546.1, CCDS46046.1	19q13.13	2008-02-05	2005-11-02	2005-11-02		ENSG00000089351			29305	protein-coding gene	gene with protein product			"""KIAA1533"""	KIAA1533		10819331	Standard	NM_020895		Approved	FLJ90346	uc010xse.1	Q96CP6		ENST00000317991.5:c.137A>C	19.37:g.35500151A>C	ENSP00000441032:p.Asp46Ala	72	0		138	22	NM_020895	0	0	2	5	3	A6NKY7|Q8NC77|Q9P1Z5	Missense_Mutation	SNP	ENST00000317991.5	37	CCDS42546.1	.	.	.	.	.	.	.	.	.	.	A	18.24	3.579681	0.65992	.	.	ENSG00000089351	ENST00000453966;ENST00000317991;ENST00000411896	T;T	0.25250	1.81;1.83	4.67	4.67	0.58626	.	0.081214	0.49916	D	0.000124	T	0.30665	0.0772	N	0.19112	0.55	0.80722	D	1	D;D;D;D	0.60160	0.987;0.978;0.987;0.987	P;P;P;P	0.61477	0.889;0.698;0.841;0.889	T	0.05402	-1.0887	10	0.45353	T	0.12	.	12.1081	0.53823	1.0:0.0:0.0:0.0	.	46;46;46;133	Q96CP6-3;Q96CP6;Q96CP6-2;F5GZ02	.;GRM1A_HUMAN;.;.	A	133;46;46	ENSP00000441032:D46A;ENSP00000439267:D46A	ENSP00000441032:D46A	D	+	2	0	GRAMD1A	40191991	1.000000	0.71417	0.569000	0.28460	0.688000	0.40055	4.842000	0.62831	1.965000	0.57142	0.459000	0.35465	GAT	.		0.647	GRAMD1A-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000461557.1	NM_020895	
DHX34	9704	ucsc.edu;bcgsc.ca	37	19	47858386	47858386	+	Missense_Mutation	SNP	C	C	T	rs371092274		TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr19:47858386C>T	ENST00000328771.4	+	3	1145	c.796C>T	c.(796-798)Cgg>Tgg	p.R266W		NM_014681.5	NP_055496.2	Q14147	DHX34_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 34	266	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	membrane (GO:0016020)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(5)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		all_cancers(25;1.65e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;7.16e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000489)|GBM - Glioblastoma multiforme(486;0.00413)|Epithelial(262;0.0132)		ACAAATCCAGCGGGAACCCAG	0.597																																					p.R266W													.	DHX34-231	0			c.C796T						.	C	TRP/ARG	0,4406		0,0,2203	88.0	76.0	80.0		796	4.8	1.0	19		80	1,8599	1.2+/-3.3	0,1,4299	no	missense	DHX34	NM_014681.5	101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	266/1144	47858386	1,13005	2203	4300	6503	SO:0001583	missense	9704	exon3			ATCCAGCGGGAAC	D50924	CCDS12700.1	19q13.3	2003-06-13	2003-06-13	2003-06-13	ENSG00000134815	ENSG00000134815		"""DEAH-boxes"""	16719	protein-coding gene	gene with protein product		615475	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 34"""	DDX34		10708517, 8590280	Standard	NM_014681		Approved	KIAA0134	uc010xyn.2	Q14147	OTTHUMG00000149959	ENST00000328771.4:c.796C>T	19.37:g.47858386C>T	ENSP00000331907:p.Arg266Trp	194	2		281	54	NM_014681	0	0	2	2	0	B4DMY8	Missense_Mutation	SNP	ENST00000328771.4	37	CCDS12700.1	.	.	.	.	.	.	.	.	.	.	C	19.65	3.867337	0.72065	0.0	1.16E-4	ENSG00000134815	ENST00000328771;ENST00000257252	T	0.07688	3.17	4.76	4.76	0.60689	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.110120	0.36374	N	0.002626	T	0.23014	0.0556	M	0.77820	2.39	0.46061	D	0.99884	D;D	0.67145	0.996;0.996	P;P	0.56788	0.806;0.803	T	0.00849	-1.1541	10	0.87932	D	0	-0.0613	11.7971	0.52106	0.176:0.824:0.0:0.0	.	266;266	Q14147;B4E3G3	DHX34_HUMAN;.	W	266	ENSP00000331907:R266W	ENSP00000257252:R266W	R	+	1	2	DHX34	52550226	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	1.007000	0.29860	2.213000	0.71641	0.456000	0.33151	CGG	.		0.597	DHX34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314313.3	NM_014681	
ZNF418	147686	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	58438722	58438722	+	Missense_Mutation	SNP	T	T	A			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr19:58438722T>A	ENST00000396147.1	-	4	1118	c.827A>T	c.(826-828)cAt>cTt	p.H276L	ZNF418_ENST00000595830.1_Missense_Mutation_p.H276L|ZNF418_ENST00000599086.1_5'Flank|ZNF418_ENST00000600989.1_Intron|ZNF418_ENST00000425570.3_Missense_Mutation_p.H297L|ZNF418_ENST00000599852.1_Missense_Mutation_p.H191L	NM_133460.1	NP_597717.1	Q8TF45	ZN418_HUMAN	zinc finger protein 418	276					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	31		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0158)		AACTCGCTGATGCTGAACAAG	0.433																																					p.H276L		.											.	ZNF418-90	0			c.A827T						.						90.0	92.0	91.0					19																	58438722		2189	4296	6485	SO:0001583	missense	147686	exon4			CGCTGATGCTGAA	AB075836, AY695825	CCDS42642.1	19q13.43	2013-01-08				ENSG00000196724		"""Zinc fingers, C2H2-type"", ""-"""	20647	protein-coding gene	gene with protein product						11853319	Standard	NM_133460		Approved	KIAA1956, FLJ31551	uc002qqs.1	Q8TF45		ENST00000396147.1:c.827A>T	19.37:g.58438722T>A	ENSP00000379451:p.His276Leu	142	0		172	34	NM_133460	0	0	0	0	0	Q2M1S2|Q670L5|Q96N18	Missense_Mutation	SNP	ENST00000396147.1	37	CCDS42642.1	.	.	.	.	.	.	.	.	.	.	.	11.49	1.655252	0.29425	.	.	ENSG00000196724	ENST00000396147;ENST00000425570;ENST00000545403	D;D	0.86865	-2.18;-2.18	2.26	1.15	0.20763	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.90147	0.6921	H	0.98295	4.195	0.09310	N	0.999995	P	0.38110	0.618	B	0.33254	0.16	D	0.83866	0.0271	9	0.87932	D	0	.	6.5871	0.22626	0.2146:0.0:0.0:0.7854	.	276	Q8TF45	ZN418_HUMAN	L	276;297;242	ENSP00000379451:H276L;ENSP00000407039:H297L	ENSP00000379451:H276L	H	-	2	0	ZNF418	63130534	.	.	0.001000	0.08648	0.109000	0.19521	.	.	0.129000	0.18514	0.240000	0.17902	CAT	.		0.433	ZNF418-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466693.1	NM_133460	
KIDINS220	57498	broad.mit.edu	37	2	8919107	8919107	+	Missense_Mutation	SNP	T	T	A			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr2:8919107T>A	ENST00000256707.3	-	19	2714	c.2533A>T	c.(2533-2535)Aat>Tat	p.N845Y	KIDINS220_ENST00000473731.1_Missense_Mutation_p.N845Y|KIDINS220_ENST00000418530.1_Missense_Mutation_p.N803Y|KIDINS220_ENST00000427284.1_Missense_Mutation_p.N845Y|KIDINS220_ENST00000319688.5_Missense_Mutation_p.N846Y	NM_020738.2	NP_065789.1	Q9ULH0	KDIS_HUMAN	kinase D-interacting substrate, 220kDa	845	KAP NTPase.				activation of MAPKK activity (GO:0000186)|cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|dendrite morphogenesis (GO:0048813)|in utero embryonic development (GO:0001701)|nerve growth factor signaling pathway (GO:0038180)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of neuron projection development (GO:0010976)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|protein complex (GO:0043234)	PDZ domain binding (GO:0030165)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(25)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	60	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					CCACGACTATTAAGGAACACA	0.418																																					p.N845Y													.	KIDINS220-93	0			c.A2533T						.						220.0	199.0	206.0					2																	8919107		1903	4132	6035	SO:0001583	missense	57498	exon19			GACTATTAAGGAA	AK025528	CCDS42650.1	2p24	2013-01-10			ENSG00000134313	ENSG00000134313		"""Ankyrin repeat domain containing"""	29508	protein-coding gene	gene with protein product	"""ankyrin repeat-rich membrane-spanning protein"""	615759				10998417, 10574462	Standard	NM_020738		Approved	ARMS	uc002qzc.2	Q9ULH0	OTTHUMG00000151658	ENST00000256707.3:c.2533A>T	2.37:g.8919107T>A	ENSP00000256707:p.Asn845Tyr	96	0		115	3	NM_020738	0	0	1	1	0	A1L4N4|Q4VC08|Q6MZU2|Q9H889|Q9H9E4|Q9NT37|Q9UF42	Missense_Mutation	SNP	ENST00000256707.3	37	CCDS42650.1	.	.	.	.	.	.	.	.	.	.	T	16.46	3.128451	0.56721	.	.	ENSG00000134313	ENST00000496383;ENST00000541927;ENST00000256707;ENST00000427284;ENST00000418530;ENST00000473731;ENST00000489024;ENST00000319688	T;T;T;T;T;T;T	0.32023	1.47;1.47;1.47;1.47;1.47;1.47;1.47	5.64	5.64	0.86602	KAP P-loop (1);	0.000000	0.85682	D	0.000000	T	0.54143	0.1840	M	0.63428	1.95	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.97110	0.999;0.986;1.0;1.0	T	0.56251	-0.8010	10	0.72032	D	0.01	.	16.1617	0.81721	0.0:0.0:0.0:1.0	.	846;846;803;845	B4DK94;E9PH70;Q9ULH0-2;Q9ULH0	.;.;.;KDIS_HUMAN	Y	592;529;845;845;803;845;846;846	ENSP00000420364:N592Y;ENSP00000256707:N845Y;ENSP00000411849:N845Y;ENSP00000414923:N803Y;ENSP00000418974:N845Y;ENSP00000419964:N846Y;ENSP00000319947:N846Y	ENSP00000256707:N845Y	N	-	1	0	KIDINS220	8836558	1.000000	0.71417	0.313000	0.25210	0.057000	0.15508	7.948000	0.87774	2.275000	0.75901	0.528000	0.53228	AAT	.		0.418	KIDINS220-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323408.2	NM_020738	
VWA3B	200403	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	98907042	98907042	+	Silent	SNP	G	G	A			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr2:98907042G>A	ENST00000477737.1	+	23	3318	c.3114G>A	c.(3112-3114)caG>caA	p.Q1038Q	VWA3B_ENST00000490947.2_3'UTR	NM_144992.4	NP_659429.4	Q502W6	VWA3B_HUMAN	von Willebrand factor A domain containing 3B	1038										NS(3)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						TCAAAGGACAGAAGGTTATTG	0.323																																					p.Q1038Q													.	VWA3B-139	0			c.G3114A						.						109.0	101.0	103.0					2																	98907042		1815	4071	5886	SO:0001819	synonymous_variant	200403	exon23			AGGACAGAAGGTT	AL832761	CCDS42718.1	2q11.2	2008-02-05			ENSG00000168658	ENSG00000168658			28385	protein-coding gene	gene with protein product						12477932	Standard	NM_144992		Approved	DKFZp686F2227, MGC26733	uc002syo.3	Q502W6	OTTHUMG00000153104	ENST00000477737.1:c.3114G>A	2.37:g.98907042G>A		324	1		353	59	NM_144992	0	0	0	0	0	B9EK71|Q86T73|Q8N2D0|Q8N770|Q8NA79|Q8ND63|Q8ND65|Q8WW02	Silent	SNP	ENST00000477737.1	37	CCDS42718.1	.	.	.	.	.	.	.	.	.	.	G	7.644	0.681410	0.14907	.	.	ENSG00000168658	ENST00000473149	.	.	.	4.52	4.52	0.55395	.	.	.	.	.	T	0.58466	0.2124	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55366	-0.8152	4	.	.	.	.	8.6822	0.34216	0.1025:0.0:0.8975:0.0	.	.	.	.	K	449	.	.	E	+	1	0	VWA3B	98273474	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.549000	0.45803	2.499000	0.84300	0.557000	0.71058	GAA	.		0.323	VWA3B-020	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353469.2	NM_144992	
NEB	4703	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	152426612	152426612	+	Missense_Mutation	SNP	A	A	T			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr2:152426612A>T	ENST00000172853.10	-	81	12457	c.12310T>A	c.(12310-12312)Tac>Aac	p.Y4104N	NEB_ENST00000604864.1_Missense_Mutation_p.Y5805N|NEB_ENST00000603639.1_Missense_Mutation_p.Y5805N|NEB_ENST00000409198.1_Missense_Mutation_p.Y4104N|NEB_ENST00000397345.3_Missense_Mutation_p.Y5805N|NEB_ENST00000427231.2_Missense_Mutation_p.Y5805N			P20929	NEBU_HUMAN	nebulin	4104					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		TGCAGTTCGTAGGCCTTCTTG	0.507																																					p.Y5805N													.	NEB-145	0			c.T17413A						.						40.0	40.0	40.0					2																	152426612		2059	4189	6248	SO:0001583	missense	4703	exon109			GTTCGTAGGCCTT	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.12310T>A	2.37:g.152426612A>T	ENSP00000172853:p.Tyr4104Asn	126	1		148	32	NM_001271208	0	0	0	0	0	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	ENST00000172853.10	37		.	.	.	.	.	.	.	.	.	.	A	19.45	3.830650	0.71258	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000397342;ENST00000413693;ENST00000172853	T;T;T;T;T	0.43688	0.94;0.94;0.94;0.94;0.94	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.66626	0.2808	M	0.77486	2.375	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.97110	1.0;0.999	T	0.69003	-0.5260	10	0.54805	T	0.06	.	16.4101	0.83708	1.0:0.0:0.0:0.0	.	4104;535	P20929;Q14215	NEBU_HUMAN;.	N	4104;5805;5805;153;535;4104	ENSP00000386259:Y4104N;ENSP00000380505:Y5805N;ENSP00000416578:Y5805N;ENSP00000410961:Y535N;ENSP00000172853:Y4104N	ENSP00000172853:Y4104N	Y	-	1	0	NEB	152134858	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	9.339000	0.96797	2.280000	0.76307	0.460000	0.39030	TAC	.		0.507	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543	
CCDC141	285025	broad.mit.edu	37	2	179701995	179701995	+	Silent	SNP	A	A	T			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr2:179701995A>T	ENST00000420890.2	-	23	4068	c.3951T>A	c.(3949-3951)gcT>gcA	p.A1317A	CCDC141_ENST00000480419.1_5'UTR|CCDC141_ENST00000295723.5_Silent_p.A742A	NM_173648.3	NP_775919.3	Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	1317										NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(37)|ovary(8)|pancreas(2)|skin(4)|upper_aerodigestive_tract(1)	78			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			CTGGATGTTCAGCACTGATTC	0.493																																					p.A1317A													.	CCDC141-78	0			c.T3951A						.						120.0	105.0	110.0					2																	179701995		2203	4300	6503	SO:0001819	synonymous_variant	285025	exon23			ATGTTCAGCACTG	AK096821		2q31.2	2013-01-14			ENSG00000163492	ENSG00000163492		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26821	protein-coding gene	gene with protein product	"""coiled-coil protein associated with myosin II and DISC1"""					20956536	Standard	NM_173648		Approved	FLJ39502, CAMDI	uc002une.2	Q6ZP82	OTTHUMG00000132578	ENST00000420890.2:c.3951T>A	2.37:g.179701995A>T		190	0		228	4	NM_173648	0	0	0	0	0	H7C0P1|J3KNW6|Q8N8H3	Silent	SNP	ENST00000420890.2	37																																																																																				.		0.493	CCDC141-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_173648	
PLCL1	5334	ucsc.edu;bcgsc.ca	37	2	198949559	198949559	+	Missense_Mutation	SNP	C	C	G	rs376872615		TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr2:198949559C>G	ENST00000428675.1	+	2	1716	c.1318C>G	c.(1318-1320)Cga>Gga	p.R440G	PLCL1_ENST00000437704.2_Missense_Mutation_p.R342G	NM_006226.3	NP_006217.3	Q15111	PLCL1_HUMAN	phospholipase C-like 1	440	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				gamma-aminobutyric acid signaling pathway (GO:0007214)|intracellular signal transduction (GO:0035556)|lipid metabolic process (GO:0006629)|positive regulation of receptor binding (GO:1900122)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|inositol 1,4,5 trisphosphate binding (GO:0070679)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(14)|lung(44)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	80					Quinacrine(DB01103)	AATGGGCTGTCGAAGCGTTGA	0.408																																					p.R440G													.	PLCL1-228	0			c.C1318G						.						61.0	59.0	59.0					2																	198949559		2203	4300	6503	SO:0001583	missense	5334	exon2			GGCTGTCGAAGCG	D42108	CCDS2326.1, CCDS2326.2	2q33	2014-06-13	2002-02-18	2002-02-22	ENSG00000115896	ENSG00000115896			9063	protein-coding gene	gene with protein product	"""phospholipase C related, but catalytically inactive protein"", ""protein phosphatase 1, regulatory subunit 127"""	600597	"""phospholipase C, epsilon"""	PLCE		7633416	Standard	NM_006226		Approved	PLC-L, PLCL, PRIP, PPP1R127	uc010fsp.3	Q15111	OTTHUMG00000132750	ENST00000428675.1:c.1318C>G	2.37:g.198949559C>G	ENSP00000402861:p.Arg440Gly	238	3		282	62	NM_006226	0	0	0	0	0	Q3MJ90|Q53SD3|Q7Z3S3	Missense_Mutation	SNP	ENST00000428675.1	37	CCDS2326.2	.	.	.	.	.	.	.	.	.	.	C	13.17	2.158059	0.38119	.	.	ENSG00000115896	ENST00000428675;ENST00000437704	T;T	0.81415	-1.49;-1.49	5.94	2.89	0.33648	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific , X domain (3);	0.000000	0.53938	D	0.000051	D	0.93449	0.7910	H	0.98466	4.24	0.58432	D	0.999995	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96190	0.9137	9	.	.	.	.	15.4712	0.75441	0.4363:0.5637:0.0:0.0	.	440;366	Q15111;B4DYZ4	PLCL1_HUMAN;.	G	440;342	ENSP00000402861:R440G;ENSP00000414138:R342G	.	R	+	1	2	PLCL1	198657804	0.997000	0.39634	1.000000	0.80357	0.930000	0.56654	1.426000	0.34870	1.501000	0.48654	0.561000	0.74099	CGA	.		0.408	PLCL1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340210.1	NM_006226	
CPS1	1373	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	211471605	211471605	+	Missense_Mutation	SNP	G	G	T			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr2:211471605G>T	ENST00000233072.5	+	18	2328	c.2132G>T	c.(2131-2133)tGc>tTc	p.C711F	CPS1_ENST00000430249.2_Missense_Mutation_p.C717F|CPS1_ENST00000451903.2_Missense_Mutation_p.C260F	NM_001875.4	NP_001866.2	P31327	CPSM_HUMAN	carbamoyl-phosphate synthase 1, mitochondrial	711	ATP-grasp 1.				anion homeostasis (GO:0055081)|carbamoyl phosphate biosynthetic process (GO:0070409)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to glucagon stimulus (GO:0071377)|cellular response to oleic acid (GO:0071400)|citrulline biosynthetic process (GO:0019240)|glutamine catabolic process (GO:0006543)|glycogen catabolic process (GO:0005980)|hepatocyte differentiation (GO:0070365)|homocysteine metabolic process (GO:0050667)|midgut development (GO:0007494)|nitric oxide metabolic process (GO:0046209)|positive regulation of vasodilation (GO:0045909)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to dexamethasone (GO:0071548)|response to drug (GO:0042493)|response to food (GO:0032094)|response to growth hormone (GO:0060416)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|carbamoyl-phosphate synthase (ammonia) activity (GO:0004087)|endopeptidase activity (GO:0004175)|glutamate binding (GO:0016595)|modified amino acid binding (GO:0072341)|phospholipid binding (GO:0005543)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(85)|ovary(8)|pancreas(1)|prostate(6)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	142				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	Carglumic Acid(DB06775)	ATGGAATACTGCATCATTGAA	0.458																																					p.C717F													.	CPS1-162	0			c.G2150T						.						129.0	110.0	116.0					2																	211471605		2203	4300	6503	SO:0001583	missense	1373	exon19			AATACTGCATCAT	AF154830	CCDS2393.1, CCDS46505.1, CCDS46506.1	2p	2014-09-17	2010-05-11		ENSG00000021826	ENSG00000021826	6.3.4.16		2323	protein-coding gene	gene with protein product		608307	"""carbamoyl-phosphate synthetase 1, mitochondrial"""				Standard	NM_001122633		Approved		uc002vee.4	P31327	OTTHUMG00000132994	ENST00000233072.5:c.2132G>T	2.37:g.211471605G>T	ENSP00000233072:p.Cys711Phe	214	1		276	51	NM_001122633	0	0	2	2	0	B7Z818|J3KQL0|O43774|Q53TL5|Q59HF8|Q7Z5I5	Missense_Mutation	SNP	ENST00000233072.5	37	CCDS2393.1	.	.	.	.	.	.	.	.	.	.	G	16.88	3.245638	0.59103	.	.	ENSG00000021826	ENST00000430249;ENST00000539150;ENST00000233072;ENST00000451903	D;D;D	0.96967	-4.19;-4.19;-4.19	5.83	5.83	0.93111	ATP-grasp fold (1);ATP-grasp fold, subdomain 2 (1);Carbamoyl-phosphate synthetase, large subunit, ATP-binding (1);	0.152323	0.64402	D	0.000009	D	0.94712	0.8294	L	0.35341	1.055	0.41705	D	0.989423	D;D	0.53151	0.958;0.958	P;P	0.54060	0.741;0.741	D	0.93061	0.6474	10	0.41790	T	0.15	-24.117	8.7971	0.34885	0.0797:0.0:0.7691:0.1511	.	721;711	Q59HF8;P31327	.;CPSM_HUMAN	F	717;719;711;260	ENSP00000402608:C717F;ENSP00000233072:C711F;ENSP00000406136:C260F	ENSP00000233072:C711F	C	+	2	0	CPS1	211179850	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.300000	0.65721	2.781000	0.95711	0.586000	0.80456	TGC	.		0.458	CPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256569.5		
IKZF2	22807	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	213872649	213872649	+	Missense_Mutation	SNP	T	T	C			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr2:213872649T>C	ENST00000434687.1	-	9	1325	c.1016A>G	c.(1015-1017)cAc>cGc	p.H339R	IKZF2_ENST00000413091.3_3'UTR|IKZF2_ENST00000451136.2_Missense_Mutation_p.H267R|IKZF2_ENST00000457361.1_Missense_Mutation_p.H339R|AC079610.1_ENST00000415387.1_RNA|IKZF2_ENST00000374327.4_Missense_Mutation_p.H194R|IKZF2_ENST00000421754.2_Missense_Mutation_p.H265R|IKZF2_ENST00000342002.2_Missense_Mutation_p.H345R|IKZF2_ENST00000374319.4_Missense_Mutation_p.H313R			Q9UKS7	IKZF2_HUMAN	IKAROS family zinc finger 2 (Helios)	339					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(7)|lung(7)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Esophageal squamous(248;0.0559)|Renal(323;0.218)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;2.97e-07)|all cancers(144;1.53e-05)|LUSC - Lung squamous cell carcinoma(224;0.00599)|Lung(261;0.00792)		GCTTGGCGGGTGCTGCATCAG	0.498																																					p.H339R													.	IKZF2-226	0			c.A1016G						.						106.0	97.0	100.0					2																	213872649		2203	4300	6503	SO:0001583	missense	22807	exon8			GGCGGGTGCTGCA	AF130863	CCDS2395.1, CCDS46507.1	2q13.1	2013-01-08	2006-08-25	2006-08-25	ENSG00000030419	ENSG00000030419		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	13177	protein-coding gene	gene with protein product		606234	"""zinc finger protein, subfamily 1A, 2 (Helios)"""	ZNFN1A2		9512513, 9560339	Standard	NM_001079526		Approved	Helios	uc002vem.3	Q9UKS7	OTTHUMG00000133005	ENST00000434687.1:c.1016A>G	2.37:g.213872649T>C	ENSP00000412869:p.His339Arg	173	1		221	40	NM_016260	0	0	0	0	0	Q53YJ5|Q6PQC5|Q6PQC6|Q6PQC7|Q6PQC8|Q6PQD0|Q6PQD1|Q8N6S1	Missense_Mutation	SNP	ENST00000434687.1	37	CCDS2395.1	.	.	.	.	.	.	.	.	.	.	T	10.59	1.391634	0.25118	.	.	ENSG00000030419	ENST00000457361;ENST00000342002;ENST00000434687;ENST00000374319;ENST00000451136;ENST00000421754;ENST00000374327	T;T;T;T;T;T;T	0.13901	3.3;3.27;3.3;3.33;3.27;3.31;2.55	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	T	0.33411	0.0862	M	0.64997	1.995	0.80722	D	1	D;D;D;B;D;D	0.89917	0.993;0.996;1.0;0.092;0.997;0.989	D;D;D;B;D;D	0.85130	0.943;0.99;0.997;0.07;0.989;0.978	T	0.01966	-1.1238	10	0.45353	T	0.12	-8.9537	12.3172	0.54964	0.0:0.0:0.1409:0.859	.	267;265;194;313;339;117	C9JCG7;C9JTM9;F5H8M1;Q9UKS7-2;Q9UKS7;Q96LD7	.;.;.;.;IKZF2_HUMAN;.	R	339;345;339;313;267;265;194	ENSP00000410447:H339R;ENSP00000342876:H345R;ENSP00000412869:H339R;ENSP00000363439:H313R;ENSP00000395203:H267R;ENSP00000399574:H265R;ENSP00000363447:H194R	ENSP00000342876:H345R	H	-	2	0	IKZF2	213580894	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.696000	0.61774	2.288000	0.76882	0.533000	0.62120	CAC	.		0.498	IKZF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256593.3	NM_016260	
EIF4E2	9470	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	233428989	233428989	+	Missense_Mutation	SNP	G	G	T			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr2:233428989G>T	ENST00000258416.3	+	4	976	c.303G>T	c.(301-303)atG>atT	p.M101I	EIF4E2_ENST00000409167.3_Missense_Mutation_p.M56I|EIF4E2_ENST00000409495.1_Missense_Mutation_p.M101I|EIF4E2_ENST00000409322.1_Missense_Mutation_p.M56I|EIF4E2_ENST00000409098.1_Missense_Mutation_p.M101I|EIF4E2_ENST00000409514.1_Missense_Mutation_p.M101I|EIF4E2_ENST00000409394.1_Missense_Mutation_p.M56I	NM_004846.2	NP_004837.1	O60573	IF4E2_HUMAN	eukaryotic translation initiation factor 4E family member 2	101					cytokine-mediated signaling pathway (GO:0019221)|in utero embryonic development (GO:0001701)|negative regulation of translation (GO:0017148)	cytosol (GO:0005829)|mRNA cap binding complex (GO:0005845)	poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)|ubiquitin protein ligase binding (GO:0031625)			endometrium(2)|kidney(1)|large_intestine(2)|lung(3)	8		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;2.3e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000912)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		ATAGCCACATGGTACGTCCTG	0.458																																					p.M101I													.	EIF4E2-90	0			c.G303T						.						48.0	45.0	46.0					2																	233428989		2203	4300	6503	SO:0001583	missense	9470	exon4			CCACATGGTACGT	AF038957	CCDS2496.1, CCDS63158.1, CCDS63159.1, CCDS74671.1	2q37.1	2008-02-05	2006-11-13	2004-10-30	ENSG00000135930	ENSG00000135930			3293	protein-coding gene	gene with protein product		605895	"""eukaryotic translation initiation factor 4E-like 3"""	EIF4EL3		9653160, 9582349	Standard	XM_005246975		Approved	IF4e, 4EHP	uc002vta.3	O60573	OTTHUMG00000133256	ENST00000258416.3:c.303G>T	2.37:g.233428989G>T	ENSP00000258416:p.Met101Ile	178	1		256	49	NM_004846	0	0	12	28	16	B8ZZJ9|O75349	Missense_Mutation	SNP	ENST00000258416.3	37	CCDS2496.1	.	.	.	.	.	.	.	.	.	.	G	15.90	2.970766	0.53614	.	.	ENSG00000135930	ENST00000258416;ENST00000409514;ENST00000409098;ENST00000409495;ENST00000409167;ENST00000409322;ENST00000409394;ENST00000454501	T;T;T;T;T;T;T;T	0.35421	1.31;1.31;1.31;1.31;1.31;1.31;1.31;1.31	5.65	5.65	0.86999	Translation Initiation factor eIF- 4e-like  domain (2);	0.000000	0.85682	D	0.000000	T	0.16257	0.0391	N	0.01618	-0.8	0.53005	D	0.999961	B;B;B	0.15473	0.013;0.003;0.002	B;B;B	0.24974	0.018;0.057;0.004	T	0.18587	-1.0332	10	0.08599	T	0.76	-10.3692	17.2336	0.86991	0.0:0.0:1.0:0.0	.	56;101;101	B4E1E4;B8ZZJ9;O60573	.;.;IF4E2_HUMAN	I	101;101;101;101;56;56;56;96	ENSP00000258416:M101I;ENSP00000387336:M101I;ENSP00000386996:M101I;ENSP00000386876:M101I;ENSP00000387328:M56I;ENSP00000386424:M56I;ENSP00000386983:M56I;ENSP00000390904:M96I	ENSP00000258416:M101I	M	+	3	0	EIF4E2	233137233	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.876000	0.87215	2.660000	0.90430	0.655000	0.94253	ATG	.		0.458	EIF4E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257033.2	NM_004846	
KIF16B	55614	broad.mit.edu	37	20	16359622	16359622	+	Silent	SNP	G	G	A			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr20:16359622G>A	ENST00000354981.2	-	19	3182	c.3025C>T	c.(3025-3027)Ctg>Ttg	p.L1009L	KIF16B_ENST00000378003.2_Silent_p.L235L|KIF16B_ENST00000408042.1_Silent_p.L1009L|KIF16B_ENST00000355755.3_Silent_p.L1009L	NM_001199865.1|NM_024704.4	NP_001186794.1|NP_078980.3	Q96L93	KI16B_HUMAN	kinesin family member 16B	1009	Glu-rich.				ATP catabolic process (GO:0006200)|early endosome to late endosome transport (GO:0045022)|endoderm development (GO:0007492)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|formation of primary germ layer (GO:0001704)|Golgi to endosome transport (GO:0006895)|microtubule-based movement (GO:0007018)|receptor catabolic process (GO:0032801)|regulation of receptor recycling (GO:0001919)	early endosome (GO:0005769)|endosome (GO:0005768)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|plus-end-directed microtubule motor activity (GO:0008574)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(24)|ovary(1)|prostate(15)|skin(3)|upper_aerodigestive_tract(2)	74						AGCCTGGCCAGGGCCCGCTCC	0.557																																					p.L1009L													.	KIF16B-291	0			c.C3025T						.						82.0	87.0	85.0					20																	16359622		2203	4300	6503	SO:0001819	synonymous_variant	55614	exon19			TGGCCAGGGCCCG	AK000142	CCDS13122.1, CCDS56178.1	20p11.23	2008-03-03	2008-03-03	2008-03-03	ENSG00000089177	ENSG00000089177		"""Kinesins"""	15869	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 23"""	C20orf23		16084724, 16782399	Standard	NM_024704		Approved	FLJ20135, dJ971B4.1, SNX23	uc010gci.2	Q96L93	OTTHUMG00000031927	ENST00000354981.2:c.3025C>T	20.37:g.16359622G>A		97	1		132	4	NM_001199865	0	0	3	3	0	A6NKJ9|A7E2A8|B1AKG3|B1AKT7|C9JDN5|C9JI52|C9JSM8|C9JWJ7|Q2TBF5|Q5HYC0|Q5HYK1|Q5JWW3|Q5TFK5|Q86VL9|Q86YS5|Q8IYU0|Q9BQJ8|Q9BQM0|Q9BQM1|Q9BQM5|Q9H5U0|Q9HCI2|Q9NXN9	Silent	SNP	ENST00000354981.2	37	CCDS13122.1																																																																																			.		0.557	KIF16B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078104.2	NM_017683	
CST9L	128821	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	23546696	23546696	+	Missense_Mutation	SNP	T	T	G			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr20:23546696T>G	ENST00000376979.3	-	2	567	c.269A>C	c.(268-270)gAg>gCg	p.E90A		NM_080610.2	NP_542177.1	Q9H4G1	CST9L_HUMAN	cystatin 9-like	90						extracellular region (GO:0005576)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			breast(1)|endometrium(1)|large_intestine(1)|lung(4)|prostate(1)	8	Colorectal(13;0.0431)|Lung NSC(19;0.235)					CAGCAGTAGCTCCATTGAGAA	0.468																																					p.E90A		.											.	CST9L-90	0			c.A269C						.						205.0	177.0	187.0					20																	23546696		2203	4300	6503	SO:0001583	missense	128821	exon2			AGTAGCTCCATTG		CCDS13157.1	20p11.21	2012-08-14	2008-03-06		ENSG00000101435	ENSG00000101435			16233	protein-coding gene	gene with protein product			"""cystatin 9 (mouse)-like"""			20565543	Standard	NM_080610		Approved	bA218C14.1, CTES7B	uc002wtk.4	Q9H4G1	OTTHUMG00000032073	ENST00000376979.3:c.269A>C	20.37:g.23546696T>G	ENSP00000366178:p.Glu90Ala	244	0		338	67	NM_080610	0	0	0	0	0	B2R5A1	Missense_Mutation	SNP	ENST00000376979.3	37	CCDS13157.1	.	.	.	.	.	.	.	.	.	.	T	12.87	2.067516	0.36470	.	.	ENSG00000101435	ENST00000376979	T	0.28666	1.6	1.92	1.92	0.25849	Proteinase inhibitor I25, cystatin (2);	0.919888	0.08938	N	0.872000	T	0.44265	0.1285	M	0.75264	2.295	0.09310	N	1	D	0.58970	0.984	P	0.55749	0.783	T	0.23619	-1.0183	10	0.37606	T	0.19	.	5.8418	0.18637	0.0:0.0:0.0:1.0	.	90	Q9H4G1	CST9L_HUMAN	A	90	ENSP00000366178:E90A	ENSP00000366178:E90A	E	-	2	0	CST9L	23494696	0.004000	0.15560	0.108000	0.21378	0.004000	0.04260	0.143000	0.16115	1.118000	0.41863	0.402000	0.26972	GAG	.		0.468	CST9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078338.1	NM_080610	
SLC32A1	140679	broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	37356957	37356957	+	Missense_Mutation	SNP	T	T	C			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr20:37356957T>C	ENST00000217420.1	+	2	1516	c.1253T>C	c.(1252-1254)tTc>tCc	p.F418S		NM_080552.2	NP_542119.1	Q9H598	VIAAT_HUMAN	solute carrier family 32 (GABA vesicular transporter), member 1	418					aging (GO:0007568)|ion transport (GO:0006811)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell tip (GO:0051286)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cone cell pedicle (GO:0044316)|dendrite (GO:0030425)|dendrite terminus (GO:0044292)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuron projection terminus (GO:0044306)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	gamma-aminobutyric acid:proton symporter activity (GO:0015495)|glycine transmembrane transporter activity (GO:0015187)			breast(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(16)|urinary_tract(1)	38		Myeloproliferative disorder(115;0.00878)			Glycine(DB00145)	CGCGCCTTTTTCCCGGCCTGC	0.632																																					p.F418S													.	SLC32A1-90	0			c.T1253C						.						31.0	34.0	33.0					20																	37356957		2203	4300	6503	SO:0001583	missense	140679	exon2			CCTTTTTCCCGGC	AL133519	CCDS13307.1	20q11	2013-05-22			ENSG00000101438	ENSG00000101438		"""Solute carriers"""	11018	protein-coding gene	gene with protein product			"""vesicular inhibitory amino acid transporter"""	VIAAT		19843525	Standard	NM_080552		Approved	VGAT, bA122O1.1	uc002xjc.3	Q9H598	OTTHUMG00000032457	ENST00000217420.1:c.1253T>C	20.37:g.37356957T>C	ENSP00000217420:p.Phe418Ser	60	1		92	25	NM_080552	0	0	0	0	0	Q8N489	Missense_Mutation	SNP	ENST00000217420.1	37	CCDS13307.1	.	.	.	.	.	.	.	.	.	.	T	15.82	2.946656	0.53186	.	.	ENSG00000101438	ENST00000217420	T	0.02140	4.43	4.45	4.45	0.53987	.	0.050284	0.85682	D	0.000000	T	0.04679	0.0127	M	0.72894	2.215	0.80722	D	1	B	0.26195	0.144	B	0.32211	0.142	T	0.31223	-0.9951	10	0.34782	T	0.22	-23.406	11.9404	0.52896	0.0:0.0:0.0:1.0	.	418	Q9H598	VIAAT_HUMAN	S	418	ENSP00000217420:F418S	ENSP00000217420:F418S	F	+	2	0	SLC32A1	36790371	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.944000	0.87722	1.786000	0.52430	0.460000	0.39030	TTC	.		0.632	SLC32A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079206.1	NM_080552	
DHX35	60625	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	37653978	37653978	+	Nonsense_Mutation	SNP	C	C	T			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr20:37653978C>T	ENST00000252011.3	+	18	1810	c.1777C>T	c.(1777-1779)Caa>Taa	p.Q593*	DHX35_ENST00000373325.2_Nonsense_Mutation_p.Q593*|DHX35_ENST00000373323.4_Nonsense_Mutation_p.Q562*	NM_021931.3	NP_068750.2	Q9H5Z1	DHX35_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 35	593					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(13)|ovary(1)|skin(2)|stomach(1)|urinary_tract(2)	40		Myeloproliferative disorder(115;0.00878)				TGTCAAGTTTCAAGTGCCCAG	0.443																																					p.Q593X		.											.	DHX35-226	0			c.C1777T						.						176.0	185.0	182.0					20																	37653978		2203	4300	6503	SO:0001587	stop_gained	60625	exon18			AAGTTTCAAGTGC	AK026412	CCDS13310.1, CCDS54463.1	20q11.22-q12	2003-06-13	2003-06-13	2003-06-13	ENSG00000101452	ENSG00000101452		"""DEAH-boxes"""	15861	protein-coding gene	gene with protein product			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 35"""	C20orf15, DDX35			Standard	NM_001190809		Approved	FLJ22759, KAIA0875	uc002xjh.3	Q9H5Z1	OTTHUMG00000032463	ENST00000252011.3:c.1777C>T	20.37:g.37653978C>T	ENSP00000252011:p.Gln593*	186	0		222	42	NM_021931	0	0	1	2	1	A2RTX3|B4E0J0|F5GXM6|Q5THR0|Q9H4H7|Q9H6T6	Nonsense_Mutation	SNP	ENST00000252011.3	37	CCDS13310.1	.	.	.	.	.	.	.	.	.	.	C	38	6.967926	0.97971	.	.	ENSG00000101452	ENST00000373325;ENST00000252011;ENST00000373323;ENST00000373321;ENST00000449559	.	.	.	5.41	4.4	0.53042	.	0.097447	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.4304	0.44405	0.3784:0.6216:0.0:0.0	.	.	.	.	X	593;593;562;73;57	.	ENSP00000252011:Q593X	Q	+	1	0	DHX35	37087392	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.037000	0.64170	2.530000	0.85305	0.655000	0.94253	CAA	.		0.443	DHX35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079212.2	NM_021931	
SLC9A8	23315	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	48431566	48431566	+	Silent	SNP	T	T	C	rs536021956		TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr20:48431566T>C	ENST00000361573.2	+	2	90	c.48T>C	c.(46-48)caT>caC	p.H16H	SLC9A8_ENST00000541138.1_5'UTR|SLC9A8_ENST00000417961.1_Silent_p.H16H|SLC9A8_ENST00000539601.1_5'UTR			Q9Y2E8	SL9A8_HUMAN	solute carrier family 9, subfamily A (NHE8, cation proton antiporter 8), member 8	16					ion transport (GO:0006811)|regulation of intracellular pH (GO:0051453)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	potassium:proton antiporter activity (GO:0015386)|sodium:proton antiporter activity (GO:0015385)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	30			BRCA - Breast invasive adenocarcinoma(9;3.91e-07)			ATACAACTCATGAGGGTTTCA	0.522																																					p.H16H		.											.	SLC9A8-91	0			c.T48C						.						90.0	78.0	82.0					20																	48431566		2203	4300	6503	SO:0001819	synonymous_variant	23315	exon2			AACTCATGAGGGT	AB023156	CCDS13421.1, CCDS58774.1	20q13.13	2013-05-22	2012-03-22		ENSG00000197818	ENSG00000197818		"""Solute carriers"""	20728	protein-coding gene	gene with protein product		612730	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 8"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 8"""			12409279	Standard	NM_001260491		Approved	KIAA0939, NHE8	uc002xuv.2	Q9Y2E8	OTTHUMG00000032710	ENST00000361573.2:c.48T>C	20.37:g.48431566T>C		127	0		184	45	NM_001260491	0	0	2	2	0	B4DTQ8|Q2M1U9|Q68CZ8|Q9BX15|Q9Y507	Silent	SNP	ENST00000361573.2	37	CCDS13421.1																																																																																			.		0.522	SLC9A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106483.3	XM_030524	
MYO18B	84700	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	26422672	26422672	+	Silent	SNP	C	C	T			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr22:26422672C>T	ENST00000407587.2	+	43	6904	c.6735C>T	c.(6733-6735)ccC>ccT	p.P2245P	MYO18B_ENST00000335473.7_Silent_p.P2244P|MYO18B_ENST00000536101.1_Silent_p.P2244P			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	2244						cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						AAAAGCTGCCCAGTCCTTCAG	0.607																																					p.P2244P		.											.	MYO18B-142	0			c.C6732T						.						24.0	25.0	25.0					22																	26422672		1910	4104	6014	SO:0001819	synonymous_variant	84700	exon43			GCTGCCCAGTCCT	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.6735C>T	22.37:g.26422672C>T		128	0		159	30	NM_032608	0	0	0	0	0	B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Silent	SNP	ENST00000407587.2	37		.	.	.	.	.	.	.	.	.	.	C	10.77	1.444427	0.25987	.	.	ENSG00000133454	ENST00000543971	T	0.55234	0.53	4.94	-4.84	0.03151	.	0.116110	0.34002	N	0.004359	T	0.50394	0.1613	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53315	-0.8456	7	0.72032	D	0.01	.	5.3684	0.16127	0.2432:0.2637:0.4198:0.0733	.	.	.	.	L	194	ENSP00000444262:P194L	ENSP00000444262:P194L	P	+	2	0	MYO18B	24752672	0.013000	0.17824	0.962000	0.40283	0.992000	0.81027	-1.785000	0.01767	-0.418000	0.07450	0.491000	0.48974	CCA	.		0.607	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	NM_032608	
NEFH	4744	bcgsc.ca	37	22	29885429	29885429	+	Silent	SNP	T	T	C			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr22:29885429T>C	ENST00000310624.6	+	4	1833	c.1800T>C	c.(1798-1800)tcT>tcC	p.S600S		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	600	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						AGGCCAAGTCTCCAGAGAAGG	0.552																																					p.S600S													.	NEFH-90	0			c.T1800C						.						65.0	62.0	63.0					22																	29885429		2203	4300	6503	SO:0001819	synonymous_variant	4744	exon4			CAAGTCTCCAGAG		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1800T>C	22.37:g.29885429T>C		221	2		293	32	NM_021076	0	0	0	0	0	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Silent	SNP	ENST00000310624.6	37	CCDS13858.1																																																																																			.		0.552	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
NEFH	4744	hgsc.bcm.edu	37	22	29885562	29885562	+	Missense_Mutation	SNP	G	G	A	rs370929798		TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr22:29885562G>A	ENST00000310624.6	+	4	1966	c.1933G>A	c.(1933-1935)Gaa>Aaa	p.E645K		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	645	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						AACGAAGGAGGAAGCAAAGTC	0.562																																					p.E645K		.											.	NEFH-90	0			c.G1933A						.						82.0	88.0	86.0					22																	29885562		2203	4300	6503	SO:0001583	missense	4744	exon4			AAGGAGGAAGCAA		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1933G>A	22.37:g.29885562G>A	ENSP00000311997:p.Glu645Lys	282	0		335	34	NM_021076	0	0	1	1	0	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Missense_Mutation	SNP	ENST00000310624.6	37	CCDS13858.1	.	.	.	.	.	.	.	.	.	.	G	9.212	1.031217	0.19590	.	.	ENSG00000100285	ENST00000328842;ENST00000310624	D	0.83914	-1.78	4.97	4.97	0.65823	.	0.115504	0.38778	N	0.001569	D	0.87783	0.6264	L	0.61218	1.895	0.29104	N	0.881289	P	0.36712	0.566	P	0.52267	0.694	D	0.83526	0.0088	10	0.44086	T	0.13	.	16.1111	0.81263	0.0:0.0:1.0:0.0	.	645	P12036	NFH_HUMAN	K	645	ENSP00000311997:E645K	ENSP00000311997:E645K	E	+	1	0	NEFH	28215562	0.001000	0.12720	0.367000	0.25926	0.091000	0.18340	0.923000	0.28757	2.745000	0.94114	0.491000	0.48974	GAA	.		0.562	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
BAIAP2L2	80115	hgsc.bcm.edu	37	22	38483172	38483172	+	Silent	SNP	G	G	T	rs539447143	byFrequency	TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr22:38483172G>T	ENST00000381669.3	-	11	1362	c.1218C>A	c.(1216-1218)tcC>tcA	p.S406S	CTA-228A9.3_ENST00000609162.1_lincRNA	NM_025045.4	NP_079321.3	Q6UXY1	BI2L2_HUMAN	BAI1-associated protein 2-like 2	406					filopodium assembly (GO:0046847)|membrane organization (GO:0061024)|regulation of actin cytoskeleton organization (GO:0032956)|signal transduction (GO:0007165)	cell-cell contact zone (GO:0044291)|cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	phospholipid binding (GO:0005543)			large_intestine(2)|lung(1)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)	8	Melanoma(58;0.045)					gtgtcatgggggacatggagg	0.662													G|||	30	0.00599042	0.0068	0.0014	5008	,	,		13061	0.0		0.004	False		,,,				2504	0.0164				p.S406S		.											.	BAIAP2L2-91	0			c.C1218A						.						31.0	37.0	35.0					22																	38483172		1925	4122	6047	SO:0001819	synonymous_variant	80115	exon11			CATGGGGGACATG	BC015619	CCDS43018.1	22q13.1	2005-02-09			ENSG00000128298	ENSG00000128298			26203	protein-coding gene	gene with protein product							Standard	NM_025045		Approved	FLJ22582	uc003auw.3	Q6UXY1	OTTHUMG00000151197	ENST00000381669.3:c.1218C>A	22.37:g.38483172G>T		103	0		146	17	NM_025045	0	0	17	17	0	B0QYE2|Q96BG7	Silent	SNP	ENST00000381669.3	37	CCDS43018.1																																																																																			.		0.662	BAIAP2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321727.1	NM_025045	
GRAP2	9402	broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	40367067	40367067	+	Silent	SNP	C	C	T			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr22:40367067C>T	ENST00000344138.4	+	8	1235	c.972C>T	c.(970-972)taC>taT	p.Y324Y	GRAP2_ENST00000399090.2_Silent_p.Y211Y|GRAP2_ENST00000540310.1_Silent_p.Y258Y|GRAP2_ENST00000407075.3_Silent_p.Y324Y|GRAP2_ENST00000543252.1_Silent_p.Y272Y|GRAP2_ENST00000544756.1_Silent_p.Y252Y	NM_004810.2	NP_004801.1	O75791	GRAP2_HUMAN	GRB2-related adaptor protein 2	324	SH3 2. {ECO:0000255|PROSITE- ProRule:PRU00192}.				cell-cell signaling (GO:0007267)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|positive regulation of signal transduction (GO:0009967)|Ras protein signal transduction (GO:0007265)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|nucleus (GO:0005634)	SH3/SH2 adaptor activity (GO:0005070)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	14						CTGCCAACTACGTGGCACCCA	0.582																																					p.Y324Y													.	GRAP2-227	0			c.C972T						.						77.0	67.0	71.0					22																	40367067		2203	4300	6503	SO:0001819	synonymous_variant	9402	exon8			CAACTACGTGGCA	AF102694	CCDS13999.1	22q13.2	2013-02-14			ENSG00000100351	ENSG00000100351		"""SH2 domain containing"""	4563	protein-coding gene	gene with protein product		604518				9878555, 10224278	Standard	XM_005261836		Approved	Grf40, GrbX, GRBLG, GADS, Mona	uc003ayh.2	O75791	OTTHUMG00000151097	ENST00000344138.4:c.972C>T	22.37:g.40367067C>T		104	1		112	30	NM_004810	0	0	2	2	0	B7Z8I3|O43726|Q9NRB7	Silent	SNP	ENST00000344138.4	37	CCDS13999.1																																																																																			.		0.582	GRAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321295.1	NM_004810	
SHANK3	85358	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	51159826	51159826	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr22:51159826G>A	ENST00000414786.2	+	21	3750	c.3523G>A	c.(3523-3525)Gag>Aag	p.E1175K	SHANK3_ENST00000445220.2_Missense_Mutation_p.E1191K|SHANK3_ENST00000262795.3_Missense_Mutation_p.E1205K			Q9BYB0	SHAN3_HUMAN	SH3 and multiple ankyrin repeat domains 3	1189					adult behavior (GO:0030534)|alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|brain morphogenesis (GO:0048854)|dendritic spine morphogenesis (GO:0060997)|guanylate kinase-associated protein clustering (GO:0097117)|learning (GO:0007612)|MAPK cascade (GO:0000165)|memory (GO:0007613)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of actin filament bundle assembly (GO:0032232)|negative regulation of cell volume (GO:0045794)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of glutamate receptor signaling pathway (GO:1900451)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse structural plasticity (GO:0051835)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density assembly (GO:0097107)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of long term synaptic depression (GO:1900452)|regulation of long-term synaptic potentiation (GO:1900271)|social behavior (GO:0035176)|striatal medium spiny neuron differentiation (GO:0021773)|synapse assembly (GO:0007416)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|neuron spine (GO:0044309)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(5)	8		all_cancers(38;3.75e-11)|all_epithelial(38;1.82e-09)|Breast(42;0.000448)|all_lung(38;0.000665)|Lung NSC(38;0.0104)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		BRCA - Breast invasive adenocarcinoma(115;0.22)		GAAGTCACCCGAGGACAAGAA	0.662																																					p.E1175K		.											.	SHANK3-69	0			c.G3523A						.						39.0	48.0	45.0					22																	51159826		2100	4200	6300	SO:0001583	missense	85358	exon21			TCACCCGAGGACA	AB051437		22q13.3	2013-11-14			ENSG00000251322	ENSG00000251322		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14294	protein-coding gene	gene with protein product	"""proline rich synapse associated protein 2"", ""shank postsynaptic density protein"""	606230				11258795, 11431708, 10806096, 17173049	Standard	NM_033517		Approved	SPANK-2, prosap2, KIAA1650, PSAP2	uc031ryd.1	Q9BYB0	OTTHUMG00000150169	ENST00000414786.2:c.3523G>A	22.37:g.51159826G>A	ENSP00000464552:p.Glu1175Lys	177	0		213	39	NM_033517	0	0	0	0	0	D7UT47|Q8TET3	Missense_Mutation	SNP	ENST00000414786.2	37		.	.	.	.	.	.	.	.	.	.	G	15.47	2.843265	0.51057	.	.	ENSG00000251322	ENST00000262795;ENST00000445220	T;T	0.26373	1.74;1.74	4.58	4.58	0.56647	.	0.163605	0.51477	D	0.000081	T	0.25827	0.0629	M	0.70275	2.135	0.29353	N	0.865219	D;P;P	0.53462	0.96;0.492;0.921	B;B;B	0.34489	0.184;0.024;0.163	T	0.43556	-0.9384	10	0.56958	D	0.05	.	14.8583	0.70359	0.0:0.0:1.0:0.0	.	1189;1190;1205	D7UT47;Q9BYB0;F2Z3L0	.;SHAN3_HUMAN;.	K	1205;1191	ENSP00000442518:E1205K;ENSP00000446078:E1191K	ENSP00000442518:E1205K	E	+	1	0	SHANK3	49506692	1.000000	0.71417	0.875000	0.34327	0.943000	0.58893	8.323000	0.90002	2.093000	0.63338	0.462000	0.41574	GAG	.		0.662	SHANK3-001	KNOWN	non_canonical_polymorphism|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000316674.2	NM_001080420	
TMEM43	79188	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	14183165	14183165	+	Missense_Mutation	SNP	C	C	T	rs63750743		TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr3:14183165C>T	ENST00000306077.4	+	12	1327	c.1073C>T	c.(1072-1074)tCg>tTg	p.S358L	RP11-434D12.1_ENST00000601399.1_Intron|RP11-434D12.1_ENST00000608606.1_Intron	NM_024334.2	NP_077310.1	Q9BTV4	TMM43_HUMAN	transmembrane protein 43	358			S -> L (in ARVD5). {ECO:0000269|PubMed:18313022}.		nuclear membrane organization (GO:0071763)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(1)|cervix(3)|endometrium(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|skin(2)	19						GTGGCCACCTCGCTGACCCTG	0.602																																					p.S358L		.											.	TMEM43-91	0			c.C1073T	GRCh37	CM081452	TMEM43	M	rs63750743	.						135.0	110.0	119.0					3																	14183165		2203	4300	6503	SO:0001583	missense	79188	exon12			CCACCTCGCTGAC	BC008054	CCDS2618.1	3p25.1	2014-09-17			ENSG00000170876	ENSG00000170876			28472	protein-coding gene	gene with protein product		612048	"""arrhythmogenic right ventricular dysplasia 5"""	ARVD5		11230166, 18313022	Standard	NM_024334		Approved	MGC3222, DKFZp586G1919, LUMA	uc003byk.2	Q9BTV4	OTTHUMG00000129802	ENST00000306077.4:c.1073C>T	3.37:g.14183165C>T	ENSP00000303992:p.Ser358Leu	135	0		155	14	NM_024334	0	0	25	34	9	Q7L4N5|Q8NC30|Q96A63|Q96F19|Q96JX0|Q9H076	Missense_Mutation	SNP	ENST00000306077.4	37	CCDS2618.1	.	.	.	.	.	.	.	.	.	.	C	35	5.493272	0.96339	.	.	ENSG00000170876	ENST00000306077	T	0.35973	1.28	5.71	5.71	0.89125	.	0.066812	0.64402	D	0.000008	T	0.58293	0.2112	L	0.57536	1.79	0.80722	A	1	D	0.89917	1.0	D	0.69142	0.962	T	0.55711	-0.8098	9	0.52906	T	0.07	-15.2636	19.8516	0.96743	0.0:1.0:0.0:0.0	rs63750743	358	Q9BTV4	TMM43_HUMAN	L	358	ENSP00000303992:S358L	ENSP00000303992:S358L	S	+	2	0	TMEM43	14158166	1.000000	0.71417	0.940000	0.37924	0.911000	0.54048	7.205000	0.77881	2.685000	0.91497	0.585000	0.79938	TCG	.		0.602	TMEM43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252030.2	NM_024334	
SMARCC1	6599	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	47718172	47718172	+	Missense_Mutation	SNP	C	C	A			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr3:47718172C>A	ENST00000254480.5	-	17	1791	c.1672G>T	c.(1672-1674)Gta>Tta	p.V558L	SMARCC1_ENST00000425518.1_5'UTR	NM_003074.3	NP_003065.3	Q92922	SMRC1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1	558					ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|insulin receptor signaling pathway (GO:0008286)|nervous system development (GO:0007399)|nucleosome disassembly (GO:0006337)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)|XY body (GO:0001741)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|protein N-terminus binding (GO:0047485)|transcription coactivator activity (GO:0003713)			breast(1)|endometrium(5)|kidney(2)|large_intestine(3)|lung(15)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33				BRCA - Breast invasive adenocarcinoma(193;7.47e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)		TCAGCTAATACATTAAAATGA	0.463																																					p.V558L		.											.	SMARCC1-228	0			c.G1672T						.						73.0	70.0	71.0					3																	47718172		2203	4300	6503	SO:0001583	missense	6599	exon17			CTAATACATTAAA	U66615	CCDS2758.1	3p21.31	2008-05-15			ENSG00000173473	ENSG00000173473			11104	protein-coding gene	gene with protein product		601732				8804307	Standard	NM_003074		Approved	BAF155, SRG3, Rsc8, CRACC1	uc003crq.2	Q92922	OTTHUMG00000133519	ENST00000254480.5:c.1672G>T	3.37:g.47718172C>A	ENSP00000254480:p.Val558Leu	112	0		131	19	NM_003074	0	0	0	1	1	Q17RS0|Q6P172|Q8IWH2	Missense_Mutation	SNP	ENST00000254480.5	37	CCDS2758.1	.	.	.	.	.	.	.	.	.	.	C	35	5.457122	0.96223	.	.	ENSG00000173473	ENST00000254480	T	0.55760	0.5	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	T	0.77294	0.4109	M	0.85099	2.735	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	T	0.78959	-0.1998	10	0.87932	D	0	-21.3909	19.4236	0.94732	0.0:1.0:0.0:0.0	.	558	Q92922	SMRC1_HUMAN	L	558	ENSP00000254480:V558L	ENSP00000254480:V558L	V	-	1	0	SMARCC1	47693176	1.000000	0.71417	0.995000	0.50966	0.958000	0.62258	7.580000	0.82523	2.937000	0.99478	0.650000	0.86243	GTA	.		0.463	SMARCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257491.1		
COL7A1	1294	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	48604393	48604393	+	Missense_Mutation	SNP	C	C	A			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr3:48604393C>A	ENST00000328333.8	-	110	8280	c.8173G>T	c.(8173-8175)Ggg>Tgg	p.G2725W	COL7A1_ENST00000454817.1_Missense_Mutation_p.G2693W|COL7A1_ENST00000470076.1_5'Flank	NM_000094.3	NP_000085.1	Q02388	CO7A1_HUMAN	collagen, type VII, alpha 1	2725	Triple-helical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen type VII trimer (GO:0005590)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(3)|breast(8)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(57)|ovary(7)|prostate(5)|skin(9)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	137				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		CCAGGTGGCCCTGGGGGACCA	0.617																																					p.G2725W													.	COL7A1-160	0			c.G8173T						.						24.0	27.0	26.0					3																	48604393		2203	4299	6502	SO:0001583	missense	1294	exon110			GTGGCCCTGGGGG	L02870	CCDS2773.1	3p21.1	2014-09-17	2008-08-01		ENSG00000114270	ENSG00000114270		"""Collagens"", ""Fibronectin type III domain containing"""	2214	protein-coding gene	gene with protein product	"""collagen VII, alpha-1 polypeptide"", ""LC collagen"""	120120	"""epidermolysis bullosa, dystrophic, dominant and recessive"""	EBDCT, EBD1, EBR1		1871109	Standard	NM_000094		Approved		uc003ctz.2	Q02388	OTTHUMG00000133541	ENST00000328333.8:c.8173G>T	3.37:g.48604393C>A	ENSP00000332371:p.Gly2725Trp	87	1		79	15	NM_000094	0	0	3	6	3	Q14054|Q16507	Missense_Mutation	SNP	ENST00000328333.8	37	CCDS2773.1	.	.	.	.	.	.	.	.	.	.	C	9.532	1.111099	0.20714	.	.	ENSG00000114270	ENST00000328333;ENST00000454817	D;D	0.99369	-5.78;-5.78	4.86	4.86	0.63082	.	0.000000	0.41938	D	0.000791	D	0.99664	0.9875	H	0.98005	4.125	0.53005	D	0.999962	D	0.89917	1.0	D	0.97110	1.0	D	0.97321	0.9944	10	0.87932	D	0	.	16.16	0.81698	0.0:1.0:0.0:0.0	.	2725	Q02388	CO7A1_HUMAN	W	2725;2693	ENSP00000332371:G2725W;ENSP00000412569:G2693W	ENSP00000332371:G2725W	G	-	1	0	COL7A1	48579397	1.000000	0.71417	0.985000	0.45067	0.058000	0.15608	6.966000	0.76073	2.260000	0.74910	0.467000	0.42956	GGG	.		0.617	COL7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257519.1	NM_000094	
APEH	327	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	49718019	49718019	+	Missense_Mutation	SNP	T	T	C			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr3:49718019T>C	ENST00000296456.5	+	14	1656	c.1256T>C	c.(1255-1257)cTc>cCc	p.L419P	APEH_ENST00000438011.1_Missense_Mutation_p.L419P	NM_001640.3	NP_001631.3	P13798	ACPH_HUMAN	acylaminoacyl-peptide hydrolase	419					beta-amyloid metabolic process (GO:0050435)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear membrane (GO:0031965)	omega peptidase activity (GO:0008242)|poly(A) RNA binding (GO:0044822)|serine-type endopeptidase activity (GO:0004252)			endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|skin(1)|stomach(2)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		GACCAGGACCTCATGGTGGCA	0.572																																					p.L419P		.											.	APEH-91	0			c.T1256C						.						136.0	107.0	117.0					3																	49718019		2203	4300	6503	SO:0001583	missense	327	exon14			AGGACCTCATGGT	D38441	CCDS2801.1	3p21	2013-05-29	2013-05-29		ENSG00000164062	ENSG00000164062	3.4.19.1		586	protein-coding gene	gene with protein product	"""acylaminoacyl-peptidase"""	102645	"""N-acylaminoacyl-peptide hydrolase"""	D3F15S2, DNF15S2, D3S48E		2392324	Standard	NM_001640		Approved		uc003cxf.3	P13798	OTTHUMG00000156882	ENST00000296456.5:c.1256T>C	3.37:g.49718019T>C	ENSP00000296456:p.Leu419Pro	175	0		269	67	NM_001640	0	0	48	84	36	Q9BQ33|Q9P0Y2	Missense_Mutation	SNP	ENST00000296456.5	37	CCDS2801.1	.	.	.	.	.	.	.	.	.	.	T	24.8	4.573571	0.86542	.	.	ENSG00000164062	ENST00000296456;ENST00000438011	T;T	0.39787	1.06;1.06	5.44	5.44	0.79542	Peptidase S9A/B/C, oligopeptidase, N-terminal beta-propeller (1);	0.000000	0.85682	D	0.000000	T	0.59074	0.2167	M	0.66939	2.045	0.80722	D	1	D;D	0.64830	0.994;0.994	P;P	0.61201	0.885;0.885	T	0.58228	-0.7673	10	0.36615	T	0.2	-28.7761	15.1365	0.72572	0.0:0.0:0.0:1.0	.	419;419	C9JIF9;P13798	.;ACPH_HUMAN	P	419	ENSP00000296456:L419P;ENSP00000415862:L419P	ENSP00000296456:L419P	L	+	2	0	APEH	49693023	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.147000	0.77382	2.056000	0.61249	0.459000	0.35465	CTC	.		0.572	APEH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346415.2		
SLC15A2	6565	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	121649781	121649781	+	Missense_Mutation	SNP	A	A	G			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr3:121649781A>G	ENST00000489711.1	+	18	2036	c.1648A>G	c.(1648-1650)Act>Gct	p.T550A	SLC15A2_ENST00000295605.2_Missense_Mutation_p.T519A|SLC15A2_ENST00000465060.1_3'UTR	NM_021082.3	NP_066568.3	Q16348	S15A2_HUMAN	solute carrier family 15 (oligopeptide transporter), member 2	550					drug transport (GO:0015893)|ion transport (GO:0006811)|protein transport (GO:0015031)|proton transport (GO:0015992)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	antibiotic transporter activity (GO:0042895)|dipeptide transporter activity (GO:0042936)|high-affinity oligopeptide transporter activity (GO:0015334)|peptide:proton symporter activity (GO:0015333)			NS(1)|endometrium(1)|kidney(4)|large_intestine(5)|lung(17)|skin(6)|upper_aerodigestive_tract(2)	36				GBM - Glioblastoma multiforme(114;0.0967)	Aminolevulinic acid(DB00855)|Amoxicillin(DB01060)|Ampicillin(DB00415)|Azidocillin(DB08795)|Benazepril(DB00542)|Benzylpenicillin(DB01053)|Cefaclor(DB00833)|Cefadroxil(DB01140)|Cefalotin(DB00456)|Cefdinir(DB00535)|Cefepime(DB01413)|Cefixime(DB00671)|Cefmetazole(DB00274)|Cefotaxime(DB00493)|Cefradine(DB01333)|Ceftazidime(DB00438)|Ceftibuten(DB01415)|Ceftriaxone(DB01212)|Cefuroxime(DB01112)|Cephalexin(DB00567)|Chlorpropamide(DB00672)|Cilazapril(DB01340)|Cloxacillin(DB01147)|Cyclacillin(DB01000)|Dicloxacillin(DB00485)|Fosinopril(DB00492)|Glyburide(DB01016)|Moexipril(DB00691)|Nateglinide(DB00731)|Oxacillin(DB00713)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Spirapril(DB01348)|Tolbutamide(DB01124)|Trandolapril(DB00519)|Tranexamic Acid(DB00302)|Valaciclovir(DB00577)|Valganciclovir(DB01610)	TGCTTATAGAACTGTGCAAAG	0.388																																					p.T550A		.											.	SLC15A2-91	0			c.A1648G						.						196.0	183.0	187.0					3																	121649781		2203	4300	6503	SO:0001583	missense	6565	exon18			TATAGAACTGTGC	BC044572	CCDS3007.1, CCDS54631.1	3q21.1	2013-07-18	2013-07-18		ENSG00000163406	ENSG00000163406		"""Solute carriers"""	10921	protein-coding gene	gene with protein product		602339	"""solute carrier family 15 (H+/peptide transporter), member 2"""			7756356	Standard	NM_021082		Approved	PEPT2	uc003eep.2	Q16348	OTTHUMG00000159423	ENST00000489711.1:c.1648A>G	3.37:g.121649781A>G	ENSP00000417085:p.Thr550Ala	157	0		199	31	NM_021082	0	0	3	3	0	A8K1A5|B4E2A7	Missense_Mutation	SNP	ENST00000489711.1	37	CCDS3007.1	.	.	.	.	.	.	.	.	.	.	A	0.388	-0.925105	0.02377	.	.	ENSG00000163406	ENST00000489711;ENST00000542599;ENST00000295605	T;T	0.02656	4.5;4.21	5.42	1.6	0.23607	.	0.546824	0.20900	N	0.083650	T	0.02156	0.0067	L	0.45228	1.405	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.49051	-0.8979	10	0.08599	T	0.76	-1.3387	3.1896	0.06613	0.5309:0.0:0.1062:0.3628	.	519;550	B4E2A7;Q16348	.;S15A2_HUMAN	A	550;512;519	ENSP00000417085:T550A;ENSP00000295605:T519A	ENSP00000295605:T519A	T	+	1	0	SLC15A2	123132471	0.000000	0.05858	0.036000	0.18154	0.509000	0.34042	0.828000	0.27435	0.109000	0.17891	0.528000	0.53228	ACT	.		0.388	SLC15A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355239.1	NM_021082	
HEG1	57493	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	124748131	124748131	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr3:124748131C>T	ENST00000311127.4	-	2	585	c.518G>A	c.(517-519)aGc>aAc	p.S173N		NM_020733.1	NP_065784.1	Q9ULI3	HEG1_HUMAN	heart development protein with EGF-like domains 1	173					cardiac atrium morphogenesis (GO:0003209)|cell-cell junction assembly (GO:0007043)|endothelial cell morphogenesis (GO:0001886)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|lymph circulation (GO:0003017)|lymph vessel development (GO:0001945)|multicellular organism growth (GO:0035264)|pericardium development (GO:0060039)|post-embryonic development (GO:0009791)|regulation of body fluid levels (GO:0050878)|vasculogenesis (GO:0001570)|venous blood vessel morphogenesis (GO:0048845)|ventricular septum development (GO:0003281)	cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(24)|ovary(2)|urinary_tract(4)	47						TGAAGAGCCGCTCCTTCCTCT	0.512																																					p.S173N		.											.	HEG1-70	0			c.G518A						.						92.0	89.0	90.0					3																	124748131		1958	4173	6131	SO:0001583	missense	57493	exon2			GAGCCGCTCCTTC	AK074987	CCDS46898.1	3q21.2	2013-03-08	2013-03-08		ENSG00000173706	ENSG00000173706			29227	protein-coding gene	gene with protein product	"""heart of glass"""	614182	"""HEG homolog 1 (zebrafish)"""			10574462, 19151727, 23007647	Standard	NM_020733		Approved	KIAA1237, HEG	uc003ehs.4	Q9ULI3	OTTHUMG00000159486	ENST00000311127.4:c.518G>A	3.37:g.124748131C>T	ENSP00000311502:p.Ser173Asn	195	0		241	56	NM_020733	0	0	0	0	0	Q6NX66|Q8NC40|Q9BSV0	Missense_Mutation	SNP	ENST00000311127.4	37	CCDS46898.1	.	.	.	.	.	.	.	.	.	.	C	0.917	-0.717219	0.03182	.	.	ENSG00000173706	ENST00000311127	T	0.44482	0.92	5.38	-10.8	0.00216	.	.	.	.	.	T	0.09158	0.0226	N	0.01352	-0.895	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.13361	-1.0512	9	0.02654	T	1	.	5.997	0.19499	0.0926:0.2061:0.5365:0.1648	.	173;173	Q9ULI3-2;Q9ULI3	.;HEG1_HUMAN	N	173	ENSP00000311502:S173N	ENSP00000311502:S173N	S	-	2	0	HEG1	126230821	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.000000	0.03693	-1.869000	0.01141	-1.298000	0.01336	AGC	.		0.512	HEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355732.2	XM_087386	
COL6A5	256076	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	130095526	130095526	+	Missense_Mutation	SNP	G	G	T			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr3:130095526G>T	ENST00000432398.2	+	3	1008	c.514G>T	c.(514-516)Gct>Tct	p.A172S	COL6A5_ENST00000265379.6_Missense_Mutation_p.A172S	NM_153264.5	NP_694996.5	A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	172	Nonhelical region.|VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						GGTGCAGAAAGCTTCTGAGGA	0.502																																					p.A172S		.											.	.	0			c.G514T						.						81.0	81.0	81.0					3																	130095526		692	1591	2283	SO:0001583	missense	256076	exon3			CAGAAAGCTTCTG	AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000432398.2:c.514G>T	3.37:g.130095526G>T	ENSP00000390895:p.Ala172Ser	108	0		155	20	NM_153264	0	0	0	0	0	A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Missense_Mutation	SNP	ENST00000432398.2	37		.	.	.	.	.	.	.	.	.	.	G	6.971	0.549091	0.13312	.	.	ENSG00000172752	ENST00000432398;ENST00000265379	T;T	0.80214	-1.35;-1.35	5.14	3.34	0.38264	.	.	.	.	.	T	0.80989	0.4730	M	0.72479	2.2	0.09310	N	0.99999	P	0.38582	0.638	P	0.45577	0.486	T	0.69379	-0.5161	9	0.38643	T	0.18	.	6.3024	0.21119	0.1591:0.0:0.6941:0.1469	.	172	A8TX70-2	.	S	172	ENSP00000390895:A172S;ENSP00000265379:A172S	ENSP00000265379:A172S	A	+	1	0	COL6A5	131578216	0.445000	0.25657	0.010000	0.14722	0.017000	0.09413	2.715000	0.47210	0.671000	0.31185	-0.259000	0.10710	GCT	.		0.502	COL6A5-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_153264	
TBL1XR1	79718	broad.mit.edu;bcgsc.ca	37	3	176771657	176771657	+	Missense_Mutation	SNP	C	C	G			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr3:176771657C>G	ENST00000430069.1	-	4	367	c.108G>C	c.(106-108)caG>caC	p.Q36H	TBL1XR1_ENST00000457928.2_Missense_Mutation_p.Q36H			Q9BZK7	TBL1R_HUMAN	transducin (beta)-like 1 X-linked receptor 1	36	LisH. {ECO:0000255|PROSITE- ProRule:PRU00126}.				canonical Wnt signaling pathway (GO:0060070)|cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|histone binding (GO:0042393)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(7)|liver(1)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	31	all_cancers(143;1.44e-17)|Ovarian(172;0.00163)|Breast(254;0.214)	Acute lymphoblastic leukemia(1;0.00599)|all_hematologic(1;0.0632)|Prostate(884;0.215)	OV - Ovarian serous cystadenocarcinoma(80;9.83e-31)			TTATATTGGACTGACTGATAT	0.378																																					p.Q36H													.	TBL1XR1-187	0			c.G108C						.						104.0	97.0	100.0					3																	176771657		1867	4107	5974	SO:0001583	missense	79718	exon4			ATTGGACTGACTG	AK022956	CCDS46961.1	3q26.33	2013-01-10	2008-01-17		ENSG00000177565	ENSG00000177565		"""WD repeat domain containing"""	29529	protein-coding gene	gene with protein product		608628	"""transducin (beta)-like 1X-linked receptor 1"""			11063877, 11931768	Standard	NM_024665		Approved	IRA1, FLJ12894, TBLR1, C21, DC42	uc003fix.4	Q9BZK7	OTTHUMG00000157140	ENST00000430069.1:c.108G>C	3.37:g.176771657C>G	ENSP00000405574:p.Gln36His	122	0		158	6	NM_024665	0	0	1	1	0	D3DNQ9|Q14DC3|Q9H2I1|Q9H9A1	Missense_Mutation	SNP	ENST00000430069.1	37	CCDS46961.1	.	.	.	.	.	.	.	.	.	.	C	18.79	3.698324	0.68386	.	.	ENSG00000177565	ENST00000430069;ENST00000457928;ENST00000352800;ENST00000437738;ENST00000450267;ENST00000431674;ENST00000422066;ENST00000443315;ENST00000422442;ENST00000427349	T;T	0.54279	0.58;0.58	5.21	4.27	0.50696	LisH dimerisation motif (2);	0.000000	0.85682	D	0.000000	T	0.46347	0.1388	L	0.54323	1.7	0.58432	D	0.999999	B	0.32731	0.382	B	0.28553	0.091	T	0.49283	-0.8956	10	0.62326	D	0.03	-20.5183	11.9894	0.53166	0.0:0.9084:0.0:0.0916	.	36	Q9BZK7	TBL1R_HUMAN	H	36	ENSP00000405574:Q36H;ENSP00000413251:Q36H	ENSP00000263964:Q36H	Q	-	3	2	TBL1XR1	178254351	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.260000	0.51523	1.202000	0.43218	0.655000	0.94253	CAG	.		0.378	TBL1XR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347587.3	NM_024665	
KLHL24	54800	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	183381404	183381404	+	Missense_Mutation	SNP	C	C	A			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr3:183381404C>A	ENST00000454652.2	+	5	1465	c.1079C>A	c.(1078-1080)gCt>gAt	p.A360D	KLHL24_ENST00000476808.1_Missense_Mutation_p.A360D|KLHL24_ENST00000242810.6_Missense_Mutation_p.A360D	NM_017644.3	NP_060114.2	Q6TFL4	KLH24_HUMAN	kelch-like family member 24	360						cell projection (GO:0042995)|cytoplasm (GO:0005737)				NS(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(10)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27	all_cancers(143;2.88e-10)|Ovarian(172;0.0303)		all cancers(12;1.43e-42)|Epithelial(37;1.73e-36)|OV - Ovarian serous cystadenocarcinoma(80;8.75e-22)			GCAGTCTGTGCTCTAAGGAAT	0.353																																					p.A360D		.											.	KLHL24-91	0			c.C1079A						.						104.0	99.0	101.0					3																	183381404		2203	4300	6503	SO:0001583	missense	54800	exon4			TCTGTGCTCTAAG		CCDS3246.1	3q27.1	2013-02-22	2013-02-22		ENSG00000114796	ENSG00000114796		"""Kelch-like"", ""BTB/POZ domain containing"""	25947	protein-coding gene	gene with protein product		611295	"""kelch-like 24 (Drosophila)"""				Standard	XM_005247552		Approved	DRE1, FLJ20059	uc003flv.3	Q6TFL4	OTTHUMG00000156911	ENST00000454652.2:c.1079C>A	3.37:g.183381404C>A	ENSP00000395012:p.Ala360Asp	84	0		107	11	NM_017644	0	0	4	4	0	A5PLN8|Q9H620|Q9NXT9	Missense_Mutation	SNP	ENST00000454652.2	37	CCDS3246.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.086083	0.76642	.	.	ENSG00000114796	ENST00000242810;ENST00000454652;ENST00000476808	T;T;T	0.79352	-1.26;-1.26;-1.26	5.34	5.34	0.76211	Galactose oxidase, beta-propeller (1);	0.047926	0.85682	D	0.000000	D	0.85048	0.5608	M	0.80847	2.515	0.80722	D	1	B;B	0.30146	0.131;0.27	B;B	0.42593	0.04;0.392	D	0.84947	0.0869	10	0.66056	D	0.02	.	19.4149	0.94690	0.0:1.0:0.0:0.0	.	360;360	Q6TFL4-2;Q6TFL4	.;KLH24_HUMAN	D	360	ENSP00000242810:A360D;ENSP00000395012:A360D;ENSP00000419010:A360D	ENSP00000242810:A360D	A	+	2	0	KLHL24	184864098	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	7.445000	0.80570	2.675000	0.91044	0.462000	0.41574	GCT	.		0.353	KLHL24-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346586.2	NM_017644	
USO1	8615	broad.mit.edu	37	4	76726384	76726384	+	Missense_Mutation	SNP	A	A	G			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr4:76726384A>G	ENST00000538159.1	+	20	2244	c.2244A>G	c.(2242-2244)atA>atG	p.I748M	USO1_ENST00000514213.2_Missense_Mutation_p.I724M			O60763	USO1_HUMAN	USO1 vesicle transport factor	739					ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi vesicle docking (GO:0048211)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|mitotic cell cycle (GO:0000278)|transcytosis (GO:0045056)|vesicle fusion with Golgi apparatus (GO:0048280)	endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|membrane (GO:0016020)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			GAGAAGAGATAGAAGAATTAA	0.363																																					.													.	USO1-25	0			.						.						62.0	59.0	60.0					4																	76726384		1844	4090	5934	SO:0001583	missense	8615	.			AGAGATAGAAGAA	AL832010	CCDS75144.1	4q21.1	2012-12-10	2012-12-10		ENSG00000138768	ENSG00000138768			30904	protein-coding gene	gene with protein product	"""vesicle docking protein"", ""transcytosis associated protein"""	603344	"""USO1 homolog, vesicle docking protein (yeast)"", ""USO1 vesicle docking protein homolog (yeast)"""			9478999, 9150144, 12077354, 15979508, 14736916	Standard	XM_006714395		Approved	TAP, VDP, p115	uc003hiu.3	O60763	OTTHUMG00000160952	ENST00000538159.1:c.2244A>G	4.37:g.76726384A>G	ENSP00000440586:p.Ile748Met	264	0		307	6	.	0	0	11	11	0	B2RAQ0|Q6PK63|Q86TB8|Q8N592	Missense_Mutation	SNP	ENST00000538159.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	10.94|10.94	1.493406|1.493406	0.26774|0.26774	.|.	.|.	ENSG00000138768|ENSG00000138768	ENST00000508939;ENST00000538159;ENST00000514213;ENST00000264904|ENST00000441296	.|.	.|.	.|.	5.7|5.7	1.58|1.58	0.23477|0.23477	Armadillo-type fold (1);|.	0.332013|.	0.36815|.	N|.	0.002383|.	T|.	0.34077|.	0.0885|.	L|L	0.47716|0.47716	1.5|1.5	0.29331|0.29331	N|N	0.866689|0.866689	P;P|.	0.48089|.	0.905;0.664|.	B;B|.	0.42555|.	0.391;0.115|.	T|.	0.32428|.	-0.9907|.	9|.	0.45353|.	T|.	0.12|.	.|.	1.9891|1.9891	0.03442|0.03442	0.4271:0.254:0.0733:0.2456|0.4271:0.254:0.0733:0.2456	.|.	748;739|.	F5GYR8;O60763|.	.;USO1_HUMAN|.	M|W	574;748;724;667|415	.|.	ENSP00000264904:I667M|.	I|X	+|+	3|2	3|0	USO1|USO1	76945408|76945408	0.998000|0.998000	0.40836|0.40836	0.998000|0.998000	0.56505|0.56505	0.316000|0.316000	0.28119|0.28119	0.503000|0.503000	0.22610|0.22610	0.399000|0.399000	0.25367|0.25367	-0.757000|-0.757000	0.03467|0.03467	ATA|TAG	.		0.363	USO1-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_003715	
WDFY3	23001	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	85716095	85716095	+	Missense_Mutation	SNP	G	G	T			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr4:85716095G>T	ENST00000295888.4	-	20	3612	c.3205C>A	c.(3205-3207)Cct>Act	p.P1069T	WDFY3_ENST00000322366.6_Missense_Mutation_p.P1069T	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	1069					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		TTATTTGTAGGAGCATTATGA	0.378																																					p.P1069T		.											.	WDFY3-93	0			c.C3205A						.						72.0	69.0	70.0					4																	85716095		2203	4300	6503	SO:0001583	missense	23001	exon20			TTGTAGGAGCATT	AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.3205C>A	4.37:g.85716095G>T	ENSP00000295888:p.Pro1069Thr	357	0		404	105	NM_014991	0	0	0	0	0	Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Missense_Mutation	SNP	ENST00000295888.4	37	CCDS3609.1	.	.	.	.	.	.	.	.	.	.	G	3.505	-0.100986	0.06967	.	.	ENSG00000163625	ENST00000322366;ENST00000295888	T;T	0.40476	1.03;1.03	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.30417	0.0764	N	0.24115	0.695	0.80722	D	1	B	0.12013	0.005	B	0.11329	0.006	T	0.14643	-1.0465	10	0.07325	T	0.83	.	19.6264	0.95679	0.0:0.0:1.0:0.0	.	1069	Q8IZQ1	WDFY3_HUMAN	T	1069	ENSP00000318466:P1069T;ENSP00000295888:P1069T	ENSP00000295888:P1069T	P	-	1	0	WDFY3	85935119	1.000000	0.71417	0.996000	0.52242	0.219000	0.24729	7.424000	0.80242	2.717000	0.92951	0.655000	0.94253	CCT	.		0.378	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252811.2	NM_014991	
STPG2	285555	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	98893529	98893529	+	Missense_Mutation	SNP	T	T	C			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr4:98893529T>C	ENST00000295268.3	-	7	924	c.835A>G	c.(835-837)Aag>Gag	p.K279E		NM_174952.2	NP_777612.1	Q8N412	STPG2_HUMAN	sperm-tail PG-rich repeat containing 2	279			K -> R (in dbSNP:rs7654193).														TTCTGTTTCTTTGAGCAGATA	0.358																																					p.K279E		.											.	.	0			c.A835G						.						71.0	71.0	71.0					4																	98893529		2203	4300	6503	SO:0001583	missense	285555	exon7			GTTTCTTTGAGCA	BC036870	CCDS3645.1	4q22.3-q23	2013-10-11	2012-07-30	2012-07-30	ENSG00000163116	ENSG00000163116			28712	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 37"""	C4orf37		23031811	Standard	NM_174952		Approved	MGC46496	uc003htt.2	Q8N412	OTTHUMG00000131009	ENST00000295268.3:c.835A>G	4.37:g.98893529T>C	ENSP00000295268:p.Lys279Glu	248	0		220	41	NM_174952	0	0	0	0	0		Missense_Mutation	SNP	ENST00000295268.3	37	CCDS3645.1	.	.	.	.	.	.	.	.	.	.	T	0.011	-1.723977	0.00694	.	.	ENSG00000163116	ENST00000295268	T	0.11604	2.76	5.45	1.74	0.24563	.	0.432965	0.22937	N	0.053831	T	0.06005	0.0156	L	0.27053	0.805	0.09310	N	1	B	0.11235	0.004	B	0.16289	0.015	T	0.34800	-0.9814	9	.	.	.	-8.5472	4.1354	0.10169	0.0:0.3996:0.2191:0.3813	.	279	Q8N412	CD037_HUMAN	E	279	ENSP00000295268:K279E	.	K	-	1	0	C4orf37	99112552	0.115000	0.22152	0.080000	0.20451	0.292000	0.27327	0.392000	0.20801	0.901000	0.36495	0.455000	0.32223	AAG	.		0.358	STPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253642.1	NM_174952	
PDE5A	8654	ucsc.edu;bcgsc.ca	37	4	120528177	120528177	+	Missense_Mutation	SNP	T	T	A			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr4:120528177T>A	ENST00000354960.3	-	2	747	c.428A>T	c.(427-429)cAt>cTt	p.H143L	PDE5A_ENST00000264805.5_Missense_Mutation_p.H101L|PDE5A_ENST00000394439.1_Missense_Mutation_p.H91L	NM_001083.3	NP_001074.2	O76074	PDE5A_HUMAN	phosphodiesterase 5A, cGMP-specific	143					blood coagulation (GO:0007596)|cGMP catabolic process (GO:0046069)|negative regulation of cardiac muscle contraction (GO:0055118)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of oocyte development (GO:0060282)|relaxation of cardiac muscle (GO:0055119)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cGMP binding (GO:0030553)|metal ion binding (GO:0046872)			breast(4)|endometrium(2)|kidney(3)|large_intestine(8)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	27					Avanafil(DB06237)|Caffeine(DB00201)|Dipyridamole(DB00975)|Pentoxifylline(DB00806)|Sildenafil(DB00203)|Tadalafil(DB00820)|Theophylline(DB00277)|Udenafil(DB06267)|Vardenafil(DB00862)	CCCTTCATCATGATCAAACCT	0.428																																					p.H143L													.	PDE5A-90	0			c.A428T						.						119.0	112.0	114.0					4																	120528177		2203	4300	6503	SO:0001583	missense	8654	exon2			TCATCATGATCAA	D89094	CCDS3713.1, CCDS34055.1	4q27	2008-05-15			ENSG00000138735	ENSG00000138735	3.1.4.17	"""Phosphodiesterases"""	8784	protein-coding gene	gene with protein product		603310				9714779, 9642111	Standard	NM_033437		Approved		uc003idh.3	O76074	OTTHUMG00000132971	ENST00000354960.3:c.428A>T	4.37:g.120528177T>A	ENSP00000347046:p.His143Leu	193	2		194	20	NM_001083	0	0	0	0	0	A0AV69|A8K2C4|O75026|O75887|Q86UI0|Q86V66|Q9Y6Z6	Missense_Mutation	SNP	ENST00000354960.3	37	CCDS3713.1	.	.	.	.	.	.	.	.	.	.	T	0.029	-1.349473	0.01266	.	.	ENSG00000138735	ENST00000354960;ENST00000394439;ENST00000264805;ENST00000420633	T;T;T;T	0.08193	3.12;3.12;3.12;3.12	5.51	0.545	0.17190	.	1.839920	0.02500	N	0.090345	T	0.03608	0.0103	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.30851	-0.9964	10	0.02654	T	1	.	2.3607	0.04307	0.1028:0.1584:0.2143:0.5245	.	143;101	O76074;O76074-2	PDE5A_HUMAN;.	L	143;91;101;91	ENSP00000347046:H143L;ENSP00000377957:H91L;ENSP00000264805:H101L;ENSP00000416309:H91L	ENSP00000264805:H101L	H	-	2	0	PDE5A	120747625	0.000000	0.05858	0.019000	0.16419	0.569000	0.35902	0.454000	0.21827	0.076000	0.16826	0.459000	0.35465	CAT	.		0.428	PDE5A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256529.1	NM_001083	
NR3C2	4306	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	149356416	149356416	+	Missense_Mutation	SNP	T	T	C			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr4:149356416T>C	ENST00000358102.3	-	2	1959	c.1597A>G	c.(1597-1599)Ata>Gta	p.I533V	NR3C2_ENST00000511528.1_Missense_Mutation_p.I533V|NR3C2_ENST00000512865.1_Missense_Mutation_p.I533V|NR3C2_ENST00000344721.4_Missense_Mutation_p.I533V|NR3C2_ENST00000355292.3_Missense_Mutation_p.I533V	NM_000901.4|NM_001166104.1	NP_000892.2|NP_001159576.1	P08235	MCR_HUMAN	nuclear receptor subfamily 3, group C, member 2	533	Modulating.				gene expression (GO:0010467)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|receptor complex (GO:0043235)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	41	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0614)	Drospirenone(DB01395)|Eplerenone(DB00700)|Felodipine(DB01023)|Fludrocortisone(DB00687)|Fluticasone Propionate(DB00588)|Nimodipine(DB00393)|Progesterone(DB00396)|Spironolactone(DB00421)	GATAAAGATATTGTACCTTGA	0.483																																					p.I533V	Melanoma(27;428 957 40335 51025 51111)	.											.	NR3C2-154	0			c.A1597G						.						121.0	112.0	115.0					4																	149356416		2203	4300	6503	SO:0001583	missense	4306	exon2			AAGATATTGTACC	M16801	CCDS3772.1, CCDS54811.1	4q31	2013-01-16			ENSG00000151623	ENSG00000151623		"""Nuclear hormone receptors"""	7979	protein-coding gene	gene with protein product		600983		MLR		2558856	Standard	NM_000901		Approved	MR	uc003ilj.4	P08235	OTTHUMG00000161455	ENST00000358102.3:c.1597A>G	4.37:g.149356416T>C	ENSP00000350815:p.Ile533Val	200	0		216	54	NM_001166104	0	0	2	2	0	B0ZBF5|B0ZBF7|Q2NKL1|Q96KQ8|Q96KQ9	Missense_Mutation	SNP	ENST00000358102.3	37	CCDS3772.1	.	.	.	.	.	.	.	.	.	.	T	13.43	2.234464	0.39498	.	.	ENSG00000151623	ENST00000344721;ENST00000355292;ENST00000358102;ENST00000512865;ENST00000544252;ENST00000342437;ENST00000511528	D;D;D;D;D;D	0.90069	-2.6;-2.61;-2.6;-2.17;-2.18;-2.61	5.51	5.51	0.81932	.	0.037872	0.85682	D	0.000000	T	0.80839	0.4700	N	0.24115	0.695	0.45806	D	0.998684	B;P	0.41524	0.144;0.753	B;B	0.35550	0.035;0.205	T	0.80576	-0.1321	9	.	.	.	.	15.9104	0.79470	0.0:0.0:0.0:1.0	.	533;533	B0ZBF5;B0ZBF6	.;.	V	533	ENSP00000341390:I533V;ENSP00000347441:I533V;ENSP00000350815:I533V;ENSP00000423510:I533V;ENSP00000343907:I533V;ENSP00000421481:I533V	.	I	-	1	0	NR3C2	149575866	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	7.615000	0.83006	2.210000	0.71456	0.533000	0.62120	ATA	.		0.483	NR3C2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364986.1		
NAF1	92345	broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	164061509	164061509	+	Silent	SNP	T	T	C			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr4:164061509T>C	ENST00000274054.2	-	5	937	c.744A>G	c.(742-744)gcA>gcG	p.A248A	NAF1_ENST00000509434.1_5'Flank|NAF1_ENST00000422287.2_Silent_p.A248A	NM_138386.2	NP_612395.2	Q96HR8	NAF1_HUMAN	nuclear assembly factor 1 ribonucleoprotein	248					pseudouridine synthesis (GO:0001522)|ribosome biogenesis (GO:0042254)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(3)|large_intestine(1)|lung(10)|ovary(2)	21	all_hematologic(180;0.166)	Prostate(90;0.109)				AAAATGGATGTGCAACAGGTC	0.299																																					p.A248A													.	NAF1-70	0			c.A744G						.						82.0	90.0	87.0					4																	164061509		2203	4291	6494	SO:0001819	synonymous_variant	92345	exon5			TGGATGTGCAACA		CCDS3803.1, CCDS47159.1	4q32.2	2013-03-05	2013-03-05			ENSG00000145414			25126	protein-coding gene	gene with protein product			"""nuclear assembly factor 1 homolog (S. cerevisiae)"""			16618814, 16601202	Standard	NM_138386		Approved		uc003iqj.3	Q96HR8		ENST00000274054.2:c.744A>G	4.37:g.164061509T>C		49	1		45	7	NM_138386	0	0	5	5	0	D3DP28|E9PAZ2	Silent	SNP	ENST00000274054.2	37	CCDS3803.1																																																																																			.		0.299	NAF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364684.2	NM_138386	
C5orf42	65250	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	37121780	37121780	+	Silent	SNP	A	A	G			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr5:37121780A>G	ENST00000508244.1	-	47	9055	c.8962T>C	c.(8962-8964)Ttg>Ctg	p.L2988L	C5orf42_ENST00000512288.1_5'UTR|C5orf42_ENST00000274258.7_Silent_p.L1886L|C5orf42_ENST00000425232.2_Silent_p.L2988L			Q9H799	CE042_HUMAN	chromosome 5 open reading frame 42	2988						integral component of membrane (GO:0016021)				breast(5)|endometrium(3)|kidney(8)|large_intestine(24)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	79	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			TTGTTAGGCAATGGTTTCTGT	0.463																																					p.L2988L		.											.	C5orf42-94	0			c.T8962C						.						308.0	265.0	280.0					5																	37121780		2203	4300	6503	SO:0001819	synonymous_variant	65250	exon48			TAGGCAATGGTTT		CCDS34146.1, CCDS34146.2	5p13.2	2014-01-28			ENSG00000197603	ENSG00000197603			25801	protein-coding gene	gene with protein product		614571				22264561	Standard	NM_023073		Approved	FLJ13231, JBTS17	uc011cpa.1	Q9H799	OTTHUMG00000160492	ENST00000508244.1:c.8962T>C	5.37:g.37121780A>G		445	1		701	235	NM_023073	0	0	3	7	4	A8MUB7|B7ZLV7|Q4G174|Q6DK46|Q8N8L4|Q9H5T1|Q9H8T9	Silent	SNP	ENST00000508244.1	37	CCDS34146.2																																																																																			.		0.463	C5orf42-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360806.1	NM_023073	
ADAMTS6	11174	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	64587271	64587271	+	IGR	SNP	T	T	A			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr5:64587271T>A								ADAMTS6 (92679 upstream) : ADAMTS6 (5763 downstream)																							GGGAGGCTCATTATCAAGGCA	0.458																																					p.N466I		.											.	ADAMTS6-226	0			c.A1397T						.						107.0	97.0	101.0					5																	64587271		2203	4300	6503	SO:0001628	intergenic_variant	11174	exon11			GGCTCATTATCAA																													5.37:g.64587271T>A		171	0		326	50	NM_197941	0	0	0	0	0		Missense_Mutation	SNP		37		.	.	.	.	.	.	.	.	.	.	T	18.48	3.633123	0.67015	.	.	ENSG00000049192	ENST00000381055;ENST00000464680	D;D	0.90004	-2.6;-2.6	5.26	5.26	0.73747	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.85682	D	0.000000	D	0.92854	0.7727	L	0.53249	1.67	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.85130	0.987;0.997	D	0.93648	0.6970	10	0.87932	D	0	.	15.4604	0.75353	0.0:0.0:0.0:1.0	.	466;466	D6R9L6;Q9UKP5	.;ATS6_HUMAN	I	466	ENSP00000370443:N466I;ENSP00000423551:N466I	ENSP00000370443:N466I	N	-	2	0	ADAMTS6	64623027	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.578000	0.82498	2.117000	0.64856	0.533000	0.62120	AAT	.	0	0.458								
UTP15	84135	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	72864379	72864379	+	Silent	SNP	T	T	A			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr5:72864379T>A	ENST00000296792.4	+	4	573	c.318T>A	c.(316-318)ctT>ctA	p.L106L	UTP15_ENST00000508491.1_Silent_p.L87L|ANKRA2_ENST00000296785.3_5'Flank|UTP15_ENST00000543251.1_5'UTR	NM_001284431.1|NM_032175.2	NP_001271360.1|NP_115551.2	Q8TED0	UTP15_HUMAN	UTP15, U3 small nucleolar ribonucleoprotein, homolog (S. cerevisiae)	106					rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|skin(2)	15		Lung NSC(167;0.00405)|Ovarian(174;0.0129)		OV - Ovarian serous cystadenocarcinoma(47;7.76e-55)		GAGTTCAACTTTTTGATATAA	0.413																																					p.L106L		.											.	UTP15-90	0			c.T318A						.						101.0	103.0	102.0					5																	72864379		2203	4300	6503	SO:0001819	synonymous_variant	84135	exon4			TCAACTTTTTGAT	AL831972	CCDS34186.1, CCDS68893.1, CCDS68894.1	5q13.2	2013-01-10	2006-04-20		ENSG00000164338	ENSG00000164338		"""WD repeat domain containing"""	25758	protein-coding gene	gene with protein product			"""UTP15, U3 small nucleolar ribonucleoprotein, homolog (yeast)"""			12477932	Standard	NM_032175		Approved	FLJ12787, NET21, FLJ23637	uc003kcw.1	Q8TED0	OTTHUMG00000162453	ENST00000296792.4:c.318T>A	5.37:g.72864379T>A		115	0		187	33	NM_032175	0	0	4	4	0	B4DU75|B4DXK8|Q6IA60|Q96E08|Q9H9F8	Silent	SNP	ENST00000296792.4	37	CCDS34186.1	.	.	.	.	.	.	.	.	.	.	T	10.81	1.454530	0.26161	.	.	ENSG00000164338	ENST00000509005	.	.	.	5.55	-2.87	0.05700	.	.	.	.	.	T	0.51500	0.1678	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49735	-0.8908	4	.	.	.	.	7.9204	0.29843	0.0:0.4287:0.3982:0.1731	.	.	.	.	Y	133	.	.	F	+	2	0	UTP15	72900135	0.042000	0.20092	0.996000	0.52242	0.996000	0.88848	-1.057000	0.03486	-0.143000	0.11334	0.533000	0.62120	TTT	.		0.413	UTP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368965.1	NM_032175	
ARSI	340075	bcgsc.ca	37	5	149678111	149678111	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr5:149678111G>C	ENST00000328668.7	-	2	955	c.376C>G	c.(376-378)Ctg>Gtg	p.L126V		NM_001012301.2	NP_001012301.1	Q5FYB1	ARSI_HUMAN	arylsulfatase family, member I	126					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(11)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	23			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ACCTGGTCCAGGGGCAGGCAG	0.612																																					p.L126V													.	ARSI-92	0			c.C376G						.						50.0	56.0	54.0					5																	149678111		2186	4287	6473	SO:0001583	missense	340075	exon2			GGTCCAGGGGCAG	AY875937	CCDS34275.1	5q32	2014-03-03	2006-03-07			ENSG00000183876		"""Arylsulfatase family"""	32521	protein-coding gene	gene with protein product		610009	"""arylsulfatase I"""			16174644, 24482476	Standard	NM_001012301		Approved	FLJ16069, SPG66	uc003lrv.2	Q5FYB1		ENST00000328668.7:c.376C>G	5.37:g.149678111G>C	ENSP00000333395:p.Leu126Val	190	0		301	9	NM_001012301	0	0	0	0	0	A1L3B0|B3KV22|B7XD03	Missense_Mutation	SNP	ENST00000328668.7	37	CCDS34275.1	.	.	.	.	.	.	.	.	.	.	G	12.98	2.101429	0.37048	.	.	ENSG00000183876	ENST00000328668	D	0.98717	-5.09	4.58	2.64	0.31445	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.068615	0.64402	D	0.000011	D	0.97561	0.9201	M	0.71036	2.16	0.80722	D	1	B	0.26147	0.143	B	0.33121	0.158	D	0.94605	0.7799	10	0.59425	D	0.04	.	11.2155	0.48823	0.2441:0.0:0.7559:0.0	.	126	Q5FYB1	ARSI_HUMAN	V	126	ENSP00000333395:L126V	ENSP00000333395:L126V	L	-	1	2	ARSI	149658304	0.998000	0.40836	0.997000	0.53966	0.952000	0.60782	0.925000	0.28791	0.124000	0.18369	-1.134000	0.01955	CTG	.		0.612	ARSI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373681.1	NM_001012301	
MRPL22	29093	broad.mit.edu	37	5	154346429	154346429	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr5:154346429G>A	ENST00000523037.1	+	7	634	c.593G>A	c.(592-594)cGc>cAc	p.R198H	MRPL22_ENST00000522038.1_Missense_Mutation_p.R204H|MRPL22_ENST00000265229.8_Missense_Mutation_p.R118H|MRPL22_ENST00000439747.3_Missense_Mutation_p.R224H|MRPL22_ENST00000518364.1_3'UTR	NM_014180.3	NP_054899.2	Q9NWU5	RM22_HUMAN	mitochondrial ribosomal protein L22	198					translation (GO:0006412)	large ribosomal subunit (GO:0015934)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|urinary_tract(2)	10	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			CAGCAGCTTCGCAGCCGGACC	0.438																																					p.R198H													.	MRPL22-90	0			c.G593A						.						54.0	47.0	50.0					5																	154346429		2203	4300	6503	SO:0001583	missense	29093	exon7			AGCTTCGCAGCCG	AB051622	CCDS4331.1, CCDS43391.1	5q33.2	2012-09-13			ENSG00000082515	ENSG00000082515		"""Mitochondrial ribosomal proteins / large subunits"""	14480	protein-coding gene	gene with protein product		611835					Standard	NM_014180		Approved	MRP-L25, RPML25, HSPC158	uc003lvy.4	Q9NWU5	OTTHUMG00000130190	ENST00000523037.1:c.593G>A	5.37:g.154346429G>A	ENSP00000431040:p.Arg198His	109	0		129	5	NM_014180	0	0	46	46	0	A6NGJ8|Q5H9Q1|Q96Q51|Q9P006	Missense_Mutation	SNP	ENST00000523037.1	37	CCDS4331.1	.	.	.	.	.	.	.	.	.	.	G	17.92	3.506467	0.64410	.	.	ENSG00000082515	ENST00000523037;ENST00000265229;ENST00000439747;ENST00000522038	T;T;T;T	0.59772	0.28;0.4;0.24;0.27	5.8	5.8	0.92144	.	0.579484	0.18168	N	0.149546	T	0.74574	0.3734	M	0.79926	2.475	0.58432	D	0.999999	D	0.60575	0.988	P	0.55303	0.773	T	0.75958	-0.3134	10	0.54805	T	0.06	-1.2567	20.0415	0.97592	0.0:0.0:1.0:0.0	.	198	Q9NWU5	RM22_HUMAN	H	198;118;224;204	ENSP00000431040:R198H;ENSP00000265229:R118H;ENSP00000411177:R224H;ENSP00000429039:R204H	ENSP00000265229:R118H	R	+	2	0	MRPL22	154326622	0.996000	0.38824	0.800000	0.32199	0.138000	0.21146	4.728000	0.62000	2.745000	0.94114	0.563000	0.77884	CGC	.		0.438	MRPL22-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252508.2		
SCUBE3	222663	hgsc.bcm.edu	37	6	35182249	35182249	+	Silent	SNP	C	C	T	rs113302940	byFrequency	TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr6:35182249C>T	ENST00000274938.7	+	1	54	c.54C>T	c.(52-54)gcC>gcT	p.A18A	SCUBE3_ENST00000394681.1_Silent_p.A18A	NM_152753.2	NP_689966.2			signal peptide, CUB domain, EGF-like 3											breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(12)|lung(11)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	37						TGGTCCACGCCCGCGCCGCCC	0.736													C|||	30	0.00599042	0.0045	0.0072	5008	,	,		9874	0.0		0.0189	False		,,,				2504	0.0				p.A18A		.											.	SCUBE3-91	0			c.C54T						.	C		15,4025		0,15,2005	4.0	5.0	5.0		54	1.0	1.0	6	dbSNP_132	5	139,7901		0,139,3881	no	coding-synonymous	SCUBE3	NM_152753.2		0,154,5886	TT,TC,CC		1.7289,0.3713,1.2748		18/994	35182249	154,11926	2020	4020	6040	SO:0001819	synonymous_variant	222663	exon1			CCACGCCCGCGCC	AF452494.1	CCDS4800.1	6p21.3	2008-02-05	2004-05-19	2004-05-21		ENSG00000146197			13655	protein-coding gene	gene with protein product		614708	"""CUB domain and EGF-like repeat containing 3"""	CEGF3		12270931	Standard	NM_152753		Approved	FLJ34743	uc003okf.1	Q8IX30		ENST00000274938.7:c.54C>T	6.37:g.35182249C>T		2	0		6	6	NM_152753	0	0	0	0	0		Silent	SNP	ENST00000274938.7	37	CCDS4800.1																																																																																			C|0.992;T|0.008		0.736	SCUBE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040275.1	NM_152753	
DEFB113	245927	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	49936558	49936558	+	Silent	SNP	T	T	C			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr6:49936558T>C	ENST00000398718.1	-	2	80	c.81A>G	c.(79-81)gaA>gaG	p.E27E		NM_001037729.1	NP_001032818.1	Q30KQ7	DB113_HUMAN	defensin, beta 113	27					defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)				breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)	7	Lung NSC(77;0.042)					TCTCTGCAACTTCTCTTGTTT	0.363																																					p.E27E		.											.	DEFB113-90	0			c.A81G						.						95.0	92.0	93.0					6																	49936558		1859	4093	5952	SO:0001819	synonymous_variant	245927	exon2			TGCAACTTCTCTT	DQ012017	CCDS43472.1	6p12.3	2010-03-30			ENSG00000214642	ENSG00000214642		"""Defensins, beta"""	18094	protein-coding gene	gene with protein product						11854508, 16033865	Standard	NM_001037729		Approved	DEFB-13	uc011dwq.2	Q30KQ7	OTTHUMG00000160210	ENST00000398718.1:c.81A>G	6.37:g.49936558T>C		57	0		85	15	NM_001037729	0	0	0	0	0		Silent	SNP	ENST00000398718.1	37	CCDS43472.1																																																																																			.		0.363	DEFB113-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359666.1		
PKHD1	5314	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	51750667	51750667	+	Missense_Mutation	SNP	G	G	T			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr6:51750667G>T	ENST00000371117.3	-	45	7488	c.7213C>A	c.(7213-7215)Cag>Aag	p.Q2405K	PKHD1_ENST00000340994.4_Missense_Mutation_p.Q2405K	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	2405					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					AAGCTTACCTGGGCACCACCT	0.383																																					p.Q2405K		.											.	PKHD1-603	0			c.C7213A						.						43.0	41.0	42.0					6																	51750667		2203	4300	6503	SO:0001583	missense	5314	exon45			TTACCTGGGCACC	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.7213C>A	6.37:g.51750667G>T	ENSP00000360158:p.Gln2405Lys	136	0		130	29	NM_170724	0	0	0	0	0	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	ENST00000371117.3	37	CCDS4935.1	.	.	.	.	.	.	.	.	.	.	G	15.47	2.841905	0.51057	.	.	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	T;T	0.79653	-1.29;-1.29	5.81	5.81	0.92471	Pectin lyase fold/virulence factor (1);Pectin lyase fold (1);	0.147468	0.48286	D	0.000193	T	0.69797	0.3151	M	0.67953	2.075	0.34697	D	0.726304	P;B;P	0.40000	0.698;0.313;0.698	B;B;B	0.35353	0.201;0.104;0.167	T	0.72704	-0.4213	10	0.27082	T	0.32	.	17.2257	0.86970	0.0:0.0:1.0:0.0	.	2405;2405;2405	A8MVM9;P08F94-2;P08F94	.;.;PKHD1_HUMAN	K	2405	ENSP00000360158:Q2405K;ENSP00000341097:Q2405K	ENSP00000341097:Q2405K	Q	-	1	0	PKHD1	51858626	0.998000	0.40836	0.941000	0.38009	0.505000	0.33919	3.052000	0.49893	2.756000	0.94617	0.650000	0.86243	CAG	.		0.383	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	
COL9A1	1297	broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	70926682	70926682	+	Missense_Mutation	SNP	G	G	T			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr6:70926682G>T	ENST00000357250.6	-	38	2842	c.2684C>A	c.(2683-2685)cCt>cAt	p.P895H	COL9A1_ENST00000370499.4_Missense_Mutation_p.P652H|COL9A1_ENST00000489611.1_5'UTR|COL9A1_ENST00000320755.7_Missense_Mutation_p.P652H	NM_001851.4	NP_001842.3	P20849	CO9A1_HUMAN	collagen, type IX, alpha 1	895	Collagen-like 10.|Triple-helical region (COL1).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|organ morphogenesis (GO:0009887)|tissue homeostasis (GO:0001894)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(44)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)	80						GGGAAGCCCAGGAGGTCCCGG	0.632																																					p.P895H													.	COL9A1-94	0			c.C2684A						.						36.0	44.0	41.0					6																	70926682		2203	4300	6503	SO:0001583	missense	1297	exon38			AGCCCAGGAGGTC		CCDS4971.1, CCDS47447.1	6q13	2013-05-07			ENSG00000112280	ENSG00000112280		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2217	protein-coding gene	gene with protein product		120210				1429648	Standard	NM_001851		Approved		uc003pfg.4	P20849	OTTHUMG00000014988	ENST00000357250.6:c.2684C>A	6.37:g.70926682G>T	ENSP00000349790:p.Pro895His	122	1		176	44	NM_001851	0	0	0	0	0	Q13699|Q13700|Q5TF52|Q6P467|Q96BM8|Q99225|Q9H151|Q9H152|Q9Y6P2|Q9Y6P3	Missense_Mutation	SNP	ENST00000357250.6	37	CCDS4971.1	.	.	.	.	.	.	.	.	.	.	G	12.05	1.820329	0.32145	.	.	ENSG00000112280	ENST00000357250;ENST00000320755;ENST00000370499	D;D;D	0.94280	-3.39;-3.39;-3.39	5.87	5.87	0.94306	.	0.341840	0.28577	N	0.014857	D	0.96009	0.8700	M	0.84773	2.715	0.51482	D	0.999929	P;B;D	0.60575	0.619;0.218;0.988	B;B;P	0.57057	0.245;0.055;0.812	D	0.94708	0.7889	10	0.41790	T	0.15	.	20.1935	0.98237	0.0:0.0:1.0:0.0	.	895;652;444	P20849;P20849-2;B3KWS8	CO9A1_HUMAN;.;.	H	895;652;652	ENSP00000349790:P895H;ENSP00000315252:P652H;ENSP00000359530:P652H	ENSP00000315252:P652H	P	-	2	0	COL9A1	70983403	1.000000	0.71417	0.924000	0.36721	0.411000	0.31082	8.196000	0.89725	2.779000	0.95612	0.591000	0.81541	CCT	.		0.632	COL9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041131.2		
ALDH8A1	64577	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	135260502	135260502	+	Missense_Mutation	SNP	A	A	G			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr6:135260502A>G	ENST00000265605.2	-	4	562	c.494T>C	c.(493-495)aTa>aCa	p.I165T	ALDH8A1_ENST00000367845.2_Missense_Mutation_p.I165T|RP11-349J5.2_ENST00000416448.2_RNA|ALDH8A1_ENST00000367847.2_Intron	NM_022568.3	NP_072090.1	Q9H2A2	AL8A1_HUMAN	aldehyde dehydrogenase 8 family, member A1	165					9-cis-retinoic acid biosynthetic process (GO:0042904)|retinal metabolic process (GO:0042574)|retinoic acid metabolic process (GO:0042573)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)	retinal dehydrogenase activity (GO:0001758)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	36	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00401)|GBM - Glioblastoma multiforme(68;0.0058)		CGCTGGAGCTATCTTCCAGGT	0.542																																					p.I165T		.											.	ALDH8A1-94	0			c.T494C						.						100.0	87.0	91.0					6																	135260502		2203	4300	6503	SO:0001583	missense	64577	exon4			GGAGCTATCTTCC	AL021939	CCDS5171.1, CCDS5172.1, CCDS55057.1	6q24.1-q25.1	2008-07-03			ENSG00000118514	ENSG00000118514		"""Aldehyde dehydrogenases"""	15471	protein-coding gene	gene with protein product		606467				11007799	Standard	NM_001193480		Approved	ALDH12	uc003qew.3	Q9H2A2	OTTHUMG00000015623	ENST00000265605.2:c.494T>C	6.37:g.135260502A>G	ENSP00000265605:p.Ile165Thr	106	0		128	17	NM_022568	0	0	6	8	2	B7Z521|O60793|Q24JS9|Q53GT3|Q5TI80	Missense_Mutation	SNP	ENST00000265605.2	37	CCDS5171.1	.	.	.	.	.	.	.	.	.	.	A	18.58	3.654610	0.67472	.	.	ENSG00000118514	ENST00000265605;ENST00000367845	T;T	0.78364	-1.17;-1.17	5.45	4.29	0.51040	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, N-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.097324	0.64402	D	0.000001	T	0.79805	0.4509	M	0.72118	2.19	0.80722	D	1	D;D	0.54397	0.958;0.966	P;D	0.64687	0.881;0.928	T	0.78919	-0.2014	10	0.35671	T	0.21	.	11.1526	0.48469	0.9277:0.0:0.0723:0.0	.	165;165	Q9H2A2-2;Q9H2A2	.;AL8A1_HUMAN	T	165	ENSP00000265605:I165T;ENSP00000356819:I165T	ENSP00000265605:I165T	I	-	2	0	ALDH8A1	135302195	1.000000	0.71417	0.338000	0.25549	0.733000	0.41908	7.522000	0.81844	0.909000	0.36697	0.460000	0.39030	ATA	.		0.542	ALDH8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042334.2		
SCAF8	22828	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	155154048	155154048	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr6:155154048G>A	ENST00000367178.3	+	20	3911	c.3335G>A	c.(3334-3336)gGt>gAt	p.G1112D	SCAF8_ENST00000367186.4_Missense_Mutation_p.G1178D|SCAF8_ENST00000417268.1_Missense_Mutation_p.G1112D|TIAM2_ENST00000461783.3_5'UTR	NM_014892.3	NP_055707.3	Q9UPN6	SCAF8_HUMAN	SR-related CTD-associated factor 8	1112					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nuclear matrix (GO:0016363)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|RNA polymerase core enzyme binding (GO:0043175)			breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(15)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	46						GTCTATGGTGGTCCAAAAGGC	0.468																																					p.G1112D		.											.	SCAF8-91	0			c.G3335A						.						66.0	72.0	70.0					6																	155154048		2203	4300	6503	SO:0001583	missense	22828	exon20			ATGGTGGTCCAAA	AB029039	CCDS5247.1, CCDS69226.1, CCDS75541.1	6q25.1-q25.3	2013-02-12	2011-01-10	2011-01-10	ENSG00000213079	ENSG00000213079		"""RNA binding motif (RRM) containing"""	20959	protein-coding gene	gene with protein product			"""RNA binding motif protein 16"""	RBM16		10470851	Standard	NM_001286189		Approved	KIAA1116	uc003qpz.3	Q9UPN6	OTTHUMG00000015877	ENST00000367178.3:c.3335G>A	6.37:g.155154048G>A	ENSP00000356146:p.Gly1112Asp	199	0		216	40	NM_014892	0	0	4	5	1	B7Z888|Q5TBU6|Q6NSK3|Q9BQN8|Q9BX43	Missense_Mutation	SNP	ENST00000367178.3	37	CCDS5247.1	.	.	.	.	.	.	.	.	.	.	G	19.22	3.784709	0.70222	.	.	ENSG00000213079;ENSG00000213079;ENSG00000213079;ENSG00000146426	ENST00000367178;ENST00000417268;ENST00000367186;ENST00000528928	T;T;T	0.61274	0.18;0.18;0.12	5.97	5.97	0.96955	.	0.000000	0.64402	U	0.000001	T	0.63534	0.2519	L	0.29908	0.895	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.66388	-0.5936	10	0.87932	D	0	.	20.4238	0.99064	0.0:0.0:1.0:0.0	.	1157;1178;1112	B7Z876;B7Z888;Q9UPN6	.;.;SCAF8_HUMAN	D	1112;1112;1178;73	ENSP00000356146:G1112D;ENSP00000413098:G1112D;ENSP00000356154:G1178D	ENSP00000356146:G1112D	G	+	2	0	TIAM2;SCAF8	155195740	1.000000	0.71417	0.999000	0.59377	0.976000	0.68499	5.774000	0.68906	2.828000	0.97474	0.655000	0.94253	GGT	.		0.468	SCAF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042798.1	NM_014892	
LPA	4018	hgsc.bcm.edu;bcgsc.ca	37	6	161071523	161071523	+	Missense_Mutation	SNP	G	G	T			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr6:161071523G>T	ENST00000316300.5	-	2	100	c.56C>A	c.(55-57)cCt>cAt	p.P19H	LPA_ENST00000447678.1_Missense_Mutation_p.P19H			P08519	APOA_HUMAN	lipoprotein, Lp(a)	2527					blood circulation (GO:0008015)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|negative regulation of endopeptidase activity (GO:0010951)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|plasma lipoprotein particle (GO:0034358)	apolipoprotein binding (GO:0034185)|endopeptidase inhibitor activity (GO:0004866)|fibronectin binding (GO:0001968)|heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|lung(54)|ovary(4)|pancreas(1)|prostate(2)|skin(10)|stomach(1)|urinary_tract(1)	107		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	GCTTTGCTCAGGTGCTGCTAA	0.433																																					p.P19H		.											.	LPA-74	0			c.C56A						.						129.0	134.0	132.0					6																	161071523		2186	4297	6483	SO:0001583	missense	4018	exon3			TGCTCAGGTGCTG	X06290	CCDS43523.1	6q25-q26	2012-10-02			ENSG00000198670	ENSG00000198670			6667	protein-coding gene	gene with protein product		152200		LP		3670400	Standard	NM_005577		Approved		uc003qtl.3	P08519	OTTHUMG00000015956	ENST00000316300.5:c.56C>A	6.37:g.161071523G>T	ENSP00000321334:p.Pro19His	95	0		109	16	NM_005577	0	0	0	0	0	Q5VTD7|Q9UD88	Missense_Mutation	SNP	ENST00000316300.5	37	CCDS43523.1	.	.	.	.	.	.	.	.	.	.	g	7.332	0.619100	0.14129	.	.	ENSG00000198670	ENST00000316300;ENST00000447678	T;T	0.61627	0.09;0.09	2.71	2.71	0.32032	.	.	.	.	.	T	0.32164	0.0820	L	0.43152	1.355	0.09310	N	1	.	.	.	.	.	.	T	0.16719	-1.0393	7	0.20519	T	0.43	.	9.0216	0.36204	0.0:0.0:1.0:0.0	.	.	.	.	H	19	ENSP00000321334:P19H;ENSP00000395608:P19H	ENSP00000321334:P19H	P	-	2	0	LPA	160991513	0.652000	0.27349	0.137000	0.22149	0.005000	0.04900	4.568000	0.60857	1.519000	0.48950	0.499000	0.49734	CCT	.		0.433	LPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042957.1	NM_005577	
SEPT7	989	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	35923576	35923576	+	Missense_Mutation	SNP	T	T	A			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr7:35923576T>A	ENST00000435235.1	+	8	1072	c.640T>A	c.(640-642)Tat>Aat	p.Y214N	SEPT7_ENST00000350320.6_Missense_Mutation_p.Y266N|SEPT7_ENST00000399035.3_Missense_Mutation_p.Y266N|SEPT7_ENST00000494488.2_Missense_Mutation_p.Y253N|SEPT7_ENST00000432293.2_Intron|SEPT7_ENST00000469679.2_Intron|SEPT7_ENST00000399034.2_Missense_Mutation_p.Y268N			Q16181	SEPT7_HUMAN	septin 7	267	Septin-type G.				cilium morphogenesis (GO:0060271)|cytokinesis (GO:0000910)|mitotic nuclear division (GO:0007067)|protein heterooligomerization (GO:0051291)|regulation of embryonic cell shape (GO:0016476)	actin cytoskeleton (GO:0015629)|axoneme (GO:0005930)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|septin complex (GO:0031105)|stress fiber (GO:0001725)	GTP binding (GO:0005525)|identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|prostate(1)	14						AGGAAGGCAGTATCCTTGGGG	0.343																																					p.Y266N													.	.	0			c.T796A						.						131.0	122.0	125.0					7																	35923576		1847	4086	5933	SO:0001583	missense	989	exon8			AGGCAGTATCCTT	S72008	CCDS75582.1	7p14.2	2013-01-21	2005-01-11	2005-01-12	ENSG00000122545	ENSG00000122545		"""Septins"""	1717	protein-coding gene	gene with protein product		603151	"""CDC10 cell division cycle 10 homolog (S. cerevisiae)"""	CDC10		8037772	Standard	NM_001788		Approved	CDC3, SEPT7A	uc011kau.2	Q16181	OTTHUMG00000155063	ENST00000435235.1:c.640T>A	7.37:g.35923576T>A	ENSP00000413507:p.Tyr214Asn	119	1		166	32	NM_001011553	0	0	22	40	18	Q52M76|Q6NX50	Missense_Mutation	SNP	ENST00000435235.1	37		.	.	.	.	.	.	.	.	.	.	T	24.2	4.503094	0.85176	.	.	ENSG00000122545	ENST00000435235;ENST00000399034;ENST00000350320;ENST00000399035;ENST00000537785;ENST00000493670;ENST00000494488	T;T;T;T;T	0.61510	0.1;0.1;0.1;0.1;0.1	4.88	4.88	0.63580	.	0.000000	0.64402	U	0.000001	T	0.78168	0.4241	M	0.86028	2.79	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.82587	-0.0383	10	0.87932	D	0	.	14.8193	0.70059	0.0:0.0:0.0:1.0	.	212;266;267	B4DNE4;E7EPK1;Q16181	.;.;SEPT7_HUMAN	N	214;268;266;266;212;214;253	ENSP00000413507:Y214N;ENSP00000381992:Y268N;ENSP00000344868:Y266N;ENSP00000381993:Y266N;ENSP00000438395:Y253N	ENSP00000344868:Y266N	Y	+	1	0	SEPT7	35890101	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.037000	0.88933	1.960000	0.56953	0.456000	0.33151	TAT	.		0.343	SEPT7-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000338285.1	NM_001788	
AUTS2	26053	broad.mit.edu	37	7	70255120	70255120	+	Missense_Mutation	SNP	A	A	T			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr7:70255120A>T	ENST00000342771.4	+	19	3239	c.2918A>T	c.(2917-2919)aAc>aTc	p.N973I	AUTS2_ENST00000406775.2_Missense_Mutation_p.N949I	NM_015570.2	NP_056385.1	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2	973										breast(2)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	50		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		GCCTACGAGAACCCCAAGAAG	0.697																																					p.N973I													.	AUTS2-92	0			c.A2918T						.						19.0	17.0	18.0					7																	70255120		2184	4284	6468	SO:0001583	missense	26053	exon19			ACGAGAACCCCAA	AF326917	CCDS5539.1, CCDS47601.1, CCDS47602.1	7q11.22	2014-01-06			ENSG00000158321	ENSG00000158321			14262	protein-coding gene	gene with protein product		607270				12160723	Standard	XM_005250257		Approved	KIAA0442, FBRSL2	uc003tvw.4	Q8WXX7	OTTHUMG00000023865	ENST00000342771.4:c.2918A>T	7.37:g.70255120A>T	ENSP00000344087:p.Asn973Ile	61	0		62	5	NM_015570	0	0	0	0	0	A4D1Y9|L7QET3|L7QF75|Q5D049|Q6PJU5|Q9Y4F2	Missense_Mutation	SNP	ENST00000342771.4	37	CCDS5539.1	.	.	.	.	.	.	.	.	.	.	A	14.15	2.448589	0.43531	.	.	ENSG00000158321	ENST00000406775;ENST00000342771	T;T	0.31769	1.48;1.48	4.63	4.63	0.57726	.	0.318337	0.36665	N	0.002467	T	0.34366	0.0895	L	0.42245	1.32	0.80722	D	1	B;B;B	0.33857	0.429;0.429;0.429	B;B;B	0.43478	0.241;0.421;0.421	T	0.09378	-1.0677	9	.	.	.	-17.0461	14.0636	0.64815	1.0:0.0:0.0:0.0	.	425;949;973	B4DLG0;Q8WXX7-2;Q8WXX7	.;.;AUTS2_HUMAN	I	949;973	ENSP00000385263:N949I;ENSP00000344087:N973I	.	N	+	2	0	AUTS2	69893056	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.386000	0.52492	1.723000	0.51488	0.533000	0.62120	AAC	.		0.697	AUTS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251971.2		
AKAP9	10142	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	91631221	91631221	+	Nonsense_Mutation	SNP	A	A	T			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr7:91631221A>T	ENST00000359028.2	+	9	2251	c.2026A>T	c.(2026-2028)Aaa>Taa	p.K676*	AKAP9_ENST00000356239.3_Nonsense_Mutation_p.K664*|AKAP9_ENST00000358100.2_Nonsense_Mutation_p.K676*			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9	676	Glu-rich.				G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)			NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			CATTCACTATAAACAGCAGAT	0.289			T	BRAF	papillary thyroid																																p.K664X				Dom	yes		7	7q21-q22	10142	A kinase (PRKA) anchor protein (yotiao) 9		E	.	AKAP9-755	0			c.A1990T						.						41.0	45.0	44.0					7																	91631221		2197	4281	6478	SO:0001587	stop_gained	10142	exon8			CACTATAAACAGC	AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.2026A>T	7.37:g.91631221A>T	ENSP00000351922:p.Lys676*	57	0		53	6	NM_005751	0	0	0	0	0	A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	Nonsense_Mutation	SNP	ENST00000359028.2	37		.	.	.	.	.	.	.	.	.	.	A	38	7.134461	0.98085	.	.	ENSG00000127914	ENST00000356239;ENST00000359028;ENST00000358100;ENST00000413120;ENST00000394565	.	.	.	5.73	4.58	0.56647	.	0.000000	0.44483	D	0.000455	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.4971	0.50415	0.93:0.0:0.07:0.0	.	.	.	.	X	664;676;676;676;676	.	ENSP00000348573:K664X	K	+	1	0	AKAP9	91469157	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.891000	0.56227	2.323000	0.78572	0.529000	0.55759	AAA	.		0.289	AKAP9-202	KNOWN	basic	protein_coding	protein_coding		NM_005751	
METTL2B	55798	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	128119287	128119287	+	Missense_Mutation	SNP	G	G	T			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr7:128119287G>T	ENST00000262432.8	+	3	315	c.278G>T	c.(277-279)aGa>aTa	p.R93I	METTL2B_ENST00000480046.1_Missense_Mutation_p.R28I|RP11-212P7.3_ENST00000462662.1_RNA	NM_018396.2	NP_060866.2	Q6P1Q9	MET2B_HUMAN	methyltransferase like 2B	93					tRNA methylation (GO:0030488)		tRNA (cytosine) methyltransferase activity (GO:0016427)			breast(1)|cervix(1)|large_intestine(2)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17						TTCAAGGATAGACATTGGCTT	0.348																																					p.R93I		.											.	METTL2B-23	0			c.G278T						.						46.0	48.0	47.0					7																	128119287		2202	4296	6498	SO:0001583	missense	55798	exon3			AGGATAGACATTG	AK002212	CCDS5803.2	7q32.2	2012-06-12	2006-02-09	2006-02-09	ENSG00000165055	ENSG00000165055			18272	protein-coding gene	gene with protein product		607846	"""methyltransferase like 2"""	METTL2		11738826	Standard	NM_018396		Approved	METL, FLJ11350	uc003vnf.3	Q6P1Q9	OTTHUMG00000143738	ENST00000262432.8:c.278G>T	7.37:g.128119287G>T	ENSP00000262432:p.Arg93Ile	390	0		481	67	NM_018396	0	0	8	8	0	B4DZ68|Q0IJ54|Q3B7J1	Missense_Mutation	SNP	ENST00000262432.8	37	CCDS5803.2	.	.	.	.	.	.	.	.	.	.	G	15.00	2.704511	0.48412	.	.	ENSG00000165055	ENST00000462662;ENST00000262432;ENST00000480046	T;T;T	0.04654	3.58;3.58;3.58	2.86	1.97	0.26223	.	0.000000	0.85682	D	0.000000	T	0.24624	0.0597	M	0.94021	3.485	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.01583	-1.1319	10	0.87932	D	0	-0.8843	7.7593	0.28942	0.1338:0.0:0.8662:0.0	.	28;93	Q6P1Q9-2;Q6P1Q9	.;MTL2B_HUMAN	I	87;93;28	ENSP00000418634:R87I;ENSP00000262432:R93I;ENSP00000418402:R28I	ENSP00000262432:R93I	R	+	2	0	METTL2B	127906523	1.000000	0.71417	0.984000	0.44739	0.344000	0.29017	9.445000	0.97587	0.540000	0.28808	-0.491000	0.04670	AGA	.		0.348	METTL2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289817.1	NM_018396	
TAS2R39	259285	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	142880641	142880641	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr7:142880641G>A	ENST00000446620.1	+	1	130	c.130G>A	c.(130-132)Gaa>Aaa	p.E44K		NM_176881.2	NP_795362.2	P59534	T2R39_HUMAN	taste receptor, type 2, member 39	44					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	20	Melanoma(164;0.059)					TTTACTTGCTGAATACCTCAT	0.413																																					p.E44K		.											.	TAS2R39-1	0			c.G130A						.						145.0	132.0	136.0					7																	142880641		1939	4149	6088	SO:0001583	missense	259285	exon1			CTTGCTGAATACC	AF494230	CCDS47729.1	7q34	2012-08-22			ENSG00000236398	ENSG00000236398		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18886	protein-coding gene	gene with protein product						12379855	Standard	NM_176881		Approved		uc011ksw.2	P59534	OTTHUMG00000152636	ENST00000446620.1:c.130G>A	7.37:g.142880641G>A	ENSP00000405095:p.Glu44Lys	106	0		188	13	NM_176881	0	0	0	0	0	A4FUI7|Q3ZCN6|Q645W4	Missense_Mutation	SNP	ENST00000446620.1	37	CCDS47729.1	.	.	.	.	.	.	.	.	.	.	G	15.58	2.876777	0.51801	.	.	ENSG00000236398	ENST00000446620	T	0.37411	1.2	4.66	4.66	0.58398	.	.	.	.	.	T	0.65196	0.2668	M	0.89478	3.035	0.29517	N	0.853797	D	0.71674	0.998	D	0.68765	0.96	T	0.65676	-0.6110	9	0.72032	D	0.01	.	14.7561	0.69567	0.0:0.0:1.0:0.0	.	44	P59534	T2R39_HUMAN	K	44	ENSP00000405095:E44K	ENSP00000405095:E44K	E	+	1	0	TAS2R39	142590763	0.321000	0.24625	0.437000	0.26809	0.026000	0.11368	1.677000	0.37576	2.583000	0.87209	0.557000	0.71058	GAA	.		0.413	TAS2R39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327090.2	NM_176881	
KRBA1	84626	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	149430813	149430813	+	Missense_Mutation	SNP	C	C	G			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr7:149430813C>G	ENST00000485033.2	+	15	2587	c.2587C>G	c.(2587-2589)Cct>Gct	p.P863A	KRBA1_ENST00000255992.10_Missense_Mutation_p.P923A|KRBA1_ENST00000479560.1_3'UTR|KRBA1_ENST00000319551.8_Missense_Mutation_p.P863A			A5PL33	KRBA1_HUMAN	KRAB-A domain containing 1	924										breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(17)|ovary(1)|prostate(1)	27	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GGCAGAACCTCCTGGGCTCCA	0.692																																					.													.	KRBA1-91	0			.						.						9.0	12.0	11.0					7																	149430813		2163	4252	6415	SO:0001583	missense	84626	.			GAACCTCCTGGGC	AB058765	CCDS75674.1	7q36	2014-02-12	2006-08-15		ENSG00000133619	ENSG00000133619		"""-"""	22228	protein-coding gene	gene with protein product			"""KRAB A domain containing 1"""				Standard	NM_001290187		Approved	KIAA1862	uc003wfz.3	A5PL33	OTTHUMG00000157886	ENST00000485033.2:c.2587C>G	7.37:g.149430813C>G	ENSP00000420112:p.Pro863Ala	48	0		50	10	.	0	0	3	5	2	A7E2F5|E7ENE9|Q8N4X0|Q96JG5	Missense_Mutation	SNP	ENST00000485033.2	37		.	.	.	.	.	.	.	.	.	.	C	10.09	1.254707	0.22965	.	.	ENSG00000133619	ENST00000255992;ENST00000319551;ENST00000485033	T;T;T	0.28069	1.63;1.63;1.63	5.37	0.334	0.15948	.	0.552042	0.15405	N	0.264109	T	0.11750	0.0286	.	.	.	0.09310	N	1	B;B	0.20780	0.048;0.048	B;B	0.24541	0.054;0.054	T	0.36529	-0.9744	9	0.05436	T	0.98	-1.0704	7.65	0.28342	0.0:0.3639:0.0:0.6361	.	863;924	E7ENE9;A5PL33	.;KRBA1_HUMAN	A	923;863;863	ENSP00000255992:P923A;ENSP00000317165:P863A;ENSP00000420112:P863A	ENSP00000255992:P923A	P	+	1	0	KRBA1	149061746	0.003000	0.15002	0.032000	0.17829	0.084000	0.17831	0.213000	0.17521	-0.172000	0.10779	-0.320000	0.08662	CCT	.		0.692	KRBA1-004	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000349841.3	NM_032534	
REPIN1	29803	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	150069172	150069172	+	Nonsense_Mutation	SNP	C	C	A			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr7:150069172C>A	ENST00000425389.2	+	1	920	c.842C>A	c.(841-843)tCg>tAg	p.S281*	REPIN1_ENST00000444957.1_Nonsense_Mutation_p.S281*|REPIN1_ENST00000479668.1_3'UTR|REPIN1_ENST00000489432.2_Nonsense_Mutation_p.S338*|REPIN1_ENST00000397281.2_Nonsense_Mutation_p.S281*|REPIN1_ENST00000466559.1_3'UTR|RP4-584D14.5_ENST00000488310.1_RNA|REPIN1_ENST00000540729.1_Nonsense_Mutation_p.S281*	NM_014374.3	NP_055189.2	Q9BWE0	REPI1_HUMAN	replication initiator 1	281					DNA replication (GO:0006260)|regulation of fatty acid transport (GO:2000191)|regulation of glucose import in response to insulin stimulus (GO:2001273)	cytosolic ribosome (GO:0022626)|lipid particle (GO:0005811)|nuclear membrane (GO:0031965)|nuclear origin of replication recognition complex (GO:0005664)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(2)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	14	Ovarian(565;0.183)|Melanoma(164;0.226)		OV - Ovarian serous cystadenocarcinoma(82;0.011)			TATCTGACTTCGCACCGGCGC	0.637																																					p.S338X		.											.	REPIN1-69	0			c.C1013A						.						18.0	23.0	22.0					7																	150069172		2160	4279	6439	SO:0001587	stop_gained	29803	exon3			TGACTTCGCACCG	AF201303	CCDS43677.1, CCDS47745.1	7q36.1	2013-01-08	2003-08-07	2003-08-08				"""Zinc fingers, C2H2-type"""	17922	protein-coding gene	gene with protein product	"""replication initiation region protein (60kD)"", ""zinc finger protein AP4"", ""zinc finger protein 464 (RIP60)"""		"""zinc finger protein 464 (RIP60)"""	ZNF464		10606657	Standard	NM_013400		Approved	RIP60, AP4, H_DJ0584D14.12, Zfp464	uc010lpr.1	Q9BWE0		ENST00000425389.2:c.842C>A	7.37:g.150069172C>A	ENSP00000388287:p.Ser281*	35	0		52	9	NM_001099695	0	0	4	6	2	C9J3L7|D3DWZ1|Q7LE03|Q9BUZ6|Q9NZH2|Q9UMP5	Nonsense_Mutation	SNP	ENST00000425389.2	37	CCDS43677.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.090002	0.76756	.	.	ENSG00000214022	ENST00000540729;ENST00000397281;ENST00000444957;ENST00000489432;ENST00000475514;ENST00000488943;ENST00000425389	.	.	.	4.91	4.91	0.64330	.	.	.	.	.	.	.	.	.	.	.	0.22017	N	0.999416	.	.	.	.	.	.	.	.	.	.	0.07325	T	0.83	-5.8606	11.3408	0.49531	0.0:0.8167:0.1833:0.0	.	.	.	.	X	281;281;281;338;340;341;281	.	ENSP00000380451:S281X	S	+	2	0	REPIN1	149700105	0.000000	0.05858	0.985000	0.45067	0.853000	0.48598	-1.414000	0.02471	2.550000	0.86006	0.462000	0.41574	TCG	.		0.637	REPIN1-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000376940.1	NM_014374	
DLGAP2	9228	broad.mit.edu	37	8	1513950	1513950	+	Silent	SNP	C	C	T	rs371842482		TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr8:1513950C>T	ENST00000421627.2	+	3	1226	c.1092C>T	c.(1090-1092)gaC>gaT	p.D364D	RP11-666I19.2_ENST00000518063.1_RNA	NM_004745.3	NP_004736.2	Q9P1A6	DLGP2_HUMAN	discs, large (Drosophila) homolog-associated protein 2	443					neuron-neuron synaptic transmission (GO:0007270)	cell junction (GO:0030054)|neurofilament (GO:0005883)|postsynaptic membrane (GO:0045211)				breast(1)|endometrium(6)|lung(31)|prostate(3)	41		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		CCATGGGGGACGAGGAGAGCG	0.567																																					p.D364D													.	DLGAP2-22	0			c.C1092T						.	C		2,4336		0,2,2167	47.0	52.0	50.0		1092	-7.2	0.2	8		50	0,8586		0,0,4293	no	coding-synonymous	DLGAP2	NM_004745.3		0,2,6460	TT,TC,CC		0.0,0.0461,0.0155		364/976	1513950	2,12922	2169	4293	6462	SO:0001819	synonymous_variant	9228	exon3			GGGGGACGAGGAG	AB000275	CCDS47760.1, CCDS75689.1	8p23	2007-12-06	2001-11-28		ENSG00000198010	ENSG00000198010			2906	protein-coding gene	gene with protein product		605438	"""discs, large (Drosophila) homolog-associated protein 2"""			9286858, 10854099	Standard	NM_004745		Approved	DAP-2	uc003wpl.4	Q9P1A6	OTTHUMG00000163599	ENST00000421627.2:c.1092C>T	8.37:g.1513950C>T		136	0		199	6	NM_004745	0	0	0	0	0	A1QCF8|A1QCF9|A5D8Y2|O14488|O14664|Q9P1A7	Silent	SNP	ENST00000421627.2	37	CCDS47760.1	.	.	.	.	.	.	.	.	.	.	C	8.974	0.973749	0.18736	4.61E-4	0.0	ENSG00000198010	ENST00000520901	.	.	.	4.55	-7.15	0.01521	.	.	.	.	.	T	0.62925	0.2468	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.67023	-0.5775	4	.	.	.	-8.2505	16.0777	0.80979	0.0:0.2339:0.0:0.7661	.	.	.	.	M	381	.	.	T	+	2	0	DLGAP2	1501357	0.455000	0.25736	0.228000	0.23943	0.986000	0.74619	-0.333000	0.07894	-1.726000	0.01370	-0.236000	0.12185	ACG	.		0.567	DLGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374478.1	NM_004745	
MTUS1	57509	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	17612803	17612803	+	Missense_Mutation	SNP	A	A	G	rs374892928		TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr8:17612803A>G	ENST00000262102.6	-	2	738	c.514T>C	c.(514-516)Ttt>Ctt	p.F172L	MTUS1_ENST00000381862.3_Missense_Mutation_p.F172L|MTUS1_ENST00000381869.3_Missense_Mutation_p.F172L|MTUS1_ENST00000519263.1_Missense_Mutation_p.F172L	NM_001001924.2	NP_001001924.1	Q9ULD2	MTUS1_HUMAN	microtubule associated tumor suppressor 1	172					cellular response to peptide hormone stimulus (GO:0071375)|regulation of macrophage chemotaxis (GO:0010758)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(14)|lung(8)|ovary(1)|skin(2)|urinary_tract(1)	36				Colorectal(111;0.0778)		TGTGATATAAAGGTGCAGTTA	0.438																																					p.F172L		.											.	MTUS1-92	0			c.T514C						.						146.0	132.0	136.0					8																	17612803		1963	4150	6113	SO:0001583	missense	57509	exon2			ATATAAAGGTGCA	AL096842	CCDS43716.1, CCDS43717.1, CCDS43718.1, CCDS43719.1, CCDS55204.1	8p22	2013-01-17	2009-10-20		ENSG00000129422	ENSG00000129422			29789	protein-coding gene	gene with protein product	"""AT2 receptor-interacting protein"", ""AT2R binding protein"", ""mitochondrial tumor suppressor gene 1"""	609589	"""mitochondrial tumor suppressor 1"""			10574462, 12692079	Standard	NM_001001931		Approved	MTSG1, KIAA1288, DKFZp586D1519, FLJ14295, ATIP1, MP44, ATBP, ICIS	uc003wxv.3	Q9ULD2	OTTHUMG00000163756	ENST00000262102.6:c.514T>C	8.37:g.17612803A>G	ENSP00000262102:p.Phe172Leu	191	0		224	34	NM_001001924	0	0	1	1	0	A8K135|B2RBJ6|B3KWJ9|B4DH03|B9EGA1|D3DSP8|Q63HJ6|Q659F4|Q6PK49|Q6URW7|Q8N4M6|Q8WTT9|Q9H7T2	Missense_Mutation	SNP	ENST00000262102.6	37	CCDS43717.1	.	.	.	.	.	.	.	.	.	.	A	13.70	2.316888	0.40996	.	.	ENSG00000129422	ENST00000381869;ENST00000262102;ENST00000519263;ENST00000381862	T;T;T;T	0.30182	2.43;2.5;2.43;1.54	4.09	2.91	0.33838	.	0.407817	0.21445	N	0.074440	T	0.21921	0.0528	L	0.32530	0.975	0.09310	N	0.999999	B;B;P	0.44139	0.356;0.206;0.827	B;B;B	0.43331	0.104;0.052;0.416	T	0.05886	-1.0858	9	.	.	.	-5.1088	5.1218	0.14863	0.5864:0.2499:0.0:0.1636	.	172;172;172	Q9ULD2-5;Q9ULD2-2;Q9ULD2	.;.;MTUS1_HUMAN	L	172	ENSP00000371293:F172L;ENSP00000262102:F172L;ENSP00000430167:F172L;ENSP00000371286:F172L	.	F	-	1	0	MTUS1	17657083	0.265000	0.24102	0.123000	0.21794	0.013000	0.08279	1.311000	0.33562	0.883000	0.36040	-0.490000	0.04691	TTT	.		0.438	MTUS1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000375247.1	XM_372031	
KAT6A	7994	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	41794945	41794945	+	Missense_Mutation	SNP	A	A	T			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr8:41794945A>T	ENST00000396930.3	-	17	3724	c.3181T>A	c.(3181-3183)Tta>Ata	p.L1061I	KAT6A_ENST00000406337.1_Missense_Mutation_p.L1061I|KAT6A_ENST00000265713.2_Missense_Mutation_p.L1061I	NM_001099412.1	NP_001092882.1	Q92794	KAT6A_HUMAN	K(lysine) acetyltransferase 6A	1061					aorta morphogenesis (GO:0035909)|cellular senescence (GO:0090398)|chromatin organization (GO:0006325)|DNA packaging (GO:0006323)|embryonic hemopoiesis (GO:0035162)|face morphogenesis (GO:0060325)|heart morphogenesis (GO:0003007)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|myeloid cell differentiation (GO:0030099)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|protein acetylation (GO:0006473)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|PML body (GO:0016605)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)										GTGGGTTCTAATCTTGGCATT	0.428																																					p.L1061I		.											.	.	0			c.T3181A						.						120.0	115.0	117.0					8																	41794945		2203	4300	6503	SO:0001583	missense	7994	exon17			GTTCTAATCTTGG	U47742	CCDS6124.1	8p11	2013-01-28	2011-07-21	2011-07-21	ENSG00000083168	ENSG00000083168		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	13013	protein-coding gene	gene with protein product	"""Monocytic leukemia zinc finger protein"""	601408	"""runt-related transcription factor binding protein 2"", ""MYST histone acetyltransferase (monocytic leukemia) 3"""	ZNF220, RUNXBP2, MYST3		8849440, 8782817	Standard	NM_001099412		Approved	MOZ, ZC2HC6A	uc003xon.4	Q92794	OTTHUMG00000150453	ENST00000396930.3:c.3181T>A	8.37:g.41794945A>T	ENSP00000380136:p.Leu1061Ile	215	0		281	58	NM_001099412	0	0	0	0	0	Q76L81	Missense_Mutation	SNP	ENST00000396930.3	37	CCDS6124.1	.	.	.	.	.	.	.	.	.	.	A	13.75	2.330228	0.41297	.	.	ENSG00000083168	ENST00000265713;ENST00000406337;ENST00000396930;ENST00000418721	T;T;T	0.66099	-0.19;-0.19;-0.19	5.63	3.27	0.37495	.	0.000000	0.53938	D	0.000041	T	0.73853	0.3640	M	0.69823	2.125	0.42293	D	0.992149	D	0.69078	0.997	D	0.78314	0.991	T	0.72571	-0.4253	10	0.62326	D	0.03	-9.4799	7.9093	0.29780	0.6901:0.0:0.3099:0.0	.	1061	Q92794	KAT6A_HUMAN	I	1061;1061;1061;641	ENSP00000265713:L1061I;ENSP00000385888:L1061I;ENSP00000380136:L1061I	ENSP00000265713:L1061I	L	-	1	2	KAT6A	41914102	0.999000	0.42202	0.996000	0.52242	0.990000	0.78478	3.600000	0.54052	0.436000	0.26393	0.528000	0.53228	TTA	.		0.428	KAT6A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318163.1	NM_006766	
WWP1	11059	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	87423961	87423961	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr8:87423961G>C	ENST00000517970.1	+	9	1226	c.919G>C	c.(919-921)Gct>Cct	p.A307P	WWP1_ENST00000265428.4_Missense_Mutation_p.A307P|WWP1_ENST00000341922.2_Missense_Mutation_p.A177P|WWP1_ENST00000349423.2_Missense_Mutation_p.A89P	NM_007013.3	NP_008944.1	Q9H0M0	WWP1_HUMAN	WW domain containing E3 ubiquitin protein ligase 1	307					central nervous system development (GO:0007417)|ion transmembrane transport (GO:0034220)|negative regulation of transcription, DNA-templated (GO:0045892)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|signal transduction (GO:0007165)|transmembrane transport (GO:0055085)|viral entry into host cell (GO:0046718)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(3)|kidney(2)|large_intestine(9)|liver(4)|lung(10)|prostate(2)|urinary_tract(1)	31						GGAATCTGAAGCTAGAAGTAT	0.408																																					p.A307P		.											.	WWP1-659	0			c.G919C						.						78.0	76.0	77.0					8																	87423961		2203	4300	6503	SO:0001583	missense	11059	exon9			TCTGAAGCTAGAA	AY043361	CCDS6242.1	8q21.3	2013-07-22			ENSG00000123124	ENSG00000123124			17004	protein-coding gene	gene with protein product		602307				9169421, 9647693	Standard	NM_007013		Approved	AIP5, DKFZP434D2111	uc003ydt.3	Q9H0M0	OTTHUMG00000163690	ENST00000517970.1:c.919G>C	8.37:g.87423961G>C	ENSP00000427793:p.Ala307Pro	109	0		111	18	NM_007013	0	0	4	5	1	O00307|Q5YLC1|Q96BP4	Missense_Mutation	SNP	ENST00000517970.1	37	CCDS6242.1	.	.	.	.	.	.	.	.	.	.	G	5.203	0.222924	0.09863	.	.	ENSG00000123124	ENST00000517970;ENST00000265428;ENST00000341922;ENST00000349423	T;T;T;T	0.46451	0.89;0.89;0.87;0.89	5.69	4.81	0.61882	.	0.669254	0.14402	N	0.321845	T	0.21962	0.0529	N	0.08118	0	0.39335	D	0.965486	B;B	0.06786	0.0;0.001	B;B	0.09377	0.004;0.003	T	0.08513	-1.0718	10	0.30078	T	0.28	.	7.2873	0.26346	0.1504:0.1403:0.7094:0.0	.	89;307	Q9H0M0-6;Q9H0M0	.;WWP1_HUMAN	P	307;307;177;89	ENSP00000427793:A307P;ENSP00000265428:A307P;ENSP00000340564:A177P;ENSP00000342665:A89P	ENSP00000265428:A307P	A	+	1	0	WWP1	87493077	0.557000	0.26546	0.093000	0.20910	0.015000	0.08874	0.271000	0.18626	1.410000	0.46936	0.650000	0.86243	GCT	.		0.408	WWP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374755.1	NM_007013	
EIF3H	8667	broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	117661151	117661151	+	Missense_Mutation	SNP	T	T	G			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr8:117661151T>G	ENST00000276682.4	-	8	1530	c.764A>C	c.(763-765)aAg>aCg	p.K255T	EIF3H_ENST00000521861.1_Missense_Mutation_p.K241T					eukaryotic translation initiation factor 3, subunit H											large_intestine(2)|lung(10)|skin(1)	13	all_cancers(13;3.98e-22)|Lung NSC(37;0.000183)|Ovarian(258;0.0172)					CTGTAGATTCTTCCCCAAATG	0.333																																					p.K241T													.	EIF3H-658	0			c.A722C						.						187.0	166.0	173.0					8																	117661151		2203	4300	6503	SO:0001583	missense	8667	exon6			AGATTCTTCCCCA	U54559	CCDS6319.1	8q24.11	2007-07-27	2007-07-27	2007-07-27	ENSG00000147677	ENSG00000147677			3273	protein-coding gene	gene with protein product		603912	"""eukaryotic translation initiation factor 3, subunit 3 gamma, 40kDa"""	EIF3S3		9341143	Standard	NM_003756		Approved	eIF3-gamma, eIF3-p40, eIF3h	uc003yoa.3	O15372	OTTHUMG00000164919	ENST00000276682.4:c.764A>C	8.37:g.117661151T>G	ENSP00000276682:p.Lys255Thr	106	1		147	36	NM_003756	0	0	136	219	83		Missense_Mutation	SNP	ENST00000276682.4	37		.	.	.	.	.	.	.	.	.	.	T	26.6	4.753458	0.89753	.	.	ENSG00000147677	ENST00000521861;ENST00000276682;ENST00000518949	T;T	0.52526	0.69;0.66	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.69251	0.3090	M	0.81112	2.525	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.64144	0.922;0.922	T	0.73228	-0.4049	10	0.62326	D	0.03	-27.6801	16.4116	0.83717	0.0:0.0:0.0:1.0	.	255;241	B3KS98;O15372	.;EIF3H_HUMAN	T	241;255;209	ENSP00000429931:K241T;ENSP00000276682:K255T	ENSP00000276682:K255T	K	-	2	0	EIF3H	117730332	1.000000	0.71417	0.996000	0.52242	0.987000	0.75469	8.040000	0.89188	2.276000	0.75962	0.528000	0.53228	AAG	.		0.333	EIF3H-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000380913.1	NM_003756	
PLIN2	123	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	19126158	19126158	+	Silent	SNP	C	C	A			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr9:19126158C>A	ENST00000276914.2	-	3	359	c.180G>T	c.(178-180)gtG>gtT	p.V60V	PLIN2_ENST00000380465.3_Silent_p.V60V|PLIN2_ENST00000380464.3_Silent_p.V60V|PLIN2_ENST00000411567.1_Silent_p.V60V	NM_001122.3	NP_001113.2	Q99541	PLIN2_HUMAN	perilipin 2	60					cellular lipid metabolic process (GO:0044255)|lipid storage (GO:0019915)|long-chain fatty acid transport (GO:0015909)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|lipid particle (GO:0005811)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	19						TGGTCATGGCCACGGAGGTGA	0.527																																					p.V60V		.											.	PLIN2-92	0			c.G180T						.						160.0	124.0	136.0					9																	19126158		2203	4300	6503	SO:0001819	synonymous_variant	123	exon3			CATGGCCACGGAG	X97324	CCDS6490.1	9p22.1	2009-08-12	2009-08-12	2009-08-12	ENSG00000147872	ENSG00000147872		"""Perilipins"""	248	protein-coding gene	gene with protein product	"""adipophilin"""	103195	"""adipose differentiation-related protein"""	ADFP		9003395, 19638644	Standard	NM_001122		Approved	ADRP	uc003zno.3	Q99541	OTTHUMG00000019624	ENST00000276914.2:c.180G>T	9.37:g.19126158C>A		207	0		263	49	NM_001122	0	1	21	53	31	Q9BSC3	Silent	SNP	ENST00000276914.2	37	CCDS6490.1																																																																																			.		0.527	PLIN2-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051835.1	NM_001122	
AGTPBP1	23287	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	88233969	88233969	+	Missense_Mutation	SNP	C	C	G			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr9:88233969C>G	ENST00000357081.3	-	17	2408	c.2264G>C	c.(2263-2265)gGa>gCa	p.G755A	AGTPBP1_ENST00000376083.3_Missense_Mutation_p.G715A|AGTPBP1_ENST00000337006.4_3'UTR|AGTPBP1_ENST00000376109.3_Missense_Mutation_p.G767A|AGTPBP1_ENST00000432218.1_Missense_Mutation_p.G593A			Q9UPW5	CBPC1_HUMAN	ATP/GTP binding protein 1	755					adult walking behavior (GO:0007628)|C-terminal protein deglutamylation (GO:0035609)|cerebellar Purkinje cell differentiation (GO:0021702)|eye photoreceptor cell differentiation (GO:0001754)|mitochondrion organization (GO:0007005)|neuromuscular process (GO:0050905)|neurotransmitter metabolic process (GO:0042133)|olfactory bulb development (GO:0021772)|protein side chain deglutamylation (GO:0035610)|retina development in camera-type eye (GO:0060041)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(12)|lung(12)|ovary(5)|skin(2)|urinary_tract(3)	44						TGGTCGCATTCCACTGACTTC	0.328																																					p.G715A		.											.	AGTPBP1-158	0			c.G2144C						.						92.0	93.0	92.0					9																	88233969		2203	4300	6503	SO:0001583	missense	23287	exon17			CGCATTCCACTGA	AB028958	CCDS6672.1, CCDS75854.1	9q21.33	2014-06-23			ENSG00000135049	ENSG00000135049			17258	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 1"", ""tubulinyl-Tyr carboxypeptidase"", ""carboxypeptidase-tubulin"", ""tyrosine carboxypeptidase"", ""soluble carboxypeptidase"""	606830				11083920	Standard	NM_015239		Approved	KIAA1035, Nna1, CCP1	uc010mqc.3	Q9UPW5	OTTHUMG00000020124	ENST00000357081.3:c.2264G>C	9.37:g.88233969C>G	ENSP00000349592:p.Gly755Ala	136	0		130	27	NM_015239	0	0	3	3	0	B4DIT6|B4DRZ8|Q5VV80|Q63HM7|Q658P5|Q6P9D6|Q9H8U6|Q9H9W8|Q9NVK1	Missense_Mutation	SNP	ENST00000357081.3	37		.	.	.	.	.	.	.	.	.	.	C	16.55	3.154898	0.57259	.	.	ENSG00000135049	ENST00000357081;ENST00000376083;ENST00000376109;ENST00000432218	T;T;T;T	0.31510	1.49;1.49;1.49;1.49	5.38	5.38	0.77491	.	0.097920	0.64402	D	0.000001	T	0.55593	0.1930	M	0.67517	2.055	0.80722	D	1	B;D;D;P	0.76494	0.34;0.992;0.999;0.729	B;P;D;B	0.73708	0.257;0.872;0.981;0.439	T	0.54057	-0.8350	10	0.48119	T	0.1	-15.9497	19.1333	0.93415	0.0:1.0:0.0:0.0	.	767;755;593;715	Q9UPW5-3;Q9UPW5;B4DHX2;Q9UPW5-2	.;CBPC1_HUMAN;.;.	A	755;715;767;593	ENSP00000349592:G755A;ENSP00000365251:G715A;ENSP00000365277:G767A;ENSP00000402804:G593A	ENSP00000349592:G755A	G	-	2	0	AGTPBP1	87423789	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.890000	0.69774	2.532000	0.85374	0.650000	0.86243	GGA	.		0.328	AGTPBP1-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000052893.1	NM_015239	
ASS1	445	broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	133342187	133342187	+	Splice_Site	SNP	G	G	C			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr9:133342187G>C	ENST00000372394.1	+	7	976		c.e7+1		ASS1_ENST00000352480.5_Splice_Site|ASS1_ENST00000372393.3_Splice_Site|ASS1_ENST00000493984.2_Splice_Site			P00966	ASSY_HUMAN	argininosuccinate synthase 1						acute-phase response (GO:0006953)|aging (GO:0007568)|arginine biosynthetic process (GO:0006526)|argininosuccinate metabolic process (GO:0000053)|aspartate metabolic process (GO:0006531)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to amine stimulus (GO:0071418)|cellular response to amino acid stimulus (GO:0071230)|cellular response to ammonium ion (GO:0071242)|cellular response to cAMP (GO:0071320)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to glucagon stimulus (GO:0071377)|cellular response to interferon-gamma (GO:0071346)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to oleic acid (GO:0071400)|cellular response to tumor necrosis factor (GO:0071356)|citrulline metabolic process (GO:0000052)|diaphragm development (GO:0060539)|kidney development (GO:0001822)|liver development (GO:0001889)|midgut development (GO:0007494)|negative regulation of leukocyte cell-cell adhesion (GO:1903038)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to growth hormone (GO:0060416)|response to mycotoxin (GO:0010046)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|urea cycle (GO:0000050)	cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)|perikaryon (GO:0043204)	amino acid binding (GO:0016597)|argininosuccinate synthase activity (GO:0004055)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|toxic substance binding (GO:0015643)			breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	17				OV - Ovarian serous cystadenocarcinoma(145;0.000514)	Adenosine triphosphate(DB00171)|L-Arginine(DB00125)|L-Aspartic Acid(DB00128)|L-Citrulline(DB00155)	GTACGCAAAGGTATGGCCGAG	0.612																																					.													.	ASS1-91	0			c.495+1G>C						.						104.0	84.0	90.0					9																	133342187		2203	4300	6503	SO:0001630	splice_region_variant	445	exon7			GCAAAGGTATGGC	X01630	CCDS6933.1	9q34.1	2012-10-02	2010-04-20	2006-08-24	ENSG00000130707	ENSG00000130707	6.3.4.5		758	protein-coding gene	gene with protein product		603470	"""argininosuccinate synthetase"""	ASS		3513483, 852520	Standard	NM_054012		Approved	CTLN1	uc004bzm.3	P00966	OTTHUMG00000020806	ENST00000372394.1:c.495+1G>C	9.37:g.133342187G>C		171	1		226	30	NM_000050	0	0	0	0	0	Q6LDL2|Q86UZ0|Q96GT4	Splice_Site	SNP	ENST00000372394.1	37	CCDS6933.1	.	.	.	.	.	.	.	.	.	.	G	10.96	1.498082	0.26861	.	.	ENSG00000130707	ENST00000334909;ENST00000352480;ENST00000372394;ENST00000372393;ENST00000422569;ENST00000443588	.	.	.	4.79	4.79	0.61399	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.8195	0.85742	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ASS1	132332008	1.000000	0.71417	0.996000	0.52242	0.068000	0.16541	8.950000	0.93019	2.187000	0.69744	0.462000	0.41574	.	.		0.612	ASS1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054652.1	NM_000050	Intron
PHPT1	29085	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	139744582	139744582	+	Missense_Mutation	SNP	A	A	G			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr9:139744582A>G	ENST00000247665.10	+	2	615	c.278A>G	c.(277-279)tAt>tGt	p.Y93C	PHPT1_ENST00000545326.1_Missense_Mutation_p.Y93C|PHPT1_ENST00000492540.1_3'UTR|MAMDC4_ENST00000445819.1_5'Flank|PHPT1_ENST00000371661.1_Missense_Mutation_p.Y93C|MAMDC4_ENST00000317446.2_5'Flank	NM_014172.4	NP_054891.2	Q9NRX4	PHP14_HUMAN	phosphohistidine phosphatase 1	93					negative regulation of ATP citrate synthase activity (GO:2000984)|negative regulation of lyase activity (GO:0051350)|negative regulation of T cell receptor signaling pathway (GO:0050860)|peptidyl-histidine dephosphorylation (GO:0035971)|positive regulation of cell motility (GO:2000147)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|protein dephosphorylation (GO:0006470)|regulation of actin cytoskeleton reorganization (GO:2000249)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	calcium channel inhibitor activity (GO:0019855)|ion channel binding (GO:0044325)|phosphohistidine phosphatase activity (GO:0008969)|phosphoprotein phosphatase activity (GO:0004721)			NS(1)|large_intestine(1)|lung(1)	3	all_cancers(76;0.0763)|all_epithelial(76;0.198)	Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;1.52e-05)|Epithelial(140;0.000171)		GTGTACGGCTATTCCATGGTG	0.662																																					p.Y93C		.											.	PHPT1-90	0			c.A278G						.						93.0	86.0	88.0					9																	139744582		2202	4300	6502	SO:0001583	missense	29085	exon2			ACGGCTATTCCAT	AF131857	CCDS7009.1, CCDS48060.1	9q34.3	2008-02-05			ENSG00000054148	ENSG00000054148	3.1.3.-		30033	protein-coding gene	gene with protein product	"""phosphohistidine phosphatase 14kDa"", "" sex-regulated protein janus-a"""	610167				11042152, 8619474	Standard	NM_014172		Approved	PHP14, HSPC141, CGI-202, DKFZp564M173, bA216L13.10	uc004cjq.4	Q9NRX4	OTTHUMG00000020950	ENST00000247665.10:c.278A>G	9.37:g.139744582A>G	ENSP00000247665:p.Tyr93Cys	120	0		179	30	NM_001135861	0	0	1	7	6	B1AMX0|B1AMX1|Q9H0Y3	Missense_Mutation	SNP	ENST00000247665.10	37	CCDS7009.1	.	.	.	.	.	.	.	.	.	.	.	22.3	4.267724	0.80469	.	.	ENSG00000054148	ENST00000371661;ENST00000545326;ENST00000247665	.	.	.	4.61	4.61	0.57282	.	.	.	.	.	T	0.80979	0.4728	M	0.88450	2.955	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.83346	-0.0005	8	0.46703	T	0.11	-0.3441	13.1692	0.59589	1.0:0.0:0.0:0.0	.	93;93	Q9NRX4-2;Q9NRX4	.;PHP14_HUMAN	C	93	.	ENSP00000247665:Y93C	Y	+	2	0	PHPT1	138864403	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	5.655000	0.67981	1.703000	0.51240	0.374000	0.22700	TAT	.		0.662	PHPT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055150.1	NM_014172	
BMP15	9210	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	50658965	50658965	+	Silent	SNP	C	C	T			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chrX:50658965C>T	ENST00000252677.3	+	2	537	c.537C>T	c.(535-537)aaC>aaT	p.N179N		NM_005448.2	NP_005439.2	O95972	BMP15_HUMAN	bone morphogenetic protein 15	179					female gamete generation (GO:0007292)|granulosa cell development (GO:0060016)|ovarian follicle development (GO:0001541)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)				NS(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(2)|skin(1)	26	Ovarian(276;0.236)					TGATGTCTAACGCTTGGAAAG	0.473																																					p.N179N		.											.	BMP15-132	0			c.C537T						.						116.0	94.0	101.0					X																	50658965		2203	4299	6502	SO:0001819	synonymous_variant	9210	exon2			GTCTAACGCTTGG	AF082349	CCDS14334.1	Xp11.2	2013-02-06			ENSG00000130385	ENSG00000130385		"""Bone morphogenetic proteins"""	1068	protein-coding gene	gene with protein product		300247				9849956	Standard	NM_005448		Approved	GDF9B	uc011mnw.2	O95972	OTTHUMG00000021525	ENST00000252677.3:c.537C>T	X.37:g.50658965C>T		184	0		217	78	NM_005448	0	0	0	0	0	Q17RM6|Q5JST1|Q9UMS1	Silent	SNP	ENST00000252677.3	37	CCDS14334.1																																																																																			.		0.473	BMP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056572.1	NM_005448	
ZCCHC5	203430	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	X	77913359	77913359	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chrX:77913359G>A	ENST00000321110.1	-	2	854	c.559C>T	c.(559-561)Cct>Tct	p.P187S		NM_152694.2	NP_689907.1	Q8N8U3	ZCHC5_HUMAN	zinc finger, CCHC domain containing 5	187	Pro-rich.						nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(18)|ovary(1)|prostate(1)|skin(1)	37						TCCTGGGGAGGTGGAAGCTCA	0.537																																					p.P187S		.											.	ZCCHC5-131	0			c.C559T						.						41.0	41.0	41.0					X																	77913359		2203	4300	6503	SO:0001583	missense	203430	exon2			GGGGAGGTGGAAG	AK096184	CCDS14440.1	Xq13.3	2008-02-05			ENSG00000179300	ENSG00000179300		"""Zinc fingers, CCHC domain containing"""	22997	protein-coding gene	gene with protein product						15716091, 16093683	Standard	NM_152694		Approved	FLJ38865, Mar3, Mart3, ZHC5	uc004edc.1	Q8N8U3	OTTHUMG00000021892	ENST00000321110.1:c.559C>T	X.37:g.77913359G>A	ENSP00000316794:p.Pro187Ser	15	0		47	18	NM_152694	0	0	0	0	0	B2RMZ0|Q5JQE9	Missense_Mutation	SNP	ENST00000321110.1	37	CCDS14440.1	.	.	.	.	.	.	.	.	.	.	G	0.020	-1.432832	0.01108	.	.	ENSG00000179300	ENST00000321110	T	0.17691	2.26	3.46	-5.74	0.02391	.	.	.	.	.	T	0.05547	0.0146	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.40289	-0.9571	9	0.07175	T	0.84	.	1.35	0.02171	0.2436:0.2501:0.329:0.1772	.	187	Q8N8U3	ZCHC5_HUMAN	S	187	ENSP00000316794:P187S	ENSP00000316794:P187S	P	-	1	0	ZCCHC5	77800015	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.423000	0.01030	-1.795000	0.01255	-3.016000	0.00074	CCT	.		0.537	ZCCHC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057319.1	NM_152694	
SRPX2	27286	broad.mit.edu	37	X	99919925	99919925	+	Missense_Mutation	SNP	T	T	G			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chrX:99919925T>G	ENST00000373004.3	+	5	938	c.510T>G	c.(508-510)agT>agG	p.S170R		NM_014467.2	NP_055282.1	O60687	SRPX2_HUMAN	sushi-repeat containing protein, X-linked 2	170	Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.				angiogenesis (GO:0001525)|cell motility (GO:0048870)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|positive regulation of synapse assembly (GO:0051965)|regulation of phosphorylation (GO:0042325)|single organismal cell-cell adhesion (GO:0016337)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|excitatory synapse (GO:0060076)|extracellular space (GO:0005615)|synaptic membrane (GO:0097060)	hepatocyte growth factor binding (GO:0036458)|identical protein binding (GO:0042802)|receptor binding (GO:0005102)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(10)|ovary(2)|upper_aerodigestive_tract(1)	19						GGAGATGGAGTGGAGGCGAGC	0.517																																					p.S170R													.	SRPX2-132	0			c.T510G						.						58.0	48.0	52.0					X																	99919925		2203	4300	6503	SO:0001583	missense	27286	exon5			ATGGAGTGGAGGC	AF393649	CCDS14471.1	Xq21.33-q23	2011-01-25	2011-01-25		ENSG00000102359	ENSG00000102359			30668	protein-coding gene	gene with protein product		300642	"""sushi-repeat-containing protein, X-linked 2"""			9864177	Standard	NM_014467		Approved	SRPUL	uc004egb.3	O60687	OTTHUMG00000022003	ENST00000373004.3:c.510T>G	X.37:g.99919925T>G	ENSP00000362095:p.Ser170Arg	121	7		124	9	NM_014467	0	0	2	2	0	B3KQT3|Q8WW85	Missense_Mutation	SNP	ENST00000373004.3	37	CCDS14471.1	.	.	.	.	.	.	.	.	.	.	T	18.27	3.587119	0.66105	.	.	ENSG00000102359	ENST00000373004	T	0.68765	-0.35	5.74	0.76	0.18442	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.85682	D	0.000000	D	0.83986	0.5373	H	0.94658	3.565	0.58432	D	0.999999	D	0.76494	0.999	D	0.87578	0.998	D	0.84349	0.0531	9	.	.	.	-15.0606	10.4888	0.44739	0.0:0.4289:0.0:0.5711	.	170	O60687	SRPX2_HUMAN	R	170	ENSP00000362095:S170R	.	S	+	3	2	SRPX2	99806581	0.023000	0.18921	0.999000	0.59377	0.990000	0.78478	-0.866000	0.04245	0.004000	0.14682	-0.335000	0.08231	AGT	.		0.517	SRPX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057486.1	NM_014467	
RBMXL1	494115	broad.mit.edu	37	1	89449426	89449426	+	Frame_Shift_Del	DEL	A	A	-			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr1:89449426delA	ENST00000321792.5	-	2	511	c.84delT	c.(82-84)tttfs	p.F28fs	CCBL2_ENST00000260508.4_Intron|CCBL2_ENST00000370485.2_Intron|RBMXL1_ENST00000399794.2_Frame_Shift_Del_p.F28fs|RBMXL1_ENST00000413769.1_5'UTR|CCBL2_ENST00000370491.3_Intron|CCBL2_ENST00000446900.2_Intron	NM_019610.5	NP_062556.2	Q96E39	RMXL1_HUMAN	RNA binding motif protein, X-linked-like 1	28	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)										CATATTTGCCAAATACTGTTT	0.413											OREG0013593	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.F28fs													.	.	0			c.84delT						.						191.0	187.0	188.0					1																	89449426		2203	4300	6503	SO:0001589	frameshift_variant	494115	exon2			TTTGCCAAATACT	BC012942	CCDS716.1	1p22.2	2013-02-12	2007-01-04	2007-01-04	ENSG00000213516	ENSG00000213516		"""RNA binding motif (RRM) containing"""	25073	protein-coding gene	gene with protein product	"""kynurenine aminotransferase III"""					10441733	Standard	NM_019610		Approved	KAT3	uc001dms.3	Q96E39	OTTHUMG00000010661	ENST00000321792.5:c.84delT	1.37:g.89449426delA	ENSP00000318415:p.Phe28fs	525	0	1267	504	53	NM_019610	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000321792.5	37	CCDS716.1																																																																																			.		0.413	RBMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029403.3	NM_019610	
IQGAP3	128239	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	156517916	156517917	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr1:156517916_156517917delAG	ENST00000361170.2	-	19	2262_2263	c.2252_2253delCT	c.(2251-2253)gctfs	p.A751fs		NM_178229.4	NP_839943.2	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	751	IQ 1. {ECO:0000255|PROSITE- ProRule:PRU00116}.				activation of MAPK activity (GO:0000187)|cellular response to organic substance (GO:0071310)|ERK1 and ERK2 cascade (GO:0070371)|G1/S transition of mitotic cell cycle (GO:0000082)|negative regulation of gene expression (GO:0010629)|positive regulation of gene expression (GO:0010628)|positive regulation of mammary gland epithelial cell proliferation (GO:0033601)|Ras protein signal transduction (GO:0007265)|regulation of cell size (GO:0008361)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)	Ras GTPase activator activity (GO:0005099)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(14)|lung(29)|ovary(5)|prostate(5)|skin(5)|urinary_tract(3)	75	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GGGAATGCTCAGCAAACTTCTG	0.579																																					p.751_751del		.											.	IQGAP3-96	0			c.2252_2253del						.																																			SO:0001589	frameshift_variant	128239	exon19			.	AY253300	CCDS1144.1	1q21.3	2008-02-05			ENSG00000183856	ENSG00000183856			20669	protein-coding gene	gene with protein product							Standard	NM_178229		Approved		uc001fpf.3	Q86VI3	OTTHUMG00000033114	ENST00000361170.2:c.2252_2253delCT	1.37:g.156517916_156517917delAG	ENSP00000354451:p.Ala751fs	101	0		131	33	NM_178229	0	0	0	0	0	Q5T3H8	Frame_Shift_Del	DEL	ENST00000361170.2	37	CCDS1144.1																																																																																			.		0.579	IQGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080657.1	NM_178229	
DNHD1	144132	broad.mit.edu	37	11	6561201	6561201	+	Frame_Shift_Del	DEL	C	C	-			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr11:6561201delC	ENST00000527990.2	+	16	3516	c.3516delC	c.(3514-3516)ttcfs	p.F1172fs	DNHD1_ENST00000254579.6_Frame_Shift_Del_p.F1172fs			Q96M86	DNHD1_HUMAN	dynein heavy chain domain 1	1172					microtubule-based movement (GO:0007018)	dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)	microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(13)|kidney(6)|large_intestine(11)|lung(14)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	55		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.171)		Epithelial(150;3.93e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		TGCTCAACTTCATCCTGCATG	0.582																																					p.F1172fs													.	DNHD1-24	0			c.3516delC						.						62.0	66.0	65.0					11																	6561201		692	1591	2283	SO:0001589	frameshift_variant	144132	exon18			CAACTTCATCCTG	AK128064	CCDS44532.1, CCDS7767.1	11p15.4	2011-02-10		2005-11-28	ENSG00000179532	ENSG00000179532			26532	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 47"", ""dynein heavy chain domain 1-like"", ""coiled-coil domain containing 35"""	DHCD1, C11orf47, DNHD1L, CCDC35		12975309	Standard	NM_173589		Approved	FLJ32752, FLJ46184, FLJ35709, DKFZp686J0796	uc001mdw.4	Q96M86	OTTHUMG00000133403	ENST00000527990.2:c.3516delC	11.37:g.6561201delC	ENSP00000436180:p.Phe1172fs	171	0		220	19	NM_144666	0	0	0	0	0	Q2NKK8|Q6UWI9|Q8NAA2|Q8TEE6|Q9NSZ9	Frame_Shift_Del	DEL	ENST00000527990.2	37	CCDS44532.1																																																																																			.		0.582	DNHD1-007	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384673.2	NM_144666	
OR8B2	26595	bcgsc.ca	37	11	124252684	124252692	+	In_Frame_Del	DEL	GGAGGAGGG	GGAGGAGGG	-			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	GGAGGAGGG	GGAGGAGGG	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr11:124252684_124252692delGGAGGAGGG	ENST00000375013.2	-	1	566_574	c.548_556delCCCTCCTCC	c.(547-558)cccctcctccag>cag	p.PLL183del		NM_001005468.1	NP_001005468.1	Q96RD0	OR8B2_HUMAN	olfactory receptor, family 8, subfamily B, member 2	183						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(13)|ovary(1)	23		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0277)		CAGGAAAGCTGGAGGAGGGGGAGTATGTC	0.488																																					p.183_186del													.	OR8B2-68	0			c.548_556del						.																																			SO:0001651	inframe_deletion	26595	exon1			AAAGCTGGAGGAG	AB065826	CCDS31708.1	11q24.1	2012-08-09			ENSG00000204293	ENSG00000204293		"""GPCR / Class A : Olfactory receptors"""	8471	protein-coding gene	gene with protein product							Standard	XM_005271500		Approved		uc010sai.2	Q96RD0	OTTHUMG00000165982	ENST00000375013.2:c.548_556delCCCTCCTCC	11.37:g.124252684_124252692delGGAGGAGGG	ENSP00000364152:p.Pro183_Leu185del	871	1		1060	38	NM_001005468	0	0	0	0	0	Q8NGH2	In_Frame_Del	DEL	ENST00000375013.2	37	CCDS31708.1																																																																																			.		0.488	OR8B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387290.1	NM_001005468	
SAV1	60485	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	51132105	51132106	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	CT	CT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr14:51132105_51132106delCT	ENST00000324679.4	-	2	689_690	c.326_327delAG	c.(325-327)gagfs	p.E109fs	RP11-248J18.2_ENST00000602954.1_RNA	NM_021818.3	NP_068590.1	Q9H4B6	SAV1_HUMAN	salvador family WW domain containing protein 1	109					hair follicle development (GO:0001942)|hippo signaling (GO:0035329)|intestinal epithelial cell differentiation (GO:0060575)|keratinocyte differentiation (GO:0030216)|lung epithelial cell differentiation (GO:0060487)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of epithelial cell proliferation (GO:0050680)|positive regulation of apoptotic process (GO:0043065)|regulation of stem cell maintenance (GO:2000036)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)				breast(1)|kidney(2)|lung(2)|prostate(1)	6	all_epithelial(31;0.000611)|Breast(41;0.0333)					AAGAACCATACTCTCTAGGGAC	0.376																																					p.109_109del		.											.	SAV1-658	0			c.326_327del						.																																			SO:0001589	frameshift_variant	60485	exon2			.	AK023071	CCDS9701.1	14q13-q23	2014-04-14	2014-04-14		ENSG00000151748	ENSG00000151748			17795	protein-coding gene	gene with protein product	"""WW domain-containing adaptor 45"""	607203	"""salvador homolog 1 (Drosophila)"""			12202036, 11027580	Standard	NM_021818		Approved	WW45, WWP4, salvador	uc001wyh.2	Q9H4B6	OTTHUMG00000140293	ENST00000324679.4:c.326_327delAG	14.37:g.51132109_51132110delCT	ENSP00000324729:p.Glu109fs	725	0		757	161	NM_021818	0	0	0	0	0	A8K4B8|D3DSB6|Q6IA58|Q9H949|Q9HAK9	Frame_Shift_Del	DEL	ENST00000324679.4	37	CCDS9701.1																																																																																			.		0.376	SAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276879.1		
GHDC	84514	broad.mit.edu;bcgsc.ca	37	17	40344519	40344519	+	Frame_Shift_Del	DEL	A	A	-			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr17:40344519delA	ENST00000301671.8	-	4	1070	c.629delT	c.(628-630)ttcfs	p.F210fs	GHDC_ENST00000414034.3_Frame_Shift_Del_p.F210fs|GHDC_ENST00000593209.1_Frame_Shift_Del_p.F210fs|GHDC_ENST00000428494.2_Frame_Shift_Del_p.F171fs|GHDC_ENST00000590520.1_5'Flank|GHDC_ENST00000587427.1_Frame_Shift_Del_p.F210fs|GHDC_ENST00000436923.2_Frame_Shift_Del_p.F210fs			Q8N2G8	GHDC_HUMAN	GH3 domain containing	210						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13		all_cancers(22;0.000229)|Breast(137;0.00104)|all_epithelial(22;0.00304)		BRCA - Breast invasive adenocarcinoma(366;0.124)		CAGGCCCAAGAAAACATCCAG	0.652																																					p.F210fs													.	GHDC-90	0			c.629delT						.						82.0	94.0	89.0					17																	40344519		2202	4298	6500	SO:0001589	frameshift_variant	84514	exon5			CCCAAGAAAACAT	AF316997, BC011056	CCDS11422.1, CCDS45682.1	17q21.2	2006-08-02				ENSG00000167925			24438	protein-coding gene	gene with protein product		608587				11161808, 11735219	Standard	NR_024573		Approved	LGP1	uc002hzf.4	Q8N2G8		ENST00000301671.8:c.629delT	17.37:g.40344519delA	ENSP00000301671:p.Phe210fs	132	0		194	19	NM_001142623	0	0	0	0	0	B4DQS4|E9PDB5|Q9BXM6	Frame_Shift_Del	DEL	ENST00000301671.8	37	CCDS11422.1																																																																																			.		0.652	GHDC-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449794.1	NM_032484	
RNF213	57674	broad.mit.edu;bcgsc.ca	37	17	78350139	78350141	+	In_Frame_Del	DEL	GAT	GAT	-			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	GAT	GAT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr17:78350139_78350141delGAT	ENST00000582970.1	+	52	13367_13369	c.13224_13226delGAT	c.(13222-13227)aagatc>aac	p.4408_4409KI>N	RNF213_ENST00000336301.6_In_Frame_Del_p.2481_2482KI>N|CTD-2047H16.4_ENST00000572151.1_RNA|RNF213_ENST00000508628.2_In_Frame_Del_p.4457_4458KI>N|CTD-2047H16.4_ENST00000575034.1_RNA	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	4408					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			GCGAATGCAAGATCCTTTCACCT	0.433																																					p.4408_4409del													.	RNF213-577	0			c.13224_13226del						.																																			SO:0001651	inframe_deletion	57674	exon52			ATGCAAGATCCTT	AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.13224_13226delGAT	17.37:g.78350139_78350141delGAT	ENSP00000464087:p.Lys4408_Ile4409delinsAsn	159	0		254	32	NM_001256071	0	0	0	0	0	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	In_Frame_Del	DEL	ENST00000582970.1	37	CCDS58606.1																																																																																			.		0.433	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443298.1	NM_020914	
CACNA1D	776	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	53844325	53844325	+	Splice_Site	DEL	A	A	-			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr3:53844325delA	ENST00000350061.5	+	47	6703	c.6192delA	c.(6190-6192)gca>gc	p.A2064fs	CACNA1D_ENST00000422281.2_Splice_Site_p.A2040fs|CACNA1D_ENST00000544977.1_3'UTR|CACNA1D_ENST00000288139.4_Splice_Site_p.A2084fs	NM_001128840.1	NP_001122312.1	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type, alpha 1D subunit	2064					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|energy reserve metabolic process (GO:0006112)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during SA node cell action potential (GO:0086052)|positive regulation of calcium ion transport (GO:0051928)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|ankyrin binding (GO:0030506)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)|voltage-gated calcium channel activity involved in cardiac muscle cell action potential (GO:0086007)|voltage-gated calcium channel activity involved SA node cell action potential (GO:0086059)			breast(3)|central_nervous_system(9)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(13)|liver(1)|lung(29)|ovary(6)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	90				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	TGGTGGAGGCAGTGAGTACGG	0.612																																					p.A2084fs		.											.	CACNA1D-100	0			c.6252delA						.						53.0	60.0	57.0					3																	53844325		2203	4300	6503	SO:0001630	splice_region_variant	776	exon48			.	AB209171	CCDS2872.1, CCDS46848.1, CCDS46849.1	3p14.3	2012-03-07			ENSG00000157388	ENSG00000157388		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1391	protein-coding gene	gene with protein product		114206		CCHL1A2, CACNL1A2		1664412	Standard	NM_000720		Approved	Cav1.3, CACH3, CACN4	uc003dgu.5	Q01668	OTTHUMG00000158278	ENST00000350061.5:c.6192+1A>-	3.37:g.53844325delA		376	0		472	86	NM_000720	0	0	0	0	0	B0FYA3|Q13916|Q13931|Q71UT1|Q9UDC3	Frame_Shift_Del	DEL	ENST00000350061.5	37	CCDS46848.1																																																																																			.		0.612	CACNA1D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350557.1	NM_000720	Frame_Shift_Del
YEATS2	55689	broad.mit.edu;bcgsc.ca	37	3	183476664	183476664	+	Frame_Shift_Del	DEL	A	A	-			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr3:183476664delA	ENST00000305135.5	+	13	1762	c.1567delA	c.(1567-1569)aagfs	p.K523fs		NM_018023.4	NP_060493.3	Q9ULM3	YETS2_HUMAN	YEATS domain containing 2	523					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|mitotic spindle (GO:0072686)	TBP-class protein binding (GO:0017025)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(24)|ovary(3)|prostate(2)|skin(3)	49	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			TCCTACAAACAAGATCTCCAC	0.373																																					p.K523fs													.	YEATS2-138	0			c.1567delA						.						138.0	126.0	129.0					3																	183476664		1834	4080	5914	SO:0001589	frameshift_variant	55689	exon13			ACAAACAAGATCT	AB033023	CCDS43175.1	3q27.3	2004-08-18			ENSG00000163872	ENSG00000163872			25489	protein-coding gene	gene with protein product		613373				10574462	Standard	NM_018023		Approved	FLJ10201, FLJ12841, FLJ13308, KIAA1197	uc003fly.2	Q9ULM3	OTTHUMG00000156898	ENST00000305135.5:c.1567delA	3.37:g.183476664delA	ENSP00000306983:p.Lys523fs	343	0		388	55	NM_018023	0	0	0	0	0	A7E2B9|D3DNS9|Q641P6|Q9NW96	Frame_Shift_Del	DEL	ENST00000305135.5	37	CCDS43175.1																																																																																			.		0.373	YEATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346507.2	NM_018023	
CNGA1	1259	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	47938977	47938977	+	Frame_Shift_Del	DEL	T	T	-			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr4:47938977delT	ENST00000514170.1	-	11	1853	c.1534delA	c.(1534-1536)atcfs	p.I512fs	CNGA1_ENST00000358519.4_Frame_Shift_Del_p.I512fs|CNGA1_ENST00000402813.3_Frame_Shift_Del_p.I581fs|CNGA1_ENST00000544810.1_Frame_Shift_Del_p.I512fs|CNGA1_ENST00000420489.2_Frame_Shift_Del_p.I512fs			P29973	CNGA1_HUMAN	cyclic nucleotide gated channel alpha 1	512					phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|urinary_tract(1)	28						TCTCGTCCGATATCCCCTTTC	0.463																																					p.I581fs		.											.	CNGA1-92	0			c.1741delA						.						111.0	112.0	111.0					4																	47938977		2138	4277	6415	SO:0001589	frameshift_variant	1259	exon10			.	M84741	CCDS43226.1, CCDS47050.1	4p12	2013-02-14				ENSG00000198515		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2148	protein-coding gene	gene with protein product		123825		CNCG1, CNCG		7683629, 16382102	Standard	NM_000087		Approved	RCNC1, RCNCa, CNG1, RP49	uc003gxu.3	P29973		ENST00000514170.1:c.1534delA	4.37:g.47938977delT	ENSP00000426862:p.Ile512fs	189	0		176	29	NM_001142564	0	0	0	0	0	A8K7K6|J3KPZ2|Q16279|Q16485|Q4W5E3	Frame_Shift_Del	DEL	ENST00000514170.1	37	CCDS43226.1																																																																																			.		0.463	CNGA1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000372070.2	NM_000087	
NPTX2	4885	bcgsc.ca	37	7	98257767	98257767	+	Frame_Shift_Del	DEL	C	C	-			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr7:98257767delC	ENST00000265634.3	+	5	1287	c.1122delC	c.(1120-1122)agcfs	p.S374fs		NM_002523.2	NP_002514.1	P47972	NPTX2_HUMAN	neuronal pentraxin II	374	Pentaxin.				synaptic transmission (GO:0007268)	extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(5)|lung(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	18	all_cancers(62;2.28e-09)|all_epithelial(64;4.86e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0128)|all_lung(186;0.0142)		STAD - Stomach adenocarcinoma(171;0.215)			GGGAGCTCAGCCAGTTCAACA	0.567																																					p.S374fs													.	NPTX2-515	0			c.1122delC						.						89.0	70.0	76.0					7																	98257767		2203	4300	6503	SO:0001589	frameshift_variant	4885	exon5			GCTCAGCCAGTTC		CCDS5657.1	7q21.3-q22.1	2008-04-30			ENSG00000106236	ENSG00000106236			7953	protein-coding gene	gene with protein product	"""apexin"""	600750				8530029	Standard	NM_002523		Approved		uc003upl.2	P47972	OTTHUMG00000154369	ENST00000265634.3:c.1122delC	7.37:g.98257767delC	ENSP00000265634:p.Ser374fs	168	1		246	43	NM_002523	0	0	0	0	0	A4D267|Q86XV7|Q96G70	Frame_Shift_Del	DEL	ENST00000265634.3	37	CCDS5657.1																																																																																			.		0.567	NPTX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334982.1	NM_002523	
ADARB2	105	broad.mit.edu	37	10	1405639	1405640	+	Frame_Shift_Ins	INS	-	-	G			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr10:1405639_1405640insG	ENST00000381312.1	-	3	985_986	c.660_661insC	c.(658-663)cccgacfs	p.D221fs	RP11-398B16.2_ENST00000432987.1_RNA	NM_018702.3	NP_061172.1	Q9NS39	RED2_HUMAN	adenosine deaminase, RNA-specific, B2 (non-functional)	221					mRNA processing (GO:0006397)	nucleus (GO:0005634)	adenosine deaminase activity (GO:0004000)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|single-stranded RNA binding (GO:0003727)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(17)|prostate(2)|skin(1)|urinary_tract(1)	41		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)		AAGAGCGTGTCGGGGAAATCGG	0.762																																					p.D221fs													.	ADARB2-153	0			c.661_662insC						.																																			SO:0001589	frameshift_variant	105	exon3			GCGTGTCGGGGAA	AF034837	CCDS7058.1	10p15.3	2013-05-20	2013-05-20		ENSG00000185736	ENSG00000185736	3.5.-.-		227	protein-coding gene	gene with protein product	"""RED2 homolog (rat)"""	602065	"""adenosine deaminase, RNA-specific, B2 (RED2 homolog rat)"", ""adenosine deaminase, RNA-specific, B2"""			9272162, 10836796	Standard	NM_018702		Approved	RED2, hRED2, ADAR3	uc009xhq.3	Q9NS39	OTTHUMG00000017543	ENST00000381312.1:c.661dupC	10.37:g.1405643_1405643dupG	ENSP00000370713:p.Asp221fs	5	0		6	2	NM_018702	0	0	0	0	0	B2RPJ5|Q5VUT6|Q5VW42	Frame_Shift_Ins	INS	ENST00000381312.1	37	CCDS7058.1																																																																																			.		0.762	ADARB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046426.1	NM_018702	
MAML2	84441	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	95712439	95712440	+	Frame_Shift_Ins	INS	-	-	T			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr11:95712439_95712440insT	ENST00000524717.1	-	5	4427_4428	c.3143_3144insA	c.(3142-3144)aatfs	p.N1048fs		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	1048					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)		CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				TGGGTCTGAGATTCAGACCCCT	0.5			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid																																p.N1048fs		.		Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	.	MAML2-850	0			c.3144_3145insA						.																																			SO:0001589	frameshift_variant	84441	exon5			.	AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.3144dupA	11.37:g.95712441_95712441dupT	ENSP00000434552:p.Asn1048fs	154	0		214	49	NM_032427	0	0	0	0	0	A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Frame_Shift_Ins	INS	ENST00000524717.1	37	CCDS44714.1																																																																																			.		0.500	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395540.1		
MMD	23531	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	53485137	53485138	+	Frame_Shift_Ins	INS	-	-	AG			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr17:53485137_53485138insAG	ENST00000262065.3	-	4	609_610	c.313_314insCT	c.(313-315)tatfs	p.Y105fs		NM_012329.2	NP_036461.2	Q15546	PAQRB_HUMAN	monocyte to macrophage differentiation-associated	105					cytolysis (GO:0019835)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|membrane (GO:0016020)	receptor activity (GO:0004872)			breast(1)|large_intestine(1)|lung(4)|prostate(1)	7						AATGAAGAAATAGATAACCATT	0.386																																					p.Y105fs		.											.	MMD-90	0			c.314_315insCT						.																																			SO:0001589	frameshift_variant	23531	exon4			.	X85750	CCDS11586.1	17q	2008-05-02				ENSG00000108960			7153	protein-coding gene	gene with protein product		604467				7503749, 16044242	Standard	NM_012329		Approved	MMA, PAQR11	uc002iui.3	Q15546		ENST00000262065.3:c.312_313dupCT	17.37:g.53485138_53485139dupAG	ENSP00000262065:p.Tyr105fs	114	0		115	31	NM_012329	0	0	0	0	0	B2R6X9|D3DTY6|Q8TAN7	Frame_Shift_Ins	INS	ENST00000262065.3	37	CCDS11586.1																																																																																			.		0.386	MMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439214.1		
CGB	1082	broad.mit.edu	37	19	49526376	49526377	+	Frame_Shift_Ins	INS	-	-	T			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr19:49526376_49526377insT	ENST00000357383.4	-	3	625_626	c.264_265insA	c.(262-267)cggctcfs	p.L89fs	CTB-60B18.6_ENST00000591656.1_Frame_Shift_Ins_p.L75fs	NM_000737.3	NP_000728.1	P01233	CGHB_HUMAN	chorionic gonadotropin, beta polypeptide	89					apoptotic process (GO:0006915)|cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|female gamete generation (GO:0007292)|peptide hormone processing (GO:0016486)|signal transduction (GO:0007165)	extracellular region (GO:0005576)	hormone activity (GO:0005179)			large_intestine(1)	1		all_epithelial(76;9.62e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000371)|OV - Ovarian serous cystadenocarcinoma(262;0.000503)|GBM - Glioblastoma multiforme(486;0.00518)|Epithelial(262;0.0427)		CAGCCAGGGAGCCGGATGGACT	0.693																																					p.L89fs													.	CGB-22	0			c.265_266insA						.																																			SO:0001589	frameshift_variant	1082	exon3			CAGGGAGCCGGAT	J00117	CCDS12749.1	19q13.3	2013-02-25				ENSG00000104827		"""Endogenous ligands"""	1886	protein-coding gene	gene with protein product		118860				6774259, 6194155	Standard	NM_000737		Approved	CGB3	uc002plv.2	P01233		ENST00000357383.4:c.264_265insA	19.37:g.49526376_49526377insT	ENSP00000349954:p.Leu89fs	18	0		10	2	NM_000737	0	0	0	0	0	A1A5E0|B9ZVP5|Q13991|Q14000|Q3KPI3|Q3SY41|Q8WTT5|Q8WXL1|Q8WXL2|Q8WXL3|Q8WXL4	Frame_Shift_Ins	INS	ENST00000357383.4	37	CCDS12749.1																																																																																			.		0.693	CGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452164.2	NM_000737	
NEFH	4744	broad.mit.edu	37	22	29885622	29885623	+	In_Frame_Ins	INS	-	-	AGGAAG	rs267607534|rs267607535		TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr22:29885622_29885623insAGGAAG	ENST00000310624.6	+	4	2026_2027	c.1993_1994insAGGAAG	c.(1993-1995)aag>aAGGAAGag	p.665_666insEE		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	671	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						GTCCCCTGAGAAGGCCAAGTCC	0.579																																					p.K665delinsKEE													.	NEFH-90	0			c.1993_1994insAGGAAG						.																																			SO:0001652	inframe_insertion	4744	exon4			CCTGAGAAGGCCA		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	Exception_encountered	22.37:g.29885622_29885623insAGGAAG	ENSP00000311997:p.Lys665_Ala666insGluGlu	472	0		595	9	NM_021076	0	0	0	0	0	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	In_Frame_Ins	INS	ENST00000310624.6	37	CCDS13858.1																																																																																			.		0.579	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
CCDC112	153733	broad.mit.edu;bcgsc.ca	37	5	114603580	114603581	+	Frame_Shift_Ins	INS	-	-	TT			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr5:114603580_114603581insTT	ENST00000512261.1	-	11	1749_1750	c.1333_1334insAA	c.(1333-1335)agafs	p.R445fs	CCDC112_ENST00000379611.5_Frame_Shift_Ins_p.R528fs|CCDC112_ENST00000506442.1_Frame_Shift_Ins_p.R413fs|CCDC112_ENST00000395557.4_Frame_Shift_Ins_p.R445fs			Q8NEF3	CC112_HUMAN	coiled-coil domain containing 112	445										endometrium(2)|kidney(1)|large_intestine(8)|lung(8)|skin(1)	20		all_cancers(142;0.000523)|all_epithelial(76;6.44e-06)|Prostate(80;0.00955)|Ovarian(225;0.0443)|all_lung(232;0.132)|Breast(839;0.195)		OV - Ovarian serous cystadenocarcinoma(64;4.09e-08)|Epithelial(69;5.28e-08)|all cancers(49;7.06e-06)		ATCTCATACTCTTCTCTGTATT	0.327																																					p.R528fs													.	CCDC112-90	0			c.1583_1584insAA						.																																			SO:0001589	frameshift_variant	153733	exon10			CATACTCTTCTCT	BC031242	CCDS4117.1, CCDS34213.1	5q22.3	2009-04-17			ENSG00000164221	ENSG00000164221			28599	protein-coding gene	gene with protein product						12477932	Standard	NM_001040440		Approved	MGC39633	uc003kqz.2	Q8NEF3	OTTHUMG00000128894	ENST00000512261.1:c.1332_1333dupAA	5.37:g.114603581_114603582dupTT	ENSP00000423712:p.Arg445fs	238	0		238	31	NM_001040440	0	0	0	0	0	Q6A334	Frame_Shift_Ins	INS	ENST00000512261.1	37	CCDS4117.1																																																																																			.		0.327	CCDC112-003	PUTATIVE	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000370999.1	NM_152549	
ABCB6	10058	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	220075010	220075011	+	Missense_Mutation	DNP	CA	CA	AG			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	CA	CA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr2:220075010_220075011CA>AG	ENST00000265316.3	-	18	2677_2678	c.2361_2362TG>CT	c.(2359-2364)acTGtg>acCTtg	p.V788L	ABCB6_ENST00000439002.2_Missense_Mutation_p.V742L	NM_005689.2	NP_005680.1	Q9NP58	ABCB6_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 6 (Langereis blood group)	788	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				brain development (GO:0007420)|cellular iron ion homeostasis (GO:0006879)|heme transport (GO:0015886)|porphyrin-containing compound biosynthetic process (GO:0006779)|skin development (GO:0043588)|transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of mitochondrial outer membrane (GO:0031307)|mitochondrial envelope (GO:0005740)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|efflux transmembrane transporter activity (GO:0015562)|heme binding (GO:0020037)|heme transporter activity (GO:0015232)|heme-transporting ATPase activity (GO:0015439)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(9)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	34		Renal(207;0.0474)		Epithelial(149;1.22e-06)|all cancers(144;0.000201)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GCATTGACCACAGTTGAGAGCC	0.55																																					p.V788L													.	ABCB6-153	0			c.T2361C						.																																			SO:0001583	missense	10058	exon18			GACCACAGTTGAG	AF070598	CCDS2436.1	2q36	2014-08-27	2014-08-27		ENSG00000115657	ENSG00000115657		"""ATP binding cassette transporters / subfamily B"""	47	protein-coding gene	gene with protein product	"""ATP-binding cassette half-transporter"""	605452	"""ATP-binding cassette, sub-family B (MDR/TAP), member 6"""			8894702, 9110174	Standard	NM_005689		Approved	EST45597, umat, MTABC3	uc002vkc.2	Q9NP58	OTTHUMG00000133131	ENST00000265316.3:c.2361_2362delinsAG	2.37:g.220075010_220075011delinsAG	ENSP00000265316:p.Val788Leu	121	1		178	28	NM_005689	0	0	0	0	0	O75542|Q49A66|Q59GQ5|Q6ZME6|Q96ME8|Q9HAQ6|Q9HAQ7	Missense_Mutation	DNP	ENST00000265316.3	37	CCDS2436.1																																																																																			.		0.550	ABCB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256820.2	NM_005689	
SMC1B	27127	broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	45785629	45785630	+	Missense_Mutation	DNP	GC	GC	CT			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	GC	GC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr22:45785629_45785630GC>CT	ENST00000357450.4	-	10	1692_1693	c.1693_1694GC>AG	c.(1693-1695)GCt>AGt	p.A565S	SMC1B_ENST00000404354.3_Missense_Mutation_p.A565S	NM_148674.3	NP_683515.3	Q8NDV3	SMC1B_HUMAN	structural maintenance of chromosomes 1B	565	Flexible hinge.				meiotic nuclear division (GO:0007126)|sister chromatid cohesion (GO:0007062)	chromosome, centromeric region (GO:0000775)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear meiotic cohesin complex (GO:0034991)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			breast(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	37		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		CTCAGGTTCAGCTCTTTCCTCC	0.386																																					p.A565S													.	SMC1B-229	0			c.G1693A						.																																			SO:0001583	missense	27127	exon10			GTTCAGCTCTTTC	AJ504806	CCDS43027.1, CCDS74876.1	22q13	2006-07-06	2006-07-06	2006-07-06	ENSG00000077935	ENSG00000077935		"""Structural maintenance of chromosomes proteins"""	11112	protein-coding gene	gene with protein product		608685	"""SMC1 (structural maintenance of chromosomes 1, yeast)-like 1"", ""SMC1 structural maintenance of chromosomes 1-like 2 (yeast)"""	SMC1L2		10591208, 11564881	Standard	XM_005261566		Approved	bK268H5	uc003bgc.3	Q8NDV3	OTTHUMG00000151334	ENST00000357450.4:c.1693_1694delinsCT	22.37:g.45785629_45785630delinsCT	ENSP00000350036:p.Ala565Ser	155	1		169	36	NM_148674	0	0	0	0	0	A0AV46|B0QY23|B0QY24|Q5TIC3|Q6ZUF9|Q9Y3G5	Missense_Mutation	DNP	ENST00000357450.4	37	CCDS43027.1																																																																																			.		0.386	SMC1B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322256.2	NM_148674	
