#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
GNB1	2782	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	1720557	1720557	+	Missense_Mutation	SNP	A	A	C			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr1:1720557A>C	ENST00000378609.4	-	10	1182	c.851T>G	c.(850-852)cTc>cGc	p.L284R		NM_001282539.1|NM_002074.3	NP_001269468.1|NP_002065.1	P62873	GBB1_HUMAN	guanine nucleotide binding protein (G protein), beta polypeptide 1	284					adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|blood coagulation (GO:0007596)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|energy reserve metabolic process (GO:0006112)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|GTP catabolic process (GO:0006184)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|Ras protein signal transduction (GO:0007265)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intracellular (GO:0005622)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	GTPase activity (GO:0003924)|GTPase binding (GO:0051020)|protein complex binding (GO:0032403)|signal transducer activity (GO:0004871)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(3)|skin(1)	12	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.62e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;1.14e-35)|OV - Ovarian serous cystadenocarcinoma(86;7.31e-23)|GBM - Glioblastoma multiforme(42;3.1e-07)|COAD - Colon adenocarcinoma(227;0.000323)|Colorectal(212;0.000374)|Kidney(185;0.00392)|BRCA - Breast invasive adenocarcinoma(365;0.00573)|STAD - Stomach adenocarcinoma(132;0.0072)|KIRC - Kidney renal clear cell carcinoma(229;0.0482)|Lung(427;0.236)		AGCAAGGAGGAGGCGCCCGCT	0.572											OREG0012998	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L284R		.											.	GNB1-227	0			c.T851G						.						100.0	94.0	96.0					1																	1720557		2203	4300	6503	SO:0001583	missense	2782	exon10			AGGAGGAGGCGCC	BC004186	CCDS34.1, CCDS72685.1	1p36.33	2013-01-10			ENSG00000078369	ENSG00000078369		"""WD repeat domain containing"""	4396	protein-coding gene	gene with protein product		139380					Standard	NM_002074		Approved		uc001aif.3	P62873	OTTHUMG00000000940	ENST00000378609.4:c.851T>G	1.37:g.1720557A>C	ENSP00000367872:p.Leu284Arg	143	0	598	145	67	NM_002074	0	0	97	140	43	B1AJZ7|P04697|P04901|Q1RMY8	Missense_Mutation	SNP	ENST00000378609.4	37	CCDS34.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	22.4|22.4	4.290122|4.290122	0.80914|0.80914	.|.	.|.	ENSG00000078369|ENSG00000078369	ENST00000378609;ENST00000455156;ENST00000378606|ENST00000424622	T|.	0.62105|.	0.05|.	5.52|5.52	5.52|5.52	0.82312|0.82312	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.76528|0.76528	0.4000|0.4000	M|M	0.80847|0.80847	2.515|2.515	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.81914|.	0.995|.	T|T	0.78219|0.78219	-0.2289|-0.2289	10|5	0.51188|.	T|.	0.08|.	-9.8798|-9.8798	14.8181|14.8181	0.70050|0.70050	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	284|.	P62873|.	GBB1_HUMAN|.	R|A	284;184;284|142	ENSP00000367872:L284R|.	ENSP00000367869:L284R|.	L|S	-|-	2|1	0|0	GNB1|GNB1	1710417|1710417	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.885000|0.885000	0.51271|0.51271	9.126000|9.126000	0.94411|0.94411	2.096000|2.096000	0.63516|0.63516	0.533000|0.533000	0.62120|0.62120	CTC|TCC	.		0.572	GNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002762.3	NM_002074	
HES3	390992	hgsc.bcm.edu	37	1	6305201	6305201	+	Missense_Mutation	SNP	A	A	C	rs188463518	byFrequency	TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr1:6305201A>C	ENST00000377898.3	+	4	260	c.195A>C	c.(193-195)caA>caC	p.Q65H		NM_001024598.3	NP_001019769.1	Q5TGS1	HES3_HUMAN	hes family bHLH transcription factor 3	65	Orange.				hindbrain morphogenesis (GO:0021575)|in utero embryonic development (GO:0001701)|midbrain development (GO:0030901)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oculomotor nerve development (GO:0021557)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of timing of neuron differentiation (GO:0060164)|transcription, DNA-templated (GO:0006351)|trochlear nerve development (GO:0021558)	nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription factor binding (GO:0008134)			lung(2)|skin(1)	3	Ovarian(185;0.0634)	all_cancers(23;2.48e-32)|all_epithelial(116;1.14e-17)|all_lung(118;2.85e-06)|all_neural(13;3.68e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;3.77e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00475)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;1.2e-37)|GBM - Glioblastoma multiforme(13;3.2e-29)|OV - Ovarian serous cystadenocarcinoma(86;2.52e-19)|Colorectal(212;1.19e-07)|COAD - Colon adenocarcinoma(227;1.3e-05)|Kidney(185;4.88e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000871)|BRCA - Breast invasive adenocarcinoma(365;0.00105)|STAD - Stomach adenocarcinoma(132;0.00308)|READ - Rectum adenocarcinoma(331;0.0642)|Lung(427;0.241)		GAGCCGAGCAACCGTCGGGCT	0.721													C|||	221	0.0441294	0.0741	0.0159	5008	,	,		7481	0.0308		0.007	False		,,,				2504	0.0757				p.Q65H		.											.	HES3-514	0			c.A195C						.	C	HIS/GLN	138,3116		2,134,1491	3.0	3.0	3.0		195	2.3	0.4	1		3	36,7122		0,36,3543	no	missense	HES3	NM_001024598.3	24	2,170,5034	CC,CA,AA		0.5029,4.2409,1.6711	benign	65/187	6305201	174,10238	1627	3579	5206	SO:0001583	missense	390992	exon4			CGAGCAACCGTCG		CCDS41238.1	1p36.31	2013-10-17	2013-10-17		ENSG00000173673	ENSG00000173673		"""Basic helix-loop-helix proteins"""	26226	protein-coding gene	gene with protein product		609971	"""hairy and enhancer of split 3 (Drosophila)"""				Standard	NM_001024598		Approved	bHLHb43	uc009vly.2	Q5TGS1	OTTHUMG00000001271	ENST00000377898.3:c.195A>C	1.37:g.6305201A>C	ENSP00000367130:p.Gln65His	3	0		21	9	NM_001024598	0	0	0	0	0	Q5TGS0	Missense_Mutation	SNP	ENST00000377898.3	37	CCDS41238.1	73	0.033424908424908424	40	0.08130081300813008	7	0.019337016574585635	19	0.033216783216783216	7	0.009234828496042216	C	9.558	1.117756	0.20877	0.042409	0.005029	ENSG00000173673	ENST00000377898	T	0.31510	1.49	3.2	2.28	0.28536	.	0.393226	0.19492	N	0.112980	T	0.00580	0.0019	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.18178	-1.0345	10	0.66056	D	0.02	-10.1808	4.0729	0.09891	0.2297:0.645:0.0:0.1253	.	65	Q5TGS1	HES3_HUMAN	H	65	ENSP00000367130:Q65H	ENSP00000367130:Q65H	Q	+	3	2	HES3	6227788	0.055000	0.20627	0.403000	0.26384	0.425000	0.31504	0.673000	0.25203	0.398000	0.25338	-0.763000	0.03452	CAA	A|0.967;C|0.033		0.721	HES3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000003716.3	NM_001024598	
DNAJC16	23341	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	15855696	15855696	+	Missense_Mutation	SNP	A	A	C			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr1:15855696A>C	ENST00000375847.3	+	2	260	c.96A>C	c.(94-96)agA>agC	p.R32S	DNAJC16_ENST00000375849.1_Missense_Mutation_p.R32S|CASP9_ENST00000469637.1_5'Flank|DNAJC16_ENST00000375838.1_Missense_Mutation_p.R32S	NM_015291.2	NP_056106.1	Q9Y2G8	DJC16_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 16	32	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.				cell redox homeostasis (GO:0045454)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(7)|urinary_tract(1)	18		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00173)|all_lung(284;0.00459)|Lung NSC(340;0.00499)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.18e-07)|COAD - Colon adenocarcinoma(227;4.5e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00774)|READ - Rectum adenocarcinoma(331;0.0657)		ACCCATACAGAGTCCTAGGGG	0.443																																					p.R32S		.											.	DNAJC16-226	0			c.A96C						.						109.0	107.0	108.0					1																	15855696		2203	4300	6503	SO:0001583	missense	23341	exon2			ATACAGAGTCCTA	AB023179	CCDS30606.1, CCDS72710.1	1p36.1	2011-09-02			ENSG00000116138	ENSG00000116138		"""Heat shock proteins / DNAJ (HSP40)"""	29157	protein-coding gene	gene with protein product							Standard	NM_015291		Approved	KIAA0962	uc001aws.3	Q9Y2G8	OTTHUMG00000002358	ENST00000375847.3:c.96A>C	1.37:g.15855696A>C	ENSP00000365007:p.Arg32Ser	106	0		120	47	NM_015291	0	0	0	0	0	Q68D57|Q86X32|Q8N5P4	Missense_Mutation	SNP	ENST00000375847.3	37	CCDS30606.1	.	.	.	.	.	.	.	.	.	.	A	14.92	2.678494	0.47886	.	.	ENSG00000116138	ENST00000375847;ENST00000375838;ENST00000375849;ENST00000546230	T;T;T	0.72282	-0.64;-0.64;-0.64	5.41	5.41	0.78517	Heat shock protein DnaJ, N-terminal (5);	0.092613	0.64402	D	0.000001	T	0.41465	0.1160	N	0.02111	-0.68	0.24628	N	0.99364	B;B	0.28208	0.166;0.203	B;B	0.24848	0.056;0.052	T	0.29518	-1.0009	10	0.38643	T	0.18	-23.0336	8.0421	0.30527	0.9101:0.0:0.0899:0.0	.	32;32	Q9Y2G8;Q5TDG9	DJC16_HUMAN;.	S	32	ENSP00000365007:R32S;ENSP00000364998:R32S;ENSP00000365009:R32S	ENSP00000364998:R32S	R	+	3	2	DNAJC16	15728283	1.000000	0.71417	1.000000	0.80357	0.863000	0.49368	3.233000	0.51311	2.060000	0.61445	0.460000	0.39030	AGA	.		0.443	DNAJC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006764.1	NM_015291	
UBR4	23352	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	19500887	19500887	+	Missense_Mutation	SNP	G	G	T			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr1:19500887G>T	ENST00000375254.3	-	22	2935	c.2908C>A	c.(2908-2910)Ctg>Atg	p.L970M	UBR4_ENST00000375267.2_Missense_Mutation_p.L970M|UBR4_ENST00000375217.2_Missense_Mutation_p.L970M|UBR4_ENST00000375226.2_Missense_Mutation_p.L970M	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	970					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		AGGGCTGTCAGTGCAGCATAA	0.438																																					p.L970M		.											.	UBR4-612	0			c.C2908A						.						120.0	102.0	108.0					1																	19500887		2203	4300	6503	SO:0001583	missense	23352	exon22			CTGTCAGTGCAGC	AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.2908C>A	1.37:g.19500887G>T	ENSP00000364403:p.Leu970Met	52	0		37	11	NM_020765	0	0	3	3	0	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Missense_Mutation	SNP	ENST00000375254.3	37	CCDS189.1	.	.	.	.	.	.	.	.	.	.	G	15.95	2.982527	0.53827	.	.	ENSG00000127481	ENST00000375254;ENST00000375267;ENST00000375217;ENST00000375226;ENST00000419533	T;T;T;T	0.36699	1.26;1.26;1.24;1.24	5.76	-1.65	0.08291	.	0.000000	0.64402	D	0.000001	T	0.44371	0.1290	L	0.39898	1.24	0.80722	D	1	D	0.65815	0.995	D	0.70487	0.969	T	0.26467	-1.0102	10	0.87932	D	0	.	11.0624	0.47955	0.5235:0.0:0.4765:0.0	.	970	Q5T4S7	UBR4_HUMAN	M	970;970;970;970;186	ENSP00000364403:L970M;ENSP00000364416:L970M;ENSP00000364365:L970M;ENSP00000364374:L970M	ENSP00000364365:L970M	L	-	1	2	UBR4	19373474	0.850000	0.29656	0.011000	0.14972	0.823000	0.46562	1.167000	0.31847	-0.623000	0.05618	-0.768000	0.03414	CTG	.		0.438	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007085.1	NM_020765	
USP48	84196	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	22073615	22073615	+	Silent	SNP	A	A	G			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr1:22073615A>G	ENST00000308271.9	-	8	1584	c.936T>C	c.(934-936)aaT>aaC	p.N312N	USP48_ENST00000529637.1_Silent_p.N312N|USP48_ENST00000400301.1_Silent_p.N312N|USP48_ENST00000421625.2_Silent_p.N312N	NM_032236.5	NP_115612.4	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 48	312	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)			NS(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(14)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		Colorectal(325;3.46e-05)|all_lung(284;4.29e-05)|Lung NSC(340;4.66e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|OV - Ovarian serous cystadenocarcinoma(117;4.74e-26)|COAD - Colon adenocarcinoma(152;1.3e-05)|GBM - Glioblastoma multiforme(114;1.86e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000614)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(1967;0.00711)|Lung(427;0.0327)|READ - Rectum adenocarcinoma(331;0.0657)|LUSC - Lung squamous cell carcinoma(448;0.0753)		CAATGTAGGTATTCAGCTTTT	0.313																																					p.N312N		.											.	USP48-659	0			c.T936C						.						94.0	91.0	92.0					1																	22073615		2203	4300	6503	SO:0001819	synonymous_variant	84196	exon8			GTAGGTATTCAGC	AF502942	CCDS30623.1, CCDS44084.1	1p36.12	2008-02-05	2005-08-08	2004-04-07	ENSG00000090686	ENSG00000090686		"""Ubiquitin-specific peptidases"""	18533	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"", ""ubiquitin specific protease 48"""	USP31		12838346	Standard	XM_005246009		Approved	FLJ23277, FLJ11328, FLJ20103, FLJ23054, MGC14879	uc001bfb.3	Q86UV5	OTTHUMG00000007798	ENST00000308271.9:c.936T>C	1.37:g.22073615A>G		18	0		18	5	NM_001032730	0	0	0	2	2	B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	Silent	SNP	ENST00000308271.9	37	CCDS30623.1																																																																																			.		0.313	USP48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021372.1	NM_032236	
MECR	51102	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	29520638	29520638	+	Missense_Mutation	SNP	G	G	C			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr1:29520638G>C	ENST00000263702.6	-	10	1043	c.1018C>G	c.(1018-1020)Ctc>Gtc	p.L340V	MECR_ENST00000373791.3_Missense_Mutation_p.L264V			Q9BV79	MECR_HUMAN	mitochondrial trans-2-enoyl-CoA reductase	340					fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	trans-2-enoyl-CoA reductase (NADPH) activity (GO:0019166)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(1)|ovary(2)|prostate(1)	11		Colorectal(325;0.000389)|Breast(348;0.00765)|Lung NSC(340;0.0081)|all_lung(284;0.00914)|all_neural(195;0.0199)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)|Medulloblastoma(700;0.123)		Colorectal(126;3.39e-07)|COAD - Colon adenocarcinoma(152;2.04e-05)|STAD - Stomach adenocarcinoma(196;0.0195)|BRCA - Breast invasive adenocarcinoma(304;0.053)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.137)		GGGGCTGTGAGCTGGCCTCGG	0.572																																					p.L340V		.											.	MECR-91	0			c.C1018G						.						102.0	109.0	107.0					1																	29520638		2203	4300	6503	SO:0001583	missense	51102	exon10			CTGTGAGCTGGCC		CCDS30659.1, CCDS30660.1	1p35.3	2012-09-20			ENSG00000116353	ENSG00000116353	1.3.1.38		19691	protein-coding gene	gene with protein product	"""nuclear receptor binding factor 1"", ""mitochondrial 2-enoyl thioester reductase"""	608205				9795230, 12654921	Standard	XM_005245885		Approved	CGI-63, NRBF1, FASN2B	uc001brq.1	Q9BV79	OTTHUMG00000059082	ENST00000263702.6:c.1018C>G	1.37:g.29520638G>C	ENSP00000263702:p.Leu340Val	67	0		96	30	NM_016011	0	0	22	65	43	B3KT72|Q5SYU0|Q5SYU1|Q5SYU2|Q6IBU9|Q9Y373	Missense_Mutation	SNP	ENST00000263702.6	37	CCDS30659.1	.	.	.	.	.	.	.	.	.	.	G	18.13	3.554761	0.65425	.	.	ENSG00000116353	ENST00000373791;ENST00000263702	T;T	0.05199	3.48;3.49	5.48	5.48	0.80851	NAD(P)-binding domain (1);	0.133396	0.53938	D	0.000051	T	0.27169	0.0666	M	0.88181	2.935	0.58432	D	0.999999	P	0.45348	0.856	P	0.55749	0.783	T	0.01583	-1.1319	10	0.59425	D	0.04	.	16.849	0.85988	0.0:0.0:1.0:0.0	.	340	Q9BV79	MECR_HUMAN	V	264;340	ENSP00000362896:L264V;ENSP00000263702:L340V	ENSP00000263702:L340V	L	-	1	0	MECR	29393225	1.000000	0.71417	1.000000	0.80357	0.411000	0.31082	6.509000	0.73725	2.584000	0.87258	0.563000	0.77884	CTC	.		0.572	MECR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130740.1	NM_016011	
SMAP2	64744	ucsc.edu;bcgsc.ca	37	1	40839876	40839876	+	IGR	SNP	T	T	A			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr1:40839876T>A								COL9A2 (56910 upstream) : SMAP2 (22630 downstream)																							ACAAGTTTTGTGCAGATTGCC	0.642																																					p.C28X													.	SMAP2-68	0			c.T84A						.						79.0	67.0	71.0					1																	40839876		2203	4300	6503	SO:0001628	intergenic_variant	64744	exon1			GTTTTGTGCAGAT																													1.37:g.40839876T>A		366	2		575	220	NM_022733	0	0	1	1	0		Nonsense_Mutation	SNP		37		.	.	.	.	.	.	.	.	.	.	T	42	9.178274	0.99091	.	.	ENSG00000084070	ENST00000435168;ENST00000372718	.	.	.	5.25	1.62	0.23740	.	0.313290	0.36002	N	0.002852	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.0719	3.5082	0.07699	0.1643:0.1819:0.0:0.6538	.	.	.	.	X	28	.	ENSP00000361803:C28X	C	+	3	2	SMAP2	40612463	0.999000	0.42202	0.988000	0.46212	0.991000	0.79684	0.291000	0.18994	0.015000	0.14971	0.460000	0.39030	TGT	.	0	0.642								
PTPRF	5792	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	44083552	44083552	+	Silent	SNP	C	C	T			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr1:44083552C>T	ENST00000359947.4	+	25	4681	c.4341C>T	c.(4339-4341)gtC>gtT	p.V1447V	PTPRF_ENST00000372413.3_Silent_p.V1438V|PTPRF_ENST00000372414.3_Silent_p.V1447V|PTPRF_ENST00000496447.1_3'UTR|PTPRF_ENST00000422171.2_Silent_p.V806V|PTPRF_ENST00000438120.1_Silent_p.V1438V	NM_002840.3	NP_002831.2	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F	1447	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|negative regulation of receptor binding (GO:1900121)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	heparin binding (GO:0008201)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(2)|breast(4)|central_nervous_system(3)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(24)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)	72	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				CCACTGTGGTCATGATGACAC	0.637																																					p.V1447V													.	PTPRF-232	0			c.C4341T						.						48.0	47.0	47.0					1																	44083552		2203	4300	6503	SO:0001819	synonymous_variant	5792	exon25			TGTGGTCATGATG	Y00815	CCDS489.2, CCDS490.2	1p34	2013-02-11			ENSG00000142949	ENSG00000142949		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9670	protein-coding gene	gene with protein product		179590		LAR		7558042	Standard	NM_130440		Approved		uc001cjr.3	P10586	OTTHUMG00000007501	ENST00000359947.4:c.4341C>T	1.37:g.44083552C>T		263	1		330	114	NM_002840	0	0	18	32	14	D3DPX6|D3DPX7|Q5T021|Q5T022|Q5W9G2|Q86WS0	Silent	SNP	ENST00000359947.4	37	CCDS489.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.16|10.16	1.275097|1.275097	0.23307|0.23307	.|.	.|.	ENSG00000142949|ENSG00000142949	ENST00000412568;ENST00000414879|ENST00000429895	.|.	.|.	.|.	5.58|5.58	4.67|4.67	0.58626|0.58626	.|.	.|.	.|.	.|.	.|.	T|T	0.70509|0.70509	0.3232|0.3232	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.70256|0.70256	-0.4922|-0.4922	4|4	.|.	.|.	.|.	.|.	14.8271|14.8271	0.70122|0.70122	0.0:0.9307:0.0:0.0693|0.0:0.9307:0.0:0.0693	.|.	.|.	.|.	.|.	Y|L	831;872|1093	.|.	.|.	H|S	+|+	1|2	0|0	PTPRF|PTPRF	43856139|43856139	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	0.916000|0.916000	0.28651|0.28651	1.506000|1.506000	0.48736|0.48736	-0.140000|-0.140000	0.14226|0.14226	CAT|TCA	.		0.637	PTPRF-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000019710.1		
INADL	10207	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	62271194	62271194	+	Missense_Mutation	SNP	A	A	G			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr1:62271194A>G	ENST00000371158.2	+	13	1738	c.1624A>G	c.(1624-1626)Atg>Gtg	p.M542V	INADL_ENST00000316485.6_Missense_Mutation_p.M542V	NM_176877.2	NP_795352	Q8NI35	INADL_HUMAN	InaD-like (Drosophila)	542					cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|intracellular signal transduction (GO:0035556)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)				breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(8)|liver(1)|lung(51)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)	103						TTATGAAGTAATGGTATGTTA	0.358																																					p.M542V		.											.	INADL-94	0			c.A1624G						.						93.0	99.0	97.0					1																	62271194		2203	4300	6503	SO:0001583	missense	10207	exon13			GAAGTAATGGTAT	AB044807	CCDS617.2	1p31	2008-02-05			ENSG00000132849	ENSG00000132849			28881	protein-coding gene	gene with protein product		603199				9280290, 11374908	Standard	NM_176877		Approved	Cipp, PATJ	uc001dab.3	Q8NI35	OTTHUMG00000008560	ENST00000371158.2:c.1624A>G	1.37:g.62271194A>G	ENSP00000360200:p.Met542Val	54	0		73	25	NM_176877	0	0	0	0	0	O15249|O43742|O60833|Q5VUA5|Q5VUA6|Q5VUA7|Q5VUA8|Q5VUA9|Q5VUB0|Q8WU78|Q9H3N9	Missense_Mutation	SNP	ENST00000371158.2	37	CCDS617.2	.	.	.	.	.	.	.	.	.	.	A	17.77	3.472247	0.63737	.	.	ENSG00000132849	ENST00000371158;ENST00000316485;ENST00000371156;ENST00000395513;ENST00000255202	T;T	0.08546	3.27;3.08	5.69	5.69	0.88448	PDZ/DHR/GLGF (1);	0.057835	0.64402	D	0.000002	T	0.21186	0.0510	M	0.62723	1.935	0.80722	D	1	D;D;P	0.67145	0.996;0.986;0.488	D;D;P	0.77557	0.99;0.965;0.508	T	0.08868	-1.0701	10	0.02654	T	1	.	14.5128	0.67800	1.0:0.0:0.0:0.0	.	542;542;542	F8W8T2;Q8NI35;Q8NI35-4	.;INADL_HUMAN;.	V	542	ENSP00000360200:M542V;ENSP00000326199:M542V	ENSP00000255202:M542V	M	+	1	0	INADL	62043782	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.401000	0.52601	2.174000	0.68829	0.528000	0.53228	ATG	.		0.358	INADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023639.2	NM_170605	
PRMT6	55170	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	107599742	107599742	+	Silent	SNP	C	C	T			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr1:107599742C>T	ENST00000370078.1	+	1	442	c.405C>T	c.(403-405)gtC>gtT	p.V135V	PRMT6_ENST00000361318.5_Silent_p.V76V			Q96LA8	ANM6_HUMAN	protein arginine methyltransferase 6	135	SAM-dependent MTase PRMT-type. {ECO:0000255|PROSITE-ProRule:PRU01015}.				base-excision repair (GO:0006284)|histone H3-R2 methylation (GO:0034970)|histone H4-R3 methylation (GO:0043985)|histone methylation (GO:0016571)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)	histone binding (GO:0042393)|histone methyltransferase activity (GO:0042054)|histone methyltransferase activity (H2A-R3 specific) (GO:0070612)|histone methyltransferase activity (H3-R2 specific) (GO:0070611)|histone methyltransferase activity (H4-R3 specific) (GO:0044020)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|protein-arginine omega-N monomethyltransferase activity (GO:0035241)			biliary_tract(1)|breast(2)|kidney(1)|large_intestine(4)|lung(5)|urinary_tract(1)	14		all_epithelial(167;0.000429)|all_lung(203;0.00122)|Lung NSC(277;0.00185)		Lung(183;0.0305)|Epithelial(280;0.0765)|Colorectal(144;0.0998)|all cancers(265;0.14)|LUSC - Lung squamous cell carcinoma(189;0.173)|BRCA - Breast invasive adenocarcinoma(282;0.242)		GGGTGCACGTCCTGCCGGGAC	0.672																																					p.V135V		.											.	PRMT6-90	0			c.C405T						.						72.0	85.0	81.0					1																	107599742		2178	4281	6459	SO:0001819	synonymous_variant	55170	exon1			GCACGTCCTGCCG	AK001421	CCDS41360.1, CCDS41360.2	1p13.2	2008-02-05	2006-02-16	2006-02-16	ENSG00000198890	ENSG00000198890		"""Protein arginine methyltransferases"""	18241	protein-coding gene	gene with protein product		608274	"""HMT1 hnRNP methyltransferase-like 6 (S. cerevisiae)"""	HRMT1L6		11724789	Standard	NM_018137		Approved	FLJ10559	uc010ous.2	Q96LA8	OTTHUMG00000010964	ENST00000370078.1:c.405C>T	1.37:g.107599742C>T		20	0		24	8	NM_018137	0	0	2	2	0	A3KME1|B4DID8|Q5T5Y5|Q6DKI4|Q9NVR8	Silent	SNP	ENST00000370078.1	37	CCDS41360.2	.	.	.	.	.	.	.	.	.	.	C	5.305	0.241690	0.10077	.	.	ENSG00000198890	ENST00000540389	.	.	.	5.75	1.4	0.22301	.	.	.	.	.	T	0.48537	0.1505	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53753	-0.8394	5	0.87932	D	0	-18.1897	6.1728	0.20427	0.0:0.3898:0.4219:0.1884	.	.	.	.	S	29	.	ENSP00000440829:P29S	P	+	1	0	PRMT6	107401265	0.574000	0.26684	0.997000	0.53966	0.007000	0.05969	-0.426000	0.07008	0.714000	0.32081	0.544000	0.68410	CCT	.		0.672	PRMT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030185.1	NM_018137	
CRNN	49860	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	152384603	152384603	+	Missense_Mutation	SNP	A	A	G			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr1:152384603A>G	ENST00000271835.3	-	2	169	c.107T>C	c.(106-108)cTc>cCc	p.L36P	RP1-91G5.3_ENST00000411804.1_RNA	NM_016190.2	NP_057274.1	Q9UBG3	CRNN_HUMAN	cornulin	36					response to heat (GO:0009408)|single organismal cell-cell adhesion (GO:0016337)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(16)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			TTGCTCCAAGAGTCTTTTCAG	0.557																																					p.L36P		.											.	CRNN-93	0			c.T107C						.						152.0	132.0	139.0					1																	152384603		2203	4300	6503	SO:0001583	missense	49860	exon2			TCCAAGAGTCTTT	AF077831	CCDS1010.1	1q21	2014-01-28	2005-06-13	2005-06-13	ENSG00000143536	ENSG00000143536		"""EF-hand domain containing"""	1230	protein-coding gene	gene with protein product		611312	"""chromosome 1 open reading frame 10"""	C1orf10		11056050, 15854041	Standard	NM_016190		Approved	SEP53	uc001ezx.2	Q9UBG3	OTTHUMG00000012383	ENST00000271835.3:c.107T>C	1.37:g.152384603A>G	ENSP00000271835:p.Leu36Pro	136	0		170	74	NM_016190	0	0	0	0	0	B2RE60|Q8N613	Missense_Mutation	SNP	ENST00000271835.3	37	CCDS1010.1	.	.	.	.	.	.	.	.	.	.	A	17.97	3.518486	0.64634	.	.	ENSG00000143536	ENST00000271835;ENST00000451038	T	0.36340	1.26	4.78	3.65	0.41850	S100/CaBP-9k-type, calcium binding, subdomain (1);EF-hand-like domain (1);	0.164580	0.29021	N	0.013391	T	0.54175	0.1842	M	0.92507	3.315	0.51233	D	0.999918	D	0.89917	1.0	D	0.80764	0.994	T	0.61652	-0.7019	10	0.87932	D	0	.	7.0943	0.25301	0.8983:0.0:0.1017:0.0	.	36	Q9UBG3	CRNN_HUMAN	P	36	ENSP00000271835:L36P	ENSP00000271835:L36P	L	-	2	0	CRNN	150651227	0.903000	0.30736	0.739000	0.30968	0.985000	0.73830	3.133000	0.50531	0.861000	0.35504	0.482000	0.46254	CTC	.		0.557	CRNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034503.1	NM_016190	
INTS3	65123	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	153735733	153735733	+	Missense_Mutation	SNP	A	A	T			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr1:153735733A>T	ENST00000318967.2	+	16	2229	c.1661A>T	c.(1660-1662)cAc>cTc	p.H554L	INTS3_ENST00000456435.1_Missense_Mutation_p.H348L|INTS3_ENST00000476843.1_3'UTR|INTS3_ENST00000512605.1_Missense_Mutation_p.H348L|INTS3_ENST00000435409.2_Missense_Mutation_p.H554L	NM_023015.3	NP_075391.3	Q68E01	INT3_HUMAN	integrator complex subunit 3	555					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|mitotic cell cycle checkpoint (GO:0007093)|response to ionizing radiation (GO:0010212)|snRNA processing (GO:0016180)	integrator complex (GO:0032039)|nucleus (GO:0005634)|SOSS complex (GO:0070876)				breast(1)|cervix(4)|endometrium(10)|kidney(1)|large_intestine(6)|lung(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	38	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			TTTCGCTTCCACCCTATCAAG	0.493																																					p.H554L													.	INTS3-93	0			c.A1661T						.						162.0	160.0	161.0					1																	153735733		2203	4300	6503	SO:0001583	missense	65123	exon16			GCTTCCACCCTAT	BX640950	CCDS1052.1	1q21.3	2012-03-16	2006-03-15	2006-03-15	ENSG00000143624	ENSG00000143624			26153	protein-coding gene	gene with protein product	"""sensor of single-strand DNA complex subunit A"""	611347	"""chromosome 1 open reading frame 60"""	C1orf60		16239144	Standard	NM_023015		Approved	FLJ21919, INT3, SOSS-A	uc001fct.3	Q68E01	OTTHUMG00000037089	ENST00000318967.2:c.1661A>T	1.37:g.153735733A>T	ENSP00000318641:p.His554Leu	171	1		179	52	NM_023015	0	0	20	52	32	A8K1W0|B4DQC8|B4E3U9|D3DV57|Q4G0E5|Q5VUQ5|Q5VUQ6|Q5VUR0|Q5VUR1|Q68DJ1|Q69YR5|Q6AI57|Q6DKG7|Q6MZQ4|Q6MZZ9|Q8NC46|Q8TB23|Q9H6S9	Missense_Mutation	SNP	ENST00000318967.2	37	CCDS1052.1	.	.	.	.	.	.	.	.	.	.	A	12.83	2.054197	0.36277	.	.	ENSG00000143624	ENST00000318967;ENST00000456435;ENST00000435409;ENST00000512605	.	.	.	5.13	5.13	0.70059	.	0.055820	0.64402	D	0.000001	T	0.28830	0.0715	L	0.40543	1.245	0.54753	D	0.999987	B;B;B	0.27732	0.187;0.039;0.187	B;B;B	0.27500	0.08;0.017;0.038	T	0.13098	-1.0522	9	0.10636	T	0.68	.	12.941	0.58345	1.0:0.0:0.0:0.0	.	348;555;554	Q68E01-3;Q68E01;Q68E01-2	.;INT3_HUMAN;.	L	554;348;554;348	.	ENSP00000318641:H554L	H	+	2	0	INTS3	152002357	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.808000	0.62583	2.153000	0.67306	0.459000	0.35465	CAC	.		0.493	INTS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090045.2	NM_023015	
DENND4B	9909	hgsc.bcm.edu	37	1	153907287	153907287	+	Missense_Mutation	SNP	G	G	C	rs3835302|rs199597671		TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr1:153907287G>C	ENST00000361217.4	-	18	3140	c.2722C>G	c.(2722-2724)Cag>Gag	p.Q908E	DENND4B_ENST00000474386.1_5'Flank	NM_014856.2	NP_055671.2	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B	908	Gln-rich.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab protein signal transduction (GO:0032483)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(1)|breast(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	36	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			tcctgctgctgctgctgctgc	0.632																																					p.Q908E		.											.	DENND4B-69	0			c.C2722G						.						23.0	27.0	26.0					1																	153907287		2184	4281	6465	SO:0001583	missense	9909	exon18			GCTGCTGCTGCTG	AB007945	CCDS44228.1	1q21.3	2012-10-03	2006-01-27	2006-01-27	ENSG00000198837	ENSG00000198837		"""DENN/MADD domain containing"""	29044	protein-coding gene	gene with protein product			"""KIAA0476"""	KIAA0476		9455484, 12906859	Standard	NM_014856		Approved		uc001fdd.1	O75064	OTTHUMG00000037157	ENST00000361217.4:c.2722C>G	1.37:g.153907287G>C	ENSP00000354597:p.Gln908Glu	45	0		90	9	NM_014856	0	0	4	4	0	Q5T4K0	Missense_Mutation	SNP	ENST00000361217.4	37	CCDS44228.1	.	.	.	.	.	.	.	.	.	.	G	1.785	-0.481073	0.04383	.	.	ENSG00000198837	ENST00000361217;ENST00000368646	T;T	0.06294	3.33;3.32	2.67	0.673	0.17941	.	5.053470	0.00166	N	0.000001	T	0.00815	0.0027	N	0.14661	0.345	0.19300	N	0.999977	B	0.02656	0.0	B	0.04013	0.001	T	0.26573	-1.0099	10	0.02654	T	1	-2.4288	3.3651	0.07201	0.1454:0.0:0.5849:0.2697	.	908	O75064	DEN4B_HUMAN	E	908;919	ENSP00000354597:Q908E;ENSP00000357635:Q919E	ENSP00000354597:Q908E	Q	-	1	0	DENND4B	152173911	0.943000	0.32029	0.986000	0.45419	0.760000	0.43138	0.537000	0.23144	0.194000	0.20326	0.271000	0.19318	CAG	.		0.632	DENND4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090278.2	XM_375806	
DENND4B	9909	broad.mit.edu	37	1	153907294	153907294	+	Silent	SNP	C	C	T			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr1:153907294C>T	ENST00000361217.4	-	18	3133	c.2715G>A	c.(2713-2715)caG>caA	p.Q905Q	DENND4B_ENST00000474386.1_5'Flank	NM_014856.2	NP_055671.2	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B	905	Gln-rich.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab protein signal transduction (GO:0032483)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(1)|breast(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	36	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			gctgctgctgctgctgctgct	0.632																																					p.Q905Q													.	DENND4B-69	0			c.G2715A						.						27.0	35.0	32.0					1																	153907294		2181	4275	6456	SO:0001819	synonymous_variant	9909	exon18			CTGCTGCTGCTGC	AB007945	CCDS44228.1	1q21.3	2012-10-03	2006-01-27	2006-01-27	ENSG00000198837	ENSG00000198837		"""DENN/MADD domain containing"""	29044	protein-coding gene	gene with protein product			"""KIAA0476"""	KIAA0476		9455484, 12906859	Standard	NM_014856		Approved		uc001fdd.1	O75064	OTTHUMG00000037157	ENST00000361217.4:c.2715G>A	1.37:g.153907294C>T		78	0		101	0	NM_014856	0	1	808	809	0	Q5T4K0	Silent	SNP	ENST00000361217.4	37	CCDS44228.1																																																																																			.		0.632	DENND4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090278.2	XM_375806	
DENND4B	9909	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	153907297	153907297	+	Silent	SNP	C	C	T	rs557071025|rs544489048	byFrequency	TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr1:153907297C>T	ENST00000361217.4	-	18	3130	c.2712G>A	c.(2710-2712)caG>caA	p.Q904Q	DENND4B_ENST00000474386.1_5'Flank	NM_014856.2	NP_055671.2	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B	904	Gln-rich.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab protein signal transduction (GO:0032483)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(1)|breast(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	36	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			gctgctgctgctgctgctgtt	0.632													c|||	1	0.000199681	0.0	0.0	5008	,	,		16455	0.0		0.0	False		,,,				2504	0.001				p.Q904Q		.											.	DENND4B-69	0			c.G2712A						.						28.0	36.0	33.0					1																	153907297		2179	4277	6456	SO:0001819	synonymous_variant	9909	exon18			CTGCTGCTGCTGC	AB007945	CCDS44228.1	1q21.3	2012-10-03	2006-01-27	2006-01-27	ENSG00000198837	ENSG00000198837		"""DENN/MADD domain containing"""	29044	protein-coding gene	gene with protein product			"""KIAA0476"""	KIAA0476		9455484, 12906859	Standard	NM_014856		Approved		uc001fdd.1	O75064	OTTHUMG00000037157	ENST00000361217.4:c.2712G>A	1.37:g.153907297C>T		80	0		100	20	NM_014856	0	0	656	663	7	Q5T4K0	Silent	SNP	ENST00000361217.4	37	CCDS44228.1																																																																																			.		0.632	DENND4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090278.2	XM_375806	
KIAA0907	22889	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	155903553	155903553	+	Silent	SNP	C	C	G	rs147323254		TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr1:155903553C>G	ENST00000368321.3	-	2	149	c.126G>C	c.(124-126)ggG>ggC	p.G42G	KIAA0907_ENST00000368319.3_Silent_p.G42G|KIAA0907_ENST00000368320.3_Silent_p.G42G|KIAA0907_ENST00000482337.1_5'UTR	NM_014949.2	NP_055764.2	Q7Z7F0	K0907_HUMAN	KIAA0907	42							RNA binding (GO:0003723)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|urinary_tract(1)	21	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		OV - Ovarian serous cystadenocarcinoma(3;8.82e-06)			CAGGACTTCCCCCACTGCTGG	0.617													C|||	1	0.000199681	0.0008	0.0	5008	,	,		14922	0.0		0.0	False		,,,				2504	0.0				p.G42G		.											.	KIAA0907-90	0			c.G126C						.	C		1,4405		0,1,2202	27.0	31.0	30.0		126	1.0	1.0	1	dbSNP_134	30	0,8600		0,0,4300	no	coding-synonymous	KIAA0907	NM_014949.2		0,1,6502	GG,GC,CC		0.0,0.0227,0.0077		42/615	155903553	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	22889	exon2			ACTTCCCCCACTG	BC062637	CCDS30885.1	1q22	2012-11-30			ENSG00000132680	ENSG00000132680			29145	protein-coding gene	gene with protein product						10048485	Standard	NM_014949		Approved	BLOM7	uc001fmi.1	Q7Z7F0	OTTHUMG00000014103	ENST00000368321.3:c.126G>C	1.37:g.155903553C>G		35	0		52	15	NM_014949	0	0	2	2	0	O94981|Q7L7Q2|Q7Z7E9|Q8TBQ0	Silent	SNP	ENST00000368321.3	37	CCDS30885.1																																																																																			C|1.000;G|0.000		0.617	KIAA0907-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039583.1	NM_014949	
HDGF	3068	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	156713547	156713547	+	Missense_Mutation	SNP	C	C	T	rs375226201		TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr1:156713547C>T	ENST00000357325.5	-	5	927	c.613G>A	c.(613-615)Ggc>Agc	p.G205S	HDGF_ENST00000465180.1_5'UTR|HDGF_ENST00000537739.1_Missense_Mutation_p.G205S|MRPL24_ENST00000368211.4_5'Flank|HDGF_ENST00000416666.2_Missense_Mutation_p.G173S|HDGF_ENST00000368206.5_Missense_Mutation_p.G221S|MRPL24_ENST00000361531.2_5'Flank|HDGF_ENST00000368209.5_Missense_Mutation_p.G198S	NM_004494.2	NP_004485.1	P51858	HDGF_HUMAN	hepatoma-derived growth factor	205	Glu-rich.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cell proliferation (GO:0008283)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein localization to nucleus (GO:0034504)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|heparin binding (GO:0008201)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription corepressor binding (GO:0001222)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)	9	all_hematologic(923;0.088)|Hepatocellular(266;0.158)	Breast(1374;0.198)		Colorectal(1306;0.018)		CGGCCAGAGCCGGGCTCAGAG	0.587																																					p.G221S		.											.	HDGF-226	0			c.G661A						.	C	SER/GLY,SER/GLY,SER/GLY	0,4406		0,0,2203	30.0	33.0	32.0		661,592,613	0.6	0.1	1		32	1,8599		0,1,4299	no	missense,missense,missense	HDGF	NM_001126050.1,NM_001126051.1,NM_004494.2	56,56,56	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign,benign	221/257,198/234,205/241	156713547	1,13005	2203	4300	6503	SO:0001583	missense	3068	exon5			CAGAGCCGGGCTC	D16431	CCDS1156.1, CCDS44247.1, CCDS44248.1	1q23.1	2013-10-14	2010-03-19		ENSG00000143321	ENSG00000143321			4856	protein-coding gene	gene with protein product	"""high-mobility group protein 1-like"""	600339	"""hepatoma-derived growth factor (high-mobility group protein 1-like)"""			8833162	Standard	NM_004494		Approved	HMG1L2	uc001fpy.4	P51858	OTTHUMG00000041295	ENST00000357325.5:c.613G>A	1.37:g.156713547C>T	ENSP00000349878:p.Gly205Ser	28	0		63	33	NM_001126050	0	0	46	61	15	B3KU21|D3DVC9|Q5SZ07|Q5SZ08|Q5SZ09	Missense_Mutation	SNP	ENST00000357325.5	37	CCDS1156.1	.	.	.	.	.	.	.	.	.	.	C	10.45	1.352591	0.24512	0.0	1.16E-4	ENSG00000143321	ENST00000357325;ENST00000368209;ENST00000537739;ENST00000416666;ENST00000368206;ENST00000406805	T;T;T;T;T	0.30448	2.05;1.56;2.05;1.6;1.53	4.55	0.546	0.17196	.	1.032050	0.07707	N	0.941443	T	0.06280	0.0162	L	0.34521	1.04	0.09310	N	1	B;B;B;B	0.28291	0.206;0.206;0.034;0.014	B;B;B;B	0.14023	0.01;0.01;0.004;0.002	T	0.38628	-0.9652	10	0.15952	T	0.53	-2.1192	6.8306	0.23907	0.0:0.6085:0.0:0.3915	.	180;221;198;205	B7Z958;Q5SZ07;Q5SZ08;P51858	.;.;.;HDGF_HUMAN	S	205;198;205;173;221;228	ENSP00000349878:G205S;ENSP00000357192:G198S;ENSP00000443120:G205S;ENSP00000416752:G173S;ENSP00000357189:G221S	ENSP00000349878:G205S	G	-	1	0	HDGF	154980171	0.000000	0.05858	0.089000	0.20774	0.788000	0.44548	-0.589000	0.05767	-0.053000	0.13289	0.456000	0.33151	GGC	.		0.587	HDGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098946.1	NM_004494	
IPO9	55705	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	201842054	201842054	+	Missense_Mutation	SNP	A	A	C			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr1:201842054A>C	ENST00000361565.4	+	20	2744	c.2675A>C	c.(2674-2676)gAt>gCt	p.D892A		NM_018085.4	NP_060555.2	Q96P70	IPO9_HUMAN	importin 9	892					protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	histone binding (GO:0042393)|protein transporter activity (GO:0008565)			cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	38						TACAGCATGGATGAGGGCATC	0.532																																					p.D892A		.											.	IPO9-228	0			c.A2675C						.						97.0	88.0	91.0					1																	201842054		2203	4300	6503	SO:0001583	missense	55705	exon20			GCATGGATGAGGG	AF410465	CCDS1415.1	1q31.3	2008-02-05			ENSG00000198700	ENSG00000198700		"""Importins"""	19425	protein-coding gene	gene with protein product						11823430, 10574461	Standard	NM_018085		Approved	Imp9, FLJ10402	uc001gwz.3	Q96P70	OTTHUMG00000035805	ENST00000361565.4:c.2675A>C	1.37:g.201842054A>C	ENSP00000354742:p.Asp892Ala	180	0		181	78	NM_018085	0	0	17	23	6	B1ASV5|Q8N1Y1|Q8N3I2|Q8NCG9|Q96SU6|Q9NW01|Q9P0A8|Q9ULM8	Missense_Mutation	SNP	ENST00000361565.4	37	CCDS1415.1	.	.	.	.	.	.	.	.	.	.	A	15.53	2.859721	0.51376	.	.	ENSG00000198700	ENST00000361565	.	.	.	5.23	5.23	0.72850	Armadillo-like helical (1);Armadillo-type fold (1);	0.136301	0.64402	D	0.000004	T	0.40498	0.1119	N	0.17723	0.515	0.80722	D	1	B	0.17038	0.02	B	0.16722	0.016	T	0.26677	-1.0096	9	0.12103	T	0.63	-31.3306	13.3919	0.60829	1.0:0.0:0.0:0.0	.	892	Q96P70	IPO9_HUMAN	A	892	.	ENSP00000354742:D892A	D	+	2	0	IPO9	200108677	1.000000	0.71417	0.990000	0.47175	0.998000	0.95712	8.726000	0.91474	2.107000	0.64212	0.533000	0.62120	GAT	.		0.532	IPO9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087088.1	NM_018085	
CENPF	1063	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	214813548	214813548	+	Nonsense_Mutation	SNP	A	A	T			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr1:214813548A>T	ENST00000366955.3	+	12	2035	c.1867A>T	c.(1867-1869)Aaa>Taa	p.K623*		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	0					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)			NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		TTCTTGTTGGAAAAGTGAAAA	0.333																																					p.K623X	Colon(80;575 1284 11000 14801 43496)	.											.	CENPF-567	0			c.A1867T						.						32.0	37.0	36.0					1																	214813548		2198	4298	6496	SO:0001587	stop_gained	1063	exon12			TGTTGGAAAAGTG	U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.1867A>T	1.37:g.214813548A>T	ENSP00000355922:p.Lys623*	64	0		51	21	NM_016343	0	0	0	0	0	Q13171|Q13246|Q5VVM7	Nonsense_Mutation	SNP	ENST00000366955.3	37	CCDS31023.1	.	.	.	.	.	.	.	.	.	.	A	40	8.443638	0.98813	.	.	ENSG00000117724	ENST00000366955	.	.	.	5.6	5.6	0.85130	.	0.000000	0.39407	N	0.001364	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.7907	0.78357	1.0:0.0:0.0:0.0	.	.	.	.	X	623	.	ENSP00000355922:K623X	K	+	1	0	CENPF	212880171	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.770000	0.85390	2.126000	0.65437	0.443000	0.29094	AAA	.		0.333	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089749.1	NM_016343	
EPRS	2058	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	220154162	220154162	+	Missense_Mutation	SNP	G	G	C			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr1:220154162G>C	ENST00000366923.3	-	25	3760	c.3491C>G	c.(3490-3492)aCt>aGt	p.T1164S		NM_004446.2	NP_004437.2	P07814	SYEP_HUMAN	glutamyl-prolyl-tRNA synthetase	1164	Proline--tRNA ligase.				cellular response to interferon-gamma (GO:0071346)|gene expression (GO:0010467)|glutamyl-tRNA aminoacylation (GO:0006424)|negative regulation of translation (GO:0017148)|prolyl-tRNA aminoacylation (GO:0006433)|protein complex assembly (GO:0006461)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|GAIT complex (GO:0097452)|membrane (GO:0016020)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|glutamate-tRNA ligase activity (GO:0004818)|proline-tRNA ligase activity (GO:0004827)|RNA stem-loop binding (GO:0035613)			breast(2)|endometrium(11)|kidney(2)|large_intestine(13)|lung(24)|ovary(1)|prostate(3)|skin(2)|stomach(2)|urinary_tract(3)	63				GBM - Glioblastoma multiforme(131;0.0735)	L-Proline(DB00172)	AAATTCACGAGTACGTAGGAA	0.388																																					p.T1164S		.											.	EPRS-92	0			c.C3491G						.						64.0	60.0	61.0					1																	220154162		2203	4300	6503	SO:0001583	missense	2058	exon25			TCACGAGTACGTA	X54326	CCDS31027.1	1q41	2011-07-01			ENSG00000136628	ENSG00000136628	6.1.1.15, 6.1.1.17	"""Aminoacyl tRNA synthetases / Class I"", ""Aminoacyl tRNA synthetases / Class II"""	3418	protein-coding gene	gene with protein product	"""glutamate tRNA ligase"", ""proline tRNA ligase"""	138295		QPRS, QARS		1988429	Standard	NM_004446		Approved	EARS, PARS, GLUPRORS	uc001hly.1	P07814	OTTHUMG00000037433	ENST00000366923.3:c.3491C>G	1.37:g.220154162G>C	ENSP00000355890:p.Thr1164Ser	202	0		207	80	NM_004446	0	0	3	6	3	A0AVA9|B9EGH3|Q05BP6|Q05DF8|Q5DSM1|Q5H9S5|Q6PD57|Q86X73	Missense_Mutation	SNP	ENST00000366923.3	37	CCDS31027.1	.	.	.	.	.	.	.	.	.	.	G	32	5.174061	0.94807	.	.	ENSG00000136628	ENST00000366923	T	0.68025	-0.3	6.06	6.06	0.98353	Aminoacyl-tRNA synthetase, class II (1);Aminoacyl-tRNA synthetase, class II (G/ H/ P/ S), conserved domain (1);	0.000000	0.85682	D	0.000000	T	0.78046	0.4222	L	0.39326	1.205	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.76865	-0.2801	10	0.56958	D	0.05	-28.6459	20.6397	0.99537	0.0:0.0:1.0:0.0	.	1164	P07814	SYEP_HUMAN	S	1164	ENSP00000355890:T1164S	ENSP00000355890:T1164S	T	-	2	0	EPRS	218220785	1.000000	0.71417	0.980000	0.43619	0.980000	0.70556	9.577000	0.98196	2.880000	0.98712	0.650000	0.86243	ACT	.		0.388	EPRS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091133.2	NM_004446	
CCDC185	164127	hgsc.bcm.edu	37	1	223567036	223567036	+	Silent	SNP	C	C	T	rs369292167	byFrequency	TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr1:223567036C>T	ENST00000366875.3	+	1	322	c.219C>T	c.(217-219)cgC>cgT	p.R73R		NM_152610.2	NP_689823.2	Q8N715	CC185_HUMAN		73	Arg-rich.									breast(4)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|skin(3)	29				GBM - Glioblastoma multiforme(131;0.0704)		CTCGCAGGCGCGGGTGCTCAG	0.736													C|||	6	0.00119808	0.0045	0.0	5008	,	,		13138	0.0		0.0	False		,,,				2504	0.0				p.R73R		.											.	C1orf65-91	0			c.C219T						.	C		15,3615		0,15,1800	4.0	6.0	5.0		219	0.3	0.0	1		5	0,7554		0,0,3777	no	coding-synonymous	C1orf65	NM_152610.2		0,15,5577	TT,TC,CC		0.0,0.4132,0.1341		73/624	223567036	15,11169	1815	3777	5592	SO:0001819	synonymous_variant	164127	exon1			CAGGCGCGGGTGC																												ENST00000366875.3:c.219C>T	1.37:g.223567036C>T		1	0		50	17	NM_152610	0	0	0	0	0	Q8N746|Q8NA93	Silent	SNP	ENST00000366875.3	37	CCDS1537.1																																																																																			.		0.736	C1orf65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092718.1		
NLRP3	114548	ucsc.edu;bcgsc.ca	37	1	247588675	247588675	+	Nonsense_Mutation	SNP	C	C	T			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr1:247588675C>T	ENST00000336119.3	+	3	2676	c.1930C>T	c.(1930-1932)Caa>Taa	p.Q644*	NLRP3_ENST00000474792.1_3'UTR|NLRP3_ENST00000348069.2_Nonsense_Mutation_p.Q644*|NLRP3_ENST00000366497.2_Nonsense_Mutation_p.Q644*|NLRP3_ENST00000391827.2_Nonsense_Mutation_p.Q644*|NLRP3_ENST00000391828.3_Nonsense_Mutation_p.Q644*|NLRP3_ENST00000366496.2_Nonsense_Mutation_p.Q644*	NM_001127462.2|NM_001243133.1|NM_004895.4	NP_001120934.1|NP_001230062.1|NP_004886.3	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3	644					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to lipopolysaccharide (GO:0071222)|defense response (GO:0006952)|defense response to virus (GO:0051607)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|interleukin-1 secretion (GO:0050701)|interleukin-18 production (GO:0032621)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|NLRP3 inflammasome complex assembly (GO:0044546)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|NLRP3 inflammasome complex (GO:0072559)	ATP binding (GO:0005524)|peptidoglycan binding (GO:0042834)			NS(1)|breast(3)|endometrium(6)|kidney(1)|large_intestine(19)|lung(85)|ovary(9)|pancreas(2)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	142	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			GGACTTCGTGCAAAGGGCCAT	0.473																																					p.Q644X													.	NLRP3-674	0			c.C1930T						.						86.0	75.0	79.0					1																	247588675		2203	4300	6503	SO:0001587	stop_gained	114548	exon3			TTCGTGCAAAGGG	AF054176	CCDS1632.1, CCDS1633.1, CCDS44346.1, CCDS44347.1	1q44	2014-09-17	2006-12-08	2006-12-08	ENSG00000162711	ENSG00000162711		"""Nucleotide-binding domain and leucine rich repeat containing"""	16400	protein-coding gene	gene with protein product	"""Cryopyrin"", ""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 3"""	606416	"""cold autoinflammatory syndrome 1"""	C1orf7, CIAS1		10741953	Standard	NM_183395		Approved	AGTAVPRL, AII, AVP, FCAS, FCU, NALP3, PYPAF1, MWS, CLR1.1	uc001icr.3	Q96P20	OTTHUMG00000040647	ENST00000336119.3:c.1930C>T	1.37:g.247588675C>T	ENSP00000337383:p.Gln644*	170	3		209	73	NM_183395	0	0	0	0	0	B2RC97|B7ZKS9|B7ZKT2|B7ZKT3|O75434|Q17RS2|Q59H68|Q5JQS8|Q5JQS9|Q6TG35|Q8TCW0|Q8TEU9|Q8WXH9	Nonsense_Mutation	SNP	ENST00000336119.3	37	CCDS1632.1	.	.	.	.	.	.	.	.	.	.	C	43	10.352876	0.99389	.	.	ENSG00000162711	ENST00000391828;ENST00000366497;ENST00000336119;ENST00000348069;ENST00000366496;ENST00000391827	.	.	.	3.96	3.02	0.34903	.	0.689062	0.12788	N	0.439137	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.9426	0.35740	0.221:0.779:0.0:0.0	.	.	.	.	X	644	.	ENSP00000337383:Q644X	Q	+	1	0	NLRP3	245655298	0.000000	0.05858	0.802000	0.32245	0.910000	0.53928	0.449000	0.21744	1.210000	0.43336	0.655000	0.94253	CAA	.		0.473	NLRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097740.1	NM_004895	
OR2M5	127059	broad.mit.edu;bcgsc.ca	37	1	248309355	248309355	+	Silent	SNP	G	G	A	rs201158893	byFrequency	TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr1:248309355G>A	ENST00000366476.1	+	1	906	c.906G>A	c.(904-906)agG>agA	p.R302R		NM_001004690.1	NP_001004690.1	A3KFT3	OR2M5_HUMAN	olfactory receptor, family 2, subfamily M, member 5	302						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(5)|kidney(2)|large_intestine(7)|liver(1)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	49	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0388)			GAGCACTCAGGAAAGTGTTAG	0.453													g|||	3	0.000599042	0.0	0.0	5008	,	,		17536	0.0		0.0	False		,,,				2504	0.0031				p.R302R													.	OR2M5-71	0			c.G906A						.						62.0	58.0	59.0					1																	248309355		2203	4300	6503	SO:0001819	synonymous_variant	127059	exon1			ACTCAGGAAAGTG		CCDS31105.1	1q44	2012-08-09		2004-03-10	ENSG00000162727	ENSG00000162727		"""GPCR / Class A : Olfactory receptors"""	19576	protein-coding gene	gene with protein product				OR2M5P			Standard	NM_001004690		Approved		uc010pze.2	A3KFT3	OTTHUMG00000040447	ENST00000366476.1:c.906G>A	1.37:g.248309355G>A		137	0		175	8	NM_001004690	0	0	0	0	0		Silent	SNP	ENST00000366476.1	37	CCDS31105.1																																																																																			G|0.999;A|0.001		0.453	OR2M5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097343.1	NM_001004690	
VIM	7431	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	17278345	17278345	+	Silent	SNP	T	T	G			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr10:17278345T>G	ENST00000224237.5	+	8	1471	c.1326T>G	c.(1324-1326)ctT>ctG	p.L442L	VIM_ENST00000544301.1_Silent_p.L442L|RP11-124N14.3_ENST00000456355.1_RNA			P08670	VIME_HUMAN	vimentin	442	Tail.			L -> F (in Ref. 1; AAA61279). {ECO:0000305}.	apoptotic process (GO:0006915)|astrocyte development (GO:0014002)|Bergmann glial cell differentiation (GO:0060020)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular component movement (GO:0006928)|intermediate filament organization (GO:0045109)|lens fiber cell development (GO:0070307)|muscle filament sliding (GO:0030049)|negative regulation of neuron projection development (GO:0010977)|positive regulation of gene expression (GO:0010628)|viral process (GO:0016032)	cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|neuron projection (GO:0043005)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	double-stranded RNA binding (GO:0003725)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of eye lens (GO:0005212)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(2)|lung(18)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						AAAGGACACTTCTGATTAAGA	0.348																																					p.L442L		.											.	VIM-291	0			c.T1326G						.						150.0	165.0	160.0					10																	17278345		2203	4300	6503	SO:0001819	synonymous_variant	7431	exon9			GACACTTCTGATT	M14144	CCDS7120.1	10p13	2013-01-16			ENSG00000026025	ENSG00000026025		"""Intermediate filaments type III"""	12692	protein-coding gene	gene with protein product		193060					Standard	NM_003380		Approved		uc001iou.2	P08670	OTTHUMG00000017744	ENST00000224237.5:c.1326T>G	10.37:g.17278345T>G		75	0		91	39	NM_003380	1	3	2551	5224	2669	B0YJC2|D3DRU4|Q15867|Q15868|Q15869|Q548L2|Q6LER9|Q8N850|Q96ML2|Q9NTM3	Silent	SNP	ENST00000224237.5	37	CCDS7120.1																																																																																			.		0.348	VIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047015.1	NM_003380	
ARHGAP21	57584	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	24873742	24873742	+	Missense_Mutation	SNP	C	C	T	rs370251256		TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr10:24873742C>T	ENST00000396432.2	-	26	5962	c.5476G>A	c.(5476-5478)Ggg>Agg	p.G1826R		NM_020824.3	NP_065875.3	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21	1825	Interaction with CTNNA1.				establishment of Golgi localization (GO:0051683)|Golgi organization (GO:0007030)|maintenance of Golgi location (GO:0051684)|organelle transport along microtubule (GO:0072384)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(17)|lung(21)|ovary(7)|pancreas(1)|prostate(5)|skin(2)|stomach(2)|urinary_tract(1)	78						TCTCTCTCCCCGCTCTGCTCA	0.498																																					p.G1826R		.											.	ARHGAP21-235	0			c.G5476A						.	C	ARG/GLY	0,4406		0,0,2203	62.0	63.0	63.0		5476	3.3	0.0	10		63	1,8599	1.2+/-3.3	0,1,4299	no	missense	ARHGAP21	NM_020824.3	125	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	1826/1959	24873742	1,13005	2203	4300	6503	SO:0001583	missense	57584	exon26			TCTCCCCGCTCTG	AF480466	CCDS7144.2	10p12.31	2013-01-10			ENSG00000107863	ENSG00000107863		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	23725	protein-coding gene	gene with protein product		609870				12056806	Standard	NM_020824		Approved	KIAA1424, ARHGAP10	uc001isb.2	Q5T5U3	OTTHUMG00000017825	ENST00000396432.2:c.5476G>A	10.37:g.24873742C>T	ENSP00000379709:p.Gly1826Arg	93	0		101	53	NM_020824	0	0	4	6	2	Q0VF98|Q7Z3P7|Q8N3A2|Q8NI19|Q8TBV5|Q9P2C3	Missense_Mutation	SNP	ENST00000396432.2	37	CCDS7144.2	.	.	.	.	.	.	.	.	.	.	C	1.589	-0.529652	0.04112	0.0	1.16E-4	ENSG00000107863	ENST00000396432;ENST00000447364	T	0.11712	2.75	5.13	3.27	0.37495	.	1.152260	0.06177	N	0.678642	T	0.06416	0.0165	N	0.16307	0.4	0.18873	N	0.999984	B	0.09022	0.002	B	0.04013	0.001	T	0.42207	-0.9465	10	0.18710	T	0.47	.	2.6596	0.05023	0.2147:0.4829:0.0:0.3023	.	1825	Q5T5U3	RHG21_HUMAN	R	1826;1275	ENSP00000379709:G1826R	ENSP00000379709:G1826R	G	-	1	0	ARHGAP21	24913748	0.000000	0.05858	0.002000	0.10522	0.007000	0.05969	0.682000	0.25335	1.139000	0.42245	0.655000	0.94253	GGG	.		0.498	ARHGAP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047229.4	NM_020824	
RBP3	5949	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	48388918	48388918	+	Missense_Mutation	SNP	G	G	C			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr10:48388918G>C	ENST00000224600.4	-	1	2073	c.1960C>G	c.(1960-1962)Cca>Gca	p.P654A	AL731561.2_ENST00000581861.1_RNA	NM_002900.2	NP_002891.1	P10745	RET3_HUMAN	retinol binding protein 3, interstitial	654	4 X approximate tandem repeats.				lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transport (GO:0006810)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|interphotoreceptor matrix (GO:0033165)|vesicle (GO:0031982)	retinal binding (GO:0016918)|retinoid binding (GO:0005501)|retinol binding (GO:0019841)|serine-type peptidase activity (GO:0008236)			central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(30)|ovary(1)|prostate(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59					Vitamin A(DB00162)	ACGACCTCTGGCCGAGCATAG	0.672																																					p.P654A		.											.	RBP3-153	0			c.C1960G						.						16.0	18.0	17.0					10																	48388918		2197	4286	6483	SO:0001583	missense	5949	exon1			CCTCTGGCCGAGC	M22453	CCDS73119.1	10q11.2	2014-05-06	2001-11-28		ENSG00000107618	ENSG00000265203			9921	protein-coding gene	gene with protein product		180290	"""retinol-binding protein 3, interstitial"""				Standard	NM_002900		Approved	D10S64, D10S65, D10S66, RP66	uc001jez.3	P10745	OTTHUMG00000188321	ENST00000224600.4:c.1960C>G	10.37:g.48388918G>C	ENSP00000224600:p.Pro654Ala	58	0		102	43	NM_002900	0	0	0	0	0	Q0QD34|Q5VSR0|Q8IXN0	Missense_Mutation	SNP	ENST00000224600.4	37	CCDS7218.1	.	.	.	.	.	.	.	.	.	.	G	7.421	0.636769	0.14386	.	.	ENSG00000107618	ENST00000224600	T	0.39997	1.05	5.53	5.53	0.82687	.	0.128692	0.53938	D	0.000058	T	0.47322	0.1439	M	0.76170	2.325	0.38359	D	0.944551	P	0.34562	0.457	B	0.31390	0.129	T	0.57894	-0.7732	10	0.87932	D	0	-14.2089	18.4586	0.90729	0.0:0.0:1.0:0.0	.	654	P10745	RET3_HUMAN	A	654	ENSP00000224600:P654A	ENSP00000224600:P654A	P	-	1	0	RBP3	48008924	1.000000	0.71417	0.047000	0.18901	0.002000	0.02628	5.637000	0.67854	2.628000	0.89032	0.561000	0.74099	CCA	.		0.672	RBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047888.1	NM_002900	
ERCC6	2074	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	50681040	50681040	+	Missense_Mutation	SNP	C	C	T			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr10:50681040C>T	ENST00000355832.5	-	15	2822	c.2744G>A	c.(2743-2745)cGg>cAg	p.R915Q	RP11-123B3.2_ENST00000423283.1_RNA|ERCC6_ENST00000542458.1_Missense_Mutation_p.R285Q|ERCC6_ENST00000465653.1_5'Flank	NM_000124.2	NP_000115.1	Q03468	ERCC6_HUMAN	excision repair cross-complementation group 6	915	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|photoreceptor cell maintenance (GO:0045494)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of protein tyrosine kinase activity (GO:0061098)|pyrimidine dimer repair (GO:0006290)|regulation of DNA-templated transcription, elongation (GO:0032784)|response to gamma radiation (GO:0010332)|response to oxidative stress (GO:0006979)|response to superoxide (GO:0000303)|response to toxic substance (GO:0009636)|response to UV (GO:0009411)|response to UV-B (GO:0010224)|response to X-ray (GO:0010165)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase II promoter (GO:0006366)|transcription-coupled nucleotide-excision repair (GO:0006283)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|protein N-terminus binding (GO:0047485)|protein tyrosine kinase activator activity (GO:0030296)			breast(5)|central_nervous_system(1)|endometrium(6)|kidney(5)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						GCCGCCCACCCGCGTGGTCAG	0.498								Direct reversal of damage;Nucleotide excision repair (NER)																													p.T915N		.											.	ERCC6-1153	0			c.C2744A						.						66.0	61.0	63.0					10																	50681040		2203	4300	6503	SO:0001583	missense	2074	exon15			CCCACCCGCGTGG	L04791	CCDS7229.1	10q11	2014-09-17	2014-03-07		ENSG00000225830	ENSG00000225830			3438	protein-coding gene	gene with protein product	"""Cockayne syndrome B protein"""	609413	"""excision repair cross-complementing rodent repair deficiency, complementation group 6"""	CKN2		1339317, 19179336	Standard	NM_000124		Approved	CSB, RAD26, ARMD5	uc001jhs.5	Q03468	OTTHUMG00000018195	ENST00000355832.5:c.2744G>A	10.37:g.50681040C>T	ENSP00000348089:p.Arg915Gln	224	0		231	92	NM_000124	0	0	0	0	0	D3DX94|Q5W0L9	Missense_Mutation	SNP	ENST00000355832.5	37	CCDS7229.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.199652	0.79015	.	.	ENSG00000225830	ENST00000355832;ENST00000374129;ENST00000542458	T;T	0.74842	-0.88;-0.88	5.88	5.88	0.94601	Helicase, C-terminal (3);	.	.	.	.	D	0.88093	0.6344	M	0.83603	2.65	0.48341	D	0.999631	D;D	0.89917	1.0;0.999	D;D	0.76575	0.987;0.988	D	0.88520	0.3095	9	0.72032	D	0.01	-20.7418	20.2422	0.98381	0.0:1.0:0.0:0.0	.	915;292	Q03468;Q59FF6	ERCC6_HUMAN;.	Q	915;292;285	ENSP00000348089:R915Q;ENSP00000445134:R285Q	ENSP00000348089:R915Q	R	-	2	0	ERCC6	50351046	0.998000	0.40836	0.702000	0.30337	0.338000	0.28826	3.873000	0.56093	2.782000	0.95742	0.655000	0.94253	CGG	.		0.498	ERCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047990.1	NM_000124	
CSTF2T	23283	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	53458361	53458361	+	Missense_Mutation	SNP	C	C	T			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr10:53458361C>T	ENST00000331173.4	-	1	994	c.949G>A	c.(949-951)Gga>Aga	p.G317R	PRKG1_ENST00000373985.1_Intron|PRKG1_ENST00000401604.2_Intron|PRKG1_ENST00000373980.4_Intron	NM_015235.2	NP_056050.1	Q9H0L4	CSTFT_HUMAN	cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa, tau variant	317	Gly-rich.				mRNA processing (GO:0006397)	intracellular (GO:0005622)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.G317R(1)		NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	30				COAD - Colon adenocarcinoma(2;0.00736)|Colorectal(2;0.00898)|all cancers(4;0.0188)|GBM - Glioblastoma multiforme(4;0.0778)|Epithelial(53;0.122)		GTCACGGGTCCGCGAGGTATA	0.567																																					p.G317R		.											.	CSTF2T-91	1	Substitution - Missense(1)	large_intestine(1)	c.G949A						.						72.0	68.0	70.0					10																	53458361		2203	4300	6503	SO:0001583	missense	23283	exon1			CGGGTCCGCGAGG	AB014589	CCDS7245.1	10q11	2013-02-12			ENSG00000177613	ENSG00000177613		"""RNA binding motif (RRM) containing"""	17086	protein-coding gene	gene with protein product		611968				12408968, 11113135	Standard	NM_015235		Approved	DKFZp434C1013, KIAA0689, CstF-64T	uc001jjp.3	Q9H0L4	OTTHUMG00000018246	ENST00000331173.4:c.949G>A	10.37:g.53458361C>T	ENSP00000332444:p.Gly317Arg	59	0		64	14	NM_015235	0	0	0	4	4	B2RAR9|O75174|Q53HK6|Q7LGE8|Q8N6T1	Missense_Mutation	SNP	ENST00000331173.4	37	CCDS7245.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.169805	0.78452	.	.	ENSG00000177613	ENST00000331173	T	0.22539	1.95	4.7	4.7	0.59300	.	0.449653	0.22819	N	0.055255	T	0.41994	0.1183	L	0.55481	1.735	0.53688	D	0.999972	D	0.89917	1.0	D	0.97110	1.0	T	0.13737	-1.0498	10	0.52906	T	0.07	-7.9329	15.5353	0.75998	0.0:1.0:0.0:0.0	.	317	Q9H0L4	CSTFT_HUMAN	R	317	ENSP00000332444:G317R	ENSP00000332444:G317R	G	-	1	0	CSTF2T	53128367	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.116000	0.71571	2.613000	0.88420	0.655000	0.94253	GGA	.		0.567	CSTF2T-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048097.1	NM_015235	
COL13A1	1305	hgsc.bcm.edu	37	10	71562297	71562297	+	Missense_Mutation	SNP	C	C	T	rs561022104	byFrequency	TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr10:71562297C>T	ENST00000398978.3	+	1	610	c.118C>T	c.(118-120)Ccg>Tcg	p.P40S	COL13A1_ENST00000398969.3_Missense_Mutation_p.P40S|COL13A1_ENST00000398966.3_Missense_Mutation_p.P40S|COL13A1_ENST00000357811.3_Missense_Mutation_p.P40S|COL13A1_ENST00000398972.3_Missense_Mutation_p.P40S|COL13A1_ENST00000520133.1_Missense_Mutation_p.P40S|COL13A1_ENST00000398971.3_Missense_Mutation_p.P40S|COL13A1_ENST00000522165.1_Missense_Mutation_p.P40S|COL13A1_ENST00000398964.3_Missense_Mutation_p.P40S|COL13A1_ENST00000398974.3_Missense_Mutation_p.P40S|COL13A1_ENST00000398973.3_Missense_Mutation_p.P40S|COL13A1_ENST00000356340.3_Missense_Mutation_p.P40S|COL13A1_ENST00000520267.1_Missense_Mutation_p.P40S|COL13A1_ENST00000398968.3_Missense_Mutation_p.P40S|COL13A1_ENST00000354547.3_Missense_Mutation_p.P40S|COL13A1_ENST00000517713.1_Missense_Mutation_p.P40S	NM_001130103.1	NP_001123575.1			collagen, type XIII, alpha 1											endometrium(5)|large_intestine(3)|lung(15)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	28						CGCACGGCTGCCGAGTCCAGG	0.766													C|||	2	0.000399361	0.0015	0.0	5008	,	,		8844	0.0		0.0	False		,,,				2504	0.0				p.P40S		.											.	COL13A1-91	0			c.C118T						.						12.0	14.0	13.0					10																	71562297		1839	3975	5814	SO:0001583	missense	1305	exon1			CGGCTGCCGAGTC	AJ293624	CCDS44419.1, CCDS44423.1, CCDS44424.1, CCDS44425.1, CCDS44427.1, CCDS44428.1, CCDS44423.2, CCDS44424.2, CCDS44425.2, CCDS44427.2, CCDS44428.2	10q22	2013-01-16			ENSG00000197467	ENSG00000197467		"""Collagens"""	2190	protein-coding gene	gene with protein product		120350					Standard	NM_001130103		Approved		uc001jql.3	Q5TAT6	OTTHUMG00000018394	ENST00000398978.3:c.118C>T	10.37:g.71562297C>T	ENSP00000381949:p.Pro40Ser	0	0		17	4	NM_080802	0	0	0	0	0		Missense_Mutation	SNP	ENST00000398978.3	37	CCDS44419.1	.	.	.	.	.	.	.	.	.	.	C	16.09	3.024834	0.54683	.	.	ENSG00000197467	ENST00000398974;ENST00000398971;ENST00000398968;ENST00000398966;ENST00000398964;ENST00000398969;ENST00000356340;ENST00000398972;ENST00000398973;ENST00000398978;ENST00000354547;ENST00000357811;ENST00000520267;ENST00000517713;ENST00000522165;ENST00000520133	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.91686	-2.74;-2.66;-2.7;-2.79;-2.89;-2.7;-2.73;-2.6;-2.72;-2.72;-2.7;-2.71;-2.66;-2.61;-2.66;-2.61	5.24	5.24	0.73138	.	0.000000	0.42294	D	0.000732	D	0.92172	0.7518	N	0.22421	0.69	0.29823	N	0.830659	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.69078	0.993;0.996;0.997;0.993;0.994;0.994;0.994;0.997;0.994;0.994;0.997;0.997;0.997;0.996;0.997;0.997;0.994;0.996	D;D;P;D;P;P;P;D;P;P;P;P;D;D;P;P;P;D	0.78314	0.979;0.991;0.9;0.979;0.796;0.796;0.796;0.986;0.796;0.723;0.9;0.9;0.986;0.991;0.9;0.9;0.796;0.991	D	0.88496	0.3079	10	0.44086	T	0.13	-5.5417	13.2925	0.60278	0.0:0.9204:0.0:0.0796	.	40;40;40;40;40;40;40;40;40;40;40;40;40;40;40;40;40;40	Q5TAT6;Q5TAT6-5;Q5TAT6-6;E9PEG9;E7ES55;E7ES51;E7ES47;E7ES46;E7ES49;E7EWL8;Q5TAT6-3;Q5TAT6-4;E7EX21;Q5TAT6-7;Q5TAT6-8;Q5TAT6-2;E7ES56;G5E987	CODA1_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	S	40	ENSP00000381946:P40S;ENSP00000381943:P40S;ENSP00000381940:P40S;ENSP00000381938:P40S;ENSP00000381936:P40S;ENSP00000381941:P40S;ENSP00000348695:P40S;ENSP00000381944:P40S;ENSP00000381945:P40S;ENSP00000381949:P40S;ENSP00000346553:P40S;ENSP00000350463:P40S;ENSP00000428057:P40S;ENSP00000430061:P40S;ENSP00000428342:P40S;ENSP00000430173:P40S	ENSP00000346553:P40S	P	+	1	0	COL13A1	71232303	1.000000	0.71417	1.000000	0.80357	0.837000	0.47467	3.084000	0.50143	2.462000	0.83206	0.456000	0.33151	CCG	.		0.766	COL13A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048468.1	NM_005203	
ZMIZ1	57178	broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	81037038	81037038	+	Silent	SNP	C	C	G			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr10:81037038C>G	ENST00000334512.5	+	8	953	c.381C>G	c.(379-381)ccC>ccG	p.P127P	ZMIZ1_ENST00000478357.1_3'UTR	NM_020338.3	NP_065071.1	Q9ULJ6	ZMIZ1_HUMAN	zinc finger, MIZ-type containing 1	127					artery morphogenesis (GO:0048844)|cell aging (GO:0007569)|developmental growth (GO:0048589)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)|vitellogenesis (GO:0007296)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(14)|ovary(2)|prostate(3)|skin(1)	30	all_cancers(46;0.0292)|Breast(12;8.52e-05)|all_epithelial(25;0.000854)|Prostate(51;0.00985)		Epithelial(14;0.00256)|all cancers(16;0.00726)|Colorectal(32;0.229)			CCATGCAGCCCCCTCTCAGCT	0.622																																					p.P127P													.	ZMIZ1-292	0			c.C381G						.						57.0	55.0	55.0					10																	81037038		2203	4300	6503	SO:0001819	synonymous_variant	57178	exon8			GCAGCCCCCTCTC	AB033050	CCDS7357.1	10q22.3	2012-11-30	2006-10-24	2006-10-24	ENSG00000108175	ENSG00000108175		"""Zinc fingers, MIZ-type"""	16493	protein-coding gene	gene with protein product		607159	"""retinoic acid induced 17"""	RAI17		15626329	Standard	NM_020338		Approved	RP11-519K18.1, KIAA1224, FLJ13541, hZIMP10, Zimp10, MIZ	uc001kaf.2	Q9ULJ6	OTTHUMG00000018560	ENST00000334512.5:c.381C>G	10.37:g.81037038C>G		49	0		53	5	NM_020338	0	0	4	4	0	Q5JSH9|Q7Z7E6	Silent	SNP	ENST00000334512.5	37	CCDS7357.1																																																																																			.		0.622	ZMIZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048944.2	NM_020338	
RNLS	55328	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	90342858	90342858	+	Silent	SNP	A	A	C			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr10:90342858A>C	ENST00000331772.4	-	1	112	c.90T>G	c.(88-90)ctT>ctG	p.L30L	Y_RNA_ENST00000364678.1_RNA|RNLS_ENST00000466945.1_5'UTR|RNLS_ENST00000437752.1_Silent_p.L30L|RNLS_ENST00000371947.3_Silent_p.L30L	NM_001031709.2	NP_001026879.2	Q5VYX0	RNLS_HUMAN	renalase, FAD-dependent amine oxidase	30					cardiac left ventricle morphogenesis (GO:0003214)|dopamine metabolic process (GO:0042417)|epinephrine metabolic process (GO:0042414)|heart contraction (GO:0060047)|norepinephrine metabolic process (GO:0042415)|phosphate ion homeostasis (GO:0055062)|regulation of systemic arterial blood pressure (GO:0003073)|response to epinephrine (GO:0071871)|response to ischemia (GO:0002931)|response to norepinephrine (GO:0071873)|response to salt (GO:1902074)	extracellular space (GO:0005615)	oxidoreductase activity (GO:0016491)			breast(1)|kidney(1)|lung(3)|ovary(1)|prostate(1)	7						CCCACACAGCAAGGTACAAGG	0.632											OREG0020353	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L30L		.											.	RNLS-91	0			c.T90G						.						65.0	63.0	64.0					10																	90342858		2203	4300	6503	SO:0001819	synonymous_variant	55328	exon1			CACAGCAAGGTAC	BC005364	CCDS7388.1, CCDS31239.1	10q23.31	2009-04-22	2009-04-22	2009-04-22	ENSG00000184719	ENSG00000184719			25641	protein-coding gene	gene with protein product		609360	"""chromosome 10 open reading frame 59"""	C10orf59		15841207, 17565281	Standard	NM_001031709		Approved	FLJ11218, renalase	uc001kfe.3	Q5VYX0	OTTHUMG00000018692	ENST00000331772.4:c.90T>G	10.37:g.90342858A>C		121	0	1274	164	57	NM_001031709	0	0	0	12	12	Q9BS33|Q9NUP8	Silent	SNP	ENST00000331772.4	37	CCDS31239.1																																																																																			.		0.632	RNLS-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049250.1	NM_018363	
NOC3L	64318	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	96121495	96121495	+	Silent	SNP	T	T	C			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr10:96121495T>C	ENST00000371361.3	-	2	244	c.144A>G	c.(142-144)aaA>aaG	p.K48K	NOC3L_ENST00000463649.1_5'UTR|NOC3L_ENST00000371350.1_Silent_p.K48K	NM_022451.9	NP_071896.8	Q8WTT2	NOC3L_HUMAN	nucleolar complex associated 3 homolog (S. cerevisiae)	48					fat cell differentiation (GO:0045444)	nuclear speck (GO:0016607)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			endometrium(3)|large_intestine(17)|lung(5)|ovary(1)|skin(2)|stomach(1)	29		Colorectal(252;0.0897)				CTTGCCTTAGTTTCCTCTGTT	0.368																																					p.K48K		.											.	NOC3L-91	0			c.A144G						.						308.0	272.0	284.0					10																	96121495		2203	4300	6503	SO:0001819	synonymous_variant	64318	exon2			CCTTAGTTTCCTC	AL355341	CCDS7433.1	10q23.33	2004-04-20	2005-08-01	2005-08-01	ENSG00000173145	ENSG00000173145			24034	protein-coding gene	gene with protein product		610769	"""chromosome 10 open reading frame 117"""	C10orf117		15564382	Standard	NM_022451		Approved	AD24, FLJ12820, FAD24	uc001kjq.1	Q8WTT2	OTTHUMG00000018788	ENST00000371361.3:c.144A>G	10.37:g.96121495T>C		93	0		79	27	NM_022451	0	0	0	0	0	Q9H5M6|Q9H9D8	Silent	SNP	ENST00000371361.3	37	CCDS7433.1																																																																																			.		0.368	NOC3L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049466.1	NM_022451	
GPAM	57678	ucsc.edu;bcgsc.ca	37	10	113920407	113920407	+	Missense_Mutation	SNP	A	A	T			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr10:113920407A>T	ENST00000348367.4	-	16	1911	c.1714T>A	c.(1714-1716)Tac>Aac	p.Y572N	GPAM_ENST00000423155.1_Missense_Mutation_p.Y572N|GPAM_ENST00000369425.1_Missense_Mutation_p.Y572N			Q9HCL2	GPAT1_HUMAN	glycerol-3-phosphate acyltransferase, mitochondrial	572					acyl-CoA metabolic process (GO:0006637)|CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|defense response to virus (GO:0051607)|fatty acid homeostasis (GO:0055089)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|interleukin-2 secretion (GO:0070970)|negative regulation of activation-induced cell death of T cells (GO:0070236)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of multicellular organism growth (GO:0040018)|regulation of cytokine secretion (GO:0050707)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			breast(2)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31				Epithelial(162;0.0306)|all cancers(201;0.123)		CCATTGCTGTAGAAGTTGAGT	0.418																																					p.Y572N	Ovarian(161;1017 2606 18293 52943)												.	GPAM-92	0			c.T1714A						.						128.0	113.0	118.0					10																	113920407		2203	4300	6503	SO:0001583	missense	57678	exon16			TGCTGTAGAAGTT	AL832464	CCDS7570.1	10q25.3	2009-07-15			ENSG00000119927	ENSG00000119927			24865	protein-coding gene	gene with protein product	"""glycerol-3-phosphate acyltransferase 1, mitochondrial"""	602395				10997877, 8369314	Standard	NM_020918		Approved	KIAA1560, MGC26846, GPAT1	uc001kzp.3	Q9HCL2	OTTHUMG00000019055	ENST00000348367.4:c.1714T>A	10.37:g.113920407A>T	ENSP00000265276:p.Tyr572Asn	237	2		251	107	NM_001244949	0	0	0	0	0	Q5VW51|Q86TA3	Missense_Mutation	SNP	ENST00000348367.4	37	CCDS7570.1	.	.	.	.	.	.	.	.	.	.	A	25.1	4.605939	0.87157	.	.	ENSG00000119927	ENST00000348367;ENST00000423155;ENST00000369425	T;T;T	0.76839	-1.05;-1.05;-0.99	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	D	0.85669	0.5750	L	0.56769	1.78	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.80764	0.994;0.991	D	0.86451	0.1773	10	0.59425	D	0.04	-19.1551	14.819	0.70055	1.0:0.0:0.0:0.0	.	572;572	Q5VW52;Q9HCL2	.;GPAT1_HUMAN	N	572	ENSP00000265276:Y572N;ENSP00000409242:Y572N;ENSP00000358433:Y572N	ENSP00000265276:Y572N	Y	-	1	0	GPAM	113910397	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.809000	0.91944	2.241000	0.73720	0.533000	0.62120	TAC	.		0.418	GPAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050377.1	NM_020918	
PDZD8	118987	hgsc.bcm.edu	37	10	119134718	119134718	+	Silent	SNP	G	G	T			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr10:119134718G>T	ENST00000334464.5	-	1	260	c.21C>A	c.(19-21)atC>atA	p.I7I		NM_173791.3	NP_776152.1	Q8NEN9	PDZD8_HUMAN	PDZ domain containing 8	7					cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|regulation of cell morphogenesis (GO:0022604)|viral process (GO:0016032)	membrane (GO:0016020)	metal ion binding (GO:0046872)			kidney(3)|large_intestine(8)|lung(24)|upper_aerodigestive_tract(3)	38		Colorectal(252;0.19)		all cancers(201;0.0121)		CCGACGCCAGGATCATGAGCA	0.741																																					p.I7I		.											.	PDZD8-90	0			c.C21A						.																																			SO:0001819	synonymous_variant	118987	exon1			CGCCAGGATCATG	AL122051	CCDS7600.1	10q26.12	2006-01-24		2006-01-24	ENSG00000165650	ENSG00000165650			26974	protein-coding gene	gene with protein product		614235		PDZK8		12477932	Standard	NM_173791		Approved	bA129M16.2, FLJ34427	uc001lde.1	Q8NEN9	OTTHUMG00000019122	ENST00000334464.5:c.21C>A	10.37:g.119134718G>T		10	0		59	38	NM_173791	0	0	0	0	0	Q86WE0|Q86WE5|Q9UFF1	Silent	SNP	ENST00000334464.5	37	CCDS7600.1																																																																																			.		0.741	PDZD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050565.1	NM_173791	
MUC2	4583	broad.mit.edu	37	11	1093099	1093099	+	Missense_Mutation	SNP	C	C	A			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr11:1093099C>A	ENST00000441003.2	+	30	4945	c.4918C>A	c.(4918-4920)Cca>Aca	p.P1640T	MUC2_ENST00000359061.5_Missense_Mutation_p.P1607T|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_5'Flank	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	tacggtgaccccaaccccaac	0.632																																					p.P1640T													.	MUC2-90	0			c.C4918A						.						63.0	117.0	98.0					11																	1093099		1809	3438	5247	SO:0001583	missense	4583	exon30			GTGACCCCAACCC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4918C>A	11.37:g.1093099C>A	ENSP00000415183:p.Pro1640Thr	109	0		132	3	NM_002457	0	0	0	0	0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	2.382	-0.341784	0.05243	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.12465	2.68;3.14	1.07	-2.15	0.07102	.	0.513936	0.13039	U	0.418649	T	0.05686	0.0149	.	.	.	0.09310	N	1	B	0.13145	0.007	B	0.04013	0.001	T	0.40496	-0.9560	9	0.15952	T	0.53	.	3.2486	0.06806	0.348:0.4185:0.2335:0.0	.	1640	E7EUV1	.	T	1640;1607	ENSP00000415183:P1640T;ENSP00000351956:P1607T	ENSP00000351956:P1607T	P	+	1	0	MUC2	1083099	0.000000	0.05858	0.000000	0.03702	0.149000	0.21700	-1.638000	0.02013	-1.307000	0.02321	0.121000	0.15741	CCA	.		0.632	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MUC2	4583	broad.mit.edu	37	11	1093376	1093376	+	Missense_Mutation	SNP	C	C	T			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr11:1093376C>T	ENST00000441003.2	+	30	5222	c.5195C>T	c.(5194-5196)cCa>cTa	p.P1732L	MUC2_ENST00000359061.5_Missense_Mutation_p.P1699L|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_Missense_Mutation_p.P20L	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	acggtgaccccaaccccaaca	0.652																																					p.P1732L													.	MUC2-90	0			c.C5195T						.						159.0	216.0	197.0					11																	1093376		1982	3848	5830	SO:0001583	missense	4583	exon30			TGACCCCAACCCC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5195C>T	11.37:g.1093376C>T	ENSP00000415183:p.Pro1732Leu	140	2		140	5	NM_002457	0	0	0	0	0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	4.814	0.151307	0.09185	.	.	ENSG00000198788	ENST00000441003;ENST00000359061;ENST00000333592	T;T;T	0.10668	3.06;3.09;2.85	1.24	-0.195	0.13236	.	498.391000	0.02047	U	0.049780	T	0.07234	0.0183	.	.	.	0.09310	N	1	B	0.20261	0.043	B	0.08055	0.003	T	0.33369	-0.9871	9	0.41790	T	0.15	.	2.831	0.05499	0.3014:0.3985:0.3:0.0	.	1732	E7EUV1	.	L	1732;1699;20	ENSP00000415183:P1732L;ENSP00000351956:P1699L;ENSP00000331373:P20L	ENSP00000331373:P20L	P	+	2	0	MUC2	1083376	0.002000	0.14202	0.001000	0.08648	0.006000	0.05464	0.947000	0.29082	0.612000	0.30071	0.195000	0.17529	CCA	.		0.652	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
ZFP91	80829	hgsc.bcm.edu	37	11	58346868	58346868	+	Silent	SNP	G	G	A			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr11:58346868G>A	ENST00000316059.6	+	1	285	c.114G>A	c.(112-114)gcG>gcA	p.A38A	LPXN_ENST00000528954.1_5'Flank|LPXN_ENST00000528489.1_5'Flank|ZFP91-CNTF_ENST00000389919.4_Silent_p.A38A	NM_001197051.1|NM_053023.4	NP_001183980.1|NP_444251.1	Q96JP5	ZFP91_HUMAN	ZFP91 zinc finger protein	38	Ala-rich.				activation of NF-kappaB-inducing kinase activity (GO:0007250)|protein K63-linked ubiquitination (GO:0070534)	nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|ubiquitin-protein transferase activity (GO:0004842)			cervix(1)|endometrium(4)|kidney(4)|large_intestine(4)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	26		Breast(21;0.00725)|all_epithelial(135;0.0101)|all_lung(304;0.24)				AGGCGGTCGCGGCGGCGCCTG	0.771																																					p.A38A		.											.	ZFP91-91	0			c.G114A						.						2.0	2.0	2.0					11																	58346868		1047	2260	3307	SO:0001819	synonymous_variant	80829	exon1			GGTCGCGGCGGCG	AB056107	CCDS31553.1	11q12	2012-11-27	2012-11-27		ENSG00000186660	ENSG00000186660		"""Zinc fingers, C2H2-type"""	14983	protein-coding gene	gene with protein product			"""zinc finger protein homologous to Zfp91 in mouse"", ""zinc finger protein 91 homolog (mouse)"""			12738986, 20682767	Standard	NM_053023		Approved	PZF, ZNF757	uc001nmx.4	Q96JP5	OTTHUMG00000137391	ENST00000316059.6:c.114G>A	11.37:g.58346868G>A		0	0		15	8	NM_001197051	0	0	0	0	0	A6NHC4|A8MSG7|Q86V47|Q96JP4|Q96QA3	Silent	SNP	ENST00000316059.6	37	CCDS31553.1																																																																																			.		0.771	ZFP91-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268674.1	NM_053023	
ATG2A	23130	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	64681557	64681557	+	Missense_Mutation	SNP	C	C	A			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr11:64681557C>A	ENST00000377264.3	-	3	595	c.483G>T	c.(481-483)gaG>gaT	p.E161D	ATG2A_ENST00000421419.2_Missense_Mutation_p.E161D	NM_015104.2	NP_055919.2	Q2TAZ0	ATG2A_HUMAN	autophagy related 2A	161					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(19)|ovary(3)|prostate(5)|skin(1)|stomach(1)|urinary_tract(3)	55						GCTCACCAGTCTCAATGGTCT	0.667																																					p.E161D		.											.	ATG2A-69	0			c.G483T						.						27.0	31.0	29.0					11																	64681557		2165	4236	6401	SO:0001583	missense	23130	exon3			ACCAGTCTCAATG		CCDS31602.1	11q13.1	2014-02-12	2012-06-06		ENSG00000110046	ENSG00000110046			29028	protein-coding gene	gene with protein product			"""ATG2 autophagy related 2 homolog A (S. cerevisiae)"""			21887408	Standard	NM_015104		Approved	KIAA0404	uc001obx.3	Q2TAZ0	OTTHUMG00000066831	ENST00000377264.3:c.483G>T	11.37:g.64681557C>A	ENSP00000366475:p.Glu161Asp	129	0		154	54	NM_015104	0	0	0	0	0	O43154|Q14DM2|Q6ZTV2|Q7Z6K8|Q8IVY5|Q8TAI8|Q96HH7	Missense_Mutation	SNP	ENST00000377264.3	37	CCDS31602.1	.	.	.	.	.	.	.	.	.	.	c	16.16	3.045338	0.55110	.	.	ENSG00000110046	ENST00000421419;ENST00000377264;ENST00000227459	T;T	0.56444	0.46;0.46	3.89	1.99	0.26369	.	0.000000	0.64402	D	0.000001	T	0.55449	0.1921	L	0.41236	1.265	0.44366	D	0.997264	D	0.63880	0.993	D	0.70016	0.967	T	0.49542	-0.8929	10	0.33940	T	0.23	.	5.9448	0.19213	0.0:0.666:0.0:0.334	.	161	Q2TAZ0	ATG2A_HUMAN	D	161	ENSP00000410522:E161D;ENSP00000366475:E161D	ENSP00000227459:E161D	E	-	3	2	ATG2A	64438133	1.000000	0.71417	0.998000	0.56505	0.950000	0.60333	0.697000	0.25556	0.439000	0.26476	0.457000	0.33378	GAG	.		0.667	ATG2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000143224.1	NM_015104	
FOLR2	2350	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	71931920	71931920	+	Missense_Mutation	SNP	C	C	A			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr11:71931920C>A	ENST00000298223.6	+	3	344	c.157C>A	c.(157-159)Ccc>Acc	p.P53T	FOLR2_ENST00000449475.2_Missense_Mutation_p.P70T|FOLR2_ENST00000454954.2_Missense_Mutation_p.P12T	NM_000803.4|NM_001113534.1|NM_001113535.1|NM_001113536.1	NP_000794.3|NP_001107006.1|NP_001107007.1|NP_001107008.1	P14207	FOLR2_HUMAN	folate receptor 2 (fetal)	53					folic acid transport (GO:0015884)	anchored component of external side of plasma membrane (GO:0031362)|extracellular region (GO:0005576)|membrane (GO:0016020)	folic acid binding (GO:0005542)|folic acid transporter activity (GO:0008517)			breast(3)|large_intestine(3)|ovary(1)|skin(1)	8					Folic Acid(DB00158)	CCAGTGCAGTCCCTGGAAGAA	0.587																																					p.P53T													.	FOLR2-290	0			c.C157A						.						46.0	44.0	44.0					11																	71931920		2200	4293	6493	SO:0001583	missense	2350	exon3			TGCAGTCCCTGGA	AK222539	CCDS8212.1	11q13.3-q14.1	2010-04-08			ENSG00000165457	ENSG00000165457			3793	protein-coding gene	gene with protein product		136425				1133088, 7698003	Standard	NM_000803		Approved		uc009ytf.3	P14207	OTTHUMG00000150394	ENST00000298223.6:c.157C>A	11.37:g.71931920C>A	ENSP00000298223:p.Pro53Thr	103	2		105	37	NM_001113535	0	0	0	0	0	Q05CA5|Q6GTE8	Missense_Mutation	SNP	ENST00000298223.6	37	CCDS8212.1	.	.	.	.	.	.	.	.	.	.	c	17.57	3.422312	0.62622	.	.	ENSG00000165457	ENST00000449475;ENST00000298223;ENST00000413873;ENST00000454954;ENST00000541003;ENST00000539412;ENST00000536778;ENST00000535625;ENST00000321324;ENST00000538353	T;T;T;T;T;T;T;T;T	0.76448	-1.02;-1.02;-1.02;-1.02;-1.02;-1.02;-1.02;-1.02;-1.02	4.25	2.38	0.29361	Folate receptor-like (1);	0.000000	0.85682	D	0.000000	D	0.88976	0.6584	M	0.93678	3.445	0.39744	D	0.971793	D	0.89917	1.0	D	0.97110	1.0	D	0.88102	0.2820	10	0.56958	D	0.05	.	8.6185	0.33847	0.0:0.8112:0.0:0.1888	.	53	P14207	FOLR2_HUMAN	T	70;53;70;12;99;64;68;53;66;53	ENSP00000405638:P70T;ENSP00000298223:P53T;ENSP00000414094:P12T;ENSP00000443307:P99T;ENSP00000441547:P64T;ENSP00000438568:P68T;ENSP00000444794:P53T;ENSP00000321957:P66T;ENSP00000440337:P53T	ENSP00000298223:P53T	P	+	1	0	FOLR2	71609568	0.920000	0.31207	0.934000	0.37439	0.977000	0.68977	3.796000	0.55507	0.435000	0.26365	0.455000	0.32223	CCC	.		0.587	FOLR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317923.2	NM_000803	
LIPT2	387787	hgsc.bcm.edu	37	11	74204479	74204479	+	Silent	SNP	G	G	T	rs533747475	byFrequency	TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr11:74204479G>T	ENST00000310109.4	-	1	299	c.270C>A	c.(268-270)acC>acA	p.T90T	AP001372.2_ENST00000526036.1_lincRNA	NM_001144869.1	NP_001138341.1	A6NK58	LIPT2_HUMAN	lipoyl(octanoyl) transferase 2 (putative)	90	BPL/LPL catalytic. {ECO:0000255|PROSITE- ProRule:PRU01067}.|Substrate binding. {ECO:0000250}.				cellular protein modification process (GO:0006464)|lipoate biosynthetic process (GO:0009107)	mitochondrion (GO:0005739)	ligase activity (GO:0016874)|lipoyl(octanoyl) transferase activity (GO:0033819)|octanoyltransferase activity (GO:0016415)			endometrium(1)|prostate(1)|stomach(1)	3						GGCCGTGGAAGGTGGCCAGGC	0.746													G|||	10	0.00199681	0.0068	0.0014	5008	,	,		12455	0.0		0.0	False		,,,				2504	0.0				p.T90T		.											.	LIPT2-68	0			c.C270A						.						3.0	8.0	7.0					11																	74204479		586	1396	1982	SO:0001819	synonymous_variant	387787	exon1			GTGGAAGGTGGCC		CCDS44679.1	11q13.4	2009-09-09			ENSG00000175536	ENSG00000175536			37216	protein-coding gene	gene with protein product							Standard	NM_001144869		Approved		uc010rrk.2	A6NK58	OTTHUMG00000165646	ENST00000310109.4:c.270C>A	11.37:g.74204479G>T		0	0		6	6	NM_001144869	0	0	0	1	1		Silent	SNP	ENST00000310109.4	37	CCDS44679.1																																																																																			.		0.746	LIPT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385544.1	NM_001144869	
BARX2	8538	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	129321185	129321185	+	Missense_Mutation	SNP	T	T	A			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr11:129321185T>A	ENST00000281437.4	+	4	824	c.728T>A	c.(727-729)cTc>cAc	p.L243H	BARX2_ENST00000531946.1_Missense_Mutation_p.L121H|BARX2_ENST00000526127.1_Missense_Mutation_p.L98H	NM_003658.4	NP_003649.2	Q9UMQ3	BARX2_HUMAN	BARX homeobox 2	243					cartilage condensation (GO:0001502)|catagen (GO:0042637)|myotube differentiation (GO:0014902)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(1)|central_nervous_system(1)|large_intestine(4)|lung(7)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	20	all_hematologic(175;0.0749)	Lung NSC(97;0.000383)|all_lung(97;0.000824)|Breast(109;0.000962)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.00929)|Lung(977;0.0245)|LUSC - Lung squamous cell carcinoma(976;0.0253)		CAGGAGGAGCTCTGTGAAGCA	0.582																																					p.L243H		.											.	BARX2-90	0			c.T728A						.						72.0	66.0	68.0					11																	129321185		2201	4297	6498	SO:0001583	missense	8538	exon4			AGGAGCTCTGTGA	AF031924	CCDS8481.1	11q24.3	2011-06-20	2007-07-09		ENSG00000043039	ENSG00000043039		"""Homeoboxes / ANTP class : NKL subclass"""	956	protein-coding gene	gene with protein product		604823	"""BarH-like homeobox 2"""			10644443	Standard	NM_003658		Approved		uc001qfc.4	Q9UMQ3	OTTHUMG00000165776	ENST00000281437.4:c.728T>A	11.37:g.129321185T>A	ENSP00000281437:p.Leu243His	143	0		134	53	NM_003658	0	0	1	3	2	O43518|Q6NT51	Missense_Mutation	SNP	ENST00000281437.4	37	CCDS8481.1	.	.	.	.	.	.	.	.	.	.	T	18.48	3.632445	0.67015	.	.	ENSG00000043039	ENST00000281437;ENST00000526127;ENST00000531946	D;D;D	0.90385	-2.66;-2.27;-2.27	5.51	-1.59	0.08453	.	0.906017	0.09601	N	0.780189	D	0.83769	0.5326	L	0.29908	0.895	0.09310	N	0.999999	P	0.45348	0.856	B	0.40101	0.319	T	0.72701	-0.4214	10	0.41790	T	0.15	.	12.1971	0.54303	0.0:0.6898:0.0:0.3102	.	243	Q9UMQ3	BARX2_HUMAN	H	243;98;121	ENSP00000281437:L243H;ENSP00000451113:L98H;ENSP00000450418:L121H	ENSP00000281437:L243H	L	+	2	0	BARX2	128826395	0.188000	0.23250	0.043000	0.18650	0.326000	0.28443	0.364000	0.20325	-0.288000	0.09051	0.533000	0.62120	CTC	.		0.582	BARX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386153.1	NM_003658	
GLS2	27165	ucsc.edu	37	12	56865334	56865334	+	Silent	SNP	A	A	G			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr12:56865334A>G	ENST00000311966.4	-	18	2024	c.1746T>C	c.(1744-1746)tcT>tcC	p.S582S	MIP_ENST00000555551.1_5'Flank|GLS2_ENST00000476991.1_5'Flank	NM_013267.2	NP_037399.2	Q9UI32	GLSL_HUMAN	glutaminase 2 (liver, mitochondrial)	582					cellular amino acid biosynthetic process (GO:0008652)|cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate secretion (GO:0014047)|glutamine metabolic process (GO:0006541)|neurotransmitter secretion (GO:0007269)|reactive oxygen species metabolic process (GO:0072593)|regulation of apoptotic process (GO:0042981)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	glutaminase activity (GO:0004359)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|stomach(1)|urinary_tract(1)	13					L-Glutamine(DB00130)	CCTGAGTTTCAGAGAGTGTGT	0.517																																					p.S582S													.	GLS2-91	0			c.T1746C						.						72.0	63.0	66.0					12																	56865334		2203	4300	6503	SO:0001819	synonymous_variant	27165	exon18			AGTTTCAGAGAGT		CCDS8921.1, CCDS73482.1	12q13	2013-01-10			ENSG00000135423	ENSG00000135423		"""Ankyrin repeat domain containing"""	29570	protein-coding gene	gene with protein product		606365				11130979, 10620514	Standard	NM_013267		Approved	GA, GLS, LGA, hLGA	uc001slj.3	Q9UI32	OTTHUMG00000140379	ENST00000311966.4:c.1746T>C	12.37:g.56865334A>G		137	1		148	2	NM_013267	0	0	1	2	1	B7Z8Q9|Q8IX91|Q9NYY2|Q9UI31	Silent	SNP	ENST00000311966.4	37	CCDS8921.1																																																																																			.		0.517	GLS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277113.1	NM_013267	
SHMT2	6472	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	57624649	57624649	+	Missense_Mutation	SNP	C	C	G			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr12:57624649C>G	ENST00000328923.3	+	2	549	c.97C>G	c.(97-99)Cag>Gag	p.Q33E	SHMT2_ENST00000557487.1_Missense_Mutation_p.Q33E|SHMT2_ENST00000554600.1_3'UTR|SHMT2_ENST00000449049.3_Missense_Mutation_p.Q12E|SHMT2_ENST00000553474.1_Missense_Mutation_p.Q12E|SHMT2_ENST00000414700.3_Missense_Mutation_p.Q12E|SHMT2_ENST00000393827.4_5'UTR|Y_RNA_ENST00000365197.1_RNA	NM_001166356.1|NM_005412.5	NP_001159828.1|NP_005403.2	P34897	GLYM_HUMAN	serine hydroxymethyltransferase 2 (mitochondrial)	33					glycine biosynthetic process from serine (GO:0019264)|L-serine biosynthetic process (GO:0006564)|one-carbon metabolic process (GO:0006730)|positive regulation of cell proliferation (GO:0008284)|protein homotetramerization (GO:0051289)|tetrahydrofolate interconversion (GO:0035999)	extracellular vesicular exosome (GO:0070062)|microtubule cytoskeleton (GO:0015630)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	amino acid binding (GO:0016597)|chromatin binding (GO:0003682)|glycine hydroxymethyltransferase activity (GO:0004372)|L-allo-threonine aldolase activity (GO:0008732)|pyridoxal phosphate binding (GO:0030170)			breast(1)|central_nervous_system(1)|large_intestine(4)|liver(2)|lung(3)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	15					Glycine(DB00145)|Tetrahydrofolic acid(DB00116)	CAACGCAGCCCAGACTCAGAC	0.582																																					p.Q33E	Esophageal Squamous(150;1369 2416 49071 49364)	.											.	SHMT2-91	0			c.C97G						.						92.0	77.0	82.0					12																	57624649		2203	4300	6503	SO:0001583	missense	6472	exon2			GCAGCCCAGACTC	AK223555	CCDS8934.1, CCDS53805.1, CCDS55837.1	12q12-q14	2006-03-27				ENSG00000182199	2.1.2.1		10852	protein-coding gene	gene with protein product		138450		SHMT		8999870	Standard	NM_005412		Approved		uc001snf.2	P34897		ENST00000328923.3:c.97C>G	12.37:g.57624649C>G	ENSP00000333667:p.Gln33Glu	346	0		402	161	NM_005412	0	0	4	7	3	B7Z9F1|E7EQ19|E7EU43|O00740|Q8N1A5	Missense_Mutation	SNP	ENST00000328923.3	37	CCDS8934.1	.	.	.	.	.	.	.	.	.	.	C	8.946	0.966931	0.18659	.	.	ENSG00000182199	ENST00000328923;ENST00000557487;ENST00000556689;ENST00000414700;ENST00000557703;ENST00000553529;ENST00000554310;ENST00000557427;ENST00000553474;ENST00000555773;ENST00000554975;ENST00000449049;ENST00000556737	T;T;T;T;T	0.28895	1.59;1.59;1.59;1.59;1.59	4.81	3.85	0.44370	.	0.335256	0.29537	N	0.011879	T	0.10551	0.0258	N	0.08118	0	0.80722	D	1	B;B	0.11235	0.004;0.002	B;B	0.12837	0.008;0.005	T	0.31586	-0.9938	10	0.02654	T	1	-12.6294	3.4496	0.07493	0.1727:0.5679:0.1666:0.0929	.	33;33	Q8N1A5;P34897	.;GLYM_HUMAN	E	33;33;33;12;12;12;12;12;12;12;12;12;12	ENSP00000333667:Q33E;ENSP00000452315:Q33E;ENSP00000406881:Q12E;ENSP00000452419:Q12E;ENSP00000413770:Q12E	ENSP00000333667:Q33E	Q	+	1	0	SHMT2	55910916	0.139000	0.22563	1.000000	0.80357	0.972000	0.66771	0.472000	0.22116	2.668000	0.90789	0.655000	0.94253	CAG	.		0.582	SHMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412525.2	NM_005412	
FAM216A	29902	hgsc.bcm.edu	37	12	110906786	110906786	+	Missense_Mutation	SNP	C	C	T	rs202079205	byFrequency	TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr12:110906786C>T	ENST00000377673.5	+	1	618	c.106C>T	c.(106-108)Ccg>Tcg	p.P36S	GPN3_ENST00000228827.3_5'Flank|GPN3_ENST00000537466.2_5'Flank|GPN3_ENST00000543199.1_5'Flank|GPN3_ENST00000552180.1_5'UTR	NM_013300.2	NP_037432.2	Q8WUB2	F216A_HUMAN	family with sequence similarity 216, member A	36																	TTCTGCAGAGCCGCCCGCTGT	0.771													C|||	12	0.00239617	0.0091	0.0	5008	,	,		13111	0.0		0.0	False		,,,				2504	0.0				p.P36S		.											.	.	0			c.C106T						.	C	SER/PRO	24,3054		0,24,1515	2.0	2.0	2.0		106	3.3	0.1	12		2	0,6186		0,0,3093	yes	missense	C12orf24	NM_013300.2	74	0,24,4608	TT,TC,CC		0.0,0.7797,0.2591	probably-damaging	36/274	110906786	24,9240	1539	3093	4632	SO:0001583	missense	29902	exon1			GCAGAGCCGCCCG	U79274	CCDS31899.1	12q24.11	2012-02-07	2012-02-07	2012-02-07	ENSG00000204856	ENSG00000204856			30180	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 24"""	C12orf24			Standard	NM_013300		Approved	HSU79274	uc001tqu.4	Q8WUB2	OTTHUMG00000169526	ENST00000377673.5:c.106C>T	12.37:g.110906786C>T	ENSP00000366901:p.Pro36Ser	0	0		22	15	NM_013300	0	0	1	1	0	A6NH30|Q99776	Missense_Mutation	SNP	ENST00000377673.5	37	CCDS31899.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.171608	0.78452	0.007797	0.0	ENSG00000204856	ENST00000377673;ENST00000538285	T	0.51071	0.72	4.16	3.27	0.37495	.	0.000000	0.39544	N	0.001336	T	0.32645	0.0836	L	0.56769	1.78	0.27811	N	0.942126	B;B	0.30709	0.291;0.129	B;B	0.26693	0.072;0.031	T	0.41645	-0.9497	10	0.87932	D	0	-0.6948	9.2806	0.37727	0.0:0.8974:0.0:0.1026	.	36;36	F5GZE4;Q8WUB2	.;CL024_HUMAN	S	36	ENSP00000366901:P36S	ENSP00000366901:P36S	P	+	1	0	C12orf24	109391169	0.943000	0.32029	0.132000	0.22025	0.895000	0.52256	2.944000	0.49034	1.096000	0.41439	0.462000	0.41574	CCG	.		0.771	FAM216A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404616.1	NM_013300	
TPCN1	53373	broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	113715129	113715129	+	Missense_Mutation	SNP	A	A	C			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr12:113715129A>C	ENST00000335509.6	+	12	1458	c.1144A>C	c.(1144-1146)Acc>Ccc	p.T382P	TPCN1_ENST00000541517.1_Missense_Mutation_p.T454P|TPCN1_ENST00000550785.1_Missense_Mutation_p.T454P|TPCN1_ENST00000392569.4_Missense_Mutation_p.T314P	NM_017901.4	NP_060371.2	Q9ULQ1	TPC1_HUMAN	two pore segment channel 1	382					calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|NAADP-sensitive calcium-release channel activity (GO:0072345)|voltage-gated calcium channel activity (GO:0005245)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(16)|ovary(2)|prostate(3)|skin(3)|urinary_tract(1)	40						GCGCTATCTTACCTTCAAGGC	0.577																																					p.T454P													.	TPCN1-93	0			c.A1360C						.						63.0	61.0	62.0					12																	113715129		2203	4300	6503	SO:0001583	missense	53373	exon13			TATCTTACCTTCA	AB032995	CCDS31908.1, CCDS44985.1	12q24.21	2011-07-05			ENSG00000186815	ENSG00000186815		"""Voltage-gated ion channels / Two-pore channels"""	18182	protein-coding gene	gene with protein product		609666				10574461, 10753632, 16382101	Standard	XM_005253905		Approved	KIAA1169, FLJ20612, TPC1	uc001tux.3	Q9ULQ1	OTTHUMG00000169625	ENST00000335509.6:c.1144A>C	12.37:g.113715129A>C	ENSP00000335300:p.Thr382Pro	84	1		60	19	NM_001143819	0	0	10	23	13	A7E258|Q86XS9|Q8NC20	Missense_Mutation	SNP	ENST00000335509.6	37	CCDS31908.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.30|14.30	2.494445|2.494445	0.44352|0.44352	.|.	.|.	ENSG00000186815|ENSG00000186815	ENST00000335509;ENST00000550785;ENST00000541517;ENST00000392569|ENST00000546781	D;D;D;D|.	0.97066|.	-4.12;-4.23;-4.23;-4.17|.	5.25|5.25	4.11|4.11	0.48088|0.48088	.|.	0.051926|.	0.85682|.	D|.	0.000000|.	T|T	0.56834|0.56834	0.2012|0.2012	L|L	0.47716|0.47716	1.5|1.5	0.50813|0.50813	D|D	0.999894|0.999894	D;D;D|.	0.76494|.	0.999;0.999;0.994|.	D;D;P|.	0.66196|.	0.942;0.931;0.795|.	T|T	0.52170|0.52170	-0.8611|-0.8611	10|5	0.37606|.	T|.	0.19|.	-8.6888|-8.6888	9.5973|9.5973	0.39582|0.39582	0.9198:0.0:0.0802:0.0|0.9198:0.0:0.0802:0.0	.|.	382;454;382|.	A5PKY2;Q9ULQ1-3;Q9ULQ1|.	.;.;TPC1_HUMAN|.	P|S	382;454;454;314|68	ENSP00000335300:T382P;ENSP00000448083:T454P;ENSP00000438125:T454P;ENSP00000376350:T314P|.	ENSP00000335300:T382P|.	T|Y	+|+	1|2	0|0	TPCN1|TPCN1	112199512|112199512	1.000000|1.000000	0.71417|0.71417	0.133000|0.133000	0.22050|0.22050	0.178000|0.178000	0.23041|0.23041	7.773000|7.773000	0.85462|0.85462	1.010000|1.010000	0.39314|0.39314	-0.363000|-0.363000	0.07495|0.07495	ACC|TAC	.		0.577	TPCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405156.3	NM_017901	
CLYBL	171425	hgsc.bcm.edu	37	13	100258999	100258999	+	Missense_Mutation	SNP	C	C	T	rs200020595		TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr13:100258999C>T	ENST00000376360.1	+	1	77	c.50C>T	c.(49-51)gCg>gTg	p.A17V	CLYBL_ENST00000339105.4_Missense_Mutation_p.A17V|CLYBL_ENST00000376354.1_Missense_Mutation_p.A17V|CLYBL_ENST00000376355.3_Missense_Mutation_p.A17V|CLYBL_ENST00000444838.2_Missense_Mutation_p.A17V			Q8N0X4	CLYBL_HUMAN	citrate lyase beta like	17						mitochondrion (GO:0005739)	lyase activity (GO:0016829)|metal ion binding (GO:0046872)			NS(1)|kidney(6)|large_intestine(6)|lung(10)|skin(2)	25	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					GCGGCGGCGGCGCTGCTGAGG	0.776																																					p.A17V		.											.	CLYBL-90	0			c.C50T						.						6.0	8.0	7.0					13																	100258999		1843	3595	5438	SO:0001583	missense	171425	exon1			CGGCGGCGCTGCT	AF428253	CCDS32002.1	13q32.3	2011-04-08			ENSG00000125246	ENSG00000125246			18355	protein-coding gene	gene with protein product		609686					Standard	XM_005254030		Approved	CLB	uc001vok.3	Q8N0X4	OTTHUMG00000017278	ENST00000376360.1:c.50C>T	13.37:g.100258999C>T	ENSP00000365538:p.Ala17Val	0	0		16	12	NM_206808	0	0	0	0	0	Q5W0F7|Q8TDH8	Missense_Mutation	SNP	ENST00000376360.1	37	CCDS32002.1	.	.	.	.	.	.	.	.	.	.	C	11.61	1.689931	0.29962	.	.	ENSG00000125246	ENST00000376355;ENST00000376360;ENST00000444838;ENST00000376354;ENST00000339105	T;T;T;T;T	0.24350	1.86;1.88;1.86;1.86;1.88	3.41	1.64	0.23874	.	0.599921	0.15592	N	0.254333	T	0.10766	0.0263	N	0.08118	0	0.22552	N	0.998997	B;B;B	0.15719	0.014;0.01;0.003	B;B;B	0.10450	0.002;0.005;0.001	T	0.30357	-0.9981	10	0.23302	T	0.38	.	5.6733	0.17735	0.0:0.7452:0.0:0.2548	.	17;17;17	B4DU60;Q8N0X4-2;Q8N0X4	.;.;CLYBL_HUMAN	V	17	ENSP00000365533:A17V;ENSP00000365538:A17V;ENSP00000404768:A17V;ENSP00000365532:A17V;ENSP00000342991:A17V	ENSP00000342991:A17V	A	+	2	0	CLYBL	99057000	0.995000	0.38212	1.000000	0.80357	0.521000	0.34408	0.074000	0.14662	0.436000	0.26393	0.313000	0.20887	GCG	.		0.776	CLYBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045611.1		
MYH7	4625	ucsc.edu;bcgsc.ca	37	14	23898982	23898982	+	Splice_Site	SNP	A	A	G			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr14:23898982A>G	ENST00000355349.3	-	12	1301		c.e12+1			NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta						adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		CCTGCCTCCCACCTTCAGTGC	0.502																																					.													.	MYH7-94	0			c.1138+2T>C						.						74.0	70.0	71.0					14																	23898982		2203	4300	6503	SO:0001630	splice_region_variant	4625	exon13			CCTCCCACCTTCA	M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.1138+1T>C	14.37:g.23898982A>G		40	0		41	4	NM_000257	0	0	0	0	0	A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Splice_Site	SNP	ENST00000355349.3	37	CCDS9601.1	.	.	.	.	.	.	.	.	.	.	a	19.39	3.817501	0.70912	.	.	ENSG00000092054	ENST00000355349;ENST00000544444	.	.	.	3.08	3.08	0.35506	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.4148	0.49945	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MYH7	22968822	1.000000	0.71417	0.819000	0.32651	0.554000	0.35429	5.627000	0.67784	1.262000	0.44165	0.375000	0.23000	.	.		0.502	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071798.3	NM_000257	Intron
LGALS3	3958	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	55604955	55604955	+	Missense_Mutation	SNP	C	C	T			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr14:55604955C>T	ENST00000254301.9	+	3	472	c.211C>T	c.(211-213)Ccc>Tcc	p.P71S	LGALS3_ENST00000554715.1_Missense_Mutation_p.P71S|LGALS3_ENST00000553755.1_3'UTR	NM_002306.3	NP_002297.2	P17931	LEG3_HUMAN	lectin, galactoside-binding, soluble, 3	71	8 X 9 AA tandem repeats of Y-P-G-X(3)-P- G-A.				eosinophil chemotaxis (GO:0048245)|epithelial cell differentiation (GO:0030855)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|macrophage chemotaxis (GO:0048246)|monocyte chemotaxis (GO:0002548)|mononuclear cell migration (GO:0071674)|mRNA processing (GO:0006397)|negative regulation of endocytosis (GO:0045806)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of immunological synapse formation (GO:2000521)|negative regulation of T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:2001189)|negative regulation of T cell receptor signaling pathway (GO:0050860)|neutrophil chemotaxis (GO:0030593)|positive chemotaxis (GO:0050918)|positive regulation of calcium ion import (GO:0090280)|positive regulation of mononuclear cell migration (GO:0071677)|regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902041)|regulation of T cell apoptotic process (GO:0070232)|regulation of T cell proliferation (GO:0042129)|RNA splicing (GO:0008380)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|spliceosomal complex (GO:0005681)	carbohydrate binding (GO:0030246)|chemoattractant activity (GO:0042056)|IgE binding (GO:0019863)|laminin binding (GO:0043236)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(1)|prostate(1)	3						TGGAGCTTATCCCGGAGCACC	0.682																																					p.P71S		.											.	LGALS3-514	0			c.C211T						.						21.0	24.0	23.0					14																	55604955		1813	4069	5882	SO:0001583	missense	3958	exon3			GCTTATCCCGGAG	M64303	CCDS41956.1	14q22.3	2014-03-19	2007-02-01		ENSG00000131981	ENSG00000131981		"""Lectins, galactoside-binding"", ""Endogenous ligands"""	6563	protein-coding gene	gene with protein product	"""galectin 3"""	153619		LGALS2		2009535, 8063692	Standard	NR_003225		Approved	MAC-2, GALIG	uc001xbr.3	P17931	OTTHUMG00000171030	ENST00000254301.9:c.211C>T	14.37:g.55604955C>T	ENSP00000254301:p.Pro71Ser	61	0		78	29	NM_002306	0	0	95	130	35	B2RC38|Q16005|Q6IBA7|Q96J47	Missense_Mutation	SNP	ENST00000254301.9	37	CCDS41956.1	.	.	.	.	.	.	.	.	.	.	C	7.633	0.679349	0.14907	.	.	ENSG00000131981	ENST00000553493;ENST00000254301;ENST00000554715	T;T;T	0.74315	-0.83;3.24;2.45	5.35	4.45	0.53987	.	0.209237	0.50627	N	0.000111	T	0.77751	0.4177	M	0.86178	2.8	0.45662	D	0.998582	B	0.11235	0.004	B	0.16722	0.016	T	0.73830	-0.3859	10	0.62326	D	0.03	.	14.3618	0.66776	0.0:0.921:0.0:0.079	.	71	P17931	LEG3_HUMAN	S	71	ENSP00000451526:P71S;ENSP00000254301:P71S;ENSP00000451381:P71S	ENSP00000254301:P71S	P	+	1	0	LGALS3	54674708	0.991000	0.36638	0.823000	0.32752	0.087000	0.18053	2.632000	0.46511	0.647000	0.30713	-0.797000	0.03246	CCC	.		0.682	LGALS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411309.1	NM_002306	
ZFYVE26	23503	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	68268851	68268851	+	Silent	SNP	G	G	T			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr14:68268851G>T	ENST00000347230.4	-	10	1722	c.1584C>A	c.(1582-1584)ctC>ctA	p.L528L	ZFYVE26_ENST00000555452.1_Silent_p.L528L	NM_015346.3	NP_056161.2	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	528					cell death (GO:0008219)|cytokinesis (GO:0000910)|double-strand break repair via homologous recombination (GO:0000724)	centrosome (GO:0005813)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(8)|lung(39)|ovary(12)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	94				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		GGTCCTCAGAGAGGCTGTCTT	0.537																																					p.L528L		.											.	ZFYVE26-162	0			c.C1584A						.						139.0	126.0	130.0					14																	68268851		2203	4300	6503	SO:0001819	synonymous_variant	23503	exon10			CTCAGAGAGGCTG	AB002319	CCDS9788.1	14q23.3	2012-11-23				ENSG00000072121		"""Zinc fingers, FYVE domain containing"""	20761	protein-coding gene	gene with protein product	"""spastizin"", ""FYVE-CENT"""	612012	"""spastic paraplegia 15 (complicated, autosomal recessive)"""	SPG15		9205841, 18394578	Standard	NM_015346		Approved	KIAA0321	uc001xka.2	Q68DK2		ENST00000347230.4:c.1584C>A	14.37:g.68268851G>T		128	0		188	71	NM_015346	0	0	0	0	0	B1B5Y3|B4E2U3|O15035|Q68DT9|Q6AW90|Q6ZR50|Q7Z3A4|Q7Z3I1|Q8N4W7	Silent	SNP	ENST00000347230.4	37	CCDS9788.1																																																																																			.		0.537	ZFYVE26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412736.2	NM_015346	
GPR65	8477	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	88478074	88478074	+	Missense_Mutation	SNP	G	G	A			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr14:88478074G>A	ENST00000267549.3	+	2	1441	c.883G>A	c.(883-885)Gaa>Aaa	p.E295K	RP11-300J18.2_ENST00000554433.1_RNA	NM_003608.3	NP_003599.2	Q8IYL9	PSYR_HUMAN	G protein-coupled receptor 65	295					actin cytoskeleton reorganization (GO:0031532)|activation of Rho GTPase activity (GO:0032862)|apoptotic process (GO:0006915)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|multicellular organismal development (GO:0007275)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of stress fiber assembly (GO:0051496)|response to acidic pH (GO:0010447)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|prostate(1)	16						TTTTGTAACCGAAACAGGAAG	0.353																																					p.E295K		.											.	GPR65-90	0			c.G883A						.						95.0	90.0	91.0					14																	88478074		2203	4300	6503	SO:0001583	missense	8477	exon2			GTAACCGAAACAG	U95218	CCDS9879.1	14q31-q32.1	2012-08-21			ENSG00000140030	ENSG00000140030		"""GPCR / Class A : Orphans"""	4517	protein-coding gene	gene with protein product		604620				9655242	Standard	NM_003608		Approved	hTDAG8, TDAG8	uc001xvv.3	Q8IYL9	OTTHUMG00000028648	ENST00000267549.3:c.883G>A	14.37:g.88478074G>A	ENSP00000267549:p.Glu295Lys	204	0		185	10	NM_003608	0	0	13	13	0	O75819	Missense_Mutation	SNP	ENST00000267549.3	37	CCDS9879.1	.	.	.	.	.	.	.	.	.	.	G	31	5.063367	0.93898	.	.	ENSG00000140030	ENST00000267549	T	0.30714	1.52	5.98	5.98	0.97165	.	0.000000	0.56097	D	0.000037	T	0.33556	0.0867	N	0.08118	0	0.44417	D	0.99733	D	0.71674	0.998	P	0.58820	0.846	T	0.20009	-1.0288	10	0.29301	T	0.29	.	20.4581	0.99154	0.0:0.0:1.0:0.0	.	295	Q8IYL9	PSYR_HUMAN	K	295	ENSP00000267549:E295K	ENSP00000267549:E295K	E	+	1	0	GPR65	87547827	1.000000	0.71417	0.654000	0.29608	0.919000	0.55068	6.201000	0.72124	2.835000	0.97688	0.650000	0.86243	GAA	.		0.353	GPR65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071564.4		
PPP4R4	57718	broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	94733352	94733352	+	Missense_Mutation	SNP	T	T	A			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr14:94733352T>A	ENST00000304338.3	+	23	2589	c.2435T>A	c.(2434-2436)gTg>gAg	p.V812E		NM_058237.1	NP_478144.1	Q6NUP7	PP4R4_HUMAN	protein phosphatase 4, regulatory subunit 4	812					negative regulation of phosphoprotein phosphatase activity (GO:0032515)|regulation of protein serine/threonine phosphatase activity (GO:0080163)	cytoplasm (GO:0005737)|protein serine/threonine phosphatase complex (GO:0008287)	protein phosphatase regulator activity (GO:0019888)			NS(1)|breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(15)|lung(10)|skin(7)|upper_aerodigestive_tract(2)	40						AAGACTTCTGTGCTTTCACTA	0.299																																					p.V812E													.	PPP4R4-94	0			c.T2435A						.						80.0	78.0	79.0					14																	94733352		2202	4295	6497	SO:0001583	missense	57718	exon23			CTTCTGTGCTTTC	AB046842, BC068491	CCDS9921.1, CCDS9922.1	14q32.2	2014-07-18	2008-09-16	2008-09-16	ENSG00000119698	ENSG00000119698		"""Serine/threonine phosphatases / Protein phosphatase 4, regulatory subunits"""	23788	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 14"""		"""KIAA1622"""	KIAA1622		18715871	Standard	NM_020958		Approved	PP4R4, CFAP14	uc001ycs.1	Q6NUP7		ENST00000304338.3:c.2435T>A	14.37:g.94733352T>A	ENSP00000305924:p.Val812Glu	52	1		63	20	NM_058237	0	0	0	0	0	Q9BUF8|Q9HCF0	Missense_Mutation	SNP	ENST00000304338.3	37	CCDS9921.1	.	.	.	.	.	.	.	.	.	.	T	10.60	1.395792	0.25205	.	.	ENSG00000119698	ENST00000304338	.	.	.	5.83	4.69	0.59074	.	1.582440	0.03220	N	0.177378	T	0.44871	0.1314	N	0.08118	0	0.80722	D	1	B	0.26258	0.145	B	0.29942	0.109	T	0.23583	-1.0184	9	0.59425	D	0.04	0.0344	9.9904	0.41868	0.0:0.076:0.0:0.924	.	812	Q6NUP7	PP4R4_HUMAN	E	812	.	ENSP00000305924:V812E	V	+	2	0	PPP4R4	93803105	0.906000	0.30813	0.249000	0.24280	0.367000	0.29736	3.233000	0.51311	2.225000	0.72522	0.383000	0.25322	GTG	.		0.299	PPP4R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413056.1	NM_058237	
CEP170B	283638	hgsc.bcm.edu	37	14	105350539	105350539	+	Missense_Mutation	SNP	C	C	T	rs373443985		TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr14:105350539C>T	ENST00000414716.3	+	9	1651	c.1423C>T	c.(1423-1425)Cgg>Tgg	p.R475W	CEP170B_ENST00000418279.1_Missense_Mutation_p.R405W|CEP170B_ENST00000453495.1_Missense_Mutation_p.R476W|CEP170B_ENST00000556508.1_Missense_Mutation_p.R405W	NM_001112726.2	NP_001106197.1	Q9Y4F5	C170B_HUMAN	centrosomal protein 170B	475						cytoplasm (GO:0005737)|microtubule (GO:0005874)											GACAGAGGAACGGCTGGGCAG	0.736																																					p.R475W		.											.	.	0			c.C1423T						.	C	TRP/ARG,TRP/ARG	2,3338		0,2,1668	4.0	7.0	6.0		1423,1213	4.1	1.0	14		6	1,7387		0,1,3693	no	missense,missense	KIAA0284	NM_001112726.2,NM_015005.2	101,101	0,3,5361	TT,TC,CC		0.0135,0.0599,0.028	probably-damaging,probably-damaging	475/1555,405/1520	105350539	3,10725	1670	3694	5364	SO:0001583	missense	283638	exon9			GAGGAACGGCTGG	AB006622	CCDS45175.1, CCDS45176.1, CCDS45176.2	14q32.33	2014-02-20	2012-11-30	2012-11-30	ENSG00000099814	ENSG00000099814			20362	protein-coding gene	gene with protein product	"""Cep170-related"""		"""KIAA0284"""	KIAA0284		23087211	Standard	NM_015005		Approved	FAM68C, Cep170R	uc010axb.4	Q9Y4F5	OTTHUMG00000170763	ENST00000414716.3:c.1423C>T	14.37:g.105350539C>T	ENSP00000404151:p.Arg475Trp	0	0		8	4	NM_001112726	0	0	2	5	3	Q2KHR7|Q86TI7	Missense_Mutation	SNP	ENST00000414716.3	37	CCDS45175.1	.	.	.	.	.	.	.	.	.	.	C	18.77	3.695399	0.68386	5.99E-4	1.35E-4	ENSG00000099814	ENST00000556508;ENST00000414716;ENST00000453495;ENST00000418279	T;T;T;T	0.51574	0.71;0.7;0.71;0.71	4.09	4.09	0.47781	.	0.577739	0.16725	N	0.202119	T	0.61751	0.2372	L	0.49350	1.555	0.52501	D	0.999953	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.995;0.989	T	0.62845	-0.6768	10	0.62326	D	0.03	-12.0906	12.3112	0.54929	0.1701:0.8299:0.0:0.0	.	475;475;405	Q9Y4F5-2;Q9Y4F5;E9PFC1	.;K0284_HUMAN;.	W	405;475;476;405	ENSP00000451249:R405W;ENSP00000404151:R475W;ENSP00000407238:R476W;ENSP00000415006:R405W	ENSP00000404151:R475W	R	+	1	2	KIAA0284	104421584	0.739000	0.28196	0.982000	0.44146	0.376000	0.30014	1.841000	0.39240	1.813000	0.52934	0.313000	0.20887	CGG	.		0.736	CEP170B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000410289.2	NM_001112726	
NPAP1	23742	hgsc.bcm.edu	37	15	24923447	24923447	+	Silent	SNP	T	T	A			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr15:24923447T>A	ENST00000329468.2	+	1	2907	c.2433T>A	c.(2431-2433)tcT>tcA	p.S811S		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	811					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)											GCAGTGCCTCTGCAGCATCGT	0.522																																					p.S811S		.											.	.	0			c.T2433A						.						138.0	133.0	135.0					15																	24923447		2203	4300	6503	SO:0001819	synonymous_variant	23742	exon1			TGCCTCTGCAGCA	AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.2433T>A	15.37:g.24923447T>A		50	0		69	4	NM_018958	0	0	0	0	0		Silent	SNP	ENST00000329468.2	37	CCDS10015.1																																																																																			.		0.522	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251253.1	NM_018958	
OTUD7A	161725	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	31818596	31818596	+	Silent	SNP	G	G	A			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr15:31818596G>A	ENST00000307050.4	-	6	920	c.828C>T	c.(826-828)agC>agT	p.S276S	OTUD7A_ENST00000382902.1_Silent_p.S283S	NM_130901.1	NP_570971.1	Q8TE49	OTU7A_HUMAN	OTU deubiquitinase 7A	276	Catalytic. {ECO:0000250}.|OTU. {ECO:0000255|PROSITE- ProRule:PRU00139}.|TRAF-binding. {ECO:0000250}.				protein K11-linked deubiquitination (GO:0035871)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			endometrium(7)|large_intestine(4)|lung(11)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	30		all_lung(180;1.6e-09)		all cancers(64;2.44e-19)|Epithelial(43;6.82e-14)|GBM - Glioblastoma multiforme(186;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00189)|Lung(196;0.208)		TGCGCGGCTCGCTGGAGGCCA	0.677																																					p.S276S		.											.	OTUD7A-502	0			c.C828T						.						37.0	34.0	35.0					15																	31818596		2202	4300	6502	SO:0001819	synonymous_variant	161725	exon6			CGGCTCGCTGGAG	AJ430383	CCDS10026.1	15q13.1	2014-02-24	2014-02-24	2006-07-07	ENSG00000169918	ENSG00000169918		"""OTU domain containing"""	20718	protein-coding gene	gene with protein product		612024	"""chromosome 15 open reading frame 16"", ""OTU domain containing 7"", ""OTU domain containing 7A"""	C15orf16, OTUD7		23827681	Standard	NM_130901		Approved	CEZANNE2	uc001zfq.3	Q8TE49	OTTHUMG00000129275	ENST00000307050.4:c.828C>T	15.37:g.31818596G>A		25	0		22	5	NM_130901	0	0	0	0	0	Q8IWK5	Silent	SNP	ENST00000307050.4	37	CCDS10026.1																																																																																			.		0.677	OTUD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251393.2	NM_130901	
C15orf53	400359	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	38988831	38988831	+	Missense_Mutation	SNP	A	A	C			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr15:38988831A>C	ENST00000318792.1	+	1	33	c.23A>C	c.(22-24)gAg>gCg	p.E8A		NM_207444.2	NP_997327.1	Q8NAA6	CO053_HUMAN	chromosome 15 open reading frame 53	8										endometrium(1)|large_intestine(1)|lung(2)|skin(1)|stomach(1)	6		all_cancers(109;1.75e-13)|all_epithelial(112;1.02e-11)|Lung NSC(122;1.9e-09)|all_lung(180;4.04e-08)|Melanoma(134;0.091)|Colorectal(260;0.198)		GBM - Glioblastoma multiforme(113;8.39e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0321)		GGGGCCCAAGAGGACCTGGGC	0.562																																					p.E8A		.											.	C15orf53-492	0			c.A23C						.						96.0	91.0	93.0					15																	38988831		2200	4297	6497	SO:0001583	missense	400359	exon1			CCCAAGAGGACCT		CCDS10048.1	15q14	2007-11-21			ENSG00000175779	ENSG00000175779			33796	protein-coding gene	gene with protein product							Standard	NM_207444		Approved	FLJ35695	uc001zkf.1	Q8NAA6	OTTHUMG00000129841	ENST00000318792.1:c.23A>C	15.37:g.38988831A>C	ENSP00000325144:p.Glu8Ala	134	0		159	46	NM_207444	0	0	0	0	0		Missense_Mutation	SNP	ENST00000318792.1	37	CCDS10048.1	.	.	.	.	.	.	.	.	.	.	A	9.365	1.069014	0.20147	.	.	ENSG00000175779	ENST00000318792	T	0.34667	1.35	3.31	-1.66	0.08265	.	.	.	.	.	T	0.23330	0.0564	N	0.08118	0	0.09310	N	1	D	0.54207	0.965	P	0.52554	0.702	T	0.12477	-1.0546	9	0.87932	D	0	.	3.0108	0.06044	0.4664:0.0:0.3378:0.1958	.	8	Q8NAA6	CO053_HUMAN	A	8	ENSP00000325144:E8A	ENSP00000325144:E8A	E	+	2	0	C15orf53	36776123	0.001000	0.12720	0.000000	0.03702	0.074000	0.17049	0.566000	0.23593	-0.349000	0.08274	-0.415000	0.06103	GAG	.		0.562	C15orf53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252081.1	NM_207444	
DUOX1	53905	broad.mit.edu	37	15	45427438	45427438	+	Silent	SNP	A	A	G			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr15:45427438A>G	ENST00000321429.4	+	6	851	c.444A>G	c.(442-444)agA>agG	p.R148R	DUOX1_ENST00000389037.3_Silent_p.R148R	NM_017434.3	NP_059130.2	Q9NRD9	DUOX1_HUMAN	dual oxidase 1	148	Peroxidase-like; mediates peroxidase activity.				cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide biosynthetic process (GO:0050665)|hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|superoxide anion generation (GO:0042554)|thyroid hormone generation (GO:0006590)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|NADP binding (GO:0050661)|peroxidase activity (GO:0004601)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|lung(16)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)	57		all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;5.77e-18)|GBM - Glioblastoma multiforme(94;5.11e-07)|COAD - Colon adenocarcinoma(120;0.071)|Colorectal(133;0.0717)		CCTTCCAGAGAAGCCGCTGGG	0.721																																					p.R148R													.	DUOX1-142	0			c.A444G						.						16.0	19.0	18.0					15																	45427438		2191	4286	6477	SO:0001819	synonymous_variant	53905	exon6			CCAGAGAAGCCGC	AF213465	CCDS32221.1	15q21	2013-01-10				ENSG00000137857		"""EF-hand domain containing"""	3062	protein-coding gene	gene with protein product	"""NADPH thyroid oxidase 1"", ""flavoprotein NADPH oxidase"", ""nicotinamide adenine dinucleotide phosphate oxidase"""	606758				10806195	Standard	XM_005254463		Approved	NOXEF1, THOX1, LNOX1	uc001zut.1	Q9NRD9		ENST00000321429.4:c.444A>G	15.37:g.45427438A>G		78	3		178	9	NM_017434	0	0	0	0	0	A6NH28|Q14C94|Q6ZMB3|Q6ZR09|Q9NZC1	Silent	SNP	ENST00000321429.4	37	CCDS32221.1																																																																																			.		0.721	DUOX1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416251.1	NM_017434	
SLCO3A1	28232	broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	92647568	92647568	+	Missense_Mutation	SNP	C	C	A			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr15:92647568C>A	ENST00000318445.6	+	4	1019	c.805C>A	c.(805-807)Ctg>Atg	p.L269M	SLCO3A1_ENST00000424469.2_Missense_Mutation_p.L269M|SLCO3A1_ENST00000555549.1_3'UTR	NM_013272.3	NP_037404.2	Q9UIG8	SO3A1_HUMAN	solute carrier organic anion transporter family, member 3A1	269					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(6)|pancreas(1)|prostate(1)|skin(2)	25	Lung NSC(78;0.0158)|all_lung(78;0.0255)		BRCA - Breast invasive adenocarcinoma(143;0.0841)		Alprostadil(DB00770)|Aminohippurate(DB00345)|Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Iloprost(DB01088)|Methotrexate(DB00563)	GGGTGGCTTTCTGCTCTGCGG	0.577																																					p.L269M													.	SLCO3A1-91	0			c.C805A						.						226.0	203.0	211.0					15																	92647568		2198	4298	6496	SO:0001583	missense	28232	exon4			GGCTTTCTGCTCT	AB031050	CCDS10371.1, CCDS45354.1	15q26	2013-05-22	2003-11-25	2003-11-26	ENSG00000176463	ENSG00000176463		"""Solute carriers"""	10952	protein-coding gene	gene with protein product		612435	"""solute carrier family 21 (organic anion transporter), member 11"""	SLC21A11			Standard	NM_001145044		Approved	OATP-D, OATP3A1	uc002bqx.2	Q9UIG8	OTTHUMG00000149846	ENST00000318445.6:c.805C>A	15.37:g.92647568C>A	ENSP00000320634:p.Leu269Met	66	1		82	26	NM_013272	0	0	1	1	0	A8K4A7|B3KPY5|B3KUR7|C6G486|Q9BW73|Q9GZV2	Missense_Mutation	SNP	ENST00000318445.6	37	CCDS10371.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.091915	0.76756	.	.	ENSG00000176463	ENST00000318445;ENST00000424469;ENST00000556649	T;T	0.56444	0.46;0.46	5.12	5.12	0.69794	Major facilitator superfamily domain, general substrate transporter (1);	0.076624	0.53938	D	0.000045	T	0.69904	0.3163	M	0.71920	2.185	0.80722	D	1	P;D;D	0.76494	0.928;0.963;0.999	P;P;D	0.77004	0.668;0.715;0.989	T	0.72903	-0.4151	10	0.66056	D	0.02	.	12.9394	0.58333	0.0:0.9216:0.0:0.0784	.	211;269;269	Q9UIG8-3;Q9UIG8-2;Q9UIG8	.;.;SO3A1_HUMAN	M	269;269;62	ENSP00000320634:L269M;ENSP00000387846:L269M	ENSP00000320634:L269M	L	+	1	2	SLCO3A1	90448572	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.517000	0.53443	2.353000	0.79882	0.655000	0.94253	CTG	.		0.577	SLCO3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313529.1	NM_013272	
WDR90	197335	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	707787	707787	+	Silent	SNP	C	C	T			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr16:707787C>T	ENST00000293879.4	+	21	2499	c.2499C>T	c.(2497-2499)ccC>ccT	p.P833P	WDR90_ENST00000549091.1_Silent_p.P833P|LA16c-349E10.1_ENST00000573609.1_RNA			Q96KV7	WDR90_HUMAN	WD repeat domain 90	833										endometrium(4)|kidney(3)|large_intestine(2)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	37		Hepatocellular(780;0.0218)				CGGATGCCCCCGCGAGCCCCA	0.726																																					p.P833P		.											.	WDR90-92	0			c.C2499T						.						8.0	11.0	10.0					16																	707787		1929	4048	5977	SO:0001819	synonymous_variant	197335	exon21			TGCCCCCGCGAGC	AB067511	CCDS42092.1	16p13.3	2013-01-09			ENSG00000161996	ENSG00000161996		"""WD repeat domain containing"""	26960	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 17"", ""chromosome 16 open reading frame 15"", ""chromosome 16 open reading frame 16"", ""chromosome 16 open reading frame 19"", ""chromosome 16 open reading frame 18"""	C16orf17, C16orf15, C16orf16, C16orf19, C16orf18		11572484, 11157797	Standard	XM_005255160		Approved	FLJ36483, KIAA1924	uc002cii.1	Q96KV7	OTTHUMG00000048040	ENST00000293879.4:c.2499C>T	16.37:g.707787C>T		35	0		281	89	NM_145294	0	0	3	3	0	Q0VA87|Q0VA88|Q6P048|Q6ZMS1|Q6ZTH1|Q8N202|Q8N221|Q8NBB8|Q96PW4|Q96S18	Silent	SNP	ENST00000293879.4	37	CCDS42092.1																																																																																			.		0.726	WDR90-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000404335.1	NM_145294	
VASN	114990	hgsc.bcm.edu	37	16	4432672	4432672	+	Silent	SNP	T	T	C	rs370088997	byFrequency	TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr16:4432672T>C	ENST00000304735.3	+	2	1949	c.1794T>C	c.(1792-1794)tgT>tgC	p.C598C	CORO7_ENST00000423908.2_Intron|CORO7_ENST00000251166.4_Intron|CORO7_ENST00000539968.1_Intron|CORO7-PAM16_ENST00000572467.1_Intron|CORO7_ENST00000574025.1_Intron|CORO7_ENST00000537233.2_Intron	NM_138440.2	NP_612449.2	Q6EMK4	VASN_HUMAN	vasorin	598					cellular response to hypoxia (GO:0071456)|cellular response to redox state (GO:0071461)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	transforming growth factor beta binding (GO:0050431)			breast(1)|lung(3)|prostate(1)|skin(1)	6						CAGCCTACTGTGTGCGGCGGG	0.741													T|||	5	0.000998403	0.0038	0.0	5008	,	,		13454	0.0		0.0	False		,,,				2504	0.0				p.C598C		.											.	VASN-68	0			c.T1794C						.	T	,,,,	8,3802		0,8,1897	4.0	7.0	6.0		,,,,1794	-1.7	1.0	16		6	0,7642		0,0,3821	no	intron,intron,intron,intron,coding-synonymous	CORO7,VASN,CORO7-PAM16	NM_001201472.1,NM_001201473.1,NM_001201479.1,NM_024535.4,NM_138440.2	,,,,	0,8,5718	CC,CT,TT		0.0,0.21,0.0699	,,,,	,,,,598/674	4432672	8,11444	1905	3821	5726	SO:0001819	synonymous_variant	114990	exon2			CTACTGTGTGCGG	AY358299	CCDS10514.1	16p13.3	2008-02-05	2006-03-30	2006-03-30	ENSG00000168140	ENSG00000168140			18517	protein-coding gene	gene with protein product		608843	"""slit-like 2 (Drosophila)"""	SLITL2		15247411	Standard	NM_138440		Approved		uc002cwj.1	Q6EMK4	OTTHUMG00000129469	ENST00000304735.3:c.1794T>C	16.37:g.4432672T>C		2	0		19	4	NM_138440	0	0	17	30	13	Q6UXL4|Q6UXL5|Q96CX1	Silent	SNP	ENST00000304735.3	37	CCDS10514.1																																																																																			.		0.741	VASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251632.1	NM_138440	
ITGAD	3681	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	31414951	31414951	+	Missense_Mutation	SNP	G	G	A			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr16:31414951G>A	ENST00000389202.2	+	7	738	c.689G>A	c.(688-690)gGc>gAc	p.G230D	RP11-120K18.2_ENST00000567545.1_RNA	NM_005353.2	NP_005344.2	Q13349	ITAD_HUMAN	integrin, alpha D	230	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				activated T cell proliferation (GO:0050798)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|integrin-mediated signaling pathway (GO:0007229)	cell surface (GO:0009986)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(2)|lung(43)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						ACGGCCACGGGCATCCTGACA	0.607																																					p.G230D		.											.	ITGAD-226	0			c.G689A						.						96.0	78.0	84.0					16																	31414951		2197	4300	6497	SO:0001583	missense	3681	exon7			CCACGGGCATCCT	U40274	CCDS32438.1	16p13.1-p11	2010-03-23				ENSG00000156886		"""CD molecules"", ""Integrins"""	6146	protein-coding gene	gene with protein product		602453				8666289, 9598326	Standard	NM_005353		Approved	CD11d, ADB2	uc002ebv.1	Q13349		ENST00000389202.2:c.689G>A	16.37:g.31414951G>A	ENSP00000373854:p.Gly230Asp	143	0		157	59	NM_005353	0	0	1	1	0	Q15575|Q15576	Missense_Mutation	SNP	ENST00000389202.2	37	CCDS32438.1	.	.	.	.	.	.	.	.	.	.	G	19.35	3.810704	0.70797	.	.	ENSG00000156886	ENST00000316569;ENST00000444228;ENST00000389202	D	0.86030	-2.06	4.7	3.7	0.42460	von Willebrand factor, type A (3);	.	.	.	.	D	0.92492	0.7616	M	0.86864	2.845	0.34300	D	0.684244	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.996;0.996	D	0.94979	0.8124	9	0.87932	D	0	.	12.6978	0.57014	0.0:0.1801:0.8199:0.0	.	230;246;230	B7Z6V7;Q59H14;Q13349	.;.;ITAD_HUMAN	D	94;246;230	ENSP00000373854:G230D	ENSP00000323325:G94D	G	+	2	0	ITGAD	31322452	1.000000	0.71417	0.706000	0.30403	0.134000	0.20937	1.683000	0.37638	2.434000	0.82447	0.508000	0.49915	GGC	.		0.607	ITGAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432836.1	NM_005353	
ARMC5	79798	hgsc.bcm.edu	37	16	31475859	31475859	+	Silent	SNP	C	C	T	rs115663676	byFrequency	TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr16:31475859C>T	ENST00000563544.1	+	5	2061	c.1515C>T	c.(1513-1515)cgC>cgT	p.R505R	ARMC5_ENST00000538189.1_Silent_p.R537R|ARMC5_ENST00000412665.2_Silent_p.R149R|ARMC5_ENST00000457010.2_Silent_p.R505R|ARMC5_ENST00000268314.4_Silent_p.R505R|ARMC5_ENST00000408912.3_Silent_p.R600R			Q96C12	ARMC5_HUMAN	armadillo repeat containing 5	505										central_nervous_system(1)|endometrium(4)|large_intestine(3)|liver(2)|lung(12)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	28						GCACCCAACGCACTCCGGGCC	0.741													C|||	36	0.0071885	0.025	0.0043	5008	,	,		9106	0.0		0.0	False		,,,				2504	0.0				p.R505R		.											.	ARMC5-24	0			c.C1515T						.	C	,	68,3728		0,68,1830	6.0	8.0	8.0		1515,1515	2.7	0.5	16	dbSNP_132	8	1,7875		0,1,3937	no	coding-synonymous,coding-synonymous	ARMC5	NM_001105247.1,NM_024742.2	,	0,69,5767	TT,TC,CC		0.0127,1.7914,0.5912	,	505/936,505/726	31475859	69,11603	1898	3938	5836	SO:0001819	synonymous_variant	79798	exon4			CCAACGCACTCCG	AY217348	CCDS42155.1, CCDS45472.1, CCDS73874.1	16p11	2013-02-14			ENSG00000140691	ENSG00000140691		"""Armadillo repeat containing"""	25781	protein-coding gene	gene with protein product		615549					Standard	NM_024742		Approved	FLJ13063	uc002ecc.3	Q96C12	OTTHUMG00000176618	ENST00000563544.1:c.1515C>T	16.37:g.31475859C>T		0	0		13	12	NM_024742	1	0	0	5	4	Q86WM9|Q9H7P8|Q9H925	Silent	SNP	ENST00000563544.1	37	CCDS45472.1																																																																																			C|0.992;T|0.008		0.741	ARMC5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432847.1	NM_024742	
PHKB	5257	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	47622955	47622955	+	Missense_Mutation	SNP	G	G	A			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr16:47622955G>A	ENST00000323584.5	+	10	1034	c.1010G>A	c.(1009-1011)gGg>gAg	p.G337E	PHKB_ENST00000299167.8_Missense_Mutation_p.G337E|PHKB_ENST00000455779.1_Missense_Mutation_p.G330E|PHKB_ENST00000567402.1_3'UTR|PHKB_ENST00000566044.1_Missense_Mutation_p.G330E	NM_000293.2	NP_000284.1	Q93100	KPBB_HUMAN	phosphorylase kinase, beta	337					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|liver(1)|lung(18)|ovary(1)|skin(1)	41		all_cancers(37;0.00447)|all_lung(18;0.00616)|Lung NSC(13;0.0418)|Breast(268;0.203)				TTGAGAGATGGGTATAGAACA	0.353																																					p.G337E		.											.	PHKB-154	0			c.G1010A						.						70.0	74.0	73.0					16																	47622955		2201	4300	6501	SO:0001583	missense	5257	exon10			GAGATGGGTATAG		CCDS10729.1, CCDS42161.1	16q12-q13	2009-07-10			ENSG00000102893	ENSG00000102893	2.7.11.19		8927	protein-coding gene	gene with protein product		172490					Standard	NM_000293		Approved		uc002eev.4	Q93100	OTTHUMG00000133102	ENST00000323584.5:c.1010G>A	16.37:g.47622955G>A	ENSP00000313504:p.Gly337Glu	69	0		107	27	NM_000293	0	0	2	4	2	Q8N4T5	Missense_Mutation	SNP	ENST00000323584.5	37	CCDS10729.1	.	.	.	.	.	.	.	.	.	.	G	31	5.099043	0.94197	.	.	ENSG00000102893	ENST00000299167;ENST00000455779;ENST00000323584	D;D	0.91792	-2.91;-2.91	5.83	5.83	0.93111	Six-hairpin glycosidase-like (1);Glycoside hydrolase 15-related (1);	0.000000	0.85682	D	0.000000	D	0.97232	0.9095	M	0.92923	3.36	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.79108	0.992;0.918	D	0.97532	1.0080	10	0.87932	D	0	-10.5585	20.127	0.97984	0.0:0.0:1.0:0.0	.	337;330	Q93100;Q93100-4	KPBB_HUMAN;.	E	330;330;337	ENSP00000414345:G330E;ENSP00000313504:G337E	ENSP00000299167:G330E	G	+	2	0	PHKB	46180456	1.000000	0.71417	0.964000	0.40570	0.946000	0.59487	9.717000	0.98755	2.775000	0.95449	0.585000	0.79938	GGG	.		0.353	PHKB-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000430413.1		
RBL2	5934	broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	53514563	53514563	+	Missense_Mutation	SNP	G	G	A			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr16:53514563G>A	ENST00000262133.6	+	20	3103	c.2966G>A	c.(2965-2967)cGc>cAc	p.R989H	RBL2_ENST00000379935.4_3'UTR|RBL2_ENST00000544545.1_Intron	NM_005611.3	NP_005602.3	Q08999	RBL2_HUMAN	retinoblastoma-like 2	989	Domain B.|Pocket; binds E1A.				chromatin modification (GO:0016568)|mitotic cell cycle (GO:0000278)|regulation of cell cycle (GO:0051726)|regulation of lipid kinase activity (GO:0043550)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)			breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(17)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						ACACCTACTCGCCTCACAGGT	0.517																																					p.R989H													.	RBL2-841	0			c.G2966A						.						132.0	113.0	119.0					16																	53514563		2198	4300	6498	SO:0001583	missense	5934	exon20			CTACTCGCCTCAC	X74594	CCDS10748.1	16q12.2	2014-03-11	2014-03-11		ENSG00000103479	ENSG00000103479			9894	protein-coding gene	gene with protein product		180203				8361765, 8643454	Standard	NM_005611		Approved	Rb2, p130	uc002ehi.4	Q08999	OTTHUMG00000133198	ENST00000262133.6:c.2966G>A	16.37:g.53514563G>A	ENSP00000262133:p.Arg989His	229	1		289	72	NM_005611	0	0	12	18	6	B7Z913|Q15073|Q16084|Q8NE70|Q92812	Missense_Mutation	SNP	ENST00000262133.6	37	CCDS10748.1	.	.	.	.	.	.	.	.	.	.	G	18.03	3.533269	0.64972	.	.	ENSG00000103479	ENST00000262133;ENST00000379935	D	0.90069	-2.61	5.67	3.48	0.39840	Retinoblastoma-associated protein, B-box (1);Cyclin-like (1);	0.232291	0.42548	N	0.000684	D	0.90841	0.7123	L	0.50333	1.59	0.49798	D	0.999827	D;D	0.76494	0.999;0.998	D;P	0.66351	0.943;0.905	D	0.88546	0.3113	10	0.41790	T	0.15	-4.2222	10.6092	0.45412	0.1771:0.0:0.8229:0.0	.	699;989	E9PG04;Q08999	.;RBL2_HUMAN	H	989;699	ENSP00000262133:R989H	ENSP00000262133:R989H	R	+	2	0	RBL2	52072064	0.993000	0.37304	0.216000	0.23742	0.932000	0.56968	2.600000	0.46240	0.564000	0.29238	0.650000	0.86243	CGC	.		0.517	RBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256908.3	NM_005611	
PIEZO1	9780	hgsc.bcm.edu	37	16	88800408	88800408	+	Missense_Mutation	SNP	C	C	A			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr16:88800408C>A	ENST00000301015.9	-	17	2481	c.2235G>T	c.(2233-2235)caG>caT	p.Q745H	RP5-1142A6.2_ENST00000567968.1_RNA|RP5-1142A6.2_ENST00000440406.2_RNA	NM_001142864.2	NP_001136336.2	Q92508	PIEZ1_HUMAN	piezo-type mechanosensitive ion channel component 1	745					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of mechanical stimulus (GO:0050982)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|positive regulation of integrin activation (GO:0033625)|regulation of membrane potential (GO:0042391)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|prostate(2)|skin(1)	10						gctgctgctgctgatgctcct	0.662																																					p.Q745H		.											.	.	0			c.G2235T						.						8.0	11.0	10.0					16																	88800408		687	1580	2267	SO:0001583	missense	9780	exon17			CTGCTGCTGATGC	D87071	CCDS54058.1	16q24.3	2011-08-31	2011-08-31	2011-08-31	ENSG00000103335	ENSG00000103335			28993	protein-coding gene	gene with protein product		611184	"""family with sequence similarity 38, member A"""	FAM38A		20813920, 21056836, 21299953, 21696149	Standard	NM_001142864		Approved	KIAA0233	uc010vpb.2	Q92508	OTTHUMG00000156776	ENST00000301015.9:c.2235G>T	16.37:g.88800408C>A	ENSP00000301015:p.Gln745His	88	0		159	16	NM_001142864	0	0	0	0	0	A6NHT9|A7E2B7|Q0KKZ9	Missense_Mutation	SNP	ENST00000301015.9	37	CCDS54058.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	-|-	5.575|5.575	0.290826|0.290826	0.10567|0.10567	.|.	.|.	ENSG00000103335|ENSG00000103335	ENST00000451779|ENST00000301015	.|T	.|0.43294	.|0.95	1.14|1.14	1.14|1.14	0.20703|0.20703	.|.	.|1.855710	.|0.04115	.|U	.|0.315402	T|T	0.24967|0.24967	0.0606|0.0606	N|N	0.19112|0.19112	0.55|0.55	0.19300|0.19300	N|N	0.999978|0.999978	.|P	.|0.37101	.|0.582	.|B	.|0.20384	.|0.029	T|T	0.25502|0.25502	-1.0130|-1.0130	5|10	.|0.48119	.|T	.|0.1	.|.	7.9701|7.9701	0.30122|0.30122	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|745	.|Q92508	.|PIEZ1_HUMAN	S|H	691|745	.|ENSP00000301015:Q745H	.|ENSP00000301015:Q745H	A|Q	-|-	1|3	0|2	FAM38A|FAM38A	87327909|87327909	0.000000|0.000000	0.05858|0.05858	0.014000|0.014000	0.15608|0.15608	0.007000|0.007000	0.05969|0.05969	-0.205000|-0.205000	0.09411|0.09411	0.499000|0.499000	0.27970|0.27970	0.134000|0.134000	0.15878|0.15878	GCA|CAG	.		0.662	PIEZO1-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000345699.4	NM_014745	
DBNDD1	79007	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	90075270	90075270	+	Missense_Mutation	SNP	T	T	A			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr16:90075270T>A	ENST00000002501.6	-	3	372	c.241A>T	c.(241-243)Acc>Tcc	p.T81S	DBNDD1_ENST00000304733.3_Missense_Mutation_p.T101S|DBNDD1_ENST00000568838.1_Missense_Mutation_p.T201S|DBNDD1_ENST00000392973.3_Missense_Mutation_p.T87S	NM_001042610.1	NP_001036075.1	Q9H9R9	DBND1_HUMAN	dysbindin (dystrobrevin binding protein 1) domain containing 1	81						cytoplasm (GO:0005737)				kidney(1)|large_intestine(1)|lung(1)	3		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0275)		GACATGTCGGTGAGCTCAGTG	0.642																																					p.T101S		.											.	DBNDD1-90	0			c.A301T						.						32.0	37.0	35.0					16																	90075270		2016	4160	6176	SO:0001583	missense	79007	exon3			TGTCGGTGAGCTC	AK090696	CCDS10991.2, CCDS42223.1, CCDS73931.1	16q24.3	2008-02-05			ENSG00000003249	ENSG00000003249			28455	protein-coding gene	gene with protein product						12477932	Standard	NM_001288708		Approved	MGC3101, FLJ12582	uc002fqe.1	Q9H9R9	OTTHUMG00000138984	ENST00000002501.6:c.241A>T	16.37:g.90075270T>A	ENSP00000002501:p.Thr81Ser	61	0		119	28	NM_024043	0	0	14	30	16	B4DQS3|Q69YT2|Q9BW25	Missense_Mutation	SNP	ENST00000002501.6	37	CCDS42223.1	.	.	.	.	.	.	.	.	.	.	T	17.81	3.480743	0.63849	.	.	ENSG00000003249	ENST00000304733;ENST00000002501;ENST00000392973	T;T	0.34072	1.38;1.38	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	T	0.61274	0.2334	M	0.78637	2.42	0.49299	D	0.999773	D;D	0.76494	0.999;0.999	D;D	0.83275	0.996;0.994	T	0.64415	-0.6413	9	.	.	.	-34.7701	15.1222	0.72453	0.0:0.0:0.0:1.0	.	81;101	Q9H9R9;Q9H9R9-2	DBND1_HUMAN;.	S	101;81;201	ENSP00000306407:T101S;ENSP00000002501:T81S	.	T	-	1	0	DBNDD1	88602771	1.000000	0.71417	0.992000	0.48379	0.282000	0.26991	5.761000	0.68801	1.992000	0.58205	0.260000	0.18958	ACC	.		0.642	DBNDD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000272872.1	NM_024043	
ZNF594	84622	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	5086862	5086862	+	Missense_Mutation	SNP	C	C	G			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr17:5086862C>G	ENST00000399604.4	-	1	830	c.690G>C	c.(688-690)caG>caC	p.Q230H	ZNF594_ENST00000575779.1_Missense_Mutation_p.Q230H			Q96JF6	ZN594_HUMAN	zinc finger protein 594	230					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Q230H(1)		NS(1)|breast(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(3)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	33						TGTGGATTCTCTGGTGCAGGA	0.438																																					p.Q230H		.											.	ZNF594-71	1	Substitution - Missense(1)	cervix(1)	c.G690C						.						104.0	107.0	106.0					17																	5086862		2051	4221	6272	SO:0001583	missense	84622	exon2			GATTCTCTGGTGC	AB058774	CCDS42241.1	17p13	2013-01-08			ENSG00000180626	ENSG00000180626		"""Zinc fingers, C2H2-type"""	29392	protein-coding gene	gene with protein product						11347906	Standard	NM_032530		Approved	KIAA1871	uc010cla.1	Q96JF6	OTTHUMG00000132059	ENST00000399604.4:c.690G>C	17.37:g.5086862C>G	ENSP00000382513:p.Gln230His	73	0		68	32	NM_032530	0	0	0	0	0	Q6RFS0	Missense_Mutation	SNP	ENST00000399604.4	37	CCDS42241.1	.	.	.	.	.	.	.	.	.	.	C	3.775	-0.046880	0.07407	.	.	ENSG00000180626	ENST00000399604	T	0.18502	2.21	2.36	1.36	0.22044	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.22859	0.0552	L	0.48986	1.54	0.20638	N	0.99988	D	0.57899	0.981	P	0.53035	0.716	T	0.08186	-1.0734	9	0.52906	T	0.07	.	6.6334	0.22869	0.0:0.8341:0.0:0.1659	.	230	Q96JF6	ZN594_HUMAN	H	230	ENSP00000382513:Q230H	ENSP00000382513:Q230H	Q	-	3	2	ZNF594	5027586	0.000000	0.05858	0.612000	0.29024	0.229000	0.25112	-0.361000	0.07612	1.314000	0.45095	0.462000	0.41574	CAG	.		0.438	ZNF594-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438996.1	XM_290737	
KIAA0100	9703	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	26971163	26971163	+	Missense_Mutation	SNP	C	C	A			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr17:26971163C>A	ENST00000528896.2	-	2	185	c.111G>T	c.(109-111)aaG>aaT	p.K37N	KIAA0100_ENST00000389003.3_5'UTR|KIAA0100_ENST00000544884.1_5'UTR	NM_014680.3	NP_055495.2	Q14667	K0100_HUMAN	KIAA0100	37						extracellular region (GO:0005576)				breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(23)|ovary(2)|prostate(2)|skin(6)|stomach(2)|urinary_tract(3)	68	Lung NSC(42;0.00431)					CCGCCTGCAGCTTCCGCTGAC	0.488											OREG0024280	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.K37N		.											.	KIAA0100-93	0			c.G111T						.						59.0	69.0	65.0					17																	26971163		2203	4300	6503	SO:0001583	missense	9703	exon2			CTGCAGCTTCCGC	D43947	CCDS32595.1	17q11.2	2012-11-29			ENSG00000007202	ENSG00000007202			28960	protein-coding gene	gene with protein product	"""cancer/testis antigen 101"", ""breast cancer overexpressed gene 1"""	610664				16289875	Standard	NM_014680		Approved	DKFZp686M0843, MGC111488, BCOX1, CT101, BCOX	uc002hbu.3	Q14667	OTTHUMG00000166587	ENST00000528896.2:c.111G>T	17.37:g.26971163C>A	ENSP00000436773:p.Lys37Asn	90	0	790	77	25	NM_014680	0	0	0	0	0	A6NCX3|Q3SYN5|Q49A07|Q5H9T4|Q6WG74|Q6ZP51|Q96HH8	Missense_Mutation	SNP	ENST00000528896.2	37	CCDS32595.1	.	.	.	.	.	.	.	.	.	.	C	11.55	1.673269	0.29693	.	.	ENSG00000007202	ENST00000005905;ENST00000389003;ENST00000528896	T	0.26373	1.74	5.18	4.2	0.49525	FMP27, N-terminal (1);	0.354102	0.32719	N	0.005740	T	0.19127	0.0459	L	0.27053	0.805	0.80722	D	1	B;B	0.15141	0.012;0.0	B;B	0.12156	0.007;0.002	T	0.03619	-1.1019	10	0.62326	D	0.03	.	11.8337	0.52309	0.1379:0.7294:0.1327:0.0	.	37;37	F6XS94;Q14667	.;K0100_HUMAN	N	37	ENSP00000436773:K37N	ENSP00000005905:K37N	K	-	3	2	KIAA0100	23995290	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.047000	0.30367	1.295000	0.44724	-0.310000	0.09108	AAG	.		0.488	KIAA0100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390571.3	NM_014680	
NUFIP2	57532	hgsc.bcm.edu;bcgsc.ca	37	17	27614566	27614566	+	Missense_Mutation	SNP	A	A	G			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr17:27614566A>G	ENST00000225388.4	-	2	504	c.446T>C	c.(445-447)aTt>aCt	p.I149T	NUFIP2_ENST00000579665.1_Intron	NM_020772.2	NP_065823.1	Q7Z417	NUFP2_HUMAN	nuclear fragile X mental retardation protein interacting protein 2	149						cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|polysomal ribosome (GO:0042788)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|liver(1)|lung(7)|ovary(1)|prostate(2)|skin(4)|urinary_tract(1)	24			BRCA - Breast invasive adenocarcinoma(11;0.000457)|Colorectal(6;0.0178)|COAD - Colon adenocarcinoma(6;0.0551)			CTTGGTTTTAATTCCTGCTTT	0.408																																					p.I149T		.											.	NUFIP2-138	0			c.T446C						.						121.0	120.0	121.0					17																	27614566		2203	4300	6503	SO:0001583	missense	57532	exon2			GTTTTAATTCCTG	AB037742	CCDS32600.1	17q11.1	2006-03-01				ENSG00000108256			17634	protein-coding gene	gene with protein product		609356				12837692, 16407062	Standard	NM_020772		Approved	KIAA1321, MGC117262, PIG1, 182-FIP, FIP-82, 82-FIP	uc002hdy.4	Q7Z417		ENST00000225388.4:c.446T>C	17.37:g.27614566A>G	ENSP00000225388:p.Ile149Thr	60	0		67	4	NM_020772	0	0	0	0	0	A1L3A6|Q9P2M5	Missense_Mutation	SNP	ENST00000225388.4	37	CCDS32600.1	.	.	.	.	.	.	.	.	.	.	A	12.71	2.020017	0.35606	.	.	ENSG00000108256	ENST00000225388	.	.	.	6.17	6.17	0.99709	.	0.134082	0.52532	D	0.000080	T	0.41328	0.1154	N	0.12182	0.205	0.80722	D	1	B	0.24721	0.11	B	0.25291	0.059	T	0.37384	-0.9708	9	0.56958	D	0.05	-12.34	12.6398	0.56702	0.8623:0.1377:0.0:0.0	.	149	Q7Z417	NUFP2_HUMAN	T	149	.	ENSP00000225388:I149T	I	-	2	0	NUFIP2	24638692	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.852000	0.55934	2.371000	0.80710	0.533000	0.62120	ATT	.		0.408	NUFIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447015.2	NM_020772	
KLHL11	55175	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	40011371	40011371	+	Missense_Mutation	SNP	T	T	C			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr17:40011371T>C	ENST00000319121.3	-	2	808	c.748A>G	c.(748-750)Aga>Gga	p.R250G		NM_018143.1	NP_060613.1	Q9NVR0	KLH11_HUMAN	kelch-like family member 11	250	BACK.									NS(2)|breast(2)|endometrium(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	17		Breast(137;0.00156)				AGCCAGTCTCTAATGAGATGG	0.398																																					p.R250G		.											.	KLHL11-90	0			c.A748G						.						57.0	58.0	58.0					17																	40011371		2203	4300	6503	SO:0001583	missense	55175	exon2			AGTCTCTAATGAG		CCDS11411.1	17q21	2013-01-30	2013-01-30		ENSG00000178502	ENSG00000178502		"""Kelch-like"", ""BTB/POZ domain containing"""	19008	protein-coding gene	gene with protein product			"""kelch-like 11 (Drosophila)"""				Standard	NM_018143		Approved	FLJ10572	uc002hyf.1	Q9NVR0	OTTHUMG00000133506	ENST00000319121.3:c.748A>G	17.37:g.40011371T>C	ENSP00000314608:p.Arg250Gly	64	0		61	33	NM_018143	0	0	0	0	0		Missense_Mutation	SNP	ENST00000319121.3	37	CCDS11411.1	.	.	.	.	.	.	.	.	.	.	T	6.149	0.395748	0.11638	.	.	ENSG00000178502	ENST00000319121;ENST00000540254	T	0.69040	-0.37	4.99	4.01	0.46588	BTB/Kelch-associated (2);	0.068566	0.56097	D	0.000034	T	0.48892	0.1525	N	0.20986	0.625	0.50313	D	0.999866	P	0.46142	0.873	B	0.38264	0.269	T	0.41215	-0.9521	10	0.21540	T	0.41	-2.2119	13.3418	0.60549	0.0:0.0:0.5227:0.4773	.	250	Q9NVR0	KLH11_HUMAN	G	250;113	ENSP00000314608:R250G	ENSP00000314608:R250G	R	-	1	2	KLHL11	37264897	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	1.686000	0.37669	1.055000	0.40461	-0.452000	0.05504	AGA	.		0.398	KLHL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257464.2	NM_018143	
KAT2A	2648	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	40269761	40269761	+	Missense_Mutation	SNP	G	G	C			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr17:40269761G>C	ENST00000225916.5	-	9	1416	c.1363C>G	c.(1363-1365)Ccc>Gcc	p.P455A		NM_021078.2	NP_066564.2	Q92830	KAT2A_HUMAN	K(lysine) acetyltransferase 2A	455					cell proliferation (GO:0008283)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|histone deubiquitination (GO:0016578)|histone H3 acetylation (GO:0043966)|histone H3-K14 acetylation (GO:0044154)|in utero embryonic development (GO:0001701)|metencephalon development (GO:0022037)|midbrain development (GO:0030901)|multicellular organism growth (GO:0035264)|neural tube closure (GO:0001843)|positive regulation of gluconeogenesis (GO:0045722)|regulation of protein stability (GO:0031647)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|somitogenesis (GO:0001756)|telencephalon development (GO:0021537)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|extracellular space (GO:0005615)|mitotic spindle (GO:0072686)|nucleoplasm (GO:0005654)|STAGA complex (GO:0030914)|transcription factor TFTC complex (GO:0033276)	chromatin binding (GO:0003682)|H3 histone acetyltransferase activity (GO:0010484)|histone acetyltransferase activity (GO:0004402)|histone acetyltransferase activity (H4-K12 specific) (GO:0043997)|histone deacetylase binding (GO:0042826)|transcription coactivator activity (GO:0003713)			central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(4)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	18						AGCTCCATGGGGATGTCACCC	0.627																																					p.P455A		.											.	KAT2A-523	0			c.C1363G						.						43.0	36.0	39.0					17																	40269761		2203	4300	6503	SO:0001583	missense	2648	exon9			CCATGGGGATGTC	AF029777	CCDS11417.1	17q12-q21	2011-07-01	2008-07-04	2008-07-04	ENSG00000108773	ENSG00000108773		"""Chromatin-modifying enzymes / K-acetyltransferases"""	4201	protein-coding gene	gene with protein product		602301	"""GCN5 general control of amino-acid synthesis 5-like 2 (yeast)"""	GCN5L2		8552087	Standard	NM_021078		Approved	GCN5, PCAF-b	uc002hyx.2	Q92830	OTTHUMG00000133504	ENST00000225916.5:c.1363C>G	17.37:g.40269761G>C	ENSP00000225916:p.Pro455Ala	107	0		132	53	NM_021078	0	0	9	15	6	Q8N1A2|Q9UCW1	Missense_Mutation	SNP	ENST00000225916.5	37	CCDS11417.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.470462	0.84533	.	.	ENSG00000108773	ENST00000225916	T	0.08634	3.07	4.7	4.7	0.59300	.	0.000000	0.85682	D	0.000000	T	0.31979	0.0814	M	0.84683	2.71	0.80722	D	1	D	0.61080	0.989	D	0.63192	0.912	T	0.28744	-1.0034	10	0.72032	D	0.01	-17.8967	17.6406	0.88135	0.0:0.0:1.0:0.0	.	455	Q92830	KAT2A_HUMAN	A	455	ENSP00000225916:P455A	ENSP00000225916:P455A	P	-	1	0	KAT2A	37523287	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.811000	0.99226	2.164000	0.68074	0.561000	0.74099	CCC	.		0.627	KAT2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257458.1	NM_021078	
KAT7	11143	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	47869395	47869395	+	Splice_Site	SNP	G	G	A			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr17:47869395G>A	ENST00000259021.4	+	2	443	c.163G>A	c.(163-165)Gat>Aat	p.D55N	KAT7_ENST00000435742.2_5'UTR|KAT7_ENST00000509773.1_Splice_Site_p.D55N|KAT7_ENST00000454930.2_Splice_Site_p.G55R|KAT7_ENST00000424009.2_Splice_Site_p.D55N|KAT7_ENST00000503935.2_5'UTR|KAT7_ENST00000510819.1_Splice_Site_p.G55R	NM_007067.4	NP_008998.1	O95251	KAT7_HUMAN	K(lysine) acetyltransferase 7	55	Ser-rich.				chromatin organization (GO:0006325)|DNA replication (GO:0006260)|histone H3 acetylation (GO:0043966)|histone H4-K12 acetylation (GO:0043983)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										GAGTTCTCAAGGTAAAAAAAC	0.493																																					p.G55R		.											.	.	0			c.G163A						.						72.0	69.0	70.0					17																	47869395		2203	4300	6503	SO:0001630	splice_region_variant	11143	exon2			TCTCAAGGTAAAA	AF074606	CCDS11554.1, CCDS56035.1, CCDS56036.1, CCDS56037.1, CCDS56038.1	17q21.32	2013-01-10	2011-07-21	2011-07-21	ENSG00000136504	ENSG00000136504	2.3.1.48	"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"""	17016	protein-coding gene	gene with protein product	"""histone acetyltransferase binding to ORC1"""	609880	"""MYST histone acetyltransferase 2"""	MYST2		10438470, 10930412	Standard	NM_001199155		Approved	HBOA, HBO1, ZC2HC7	uc002ipm.3	O95251	OTTHUMG00000161770	ENST00000259021.4:c.163+1G>A	17.37:g.47869395G>A		25	0		36	11	NM_001199158	0	0	0	0	0	B3KN74|B4DF85|B4DFB4|B4DFE0|B4DGY4|E7ER15|G5E9K7	Missense_Mutation	SNP	ENST00000259021.4	37	CCDS11554.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	33|33	5.224482|5.224482	0.95139|0.95139	.|.	.|.	ENSG00000136504|ENSG00000136504	ENST00000259021;ENST00000509773;ENST00000424009|ENST00000454930;ENST00000510819	.|.	.|.	.|.	5.56|5.56	5.56|5.56	0.83823|0.83823	.|.	0.153798|.	0.56097|.	D|.	0.000026|.	T|T	0.76385|0.76385	0.3980|0.3980	L|L	0.50333|0.50333	1.59|1.59	0.80722|0.80722	D|D	1|1	D;B;D|D;D	0.60575|0.89917	0.98;0.281;0.988|1.0;1.0	D;B;D|D;D	0.73708|0.97110	0.956;0.083;0.981|1.0;1.0	T|T	0.77747|0.77747	-0.2472|-0.2472	9|8	0.09843|0.87932	T|D	0.71|0	-15.7574|-15.7574	19.1747|19.1747	0.93599|0.93599	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	55;55;55|55;55	B4DFB4;O95251;G5E9K7|B4DFE0;E7ER15	.;KAT7_HUMAN;.|.;.	N|R	55|55	.|.	ENSP00000259021:D55N|ENSP00000413415:G55R	D|G	+|+	1|1	0|0	KAT7|KAT7	45224394|45224394	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.983000|0.983000	0.72400|0.72400	9.448000|9.448000	0.97600|0.97600	2.623000|2.623000	0.88846|0.88846	0.650000|0.650000	0.86243|0.86243	GAT|GGA	.		0.493	KAT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366032.1	NM_007067	Missense_Mutation
CELF5	60680	hgsc.bcm.edu	37	19	3285978	3285978	+	Missense_Mutation	SNP	A	A	T			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr19:3285978A>T	ENST00000292672.2	+	10	1178	c.1141A>T	c.(1141-1143)Agc>Tgc	p.S381C	CELF5_ENST00000541430.2_Missense_Mutation_p.S356C|CELF5_ENST00000588101.1_3'UTR	NM_021938.3	NP_068757.2	Q8N6W0	CELF5_HUMAN	CUGBP, Elav-like family member 5	381					mRNA processing (GO:0006397)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			kidney(1)|large_intestine(2)|lung(7)|ovary(2)|skin(1)	13						CATCGCGCACAGCGTCCCCCA	0.756																																					p.S381C		.											.	CELF5-92	0			c.A1141T						.						12.0	12.0	12.0					19																	3285978		2081	4145	6226	SO:0001583	missense	60680	exon10			GCGCACAGCGTCC	AF248649	CCDS12106.1, CCDS54197.1	19p13	2013-02-12	2010-02-19	2010-02-19		ENSG00000161082		"""RNA binding motif (RRM) containing"""	14058	protein-coding gene	gene with protein product		612680	"""Bruno (Drosophila) -like 5, RNA binding protein"", ""bruno-like 5, RNA binding protein (Drosophila)"""	BRUNOL5		10893231	Standard	NM_001172673		Approved		uc002lxm.3	Q8N6W0		ENST00000292672.2:c.1141A>T	19.37:g.3285978A>T	ENSP00000292672:p.Ser381Cys	4	0		67	37	NM_021938	0	0	0	0	0	D6W614|O75253|Q59GP2|Q86VW6|Q9BZC0|Q9NR86	Missense_Mutation	SNP	ENST00000292672.2	37	CCDS12106.1	.	.	.	.	.	.	.	.	.	.	A	24.1	4.488587	0.84854	.	.	ENSG00000161082	ENST00000292672;ENST00000541430;ENST00000334293	T;T;T	0.51071	0.72;1.66;1.56	4.15	4.15	0.48705	.	0.325407	0.28841	N	0.013971	T	0.53867	0.1823	L	0.36672	1.1	0.37559	D	0.919007	D;D;P	0.76494	0.985;0.999;0.944	P;D;P	0.63192	0.731;0.912;0.662	T	0.61451	-0.7060	10	0.62326	D	0.03	-4.5717	11.4083	0.49911	1.0:0.0:0.0:0.0	.	267;356;381	B4DFI3;Q8N6W0-2;Q8N6W0	.;.;CELF5_HUMAN	C	381;356;267	ENSP00000292672:S381C;ENSP00000443498:S356C;ENSP00000335182:S267C	ENSP00000292672:S381C	S	+	1	0	CELF5	3236978	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.948000	0.49066	1.666000	0.50821	0.402000	0.26972	AGC	.		0.756	CELF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452574.1	NM_021938	
ATP13A1	57130	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	19758062	19758062	+	Missense_Mutation	SNP	T	T	C			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr19:19758062T>C	ENST00000357324.6	-	22	3007	c.2981A>G	c.(2980-2982)aAt>aGt	p.N994S	ATP13A1_ENST00000291503.5_Missense_Mutation_p.N876S	NM_020410.2	NP_065143.2	Q9HD20	AT131_HUMAN	ATPase type 13A1	994						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|liver(2)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						GATGAGGGCATTGAGCGCCAG	0.632																																					p.N994S	Esophageal Squamous(142;920 1789 9047 14684 24777)	.											.	ATP13A1-138	0			c.A2981G						.						108.0	109.0	109.0					19																	19758062		2203	4300	6503	SO:0001583	missense	57130	exon22			AGGGCATTGAGCG	AK056420	CCDS32970.2	19p13.11	2010-04-20	2005-01-12	2005-01-12	ENSG00000105726	ENSG00000105726		"""ATPases / P-type"""	24215	protein-coding gene	gene with protein product	"""cation transporting ATPase"""		"""ATPase type 13A"""	ATP13A		11347906	Standard	NM_020410		Approved	KIAA1825, FLJ31858, CGI-152	uc002nnh.4	Q9HD20	OTTHUMG00000153016	ENST00000357324.6:c.2981A>G	19.37:g.19758062T>C	ENSP00000349877:p.Asn994Ser	63	0		99	19	NM_020410	0	0	67	87	20	B3KPJ2|B3KTA7|Q6NT90|Q6ZMG7|Q9H6C6	Missense_Mutation	SNP	ENST00000357324.6	37	CCDS32970.2	.	.	.	.	.	.	.	.	.	.	T	22.3	4.274546	0.80580	.	.	ENSG00000105726	ENST00000291503;ENST00000357324	D;D	0.88354	-2.37;-2.37	4.75	4.75	0.60458	.	0.000000	0.85682	D	0.000000	D	0.91784	0.7401	M	0.75264	2.295	0.80722	D	1	D;D	0.59357	0.974;0.985	P;P	0.61592	0.78;0.891	D	0.89608	0.3839	10	0.11794	T	0.64	-19.537	12.2865	0.54795	0.0:0.0:0.0:1.0	.	994;876	Q9HD20;Q9HD20-2	AT131_HUMAN;.	S	876;994	ENSP00000291503:N876S;ENSP00000349877:N994S	ENSP00000291503:N876S	N	-	2	0	ATP13A1	19619062	1.000000	0.71417	0.855000	0.33649	0.995000	0.86356	7.576000	0.82467	1.789000	0.52484	0.529000	0.55759	AAT	.		0.632	ATP13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329005.1	NM_020410	
GRAMD1A	57655	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	35506763	35506763	+	Missense_Mutation	SNP	C	C	T			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr19:35506763C>T	ENST00000317991.5	+	11	1297	c.1105C>T	c.(1105-1107)Cgc>Tgc	p.R369C	CTD-2527I21.14_ENST00000605640.1_RNA|GRAMD1A_ENST00000599564.1_Missense_Mutation_p.R456C|GRAMD1A_ENST00000411896.2_Missense_Mutation_p.R362C|GRAMD1A_ENST00000504615.2_Missense_Mutation_p.R135C	NM_020895.3	NP_065946.2	Q96CP6	GRM1A_HUMAN	GRAM domain containing 1A	369						integral component of membrane (GO:0016021)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	19	all_lung(56;2.66e-08)|Lung NSC(56;4.13e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)			CCTCTCCGGCCGCCTCCTCAT	0.642																																					p.R369C		.											.	GRAMD1A-90	0			c.C1105T						.						39.0	44.0	42.0					19																	35506763		2115	4223	6338	SO:0001583	missense	57655	exon11			TCCGGCCGCCTCC	AK074864	CCDS42546.1, CCDS46046.1	19q13.13	2008-02-05	2005-11-02	2005-11-02		ENSG00000089351			29305	protein-coding gene	gene with protein product			"""KIAA1533"""	KIAA1533		10819331	Standard	NM_020895		Approved	FLJ90346	uc010xse.1	Q96CP6		ENST00000317991.5:c.1105C>T	19.37:g.35506763C>T	ENSP00000441032:p.Arg369Cys	93	0		106	43	NM_020895	0	0	9	22	13	A6NKY7|Q8NC77|Q9P1Z5	Missense_Mutation	SNP	ENST00000317991.5	37	CCDS42546.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.127959	0.77549	.	.	ENSG00000089351	ENST00000453966;ENST00000504615;ENST00000317991;ENST00000411896	T;T;T	0.60548	0.18;1.34;1.3	5.01	5.01	0.66863	.	0.067735	0.64402	D	0.000013	T	0.75398	0.3844	M	0.82323	2.585	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.80764	0.96;0.994;0.917;0.975	T	0.78443	-0.2202	10	0.87932	D	0	.	10.8825	0.46946	0.1875:0.8125:0.0:0.0	.	369;369;135;362	Q96CP6-3;Q96CP6;B3KQF7;Q96CP6-2	.;GRM1A_HUMAN;.;.	C	455;135;369;362	ENSP00000423728:R135C;ENSP00000441032:R369C;ENSP00000439267:R362C	ENSP00000441032:R369C	R	+	1	0	GRAMD1A	40198603	1.000000	0.71417	0.997000	0.53966	0.988000	0.76386	3.193000	0.50997	2.615000	0.88500	0.555000	0.69702	CGC	.		0.642	GRAMD1A-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000461557.1	NM_020895	
RSPH6A	81492	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	46305454	46305454	+	Missense_Mutation	SNP	C	C	G			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr19:46305454C>G	ENST00000221538.3	-	4	1864	c.1722G>C	c.(1720-1722)gaG>gaC	p.E574D	RSPH6A_ENST00000597055.1_Missense_Mutation_p.E574D|RSPH6A_ENST00000600188.1_Missense_Mutation_p.E310D	NM_030785.3	NP_110412.1	Q9H0K4	RSH6A_HUMAN	radial spoke head 6 homolog A (Chlamydomonas)	574	Glu-rich.					intracellular (GO:0005622)				central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	32						catctgccttctcttcctcct	0.622																																					p.E574D		.											.	RSPH6A-91	0			c.G1722C						.						111.0	73.0	86.0					19																	46305454		2203	4300	6503	SO:0001583	missense	81492	exon4			TGCCTTCTCTTCC	AL136761	CCDS12675.1	19q13.3	2010-02-17	2009-11-18	2009-11-18	ENSG00000104941	ENSG00000104941			14241	protein-coding gene	gene with protein product		607548	"""radial spokehead-like 1"""	RSHL1		11237735	Standard	NM_030785		Approved	RSP4, RSP6, RSPH4B	uc002pdm.3	Q9H0K4		ENST00000221538.3:c.1722G>C	19.37:g.46305454C>G	ENSP00000221538:p.Glu574Asp	107	0		139	50	NM_030785	0	0	0	0	0	Q53FE2|Q6PEZ9	Missense_Mutation	SNP	ENST00000221538.3	37	CCDS12675.1	.	.	.	.	.	.	.	.	.	.	C	11.81	1.748680	0.30955	.	.	ENSG00000104941	ENST00000221538	T	0.19806	2.12	4.27	2.08	0.27032	.	0.108659	0.64402	D	0.000011	T	0.15912	0.0383	L	0.48986	1.54	0.27895	N	0.939171	P	0.41978	0.767	B	0.38985	0.287	T	0.08827	-1.0703	10	0.26408	T	0.33	-9.2878	6.3085	0.21151	0.0:0.764:0.0:0.236	.	574	Q9H0K4	RSH6A_HUMAN	D	574	ENSP00000221538:E574D	ENSP00000221538:E574D	E	-	3	2	RSPH6A	50997294	0.980000	0.34600	1.000000	0.80357	0.407000	0.30961	0.054000	0.14205	0.710000	0.31997	-0.390000	0.06520	GAG	.		0.622	RSPH6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461657.1		
GLTSCR1	29998	hgsc.bcm.edu	37	19	48183660	48183660	+	Silent	SNP	G	G	A	rs145963832	byFrequency	TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr19:48183660G>A	ENST00000396720.3	+	6	1427	c.1233G>A	c.(1231-1233)ctG>ctA	p.L411L	CTD-2571L23.8_ENST00000599924.1_lincRNA	NM_015711.3	NP_056526.3	Q9NZM4	GSCR1_HUMAN	glioma tumor suppressor candidate region gene 1	411										breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|pancreas(3)|prostate(4)|skin(2)	20		all_cancers(25;1.8e-07)|all_lung(116;5.73e-06)|Lung NSC(112;9.69e-06)|all_epithelial(76;2.42e-05)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000358)|OV - Ovarian serous cystadenocarcinoma(262;0.000576)|Epithelial(262;0.0212)|GBM - Glioblastoma multiforme(486;0.0355)		ACGTGGTGCTGTCGGGCTTCC	0.741													G|||	75	0.014976	0.0469	0.0058	5008	,	,		9935	0.0		0.007	False		,,,				2504	0.002				p.L411L		.											.	GLTSCR1-48	0			c.G1233A						.	G		101,3065		2,97,1484	5.0	8.0	7.0		1233	-4.3	0.6	19	dbSNP_134	7	28,6636		0,28,3304	no	coding-synonymous	GLTSCR1	NM_015711.3		2,125,4788	AA,AG,GG		0.4202,3.1901,1.3123		411/1561	48183660	129,9701	1583	3332	4915	SO:0001819	synonymous_variant	29998	exon6			GGTGCTGTCGGGC	AF182077	CCDS46134.1	19q13.3	2012-11-29			ENSG00000063169	ENSG00000063169			4332	protein-coding gene	gene with protein product		605690				10708517	Standard	NM_015711		Approved		uc002phh.4	Q9NZM4		ENST00000396720.3:c.1233G>A	19.37:g.48183660G>A		0	0		9	7	NM_015711	0	0	1	1	0	A8MW01	Silent	SNP	ENST00000396720.3	37	CCDS46134.1																																																																																			G|0.985;A|0.015		0.741	GLTSCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465846.1	NM_015711	
GLTSCR1	29998	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	48183987	48183987	+	Silent	SNP	G	G	T	rs377326337		TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr19:48183987G>T	ENST00000396720.3	+	6	1754	c.1560G>T	c.(1558-1560)ctG>ctT	p.L520L	CTD-2571L23.8_ENST00000599924.1_lincRNA	NM_015711.3	NP_056526.3	Q9NZM4	GSCR1_HUMAN	glioma tumor suppressor candidate region gene 1	520										breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|pancreas(3)|prostate(4)|skin(2)	20		all_cancers(25;1.8e-07)|all_lung(116;5.73e-06)|Lung NSC(112;9.69e-06)|all_epithelial(76;2.42e-05)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000358)|OV - Ovarian serous cystadenocarcinoma(262;0.000576)|Epithelial(262;0.0212)|GBM - Glioblastoma multiforme(486;0.0355)		ACCAGAACCTGGCGGGCCCAC	0.726																																					p.L520L		.											.	GLTSCR1-48	0			c.G1560T						.						26.0	32.0	30.0					19																	48183987		1884	4062	5946	SO:0001819	synonymous_variant	29998	exon6			GAACCTGGCGGGC	AF182077	CCDS46134.1	19q13.3	2012-11-29			ENSG00000063169	ENSG00000063169			4332	protein-coding gene	gene with protein product		605690				10708517	Standard	NM_015711		Approved		uc002phh.4	Q9NZM4		ENST00000396720.3:c.1560G>T	19.37:g.48183987G>T		25	0		108	42	NM_015711	0	0	0	0	0	A8MW01	Silent	SNP	ENST00000396720.3	37	CCDS46134.1																																																																																			.		0.726	GLTSCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465846.1	NM_015711	
SBK2	646643	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	56047489	56047489	+	Missense_Mutation	SNP	A	A	C			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr19:56047489A>C	ENST00000413299.1	-	2	210	c.173T>G	c.(172-174)gTg>gGg	p.V58G	SBK2_ENST00000344158.3_Missense_Mutation_p.V58G	NM_001101401.2	NP_001094871.2	P0C263	SBK2_HUMAN	SH3 domain binding kinase family, member 2	58							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	9						GAGCTCGTCCACCTCGGCTCG	0.657																																					p.V58G													.	SBK2-68	0			c.T173G						.						33.0	37.0	36.0					19																	56047489		2120	4212	6332	SO:0001583	missense	646643	exon2			TCGTCCACCTCGG		CCDS42631.1	19q13.42	2013-09-27	2013-09-27		ENSG00000187550	ENSG00000187550			34416	protein-coding gene	gene with protein product			"""SH3-binding domain kinase family, member 2"""				Standard	NM_001101401		Approved	SGK069	uc010ygc.2	P0C263	OTTHUMG00000155830	ENST00000413299.1:c.173T>G	19.37:g.56047489A>C	ENSP00000389015:p.Val58Gly	97	1		124	40	NM_001101401	0	0	0	0	0		Missense_Mutation	SNP	ENST00000413299.1	37	CCDS42631.1	.	.	.	.	.	.	.	.	.	.	A	18.86	3.714242	0.68730	.	.	ENSG00000187550	ENST00000413299;ENST00000344158	T;T	0.72615	-0.67;-0.67	4.44	3.42	0.39159	Protein kinase-like domain (1);	0.145674	0.45361	D	0.000372	T	0.55673	0.1935	N	0.24115	0.695	0.58432	D	0.999995	P	0.44659	0.84	B	0.42062	0.374	T	0.56649	-0.7944	10	0.72032	D	0.01	-26.5917	8.3241	0.32147	0.9021:0.0:0.0979:0.0	.	58	P0C263	SBK2_HUMAN	G	58	ENSP00000389015:V58G;ENSP00000345044:V58G	ENSP00000345044:V58G	V	-	2	0	SBK2	60739301	0.757000	0.28394	0.995000	0.50966	0.864000	0.49448	6.326000	0.72905	0.673000	0.31224	0.379000	0.24179	GTG	.		0.657	SBK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341919.1	NM_001101401	
MXD1	4084	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	70165384	70165384	+	Missense_Mutation	SNP	C	C	G			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr2:70165384C>G	ENST00000264444.2	+	6	894	c.634C>G	c.(634-636)Cag>Gag	p.Q212E	MXD1_ENST00000465446.1_3'UTR|MXD1_ENST00000540449.1_Missense_Mutation_p.Q202E	NM_001202513.1|NM_001202514.1|NM_002357.3	NP_001189442.1|NP_001189443.1|NP_002348.1	Q05195	MAD1_HUMAN	MAX dimerization protein 1	212					cell proliferation (GO:0008283)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)			breast(1)|endometrium(1)|large_intestine(3)|lung(1)|upper_aerodigestive_tract(1)	7						AATAAAGCTGCAGGACAGTCA	0.547																																					p.Q212E		.											.	MXD1-226	0			c.C634G						.						103.0	101.0	101.0					2																	70165384		2203	4300	6503	SO:0001583	missense	4084	exon6			AAGCTGCAGGACA		CCDS1896.1, CCDS56123.1	2p13-p12	2010-07-07		2005-02-11	ENSG00000059728	ENSG00000059728		"""MAX dimerization proteins"", ""Basic helix-loop-helix proteins"""	6761	protein-coding gene	gene with protein product		600021		MAD		7829091	Standard	NM_002357		Approved	MAD1, bHLHc58	uc002sfy.3	Q05195	OTTHUMG00000129646	ENST00000264444.2:c.634C>G	2.37:g.70165384C>G	ENSP00000264444:p.Gln212Glu	328	0		335	22	NM_002357	0	0	3	3	0	B2R6V8|B7ZLI6|D6W5G2|Q6FI41	Missense_Mutation	SNP	ENST00000264444.2	37	CCDS1896.1	.	.	.	.	.	.	.	.	.	.	C	18.69	3.677983	0.68042	.	.	ENSG00000059728	ENST00000435990;ENST00000264444;ENST00000540449	T;T;T	0.45276	0.9;0.91;0.91	5.75	5.75	0.90469	.	0.527941	0.22156	N	0.063844	T	0.35537	0.0935	N	0.22421	0.69	0.47214	D	0.999358	B;B;B	0.23316	0.083;0.083;0.083	B;B;B	0.24006	0.05;0.05;0.05	T	0.13072	-1.0523	10	0.66056	D	0.02	.	18.875	0.92331	0.0:1.0:0.0:0.0	.	202;211;212	B7ZLI6;B7ZLI7;Q05195	.;.;MAD1_HUMAN	E	180;212;202	ENSP00000410672:Q180E;ENSP00000264444:Q212E;ENSP00000443935:Q202E	ENSP00000264444:Q212E	Q	+	1	0	MXD1	70018888	1.000000	0.71417	0.999000	0.59377	0.853000	0.48598	5.131000	0.64751	2.866000	0.98385	0.650000	0.86243	CAG	.		0.547	MXD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251845.3	NM_002357	
RGPD4	285190	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	108488583	108488583	+	Missense_Mutation	SNP	A	A	G			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr2:108488583A>G	ENST00000408999.3	+	20	4200	c.4123A>G	c.(4123-4125)Aaa>Gaa	p.K1375E	RGPD4_ENST00000354986.4_Missense_Mutation_p.K1375E	NM_182588.2	NP_872394.2	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4	1375	RanBD1 2. {ECO:0000255|PROSITE- ProRule:PRU00164}.				protein targeting to Golgi (GO:0000042)					breast(1)|endometrium(7)|kidney(4)|lung(23)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(3)	43						TGGTCAATGGAAAGAAAGGGG	0.353																																					p.K1375E		.											.	RGPD4-2	0			c.A4123G						.						3.0	3.0	3.0					2																	108488583		568	1292	1860	SO:0001583	missense	285190	exon20			CAATGGAAAGAAA	BX537861	CCDS46381.1	2q12.3	2013-01-10			ENSG00000196862	ENSG00000196862		"""Tetratricopeptide (TTC) repeat domain containing"""	32417	protein-coding gene	gene with protein product		612707				15710750, 15815621	Standard	NM_182588		Approved	RGP4, DKFZp686P0288	uc010ywk.2	Q7Z3J3	OTTHUMG00000153208	ENST00000408999.3:c.4123A>G	2.37:g.108488583A>G	ENSP00000386810:p.Lys1375Glu	237	1		290	198	NM_182588	0	0	0	0	0	B9A029	Missense_Mutation	SNP	ENST00000408999.3	37	CCDS46381.1	.	.	.	.	.	.	.	.	.	.	-	12.87	2.068566	0.36470	.	.	ENSG00000196862	ENST00000354986;ENST00000408999	T;T	0.53423	0.62;0.62	2.33	2.33	0.28932	Pleckstrin homology-type (1);Ran binding protein 1 (3);	.	.	.	.	T	0.70745	0.3259	M	0.91406	3.205	0.37032	D	0.896721	D	0.76494	0.999	D	0.80764	0.994	T	0.77611	-0.2523	9	0.87932	D	0	-35.6834	9.2036	0.37275	1.0:0.0:0.0:0.0	.	1375	Q7Z3J3	RGPD4_HUMAN	E	1375	ENSP00000347081:K1375E;ENSP00000386810:K1375E	ENSP00000347081:K1375E	K	+	1	0	RGPD4	107855015	1.000000	0.71417	1.000000	0.80357	0.405000	0.30901	9.032000	0.93736	1.072000	0.40860	0.136000	0.15936	AAA	.		0.353	RGPD4-001	NOVEL	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330096.2	XM_496581	
SP5	389058	hgsc.bcm.edu	37	2	171572792	171572792	+	Silent	SNP	G	G	A			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr2:171572792G>A	ENST00000375281.3	+	2	237	c.75G>A	c.(73-75)ccG>ccA	p.P25P	SP5_ENST00000487037.1_3'UTR|AC007405.2_ENST00000409786.1_5'Flank	NM_001003845.2	NP_001003845.1	Q6BEB4	SP5_HUMAN	Sp5 transcription factor	25					bone morphogenesis (GO:0060349)|post-anal tail morphogenesis (GO:0036342)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			NS(1)|endometrium(2)|lung(1)|prostate(1)	5						GCGCCTCCCCGGACCTGGGCA	0.736																																					p.P25P		.											.	SP5-90	0			c.G75A						.						16.0	22.0	20.0					2																	171572792		2004	3993	5997	SO:0001819	synonymous_variant	389058	exon2			CTCCCCGGACCTG		CCDS33322.1	2q31	2013-01-08			ENSG00000204335	ENSG00000204335		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	14529	protein-coding gene	gene with protein product		609391					Standard	NM_001003845		Approved		uc002uge.3	Q6BEB4	OTTHUMG00000154053	ENST00000375281.3:c.75G>A	2.37:g.171572792G>A		1	0		5	5	NM_001003845	0	0	0	0	0		Silent	SNP	ENST00000375281.3	37	CCDS33322.1																																																																																			.		0.736	SP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333670.1	XM_371581	
FZD7	8324	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	202900342	202900342	+	Nonsense_Mutation	SNP	C	C	G	rs571062625		TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr2:202900342C>G	ENST00000286201.1	+	1	1033	c.972C>G	c.(970-972)taC>taG	p.Y324*	RP11-107N15.1_ENST00000608741.1_lincRNA	NM_003507.1	NP_003498.1	O75084	FZD7_HUMAN	frizzled class receptor 7	324					axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|mesenchymal to epithelial transition (GO:0060231)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of ectodermal cell fate specification (GO:0042666)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|positive regulation of JNK cascade (GO:0046330)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of catenin import into nucleus (GO:0035412)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle satellite cell maintenance involved in skeletal muscle regeneration (GO:0014834)|somatic stem cell division (GO:0048103)|stem cell maintenance (GO:0019827)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell differentiation in thymus (GO:0033077)|vasculature development (GO:0001944)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	frizzled binding (GO:0005109)|G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(1)|endometrium(6)|large_intestine(6)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	31						ACGATGGCTACCGCACGGTGG	0.632											OREG0015146	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Y324X		.											.	FZD7-659	0			c.C972G						.						65.0	64.0	65.0					2																	202900342		2203	4300	6503	SO:0001587	stop_gained	8324	exon1			TGGCTACCGCACG	AB010881	CCDS2351.1	2q33	2014-01-29	2014-01-29		ENSG00000155760	ENSG00000155760		"""GPCR / Class F : Frizzled receptors"""	4045	protein-coding gene	gene with protein product		603410	"""frizzled (Drosophila) homolog 7"", ""frizzled homolog 7 (Drosophila)"", ""frizzled 7, seven transmembrane spanning receptor"", ""frizzled family receptor 7"""			9707618, 9813155	Standard	NM_003507		Approved	FzE3	uc002uyw.1	O75084	OTTHUMG00000132841	ENST00000286201.1:c.972C>G	2.37:g.202900342C>G	ENSP00000286201:p.Tyr324*	179	0	2133	217	67	NM_003507	0	0	0	0	0	O94816|Q53S59|Q96B74	Nonsense_Mutation	SNP	ENST00000286201.1	37	CCDS2351.1	.	.	.	.	.	.	.	.	.	.	C	36	5.730939	0.96856	.	.	ENSG00000155760	ENST00000286201	.	.	.	5.54	5.54	0.83059	.	0.140083	0.49916	D	0.000138	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.4882	0.95039	0.0:1.0:0.0:0.0	.	.	.	.	X	324	.	ENSP00000286201:Y324X	Y	+	3	2	FZD7	202608587	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.927000	0.63440	2.618000	0.88619	0.563000	0.77884	TAC	.		0.632	FZD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256314.1	NM_003507	
FAM117B	150864	hgsc.bcm.edu	37	2	203500481	203500481	+	Silent	SNP	A	A	C			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr2:203500481A>C	ENST00000392238.2	+	1	571	c.571A>C	c.(571-573)Agg>Cgg	p.R191R	FAM117B_ENST00000303116.6_5'UTR			Q6P1L5	F117B_HUMAN	family with sequence similarity 117, member B	191										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(5)|ovary(1)	17						GCCGGAGAAGAGGAGCCCCAG	0.731																																					p.R191R		.											.	FAM117B-91	0			c.A571C						.						2.0	2.0	2.0					2																	203500481		404	1189	1593	SO:0001819	synonymous_variant	150864	exon1			GAGAAGAGGAGCC	AB053315	CCDS33362.1, CCDS33362.2	2q33	2008-08-18	2008-08-18	2008-08-18	ENSG00000138439	ENSG00000138439			14440	protein-coding gene	gene with protein product			"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 13"""	ALS2CR13		11586298	Standard	NM_173511		Approved	FLJ38771	uc010zhx.2	Q6P1L5	OTTHUMG00000154550	ENST00000392238.2:c.571A>C	2.37:g.203500481A>C		0	0		5	5	NM_173511	0	0	1	4	3	Q53QZ5|Q585T9|Q8N8W1|Q96Q34	Silent	SNP	ENST00000392238.2	37	CCDS33362.2																																																																																			.		0.731	FAM117B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000335888.3	NM_173511	
RPE	6120	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	210881324	210881324	+	Missense_Mutation	SNP	G	G	A			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr2:210881324G>A	ENST00000359429.6	+	4	533	c.436G>A	c.(436-438)Ggg>Agg	p.G146R	RPE_ENST00000429921.1_Missense_Mutation_p.G96R|RPE_ENST00000411934.2_Missense_Mutation_p.G78R|RPE_ENST00000435437.2_Missense_Mutation_p.G146R|RPE_ENST00000452025.1_Missense_Mutation_p.G146R|RPE_ENST00000354506.6_Missense_Mutation_p.G138R|RPE_ENST00000429907.1_Missense_Mutation_p.G78R|RPE_ENST00000445268.1_Missense_Mutation_p.G78R|RPE_ENST00000454822.1_Missense_Mutation_p.G96R|RPE_ENST00000438204.2_Missense_Mutation_p.G78R|RPE_ENST00000436630.2_Missense_Mutation_p.G96R|RPE_ENST00000540255.1_Missense_Mutation_p.G146R	NM_199229.1	NP_954699.1	Q96AT9	RPE_HUMAN	ribulose-5-phosphate-3-epimerase	146	Substrate binding.				carbohydrate metabolic process (GO:0005975)|pentose-phosphate shunt (GO:0006098)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|ribulose-phosphate 3-epimerase activity (GO:0004750)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|skin(2)	9				Epithelial(149;0.00241)|Lung(261;0.041)|all cancers(144;0.0429)|LUSC - Lung squamous cell carcinoma(261;0.0431)		AGTGGAACCGGGGTTTGGAGG	0.438																																					p.G146R		.											.	RPE-90	0			c.G436A						.						132.0	129.0	130.0					2																	210881324		2203	4300	6503	SO:0001583	missense	6120	exon4			GAACCGGGGTTTG		CCDS2388.1, CCDS42810.1, CCDS63107.1, CCDS63108.1	2q32-q33.3	2012-10-02			ENSG00000197713	ENSG00000197713	5.1.3.1		10293	protein-coding gene	gene with protein product		180480					Standard	NM_199229		Approved		uc002vdn.4	Q96AT9	OTTHUMG00000154690	ENST00000359429.6:c.436G>A	2.37:g.210881324G>A	ENSP00000352401:p.Gly146Arg	177	0		159	118	NM_199229	0	0	0	19	19	A8K4S0|B4E016|C9JPQ7|O43767|Q53TV9|Q8N215|Q96N34|Q9BSB5	Missense_Mutation	SNP	ENST00000359429.6	37	CCDS2388.1	.	.	.	.	.	.	.	.	.	.	G	34	5.304604	0.95601	.	.	ENSG00000197713	ENST00000359429;ENST00000436630;ENST00000408981;ENST00000454822;ENST00000429921;ENST00000540255;ENST00000438265;ENST00000429907;ENST00000441588;ENST00000445268;ENST00000452025;ENST00000438204;ENST00000411934;ENST00000435437;ENST00000354506	.	.	.	5.45	5.45	0.79879	Aldolase-type TIM barrel (1);Ribulose-phosphate binding barrel (1);	0.000000	0.85682	D	0.000000	D	0.85852	0.5793	M	0.90369	3.11	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.88209	0.2889	9	0.87932	D	0	-3.1604	19.2659	0.93985	0.0:0.0:1.0:0.0	.	146;138;146;146	B4E016;E7EW52;Q96AT9;C9J9T0	.;.;RPE_HUMAN;.	R	146;96;78;96;96;146;96;78;78;78;146;78;78;146;138	.	ENSP00000346501:G138R	G	+	1	0	RPE	210589569	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.777000	0.99008	2.725000	0.93324	0.655000	0.94253	GGG	.		0.438	RPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336574.2	NM_006916	
CUL3	8452	bcgsc.ca	37	2	225449679	225449679	+	Missense_Mutation	SNP	C	C	T			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr2:225449679C>T	ENST00000264414.4	-	1	386	c.48G>A	c.(46-48)atG>atA	p.M16I	CUL3_ENST00000344951.4_Missense_Mutation_p.M16I	NM_003590.4	NP_003581.1	Q13618	CUL3_HUMAN	cullin 3	16					cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|COPII vesicle coating (GO:0048208)|cyclin catabolic process (GO:0008054)|embryonic cleavage (GO:0040016)|ER to Golgi vesicle-mediated transport (GO:0006888)|G1/S transition of mitotic cell cycle (GO:0000082)|gastrulation (GO:0007369)|integrin-mediated signaling pathway (GO:0007229)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic metaphase plate congression (GO:0007080)|negative regulation of Rho protein signal transduction (GO:0035024)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|stem cell division (GO:0017145)|stress fiber assembly (GO:0043149)|trophectodermal cellular morphogenesis (GO:0001831)|Wnt signaling pathway (GO:0016055)	Cul3-RING ubiquitin ligase complex (GO:0031463)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|nucleus (GO:0005634)|polar microtubule (GO:0005827)	POZ domain binding (GO:0031208)			endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(2)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	46		all_lung(227;0.00877)|Lung NSC(271;0.011)|Renal(207;0.0112)|all_hematologic(139;0.138)		Epithelial(121;1.58e-11)|all cancers(144;1.43e-08)|Lung(261;0.00863)|LUSC - Lung squamous cell carcinoma(224;0.00902)		CCCGGATCCGCATCTTGGTGT	0.736																																					p.M16I													.	CUL3-229	0			c.G48A						.						37.0	35.0	35.0					2																	225449679		2200	4300	6500	SO:0001583	missense	8452	exon1			GATCCGCATCTTG	U58089	CCDS2462.1, CCDS58751.1	2q36.2	2011-05-24			ENSG00000036257	ENSG00000036257			2553	protein-coding gene	gene with protein product		603136				8681378, 17192413	Standard	NM_003590		Approved		uc002vny.3	Q13618	OTTHUMG00000133167	ENST00000264414.4:c.48G>A	2.37:g.225449679C>T	ENSP00000264414:p.Met16Ile	79	2		128	90	NM_003590	0	0	0	0	0	A8K536|B8ZZC3|O75415|Q569L3|Q9UBI8|Q9UET7	Missense_Mutation	SNP	ENST00000264414.4	37	CCDS2462.1	.	.	.	.	.	.	.	.	.	.	C	12.27	1.887994	0.33348	.	.	ENSG00000036257	ENST00000264414;ENST00000344951	T;T	0.66995	-0.24;-0.15	2.95	1.93	0.25924	.	0.000000	0.85682	U	0.000000	T	0.40862	0.1134	N	0.14661	0.345	0.20196	N	0.999924	B;P	0.35077	0.011;0.483	B;B	0.27887	0.043;0.084	T	0.24225	-1.0166	10	0.22109	T	0.4	.	9.904	0.41364	0.0:0.7891:0.2109:0.0	.	16;16	Q13618-3;Q13618	.;CUL3_HUMAN	I	16	ENSP00000264414:M16I;ENSP00000343601:M16I	ENSP00000264414:M16I	M	-	3	0	CUL3	225157923	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.228000	0.42981	1.170000	0.42753	0.313000	0.20887	ATG	.		0.736	CUL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256871.2		
VSX1	30813	hgsc.bcm.edu	37	20	25062342	25062342	+	Missense_Mutation	SNP	G	G	T	rs6050307	byFrequency	TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr20:25062342G>T	ENST00000376709.4	-	1	654	c.391C>A	c.(391-393)Cgc>Agc	p.R131S	VSX1_ENST00000429762.3_Missense_Mutation_p.R131S|VSX1_ENST00000398332.1_Missense_Mutation_p.R131S|VSX1_ENST00000444511.2_Missense_Mutation_p.R131S|VSX1_ENST00000451258.1_Missense_Mutation_p.R131S|VSX1_ENST00000424574.1_Missense_Mutation_p.R131S|VSX1_ENST00000376707.3_Missense_Mutation_p.R131S	NM_014588.5	NP_055403.2	Q9NZR4	VSX1_HUMAN	visual system homeobox 1	131			R -> S (in dbSNP:rs6050307). {ECO:0000269|PubMed:15051220}.		neuron maturation (GO:0042551)|response to stimulus (GO:0050896)|retinal bipolar neuron differentiation (GO:0060040)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(3)|lung(2)	6						CGCTTCTGGCGGCCGAGCGCA	0.741													G|||	206	0.0411342	0.1483	0.0144	5008	,	,		11176	0.0		0.0	False		,,,				2504	0.0				p.R131S		.											.	VSX1-90	0			c.C391A						.	G	SER/ARG,SER/ARG	328,3228		8,312,1458	4.0	4.0	4.0		391,391	-3.9	0.0	20	dbSNP_114	4	13,6761		0,13,3374	yes	missense,missense	VSX1	NM_014588.4,NM_199425.1	110,110	8,325,4832	TT,TG,GG		0.1919,9.2238,3.3011	benign,benign	131/366,131/240	25062342	341,9989	1778	3387	5165	SO:0001583	missense	30813	exon1			TCTGGCGGCCGAG	AF176797	CCDS13168.1, CCDS13169.1, CCDS58766.1, CCDS58767.1	20p11.21	2014-02-14	2007-07-12		ENSG00000100987	ENSG00000100987		"""Homeoboxes / PRD class"""	12723	protein-coding gene	gene with protein product		605020	"""posterior polymorphous corneal dystrophy"", ""visual system homeobox 1 homolog, CHX10-like (zebrafish)"""	PPCD		10673340	Standard	NM_001256272		Approved	PPD, PPCD1	uc002wuf.4	Q9NZR4	OTTHUMG00000032111	ENST00000376709.4:c.391C>A	20.37:g.25062342G>T	ENSP00000365899:p.Arg131Ser	1	0		19	10	NM_014588	0	0	0	0	0	B9EGJ4|D1MF28|Q0GM60|Q0GM61|Q0GM62|Q0GM63|Q0GM64|Q0GM65|Q5TF40|Q5TF41|Q9HCU3|Q9NU27	Missense_Mutation	SNP	ENST00000376709.4	37	CCDS13168.1	90	0.04120879120879121	82	0.16666666666666666	8	0.022099447513812154	0	0.0	0	0.0	G	3.761	-0.049660	0.07407	0.092238	0.001919	ENSG00000100987	ENST00000429762;ENST00000444511;ENST00000424574;ENST00000451258;ENST00000376709;ENST00000376707;ENST00000398332	D;D;D;D;D;D;T	0.91792	-2.73;-2.91;-2.72;-2.77;-2.82;-2.83;-0.0	4.14	-3.91	0.04168	.	1.617690	0.02904	N	0.135773	T	0.00412	0.0013	N	0.00926	-1.1	0.80722	P	0.0	B;B;B;B	0.09022	0.001;0.0;0.002;0.0	B;B;B;B	0.06405	0.001;0.002;0.001;0.001	T	0.56992	-0.7887	9	0.06625	T	0.88	.	0.1523	0.00094	0.3252:0.149:0.2095:0.3163	rs6050307;rs61429181	131;131;131;131	Q9NZR4-7;Q9NZR4-8;Q9NZR4-2;Q9NZR4	.;.;.;VSX1_HUMAN	S	131	ENSP00000401690:R131S;ENSP00000387720:R131S;ENSP00000399496:R131S;ENSP00000389654:R131S;ENSP00000365899:R131S;ENSP00000365897:R131S;ENSP00000381376:R131S	ENSP00000365897:R131S	R	-	1	0	VSX1	25010342	0.000000	0.05858	0.000000	0.03702	0.543000	0.35085	-0.882000	0.04174	-0.591000	0.05859	0.563000	0.77884	CGC	G|0.959;T|0.041		0.741	VSX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078384.3		
FRG1B	284802	bcgsc.ca	37	20	29623218	29623218	+	Silent	SNP	A	A	G	rs368763678	byFrequency	TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr20:29623218A>G	ENST00000278882.3	+	3	410	c.30A>G	c.(28-30)acA>acG	p.T10T	FRG1B_ENST00000358464.4_Silent_p.T10T|FRG1B_ENST00000439954.2_Missense_Mutation_p.N12D			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	10								p.T10T(4)		endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						TGCACTCGACAATGGTCTTTT	0.408													.|||	318	0.0634984	0.0212	0.0692	5008	,	,		48514	0.0228		0.1431	False		,,,				2504	0.0767				.													.	FRG1B-22	4	Substitution - coding silent(4)	endometrium(2)|kidney(2)	.						.																																			SO:0001819	synonymous_variant	284802	.			CTCGACAATGGTC			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.30A>G	20.37:g.29623218A>G		882	20		985	40	.	0	0	41	55	14	C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	a	9.656	1.142954	0.21205	.	.	ENSG00000149531	ENST00000439954	T	0.51817	0.69	1.93	1.93	0.25924	.	.	.	.	.	T	0.50803	0.1637	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50242	-0.8851	6	0.48119	T	0.1	.	7.8149	0.29254	1.0:0.0:0.0:0.0	.	.	.	.	D	12	ENSP00000408863:N12D	ENSP00000408863:N12D	N	+	1	0	FRG1B	28236879	1.000000	0.71417	1.000000	0.80357	0.105000	0.19272	7.836000	0.86788	1.147000	0.42369	0.347000	0.21830	AAT	.		0.408	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
ZBTB46	140685	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	62378613	62378613	+	Missense_Mutation	SNP	G	G	T			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr20:62378613G>T	ENST00000245663.4	-	5	1590	c.1440C>A	c.(1438-1440)agC>agA	p.S480R	ZBTB46_ENST00000395104.1_Missense_Mutation_p.S480R|RP4-583P15.10_ENST00000433905.2_RNA|ZBTB46_ENST00000302995.2_Missense_Mutation_p.S480R|RP4-583P15.10_ENST00000447343.2_RNA	NM_025224.3	NP_079500.2	Q86UZ6	ZBT46_HUMAN	zinc finger and BTB domain containing 46	480					negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of monocyte differentiation (GO:0045656)|positive regulation of dendritic cell differentiation (GO:2001200)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(2)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	24	all_cancers(38;2.09e-12)|all_epithelial(29;3.8e-14)|Lung NSC(23;7.61e-10)|all_lung(23;2.64e-09)					TGAAGACGCGGCTGCACACCT	0.701																																					p.S480R		.											.	ZBTB46-154	0			c.C1440A						.						9.0	7.0	8.0					20																	62378613		2124	4163	6287	SO:0001583	missense	140685	exon5			GACGCGGCTGCAC	AK131482	CCDS13538.1	20q13.33	2013-01-08	2006-09-19	2006-09-19	ENSG00000130584	ENSG00000130584		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	16094	protein-coding gene	gene with protein product	"""BTB-ZF protein expressed in effector lymphocytes"""	614639	"""BTB (POZ) domain containing 4"""	ZNF340, BTBD4			Standard	NM_025224		Approved	FLJ13502, RINZF, BZEL	uc002ygv.2	Q86UZ6	OTTHUMG00000033001	ENST00000245663.4:c.1440C>A	20.37:g.62378613G>T	ENSP00000245663:p.Ser480Arg	64	0		138	52	NM_025224	0	0	0	0	0	E1P5K9|Q5JWJ3|Q6GMV4|Q9BQK3|Q9H3Z8|Q9H3Z9	Missense_Mutation	SNP	ENST00000245663.4	37	CCDS13538.1	.	.	.	.	.	.	.	.	.	.	G	14.61	2.585999	0.46110	.	.	ENSG00000130584	ENST00000245663;ENST00000302995;ENST00000395104	T;T;T	0.15487	2.42;2.42;2.42	4.29	3.16	0.36331	Zinc finger, C2H2-like (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.174840	0.48767	D	0.000179	T	0.11793	0.0287	L	0.28504	0.86	0.46336	D	0.998998	P	0.38048	0.616	B	0.35278	0.199	T	0.09509	-1.0671	10	0.39692	T	0.17	.	10.1961	0.43056	0.1118:0.0:0.8882:0.0	.	480	Q86UZ6	ZBT46_HUMAN	R	480	ENSP00000245663:S480R;ENSP00000303102:S480R;ENSP00000378536:S480R	ENSP00000245663:S480R	S	-	3	2	ZBTB46	61849057	1.000000	0.71417	0.991000	0.47740	0.822000	0.46500	2.148000	0.42235	0.504000	0.28082	0.462000	0.41574	AGC	.		0.701	ZBTB46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080232.2	NM_025224	
RRP7A	27341	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	42912080	42912080	+	Missense_Mutation	SNP	C	C	A			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr22:42912080C>A	ENST00000323013.6	-	3	294	c.279G>T	c.(277-279)aaG>aaT	p.K93N		NM_015703.4	NP_056518.2	Q9Y3A4	RRP7A_HUMAN	ribosomal RNA processing 7 homolog A (S. cerevisiae)	93							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|liver(2)|lung(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	10						CCAGGTCCGGCTTCTCCTGCA	0.617																																					p.K93N		.											.	RRP7A-91	0			c.G279T						.						57.0	51.0	53.0					22																	42912080		2203	4300	6503	SO:0001583	missense	27341	exon3			GTCCGGCTTCTCC	BC035992	CCDS14036.1	22q13.2	2008-08-08			ENSG00000189306	ENSG00000189306			24286	protein-coding gene	gene with protein product						10810093, 12087473	Standard	NM_015703		Approved	CGI-96	uc003bcq.3	Q9Y3A4	OTTHUMG00000150891	ENST00000323013.6:c.279G>T	22.37:g.42912080C>A	ENSP00000321449:p.Lys93Asn	119	0		121	50	NM_015703	0	0	26	37	11	A4FTX2|B2RBG4|Q0VAD0|Q5JZ94|Q6P4B5|Q8IVR9|Q8IVY0|Q8N5Q3|Q8NEY6|Q9Y3H5	Missense_Mutation	SNP	ENST00000323013.6	37	CCDS14036.1	.	.	.	.	.	.	.	.	.	.	C	12.33	1.907011	0.33628	.	.	ENSG00000189306	ENST00000323013	T	0.15952	2.38	3.93	2.9	0.33743	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (1);	0.106611	0.64402	D	0.000007	T	0.30103	0.0754	M	0.72576	2.205	0.51012	D	0.999906	D	0.56035	0.974	P	0.55577	0.779	T	0.03818	-1.1001	10	0.72032	D	0.01	-34.7209	8.4778	0.33023	0.0:0.7373:0.0:0.2627	.	93	Q9Y3A4	RRP7A_HUMAN	N	93	ENSP00000321449:K93N	ENSP00000321449:K93N	K	-	3	2	RRP7A	41242024	1.000000	0.71417	0.993000	0.49108	0.007000	0.05969	0.731000	0.26058	0.946000	0.37632	-0.346000	0.07831	AAG	.		0.617	RRP7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320451.1	NM_015703	
BHLHE40	8553	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	5024970	5024970	+	Missense_Mutation	SNP	A	A	C			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr3:5024970A>C	ENST00000256495.3	+	5	1435	c.832A>C	c.(832-834)Att>Ctt	p.I278L		NM_003670.2	NP_003661.1	O14503	BHE40_HUMAN	basic helix-loop-helix family, member e40	278					circadian regulation of gene expression (GO:0032922)|entrainment of circadian clock by photoperiod (GO:0043153)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	bHLH transcription factor binding (GO:0043425)|E-box binding (GO:0070888)|MRF binding (GO:0043426)|protein domain specific binding (GO:0019904)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(1)|lung(2)|ovary(1)|skin(2)	12						GATCGGCGCAATTAAGCAAGA	0.537																																					p.I278L		.											.	BHLHE40-91	0			c.A832C						.						76.0	77.0	77.0					3																	5024970		2203	4300	6503	SO:0001583	missense	8553	exon5			GGCGCAATTAAGC	AB004066	CCDS2565.1	3p26	2009-01-12	2009-01-12	2009-01-12	ENSG00000134107	ENSG00000134107		"""Basic helix-loop-helix proteins"""	1046	protein-coding gene	gene with protein product	"""differentially expressed in chondrocytes 1"", "" differentiated embryo chondrocyte expressed gene 1"""	604256	"""basic helix-loop-helix domain containing, class B, 2"""	STRA13, BHLHB2		9240428, 10449910, 18557763	Standard	NM_003670		Approved	DEC1, bHLHe40	uc003bqf.3	O14503	OTTHUMG00000119035	ENST00000256495.3:c.832A>C	3.37:g.5024970A>C	ENSP00000256495:p.Ile278Leu	82	0		96	38	NM_003670	0	0	56	94	38	Q96TD3	Missense_Mutation	SNP	ENST00000256495.3	37	CCDS2565.1	.	.	.	.	.	.	.	.	.	.	A	17.95	3.513068	0.64522	.	.	ENSG00000134107	ENST00000256495	T	0.79845	-1.31	5.62	4.47	0.54385	.	0.309371	0.35970	N	0.002872	D	0.85944	0.5815	M	0.75615	2.305	0.80722	D	1	D	0.56035	0.974	P	0.57911	0.829	D	0.85230	0.1032	10	0.46703	T	0.11	.	11.0922	0.48123	0.9283:0.0:0.0717:0.0	.	278	O14503	BHE40_HUMAN	L	278	ENSP00000256495:I278L	ENSP00000256495:I278L	I	+	1	0	BHLHE40	4999970	1.000000	0.71417	0.912000	0.35992	0.165000	0.22458	7.345000	0.79337	0.983000	0.38602	0.533000	0.62120	ATT	.		0.537	BHLHE40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239244.2	NM_003670	
XPC	7508	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	14188804	14188804	+	Missense_Mutation	SNP	G	G	C	rs373301509		TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr3:14188804G>C	ENST00000285021.7	-	15	2804	c.2590C>G	c.(2590-2592)Cgc>Ggc	p.R864G	RP11-434D12.1_ENST00000608606.1_Intron|AC093495.4_ENST00000420253.1_RNA|RP11-434D12.1_ENST00000601399.1_Intron|XPC_ENST00000449060.2_Missense_Mutation_p.R827G|AC093495.4_ENST00000428681.3_RNA	NM_001145769.1|NM_004628.4	NP_001139241.1|NP_004619.3	Q01831	XPC_HUMAN	xeroderma pigmentosum, complementation group C	864	Interaction with CETN2.|Interaction with ERCC2 and GTF2H1.				DNA repair (GO:0006281)|intra-S DNA damage checkpoint (GO:0031573)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage recognition (GO:0000715)|nucleotide-excision repair, DNA damage removal (GO:0000718)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to drug (GO:0042493)|response to UV-B (GO:0010224)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|XPC complex (GO:0071942)	bubble DNA binding (GO:0000405)|damaged DNA binding (GO:0003684)|heteroduplex DNA loop binding (GO:0000404)|single-stranded DNA binding (GO:0003697)			NS(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						GGCCCGTAGCGACGCTTCAGC	0.547			"""Mis, N, F, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																												p.R864G		.	yes	Rec		Xeroderma pigmentosum (C)	3	3p25	7508	"""xeroderma pigmentosum, complementation group C"""		E	.	XPC-662	0			c.C2590G						.						53.0	57.0	56.0					3																	14188804		1998	4157	6155	SO:0001583	missense	7508	exon15	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	CGTAGCGACGCTT		CCDS46763.1	3p25.1	2014-09-17			ENSG00000154767	ENSG00000154767			12816	protein-coding gene	gene with protein product	"""xeroderma pigmentosum group C protein"""	613208				1522891	Standard	NM_004628		Approved	XPCC, RAD4	uc011ave.2	Q01831	OTTHUMG00000155526	ENST00000285021.7:c.2590C>G	3.37:g.14188804G>C	ENSP00000285021:p.Arg864Gly	60	0		110	8	NM_004628	0	0	1	1	0	B4DIP3|E9PB96|E9PH69|Q53GT7|Q96AX0	Missense_Mutation	SNP	ENST00000285021.7	37	CCDS46763.1	.	.	.	.	.	.	.	.	.	.	G	19.14	3.770436	0.69992	.	.	ENSG00000154767	ENST00000285021;ENST00000449060	T;T	0.36157	1.27;1.29	5.18	4.3	0.51218	.	0.000000	0.85682	D	0.000000	T	0.59959	0.2232	M	0.78801	2.425	0.80722	D	1	D;D	0.76494	0.996;0.999	P;D	0.70716	0.903;0.97	T	0.64437	-0.6408	10	0.49607	T	0.09	-14.9319	15.159	0.72767	0.0:0.0:0.8577:0.1423	.	827;864	E9PH69;Q01831	.;XPC_HUMAN	G	864;827	ENSP00000285021:R864G;ENSP00000404002:R827G	ENSP00000285021:R864G	R	-	1	0	XPC	14163805	1.000000	0.71417	0.891000	0.34965	0.837000	0.47467	6.671000	0.74472	1.385000	0.46445	0.591000	0.81541	CGC	.		0.547	XPC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000340517.3	NM_004628	
DAG1	1605	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	49568609	49568609	+	Missense_Mutation	SNP	T	T	C			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr3:49568609T>C	ENST00000539901.1	+	3	1223	c.665T>C	c.(664-666)cTt>cCt	p.L222P	DAG1_ENST00000541308.1_Missense_Mutation_p.L222P|DAG1_ENST00000515359.2_Missense_Mutation_p.L222P|DAG1_ENST00000545947.1_Missense_Mutation_p.L222P|DAG1_ENST00000538711.1_Missense_Mutation_p.L222P|DAG1_ENST00000308775.2_Missense_Mutation_p.L222P	NM_001177644.2	NP_001171115	Q14118	DAG1_HUMAN	dystroglycan 1 (dystrophin-associated glycoprotein 1)	222	Required for laminin recognition.				basement membrane organization (GO:0071711)|branching involved in salivary gland morphogenesis (GO:0060445)|calcium-dependent cell-matrix adhesion (GO:0016340)|commissural neuron axon guidance (GO:0071679)|cytoskeletal anchoring at plasma membrane (GO:0007016)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|extracellular matrix organization (GO:0030198)|membrane protein ectodomain proteolysis (GO:0006509)|microtubule anchoring (GO:0034453)|modulation by virus of host morphology or physiology (GO:0019048)|morphogenesis of an epithelial sheet (GO:0002011)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cell migration (GO:0030336)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of protein kinase B signaling (GO:0051898)|nerve maturation (GO:0021682)|NLS-bearing protein import into nucleus (GO:0006607)|response to peptide hormone (GO:0043434)	basement membrane (GO:0005604)|basolateral plasma membrane (GO:0016323)|cell outer membrane (GO:0009279)|cell-cell adherens junction (GO:0005913)|contractile ring (GO:0070938)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystroglycan complex (GO:0016011)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|membrane raft (GO:0045121)|node of Ranvier (GO:0033268)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|alpha-actinin binding (GO:0051393)|calcium ion binding (GO:0005509)|laminin-1 binding (GO:0043237)|SH2 domain binding (GO:0042169)|structural constituent of muscle (GO:0008307)|tubulin binding (GO:0015631)|vinculin binding (GO:0017166)|virus receptor activity (GO:0001618)			NS(1)|autonomic_ganglia(2)|breast(2)|endometrium(1)|large_intestine(8)|lung(5)|ovary(2)|prostate(1)|skin(1)	23				BRCA - Breast invasive adenocarcinoma(193;5.13e-05)|Kidney(197;0.00241)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		GAAGTAGAGCTTCACAACATG	0.493																																					p.L222P		.											.	DAG1-92	0			c.T665C						.						76.0	81.0	80.0					3																	49568609		2203	4300	6503	SO:0001583	missense	1605	exon4			TAGAGCTTCACAA	L19711	CCDS2799.1	3p21	2014-09-17			ENSG00000173402	ENSG00000173402			2666	protein-coding gene	gene with protein product	"""alpha-dystroglycan"", ""dystrophin-associated glycoprotein-1"", ""beta-dystroglycan"""	128239				7774920, 1741056	Standard	NM_001177643		Approved	A3a, 156DAG, AGRNR, DAG	uc021wyd.1	Q14118	OTTHUMG00000156869	ENST00000539901.1:c.665T>C	3.37:g.49568609T>C	ENSP00000439334:p.Leu222Pro	124	0		116	47	NM_001177642	0	0	4	4	0	A8K6M7|Q969J9	Missense_Mutation	SNP	ENST00000539901.1	37	CCDS2799.1	.	.	.	.	.	.	.	.	.	.	T	11.97	1.798715	0.31777	.	.	ENSG00000173402	ENST00000515359;ENST00000308775;ENST00000545947;ENST00000541308;ENST00000539901;ENST00000538711;ENST00000415315	T;T;T;T;T;T	0.81163	-1.46;-1.46;-1.46;-1.46;-1.46;-1.46	5.92	3.55	0.40652	.	0.170769	0.52532	N	0.000062	T	0.76652	0.4017	M	0.65975	2.015	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.70368	-0.4891	10	0.51188	T	0.08	-12.03	9.6231	0.39734	0.0:0.1436:0.0:0.8564	.	222	Q14118	DAG1_HUMAN	P	222;222;222;222;222;222;21	ENSP00000440705:L222P;ENSP00000312435:L222P;ENSP00000442600:L222P;ENSP00000440590:L222P;ENSP00000439334:L222P;ENSP00000438421:L222P	ENSP00000312435:L222P	L	+	2	0	DAG1	49543613	1.000000	0.71417	0.997000	0.53966	0.982000	0.71751	4.211000	0.58507	0.496000	0.27904	0.533000	0.62120	CTT	.		0.493	DAG1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346326.1		
MAPKAPK3	7867	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	50685441	50685441	+	Silent	SNP	C	C	G			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr3:50685441C>G	ENST00000446044.1	+	13	1709	c.1113C>G	c.(1111-1113)ggC>ggG	p.G371G	MAPKAPK3_ENST00000357955.2_Silent_p.G371G	NM_001243926.1	NP_001230855.1	Q16644	MAPK3_HUMAN	mitogen-activated protein kinase-activated protein kinase 3	371					activation of MAPK activity (GO:0000187)|innate immune response (GO:0045087)|macropinocytosis (GO:0044351)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|Ras protein signal transduction (GO:0007265)|response to cytokine (GO:0034097)|response to lipopolysaccharide (GO:0032496)|response to stress (GO:0006950)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|ovary(1)	2				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.0188)|Kidney(197;0.0223)		AGCAGGCAGGCAGCTCCTCTG	0.562																																					p.G371G		.											.	MAPKAPK3-1423	0			c.C1113G						.						69.0	69.0	69.0					3																	50685441		2203	4300	6503	SO:0001819	synonymous_variant	7867	exon11			GGCAGGCAGCTCC	U43784	CCDS2832.1	3p21.3	2004-03-10			ENSG00000114738	ENSG00000114738			6888	protein-coding gene	gene with protein product		602130				8626550, 8622688	Standard	NM_004635		Approved	3pK, MAPKAP3, 3PK	uc003dba.2	Q16644	OTTHUMG00000156850	ENST00000446044.1:c.1113C>G	3.37:g.50685441C>G		246	1		260	110	NM_004635	0	0	21	44	23	B5BU67	Silent	SNP	ENST00000446044.1	37	CCDS2832.1	.	.	.	.	.	.	.	.	.	.	C	9.156	1.017372	0.19355	.	.	ENSG00000114738	ENST00000451680	.	.	.	5.73	2.59	0.31030	.	.	.	.	.	T	0.53626	0.1808	.	.	.	0.45733	D	0.998639	.	.	.	.	.	.	T	0.49194	-0.8965	4	.	.	.	-29.6661	6.4693	0.21999	0.2822:0.5832:0.0:0.1346	.	.	.	.	E	86	.	.	Q	+	1	0	MAPKAPK3	50660445	0.089000	0.21612	0.973000	0.42090	0.978000	0.69477	0.290000	0.18975	1.409000	0.46915	0.655000	0.94253	CAG	.		0.562	MAPKAPK3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346237.1	NM_004635	
MAGI1	9223	hgsc.bcm.edu	37	3	65425597	65425597	+	Silent	SNP	C	C	T	rs571281009	byFrequency	TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr3:65425597C>T	ENST00000497477.2	-	9	1226	c.1227G>A	c.(1225-1227)caG>caA	p.Q409Q	MAGI1_ENST00000330909.8_Silent_p.Q409Q|MAGI1_ENST00000470990.1_5'UTR|MAGI1_ENST00000483466.1_Silent_p.Q409Q|MAGI1_ENST00000402939.2_Silent_p.Q409Q			Q96QZ7	MAGI1_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 1	409	Poly-Gln.				cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|neuron death (GO:0070997)|protein complex assembly (GO:0006461)	cell junction (GO:0030054)|cell projection (GO:0042995)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	alpha-actinin binding (GO:0051393)|ATP binding (GO:0005524)|protein C-terminus binding (GO:0008022)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|liver(1)|lung(21)|pancreas(1)|skin(5)	51		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)		gctgttgctgctgctgttgct	0.532											OREG0015658	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	C|||	49	0.00978435	0.0325	0.0043	5008	,	,		14951	0.003		0.0	False		,,,				2504	0.0				p.Q409Q		.											.	MAGI1-661	0			c.G1227A						.						68.0	64.0	65.0					3																	65425597		2202	4296	6498	SO:0001819	synonymous_variant	9223	exon9			TTGCTGCTGCTGT	AB010894	CCDS33780.1, CCDS33781.1, CCDS2904.1	3p14.1	2009-10-06	2005-05-10	2005-05-10	ENSG00000151276	ENSG00000151276			946	protein-coding gene	gene with protein product		602625	"""BAI1-associated protein 1"""	BAIAP1		9647739, 9225980	Standard	XM_005265563		Approved	BAP1, MAGI-1, TNRC19, AIP3, WWP3	uc003dmn.3	Q96QZ7	OTTHUMG00000157554	ENST00000497477.2:c.1227G>A	3.37:g.65425597C>T		38	0	1084	41	7	NM_001033057	0	0	0	0	0	A8K188|O00309|O43863|O75085|Q96QZ8|Q96QZ9	Silent	SNP	ENST00000497477.2	37		.	.	.	.	.	.	.	.	.	.	C	1.115	-0.657141	0.03480	.	.	ENSG00000151276	ENST00000460329	.	.	.	3.23	1.37	0.22104	.	.	.	.	.	T	0.23014	0.0556	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	T	0.22277	-1.0221	4	.	.	.	0.0018	2.6711	0.05067	0.2253:0.507:0.0:0.2677	.	.	.	.	N	290	.	.	S	-	2	0	MAGI1	65400637	0.651000	0.27340	0.048000	0.18961	0.002000	0.02628	-0.987000	0.03743	0.095000	0.17434	-0.850000	0.03035	AGC	.		0.532	MAGI1-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000349132.2	NM_004742	
ABHD10	55347	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	111710242	111710242	+	Missense_Mutation	SNP	A	A	C			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr3:111710242A>C	ENST00000273359.3	+	5	622	c.595A>C	c.(595-597)Atg>Ctg	p.M199L	ABHD10_ENST00000534857.1_Missense_Mutation_p.M42L|ABHD10_ENST00000494817.1_3'UTR	NM_018394.2	NP_060864.1	Q9NUJ1	ABHDA_HUMAN	abhydrolase domain containing 10	199					glucuronoside catabolic process (GO:0019391)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			large_intestine(2)|lung(7)|skin(1)	10						GGAAGTAGAGATGAAAGGTGT	0.323																																					p.M199L		.											.	ABHD10-90	0			c.A595C						.						79.0	75.0	76.0					3																	111710242		2203	4300	6503	SO:0001583	missense	55347	exon5			GTAGAGATGAAAG	AL713726	CCDS2963.1, CCDS63718.1	3q13.2	2012-03-26			ENSG00000144827	ENSG00000144827		"""Abhydrolase domain containing"""	25656	protein-coding gene	gene with protein product						22294686	Standard	NM_018394		Approved	FLJ11342	uc003dyk.5	Q9NUJ1	OTTHUMG00000159280	ENST00000273359.3:c.595A>C	3.37:g.111710242A>C	ENSP00000273359:p.Met199Leu	154	0		151	34	NM_018394	0	0	13	24	11	B7Z6A8|C9IZX5|D3DN63|Q8TCF9	Missense_Mutation	SNP	ENST00000273359.3	37	CCDS2963.1	.	.	.	.	.	.	.	.	.	.	A	12.86	2.064132	0.36373	.	.	ENSG00000144827	ENST00000534857;ENST00000273359	T;T	0.66099	1.02;-0.19	5.47	-3.29	0.05017	.	0.598228	0.18438	N	0.141217	T	0.33585	0.0868	N	0.19112	0.55	0.23445	N	0.997665	B	0.02656	0.0	B	0.06405	0.002	T	0.06661	-1.0814	10	0.30078	T	0.28	-12.4265	1.0289	0.01533	0.3041:0.125:0.3257:0.2452	.	199	Q9NUJ1	ABHDA_HUMAN	L	42;199	ENSP00000442932:M42L;ENSP00000273359:M199L	ENSP00000273359:M199L	M	+	1	0	ABHD10	113192932	1.000000	0.71417	0.986000	0.45419	0.987000	0.75469	1.234000	0.32660	-0.436000	0.07254	0.443000	0.29094	ATG	.		0.323	ABHD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354326.1	NM_018394	
GP9	2815	broad.mit.edu	37	3	128780901	128780901	+	Missense_Mutation	SNP	G	G	T			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr3:128780901G>T	ENST00000307395.4	+	3	541	c.319G>T	c.(319-321)Gcc>Tcc	p.A107S		NM_000174.3	NP_000165.1	P14770	GPIX_HUMAN	glycoprotein IX (platelet)	107	LRRCT.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(1)|lung(4)	6					Quinine(DB00468)	CACGCCCGAGGCCCTGCTGCA	0.701																																					p.A107S													.	GP9-90	0			c.G319T						.						20.0	20.0	20.0					3																	128780901		2199	4296	6495	SO:0001583	missense	2815	exon3			CCCGAGGCCCTGC		CCDS3055.1	3q21.3	2014-09-17				ENSG00000169704		"""CD molecules"""	4444	protein-coding gene	gene with protein product		173515				2253772	Standard	XM_005247374		Approved	CD42a, GPIX	uc003elm.2	P14770		ENST00000307395.4:c.319G>T	3.37:g.128780901G>T	ENSP00000303942:p.Ala107Ser	37	2		162	12	NM_000174	0	0	0	0	0	Q14445|Q8N1D1|Q92525	Missense_Mutation	SNP	ENST00000307395.4	37	CCDS3055.1	.	.	.	.	.	.	.	.	.	.	G	6.262	0.416458	0.11870	.	.	ENSG00000169704	ENST00000307395	D	0.90069	-2.61	4.26	-0.227	0.13102	Cysteine-rich flanking region, C-terminal (1);	1.070780	0.07282	U	0.870998	T	0.72309	0.3444	N	0.05414	-0.055	0.09310	N	1	B	0.19445	0.036	B	0.18263	0.021	T	0.58211	-0.7676	10	0.17369	T	0.5	-0.9252	1.9494	0.03364	0.2082:0.1579:0.4733:0.1606	.	107	P14770	GPIX_HUMAN	S	107	ENSP00000303942:A107S	ENSP00000303942:A107S	A	+	1	0	GP9	130263591	0.000000	0.05858	0.002000	0.10522	0.150000	0.21749	0.045000	0.14013	0.051000	0.15978	0.462000	0.41574	GCC	.		0.701	GP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358428.1		
ARRDC3	57561	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	90669948	90669948	+	Missense_Mutation	SNP	A	A	C			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr5:90669948A>C	ENST00000265138.3	-	6	1282	c.1016T>G	c.(1015-1017)cTt>cGt	p.L339R	ARRDC3_ENST00000503192.1_5'Flank	NM_020801.2	NP_065852.1	Q96B67	ARRD3_HUMAN	arrestin domain containing 3	339					fat pad development (GO:0060613)|negative regulation of heat generation (GO:0031651)|negative regulation of locomotion involved in locomotory behavior (GO:0090327)|negative regulation of multicellular organismal metabolic process (GO:0044252)|positive regulation of adrenergic receptor signaling pathway (GO:0071879)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|skin development (GO:0043588)|temperature homeostasis (GO:0001659)	endosome (GO:0005768)|plasma membrane (GO:0005886)	beta-3 adrenergic receptor binding (GO:0031699)			breast(2)|endometrium(3)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|urinary_tract(1)	18		all_cancers(142;2.22e-05)|all_epithelial(76;1.58e-07)|all_lung(232;0.000521)|Lung NSC(167;0.000548)|Ovarian(174;0.0798)|Colorectal(57;0.207)		OV - Ovarian serous cystadenocarcinoma(54;4.56e-30)|Epithelial(54;7.55e-26)|all cancers(79;3.63e-22)		TCTTTCAGGAAGTGATAAACT	0.373																																					p.L339R		.											.	ARRDC3-136	0			c.T1016G						.						187.0	185.0	186.0					5																	90669948		2203	4300	6503	SO:0001583	missense	57561	exon6			TCAGGAAGTGATA	AB037797	CCDS34202.1	5q14.3	2013-10-11			ENSG00000113369	ENSG00000113369			29263	protein-coding gene	gene with protein product	"""alpha-arrestin 3"""	612464				10718198, 19605364	Standard	NM_020801		Approved	KIAA1376	uc003kjz.2	Q96B67	OTTHUMG00000162616	ENST00000265138.3:c.1016T>G	5.37:g.90669948A>C	ENSP00000265138:p.Leu339Arg	105	0		113	33	NM_020801	0	0	0	1	1	A8K6T8|Q9P2H1	Missense_Mutation	SNP	ENST00000265138.3	37	CCDS34202.1	.	.	.	.	.	.	.	.	.	.	A	22.2	4.263139	0.80358	.	.	ENSG00000113369	ENST00000265138	T	0.08984	3.03	5.77	5.77	0.91146	Immunoglobulin E-set (1);	0.000000	0.85682	D	0.000000	T	0.26085	0.0636	M	0.62723	1.935	0.80722	D	1	D	0.65815	0.995	D	0.72982	0.979	T	0.00473	-1.1718	10	0.34782	T	0.22	-10.2226	16.086	0.81049	1.0:0.0:0.0:0.0	.	339	Q96B67	ARRD3_HUMAN	R	339	ENSP00000265138:L339R	ENSP00000265138:L339R	L	-	2	0	ARRDC3	90705704	1.000000	0.71417	0.981000	0.43875	0.932000	0.56968	9.339000	0.96797	2.207000	0.71202	0.528000	0.53228	CTT	.		0.373	ARRDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369763.2	NM_020801	
PAM	5066	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	102285295	102285295	+	Missense_Mutation	SNP	C	C	T			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr5:102285295C>T	ENST00000438793.3	+	9	1168	c.698C>T	c.(697-699)gCc>gTc	p.A233V	PAM_ENST00000274392.9_Missense_Mutation_p.A136V|PAM_ENST00000379787.4_5'UTR|PAM_ENST00000346918.2_Missense_Mutation_p.A233V|PAM_ENST00000348126.2_Missense_Mutation_p.A233V|PAM_ENST00000455264.2_Missense_Mutation_p.A233V|PAM_ENST00000304400.7_Missense_Mutation_p.A233V	NM_000919.3|NM_001177306.1|NM_138766.2	NP_000910.2|NP_001170777.1|NP_620121.1	P19021	AMD_HUMAN	peptidylglycine alpha-amidating monooxygenase	233	Peptidylglycine alpha-hydroxylating monooxygenase. {ECO:0000250}.				central nervous system development (GO:0007417)|heart development (GO:0007507)|lactation (GO:0007595)|limb development (GO:0060173)|long-chain fatty acid metabolic process (GO:0001676)|maternal process involved in female pregnancy (GO:0060135)|odontogenesis (GO:0042476)|ovulation cycle process (GO:0022602)|peptide amidation (GO:0001519)|protein amidation (GO:0018032)|protein homooligomerization (GO:0051260)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of protein secretion (GO:0050708)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to copper ion (GO:0046688)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to pH (GO:0009268)|toxin metabolic process (GO:0009404)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuron projection (GO:0043005)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|secretory granule membrane (GO:0030667)|trans-Golgi network (GO:0005802)	calcium ion binding (GO:0005509)|copper ion binding (GO:0005507)|L-ascorbic acid binding (GO:0031418)|peptidylamidoglycolate lyase activity (GO:0004598)|peptidylglycine monooxygenase activity (GO:0004504)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(10)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	25		all_cancers(142;3.12e-07)|all_epithelial(76;3.48e-10)|Prostate(80;0.00914)|Lung NSC(167;0.0213)|Ovarian(225;0.024)|Colorectal(57;0.0251)|all_lung(232;0.0284)		Epithelial(69;1.1e-13)|COAD - Colon adenocarcinoma(37;0.0127)	Vitamin C(DB00126)	CATGTCTTTGCCTATAGAGTT	0.323																																					p.A233V		.											.	PAM-68	0			c.C698T						.						106.0	108.0	107.0					5																	102285295		2203	4297	6500	SO:0001583	missense	5066	exon9			TCTTTGCCTATAG	AB095007	CCDS4092.1, CCDS4093.1, CCDS4094.1, CCDS43348.1, CCDS54885.1	5q	2008-02-05			ENSG00000145730	ENSG00000145730	1.14.17.3		8596	protein-coding gene	gene with protein product	"""peptidyl-alpha-hydroxyglycine alpha-amidating lyase"", ""peptidylglycine alpha-hydroxylating monooxygenase"""	170270				2357221	Standard	NM_000919		Approved	PAL, PHM	uc003knt.3	P19021	OTTHUMG00000128729	ENST00000438793.3:c.698C>T	5.37:g.102285295C>T	ENSP00000396493:p.Ala233Val	264	0		259	24	NM_138822	0	0	3	3	0	A6NMR0|A8K293|O43211|O95080|Q16252|Q16253|Q54A45|Q86U53|Q8WVC7|Q9UCG0	Missense_Mutation	SNP	ENST00000438793.3	37	CCDS54885.1	.	.	.	.	.	.	.	.	.	.	C	32	5.156388	0.94686	.	.	ENSG00000145730	ENST00000438793;ENST00000346918;ENST00000348126;ENST00000304400;ENST00000274392;ENST00000455264	T;T;T;T;T;T	0.78003	-1.14;-1.14;-1.14;-1.14;-1.14;-1.14	6.02	6.02	0.97574	Copper type II, ascorbate-dependent monooxygenase, histidine-cluster-2 conserved site (1);PHM/PNGase F domain (1);Copper type II, ascorbate-dependent monooxygenase-like, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.91036	0.7180	M	0.90650	3.135	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.91659	0.5341	10	0.87932	D	0	.	20.5373	0.99239	0.0:1.0:0.0:0.0	.	136;233;233;233;233;233	F8WE90;P19021;P19021-4;P19021-3;P19021-5;P19021-2	.;AMD_HUMAN;.;.;.;.	V	233;233;233;233;136;233	ENSP00000396493:A233V;ENSP00000282992:A233V;ENSP00000314638:A233V;ENSP00000306100:A233V;ENSP00000274392:A136V;ENSP00000403461:A233V	ENSP00000274392:A136V	A	+	2	0	PAM	102313194	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.290000	0.72712	2.857000	0.98124	0.650000	0.86243	GCC	.		0.323	PAM-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000250640.2	NM_000919	
PCDHGB6	56100	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	140788348	140788348	+	Missense_Mutation	SNP	G	G	T			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr5:140788348G>T	ENST00000520790.1	+	1	579	c.579G>T	c.(577-579)gaG>gaT	p.E193D	PCDHGA7_ENST00000518325.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB4_ENST00000519479.1_Intron	NM_018926.2|NM_032100.1	NP_061749.1|NP_115271.1	Q9Y5F9	PCDGI_HUMAN	protocadherin gamma subfamily B, 6	193	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|endometrium(9)|kidney(1)|large_intestine(10)|lung(16)|ovary(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)	48			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AATACCCAGAGTTATCTCTGG	0.403																																					p.E193D		.											.	.	0			c.G579T						.						26.0	26.0	26.0					5																	140788348		1835	4088	5923	SO:0001583	missense	56100	exon1			CCCAGAGTTATCT	AF152522	CCDS54929.1, CCDS75342.1	5q31	2010-01-26				ENSG00000253305		"""Cadherins / Protocadherins : Clustered"""	8713	other	protocadherin		606303				10380929	Standard	NM_018926		Approved	PCDH-GAMMA-B6		Q9Y5F9		ENST00000520790.1:c.579G>T	5.37:g.140788348G>T	ENSP00000428603:p.Glu193Asp	38	0		53	22	NM_032100	0	0	0	0	0	Q9Y5C5	Missense_Mutation	SNP	ENST00000520790.1	37	CCDS54929.1	.	.	.	.	.	.	.	.	.	.	g	13.81	2.348524	0.41599	.	.	ENSG00000253305	ENST00000520790	T	0.21734	1.99	5.34	1.01	0.19927	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.40909	0.1136	M	0.77616	2.38	0.09310	N	0.999999	D;D	0.71674	0.994;0.998	D;D	0.70016	0.948;0.967	T	0.12760	-1.0535	9	0.66056	D	0.02	.	6.0351	0.19702	0.382:0.0:0.4936:0.1244	.	193;193	Q9Y5F9;Q9Y5F9-2	PCDGI_HUMAN;.	D	193	ENSP00000428603:E193D	ENSP00000428603:E193D	E	+	3	2	PCDHGB6	140768532	0.000000	0.05858	0.987000	0.45799	0.966000	0.64601	-1.583000	0.02115	0.257000	0.21650	-0.373000	0.07131	GAG	.		0.403	PCDHGB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374746.1	NM_018926	
SPINK1	6690	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	147207646	147207646	+	Missense_Mutation	SNP	G	G	A			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr5:147207646G>A	ENST00000296695.5	-	3	341	c.133C>T	c.(133-135)Cct>Tct	p.P45S	SPINK1_ENST00000510027.2_Missense_Mutation_p.P45S	NM_003122.3	NP_003113.2	P00995	ISK1_HUMAN	serine peptidase inhibitor, Kazal type 1	45	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.				negative regulation of calcium ion import (GO:0090281)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of serine-type endopeptidase activity (GO:1900004)|regulation of acrosome reaction (GO:0060046)|regulation of store-operated calcium entry (GO:2001256)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			endometrium(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCACAGACAGGGTCATATATC	0.328									Hereditary Pancreatitis																												p.P45S		.											.	SPINK1-90	0			c.C133T						.						126.0	119.0	121.0					5																	147207646		2203	4300	6503	SO:0001583	missense	6690	exon3	Familial Cancer Database		AGACAGGGTCATA		CCDS4286.1	5q32	2011-08-31	2005-08-17		ENSG00000164266	ENSG00000164266		"""Serine peptidase inhibitors, Kazal type"""	11244	protein-coding gene	gene with protein product		167790	"""serine protease inhibitor, Kazal type 1"""				Standard	XM_005268501		Approved	Spink3, PCTT, PSTI, TATI	uc003los.2	P00995	OTTHUMG00000129730	ENST00000296695.5:c.133C>T	5.37:g.147207646G>A	ENSP00000296695:p.Pro45Ser	106	0		114	24	NM_003122	0	0	0	0	0		Missense_Mutation	SNP	ENST00000296695.5	37	CCDS4286.1	.	.	.	.	.	.	.	.	.	.	G	16.15	3.042553	0.55003	.	.	ENSG00000164266	ENST00000296695;ENST00000510027	D;D	0.85339	-1.97;-1.97	4.9	4.9	0.64082	Proteinase inhibitor I1, Kazal (3);	0.000000	0.64402	D	0.000001	D	0.91991	0.7463	.	.	.	0.43708	D	0.996175	D	0.89917	1.0	D	0.97110	1.0	D	0.92165	0.5739	9	0.56958	D	0.05	-21.6312	15.9791	0.80094	0.0:0.0:1.0:0.0	.	45	P00995	ISK1_HUMAN	S	45	ENSP00000296695:P45S;ENSP00000427376:P45S	ENSP00000296695:P45S	P	-	1	0	SPINK1	147187839	1.000000	0.71417	0.938000	0.37757	0.224000	0.24922	4.936000	0.63506	2.725000	0.93324	0.655000	0.94253	CCT	.		0.328	SPINK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251940.2	NM_003122	
FNDC9	408263	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	156770121	156770121	+	Nonsense_Mutation	SNP	C	C	A			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr5:156770121C>A	ENST00000312349.4	-	2	611	c.424G>T	c.(424-426)Gag>Tag	p.E142*	CYFIP2_ENST00000442283.2_Intron|CYFIP2_ENST00000522463.1_Intron|CYFIP2_ENST00000541131.1_Intron|CYFIP2_ENST00000521420.1_Intron|CYFIP2_ENST00000347377.6_Intron|CYFIP2_ENST00000435847.2_Intron|CYFIP2_ENST00000318218.6_Intron|CYFIP2_ENST00000377576.3_Intron	NM_001001343.3	NP_001001343.2	Q8TBE3	FNDC9_HUMAN	fibronectin type III domain containing 9	142						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|prostate(1)|skin(1)|urinary_tract(1)	9						CATCGCGGCTCATGGCAACGG	0.607											OREG0016977	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E142X		.											.	FNDC9-68	0			c.G424T						.						64.0	62.0	63.0					5																	156770121		2203	4300	6503	SO:0001587	stop_gained	408263	exon2			GCGGCTCATGGCA	BC022570	CCDS4337.1	5q33.3	2013-02-11	2011-01-25	2011-01-25	ENSG00000172568	ENSG00000172568		"""Fibronectin type III domain containing"""	33547	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 40"""	C5orf40			Standard	NM_001001343		Approved	MGC27121	uc003lwu.2	Q8TBE3	OTTHUMG00000130248	ENST00000312349.4:c.424G>T	5.37:g.156770121C>A	ENSP00000310594:p.Glu142*	116	0	1781	136	43	NM_001001343	0	0	0	0	0	A8K0Y6	Nonsense_Mutation	SNP	ENST00000312349.4	37	CCDS4337.1	.	.	.	.	.	.	.	.	.	.	C	19.32	3.805183	0.70682	.	.	ENSG00000172568	ENST00000312349;ENST00000520782	.	.	.	5.08	4.15	0.48705	.	0.241065	0.28784	N	0.014157	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	-4.2189	9.3255	0.37990	0.16:0.6848:0.1551:0.0	.	.	.	.	X	142	.	ENSP00000310594:E142X	E	-	1	0	FNDC9	156702699	0.304000	0.24472	0.997000	0.53966	0.674000	0.39518	0.688000	0.25422	2.369000	0.80426	0.491000	0.48974	GAG	.		0.607	FNDC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252573.2	NM_001001343	
GABRB2	2561	broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	160886718	160886718	+	Missense_Mutation	SNP	T	T	A			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr5:160886718T>A	ENST00000393959.1	-	4	369	c.370A>T	c.(370-372)Aac>Tac	p.N124Y	GABRB2_ENST00000517547.1_Intron|GABRB2_ENST00000274547.2_Missense_Mutation_p.N124Y|GABRB2_ENST00000520240.1_Missense_Mutation_p.N124Y|GABRB2_ENST00000353437.6_Missense_Mutation_p.N124Y|GABRB2_ENST00000517901.1_Missense_Mutation_p.N61Y			P47870	GBRB2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta 2	124					cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|cochlea development (GO:0090102)|gamma-aminobutyric acid signaling pathway (GO:0007214)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|GABA-A receptor complex (GO:1902711)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|GABA-A receptor activity (GO:0004890)|inhibitory extracellular ligand-gated ion channel activity (GO:0005237)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|liver(1)|lung(9)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	26	Renal(175;0.00259)	Medulloblastoma(196;0.021)|all_neural(177;0.0463)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Fospropofol(DB06716)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	TTCTTATCGTTCAGGAAATAG	0.478																																					p.N124Y													.	GABRB2-91	0			c.A370T						.						105.0	94.0	97.0					5																	160886718		2203	4300	6503	SO:0001583	missense	2561	exon5			TATCGTTCAGGAA		CCDS4354.1, CCDS4355.1	5q34	2012-06-22			ENSG00000145864	ENSG00000145864		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4082	protein-coding gene	gene with protein product	"""GABA(A) receptor, beta 2"""	600232				7851879	Standard	NM_000813		Approved		uc003lys.1	P47870	OTTHUMG00000130349	ENST00000393959.1:c.370A>T	5.37:g.160886718T>A	ENSP00000377531:p.Asn124Tyr	221	1		252	111	NM_021911	0	0	0	0	0	A8K115|A8K1A0|D1LYT0|D1LYT1|Q16323|Q4FZB2	Missense_Mutation	SNP	ENST00000393959.1	37	CCDS4355.1	.	.	.	.	.	.	.	.	.	.	T	26.1	4.702239	0.88924	.	.	ENSG00000145864	ENST00000393959;ENST00000274547;ENST00000353437;ENST00000520240;ENST00000517901	D;D;D;D;D	0.87256	-2.23;-2.23;-2.23;-2.23;-2.23	4.97	4.97	0.65823	Neurotransmitter-gated ion-channel ligand-binding (3);	0.096322	0.64402	D	0.000002	D	0.95698	0.8601	H	0.96662	3.86	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.97208	0.9869	10	0.87932	D	0	.	14.9655	0.71188	0.0:0.0:0.0:1.0	.	124;61;124;124	B7Z4P0;E7EV50;P47870;P47870-1	.;.;GBRB2_HUMAN;.	Y	124;124;124;124;61	ENSP00000377531:N124Y;ENSP00000274547:N124Y;ENSP00000274546:N124Y;ENSP00000429320:N124Y;ENSP00000430532:N61Y	ENSP00000274547:N124Y	N	-	1	0	GABRB2	160819296	1.000000	0.71417	0.994000	0.49952	0.982000	0.71751	7.867000	0.87062	1.988000	0.58038	0.533000	0.62120	AAC	.		0.478	GABRB2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252704.1		
FAM65B	9750	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	24843494	24843494	+	Missense_Mutation	SNP	C	C	G			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr6:24843494C>G	ENST00000259698.4	-	14	1691	c.1516G>C	c.(1516-1518)Gag>Cag	p.E506Q	FAM65B_ENST00000540914.1_Missense_Mutation_p.E456Q|FAM65B_ENST00000538035.1_Missense_Mutation_p.E485Q|FAM65B_ENST00000378023.4_Missense_Mutation_p.E456Q|FAM65B_ENST00000510784.2_Missense_Mutation_p.E490Q|FAM65B_ENST00000473070.1_5'Flank	NM_014722.2	NP_055537.2	Q9Y4F9	FA65B_HUMAN	family with sequence similarity 65, member B	506					cell differentiation (GO:0030154)|muscle organ development (GO:0007517)	cell projection (GO:0042995)|cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)				breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	25						CTGGGCTCCTCTGGGTCTTCC	0.577																																					p.E506Q		.											.	FAM65B-91	0			c.G1516C						.						86.0	82.0	83.0					6																	24843494		1916	4115	6031	SO:0001583	missense	9750	exon14			GCTCCTCTGGGTC	U49187	CCDS47383.1, CCDS47384.1, CCDS69057.1, CCDS69058.1, CCDS75410.1	6p22.3-p21.32	2012-11-30	2008-06-13	2008-06-13	ENSG00000111913	ENSG00000111913			13872	protein-coding gene	gene with protein product	"""myogenesis-related and NCAM-associated protein homolog (chicken)"""	611410	"""chromosome 6 open reading frame 32"""	C6orf32		9205841, 17150207, 17825087	Standard	NM_001286447		Approved	KIAA0386, DIFF48, MYONAP	uc003neo.1	Q9Y4F9	OTTHUMG00000014375	ENST00000259698.4:c.1516G>C	6.37:g.24843494C>G	ENSP00000259698:p.Glu506Gln	83	0		99	33	NM_014722	0	0	2	2	0	A6NHP2|Q13529|Q5VV37|Q5VV38|Q9BQ28	Missense_Mutation	SNP	ENST00000259698.4	37	CCDS47383.1	.	.	.	.	.	.	.	.	.	.	C	9.393	1.076084	0.20227	.	.	ENSG00000111913	ENST00000259698;ENST00000538035;ENST00000378023;ENST00000540914;ENST00000510784	T;T;T;T;T	0.32515	1.45;1.45;1.45;1.45;1.45	4.3	2.46	0.29980	.	1.536000	0.03262	N	0.183420	T	0.06917	0.0176	N	0.24115	0.695	0.09310	N	1	B;B;B;B	0.16396	0.017;0.004;0.009;0.004	B;B;B;B	0.11329	0.006;0.003;0.004;0.004	T	0.23404	-1.0189	10	0.13853	T	0.58	-0.5328	7.1945	0.25845	0.0:0.6914:0.1422:0.1664	.	490;485;456;506	B7Z6U4;F5GX51;Q9Y4F9-2;Q9Y4F9	.;.;.;FA65B_HUMAN	Q	506;485;456;456;490	ENSP00000259698:E506Q;ENSP00000441138:E485Q;ENSP00000367262:E456Q;ENSP00000438425:E456Q;ENSP00000441305:E490Q	ENSP00000259698:E506Q	E	-	1	0	FAM65B	24951473	0.000000	0.05858	0.000000	0.03702	0.033000	0.12548	0.333000	0.19768	0.417000	0.25871	0.655000	0.94253	GAG	.		0.577	FAM65B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040024.2		
HLA-E	3133	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	30459405	30459405	+	Silent	SNP	T	T	C			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr6:30459405T>C	ENST00000376630.4	+	5	1043	c.978T>C	c.(976-978)gcT>gcC	p.A326A		NM_005516.5	NP_005507.3	P13747	HLAE_HUMAN	major histocompatibility complex, class I, E	326					antigen processing and presentation of endogenous peptide antigen via MHC class Ib (GO:0002476)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of natural killer cell mediated immunity (GO:0002717)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|protection from natural killer cell mediated cytotoxicity (GO:0042270)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|ER to Golgi transport vesicle membrane (GO:0012507)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	MHC class I protein binding (GO:0042288)|peptide antigen binding (GO:0042605)			breast(2)|central_nervous_system(4)|endometrium(1)|kidney(3)|large_intestine(2)|lung(1)|ovary(3)|skin(1)|urinary_tract(1)	18						TGGTTGCTGCTGTGATATGGA	0.557																																					p.A326A		.											.	HLA-E-516	0			c.T978C						.						153.0	162.0	159.0					6																	30459405		1509	2709	4218	SO:0001819	synonymous_variant	3133	exon5			TGCTGCTGTGATA	M20022	CCDS34379.1	6p21.3	2013-01-11			ENSG00000204592	ENSG00000204592		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4962	protein-coding gene	gene with protein product		143010				3131426	Standard	NM_005516		Approved		uc003nqg.3	P13747	OTTHUMG00000031155	ENST00000376630.4:c.978T>C	6.37:g.30459405T>C		100	0		100	27	NM_005516	0	0	205	373	168	Q30169|Q9BT83|Q9GIY7|Q9GIY8	Silent	SNP	ENST00000376630.4	37	CCDS34379.1																																																																																			.		0.557	HLA-E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076282.2	NM_005516	
C6orf10	10665	broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	32261299	32261299	+	Missense_Mutation	SNP	T	T	G			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr6:32261299T>G	ENST00000447241.2	-	23	1323	c.1151A>C	c.(1150-1152)aAg>aCg	p.K384T	C6orf10_ENST00000375007.4_Missense_Mutation_p.K382T|C6orf10_ENST00000527965.1_Missense_Mutation_p.K368T|C6orf10_ENST00000442822.2_Missense_Mutation_p.K375T|C6orf10_ENST00000375015.4_Missense_Mutation_p.K383T|C6orf10_ENST00000533191.1_Missense_Mutation_p.K382T	NM_006781.3	NP_006772.3	Q5SRN2	CF010_HUMAN	chromosome 6 open reading frame 10	384						integral component of membrane (GO:0016021)|nucleus (GO:0005634)				cervix(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(12)|ovary(1)|skin(1)	25						CTGACTCTTCTTTACTTGGGA	0.502																																					.													.	C6orf10-91	0			.						.						192.0	206.0	201.0					6																	32261299		1511	2709	4220	SO:0001583	missense	10665	.			CTCTTCTTTACTT	U60665	CCDS34422.1, CCDS69082.1, CCDS75430.1	6p21.32	2012-11-20			ENSG00000204296	ENSG00000204296			13922	protein-coding gene	gene with protein product	"""testis specific basic protein"""					10803852	Standard	XM_005248810		Approved	TSBP	uc021yvs.1	Q5SRN2	OTTHUMG00000031107	ENST00000447241.2:c.1151A>C	6.37:g.32261299T>G	ENSP00000415517:p.Lys384Thr	103	1		122	47	.	0	0	0	0	0	A2BET1|A2BET2|A6NME2|B0S7R2|B0S7R3|E9PMB1|Q5SPI9|Q5SPJ0|Q5SPK9|Q5SPL0|Q5SRN3|Q5TG25|Q5TG26|Q8N4B6	Missense_Mutation	SNP	ENST00000447241.2	37	CCDS34422.1	.	.	.	.	.	.	.	.	.	.	T	13.39	2.223109	0.39300	.	.	ENSG00000204296	ENST00000442822;ENST00000447241;ENST00000375015;ENST00000533191;ENST00000527965;ENST00000375007;ENST00000375002;ENST00000305725	T;T;T;T;T;T	0.05081	3.5;3.58;3.55;3.56;3.56;3.59	3.83	1.33	0.21861	.	.	.	.	.	T	0.07818	0.0196	M	0.67397	2.05	0.09310	N	1	D;D	0.89917	0.991;1.0	P;D	0.87578	0.858;0.998	T	0.18116	-1.0347	9	0.59425	D	0.04	-1.1846	2.4408	0.04494	0.2053:0.224:0.0:0.5707	.	384;375	Q5SRN2;C9J9T8	CF010_HUMAN;.	T	375;384;383;382;368;382;381;381	ENSP00000411164:K375T;ENSP00000415517:K384T;ENSP00000364155:K383T;ENSP00000431199:K382T;ENSP00000435103:K368T;ENSP00000364146:K382T	ENSP00000303292:K381T	K	-	2	0	C6orf10	32369277	0.001000	0.12720	0.000000	0.03702	0.005000	0.04900	0.908000	0.28545	0.271000	0.22005	0.528000	0.53228	AAG	.		0.502	C6orf10-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076178.4	NM_006781	
PRICKLE4	29964	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	41751890	41751890	+	Missense_Mutation	SNP	G	G	A			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr6:41751890G>A	ENST00000394260.1	+	1	34	c.34G>A	c.(34-36)Ggt>Agt	p.G12S	PRICKLE4_ENST00000394263.1_Missense_Mutation_p.G52S|PRICKLE4_ENST00000359201.5_Missense_Mutation_p.G52S|PRICKLE4_ENST00000394259.1_Missense_Mutation_p.G12S|PRICKLE4_ENST00000458694.1_Missense_Mutation_p.G52S			Q2TBC4	PRIC4_HUMAN	prickle homolog 4 (Drosophila)	12	PET. {ECO:0000255|PROSITE- ProRule:PRU00636}.					nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)	13	Ovarian(28;0.0355)|Colorectal(47;0.121)		Epithelial(12;8.38e-05)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			TCTGAGCTTGGGTTCCCTTTG	0.542																																					p.G52S		.											.	PRICKLE4-22	0			c.G154A						.						140.0	115.0	123.0					6																	41751890		2203	4300	6503	SO:0001583	missense	29964	exon4			AGCTTGGGTTCCC	AF216754	CCDS34449.1	6p21.1	2010-08-05	2007-09-18	2007-09-18	ENSG00000124593	ENSG00000124593			16805	protein-coding gene	gene with protein product		611389	"""chromosome 6 open reading frame 49"""	C6orf49		15702247	Standard	NM_013397		Approved	OEBT, DKFZp761H221	uc011duf.1	Q2TBC4	OTTHUMG00000014685	ENST00000394260.1:c.34G>A	6.37:g.41751890G>A	ENSP00000377803:p.Gly12Ser	154	0		169	58	NM_013397	0	0	7	7	0	A2A3M0|A6PVU1|B3KQ15|Q5T3D4|Q9NSV1	Missense_Mutation	SNP	ENST00000394260.1	37		.	.	.	.	.	.	.	.	.	.	G	15.41	2.826744	0.50739	.	.	ENSG00000124593	ENST00000458694;ENST00000359201;ENST00000394263;ENST00000394259;ENST00000394260	T;T;T;T;T	0.68624	-0.14;-0.33;-0.14;-0.34;-0.12	4.61	2.79	0.32731	.	0.160117	0.29892	N	0.010940	T	0.41442	0.1159	L	0.57536	1.79	0.09310	N	1	P	0.47910	0.902	P	0.46543	0.52	T	0.28650	-1.0037	10	0.15952	T	0.53	-8.6317	5.2819	0.15680	0.1041:0.0:0.6944:0.2015	.	52	Q2TBC4-3	.	S	52;52;52;12;12	ENSP00000404911:G52S;ENSP00000352128:G52S;ENSP00000377806:G52S;ENSP00000377802:G12S;ENSP00000377803:G12S	ENSP00000335185:G52S	G	+	1	0	PRICKLE4	41859868	0.041000	0.20044	0.003000	0.11579	0.193000	0.23685	1.999000	0.40806	0.540000	0.28808	0.491000	0.48974	GGT	.		0.542	PRICKLE4-007	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000303948.1	NM_013397	
CASP8AP2	9994	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	90578032	90578032	+	RNA	SNP	G	G	C			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr6:90578032G>C	ENST00000551025.1	+	0	6460									caspase 8 associated protein 2											NS(1)|endometrium(7)|kidney(6)|large_intestine(12)|lung(21)|ovary(2)|urinary_tract(2)	51		all_cancers(76;3.64e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;4.69e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0953)		CTCACACTCTGTTGGGGAACA	0.378																																					p.V1675L	Colon(187;1656 2025 17045 31481 39901)	.											.	CASP8AP2-24	0			c.G5023C						.						49.0	50.0	49.0					6																	90578032		1888	4122	6010			9994	exon8			CACTCTGTTGGGG	AB037736		6q15	2012-04-19	2008-10-30		ENSG00000118412	ENSG00000118412			1510	protein-coding gene	gene with protein product	"""FLICE-associated huge protein"""	606880	"""CASP8 associated protein 2"""			10235259, 17245429, 17003126	Standard	NM_001137668		Approved	FLASH, CED-4, RIP25, FLJ11208, KIAA1315	uc011dzz.2	Q9UKL3	OTTHUMG00000015212		6.37:g.90578032G>C		75	0		62	29	NM_001137667	0	0	0	1	1		Missense_Mutation	SNP	ENST00000551025.1	37																																																																																				.		0.378	CASP8AP2-202	KNOWN	basic	processed_transcript	processed_transcript		NM_001137667	
NFE2L3	9603	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	26224503	26224503	+	Missense_Mutation	SNP	G	G	T			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr7:26224503G>T	ENST00000056233.3	+	4	1444	c.1185G>T	c.(1183-1185)atG>atT	p.M395I		NM_004289.6	NP_004280.5	Q9Y4A8	NF2L3_HUMAN	nuclear factor, erythroid 2-like 3	395					transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|skin(5)|urinary_tract(7)	29						TAAACTTAATGTCATTGGCCA	0.363																																					p.M395I		.											.	NFE2L3-94	0			c.G1185T						.						89.0	93.0	92.0					7																	26224503		2203	4300	6503	SO:0001583	missense	9603	exon4			CTTAATGTCATTG	AB010812	CCDS5396.1	7p15.2	2013-08-23	2013-08-23		ENSG00000050344	ENSG00000050344		"""basic leucine zipper proteins"""	7783	protein-coding gene	gene with protein product		604135	"""nuclear factor (erythroid-derived 2)-like 3"""			10037736	Standard	NM_004289		Approved	Nrf3	uc003sxq.3	Q9Y4A8	OTTHUMG00000023882	ENST00000056233.3:c.1185G>T	7.37:g.26224503G>T	ENSP00000056233:p.Met395Ile	93	0		80	29	NM_004289	0	0	3	8	5	Q6NUS0|Q7Z498|Q86UJ4|Q86VR5|Q9UQA4	Missense_Mutation	SNP	ENST00000056233.3	37	CCDS5396.1	.	.	.	.	.	.	.	.	.	.	G	11.69	1.714423	0.30413	.	.	ENSG00000050344	ENST00000056233;ENST00000398175	T	0.32988	1.43	5.12	1.16	0.20824	.	0.373144	0.32328	N	0.006247	T	0.33030	0.0849	M	0.78049	2.395	0.28293	N	0.923461	B	0.14805	0.011	B	0.13407	0.009	T	0.34950	-0.9808	10	0.54805	T	0.06	-0.9264	10.7382	0.46137	0.3412:0.0:0.6588:0.0	.	395	Q9Y4A8	NF2L3_HUMAN	I	395;101	ENSP00000056233:M395I	ENSP00000056233:M395I	M	+	3	0	NFE2L3	26191028	0.998000	0.40836	0.717000	0.30585	0.799000	0.45148	2.503000	0.45407	0.259000	0.21709	-0.229000	0.12294	ATG	.		0.363	NFE2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214088.1		
NAMPT	10135	broad.mit.edu	37	7	105903928	105903928	+	Missense_Mutation	SNP	T	T	G			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr7:105903928T>G	ENST00000222553.3	-	7	1186	c.879A>C	c.(877-879)gaA>gaC	p.E293D	NAMPT_ENST00000354289.4_Missense_Mutation_p.E293D	NM_005746.2	NP_005737.1	P43490	NAMPT_HUMAN	nicotinamide phosphoribosyltransferase	293					cell-cell signaling (GO:0007267)|circadian regulation of gene expression (GO:0032922)|NAD biosynthetic process (GO:0009435)|NAD metabolic process (GO:0019674)|nicotinamide metabolic process (GO:0006769)|positive regulation of cell proliferation (GO:0008284)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|nicotinamide phosphoribosyltransferase activity (GO:0047280)|nicotinate-nucleotide diphosphorylase (carboxylating) activity (GO:0004514)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	14						GTCTTAGATCTTCACCCCATA	0.368																																					p.E293D													.	NAMPT-577	0			c.A879C						.						104.0	94.0	98.0					7																	105903928		2203	4299	6502	SO:0001583	missense	10135	exon7			TAGATCTTCACCC	U02020	CCDS5737.1	7q22.3	2012-10-02	2008-03-27	2008-03-27	ENSG00000105835	ENSG00000105835			30092	protein-coding gene	gene with protein product	"""visfatin"""	608764	"""pre-B-cell colony enhancing factor 1"""	PBEF1		8289818	Standard	NM_005746		Approved	PBEF	uc003vdq.3	P43490	OTTHUMG00000140388	ENST00000222553.3:c.879A>C	7.37:g.105903928T>G	ENSP00000222553:p.Glu293Asp	199	1		169	14	NM_005746	0	0	18	22	4	A4D0Q9|A4D0R0|Q3KQV0|Q8WW95	Missense_Mutation	SNP	ENST00000222553.3	37	CCDS5737.1	.	.	.	.	.	.	.	.	.	.	T	9.068	0.996237	0.19043	.	.	ENSG00000105835	ENST00000222553;ENST00000354289	.	.	.	5.39	4.23	0.50019	Quinolinate phosphoribosyl transferase, C-terminal (1);	0.047647	0.85682	D	0.000000	T	0.32466	0.0830	N	0.21448	0.665	0.40718	D	0.982633	B;B;B	0.10296	0.003;0.0;0.0	B;B;B	0.09377	0.004;0.001;0.0	T	0.08994	-1.0695	9	0.15952	T	0.53	-10.4608	6.1952	0.20546	0.1046:0.0644:0.1083:0.7227	.	206;274;293	B7Z8W6;Q5SYT8;P43490	.;.;NAMPT_HUMAN	D	293	.	ENSP00000222553:E293D	E	-	3	2	NAMPT	105691164	0.999000	0.42202	1.000000	0.80357	0.971000	0.66376	0.564000	0.23563	0.426000	0.26116	-1.139000	0.01908	GAA	.		0.368	NAMPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277146.1	NM_182790	
FLNC	2318	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	128494117	128494117	+	Missense_Mutation	SNP	G	G	C			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr7:128494117G>C	ENST00000325888.8	+	40	6835	c.6574G>C	c.(6574-6576)Gag>Cag	p.E2192Q	FLNC_ENST00000346177.6_Missense_Mutation_p.E2159Q|RP11-309L24.2_ENST00000469965.1_RNA	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	2192	Intradomain insert; mediate targeting to Z lines.				cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						GGAGCGCACGGAGATCAGCAA	0.652																																					p.E2192Q													.	FLNC-141	0			c.G6574C						.						20.0	25.0	23.0					7																	128494117		2098	4228	6326	SO:0001583	missense	2318	exon40			CGCACGGAGATCA	AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.6574G>C	7.37:g.128494117G>C	ENSP00000327145:p.Glu2192Gln	162	3		295	107	NM_001458	0	0	0	0	0	B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Missense_Mutation	SNP	ENST00000325888.8	37	CCDS43644.1	.	.	.	.	.	.	.	.	.	.	G	13.86	2.363533	0.41902	.	.	ENSG00000128591	ENST00000325888;ENST00000346177	D;D	0.85773	-2.03;-2.03	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	D	0.87537	0.6202	L	0.28192	0.835	0.54753	D	0.999988	D;P	0.67145	0.996;0.627	D;B	0.75484	0.986;0.198	D	0.86369	0.1722	10	0.34782	T	0.22	.	17.1975	0.86897	0.0:0.0:1.0:0.0	.	2159;2192	Q14315-2;Q14315	.;FLNC_HUMAN	Q	2192;2159	ENSP00000327145:E2192Q;ENSP00000344002:E2159Q	ENSP00000327145:E2192Q	E	+	1	0	FLNC	128281353	1.000000	0.71417	1.000000	0.80357	0.517000	0.34286	9.621000	0.98376	2.655000	0.90218	0.655000	0.94253	GAG	.		0.652	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059948.3		
STRIP2	57464	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	129104562	129104562	+	Missense_Mutation	SNP	C	C	G			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr7:129104562C>G	ENST00000249344.2	+	16	1799	c.1759C>G	c.(1759-1761)Ctc>Gtc	p.L587V	STRIP2_ENST00000435494.2_Missense_Mutation_p.L587V	NM_020704.2	NP_065755.1	Q9ULQ0	STRP2_HUMAN	striatin interacting protein 2	587					cell migration (GO:0016477)|cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)											ACACTTCAAACTCAACCATAT	0.478																																					p.L587V													.	.	0			c.C1759G						.						146.0	139.0	141.0					7																	129104562		2203	4300	6503	SO:0001583	missense	57464	exon16			TTCAAACTCAACC	AB032996	CCDS34752.1, CCDS47709.1	7q32.3	2012-11-05	2012-11-05	2012-11-05	ENSG00000128578	ENSG00000128578			22209	protein-coding gene	gene with protein product	"""FAR11 factor arrest 11 homolog B (yeast)"""		"""family with sequence similarity 40, member B"""	FAM40B		22782902, 22298706, 18782753	Standard	NM_020704		Approved	KIAA1170, FAR11B	uc011koy.2	Q9ULQ0	OTTHUMG00000157695	ENST00000249344.2:c.1759C>G	7.37:g.129104562C>G	ENSP00000249344:p.Leu587Val	77	1		103	38	NM_020704	0	0	0	3	3	Q8WUZ4	Missense_Mutation	SNP	ENST00000249344.2	37	CCDS34752.1	.	.	.	.	.	.	.	.	.	.	C	17.50	3.404795	0.62288	.	.	ENSG00000128578	ENST00000249344;ENST00000435494	T;T	0.49139	0.79;0.79	5.22	4.32	0.51571	.	0.000000	0.85682	D	0.000000	T	0.53270	0.1786	L	0.33792	1.035	0.80722	D	1	D;P	0.69078	0.997;0.815	D;P	0.79108	0.992;0.674	T	0.37384	-0.9708	10	0.20046	T	0.44	-16.1153	12.634	0.56673	0.0:0.9198:0.0:0.0802	.	587;587	Q9ULQ0;Q9ULQ0-2	FA40B_HUMAN;.	V	587	ENSP00000249344:L587V;ENSP00000392393:L587V	ENSP00000249344:L587V	L	+	1	0	FAM40B	128891798	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	4.948000	0.63590	2.620000	0.88729	0.655000	0.94253	CTC	.		0.478	STRIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349418.1	NM_001134336	
HR	55806	hgsc.bcm.edu	37	8	21978269	21978269	+	Missense_Mutation	SNP	C	C	T	rs114871775	byFrequency	TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr8:21978269C>T	ENST00000381418.4	-	11	4050	c.2570G>A	c.(2569-2571)cGt>cAt	p.R857H	HR_ENST00000312841.8_Missense_Mutation_p.R857H	NM_005144.4	NP_005135.2	O43593	HAIR_HUMAN	hair growth associated	857					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	27		Breast(100;0.000162)|Acute lymphoblastic leukemia(644;0.0775)|Prostate(55;0.116)		KIRC - Kidney renal clear cell carcinoma(542;1.19e-05)|BRCA - Breast invasive adenocarcinoma(99;3.56e-05)|Colorectal(74;0.00191)|COAD - Colon adenocarcinoma(73;0.0615)|READ - Rectum adenocarcinoma(644;0.1)		GTGGAAGCCACGCCGAGGGCA	0.741													C|||	61	0.0121805	0.0454	0.0	5008	,	,		13295	0.0		0.001	False		,,,				2504	0.0				p.R857H		.											.	HR-154	0			c.G2570A						.	C	HIS/ARG,HIS/ARG	107,3239		0,107,1566	2.0	3.0	2.0		2570,2570	0.6	0.0	8	dbSNP_132	2	4,6868		0,4,3432	yes	missense,missense	HR	NM_005144.4,NM_018411.4	29,29	0,111,4998	TT,TC,CC		0.0582,3.1978,1.0863	benign,benign	857/1190,857/1135	21978269	111,10107	1673	3436	5109	SO:0001583	missense	55806	exon11			AAGCCACGCCGAG	AF039196	CCDS6022.1, CCDS6023.1	8p12	2012-12-07	2012-12-07		ENSG00000168453	ENSG00000168453			5172	protein-coding gene	gene with protein product		602302	"""hairless (mouse) homolog"", ""hairless homolog (mouse)"""	ALUNC		10051399, 9463324	Standard	NM_018411		Approved	AU	uc003xas.3	O43593	OTTHUMG00000097089	ENST00000381418.4:c.2570G>A	8.37:g.21978269C>T	ENSP00000370826:p.Arg857His	0	0		15	7	NM_018411	0	0	0	0	0	Q6GS30|Q96H33|Q9NPE1	Missense_Mutation	SNP	ENST00000381418.4	37	CCDS6022.1	22	0.010073260073260074	20	0.04065040650406504	1	0.0027624309392265192	0	0.0	1	0.0013192612137203166	C	7.312	0.615246	0.14129	0.031978	5.82E-4	ENSG00000168453	ENST00000381418;ENST00000312841;ENST00000517699	T;T;T	0.71461	-0.57;-0.57;0.94	5.06	0.547	0.17202	.	0.836181	0.10478	N	0.670017	T	0.12646	0.0307	N	0.02315	-0.6	0.09310	N	1	B;B	0.17667	0.023;0.007	B;B	0.13407	0.009;0.004	T	0.09862	-1.0655	10	0.23891	T	0.37	-0.1927	6.1814	0.20474	0.0:0.4668:0.0:0.5332	.	857;857	O43593-2;O43593	.;HAIR_HUMAN	H	857;857;80	ENSP00000370826:R857H;ENSP00000326765:R857H;ENSP00000430413:R80H	ENSP00000326765:R857H	R	-	2	0	HR	22034214	0.001000	0.12720	0.000000	0.03702	0.426000	0.31534	0.809000	0.27168	0.243000	0.21327	-0.339000	0.08088	CGT	C|0.990;T|0.010		0.741	HR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214213.1		
SDC2	6383	ucsc.edu	37	8	97605816	97605816	+	Missense_Mutation	SNP	T	T	A			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr8:97605816T>A	ENST00000302190.4	+	2	1090	c.169T>A	c.(169-171)Tcg>Acg	p.S57T	SDC2_ENST00000518385.1_Intron|SDC2_ENST00000522911.1_Missense_Mutation_p.S28T|SDC2_ENST00000519914.1_Missense_Mutation_p.S28T	NM_002998.3	NP_002989.2	P34741	SDC2_HUMAN	syndecan 2	57					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dendrite morphogenesis (GO:0048813)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|regulation of dendrite morphogenesis (GO:0048814)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|wound healing (GO:0042060)	Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)			breast(1)|cervix(1)|large_intestine(5)|lung(4)|ovary(2)|prostate(1)|stomach(2)	16	Breast(36;3.41e-05)				Sargramostim(DB00020)	TGCGTCTGGCTCGGGTAAGGT	0.483																																					p.S57T													.	SDC2-516	0			c.T169A						.						122.0	93.0	103.0					8																	97605816		2203	4300	6503	SO:0001583	missense	6383	exon2			TCTGGCTCGGGTA	BC030133	CCDS6272.1	8q22-q23	2011-08-11	2007-02-15		ENSG00000169439	ENSG00000169439		"""Proteoglycans / Cell Surface : Syndecans"", ""CD molecules"""	10659	protein-coding gene	gene with protein product	"""syndecan proteoglycan 2"""	142460	"""heparan sulfate proteoglycan 1, cell surface-associated"""	HSPG, HSPG1		8187643	Standard	NM_002998		Approved	fibroglycan, SYND2, CD362	uc003yhv.1	P34741	OTTHUMG00000164689	ENST00000302190.4:c.169T>A	8.37:g.97605816T>A	ENSP00000307046:p.Ser57Thr	80	0		59	1	NM_002998	0	0	0	0	0	B3KQA3|Q6PIS6|Q9H6V1	Missense_Mutation	SNP	ENST00000302190.4	37	CCDS6272.1	.	.	.	.	.	.	.	.	.	.	T	20.1	3.939239	0.73557	.	.	ENSG00000169439	ENST00000302190;ENST00000545117;ENST00000546193;ENST00000522911;ENST00000519914;ENST00000521590;ENST00000523877	T;T;T;T	0.48201	0.82;0.82;0.82;0.82	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	T	0.53965	0.1829	M	0.71581	2.175	0.52099	D	0.999948	P	0.47253	0.892	P	0.45753	0.492	T	0.60576	-0.7236	10	0.72032	D	0.01	-11.9994	13.8671	0.63594	0.0:0.0:0.0:1.0	.	57	P34741	SDC2_HUMAN	T	57;57;47;28;28;28;28	ENSP00000307046:S57T;ENSP00000427784:S28T;ENSP00000428256:S28T;ENSP00000429121:S28T	ENSP00000307046:S57T	S	+	1	0	SDC2	97674992	1.000000	0.71417	1.000000	0.80357	0.687000	0.40016	4.485000	0.60279	2.320000	0.78422	0.528000	0.53228	TCG	.		0.483	SDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379750.1	NM_002998	
COL14A1	7373	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	121357692	121357692	+	Missense_Mutation	SNP	C	C	T			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr8:121357692C>T	ENST00000297848.3	+	45	5237	c.4967C>T	c.(4966-4968)cCt>cTt	p.P1656L	COL14A1_ENST00000247781.3_Missense_Mutation_p.P1561L|COL14A1_ENST00000309791.4_Missense_Mutation_p.P1656L	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1											NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			CAAGGGCCTCCTGGGGAGCCT	0.622																																					p.P1656L		.											.	COL14A1-543	0			c.C4967T						.						59.0	58.0	58.0					8																	121357692		2203	4300	6503	SO:0001583	missense	7373	exon45			GGCCTCCTGGGGA		CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.4967C>T	8.37:g.121357692C>T	ENSP00000297848:p.Pro1656Leu	103	0		97	40	NM_021110	0	0	1	1	0		Missense_Mutation	SNP	ENST00000297848.3	37	CCDS34938.1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.621078	0.87460	.	.	ENSG00000187955	ENST00000309791;ENST00000297848;ENST00000247781;ENST00000440844	D;D;D;D	0.98684	-3.87;-3.87;-3.87;-5.07	5.54	4.67	0.58626	.	0.048120	0.85682	D	0.000000	D	0.99032	0.9669	M	0.86502	2.82	0.80722	D	1	D	0.56746	0.977	D	0.69307	0.963	D	0.99226	1.0880	10	0.49607	T	0.09	.	12.3879	0.55343	0.0:0.9213:0.0:0.0787	.	1656	Q05707	COEA1_HUMAN	L	1656;1656;1561;3	ENSP00000311809:P1656L;ENSP00000297848:P1656L;ENSP00000247781:P1561L;ENSP00000403640:P3L	ENSP00000247781:P1561L	P	+	2	0	COL14A1	121426873	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	6.600000	0.74132	1.364000	0.46038	0.555000	0.69702	CCT	.		0.622	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313657.2	NM_021110	
AGO2	27161	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	141557696	141557696	+	Missense_Mutation	SNP	A	A	G			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr8:141557696A>G	ENST00000220592.5	-	13	1731	c.1619T>C	c.(1618-1620)cTg>cCg	p.L540P	AGO2_ENST00000519980.1_Missense_Mutation_p.L540P	NM_012154.3	NP_036286.2	Q9UKV8	AGO2_HUMAN	argonaute RISC catalytic component 2	540	Interaction with guide RNA.|Piwi. {ECO:0000255|HAMAP-Rule:MF_03031}.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|innate immune response (GO:0045087)|mRNA cleavage involved in gene silencing by miRNA (GO:0035279)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|negative regulation of translational initiation (GO:0045947)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|post-embryonic development (GO:0009791)|pre-miRNA processing (GO:0031054)|regulation of transcription, DNA-templated (GO:0006355)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|mRNA cap binding complex (GO:0005845)|nucleus (GO:0005634)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|RISC complex (GO:0016442)	endoribonuclease activity (GO:0004521)|endoribonuclease activity, cleaving siRNA-paired mRNA (GO:0070551)|metal ion binding (GO:0046872)|miRNA binding (GO:0035198)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA 7-methylguanosine cap binding (GO:0000340)|siRNA binding (GO:0035197)|translation initiation factor activity (GO:0003743)										GGCCATCCCCAGCACCGTGTC	0.637																																					p.L540P		.											.	.	0			c.T1619C						.						182.0	140.0	154.0					8																	141557696		2203	4300	6503	SO:0001583	missense	27161	exon13			ATCCCCAGCACCG	AF121255	CCDS6380.1, CCDS55279.1	8q24.3	2013-02-15	2013-02-15	2013-02-15	ENSG00000123908	ENSG00000123908		"""Argonaute/PIWI family"""	3263	protein-coding gene	gene with protein product	"""argonaute 2"""	606229	"""eukaryotic translation initiation factor 2C, 2"""	EIF2C2		10534406, 12906857	Standard	NM_012154		Approved	hAGO2, Q10	uc003yvn.3	Q9UKV8	OTTHUMG00000164232	ENST00000220592.5:c.1619T>C	8.37:g.141557696A>G	ENSP00000220592:p.Leu540Pro	111	0		110	38	NM_012154	0	0	0	0	0	Q8TCZ5|Q8WV58|Q96ID1	Missense_Mutation	SNP	ENST00000220592.5	37	CCDS6380.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.212273	0.79240	.	.	ENSG00000123908	ENST00000220592;ENST00000519980	T;T	0.35236	1.32;1.32	5.49	5.49	0.81192	Stem cell self-renewal protein Piwi (3);Ribonuclease H-like (1);	0.000000	0.85682	D	0.000000	T	0.69958	0.3169	M	0.94021	3.485	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.995;0.997	T	0.79259	-0.1877	10	0.87932	D	0	-13.6154	15.5836	0.76465	1.0:0.0:0.0:0.0	.	540;540	Q9UKV8-2;Q9UKV8	.;AGO2_HUMAN	P	540	ENSP00000220592:L540P;ENSP00000430176:L540P	ENSP00000220592:L540P	L	-	2	0	EIF2C2	141626878	1.000000	0.71417	0.973000	0.42090	0.690000	0.40134	9.193000	0.94954	2.076000	0.62316	0.533000	0.62120	CTG	.		0.637	AGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377866.4		
TRPM6	140803	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	77435298	77435298	+	Missense_Mutation	SNP	C	C	G			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr9:77435298C>G	ENST00000360774.1	-	9	1293	c.1056G>C	c.(1054-1056)caG>caC	p.Q352H	TRPM6_ENST00000376864.4_Missense_Mutation_p.Q352H|TRPM6_ENST00000451710.3_Missense_Mutation_p.Q352H|TRPM6_ENST00000361255.3_Missense_Mutation_p.Q347H|TRPM6_ENST00000483186.1_5'UTR|TRPM6_ENST00000376871.3_Missense_Mutation_p.Q352H|TRPM6_ENST00000449912.2_Missense_Mutation_p.Q347H|TRPM6_ENST00000376872.3_Missense_Mutation_p.Q352H	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	352					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						TGAAAGTGTTCTGAATCATGC	0.438																																					p.Q352H		.											.	TRPM6-335	0			c.G1056C						.						148.0	135.0	140.0					9																	77435298		2203	4300	6503	SO:0001583	missense	140803	exon9			AGTGTTCTGAATC	AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.1056G>C	9.37:g.77435298C>G	ENSP00000354006:p.Gln352His	83	0		87	8	NM_017662	0	0	0	0	0	Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Missense_Mutation	SNP	ENST00000360774.1	37	CCDS6647.1	.	.	.	.	.	.	.	.	.	.	C	18.08	3.544685	0.65198	.	.	ENSG00000119121	ENST00000360774;ENST00000451710;ENST00000376872;ENST00000376871;ENST00000449912;ENST00000361255;ENST00000376864;ENST00000312449;ENST00000448641	T;T;T;T;T;T;T	0.66460	-0.21;-0.21;-0.21;-0.21;-0.21;-0.21;-0.21	5.37	4.36	0.52297	.	0.122952	0.64402	D	0.000020	T	0.79476	0.4452	M	0.78456	2.415	0.43617	D	0.995992	D;D;P;P	0.71674	0.998;0.998;0.951;0.896	D;D;P;P	0.67382	0.951;0.951;0.765;0.694	T	0.81861	-0.0738	10	0.87932	D	0	.	11.9834	0.53133	0.0:0.8466:0.0:0.1534	.	352;352;352;347	Q9BX84-6;Q9BX84-5;Q9BX84;Q9BX84-3	.;.;TRPM6_HUMAN;.	H	352;352;352;352;347;347;352;15;15	ENSP00000354006:Q352H;ENSP00000407341:Q352H;ENSP00000366068:Q352H;ENSP00000366067:Q352H;ENSP00000396672:Q347H;ENSP00000354962:Q347H;ENSP00000366060:Q352H	ENSP00000309693:Q15H	Q	-	3	2	TRPM6	76625118	0.998000	0.40836	1.000000	0.80357	0.997000	0.91878	0.737000	0.26144	2.500000	0.84329	0.655000	0.94253	CAG	.		0.438	TRPM6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052693.1	NM_017662	
GOLM1	51280	ucsc.edu	37	9	88692380	88692380	+	Missense_Mutation	SNP	A	A	G			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr9:88692380A>G	ENST00000388712.3	-	3	424	c.256T>C	c.(256-258)Tcc>Ccc	p.S86P	GOLM1_ENST00000388711.3_Missense_Mutation_p.S86P|GOLM1_ENST00000257504.6_5'UTR	NM_016548.3	NP_057632.2	Q8NBJ4	GOLM1_HUMAN	golgi membrane protein 1	86					nucleus organization (GO:0006997)|regulation of lipid metabolic process (GO:0019216)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)				breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|liver(1)|lung(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	17						TTGTGGCTGGACTGGATTTTG	0.562																																					p.S86P													.	GOLM1-22	0			c.T256C						.						116.0	103.0	107.0					9																	88692380		2203	4300	6503	SO:0001583	missense	51280	exon3			GGCTGGACTGGAT	AF236056	CCDS35054.1	9q21.33	2012-12-13	2007-07-30	2007-07-30	ENSG00000135052	ENSG00000135052			15451	protein-coding gene	gene with protein product		606804	"""golgi phosphoprotein 2"", ""chromosome 9 open reading frame 155"""	GOLPH2, C9orf155		10831838, 18953438, 22542941	Standard	NM_016548		Approved	GP73, FLJ23608, bA379P1.3	uc004aol.3	Q8NBJ4	OTTHUMG00000020130	ENST00000388712.3:c.256T>C	9.37:g.88692380A>G	ENSP00000373364:p.Ser86Pro	131	7		130	11	NM_016548	0	0	3	9	6	Q6IAF4|Q9NRB9	Missense_Mutation	SNP	ENST00000388712.3	37	CCDS35054.1	.	.	.	.	.	.	.	.	.	.	A	22.2	4.258712	0.80246	.	.	ENSG00000135052	ENST00000388712;ENST00000388711;ENST00000486130	T;T;D	0.90732	0.91;0.91;-2.72	5.08	5.08	0.68730	.	0.273079	0.41294	D	0.000904	D	0.94165	0.8128	M	0.68593	2.085	0.38371	D	0.944862	D	0.76494	0.999	D	0.71656	0.974	D	0.95318	0.8418	10	0.59425	D	0.04	-11.2339	14.9684	0.71213	1.0:0.0:0.0:0.0	.	86	Q8NBJ4	GOLM1_HUMAN	P	86	ENSP00000373364:S86P;ENSP00000373363:S86P;ENSP00000419076:S86P	ENSP00000373363:S86P	S	-	1	0	GOLM1	87882200	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.159000	0.64923	2.263000	0.75096	0.379000	0.24179	TCC	.		0.562	GOLM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052904.2	NM_177937	
TEX10	54881	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	103109141	103109141	+	Missense_Mutation	SNP	C	C	G			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr9:103109141C>G	ENST00000374902.4	-	3	904	c.728G>C	c.(727-729)aGt>aCt	p.S243T	TEX10_ENST00000537512.1_Missense_Mutation_p.S178T|TEX10_ENST00000535814.1_Missense_Mutation_p.S246T	NM_017746.3	NP_060216.2	Q9NXF1	TEX10_HUMAN	testis expressed 10	243						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|MLL1 complex (GO:0071339)				NS(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(14)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	38		Acute lymphoblastic leukemia(62;0.0527)		OV - Ovarian serous cystadenocarcinoma(323;0.157)		TCTCAACCTACTGGATCCATC	0.448																																					p.S246T		.											.	TEX10-92	0			c.G737C						.						122.0	118.0	119.0					9																	103109141		2203	4300	6503	SO:0001583	missense	54881	exon3			AACCTACTGGATC	AB060968	CCDS6748.1, CCDS55330.1	9q31.1	2012-05-02	2007-03-13		ENSG00000136891	ENSG00000136891			25988	protein-coding gene	gene with protein product			"""testis expressed gene 10"", ""testis expressed sequence 10"""			12477932	Standard	NM_017746		Approved	FLJ20287, bA208F1.2, Ipi1	uc004bas.3	Q9NXF1	OTTHUMG00000020366	ENST00000374902.4:c.728G>C	9.37:g.103109141C>G	ENSP00000364037:p.Ser243Thr	83	0		84	28	NM_001161584	0	0	1	1	0	B4DYV2|Q5T722|Q5T723|Q8NCN8|Q8TDY0	Missense_Mutation	SNP	ENST00000374902.4	37	CCDS6748.1	.	.	.	.	.	.	.	.	.	.	C	9.748	1.166577	0.21621	.	.	ENSG00000136891	ENST00000535814;ENST00000374902;ENST00000444730;ENST00000537512	.	.	.	5.26	4.31	0.51392	Armadillo-type fold (1);	0.430875	0.29932	N	0.010833	T	0.29288	0.0729	N	0.12182	0.205	0.38372	D	0.944907	B;B;B;B;B	0.29766	0.002;0.007;0.11;0.256;0.002	B;B;B;B;B	0.21360	0.003;0.004;0.011;0.034;0.003	T	0.20638	-1.0269	9	0.29301	T	0.29	-9.3945	9.3406	0.38079	0.0:0.7187:0.1367:0.1446	.	178;246;111;111;243	B7Z9D5;B4DYV2;E7ERG2;B4DQR0;Q9NXF1	.;.;.;.;TEX10_HUMAN	T	246;243;111;178	.	ENSP00000364037:S243T	S	-	2	0	TEX10	102148962	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.669000	0.37492	2.450000	0.82876	0.655000	0.94253	AGT	.		0.448	TEX10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053416.1	NM_017746	
EGFL7	51162	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	139564703	139564703	+	Missense_Mutation	SNP	G	G	C			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr9:139564703G>C	ENST00000371699.1	+	7	1403	c.492G>C	c.(490-492)tgG>tgC	p.W164C	EGFL7_ENST00000406555.3_Missense_Mutation_p.W164C|EGFL7_ENST00000308874.7_Missense_Mutation_p.W164C|EGFL7_ENST00000371698.3_Missense_Mutation_p.W164C|MIR126_ENST00000362291.1_RNA|EGFL7_ENST00000492002.1_3'UTR			Q9UHF1	EGFL7_HUMAN	EGF-like-domain, multiple 7	164	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				angiogenesis (GO:0001525)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|negative regulation of cell migration (GO:0030336)|negative regulation of Notch signaling pathway (GO:0045746)|positive regulation of endothelial cell proliferation (GO:0001938)|vasculogenesis (GO:0001570)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium ion binding (GO:0005509)			kidney(2)|ovary(1)|prostate(2)|urinary_tract(1)	6	all_cancers(76;0.109)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;9.87e-06)|Epithelial(140;0.000123)		GCCAGTGTTGGGAGGGGCACA	0.652																																					p.W164C		.											.	EGFL7-523	0			c.G492C						.						28.0	30.0	29.0					9																	139564703		2198	4297	6495	SO:0001583	missense	51162	exon8			GTGTTGGGAGGGG	AF186111	CCDS7002.1	9q34.3	2008-02-05			ENSG00000172889	ENSG00000172889			20594	protein-coding gene	gene with protein product		608582					Standard	NM_016215		Approved	ZNEU1	uc004cih.3	Q9UHF1	OTTHUMG00000020938	ENST00000371699.1:c.492G>C	9.37:g.139564703G>C	ENSP00000360764:p.Trp164Cys	129	0		157	47	NM_016215	0	0	8	8	0	B3KRP0|M9VTX9|Q5M7Y5|Q5VUD5|Q96EG0	Missense_Mutation	SNP	ENST00000371699.1	37	CCDS7002.1	.	.	.	.	.	.	.	.	.	.	G	15.33	2.802260	0.50315	.	.	ENSG00000172889	ENST00000371699;ENST00000308874;ENST00000406555;ENST00000371698	T;T;T;T	0.36157	1.27;1.27;1.27;1.27	5.26	2.31	0.28768	EGF-like calcium-binding (2);	1.149640	0.06146	N	0.673294	T	0.37785	0.1016	L	0.32530	0.975	0.45822	D	0.998694	D	0.56968	0.978	P	0.50754	0.649	T	0.04454	-1.0950	10	0.46703	T	0.11	-0.7885	7.8608	0.29509	0.1492:0.1325:0.7182:0.0	.	164	Q9UHF1	EGFL7_HUMAN	C	164	ENSP00000360764:W164C;ENSP00000307843:W164C;ENSP00000385639:W164C;ENSP00000360763:W164C	ENSP00000307843:W164C	W	+	3	0	EGFL7	138684524	0.247000	0.23920	0.257000	0.24404	0.612000	0.37316	0.439000	0.21575	0.188000	0.20168	0.561000	0.74099	TGG	.		0.652	EGFL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055094.1	NM_016215	
TRAF2	7186	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	139794876	139794876	+	Silent	SNP	C	C	G			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr9:139794876C>G	ENST00000247668.2	+	4	322	c.270C>G	c.(268-270)gcC>gcG	p.A90A	TRAF2_ENST00000359662.3_Silent_p.A90A|TRAF2_ENST00000536468.1_Silent_p.A90A	NM_021138.3	NP_066961.2	Q12933	TRAF2_HUMAN	TNF receptor-associated factor 2	90					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular protein complex assembly (GO:0043623)|cellular response to nitric oxide (GO:0071732)|innate immune response (GO:0045087)|negative regulation of glial cell apoptotic process (GO:0034351)|negative regulation of neuron death (GO:1901215)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell cytokine production (GO:0002726)|programmed necrotic cell death (GO:0097300)|protein autoubiquitination (GO:0051865)|protein catabolic process (GO:0030163)|protein complex assembly (GO:0006461)|protein heterooligomerization (GO:0051291)|protein homotrimerization (GO:0070207)|protein K63-linked ubiquitination (GO:0070534)|regulation of apoptotic process (GO:0042981)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of immunoglobulin secretion (GO:0051023)|signal transduction (GO:0007165)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	CD40 receptor complex (GO:0035631)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|membrane raft (GO:0045121)|ubiquitin ligase complex (GO:0000151)	CD40 receptor binding (GO:0005174)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|ligase activity (GO:0016874)|protein phosphatase binding (GO:0019903)|signal transducer activity (GO:0004871)|sphingolipid binding (GO:0046625)|thioesterase binding (GO:0031996)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.229)	OV - Ovarian serous cystadenocarcinoma(145;4.48e-06)|Epithelial(140;9.55e-06)		CTCCCCAGGCCTTCCCAGATA	0.577																																					p.A90A		.											.	TRAF2-660	0			c.C270G						.						43.0	38.0	39.0					9																	139794876		2203	4300	6503	SO:0001819	synonymous_variant	7186	exon4			CCAGGCCTTCCCA	U12597	CCDS7013.1	9q34	2013-01-09			ENSG00000127191	ENSG00000127191		"""RING-type (C3HC4) zinc fingers"""	12032	protein-coding gene	gene with protein product		601895				7639698	Standard	NM_021138		Approved	TRAP3	uc004cjv.3	Q12933	OTTHUMG00000020952	ENST00000247668.2:c.270C>G	9.37:g.139794876C>G		51	0		50	14	NM_021138	0	0	0	0	0	A8K107|B4DPJ7|Q7Z337|Q96NT2	Silent	SNP	ENST00000247668.2	37	CCDS7013.1																																																																																			.		0.577	TRAF2-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055166.1	NM_021138	
CCDC18	343099	broad.mit.edu;bcgsc.ca	37	1	93705010	93705043	+	Splice_Site	DEL	TAGAAAAGAAAACAAATGCTGGTAAGCAAGTGGT	TAGAAAAGAAAACAAATGCTGGTAAGCAAGTGGT	-	rs550574161		TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	TAGAAAAGAAAACAAATGCTGGTAAGCAAGTGGT	TAGAAAAGAAAACAAATGCTGGTAAGCAAGTGGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr1:93705010_93705043delTAGAAAAGAAAACAAATGCTGGTAAGCAAGTGGT	ENST00000343253.7	+	20	3246_3266	c.2744_2764delTAGAAAAGAAAACAAATGCTGGTAAGCAAGTGGT	c.(2743-2766)ctagaaaagaaaacaaatgctggt>cgt	p.LEKKTNAG915fs	CCDC18_ENST00000421014.2_3'UTR|CCDC18_ENST00000338949.4_Splice_Site_p.LEKKTNAG671fs|CCDC18_ENST00000401026.3_Splice_Site_p.LEKKTNAG916fs|CCDC18_ENST00000334652.5_Splice_Site_p.LEKKTNAG211fs|CCDC18_ENST00000557479.1_Splice_Site_p.LEKKTNAG1034fs			Q5T9S5	CCD18_HUMAN	coiled-coil domain containing 18	915										breast(5)|endometrium(3)|kidney(1)|large_intestine(6)|lung(19)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	42		all_lung(203;0.00196)|Lung NSC(277;0.00903)|Melanoma(281;0.099)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00166)|GBM - Glioblastoma multiforme(16;0.00551)|Epithelial(280;0.0967)		AAGACAGAGCTAGAAAAGAAAACAAATGCTGGTAAGCAAGTGGTTAGATGAGTA	0.363																																					p.916_923del													.	CCDC18-138	0			c.2747_2767del						.																																			SO:0001630	splice_region_variant	343099	exon20			CAGAGCTAGAAAA			1p22.1	2008-02-05			ENSG00000122483	ENSG00000122483			30370	protein-coding gene	gene with protein product						12601173	Standard	XM_006710609		Approved	NY-SAR-41	uc021opx.1	Q5T9S5	OTTHUMG00000010598	ENST00000343253.7:c.2764+1TAGAAAAGAAAACAAATGCTGGTAAGCAAGTGGT>-	1.37:g.93705010_93705043delTAGAAAAGAAAACAAATGCTGGTAAGCAAGTGGT		185	0		144	8	NM_206886	0	0	0	0	0	Q6ZU17	In_Frame_Del	DEL	ENST00000343253.7	37																																																																																				.		0.363	CCDC18-008	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000382327.1	NM_206886	Frame_Shift_Del
YOD1	55432	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	207222409	207222409	+	Frame_Shift_Del	DEL	C	C	-			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr1:207222409delC	ENST00000315927.4	-	2	1049	c.1003delG	c.(1003-1005)gaafs	p.E335fs	YOD1_ENST00000391927.1_Frame_Shift_Del_p.E291fs|YOD1_ENST00000367084.1_Frame_Shift_Del_p.E291fs|PFKFB2_ENST00000411990.2_5'Flank	NM_018566.3	NP_061036.3	Q5VVQ6	OTU1_HUMAN	YOD1 deubiquitinase	335					cellular amino acid metabolic process (GO:0006520)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|protein K11-linked deubiquitination (GO:0035871)|protein K27-linked deubiquitination (GO:1990167)|protein K29-linked deubiquitination (GO:0035523)|protein K33-linked deubiquitination (GO:1990168)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)		Lys48-specific deubiquitinase activity (GO:1990380)|metal ion binding (GO:0046872)|ubiquitin-specific protease activity (GO:0004843)			cervix(1)|endometrium(3)|large_intestine(1)|lung(3)|ovary(3)	11	Prostate(682;0.19)					TTGGCATGTTCCCTTGCTTCT	0.478																																					p.E335fs		.											.	YOD1-522	0			c.1003delG						.						271.0	251.0	257.0					1																	207222409		2203	4300	6503	SO:0001589	frameshift_variant	55432	exon2			.		CCDS31002.1, CCDS60402.1	1q32.2	2013-06-04	2013-06-04		ENSG00000180667	ENSG00000180667		"""OTU domain containing"""	25035	protein-coding gene	gene with protein product		612023	"""YOD1 OTU deubiquinating enzyme 1 homolog ( yeast)"", ""YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae)"""				Standard	NM_001276320		Approved	DKFZp451J1719, OTUD2, DUBA8	uc001hfe.1	Q5VVQ6	OTTHUMG00000036032	ENST00000315927.4:c.1003delG	1.37:g.207222409delC	ENSP00000326813:p.Glu335fs	141	0		131	40	NM_018566	0	0	0	0	0	B2RNX3|Q5VVQ5|Q6ZRS6|Q86T63|Q9P1L8	Frame_Shift_Del	DEL	ENST00000315927.4	37	CCDS31002.1																																																																																			.		0.478	YOD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087837.1	NM_018566	
TLR5	7100	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	223285316	223285316	+	Frame_Shift_Del	DEL	C	C	-			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr1:223285316delC	ENST00000540964.1	-	4	1519	c.1058delG	c.(1057-1059)agtfs	p.S354fs	TLR5_ENST00000342210.6_Frame_Shift_Del_p.S354fs			O60602	TLR5_HUMAN	toll-like receptor 5	354					cellular response to lipopolysaccharide (GO:0071222)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|male gonad development (GO:0008584)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|regulation of cytokine secretion (GO:0050707)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor signaling pathway (GO:0002224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-1 receptor binding (GO:0005149)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32				GBM - Glioblastoma multiforme(131;0.0851)		GAAATTCGAACTGTAAAGTTC	0.353																																					p.S353fs		.											.	TLR5-525	0			c.1058delG						.						93.0	93.0	93.0					1																	223285316		2203	4300	6503	SO:0001589	frameshift_variant	7100	exon6			.		CCDS31033.1	1q32.3-q42	2014-01-29			ENSG00000187554	ENSG00000187554			11851	protein-coding gene	gene with protein product	"""Toll/interleukin-1 receptor-like protein 3"""	603031	"""systemic lupus erythematosus susceptibility 1"""	SLEB1		9435236, 16027372	Standard	NM_003268		Approved	TIL3, FLJ10052, MGC126430, MGC126431	uc001hnw.2	O60602	OTTHUMG00000037937	ENST00000540964.1:c.1058delG	1.37:g.223285316delC	ENSP00000440643:p.Ser354fs	46	0		57	25	NM_003268	0	0	0	0	0	B1AZ05|B3Y633|B9VJ63|D1CS80|D3DTB8|O15456|Q32MI2|Q32MI3	Frame_Shift_Del	DEL	ENST00000540964.1	37	CCDS31033.1																																																																																			.		0.353	TLR5-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_003268	
ITPKB	3707	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	226924770	226924784	+	In_Frame_Del	DEL	CTTCCTCTTGGCCTC	CTTCCTCTTGGCCTC	-	rs140396711|rs144653273|rs531138740|rs563769960	byFrequency	TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	CTTCCTCTTGGCCTC	CTTCCTCTTGGCCTC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr1:226924770_226924784delCTTCCTCTTGGCCTC	ENST00000272117.3	-	1	375_389	c.376_390delGAGGCCAAGAGGAAG	c.(376-390)gaggccaagaggaagdel	p.EAKRK126del	ITPKB_ENST00000366784.1_In_Frame_Del_p.EAKRK126del|ITPKB_ENST00000429204.1_In_Frame_Del_p.EAKRK126del			P27987	IP3KB_HUMAN	inositol-trisphosphate 3-kinase B	126					cell surface receptor signaling pathway (GO:0007166)|inositol phosphate metabolic process (GO:0043647)|MAPK cascade (GO:0000165)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of Ras protein signal transduction (GO:0046579)|positive thymic T cell selection (GO:0045059)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)	p.A127A(1)		central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(13)|ovary(4)|prostate(1)|skin(1)	30		Prostate(94;0.0773)				AGATCCGCAGCTTCCTCTTGGCCTCCTCCGGCCCT	0.656																																					p.126_130del	Colon(84;110 1851 5306 33547)	.											.	ITPKB-230	1	Substitution - coding silent(1)	large_intestine(1)	c.376_390del						.																																			SO:0001651	inframe_deletion	3707	exon2			.	AJ242780	CCDS1555.1	1q42.12	2011-04-28	2011-04-28		ENSG00000143772	ENSG00000143772	2.7.1.127		6179	protein-coding gene	gene with protein product		147522	"""inositol 1,4,5-trisphosphate 3-kinase B"""			1654894, 1330886	Standard	NM_002221		Approved	IP3KB, IP3-3KB	uc010pvo.2	P27987	OTTHUMG00000037582	ENST00000272117.3:c.376_390delGAGGCCAAGAGGAAG	1.37:g.226924770_226924784delCTTCCTCTTGGCCTC	ENSP00000272117:p.Glu126_Lys130del	54	0		76	17	NM_002221	0	0	0	0	0	Q5VWL9|Q5VWM0|Q96BZ2|Q96JS1|Q9UH47	In_Frame_Del	DEL	ENST00000272117.3	37	CCDS1555.1																																																																																			.		0.656	ITPKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091632.1	NM_002221	
GAREM	64762	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	18	29867165	29867165	+	Frame_Shift_Del	DEL	A	A	-			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr18:29867165delA	ENST00000269209.6	-	4	1398	c.1395delT	c.(1393-1395)catfs	p.H465fs	GAREM_ENST00000578619.1_5'Flank|GAREM_ENST00000399218.4_Frame_Shift_Del_p.H465fs|RP11-344B2.2_ENST00000579580.1_RNA			Q9H706	GAREM_HUMAN	GRB2 associated, regulator of MAPK1	465					cellular response to epidermal growth factor stimulus (GO:0071364)|epidermal growth factor receptor signaling pathway (GO:0007173)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)	plasma membrane (GO:0005886)	proline-rich region binding (GO:0070064)										TGAGAGGCTGATGGCTGGGCT	0.527																																					p.H465fs		.											.	.	0			c.1395delT						.						104.0	102.0	103.0					18																	29867165		2203	4300	6503	SO:0001589	frameshift_variant	64762	exon4			.	AK025263	CCDS11905.1, CCDS56057.1	18q12.1	2012-11-30	2012-11-30	2012-11-30	ENSG00000141441	ENSG00000141441			26136	protein-coding gene	gene with protein product	"""Grb2-associated and regulator of Erk/MAPK"""		"""chromosome 18 open reading frame 11"", ""family with sequence similarity 59, member A"""	C18orf11, FAM59A		19509291	Standard	NM_001242409		Approved	FLJ21610	uc002kxl.3	Q9H706	OTTHUMG00000132273	ENST00000269209.6:c.1395delT	18.37:g.29867165delA	ENSP00000269209:p.His465fs	93	0		66	27	NM_022751	0	0	0	0	0	Q0VAG3|Q0VAG4|Q8ND03|Q9BSF5	Frame_Shift_Del	DEL	ENST00000269209.6	37	CCDS56057.1																																																																																			.		0.527	GAREM-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255365.1	NM_022751	
CUL3	8452	hgsc.bcm.edu;bcgsc.ca	37	2	225449678	225449678	+	Frame_Shift_Del	DEL	G	G	-			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr2:225449678delG	ENST00000264414.4	-	1	387	c.49delC	c.(49-51)cggfs	p.R17fs	CUL3_ENST00000344951.4_Frame_Shift_Del_p.R17fs	NM_003590.4	NP_003581.1	Q13618	CUL3_HUMAN	cullin 3	17					cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|COPII vesicle coating (GO:0048208)|cyclin catabolic process (GO:0008054)|embryonic cleavage (GO:0040016)|ER to Golgi vesicle-mediated transport (GO:0006888)|G1/S transition of mitotic cell cycle (GO:0000082)|gastrulation (GO:0007369)|integrin-mediated signaling pathway (GO:0007229)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic metaphase plate congression (GO:0007080)|negative regulation of Rho protein signal transduction (GO:0035024)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|stem cell division (GO:0017145)|stress fiber assembly (GO:0043149)|trophectodermal cellular morphogenesis (GO:0001831)|Wnt signaling pathway (GO:0016055)	Cul3-RING ubiquitin ligase complex (GO:0031463)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|nucleus (GO:0005634)|polar microtubule (GO:0005827)	POZ domain binding (GO:0031208)			endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(2)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	46		all_lung(227;0.00877)|Lung NSC(271;0.011)|Renal(207;0.0112)|all_hematologic(139;0.138)		Epithelial(121;1.58e-11)|all cancers(144;1.43e-08)|Lung(261;0.00863)|LUSC - Lung squamous cell carcinoma(224;0.00902)		GCCCGGATCCGCATCTTGGTG	0.736																																					p.R17fs		.											.	CUL3-229	0			c.49delC						.						37.0	35.0	35.0					2																	225449678		2200	4300	6500	SO:0001589	frameshift_variant	8452	exon1			.	U58089	CCDS2462.1, CCDS58751.1	2q36.2	2011-05-24			ENSG00000036257	ENSG00000036257			2553	protein-coding gene	gene with protein product		603136				8681378, 17192413	Standard	NM_003590		Approved		uc002vny.3	Q13618	OTTHUMG00000133167	ENST00000264414.4:c.49delC	2.37:g.225449678delG	ENSP00000264414:p.Arg17fs	76	0		126	89	NM_003590	0	0	0	0	0	A8K536|B8ZZC3|O75415|Q569L3|Q9UBI8|Q9UET7	Frame_Shift_Del	DEL	ENST00000264414.4	37	CCDS2462.1																																																																																			.		0.736	CUL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256871.2		
CUL3	8452	hgsc.bcm.edu	37	2	225449678	225449679	+	Frame_Shift_Del	DEL	GC	GC	-			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	GC	GC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr2:225449678_225449679delGC	ENST00000264414.4	-	1	386_387	c.48_49delGC	c.(46-51)atgcggfs	p.R17fs	CUL3_ENST00000344951.4_Frame_Shift_Del_p.R17fs	NM_003590.4	NP_003581.1	Q13618	CUL3_HUMAN	cullin 3	17					cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|COPII vesicle coating (GO:0048208)|cyclin catabolic process (GO:0008054)|embryonic cleavage (GO:0040016)|ER to Golgi vesicle-mediated transport (GO:0006888)|G1/S transition of mitotic cell cycle (GO:0000082)|gastrulation (GO:0007369)|integrin-mediated signaling pathway (GO:0007229)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic metaphase plate congression (GO:0007080)|negative regulation of Rho protein signal transduction (GO:0035024)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|stem cell division (GO:0017145)|stress fiber assembly (GO:0043149)|trophectodermal cellular morphogenesis (GO:0001831)|Wnt signaling pathway (GO:0016055)	Cul3-RING ubiquitin ligase complex (GO:0031463)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|nucleus (GO:0005634)|polar microtubule (GO:0005827)	POZ domain binding (GO:0031208)			endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(2)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	46		all_lung(227;0.00877)|Lung NSC(271;0.011)|Renal(207;0.0112)|all_hematologic(139;0.138)		Epithelial(121;1.58e-11)|all cancers(144;1.43e-08)|Lung(261;0.00863)|LUSC - Lung squamous cell carcinoma(224;0.00902)		GCCCGGATCCGCATCTTGGTGT	0.733																																					p.16_17del		.											.	CUL3-229	0			c.48_49del						.																																			SO:0001589	frameshift_variant	8452	exon1			.	U58089	CCDS2462.1, CCDS58751.1	2q36.2	2011-05-24			ENSG00000036257	ENSG00000036257			2553	protein-coding gene	gene with protein product		603136				8681378, 17192413	Standard	NM_003590		Approved		uc002vny.3	Q13618	OTTHUMG00000133167	ENST00000264414.4:c.48_49delGC	2.37:g.225449678_225449679delGC	ENSP00000264414:p.Arg17fs	79	0		129	50	NM_003590	0	0	0	0	0	A8K536|B8ZZC3|O75415|Q569L3|Q9UBI8|Q9UET7	Frame_Shift_Del	DEL	ENST00000264414.4	37	CCDS2462.1																																																																																			.		0.733	CUL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256871.2		
MICAL3	57553	hgsc.bcm.edu;broad.mit.edu	37	22	18300505	18300505	+	Frame_Shift_Del	DEL	T	T	-			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr22:18300505delT	ENST00000441493.2	-	26	5274	c.4922delA	c.(4921-4923)cagfs	p.Q1641fs	MICAL3_ENST00000580469.1_5'Flank	NM_015241.2	NP_056056.2	Q7RTP6	MICA3_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 3	1641					actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|exocytosis (GO:0006887)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4		all_epithelial(15;0.198)		Lung(27;0.0427)		CTCCTTGCCCTGGGAGGGTGC	0.711																																					p.Q1641fs		.											.	MICAL3-68	0			c.4922delA						.						13.0	18.0	16.0					22																	18300505		1932	4104	6036	SO:0001589	frameshift_variant	57553	exon26			.	AB037785	CCDS46659.1, CCDS46660.1, CCDS46661.1	22q11.21	2013-03-26	2013-03-26		ENSG00000243156	ENSG00000243156			24694	protein-coding gene	gene with protein product		608882				12110185	Standard	NM_015241		Approved	KIAA0819	uc002zng.4	Q7RTP6	OTTHUMG00000150067	ENST00000441493.2:c.4922delA	22.37:g.18300505delT	ENSP00000416015:p.Gln1641fs	4	0		29	12	NM_015241	0	0	0	0	0	B2RXJ5|E9PEF0|O94909|Q5U4P4|Q6ICK4|Q96DF2|Q9P2I3	Frame_Shift_Del	DEL	ENST00000441493.2	37	CCDS46659.1																																																																																			.		0.711	MICAL3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447351.1		
RFX6	222546	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	117203548	117203548	+	Frame_Shift_Del	DEL	C	C	-			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr6:117203548delC	ENST00000332958.2	+	4	539	c.523delC	c.(523-525)cccfs	p.P175fs		NM_173560.3	NP_775831.2	Q8HWS3	RFX6_HUMAN	regulatory factor X, 6	175					endocrine pancreas development (GO:0031018)|glucose homeostasis (GO:0042593)|pancreatic A cell differentiation (GO:0003310)|pancreatic D cell differentiation (GO:0003311)|pancreatic epsilon cell differentiation (GO:0090104)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of insulin secretion (GO:0050796)|transcription, DNA-templated (GO:0006351)|type B pancreatic cell differentiation (GO:0003309)	nucleus (GO:0005634)	transcription regulatory region DNA binding (GO:0044212)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(29)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	59						CCAGAAGTTTCCCCTCCTAAC	0.413																																					p.P175fs		.											.	RFX6-93	0			c.523delC						.						105.0	92.0	96.0					6																	117203548		2203	4300	6503	SO:0001589	frameshift_variant	222546	exon4			.	BC039248	CCDS5113.1	6q22.31	2008-08-04	2008-08-04	2008-08-04	ENSG00000185002	ENSG00000185002			21478	protein-coding gene	gene with protein product		612659	"""regulatory factor X domain containing 1"""	RFXDC1			Standard	NM_173560		Approved	MGC33442, dJ955L16.1	uc003pxm.3	Q8HWS3	OTTHUMG00000015449	ENST00000332958.2:c.523delC	6.37:g.117203548delC	ENSP00000332208:p.Pro175fs	54	0		77	35	NM_173560	0	0	0	0	0	Q5T6B3	Frame_Shift_Del	DEL	ENST00000332958.2	37	CCDS5113.1																																																																																			.		0.413	RFX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041970.2	NM_173560	
CEP83	51134	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	94763803	94763804	+	Frame_Shift_Ins	INS	-	-	T			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr12:94763803_94763804insT	ENST00000397809.5	-	9	1491_1492	c.942_943insA	c.(940-945)gaacttfs	p.L315fs	CCDC41_ENST00000339839.5_Frame_Shift_Ins_p.L315fs|CCDC41_ENST00000549352.1_5'UTR|CCDC41_ENST00000397807.2_Frame_Shift_Ins_p.L282fs|CCDC41_ENST00000547575.1_Frame_Shift_Ins_p.L315fs	NM_016122.2	NP_057206.2	Q9Y592	CEP83_HUMAN		307					cilium assembly (GO:0042384)|protein localization to centrosome (GO:0071539)|vesicle docking (GO:0048278)	centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|Golgi apparatus (GO:0005794)				breast(1)|central_nervous_system(3)|kidney(3)|large_intestine(8)|lung(8)|prostate(2)|skin(2)	27						GAATGTTTAAGTTCTTTTACCT	0.332																																					p.L315fs		.											.	CCDC41-90	0			c.943_944insA						.																																			SO:0001589	frameshift_variant	51134	exon8			.																												ENST00000397809.5:c.943dupA	12.37:g.94763805_94763805dupT	ENSP00000380911:p.Leu315fs	62	0		58	21	NM_001042399	0	0	0	0	0	A4FVB1|Q08AP1	Frame_Shift_Ins	INS	ENST00000397809.5	37	CCDS41820.1																																																																																			.		0.332	CCDC41-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408147.3		
NEFH	4744	hgsc.bcm.edu	37	22	29885589	29885590	+	In_Frame_Ins	INS	-	-	CCCCTGAGAAGGCCAAGT	rs200984527|rs267607533		TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr22:29885589_29885590insCCCCTGAGAAGGCCAAGT	ENST00000310624.6	+	4	1993_1994	c.1960_1961insCCCCTGAGAAGGCCAAGT	c.(1960-1962)tcc>tCCCCTGAGAAGGCCAAGTcc	p.654_654S>SPEKAKS		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	660	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						GAAGGCCAAGTCCCCAGAGAAG	0.559																																					p.S654delinsSPEKAKS		.											.	NEFH-90	0			c.1960_1961insCCCCTGAGAAGGCCAAGT						.																																			SO:0001652	inframe_insertion	4744	exon4			.		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1943_1960dupCCCCTGAGAAGGCCAAGT	22.37:g.29885589_29885590insCCCCTGAGAAGGCCAAGT	ENSP00000311997:p.ProGluLysAlaLysSer654dup	158	0		201	77	NM_021076	0	0	0	0	0	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	In_Frame_Ins	INS	ENST00000310624.6	37	CCDS13858.1																																																																																			.		0.559	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
MYH15	22989	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	108174686	108174687	+	Frame_Shift_Ins	INS	-	-	T			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr3:108174686_108174687insT	ENST00000273353.3	-	21	2274_2275	c.2218_2219insA	c.(2218-2220)aggfs	p.R740fs	MYH15_ENST00000495753.2_5'UTR	NM_014981.1	NP_055796.1	Q9Y2K3	MYH15_HUMAN	myosin, heavy chain 15	740	Myosin motor.					cytoplasm (GO:0005737)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(3)|central_nervous_system(2)|cervix(4)|endometrium(10)|kidney(4)|large_intestine(14)|lung(47)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	105						TGGAAAGGTCCTTGGATTCAGA	0.361																																					p.R740fs		.											.	MYH15-73	0			c.2219_2220insA						.																																			SO:0001589	frameshift_variant	22989	exon21			.	AB023217	CCDS43127.1	3q13	2011-09-27	2006-09-29		ENSG00000144821	ENSG00000144821		"""Myosins / Myosin superfamily : Class II"""	31073	protein-coding gene	gene with protein product		609929	"""myosin, heavy polypeptide 15"""			15014174, 15042088	Standard	NM_014981		Approved	KIAA1000	uc003dxa.1	Q9Y2K3	OTTHUMG00000159226	ENST00000273353.3:c.2219dupA	3.37:g.108174688_108174688dupT	ENSP00000273353:p.Arg740fs	38	0		55	15	NM_014981	0	0	0	0	0		Frame_Shift_Ins	INS	ENST00000273353.3	37	CCDS43127.1																																																																																			.		0.361	MYH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353935.1	XM_036988	
MYO5A	4644	hgsc.bcm.edu;broad.mit.edu	37	15	52680095	52680096	+	Missense_Mutation	DNP	AC	AC	CA			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	AC	AC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr15:52680095_52680096AC>CA	ENST00000399231.3	-	14	1925_1926	c.1682_1683GT>TG	c.(1681-1683)tGT>tTG	p.C561L	MYO5A_ENST00000358212.6_Missense_Mutation_p.C561L|MYO5A_ENST00000399233.2_Missense_Mutation_p.C561L|MYO5A_ENST00000356338.6_Missense_Mutation_p.C561L|MYO5A_ENST00000553916.1_Missense_Mutation_p.C561L	NM_000259.3	NP_000250	Q9Y4I1	MYO5A_HUMAN	myosin VA (heavy chain 12, myoxin)	561	Myosin motor.				actin filament-based movement (GO:0030048)|anagen (GO:0042640)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|endoplasmic reticulum localization (GO:0051643)|exocytosis (GO:0006887)|insulin secretion (GO:0030073)|locomotion involved in locomotory behavior (GO:0031987)|long-chain fatty acid biosynthetic process (GO:0042759)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|melanosome transport (GO:0032402)|membrane organization (GO:0061024)|myelination (GO:0042552)|odontogenesis (GO:0042476)|post-Golgi vesicle-mediated transport (GO:0006892)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031585)|secretory granule localization (GO:0032252)|synapse organization (GO:0050808)|synaptic transmission (GO:0007268)|transport (GO:0006810)|vesicle transport along actin filament (GO:0030050)|vesicle-mediated transport (GO:0016192)|visual perception (GO:0007601)	actomyosin (GO:0042641)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium tip (GO:0032433)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|insulin-responsive compartment (GO:0032593)|intermediate filament (GO:0005882)|melanosome (GO:0042470)|membrane (GO:0016020)|microtubule plus-end (GO:0035371)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|microfilament motor activity (GO:0000146)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(7)|large_intestine(12)|lung(19)|ovary(3)|skin(3)|stomach(1)	57				all cancers(107;0.0085)|Colorectal(133;0.077)|READ - Rectum adenocarcinoma(133;0.196)		GAAATCCTTCACACTGGTATTC	0.307																																					p.C561L		.											.	MYO5A-93	0			c.G1682T						.																																			SO:0001583	missense	4644	exon14			CCTTCACACTGGT		CCDS42037.1, CCDS45262.1	15q21	2014-09-17	2006-09-29		ENSG00000197535	ENSG00000197535		"""Myosins / Myosin superfamily : Class V"""	7602	protein-coding gene	gene with protein product	"""myosin, heavy polypeptide kinase"", ""myosin heavy chain 12"", ""myoxin"", ""myosin V"""	160777	"""myosin VA (heavy polypeptide 12, myoxin)"""	MYH12		8188282, 8022818	Standard	NM_000259		Approved	MYO5, GS1, MYR12	uc002aby.2	Q9Y4I1	OTTHUMG00000137383	ENST00000399231.3:c.1682_1683delinsCA	15.37:g.52680095_52680096delinsCA	ENSP00000382177:p.Cys561Leu	13.0	0.0		13.0	5.0	NM_000259	0	0	0	0	0	A8MZC5|O60653|Q07902|Q16249|Q9UE30|Q9UE31	Missense_Mutation	DNP	ENST00000399231.3	37	CCDS42037.1																																																																																			.		0.307	MYO5A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268102.1	NM_000259	
